sort by

260 publications mentioning mmu-mir-125b-2 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-125b-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 387
Other miRNAs from this paper: hsa-mir-125b-1, hsa-mir-125b-2, mmu-mir-125b-1
In MDA-MB-231 cell lines with high expression of miR-125b, the cells migration ability was decreased significantly with down-regulation of the expression of miR-125b by the miR-125b inhibitor (Figure2A). [score:10]
Scott et al. reported that oncogene ERBB2 was a target of miR-125b [32] but in another report, Zhou et al. found that miR-125b down-regulated the expression of pro-apoptotic BCL-2 antagonist killer1 (Bak1) and miR-125b have no influence on expression of ERBB2 in breast cell lines BT-474, BT-474M1 and SKBr3. [score:10]
The expression of vimentin was up-regulated in MCF-7/ADR cells when treated with miR-125b -mimics; (Figure 7A) while the expression was down-regulated compared with NC or normal control group in MDA-MB-231 cells (Figure 7B). [score:10]
It indicated that miR-125b may downregulate expression of STARD13 gene expression through miR-125b-biding sequences at the 3’UTR of STARD13 gene (Figure 4B). [score:8]
To further study the relationship between miR-125b and the expression of STARD13, qRT-PCR and western bolt were performed to examine the effect of over -expression or down-regulated of miR-125b on the mRNA and protein levels of STARD13 in cancer cells. [score:8]
For the first time, we identified STARD13 as a target of miR-125b (Figure 4) and miR-125b would promote breast cancer cells migration via regulating STARD13 expression (Figure 5B and 5C) by a siRNA targeting STARD13. [score:8]
For human breast cancer cell lines MCF-7 with low metastatic ability and low expression of miR-125b, up-regulation of the expression of miR-125b permitted MCF-7 cell lines to gain a high metastasis potentiality (Figure1B 2A and Figure 3). [score:8]
Furthermore, by knockdown of miR-125b in MDA-MB-231, expression of vimentin and α-SMA was downregulated by knockdown of miR-125b in MDA-MB-231 (Figure. [score:8]
While the expression of miR-125b was down-regulated by adding inhibitor-miR-125b in MDA-MB-231 cell line, the cells migration ability was decreased significantly (P<0.001). [score:8]
qRT-PCR was used to analyzed the expression of miR-125b when treated with mimics, inhibitor and NC and the result showed that the expression of miR-125b was positive correlation with the migration ability of breast cancer cell lines MCF-7 and MDA-MB-231 (Fig. 2C). [score:7]
For miR-125b high -expression cell lines MDA-MB-231, cell migration was inhibited when treated with miR-125b -inhibitor. [score:7]
miRNA over -expression and inhibition: miR-125b -mimics, inhibitors (5′-ucacaaguuagggucucaggga-3′ ) and Normal Control (NC) were designed through the reference of miRbase Database (www. [score:7]
When MCF-7/ADR and MDA-MB-231 cells were treated with Y-27632 (inhibitor of ROCK) after transient transfection with miR-125b -mimics, it completely blocked the upregulation of α-SMA induced by miR-125b rather than the regulation of vimentin (Figure 8). [score:7]
Earlier Scott et al. restored that miR-125b expression in SKBR3 cells which over-express ERBB2 [32]and reported a decreased cell migration due to targeting of ERBB2 by miR-125b. [score:7]
As shown from the images in Fig. 2A, when the expression of miR-125b was upregulated by mimics-miR-125b in MCF-7 cell lines, the cells demonstrated high-migration potentiality compared to cells treated with inhibitor-miR-125b or NC. [score:7]
miR-125b up-regulated the expression of vimentin and α-SMA both at mRNA and protein levels. [score:6]
miR-125b, a human homologue of lin-4, downregulated in bladder, ovarian and breast tumors with functions as a tumor suppressor. [score:6]
[34] We found that miR-125b targeted STARD13 and miR-125b might play a role in regulating vimentin and α-SMA expression. [score:6]
As shown in Figure 3A, in the group of up-regulated miR-125b expression, it was found that 4 cases had kidney metastasis, 1 case had lung metastasis and one had eye metastasis. [score:6]
We found that miR-125b significantly upregulated vimentin and α-SMA expression while another EMT marker E-Cadherin had no significantly changed (data not shown). [score:6]
miR-125b Directly Targeted the Tumor Suppressor gene STARD13. [score:6]
Therefore, we speculated that inhibition of RhoA-ROCK in MCF-7/ADR might affect the regulation function of miR-125b on vimentin and α-SMA expression. [score:6]
miR-125b Promoted Metastasis by Targeting STARD13 in MCF-7. miR-125b regulated breast cancer metastasis by targeting STARD13. [score:6]
Breast Cancer Res Treat 19 Rajabi H Jin C Ahmad R McClary C Joshi MD 2010 MUCIN 1 ONCOPROTEIN EXPRESSION IS SUPPRESSED BY THE miR-125b ONCOMIR. [score:5]
Effects of miR-125b on vimentin and α-SMA expression in MCF-7/ADR and MDA-MB-231 with ROCK inhibitor in vitro. [score:5]
To further explore whether miR-125b promoted metastasis by targeting STARD13, a siRNA targeting STARD13 was designed. [score:5]
0035435.g008 Figure 8Effects of miR-125b on vimentin and α-SMA expression in MCF-7/ADR and MDA-MB-231 with ROCK inhibitor in vitro. [score:5]
When miR-125b -mimics or miR-125b -inhibitor were cotransfected with the reporter plasmid, the relative luciferase activity of the reporter containing wild-type STARD13 3’-UTR was obviously suppressed while the luciferase activity of the reporter containing mutant STARD13 3’-UTR was unaltered. [score:5]
[9], [10], [11], [12] However, miR-125b not only over-expresses in pancreatic cancer, oligodendroglial tumors, prostate cancer, myelodysplastic syndromes and acute myeloid leukemia, but also promotes cell proliferation in prostate cancer cells, enhances invasive potential in urothelial carcinomas and suppresses p53 -dependent apoptosis in human neuroblastoma cells. [score:5]
In addition, we found that tumor suppressor gene STARD13 was a target protein of miR-125b. [score:5]
It may suggest that miR-125b regulate metastasis not only through targeting STARD13 but through also by some other unknown mechanisms. [score:4]
We identified that miR-125b regulated α-SMA expression through STARD13-RhoA-ROCK signaling pathway (Fig. 8). [score:4]
miR-125b directly target STARD13 mRNA. [score:4]
Interestingly, these results suggested that miR-125b regulated metastasis not only by targeting STARD13 but also by some other unknown mechanisms. [score:4]
Int J Cancer 12 Zhang Y Yan LX Wu QN Du ZM Chen J 2011 miR-125b Is Methylated and Functions as a Tumor Suppressor by Regulating the ETS1 Proto-oncogene in Human Invasive Breast Cancer. [score:4]
After transfected with mimics-miR-125b, the adhesion activity was increased about 1.42 fold in MCF-7; when treated with miR-125b inhibitors, the adhesion activity was decreased compared with NC group and the inhibition rate was about 45.8% (Figure. [score:4]
miR-125b may induce the phosphorylation of Rho-GTPases ROCK by silencing STARD13, while the mechanisms of miR-125b regulating vimentin expression need to be further studied. [score:4]
NC group in MCF-7. To validate whether STARD13 is a bona fide target of miR-125b, a human STARD13 3’UTR fragment containing wild-type or mutant miR-125b-biding sequences was sub-cloned to the downstream of the Renilla luciferase reporter gene. [score:3]
NC group in MCF-7. To validate whether STARD13 is a bona fide target of miR-125b, a human STARD13 3’UTR fragment containing wild-type or mutant miR-125b-biding sequences was sub-cloned to the downstream of the Renilla luciferase reporter gene. [score:3]
Plasmid Construction and Establishment of Stable miR-125b Over -expressing Cells. [score:3]
[19] Based on the evidence above, it is theoretically proposed that the expression of miR-125b is closely related to the metastatic activity of tumor cells. [score:3]
[28] Wounded monolayers were then washed for several times with PBS to remove cell debris and transfected with miR-125b -mimics and miR-125b -inhibitor and incubated for 24 h. Cells migrated into wound surface and the average distance of migrating cells was determined under an inverted microscopy at designated time points. [score:3]
In sum, the results indicated that mRNA and protein levels of vimentin and α-SMA were positively correlated with the expression of miR-125b. [score:3]
NC group in MCF-7. We validated that miR-125b promoted breast cancer metastasis in vivo and in vitro and that STARD13 was one of miR-125b targets was also validated in previous results. [score:3]
It showed that there were significant inverse correlations between the expression of miR-125b and STARD13 protein (Figure 4D and E,) for breast cancer cells. [score:3]
q-RT-PCR was used to test the expression of miR-125b in different metastatic potential breast cancer cell lines of MCF-7, MDA-MB-231, MCF-7/ADR MDA-MB-435, and MCF-10A. [score:3]
The normalized miR-125b expression for MCF-10A was set 1. Data were present as mean ± SEM, n = 3, *p<0.05, **p<0.01 vs. [score:3]
MCF-7 cells were transfected with miR-125b- mimics, miR-125b -inhibitors and control RNA. [score:3]
[41] For a long time, miR-125b was considered as an anti-oncogene because of miR-125b was down-regulated in breast cancer. [score:3]
The migratory cell numbers of both cell lines transfected with miR-125b mimics were significantly more than that of cells transfected with inhibitor respectively. [score:3]
The expression of miR-125b affected the metastatic activities of breast cancer cells in vivo and in vitro. [score:3]
In contrast, mRNA and protein levels of Vimentin and α-SMA were reduced by 97.4%, 98.15% and 64.72, 34.66% in MDA-MB-231 with miR-125b -inhibitor transient transfection. [score:3]
0035435.g004 Figure 4(A) MiR-125b directly target human STARD13. [score:3]
However, there was no correlation between miR-125b and the STARD13 expression in mRNA level (Figure 4C). [score:3]
Meanwhile, the morphology of cells treated with miR-125b -inhibitor changed from long shuttle-shape to spherical. [score:3]
We validated that miR-125b promoted breast cancer metastasis in vivo and in vitro and that STARD13 was one of miR-125b targets was also validated in previous results. [score:3]
0035435.g006 Figure 6(A) MCF-7/ADR and MDA-MB-231 cells were transfected with miR-125b -mimics, miR-125b -inhibitors and control RNA. [score:3]
miR-125b -mimics, inhibitor and NC were transfected into MDA-MB-231 and MCF-7/ADR, respectively. [score:3]
The sequences used in these studies were: STARD13-wt: 5′-CTAGTTTTTGCCCAGTGTGACATCAAA CTCAGGGAAGAGGAAGCTAAAGTGACGAGTGA-3′ 5′AGCTTCACTCGTCACTTTAGCTTCCTCT TCCCTGAGTTTGATGTCACACTGGGCAAAAA-3′ STARD13-mut: 5′-CTAGTTTTTGCCCAGTGTGACATCAAAACCGTAGGAGAGGAAGCTAAAGTGACGAGTGA -3 5′-AGCTTCACTCGTCACTTTAGCTTCCTCTCCTACGGTTTTGATGTCACACTGGGCAAAAA-3′ HEK 293T cells were co -transfected with the pMiR-Report vectors containing the STARD13 3’UTR with wild-type (wt) or mutant (mut) sequences and mimics-miR-125b, inhibitor or NC. [score:3]
To investigate the target of miR-125b in breast cancer, systemic bioinformatic publicly available algorithms were used to analyze and identify potential targets. [score:3]
0035435.g007 Figure 7 miR-125b -mimics, inhibitor and NC were transfected into MDA-MB-231 and MCF-7/ADR, respectively. [score:3]
in Fig. 1A showed that the expression of miR-125b in MDA-MB-231, highly metastatic tumor cells, was 5.35 folds more than MCF-10A and 22.6 folds than MCF-7 (Figure 1A). [score:3]
NC group in MCF-7; (D) Breast cancer cell lines of MCF-7 and MDA-MB-231 cells were transfected with miR -mimics, miR-125b -inhibitors and control miRNA, STARD13 protein and β-actin after 72 h were detected by western blot. [score:3]
Although miR-125b has been implicated with functions as a tumor suppressor in breast tumors, its functional role in metastasis has not been clearly described. [score:3]
group of cotransfected with miR-125b and Y-27632 of α-SMA expression. [score:3]
Our results shown that miR-125b has no significant to decrease phosphorylation of ERK1/2 and AKT which downstream targets of ERBB2 in HER2 -negative breast cancer cell lines MCF-7 (Fig. 5E). [score:3]
Expression of miR-125b was detected by qRT-PCR analysis after 48 h from transfection pSilencer-125b and pSilencer-control plasmid into human breast cancer cells MCF-7 for 48 h. Positive cells were selected with 2 ug/ml G418 was confirmed by qRT-PCR. [score:3]
miR-125b -mimics, miR-125b -inhibitor and NC were transfected into the cells for 24 h prior to seeding. [score:3]
The sequences used in these studies were: STARD13-wt: 5′-CTAGTTTTTGCCCAGTGTGACATCAAA CTCAGGGAAGAGGAAGCTAAAGTGACGAGTGA-3′ 5′AGCTTCACTCGTCACTTTAGCTTCCTCT TCCCTGAGTTTGATGTCACACTGGGCAAAAA-3′ STARD13-mut: 5′-CTAGTTTTTGCCCAGTGTGACATCAAAACCGTAGGAGAGGAAGCTAAAGTGACGAGTGA -3 5′-AGCTTCACTCGTCACTTTAGCTTCCTCTCCTACGGTTTTGATGTCACACTGGGCAAAAA-3′ HEK 293T cells were co -transfected with the pMiR-Report vectors containing the STARD13 3’UTR with wild-type (wt) or mutant (mut) sequences and mimics-miR-125b, inhibitor or NC. [score:3]
The role of miR-125b in adjusting the ultrastructure and cytoskeleton protein expression of breast cancer cell lines MDA-MB-231 is possibly through attenuating the phosphorylation of Rho-GTPases by silencing STARD13, as our results showed that miR-125b promoted metastasis by downstream signaling transduction pathways of STARD13. [score:3]
[43] miR-125b regulated G1/S transition through E2F3-Cyclin A2 signaling pathway and kept cells at G1/S phase [10] may indicate an important role of miR-125b in TGFβ1-indunced EMT. [score:2]
These results indicated that HER2 signaling pathway did not play an important role in miR-125b regulated ERBB2 -negative breast cancer metastasis. [score:2]
miR-125b Regulated α-SMA by STARD13-RhoA-ROCK Signaling Pathway. [score:2]
Our results demonstrated that miR-125b was a novel regulator for α-SMA and vimentin in breast cancer cells (Fig. 6). [score:2]
It suggested that miR-125b was important in regulating reorganization of actin cytoskeleton and the maintenance of cell morphology. [score:2]
Vimentin and α-SMA were Involved in miR-125b Regulated Metastasis. [score:2]
The expression of miR-125b was low in most breast cancer cell lines MCF-7, T47D, SK-BR3, BT-20 and MDA-MB-175 compared to mammary epithelial cell MCF-10A, but high in MDA-MB-231 which is a highly metastatic breast cancer cells. [score:2]
The regulation of α-SMA by miR-125b was dependent on STARD13-RhoA-ROCK signaling pathway. [score:2]
[49], [50] To further demonstrate the mechanisms that miR-125b regulated vimentin and α-SMA, we used an inhibitor of ROCK to investigate RhoA-ROCK signal pathway. [score:2]
Confluent monolayers of cells were scratched to be wounded and cultured for 24 h or 36 h. (Figure 1B) The treatment with miR-125b mimics led to significantly increase of wound healing cell migration compared to the treatment of NC and inhibitor of miR-125b in MCF-7 cells. [score:2]
Over -expression of miR-125b induced breast cancer cells to obtain epithelial and mesenchymal characteristics while regulating the reorganization of actin cytoskeleton. [score:2]
It suggested that miR-125b regulated α-SMA in MCF-7 cells through STARD13-RhoA-ROCK signaling pathway. [score:2]
The question of whether miR-125b is a proto-oncogene or anti-oncogene in breast cancers is controversial. [score:1]
0035435.g001 Figure 1 (A) Expression of miR-125b in MCF-7, MDA-MB-435, MCF-7/ADR, MDA-MB-231and MCF-10A cells measured by real-time RT-PCR. [score:1]
Our results obtained from gain-of-function and loss-of-function approaches indicated that miR-125b was positively correlated with the invasive and migratory abilities of breast cancer cells in vitro. [score:1]
Interestingly, miR-125b showed a pro-metastasis function in human breast cancer cell lines MCF-7 and MDA-MB-231. [score:1]
Elevated expression of miR-125b induces luminal-like breast cancer cells to obtain post-EMT or basal-like properties, which has an aggressive phenotype characterized by high cell migration and poor clinical outcome. [score:1]
We investigated the influence of miR-125b on HER2 signaling pathway in ERBB2 -negative breast cancer cell lines MCF-7. [33] Western blotting for phosphorylated ERK1/2 and AKT, downstream targets of ERBB2, demonstrated that there was no significant decrease in MCF-7(Figure 5E). [score:1]
The activation of STARD13 was responsible for MCF-7 metastasis induced by miR-125b was also validated. [score:1]
[13], [14], [15], [16] Latest report identified miR-125b as a basal-like microRNAs and was significantly elevated in highly tumorigenic human breast cancer stem cells [17] and malignant myoepithelioma breast cancer cells. [score:1]
miR-125b Promoted Metastasis of MCF-7 and MDA-MB-231 Cells. [score:1]
pMiR-Report Fluc vectors (Ambion) was used to introduce the portion of the 3’ UTR of STARD13 mRNA containing the putative binding site for miR-125b. [score:1]
Effects of miR-125b on cell migration in MCF-7 and MDA-MB-231 in vitro. [score:1]
In this study, we found that miR-125b played a critical role in breast cancer metastasis. [score:1]
But lasted research shown that miR-125b was a basal-like microRNAs [18] and was significantly elevated in highly tumorigenic human breast cancer stem cells. [score:1]
Therefore, our results supported the hypothesis that miR-125b is critical in breast cancer cells metastasis. [score:1]
Further examination of the consequences of gain- and loss-of-function of miR-125b in breast cancer cells, we investigated the influence of miR-125b on the expression of α-SMA and vimentin, two classical mesenchymal phenotype markers and provided new insights into the function of miR-125b in cancer metastasis. [score:1]
In the present study, we began by examining the function of miR-125b on cell migration. [score:1]
We found that human STARD13 3′-UTR contained putative miR-125b complementary sites. [score:1]
Effects of miR-125b on cell invasion in MCF-7 and MDA-MB-231 in vitro. [score:1]
Interestingly, we found that miR-125b has a role of pro-metastasis in vitro. [score:1]
A complementary site for the seed region of miR-125b was contained by STARD13 3′-UTR (Figure 4A). [score:1]
[18] Even though great evidence indicated the important roles of miR-125b in the biological properties of breast cancer, few reports to date studied the relationship between miR-125b and the metastatic potential of breast cancer. [score:1]
It was shown in Figure 5C, cells showed high-migration potentiality compared to cells of NC or Normal group when down-regulated STARD13 by siRNA-STARD13 (Figure 5D); the group which cotransfected with siRNA-STARD13 and miR-125b mimics displayed significantly difference compared with siRNA-STARD13 group, while the siRNA+miR-125b- group had no significant difference compared to siRNA-STARD13 group. [score:1]
We examined the influence of miR-125b on the adhension activities of breast cancer MCF-7 and MDA-MB-231 cells to the substrates precoated with fibronectin, which is a basement member component. [score:1]
To further examine whether miR-125b would induce EMT, breast cancer cell lines MDA-MB-231 and MCF-7/ADR were used to observe the variation of vimentin and α-SMA because MCF-7 is vimentin -negative cell line. [score:1]
Effects of miR-125b on breast tumor metastasis in vivo. [score:1]
It indicated that miR-125b was a key molecule in adjusting reorganization of actin cytoskeleton. [score:1]
miR-125b affected vimentin and α-SMA at gene level and protein level. [score:1]
In the study of nude mice mo del, we validated that miR-125b had a role of pro-metastasis in vivo by a probe for NIR-imaging. [score:1]
[21] To fully elaborate the influences of miR-125b on the mesenchymal features of breast cancer cells will provide important information on the mechanisms of tumor metastasis. [score:1]
[18] Taken together, miR-125b plays an important role in keeping basal-like and post-EMT properties. [score:1]
Data were present as mean ± SEM, n = 3, *p<0.05, **p<0.01 vs NC group; [Δ]p<0.05, group of cotransfected with siRNA-STARD13 and miR-125b mimics vs group of treatment with siRNA-STARD13. [score:1]
To test whether miR-125b was pro-metastasis in vivo, a metastasis animal mo del was designed. [score:1]
In addition, we investigated the mechanisms of pro-metastasis for miR-125b and found that STARD13, (StAR-related lipid transfer domain containing 13) also known as DLC2 (deleted in liver cancer cells) with a Rho-GAPase-activating protein (RhoGAP), [26] was a target protein of miR-125b. [score:1]
[1 to 20 of 115 sentences]
2
[+] score: 341
To systematically identify direct targets of miR-125b in the p53 network of vertebrates, we first employed a bioinformatics approach by identifying all predicted miR-125b targets in the p53 network, followed by three complementary methods to screen and validate these targets for both direct binding and repression by miR-125b (Figure 1). [score:9]
Our identification of 20 direct targets of miR-125b in the p53 network reconciles these findings because miR-125b modulates the expression of both apoptosis regulators and cell-cycle regulators. [score:8]
We identified 20 direct targets of miR-125b in the p53 network, including 15 novel targets like Zac1, Puma, Itch and Cdc25c, and also targets like Bak1 and Tp53 that were identified in previous studies [9], [16]– [18]. [score:8]
On the other hand, miR-125b can also downregulate proliferation in a variety of human cancer cell-lines [19]– [23] and one of its bona fide targets Lin28, also promotes cancer cell proliferation [24]. [score:6]
