sort by

32 publications mentioning dme-mir-2a-2

Open access articles that are associated with the species Drosophila melanogaster and mention the gene name mir-2a-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 110
Although ectopically expressing members of miR-2 family could suppress undergrowth of yki RNAi tissue, the negative result with the miR-2a reporter suggests that the effects of Yki on reaper are not mediated by regulation of miR-2a expression in the wing discs. [score:8]
As a first step to address how Yki might regulate miR-2 expression, we sought to identify cis-regulatory control elements that direct expression of miR-2 loci in S2 cells. [score:8]
Yki regulates miRNA expression to control reaper levelPrevious reports have shown that microRNAs of the miR-2 seed family (Fig.  3A) can regulate reaper, grim and skl (Stark et al., 2003; Leaman et al., 2005; Brennecke et al., 2005; Thermann and Hentze, 2007). [score:5]
As a member of the miR-2 seed family, miR-11 is expected to regulate the same targets as miR-2. Regulation of reaper by miR-11 has been confirmed in the embryo by Leaman et al. and Ge et al. (Leaman et al., 2005; Ge et al., 2012). [score:5]
The sensor transgene expresses GFP under control of the ubiquitously-expressed tubulin promoter and carries two miR-2a sites in its 3′ UTR (as described (Brennecke et al., 2005)). [score:5]
Drosophila miR2 induces pseudo-polysomes and inhibits translation initiation. [score:5]
Coexpression of a miR-2a/2b cluster transgene or a miR-11 transgene suppressed the undergrowth of yki -depleted tissue caused by elevated reaper mRNA (Fig.  4A,B; P<0.001). [score:5]
miR-2 has been shown to regulate translation of repaer mRNA (Thermann and Hentze, 2007). [score:4]
To ask whether this regulation occurred in other tissues in vivo, in addition to S2 cells, we expressed UAS-yki [RNAi] ubiquitously under tubulin-Gal4 control and found a significant reduction of miR-2a and b in the whole 3 [rd] instar larvae (Fig.  4C; P<0.05). [score:4]
In some tissues, Yki acts independently via members of the miR-2 family to regulate expression of reaper post-transcriptionally. [score:4]
microRNAs of the miR-2 seed family have also been shown to regulate the expression of the proapoptotic genes reaper, grim and skl (Stark et al., 2003; Brennecke et al., 2005; Leaman et al., 2005; Thermann and Hentze, 2007) and to limit apoptosis in the developing nervous system (Ge et al., 2012). [score:4]
These findings suggest that the Hippo pathway contributes to control of apoptosis through regulation of miR-2 expression in some but not all tissues. [score:4]
Yorkie regulates miR-2a cluster expression in S2 cells. [score:4]
Expression of the miR-2a cluster reporter decreased significantly in yki -depleted cells (Fig.  3D), suggesting that Yorkie regulates transcription of the miR-2a cluster. [score:4]
*** indicates statistically significant increase in the width of the ptc-Gal4 expression domain when miR-2 cluster level was increased (P<0.001). [score:3]
However, depletion of yki had no effect on the expression of the miR-2a reporter in wing imaginal discs (supplementary material Fig. S3). [score:3]
Expression of miR-2 family mediates tissue growth of Hippo pathway. [score:3]
Depletion of yki in S2 cells by RNAi led to a significant reduction in the levels of expression of miR-2a and b (P<0.05, Fig.  3B; miR-13a/b were on average lower, but the effect was variable and so not statistically significant). [score:3]
To further assess this regulation in vivo, we first asked whether overexpressing members of the miR-2 family could rescue the ptc-Gal4 UAS-yki [RNAi] undergrowth assay. [score:3]
Lower panels: flies expressing UAS-miR-2a/2b cluster transgene to increase miR-2a and 2b levels. [score:3]
Here we provide evidence for additional parallel pathways involving Yki, p53 and the miR-2 family of microRNAs in controlling the expression of reaper another key proapoptotic gene. [score:3]
Yki acts in parallel in some tissues via regulation of miR-2 family miRNAs to regulate reaper activity. [score:3]
Expression of miR-2a/2b or miR-11 on their own had no effect on growth. [score:3]
miR-2a-1, miR-2a-2 and miR-2b-2 are expressed as a cluster of 3 miRNAs located in an intron of the spitz gene (Fig.  3C). [score:3]
As a first step we asked which of the miR-2 family miRNAs is subject to regulation by the Hippo pathway in S2 cells. [score:2]
Yorkie further mediates reaper levels post-transcriptionally through regulation of members of the miR-2 microRNA family to prevent apoptosis. [score:2]
