sort by

185 publications mentioning hsa-mir-107 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-107. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 291
Suppression of cell migration and invasion by taxol via activate miR-107 expression, leading to down-regulation of MCL1 expression. [score:10]
Subsequently, overexpression of miR-107 suppressed the expression of MCL1, which has been proved to be directly targeting on ATR/Chk1 pathway in our work. [score:10]
miR-107 suppressed the expression of MCL1, which has been proved to be directly targeting on ATR/Chk1 pathway. [score:8]
We identified MCL1 as a target gene of miR-107, and found that miR-107 is down-regulated, whereas MCL1 is up-regulated in cervical cancer tissues when compared with adjacent normal tissues. [score:8]
Taxol Regulates Expression of MCL1 by Up-Regulating miR-107. [score:7]
Expression of an EGFP reporter containing the 3′-UTR of MCL1 was inhibited when miR-107 was overexpressed and activated when ASO-miR-107 was used. [score:7]
Therefore, we determined by qRT-PCR that MCL1 was overexpressed in cervical cancer relative to adjacent normal tissues, and MCL1 was identified as a direct target of miR-107. [score:6]
Accordingly, miR-107 upregulated ATR expression and activated ATR/Chk1 pathway but not ATM/Chk2 pathway. [score:6]
The taxol -mediated change in the expression of MCL1, as indicated by the results from the Western blot analysis, suggesting that taxol might regulate miR-107 expression at transcription levels. [score:6]
miR-107 is expressed at a low level in cervical cancer when compared with normal cervical tissues, and overexpression of miR-107 inhibits cell growth and invasion. [score:6]
A new target gene of miR-107, MCL1, was found to be up-regulated in cervical cancer tissues. [score:6]
These data indicated that miR-107 negatively regulates endogenous MCL1 protein expression through mRNA degradation and translational repression. [score:6]
The taxol -mediated change in the expression of MCL1 suggests that taxol might regulate miR-107 expression at transcription levels. [score:6]
A, the expression level of miR-107 in HeLa and SiHa cells was significantly altered following transfection with either pri-miR-107 or ASO-miR-107 expression constructs as determined by qRT-PCR using U6 snRNA for normalization. [score:5]
In HeLa cells, overexpression of miR-107 resulted in approximately 70% decrease in MCL1 mRNA levels (Fig. 1 D ) and about 50% decrease in protein expression (Fig. 1 E ). [score:5]
Additionally, we determined whether miR-107 also suppresses endogenous MCL1 expression at the post-transcriptional level, we analyzed the effect of miR-107 on endogenous MCL1 mRNA and protein levels using qRT-PCR analysis and Western blotting, respectively. [score:5]
To overcome this problem, we have taken advantage of the integrated computational algorithms of gNET method with TargetScan algorithms previously established and to predict that MCL1 is a candidate target of miR-107. [score:5]
The working mo del of taxol regulates expression of MCL1 by up -regulating miR-107 was shown in Fig. 4 H. [score:5]
0111860.g001 Figure 1 A, the expression level of miR-107 in HeLa and SiHa cells was significantly altered following transfection with either pri-miR-107 or ASO-miR-107 expression constructs as determined by qRT-PCR using U6 snRNA for normalization. [score:5]
Ectopic expression of miR-resistant MCL1 was sufficient to partially rescue the loss-of-function phenotype in miR-107 -overexpressing HeLa and SiHa cells. [score:5]
To further investigate whether the inhibitory effect of taxol on the expression of miR-107 in cervical cancer cells was at the level of mRNA expression, a semi-quantitative RT-PCR analysis was performed. [score:5]
N, schematic representing miR-107 -mediated regulation of MCL1 expression during cancer progression. [score:4]
Together, these results demonstrated that miR-107 binds directly to the 3′-UTR of MCL1 to repress gene expression. [score:4]
We revealed a fine tuning process of cells in response to DNA damage and replenished the ATR/Chk1 pathway, in which miR-107 played an important role by regulating the expression of MCL1. [score:4]
As shown in Fig. 3 M, the expression levels of MCL1 were significantly higher than those in adjacent normal tissues, further supporting that miR-107 negatively regulates MCL1. [score:4]
MCL1 is a direct target of miR-107. [score:4]
Interestingly, miR-107 is down-regulated in human breast cancer tissues [23], which is consistent with our results. [score:4]
miR-107 was expressed at a lower level (Fig. 3 K ), whereas MCL1 was expressed at a significantly higher level in the tumor tissues when compared with the corresponding normal tissues (Fig. 3 L ). [score:4]
miR-107 Directly Targets MCL1. [score:4]
Here, we identified that miR-107 was down-regulated in human cervical cancer. [score:4]
These findings demonstrated the effect of MCL1 knockdown on cell proliferation, migration, and invasion, which are consistent with the effect of miR-107 overexpression in both HeLa and SiHa cells. [score:4]
Over -expression of MCL1 countered the effect of miR-107 on cell proliferation, migration, and invasiveness of HeLa and SiHa cells. [score:3]
Transfection of HeLa and SiHa cells with this MCL1 ORF expression construct reversed the negative effects of miR-107 on MCL1 protein levels (Fig. 3 A ). [score:3]
As a result, neither overexpression nor blocking of miR-107 had any effect on the intensity of EGFP fluorescence in cells transfected with the 3′-UTR mutant vector (Fig. 1 C ). [score:3]
These data suggest that miR-107 inhibits cell proliferation, migration, and invasiveness in HeLa and SiHa cells in vitro. [score:3]
Correspondingly, the cells in S phase were decreased along with miR-107 overexpression whereas there was no significant change in G2/M phase. [score:3]
Next, the effect of miR-107 on MCL1 expression was validated by miR-107 gain and loss of functions. [score:3]
Then cells were transfected with miR-107 expression vector (pri-miR-20a, 4 µg each well) or miR-107 antisense oligonucleotides (ASO-miR-107). [score:3]
Moreover, we showed that MCL1 was negatively regulated by miR-107 at the posttranscriptional level, via a specific target site within the 3′-UTR by luciferase reporter assay. [score:3]
As shown in Fig. 3 G, Chk1 was dramatically phosphorylated after pri-miR-107 overexpression, however there was no significant change in phosphorylation of Chk2. [score:3]
Our results demonstrated that MCL1 was directly regulated by miR-107 and, moreover, suggested that miR-107 may be a potential anti-cancer therapeutic for cervical cancer. [score:3]
Taken together, these results suggested that in vitro miR-107 can bind to the 3′-UTR of the human MCL1 mRNA and inhibit protein synthesis by RNA degradation. [score:3]
In both HeLa and SiHa cells, qRT-PCR was performed to validate the miR-107 over -expression construct or miR-107 ASO, with pcDNA3 or ASO-NC to be the respective controls (Fig. 1 A ). [score:3]
Restoration of MCL1 Counteracts Effects of miR-107 Expression. [score:3]
The inhibition of cell proliferation (Fig. 3 B ), colony formation (Fig. 3 C and Fig. S3A in File S1), migration (Fig. 3 D and Fig. S3B in File S1), and invasiveness (Fig. 3 E and Fig. S3C in File S1) caused by pri-miR-107 was abrogated in cells co -transfected with the pcDNA3/MCL1 vector. [score:3]
A synthesized ASO-miR-107 was as an inhibitor of miR-107. [score:3]
miR-107 suppresses and MCL1 promotes the proliferation, migration and invasiveness of HeLa and SiHa cells. [score:3]
miR-107 Inhibits Migration and Invasion. [score:3]
Although the miR-107 is considered to play a key role in determining tumor properties, the regulation of MCL1 expression in cervical cancers remains largely unknown. [score:3]
Of note, we elucidated the underlying mechanisms by which taxol attenuates the migration and invasion of cervical cancer cells, possibly by activate the miR-107 and reducing the level of MCL1 expression, as well as having an anti-metastatic potential. [score:3]
Therefore, the identification of miR-107 and its target gene, MCL1, in cervical cancer may help us to understand potential molecular mechanisms of tumorigenesis and may provide new prognostic markers for the management of cervical cancer. [score:3]
Gain of pri-miR-107 massively induced the expression of ATR but not ATM at mRNA level. [score:3]
Expression of miR-107 and MCL1 in Cervical Cancer and Normal Tissues. [score:3]
Together, our data reveals miR-107 as a potential biomarker of response to therapy in cervical cancer and highlights its potential as a therapeutic target. [score:3]
N and O, the relative expression of miR-107 (K) and MCL1 (L) in the 15 pairs, including cervical cancer tissues and matched normal tissues, was determined using qRT-PCR. [score:3]
In this study, we investigated the role of miR-107 in cervical cancer and regulates proliferation and metastasis and invasion in cells by targeting MCL1. [score:2]
Moreover, mutant fragment of MCL1 3′-UTR containing a mutated miR-107 binding site was amplified using PCR site-directed mutagenesis and cloned into the pcDNA3/EGFP plasmid between the same sites. [score:2]
To detect the expression of miR-107 in human cervical cancer tissues, the qRT-PCR assay was performed on fifteen paired samples of cervical cancer and adjacent normal tissues. [score:2]
miR-107 negatively regulates MCL1 at both mRNA and protein levels. [score:2]
We performed MTT, colony formation, cell migration, and invasiveness assays using HeLa and SiHa cells transfected with either pri-miR-107 or ASO-miR-107 plasmids to determine the effects of miR-107 expression in vitro. [score:2]
We used this algorithm programs to predict miR-107 binding directly to 3′-UTR of MCL1. [score:2]
The mRNA (D) or protein (E) levels of MCL1 in HeLa and SiHa cells decreased or increased when compared with the control group when pri-miR-107 was overexpressed or blocked, respectively (*, p<0.05, **, p<0.005). [score:2]
Quantitative RT-PCR was performed to detect the relative transcript levels of miR-107. [score:1]
Treatment with miR-107 significantly blocked cell proliferation, DNA replication, colony formation and invasion in HeLa and SiHa cells. [score:1]
As shown in Fig. 1 B, the intensity of EGFP fluorescence in the pri-miR-107 group was significantly reduced, whereas that in the ASO-miR-107 group increased significantly at 48 h after transfection. [score:1]
miR-107 Activates ATR/Chk1 Pathway. [score:1]
To confirm that the effects of miR-107 on the proliferation, migration, and invasiveness of HeLa and SiHa cells are mediated through MCL1, we constructed a pcDNA3/MCL1 vector containing the MCL1 ORF without the 3′-UTR to avoid the influence of miRNAs. [score:1]
Our results indicated that MCL1 may function as an oncogene and is a mediator of miR-107 in cervical cancer. [score:1]
In this study, we investigated the role played by miR-107, a miRNA associated with cervical cancer and its interaction with the suppressor MCL1. [score:1]
Cervical cancer cells were transfected with either pri-miR-107 or ASO-miR-107. [score:1]
To determine the function of the miR-107 binding site, we constructed an additional EGFP reporter vector containing the MCL1 3′-UTR with a mutant miR-107 binding site. [score:1]
B, the intensity of EGFP fluorescence in HeLa cells transfected with pri-miR-107 was decreased after 48 h and increased following transfection with ASO-miR-107. [score:1]
All these data suggest that increased miR-107 induces G1 arrest by activating ATR/Chk1 pathway. [score:1]
MCL1 rescues miR-107 -induced cellular phenotypes in cervical cancer cells. [score:1]
Among them, miR-107, belonging to the miR-103/107 family due to their identical seed sequences, is capable of inducing epithelial-to-mesenchymal transition of mammary epithelial cells, thereby fostering invasive and metastatic behaviors of cancers [6]– [8]. [score:1]
cDNA was subsequently used for the amplification of miR-107 and an endogenous control, U6 snRNA, via PCR. [score:1]
0111860.g002 Figure 2Cervical cancer cells were transfected with either pri-miR-107 or ASO-miR-107. [score:1]
Mo del of modified ATR/Chk1 pathway, in which miR-107 and MCL1 are involved. [score:1]
C, pri-miR-107 and ASO-miR-107 had no effect on the intensity of EGFP fluorescence in cells transfected with the 3′-UTR mutant vector. [score:1]
5 µg pri-miR-107 or 500 µmol ASO-miR-107 was transfected. [score:1]
Furthermore, MCL1 mRNA and protein levels increased approximately 3- and 2-fold, respectively, in HeLa cells transfected with ASO-miR-107. [score:1]
miR-107 represses cell proliferation and migration and invasiveness. [score:1]
The working mo del of the miR-107-MCL1 interaction during cancer progression was shown in Fig. 3 N. [score:1]
Furthermore, overexpression of miR-107 resulted in a significant reduction in the invasive potential of HeLa cells when compared with control cells in Transwell assay with Matrigel, and cells transfected with ASO-miR-107 had a significantly increase in their invasive potential (Fig. 2 D and Fig. S2C in File S1). [score:1]
The following vectors were cotransfected into cells: those containing the EGFP reporter vector alone, with pcDNA3/primiR-107, or bearing ASO-miR-107. [score:1]
HeLa and SiHa cells were co -transfected with pri-miR-107 or ASO-miR-107 in a 48-well plate followed by the pcDNA3/EGFP-MCL1 3′-UTR reporter vector or pcDNA3/EGFP-MCL1 3′-UTR mutant. [score:1]
0111860.g003 Figure 3 (A), cells were co -transfected with the pcDNA3/MCL1 vector, which did not contain the 3′-UTR of MCL1, with or without pri-miR-107 vector. [score:1]
Fig. S2 A, cervical cancer cells were transfected with pri-miR-107 or ASO-miR-107 and then seeded in 12-well plates. [score:1]
HeLa cells were co -transfected with the pcDNA3/EGFP-MCL1 3′-UTR report vector and pri-miR-107 or ASO-miR-107. [score:1]
Transwell assay without Matrigel (Fig. 2 C and Fig. S2B in File S1) demonstrated that miR-107 overexpression reduced migration in HeLa cells by 60%, and transfection of ASO-miR-107 increased migration by approximately two-fold compared with the control cells. [score:1]
To verify that whether miR-107 could activate DNA damage pathways, we monitored the mRNA level of ATR and ATM (Fig. 3 F ). [score:1]
miR-107 reduced MCL1 levels in HeLa and SiHa cell lines, two cell lines with high MCL1 and low miR-107. [score:1]
miR-107 is a member of the miR-15/107 superfamily and has been shown to be associated with several human cancer types. [score:1]
B cervical cancer cells were transfected with pri-miR-107 or ASO-miR-107 and then seeded in 12-well plates. [score:1]
The resulting construct pcDNA3/pri-miR-107 was confirmed by DNA sequencing. [score:1]
[1 to 20 of 95 sentences]
2
[+] score: 252
Other miRNAs from this paper: mmu-mir-331, mmu-mir-107, hsa-mir-331
Inhibition of miR-107 expression resulted in a significant upregulation of FEZF1-AS1 (>twofold, Fig.   3c), while miR-107 mimic significantly reduced FEZF1-AS1 expression level (>50%, Fig.   3d) in both cell lines. [score:10]
Luciferase assays of 293T cells co -transfected with pmirGLO-FEZF1-AS1 vector and pcDNA3.1-FEZF1-AS1 vector revealed that FEZF1-AS1 over -expression induced a dramatic increase in luciferase activity, which was abrogated by miR-107 -binding site mutation, suggesting that ectopically expressed FEZF1-AS1 specifically sequestered endogenous miR-107, thereby preventing it from inhibiting luciferase expression (Fig.   3k). [score:9]
Collectively, these results demonstrate that miR-107 exerts inhibitory effects on FEZF1-AS1 expression via directly targeting FEZF1-AS1. [score:8]
Furthermore, the effect of FEZF1-AS1 knockdown on the inhibition of glucose uptake and lactate production in PDAC cells could be rescued by miR-107 inhibitor, whereas the effect of FEZF1-AS1 over -expression on the promotion of glucose uptake and lactate production in PDAC cells could be diminished by miR-107 mimic (Fig.   8e, f and Supplementary Fig.   S8E, F). [score:8]
We co -transfected PANC-1 and Capan-2 cells with si-FEZF1-AS1 and miR-107 inhibitor, and found that inhibition of miR-107 partly abrogated the silencing effect of FEZF1-AS1 knockdown on endogenous ZNF312B protein expression (Fig.   4c). [score:8]
These observations suggest that the effects of FEZF1-AS1 or ZNF312B over -expression on the promotion of PDAC cell migration and invasion could be diminished by miR-107 mimic, in accordance with the suppression of ectopic FEZF1-AS1 and ZNF312B expression by miR-107 mimic. [score:7]
Fig. 8 a, b Silencing of FEZF1-AS1 expression abrogated the glycolytic capacity of PANC-1 and Capan-2 cells, while the miR-107 inhibitor could rescue the inhibitory effects of si-FEZF1-AS1 on the glycolytic process in both PDAC cell lines, as reflected by ECAR analysis. [score:7]
e, f Silencing of FEZF1-AS1 or ZNF312B expression inhibited the glucose uptake and lactate production in PANC-1 and Capan-2 cells, while the miR-107 inhibitor could rescued the effect of si-FEZF1-AS1 or si-ZNF312B on glucose uptake and lactate production of both PDAC cell lines. [score:7]
Accordingly, miR-107 inhibitor or FEZF1-AS1 over -expression dramatically elevated endogenous ZNF312B protein expression. [score:7]
Effects of FEZF1-AS1 or ZNF312B knockdown on the inhibition of PDAC cell migration and invasion could be rescued by miR-107 inhibitor in vitro. [score:6]
Effects of FEZF1-AS1 or ZNF312B knockdown on the inhibition of PDAC cell glycolytic capacity could be rescued by miR-107 inhibitor in vitro. [score:6]
Furthermore, the effect of FEZF1-AS1 expression on endogenous ZNF312B protein in combination with the modulation of miRNA was monitored via the different approaches shown in Fig.   4c, d. showed that miR-107 mimic or FEZF1-AS1 knockdown triggered a significant silencing effect on endogenous ZNF312B protein expression. [score:6]
These results suggested that miR-107 negatively regulates FEZF1-AS1 expression either directly or indirectly. [score:6]
Effects of FEZF1-AS1 or ZNF312B knockdown on the inhibition of PDAC cell proliferation and colony formation could be rescued by miR-107 inhibitor in vitro. [score:6]
In addition, miR-107 inhibitor rescued the effect of si-FEZF1-AS1 on inhibiting glucose metabolism in PDAC cells. [score:5]
Using DIANA-LncBase, Annolnc, TargetScan and miRcode bioinformatics algorithms, we found a potential miRNA candidate miR-107 targeting both FEZF1-AS1 and ZNF312B. [score:5]
To further assess the potential relationship between FEZF1-AS1 and miR-107, we transfected PANC-1 and Capan-2 cells with miR-107 inhibitor or mimic to decrease or increase miR-107 expression level, respectively. [score:5]
As mentioned above, we discovered a potential miRNA candidate miR-107 targeting ZNF312B via using TargetScan and miRcode software. [score:5]
In addition, we co -transfected PANC-1 and Capan-2 cells with pcDNA3.1-FEZF1-AS1 and miR-107 mimic, and found that miR-107 mimic partly abrogated the promoting effect of FEZF1-AS1 over -expression on endogenous ZNF312B protein expression (Fig.   4d). [score:5]
Moreover, the transwell assay also demonstrated that knockdown of FEZF1-AS1 or ZNF312B dramatically attenuated the migration and invasion of PDAC cells, while co-transfection of miR-107 inhibitor and si-FEZF1-AS1 showed that miR-107 inhibitor increased cell migration and invasion attenuated by si-FEZF1-AS1 (Fig.   6c, d). [score:5]
In conclusion, our results indicate that FEZF1-AS1 is an inhibitory target of miR-107 in PDAC progression. [score:5]
In addition, miR-107 inhibitor rescued the effect of si-FEZF1-AS1 on inhibiting the glycolytic process of both PDAC cell lines (Fig.   8a, d). [score:5]
e The proliferation of si-NC, si-FEZF1-AS1, si-NC + miR-107 inhibitor, si-FEZF1-AS1 + miR-107 inhibitor, or si-ZNF312B transfected PANC-1 and Capan-2 cells by colony formation assay. [score:4]
a Bioinformatics analysis showed that miR-107 might target FEZF1-AS1 and the potential wild-type -binding site and mutation site are shown. [score:4]
Conversely, miR-107 inhibitor induced a remarkable increase in luciferase activity in both cell types (P  < 0.01), which was also abrogated by binding site mutation. [score:4]