Finally, we checked miR-125b regulation of protein expression in a subset of p53 network targets for which reliable Western blotting was possible. [score:6]
Although miR-125b's suppression of p53 itself is not conserved in mice, miR-125b's anti-apoptotic role – through suppression of multiple pro-apoptosis regulators in the p53 network – appears to be conserved in vertebrates. [score:6]
Quantification of the pulled down mRNA targets in hLF cells revealed that 13 out of 22 gene transcripts, Bak1, Cdc25c, Edn1, Igfbp3, Mre11a, Ppp1ca, Ppp2ca, Prkra, Puma, Tdg, Tp53, Tp53inp1 and Zac1, were direct binding targets of miR-125b in human cells (Figure 3A). [score:6]
In this study, we sought to identify direct targets of miR-125b in the p53 network of humans, mice and zebrafish, to better understand how miR-125b regulates the p53 network throughout evolution and how that might relate to its conserved role in regulating tissue stem cells. [score:6]
We demonstrate that miR-125b directly represses 20 novel targets in the p53 network, including both apoptosis regulators like Bak1, Igfbp3, Itch, Puma, Prkra, Tp53inp1, Tp53, Zac1, and also cell-cycle regulators like cyclin C, Cdc25c, Cdkn2c, Edn1, Ppp1ca, Sel1l. [score:6]
Overexpression of miR-125a/b causes an expansion of mammalian hematopoietic stem cells (HSCs) and aberrant differentiation, leading to myeloid leukemia [9], [10] and also lymphoid leukemia if miR-125b is overexpressed in fetal liver HSC-enriched cells [12]. [score:5]
Transfection of miR-125b significantly suppressed 40-60% (P<0.01) of the luciferase activity of many 3′ UTR reporters of the miR-125b targets we analyzed, relative to transfection of the negative control miRNA (Figure 4A). [score:5]
To address this question, we used a gain- and loss-of-function screen for miR-125b targets in different vertebrates, and validated these targets with the luciferase assay and a novel miRNA-target pull-down assay. [score:5]
miR-125a-AS was co -transfected with miR-125b-AS to achieve a complete silencing of the miR-125a/b family, because miR-125a, which shares the same seed sequence and the same predicted targets as miR-125b, is also highly expressed in human and mouse fibroblasts (Figure S1C, S1D). [score:5]
The genes at the intersection of the predicted miR-125b target list and the list of p53 network genes constituted our list of predicted miR-125b targets in the p53 network (Table S1). [score:5]
Tp53 mRNA was pulled down by miR-125b only in human lung fibroblasts and zebrafish embryos but not in mouse fibroblasts, consistent with previously published results [16] and the Targetscan algorithmic prediction that miR-125b targets Tp53 in humans and zebrafish but not in mice. [score:5]
On the other hand, several research groups have also reported miR-125b's role as a potential tumor suppressor by suppressing proliferation in cell-culture mo dels [19]– [23]. [score:5]
cell-cycle regulators and thus buffer the p53 network dosage in different contexts, could explain why miR-125b dysregulation can lead to either tumor suppression or oncogenesis depending on the context. [score:5]
We then analyzed the TargetScan and MicroCosm Target databases [31], [32] for genes that are predicted to possess miR-125b -binding sites in their 3′ UTRs, in three vertebrate genomes: human, mouse and zebrafish. [score:5]
The targets of miR-125b in human and mouse were predicted by TargetScan [31]. [score:5]
miR-125b has been shown to downregulate apoptosis in many contexts, in some cases by repressing Tp53 and Bak1. [score:4]
Direct binding interactions between miR-125b and mRNA targets from the p53 network. [score:4]
Instead, conserved miR-125b regulation of the p53 network appears to occur through evolving miRNA-target pairs in the three vertebrates – zebrafish (Figure 6A), mouse (Figure 6B), and humans (Figure 6C). [score:4]
To assess which candidate miR-125b targets identified in the gain- and loss-of-function qRT-PCR screen are directly bound by miR-125b in cells, we employed a novel miRNA pull-down method developed by Lal et al. (manuscript in preparation). [score:4]
miR-125b regulation of the p53 network, but not individual miRNA-target pairs, is conserved. [score:4]
As a final validation of the candidate miR-125b targets we have identified in the p53 network, we tested our candidate target genes with the luciferase reporter assay. [score:4]
of point mutations into the predicted seed binding sequences abrogated miR-125b-repression of each target 3′UTR luciferase reporter (P<0.05), validating the predicted miR-125b binding sites and confirming the miRNA-mRNA sequence evolution patterns we observed (Figure 4E). [score:4]
Where cloning was successful, we cloned the entire 3′ UTR of selected candidate target genes into a Renilla luciferase reporter, and assayed luciferase expression following co-transfection of miR-125b duplex into HEK-293T cells. [score:4]
Genes that were either significantly repressed by miR-125b or significantly derepressed by miR-125a/b-AS with fold-changes within the range of microRNA regulation (P<0.05, fold change > 1.3), were selected as candidate miR-125b targets (Figure 2B–2D). [score:4]
Using our conservative estimate of miR-125b targets in the p53 network, we found that in all three vertebrates we examined – humans, mice and zebrafish – miR-125b regulates multiple p53 network genes. [score:4]
Identifying direct targets of miR-125b in the p53 network. [score:4]
Candidate p53 network genes that were positive in both the GOF/LOF screen and miR-125b pull-down were validated for targeting by miR-125b using the 3′ UTR luciferase reporter assay and Western blots for protein expression. [score:4]
In mouse N2A neuroblastoma cells, miR-125b significantly downregulated mouse BAK1, PPP1CA, PUMA, and ITCH protein (Figure 4G). [score:4]
We found that, although each miRNA-target pair evolves rapidly across vertebrates, regulation of the p53 pathway by miR-125b is conserved at the network level. [score:4]
On the other hand, the strict conservation of miR-125b-regulation at the network-level in humans, mice and zebrafish, suggests that natural selection acts on the network-level rather than the gene-level with regard to miRNA-target evolution. [score:4]
Instead, we found that only the network-level of regulation was conserved, and miR-125b-regulation of individual apoptosis and proliferation regulators appears to be evolving rapidly from species to species. [score:4]
In general, we observe miR-125b regulating 2 general classes of genes in the p53 network: (i) apoptosis regulators like Bak1, Igfbp3, Itch, Puma, Prkra, Tp53inp1, Tp53, and Zac1, and (ii) cell-cycle regulators like cyclin C, Cdc25c, Cdkn2c, Edn1, Ppp1ca, and Sel1l. [score:4]
Summary of genes in p53 network that are directly targeted by miR-125b. [score:4]
These studies have ascribed miR-125b's anti-apoptotic effect as an oncogene to its direct suppression of Bak1 or Tp53 [9], [16]- [18]. [score:4]
Figure S1Mature miR-125b levels before and after overexpression or knockdown. [score:4]
miR-125b significantly downregulated the protein levels of human BAK1, PPP1CA, TP53INP1, PPP2CA, CDC25C, and TP53 in SH-SY5Y neuroblastoma cells (Figure 4F). [score:4]
Our results reveal that miR-125b regulation of the p53 network is conserved at the network-level over the course of vertebrate evolution, but individual miRNA-target pairs are evolving rapidly. [score:4]
We found that although individual miRNA-target pairs were seldom conserved, regulation of the p53 network by miR-125b appears to be conserved at the network-level. [score:4]
In general, we found that miR-125b directly represses 2 classes of genes: apoptosis regulators and cell-cycle regulators. [score:4]
Direct binding of miR-125b to p53 network targets. [score:4]
The 2 classes of miR-125b targets in the p53 network, and the incoherent FFL network motifs that we found, may at least partially explain how miR-125b regulates tissue stem cells in vertebrates. [score:4]
In mouse 3T3 cells, 11 out of 13 gene transcripts, Bak1, Hspa5, Itch, Ppp1ca, Ppp2ca, Prkra, Puma, Sel1l, Sp1, Tdg and Tp53inp1, were found to be direct binding targets of miR-125b (Figure 3B). [score:4]
1002242.g004 Figure 4Candidate p53 network genes that were positive in both the GOF/LOF screen and miR-125b pull-down were validated for targeting by miR-125b using the 3′ UTR luciferase reporter assay and Western blots for protein expression. [score:4]
Amongst these targets, we found Ppp1ca, Prkra and Tp53 to be especially interesting from the evolutionary viewpoint, since all 3 vertebrate species possess these 3 genes, but each gene shows a different pattern of evolutionary conservation with respect to miR-125b-repression. [score:3]
However very few individual gene targets of miR-125b in the p53 network were conserved across all three vertebrates (Figure 5; Figure 6A-6C). [score:3]
In mice, out of 22 predicted targets in the p53 network, 11 genes were derepressed by miR-125a/b-AS in 3T3 cells and 12 genes were repressed by miR-125b in N2A cells (Figure 2C). [score:3]
Validation of miR-125b targets in the p53 network. [score:3]
Identifying miR-125b targets in the p53 network of vertebrates. [score:3]
It could explain how overexpression of miR-125b leads to an expansion of self-renewing hematopoietic stem cells while loss of miR-125b leads to aberrant apoptosis and proliferation, with consequent defects in tissue differentiation. [score:3]
For humans, the 3′ UTR reporters of Bak1, Cdc25c, Ppp1ca, Ppp2ca, Prkra, Puma, Tdg, Tp53, Tp53inp1, and Zac1 were significantly suppressed by miR-125b. [score:3]
Fine-regulation of p53 network dosage by miR-125b may also explain miR-125b's conserved role in regulating tissue stem cell homeostasis. [score:3]
Due to the central role of the p53 network in these two processes, and because we found that miR-125b regulates both human and zebrafish Tp53 but not mouse Tp53 [16], we sought to examine if miR-125b regulates the p53 network in a conserved manner in vertebrates. [score:3]
In mice, the 3′ UTR reporters of Bak1, Itch, Ppp1ca, Ppp2ca, Prkra, Puma, Sel1l, Tdg, and Tp53inp1 were significantly suppressed by miR-125b (Figure 4B). [score:3]
In zebrafish, the 3′ UTR reporters of Ccnc, Cdc25c, Cdkn2c, Gtf2h1, Hspa5, Ppp1ca, and Tp53 were significantly suppressed by miR-125b (Figure 4C). [score:3]
The targets of miR-125b in zebrafish were predicted by MicroCosm [32]. [score:3]
Validation of miR-125b targets. [score:3]
By fine-tuning both apoptosis regulators and cell-cycle regulators, miR-125b may fine-tune the p53 network dosage to drive the self-renewal of tissue stem cells. [score:3]
Next we sought to screen our list of predicted targets for significant repression by miR-125b in cells, by performing a miR-125b gain- and loss-of-function screen. [score:3]
Here we describe how miR-125b targets 20 apoptosis and proliferation genes in the p53 network. [score:3]
Prediction of miR-125b targets in the p53 network. [score:3]
Taken together the three assays provide a powerful means to identify direct miR-125b targets. [score:3]
Our GOF/LOF screen revealed that in humans, out of 29 predicted targets in the p53 network, 13 genes were derepressed by miR-125a/b-AS in hLF cells and 20 genes were repressed by miR-125b in SH-SY5Y cells (Figure 2B). [score:3]
In zebrafish embryos, out of 20 predicted targets in the p53 network, 13 genes were derepressed by pre- miR-125b morpholino and 12 genes were repressed by the injection of miR-125b duplex (Figure 2D). [score:3]
To summarize our results, our list of predicted miR-125b targets in the p53 network (Table S1) was filtered and reclassified according to the results of the screen and validation assays (Figure 5). [score:2]
To examine the sequence evolution of these miRNA-mRNA pairs in greater detail, we compared the Targetscan-predicted miR-125b binding sites of these genes in humans, mice and zebrafish. [score:2]
Gain-of-function (GOF) in miR-125b was achieved by transfection of miR-125b duplex into human SH-SY5Y or mouse N2A neuroblastoma cells, whereas loss-of-function (LOF) in miR-125b was achieved in human primary lung fibroblasts or mouse 3T3 fibroblasts by knocking down miR-125b with an antisense (AS) RNA (Figure 2A). [score:2]
In the knockdown experiments, miR-125b morpholinos were injected at 0.75 pmole/embryo (lp125bMO1/2/3 indicates the co-injection of three lp125bMOs, 0.25 pmole each); miR-125b duplex was injected as 37.5 fmole/embryo. [score:2]
We believe these findings on miR-125b support a new fundamental principle for how miRNAs regulate gene networks in general. [score:2]
Depending on the cell context, miR-125b has been proposed to regulate both apoptosis and proliferation. [score:2]
The structure of the miR-125b regulatory network suggests that miR-125b buffers and fine-tunes p53 network activity. [score:2]
Predicted targets that passed 3 assays (red), 2 assays (orange), 1 assay (yellow), or predicted targets that failed all assays but whose orthologues in other species passed 3 assays of direct regulation by miR-125b (pink), were colored as indicated (Figure 5). [score:2]
Therefore in different contexts, miR-125b appears to be able to regulate both apoptosis and proliferation. [score:2]
It is possible that this buffering feature of miR-125b represents a general principle of miRNA regulation of gene networks. [score:2]
GOF/LOF screen for p53 network genes regulated by miR-125b. [score:2]
Mo dels of miR-125b regulation of p53 networks in humans, mice, and zebrafish. [score:2]
This shows that miR-125b regulation of the p53 network is conserved at least at the network level. [score:2]
This buffering feature of miR-125b has implications for our understanding of how miR-125b regulates oncogenesis and tissue stem cell homeostasis. [score:2]
The gain-of-function (GOF) screen was performed by co-injecting miR-125b duplex with the morpholino (Figure 2A). [score:1]
The enrichment of mRNAs bound to miR-125b is presented as mean log [2] fold change ± s. e. m. (n≥3 biological replicates). [score:1]
miR-125b gain- and loss-of-function screen in 3 vertebrates. [score:1]
In zebrafish embryos, 8 out of 14 gene transcripts, Cdc25c, Cdkn2c, Gtf2h1, Hspa5, Itch, Ppp1ca, Sel1l, and Tp53, were pulled down by miR-125b (Figure 3C). [score:1]
1002242.g003 Figure 3Biotinylated miR-125b was used as bait to pull-down mRNAs bound to miR-125b, using streptavidin-conjugated magnetic beads. [score:1]
This led us to propose that miR-125b buffers and fine-tunes p53 network dosage, with implications for the role of miR-125b in tissue stem cell homeostasis and oncogenesis. [score:1]
Biotinylated miR-125b was used as bait to pull-down mRNAs bound to miR-125b, using streptavidin-conjugated magnetic beads. [score:1]
Our findings suggest that the fine-tuning of p53 network dosage by miR-125b is another example of this paradigm. [score:1]
Existing databases and prediction algorithms were used to shortlist a set of p53 network genes predicted to possess miR-125b -binding sites in their 3′ UTRs. [score:1]
For zebrafish embryos, which possess high levels of miR-125b, the loss-of-function (LOF) screen was performed using an antisense morpholino cocktail that blocks the loop regions of all 3 pre- miR-125b hairpin precursors [16]. [score:1]
RNA transcripts bound to biotinylated-miR-125b were pulled down with streptavidin beads and quantified by qRT-PCR relative to mRNAs bound to biotinylated-control miRNA (log [2] fold change > 0.5, P<0.05). [score:1]
Our observation that an incoherent FFL-like network motif fits the overall structure of the miR-125b - p53 network mo dels with respect to apoptosis and cell proliferation, lends further support to this idea since incoherent FFL network motifs are well-adapted for noise filtering [41], [43], [46]. [score:1]
With the exception of zebrafish Ccnc, all genes tested were positive in the miR-125b-pull-down as well as the miR-125b gain- and loss-of-function screen. [score:1]
A reporter containing a 23-nucleotide -binding-site with perfect complementarity to miR-125b was used as the perfect match positive control, while the unmodified luciferase reporter was used as the empty negative control. [score:1]
In all panels, the levels of miR-125a and miR-125b were quantified by real-time PCR, and presented as log [2] (fold change) ± s. e. m. (n≥3) relative to the levelsof RNU6B loading control. [score:1]
Several studies have implicated miR-125b as an oncogene in a variety of mammalian tissue compartments, e. g. leukemia, neuroblastoma, prostate cancer and breast cancer [9]– [18]. [score:1]
hsa-miR-125b or cel-miR-67 (negative control) duplex was synthesized with a biotin conjugated at the 3′ end of the active strand by Dharmacon Research Inc. [score:1]
1002242.g002 Figure 2(A) Loss-of-function (LOF) screens were performed in human primary lung fibroblasts (hLF) or mouse 3T3 fibroblasts by transfecting an antisense RNA against both miR-125a and miR-125b (miR-125a/b-AS), or by microinjecting morpholinos (MO) against pre- mir-125b hairpin precursors (all 3 isoforms) into zebrafish embryos. [score:1]
Ppp1ca is repressed by miR-125b in all 3 species, Prkra is repressed by miR-125b in humans and mice, while Tp53 is repressed in humans and zebrafish. [score:1]
We chose to perform a gain-of-function screen in human (SH-SY5Y) or mouse (N2A) neuroblastoma cells, because these cells possess low levels of endogenous miR-125b (Figure S1A, S1B). [score:1]
From the GOF/LOF screen we were able to identify mRNAs perturbed by miR-125b. [score:1]
During zebrafish embryogenesis, loss of miR-125b leads to widespread apoptosis in a p53 -dependent manner, causing severe defects in neurogenesis and somitogenesis [16]. [score:1]
Gain-of-function (GOF) screens were performed in human SH-SY5Y and mouse N2A neuroblastoma by transfecting the miR-125b duplex into cells in culture, or by coinjecting the miR-125b duplex with the morpholinos against pre- mir-125b into zebrafish embryos. [score:1]
In other words, the loss or gain of a single miR-125b -binding site in the 3′ UTR of most genes appears to have a relatively insignificant effect on the fitness of an organism. [score:1]
For the loss-of-function screen, we chose human fetal lung (hLF) or mouse (3T3) fibroblasts because they possess high levels of miR-125b (Figure S1C, S1D). [score:1]
miR-125b's ability to fine-tune the subtle balance of apoptosis vs. [score:1]
Because miR-125b represses both pro-apoptosis and anti-apoptosis genes, as well as both proliferation and cell-cycle arrest genes in all three vertebrates (Figure 5), miR-125b appears to modulate the p53 network on the whole through an incoherent feedforward loop (FFL) [33], [34] acting on the cellular processes of apoptosis and cell proliferation (Figure 6D). [score:1]
Thus our finding that incoherent FFLs fit the overall structure of network relationships between miR-125b and the p53 -mediated processes, suggests that miR-125b is fine-tuning and buffering p53 network dosage. [score:1]
In zebrafish, loss of miR-125b leads to widespread p53 -dependent apoptosis with consequent defects in early embryogenesis, especially in neurogenesis and somitogenesis [16]. [score:1]
Table S1Genes in p53 network with predicted miR-125b binding sites. [score:1]
[1 to 20 of 111 sentences]
3
[+] score: 290
In this study, we present evidences to show that (i) in STHdh [Q111]/Hdh [Q111] cells decreased expression of miR-146a is mediated through decreased expression and activity of RelA/NFkB, (ii) increased expression of p53 in the same cells could be due to decreased expression of miR-125b and miR-150, (iii) p53 and RelA/NFkB regulate the expression of miR-146a and (iv) neuronal cells expressing N-terminal HTT with 83Q coded by exon1 exhibit decreased miR-125b and miR-150 expressions, increased p53 expression and reduced RelA/NFkB expression and activity and miR-146a expression. [score:22]
Among the down regulated miRNAs, expression of miR-146a was decreased in all the four cell mo dels whereas expression of miR-125b and miR-150 were decreased in three of the four cell mo dels excepting Neuro2A where expressions of those were up regulated. [score:9]
This result shows that mutant HTT aggregates directly or indirectly increased p53 expression, reduced RelA/NFkB expression and activity and also reduced miR-146a, miR-125b and miR-150 expressions. [score:9]
Since p53 is a known target of miR-125b [28] and the expression of miR-125b is down regulated in STHdh [Q111]/Hdh [Q111] cells [33], we tested the hypothesis that increased expression of p53 in these cells could be due to decreased level of miR-125b. [score:8]
Given that p53 is a validated target of miR-125b [28], we explored whether increased expression level of endogenous p53 in STHdh [Q111]/Hdh [Q111] cells could be due to decrease in the expression of miR-125b or any other miRNA down regulated in these cells [33]. [score:8]
Such increase in miR-146a expression (n = 3, p = 0.0079), miR-125b expression and miR-150 expression were also observed with STHdh [Q7]/Hdh [Q7] cells 48 hours post transfection with 83Q DsRed and Hsp70-GFP. [score:7]
The mo del shows that mutant HTT modulates the expression of both p53 and p65 subunit of NFkB (RelA/NFkB) expression and activity and miR-146a, miR-125b and miR-150 expressions. [score:7]