Previous reports have shown that microRNAs of the miR-2 seed family (Fig.  3A) can regulate reaper, grim and skl (Stark et al., 2003; Leaman et al., 2005; Brennecke et al., 2005; Thermann and Hentze, 2007). [score:2]
UAS-miR-2a/2b and miR-2a GFP sensor flies were described by Stark et al. (Stark et al., 2003). [score:1]
Student's t-test for miR-2 vs U27: * P<0.05, ** P<0.01. [score:1]
Fig. 3. (A) Sequence alignment of Drosophila miR-2 family miRNAs. [score:1]
Student's t-test for miR-2 vs U14: * P<0.05, ** P<0.01. [score:1]
microRNAs of miR-2 family were represented as black dots. [score:1]
[1 to 20 of 32 sentences]
2
[+] score: 64
Sli-miR-2a expressed at low level in egg, prepupa and adult stages, instead expressed most strongly in pupa stage, which accord with that in mo del insects, D. melanogaster [30] and B. mori [24]. [score:5]
Expression Patterns of sli-miR-14, sli-miR-2a and sli-bantam from S. lituraThe expression patterns of the putative miRNAs, sli-miR-14, sli-miR-2a and sli-bantam were also studied to make a further validation of this method. [score:5]
There were significant differences among various developmental stages, the relative expression levels of sli-miR-2a were 2.89-, 15.65-, 24.55-, 4.88-, 2.23-, 38.68- and 1.81-fold higher in the first instar, third instar, fourth instar, six instar, prepupa, pupa and adult than in egg, respectively (Figure 5b). [score:4]
Development-specific expression patterns for sli-miR-2a were also detected by qPCR. [score:4]
Three known miRNAs, miR-14, miR-2a and bantam, play important roles in the developmental stages in D. melanogaster [23, 24], such as regulating steroid hormone signaling [25] and apoptosis [12, 26, 27]. [score:3]
The expression patterns of the putative miRNAs, sli-miR-14, sli-miR-2a and sli-bantam were also studied to make a further validation of this method. [score:3]
Expression Patterns of sli-miR-14, sli-miR-2a and sli-bantam from S. litura. [score:3]
It has been clearly stated that cell autonomous anti-apoptotic activity mediated by miR-14 and miR-2a [12, 27], miR-14 also plays critical role in molting process [25], indicating miRNAs are involved in strict developmental regulation in insects. [score:3]
Moreover, expression patterns analysis indicated that the highly conserved miRNAs, both miR-14 and miR-2a, could be detected successfully by real-time quantitative PCR, which confirms that stem-loop RT-PCR can be used not only for quantification of miRNAs, but also for identifying highly conserved miRNAs in non-mo del insects. [score:3]
Therefore, Primers Pre-2aF and Pre-2aR were designed according to the conserved miRNAs for amplifying pre-miR-2a-2, and rising nealing temperature to 65 °C to inhibit non-specific amplification. [score:2]
However, the expression patterns of sli-miR-14 and sli-miR-2a, two highly conserved miRNAs in insect, could be obtained in this assay. [score:2]
The homologues of miR-14, miR-2a and bantam were cloned from Spodoptera litura, a prevalent agriculture pest in China, by stem-loop RT-PCR, and their expression patterns in different developmental stages were also investigated to confirm the results of sequence analysis. [score:2]
The mature sli-miR-14 and sli-miR-2a in their precursors shared 100% identity to the results shown by stem-loop RT-PCR. [score:1]
Amplification and Identification of sli-miR-14, sli-miR-2a and sli-bantam from S. lituraTo identify the availability of stem-loop RT-PCR technology for cloning conserved miRNAs from non-mo del insects, the sequences of miR-14, miR-2a and bantam in mo del insects were searched from miRBase (Table S1). [score:1]
MiR-14 and miR-2a are more conserved members of miRNAs family than bantam in mo del insects including D. melanogaster and B. mori (Table S1). [score:1]
To identify the availability of stem-loop RT-PCR technology for cloning conserved miRNAs from non-mo del insects, the sequences of miR-14, miR-2a and bantam in mo del insects were searched from miRBase (Table S1). [score:1]
The putative homologue of the three miRNAs in S. litura, namely sli-miR-14, sli-miR-2a and sli-bantam were cloned by a stem-loop RT-PCR technique. [score:1]
A 552bp fragment containing putative pre-sli-miR-2a-2 was amplified from genomic DNA of adult of S. litura. [score:1]
Genomic DNA Isolation and the Amplification of pre-miR-14 and pre-miR-2a from S. lituraTotal genomic DNA was isolated from the adult of S. litura according to the instruction of E. Z. N. A. Insect DNA Kit (OMEGA, USA). [score:1]
A cluster of miR-2a-1, miR-2a-2, miR-2b, miR-13a and miR-13b is localized on chromosome 1 of B. mori, indicating there are two precursors of miR-2a, and miR-2a-2 is in the interior of this cluster. [score:1]
