sort by

129 publications mentioning mmu-mir-101a (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-101a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 467
Other miRNAs from this paper: mmu-mir-16-1, mmu-mir-16-2, mmu-mir-101b, mmu-mir-101c
MiR-101 directly targets ROCK2 3’UTRIn our study, the putative targets of miR-101 were predicted using target prediction programs, miRanda and TargetScan. [score:10]
Recently, we and other groups have found that the levels of a specific miRNA, miR-101, were frequently down-regulated in human HCC tissues, and ectopic overexpression of miR-101 dramatically inhibited HCC cells tumorigenicity and invasiveness in vitro by targeting MCL-1 and FOS, respectively [11, 12]. [score:10]
In 2009, another direct target gene of miR-101, MCL-1, was identified by our group and enforced expression of miR-101 in HCC cells could dramatically decrease MCL-1 levels and thus, promoting apoptosis to suppress tumorigenicity [11]. [score:8]
Down, protein expressions of ROCK2 is up-regulated in lent-miR-101-LM9 cells after the down-regulation of miR-101 by anti-miR-101, as compared to that in control anti-miR-NC cells. [score:8]
D. Protein expression of STMN1 is up-regulated in HCC HepG2 cells after the down-regulation of miR-101 by anti-miR-101, as compared to that in control Mock and anti-miR-NC HepG2 cells. [score:8]
E. Upper, protein expression of ROCK2 is up-regulated in HCC HepG2 cells after the down-regulation of miR-101 by anti-miR-101, as compared to that in control Mock and anti-miR-NC HepG2 cells. [score:8]
C. IF staining (red signal) showing that the Epithelial markers E-cadherin, α-catenin, β-catenin were up-regulated and mesenchymal markers fibronectin, N-cadherin and vimentin were down-regulated in lent-miR-101 treated LM9 cells, as compare to that in lent-miR-ctr cells. [score:7]
The Epithelial markers E-cadherin, α-catenin, β-catenin were upregulated and mesenchymal markers fibronectin, N-cadherin and vimentin were downregulated in lent-miR-101 treated Huh cells, as compare to that in lent-miR-ctr Huh cells. [score:7]
In our study, the putative targets of miR-101 were predicted using target prediction programs, miRanda and TargetScan. [score:7]
As a result of our collective present data, we therefore propose herein a molecular mo del, in which miR-101 broadly abrogates HCC tumorigenesis and metastasis by a direct suppression of multiple molecular targets and an inactivation of the RhoA/ROCK pathway (Fig. 5D). [score:6]
Ectopic overexpression of miR-101 inhibits stress fiber formation in vitro and angiogenesis in a CAM mo del, and a proposed regulatory loop of miR-101 in HCC tumorigenesis and metastasis. [score:6]
We first find that the plasma levels of miR-101 are significantly down-regulated in HCC patients with distant metastasis and associated closely with HCCs progression and/or worse disease-free survival (DFS). [score:6]
It has been reported that HBx -mediated miR-101 down-regulation and subsequent induction of aberrant DNMT3A expression contributes to HBV mediated hepatocarcinogenesis [22]. [score:6]
The results reveal that therapeutic delivery of lenti-miR-101 in mouse potently inhibits HCC development/metastasis in vivo and thereby, establishing a principle that miR-101 may be useful as an effective anti-HCC agent through its ability to broadly suppress HCC cells tumorigenicity and invasiveness. [score:6]
In a series of in vitro and in vivo experiments of our present study, we not only confirmed that STMN1 is a target of miR-101 (S2 Fig. ), but also identified a novel direct target of miR-101, ROCK2, in HCC. [score:6]
Furthermore, IHC staining showed that ROCK2 expressions were down-regulated in HCC tissues of mice treated with systemic delivery of lent-miR-101 (Fig. 3F). [score:6]
1004873.g005 Figure 5Ectopic overexpression of miR-101 inhibits stress fiber formation in vitro and angiogenesis in a CAM mo del, and a proposed regulatory loop of miR-101 in HCC tumorigenesis and metastasis. [score:6]
More recently, it has been reported that miR-101 could inhibit autophagy and enhance cisplatin -induced apoptosis in HCC cells by targeting STMN1 [13]. [score:5]
More recently, Xu and colleagues [13] reported that miR-101 could inhibit autophagy and enhance cisplatin -induced apoptosis in HCC cells by targeting STMN1. [score:5]
These data suggest that miR-101 could enhance its inhibiting effects on HCC by targeting an additional oncogene ROCK2. [score:5]
Overexpression of miR-101 in HCC cells suppresses metastasis in vivo. [score:5]
Ectopic overexpression of miR-101 inhibits HCC Huh7 cell invasion and EMT in vitro. [score:5]
The results showed that ectopic overexpression of miR-101 in LM9 and Huh7 cells dramatically suppressed the angiogenesis in vivo (Mock versus lent-miR-ctr, and versus lent-miR-101 LM9 cells were 112%±12.1% versus 98.67%±8.84%, and versus 46.33%±9.67%, and mock versus lent-miR-ctr, and versus lent-miR-101 Huh7 cells were 115%±8.6% versus 100%±10.8%, and versus 48%±6.3%, Fig. 5C). [score:5]
S6 FigEctopic overexpression of miR-101 inhibits HCC Huh7 cell invasion and EMT in vitro. [score:5]
In our study, we found that after miR-101 overexpression, the formation of stress fiber in HCC cells was inhibited, and concurrently, the levels of active RhoA, Rac1 and Cdc42 were all reduced. [score:5]
These data suggest that EZH2 and COX2 are two important targets of miR-101 to suppress HCC. [score:5]
F. IHC staining showing down-regulated expressions of ROCK2 in HCC tissues of mice treated with systemic delivery of lent-miR-101, as compared to that treated with NaCl or lent-miR-ctr. [score:5]
Overexpression of miR-101 in HCC cells inhibits angiogenesis in a chicken chorioallantoic membrane (CAM) mo del. [score:5]
1004873.g004 Figure 4Enforced overexpression of miR-101 inhibits HCC LM9 cells invasion and EMT in vitro and reduces metastasis in vivo. [score:5]
S4 FigEnforced expression of miR-101 in HCC cell line inhibits the mRNA and protein levels of COX2. [score:5]
In addition, ectopic overexpression of miR-101 in HCC cells not only suppressed cell motility, invasion and EMT, but also blocked the formation of cells stress fiber. [score:5]
Moreover, after miR-101 overexpression in LM9 and Huh7 lines, the expression levels of all tested epithelial markers (E-cadherin, α-catenin and β-catenin) increased, while the levels of mesenchymal markers (fibronectin, N-cadherin and vimentin) decreased (Fig. 4B and 4C; S6B– S6C Fig. ). [score:5]
D. A proposed mo del in which miR-101 inhibits tumorigenesis and metastasis of HCC by repression of multiple target genes and tumor activators. [score:5]
S7 FigEctopic overexpression of miR-101 inhibits stress fiber formation in vitro. [score:5]
Enforced expression of miR-101 in HCC cell line inhibits the mRNA and protein levels of EZH2. [score:5]
S8 FigEnforced expression of miR-101 in HCC cell line inhibits the mRNA and protein levels of EZH2. [score:5]
The levels of miR-101 was analyzed by real-time PCR, and ROC curve analysis was applied to determine the cutoff score for high expression (n = 88) and low expression of plasma miR-101 (n = 75). [score:5]
E. IHC staining showing down-regulated expressions of STMN1 in HCC tissues of mice treated with systemic delivery of lent-miR-101, as compared to that treated with NaCl or lent-miR-ctr. [score:5]
Enforced expression of miR-101 in HCC cell line inhibits the mRNA and protein levels of COX2. [score:5]
Ectopic overexpression of miR-101 inhibits stress fiber formation in vitro. [score:5]
Ectopic expression of miR-101 inhibits HCC cell motility, invasion and epithelial-mesenchymal transition (EMT) in vitro. [score:5]
Enforced overexpression of miR-101 inhibits HCC LM9 cells invasion and EMT in vitro and reduces metastasis in vivo. [score:5]
The luciferase activity assays showed that increased expression of miR-101 upon infection significantly affected the luciferase expressions of ROCK2 in LM9 cells. [score:4]
To verify whether or not ROCK2 is a direct target of miR-101, ROCK2 3’-UTR (Fig. 3A) and two mutants containing the miR-101 binding sites were cloned downstream of the luciferase open reading frame. [score:4]
We and other groups previously identified a frequently down-regulated miRNA, miR-101, in various solid tumors including HCC [11, 12]. [score:4]
Furthermore, functional and/or mechanistic studies of miR-101 as provided in this report, suggest a critical role of miR-101 in the control of HCC cells cytoskeletal reorganization, EMT, invasiveness and angiogenesis, resulting in a potent abrogation of HCC development and progression by means of a “one-hit/multiple-targets” mechanism. [score:4]
Consequently, it is unlikely that HBV infection itself induced the differential expression patterns of plasma miR-101 in our set of HCCs. [score:3]
A. Expression levels of miR-101 in human plasma samples from healthy donors (n = 50) and HCC patients with distant metastasis (n = 16) and without distant metastasis (n = 147). [score:3]
But the expression levels of miR-101 in the liver, the lung and tumor tissues were significantly higher in lent-miR-101 treated mice than that in both control mice (p<0.0001, Fig. 2A, down panel). [score:3]
Next, LM9 and Huh-7 HCC cells were infected by lent-miR-101 and lent-miR-ctr, respectively, to construct the stable miR-101 -expressing and control HCC cells. [score:3]
In other solid tumors, the levels of miR-101 were also decreased in neoplastic tissues [14– 17], and miR-101 could inhibit the tumorigenesis and/or cancer progression by repressing the oncogenes EZH2 and COX2 [17– 20]. [score:3]
B. Expression levels of the epithelial markers E-cadherin, α-catenin and β-catenin and the mesenchymal markers fibronectin, N-cadherin and vimentin were analyzed by Western blot between lent-miR-101 and control lent-miR-ctr LM9 cells. [score:3]
In addition, the mRNA and protein levels of ROCK2 were all substantially reduced after miR-101 overexpression in LM9 and Huh7 cells (Fig. 3C and 3D). [score:3]
In our mouse HCC mo del of the present study, we did observe that systemic delivery of lent-miR-101 exhibited an over 90% infective efficiency and high expression levels of miR-101 in the liver, the lung and tumor tissues of mice without toxicity, indicating that lentivirus provides an effective and nontoxic means to deliver miRNAs to mouse. [score:3]
High expression of plasma miR-101 was examined in 88/163 (54.0%) of HCC patients. [score:3]
The sequence of miR-101 inhibitor is UUCAGUUAUCACAGUACUGUA. [score:3]
Firstly, we observed that systemic delivery of lent-miR-101 in the mouse HCC mo del substantially inhibited tumor angiogenesis. [score:3]
In a CAM Mo del, we also demonstrated that enforced expression of miR-101 in HCC cells could diminish angiogenesis. [score:3]
To identify a single, optimal cutpoint for mature miR-101, ROC curve analysis was applied to our HCC cohort to determine the cutoff score for high or low expression of miR-101 [21]. [score:3]
Next, we identify that systemic delivery of lentivirus -mediated miR-101 in an orthotopic liver implanted HCC mo del of mouse, not only suppresses tumor xenograft growth in the liver, but also substantially blocks intrahepatic metastasis and distant metastasis to the lung and to the mediastinum, resulting in a dramatic abrogation of HCC tumorigenesis and progression in mice without toxicity. [score:3]
Therapeutic delivery of miR-101 suppresses tumor growth, angiogenesis and metastasis in an orthotopic liver implanted HCC mo del of mouse. [score:3]
Down-regulation of plasma MiR-101 is a frequent event in HCC patients with distant metastasis and predicts worse prognosis. [score:3]
STMN1 is the target of miR-101. [score:3]
Systemic delivery of lent-miR-101 suppresses tumor growth, angiogenesis and metastasis in the orthotopic liver implanted HCC mo del of mouse. [score:3]
Correlation of plasma miR-101 expression with patients’ clinicopathologic variables in human hepatocellular carcinomas. [score:3]
A. Enforced overexpression of miR-101 in LM9 cells decreases endogenous levels of EZH2 protein. [score:3]
1004873.g003 Figure 3 ROCK2 is the target of miR-101. [score:3]
Tumors designated as “high expression” for miR-101 were those with scores above the value of 2.243928. [score:3]
A. Enforced overexpression of miR-101 in LM9 cells decreases endogenous levels of COX2 protein. [score:3]
The oncogenes, EZH2 and COX2, were two targets of miR-101 first identified in 2008 [17, 18] and they were confirmed in our HCC cells of the present study (S4 Fig. and S8 Fig. ). [score:3]
S3 Fig STMN1 is the target of miR-101. [score:3]
In an experimental in vivo metastasis mo del of SCID mouse, we further showed that the tail-vein-injection of miR-101 -overexpressing HCC cells led to a significant decrease in the number of metastatic lesions in the liver and in the lung. [score:3]
Next, in an orthotopic liver implanted HCC mo del of mouse, we clearly showed that systemic delivery of lenti-miR-101 not only induced a dramatic suppression of tumor growth in the liver, but also substantially diminished HCC intrahepatic metastasis and distant metastasis to the lung and to the mediastinum, resulting in a dramatic suppression of HCC in mice without a measurable toxicity. [score:3]
ROCK2 is the target of miR-101. [score:3]
MiR-101 directly targets ROCK2 3’UTR. [score:3]
1004873.g001 Figure 1 A. Expression levels of miR-101 in human plasma samples from healthy donors (n = 50) and HCC patients with distant metastasis (n = 16) and without distant metastasis (n = 147). [score:3]
We evaluated that besides the target genes of EZH2, COX2, STMN1, MCL-1 and FOS identified previously [11– 13, 17, 18], the 3’-UTR of ROCK2 mRNA contains a complementary site for the seed region of miR-101, the ROCK2 gene was an additional potential target of miR-101 (Fig. 3A). [score:3]
At the same time, we also confirmed that STMN1 and COX2 are the other targets of miR-101 in HCC (S3– S4 Fig. ). [score:3]
B. Expression levels of the epithelial markers E-cadherin, α-catenin, β-catenin and the mesenchymal markers fibronectin, N-cadherin and vimentin were analyzed by Western blot between lent-miR-101 and control lent-miR-ctr treated Huh cells. [score:3]
These data, collectively, strongly supported that miR-101 plays a crucial tumor suppressive role in the control of HCC aggressive process. [score:3]
C. IF staining was used to compare expression levels/pattern of epithelial markers and mesenchymal markers (red signal) between the control lent-miR-ctr and lent-miR-101 treated Huh cells. [score:3]
Almost at the same time, Li et al [12] showed that miR-101 significantly repressed the abilities of HCC cell migration and invasion by targeting the FOS oncogene. [score:3]
C. Lent-miR-101 LM9 and Huh7 cells inhibits angiogenesis in a CAM mo del. [score:3]
Silence of either ROCK2 or STMN1 by specific siRNA could partially mimic the inhibiting effect of lent-miR-101 on both HCC cells motilities. [score:3]
Anti-miR-101 could increase COX2 expression in HepG2 cells. [score:3]
Anti-miR-101 could increase EZH2 expression in HepG2 cells. [score:3]
Furthermore, functional and/or mechanistic studies of miR-101 demonstrate that miR-101 in HCC cells inhibits Rho/Rac GTPase activation, and blocks HCC cells epithelial-mesenchymal transition (EMT) and angiogenesis, inducing a strong abrogation of HCC tumorigenesis and aggressiveness both in vitro and in vivo. [score:3]
MiR-101 inhibits RhoA/Rac1 GTPase in HCC cells. [score:2]
Down, ectopic overexpression of miR-101 by lenti-miR-101 reduces the levels of STMN1 protein in LM9 cells, as compared to that in both Mock and lent-miR-ctr treated LM9 cells. [score:2]
On the other hand, knocking down miR-101 in HepG2 and miR-101-LM9 cells, dramatically increased protein levels of ROCK2 (Fig. 3E). [score:2]
To test the function of miR-101 in regulating angiogenesis, we also examined the effect of lent-miR-101-LM9 and lent-miR-101-Huh7 cells on angiogenesis in a CAM mo del. [score:2]
In this study, we chose a lentivirus -based vector system as miR-101 delivery vehicle, since it is an attractive platform for regulatory gene delivery [27, 28]. [score:2]
MiR-101 inhibitor was synthesized by Genepharma (Shanghai, China). [score:2]
Down, ectopic overexpression of miR-101 by lenti-miR-101 reduces the levels of ROCK2 proteins in LM9 cells, as compared to that in both MOCK and lent-miR-ctr treated LM9 cells. [score:2]
Ectopic overexpression of miR-101 by infection of lent-miR-101 decreased cell motility in both LM9 and Huh7 cells, compared with that in lent-miR-ctr control cells. [score:2]
The Matrigel invasion and Wound healing assays demonstrated that miR-101 overexpression substantially decreased both LM9 and Huh7 HCC cells motility and invasive capability (Fig. 4A; S5– S6A Fig. ). [score:2]
These results prompt us to further explore the functions and excise molecular mechanisms of miR-101 in the development and/or progression of HCC. [score:2]
Down, ectopic overexpression of miR-101 by lenti-miR-101 reduces the levels of ROCK2 proteins in Huh7 cells, as compared to that in both Mock and lent-miR-ctr treated Huh7 cells. [score:2]
Right, real-time PCR examination of mRNA level of ROCK2 between the lenti-miR-101 and control lent-miR-ctr treated Huh7 cells. [score:1]
In our study, we subsequently assessed the therapeutic efficacy of miR-101 via tail vein delivery to an orthotopic liver implanted HCC mo del of mouse. [score:1]
The plasma levels of miR-101 were examined by Real-time PCR in 163 HCC patients and 50 healthy donors. [score:1]
[21] Eight 4-week-old male SCID-Beige mice in each experimental group were injected with lent-miR-101-LM9, lent-miR-ctr-LM9 and mock-LM9 cells separately. [score:1]
Lentivirus-miR-101-coGFP (lent-miR-101) and lentivirus-miR-ctr-coGFP (lent-miR-ctr) were condensed and purified for 10 [8] MOI/200μl. [score:1]
B. Kaplan-Meier analysis for HCC patients DFS according to plasma levels of miR-101. [score:1]
Lenti-miR-101 decreased the levels of COX2 mRNA in LM9 cells. [score:1]
LM9 cells were infected with Mock, lent-miR-ctr or lenti-miR-101 for 72 hours. [score:1]
C. Upper, real-time PCR examination of mRNA levels of ROCK2 between the lenti-miR-101 and control lent-miR-ctr treated LM9 cells. [score:1]
The average plasma levels of miR-101 were significantly lower in HCC patients with distant metastasis than that in HCCs without distant metastasis and control healthy donors (Fig. 1A). [score:1]
LM9 cells were infected with lent-miR-ctr or lent-miR-101 for 72 hours. [score:1]
A. Schematic of predicted miR-101 -binding sites in the 3′UTR of ROCK2. [score:1]
The average size of primary tumors in the liver was 10.75±3.25 mm in diameter in NaCl treated group (n = 8), 11.51±3.71 mm in lent-miR-ctr treated group (n = 8), and 2.78±1.25 mm in lent-miR-101 treated group (n = 7). [score:1]
The firefly luciferase construct was cotransfected with a control Renilla luciferase vector into LM9 cells in the presence of either lent-miR-101 or lent-miR-ctr. [score:1]
Analysis of miR-101 levels in human plasma samples by real-time PCR. [score:1]
Then lentivirus-miR-101-coGFP (lent-miR-101), lentivirus-miR-ctr-coGFP (lent-miR-ctr) and physiological saline (NaCl) were administered at a dose of 10 [8] MOI per animal by tail vein injection (200 μl total volume) using a 30 gauge ultra-fine insulin syringe at a week after the mo del construction, 2 times a week for a month. [score:1]
B. The level of mature miR-101 in HBV -negative (n = 5) and HBV -positive (n = 10) HCC patient’s plasma with distant metastasis. [score:1]
Correlation analysis showed that low level of plasma miR-101 in HCC patients was significantly associated with a more aggressive phenotype (Table 1, p<0.05). [score:1]
Human miR-101, MI0000937; human ROCK2, Homo sapiens ROCK2 NM_004850; Human STMN1, NM_005563.3 Homo sapiens stathmin 1 (STMN1), transcript variant 3, mRNA. [score:1]
To date, however, the in vivo efficacy of miR-101 replacement therapy to human cancers, such as HCC, has not been elucidated. [score:1]