Further, over expression of pre-miR-125b that increased the expression of mature miR-125b significantly (data not shown) decreased reporter luciferase activity significantly in STHdh [Q7]/Hdh [Q7] cells (n = 3, p = 0.024) and STHdh [Q111]/Hdh [Q111] cells (n = 3, p = 0.0086) when co-expressed with p53-UTR1 (Figure 3D ). [score:7]
Thus, out of the thirteen miRNAs whose expressions have been studied, expressions of eight miRNAs including miR-146a, miR-125b and miR-150 were decreased, expressions of two miRNAs (viz. [score:7]
Report that expressions of miR-125b and miR-150 are decreased in STHdh [Q111]/ [Q111] cells [33] and p53 is one of the targets of these two miRNAs provides an explanation for the increased expression of p53 in these cells. [score:7]
However, co -expression of HYPK together with mutant HTT exon1 reduced the aggregates, reduced p53 expression and recovered the activity of NFkB and miR-146a, miR-125b and miR-150 expressions (Figures 10A–10D ). [score:7]
0023837.g012 Figure 12 The mo del shows that mutant HTT modulates the expression of both p53 and p65 subunit of NFkB (RelA/NFkB) expression and activity and miR-146a, miR-125b and miR-150 expressions. [score:7]
Since the expressions of miR-125b and miR-150 were decreased in STHdh [Q111]/Hdh [Q111] cells compared to those obtained in STHdh [Q7]/Hdh [Q7] cells, we expressed these miRNAs in STHdh [Q111]/Hdh [Q111] cells and detected the endogenous expression of p53 as shown in Figure 5D. [score:6]
0023837.g005 Figure 5(A) No change in relative luciferase activity of p50-3′UTR (bearing no predicted recognition site for miR-125b or miR-150) in cells co -transfected with pre- miR-125b and pre-miR-150 compared to cells co -transfected with empty vector U61; (B) RT-PCR showing (i) reduction in p53 mRNA in cells expressing exogenous pre-miR-150 and pre-miR-125b compared to cells expressing empty vector U61, (ii) no reduction in p53 mRNA in cells expressing exogenous pre-miR-19a and pre-miR-146a compared to cells expressing empty vector U61. [score:6]
Similar increase (n = 6, p = 0.029) in relative luciferase activity of NFkB-RE was observed in STHdh [Q7]/Hdh [Q7] cells 48 hours post transfection with 83Q DsRed and Hsp70-GFP; (D) Similarly, miR-146a expression (n = 3, p = 0.033), miR-125b expression and miR-150 expression were significantly increased in STHdh [Q7]/Hdh [Q7] cells 48 hours post transfection with 83Q DsRed and HYPK-GFP compared to STHdh [Q7]/Hdh [Q7] cells transfected with 83Q DsRed and empty vector GFP-C1. [score:6]
The mo del shows that mutant HTT modulates the expressions of both p53 and RelA/NFkB, NFkB activity and decreases miR-146a, miR-125b and miR-150 expressions. [score:5]
Thus, the increased expression level of endogenous p53 in STHdh [Q111]/Hdh [Q111] cells could be due to decreased expression of endogenous miR-125b. [score:5]
0023837.g003 Figure 3Endogenous expression of p53 in STHdh [Q7]/Hdh [Q7] and STHdh [Q111]/Hdh [Q111] cells: decreased miR-125b target p53. [score:5]
Expression of miR-146a was also significantly (n = 4, p = 0.011) decreased along with the expression of miR-125b and miR-150 as shown in Figure 9C, similar to that which has been shown in STHdh [Q111]/Hdh [Q111] cells [33]. [score:5]
The results shown in Table S1 suggests that although there is a heterogeneity in the expressions of miRNAs in different cell lines exogenously expressing mutated exon1 of HTT, miR-146a, miR-125b and miR-150 were preferentially decreased than others in the presence of poly Q aggregates. [score:5]
Endogenous expression of p53 in STHdh [Q7]/Hdh [Q7] and STHdh [Q111]/Hdh [Q111] cells: decreased miR-125b target p53. [score:5]
Thus, decreased expressions of miR-125b and miR-150 in STHdh [Q111]/Hdh [Q111] cells could result in increased expression of p53. [score:5]
To address the specificity of such alteration of miR-146a, miR-125b and miR-150 in the presence of poly Q aggregates, mutated exon1 of HTT gene that translated to N-terminal HTT with 83 Q was exogenously expressed in four different cell lines viz. [score:5]
Over expression of p53 in STHdh [Q111]/Hdh [Q111] cells: role of miR-125b and miR-150Expression of p53 is increased in STHdh [Q111]/Hdh [Q111] cells [32] as well as in various mo dels of HD and post mortem HD brains. [score:5]
Luciferase activity of the reporter vector pmiR-Report with 150 bp (position 733–739) of the 3′-UTR of human p53 (p53-UTR1) containing miR-125b recognition site [28] was also significantly (n = 3, p = 0.026) increased in STHdh [Q111]/Hdh [Q111] cells compared to that observed in STHdh [Q7]/Hdh [Q7] cells (Figure 3C ) indicating that down regulated miR-125b could target p53 and increase its expression. [score:5]
The results given in Table S1 show that expressions of miR-100, miR-125b, miR-135a, miR-138, miR-150, miR-146a, miR-221 which were decreased in HD cell mo del [33] were also decreased in and the expressions of miR-127-3p and miR-214 were increased in both STHdh [Q111]/Hdh [Q111] cells [33] and the R6/2 mouse mo del. [score:5]
Besides, we also show that expressions of miR-125b, miR-146a, miR-150 and RelA/NFkB were decreased while the expression of p53 was increased in striatal tissues of mo dels of HD. [score:5]
The mo del shows that mutant HTT modulates the expression of p53 and p65 subunit of NFkB (RelA/NFkB), NFkB activity and miR-146a, miR-125b and miR-150 expressions. [score:5]
In addition, exogenous expression of miR-125b decreased the endogenous expression of p53 (n = 3, p = 0.039), shown in Figure 3E. [score:5]
Since miR-125b and miR-150 target p53, we postulate that in the presence of mutant HTT aggregates there is an initial decrease in miR-125b and miR-150 expression. [score:5]
Interestingly, p53 is one of the targets of miR-125b [28], which is itself negatively regulated by p53 [26]. [score:4]
The results obtained indicate that despite differences in miRNA expressions in various mo dels, miR-146a, miR-125b and miR-150 were preferentially down regulated than others in the presence of poly Q aggregates. [score:4]
de/rnahybrid/), we observed that mouse p53 (Trp53) could also be targeted by miR-125b at 3′-UTR position 413–435 as shown in Figure S1 (B). [score:3]
miR-125b and miR-150 were down regulated by more than 1.5 fold in five of the mo dels including whereas miR-146a was down regulated in all the mo dels. [score:3]
In order to see whether miR-146a, miR-125b and miR-150 were specifically down regulated than others in striatal region of the brains of, we determined the expression levels of additional ten miRNAs in the mouse mo del and compared the results with that obtained earlier by us in HD cell mo del [33]. [score:3]
Taken together, these results show that p53 is specifically targeted by miR-125b and miR-150. [score:3]
This result shown in Figure 11B reveals that the alterations in the expressions of p53, RelA/NFkB, miR-125b, miR-146a and miR-150 might be involved in the pathogenesis of HD. [score:3]
Although endogenous p53 level was decreased by over expressing miR-125b and miR-150, there was no change in p53 level either in the presence of exogenous miR-19a or miR-146a (negative control), which bears no predicted recognition site in the 3′UTR of p53 (Figure 5B ). [score:3]
Poly Q aggregates alter the expressions of miR-125b, miR-150, p53, RelA/NFkB and miR-146a. [score:3]
In the presence of mutant HTT aggregates, miR-125b and miR-150 expressions decrease leading to an increased level of p53. [score:3]
p53 is specifically targeted by miR-125b and miR-150 in HD cell mo del. [score:3]
Taken together, these results confirmed the earlier observation that p53 is one of the targets of miR-125b [28]. [score:3]
NFkB activity and expression of miR-146a, miR-125b and miR-150 were also reduced in such condition (Figures 9B and 9C ). [score:3]
These results confirmed that in STHdh [Q111]/Hdh [Q111] cells, increased p53 level could be mediated by decreased expression of miR-125b. [score:3]
Further, results obtained with mutant HTT aggregates led us to postulate that in the presence of the aggregates there is an initial decrease in miR-125b and miR-150 expression. [score:3]
Over expression of p53 in STHdh [Q111]/Hdh [Q111] cells: role of miR-125b and miR-150. [score:3]
Exogenous expression of miR-125b decreased the endogenous level of p53 in STHdh [Q111]/Hdh [Q111] cells (Figure 3E ). [score:3]
Expressions of p53, RelA/NFkB, miR-125b, miR-146a and miR-150 in striatal region of the brains of. [score:3]
We have already shown in the earlier section that Poly Q aggregates cause decrease in the expressions of miR-146a, miR-125b and miR-150 and removal of aggregates by chaperones rescue such changes. [score:3]
Moreover, removal of aggregates by HYPK and Hsp70 also rescued the expression of miR-146a, miR-125b and miR-150 (Figure 10D ). [score:3]
This indicates that (D) Average IOD showing relative expression of p53 protein level in cell extracts prepared from STHdh [Q7]/Hdh [Q7], STHdh [Q111]/Hdh [Q111] and in STHdh [Q111]/Hdh [Q111] cells transfected with miR-125b or miR-150. [score:3]
Although endogenous p53 level was decreased by over expressing miR-125b or miR-150, there was no change in p53 level either in the presence of exogenous miR-19a or miR-146a (Figure 5B and 5C ). [score:3]
It is to be noted that the ability to recover the expressions of miR-125b, miR-146a and miR-150 by Hsp70 was higher compared to that obtained with HYPK, reasons remaining unknown. [score:2]
If this down regulation of miR-125b and miR-150 are confirmed along with increased p53 in the post mortem brains of HD, then it may explain the cause for elevated p53 and its role in HD pathogenesis as observed in other studies [4], [10], [11]. [score:2]
Increased p53 level in HD mo dels could be mediated through down regulation of miR-125b and miR-150. [score:2]
For over expression studies, 200 ng of pmiR-Report with desired clone and 300 ng of cloned pre-miR-125b or pre- miR-150 were co -transfected and luciferase assay was done following the same procedure. [score:2]
, p53-UTR1 in STHdh [Q111]/Hdh [Q111] cells compared to that in STHdh [Q7]/Hdh [Q7] cells (Figure 3C ) and decreased luciferase activity of the same in presence of exogenous miR-125b indicated that miR-125b could target p53 (Figure 3D ). [score:2]
Besides, cDNA prepared using stem-loop specific primers for mature miR-125b, miR-146a and miR-150 also revealed a decrease in the expressions of these miRNAs (n = 3, p<0.01), similar to that obtained in STHdh [Q111]/Hdh [Q111] cells [33]. [score:2]
However, 213 bp (145–359) of the 3′ UTR of NFkB1 (p50-UTR) containing no predicted binding site for either miR-125b or miR-150 showed no change in its luciferase activity (negative control) when the construct was co -transfected with cloned pre-miR-125b or pre-miR-150 (Figure 5A ). [score:1]
Our investigation using HD cell lines provides important observations that miR-146a is regulated by p53 and RelA/NFkB and increased p53 could be mediated through down regulation of miR-125b and miR-150. [score:1]
In addition, we showed that increased level of p53 in STHdh [Q111]/Hdh [Q111] cells could be due to decreased level of miR-150 and miR-125b. [score:1]
Precursor miRNA-125b (Chr11: 121970465–121970552, - strand) and precursor miRNA-150 (Chr19: 50004042–50004125, - strand) were amplified by PCR from human genomic DNA and respectively cloned into pU61 Hygro (Genescript, USA) vector using BamHI and HindIII (NEB, USA) sites. [score:1]
It has been shown by us that miR-125b is down regulated in STHdh [Q111]/Hdh [Q111] cells compared to the wild type cells [33]. [score:1]
show that the extent of p53 up regulation found in STHdh [Q111]/Hdh [Q111] cells when compared to STHdh [Q7]/Hdh [Q7] cells was reduced when STHdh [Q111]/Hdh [Q111] cells were transfected with miR-125b or miR-150. [score:1]
mmu-miR-125b binds to the 3′UTR of mouse Trp53. [score:1]
Their predicted stable RNA -RNA duplex formed by the binding of miR-125b to the 3′UTR of mouse Trp53 is shown in panel (II). [score:1]
For NFkB1 (p50), 213 bp (position 145–359) of the 3′ UTR of NFkB1 containing no predicted recognition site for either miR-125b or miR-150 was cloned into the vector using SpeI and MluI (NEB) sites and was named p50-UTR. [score:1]
As a negative control, we tested 213 bp (position 145–359 of the 3′ UTR) of p50 sub-unit of NFkB (also known as NFkB1) containing no predicted recognition sites for either miR-125b or miR-150 and did not observe any change in the luciferase activity significantly when the construct (p50-UTR) was co -transfected with cloned pre-miR-125b or pre-miR-150 in STHdh [Q7]/Hdh [Q7] cells (Figure 5A ). [score:1]
The RNA strand in green represents mmu-miR-125b and the RNA strand in brown represents 413–435 of the 3′UTR in the mouse Trp53 transcript. [score:1]
Increased reporter luciferase activity of human p53 3′-UTR (718 to 742) containing miR-125b recognition site viz. [score:1]
[1 to 20 of 70 sentences]
4
[+] score: 280
Thus, miR-125b-5p inhibits ALF by suppressing cell death rather than directly effecting proliferation. [score:6]
Indeed KEAP1 protein levels decreased in miR-125b-5p -overexpressing mice, indicating that miR-125b-5p regulates KEAP1 expression (Fig. 4b and Supplementary Fig. 10a). [score:6]
e. m. (a) In silico analyses by TargetScan and PicTar predicts 3′-UTR of KEAP1 as a target of miR-125b-5p. [score:5]
Furthermore, the expression of NRF2 target genes such as Ugt1a6, Gclc, Nqo1 and Gsta2 increased in mice injected with AAV-Ttr-miR-125b-5p (Fig. 4h). [score:5]
Twelve hours after seeding, hepatocytes were transfected with 25 nM miR-125b-5p mimic, miR-125b-5p inhibitor or control scramble (Qiagen), using the Targefect reagent in the presence of virofect enhancer (Targeting Systems). [score:5]
AAV -based miR-125b-5p overexpression inhibits ALF in vivo. [score:5]
It is important to mention that other miR-125b-5p targets in addition to KEAP1 may also contribute to the observed attenuation of ALF, especially in light of our results, demonstrating only partial rescue of the observed effect on blockade of Keap1 expression using siRNA. [score:5]
Importantly, decreased serum glutamate dehydrogenase (GDH) levels, elevated GSH/GSSG levels and decreased serum mitochondrial DNA (mtDNA) in miR-125b-5p -overexpressing mice confirmed the specific inhibition of APAP -induced ALF (Fig. 2f–h). [score:5]
Importantly, hepatocytes co -transfected with miR-125b-5p inhibitor and Keap1 siRNA showed significantly lower toxicity than hepatocytes transfected with miR-125b-5p inhibitor alone (Fig. 5c–m). [score:5]
Indeed, our results revealed that miR-125b-5p overexpression elevates not only NRF2 levels but also the expression of NRF2-responsive genes such as Ugt1a6, Gclc, Nqo1 and Gsta2. [score:5]
Thus, miR-125b-5p directly regulates Keap1, which leads to enhanced NRF2 signalling and hence inhibits APAP -induced ALF. [score:5]
In addition, we analysed whether APAP influences miR-125b-5p expression and found that miR-125b-5p expression reduces in a dose- and time -dependent manner on ALF induction in vitro (Supplementary Fig. 4). [score:5]
We again confirmed the overexpression of miR-125b-5p expression (Fig. 3j). [score:5]
Upregulation of miR-125b-5p in sera of ALF patients has been recently reported 10. [score:4]
Taken together, the loss of hepatic miR-125b-5p expression during ALF, increased levels of serum miR-125b-5p in ALF patients and the alleviation of ALF on miR-125b-5p supplementation in mouse liver indicate that miR-125b-5p is a key regulator of ALF. [score:4]
We observed significant downregulation of KEAP1 levels in miR-125b-5p mimic -transfected primary human hepatocytes (Fig. 6a,b and Supplementary Fig. 10e). [score:4]
In light of our data demonstrating decrease in hepatic miR-125b-5p levels in biopsies of ALF patients and amelioration of ALF on its overexpression, miR-125b-5p may prove to be a potent ALF regulator and useful mechanistic serum biomarker for the diagnosis and prognosis of ALF. [score:4]
In addition to our current findings of protective role of miR-125b-5p during ALF, miR-125b-5p has been previously reported as one of the circulating miRNAs upregulated during the early phase of ALF, at the time when classical markers such as ALT remain low 10 25. [score:4]
Therefore, to find a mechanism for the protective effect of miR-125b-5p against ALF, we performed in-silico analyses on key regulators of ALF, to find a novel target of miR-125b-5p. [score:4]
On one hand, reduced levels of miR-125b-5p causes NRF2 downregulation via Keap1 signalling but, on the other hand, it is plausible that NRF2 may also contribute to the further changes in miR-125b-5p levels via a feedback loop as reported previously 23 24. [score:4]
Finally, we addressed whether miR-125b-5p expression is deregulated during ALF in human patients. [score:4]
Subsequently, we showed the miR-125b-5p transfection in primary human hepatocytes leads to significant upregulation of NRF2 protein levels and NRF2-responsive genes such as UGT1A6, GCLC, NQO1 and GSTA2 (Fig. 6g–i and Supplementary Fig. 10f). [score:4]
Unchanged levels of luciferase activity in the presence of mutated 3′-UTR confirmed that miR-125b-5p regulates the Keap1 expression at posttranscriptional level (Fig. 4f). [score:4]
Thus, these experiments suggest that delivery of miR-125b-5p after onset of ALF is capable of suppressing ALF, and hence leads to improved survival. [score:3]
AAV -based overexpression in ALF would remain a prophylactic approach; therefore, to test whether miR-125b-5p delivery may serve as a treatment option, we examined the effect of miR-125b-5p in ALF mo dels when injury has already begun. [score:3]
Indeed, western blot and quantitative reverse transcriptase—PCR results confirmed that NRF2 protein levels and mRNA levels of Ugt1a6, Gclc, Gsta2 and Nqo1, respectively, were elevated on transfection of Keap1 siRNA alone or together with miR-125b-5p inhibitor (Fig. 5g–i and Supplementary Fig. 10d). [score:3]
In fact, we found elevated levels of NRF2 in miR-125b-5p -overexpressing mice (Fig. 4g and Supplementary Fig. 10b). [score:3]
To this end, we transfected hepatocytes with Keap1 siRNA alone or in the presence of the miR-125b-5p inhibitor before the induction of apoptosis. [score:3]
To answer this question, we co -transfected primary mouse hepatocytes with miR-125b-5p inhibitor and Keap1 small interfering RNA (siRNA). [score:3]
demonstrated that miR-125b-5p binds to the 3′-UTR and thus regulates KEAP1 directly (Fig. 4d). [score:3]
Next, we examined whether direct regulation of KEAP1 by miR-125b-5p affects subsequent signalling involved in progression of ALF. [score:3]
Our screen identified five miRNAs, miR-130a-3p, miR-125b-5p, miR-29c-3p, miR-16-5p and miR-23b-3p, whose mimics suppressed FAS -induced apoptosis in primary hepatocytes (Fig. 1h). [score:3]
Likewise, we examined the contribution of KEAP1 in suppression of FAS -induced apoptosis by miR-125b-5p. [score:3]
Primary hepatocytes transfected with miR-125b-5p mimic have lower relative luciferase units (RLUs), whereas hepatocytes transfected with miR-125b-5p inhibitor showed higher RLUs than the control miRNA scramble transfection. [score:3]
Thus, we identified Keap1 as a novel target of miR-125b-5p. [score:3]
To overexpress miR-125b-5p in the mouse liver, we cloned pri-miR-125b-5p under the transcriptional control of the hepatocyte-specific promoter transthyretin (Ttr) in an adeno -associated virus (AAV) plasmid and subsequently prepared high-titre AAV serotype 8 encoding miR-125b-5p (henceforth referred to as AAV-Ttr-miR-125b-5p). [score:3]
The successful overexpression of miR-125b-5p was confirmed in BALB/c mice administered with 1 × 10 [10] AAV-Ttr-miR-125b-5p virions via the tail vein (Fig. 2b). [score:3]
Importantly, we observed significantly improved survival (Fig. 3k) due to suppressed apoptosis as shown by lower ALT and AST levels, reduced injury, lower caspase-3/7 activity and decreased TUNEL staining in mice injected with stabilized 10 μg miRIDIAN miR-125b-5p mimic (Fig. 3l–p). [score:3]
Our findings that miR-125b-5p functions as an attenuator of ALF were somewhat unexpected, especially in light of previously reported tumour suppressor functions of miR-125b-5p in liver cancer 20 21. [score:3]
To address this, a different set of miR-125b-5p -overexpressing mice and control mice was killed 6 h after APAP injection. [score:3]
We first confirmed the efficacy of Keap1 siRNA by determining KEAP1 protein levels after transfection of hepatocytes with Keap1 siRNA alone or in combination with miR-125b-5p inhibitors (Fig. 5a,b and Supplementary Fig. 10c). [score:3]
First, we overexpressed miR-125b-5p in mouse liver by administering AAV-Ttr-miR-125b-5p in BALB/c mice (Fig. 2j) and subsequently injected them with a lethal dose of FAS antibody. [score:3]
Thus, miR-125b-5p overexpression improves survival of mice in APAP -induced ALF mo del. [score:3]
We first confirmed the overexpression of miR-125b-5p in mouse liver after administration of miR-125b-5p mimic (Fig. 3b). [score:3]
In contrast, we did not find significant difference in mRNA levels of miR-125b-5p -overexpressing mice and control mice (Fig. 4c). [score:3]
Our results demonstrate that miR-125b-5p overexpression attenuates APAP -induced necrosis and FAS -induced apoptosis in vitro, as well as ALF, in vivo. [score:3]
Primary human hepatocytes transfected with miR-125b-5p mimic show lower relative luciferase units (RLUs), whereas those transfected with miR-125b-5p inhibitor showed higher RLUs than the scramble miRNA transfection. [score:3]
