sort by

205 publications mentioning hsa-mir-100 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-100. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 507
We found that genes upregulated in the paclitaxel-sensitive signature were significantly enriched among genes that positively correlated with miR-100 expression (Figure 6A), while genes downregulated in the paclitaxel sensitive signature were enriched among genes whose expression was inversely correlated with miR-100 expression (Figure 6B). [score:13]
Third, of the published gene expression signature that predicts a positive response of patients to paclitaxel, the upregulated genes positively correlated, and the downregulated genes negatively correlated, with miR-100 expression in human breast cancer (Figure 6). [score:11]
In summary, we found that miR-100 expression was significantly downregulated in breast cancer, and the downregulation was more extensive in luminal A breast cancers and was associated with worse patient survival. [score:9]
C. Overexpression of miR-100 inhibits, while inhibition of miR-100 promotes, mTOR expression in MCF-7 and MDA-MB-231 breast cancer cell lines respectively, as detected by. [score:9]
In this study, we provided another line of evidence for a tumor suppressor role of miR-100 in breast cancer, as we found that miR-100 was frequently downregulated in human breast cancer, and the extent of downregulation was greater in the luminal A subtype of tumors than in other subtypes (Figure 1). [score:9]
B. Genes downregulated in paclitaxel-responsive tumors were significantly enriched among genes whose expression levels negatively correlated with miR-100 expression in breast cancer, also determined by GSEA. [score:8]
Second, in the MCF-7 luminal A breast cancer cell line, which expressed a lower level of miR-100 (Figure 2A), ectopic expression of miR-100 sensitized cells not only to paclitaxel -induced cell cycle arrest and apoptosis in vitro (Figures 2, 4) but also to tumor suppression in nude mice (Figure 3), providing direct functional evidence. [score:8]
Previous studies suggest that miR-100 plays a tumor suppressor role in breast cancer, as it suppresses the migration, invasion and tumorigenesis of breast cancer cells, inhibits the self-renewal of BrCSCs, and promotes the differentiation of BrCSCs[11, 22, 25, 26]. [score:7]
Again, miR-100 was downregulated in these breast cancers, and the downregulation was more pronounced in luminal A breast cancers than in other subtypes of tumors (Figure 1B). [score:7]
In addition to confirming a significant downregulation of miR-100 in breast cancer tissues (Figure 1A), we noticed that miR-100 downregulation occurred in each of the four subtypes of breast cancers, luminal A, luminal B, HER2 and basal-like (Figure 1A). [score:7]
Our expression analysis in human breast cancer tissues and cell lines, including cell lines where miR-100 expression was manipulated, further confirmed mTOR as a target of miR-100 (Figure 5A, 5B, 5C). [score:7]
Ectopic expression of miR-100 sensitized, while inhibition of miR-100 expression desensitized, breast cancer cells to the effect of paclitaxel on cell cycle arrest, multinucleation, apoptosis and tumorigenesis. [score:7]
A. Genes upregulated in breast cancers that responded to paclitaxel treatment, when compared to those that did not respond, were significantly enriched among genes whose expression levels positively correlated with miR-100 expression, as determined by Gene Set Enrichment Analysis (GSEA). [score:7]
Consistently, in MDA-MB-231 basal-like cells, which expressed a higher level of miR-100 and were very sensitive to paclitaxel (Figure 2A, 2B), inhibition of miR-100 expression desensitized cells to paclitaxel -induced cell proliferation and survival (Figure 2E). [score:7]
Interestingly, the ratio of miR-100 level in a tumor to that in matched normal control, which indicates the extent of miR-100 downregulation, was significantly smaller in luminal A tumors than in other tumors (Figure 1A), indicating that miR-100 downregulation was more extensive in the luminal A subtype of breast cancer. [score:7]
To explore whether patients with breast cancers with higher miR-100 expression levels benefit more from paclitaxel treatment, we analyzed whether the expression of miR-100 correlative genes is associated with the expression of genes in the paclitaxel-sensitive signature by using gene set enrichment analysis (GSEA). [score:7]
Figure 6 A. Genes upregulated in breast cancers that responded to paclitaxel treatment, when compared to those that did not respond, were significantly enriched among genes whose expression levels positively correlated with miR-100 expression, as determined by Gene Set Enrichment Analysis (GSEA). [score:7]
Ectopic expression of miR-100 sensitized, while inhibition of miR-100 expression desensitized, breast cancer cells to the therapeutic effect of paclitaxel both in vitro and in xenograft tumorigenesis (Figures 2 and 3). [score:7]
In the same group of patients, those with higher mTOR protein expression had a trend toward worse survival but the difference was not statistically significant D. Luminal A breast cancers are more resistant to chemotherapies including paclitaxel treatment [2, 6- 8], and the greater degree of downregulation of miR-100 in luminal A breast cancers (Figure 1) suggests a role for miR-100 in determining breast cancer sensitivity to paclitaxel treatment. [score:6]
As a miRNA, miR-100 targets a number of genes for translational regulation. [score:6]
For example, miR-100 is commonly downregulated in various types of human tumors [14- 20], and lower levels of miR-100 expression correlate with poorer prognosis in patients with several types of malignancies such as esophageal squamous cell carcinoma, colorectal cancer, hepatocellular carcinoma and bladder cancer [14- 17, 21]. [score:6]
Previous studies identified mTOR as a direct target of miR-100 in the promotion of apoptosis [34] and autophagy [35] and in the inhibition of cell proliferation [36] (Table S3). [score:6]
In the MDA-MB-231 basal-like breast cancer cell line, which expressed a much higher miR-100 level than MCF-7 cells (Figure 1) and was much more sensitive to paclitaxel (Figure 2B), knockdown of miR-100 expression did not affect cell proliferation or survival with no or lower concentrations of paclitaxel (0-0.01 μg/ml) but significantly compromised the effect of higher concentrations of paclitaxel (0.1-10 μg/ml) (Figure 2E). [score:6]
To identify genes whose expression changes corresponded to that of miR-100 in breast cancer, we used the cBioPortal program to rank the expression change of each gene between a cancer and its normal control compared with miR-100's expression change in the same tumor and normal samples. [score:6]
For example, miR-100 regulates apoptosis, autophagy, cell growth and survival, migration, stem cell self-renewal and drug sensitivity by targeting different molecules such as mammalian target of rapamycin (mTOR), PLK1 and SMARCA5 [11- 13]. [score:6]
This suppression was much more profound in tumors expressing ectopic miR-100, as indicated by significantly reduced tumor volumes from day 2 after paclitaxel administration (Figure 3A), tumor weights at excision (Figure 3B), and tumor images (Figure 3C). [score:5]
To evaluate whether mTOR is a target molecule of miR-100 in breast cancer, we collected breast cancer samples in the TCGA database that had expression information for both miR-100 and mTOR protein (Table S4), and looked for correlations between their expression levels. [score:5]
First, when breast cancer cell lines were classified into different subtypes based on the expression status of ER, PR and HER2 [29, 30], luminal A lines expressed much lower levels of miR-100 than basal-like lines (Figure 2), which was consistent with our finding in breast cancer tissues (Figure 1). [score:5]
Furthermore, miR-100 overexpression in basal-like cells not only inhibits the maintenance and expansion of breast cancer stem-like cells (BrCSCs), it also promotes their differentiation or conversion from a basal-like phenotype to a luminal phenotype [26]. [score:5]
Mechanistically, targeting mTOR appeared to mediate miR-100's function in sensitizing breast cancer cells to paclitaxel, but other mechanisms also seem to be involved, including targeting other molecules such as PLK1. [score:5]
Consistently, when miR-100 expression was inhibited in MDA-MB-231 cells, the mTOR protein level was increased (Figure 5C, panel at right). [score:5]
The role of miR-100 in paclitaxel sensitivity does not seem specific to luminal A breast cancer, because the downregulation of miR-100 was also frequent and significant in other subtypes of breast cancer (Figure 1), and knockdown of miR-100 in MDA-MB-231 basal-like breast cancer cells desensitized their response to paclitaxel. [score:5]
MCF-7 breast cancer cells were transfected with miR-100 expression plasmid and control vector, and cells stably expressing exogenous miR-100 or control vector were injected subcutaneously into nude mice, with or without paclitaxel treatment. [score:5]
Inhibition of miR100 expression was confirmed by real-time PCR (panel at right). [score:5]
Consistently, miR-100 overexpression in MCF-7 cells inhibited mammosphere formation (data not shown), which indicates the stem-like feature of cancer cells. [score:5]
Figure 2Expression of miR-100 sensitizes breast cancer cells to the cytotoxic effect of paclitaxel in vitro A. Expression levels of miR-100, as determined by real-time PCR, in noncancerous breast epithelial cell lines (184A1 and MCF10A) and breast cancer cell lines of luminal A subtype (ZR-75-1, T-47D and MCF-7) and basal-like subtype (BT-549, Hs 578T and MDA-MB-231). [score:5]
Considering that mTOR, an important player in PI3K oncogenic signaling, has been identified as a target molecule of miR-100 [13, 27], and combined use of rapamycin and paclitaxel improves the chemotherapeutic effect of either in breast cancer [28], we also tested whether miR-100 affects the response of breast cancer cells to paclitaxel by targeting mTOR. [score:5]
Expression of genes that are part of a known signature of paclitaxel sensitivity in breast cancer significantly correlated with miR-100 expression. [score:5]
In addition, the Spearman correlation analysis was applied to the mean of miR-100 expression levels and that of paclitaxel IC50 in luminal A and basal-like breast cancer cell lines to determine the correlation between miR-100 expression, IC50 and subtypes of breast cancer. [score:5]
Compared to the noncancerous lines and 3 basal-like lines, the 3 luminal A cell lines expressed much less miR-100 (Figure 2A), consistent with the pattern of miR-100 expression in the two subtypes seen in human breast cancer specimens (Figure 1). [score:4]
Considering the more severe miR-100 downregulation in luminal A cancers (Figure 1), it is possible that miR-100 is functionally involved in breast cancer sensitivity to paclitaxel's cytotoxic effect. [score:4]
Expression evaluation, functional and molecular tests, and bioinformatic and survival analyses suggest that miR-100 plays a role in breast cancer development by promoting paclitaxel sensitivity in part by targeting mTOR. [score:4]
For example, while miR-100 regulates β-tubulin isotypes in MCF-7 breast cancer cells [23], and tubulin alteration is a known mechanism for breast cancer resistance to the microtubule -targeted drug paclitaxel [24], luminal A breast cancers are less responsive to paclitaxel treatment, and the role of miR-100 in paclitaxel response is unknown. [score:4]
Therefore, while the mechanism by which luminal A breast cancers appear to be more affected by miR-100 is unknown, one possibility is that miR-100 plays a more crucial role in the luminal differentiation of breast epithelial cells, and more severe downregulation of miR-100 is important for the formation of luminal breast cancers. [score:4]
Downregulation of miR-100 in breast cancer. [score:4]
Luminal A breast cancers are more resistant to chemotherapies including paclitaxel treatment [2, 6- 8], and the greater degree of downregulation of miR-100 in luminal A breast cancers (Figure 1) suggests a role for miR-100 in determining breast cancer sensitivity to paclitaxel treatment. [score:4]
These findings suggest that miR-100 plays a role in breast cancer development, and its detection and expression have diagnostic, prognostic and therapeutic value in the detection and treatment of breast cancer. [score:4]
In addition, miR-100 downregulation in breast cancer was associated with worse overall survival in breast cancer patients (Figure 6). [score:4]
MCF-7 cells with or without miR-100 expression (miR-100 vs. [score:3]
While miR-100 overexpression did not itself alter cell cycle progression, it significantly enhanced the induction of cell cycle arrest at the G2/M phase by paclitaxel treatment (Figure 4A and 4B). [score:3]
Our results showed that miR-100 overexpression enhanced the effect of paclitaxel on cell cycle arrest, multinucleation and apoptosis (Figure 4). [score:3]
In addition, while miR-100 inhibits the self-renewal of breast cancer stem-like cells (BrCSCs) and sensitizes basal-like breast cancer stem cells to hormonal therapy by promoting cell differentiation [25, 26], whether miR-100 has different effects on different subtypes of breast cancer remains unknown. [score:3]
While restoration of miR-100 expression did not change cell proliferation or survival (Figure 2C, bars at far left), it significantly enhanced the effect of paclitaxel even at the low concentration of 1 ng/ml (Figure 2C, panel at left), with IC [50] decreasing from 9.6 μg/ml (9.56 ± 1.8) to 0.05 μg/ml (0.05 ± 0.02). [score:3]
Figure 5 A. Expression level of miR-100 inversely correlates with that of mTOR protein in breast cancer samples, as determined by Pearson correlation analysis using data from the TCGA database (Table S4). [score:3]
IC [50] values between the 2 groups of breast cancer cell lines were significantly correlated with miR-100 expression levels (P < 0.001), supporting the role of miR-100 in the sensitivity of breast cancer cells to paclitaxel treatment. [score:3]
We then collected all molecules that had been identified as target molecules of miR-100 (Table S3). [score:3]
Similarly, while miR-100 overexpression did not induce detectable multinucleation and apoptosis, it significantly enhanced the induction of both multinucleation and apoptosis observed following paclitaxel treatment (Figure 4C- 4F). [score:3]
A. Detection of miR-100 expression by real-time RT-PCR in 36 breast cancer specimens and their matched adjacent normal tissues. [score:3]
In several breast cancer cell lines including the MCF-7 luminal A line, miR-100 overexpression decreases the number of ALDH positive cells, which represent a stem-like subpopulation [25]. [score:3]
We therefore conclude that miR-100 affects the therapeutic response of breast cancer to paclitaxel, and that patients with higher levels of miR-100 expression benefit more from paclitaxel treatment. [score:3]
The pattern was the inverse of that seen for miR-100 expression (Figure 2A). [score:3]
The tumor suppressor function of miR-100 appears to involve the proliferation and survival-promoting oncogene insulin-like growth factor (IGF) 2 [22]. [score:3]
Figure 4MCF-7 cells with or without miR-100 expression (miR-100 vs. [score:3]
These results indicate that miR-100 plays a causal role in breast cancer cell sensitivity to the inhibitory effect of paclitaxel on cell proliferation and survival. [score:3]
MCF7 cells with or without miR-100 overexpression were exposed to paclitaxel for 48 hours as described above, and then collected and fixed with 70% ethanol for at least 24 hours. [score:3]
The IC [50] values of paclitaxel were much higher in the 3 luminal A lines (ranging from 2 to 10 μg/ml), all of which had lower levels of miR-100 expression, than in the 3 basal-like breast cancer cell lines (less than 0.05 μg/ml) (Figure 2B). [score:3]
In addition, paclitaxel induced miR-100 expression in two luminal A breast cancer cell lines, MCF-7 and T-47D (Figure 2D), suggesting that miR-100 can serve as an effector in paclitaxel -induced cellular responses. [score:3]
The association of lower miR-100 expression with worse patient survival has also been reported in other types of cancers, including esophageal squamous cell carcinoma [14], colorectal cancer [15], hepatocellular carcinoma [16], bladder cancer [17], ovarian cancer [21] and non-small cell lung cancer [20]. [score:3]
These results suggest that breast cancer patients with higher tumor miR-100 expression, particularly those with luminal A and B subtypes, benefit more from paclitaxel treatment. [score:3]
Figure 3MCF-7 cells with miR-100 expression, along with control cells (pcDNA3.1), were injected into both sides of nude mice to initiate tumorigenesis, with paclitaxel treatment administered 14 days post inoculation. [score:3]
More cells with miR-100 overexpression and paclitaxel treatment (0.01 μg/ml) were arrested at the G2-M phase A., B., had multinucleation C., D., and underwent early or late apoptosis E., F.. [score:3]
As previously described [47], we used the Gene Set Enrichment Analysis (GSEA) software to calculate enrichment scores for paclitaxel-responsive genes and their expression correlation with miR-100 expression. [score:3]
Similar results were obtained when miR-100 expression, as determined by RNA-Seq, was analyzed in the group of breast cancer samples that had matched normal tissues with complete ER, PR and HER2 status in the TCGA database (Table S1). [score:3]
In addition, among the large number of miR-100 targets that have been identified in published studies (Table S3), PLK1 kinase has also been shown in a number of studies to function in cell proliferation and apoptosis. [score:3]
E. Inhibition of miR-100 desensitizes the MDA-MB-231 basal-like breast cancer cell line to paclitaxel. [score:3]
Expression of miR-100 sensitizes breast cancer cells to the cytotoxic effect of paclitaxel in vitro. [score:3]
MiR-100 is downregulated in human breast cancer, particularly the luminal A subtype. [score:3]
A significant inverse correlation was found between miR-100 and mTOR in invasive breast cancers (Figure 5A), implicating mTOR as a target of miR-100 in breast cancer. [score:3]
When miR-100 was ectopically expressed in MCF-7 cells, the mTOR protein level was dramatically decreased (Figure 5C, panel at left). [score:3]
Other targets of miR-100 may also contribute to its effects on breast cancer cell sensitivity to paclitaxel. [score:3]
C. Ectopic expression of miR-100 sensitizes the MCF-7 luminal A breast cancer cell line to paclitaxel. [score:3]
Expression of miR-100 sensitizes MCF-7 tumors to paclitaxel treatment. [score:3]
During the 3 weeks of tumor growth before paclitaxel administration, miR-100 expression appeared to reduce tumor volumes but the reduction was not statistically significant (Figure 3A). [score:3]
Additional experiments further confirmed that mTOR is indeed a target of miR-100 in breast cancer cells. [score:3]
In addition, paclitaxel treatment increased miR-100 expression level in the luminal A breast cancer cell lines we tested (Figure 2D). [score:3]
By comparing molecules involved in both groups, we found that mTOR was the only known miR-100 target that has also been shown to affect breast cancer sensitivity to paclitaxel. [score:3]
Therefore, targeting mTOR appears to be an important mechanism by which miR-100 sensitizes breast cancer cells to paclitaxel. [score:3]
B. Expression of miRNA-100, as determined by RNA sequencing, in 67 breast cancer samples and their matched normal tissues in the TCGA database. [score:3]
These results indicate that restoration of miR-100 expression sensitizes MCF-7 breast cancer cells to paclitaxel treatment in a xenograft mo del. [score:3]
It is unknown why and how luminal A breast cancers have a greater degree of miR-100 downregulation compared to other subtypes. [score:3]
MCF-7 cells with ectopic expression of miR-100 were obtained by transfecting pcDNA3.1-miR-100 plasmids into cells, along with the vector control, and selection with G418-containing medium (800 μg/ml) for at least 2 weeks after transfection. [score:3]
To experimentally test whether mTOR plays a role in miR-100 -mediated sensitivity to paclitaxel, we first measured mTOR protein expression in the 6 luminal A and basal-like breast cancer cell lines used for expression and functional analyses of miR-100. [score:3]
The cBioPortal program [33] was applied to the TCGA database to identify invasive breast carcinomas that had information on the expression levels of both miR-100 and mTOR protein. [score:3]
MCF-7 cells with miR-100 expression, along with control cells (pcDNA3.1), were injected into both sides of nude mice to initiate tumorigenesis, with paclitaxel treatment administered 14 days post inoculation. [score:3]
We examined these cellular processes in paclitaxel -treated MCF-7 cells with or without miR-100 overexpression to determine their involvement in miR-100 -mediated sensitization to paclitaxel. [score:3]
The heat map lists genes in the order of strong positive correlation (red) to strong negative correlation with miR-100 expression (green). [score:3]
A. Expression level of miR-100 inversely correlates with that of mTOR protein in breast cancer samples, as determined by Pearson correlation analysis using data from the TCGA database (Table S4). [score:3]
Ectopic expression of miR-100 sensitizes MCF-7 luminal breast cancer to the therapeutic effects of paclitaxel in nude mice. [score:3]
A. Expression levels of miR-100, as determined by real-time PCR, in noncancerous breast epithelial cell lines (184A1 and MCF10A) and breast cancer cell lines of luminal A subtype (ZR-75-1, T-47D and MCF-7) and basal-like subtype (BT-549, Hs 578T and MDA-MB-231). [score:3]
C. and D. Patients with lower miR-100 levels had worse overall survival than those with higher miR-100 expression, as analyzed using data from the TCGA database C.. [score:3]
For example, enhancement or restoration of miR-100 expression in cancer cells, particularly in luminal A breast cancer, may sensitize these cells to paclitaxel treatment. [score:3]
Figure 1 A. Detection of miR-100 expression by real-time RT-PCR in 36 breast cancer specimens and their matched adjacent normal tissues. [score:3]
D. Paclitaxel treatment induces miR-100 expression in luminal A breast cancer cell lines MCF-7 and T-47D, as detected by real-time PCR. [score:3]
We therefore performed a series of analyses to identify the molecular target(s) of miR-100 involved in breast cancer sensitivity to paclitaxel treatment. [score:3]
MCF-7 cells with and without miR-100 expression were resuspended in a solution of Matrigel (BD USA) and PBS (equal volume), and then inoculated subcutaneously into the flanks of 8 week old female BALB/c nude mice (Charles River, San Diego, CA) at 3 × 10 [6] cells per site. [score:3]
Ectopic expression of miR-100 was confirmed by real-time PCR (panel at right). [score:3]
One target of miR-100, mTOR, is involved in paclitaxel sensitivity. [score:3]
In breast cancer, miR-100 also appears to play a role, as miR-100 induces epithelial-mesenchymal transition but suppresses tumorigenesis, migration and invasion [11]. [score:3]
Patients with lower miR-100 expression in their cancers had worse overall survival (Figure 6C). [score:3]
MiR-100 sensitizes breast cancer cells to paclitaxel by targeting mTOR and other mechanisms. [score:2]
MiR-100 plays a suppressor role in breast cancer. [score:2]
We also performed tumorigenesis assays to determine whether miR-100 expression improves the therapeutic effect of paclitaxel on breast cancer. [score:2]
Real-time PCR with SYBR green (Takara, Dalian, China) was performed with the Realplex Real-time PCR Detection System (Eppendorf, Beijing, China) to detect the expression of miR-100, with the 5′-GTGCAGGGTCCGAGGT-3′ (forward) and 5′-CCCGTAGATCCGAACTTG-3′ (reverse) primer sequences. [score:2]
The pcDNA3.1-miR-100 expression vector was constructed by PCR amplification of the genomic DNA containing pre-miR-100 with primers 5′-TCCGGAATTCGTGGAAACCAAGGGAAGC-3′ and 5′-CTAGTCTAGATTGAGGGCCAGCCTATTA-3′, digestion with EcoRI and XbaI, and subsequent cloning into the pcDNA3.1 plasmid (Invitrogen, Carlsbad, CA). [score:2]
MiR-100 expression in breast cancer tissues and their adjacent normal tissues, as determined by the Illumina HiSeq and Illumina Genome Analyzer and indicated by normalized read counts, were retrieved from the Cancer Genome Atlas (TCGA) database (http://cancergenome. [score:2]
MiR-100 sensitizes breast cancer cells to paclitaxel inhibition of cell proliferation and survival. [score:2]
The T/N ratio of miR-100 expression in luminal A tumors was significantly lower when compared to the remaining samples in A (P < 0.05). [score:2]
To test this possibility, we first evaluated miR-100 expression by real-time PCR in 3 luminal A (ZR-75-1, T-47D and MCF-7) and 3 basal-like (BT-549, Hs 578T and MDA-MB-231) breast cancer cell lines [29, 30], with immortalized noncancerous breast epithelial cell lines 184A1 and MCF10A as references. [score:1]
Implication of miR-100 in breast cancer response to paclitaxel treatment. [score:1]
Implication of miR-100 in the treatment of human breast cancer with paclitaxel. [score:1]
MiR-100 appears to play a role in cancer development. [score:1]
To clarify the function of miR-100 in breast cancer, we first evaluated the expression of miR-100 by real-time PCR in 36 breast cancer specimens, with each cancer's adjacent normal breast tissue as the control. [score:1]
This result confirms that mTOR plays a role in miR-100 -mediated sensitization of breast cancer cells to paclitaxel. [score:1]
These findings indicate a role of miR-100 in paclitaxel -induced cell cycle arrest, multinucleation and apoptosis. [score:1]
However, the role of miR-100 in breast cancer remains to be clarified. [score:1]
Our findings in this study suggest that miR-100 may also have therapeutic value. [score:1]
We used the cBioPortal program and the TCGA database to determine the expression change for every gene between cancers and their matched normal tissues, and then calculated the correlation of these changes to those of miR-100 [33]. [score:1]
In addition, detection of miR-100 in the serum of cancer patients appears to have diagnostic and prognostic value as a potential biomarker [19, 37- 40]. [score:1]
In addition, GSEA showed that the enrichment of genes conferring paclitaxel sensitivity in miR-100-corresponding genes was more profound in the luminal A and B subtypes than in basal-like and HER2 subtypes, and the former two are more differentiated than the latter two. [score:1]
Interestingly, the IC [50] of paclitaxel was much greater in the luminal A lines than in the basal-like lines (Figure 2B), providing functional support for the role of miR-100 in paclitaxel sensitivity. [score:1]
mTOR plays a role in miR-100 -mediated sensitization to paclitaxel treatment. [score:1]
ES is the maximum deviation from zero encountered in walking the list, reflecting the degree to which a gene set is overrepresented at the top or bottom of a ranked list of genes (e. g., miR-100-responsive genes). [score:1]
It is thus possible that, like mTOR, PLK1 may also mediate the effect of miR-100 on breast cancer sensitivity to paclitaxel, though this remains to be determined. [score:1]
[1 to 20 of 133 sentences]
2
[+] score: 427
Mechanistically, miR-100 induces EMT by targeting SMARCA5, an epigenetic regulator of E-cadherin, and inhibits tumorigenesis, migration and invasion by targeting HOXA1, leading to downregulation of multiple HOXA1 downstream targets involved in oncogenesis and invasiveness, including CCND1, MET, SMO and SEMA3C (Figure 7H ). [score:13]
Interestingly, overexpression of either Twist or Snail increased ZEB1 expression to the level as high as that of ZEB1 -overexpressing cells (Figure S1B), which could explain why miR-100 was identified as a commonly upregulated miRNA in HMLE cells overexpressing Twist, Snail or ZEB1. [score:12]
Similarly, expression of miR-100 in the MCF7 human epithelial breast cancer cell line (Figure S2C) also markedly downregulated E-cadherin and upregulated vimentin (Figure 1D ), although we did not observe a clear morphological change. [score:9]
Here we demonstrate that a miRNA downregulated in human breast tumors, miR-100, can simultaneously induce EMT and inhibit tumorigenesis, migration and invasion through direct targeting of distinct genes. [score:9]
Spearman rank correlation test was used to assess the correlation between miR-100 expression level and MIR100HG gene methylation level (n = 522), and the correlation between miRNA expression levels and mRNA expression levels in all breast cancer samples with both miRNA and mRNA expression data available (n = 777). [score:9]
To determine the cellular origin of miR-100 expression, we performed in situ hybridization on human normal and cancer tissues, and found that miR-100 was indeed highly expressed in normal human mammary epithelium as opposed to barely detectable expression in the stroma, whereas human breast tumors exhibited reduced miR-100 expression (Figure 2B and 2C ). [score:9]
This markedly reduced E-cadherin protein expression (Figure 3C ) but did not alter cell proliferation (Figure S5C), suggesting that downregulation of SMARCA5 partially mediates the EMT-inducing effect of miR-100 but not its growth -inhibitory function. [score:8]
In addition, among all predicted targets of miR-100, HOXA1 is a mammary oncogene [20] and is upregulated in human breast cancer [21]; overexpression of HOXA1 in immortalized human mammary epithelial cells was sufficient to induce aggressive tumor formation in vivo [20]. [score:8]
miR-100 inhibits migration and invasion by targeting HOXA1 Unexpectedly, despite strong EMT induction in both HMLE-Erbb2 and MCF7 cells, expression of miR-100 suppressed their migration and invasion in vitro, as gauged by Transwell assays (Figure 5A and 5B ; Figure S6A and S6B). [score:8]
Conversely, re -expression of SMARCA5 in miR-100 -overexpressing HMLE cells restored the expression of E-cadherin at both mRNA and protein levels (Figure 3D and 3E ), although the mesenchymal morphology was not reversed. [score:7]
In the present study, ectopic expression of miR-100 markedly reduced the mRNA levels of MET, SMO, SEMA3C and CCND1, either in the presence or absence of Erbb2 expression (Figure 6A and 6B ), while restoration of HOXA1 rescued the expression of each of these four genes (Figure 6B ). [score:7]
miR-100 expression is regulated by ZEB1 and the methylation of the host gene MIR100HG We sought to understand how miR-100 expression is regulated. [score:7]
In contrast to the effect of SMARCA5, restoring HOXA1 expression in miR-100 -overexpressing HMLE-Erbb2 cells to the same level as the control HMLE-Erbb2 cells (Figure 4A ) did not affect expression levels of EMT -associated markers (Figure S5D), but instead fully rescued tumor onset and partially rescued tumor volume (51% rescue, Figure 4B ) and tumor weight (40% rescue, Figure 4C and 4D ). [score:7]
Paradoxically, miR-100 is commonly downregulated in all subtypes of human breast cancers (Figure 2A ), which indicates that other mechanisms lead to downregulation of miR-100. [score:7]
Indeed, expression of miR-100 significantly inhibited the proliferation of HMLE cells in vitro, either in the presence or absence of ectopic expression of the Erbb2 mammary oncogene (Figure 2D and S4A). [score:7]
Moreover, the activity of a luciferase reporter fused to a wild-type HOXA1 3′ UTR, but not that of a reporter fused to a mutant HOXA1 3′ UTR with mutations in the miR-100 binding site (Figure S5B), was reduced by 80% upon expression of miR-100 (Figure 3B ), which validated HOXA1 as a direct target of this miRNA. [score:7]
While miR-125b and miR-720 did not cause any changes in cell morphology or EMT markers (Figure 1C and data not shown), expression of either miR-100 or miR-22 (Figure S2B) was sufficient to induce EMT: upon expression of either miRNA, epithelial cells became scattered and assumed fibroblastic morphology (Figure 1C ); E-cadherin expression was undetectable and the mesenchymal marker vimentin was dramatically induced (Figure 1D ). [score:7]
Taken together, these results do not argue that EMT itself suppresses cancer, but instead demonstrate that EMT is not always associated with increased tumorigenesis, migration and invasion, and that all EMT inducers are not equal: while some of them (such as miR-22) can promote tumorigenicity, motility and invasiveness, others (such as miR-100) inhibit these properties owing to their ability to target both EMT-repressing genes and oncogenic/pro-invasive genes (Figure 7H ). [score:7]
It should be noted that miR-100 has been reported to target IGF2 in 4T1 mouse mammary tumor cells [40]; however, IGF2 expression is undetectable in the human mammary epithelial cells (HMLE) used in this study (data not shown), although it is possible that IGF2 mediates the function of miR-100 in cells that express IGF2. [score:7]
Consistently, treatment of MCF7 and SUM149 human breast cancer cell lines with the DNA demethylating agent 5-azacytidine led to significant upregulation of miR-100 expression (Figure 7F and 7G ). [score:6]
In summary, we identified miR-100 as a novel EMT inducer and a tumor suppressor, and validated in human tumors that miR-100 is downregulated in clinical breast cancer and correlates with EMT -associated markers. [score:6]
miR-100 inhibits tumorigenesis and is downregulated in human breast cancer. [score:6]
We conclude from these experiments that miR-100 suppresses migration and invasion, at least in part, through direct targeting of HOXA1 but not SMARCA5. [score:6]
miR-100 downregulates multiple HOXA1 downstream targets involved in tumorigenesis, migration and invasion. [score:6]
miR-100 downregulates HOXA1 downstream targets. [score:6]
In contrast, neither re -expression of SMARCA5 in miR-100 -overexpressing HMLE cells nor knockdown of SMARCA5 in HMLE cells affected cell motility (Figure S6C and S6D). [score:6]