When Group 1 was used for amplification of miR-14, miR-2a and bantam, PCR products were 86 bp, 89 bp, 89 bp, respectively (Figure 1a); when Group 2 was used, PCR products were 76 bp, 79 bp and 79 bp in length, respectively (Figure 1b). [score:1]
Results showed that putative pre-miR-14 and pre-miR-2a of S. litura can form stable stem-loop structures (initial Δ G = −41.80 and Δ G = −41.20 respectively) and are highly homologous to those of B. mori and D. melanogaster, indicating they are the precursors of sli-miR-14 and sli-miR-2a (Figure 4). [score:1]
The putative pre-sli-miR-2a showed 81.1% and 70.4% similarities with pre-bmo-miR-2a and pre-dme-miR-2a respectively (Figure 3b). [score:1]
In order to confirm whether the PCR products are endogenous miRNAs, putative precursors of miR-14 and miR-2a as representatives were also cloned from S. litura, results showed that both their sequences and secondary structures were highly conserved with mo del insects. [score:1]
Moreover, both mature sequences of miR-14 and miR-2a in their precursors shared 100% identity to the results shown by stem-loop RT-PCR. [score:1]
Cloning and Analysis of pre-miR-14 and pre-miR-2a from S. lituraTo verify the present results, homology of pre-miR-14 and pre-miR-2a were cloned from S. litura. [score:1]
Genomic DNA Isolation and the Amplification of pre-miR-14 and pre-miR-2a from S. litura. [score:1]
To verify the present results, homology of pre-miR-14 and pre-miR-2a were cloned from S. litura. [score:1]
The efficiency of miR-14, miR-2a and 5S rRNA was close to the ideal value of 2 (Table 1), therefore relative quantification (RQ) of miRNA expression was calculated with 2 [−Δ ΔCt] method [28, 29]. [score:1]
By searching bmo-miR-2a in Silkworm Genome Database, it is noticed that there are two precursors of pre-bmo-miR-2a which localized on chromosome 1 and organized as a cluster with pre-miR-2b, pre-miR-13a and pre-miR-13b (Figure 5). [score:1]
Although the identification of miRNAs in non-mo del insects with stem-loop RT-PCR is limited by 5′ region of putative miRNA, large amounts of miRNAs that are highly conserved, such as miR-14 and miR-2a, can be simply cloned by this method. [score:1]
Cloning and Analysis of pre-miR-14 and pre-miR-2a from S. litura. [score:1]
Amplification and Identification of sli-miR-14, sli-miR-2a and sli-bantam from S. litura. [score:1]
Based on the conserved character of miRNA, Pre-2aF and Pre-2aR for cloning pre-miR-2a-2 were designed according to the mature sequences of miR-2b and miR-2a-1 which located at both ends of the cluster. [score:1]
Pre-miR-14 and pre-miR-2a as representatives were also cloned from S. litura; both their sequences and secondary structures shared a high degree of homology with those in mo del insects, and the mature sequences of miR-14 and miR-2a in their precursors shared 100% identity to the results shown by stem-loop RT-PCR. [score:1]
Three homologues of known miRNAs, miR-14, miR-2a and bantam in mo del insects, were cloned from S. litura by stem-loop RT-PCR, and named sli-miR-14, sli- miR-2a and sli-bantam. [score:1]
PCR of sli-miR-14, sli-miR-2a and sli-bantam. [score:1]
[1 to 20 of 37 sentences]
3
[+] score: 24
These genes are not yet known to be miRNA targets, and therefore constitute strong candidates for experimental verification of regulation by members of the miR-2 family. [score:4]
Consistent with previous observations [17], target sites for miR-2a/2b/2c/6/13a/13b (UGUGAUA, K box) and miR-277 (AGCUUUA, Brd box) are significantly coconserved within fly 3′UTRs (p < 10 [−17]). [score:3]
Indeed, the target set for miR-2a/b/c contains the Brd genes m2, m4, and mα and the E(spl) genes m3, m5, mδ, and E(spl). [score:3]
In another case, also in worms, the target sites for two coconserved and distinct miRNAs (or miRNA sets) miR-2/miR-43 (CUGUGAU) and miR-80/miR-81/miR-82 (UGAUCUC), were found to overlap more often than expected by chance (p < 10 [−5]) (note that we limited the extent of the overlap to 4 nt in our coconservation analysis). [score:3]
Indeed, our predicted target set for miR-2a/2b/2c (259 genes having a conserved CUGUGAU or UGUGAUA in their 3′UTRs) contains the reaper and sickle genes (but not grim), as well as several other genes known to be involved in apoptosis: CG10345, CG11593, tartan, croquemort, and Ice. [score:3]
For example, Figure 5B shows that some worm miRNAs potentially regulate hundreds of genes (e. g., miR-2/ miR-43), while others may regulate fewer than ten genes (e. g., miR-273). [score:3]
Similarly, the target sites for miR-2/43 and miR-1 are coconserved in 12 genes (p < 10 [−6]). [score:3]
As another example, recent in vitro and in vivo experiments suggest that members of the fly miR-2 family (miR-2a/2b/2c) regulate the proapoptotic genes reaper, grim, and sickle in D. melanogaster [9]. [score:2]