Furthermore, we analysed miR-125b-5p expression in liver biopsies obtained from ALF patients. [score:3]
Likewise, apoptosis, which is another mode of cell death, was also inhibited in vitro and in vivo by anti-apoptotic function of miR-125b-5p via KEAP1-NRF2 signalling. [score:3]
Our in vivo studies established miR-125b-5p as an anti-ALF miRNA that possesses the capability to inhibit ALF progression. [score:3]
Serum RNA (2.25 ng) was reverse transcribed using the Taqman miRNA RT kit (Applied Biosystems) and miR-125b-5p expression was determined by real-time PCR using Taqman Universal Real Time PCR kit (Applied Biosystems). [score:3]
Hence, the survival study indicates that miR-125b-5p overexpression in mouse liver renders resistance against APAP -induced ALF and thus improves survival. [score:3]
We found that miR-125b-5p is predicted to target 3′-UTR of kelch-like ECH -associated protein1 (Keap1) (Fig. 4a). [score:3]
Furthermore, serum ALT and AST levels, haematoxylin and eosin staining, caspase-3/7 activity assay, TUNEL assay (Fig. 2l–p), cleaved caspase-3 staining and caspase-7 staining (Supplementary Fig. 6A,B) provided evidence that miR-125b-5p overexpression in mice inhibited ALF and hence improved survival. [score:3]
Although we found that mimics of miR-125b-5p, miR-194-5p miR-21-5p and miR-122-5p restored GSH levels significantly (Fig. 1d), inhibitors of only miR-125b-5p and miR-122-5p led to significant reduction in GSH levels (Fig. 1e). [score:3]
Importantly, hepatocytes co -transfected with the Keap1 siRNA and miR-125b-5p inhibitor had significantly higher FAS -induced injury compared with hepatocytes transfected with Keap1 siRNA alone (Fig. 5j–m). [score:2]
However, terminal deoxynucleotidyl transferase -mediated dUTP nick-end labelling (TUNEL) assay confirmed hepatoprotection by miR-125b-5p and miR-29c-3p, indicating that only these two miRNAs exhibit the ability to suppress FAS -induced apoptosis (Fig. 1i,j). [score:2]
Thus, miR-125b-5p regulates KEAP1 and subsequent NRF2 signalling in primary human hepatocytes similar to mouse hepatocytes. [score:2]
KEAP1 mRNA levels remained unchanged, further suggesting posttranscriptional regulation of KEAP1 by miR-125b-5p (Fig. 6c). [score:2]
In summary, based on miRNA screenings, we identified miR-125b-5p as a novel regulator of ALF. [score:2]
Inhibition of three miRNAs, let-7a-5p, miR-125b-5p and miR-122-5p, showed lower cell viability compared with control (Supplementary Fig. 1B). [score:2]
It is important to mention that the inhibition of toxicity by Keap1 siRNA remained less pronounced compared with the miR-125b-5p mimic (Fig. 1). [score:2]
We then confirmed direct binding of miR-125b-5p with 3′-UTR of human KEAP1 but not with mutated 3′-UTR by luciferase assay (Fig. 6d–f), indicating that miR-125b-5p regulates human KEAP1 at the posttranscriptional level. [score:2]
Likewise, transfection of miR-125b-5p inhibited FAS -induced apoptosis in primary human hepatocytes as demonstrated by reduced caspase-3/7 activity and TUNEL assay (Fig. 6m–o). [score:2]
Functional miRNA screens identify miR-125b-5p as a regulator of ALF. [score:2]
Therefore, miR-125b-5p regulates GSH levels and hence APAP -induced ALF by modulation of KEAP1-NRF2 signalling. [score:2]
MiR-125b-5p mimic delivery suppresses ALF in vivo. [score:2]
Based on two complementary miRNA screenings in primary hepatocytes, we identified miR-125b-5p as a novel regulator of ALF and uncovered its hepatoprotective function in ALF. [score:2]
Notably, hepatocytes co -transfected with siRNA and miR-125b-5p inhibitors had significantly increased APAP -induced injury compared with hepatocytes that were transfected with Keap1 siRNA alone (Fig. 5c-f). [score:2]
First, we detected lower levels of alanine transaminase (ALT) and aspartate transaminase (AST) (Fig. 2d), and reduced hepatic injury (Fig. 2e) in miR-125b-5p -overexpressing mice compared with their respective controls. [score:2]
How to cite this article: Yang, D. et al. MicroRNA-125b-5p mimic inhibits acute liver failure. [score:2]
To test whether miR-125b-5p regulates human KEAP1 as well, we transfected primary human hepatocytes with miR-125b-5p mimic. [score:2]
The circulating level of miR-125b-5p has been reported to be elevated in patients with APAP overdose 10. [score:1]
In addition, we observed decreased miR-125b-5p levels in hepatocytes and in liver tissue of APAP- or FAS -injected mice (Supplementary Fig. 9). [score:1]
Determination of miR-125b-5p levels in ALF patients. [score:1]
KEAP1 contributes to anti-ALF effects of miR-125b-5p. [score:1]
For rapid gain of miR-125b-5p function we injected 10 μg HPLC-purified miRIDIAN miR-125b-5p mimic (Dharmacon) via the tail vein in BALB/c mice that were injected 1 h earlier with APAP or FAS intraperitoneally. [score:1]
We then tested efficacy of miR-125b-5p in an in vivo ALF mouse mo del using BALB/c mice injected with 350 mg kg [−1], a lethal dose of APAP, intraperitoneally. [score:1]
MiR-125b-5p mimic administration in vivo For rapid gain of miR-125b-5p function we injected 10 μg HPLC-purified miRIDIAN miR-125b-5p mimic (Dharmacon) via the tail vein in BALB/c mice that were injected 1 h earlier with APAP or FAS intraperitoneally. [score:1]
It is important to mention that mice that survived in miR-125b-5p mimic -injected group remained alive at later time points as well (monitored for 1 month). [score:1]
AAV8-Ttr-miR-125b-5p vector and control vector (AAV8-Ttr-Cre) were prepared as described 27 28. [score:1]
We found seven miRNAs fulfilling these two criteria: miR-194-5p, miR-125b-5p, miR-21-5p, let-7a-5p, miR-122-5p, miR-30c-5p and miR-193a-3p (Fig. 1c). [score:1]
We confirmed the elevated levels of miR-125b-5p in mice sera (Supplementary Fig. 9). [score:1]
We were able to confirm the elevated levels of miR-125b-5p as reported in APAP-overdose patients 10. [score:1]
One hour after APAP injection, these mice were administered with stabilized 10 μg miRIDIAN miR-125b-5p mimic (Fig. 3a). [score:1]
Thus, on the basis of our screens and in vitro experiments, we selected miR-125b-5p for further studies. [score:1]
Thus, miR-125b-5p levels follow an inverse correlation between serum and hepatocytes or the liver. [score:1]
Hence, KEAP1 contributes significantly to the anti-ALF effects of miR-125b-5p. [score:1]
We further investigated whether suppression of APAP -induced injury via miR-125b-5p affects NRF2 levels and NRF2-responsive genes. [score:1]
MiR-125b-5p regulates Keap1 at posttranscriptional level. [score:1]
We then tested the dose -dependent effect of miR-125b-5p and found that mimic at the concentration of 25 nM or higher provides significant protection against APAP- and FAS -induced ALF in vitro (Supplementary Fig. 3). [score:1]
Thus, gain- and loss-of-function of let-7a-5p, miR-125b-5p and miR-122-5p inversely influences APAP -induced hepatocyte cell death. [score:1]
To validate predicted binding sites of miR-125b-5p in the 3′-UTR of Keap1 mRNA, we cloned the 3′-UTR of Keap1 in a luciferase reporter vector and co -transfected miR-125b-5p and reporter vector in primary mouse hepatocytes. [score:1]
MiR-125b-5p regulates Keap1 at the post-transcriptional level. [score:1]
We also confirmed elevated levels of miR-125b-5p in sera of ALF patients (Fig. 7a). [score:1]
We transfected miR-125b-5p in primary human hepatocytes that were subsequently exposed to APAP. [score:1]
Together, miRNA screening and subsequent validation revealed that miR-125b-5p and miR-122-5p protect against APAP -induced hepatocyte toxicity. [score:1]
Thus, gain of miR-125b-5p attenuates APAP- and FAS -induced ALF in human hepatocytes as well. [score:1]
We observed significantly higher survival in mice injected with AAV-Ttr-miR-125b-5p than in mice injected with a control AAV (Fig. 2c). [score:1]
MiR-125b-5p ameliorates APAP -induced ALF via posttranscriptional regulation of Keap1 mRNA. [score:1]
It is reasonable to speculate that release via exosomes or microvesicles is the most probable way that can explain miR-125b-5p elevation in serum in the initial stages of ALF 10. [score:1]
Administration of miR-125b-5p ameliorates ALF in vivo. [score:1]
Therefore, we asked the question up to what extent does miR-125b-5p exert an anti-ALF effect via KEAP1. [score:1]
Similar to APAP mo del, mice were injected with miR-125b-5p mimic 1 h after the injection of lethal dose of FAS. [score:1]
Therefore, miR-125b-5p mimic delivery may have a therapeutic relevance for treating ALF. [score:1]
The miR-125b-5p dilution and injection was performed according to instructions provided by the manufacturer. [score:1]
There are many possibilities that may lead to miR-125b-5p release into serum. [score:1]
Surviving mice in AAV-Ttr-miR-125b-5p group were monitored and kept alive for 6 months after the induction of APAP toxicity. [score:1]
Our Kaplan–Meier survival curve analyses revealed that miR-125b-5p administration after APAP injection significantly improved the survival of mice (Fig. 3c). [score:1]
We then investigated whether overexpression of miR-125b-5p influences proliferation in APAP -induced ALF. [score:1]
Based on our complementary miRNA screenings in two different mo dels of ALF, we identified miR-125b-5p as a common miRNA that protected primary hepatocytes in vitro against both APAP -induced ALF and FAS -induced ALF. [score:1]
Hence, miR-125b-5p supplementation may serve as therapeutic agent to attenuate ALF. [score:1]
Therefore, our results highlight the fact that an miRNA, such as miR-125b-5p in the liver, may have diverse functions depending on whether liver damage is acute or chronic. [score:1]
Similar to APAP -induced ALF, we observed significantly higher survival of mice injected with AAV-Ttr-miR-125b-5p than their respective controls (Fig. 2k). [score:1]
Thus, miR-125b-5p acts as an anti-ALF therapeutic agent as demonstrated by our study in two different mouse mo dels of ALF. [score:1]
[1 to 20 of 115 sentences]
5
[+] score: 266
Endogenous miR-125b expression was the most significantly up-regulated in type II EC samples compared with type I. QRT-PCR was performed to validate the expression of endogenous miRNAs (n = 6, miR-125b, miR-196b, miR-625, miR-196a*, miR-29a, and miR-140-5P), which were significantly up-regulated in our microRNAs microarray, in type I (endometrioid) and type II (papillary serous) EC samples. [score:10]
Click here for file Endogenous miR-125b expression was the most significantly up-regulated in type II EC samples compared with type I. QRT-PCR was performed to validate the expression of endogenous miRNAs (n = 6, miR-125b, miR-196b, miR-625, miR-196a*, miR-29a, and miR-140-5P), which were significantly up-regulated in our microRNAs microarray, in type I (endometrioid) and type II (papillary serous) EC samples. [score:10]
The results showed that endogenous miR-125b expression was the most significantly up-regulated in type II EC samples compared with type I. Click here for file Shown are 148 potential targets of miR-125b which were combinational predicted by TargetScan, Pictar-Vert, and Microrna. [score:9]
The results showed that endogenous miR-125b expression was the most significantly up-regulated in type II EC samples compared with type I. Shown are 148 potential targets of miR-125b which were combinational predicted by TargetScan, Pictar-Vert, and Microrna. [score:9]
As shown in Figure 1A, the expression of miR-125b in KLE cells was 17.36 fold (p = 0.000) and 3.46 fold (p = 0.002) that of RL95-2 and ishikawa, respectively; the expression of miR-125b in AN3CA cells was 22.39 fold (p = 0.000) and 4.46 fold (P = 0.000) that of RL95-2 and ishikawa, respectively; the expression of miR-125b in ishikawa cells was 5.03 fold (p = 0.173) that of RL95-2. There was a slight increase in expression of miR-125b in AN3CA cells compared with KLE but with no statistical significance. [score:8]
MiR-125b was overexpressed in type II EC cells compared with type I. Exogenous miR-125b expression increased proliferation and migration of ishikawa cells and abrogating expression of miR-125b suppressed proliferation, and migration of AN3CA cells in vitro. [score:8]
In addition, in vivo tumor formation assay confirmed that forced miR-125b expression promoted proliferation potential of ishikawa cells, and tumor suppressor gene Tumor Protein 53-Induced Nuclear Protein 1 (TP53INP1) was identified to be the direct target of miR-125b. [score:7]
These results imply that repressing TP53INP1 expression could significantly attenuate the inhibitory effect of miR-125bi on cell proliferation and migration, suggesting that the miR-125b promoted the proliferation and migration of AN3CA cells through targeting TP53INP1 signal pathway. [score:7]
Meanwhile, we selected significantly up-regulated miRNAs (n = 6, miR-125b, miR-196b, miR-625, miR-196a*, miR-29a, and miR-140-5P) in our microRNAs microarray (unpublished data) and validated their expression in type I and type II (each 10 cases) EC samples by qRT-PCR. [score:6]
In present studies, we found that miR-125b was overexpressed cultured type II EC cells compared with type I. exogenous miR-125b expression stimulated the growth and mobility of ishikawa cells, whereas ablation of miR-125b inhibited the growth and mobility of AN3CA cells in vitro. [score:6]
Tumor suppressor gene TP53INP1 was newly identified to be the direct downstream target of miR-125b. [score:6]
To address whether the above-observed phenotype is indeed due to the suppression of TP53INP1 and not from the targeting of other cellular genes by miR-125b, a rescue experiment was performed. [score:5]
To search for potential targets of miR-125b that may influence proliferation, migration ability of cells, TargetScan, Pictar-Vert, and Microrna. [score:5]
Four synthetic, chemically modified short single- or double-stranded RNA oligonucleotides: miR-125b mimics (miR-125bm), miR-125b mimics negative control (miR-125bm NC), miR-125b inhibitors (miR-125bi) and miR-125b inhibitors negative control (miR-125bi NC) were synthesized from Shanghai GenePharma Co. [score:5]
Although recent studies have shown the important role of miR-125b in several tumors and overexpression of miR-125b in advanced EC, its function in this disease has not yet been defined. [score:5]
In current study, exogenous miR-125b expression stimulated the growth and mobility of ishikawa cells, whereas ablation of miR-125b inhibited the growth and mobility of AN3CA cells in vitro. [score:5]
Although recent studies have shown the important role of miR-125b in several tumors and overexpression of miR-125b in advanced ECs [22], its function in this disease has not yet been defined. [score:5]
We found that endogenous miR-125b expression was the most significantly up-regulated in type II EC samples compared with type I (additional file 2). [score:5]
These results suggested that the expression level of miR-125b was inversely to endogenous TP53INP1 expression in EC I vs. [score:5]
Using computational search, 148 potential targets of miR-125b were combinational predicted by TargetScan, Pictar-Vert, and Microrna. [score:5]
The 3'UTR of TP53INP1 carries a binding site for miR-125b (Figure 5A), suggesting that TP53INP1 mRNA might be a direct target of miR-125b. [score:4]
MiR-125b can directly repress the TP53INP1 protein expression through its binding to the binding sites in 3'UTR of human TP53INP1 gene, thereby negatively regulating TP53INP1 functions. [score:4]
Taken together, these findings indicate that TP53INP1 is a direct downstream target for miR-125b in EC cells. [score:4]
In addition, luciferase reporter plasmid was constructed to demonstrate the direct target of miR-125b. [score:4]
TP53INP1 was newly identified to be the direct downstream target of miR-125b. [score:4]
In addition to TP53INP1, three recent studies reported miR-125b can directly target p53 [18], Bak1 [19], and Bmf [20] to enhance the initiation and progression of tumor. [score:4]
The findings here show a regulatory interaction between miR-125b and the tumor suppressor protein, TP53INP1. [score:4]
Thus, miR-125b might have many other targets that remain to be discovered in future. [score:3]
A. Putative binding sites of miR-125b in the TP53INP1 3'UTR (white sequences) predicted by TargetScan. [score:3]
In agreement with the microarray results, there was a significant difference of miR-125b expression between ER -negative and ER -positive cells (P < 0.01). [score:3]
These results exhibit a functional role for miR-125b in mediating migration in EC cells and suggest a mechanism by which overexpression of miR-125b may contribute to metastasis of type II EC. [score:3]
One recent publication was about a comprehensive analysis of the miRNA profile of surgically staged early and advanced endometrial cancer using archival primary ECs tissue samples, and found that expression of miR-125b-1 and miR-125b-2 in stages III and IV ECs was 3.655 and 3.89 fold of stage I endometrioid ECs, respectively[22]. [score:3]
Using microRNAs microarray, we found that miR-125b was significantly overexpressed in type II EC cells with ER negative. [score:3]
In present study, we newly identified miR-125b as the direct regulator of TP53INP1. [score:3]
MiR-125b negatively regulated the expression of TP53INP1. [score:3]
To validate microarray findings, TaqMan based qRT-PCR analysis of differentially expressed miR-125b was performed. [score:3]
TP53INP1 was found among potential targets of miR-125b combinational predicted by the three softwares. [score:3]
In addition, in vivo xenograft experiment confirmed that forced miR-125b expression promoted proliferation potential of EC cells. [score:3]
To verify that the putative miR-125b binding site in the 3'UTR of TP53INP1 is responsible for regulation by miR-125b, we constructed vectors containing wild-type or mutant 3'UTR of TP53INP1 directly fused to the downstream of the Firefly luciferase gene (Figure 5D). [score:3]
Differential expression of miR-125b was detected between type II EC cells (KLE, AN3CA) with ER negative and type I EC cells (ishikawa, RL95-2) with ER positive by qRT-PCR and northern blotting. [score:3]
Overexpression of miR-125b has been observed in many cancers such as prostate cancer [13], pancreatic cancer [24], and oligodendroglial tumors [17]. [score:3]
TargetScan analysis indicated that TP53INP1 contains one miR-125b binding site on its 3'UTR, and the sequence of the binding site is highly conserved across different species (chimpanzee, Rhesus, Mouse, Rat, and human) (Figure 5C). [score:3]
MiR-125b plasmid group was injected with ishikawa cells transfected with miR-125b expression plasmid. [score:3]
Commercial miR-125b expression plasmid and control vector were purchased from Shanghai GeneChem Co. [score:3]
Figure 1 Expression of miR-125b were assessed in EC cells by qRT-PCR and Northern blotting. [score:3]
Consistent with the results in wound healing, migration was significantly promoted in all three miR-125b overexpressed EC cells (ishikawa transfected with miR-125bm, AN3CA without treatment or transfected with miR-125bi NC) (Figure 4A~D). [score:3]
Differential expression of miR-125b between type I and type II EC cells. [score:3]
Furthermore, miR-125b plays a vital role in promoting the development of precursor B-cell acute lymphoblastic leukemia and prostate cancer [13, 25]. [score:2]
Using microRNAs microarray, we found that miR-125b was significantly overexpressed in ER -negative cells, especially in AN3CA cells, when compared with ER -positive cells. [score:2]
It was demonstrated that miR-125b was dysregulated in many tumors such as prostate cancer [13], leukemia [14, 15] liver cancer [16], and oligodendroglial tumors [17]. [score:2]
Our previous studies have identified that miR-125b was overexpressed in type II endometrial carcinoma (EC) cells compared with type I using microRNAs microarray. [score:2]
MiR-125b, which was overexpressed in type II EC cells compared with type I, contributes to malignancy of type II EC possibly through down -regulating TP53INP1. [score:2]
In addition, in vivo tumor formation assay confirmed that forced miR-125b expression promoted proliferation potential of EC cells. [score:2]
In our previous work, we found that miR-125b was significantly overexpressed in type II EC cells (KLE and AN3CA) with ER negative compared with type I EC cells (RL95-2 and ishikawa) with ER positive using microRNA microarray (unpublished data). [score:2]
As shown in Figure 5E, miR-125b significantly decreased the relative luciferase activity of wild-type TP53INP1 3'UTR (more than 60%), whereas the reduction of the luciferase activity with mutant TP53INP1 3'UTR was not as sharp as that observed in the wild-type counterpart, suggesting that miR-125b could directly bind to the 3'UTR of TP53INP1. [score:2]
In addition, miR-125b has been demonstrated to mediate the proliferative effects through down -regulating p53 [18], pro-apoptotic Bcl-2 antagonist killer 1 (Bak1) [19], and Bcl-2 modifying factor (Bmf) [20]. [score:2]
Our findings were consistent with a previous observation that miR-125b was overexpressed in stages III and IV ECs compared with stage I [22]. [score:2]
Figure 5 MiR-125b negatively regulated TP53INP1 protein levels in EC cells. [score:1]
C. Photograph of tumors derived from miR-125b plasmid, control vector, or untransfected ishikawa cells in nude mice. [score:1]
Ishikawa cells transfected with miR-125b, but not miR-125bm NC and untransfected group, closed the wound at 48 h after incubation. [score:1]
