sort by

102 publications mentioning mmu-mir-23b (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-23b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 204
Taken together, these findings suggest that hypoxia could induce c-Myc expression to inhibit the transcription of miR-23b and miR-27b in neurons, resulting in the upregulation of Apaf-1. C57BL/6 mice were employed in the present study. [score:8]
Our previous study showed that miR-23b and miR-27b in neurons, both of which are encoded by the miR-23b-27b-24–1 cluster, are downregulated during hypoxia, resulting in the upregulation of Apaf-1 and the promotion of apoptosis both in vitro and in vivo [10]. [score:7]
To further determine whether c-Myc could inhibit miR-23b and miR-27b expression in neurons, we placed a c-Myc expression vector into the neurons to elevate the c-Myc protein level (Fig. 3A). [score:7]
The decreased miR-23b/27b expression led to greater expression of their target, the Apaf-1 protein, which enhanced the neuronal cells’ sensitivity to hypoxia -induced apoptosis. [score:7]
We found that c-Myc could directly downregulate the expression of miR-23b and miR-27b at the transcriptional level in mouse neurons. [score:7]
Finally, we showed that elevated c-Myc expression led to an increased Apaf-1 level through suppressing miR-23b-27b expression, and this enhanced neuronal sensitivity to apoptosis. [score:7]
The acute brain injury induced by hypoxia appears to promote the expression of c-Myc and suppress the expression of miR-23b and miR-27b, consequently leading to greater neuronal apoptosis. [score:7]
Therefore, the inversely correlated expression patterns of miR-23b-27b cluster and the c-Myc gene in this mo del indicate that c-Myc might suppress miR-23b and 27b expression in neurons during hypoxia. [score:7]
Knockdown of c-Myc suppresses Apaf-1 through elevating the expression of miR-23b-27b cluster and attenuates neuronal apoptosis induced by hypoxia. [score:6]
Because we demonstrated that c-Myc suppressed the expression of miR-23b and miR-27b, we next tested whether c-Myc could directly bind to the promoter region of miR-23b-27b cluster. [score:6]
The similar expression patterns of the pri-miRNA and mature miRNA indicate that the transcription of the miR-23b-27b cluster is downregulated during hypoxia (Fig. 1A-B). [score:6]
Furthermore, forced knockdown of c-Myc by siRNA could increase the transcription of miR-23b and miR-27b in neurons, whereas a c-Myc overexpression plasmid could inhibit the transcription of miR-23b and miR-27b in neurons. [score:6]
Our previous study showed that miR-23/27 regulates neuronal sensitivity to apoptosis by suppressing Apaf-1 expression [10]. [score:6]
c-Myc downregulates miR-23b and miR-27b expression in cultured neurons at the transcriptional level. [score:6]
To further determine whether the recovered miR-23b and miR-27b expression could regulate the targeting protein Apaf-1, we assessed the protein level of Apaf-1 in neurons treated with c-Myc siRNA and subjected to anaerobic treatment (24 h). [score:6]
Consistent with Gao’s result [24], we found that c-Myc suppressed miR-23b and miR-27b expression, and we identified two binding sites in the miR-23b-27b cluster in primary cultured neurons. [score:5]
The elevated c-Myc level suppressed the expression of miR-23b and miR-27b, and resulted in higher Apaf-1 levels and enhanced sensitivity to apoptosis. [score:5]
In conclusion, these results indicate that knockdown of c-Myc alleviates neuronal apoptosis by enhancing miR-23b and miR-27b and inhibiting Apaf-1 in hypoxia -induced pathological conditions. [score:4]
c-Myc downregulates miR-23b and miR-27b at the transcriptional level. [score:4]
Cortical neurons were transfected with the c-Myc siRNA; 48 h later, the neurons received anaerobic treatment (6 h), and we found that knocking down c-Myc expression restored the miR-23b and miR-27b levels (Fig. 5A-B). [score:4]
To determine whether the miRNAs are regulated at the transcriptional level, we simultaneously examined the expression levels of both mature miR-23b/27b and their primary transcripts. [score:4]
Together, these findings demonstrate that c-Myc negatively regulates the expression of miR-23b and miR-27b in primary cortical neurons. [score:4]
There was no c-Myc binding signal on site 2. This result clearly showed that c-Myc binds directly to the miR-23b-27b cluster locus, providing strong evidence that these miRNAs are directly regulated by this transcription factor. [score:4]
We have reported that mature miR-23b and miR-27b are downregulated during hypoxia [10]. [score:4]
Previous studies have shown that c-Myc differentially regulates miR-23 and miR-27 expression at the transcriptional level in different cell types [24, 25]. [score:4]
In the present study, we observed that the expression levels of the primary transcripts of miR-23b and miR-27b were also significantly lower in the hypoxia group, suggesting that miR-23b and miR-27b may be regulated by transcription factors. [score:4]
We observed that the expression levels of pri-miR-23b/27b were significantly lower in the mouse cortex and primary cortical neurons after hypoxia treatment. [score:3]
c-Myc acts at an E-Box to repress miR-23b and miR-27b expression. [score:3]
Real-time PCR analysis showed that mature the expression of mature and primary form of miR-23b and miR-27b were significantly decreased (Fig. 3B). [score:3]
We show that c-Myc could suppress the transcription of pri-miR-23b/27b, resulting in a lower level of mature miR-23b/27b. [score:3]
B, Quantitative RT-PCR detection of the expression of mature and primary form of miR-23b and miR-27b in primary cortical neurons pre -transfected with siRNA under conditions of normoxia or hypoxia for 6 h (n = 5, one-way ANOVA with Newman-Keuls multiple comparison test, ns, not significant, *** P<0.001). [score:3]
Hypoxia causes increased c-Myc protein expression and decreased miR-23b-27b in mouse cerebral cortex and primary cortical neurons. [score:3]
0120217.g001 Fig 1 A and B, Quantitative RT-PCR detection of the expression of mature and primary form of miR-23b and miR-27b in the cerebral cortices (A) and in primary cultures of cortical neurons (B) under conditions of normoxia or hypoxia for 6 h (n = 4, unpaired t-test, * P < 0.05, ** P < 0.01, *** P<0.001). [score:3]
D, Quantitative RT-PCR detection of the expression of mature and primary form of miR-23b and miR-27b in primary cortical neurons pre -transfected with siRNA (n = 4, unpaired t-test, * P < 0.05). [score:3]
We also generated luciferase reporter constructs covering the potential element-site1, as well as mutation, of the putative promoter region of miR-23b-27b cluster to test the transcriptional regulation by c-Myc. [score:3]
A and B, Quantitative RT-PCR detection of the expression of mature and primary form of miR-23b and miR-27b in the cerebral cortices (A) and in primary cultures of cortical neurons (B) under conditions of normoxia or hypoxia for 6 h (n = 4, unpaired t-test, * P < 0.05, ** P < 0.01, *** P<0.001). [score:3]
B, Quantitative RT-PCR detection of the expression of mature and primary form of miR-23b and miR-27b in primary cortical neurons pre -transfected with plasmids (n = 4, unpaired t-test, ** P < 0.01, and *** P<0.001). [score:3]
We found that the expression of mature and primary form of miR-23b and miR-27b were significantly increased above control levels (Fig. 3D). [score:3]
Whether c-Myc promotes or suppresses miR-23b and miR-27b at the transcriptional level in mouse neurons remains unknown. [score:3]
Knockdown of c-Myc recovers the miR-23b and miR-27b levels decreased by hypoxia. [score:2]
D, c-Myc regulates the promoter of the miR-23b-27b cluster. [score:2]
However, the mechanism by which miR-23b and miR-27b are downregulated by hypoxia has not been investigated. [score:2]
We therefore examined the possible role of c-Myc in regulating miR-23b and miR-27b in our mo del. [score:2]
This result indicates that c-Myc transcriptionally represses miR-23b-27b cluster by binding to the upstream canonical E-box element of miR-23b-27b cluster. [score:1]
Promoter of miR-23b-27b cluster was amplified by PCR from mouse genomic DNA. [score:1]
The probes for pri-miRNAs were made to order and the ID number for pri-miR-23b is Mm03306184_pri and for pri-miR-27b is Mm03306468_pri. [score:1]
Hypoxia treatments decrease the levels of mature miR-23b and miR-27b and their primary transcripts. [score:1]
c-Myc acts on E-Boxes in the promoter of the miR-23b-27b cluster. [score:1]
We found that c-Myc could repress miR-23b and miR-27b at the transcriptional level in primary cortical neurons. [score:1]
The ID number for mature miR-23b is 000400 and for mature miR-27b is 000409. [score:1]
We further identified c-Myc binding sites in the promoter region of the miR-23b-27b cluster. [score:1]
0120217.g004 Fig 4 A, Diagram representing the c-Myc binding sites in the miR-23b-27b cluster promoter region. [score:1]
It has been reported that c-Myc represses miR-23a and miR-23b at the transcriptional level in human P-493B lymphoma cells and PC3 prostate cancer cells [24]. [score:1]
Approximately thirty kilobases of DNA sequence on chromosome 13 upstream of the mir-23b-27b cluster was analyzed for putative c-Myc -binding sites. [score:1]
A, Diagram representing the c-Myc binding sites in the miR-23b-27b cluster promoter region. [score:1]
[1 to 20 of 55 sentences]
2
[+] score: 162
Furthermore, shear stress could upregulate E-Tmod41 expression by suppressing E-Tmod41 -targeting miR-23b-3p and activating the alternative promoter upstream of exon 0. Mouse erythroleukemia (MEL) cell line derived from Friend virus-infected mice were maintained in RPMI 1640 medium containing 10% fetal bovine serum (FBS). [score:10]
Among the down-regulated miRNAs, miR-23b-3p was predicted to target E-Tmod mRNA 3'UTR by TargetScan and Pictar. [score:8]
The data suggest that fluid shear stress downregulated the expression of miR-23b-3p and that miR-23b-3p was an E-Tmod targeting miRNA. [score:8]
The upregulation of E-Tmod41 by shear stress could be mediated by two mechanisms: the inhibition of its targeting miRNA, miR-23b-3p, and the activation of its promoter, P [E0]. [score:8]
The suppression of miR-23b-3p resulted in the upregulation of E-Tmod41 protein expression and contributed to F-actin remo deling in MEL cells (Figs 7 and 8). [score:8]
Overexpression of miR-23b-3p downregulated E-Tmod41 expression and contributed to F-actin cytoskeleton remo deling. [score:8]
Fluid shear stress suppresses the expression of an E-Tmod -targeting miRNA, miR-23b-3p. [score:7]
Knockdown of miR-23b-3p upregulated E-Tmod41 expression and contributed to F-actin cytoskeleton remo deling. [score:7]
Fluid shear stress suppressed the expresson of miR-23b-3p and E-Tmod mRNA 3’UTR is the target of miR-23b-3p. [score:7]
Since miR-23b-3p was shown to be an E-Tmod targeting miRNA, we next examined whether miR-23b-3p could regulate E-Tmod41 expression and thus affect F-actin content in MEL cells. [score:6]
