sort by

66 publications mentioning mmu-mir-99a

Open access articles that are associated with the species Mus musculus and mention the gene name mir-99a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 398
We, therefore speculate that the down-regulation of E-cadherin and ZO-1 resulting from over -expression of mir-99a and mir-99b is probably caused through mTOR, because mTOR is a target of mir-99a and mir-99b, and its down-regulation decreases E-cadherin and ZO-1 expression in epithelial phase NMUMG cells (Figure 5D). [score:13]
Conversely, SM-22-α expression was inhibited by the over -expression of mTOR in mesenchymal phase NMUMG cells over -expressing mir-99a and mir-99b (Figure 8C). [score:9]
In this scenario most available mir-99a and mir-99b binding sites would be already “saturated”, thus the TGF-β signaling pathway would be affected only upon by inhibition of mir-99a and mir-99b, and de-saturation of the mirnas binding sites Currently, the target of mir-99a and mir-99b that is responsible for altered SMAD3 phosphorylation is still unknown, and it is unlikely that only one target for mir-99a and mir-99b target is responsible for the altered SMAD3 phosphorylation. [score:9]
Finally, we found that either mTOR down-regulation or mir-99a and mir-99b over -expression, in mesenchymal NMUMG cells resulted in increased expression of SM-22-α (transgelin), a marker of fully differentiated and contractile smooth muscle cells. [score:8]
Interestingly, in epithelial NMUMG cells mir-99a and mir-99b over -expression increased migration, as evidenced by down-regulation of E-cadherin and ZO-1 and increased fibronectin expression. [score:8]
The blockade of mir-99a and mir-99b with LNA-knockdown probes inhibited TGF-β autocrine activity in NMUMG cells through inhibition of Smad3 phosphorylation and consequently inhibited cell migration, increased cell proliferation, yet failed to completely arrest EMT. [score:8]
Mir-99a and mir-99b over -expression in NMUMG cells induced the expression of a marker for mature smooth muscle cells, transgelin (SM-22-α), (Figure 8A) [33] by targeting mTOR gene (Figure 8B). [score:7]
On the other hand, up-regulation of mir-99a and mir-99b in NMUMG cells resulted in down-regulation of E-cadherin and ZO-1, together with increased cell migration and proliferation. [score:7]
However, in mesenchymal phase NMUMG cells, mTOR down-regulation affected cell proliferation and cell cycle concomitantly with the observed up-regulation of mir-99a and mir-99b (Figure 6A,B,C). [score:7]
Some important mir-99a and mir-99b effects such as E-cadherin and ZO-1 down-regulation could be replicated by mTOR down-regulation using a specific sirna. [score:7]
We have validated most of the hypothetical mir-99a and mir-99b target genes identified in silico (Figure 9A), and inhibition of some of those target genes in epithelial phase NMUMG cells may result in the increased cell proliferation and migration that we observed in our experiments. [score:7]
Having determined that either mir-99a and mir-99b over -expression or mTOR knock-down resulted in inhibition of mesenchymal phase NMUMG cell proliferation, we next determined whether mir-99a and mir-99b stimulated the differentiation of mesenchymal phase NMUMG cells into smooth muscle cells. [score:6]
Mir-99a and mir-99b over -expression increased cell motility and down-regulated E-cadherin and ZO-1 in epithelial NMUMG cells. [score:6]
By comparing cell proliferation data obtained after mir-99a and mir-99b over -expression and sirna induced mTOR knock-down, we concluded that mTOR gene is likely the principal target of mir-99a and mir-99b when culturing NMUMG with TGF-β (and therefore mesenchymal cells). [score:6]
NMUMG migration was markedly increased by mir-99a and mir-99b over -expression (Figure 5, B) which also resulted in down-regulation of E-Cadherin and ZO-1 proteins (Figure 5D). [score:6]
Furthermore, using a specific sirna against mTOR gene we were able to replicate many of the effects of the mir-99a and mir-99b over -expression, such as E-cadherin and ZO-1 down-regulation, in epithelial phase NMUMG cells (Figure 5E). [score:6]
In contrast, actin distribution was not affected by mir-99a and mir-99b over -expression (Figure 6A), as shown by concentrated actin expression pattern at the epithelial junction, indicating that NMUMG cells did not undergo EMT. [score:5]
In addition, the identification of mTOR gene as a notable target of mir-99a and mir-99b opens the door to the possibility of therapeutic applications for mir-99a and mir-99b in cancer-like diseases such as Lymphangiomyelomatosis. [score:5]
In addition, TGF-β induced migration and adhesion of NMUMG cells were inhibited upon inhibition of mir-99a and mir-99b, which further confirms that mir-99a and mir-99b activity is necessary for normal TGF-β signaling in mammary gland cells. [score:5]
0031032.g008 Figure 8 (A) Over -expression of mir-99a and mir-99b in mesenchymal phase NMUMG induces expression of SM-22-α. [score:5]
In addition, neither SMAD3 phosphorylation (Figure S2A) nor TGF-β pathway activity (Figure S2B) was affected by mir-99a and mir-99b over -expression either with or without TGF-β, suggesting that mir-99a and mir-99b over -expression increased epithelial NMUMG cells migration in a SMAD3-independent manner. [score:5]
When cells were cultured with TGF-β (and thus are in the mesenchymal phase) mir-99a and mir-99b over -expression resulted in decreased cell proliferation, reduction of cells in s-phase as well as reduced cyclin D1 expression (Figure 7A,B). [score:5]
Oncogene 25 Sun D Lee YS Malhotra A Kim HK Matecic M 2011 miR-99 family of MicroRNAs suppresses the expression of prostate-specific antigen and prostate cancer cell proliferation. [score:5]
Thus, multiple mir-99a and mir-99b targets are likely to impinge on the TGF-β pathway and be responsible for decreased SMAD3 phosphorylation when mir-99a and mir-99b are inhibited. [score:5]
Interestingly we found that mir-99a and mir-99b over -expression in epithelial phase NMUMG cells caused an increase of the fibronectin expression (Figure 6B), which may explain the increased migration observed in Figure 5A. [score:5]
It is also noteworthy that, although mir-99a and mir-99b inhibition altered TGF-β signaling, it did not fully inhibit EMT progression in of NMUMG cells. [score:5]
, suggesting that mir-99a and mir-99b inhibition alters TGF-β pathway signaling by inhibiting phosphorylation of SMAD3. [score:5]
To determine the role of mir-99a and mir-99b in TGF-β signaling and EMT processes we inhibited mir-99a and mir-99b activity with LNA antisense probes or conversely increased their expression in NMUMG cells. [score:5]
0031032.g003 Figure 3 (A,B) Mir-99a and mir-99b inhibition reduces TGF-β activity by inhibiting SMAD3 phosphorylation (* = p<0.05). [score:5]
Mir-99a and mir-99b induced SM-22-α expression in mesenchymal phase NMUMG cells by targetingt mTOR gene. [score:5]
Indeed, when cultured with TGF-β in the presence of mir-99a and mir-99b LNA-antisense probes, NMUMG cells still lost ZO-1 expression and assumed the morphological features of mesenchymal cells as indicated by the pattern of expression of filamentous actin (Figure 4A,B,C). [score:5]
In contrast, in epithelial phase NMUMG cells, mir-99a and mir-99b are targeting at least one gene other than mTOR, whose inhibition is likely responsible for the increased migration and proliferation of epithelial NMUMG cells [28]. [score:5]
By targeting mTOR, mir-99a and mir-99b inhibit proliferation of c-Src-transformed cells and prostate cancer cells. [score:5]
Since the expression of mir-99a and mir-99b increased in NMUMG undergoing EMT (Figure 1C), and the blockade of mir-99a and mir-99b with LNA probes significantly affected mesenchymal phase NMUMG cell behavior, but did not fully arrest TGF-β induced EMT progression, we next determined whether the over -expression of mir-99a and mir-99b in epithelial phase NMUMG cells could induce their transition into mesenchymal cells. [score:5]
Thus, mTOR may be considered as a main functional target of mir-99a and mir-99b among a rather broad network of targets modulating different aspects of cellular function. [score:4]
0031032.g007 Figure 7 (A,B,C) Either over -expression of mir-99a and mir-99b or mTOR knock-down in mesenchymal phase NMUMG cells decreases cell proliferation. [score:4]
On the other hand, when mir-99a and mir-99b were up-regulated, TGF-β signaling pathway and SMAD3 phosphorylation were not altered (Figure S2A,B). [score:4]
Herein, we identified mir-99a and mir-99b as two new mirnas that function as downstream regulators in the TGF-β pathway, based upon the observation that TGF-β increased the expression of both mir-99a and mir-99b in NMUMG cells undergoing EMT. [score:4]
This conclusion is confirmed by the observation that over -expression of mir-99a and mir-99b mimicked many effects of mTOR knock-down with a specific sirna. [score:4]
0031032.g002 Figure 2 (A) with a PAI-promoter luciferase reported plasmid shows that mir-99a and mir-99b blockade inhibits TGF-β pathway. [score:3]
Role of mir-99a and mir-99b inhibition on TGF-β pathway. [score:3]
Mir-99a and mir-99b inhibition alters TGF-β induced SMAD3. [score:3]
NMUMG cells over -expressing mir-99a, mir-99b or a control mirna do not show changes the TGF-β pathway activity. [score:3]
When NMUMG are epithelial, mir-99a and mir-99b stimulate cell proliferate; while they inhibit cell proliferation in mesenchymal NMUMG cells. [score:3]
Cell proliferation of mesenchymal phase NMUMG cells was stimulated by inhibiting mir-99a and mir-99b with LNA-antisense probes (Figure 2B). [score:3]
Taken together, these data suggest that mir-99a and mir-99b could induce mesenchymal phase NMUMG to fully differentiate into smooth muscle cells by targeting the mTOR gene. [score:3]
On the other hand in epithelial phase NMUMG cells (cultured without TGF-β) mir-99a and mir-99b over -expression stimulated cell proliferation (Figure 7D,E). [score:3]
Thus, we concluded that mir-99a and mir-99b must be targeting other genes, in addition to mTOR, to promote migration of epithelial phase NMUMG cells. [score:3]
Identification of mir-99a and mir-99b targets. [score:3]
0031032.g005 Figure 5 (A–B) Over -expression of mir-99a and mir-99b increases the migration of epithelial phase NMUMG cells (* = p<0.05). [score:3]
We speculate that, mir-99a and mir-99b may play key roles in cancer development and progression, as well as in embryonic development by modulating TGF-β signaling. [score:3]
F- actin and ZO-1 staining of untreated (t0) (A) or TGF-β treated NMUMG cells for 24 h (B) or 48 h (C) shows that mir-99a and mir-99 inhibition does not block the transition of epithelial phase NMUMG cells into mesenchymal cells. [score:3]
0031032.g006 Figure 6 (A) F-actin staining of epithelial NMUMG cells shows that actin filaments do not change when mir-99a and mir-99b are over-expressed, indicating that NMUMG cells are still epithelial. [score:3]
Mir-99a and mir-99b have a unique seed sequence, and the number of their predicted targets is quite small: 30 according to PicTar software, http://pictar. [score:3]
However, even though mir-99a and mir-99b blockade inhibited the TGF-β-SMAD3 pathway, TGF-β induced EMT of NMUMG cells was not apparently affected. [score:3]
Mir-99a and mir-99b expression during TGF-β induced EMT of NMUMG cells. [score:3]
Taken together, these results suggest that while mir-99a and mir-99b over -expression was not sufficient to induce completion of EMT in epithelial phase NMUMG cells, it induced some molecular and behavioral changes which are typical of partial EMT. [score:3]
However, Li X et al. (2011) reported that mir-99a and mir-99b are over-expressed in gastric carcinoma [26], which indicates that mir-99a and mir-99b may also act as oncomirs in different cell types. [score:3]
Mir-99a and mir-99b blockade resulted in inhibition of TGF-β pathway activity (Figure 2A) and decreased SMAD3 phosphorylation (Figure 3A,B). [score:3]
TGF-β decreases proliferation of NMUMG cells but mir-99a and mir-99b blockade reversed the inhibitory effect of TGF-β on cells proliferation of NMUMG cells, supporting the hypothesis that mir-99a and mir-99b are necessary for normal TGF-β signaling. [score:3]
These data suggest that mir-99a and mir-99b over -expression affected cell proliferation and cell cycle of NMUMG cells in a phase -dependent manner, depending on whether cells are in the epithelial versus mesenchymal phase. [score:3]
Mir-99a and mir-99b blockade also inhibited TGF-β induced cell migration of human 4T1 cells (Figure S1A,B). [score:3]
Mir-99a and mir-99b over -expression in epithelial NMUMG cells does not induce EMT. [score:3]
We used RT-Real Time PCR to determine whether the expression of mir-99a and mir-99b changes during TGF-β induced EMT in NMUMG cells. [score:3]
Mir-99a and mir-99b inhibition also resulted in reduced cell migration (Figure 2C,D) and less efficient adhesion (Figure 2E) of mesenchymal phase NMUMG cells. [score:3]
Several mir-99a and mir-99b targets are known to affect TGF-β signaling pathway, including mTOR, CTDSPL, CALM, PAM and FOXA1. [score:3]
We have validated multiple targets of mir-99a and mir-99b that are known to be involved in cell proliferation, and differentiation, as well as chromatin remo deling. [score:3]
Interestingly, SMAD3 phosphorylation by TGF-β was inhibited by mir-99a and mir-99b blockade (Figure 3A,B). [score:3]
Mir-99a and mir-99b over -expression in mesenchymal phase NMUMG cells. [score:3]
The expression of mir-99a and mir-99b was stimulated by TGF-β during TGF-β induced EMT in NMUMG cells. [score:3]
Part of the wild type 3′UTR (WT-3′-UTR) and mutated 3′UTR (MUT-3′UTR) of the hypothetical target gene messenger RNA, containing the putative mir-99a and mir-99b binding sites was amplified by PCR and inserted downstream of a luciferase reporter gene in a PGL4.13 plasmid (Promega, San Luis Obispo, CA). [score:3]
Figure S2 Mir-99a and mir-99b over -expression does not affect TGF-β pathway. [score:3]
Mir-99a and mir-99b inhibition does not block TGF-β induced EMT of NMUMG cells. [score:3]
0031032.g004 Figure 4 F- actin and ZO-1 staining of untreated (t0) (A) or TGF-β treated NMUMG cells for 24 h (B) or 48 h (C) shows that mir-99a and mir-99 inhibition does not block the transition of epithelial phase NMUMG cells into mesenchymal cells. [score:3]
We further validated mTOR gene as a target of mir-99a and mir-99b by using approach (Figure 9B). [score:3]
Mir-99a and mir-99b over -expression increases migration of epithelial phase NMUMG cells. [score:3]
As shown in Figure 1C, mir-99a and mir-99b expression was higher in the mesenchymal versus the epithelial phase of NMUMG. [score:3]
Mir-99a and mir-99b expression increased during TGF-β induced EMT in NMUMG cells. [score:3]
Mir-99a and mir-99b targets validation. [score:3]
As mentioned above, the expression of mir-99a and mir-99b increased during TGF-β induced EMT of NMUMG cells. [score:3]
This contradiction can be explained by assuming that mir-99a and mir-99b have strong binding affinities for the mRNA gene targets which then alter TGF-β activity and SMAD3 phosphorylation. [score:3]
mTOR is a target of mir-99a and mir-99b [24], [25]. [score:3]
We used human breast cancer cells 4T1 to validate that mir-99a and mir-99b inhibition negatively affected TGF-β signaling and cell wound-healing abilities (Figure S1A,B). [score:3]
The blockade of mir-99a and mir-99b with LNA-probe indeed inhibited the luciferase activity by about 50% (Figure 2A). [score:3]
Figure S1 Mir-99a and mir-99b blockade inhibits TGF-β induced migration of 4T1 cells. [score:3]
To confirm mir-99a and mir99b targets, a luciferase assay was used. [score:2]
The mutated 3′UTR (MUT-3′-UTR) was obtained by inserting 3 point mutations in the mir-99a and mir-99b binding site, thus destroying the putative mirna/mRNA interaction. [score:2]
Mir-99a and mir-99a are, in turn, positive modulators of the TGF-β pathway itself and also regulators of cell proliferation and migration of both epithelial and mesenchymal phase NMUMG cells. [score:2]
We found that mir-99a and mir-99b are important components of the TGF-β pathway because inhibition of mir-99a and mir-99b negatively affected TGF-β pathway in NMUMG cells as evidenced by a luciferase activity assay. [score:2]
We used a luciferase assay to validate most of the putative mir-99a and mir-99b targets (Figure 9A). [score:2]
In particular, by negatively modulating TGF-β pathway signaling and therefore epithelial and mesenchymal cell plasticity, we speculate that mir-99a and mir-99b may prove to be critical modulators of cancer development and progression. [score:2]
Next, we determined the role of mir-99a and mir-99b on cell cycle and proliferation in epithelial versus mesenchymal phase NMUMG cells. [score:1]
Therefore, we used using specific LNA-probes for mir-99a and mir-99b to determine the effect of mir-99a and mir-99b blockade on the TGF-β signaling pathway and on the EMT process. [score:1]
In our study we have identified mir-99a and mir-99b as two novel downstream mirnas of the TGF-β pathway. [score:1]
Mir-99a and mir-99b share most of their nucleotide sequence and they are located in different chromosomes adjacent to the let-7 family of micrornas (Figure 1D), which suggests an evolutionary chromosome duplication. [score:1]
NMUMG cells were treated with TGF-β for 3 days and RNA was collected for mir-99a and mir-99b quantification. [score:1]
To determine whether the decreased TGF-β activity was accompanied with decreased SMAD3 phosphorylation, NMUMG cells were transfected with mir-99a, mir-99b or control LNA-probe, and pulsed 72 hours later with TGF-β recombinant protein. [score:1]
Next, we determined whether mir-99a and mir-99b blockade affected cell proliferation and migration in mesenchymal phase NMUMG cells. [score:1]
Therefore, we concluded that mir-99a and mir-99b modulate downstream TGF-β signaling in NMUMG cells, affecting cell migration, adhesion and cell proliferation and we also concluded but that mir-99a and mir-99b are not needed for TGF-β induced EMT progression. [score:1]