MiR-125b contributes to malignancy of type II EC possibly through down -regulating TP53INP1. [score:1]
C. Potential binding site of miR-125b on TP53INP1 3'UTR in different species. [score:1]
We therefore evaluated the effect of miR-125b on the expression of TP53INP1 protein in ishikawa (or AN3CA) cells transfected with miR-125bm (or miR-125bi). [score:1]
The proliferation indexes were (77.40 + 9.29) %, (34.00 +5.61) %, and (35.60 +7.40) %, in miR-125b plasmid group, control vector group, and no transfection group, respectively. [score:1]
In addition, northern blotting revealed that miR-125b signal in EC cells with ER negative was stronger than in that with ER positive (Figure 1B). [score:1]
miR-125b NC, untransfected. [score:1]
① indicates the nude mouse injected with ishikawa cells transfected with miR-125b plasmid. [score:1]
In addition, staining intensity of ki67 in miR-125b plasmid group was much stronger than other groups. [score:1]
In addition, it is required further to evaluate the expression of TP53INP1 and miR-125b simultaneously in large type II EC tissue samples. [score:1]
The findings promoted us to hypothesize that miR-125b may contribute to malignancy of type II EC. [score:1]
B. The results of Northern blotting show that the hybridized signal of the mature miR-125b in EC cells with ER negative was stronger than that in EC cells with ER positive. [score:1]
To further determine the role of miR-125b in the progression of EC, we did in vivo animal experiments using ishikawa cells. [score:1]
In the present study, we tried to confirm the result of microRNAs microarray and further investigated the functions of miR-125b in EC, and tried to find new downstream targets of miR-125b. [score:1]
In the present study, we confirmed the result of microRNAs microarray, and further investigated the functions of miR-125b in EC and found new downstream targets of miR-125b. [score:1]
These reports suggested that miR-125b might be associated with tumorigenesis of other types of human tumors. [score:1]
Oncogenic role of miR-125b was further demonstrated in vivo tumor xenograft mo del. [score:1]
Taken together, these observations suggest that miR-125b may play a vital role in the initiation and progression of cancers. [score:1]
Relative expression of miR-125b, relative to U6 snRNA, was calculated using the 2 [- delta delta CT ]method. [score:1]
MiR-125b is dysregulated in various human cancers but its underlying mechanisms of action are poorly understood. [score:1]
We next asked how miR-125b might function inside cells accounting for the effect of miR-125b on biological behavior of EC cells. [score:1]
At six weeks, the size and weights of tumors were substantially larger in miR-125b plasmid group than those in no transfection group and control vector group, respectively (Figure 7B~D). [score:1]
After being UV-cross-linked and baked at 50°C for 30 min, the membrane was prehybridized at 42°C for 4 h and then hybridized with the miR-125b anti-sense StarFire probe, 5'-TCACAAGTTAGGGTCTCAGGGA-3' (IDT, Coralville, IA), to detect the 22-nt miRNA-125b fragments according to the instruction of the manufacturer. [score:1]
In addition to wound healing assay, transwell migration assay was also performed to confirm the increase in motility of EC cells with overexpressed miR-125b. [score:1]
Consistent with these published findings, our results support the concept that miR-125b may act as an oncogene in type II EC. [score:1]
[1 to 20 of 84 sentences]
6
[+] score: 214
In contrast to the marked inhibitory role of miR-125b on endodermal and ectodermal differentiation, the present study has shown that overexpression of miR-125b-2 did not affect the expression of mesoderm -associated markers and therefore the mesodermal differentiation of ESCs. [score:7]
In poorly differentiated cerebellar granule cell progenitors (GCPs), miR-125b-2 is downregulated, but it promotes GCP differentiation and antagonizes the effects induced by sonic hedgehog (Shh) via targeting activating components of the Hh signaling pathway (18). [score:6]
In hippocampal neurons, NR2A expression is negatively regulated through its 3′-untranslated region by fragile X mental retardation 1, miR-125b and argonaute 1 (17). [score:6]
The preliminary results showed that miR-125b inhibited the expression of at least five genes, among which at least two genes were associated with nervous system development (data not shown). [score:6]
Of note, miR-125b was shown to target Lin28 in cardiac differentiation, whereas it targets Dies1 in neuronal differentiation (20). [score:5]
miR-125b-2 overexpression inhibits the differentiation of mESCs into endoderm and ectoderm, but not mesoderm. [score:5]
In the present study, the expression of four ESC self-renewal markers was found to be similar among miR-125b-2 -overexpressing and control cells, and no major change in morphology was observed among them. [score:5]
Stable miR-125b-2 -expressing mESC lines were established, and it was shown that the ectopic expression of miR-125b-2 did not affect the self-renewal and proliferation of mESCs. [score:5]
These results suggested that miR-125b-2 overexpression suppressed the differentiation of mESCs into endoderm and ectoderm, while there was no obvious influence on the mesodermal differentiation of ESCs. [score:5]
They further showed that miR-125b is highly enriched in undifferentiated mESCs as compared with other expressed miRNAs, while it is markedly downregulated during early ESC differentiation (19). [score:5]
The results showed that the expression levels of miR-125b-2 in mESCs were 36 times higher than those in the controls (Fig. 1A), which indicated the successful establishment of stably miR-125b-2 -expressing mESCs. [score:5]
RT-qPCR analysis confirmed that miR-125b-2 was expressed in undifferentiated mESCs (Fig. 1A); however, it has remained impossible to identify the expression levels without the threshold. [score:5]
Another study from 2012 showed that overexpression of miR-125b did not affect the ectoderm and neuron differentiation in mESCs (19), which was in contrast with a study from 2013, which reported that the ectopic expression of miR-125b blocked ESC differentiation at the epiblast stage (20). [score:5]
This regulatory role of miR-125b was confirmed by the observations of previous studies, which reported that the downregulation of miR-125b is required for the initiation of ESC differentiation (19, 20). [score:5]
Furthermore, exploration of the targets of miR-125b led to the discovery of two distinct targets, Lin28 and Dies1 (19, 20). [score:5]
Wang et al (19) reported that ectopically expressed miR-125b-2 can impair the expression of endoderm marker genes, which is consistent with these results. [score:5]
A stably miR-125b-2 -overexpressing mESC line E14Tg2A was established by transfection with an miR-125b-2 expression lentivirus. [score:5]
miR-125b is upregulated during the differentiation of human neural progenitor ReNcell VM cells, and high levels of miR-125b have been shown to promote neurite outgrowth in these cells (16). [score:4]
The levels of Foxa2 and Gata6 (29, 30), which are expressed by all extra-embryonic endodermal cells, were significantly decreased in miR-125b-2 -overexpressing EBs compared with those in the control EBs (P<0.05) (Fig. 3). [score:4]
Therefore, the ongoing identification of novel targets of miR-125b will further elucidate the molecular mechanisms of ESC differentiation and may provide tools to direct ESC differentiation toward specific lineages. [score:4]
Overexpression of miR-125b-2 did not significantly stimulate the growth of mESCs as compared with that in the controls (P<0.05) (Fig. 2), which implied that miR-125b-2-overexpression had no distinct effect on ESC proliferation. [score:4]
Functional genetic studies on EBs treated with RA further indicated that miR-125b-2 overexpression impaired neuron development. [score:4]
These results suggested that downregulation of miR-125b-2 may be required to induce the differentiation of ESCs. [score:4]
The present study showed that miR-125b-2 has an important role in mouse embryonic stem cells (mESCs) by inhibiting the differentiation of mESCs into endoderm and ectoderm without affecting their proliferation, mesodermal differentiation and self-renewal. [score:3]
In order to determine the impact of miR-125b-2 overexpression on the nervous system, RA was used to induce EB differentiation into neuronal cells (34). [score:3]
miR-125b-2 overexpression reduces neural progenitor differentiation. [score:3]
After one week, the overexpression of miR-125b-2 was verified by RT-qPCR. [score:3]
There were no significant differences in the expression levels of self-renewal markers between miR-125b-2 -transfected cells and control cells (Fig. 1B) Furthermore, Nanog, Sox2 and Oct4 were detected by immunohistochemistry. [score:3]
In agreement with these data, miR-125b-2 was shown to be highly expressed in numerous adult mouse tissue types. [score:3]
1 vector containing an miR-125b-2 expression vector, a psPAX2 packaging vector and a pMD2. [score:3]
Of note, a proportion of miR-125b -overexpressing cells were resistant to differentiation into endoderm and ectoderm. [score:3]
In the past few years, miR-125b was shown to be an important factor involved in stem cell development by regulating the differentiation of stem cells (19, 20, 27). [score:3]
Next, to determine the effects of miR-125b-2 on the self-renewal of mESCs, the expression of the mESC markers Klf4, Nanog, Rex1 and Oct4 was detected by RT-qPCR. [score:3]
Furthermore, the ectoderm forms the central nervous system (41); therefore the decreased RA -induced differentiation of ESCs into neurons following overexpression of miR-125b-2, as indicated by reduced levels of neuroectodermal markers, was in line with the decreases in ectodermal differentiation. [score:3]
To determine the function of miR-125b-2 in the maintenance of pluripotency and self-renewal, ESCs that overexpressed miR-125b-2 were established by transfection with a pL KO. [score:3]
The expression of miR-125b-2 in brains of children with DS was found to be 1.5 times higher than that in normal brains (14). [score:3]
These results indicated that the overexpression of miR-125b-2 had no influence on the maintenance of mESCs. [score:3]
Solozobova and Blattner (37) have shown that expression of miRNA-125b-2 during the process of EB formation is significantly lower in all mESC lines (R1, D3 and CGR8) than that in differentiated cells. [score:3]
Ectopic expression of miR-125b can increase the relative number of differentiated SH-SY5Y cells that show neurite outgrowth (16). [score:3]
miR-125b-2 overexpression does not affect the pluripotency and self-renewal of mESCs. [score:3]
By contrast, Wang et al (19) reported that miR-125b expression was detected in R1 mESCs using microRNA array screening. [score:3]
NR2A, which is a subunit of NMDA receptors and affects synaptic plasticity, is a target of miR-125b (17). [score:3]
miR-125b, a homolog of lin-4, was first discovered in C. elegans, in which it regulates developmental timing (1). [score:3]
miR-125b-2 overexpression does not promote ESC proliferation. [score:3]
Ectopical expression of miR-125b did not affect the self-renewal of undifferentiated ESCs. [score:3]
These findings showed that miR-125b may not be an ESC-specific cell cycle -regulating miRNA. [score:2]
Thus, it cannot be excluded that miR-125b also regulates ectoderm formation and neural differentiation, which therefore requires further study. [score:2]
Furthermore, the present study tested the proliferation of miR-125b-2 -overexpressing mESCs using the CCK-8 assay. [score:2]
The results of the present study further showed that miR-125b is acts as a regulator of ESC-specific germ layer commitment. [score:2]
There was a significant decrease in the expression of the two neuronal markers in the ES/miR-125b-2 group as compared with those in the control group (Fig. 4). [score:2]
Two recent studies have demonstrated the contribution of miR-125b to early neuronal development in embryos (19, 20). [score:2]
The findings of the present study highlighted an important role of miR-125b-2 in the regulation of ESC germ layer differentiation and revealed a novel mechanism for cell lineage determination and neuronal differentiation. [score:2]
However, the expression of a number of miRNAs changed significantly during ESC differentiation, among which miR-125b showed a marked reduction as compared with that in the control. [score:2]
In conclusion, the results of the present study indirectly demonstrated that miR-125b is required for the initiation of ESC differentiation. [score:2]
Bioinformatic analysis has demonstrated that Hsa21 harbors five miRNA genes, miR-99a, let-7c, miR-125b-2, miR-155 and miR-802 (12, 13). [score:1]
1-miR-125b-2 lentiviral vectors combined with packaging plasmids, pMD2. [score:1]
These studies used the mouse embryonic stem cell (mESC) lines R1 mESCs or E14Tg2a as a mo del to demonstrate that miR-125b is associated with a specific step during neural differentiation of mESCs. [score:1]
The results of the present study demonstrated that miR-125b is essential for the proper differentiation of ESCs, which is consistent with the results recently observed in mESCs (19, 20). [score:1]
The coding regions of mouse miR-125b-2 were amplified by polymerase chain reaction (PCR) of mouse genomic DNA. [score:1]
For example, Tarantino et al (36) reported that miR-125b is undetectable in undifferentiated cells and is induced upon differentiation in the two mESC lines E14Tg2A and MPI; however, it was not detectable in R1 mESCs by microRNA array. [score:1]
Fluorescence microscopy showed that all four markers remained detectable in miR-125b-2 -transfected cells. [score:1]
Therefore, these observations, together with the findings of the present study, suggested a distinctive role of miR-125b in the lineage commitment of ESCs as well as tissue/organ generation. [score:1]
miR-125b-2 was found to have no significant effect on the proliferation of mESCs. [score:1]
Boissart et al (42) showed that miR-125b-2 potentiated early neuronal specification of human embryonic stem cells (hESCs). [score:1]
Whether miR-125b coordinately targets Dies1 and other genes requires further investigation. [score:1]
The present study was performed to assess the association of miR-125b with the nervous system. [score:1]
However, other studies have shown that miR-125b-2 promote neuronal differentiation of SH-SY5Y, GCP and P19 cells as well as hippocampal neurons (16– 18). [score:1]
Phase-contrast images of the morphology of the colonies in the presence of LIF showed no obvious differences in morphology between miR-125b-2 -transfected cells and control cells (Fig. 1C). [score:1]
The present study investigated the cellular function of the overexpression of miR-125b-2 in mESCs. [score:1]
miR-125b also affects dendritic spine morphology. [score:1]
[1 to 20 of 70 sentences]
7
[+] score: 212
Other miRNAs from this paper: hsa-mir-125b-1, hsa-mir-125b-2, mmu-mir-125b-1
The expression of miR-125b was significantly up-regulated in the preimplantation period (day 4), and down-regulated in the implantation period (day 5) and post-implantation period (days 7–8). [score:9]
To predict the target gene of miR-125b, we used 10 online target prediction programs (DIANAmT, miRanda, miRDB, miRWalk, RNAhybrid, PICTAR4, PICTAR5, PITA, RNA22, Targetscan): MMP26 was one of the target genes predicted by five programs (Fig. 3A). [score:9]
Similarly, the expression of miR-125b was significantly up-regulated in the preimplantation period, and down-regulated in the implantation period and post-implantation period, in mice. [score:9]
MiR-125b binds to the 3′UTR region of MMP26 and negatively regulates the expression of MMP26 by inhibiting mRNA translation, but does not affect mRNA stability. [score:7]
Moreover, overexpression of miR-125b in human EECs can dramatically inhibit cell migration and invasion capacity by decreasing the expression of MMP26. [score:7]
In the present study, our results found that miR-125b expression was up-regulated in the women with elevated progesterone on HCG administration day. [score:6]
In our study, we demonstrated that MMP26 is a target gene of miR-125b and that miR-125b could significantly down-regulate MMP26 in vivo and in vitro. [score:6]
In order to confirm this conjecture, we added 10 [−6] mol/L progesterone to in vitro cultured human endometrial cells, and the expression of miR-125b was indeed up-regulated in EECs and constant in ESCs. [score:6]
To further investigate whether MMP26 is the target gene of miR-125b, the expression of MMP26 mRNA and protein was examined in human EECs after transfection with miR-125b mimics, which could up-regulate miR-125b about 500-fold (Fig. 4A). [score:6]
MiR-125b could significantly down-regulate MMP26 protein both in cells and in secretions in culture medium, although it did not affect the expression of MMP26 mRNA. [score:5]
To understand the expression profile of miR-125b in natural cycles, we examined the expression of miR-125b in different phases of menstruation. [score:5]
These data suggest that miR-125b cannot degrade MMP26 mRNA, but it can inhibit MMP26 protein translation. [score:5]
It has been suggested that elevated progesterone on the day of HCG administration up-regulates miR-125b in EECs and may be associated with a lower pregnancy rate. [score:4]
These results suggest that miR-125b may regulate gene expression by binding to the seed sequence in the 3′UTR region of MMP26. [score:4]
It was demonstrated that up-regulation of miR-125b in EECs was detrimental to embryo implantation. [score:4]
In summary, our study demonstrated that miR-125b was significantly up-regulated in EECs from women with elevated progesterone during the WOI and showed a progesterone -dependent effect in vitro, whereas it was constant in ESCs. [score:4]
Furthermore we identified a miR-125b target gene, MMP26, and demonstrated that MMP26 is a key intermediary in the maintenance of ER regulated by miR-125b. [score:4]
As shown in Fig. 2B, the level of miR-125b expression was much higher in the secretory phase than in the proliferative phase in EECs, while it was constant in ESCs. [score:3]
In addition, the expression of MMP26 protein in mouse EECs showed an inverse correlation with miR-125b during days 3–8 (Fig. 7A), and was significantly higher at implantation sites than interimplantation sites (Fig. 7B). [score:3]
Because of ethical considerations, we only examined the expression profile of miR-125b in mouse EECs during the peri-implantation period. [score:3]
The expression of miR-125b in human endometrial epithelial cells and stromal cells. [score:3]
How to cite this article: Chen, C. et al. MiR-125b regulates endometrial receptivity by targeting MMP26 in women undergoing IVF-ET with elevated progesterone on HCG priming day. [score:3]
EECs and ESCs are the two main cell types in the endometrium, and our results showed that the expression pattern of miR-125b in the two cell types was very different. [score:3]
The temporal and spatial expression patterns of miR-125b indicate its role in ER during the process of embryo implantation. [score:3]
Expression pattern of miR-125b in mouse endometrial epithelial cells. [score:3]
The expression profile of MMP26 showed an inverse relationship with miR-125b in vivo and in vitro. [score:3]
Real-time PCR analysis showed that the level of expression of miR-125b was dramatically increased on day 4, the day before the implantation period (D5), and then decreased (Fig. 6A). [score:3]
MMP26 is a target gene of miR-125b. [score:3]
In vivo effect of miR-125b gain-of-function on embryo implantationFirst, we examined the expression profile of miR-125b in EECs in untreated C57BL6/J mice during early pregnancy. [score:3]
Real-time PCR showed that the injection of miR-125b agomir resulted in a significant increase of miR-125b expression (Fig. 8A). [score:3]
This suggests a close association of increased expression of miR-125b with the onset of embryo implantation, which occurs in the evening of day 4 in the mouse. [score:3]
Confirmation of the target gene of miR-125b. [score:3]
Our study demonstrated that miR-125b was up-regulated in EECs from women with elevated progesterone compared to those with non -elevated progesterone. [score:3]
Through in-vitro cell experiment and in-vivo mouse experiment, we found that miR-125b expression was depended on progesterone level and impaired embryo implantation, which gave an explanation for the decreased implantation rate in the women with elevated progesterone on HCG administration day. [score:3]
Expression of miR-125b in human endometrial epithelial and stromal cells. [score:3]
In addition, miR-125b was expressed at lower levels at implantation sites than at interimplantation sites. [score:3]
It is suggested that the expression of miR-125b in EECs may be influenced by periodic changes in estrogen and progesterone during the menstrual cycle. [score:3]
MiR-125b suppresses EEC migration and invasion by down -regulating MMP26, which may restrain embryo attachment and the subsequent invasion of the endometrium. [score:3]
First, we examined the expression profile of miR-125b in EECs in untreated C57BL6/J mice during early pregnancy. [score:3]
Second, we aimed to study the expression of miR-125b at different stages of menstruation during natural cycles. [score:3]