miR-23b-3p was overexpressed or knocked down with mimic or inhibitor (Figs 7A and 8A). [score:6]
Among them, mechanosensitive miR-23b-3p, which was proved to be an E-Tmod targeting miRNA, was found suppressed by shear stress (Fig 6). [score:5]
0136607.g008 Fig 8 (A) The expression of miR-23b-3p in MEL cells transfected with miR-23b-3p inhibitor (100 nM) was verified by quantitative RT-PCR. [score:5]
We noticed that miR-23b was found upregulated by pulsatile shear stress in human umbilical endothelial cells and participated in the regulation of cell proliferation [31]. [score:5]
Quantitative RT-PCR data showed that, in addition to miR-23b-3p, fluid shear stress could also suppress the expression of miR-23b-3p’s host gene, 2010111I01Rik (Fig 6A and 6B). [score:5]
Therefore, the down-regulation of E-Tmod29 is mainly through the regulation of alternative promoters by fluid shear stress but not through miR-23b-3p. [score:5]
miR-23b-3p regulates E-Tmod41 expression and F-actin content in MEL cells. [score:4]
The mutagenesis of potential miR-23b-3p targeting site was introduced by using site-directed mutagenesis kit (Tiangen Biotech. [score:4]
0136607.g006 Fig 6(A, B) The expressions of miR-23b-3p and its host gene, 2010111I01Rik, as detected by microRNA array analysis (A) and quantitative RT-PCR (B). [score:3]
Besides, it should be pointed out that, in our study of miRNA, the protein level of E-Tmod29 was not changed by miR-23b-3p (data not shown), which means E-Tmod41 but not E-Tmod29 is the target of miR-23b-3p. [score:3]
The mimic and inhibitor of miR-23b-3p were purchased from RiboBio (Guangzhou, China). [score:3]
To test whether miR-23b-3p targets E-Tmod, two reporter vectors were constructed with a luciferase-coding sequence followed by wild type or mutant E-Tmod 3’UTR (Fig 6D), which were named as pGL3-E-Tmod 3’UTR and pGL3-E-Tmod 3’UTR mutant, respectively. [score:3]
In addition, miR-23b was found to target many genes that participate in cell cytoskeleton remo deling [33]. [score:3]
MiR-23b was found to directly target p21-activated kinase 2 (PAK2) and increase the phosphorylation of myosin II. [score:3]
Quantitative RT-PCR showed that mRNA level of E-Tmod41 was not changed by miR-23b-3p mimic or inhibitor (Figs 7B and 8B). [score:3]
F-actin was stained in MEL cells transfected with miR-23b-3p mimic or inhibitor. [score:3]
Data showed that miR-23b-3p mimic reduced F-actin content in MEL cells (Fig 7F), while miR-23b-3p inhibitor had the opposite effect (Fig 8F). [score:3]
Fig D. miR-23b-3p has no effect on the expression of its host gene, 2010111I01Rik. [score:3]
Sequence analysis showed that the targeting site of miR-23b-3p on E-Tmod 3’UTR is highly conserved in mammals (Fig 6C). [score:3]
It was reported that miR-23b could enhance the connections between breast cancer cells and that the inhibition of miR-23b enhanced their migration and deformation abilities [32]. [score:3]
Importantly, 2010111I01Rik is not a target of miR-23b-3p (Fig D in S1 File). [score:3]
0136607.g007 Fig 7(A) The expression of miR-23b-3p in MEL cells transfected with miR-23b-3p mimic (100 nM) was verified by quantitative RT-PCR. [score:3]
These studies suggest that miR-23b can regulate cytoskeleton and deformation of cells. [score:2]
There are mechano-sensitive miRNAs, such as miR-126, miR-23b, miR-10a, etc. [score:1]
For miRNA study, pGL3 control vector containing wild type or mutated E-Tmod 3’UTR were co -transfected into MEL cells with miR-23b-3p mimics (50 nM) or control mimics. [score:1]
[1 to 20 of 35 sentences]
3
[+] score: 125
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-92a-1, hsa-mir-92a-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-27b, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-140, mmu-mir-24-1, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, hsa-mir-30c-2, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-200b, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-20a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-92a-2, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-17, mmu-mir-19a, mmu-mir-200c, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-92a-1, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-301a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-196b, mmu-mir-196b, dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, hsa-mir-18b, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-15a-1, dre-mir-15a-2, dre-mir-15b, dre-mir-17a-1, dre-mir-17a-2, dre-mir-18a, dre-mir-18b, dre-mir-18c, dre-mir-19a, dre-mir-20a, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30c, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-130a, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-140, dre-mir-196a-2, dre-mir-196b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-301a, dre-let-7j, hsa-mir-92b, mmu-mir-666, mmu-mir-18b, mmu-mir-92b, mmu-mir-1b, dre-mir-196c, dre-mir-196d, mmu-mir-3074-1, mmu-mir-3074-2, hsa-mir-3074, mmu-mir-133c, mmu-let-7j, mmu-let-7k, dre-mir-24b
As previously described for many clustered miRNAs (Lagos-Quintana et al., 2003; Lim et al., 2003), Mir24.1 had an expression pattern similar to that observed for Mir23b, including expression in the nasal epithelium (Supplemental Figures 3A– C), tongue (Supplemental Figures 3E,F,H,I) and maxillary process epithelium (Supplemental Figure 3D), though expression in the palatal shelf mesenchyme and overlying epithelium (Supplemental Figures 3D,F,H,I) and trigeminal ganglia (Supplemental Figure 3G) was weak. [score:7]
Our analysis of expression and function in zebrafish suggest that mir23b is expressed in the pharyngeal arch mesenchyme and potentially functions to promote proliferation of chondrocytes, such that when overexpressed, ectopic cartilage arises. [score:7]
Potential Mir23b and Mir133b functions and targetsHere we have shown that Mir23b is expressed in the developing face of mouse embryos and in the head of zebrafish embryos and that its overexpression in zebrafish embryos results in ectopic cartilage structures in the viscerocranium. [score:6]
To examine whether the pattern of expression of mir23b and mir133b was also conserved between mouse and zebrafish embryos, we examined expression of both miRNAs in 30–72 hpf embryos. [score:5]
mir23b and mir133b overexpression results in viscerocranial and neurocranial defects in zebrafishTwo potential methods for assessing function of genes in zebrafish are over -expression and gene inactivation. [score:5]
At 30 hpf, mir133b expression was also observed in the head region (around the eye and portions of the brain; Figure 6A), though expression was weaker than that of mir23b. [score:5]
One of the interesting aspects our data analysis (Figure 1) is that Mir27b expression is also present in the developing midface, with its expression mirroring that of Mir23b. [score:5]
miRNA Embryonic age Expression profile mir15a 48 and 72 hpf Midbrain, MHB, notochord mir15b 48 and 72 hpf Midbrain, neurocranium, notochord mir23b 30, 48, and 72 hpf Somites, lens, pharyngeal arches, notochord mir27b 48 and 72 hpf mir30c 48 and 72 hpf Brain, neurocranium, eye, heart mir130a 48 and 72 hpf Brain, gut tube, heart, eye mir133b 30, 48, and 72 hpf Notochord mir301a 48 and 72 hpf Forming cartilage Midbrain, neurocranium, eye, trigeminal ganglia Figure 5 Expression of mir23b in zebrafish embryos. [score:5]
miRNA Embryonic age Expression profile mir15a 48 and 72 hpf Midbrain, MHB, notochord mir15b 48 and 72 hpf Midbrain, neurocranium, notochord mir23b 30, 48, and 72 hpf Somites, lens, pharyngeal arches, notochord mir27b 48 and 72 hpf mir30c 48 and 72 hpf Brain, neurocranium, eye, heart mir130a 48 and 72 hpf Brain, gut tube, heart, eye mir133b 30, 48, and 72 hpf Notochord mir301a 48 and 72 hpf Forming cartilage Midbrain, neurocranium, eye, trigeminal ganglia Figure 5 Expression of mir23b in zebrafish embryos. [score:5]
mir23b and mir27b are separated by less than 200 bp, though it is not clear that their expression is co-regulated. [score:4]
Expression of mir23b and mir133b is conserved in zebrafish facial structuresBased on analysis of mir140 action, miRNA function during facial development is also present in zebrafish embryos. [score:4]
In the fetal mouse liver, the Mir23b cluster regulates cell fate switch between hepatocytes and bile duct cells by regulating expression of Smad3, 4, and 5 and thereby repressing TGF-β signaling (Rogler et al., 2009). [score:4]
Overall, the expression pattern of MiR23b supported our analysis (Figure 1), though it was difficult to assess the qualitative differences in expression between prominences compared to the quantitative differences of miRNA-seq. [score:4]
Here we have shown that Mir23b is expressed in the developing face of mouse embryos and in the head of zebrafish embryos and that its overexpression in zebrafish embryos results in ectopic cartilage structures in the viscerocranium. [score:4]
Further, like the comparison between MiR23b and MiR24.1, expression of MiR206 was much weaker than the expression observed for MiR133b. [score:4]
Our in situ hybridization and overexpression analyses provide evidence that Mir23b and Mir133b are important regulators of craniofacial development. [score:4]
We initially examined miRNA expression in E12.5 mouse embryo using whole mount ISH and LNA probes against Mir23b, Mir24.1, and Mir666 (Supplemental Figure 1). [score:3]
In addition, we have shown that over -expression of mir23b and mir133b results in changes in craniofacial cartilage morphogenesis. [score:3]
MicroRNA-23b cluster microRNAs regulate transforming growth factor-beta/bone morphogenetic protein signaling and liver stem cell differentiation by targeting Smads. [score:3]
Expression of mir23b and mir133b is conserved in zebrafish facial structures. [score:3]
Expression of mir23b was detected in the head and pharyngeal arch mesenchyme (Figure 5A) and in the somitic mesoderm (Figure 5D) at 30 hpf. [score:3]
This is especially true for Mir23b and Mir27b, as while both work concurrently to drive cardiomyocyte development from ES cells in vitro, Mir23b subsequently controls the later beating phenotype of differentiated cells while Mir27b functions to inhibit this event (Chinchilla et al., 2011; Wang et al., 2012). [score:3]
mir23b and mir133b overexpression results in viscerocranial and neurocranial defects in zebrafish. [score:3]
At 48 hpf, mir23b expression was still present in the head and pharyngeal arch mesenchyme while also appearing in the otic vesicle (Figure 5B). [score:3]
The arrow in (F) denotes the epithelium where Mir23b expression begins. [score:2]
In addition, MiR23b was expressed along the palatal shelf epithelium, again starting at the midline of the shelf and continuing on the oral side (Figures 3H,I). [score:2]
Like Mir23b, Mir133b exists in a cluster with Mir206, which had a similar pattern of expression to that of Mir133b. [score:2]