This observed downregulation of miR-100 in human breast tumors prompted us to determine whether it could be a tumor suppressor. [score:6]
Using TaqMan qPCR assays, we confirmed that four miRNAs, miR-100, miR-125b, miR-22 and miR-720, were commonly upregulated miRNAs in EMT; five miRNAs, miR-200c, miR-141, miR-205, miR-663 and miR-638, were commonly downregulated miRNAs in EMT (Figure 1B and Table S2). [score:6]
miR-100 downregulates E-cadherin by targeting SMARCA5. [score:6]
Therefore, miR-100 downregulates multiple HOXA1 downstream targets involved in oncogenesis and invasiveness. [score:6]
Taken together, downregulation of HOXA1 mediates, at least in part, the tumor-suppressing effect of miR-100 but not its EMT-inducing function. [score:6]
miR-100 suppresses tumor growth and is downregulated in human breast cancer. [score:6]
We further validated the effect on tumor invasion in vivo: tumors formed by miR-100 -overexpressing HMLE-Erbb2 cells were well demarcated and did not show overt invasion to their surrounding tissues (Figure 5F ); in contrast, tumors formed by either the control HMLE-Erbb2 cells (mock) or HMLE-Erbb2 cells with simultaneous expression of miR-100 and HOXA1 were invasive and infiltrated muscular, adipose and stromal tissues (Figure 5F ). [score:5]
miR-100 suppresses tumorigenesis by targeting HOXA1. [score:5]
Consistent with the in vitro effect of miR-100 on EMT induction (Figure 1C and 1D ) and cell proliferation (Figure S4A), the control HMLE-Erbb2 tumors were epithelial and had 80% Ki-67 -positive cells, miR-100 -expressing HMLE-Erbb2 tumors exhibited mesenchymal morphology and 8% Ki-67 -positive cells, whereas HMLE-Erbb2 tumors with co -expression of miR-100 and HOXA1 were mesenchymal but showed 63% Ki-67 -positive cells (Figure 4E ). [score:5]
While miR-100 did not substantially alter expression levels of SMARCD1, mTOR and BMPR2 in HMLE cells (Figure S5A), overexpression of this miRNA in both HMLE and MCF7 cells resulted in a pronounced decrease in SMARCA5 and HOXA1 protein levels (Figure 3A ). [score:5]
miR-100 inhibits migration and invasion by targeting HOXA1. [score:5]
To validate this effect in vivo, we subcutaneously implanted Erbb2 -expressing HMLE cells (HMLE-Erbb2) with or without miR-100 overexpression into nude mice. [score:5]
miR-100 inhibits migration and invasion by targeting HOXA1. [score:5]
Strikingly, miR-100 expression dramatically suppressed tumor formation and growth (Figure 2E–2G ), as it not only delayed initial tumor onset by one week (Figure 2E ), but also caused a 83% reduction in tumor volume (683.3 mm [3] vs. [score:5]
The miR-Zip construct expressing a short hairpin inhibiting miR-100 was from System Biosciences. [score:5]
The association between miR-100 and EMT markers was further validated in human tumors: from the Cancer Genome Atlas (TCGA) breast cancer data [17], we observed a moderate but significant inverse correlation between miR-100 and E-cadherin expression levels (Rs = −0.1, P = 0.006, Figure 1F ) and a highly significant positive correlation between miR-100 and vimentin expression levels (Rs = 0.43, P<2×10 [−16], Figure 1G ). [score:5]
miR-100 expression is regulated by ZEB1 and the methylation of the host gene MIR100HG. [score:4]
Taken together, these data suggest that miR-100 expression is regulated by both transcriptional activation and epigenetic silencing. [score:4]
Unexpectedly, despite strong EMT induction in both HMLE-Erbb2 and MCF7 cells, expression of miR-100 suppressed their migration and invasion in vitro, as gauged by Transwell assays (Figure 5A and 5B ; Figure S6A and S6B). [score:4]
miR-100 regulates EMT and tumorigenesis by targeting distinct genes. [score:4]
Therefore, downregulation of miR-100 reflects the difference between normal mammary epithelium and breast tumor cells, but is not due to the difference in the stroma. [score:4]
Four miR-100 targets, SMARCA5, SMARCD1, MTOR (mammalian target of rapamycin) and BMPR2, have been identified by reporter assays previously [18], [19]. [score:4]
Consistent with the correlation of miR-100 with EMT markers (Figure 1F and 1G ), the luminal A subtype of primary breast tumors (which are known to be E-cadherin -positive and vimentin -negative) exhibited the most significant downregulation of miR-100 (Figure 2A ). [score:4]
We sought to understand how miR-100 expression is regulated. [score:4]
Indeed, bisulfite sequencing assays of the 27 CpG sites in the CDH1 promoter region revealed 29.6% methylation in the control HMLE cells and 55.1% methylation in miR-100 -overexpressing HMLE cells, while re -expression of SMARCA5 reversed the effect of miR-100 on CDH1 promoter methylation (Figure 3F ). [score:4]
1004177.g007 Figure 7Regulation of miR-100 expression by ZEB1 and the methylation of the host gene MIR100HG. [score:4]
Regulation of miR-100 expression by ZEB1 and the methylation of the host gene MIR100HG. [score:4]
However, in stark contrast to miR-100, miR-22 functions to promote tumorigenesis, invasion and metastasis, ostensibly through direct targeting of the TET family of methylcytosine dioxygenases [41]. [score:4]
Notably, our results indicate the following: on one hand, both DNA hypermethylation and genetic deletion could contribute to miR-100 downregulation or loss in all subtypes of human breast tumors independently of EMT. [score:4]
Moreover, we observed a significant inverse correlation between MIR100HG gene methylation and miR-100 expression levels in breast cancer patients (Rs = −0.3, P = 7×10 [−17], n = 522, Figure 7E ). [score:3]
1004177.g002 Figure 2(A) miR-100 expression levels in four subtypes of human breast tumors and paired normal breast tissues, based on the RNA-Seq data from TCGA. [score:3]
Figure S2 Expression levels of miR-100 and miR-22. [score:3]
Thus, the anti-tumor function of miR-100 is not due to depletion of the stem-like cell population, but instead results from inhibition of cell proliferation. [score:3]
Indeed, we observed induction of both ALDH1 expression (Figure S8A) and mammosphere formation (Figure S8B and S8C) by miR-100 in HMLE and HMLE-Erbb2 cells. [score:3]
Western blot analysis of E-cadherin and vimentin in tumor lysates (Figure 2H ) and E-cadherin immunohistochemical staining of the tumors (Figure S4B) confirmed that the EMT status was retained in tumors formed by miR-100 -expressing HMLE-Erbb2 cells. [score:3]
Consistently, miR-100 exhibited a strong positive correlation with Twist (Rs = 0.3, P = 5×10 [−19]), Snail (Rs = 0.2, P = 4×10 [−7]) and ZEB1 (Rs = 0.5, P<2×10 [−16]) expression levels in human breast tumors (Figure S7B–S7D) 10.1371/journal. [score:3]
Relative to HMLE cells, epithelial-like tumor cell lines exhibited either comparable or much lower miR-100 expression, whereas mesenchymal-like tumor cell lines showed higher levels of miR-100 (Figure 1E ). [score:3]
It should be noted that in order to permit the space for cell movement, the condition used for this experiment was low density and did not allow the majority of HMLE-Erbb2 cells to form epithelial clusters; however, we did observe HMLE-Erbb2 cell clusters with epithelial island structure that exhibited a surprisingly rapid collective movement and long trajectories without cell dissociation (Video S1 – note that an epithelial cell cluster initially appeared in the upper left corner and then moved to the lower part of the field), whereas all miR-100 -expressing HMLE-Erbb2 cells had highly limited area of movement and reduced speed (Video S2). [score:3]
Consistently, miR-100 exhibited a strong positive correlation with Twist (Rs = 0.3, P = 5×10 [−19]), Snail (Rs = 0.2, P = 4×10 [−7]) and ZEB1 (Rs = 0.5, P<2×10 [−16]) expression levels in human breast tumors (Figure S7B–S7D) 10.1371/journal. [score:3]
Although it is not clear how this interaction modulates DNMT3B activity, we speculated that miR-100 might promote CDH1 (encoding E-cadherin) gene methylation by targeting SMARCA5. [score:3]
Consistent with this finding, restoration of HOXA1 in miR-100 -overexpressing HMLE-Erbb2 cells (Figure 4A ) rescued cell migration and invasion (Figure 5A and 5C ; Figure S6A; Video S3). [score:3]
Figure S5Examination of different miR-100 targets. [score:3]
Surprisingly, miR-100 was found to be downregulated in all subtypes of human breast tumors, including luminal A (P = 1×10 [−11]), luminal B (P = 0.008), basal-like (P = 0.006) and HER2 (P = 0.001) subtypes, compared with paired normal breast tissues (Figure 2A ). [score:3]
We performed to determine the expression levels of miR-100 and miR-22 in human breast cancer. [score:3]
Genes that contain the miR-100 -binding site(s) in the 3′ UTR were obtained using the TargetScan program [43] (www. [score:3]
We examined miR-100 expression levels in a series of human breast cancer cell lines. [score:3]
To further confirm the inhibitory effect of miR-100 on cell motility, we tracked the movement of individual cells cultured on top of collagen over a 24-hour period. [score:3]
To determine the loss-of-function effect, we used a miR-Zip method to achieve lentiviral inhibition of miR-100 in MDA-MB-231 breast cancer cells. [score:3]
To our knowledge, this is the first time that conversion from an epithelial state to a mesenchymal state has been found to be accompanied by reduced motility and invasiveness, which indicates that miR-100 may concurrently target EMT-repressing genes (SMARCA5) and pro-invasive genes. [score:3]
We hypothesized that different target genes of miR-100 mediate the two distinct functions of this miRNA. [score:3]
Our work is consistent with the anti-proliferative function of miR-100 described in several recent studies [18], [40], and is the first report of an EMT inducer that suppresses cell movement and invasion. [score:3]
Moreover, luciferase assays demonstrated that ZEB1 significantly increased the activity of the putative mir-100 promoter (Figure 7C ), suggesting that mir-100 is likely to be a transcriptional target of ZEB1. [score:2]
Because induction of the EMT program can generate stem-like cells [13], [14], we examined the ability of miR-100 to regulate stem cell properties, as gauged by the stem cell marker ALDH1 (aldehyde dehydrogenase 1) [38] and mammosphere-forming ability [39]. [score:2]
Using time-lapse video microscopy, we observed a 53% decrease in the speed of movement of miR-100 -expressing HMLE-Erbb2 cells compared with HMLE-Erbb2 cells (Figure 5C ; Video S1 and S2). [score:2]
Furthermore, a 91% decrease in tumor weight was observed in mice implanted with miR-100 -overexpressing MCF7 human breast cancer cells, compared with hosts of mock-infected MCF7 cells (Figure 2I and 2J ). [score:2]
In support of this notion, miR-100 -expressing HMLE-Erbb2 tumors displayed a 90% reduction in the percentage of Ki-67 -positive cells compared with the control HMLE-Erbb2 tumors (Figure 4E ). [score:2]
1004177.g006 Figure 6(A) qPCR of MET, SMO, SEMA3C and CCND1 in HMLE cells transduced with miR-100. [score:1]
A 1.5 kb putative human mir-100 promoter sequence containing the ZEB1 -binding site (E-box) was PCR amplified from normal genomic DNA and cloned into the pGL3-Basic vector. [score:1]
On the other hand, induction of miR-100 may serve as a negative feedback mechanism to counteract the tumor-promoting and pro-invasive effect of EMT-inducing transcription factors. [score:1]
Analysis of TCGA data revealed that 1.2% of the breast tumors (11 out of a total of 913 samples with copy number data available) had homozygous deletion of both mir-100 and MIR100HG, which could explain loss of miR-100 in these samples. [score:1]
miR-100 induces epithelial-mesenchymal transition. [score:1]
Examination of the 2.5 kb genomic sequence upstream of the human mir-100 stem-loop identified two putative ZEB1 -binding sites at −400 bp (Z-box, CAGGTA) and −2.2 kb (E-box, CAGCTG), respectively (Figure S7A). [score:1]
The mir-100 gene is embedded in a non-coding host gene, MIR100HG. [score:1]
In situ hybridizationThe double (5′ and 3′) digoxigenin (DIG)-labeled miR-100 probe and U6 probe were purchased from Exiqon. [score:1]
The RNAhybrid program [44] was used to predict duplex formation between miR-100 and human HOXA1 3′ UTR. [score:1]
The human mir-100, mir-22, mir-125b and mir-720 genomic sequences were PCR amplified from normal genomic DNA and cloned into the MSCV-PIG or pBabe-puro retroviral vector. [score:1]
miR-100 induces EMT and correlates with the EMT state in human breast cancer. [score:1]
Video S3 of HMLE-Erbb2 cells transduced with both miR-100 and HOXA1. [score:1]
Video S2 of miR-100-transduced HMLE-Erbb2 cells. [score:1]
The double (5′ and 3′) digoxigenin (DIG)-labeled miR-100 probe and U6 probe were purchased from Exiqon. [score:1]
Compared with cells infected with a scrambled hairpin control (Zip-scr), cells with approximately 60% knockdown of miR-100 (Zip-100, Figure 5D ) displayed a significant increase in their migratory and invasive capacity (Figure 5E ), while their mesenchymal status was not altered (data not shown). [score:1]
Lower panel: sequence of the miR-100 binding site within the HOXA1 3′ UTR of human (hs) and mouse (mm); a mutant 3′ UTR of human HOXA1 containing mutations in the miR-100 binding site (mut) was used for luciferase reporter assays in Figure 3B. [score:1]
[1 to 20 of 98 sentences]
3
[+] score: 362
Also, overexpression of miR-100 could inhibit growth, enhance apoptosis and induce cell cycle arrest in G [2]/M stage, which is possibly owing to increased apoptosis associated with downregulation of PLK1 expression. [score:10]
RT-PCR and Western Blot assays showed that the expression levels of PLK1 both mRNA and protein were significantly downregulated by miR-100 mimics while miR-100 inhibitors could increase the expression levels of PLK1 mRNA and protein in A549 cells (Figure 4B). [score:9]
Thus, these data further support that downregulation of miR-100 was inversely correlated with upregulation of PLK1 in NSCLC tissues. [score:7]
As shown in Figure 2A, there was no significant difference in 5-year disease-free survival (DFS) between patients with low miR-100 expression and those with high miR-100 expression (P = 0.078). [score:7]
Meanwhile, miR-100 mimics could significantly inhibit PLK1 mRNA and protein expression and reduce the luciferase activity of a PLK1 3’ untranslated region -based reporter construct in A549 cells. [score:7]
However, the status of miR-100 expression in NSCLC is unclear, and whether miR-100 plays a critical role in NSCLC development by posttranscriptionally regulating PLK1 expression needs to be further elucidated. [score:7]
Patients with miR-100 expression (△Ct < −6.218) were considered as the low expression group (n = 64), while patients with miR-100 expression (△Ct ≥ −6.218) were considered as the high expression group (n = 46). [score:7]
In the present study, we showed that downregulation of miR-100 might play critical roles in the formation of malignant phenotypes by posttranscriptionally regulating PLK1 expression. [score:7]
Meanwhile, miR-100 mimics or inhibitor could lead to the decreased or increased PLK1 expression in NSCLC at both transcriptional and translational levels. [score:7]
Furthermore, small interfering RNA (siRNA) -mediated PLK1 downregulation could mimic the effects of miR-100 mimics while PLK1 overexpression could partially rescue the phenotypical changes of NSCLC cells induced by miR-100 mimics. [score:6]
Functional experiments showed that upregulation of miR-100 could inhibit growth of NSCLC cells, which might be apoptosis enhancement and cell cycle arrest in G [2]/M stage. [score:6]
MiR-100 was significantly downregulated in NSCLC tissues, and low miR-100 expression was found to be closely correlated with higher clinical stage, advanced tumor classification and lymph node metastasis of patients. [score:6]
Finally, the effects of miR-100 expression on growth, apoptosis and cell cycle of NSCLC cells by posttranscriptionally regulating PLK1 expression were determined. [score:6]
In the present study, we set out to detect the expression of miR-100 in NSCLC tissues and analyze its correlation with clinicopathological factors or prognosis of NSCLC patients, and post-transcriptional regulatory relation between miR-100 and PLK1 in NSCLC cells, which will provide one day a potential molecular therapeutic target for human NSCLCs. [score:6]
Figure 7 PLK1 was significantly upregulated in NSCLC tissues and inversely correlated with miR-100 expression. [score:6]
Our findings indicate that low miR-100 may be a poor prognostic factor for NSCLC patients and functions as a tumor suppressor by posttranscriptionally regulating PLK1 expression. [score:6]
Although miR-100 has been found to function as a tumor suppressor in nasopharyngeal cancer, epithelial ovarian cancer, bladder cancer and acute myeloid leukemia [36, 37], the expression of miR-100 and its roles in NSCLC development are unknown. [score:6]
By functional analysis, it was shown that siRNA -mediated PLK1 downregulation could mimic the effects of miR-100 mimics on phenotypes of NSCLC cells and overexpression of PLK1 could partially reverse miR-100 mimics -induced phenotypical changes in NSCLC cells. [score:6]
By using microRNA (miR) target prediction algorithms, we identified miR-100 that might potentially bind the 3’-untranslated region of PLK1 transcripts. [score:5]
Other groups have shown that underexpressed miR-100 leads to Plk1 overexpression, which in turn contributes to nasopharyngeal cancer progression [15]. [score:5]
In acute myeloid leukemia, RBSP3 (a phosphatase-like tumor suppressor) has been validated as a bona fide target of miR-100 [37]. [score:5]
Overexpression of PLK1 could rescue the effects of ectopic miR-100 expression in NSCLC cells. [score:5]
Thus, miR-100 expression could affect the prognosis of NSCLC patients, and low miR-100 expression might be a poor prognostic factor. [score:5]
To further determine whether PLK1 was a bona fide target of miR-100 -mediated gene overexpression, the entire 3’-UTR of PLK1 mRNA and the miR-100 binding region within 3’-UTR of PLK1 mRNA were cloned into a luciferase reporter. [score:5]
However, the 5-year overall survival (OS) of patients with high miR-100 expression was significantly higher than that of those with low miR-100 expression (P = 0.006; Figure 2B). [score:5]
By statistical analysis, we found that miR-100 expression was significantly correlated with clinical stage, tumor classification and lymph node metastasis of NSCLC patients, suggesting that low miR-100 expression might play roles in NSLC progression. [score:5]
Additionally, miR-100 expression was inversely correlated with PLK1 mRNA expression in NSCLC tissues. [score:5]
To identify miR-100 targets, we performed in-silico screening using TargetScan with a recently described strategy [17]. [score:5]
To experimentally validate whether PLK1 is a possible target of miR-100 in NSCLC, we detected the expression of PLK1 mRNA and protein in miR-100 mimics or anti-miR-100 -transfected A549 cells. [score:5]
As shown in Figure 4C, upregulation of miR-100 could result in a significant decrease in luciferase activity when the reporter contained a wild-type sequence (WT), but not when it contained a mutant sequence (MT) within the miR-100 binding site (five nucleotides within the complementary seed sequence). [score:4]
Real-time quantitative RT-PCR assay was performed to detect the expression of miR-100 in 110 NSCLC tissues, and the association of miR-100 expression with clinicopathological features of NSCLC patients was performed (Additional file 1 Table S1). [score:4]
Taken together, these data indicate that miR-100 directly targets PLK1 in NSCLC cells. [score:4]
Thus, it was concluded that downregulation of miR-100 might play important roles in lung tumorigenesis. [score:4]
MiR-100 expression was inversely correlated with PLK1 mRNA expression in NSCLC tissues. [score:4]
The results of MTT assay showed that miR-100 mimics could markedly inhibit the growth of A549 cells while miR-100 inhibitors could slightly promote the growth of A549 cells (Figure 3B). [score:4]
Therefore, siRNA -mediated downregulation of PLK1 could mimic the effects of increased miR-100 in NSCLC cells. [score:4]
Site-directed mutagenesis of the miR-100 target-site in the PLK1-3’-UTR was performed using the Quick-change mutagenesis kit (Stratagene, Hei delberg, Germany) and named PLK1 3’-UTR-mut according to the manufacturer’s instructions. [score:4]
Figure 4 PLK1 is a direct target of miR-100. [score:4]
It was also reported that miR-100 could affect the growth of epithelial ovarian cancer cells by post-transcriptionally regulating polo-like kinase 1 expression [16]. [score:4]
Meanwhile, downregulation of miR-100 could lead to a significant increase in luciferase activity the reporter contained a wild-type sequence (WT), but not when it contained a mutant sequence (MT) within the miR-100 binding site. [score:4]
Then, we analyzed the association of downregulated miR-100 with clinicopathologic factors of NSCLC patients. [score:4]
These data showed that low miR-100 expression might play important roles in NSCLC development. [score:4]
Zheng and his colleagues revealed a new pathway that miR-100 regulates G [1]/S transition and S-phase entry and blocks the terminal differentiation by targeting RBSP3, which promoted cell proliferation. [score:4]
As shown in Figure 1A, the relative level of miR-100 expression was significantly lower in NSCLC tissues than in corresponding nontumor tissues. [score:3]
We found that, among the predicted miR-100 target genes, the 3’-UTR of PLK1 gene contained binding sites for miR-100 with reasonable scores. [score:3]
low miR-100 expression levels are shown. [score:3]
Transfection of miR-100 mimics or inhibitor. [score:3]
Univariate analysis showed that clinical stage, lymph node metastasis and low miR-100 expression were significantly correlated with poor over survival of NSCLC patients (P = 0.003, 0.016 and 0.022, respectively; Table 1). [score:3]
Furthermore, multivariate analysis using the Cox proportional hazard mo del indicated that miR-100 expression was an independent prognostic factor for NSCLC patients. [score:3]
Figure 6 DNA vector -mediated PLK1 overexpression could partially rescue the effects of miR-100 mimics on malignant phenotypes of A549 cells. [score:3]
When the levels of PLK1 mRNA were plotted against miR-100 expression, a significant inverse correlation was observed (r = −0.543; P < 0.001; Figure 7B). [score:3]
However, the expression of miR-100 was not correlated with other factors of patients including sex, age, smoking, histological type (P = 0.488, 0.583, 0.359 and 0.871, respectively). [score:3]
Next, the effect of miR-100 expression on cell cycle of A549 cells was also determined by flow cytometry (Figure 3D). [score:3]
The overall survival of NSCLC patients with low miR-100 was significantly lower than that of those patients with high miR-100, and univariate and multivariate analyses indicated that low miR-100 expression might be a poor prognostic factor. [score:3]
Also, pcDNA/PLK1 could partially reverse growth inhibition and apoptosis enhancement of A549/miR-100 cells (Figure 6B-C). [score:3]
By statistical analyses, we showed that low miR-100 expression was closely correlated with higher clinical stage, advanced tumor classification and lymph node metastasis (P = 0.005, 0.013 and 0.001, respectively). [score:3]
The mean miR-100 expression level (△Ct) was −4.527 ± 1.04 for NSCLC tissues (n = 10) and −9.878 ± 1.33 for corresponding nontumor tissues (n = 10); this difference was statistically significant with a P-value of <0.01 (Figure 1B). [score:3]
Effects of miR-100 expression on growth, apoptosis and cell cycle of NSCLC cells. [score:3]
Also, miR-100 mimics could lead to growth inhibition, G [2]/M cell cycle arrest and apoptosis enhancement in NSCLC cells. [score:3]
Association between miR-100 expression and clinicopathological features of NSCLC patients. [score:3]
From these data, it was concluded that miR-100 could inhibit growth of NSCLC cells by modulating apoptosis and cell-cycle distribution. [score:3]
PLK1 is a functional target of miR-100 in NSCLC. [score:3]
In other cancers, PLK1 has been reported to be a functional target of miR-100. [score:3]
Additionally, the expression of miR-100 in 110 NSCLC tissues and its correlation with clinicopathological factors or prognosis of patients was analyzed. [score:3]
Figure 1 Taqman real-time quantitative analysis of miR-100 expression in tissue samples. [score:3]
Figure 3 Effects of miR-100 mimics or inhibitor on growth, apoptosis and cell cycle of NSCLC cells. [score:3]
The mean miR-100 expression level (△Ct) was −6.218 ± 1.53 for NSCLC tissue (n = 110). [score:3]
Association of miR-100 expression with clinicopathological features of NSCLC patients. [score:3]
By performing in-silico screening using TargetScan, we found that the 3’-UTR of PLK1 gene contained binding sites for miR-100 with reasonable scores. [score:3]
Then, we analyzed the effect of miR-100 expression on apoptosis of NSCLC cells (Figure 3C). [score:3]
Moreover, we found that pcDNA/PLK1 -mediated overexpression of PLK1 could partially reverse the G [2]/M phase cell cycle arrest of A549/miR-100 cells (Figure 6D). [score:3]
48h after pcDNA/PLK1 or pcDNA/control vector was transfected into A549/miR-100 cells, the expression levels of PLK1 mRNA and protein were determined. [score:3]
As shown in Figure 6A, pcDNA/PLK1 could rescue the decreased mRNA and protein expression in A549/miR-100 cells. [score:3]
These results suggested that overexpression of PLK1 could rescue the effects of ectopic miR-100 on phenotypes of NSCLC cells. [score:3]
The disease-free survival showed between NSCLC patients with low miR-100 and those with high miR-100, but the overall survival of patients with high miR-100 was higher than that of patients with low miR-100. [score:3]
As the number of patients in the present study is small, further study of a larger case population is necessary to confirm the clinical significance of miR-100 expression in NSCLC. [score:3]
Multivariate analysis using the Cox proportional hazard mo del indicated that the status of lymph node metastasis and the level of miR-100 expression were independent prognostic factors for NSCLC patients (P = 0.036 and 0.008, respectively; Table 1). [score:3]
MiR-100 was significantly downregulated in NSCLC tissues compared with corresponding nontumor tissues. [score:2]
Compared with that in A549/anti-miR-100 cells, the level of miR-100 expression in A549/anti-miR-100 cells was also significantly decreased by approximately 54.3% (P < 0.05). [score:2]
Real-time quantitative RT-PCR assay was performed to detect the expression of miR-100 in 10 NSCLC tissues and corresponding nontumor tissues. [score:2]
However, the functions of RBSP3 and its correlation with posttranscriptional regulation of miR-100 in NSCLC are unclear and remains to be elucidated in future research. [score:2]
Taqman real-time quantitative RT-PCR assay was performed to detect miR-100 expression 10 NSCLC tissues and corresponding nontumor tissues. [score:2]
As shown in Figure 3A, the level of miR-100 expression in A549/miR-100 cells was significantly increased by approximately 586.7% compared with A549/miR-NC cells (P < 0.01). [score:2]
By firefly luciferase activity assay, miR-100 could inhibit luciferase activity in the PLK1 WT but had no effect in the mutant construct. [score:2]
48 h after transfection with miR-100/mimics (or miR-NC/mimics) or anti-miR-100 (or anti-miR-NC), Real-time quantitative RT-PCR assay was performed to detect the expression of miR-100 in A549 cells. [score:2]
Sequence analyses revealed that the 3’-UTR of PLK1 mRNA contains a putative site partially complementary to miR-100. [score:1]
Sequence analyses revealed that the 3’-UTR of PLK1 mRNA contains a putative site partially complementary to miR-100 (Figure 4A). [score:1]
In the present study, we firstly found that miR-100 was significantly lower in NSCLC tissues than in corresponding nontumor tissues. [score:1]
Association of miR-100 with prognosis of NSCLC patients. [score:1]
This raises the possibility that anti-miR-100 may have potential therapeutic value for NSCLC. [score:1]
While the goal of this study was to better understand miR-100 function in NSCLC, future research is required to address the therapeutic potential of modulating miR-100. [score:1]
Next, the effects of miR-100 expression on malignant phenotypes of NSCLC cells were investigated. [score:1]
The association of miR-100 expression with prognosis of NSCLC patients was also investigated by Kaplan-Meier analysis and log-rank test. [score:1]
Our results showed that low miR-100 might be a poor prognostic factor for NSCLC patients. [score:1]
MiR-100 mimics (or anti-miR-100) and their negative control oligonucleotides (miR-NC or anti-miR-100) were obtained from Ambion Inc (Austin, TX, USA). [score:1]
Likewise, the percentage of S stage cells showed no difference between A549/anti-miR-NC and A549/anti-miR-100 cells. [score:1]
[1 to 20 of 96 sentences]
4
[+] score: 292
Despite the fact that isolated (low) GFP cells (V [miR-100]) had two to three-fold higher miR-100 expression than control (V [cont]) or endogenous miR-100 expression in GBM (Figure 4A), this expression level was significantly below the endogenous miR-100 level in control astrocytes (Figure 4A). [score:7]
Overexpression of miR-100 and specific SMRT/NCOR2 targeted inhibition relating to tumor proliferation and apoptosis in vitro, and in vivo observations of reduced tumor size and improved animal tumor mo del survival were shown. [score:7]
Although GFP expression indicated vector activation, amplified expression of miR-100 was also directly confirmed quantitatively by qPCR. [score:6]
In a differential microRNA profiling analysis of GBM against non-tumor cell lines, miR-100 was one of the top down-regulated miRNAs (data not shown), and QPCR assays confirmed the low endogenous miR-100 expression in all four GBM lines (Figure 1A). [score:5]
3B), and high GFP (and miR-100) -expressing cells not used to avoid miR-100 overexpression-related apoptosis. [score:5]
Candidate mRNA targets of has-miR-100 ID of each transcripts PhastCons score mirSVR score TMPRSS13 NM_001077263 0.65 -1.29 SMARCA5 NM_003601 0.73 -1.27 ANKAR AK058144 0.71 -1.26 NCOR2 (SMRT) NM_006312 0.64 -1.24 These were the top 4 out of 1389 targets predicted by microRNA. [score:5]
Although a survival advantage for mice implanted with 22T V [miR-100] was not observed (P = 248; n=8/group), we hypothesized that higher miR-100 expression (>100 fold, and closer to miR-100 expression in normal cells) may be needed to significantly improve survival. [score:5]
Cell death has been prevented when SMRT/NCOR2 was overexpressed together with miR-100 overexpression. [score:5]
To test in vivo effects of miR-100 expression, an expression vector of tetracycline-inducible promoter linked to miR-100 and GFP genes was created. [score:5]
The isolated low-medium miR-100 expressing cell lines showed two to three-fold higher expression than in untransfected GBM cells (Figure 4A). [score:5]
Rescue of SMRT/NCOR2 inhibition by overexpressing it (with a vector) in the presence of miR-100 significantly reduced cell death up to 100% (Figure 3, A & B). [score:5]
Since we identified SMRT/NCOR2 as a target for miR-100 inhibition, tumor xenograft brain sections were immuno-labeled with anti-SMRT/NCOR2 and anti-Ki-67 (Figure 4, C & E). [score:5]
Therefore, although we first identified miR100 down-regulation via microarray analysis of GBM cells isolated via serum-free media (Figure S1), the clinical applicability of our results will be further supported if verified in planned experiments with serum-free, stem cell media cultured GBM lines. [score:4]
In this work, microRNA profiling analysis of human GBM against human non-tumor cell lines, miR-100 was one of the top down-regulated microRNAs. [score:4]
miR-100 is down-regulated in GBM. [score:4]
This reporter assay confirmed miR-100’s ability to directly inhibit SMRT/NCOR2 expression, compared to control microRNAs (P < 0.01; Figure 1D; Supp. [score:4]
To examine the possibility that therapeutic miR-100 effects required much higher expression levels, a cohort of sixteen mice were implanted with native (22T) tumor xenografts that were then challenged with direct orthotopic injection of miR-100 or control miR. [score:4]
Proliferation was partially inhibited (30% -50%) by miR-100 overexpression compared to control miR (P < 0.05; n=3/line; Figure 1C). [score:4]
SMRT/NCOR2 (silencing mediator of retinoid or thyroid receptor) was identified in silico as a candidate miR-100 regulated target gene (Supp. [score:4]
Overall, we report data showing anti-tumor role for miR-100 in GBM, and reveal that regulation of miR-100 levels, plus SMRT/NCOR2 and associated downstream pathways (e. g. HDAC3) are potential therapeutic targets for GBM. [score:4]
Over-Expression of miR-100 Reduces Proliferation. [score:3]
Western blot analysis of SMRT/NCOR2 – Silencing mediator of retinoic acid and thyroid hormone receptor – (also known as NCOR2) in both miR-100 transfected cells and scramble miR controls revealed an average of 50% higher SMRT/NCOR2 expression in scramble miR transfection controls (P < 0.01; n=3; Figure 1E; Supp. [score:3]
Western blot analysis showed an average 50% reduction in SMRT/NCOR2 protein level in four GBM cell lines after miR-100 overexpression, and congruent results were obtained with siSMRT/NCOR2 (Figure 1E). [score:3]
miR-100 decreases GBM proliferation and targets SMRT/NCOR2. [score:3]
TaqMan real-time PCR assays were used to confirmed miR-100 down-regulation. [score:3]
Microarray analysis comparing miR100 expression in two independent human GBM specimens cultured in stem cell media conditions with human neural stem cells (hNSCs). [score:3]
22T GBM-derived lines stably transfected with a doxycycline-inducible miR-100-GFP lentiviral vector were isolated that exhibit low/medium GFP expression after 24 hours of induction for further analysis (Supp. [score:3]
Figure S4 Western blot of reduced SMRT protein when miR-100 was over expressed. [score:3]
Moreover, miR-100 overexpression via therapeutic tumor injection improved animal survival. [score:3]