E. The number of metastatic nodules in the liver and in the lungs of mice (n = 8 per group) 8 weeks after tail vein injection of let-miR-101 LM9 cells (mean±SE, liver: 2.8±0.8, lung: 9.8±4.7), mock LM9 cells (mean±SE, liver: 9.8±1.0, lung: 33.5±4.6) and lent-miR-ctr LM9 cells (mean±SE, liver: 9.5± 1.6, lung: 33.5± 6.7). [score:1]
S1 Fig A. The level of mature miR-101 in HBV -negative (n = 29) and HBV -positive (n = 134) HCC patient’s plasma. [score:1]
Lenti-miR-101 decreased the levels of EZH2 mRNA in LM9 cells. [score:1]
A. The level of mature miR-101 in HBV -negative (n = 29) and HBV -positive (n = 134) HCC patient’s plasma. [score:1]
The putative miR-101 binding sites at the 3’-UTRs of ROCK2, STMN1 and COX2 mRNAs were cloned downstream of the cytomegalovirus (CMV) promoter in a pMIR-REPORT vector (Ambion). [score:1]
The MVD-CD34 of tumors in lent-miR-101 group (mean, 18; range, 9–46) was significantly smaller than that in both lent-miR-ctr (mean, 41; range, 25–69) and NaCl (mean, 43; range, 22–78) treated groups (p<0.01, Fig. 2C). [score:1]
Active forms of RhoA, Rac1 and Cdc42 were lower in lent-miR-101 Huh7 than that in lent-miR-ctr Huh7 cells. [score:1]
B. Representative tumor xenografts in the liver of mice in different (NaCl, lent-miR-ctr and lent-miR-101) treated groups. [score:1]
Left panel, representative plugs from different (Mock, lent-miR-ctr and lent-miR-101 LM9 and Huh7 cells) treated groups. [score:1]
Meanwhile, the administrations of lent-miR-101 and lent-miR-ctr did not cause acute liver toxicity, as demonstrated by the maintenance of normal levels of serum markers of liver function (S1 Table) and an absence of overt histological evidence of toxicity (S2 Fig. ). [score:1]
Overall, our data hereby provide a basis for the concept that the systemic administration of miR-101 mediated by lentivirus might be a clinically viable anti-HCC therapeutic strategy. [score:1]
These data suggest a powerful anti-tumorigenic activity of miR-101 in different human cancers. [score:1]
Huh7 cells were infected with lent-miR-ctr or lent-miR-101 for 72 hours. [score:1]
E. The mean number of metastasis in lenti-miR-101 treated group (liver: 9.4±2.9; lung: 11.3±2.5, n = 7) was significantly larger than that in control NaCl (liver: 32.1±5.1; lung: 39.4±6.0, n = 8) and lent-miR-ctr (liver: 30.8±5.4; lung: 40.9±5.4, n = 8) treated groups (P<0.01). [score:1]
C. The mRNA levels of COX2 in Mock, lent-miR-ctr or lenti-miR-101 LM9 cells examined by Real-time PCR. [score:1]
Right, real-time PCR examination of mRNA levels of ROCK2 between the lenti-miR-101 and control lent-miR-ctr treated LM9 cells. [score:1]
Lent-miR-101, control lent-miR-ctr and physiological saline (NaCl) was administered, respectively, to mice by tail vein at one week after the preparation of the mouse HCC mo del, 2 times a week for a month. [score:1]
We thus examined the levels of miR-101 in HBV -negative and HBV -positive HCC patient’s plasma. [score:1]
We found that there are no significant differences between the plasma levels of miR-101 in HBV -negative and HBV -positive HCC patients (S1A Fig. ). [score:1]
F. The difference in survival time of mice between the lenti-miR-101 group and 2 control (NaCl and lent-miR-ctr) groups was statistically significant (P<0.05). [score:1]
Further survival analysis established that the plasma level of miR-101 is an independent prognostic factor for HCC patient survival (p<0.0001, Fig. 1B, Table 2). [score:1]
The ROC curve analysis was applied to define a cutoff score for plasma miR-101 level by a 0, 1- criterion[47]. [score:1]
Next, we found that mice in control groups developed larger sized primary tumors than that in lent-miR-101 treated mice (Fig. 2B, p<0.01). [score:1]
D. Left, the levels of miR-101 by Real-time PCR in the lenti-miR-101 and mock and lent-miR-ctr treated Huh7 cells. [score:1]
Virus particles were harvested 48h after pCDH-CMV-miR-101-coGFP or pCDH-CMV-coGFP (System Biosciences, CA) transfection with the packaging plasmid pRSV/REV, pCMV/VSVG and pMDLG/pRRE into 293FT cells by using Lipofectamine 2000 reagent (Invitrogen). [score:1]
Lent-miR-101, lent-miR-ctr and mock LM9 cells were re-suspended in PBS buffer solution. [score:1]
In the present study, our initial Quantitative PCR demonstrated that in a large cohort of HCC patients, all HCCs with distant metastasis had a low level of plasma miR-101, and it was associated closely with an advanced clinical stage and predicted poor prognosis. [score:1]
Active forms of RhoA, Rac1 and Cdc42 were lower in lent-miR-101 LM9 than that in lent-miR-ctr LM9 cells. [score:1]
S2 Fig Lent-miR-101 and control lent-miR-ctr was administered, respectively, to mice by tail vein at one week after the preparation of the mouse HCC mo del, 2 times a week for a month. [score:1]
Analysis of miR-101 levels in human plasma samples by real-time PCR and Kaplan-Meier analysis for HCC patients DFS according to the plasma levels of miR-101. [score:1]
Conversely, when we performed luciferase assays using a plasmid harboring the 3’-UTR of ROCK2 mRNA, in which the binding sites for miR-101 were inactivated by site-directed mutant genesis, the luciferase activities of mutant reporters were unaffected by the simultaneous infection of miR-101 (Fig. 3B). [score:1]
A. Schematic of predicted miR-101 -binding sites in the 3′UTR of STMN1. [score:1]
C. Left, the levels of miR-101 by Real-time PCR in the lenti-miR-101 and control MOCK and lent-miR-ctr treated LM9 cells. [score:1]
B. The mRNA levels of EZH2 in Mock, lent-miR-ctr or lenti-miR-101 LM9 cells examined by Real-time PCR. [score:1]
Firstly, we observed that the levels of coGFP in the liver, the lung and tumor tissues of lent-miR-101 treated mice were equivalent to that in lent-miR-ctr treated mice, exhibiting over 90% infection efficiency (Fig. 2A, upper panel). [score:1]
Down panel, the levels of miR-101 in the liver, the lung and tumor tissues were significantly higher in lent-miR-101 treated mice than that in both control mice (P<0.001). [score:1]
We investigated if miR-101 modifies HCC cell cytoskeleton rearrangement and inhibits Rho-GTPase. [score:1]
C. Representative images of microvessel density (MVD) of implanted primary tumor examined by IHC staining of CD34 in lent-miR-101 treated and 2 control groups. [score:1]
To sum up, herein, we report, for the first time, an essential role for systemic delivery of lent-miR-101 in the efficient therapy of HCC in a mouse mo del, and the use of lentivirus vector has a unique advantage to enhance a transduction and therapeutic abundance of miRNA in vivo without toxic effects. [score:1]
Systemic delivery of lent-miR-101 to an orthotopic liver implanted HCC mo del of mouse. [score:1]
[1 to 20 of 158 sentences]
2
[+] score: 304
Taken together, the results of the present study support that miR-101 -induced suppression of CDK8 expression down-regulates the expression of β-catenin either directly or indirectly to suppress Wnt/β-catenin signaling. [score:14]
The present data also suggest that miR-101 directly inhibits the expression of CDK8 and down-regulates the protein level of β-catenin, with the latter involving the Wnt/β-catenin signaling pathway and the downstream effectors, cyclin D1. [score:9]
In summary, the results of the present study verify that miR-101 is down-regulated in LSCC tumour tissues and exogenous expression of miR-101 inhibits cell proliferation, reduces cell invasion, and induces apoptosis in LSCC. [score:8]
Moreover, we showed that up-regulation of miR-101 expression suppressed humen LSCC Hep-2 cells proliferation and migration, and induced cell-cycle arrest. [score:8]
And miR-101 inhibited the tumourigenesis progression through the regulation of Wnt/β-catenin signaling pathway by targeting CDK8 directly in LSCC. [score:7]
The computer sequence analysis (TargetScan and miRDB [7, 43]) suggested that the 3′ untranslated region (UTR) of CDK8 mRNA might represent a target of miR-101. [score:7]
Ectopic expression of miR-101 significantly inhibits cell proliferation, migration, and invasion by regulating genes involved in these processes (e. g., COX- 2 [23, 24, 28], EZH2 [25, 27– 29, 33, 34], Mcl- 1 [28, 29], Fos [29], Stathmin1 [30] and c- Met [32]). [score:6]
The 3′ UTR of CDK8 is a target for miR-101To test the hypothesis that the 3′ UTR of CDK8 is a functional target of miR-101, the miR-101 seed sequence of the 3′ UTR of CDK8 was cloned into a luciferase reporter construct immediately downstream of the luciferase gene (Fig.   3a). [score:5]
In LSCC cells, this would inhibit tumour progression, and this is consistent with the reduced proliferation and migration that were observed for Hep-2 cells expressing exogenous miR-101. [score:5]
Recently, miR-101 was identified as a tumour suppressor and was found to be expressed at low levels in various types of tumours, including prostate, breast, endometrium, and bladder cancers. [score:5]
Interestingly, in this study, we found that exogenous miR-101 significantly decreased β-catenin protein expression and inhibited LSCC cell proliferation, invation, and induced apoptosis in vitro and in vivo. [score:5]
In the present study, the transduction of miR-101 lentivirus led to a decrease in CDK8 expression and a decrease in β-catenin expression. [score:5]
a Expression of CDK8, β-catenin, and cyclin D1 in the cells of the miR-101 -treated group were lower than the expression levels of these three proteins in cells of the blank control group and the negative control group (*P < 0.05). [score:5]
Therefore, our results revealed that indirect regulation of Wnt/β-catenin signalling pathway could be a potential mechanism of miR-101 inhibiting tumourigenesis progression of LSCC. [score:5]
The TargetScan and miRDB sequence analysis predicted that the 3′ UTR of CDK8 mRNA represented a target of miR-101. [score:5]
Expression of miR-101 was down-regulated in the LSCC tissues compared with the adjacent normal tissues. [score:5]
Therefore, our findings demonstrate the role of tumour suppressor of miR-101 in LSCC progression and indicate that miR-101 might serve as a prognostic and therapeutic target for LSCC. [score:5]
In addition, the in vitro and in vivo mo dels evaluated in the present study showed that exogenous expression of miR-101 decreased expression levels of CDK8 expression. [score:5]
Up-regulation of miR-101 in Hep-2 cells reduces cell proliferation and induces cell cycle arrest. [score:4]
MiR-101 suppresses CDK8, beta-catenin, and cyclin D1 expression both in vitro and in vivo. [score:4]
This paper provides the first definitive evidence that miR-101 is down-regulated in LSCC. [score:4]
These results suggest that patients with LSCC tumours that express lower levels of miR-101 will have a poor prognosis and a shorter survival period compared with patients with LSCC tumours that express higher levels of miR-101. [score:4]
Site-directed mutagenesis of the miR-101 target site in the CDK8-3′-UTR (5′-AUGCGGCA-3′) was used as a negative control and termed CDK8-3′UTR mutant. [score:4]
In the present study, down-regulation of miR-101 was detected in LSCC tissues and not in matching normal tissues. [score:4]
However, the question whether miR-101 -mediated regulation of CDK8 directly or indirectly affects Wnt/β-catenin signaling in LSCC remains. [score:4]
As a result, we interested in whether miR-101 could participate in the regulation of the Wnt/β-catenin signaling pathway through targetting CDK8 in LSCC. [score:4]
In this study, we found that miR-101 was down-regulated in LSCC cell lines and tissues. [score:4]
Furthermore, downregulation of miR-101 correlated with T3–4 tumour grade, lymph node metastasis, and an advanced clinical stage in the LSCC patients examined (P < 0.05). [score:4]
These results indicate that miR-101 is a potent tumour repressor that directly represses CDK8 expression. [score:4]
a Wildtype and mutated miR-101 target sites in the 3′ UTR of CDK8 were cloned into luciferase reporter vectors. [score:3]
We also found no significant correlation between the expression of miR-101 and the tested clinicopathological parameters, which included the patient’s sex, age, differentiation and tobacco exposure. [score:3]
Fig.  4Exogenous expression of miR-101 reduces cell proliferation and induces cell cycle arrest in Hep-2 cells. [score:3]
To our knowledge, these data demonstrate, for the first time, that miR-101 functions as a tumour suppressor in LSCC. [score:3]
Correspondingly, the expression level of miR-101 was up-regulated in the miR-101 -treated cells compared with that in the negative control cells and the blank control cells, as measured by quantitative real-time PCR (P < 0.05) (Additional file 2: Fig.  S2 E). [score:3]
Prognostic significance of miR-101 expression levels. [score:3]
The corresponding 5-year survival probability rates for these patients were 67.5 and 47.5 % according to the expression levels of miRNA-101 (e. g., high versus low, respectively) in the LSCC tissues examined (P < 0.05) (Fig.   2). [score:3]
Fig.  1Expression of miR-101 in vivo and in vitro. [score:3]
A miRNA profiling using microarray analysis identified hsa-miR-101 was down-regulated in head and neck cancers samples compared to normal samples [21], which interested us in the role miR-101 played in LSCC. [score:3]
Additionally, we report the potential clinical value of understanding miR-101 expression in patients with LSCC. [score:3]
Furthermore, exogenous expression of miR-101 led to a decrease in cell proliferation, reduced invasion of Hep-2 cell lines, and reduced growth of a xenograft tumour in vivo. [score:3]
Kaplan–Meier OS curves further showed that lower levels of miR-101 expression were associated with a shorter progression-free survival trend for patients with LSCC. [score:3]
To test the hypothesis that the 3′ UTR of CDK8 is a functional target of miR-101, the miR-101 seed sequence of the 3′ UTR of CDK8 was cloned into a luciferase reporter construct immediately downstream of the luciferase gene (Fig.   3a). [score:3]
In the present study, it was confirmed that CDK8 is a direct target gene of miR-101 based on the use of wildtype and mutant 3′ UTR sequences of CDK8 in luciferase reporter assays. [score:3]
Furthermore, miR-101 has been found to function as a tumour suppressor. [score:3]
Correspondingly, exogenous expression of miR-101 significantly reduced the growth of tumour in a LSCC xenograft mo del. [score:3]
The low level of miR-101 expression was associated with poor prognosis (P < 0.05). [score:3]
Table 1 Relationship between miR-101 expression levels and clinicopathological parameters for the present LSCC cohort Clinicopathological parameters N (No. [score:3]
Thus, miR-101 appears to be a valuable target for the diagnosis and treatment of LSCC, and further study of this miRNA is warranted. [score:3]
Seventy-two hours after transduction, greater than 80 % of Hep-2 cells in each set of the miR-101 -treated group and the negative control group were found to express GFP, a marker of the infection efficiency of the lentivirus vectors (Additional file 2: Fig.  S2 A-D). [score:3]
Thus, detection and targeting of miR-101 may represent a novel diagnostic and therapeutic strategy for LSCC patients. [score:3]
In parallel, another reporter construct was generated which included a mutated version of the conserved targeting region of miR-101 within the 3′-UTR of CDK8 (Fig.   3a). [score:3]
However, the low miR-101 expression was found to be correlated with higher-grade tumours, lymph node metastases, or more advanced clinical stages of the gastric LSCC samples (P < 0.05, Table  1). [score:3]
We found exogenous miR-101 not only could reduce β-catenin protein expression but could also concurrently decrease the Cyclin D1 level in cultured Hep-2 cells and xenograft tissues. [score:3]
Increased expression of miR-101 induced cells apoptosis both in vitro and in vivo. [score:3]
Fig.  5Exogenous expression of miR-101 reduces the migration of Hep-2 cells. [score:3]
The relative luciferase activity of the reporter containing the wildtype 3′ UTR of CDK8 was significantly suppressed when miR-101 was co -transfected (Fig.   3b). [score:3]
In contrast, tumour sections from the miR-101 -treated mice exhibited only weak expression of cytoplasmic CDK8, β-catenin, and cyclin D1 (Fig.   8B). [score:3]
The 3′ UTR of CDK8 is a target for miR-101. [score:3]
The reduced miR-101 could be used as a prognostic factor for poor disease outcome. [score:3]
In addition, flow cytometric analysis showed that increased expression of miR-101 caused cell-cycle arrest at the G1/S border. [score:3]
Aberrant expression of miR-101 has been observed in several cancer cell lines and cancer tissues [23– 34]. [score:3]
In conclusion, our studies suggest that miR-101 may be a potential therapeutic target for LSCC patients. [score:3]
The expression levels of miR-101 in laryngeal squamous cell carcinoma (LSCC) tissues and cells were detected by qPCR. [score:3]
MiR-101 has been found to be frequently down-regulated in many types of tumours, including colon [23], prostate [24, 25], lung [26, 27], gastric [28], endometrium [29], breast [30], bladder [31, 32], melanoma [33], and head and neck squamous cell carcinomas [34]. [score:3]
b Luciferase activity for the wildtype CDK8 reporter significantly decreased by 43 % in HEK293T cells that expressed miR-101 compared with the control cells (*P < 0.05). [score:2]
The ability of miR-101 to negatively regulate tumour growth and progression was further demonstrated in vivo when xenograft mo dels of LSCC tumours exhibited slower growth following treatment with miR-101. [score:2]
CDK8 was identified as the target gene of miR-101 by luciferase reporter assay. [score:2]
The results of bioinformatic tools for miRNA target screening and luciferase assay indicated that miR-101 interacted with CDK8. [score:2]
Moreover, we identified Cyclin -dependent kinase 8 (CDK8) as the target of miR-101 by a luciferase assay. [score:2]
Fig.  6Exogenous expression of MiR-101 enhances apoptosis by LSCC cells. [score:2]
MiR-101 suppresses the growth of LSCC tumour xenografts in nude mice. [score:2]
The purpose of this study is to explore the role of miR-101 in LSCC cell proliferation, invasion, apoptosis and cell cycle regulation. [score:2]
For the reporter assays, cells were transiently transfected in 24-well plates with luciferase reporter gene constructs and has-miR-101, or an antagomir that was designed to target endogenous has-miR-101, using Lipofectamine 2000 (Invitrogen). [score:2]
These data strongly suggest that miR-101 negatively affects the invasive phenotype of LSCC cells. [score:1]
c The average tumour weight (g) for the miR-101 -treated group was also lower than that for the blank control group and the negative control group. [score:1]
a Levels of miR-101 that were detected in LSCC tissues were significantly lower than the levels of miR-101 detected in the corresponding adjacent, non-cancerous tissues. [score:1]
A MiR-101 expression significantly increased in the miR-101 -treated group compared with that in the negative control group and the blank control group in real-time RT-PCR assays (* P < 0.05). [score:1]
Similarly, the mean tumour weight for the mice treated with miR-101 lentivirus (0.41 ± 0.26 g) was markedly lower than the mean tumour weights for the negative control group (0.81 ± 0.50 g) and the blank control group (0.90 ± 0.51 g) (P < 0.05; Fig.   7). [score:1]
As shown in Fig.   6A, the Hep-2 cells infected with the miR-101 lentivirus exhibited significantly higher levels of apoptosis (12.51 ± 2.22 %) 72 h after transduction than the blank control cells (4.12 ± 0.85 %) and the negative control cells (3.45 ± 1.39 %) (P < 0.05). [score:1]
A The Hep-2 cells in the miR-101 -treated group (c) exhibited significantly higher levels of apoptosis (12.51 ± 2.22 %) 72 h after transduction than the Hep-2 cells in the blank control group (a) (4.12 ± 0.85 %) and the cells in the negative control group (b) (3.45 ± 1.39 %) (P < 0.05). [score:1]
Has-miR-101 and a green fluorescent protein (GFP) sequence were cloned into a recombinant lentivirus vector (Genechem, Shanghai, China) (Additional file 1: Fig.  S1). [score:1]