Like MiR23b, MiR133b was also strongly expressed in the craniofacial region at E12.5. [score:2]
When using LNA probes against Mir23b and Mir133b, robust expression was present in a variety of facial structures, though overall background staining on the sections was high (Supplemental Figure 2). [score:2]
Expression of MiR23b and MiR133b in mouse facial structures at E12.5. [score:2]
Potential Mir23b and Mir133b functions and targets. [score:2]
Figure 3Expression of Mir23b in mouse facial structures at E12.5. [score:2]
Thirty-three micrometers of MiR23b duplex (5′—3′), 6.25 μM of MiR133b (5′—3′), and 33 μM of standard control miRNA (5′- CTTACCTCAGTTACAATTTATA -3 duplexed with 5′- TAAATTGTAACTGAGGTAAGAG-3′) were injected into single cell zebrafish embryos and allowed to grow for 6 dpf. [score:1]
In zebrafish, this corresponds to mir23b, mir27d, and mir24.1. [score:1]
Whole-mount in situ hybridization analysis with a digoxigenin-labeled probe against the mir23b transcript at 30–72 hpf. [score:1]
This may indicate roles for Mir23b in regulating either patterning of the NCC-derived mesenchyme or later chondrogenesis. [score:1]
In the viscerocranium, MiR23b duplex injection resulted in aberrant development of Meckel's cartilage and the ceratohyal (Figure 7B). [score:1]
In mouse, Mir23b is part of a miRNA cluster that includes Mir23b, Mir27b, Mir3074.1, and Mir24.1. [score:1]
While Crispr-Cas9 -mediated gene inactivation is underway, we began our analysis of potential function by injecting 1–2 cell zebrafish embryos with duplex RNA for MiR23b and MiR133b examining cartilage development at 6 dpf. [score:1]
[1 to 20 of 39 sentences]
4
[+] score: 60
The association between a reduction in miR-23 expression and an increase in PGC-1α protein content indicates that miR-23 may negatively regulate PGC-1α protein expression. [score:6]
In this study, we found that down-regulation of miR-23 is associated with a significant increase in PGC-1α mRNA expression and protein content in quadriceps of C57Bl/6J male mice three hours following an acute bout of endurance exercise. [score:6]
An acute bout of endurance exercise results in the down-regulation of miR-23 and increases in cellular PGC-1α protein content along with several of its downstream mitochondrial targets. [score:6]
miR-23 expression, a putative regulator of PGC-1α mRNA translation [24], was significantly decreased (84% END vs. [score:6]
We speculate that dysregulation of miR-23 expression may be partly responsible for the etiology of these pathologies, and modulation of miR-23 could be a future therapeutic target for conditions where physical activity is not medically feasible. [score:6]
PGC-1α mRNA expression, protein content and miR-23 expression are normalized to β-2 microglobulin, actin and Rnu6, respectively. [score:5]
PGC-1α (A) mRNA expression and (B) protein content, and (C) miR-23 expression in the quadriceps of C57Bl/6J mice (N = 7/group) 3-hour following an acute bout of END exercise vs. [score:5]
0005610.g001 Figure 1PGC-1α (A) mRNA expression and (B) protein content, and (C) miR-23 expression in the quadriceps of C57Bl/6J mice (N = 7/group) 3-hour following an acute bout of END exercise vs. [score:5]
Linear regression was carried out to define correlation between PGC-1α content and miR-23 expression. [score:3]
The increase in PGC-1α protein content was significantly negatively correlated with decreased expression of miR-23 (R = 0.62; P = 0.032; Figure 1D). [score:3]
During the recovery period following exercise, the decrease in miR-23 may be permissive for an increase in PGC-1α protein, possibly via increased translation or stability of PGC-1α mRNA. [score:3]
PGC-1α content and miR-23 expression following exercise. [score:3]
They identified miR-23 as a putative regulator of PGC-1α protein content. [score:2]
Indeed we observed a significant reduction in miR-23 transcript following acute endurance exercise (Figure 1C) which was significantly correlated with increases in PGC-1α protein content (Figure 1D). [score:1]
[1 to 20 of 14 sentences]
5
[+] score: 43
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
We have recently shown that HDI downregulated the expression of AID and Blimp-1 by upregulating miR-155, miR-181b, and miR-361, which silence Aicda mRNA, and miR-23b, miR-30a, and miR-125b, which silence Prdm1 mRNA, but not miR-19a/b, miR-20a, and miR-25, which are not known to regulate Aicda, Prdm1, or Xbp1 (16). [score:10]
We have further shown that HDI, such as VPA and butyrate, inhibit AID and Blimp1 expression by upregulating miR-155, miR-181b, and miR-361, which silenced AICDA/Aicda mRNA, and miR-23b, miR-30a, and miR-125b, which silenced PRDM1/Prdm1 mRNA (16). [score:8]
In addition to miR-23b, miR-30a, and miR-125b, which, as we showed by qRT-PCR and miRNA-Seq, are upregulated by HDI, several other putative Prdm1 targeting miRNAs, including miR-125a, miR-96, miR-351, miR-30c, miR-182, miR-23a, miR-200b, miR-200c, miR-365, let-7, miR-98, and miR-133, were also significantly increased by HDI. [score:6]
Figure 8The Prdm1 targeting miRNAs miR-23b, miR-125a, miR-351, miR-30a/c/d, miR-182, miR-96, miR-98, miR-200b/c, and miR-365 are upregulated by HDI. [score:6]
We have shown by qRT-PCR that miR-23b, miR-30a, and miR-125b, which silence Blimp-1 by targeting Prdm1 3′ UTR, were significantly upregulated by HDI (16). [score:6]
This likely resulted from increased primary miRNA transcripts, as suggested by the upregulation of pri-miR-23b. [score:4]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
[1 to 20 of 7 sentences]
6
[+] score: 38
Altogether, our data show that the transgenerational upregulation of let-7 and miR-23b in PGCs of VCZ exposed animals was associated with the downregulation of the key PGC factors Lin28 and Blimp1 along three generations. [score:7]
Deregulated miRNAs (let-7, miR-21, miR-23b) and their targets genes (Lin28a/ Lin28b and Blimp1) are involved in PGC specification and development. [score:5]
let-7 and mir-23b also regulate Lin28, which encode a stem cell-expressed RNA binding protein required for PGC development. [score:5]
We found that miR-23b was upregulated in a dosage -dependent manner in PGCs from the three generations of embryos exposed to VCZ (Fig 4A). [score:4]
Our results show that VCZ induces an upregulation of miR-21 and miR-23b in PGCs. [score:4]
a) Relative expression of miR-23b in PGCs of exposed embryos relative to the control embryos. [score:3]
In addition to let-7, Lin28 is also a predicted target of miR-23b. [score:3]
This includes members of the let-7 family and miR-23b, which can regulate Blimp1, a key in the PGC differentiation [22– 24]. [score:2]
In addition to Lin28, let-7 and miR-23b are also potential regulators of Blimp1. [score:2]
miR-23b is a potential regulator of Lin28 and Blimp1, an is also involved in the control of cell migration and adhesion [44], growth arrest [45] and apoptosis [46]. [score:2]
This suggests that miR-23b and miR-21 could participate in the response to VCZ by modulating cell proliferation and migration in germ cells. [score:1]
[1 to 20 of 11 sentences]
7
[+] score: 35
Taken together, we demonstrate for the first time that salivary miRNA are indicative of pancreatic disease and can be used to diagnose unresectable PDAC (hsa-miR-21, hsa-miR-23a, hsa-miR-23b) or pancreatitis (hsa-miR-210). [score:3]
We identified hsa-miR-21, hsa-miR-23a, hsa-miR-23b and miR-29c as being significantly upregulated in saliva of pancreatic cancer patients compared to control, showing sensitivities of 71.4%, 85.7%, 85,7% and 57%, respectively and excellent specificity (100%). [score:3]
We found that these cells and resulting xenografts express high levels of hsa-miR-21, hsa-miR-23a, hsa-miR-23b and hsa-miR-29c (S3 and S4 Tables). [score:3]
In this article, we have identified hsa-miR-21, hsa-miR-23a and hsa-miR-23b that were differently expressed between saliva samples of patients with a malignant tumor and cancer-free patients, with excellent specificity and sensitivity. [score:3]
Interestingly, hsa-miR-23a and hsa-miR23b are overexpressed in the saliva of patients with pancreatic cancer precursor lesions. [score:3]
We found that 4 miRNAs (hsa-miR-21, hsa-miR23a, hsa-miR-23b and hsa-miR-29c) were significantly expressed in saliva from patients with pancreatic cancer (n = 7), while undetectable in the saliva of control patients (n = 4; Wilcoxon test, 0.001< p < 0.03) (Fig 1 and Table 2). [score:3]
While hsa-miR-23a and hsa-miR-23b were highly expressed in human pancreatic cancer cells-derived xenografts, they were barely detectable in saliva in this mo del of tumor-bearing mice. [score:3]
Interestingly, hsa-miR-23b was recently demonstrated to regulate autophagy associated with radioresistance of pancreatic cancer cells [37]. [score:2]
In this pilot study, we found that four salivary miRNAs (hsa-miR-21, hsa-miR-23a, hsa-miR-23b and hsa-miR-29c) successfully segregated PDAC patients from cancer-free donors, while hsa-miR-210 and let-7c indicate pancreatitis and hsa-miR-216 discriminates pancreatitis from cancer. [score:1]
In addition, hsa-miR-23a and hsa-miR-23b are present in the saliva of patients with IPMN. [score:1]
In addition, hsa-miR-21, hsa-miR-23a and hsa-miR-23b were strictly specific to cancer patients, with excellent sensitivity (71.4% and 85.7%, respectively). [score:1]
Of note, hsa-miR-21, hsa-miR23a, hsa-miR-23b and hsa-miR-29c could be detected in the saliva of patients with pancreatitis (Fig 1). [score:1]
On the other hand, salivary hsa-miR-23a, hsa-miR-23b and hsa-miR-29c were detected at low levels in the saliva of PDAC-bearing mice (Fig 2 and S5 Table). [score:1]
Analysis of salivary hsa-miR-21, hsa-miR-23a, hsa-miR-23b and hsa-miR-29c levels and Lucia blood levels in mice xenografted with Mia PACA-2 Lucia cells at the time indicated following tumor induction. [score:1]
Hsa-miR-21, hsa-miR-23a and hsa-miR-23b were found significantly deregulated in the saliva of resectable PDAC patients as compared to healthy control during the discovery phase, but were not further investigated as they didn’t exhibit at least a 4-fold change in expression between the two groups [24]. [score:1]
On the contrary, patients diagnosed with pancreatitis and elevated salivary hsa-miR-21, hsa-miR-23a and hsa-miR-23b, or patients diagnosed with IPMN and elevated salivary hsa-miR-23a and hsa-miR-23b may be at-risk of developing PDAC and may require careful clinical follow-up. [score:1]
Of more than 90 miRNAs tested, 4 were identified as being significantly deregulated in saliva of pancreatic cancer patients compared to control (hsa-miR-21, hsa-miR-23a, hsa-miR-23b and hsa-miR-29c). [score:1]
To our knowledge, we provide herein the first demonstration that hsa-miR-23a and hsa-miR-23b could be detected in the saliva of patients diagnosed with cancer; however, the specificity of both candidate miRNAs for PDAC is still to be demonstrated. [score:1]