Luciferase reporter activity was inhibited more than fifty percent (P < 0.01; n=3) in the presence of miR-100, but unaffected when the miR-100 seed sequence in the 3’UTR reporter was mutated. [score:3]
All GBM lines showed significantly lower miR-100 expression. [score:3]
V [miR-100] (22T and U251) had (40% and 60%) less Ki-67 labeling, respectively, suggesting induction of miR-100 expression reduced in vivo tumor cell proliferation (P < 0.01; n=3/group; Figure 4F). [score:3]
Luciferase reporter assays were performed to assess whether miR-100 directly inhibits SMRT/NCOR2. [score:3]
Transient miR-100 overexpression in all GBM lines show reduced cell growth by an average of 50% (Figure 1B). [score:3]
Xenograft mo dels were created by implanting modified 22T GBM cells expressing inducible low/medium miR-100-GFP, or 22T GBM cells transfected with control vector (inducible GFP only). [score:3]
SMRT/NCOR2 is one of the top four predicted miR-100 targets at microrna. [score:3]
After confirming miR-100 over -expression in transfected GBM (Supp. [score:3]
0080865.g001 Figure 1 (A) Quantitative PCR showed native miR-100 expression in multiple GBM tumor lines relative to normal control (astrocyte extracted from non-tumor brain). [score:3]
In this work, the therapeutic utility of miR-100 over -expression was tested and shows reduced GBM proliferation and improved survival in a mouse xenograft mo del. [score:3]
Patient-derived GBM (22T and 33T) and standard laboratory GBM lines (U87 and U251) exhibited low endogenous miR-100 expression. [score:3]
QPCR confirmed miR-100 overexpression in miR-100 transfected cells (Figure S3A). [score:3]
Ten thousand cells were plated for 24 hours and then treated with miR-100, control miRs, or miR-100 in combination with SMRT/NCOR2 expression vector (pSMRT; Fisher Scientific). [score:3]
miR-100 Expression Vector. [score:3]
Tumor proliferation was markedly reduced and GBM apoptosis was induced by miR-100 expression above endogenous GBM levels. [score:3]
SMRT/NCOR2 Gene is targeted by miR-100. [score:3]
Altered miR-100 expression was confirmed with quantitative polymerase chain reaction (qPCR) in four GBM lines (serum cultured patient-derived primary GBM lines (22T, 33T) and two standard laboratory GBM lines (U251, U87)). [score:3]
Our data suggested that miR-100 acts as ‘anti-tumorigenic’ and we tested whether miR-100 over -expression reduces tumorigenicity. [score:3]
In silico analysis showed that SMRT/NCOR2 is one of the top targets of miR-100, which was confirmed experimentally. [score:3]
In addition, Liu et al. displayed miR-100 as tumor suppressor and clinical marker for high tumor stage in non-small cell lung cancer [19]. [score:3]
The two to three fold higher miR-100 expression (compared to endogenous GBM miR-100 expression) showed significantly reduced tumor proliferation activity, (shown by Ki-67 assay), but did not lead to a statistically significant improvement in survival (P = 0.248; n=8). [score:3]
Upon addition of doxycycline, low to medium GFP (and miR-100) -expressing cells were collected via flow cytometry (Supp. [score:3]
The low-medium expressing miR-100 cells were implanted orthotopically into mouse brains to generate tumor xenografts. [score:3]
In conclusion, this study provides strong evidence that miR-100 activity inhibits GBM tumorigenicity in vitro and in vivo. [score:3]
Top 4 predicted hsa-mir-100 mRNA targets from microRNA. [score:3]
Figure S1 Identification of altered miR-100 expression in glioblastoma. [score:3]
Then, animals were treated with doxycycline (10 mg/kg) to induce miR-100 expression from integrated vectors starting 8 days after implantation, and administered every other day at until animals were moribund or sacrificed. [score:3]
Luciferase reporter assays showed that miR-100 specifically inhibited luciferase-SMRT/NCOR2 3’UTR activity, and suggested a direct relationship between SMRT/NCOR2 and miR-100 (Figure 1D). [score:3]
SMRT levels was reduced when both siSMRT and pre-miR-100 were overexpressed, n=3. [score:3]
Significant miR-100 down-regulation was detected in multiple patient-derived and established GBM cell lines compared to control, non-tumor brain cells, thus suggesting anti-oncogenic role for miR-100. [score:3]
The therapeutic potential of miR-100 to suppress GBM proliferation and improve survival was explored in this study. [score:3]
Since similar patterns with all cell lines were observed in pilot experiments, we chose to focus on creating one tumor line (22T) with stable inducible miR-100 expression for animal experiments. [score:3]
Both transient miR-100 over -expression and siSMRT/NCOR2 activity introduced a minimum of 70% more cell death than controls in all cell lines tested (Figure 2, A & B). [score:3]
Doxycycline was administered every other day to induce miR-100 expression starting eight days after implantation when tumor was detectable on MRI. [score:3]
Simultaneous overexpression of both miR-100 and SMRT/NCOR2 eliminated proliferation bias produced by miR-100 elevation. [score:3]
Stable transfected GBM cell lines harboring an inducible miR-100 expression vector (miR-100 at two-three fold higher level than endogenous GBM levels) showed marked reduction of both Ki-67 proliferation by 40%, and SMRT/NCOR2 level by 70% in tumor xenografts. [score:3]
In lung and colon cancer studies, miR-100 dysregulation was linked to cancer progression [18, 19]. [score:2]
0080865.g004 Figure 4(A) Treatment of 22T GBM cells with a miR-100 expressing vector (V [miR-100]) increased miR-100 levels by 3-fold compared to control vector (V [cont]) treated cells. [score:2]
0080865.g003 Figure 3 (A) Treatment with both pre-miR-100 and SMRT/NCOR2 (pSMRT/NCOR2) overexpression prevented avoided induced cell death as shown by TUNEL staining compared to pre-miR-100 alone. [score:2]
Experiments with single dose miR-100 injection directly into tumor xenografts were performed with two implanted GBM lines (22T and U87). [score:2]
Mouse xenograft brain specimens (both groups harvested at equivalent times) were analyzed, grossly showing that xenografts induced for miR-100 expression were markedly reduced in growth and size (22T V [miR-100] compared to control 22T V [cont] samples; Figure 4B). [score:2]
Microarray analysis showed markedly decreased miR100 expression in two independent human GBM specimens cultured in stem cell media conditions compared to human neural stem cells (hNSCs) (Supp. [score:2]
Compared to control astrocyte cells derived from brains free of malignancy, all four GBM lines show an average 70% lower level of miR-100 expression (P < 0.01; n=3/line; Figure 1A). [score:2]
After GBM implantation, mice were imaged with MRI starting at day 8. After detecting tumor xenografts at least 0.5 cm in size, 60 pmoles of miR-100 precursor or control miR were directly injected into xenografts. [score:2]
Animals harboring miR-100 expressing xenografts did not have a significantly longer survival compared to the control group (p = 0.248). [score:2]
In addition, EdU assay illustrated reduced proliferation with miR-100 overexpression by 40% in all GBM lines. [score:2]
Interestingly, both miR-100 overexpression and SMRT/NCOR2 silencing showed increased GBM apoptosis via TUNEL assay. [score:2]
To assess whether the doxycycline -induced three-fold increase in miR-100 expression influenced animal survival, a cohort of xenografted mice with either V [miR-100] or V [cont] were treated with doxycycline in a survival assay. [score:2]
This is consistent with an anti-oncogenic role for miR-100 in GBM. [score:1]
The same pattern was seen with miR-100 transfected cells (P < 0.01; n=3; Figure 2, A & B). [score:1]
Figure S2 miR-100 predicted binding. [score:1]
miR-100 improves survival. [score:1]
microRNA-100 precursor, siRNA (silencer)/siSMRT, and control miR (non-specific microRNAs) were purchased from Life Technologies (formerly Invitrogen). [score:1]
In xenografts, more SMRT/NCOR2 was seen in control (V [cont]) brain than V [miR-100] brain. [score:1]
More Ki-67 staining was seen in control (V [cont]) brain than V [miR-100] brain. [score:1]
Transfections with miR-100, siSMRT/NCOR2 or control miR were done the next morning. [score:1]
Inducible test vectors with miR-100 and GFP genes (V [miR-100]) and control vectors (V [cont. ]) [score:1]
miR-100 induces cell death. [score:1]
miR-100 decreases tumor size. [score:1]
Scramble (control miR) and miR-100 microRNAs were used at 15 pmoles per 500k cells. [score:1]
The inducible miR-100/GFP vector integrated into tumor cell genomes via lentiviral transfection. [score:1]
Group over the V [miR-100] group. [score:1]
Inspection of mouse brains grossly after death showed larger xenografts in the control mice than tumors in the miR-100 group (Figure 4B). [score:1]
No further miR treatment was given and survival analysis showed that a single dose of pre-mir-100 extended survival 25% more than untreated controls (P < 0.01; n=8/gp; Figure 5, C & D). [score:1]
Since GBM cells are highly invasive in humans and grow rapidly in culture, miR-100’s effect on GBM proliferation was tested via partially restoring miR-100 activity through transient transfection. [score:1]
0080865.g005 Figure 5 (A) T1 gadolinium enhanced MRI show smaller tumor xenografts after miR-100 treatment versus control miR treatment. [score:1]
0080865.g002 Figure 2 (A) Treatment with either pre-miR-100 or SMRT/NCOR2 siRNA (siSMRT/NCOR2) induced cell death as shown by TUNEL staining. [score:1]
miR-100 reduces tumor mass and improves prognosis. [score:1]
Recently, miR-100 was reported to have anti-angiogenic function through mTOR signaling repression in endothelial cells [18]. [score:1]
The SMRT/NCOR2 3’UTR is 1052nt long and the miR100 seed sequence is located from 665 to 676nt. [score:1]
Figure S3 Quality control of miR-100 transfection and isolation of stable miR-100 transfectants. [score:1]
An orthotopic xenograft mo del was used to test in vivo miR-100 effects. [score:1]
60 pmoles of microRNA-100 or control microRNA were injected at previously reported stereotactic coordinates used for tumor cell implantation [23, 33]. [score:1]
The following were designed and ordered from Genecopoeia (Rockville, MD): an inducible DNA construct (pEZ-lv201 backbone) containing miR-100 and GFP coding sequences, and a control vector that did not contain miR-100 coding sequence. [score:1]
One had the 3’UTR of SMRT mRNA with miR100 seed sequence, while this was mutated in the negative control. [score:1]
Then, miR-100 microRNA precursors were transfected. [score:1]
This is consistent with an anti-oncogenic role for miR-100 in GBM (Figure 1C). [score:1]
The miR-100 -injected xenografts were smaller on MRI than the control miR -injected xenografts (Figure 5A). [score:1]
exhibited up to 70% and 40% more SMRT/NCOR2 label than 22T and U251 V [miR-100] xenografts, respectively (Figure 4 C & D). [score:1]
The miR-100 group showed significantly reduced tumor progression, while control miR treatment did not alter tumors (Figure 5A). [score:1]
Precursors of miR-100 (pre-miR-100) were transiently transfected into the four GBM lines (22T, 33T, U251, U87) following overnight serum starvation. [score:1]
org algorithm for hsa-miR-100. [score:1]
Both vectors were co -transfected with pre-miR-100 or control miRs. [score:1]
Therefore these data suggest that miR-100 has anti-tumor effect by modulating SMRT/NCOR2. [score:1]
[1 to 20 of 113 sentences]
5
[+] score: 291
To explore the role of miR-100 in regulating apoptosis of breast cancer, the expression levels of miR-100 in different breast cancer cell lines were examined, including MCF7, MDA-MB-453, T47D, HCC1954, SUM149 and SK-BR-3. The results showed that miR-100 was significantly upregulated in SK-BR-3 cells and downregulated in MCF7, MDA-MB-453, T47D, HCC1954 and SUM149 cells (Fig. 1A), suggesting that the miR-100 -mediated apoptotic pathway might be different in various cancer cells. [score:10]
However, the silencing or overexpression of miR-100 took no effect on the MTMR3 expression in the miR-100 -downregulated breast cancer cells (MCF7, MDA-MB-453, T47D, HCC1954 and SUM149) (Fig. 3E). [score:8]
This indicated that miR-100 negatively regulated p27 expression by targeting MTMR3, which suggested that the interaction between miR-100 and MTMR3 was associated with cell cycle regulation and apoptosis. [score:7]
In SK-BR-3 cells, miR-100 was upregulated, but was downregulated in MCF7, T47D, HCC1954, SUM149 and MDA-MB-453 cells. [score:7]
As previously reported 20, miR-100 could target the SMARCA5 gene in MCF7 and HMLE cells, in which miR-100 was downregulated. [score:6]
The effects of miR-100 on the tumourigenesis of breast cancer in vivoIn the miR-100 -downregulated breast cancer cells, the previous study has revealed that miR-100 can suppress tumuorigenesis in vivo 20. [score:6]
In the miR-100 -downregulated breast cancer cells, the previous study has revealed that miR-100 can suppress tumuorigenesis in vivo 20. [score:6]
In SK-BR-3 cells, miR-100 inhibited apoptosis by negatively regulating the expression of MTMR3. [score:6]
The results showed that MTMR3-siRNA could reduce the apoptosis caused by inhibiting miR-100, as indicated by a reduction of the pro-apoptotic proteins Bax and Bcl-2 (Fig. 4F), suggesting that targeting of MTMR3 by miR-100 directly contributed to SK-BR-3 cell proliferation. [score:6]
It was revealed that miR-100 knockdown resulted in a significant upregulation of MTMR3 mRNA and its encoded protein in SK-BR-3 cells (Fig. 3D). [score:5]
In addition, the target gene prediction indicated that MTMR3 was a target of miR-100 (Fig. 3B). [score:5]
The data were consistent with the expression profiles in breast cancer cells (Fig. 1A), suggesting that MTMR3 was a target gene of miR-100 in SK-BR-3 cells. [score:5]
Therefore, miR-100 silencing inhibited the expression of active cyclin B and active CDK1, leading to the cell cycle arrest at the G2/M phase in SK-BR-3 cells. [score:5]
The targets of miR-100 were predicted using Targetscan 31, miRanda 32, Pictar 33 and miRInspector 34 algorithms. [score:5]
Conversely, miR-100 overexpression led to a significant decrease of MTMR3 expression in SK-BR-3 cells (Fig. 3D). [score:5]
These data indicated that miR-100 was specifically upregulated in SK-BR-3 cells and its function in regulating apoptosis was different in various breast cancer cells. [score:5]
The SK-BR-3 cells were co -transfected with miExpress-miR-100 (miR-100) or miExpress plasmid (vector only) and MTMR3 3′UTR or MTMR3 3′UTR-mutant. [score:5]
The results showed that the growth of SK-BR-3 cells was significantly inhibited by AMO-miR-100 treatment, compared with the control AMO-miR-100-scrambled, and that the inhibition was dose -dependent (Fig. 6A). [score:4]
Both active cyclin B and inactive phospho-cyclin B were decreased when the expression of miR-100 was knocked down (Fig. 4D). [score:4]
This indicated that the downregulation of miR-100 sensitized breast cancer cells to chemotherapy. [score:4]
The differential expression of miR-100 suggested that the role of miR-100 in regulating apoptosis might be different in various breast cancer cells. [score:4]
The results revealed that the expression of miR-100 was significantly reduced by AMO-miR-100 (Fig. 2E), which suggested that the reduced tumour development resulted from miR-100 silencing. [score:4]
This indicated that miR-100 antagonism could inhibit the development of breast cancer in vivo. [score:4]
A dual luciferase reporter assay, in which the wild-type MTMR3 3’UTR was expressed with luciferase, revealed that miR-100 could significantly decrease the expression of luciferase. [score:4]
However, the miR-100 silencing had no effect on the cell viability of MCF7, MDA-MB-453, T47D, HCC1954 and SUM149 cells, in which miR-100 was downregulated. [score:4]
Considering the differential expression of miR-100 and the miR-100 -mediated apoptotic pathways, the role of miR-100 in regulating apoptosis of breast cancer was different in various breast cancer cells. [score:4]
The effects of miR-100 downregulation on chemotherapy of breast cancer. [score:4]
To knock down the expression of miR-100, the breast cancer cells were transfected with anti-miRNA-100 oligonucleotide (AMO-miR-100), respectively. [score:4]
To screen for the target genes of miR-100, Human Genome U133 Plus 2.0 Array (Affymetrix California, USA) was used. [score:3]
The apoptotic target of miR-100 in breast cancer cells. [score:3]
To explore the miR-100 -mediated apoptotic-signalling pathway in breast cancer cells, the target genes of miR-100 were screened using a DNA microarray. [score:3]
Interestingly, the overexpression of miR-100 had a slight stimulatory effect on cell growth in SK-BR-3 cells, while seriously damaging other breast cancer cells (Fig. 1F). [score:3]
Therefore, miR-100 antagonism could inhibit tumourigenesis of SK-BR-3 cells in vivo. [score:3]
In this study, the results indicated that silencing miR-100 triggered apoptosis in SK-BR-3 cells, leading to the suppression of tumour cell growth in vitro and in vivo. [score:3]
At different times after transfection, the cells were subjected to real-time PCR to detect miR-100 and the effects of miR-100 overexpression on cell proliferation were analysed. [score:3]
Screening for miR-100 target gene with DNA microarray. [score:3]
The results suggested that MTMR3 (myotubularin related protein 3) might be a target gene of miR-100 (Fig. 3A). [score:3]
Target gene prediction of miR-100. [score:3]
To evaluate the effect of miR-100 silencing on p27 expression, SK-BR-3 cells were treated with AMO-miR-100 and p27 expression was analyzed. [score:3]
This study revealed that the antagonism of miR-100 mediated the apoptosis of SK-BR-3 cells by triggering the MTMR3- p27 pathway, as miR-100 suppressed the MTMR3 gene. [score:3]
After transfection of miR-100 precursor or negative control AMOs, the levels of MTMR3 gene expression were detected by quantitative real-time PCR and western blot. [score:3]
The results of our study suggest that miR-100 could be a promising target for the treatment of breast carcinoma, because miR-100 silencing could significantly prevent growth by inducing cell cycle arrest and apoptosis in breast cancer cells. [score:3]
The target gene of miR-100. [score:3]
In this context, miR-100 targeted different genes in various breast cancer cells. [score:3]
AMO-miR-100 or AMO-miR-100-scrambled was transfected into SK-BR-3 cells, followed by detection of miR-100 expression using real-time PCR at 48 h after transfection. [score:3]
The expression level of MTMR3 in different cell lines was examined with quantitative real-time PCR after treated with AMO-miR-100 or miR-100 precursor. [score:3]
To examine the expression of miR-100 in mice treated with AMO-miR-100 or AMO-miR-100-scrambled, the total RNAs from the solid tumours were extracted and real-time PCR was performed. [score:3]
In this study, miR-100, a highly conserved miRNA in animals 26, was found to be involved in breast cancer tumourigenesis that functioned by inhibiting the apoptotic activity of SK-BR-3 cells. [score:3]
In our study, U6 was used as an endogenous standard to normalize the miR-100 expression level in breast cancer cells, while RNU24 was used to normalize the quantitative real-time PCR data in the previous study 27. [score:3]
The expression level of miR-100 in different cell lines including SK-BR-3, T47D, SUM149, HCC1954, MDA-MB-453 and MCF7 was examined with quantitative real-time PCR. [score:3]
It was found that miR-100 expression was specifically reduced by AMO-miR-100 (Fig. 1B). [score:3]
SK-BR-3 cells were transfected with AMO-miR-100 and MTMR3-siRNA and the expression of MTMR3 and the apoptotic proteins Bax and Bcl-2 were detected by western blot. [score:3]
In addition, miR-100 (5′-AAC CCGUAGAUCCGAACUUGUG-3′) was cloned into a miExpress vector (Genecopoeia, USA). [score:3]
As reported, miR-100 could target the SMARCA5 gene in MCF7 and HMLE cells 20, suggesting that the apoptotic pathway mediated by miR-100 was different in various breast cancer cells. [score:3]
The expression of miR-100 was significantly increased in miR-100 precursor transfected cells relative to cells transfected with the miR-100 negative control (Fig. 1F). [score:3]
Taken together, the findings demonstrated that miR-100 significantly inhibited the MTMR3-p27 signalling pathway and thereby prevented cell cycle arrest and apoptosis of SK-BR-3 cells (Fig. 5). [score:3]
These results suggested that miR-100 was involved in tumour development in vivo. [score:2]
However, miR-100 has the opposite role in regulating other types of breast cancer cells 27 28. [score:2]
These findings indicated that miR-100 had an important role in the regulation of apoptosis of SK-BR-3 cells. [score:2]
The role of miR-100 in the regulation of apoptosis in breast cancer cells. [score:2]
Silencing miR-100 led to a significant decrease in cell viability and a significant increase in caspase 3/7 activity in SK-BR-3 cells compared with controls (Non -treated and AMO-miR-100-scrambled) (Fig. 1C,D), indicating that miR-100 was involved in inhibiting apoptosis of breast cancer cells. [score:2]
Chemotherapy treatment of miR-100 knockdown breast cancer cells. [score:2]
This indicated the existence of a direct interaction between miR-100 and MTMR3 mRNA. [score:2]
This indicated that miR-100 knockdown resulted in cell cycle arrest. [score:2]
A mo del demonstrating how miR-100 regulates cell cycle arrest at the G2/M phase and apoptosis in SK-BR-3 cells. [score:2]
How to cite this article: Gong, Y. et al. The role of miR-100 in regulating apoptosis of breast cancer cells. [score:2]
The involvement of miR-100 in the regulation of apoptosis in breast cancer cells. [score:2]
The expression levels of miR-100 in the solid tumours were measured by real-time PCR. [score:1]
The SK-BR-3 cells were transfected with AMO-miR-100 or AMO-miR-100-scrambled. [score:1]
SK-BR-3 cells were transfected with AMO-miR-100 or AMO-miR-100-scrambled and at 48 h after transfection the cells were subjected to real-time PCR (left) and western blot (right). [score:1]
AMO-miR-100-scrambled (5′-GT CGG TTC TGA TGT CA-3′) was synthesized using the same modifications as above. [score:1]
The SK-BR-3 cells were co -transfected with miR-100 and a luciferase reporter fused with MTMR3 3′UTR and firefly and renilla luciferase activities were analysed. [score:1]
The sequence of AMO-miR-100 was 5′-TT CGG ATC TA C GGG TT-3′, which was modified with locked nucleic acids (LNA; old letters), 2’-O-methyl (OME; Italic letters) and phosphorothioate (the remaining nucleotides). [score:1]
Tumour development was significantly reduced in mice treated with AMO-miR-100, compared with mice treated with the control (AMO-miR-100-scrambled) (Fig. 2B). [score:1]
SK-BR-3 cells were injected into nude mice and 10 d later AMO-miR-100-scrambled or AMO-miR-100 was subcutaneously and intravenously injected into mice. [score:1]
In our study, miR-100 silencing triggered the MTMR3- p27 pathway and the activation of p27 induced the cleavage of poly-(ADP-ribose) polymerase, the accumulation of Bax and Bcl-2 and reduced cyclin B-CDK1 complexes, all of which are key proteins in apoptosis and G2/M cell cycle arrest. [score:1]
The effects of miR-100 silencing on breast cancer chemotherapy. [score:1]
To reveal the effects of miR-100 silencing on the efficacy of chemotherapy, SK-BR-3 cells were simultaneously treated with AMO-miR-100 and Cisplatin, a drug wi dely used for cancer chemotherapy, which can induce apoptosis by causing DNA damage. [score:1]
SK-BR-3, MCF7, HCC1954, MDA-MB-453, T47D and SUM149 cells were transfected with the miR-100 precursor or a negative control. [score:1]
The miR-100 -mediated signalling pathway for apoptosis of breast cancer cells. [score:1]
The miR-100 -mediated signalling pathway for apoptosis of breast cancer. [score:1]
The effects of miR-100 on tumourigenesis were inconsistent in different breast cancer cells. [score:1]
Silencing miR-100, therefore, induced cell cycle arrest and apoptosis of SK-BR-3 cells. [score:1]
SK-BR-3 cells were treated with AMO-miR-100 or AMO-miR-100-scrambled at different concentrations. [score:1]
Ten d later, when the tumour volume was around 12.5 mm [3], mice were injected via the lateral tail vein with 80 mg/kg of AMO-miR-100 or AMO-miR-100-scrambled every 3 days. [score:1]
This suggested that miR-100 silencing could promote Cisplatin -induced apoptosis. [score:1]
To reveal the role of miR-100 in the cell cycle, the cell cycle of AMO-miR-100 -treated SK-BR-3 cells was analysed. [score:1]
SK-BR-3 cells were transfected with AMO-miR-100 or AMO-miR-100-scrambled. [score:1]
Knockdown of miR-100 resulted in significant increases of p27 mRNA and the encoded protein when compared with non -treated cells (Fig. 4A). [score:1]
This study revealed a novel miR-100 -mediated pathway that prevented apoptosis of breast cancer cells. [score:1]
Solid tumours treated with AMOs were subjected to real-time PCR to evaluate the miR-100 expression level. [score:1]
In this investigation, however, the miR-100 expression level in SK-BR-3 cells was different from the previous data 27. [score:1]
The cells were then transfected with AMO-miR-100 or AMO-miR-100-scrambled at a final concentration of 50 mM. [score:1]
The effects of miR-100 on the tumourigenesis of breast cancer in vivo. [score:1]
The effect of miR-100 silencing on tumour volume (C) and weight (D). [score:1]
In this study, to evaluate the effects of miR-100 -mediated apoptosis regulation on breast cancer tumourigenesis in vivo, SK-BR-3 cells were injected into nude mice, which were further treated with AMO-miR-100 or AMO-miR-100-scrambled and tumour development was monitored (Fig. 2A). [score:1]
The effects of miR-100 on the tumourigenesis of breast cancer cells in vivo. [score:1]
The percentage of cells in the G2/M phase following treatment with AMO-miR-100 was significantly higher than cells treated with AMO-miR-100-scrambled (Fig. 4C). [score:1]
The miR-100 precursor and the negative control were purchased from Applied Biosystem (USA). [score:1]
In addition, the volume and weight of tumours was significantly lower in mice treated with AMO-miR-100 (Fig. 2C,D). [score:1]
To evaluate the effects of miR-100 overexpression on breast cancer cells, the miR-100 precursor was transfected into breast cancer cells. [score:1]
In addition, our study showed that miR-100 antagonism could sensitize breast cancer cells to chemotherapy, suggesting that the efficacy of chemotherapy could be improved with less toxicity. [score:1]
To further confirm the role of the miR-100- MTMR3 interaction in mediating apoptosis of SK-BR-3 cells, we transfected cells with AMO-miR-100 and a MTMR3 specific siRNA. [score:1]
Annexin V assays revealed that suppressing miR-100 increased the proportion of cells in early apoptosis of SK-BR-3 cells, when compared with the control (AMO-miR-100-scrambled) (Fig. 1E). [score:1]
The present investigation showed that the overexpression of miR-100 had a slight stimulatory effect on cell growth in SK-BR-3 cells, but seriously damaged other breast cancer cells. [score:1]
The SK-BR-3 cells were treated with AMO-miR-100 or AMO-miR-100-scrambled. [score:1]
[1 to 20 of 106 sentences]
6
[+] score: 273
Upregulation of miR-100 is found in gastric cancer and pediatric acute myeloid leukaemia [10, 11], whereas frequent downregulation of miR-100 occurs in various types of malignancies including HCC [12- 17], indicating the context -dependent effect of miR-100 in cancer development. [score:8]
Furthermore, we observed a correlation between p62 upregulation and miR-100 downregulation. [score:7]
Dual-luciferase reporter system showed that co-transfection of miR-100 significantly suppressed the activity of firefly luciferase reporter with the wild-type 3'UTR of mTOR or IGF-1R, whereas this effect was abrogated when the predicted miR-100 binding site at 3′UTR was mutated (Figure 5A, Supplementary Figure 3), suggesting that miR-100 may suppress gene expression by binding to the 3′UTR of mTOR or IGF-1R. [score:7]
Furthermore, the downregulation of miR-100 was correlated with the upregulation of p62 (Figure 3C), suggesting an in vivo pro-autophagy effect of miR-100. [score:7]
Figure 1 (A) Ectopic expression of miR-100 induced a significant accumulation of LC3B-II and downregulation of p62. [score:6]
miR-100 promotes autophagy by directly inhibiting the expression of mTOR and IGF-1R. [score:6]
In this study, we found that frequent downregulation of miR-100 was associated with reduced autophagy in human HCC tissues, and the restoration of miR-100 promoted the Atg7 -dependent autophagy and subsequent apoptotic cell death, and inhibited the in vivo growth of HCC cells. [score:6]
We showed that miR-100 directly suppressed the expression of mTOR and IGF-1R in HCC cells. [score:6]
We found that rapamycin, one of the mTOR inhibitors, caused Akt activation in a dose -dependent manner in HepG2 cells and the introduction of miR-100 significantly downregulated the level of active Akt in the rapamycin -treated cells (data not shown). [score:6]
The restoration of miR-100 expression resulted in significant accumulation of LC3B-II and downregulation of p62 protein in both HepG2 and Huh7 cells (Figure 1A). [score:6]
Considering the multiple inhibitory function of miR-100 on both IGF-1R and mTOR, we speculate that miR-100 may have more potent anti-tumor activity than mTOR inhibitors alone. [score:5]
We found that the restoration of miR-100 induced autophagy and led to cell death and in vivo growth inhibition of HCC cells, suggesting miR-100 as an attractive target for anti-cancer therapy. [score:5]
Figure 6Restoration of miR-100 expression promotes apoptotic cell death and inhibits in vivo tumor growth(A) miR-100 -induced autophagy led to massive cell death. [score:5]
Furthermore, overexpression of miR-100 inhibits the proliferation and promotes the apoptosis of lung cancer and acute lymphoblastic leukaemia cells [16, 17]. [score:5]
These results indicate that miR-100 induces autophagy in HCC cells by targeting mTOR and IGF-1R, although other unidentified targets may also be involved. [score:5]
Restoration of miR-100 expression promotes apoptotic cell death and inhibits in vivo tumor growth. [score:5]
To construct the miR-100 expression vector (pCDH-miR-100), a 514 bp DNA fragment encompassing the mature miR-100 sequence and its 5′- and 3′-flanking regions, was amplified and integrated into the EcoRI/ BamHI sites of pCDH-CMV-MCS-EF1-copGFP (System Biosciences, Mountain View, CA, USA, Supplementary Figure 7), a lentiviral vector that expresses fluorescent copGFP. [score:5]
The HepG2 subline with stable miR-100 expression (HepG2-pCDH-miR-100) and its control line (HepG2-pCDH-control) were established using the lentiviral expression system. [score:5]
In summary, our findings, based on clinical samples, cell and mouse mo dels, disclose a new regulatory mechanism of autophagy and a novel biological function of miR-100, and provide a potential molecular target for HCC therapy. [score:4]
PLK1, mTOR, IGF-1R, FKBP5 and RBSP3 have been identified as the direct targets of miR-100 [13, 15- 18]. [score:4]
Previous studies have identified mTOR and IGF-1R as the direct targets of miR-100 [22]. [score:4]
Figure 3(A) Downregulation of miR-100 in HCC tissues. [score:4]
Interestingly, the inhibition of Atg7 markedly attenuated the miR-100 -induced accumulation of LC3B-II in HepG2 cells (Figure 4B, lanes 1~4), whereas knockdown of Beclin-1 did not affect the level of miR-100-promoted autophagy (Figure 4B, lanes 5~6). [score:4]
Knockdown of mTOR and IGF-1R closely mimicked the autophagy-promoting effect of miR-100 overexpression in our cell mo dels. [score:4]
Our data highlight the importance of miR-100 in autophagy regulation, and the significance of miR-100 and autophagy deregulation in HCC development. [score:4]
Although abnormal miR-100 expression is frequently observed in various types of cancers, the biological outcome of miR-100 deregulation is largely cellular context -dependent. [score:4]
As shown, miR-100 was downregulated in the majority of HCC tissues (Figure 3A), with 13 out of 24 (54.2%) HCC tissues displaying a more than 50% reduction. [score:4]
To determine the role of Beclin-1 and Atg7 in the miR-100 -induced autophagy, siRNA approach was used to selectively knockdown the expression of Beclin-1 and Atg7 (Figure 4A). [score:4]
It is inspiring to find that a single miRNA may repress HCC development via multiple mechanisms, which makes miR-100 a promising target for anti-HCC therapy. [score:4]
Furthermore, frequent downregulation of miR-100 was associated with reduced autophagy in human HCC tissues. [score:4]
Notably, miR-100 was downregulated in the majority of examined cell lines (Supplementary Figure 1). [score:4]
To further confirm the autophagy-promoting effect of miR-100 in vivo, we detected the expression levels of miR-100 and p62 in the paired HCC and adjacent nontumor liver tissues. [score:3]
Furthermore, silencing of Atg7 expression or CQ-treatment significantly attenuated the cell death in miR-100-transfectants (Figure 6A). [score:3]
Figure 2(A) Overexpression of miR-100 increased the number and size of punctate LC3B aggregates. [score:3]
The mean level of miR-100 in nontumor tissues was set as relative expression 1. ***, P < 0.001. [score:3]
The stable expression of miR-100 was confirmed by qPCR and the immunofluorescent intensity of CopGFP was determined by flow cytometry (Gallios). [score:3]
However, overexpression of miR-100 did not affect the levels of Beclin-1 and Atg7, two critical autophagy-related molecules (Supplementary Figure 2). [score:3]
miR-100 expression was analyzed in 24 paired HCC (T) and adjacent nontumor (N) liver tissues by real-time quantitative PCR. [score:3]
In this study, we found that miR-100 promoted the Atg7 -dependent autophagy and subsequent apoptotic cell death by modulating the expression of IGF-1R and mTOR in HCC cells. [score:3]
Quantitative Real-Time PCR (qPCR) analysis for miR-100 expression. [score:3]
Figure 5(A) Overexpression of miR-100 repressed the activity of a luciferase reporter that contained the wild-type 3′UTR of mTOR or IGF-1R. [score:3]