However, the function(s) of miR-101 in laryngeal carcinoma remain unknown. [score:1]
Our results suggest that there is a potential role for miR-101 in the molecular pathogenesis, clinical progression and prognosis of LSCC. [score:1]
Levels of miR-101 in LSCC tissues and cell lines. [score:1]
MiR-101 is a highly conserved miRNA, whose encoding genes locate at chromosome 1p31.3 and chromosome 9p24.1 and undergo abnormal deletions in several malignant cells [22]. [score:1]
b Tumours in the miR-101 -treated group had a smaller volume (cm [3]) than the tumours grown in the blank control group and the negative control group (P < 0.05). [score:1]
We named the lentivirus containing miR-101 sequence as miR-101 lentivirus and the cells treated with miR-101 lentivirus as the miR-101 -treated group; lentivirus containing only the GFP cassette as GFP-lentivirus and the cells treated with GFP-lentivirus as the negative control group; the cells without any treatment as the blank control group. [score:1]
In contrast, the luciferase activity of the mutant reporter was unaffected by the simultaneous transfection of miR-101 (Fig.   3c). [score:1]
Levels of miR-101 were ~fivefold higher in adjacent normal tissues than in cancer tissue (from the 80 patients) (P < 0.05) (Fig.   1a). [score:1]
To investigate the biological function of miR-101 in LSCC, recombinant lentiviruses containing the human sequence of miR-101, as well as a GFP cassette, were generated to restore expression of miR-101 to a LSCC cell line. [score:1]
However, the mean tumour volume for the mice treated with miR-101 lentivirus (0.34 ± 0.23 cm [3]) was much smaller than the tumour volumes recorded for the negative control group (0.82 ± 0.47 cm [3]) and the blank control group (0.89 ± 0.46 cm [3]). [score:1]
Furthermore, typical signs of apoptosis, such as nuclear condensation and fragmentation, marginalization of chromatin, cell shrinkage, and formation of cytoplasmic vacuoles, were associated with the miR-101 -treated tumours (Fig.   6C, c). [score:1]
The mice in the treated group received an injection of miR-101 lentivirus (10 [8] TU/ml, 100 µl) once a week, the negative control mice received an injection of GFP-lentivirus (10 [8] TU/ml, 100 µl) once a week, and the blank control mice received an injection of 100 µl DMEM once a week. [score:1]
Taken together, these data strongly indicate that miR-101 induces apoptosis in LSCC cells. [score:1]
b Levels of miR-101 in the Hep-2 cells were significantly lower than in the 16HBE cells. [score:1]
C Cell cycle profiles are shown for: Hep-2 cells in the blank control group (a) [G0/G1 = (64 ± 2.16) %, S = (28.94 ± 2.30) %, G2/M = (7.06 ± 1.40) %]; Hep-2 cells in the negative control group (b) [G0/G1 = (65.11 ± 1.05) %, S = (28.53 ± 1.14) %, G2/M = (6.36 ± 1.33) %]; and Hep-2 cells in the miR-101 -treated group (c) [G0/G1 = (73.79 ± 2.45) %, S = (22.73 ± 1.05) %, G2/M = (3.47 ± 2.27) %]. [score:1]
[1 to 20 of 96 sentences]
3
[+] score: 268
On the other hand, knockdown of c-Jun or/and c-Fos led to a dramatic decrease of the transcription activity of p(−17.4/−16.4k) (Figure 4C) and TPA -induced expression of miR-101 (Figure 4D), suggesting that the expression of miR-101 depends on the activity of AP-1. Figure 4. AP-1 regulates miR-101 expression through the enhancer region of miR-101-2. (A) Effect of AP-1 overexpression on the luciferase activity of the various deleted versions of p(−17.4/−16.4k). [score:11]
On the other hand, knockdown of c-Jun or/and c-Fos led to a dramatic decrease of the transcription activity of p(−17.4/−16.4k) (Figure 4C) and TPA -induced expression of miR-101 (Figure 4D), suggesting that the expression of miR-101 depends on the activity of AP-1. Figure 4. AP-1 regulates miR-101 expression through the enhancer region of miR-101-2. (A) Effect of AP-1 overexpression on the luciferase activity of the various deleted versions of p(−17.4/−16.4k). [score:11]
Here we showed that miR-101, a direct target of AP-1, could attenuate the AP-1 signaling by directly inhibiting the expression of ERK2 and c-Fos. [score:9]
Furthermore, we identified the enhancer region for the miR-101-2 gene and classified AP-1 as a transactivator of miR-101 expression rested on the following evidence: Firstly, ectopic expression of AP-1 or stimulation with TPA, an AP-1 activator significantly increased miR-101 level and knockdown of AP-1 abrogated the TPA -induced miR-101 expression. [score:8]
These results indicate that miR-101 may suppress AP-1 activity by directly inhibiting the expression of ERK2 and c-Fos. [score:8]
Buechner J. Tomte E. Haug B. H. Henriksen J. R. Lokke C. Flaegstad T. Einvik C. Tumour-suppressor microRNAs let-7 and mir-101 target the proto-oncogene MYCN and inhibit cell proliferation in MYCN-amplified neuroblastomaBr. [score:7]
Our results elucidate the regulation mechanism of miR-101 transcription and suggest an important role of the AP-1/miR-101 feedback loop in preventing the excessive activation of metastatic signals imposed by ERK2/AP-1. Although the tumor suppressive role of miR-101 has been reported in a wide variety of cancers, how the expression of miR-101 itself is regulated remains elusive. [score:7]
In a search for the potential targets regulated by miR-101, we found that two key members of the AP-1 signaling pathway, c-Fos and ERK2, are among the list of predicted targets. [score:6]
To explore the biological significance of the AP-1/miR-101 regulatory loop, the effect of miR-101 on the expression of several reported AP-1 target genes was firstly examined by qPCR. [score:6]
We have previously shown that miR-101 is significantly downregulated in hepatocellular carcinoma (HCC) cells, and the restoration of miR-101 dramatically promotes the apoptosis and suppresses the tumorigenicity of hepatoma cells in vitro and in vivo (6). [score:6]
As c-Fos has been previously reported as a direct target of miR-101 in hepatoma cells (8), we only performed luciferase reporter assays to verify whether miR-101 regulated ERK2 expression by binding to its 3′-UTR. [score:6]
To explore which AP-1 component involved in TPA -induced miR-101 expression, the expression of the Jun, Fos and ATF family members was determined in TPA -treated HepG2 cells. [score:5]
The levels of primary miR-101 (pri-miR-101), AP-1 family members and target genes of AP-1, including MMP1, MMP3,  MMP9,  CD44,  uPA,  uPAR,  CCND1 and IL-8, were quantified by Thunderbird SYBR qPCR Mix (QPS-201, TOYOBO, Japan) and normalized to β-actin expression. [score:5]
Studies from others also disclose that miR-101 not only inhibits the proliferation and colony formation of different cancer cells (10, 11) but also suppresses tumor cell migration, invasion and metastasis (4, 5, 7– 10). [score:5]
Among the TPA -induced AP-1 targets, MMP1,  MMP3,  MMP9,  CD44 and IL-8 were suppressed by miR-101 (Figure 6B and Supplementary Figure S7). [score:5]
Left panel: miR-101 suppresses the transcriptional activity of AP-1. Right panel: overexpression effect of miR-101. [score:5]
It is worth noting that downregulation of miR-101 is a common event in cancers and has been implicated in the development and progression of different malignancies. [score:5]
Although the tumor suppressive function of miR-101 has been largely explored, the transcriptional regulation and the regulatory network of miR-101 remain obscure. [score:5]
As AP-1 is an inducible transcription factor complex that can be activated by TPA (18), we therefore treated HepG2 and MHCC-97H cells with TPA to examine whether AP-1 regulated miR-101 expression. [score:4]
Figure 5. MiR-101 suppresses AP-1 activity by targeting c-Fos and ERK2. [score:4]
In this study, we disclose a novel AP-1/miR-101 regulatory circuitry, that is, AP-1 promotes the transcription of miR-101, whereas the expression of miR-101 reduces the levels of ERK2 and c-Fos and thereby attenuates the AP-1 signaling and in turn abrogates the AP-1-promoted migration and invasion of cancer cells. [score:4]
Considering that CD44 and MMPs are critical factors in regulating cell adhesion and Extracellular matrix (ECM)-degrading and gelatin zymography disclosed that both miR-101 and siAP-1 significantly inhibited the TPA-enhanced MMP9 activity (Figure 6C), we therefore evaluated whether miR-101 could inhibit AP-1 -mediated migration and invasion. [score:4]
Overexpression of miR-101 induced a dose -dependent decrease in luciferase activity, an effect mimicked knockdown of ERK2 (Figure  5A and B). [score:4]
In an attempt to explore the regulatory networks of miR-101, we revealed that AP-1 directly transactivated miR-101 and there existed a novel AP-1/miR-101 negative regulatory circuitry in hepatoma cells, whose disturbance enhanced the activity of MMP9 and thus promoted the migration and invasion of hepatoma cells. [score:4]
Our data suggest that frequent downregulation of miR-101 may also account for the abnormal activation of AP-1 signaling in human cancers. [score:4]
Taken together, we suggest a novel AP-1/miR-101 regulatory circuitry: AP-1 promotes the transcription of miR-101, whereas the expression of miR-101 reduces the level of ERK2 and c-Fos and thereby attenuates the AP-1 signaling (Figure 7E). [score:4]
Collectively, these results indicate that c-Jun and c-Fos may directly bind to the −17.4 to −16.4 k region and promote the expression of miR-101. [score:4]
The level of pri-miR-101-1 in the normal human liver (661N) was set to 1. (C) Expression of mature miR-101a and miR-101b in various mouse tissues. [score:3]
Figure 6. The AP-1/miR-101 regulatory feedback loop regulates the migration and invasion of hepatoma cells. [score:3]
Consistently, inhibition of endogenous miR-101 by anti-miR-101 increased ERK2 and c-Fos protein levels and prolonged the TPA -induced activation of both ERK2 and c-Fos (Figure 5D). [score:3]
As expected, the expression of miR-101 increased at 12 h and peaked at 24 h after TPA treatment (Figure 2D and Supplementary Figure S2A) in both cell lines. [score:3]
Expression of miR-101a in the liver was set to 1. Figure 2. AP-1 is associated with transcription and enhancer activity of miR-101. [score:3]
Consistent with the above finding in human cells, the expression of miR-101b, the mouse counterpart of human miR-101-2, is much higher than that of miR-101a in all the mouse tissues examined (Figure 1C), with the highest level of both miR-101a and miR-101b in the liver. [score:3]
Transfection of miR-101 significantly suppressed the Renilla luciferase activity of the psiCHECK-2 reporter with wild-type but not mutant 3′-UTR of ERK2 (Figure 5E). [score:3]
Furthermore, introduction of miR-101 suppressed TPA -induced ERK2 and c-Fos activation (phopho-ERK2 and phopho-c-Fos), as well as total ERK2 and c-Fos proteins (Figure 5C). [score:3]
Expression of miR-101a in the liver was set to 1. Figure 2. AP-1 is associated with transcription and enhancer activity of miR-101. [score:3]
The other MAPKs, including p38 and JNK, were largely unchanged when miR-101 was either overexpressed or depleted (Supplementary Figure S6A and B). [score:3]
Allele loss is one of the main mechanisms of decreased miR-101 expression in prostate tumors, which was also implicated in a subset of other cancers like breast, gastric cancers and glioblastoma (5). [score:3]
HepG2 cells were non -transfected or transfected with the inhibitor of miR-101 (anti-miR-101) or its control (anti-NC) for 44 h, and then treated with TPA for 4 h before protein extraction. [score:3]
The results showed that introduction of miR-101 efficiently suppressed the TPA -induced transcription of pri-miR-101-2 (Figure 6A). [score:3]
Remarkably, miR-101 level was increased by ectopic expression of c-Fos and c-Jun, and was further enhanced by TPA treatment (Figure 4B and Supplementary Figure S5B). [score:3]
These data suggest a potential tumor suppressive role of miR-101. [score:3]
miR-101 transcription is directly activated by AP-1. A novel AP-1/miR-101 regulatory feedback loop is implicated in the migration and invasion of hepatoma cells. [score:3]
The miR-101 inhibitor (anti-miR-101) with a sequence complementary to the mature miR-101 and its control (anti-NC) were 2′- O-methyl -modified RNA oligoribonucleotides. [score:3]
Our findings that AP-1 pathway and miR-101 were regulated in a reciprocal fashion raised the possibility that AP-1 and miR-101 form a regulatory feedback loop. [score:3]
Moreover, TPA induced miR-101 expression in a dose -dependent manner (Figure 2E and Supplementary Figure S2B). [score:3]
Several molecules, including enhancer of  zeste homolog 2 (EZH2),  myeloid cell leukemia sequence 1 (Mcl-1),  c-Fos and MYCN, have been experimentally validated as the targets of miR-101 (5, 6, 8, 11). [score:3]
Deregulation of microRNA-101 (miR-101) has been implicated in the development of different malignancies (4– 9). [score:3]
To determine the relative abundance of different miR-101 primary transcripts, the expression levels of pri-miR-101-1 and pri-miR-101-2 were analyzed in normal human liver tissue (661N) and five human hepatoma cell lines (HepG2, Huh7, MHCC-97H, QGY-7703 and SMMC-7721). [score:3]
Whereas knockdown of either c-Fos or c-Jun (Supplementary Figure S5A) markedly reduced the antibody-precipitated DNAs (Figure 3B), suggesting the interaction between AP-1 and the miR-101 enhancer in vivo. [score:2]
These findings indicate that miR-101 may prevent the excessive activation of metastatic signals imposed by ERK2/AP-1 and the AP-1/miR-101 regulatory loop thus plays a vital role in maintaining cellular homeostasis. [score:2]
Our results suggest that the miR-101 feedback regulation on AP-1 signaling is an alternative mechanism in preventing the prolonged AP-1 activity. [score:2]
Kottakis F. Polytarchou C. Foltopoulou P. Sanidas I. Kampranis S. C. Tsichlis P. N. FGF-2 regulates cell proliferation, migration, and angiogenesis through an NDY1/KDM2B-miR-101-EZH2 pathwayMol. [score:2]
For miR-101 targeted 3′-UTR assays, HepG2 cells in a 48-well plate were co -transfected with 50 ng of the indicated psiCHECK-2 wild-type or mutant reporter plasmids and 50 nM of either miR-101 or control RNA (NC) duplex. [score:2]
In addition, studies in HCCs and bladder cancers have demonstrated that miR-101 is epigenetically repressed by EZH2 -mediated histone modification (10, 24), which may also lead to the aberrant regulation of AP-1 signaling by miR-101. [score:2]
To exclude this possibility, we checked the expression levels of mature miR-101a and miR-101b in different mouse tissues as they have a nucleotide difference that can be distinguished by the TaqMan MicroRNA Assay Kit. [score:2]
Our results highlight the importance of AP-1/miR-101 regulatory loop in preventing the abnormal transcription of pro-metastatic genes and in maintaining cellular homeostasis. [score:2]
This observation suggests that AP-1/miR-101 may regulate multiple downstream genes and might affect different aspects of cellular function. [score:2]
For the AP-1 reporter assays, 50 nM of miR-101, siERK2 or NC were reversely transfected into HepG2 cells for 24 h, then 50 ng of the pAP-1-Luc reporter plasmids (Stratagene, La Jolla, CA, USA) harboring seven copies of AP-1 cis-element on its promoter were co -transfected with 15 ng of pRL-PGK (expressing Renilla luciferase). [score:2]
miR-101 is mainly transcribed from the human miR-101-2 and mouse miR-101b lociThe mature miR-101 is processed from two primary miR-101 transcripts in human: pri-miR-101-1 encoded on chromosome 1 and pri-miR-101-2 encoded on chromosome 9 (Figure 1A). [score:1]
Consistently, the antagonism of miR-101 increased the MMP9 activity (Figure 7A) and in turn promoted the migration and invasion of TPA -treated HepG2 cells (Figure 7B–D). [score:1]
These results suggest that miR-101 is mainly transcribed from the miR-101-2 locus in human and the miR-101b in mouse. [score:1]
miR-101 is mainly transcribed from the human miR-101-2 and mouse miR-101b loci. [score:1]
Taken together, our study delineates a novel mechanism underlying the transactivation of miR-101 gene. [score:1]
To explore the role of miR-101 in AP-1 signaling, HepG2 cells were co -transfected with miR-101 duplex and the luciferase reporter vector harboring seven copies of AP-1 responsive elements (pAP-1-Luc). [score:1]
These data suggest that pri-miR-101-2 is the main precursor of miR-101 in human liver cancer cell lines and normal liver tissue. [score:1]
HepG2 cells transfected with NC or miR-101 were treated with DMSO or TPA for 24 h, then subjected for qPCR. [score:1]
Figure 1. MiR-101 is mainly transcribed from the human miR-101-2 and mouse miR-101b loci. [score:1]
HepG2 cells were co -transfected with NC or miR-101 duplex, and the luciferase reporter plasmid containing wild-type (WT) or mutant (MUT) ERK2 3′UTR. [score:1]
The mature miR-101 level was normalized to the level of U6 to yield a 2 [−△△Ct] value. [score:1]
Taken together, we disclose a novel AP-1/miR-101 regulatory circuit based on in vitro and in vivo assays. [score:1]
Based on the results from qPCR analysis in human hepatoma cell lines and mouse tissues, we showed that miR-101 was mainly transcribed from human miR-101-2 and mouse miR-101b gene loci. [score:1]
A 488-bp wild-type 3′-UTR fragment of human ERK2 mRNA that contained putative binding site for miR-101 was polymerase chain reaction (PCR) amplified from genomic DNA and inserted into XhoI and NotI sites downstream of the stop codon of Renilla luciferase gene in psiCHECK-2 vector (Promega, Madison, WI, USA). [score:1]
There are two genomic loci encode miR-101 in human, including miRNA-101-1 on chromosome 1 and miRNA-101-2 on chromosome 9. MiR-101-1 is located in intergenic region and miR-101-2 in the eighth intron of RCL1 gene. [score:1]
The bioinformatic analysis predicted one conservative miR-101 binding site in ERK2 3′-UTR. [score:1]
In (B) and (D), HepG2 cells without transfection or transfected with anti-miR-101 or anti-NC were treated with or without TPA for 24 h, and then added to transwell chambers for 20 h, followed by analysis for migration (B) and invasion (D). [score:1]
Seed region of miR-101 was underlined. [score:1]
The mutant 3′-UTR, which contained the mutated sequence in the complementary site for the seed region of miR-101, was generated using fusion PCR based on the construct with wild-type 3′-UTR. [score:1]
The miRNA duplexes corresponding to mature miR-101 were designed as described previously (6). [score:1]
In (D)–(F), HepG2 cells without transfection or transfected with NC, miR-101 or siRNA duplex were treated with TPA for 24 h, then added to transwell chambers and incubated for 20 h, followed by staining with crystal violet. [score:1]
To verify this hypothesis, we reintroduced the mature miR-101 mimics into HepG2 cells and analyzed the pri-miR-101-2 level. [score:1]
The mature miR-101 is processed from two primary miR-101 transcripts in human: pri-miR-101-1 encoded on chromosome 1 and pri-miR-101-2 encoded on chromosome 9 (Figure 1A). [score:1]
Upper, putative miR-101 binding sequence in the 3′UTR of ERK2 mRNA. [score:1]
Figure 7. Disruption of the miR-101/AP1 feedback loop promotes the TPA -induced migration and invasion. [score:1]
HepG2 cells were reverse transfected with miR-101 duplex for 24 h, followed by co-transfection with pAP-1-Luc and pRL-PGK plasmids. [score:1]
[1 to 20 of 85 sentences]
4
[+] score: 236
Here, we demonstrate that the RanBP9 gene is a novel target of miR-101, and that miR-101 is involved in the amyloidogenic processing of APP by downregulating the expression of the RanBP9 protein. [score:8]
To identify putative miR-101 target mRNAs associated with APP metabolism, we used several microRNA target prediction computational programs, such as TargetScan, Pictar, and miRanda (Gomes et al., 2013). [score:7]
Expression of the miR-101 lentiviral sponge resulted in an increase in the protein expression levels of the miR-101 targets, APP and RanBP9, with respect to non -injected tissue. [score:7]
Western blotting showed that the expression of the miR-101 sponge induced the upregulation of the APP and RanBP9 proteins in the injected side of the hippocampus relative to the non -injected side (Figure 5). [score:6]