The expression of miR-125b in the secretory phase was significantly higher than in the proliferating phase in EECs and showed a progesterone -dependent manner in vitro. [score:3]
Prediction and confirmation of the miR-125b target gene. [score:3]
This result was consistent with the reports of Xu et al. 48, Li et al. 49 and Wang et al. 50 that miR-125b inhibited migration and invasion in cutaneous squamous cell carcinoma cells, non-small cell lung cancer cells and Ewing’s sarcoma cells. [score:3]
Prediction and confirmation of miR-125b target genes. [score:3]
Additionally, the expression of MMP26 in mouse EECs showed an inverse relationship with miR-125b during days 3–8 of pregnancy. [score:3]
Moreover, miR-125b expression showed a remarkable decrease at implantation sites when compared with interimplantation sites on day 5 (Fig. 6B). [score:2]
MMP26 is a target gene of miR-125b, as predicted by bioinformatics programs and confirmed by the dual luciferase activity assay. [score:2]
To evaluate whether miR-125b can regulate embryo implantation, mouse uterine horns were injected with miR-125b agomir; these overexpressed miR-125b in vivo. [score:2]
However, there was no obvious alteration in the group co -transfected with miR-125b mimics with MMP26-MUT (Fig. 3C). [score:1]
MMP26-WT or MMP26-MUT reporter vectors were co -transfected with miR-125b mimics or miR-125b NC in 293 T cells. [score:1]
MiR-125b agomir or negative control (NC) (RiboBio, Guangzhou, China) was injected into the right uterine horn, and RNase-free water was injected into the left uterine horn on day 3 at nine o’clock in the morning. [score:1]
Furthermore, the progesterone antagonist Ru486 could abrogate the increase of miR-125b in EECs (Fig. 2C). [score:1]
In another group, miR-125b NC and blanks were treated, respectively, as controls. [score:1]
Furthermore, mouse uterine horns injected with miR-125b agomir showed decreased MMP26 protein in vivo (Fig. 7C). [score:1]
In vivo effect of miR-125b gain-of-function on embryo implantation. [score:1]
To examine the influence of miR-125b on embryo implantation, naturally pregnant mice were randomly assigned to two groups (seven per group). [score:1]
Human EECs were cultured in 24-well plates and transfected with miR-125b mimics or NC according to the manufacturer’s instructions (RiboBio). [score:1]
Recently, miR-125b has gained special interest in cancer research 31. [score:1]
However, there has been no study of miR-125b in embryo implantation, which shares various physiological and pathological events with oncogenesis. [score:1]
These results suggest that reduced secretion of MMP26 by miR-125b transfected human EECs may weaken cell movement ability. [score:1]
Gain-of-function of miR-125b showed a significant decrease in the number of implantation sites. [score:1]
The effect of miR-125b on cell migration and invasion. [score:1]
Similarly, the secretion of MMP26 in cell-culture medium, examined by ELISA, also showed an inverse correlation with miR-125b in a concentration- and time -dependent manner (Fig. 4D). [score:1]
As shown in Fig. 5, miR-125b mimics could significantly decrease the migratory and invasive capacity of human EECs. [score:1]
Ru486 could abrogate the increase of miR-125b in EECs. [score:1]
); (D) Release of MMP26 in cell- culture medium after transfected with different concentration of miR-125b mimic and for different time. [score:1]
In addition, miR-125b showed a greater decrease at implantation sites than at interimplantation sites. [score:1]
Our study found that gain-of-function of miR-125b could reduce the number of implantation sites in mice. [score:1]
The implantation sites were identified by intravenous injection of Chicago Blue dye solution on day 5 or 7. The number of implantation sites in the miR-125b agomir group (2.29 ± 1.25) was significantly lower than those in the miR-125b NC group (4.86 ± 1.77; p < 0.05), water group (5.29 ± 2.22; p < 0.05) and blank group (5.71 ± 2.14), and there was no difference among the miR-125b NC group, water group and blank group (p > 0.05, Fig. 8B). [score:1]
Therefore, we can only use human primary cultured EECs to verify the reverse relationship between miR-125b and MMP26 in vitro. [score:1]
[1 to 20 of 70 sentences]
8
[+] score: 180
Through depleting miR-125b in T cells using a miR-125b inhibitor, the decrease of FoxP3 expression induced by GLPS was abolished (Figure  4E), suggesting that the inhibition of Tregs by GLPS might act through increasing miR-125b expression. [score:9]
The mircroRNA-125b (miR-125b) inhibitor was used to down-regulate miR-125b expression. [score:8]
As shown in Figure  4F, GLPS treatment significantly down-regulated Notch1 expression, which was restored by the miR-125b inhibitor (Figure  4G). [score:8]
In addition, the expression of miR-125b was obviously down-regulated in Tregs from hepatoma-bearing mice injected with GLPS and miR-125b inhibitor (Figure  5C). [score:8]
Addition of GLPS to treat T cells inhibited Notch1 and FoxP3 expression through increase of miR-125b expression. [score:7]
In addition, treatment with curcumin, a known Notch1 inhibitor, could reverse the effect of miR-125b inhibitor on FoxP3 expression in T cells exposed to GLPS (Figure  4H). [score:7]
The decrease of Tregs accumulation and inactivation associated with GLPS administration was due to increase of miR-125b expression, which resulted in inhibition of Notch1 signaling pathway and FoxP3 expression. [score:7]
Further study showed that treatment with Notch1 inhibitor could reverse the effect of miR-125b inhibitor on FoxP3 expression in T cells. [score:7]
It has been demonstrated miR-125b expression was down-regulated in HCC, which is the prediction of aggressiveness and poor prognosis of HCC [33]. [score:6]
In HCC, miR-125b is significantly downregulated and exerts tumor-suppressive function [10]. [score:6]
These data indicate that GLPS could decrease FoxP3 levels by miR-125b down-regulation of Notch1 expression. [score:6]
All these lines of evidence strongly suggested that GLPS exerted anti-HCC activity through up-regulation of miR-125b expression. [score:6]
For down-regulation of miR-125b, miR-125b inhibitor was injected intratumorally before GLPS administration. [score:6]
Third, Notch1, a target of miR-125b, was down-regulated by GLPS. [score:6]
After 96 h of treatment, the expression of miR-125b was significantly up-regulated in a dose -dependent manner (Figure  4B). [score:6]
The present study, we have demonstrated that inhibition of miR-125b expression could attenuate GLPS -induced decrease of Notch1 level. [score:5]
This finding provides the novel evidence for GLPS on inhibition of HCC through miR-125b inhibiting Tregs accumulation and function. [score:5]
Last, the effect of GLPS on suppression of tumor growth was reversed by miR-125b inhibitor. [score:5]
To observe the role of miR-125b in anti-tumor of GLPS, mice were also divided into 4 groups: injection of negative control (5′-CAGUACUUUUGUGUAGUACAA-3′), miR-125b inhibitor (5′-UCACAAGUUAGGGUCUCAGGGA-3′), GLPS + negative control, and GLPS + miR-125b inhibitor. [score:5]
In GLPS + miR-125b inhibitor group, miR-125b inhibitor was pretreated for 24 hours and then injected with GLPS. [score:5]
First, miR-125b was significantly up-regulated in intratumoral Tregs from hepatoma-bearing mice injected with GLPS. [score:4]
In hepatoma-bearing mice, miR-125b inhibitor obviously abolished the effect of GLPS on tumor growth. [score:3]
Cholesterol-conjugated miR-125b inhibitor and negative control oligonucleotide (NC) were purchased from RiboBio (Guangzhou, China). [score:3]
Twenty-four hours after the miR-125b inhibitor (10 nmol) injection, hepatoma-bearing mice were treated with 50 mg/kg GLPS or same volume of PBS by i. p. injection. [score:3]
Jia et al. showed that miR-125b expression was obviously decreased in HCC tissues and cells, which is the prediction of aggressiveness and poor prognosis of HCC [11]. [score:3]
To determine whether miR-125b was implicated in the anti-tumor effect of GLPS, the cholesterol-conjugated miR-125b inhibitor was administered into the hepatoma-bearing mice. [score:3]
After transfected with miR-125b inhibitor for 24 h, naïve T cells under iTreg polarizing condition were treated with GLPS (100 μg/ml) for 96 h. Then, the protein levels of FoxP3 (E) and Notch1 (F), and the mRNA level of Notch1 (G) were determined. [score:3]
Among these miRNAs, miR-125b aberrant expression is involved in tumorigenesis and progression of numerous human cancers [9]. [score:3]
It has been demonstrated that Notch1, a target of miR-125b, plays an important role in cell growth and apoptosis of HCC [24, 25]. [score:3]
Second, miR-125b expression displayed an increase in T cells treated with GLPS. [score:3]
After intratumoral injection of miR-125b inhibitor, the tumor volume and weight exhibited a slight increase. [score:3]
These results suggest that miR-125b plays an important role in the effect of GLPS on inhibition of HCC tumor growth. [score:3]
However, miR-125b inhibitor obviously restored the effect of GLPS on tumor growth (Figure  5A and B). [score:3]
For the knockdown of miR-125b, anti-miR-125b or a negative-control anti-miRNA (anti-NC) was used at the concentration of 100 nM. [score:2]
To further explore the mechanism of GLPS mediating the alteration of Treg to Teff balance in the HCC tissues, we measured the expression of many miRNAs including miR-126, miR-155, miR-146a, miR-224, miR-150 and miR-125b, which may be involved in Treg cell development [23]. [score:2]
Ganoderma lucidum polysaccharides Hepatocellular carcinoma Regulatory T cell Effector T cell miR-125b Hepatocellular carcinoma (HCC) is one of the most lethal cancers worldwide, especially in China [1]. [score:2]
To explore the possible role of miR-125b on induction and function of Tregs, we measured the miR-125b expression in naïve T cells under iTreg polarizing condition with various concentrations of the GLPS. [score:1]
The levels of miRNAs (miR-126, miR-155, miR-146a, miR-224, miR-150 and miR-125b) were quantified by using a TaqMan PCR kit (Applied Biosystems, Foster City, CA, USA). [score:1]
In this study, we found that miR-125b was implicated in the effect of GLPS on anti-HCC. [score:1]
Among these miRNAs, miR-125b was significantly increased in intratumoral Tregs from hepatoma-bearing mice injected with GLPS (Figure  4A). [score:1]
miR-125b plays an important role in anti-tumor effect of GLPS. [score:1]
miR-125b was implicated in the effect of GLPS on intratumoral Tregs. [score:1]
[1 to 20 of 42 sentences]
9
[+] score: 157
This is an unlikely mechanism in the case of miR-125b since the screening for the effect of miR-125b overexpression on Akt, Stat, mTOR did not show any changes in the expression level in MM cell lines and E2F2 and E2F3 proteins are not expressed in Mel-Juso cells (data not shown). [score:7]
MiR-125b may negatively regulate the p53 tumour suppressor gene and Bak1 [48] but such a downregulation has not been seen in Mel-Juso cells in our experiments (data not shown). [score:6]
In this paper we show that upregulation of miR-125b induces senescence and might constitute one of the possible mechanisms of the suppressive effect of miR-125b in MM. [score:6]
It is therefore our goal for future research to identify which signaling pathways of therapeutic relevance are targeted by miR-125b and devise strategies by which mir-125b overexpression may amplify the effect of anticancer drug. [score:5]
Mel-Juso cells overexpressing miR-125b were tumourigenic in mice, but the tumours exhibited higher level of cell senescence and decreased expression of proliferation markers, cyclin D1 and Ki67 than the control tumours. [score:5]
The stability of miR-125b overexpression was confirmed by RT-q-PCR quantification of miR-125b in the tumour tissue showing an 11.6 ± 6.0 fold increased expression in the miRVec-125b transfected tumours. [score:5]
A stable overexpression of miR-125b in human melanoma cell line Mel-Juso resulted in a G0/G1 cell cycle block and emergence of large cells expressing senescence markers: senescence -associated beta-galactosidase, p21, p27 and p53. [score:5]
ISH revealed considerable expression of miR-125b in the tumours originating from the miRVec-125b vector -transfected cells, in contrast to a negligible expression in the tumours emerging from the miRVec-control cells. [score:5]
In view of the recent developments in the use of miRNA mimics and inhibitors for therapy, it is conceivable that miR-125b would be utilized for the treatment of MM by inducing senescence of cancer cells. [score:4]
Together with the results of ISH showing that miR-125b is expressed in primary human MM and lymph node metastases, the data indicate that miR-125b is implicated in the regulation of senescence in human MM. [score:4]
Transfection with miRVec-125b resulted in an 8.0 ± 1.13-fold upregulation of miR-125b by RT-qPCR compared to the miRVec-control transfected cells. [score:3]
Here we employed ISH to further define the expression pattern of miR-125b in MM. [score:3]
miR-125b inhibits proliferation and induces senescence in human melanoma line Mel-Juso. [score:3]
miR-125b is expressed in human primary cutaneous MM and lymph node metastases. [score:3]
miR-125b expression in Mel-Juso cells induces senescence and reduces proliferation in a murine tumour mo del. [score:3]
We have previously shown by miRNA array approach that miR-125b is expressed in primary cutaneous MM [26, 41]. [score:3]
However, our and other’s preliminary evidence suggested that miR-125b has an anticancer effect in MM [26, 28, 36, 41] and its decreased expression correlated with the metastatic potential of primary cutaneous MM. [score:3]
As shown in Figure  1 miR-125b is expressed in MM cells both in the primary tumours and in the sentinel node metastases. [score:3]
In primary human tumours and in lymph node metastases increased expression of miR-125b was found in single, large tumour cells with abundant cytoplasm. [score:3]
miR-125b expression was confirmed using PCR in each clone. [score:3]
The mechanism by which miR-125b overexpression promotes cellular senescence is unknown. [score:3]
This study documented that stable, ectopic expression of miR-125b induced cellular senescence in a MM cell line Mel-Juso, both in vitro and in a xenotransplantation mo del in mice in vivo. [score:3]
We noted that the expression was not homogenous and some cells characterized by large size and abundant cytoplasm expressed higher amounts of miR-125b than other cells (arrows in Figure  1A,B). [score:3]
Our results confirm the theory that miR-125b function as a tumour supressor in cutaneous malignant melanoma by regulating cellular senescence, which is one of the central mechanisms protecting against the development and progression of malignant melanoma. [score:3]
Our results confirm the theory that miR-125b functions as a tumour supressor in cutaneous malignant melanoma by regulating cellular senescence, which is one of the central mechanisms protecting against the development and progression of malignant melanoma. [score:3]
Kappelmann et al. showed that treatment of MM cells with pre-mir-125b resulted in a strong suppression of cellular proliferation [28]. [score:3]
It is known that Mel-Juso cells are very resistant to apoptosis, which enabled us to achieve a stable miR-125b overexpression. [score:3]
We used in-situ-hybridization to visualise miR-125b expression in primary tumours and in lymph node metastasis. [score:3]
Mir-125b has been identified as an oncomir in various forms of tumours, but we have previously proposed that miR-125b is a suppressor of lymph node metastasis in cutaneous malignant melanoma. [score:3]
Second, we focused primarily on the effect of the sustained overexpression of miR-125b in MM cells. [score:3]
Figure 1 Expression of miR-125b in primary cutaneous malignant melanoma and lymph node metastases shown with ISH. [score:3]
By comparing metastasizing and non-metastasizing stage T2 cutaneous MM we detected an overall decrease in miR-125b expression in metastasizing tumours [26]. [score:3]
In general, the functional role of miR-125b seems to be cell specific, since in some types of cancer (e. g. urothelial carcinoma) this miR seems to acts as a tumour suppressor [34]. [score:3]
By comparing miR expression profiles in metastasizing and non-metastasizing MM we proposed that miR-125b is implicated in the progression of human MM [26]. [score:3]
Figure 2 miR-125b inhibits the proliferation rate in cell line Mel-Juso. [score:3]
We have gathered preliminary evidence that miR-125b may be involved in the regulation of senescence in MM [36]. [score:2]
The results were surprising, since miR-125b is generally considered to be an oncogene and in a transgenic mouse mo del miR-125b overexpression causes myeloid leukemia and B-cell malignancies [46, 47]. [score:2]
MiR-125b expression is decreased in the primary cutaneous MM producing sentinel node metastasis comparing to the T-stage-matched non-metastasizing tumours [26]. [score:2]
After the experiments were completed, the miR-125b insert was sequenced to confirm that no mutation had occurred in the miR-125b sequence of the insert throughout the experimental period. [score:2]
In this study we used ISH to evaluate the miR-125b expression locally in the tissue. [score:1]
Primary cutaneous MM (stage T2; A, C) and a sentinel node with micrometastases (B) were hybridized with the probe for miR-125b (A, B) or with the control, scrambled probe (C). [score:1]
Kobuzek et al. [24] showed that the miR-125b signal in MM is different in tissue and cell lines. [score:1]
Aliquots of 3 different Mercury LNA miRNA Detection Probes; hsa-miR-125b, scrambled probe, and U6 snRNA (Exiqon, Vedbaek, Denmark) were then denatured by heating to 90°C for 4 min and diluted to 40 nM, 40 nM, and 1 nM, respectively, in a formamide-free ISH buffer (Exiqon). [score:1]
The use of inducible miR-125b vectors will be helpful to elucidate the effect of acute changes in miR-125b levels. [score:1]
This is supported by the fact that ISH staining for miR-125b on other tissues have showed that in some tissues there is a clear staining of the nuclei [54- 56] while in others the staining is mainly cytoplasmatic [57, 58]. [score:1]
One explanation of this could be that the miR-125b distribution in the cell is different between cells from a cultivated cell line and cells from tissue samples. [score:1]
The staining of miR-125b seems to be located predominantly to the nuclei. [score:1]
Mir-125b is a known oncomir and has been implicated in the pathogenesis of leukemias and B-cell lymphomas, breast cancer, squamous cell carcinoma, urothelial carcinoma, prostate carcinoma and colon cancer [29- 35]. [score:1]
We observed that the ISH on human tissue samples showed a strong nucleic concentration of miR-125b. [score:1]
Then using a miRVector plasmid containing a miR-125b-1 insert we transfected melanoma cell line Mel-Juso and then investigated the effect of the presence of a stable overexpression of miR-125b on growth by western blotting, flow cytometry and β-galactosidase staining. [score:1]
Figure 4 Reduced mitotic activity and increased senescence in tumours emerging from miRVec-125b transfected Mel-Juso cells shown by (A) ISH with miR-125b (In situ miR-125b), SA-beta-galactosidase staining (X-gal), Ki67 and Cyclin D. The different stainings were not made in paralelle. [score:1]
ISH: In situ hybridization; miR-125b: MicroRNA 125b; miRNA: MicroRNA; MM: Malignant melanoma; OIS: Oncogene -induced-senescence; PBS: Phosphate-buffered saline; TIS: Therapy -induced senescence. [score:1]
However, as exemplified by our murine MM mo del, miR-125b induces senescence focally in the tumours and the effect on tumour mass is negligible. [score:1]
Since is not possible on paraffin-embedded material and fresh samples from primary cutaneous MM are not available due to ethical considerations, we decided to examine the potential functional involvement of miR-125b in MM cell proliferation and senescence in vitro. [score:1]
Arrows show the cells with prominent staining for miR-125b. [score:1]
However, we did not detect any difference in weight between the tumours originating from miRVec-125b -transfected cells and the control, miRVec-control transfected cells (mean weight miR-125b: 0.021 g ± 0.003, control: 0.023 g ± 0.004). [score:1]
However, the studies on the compartmentalization of miR-125b have been done with cell lines and not tissue samples, like in our study. [score:1]
1] [37] insert and a blasticidin resistance gene (miRVec-125b) [38] or the control miRNA Vector plasmid with a blasticidin resistance gene but without any insert (miRVec-control) (Source BioScience, LifeSciences, Nottingham, UK) (map and sequence of miR-125b, see Additional file 1: Figure S1). [score:1]
Figure 3 miR-125b induces senescence in melanoma cell line Mel-J uso. [score:1]
It is finally possible, that nuclear miR-125b have a distinct biological role, as previously suggested for other miRNA species. [score:1]
In situ hybridization (ISH) for miR-125b. [score:1]
[1 to 20 of 61 sentences]
10
[+] score: 117
The p53 -mediated regulation of miR-125b is consistent with recent data showing that miR-125 served as a tumor suppressor microRNA in tumor cells [22] and that miR-125 is upregulated along with the p53 targets miR-34a-c, in K562 cells in response to cisplatin [23], a p53 -dependent apoptotic inducer [24]. [score:9]