We have obtained preliminary results suggesting that hsa-miR-23a and hsa-miR-23b are also be present in saliva from patients diagnosed with IPMN, and could be used for decision making in IPMN management. [score:1]
However, our study tends to indicate that hsa-miR-21, hsa-miR-23a and hsa-miR-23b are present in the saliva of patients with pancreatitis, while hsa-miR-210 is detected in the saliva of a fraction of patients with PDAC. [score:1]
[1 to 20 of 20 sentences]
8
[+] score: 31
Description miR-451[39] Upregulated in heart due to ischemia miR-22[40] Elevated serum levels in patients with stablechronic systolic heart failure miR-133[41] Downregulated in transverse aortic constrictionand isoproterenol -induced hypertrophy miR-709[42] Upregulated in rat heart four weeks after chronicdoxorubicin treatment miR-126[43] Association with outcome of ischemic andnonischemic cardiomyopathy in patients withchronic heart failure miR-30[44] Inversely related to CTGF in two rodent mo delsof heart disease, and human pathological leftventricular hypertrophy miR-29[45] Downregulated in the heart region adjacent toan infarct miR-143[46] Molecular key to switching of the vascular smoothmuscle cell phenotype that plays a critical role incardiovascular disease pathogenesis miR-24[47] Regulates cardiac fibrosis after myocardial infarction miR-23[48] Upregulated during cardiac hypertrophy miR-378[49] Cardiac hypertrophy control miR-125[50] Important regulator of hESC differentiation to cardiacmuscle(potential therapeutic application) miR-675[51] Elevated in plasma of heart failure patients let-7[52] Aberrant expression of let-7 members incardiovascular disease miR-16[53] Circulating prognostic biomarker in critical limbischemia miR-26[54] Downregulated in a rat cardiac hypertrophy mo del miR-669[55] Prevents skeletal muscle differentiation in postnatalcardiac progenitors To further confirm biological suitability of the identified miRNAs, we examined KEGG pathway enrichment using miRNA target genes (see ). [score:31]
[1 to 20 of 1 sentences]
9
[+] score: 30
Table 1 The role of miRNAs in autoimmune diseases miRNA Predicted/Identified targets Function Related diseases miR-22 IRF8Enhances CD11c [+]CD11b [+]B220 [−] cDC generation at the expense of pDCs miR-142 IRF8Plays a pivotal role in the maintenance of CD4 [+] DCs miR-142-3p IL-6 Specifically inhibits IL-6 expression by moDC MS miR-21 IL-12p35, Wnt1 Negatively regulates the production of IL-12 by moDC; negatively regulate the development of moDC SLE, IBD, UC, MS miR-10a IL-12/IL-23p40 Suppress the production of IL-12 and IL-23 by moDC SLE miR-148/152 Calcium/Calmodulin- dependent protein kinase IIa Suppress the production of IL-12 and IL-6 SLE miR-23b Notch1, NF-κB Inhibits the production of IL-12 while promotes IL-10 production UC miR-155 SOCS1, SHIP1, TAB2 Positively regulates the production of several pro-inflammatory cytokines including IL-6, IL-23, IL-12, and TNF-α RA, IBD miR-146a IRAK1, TRAF6 Negatively regulates TLR4-NF-κB pathway in monocytes RA, SLE, IBD miR-34a JAG1 Negatively regulates the development of moDC MS miR-223 C/EBPβNegatively regulates LCs -mediated antigen-specific CD8 [+] T cell proliferation, production of inflammatory cytokine TNFα, IL-1β, and IL-23 by intestinal DCs. [score:25]
For example, miR-148/152 suppressed IL-12 as well as IL-6 production; miR-23b suppressed IL-12 production while enhancing IL-10 production (Liu et al., 2010). [score:5]
[1 to 20 of 2 sentences]
10
[+] score: 29
Other miRNAs from this paper: mmu-mir-23a
Consistent with these observations, the developmental expression pattern of miR-23 in vivo is reciprocal to that of the lamin B1 [26, 91]. [score:4]
Likewise, identification of upstream enhancer/repressor elements that can modulate miRNA expression and additional downstream effectors of lamin B1 and miR-23 may provide novel insights into the mechanisms of oligodendrocyte development, myelin formation, and maintenance. [score:4]
Importantly, the adverse effect of LMNB1 overexpression in oligodendrocytes can be abrogated by miR-23, suggesting that it may be a negative regulator of lamin B1 [26]. [score:4]
miRNA-23 (miR-23) is among the most abundant miRNAs in oligodendrocytes [85, 86] and is able to counteract the expression of Lmnb1[26, 57]. [score:3]
In the presence of excess miR-23 in cell culture, a greater proportion of cells express mature markers of oligodendrocytes that are accompanied by multipolar morphological appearance and increased levels of mature myelin proteins, indicating that miR-23 can enhance differentiation. [score:3]
MiRNA-23 regulates myelination through multiple targets including LMNB1. [score:3]
The in vivo effects of miR-23 on oligodendrocyte differentiation and myelin formation in the CNS were validated by transgenic mice overexpressing mmu-miR-23a driven by an oligodendrocyte specific promoter [2’ , 3’-cyclic ucleotide 3’-phophodiesterase (Cnp)] [91]. [score:3]
In addition, miR-23 can also enhance oligodendrocyte development through other lamin B1 independent pathways such as PTEN/Akt/mTOR. [score:2]
Importantly, the adverse effect of lamin B1 on oligodendrocyte cells can be abrogated by miR-23 as a negative regulator of lamin B1 [26]. [score:2]
Moreover, we discuss the emerging role of non-coding RNAs (ncRNAs) in modulating gene networks, specifically investigating miR-23 as a potential target for the treatment of ADLD and other demyelinating disorders. [score:1]
[1 to 20 of 10 sentences]
11
[+] score: 28
From the miRNA database, we also observed that TWEAK down-regulates miRNAs that are targeting proliferation and remo deling of muscles (miR-107), matrix metalloprotease such as aggrecanase-2 (miR-192), adamtsl-3 (miR-199-3p), and genes involved in increasing cell growth and proliferation, and microtubule -associated proteins (miR-23b) (Table 3). [score:6]
Some of the important miRs with known/putative targets and differentially regulated by TWEAK are presented in Figure 3. Our results showed that TWEAK reduced the expression of muscle-specific miR-1, miR-133a, miR-133b and miR-206 in addition to several other miRs including miR-27, miR-23, miR-93, miR-199, miR-107, and miR-192 (Figure 3A). [score:6]
miR-148b −2.6183 decrease apoptosis miR-152 −2.3341 Increase cell growth miR-17 −6.2545 Bcl2, N-myc miR-181c −3.5756 proliferation and remo deling of muscles miR-190b −2.2 Binds to Ubiquitin-specific protease 46, increase cell growth miR-192 −2.4871 Increase cell growth miR-199a-3p −1.9 Activin receptor IIA, Map3k4 miR-218-1 −2.2887 Increase cell growth miR-23b −2.1623 Increase Cell growth, proliferation miR-26a −2.4565 decrease proapoptotic signaling miR-27a −2.7 Ubiquitin-conjugating enzyme E2N miR-27b −3 Ubiquitin-conjugating enzyme E2N miR-296-3p −7.3378 Increase cell growth, decrease apoptosis miR-322 8.7 Hydroxysteroid (17-beta) dehydrogenase 7 miR-455 129.249 Up-regulated brown adipocyte differentiation miR-470 3.2 TGFB -induced factor homeobox 1 miR-715 18.25 Fucosyltransferase 1 miR-7a −6.2174 Increase cell growth, decrease apoptosis miR-93 −48.423 Map3k14 (NIK) miR-98 1.8 Tripartite motif-containing 6, insulin-like growth factor 2 mRNA binding protein 1 A) C2C12 myotubes were treated with 10ng/ml of TWEAK for 18h following isolation of total RNA enriched with small RNAs. [score:4]
Low-density miRNA array of TWEAK -treated C2C12 myotubes showed down-regulation of miR-1, miR-133a, miR-133b, miR-206, miR-27, miR-23, miR-93, miR-199, miR-107, and miR-192. [score:4]
In addition to MyomiRs, TWEAK also down-regulated a few more miRNAs such as miR-27a and b, miR-93, miR-199a-3p, miR-107, miR-192, and miR-23b (Fig. 5A). [score:4]
miR-148b −2.6183 decrease apoptosis miR-152 −2.3341 Increase cell growth miR-17 −6.2545 Bcl2, N-myc miR-181c −3.5756 proliferation and remo deling of muscles miR-190b −2.2 Binds to Ubiquitin-specific protease 46, increase cell growth miR-192 −2.4871 Increase cell growth miR-199a-3p −1.9 Activin receptor IIA, Map3k4 miR-218-1 −2.2887 Increase cell growth miR-23b −2.1623 Increase Cell growth, proliferation miR-26a −2.4565 decrease proapoptotic signaling miR-27a −2.7 Ubiquitin-conjugating enzyme E2N miR-27b −3 Ubiquitin-conjugating enzyme E2N miR-296-3p −7.3378 Increase cell growth, decrease apoptosis miR-322 8.7 Hydroxysteroid (17-beta) dehydrogenase 7 miR-455 129.249 Up-regulated brown adipocyte differentiation miR-470 3.2 TGFB -induced factor homeobox 1 miR-715 18.25 Fucosyltransferase 1 miR-7a −6.2174 Increase cell growth, decrease apoptosis miR-93 −48.423 Map3k14 (NIK) miR-98 1.8 Tripartite motif-containing 6, insulin-like growth factor 2 mRNA binding protein 1 In order to understand the interaction between different genes, we generated common networks using Ingenuity Pathway Analysis (IPA) software. [score:4]
[1 to 20 of 6 sentences]
12
[+] score: 23
Moreover, a microRNA can regulate the expression of multiple target genes; therefore, the miR-23 target genes that are relevant to osteoblast maturation and BMSC differentiation might be different. [score:8]
In this study, we identified two novel miRNAs, miR-23a, and miR-23b, that are downregulated in the BMSCs of aged vs young mice and humans. [score:4]
[23] Several studies have shown that the activation of miR-23a by NFATc3 regulates cardiac hypertrophy [24] and that miR-23b inhibits autoimmune inflammation. [score:4]
31) are potential target genes of miR-23a or miR-23b. [score:3]
To further investigate the age-related switch in differentiation potential of BMSCs, we observed and identified two important downregulated miRNAs, miR-23a and miR-23b, in the BMSCs of aged mice. [score:2]
miR-23a and miR-23b belong to the same family and have strong similarities in their nucleotide sequences, and importantly, they function as synergistic regulators of BMSC functions. [score:2]
[1 to 20 of 6 sentences]
13
[+] score: 22
The miRNA with the least dysregulated targets was hsa-miR-211 (52 targets) while hsa-miR-23b was the miRNA with the most dysregulated targets (115). [score:9]
MiRTrail identified several deregulated miRNAs that target deregulated mRNAs including miRNAs hsa-miR-23b and hsa-miR-223, which target the highest numbers of deregulated mRNAs and regulate the pathway "basal cell carcinoma". [score:9]
For this analysis, we decided to use the eight miRNAs having more than 80 dysregulated targets (miR-23b [50], miR-223, miR-193b [51], miR-424, miR-20a [52], miR-98, miR-891a, and miR-566), see Figure 2. We left the custom degree constraint at the default of 1 for the subsequent ORA. [score:4]
[1 to 20 of 3 sentences]
14
[+] score: 20
However, miRNA-23b over -expression in untreated villin-hPepT1 mice does not appear to affect Marcksl-1 expression, which is extremely low in non-inflamed intestine (Figure 4C). [score:5]
Together, these results suggest that miRNA-23b expression may play a role in regulating Marcksl-1 during intestinal inflammation. [score:4]