Moreover, a mechanistic analysis reveals that FEZF1-AS1 may function as a competing endogenous RNA (ceRNA) to regulate the expression of ZNF312B via sponging miR-107, thereby playing an oncogenic role in promoting progression and the Warburg effect in PDAC. [score:4]
To further explore whether ZNF312B was upregulated by FEZF1-AS1, we subsequently transfected 293T cells with the luciferase reporter plasmids together with miR-107 mimic and pcDNA3.1-FEZF1-AS1. [score:4]
ZNF312B is a target gene of miR-107 and is regulated by FEZF1-AS1. [score:4]
Conversely, inhibition of miR-107 induced a remarkable increase in luciferase activity in both cell types, which was also abrogated by binding site mutation. [score:4]
Fig. 3 a Bioinformatics analysis showed that miR-107 might target FEZF1-AS1 and the potential wild-type -binding site and mutation site are shown. [score:4]
c, d The cell viability of si-NC, si-FEZF1-AS1, si-NC + miR-107 inhibitor, si-FEZF1-AS1 + miR-107 inhibitor, or si-ZNF312B transfected PANC-1 and Capan-2 cells by CCK-8 assay. [score:4]
Nevertheless, we observed no obvious changes in miR-107 levels following FEZF1-AS1 knockdown or over -expression (Fig.   3i, j). [score:4]
b The 3'-UTR of ZNF312B with wild-type (ZNF312B-WT-3'UTR) or mutant site (ZNF312B-MUT-3’UTR) fused to the luciferase coding region and transfected in 293T cells with miR-107 mimic or negative control to confirm ZNF312B is the target of miR-107. [score:3]
FEZF1-AS1/miR-107/ZNF312B pathway facilitates proliferation and inhibits apoptosis of PDAC cells in vitro. [score:3]
Our present work provides the valid evidence for a positive FEZF1-AS1/ZNF312B correlation and the crosstalk among FEZF1-AS1, miR-107 and ZNF312B, shedding new light on the utilization of FEZF1-AS1/miR-107/ZNF312B axis as a potential novel therapeutic target for the treatment of PDAC. [score:3]
Besides, the miR-107 inhibitor abrogated the effect of si-FEZF1-AS1 on the reduction of cell viability of both PDAC cell lines (Fig.   5c, d). [score:3]
The next day, cells were co -transfected with pmirGLO-FEZF1-AS1-WT or pmirGLO-FEZF1-AS1-MUT reporter plasmids, pmirGLO-ZNF312B-WT or pmirGLO-ZNF312B-MUT reporter plasmids and miR-107 mimic or inhibitor. [score:3]
The amount of FEZF1-AS1 and miR-107 enriched by Ago2 or IgG was measured by qRT-PCR in the presence of miR-107 inhibitor or NC inhibitor. [score:3]
Our wound healing scratch assay revealed that knockdown of FEZF1-AS1 or ZNF312B dramatically decreased cell motility, whereas miR-107 inhibitor abrogated the effect of si-FEZF1-AS1 on reducing cell viability (Fig.   6a, b). [score:3]
ZNF312B-WT-3'UTR or ZNF312B-MUT-3'UTR and miR-107 mimic were co -transfected into 293T cells with plasmids expressing FEZF1-AS1 or with a control vector to verify the ceRNA activity of FEZF1-AS1. [score:3]
g PANC-1 and Capan-2 cells -expressing si-FEZF1-AS1 or si-ZNF312B combined with miR-107 inhibitor were cultured under normoxic conditions for 24 h. Acidification of the culture medium was evaluated by visually inspecting the colour of the medium. [score:3]
In addition, miR-107 inhibitor significantly abolished the effect of si-FEZF1-AS1 in promoting apoptosis and inducing G1 phase arrest (Supplementary Fig.   S5A–D). [score:3]
Conversely, over -expression of FEZF1-AS1 or ZNF312B significantly increased the migration and invasion of the two cell lines, while miR-107 mimic decreased cell migration and invasion promoted by pcDNA3.1-FEZF1-AS1 (Supplementary Fig.   S7C, D). [score:3]
In contrast, FEZF1-AS1 or ZNF312B over -expression combined with miR-107 mimic had the opposite effect (Supplementary Fig.   S8A–D). [score:3]
c, d The migration and invasion of PANC-1 and Capan-2 cells transfected with si-NC, si-FEZF1-AS1, si-NC + miR-107 inhibitor, si-FEZF1-AS1 + miR-107 inhibitor or si-ZNF312B compared with the controls by transwell assay. [score:3]
The contribution of the FEZF1-AS1/miR-107/ZNF312B pathway to Warburg effect maintenance in PC has never been previously reported, and thus we sought to uncover the molecular mechanism underlying the FEZF1-AS1/miR-107/ZNF312B axis in glycolysis regulation. [score:2]
Our RNA immunoprecipitation (RIP) assays revealed that while FEZF1-AS1 was detected in Ago2 immunoprecipitates from the control group, its levels were significantly reduced in Ago2 complexes purified from cells treated with miR-107 inhibitor (P  < 0.01, Fig.   3g), indicating that FEZF1-AS1 is likely in the miR-107–RISC complex. [score:2]
FEZF1-AS1 acts as a competing endogenous RNA by directly binding to miR-107. [score:2]
FEZF1-AS1 was pulled down as analyzed by qRT-PCR, but the introduction of mutations that disrupt base pairing between miR-107 and FEZF1-AS1 abrogated the ability of miR-107 to pull down FEZF1-AS1 (P  < 0.001, Fig.   3h), suggesting that miR-107 interacts with FEZF1-AS1 in a sequence-specific manner. [score:2]
We subcloned full-length FEZF1-AS1 into the pmirGLO dual-luciferase reporter vector and performed luciferase assays in PANC-1 and Capan-2 cells, both of which express endogenous miR-107. [score:2]
This repressive effect was abolished by directed mutagenesis of the miR-107 -binding seed region in FEZF1-AS1. [score:2]
b Spearman correlation analysis suggested a negative relationship between FEZF1-AS1 and miR-107 in PDAC specimens (n = 94, r = −0.611, P < 0.01). [score:1]
We transfected 293T cells with the luciferase reporter plasmids, together with miR-107 mimic. [score:1]
The predicted sites of miR-107 binding to FEZF1-AS1 or ZNF312B sequence were illustrated in Fig.   3a and Fig.   4a. [score:1]
These results demonstrate the pivotal role of FEZF1-AS1/miR-107/ZNF312B axis in the proliferation and apoptosis of PDAC cells. [score:1]
h PANC-1 cells were transfected with biotinylated WT miR-107 (miR-107-Bio) or biotinylated mutant miR-107 (miR-107-Mut-Bio) or biotinylated NC (NC-Bio). [score:1]
g Associations of FEZF1-AS1, miR-107 and Ago2. [score:1]
Our data showed that miR-107 mimic significantly reduced the luciferase activity of the wild-type 3'-UTR, but not the mutant 3'-UTR of ZNF312B in 293T cells (P  < 0.01, Fig.   4b). [score:1]
ZNF312B was predicted to harbor miR-107 based on miRNA seed sequence matching (Fig.   4a). [score:1]
Thus, FEZF1-AS1/miR-107/ZNF312B axis -induced promotion of PDAC cell proliferation appeared to be mediated by modulation of the apoptosis and the G1-S checkpoint. [score:1]
Taken together, the FEZF1-AS1/miR-107/ZNF312B axis is responsible for Warburg effect maintenance in PDAC cells, which meets the demands for continuous energy and nutrients to support uncontrolled proliferation. [score:1]
To confirm this prediction, we first constructed luciferase reporter plasmids harboring either the wild-type 3'-UTR of ZNF312B or a mutant 3'-UTR predicted to be insensitive to miR-107. [score:1]
This study provides the first connection between FEZF1-AS1/miR-107/ZNF312B axis and PDAC progression and the Warburg effect. [score:1]
In conclusion, these results reinforced the contribution of FEZF1-AS1/miR-107/ZNF312B molecular axis to Warburg effect maintenance in PDAC cells. [score:1]
Taken together, these data indicate that FEZF1-AS1 acts as an endogenous sponge by sequestering miR-107 and thus abolishing the miRNA -induced repressing effect on the ZNF312B 3'-UTR. [score:1]
Furthermore, cells co -transfected with pmirGLO-FEZF1-AS1-MUT vector and negative control exhibited a higher level of luciferase activity with respect to the group co -transfected with WT vector and negative control, which may be due to the disruption of miR-107 binding in the MUT construct (>50%, Fig.   3e, f). [score:1]
Thus, we chose miR-107 as a mo del miRNA for further studies. [score:1]
Spearman correlation analysis suggested a negative relationship between FEZF1-AS1 and miR-107 in 94 PDAC specimens (r = −0.611, P < 0.001, Fig.   3b). [score:1]
FEZF1-AS1/miR-107/ZNF312B pathway maintains Warburg effect of PDAC cells. [score:1]
c, d Relative FEZF1-AS1 levels were investigated in PANC-1 and Capan-2 cells after transfected with miR-107 inhibitor or miR-107 mimic. [score:1]
FEZF1-AS1/miR-107/ZNF312B pathway promotes PDAC cell migration and invasion in vitro. [score:1]
[1 to 20 of 71 sentences]
3
[+] score: 223
Other miRNAs from this paper: hsa-mir-331, hsa-mir-216b
miR-107 downregulates CPEB3 expression by directly targeting the CPEB3 3′-UTR. [score:9]
The hsa-miR-107 mimic, miR-107 inhibitor, mimic negative control (NC mimic), inhibitor negative control (NC inhibitor) sequences and human CPEB3 siRNA were obtained from the Gene Pharma Company (Shanghai, China). [score:7]
Interestingly, we observed that the miR-107 -mediated downregulation of the CPEB3 level increased the expression of EGFR, which is a regulating pivot in HCC [36]. [score:7]
At the molecular level, we performed luciferase assays and western blotting analyses to determine that miR-107 suppresses the expression of CPEB3 by targeting its 3′-UTR. [score:6]
For all related DNA sequences, see the Table 1. Table 1 Primer function/target and nameDirection * Sequence Plasmid construction   CPEB3 3′UTR WT F CTGAGCTCACTCGTGAGTAGGTGGCAGA R GTTCTAGACATGCCTTCCTCCGGTCAAT qPCR   miR-107 stem-loop RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAAT TGCACTGGATACGACTGATAG   U6 RT CGCTTCACGAATTTGCGTGTCAT   miR-107 F AGCAGCATTGTACAGGGCTATCA R ATTGCGTGTCGTGGAGTCG   CPEB3 F GAAAGGTAAACACTACCCTCCCA R CCAGGAAGGCATTGTTAAGTGC   β-Actin F TACCTCATGAAGATCCTCACC R TTTCGTGGATGCCACAGGAC   U6 F GCTTCGGCAGCACATATACTAAAAT R CGCTTCACGAATTTGCGTGTCAT Oligonucleotides   miR-107 mimic AGCAGCAUUGUACAGGGCUAUCA AUAGCCCUGUACAAUGCUGCUUU   Negative Control (NC mimic) UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT   miR-107 inhibitor UGAUAGCCCUGUACAAUGCUGCU   Inhibitor NC CAGUACUUUUGUGUAGUACAA   siCPEB3 GGACCGAUAAUGGUAACAATT UUGUUACCAUUAUCGGUCCTT   Negative Control (siNC) UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT TABLE Primers for plasmid construction, qRT-PCR, and oligonucleotides * F, forward; R, reverse. [score:6]
Interestingly, we found that the CPEB3 expression decreased by miR-107 was accompanied by the upregulation of EGFR and pAKT. [score:6]
For all related DNA sequences, see the Table 1. Table 1 Primer function/target and nameDirection * Sequence Plasmid construction   CPEB3 3′UTR WT F CTGAGCTCACTCGTGAGTAGGTGGCAGA R GTTCTAGACATGCCTTCCTCCGGTCAAT qPCR   miR-107 stem-loop RT GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAAT TGCACTGGATACGACTGATAG   U6 RT CGCTTCACGAATTTGCGTGTCAT   miR-107 F AGCAGCATTGTACAGGGCTATCA R ATTGCGTGTCGTGGAGTCG   CPEB3 F GAAAGGTAAACACTACCCTCCCA R CCAGGAAGGCATTGTTAAGTGC   β-Actin F TACCTCATGAAGATCCTCACC R TTTCGTGGATGCCACAGGAC   U6 F GCTTCGGCAGCACATATACTAAAAT R CGCTTCACGAATTTGCGTGTCAT Oligonucleotides   miR-107 mimic AGCAGCAUUGUACAGGGCUAUCA AUAGCCCUGUACAAUGCUGCUUU   Negative Control (NC mimic) UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT   miR-107 inhibitor UGAUAGCCCUGUACAAUGCUGCU   Inhibitor NC CAGUACUUUUGUGUAGUACAA   siCPEB3 GGACCGAUAAUGGUAACAATT UUGUUACCAUUAUCGGUCCTT   Negative Control (siNC) UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT TABLE Primers for plasmid construction, qRT-PCR, and oligonucleotides * F, forward; R, reverse. [score:6]
These data indicate that miR-107 directly targets the CPEB3 3′UTR, thereby reducing CPEB3 expression. [score:6]
s. Cells were transfected with NC mimic/miR-107 mimic and NC inhibitor/miR-107 inhibitor. [score:5]
In addition, the high expression of miR-107 dramatically suppressed the endogenous mRNA and protein levels of CPEB3 in human HCC cell lines (Figure 4A– 4B). [score:5]
In the present study, we showed that miR-107 promotes the progression of HCC by targeting the CPEB3/EGFR axis and that this newly discovered mechanism might provide a new potential therapeutic target for HCC treatment. [score:5]
The same experiments as (A-C) were performed in cells transfected with miR-107 inhibitor and negative control (inhibitor NC). [score:5]
All four bioinformatics algorithms, miRanda, TargetScan, miRBase, and PicTar, indicated that CPEB3 was a target of miR-107. [score:5]
To test this hypothesis, we constructed a CPEB3 expression vector, then co -transfected the CPEB3 expression vector (or empty vector) with the miR-107 mimic (or NC mimic) into the Huh7 cells. [score:5]
More importantly, CPEB3 was identified as a novel and functional target of miR-107, which acts as a tumor suppressor in HCC. [score:5]
We have previously demonstrated miR-107 downregulated CPEB3 at the mRNA and protein levels, so we hypothesized that in vitro phenotypes associated with miR-107 could be reversed via the restoration of CPEB3 levels. [score:4]
miR-107 directly targets the CPEB3 3′-UTR. [score:4]
To determine whether CPEB3 is directly targeted by miR-107 at its 3′-UTR, the luciferase reporter plasmid containing 3′-UTR fragments of CPEB3 was co -transfected with miR-107 mimics and NC mimics. [score:4]
Therefore, these observations suggest that miR-107 is a newly discovered HCC promoter that is associated with EGFR signaling pathway partially through its target, CPEB3. [score:3]
The results demonstrated that the overexpression of miR-107 significantly promoted cell proliferation in both cell lines (Figure 1B– 1C). [score:3]
Moreover, the growth ability of cells decreased when endogenous miR-107 was silenced with a miRNA inhibitor (Figure 1D– 1F). [score:3]
The ability of migration and invasion of the cells was enhanced (Figure 5D– 5G) as a result of the overexpression of miR-107. [score:3]
We also tested the PTEN level, as a putative HCC suppressor [21], but found no significant correlation with miR-107 or CPEB3 (data not shown). [score:3]
We demonstrated that the overexpression of miR-107 promotes human HCC cell proliferation, migration and invasion. [score:3]
The expression possibility of miR-107 was significantly higher in the HCC tissues than in the corresponding non-cancerous liver tissue (Figure 7B– 7C). [score:3]
qRT-PCR and western blotting were applied to detect the mRNA and protein expression levels of CPEB3 in the HepG2 and Huh7 cells transfected with the NC mimic and miR-107 mimic. [score:3]
Figure 7 A. miR-107 mediates CPEB3 inhibitory functions through the EGFR pathway. [score:3]
As a result, these findings suggest that miR-107 functionally targets CPEB3 and promotes tumor effects partially through CPEB3. [score:3]
D. Huh7 cells were co -transfected with the miR-107 mimic (or NC mimic) and the CPEB3 expression vector (or pcDNA 3.1(+)). [score:3]
C. The prediction targeting site of CPEB3 3′-UTR combined with miR-107 were shown (MUT1, the first binding site is mutant; MUT2, the second binding site is mutant and MUT3, both binding sites are mutant). [score:3]
A. Relative miR-107 expression levels of the two cell lines (HepG2 and Huh7) were detected with quantitative real-time PCR (qRT-PCR) after transfecting with the miR-107 mimic or the negative control (NC mimic). [score:3]
Although miR-107 has been identified as an upregulated gene in HCC tissue compared with non-tumor tissue based on microarray analysis, relatively little is known about the role of miR-107 in human HCC [17]. [score:3]
Overexpression of miR-107 exacerbates human HCC cell migration and invasion. [score:3]
A. miR-107 mediates CPEB3 inhibitory functions through the EGFR pathway. [score:3]
Overexpression of miR-107 promotes the migration and invasion of human HCC cells. [score:3]
Figure 1miR-107 promotes cell growth ability in vitro A. Relative miR-107 expression levels of the two cell lines (HepG2 and Huh7) were detected with quantitative real-time PCR (qRT-PCR) after transfecting with the miR-107 mimic or the negative control (NC mimic). [score:3]
The results showed that overexpression of miR-107 increased the migration rate of both cell lines (Figure 3F– 3G). [score:3]
In conclusion, the newly identified miR-107/CPEB3 axis provides new insight into the pathogenesis of HCC and represents a novel, potential therapeutic target for the treatment of HCC. [score:3]
While Zhou et al. [28] suggested that the miR-107 acts as a tumor-suppressor in cervical cancer. [score:3]
A recent published study reported that miR-107 exhibits weak to moderate tumor suppressor potential in c-Myc and AKT/Ras mice [29]. [score:3]
We demonstrated that overexpressing miR-107 contributes to proliferation both in vitro and in vivo in human HCC (Figure 1– 2). [score:3]
D. The tumor volumes were determined, and miR-107 overexpression resulted in an increased growth rate. [score:3]
To understand how miR-107 mediates human HCC cell growth and metastasis, bioinformatics strategies were used to search for the potential targets of miR-107. [score:3]
Furthermore, we showed that miR-107 regulates the pathogenesis of HCC partially through the CPEB3/EGFR pathway. [score:2]
As expected, there was a significant increase in tumor size and weight of the miR-107 -overexpressing groups compared with the NC group (Figure 2C– 2E). [score:2]
Taken together, these observations suggest that miR-107 is a positive proliferative regulator in HCC. [score:2]
We found that the growth ability was increased in miR-107 -overexpressing cells compared with the NC group (Figure 2A– 2B). [score:2]
High expression of miR-107 was observed in cancer tissue compared with non-cancer tissue in clinical samples. [score:2]
The last new finding of this study is that miR-107 may facilitate HCC pathogenesis through the CPEB3/EGFR axis. [score:1]
These findings indicate that miR-107 promotes migration and invasion of HCC cells. [score:1]
miR-107 promotes tumor proliferation in vitro and in a xenograft mo del. [score:1]
To explore the role of miR-107 in tumor proliferation in vivo, the xenograft mo del of human HCC cells in nude mice was used. [score:1]
In this report, we explored the functional role of miR-107 in human HCC progression. [score:1]
The annealing temperature for CPEB3 and miR-107 was 60°C. [score:1]
The transwell assays without Matrigel demonstrated that overexpression of miR-107 by transfecting its mimic significantly promotes the migration of Huh7 compared with the NC group. [score:1]
To test whether miR-107 plays the same role, a HCC promoter, in clinical samples, we evaluated the expression of miR-107 using in situ hybridization (ISH) on tissue microarrays containing 30 HCC tissues and corresponding non-cancerous liver tissues. [score:1]
B. Representative results of the in situ hybridization of HCC specimens and corresponding adjacent non-cancerous liver tissues for miR-107. [score:1]
There are two predicted miR-107 binding sites in the 3′-UTR of CPEB3, so we built different 3′-UTR fragments, including wild-type (WT-UTR) and mutant-type 3′-UTR (MUT1, MUT2 and MUT3) to clarify the functional site (Figure 4C). [score:1]
The results support that miR-107 promotes tumor effects in HCC. [score:1]
These conclusions are not clear because the role of miR-107 in tumorigenesis is complicated and seems to be tissue type -dependent [27, 28], and the molecular mechanisms involved in the two studies may be different. [score:1]
C. miR-107 was detected in both HCC tissues and normal tissues. [score:1]
To construct a pmir-CPEB3–3′UTR plasmid containing the potential miR-107 binding sites, a 597-bp sequence was amplified and inserted into the SacI and XbaI sites of the pmir-GLO Dual Luciferase vector (Promega, Madison, WI, USA). [score:1]
However, little is known about the role and underlying molecular mechanisms of miR-107 in human HCC. [score:1]
To better understand miR-107 function in human HCC cell metastasis, we tested the miR-107 level and migratory ability of the two cell lines (Figure 3A– 3C). [score:1]
ISH of miR-107 with microarrays was performed by Shanghai Outdo Biotech Co. [score:1]
To date, recent findings have shown that miR-107 was involved in various pathological processes including carcinogenesis. [score:1]
When grown to 60–70% confluence, the cells were co -transfected with a 100-ng Luciferase plasmid along with a 650-ng miR-107 mimic or a NC mimic as described above. [score:1]
These results suggest that miR-107 may function as a tumor promoter in HCC. [score:1]
As shown in Figure 4D, the relative luciferase activity was remarkably reduced by miR-107 when the wild-type 3′-UTR of CPEB3 was present. [score:1]