It has been shown that miR-100 promotes the proliferation of acute myeloid leukaemia [18] but suppresses the proliferation of HCC, breast and bladder cancer cells [13- 15]. [score:3]
In addition, the restoration of miR-100 reduced the expression of cellular mTOR and IGF-1R proteins (Figure 5B, Supplementary Figure 4A), whereas the antagonism of endogenous miR-100 increased the level of mTOR and IGF-1R proteins in HepG2 (Figure 5C) and MHCC97-L cells (Supplementary Figure 4B). [score:3]
Establishment of the miR-100 stable -expressing HepG2 subline. [score:3]
Collectively, these data suggest that miR-100 may induce autophagy, at least partly, by repressing the expression of mTOR and IGF-1R. [score:3]
These data suggest that the autophagy induced by miR-100 may lead to cell death and thereby inhibitory tumor growth of HCC cells. [score:3]
Mouse xenograft mo dels revealed that the restoration of miR-100 inhibited the in vivo growth of HCC cells. [score:3]
Briefly, lentiviruses were generated by transiently co-transfecting HEK293T cells with the lentiviral expression vectors (pCDH-CMV-MCS-EF1-copGFP or pCDH-miR-100) and the lentivirus packaging vectors (pMD2. [score:3]
To uncover the effect of endogenous miR-100 on autophagy, HepG2 and MHCC97-L cells were transfected with sequence-specific inhibitor of miR-100 (anti-miR-100) or its negative control (anti-miR-NC), then subjected to serum deprivation. [score:3]
We further examined whether overexpression of miR-100 disrupted the mitochondrial membrane potential (ΔΨm). [score:3]
Previous studies have revealed that miR-100 can suppress the proliferation of HCC cells [13]. [score:3]
293T cells grown in a 48-well plate were co -transfected with 5 nM of either NC or miR-100 duplex, 10 ng of firefly luciferase reporter plasmid comprising the wild-type or mutant 3′UTR of target gene, and 2 ng of pRL-TK (Promega, Madison, WI, USA). [score:3]
The altered expression of miR-100 and p62 in HCC tissues. [score:3]
HepG2-pCDH-miR-100, a HepG2 subline with stable miR-100 expression, and HepG2-pCDH-control cells were injected subcutaneously into nude mice and tumor growth was monitored using in vivo imaging. [score:3]
Knockdown of Atg7 but not Beclin-1 attenuates the miR-100 -induced autophagy. [score:2]
Immunofluorescent staining disclosed that the introduction of miR-100 obviously enhanced the punctate LC3B signals (Figure 2A), whereas knockdown of endogenous miR-100 by anti-miR-100 decreased LC3B signals (Figure 2B). [score:2]
qPCR analysis of miR-100 expression was performed on a LightCycler 480 (Roche Diagnostics, Germany) using a TaqMan MicroRNA Assay kit (Applied Biosystems, Foster City, CA). [score:2]
Furthermore, knockdown of either mTOR or IGF-1R significantly enhanced the LC3B-II level and punctate LC3B signals in both HepG2 (Figure 5D and E) and MHCC97-L cells (Supplementary Figure 4C), which phenocopied the effect of miR-100. [score:2]
To date, the role of miR-100 in the regulation of autophagy has not been elucidated yet. [score:2]
Deregulation of miR-100 has been observed in different human neoplasms. [score:2]
Both gain- and loss-of-function studies revealed the pro-autophagy effect of miR-100. [score:1]
HepG2 and Huh7 cells were non -transfected (lane 1) or transfected with NC or miR-100 duplex for 72 hours before immunoblotting. [score:1]
The anti-miR-NC, which is non-homologous to any human genome sequences, was used as a negative control for anti-miR-100. [score:1]
Most published studies so far have focused on analyzing the effect of miR-100 on cell growth. [score:1]
HepG2 cells were reversely transfected with NC or miR-100 for 48 hours, followed by incubation in the 10% FBS-containing DMEM (lanes 1 and 2) or serum-free DMEM (lanes 3-6) without (−) or with (+) 10 μM chloroquine (CQ) for 24 hours. [score:1]
Therefore, HepG2 and Huh7 cells, both of which displayed very low miR-100 levels, were subjected to immunobloting for LC3B-II and p62 after being transfected with negative control (NC) or miR-100 duplex. [score:1]
The percentage of Annexin V-staining cells significantly increased in the miR-100 -transfected group, implying simultaneous induction of apoptosis by miR-100 (Figure 6B, C). [score:1]
Next, we confirmed the effect of miR-100 on autophagy by morphological examination. [score:1]
Taken together, these data suggest that miR-100 may promote the Atg7 -dependent autophagy. [score:1]
The mutant 3′UTR (Supplementary Figure 3), which carries the mutated sequence in the complementary site for the seed region of miR-100, was generated using fusion PCR based on the construct with wild-type 3′UTR. [score:1]
These findings suggest that miR-100 may promote the autophagy of HCC cells. [score:1]
The anti-miR-100, with a sequence complementary to mature miR-100, was a 2′- O-methyl -modified oligoribonucleotide. [score:1]
The level of miR-100 was normalized to that of U6B, which yielded a 2 [−ΔΔC]t value. [score:1]
Morphological examination discloses the autophagy-promoting function of miR-100. [score:1]
Next, the role of miR-100 on in vivo tumor growth was analyzed. [score:1]
HepG2 cells were transfected with miR-100 or NC duplex and then cultured in serum-free medium. [score:1]
HepG2 (C) and MHCC97-L (D) cells were non -transfected (lanes 1 and 4) or transfected with anti-miR-NC or anti-miR-100 for 48 hours, then incubated in the serum-free DMEM without (−) or with (+) 10 μM CQ for 24 hours. [score:1]
The miR-100 -induced autophagy promotes apoptotic cell death and represses tumor growth. [score:1]
Interestingly, the restoration of miR-100 resulted in massive cell death upon serum starvation, as manifested by the increased number of trypan blue-staining cells (Figure 6A, bars 1~3). [score:1]
These results suggest that the miR-100 -induced autophagy may trigger mitochondrial apoptotic pathway in our cell mo dels. [score:1]
Autophagy may lead to either cell survival or cell death, we therefore explored the consequence of the miR-100 -induced autophagy. [score:1]
To date, there is no report showing the effect of miR-100 on autophagy. [score:1]
The miR-100 or p62 level in HCC tissue relative to that in adjacent nontumor tissue (T/N) was used. [score:1]
Compared with the control group, knockdown of miR-100 by anti-miR-100 led to a significant reduction in LC3B-II protein, both in the absence and presence of CQ (Figure 1C and D). [score:1]
miR-100 promotes the Atg7 -dependent autophagy in HCC cells. [score:1]
To evaluate the role of miR-100 in autophagic process, miR-100 expression was first analyzed in different hepatoma cell lines. [score:1]
The negative control RNA duplex (named as NC) for both miR-100 and siRNAs was non-homologous to any human genome sequences. [score:1]
Effect of miR-100 on the levels of LC3B-II and p62 in HCC cells. [score:1]
Therefore, miR-100 reduction may represent one of the mechanisms responsible for the low autophagy level in HCC tissues. [score:1]
Regardless of the presence or absence of serum, the miR-100 -transfected cells displayed much more accumulation of LC3B-II than NC-transfectants (Figure 1B, lanes 1~4). [score:1]
HepG2-pCDH-control and HepG2-pCDH-miR-100 cells (5×10 [6]) were suspended in 100 μl 1xPBS and then injected subcutaneously into either side of the posterior flank of the same male BALB/c athymic nude mouse at 5-6 weeks of age. [score:1]
Therefore, the effect of miR-100 on the serum starvation -induced autophagy was further studied. [score:1]
HepG2 cells were transfected with NC or miR-100 for 48 hours, then cultured in the serum-free DMEM with 10 μM CQ for 24 hours before examination by transmission electron microscopy. [score:1]
To create luciferase reporter construct, a wild-type 3′UTR fragment of human IGF-1R or mTOR mRNA that contained the putative binding sites for miR-100 was PCR-amplified and inserted into the EcoRI and XbaI sites downstream of the stop codon of firefly luciferase in pGL3cm vector, which was generated previously [12]. [score:1]
HepG2-pCDH-control and HepG2-pCDH-miR-100 cells were injected subcutaneously into either side of the posterior flank of the same mouse. [score:1]
[1 to 20 of 95 sentences]
7
[+] score: 261
Importantly, siRNA -mediated downgulation of PLK1 could recapitulate the tumor suppressor function of miR-100, and overexpression of PLK1 could partly rescue the reduced cellular proliferation observed upon miR-100 upregulation in S KOV-3 cells, demonstrating that PLK1 is an important functional target of miR-100 in this mo del. [score:10]
These data show that cell viability could be inhibited by upregulation of miR-100, and could be promoted by downregulation of miR-100. [score:9]
Patients with relative miR-100 expression levels in EOC tissues less than the median value of 0.14 formed the low expression group (n=50), while patients with relative miR-100 expression levels in EOC tissues ≥0.14 formed the high expression group (n=48). [score:9]
To further confirm the target specificity between miR-100 and its potential target, PLK1, we carried out a luciferase reporter assay with a vector containing the putative PLK1 3′-untranslated region (UTR) target site downstream of the luciferase reporter gene. [score:8]
Overexpression of miR-100 could induce growth suppression in human EOC cells, while downregulation of miR-100 could promote growth of EOC cells. [score:8]
In another research, a subset of 37 miRNAs was found to be overexpressed in all epithelial ovarian cancer subtypes and 21 were underexpressed and the validated downregulated genes included miR-100, miR-210, miR-22 and miR-222 (11). [score:8]
In our study, we show that overexpression of miR-100 could inhibit the expression of PLK1 protein in EOC cells. [score:7]
Recently, Zheng and his group reported that miR-100 could regulate cell differentiation and survival by targeting RBSP3, a phosphatase-like tumor suppressor in acute myeloid leukemia (27). [score:6]
The expression of miR-100 is significantly downregulated in human EOC tissues. [score:6]
Although miR-100 was reported to be significantly downregulated in EOC tissues, the correlation of miR-100 expression with clinicopathological factors or prognosis of patients with EOC and its functional roles in EOC remain unclear. [score:6]
Finally, whether polo-like kinase 1 (PLK1) was a target regulated by miR-100 expression was also determined. [score:6]
In conclusion, this study suggests that miR-100 is downregulated in human EOC and low miR-100 expression may be a poor prognostic factor. [score:6]
So, it can be demonstrated that miR-100 negatively regulated PLK1 at the post-translational level, acting as a tumor suppressor in the EOC. [score:6]
Next, a miR-100 inhibitor or precusor was transiently transfected into EOC cell lines, and the effect of miR-100 expression on the growth of EOC cells was analyzed. [score:5]
Therefore, it was concluded that miR-100 may function as a tumor suppressor in EOC by targeting PLK1. [score:5]
Molecules of dsRNAs that mimic endogenous hsa-miR-100 (pre-miR-100) and single-strand miR-100 inhibitor (anti-miR-100), designed to inhibit endogenous hsa-miR-100, were purchased from Ambion (Austin, TX, USA). [score:5]
Furthermore, patients with low miR-100 expression showed poorer survival than those with high miR-100 expression. [score:5]
As shown in Table I, the low level of miR-100 expression was closely correlated with advanced FIGO stage, higher serum CA125 expression level and lymph node involvement (P=0.001, 0.001 and 0.014, respectively). [score:5]
In nasopharyngeal cancer, underexpressed miR-100 was found to lead to PLK1 overexpression, which in turn contributes to NPC progression (25). [score:5]
To confirm this, we firstly determined the effect of miR-100 expression on the expression of PLK1 protein in EOC cells. [score:5]
Meanwhile, compared with the antisense control, the expression of miR-100 was downregulated to 45.6% (P<0.05). [score:5]
Meanwhile, overexpression of PLK1 could also reverse the inhibitory growth induced by pre-miR-100 (Fig. 5D). [score:5]
Also, miR-100 can significantly inhibit growth of EOC cells by targeting PLK1. [score:5]
As shown in Fig. 3A, compared with precursor control, the expression of miR-100 showed up-regulation to 6.34-fold in the transfected group with pre-miR-100 (P<0.01). [score:5]
In particular, miR-100 was found to be downregulated in 76% of tumors. [score:4]
As shown in Fig. 4A, western blot assay indicated that pre-miR-100 could induce the decreased expression of PLK1 protein, but anti-miR-100 could induce the increased expression of PLK1 protein in EOC cells (P<0.05). [score:4]
However, whether PLK1 is a direct miR-100 target in EOC cells is unknown. [score:4]
Although miR-100 was reported to be downregulated in human EOC by other research groups, the clinicopathological or prognostic significance of miR-100 in EOC is still unknown. [score:4]
By miRNA microarrays, 36 miRNAs were found to be deregulated between normal ovarian cells and epithelial ovarian tumors, with miR-199a [*], miR-214, miR-200a, and miR-100 being the most highly differentially expressed candidates (10). [score:4]
The Kaplan-Meier curve is shown in Fig. 2. Those EOC patients with low miR-100 expression were more likely to have a shorter overall survival (P=0.021), when compared to patients with high miR-100 expression. [score:4]
In contrast, upregulation of miR-100 led to decreased cell viability compared with the pre-miR-NC -transfected cells. [score:3]
For the matched normal tissues, the mean level of miR-100 expression was 8.4 (range, 2.7–16.4). [score:3]
A multivariate analysis with the Cox proportional hazards showed that the status of miR-100 expression was an independent predictor of overall survival in EOC. [score:3]
Thus, this miR-100/PLK1 signaling pathway may provide therapeutic targets for human EOCs. [score:3]
Meanwhile, we showed that low miR-100 expression was closely correlated with advanced FIGO stage, high serum CA125 level and lymph node involvement. [score:3]
The relationship between miR-100 expression and clinicopathological factors was analyzed using the Student’s t-test. [score:3]
Then, the clinicopathological or prognostic significance of miR-100 expression in human EOCs was statistically analyzed. [score:3]
Then, we analyzed the effect of miR-100 expression on the growth of EOC cells and its possible mechanisms. [score:3]
However, there was no significant correlation between miR-100 expression and other clinicopathological variables of EOC patients including age, histological type, histological grade, residual tumor diameter and ascites (P=0.155, 0.486, 0.849, 0.366 and 0.279, respectively). [score:3]
Association of miR-100 expression with prognosis of EOC patients. [score:3]
Whether miR-100 expression could affect prognosis of patients was statistically analyzed. [score:3]
Western blot analysis indicated that pcDNA/PLK1 could reverse the decreased expression of PLK1 protein induced by pre-miR-100 (Fig. 5C). [score:3]
The base pairing between miR-100 and the wild-type (wt) or mutant (mut) target site in the 3′-UTR of PLK1 mRNA is shown in Fig. 4B. [score:3]
Polo-like kinase 1 (PLK1) is a target of miR-100. [score:3]
In this study, our aim was to determine the expression of miR-100 in 98 EOC tissues and corresponding adjacent normal epithelial tissues. [score:3]
In a previous study, PLK1 has been reported to be a miR-100 target in human nasopharyngeal cancer. [score:3]
In the present study, we firstly showed that the mean level of miR-100 expression in EOC tissues was significantly higher than that in the matched normal tissues. [score:3]
Next, the clinicopathological significance of miR-100 expression in human EOC was analyzed. [score:3]
By univariate analysis, the status of miR-100 expression was correlated with poor survival of EOC patients (P=0.038). [score:3]
Effect of miR-100 expression on in vitro proliferation of EOC cells. [score:3]
Finally, a multivariate analysis with the Cox proportional hazards showed that the status of miR-100 expression, along with FIGO stage and lymph node involvement, was an independent predictor of overall survival in EOC (RR, 2.12; 95%CI, 1.88–3.41; P=0.008). [score:3]
For the EOC tissues, the mean level of miR-100 expression was 3.8 (range, 1.6–8.5). [score:3]
Forty-eight hours after transfection, TaqMan real-time RT-PCR assay was performed to examine the expression of miR-100. [score:2]
Furthermore, the expression level of miR-100 was significantly lower in EOC patients with advanced clinical stage (III/IV) compared with those with clinical stage (I/II) (P<0.01; Fig. 1B). [score:2]
The TaqMan real-time RT-PCR assay was performed to determine the expression of miR-100 in 15 cases of EOC and their matched normal tissues. [score:2]
In vitro luciferase assay further suggested that PLK1 is the target gene of miR-100. [score:2]
Also, the expression level of miR-100 was significantly lower in EOC patients with advanced clinical stage (III/IV) compared with those with clinical stage I/II. [score:2]
In order to study the functional role of miR-100 in ovarian tumorigenesis, S KOV-3 cells were transfected with pre-miR-100, anti-miR-100 or scrambled precursor (pre-miR-NC)/antisense oligonucleotide control (anti-miR-NC). [score:1]
Seed regions were mutated to remove all complementarity to nucleotides 2–8 of miR-100 by using the QuickChangeXL mutagenesis kit (Stratagene, La Jolla, CA). [score:1]
As shown in Fig. 4C, pre-miR-100 or anti-miR-100 significantly decreased or respectively increased the activity of the Luc-PLK1-3′-UTR reporter (P<0.01). [score:1]
Next, pcDNA/PLK1 vector and pre-miR-100 were co -transfected into the S KOV-3 cell line. [score:1]
Next, S KOV-3 cells were co -transfected with PLK1-3′-UTR luciferase reporter (wt-PLK1-3′-UTR) and pre-miR-100 or anti-miR-100. [score:1]
Interestingly, we also found that the incidence of lymph node metastasis in EOC patients with low miR-100 level (58.0%) was significantly higher than that in patients with high miR-100 levels (33.3%). [score:1]
The level of miR-100 was significantly lower in EOC tissues than in adjacent normal tissues (P<0.001; Fig. 1A). [score:1]
However, in prostate cancer, it was reported that a high level of miR-100 was related to biochemical recurrence of localized prostate cancer in patients treated with radical prostatectomy (26). [score:1]
For each well, 50 nM of pre-miR-100 (anti-miR-100) or a negative control pre-miR-NC (anti-miR-100) was co -transfected with the reporter constructs. [score:1]
Association of miR-100 expression with clinicopathological characteristics in EOC. [score:1]
Firstly, the number of tissue samples is small, and further investigation of a larger case population is needed to confirm the prognostic significance of miR-100 expression in EOC. [score:1]
[1 to 20 of 68 sentences]
8
[+] score: 222
[21] In our study, we observed the effect on the cell proliferation of BEAS-2B after silencing the expression of miR-100 by using miR-100 inhibitor lentivirus expression vector (miR-100 -inhibitor). [score:9]
[9] However, in lung cancers, the expression of miR-100 was downregulated, suggesting it played a tumor suppressor function. [score:8]
To study whether arsenic can effect synergistically with miR-100 inhibited, the BEAS-2B cells transfected with miR-100 inhibitor lentivirus expression vector were incubated with or without 0.25 μM arsenic for 10 weeks (AS 20 passages) and 20 weeks (AS 40 passages). [score:7]
C. The colony-formation assay revealed that colony number and colony size were increased following inhibition of miR-100 in BEAS-2B cells, similar trend was observed in the AS -treated cells(AS (40) and AS (20)) when the expression of miR-100 was inhibited. [score:6]
Luo J, Chen B, Ji XX, Zhou SW, Zheng D Overexpression of miR-100 inhibits cancer growth, migration, and chemosensitivity in human NSCLC cells through fibroblast growth factor receptor 3. Tumour Biol 2016; 37(12):15517-24; PMID:26314855; https://doi. [score:5]
Similar trend was observed in the AS -treated cells when the expression of miR-100 was inhibited, especially in as BEAS-2B (Inh-miR-100)-AS (20) or AS (40) cells. [score:5]
Xiao F, Bai Y, Chen Z, Li Y, Luo L, Huang J, Yang J, Liao H, Guo L Downregulation of HOXA1 gene affects small cell lung cancer cell survival and chemoresistance under the regulation of miR-100. [score:5]
We demonstrated that inhibition of miR-100 expression in BEAS-2B cells led to enhancement of cell proliferation and migration. [score:5]
For control or miR-100–3p inhibition group, a sequence encoding a miR-100–3p negative control or its specific inhibitor was cloned into the lentiviral vector hU6-MCS-Ubiquitin–EGFP -IRES-puromycin. [score:5]
In our study, we have established BEAS-2B cell lines with stable expression of miR-100 inhibitor, and then treated the cells with 0.25 μM arsenic for 10 weeks (AS 20 passages) and 20 weeks (AS 40 passages). [score:5]
The results shown that chronic arsenic treatment promoted the malignant transformation of BEAS-2B cell after inhibition of miR-100 expression. [score:5]
To test this hypothesis, BEAS–2B cells were treated with low-dose of As [2]O [3] chronically, and lentiviral vectors were used to mediate the inhibition of miR-100 expression. [score:5]
Luo reported that, overexpression of miR-100 in non-small cell lung cancer cell inhibited the cancer growth, migration, and chemo-sensitivity through FGFR3. [score:5]
[24] Consistently, in the process of chronic arsenic exposure, we observed that chronic arsenic treatment of BEAS-2B cells, when the expression of miR-100 was inhibited, underwent a marked morphologic change, i. e., from epithelial to spindle-like mesenchymal morphology (Fig.  5A). [score:5]
Li BH, Zhou JS, Ye F, Cheng XD, Zhou CY, Lu WG, Xie X Reduced miR-100 expression in cervical cancer and precursors and its carcinogenic effect through targeting PLK1 protein. [score:5]
B. by using flow cytometry system suggested that inhibition of miR-100 accelerated cell re-entering into the S phase, especially in as BEAS-2B(miR-100 -inhibitor)-AS(40) cells. [score:5]
These results proved that treatment of BEAS-2B cells with arsenic, after inhibiting the expression of miR-100, resulted in EMT, as evidenced by reduction of the epithelial marker E-cadherin, and induction of the mesenchymal markers vimentin, ZEB1, and the matrix metalloproteinases MMP-3, MMP-9, and nuclear β-catenin. [score:5]
These changes promoted an adhesion switch to predominately cell-matrix interactions, were accompanied by drastic morphological changes, and were associated with the upregulation of a variety of cytoskeletal proteins that contribute to increased cell motility [34] [,] [35] In our study, miR-100 inactivation in combination with chronic arsenic treatment of BEAS-2B caused EMT phenotype, a sign with more malignant features, particularly associated with increased metastatic potential. [score:4]
Liu J, Lu KH, Liu ZL, Sun M, De W, Wang ZX MicroRNA-100 is a potential molecular marker of non-small cell lung cancer and functions as a tumor suppressor by targeting polo-like kinase 1. BMC Cancer 2012; 12: 519; PMID:23151088; https://doi. [score:4]
[20] In present study, both in vitro and in vivo experiments were performed to test our hypothesis that downregulation of miR-100 combined with chronic arsenic exposure could enhance metastasis and proliferation of BEAS-2B by promoting EMT, and our results confirmed this notion. [score:4]
A. BEAS-2B cells with inhibited miR-100 were exposed to 0 or 0.25 μM of As [2]O [3] for 0, 20, or 40 passages, and typical images with or without treatment are shown. [score:3]
The combination of miR-100 inhibition and chronic arsenic treatment promote the cell proliferation significantly. [score:3]
Wang S, Xue S, Dai Y, Yang J, Chen Z, Fang X, Zhou W, Wu W, Li Q Reduced expression of microRNA-100 confers unfavorable prognosis in patients with bladder cancer. [score:3]
The results showing that the colony number and colony size were increased following inhibition of miR-100 in BEAS-2B cells. [score:3]
Chen D, Sun Y, Yuan Y, Han Z, Zhang P, Zhang J, You MJ, Teruya-Feldstein J, Wang M, Gupta S, et al. miR-100 induces epithelial-mesenchymal transition but suppresses tumorigenesis, migration and invasion. [score:3]
Note the morphological shift of BEAS-2B cells from epithelial-like to mesenchymal-like when miR-100 inhibition. [score:3]
BEAS-2B cells with miR-100 inactivation were exposed to 5 μM As [2]O [3] in the short term, i. e., 0, 6, 12, and 24 h. We then examined the expression of EMT markers in treated cells. [score:3]
Lentivirus -mediated suppression of miR-100–3p. [score:3]
For arsenic acute stimulate, 5 μM As [2]O [3] (Sigma) was co-cultured with BEAS-2B cells with or without miR-100 inhibition for 0 h, 6 h, 12 h, and 24 h, respectively. [score:3]
One thousand arsenic treated BEAS-2B (miR-100 -inhibitor) and BEAS-2B (miR-NC) cells were re-suspended in 1mL of complete medium (DMEM medium with 10%FBS) containing 0.6% agar and were then plated on top of a bottom layer that contains 1.2% agar (BD) with complete medium. [score:3]
[29] In the present study, the miR-100 inactivation promoted arsenic induced carcinogenesis in human lung bronchial epithelial cells, which might reveal the oncogenic transformation of lung disease under the arsenic exposure. [score:3]
Taken together, these results confirmed that inhibition of miR-100 promoted proliferation of BEAS-2B cells, and chronic arsenic treatment increased BEAS-2B cell proliferation. [score:3]
Furthermore, to understand the synergistic effect of arsenic on BEAS-2B cells after inhibition of miR-100, the cells were treated with arsenic chronically. [score:3]
Arsenic treated BEAS-2B (miR-100 -inhibitor) and BEAS-2B (miR-NC) cells were seeded and cultured on 96-well plates at an initial density of 2000/well after trypsinization. [score:3]
Arsenic treated BEAS-2B (miR-100 -inhibitor) and BEAS-2B(miR-NC) cells were harvested. [score:3]
[8] Study found that, in prostate cancer, the miR-100 expression was elevated and associated with increased metastasis. [score:3]
Next, the effect of miR-100 inhibition on cell cycle progress of BEAS-2B cells was determined by flow cytometry (Fig.  1B). [score:3]
The arsenic exposure affected on oncogenic transformation via affect the miR-100 expression. [score:3]
[22] In this study, we observed that inhibition of miR-100 promoted anchorage-independent cell growth in soft agar (Fig.  2). [score:3]
Left panel: BEAS-2B cells with inhibited miR-100 were exposed to 0 or 0.25 μM of arsenic for 20, or 40 passages, or 5 μM of arsenic for 0, 6, 12, 24h. [score:3]
These results demonstrated that inhibition of miR-100 promoted the ability of migration of BEAS-2B cells, while chronic arsenic treatment increased migration synergistically. [score:3]
A. BEAS-2B cells with miR-100 inhibition were exposed to 0 or 0.25 μM As [2]O [3] for 20, and 40 passages. [score:3]
Left panel: The soft agar colony formation assay shows that inhibition of miR-100 promotes anchorage-independent growth of BEAS-2B cells. [score:2]
For the migration assays, a total of 2 × 10 [4] arsenic treated BEAS-2B(miR-100 -inhibitor) and BEAS-2B (miR-NC) cells in serum-free media were placed into the upper chamber of an insert (8 μm pore size, millepore). [score:2]
As showed in Fig.  3, inhibition of miR-100 promoted the migration of BEAS-2B cells by approximately 50.5% compared with control group. [score:2]
MiR-100 was downregulated in the lung cancer, and considered as a diagnostic bio-marker. [score:2]
Compared with BEAS-2B/miR-NC cells, BEAS-2B/miR-100 -inhibition cells showed the increased percentage of S phase cells and decreased percentage of G [0]/G [1] phase cells. [score:2]
org/ 10.1007/s13277-015-3267-8 25740059 9. Leite KR, Tomiyama A, Reis ST, Sousa-Canavez JM, Sanudo A, Dall'Oglio MF, Camara-Lopes LH, Srougi M MicroRNA-100 expression is independently related to biochemical recurrence of prostate cancer. [score:2]
Left panel: Transwell assays were performed to evaluate the migratory capabilities of the cells untransfected, transfected with either a miR-100–3p inhibitor (Inh-miR-100) or a miR-100–3p inhibitor control (Inh-NC) with or without chronic arsenic treatment. [score:2]
Furthermore, chronic arsenic treatment promotes the anchorage-independent growth of BEAS-2B cells after the miR-100 inactivation, indicated by the increased colony size and colony number. [score:1]
Figure 3. Inactivation of miR-100 combined with arsenic treatment promotes migration of BEAS-2B cells. [score:1]
Our data indicate that inactivation of miR-100 combined with chronic arsenic treatment promotes tumorigenicity of BEAS-2B cells via activation of EMT. [score:1]
Literatures indicated that miR-100 is a novel EMT inducer, and validated in human tumors that miR-100 correlates with EMT -associated markers. [score:1]
We found that the proliferation ability of BEAS-2B cells increased after the inactivation of miR-100. [score:1]
Inactivation of miR-100 combined with chronic arsenic treatment induces the EMT like transition. [score:1]
Similarly, we found that chronic arsenic treatment after miR-100 inactivation contributed the BEAS-2B cells to re-enter the cell cycle(S phase). [score:1]
To determine whether arsenic promoted migration of BEAS-2B cells after miR-100 inactivation, the cells were treated with low dose of arsenic chronically. [score:1]
Inactivation of miR-100 combined with chronic arsenic treatment promotes anchorage- independent growth of BEAS-2B cells. [score:1]
[32] Xiao observed that the HOXA1 mediated the chemo-resistance of small cell lung cancer under the regulation of MiR-100. [score:1]
2016.09.015 27634639 8. Qin C, Huang RY, Wang ZX Potential role of miR-100 in cancer diagnosis, prognosis, and therapy. [score:1]
Inactivation of miR-100 combined with arsenic promotes migration of BEAS-2B cells. [score:1]
Figure 4. Inactivation of miR-100 combined with arsenic treatment promotes mammary tumor growth of BEAS-2B cells. [score:1]
Figure 2. Inactivation of miR-100 combined with arsenic treatment promotes anchorage- independent growth of BEAS-2B cells. [score:1]
[36-38] In this study, we identified as an EMT inducer, and demonstrated that inactivation of miR-100 in BEAS-2B cells led to significant enhancement of cell proliferation and migration. [score:1]
As shown in Fig.  4A, the tumor growth was promoted after the chronic arsenic treatment, and this effect was significantly enhanced by the inactivation of miR-100. [score:1]
Figure 1. Inactivation of miR-100, combined with arsenic treatment, promotes proliferation of BEAS-2B cells. [score:1]
Inactivation of miR-100 combined with chronic arsenic treatment promotes tumorigenesis of BEAS-2B cells in mice. [score:1]
Inactivation of miR-100 combined with arsenic promotes proliferation of BEAS-2B cells. [score:1]
Similar trend was observed in the chronic arsenic treated cells (AS [40] and AS [20]) after the miR-100 inactivation. [score:1]
[24] In our study, we observed that EMT is involved in inactivation of miR-100 and chronic arsenic treated BEAS-2B cells. [score:1]
In this study, we hypothesize that inactivation of miR-100 combined with low concentration of arsenic exposure could promote the malignant transformation of human bronchial epithelial cells (BEAS-2B cell) by promoting EMT. [score:1]
[7] The research about the relationship between miR-100 and tumor has made significant progresses, but the data so far are still controversial. [score:1]
Arsenic treated BEAS-2B (miR-100 -inhibitor) and BEAS-2B(miR-NC) cells were seeded and cultured on 60 mm [2] plates at an initial density of 400/well after trypsinization, each group was measured in 3 parallel wells, and incubated for 2 weeks at 37°C, 5% CO [2]. [score:1]
As illustrated in Fig.  4B-D, the miR-100 inactivation combined with chronic arsenic treatment significantly increased the weight of the mammary tumors. [score:1]
[31] The low miR-100 might be a poor prognostic factor in non-small cell lung cancer patients. [score:1]
To further determine the synergistic effect of chronic arsenic treatment combined with miR-100 inactivation, the cells were treated with arsenic for 20 passages and 40 passages, respectively. [score:1]
The inactivation of miR-100 and chronic arsenic treatment might play synergistic role in this process. [score:1]
The colony number and size was significantly increased after the inactivation of miR-100 in BEAS-2B cells. [score:1]
Carcinogenesis lung cancer micro RNA miR-100 Lung cancer is the leading cause of mortality worldwide. [score:1]
The chronic arsenic treatment combined with miR-100 inactivation enhanced tumor growth. [score:1]
Our results showed that, the inactivation of miR-100 combined with arsenic treatment significantly promoted the proliferation, viability, and migration of BEAS-2B cells in vitro, and tumorigenesis in vivo. [score:1]
The miR-100 inactivation BEAS-2B cells with or without chronic arsenic treatment were injected into BALB/C nude mice. [score:1]
Overall, the morphological and molecular changes have all suggested that BEAS-2B cells with the inactivation of miR-100 underwent an EMT process after the As [2]O [3] exposure. [score:1]
A. the representative image showed mammary tumors from the miR-100 inactivation (Lv-Inh-miR100. ) [score:1]
[1 to 20 of 84 sentences]
9
[+] score: 153
Other miRNAs from this paper: hsa-mir-99a, hsa-mir-99b
Bladder cancer tissues expressing miR-100 at levels less than the median expression level (2.8) were assigned to the low expression group (mean expression value 1.8, n = 78), and those samples with expression above the median value were assigned to the high expression group (mean expression value 3.9, n = 48). [score:15]
MicroRNA-100 (miR-100) has been demonstrated to be downregulated in bladder cancer tissues, and enforced expression of this miRNA may inhibit cell growth and colony formation of human bladder cancer 5637 cells in vitro. [score:8]
MiR-100 is downregulated in nasopharyngeal cancer, oral squamous cell carcinoma, ovarian cancer, hepatocellular carcinoma, hepatoblastoma and bladder cancer, whereas its upregulation has been described in acute myeloid leukemia, medulloblastomas, gastric cancer, pancreatic cancer and prostate cancer [17- 27]. [score:6]