However, we could not establish whether mir-99a and mir-99b are directly regulated by TGF-β, because the mir-99a and mir-99b promoters have yet to be characterized. [score:1]
Mir-99a and mir-99b are required for normal TGF-β signaling in NMUMG cells. [score:1]
Herein, we focused on determining whether the mir-99a and mir-99b family of mirnas play a functional role in modulating the TGF-β pathway and their role on cell proliferation in epithelial NMUMG cells, which are insensitive to rapamycin, versus mesenchymal NMUMG cells that are instead rapamycin sensitive [28]. [score:1]
Cells were seed in 12 well plates at 50% confluency and the next day transfected with mir-99a, mir-99b or a scrambled mirna at a final concentration of 80 nM. [score:1]
Herein, we found that mir-99a and mir-99b affect cell proliferation in a cell phase dependent manner, depending on whether NMUMG cells are epithelial or mesenchymal. [score:1]
Mir-99a and mir-99b effects on proliferation and cell cycle in NMUMG cells was epithelial or mesenchymal phase -dependent. [score:1]
Mir-99a and mir-99b effects on proliferation and cell cycle in NMUMG cells is epithelial or mesenchymal phase -dependent. [score:1]
In conclusion, we have identified mir-99a and mir-99b as two novel effectors of the TGF-β pathway during EMT in NMUMG cells. [score:1]
Cells were seeded at 50% confluence and the next day transfected with mir-99a, mir-99b or a scrambled mirna precursor (final concentration 80 nM) (Dharmacon) using lipofectamine 2000 (Gibco/Invitrogen, Carlsbad, CA). [score:1]
0031032.g001 Figure 1 NMUMG cells were treated with TGF-β for 3 days and RNA was collected for mir-99a and mir-99b quantification. [score:1]
[1 to 20 of 109 sentences]
2
[+] score: 348
[38] qRT-PCR was performed to determine the relative RNA levels of: (1) miR-99a in 10 cancer tissues (versus normal) to corroborate the array data; (2) miR-99a RNA levels in H1299, H1975 and H1650 NSCLC cell lines (control and transfected with miR-99a); (3) Nanog, Oct3/4, Sox2, Snail and Twist genes in the H1299, H1975 and H1650 NSCLC cell lines expressing miR-99a versus control; (4) Nanog, Oct3/4, Sox2, Snail and Twist genes in H1975 mice tumours formed by miR-99a expression (versus control); (5) Nanog, Oct3/4, Sox2, Snail and Twist genes in 8 cancer tissues: the top 4 with highest miR-99a expression (patients 6, 26, 28 and 48 from series 1) versus the top 4 with the lowest miR-99a expression (patients 14, 18, 36 and 40) from the array (series 1) and (6) miR-99a in 30 cancer tissues to correlate with E2F2 and EMR2 expression. [score:11]
A total of 95 deregulated microRNAs were identified in this second series of 23 patients (48 upregulated and 47 downregulated), of which 29 microRNAs were common with the first series and miR-99a was also confirmed as one of the most downregulated microRNAs (Figure 1a and Supplementary Table 4). [score:11]
[37] We observed that: (1) miR-99a expression inversely correlated with β-catenin expression and (2) E2F2 and EMR2 expression correlated with β-catenin expression in the lung cancer biopsies. [score:9]
This association supports the results obtained from the mice tumours that pointed out that lower expression of E2F2 and EMR2 proteins (due to miR-99a upregulation) favours an epithelial phenotype and downregulation of stemness -associated genes. [score:9]
20, 32, 33 In the current study, we found that all mice tumours formed by miR-99a overexpression showed a fusocellular pattern different from the tumours formed in the control group, supporting a role of miR-99a in EMT inhibition concomitant to a downregulation of stem cell genes. [score:8]
[14] Increased protein expression levels of N-cadherin and decreased E-cadherin expression, as indicators of the EMT, were observed in the mice tumours derived from the control group but not in those originated from miR-99a expression (Figure 5f). [score:7]
The presence of miR-99a was able to inhibit the expression of each wild-type 3′-UTR and the 3′-UTR mutants revealed no effects, indicating that these two proteins are targets of miR-99a (Figure 3c). [score:7]
Of note, lung cancer biopsies with high expression levels of miR-99a showed downregulation of the stem cell genes when compared with biopsies with very low expression. [score:7]
miR-99a suppresses tumourigenicity in vivoTo confirm the tumour-suppressive function of miR-99a in vivo, 1 × 10 [6] miR-99a -expressing H1975 cells and controls were xeno -injected subcutaneously to immunocompromised mice. [score:7]
In order to analyse whether E2F2 or EMR2 expression was able to rescue the suppressive function of miR-99a, coexpression of E2F2 or EMR2 genes was performed concomitantly with miR-99a (Figure 4a). [score:7]
Other EMT-related genes, such as Snail and Twist, were downregulated in the miR-99a -expressing mice tumours and NSCLC cells but not in biopsies (Figures 6a–c). [score:6]
Downregulation of both EMR2 and E2F2 proteins occurred upon expression of miR-99a (Figure 3b and Supplementary Figure 7a). [score:6]
Accordingly, E2F2 but not EMR2 overexpression concomitantly to miR-99a was able to rescue the suppressive function of miR-99a in proliferation of NSCLC cells. [score:5]
In such tumours, miR-99a expression inversely correlated with E2F2 expression. [score:5]
We also found that concomitant expression of E2F2 and EMR2 with miR-99a was able to rescue the inhibitory role of miR-99a on cell migration (Figure 4b). [score:5]
To determine whether E2F2 and/or EMR2 expression was able to inversely correlate with miR-99a expression in patients, RNA was extracted from a group of 30 randomly taken patients out of 119. [score:5]
Overall, a tumour-suppressor function of miR-99a was observed upon expression of miR-99a in all lung cancer cell lines. [score:5]
miR-99a expression targets CSCs. [score:5]
At 72 h after transfection, cells were counted and the cellular lysates were collected for analysis of the protein expression of the selected putative miR-99a targets. [score:5]
Expression of β-catenin inversely correlated with miR-99a expression (Figure 8g). [score:5]
The expression level of E2F2 (but not EMR2) inversely correlated with miR-99a expression (Figure 8). [score:5]
Moreover, changes in protein expression of N-cadherin and E-cadherin were also observed in H1975 cells expressing miR-99a versus control cells (Supplementary Figure 10a). [score:5]
These results support the tumour-suppressor function of miR-99a and its link with the identified targets. [score:5]
[17] We described two novel miR-99a targets, E2F2 and EMR2, representing two oncogenic proteins that could modulate tumour suppression in NSCLCs. [score:5]
To confirm the tumour-suppressive function of miR-99a in vivo, 1 × 10 [6] miR-99a -expressing H1975 cells and controls were xeno -injected subcutaneously to immunocompromised mice. [score:5]
from the qRT-PCR corroborate well the data from the microRNA array for assessing up- or down-regulated miR-99a. [score:4]
The consistency of the downregulation of the stem cell genes (cells, mice tumours and human biopsies) led us to hypothesise that miR-99a could modulate the CSC population. [score:4]
In order to detect cells with a stem cell-like properties, the ‘Side Population’ (SP) discrimination assay has been performed for H1975 cells expressing miR-99a or miR-C. The percentage of the SP detected in control or miR-99a expressing H1975 cells was 2.66% and 1.02%, respectively, suggesting increased stem-like cancer cells (Figure 7a). [score:4]
Downregulation of these proteins by miR-99a provokes apoptosis and cell cycle arrest with a consequent decrease of proliferative capacity. [score:4]
As the CSC-related genes were downregulated in the mice tumours, NSCLC cells and biopsies, we hypothesised that miR-99a might play an important role in acquisition of CSC features in lung tumourigenesis. [score:4]
miR-99a was among of the most downregulated microRNAs (Supplementary Table 2). [score:4]
Proliferation profiles of either stably or transiently miR-99a -expressing cells were similar (Supplementary Figures 4b–d, data not shown). [score:3]
Potential miR-99a targets were predicted and analysed by using publicly available algorithm -based databases, including PicTar (http://pictar. [score:3]
[40] For the stable expression, miR-99a (cloned in miR-V, designated miRV-99a), miR-V and miRV-GFP were included, the latter for checking infection efficiency that in all cases was ~100%. [score:3]
For the miR-99a stable overexpression experiments, premiR-99a was cloned into retroviral vector miR-V that was kindly donated by Dr. [score:3]
Accordingly, a decrease in the number of miR-99a -expressing cells was confirmed by Trypan-blue staining (Supplementary Figure 4e). [score:3]
Bioinformatic search revealed two potential novel targets of miR-99a, EMR2 and E2F2. [score:3]
To validate these proteins as miR-99a targets, the 3′-UTR of each gene was cloned in the pmirGLO vector (Figure 3a). [score:3]
The suppressive function of miR-99a was maintained at physiological levels, as shown by treatment of the above cells with 1:10 and 1:3 diluted miR-99a-viral supernatants (Figure 2 and Supplementary Figures 5 and 6a). [score:3]
[34] Therefore, activation of the EMT can increase CSC number and that miR-99a can inhibit the viability of the CSC population. [score:3]
The levels of miR-99a and target proteins were verified after transfection and just before the injection (Figure 5a, data not shown). [score:3]
In order to verify the results from the array, a total of 10 patients from series 1 were studied for the expression of miR-99a by qRT-PCR (Supplementary Figures 3a and b). [score:3]
For the cell cycle analysis, a fluorescence-activated cell sorting Calibur flow cytometer (FACS Calibur, Becton Dickinson, E0772; BD Biosciences, San Jose, CA, USA) was used to analyse H1299, H1650 and H1975 cells that transiently or stably expressed miR-99a versus negative control. [score:3]
We conclude that the major contributor of the suppressive function of miR-99a in NSCLC cells is E2F2 and the contribution of EMR2 is only partial. [score:3]
To assess the properties of miR-99a, the H1299, H1650 and H1975 cells were transduced with miR-99a mimic (miR-99a) or miR-C (non-target control). [score:3]
Moreover, the effect of an anti-miR-99a was accompanied by an increase of EMR2 and E2F2 protein expressions (Figure 3d and Supplementary Figure 7b). [score:3]
The microscopic examination of tumours revealed a consistent pattern of heterogeneous tumours with fusocellular morphology in the control group in contrast to a more homogeneous epithelial pattern observed in tumours overexpressing miR-99a (Figure 5e). [score:3]
Expression of miR-99a also decreased two times the SP number in H1299 cells (Figure 7b). [score:3]
miR-99a suppresses tumourigenicity by inducing apoptosis and cell cycle arrest. [score:3]
Moreover, miR-99a exerts a tumour-suppressor function not only in CSCs (decreasing their percentage and functionality) but also in parental cells from the lung (decreasing their proliferation capacity). [score:3]
Overall, these data provide compelling evidence of two novel targets for miR-99a. [score:3]
In view of our data, we propose that those lung cancer tumours with high miR-99a levels and corresponding repression of E2F2 and EMR2 would evolve more favourably because of an inhibition of cell proliferation. [score:3]
An increase in apoptosis was detected after miR-99a expression in the three cell lines (Figure 2e). [score:3]
Under these conditions, miR-99a -expressing CSCs formed fewer colonies than those CSCs derived from control cells (Figure 7d). [score:3]
We demonstrate that E2F2 but not EMR2 was able to rescue the suppressive function of miR-99a in H1299, H1650 and H1975 cells (Figure 4a). [score:3]
E2F2 and EMR2 are revealed as two novel miR-99a targets. [score:3]
27, 28 In NSCLC cells, we found that the action of both E2F2 and EMR2 concurred to the suppressor function of miR-99a, thereby supporting a proliferative and pro-oncogenic role for these proteins. [score:3]
Parental cells for each cell line, the control cells (miRV-GFP-infected), and cells that expressed miR-99a (miRV-99a) were grown simultaneously. [score:3]
The miR-99a -expressing cells formed fewer colonies than control cells (Figure 7c). [score:3]
miR-99a suppresses invasion and migration whereas favours adhesion of NSCLC cells. [score:3]
To select the putative miR-99a mRNA targets, we focussed on those detected in more than one miRNA database. [score:3]
To uncover possible mechanisms of the miR-99a -mediated suppression of cell proliferation, cell cycle arrest, apoptosis and senescence were studied. [score:3]
To our knowledge, this is the first study that associates the tumour-suppressor function of miR-99a with E2F2 and EMR2 repression. [score:3]
Moreover, miR-99a overexpression stimulated cell adhesion (Supplementary Figure 8b, data not shown). [score:3]
H1299, H1650 and H1975 cells were transfected with miR-99a versus control and infected with miRV-99a or miRV-GFP and were selected with blasticidin for stable expression. [score:3]
E2F2 and EMR2 overexpression is concomitant to miR-99a. [score:3]
miR-99a suppresses tumourigenicity in vivo. [score:3]
Our results support previous studies reporting a tumour-suppressive function for miR-99a as a general mechanism for other cancer mo dels. [score:3]
Finally, representative lung cancer biopsies were assessed for the SP and miR-99a expression. [score:3]
[40]For the stable expression, miR-99a (cloned in miR-V, designated miRV-99a), miR-V and miRV-GFP were included, the latter for checking infection efficiency that in all cases was ~100%. [score:3]
Concomitant expression of E2F2 or EMR2 with miR-99a restored the effect of sphere formation (Figure 4c). [score:3]
miR-99a -expressing cells were negative for β-galactosidase staining, discarding the possibility of cell senescence (data not shown). [score:3]
Moreover, miR-99a expression sensitised CSCs to the exposure of CDDP but had no effect on the parental H1975 cells (Figure 7f). [score:3]
In particular, CSC sensitisation to CDDP by miR-99a is not only due to the inhibition of E2F2 and/or EMR2 but also due to participation of other proteins. [score:3]
miR-99a expression was verified by qRT-PCR (Figure 2a). [score:3]
This was accompanied by cell cycle arrest in miR-99a -expressing cells as compared with control cells (Figure 2f). [score:2]
A schematic representation of the binding sites of miR-99a with EMR2 and E2F2 is shown (Figure 3a). [score:1]
Tumours formed by miR-99a were smaller than those formed in the control group (Figures 5b–d). [score:1]
Second, NSCLC cells were transfected with miR-99a in nonadherent conditions with a stem cell media. [score:1]
Quantitative real-time PCR was used to determine levels of miR-99a (Hs04231437_s1), miR-205 (ID 000509), Nanog (Hs04399610_g1), Oct3/4 (Hs04260367_gH), Sox2 (Hs01053049_s1), Snail (Hs00161904_m1), Twist (Hs01675818_s1) and housekeeping genes U6 (ID 0001093), TBP (Hs00427620_m1) and IPO8 (Hs00183533_m1) using the Assays-on-Demand Taqman Gene Expression Assays (Applied Biosystems, Foster City, CA, USA) according to the procedure previously described. [score:1]
Conversely, anti-miR-99a was able to reverse proliferative effect of miR-99a (Figure 2d, data not shown). [score:1]
Both the pmirGLO 3′-UTR-E2F2 and pmirGLO 3′-UTR-EMR2 plasmids were transfected in HEK293T cells concomitantly with miR-99a. [score:1]
For the mutant E2F2 miR-99 construct, the seeding sequence was replaced with 5′-GGGAGATATGAATGGTACcaaTG-3′ having recognition site for KpnI restriction enzyme (Figure 3a and Supplementary Table 8). [score:1]
H1975 cells were injected into a total of 16 mice (8 mice were xeno -injected with control microRNA and 8 mice with miR-99a). [score:1]
HEK293T cells were seeded at 1 × 10 [4] cells per well in a 96-well plate and were transfected the following day with Lipofectamine with the following molecules: the synthetic miRNA precursor miR-99a (ID: AM17100; Thermo Fisher Scientific), and negative control miR-C (ID: AM17110; Ambion), Cy3 (ID: AM17020; Thermo Fisher Scientific) and the pmirGLO plasmid (Promega Corporation, Madison, WI, USA) containing the luciferase reporter and also the Renilla gene (control) versus pmirGLO3′-UTR-E2F2 or pmirGLO3′-UTR-EMR2. [score:1]
In order to validate the miR-99a biological effect, the anti-miR-99a was included for comparison (Figures 2g and 8a and Supplementary Figure 9a). [score:1]
H1975 lung cancer cells (1 × 10 [6] cells) were transiently transfected with 100 nM of control microRNA (miR-C, non-silencing control) or miR-99a mimic. [score:1]
Transient transfection of H1299, H1650 and H975 cells using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA) or jetPEI (Polyplus) was performed with the synthetic precursors of miR-99a called pre-miR-99a or miR-99a mimic (designated here as miR-99a) (ID: AM17100; (Thermo Fisher Scientific)), anti-miR-99a (ID: 10719; Thermo Fisher Scientific), a Cy3 dye -labelled negative control (ID: AM17020; Thermo Fisher Scientific) or negative control miR-C (ID: AM17110; Thermo Fisher Scientific). [score:1]
miR-99a levels in the mice tumours were able to persist upon few weeks from the initial transient transfection in H1975 cells (Supplementary Figure 11d). [score:1]
This finding highlights the functional plasticity of miR-99a according to the cellular context. [score:1]
H1299, H1650 and H1975 cells were seeded at 2.5 × 10 [5] and 2.0 × 10 [5] and 1.5 cells × 10 [5] per well, respectively, in 6-well plates and transiently transfected with miR-99a or anti-miR-99a to a final concentration of 80 nM with Lipofectamine according to the manufacturer’s instructions. [score:1]
Transduction with miR-99a decreased proliferation of NSCLC cells (Figures 2b and c and Supplementary Figure 4a). [score:1]
miR-99a reduced the migration and invasion in all three lines (Figure 2g, Supplementary Figures 8a and 9a–b, data not shown). [score:1]
For the preparation of the analysis of the SP cells, H1299 and H1975 cells were transduced using Lipofectamine 2000 concomitantly with Cy3 dye -labelled negative control plus miR-99a versus miR-C (1 : 10 ratio) in order to select only transfected cells. [score:1]