The miR-107 positivity analysis is shown. [score:1]
Then, 5 × 10 [6] HepG2 cells that were transfected with miR-107 or CPEB3 siRNA were injected subcutaneously into the right flank of the nude mice. [score:1]
To confirm the tumor promoter role of miR-107 in our study, the Huh7 and HepG2 human HCC cell lines were used to perform the MTT, transwell, colony formation and wound healing experiments (Figure 1). [score:1]
D. HEK-293T cells were cotransfected with wild-type 3′-UTR (WT-UTR) or mutant-type 3′-UTR (MUT1, MUT2 and MUT3) reporters and the NC mimic or the miR-107 mimic. [score:1]
To further understand the molecular mechanism of miR-107 HCC promoter potential, western blotting was performed to test the potential signaling at the protein level. [score:1]
Song et al. [27] reported that miR-107 contributes to accelerating the proliferation of gastric cancer cells. [score:1]
In the present study, our data showed that miR-107 acts as a tumor promoter in HCC by accelerating growth, both in vitro and in vivo, and exacerbating metastasis of human HCC cells. [score:1]
EGFR is involved in the miR-107 pathogenesis of HCC through CPEB3. [score:1]
miR-107 promotes cell growth ability in vitro. [score:1]
miR-107 promotes human HCC cell proliferation in vitro and in vivo. [score:1]
To investigate colony formation ability, HepG2 or Huh7 cells were transfected with miR-107 mimic, miR-107 inhibitor, or NC and subsequently seeded in 6-cm plates (1 000 cells/dish) and incubated for 2 weeks to allow for colony formation. [score:1]
HepG2 cells transfected with NC mimic/miR-107 mimic were injected subcutaneously into the flank of each nude mouse. [score:1]
The hsa-miR-107 miRCURY LNA Detection probe, 5′-DIG and 3′-DIG labeled, was used as the microRNA probe (Exiqon, 18015–15). [score:1]
To understand the underlying mechanisms of the miR-107 oncogenic effects in HCC, we performed western blotting in the HepG2 and Huh7 cells to explore the correlative genes in HCC. [score:1]
These results indicate that miR-107 significantly accelerates human HCC cell proliferation in vitro. [score:1]
CPEB3 is involved in miR-107 -induced growth and migration in HCC cells. [score:1]
In addition, we performed the miR-107 ISH in clinical samples. [score:1]
[1 to 20 of 86 sentences]
4
[+] score: 189
The expression level of CDK8 mRNA and protein in miR-107 inhibitor transfected GC cell line was significantly decreased compared with control group,, indicating that miR-107 suppressed CDK8 expression posttranscriptionally. [score:8]
Luciferase assays using a reporter carrying a putative miR-107 target site in the 3′untranslated region (3′-UTR) of cyclin dependent kinase 8 (CDK8) revealed that miR-107 directly targets CDK8. [score:7]
Clone formation rate of miR-107 inhibitor transfected group was significantly lower than that of control group, demonstrating that miR-107 inhibitor significantly inhibited GC cell line SGC7901 colony formation (P < 0.05, shown in Figure  3). [score:7]
Previously, Feng et al. found that miR-107 targeted cyclin -dependent kinase 6 (CDK6) expression, induced cell cycle G1 arrest and inhibited invasion in GC cells [18]. [score:7]
In addition, we found that clone formation rate of miR-107 inhibitor transfected group was significantly lower than that of control group, demonstrating that miR-107 inhibitor significantly inhibited GC cell line colony formation. [score:7]
Li et al. found that upregulation of miR-107 induced proliferation in GC cells by targeting the transcription factor FOXO1 [19]. [score:6]
We found that miR-107 inhibitor transfection significantly decreased the proliferation of GC cell line, and clone formation rate of miR-107 inhibitor transfected group was significantly lower than that of control group. [score:5]
These results indicated that miR-107 suppressed CDK8 expression posttranscriptionally. [score:5]
qRT-PCR was used to detect the expression of miR-107 in GC cell line, SGC7901, and a gastric epithelial cell line, GES-1. Expression of miR-107 was significantly elevated in GC cell line, SGC7901 (P = 0.012, shown in Figure  1). [score:5]
In conclusion, our findings indicate that miR-107 is upregulated in GC and affects the proliferation of GC cells, partially through the regulation of CDK8. [score:5]
Our findings indicate that miR-107 is upregulated in GC and affects the proliferation of GC cells, partially through the regulation of CDK8. [score:5]
In Kaplan-Meier survival curve analysis, OS and DFS of patients with high miR-107 expression were significantly worse than those of patients with low miR-107 expression. [score:5]
The expression of CDK8 was normalized with GAPDH, and the expression of miR-107 was normalized with U6. [score:5]
Figure 3 miR-107 inhibitor inhibited cell colony formation. [score:5]
CDK8 was a direct target of miR-107. [score:4]
The expression level of CDK8 mRNA and protein in miR-107 inhibitor transfected GC cell line was significantly decreased compared with control group. [score:4]
We identified that miR-107 could regulate proliferation of GC by targeting CDK8. [score:4]
CDK8 mRNA expression level was significantly decreased in miR-107 inhibitor transfected SGC7901 cells compared with control group (shown in Figure  4b). [score:4]
Thus, the identification of the role of miR-107 as an oncogene through targeting CDK8 in GChelps us to further elucidate the potential molecular mechanisms of GC development. [score:4]
In the comparison of clinicopathological factors, miR-107 expression showed significant association with depth of tumor invasion, lymph node metastasis and tumor stage [13]. [score:3]
Accumulating evidence shows that miR-107 is one of the oncogenic RNAs, and overexpression of these RNAs has been reported in several types of human malignant solid tumors. [score:3]
miR-107 inhibitor decreased GC cell line SGC7901 clone formation rate. [score:3]
a Inhibition of miR-107 significantly decreased cell proliferation in SGC7901 cells. [score:3]
MTT assay showed that down regulation of CDK8 by siRNA for CDK8 could significantly attenuate the oncogenic effect of miR-107 (shown in Figure  5), suggesting that miR-107 promoted the proliferation of GC cells partially by targeting CDK8. [score:3]
b The proportion of apoptotic SGC7901 cells induced by miR-107 inhibitor was significantly greater than that induced by the negative control. [score:3]
We found that miR-107 might modulate CDK8 using online prediction software Target Scan. [score:3]
We found that miR-107 inhibitor transfection significantly decreased the proliferation of SGC7901 (shown in Figure  2a). [score:3]
c: CDK8 protein level was detected by in SGC7901 cells transfected with miR-107 inhibitor or the control. [score:3]
In the comparison of clinicopathological factors, miR-107 expression showed significant association with depth of tumor invasion, lymph node metastasis and tumor stage. [score:3]
Consistent with previous findings from other cancers, such as esophageal cancer, pancreatic cancer and colorectal cancer [9– 12], in GC, we also found that miR-107 could remarkably promote cell proliferation and suppress apoptosis. [score:3]
In our study, MTT assay showed that down regulation of CDK8 by siRNA could significantly attenuate the oncogenic effect of miR-107, suggesting that miR-107 promoted the proliferation of GC cells partially by targeting CDK8. [score:3]
Accumulating evidence shows that microRNA-107(miR-107) is one of the oncogenic RNAs, and overexpression of these RNAs has been reported in several types of human malignant solid tumors, including gastric, esophageal, pancreatic and colorectal cancer [9– 12]. [score:3]
We further explored the effect of miR-107 on apoptosis and found that apoptosis was increased dramatically in SGC7901 cells 72 h after transfection of miR-107 inhibitor (shown in Figure  2b), suggesting that miR-107 might function as an antiapoptotic factor in human GC cells. [score:3]
b: CDK8 mRNA level was detected by RT-PCR in SGC7901 cells transfected with miR-107 inhibitor or the control. [score:3]
miR-107 inhibitor or control was transfected into SGC7901 cells at 100 nM concentrations. [score:3]
Quantitative real-time RT-PCR was used to test miR-107 expression. [score:3]
Expression of miR-107 was significantly elevated in GC cell line than that in gastric epithelial cell line(p = 0.012). [score:3]
In this study, CDK8 was predicted to be the target gene of miR-107 by online biological software, then luciferase reporter vectors containing CDK8 gene 3′-UTR region with miR-107 binding site was constructed and specific binding between miR-107 and CDK8 was verified. [score:3]
miR-107 target gene prediction and 3′-UTR plasmid vectors construction. [score:3]
3′-UTR region of CDK8 including miR-107 targeting sequence was amplified using PCR amplification. [score:3]
In the Cox multivariate analysis, it was shown that miR-107 expression in GC tissues was an independent prognostic factor for OS and DFS. [score:3]
MiR-107 inhibitor was transfected into cells according to Invitrogen Lipofectamine reagent instructions. [score:2]
Thus, our data suggested that miR-107 might play an important role in GC development. [score:2]
Previously, Inoue et al. found that the mean expression level of miR-107 was significantly higher in the GC tissues compared to that of normal tissues. [score:2]
Furthermore, CDK8 protein expression measured by in miR-107 inhibitor transfected SGC7901 cells was significantly decreased compared with control group (shown in Figure  4c). [score:2]
Down regulation of CDK8 attenuated the oncogenic effect of miR-107. [score:2]
In the present study, we validated that the expression of miR-107 was significantly increased in GC cell line compared with normal controls. [score:2]
In this study, we aimed to investigate the expression, biological functions and mechanisms of miR-107 in GC. [score:1]
miR-107 was elevated in GC cell line SGC7901. [score:1]
Figure 1 miR-107 was elevated in GC cell line. [score:1]
The biological processes and molecular mechanisms underlying miR-107 remain unclear in gastric cancer(GC). [score:1]
HEK293 cells in logarithmic growth phase were seeded into 96-well culture plate, incubated at 37°C, 5% CO [2] for 24 h, and co -transfected with pMIR-REPORT and miR-107 mimics (or NC) using Lipofectamine 2000. [score:1]
miR-107 promoted GC cell line proliferation. [score:1]
This data showed that there was specific binding between miR-107 and 3′-UTR in CDK8 gene. [score:1]
Comparison of luciferase activity in experimental group with negative control group showed that luciferase activity in SGC7901 cells cotransfected with pMIR-REPORT and miR-107 mimics was 38.9% of that in pMIR-REPORT and NC cotransfected group (5.02 ± 2.11 vs. [score:1]
Their results indicate that miR-107 may be useful as an effective biomarker for prediction of a poor prognosis in GC patients [13]. [score:1]
[1 to 20 of 56 sentences]
5
[+] score: 170
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-150
Meanwhile, miR-107-5p has also been proved to target other genes, such as over -expression of miR-107 could arrest cell cycle and suppress cell proliferation in H1299 and A549 cells by targeting CDK6, miR-107 could directly target CDK8 to further inhibit cell proliferation in A549 cells and miR-107 could inhibit tumor growth and metastasis in NSCLC cells by directly targeting BDNF and regulating the P13K/AKT signaling pathway indirectly [26, 29, 30] (Figure 7). [score:21]
Our results demonstrated that EGFR was a direct target of miR-107-5p in NSCLC cell lines for the first time, and based on previous studies in our lab, we found that miR-150 [28], miR-34a and miR-107-5p may have a close correlation with NSCLC development by partly targeting EGFR. [score:7]
Immunohistochemical analysis of tumor tissues from miR-107-stably -overexpressing mice, and results showed that Ki67 was significantly downregulated (Figure 6E). [score:6]
To further explore the biological effects involved in regulation of EGFR expression by miR-107-5p in NSCLC cell lines, EGFR was knocked down by using siRNA to test the change in cell proliferation, cell cycle and apoptosis progression of A549 cells and HCC827 cells. [score:5]
In this study, we demonstrated that in clinical NSCLC samples, miR-107-5p was significantly downregulated compared with the control, suggesting its role as a tumor suppressor. [score:5]
Meanwhile, the expression of miR-107-5p was significantly upregulated in tumor tissues of pLenti-miR-107 group compared to the control (Figure 6D). [score:5]
MiR-107-5p suppresses the tumorigenesis in vivoTo explore the role of miR-107-5p in tumor proliferation in vivo, nude mice were treated with A549 cells (5 × 10 [6]) with stably overexpressing miR-107 (pLenti-miR-107) or control (pLenti). [score:5]
Overexpression of miR-107 inhibits tumor growth. [score:5]
Figure 7 We speculate that miR-107-5p function as tumor suppressor by down -regulating EGFR and has a close correlation with several miRNAs or genes that are related to the NSCLC process. [score:4]
In view of the fact that miR-107-5p is significantly down regulated in NSCLC, moreover, we hypothesized that miR-107-5p may play an important role in tumorigenesis and tumor development in NSCLC by regulating EGFR. [score:4]
We speculate that miR-107-5p function as tumor suppressor by down -regulating EGFR and has a close correlation with several miRNAs or genes that are related to the NSCLC process. [score:4]
EGFR is a direct target of miR-107-5p. [score:4]
When grown to 60–80% confluence, the cells were transiently co -transfected with 400 ng of luciferase vector pGL3-EGFR-3′-UTR or pGL3-EGFR-3′-mUTR, and miR-107-5p mimic or NC miRNA, we used 100 nM with 20 ng plasmid expressing the renilla luciferase gene (pRL, Promega) as a final concentration for transfection efficiency which was the control. [score:3]
Together, the data demonstrated that miR-107-5p can inhibit cell proliferation and migration of NSCLC cells. [score:3]
The expression of miR-107-5p in NSCLC cell lines was also examined, and miR-107-5p was significantly down regulated in A549, 95-D, PC-9, HCC827 cells when compared with BEAS-2B cells, the normal bronchial epithelial cells (Figure 1B). [score:3]
Figure 6 (A) MiR-107-stably -overexpressing A549 cells (pLenti-miR-107) and control (pLenti) were injected into nude mice. [score:3]
In order to validate whether, we constructed two recombinant expression vectors containing the miR-107-5p wild type binding sequences in the 3′UTR of EGFR and mutated five binding sites within the 3′UTR (pGL3-EGFR-3′-UTR, and pGL3-EGFR-3′-mUTR), and co-transfection of miR-107-5p mimic or NC mimic in HEK293T cells with pGL3-EGFR-3′-UTR resulted in significant restraint of luciferase activity (co -transfected with pGL3-EGFR-3′-UTR and miRNA NC). [score:3]
Expression of miR-107-5p decreases in NSCLC. [score:3]
Dysregulated of miR-107 is related to various tumor development [17, 18]. [score:3]
To explore the role of miR-107-5p in tumor proliferation in vivo, nude mice were treated with A549 cells (5 × 10 [6]) with stably overexpressing miR-107 (pLenti-miR-107) or control (pLenti). [score:3]
The wild type binding site of miR-107-5p with EGFR was displayed by using in TargetScan prediction programs and the mutant type binding site of miR-107-5p with EGFR were also shown (Figure 4B). [score:3]
On the other hand, miR-107 was associated with several pathological conditions, such as neurodegenerative disease, angiogenesis and tumorigenesis. [score:3]
Performed as previously described [32], pri-miR-107 was amplified in A549 cells, then digested with Xho I and BamH I and cloned into the lentiviral expression vector, pLenti (Invitrogen, Carlsbad, CA, USA), named pLenti-miR-107. [score:3]
Flow cytometry (Beckman Coulter) was used to obtain stable overexpression of miR-107 (pLenti-miR-107) or negative control (NC, pLenti) in A549 cells. [score:3]
The protein expression of EGFR was reduced in A549 cells and HCC827 cells after transfected with miR-107-5p mimic (Figure 4D). [score:3]
Our results showed that miR-107-5p can inhibit cell proliferation, colony formation, metastasis, cause cell cycle arrest at G0/G1 phase and promote apoptosis in A549, HCC827 and 95-D cells. [score:3]
After 1 week mice were randomly assigned into 2 groups, and 5 × 10 [6] A549 cells stably overexpressing miR-107 (pLentimiR-107) or control (pLenti) were injected into each mouse. [score:3]
Our results validate that miR-107-5p functions as a tumor suppressor through EGFR, and this shed light on precision medicine of lung cancer. [score:3]
Figure 1 (A) Expression of miR-107-5p in NSCLC and corresponding non-tumor tissues (n = 61). [score:3]
To identify the potential target genes of miR-107-5p, bioinformatics method (www. [score:3]
Figure 4 (A) Identification of the candidate target of miR-107-5p by bioinformatics. [score:3]
In contrast, miR-107-5p functions as a tumor suppressor in colorectal cancer, glioma and NSCLC [25– 27]. [score:3]
MiR-107-5p is downregulated in NSCLC. [score:3]
MiR-107-5p promotes apoptosis and inhibits cell cycle progression in NSCLC cells. [score:2]
MiR-107-5p inhibits cell proliferation and migration. [score:2]
MiR-107-5p suppresses the tumorigenesis in vivo. [score:2]
There was a significant decrease in tumor size and weight of the miR-107 -overexpressing groups compared with the control (Figure 6A–6C). [score:2]
Taken together, these presentations suggested that miR-107-5p is a negaitive regulator in NSCLC. [score:2]
The regulatory network of miR-107-5p in NSCLC. [score:2]
MiR-107-5p inhibits cell proliferation and migration in NSCLC cells. [score:2]
The results revealed that expression of miR-107-5p decreased the migration rate of A549 and HCC827 cell lines when compared with the NC group (Figure 2E). [score:2]
The transfection of miR-107-5p increased its level in these cell lines by (Figure 2A, Supplementary Figure 1A). [score:1]
These results suggested that the miR-107-5p was associated with NSCLC carcinogenesis. [score:1]
Next, pLenti vector or pLenti-miR-107 was co -transfected into HEK293T cells using a packaging plasmid system (pMD2G and psPAX2) and viral particles, after 24 h and 48 h later to collect lentiviral particles. [score:1]
To investigate the role of miR-107-5p in lung cancer, we first analyzed the expression level of miR-107-5p in 61 human NSCLC samples and para-carcinoma tissues. [score:1]
Figure 2 in NSCLC cells (A) The expression of miR-107-5p was measured by qRT-PCR in A549 and HCC827 cells 48 h after transfection with NC (negative control) or miR-107-5p mimic. [score:1]
Thus miR-107-5p promotes apoptosis and arrests cell cycle in NSCLC cells. [score:1]
These data suggested that miR-107-5p could promote the level of apoptosis in NSCLC cells and arrest cells in the G1 phase and reduced the proportion of cells in the S phase. [score:1]
A549 cells, HCC827 cells and 95-D cells were transfected with miR-107-5p mimic. [score:1]
It is urgent to understand miR-107 in lung cancer. [score:1]
The percentages of apoptotic cells in the miR-107-5p mimic groups were significantly higher than that of NC group (Figure 3A, Supplementary Figure 1D). [score:1]
A549 cells, HCC827 cells and 95-D cells were treated with miR-107-5p mimic for 48 h and then were stained with FITC/PI and analyzed by flow cytometry. [score:1]
Cells were transiently transfected with 30 nM of miR-107-5p mimic, negative control mimic (NC), and transfected with 150 nM EGFR siRNA (siEGFR), or negative control siRNA (siNC) (RIBOBIO, Guangzhou, China) using Invitrogen™ Lipofectamine 2000 (Life Technologies, New York, USA) according to the manufacturer's instructions. [score:1]
Our data revealed that miR-107-5p was down regulated when compared with corresponding para-carcinoma tissues (Figure 1A). [score:1]
To determine the role of miR-107-5p on cell cycle, cells were transfected with miR-107-5p mimic for 24 h, and the results analyzed by flow cytometry. [score:1]
Then A549 cells were infected with the viral particles twice within 48 h. Transfected green fluorescence to pLenti vector or pLenti-miR-107 in A549 cells. [score:1]
On the one hand, miR-107 played vital function in stress response, metabolism, and cell division [16]. [score:1]