It is worth mentioning that beyond miR-101, among several microRNAs reported to regulate APP expression, miR-153 (Long et al., 2012) is also predicted to target human and mouse, but not rat, RanBP9 3′UTR. [score:6]
Since RANBP9 silencing in pLSyn-miR-101 sponge neurons did not reverse APP protein overexpression we can exclude that RANBP9 protein levels were indirectly modulating APP translation. [score:6]
This observation suggests that RanBP9 upregulation may increase sAPPβ production when miR-101 is inhibited. [score:6]
The miR-101 sponge induces APP and RanBP9 expression in vivoThe significance of miR-101 -mediated post-transcriptional regulation on the expression of its targets was evaluated in vivo by unilaterally injecting lentiviral particles into the hippocampus of adult mice. [score:6]
Furthermore, miR-101 is downregulated in the human AD brain, suggesting that miR-101 expression levels may critically participate in the pathogenesis of AD (Hébert et al., 2008; Nunez-Iglesias et al., 2010). [score:6]
Furthermore, the demonstration that RanBP9 is post-transcriptionally regulated by miR-101 might have interesting disease implications independently of its effects on amyloidogenic processing, because the overexpression of RanBP9 can induce neuronal apoptosis without generating Aβ peptides (Woo et al., 2012), and RanBP9 transgenic mice show synapse loss, neurodegeneration, and spatial memory deficits (Lakshmana et al., 2012; Woo et al., 2012). [score:6]
Consistently with these data we found that the over -expression of miR-101 in hippocampal neurons induced a significant downregulation of RanBP9 protein (Figure S2). [score:6]
The injection of the control lentivirus did not appreciably alter the expression of either miR-101 target (Figure 5). [score:5]
A lentiviral sponge induces the expression of miR-101 targets in hippocampal neurons. [score:5]
On the other hand, lentivirus -mediated overexpression of miR-101 significantly reduced APP expression and the Aβ load in hippocampal neurons (Vilardo et al., 2010). [score:5]
This result demonstrates that the inhibition of miR-101 action on its target genes increases the amyloidogenic processing of APP. [score:5]
Cultured hippocampal neurons expressing the miR-101 sponge were transduced with a lentiviral vector containing RanBP9 siRNA under the control of the U6 promoter, or with a control lentiviral vector expressing a scrambled siRNA. [score:5]
MicroRNA-101 downregulates Alzheimer's amyloid-beta precursor protein levels in human cell cultures and is differentially expressed. [score:5]
Inhibition of miR-101 via delivery of the sponge increased protein expression levels of APP and RanBP9, as well as the secretion of sAPPβ. [score:5]
Figure 1 The conserved miR-101 target site at the 507–513 bp region of the RanBP9 3′UTR is necessary for RanBP9 post-transcriptional regulation. [score:4]
Finally, miR-101 is downregulated in the hippocampus of very old vs. [score:4]
The significance of miR-101 -mediated post-transcriptional regulation on the expression of its targets was evaluated in vivo by unilaterally injecting lentiviral particles into the hippocampus of adult mice. [score:4]
These data indicate that miR-101 negatively regulates RanBP9 expression. [score:4]
To assay the effects of miR-101 on its target genes and their protein products in hippocampal neurons, we used a lentiviral pLSyn-miR-101 sponge vector in which the synapsin promoter controlled the expression of four tandem bulged miR-101 REs located downstream of the EGFP open reading frame (Figure 2). [score:4]
In addition, miR-101 is also downregulated in the human AD cerebral cortex (Hébert et al., 2008; Nunez-Iglesias et al., 2010). [score:4]
Recently, we reported that miR-101 is among the microRNA species that target the APP gene (Vilardo et al., 2010). [score:3]
To determine whether the RanBP9 gene is a target of miR-101, we introduced a firefly reporter vector containing the full-length RanBP9 3′UTR (883 bp) downstream of the luciferase open reading frame into SH-SY5Y neuroblastoma cells. [score:3]
Figure 5Full-length APP and RanBP9 are targets of miR-101 in mouse hippocampal neurons in vivo. [score:3]
This sponge interferes with the actions of miR-101 on its targets, including the RanBP9 gene. [score:3]
Our study provides evidence that miR-101 may regulate not only APP but also RanBP9 in hippocampal neurons both in vitro and in vivo and that miR-101 -mediated post-transcriptional regulation of RanBP9 may modulate the amyloidogenic processing of APP. [score:3]
The relative ratio of APP (pLSyn n = 3; pLSyn-miR-101 sponge n = 4) and RanBP9 (pLSyn n = 3; pLSyn-miR-101 sponge n = 4) expression in injected vs. [score:3]
Seven days later, the lentiviral vector-transduced hippocampal neurons expressed EGFP mRNA at a sub-saturating level, resulting in a notable reduction in EGFP fluorescence in the pLSyn-miR-101 sponge-containing neurons vs. [score:3]
On the other hand, the pLSyn-miR-101 sponge-containing neurons with silenced RanBP9 showed a positive correlation between decreased RanBP9 expression and attenuated sAPPβ secretion into the conditioned medium (Figure 4). [score:3]
We first took advantage of the neuron-selective synapsin promoter (Kügler et al., 2003) to express a lentiviral miR-101 sponge in cultured neurons. [score:3]
2014.00037/abstract Figure S1 The gel blot of RanBP9 protein level in three independent hippocampal cultured neurons expressing the miR-101 sponge construct (pLSyn-miR-101 sponge) and the parental control vector (pLSyn). [score:3]
Further studies in mouse mo dels may therefore elucidate the consequences of long-term inhibition of miR-101 on AD pathology. [score:3]
Previously, we demonstrated that the 3′UTR of APP mRNA can functionally interact with miR-101, a brain-enriched microRNA, and that inhibition of endogenous miR-101 increases APP levels. [score:3]
Silencing of RanBP9 after miR-101 inhibition mitigates sAPPβ overproduction. [score:3]
Figure 2 Expression of the pLSyn-miR-101 sponge in primary hippocampal neurons. [score:3]
The neurons were transduced at 7 days in vitro with 2 × 10 [6] transducing units (TU)/mL of the pLSyn-miR-101 sponge vector (constructed as described below), or with a control pLSyn vector expressing only EGFP. [score:3]
Cultures expressing the pLSyn-miR-101 sponge exhibited sAPPβ levels that were 1.3-fold higher than the control levels found in pLSyn-transduced cells. [score:3]
The synthetic miR-101 precursor significantly reduced luciferase expression by more than 40% relative to the control microRNA. [score:3]
RanBP9 is a target of miR-101. [score:3]
MicroRNA-101 regulates amyloid precursor protein expression in hippocampal neurons. [score:3]
Expression levels in miR-101 sponge-transduced neurons relative to control pLSyn vector-transduced cells are shown. [score:3]
Figure S2 Reduction of RanBP9 protein levels by miR-101 overexpression. [score:3]
Our data showed that miR-101 regulates two target genes that are closely associated with AD, Further investigations are required to determine whether alteration of this regulatory mechanism may affect AD pathogenesis. [score:3]
Figure 3 Inhibition of miR-101 in neurons increases levels of endogenous RanBP9, full-length APP, and its secreted product, sAPPβ. [score:3]
The miR-101 sponge induces APP and RanBP9 expression in vivo. [score:3]
Therefore, study of hippocampal cells may improve our understanding of the role of miR-101 and other microRNAs in the gene regulation as well as the involvement of microRNAs in neurodegenerative processes associated with the progression of AD. [score:2]
Next, we demonstrated the specific relevance of miR-101 -mediated post-transcriptional regulation of the RanBP9 gene to APP metabolism in hippocampal neurons. [score:2]
Intrahippocampal injection of lentiviral sponge particles in adult mice also demonstrated that the APP and RanBP9 genes are regulated by miR-101 in adult hippocampal neurons in vivo. [score:2]
The repressive effect of miR-101 on the RanBP9 3′UTR was abrogated by site-directed mutagenesis of the nucleotides at positions 4 and 5 of the miR-101 RE at 507–513 bp. [score:2]
To evaluate the role of RanBP9 in sAPPβ overproduction, we analyzed the levels of sAPPβ in pLSyn-miR-101 sponge-containing hippocampal cultures in which RanBP9 was downregulated. [score:2]
It would therefore be tempting to speculate that APP protein levels may be influenced by miR-101 post-transcriptional regulation of FMRP/RanBP9 complex. [score:2]
These findings indicate that miR-101 -mediated post-transcriptional regulation is involved in the APP metabolism of adult neurons both in vivo and in vitro. [score:2]
The EGFP signal was slightly lower in the pLSyn-miR-101 sponge-containing neurons (top image) at 14 days post-transduction with respect to the pLSyn-containing neurons (bottom image). [score:1]
Moreover, the overproduction of sAPPβ in the extracellular medium of pLSyn-miR-101 sponge-containing neurons was reversed by RanBP9 silencing. [score:1]
Through the use of computational prediction programs, we found a putative conserved miR-101 RE within the RanBP9 mRNA 3′UTR. [score:1]
The secretion of sAPPβ into the conditioned culture medium was significantly increased for neurons transduced with the pLSyn-miR-101 sponge vector relative to the control pLSyn vector (Figure 3D). [score:1]
Here searching for predicted APP metabolism -associated miR-101 targets we further investigated the action of endogenous miR-101 in hippocampal neurons. [score:1]
A schematic representation of the pLSyn-miR-101 sponge and the control pLSyn lentiviral vector is shown. [score:1]
Rat hippocampal cultures were transduced at 7 days in vitro with either the control pLSyn vector or the pLSyn-miR-101 sponge vector. [score:1]
Control pLSyn vector or pLSyn-miR-101 sponge vector (1 μ L) was unilaterally microinfused into the hippocampus via a stainless steel cannula (0.1 mm in diameter) connected to a Hamilton microsyringe. [score:1]
The miR-101 sponge was constructed by using the following synthetic oligonucleotides: S1 CATAATTCAGTTATCCAGTACTGTACGATTTCAGTTATCCAGTACTGTAACCGGT; AS1 TACAGTACTGGATAACTGAAATCGTACAGTACTGGATAACTGAATTATGGTAC; S2 TT CAGTTATCCAGTACTGTATCACTTCAGTTATCCAGTACTGTACCCGGGGGTACCGAGCT; and AS2 CGGTACCCCCGGGTACAGTACTGGATAACTGAAGTGATACAGTACTGGATAACTGAAACCGG. [score:1]
Our analysis revealed a putative miR-101 RE within the 3′UTR of the mRNA encoding RanBP9 (seed location 507–513 bp), which is conserved among vertebrates (Figure 1A). [score:1]
Figure 4 Silencing of RanBP9 reverses oversecretion of sAPPβ into the conditioned medium of pLSyn-miR-101-containing hippocampal neurons. [score:1]
In the mutant construct, the nucleotides at positions 4 and 5 of the miR-101 RE were mutated, as indicated in bold font. [score:1]
Mice were unilaterally microinfused into the CA1 field of the hippocampus with lentiviral particles derived from the control pLSyn vector (n = 6) or the pLSyn-miR-101 sponge vector (n = 6), as described below. [score:1]
The band intensities for miR-101 sponge-containing neurons were quantified relative to those for control pLSyn vector-containing neurons. [score:1]
Hippocampal neurons at 7 days in vitro were infected with the control pLSyn vector or the pLSyn-miR-101 sponge vector. [score:1]
The miR-101 RE within the RanBP9 3′-UTR is underlined. [score:1]
Preparation of the miR-101 sponge, miRNA and silencing RNA lentiviral vectors, and viral particles. [score:1]
Furthermore, luciferase assays and site-directed mutagenesis experiments demonstrated a functional interaction between the RanBP9 3′UTR and miR-101. [score:1]
are presented as the normalized activity of miR-101 -transfected cells relative to that of cells transfected with cel-miR-67. [score:1]
SH-SY5Y cells were co -transfected with either a reporter construct containing the RanBP9 3′UTR or with a control firefly plasmid, in addition to a synthetic miR-101 precursor or a control microRNA (Figures 1B,C). [score:1]
Oligonucleotides S1 and S2, containing four tandem bulged miR-101 binding sites (at position 11), were annealed with AS1 and AS2, respectively, ligated, and digested with the KpnI restriction enzyme. [score:1]
[1 to 20 of 76 sentences]
5
[+] score: 136
Therefore, up-regulation of miR-101 by cigarette smoke or cadmium could affect lung fluid homeostasis and therefore mucus clearance by suppressing CFTR but also immune responses by preventing dephosphorylation of MAPKs due to inhibition of MKP-1. Future studies need to be done to investigate the effect of smoking cessation on CFTR expression and miRNAs regulating its expression. [score:11]
It is therefore possible that expression and regulation of miRNA-101 is cell-type specific but also depends on the disease state (normal or cancerous). [score:6]
We can speculate that high expression of miR-101 observed in the lung samples could contribute to the sustained activation of Erk1/2 (phosphoErk1/2) observed in COPD patients [22] due to lack of dephosphorylation by MKP-1. Regarding miR-144, this miRNA has been found to be elevated in cancer [23]- [25], and was recently identified to be among the top three miRNAs up-regulated in the lung of COPD patients [7]. [score:6]
Taken together, our results indicate that up-regulation of miR-101 and/or miR144 could contribute to the suppression of CFTR observed in COPD patients. [score:6]
Expression of miR-101 and miR-144 decreases expression of CFTR protein. [score:5]
The expression of three miRNAs predicted to target CFTR (miR-101, miR-144, and miR-145) was determined. [score:5]
Expression of miR-144 and miR-101 Suppresses CFTR Protein in HBE Cells. [score:5]
In order to confirm that miR-101 and miR-144 directly target CFTR, the CFTR 3′UTR was subcloned into the reporter psiCHECK-2 vector. [score:4]
We also determined the role of miR-101 and miR-144 in regulating CFTR expression. [score:4]
Since cadmium is a contaminant of cigarette smoke, it is possible that cadmium present in cigarette smoke was responsible for the up-regulation of miR-101 and miR-144. [score:4]
We further show that miR-101 is up-regulated in the lung of mice subjected to cigarette smoke and in COPD patients. [score:4]
Interestingly, miR-101 was reported to play a role in inflammation by targeting MAPK phosphatase-1 (MKP-1), a dual specific phosphatase that deactivates MAPKs, which functions as a negative regulator of the innate immune system [20], [21]. [score:4]
Cigarette Smoke and Cadmium Induce Up-regulation of miR-101 and miR-144. [score:4]
Interestingly, the cytokine IL-17A was recently identified to up-regulate miR-101 via activation of the Akt pathway in cardiac fibroblasts [21]. [score:4]
Since both cigarette smoke and cadmium activate the Akt pathway [26]- [28], it is possible that up-regulation of miR-101 occurs via a similar pathway in the lung. [score:4]
We focused on miR-101 since this miRNA was the most highly up-regulated by cigarette smoke in vitro. [score:4]
On the other hand, the fact that both miR-101 and miR-144 target the same region suggests that this 3′UTR region is highly regulated by miRNAs. [score:4]
Since miR-101 and miR-144 are predicted to target the CFTR gene, we evaluated the effect of these miRNAs on the expression of CFTR protein. [score:3]
The expression of mature miR-101 and miR-144 was confirmed by quantitative RT-PCR. [score:3]
Effect of the air pollutants cigarette smoke and cadmium on expression of miR-101, miR-144, and miR-145. [score:3]
As indicated in Figure 3, expression of miR-101 reduced the reporter activity by ≈40%. [score:3]
MiR-101 and miR-144 Target CFTR 3′UTR. [score:3]
Mature miR-101 and miR-144 could be detected six hours post-transfection and were still highly expressed 48 hours after transfection (Fig. 2B and data not shown). [score:3]
MiR-101 and miR-144 target the same region of CFTR 3′UTR and share the same seed sequence indicating that these two miRNAs do not act synergistically or additionally. [score:3]
Since we previously showed that miR-101 targets CFTR, we next investigated the expression of the CFTR protein. [score:3]
MiR-101 is Overexpressed in the Lung of Mice Subjected to Cigarette Smoke. [score:2]
Therefore, we investigated whether miR-101 was upregulated in the lung of these COPD patients. [score:2]
MiR-101 targets 3′UTR of CFTR. [score:2]
MiR-101 is Highly Expressed in the Lung of COPD Patients. [score:2]
Gillen et al. recently reported that CFTR can be regulated by several miRNAs including miRNA-144 but did not observe any effect of miR-101 on CFTR [10]. [score:2]
Mutations in the CFTR 3′UTR (CFTR 3′UTR Mut: GU to CA) eliminated the effect of miR-101 and -144 on reporter activity (Figs. 3 and 4). [score:2]
As observed in Figure 6, miR-101 (purple staining) was strongly expressed in bronchial epithelial cells in patients with severe COPD (GOLD 4) when compared to control patients (GOLD 0). [score:2]
Detection of miR-101 in the lung of control (GOLD 0) and GOLD 4 COPD patients. [score:1]
Cells were transfected with 50 ng of psiCHECK containing wild-type (WT) or mutated (Mut) CFTR 3′UTR and 30 nM of pre-miR-101. [score:1]
0050837.g002 Figure 2 HBE cells were transfected with 30 nM of pre-miR-101 or pre-miR-144 using Lipofectamine 2000. [score:1]
HEK-293 cells were transfected with 50 ng of psiCHECK-CFTR or psiCHECK empty vector and either scrambled pre-miR, pre-miR-101, or pre-miR-144. [score:1]
HBE cells were transfected with 30 nM of pre-miR-101 or pre-miR-144 using Lipofectamine 2000. [score:1]
Both pollutants increased miR-101 and miR-144 but had no effect on miR-145. [score:1]
The locked nucleic acid (LNA) modified cDNA probe complementary to human mature miR-101 was used (Exiqon Inc, MA). [score:1]
Total RNA was isolated and expression of mature miR-101, miR-144, and miR-145 was measured by quantitative RT-PCR. [score:1]
Paraffin-embedded, formalin-fixed lung tissues from control (GOLD 0) (A&B) or patients with severe COPD (GOLD 4) (C&D) were incubated with an LNA probe anti-miR-101 (purple staining). [score:1]
0050837.g006 Figure 6 Paraffin-embedded, formalin-fixed lung tissues from control (GOLD 0) (A&B) or patients with severe COPD (GOLD 4) (C&D) were incubated with an LNA probe anti-miR-101 (purple staining). [score:1]
0050837.g003 Figure 3 Cells were transfected with 50 ng of psiCHECK containing wild-type (WT) or mutated (Mut) CFTR 3′UTR and 30 nM of pre-miR-101. [score:1]
MiR-101 (purple staining) was found to be highly expressed in bronchial epithelial cells and in alveolar cells in the lung of mice subjected to cigarette smoke when compared to mice exposed to filtered air (Fig. 5A). [score:1]
Exposure of HBE cells to cigarette smoke resulted in ≈80- and 4-fold increases of miR-101 and miR-144, respectively, while cadmium induced miR-101 and miR-144 by ≈40 and 6 fold (Fig. 1). [score:1]
Detection of miR-101 in the lung of mice subjected to cigarette smoke. [score:1]
[1 to 20 of 46 sentences]
6
[+] score: 136
Here we determined that miR-101 is down-regulated in GBM, resulting in overexpression of the miR-101 target PcG protein EZH2, a histone methyltransferase affecting gene expression profiles in an epigenetic manner. [score:10]
Upon integration of the list of miRNAs predicted to target EZH2 and the differential GBM/NNB miRNA expression ratios, we found that miR-101, miR-98, miR-137, and miR-139 were down-regulated in GBM tissue as compared to NNB and have the potential to regulate EZH2 (Supplemental Table S1B). [score:8]
Here we demonstrate a role for EZH2 overexpression in GBM, which could be inhibited by miR-101, siEZH2, or small molecule inhibitor DZNep. [score:7]
miR-101 is down-regulated in GBM and targets EZH2. [score:6]
We show that miR-101 is down-regulated in GBM cells, resulting in increased EZH2 expression and enhanced GBM cell proliferation, migration, and angiogenesis. [score:6]
DZNep, EZH2 siRNA, and pre-miR-101 all notably repressed EZH2 protein expression and reduced the levels of trimethylation of H3K27 (Fig. 2D), indicating inhibition of EZH2 function. [score:5]