We found that miR-125b downregulated (2- to 3-fold) the protein levels of TEF (Figure 4B) which correlates with the lack of interaction between TEF and its DNA target sequence in cells overexpressing miR-125b as determined by EMSA (Figure 4C). [score:8]
Here we demonstrate that TEF expression is controlled by p53 through upregulation of microRNA-125b, as determined by both regulating the activity of p53 and transfecting cells with microRNA-125b precursors. [score:7]
Therefore, we searched for miR target sequences in the TEF gene using the TargetScan and PicTar prediction programs [18], [19], and identified a highly conserved seed sequence for miR-125a and miR-125b homologs within the 3′-untranslated region of TEF that exhibit an almost perfect complementarity with both miRs (the interaction between miR-125b and human TEF is shown in Figure 3A). [score:7]
Therefore, if p53 has been implicated in seizure neuronal damage, downregulation of TEF through a p53 -mediated induction of miR-125b, could contribute to the overall apoptotic response promoted by activation of this suppressor gene. [score:6]
By using quantitative PCR, we then showed that activation of p53 in NB4 cells increased the expression of miR-125b to nearly the same extend as did the p53 target miR-34a, but had no effect on the levels of miR-147, used here as a p53-independent miR (Figure 3B). [score:5]
The maximum free energies predicted for the configuration between the target element in TEF and the seed sequences in miR-125 are –25.7 kcal/mol (miR-125a) and –27.4 kcal/mol (miR-125b) as determined by mFold analysis and consistent with authentic miR targeting [20]. [score:5]
In the present study, we demonstrate that TEF is downregulated by miR-125b through activation of p53, and that this novel regulation pathway contributes to determine the actin distribution and the shape of fibroblasts. [score:5]
To establish that the effect of miR-125b on the distribution of actin filaments was mediated through downregulation of TEF, we flow sorted DsRed -positive wild type fibroblasts cotransfected with a TEF cDNA lacking the mir-125b binding site, which were subsequently transfected with miR-125b. [score:4]
miR-125b downregulates TEF. [score:4]
In addition, it has been shown that miR-125b is a negative regulator of p53 [25], which would suggest a negative feedback loop involved in the control of this tumor suppressor. [score:4]
Overall, we set the basis of a regulatory pathway orchestrated by p53 which modifies the expression levels of TEF through activation of miR-125b, and showed that this pathway has a significant influence on cytoskeletal organization and cell shape. [score:4]
We have shown that p53 downmodulates the expression of TEF not by a direct transcriptional mechanism but through a microRNA, miR-125b. [score:4]
However, the same authors described that miR-125b is downregulated in zebrafish embryos following p53 activation by DNA-damaging agents. [score:4]
Both miR-34a and miR-125b were upregulated, whereas the levels of miR-147 remained unmodified (Figure 3C). [score:4]
Although we must take into consideration that our data were mostly obtained using mouse fibroblasts, we may hypothesize that the miR-125b -dependent regulation of TEF contributes to the response to p53 activation in both physiological conditions (i. e., response to cellular stress stimuli) and certain degenerative diseases. [score:4]
Consistent with our previous findings, transfection of wild type fibroblasts with miR-125b promoted a TEF (−/−)-like phenotype, and a similar but weaker effect was observed following exogenous expression of p53. [score:3]
To further extend these results we studied whether miR-125b was able to repress the expression of TEF by transfecting wild type fibroblasts with miR-125b. [score:3]
Overexpression of TEF, miR-125b or p53 modifies the cell phenotype. [score:3]
Double-stranded oligonucleotides corresponding to the 3′ untranslated region of mouse TEF, which contain the miR-125b binding sequence ([5′]GAGGGTGTGTTTGTTTGCTCAGGGCGGGCAGCCT [3′] ) or a mismatch sequence ([5′]GAGGGTGTGTTTGTCCGAAGCATACGGTGTGCCT [3′] ) was cloned into XhoI and SmaI sites of the psiCHECK-1 reporter vector (Promega). [score:3]
In order to verify whether the binding site for miR-125b identified in the TEF gene can repress translation, we introduced this conserved sequence downstream of the luciferase gene in a reporter construct. [score:3]
The role of p53 in promoting the expression of miR-125b was further confirmed by transfection of NB4 cells with a p53-containing vector. [score:3]
These findings provide the first evidence of TEF regulation, through a miR-125b -mediated pathway, and describes a novel role of TEF in the maintenance of cell shape in fibroblasts. [score:2]
A more direct evidence was obtained following contransfection of HEK293T cells with the same luciferase construct and with miR-125b. [score:2]
mir-125b-TEF regulation pathway controls fibroblast cell shape. [score:2]
Moreover, when wild type fibroblasts were transfected with miR-125b precursor, actin filaments were redistributed along the cell periphery and fibroblasts acquired a rounded shape in more than 60% of transfected cells (Figure 6B) resembling the morphology of TEF (−/−) fibroblasts. [score:1]
These data suggest that the p53-miR-125b-TEF axis has a significant influence on cytoskeletal organization and cell shape. [score:1]
miR-125b is induced in response to p53 activation. [score:1]
0017169.g003 Figure 3 (A) The interaction between miR-125b and the 3′UTR of TEF is shown as predicted by PICTAR. [score:1]
miR-125b mediates TEF silencing. [score:1]
After 24 h of transfection, DsRed -positive cells were sorted by flow cytometry and subsequently cotransfected with 375 ng of miR-125b and FAM-labeled miR. [score:1]
Wild type fibroblasts were transfected with miR-34a or miR-125b precursors (Applied Biosystems) using Hyperfect. [score:1]
When indicated, TEF (−/−) fibroblasts were transfected with TEF cDNA, and wild type cells were transfected with miR-125b. [score:1]
Furthermore, in other systems such as leukemia cells, p53 protein levels were not altered by miR-125b [26]. [score:1]
[1 to 20 of 34 sentences]
11
[+] score: 110
In agreement with reports in which upregulation of miR-125b has been associated with astrogliosis and glial cell proliferation in culture [55], we found upregulation of miR-125b activity in the astroglial compartment and in proliferating nestin [+] cells. [score:7]
A moderate upregulation of expression levels in differentiated cultures was observed for the brain -associated miR-125b. [score:6]
These data, and the hypothesis that the weak upregulation of miRNA expression observed in bulk populations might overestimate cell subsets with differential miRNA expression/activity, prompted us to consider miR-125b as an interesting candidate to be further investigated in our NSC culture mo del. [score:6]
While miR-125b expression increased upon cell commitment and was maintained at high level in the differentiated progeny (Figure 1E ), miR-93 was significantly downregulated during NSC differentiation (Figure 1F ). [score:6]
However, the involvement of miR-125b in the regulation of cell proliferation and apoptosis [36], and the indication that nestin is a direct functional target of miR-125b [37] suggest a possible implication of this miRNA in NSC homeostasis. [score:5]
miRT125b-transduced stem/precursor cells and progenitors might appear counterintuitive when considering the high basal levels of miR-125b expression (see Figure 1B ) and the 10-fold repression of GFP expression (Figure 4B ). [score:5]
The pattern of expression and activity of miR-125b in NSC cultures and in vivo suggested that this miRNA might regulate the transition between stem cells and committed progenitors. [score:4]
Thus, the downregulation of miR-125b activity might be dependent on the position of neuroblasts along the pathway and/or on the exit from the cell cycle. [score:4]
In this way, we identified miR-125b and miR-93 as abundantly expressed in SVZ neural stem/progenitor cells, and extended our understanding on their potential involvement in the regulation of NSC function. [score:4]
miRT125b-transduced stem/precursors and progenitors, which increased up to 20 fold after removal of FGF2 (Figure 4A, B ), indicating upregulation of miR-125b activity at the beginning of lineage commitment that persisted in the differentiated populations. [score:4]
Altogether these results indicate upregulation of miR-125b at the time of lineage commitment and further increase of its activity as astroglial maturation progressed. [score:4]
Importantly, all our data indicate a strong downregulation of miR-93 activity in mature neurons, thus underlying an important difference with respect to miR-125b. [score:4]
Our results indicate that the basal expression of miR-93 in stem/precursors and progenitors is lower when compared to miR-125b, but its activity is up to 4-fold higher, as assessed by the high fold-repression of GFP expression in bdLV. [score:4]
Interestingly, miR-125b activity in the SVZ niche was present not only in cells expressing nestin and GFAP, markers that identify primary progenitors [56], but also in βtubIII [+] neuroblasts, which are actively proliferating in this region. [score:3]
We found that miR-93, a member of the miR-106b-25 cluster, and the brain -associated miR-125b are highly enriched in somatic NSCs, and their expression and activity are significantly modulated in NSC-derived progeny, with distinct temporal progression as well as lineage- and cell type-specific patterns of modulation. [score:3]
While these data suggested a potential role for miR-93 and miR-125b in the maintenance of stem/early progenitor cells and/or in lineage commitment, they also highlighted the limitation of qPCR -based analysis in detecting modulation of miRNA -expression in low-represented subset of cells within a bulk culture. [score:3]
Based on the available data and on our expression profile we selected miR-93 and miR-125b for further analysis, in order to assess their activity in stem/early progenitor cells and the cell-specific modulation during lineage commitment and differentiation, considering the neuronal-specific miR-124 [11], [43] and the astroglial-specific miR-23a [33] as reference. [score:3]
These results indicate that miR-93 and miR-125b are highly active in proliferating neural stem/precursor cells and committed progenitors, displaying a distinct time- and cell-type-pattern of modulation of both expression and activity during cell differentiation in vitro. [score:3]
Using this platform we described for the first time a cell type- and differentiation stage-specific modulation of miR-93 and miR-125b in NSC cultures and in the SVZ neurogenic niche, suggesting a role of these miRNAs in regulating NSC function. [score:2]
Among the most wi dely studied, miR-124 is a neuronal fate determinant in cell cultures [12], [13] and in the subventricular zone (SVZ) neurogenic niche [14], [15], while miR-125b promotes neuronal differentiation and regulation of synaptic function [16], [17], [18]. [score:2]
Quantitative PCR analysis confirmed that miR-125b and miR-93 are abundantly expressed in stem/precursor cells when compared to miR-23a and miR-124 (Figure 1B ). [score:2]
miR-125b antisense 2: ccgggtccctgagaccctaacttgtgagtgatccctgagaccctaacttgtgaacgcgt. [score:1]
List of oligonucleotides used to generate transfer vector plasmids: miR-125b sense 1: ctagatcacaagttagggtctcagggacgattcacaagttagggtctcagggaacgcgt. [score:1]
Modulation of miR-125b and miR-93 activity in the SVZ neurogenic niche. [score:1]
miR-125b sense 2: tcacaagttagggtctcagggatcactcacaagttagggtctcagggac. [score:1]
miR125b- (Figure 4D ) and bdLV. [score:1]
List of oligonucleotides used to generate transfer vector plasmids: miR-125b sense 1: ctagatcacaagttagggtctcagggacgattcacaagttagggtctcagggaacgcgt. [score:1]
miRT to label the whole SVZ neurogenic niche, showing that miR-125b is active in a consistent fraction of newly-generated neurons in the different OB layers. [score:1]
Modulation of miR-125b and miR-93 activity during NSC differentiation. [score:1]
Modulation of miR-125b and miR-93 in the SVZ Neurogenic Niche. [score:1]
Our data do not allow us to functionally distinguish the subpopulations of neurons based on miR-125b activity. [score:1]
TaqMan quantitative real-time PCR was performed with hsa-miR-16, hsa-let7a, hsa-miR-125b, mmu-miR93, mmu-miR-124a, hsa-miR-23a, hsa-miR-106b, hsa-miR-25 and hsa-miR-9 specific probes (Life Technologies-Applied Biosystems) on ABI7900 thermal cycler. [score:1]
CTRL-transduced matched populations, strongly suggesting a positive association between miR-125b and miR-93 activity and proliferation of immature neural cells. [score:1]
Activity of miR-125b was low in both immature and mature NSC-derived neuronal populations in vitro (Figure 5B, C ). [score:1]
In order to define a lineage- and/or functional-specific modulation of miR-93 and miR-125b activity in NSC-derived neuronal and glial progeny, we exploited the sensitivity and specificity of the bdLV. [score:1]
The use of NSC cultures allowed us describing the modulation of miR-125b and miR-93 activity in SVZ-derived NSC populations. [score:1]
miR-125b antisense 1: tccctgagaccctaacttgtgaatcgtccctgagaccctaacttgtgat. [score:1]
Genome-wide miRNA profiling on NSC cultures allowed us to shortlist miR-125b and miR-93 as candidates of potential interest in NSC biology. [score:1]
Lineage-specific modulation of miR-125b and miR-93 activity during NSC differentiation. [score:1]
Figure S2 Activity of miR-125b and miR-93 in proliferating precursors and progenitors. [score:1]
miRT -injected mice indicates modulation of miR-125b and miR-93 activity in different OB layers. [score:1]
Activity of miR-124, miR-23a, miR-125b and miR-93a in striatal cell types. [score:1]
CTRL-transduced cells, revealing high activity of miR-125b and miR-93 in cycling precursors. [score:1]
Also, they provide for the first time a comprehensive analysis of the dynamic activity of miR-93 and miR-125b during lineage commitment and differentiation of murine somatic NSCs in culture systems and in the SVZ stem cell niche during physiological neurogenesis. [score:1]
On the contrary, miR-125b activity was maintained in a variable but significant proportion (30–70%) of neurons in all the OB layers (Figure 7G, H ), similarly to what observed in bdLV. [score:1]
Cell-type Specific Modulation of miR-125b and miR-93 Activity during NSC Differentiation. [score:1]
miRT125b -injected striatal parenchyma, indicating high miR-125b activity in this region. [score:1]
[1 to 20 of 47 sentences]
12
[+] score: 87
b miRNA RT-qPCR analysis showing the complete regulation of Hsa-miR-93, Hsa-miR-20a, Hsa-miR-125b and Hsa-miR-27b and, significant increase in the expression of Hsa-miR-1260 and Hsa-miR-1224-3p in metastatic tumors as compared to the non-metastatic xenograftTo validate the altered expression levels observed with whole genome miRNA array, we examined the expression levels of select miRNAs including hsa-miR-1260, hsa-miR-1224-3p (showing significant upregulation; see Fig.   2), hsa-miR-93, hsa-miR-20a, hsa-miR-125b, hsa-miR-27b (showing significant downregulation; see Fig.   3a), using individual miRNA QPCR analysis. [score:13]
b miRNA RT-qPCR analysis showing the complete regulation of Hsa-miR-93, Hsa-miR-20a, Hsa-miR-125b and Hsa-miR-27b and, significant increase in the expression of Hsa-miR-1260 and Hsa-miR-1224-3p in metastatic tumors as compared to the non-metastatic xenograft To validate the altered expression levels observed with whole genome miRNA array, we examined the expression levels of select miRNAs including hsa-miR-1260, hsa-miR-1224-3p (showing significant upregulation; see Fig.   2), hsa-miR-93, hsa-miR-20a, hsa-miR-125b, hsa-miR-27b (showing significant downregulation; see Fig.   3a), using individual miRNA QPCR analysis. [score:13]
To define the effect of characterized metastamiRs on the putative target proteins, we adopted two approaches: (i) inhibited hsa-miR-1224-3p or hsa-miR-1260 (both significantly upregulated) and (ii) functionally mimicked hsa-miR-125b, hsa-miR-27b, hsa-miR-93 or hsa-miR-20a (all significantly downregulated) and examined for the miRNA -dependent modulations in protein targets. [score:11]
In order to validate the miRNA expression obtained from whole genome profiling, expression of selected metastamiRs, including hsa-miR-1224-3p, hsa-miR-1260 (both significantly upregulated), hsa-miR-125b, hsa-miR-27b, hsa-miR-93,and hsa-miR-20a (all significantly downregulated) were confirmed using QPCR. [score:11]
First, MSDACs transiently transfected with mimics for hsa-miR-125b, hsa-miR-27b, hsa-miR-93 or hsa-miR-20a (those exhibited complete suppression in aggressive disease) and examined for the regulation of their corresponding target proteins (Fig.   6a). [score:8]
Thus, we validated our microarray results with RT-qPCR for upregulation (Hsa-miR-1260; Hsa-miR-1224-3p) and downregulation (Hsa-miR-20a, Hsa-miR-27b, Hsa-miR-125b, Hsa-miR-93) profiles (see Fig.   3b). [score:7]
miRNA mimic (hsa-miR-125b, hsa-miR-27b, hsa-miR-93, hsa-miR-20a) and inhibitor (hsa-miR-1224-3p, hsa-miR-1260) approach for select miRNAs revealed the direct influence of the altered metastamiRs in the regulation of identified protein targets. [score:7]
Transient transfection of MSDACs with hsa-miR-125b-, hsa-miR-27b-, hsa-miR-93- or hsa-miR-20a- mimics (MISSION® microRNA Mimics, Sigma-Aldrich) as well as hsa-miR-1224-3p- and hsa-miR-1260 -inhibitors (MISSION® Synthetic miRNA Inhibitors, Sigma-Aldrich) were carried out by using either TurboFectin 8.0 reagent (Origene) or Neon electroporation transfection system (Life Technologies). [score:5]
In addition, we observed a marginal decrease in GRB10 and STAT3 expression with hsa-miR-125b mimic. [score:3]
b Histograms of mean cell–Alexa Fluor intensity obtained from Columbus automated batch analysis showing alterations in the expression (i) GRB10, MMP2, p38, STAT3, TNFα and VEGF in cells with hsa-miR-125b mimic, (ii) EGFR FOSB, kRAS, p38, PTPN3 and VEGF in hsa-miR-27b mimic transfected cells, (iii) ASK1, CREB, MMP2, MMP3/10, PTPN3, STAT3and VEGF in MSDACs with hsa-miR-20a mimic and, (iv) MMP2, MMP3/10, PTPN3 and STAT3 with hsa-miR-93 mimic in MSDACs. [score:3]
High-throughput quantitative confocal immunofluorescence demonstrated a significant (P < 0.001) inhibition of MMP2, p38, TNFα and VEGF in MSDACs in the presence of hsa-miR-125b mimic (Fig.  6b i). [score:3]
Compared to the non-metastatic xenograft, we observed a complete (P < 0.001) decrease in the expression of hsa-miR-93, hsa-miR-20a, hsa-miR-125b, and hsa-miR-27b (Fig.   3b). [score:2]
Of the 74 metastamiRs identified in this study, we found an overlap of 16 metastamiRs, including Hsa-miR-148b, Hsa-miR-23a, Hsa-miR-100, Hsa-miR-93, Hsa-miR-125b, Hsa-miR-98, Hsa-miR-92a, Hsa-miR-29b, Hsa-miR-30c, Hsa-let-7a, Hsa-let-7b, Hsa-let-7c, Hsa-let-7e, Hsa-let-7f, and Hsa-let-7g, with the findings of other researchers. [score:1]
[1 to 20 of 13 sentences]
13
[+] score: 85
miR-125 is highly expressed in neurons, however in contrast to miR-124, also present in glia 30 where distinct genes are likely to be targeted, making bioinformatical approaches to identify miR-125 targets complicated. [score:7]
Genes that showed the greatest reduction in relative AGO2 binding after miR-125 inhibition (blue, dotted graph) showed a trend of being less downregulated in comparison of that of all other genes (black graph), however this did not reach significance (p = 0.062; Kolmogorov-Smirnov Z test). [score:6]
However, it is worth noting that inhibition of miR-124 or miR-125 did not affect AGO2 -binding of several validated miR-124 and miR-125 targets (Supplementary Fig. 3). [score:5]
Changes in RISC composition and mRNA expression after miR-125 inhibition. [score:5]
Inhibition of miR-125 reveals distinct targets but similar dynamics of miRNA regulation compared to miR-124. [score:5]
However, the majority of the genes displaying reduced AGO2 binding upon miR-125 inhibition were different to when inhibiting miR-124 (Fig. 5E). [score:5]
Predicted target genes of three miRNAs (miR-124, miR-125 and let-7) known to be expressed in hippocampal neurons, were found to be highly enriched in the fraction of AGO2-bound mRNAs (Supplementary Fig. S1A, three left-most graphs). [score:5]
Similar to when miR-124 was inhibited, the inhibition of miR-125 also led to major changes in the mRNA composition of the RISC where mRNAs from 384 out of the 2177 AGO2-bound genes were lost from the RISC (Fig. 5B). [score:5]
In addition, GO analysis of genes with reduced AGO2 binding after inhibition of miR-124 and miR-125 respectively (Figs 4F), confirmed that these two miRNAs regulate separate sets of genes. [score:4]
In line with this it is interesting to note that dysregulation of both miR-124 and miR-125 have been implicated in Alzheimer´s disease 40 41. [score:4]
miR-125 is a brain-enriched miRNA family, unrelated to miR-124, that is also highly expressed and active in hippocampal neurons but also present in other cells of the brain such as glia 30. [score:3]
We also extended our analysis to include neuron-specific identification of miR-125-targets. [score:3]
Data are represented as mean ± SEM (E) Inhibition of miR-125 resulted in reduction in AGO2 binding in a different set of genes than that of miR-124. [score:3]