[1 to 20 of 57 sentences]
6
[+] score: 123
On the other hand, during the preparation of this manuscript, Lee et al. reported that demethylation and deacetylation treatments to human pancreatic cancer cell lines induced the overexpression of miR-107 and the overexpression of miR-107 suppressed cell growth and the expression of the CDK6 in the human pancreatic cancer cell lines [30]. [score:9]
The extent of growth suppression by these miRNAs is similar to that by the tumor suppressive miRNA, let-7. Gene expression profiling analysis with the transfection of these miRNAs indicated that only miR-107 showed significant enrichment of cell cycle regulators for the downstream effectors. [score:8]
In the hsa-miR-107, hsa-miR-185 and hsa-let-7a transfected cells there were 561, 646 and 812 transcripts down-regulated and 608, 698 and 949 upregulated by 1.5 fold or greater, respectively. [score:7]
For miR-107, we confirmed mRNA down-regulation of CCNE1 (NM_001238), CDK6, CDCA4 (NM_017955.3), RAB1B (NM_030981.2) and CRKL (NM_005207.3), and for miR-185, we confirmed down-regulation of CCNE1, CDK6, AKT1 (NM_001014431.1), HMGA2 (NM_003483.4) and CORO2B (NM_006091.3) (Fig. 5B). [score:7]
miR-107 shares 7 of the 8 bases of its seed sequence with the miR-16 family of miRNAs, which induce G1 arrest by targeting multiple cyclins and cell cycle regulators, including CDK6 which we confirmed as a miR-107 target [28]. [score:6]
We note that both miR-107 and miR-185 transfection caused down-regulation of cyclin E1 (CCNE1) and cyclin dependent kinase 6 (CDK6) mRNA levels although the suppression level of CDK6 by miR-185 is modest (Fig. 5B). [score:6]
We then confirmed by western blotting that CDK6 protein levels are also down-regulated by miR-107, whereas CDK6 expression was relatively unchanged by miR-185 (Fig. 5C). [score:6]
Using miRNA-target prediction analyses and the array data, we listed up a set of likely targets of miR-107 and miR-185 for G1 cell cycle arrest and validate a subset of them using real-time RT-PCR and immunoblotting for CDK6. [score:5]
Overexpression of miR-107 and miR-185 causes growth suppression and induces G1 cell cycle arrest. [score:5]
The number of cell cycle regulators in the downstream suppressed genes is much lower by miR-185 than by miR-107. [score:4]
C) Western Blot showing down-regulation of CDK6 protein by miR-107. [score:4]
The top five terms in genes down-regulated by hsa-miR-107 were all cell cycle related (table 1). [score:4]
Especially for miR-107, a large number of down-regulated genes are annotated with the gene ontology term ‘cell cycle’. [score:4]
Gene ontology terms enriched of genes down-regulated by miR-107, miR-185 and let-7a transfection. [score:4]
In terms of miR-107, other evidence supports a role for this miRNA in G1 arrest and growth suppression. [score:3]
Effect of miR-107, miR-185 and let-7a over -expression on cell cycle profile in H1299 cells. [score:3]
This suggests that growth suppression induced by hsa-miR-107 and hsa-miR-185 transfection was caused by induction of G1 arrest rather than apoptosis. [score:3]
The latter study is compatible to our data in terms of CDK6 as a candidate downstream target of miR-107. [score:3]
The vertical axis indicates the relative ratio of the A450 nm: that of day 0 of each cell as 1. Note miR-107 and miR-185 suppresses proliferation in both cell lines. [score:3]
B) The quantitative RT-PCR analyses of potential targets of miR-107 (CCNE1, CDK6, CDCA4, RAB1B and CRKL) and miR-185 (CCNE1, CDK6, AKT1, HMGA2, CORO2B) are shown. [score:3]
During the study, we found that miR-107 (MIMAT0000104) and miR-185 (MIMAT0000455) suppress proliferation in lung adenocarcinoma cell lines and induce cell cycle arrest at the G1 phase of the cell cycle. [score:3]
It is interesting that expression of the analyzed miRNAs (miR-107, 185, and let-7a) were lower in the lung tumor and lung cancer cell lines than in normal lung. [score:3]
Furthermore, a previous study found that synthetic inhibitors for miR-107 increase proliferation of A549 cells, but do not effect HeLa cells [29] suggesting miR-107 may indeed play a lung specific role in reducing proliferation. [score:3]
Interestingly, the miR-107 showed overexpressions in pancreatic cancers suggesting this miRNA has some positive role in pancreatic carcinogenesis [21]. [score:3]
We happened to find that miR-107 and miR-185 can suppress cell proliferation in two lung cancer cell lines and induced a G1 arrest of the cell cycle. [score:3]
of synthetic miR-107 or miR-185 suppressed growth of the human non-small cell lung cancer cell lines. [score:3]
We identified new cell cycle regulating miRNAs, miR-107 and miR-185, localized in frequently altered chromosomal regions in human lung cancers. [score:2]
According to the review by Wilfred et al., the miR-107 and its paralog, miR-103, may function in the regulation of cellular metabolism [32]. [score:2]
Then we chose three miRNAs : miR-107, miR-185, and miR-31 (MIMAT0000089) [19]– [22]. [score:1]
DNA content analysis by flow cytometry revealed transfection of hsa-miR-107 and hsa-miR-185 induced a significant increase in the percentage of cells at the G1 phase of the cell cycle, to similar levels as a let-7a control while a scrambled negative control did not (Fig. 3). [score:1]
Safdar et al. suggested that miR-107 has been induced in exercised mice quadriceps muscles [31]. [score:1]
Transfection of hsa-miR-107 and hsa-miR-185 dramatically reduced cell proliferation in both cell lines (Fig. 2). [score:1]
[1 to 20 of 32 sentences]
7
[+] score: 123
The downregulation of miR-103 and miR-107 with age could concern a protective effect against plaque formation because reduced levels of these miRNAs would lead to an increased level of the predicted target ADAM10 and its neuroprotective product sAPPα in brains of AD patients. [score:6]
MiR-107 and miR-103 are downregulated with age [35] as well as in AD gray matter [36] and repress the translation of cofilin. [score:6]
After the analysis we got 156 and 157 target genes for miR-103 and miR-107, respectively, common in four out of six databases, and 890 target genes for miR-1306 of database PITA. [score:5]
Another target gene in the network, Granulin (GRN), is regulated by miR-107[49] which regulates BACE1 as well [38]. [score:5]
Each set of target genes of miR-103 and miR-107 common in 4 out of 6 databases as well as the set of target genes of miR-1306 in the database PITA was explored for enrichment in Gene Ontology [32] by the software Pathway Studio 8.0 (Ariadne Genomics) based on database ResNet 8.0. [score:5]
The expression of the hypoxia-regulated gene VEGFA is decreased by miR-107[58]. [score:4]
As miR-107 regulates beta-site APP-cleaving enzyme 1 (BACE1) it might be involved in accelerated disease progression [38]. [score:4]
The tumor suppressors TP53 as well as TP73 appear to regulate the processing of miR-107[46]. [score:4]
Our observations of strong inhibition (> 40%) of ADAM10 expression in the reporter assay upon application of miR-103 and miR-107 would coincide with such a possible protective influence on amyloid pathology (see “Experimental validation of bioinformatically predicted miRNAs”). [score:4]
The genes dicer 1, ribonuclease type III (Dicer) and TAR (HIV-1) RNA binding protein 2 (TARBP2) targeted by miRNA-103 and miRNA-107 are components of the miRNA-processing complex [46]. [score:3]
These experimental results suggest an influence of miR-103 miR-107 and miR-1306 on ADAM10 expression. [score:3]
Furthermore, target genes of miR-103, miR-107 and miR-1306 were derived from six publicly available. [score:3]
We generated Venn diagrams to see the overlap between target genes of miR-103 and miR-107 common in 4 out of 6 databases as well as genes in the AlzGene database (http://www. [score:3]
In addition, the program TargetScan verifies the same binding site of miR-103 and miR-107 to human ADAM10. [score:3]
Click here for file List of enriched target genes of miR-107 in Gene Ontology. [score:3]
List of enriched target genes of miR-107 in Gene Ontology. [score:3]
The table shows the Gene Ontology entities with enrichment of predicted target genes of miR-107. [score:3]
The Venn diagram shows the significant overlap of the target genes of miR-103 and miR-107 common in four out of six databases as well as the genes of AlzGene database. [score:3]
Furthermore, miR-107 expression is decreased even in the earliest stages of AD. [score:3]
These findings of the literature and AlzGene database confirm the biological role of the target genes in neurodegenerative processes and hence the involvement of miR-103 and miR-107 in AD. [score:3]
In our case Tarbase doesn’t contain target genes for the miRNAs: miR-103, miR-107 and miR-1306. [score:3]
Applying a Fisher’s exact test we got a p-value of 0.0065, 0.0009 and 0.1904 for the overlap of miR-103, miR-107 and miR-1306, respectively, with the AlzGene database, which shows that 12 and 14 are significant high numbers of overlapping genes between the target genes and the AlzGene database. [score:3]
While miR-103 and miR-107 target the same DNA sequence within the ADAM10 3′UTR (see Figure  2), miR-1306 has a binding site in closer proximity to the Stop codon. [score:3]
The table shows a list of predicted target genes of miR-103, miR-107, miR-1306. [score:3]
The combination of different and the restriction of the output to four out of six databases in the case of miR-103 and miR-107 are important to reduce the amount of false positive miRNA target sites in the end. [score:3]
Predicted target genes of miR-103 (p-value = 0.0065) and miR-107 (p-value = 0.0009) showed significant overlap with the AlzGene database except for miR-1306. [score:3]
An additional evidence is given by the significant biological processes learning (miR-103: p-value = 0.0008; miR-107: p-value = 3.3 × 10 [−5]; miR-1306: p-value = 0.0003), brain development (miR-103: p-value = 0.0023; miR-107: p-value = 0.0004; miR-1306: p-value = 7.1 × 10 [−6]) and nervous system development (miR-103: p-value = 0.0004; miR-107: p-value = 0.0004; miR-1306: p-value = 6.9 × 10 [−8]) that the three miRNAs are involved in AD. [score:3]
MiR-103 and miR-107 have 130 target genes in common (Figure  5, Additional file 1). [score:3]
The overlap between AlzGene database genes and the target genes of miR-103, miR-107 as well as miR-1306 are 12, 14 (Figure  5) and 24 genes, respectively (Additional file 1). [score:3]
Our results show that miR-103, miR-107 and miR-1306 influence the expression of ADAM10 at least in the reporter assay system. [score:2]
NFIA is negatively regulated by miR-107[55] and plays an important role in the formation of the corpus callosum in the developing brain. [score:2]
ADAM10 expression in the reporter assay was reduced by miR-1306 (28%), miR-103 (45%) and miR-107 (52%). [score:2]
Only target genes predicted in at least four out of six databases in the case of miR-103 and miR-107 were compared to genes listed in the AlzGene database including genes possibly involved in AD. [score:2]
The figure shows the conservation of the miR-1306 (A), miR-103 (B) and miR-107 (C) binding region (light green) between different species. [score:1]
This result suggests that miR-103 and miR-107 might play a role in AD. [score:1]
Figure 6 Interaction network of miR-103 and miR-107. [score:1]
The three miRNAs identified by bioinformatical approaches and integration of literature mining all showed a significant decreasing effect on the ADAM10 3′UTR-reporter construct: miR-1306 lowered the luminescent signal to 72%, miR-103 to 55% and miR-107 to 48% of control. [score:1]
The second most interesting miRNAs possibly binding to human ADAM10 3′UTR are miR-103 as well as miR-107 both having the same binding site located on chromosome 15 positions 58889443–58889468. [score:1]
Furthermore, a network (Figure  6) containing already published interactions of miR-103 and miR-107 with genes involved in AD or included in the AlzGene database was established using the literature mining tool Pathway Studio. [score:1]
This site is predicted by the two programs RNAhybrid and miRanda with binding energy −27.9 and −23.66 kcal/mol for miR-103, respectively, as well as −26.2 and −22.28 kcal/mol for miR-107, respectively. [score:1]
Interactions between miR-103 and miR-107 to genes were revealed playing a role in processes leading to AD. [score:1]
Three of them (miR-103, miR-107, miR-1306) were further analysed as they are linked to AD and most strictly conserved between different species. [score:1]
In brains of a transgenic mouse mo del of AD the level of miR-103 and miR-107 is decreased while the cofilin protein level is increased which results in the formation of rod-like structures [37]. [score:1]
The network (established by Pathway Studio) shows already published interactions between miR-103 as well as miR-107 and genes known to be involved in AD or neurodegenerative processes. [score:1]
We therefore combined miR-1306 and miR-103 or miR-107, respectively, but observed no distinct significant synergistic effect (miR-1306 vs. [score:1]
[1 to 20 of 45 sentences]
8
[+] score: 111
The expression of miR-107 inhibited ARNT expression, and the inhibition was reversed by a miR-107 inhibitor (Figure 8B). [score:11]
In addition, miR-107 overexpression inhibits ARNT expression by targeting the 3′UTR of ARNT. [score:9]
Recent reports have shown that overexpression of miR-107 inhibits ARNT expression by targeting the 3′UTR of ARNT [22]. [score:9]
To further confirm that miR-107-regulated ARNT expression was associated with tumor cell invasion, the invasion assay was performed in miR-107- or miR-107 inhibitor -expressing cells. [score:7]
We also found that miR-107 overexpression significantly inhibited ARNT expression and promoted tumor cell invasion. [score:7]
The expression of miR-107 was also up-regulated in both chemotherapeutic drug -treated colorectal cancer cells or under hypoxic conditions, which is a significant event in the promotion of tumor metastasis [42, 43]. [score:6]
However, the miR-107 inhibitor not only reversed the chemotherapeutic drug -induced degradation of ARNT, but inhibited tumor cell invasion. [score:5]
staining also demonstrated that the miR-107 inhibitor enhanced the expression of ARNT-Myc 3′UTR (Figure 8C). [score:5]
Values are indicated as the mean ± s. e. m. (E) Cells expressing the miR-107 inhibitor and miR-107 were selected with puromycin. [score:5]
The expression level of ARNT-Myc 3′UTR was recovered when the miR-107 -targeted sequence was mutated (ARNT-Myc 3′UTR mut). [score:5]
In contrast, miR-107 inhibitor -expressing cells lost their capacity for invasion (Figure 8E). [score:5]
As shown in Figure 8A, the expression of miR-107 was elevated when cells were transfected with the miR-107 -expressing vector. [score:5]
These results indicate that the elevated miR-107 levels found in late-stage cancer and with chemotherapeutic treatment could down-regulate ARNT levels and therefore promote tumor metastasis. [score:4]
These results indicated that ARNT was a target of miR-107. [score:3]
Interestingly, chemotherapeutic drug-promoted ARNT degradation was reversed by the miR-107 inhibitor (Figures 7E and 8F). [score:3]
As shown in Figure 8E, miR-107 -expressing cells had higher invasive properties, as did shARNT cells. [score:3]
miR-107 targets ARNT to promote cancer cell invasion. [score:3]
The expression of miR-107 was examined by Q-PCR (GeneCopoeia, Inc. [score:3]
The construct of miR-107 inhibitor was purchased from GeneCopoeia, Inc. [score:3]
Figure 8 (A) A miR-107 expression construct was transfected into cells. [score:3]
Therefore, we studied whether the expression of ARNT was controlled by miR-107, resulting in enhancement of tumor cell metastasis. [score:3]
These results suggest that the degradation of ARNT in cells treated with chemotherapeutic drugs may be regulated by miR-107. [score:2]
Consistent with our finding that ARNT was decreased in late-stage colorectal cancer, miR-107 is elevated in highly metastatic colorectal cancer tissue [44]. [score:1]
DNA fragment of miR-107 was generated by PCR from genomic DNA and subcloned into pEZX-AM02. [score:1]
[1 to 20 of 24 sentences]
9
[+] score: 102
In contrast, while NEAT1 knockdown decreased CDK6 expression (compared lane 7 to lane 2, Fig.   8f), downregulation of miR-107 (by lentivirus transduction of Anti-miR-107) could restore CDK6 expression inhibited by NEAT1 knockdown (compared lane 7 to lane 1, Fig.   8f). [score:10]
Furthermore, we demonstrated that NEAT1 upregulated cyclin -dependent kinase 6 (CDK6) through inhibiting the expression of miR-107. [score:8]
Targetscan predicted that CDK6 may be a target of miR-107 and Starbase database suggested the target sites between NEAT1 and miR-107. [score:7]
In Hep-2 cells with high expression of NEAT1, overexpression of miR-107 led to significant reduction of CDK6 expression (Compared lane 2 to lane 5, Fig.   8f). [score:6]
a TargetScan database predicated CDK6 as a target of miR-107. [score:5]
GAPDH was loading control To further confirm NEAT1 can regulate CDK6 expression which is mediated by miR-107, we performed rescue experiments. [score:4]
cn), we found that CDK6 is a potential target of miR-107 while NEAT1 may acts as a regulator of miR-107 (Fig.   8a and c). [score:4]
NEAT1 regulates CDK6 expression through modulating miR-107. [score:4]
The lentiviruses for the overexpression and knockdown of miR-107 were provided by Genechem (Shanghai, China). [score:4]
Furthermore, NEAT1 regulated CDK6 expression in LSCC cells which was mediated by miR-107. [score:4]
GAPDH was loading controlTo further confirm NEAT1 can regulate CDK6 expression which is mediated by miR-107, we performed rescue experiments. [score:4]
These results indicate that miR-107 directly modulate CDK6 expression by binding miR-107 seed complementary site located in 3′UTR of CDK6. [score:4]
Through luciferase reporter assay, we found that CDK6 is a direct target gene of miR-107. [score:3]
f showed that CDK6 protein level decreased after NEAT1 knockdown in Hep-2 cells, but was restored after the knockdown of miR-107. [score:3]
miR-107 belongs to the miR-103/107 family and functions as a tumor suppressor in multiple cancers including head and neck squamous cell carcinoma [26]. [score:3]
We speculated that there is a regulatory loop among CDK6, miR-107 and NEAT1 in LSCC cells. [score:2]
These results are consistent with our predication and suggest that NEAT1 can regulate CDK6 through miR-107. [score:2]
Furthermore, RT-PCR and showed that knockdown of NEAT1 in LSCC cells led to increased level of miR-107 and decreased level of CDK6 protein (Fig.   8d and e). [score:2]
Fig. 8NEAT1 regulates CDK6 through modulating miR-107. [score:2]
3′UTR of CDK6 gene with three mismatch mutations in miR-107 seed complementary site was inserted downstream of f-luc in pGL3 plasmid and named as 3′UTR-MU. [score:2]
These results provide the evidence that NEAT1-miR-107-CDK6 regulatory network promotes LSCC. [score:2]
Luciferase reporter assay showed that overexpression of miR-107 led to a marked decrease of luciferase activity of 3′UTR but could not decrease the luciferase activity of 3′UTR-NC and 3′UTR-MU (Fig.   8b). [score:2]
To confirm the direct interaction between miR-107 and its binding site within 3′UTR of CDK6, we created 3′UTR reporter plasmid and generated 3′UTR-NC and 3′UTR-MU plasmids as negative controls. [score:2]
The molecular mechanism of NEAT1 function in LSCC is associated with the regulation of miR-107/CDK6 pathway. [score:2]
Thus, we speculated that NEAT1 can regulate CDK6 thorough miR-107 network in LSCC. [score:2]
d Real-time PCR showed that miR-107 level significantly increased after NEAT1 knockdown in Hep-2 cells. [score:2]
Laryngeal squamous cell cancer Long noncoding RNA microRNA NEAT1 CDK6 miR-107 Laryngeal squamous cell carcinoma (LSCC) is one of the most common malignancies in the head and neck [1]. [score:1]
miR-NC indicated scramble miRNA used as the negative control for miR-107. [score:1]
b miR-107 decreased luciferase activity of 3′UTR but not that of 3′UTR-NC and 3′UTR-MU. [score:1]