[1 to 20 of 8 sentences]
4
[+] score: 23
grim is the only target of this group not recovered by PicTar, because it has only a 6mer nucleus for miR-2. A recent algorithm for the prediction of microRNA targets did not rely on evolutionary information, but incorporated the 3′ UTR secondary structure to compute putative microRNA targets [12]. [score:7]
grim is the only target of this group not recovered by PicTar, because it has only a 6mer nucleus for miR-2. A recent algorithm for the prediction of microRNA targets did not rely on evolutionary information, but incorporated the 3′ UTR secondary structure to compute putative microRNA targets [12]. [score:7]
Furthermore, many targets of Notch signaling were also predicted as targets of the Bearded-box microRNAs miR-4 and miR-79 (E(spl)m5, Bearded, E(spl)mγ, and Tom) and of the K-box microRNAs miR-2 and miR-11 (E(spl)m5, E(spl)m2, E(spl)mδ, and E(spl)m3), consistent with previous observations [27]. [score:5]
The proapoptotic genes reaper, grim, and sickle are validated targets of the miR-2 family [4]. [score:3]
For sickle we found one conserved site in all flies for miR-2, miR-13, and miR-6, which share the same nucleus. [score:1]
[1 to 20 of 5 sentences]
5
[+] score: 19
mir-2 and mir-13 repress translation of the target genes, grim, skl and rpr, suggesting that they may be involved in regulating apoptosis [48]. [score:6]
bmo-miR-2b, which is found in the gene cluster bmo-miR-2a-1/bmo-miR-2a-1*/bmo-miR-2a-2/bmo-miR-2b/bmo-miR-13a*/bmo-miR-13b, encodes a newly identified member of the mir-2 family. [score:1]
mir-2 and mir-7 may be related to the Notch signaling pathway in B. mori; this hypothesis is consistent with previous predictions [38, 53]. [score:1]
4220] of these six genes can bind perfectly to mir-2 (bmo-miR-2a, bmo-miR-2b, bmo-miR-13a* and bmo-miR-13b) and bmo-miR-7, respectively. [score:1]
mir-2 controls HLHm delta, and mir-7 controls HLHm3, HLHm5, HLHmgamma, M4 and TOM, in D. melanogaster; these six genes are involved in the Notch signaling pathway. [score:1]
These newly identified miRNAs are bmo-miR-2a*, bmo-miR-8*, bmo-miR-13a*, bmo-miR-46*, bmo-miR-263*, bmo-miR-279*, and bmo-miR-305*. [score:1]
a. bmo-miR-2a-1/bmo-miR-2a-1*/bmo-miR-2a-2/bmo-miR-2b/bmo-miR-13a*/bmo-miR-13b; b. bmo-miR-275/bmo-miR-305/bmo-miR-305*. [score:1]
Examining the positions of the identified miRNAs in the B. mori genome, we identified two miRNA clusters (Figure 4): bmo-miR-2a-1/bmo-miR-2a-1*/bmo-miR-2a-2/bmo-miR-2b/bmo-miR-13a*/bmo-miR-13b; and bmo-miR-275/bmo-miR-305/bmo-miR-305*. [score:1]
Searching miRBase, we found that the bmo-miR-2a sequence was identical to the dme-miR-2a, dps-miR-2a, ame-miR-2, and aga-miR-2 sequences, but we failed to identify any other miRNA that had the same sequence as bmo-miR-2b (Figure 5); therefore, bmo-miR-2b is a newly identified member of the mir-2 miRNA family. [score:1]
Genes in the cluster containing bmo-miR-2a-1/bmo-miR-2a-1*/bmo-miR-2a-2/bmo-miR-2b/bmo-miR-13a*/bmo-miR-13b are members of the mir-2 miRNA family. [score:1]
This cluster contains bmo-miR-2a, which can be derived from two different precursor miRNAs transcribed from two paralogous miRNA genes, bmo-miR-2a-1 and bmo-miR-2a-2. The opposite strand to bmo-miR-2a-1 also encodes a miRNA. [score:1]
Figure 5Homologous analysis of mir-2 family. [score:1]
We identified two miRNA gene clusters in the B. mori genome, and bmo-miR-2b was identified as a new member of the mir-2 family. [score:1]
Searching the D. melanogaster and A. gambiae miRNAs, we found that corresponding mir-2 and mir-13 family members also assembled into clusters in these two species. [score:1]
[1 to 20 of 14 sentences]
6
[+] score: 19
Atf3 appears on the predicted target lists for three miRNAs whose over -expression eliminates Or47b expression (i. e., miR-2a-2, miR-33, and miR-2491). [score:7]
We were also able to confirm that the loss of Or47b expression induced by miR-2a-2 over -expression is rescued by introduction of an Atf3::eGFP fusion that lacks its 3′-UTR and thus the miR-2a-2 binding site (Fig. 2H). [score:5]
Still, in the interest of completeness, we confirmed that the over -expression of miR-2a-2 reduces the level of Atf3 in antennal cDNAs as detected by qPCR (Fig. 2G). [score:3]
Combined we identified seven miRNA lines (Pictured: miR-263a, miR-2a-2, and miR-2491; Not shown: bantam, miR-33, miR-308, and miR-973/974) that reduce the expression of the Or47b reporter. [score:3]
Figure 2D indicates the positions of the miR-2a-2 and miR-33 binding sites in the Atf3 3′-UTR. [score:1]
[1 to 20 of 5 sentences]
7