To determine whether its expression differed between bladder cancer and adjacent normal bladder tissues, the expression levels of miR-100 were detected in 126 pairs of bladder cancer and adjacent normal bladder tissues normalized to RNU6B. [score:5]
Expression levels of miR-100 in bladder cancer tissues were significantly lower than those in adjacent normal tissues (mean expression level: 2.6 ± 1.2 vs. [score:5]
The miR-100 expression was associated with several clinicopathological parameters as shown in Table 2. The bladder cancer patients with low miR-100 expression more frequently had the high tumor stage (P = 0.01), the tumor recurrence (P =0.008), the advanced tumor progression (P = 0.01), and the death (P < 0.001) of patients with bladder cancer. [score:5]
high expression, low miR-100 expression was negatively associated with the stage (P = 0.01), the recurrence (P = 0.008), the progression (P = 0.01), and the death (P < 0.001) of patients with bladder cancer. [score:5]
In another report of Oliveira et al. [15] in 2011, enforced expression of miR-100 may inhibit cell growth and colony formation of human bladder cancer 5637 cells in vitro. [score:5]
In line with these findings, our data also validated the downregulation of miR-100 in a large number of clinical bladder cancer cases. [score:4]
In particular, miR-100 was found to be downregulated in bladder cancer. [score:4]
Similarly, our data in the present study showed that the downregulation of miR-100 may more frequently occur in bladder cancer tissues with aggressive clinicopathological features and poor prognosis. [score:4]
However, the mechanism by which miR-100 was downregulated in bladder cancer is still unclear. [score:4]
Association between miR-100 expression and clinicopathological parameters of bladder cancer. [score:3]
Figure 1 miR-100 expression in 126 pairs of bladder cancer and adjacent normal bladder tissues detected by quantitative real-time polymerase chain reaction (qRT-PCR) analysis. [score:3]
In the multivariate analysis, low miR-100 expression was an independent prognostic factor for both PFS (P = 0.01) and OS (P = 0.008). [score:3]
miR-100 expression (OR, 10.1; 95% CI, 1.5 ~ 27.2; P = 0.008), stage (OR, 7.6, 95% CI, 1.2 ~ 22.3; P = 0.01), grade (OR, 3.9, 95% CI, 1.0 ~ 10.2; P = 0.04) and CIS (OR, 4.8, 95% CI, 1.0 ~ 12.5; P = 0.03) retained significance as a prognostic factor of a short OS (Table 4). [score:3]
For the 3-year PFS rates, patients with low miR-100 expression represented 20.5% and patients without, 54.2% (Table 3). [score:3]
In univariate analysis, low miR-100 expression (P < 0.001), the stage (P = 0.006), the grade (P = 0.02), and CIS (P = 0.01) were significant predictors of short OS (Table 3). [score:3]
To our best of knowledge, this is the first study on the clinical significance of miR-100 expression using a large number of bladder cancer cases. [score:3]
In multivariate PFS analysis, miR-100 expression (OR, 8.3; 95% CI, 1.3 ~ 23.7; P = 0.01), stage (OR, 6.5, 95% CI, 1.0 ~ 13.1; P = 0.02), grade (OR, 1.6, 95% CI, 0.2 ~ 3.7; P = 0.08) and CIS (OR, 3.1, 95% CI, 1.0 ~ 9.6; P = 0.04) were independently significant prognostic factors (Table 4). [score:3]
Notably, the roles of miR-100 in different cancers are quite contradictory as it can behave either as an oncogene or a tumor suppressor gene, depending on the tumor type examined. [score:3]
Low miR-100 expression (P = 0.001), stage (P = 0.008), grade (P = 0.03), and CIS (P = 0.02) were also negative predictors of the PFS (Table 3). [score:3]
In conclusion, our data offer the convincing evidence that miR-100 may play an important role in the progression of bladder cancer and that the reduced expression of this miRNA may be independently associated with shorter PFS and OS of patients, suggesting that miR-100 might be a potential marker for further risk stratification in the treatment of this cancer. [score:3]
Reduced expression of miR-100 in bladder cancer. [score:3]
Especially in bladder cancer, both the previous studies of Oliveira et al. [15] and Song et al. [14] found the decreased expression of miR-100 in bladder cancer cells. [score:3]
Functionally, the aberrant expression of miR-100 in acute myeloid leukemia cells can promote cell proliferation and block granulocyte/monocyte differentiation [22]. [score:3]
Our data offer the convincing evidence that miR-100 may play an important role in the progression of bladder cancer and that the reduced expression of this miRNA may be independently associated with shorter PFS and OS of patients, suggesting that miR-100 might be a potential marker for further risk stratification in the treatment of this cancer. [score:3]
Henson et al. [28] also demonstrated that miR-100 could be used therapeutically to increase the sensitivity of oral squamous cell carcinoma cells to ionizing radiation by decreasing the expression of the genes that confer radioresistance. [score:3]
Oral squamous cell carcinoma cells transfected with miR-100 may modify the expression of a number of oncogenes including ID1, EGR2, MMP13, and FGFR3 [18]. [score:3]
The 3-year OS rates of patients who were low (n = 78) and high (n = 48) for miR-100 expression were 29.5% and 68.8%, respectively (Table 3). [score:3]
In patients who progressed, 20 (76.9%) had low miR-100 expression. [score:3]
Figure 2 shows the OS and PFS curves with respect of miR-100 expression. [score:3]
Moreover, low miR-100 expression clearly predicted poorer PFS (P = 0.001) and OS (P < 0.001). [score:3]
Recent studies have demonstrated that the aberrant expression of miR-100 is associated with tumorigenesis and tumor progression. [score:3]
The mean level of miR-100 expression in bladder cancer tissues was 2.6 ± 1.2, which was significantly lower on average than that in adjacent normal bladder tissues (3.9 ± 1.5, P < 0.001, Figure 1). [score:3]
Expression levels of miR-100 in 126 pairs of bladder cancer and adjacent normal tissues were detected by TaqMan real-time quantitative RT-PCR assay. [score:2]
These findings raise the possibility that miR-100 might have an important role in the development or pathogenesis of various cancers. [score:2]
As shown in Figure 1, the expression levels of miR-100 were found to be distinctly reduced in bladder cancer tissues compared to adjacent normal bladder tissues. [score:2]
More importantly, the prognostic value of miR-100 in bladder cancer patients was higher than that of tumor stage (P value for OS: <0.001 vs. [score:1]
However, the clinical significance of miR-100 in human bladder cancer has not yet been elucidated. [score:1]
In multivariate OS analysis, miR-100, stage, grade, and CIS was entered into the Cox proportional hazard analysis. [score:1]
Univariate analysis of the correlation between miR-100 and the survival of patients with bladder cancer. [score:1]
The Cox proportional hazards mo del was used to evaluate the association of miR-100 expression with PFS and OS, respectively, after the operation. [score:1]
miR-100 expression in bladder cancer and adjacent normal bladder tissues was measured by real-time quantitative RT-PCR analysis. [score:1]
Thus, the aim of this study was to investigate the diagnostic and prognostic values of miR-100 in this disease. [score:1]
MiR-100, together with miR-99a and miR-99b, belongs to the miR-100 family. [score:1]
[1 to 20 of 46 sentences]
10
[+] score: 145
Other miRNAs from this paper: hsa-mir-99a, hsa-mir-99b, hsa-mir-708
The miR-99 family (miR-99a, miR-99b, and miR-100) has been reported to be upregulated following DNA damage, and their expression has been correlated with radiation sensitivity, in breast and PCa cell lines, by their ability to downregulate the chromatin remo deler SWI/SNF-related, matrix -associated, actin -dependent regulator of chromatin (SMARC) A5 (SNF2H) [21]. [score:10]
However, treatment of androgen-independent CB and PC3 cells, with the synthetic androgen R1881 (10 nM), did not result in a change of miR-99a/miR-100 or SMARCA5 and SMARCD1 expression (Figure 6A, 6B, Supplementary Figure S3A), whereas LNCaP, an AR expressing PCa cell line demonstrated a downregulation of both miRNAs after R1881 treatment (Supplementary Figure S3B), confirming previous data [30]. [score:8]
The miRNA inhibitors anti-hsa-miR-99a-5p miScript miRNA Inhibitor (miR99a-i), Anti-hsa-miR-100-5p miScript miRNA Inhibitor (miR100-i) and the endo-ribonuclease prepared siRNA (esiRNA) esiPARP1, esiSMARCA5, esiSMARCD1 (Sigma-Aldrich Company Ltd, Gillingham, UK) were transfected with Lipofectamine® RNAiMAX Transfection Reagent (Life Technologies Ltd, Paisley, UK) according to the manufacturer's protocol. [score:7]
Since we saw no changes in the expression of EMT markers after miR-99a/100 inhibition, the mechanism behind the change in DNA damage response after inhibition of miR-99a or miR100 is not due to dedifferentiation/EMT. [score:7]
Suppression of miR-99a and miR-100 promotes efficient DNA repair in cells with high miR-99a/100 expression. [score:5]
A. Representative western blot analysis of epithelial-mesenchymal transition -associated proteins E-cadherin (CDH1), fibronectin (FN1) and Vimentin (VIM) in CB cells transfected with control, miR-99a -inhibitor, and miR-100 -inhibitor, for 3 days. [score:5]
However it is known that miR-100 expression in human (androgen independent) corneal fibroblasts is significantly suppressed by synthetic glucocorticoid Dexamethasone (DEX) [49]. [score:5]
qRT-PCR analysis of the miR-99a and miR-100 targets SMARCA5 and SMARCD1 showed the expected decrease of both targets after Mifepristone treatment (Figure 6F). [score:5]
To further investigate the role of miR-99a/100 in radiation response, we inhibited miR-99a or miR-100 expression in highly expressing BPH and PCa-derived primary CB cells (Figure 2C). [score:5]
Committed basal (CB) cells, which express relatively high levels of miR-99a/100, were transfected with control, miR-99a-inihibitor or miR-100 inhibitor for 3 days and then analyzed with or without exposure to 5-Gy radiation. [score:5]
Figure 5 A. Representative western blot analysis of epithelial-mesenchymal transition -associated proteins E-cadherin (CDH1), fibronectin (FN1) and Vimentin (VIM) in CB cells transfected with control, miR-99a -inhibitor, and miR-100 -inhibitor, for 3 days. [score:5]
miRNAs have been shown to play a key role in chemotherapeutic drug resistance, and we now show that miR-99a/miR-100 are downregulated in patients with CRPC compared with benign disease. [score:5]
B. Proliferation assays showing the relative surviving fraction of LNCaP cells transfected with control, miR-99a -inhibitor, and miR-100 -inhibitor cells 48 h after exposing the to 2, 5, 10 Gy radiation (n=3). [score:4]
Analysis of two further expression arrays published by other groups revealed that miR-99a and miR-100 are also significantly suppressed in primary tumors compared to benign samples (Figure 1C, 1D) [26, 27]. [score:4]
miR-99a/miR-100 were significantly upregulated in the treated samples (Figure 6E). [score:4]
Our results show that inhibition of miR-99a/miR-100 via glucocorticoid treatment results in an increased DNA repair efficiency at least partly through regulation of the SMARCA5 and SMARCD1 proteins in androgen-independent cells. [score:4]
Analysis of our published miRNA expression array data demonstrates that the miR-99 family members, miR-99a and miR-100 (miR-99a/100), are significantly suppressed in prostate stem-like cells (SC) compared to their differentiated progeny; committed basal (CB) cells (Figure 1A, 1B) [24, 25]. [score:4]
Therefore, when CB populations were treated with DEX the expected lower expression of both miR-99a/miR-100, and a reciprocally increased expression of SMARCA5 and SMARCD1 mRNA, compared with ethanol (EtOH) treated cells (Figure 6A, 6B) was observed. [score:4]
A+ B. Expression profiles of miR-99a (A) and miR-100 (B) in the separated populations: stem cell (SC), cancer stem cell (CSC), transit amplifying (TA) and committed basal (CB) (n=5 Benign prostatic hyperplasia (BPH) and treatment naïve Prostate Cancer (tnCancer), n=3 castration resistant PCa (CRPC). [score:3]
In our previous work we integrated miRNA-mRNA expression datasets and demonstrated that miR-99a/miR-100 plays an essential role in DNA repair [25, 35]. [score:3]
Figure 1 A+ B. Expression profiles of miR-99a (A) and miR-100 (B) in the separated populations: stem cell (SC), cancer stem cell (CSC), transit amplifying (TA) and committed basal (CB) (n=5 Benign prostatic hyperplasia (BPH) and treatment naïve Prostate Cancer (tnCancer), n=3 castration resistant PCa (CRPC). [score:3]
A. qRT-PCR analysis of miR-99a and miR-100 expression in CB cells treated with R1881 or dexamethasone (DEX) for 72 h (n= 5 PCa). [score:3]
In addition, we show that miR-99a and miR-100 -mediated radiation-sensitivity is influenced by inhibition of the Glucocorticoid receptor (GR, NRC1), revealing a potential new treatment strategy to improve radiotherapy and reduce PCa relapse. [score:3]
E. qRT-PCR analysis of miR-99a and miR-100 expression in total primary cell populations treated with Mifepristone for 72 h (n= 5 PCa). [score:3]
I. Expression profiles of miR-99 and miR-100 in prostate cancer cell lines (n=3). [score:3]
Figure 6 A. qRT-PCR analysis of miR-99a and miR-100 expression in CB cells treated with R1881 or dexamethasone (DEX) for 72 h (n= 5 PCa). [score:3]
In this study, using patient-derived cells, we have shown that inhibition of miR-99a/miR-100 prevents p53 dependent apoptosis in PCa cells after irradiation. [score:3]
The analysis shows a significant correlation between miR-99a and miR-100 expression in PCa patients. [score:3]
H. Comparison of miR-99 and miR-100 expression in unfractionated primary prostate samples from BPH (n=3), tnCancer (n=3) and CRPC (n=3). [score:3]
G. Correlation analysis of miR-99a and miR-100 after pooling the expression data of GSE21036 and GSE36802. [score:3]
Lower expression of miR-99a and miR-100 is associated with aggressive PCa and a stem cell-like phenotype. [score:3]
E. Colony forming assay of malignant irradiated CB cells after miR-99a and miR-100 inhibition (n=3 PCa). [score:2]
We have shown in multiple near-patient PCa samples that the two miR-99 family members miR-99a/miR-100 play an important role in regulation of post-irradiation DNA damage response (via SMARC proteins) in the rare tumor initiating CSC population. [score:2]
Furthermore, patients with low levels of miR-99a/miR-100 are more susceptible to biochemical recurrence after treatment. [score:1]
D. Proliferation of malignant irradiated CB cells measured by live cell count after miR-99a and miR-100 inhibition (n=3 PCa). [score:1]
miR-100 is located in an intronic area of the BH3-like motif-containing cell death inducer BLID, (https://omim. [score:1]
E+ F. Survival analysis from GSE21036 of patients with low and high mir-99a (E) and miR-100 (F) levels using the Project Betastasis database (http://www. [score:1]
This study shows, for the first time the role of two members of the miR-99 family (miR-99a and miR-100) in DNA damage repair following radiation in primary PCa cell mo dels, and provides additional functional and mechanistic details about the miR-99a family-DNA repair relationship. [score:1]
C+ D. miR-99a and miR-100 levels in unseparated benign and malignant populations from the GSE21036 (C, benign n=28, malignant n=99, metastasis n=14) and GSE36802 (D, benign n=21, malignant n=21) data sets. [score:1]
[1 to 20 of 39 sentences]
11
[+] score: 124
This leads to a proposed mechanism for our findings whereby hMSCs on stiff substrates express high levels of miR-100-5p and 143-3p, have decreased mTORC1 activity and increased osteogenic bias while hMSCs on soft substrates, or with RhoA inhibition, express low levels of miR-100-5p and 143-3p, have increased mTORC1 activity and increased adipogenic bias (Fig.   7). [score:7]
Statistically different samples are denoted by (*) A closer analysis of the predicted targets of miR-100-5p and miR-143-3p, both of which showed the most significant impact upon the differentiation of hMSCs, revealed a potential convergence upon mTOR signalling, with miR-100-5p targeting mTOR itself, while RICTOR and LARP, both key components of the mTOR network, were predicted targets of miR-143-3p. [score:7]
miR-100 was also upregulated in Lamin A/C knockout MSCs showing additional changes in gene expression that are otherwise suggestive of a switch away from osteogenesis [37]. [score:7]
c qPCR determination of the relative expression of miRNA target genes in hMSCs treated with miRNA inhibitors for miR-100-5p and d miR-143-3p. [score:7]
Both miR-100-5p and miR-143-3p showed a significant decrease in response to C3T-treatment and soft substrates, suggesting that downregulation of their expression is related to low RhoA activity and substrate stiffness. [score:6]
We next treated hMSCs with rapamycin, an inhibitor of mTOR, to determine whether this would have similar effects to downregulation of mTOR components mediated by miR-100-5p and miR-143-3p. [score:6]
showed upregulation of mTOR and Rictor with C3T treatment and on 0.6 kPa substrates- the conditions in which we observed decreased expression of miR-100-5p and miR-143-3p (Fig.   4a, Supplementary Fig.   5A). [score:6]
miR-100 has been consistently linked to mTOR in the literature, where it has been shown to regulate proliferation and migration via its effects on mTOR, particularly in cancer cells 42, 43. miR-143 has also been linked to regulation of mTOR, through inhibition of mTOR and Akt phosphorylation [44]. [score:5]
No significant differences were observed between any conditions treated with Rapamycin indicating that inhibition of mTOR signalling is sufficient to overcome differences in differentiation bias caused by inhibition of miR-100-5p and 143-3p. [score:5]
Scrambled control oligonucleotides did not alter reporter activity from untreated levels, but miR-100-5p mimics and inhibitors significantly decreased and increased reporter activity respectively, thus confirming a direct interaction between miR-100-5p and mTOR regulation in our cells (Fig.   4e). [score:5]
Conversely, mTOR and Rictor expression was elevated in MSCs treated with inhibitors of miR-100-5p, miR-143-3p or both and Larp1 levels were increased in the presence of miR-143-3p mimic (Fig.   4b; Supplementary Fig.   6A). [score:5]
Interestingly, mTORC1 regulates Runx2 and PPARγ [39] and mTORC2 links into regulation of RhoA and cytoskeletal remo delling 40, 41, corroborating the concept that miR-100-5p and 143-3p could regulate both mechanotransductive signalling and hMSC differentiation via mTOR activity. [score:4]
Specifically, the targets of miR-100-5p and 143-3p highlighted a new role for mTOR signalling in the mechano-regulation of hMSC fate. [score:4]
Notably, our analysis of putative targets of the miRNAs showed that both miR-100-5p and miR-143-3p converge upon components of the mTOR signalling network (mTOR, RICTOR, LARP), which is known for its critical role in regulating cell fate. [score:4]
Zhao B Shao L Wang Q Li M MicroRNA-100 inhibits bone morphogenetic protein -induced osteoblast differentiation by targeting Smad1Eur. [score:4]
Previous reports have suggested that miR-100 inhibits osteogenesis, which is in contrast to our findings 34, 35. [score:3]
To further confirm that mTOR signalling is modulated by miR-100-5p and miR-143-3p, MSCs were transfected with inhibitors of miR-100-5p and miR-143-3p and treated with rapamycin. [score:3]
We further showed that miR-100-5p targets mTOR itself and so would affect signalling via mTORC1 and mTORC2, while miR-143-3p could exert differentiation effects on both mTORC1 and mTORC2 via Larp1 and Rictor, respectively. [score:3]
The ability of rapamycin to over-ride the effects of miR-100-5p and miR-143-3p inhibitors provided a clear demonstration that the effects of these factors upon MSC fate is mediated by mTOR signalling. [score:3]
Zeng Y MicroRNA-100 regulates osteogenic differentiation of human adipose-derived mesenchymal stem cells by targeting BMPR2FEBS Lett. [score:3]
Inhibition of these miRNAs had the opposite effect on hMSC differentiation bias to the mimics, with miR-100-5p, miR-143-3p and both miR-100-5p, and miR-143-3p together causing a significant decrease in the proportion of osteoblasts in the culture (Fig.   3b, d). [score:3]
Consistent with our previous results, inhibition of both miR-100-5p and miR-143-3p enhanced the bias towards adipogenesis resulting in a decrease in the proportion of osteoblasts in the culture (Fig.   5; Supplementary Fig.   7). [score:3]
Statistically different samples are denoted by * p < 0.05, ** p < 0.01 and *** p < 0.001Confirming the regulation of these mTOR components within our system, transfection of hMSCs with a mimic of miR-100-5p decreased mTOR levels, while co-transfection of miR-100-5p and miR-143-3p mimics reduced Rictor and Larp1 protein levels. [score:2]
Although the relative contributions of these miRNAs to overall mTORC1 and mTORC2 bias remains a topic for future investigation, it is clear that miR-100-5p and 143-3p can both directly modulate key mTOR components and cause analogous changes to MSC differentiation, as observed using the small molecule mTOR inhibitor, rapamycin. [score:2]
Fig. 7 Proposed mo del of differential mTOR regulation and hMSC differentiation in response to miRNA signalling and substrate stiffness In accordance with this, we demonstrated greatly increased amounts of hydroxapatite accumulation when modulating miR-100-5p and 143-3p in hMSCs encapsulated in 3D gelatin hydrogels. [score:2]
However, mimics of miR-100-5p and miR-143-3p, both of which were expressed at greater levels in stiff substrates, caused a significant increase in the proportion of osteoblasts when compared to cells treated with a control oligonucleotide (Fig.   3a, c; Supplementary Fig.   4). [score:2]
Statistically different samples are denoted by * p < 0.05, ** p < 0.01 and *** p < 0.001 Confirming the regulation of these mTOR components within our system, transfection of hMSCs with a mimic of miR-100-5p decreased mTOR levels, while co-transfection of miR-100-5p and miR-143-3p mimics reduced Rictor and Larp1 protein levels. [score:2]
e 3′UTR reporter assay for FRAP1 (mTOR) in hMSCs transfected with mimics (black) and inhibitors (grey) of miR-100-5p. [score:2]
Our findings indicate that both miR-100-5p and miR-143-3p enhance osteogenesis. [score:1]
To provide functional validation of the interaction of miR-100-5p with mTOR, we used a dual luciferase/alkaline phosphatase (ALP) reporter system to probe the interaction of miR-100-5p with the 3′UTR of FRAP1 (mTOR). [score:1]
On the 70kPa substrate, combining mimics of both miR-100-5p and miR-143-3p had a larger effect than modulating either miRNA individually. [score:1]
We provide an insight into the mechanism of action by showing that miR-100-5p and miR-143-3p converge on mTOR signalling. [score:1]
Of the miRNAs we tested, miR-100-5p and 143-3p had the most influence on hMSC differentiation and were observed to promote osteogenesis. [score:1]
This includes miR-21, which has been shown to mediate substrate mechanical memory of MSCs [27], miR-21, miR-100 and miR-5096 which changed in response to mechanical stretch in human periodontal ligament stem cells [28] and miR-494-3p, which was sensitive to compressive force in MC3T3-E1 cells [29]. [score:1]
This supports our premise that miR-100-5p and miR-143-3p exert their effects upon MSC fate via mTOR signalling. [score:1]
Fig. 4 miR-100-5p and miR-143-3p converge on mTOR signalling. [score:1]
This was particularly evident for the samples containing cells transfected with both miR-100-5p and 143-3p mimics which had significantly more mineral deposition than in cultures with either miRNA individually. [score:1]
[1 to 20 of 37 sentences]
12
[+] score: 92
Our findings thus highlight miR-100/ZNRF2 axis as a novel therapeutic target for inhibiting the growth of OS and for suppression of their potential of chemo-resistance. [score:7]
To summarize, here we provide evidence to suggest miR-100/ZNRF2 axis as a novel therapeutic target for inhibiting the growth of OS and for suppression of their potential of chemo-resistance. [score:7]
MiR-100 targets 3’-UTR of ZNRF2 to inhibit its expression. [score:6]
The intact 3’-UTR of ZNRF2 mRNA (ZNRF2 3’-UTR), or a 3’-UTR with a mutant at miR-100 -binding sites on ZNRF2 mRNA (ZNRF2 3’-UTR mut), was co -transfected with miR-100 -modified plasmids in a dual luciferase reporter assay, showing that miR-100 specifically targets 3’-UTR of ZNRF2 mRNA to inhibit its translation in OS cells (Figure 4C). [score:6]
Figure 6 (A-B) ZNRF2 suppression abolished the effects of as-miR-100 expression on cell growth (A) and chemo-sensitivity (B) in U2OS cells. [score:5]
We found that ZNRF2 suppression abolished the effects of as-miR-100 expression on cell growth (Figure 6A) and chemo-sensitivity (Figure 6B) in U2OS cells. [score:5]
Figure 7 MiR-100 inhibits OS cell growth and suppresses its chemo-sensitivity through ZNRF2. [score:4]
MiR-100 inhibits OS cell growth and suppresses its chemo-sensitivity through ZNRF2. [score:4]
Either ZNRF2 overexpression or miR-100 depletion increased in vitro OS cell growth and improved cell survival at the presence of Doxorubicin. [score:3]
These data suggest that miR-100 may suppress OS cell growth and chemo-resistance through ZNRF2 (Figure 7). [score:3]
Figure 4 (A) Bioinformatics analysis of ZNRF2 target sequence, which showed that miR-100 binds to 3’-UTR of ZNRF2 mRNA at 886 [th]-872 [th] base site. [score:3]
Third, in vivo application of gene therapy in animal mo dels of OS may provide in vivo data to better comprehend the effects of miR-100 re -expression in OS treatment. [score:3]
Next, we performed bioinformatics analysis on the ZNRF2 targeting sequence for miRNA, which showed the miR-100 -binding sites at 3’-UTR of ZNRF2 mRNA (Figure 4A). [score:3]
From the candidate ZNRF2 -targeting miRNAs, we specifically found miR-100 as an interesting one, since in the resected 28 OS specimens along with the paired normal bone tissue (NT) (Table 1), we detected significant changes in miR-100 levels (Supplementary Table 1). [score:3]
Although a diverse role of miR-100 has been reported in different cancers [20– 24], its effects on ZNRF2 expression specifically in OS has not been reported. [score:3]
Augmentation of ZNRF2 abolished the effects of miR-100 expression on cell growth (Figure 6C) and chemo-sensitivity (Figure 6D) in U2OS cells. [score:3]
Mechanistically, with the help of bioinformatics analysis and luciferase-reporter assay, we found that miR-100 might bind to the 3’-UTR of ZNRF2 mRNA to prevent its protein translation. [score:2]
In this study, we aimed to study the molecular mechanisms that underlie the regulation of the tumor growth of OS by miR-100 and ZNRF2. [score:2]
Low miR-100 appeared to be associated with poor prognosis of the OS patients. [score:1]
The plasmids that modifies miR-100 levels were prepared and validated (Figure 4B). [score:1]
Second, although we have checked cisplatin in our experimental settings and got similar results as DOX, additional chemotherapeutic drugs might be examined in miR-100 -modified cells in future. [score:1]
Next, U2OS cells were co -transfected with miR-100 and ZNRF2 (Figure 5C– 5D). [score:1]
The levels of ZNRF2 and miR-100 inversely correlated in the OS specimens. [score:1]
MiR-100, an antisense (as) of miR-100, and a null sequence (null) were similarly prepared. [score:1]
Specifically, the effects of as-miR-100 on ZNRF2 protein compromised the effects of shZNRF2 on ZNRF2 protein, which explained the findings in OS cells transfected with both as-miR-100 and shZNRF2 (Figure 5A– 5B). [score:1]
The median value of all 28 cases was chosen as the cutoff point for separating miR-100 -high cases (n=14) from miR-100-low cases (n=14). [score:1]
The ZNRF2 3’-UTR reporter plasmid and the ZNRF2 3’-UTR reporter plasmid with a mutant at miR-100 binding site were both purchased from Creative Biogene (Shirley, NY, USA). [score:1]
MiR-100 sequence is 5’- AACCCGUAGAUCCGAACUUGUG-3’, and as-miR-100 sequence is 5’-CACAAGUUCGGAUCUACGGGUU-3’. [score:1]
Figure 5 (A-B) U2OS cells were co -transfected with as-miR-100 and shZNRF2, and the levels of ZNRF2 were examined by RT-qPCR (A) and by (B). [score:1]
High levels of ZNRF2 and low levels of miR-100 are inversely correlated in OS. [score:1]
The median value of miRNA the 28 cases was chosen as the cutoff point, after which Kaplan-Meier curves were performed, showing that miR-100 -high OS patients had a significantly better survival (Figure 1D). [score:1]
Functional binding of 3’-UTR of ZNRF2 mRNA by miR-100. [score:1]
We specifically found that miR-100 was such a microRNA. [score:1]
First, U2OS cells were co -transfected with as-miR-100 and shZNRF2. [score:1]
Thus, decreased miR-100 in OS is associated with poor prognosis. [score:1]
MiR-100 regulates OS cell growth and chemo-sensitivity through ZNRF2. [score:1]
Previous studies have confirmed the importance of miRNAs in the tumorigenesis, but a role of miR-100 in the tumorigenesis is just acknowledged very recently [20– 24]. [score:1]
Moreover, a significant inverse correlation was found between ZNRF2 and miR-100 levels in OS specimens (Figure 1C, r= -0.72; p < 0.0001). [score:1]
[1 to 20 of 38 sentences]
13
[+] score: 86
Other miRNAs from this paper: mmu-mir-100
In the GC cells, HAGLROS knockdown by siRNAs caused miR-100-5p up-regulation (Fig. 5c), while overexpression of miR-100-5p by transfection with mimics caused HAGLROS down-regulation (Fig. 5d). [score:10]
The miR-100-5p mimics significantly reduced the luciferase activity, while the miR-100-5p inhibitor markedly strengthened it, indicating that mTOR was a direct target of miR-100-5p. [score:6]
c miR-100-5p expression was examined in SGC-7901 and BGC-823 cells with HAGLROS knockdown by siRNAs, and HAGLROS expression was tested to determine the transfection efficiencies. [score:6]
In the one hand, HAGLROS competitively sponged miR-100-5p to increase mTOR expression by antagonizing miR-100-5p -mediated mTOR mRNA inhibition. [score:5]
HAGLROS overexpression negated the decrease in luciferase activity induced by overexpressing miR-100-5p (Fig. 6d). [score:5]
Mechanistic studies showed that HAGLROS regulated mTOR signaling by functioning as a competing endogenous RNA (ceRNA), which suppressed the degradation of mTOR mRNA by competing with miR-100-5p. [score:4]
Moreover, the expression of miR-100-5p and HAGLROS showed an inverse correlation in tumor samples in the higher expression of HAGLROS in GC compared to the adjacent non-cancerous tissue (Fig. 5e). [score:4]
To verifying this hypothesis, the 3′-UTR of mTOR was cloned into a luciferase vector and transfected into 293T cells together with miR-100-5p mimics, an miR-100-5p inhibitor or a negative control. [score:3]
Our study demonstrates that the GC -associated lncRNA HAGLROS is an oncogenic lncRNA that promotes tumorigenesis and progression through mTOR pathway -mediated autophagy suppression by serving as a ceRNA for miR-100-5p and as a cytoplasmic scaffold to bind mTORC1. [score:3]
These results show that HAGLROS and miR-100-5p are competitively expressed. [score:3]
On the one hand, HAGLROS functions as a ceRNA to increase mTOR mRNA expression through competing with miR-100-5p, on the other hand, HAGLROS binds mTORC1 key proteins to activate the complex and finally participates in cellular biological processes. [score:3]
c The effect of miR-100-5p overexpression by transfection with miR-100-5p mimics on mTOR mRNA level in GC cells. [score:3]
The fact that transfection of miR-100-5p mimics attenuated mTOR mRNA levels (Fig. 6c) suggested that mTOR might be the target of miR-100-5p. [score:3]
Endogenous HAGLROS pull-down by AGO2 was significantly enriched in miR-100-5p -overexpressing cells (Fig. 5g). [score:3]
The 3′-UTR of mTOR was cloned into the luciferase vector and transfected into 293T together with miR-100-5p mimics, the miR-100-5p inhibitor, the HAGLROS plasmid or the negative control. [score:3]
d Relative luciferase activity of mTOR mRNA 3’-UTR was determined after transfection with miR-100-5p mimics, miR-100-5p inhibitor or HAGLROS plasmid. [score:3]
We performed anti-AGO2 RIP to detect whether HAGLROS was regulated by miR-100-5p in an AGO2 -dependent manner. [score:2]
e The expression of miR-100-5p in tumor samples of GC compared to adjacent non-cancerous tissues. [score:2]
Subsequently, the 3′-UTR of mTOR was co -transfected with the HAGLROS plasmid and miR-100-5p mimics. [score:1]
This result implied that HAGLROS bound to miR-100-5p and released mTOR from miR-100-5p, further demonstrating the existence of HAGLROS-mTOR crosstalk through competition for miR-100-5p binding. [score:1]
Fig. 5Subcellular localization of HAGLROS and its “sponge” function as a ceRNA competing with miR-100-5p. [score:1]
lncRNA HAGLROS miR-100-5p mTOR Gastric cancer Autophagy Recent evidence indicates that although more than 70% of the eukaryotic genome is transcribed, only approximately 1 to 2% of the transcriptome contributes to protein-coding RNA, suggesting that transcription is not limited to the protein-coding portion of the eukaryotic genome but includes other non-protein-coding sections [1, 2]. [score:1]
HAGLROS functions as a ceRNA to antagonize miR-100-5p -mediated mTOR mRNA degradation. [score:1]
b Bioinformatic analysis of the interactions of HAGLROS with miR-100-5p and mTOR mRNA. [score:1]
; HAGLROS and mTOR interact through competition for miR-100-5p binding. [score:1]
php) software suggested that HAGLROS could bind both miR-100-5p and mTOR mRNA (Fig. 6b). [score:1]
The miR-100-5p sequence was synthesized, inserted into the pGL3-basic vector and co -transfected with wild-type and mutant HAGLROS (the binding site for miR-100-5p was mutated) plasmid into 293T cells. [score:1]
d HAGLROS levels were examined in SGC-7901 and BGC-823 cells transfected with miR-100-5p, and miR-100-5p levels were tested for transfection efficiencies. [score:1]
Error bars indicate the means ± S. E. M. * P < 0.05, ** P < 0.01, # P < 0.05To further determine the interaction of miR-100-5p and HAGLROS, we constructed luciferase vectors of wild-type and mutant HAGLROS (the binding site for miR-100-5p was mutated). [score:1]