To examine whether miRNA-23b directly targets the 3′UTR of Marcksl-1 mRNA, Marcksl-1 3′UTR was cloned downstream in pEZX vector with neomycin/kanamycin selection with a luciferase reporter gene (Luc-Marcksl-1 3′UTR) (Genecopoeia, Rockville, MD). [score:4]
MiR-23b directly targets the Marcksl-1 3′UTR in macrophages. [score:3]
As controls, Luc-Marcksl-1 3′UTR and miRNA-23b precursor constructs alone transfected in RAW 264.7 cells using Lipofectamine 2000 (Life Technologies, Grand Island, NY) in Opti-MEM reduced serum medium (GIBCO, Life Technologies, Grand Island, NY). [score:1]
MiRNA-23b expression was lower in DSS -treated villin-hPepT1 mice compared to untreated villin-hPepT1 mice. [score:1]
RAW-264.7 cells were grown in 6 well plate (3.3×10 [5]) and Luc-Marcksl-1 3′UTR construct was co -transfected with miRNA-23b precursor. [score:1]
Precursor miRNA-23b cloned in CMV promoter with ampicillin selection (Genecopoeia, Rockville, MD). [score:1]
[1 to 20 of 8 sentences]
15
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-mir-34c, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, mmu-mir-346, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, hsa-mir-381, mmu-mir-375, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-346, hsa-mir-196b, mmu-mir-196b, hsa-mir-18b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, mmu-mir-92b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Two of the six miRNAs showed a trend for a stronger upregulation during white adipocyte differentiation - miR-24-1* and miR-23b. [score:4]
The six miRNAs tending to demonstrate a stronger upregulation during the white adipocyte differentiation included miR-24-1* and miR-23b, members of a recently identified miR-23b cluster. [score:4]
They belong to a recently identified miR-23b cluster shown to be a molecular switch regulating TGFྞ response of liver stem cells during their differentiation [40], and also to be regulated by bone morphogenetic protein-2 (BMP-2) in mesenchymal stem cells differentiating into adipocytes [41]. [score:3]
Another important member of this miR-23b cluster is miR-27b, which has also been shown to play important roles in adipogenesis by impairing differentiation of human adipocytes and targeting PPARγ [43]. [score:3]
The miRNAs targeting Sirt1 include miR-143, miR-23b miR-34c as well as mir-34a [51, 52]. [score:3]
Our results, in combination with these previous observations, suggest that this mechanism might therefore involve miR-24-1 and miR-23b. [score:1]
[1 to 20 of 6 sentences]
16
[+] score: 18
miR-23b expression was observed in most tissues except in the liver and mammary glands. [score:3]
On the other hand, there was no change in miR-23b expression. [score:3]
To mimic in vivo states, EpH4 cells were induced to undergo lactogenic differentiation by DIP treatment for 72 h. Increased expression levels of miR-200a, but not miR-23b, was observed after 48 h and 72 h DIP treatment (Fig. 2C). [score:3]
Mice brain, heart, lung, liver, spleen, kidney, and mammary glands were collected on day 7 of lactation (n = 3 animals), and expression of miR-23b and miR-200a were analyzed by real-time PCR. [score:3]
To confirm the tissue expression of miR-200a and miR-23b (as a control) in mice, we conducted real-time PCR analysis using cDNAs from brain, heart, lung, liver, spleen, kidney, and mammary glands (Fig. 1). [score:3]
0065127.g001 Figure 1 Mice brain, heart, lung, liver, spleen, kidney, and mammary glands were collected on day 7 of lactation (n = 3 animals), and expression of miR-23b and miR-200a were analyzed by real-time PCR. [score:3]
[1 to 20 of 6 sentences]
17
[+] score: 17
Furthermore, miR-207 was upregulated in both chlorpromazine- and Mn [2+] -induced NPA mo dels, and miR-23b-3p was only downregulated in the mo del triggered by promazine -induced NPA. [score:7]
Finally, downregulated miR-23b-3p expression was observed in the murine mo del produced by promazine -induced NPA. [score:6]
The remaining six deregulated miRNAs: let-7e-5p, miR-18a-5p, miR-23b-3p, miR-205-5p, miR-207, and miR-574-3p, which are specific to each of our murine lupus-like mo dels, highlight some differences between them, but also show roles on inflammation and immune disease. [score:4]
[1 to 20 of 3 sentences]
18
[+] score: 17
To this end, studies have shown that miR-23b inhibits TGF-β1 -induced airway smooth muscle proliferation and promotes apoptosis, indicating a potential role of this miRNA in lung functions and diseases that are affected by the menstrual cycle [74– 77]. [score:5]
Finally, we found that miR-23b-3p was downregulated in females exposed to O [3] in non-proestrus stages (i. e., when estrogen levels are low) but not in females exposed in proestrus. [score:4]
In contrast, in females exposed to O [3] in the metestrus (diestrus 1), estrus, and diestrus 2 stages combined, only two miRNAs were found affected (downregulated): miR-23b-3p (log fold change = − 0.330), and miR-30c-5p (log fold change = − 0.328) (Fig.   8). [score:4]
Curiously, the tumor suppressor TP53 and TMED7, a protein involved in TLR mediated responses, were present in the molecular analysis, suggesting a correlation with the regulation of miR-23b-3p and miR-30c-5p as well as important mediators of lung immunity such as members of the TNF family (Fig.   9). [score:4]
[1 to 20 of 4 sentences]
19
[+] score: 14
As shown in the Venn diagram in Fig.   7, notably, 23 of the 28 upregulated miRNAs in DIO + LFD mice (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were downregulated in the DIO mice. [score:7]
Notably, 23 circulating miRNAs (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were significantly downregulated in DIO mice but upregulated in DIO + LFD mice. [score:7]
[1 to 20 of 2 sentences]
20
[+] score: 13
The consensus DE miRs whose expression is anti-correlated with their DE predicted targets (mmu-miR-125a-5p/mmu-miR-125b-5p, mmu-let-7b-5p/mmu-let-7c-5p/mmu-let-7d-5p/mmu-let-7e-5p/mmu-let-7f-5p, mmu-miR-126-3p, mmu-miR-335-5p and mmu-miR-23b-3p) are designated as candidate key regulatory miRs (miRhubs), which may represent major control points in the network-level neutrophil response to S. pneumoniae. [score:6]
A complementary approach using miRHub analysis 37, 38 identified candidate key regulatory miRs based on conserved target sites in DE mRNAs, of which 10 individual miRs are differentially expressed (mmu-miR-125a-5p/mmu-miR-125b-5p, mmu-let-7a-5p/ mmu-let-7c-5p/mmu-let-7d-5p/mmu-let-7e-5p/mmu-let-7f-5p, mmu-miR-126-3p, mmu-miR-335-5p and mmu-miR-23b-3p; see Fig.   6 and Supplementary Tables  8 and 9). [score:6]
7* mmu-miR-29a-3p −1.0 mmu-miR-16-5p 2.0* mmu-miR-23b-3p −2.8* mmu-miR-15a-5p 2.3* mmu-let-7i-5p −1.6* mmu-miR-24-3p −1.5*mmu-miR-19b-3p [a] 1.1 mmu-miR-26b-5p 1.1 mmu-miR-26b-5p −1.1 mmu-let-7i-5p −1.1 mmu-miR-16-5p 1.5*mmu-miR-30a-5p [d] −4.1* mmu-miR-29c-3p −1.1 mmu-let-7d-5p −2.1* mmu-let-7d-5p −3.0* mmu-miR-29c-3p 1.1mmu-miR-107-3p [b] −1.3 mmu-miR-29b-3p −1.2Data were normalized using LVS or RMA. [score:1]
[1 to 20 of 3 sentences]
21
[+] score: 12
In addition, miR-23a, miR-23b, miR-24 and miR-30d were shown to be upregulated in hypoxia [38]. [score:4]
Several other miRNAs also appeared as promising candidates for selective vascular expression, including miR-145, miR-30d, miR-23b and miR-24 (within the dashed lines in Figure 1b). [score:3]
The miRNAs identified in the present study - miR-145, miR-30D, miR-24, miR-23a and miR-23b - are therefore possible targets in future therapeutic strategies. [score:3]
Based on the above described in silico analyses, we chose to further characterize the expression of miR-126-3p (the predominant mature form of this miRNA, hereafter referred to as miR-126), miR-145, miR-30d, miR-23b, miR-24 and miR-23a; the latter being co-transcribed with miR-24 [1]. [score:1]
Many of the miRNAs we identified scored favorably in one or more of these screens, including miR-23a [6- 8, 12], miR-23b [7, 8, 12], miR-24 [7, 8, 12] and miR-126 [6, 8, 12]. [score:1]
[1 to 20 of 5 sentences]
22
[+] score: 12
Our data also documented a statistically significant up-regulation of miR-23b cluster miRNAs (miR-23b, miR-27b, and miR-24) during postnatal aortic development (Supplementary Table S2), consistent with an inhibitory effect of these miRNAs on TGF- signaling. [score:7]
miR-23b cluster miRNAs target several SMAD genes, and were recently shown to be expressed at low levels during hepatic stem-cell differentiation, which in turn allows TGF- signaling and bile duct formation [61]. [score:5]
[1 to 20 of 2 sentences]
23
[+] score: 11
These are miR-23b-5p and miR-205 which function as tumor suppressors in many ways [26, 51], miR-375-3p is well characterized as a valuable marker of disease progression for diagnosis and prognosis [reviewed in 54], and miR-384-5p. [score:3]
To discover the molecular mechanisms through which Runx1, Runx2, and the Runx -targeting miRNAs, miR-23b-5p, miR-139-5p, miR-205-5p, miR-221-3p, miR-375-3p, miR-382-5p, and miR-384-5p, drive prostate tumorigenesis, we interrogated well-accepted bioinformatics tools; DAVID [57, 58] and Ingenuity Pathway Analysis (IPA-www. [score:3]
Consistent with these observations is the fact that miRNAs predicted to target AR, such as miR-23b-5p, miR-181-5p, and miR-205-5p are constitutively reduced in TRAMP prostates. [score:3]
Several of these candidate miRNAs, such as miR-23b-5p [51] and miR-221-3p [52], have a characterized phenotype in PCa and are downregulated in malignant human tissue [53]. [score:2]
[1 to 20 of 4 sentences]
24
[+] score: 10
miR-24 remained significantly downregulated at three time points (days 7, 14 and 28; Fig. 1d), while miR-23b and miR-27b were downregulated only at day 7, supporting independent release of individual miRNAs from the cluster-transcript. [score:7]
Pri-miR-23b, -27b and -24-1 may be transcribed independently from the cluster gene in mice, although pre-miR-23b may be co-transcribed with pre-miR-27b and pre-miR-24-1 (ref. [score:1]
One is intronic (mouse-chr13; human-chr9: miR-23b, miR-27b and miR-24-1) and the second is intergenic (mouse-chr8; human-chr19: miR-23a, miR-27a and miR-24-2) 12. [score:1]
Further, IL-6 has a minor effect on miR-23b levels at 24 h (Supplementary Fig. 7A). [score:1]
[1 to 20 of 4 sentences]
25
[+] score: 10
In contrast, another seven miRNAs (miR-126-3p, miR-23b, miR-27a, miR-29a, miR-29c, miR-451, and miR-690) were significantly up-regulated in the liver but down-regulated in the brain. [score:7]
Fifteen miRNAs were highly expressed in both liver and brain: miR-709, let-7a, let-7f, let-7c, let-7d, miR-26a, let-7b, let-7g, miR-26b, miR-29a, miR-126-3p, miR-23b, miR-30c, miR-16, and miR-23a. [score:3]
[1 to 20 of 2 sentences]
26
[+] score: 10
Wen et al. [35] have reported that miRNA-23b expression is downregulated by and that this miRNA inhibits viral replication via suppression of the structural protein VP1. [score:10]
[1 to 20 of 1 sentences]
27
[+] score: 10