Indeed, cells overexpressing miR-99a have less number of CSCs and less self-renewal ability that are known characteristics of CSCs. [score:1]
miR-99a reduces the proliferative capacity of NSCLC cells. [score:1]
Two previous publications described the ability of miR-99a to reduce migration and invasion in bladder and lung cancer cells. [score:1]
Overall, the above results suggest that miR-99a reverses the phenotype of CSCs by decreasing their tumourigenic potential. [score:1]
Particularly, miR-99a could be a potential therapeutic marker in lung cancer. [score:1]
At third, miR-99a -expressing spheroid CSCs, adherent (parental) or control cells were grown in the presence of cisplatin (CDDP) and cell viability was measured at 48 h post treatment. [score:1]
An inverse correlation with miR-99a level was found (Figure 7h and Supplementary Figure 11c). [score:1]
For the mutant EMR2 miR-99 construct the seeding sequence was replaced with 5′-GTTGTTCTCTAGTTCTAaGcttTT-3′ having recognition site for HindIII restriction enzyme (Figure 3a and Supplementary Table 8). [score:1]
First, NSCLC cells that normally grow in standard adherent conditions were transfected with miR-99a and forced to grow in tridimensional cultures (soft agar), allowing to form colonies during 10–15 days. [score:1]
Moreover, cells infected with miR-99a viral construct in a 1 : 10 dilution were also able to increase apoptosis (Supplementary Figure 6b, data not shown). [score:1]
We found that miR-99a -mediated decrease of cell proliferation elicits a different response depending on the cell line. [score:1]
Approximately 500 nt of the genomic DNA sequence that encodes for primary miR-99a and its natural flanking sequences was selected for PCR amplification, according to a previously described procedure. [score:1]
[1 to 20 of 106 sentences]
3
[+] score: 329
In view of our present results showing decreased miR-99a expression in RCC clinical samples correlating with overall survival of RCC patients and the suppression of tumorigenicity upon upregulation of miR-99a in vitro and in vivo, we propose a hypothesis that miR-99a may be an attractive target for prognostic and therapeutic interventions in RCC. [score:10]
Expression of miR-99a has been proved frequently downregulated in various tumors [14- 20], but the mechanisms underlying the downregulation of miR-99a in cancers remain to be unknown. [score:9]
As shown in Figure 6A, compared with NC transfectants, the expression of p-p70S6K and p-4E-BP1 were downregulated in miR-99a-restored 786–0 cells, which suppressed the activation of sequential signaling cascades involved in synthesis of several G1/S transition-related molecules [21, 22]. [score:7]
Furthermore, siRNA -mediated knockdown of mTOR partially phenocopied the effect of miR-99a overexpression, suggesting that the tumor suppressive role of miR-99a may be mediated primarily through mTOR regulation. [score:7]
Compared with nonmalignant immortalized renal cell line HK-2, the expression of miR-99a was significantly downregulated in RCC cell lines 786–0 and OS-RC-2. As consistent with the results in cell lines, detection of miR-99a in RCC tissues also pointed to a dramatic attenuation of miR-99a expression in 72.5% (29/40) of RCC tissues. [score:7]
Collectively, these results demonstrate for the first time, to our knowledge, that deregulation of miR-99a is involved in the etiology of RCC partially via direct targeting mTOR pathway, which suggests that miR-99a may offer an attractive new target for diagnostic and therapeutic intervention in RCC. [score:7]
It has been reported that overexpression of miR-99a inhibits the growth of prostate cancer cells and decreases the expression of prostate-specific antigen (PSA) [19]. [score:7]
Up to date, there are no studies on the mechanisms of miR-99a downregulation in RCC, so illuminating the mechanisms responsible for downregulation of miR-99a in RCC would be our next study in the future. [score:7]
In addition, We detected the expression of mTOR in tumor xenografts after miR-99a injection by Western blot, we found that intratumoral delivery of synthetic miR-99a makedly suppressed mTOR expression compared with control mice (Figure 4B). [score:6]
MicroRNA-99a (miR-99a), a potential tumor suppressor, is downregulated in several human malignancies. [score:6]
We found that miR-99a was remarkably downregulated in RCC and low expression level of miR-99a was correlated with poor survival of RCC patients. [score:6]
These findings indicate that miR-99a is wi dely downregulated in human cancers, suggesting a potential role of miR-99a as a tumor suppressor. [score:6]
In addition, with the help of a bioinformatic analysis, we found that the mammalian target of rapamicin (mTOR), a key promoter of cell growth, was a direct target of miR-99a in RCC cells. [score:6]
We restored miR-99a in 786–0 cells and found that the expression of p-p70S6K, p-4E-BP1, cyclin D1, cyclin D3 and cyclin E are really downregulated, consistent with the previous reports in hepatocellular carcinoma [17]. [score:6]
To explore the mechanisms by which miR-99a regulates the tumorigenicity of RCC, we performed a bioinformatic search (Targetscan, Pictar and MICROCOSM) for putative targets of miR-99a and found 3 [′]UTR of mTOR containing the highly conserved putative miR-99a binding sites (Figure 5A). [score:6]
In addition, we also fond that mammalian target of rapamycin (mTOR) was a direct target of miR-99a in RCC cells. [score:6]
In conclusion, our study demonstrates for the first time that deregulation of miR-99a is involved in the etiology of RCC partially via direct targeting mTOR pathway. [score:5]
Relative miR-99a level was assessed by real-time qRT-PCR and T/N = 0.5 was chosen as the cut-off point for separating miR-99a high -expression tumors (n = 11; T/N > 0.5) from miR-99a low -expression cases (n = 29; T/N < 0.5). [score:5]
The present study was undertaken to examine the expression of miR-99a in RCC cell lines and tissues, assess the impact of miR-99a on RCC cells and RCC xenograft modle, and identify target genes for miR-99a that might mediate their biological effects. [score:5]
Furthermore, siRNA -mediated knockdown of mTOR partially phenocopied miR-99a restoration suggesting that the tumor suppressive role of miR-99a may be mediated primarily through mTOR regulation. [score:5]
To identify the expression of miR-99a in RCC, we firstly performed real-time qRT-PCR using the renal cell line HK-2 and RCC cell lines 786–0 and OS-RC-2 and found that miR-99a expression in RCC cell lines (786–0 and OS-RC-2) was significantly lower than that in HK-2 (Figure 1A). [score:5]
As consistent with the results in cell lines, the expression of miR-99a was remarkably downregulated in RCC tissues (29/40, 72.5%), compared with matched adjacent non-tumor tissues (Figure 1B). [score:5]
The reduced expression of miR-99a in RCC prompted us to identify whether miR-99a functions as a tumor suppressor. [score:5]
However, the migration and invasion of mTOR-knockdowned 786–0 cells were not decreased, which suggests that the regulation of miR-99a on migration and invasion in RCC cells is not likely related to mTOR inhibition. [score:5]
However, the migration and invasion of mTOR- knockdowned 786–0 cells were not decreased compared with NC transfectants (Figure 7D, E), which suggests that the regulation of miR-99a on migration and invasion in RCC cells is not likely related to mTOR inhibition. [score:4]
To further elucidate mechanisms underlying the tumor suppressive effect of miR-99a, we knockdowned mTOR in 786–0 cells and found that the proliferation and colony formation were decreased and the G1-phase population was increased, similar to the phenotype observed upon miR-99a restoration in 786–0 cells. [score:4]
We found that intratumoral delivery of synthetic miR-99a induced a makedly inhibition of mTOR expression compared with control mice. [score:4]
As mentioned above, miR-99a was remarkably downregulated in RCC cell lines (Figure 1A). [score:4]
To further reveal mechanisms underlying this tumor suppressive effect of miR-99a, we knockdowned mTOR in RCC cells. [score:4]
It has been reported that miR-99a is transcribed from the commonly deleted region at 21q21 in human lung cancers [13], and that miR-99a is downregulated in ovarian carcinoma [14], squamous cell carcinoma of the tongue [15], squamous cell lung carcinoma [16], hepatocellular carcinoma [17], bladder cancer [18], prostate cancer [19] and childhood adrenocortical tumors [20]. [score:4]
Notably, dramatic downregulation of miR-99a was observed in 50% (9/18) cases of low stage (pT1 + pT2) and 91% (20/22) cases of high stage (pT3 + pT4) RCC. [score:4]
It has been reported that downregulation of miR-99a is caused by the activation of Src/Ras-related pathways in human tumors [23]. [score:4]
Taken together, we conclude that the tumor suppressive role of miR-99a may be mediated partially through mTOR pathway regulation. [score:4]
In our study, we found that the regulation of miR-99a on migration and invasion in RCC cells is not likely related to mTOR inhibition. [score:4]
With the help of bioinformatics prediction and sequential experimental demonstration, mTOR was identified as a direct target of miR-99a in RCC. [score:4]
miR-99a is downregulated and correlates with overall survival in renal cell carcinoma. [score:4]
There results suggest that the tumor suppressive role of miR-99a may be mediated partially through mTOR pathway regulation. [score:4]
In this study, we observed that miR-99a was remarkably downregulated in RCC cell lines and tissues and correlated with overall survival of RCC patients. [score:4]
To show that miR-99a participated in the regulation of mTOR expression, we restored miR-99a in RCC cells. [score:4]
Downregulation of miR-99a leading to increase of mTOR and p-mTOR results in the phosphorylation of 4E-BP1 and p70S6K, which in turn activates protein synthesis,promotes cell proliferation and cell clonability and allows progression from the G1 to the S phase of the cell cycle. [score:4]
These findings suggest that miR-99a plays a tumor suppressive role and may be a therapeutic intervention in RCC. [score:3]
Restoration of miR-99a induced G1-phase cell cycle arrest in vitro and dramatically suppressed tumorigenicity of RCC in vitro and in vivo. [score:3]
miR-99a suppresses tumorigenicity in vitro. [score:3]
These results indicate that miR-99a expression possibly correlates with pathologic stage of RCC. [score:3]
Then we detected the expression of cyclin D1, cyclin D3 and cyclin E in miR-99a-restored 786–0 cells. [score:3]
mTOR is a target of miR-99a. [score:3]
These observations suggest that miR-99a restoration suppresses the tumorigenicity of RCC cells in vitro. [score:3]
Figure 1 MiR-99a is downregulated in renal cell carcinoma. [score:3]
In addition, restoration of miR-99a dramatically suppresses tumor cell growth in lung cancer [23]. [score:3]
The RCC cell lines 786-O and OS-RC-2 were transfected with miR-99a mimics to restore the expression of miR-99a. [score:3]
Then we analysed miR-99a expression in clinical samples. [score:3]
miR-99a suppresses tumor growth in vivo. [score:3]
In addition, lower miR-99a expression level in RCC tissues significantly correlated with reduced overall survival in RCC patients. [score:3]
As shown in Figure 1C, lower miR-99a expression level in RCC tissues dramatically correlated with decreased overall survival of RCC patients. [score:3]
Restoration of miR-99a dramatically suppressed RCC cells growth, clonability, migration and invasion as well as induced G1-phase cell cycle arrest in vitro. [score:3]
Moreover, intratumoral delivery of miR-99a could inhibit tumor growth in murine xenograft mo dels of human RCC. [score:3]
We found that restoration of miR-99a suppressed cell growth, clonability, migration and invasion and induced G1-phase cell cycle arrest in vitro. [score:3]
Figure 5 MTOR is a target of miR-99a. [score:3]
Recently, Li et al. reported that restoration of miR-99a significantly inhibits hepatocellular carcinoma cell growth in vitro by inducing the G1 phase cell cycle arrest [17]. [score:3]
Our study suggests that miR-99a may offer an attractive new target for diagnostic and therapeutic intervention in RCC. [score:3]
We therefore examined the expression of miR-99a in RCC cell lines and tissues, and assessed the impact of miR-99a on the tumorigenesis of RCC. [score:3]
Figure 4 MiR-99a suppresses tumor growth in vivo. [score:2]
These characteristics of miR-100 and miR-199a-3p are quite similar to those of miR-99a, indicating that mTOR expression might be regulated redundantly by various closely related miRNAs. [score:2]
The enforced expression of miR-99a in RCC cell lines led to a decrease in mTOR protein and also led to a decrease in phospho-mTOR (p-mTOR) protein, compared with NC transfectants (Figure 5C). [score:2]
CCK-8 assay showed that mir-99a restoration was more potent than their NC transfectants in inhibiting the proliferation of RCC cells. [score:2]
To investigate whether downregulation of miR-99a in RCC tissues correlated with overall survival of RCC patients, we performed statistical analysis with Kaplan-Meier method. [score:2]
Figure 7 MTOR knockdown partially phenocopies miR-99a restoration in renal cell carcinoma cells. [score:2]
At the end of the experiment, intratumoral delivery of synthetic miR-99a induced a specific inhibitory response and robustly interfered with tumor growth compared with control mice. [score:2]
Taken together, these findings showed a direct interaction between miR-99a and mTOR mRNA in RCC cell lines. [score:2]
To ascertain the direct miR-99a-mTOR interaction, we created pGL3-WT-mTOR-3 [′]UTR and pGL3-MUT- mTOR-3 [′]UTR plasmids. [score:2]
mTOR knockdown partially phenocopies miR-99a restoration in renal cell carcinoma cells. [score:2]
Figure 2 MiR-99a suppresses tumorigenicity in vitro. [score:2]
Thus, we concentrated on miR-99a in RCC. [score:1]
786-O and OS-RC-2 cells were transfected with miR-99a or NC. [score:1]
A murine xenograft mo del of RCC was used to confirm the effect of miR-99a on tumorigenicity in vivo. [score:1]
786–0 and OS-RC-2 cells were transfected with the miR-99a mimics, mTOR-siRNA or negative control (NC) for 48 hours and then seeded at 2000 cells per well in 96-well plates. [score:1]
Previous studies have reported that miR-99a participated in tumorigenesis of several tumor type,including hepatocellular carcinoma [17], prostate cancer [19], childhood adrenocortical tumors [20] and lung cancer [23]. [score:1]
miR-99a induces G1-phase cell cycle arrest. [score:1]
Moreover, intratumoral delivery of miR-99a was sufficient to trigger in vivo regression of tumor growth in RCC xenograft mo del. [score:1]
However, up to date, there are no studies of miR-99a in RCC. [score:1]
These mice were then treated with 200 pmol miR-99a or NC mimics in 10 μl Lipofectamine 2000 through a local injection of the xenograft tumor at multiple sites. [score:1]
786-O and OS-RC-2 cells were transfected with the miR-99a mimics, mTOR-siRNA or negative control (NC) for 24 hours and then seeded for colony formation in 6-well plates at 200 cells per well. [score:1]
So, there was an inverse correlation between miR-99a levels and mTOR protein. [score:1]
pGL3-MUT-mTOR- 3 [′]UTR was generated from pGL3-WT-mTOR-3 [′]UTR by deleting the binding site for miR-99a “UACGGGU”. [score:1]
786-O and OS-RC-2 cells were transfected with the miR-99a mimics, mTOR-siRNA or negative control (NC), cultivated for 48 hours, and transferred on the top of Non-matrigel-coated/ Matrigel-coated chambers (24-well insert, 8-μm pore size, BD Biosciences, San Jose, USA) in a serum-free RPMI 1640 and the medium containing 30% fetal calf serum was added to the lower chamber as a chemoattractant. [score:1]
Cells at 70%–80% confluence were transfected with miR-99a mimics, mTOR-siRNA or negative control (NC) using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. [score:1]
These results indicate that miR-99a may serve as a potential predictor for prognosis of RCC patients. [score:1]
Then, miR-99a or NC mimics was repeatedly administered by intratumoral injections every 3 days for 4 weeks. [score:1]
On the basis of these findings, we propose a hypothetical mo del for the function of the miR-99a–mTOR axis in RCC. [score:1]
The mechanisms underlying miR-99a implicated in the carcinogenesis of RCC is very complicated, and further extensive analysis will be necessary to elucidate the precise mechanisms of miR-99a implicated in the carcinogenesis of RCC. [score:1]
As expected, compared with NC transfectants, mTOR-knockdowned 786–0 cells showed a decrease in the proliferation and colony formation and an increase in the G1-phase population (Figure 7A–C), similar to the phenotype observed upon miR-99a restoration in 786–0 cells. [score:1]
Additionally, we also examined the effect of miR-99a on apoptosis and found that miR-99a restoration could hardly influence apoptosis in RCC cell lines (data not shown). [score:1]
The gene encoding miR-99a was found residing within an intron of C21or f34, C21 or f34 located in chromosome 21q21, the region was commonly deleted in lung cancer [13, 32]. [score:1]
The expression and function of miR-99a, however, have not been investigated in human renal cell carcinoma (RCC) so far. [score:1]
Figure 6 MTOR pathway is involved in miR-99a mediated G1/S Transition. [score:1]
However, in this study, we demonstrate for the first time that miR-99a is implicated in the carcinogenesis of RCC. [score:1]
786–0 and OS-RC-2 cells were transfected with miR-99a or NC. [score:1]
These results demonstrate that mTOR pathway is involved in miR-99a mediated G1/S Transition. [score:1]
Recently, miR-99a was also shown to be co-transcripted with C21 or f34 in hepatocellular carcinoma [17]. [score:1]
These data suggest that miR-99a may be a predictor for prognosis of RCC patients. [score:1]
mTOR pathway is involved in miR-99a mediated G1/S transition. [score:1]