[+] score: 16
However, the microRNA that switched in the mir-2 family did not contain completely unique mature sequences and relative arm switching may have been over or underestimated. [score:1]
The seven copies of mir-2 that are located on six different scaffolds are all found close to the ends of the scaffolds, and may therefore possibly be fragments of larger mir-71/ mir-2 clusters (fig. 3). [score:1]
In this horseshoe crab we found eight copies of mir-71 located on seven scaffolds, of which six also contain at least one copy of mir-2 (fig. 3). [score:1]
Parasteatoda tepidariorum contains one cluster containing a single copy of mir-71 and three copies of mir-2, and a second cluster, on a different scaffold, also with one copy of mir-71, but with six copies of mir-2 (fig. 3). [score:1]
In the S. mimosarum and C. sculpturatus genomes we found one scaffold containing one copy of mir-71 and four copies of mir-2 (fig. 3), and a second scaffold with one copy of mir-71 and three copies of mir-2 (fig. 3). [score:1]
In the spiders, the scorpion and the horseshoe crab, we consistently found at least two copies of mir-71 and more than two copies of mir-2 (fig. 2). [score:1]
Fig. 3. —The duplicate mir-71/ mir-2 clusters in chelicerate lineages. [score:1]
The mir-71/ mir-2 cluster is duplicated in spiders (purple), the scorpion (magenta), and the horseshoe crab (blue). [score:1]
The mir-71/ mir-2 cluster is an invertebrate-specific microRNA cluster that has expanded in arthropods probably due to tandem duplications of mir-2 (Marco et al. 2010; Marco, Hooks, et al. 2012). [score:1]
There is another scaffold with one copy of mir-71 and one copy of mir-2 located approximately 6 kb from the end of the scaffold. [score:1]
The arrangement of L. polyphemus mir-71/ mir-2 genes is much more fragmented (fig. 3). [score:1]
Therefore the mir-71/ mir-2 and mir-100/ let-7/ mir-125 clusters appear to have been duplicated in spiders and scorpions (Arachnopulmonata) and L. polyphemus but not other chelicerates or mandibulates that we surveyed. [score:1]
In the acariform and parasitiform lineages, the copy numbers of mir-71 and mir-2 are variable, though usually there is one copy of mir-71 and two copies of mir-2 (fig. 2). [score:1]
This could perhaps be caused by the many paralogs of the mir-3791 and mir-2 families, which were generally 3’ dominant, though both of these families do show instances of arm switching (fig. 4 and supplementary fig. S6, online). [score:1]
In A. geniculata there is one complete cluster with one mir-71 and four mir-2 copies, all on one scaffold (fig. 3). [score:1]
There are also two other copies of mir-2, each on approximately 1 kb scaffolds. [score:1]
[1 to 20 of 16 sentences]
8
[+] score: 14
Specifically, Legeai et al. 16 reported that 17 miRNAs from A. pisum shows significant differences in their steady-state levels between two morphs, in which Let-7 and miR-100 with similar expression patterns were up-regulated and miR-2a was down-regulated between oviparae and the two other parthenogenetic morphs (virginoparae and sexuparae). [score:9]
Analogously, miRNAs have also been implicated in modulating gene expression during wing development 29, and includes the roles of miR-7 30, miR-iab-4 31, and miR-2a 32 (Table 3). [score:4]
The miR-2 family was predicted to contain the most family members (n = 8), followed by miR-10 (n = 5), and miR-87, -184, -252, -263, -279, -9, -3015 (n = 4). [score:1]
[1 to 20 of 3 sentences]
9
[+] score: 12
Furthermore, other corresponding predicted detoxification targets, Esterase8, Esterase10, GstD1, GstE10, GstS1, GABA-R, mAChR-A, nAcRalpha-A and GluR-IB were significantly up-regulated with the down-regulation of miR-286-3p, miR-2a-3p, miR-311-3p, miR-312-3p, and miR-313-3p in 91-R strain (Fig 4). [score:9]
Additionally, 4 out of 10 miRNAs predicted to be differentially expressed between 91-R and 91-C (miR-986-5p, miR-995-3p, miR-312-3p, miR-2a-3p) were also predicted to interact with and impact the transcript level of multidrug resistance -associated protein B7 (ABC-B7). [score:3]
[1 to 20 of 2 sentences]
10
[+] score: 10
Therefore, feeding of the DCPTN-PT containing culture media did not depress the regulatory microRNAs (miR-2, miR-13 and miR-14) that control the translation of three pro-apoptotic host genes (miR-2 and miR-13 targets rpr, grim and miR-14 targets Drice), suggesting that DCPTN-PT compound is not an inhibitor of all proapoptotic genes but very specific to oncomiR bantam. [score:10]
[1 to 20 of 1 sentences]
11
[+] score: 10
Other miRNAs from this paper: dme-mir-2a-1, dme-mir-14, mmu-mir-184, dme-mir-184, hsa-mir-184