php) software suggested that HAGLROS could bind both miR-100-5p and the Argonaute 2 (Ago2) protein. [score:1]
Error bars indicate the means ± S. E. M. * P < 0.05, ** P < 0.01, # P < 0.05 To further determine the interaction of miR-100-5p and HAGLROS, we constructed luciferase vectors of wild-type and mutant HAGLROS (the binding site for miR-100-5p was mutated). [score:1]
HAGLROS, as a mainly cytoplasmic lncRNA, serves as a sponge for miR-100-5p. [score:1]
Fig. 6HAGLROS antagonized miR-100-5p -mediated mTOR mRNA degradation. [score:1]
[1 to 20 of 33 sentences]
14
[+] score: 82
MiR-21 and miR-100 inhibition causes an increase of the expression levels of their target genes while miR-192 overexpression decreases target gene expression levels (B) In vitro modulation of miR-21, miR-100 and miR-192 expression result in a reduction of HSC activation. [score:15]
On the contrary, an inhibition of the endogenous miR-100 expression level enhanced the expression of its two predicted target genes, i. e. BTG2 and SPARCL1, but also caused a ~20% reduction of the basal expression of pro-fibrogenic genes such as COL1A1 and LOX. [score:11]
Indeed, 66% of miRNAs expressed in qHSCs were associated with at least 6 target genes with an average of 17,28 ± 10,7 target genes per miRNA, whereas we did not find any miRNA up regulated in aHSCs with more than 4 predicted targets except for miR-100 (Fig. 3B). [score:10]
MiR-100 is the up-regulated miRNA following HSC activation and has the highest number of predicted targets and miR-21 is not only up-regulated in activated HSC but also in human cirrhotic tissue. [score:9]
In concordance with the integrative analysis, functional in vitro assays showed that mir-100 inhibition resulted in SPARCL1 up-regulation and in a significant reduction of COL1A1 and LOX expression levels. [score:7]
Primer sequences used are listed in Supplementary Table 3. In vitro modulation of miRNA expression in human HSCs (LX2)In order to validate relevant miRNA-mRNA interactions resulting from the integrative analysis, miR-21 and miR-100 expression were knocked down and miR-192 was over-expressed in a human HSC cell line (LX2) (kindly provided by Dr. [score:7]
Reduction of miR-21 and miR-100 expression and up-regulation of miR-192 in LX2 cells was achieved by transfecting miR-21 antagomir (50 nM), miR-100 antagomir (50 nM) or miR-192 mimic (50 nM), respectively (n = 3). [score:6]
Among all miRNAs found highly expressed in aHSCs, miR-100 is the miRNA with the highest number of predicted target genes. [score:5]
Primer sequences used are listed in Supplementary Table 3. In order to validate relevant miRNA-mRNA interactions resulting from the integrative analysis, miR-21 and miR-100 expression were knocked down and miR-192 was over-expressed in a human HSC cell line (LX2) (kindly provided by Dr. [score:5]
LX2 cells were transfected with 50 nM of mirVana [TM] miRNA Inhibitor for miR-21 and miR-100 and mirVana [TM] miRNA mimic for miR-192 (Life Technologies) using JetPRIME® (PolyPlus, Illkirch, France) according to the manufacturer’s recommendations. [score:3]
In vitro modulation of miRNA-21, miRNA-100 and miRNA-192 expression in LX2 cells. [score:3]
As a control miRNA we used miR-100 and miR-21. [score:1]
[1 to 20 of 12 sentences]
15
[+] score: 71
While miR-100 and miR-143 target NPR3 to downregulate its expression, both microRNAs were also observed to regulate MIR143HG promoter activity suggesting possible cross talk between the two NPR3 -targeting microRNAs. [score:11]
To further examine the interaction of miR-100 and miR-143 with predicted target sites on the promoter region of MIR143HG, mutations were introduced into selected transcriptional response elements that contain over 90% complementary base pair matching with the mature seed region of micro-143 and miR-100, namely −1504 bp and −2171 bp (miR-143 target sites), as well as −44 bp, and −1439 bp (miR-100 target sites) with respect to the transcription start site on the MIR143HG promoter region. [score:8]
Second, the upregulated miR-100 levels observed in multiple cardiovascular cells after knock down of miR-143 expression under both normoxic and hypoxic conditions (Supplemental data 1). [score:7]
Notably, miR-100 was found to target NPR3 3′UTR and is differentially upregulated in the plasma of heart failure patients, suggesting a plausible microRNA -based compensatory mechanism in response to cardiac overload. [score:6]
To examine the possible microRNA-directed transcriptional regulation of MIR143HG, miR-143 and miR-100 mimics were co -transfected with the pMIR143HG-containing vector and the relative strength of promoter activities in driving luciferase reporter expression in transfected cells was determined. [score:5]
This finding was corroborated by the observed upregulation of miR-100 in multiple cardiovascular cell lineages after knock down of the endogenous miR-143 levels using antagomiR-143 (Supplemental data 1). [score:5]
Nevertheless, the changes in MIR143HG promoter activities after treatment with miR-100 and miR-143 mimics reflect the complexity of microRNA-directed regulatory mechanisms in gene expression. [score:5]
This finding indicates that complementary base pairing of miR-100 and miR-143 with predicted motifs in the promotor region might play role(s) in microRNA-directed transcriptional modulation of the expression of MIR143HG. [score:4]
In recent published work, our group used multiple platforms to demonstrate the regulatory effects of miR-100 on the expression of NPR3 [13]. [score:4]
This hypothesis is supported by two lines of evidence, first, the observation of diminished regulatory effect of miR-100 and miR-143 on luciferase activity in cells that harbor mutations on the MIR143HG promoter. [score:3]
Feedforward regulation of miR-143 and miR-100 on the MIR143HG promoter activity. [score:2]
Figure 6 Schematic diagram of hypoxia -induced transcriptional activation of MIR143HG and the proposed microRNA directed transcriptional modification by miR-143 and miR100 in cardiac cells. [score:2]
Intriguingly, the promoter activity of MIR143HG was enhanced in the presence of exogenous miR-143, but was suppressed by the exogenous miR100 compared to scrambled controls (Fig.   4a). [score:2]
In the 2-Kb MIR143HG promoter region, 7 and 4 putative binding sites were identified for miR-143 and miR-100, respectively (Tables  2 and 3). [score:1]
Location Sequence alignment Transcriptional factors −44pMIR143HGmiR-1005′-C CCGCCTCG CCCCAA TACGGGGC-3′3′- GUGUUCAA GCCUAG AUGCCCAA-5′ GR-β, Pax-5, P53 and NFI/CTF −639pMIR143HGmiR-1005′-GCTGG GTCA GGATCTT CCCTG T-3′3′-GUGUU CAAG CCUAGAU GCCCA A-5′ TFII-I, STAT4, NF-κB, RelA and RAR-α −1439pMIR143HGmiR-1005′- CACAAGGC CCCG TG TG CT GC TG-3′3′- GUGUUCAA GCCU AG AU GC CC AA-5′ GR-α, AP-2αA, Pax-5 and P53 −2112pMIR143HGmiR-1005′- CACAAGCCTTCCCTA ACCCACC-3′3′- GUGUUCAAGCCUAGA UGCCCAA-5′ C/EBPβ The promoter position of the nucleotide with respect to the transcription start site (defined as position 0) that is aligned to the 3′ end of each putative miR-100 binding site in MIR143HG promoter region is indicated under the “Location” column. [score:1]
In the current study, the effects of miR-143 and miR-100 on MIR143HG and MIR100HG promoter activities suggest possible cross talk between the two microRNAs. [score:1]
The negative modulation of the transcriptional activity of miR-100 host gene, MIR100HG, was also observed when treated with exogenous miR-143 (Fig.   4b). [score:1]
Luciferase reporter analyses showed that miR-100 and miR-143 fail to modulate the luciferase activities in cardiac cells that harbor the corresponding mutated MIR143HG promoter constructs (Fig.   4a). [score:1]
Sequence analysis of the promoter region of MIR143HG revealed the presence of several specific sequence motifs (~6–7 nucleotides) that are complementary to mature miR-143 and miR-100. [score:1]
Figure 4Differential promoter activities of MIR143HG and MIR100HG in the presence of exogenous miR-100 or miR-143 in HCMa cells. [score:1]
[1 to 20 of 20 sentences]
16
[+] score: 66
Has-miR-100 and has-miR-125b down-regulation were significantly associated with poorer survival, and has-let-7c, has-miR-143, has-miR-145 and has-miR-199a-5p down-regulation tended to predict poorer survival, although these results were not statistically significant. [score:7]
0033762.g004 Figure 4 Has-miR-100 and has-miR-125b down-regulation were significantly associated with poorer survival, and has-let-7c, has-miR-143, has-miR-145 and has-miR-199a-5p down-regulation tended to predict poorer survival, although these results were not statistically significant. [score:7]
Kaplan–Meier survival analyses revealed that the SCCC patients with low expression of has-miR-100 (P = 0.019) and has-miR-125b (P = 0.020) had a poorer prognosis compared to patients with high expression of these miRNAs, while has-let-7c (P = 0.071), has-miR-143 (P = 0.064), has-miR-145 (P = 0.072) and has-miR-199a-5p (P = 0.056) down-regulation tended to adversely affect survival. [score:7]
In this study, we observed that downregulation of six miRNAs (has-let-7c, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p) is associated with advanced tumor stage, lymph node metastasis and poorer survival in SCCC patients (Table 1 ), suggesting that clustering analysis based on miRNA expression may facilitate a detailed individual diagnosis of SCCC patients. [score:6]
Since variables observed to have prognostic influence by univariate analysis may covariate, the downregulation of has-miR-100, has-miR-125b as well as FIGO stage that were significant in univariate analysis were examined in multivariate analysis (Table S1). [score:4]
Among, downregulation of six miRNAs, has-let-7c, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p were significantly associated with lymph node metastasis and reduced survival in SCCC. [score:4]
Interestingly, of the nine miRNAs associated with metastasis, downregulation of has-let-7c, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p were also significantly correlated with advanced tumor stage as described above. [score:4]
In conclusion, this study has revealed that downregulation of has-let-7c, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p are significantly correlated with advanced tumor stage, lymph node metastasis and poorer survival in SCCC. [score:4]
As several other miRNAs, including has-let-7c, has-miR-100 and has-miR-125b are also downregulated in SCCC, we aim to determine whether detection and analysis of combined miRNA profiles can determine the prognosis of SCCC patients more precisely in future studies. [score:4]
Kaplan–Meier survival analyses revealed that SCCC patients with low expression of has-miR-100 (P = 0.019) and has-miR-125b (P = 0.020) projected a significant tendency towards poorer prognosis. [score:3]
Kaplan-Meier estimates of overall survival in 44 patients with stage small cell carcinoma of the cervix according to has-let-7c (A), has-miR-100 (B), has-miR-125b (C), has-miR-143 (D), has-miR-145 (E) andas-miR-199a-5p expression (F). [score:3]
Seven miRNAs, has-let-7c, has-miR-10b, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p were significantly down-regulated in advanced stage SCCCpatients (FIGO IB2-IV) compared to early stage SCCC patients (FIGOIB1). [score:3]
We found that downregulation of has-miR-100 was evaluated as an independent risk factor for patient survival (hazards ratio: 0.161; 95% confidence interval: 0.036–0.814; P = 0.044). [score:2]
The sensitivity and specificity of discriminate early from advanced tumour stages for each miRNA were plotted: has-let-7c (P = 0.009), has-miR-100 (P = 0.002), has-miR-125b (P = 0.003), has-miR-143 (P = 0.006), has-miR-145 (P = 0.004), has-miR-199a-5p (P = 0.015). [score:1]
0033762.g006 Figure 6The sensitivity and specificity for each miRNA were plotted: (A) has-let-7c (P = 0.030); (B) has-miR-100 (P = 0.025); (C) has-miR-125b (P = 0.007); (D) has-miR-143 (P = 0.016); (E) has-miR-145 (P = 0.009); (F) has-miR-199a-5p (P = 0.008). [score:1]
The sensitivity and specificity for each miRNA were plotted: (A) has-let-7c (P = 0.009); (B) has-miR-100 (P = 0.002); (C) has-miR-125b (P = 0.003); (D) has-miR-143 (P = 0.006); (E) has-miR-145 (P = 0.004); (F) has-miR-199a-5p (P = 0.015). [score:1]
We also identified nine miRNAs (has-let-7c, has-miR-31, has-miR-100, has-miR-125b, has-miR-143, has-miR-145, has-miR-199a-5p, has-miR-203 and has-miR-218) which could significantly discriminate between tumor tissues from patients with metastasis (M, n = 13) and without metastasis (NM, n = 31, P<0.05). [score:1]
Similarly, the sensitivity and specificity of discriminate presence or absence of lymph node metastasis for each miRNA were: has-let-7c (P = 0.030, has-miR-100 (P = 0.025), has-miR-125b (P = 0.007), has-miR-143 (P = 0.016), has-miR-145 (P = 0.009), has-miR-199a-5p (P = 0.008). [score:1]
The sensitivity and specificity for each miRNA were plotted: (A) has-let-7c (P = 0.030); (B) has-miR-100 (P = 0.025); (C) has-miR-125b (P = 0.007); (D) has-miR-143 (P = 0.016); (E) has-miR-145 (P = 0.009); (F) has-miR-199a-5p (P = 0.008). [score:1]
Has-let-7c, has-miR-10b, has-miR-100, has-miR-125b, has-miR-143, has-miR-145 and has-miR-199a-5p were significantly down- regulated in advanced stage SCCC, compared to early stage SCCC. [score:1]
0033762.g005 Figure 5The sensitivity and specificity for each miRNA were plotted: (A) has-let-7c (P = 0.009); (B) has-miR-100 (P = 0.002); (C) has-miR-125b (P = 0.003); (D) has-miR-143 (P = 0.006); (E) has-miR-145 (P = 0.004); (F) has-miR-199a-5p (P = 0.015). [score:1]
[1 to 20 of 21 sentences]
17
[+] score: 55
Other miRNAs from this paper: hsa-mir-21, hsa-mir-222, hsa-mir-223, hsa-mir-126
Indeed, data reported in Fig 5C and 5D demonstrate that miR-100 can, when its expression is favoured with respect to miR-21, drive signals, mediated by mTOR down-regulation, which result in the inhibition of MC TGFβ expression and collagen production. [score:10]
EV -mediated miR-21 down-regulation can promote miR-100 post-transcriptional activity which contributes to the inhibition of collagen production. [score:6]
Over -expression of miR-100 in HG -treated MCs impairs mTOR and TGFβ expression and collagen production. [score:5]
Moreover, we provide evidence that EVs may also indirectly contribute to the inhibition of collagen production by driving changes in the balance between miR-21 and miR-100 in the recipient cell. [score:4]
Again, miR-100 over -expression did not impact on LG-cultured MCs (Fig 5C and 5D). [score:3]
In the present study, we analyse the effects of EVs that were released from different stem cell sources on HG -induced collagen production and mitochondria damage, while paying particular attention to their effects on STAT5A, miR-21, miR-222, miR-100 and TGFβ expression. [score:3]
Although miR-100 content increases in HG -treated MC cells, possibly as a protective mechanism, its expression did not change upon EV treatment. [score:3]
The effect of miR-100 over -expression did not further increase after EVs treatment (data not shown). [score:3]
We herein provide evidence that the increase in miR-100 content in HG -treated cells is associated with the reduced expression of mTOR, TGFβ and collagen production. [score:3]
This, in turn, by changing the balance between miR-21 and miR-100, may result in miR-100 post-transcriptional regulation of mTOR. [score:2]
We did not provide data on a direct correlation between miR-21 and miR-100. [score:2]
However, as the balance of intracellular miRs directs specific biological responses, we hypothesized that the decreased miR-21 intracellular content associated with EV treatment could favour miR-100 post-transcriptional activity. [score:2]
First, miR-100 expression was evaluated in MCs subjected to EV treatment. [score:1]
were performed in MCs cultured in LG or HG that had either been transfected with the pre-miR negative control or the pre-miR-222, pre-miR-223 or pre-miR-100 precursor oligonucleotides (Applied Biosystem), according to manufacturer’s instructions. [score:1]
Other potential therapeutic miRs were identified by investigating MSC and HLSC EV content, including miR-100 [27], which has been shown to target mTOR [37]. [score:1]
RNA from cells was then reverse-transcribed either using a TaqMan microRNA RT kit, that is specific for miR-222 and miR-223, or a Syber Green microRNA RT Kit specific for miR-21 and miR-100. [score:1]
As shown in Fig 5A, while miR-100 MC content increased upon HG treatment, no changes in its content were detected after EV treatment. [score:1]
0162417.g005 Fig 5 (A) miR-100 expression was evaluated by qRT-PCR on 48h LG- and HG-cultured MCs, either alone or in combination with MSC-EVs or HLSC-EVs for 18h. [score:1]
To validate this hypothesis, gain-of function experiments using pre-miR-100 were performed in HG -treated MCs (Fig 5B). [score:1]
However, as the balance of intracellular miR content that occurs after EV treatment is able to change the biological response of the cell, we attempted to mimic such an event by performing gain-of-function experiments using pre-miR-100. [score:1]
Changes in the balance between miR-21 and miR-100 may also contribute to EV action. [score:1]
[1 to 20 of 21 sentences]
18
[+] score: 52
, High Wycombe, UK) analysis of 1733 human microRNAs and validation by qRT-PCR showed microRNA-21, microRNA-99a, microRNA-100, microRNA-125b, microRNA-138, microRNA-147b, microRNA-148a, microRNA-210, microRNA-376a, and microRNA-455-3p to be significantly upregulated, whereas microRNA-31-star, microRNA-330-3p, microRNA-330-5p, microRNA-378d, microRNA-422a, and microRNA-486-5p were significantly downregulated. [score:7]
MicroRNA-21 (p = 4.3817E-07), microRNA-31 (p = 0.0003), microRNA-99a (p = 0.0406), microRNA-100 (p = 4.0492E-08), microRNA-125b (p = 0.0001), microRNA-138 (p = 0.0301), microRNA-147b (p = 0.0028), and microRNA-210 expression (p = 0.0044) were significantly upregulated in PDAC stage II vs. [score:6]
Interestingly, co-overexpression of miR-125b, miR-99a, and miR-100 was reported in different cancers suggests possible co-regulation of these miRs in chemoresistant PDAC as well [30, 31]. [score:4]
In particular, microRNA-21 and microRNA-100 show promise as molecular markers and key regulators for targeted therapies in chemorefractive PDAC patients. [score:4]
p < 0.05 indicates significance Kaplan-Meier survival analysis revealed significantly improved overall survival and recurrence-free survival rates in PDAC patients with low expression of microRNA-21 (cutoff 4.7; p = 0.0181; p = 0.0149), microRNA-99a (cutoff 2.5; p = 0.0325; p = 0.1711), microRNA-100 (cutoff 5.0; p = 0.0004; p = 0.0111), microRNA-125b (cutoff 1.6; p = 0.0491; p = 0.0373), and microRNA-210 (cutoff 4.6; p = 0.0161; p = 0.0116) in the adjuvant setting (Fig.   4). [score:3]
Co -expression of microRNA-21 and microRNA-100 as remaining independent prognostic factors results in a hazard ratio of 2.620 (95 % CI 1,251-5,487) and 3.543 (95 % CI 1.504-8.345), respectively. [score:3]
p < 0.05 indicates significanceKaplan-Meier survival analysis revealed significantly improved overall survival and recurrence-free survival rates in PDAC patients with low expression of microRNA-21 (cutoff 4.7; p = 0.0181; p = 0.0149), microRNA-99a (cutoff 2.5; p = 0.0325; p = 0.1711), microRNA-100 (cutoff 5.0; p = 0.0004; p = 0.0111), microRNA-125b (cutoff 1.6; p = 0.0491; p = 0.0373), and microRNA-210 (cutoff 4.6; p = 0.0161; p = 0.0116) in the adjuvant setting (Fig.   4). [score:3]
MicroRNA-100, microRNA-21, and its targets PTEN and MDR-1 were independent factors of survival in multivariate analysis. [score:3]
After normalization to benign noninflammatory controls (n = 13) by the ΔΔCt method, poor adjuvant gemcitabine mono-chemotherapy response was significantly related to overexpression of microRNA-21 (p = 0.0366), microRNA-99a (p = 0.0163), microRNA-100 (p = 0.0157), and microRNA-210 (p = 0.0252) (Fig.   3). [score:3]
Instead, we identified microRNA-100 and microRNA-21 with its targets PTEN and MDR-1 as independent prognostic survival and chemotherapy response markers in PDAC UICC stage II patients. [score:3]
Poor response to chemotherapy was significantly correlated to overexpression of microRNA-21 (p = 0.029), microRNA-99a (p = 0.037), microRNA-100 (p = 0.028), and microRNA-210 (p = 0.021) in tissue samples of PDAC patients UICC stage II. [score:3]
Fig. 3The 2 [-ΔΔCt] expression level of microRNA-21 (a), microRNA-99a (b), microRNA-100 (c), and microRNA-210 (d) in PDAC UICC stage II with good and bad response. [score:3]
microRNA-99a and microRNA-100, two members of the microRNA-99 family, were found to be overexpressed in PDAC tissue compared with normal pancreatic tissue and chronic pancreatitis [25]. [score:2]
p < 0.05 indicates significance Multivariate Cox regression overall and recurrence-free survival analyses identified microRNA-21 (p = 0.0064; p = 0.0338), microRNA-100 (p = 0.0045; p = 0.1683), and MDR-1 (p = 0.0003; p = 0.0021) as unfavorable prognostic factors while PTEN (p = 0.1008; p = 0.0211) was a favorable prognostic factor in resected and adjuvantly treated PDAC UICC stage II patients (Table  6). [score:1]
In addition to microRNA-21, microRNA-100 remained as a further independant prognostic survival and chemotherapy response marker in multivariate analysis. [score:1]
Fig. 4Prognostic impact of microRNA-21 (a, b), microRNA-99a (c, d), microRNA-100 (e, f), microRNA-125b (g, h), and microRNA-210 (i, j) on overall survival (right column) and recurrence-free survival (left column) in PDAC UICC stage II patients. [score:1]
Univariate Cox regression overall and recurrence-free survival analyses identified microRNA-21 (p = 0.0231; p = 0.0211), microRNA-99a (p = 0.0393; p = 0.1864), microRNA-100 (p = 0.0013; p = 0.0163), microRNA-125b (p = 0.0578; p = 0.0472), and microRNA-210 (p = 0.0211; p = 0.0168) as unfavorable prognostic factors in resected and adjuvant -treated PDAC UICC stage II patients (Table  5). [score:1]
Multivariate survival analyses identified microRNA-21 and microRNA-100 as unfavorable prognostic factors in resected and adjuvant treated PDAC UICC stage II patients. [score:1]
[1 to 20 of 18 sentences]
19
[+] score: 52
While miR-221, miR-125b, miR-34a and miR-100 were up-regulated and miR-130b, miR-210 and miR-185 were down-regulated in obese subjects; miR-130b and miR-210 were both down-regulated during differentiation and in subcutaneous fat depots from obese subjects. [score:10]
Of note there, miR-10a, miR-34a, miR-100 (in both pre-adipocytes and mature adipocytes), miR-210 and miR-99a (only in mature adipocytes) were up-regulated in cell lines from obese subjects (Table 1) and correlated with BMI [Table S3] while miR-221 (in both pre-adipocytes and adipocytes), miR-210 (in pre-adipocytes) and miR-125b (in adipocytes) were significantly down-regulated (Table 1). [score:7]
However, some miRNAs were down-regulated during adipocyte differentiation and maturation (miR-221, miR-125b and miR-100) while up-regulated in obese subjects. [score:7]
Both miR-221 and miR-222 have been described to inhibit endothelial cell migration, proliferation, and angiogenesis [29] while down-regulation of miR-100 and miR-125b has been associated with some malignancies [30]. [score:6]
1) Differential miRNA Expression between Lean and Obese Cell Lines before and after In Vitro Differentiation and during Adipogenesis MiR-10a (in both pre-adipocytes and mature adipocytes), miR-34a, miR-100, miR-30a (only in pre-adipocytes), miR-99a and miR-210 (only in mature adipocytes) were up-regulated in cells and subcutaneous fat depots from obese when compared to those obtained from lean individuals. [score:5]
Of note were miR-221, miR-222, miR-100 and miR-125b, down-regulated during adipogenesis and associated with BMI in human adipose tissue samples. [score:4]
Importantly, among these 15 miRNAs, miR-130b (r = −0.406, p = 0.032), miR-210 (r = −0.362, p = 0.049), miR-100 (r = 0.411, p = 0.030), miR-221 (r = 0.436, p = 0.020) and miR-125 (r = 0.477, p = 0.010) were down-regulated during differentiation. [score:4]
MiR-10a (in both pre-adipocytes and mature adipocytes), miR-34a, miR-100, miR-30a (only in pre-adipocytes), miR-99a and miR-210 (only in mature adipocytes) were up-regulated in cells and subcutaneous fat depots from obese when compared to those obtained from lean individuals. [score:3]
Our findings are also in agreement with those of Esau et al. [27], that identified a similar expression pattern regarding miR-30c, miR-30a*, miR-30d, miR-196, miR-107, miR-30b and miR-100 during differentiation of human adipocytes. [score:3]
In the 3T3-L1 cell line, the findings with miR-100, miR-107, miR-148a and miR-30c were similar to those described here in human adipocytes [11]. [score:1]
IntegratedSeveral miRNAs, namely miR-221, miR-125b, miR-100, miR-130b, miR-210, miR-30a*, miR-34a, miR-503 and miR-185, were outstanding when integrating results from cells and subcutaneous fat tissue together. [score:1]
Several miRNAs, namely miR-221, miR-125b, miR-100, miR-130b, miR-210, miR-30a*, miR-34a, miR-503 and miR-185, were outstanding when integrating results from cells and subcutaneous fat tissue together. [score:1]
[1 to 20 of 12 sentences]
20
[+] score: 49
MiR-100, another important consistent expressed miRNA in this study, may be as another candidate biomarker in ovarian cancer, which has been reported to be down-regulated in 5 profiling studies but up-regulated only in one study. [score:9]
Additionally, miR-100 inhibited cell proliferation by suppressing mTOR in esophageal squamous cell carcinoma (ESCC) cell lines and Low miR-100 expression was associated with worse overall survival in ESCC patients [26]. [score:7]
Conclusively, this systematic review and validation experiment demonstrated four up-regulated miRNAs (miR-200a, miR-200b, miR-200c and miR-141) and one down-regulated miRNA (miR-100) are promising important candidate biomarkers for EOC. [score:7]
It is that MiR-100 was down-regulated and the others all up-regulated in EOC tissues. [score:6]
To validate the expression of the five most consistently reported miRNAs (miR-200a, miR-100, miR-141, miR-200b, and miR-200c), that may be the candidate biomarkers for EOC, the expression of these miRNAs between EOC and normal ovarian tissues were compared using qRT-PCR analysis. [score:4]
Figure 1 qRT-PCR analysis of miR-200a, miR-100, miR-141, miR-200b, and miR-200c expressions in the EOC and normal ovarian tissues. [score:3]
Thus, they suggested the miR-100/PLK1 signaling pathway may provide therapeutic targets for human EOCs [17]. [score:3]
Recently, Peng et al. showed that miR-100 can significantly inhibit growth of EOC cells by targeting PLK1 (Polo-like kinase-1) and more importantly, miR-100 may be as an independent predictor for the prognosis evaluation of ovarian cancer patients. [score:3]
More importantly, 5 differentially miRNAs (miR-200a, miR-100, miR-141, miR-200b, and miR-200c) were reported with the consistent direction among four or more studies (Table  5). [score:2]
MiR-100 represses mTOR (mammalian target of rapamycin) signaling and increases sensitivity to the cancer drug everolimus (rapamycin analog RADOO1) in cell lines derived from clear cell carcinomas [24]. [score:2]
Excitingly, among the 17 miRNAs, 5 promising differentially miRNAs (miR-200a, miR-100, miR-141, miR-200b, and miR-200c) were reported with the consistent direction in four or more studies. [score:2]
MiR-200a and miR-100 were reported in 6 studies; MiR-141 and miR-99a were reported in 5 studies; MiR-200b and miR-200c were reported in 4 studies and 11 miRNAs (miR-143, miR-145, miR-214, miR-134, miR-154, miR-424, miR-29a, miR-21, miR-10b, miR-26a, and let-7d) were reported in 3 studies. [score:1]
[1 to 20 of 12 sentences]
21
[+] score: 40
Cells were transfected by separated with 25 μM of miR100-5p (overexpressed in all exosomes), miR21-5p (overexpressed in bulk cell exosomes) and miR139-5p (overexpressed in CSCs exosomes). [score:7]
The highly expressed hsa-miR-100-5p and hsa-miR-21-5p, and the differentially expressed hsa-miR-139-5p and hsa-miR-30c-5p, were detected in bulk cells and CSCs, and also in their exosomes. [score:5]
For the most expressed miRNA, hsa-miR100-5p, the bioinformatics analysis showed regulatory effects in cell proliferation, differentiation from epithelial cells and osteoblasts (Table 3). [score:4]
miR-100 also increased MMP-2 and -13 but it had no effect on MMP-9. miR-139 also regulated the expression of all MMPs. [score:4]
hsa-miR-100-5p was expressed more than 10 times over the other miRNAs, with no differences at the exosome origin. [score:3]
Transfection with miR-100, miR-21 and miR-139 increased significantly the expression of RANKL in fibroblasts at protein (Figure 7A and 7C) and mRNA levels (Figure 7B) that could act as a paracrine factor for cancer cells. [score:3]
Effect of miRNA-100, -21, -139 and let 7c transfection of WPMY-1 cells on MMP-2, -9 and -13 and RANKL expression at 48 hours post-transfection. [score:3]
miR-100, together with miR-let7c and miR-218 is significantly overexpressed in localized PCa (similar to the type of cells that we analyzed in our study) when compared with metastatic carcinoma [35]. [score:2]
miR-100 has been related with prostatic carcinogenesis with a controversial role. [score:1]
From them, hsa-miR-100-5p and hsa-miR-21-5p were the most abundant miRNAs in exosomes from bulk and CSCs. [score:1]
From these, hsa-miR-100-5p was the most abundant miRNA in all samples analyzed (Figure 4). [score:1]
Effect of miRNA-100, -21, -139 and let 7c transfection on migration of WPMY-1 cells. [score:1]
Then, cells were transfected separately with the miRNAs miR-100, miR-21 and miR-139. [score:1]
The most abundant, miR-100-5p and miR-21-5p were previously described in the top 10 miRNAs in exosomes from human esophageal cancer cells [28]. [score:1]
Functional analysis for hsa-miR-100-5p for selected biological processes. [score:1]
Finally, for the new targets genes prediction the mirMap bioinformatics software [73] was utilized with a pValue threshold of 0.01. cDNA was synthetized from miRNA samples (300 ng) from exosomes and cells with the TaqMan [®] MicroRNA Reverse Transcription Kit (Lifetechnologies) using a pool of primers included in the TaqMan miRNA assays for hsa-miR-100, hsa-miR-21-5p, hsa-miR-139-5p, hsa-miR-30c and U6 snRNA according to manufacturer's instructions. [score:1]
hsa-miR100-5p was the most abundant miRNA in PCa exosomes. [score:1]
[1 to 20 of 17 sentences]
22
[+] score: 35
42, 56 Mir-100 directly targets these genes in mammary epithelial cells, imposing epithelial-to-mesenchymal transition (EMT) through downregulation of their expression (Supplementary Figure S7A). [score:8]
Consistent with published findings, our LC-MS/MS proteomic data demonstrates that the protein expression levels of both SMARCA5 and HOXA1 are significantly reduced upon SEN of hADSCs (Supplementary Figure S7B) in accordance with endogenous upregulation of mir-100-5p (Fig.   2d). [score:6]
Notably, both SMARCA5 and HOXA1 mRNA levels in SEN cells do not show significant downregulation when compared to SR cells, thus suggesting that mir-100-5p operates via the translational repression pathway illustrated in Fig.   3a (right panel). [score:5]
To verify the validity and sensitivity of our integrated approach for the identification of SA-miRNA target genes, we evaluated gene expression of two previously established targets of mature mir-100 from the MIR100HG locus, the HOXA1 and SMARCA5 genes. [score:5]
Three out of four upregulated ncRNA loci (Fig.   2b) encode polycistronic transcripts that could be processed to yield multiple miRNAs (Fig.   2b): chr11: MIR100HG (encoding mir-125b1, mir-let7a-2, mir-100), chr13: MIR17HG (encoding mir-17, mir-18a, mir-19a, mir-20a, mir-19b-1, mir-92a-1) and chr22: MIRLET7BHG (encoding mir-3619, mir-let7a-3, mir-4763, mir-let-7b). [score:4]
Chen D miR-100 induces epithelial-mesenchymal transition but suppresses tumorigenesis, migration and invasion PLoS Genet. [score:3]
a Percentage of SA-β-Gal positive cells among the total amount of cells counted after transient transfection of the mimics of the SA-miRNAs from either the MIR17HG (mir-17-5p, mir-18a-5p, mir-19a-3p, mir-20a-5p and mir-92a1-5p) or the MIR100HG (mir-125b1-5p, mir-1let7a-2-3p, mir-100-5p) clusters separately or after simultaneous transfection by a full set of the SA-miRNA mimics from both clusters in SR hADSCs. [score:1]
The MIR100HG cluster has given rise to two guide strand mature miRNAs: mir-125b1- 5p and mir-100- 5p in SEN hADSCs. [score:1]
41, 46 The chromosome 11 MIR100HG cluster homes three miRNAs (mir-125b1, mir-let7a-2, mir-100) situated within a comparable genomic distance (Fig.   2d). [score:1]
No mature passenger strands: mir-125b1- 3p and mir-100- 3p have been detected in our samples. [score:1]
[1 to 20 of 10 sentences]
23
[+] score: 35
The observed upregulation of miR-125b and miR-100 with combination treatment may reflect additive or synergistic inhibition of the Akt3/mTOR pathway with combination treatment, mediated by three mechanisms: direct inhibition of mTOR by Temsirolimus, translational inhibition of mTOR by upregulation of miR-100, and inhibition of the Akt3 pathway by upregulation of miR-125b. [score:21]
A potential mechanism by which upregulation of these miRNAs may exert an anti-tumor effect involves the influence of miR-125b and miR-100 over the Akt/mTOR pathway. [score:4]
miR-100 was also upregulated with combination treatment. [score:4]
Overexpression of miR-100 enhances in vitro sensitivity to rapamycin in ovarian cancer cell lines [41]. [score:3]
miR-100, known to target mTOR [26], had a dLMR > 0.5, but was not significantly different in the two-tailed t-test. [score:3]
[1 to 20 of 5 sentences]
24
[+] score: 34
Due to a high seed pairing stability and its CG dinucleotide rich seed site, miR-100 is supposed to have only few mRNA targets, among them mTOR (mammalian target of rapamycin) and TARDPB [50]. [score:5]