Because the in vitro data demonstrated that miR-99a harbored antitumorigenic properties in RCC, we conducted a proof-of-principle experiment, in which a 786–0 xenograft mo del was used to confirm the effect of miR-99a on tumorigenicity in vivo. [score:1]
However, Li et al. also reported that restoration of miR-99a could hardly influence the metastasis of hepatocellular carcinoma cell lines [17], inconsistent with our findings in RCC. [score:1]
[1 to 20 of 103 sentences]
4
[+] score: 251
MiR-99a Overexpression Inhibits Cardiac Hypertrophy in vivoTo elucidate whether miR-99a overexpression was sufficient to decrease cardiac hypertrophy in vivo, we generated mice with cardiac specific overexpression of miR-99a through lentivirus infection 1 week after the TAC surgery. [score:9]
Expression of miR-99a was up-regulated in NMVMs under Ang II (Fig 2G) or ISO (Fig 2H) stimulation, suggesting that miR-99a was functionally involved in the development of hypertrophy in cardiomyocytes induced by different stimuli in vitro. [score:7]
Intriguingly, we found that another target of miR-99a FGFR3 was down-regulated in lenti-99a-GFP group. [score:6]
Our data suggested that miR-99a overexpression might work as a novel avenue for the treatment of pressure-overload heart disease. [score:5]
The expression of cardiac stress marker ANP was dramatically decreased in lenti-99a-GFP hearts compared to lenti-GFP hearts (Fig 4E and 4F), demonstrating that miR-99a overexpression abates the development of heart failure in TAC mice. [score:5]
Targets of miR-99a include a variety of signaling molecules, such as mTOR, SWI/SNF-related matrix -associated actin -dependent regulator of chromatin subfamily A member 5 (SMARCA5), SWI/SNF-related matrix -associated actin -dependent regulator of chromatin subfamily D member 1 (SMARCD1) and fibroblast growth factor receptor 3 (FGFR3) [13– 16]. [score:5]
The expression of miR-99a showed low correlated with cardiac function (R = 0.38, p = 0.22) 1 week after surgery (Fig 1J), while miR-99a expression showed a high inverse correlation with cardiac function (R = -0.72, p<0.01) eight weeks after surgery (Fig 1L), suggesting that miR-99a might correlate with hypertrophic growth of cardiomyocytes and affect the heart function in vivo. [score:5]
G-I. Inhibition of mTOR and ANP expression by miR-99a in NMVMs under ISO or Ang II stimulation assessed by western blotting analysis. [score:5]
To elucidate whether miR-99a overexpression was sufficient to decrease cardiac hypertrophy in vivo, we generated mice with cardiac specific overexpression of miR-99a through lentivirus infection 1 week after the TAC surgery. [score:5]
No significant decrease expression of these targets were observed in miR-99a treated mice (Fig 6A and 6B), ruling out the involvement of SMARCA5 and SMARCD1 in miR-99a mediated cardiac protection. [score:5]
Overexpression of miR-99a reduced mTOR expression in Ang II -induced hypertrophic NMVMs (Fig 3G). [score:5]
We also detected the protein expression of other known targets of miR-99a, including SMARCA5 and SMARCD1. [score:5]
Therefore, miR-99a overexpression may protect heart from hypertrophy via inhibition of mTOR/P70/S6K signaling pathway. [score:5]
To investigate whether miR-99a improves heart function after TAC via down-regulation of mTOR/P70/S6K pathway in vivo, we assessed mTOR and P70/S6K expression in lentiviral infected heart by western blotting analysis. [score:4]
ANP expression was decreased in miR-99a treated cells under Ang II stimulation compared to lenti-GFP group (Fig 3G–3I), suggesting that miR-99a overexpression protects cells from hypertrophic stress. [score:4]
Data exist show that mTOR expression could be regulated by miR-99a, and mTOR/P70/S6K signaling pathway played an important role in cardiac hypertrophy. [score:4]
The average NMVMs cell size was increased in NMVMs without miR-99a lentiviral transfection in the presence of Ang II (Fig 3D) or ISO (Fig 3F), as compared to miR-99a overexpressing NMVMs (Fig 3C–3E), suggesting that miR-99a overexpression restored cardiomyocyte phenotype under hypertrophic stimuli. [score:4]
As the target of miR-99a, mTOR is known to play a key role in regulating cellular protein synthesis not only in physiological hypertrophy but also pathological remo deling of the heart [29– 30]. [score:4]
MiR-99a Overexpression Inhibits Cardiac Hypertrophy in vivo. [score:4]
We noticed that FGFR3 was also down-regulated in mice heart treated with miR-99a. [score:4]
In all, our results showed that miR-99a negatively regulated mTOR expression and P70/S6K activation. [score:4]
Expression of miR-99a during the development of concentric hypertrophy and eccentric hypertrophy was assessed by Taqman RT-PCR analysis. [score:4]
To investigate whether miR-99a overexpression affects cardiomyocytes metabolism, we analyzed Hif-1α, PPAR-α, GLUT1 and HK2 mRNA expression in hearts by RT-PCR. [score:3]
We observed that miR-99a overexpression protected cardiomyocytes from ISO/Ang II induced hypertrophy. [score:3]
Taken together, these results demonstrated that both mTOR and miR-99a expressions were increased in cardiomyocytes during cardiomyocyte hypertrophy in vitro. [score:3]
Overexpression of miR-99a in heart tissues from the mice 1 week and 7 weeks after lentiviral delivery was verified by Taqman RT—PCR analyses of the mature forms of these miRNAs (Fig 4B). [score:3]
Inhibition of miR-99a could do harm to cardiomyocytes under the treatment of Ang II and ISO. [score:3]
The expression of miR-99a and mTOR in NMVMs upon hypertrophic stimuli. [score:3]
Taken together, these results demonstrated that the cardiomyocytes specific overexpression of miR-99a in mice protects heart from pathological hypertrophy and failure. [score:3]
These data demonstrated that miR-99a overexpression improves heart morphology after TAC. [score:3]
B. One week after lentivirus (lenti-GFP-99a) intramyocardially infection, there was no difference of miR-99a expression in kidney, lung, liver and spleen. [score:3]
Both mTOR expression (Fig 6A and 6B) and P70/S6K activation (Fig 6C and 6D) were decreased 7 weeks after miR-99a lentiviral delivery in TAC animals. [score:3]
MiR-99a was up-regulated in hypertrophic stimuli treated cardiomyocytes and pressure-overloaded heart. [score:3]
We observed the expression of mir-99a was declined to 24% of its original value in LV-anti-GFP group (date not show). [score:3]
Cardiac specific overexpression of miR-99a in pressure-overloaded heart preserved myocardial structure, reduced myocardial fibrosis and apoptosis, attenuated cardiac hypertrophy and improved cardiac function. [score:3]
E-G. Western blotting analysis showed ANP (F) and α-SMA (G) were both down-regulated in miR-99a treated group compared to lenti-GFP group. [score:3]
Overexpression of miR-99a protected cardiomyocytes from stimuli -induced pathological hypertrophy in vitro. [score:3]
To investigate whether mTOR, the downstream molecule of miR-99a, is involved in this process, we assessed mTOR protein expression in miR-99a overexpressing cells. [score:3]
Taken together, these results indicated that miR-99a inhibits cardiac hypertrophy via an mTOR/P70/S6K Signaling Pathway. [score:3]
The expression of miR-99a and mTOR in heart with hypertrophy and failure induced by TAC in mice. [score:3]
0148480.g004 Fig 4 A, Immunofluorescence for GFP tag, indicating successful expression of exogenous miR-99a in heart after lenti-99a-GFP delivery. [score:3]
To investigate whether miR-99a/mTOR signaling pathway is involved in cardiomyocytes hypertrophy, we assessed the expression of miR-99a and its target mTOR in hypertrophic NMVMs. [score:3]
No significant change of miR-99a expression was seen in kidney, lung, liver and spleen, indicating the successful lentiviral transfection in heart (S1B Fig). [score:3]
Taqman RT-PCR was used to determine the changes of miR-99a expression in NMVMs under stimuli. [score:3]
Cardiac overexpression of miR-99a improved BP in mice received TAC surgery (systolic BP: 109 ± 3 mmHg and 95 ± 2 mmHg, diastolic BP: 80 ± 2 mmHg and 66 ± 2 mmHg, lenti-99a-GFP group versus lenti-GFP group, *, p<0.05), while systemic blood pressure was comparable between sham and lenti-99a-GFP group (S1C Fig). [score:3]
B. Increased miR-99a expression in heart 1 week and 7 weeks after lentiviral delivery assessed by TaqMan RT-PCR. [score:3]
To identify whether miR-99a overexpression protects cardiomyocytes from stumili -induced hypertrophy, we transfected NMVMs with lentivirus vector containing miR-99a. [score:3]
Taken together, these results demonstrated that miR-99a/mTOR signaling pathway inhibits hypertrophic growth of cardiomyocytes under pathological stimuli in vitro, and protects cardiomyocytes from apoptosis under hypertrophic stimuli. [score:3]
Cardiac-specific overexpression of miR-99a protected hearts from TAC induced cardiac hypertrophy and subsequent heart failure, and attenuated the re-activation of fetal cardiac genes in the adult failing heart. [score:3]
Seventy-two hours after transfection, miR-99a overexpressing NMVMs (about 22-fold increase) were exposed to hypertrophic stimuli. [score:3]
A, Immunofluorescence for GFP tag, indicating successful expression of exogenous miR-99a in heart after lenti-99a-GFP delivery. [score:3]
In our study, the ‘fetal’ genes including BNP, β-MHC and ACTA1 levels were strongly increased in lenti-GFP treated hearts (Fig 4H), and reduced in lenti-99a-GFP group, further supporting our observation that miR-99a overexpression attenuated cardiac hypertrophy and heart failure. [score:3]
We observed that inhibition of miR-99a could do harm to cardiomyocytes under the treatment of Ang II and ISO. [score:3]
Lentivirus carried mir-99a inhibitor (LV-anti-GFP) sequence (5’-3’CACAAGATCGGATCTACGGGTT) were purchased from Shanghai GenePharma. [score:3]
C. We observed that miR-99a overexpression in hearts of mice did alter the BP (systolic BP: 109 ± 3 mmHg and 95 ± 2 mmHg, diastolic BP: 80 ± 2 mmHg and 66 ± 2 mmHg, lenti-99a-GFP group verse lenti-GFP group, *, p<0.05). [score:3]
D. Heart-to-body-weight ratio (mg/g) was increased in TAC mice, but attenuated in miR-99a overexpressing heart (n = 8 in lenti-99a-GFP group; n = 19 in lenti-GFP group). [score:3]
All of the four genes were up-regulated in TAC group compared to sham group, and were significantly decreased or tend to decrease in miR-99a treated group (Fig 4H), suggesting improved cardiac metabolism in miR-99a treated heart. [score:3]
G-H. MiR-99a expression was increased 1 week after surgery, but low correlated with cardiac function. [score:2]
MiR-99a suppressed hypertrophy and improved cardiac function in response to pressure overload. [score:2]
MiR-99a Inhibits Cardiomyocytes Hypertrophy in vitro. [score:2]
I-J. MiR-99a expression was increased 8 weeks after surgery, and showed a high correlated with cardiac function. [score:2]
MiR-99a expression was relative to the control U6. [score:2]
We observed restored serca2a expression in miR-99a treated heart compared to lenti-GFP group, indicating improved heart function with miR-99a treatment. [score:2]
Expression of mTOR and MiR-99a in Hypertrophic and Failing Mouse Hearts. [score:2]
MiR-99a Inhibits Cardiac Hypertrophy via an mTOR/P70/S6K Signaling Pathway. [score:2]
Expression of mTOR and MiR-99a in NMVMs upon Hypertrophic Stimuli Treatment. [score:2]
G. MiR-99a expression was increased about 2.00-fold after ISO stimulation. [score:2]
E-F. EF% and FS% were improved in TAC mice with miR-99a treatment at 5 weeks and 7 weeks after infection. [score:1]
TAC -induced cardiac fibrosis, a hallmark of cardiac remo deling, was less profound in miR-99a treated hearts (Fig 4K and 4L). [score:1]
To investigate whether miR-99a overexpression also improves hemodynamics in mice, we assessed systemic blood pressure (BP) of mice 8 weeks after TAC surgery. [score:1]
35ul lentivirus containing either miR-99a precursor GFP or miR-scramble GFP (3.5*10 [7] viral particles). [score:1]
One week after surgery, hearts in TAC group developed concentric hypertrophy, and miR-99a level was about 2-fold higher in those group than the sham group (Fig 1I); whereas, eight weeks after TAC, hearts developed eccentric hypertrophy and the miR-99a level was about 1.74 fold higher in TAC group (Fig 1K). [score:1]
Heart samples were collected to evaluated the expression of miR-99a and mTOR 1 week (n = 11) and 8 weeks (n = 16) after TAC; 2). [score:1]
B. Hypertrophy of LV posterior wall was attenuated in TAC mice with treatment of miR-99a as early as 1 week after lentiviral delivery. [score:1]
Interventricular septum was significantly decreased in in miR-99a group as early as 1 week after lentiviral delivery, and lasted for 7 weeks (Fig 5A). [score:1]
Although miR-99a has been reported to be associated with myocytes proliferation and apoptosis [17– 18], to date, study on the precise role and therapeutic potential of miR-99a in cardiac hypertrophy is still lacking. [score:1]
Western blotting analysis showed an up to 40% decrease in mTOR protein level in NMVMs after miR-99a lentiviral infection (date not shown). [score:1]
J-M. Decreased cell apoptosis in MiR-99a overexpressing NMVMs under ISO or Ang II stimulation assessed by western blotting analysis and TUNEL assay. [score:1]
To assess whether the attenuation of hypertrophy by miR-99a is due to reduced cell apoptosis in the hearts, we examed cardiomyocytes apoptosis in the hearts of TAC mice. [score:1]
Decreased cleavage of caspase 3 at 17 kD indicates a reduced apoptosis in TAC mice treated miR-99a (Fig 6E and 6F). [score:1]
MiR-99a regulated mTOR/P70/S6K signaling pathway and decreased cell apoptosis in heart of TAC mice. [score:1]
Taken together, our research showed a previously unknown link between miR-99a and cardiac hypertrophy, and provide a promising therapeutic strategy for pathological cardiac hypertrophy. [score:1]
Here we demonstrated that miR-99a played a key role in cardiac hypertrophy and heart failure for the first time. [score:1]
Group #2 mice were subject to chest reopening without (sham, n = 6) or with injection of 35ul lentivirus (3.5*10 [7] viral particles per mice) containing either miR-scramble GFP (Lenti-GFP group, n = 25) or miR-99a precursor GFP (Lenti-99a-GFP group, n = 10) in the heart 1 week after TAC operation. [score:1]
TAC induced pathological hypertrophy in mice as reflected by increased heart weight indices and the overall heart size, and these TAC -induced changes were attenuated in miR-99a treated mice (Fig 4C and 4D). [score:1]
[1 to 20 of 85 sentences]
5
[+] score: 234
In this study, we observed that miR-99a overexpression effectively down-regulated the mTOR pathway, which may lead to the suppressed apoptosis and increased autophagy in injured myocytes. [score:8]
Therefore, overexpression of miR-99a may serve as a new target for the treatment of ischaemic heart disease. [score:7]
Human miR-99a is encoded by 21st chromosomes and its targets include a variety of molecules involved in cardiovascular pathology, such as mammalian target of rapamycin (mTOR), SWItch/Sucrose NonFermentable (SWI/SNF)-related matrix -associated actin -dependent regulator of chromatin subfamily A member 5 (SMARCA5), SWI/SNF-related matrix -associated actin -dependent regulator of chromatin subfamily D member 1 (SMARCD1) and fibroblast growth factor receptor 3 (FGFR3) [10– 13]. [score:7]
To investigate whether miR-99a overexpression improves heart function in MI mice by down-regulation of mTOR/P70/S6K pathway, we assessed mTOR and P70/S6K expression in miR-99a-lentivirus-infected heart and NMVMs. [score:6]
MiR-99a expression was normalized to the U6 expression and expressed as fold change relative to sham group. [score:6]
In conclusion, our study demonstrates that overexpression of miR-99a improves post-MI cardiac function by up -regulating autophagy, inhibiting apoptosis and attenuating pathological remo delling. [score:6]
Interestingly, there was no significant decrease in mRNA transcriptional level of mTOR in miR-99a -overexpressing NMVMs (date not shown), suggesting that miR-99a regulates mTOR expression at a post-transcriptional level. [score:6]
To investigate whether other miR-99a targets besides mTOR are involved in the cardioprotective effect of miR-99a, we assessed the expression of other known miR-99a targets, including SMARCA5, SMARCD1 and FGFR3. [score:5]
Western blotting analysis showed that both mTOR expression (Fig. 5A, B and H, I) and the activation modifications of P70/S6K (Fig. 5F, G and J, K) were decreased in miR-99a -overexpressing heart tissue and NMVMs. [score:5]
As shown in Figure S2B, there was a fourfold increase in miR-99a expression in U0126 -treated NMVMs after 6 hrs of hypoxia and miR-99a expression maintained at a high level (approximately twofold higher than control, Figure S2C) even after 24 hrs of hypoxia. [score:5]
We also assessed miR-99a expression in hypoxic NMVMs in the presence of a MEK1/2 inhibitor (U0126). [score:5]
To exclude the possibility that some lentiviral vectors may spill over to the circulation and increase miR-99a expression in other tissues, we tested miR-99a expression in aorta, livers, kidneys and lungs after lentiviral vector delivery into heart using a TaqMan RT-PCR kit or immunofluorescent staining of GFP. [score:5]
Mammalian target of rapamycin has been identified as the direct target of miR-99a by multiple studies using reporter gene assays [10, 13, 20]. [score:5]
To identify whether miR-99a overexpression protects NMVMs against apoptosis under hypoxic stress, we infected NMVMs with lenti-99a-green fluorescent protein (GFP) or lenti-GFP (Figure S1B) and assessed miR-99a expression using RT-PCR analysis. [score:5]
In the present study, we found that miR-99a overexpression induced cell autophagy in the border myocardium, which might serve as another mechanism contributes to improve cardiac remo delling after miR-99a overexpression. [score:5]
To confirm our observation that miR-99a expression decreased in infarcted heart, we assessed miR-99a expression in NMVMs under hypoxia. [score:5]
More importantly, the hypoxia -induced reduction in miR-99a expression is reversed by pharmacological inhibition of MEK1/2. [score:5]