In addition to pre-miR-101, we included EZH2 siRNA, non-related control oligonucleotides, and the S-adenosylhomocysteine hydrolase inhibitor DZNep, a potent EZH2 inhibitor [33, 34]. [score:5]
Our results indicate that EZH2 has a versatile function in GBM progression and that its overexpression is at least partly due to decreased miR-101 expression. [score:5]
Besides miR-101, we also found the predicted EZH2 targeting miRNAs miR-98, miR-137, and miR-139 to be down-regulated in GBM cells as compared to NNB tissue. [score:5]
We provide evidence that miR-101 down-regulation regulates angiogenesis by induction of EZH2 and a pro-angiogenic mRNA profile. [score:5]
The impaired translational repression of EZH2 by miR-101 causes EZH2 overexpression in GBM, which correlates with patient survival. [score:5]
In conclusion, our results indicate that EZH2 has a versatile pro-tumoral function in GBM and that its overexpression is at least partly due to decreased miR-101 expression. [score:5]
In order to determine whether miR-101 up-regulation or EZH2 inhibition also affected GBM cell migration, scratch assays were performed. [score:5]
Figure 3:miR-101-regulated EZH2 affects GBM proliferation in vitro(A) of EZH2 mRNA expression and the correlation to proliferation-related mRNAs. [score:4]
Here we show that miR-101 is down-regulated in glioma in a grade dependent manner. [score:4]
First, down-regulation of miR-101 was confirmed in primary glioma samples of different WHO grades by quantitive PCR (qRT-PCR) analysis (Fig. 2B and 2C). [score:4]
Up-regulation of miR-101 in U87-GFP cells resulted in a substantial decrease in total tubule length and tubule branching (Fig. 5B and 5C). [score:4]
Here we report that EZH2 expression in GBM is regulated by miR-101. [score:4]
Up-regulation of miR-101 by pre-miR-101 resulted in a significant decrease in U87 migration. [score:4]
The complex interaction of reduced miR-101 -mediated translational repression and increased EZH2 -mediated transcriptional repression at least seem to cause pro-tumoral switches in the GBM transcriptome profile. [score:3]
In addition to pre-miR-101, treatment of the U87-GFP cells with EZH2 siRNA and DZNep also inhibited U87 -induced tubule network formation (Fig. 5B and 5C). [score:3]
To establish that miR-101 affects EZH2 protein expression and histone methyltransferase activity in GBM, we transfected human U87 GBM cells with pre-miR-101 molecules and determined the levels of EZH2 protein and H3K27me3. [score:3]
Further research in the nature and behavior of this subset of EZH2-low GBMs and its correlation to miR-101 expression is warranted. [score:3]
Results: Inhibition of EZH2 in vitro by pre-miR-101, EZH2 siRNA, or small molecule DZNep, attenuated GBM cell growth, migration/invasion, and GBM -induced endothelial tubule formation. [score:3]
Figure 5:miR-101/EZH2 affects GBM angiogenesis in vitro(A) of EZH2 mRNA expression and the correlation to angiogenesis-related mRNAs. [score:3]
miR-101 induction, EZH2 knock down by siRNA and treatment with DZNep significantly reduced cellular proliferation in U87-GFP GBM cells (Fig. 3B and 3C). [score:2]
miR-101-regulated EZH2 affects GBM proliferation in vitro. [score:2]
Unpublished data indicate that miR-101 also regulates EZH2 in endothelial cells. [score:2]
miR-101/EZH2 was found to be deregulated in several other types of cancer, including prostate cancer [30], bladder transitional cell carcinoma [31], gastric cancer [37], and described to strongly correlate with migration, invasion, and metastasis [30, 37]. [score:2]
After pre-treatment of the GBM cells with DZNep, or transfection with pre-miR-101, EZH2 siRNA, or non-related oligonucleotides of similar chemistry, and subsequent co-culturing with HBMVECs on Matrigel, we analyzed tubule length and tubule branching. [score:1]
Figure 2: (A) Predicted RNA structure of the 3'UTR of EZH2 by RNAfold software, in red the 2 miR-101 biniding sites are indicated. [score:1]
We were particularly interested in miR-101 since it was confirmed to bind the EZH2 3’-UTR at two sites (Fig. 2A), and was recently shown to interact with EZH2 in other types of cancer [30, 31]. [score:1]
Here we show a role for miR-101 in GBM -induced angiogenesis. [score:1]
U87 cells that were transfected with pre-miR-101 showed a significant decrease in ability to invade, as visualized by Hoechst staining (Fig. 4D and quantitated in 4E). [score:1]
50 nM of pre-miR-101 (Ambion) or pre-miR-control (Ambion) oligonucleotides were transfected into U87 human GBM cells using Lipofectamin2000 (Invitrogen), according the manufacturer's protocol. [score:1]
It remains to be investigated whether these miRNAs truly repress EZH2, and whether other previously identified miR-101 target genes are also repressed by miR-101 in GBM cells, these may include Cox-2, Mcl-1 and Fos [37], MAGI-2 [40], DNA-PKcs and ATM [41], COX-2 [42]. [score:1]
Based on these findings, we decided to further analyze miR-101/EZH2 functionality in GBM. [score:1]
miR-101/EZH2 affects GBM angiogenesis in vitro. [score:1]
[1 to 20 of 38 sentences]
7
[+] score: 97
Eight miRNAs (miR-101, miR-107, miR-122, miR-29, miR-365, miR-375, miR-378, and miR-802), whose expression was found to be downregulated in c-Myc and/or AKT/Ras liver tumors, were selected and their tumor suppressor activity was assessed in c-Myc and AKT/Ras mice. [score:8]
In accordance with the latter findings, we found that Mcl-1, EZH2, and STMN1 genes were significantly down-regulated following miR-101 overexpression in c-Myc [39] and AKT/Ras [21] mouse HCC cell lines (Supplementary Figure 9), suggesting that these genes are miR-101 targets in mouse liver tumors. [score:8]
Of note, preliminary results from our group indicate that co -expression of miR-101 and a Mcl-1 form lacking the 3′ untranslated region (thus impeding the binding of Mcl-1 to miR-101) via hydrodynamic transfection leads to the impairment of miR-101 tumor suppressor activity in AKT/Ras and c-Myc mice. [score:7]
Overexpression of miR-101 efficiently inhibits c-Myc and AKT/Ras induced liver tumor development. [score:6]
For instance, transgenic mice overexpressing viral genes, such as HBX [34] or HCV Core [35] transgenic mice, might be used to test whether miR-101 inhibits hepatitis virus -driven HCC development. [score:6]
These data, together with the downregulation of Mcl-1 in c-Myc and AKT/Ras cell lines, suggest that Mcl-1 may be a crucial target of miR-101 in AKT/Ras and c-Myc hepatocarcinogenesis. [score:6]
Different from all the other tumor suppressor miRNAs tested, overexpression of miR-101 completely prevented both c-Myc and AKT/Ras driven liver tumor formation in mice. [score:5]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
Consistent with our observation, overexpression of miR-101 is able to inhibit the growth of human HCC cell lines with different genetic background, including HepG2 [36], QGY-7703 [36], BEL-7402 [37], Hep3B [40], and Huh7 [40] cells. [score:5]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
Overexpression of miR-101 completely suppresses liver tumor formation induced by c-Myc and AKT/Ras oncogenes. [score:5]
miR-101 has been shown to be downregulated in multiple tumor types, including HCC [36]. [score:4]
miR-101 targets many genes associated with tumorigenesis, such as Mcl-1 [36], EZH2 [37] and STMN1 [38]. [score:3]
Previous studies showed that Mcl-1, an antiapoptotic member of the Bcl-2 family, is a bona fide target of miR-101 in HCC [36]. [score:3]
Overexpression of miR-101 in the liver might represent a novel and efficient strategy for HCC prevention and treatment. [score:3]
Importantly, we found that miR-101 strongly inhibited both c-Myc and AKT/Ras induced hepatocarcinogenesis. [score:3]
Similarly, none of the AKT/Ras/miR-101 injected mice showed any sign of tumor development at the same time point (Figure 5C and 5D). [score:2]
Nonetheless, additional investigations are needed to identify crucial miR-101 targets in liver tumor development. [score:2]
In accordance with the latter hypothesis, in the present study we showed that miR-101 effectively prevents liver tumor development initiated by c-Myc and AKT/Ras oncogenes, providing strong evidence that miR-101 may be an ideal candidate for miRNA -based chemoprevention of HCC. [score:2]
Upon dissection, no liver tumor nodules were identified, and livers of c-Myc/miR-101 injected mice appeared to be completely normal histologically (Figure 5A). [score:1]
Among the 8 miRNAs, 4 miRNA (miR-101, miR-29, miR-107 and miR-122) had available human miRNA array data. [score:1]
Thus, additional investigations in other murine liver cancer mo dels are necessary to further establish the tumor suppressor role of miR-101 in HCC [33]. [score:1]
In summary, the present data indicate that miR-101 possesses a broad anti-tumor activity against mouse liver tumors induced by different oncogenes. [score:1]
Indeed, AKT/Ras/miR-101/Mcl1 and c-Myc/miR-101/Mcl-1 injected mice developed large tumors within 6 weeks post injection, whereas AKT/Ras/miR-101/pT3 and c-Myc/miR-101/PT3 mice were completely healthy at the same time point (Supplementary Figure 10A and 10B). [score:1]
Specifically, all c-Myc/miR-101 injected mice appear to be healthy 8 weeks post injection (Figure 5A and 5B). [score:1]
Furthermore, mo dels of chemically -induced HCC, such as the diethylnitrosamine (DENA) mo del, might be helpful to evaluate the tumor suppressor activity of miR-101 in the context of liver injury and inflammation. [score:1]
Figure 5 (A) Macroscopic (upper panel) and microscopic (lower panel) appearance of livers from c-Myc/pT3 mice and c-Myc/miR-101 mice stained with H&E (100X), insets (400 X). [score:1]
Livers from AKT/Ras/miR-101 injected mice were slightly pale, and clusters of lipid-rich preneoplastic hepatocytes were detected at the microscopic level (Figure 5A). [score:1]
[1 to 20 of 28 sentences]
8
[+] score: 90
Other miRNAs from this paper: mmu-mir-101b, mmu-mir-101c
First, DNA-PKcs inhibition or shRNA knockdown dramatically potentiated salinomycin -induced OS cell death and apoptosis; Second, expression of miR-101, an anti-DNA-PKcs miRNA [26, 36], downregulated DNA-PKcs and augmented salinomycin's lethality in OS cells; Third, forced -expression of DNA-PKcs in OS cells inhibited salinomycin's cytotoxicity; Fourth, salinomycin -mediated anti-tumor activity in vivo was dramatically sensitized with co-administration of DNA-PKcs inhibitor NU7026. [score:15]
DNA-PKcs inhibition, shRNA knockdown or miR-101 expression inhibited salinomycin -induced Beclin-1 expression and autophagy induction. [score:10]
Significantly, DNA-PKcs inhibition (by NU7441), shRNA knockdown, or miR-101 expression largely inhibited autophagy activation by salinomycin in USO2 cells (Figure 4A-4C). [score:8]
Stable U2OS cells, expressing microRNA-101 (“miR-101”), miRNA control (“miR-C”) or the control U2OS cells (“no miR”) were subjected to real-time PCR assay, miR-101 expression A. and DNA-PKcs mRNA expression B. were shown; DNA-PKcs protein expression was also tested C. ; Above cells were treated with vehicle (“V”, 0.1 % of DMSO) or salinomycin (“Sali”, 10 μM) for applied time, cell viability D., CCK-8 assay and apoptosis E., Histone DNA ELISA assay) were tested. [score:6]
Figure 4Stable U2OS cells, expressing scramble control shRNA (“sh-C”), DNA-PKcs-shRNA (“shDNAPKcs-2”) or microRNA-101 (“miR-101”), were treated with vehicle (“V”, 0.1 % of DMSO), salinomycin (“Sali”, 10 μM) or plus NU7441 (10 μM) for indicated time, the percentage of LC3B puncta positive cells was shown A. ; The expression of listed proteins was detected by assay B. Stable U2OS cells, expressing scramble control shRNA (“sh-C”) or Beclin-1-shRNA (“shBeclin-1 a/b”) were treated with vehicle (“V”, 0.1 % of DMSO) or salinomycin (“Sali”, 10 μM) for applied time, Beclin-1 expression C., cell survival CCK-8 assay, D. and apoptosis histone DNA ELISA assay, E. were tested. [score:6]
Figure 3Stable U2OS cells, expressing microRNA-101 (“miR-101”), miRNA control (“miR-C”) or the control U2OS cells (“no miR”) were subjected to real-time PCR assay, miR-101 expression A. and DNA-PKcs mRNA expression B. were shown; DNA-PKcs protein expression was also tested C. ; Above cells were treated with vehicle (“V”, 0.1 % of DMSO) or salinomycin (“Sali”, 10 μM) for applied time, cell viability D., CCK-8 assay and apoptosis E., Histone DNA ELISA assay) were tested. [score:6]
These results again imply that miR-101 selectively targets and downregulates DNA-PKcs in OS cells. [score:6]
Stable U2OS cells, expressing scramble control shRNA (“sh-C”), DNA-PKcs-shRNA (“shDNAPKcs-2”) or microRNA-101 (“miR-101”), were treated with vehicle (“V”, 0.1 % of DMSO), salinomycin (“Sali”, 10 μM) or plus NU7441 (10 μM) for indicated time, the percentage of LC3B puncta positive cells was shown A. ; The expression of listed proteins was detected by assay B. Stable U2OS cells, expressing scramble control shRNA (“sh-C”) or Beclin-1-shRNA (“shBeclin-1 a/b”) were treated with vehicle (“V”, 0.1 % of DMSO) or salinomycin (“Sali”, 10 μM) for applied time, Beclin-1 expression C., cell survival CCK-8 assay, D. and apoptosis histone DNA ELISA assay, E. were tested. [score:6]
Notably, miR-101 expression alone also induced moderate cell death (Figure 3D) and apoptosis (Figure 3E) in U2OS cells, which are in line with the DNA-PKcs inhibitor (Figure 1) and shRNA data (Figure 2). [score:5]
miR-101 downregulates DNA-PKcs and augments salinomycin's cytotoxicity in OS cells. [score:4]
Collectively, these results suggest that miR-101 downregulates DNA-PKcs and potentiates salinomycin's cytotoxicity in OS cells. [score:4]
Significantly, U2OS cells with miR-101 over -expression became vulnerable to salinomycin, which induced profound cytotoxicity (Figure 3D) and apoptosis (Figure 3F) in these cells. [score:3]
Expression of miR-101 in the stable cells was always tested by RT-qPCR assay. [score:2]
The expression of mature microRNA-101 (“miR-101”) was tested by the TaqMan microRNA assay as described [48]. [score:2]
Real-time quantitative PCR (“RT-qPCR”) assay results confirmed miR-101 over -expression in the stable cells (Figure 3A). [score:2]
Cells were transfected with miR-101 or miR-C vector using Lipofectamine 2000 transfection reagent. [score:1]
Recent studies have demonstrated that microRNA-101 (“miR-101”) is anti-DNA-PKcs microRNA [26, 27]. [score:1]
We repeated the miR-101 experiments in MG-63 cells, and similar results were obtained (Data not shown). [score:1]
In the current study, miR-101-exprsssion vector (a gift from Dr. [score:1]
The miR-101 pSuper-puro-GFP vector and miR-control (“miR-C”) vector were gifts from Dr. [score:1]
[1 to 20 of 20 sentences]
9
[+] score: 86
miR-101 downregulation leads to overexpression of its negative feedback regulator, EZH2, which acts as a co-suppressor of YY1 to epigenetically suppress miR-361, upregulating Twist (a direct target of miR-361). [score:17]
miR-101 repression upregulates expression of its target, EZH2 [6], and EZH2 inhibition in EC cells induces miR-101 expression (Figure 3C), suggesting a miR-101/EZH2 double -negative feedback loop. [score:12]
Figure 1(A) miRNA profiling showing miRNAs (103 upregulated and 72 downregulated) differentially expressed in miR-101 mimic -transfected SPAC-1-L cells compared with controls Venn diagram depicts overlapping miRNAs (let-7b, miR-361 and miR-378) that may be EZH2-regulated tumor suppressors. [score:11]
We showed that miR-101 directly targets EZH2 [6], which controls expression of a host of miRNAs [7], indicating possible overlap between miRNAs upregulated by miR-101 and those induced upon EZH2 knockdown. [score:10]
We report that miR-101 can suppress EC cell proliferation, invasion and stem cell-like features by targeting the oncogene EZH2, and downregulating Twist expression [6]. [score:10]
miR-101 restoration upregulated 103 miRNAs and downregulated 72 (Figure 1A; Supplementary Table 1). [score:7]
EZH2 overexpression resulting from miR-101 loss could indirectly activate important oncogenes via suppression of let-7b or miR-361. [score:6]
Our microarray and qRT-PCR analyses demonstrated that the miR-101 mimic, a direct regulator of EZH2 [6], upregulated let-7b and miR-361 (Figures 1A and 3A). [score:6]
To assess global changes in miRNA levels following transient miR-101 mimic overexpression, microarray -based miRNA profiling of the EC cell line, SPAC-1-L, was performed to generate a list of 175 miRNAs. [score:3]
miR-101 and miR-200a/b, known EZH2 -suppressed miRNAs [7, 16], were used as positive controls (Figure 3C). [score:3]
RNA was purified from SPAC-1-L cells transfected with miR-101 or control mimic. [score:1]
[1 to 20 of 11 sentences]
10
[+] score: 80
Other miRNAs from this paper: hsa-mir-101-1, mmu-mir-101b, hsa-mir-101-2, mmu-mir-101c
Introduction of miR-101 in RCC cells downregulated DNA-PKcs expression, and inhibited AKT activation, HIF-2α expression and cell proliferation. [score:10]
Reversely, over -expression of antagomiR-101 downregulated miR-101, and further enhanced DNA-PKcs expression and RCC cell proliferation. [score:8]
Importantly, in 786-0 cells, AKT Ser-473 phosphorylation (Fig. 6E), HIF-2α expression (Fig. 6E) as well as cell proliferation (Fig. 6F,G) were significantly inhibited by miR-101 over -expression, but were further potentiated with introduction of antagomiR-101 (Fig. 6E–G). [score:7]
These results indicate that miR-101 downregulation might be at least one key reason for DNA-PKcs overexpression in RCC cells. [score:6]
These results suggest that miR-101 downregulation could be the key reason of DNA-PKcs overexpression and DNA-PKcs mediated oncogenic behaviors in RCC cells. [score:6]
miR-101 downregulation correlates with DNA-PKcs overexpression in RCC. [score:6]
To study whether low level of miR-101 is responsible of DNA-PKcs overexpression in RCC cells, we exogenously expressed miR-101 into 786-0 cells 32. assay results confirmed miR-101 over -expression in stable 786-0 cells with the miR-101 construct 32 (Fig. 6C). [score:6]
On the other hand, introduction of antagomiR-101 32 expectably downregulated miR-101 in 786-0 cells (Fig. 6C), leading to even higher DNA-PKcs expression (Fig. 6D,E). [score:6]
Stable 786-0 cells expressing miR-101, antagomiR-101, miRNA control (“miR-C”) or vector control (pSuper-puro, “Vector”) were subjected to real-time PCR assay, relative miR-101 expression and DNA-PKcs mRNA expression was shown (C,D). [score:6]
miRNA-101 (miR-101) expression pSuper-puro-GFP vector and antagomiR-101 expression vector as well as miR-control (“miR-C”) and pSuper-puro-GFP vector were gifts from Dr. [score:5]
In the current study, we showed that miR-101 level was significantly lower in human RCC tissues, and in established or primary RCC cells, which might be a reason for DNA-PKcs over -expression. [score:3]
A recent study by Yan et al. showed that miR-101 targeted 3′UTR of DNA-PKcs mRNA, leading to DNA-PKcs mRNA degradation 19. [score:3]
Relative miRNA-101 (miR-101) expression in human RCC tissues (“Tumor”) and surrounding normal renal tissues (“Normal”) as well as in established (A498 and 786-0)/primary human RCC cells or in HK-2 cells was shown (A,B). [score:3]
DNA-PKcs is shown to be negatively regulated by miRNA-101 19. [score:2]
Note that AKT Thr-308 phosphorylation was again not affected by miR-101 nor antagomiR-101 (Fig. 6E). [score:1]
We thus analyzed level of miR-101 in human RCC tissues and RCC cells. [score:1]
Cells were always tested for miR-101. [score:1]
[1 to 20 of 17 sentences]
11
[+] score: 58
Other miRNAs from this paper: hsa-mir-101-1, mmu-mir-101b, hsa-mir-101-2, mmu-mir-101c
When we exogenously overexpressed miR-101 in HepG2 cells (Figure 6E), DNA-PKcs mRNA (Figure 6F) and protein (Figure 6G) expressions were correspondingly downregulated. [score:8]
DNA-PKcs upregulation and miRNA-101 downregulation in human HCC cells and tissues. [score:7]
DNA-PKcs upregulation in human HCC cells and tissues, correlated with miRNA-101 downregulation. [score:7]
These results demonstrate DNA-PKcs overexpression in human HCC tissues, which is correlated with miRNA-101 downregulation. [score:6]