IPA analyses predicted GRIN2A (miR-4449); IRAK3 (miR-4674); MAPT (miR-146a); ADAM19, BDNF (miR-335) and mTOR, TARDPB (miR-100) as targets of our deregulated miRNAs from set A (S4 Dataset). [score:4]
Furthermore, miR-100 is up-regulated in the medial frontal gyrus of AD patients but not in hippocampus in analogy to the expected tau progression in AD, which could explain elevated CSF concentrations of miR-100 due to the release during atrophic processes [15]. [score:4]
While Caccamo et al. provided preclinical data indicating that reducing mTOR signalling may be a valid therapeutic approach for tauopathies, our results suggest that this salvage pathway may already be active in AD patients by up-regulation of miR-100 (fold change 2.17). [score:4]
Beside its biomarker potential miR-100 could also be an interesting target for therapeutic interventions. [score:3]
S3 DatasetLog2-transformed miRNA expression ratios obtained from RT-qPCR analysis are plotted for the most reliable (RF ≥ 0.8) miRNAs from set A: (A) miR-100, (B) miR-146a, (C) miR-1274B and the most informative (MoR-value d≥0.57) miRNAs from set B: (D) miR-505*, (E) miR-375, and (F) miR-103. [score:3]
Bonferroni correction pointed to a significant differential expression of miR-1274A, F(1, 46) = 16.58, p = 0.000, miR-100 [F(1, 46) = 7.85, p = 0.007], miR-146a [F(1, 46) = 4.78, p = 0.034] and naturally tau [F(1, 46) = 22.67, p = 0.000] and p-tau [F(1, 46) = 13.96, p = 0.001] between groups (Fig 2C). [score:3]
S5 Dataset ROC curves for the combination of (A) miR-146a and p-tau, and (B) miR-100, miR-103 and miR-375 to separate 28 control- from 22 AD cases. [score:1]
In this case, miR-1274A, miR-100 and miR-146a (Fig 2A and 2C and S3 Dataset) were confirmed as reliable and significant biomarkers. [score:1]
After substitution of missing values by group mean, miR-4449, miR-1274a, miR-146a, miR-335 and miR-100 were found as reliable candidates with RF ≥ 0.8 (Fig 2B). [score:1]
Another discriminant analysis performed on the most reliable biomarker miR-100 from set A (Fig 2B and 2C and S3 Dataset) and the most abundant miR-103 and miR-375 from set B (S2 Dataset and S3 Dataset) revealed for the two test groups a total correct classification rate of 96% after substitution of missing values, positively classifying controls and AD cases with 96.4% and 95.5% accuracy, respectively. [score:1]
By performing discriminant analysis including candidate miRNAs of both subsets as well as in combination with CSF protein marker, we could, irrespective of FOC, demonstrate overall classification rates of 96% (miR-100, miR-375 and miR-103) and 86.4% (miR-146a and p-tau). [score:1]
Thus, miR-100, miR-1274a and miR-146a might be strong candidates for new AD biomarkers. [score:1]
ROC curve analysis showed an AUC of 0.72 (miR-100), an AUC of 0.87 (miR-103) and an AUC of 0.99 (miR-375) for this combination (S5 Dataset). [score:1]
Interestingly, we found on a trend-level a negative correlation of CSF miR-100 concentrations with CSF p-tau in our controls (r = -0.42, p = 0.065) but not in our AD samples (r = -0.0188, p = 0.941). [score:1]
[1 to 20 of 15 sentences]
25
[+] score: 33
In accordance with our results, miR-21, miR-100, and miR-125b were upregulated, whereas miR-455-3p and miR-378 were downregulated in chemoresistant BxPC-3. In addition, miR-330-5p could be detected by Tréhoux et al. as a tumor suppressor in PDAC in vitro and in vivo, sensitizing pancreatic cancer cells to gemcitabine [19]. [score:9]
MiR-screening revealed significantly upregulated (miR-21, miR-99a, miR-100, miR-125b, miR-138, miR-210) and downregulated miRs (miR-31*, miR-330, miR-378) in chemoresistant PDAC (p<0.05). [score:7]
In MIA-PaCa-2-GR cell clones miR-125b, miR-210, miR-21, miR-100, miR-148a, miR-99a and miR-455-3p were significantly upregulated, whereas miR-330-3p, miR-330-5p, miR-486-5p, miR-422a and miR-31-star were significantly downregulated (Fig 6B). [score:7]
The cell division cycle 25 homolog A (CDC25A), required for progression from G1 to S phase of the cell cycle by activating cyclin -dependent kinases (CDK), is highly predicted to be targeted by miR-21, miR-99a, miR-100, and miR-125b [56]. [score:3]
MiR-99a and miR-100, two members of the miR-99 family, were found by Bloomston et al. to be overexpressed in PDAC tissue compared with normal pancreatic tissue and chronic pancreatitis [17]. [score:2]
Interestingly, most of our chemoresistance-specific miRs (miR-21-5p, miR-100-5p, miR-125b-5p, miR-210-3p, miR-330-3p, miR-378a-3p, miR-486-5p) are predicted by IPA to be regulated by TP53 gene (Fig 10). [score:2]
MiR-21-5p, miR-100-5p, miR-125b-5p, miR-210-3p, miR-330-3p, miR-378a-3p, and miR-486-5p are predicted by IPA to be regulated by TP53 gene. [score:2]
Some of these miRs, such as miR-21, miR-99a, miR-100, and miR-210 are already known as potential oncogenes (oncomiRs) in PDAC. [score:1]
[1 to 20 of 8 sentences]
26
[+] score: 29
Here, we chose three miRNAs (miR-100, miR-222 and miR-30a) with the significantly increased expression in both A/exo and D/exo for prediction because all these miRNAs displayed a consistent up-regulation in both MCF-7/Adr and MCF-7/Doc as we previously reported [15]. [score:6]
So far, there is no direct evidence as to the involvement of exosome- delivered miR-100, miR-222 and miR-30a in actually modulating the targets within recipient sensitive cells. [score:4]
Here we chose miR-100, miR-222 and miR-30a for further study because all these miRNAs displayed a consistent up-regulation in A/exo, D/exo, MCF-7/Adr and MCF-7/Doc [15]. [score:4]
After target gene prediction and KEGG pathway analysis, we found one pathway for miR-100, five pathways for miR-222 and eleven pathways for miR-30a. [score:3]
Compared to S/exo, the levels of miR-100, miR-17, miR-222, miR-342-3p and miR-451 were significantly up-regulated in A/exo and D/exo using qRT-PCR. [score:3]
In particular, both miR-100 and miR-222 were significantly related to “pathways in cancer”, suggesting that increased expression of these two miRNAs may serve as potential biomarkers for BCa. [score:3]
Likewise, the co-culture of MCF-7/S with A/exo resulted in significantly fold higher expressions of miR-100, miR-222, miR-30a and miR-17, as compared to MCF-7/S (not shown). [score:2]
In the present study, both MCF-7/S and resistant sublines as well as their exosomes carried several miRNAs, namely, miR-100, miR-222, miR-30a and miR-17. [score:1]
Five miRNAs were selected for validation, all of which (miR-100, miR-17, miR-222, miR-342-3p and miR-451) were elevated in both A/exo and D/exo. [score:1]
qRT-PCR analysis showed that both MCF-7/S and MCF-7/Doc as well as D/exo carried miR-100, miR-222, miR-30a and miR-17 (Fig. 8A; ** P<0.05). [score:1]
0095240.g008 Figure 8(A) miR-100, miR-222, miR-30a and miR-17 were analyzed in D/exo, MCF-7/Doc, the recipient MCF-7/S before and after D/exo incubation. [score:1]
[1 to 20 of 11 sentences]
27
[+] score: 28
a High level of six hsa-miRNAs randomly selected for the validation of expression level by qRT-PCR is consistent with the result from miRNA microarray; b Low level of six hsa-miRNAs randomly selected for the validation of expression level by real-time RT-PCR is consistent with the result from miRNA microarray Fig.  3Validation of 12 hsa-miRNAs using qRT PCR shows hsa-mir-1267, hsa-miR-4309, hsa-miR-554, hsa-miR-1272, hsa-miR-4501, hsa-miR-182-3p were up-regulated and hsa-miR-625-5p, hsa-miR-100-5p, hsa-miR-125b-5p, hsa-miR-197-3p, hsa-miR-4522, hsa-miR-493-5p were down-regulated in each of the peripheral blood samples from narcolepsy patients. [score:11]
Consistent with the results from the microRNA microarray (Fig.   2a, b), hsa-mir-1267, hsa-miR-4309, hsa-miR-554, hsa-miR-1272, hsa-miR-4501, hsa-miR-182-3p were up-regulated and hsa-miR-625-5p, hsa-miR-100-5p, hsa-miR-125b-5p, hsa-miR-197-3p, hsa-miR-4522, hsa-miR-493-5p were down-regulated in each of the peripheral blood samples (Fig.   3). [score:7]
Among these miRNAs with significant change, 12 hsa-miRNAs were validated by qRT PCR which showed that hsa-mir-1267, hsa-miR-4309, hsa-miR-554, hsa-miR-1272, hsa-miR-4501, hsa-miR-182-3p had significantly high expression and hsa-miR-625-5p, hsa-miR-100-5p, hsa-miR-125b-5p, hsa-miR-197-3p, hsa-miR-4522, hsa-miR-493-5p had significantly low expression in each of the peripheral blood samples. [score:5]
For example, miR-625-5p may act as one of potential mediators of hypoxic response in soft tissue sarcomas (STS); miR-100-5p appeared to be important to regulation some gene expression during GC reaction. [score:4]
In conclusion, we have identified 12 aberrant miRNAs (hsa-mir-1267, hsa-miR-4309, hsa-miR-554, hsa-miR-1272, hsa-miR-4501, hsa-miR-182-3p, hsa-miR-625-5p, hsa-miR-100-5p, hsa-miR-125b-5p, hsa-miR-197-3p, hsa-miR-4522, hsa-miR-493-5p) in plasma from patients with sleep disorder. [score:1]
[1 to 20 of 5 sentences]
28
[+] score: 27
C) MicroRNA-100-5p and miR-99a-5p whose expression levels negatively correlate with stemness, were significantly downregulated after 6–7 days of simulated microgravity in neonatal CPCs (n = 3, p<0.05). [score:6]
Interestingly, microRNAs-99a and miR-100 were among those which were significantly downregulated in neonatal, but not adult CPCs. [score:4]
In animals with superior regenerative ability, such as zebrafish, microRNA-99a and miR-100 are strongly downregulated at the initiation of regeneration and result in dedifferentiation of existing cardiomyocytes [32]. [score:4]
Two of the 15 significantly altered microRNAs, microRNA-99a-5p and microRNA-100-5p which were significantly down-regulated in response to simulated microgravity (1.9 fold decrease, p = 0.04 and 2.4 fold decrease, p = 0.03 respectively, Fig 4C) play a critical role in dedifferentiation [32]. [score:4]
Adult CPCs did not demonstrate a significant difference in the expression of microRNA-99a-5p (1.1 fold decrease, p = 0.16) and microRNA-100-5p (1.1 fold decrease, p = 0.21) before and after exposure to simulated microgravity (Fig 4D). [score:3]
D) Expression of microRNA-99a-5p and miR-100-5p were unchanged in adult CPCs after simulated microgravity (n = 3, run in triplicate). [score:3]
MicroRNA-99a and miR-100 transcripts are undetectable in undifferentiated embryonic stem cells, but the level of expression increases with cell differentiation [46]. [score:3]
[1 to 20 of 7 sentences]
29
[+] score: 25
The panel of differentially expressed miRNAs were validated by real-time PCR using TaqMan assays, and the results were consistent with the data that showed up-regulation of miR-21, miR-221, miR-100 and miR-26a and down-regulation of miR-26b, miR-141, miR-96, miR483-3p, miR-216, and miR-217 in the KC compared to control mice (Figure 1A). [score:7]
We have shown that in tumor samples compared to normal samples, the majority of miRNAs (miR-216, miR-217, miR-100, miR-345, miR-141, miR-483-3p, miR-26b, miR-150, Let-7b, Let-195 and miR-96) were downregulated, and few were upregulated (miR-146b, miR-205, miR-31, miR-192, miR-194 21, miR-379, miR-431, miR-541, and miR-199b). [score:6]
Further, at 50 weeks of age, the expression of miR-216, miR-217, miR-345, miR-141, miR-483-3p, miR-26b, miR-96, Let-7b (p-value = 0.01), miR-100, miR-26a and miR-150 (p-value = 0.094) were further downregulated in KC animals compared to control mice (Figure 2D). [score:5]
Several studies have shown the abnormal expression of miRNAs including miR-21, Let-7b, miR-100, miR-217, and miR-216 in PC and have proposed them as candidates for early diagnosis and potential molecular targets [23, 24]. [score:5]
Similarly, the expression of miR-10, miR-21, miR-100 and miR-155 was shown to increase in p48-Cre/Kras [G12D] mice when compared to control animals [59]. [score:2]
[1 to 20 of 5 sentences]
30
[+] score: 24
Differentially expression type microRNA name Mean ratio Up-regulated hsa-miR-193b 2.1165 hsa-miR-34a 3.1282 hsa-miR-100 2.3189 hsa-miR-4485 2.6155 Down-regulated hsa-miR-3690 0.4276 hsa-miR-124 0.3538 hsa-miR-183 0.3946 hsa-miR-3935 0.3999 hsa-miR-451 0.4126 hsa-miR-4538 0.3603 hsa-miR-4701 0.4249 Figure 1 Hierarchical clustering analysis between 5 SALS patients and 5 healthy controls based on differentially expressed miRNAs. [score:11]
Differentially expression type microRNA name Mean ratio Up-regulated hsa-miR-193b 2.1165 hsa-miR-34a 3.1282 hsa-miR-100 2.3189 hsa-miR-4485 2.6155 Down-regulated hsa-miR-3690 0.4276 hsa-miR-124 0.3538 hsa-miR-183 0.3946 hsa-miR-3935 0.3999 hsa-miR-451 0.4126 hsa-miR-4538 0.3603 hsa-miR-4701 0.4249 Figure 1 Hierarchical clustering analysis between 5 SALS patients and 5 healthy controls based on differentially expressed miRNAs. [score:11]
Four miRNAs, including hsa-miR-34a, hsa-miR-100, hsa-miR-193b, hsa-miR-4485, with significantly higher expression levels were identified in the SALS group compared with those in the healthy control group (mean ratio = 2.11−3.12, p < 0.05, Table 2, Figure 1). [score:2]
[1 to 20 of 3 sentences]
31
[+] score: 22
84uphsa-miR-574-3p1.77down   hsa-miR-19a2.32downhsa-miR-5722.92uphsa-miR-574-5p2.41down   hsa-miR-21*3.23downhsa-miR-574-3p3.75up      hsa-miR-301a2.32downhsa-miR-574-5p2.083up      hsa-miR-30e2.24downhsa-miR-629*2.85up      hsa-miR-7203.39downhsa-miR-6382.19up         hsa-miR-6634.52up         hsa-miR-9392.32up         hsa-miR-100*3.47down         hsa-miR-12603.09down         hsa-miR-12803.01down         hsa-miR-1414.5down         hsa-miR-21*4down         hsa-miR-2212.72down                   hsa-miR-455-3p 2.16 downAmong the listed profiles of differentially down-regulated miRNA as compared with non-infected control cells, it was found that miR-574-5p was down regulated (>2-fold, p<0.05) in H5N1 infected cells at 3-hour post-infection. [score:4]
It was found that six miRNAs (miR-21*, miR-100*, miR-141, miR-1274a, miR-1274b and miR-574-3p) were initially up-regulated at 3 hours post-infection. [score:4]
84uphsa-miR-574-3p1.77down   hsa-miR-19a2.32downhsa-miR-5722.92uphsa-miR-574-5p2.41down   hsa-miR-21*3.23downhsa-miR-574-3p3.75up      hsa-miR-301a2.32downhsa-miR-574-5p2.083up      hsa-miR-30e2.24downhsa-miR-629*2.85up      hsa-miR-7203.39downhsa-miR-6382.19up         hsa-miR-6634.52up         hsa-miR-9392.32up         hsa-miR-100*3.47down         hsa-miR-12603.09down         hsa-miR-12803.01down         hsa-miR-1414.5down         hsa-miR-21*4down         hsa-miR-2212.72down                   hsa-miR-455-3p 2.16 down Among the listed profiles of differentially down-regulated miRNA as compared with non-infected control cells, it was found that miR-574-5p was down regulated (>2-fold, p<0.05) in H5N1 infected cells at 3-hour post-infection. [score:4]
Furthermore, at 18, and 24-hour post-infection, miR-1260, miR-1274a, miR-1274b, miR-141, miR-18b, miR-21*, miR-720, miR-100*, miR-1260, miR1280, and miR21* were found to be down-regulated (>3-fold, p<0.05) in H5N1 infected cells. [score:4]
We found that miR-21*, miR-100*, miR-141, miR-574-3p, miR-1274a and miR1274b were differentially expressed in response to influenza A virus infection. [score:3]
Moreover, miR-100*, miR-21*, miR-141, miR-1274a and miR1274b were found to be down-regulated (>3-fold, p<0.05) in infection with subtype H5, particularly at 18 or 24 hours post-infection as compared with non-infected control cells. [score:3]
[1 to 20 of 6 sentences]
32
[+] score: 21
More importantly, the miRNAs analyzed in this study not only included the miRNAs like Let-7a, miR-15b, miR24, miR-100 and miR-125 which may suppress the expression of cyclins A and B, and miRNAs such as Let-7a, miR24 and miR-125 which may regulate activity of CDK1, but also miRNAs such as miR-181a, miR-221 and miR-222 which can target CDK inhibitors [30– 32]. [score:10]
To investigate whether miRNAs have a role in the cell cycle regulation of splenocytes following aniline exposure, the expression of miRNAs, including Let-7a, miR-15b, miR24, miR-100, miR-125, miR-181a, miR-221 and miR-222 which are known to mainly control G2/M phase regulators [30– 32], was analyzed by using real-time PCR and the results are presented in Fig 7. Aniline exposure led to significantly decreased expression of Let-7a (decreased 82%), miR-15b (decreased 62%), miR24 (decreased 78%), miR-100 (decreased 63%), miR-125 (decreased 86%), whereas miR-181a, miR-221 and miR-222 increased by 155%, 78% and 56%, respectively, in comparison to controls (Fig 7). [score:5]
Real-time PCR analysis of miRNAs Let-7a, miR-15b, miR24, miR-100 and miR-125 (A), and miRNAs miR-181a, miR-221 and miR-222 (B) expression in rat spleens following aniline exposure. [score:3]
Therefore, greater decreases in Let-7a, miR-15b, miR24, miR-100 and miR-125 expression and significant increases in miR-181a, miR-221 and miR-222 levels in the spleens following aniline treatment may be mechanistically important in generalizing that aniline exposure leads to increased cyclin A, cyclin B, CDK1, and decreased p21, p27, thus triggering the splenocytes to go through G2/M transition. [score:3]
[1 to 20 of 4 sentences]
33
[+] score: 21
In particular, the following target proteins were downregulated: PTEN which is known to be targeted by miR-21 [28], [29], cyclin D1 which is known to be targeted by miR-100, miR-99a and miR-223 [30] and Bcl-2 which is known to be targeted directly by miR-34, miR-181b and miR-16 [31], [32], [33] or indirectly modulated by miR-21 [34]. [score:14]
Similar results were obtained with FAM hsa-miR-100 (not shown). [score:1]
The following miRNAs were tested: miR-221 (line1), miR-99a (line 2), miR-222 (line 3), miR-24 (line 4), miR-410 (line 5), miR-21 (line 6), miR-100 (line 7), miR-214 (line 8), miR-31 (line9), miR-223 (line 12), miR-122 (line 13) and miR-451 (line 14). [score:1]
D. hsa-miR-125b 157.2±44.7 hsa-miR-24 52.5±12.8 hsa-miR-222 120.1±10.7 hsa-miR-222 48.9±18.8 hsa-miR-24 70.9±25.4 hsa-miR-99a 43.3±7.5 hsa-miR-99a 67.9±5.4 hsa-miR-125b 37.8±0.2 hsa-miR-100 62.6±0.0 hsa-miR-100 37.2±0.3 hsa-miR-594 40.3±3.2 hsa-miR-31 30.9±12.3 hsa-miR-31 33.2±8.4 hsa-miR-19b 25.3±4.3 hsa-miR-16 29.4±3.1 hsa-miR-16 21.4±3. [score:1]
AllStars Negative Control siRNA Alexa 488 (Qiagen, 100 nM) and FAM conjugated MISSION® microRNA Mimics (Sigma, hsa-miR-100 and hsa-miR-21, 100 nM) were used in each experiment. [score:1]
Moreover, the transfer of miRNAs within mTEC was confirmed using two fluorescent labeled reporter miRNAs carried by MVs derived from MSCs transfected with Alexa-488 labeled siRNA or with FAM labeled miRNA Mimics (hsa-miR-21 and hsa-miR-100). [score:1]
D. miRNAs MSCs MSC MVs HLSCs HLSC MVs hsa-miR-125b 296.2±82.55 66.1±57.6 51.3±0.25 20.4±3.15 hsa-miR-222 222.25±19.7 39.1±20.2 68.7±25.5 43.2±4.2 hsa-miR-24 135±46.85 40.75±29.6 72.3±17.4 54.4±18.5 hsa-miR-99a 125.7±9.9 23.7±14.1 59.1±10.2 15.0±1.8 hsa-miR-100 115. [score:1]
The abundance of some miRNAs (miR-21, miR-100, miR-99a and miR-223) increased progressively in mTEC concomitantly with the internalization of PKH26- labeled MVs (Figure 7A and B). [score:1]
[1 to 20 of 8 sentences]
34
[+] score: 20
Of interest, all miRNAs predicted to regulate Blimp-1 expression were concordantly down-modulated by IFN-α; on the contrary, during DC differentiation driven by IL-4, miR-100 and miR-125b resulted up-modulated, whereas miR-23a, miR-30c and let-7e were not differentially expressed compared to the untreated control (Figure 1C). [score:5]
Conversely, this cytokine did not further affect the expression of miR-23a as well as let-7e, whereas barely induced miR-100 expression (Figure 4B). [score:5]
We found PRDM-1 gene, encoding Blimp-1, predicted to be the target gene of 5 out of 10 miRNAs regulated in IFN-α DC: miR-23a, miR-30c, miR-100, miR-125b and let-7e (Figure 1C). [score:4]
The assessment of the expression of miR-23a, miR-30c, miR-100, let-7e and miR-125b in pDC exposed to IFN-α for 24 hours revealed that IFN-α stimulated the down-modulation of miR-125b along with that of miR-30c. [score:3]
Interestingly, 8 out of these 10 miRNAs were modulated in the same direction in pDC, being miR-23a, miR-27b, miR-30c, miR-32, miR-100, miR-146a, and let-7e significantly down-modulated and miR-155 up-modulated. [score:2]
Of interest, the pattern of miRNAs in IFN-α DC was quite different from that observed in IL-4 DC, since these populations shared only the modulation of miR-100, miR-125b and miR-32, but in an opposite manner. [score:1]
[1 to 20 of 6 sentences]
35
[+] score: 19
miR-100 and mir-99a, both putative tumor suppressors, were under- expressed in T vs N and over-expressed in M vs T. Identification of DEM confirmed that more miRNAs are modulated in T vs N than in M vs T comparison; however, DEMs in metastasis compared with primary tumors may be of great importance, since they include miR-10b, miR-210 and miR-708, which are key regulators of several processes related to disease progression, such as DNA repair, angiogenesis, hypoxia, EMT induction, and cancer recognition by the immune system [16- 18]. [score:9]
miR-100 and mir-99a, both putative tumor suppressors, were under- expressed in T vs N and over-expressed in M vs T. Identification of DEM confirmed that more miRNAs are modulated in T vs N than in M vs T comparison; however, DEMs in metastasis compared with primary tumors may be of great importance, since they include miR-10b, miR-210 and miR-708, which are key regulators of several processes related to disease progression, such as DNA repair, angiogenesis, hypoxia, EMT induction, and cancer recognition by the immune system [16- 18]. [score:9]
Relevant examples are miR-143, miR-145, miR-125b and miR-21 (associated with cell growth and survival), the miR-17-92 cluster, miR-20 and miR-100 (involved in uncontrolled cellular proliferation), the miR-183 cluster and miR-31 (implicated in cell migration), and miR-150 (potential biomarker of prognosis and therapeutic outcome in CRC). [score:1]
[1 to 20 of 3 sentences]
36
[+] score: 19
Both miR-99a and miR-100 are among the most downregulated miRNAs in adrenocortical tumours (ACT), which have been identified to be regulators of IGF-R expression by acting on a target site in the 3′-UTR of its mRNA [143]. [score:9]
For example, miR-199a-3p, miR-100 and miR-7 target the 3′-UTR of mTOR and suppress translation of its mRNA, resulting in activation of the mTOR kinase pathways [147, 154, 156]. [score:7]
Firstly, suppression of the mTOR pathway by mir-100 enhanced the chemotherapeutic effect of rapamycin analog RAD001 (everolimus) in clear cell ovarian cancer cells [154]. [score:3]
[1 to 20 of 3 sentences]
37
[+] score: 19
Reduced miR-100 expression in cervical cancer and precursors and its carcinogenic effect through targeting PLK1 protein. [score:5]
Although two miRNAs, miR-328 and miR-519c, that have been previously described to downregulate human ABCG2 (Pan et al., 2009; To et al., 2009) have no fly orthologs, we report a reduction in miR-100, which is also predicted to bind to the human ABCG2 3′UTR (To et al., 2008). [score:4]
Decreased expression of miR-125b and miR-100 in oral cancer cells contributes to malignancy. [score:3]
Of these, a core set of 10 miRNAs was found to be consistently dysregulated across all time points: let-7, miR-210, miR-9a, miR-275, miR-1, miR-993, miR-100, miR-1004, miR-980 and miR-317 (Fig.  2E). [score:2]
Significance of Plk1 regulation by miR-100 in human nasopharyngeal cancer. [score:2]
Of the ten Drosophila miRNAs identified, let-7, miR-210, miR-1, miR-100, and miR-9a have homologues in humans as evidenced in miRBase (Griffiths-Jones et al., 2006). [score:1]
Notably, the mature miRNA sequences of miR-100 have a one base pair difference between human and Drosophila as reported by miRBase (Griffiths-Jones et al., 2006). [score:1]
Among these, let-7 and miR-100 are processed from the same primary miRNA. [score:1]
[1 to 20 of 8 sentences]
38
[+] score: 18
The results showed that mir-6739-5p, mir-4521, mir-181b-5p, mir-100-5p and hmir-3919 were up-regulated, while hsa-mir-513a-5p was down-regulated in arsenic -treated HaCaT cells (Figure 2C). [score:7]
Among of these miRNAs, mir-4521, mir-181b-5p, mir-100-5p and mir-3919 were significantly up-regulated, and mir-513a-5p was down-regulated. [score:7]
The following forward primers were used: miRNA Sequence mir-181b-5p 5’-GCAACATTCATTGCTGTCGGTGGGT-3’ mir-100-5p 5’-GCGCAACCCGTAGATCCGAACTTGT-3’ mMir-6739-5p 5’-GCGCAGTGGGAAAGAGAAAGAACAAGT-3’ mir-4521 5’-GCGCTAAGGAAGTCCTGTGCTCAG-3’ mir-3919 5’-GGGCAGAGAACAAAGGACTCAGT-3’ mir-513a-5p 5’-GCGTTCACAGGGAGGTGTCAT-3’ U6 5’-ACACGCAAATTCGTGAAGCGTTCC-3’ To obtain a wide view of the potential miRNA targets, we performed an in silico prediction analysis using three distinct software: Miranda (www. [score:2]
The following forward primers were used: miRNA Sequence mir-181b-5p 5’-GCAACATTCATTGCTGTCGGTGGGT-3’ mir-100-5p 5’-GCGCAACCCGTAGATCCGAACTTGT-3’ mMir-6739-5p 5’-GCGCAGTGGGAAAGAGAAAGAACAAGT-3’ mir-4521 5’-GCGCTAAGGAAGTCCTGTGCTCAG-3’ mir-3919 5’-GGGCAGAGAACAAAGGACTCAGT-3’ mir-513a-5p 5’-GCGTTCACAGGGAGGTGTCAT-3’ U6 5’-ACACGCAAATTCGTGAAGCGTTCC-3’ To obtain a wide view of the potential miRNA targets, we performed an in silico prediction analysis using three distinct software: Miranda (www. [score:2]
[1 to 20 of 4 sentences]
39
[+] score: 17
miR-200c TUBB3 (β III-tubulin) Tumour suppressor Paclitaxel Ovarian cancer Microtubule system[19] miR-100 TUBB2A (β 2A-tubulin), TUBB3 (β III-tubulin) Tumour suppressor Paclitaxel Breast cancer Microtubule system[20] miR-34c-5p MAPT (Microtubule -associated protein tau) Tumour suppressor Paclitaxel Gastric cancer Microtubule system[22] miR-433 MAD2 (mitotic arrest deficiency protein 2) Oncogene Paclitaxel Ovarian cancer Cell cycle[29] let-7iCyclin D1 and D2 etc. [score:7]
Overexpression of PLK1 has been found in a number of human tumours and PLK1 miRNA is proposed to be the target of miR-100 [33– 35]. [score:5]
In our previous report, miR-100 has been shown to be a chemosensitivity restorer to docetaxel in human lung adenocarcinoma cells by targeting PLK1 [36]. [score:3]
On the other hand, β-tubulin miRNAs of classes I, IIA, IIB and V were proved to be regulated by miR-100 in MCF-7 breast cancer cells [20]. [score:2]
[1 to 20 of 4 sentences]
40
[+] score: 16
The highly expressed aae-miRNA-125 and aae-miR-100 were both upregulated in CHIKV-infected Ae. [score:6]
albopictus saliva whereas aae-mir-125 (2.2-fold), aae-mir-263a (3.4-fold), aae-mir-184 (1.3-fold) and aae-mir-100 (2.0-fold) were all upregulated in comparison with uninfected Ae. [score:4]
Therefore, both aae-mir-125 and aae-mir-100 could be contributing to regulating immune cell activity at the bite site in order to influence CHIKV replication. [score:2]
aegypti saliva were aae-mir-8 (50004), aae-mir-2940 (21514), aae-mir-263a (20584), aae-mir-bantam (18002), aae-mir-125 (15735), aae-mir-100 (13160), aae-mir-14 (12958) and aae-mir-285 (10006) (Table 1). [score:1]
albopictus saliva were from aae-mir-125 (4333), aae-mir-263a (4293), aae-mir-8 (2609), aae-mir-184 (2332) and aae-mir-100 (2255) (Table 3). [score:1]
MicroRNA-125, miR-100 and miR-let-7 are part of the same primary transcript and originate from a common genomic locus in Drosophila [54]. [score:1]
aegypti saliva and these include aae-mir-8, aae-mir-2940, aae-mir-263a, aae-mir-bantam, aae-mir-125, aae-mir-184, aae-mir-281and aae-mir-100 all of which have been identified in Aedes spp. [score:1]
[1 to 20 of 7 sentences]
41
[+] score: 16
Among the 22 differentially expressed microRNAs, 13 microRNAs were up-regulated (e. g. miR-34a, miR-100) and 9 microRNAs were down-regulated (e. g. miR-221, miR-222) by Par-4. Unsupervised hierarchical clustering based on the 22 microRNAs confirmed the segregation between empty vector- and Par-4 -transfected cells (Figure 8B). [score:9]
Moreover, miR-221, miR-222 and miR-134 are up-regulated in lymphocytic leukemia, pancreatic, liver, esophagus, or thyroid cancers [57- 59], whereas miR-34a and miR-100 are down-regulated in neuroblastoma [60], esophagus and ovary cancers [8, 58]. [score:7]
[1 to 20 of 2 sentences]
42
[+] score: 16
Specifically, everolimus targets mTOR signaling and mTOR regulated miRNAs such as miR-99a-3p (upregulated), miR-99a-5p (downregulated), miR-221 (upregulated), and miR-100 (downregulated). [score:16]
[1 to 20 of 1 sentences]
43
[+] score: 16
They found that upregulation of miR-499a-5p is a common feature of all placental insufficiencies such as preeclampsia (n = 80), gestational hypertension (n = 35), and FGR (n = 35); in addition, they demonstrated an upregulation of miR-1-3p in FGR pregnancies with abnormal umbilical fetal flows (n = 19); finally, they found downregulation of a series of miRNAs (miR-16-5p, miR-26a-5p, miR-100-5p, miR-103a-3p, miR-122-5p, miR-125b-5p, miR-126-3p, miR-143-3p, miR-145-5p, miR-195-5p, miR-199a-5p, miR-221-3p, miR-342-3p, and miR-574-3p) in FGR requiring the delivery before 34 weeks of gestation. [score:10]
Last year, Hromadnikova's group investigated maternal blood levels of specific miRNAs involved in cardiovascular and cerebrovascular diseases, finding a downregulation of miR-100-5p, miR-125b-5p, and miR-199a-5p in 39 patients with gestational hypertension, in 68 with preeclampsia, and in 33 with fetal growth restriction compared with 55 healthy controls; in addition, they showed downregulation of miR-17-5p, miR-146a-5p, miR-221-3p, and miR-574-3p only in FGR pregnancies [46]. [score:6]
[1 to 20 of 2 sentences]
44
[+] score: 16
We chose one micro RNA (miR183) for which transcription was reported to be upregulated in BC, four micro RNAs (miR100, 200A, 203, 205), for which contradictory data were reported, and two micro RNAs (miR143, 199A) published as downregulated in BC. [score:7]
For miR100 and miR143, we observed a total suppression of expression in all studied cases. [score:5]
Furthermore, the regulation of FGFR3 by miR99a and miR100 was experimentally validated (Catto et al., 2009). [score:2]
Only four miRNAs (miR100, miR125B, miR143, and Let7c) showed the Sn values >0.7 for the strict criterion (R [BC]/R [N] ratio > 3 or < 0.33). [score:1]
Examples of this include miR145, miR101, miR99a, and miR100. [score:1]
[1 to 20 of 5 sentences]
45
[+] score: 15
Extracellular Transcript Number hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 95 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 57 hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 38 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 29 hsa-miR-27b-3p 3p TCACAG TTCACAGTGGCTAAGTTCTGC Yes 26 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 22 hsa-miR-19a-3p 3p GTGCAA TGTGCAAATCTATGCAAAACTGA Yes 21 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 18 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 12 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 11 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 11 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 11 hsa-miR-320a 3p AAAGCT AAAAGCTGGGTTGAGAGGGCGA Yes 11 hsa-miR-423-5p 5p GAGGGG TGAGGGGCAGAGAGCGAGACTTT Yes 10 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 9 hsa-miR-92a-3p 3p ATTGCA TATTGCACTTGTCCCGGCCTGT Yes 9 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 7 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 6 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 6 ijms-15-15530-t004_Table 4 Table 4 Top 10 novel miRNAs expressed in exosome libraries. [score:3]
Researchers proposed that the reduced proliferation observed in cells co -transfected with miR-125b and miR-100 is caused by the additive effect of the two miRNAs on gene expression rather than a synergistic change [46]. [score:3]
Henson B. J. Bhattacharjee S. O’Dee D. M. Feingold E. Gollin S. M. Decreased expression of miR-125b and miR-100 in oral cancer cells contributes to malignancy Genes Chromosom. [score:3]
Extracellular Transcript Number hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 95 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 57 hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 38 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 29 hsa-miR-27b-3p 3p TCACAG TTCACAGTGGCTAAGTTCTGC Yes 26 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 22 hsa-miR-19a-3p 3p GTGCAA TGTGCAAATCTATGCAAAACTGA Yes 21 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 18 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 12 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 11 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 11 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 11 hsa-miR-320a 3p AAAGCT AAAAGCTGGGTTGAGAGGGCGA Yes 11 hsa-miR-423-5p 5p GAGGGG TGAGGGGCAGAGAGCGAGACTTT Yes 10 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 9 hsa-miR-92a-3p 3p ATTGCA TATTGCACTTGTCCCGGCCTGT Yes 9 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 7 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 6 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 6 ijms-15-15530-t004_Table 4 Table 4 Top 10 novel miRNAs expressed in exosome libraries. [score:3]
Intracellular Transcript Number hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 382,634 hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 243,882 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 91,479 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 82,325 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 66,589 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 41,096 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 30,233 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 28,900 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 26,923 hsa-miR-24-3p 3p GGCTCA TGGCTCAGTTCAGCAGGAACAG Yes 26,085 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 23,649 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 21,557 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 17,757 hsa-miR-182-5p 5p TTGGCA TTTGGCAATGGTAGAACTCACACT Yes 15,213 hsa-miR-425-5p 5p ATGACA AATGACACGATCACTCCCGTTGA No 12,236 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 11,993 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 11,329 hsa-miR-99a-5p 5p ACCCGT AACCCGTAGATCCGATCTTGTG Yes 10,476 hsa-miR-103a-3p 3p GCAGCA AGCAGCATTGTACAGGGCTATGA Yes 10,305 ijms-15-15530-t003_Table 3 Table 3 Common transcripts in extracellular samples that belong to the mid-range category with five to 100 transcripts. [score:1]