As shown in Figure 1C and D, the percentage of annexin V -positive apoptotic cells was significantly decreased in miR-99a -overexpressed myocytes 6 hrs after hypoxia compared to the lenti-GFP group, indicating that early apoptosis of hypoxic myocytes was reduced by miR-99a overexpression. [score:4]
Previous study had shown the regulation of miR-99a expression by MEK1/2/MAPK pathway [13]. [score:4]
Data exist show that mTOR expression can be regulated by miR-99a, and mTOR/P70/S6K signalling pathway plays an important role in cardioprotection from ischaemia [10, 13, 17, 20]. [score:4]
Attenuation of apoptosis and regulation of autophagy by miR-99a overexpression in vivo. [score:4]
Attenuation of apoptosis and regulation of autophagy by miR-99a overexpression in vivoStudies show that cell apoptosis and autophagy contribute to LV remo delling and dysfunction [16, 17]. [score:4]
In line with their finding, we observed that miR-99a was down-regulated in ischaemic myocardium and myocytes exposed to hypoxia. [score:4]
Previous study has shown the regulation of miR-99a expression in tumours by MEK1/2/MAPK pathway [13]. [score:4]
These data suggest that the down -regulating effect of hypoxia on miR-99a expression in NMVMs is mediated by the MEK1/2/MAPK signalling pathway. [score:4]
All these results indicate that overexpression of miR-99a improve heart function after MI. [score:3]
Mechanistically, the protective role of miR-99a in MI was largely because of its inhibition of apoptosis and promotion autophagy. [score:3]
We barely found expression of miR-99a or GFP delivered by lenti-miR-99a vectors in aorta, liver, kidney and lung (data not shown). [score:3]
As shown in Figure S3C, collagen volume fraction was reduced in the border zone of lenti-99a-GFP heart, suggesting suppressed interstitial fibrosis in heart treated miR-99a. [score:3]
Therefore, decreased myocardial apoptosis is one of the mechanisms by which overexpressed miR-99a attenuates post-MI cardiac remo delling. [score:3]
More importantly, the LC3 lipidation level (LC3II/LC3I ratios) was increased and the autophagy substrate p62 level was decreased in the border zone of miR-99a -treated hearts 4 weeks after MI (Fig. 4F and G), suggesting that miR-99a overexpression leads to an increased autophagic flux and enhanced autophagy in myocytes in response to myocardial ischaemia and infarction. [score:3]
Decreased miR-99a expression in infarcted hearts and hypoxic NMVMs. [score:3]
We observed a progressive decrease in miR-99a expression in NMVMs ranging from 43% at 1 hr of hypoxia to 21% at 6 hrs of hypoxia. [score:3]
Fig. 2Expression of green fluorescent protein (GFP) and miR-99a after lentiviral delivery. [score:3]
In the present study, we demonstrated a novel therapeutic strategy for the treatment of MI based on miR-99a overexpression. [score:3]
We found no significant change in the expression of these molecules in either miR-99a -treated heart tissue (Fig. 5C–E) or miR-99a -treated NMVMs (Fig. 5H and I). [score:3]
Improvement in survival and cardiac function of MI mice by miR-99a overexpression. [score:3]
As shown in Figure 2C, miR-99a expression was 5.52 ± 0.69-fold higher in miR-99a group 7 days after MI, and maintained 3.94 ± 0.71-fold higher 28 days after MI. [score:3]
Therefore, we used the lentiviral vectors to deliver and express miR-99a in myocytes in the present study. [score:3]
Considering the previous finding that MEK1/2-ERK1/2 kinase in cardiomyocytes exerts rapid response to hypoxia stress [21], we think the decrease in miR-99a expression in the very early stage of hypoxia is because of the activation of MEK1/2-ERK1/2 kinase. [score:3]
As microRNAs are involved in the regulation of cell apoptosis and autophagy, we investigated whether miR-99a overexpression attenuated LV remo delling by regulation of cell apoptosis and autophagy after MI. [score:3]
Taken together, all above suggest that miR-99a overexpression may protect heart against ischaemia injury via an mTOR/P70/S6K signalling pathway. [score:3]
The enhanced autophagy in miR-99a -treated heart was further confirmed by the increased autophagic vacuoles in miR-99a overexpressing cardiomyocytes as revealed by electron microscope (Fig. 4H and I). [score:3]
Fig. 1Expression profile of miR-99a in ischaemic heart and neonatal mice ventricular myocytes (NMVMs) under hypoxia. [score:3]
To test this concept, we overexpressed miR-99a in the ischaemic heart by lentiviral delivery of miR-99a. [score:3]
Published data show that the expression of miR-99a was decreased in apoptotic cardiomyocyte upon exposure to hypoxia in vitro [8], suggesting that miR-99a is associated with hypoxia -induced cardiomyocyte apoptosis. [score:3]
Hu et al. [8] reported that the expression of miR-99a decreased in apoptotic myocytes subjected to hypoxia. [score:3]
The significantly decreased miR-99a expression in both infracted hearts and NMVMs under hypoxia suggests an important role for miR-99a in ischaemic injury. [score:3]
MiR-99a expression dramatically decreased up to 94% 1 hr after infarction, then recovered to only 41 ± 7% of the miR-99a level in the control group 24 hrs after infarction and maintained thereafter 43–50% of the miR-99a levels in the control group over the 44-day period (Fig. 1A). [score:3]
Furthermore, we observed no significant difference in cardiac function between lenti-99a-GFP -treated normal hearts and lenti-GFP -treated normal hearts (Table 1), suggesting that miR-99a overexpression does not affect cardiac function under non-surgical conditions. [score:3]
The expression profile of miR-99a was markedly different between MI group and control (sham) group throughout the 44-day observation period. [score:3]
Regulation of mTOR/P70/S6K pathway by miR-99a. [score:2]
The regulation of mTOR signalling pathway by miR-99a may contribute to the cardioprotective role of miR-99a. [score:2]
However, how mTOR signalling pathway precisely regulates switch between apoptosis and autophagy in miR-99a overexpressing myocytes needs further investigation. [score:2]
Increased myofilament density and decreased myocyte size were observed in the border zone of lenti-99a-GFP group compared to lenti-GFP group (Fig. 3I and J), while no significant difference in either myofilament density or myocyte size was observed in the remote zone between the two groups (Fig. 3G and H), suggesting that miR-99a overexpression attenuates myocyte hypertrophy and secondary cell loss in the border zone after MI. [score:2]
MiR-99a expression was about 30-fold higher in the lenti-99a-GFP group than the lenti-GFP group (Figure S1C). [score:2]
Hearts from lenti-99a-GFP group showed reduced infarct size and LVEDD compared to lenti-GFP group (Fig. 3E), indicating that LV remo delling is improved by miR-99a overexpression. [score:2]
It has been suggested that miR-99a protected heart against infarction by regulation of cardiomyocyte survival. [score:2]
Our study demonstrates that mTOR is negatively regulated by miR-99a in both NMVMs and myocardium. [score:2]
Anti-apoptotic function of miR-99a in NMVMs. [score:1]
Lentivirus -mediated miR-99a delivery improved survival rate and cardiac function in mice after MI. [score:1]
This observation was confirmed by assessment of the cleavage of caspase 3 by western blotting analysis, as decreased activation/cleavage of caspase 3 in the border zones of hearts after miR-99a treatment was observed (Fig. 4C and D). [score:1]
The precise role and therapeutic potential of miR-99a in MI is still unknown. [score:1]
Taken together, these data demonstrate that miR-99a attenuates hypoxia induced early and late apoptosis in myocytes. [score:1]
However, studies on the role of miR-99a in MI and subsequent cardiac remo delling are very limited. [score:1]
Eulalio et al. identified that miR-99a mimics could significantly increase neonatal cardiomyocytes proliferation [14]. [score:1]
We observed improved heart function and attenuated pathological myocardial remo delling in MI mice treated with miR-99a. [score:1]
We found that miR-99a could prevent both cultured myocytes and myocardium against hypoxia -induced apoptosis. [score:1]
Hearts from lenti-99a-GFP group showed less spherical shape than those from lenti-GFP group 4 weeks after MI, reflecting attenuated global cardiac remo delling in mice treated with miR-99a (Fig. 3C). [score:1]
To investigate whether MEK1/2/MAPK pathway is involved in the suppressed miR-99a expression that we observed, we evaluated ERK1/2 and phosphorylated ERK1/2 levels in hypoxic NMVMs. [score:1]
The expression of miR-99a in the border zone of heart after lentivirus delivery was evaluated using a TaqMan RT-PCR kit. [score:1]
[1 to 20 of 71 sentences]
6
[+] score: 191
Taken together, these results suggested that the miR-99 family regulates PI3K/AKT and mTOR signaling pathways by targeting a number of key genes, including known target genes (IGF1R, mTOR), and the new target gene AKT1. [score:8]
This is consistent with previous observations made in HaCaT cells [39], and suggests that the miR-99 family regulates IGF1R gene expression primarily by inhibiting translation in HaCaT cells. [score:8]
Our working hypothesis is that upon wounding, down-regulation of the miR-99 family members leads to the up-regulation/activation of AKT/mTOR signaling pathway, which in turn actives cell proliferation and migration, and facilitates the wound closure. [score:7]
These results, together with the luciferase reporter assays, provided solid evidence supporting that members of miR-99 family down-regulate the expression of the AKT1 gene by directly interacting with AKT1 mRNA. [score:6]
Down-regulation of hsa-miR-99b and hsa-miR-100 was confirmed in human skin wounds (Figure S1), while no apparent difference was observed in the expression of hsa-miR-99a. [score:6]
Hierarchical clustering analysis revealed several groups of microRNAs that exhibit similar expression patterns, including a 9-microRNA group (mmu-miR-152, mmu-miR-365, mmu-let-7d*, mmu-miR-125a-5p, mmu-miR-181d, mmu-miR-99a, mmu-miR-100, mmu-miR-30c, mmu-miR-125b-5p, named as cluster X in Figure 1A ) which was down-regulated during the early phase of wound healing (day 1) as compared to unwounded skin (day 0), and returned to basal level during the later phase of wound healing (day 5) (Table 1 ). [score:5]
0064434.g002 Figure 2HaCaT cells were transfected with mimics for miR-99a, miR-99b, miR-100 or negative control mimic, or treated with PI3 Kinase Inhibitor LY294002 (LY), mTOR Inhibitor Rapamycin (Rapa) or vehicle alone (DMSO). [score:5]
To test whether the miR-99 family directly interacts with these predicted targeting sites in AKT1 mRNA, dual luciferase reporter assays were performed using constructs containing these targeting sites (Figure 5B ). [score:5]
HaCaT cells were transfected with mimics for miR-99a, miR-99b, miR-100 or negative control mimic, or treated with PI3 Kinase Inhibitor LY294002 (LY), mTOR Inhibitor Rapamycin (Rapa) or vehicle alone (DMSO). [score:5]
IGF1R and mTOR, two major players in PI3K/AKT and mTOR signaling pathways, have previously been suggested as direct targets of the miR-99 family in different types of cancer cells [24], [30]– [32]. [score:4]
In addition to the PI3K/AKT and mTOR signaling pathways, the miR-99 family has also been implicated in other pathways, including regulating cell cycle by targeting proto-oncogene PLK1 [34], [45]– [47], an early trigger for G2/M transition. [score:4]
However, we were not able to observe any miR-99 family -mediated down-regulation of PLK1 in the cell lines we tested (data not shown). [score:4]
We further demonstrated that the miR-99 family regulates the wound healing process by targeting multiple genes in the AKT/mTOR signaling pathway, which plays a major role in cell migration and proliferation that contribute to the replenishment of lost tissues after injury. [score:4]
In addition to IGF1R and mTOR, we also tested whether the miR-99 family regulates the expression of the AKT gene family. [score:4]
These miR-99 family -induced changes in IGF1R, mTOR and AKT1 expression were further validated in mouse wounds by directly applying the microRNA mimics to the dermal wounds. [score:4]
These results are consistent with our bioinformatics analysis and the recent observations based on cancer cells [30]– [32] suggesting that the members of miR-99 family regulate cell proliferation, apoptosis and migration by targeting the mTOR signaling pathway, as well as the PI3K/AKT pathway which is upstream of mTOR. [score:4]
We further demonstrated that miR-99 regulates cell migration and cell proliferation by targeting PI3K/AKT and mTOR signaling pathways during wound healing. [score:4]
A 9-microRNA cluster (mmu-miR-152, mmu-miR-365, mmu-let-7d*, mmu-miR-125a-5p, mmu-miR-181d, mmu-miR-99a, mmu-miR-100, mmu-miR-30c, mmu-miR-125b-5p, which exhibited statistical significant down-regulation on day 1 and returned to basal level on day 5) was named as cluster X (marked by solid bar on the right). [score:4]
While we confirmed the effect of the miR-99 family on Raptor in an oral cancer cell line (UM1), we did not observe any apparent change in Raptor expression after transfecting the HaCaT cells with miR-99a, miR-99b or miR-100 mimic (data not shown). [score:3]
The miR-99 family targeting sites were identified by lines below the alignment. [score:3]
Bioinformatics analysis revealed 2 adjacent miR-99 family targeting sites in the 3′-UTR of the AKT1 mRNA (Figure 5A ). [score:3]
Figure S1 The expression of miR-99 family members in human skin wounds. [score:3]
C) The differential expression of miR-99a, miR99b and miR-100 were confirmed by quantitative RT-PCR in additional mice at 0, 1 and 5 days post-wounding (6 mice per groups). [score:3]
While the targeting sequences for miR-99 members on IGF1R and mTOR mRNAs have been previously identified and experimentally confirmed using luciferase reporter assays [24], [30]– [32], the direct interaction of miR-99 family and AKT1 mRNA has not been defined. [score:3]
Mmu-miR-99b (the 3rd member of the miR-99 family) is also differentially expressed during dermal wound healing (p<0.05) in mice. [score:3]
In summary, we identified a panel of differentially expressed microRNAs during dermal wound healing, including members of the miR-99 family. [score:3]
All 3 variants have identical 3′-UTR, and as such, they contain the same set of miR-99 family targeting sites. [score:3]
The effect of the miR-99 family on the expression of mTOR, IGF1R and AKT. [score:3]
No targeting site for the miR-99 family was indentified in the AKT2 mRNA sequence. [score:3]
Figure S4 Predicted miR-99 family targeting sites in AKT1 mRNA. [score:3]
A) Two adjacent targeting sites for miR-99a/b/100 were identified in AKT1 3′-UTRs (nt 2175 to nt 2235, NM_005163). [score:3]
In the late phase, miR-99 family members return to the basal levels, which will suppress the AKT/mTOR signaling and slow down cell proliferation and migration. [score:3]
0064434.g005 Figure 5 A) Two adjacent targeting sites for miR-99a/b/100 were identified in AKT1 3′-UTRs (nt 2175 to nt 2235, NM_005163). [score:3]
The luciferase reporter gene construct containing 2 adjacent miR-99 family targeting sites from the 3′-UTR of AKT1 mRNA was created by cloning an 81-bp fragment into the XbaI site on the 3′-UTR of the luciferase gene in the pGL3-Control firefly luciferase reporter vector (Promega) as described previously [26]. [score:3]
As shown in Figure 1C, differential expression of mmu-miR-99a and mmu-miR-100 during wound healing was confirmed by quantitative RT-PCR in additional animals (n = 10). [score:3]
As such, our results demonstrated that in addition to IGF1R and mTOR, ATK1 is another functional target gene of miR-99 family members in the AKT/mTOR signaling pathway. [score:3]
In this study, we identified a panel of differentially expressed microRNAs during dermal wound healing, including members of miR-99 family. [score:3]
Taken together, these results suggest that the miR-99 family plays an important role in dermal wound healing by concurrently targeting IGF1R, mTOR, and AKT1 (as well as AKT2, to a lesser extent), which in turn modulate the PI3K/AKT and mTOR signaling pathways. [score:3]
Here, we confirmed the effects of the miR-99 family on the expression of IGF1R and mTOR in skin keratinocytes (HaCaT). [score:3]
Further studies are required to explore miR-99 family’s potential as a novel therapeutic target for the treatment of impaired wound healing. [score:3]
These results provide further evidence supporting a role for the miR-99 family in regulating PI3K/AKT and mTOR signaling. [score:2]
The miR-99 family members (miR-99a/b and miR-100) have been shown to regulate cell proliferation and cell migration in several types of cancer of epithelial origin [24], [33], [34], however, their role(s) in wound healing are not well defined. [score:2]
It is worth noting that miR-99 family members have also been shown to regulate additional genes that participate in mTOR signaling, including Raptor [32], [44], an essential component of mTOR Complex 1 (mTORC1). [score:2]
Recent studies suggest that the miR-99 family regulates mTOR signaling in cancer cells [30]– [32]. [score:2]
It is possible that the HaCaT cells (or the UM1 cells, or the adrenocortical tumor cell line and HeLa cells used in the previous studies [32], [44]) may have a specific mutation(s) that dictates the miR-99 family’s effects on Raptor. [score:2]
To directly demonstrate the effect of miR-99 family on PI3K/AKT and mTOR signaling, we investigated the effect of miR-100 on the phosphorylation of p70 S6 Kinase (p70S6K) and eukaryotic translation initiation factor 4E binding protein 1 (4E-BP1), two important signaling molecules that lie downstream of PI3K/AKT and mTOR [36]. [score:2]
The relative expression levels of miR-99a, miR-99b and miR-100 were determined by TaqMan microRNA assays as previously described [24]. [score:2]
Nevertheless, our results, together with the earlier observations, suggest that miR-99 family members are multi-functional molecular regulators, and appear to play major roles in wound healing and other biological/pathological events. [score:2]