Figure 6DNA-PKcs (Protein and mRNA) and miRNA-101 (“miR-101”) expressions in surgery-isolated fresh human HCC tumor tissues (“Tumor tissues”) and surrounding normal liver tissues (“Liver tissues”) were shown A, C. and D. Protein expression of DNA-PKcs (vs. [score:5]
DNA-PKcs (Protein and mRNA) and miRNA-101 (“miR-101”) expressions in surgery-isolated fresh human HCC tumor tissues (“Tumor tissues”) and surrounding normal liver tissues (“Liver tissues”) were shown A, C. and D. Protein expression of DNA-PKcs (vs. [score:5]
Results in Figure 6D demonstrated clearly that miR-101 level in HCC tissues was significantly lower than that in surrounding normal liver tissues, which might be responsible for DNA-PKcs mRNA/protein upregulation in HCCs (Figure 6A and 6C). [score:4]
Meanwhile, results in Supplementary Figure S3B and S3C demonstrated low miR-101 expression yet high DNA-PKcs mRNA expression in established or primary HCC cells, as compared to the non-cancerous HL-7702 cells. [score:4]
These miR-101 -expressing HepG2 also showed spontaneous cell apoptosis (Figure 6J). [score:3]
Puromycin (5.0 μg/mL, Sigma) was then added to establish stable cells (10-14 days), which were always checked for miR-101 and DNA-PKcs expressions. [score:3]
miRNA-101 (miR-101) expression pSuper-puro construct was described in our previous study [24]. [score:3]
Existing evidences have shown that miR-101 could direct bind to and sequester DNA-PKcs mRNA [36]. [score:2]
Tubulin) was quantified B. Stable HepG2 cells transfected with miR-101 construct, nonsense miRNA-control construct (“miR-C”), or the empty vector (pSuper-puro, “Vector”), were subjected to real-time PCR assay E-F. or Western blotting assay G. to test DNA-PKcs and miRNA-101 expressions. [score:1]
[1 to 20 of 13 sentences]
12
[+] score: 56
Other miRNAs from this paper: mmu-mir-101b, mmu-mir-101c
We further confirmed miR-101 inhibited MARCH7 expression by targeting its mRNA 3′UTR. [score:7]
We also found that expression of miR-101 inhibited proliferation, migration and invasion of S KOV3 cells. [score:5]
In contrast, no significant suppressive effect on luciferase activity was observed in cells transfected with a control vector with mutant MARCH7 3′UTR (MIR- MARCH73UTRm), when miR-101 expression was elevated (Fig. 4C(II)). [score:5]
These data indicate that MARCH7 is a direct target of miR-101. [score:4]
We also found that miR-101 mimics could downregulate the mRNA and protein level of MARCH7 (Fig. 4C(III) and S1K). [score:4]
Our data also demonstrates that MARCH7 can regulate nuclear factor kB (NF-kB) and Wnt/β-catenin pathway, and that MIR-101 controls MARCH7 by targeting MATCH7 3′UTR region. [score:4]
We found that miR-101 markedly inhibited luciferase activity when MARCH7 3′UTR was inserted downstream of luciferase cDNA in our reporter vector (pMIR-MARCH73UTR). [score:3]
The results showed that protein levels of E-cadherin were significantly decreased in LV5-MARCH7-infected A2780 cells (Fig. 4B(I)); whereas, they were significantly increased in LV3-shMARCH7-1 or LV3-shMARCH7-2 infected S KOV3 cells, relative to LV3-NC infected S KOV3 cells (Fig. 4B(II)) Bioinformatics analyses using multiple algorithms showed that MARCH7 is a predictive target of miR-101(http://www. [score:3]
Thus, we experimentally verified whether miR-101 modulated MARCH7 expression in S KOV3 cells. [score:3]
Further, we identified MARCH7 was an authentic target of miR-101. [score:3]
MiR-101 regulates MARCH7 expression in ovarian cancers. [score:3]
The phenotypes can be partially restored expression of a miR-101 resistant MARCH7 (Fig. 4D, 4E and 4F). [score:3]
MiR-101 ectopic expression in epithelial ovarian cancer cell lines resulted in increased apoptosis, decreased cellular proliferation, invasiveness, and reduced growth of tumor xenografts [28, 29]. [score:2]
We constructed a vector to investigate if miR-101 could directly target MARCH7 3′UTR. [score:2]
miR-101 Mimics (sense: 5′-UACAGUACUGUGAUAACUGAA-3′) were synthesized at Ruibo Biotech (Ruibo Biotechnology, Guangzhou, China). [score:1]
, Shanghai, China) were co -transfected into skov3 cells in 24-well plates with 100 nM miR-101 or 100 nM miR-NC and Renilla plasmid by using Endofectin™-Plus (GeneCopoeia). [score:1]
Our results showed that miR-101 mimics reduced the mRNA and protein level of MARCH7 in ovarian cancer S KOV3 cells. [score:1]
The fold changes of relative luciferase activity in miR-101 mimics with indicated plasmids transfected cells were normalized to NC with corresponding indicated plasmids transtected cells, respectively. [score:1]
We predicted that miR-101-specific binding site was located within the 3′UTR of MARCH7 mRNA (Fig. 4C(I)). [score:1]
[1 to 20 of 19 sentences]
13
[+] score: 54
With regard to the downregulated miRNAs, miR-101a regulates the activation of mitogen-activated protein kinase (MAPK) in macrophages by targeting MAPK phosphatase-1 47. [score:7]
The miRNA expression levels in splenic lymphocytes from murine lupus mo dels revealed that miR-101a was also markedly upregulated in splenic T cells, but not B cells, from MRL-lpr mice 49. [score:6]
Further, the targets of miR-101a, such as COX-2, enhancer of zeste homolog 2 and cFos, were all upregulated. [score:6]
The development of colonic inflammation in IL-10 knockout mice was accompanied by the upregulation of miR-101, miR-223 and miR-146a. [score:6]
Seven of these 10 miRNAs were upregulated (miR-223, 146a, 15b, 23a, 27a, 34a and 451) and three were downregulated (miR-101a, 101b and 148a) compared with that observed in the syngeneic grafts. [score:6]
Consistent with the results of the microarray, the expressions of miR-23a, 15b, 27a, 146a, 34a, 451 and 223 were consistent with the level of inflammation (Fig. 4A), and the changes in the expressions of miR-101a, 101b and 148a were in inverse proportion to the inflammation level after transplantation (Fig. 4B). [score:5]
The induction of liver damage in mice exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) showed that miR-101a was differentially downregulated by TCDD. [score:4]
In vitro exposure of colonic intraepithelial lymphocytes to IL-10 resulted in the downregulation of miR-101 and miR-223 54. [score:4]
MiR-101a is also upregulated in CD4 T cells from sanroque mice, which develop lupus-like autoimmune syndrome as a result of the loss of Roquin -mediated repression of the inducible T-cell co-stimulator (ICOS) 50. [score:3]
These data demonstrated that miR101a plays a significant role in the development of liver damage in mice exposed to TCDD 48. [score:2]
The cluster had two groups, one consisting of miR-101a, 101b and 148a and the other consisting of miR-146a, 15b, 23a, 223, 451, 27a and 34a (Table 1). [score:1]
The results suggest that miR-223, 146a, 451, 34a and 15b are strongly correlated with inflammation, while miR-101a and 101b are correlated with the induction or maintenance of tolerance. [score:1]
In contrast, the levels of the three residual miRNAs (miR-101a, 101b and 148a) decreased after transplantation, reaching the lowest level 14 days after transplantation then increasing (Fig. 5B and 6B). [score:1]
Clusters 2 and 3 contain miR-101a and 101b, and 148a, respectively. [score:1]
These reports suggested that miR-101a plays an important role in the anti-inflammatory responses. [score:1]
[1 to 20 of 15 sentences]
14
[+] score: 43
Other miRNAs from this paper: hsa-mir-101-1, mmu-mir-101b, hsa-mir-101-2, mmu-mir-101c
ICOS and miR101 expression are similarly expressed in reactive and AITL T [FH] Physiologically, in mice, Roquin limits ICOS expression by promoting the degradation of ICOS mRNA in a dose -dependent manner [24], [25]. [score:7]
0064536.g004 Figure 4Expression of ICOS and miR101 expression in human reactive and neoplastic T [FH] cells. [score:5]
ICOS and miR101 expression are similarly expressed in reactive and AITL T [FH]. [score:5]
Level of miR101 was low and similar in both neoplastic and reactive T [FH] cells (Figure 4B), in accordance with recent finding in mouse showing that BCL6 could repress inhibitors of specific T [FH] expressing gene including miR101 [28]. [score:5]
Expression of ICOS and miR101 expression in human reactive and neoplastic T [FH] cells. [score:5]
Altogether, by comparing reactive and AITL T [FH] cells, we have shown here that neither alteration of ROQUIN gene nor deregulation of miR101 expression is likely to be a frequent recurrent abnormality in AITL. [score:4]
We therefore looked for miR101 expression in our T [FH] cells. [score:3]
It has been suggested that Roquin repressive effect on ICOS transcripts requires miR101 expression [25]. [score:3]
The level of ICOS mRNA expression is maintained even in the presence of ROQUIN transcripts both in human reactive and tumor T [FH] cells (A) Level of miR101 (has-miR-101) is low and similar in both tumor and reactive T [FH] cells (p = 0,8 unpaired t-test, NS) (B). [score:3]
Analyses of gene expression profiles focused on probesets matching to ROQUIN (228996_at), ICOS (210439_at), and on miR101 (has-miR-101). [score:3]
[1 to 20 of 10 sentences]
15
[+] score: 41
miRNA Number of targets in miRNA-gene bigraph network P-value miR-20a 9 8.16E-09 miR-17 10 1.30E-07 miR-34a 9 2.78E-07 miR-155 14 2.16E-07 miR-18a 5 4.04E-06 miR-22 5 6.18E-06 miR-26a 6 9.29E-06 miR-101 5 3.30E-05 miR-106b 5 3.30E-05 miR-125b 8 8.37E-05 It is well known that AD is a complex disease and devastating neurodegenerative disorder without effective disease-modifying or preventive therapies. [score:7]
MicroRNA-101 downregulates Alzheimer's amyloid-beta precursor protein levels in human cell cultures and is differentially expressed. [score:5]
APP expression was regulated by miR-20a (Hebert et al., 2009; Fan et al., 2010; Delay et al., 2011), miR-17 (miR-17-5p) (Delay et al., 2011), miR-106b (Hebert et al., 2009), and miR-101 (Vilardo et al., 2010; Long and Lahiri, 2011). [score:4]
In addition, it was reported that miR-101 regulates ataxin1 expression in the hippocampus (Lee et al., 2008). [score:4]
The top 10 miRNAs with P ≤ 8.37 e [5] were listed in Table 3. They are miR-20a, miR-17, miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b, indicating that these ten miRNAs could regulate the expression of nodes (genes) in the sub-network of SAMP8 mice and might be one cause inducing SAMP8 mice to exhibit significant nodes (or genes) and to display a distinct genetic sub-network in the brain. [score:4]
In addition, microRNAs, including miR-20a, miR-17, miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b might regulate the expression of genes (nodes) in the sub-network, thereby disrupting the fine-tuning of genetic networks in SAMP8 mice. [score:4]
miRNA Number of targets in miRNA-gene bigraph network P-value miR-20a 9 8.16E-09 miR-17 10 1.30E-07 miR-34a 9 2.78E-07 miR-155 14 2.16E-07 miR-18a 5 4.04E-06 miR-22 5 6.18E-06 miR-26a 6 9.29E-06 miR-101 5 3.30E-05 miR-106b 5 3.30E-05 miR-125b 8 8.37E-05 Differentially expressed mRNA in the hippocampus and cerebral cortex of SAMP8 and SAMR1 mice at 2, 6, and 12 months were investigated using cDNA microarray (Cheng et al., 2007b). [score:3]
MicroRNA-101 regulates amyloid precursor protein expression in hippocampal neurons. [score:3]
Furthermore, the gene expression of CDKN2A and MCM3AP were changed, and miRNAs, including miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b are important in SAMP8 mice in the present study. [score:3]
miR-19, miR-101 and miR-130 co-regulate ATXN1 levels to potentially modulate SCA1 pathogenesis. [score:2]
In these miRNAs, we first indicated that miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b were important in SAMP8 mice. [score:1]
Based on the miRNA-gene bipartite graph network in the brain of SAMP8 mice, we identified the top 10 miRNAs with P ≥ 8.37E-05, including miR-20a, miR-17, miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b (Table 3). [score:1]
[1 to 20 of 12 sentences]
16
[+] score: 36
Other miRNAs from this paper: mmu-mir-199a-1, mmu-mir-200a, mmu-mir-96, mmu-mir-199a-2
Our unpublished data revealed that GTRAP3-18 (also known as Addicsin), an inhibitory protein of EAAC1, is reduced by the transfection of miR-101a-3p, suggesting that the bilateral negative effects for EAAC1 and GTRAP3-18 or other inhibitory factors are counteracted so that the change in the GSH level is less than expected. [score:5]
The heat scale at the right of the panel represents a linear scale, with magenta, black and turquoise representing high, average and low expression, respectively; Expression profiles of miR-96-5p (b), miR-101a-3p (c), miR-199a-5p (d) and miR-200a-3p (e) over 24 h in mesencephalon examined by a microarray or qRT-PCR. [score:5]
The sequences for the target site of miR-96-5p and miR-101a-3p on EAAC1 3′-UTR region are shown. [score:3]
Significant rhythmicity of the expression patterns of miR-96-5p and miR-199a-5p miR-200a-3p was revealed (P=0.0082, 0.026 and 0.023, respectively) but not of miR-101a-3p (P=0.053). [score:3]
These oscillations of miRNAs such as miR-96-5p, miR-199a-5p and miR-200a-3p are unique in mature miRNA processing; other miRNAs such as miR-101a-3p exhibit no significant diurnal changes in expression (Supplementary Fig. 8). [score:3]
We also identified miR-101a-3p as a conserved EAAC1 -targeting miRNA candidate, although this miRNA is classified among the lower-amplitude candidates (Supplementary Fig. 7). [score:3]
Consistent with the decreased endogenous expression of EAAC1 by these miRNAs, the luciferase activity was significantly lower when miR-96-5p or miR-101a-3p was transfected (Williams’ test; P<0.025) (Fig. 4d, Supplementary Fig. 9b). [score:3]
We then tested miR-96-5p and miR-101a-3p as EAAC1 -targeting miRNAs, using a luciferase reporter assay. [score:2]
The transfection of miR-96-5p or miR-101a-3p into HEK293 cells decreased EAAC1 protein compared with control miRNA (Steel’s test; P<0.05), whereas miR-199a-5p and miR-200a-3p had no effects on protein expression (Fig. 4a,b). [score:2]
The result showed that the GSH level was significantly decreased by miR-96-5p (Steel’s test; P<0.05) but not by miR-101a-3p, suggesting that miR-96-5p regulates GSH levels through EAAC1 3′-UTR (Fig. 4f). [score:2]
Our statistical analysis for rhythmicity revealed that miR-101a-3p had no significant rhythm, although analysis of variance (ANOVA) revealed significant variation (ANOVA; P=0.032, Cosinor; P=0.053), suggesting that miR-101a-3p is needed for temporal regulation during a day (Fig. 3c). [score:2]
miR-101a-3p had no effect on the GSH level, whereas it markedly decreased the EAAC1 level. [score:1]
Finally, we examined whether miR-96-5p and miR-101a-3p affect the GSH level. [score:1]
Using qRT–PCR, we confirmed that miR-96-5p, miR-199a-5p and miR-200a-3p oscillate in a diurnal manner as shown by the microarray data (Cosinor; P=0.0082, 0.026 and 0.023, respectively) but that miR-101a-3p does not (Cosinor; P=0.053). [score:1]
[1 to 20 of 14 sentences]
17
[+] score: 32
Pathways analysis predicted that miR-101a is targeting TGFBR1 and SMAD3, miR-582 is targeting TGFB2, SMAD1, miR-425 is targeting TGFBR2 and FST, miR-199a is targeting ACVR2a, miR-148 is targeting ACVR1, and miR-103 is targeting BMP2 in TGF- β signaling pathway. [score:13]
Predicted target and pathway analysis concluded that miR-101a is targeting TGFBR1 and SMAD3, miR-425 is targeting TGFBR2 and FST, miR-582 is targeting SMAD1 and TGFB2, miR-148 is targeting ACVR1, and miR-199a is targeting AcvR1a gene in the TGF- β signaling pathway. [score:13]
In addition to well-known myomiRs, recent studies have demonstrated that miR-486 [49], miR-378 [50], miR181a [80], miR-21a, miR-101a, and miR-151 [54] are also involved in regulation of myogenesis and several other ubiquitously expressed miRNAs have also been found to participate in myogenesis, including miR-26a [51], miR-27b [52, 53], and miR-29 [44]. [score:4]
Of the 8 known miRNAs examined, 7 miRNAs (miR-425, miR-26a, miR-1a, miR-199a, miR-101, miR-378, and miR-151) showed a consistent pattern with the deep sequencing data (Figures 6(a)– 6(j)). [score:1]
Out of 8 known miRNAs, 6 miRNAs have been functionally linked to myogenesis (i. e., miR-1a, miR-26a, miR-133a and miR-199a, miR-101, and miR-378 [38, 50, 51, 54, 55, 70]). [score:1]
[1 to 20 of 5 sentences]
18
[+] score: 29
Recent works have reported that miR-101 downregulation is involved in COX-2 overexpression in human colon cancer cells (CRC) [24], miRNA-26b regulates the expression of COX-2 in desferrioxamine -treated carcinoma of nasopharyngeal epithelial cells [25] and binding of miR-16 to AREs of TNF-α, IL-6, IL-9 and COX-2 mRNA transcripts could promote their degradation [20], [26]. [score:9]
miR-101a also controls mammary gland development by regulating COX-2 expression [52]. [score:5]
The miRNAs (miR-16, miR-26b, miR-101, miR-199a, miR-122 and miR-21) were selected by using miRWalk computational analyses, that covers miRNA-targets interactions information produced by 8 established miRNA prediction programs on 3' UTRs of all known genes of Human, Mouse and Rat, i. e., RNA22, miRanda, miRDB, TargetScan, RNAhybrid, PITA, PICTAR, and Diana-microT, and comparing the obtained results with data collected from the literature. [score:5]
In the context of colon cancer cell lines and colon tumors, miR-101 inhibited COX-2 translation [24]. [score:5]
The expression profile of six miRNAs (miR-16, miR-26b, miR-101, miR-199a, miR-122 and miR-21) was analyzed in HCC cell lines (Table 1). [score:3]
Regarding COX-2, Dey’s group [22], [23] highlighted a miRNA -mediated regulation of COX-2 by mmu-miR-101a and mmu-miR-199a* during embryo implantation and in endometrial cancer cells. [score:2]
[1 to 20 of 6 sentences]
19
[+] score: 28
For bats, 3 out of 4 up-regulated miRNA (miR-101-3p, miR-16-5p, miR-143-3p) likely function as tumor suppressors against various kinds of cancers, while one down-regulated miRNA (miR-221-5p) acts as a tumorigenesis promoter in human breast and pancreatic cancers. [score:9]
The summary of the six DE miRNA common to all species is described in Fig.   5. Briefly, all DE candidates were single copy miRNA across all libraries, and 4 DE miRNA (miR-101-3p, miR-16-5p, miR-143-3p and miR-155-5p) were up-regulated in bats while 2 (miR-125-5p and miR-221-5p) were down-regulated. [score:7]
It is reported that miR-101, which functions as a tumor suppressor, is down-regulated in several cancers. [score:6]
Among the 4 up-regulated miRNA, the expression of miR-101 in bat was at least three times than that in other mammals (Fig.   5). [score:6]
[1 to 20 of 4 sentences]
20
[+] score: 27
FACS analysis showed that the miR-124 -induced down-regulation of the EGFP-Ezh2 3′-UTR expression exceeded that of most other miRNAs and was comparable with the effects induced by miR-26a and miR-101 (Fig. 2, A and B), two miRNAs previously reported to regulate Ezh2 expression and contribute to tumorigenesis (42, 43). [score:9]
Moreover, overexpression of miR-124, as well as miR-26a and miR-101, caused a noticeable down-regulation of endogenous Ezh2 protein level in HEK293T cells (Fig. 2 C). [score:6]
Other than miR-124, miR-26a, and miR-101, six additional miRNAs consistently down-regulated the expression of Ezh2 3′-UTR reporter genes (Fig. 2 D). [score:6]
miR-26a and miR-101 expression constructs were used as positive controls, and miR-9 was used as a negative control. [score:3]
Varambally S. Cao Q. Mani R. S. Shankar S. Wang X. Ateeq B. Laxman B. Cao X. Jing X. Ramnarayanan K. (2008) Genomic loss of microRNA-101 leads to overexpression of histone methyltransferase EZH2 in cancer. [score:3]
[1 to 20 of 5 sentences]
21
[+] score: 23
The upregulation of miR-101a is consistent with the previous finding that miR-101a is upregulated in CD4 [+] T cells from sanroque mice, which develop lupus-like autoimmune syndrome as a result of loss of Roquin mediated-repression of the inducible T-cell co-stimulator (ICOS) [39]. [score:7]
In addition, Real-time RT-PCR revealed that miR-146a, miR-101a, and miR-17-92 were also markedly upregulated in splenic T, but not B cells from MRL-lpr mice. [score:4]