For example, miR-23 and miR-203 have been shown to enhance radiosensitivity by targeting IL8/Stat3 and IL8/AKT signalling pathway, respectively in nasopharyngeal carcinoma [24, 25]; miR-205 has been reported to function as a tumour radiosensitizer by inhibiting DNA repair pathway via down-regulation of ZEB1 and Ubc13 in breast cancer cells [26]; miR-15a/16 can enhance radiation sensitivity of NSCLC cells by targeting the TLR1/NF-κB signalling pathway [27]. [score:10]
[1 to 20 of 1 sentences]
28
[+] score: 9
miR-31, miR-150 and miR-184 have shown to be downregulated in oxygen -induced retinopathy mice mo dels [20]; miR-23~24~27 cluster was upregulated in laser induced CNV mice mo dels [21]. [score:7]
Zhou Q. Gallagher R. Ufret-Vincenty R. Li X. Olson E. N. Wang S. Regulation of angiogenesis and choroidal neovascularization by members of microRNA-23∼27∼24 clusters Proc. [score:2]
[1 to 20 of 2 sentences]
29
[+] score: 9
Other miRNAs from this paper: mmu-mir-27b, mmu-mir-24-1, mmu-mir-23a, mmu-mir-24-2, mmu-mir-27a
The PI3K/Akt pathway can be upregulated by mirn23a targeting the pathway inhibitors Pten (miR-23), and PPP2RSE (regulatory subunit of PP2A, miR-23)[53, 54]. [score:9]
[1 to 20 of 1 sentences]
30
[+] score: 8
Other miRNAs from this paper: mmu-mir-155, mmu-mir-23a
For both target sequences, the following series of shRNAs were created for comparison: N19 – a simple stem-loop design [2], F – a 'frayed' shRNA design employing artificial asymmetry [28], and mi23 – a shRNA utilizing the miR23 loop reported to increase cytoplasmic expression [29, 30]. [score:5]
While we noticed a modest increase in knockdown efficiency by the addition of the miR23 loop at a 10:1 ratio of shRNA to pGL3-MELK, there was no significant increase in efficacy with the miR23 loop at lower molar ratios of shRNA to pGL3-MELK (data not shown) as had been previously reported [30]. [score:2]
As there did not appear to be a reproducible improvement with modified shRNAs (F or miR23), we have utilized a N19 shRNA design for the remainder of this study. [score:1]
[1 to 20 of 3 sentences]
31
[+] score: 8
Previously, we have identified Omp25 induction of miR-21-5p and miR-23b by directly suppressing LPS/R848 -induced IL-12 expression through targeting il12A 3′UTR and il12B 3′UTR, respectively (40). [score:8]
[1 to 20 of 1 sentences]
32
[+] score: 8
Among the 10 most upregulated miRNAs (Supplementary Table 2), miR-16-5p, miR-23b-3p, let-7a-5p, miR-15a-5p, miR-17-5p and miR-93 were identified as the candidate regulators of PDCD4. [score:5]
The resulting plasmid was transfected into the human gastric carcinoma cell line AGS along with pre-miRNAs of miR-16-5p, miR-23b-3p, let-7a-5p, miR-15a-5p, miR-17-5p and miR-93. [score:1]
As a result, luciferase activity was markedly reduced in cells transfected with pre-miR-23b-3p, pre-miR-17-5p or pre-miR-93, while pre-miR-16-5p, pre-let-7a-5p and pre-miR-15a-5p have no influence on the luciferase activity (Supplementary Fig. 1B). [score:1]
These results suggested that miR-23b-3p, miR-17-5p and miR-93 could potentially bind to the 3′-UTR of PDCD4 mRNA transcript. [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 7
In mice, tumor -associated miRNAs were found to modulate the survival and longevity of DC (44), miR-223 was described to negatively regulate and miR-150 to positively regulate the cross-presenting abilities of LC (45, 46), the TGF-β associated miR-27a was reported to inhibit DC -mediated differentiation of Th1 and Th17 cells (47) and in an allergy setting miR-23b was shown to induce tolerogenic DC through inhibition of the Notch1/NF-κB pathway (48). [score:7]
[1 to 20 of 1 sentences]
34
[+] score: 7
Post-transcriptional regulation of mouse mu opioid receptor (MOR1) via its 3' untranslated region: a role for microRNA23b. [score:3]
Additional studies demonstrate altered miRNA expression in CNS tissue following opioid administration; miR-190 (Zheng et al., 2010a), miR-133b (Sanchez-Simon et al., 2010), miR-28, -125b, -150 and -382 (Wang et al., 2011), miR-23b and -339 (Wu et al., 2008, 2009, 2013), miR-339 (Zheng et al., 2012), miR-103 and -107 (Lu et al., 2014), miR-21 and -146a (Strickland et al., 2014), and miR-124 (Qiu et al., 2015). [score:3]
Long-term morphine treatment decreases the association of mu-opioid receptor (MOR1) mRNA with polysomes through miRNA23b. [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 7
Gao et al. revealed that c-Myc transcriptionally represses miR-23a and miR-23b, which function as tumor suppressors, resulting in greater expression of their target protein, mitochondrial glutaminase, in human P-493 B lymphoma cells and PC3 prostate cancer cells [21]. [score:7]
[1 to 20 of 1 sentences]
36
[+] score: 7
The microRNA miR-23b suppresses IL-17 -associated autoimmune inflammation by targeting TAB2, TAB3 and IKK-α. [score:5]
In addition, miR-20b, miR-23b and miR-301a are closely associated with EAE pathogenesis through regulation of factors inducing Th17 generation, such as RORγt, STAT3 (Zhu et al., 2014), TAB2, TAB3, IKK-α (Zhu et al., 2012) and PIAS3 in the IL-6/23-STAT3 pathway (Mycko et al., 2012). [score:2]
[1 to 20 of 2 sentences]
37
[+] score: 7
However expression of miR-23b and miR-27b was highest in the double negative fraction with lowest levels expressed in the T [+] (GFP [+])/Flk1 [+] fraction. [score:5]
Q-RT-PCR was performed with RNA extracted from the isolated fractions to examine the relative levels of mature mirn23a/ mirn23b miRNAs: miR-24, mir-23a, miR23b, miR-27a, and miR-27b (Fig. 7B, 7C). [score:1]
The mirn23b miRNAs, miR-23b, 24–1, and 27b are clustered on mouse chromosome 13 and are embedded in an intron of aminopeptidase O. C) RNA was isolated from the fractions diagrammed in panel A and used to evaluate the relative expression of the mature mirn23a, and mirn23b miRNAs in the fractions. [score:1]
[1 to 20 of 3 sentences]
38
[+] score: 7
Hypermethylation of the VHL promoter in renal cell carcinoma has been correlated with increased HIF1a expression [24], and deletion of miR-23b has been reported to reduce HIF1a and VEGFA expression via its targeting of VHL[25]. [score:7]
[1 to 20 of 1 sentences]
39
[+] score: 7
Herein, we found an upregulation of the miR-23b~27b~24 cluster, thus at variance with the findings observed in primary macrophages, which exhibit rapid decrease miR-27a and miR-27b expression upon murine cytomegalovirus infection (37). [score:6]
Mature miR-27a and miR-27b differ from each other by just one nucleotide and are transcribed from paralog clusters, the intergenic miR-23a~27a~24 cluster (localized in chromosome 9q22) and the intronic miR-23b~27b~24 cluster (localized in chromosome 19p13) (35, 36). [score:1]
[1 to 20 of 2 sentences]
40
[+] score: 7
Noveski et al. determined that miR-23b, miR-32, miR-154 and miR-99 in MArrest and SCOS were up-regulated [42], and we found that these genes were also up-regulated in NOA. [score:7]
[1 to 20 of 1 sentences]
41
[+] score: 6
Other miRNAs from this paper: mmu-mir-125b-2, mmu-mir-23a, mmu-mir-125b-1
Potential therapeutic approach by targeting miR-23 is suggested. [score:3]
Our findings also suggest treatment targeting miR-23 have potential benefit for patients with prostate cancer. [score:3]
[1 to 20 of 2 sentences]
42
[+] score: 6
Other miRNAs from this paper: hsa-mir-23b
Meanwhile, BMAL1 knockout cells express lower amounts of the miRNA-23b/-27b/-24-1 cluster, which targets transforming growth factor beta receptor 2 and Smad proteins [23]. [score:6]
[1 to 20 of 1 sentences]
43
[+] score: 6
In particular miR-23b, miR-199a, and miR-15a displayed increased expression during early AVC development and characterization of target genes suggests that they are involved in regulating epithelial-mesenchymal transition (EMT) signaling pathways [106]. [score:5]
Bonet F. Duenas A. Lopez-Sanchez C. Garcia-Martinez V. Aranega A. E. Franco D. Mir-23b and mir-199a impair epithelial-to-mesenchymal transition during atrioventricular endocardial cushion formation Dev. [score:1]
[1 to 20 of 2 sentences]
44
[+] score: 6
Microarray analysis showed altered expression of some miRNAs in hepatomas such as let-7a, miR-21, miR-23, miR-130, whereas the hepato-specific miR-122a and others were found downregulated in 70% of HCCs and in HCC-derived cell lines [20], [46], [47], as reported in our data (Table 1). [score:6]
[1 to 20 of 1 sentences]
45
[+] score: 6
Other miRNAs from this paper: mmu-mir-21a, mmu-mir-21b, mmu-mir-21c
Chen C. Tang Z. Song Q. Yang M. Shi Q. Weng Y. Downregulated microRNA-23b promotes BMP9 -mediated osteogenesis in C2C12 myoblast cells by targeting Runx2Mol. [score:6]
[1 to 20 of 1 sentences]
46
[+] score: 6
To identify the specific microRNA targeting GSK3 β, we used a neuronal cell line to test the regulatory effects of several potential candidates based on the 3′-untranslated region (3′-UTR) sequence of GSK3 β and previous studies, including microRNA-23b (miR-23b), microRNA-28a (miR-28a), microRNA-221 (miR-221), microRNA-135b (miR-135b), microRNA-101a (miR-101a), microRNA-26a (miR-26a) and microRNA-603 (miR-603). [score:6]
[1 to 20 of 1 sentences]
47
[+] score: 5
NFATs may also control genes encoding signaling molecules as variate as Ca [2+] regulators [inositol 1,4,5-trisphosphate (IP [3]) receptor (IP [3]R), regulator of calcineurin 1 (RCAN1)], growth factors (VEGF, neurotrophins), myelination genes (P0 and Krox-20), glucose regulation genes (insulin, HNF1, PDX, and GLUT2), cell cycle and death regulator/activators [p21 [Waf1], c-Myc, cyclin -dependent kinase 4 (CDK4), B-cell lymphoma 2 (Bcl-2), and cyclins A2, D1, and D2], oncogenes (Wnt, β-catenin), microRNAs (miR-21, miR-23, miR-24, miR-27, miR-125, miR-195, miR-199, and miR-224), and surfactants (sftpa, sftpb, sftpc, and abca3) [9, 65– 74]. [score:5]
[1 to 20 of 1 sentences]
48
[+] score: 5
The miRNA expression profiles were normalized either to reference gene U6 (snRNA) or to the average obtained between miR-23a, miR-23b, and miR-24, whose expression levels are stable under the experimental conditions applied in this study. [score:5]
[1 to 20 of 1 sentences]
49
[+] score: 5
To validate the identified phenotypes, the miRNAs that were down-regulated in clinical samples and Top-40 ranked in the phenotype screen (miR-150, miR-375, miR23b, miR-138, miR-139-5p and miR-9) were subjected to detailed functional analysis using HCT116, HT29, LS174T TR4, DLD1 TR7 and SW480 colon cancer cell lines. [score:4]
miR-150 and miR-23b only reduced the viability of one cell line (DLD1 TR7). [score:1]
[1 to 20 of 2 sentences]
50
[+] score: 5
Interestingly, miRNA-548c-3p, miRNA-509-3p, and miRNA23b-3p were shown to induce significant proliferation of adult rat cardiomyocytes through translational inhibition of (47). [score:5]
[1 to 20 of 1 sentences]
51
[+] score: 5
ZNF91 belongs to a C [2]H [2] zinc finger (ZNF) gene family that is greatly expanded in the primate lineage and known to contain exceptionally abundant target sites for several miRNA families, including miR-23, miR-181 and miR-199 [28]. [score:3]