3′UTR of CDK6 gene harboring miR-107 binding site was inserted downstream of firefly luciferase (f-luc) in pGL3 plasmid and named as 3′UTR. [score:1]
HEK293T cells were cultured in 96-well plates and co -transfected with 400 ng of either 3′UTR, 3′UTR-NC or 3′UTR-MU, 50 ng of pRL-TK (Promega, USA) and 50 nmol/L of miR-107 or scramble miRNA negative control (miR-NC). [score:1]
Furthermore, we showed that NEAT1 siRNA increased miR-107 level and decreased CDK6 protein level. [score:1]
3′UTR of CDK6 gene with the deletion of miR-107 binding site was inserted downstream of f-luc in pGL3 plasmid and named as 3′UTR-NC. [score:1]
[1 to 20 of 33 sentences]
10
[+] score: 100
miRNA target predictions were downloaded from TargetScan Human Release 5.2, with predicted target genes for miR-181b and miR-107 categorised by cross-species conservation and seed-region composition before being correlated against the observed gene expression changes subsequent to miRNA modulation. [score:9]
There was also a significant difference (p=0.0002) in the accuracy of the algorithm to predict the observed changes in gene expression for miR-107 over -expression, inhibition, and bidirectional conditions. [score:8]
In view of these and other possible influences of miRNA on the transcriptome, we established a genome-wide survey of miRNA -associated target-transcript abundance to determine the genomic response to bidirectional modulation of miR-181b and miR-107, both of which have previously been reported to be upregulated in schizophrenia [27, 28]. [score:7]
Panel B shows the modulation of miR-107 expression levels in HEK-293 and HeLa cell types, indicative of miR-107 over -expression and inhibition. [score:7]
The FNR was lowest with bidirectional modulation, followed by miRNA inhibition (p=0.0042), with miR-107 over -expression providing the highest FNR (p=0.0009). [score:6]
The intersection of bidirectionally-modulated genes identifies genes modulated by both miR-107 over -expression and inhibition in each cell type. [score:6]
The variation observed for the 7mer-1A and 7mer-m8 seed regions between miR-181b and miR-107 supports the notion that determinants for target recognition exist outside of the seed region [62], while also highlighting the increased false -positive rate associated with non-conserved target predictions. [score:5]
The sensitivity of the E2F1 3 [′]-UTR to intracellular 181b, miR-107, and miR-20a levels was determined by luciferase reporter gene expression in the presence of either synthetic miRNA or corresponding anti-miR inhibitor. [score:5]
These both produced more conventional inversely proportional relationships with the miR-107 inhibition elevating reporter expression 37% (p<0.0001). [score:5]
To further explore the role of miRNA in this context, we performed a genome-wide expression analysis to investigate the molecular consequences of bidirectional modulation of the disease -associated miRNAs miR-181b and miR-107 in multiple human cell lines. [score:4]
Bidirectional modulation of miR-107 expression. [score:4]
As with miR-181b, the only parameter not to show significant correlation between canonical and non-canonical miR-107 function is for Targetscan’s conserved parameter, in which the FPR and FNR were not significantly correlated, despite no significant difference between these features by t-test (FPR: p=0.7441; FNR: p=0.7222). [score:3]
Genome-wide analysis of miR-107 associated gene expression. [score:3]
Panel A shows enriched KEGG pathways from predicted miR-107 target genes. [score:3]
Panel D illustrates enriched KEGG pathways from modulated mRNA subsequent to miR-107 inhibition in HEK-293 and HeLa cell mo dels. [score:3]
To confirm that this response was not a reporter gene artefact, other E2F1 targeting miRNA miR-107 and miR-20a were also transfected and analysed. [score:3]
Panel C illustrates enriched KEGG pathways from modulated mRNA subsequent to miR-107 over -expression in HEK-293 and HeLa cell mo dels. [score:3]
These observations were also replicated for miR-107 expression profiling, all displaying highly significant correlation between observed canonical and non-canonical responses. [score:3]
With miR-107 also possessing the capacity to regulate E2F1 expression, the proportion of observed changes that can be attributed to primary and secondary miR-107 function were also investigated, explaining 87% of bidirectionally modulated genes in both cell types (Figure 9C1; Additional file 4: Figure S3). [score:3]
Overall, the gene expression analysis of canonical miR-107 function demonstrated great consistency with miR-181b in respect to prediction-response evaluation using a Targetscan framework (Figure 9B1). [score:3]
Panel A shows the proportion of modulated genes that can be attributed to predicted miR-181b and E2F1 function across individual and multiple cell mo dels; whilst Panel B shows this for miR-107 predicted function. [score:1]
Panel B illustrates predicted binding sites for schizophrenia -associated miR-181b, miR-107, and miR-20a in the 3′-UTR of E2F1, as well as the AU-rich element in this 3′-UTR. [score:1]
Figure legend as per Figure 8 except in respect to miR-107. [score:1]
This comparative analysis was also applied to the miR-107 dataset to identify genes modulated across both the HEK-293 and HeLa cell types (Figure 9D), with canonical function showing an enrichment in pathways including tight junction, arrhythmogenic right ventricular cardiomyopathy, pathways in cancer, MAPK signalling, and haematopoietic cell lineage; whilst non-canonical function revealed enrichment in pathways including neuroactive ligand receptor interaction, hypertrophic cardiomyopathy, MAPK signalling, T cell receptor signalling, pathways in cancer, axon guidance, and the mTOR signalling pathway. [score:1]
Figure 9 Comparison of canonical (left) and non-canonical (right) miR-107 function. [score:1]
Further evidence of this phenomenon in miR-107 datasets suggests this behaviour extends beyond let-7-miR-181b feedback. [score:1]
All remaining parameters for analysis demonstrated highly significant correlation between canonical and non-canonical miR-107 function (Table 3). [score:1]
[1 to 20 of 27 sentences]
11
[+] score: 85
Other miRNAs from this paper: hsa-mir-195, hsa-mir-196b
Over -expression of miR-107 has been also demonstrated to inhibit glioma cell growth increasing apoptosis [28] and to inhibit cell migration/invasion [26, 27]. [score:7]
b- c Western-blot analysis of EGFR and N-cadherin proteins expression levels in U87MG cells upon miR-107 over -expression with miR-107 mimic (miR-107) (b) or depletion with miR-107 inhibitor (inh miR-107) (c). [score:7]
The inhibitory effect on cell migration was also verifiable in the levels of EGFR and N-Cadherin proteins that were strongly reduced by miR-107 over -expressing cells (Fig.   6b) or by BRV and LCM treatments (Fig.   2c). [score:5]
Brivaracetam and lacosamide treatments induce miR-107 and miR-195-5p expression in glioma cells by determining epigenetic modification on their regulatory regions. [score:4]
Altogether these findings indicated a BRV- and LCM -mediated chromatin remo deling effect on miR-107 and miR-195 genes, in particular a reduction in the methylation status, determining miRNAs expression. [score:3]
Fig. 6 Brivaracetam and lacosamide treatments inhibit glioma cells migration in part trough miR-107. [score:3]
On the other hand, miR-107 overexpression didn’t determine any change (Additional file 7: Figure S7a-b). [score:3]
The meaning of the decreased expression of N-cadherin and EGFR following miR-107 overexpression deserves further investigation. [score:3]
d- e- f qRT-PCR validation of miR-107 and miR-195-5p in U87MG, SW1783 and T98G upon IC20 LCM or BRV treatments at the indicated time points By performing pathway analysis of the putative target of both miRNAs signatures, we observed an almost complete overlapping between BRV and LCM treatments, possibly indicating a similar mechanism of action of the two AEDs (Table  1). [score:3]
In U87 cells the decrease in N-cadherin protein levels correlates with a reduced migratory ability of the cells upon ectopic expression of miR-107 as upon treatment with BRV or LCM. [score:3]
The exposure of glioma cells to brivaracetam and lacosamide resulted in the modulation of several microRNAs; particularly, the effect of miR-195-5p modulation seemed to affect cell cycle, while miR-107 seemed to be implicated in the inhibition of cells migration. [score:3]
Although at a minor extent, the increase in miR-195-5p expression was detected also in SW1783 and in T98G cell line upon treatments with both drugs, while in the latter cell line miR-107 was not inducible by LCM (Fig.   3e-f). [score:3]
To confirm these results, we analysed the expression levels of miR-107 and miR-195-5p by qRT-PCR (Fig.   3d). [score:3]
For mature miR-195-5p or miR-107 expression, we used Pre-miRNA Precursor-Negative Control (Ambion) and Pre-miRNA195-5p (Ambion) or Pre-miRNA107 at final concentration of 5nM. [score:3]
d- e- f qRT-PCR validation of miR-107 and miR-195-5p in U87MG, SW1783 and T98G upon IC20 LCM or BRV treatments at the indicated time points By performing pathway analysis of the putative target of both miRNAs signatures, we observed an almost complete overlapping between BRV and LCM treatments, possibly indicating a similar mechanism of action of the two AEDs (Table  1). [score:3]
Moreover, miR-107 depletion prevented BRV- and LCM -mediated inhibition of cell migration (Fig.   6e and Additional file 8: Figure S8b). [score:3]
For miR-195-5p and miR-107 depletion we used miRCURY LNA microRNA inhibitor control (Exiqon) and hsa-miR-195-5p miRCURY LNA (Exiqon) or hsa-miR-107 miRCURY LNA (Exiqon) at final concentration of 10nM. [score:3]
d Transwell migration assay in U87MG cells upon miR-107 depletion with miR-107 inhibitor (inh miR-107) Epilepsy is a frequent complication in patients with brain tumors, therefore AED are wi dely used for seizure control in addition to surgery, chemotherapy and radiotherapy. [score:2]
On the other hand, our data confirm that overexpression of miR-107 reduces the ability of glioma cells to migrate in an in vitro assay. [score:2]
Fig. 4 Brivaracetam and lacosamide treatments induce epigenetic modification on miR-107 and miR-195 regulatory regions. [score:2]
d- e ChIP analysis of acetylated histone H4 and methylated histone H3 occupancy on miR-107 regulatory regions in U87MG cells upon treatment with BRV or LCM at IC20. [score:2]
d Transwell migration assay in U87MG cells upon miR-107 depletion with miR-107 inhibitor (inh miR-107) In our experimental conditions, BRV and LCM displayed a dose -dependent cytotoxic effect in all glioma cell lines tested (Fig.   1) while no cytotoxic effect was detected in normal human fibroblasts (Additional file 1: Figure S1). [score:2]
a Transwell migration assay in U87MG cells upon miR-107 exogenous expression (* =  pval < 0.05). [score:2]
As shown in Fig.   4a-b, both two AEDs increase pre-miRNAs levels, suggesting a transcriptional regulation of miR-107 and miR-195-5p. [score:2]
To test if the cytotoxic effect of BRV and LCM was in part mediated by the induction of miR-195-5p or miR-107, we ectopically expressed miR-195-5p or miR-107 in U87MG and we evaluated cell proliferation rate. [score:1]
c Supervised statistical test of the significance level of the difference between signal distributions of miR-107 and miR-195-5p in U87MG cells treated with LCM or BRV versus the control (untreated cells). [score:1]
To evaluate if BRV- and LCM -mediated modulation of miR-107 and miR-195-5p expression occurred at the transcriptional level, we analysed the levels of their precursors (pre-miRNAs) upon BRV and LCM treatments in U87MG cells. [score:1]
Cells were transfected with Pre-miRNA Precursor-Negative Control or the Pre-miRNA107, or the Pre-miRNA195-5p (Ambion), or treated with BRV or LCM at IC20. [score:1]
On the contrary, miR-107 depletion improve migratory ability of U87MG cells as indicated by the increase of EGFR and N-cadherin protein levels (Fig.   6c). [score:1]
b) qRT-PCR of miR-107 in U87MG cells depleted for miR-107 (inh miR-107) and treated with BRV or LCM (IC20). [score:1]
MiR-107 significantly impinged on cell migration, while miR-195-5p had no effect (Fig.   6a and Additional file 8: Figure S8a). [score:1]
a- b qRT-PCR of miR-107 a and miR-195-5p b precursors (pre-miRNAs) in U87MG cells upon IC20 LCM or BRV treatments. [score:1]
In particular, for miR-107, which is localized in the third intron of PANK1 gene, by analysing two regions of PANK1 promoter, we didn’t observed a significant modification in the acetylation status of histone H4, that resulted highly acetylated in the control cells (untreated cells), while we observed a reduction in the methylation status of histone H3 in (Fig.   4c-e). [score:1]
[1 to 20 of 33 sentences]
12
[+] score: 69
Ssc-miR-103 and ssc-miR-107 expression was slightly lower in premolars (Dpm) than in other types of teeth, ssc-miR-133a and ssc-miR-133b expression was much higher in Dpm than in other types of teeth, and ssc-miR-127 expression gradually increased from the incisor (Di) to the molar (Dm) In order to detect the oral developmental specificity of the five selected miRNAs, we further extracted kidney, liver and submandibular gland to contrast the five miRNAs expression (Fig.   5). [score:10]
Ssc-miR-103 and ssc-miR-107 expression was slightly lower in premolars (Dpm) than in other types of teeth, ssc-miR-133a and ssc-miR-133b expression was much higher in Dpm than in other types of teeth, and ssc-miR-127 expression gradually increased from the incisor (Di) to the molar (Dm)In order to detect the oral developmental specificity of the five selected miRNAs, we further extracted kidney, liver and submandibular gland to contrast the five miRNAs expression (Fig.   5). [score:10]
We also found that expression levels of ssc-miR-103 and ssc-miR-107 were slightly lower in Dpm than in other types of teeth, ssc-miR-133 a and ssc-miR-133b expression levels were much higher in Dpm than in other types of teeth, and ssc-miR-127 expression increased in Di, Dc, Dpm, and Dm, in that order. [score:7]
In our study, they were also broadly expressed in all types of teeth at nearly every stage, but the complete lack of expression of ssc-miR-103 and ssc-miR-107 in Dpm during E40 and E50 is worthy of attention, as this could indicate that they exist in bidirectional antagonism with ssc-miR-133a and ssc-miR-133b during premolar morphogenesis in large animal species. [score:6]
We could found that the expression levels of ssc-miR-103 were strongly lower in kidney, liver and submandibular gland, while the expression levels of ssc-miR-107 were strongly lower in kidney and liver but somehow relatively high in submandibular gland. [score:5]
The present study indicated that these five miRNAs, including ssc-miR-103 and ssc-miR-107, ssc-miR-133a and ssc-miR-133b, and ssc-miR-127, may play key regulatory roles in different types of teeth during different stages and thus may play critical roles in tooth morphogenesis during early development in miniature pigs. [score:3]
We then predicted that the miR-103, and miR-107, miR-133a, and miR-133b isomiRs would be differentially expressed miRNAs. [score:3]
Expression levels of five miRNAs (ssc-miR-103, ssc-miR-107, ssc-miR-127, ssc-miR-133a, and ssc-miR-133b) were detected by real-time RT-PCR and microarray chip. [score:3]
At E50, localization of miR-107 in all four types of teeth stayed the same, but the expression level was more restricted in the inner enamel epithelium in the incisor, canine, and molar (B1–B4). [score:3]
Ssc-mir-107 expression was similar to that of ssc-miR-103 (Additional file 6A1–C4). [score:3]
In combination with our other results, this implies that ssc-miR-127, ssc-miR-103, and ssc-miR-107 may play a regulatory role in the morphogenesis of all kinds of teeth during different developmental stages. [score:3]
All the expression levels of five miRNAs were fairly high in tooth except ssc-miR-107, and relatively high in submandibular gland except ssc-miR-103, and lower in kidney and liver. [score:3]
At E60, mir-107 expression in the premolar increased significantly; in the premolar as in the other three types of teeth, the location was restricted in the inner enamel epithelium (C1–C4). [score:3]
Microarray, real-time RT-PCR, and in situ hybridization experiments revealed that ssc-miR-103 and ssc-miR-107, ssc-miR-133a and ssc-miR-133b, and ssc-miR-127 may play more important roles in Di and Dc, Dpm, and Dm, respectively, during different developmental stages. [score:2]
Previous studies have demonstrated that miR-103 and miR-107 may regulate human metabolic pathways that involve cellular acetyl-CoA and lipid levels [20]. [score:2]
These results suggest that ssc-miR-103 and ssc-miR-107 may play important roles in the early morphogenesis of conoides teeth and in crosstalk between epithelial and mesenchymal tissue. [score:1]
For ssc-miR-103 and ssc-miR-107, we chose the first deciduous incisor to contrast with the three kinds of tissues. [score:1]
By clustering analysis, we predicted 11 unique miRNA sequences that belong to mir-103 and mir-107, mir-133a and mir-133b, and mir-127 isomiR families. [score:1]
[1 to 20 of 18 sentences]
13
[+] score: 52
ESC obviously upregulated hsa-miR-107 and hsa-miR-638 expression, but only target genes of hsa-miR-107, MCL1, SALL4 and Bcl2, were changed greatly. [score:8]
In this study, we found ESC could upregulate the expression hsa-miR-107 in both MHCC97H and HepG2 cells. [score:6]
ESC could significantly downregulate SALL4, McL-1 and Bcl-2 genes that has-miR-107 targeted in MHCC-97H cells. [score:6]
Hsa-miR-107 activated ATR/Chk1 pathway, suppressed cervical cancer invasion and inhibited the tumorigenicity of head and neck squamous cell carcinoma [14, 15]. [score:5]
Expressions of hsa-miR-107 and hsa-miR-638 increased obviously in HCC cells treated by ESC. [score:3]
Hsa-miR-107, which functionally overlaps with miR-15, miR-16, and miR-195 due to a common 5′ sequence critical for target specificity [13]. [score:3]
Interestingly, only target genes of hsa-miR-107 changed greatly. [score:3]
Interestingly, only target genes of hsa-miR-107 were changed greatly. [score:3]
From the references and databases of bioinformatics, we have known that MCL1, CACNA2D1, SALL4 and Bcl2 were target genes of hsa-miR-107. [score:3]
Real-time PCR results showed that hsa-miR-107, hsa-miR-638 expressions were obviously different in MHCC97H cells and the difference of hsa-miR-107 in the HepG2 cells was obviously observed (Fig.   4b). [score:3]
Expressions of hsa-miR-107, hsa-miR-638 in HCC cells treated by ESC were significantly increased. [score:3]
hsa-miR-107 is also confirmed to be involved in the progression of HCC [12, 16]. [score:1]
According to the professional knowledge and literature (Table  2), 3 differential miRNAs (hsa-miR-107, hsa-miR-638, hsa-miR-106b-5p) that related to cancers were singled out for real-time PCR validation. [score:1]
There were opposite arguments in roles of hsa-miR-107 on cancers. [score:1]
hsa-miR-107, hsa-miR-638, hsa-miR-106b-5p were selected to be validated with real-time PCR method in HepG2 and MHCC97H cells. [score:1]
Among of them, 12miRNAs (hsa-miR-139-5p, hsa-miR-638, hsa-miR-107, hsa-miR-331-3p, hsa-miR-21-3p, hsa-miR-134-5p, hsa-miR-16-1-3p, hsa-miR-339-5p, hsa-miR-106b-5p, hsa-miR-423-3p, hsa-miR-491-3p, hsa-miR-24-3p) were related to cancers. [score:1]
According to the references, we selected hsa-miR-107, hsa-miR-638, hsa-miR-106b-5p to be verified with real-time PCR in MHCC97H and HepG2 cells. [score:1]
[1 to 20 of 17 sentences]
14
[+] score: 52
Seven miRNAs showed significant differences in expression in samples from FMF patients compared to healthy controls: four miRNAs were upregulated (miR-144-3p, miR-21−5p, miR−4454, and miR-451a), and three were downregulated (miR-107, let−7d−5p, and miR-148b-3p). [score:8]
Seven were found to be significantly deregulated in the patients with FMF: compared to control samples, three were significantly downregulated (miR-107, let−7d−5p, and miR-148b-3p), and four were significantly upregulated (miR-144-3p, miR-21−5p, miR−4454 and miR-451a), all with P values of <0.01 (Table 2, Fig 1, and S1 Fig). [score:7]