In addition, we found that miR-101a, miR-146a and miR-17-92 cluster (except miR-92) were upregulated in splenic T cells from MRL-lpr mice. [score:4]
Impressively, we found that although several members of the miR-17-92 cluster (miR-17, miR-18a, miR-19a, miR-20a), miR-146a, and miR-101a were not changed in purified splenic B cells, they were significantly upregulated in splenic T cells (Fig. 3). [score:4]
Other studies have also revealed that miR-150, miR-155, miR-17-92, and miR-101a play roles in the regulation of antibody responses, germinal center responses, inflammatory responses, and/or autoimmunity [7], [13], [19], [20], [21]. [score:2]
However, some miRNAs including miR-17-92 cluster members, miR-146a and miR-101a were selectively dysregulated in splenic T cells, but not splenic B cells, suggesting an exclusive role of these miRNAs in lupus T cells. [score:2]
[1 to 20 of 6 sentences]
22
[+] score: 22
For example, microRNA-375, miR-29c, miR-195, miR-625, miR-203, miR-302b, miR-133a, miR-101, miR-27a, miR-655 and miR-200b can suppress the growth of ESCC cells by regulating the expression of a variety of molecules, including IGF1R (insulin-like growth factor 1 receptor), cyclin E, Cdc42, Sox2, Ran, ErbB4, FSCN1 and MMP14, enhancer of zeste homolog 2 (EZH2), KRAS, ZEB1, TGFBR2 and Kindlin-2. In this study, we revealed the inhibitory effects of both miR-26a and miR-144 on proliferation and metastasis of ESCC. [score:8]
We searched the databases TargetScan, PicTar, miRwalk, DIANAmT, microRNA, Microcosm Targets and MicroRanda for miRNAs that might bind to the 3′ -UTR of COX-2. Four candidates including miR-101, miR143, miR-26a and miR-144 were found via computational prediction of microRNA targets. [score:7]
In addition, we have reported that miR-101 inhibits ESCC proliferation and metastasis by regulating COX2 [41]. [score:4]
In our preliminary experiments to examine the effect of those 4 miRNAs on proliferation function of ESCC cell lines, we found that miR-101 or miR-143 could inhibit the proliferation of ESCC cell lines, but miR-26a or miR-144 alone did not. [score:3]
[1 to 20 of 4 sentences]
23
[+] score: 22
Other miRNAs from this paper: hsa-mir-101-1, mmu-mir-101b, hsa-mir-101-2, mmu-mir-101c
In line with our previous findings [26], we showed that SphK1 was dramatically downregulated in HepG2 cells by SphK1 shRNA or over -expression of miRNA-101 (Figure 4D). [score:6]
shRNA- or miRNA-101 -mediated SphK1 downregulation also induced HepG2 cell viability reduction and apoptosis (Figure 4E and 4F). [score:4]
Stable HepG2 cells expressing SphK1-shRNA, scramble control shRNA (“sc- shRNA”) or miR-101 as well as wt-SphK1, or the empty vector (pSuper-puro, “Vector”), were subjected to Western blot assay or real-time PCR assay to test mRNA and protein expressions of SphK1 (D and G). [score:3]
As reported, the miR-101 precursor [26] was sub-cloned into pSuper-puro-GFP vector to generate miR-101 expression construct. [score:3]
Here we found that SphK1 silence (by shRNA or miR-101) significantly inhibited STAT3 activation (pSTAT3 at Y705) in HepG2 cells (Supplementary Figure S3A). [score:3]
miR-101 or SphK1 expression in the stable cells was always tested. [score:3]
[1 to 20 of 6 sentences]
24
[+] score: 21
miR-101 was found to be down-regulated in ALK(+) and (−) human ALCL and CD4/NPM/ALK transgenic mouse mo dels, but its forced expression increased the number of cells arrested in G1 phase of the cell cycle only in ALK(+) and not in ALK(−) ALCL cell lines The serine/threonine kinase mTOR was shown to be targeted by miR-101, and its inhibition led to reduced tumor growth in engrafted ALCL mouse mo dels, suggesting that mTOR inhibitors may offer a viable therapeutic strategy [31]. [score:12]
This attenuated cell proliferation was also likely to be a result of downregulation of miR-101 targets, such as the pro-survival protein Mcl-1 [31]. [score:6]
2.3.1. miR-101, miR-29a and miR-150: Suppressors of Cell Proliferation and Survival. [score:3]
[1 to 20 of 3 sentences]
25
[+] score: 20
However in 501mel cells, miR-101 downregulated reporter gene expression at the two highest concentrations used suggesting that it may play a role in melanocytes or melanoma cells. [score:6]
with miR-101 resulted in some downregulation of the reporter whereas other miRNAs tested did not show statistically significant effects compared to the mouseMitf-3′UTR-luciferase vector alone. [score:3]
The microRNA miR-101 has a highly conserved binding site but did not affect reporter gene expression in HEK293 cells. [score:3]
The other miRNAs tested, miR-27, miR-32 and miR-101 did not show significant effects on luciferase expression in this assay (Fig. 2B). [score:2]
and are the following: hsa-miR-27a (Product ID:PM10939), hsa-miR-32 (Product ID:PM10124), hsa -miR-101 (Product ID:PM10537), mmu-miR-124a (Product ID:PM10691), mmu-miR-137 (Product ID: PM10513), hsa-miR-148a (Product ID:PM10263), hsa-miR-182. [score:1]
Black bars: miR-124/506 binding sites, dark grey bars: binding sites, light grey bars: miR-148/152 binding sites, white bars: miR-27, miR-25/32/92/363/367 and miR-101/144. [score:1]
We tested the effects of microRNAs which have conserved binding sites in the 3′UTR region of Mitf, including miR-27a (located at 229–235 in the mouse Mitf 3′UTR sequence), miR-25/32/92/363/367 (1491–1497), miR-101/144 (3023–3029), miR-124/506 (1639–1646) and miR-148/152 (1674–1680 and 2931–2937) (Fig. 1A and 1B). [score:1]
In addition, seven species contain a conserved second miR-101/144 binding site. [score:1]
All Mitf 3′UTR sequences in 11 vertebrate species analysed contain the miR-27, miR-25/32/92/363/367 and the miR-101/144 binding sites (Fig. 1B). [score:1]
A. The line indicates the 3′ UTR region of the mouse Mitf gene, including the coding region of exon 9. Potential binding sites for miR-27, miR-124/506, miR-25/32/92/363/367, miR-148/152, and miR-101/144 in the mMitf 3′UTR sequence are indicated below the line and potential PAS sites above. [score:1]
[1 to 20 of 10 sentences]
26
[+] score: 19
In TM4 cells exposed to NP, Ppara was down-regulated at both 3 and 24 h. We thus surmised that miRNAs regulated by Ppara may include miR-378, miR-125a-3p, and miRNA-148a at 3 h, and miR-20a, miR-203, and miR-101a at 24 h. Figure 3 Network analysis of miRNAs the expression of which in TM4 cells was altered by NP (A) 3 h. (B) 24 h. Network analysis was performed using an algorithm supported by IPA. [score:7]
In TM4 cells exposed to NP, Ppara was down-regulated at both 3 and 24 h. We thus surmised that miRNAs regulated by Ppara may include miR-378, miR-125a-3p, and miRNA-148a at 3 h, and miR-20a, miR-203, and miR-101a at 24 h. Figure 3 Network analysis of miRNAs the expression of which in TM4 cells was altered by NP (A) 3 h. (B) 24 h. Network analysis was performed using an algorithm supported by IPA. [score:7]
Network analysis of deregulated miRNAs suggested that Ppara may regulate the expression of certain miRNAs, including miR-378, miR-125a-3p miR-20a, miR-203, and miR-101a, after exposure to NP. [score:5]
[1 to 20 of 3 sentences]
27
[+] score: 18
Both miR-145 and miR-495 target SOX9 in mesenchymal stem cells (9, 28), and miR-101 targets SOX9 in hepatocellular carcinoma (29). [score:5]
miR-101 and miR-145 were very lowly expressed, indeed barely detected, in any cell type of the intestinal epithelium (Fig. 1 b). [score:3]
Based on these differences, we conclude that it is likely that both miR-145 and miR-101 are robustly expressed in a non-epithelial mucosal tissue, but not in IECs. [score:3]
Only four miRNA families were expressed at a minimum of 10 reads/million mapped: miR-145, miR-101, miR-320, and miR-30 (Fig. 1 a). [score:3]
Zhang Y., Guo X., Xiong L., Kong X., Xu Y., Liu C., Zou L., Li Z., Zhao J., and Lin N. (2012) MicroRNA-101 suppresses SOX9 -dependent tumorigenicity and promotes favorable prognosis of human hepatocellular carcinoma. [score:2]
At 70% confluency, cells were transfected with 100 n m LNA against miR-30bcd, miR-320a, or miR-101*. [score:1]
Locked Nucleic Acids were purchased from Exiqon (Woburn, MA) including hsa-miR-101* (catalog no. [score:1]
[1 to 20 of 7 sentences]
28
[+] score: 18
Selection of the differentially expressed miRNAs under the relatively strict conditions (≥500 sequence reads in at least one of the libraries selected for comparison, ≥5-fold difference in expression, and a p value of ≤ 0.01) identified nine upregulated miRNAs (let-7e-5p, miR-101a-3p, miR-151-5p, miR-181a-5p, miR-204-5p, miR-340-5p, miR-381-3p, miR-411-5p, miR-9-5p, and miR-219-2-3p) at 3 d, but none at 7 d or 14 d, suggesting that these upregulated miRNAs impact biological functions, particularly during the early stages after nerve allotransplantation with FK506 immunosuppression. [score:13]
Among the nine upregulated miRNAs (let-7e-5p, miR-101a-3p, miR-151-5p, miR-181a-5p, miR-204-5p, miR-340-5p, miR-381-3p, miR-411-5p, miR-9-5p, and miR-219-2-3p), miR-9-5p had the highest fold-change (≥50-fold at 3 d), followed by miR-340-5p with 38.8-fold. [score:4]
Nine candidate miRNAs (let-7e-5p, miR-101a-3p, miR-151-5p, miR-181a-5p, miR-204-5p, miR-340-5p, miR-381-3p, miR-411-5p, and miR-9-5p) were identified. [score:1]
[1 to 20 of 3 sentences]
29
[+] score: 18
g Association of COX-2 mRNA and miR-101a expression levels; values for mRNAs and miR-101a are normalized to cyclophilin B mRNAs and U6 snRNA expression levels, respectively. [score:5]
Abundance of miR-101a, which regulates COX-2 expression (Chakrabarty et al. 2007; Strillacci et al. 2009; Tanaka et al. 2009), was significantly decreased following TCDD exposure, regardless of cPLA [2]α genotype (Fig.   6f). [score:4]
In contrast, cPLA [2]α played only minimal roles in inflammatory reactions, hepatomegaly, and miR-101a -mediated regulation of COX-2 expression in TCDD-exposed livers. [score:4]
Fig.  6CYP1A1 (a), cPLA [2]α (b), F4/80 (c), COX-2 (d), and mPGES-1 (e) mRNA, and miR-101a (f) expression in livers of adult male cPLA [2]α [+/+] and cPLA [2]α [−/−] mice at 8 days post-administration of TCDD (50 μg/kg body weight) or vehicle. [score:3]
Consistent with roles as a negative regulator of COX-2, miR-101a abundance was inversely correlated with COX-2 mRNA abundance (Fig.   6g) with a correlation coefficient of −0.71. [score:2]
[1 to 20 of 5 sentences]
30
[+] score: 18
Target gene Description miRNA ID Osteoblastic genes COL1A1 Type I collagen miR-29a, miR-150, miR-185 BGLAP Osteocalcin – RUNX2 Runt-related transcription factor – Chondrogenic genes COL2A2 Type II collagen miR-7, miR-29a, miR-29b COL10A1 Type X collagen miR-101 SOX9 SRY (sex determining region Y)-box 9 miR-101, miR-124 for the selected genes were carried out with TargetScan, PicTar, or miRanda miRNA target prediction tools. [score:7]
PBX1 (pre-B-cell leukemia homeobox) is a potential target for miR-101 that was over 5-fold upregulated in chondroblasts. [score:6]
miRNA(s) TF Downstream target gene(s) Physiological response(s) Reference(s) miR-101 PBX1 MyoD, COL1A1, BMP4 Suppression of myogenic differentiation in favour of osteogenesis or chondrogenesis. [score:5]
[1 to 20 of 3 sentences]
31
[+] score: 18
miR-101 targets ataxin 1, responsible for SCA1, at both the mRNA and protein levels; miR-433 targets fibroblast growth factor 20 which induces α-synuclein expression, which was previously shown to cause Parkinson’s disease when overexpressed [38]. [score:11]
For example, miR-101 and miR-433, both significantly downregulated in our dataset, have been linked to spinocerebellar ataxia type 1 (SCA1) and Parkinson’s disease, respectively [36], [37]. [score:6]
Other brain-specific miRNAs [14] included in our dataset include miR-101, -127, -128, and -132. [score:1]
[1 to 20 of 3 sentences]
32
[+] score: 18
Downregulated miRNAs included miR-101, which is a tumor suppressor and inhibitor of EZH2 [33]. [score:8]
Downregulated genes that clustered with miR-101 and upregulated genes that clustered with miR-9 were magnified within the figure. [score:7]
B) qPCR validation of miR-9 and miR-101 expression. [score:3]
[1 to 20 of 3 sentences]
33
[+] score: 17
Evidence of the concerted interplay of miRNAs regulated by CpG-ODN and their potential target mRNAs was observed (Fig. 4) for 2 miRNAs upregulated (hsa-miR-302b and hsa-miR-374b) and for 13 miRNAs downregulated in CpG-ODN -treated mice (hsa-miR-135a, hsa-miR-136, hsa-miR-340, hsa-miR-445-5p, hsa-miR-424, hsa-miR-96, hsa-miR-142-3p, hsa-miR-140-5p, hsa-miR-542-3p, hsa-miR-18a, hsa-miR-18b, hsa-miR-101, and hsa-miR-99a). [score:10]
Comparison of hsa-miR-18a, hsa-miR-18b, hsa-miR-140-5p, hsa-miR-101, hsa-miR-556-3p, hsa-miR-424, hsa-miR-136, hsa-miR-340, hsa-miR-302b expression obtained by miRNA expression profile and qRT-PCR on tumors collected from human IGROV-1 ovarian tumor-bearing mice treated daily i. p. with CpG-ODN or saline (control group). [score:5]
Of the 9 miRNAs, hsa-miR-18a and hsa-miR-18b were selected based on their reported role in the pathogenesis of ovarian cancer [25]; [26], and hsa-miR-101 and hsa-miR-302b for their described involvement in DNA repair processes and sensitivity to chemotherapy [20]; the remaining 5 miRNAs were randomly selected. [score:1]
RT-qPCR using the RNA profiled in microarray analysis validated all 9 miRNAs (Fig. S1), whereas RT-qPCR using the RNA of the replica confirmed 6 of 9 miRNAs (p<0.05), with a trend observed for hsa-miR-18b and hsa-miR-101 but not for hsa-miR-136 (Fig. 2). [score:1]
[1 to 20 of 4 sentences]
34
[+] score: 17
[13], [14] Amongst the hundreds of miRs, cardiac fibrosis has been associated with downregulation of miR-29, miR-30, miR-101, and miR-133 families, and with upregulation of miR-21. [score:7]
Cardiac fibrosis is associated with downregulation of miR-29, miR-30, miR-101, and miR-133, and upregulation of miR-21. [score:7]
The intensities for several of these miRs did not change over 3–7 days, including miR-29a, miR-29b, miR-30, miR-101 or miR133 families. [score:1]
Cardiac fibrosis has been associated with decreases in miR-29, [25] miR-133, miR-30, [30] miR-101 [17] and/or increased miR-21 [31], [32] in pathological conditions (e. g. ischemia-reperfusion, hypertrophy and heart failure). [score:1]
There was no significant change in miR-133, miR-30, or miR-101 family members after LPS. [score:1]
[1 to 20 of 5 sentences]
35
[+] score: 16
Despite the up-regulation of miR-101a at 2 days, we did not observe suppression of DNMT3a expression after irradiation or TCDD –exposure, but instead an induction at 2 and 15 days after irradiation (at 5 Gy). [score:8]
In addition, miR-101 has been shown to cause aberrant DNA methylation in hepatocellular carcinoma tissue by targeting DNMT3a (64). [score:3]
All the five candidate signature miRNAs (miR-29b, miR-31, miR-101a, miR-130a, miR-199a-5p) have been reported to show altered expression levels in different types of cancers (49– 58). [score:3]
Mir-101a targets cFOS, EZH2, and COX-2 (62). [score:2]
[1 to 20 of 4 sentences]
36
[+] score: 15
Second, it represses the expression of two COX-2 inhibiting microRNAs miR101 and miR199a and indirectly promote COX-2 expression [11]. [score:8]
We have previously demonstrated that the epithelial sodium channel (ENaC) in the endometrial epithelial cells can be activated by embryo-derived protease, which subsequently triggers a sequence of events in endometrial epithelial cells, including Ca [2+] increase, phosphorylation of CREB (Ca [2+]/cAMP responsive element binding protein), downregulation of miR101 and miR199a, upregulation of COX-2 and eventually PGE [2] production and release to the stroma, leading to decidualization and embryo implantation [10, 11]. [score:7]
[1 to 20 of 2 sentences]
37
[+] score: 15
Prior to the present study, three molecular mechanisms were identified that could be responsible for overexpression of EZH2 in prostate cancer--amplification of the EZH2 gene [8], the deletion of its negative regulator miR-101 [5], and transcriptional regulation of EZH2 by ETS gene family members [12, 13]. [score:5]
miR-101 was shown to specifically target EZH2 for down regulation in prostate cancer cells, and the miR-101 locus was deleted in 37.5% of localized prostate cancers and 66.7% of castrate-resistant metastatic prostate cancer cases. [score:4]
More recently, Varambally et al. used a bioinformatics approach to nominate miR-101 as a potential microRNA that can target EZH2 mRNA for silencing [5]. [score:3]
Interestingly, two of these mechanisms (EZH2 amplification and miR-101 deletion) are encountered more frequently in advanced and castrate resistant prostate cancers than in primary untreated prostate cancers, and ETS family gene fusions and ERG protein overexpression are rarely seen in isolated PIN lesions or PIN lesions associated with ERG -negative carcinomas [34]. [score:3]
[1 to 20 of 4 sentences]
38
[+] score: 14
Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42]. [score:8]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
[1 to 20 of 3 sentences]
39
[+] score: 14
To validate the microarray results, the expressions of five miRNAs were quantified using real-time quantitative PCR, including two up-regulated (miR-23a-3p and miR-215-5p) and three down-regulated (miR-27b-3p, miR-101a-3p, and miR-6394) miRNAs (Fig.   2d). [score:9]
Only 15 miRNAs from the 64 DEMs had validated target genes in IPA by target filter analysis, including miR-6349, miR-101a-3p, miR-6394, miR-126a-3p, miR-721, miR-143-3p, miR-497a-5p, miR-93-5p, miR-215-5p, miR-199a-3p, miR-23a-3p, miR-27b-3p, miR-2861, miR-30a-5p, and miR-370-3p. [score:5]
[1 to 20 of 2 sentences]
40
[+] score: 13
In a comparative analysis involving thymocytes derived from 4 week-old (1 mo) pre-diabetic, T CD3 [+] peripheral lymphocytes derived from pre-diabetic (1 mo or 7 mo) and diabetic (≥ 7 mo), PILs derived from pre-diabetic (1 mo) NOD mice we observed that thymocytes exhibited four modulated miRNAs, of which two were down-regulated (miR-101a and miR-29c) and two were up-regulated (miR-345-5p and miR-34a). [score:7]
For example, miR-101a, which was down-regulated in thymocytes, interacted with the following mRNA targets: Bub1, Bub1b, Cenpf, Endou, Rorc, Pax1, Epha2, Rag1 and Ptcra. [score:6]
[1 to 20 of 2 sentences]
41
[+] score: 13
For example, miR-200a, miR-429 and miR-141 were shown to play important roles in neurogenesis, epithelial-to-mesenchymal transition and Notch signaling [73, 75– 84], miR-214 was found to be overexpressed in fetal sclera versus adult sclera and shown to play important role in brain and retina development and function [36, 85– 89], miR-18b, miR-21, miR-101a, miR-200a and miR-429 were found to be involved in stem cell function and differentiation [90– 100], miR-1306 negatively regulated Alzheimer’s disease gene ADAM10 [101]. [score:7]
Seven of the up-regulated miRNAs (miR-465b, miR-466f, miR-669o, miR-18b, miR-291a, miR-696, miR-101a) were also much more (≥ 5 fold) expressed in the retina compared to the sclera suggesting that they might be involved in the regulation of retina-specific processes. [score:6]
[1 to 20 of 2 sentences]
42
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
miR-101, miR-378 and 143 expression patterns. [score:3]
The expression of miR-101 also varied among the tissues; it could be detected in liver, stomach, salivary glands, pancreas, spleen, lymph node and testes but not in thymus and bladder tissues. [score:3]
Some miRNAs, including miR-208, miR-101, miR-18a, miR-20 and miR-142-3p, showed a weaker expression than other miRNAs tested by small RNA blot analyses (Figures 2 and 3). [score:3]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
[1 to 20 of 4 sentences]
43
[+] score: 10
By using dual luciferase reporter assay and RNA expression assays, the group showed that miR-21 and miR-101 target Aspn to regulate its expression during osteogenic differentiation of PDL cells [65, Table I]. [score:6]
Li and coworkers reported that micro -RNAs miR-21 and miR-101 regulate Aspn expression in PDL cells. [score:4]
[1 to 20 of 2 sentences]
44
[+] score: 10