We conclude that the identity of the first miRNA nucleotide contributes more to the loading of miR-2a than do differences in the stability of the duplex termini. [score:1]
Single-stranded (ssRNA), 5′- [32]P-radiolabeled miR-2a was incubated for one hour in embryo lysate. [score:1]
Next, we examined a series of miR-2a/miR-2a* derivatives in which the 19th base of miR-2a* was always C, ensuring that duplex stability was the same when the miRNA began with U or A. Again, a 5′-U favored miRNA loading and disfavored miRNA* loading (Figure 3C). [score:1]
Inverting this U:A base pair so that miR-2a began with A nearly halved the amount of miRNA assembled into RISC and more than doubled the amount of miR-2a-1* (Figure 3A). [score:1]
Changing the 5′-nt of miR-2a (C) or miR-184 (D) into 5′-guanidine (5′-G) decreases miRNA loading (relatively to a 5′-A). [score:1]
Mutating miRNA nt 2 in miR-2a and miR-184 influenced the order of preference for nt 1 in flies (Figures 4B and 4C). [score:1]
Strikingly, the order of preference for nt 1 was not the same across the three tested miRNA: miR-2a preferred U > A > C (Figure 3), miR-14 preferred U ~ C > A and miR-184 preferred U ~ A > C (Additional file 6, Figure S6). [score:1]
Both authentic miR-2a and miR-2a-1* begin with U; the 5′-U of miR-2a is paired to A19 of miR-2a-1*. [score:1]
When the initial U:A base pair of miR-2a/miR-2a-1* was altered, UU assembled more miRNA into RISC than did AA (Figure 3B). [score:1]
Lysate was incubated for one hour with 5′- [32]P-radiolabeled Drosophila melanogaster miR-2a paired with 5′ phosphorylated miR-2a-1*. [score:1]
[1 to 20 of 10 sentences]
12
[+] score: 9
Drosophila miR2 induces pseudo-polysomes and inhibits translation initiation. [score:5]
In addition, miR-2 is known to bind to the 3′ UTR of reaper, repressing its translation and directing it to P-body-like structures (Thermann and Hentze, 2007). [score:4]
[1 to 20 of 2 sentences]
13
[+] score: 8
There is an aga-miR-2 in miRBase (derived from two precursors aga-miR-2-1 and aga-miR-2-2), which is reverse complementary to ast-miR-2a. [score:1]
Four of the six Anopheline miRNAs (miR-12, miR-375, miR-2a, and miR-76) have conserved sequences in Ae. [score:1]
Sequence comparison showed that ast-miR-2a is not derived from aga-miR-2* because of the existence of multiple in dels/mismatches between the alignment of aga-miR-2 and aga-miR-2*. [score:1]
However, ast-miR-2a is reverse complementary to the aga-miR-2 reported in miRBase. [score:1]
Cloning results for ast-miR-2a, comparisons to dme-miR-2a, and miRscan predictions are all consistent. [score:1]
ast-miR-2a matches dme-miR-2a perfectly thus is named as miR-2a. [score:1]
The orientation of our cloned ast-mir-2a is consistent with the miRscan prediction based on An. [score:1]
One miRNA, ast-miR-2a, is worth noting. [score:1]
[1 to 20 of 8 sentences]
14
[+] score: 7
For instance, members of the mir-2 family have, in general, the same targets (49, 51, 52). [score:3]
However, we have previously shown that the mir-2 cluster originally appeared by the de novo birth of the first mir-2 family member within the mir-71 transcript (48, 49). [score:1]
Later, the mir-2 family expanded by duplication and mir-71 was lost in several lineages, including the Drosophila genus (49). [score:1]
Two of the five clusters, mir-13b-1/mir-13a/mir-2c and mir-2a-2/mir-2a-1/mir-2b-2, are derived from a single ancestral mir-2/mir-13 cluster (48, 49). [score:1]
All members of the mir-2/mir-13 ancestral cluster belong to the same family (the mir-2 family), suggesting that the ancestral cluster originated by tandem duplication. [score:1]
[1 to 20 of 5 sentences]
15
[+] score: 6
Other miRNAs from this paper: dme-mir-1, dme-mir-2a-1, dme-mir-2b-1, dme-mir-2b-2, dme-mir-2c
The targeting sites of Cow-miRNA-1 and Cow-miRNA-2 were TTAGCATAGTTGCTGCGTAAGA in the 5′-untranslated region (UTR) and CCACAAGAATCGTGATGAGATA in the N region, respectively (see Figure S1B). [score:5]
SP-Flag-Cow, SP-EGFP-Cow, SP-Flag-Cow-mSG1+2, Cow-miRNA-1 and Cow-miRNA-2 were cloned into the pUAST vector [25]. [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 5
While hid and other proapoptotic genes are targeted by other miRNAs, including bantam and the miR-2 family [5], [9], [10], none of these interactions has been shown to affect apoptotic pruning. [score:3]
Finally, members of the miR-2 family of miRNAs have been shown to regulate the propaptotic genes, reaper, grim, and sickle in S2 cell over -expression assays or in reporter transgene assays in vivo [10], [38]. [score:2]
[1 to 20 of 2 sentences]
17
[+] score: 5