In this study, we showed that miR-107 and miR-148 are downregulated in FMF patients, whereas miR-21 is upregulated, demonstrating an overall proinflammatory profile of the innate immune system of FMF patients, even in the quiescent phase. [score:7]
We found that miR-107, let−7d−5p, and miR-148b-3p were downregulated in patients with FMF, and miR-144-3p, miR-21−5p, miR−4454, and miR-451a were upregulated. [score:7]
[12] hsa-miR-107 Downregulated 0.47 0.003Downregulation by toll like receptor 4 in response to activation of murine macrophages with lipopolysaccharide. [score:7]
In FMF patient samples, three miRNAs were downregulated compared to healthy control samples (miR-107, let−7d−5p, and miR-148b-3p), and four miRNAs were upregulated (miR-144-3p, miR-21−5p, miR−4454 and miR-451a). [score:6]
Toll-like receptor-4 (TLR4) down-regulates microRNA-107, increasing macrophage adhesion via cyclin -dependent kinase 6. J Biol Chem. [score:4]
Of the total 49 immune miRNAs that appear in the database, three (miR-107, miR-21 and miR-148) were differentially expressed in our cohort. [score:3]
Interestingly, miR-107 and miR-148 were reported to serve as negative regulators of the innate immune system, whereas miR-21 plays a proinflammatory role. [score:2]
Moreover, miR-107, miR-21 and miR-148 were found in InnateDB, which integrates interaction and pathway information from several of the major publicly available databases and aims to capture an improved coverage of the innate immunity interactome. [score:1]
[1 to 20 of 10 sentences]
15
[+] score: 50
According to the result, we found that although the population -based effects and inherent differences inevitably emerged as the previous report [33], the tendency of the expression patterns was consistent with the NGS findings, as miR-107 and miR-223-3p showed the upregulated expression levels in cancerous penile tissues, while miR-1247-5p and miR-509-3p showed the downregulated expression levels in cancerous penile tissues, which again verified the smRNA-seq sequencing data (S6 Fig). [score:13]
From both techniques, miR-509-3p showed the largest fold-change of downregulated expression levels in cancerous penile tissues, and miR-107 possessed the largest fold-change of upregulated expression levels in cancerous penile tissues, which together indicated that the expression levels of miRNAs detected by smRNA-seq sequencing were reliable (S5 Fig). [score:13]
Among the deregulated miRNAs, the most abundantly downregulated and upregulated miRNAs were miR-320a and miR-107, respectively. [score:8]
Of the upregulated miRNAs, miR-107, miR-223-3p, miR-340-5p, miR-424-5p and miR-944 were the top 5 most abundantly expressed miRNAs in the penile cancer tissues, among which, miR-107 had an expression level in PeCa exceeding 30,000 reads count. [score:8]
Referring to the most abundantly and also significantly upregulated miRNA in penile cancer miR-107, it was consistently revealed the tumorigenic and metastatic potency to human colorectal cancer [57], pancreatic cancer [58] and gastric cancer [59]. [score:4]
Meanwhile, miR-107 was also the most significantly upregulated miRNA as the log [2](Cancer/Normal Ratio) was 3.83708. [score:4]
[1 to 20 of 6 sentences]
16
[+] score: 40
Previous study showed that miR-107 increased the tumourigenic and metastatic potential via inhibition of let-7 and upregulation of let-7 targets in human breast cancer cell line and in mice mo del [51]. [score:8]
Our result indicates that miR-107 is upregulated under 1 Gy dosage of radiation exposure and this increase in expression is associated with metabolic pathways and potentially involved in cancer development. [score:7]
Elevated expression of miR-107 has been correlated with PARP inhibitor sensitivity and reduced RAD51 expression in a subset of ovarian clear cell carcinomas [49]. [score:7]
The miRNAs hsa-mir-103 and hsa-mir-107 are upregulated in relation to insulin sensitivity in an obese mouse mo del. [score:4]
Previous study reported that hsa-miR-107 regulates the DNA damage response (DDR) and sensitizes tumor cells by repressing expression of RAD51 and corporation with miR-222 in olaparib, an experimental chemotherapeutic agent, thus impairing DSB repair by HR [49]. [score:4]
The miR-107 negatively regulates the miRNA let-7 via direct interaction in tumors and in cancer cell line. [score:3]
Our analysis demonstrated that miR-107 may cooperate with miR-185-5p to regulate the cell cycle via YWHAB. [score:2]
This result corresponds to a previous study, which showed that the miR-107 and miR-185, localized in frequently altered chromosomal regions in human lung cancers, may contribute to regulate cell cycle in human malignant tumors [52]. [score:2]
This suggested that these miRNAs represent potential biomarkers for type 2 diabetes (the miR-103 microRNA precursor is homologous to miR-107) [50]. [score:1]
From publicly available miRNA knowledge bases, we retrieved a list of genes that have been validated to interact with these miRNAs, namely, hsa-miR-185-5p, hsa-miR-107, hsa-miR-20b-5p, and hsa-miR-17-5p for the low radiation doses and hsa-miR-142, hsa-miR-223-3p, and hsa-miR-451a for the 5 Gy radiation exposure. [score:1]
Three genes, MME, YWHAB, and CRKL, were predicted to interact with miR-107. [score:1]
[1 to 20 of 11 sentences]
17
[+] score: 39
For example, the down-regulation of miR-30 family and miR-107 can up-regulated p53 expression in human cell lines (Li et al., 2010), and overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells (Le et al., 2009). [score:13]
Fourth, miR-26a, miR-24, miR-26b, miR-410, and miR-107 were down-regulated from infancy to children, up-regulated in young adulthood, and then showed expression diminishing with aging (Fig. 4D). [score:9]
Four (hsa-let-7a, miR-30e-5p, miR-410, and miR-107) of the six miRNAs of the class of aging-diminished expression were chosen for validation in meeting one of the following criteria: (i) the expression levels of the miRNAs were significantly correlated with aging after Bonferroni correction (hsa-let-7a, miR-410, and miR-107 as shown in Fig. S2); or (ii) the miRNAs were reported to have biological relevance with aging (hsa-let-7a, miR-30e-5p, and miR-107). [score:5]
One of the miRNAs, miR-107, was also found in a previous study (Noren Hooten et al., 2010) to be down-regulated in the peripheral blood of old people, and three of the miRNAs (hsa-let-7a, miR-30e-5p, and miR-107) have been implicated in human cancers (Moncini et al., 2011; Thornton & Gregory, 2012). [score:4]
When all of the adults were divided into young (≤ 35 years, n = 32) and middle-aged (> 35 years, n = 28) adults, six miRNAs (hsa-let-7a, miR-30e-5p, miR-107, miR-140, miR-376a, and miR-410) exhibited decreasing expression from young adulthood to middle-aged adulthood according to Benjamini and Hochberg (BH) false discovery rate correction (Table 3). [score:3]
Furthermore, except miR-107, the correlation coefficients with age for the other three miRNAs (hsa-let-7a, miR-30e-5p, and miR-410) ranged from −0.27 to −0.36 (P = 0.02 to 0.003) (Fig S3). [score:1]
Thus, reduced levels of both the miR-30 family and miR-107 in old adults seem to protect these individuals from malignant mesothelioma and neuroblastoma, whereas reduced levels of the let-7 family in old adults seem to promote tumor progression. [score:1]
All of the four miRNAs (hsa-let-7a, miR-30e-5p, miR-410, and miR-107) chosen for validation showed similar age-diminishing trend. [score:1]
These six miRNAs were then subjected to correlation analyses, and three (hsa-let-7a, miR-410, and miR-107) of them were significantly decreased with increasing age (r = −0.34 to −0.40, P < 0.0083, with Bonferroni correction) (Fig. S2). [score:1]
Furthermore, hsa-let-7a and miR-107 were negatively correlated with age (r = −0.40, P < 0.0083, with Bonferroni correction) after adjustment for gender. [score:1]
[1 to 20 of 10 sentences]
18
[+] score: 38
The pathway of PGRN or PGRN itself is influenced by several miRNA including miRNA-132, miRNA-659-3p, miRNA-107 and miRNA-9. The majority of miRNA with links to various diseases, as e. g., miRNA-132, have been found through profiling miRNA that are either up- or down-regulated after certain traumatic events (status epilepticus, traumatic brain injury) or in certain neurodegenerative disorders such as FTD and Alzheimer’s Disease (AD). [score:8]
Wang W. X. Rajeev B. W. Stromberg A. J. Ren N. Tang G. Huang Q. Rigoutsos I. Nelson P. T. The expression of microRNA miR-107 decreases early in Alzheimer’s disease and may accelerate disease progression through regulation of β-site amyloid precursor protein-cleaving enzyme 1 J. Neurosci. [score:8]
The reduced expression of miRNA-107 causes an up-regulation of PGRN in the affected cells (though this was not confirmed in Piscobo et al., 2016 [22]). [score:6]
Thus far miRNA-107 has mostly been studied in the two diseases above, and no direct link to SE or FTD has been found yet. [score:4]
Wang W. X. Wilfred B. R. Madathil S. K. Tang G. Hu Y. Dimayuga J. Stromberg A. J. Huang Q. Saatman K. E. Nelson P. T. miR-107 regulates granulin/progranulin with implications for traumatic brain injury and neurodegenerative disease Am. [score:4]
In AD as well as in the TBI mouse mo del there has been a marked decrease of miRNA-107, the cells of older individuals have shown a decreased expression of miRNA-107 as well [52]. [score:3]
GRN has been found in a high-throughput experimental miRNA assay to be the strongest target for miRNA-107 [50]. [score:2]
3.3. miRNA-107. [score:1]
Profiling miRNA in the human cerebral cortex has shown a far higher level of miRNA-107 than, e. g., miRNA-659-3p. [score:1]
Corresponding to the mechanism for miR-659-3p, the correlation between decreased levels of miRNA-107 and higher levels of PGRN in the affected cells indicates a neuroprotective mechanism. [score:1]
[1 to 20 of 10 sentences]
19
[+] score: 35
Table 1 MicroRNAs involved in regulating HIFs and HIF regulatory gene levels in ECs miRNA Cell type Impact of hypoxia on miRNA expression miRNA target (s) (direct or indirect*) Investigated processes miR-18a Choroidal endothelial cells Upregulated HIF1A Proliferation migration[116] miR-107 Endothelial progenitor cells—EPCs Upregulated ARNT Differentiation[121] miR-135b HUVECs Upregulated HIF1AN Angiogenesis[124] HIF1A* miR-155 Mouse skin endothelial SENDs cells and HUVECs Upregulated HIF1A Angiogenesis hypoxia[108] miR-199a Endometrial stromal cells; endothelial EA. [score:19]
In contrast, another study showed that miR-107 was upregulated in hypoxia in rat endothelial progenitor cells and prevents their differentiation via its target HIF-1β [121]. [score:6]
Furthermore, in human colon cancer specimens, expression of miR-107 was controlled via p53 and inversely associated with the expression of HIF-1β [120]. [score:5]
This report confirms a previous study of Yamakuchi and coworkers who showed in human colon cancer cells that miR-107 decreases hypoxia signaling by suppressing the expression of ARNT1 [120]. [score:5]
[1 to 20 of 4 sentences]
20
[+] score: 34
Eight miRNAs (miR-101, miR-107, miR-122, miR-29, miR-365, miR-375, miR-378, and miR-802), whose expression was found to be downregulated in c-Myc and/or AKT/Ras liver tumors, were selected and their tumor suppressor activity was assessed in c-Myc and AKT/Ras mice. [score:8]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
In summary, the present results indicate that miR-107, miR-122, miR-29, miR-365, and miR-802 possess weak to moderate tumor suppressive properties, as none of them is able to completely prevent oncogene driven liver tumor development in mice. [score:4]
Weak to moderate tumor suppressor potential of miR-107, miR-122, miR-29, miR-365, and miR-802 in c-Myc and AKT/Ras driven liver tumor development. [score:4]
On the other hand, miR-107 showed moderate suppressor activity against AKT/Ras induced hepatocarcinogenesis: indeed, none of AKT/Ras/miR-107 injected mice developed enlarged abdomen, and all mice were alive by eight weeks post injection. [score:3]
Overexpression of miR-107 slightly delayed c-Myc induced liver tumor formation (Supplementary Figure 4A and 4B). [score:3]
Among the 8 miRNAs, 4 miRNA (miR-101, miR-29, miR-107 and miR-122) had available human miRNA array data. [score:1]
Indeed, 2 out of 4 c-Myc/miR-107 mice developed high tumor burden by eight weeks post injection. [score:1]
[1 to 20 of 9 sentences]
21
[+] score: 23
The expression of microRNA miR-107 decreases early in Alzheimer’s disease and may accelerate disease progression through regulation of beta-site amyloid precursor protein-cleaving enzyme 1. J. Neurosci. [score:8]
miR-107 is enriched in neurons and recent studies indicate that numerous members of miR-15/107 family having the target sites in BACE1 gene including miR-15a, miR-15b, mR-16, miR-195, miR-103 as well as miR-107; all of these miRNAs are down-regulated in gray matter of AD patients (Wang et al., 2011). [score:6]
miR-107 is exceptional example of miRNA related to AD, because it has been shown that expression level of the miR-107 can change in brains of AD patients even in the earlier stages of disease (Wang et al., 2008). [score:5]
Moreover miR-107 has a target site in 3′-UTR of β-amyloid cleavage enzyme 1 (BACE1) mRNA which is the first enzyme in the amyloidogenic pathway of amyloid precursor protein (APP) processing. [score:3]
Recent studies indicate a possible role for miR-107 in AD pathology. [score:1]
[1 to 20 of 5 sentences]
22
[+] score: 21
Ectopic expression of miR-107 reduced both mRNA and protein expression levels of CDK6. [score:5]
The expression of miR-107 was found inversely correlated with CDK6 expression in GC cell lines. [score:5]
The authors argued that miR-107 could significantly suppress CDK6 3′-UTR luciferase reporter activity. [score:3]
DICER1 and PTEN genes have been identified as target genes for miR-107 and miR-222, respectively [113, 114]. [score:3]
Oncol 2011 in press 113 Li X. Zhang Y. Shi Y. Dong G. Liang J. Han Y. Wang X. Zhao Q. Ding J. Wu K. MicroRNA-107, an oncogene microRNA that regulates tumour invasion and metastasis by targeting DICER1 in gastric cancerJ. [score:3]
Deregulation of others miRNAs, such as miR-622, miR-107, miR-221, and miR-222, has been described in GC. [score:2]
[1 to 20 of 6 sentences]
23
[+] score: 21
The observed downregulation of miR-107 in HNOC is consistent with its previously suggested tumor suppresser function in lung carcinoma cells [68]. [score:6]
Also, all-trans-retinoic acid (ATRA) treatment lead to upregulated miR-107 in acute promyelocytic leukemia cells [98]. [score:4]
Also, downregulation of several microRNAs has been consistently observed in HNOC, including miR-26b, miR-138, miR-107, miR-139. [score:4]
Other interesting observations include that of downregulation of miR-107 is specifically associated with HNF1alpha in hepatocellular tumors [97]. [score:4]
However, significant overexpression of miR-107 (and its highly homologous miR-103) has been observed in pancreatic tumors [70]. [score:3]
[1 to 20 of 5 sentences]
24
[+] score: 20
NEAT1 increases CDK6 expression by down -regulating miR-107 expression [71]. [score:6]
e. The lncRNA PTCSC2 inhibits tumor cell cycle progression and promotes apoptosis; f. The lncRNA NEAT1 promotes cell cycle progression by inhibiting the miR-107/ CDK6 pathway. [score:5]
miR-107 represses CDK6 expression by targeting its 3′UTR. [score:5]
/ NEAT1 up LSCCPromotes tumor growth and cell cycle progression in LSCC by regulating the miR-107/CDK6 pathway [71]. [score:2]
NEAT1 promotes LSCC tumorigenesis by regulating the miR-107/cyclin -dependent kinase 6 (CDK6) pathway [71]. [score:2]
[1 to 20 of 5 sentences]
25
[+] score: 19
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
OsmoticUptake of hyperosmotic 2% saline water resulted in upregulation of expression of miR-7b, miR-9, miR-29b, miR-137, and miR-451 and downregulation of miR-409, miR-107, miR-103, miR-185, and miR-320 in hypothalamus in mice (Lee et al. 2006). [score:9]
Uptake of hyperosmotic 2% saline water resulted in upregulation of expression of miR-7b, miR-9, miR-29b, miR-137, and miR-451 and downregulation of miR-409, miR-107, miR-103, miR-185, and miR-320 in hypothalamus in mice (Lee et al. 2006). [score:9]
Soares et al. (2009) let-7a,b,c,f,i, miR-7b, miR-9-5p, miR-9-3p, miR-34b, miR-103, miR-107, miR-124a, miR-125a,b, miR-128, miR-129-3p, miR-132, miR-138, miR-181a,b, miR-216, miR-217, miR-219, and miR-375 Zebrafish Microarray, ISH ? [score:1]
[1 to 20 of 3 sentences]
26
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Feng L. Xie Y. Zhang H. Wu Y. miR-107 targets cyclin -dependent kinase 6 expression, induces cell cycle G1 arrest and inhibits invasion in gastric cancer cells Med. [score:7]
Moreover, GC patients with over -expression of miR-107 [28, 29, 30], miR-143 [40], miR-145 [41, 42], miR-181b/c [17, 47, 48, 55, 56], miR-196a/b [59], miR-20b [23, 66], miR-23a/b [77, 78, 79], miR-34 [17, 47, 48, 55, 56] and miR-630 [100] and decreased expression of miR-1 [111], miR-1207-5p [121], miR-125a-3p/-5p [24, 125, 126, 127], miR-185 [140], miR-193b [60], miR-20a [111], miR-206 [150, 151], miR-215 [142], miR-217 [153], miR-27a [111], miR-29c [169], miR-34a [172, 173], miR-423-5p [111], and miR-520d-3p [99] indicate advanced tumor stage or TNM stage. [score:5]
Inoue T. Iinuma H. Ogawa E. Inaba T. Fukushima R. Clinicopathological and prognostic significance of microRNA-107 and its relationship to DICER1 mRNA expression in gastric cancer Oncol. [score:3]
Li X. Zhang Y. Shi Y. Dong G. Liang J. Han Y. Wang X. Zhao Q. Ding J. Wu K. MicroRNA-107, an oncogene microRNA that regulates tumour invasion and metastasis by targeting DICER1 in gastric cancer J. Cell. [score:3]
[1 to 20 of 4 sentences]
27
[+] score: 18
The miR-15/107 family includes miR-15a-5p, miR-15b-5p, miR-16-5p, miR-103-3p, miR-107 (which are expressed in all vertebrates), miR-195-5p, miR-424-5p, miR-497-5p, miR-503-5p (which are expressed in mammals), and miR-646 (human specific) (Finnerty et al., 2010[53]). [score:5]
Although neither algorithm identified human endoglin mRNA MRE target sites for HITS-CLIP validated miRNAs (miR-20a-3p, miR-23b-5p, miR-29a-5p, miR-103-3p, miR-107, and miR-532-5p) (Table 7 (Tab. [score:3]
Again, it is not clear why the Diana-microT-CDS and TargetScan algorithms did not identify the miR-20a-3p, miR-23b-5p, miR-29a-5p, miR-103-3p, miR-107 and miR-532-5p MREs in human S-endoglin mRNA that were detected manually. [score:3]
7) (References in Table 7: let-7b-5p: Selbach et al., 2008[145]; miR-16-5p: Balakrishnan et al., 2014[14]; miR-20a-3p: Balakrishnan et al., 2014[14]; miR-23b-5p: Balakrishnan et al., 2014[14]; miR-29a-5p: Balakrishnan et al., 2014[14]; miR-103a-3p: Balakrishnan et al., 2014[14]; miR-107: Balakrishnan et al., 2014[14]; miR-532-5p: Haecker et al., 2012[63]; miR-628-5p: Balakrishnan et al., 2014[14]; miR-522-3p: Tan et al., 2014[153]) documents ten human experimentally supported miRNA/endoglin mRNA interactions, and the methodology utilized to substantiate the interaction, the tissue and/or cell line used for experimentation, the location of the MRE if known, the type of interaction (direct or indirect), and the literature reference. [score:3]
Finally, sequence analysis detected three identical miR-103-3p and miR-107 MREs harbored in the human S-endoglin mRNA which overlaped with the three Diana-microT-CDS algorithm predicted miR-16-5p MREs above (3′-UTR MRE [5′ GCUGCU 3′, 6mer “seed” region] 842 nts downstream from the stop codon and two CDS MREs [5′ UGCUGCU 3′, 7mer “seed” region] 34 and 473 nts downstream from the start codon). [score:1]
Again, it is important to note that the miR-15/107 family members, miR-16-5p, miR-103a-3p, and miR-107 were identified to interact with human endoglin mRNAs by the HITS-CLIP technique (Table 7 (Tab. [score:1]
Importantly this group of miRNAs shares a sequence (5′ AGCAGC 3′) near the 5′ end that complements with the Diana-microT-CDS algorithm predicted miR-16-5p MREs (5′ GCUGCU 3′) and the manually identified miR-103-3p and miR-107 MREs within the human S-endoglin mRNA. [score:1]