HaCaT cells were transfected with mimics for miR-99a, miR-99b, miR-100 or negative control mimic. [score:1]
Decrease in the AKT2 protein level was also observed in cells treated with miR-100, but not in cells treated with miR-99a or miR-99b. [score:1]
As shown in Figure 2A, ectopic transfection of miR-99a, miR-99b, and miR-100 mimic to HaCaT cells led to a statistically significant down-regulation in cell proliferation (measured by MTT assay). [score:1]
As shown in Figure 4A, the AKT1 protein level decreased in cells that were treated with miR-100, miR-99a or miR-99b. [score:1]
As shown in Figure 4A, decreases in IGF1R and mTOR protein levels were observed in cells that were treated with miR-100, miR-99a or miR-99b. [score:1]
For functional analysis, miR-99a, miR-99b, miR-100 or control microRNA mimic (Dharmacon) was transfected into the cells using DharmaFECT Transfection Reagent 1 as described previously [20], [21]. [score:1]
An apparent reduction in cell proliferation was also observed in cells treated with miR-99a mimic, however, the difference was not statistically significant. [score:1]
Among the cluster X microRNAs, mmu-miR-99a and mmu-miR-100 are members of miR-99 family. [score:1]
It is worth noting that we recently showed that both IGF1R protein and mRNA were significantly reduced in 2 head and neck cancer cell lines (UM1 and 1386Ln) when they were treated with mimics of miR-99 family members [24]. [score:1]
This apparent difference in the effect of the miR-99 family on Raptor may be due to the differences in the cell lines tested. [score:1]
The miR-99 family is one of the evolutionarily most ancient microRNA families whose origin dates back before the bilaterian ancestor [28], [29], and the sequences of the mature microRNAs are identical in human and mouse. [score:1]
The corresponding mutant constructs were created by replacing the seed regions (positions 2–8) of the miR-99 family binding sites with 5′-TTTTTTT-3′. [score:1]
As such, we chose to further explore the functional role of the miR-99 family in our study. [score:1]
An apparent decrease in AKT1 mRNA was also observed in cells treated with miR-99a, but the difference was not statistically significant. [score:1]
The effect of the miR-99 family on cell proliferation and cell migration in skin keratinocytes. [score:1]
0064434.g004 Figure 4HaCaT cells were transfected with mimics for miR-99a, miR-99b, miR-100 or negative control mimic. [score:1]
Significant reduction in mTOR mRNA level was observed in cells that were treated with miR-99a, miR-99b or miR-100 (Figure 4B ). [score:1]
Alternatively, the previously observed effect of miR-99 family members on Raptor may be specific to malignancy. [score:1]
[1 to 20 of 66 sentences]
7
[+] score: 152
Other miRNAs from this paper: mmu-mir-99b
The overexpression of miR-99a could significantly inhibit the expression of Ago2 protein, whereas the mRNA level of Ago2 was not significantly reduced, suggesting that miR-99a might inhibit Ago2 through translation repression rather than mRNA degradation 15. [score:11]
This delivery should restore miR-99a expression, reduce expression of its target genes and suppress HCC growth. [score:9]
Down-regulation of mTOR protein expression was most pronounced when miR-99a-PEAL-LA/VEGFab NPs were used (Fig. 4B), which correlated with the inhibition of tumor progression. [score:8]
Notably, miR-99a-PEAL-LA/VEGFab NPs showed the strongest inhibitory effect on mTOR mRNA expression, as mTOR mRNA expression was decreased by more than 60%. [score:7]
The miR-99a delivery resulted in the suppression of mTOR expression and led to effective inhibition of the migration, invasion and clonogenic formation of HepG2 hepatocellular carcinoma cells. [score:7]
In addition, as to the Ago2 protein (Fig. 4C), compared with the PBS group, decreased expression of Ago2 protein was observed in cells treated with miR-99a-Lip2000, miR-99a-PEAL-LA NPs and miR-99a-PEAL-LA/VEGFab NPs and among them, miR-99a-PEAL-LA/VEGFab NPs showed the most pronounced inhibitory effect resulting in more than 60% decrease of Ago2 protein expression. [score:6]
Double -targeted miR-99a-PEAL-LA/VEGFab NPs had excellent specificity for HepG2 hepatocellular carcinoma cells and exhibited synergic efficacy in delivering miR-99a to the target cells. [score:5]
Previous research has revealed that mTOR was an acknowledged target gene of miR-99a and the restoration of miR-99a in HCC could dramatically reduce its expression on both mRNA and protein level 13. [score:5]
Furthermore, cells cultured with Cy5-miR-99a-PEAL-LA/VEGFab NPs exhibited much brighter fluorescence emission than those cultured with Cy5-miR-99a-PEAL-LA NPs or Cy5-miR-99a-Lip2000, suggesting that Cy5-miR-99a-PEAL-LA/VEGFab NPs containing dual -targeting moieties (LA and VEGFab) exhibit a synergistic targeted effect and show significant enhancement of miR-99a delivery. [score:5]
Therefore, if the miR-99a was restored effectively in HCC, the expression of mTOR mRNA, mTOR protein as well as Ago2 protein would be inhibited significantly. [score:5]
The ideal anticancer therapy would need to effectively facilitate miR-99a interaction with its target genes through the effective delivery of miR-99a to target cells, such as HepG2 hepatocellular carcinoma cells. [score:5]
These results suggest that miR-99a-PEAL-LA/VEGFab NPs effectively suppress tumor growth by inhibiting proliferation and inducing apoptosis in HCC tumor cells. [score:5]
These results suggest that the dual -targeting PEAL-LA/VEGFab NPs could deliver miR-99a into HepG2 cells most effectively, which results in the inhibition of the proliferation of tumor cells and enhanced anti-tumor activity in vitro. [score:5]
The western blot results revealed that the PEAL-LA/VEGFab NPs could mediate the most effectively delivery of miR-99a and subsequently regulate the expression of Ago2 protein. [score:4]
Intravenous delivery of miR-99a -loaded NPs suppresses growth of HCC xenografts in nude mice. [score:3]
Moreover, the nearly neutral charge of miR-99a-PEAL-LA/VEGFab NPs should favor binding with the target receptor on the cell membrane and promote NPs internalization. [score:3]
These results are consistent with the CLSM results and further confirm that the modification of double -targeting moieties (LA and VEGFab) results in greater endocytosis of miR-99a-PEAL-LA/VEGFab NPs by HepG2 cells and enhances delivery efficiency of miR-99a. [score:3]
Both miR-99a-PEAL-LA NPs and miR-99a-PEAL-LA/VEGFab NPs showed rapid miR-99a release of approximately 30% at 12 h. Over the subsequent 132 h, the miR-99a was sustainably released to final cumulative levels of 79.01 ± 2.08% and 81.33 ± 1.86% for miR-99a-PEAL-LA NPs and miR-99a-PEAL-LA/VEGFab NPs, respectively, which contributes to prolonged interaction time between miR-99a and the target genes and enhances therapeutic efficiency. [score:3]
To test the efficacy of the NPs -mediated delivery of miR-99a, we analyzed HepG2 cells treated with our NPs-miR-99a nanocomplexes for the expression of mTOR mRNA by qRT-PCR, mTOR protein and Ago2 protein by western blot. [score:3]
386.30 ± 6.77, P < 0.01), their inhibitory efficiency was far less than that of miR-99a-PEAL-LA/VEGFab NPs, which resulted in a substantial decrease in the migratory activity of HepG2 cells (170.00 ± 4.51 vs. [score:3]
Previous study showed that Ago2 was a novel target gene of miR-99a. [score:3]
In contrast, the tumor growth inhibition of mice treated with miR-99a-PEAL-LA NPs or miR-99a-PEAL-LA-VEGFab NPs was much higher than that of mice receiving PBS or PEAL NPs. [score:3]
Moreover, more effective inhibition was observed in cells treated with miR-99a-PEAL-LA/VEGFab NPs (24.00 ± 1.00 vs. [score:3]
Similarly, the results of the invasion assay depicted in Fig. 5C and D also showed that miR-99a-PEAL-LA/VEGFab NPs achieve better inhibition of cell invasion than PBS, miR-99a-Lip2000, or miR-99a-PEAL-LA NPs (207.30 ± 4.67 vs. [score:2]
As shown in Fig. 4A, decreased expression of mTOR mRNA was observed in cells treated with miR-99a-Lip2000, miR-99a-PEAL-LA NPs and miR-99a-PEAL-LA/VEGFab NPs compared with the PBS group. [score:2]
Then, Cy5-miR-99a-Lip2000, Cy5-miR-99a-PEAL-LA NPs or Cy5-miR-99a-PEAL-LA/VEGFab NPs, each containing equivalent amounts of Cy5-miR-99a, was added to the culture dish and incubated in the dark for 4 h. Then, the cells were fixed with 4% paraformaldehyde for 15 min and stained with DAPI for another 10 min. [score:1]
Then, miR-99a-Lip2000, miR-99a-PEAL-LA NPs or miR-99a-PEAL-LA/VEGFab NPs, each containing an equivalent amount of miR-99a, was added and incubated for 6 h. Cells treated with PBS were used as a negative control. [score:1]
Has-miR-99a mimics (miR-99a, sense strand, 5′-AACCCGUAGAUCCGAUCUUGUG-3′ and anti-sense strand, 5′-CAAGAUCGGAUCUACGGGUUUU-3′), Cy5 labeled has-miR-99a mimics (Cy5-miR-99a) were purchased from Ribobio (Guangzhou, China). [score:1]
To facilitate observations by CLSM, miR-99a was labeled with the Cy5 fluorescent probe to form Cy5-miR-99a-PEAL-LA NPs and Cy5-miR-99a-PEAL-LA/VEGFab NPs. [score:1]
Then, the miR-99a-NPs suspension was subjected to centrifugation (15,000 rpm, 4 °C, 30 min) at predetermined intervals. [score:1]
Briefly, 200 HepG2 cells from each group (PBS, miR-99a-Lip2000, miR-99a-PEAL-LA NPs and miR-99a-PEAL-LA/VEGFab NPs) were seeded in 60-mm dishes containing complete medium and were cultured for 14 days at 37 °C in a 5% CO [2] incubator. [score:1]
This study highlights the great potential of miR-99a-PEAL-LA/VEGFab NPs for tumor therapy applications. [score:1]
In addition, miR-99a-PEAL-LA/VEGFab NPs exhibited a remarkably sustained release of miR-99a. [score:1]
The cellular uptake of the Cy5-labeled miR-99a was determined using an FV1000 confocal laser scanning microscope (Leica, Germany). [score:1]
Two milliliters of miR-99a-PEAL-LA NPs or miR-99a-PEAL-LA/VEGFab NPs solution was dispensed in an RNase-free tube containing 5 mL of TE buffer, and the tubes were shaken horizontally in a thermostatic shaker (37 °C, 120 rpm/min). [score:1]
The monodispersed PEAL-LA NPs, PEAL-LA/VEGFab NPs and miR-99a-PEAL-LA/VEGFab NPs exhibited similar spherical morphologies with average diameters of 50.06 ± 1.16 nm, 49.46 ± 1.19 nm and 50.95 ± 1.21 nm, respectively (Fig. 1B). [score:1]
After synthesis of the nanoparticles, 250 μL of EDC (1 mg/mL) and 250 μL of NHS (1 mg/mL) were added to a 5 mL solution containing 10 mg of miR-99a-PEAL-LANPs. [score:1]
As shown in Fig. 3A, after 4 h of co-incubation, the fluorescent signal (red) in cells treated with Cy5-miR-99a-PEAL-LA NPs was similar to those incubated with Cy5-miR-Lip2000, suggesting that PEAL-LA NPs can achieve similar transfection efficiencies to Lip2000. [score:1]
Preparation of miR-99a-PEAL-LA NPs. [score:1]
Overall, miR-99a-PEAL-LA/VEGFab NPs were successfully constructed and applied as a highly effective HCC treatment modality. [score:1]
Then, Cy5-miR-99a-Lip2000, Cy5-miR-99a-PEAL-LA NPs or Cy5-miR-99a-PEAL-LA/VEGFab NPs, each containing an equivalent amount of Cy-5-miR-99a, was added to the cells and incubated for 4 h. Cells treated with PBS were used as a negative control. [score:1]
With the encapsulation of negatively charged miR-99a, the average zeta potential of miR-99a-PEAL-LA/VEGFab NPs decreased to 3.02 mV, which is indicative of the effective loading of the miR-99a. [score:1]
Then, miR-99a-Lip2000, miR-99a-PEAL-LA NPs or miR-99a-PEAL-LA/VEGFab NPs, each containing an equivalent amount of miR-99a, was added to cells and co-cultured for 6 h. PBS treatment was used as a negative control. [score:1]
Preparation of miR-99a-PEAL-LA/VEGFab NPs. [score:1]
In vivo antitumor experiments further verified the effectiveness of miR-99a-PEAL-LA/VEGFab NPs as a therapeutic nanomedicine. [score:1]
To explore the in vivo antitumor efficiency of NPs, we used a HepG2 subcutaneous xenograft nude mouse mo del to monitor tumor progression and test the superiority of the miR-99-PEAL-LA/VEGFab NPs delivery system. [score:1]
In the present work, we prepared the miR-99a-PEAL-LA/VEGFab NPs using a two-step synthetic route (Fig. 1A). [score:1]
First, the miR-99a was loaded onto the PEAL-LA copolymers via ultrasonic emulsification to form miR-99a-PEAL-LA NPs. [score:1]
Although our study is focused on the HCC therapy by miR-99a -loaded nanocarriers, due to the high similarity with human internal environment, these miRNA -based anti-cancer therapies may also be effective for other tumors such as renal cell carcinoma and breast cancer 39 40. [score:1]
First, the miR-99a-PEAL-LA/VEGFab NPs are small enough to pass through the cell membrane by receptor -mediated endocytosis and escape uptake by the reticuloendothelial system (NPs > 100 nm are recognized by the RES) 16 36. [score:1]
These results suggest that the miR-99a-PEAL-LA/VEGFab NPs induce no significant systemic toxicity or other physiological complications in vivo at the tested dose. [score:1]
The miR-99a-PEAL-LA/VEGFab NPs we constructed showed a relatively uniform size distribution with an average diameter of approximately 50 nm, which is an optimal size for NPs as non-viral vectors for the following reasons. [score:1]
The resulting water/oil/water emulsion was transferred to a rotary evaporator to evaporate the organic solvent and obtain the miR-99a-PEAL-LA NPs. [score:1]
As shown in Fig. 7B–D, all biochemistry parameters of mice treated with miR-99a-PEAL-LA/VEGFab NPs were within ranges similar to mice treated with PBS. [score:1]
The obtained sediment was washed and then re-dissolved in PBS to obtain miR-99a-PEAL-LA/VEGFab NPs. [score:1]
Second, VEGFab was conjugated to the miR-99a-PEAL-LA NPs to form miR-99a-PEAL-LA/VEGFab NPs. [score:1]
One nanomoles of miR-99a was dissolved in 50 μL of RNase-free water and emulsified in 500 μL dichloromethane solution containing 5 mg of PEAL-LA copolymer by sonication (Scientz sonicator probe, Scientz, China) at 400 W for 1 min to obtain a water/oil emulsion. [score:1]
The final tumor size of mice treated with miR-99a-PEAL-LA/VEGFab NPs was approximately 50 mm [3], which was remarkably smaller than that of the other groups, confirming effective antitumor efficiency of this NP formulation in HCC-bearing mice. [score:1]
The miR-99a was entrapped in the hydrophobic PLGA core via hydrophobic interactions, and partial miR-99a adsorbed to the positively charged PLL chains through electrostatic interactions. [score:1]
[1 to 20 of 59 sentences]
8
[+] score: 152
Here, combination of photofrin based PDT and miR-99a overexpression very effectively down regulated expression of FGFR3, which might directly or indirectly inhibit expression of PI3K and Akt, with an increase in expression of p53. [score:14]
Recent studies showed that miR-99 family was upregulated following DNA damage and miR-99 expression correlated well with radiation sensitivity due to down regulation of SNF2H, a miR-99 family target [35]. [score:9]
Our results also showed that photofrin based PDT followed by miR-99a overexpression could directly or indirectly inhibit fibroblast growth factor receptor 3 (FGFR3) and PI3K/Akt signaling mechanisms to trigger the p53 -mediated caspase -dependent pathway of apoptosis in the p53 wild-type glioblastoma cells both in vitro and in vivo. [score:7]
Upregulation of miR-99a occurred to some extent in both cell lines following photofrin based PDT when compared with the untreated control cells, but upregulation of miR-99a reached a maximum level in the cells that were subjected to combination of photofrin based PDT and miR-99a transfection. [score:6]
To determine the possible signaling mechanisms for anti-proliferative and pro-apoptotic activity of photofrin based PDT and miR-99a overexpression, we performed Western blotting and detected alterations in the expression of the regulatory factors for cell growth and apoptosis in both cell lines (Fig. 6c). [score:6]
Photofrin based PDT and miR-99a overexpression very efficiently suppressed the levels of FGFR3, PI3K, and Akt to promote p53 -mediated mitochondrial caspase -dependent apoptosis. [score:5]
These results clearly suggested that miR-99a could act as a tumor suppressor and an increase in level of expression of miR-99a could further increase amounts of apoptosis in glioblastoma cell lines. [score:5]
Anti-miR-99a transfection inhibited the photofrin based PDT enhancement of miR-99a expression in both glioblastoma cell lines. [score:5]
We have performed real-time qRT-PCR to examine the levels of expression of the tumor suppressor miR-99a in photofrin treated glioblastoma U87MG and U118MG cells after irradiation, without or with miR-99a transfection (Fig. 7). [score:5]
After 4 h incubation, cells were transfected with 50 nM anti-miR-99a mimic or miR-99a mimic and incubated for another 24 h. Total RNA was extracted and cDNA was synthesized using gene specific primers, and real-time qRT-PCR analysis was performed for relative expression of miR-99a after normalizing with expression of U6 RNA (control) in glioblastoma U87MG and U118MG cells. [score:4]
A recent study showed that the upregulation of the miR-99 family following radiation decreased the efficiency of repair factor recruitment and the rate of DNA repair after a second exposure to radiation [35]. [score:4]
The induction of miR-99a expression represents a switch by which cells subjected to multiple rounds of radiation are directed away from continuing to repair their DNA. [score:4]
Efficacy of Photofrin Based PDT and miR-99a Overexpression for Tumor Regression. [score:3]
Photofrin based PDT followed by transfection of miR-99a mimic could significantly increase induction of apoptosis due to dramatic miR-99a overexpression. [score:3]
Real-time qRT-PCR analyses of miR-99a expression in U87MG and U118MG cells after photofrin based PDT and miR transfection. [score:3]
Photofrin Based PDT followed by Ectopic Overexpression of miR-99a Increased Apoptotic Death. [score:3]
We observed increases in expression of miR-99a in glioblastoma cells after photofrin based PDT. [score:3]
In essence, our current findings clearly demonstrated that the combination of photofrin based PDT and miR-99a overexpression could serve as a new therapeutic strategy for an effective treatment of human glioblastomas harvoring p53 wild-type. [score:3]