Intracellular Transcript Number hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 382,634 hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 243,882 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 91,479 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 82,325 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 66,589 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 41,096 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 30,233 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 28,900 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 26,923 hsa-miR-24-3p 3p GGCTCA TGGCTCAGTTCAGCAGGAACAG Yes 26,085 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 23,649 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 21,557 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 17,757 hsa-miR-182-5p 5p TTGGCA TTTGGCAATGGTAGAACTCACACT Yes 15,213 hsa-miR-425-5p 5p ATGACA AATGACACGATCACTCCCGTTGA No 12,236 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 11,993 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 11,329 hsa-miR-99a-5p 5p ACCCGT AACCCGTAGATCCGATCTTGTG Yes 10,476 hsa-miR-103a-3p 3p GCAGCA AGCAGCATTGTACAGGGCTATGA Yes 10,305 ijms-15-15530-t003_Table 3 Table 3 Common transcripts in extracellular samples that belong to the mid-range category with five to 100 transcripts. [score:1]
Another study on miRNAs in oral squamous cell carcinoma (OSCC) reported that increasing miR-125b and miR-100 levels reduces cell proliferation; however, co-transfecting the two miRNAs significantly influences proliferation than transfecting OSCC cells individually. [score:1]
[1 to 20 of 7 sentences]
46
[+] score: 15
miR-100 was significantly down-regulated in esophageal cancer, and miR-100 overexpression in esophageal cancer cells significantly inhibited cell proliferation, migration and invasion and suppressed tumor growth via targeting CXCR7 [33]. [score:12]
miR-100 functions as a tumor suppressor in esophageal cancer, which could be potentially applied in treating esophageal cancer [33]. [score:3]
[1 to 20 of 2 sentences]
47
[+] score: 14
For instance, hsa-miR-100, which is highly expressed in the p16 [INK4a ]wild-type cell lines, targets the RBSP3 gene that in acute myeloid leukemia regulates the cell cycle through partial modulation of pRB/E2F1 [57]. [score:6]
Among the 87 most-variable expressed miRNAs across the entire panel, a group of 15 miRNAs (hsa-miR-130a, hsa-miR-886-5p, hsa-miR-886-3p, hsa-miR-222, hsa-miR-21*, hsa-miR-29a, hsa-miR-23a, hsa-miR-24, hsa-miR-30a, hsa-miR-27a, hsa-miR-22, hsa-miR-532-3p, hsa-miR-100, hsa-miR-125b, hsa-miR-221) was significantly higher expressed in the minor cluster as opposed to other miRNAs (Figure 2, top red box). [score:5]
The most highly expressed miRNAs in p16 [INK4a ]mutant cell lines were hsa-miR-29a and hsa-miR-100 (fold change ≥ 2). [score:3]
[1 to 20 of 3 sentences]
48
[+] score: 13
They showed up-regulation of the expressions of miR-204 and miR-206 and down-regulation of miR-9, miR-100, miR-223, and miR-200c in CD133 [+] cells using RT PCR. [score:9]
Guo and colleagues reported that the expression levels of miR-204, miR-206, miR-223, miR-9, miR-100, and miR-200c were dysregulated in CD133 [+] OVCAR3 human ovarian cancer cells [12]. [score:4]
[1 to 20 of 2 sentences]
49
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
When globally analyzed the relapse-related miRNAs-miR-7, miR-100, miR-216 and let-7i—were up-regulated, and miR-486, miR-191, miR-150, miR-487 and miR-342 were down-regulated in early relapse ALL patients [76]. [score:7]
High miR-3151 expression was associated with high miR-501-5p and low miR-590, miR-135a, miR-100*, miR-186* and let-7a* expression, however the significance of this association is unknown [129]. [score:5]
The miR-125 family includes miR-125a/miR-99b/let-7e, miR-125b-2/miR-99a/let-7c-1, and miR-125b-1/miR-100/let-7a-2 located on human chromosomes 19, 21, and 11, respectively. [score:1]
[1 to 20 of 3 sentences]
50
[+] score: 12
The up-regulation of miR-100 represses its target RB serine phosphatase (RBSP3) [18], which is a phosphatase-like tumor suppressor, frequently mutated in human hematopoietic cell lines. [score:8]
miR-100 is another oncomiR in AML with high expression in primary AML blasts [17]. [score:3]
In vitro studies revealed that the mechanism underlying miR-100 in arresting human granulocyte and monocyte differentiation and promoting cell survival was through the RBSP3-pRB-E2F1 pathway [18]. [score:1]
[1 to 20 of 3 sentences]
51
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26b, hsa-mir-27a, hsa-mir-31, hsa-mir-33a, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-147a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-212, hsa-mir-221, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-142, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-127, hsa-mir-134, hsa-mir-200c, hsa-mir-106b, hsa-mir-361, hsa-mir-148b, hsa-mir-20b, hsa-mir-410, hsa-mir-202, hsa-mir-503, hsa-mir-33b, hsa-mir-643, hsa-mir-659, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-221, bta-mir-26b, bta-mir-27a, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-127, bta-mir-142, bta-mir-20b, bta-let-7d, bta-mir-132, bta-mir-148b, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-361, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, hsa-mir-708, hsa-mir-147b, hsa-mir-877, hsa-mir-940, hsa-mir-548j, hsa-mir-302e, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-100, bta-mir-106b, bta-mir-130a, bta-mir-134, bta-mir-147, bta-mir-152, bta-mir-153-1, bta-mir-153-2, bta-mir-182, bta-mir-24-1, bta-mir-199a-2, bta-mir-202, bta-mir-212, bta-mir-224, bta-mir-33a, bta-mir-33b, bta-mir-410, bta-mir-708, bta-mir-877, bta-mir-940, bta-mir-29b-1, bta-mir-148c, bta-mir-503, bta-mir-148d
For this a total of six miRNAs representing those whose expression was induced (miR-212, miR-182 & let-7 g) or suppressed (miR-100, miR-877 and miR-200c) due to hyperstimulation were selected for detecting their expression in exosome and Ago2 fractions. [score:7]
On the other hand, miR-100 and miR-877 showed the greatest fold change regulation among the downregulated miRNAs (Table  1). [score:5]
[1 to 20 of 2 sentences]
52
[+] score: 12
The miRNAs Tc-miR-2305 and Tc-miR-6090 are proposed to have roles in reproduction, embryo development and larval development, and Tc-let-7-5p, Tc-miR-34 and Tc-miR-100 appear to be involved in host-parasite interactions. [score:3]
The common markers, such as let-7, bantam and miR-100, in parasitic nematodes might have implications for the diagnosis of infection or disease [37, 71– 73]. [score:3]
In addition, 42 miRNAs, particularly Tc-let-7-5p, Tc-lin-4, Tc-bantam, Tc-miR-10, Tc-miR-34, Tc-miR-71 and Tc-miR-100, were predicted to be excreted/secreted by developmental arrested/infective larvae of T. canis into host tissues. [score:2]
Panel a: Normalised transcription for distinct miRNAs Tc-miR-100, Tc-miR-100d, Tc-let-7-5p, Tc-let-7b-5p, Tc-let-7c-5p, Tc-let-7e-5p, Tc-let-7f-5p, Tc-miR-87, Tc-miR-87a, Tc-miR-87b, Tc-miR-103a and Tc-miR-103b. [score:1]
In addition, sequence -dependent transcription was recorded in male and in female T. canis; for instance, transcription levels differed among miRNAs Tc-miR-100, Tc-miR-100d, Tc-let-7-5p, Tc-let-7b-5p, Tc-let-7c-5p, Tc-let-7e-5p, Tc-let-7f-5p, Tc-miR-87, Tc-miR-87a, Tc-miR-87b, Tc-miR-103a and Tc-miR-103b (Fig.   2a; 1: Table S5), whereas only limited differences in transcription were recorded for 342 miRNAs shared by male and female T. canis, with these miRNAs having a conserved seed sequence between the two sexes (Fig.   2b; 1: Table S5). [score:1]
Interestingly, the most prevalent, relatively conserved miRNAs, namely Tc-let-7-5p, Tc-lin-4, Tc-bantam, Tc-miR-10, Tc-miR-34, Tc-miR-71 and Tc-miR-100, were identified (Additional file 1: Table S8), suggesting key roles for them in modulating host/immunological responses. [score:1]
Moreover, some miRNAs, such as Tc-miR-84-5p, Tc-miR-34, Tc-miR-100, Tc-miR-57-5p, Tc-miR-125a-5p, Tc-miR-71 and Tc-miR-753b-3p, with seed sequences including 5′-GAGGUAG-3′, 5′-GGCAGUG-3′, 5′-ACCCGUA-3′, 5′-ACCCUGU-3′, 5′-CCCUGAG-3′, 5′-GAAAGAC-3′ and 5′-GAGAUCA-3′, respectively (Additional file 1: Table S8), were predicted to be involved in host-parasite interactions. [score:1]
[1 to 20 of 7 sentences]
53
[+] score: 12
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-200c, hsa-mir-200a
Recent studies have linked the increased expression of Plk1 during HCC progression to down-regulation of miR-100, a microRNA that targets Plk1 [38]. [score:8]
Whether miR-100 becomes down-regulated in HBV -mediated HCCs remains to be determined. [score:4]
[1 to 20 of 2 sentences]
54
[+] score: 12
miR-125b Deletions[373] mir-320d Deletions[374] let-7 g Deletions[378] miR-34a Deletions[376] miR-100 Deletions[375] miR-145 Deletions[112] miR-143 Deletions[112] OncomiR-1 Amplifications[367] miR-21 Amplifications[369] miR-155 Amplifications[368] miR-151a-5p Amplifications[370, 371] miRNAs that are silenced or amplified from CNA can have a cascade effect on the expression of different genes regulating entire pathways. [score:4]
miR-125b Deletions[373] mir-320d Deletions[374] let-7 g Deletions[378] miR-34a Deletions[376] miR-100 Deletions[375] miR-145 Deletions[112] miR-143 Deletions[112] OncomiR-1 Amplifications[367] miR-21 Amplifications[369] miR-155 Amplifications[368] miR-151a-5p Amplifications[370, 371] miRNAs that are silenced or amplified from CNA can have a cascade effect on the expression of different genes regulating entire pathways. [score:4]
Genetic deletion could contribute to miR-100 down-regulation [375] inducing epithelial-mesenchymal transition. [score:4]
[1 to 20 of 3 sentences]
55
[+] score: 11
We found 12 miRNAs (hsa-miR-21, hsa-miR-23a, hsa-miR-23b, hsa-miR-24, hsa-miR-27a, hsa-miR-29a, hsa-miR-31, hsa-miR-100, hsa-miR-193a, hsa-miR-221, hsa-miR-222 and hsa-let-7i) that were consistently up-regulated in the senescent cells of all donors (Fig. 1A), whereas only three miRNAs of the 17–92 cluster were down-regulated (Fig. 1A). [score:7]
We identified 12 miRNAs to be up-regulated in senescence, comprising hsa-miR-23a, hsa-miR-23b, hsa-miR-24, hsa-miR-27a, hsa-miR-29a, hsa-miR-31, hsa-miR-100, hsa-miR-193a, hsa-miR-221, hsa-miR-222 and hsa-let-7i. [score:4]
[1 to 20 of 2 sentences]
56
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Other miRNAs recently implicated in breast cancer include miR-100, shown to target SMARCA5, SMARCD1, and BMPR2 genes, which directly influence tumor cell proliferation [80], and miR-30c, known to target TWF1 and IL-11 [81], both of which are expressed in the MaSC/basal lineage. [score:8]
Deng L Shang L Bai S Chen J He X Martin-Trevino R MicroRNA100 inhibits self-renewal of breast cancer stem-like cells and breast tumor developmentCancer Res. [score:3]
[1 to 20 of 2 sentences]
57
[+] score: 11
Similarly to our recent observation (Funikov et al., 2016), the expression levels of several clustered miRNAs respond to HS individually and independently of each other: in the cluster let-7, mir-100, mir-125 HS up-regulates let-7 expression, but down-regulates mir-100. [score:11]
[1 to 20 of 1 sentences]
58
[+] score: 11
In vitro, depletion of miR-100 resulted in cisplatin resistance of chondrosarcoma cells probably mediated by mTOR, which is a direct target of miR-100 [212]. [score:4]
Depletion of two miRNAs has been implicated in chemoresistance; miR-100 is downregulated in human chondrosarcoma tissues and cell lines. [score:4]
Zhu Z. Wang C. P. Zhang Y. F. Nie L. MicroRNA-100 resensitizes resistant chondrosarcoma cells to cisplatin through direct targeting of mtorAsian Pac. [score:3]
[1 to 20 of 3 sentences]
59
[+] score: 10
To identify whether miRNAs were involved in radiation induced mTOR aberrant expression and activation, several miRNAs which targeted mTOR kinase including miR-101, miR-144, miR-100, miR-451, miR-199a and miR-99b were tested before and after radiation treatment. [score:5]
Numerous studies have shown that miR-99b, miR-100, miR-199a-3p, miR-451, miR-144 and miR-101 can directly or indirectly mediate mTOR expression [18- 23], and reduction of these miRNAs was connected with the elevated levels of mTOR in prostate cancer and endometrial carcinoma [18, 24]. [score:5]
[1 to 20 of 2 sentences]
60
[+] score: 10
EF24 treatment inhibits miR-21 expression, but does not affect the expression of several other miRNAs, including miR-100, -126, -181a and -200a. [score:7]
As shown in Figure 4A and D EF24 treatment of DU145 and B16 cells, respectively, reduced miR-21 levels by >70%, while it had no effect on the expression levels of miR-100, -126, -181a and -200a (Fig. 4B and E). [score:3]
[1 to 20 of 2 sentences]
61
[+] score: 10
Downregulation of microRNA-100 correlates with tumor progression and poor prognosis in colorectal cancer. [score:4]
MicroRNA-100 regulates SW620 colorectal cancer cell proliferation and invasion by targeting RAP1B. [score:3]
The miR-10 family consists of seven miRNAs (miR-10a/b, miR-99a/b, miR-100 and miR-125a/b). [score:1]
In vitro studies of CRC cell lines indicate that miR-100 and miR-125b promote apoptosis, and thus may repress tumorigenesis, or may be important for the sensitization of tumors to chemotherapeutic drugs (Gong et al., 2013; Peng et al., 2014). [score:1]
One odd but significant feature of the arrangement of the miR-10 gene family is that the miR-99, miR-100, and miR-125 genes (all except miR-10a/b) are physically clustered with the loci that encode Let-7 miRNAs. [score:1]
[1 to 20 of 5 sentences]
62
[+] score: 10
These mRNAs are all included in the list of predicted target in Table 2. It was interesting to see that the four remaining miRNAs (miR-100, rno-miR-140, miR15a and miR-26a) were grouped in this network by IPA and not connected through the above cancer-related target mRNAs by the pathway designer and hence two of them (miR-100 and miR-15a) were not included in Figure 4A. [score:5]
The maximum number of predicted targets was 25 for miR-30d, and the minimum number of predicted targets was one for miR-1, miR-100 and rno-miR-140 (Table 1). [score:5]
[1 to 20 of 2 sentences]
63
[+] score: 10
miR-93, miR-141, miR-200 and miR-214 are frequently upregulated whereas miR-100, miR-143, miR-145 and let-7 are downregulated in ovarian carcinomas compared with normal counterparts (5– 9). [score:6]
miR-100, miR-143 and miR-145 that are down-regulated miRNAs in ovarian cancer (5, 6, 8) induced a 15–30% decrease in the cell viability of A2780 (the cell viability; 84.1, 81.8 and 73.1 with miR-100, miR-143 and miR-145 transfection, respectively). [score:4]
[1 to 20 of 2 sentences]
64
[+] score: 10
They found that miR-199b-5p and miR-100-3p were downregulated and miR-155-5p, miR-135-5p, and miR-146-5p upregulated in more aggressive osteosarcoma cell lines. [score:7]
The first significant study of miRNAs in chondrosarcoma tissue samples and cell lines revealed downregulation of let-7a, miR-100, miR-136, miR-222, miR-335, and miR-376a compared to normal chondrocytes (Yoshitaka et al., 2013; Nugent, 2014). [score:3]
[1 to 20 of 2 sentences]
65
[+] score: 10
MiR-99 was reported to mediate down-regulation of mTOR/FGFR3 and suppress tumor growth; miR-100 is known to inhibit mTOR signaling and enhance sensitivity to Everolimus in clear cell ovarian cancer (Nagaraja et al., 2010; Oneyama et al., 2011); and mTORC1 was recently reported to regulate miR-1 in skeletal myogenesis (Sun et al., 2010). [score:9]
A link between mir-100 and FRAP1/mTOR in clear cell ovarian cancer. [score:1]
[1 to 20 of 2 sentences]
66
[+] score: 10
14.0 and showed that the expression of miR-221, miR-18a, miR-18b, and miR-423-5p in poorly differentiated HCC were significantly higher than in well differentiated HCC, and 8 miRNAs (miR-455-3p, miR-1914*, miR-100, miR-215, miR-122*, let-7b, miR-22 and miR-99a) in poorly differentiated HCC were expressed significantly lower than in well differentiated HCC. [score:5]
The expression of miR-221, miR-18a, miR-18b, and miR-423-5p in poorly differentiated HCC were significantly higher than in well differentiated HCC, and 8 miRNAs (miR-455-3p, miR-1914*, miR-100, miR-215, miR-122*, let-7b, miR-22 and miR-99a) in poorly differentiated HCC had significantly lower expression levels than in well differentiated HCC (p < 0.05) (Table  2). [score:5]
[1 to 20 of 2 sentences]
67
[+] score: 9
Over -expression of miR-100 is responsible for the low -expression of ATM in the human glioma cell line: M059J. [score:5]
For instance, a catalytic subunit of DNA -dependent protein kinase (DNA-PKs) is inhibited by miR-7 and miR-101 (Yan et al., 2010; Lee et al., 2011), and ataxia telangiectasia mutated protein (ATM) is regulated with miR-18a, miR-100, miR-101, and miR-421 (Ng et al., 2010; Yan et al., 2010). [score:4]
[1 to 20 of 2 sentences]
68
[+] score: 9
Among the top 20 expressed miRNAs only 50% of the miRNAs had their canonical form as their major expressed isoform and these were let-7a-1, miR-22, miR-26a-1, miR-100, let-7f-1, miR-148a, let-7i, let-7c, miR-99b and miR-92a1. [score:5]
But the role of many other miRNAs, such as miR-100 and miR-99a, that we and Crowe et al. found to be highly expressed, have not been studied [20]. [score:3]
AGO2-RIP-Seq Log2Fold (Control vs IL-1β), Q-value 1 mir-27b-3p 11Yes [21] −1, 1.43E-08 2 mir-10b-5p 2 No NS 3 let-7a-5p 9 No NS 4 mir-22-3p —Yes [43] NS 5 mir-26a-5p 5Yes [48] NS 6 mir-100-5p 14 No NS 7 let-7f-5p 18 No NS 8 mir-140-3p 1Yes [20] NS 9 mir-148a-3p —Yes [13] NS 10 mir-125a-5p — No NS 11 mir-21-5p 15Yes [13] NS 12 mir-199a-3p — No NS 13 mir-125b-5p 12Yes [13] NS 14 mir-222-3p —Yes [49] NS 15 let-7i-5p — No 1.01, 1.12E-23 16 let-7c-5p 17 No NS 17 mir-99b-5p 20 No NS 18 mir-92a-3p —Yes [50] 0.94, 4.87E-07 19 mir-99a-5p —Yes [51] NS 20 mir-92b-3p — No 1.35, 3.31E-09 NS, non-significant. [score:1]
[1 to 20 of 3 sentences]
69
[+] score: 9
The results are shown in Figure 4A, bta-miR-15b, bta-miR-107, bta-miR-30b-5p, bta-miR-214, bta-miR-193a-5p, bta-miR-339b, bta-miR-375, bta-miR-487b, and bta-miR-100 were differentially expressed in peak and late lactation, and the expression levels of bta-miR-15b, bta-miR-107, bta-miR-30b-5p, bta-miR-214, bta-miR-339b, bta-miR-375, and bta-miR-487b in late lactation tissue were higher than the expression levels in peak lactation, bta-miR-100 was down regulated in late lactation compared with peak lactation, the expression pattern was consistent with the Solexa sequencing results (Table S1), only bta-miR-107 was not consist with Solexa sequencing results, this may be caused by deviation of qRT-PCR. [score:9]
[1 to 20 of 1 sentences]
70
[+] score: 9
The O. volvulus miR-100 and bantam miRNAs identified have distinct sequences outside of their seed regions from the miRNAs in H. polygyrus (Figure  4). [score:1]
Strikingly multiple miR-100 and bantam family members are present in the datasets. [score:1]
We recently identified 16 miRNAs in the serum of mice infected with the filarial nematode L. sigmodontis and four of these are identical to the O. volvulus miRNAs detected in human serum (mir-71, two miR-100 members, and one bantam family member) and one is derived from the other arm of the hairpin of a O. volvulus miRNA (miR-87). [score:1]
Four of these are also identical to those found in the serum of mice infected with L. sigmodontis including miR-100 and bantam family members. [score:1]
A common feature in all the infections is the presence of miR-71, bantam family and miR-100 family miRNAs (where family is defined based on identical seed sequences, nucleotides 2–8). [score:1]
The factors dictating the expansion of this miRNA family are not known; miR-100 is one of the oldest miRNAs, having evolved in the last common ancestor of Eumetazoa (the highly conserved sequence is noted in Figure  4 and is identical across parasitic nematodes and all of their mammalian hosts). [score:1]
The conserved miR-100 sequence (Eumetazoa) is shown in relation to the nematode family members identified in these datasets: O. volvulus (OVO), O. ochengi (OOC), L. sigmodontis (LSI) or H. polygyrus (Hpolygyrus). [score:1]
Figure 4 Sequences of extracellular miR-100 and bantam family members in nematode parasites. [score:1]
We previously identified 5 miR-100 family members within the top 20 most abundant miRNAs secreted by H. polygyrus [9]. [score:1]
[1 to 20 of 9 sentences]
71
[+] score: 9
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
In addition, integration of copy number and expression data in these samples showed overexpression of miR-100, miR-125b-1, and miR-130a (on chromosome 11, and members of the MG-B cluster) as a consequence of chromosomal gain or amplification [49]. [score:5]
On the other hand, Clusterin (CLU) is a predicted target of miR-99a, miR-100, miR-126, and miR-335 and is commonly associated with tumorigenesis and malignant progression in part through TGF-miR-135a, miR-135b, miR-181a, and miR-181b [65]. [score:3]
Distinctive miRNA signatures obtained using unsupervised hierarchical clustering could distinguish these three groups based on just 16 miRNAs with miR-17~92 cluster members (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-20b, and miR-92) and its paralog miR-106a, being the predominant one in addition to miR-29a/c,miR-100, miR-199a*, miR-140, miR-630, and miR-16 [49]. [score:1]
[1 to 20 of 3 sentences]
72
[+] score: 9
When considering fold changes, the most upregulated miRNAs were miR-31, miR-100, miR-378a, miR-18a, and miR-584, whereas the most downregulated ones were miR-143, miR-26b, miR-125a, miR-148a, and miR-192 (Fig.   3c). [score:7]
miR-148a, miR-99a and miR-26a were abundant in S0, but no longer in top 10 miRNAs in S3 where they were replaced by miR-100, miR-30a and miR-92a. [score:1]
The most abundant miRNA in S0 was miR-126, whereas in S1–S3, it was miR-21, and by S3, miR-126 had dropped down to the third place, after miR-21 and miR-100. [score:1]
[1 to 20 of 3 sentences]
73
[+] score: 8
The pediatric AML patients with the upregulation of miR-100 may have poor relapse-free and overall survival [37]. [score:4]
Among these miRNAs, hsa-mir-100 was considered a potential tumor-related miRNA, which has been reported to regulate cell differentiation by targeting RBSP3 in acute myeloid leukemia [36]. [score:3]
Among the cancer-related miRNAs, five miRNAs, namely, hsa-mir-217, hsa-mir-188, hsa-mir-125b-1, hsa-mir-100, and hsa-mir-181d, were reported to be associated with the acute myeloid leukemia. [score:1]
[1 to 20 of 3 sentences]
74
[+] score: 8
Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42]. [score:8]
[1 to 20 of 1 sentences]
75
[+] score: 8
It has been reported that miR-100 is downregulated and targets mTOR in clear cell ovarian cancer [29] and childhood adrenocortical tumors [20]. [score:6]
These characteristics of miR-100 and miR-199a-3p are quite similar to those of miR-99a, indicating that mTOR expression might be regulated redundantly by various closely related miRNAs. [score:2]
[1 to 20 of 2 sentences]
76
[+] score: 8
We also observed (as shown in Fig 6) that some miRNAs including miR-100, 106b, 222 was up-regulated during Candida infection. [score:4]
Abnormal expression of miR-100 interfere the migration, proliferation pathway and causes gastric cancer [41]. [score:3]
Gene Ontology database showed that some genes (miR-100, 101, 106a) were associated with cell motility, energy production, active transportation, and DNA damage response (DDR pathway). [score:1]
[1 to 20 of 3 sentences]
77
[+] score: 8
Analysis of the expression of individual miRs showed three major trends (Figure 2A–C): First, expression of miR-10, miR-16, miR-21, miR-100 and miR-155 increased in the early PanIN lesions relative to control, and maintained high expression in the late PanIN and adenocarcinoma tissues. [score:7]
Serum levels of miR-100 and miR-375 were reduced by >2-fold after the treatment though only the controls showed statistically significant differences (p<0.05). [score:1]
[1 to 20 of 2 sentences]
78
[+] score: 7
Increased in Bissels et al. and this studyIncreased in Liao et al. and this studyIncreased in Cattaneo et al. and this study Commonly increased in three studies miR-484 miR-16 nil miR-142-3p miR-425-5p miR-27a miR-142-5p miR-191 Decreased in Bissels et al. and this study Decreased in Liao et al. and this study Decreased in Cattaneo et al. and this study Decreased in Bissels et al. and Cattaneo et al. miR-146a miR-127 miR-126-5p miR-29b-3p miR-146b-5p miR-100 miR-99a miR-10a miR-125b miR-125a-5p These data together suggest a signature of miRNA expression associated with differentiation status and maturation within the myeloid lineage. [score:3]
Increased in Bissels et al. and this studyIncreased in Liao et al. and this studyIncreased in Cattaneo et al. and this study Commonly increased in three studies miR-484 miR-16 nil miR-142-3p miR-425-5p miR-27a miR-142-5p miR-191 Decreased in Bissels et al. and this study Decreased in Liao et al. and this study Decreased in Cattaneo et al. and this study Decreased in Bissels et al. and Cattaneo et al. miR-146a miR-127 miR-126-5p miR-29b-3p miR-146b-5p miR-100 miR-99a miR-10a miR-125b miR-125a-5p These data together suggest a signature of miRNA expression associated with differentiation status and maturation within the myeloid lineage. [score:3]
Interestingly, four of the reduced miRNAs, miR-99a, miR-100, miR-125b, miR-125a-5p, are members of homologous tricistronic clusters involved in stem and progenitor cell homeostasis [37]. [score:1]
[1 to 20 of 3 sentences]
79
[+] score: 7
Importantly, profiling of Drosophila microRNA expression in dissected thoracic muscles, had previously demonstrated miR-124, miR-100, miR-277 and miR-304 expression in these muscles 35. [score:5]
We selected dme-miR-92a, dme-miR-100 and dme-miR-124 based on data generated in our laboratory and their orthology with human miRNAs. [score:1]
57. miRNA sponge lines (UAS-miR-SP) for dme-miR-92a, dme-miR-100, dme-miR-124, dme-miR-277, dme-miR-304 and scramble-SP (control) were obtained from Dr. [score:1]
[1 to 20 of 3 sentences]
80
[+] score: 7
Torres and coworkers [29] found that the expression of miR-99a, miR-100 and miR-199b was up-regulated in plasma of EEC patients, and a combination of miR-99a and miR-199b was more accurate in distinguishing EEC disease when compared with single miRNAs. [score:7]
[1 to 20 of 1 sentences]
81
[+] score: 7
Dai et al. have correlated a miRNA signature (downregulation of miR-100, miR-130a, and miR-197 and upregulation of miR-181b, miR-181d, miR-101, and miR-195) in HNSCC cells with multiple drug resistance phenotypes in vitro [84]. [score:7]
[1 to 20 of 1 sentences]
82
[+] score: 7
We also observed significant inhibition of immunostimulatory ssRNA sensing by select LNA/DNA phosphorothioate AMOs from Classes 3 and 4. Although miRNA -based mechanisms could be at play for LNA/DNA AMOs targeting abundant miRNAs (such as miR-191-5p, miR-16-5p, miR-29a-3p or miR-100-5p), such effects can be ruled out for other AMOs of Class 3 targeting poorly abundant miR-224-5p, miR-331-3p, miR-134-5p or miR-31-5p. [score:7]
[1 to 20 of 1 sentences]
83
[+] score: 7
Likewise, miR-100-5p, miR-34c-5p and miR-34b-5p were up-regulated in human pachytene spermatocytes compared with human round spermatids, whereas miR-206 was down-regulated in human pachytene spermatocytes compared to human round spermatids (Fig. 6B), which was fully consistent with their expression patterns of these miRNAs by our miRNA microarrays. [score:7]
[1 to 20 of 1 sentences]
84
[+] score: 7
For example, miR-100 and miR-199a-3p suppress mTOR expression [20- 22], and miR-152 and miR-218 suppress Rictor in some cancers [23, 24]. [score:7]
[1 to 20 of 1 sentences]
85
[+] score: 7
We subsequently identified five miRNAs (let-7e, miR-100, -139-5p, -181a, -181b) that were significantly up-regulated in primary CRC tissues in relapse patients in both datasets. [score:4]
The expression of miR-100 was unable to discern patients based on relapse (data not shown). [score:3]
[1 to 20 of 2 sentences]
86
[+] score: 7
Six under-expressed microRNAs that were altered at least four fold, including hsa-miR-3646, hsa-miR-17*, hsa-miR-3679-3p, hsa-miR-17, hsa-miR-155, and hsa-miR-146a, (Figure 5A) and ten under-expressed microRNAs that were highly expressed (normalized data ≥6), including hsa-miR-100, hsa-miR-10a, hsa-miR-130b, hsa-miR-146a, hsa-miR-17, hsa-miR-1973, hsa-miR-29a, hsa-miR-31, hsa-miR-31* and hsa-miR-762 (Figure 5B), were selected for further qRT-PCR analyses. [score:7]
[1 to 20 of 1 sentences]
87
[+] score: 7
Of these 16 miRNAs, 9 were downregulated (let-7d, miR-106b, miR-122a, miR-141, miR-183, miR-195, miR-200a, miR-335, mir424) and 7 were upregulated (miR-100, miR-199a, miR-296, miR-29a, miR-29c, miR-99a, mir-494). [score:7]
[1 to 20 of 1 sentences]
88
[+] score: 7
miR-100 down-regulation in HCC and CRC tissues was strongly associated with venous invasion, poorer cell differentiation and shorter recurrence-free survival (Figure 1). [score:4]
the restoration of miR-100 inhibits cell growth and invasion. [score:3]
[1 to 20 of 2 sentences]
89
[+] score: 7
When these samples were compared to healthy controls, only three significantly dysregulated miRNAs were identified; miR-486-5p and miR-451 were up-regulated, and miR-100 was down-regulated (fold change ≥ 2, p ≤ 0.05) (not shown). [score:7]
[1 to 20 of 1 sentences]
90
[+] score: 7
The most significantly upregulated human miRNAs were miR-513a-3p, miR-298, and miR-206; whereas miR-99a, miR-200 family, miR-199b-5p, miR-100, and miR-335 were the most significantly downregulated miRNAs. [score:7]
[1 to 20 of 1 sentences]
91
[+] score: 7
In ovarian cancer, 11 miRs were upregulated (miR-16, miR-20a, miR-21, miR-23a, miR-23b, miR-27a, miR-93, miR-141, miR-200a, miR-200b, and miR-200c) and 12 were downregulated (miR-10b, miR-26a, miR-29a, miR-99a, miR-100, miR-125a, miR-125b, miR-143, miR-145, miR-199a, miR-214, and let-7b). [score:7]
[1 to 20 of 1 sentences]
92
[+] score: 7
Other miRNAs from this paper: hsa-let-7b, hsa-mir-15a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-1-2, hsa-mir-15b, hsa-mir-30b, hsa-mir-122, hsa-mir-132, hsa-mir-141, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-195, hsa-mir-200c, hsa-mir-1-1, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-371a, hsa-mir-372, hsa-mir-373, hsa-mir-375, hsa-mir-151a, hsa-mir-429, hsa-mir-449a, hsa-mir-483, hsa-mir-193b, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-449b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320b-2, hsa-mir-891a, hsa-mir-935, hsa-mir-1233-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-1275, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1973, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-1233-2, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
In sperm of patients with oligozoospermia, hsa-miR-100 and hsa-let-7b, two miRNAs that target the ER genes, are overexpressed, while ER expression levels are decreased [60]. [score:7]
[1 to 20 of 1 sentences]
93
[+] score: 6
Retroviral expression vectors (miR-vec) for miR-100, miR-15a/16-1, and -181a were a kind gift of Reuven Agami. [score:3]
In addition, we showed that oncogenic BRaf also significantly increased the expression of miR-143, miR-34a, let-7c, miR-15a, miR-29a, miR-100, miR-181a, and miR-181d. [score:3]
[1 to 20 of 2 sentences]
94
[+] score: 6
Several miRs, for example, miR-100-3p, were also found to be upregulated by HPV16 E7, whereas other miRs showed different trends of expression. [score:6]
[1 to 20 of 1 sentences]
95
[+] score: 6
In contrast, 11 miRNAs (hsa-miR-206, hsa-miR-34a, hsa-miR-374, hsa-miR-424, hsa-miR-100, hsa-miR-101, hsa-miR-323, hsa-miR-368, hsa-miR-137, hsa-miR-138 and hsa-miR-377) were abundantly expressed in day 9 neuronal progenitors (Figures 1B and 2A). [score:3]
Another 11 miRNAs (miR-206, miR-34a, miR-374, miR-424, miR-100, miR-101, miR-323, miR-368, miR-137, miR-138 and miR-377) were abundantly expressed in transdifferentiated neuronal progenitors. [score:3]
[1 to 20 of 2 sentences]
96
[+] score: 6
In non-small cell lung cancer, silenced PLK1 expression by iNOP-7-PLK1 siRNA reduced tumor growth in vitro and in vivo [13], and PLK1 was the target for miR-100 to regulate non-small cell lung cancer cell proliferation, apoptosis, and cell cycle [14]. [score:6]
[1 to 20 of 1 sentences]
97
[+] score: 6
However, reduced mir-100 expression has been observed in a bovine mammary epithelial cell line after the infection with streptococcus uberis [40], indicating that the miRNA response is associated with gram -positive bacterial infection. [score:3]
Expression of mir-100 was at lower levels in the PP vs the NN group in the present study (Table 1), although increased levels of mir-100 have been described in mouse lung after viral infection [38] and even in hemocytes from gram -negative infected shrimps [61]. [score:3]
[1 to 20 of 2 sentences]
98
[+] score: 6
Cluster1-a (let-7a-2, miR-100, miR-125b-1) and Cluster1-b (let-7c, miR-99a, miR-125b-2) are involved in HSPC (hematopoietic stem and progenitor cell) homeostasis such as self-renewal, proliferation, quiescence, and differentiation by blocking TGFβ pathway and amplifying Wnt signaling (Emmrich et al., 2014), whereas LIN28B represses let-7 to inhibit erythroid development and maintain stemness (Copley et al., 2013; Lee et al., 2013b). [score:4]
However, miR-125a is responsible for most of these properties in cluster 1-c and the transcription of miRNAs in cluster 1-a (let-7a-2, miR-100, and miR-125b-1) are loosely related (Sempere et al., 2004; Gerrits et al., 2012). [score:1]
Cluster 1, which contains three miRNAs, including let-7a, miR-100, and miR-125, is also conserved in D. melanogaster (Table  2). [score:1]
[1 to 20 of 3 sentences]
99
[+] score: 6
Seeliger et al. [7] have identified 6 miRNAs upregulated in osteoporotic fracture patients: miR-21, miR-23a, miR-24, miR-25, miR-100 and miR-125b meanwhile Garmilla-Ezquerra et al. [8] detected miR-187 and miR-518f as differentially expressed between sample groups. [score:6]
[1 to 20 of 1 sentences]
100
[+] score: 6
miR-100 is downregulated after femoral artery occlusion and inhibition of miR-100 restores perfusion in hindlimb ischemic region in vivo [18]. [score:6]
[1 to 20 of 1 sentences]