Other miRNAs from this paper: dme-mir-2a-1, dme-mir-2b-1, dme-mir-2b-2, dme-mir-9a, dme-mir-10, dme-mir-12, dme-mir-13a, dme-mir-13b-1, dme-mir-13b-2, dme-mir-276a, dme-mir-133, dme-mir-276b, dme-mir-210, dme-mir-31b, dme-mir-9c, dme-mir-306, dme-mir-9b, dme-mir-31a, dme-mir-309, dme-mir-316, dme-mir-317, dme-mir-2c, ame-mir-12, ame-mir-133, ame-mir-210, ame-mir-276, ame-mir-2-1, ame-mir-2-2, ame-mir-317, ame-mir-9a, ame-mir-9b, bmo-mir-9a, bmo-mir-10, bmo-mir-276, bmo-mir-31, bmo-mir-71, ame-mir-10, ame-mir-137, ame-mir-13a, ame-mir-2-3, ame-mir-29b, ame-mir-31a, ame-mir-375, ame-mir-71, ame-mir-932, dme-mir-193, dme-mir-375, dme-mir-932, dme-mir-970, dme-mir-971, dme-mir-989, dme-mir-137, dme-mir-1006, dme-mir-1007, bmo-mir-2a-1, bmo-mir-2a-2, bmo-mir-2b, bmo-mir-13a, bmo-mir-13b, bmo-mir-133, bmo-mir-210, bmo-mir-317, tca-mir-2-3, tca-mir-2-1, tca-mir-2-2, tca-mir-10, tca-mir-12, tca-mir-13a, tca-mir-13b, tca-mir-31, tca-mir-71, tca-mir-133, tca-mir-137, tca-mir-210, tca-mir-276, tca-mir-317, tca-mir-932, tca-mir-9b, bmo-mir-12, bmo-mir-137, bmo-mir-932, bmo-mir-9b, tca-mir-9a, tca-mir-970, ame-mir-13b, ame-mir-1006, ame-mir-316, bmo-mir-970, lmi-mir-276, lmi-mir-210, lmi-mir-10, lmi-mir-9a, bmo-mir-9c, bmo-mir-306a, bmo-mir-989a, bmo-mir-316, bmo-mir-1175, bmo-mir-9d, bmo-mir-750, bmo-mir-375, bmo-mir-306b, api-mir-137, api-mir-10, api-mir-276, api-mir-13a, api-mir-210, api-mir-29, api-mir-2a, api-mir-2b, api-mir-2c, api-mir-316, api-mir-317, api-mir-71, api-mir-971, api-mir-9a, api-mir-9b, api-mir-306, api-mir-3049, bmo-mir-989b, ame-mir-1175, ame-mir-193, ame-mir-989, ame-mir-3049, ame-mir-971, ame-mir-3770, ame-mir-9c, ame-mir-306, ame-mir-750, tca-mir-9c, tca-mir-316, tca-mir-9d, tca-mir-309a, tca-mir-3049, tca-mir-375, tca-mir-29, tca-mir-1175, tca-mir-750, tca-mir-989, tca-mir-309b, tca-mir-193, tca-mir-6012, tca-mir-9e, ame-mir-6037, ame-mir-6012, ame-mir-2b, tca-mir-309c, tca-mir-971b
The structure of the miR-2 cluster in the seven species of insects studied. [score:1]
There is no correlation between the number of miRNA genes in a given family and the time of emergence of the family (MIR-2 family, which is the one that have more genes, appeared with the protostomes, whereas there are many monogenic miRNA families that emerged with the bilaterians) (Fig. 4). [score:1]
Transposable elements could be one of the sources of the miRNA cluster expansions as we observed on B. germanica Mir-71/Mir-2 cluster. [score:1]
Then, 5 families (8%) have between 2 and 3 genes, 4 families (6%) have between 3 and 5, and only one family (MIR-2) that have between 5 and 16 genes (Supplementary Table S8). [score:1]
In the cluster of Blattella germanica it is remarkable the distance between the second and the third copy of miR-2, where it is inserted a TIGD4 sequence. [score:1]
[1 to 20 of 5 sentences]
18
[+] score: 5
Four microRNA families were affected by multiple matching reads: mir-983, mir-281, mir-276 and mir-2. The first three did not show any differential expression between sexes. [score:3]
We recently characterized sex-biased microRNAs in the parasitic Schistosoma mansoni and reported that one of the microRNA clusters (mir-71/mir-2) has two copies, one in the sexual chromosome with no detectable bias and another copy in an autosome with sex-biased expression. [score:1]
To avoid biases due to multiple matches, the mir-2 family was removed from the subsequent analyses. [score:1]
[1 to 20 of 3 sentences]
19
[+] score: 5
Similarly, miR-2 and miR-7 control signal transduction pathways (notch signalling) in both Drosophila sp and B. mori by targeting HLHmδ, HLHm3, HLHm5, HLHmγ, M4 and TOM [33, 34]. [score:3]
In this specific instance, miR-2a and miR-34 were identified from Helicoverpa armigera and S. litura based on in silico comparative analysis using data set of B. mori. [score:1]
The cluster (sfr-mir-2a, sfr-mir-2b, sfr-mir-2c, sfr-mir-13a, sfr-mir-13b) is distributed over the region, 8161–8774 of scaffold 1973 with a size of 20411bp (Fig. 3B, i), while the other (sfr-mir-10494, sfr-mir-10463, sfr-mir-10471) span over 10636bp region of scaffold 6745. [score:1]
[1 to 20 of 3 sentences]
20
[+] score: 5
Likewise, although unstable PGC transcripts are enriched for miR-1, miR-2a-2 cluster, miR-8, miR-10, miR-11, miR-13b-1 cluster, miR-92a, miR-274, and miR-283 target sites, all of these miRs are expressed in the soma but not in the PGCs [73]. [score:5]
[1 to 20 of 1 sentences]
21
[+] score: 4
These included miR-SPs targeting bantam, miR-1, the K-box family (miR-2b, miR-2c and miR-13b displayed strong phenotypes; miR-2a and miR-13a were flight impaired but fell below our stringent cutoff; ), miR-7, the miR-31 family, miR-34, miR-190, miR-957, miR-986, miR-987 and miR-1001. [score:3]