In particular, a circRNA generated from the ZNF91 locus (circRNA-ZNF91) contains 24 miR-23 sites (Figure  6E), 19 of which were 8-nucleotide sites. [score:1]
miR-23 and miR-296 seed matches are indicated. [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 5
The microRNA miR-23b suppresses IL-17 -associated autoimmune inflammation by targeting TAB2, TAB3 and IKK-α. [score:5]
[1 to 20 of 1 sentences]
53
[+] score: 5
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Another report demonstrates that miR-23 facilitates OL development by negatively regulating lamin B1 (LMNB1), a protein found to repress production of MBP, proteolipid protein 1 (PLP), and myelin oligodendrocyte glycoprotein (MOG) [19]. [score:3]
MiR-23b was also present in high levels during these same stages, although with reduced expression at the OP2 and OP3 stages. [score:2]
[1 to 20 of 2 sentences]
54
[+] score: 5
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-23b, mmu-mir-23a, hsa-mir-23c
For example, it has been previously shown that miR-23 a suppresses the translation of both MAFbx/atrogin-1 and MuRF-1 in a 3_-UTR -dependent manner (Wada et al., 2011). [score:5]
[1 to 20 of 1 sentences]
55
[+] score: 5
Although the p53 transcription factor is known to regulate a number of miRNAs, including miR-34a, miR-23b, miR-26, miR-30, miR-107 and miR-192 [40]– [45], there was very little difference in miRNA expression patterns between tumors derived from p53 wild-type TH- MYCN versus p53 mutant TH- MYCN mice, despite significant differences in tumor phenotype when MYCN drives neuroblastoma in a p53 deficient background [25]. [score:4]
The most significant contribution to PC1 was from miR-10a, miR-30a, miR-30d, let-7f, miR-22 and miR-23b, ranked in order. [score:1]
[1 to 20 of 2 sentences]
56
[+] score: 5
In addition, developmental upregulation of some miRNAs identified in our screen was observed in differentiating oligodendrocytes in vitro, including miR-146, miR-23b, miR-24, and miR-27b in one study [13] and miR-204, miR-27b and miR-100 very recently in another study [20]. [score:5]
[1 to 20 of 1 sentences]
57
[+] score: 4
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-182, mmu-mir-199a-1, mmu-mir-122, mmu-mir-143, mmu-mir-298, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-27a, mmu-mir-31, mmu-mir-98, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-181b-1, mmu-mir-379, mmu-mir-181b-2, mmu-mir-449a, mmu-mir-451a, mmu-mir-466a, mmu-mir-486a, mmu-mir-671, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-491, mmu-mir-700, mmu-mir-500, mmu-mir-18b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-669e, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-669a-10, mmu-mir-669a-11, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-486b, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-145b, mmu-let-7j, mmu-mir-451b, mmu-let-7k, mmu-mir-126b, mmu-mir-466c-3
For example, miR-23a and miR-23b were downregulated in TCDD -treated thymocytes when compared to vehicle -treated thymocytes (Table 1). [score:3]
miR-23a and miR-23b possessed highly omplementary sequence with Fas 3′UTR region (Table 2) whereas, miR-18b and miR-98 showed highly complementary sequence with FasL 3′UTR region (Table 2). [score:1]
[1 to 20 of 2 sentences]
58
[+] score: 4
miR-23b is involved in the mechano-transduction of proliferative signals in endothelial cells [38], [39], whereas miR-218 was recently shown to be a critical regulator of vasculogenesis and heart tube formation during development [39], [40]. [score:3]
[48] miR-23b 30.1±0.4 Response to cardiac injury. [score:1]
[1 to 20 of 2 sentences]
59
[+] score: 4
Black arrow indicates miR-23 inhibitor or Src injection. [score:3]
e The validation of transfection efficiency of miR-23 mimics or Lenti-miR-23a in the mouse spinal cord by qRT-PCR. [score:1]
[1 to 20 of 2 sentences]
60
[+] score: 4
Recently, some specific miRNAs, such as miR-9, miR-23, and miR-29a, were found to participate in the regulation of oligodendrocyte differentiation and myelin maintenance, as well as in the pathogenesis of demyelination-related diseases. [score:4]
[1 to 20 of 1 sentences]
61
[+] score: 4
TAB2 is targeted by miR-23b and miR-155 [32, 70] and while no role for TAB2 has been identified in asthma, it is an adaptor in the TLR/IL-1 signaling cascade and may regulate inflammation in asthma [32]. [score:4]
[1 to 20 of 1 sentences]
62
[+] score: 4
Two other clusters, miR-23a∼27a∼24-2 and mir-23b-27b-24-1, each containing three miRNA genes, were observed in the present study to be up-regulated to different degrees in the old versus young adult heart. [score:4]
[1 to 20 of 1 sentences]
63
[+] score: 4
2015.05.008 25998163 7. An Y miR-23b-3p regulates the chemoresistance of gastric cancer cells by targeting ATG12 and HMGB2Cell Death Dis. [score:4]
[1 to 20 of 1 sentences]
64
[+] score: 4
Other miRNAs from this paper: hsa-mir-23b
For the PDGFA and C9orf3/MIR23b loci, we previously showed that differential methylation coincided with significant changes in expression in aortic samples [9]. [score:3]
As for biological validation, the same 450 k array data from which the grade-CpG profiles were obtained, were previously validated in 15 discovery and 24 validation paired aortic samples [9], including the grade-CpG-harboring genes PDGFA and C9orf3/MIR23b. [score:1]
[1 to 20 of 2 sentences]
65
[+] score: 4
They also found that miR-30c-1, miR-125b-2, miR-23b-27b-24-1 and miR-17 ~ 92 were up-regulated in human macrophages after T. gondii infection, which were associated with the anti-apoptosis responses of the host cells [20]. [score:4]
[1 to 20 of 1 sentences]
66
[+] score: 4
Similarly, miR-23–miR-27–miR-24 cluster overexpression impairs TGF-β -mediated Treg induction (42). [score:3]
Moreover, miRNA (miR-31, miR-17–miR-92, and miR-23–miR-27–miR-24) antagomir treatment of T cells in vitro may be exploited to support iTreg generation, while in vivo treatment may foster pTreg generation. [score:1]
[1 to 20 of 2 sentences]
67
[+] score: 4
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-145b
Furthermore, microRNA-23b and miRNA-145, which are downregulated in many prostate and colorectal cancers, repress SRC and YES activity [31, 32]. [score:4]
[1 to 20 of 1 sentences]
68
[+] score: 3
Again, M [TPP] clearly differed from M1 and M2 activation at the miRNA level: M [TPP] had elevated hsa-miR-125a-5p expression and a lack of M1- (hsa-miR-23b-3p) or M2 -associated microRNAs (miRNAs) (e. g., hsa-miR-125b-5p, hsa-miR-99a-5p). [score:3]
[1 to 20 of 1 sentences]
69
[+] score: 3
Other miRNAs from this paper: mmu-mir-23a
c-MYC, which is known to stimulate cell proliferation, transcriptionally represses miR-23a and miR-23b, which are repressors of GLS1 expression. [score:3]
[1 to 20 of 1 sentences]
70
[+] score: 3
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-29b-1, mmu-mir-30b, mmu-mir-99a, mmu-mir-126a, mmu-mir-132, mmu-mir-141, mmu-mir-181a-2, mmu-mir-185, mmu-mir-193a, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-34c, mmu-let-7d, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-22, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-34a, mmu-mir-200c, mmu-mir-212, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-378a, mmu-mir-451a, mmu-mir-674, mmu-mir-423, mmu-mir-146b, bta-mir-26a-2, bta-let-7f-2, bta-mir-16b, bta-mir-20a, bta-mir-26b, bta-mir-99a, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-193a, bta-let-7d, bta-mir-132, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-423, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-23b, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-34a, bta-mir-141, bta-mir-146b, bta-mir-16a, bta-mir-185, bta-mir-196a-2, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-29b-1, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-2284y-1, mmu-let-7j, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285t, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2284ab, bta-mir-2284ac
Among them, four miRNA (miR-29b-3p, miR-181a-5p, miR-181b-5 and miR-451a-5p) and five miRNA (miR-20a-5p, miR-23b-3p, miR-26b-5p, miR-99a-5p and miR-199a-3p) in the mouse and bovine, respectively, were expressed in the other species with moderate (over 10,000 reads) to high abundance (Table S2). [score:3]
[1 to 20 of 1 sentences]
71
[+] score: 3
Expression levels of five miRNAs [miR-23a (−1.52), miR-23b (−1.58), miR-34 (−1.78), miR-214 (−2.31), and miR-322 (−2.31)] were shown to be significantly decreased in Cmah -null mouse-derived livers by Liver miFinder microRNA PCR array analysis (Figure 3(d)). [score:3]
[1 to 20 of 1 sentences]
72
[+] score: 3
YiRen H Long noncoding RNA MALAT1 regulates autophagy associated chemoresistance via miR-23b-3p sequestration in gastric cancerMol. [score:2]
These suggested that miR-139 was not likely to have canonical miRNA repression on gomafu, which were similar with the mode of miR-23b-3p and MALAT1 in gastric cancer cells [23]. [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 3
Our screen identified five miRNAs, miR-130a-3p, miR-125b-5p, miR-29c-3p, miR-16-5p and miR-23b-3p, whose mimics suppressed FAS -induced apoptosis in primary hepatocytes (Fig. 1h). [score:3]
[1 to 20 of 1 sentences]
74
[+] score: 3
Other miRNAs from this paper: mmu-mir-23a
Dependence of cancer cells on exogenous Gln is driven by Myc protein, which suppresses miR-23a and miR-23b, leading to the induction of glutaminase (GLS) [15]. [score:3]
[1 to 20 of 1 sentences]
75
[+] score: 3
Other miRNAs from this paper: mmu-mir-27b, mmu-mir-23a, mmu-mir-27a
In agreement, simultaneous knockdown of miR-23 and miR-27b in the miR-23/27/24 cluster attenuated neonatal retinal angiogenesis as well as laser -induced choroidal neovascularization [28]. [score:2]
There are similar findings regarding other members of the miR-23/27/24 cluster distinct from miR-27b [57]. [score:1]
[1 to 20 of 2 sentences]
76
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-18a, hsa-mir-21, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, mmu-mir-1a-1, mmu-mir-30a, mmu-mir-99a, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-138-2, hsa-mir-192, mmu-mir-204, mmu-mir-122, hsa-mir-204, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-138-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-103-1, mmu-mir-103-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-26a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-26a-2, hsa-mir-376c, hsa-mir-381, mmu-mir-381, mmu-mir-133a-2, rno-let-7a-1, rno-let-7a-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-18a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-26a, rno-mir-30a, rno-mir-99a, rno-mir-103-2, rno-mir-103-1, rno-mir-122, rno-mir-126a, rno-mir-133a, rno-mir-138-2, rno-mir-138-1, rno-mir-192, rno-mir-204, mmu-mir-411, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-193b, rno-mir-1, mmu-mir-376c, rno-mir-376c, rno-mir-381, hsa-mir-574, hsa-mir-652, hsa-mir-411, bta-mir-26a-2, bta-mir-103-1, bta-mir-16b, bta-mir-18a, bta-mir-21, bta-mir-99a, bta-mir-126, mmu-mir-652, bta-mir-138-2, bta-mir-192, bta-mir-23a, bta-mir-30a, bta-let-7a-1, bta-mir-122, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-204, mmu-mir-193b, mmu-mir-574, rno-mir-411, rno-mir-652, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-1-2, bta-mir-1-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-138-1, bta-mir-193b, bta-mir-26a-1, bta-mir-381, bta-mir-411a, bta-mir-451, bta-mir-9-1, bta-mir-9-2, bta-mir-376c, bta-mir-1388, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-451b, bta-mir-574, bta-mir-652, mmu-mir-21b, mmu-mir-21c, mmu-mir-451b, bta-mir-411b, bta-mir-411c, mmu-mir-126b, rno-mir-193b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In contrast, 15 miRNAs were identified in all tissues and several of them (e. g., miR-23b and -99a) were expressed at high levels in all tissues. [score:3]