It is now clear that miR-16-5p, miR-103-3p, and miR-107 belong to a group of paralogous, evolutionarily-conserved miRNAs termed the miR-15/107 family (Finnerty et al., 2010[53]). [score:1]
[1 to 20 of 8 sentences]
28
[+] score: 16
Besides, miR-107 was found to be overexpressed in GH-secreting and nonfunctioning pituitary adenomas and inhibited the expression of pituitary tumor suppressor gene aryl hydrocarbon receptor-interacting protein (AIP) [20]. [score:9]
Specifically, five miRNAs (miR-26b, miR-26a, miR-212, miR-107, and miR-103) were upregulated and twelve miRNAs (miR-125b, miR-141, miR-144, miR-164, miR-145, miR-143, miR-15b, miR-16, miR-186, let-7b, let-7a3, and miR-128) were downregulated. [score:7]
[1 to 20 of 2 sentences]
29
[+] score: 16
Our study also identified miR-107 and miR-299-3p as being responsible for an up-regulation in the expression of human GP Ibα mRNA. [score:6]
Furthermore, by performing a literature review, we found that miR-10a, miR-10b and miR-107 were previously reported to be involved in the regulation of hematopoietic gene expression [15, 19], and miR-299-3p is predicted to target the 3′-UTRs of both human and mouse GP1BA gene. [score:6]
Therefore, we chose to assess four miRNAs (miR-10a, miR-10b, miR-107, and miR-299-3p) and investigate if they can target the 3′-UTR and regulate the expression of human GP Ibα (Figure 1A). [score:4]
[1 to 20 of 3 sentences]
30
[+] score: 16
The quantitative RT-PCR results showed that miR-409-3p was upregulated 2.04 times, miR-103a-3p was downregulated 1.85 times, miR-200b-3p was downregulated 2.22 times and miR-107 was downregulated 2.13 times in the oridonin treatment group compared with the control (Figure  2), which correlated well with the microarray results in Table  1. Figure 2 qPCR validation of a subset of miRNA microarray data. [score:12]
It has been reported that epigenetic silencing of miR-107 can regulate the expression of cyclin -dependent kinase 6 in pancreatic cancer [15]; while interfering miR-409-3p promotes tumour growth, the epithelial-to-mesenchymal transition (EMT) and bone metastasis [38]. [score:4]
[1 to 20 of 2 sentences]
31
[+] score: 16
In the aspect of drug resistance, Teng et al. reported that over -expression of Lin28 decreased the sensitivity to chemotherapy (e. g. Oxaliplatin, Paclitaxel, Doxorubicin and Fluorouracil) via inhibiting miR-107, as well as the RNA and protein expression of c-Myc and P-gp [60]. [score:7]
Figure 3 Lin28 can regulate multiple tumor -associated progressions without let-7, but with proliferation (CyclinA/B/D, CDK1/2/4/6, miR-125b), chemoresistance (pRb, p21, Bcl-xL, miR-107), metabolism (IGF2, Oxidative enzymes), inflammation (hnRNP A1), stemness (OCT4, miR-200), cell development (Hbl-1, Lin4/14, miR-48/84/241) related proteins and RNAs. [score:3]
Lin28 decreased chemosensitivity via inhibiting miRNA-107, let-7, Rb, p21 and Bcl-xL. [score:3]
Lin28 can regulate multiple tumor -associated progressions without let-7, but with proliferation (CyclinA/B/D, CDK1/2/4/6, miR-125b), chemoresistance (pRb, p21, Bcl-xL, miR-107), metabolism (IGF2, Oxidative enzymes), inflammation (hnRNP A1), stemness (OCT4, miR-200), cell development (Hbl-1, Lin4/14, miR-48/84/241) related proteins and RNAs. [score:3]
[1 to 20 of 4 sentences]
32
[+] score: 15
Western blotting results showed that overexpressing miR-9 and miR-137 significantly reduced CUL4A protein expression in HGC-27 cells; whereas, overexpressing miR-103 and miR-107 had no effect on CUL4A protein expression (Figure 5B). [score:9]
B. Western blotting results showed that the overexpression of miR-9 and miR-137 significantly reduced CUL4A protein levels in HGC-27, SGC-7901 and BGC-823 cells; whereas, miR-103 and miR-107 had no effect on CUL4A protein levels. [score:3]
Four miRNAs, including miR-103, miR-107, miR-9, and miR-137 (Figure 5A), were predicted using two independent miRNA databases: TargetScan (http://www. [score:3]
[1 to 20 of 3 sentences]
33
[+] score: 15
Relatively little is known about the functions in gene regulation of micro -RNAs (hsa-mir-214, hsa-mir-103, hsa-mir-107, & hsa-mir-98), although one member of this group, mir-214, has been implicated in cell survival in cancer [32] and another, mir-107, has been linked to Alzheimer’s disease pathogenesis [33]. [score:4]
Of the seven micro -RNAs selected for follow-up quantitative PCR analysis from the larger dataset generated from our microarray analyses (hsa-let-7b, hsa-mir-214, hsa-let-7c, hsa-let-7e, hsa-mir-103, hsa-mir-107, & hsa-mir-98), all but two of these micro -RNAs (hsa-let7b and hsa-let7c) showed significant up-regulation in fetal compared to adult sclera, irrespective of whether tissue samples were collected from the posterior pole or more peripherally. [score:3]
Figure 4 shows the results of comparisons of equivalent fetal and adult samples, expressed as relative fold differences for the selected micro -RNAs – hsa-let-7b, hsa-mir-214, hsa-let-7c, hsa-let-7e, hsa-mir-103, hsa-mir-107, and hsa-mir-98; microarray data are also shown for reference. [score:3]
Specifically, fetal sclera showed increased expression of mir-214, let-7c, let-7e, mir-103, mir-107, and mir-98 (1.5 to 4 fold changes, p<0.01). [score:3]
Subsequent validation experiments used TaqMan® micro -RNA assays on posterior and peripheral scleral samples from fetal and adult eyes (total of 4 groups; n=7 in each group) and targeted micro -RNAs showing collagen (Col1A1) specificity (i. e., hsa-let-7b, hsa-mir-214, hsa-let-7c, hsa-let-7e, hsa-mir-103, hsa-mir-107, and hsa-mir-98) and either highest significance, detection, or fold differences in comparisons of equivalent fetal and adult samples in microarray profiling. [score:2]
[1 to 20 of 5 sentences]
34
[+] score: 14
In addition, S-NSC cells infected with T. gondii PRU tachyzoites had more than a two-fold reduction in the expression of mir-29a and mir-107, found to be down-regulated in patients with AD 58– 61. mir-132, that is under-regulated in post-mortem Huntington’s disease patients and in a mouse mo del for this disease [62], showed a ~four-fold down-regulation in GT1 and PRU-infected S-NSC cells. [score:14]
[1 to 20 of 1 sentences]
35
[+] score: 14
The E2-regulated miR-30c has been reported to be a tumor suppressor in endometrial cancer [34], miR-107 functions as a tumor-suppressor gene in head and neck squamous cell carcinoma and was shown to mediate p53 tumor-suppressor function in human colon cancer cells [35, 36], and miR-26a strongly inhibited estrogen-stimulated breast cancer cells and tumor growth [6, 37]. [score:10]
Yamakuchi M. Lotterman C. D. Bao C. Hruban R. H. Karim B. Men dell J. T. Huso D. Lowenstein C. J. P53 -induced microRNA-107 inhibits HIF-1 and tumor angiogenesisProc. [score:3]
Noticeably, several of the estrogen-repressed miRNAs (miR-26, miR-107, miR-126 and miR-145) were also reduced by the physiological estrogen levels of vitellogenic females [8]. [score:1]
[1 to 20 of 3 sentences]
36
[+] score: 13
The expression of microRNA miR-107 decreases early in Alzheimer's disease and may accelerate disease progression through regulation of beta-site amyloid precursor protein-cleaving enzyme 1. J. Neurosci. [score:8]
For instance, postmortem human tissue studies in well-characterized cohorts have shown decreased neocortical levels of miR-29a/b, miR-9, and miR-107 in AD compared to control subjects, which was associated with increased BACE1 mRNA expression and Aβ generation (Hébert et al., 2008; Wang et al., 2008; Che et al., 2014); in particular, miR-107 is downregulated very early in the disease process (Wang et al., 2008). [score:5]
[1 to 20 of 2 sentences]
37
[+] score: 13
miR-107 was shown to directly target RAD51 and RAD51D and expression level correlated with PARP inhibitor sensitivity [35, 70]. [score:8]
Overexpression of miR-103, miR-222, and miR-96, but not miR-107, decrease RAD51 expression and efficiency of HR repair [35, 36, 70]. [score:5]
[1 to 20 of 2 sentences]
38
[+] score: 13
118, 119 Besides regulating HIF1α, miR-107 was able to inhibit the expression of HIF1β, so downregulation of miR-107 promotes tumor angiogenesis under hypoxic conditions. [score:9]
[36] Further studies indicated that p53 performs its function through regulating the expression of a range of miRNAs, such as miR-605, [37] miR-1246, [38] and miR-107. [score:4]
[1 to 20 of 2 sentences]
39
[+] score: 13
Daimiel-Ruiz L. Klett-Mingo M. Konstantinidou V. Mico V. Aranda J. F. Garcia B. Martinez-Botas J. Davalos A. Fernandez-Hernando C. Ordovas J. M. Dietary lipids modulate the expression of miR-107, a miRNA that regulates the circadian system Mol. [score:4]
miR-107 oscillates in a circadian manner and miR-107 overexpression altered the circadian rhythm of these cells. [score:3]
Our group demonstrated that miR-107 targets CLOCK in Caco-2 cells, a cellular mo del of human enterocytes. [score:3]
Moreover, we demonstrated that miR-107 is modulated by dietary lipids both in vitro and in vivo. [score:1]
miR-107 has long been recognized for its association with insulin sensitivity [109, 147]. [score:1]
Thus, miR-107 is a circadian microRNA that modulates the circadian system. [score:1]
[1 to 20 of 6 sentences]
40
[+] score: 13
Of the 186 miRNAs the expression of which was altered, nine were up-regulated at both time points (miR-125a-3p, miR-297c, miR-421, miR-452, miR-483, miR-574-3p, miR-574-5p, miR-669a, miR-720) and 11 were down-regulated at both time points (let-7g, miR-107, miR-10a, miR-15a, miR-15b, miR-199b*, miR-26a, miR-29c, miR-324-5p, miR-331-3p, miR-342-3p). [score:9]
miR-125a-3p and miR-107 are also involved in cell cycle and it is known that their expression is regulated by PPARA [23]. [score:4]
[1 to 20 of 2 sentences]
41
[+] score: 13
miR-107, miR-153 and miR-142-3p indirectly reduce p21 expression through targeting the upstream regulators, FOXO1, PTEN and FOXO4, respectively [50– 52]. [score:7]
For example, miR-107, miR-153, and miR-142-3p had been shown to reduce p21 expression through targeting the upstream regulators, FOXO1, PTEN and FOXO4, respectively [50– 52]. [score:6]
[1 to 20 of 2 sentences]
42
[+] score: 13
miR-107 targets cyclin -dependent kinase 6 expression, induces cell cycle G1 arrest and inhibits invasion in gastric cancer cells. [score:7]
So, there are miRNA profiles that promote tumor growth including hsa-miR-622, hsa-miR-650, hsa-miR-223, hsa-miR-21, and hsa-miR-181a, among others (Zhang et al., 2010, 2012a, b; Guo et al., 2011; Li et al., 2011b); while hsa-miR-107, -145, -495, -551a, let-7f, -218, and -610, among others, inhibit cell invasion and metastasis (Tie et al., 2010; Li et al., 2011a, 2012b; Liang et al., 2011; Feng et al., 2012; Gao et al., 2012; Wang et al., 2012). [score:3]
MicroRNA-107, an oncogene that regulates tumour invasion and metastasis by targeting DICER1 in gastric cancer. [score:3]
[1 to 20 of 3 sentences]
43
[+] score: 13
Zhong et, al reported that circTCF25 binded to miR-103a-3p/miR-107 and potentially contributed to the up-regulation of thirteen targets about cell proliferation, migration and invasion. [score:6]
Subsequently, the phenomena that down -regulating miR-103a-3p and miR-107, increasing CDK6 expression, and promoting proliferation and migration were observed by over -expression of circTCF25. [score:6]
All of these suggested that circTCF25 could be involved in pathway of bladder carcinoma via circTCF25-miR-103a-3p/miR-107-CDK6 axis and be a new potential marker for this cancer [50]. [score:1]
[1 to 20 of 3 sentences]
44
[+] score: 12
The targets of 3 miRNAs associated with mitochondria (let-7b: STAT3; hsa-miR-107: MFN2; hsa-miR-320a: XIAP) were determined by Starbase and validated by qPCR. [score:3]
We analyzed the targets of 3 miRNAs (let-7b: STAT3; hsa-miR-107: MFN2; hsa-miR-320a: XIAP) by StarBase using intersection of 3 computational tools as described in materials and methods and checked their association with mitochondria. [score:3]
The levels of target mRNAs (STAT3, MFN2 and XIAP) of selected miRNAs (let-7b, hsa-miR-107, hsa-miR-320a) were significantly associated with mitochondria whereas the levels decreased significantly in mitoplast (Figure 7D). [score:3]
The most abundant miRNAs associated with mitochondria of HEK293 and HeLa were hsa-miR-423-5p, hsa-miR-320a and let-7 family members (let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, let-7h and let-7i) followed by hsa-miR-103b, hsa-miR-140-3p, hsa-miR-744, hsa-miR-107 (Figure 4C, Figure 4D, Table S3). [score:1]
The levels of following miRNAs were determined from 10 ng cDNA using U6 snRNA (Accession number: X59362) and 5 S rRNA (NCBI Accession no: V00589) as endogenous control using miRCURY LNA™ Universal RT microRNA PCR, SYBR Green master mix (Exiqon, Denmark): hsa-let-7b (UGAGGUAGUAGGUUGUGUGGUU); hsa-let-7g (UGAGGUAGUAGUUUGUACAGUU); hsa-miR-107 (AGCAGCAUUGUACAGGGCUAUCA); hsa-miR-181a (AACAUUCAACGCUGUCGGUGAGU); hsa-miR-221 (AGCUACAUUGUCUGCUGGGUUUC); hsa-miR-320a (AAAAGCUGGGUUGAGAGGGCGA); hsa-miR-145 (GUCCAGUUUUCCCAGGAAUCCCU). [score:1]
The levels of following miRNAs were determined from 10 ng cDNA using U6 snRNA (Accession number: X59362) and 5 S rRNA (NCBI Accession no: V00589) as endogenous control using miRCURY LNA™ Universal RT microRNA PCR, SYBR Green master mix (Exiqon, Denmark): hsa-let-7b (UGAGGUAGUAGGUUGUGUGGUU); hsa-let-7g (UGAGGUAGUAGUUUGUACAGUU); hsa-miR-107 (AGCAGCAUUGUACAGGGCUAUCA); hsa-miR-181a (AACAUUCAACGCUGUCGGUGAGU); hsa-miR-221 (AGCUACAUUGUCUGCUGGGUUUC); hsa-miR-320a (AAAAGCUGGGUUGAGAGGGCGA); hsa-miR-145 (GUCCAGUUUUCCCAGGAAUCCCU). [score:1]
[1 to 20 of 6 sentences]
45
[+] score: 12
They found upregulation of miR-107 targeted nuclear factor 1-A, a gene involving miR-223 and C/EBPa in a regulatory loop during granulocytic differentiation. [score:7]
Besides, Roldo et al. showed that the expression of miR-103 and miR-107, associating with a lack of miR-155 expression, could discriminate pancreatic tumors from normal pancreas. [score:5]
[1 to 20 of 2 sentences]
46
[+] score: 12
There are also reports linking non-coding RNAs with neurological disorders such as Parkinson's disease (miR-133b) [17], Huntington's disease (miR-132, miR-9) [18], [19], Alzheimer's disease (miR-29 and miR-107) [20], [21], and Tourette's syndrome (miR-189) [22]. [score:7]
We also detected expression of a number of miRNAs associated with neurological disorders, such as miR-29 and miR-107 associated with Alzheimer's disease [20], [21]. [score:5]
[1 to 20 of 2 sentences]
47
[+] score: 12
The expression of miR-107 is also decreased in the brains of transgenic mice overexpressing human APP carrying familial AD mutations [56]. [score:6]
The levels of miR-107 that targets BACE1 are reduced in the temporal cortex not only of AD but also of the patients affected with mild cognitive impairment (MCI), a prodrome of AD, indicating that downregulation of miR-107 begins at the very early stage of AD [55]. [score:6]
[1 to 20 of 2 sentences]
48
[+] score: 12
For instance, miR-103 and miR-107, having very similar mature sequence and expression levels (Figure 6c), are two known miRNAs that have the same roles in regulating insulin sensitivity and promoting metastasis of colorectal cancer [20], [21]; miR-34b and miR-34c, having very similar mature sequence and expression levels (Figure 6c), are targets of p53 and cooperate in control of cell proliferation and adhesion-independent growth [22]; let-7a/b/c were also claimed to reduces tumor growth in mouse mo dels of lung cancer [23] and miR-29a/b/c reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B [24] while these two miRNA clusters have very similar mature sequences and expression levels (Figure 6d). [score:12]
[1 to 20 of 1 sentences]
49
[+] score: 11
MiR-107 was shown to directly interact with mature let-7 to inhibit its function, leading to promoting tumor progression and metastasis [108] (Table  2). [score:4]
Moreover, miR-103/miR-107 up-regulated ZEB levels in a miR-200 -dependent manner [78]. [score:4]
In addition, let-7 has been shown to be inhibited by miR-107. [score:3]
[1 to 20 of 3 sentences]
50
[+] score: 11
Two members of the miR-103 gene family, miR-103 and miR-107, are both downregulated with age. [score:4]
In addition to the miR-155 oncomir, we found that several other cancer -associated miRNAs are downregulated with age including miR-103, miR-107, miR-128 and miR-221 (see Fig. 3C for list of cancers associated with each miRNA). [score:4]
miR-103 and miR-107 only differ by one nucleotide and are predicted to target the same genes. [score:3]
[1 to 20 of 3 sentences]
51
[+] score: 11
For instance, by selecting prostate cancer disease (in step 3 of the tool), for both extracellular and cellular miRNAs, users will see that there is no difference in the expression profile patterns for some miRNAs (e. g. let-7c, let-7e and miR-107), while there are some differences for other miRNA signatures (e. g. miR-141 is up-regulated in the plasma of prostate cancer patients [32], and is down-regulated in prostate cancer cell lines [33]). [score:11]
[1 to 20 of 1 sentences]
52
[+] score: 10
Disease Origin References of iPSC lines Phenotype of iPSC-derived neurons miRNAs of interest Fragile X syndrome Loss of function of FMRP (FMR1 gene) Urbach et al. (2010), Sheridan et al. (2011) Hyper-excitability of glutamatergic synapses DICER and AGO-1 complexes Rett’s syndrome Loss of function of MeCP2 transcriptional repressor Marchetto et al. (2010), Kim et al. (2011c), Cheung et al. (2012) Decreased soma size, neurite atrophy, decreased efficiency of glutamatergic synapses miR-132, miR-184, miR-483-5p, miR-212 Schizophrenia Multifactorial Urbach et al. (2010); Brennand et al. (2011), Paulsen Bda et al. (2012), Robicsek et al. (2013) Diminished neuronal connectivity miR-17-5p, miR-34a, miR-107, miR-122, miR-132, miR-134, miR-137 Down’s syndrome Additional copy of chromosome 21 Briggs et al. (2013), Weick et al. (2013) Reduced synaptic activity, increased sensitivity to oxidative stress miR-99a, miR-125b, miR-155, miR-802, Ret 7c Micro -RNAs, as fine regulators of protein translation, influence directly the level of gene expression. [score:9]
These include miR-17-5p, miR-34a, miR-107, miR-122, the brain-specific miR-132, the synaptic miR-134, miR-185, miR-382, and miR-652. [score:1]
[1 to 20 of 2 sentences]
53
[+] score: 10
The results are shown in Figure 4A, bta-miR-15b, bta-miR-107, bta-miR-30b-5p, bta-miR-214, bta-miR-193a-5p, bta-miR-339b, bta-miR-375, bta-miR-487b, and bta-miR-100 were differentially expressed in peak and late lactation, and the expression levels of bta-miR-15b, bta-miR-107, bta-miR-30b-5p, bta-miR-214, bta-miR-339b, bta-miR-375, and bta-miR-487b in late lactation tissue were higher than the expression levels in peak lactation, bta-miR-100 was down regulated in late lactation compared with peak lactation, the expression pattern was consistent with the Solexa sequencing results (Table S1), only bta-miR-107 was not consist with Solexa sequencing results, this may be caused by deviation of qRT-PCR. [score:9]
However, in late lactation, miR-143, let-7, miR-21, miR-148, miR-30, miR-146, miR-107 and miR-103 were the most abundant, each with more than 100,000 reads. [score:1]
[1 to 20 of 2 sentences]
54
[+] score: 10
CircRNA profiling and circRNA/miRNA interactions were first studied in bladder cancer, and researchers demonstrated that overexpression of circTCF25 could downregulate miR-103a-3p and miR-107, increase cyclin -dependent kinase 6 (CDK6) expression, and promote proliferation and migration in vitro and in vivo. [score:8]
Recently, the first study to exploit circRNA profiling and circRNA/miRNA interactions in bladder cancer was reported, and Zhong et al. determinated the regulatory role of circTCF25-miR-103a-3p/miR-107-CDK6 axes in bladder cancer [28]. [score:2]
[1 to 20 of 2 sentences]
55