Further, our in vivo studies showed that combination of photofrin based PDT and miR-99a overexpression very effectively reduced the growth of both U87MG and U118MG xenografts in athymic nude mice (Fig. 8a, 8b, 8c). [score:3]
Determination of Levels of Expression of miR-99a by Real-time qRT-PCR. [score:3]
Down regulation of miR-99a has been reported in several human cancers [34], suggesting the important role of low level of miR-99a in cancer development. [score:3]
We studied the effects of miR-99a overexpression that enhanced the efficacy of photofrin based PDT for induction of apoptosis in glioblastoma cell lines. [score:3]
The expression of miR-99a relative to U6 RNA (control) was determined using the 2 [−ΔCT] method [41]. [score:3]
The results of this study revealed the molecular basis for the effectiveness of combination of photofrin based PDT and miR-99a transfection for inhibiting growth of the p53 wild-type glioblastoma cells in vitro and in vivo. [score:3]
Following treatments, H&E staining of tumor sections showed that control tumors maintained characteristic growth, photofrin based PDT or miR-99a overexpression alone induced cell death to some extent, but combination of photofrin based PDT and miR-99a overexpression dramatically increased cell death in both U87MG and U118MG xenograft mo dels (Fig. 8d). [score:3]
The efficacy of combination of photofrin based PDT and miR-99a overexpression in increasing apoptosis in human glioblastoma U87MG and U118MG cell lines was analyzed by flow cytometry and Western blotting (Fig. 6). [score:3]
Photofrin based PDT could increase miR-99a expression to some extent in the p53 wild-type glioblastoma cells. [score:3]
The expression of miR-99a precursor was determined using real-time qRT-PCR method [40] with some modifications. [score:3]
So, our results from xenograft mo dels further confirmed that combination of photofrin based PDT and miR-99a transfection inhibited FGFR3 and PI3K/Akt signaling pathways to promote p53 -mediated mitochondrial caspase -dependent apoptosis in human glioblastomas in vivo. [score:3]
Augmentation of efficacy of photofrin based PDT by miR-99a overexpression for induction of apoptosis in U87MG and U118MG cells. [score:3]
Quantification of miR-99a Expression after Photofrin Based PDT or/and miR-99a Transfection. [score:3]
However, the role of miR-99a in glioblastoma development still remains unknown. [score:2]
As observed from flow cytometric analyses, photofrin based PDT alone could induce some apoptosis, which appeared to be significantly increased with combination of photofrin based PDT and miR-99a transfection (Fig. 6a, 6b). [score:1]
Histopathological Changes after Photofrin Based PDT and miR-99a Treatments. [score:1]
Transfection of U87MG and U118MG Cells with miR-99a Mimic. [score:1]
We also kept appropriate control (no photofrin and irradiation) cells and anti-miR-99a mimic and miR-99a mimic transfected cells for relative efficacy studies. [score:1]
After photofrin based PDT or/and miR-99a administration as described above, protein samples were isolated from the gliobalstoma U87MG and U118MG cells and xenografts. [score:1]
Significant difference between untreated control (CTL) and photofrin based PDT or miR-99a transfection was indicated by * P<0.05 or ** P<0.01. [score:1]
After photofrin based PDT and miR-99a transfection, the anti-cancer effects were analyzed at the cellular and molecular (DNA, RNA, and protein) levels. [score:1]
Following 4 h incubation, cells were transfected with 50 nM pre-miR-99a mimic and incubated for another 24 h. (a) Cells were collected for estimation of apoptosis by Annexin V-FITC/PI double staining and flow cytometry. [score:1]
Here, we investigated whether miR-99a overexpression could significantly enhance the therapeutic efficacy of photofrin based PDT. [score:1]
An equal volume of either anti-miR-99a or miR-99a and atelocollagen [44] (0.1% in PBS, pH 7.4) were mixed for 1 h at 4°C. [score:1]
This photochemical reaction may help the miR-99a transfection process. [score:1]
We also investigated the important molecular mechanisms for the anti-cancer effects of the combination of photofrin based PDT and miR-99a overexpression in human glioblastoma cells in culture and xenograft mo dels. [score:1]
Finally, anti-miR-99a or miR-99a (50 µg) with 0.05% atelocollagen in 200 µl was injected (via tail vein) into each mouse on 14 [th], 17 [th], and 20 [th] days. [score:1]
After each desired treatment, irradiation, and miR-99a transfection, total RNA was extracted from 3×10 [6] cells using TRIZOL according to the manufacturer’s protocol (Invitrogen, Carlsbad, CA, USA). [score:1]
We observed induction of more apoptosis when miR-99a transfection was carried out using Lipofectamine after irradiation. [score:1]
The most important outcome of this investigation is the establishment of molecular basis of the efficacy of the combination of photofrin based PDT and miR-99a overexpression in controlling the growth of human glioblastoma cells (p53 wild-type) invitro and in vivo. [score:1]
After 4 h, cells were irradiated (1 J/cm [2]) and incubated for another 4 h. Then, the cells were transfected with miR-99a oligomeric RNA at 50 nM final concentration using 20 µl Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) and Opti-MEM medium following manufacturer’s protocol (Invitrogen, Carlsbad, CA, USA). [score:1]
The tumor-bearing mice were categorized into five separate experimental groups (control, anti-miR-99a, miR-99a, photofrin, and photofrin+miR-99a). [score:1]
Then, the mixture of miR-99a mimic (50 µg) and 0.05% atelocollagen in 200 µl was injected (via tail vein) into each mouse on 14 [th], 17 [th], and 20 [th] days. [score:1]
[1 to 20 of 51 sentences]
9
[+] score: 40
miR-99 family of MicroRNAs suppresses the expression of prostate-specific antigen and prostate cancer cell proliferation. [score:5]
It has been reported that mammalian target of rapamycin (mTOR) is one of the targets of both miR-99 and miR-100 (Sun et al., 2011; Li et al., 2013; Xu et al., 2013). [score:5]
Among the potential targets, mTOR was taken into consideration, which had been proved as one of the major targets of miR-99 family. [score:5]
Here, mTOR is a common target of miR-99 and miR-100, and it is also a pivotal molecule involved in neurodegenerative diseases. [score:5]
It has been demonstrated that the miR-99 can repress three targets: mTOR, SMARCA5 (SWI/SNF-related, matrix -associated, actin -dependent regulator of chromatin, subfamily a, member 5), and SMARCD1 (SWI/SNF-related, matrix -associated, actin -dependent regulator of chromatin, subfamily d, member 1) (Sun et al., 2011). [score:5]
Down-regulation of the microRNA-99 family members in head and neck squamous cell carcinoma. [score:4]
The miR-99 family regulates the DNA damage response through its target SNF2H. [score:4]
MicroRNA-99 family was found to be deregulated in different cancer types (Zhang et al., 2009; Doghman et al., 2010; Sun et al., 2011; Chen et al., 2012; Zheng et al., 2012; Jin et al., 2013; Mueller et al., 2013), but the role of miR-99 family in neuronal cell differentiation or cell death is not clear. [score:2]
Studies have shown that miR-99 family regulates cell survival, cell stress response, proliferation, angiogenesis, DNA damage, and wound healing process (Zhang et al., 2009; Doghman et al., 2010; Sun et al., 2011; Chen et al., 2012; Zheng et al., 2012; Jin et al., 2013; Mueller et al., 2013). [score:2]
MicroRNA-99 family targets AKT/mTOR signaling pathway in dermal wound healing. [score:2]
MiR-99b-5p and miR-100-5p belong to the same miR-99 family, which consists of three members, miR-99a, miR-99b, and miR-100. [score:1]
[1 to 20 of 11 sentences]
10
[+] score: 30
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30a A notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30aA notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
The megaloop contains, among other features, a conserved pair of target sites for miR-320a and miR-182 (Fig.  4b) and a conserved triplet of target sites for miR-378, miR-99a and miR-30a (Fig.  4c). [score:5]
The miR-99a and miR-30a target sites are found in the Latimeria sequence and can therefore be inferred to have been present in the last common ancestor of tetrapods and lobe-finned fishes. [score:3]
[1 to 20 of 4 sentences]
11
[+] score: 22
To normalize the detection method of miR-1253 expression in NSCLC, two other miRNAs, namely, miR-99a and MiR-18a-5p, were assessed, and a similar approach demonstrated that expression miR-99a was significantly down-regulated and miR-18a-5p was obviously up-regulated in tumor tissue samples compared with the controls (Supplementary Figure S1a-b) 21, 22. [score:10]
To normalize the detection method of miR-1253 expression in NSCLC, two other miRNAs, namely, miR-99a and MiR-18a-5p, were assessed, and a similar approach demonstrated that expression miR-99a was significantly down-regulated and miR-18a-5p was obviously up-regulated in tumor tissue samples compared with the controls (Supplementary Figure S1a-b) 21, 22. a miR-1253 level was measured by qRT-PCR in 70 NSCLC and pair-matched lung tissue samples, and normalized against endogenous U6 RNA. [score:8]
The expression of miR-1253 was normalized to miR-99a and miR-18a-5p. [score:3]
Feliciano A miR-99a reveals two novel oncogenic proteins E2F2 and EMR2 and represses stemness in lung cancerCell Death Dis. [score:1]
[1 to 20 of 4 sentences]
12
[+] score: 21
LPS down-regulates AChR expression resulting in acetylcholine increase, down-regulates α7 nAChR expression and changes the levels of miR-132/212, miR-9, miR-99 and let-7g. [score:11]
Another brain-abundant miRNA-99 regulates pro-survival Akt/mTOR signaling (Jin et al., 2013); its up-regulation with LPS was expected to decrease the brain cell viability; whereas the α7(1–208)-specific antibody limited this effect. [score:5]
MiR-99a was obviously up-regulated by both nicotine and LPS and the effect of LPS was withdrawn by the antibody. [score:3]
MicroRNA-99 family targets AKT/mTOR signaling pathway in dermal wound healing. [score:2]
[1 to 20 of 4 sentences]
13
[+] score: 17
Many of these upregulated miRNAs were known oncomiRs in breast cancer, such as miR-200, miR-141 and miR-223 [21– 23], Also, many of down-regulated miRNAs in MCF7 HER2 cells were tumor suppressors, such as miR-125b, miR-31 and miR-99a [24– 26]. [score:9]
Our qRT-PCR data demonstrated that miR-489, miR-125b and miR-99a at least partially restored their expression profile after inhibition of HER2 phosphorylation (Figure 1C). [score:5]
A comparison of our data with these published expression signatures revealed several miRNAs previously found to be associated with HER2 such as miR-125, miR-99a and miR-21 [30, 33, 34]. [score:3]
[1 to 20 of 3 sentences]
14
[+] score: 17
In the ileum, IPA indicated that increases in miR-34a-5p alters NF-κB; let-7g and miR-98 regulates STAT3; miR-34a, mR-188-5p, let-7a-5p, and miR-151-5p regulate MAPK; miR-20b regulates IL-10; let-7g and miR-98 regulate IL-10, IL-13, IL-6; miR-15b regulates IL-6; whereas miR-99a and miR-100 regulate TNF (Fig 8). [score:7]
CI increases not only miR-15, miR-99, and miR-100 that target IL-6 and TNF, but also let-7g and miR-98 that target STAT3, whose activation transcribes iNOS [61– 64]. [score:5]
RI and CI also increase miR-15, miR-99, and miR-100, which target IL-6 and TNF. [score:3]
Increases in miR-98, let-7g, miR-15b, miR-99a, and miR-100 predict to regulate STAT3, IL-10, IL-13, IL-6, and TNF. [score:2]
[1 to 20 of 4 sentences]
15
[+] score: 17
For example, miR-99a cooperates with miR-150 to repress the expression of the mammalian target of rapamycin (mTor), a known inhibitor of iTreg differentiation (29). [score:7]
Whereas miR-99a expression was upregulated by RA exposure and repressed mTor by binding to the 3′ UTR (29), miR-150 only repressed mTor in the presence of miR-99a (29). [score:6]
Together, these data identify miRNA agonist targets (miR-99a, miR-150, iR-15b-16, miR-100, miR-126, and miR-155) that can be exploited to increase iTreg generation. [score:3]
miR-10b, miR-99a, miR-130a, miR-146b, miR-150, and miR-320 were amongst those found to drive Treg differentiation. [score:1]
[1 to 20 of 4 sentences]
16
[+] score: 15
In addition, the miR-99 family has been shown to directly target Mtor (mammalian target of rapamycin) [28], [29]. [score:6]
KEGG pathway analysis predicted, with a high degree of confidence (p<0.001), miR-99b regulation of the mTOR (mammalian target of rapamycin) pathway, whereas association of miR-99a and miR-100 with the mTOR pathway was predicted with lower confidence (p<0.005) (Figures 5B, 6B, and 9B). [score:4]
miR-99a-5p belongs to expression cluster 4, miR-99b-5p to cluster 7, and miR-100-5p to cluster 3 (Figures 5A, 6A, and 9A). [score:3]
The validity of this pathway clustering approach is further supported by analysis of the miRNA family formed by miR-99a, miR-99b, and miR-100. [score:1]
As discussed above, several studies demonstrated the role of the miR-99 family in repressing mTOR signaling in different cell systems, including wound healing keratinocytes, as well as prostate, endometrial, and pancreatic cancer cells [28], [29], [44], [45]. [score:1]
[1 to 20 of 5 sentences]
17
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
adj ssc-miR-371-5p 11.3640 6.94E-19 7.93E-18 ssc-miR-219b-3p 10.1953 2.42E-32 1.94E-30 ssc-miR-218b 5.3242 5.95E-18 5.95E-17 ssc-miR-92b-3p 3.2034 3.39E-17 3.01E-16 ssc-miR-7138-3p 2.0714 1.31E-02 1.59E-02 ssc-miR-219a 2.0675 1.31E-07 4.37E-07 ssc-miR-99a 1.4504 2.83E-06 8.09E-06 ssc-miR-128 1.1854 1.31E-05 3.49E-05To validate this differential miRNA expression pattern, we performed quantitative stem-loop RT-PCR to assess the expression of the three[35] selected hpiPSCs- specific miRNAs: ssc-miR-371-5p, ssc-miR-106a and ssc-miR-363, which were found to be more highly expressed in hpiPSCs (Fig 3B). [score:7]
adj ssc-miR-371-5p 11.3640 6.94E-19 7.93E-18 ssc-miR-219b-3p 10.1953 2.42E-32 1.94E-30 ssc-miR-218b 5.3242 5.95E-18 5.95E-17 ssc-miR-92b-3p 3.2034 3.39E-17 3.01E-16 ssc-miR-7138-3p 2.0714 1.31E-02 1.59E-02 ssc-miR-219a 2.0675 1.31E-07 4.37E-07 ssc-miR-99a 1.4504 2.83E-06 8.09E-06 ssc-miR-128 1.1854 1.31E-05 3.49E-05 To validate this differential miRNA expression pattern, we performed quantitative stem-loop RT-PCR to assess the expression of the three[35] selected hpiPSCs- specific miRNAs: ssc-miR-371-5p, ssc-miR-106a and ssc-miR-363, which were found to be more highly expressed in hpiPSCs (Fig 3B). [score:7]
[1 to 20 of 2 sentences]
18
[+] score: 14
Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42]. [score:8]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
[1 to 20 of 3 sentences]
19
[+] score: 14
Members of the miR-99 family (miR99a, and miR100, the fourth and seventh most abundant mouse sRNAs) are miRNAs that have been shown to co-enrich with polyribosomes in mammalian neurons, and regulate the mammalian target of rapamycin (mTOR) pathway 46. miR22, the eighth most abundant mouse sRNA, is important for cerebellar development, and in adults has been shown to protect neurons from neurodegeneration, and is down regulated in both Huntington’s and Alzheimer’s disease 47. miR127, along with a cluster of miRNAs found on chromosome14q32, is maternally expressed, and the down regulation of miRNAs within this cluster (including miR127) has been linked to schizophrenia 48. [score:11]
The third, fourth, seventh, eighth and ninth mapped to neuronal associated microRNAs, including miR128, miR99, miR100, miR22, and miR127 (21–22 nt). [score:1]
However, a previous study has demonstrated that miR99a is released from synaptosomes in an activity and calcium dependent manner, consistent with the release from SVs, and synthetic miRNAs were taken up by synaptosomes via an unspecified endocytic pathway 13. [score:1]
The most abundant sequences of sRNAs isolated and sequenced were over 30 nt; however, we did isolate and sequence miRNAs in the 20–21 nt range, including miR128, miR99a, miR100, miR22, and miR127. [score:1]
[1 to 20 of 4 sentences]
20
[+] score: 11
Noveski et al. determined that miR-23b, miR-32, miR-154 and miR-99 in MArrest and SCOS were up-regulated [42], and we found that these genes were also up-regulated in NOA. [score:7]
For the up-regulated genes, 21 genes among 717 genes (0.029%) were common among PostMA, MA and SCOS, and half of these genes were miRNA (LOC100130428, LOC100131541, MALAT1, MGC24103, miR-145, miR-199a-2, miR-21, miR-27b, miR-30e, miR-32, miR-99a, miR-LET7A2, miR-LET7C, miR-LET7G, PP12719, PWAR6, SNX2, TET2, ZEB2, ZNF189 and ZNF737). [score:4]
[1 to 20 of 2 sentences]
21
[+] score: 10
Evidence of the concerted interplay of miRNAs regulated by CpG-ODN and their potential target mRNAs was observed (Fig. 4) for 2 miRNAs upregulated (hsa-miR-302b and hsa-miR-374b) and for 13 miRNAs downregulated in CpG-ODN -treated mice (hsa-miR-135a, hsa-miR-136, hsa-miR-340, hsa-miR-445-5p, hsa-miR-424, hsa-miR-96, hsa-miR-142-3p, hsa-miR-140-5p, hsa-miR-542-3p, hsa-miR-18a, hsa-miR-18b, hsa-miR-101, and hsa-miR-99a). [score:10]
[1 to 20 of 1 sentences]
22
[+] score: 10
Next to miR-204, the next most highly expressed MG miRNAs (with less than 20% expression in neurons) were miR-125b, and miR-9. These two miRNAs are also highly expressed in P7 FAC-sorted astrocytes of the forebrain, along with several others of the most highly expressed mGliomiRs (miR-99a, miR-204, miR-135a) and shared miRs (miR-720, let-7b, miR-29a, and miR-30d) 40. [score:9]
For the other mGliomiRs, miR-135a 40 51, miR-23a 45, and miR-99a 40 have been reported in astrocytes as well as for Schwann cells in the sciatic nerve along with miR-100 48, indicating that these miRNAs could be common among glia. [score:1]
[1 to 20 of 2 sentences]
23
[+] score: 9
The upregulated miRNAs included mmu-miR-34a-5p, mmu-miR-129b-5p, mmu-miR-451a, mmu-miR-144-5p and mmu-miR-129b-3p, whereas highly downregulated miRNAs included mmu-miR-100-5p, mmu-miR-99a-5p, mmu-miR-33-5p, mmu-miR-125a-5p, mmu-miR-128-1-5p, mmu-miR-181b-1-3p, mmu-miR-188-5p, mmu-miR-196b-5p, mmu-miR-211-5p, mmu-miR-224-5p, mmu-miR-455-3p, mmu-miR-504-5p, mmu-miR-592-5p, mmu-miR-5107-3p, mmu-miR-5120, and mmu-let-7i-3p. [score:7]