Buechner and colleagues [3] showed that let-7e-5p, miR-101-3p and miR-202-3p are able to affect MYCN expression in a MYCN amplified neuroblastoma cell line, whereas we found no evidence that they are regulating MYCN in MYCN non-amplified primary neuroblastoma tumors. [score:4]
Notably, three of these excluded miRNAs, let-7e-5p, miR-101-3p and miR-202-3p, have been reported to target MYCN in a MYCN amplified neuroblastoma cell line [3]. [score:3]
Eleven MYCN -targeting miRNAs have thus been identified, of which miR-34a, miR-101, let-7e and miR-202 were shown to affect neuroblastoma proliferation in vitro [3, 8]. [score:3]
[1 to 20 of 3 sentences]
45
[+] score: 10
It has been found that hypoxia decreased the expression of miR-101, a potential anti-oncogenic molecule, and increased expression of miR-21 and miR-210, pro-oncogenic molecules in several cancers including PC [14], [15]. [score:5]
Recent experimental evidence has shown that hypoxia could regulate the expression of a number of miRNAs, including anti-oncogenic (let-7 and miR-101), and pro-oncogenic (miR-21 and miR-210) miRNAs [10], [12], [13], [15], [23], [24]. [score:4]
The results show that CDF increased the relative miRNA levels of let-7c,d, miR-101, and miR-200b and decreased the relative levels of miR-210 in MiaPaCa-2 tumor sphere cells under hypoxic conditions (Figure 5B). [score:1]
[1 to 20 of 3 sentences]
46
[+] score: 10
Two were upregulated (miR-492 and miR-224) and six were downregulated (miR-191, miR-122, miR-192, miR-101, miR-302b, miR-148a) (Figure  1A). [score:7]
Furthermore, it was reported that miR-101, an important tumor-suppressive miRNA in human hepatocarcinomas, was epigenetically repressed by PRC2 complex in a c-Myc -mediated manner [6]. [score:3]
[1 to 20 of 2 sentences]
47
[+] score: 9
Other miRNAs from this paper: hsa-mir-101-1, mmu-mir-101b, hsa-mir-101-2, mmu-mir-101c
Similarly in ovarian cancer, human MDSC isolated from the TME were capable of fostering and maintaining ALDH expression within the CSC pool (26) CD33 [hi] MDSCs stimulated the upregulation of microRNA101 in ovarian cancer cells that in turn targets cell stemness repressor gene C-terminal binding protein (CtBP) 2. The clinical relevance of this was demonstrated in those patients who had tumors with the highest levels of CD33 [hi] cell infiltration, and the lowest levels of CtBP2 expression experienced a shorter overall survival. [score:9]
[1 to 20 of 1 sentences]
48
[+] score: 9
Remarkably, other miRNAs exhibited a higher expression in cultured cells such as: miR-101a-3p, miR-210-3p and miR-21a-5p, possibly indicative that culture conditions could directly affect miRNA expression in differentiating cells. [score:6]
The highest miR-101a-3p expression level was detected in those samples cultured with the AlbuMAX I supplemented medium. [score:3]
[1 to 20 of 2 sentences]
49
[+] score: 9
In our previous study, we conducted miRNA microarray analysis during mammary epithelial cell differentiation in mice and found that miR-101a may regulate cell proliferation by targeting COX-2 expression, which may be important for the differentiation and involution of mammary glands [9]. [score:6]
Similar to miR-101a, increased miR-200a expression was observed in differentiated epithelial cells. [score:3]
[1 to 20 of 2 sentences]
50
[+] score: 9
Mir-101, which we found up-regulated in normal heart, was found instead down-regulated in patients with atrial fibrillation [85]. [score:6]
Among miRNAs preferentially expressed in the heart (Figure 4) mir-148a, mir-101, and mir-138 are particularly important. [score:3]
[1 to 20 of 2 sentences]
51
[+] score: 8
Other miRNAs from this paper: mmu-mir-101b, mmu-mir-101c
miR-101 is down-regulated in glioblastoma resulting in EZH2 -induced proliferation, migration, and angiogenesis. [score:4]
Down-regulation of miR-101 in endothelial cells promotes blood vessel formation through reduced repression of EZH2. [score:4]
[1 to 20 of 2 sentences]
52
[+] score: 7
Conversely, individual and common predicted targets of miR-101a and its -1 5′ isomiR (87% and 74% of HL-1 and heart biopsy tags, respectively; also predominant in ES cells but not the liver [38]) are strongly implicated in cardiovascular disease, suggesting they may act through both common and distinct targets to affect cardiac function (Figure 2F). [score:7]
[1 to 20 of 1 sentences]
53
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, hsa-mir-676, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The miRNA families that change expression in both mice and rats were: mir-7, mir-9, mir-10, mir-15, mir-17, mir-26, mir-29, mir-30, mir-101, mir-130, mir-181, mir-204, mir-339, mir-340, mir-368, mir-434, mir-467. [score:3]
The miRNA families that change expression in both mouse and human were: let-7, miR-7, miR-15, miR-101, miR-140, miR-152 (all validated by qPCR, P < 0.05), as well as miR-17, miR-34, miR-135, miR-144, miR-146, miR-301, miR-339, miR-368 (qPCR not performed). [score:3]
26E-0212mmu-miR-101b-3pmir-1010.297.791.72E-059.11E-0437mmu-miR-101a-3pmir-1010.2410.121.17E-031.92E-0250mmu-miR-107-3pmir-1030.228.773.24E-034.12E-0264mmu-miR-124-5pmir-1240.156.327.13E-037.09E-0233mmu-miR-301a-3pmir-1300.228.396.90E-041.29E-0259mmu-miR-130a-3pmir-1300.168.305.94E-036.44E-0252mmu-miR-135b-5pmir-1350.227.924.08E-034.99E-0274mmu-miR-136-5pmir-1360.229.061.09E-029. [score:1]
[1 to 20 of 3 sentences]
54
[+] score: 7
In addition, recent reports have demonstrated that deferoxamine mesylate (DFO) enhances Ezh2 expression through ARNT induction, which leads to the inhibition of miR-101 expression [48]. [score:7]
[1 to 20 of 1 sentences]
55
[+] score: 7
Tu X MicroRNA-101 suppresses liver fibrosis by targeting the TGFβ signaling pathwayJ. [score:4]
For example, Tu et al. [33] reported that lentivirus -mediated ectopic expression of miR-101 in liver greatly reduced CCl [4] -induced liver fibrosis and Hyun et al. [18] showed that systemic delivery of miR-378a-3p by nanoparticle technology significantly reduced hepatic damage. [score:3]
[1 to 20 of 2 sentences]
56
[+] score: 7
It has been shown that miR101 overexpression significantly reduces App and Aβ load in hippocampal neurons [25]. [score:3]
Interestingly, a microRNA responsive element for miR101 was identified in the 3′-untranslated region (UTR) of App [25]. [score:3]
We noted an increase in miR101-3p in the brainstem that may be sufficient to prevent Aβ plaques in the brain. [score:1]
[1 to 20 of 3 sentences]
57
[+] score: 7
In naïve peripheral CD3 [+] T cells, we found six miRNAs exclusively up-regulated in DBA-1/J mice (miR-195, miR-689, miR-500, miR-196b, miR-10a and miR-805) and four exclusively up-regulated in DBA-2/J mice (miR-467e, miR-101a, miR-125-5p and miR-669a). [score:7]
[1 to 20 of 1 sentences]
58
[+] score: 7
Wang L Microrna-101 suppresses progression of lung cancer through the PTEN/AKT signaling pathway by targeting DNA methyltransferase 3aOncol. [score:4]
MiR-101 affects lung cancer progression by targeting DNMT3A to regulate the PTEN/AKT signaling pathway [27]. [score:3]
[1 to 20 of 2 sentences]
59
[+] score: 7
Other miRNAs from this paper: mmu-mir-340, mmu-mir-101b, mmu-mir-101c
This is in accordance with a recent study that reported the role of miR-101 to orchestrate early postnatal network development and also to target NKCC1 to facilitate the GABA-signaling switch [34]. [score:4]
Additionally, we also found miR-101a-3p downregulated in Lg del [+/−] compared to WT samples. [score:3]
[1 to 20 of 2 sentences]
60
[+] score: 7
PRDM14 -transfected breast cancer cell lines also exhibited increased expression of oncogenic microRNAs (miRNAs) (miR-101, miR-155, miR-21, miR-221, and miR-23a) and decreased expression of tumor suppressor miRNAs (miR-128a, miR-200a/b, and miR-520f) (Supplementary Table 2). [score:7]
[1 to 20 of 1 sentences]
61
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
Among the most up-regulated miRNAs were miR-196b and let-7h, and miR-130c and miR-101a were the most down-regulated. [score:7]
[1 to 20 of 1 sentences]
62
[+] score: 6
Other miRNAs from this paper: mmu-mir-26a-1, mmu-mir-101b, mmu-mir-26a-2, mmu-mir-101c
Apart from directly binding to E-box element of EZH2 promoter, Myc also regulates EZH2 expression by epigenetically repressing 35, 36 the negative regulators miRNA-101 and miRNA-26a 37, 38. miRNA-101 is reduced upon NIC treatment [39]. [score:6]
[1 to 20 of 1 sentences]
63
[+] score: 6
MicroRNA-101 is downregulated in bladder transitional cell carcinoma (TCC) tissues and inhibits cell proliferation and colony formation in TCC cell lines by directly repressing oncogene EZH2 [20]. [score:6]
[1 to 20 of 1 sentences]
64
[+] score: 6
To identify the specific microRNA targeting GSK3 β, we used a neuronal cell line to test the regulatory effects of several potential candidates based on the 3′-untranslated region (3′-UTR) sequence of GSK3 β and previous studies, including microRNA-23b (miR-23b), microRNA-28a (miR-28a), microRNA-221 (miR-221), microRNA-135b (miR-135b), microRNA-101a (miR-101a), microRNA-26a (miR-26a) and microRNA-603 (miR-603). [score:6]
[1 to 20 of 1 sentences]
65
[+] score: 6
Also, Robo2 was targeted by miR-153 in the Udown group and miR-148a/b, miR-338-3p, and miR-101a/b in the Uup group (Fig 6A). [score:3]
Specifically, miR-153in the Udown group microRNA and five microRNAs in the Uup group, miR-148a/b, miR-101a/b, and miR-338-3p, targeted the same mRNA, Robo2. [score:3]
[1 to 20 of 2 sentences]
66
[+] score: 6
Only miR-292-5p and miR-155, miR-21*, and miR-101a showed upregulated expression in the liver and spleen, respectively. [score:6]
[1 to 20 of 1 sentences]
67
[+] score: 6
The miR-20a family and miR-101, which target APP, are down-regulated in AD patients 46 47. [score:6]
[1 to 20 of 1 sentences]
68
[+] score: 5
Inhibition of autophagy by miR-101 targeting autophagy related 4 (ATG4) protein, which is an essential protein for LC3 processing, was recently reported [57]. [score:5]
[1 to 20 of 1 sentences]
69
[+] score: 5
miR-19, miR-101 and miR-130 co-regulate ATXN1 levels to potentially modulate SCA1 pathogenesis. [score:2]
Relevant to polyQ-ATXN1 cytotoxicity, Lee et al. found that ATXN1 levels might be post-transcriptionally regulated by miRNA, specifically miR-19, miR-101, and miR-130. [score:2]
When miR-19, miR101, and miR130 were transfected into HEK293T, HeLa and MCF7 cells, a marked decrease in ATXN1 levels was observed. [score:1]
[1 to 20 of 3 sentences]
70
[+] score: 5
Other miRNAs from this paper: mmu-mir-101b, mmu-mir-101c
In addition to regulation by transcription factors, EZH2 expression is also regulated by microRNAs such as miR101 [3]. [score:5]
[1 to 20 of 1 sentences]
71
[+] score: 5
Tu X microRNA-101 suppresses liver fibrosis by targeting the TGFβ signaling pathwayJ Pathol. [score:5]
[1 to 20 of 1 sentences]
72
[+] score: 5
Moreover, miR-101 regulated the expression of Mcl-1 in liver cancer cells and regulated cyclooxygenase-2 in colon cancer cells [12, 50]. [score:5]
[1 to 20 of 1 sentences]
73
[+] score: 5
A similar result was observed when we used the targets of hsa-let-7b, hsa-mir-18a, hsa-mir-21, hsa-mir-30b and hsa-mir-101 that have the most common targets from both the AD and BARHL1-ESR1 networks (Table S13) for ToppFun analysis. [score:5]
[1 to 20 of 1 sentences]
74
[+] score: 5
In contrast to the microarray data, expression of miR-101 and miR-467f increased as observed by qRT-PCR, showing discrepancy between the two methods (Figures 2C and E), and miR-331 showed no significant change in expression (Figure 2F). [score:5]
[1 to 20 of 1 sentences]
75
[+] score: 5
For example, miR-194 and miR-206 were previously found to be involved in osteoblast [62] and muscle differentiation, [63] respectively, while miR-101, whose expression was decreased in p53R172H iPS cells, is a well-characterised tumour suppressor that inhibits tumour growth and metastasis. [score:5]
[1 to 20 of 1 sentences]
76
[+] score: 5
Other miRNAs from this paper: mmu-mir-154, mmu-mir-410
For instance, mir-101a, which is encompassed by AK021368 (E130102H24Rik), has correlated expression in hindbrain (Emg1) and pons, mir-154 and mir-410 which are encompassed by Mirg are expressed brain-wide with regional covariance in pons (Mtch1) and hippocampus (Mrpl13), and the ACA17 snoRNA hosting transcript mCG1030139 is correlated to Mtnr1b in the thalamus. [score:5]
[1 to 20 of 1 sentences]
77
[+] score: 5
Su H MicroRNA-101, down-regulated in hepatocellular carcinoma, promotes apoptosis and suppresses tumorigenicityCancer Res. [score:5]
[1 to 20 of 1 sentences]
78
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-217, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-34a, mmu-mir-98, mmu-mir-322, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-18b, hsa-mir-503, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, hsa-mir-744, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Osteocyte marker Stemness inhibitor high in 2w−, low in 2w+ miR-18a, 322, 125b-5p, 182, 872, 130a, 191, 28, 425, 196a, 93 Osteocyte negative marker Stemness marker high only in 2w+ Snord85 Osteocyte marker Stemness inhibitor high only in 2w− miR-101a, 16, 23b, 23a, 9, 24, 467c, 140, 10b, 467e, 29a, 27b, 150, 199a-5p, 199b, 218, 17, 126-3p, 99a, 10a, 30e, 19b, 126-5p, 196b, 25, 96, 186, 106b, 31, 22, 140, 30a, 374, 34c, 27a, 880. let-7i, 7g, 7f, 7a, 7b, 7c, 7d Osteocyte negative marker Stemness marker Possible functions of miRNAs were shown in right. [score:5]
[1 to 20 of 1 sentences]
79
[+] score: 5
Chakrabarty et al. found that mmu-miR-101a and mmu-miR-199a* were spatiotemporally expressed in the mouse uterus during implantation concurrently with the expression of the cyclooxygenase-2 gene, which is critical for embryo implantation [4]. [score:5]
[1 to 20 of 1 sentences]
80
[+] score: 5
[31] Overexpression of miR-101 in HCC mice mo del reduces epithelial–mesenchymal transition (EMT) and angiogenesis by repressing EZH2, COX2, STMN1 and ROCK2 [22] and miR-195 suppresses angiogenesis by reducing VEGF, VAV2 and CDC42. [score:5]
[1 to 20 of 1 sentences]
81
[+] score: 4
MiR-101a and miR-199a* regulate uterine expression of cyclooxygenase-2 around the implantation site [15]. [score:4]
[1 to 20 of 1 sentences]
82
[+] score: 4
For example, in this study we screened miRNAs that have been reported to be upregulated in IBD, including miR-223, miR-21, miR-155, miR-19a, miR-101, miR-594, and miR-16. [score:4]
[1 to 20 of 1 sentences]
83
[+] score: 4
Metastasis -associated lung adenocarcinoma transcript 1 (MALAT1) induced DDP resistance by functioning as a ceRNA of miR-101 to regulate the expression of SOX9 and downstream Wnt signaling [12]. [score:4]
[1 to 20 of 1 sentences]
84
[+] score: 4
Reviewing miRTarBase 41, human miRNAs, i. e. hsa-miR-101 and hsa-miR-320a targeting of RAC1 had been observed in cells 55 56, supporting the current findings with these miRNAs in mouse retina. [score:3]
These included miR-103-3p, let-7a/c/e/f-5p, miR-320-3p, miR-101a-3p and miR-672-5p (Fig. 4d and Table 3). [score:1]
[1 to 20 of 2 sentences]
85
[+] score: 4
Consistent with Cao et al.,[26], we also observed a down-regulation of miR-101 in these samples (Supplementary Fig. S5B). [score:4]
[1 to 20 of 1 sentences]
86
[+] score: 4
For example, miR-29b [20] and miR-133a [21] directly represses the expression of several collagen genes, whereas miR-19b [22], miR-101 [23] and miR-146a [24] impairs TGF-β signaling. [score:4]
[1 to 20 of 1 sentences]
87
[+] score: 4
Recently, deregulations of many miRs have been implicated in the growth and metastasis of HCC, such as miR-21 [11], miR-101 [12], miR-124 [13], miR-203 [13], and miR-148 [14], which may be used as potential therapeutic targets or candidates for HCC treatment. [score:4]
[1 to 20 of 1 sentences]
88
[+] score: 3
Five miRNAs (miR-290, miR-720, miR-29c, miR-152 and miR-101a) showed inverse expressions, whereas 23 candidates showed comparable results (r = 0.62, p ≤ 0.0005; Spearman rho). [score:3]
[1 to 20 of 1 sentences]
89
[+] score: 3
These results suggest that a critical Roquin-regulated cis-element is present between nucleotides 2211 and 2271 of ICOS mRNA, a region that has already been implicated in Roquin -mediated regulation of ICOS via a miR-101 binding site 17, 33. [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 3
The interaction of miRNA and their target mRNAs (interactome) that were further investigated with qPCR analysis is presented as follows in Table  2: miRNA/ target gene; let‐7e/ Tlr4, miR101a/ Ptgs2, miR101a/ Dusp1, miR‐15b/ Esrrg, miR‐188/ Atg9a, miR‐34b/ Myc, miR‐34b/ Creb1, miR‐34b/ Vegf, miR‐379/ Cdkn2aip, miR‐691/ Map3k7ip3, miR‐872/ Mecp2 and miR‐872/ Anxa7. [score:3]
[1 to 20 of 1 sentences]
91
[+] score: 3
The 3′ UTR of FMR1 mRNA is a target of miR-101, miR-129-5p and miR-221: implications for the molecular pathology of FXTAS at the synapse. [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
Other miRNAs from this paper: mmu-mir-101b, mmu-mir-101c
MicroRNA-101 targets MAPK phosphatase-1 to regulate the activation of MAPKs in macrophages. [score:3]
[1 to 20 of 1 sentences]
93
[+] score: 3
Furthermore, miR-101 can control SOX9 expression levels in hepatocellular carcinoma [37]. [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
Several miRNAs, such as miR-101 [6], miR-122 [7], [8], [9] miR-373 [10], miR-221/222 [11], [12], [13], miR-195 [14], miR-30d [15], miR-125b [16], miR-18a [17], miR-139 [18], miR-223 [19] and miR-29 [20], have already been reported to regulate HCC tumor progression and metastasis by regulating key genes such as Mcl-1, ADAM17, YAP, DDIT4, Cyclin D1, CDK6, E2F3, Galphai2, LIN28B, estrogen receptor-α, Rho-kinase 2, Stathmin 1 and Bcl-2 and so on. [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 3
For example, decreased levels in certain microRNAs, such as miR101 and miR214, result in the overexpression of EZH2 in cancer [43, 44], and thus factors governing mRNA stability and translation should also be measured. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
MicroRNA-101 regulates amyloid precursor protein expression in hippocampal neurons. [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
MiR-101 regulates zeste homolog 2 and further inhibits the growth of bladder cancer stem cells [19]. [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
Other miRNAs from this paper: cel-let-7, cel-lin-4, hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-29b-1, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-132, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-199a-1, hsa-mir-199a-1, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-128-1, hsa-mir-132, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-138-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-92a-2, rno-let-7d, rno-mir-7a-1, rno-mir-101b, mmu-mir-101b, hsa-mir-181b-2, mmu-mir-17, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-101-2, cel-lsy-6, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7a-2, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-92a-1, rno-mir-92a-2, rno-mir-101a, rno-mir-128-1, rno-mir-128-2, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-199a, rno-mir-181a-1, rno-mir-421, hsa-mir-181d, hsa-mir-92b, hsa-mir-421, mmu-mir-181d, mmu-mir-421, mmu-mir-92b, rno-mir-17-2, rno-mir-181d, rno-mir-92b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, mmu-mir-101c, mmu-let-7j, mmu-let-7k, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Mouse miR-124a as well as miR-128, miR-101 and miR-132 have been reported to be expressed specifically in brain [15]. [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
In fact, a couple of miRNAs (miR-27a and miR-133a), targeting inflammation and cell proliferation, had been found to be modulated by the same NSAID in A/J mice aged 10 weeks, whereas other miRNAs (miR-30, miR-101 and miR-344b) affecting later stages of pulmonary carcinogenesis were able to distinguish the mice according to the yield of both microadenomas and adenomas. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
Other recent studies have reported that miR-9, miR-101 and miR-217 target MALAT1 for degradation in other human cancer cell lines. [score:3]
[1 to 20 of 1 sentences]