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-33a, hsa-mir-103a-2, hsa-mir-103a-1, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-191, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-10a, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-let-7a-3, gga-mir-155, gga-mir-18a, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-mir-126, gga-let-7a-2, gga-mir-27b, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, hsa-mir-33b, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-675, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, hsa-mir-675, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-664a, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, gga-mir-10a, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, mmu-mir-126b, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
We also found opposing results regarding the expression of two miRNA/host gene pairs, murine mmu-mir-103/Pank3 and mmu-mir-107/Pank1– these have previously been demonstrated to have coordinate [71] as well as anti-correlative (or discordant) expression patterns [72]. [score:5]
Out of the 26 miRNA/host gene pairs with coordinated expression, 11 have been found to be coordinately expressed in both, human and mouse [19], [27], [59], [61]– [64], [67]– [69], [71], [73]– [79]: mir-103/ PANK3, mir-107/ PANK1, mir-126/ EGFL7, mir-128-1/ R3HDM1, mir-140/ WWP2, mir-211/ TRPM1, mir-218-1/ SLIT2, mir-218-2/ SLIT3, mir-27b/ C9orf3, mir-33/ SREBF2, and mir-499/ MYH7B. [score:5]
[1 to 20 of 2 sentences]
56
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-28, hsa-mir-29a, hsa-mir-93, hsa-mir-100, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-34a, hsa-mir-181c, hsa-mir-182, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-217, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-134, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-106b, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-372, hsa-mir-382, hsa-mir-148b, hsa-mir-196b, hsa-mir-424, hsa-mir-448, hsa-mir-449a, hsa-mir-483, hsa-mir-491, hsa-mir-501, hsa-mir-503, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320c-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320c-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Up-regulation of miR-276 promotes liver stenosis whereas down-regulation of miR-449a and miR-107, as well as up-regulation of miR-200c, supports hepatic fibrosis [43, 65]. [score:10]
[1 to 20 of 1 sentences]
57
[+] score: 10
For example, miR-106b, miR-107, miR-130a, miR-34 [9], miR-93, miR-155, miR-181a, miR-21, miR-23a, miR-320a [8], miR-193b, miR-320b [13] are significantly up-regulated and miR-148a [11, 14], miR-330-5p [15], miR-373 [16] significantly down-regulated. [score:7]
Interestingly, most of these miRNAs are coincident with those appearing in Table 1 (miR-374b, miR-148a, miR-181a, miR-373, miR-320a, miR-93, miR-106b, miR-497, miR-23a, miR-19b, miR-107, miR-15a, miR-330-5p, miR-144), indicating that, apart from being targeting many mRNAs, these miRNAs are participating in the most reliable interactions. [score:3]
[1 to 20 of 2 sentences]
58
[+] score: 10
However, in the group of inconsistently reported miRNAs, miR-107 was reported in nine studies with upregulation in eight studies and downregulation in one study followed by miR-103 in eight studies with seven and one study showing up- and downregulation, respectively. [score:10]
[1 to 20 of 1 sentences]
59
[+] score: 10
Of these, 14 (miR-23b, miR-28, miR-98, miR-103, miR-107, miR-193a,0, miR-324-5p, miR-324-3p, miR-331, miR-374, miR-432, miR-502, and miR-660) were upregulated and 6 (miR-31, miR-451, miR-452, miR-565, miR-594 and miR-659) were downregulated. [score:7]
[26]↑ C2C12 diff [33]↑ muscle development [31] 16miR-30d↑↑(this study)↑ pMyo diff [33]  17miR-30e-3p↑(this study)↑ pMyo diff [33]  18 miR-31 (n)↓(this study)   19 miR-98 (n)↑(this study)   20miR-99a↓(this study)↑ C2C12 diff [33] ↑ pMyo diff [33]  21 miR-101↑↑(this study)-↑ muscle development [31] 22 miR-103 (n)↑(this study)   23 miR-107 (n)↑(this study)-  24miR-126↑↑(this study)↓ C2C12 diff [33]  25↑↑↑↑ pMyo diff. [score:3]
[1 to 20 of 2 sentences]
60
[+] score: 9
42) 13 hsa-mir-199b dbDEMC, HMDD, miR2Disease 38 hsa-mir-206 dbDEMC 14 hsa-mir-181a dbDEMC, miR2Disease 39 hsa-mir-192 dbDEMC 15 hsa-mir-29a dbDEMC, HMDD, miR2Disease 40 hsa-mir-335 literature 16 hsa-let-7e dbDEMC 41 hsa-mir-365 literature 17 hsa-mir-107 HMDD 42 hsa-mir-30a miR2Disease 18 hsa-mir-18a higher RWRMDA (No. [score:9]
[1 to 20 of 1 sentences]
61
[+] score: 9
Six of them, namely, rno-miR-107-5p, rno-miR-383-5p, rno-miR-24-1-5p, rno-mir-191b, rno-miR-196b-5p, and rno-miR-3552, were upregulated, while only rno-mir-194-1 was downregulated in the MCAO group compared with the sham group. [score:6]
H2A histone family member Z (H2afz), protein tyrosine phosphatase receptor type C (Ptprc), and serine/arginine-rich splicing factor 2 (Srsf2) were extracted as target genes of rno-miR-107-5p, rno-miR-196b-5p, and rno-miR-3552, respectively. [score:3]
[1 to 20 of 2 sentences]
62
[+] score: 9
Previously, it was reported that p53, another well-known tumor suppressor, upregulates the transcription of tumor-suppressor miRNAs such as miR-34a/b/c/, miR-107, miR-145, miR-192, and miR-215, which regulate cell proliferation, apoptosis, and angiogenesis [29]. [score:9]
[1 to 20 of 1 sentences]
63
[+] score: 9
Liu et al. [29] found that expression of 4 miRNAs was significantly upregulated (miR-136, miR-703, miR-30b, and miR-107), while miR-653 and miR-598 were significantly downregulated. [score:9]
[1 to 20 of 1 sentences]
64
[+] score: 9
miR-107 suppressed proliferation, downregulated stem cell markers (CD133 and Nestin), reduced MMP-12 expression, and concealed GSCs xenograft growth in vivo [72]. [score:8]
miR-107 was reported to Notch-2 by Chen et al. in 2013 [72]. [score:1]
[1 to 20 of 2 sentences]
65
[+] score: 9
Ectopic overexpression of circTCF25 was shown to promote proliferation and migration of the bladder cancer cells via inhibition of miR-103a-3p and miR-107 [97]. [score:5]
Previous studies have reported that miR-103a-3p and miR-107 can negatively regulate oncogenic factors, including CDK6 [98, 99]. [score:2]
These results illustrate that the circTCF25-miR-103a-3p/miR-107-CDK6 network plays an important role in bladder cancer [97]. [score:1]
Bioinformatic analysis found MREs in circTCF25 that indicate binding sites for the miRs, miR-103a-3p and miR-107. [score:1]
[1 to 20 of 4 sentences]
66
[+] score: 8
Furthermore, circTCF25 was shown to function as a miRNA sponge by down -regulating miR-103a-3p and miR-107 in cancerous tissue, leading to increased CDK6 expression. [score:4]
Screening differential circular RNA expression profiles reveals the regulatory role of circTCF25-miR-103a-3p/miR-107-CDK6 pathway in bladder carcinoma. [score:4]
[1 to 20 of 2 sentences]
67
[+] score: 8
9 −3.8 hsa-miR-424 −4.2 −2 −4.5 hsa-miR-24-1* −3.9 −2.3 −4.1 hsa-miR-542-3p −2.9 −2.2 −3.8 hsa-miR-29b −2.6 −2.1 −3.3 hsa-miR-301a −2.4 −1.8 −2 hsa-miR-107 −2 −1.7 −2.2 hsa-miR-101 −1.8 −1.9 −1.8 hsa-miR-188-5p −1.7 −1.6 −1.8Based on the 3 lists of DEMs, we focused our attention on the miRNAs whose expression was influenced specifically by the oncogenic alteration of AKT1, PIK3CA or PTEN, and, alternatively, on those commonly deregulated by two or three of the above-mentioned alterations. [score:4]
9 −3.8 hsa-miR-424 −4.2 −2 −4.5 hsa-miR-24-1* −3.9 −2.3 −4.1 hsa-miR-542-3p −2.9 −2.2 −3.8 hsa-miR-29b −2.6 −2.1 −3.3 hsa-miR-301a −2.4 −1.8 −2 hsa-miR-107 −2 −1.7 −2.2 hsa-miR-101 −1.8 −1.9 −1.8 hsa-miR-188-5p −1.7 −1.6 −1.8 Based on the 3 lists of DEMs, we focused our attention on the miRNAs whose expression was influenced specifically by the oncogenic alteration of AKT1, PIK3CA or PTEN, and, alternatively, on those commonly deregulated by two or three of the above-mentioned alterations. [score:4]
[1 to 20 of 2 sentences]
68
[+] score: 8
The analysis of miRNA expression data suggest that the age -associated abundance changes observed for three candidate proteins (DNAJC3, DDX3X, CALM1) are caused by post-transcriptional regulation through corresponding miRNAs, i. e. miR-107, miR-29c, miR-181a and miR-409-3p, which may target the transcripts of these proteins and showed an inverse expression pattern compared to these proteins in our fibroblast cultures. [score:7]
DNAJC3, DDX3X and CALM1 exhibited an anti-correlation with miR-107, miR-29c as well as with miR181a and miR-409-3p, respectively. [score:1]
[1 to 20 of 2 sentences]
69
[+] score: 8
Along with miR-103, miR-107 can promote CRC metastasis by targeting the metastatic suppressors DAPK and KLF4 [69]. [score:5]
MiR-107, which is induced by p53, is reported to inhibit HIF-1 and thereby tumour angiogenesis [68]. [score:2]
miRNA-107 is also exclusively represented in A33-Exos, albeit to a lesser extent than miRs-19a/b, -378a/b/cd and -320a/b. [score:1]
[1 to 20 of 3 sentences]
70
[+] score: 8
miR-107 lowers the expression of b-site amyloid precursor protein-cleaving enzyme 1 (BACE1) and may be involved in the acceleration of Alzheimer's disease progression. [score:5]
In the cortex of Alzheimer patients, the expression of miR-107 was reduced significantly even in patients with very early pathological alterations [47]. [score:3]
[1 to 20 of 2 sentences]
71
[+] score: 8
Some of these mechanisms have been proposed to explain the increased accumulation of BACE1 observed in AD brains, including depletion of GGA3 [8], increased phosphorylation of translation factor eIF2α [40], increased expression of a non-coding anti-sense BACE1 transcript [41] and decreased expression of the BACE1 regulating microRNA’s, miR-29 and miR-107 [42, 43]. [score:8]
[1 to 20 of 1 sentences]
72
[+] score: 8
Chen and colleagues showed that miR-103 and miR-107 target the metastasis suppressors DAPK and KLF4 [45]. [score:5]
Association between differentially abundant circulating miR-103a-3p/miR-107 and HNSCC T stage. [score:1]
As evidenced in Figures 4 and 5, the interaction network approach underscores the key role of let-7a/f, miR-26a/b, miR-103, miR-107, miR-205, and miR-320a/b among others. [score:1]
In contrast to the clear oncogenic role demonstrated for miR-103a and miR-107, miR-320 has been mainly reported as an anti-angiogenic miRNA in breast cancer [51] and oral squamous cell carcinoma [43]. [score:1]
[1 to 20 of 4 sentences]
73
[+] score: 8
The expression of microRNA mir-107 decreases early in Alzheimer's disease and may accelerate disease progression through regulation of beta-site amyloid precursor protein-cleaving enzyme 1. J. Neurosci. [score:8]
[1 to 20 of 1 sentences]
74
[+] score: 8
Recently, TLR-4 activation, has been shown to down-regulate miR-107 expression in macrophages. [score:6]
In addition, miR-107 has been demonstrated to be deregulated in murine and rodent mo dels of obesity and insulin resistance, contributing to both conditions [58]. [score:2]
[1 to 20 of 2 sentences]
75
[+] score: 8
The expression of microRNA miR-107 decreases early in Alzheimer's disease and may accelerate disease progression through regulation of beta-site amyloid precursor protein-cleaving enzyme 1. J. Neurosci. [score:8]
[1 to 20 of 1 sentences]
76
[+] score: 8
Using published mouse miRNA expression data [55], we found that our strongest candidates, mir-107 and mir-103, are indeed strongly expressed in brain, heart, and muscle. [score:5]
All seven miRNAs were associated with DMPK repression using the RE metric (P = 0.02 by binomial test), with mir-107 and mir-103 repressing DMPK among the most at about 15% (Figure 4d). [score:1]
Together, these results support a role for miRNAs in DM1 pathogenesis, and, in particular, highlight mir-107 and mir-103 as attractive candidates for binding to DMPK. [score:1]
In this mo del, CTG repeat -binding miRNAs, such as mir-107 and mir-103, preferentially bind to the mutated DMPK transcript. [score:1]
[1 to 20 of 4 sentences]
77
[+] score: 7
It is however interesting to note that several miRNAs in addition to miRNA-210 i. e., miR-23, miR-24, miR-26a, miR-26b, miR-29a and miR-107 up-regulated through time course infection in our study were described as hypoxia-related [77], [78], negatively regulating HIF-1α through factor inhibiting-HIF-1α (FIH) [79] or induced by this TF [80]. [score:7]
[1 to 20 of 1 sentences]
78
[+] score: 7
Hence, upregulation of miR-103 and miR-107 as well as downregulation of miR-744 in asthmatic horses highlight a potential role of this miRNA network in chronic inflammatory conditions. [score:7]
[1 to 20 of 1 sentences]
79
[+] score: 7
These miRNAs have been shown to be over-expressed in several types of cancers including lung cancers [17, 50, 51], and high expression of miR-103 and miR-107 were correlated with poor survival in cancer patients (esophageal squamous and pancreatic tumors) [51, 52]. [score:5]
For example, we found significant overexpression of miR-103, miR-107, miR-301 and miR-338 in lung cancer cells as compared to HBECs. [score:2]
[1 to 20 of 2 sentences]
80
[+] score: 7
These miRNAs seem to fall into three situations: miRNAs (e. g. miR-9[46], miR-107[47, 48], miR-29[8]) that downregulate/have a negative correlation with “pro-AD” genes (e. g. FGFR1, NFκB, SIRT1, BACE1, CDK5, ADAM10)/are negatively correlated with amount of Aβ plaque and NFTs, exhibit downregulated in the brain and/or peripheral circulation of AD patients. [score:7]
[1 to 20 of 1 sentences]
81
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-mir-34c, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, mmu-mir-346, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, hsa-mir-381, mmu-mir-375, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-346, hsa-mir-196b, mmu-mir-196b, hsa-mir-18b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, mmu-mir-92b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
However, Xie et al. additionally found miR-107 and miR-103 to be upregulated, similarly to Ortega's findings in human adipocytes, but contrary to our results. [score:4]
As the regulation of mir-107 and mir-103 exists in man and mouse, differences in the differentiation protocols applied could explain the discrepancy. [score:2]
However, our results are not in accordance with Esau regarding miR-20, miR-93, miR-103 and miR-107. [score:1]
[1 to 20 of 3 sentences]
82
[+] score: 7
In particular, these studies identified miR15/miR-16, miR-26, miR-29, miR-107, miR-142, miR-342, and let7 between the miRNAs significantly induced, whereas miR-181b was found to be downregulated by ATRA. [score:4]
In particular, NFI-A, Bcl-2, and RAS transcripts were identified as relevant targets for miR-107, miR15/miR-16, and let7, respectively [29]. [score:3]
[1 to 20 of 2 sentences]
83
[+] score: 7
One possible explanation for this is that other miRNAs in the miR-103 family (e. g., miR-107), or synergic miRNAs which target genes in conjunction with miR-103, could regulate fatty acid synthesis, compensating for miR-103 knockdown. [score:5]
However, we were not able to analyze the relationship between miR-103-2, miR-107 and their host gene PANK2, PANK1, as the sequences of PANK1 and PANK2 in goat are unknown and cDNA cloning did not succeed. [score:1]
The MiR-103 family has three members, miR-103-1, miR-103-2 and miR-107, which reside in the sense oriented intron 5 of three members of the pantothenate kinase (PANK) gene family members across species: PANK3, PANK2, and PANK1, respectively. [score:1]
[1 to 20 of 3 sentences]
84
[+] score: 6
miR-484; miR-107; miR-30dHigh glucose down-regulates their expression in insulinoma cells [35]. [score:6]
[1 to 20 of 1 sentences]
85
[+] score: 6
We have identified a total of 59 miRs including 23 significantly up-regulated expression miRs (miR-214, miR-17, miR-20a, miR-200c, miR-107, miR-27a, etc. ) [score:6]
[1 to 20 of 1 sentences]
86
[+] score: 6
Other miRNAs from this paper: hsa-mir-22, hsa-mir-34a, hsa-mir-20b
Sci STKE 2007 cm8 34 Yamakuchi M Lotterman CD Bao C Hruban RH Karim B P53 -induced microRNA-107 inhibits HIF-1 and tumor angiogenesis. [score:3]
We previously found that miR-107 inhibits HIF-1β [34]. [score:3]
[1 to 20 of 2 sentences]
87
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
miR-107 regulates granulin/progranulin with implications for traumatic brain injury and neurodegenerative disease. [score:4]
Interestingly, there are many miRNAs, such as miRNA-107, miRNA-29a-1/b-1, miRNa-9 and miRNA-124, which regulate the APP-processing enzyme b-secretase enzyme I (BACE1) in AD patients (Bossy-Wetzel et al., 2004; Wang et al., 2010; Fang et al., 2012). [score:2]
[1 to 20 of 2 sentences]
88
[+] score: 6
Among these 54 miRNAs, miR-16, miR-20a, miR-20b, let-7b, miR-17-5p, miR-27a, miR-106a, miR-106b, miR-107, miR-193a, miR-210, miR-320, and miR-361 were predicted to target VEGF. [score:3]
Computational predictions indicated that miR-20a, miR-20b, miR-17-5p, miR-106a, and miR-106b had binding sites in Construct I. With slightly relaxed criteria about free energy and conservation, miR-15b, miR-16, miR-17-5p, miR-20b, and miR-107 have computationally predicted target sites in Construct II reporters (Table 4). [score:3]
[1 to 20 of 2 sentences]
89
[+] score: 6
Based on real-time polymerase chain reaction (PCR), the analysis of miRNA arrays using pooled RNA samples from five gastric cancer patients indicates that the expression of miRNA-107, miRNA-21, miRNA-196a, miRNA-26b, miRNA-9, miRNA-142-3p, miRNA-30b, miRNA-150, miRNA-191, and miRNA-17 was found to be upregulated [14]. [score:6]
[1 to 20 of 1 sentences]
90
[+] score: 6
BCL6 modulates the B cell response inducing tolerance to DNA damage -induced apoptosis by suppressing TP53 in GC B cells, [48]; while P53 controls the cell cycle at two distinctive checkpoints (G1/S and G2/M) by the regulation of miR-107, miR-145, miR-34, and of the miRNA clusters miR-15a/miR-16 and miR-192/miR-194/miR-215, able to target many cell cycle-related genes [49]. [score:6]
[1 to 20 of 1 sentences]
91
[+] score: 6
Other miRNAs from this paper: hsa-let-7d, hsa-mir-215, hsa-mir-224, hsa-mir-15b, hsa-mir-324
Fish-oil exposure also prevented downregulation of five miRNAs (let-7d, mir-15b, miR-107, miR-109 and miR-324–5p) by AOM treatment, and had the overall strongest reducing effect on the numbers of differentially expressed miRNAs. [score:6]
[1 to 20 of 1 sentences]
92
[+] score: 6
Similar regulatory pattern variation occurs for hsa-miR-107 and CDK6, which tend to be overexpressed in aggressive tumours. [score:4]
We propose that the enhanced regulatory effect of has-miR-107 on CDK6 is also due to the combined action of P53 and Drosha. [score:2]
[1 to 20 of 2 sentences]
93
[+] score: 6
Likewise, the overexpression of NEAT1 contributes to the malignant behavior of laryngeal squamous cell cancer by downregulating the miR-107/CDK6 pathway [27]. [score:6]
[1 to 20 of 1 sentences]
94
[+] score: 6
We found that LMP1 could induce the expression of several miRNAs such as miR-155, miR-188, miR-181b while other cellular miRNAs such as miR-103, miR-107 were downregulated. [score:6]
[1 to 20 of 1 sentences]
95
[+] score: 6
Hsa-miR-107, one of the targets of several dysregulated circRNAs identified in the present study, is wi dely confirmed to be associated with cancers 26– 30, which is the downstream target of circTCF25, and the interaction between this circRNA with miR-107 and miR-103a-3p leads to increased proliferation and migration of bladder cancer cells [31]. [score:6]
[1 to 20 of 1 sentences]
96
[+] score: 6
The study showed that circTCF25 promotes proliferation and metastasis of urinary bladder carcinoma by acting as a sponge for miR-103a-3p and miR-107, which resulted in upregulated CDK6 expression [129]. [score:6]
[1 to 20 of 1 sentences]
97
[+] score: 6
Another miRNA that targets BACE1 and is down-regulated in early AD and MCI-affected cortex is miR-107 [97]. [score:6]
[1 to 20 of 1 sentences]
98
[+] score: 6
The dysregulation of miRNAs in CRC has been reported using miRNA expression profiling studies with different miRNAs identified either as enhancers (miR-21, miR-31, miR-103, miR-107) or suppressors (miR-135, miR-145, miR-200c) in the initiation and evolution of tumor metastasis [8- 13]. [score:6]
[1 to 20 of 1 sentences]
99
[+] score: 5
Furthermore, it was shown that miR-107 expression in GC tissues was an independent prognostic factor for overall survival (OS) and disease-free survival [62]. [score:5]
[1 to 20 of 1 sentences]
100
[+] score: 5
In addition, Wang et al. (2008) reported that a change in neuronal miR-107 expression, which also targets BACE1, could contribute to the pathogenesis of AD [18]. [score:5]
[1 to 20 of 1 sentences]