Supporting this argument, several hits in the viability screen belonged to the K-box family (miR-2a, miR-2b and miR-2c, and miR-13a and miR-13b) and the miR-9 family (miR-9b and miR-9c). [score:1]
[1 to 20 of 2 sentences]
22
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-101-1, dme-mir-1, dme-mir-2a-1, dme-mir-2b-1, dme-mir-2b-2, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-101a, mmu-mir-124-3, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-137, mmu-mir-140, mmu-mir-142a, mmu-mir-155, mmu-mir-10b, mmu-mir-183, mmu-mir-193a, mmu-mir-203, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-183, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-222, hsa-mir-223, dme-mir-133, dme-mir-34, dme-mir-124, dme-mir-79, dme-mir-210, dme-mir-87, mmu-mir-295, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, dme-let-7, dme-mir-307a, dme-mir-2c, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-193a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-27a, mmu-mir-34a, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-10a, mmu-mir-210, mmu-mir-223, mmu-mir-222, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-411, hsa-mir-193b, hsa-mir-411, mmu-mir-193b, hsa-mir-944, dme-mir-193, dme-mir-137, dme-mir-994, mmu-mir-1b, mmu-mir-101c, hsa-mir-203b, mmu-mir-133c, mmu-let-7j, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, mmu-mir-124b
Of note, such 5′-isomiR abundance variation has been previously indicated for the miR-2 family which have five members in fruitfly (7). [score:1]
Besides shifted seeds, many well-conserved 5′-isomiRs with the same or nearly identical seed regions had different arm abundances among the four species, exemplified by miR-124, miR-193, miR-210, miR-2 and miR-87 (Table 3). [score:1]
Similar observations were made for miR-124, miR-137, miR-193, miR-210, miR-2, miR-79 and miR87 across species, with miRNAs following the loop-counting rule having lower arm abundances of 5′-isomiRs. [score:1]
Such variations were also observed for miRNAs conserved only in fruitfly and worm, such as miR-2-3p and miR-87-3p (Table 3). [score:1]
[1 to 20 of 4 sentences]
23
[+] score: 3
The GO analysis revealed that four genes targeted by miR-2 were classified into the autophagy subcategory, including the endogenous autophagosome marker protein microtubule -associated protein 1 light chain 3 (LC3), suggesting that miR-2 had important roles in the autophagy pathway. [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 2
A third wave (CoMod-B) that peaks during ED2, contains MIR-2 miRNAs, which are related to cell differentiation, development, morphogenesis and neurogenesis [28]. [score:2]
[1 to 20 of 1 sentences]
25
[+] score: 2
Importantly, sequences derived from several pri-miRNAs, including Bantam, miR-2 family, miR-11, miR- 33 and miR- 34 were also recovered, thus demonstrating direct interactions between SmD1 and pri-miRNAs (Figs 3C, 5C, 5D and S9; S6 Table). [score:2]
[1 to 20 of 1 sentences]
26
[+] score: 2
In D. melanogaster, the proapoptotic K-box miRNA mir-2, and mir-13 occur jointly. [score:1]
Finally, three copies of ame-mir-2, plus one instance each of ame-mir-13a and ame-mir-71, all occur within intron 3 of GB15727 - a serine/threonine phosphatase lost from Drosophila, but with both vertebrate and more ancient metazoan orthologs. [score:1]
[1 to 20 of 2 sentences]
27
[+] score: 2
This clustering is conserved across protostomes, and it has previously been shown that the mir-2 family underwent various expansions during evolution [130]. [score:1]
Among the former, there are five homologues of mir-2 localized in close proximity to each other and downstream of mir-71. [score:1]
[1 to 20 of 2 sentences]
28
[+] score: 1
Number of reads: Tg-proto-miR-1 (158 reads), Tg-proto-miR-2 (109 reads), Tg-proto-miR-3 (138 reads) and Tg-proto-miR-4 (107 reads). [score:1]
[1 to 20 of 1 sentences]
29
[+] score: 1
Other miRNAs from this paper: dme-mir-1, dme-mir-2a-1, dme-mir-2b-1, dme-mir-2b-2, dme-mir-2c
For chaining, BamHI/XhoI-restricted pre-miR2 -RNAi cassettes were subcloned into pcDNA6.2-GW/EmGFP- SRSF1-miR1 using BglII/XhoI. [score:1]
[1 to 20 of 1 sentences]
30
[+] score: 1
This UTR contains two binding sites for miR-2, which exert strong repression in the developing larval eye (Lai and Posakony 1997). [score:1]
[1 to 20 of 1 sentences]
31
[+] score: 1
Other miRNAs from this paper: dme-mir-2a-1
A cytoplasmic miRNA control (mir2A) is ~2.5 fold enriched in the cytoplasm (Fig.   7b). [score:1]
[1 to 20 of 1 sentences]
32
[+] score: 1
And ten pre-miRNAs also predicted mature parts on the star (*) arm (mir-305, mir-79, let-7, mir-2a-2, mir-8, mir-7, mir-9a, mir-316, mir-34, mir-12). [score:1]
[1 to 20 of 1 sentences]