Akbari Moqadam F. Lange-Turenhout E. A. Aries I. M. Pieters R. den Boer M. L. MiR-125b, miR-100 and miR-99a co-regulate vincristine resistance in childhood acute lymphoblastic leukemia Leuk. [score:2]
[1 to 20 of 2 sentences]
24
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
After 6 and 12 wks of E [2] exposure, 15 miRNAs were down-regulated, e. g., miR-22, miR-99a, miR-106a, miR-127, miR-499, and 19 miRNAs were-up-regulated, e. g., miR-17-5p, miR-20a, miR-21, miR-129-3p, miR-106a, miR-22, and miR-127. [score:7]
[1 to 20 of 1 sentences]
25
[+] score: 7
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In a number of single studies, miRNAs such as let-7d [26], let-7i [26] and miR-210 [23] were also found to be up-regulated in prostate cancer, in contrast to let-7g [23], miR-27b [28], miR-99a [23], miR-126 [54], miR-128 [26], miR-152 [28], miR-200a [58] and miR-449a [59] which were down-regulated in prostate cancer samples. [score:7]
[1 to 20 of 1 sentences]
26
[+] score: 7
Among the five miRNAs predicted to target SREBP-1c, gga-miR-99a, gga-miR-100, gga-miR-200b and gga-miR-429 were found to be significantly (P < 0.05) up-regulated in the liver of leptin -treated chickens. [score:6]
It is noteworthy that gga-miR-99a and gga-miR-100 belong to the miRNA gene family of miR-99, while the remaining three miRNAs, gga-miR-200a, gga-miR-200b and gga-miR-429, belong to the miRNA gene family of miR-8, located in the same miRNA cluster. [score:1]
[1 to 20 of 2 sentences]
27
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
Several microRNAs had similar expression when comparing results from the present study with those of There were nine microRNAs (bta-miR-10b, bta-miR-423-3p, bta-miR-99a-5p, bta-miR-181a, bta-miR-423-5p, bta-miR-148a, bta-miR-26a, bta-miR-192, and bta-miR-486), that were upregulated in earlier stages of life in both studies. [score:6]
[1 to 20 of 1 sentences]
28
[+] score: 6
Cluster1-a (let-7a-2, miR-100, miR-125b-1) and Cluster1-b (let-7c, miR-99a, miR-125b-2) are involved in HSPC (hematopoietic stem and progenitor cell) homeostasis such as self-renewal, proliferation, quiescence, and differentiation by blocking TGFβ pathway and amplifying Wnt signaling (Emmrich et al., 2014), whereas LIN28B represses let-7 to inhibit erythroid development and maintain stemness (Copley et al., 2013; Lee et al., 2013b). [score:4]
Moreover, let-7 is known to regulate hematopoietic stem cell fate along with miR-99a/100, miR-125b-1/2, and LIN28B (Copley et al., 2013; Lee et al., 2013b; Emmrich et al., 2014). [score:2]
[1 to 20 of 2 sentences]
29
[+] score: 6
Other miRNAs from this paper: hsa-mir-99a, mmu-mir-99b, hsa-mir-99b
To validate that hypothesis we generated target site predictions for the human miRNA family miR-99, consisting of four different miRNAs, for all 9158 human mRNAs by training on the 10 most-abundantly expressed human miRNAs. [score:5]
We were able to successfully predict 134 out of 155 MTIs in the miRTarBase database for the miR-99 miRNA family, thereby achieving a recall value of 86.5 %. [score:1]
[1 to 20 of 2 sentences]
30
[+] score: 5
Recently, it has been shown that five miRNA genes are overexpressed in the heart and brain of people with Down syndrome [24], three of which (miR-99a, let-7c, miR-125b-2) are expressed in the inner ear [25]. [score:5]
[1 to 20 of 1 sentences]
31
[+] score: 5
MiR-125 (5,811 CPM) and miR-99 (12,280 CPM) were also expressed highly in the developing mouse brain. [score:3]
Together with let-7c, both miR-125 and miR-99 are over-expressed by at least 50% in the foetal hippocampus of individuals with Down syndrome compared to age and sex matched controls suggesting that miRNAs are playing an important role in this brain region, which is pertinent for learning and long-term memory formation [51]. [score:2]
[1 to 20 of 2 sentences]
32
[+] score: 5
miR-155 is required for α-syn -induced inducible nitric oxide synthase (iNOS) expression in microglia in mo dels of PD [14], while three of these miRNAs (miR-125b-5p, miR-342-3p, and miR-99a) were specifically expressed in microglia [15]. [score:5]
[1 to 20 of 1 sentences]
33
[+] score: 5
Of the 113 miRNAs with significantly aberrant expressions after RDX exposure, the expression levels of 10 miRNAs were significantly increased in both mouse liver and brain (p < 0.01): miR-99a, miR-30a, miR-30d, miR-30e, miR-22, miR-194, miR-195, miR-15a, miR-139-5p, and miR-101b. [score:5]
[1 to 20 of 1 sentences]
34
[+] score: 5
For example, miR-625, miR-103/miR-107, miR-21 and miR-301 have been found to promote CRC to invade and metastasize by stimulating multiple metastasis-promoting genes [27– 30], whereas miR-99, miR-137, miR-132 and miR-128 function as tumor suppressors to inhibit the metastasis of CRC [31– 34]. [score:5]
[1 to 20 of 1 sentences]
35
[+] score: 4
Subsequently, we analyzed miRNA content and found a number of immune-related miRNAs expressed in these vesicles, including miR-21, miR-30a, miR-92a, miR-99a and miR-223 (Fig 1e). [score:3]
Sequence bta-miR-21 MI0004742 AUGCUUAUCAGACUGAUGUUGACU bta-miR-30a MI0005054 UGUAAACAUCCUCGACUGGAAGC bta-miR-92a MI0009905 UAUUGCACUUCUGGGCCGGUCU bta-miR-99a MI0004751 AACCCGUAGAUCCGAUCUUGU bta-miR-223 MI0009782 UGUCAGUUUGUCAAAUACCCCA Bovine milk-derived EVs were isolated as described above. [score:1]
[1 to 20 of 2 sentences]
36
[+] score: 4
The overexpression of miR-100, let-7e, and miR-99a, which have been shown to be powerful regulators of the epithelial-to-mesenchymal transition (EMT) [28– 30], was found in the mesenchymal tumor subtype. [score:4]
[1 to 20 of 1 sentences]
37
[+] score: 4
In addition, miR-99 family has been shown to regulate AKT/mTOR signaling by targeting mTOR and AKT1, which may play an important role in wound healing 30. [score:4]
[1 to 20 of 1 sentences]
38
[+] score: 4
miR-99a was not included since it targets only a small number of mRNAs. [score:3]
At 15 dpi, 17 miRNAs (let-7b,c, miR-10a, miR-21, miR-25, miR-26a, miR-29c, miR-30a,b,c,d, miR-99a, miR-103, miR-151, miR-195, and miR-200b,c) were identified to be important in the late repair phase. [score:1]
[1 to 20 of 2 sentences]
39
[+] score: 4
MiRNA expression in psoriatic skin: reciprocal regulation of hsa-miR-99a and IGF-1R. [score:4]
[1 to 20 of 1 sentences]
40
[+] score: 4
miR-99/100 and Let-7a/c have been reported to regulate the cardiac regenerative response in zebrafish and mouse hearts [15]. [score:2]
Consistent with this, Hippo/Yap pathway components 9, 10, the transcription factor Meis1 [11], and a series of microRNA including members of the miR-15 family [12], miR-199a, miR-590 [13], miR-17-92 cluster [14], miR-99/10, and Let-7a/c [15] have been separately implicated in the regulation of CM proliferation. [score:2]
[1 to 20 of 2 sentences]
41
[+] score: 3
Here, by sequence matching using bioinformatics analyses, we found quite a few of candidate miRNAs that target Bcl-2, including miR-429, miR-30, miR-22, miR-25, miR-32, miR-92, miR-363, miR-367, miR-99, miR-27, miR-128, etc. [score:3]
[1 to 20 of 1 sentences]
42
[+] score: 3
Indeed, decreased expression of the miR-99 family in keratinocytes supports wound closure [13]. [score:3]
[1 to 20 of 1 sentences]
43
[+] score: 3
Again, M [TPP] clearly differed from M1 and M2 activation at the miRNA level: M [TPP] had elevated hsa-miR-125a-5p expression and a lack of M1- (hsa-miR-23b-3p) or M2 -associated microRNAs (miRNAs) (e. g., hsa-miR-125b-5p, hsa-miR-99a-5p). [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 3
For example, miR-99a, let-7, miR-125b-2 are located in homozygous deletion regions without known tumor suppressor genes in lung cancer [3]. [score:3]
[1 to 20 of 1 sentences]
45
[+] score: 3
miR-99 is involved in DNA damage response in breast and prostate cancer cells, where overexpression showed an adverse effect on the efficiency of DNA damage repair by both NHEJ and homologous recombination [47]. [score:3]
[1 to 20 of 1 sentences]
46
[+] score: 3
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30b, mmu-mir-126a, mmu-mir-132, mmu-mir-141, mmu-mir-181a-2, mmu-mir-185, mmu-mir-193a, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-34c, mmu-let-7d, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-22, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-34a, mmu-mir-200c, mmu-mir-212, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-378a, mmu-mir-451a, mmu-mir-674, mmu-mir-423, mmu-mir-146b, bta-mir-26a-2, bta-let-7f-2, bta-mir-16b, bta-mir-20a, bta-mir-26b, bta-mir-99a, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-193a, bta-let-7d, bta-mir-132, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-423, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-23b, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-34a, bta-mir-141, bta-mir-146b, bta-mir-16a, bta-mir-185, bta-mir-196a-2, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-29b-1, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-2284y-1, mmu-let-7j, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285t, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2284ab, bta-mir-2284ac
Among them, four miRNA (miR-29b-3p, miR-181a-5p, miR-181b-5 and miR-451a-5p) and five miRNA (miR-20a-5p, miR-23b-3p, miR-26b-5p, miR-99a-5p and miR-199a-3p) in the mouse and bovine, respectively, were expressed in the other species with moderate (over 10,000 reads) to high abundance (Table S2). [score:3]
[1 to 20 of 1 sentences]
47
[+] score: 3
The relative expression of the individual samples was normalized to the geometric mean of RNU19, miR-9 and miR-99a (previously shown not to differ between C57BL/6 J and DBA 2 J, [20]). [score:3]
[1 to 20 of 1 sentences]
48
[+] score: 3
As a control, the total list of miRNAs profiled was randomized in order and 9 miRNAs were selected (miR-452, miR-7, miR-205, miR-15a, miR-144, miR-183, miR-463, miR-25, miR-99a), targets and pathway ontology was analyzed as for the candidate list. [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 3
Other miRNAs from this paper: mmu-mir-125b-2, mmu-mir-155, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-802
HSA21 miRNAs (miR-99a, let-7c, miR-125b-2, miR-155, and miR-802) are overexpressed in the DS brain from fetal to adult stages [46, 67, 68]. [score:3]
[1 to 20 of 1 sentences]
50
[+] score: 3
Feliciano et al. [40] reported that miR-99a represses EMT in vivo by inhibiting E2F2, prevents stemness features, and consequently decreases the number of cancer stem cells in LC. [score:3]
[1 to 20 of 1 sentences]
51
[+] score: 3
001 Down 42 TGCATGACGGCCTGC Chrl2 MIMAT0001418 110828676 − 110828689  mmu-miR-466b-3p <0.001 Down 71 TCTTATGTGTGCGTGTA Chr2 MIMAT0004876 10395901 − 10395917 mmu-miR-467 a * <0.001 Down 169 TGTAGGTGTGTGTATGTATA Chr2 MIMAT0002108 10398019 − 10398038  mmu-miR-467b <0.001 Down 227 CATATACATGCAGGCACT Chr2 MIMAT0005448 10402887 − 10402903  mmu-miR-467e <0.001 Down 73 ACATATACATGCTCACACT Chr2 MIMAT0005293 10427362 − 10427379  mmu-miR- 5103 <0.001 Down 59 CCTCAGGGGATCCC Chr1 MIMAT0020610 34490035 + 34490023  mmu-miR- 5117 <0.001 Up 204 TAACTTTATTGATCATCACTAAC Chr1 MIMAT0020625 162967492 − 162967513  mmu-miR-582-5p <0.001 Down 69 AGTAACTGGTTGAACAACTGTA Chrl3 MIMAT0005291 110114949 − 110114969  mmu-miR-711 <0.001 Down 44 CTTACATCTCTCCCCG Chr9 MIMAT0003501 108872022 − 108872036 mmu-miR-99a * <0.001 Down 40 AGACCCATAGAAACGAGC Chrl6 MIMAT0016981 77599226 − 77599242Differentially expressed miRNAs (P < 0.05) between high- (C57L/J) and low-active (C3H/HeJ) mice strains in nucleus accumbens, EDL, and soleus. [score:3]
[1 to 20 of 1 sentences]
52
[+] score: 3
miRNAs that were differentially expressed only in the LW during aging include miR-29c, miR-705, miR-99a, miR-127, miR-130a, miR-145, miR-151-5p, miR-379, miR-467a, and miR-574-3p. [score:3]
[1 to 20 of 1 sentences]
53
[+] score: 3
By combining transcriptome profiling, in situ hybridization and bioinformatics the authors zoomed in on six miRNAs (miR-15a, miR-18a, miR-30b, miR-99a, miR-182, and miR-199a) showing different spatio-temporal expression in new born mouse cochlea and vestibule. [score:3]
[1 to 20 of 1 sentences]
54
[+] score: 3
Seven miRNAs (miR-31, miR-95, miR-99a, miR-130b, miR-10a, miR-134, and miR-146a) were expressed at 6-fold lower level in SLE patients than that of healthy controls (Tang et al., 2009). [score:3]
[1 to 20 of 1 sentences]
55
[+] score: 2
Comparison of these results with miRNAs listed in Table 1, shows that 4 miRNAs, such as members of let-7 family, miR-99a, miR-34c and miR-144 were in common, while only miR-144 is in common with miRNAs listed in Table 2, indicating its potential role in MB development after irradiation. [score:2]
[1 to 20 of 1 sentences]
56
[+] score: 2
To validate the microarray results, eight miRNAs were selected for further experimental confirmation: miR-126-5p, miR-99a, miR-324-5p, miR-762, miR-29a, miR-302c, miR-295, miR-20b. [score:1]
Eight miRNAs (miR-126-5p, miR-99a, miR-324-5p, miR-762, miR-29a, miR-302c, miR-295, miR-20b) were randomly selected to confirm the microarray results using real-time RT-PCR. [score:1]
[1 to 20 of 2 sentences]
57
[+] score: 2
miR-124 is one of the five most abundant miRNAs (miR-99a-5p, miR-128, miR-124, miR-22-3p, and miR-99b-5p) embedded in the human circulating vesicles [36], which suggests a high priority in the regulation of ECs’ behaviors. [score:2]
[1 to 20 of 1 sentences]
58
[+] score: 2
Parker BC The tumorigenic FGFR3-TACC3 gene fusion escapes miR-99a regulation in glioblastomaJ. [score:2]
[1 to 20 of 1 sentences]
59
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-18a, hsa-mir-21, hsa-mir-27a, hsa-mir-96, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30b, mmu-mir-124-3, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-21a, mmu-mir-27a, mmu-mir-96, mmu-mir-135b, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-200a, hsa-mir-135b, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-15a-1, dre-mir-15a-2, dre-mir-18a, dre-mir-21-1, dre-mir-21-2, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30b, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-135c-1, dre-mir-135c-2, dre-mir-200a, dre-mir-200b, dre-let-7j, dre-mir-135b, dre-mir-181a-2, dre-mir-135a, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
mir-15a, mir-18a, mir-30b, mir-99a and mir-199a were found in different and distinct regions of the mouse P0 cochlea and vestibule, including hair and supporting cells, the spiral ganglia and other cell types. [score:1]
[1 to 20 of 1 sentences]
60
[+] score: 1
Other miRNAs from this paper: hsa-mir-99a, mmu-mir-155, hsa-mir-155, hsa-mir-802, mmu-mir-802
The syndrome is caused by an extra duplication of chromosome 21, which harbors miRNAs including miR-99a, miR-155, and miR-802 [51]. [score:1]
[1 to 20 of 1 sentences]
61
[+] score: 1
We excluded miRNAs with the most variations between groups, miR-99 and U6 (in fibroblasts) and miR-16 (in PBMC), from being used as reference miRNAs (see Additional file 1: Figure S2, S3). [score:1]
[1 to 20 of 1 sentences]
62
[+] score: 1
Tao Z Neuroprotective effect of microRNA-99a against focal cerebral ischemia-reperfusion injury in miceJ. [score:1]
[1 to 20 of 1 sentences]
63
[+] score: 1
The results revealed potentially conserved sites for approximately nine miRNA family candidates (miR-30c, miR-34a/c, miR-449b, miR-181, miR-301a, miR-421, miR-299-5p, miR-609 and miR-99a) in the PAI-1 mRNA 3′ UTR. [score:1]
[1 to 20 of 1 sentences]
64
[+] score: 1
In addition, miRNAs have been described to be modulated even in steatosis/NASH (i. e. miR-155, miR-370, miR-34a, miR-200a/b, miR-99a/b), fibrosis (i. e. miR-200a/b, miR-221/222, miR-34a, miR-16, miR-99b), cirrhosis (i. e. miR-34a, miR-21, miR-31, miR-181b), and HCC (i. e. miR-16, miR-33, miR-21, miR-31, miR-181a/b, miR-99a, miR-200a/b) [15]. [score:1]
[1 to 20 of 1 sentences]
65
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-18a, hsa-mir-21, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-30a, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-138-2, hsa-mir-192, mmu-mir-204, mmu-mir-122, hsa-mir-204, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-138-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-103-1, mmu-mir-103-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-26a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-26a-2, hsa-mir-376c, hsa-mir-381, mmu-mir-381, mmu-mir-133a-2, rno-let-7a-1, rno-let-7a-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-18a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-26a, rno-mir-30a, rno-mir-99a, rno-mir-103-2, rno-mir-103-1, rno-mir-122, rno-mir-126a, rno-mir-133a, rno-mir-138-2, rno-mir-138-1, rno-mir-192, rno-mir-204, mmu-mir-411, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-193b, rno-mir-1, mmu-mir-376c, rno-mir-376c, rno-mir-381, hsa-mir-574, hsa-mir-652, hsa-mir-411, bta-mir-26a-2, bta-mir-103-1, bta-mir-16b, bta-mir-18a, bta-mir-21, bta-mir-99a, bta-mir-126, mmu-mir-652, bta-mir-138-2, bta-mir-192, bta-mir-23a, bta-mir-30a, bta-let-7a-1, bta-mir-122, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-204, mmu-mir-193b, mmu-mir-574, rno-mir-411, rno-mir-652, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-1-2, bta-mir-1-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-138-1, bta-mir-193b, bta-mir-26a-1, bta-mir-381, bta-mir-411a, bta-mir-451, bta-mir-9-1, bta-mir-9-2, bta-mir-376c, bta-mir-1388, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-451b, bta-mir-574, bta-mir-652, mmu-mir-21b, mmu-mir-21c, mmu-mir-451b, bta-mir-411b, bta-mir-411c, mmu-mir-126b, rno-mir-193b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
A-to-G transitions potentially caused by A-to-I editing were mainly identified in miR-99a and miR-376c (Figure 2), which have been reported to undergo A-to-I editing in human and mouse, respectively [22, 23]. [score:1]
[1 to 20 of 1 sentences]
66
[+] score: 1
Bioinformatic analysis has demonstrated that Hsa21 harbors five miRNA genes, miR-99a, let-7c, miR-125b-2, miR-155 and miR-802 (12, 13). [score:1]
[1 to 20 of 1 sentences]