[1 to 20 of 1 sentences]
77
[+] score: 3
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-23b, mmu-mir-23a, hsa-mir-23c
LMNB1 is negatively regulated by miR-23, which is also implicated in ADLD variants and it has been proposed that an over representation of lamin B1 mRNA sequesters miR-23 leading to disturbances in myelin protein production [60,66]. [score:2]
Future studies should focus on lamin B1 interactions (e. g. with miR-23) which will form the basis of understand the pathways that do depend on these lamins. [score:1]
[1 to 20 of 2 sentences]
78
[+] score: 3
Other miRNAs from this paper: mmu-mir-27b, mmu-mir-24-1, mmu-mir-23a, mmu-mir-24-2, mmu-mir-27a
Col1a1-miR-23 decoy (N=7 for WT, 11 for 23D); Col1a1-miR-27 decoy (N=8 for WT, 11 for 27D); 24D, Col1a1-miR-24 decoy (N=10 for WT, 7 for 24D). [score:1]
Together, these data support an accelerated differentiation of mature osteoblasts into osteocytes in the mo dels of GOF of the miR-23 cluster. [score:1]
Col1a1-miR-23 decoy (23D) and Col1a1-miR-27 decoy (27D) mice showed a low bone mass phenotype, but not Col1a1-miR-24 decoy (24D) mice. [score:1]
[1 to 20 of 3 sentences]
79
[+] score: 3
Decreased expression of other miRNAs, such as miR-23b, -100, -145, -221 and -222 has been also documented. [score:3]
[1 to 20 of 1 sentences]
80
[+] score: 3
We found that miRNAs with higher expression in WBCs includes different miRNA families: mir-15, mir-17, mir-181, mir-23, mir-27 and mir-29 families. [score:3]
[1 to 20 of 1 sentences]
81
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
adj ssc-miR-21 -1.1788 1.45E-02 1.68E-02 -2.4642 2.07E-04 3.85E-04 ssc-miR-143-3p -1.1940 1.40E-02 1.67E-02 -2.7004 2.27E-05 5.34E-05 ssc-miR-145-3p -1.2289 2.47E-02 2.68E-02 -2.6837 6.34E-04 1.10E-03 ssc-miR-505 -1.3657 2.68E-02 2.82E-02 -2.1577 4.16E-02 4.16E-02 ssc-miR-98 -1.5185 3.46E-03 5.15E-03 -2.8061 7.55E-05 1.55E-04 ssc-miR-139-3p -1.6685 2. 54E-02 2.71E-02 -2.5158 1.69E-02 1.93E-02 ssc-miR-23b -1.7157 3.70E-03 5.42E-03 -2.3687 8.39E-03 1.10E-02 ssc-miR-224 -1.8515 1.41E-02 1.67E-02 -2.5778 1.95E-02 2.19E-02 ssc-miR-23a -1.8753 3.40E-03 5.15E-03 -2.4676 1.00E-02 1.24E-02 ssc-miR-143-5p -1.9243 1.15E-04 2.60E-04 -3.9943 1.25E-09 5.88E-09 ssc-miR-139-5p -2.1198 2.01E-02 2.24E-02 -3. 2644 1.01E-02 1.24E-02 ssc-miR-222 -2.2666 2.58E-07 1.02E-06 -2.6019 2.34E-05 5.35E-05 ssc-miR-671-5p -2.3068 1.15E-02 1.47E-02 -2.7986 3.86E-02 3.92E-02 ssc-miR-9843-3p -2.3507 9.68E-04 1.87E-03 -4.7281 5.90E-05 1.31E-04 ssc-miR-145-5p -2.7059 2.08E-03 3.50E-03 -4.3459 7.18E-05 1.51E-04 ssc-miR-221-5p -2.7136 3.21E-07 1.21E-06 -1.9513 3.02E-02 3. 22E-02 ssc-miR-221-3p -2.9643 8.31E-11 5.47E-10 -2.1967 1.74E-03 2.90E-03 ssc-miR-708-5p -4.0615 2.31E-06 7.60E-06 -2.8238 6.43E-03 8.72E-03 ssc-miR-193a-3p -4.1933 2.39E-07 1.02E-06 -4.3848 2.87E-07 9.18E-07 ssc-miR-193a-5p -4.1933 2.39E-07 1.02E-06 -7.1423 2.32E-12 1.33E-11 ssc-miR-452 -4.3025 5.55E-11 3.99E-10 -2.2057 1.53E-02 1.77E-02 ssc-miR-206 -5.3001 6. 39E-09 3.37E-08 -6.2200 3.10E-09 1.38E-08 10.1371/journal. [score:1]
adj ssc-miR-21 -1.1788 1.45E-02 1.68E-02 -2.4642 2.07E-04 3.85E-04 ssc-miR-143-3p -1.1940 1.40E-02 1.67E-02 -2.7004 2.27E-05 5.34E-05 ssc-miR-145-3p -1.2289 2.47E-02 2.68E-02 -2.6837 6.34E-04 1.10E-03 ssc-miR-505 -1.3657 2.68E-02 2.82E-02 -2.1577 4.16E-02 4.16E-02 ssc-miR-98 -1.5185 3.46E-03 5.15E-03 -2.8061 7.55E-05 1.55E-04 ssc-miR-139-3p -1.6685 2. 54E-02 2.71E-02 -2.5158 1.69E-02 1.93E-02 ssc-miR-23b -1.7157 3.70E-03 5.42E-03 -2.3687 8.39E-03 1.10E-02 ssc-miR-224 -1.8515 1.41E-02 1.67E-02 -2.5778 1.95E-02 2.19E-02 ssc-miR-23a -1.8753 3.40E-03 5.15E-03 -2.4676 1.00E-02 1.24E-02 ssc-miR-143-5p -1.9243 1.15E-04 2.60E-04 -3.9943 1.25E-09 5.88E-09 ssc-miR-139-5p -2.1198 2.01E-02 2.24E-02 -3. 2644 1.01E-02 1.24E-02 ssc-miR-222 -2.2666 2.58E-07 1.02E-06 -2.6019 2.34E-05 5.35E-05 ssc-miR-671-5p -2.3068 1.15E-02 1.47E-02 -2.7986 3.86E-02 3.92E-02 ssc-miR-9843-3p -2.3507 9.68E-04 1.87E-03 -4.7281 5.90E-05 1.31E-04 ssc-miR-145-5p -2.7059 2.08E-03 3.50E-03 -4.3459 7.18E-05 1.51E-04 ssc-miR-221-5p -2.7136 3.21E-07 1.21E-06 -1.9513 3.02E-02 3. 22E-02 ssc-miR-221-3p -2.9643 8.31E-11 5.47E-10 -2.1967 1.74E-03 2.90E-03 ssc-miR-708-5p -4.0615 2.31E-06 7.60E-06 -2.8238 6.43E-03 8.72E-03 ssc-miR-193a-3p -4.1933 2.39E-07 1.02E-06 -4.3848 2.87E-07 9.18E-07 ssc-miR-193a-5p -4.1933 2.39E-07 1.02E-06 -7.1423 2.32E-12 1.33E-11 ssc-miR-452 -4.3025 5.55E-11 3.99E-10 -2.2057 1.53E-02 1.77E-02 ssc-miR-206 -5.3001 6. 39E-09 3.37E-08 -6.2200 3.10E-09 1.38E-08 10.1371/journal. [score:1]
[1 to 20 of 2 sentences]
82
[+] score: 2
However, several additional miRNAs were identified including miR-23b and miR-133b. [score:1]
MicroRNA profiling during craniofacial development: potential roles for Mir23b and Mir133b. [score:1]
[1 to 20 of 2 sentences]
83
[+] score: 2
Zhou Q Regulation of angiogenesis and choroidal neovascularization by members of microRNA-23~27~24 clustersProc. [score:2]
[1 to 20 of 1 sentences]
84
[+] score: 2
Role of microRNA-23b in flow-regulation of Rb phosphorylation and endothelial cell growth. [score:2]
[1 to 20 of 1 sentences]
85
[+] score: 2
An anti-sense sequence of the selected mRNA region followed by a miR23 loop of 10 nucleotides (CTTCCTGTCA) was added at the 5′ end of the above sequences. [score:1]
The miR23 loop facilitates the transfer of the hairpin RNA out of the nucleus. [score:1]
[1 to 20 of 2 sentences]
86
[+] score: 2
We designed and cloned into the pcPURhU6 vector the hairpin-type RNAs with si-6 sequence (pcPURhU6 si-6) with the 19-21 base pair (bp) stems and with various loops: (1) pcPURhU6 si-6 (21 bp)-miR26, (2) si-6 (19 bp) with 9-nt UUCAAGAGA loop [28], (3) si-6 (21 bp) with 9-nt UUCAAGAGA loop, (4) si-6 (21 bp) with 10-nt CUUCCUGUCA (loop from miRNA23), and (5) si-6 (21 bp) with 19-nt UAGUGAAGCCACAGAUGUA (loop from miRNA30) (see Figure 3). [score:1]
Constructs 4 and 5 with miRNA-origin loops miRNA23 and miRNA30, respectively, demonstrated moderate silencing activity, lowering BACE1 mRNA by 27% and 38%, respectively. [score:1]
[1 to 20 of 2 sentences]
87
[+] score: 2
In eQTL hot spots as on chromosome 2 (28–51 Mb), miR-423-3p and miR-23b are clustered in the ‘yellow’ module. [score:1]
On chromosome 2, five miRNAs (miR-26a, mir-291a, miR-423, miR-671 and miR-23b) were mapped between 28–51 Mb (Fig.   2). [score:1]
[1 to 20 of 2 sentences]
88
[+] score: 2
Unspecified Ambion and Exiqon company sequences, which are not as yet entered into the Sanger miR Database [37], were excluded from analysis but are listed in 1 and 2. Other miRs, such as miR-451 and miR-146a (from Ambion microarray data) or miR-21, miR-23 and miR-140 (from Exiqon microarray data) were also left out from further analysis because these miRs exhibited very low levels of expression in the retina compared with the mouse platform. [score:2]
[1 to 20 of 1 sentences]
89
[+] score: 1
In addition, at the same time point three first emerged miRNAs with the three largest numbers of connecting edges were miR-26b, miR-23b, and miR-98 (Table  1B), which all have been reported as relevant miRNAs in cardiac hypertrophy 29– 31. [score:1]
[1 to 20 of 1 sentences]
90
[+] score: 1
PCR analysis was performed using cDNA in triplicate on the 7900 HT Fast Realtime system (Applied Biosystems) for the following primary-miRNA transcripts using Applied Biosystems pri-miRNA gui delines; pri-mir181d (Hs03303910_pri), pri-mir130a (Hs03303108_pri), pri-let7d (Hs03302562_pri) and pri-mir23b (Hs03303058_pri). [score:1]
[1 to 20 of 1 sentences]
91
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, hsa-mir-676, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
54E-0263mmu-miR-221-5pmir-2210.175.616.79E-036.99E-0238mmu-miR-23a-3pmir-230.2210.571.12E-031.92E-0251mmu-miR-23b-3pmir-230.2711.853.70E-034.63E-0213mmu-miR-24-2-5pmir-240.247.131.89E-059.26E-0424mmu-miR-24-3pmir-240.2511.701.98E-045.27E-0358mmu-miR-24-1-5pmir-240.177.725.92E-036.44E-023mmu-miR-26a-5pmir-260.3012.794.71E-071.27E-0447mmu-miR-26b-5pmir-260.299.792.47E-033. [score:1]
[1 to 20 of 1 sentences]
92
[+] score: 1
Our BMAL1 ChIP-PCR experiment in mouse livers validated the physical binding of BMAL1 on the promoters of three selected circadian miRNA primary transcripts, pri-mir-23b~27b~24-1, pri-mir-101a, and pri-mir-378 (Fig. 2b). [score:1]
[1 to 20 of 1 sentences]
93
[+] score: 1
Recent studies provide evidence for the influence of other, less common miRNAs subtypes such as miR-204, miR-669a, miR-669q, miR-23a, and miR-23b in promoting CPC differentiation. [score:1]
[1 to 20 of 1 sentences]
94
[+] score: 1
These miRs can modulate nociception and, for instance, intrathecal delivery of miR-124, miR-103, and miR-23b attenuates inflammatory and neuropathic pain by altering intracellular neuronal, astrocytic, and microglial functions 18– 20. [score:1]
[1 to 20 of 1 sentences]
95
[+] score: 1
In brief, 24 h after infection of miR-23b sponge or NC, HUVECs were seeded on matrigel (BD Biosciences) in a 96-well plate (Sigma). [score:1]
[1 to 20 of 1 sentences]
96
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
Hcy also induces alteration of miRNAs related to tight junctions signaling such as miR-128, miR-132, miR-133, miR-195, miR-3473, miR-19, miR-200, miR-205, miR-214, miR-217, miR-23, miR-26, miR-29, miR-30, miR-31 AND miR-690. [score:1]
[1 to 20 of 1 sentences]
97
[+] score: 1
Additionally, the importance of significant changes in expression of miRs including miR-21, miR-23 and miR-26 observed during the course of this study needs to be further investigated. [score:1]
[1 to 20 of 1 sentences]
98
[+] score: 1
The resulting strain named MIR23 carrying the integrated construct risIs[Pbcat-1::bcat-1::gfp+unc119] has been used for experiments. [score:1]
[1 to 20 of 1 sentences]
99
[+] score: 1
Only 28% of all mGliomiRs (i. e., miR-23) and 21% of all shared miRs increased. [score:1]
[1 to 20 of 1 sentences]
100
[+] score: 1
It appears that some microRNAs, such as miR-10a, miR-19a, and miR-23b are inducible by shear stress and play a protective role in atherosclerosis [166– 168]. [score:1]
[1 to 20 of 1 sentences]