We inhibited miR-125 in hippocampal neurons by the same approach used for miR-124 and performed RIP-seq analysis (Fig. 5A). [score:3]
In order to confirm that our results can be applied to miRNAs with broader expression profiles, we also investigated how inhibition of miR-125 affects AGO2 binding in hippocampal neurons. [score:3]
We also found that reduction of AGO2 binding was correlated with significant but modestly increased mRNA levels when inhibiting miR-125 (Fig. 5C,D). [score:3]
To probe this issue, we inhibited miR-124 and miR-125 using so-called AAV-sponge vectors. [score:3]
miR292sp were used to produce cumulative graphs (x-axis) comparing the presence of a computationally predicted and evolutionary conserved target site for five separate miRNAs (miR-124, miR-125, let-7, miR-21, miR-292). [score:3]
We have also previously demonstrated that the miR-124 and miR-125 sponge sequences used in the current study efficiently de-repress target transcripts using luciferase assays 13 30. [score:2]
Previous studies have suggested that miR-125 regulates genes related to synaptic plasticity and dendritic arborisation 30 32. [score:2]
The sponge sequences contained 8 imperfectly complementary binding sites for miR-292 (ACACTCAAAACCCACGGCACTT),miR-124(TTAAGGCACGTATGAATGCCA) and miR-125 (TCACAAGTTTAGTCTCAGGGA). [score:1]
In addition, our data support a role for miR-125 in the control of protein degradation and cell death. [score:1]
GO analysis demonstrated that miR-125 controls axon guidance pathways, which is in line with previous observations on miR-125 and synaptic plasticity 30 32, and also functions related to catabolic processes and cell death. [score:1]
Fluorescence in situ hybridisation (FISH) was conducted as previously described 13 using the miRCURY LNA [TM] detection probes for miR-124 and miR-125 (5′-DIG and 3′-DIG-labeled; Exiqon). [score:1]
The cellular networks controlled by miR-124 and miR-125 are largely separate, yet both networks indicate important functions for these miRNAs in the adult mouse hippocampus. [score:1]
For the miR-125 experiment, we used 3 mice injected with AAV5-GFP. [score:1]
[1 to 20 of 26 sentences]
14
[+] score: 85
Other miRNAs from this paper: mmu-mir-155, mmu-mir-34c, mmu-mir-34b, mmu-mir-34a, mmu-mir-125b-1
Finally, as miRNA-155 and miRNA-125b exhibited similar expression patterns, an intriguing question was whether CP -induced suppression of these miRNAs can intensify p53 -mediated apoptosis employing shared targets of these miRNAs. [score:7]
Instead, the expression of miRNA-125b and miRNA-155 having the potential to negatively regulate the p53 -mediated proapoptotic signaling was suppressed. [score:6]
Two other teratogens, ionizing radiation and camptothecin [35], have been shown to suppress miRNA-125b expression in zebrafish embryos [36]. [score:5]
It also suggests for the first time that in some embryonic tissues p53-independent mechanisms may exist, contributing to teratogen -induced activation of miRNA-34a and miRNA-34c, whereas teratogen -induced suppression of miRNA-125b and miRNA-155 expression may be p53 dependent. [score:5]
However, this dose suppressed miRNA-125b and miRNA-155 expression in the fore- and hindlimbs of p53 [+/+ ]embryos. [score:5]
At the same time, teratogen -induced suppression of miRNA-125b and miRNA-155 expression may be p53 dependent. [score:5]
Given the potential involvement of miRNA-34, miRNA-125b and miRNA-155 in the mechanisms regulating teratologic susceptibility of embryos, we chose to explore whether CP alters the expression of the miRNAs in the embryonic limbs and how the alterations correlate with the embryonic p53 genotype and CP -induced limb phenotypes. [score:4]
The only observed effect on miRNA-155 and miRNA-125b expression was in the limbs of p53 [+/+ ]embryos exposed to 40 mg/kg CP. [score:3]
The objectives of this study were formulated as follows: 1) to evaluate whether CP -induced teratogenic insult alters the expression of several miRNAs (miRNA-34, miRNA-125b and miRNA-155) in mouse embryonic limbs and to what extent these alterations are mediated by p53; and 2) to estimate how CP -induced alterations in the expression of the miRNAs correlates with CP -induced limb phenotypes. [score:3]
This study demonstrates that teratogen -induced limb dysmorphogenesis may be associated with alterations in miRNA-34, miRNA-125b and miRNA-155 expression. [score:3]
As to miRNA-125b, its expression was found to be decreased in embryos of female rats treated with such a teratogen as retinoic acid [34]. [score:3]
Yet, the levels of miRNA-34, miRNA-125b and miRNA-155 expression were found to be practically identical in the hindlimbs and the forelimbs of p53 -positive embryos. [score:3]
Our results concur with the above observations and, in parallel, for the first time, demonstrate that teratogen -induced suppression of miRNA-125b and miRNA-155 may be p53 dependent. [score:3]
No differences in the levels of miRNA-155 and miRNA-125b expression were observed in fore- and hindlimbs of control p53 [+/+ ]and p53 [-/- ]embryos (data not presented). [score:3]
On the other hand, unlike miRNA-34 ability to act in concert with p53, miRNA-125b and miRNA-155 seem to have the potential to function as inhibitors of CP -induced p53 -mediated apoptosis. [score:3]
Influence of CP on miRNA-155 and miRNA-125b expression. [score:3]
In the light of the above data, the activation of miRNA-34 and suppression of miRNA-125b and miRNA-155 in the limbs of CP -treated embryos may be suggested as pathogenetic events in CP -induced apoptosis and, hence, CP -induced limb dysmorphogenesis. [score:3]
Figure 1Expression of miRNA-34, miRNA-125b and miRNA-155 in the forelimbs (FL) and hindlimbs (HL) of p53 [+/+ ]and p53 [+/+ ]embryos of mice exposed to different doses of CP. [score:3]
As a result, five genes, such as SOX11, KCNA1, E2F2, ETS1 and MAP3K10, were predicted as common targets for miRNA-125b and miRNA-155. [score:3]
As to miRNA-125b, it was recently suggested to be a bona fide negative regulator of p53 in zebrafish and humans [36]. [score:2]
Two other miRNAs, miRNA-125b and miRNA-155 also seemed to be good candidates for the role of teratologic regulators. [score:2]
MiRNA-125b has been suggested to control the expression of the tumor necrosis factor alpha (TNFα) [26], a cytokine, acting as a powerful activator of NF-kB [27]. [score:2]
In a large number of studies, members of the microRNA (miRNA)-34 family such as miRNA-34a, miRNA-34b, miRNA-34c, as well as miRNA-125b and miRNA-155, have been shown to be regulators of apoptosis. [score:2]
Whereas the levels of miRNA-34 increased in CP -treated embryos, miRNA-125b and miRNA-155 levels clearly tended to decrease in the limbs of p53 [+/+]embryos exposed to 40 mg/kg CP. [score:1]
We chose to explore whether miRNA-34a/b/c, miRNA-125b and miRNA-155 may play a role in teratogenesis by using p53 [+/- ]pregnant mice treated with cyclophosphamide (CP) as a mo del. [score:1]
Evaluation of the expression of miRNA-34, miRNA-125b and miRNA-155 was performed in the fore- and hindlimbs of p53 [+/+ ]and p53 [-/- ]embryos collected 24 hours after CP injection. [score:1]
The analysis of studies addressing the biological activities of miRNA-34, miRNA-125b and miRNA-155 strongly suggests that all tested miRNAs may be involved in the mechanism of determining the response of the embryo to CP -induced teratogenic stimuli. [score:1]
[1 to 20 of 27 sentences]
15
[+] score: 68
Other miRNAs from this paper: mmu-mir-125b-1
Among the candidate miRNAs, we determined that miR-125b was substantially down regulated when lnc-mg was overexpressed, while substantially upregulated when lnc-mg was knocked down (Fig. 5b) with a dose -dependent manner (Supplementary Fig. 4a,b). [score:8]
In this study, we demonstrate that miR-125b expression is notably suppressed when lnc-mg is overexpressed. [score:7]
We demonstrate that miR-125b levels in tissue and cells are down-regulated when lnc-mg is overexpressed, resulting in increased Igf2 protein to enhance myogenesis. [score:6]
Interestingly, miR-125b has been reported to negatively modulate myoblast differentiation and its expression is known to be down-regulated during myogenesis 34. [score:6]
To validate that lnc-mg was indeed targeted by miR-125b, WT and mutant miR-125b were synthesized (Fig. 5c), and luciferase reporters containing a WT or mutant target site from lnc-mg were also constructed (Fig. 5d). [score:5]
Previous research has shown that miR-125b could negatively modulate myoblast differentiation by directly targeting Igf2 (ref. [score:4]
In addition, Igf2 (refs 34, 45, 46), a key regulator of myogenesis, has been confirmed to serve as a target of miR-125b 47. [score:4]
For further confirmation, luciferase reporter assay shows that the luciferase activity of Igf2 3′-untranslated region reporters is increased upon WT lnc-mg overexpression but not upon miR-125b binding site mutated lnc-mg (Supplementary Fig. 4d). [score:4]
Streptavidin capture analysis further suggests that the binding enrichment of miR-125b on Igf2 decreases with overexpression of WT lnc-mg, but not with miR-125b -binding site mutated lnc-mg (Supplementary Fig. 4e). [score:3]
Only WT miR-125b (AgomiR-125b) significantly reduces luciferase activity for the WT lnc-mg reporter (Fig. 5e) and only WT lnc-mg targeting site is recognized by AgomiR-125b (Fig. 5f). [score:3]
Compared with lnc-mg [fl/fl] mice, the relative expression of miR-125b is higher in GAS from lnc-mg [skl−/−] mice (Fig. 6a). [score:2]
The graphic abstract of lnc-mg regulating myogenesis is shown in Fig. 7. In conclusion, lnc-mg is a key myogenesis enhancer by functioning as a ceRNA for miR-125b controlling protein abundance of Igf2. [score:2]
lnc-mg modulates miR-125b by functioning as a ceRNA in vivoTo determine whether lnc-mg functions as a molecular sponge for miR-125b in vivo, we performed real-time PCR analysis of miR-125b levels in mice. [score:1]
To determine whether lnc-mg functions as a molecular sponge for miR-125b in vivo, we performed real-time PCR analysis of miR-125b levels in mice. [score:1]
lnc-mg acts as a molecular sponge for miR-125b in vitro. [score:1]
All these data demonstrate that lnc-mg contains functional miR-125b binding sites. [score:1]
Biotin -labelled miR-125b capture. [score:1]
For further confirmation, Ago2 immunoprecipitation and biotin -labelled miR-125b capture followed by real-time PCR confirm the interaction between miR-125b and lnc-mg (Fig. 5i,j). [score:1]
Two seed sequence mutants of miR-125b (miR-125b-mut1 and miR-125b-mut2) are shown below. [score:1]
lnc-mg acts as a molecular sponge for miR-125b in vitrolnc-mg locates in both cytoplasm and in nucleus (Supplementary Fig. 3a,b), and the amount of lnc-mg in cytoplasm increases significantly in differentiated myoblast C2C12 cells (Supplementary Fig. 3c). [score:1]
By functioning as a ceRNA, lnc-mg blocks miR-125b to control Igf2 protein level in vitro and in vivo. [score:1]
Further studies show that the luciferase activity of WT lnc-mg reporter is specifically increased upon reduction of endogenous miR-125b levels with Antagomir-125b (Fig. 5g,h). [score:1]
lnc-mg functions as a ceRNA for miR-125b in vivo. [score:1]
Moreover, bioinformatics analysis reveals a predicted miR-125b response element resides in the lnc-mg transcript. [score:1]
lnc-mg functions as a ceRNA for miR-125b in vitro. [score:1]
lnc-mg modulates miR-125b by functioning as a ceRNA in vivo. [score:1]
[1 to 20 of 26 sentences]
16
[+] score: 65
Highly expressed miRNAs included miR-124, miR-125a, miR-125b, miR-204 and miR-9. Over -expression of three miRNAs with significant predicted effects upon global mRNA levels resulted in a decrease in mRNA expression of five out of six individual predicted target genes assayed. [score:8]
The identity and expression pattern of those miRNAs which were detected by analysis of target gene expression, such as miR-124, miR-125 and miR-9, provides further evidence that miRNAs play a central role in neuronal differentiation during retinal development. [score:8]
Six genes targeted by three miRNAs with the highest expression and greatest predicted effects (miR-124; miR-125 and miR-9. ) were selected for validation: ACCN2; ETS1; KLF13; LIN28B; NFIB and SH2B3. [score:5]
Not surprisingly, these effects were related to the expression level of the miRNA; those with extremely significant effects, such as miR-125, miR-124 and miR-9 were amongst the most highly expressed in the P4 and adult murine retina. [score:5]
miR-125 is another miRNA with highly significant predicted effects upon mRNA expression and the high expression levels for miR-125a and miR-125b detected by are in agreement with previous miRNA array data [8, 11]. [score:5]
Notably, miR-125 has amongst the most significant predicted effects upon mRNA expression at all stages (Table 1) and miR-125a and miR-125b are the most highly expressed miRNAs in all samples (Figure 3B). [score:5]
F: In the adult retina expression of miR-125b was detected in the ONL (arrows) and INL (arrowheads). [score:3]
In the adult retina miR-125b was expressed in the inner and outer nuclear layers. [score:3]
The following miRNAs had highly significant predicted effects on target mRNA levels and were selected for analysis by: miR-124, miR-125, miR-9, and miR-24. [score:3]
For example, miR-125, miR-124 and miR-9 have all been independently reported to be highly expressed in the retina [9- 11]. [score:3]
Following transfection of HEK293 cells with a pool of miR-124, miR-125 and miR-9 miRNA mimics the mRNA expression of 5 of these 6 genes was significantly reduced (Figure 6). [score:3]
E: In the P4 retina strong expression of miR-125b-5p was found in the inner portion of the NBL (arrows) and GCL (arrowheads). [score:3]
miR-125b was also expressed at all stages with strong signal in the inner plexiform layer at P4. [score:3]
Whilst most of the candidate miRNAs predicted to affect mRNA levels (P < 0.05) at P4 were also in the adult, only miR-125, miR-378 and miR-24 were detected in all the different tissue types and developmental stages. [score:2]
Pools of miR-124, miR-125 and miR-9 miRNA mimics (miRNAs) or scrambled controls (Scrambled) were transfected into HEK293 cells. [score:1]
In the adult retina miR-124 and miR-125 were again prominent, but others, including miR-24, miR-326, miR-370, miR-96 and let-7 also had highly significant predicted effects. [score:1]
Together with miR-124 and miR-9, miR-125b is also induced during neural differentiation of embryonic stem cells [51]. [score:1]
D: miR-125b-5p was detected in the RSC neurospheres (purple staining depicted with arrowheads). [score:1]
At P4 many miRNAs had highly significant effects, with miR-124, miR-125 and miR-9 being particularly significant (Figure 1, Table 1 and Additional file 1: Table S1). [score:1]
Interestingly, miR-125b, one of the miRNAs with the strongest predicted effect upon mRNA levels, has been shown to accelerate deadenylation leading to rapid mRNA decay [52]. [score:1]
[1 to 20 of 20 sentences]
17
[+] score: 53
To test if the expression of miR-200c, miR-125b and miR-182 could contribute to the low expression of cMaf in beta cells, Min6 cells were transfected with a combination of 200 nM each miR-200c, miR-125b, and miR-182 exogenous hairpin inhibitors (Dharmacon-Thermo Scientific). [score:7]
0055064.g005 Figure 5Min 6 cells were transfected with hairpin inhibitors of miR125b, 182 and 200c (200 nM each) or irrelevant hairpin inhibitor control (600 nM). [score:5]
Min 6 cells were transfected with hairpin inhibitors of miR125b, 182 and 200c (200 nM each) or irrelevant hairpin inhibitor control (600 nM). [score:5]
Among the β-miRNAs potentially targeting cMaf are miR-125b, miR-182 and miR-200c, which are 27.3-, 9.7- and 3.3 fold more expressed in β-cells (Table 1 ). [score:5]
D. miR-125b inhibits c-Maf and Gcg expression in α-TC6 cells. [score:5]
Cells were transfected using Dharmafect duo transfection reagent (Dharmacon-ThermoScientific) with 200 nM each miRIDIAN Hairpin Inhibitor-miR125b; 182; and 200c or with 600 nM irrelevant inhibitor (Dharmacon-Thermo Scientific). [score:5]
Over -expression of miR-125b mimics (50 nM) for 72 hs inhibits endogenous cMaf and Gcg mRNAs, (n = 5), * p = 0.05 and 0.002 respectively, paired-2 tailed t test. [score:5]
B. Differential expression of β-miRNAs: miR-200c, miR-125b and miR-182 assessed by qRT-PCR. [score:3]
Conversely, inhibition of miR-200c, miR-125b and miR-182 in Min6 cells increased the amount of cMaf transcripts. [score:3]
Moreover, in Min6 the expression of miR-125b, miR-182 and miR-200c is much higher than in alpha TC6. [score:3]
This result strongly suggests that miR-125b and miR-182 regulate cMaf as well. [score:2]
The same experiments were performed with miR-125b (Fig. 4D ) and miR-182 (Fig. 4E ) resulting in down regulation of endogenous cMaf and Gcg mRNAs as well cMaf protein levels. [score:2]
α-TC6, transfected either with 50 nM mimic miR-200c, mimic miR-182,, mimic miR-125b or irrelevant control were lysed in SDS, Tris-HCL buffer (pH 6.8), and aliquots corresponding to 1.8 to 2.6 µg of protein (for cMaf nuclear proteins) were subjected to. [score:1]
U6 small nuclear RNA was used as endogenous control, mean ± SD (n = 4), * p = 0.005, 0.005 and 0.0022 (t-test, 2 tails) for miR-200c, miR-125b and miR-182. [score:1]
In n = 4 independent experiments we found a 222 fold (Min6 vs alphaTC6) for miR-125b, 27 fold for miR-182 and 166×103 for miR-200c (Fig. 3B ). [score:1]
[1 to 20 of 15 sentences]
18
[+] score: 53
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
We have recently shown that HDI downregulated the expression of AID and Blimp-1 by upregulating miR-155, miR-181b, and miR-361, which silence Aicda mRNA, and miR-23b, miR-30a, and miR-125b, which silence Prdm1 mRNA, but not miR-19a/b, miR-20a, and miR-25, which are not known to regulate Aicda, Prdm1, or Xbp1 (16). [score:10]
We have further shown that HDI, such as VPA and butyrate, inhibit AID and Blimp1 expression by upregulating miR-155, miR-181b, and miR-361, which silenced AICDA/Aicda mRNA, and miR-23b, miR-30a, and miR-125b, which silenced PRDM1/Prdm1 mRNA (16). [score:8]
In addition to miR-23b, miR-30a, and miR-125b, which, as we showed by qRT-PCR and miRNA-Seq, are upregulated by HDI, several other putative Prdm1 targeting miRNAs, including miR-125a, miR-96, miR-351, miR-30c, miR-182, miR-23a, miR-200b, miR-200c, miR-365, let-7, miR-98, and miR-133, were also significantly increased by HDI. [score:6]
We have shown by qRT-PCR that miR-23b, miR-30a, and miR-125b, which silence Blimp-1 by targeting Prdm1 3′ UTR, were significantly upregulated by HDI (16). [score:6]
Some miRNAs, including miR-155, miR-181b, and miR-361, can silence AID expression, whereas miR-30a and miR-125b can silence Blimp-1 expression (16). [score:5]
In the presence of HDI, miR-125a expression was increased by up to 7.5-fold, perhaps suggesting a more important role of this miRNA than miR-125b in modulating Blimp1 expression. [score:5]
miR-125a and miR-351 contain the same seed sequence as miR-125b, and therefore potentially target Prdm1 3′ UTR at the same site as miR-125b. [score:3]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
Like miR-125b, miR-125a also potentially targets Prdm1 in both human being and mouse, as predicted by the sequences (Figure 8). [score:3]
miR-125 is a an evolutionarily conserved miRNA family consisting of three paralogs, including miR-125a, miR-125b-1, and miR-125b-2 (miR-125b). [score:1]
Recent studies have presented strong evidence for a role of the miR-125 family in the immune response. [score:1]
miR-125a shares the same seed sequence with miR-125b. [score:1]
The abundance of miR-125a in B cells induced to undergo CSR and plasma cell differentiation by LPS plus IL-4 was much greater than that of miR-125b, as in all three experiments. [score:1]
[1 to 20 of 13 sentences]
19
[+] score: 52
Therefore, we generated detargeted viruses by inserting two tandem copies of miR-124, miR-125b, or either miR-142-3p target sequences immediately preceding the pCT in the 5′ NCR or two copies each of miR-133b and miR-208a [133/208(2×)] target sequences or four copies of miR-142-3p target sequences in the 3′ NCR of vMC [24]. [score:9]
We also generated detargeted viruses containing two copies each of either miR-124 or miR-125b target sequences prior to the pCT in the 5′ NCR and the 133/208(2×) insert in the 3′ NCR. [score:5]
miR-134 is also highly expressed in the hippocampus, a major site of mengovirus pathology, and may serve as an additional alternative to miR-124 or miR-125 targets, expanding the versatility of this virotherapy. [score:5]
Additionally, an upregulation of miR-125b enhanced by treatment with dexamethasone has been observed in multiple myeloma patients (58). [score:4]
The replication of miRT viruses was compared to that of unmodified vMC [24] using single-step growth curve analysis (Fig. 2B) in H1HeLa cells, which do not express any of the corresponding miRNAs, and in RAW 264.7 macrophages, which express high levels of miR-142 and intermediate levels of miR-125b (37, 38, 42). [score:4]
Chaudhuri et al. showed that increased expression of miR-125b in macrophages enhances their response to IFN-γ, which may increase the rate of viral clearance diminishing therapeutic efficacy (42). [score:3]
The targeting specificity of the inserts was verified in vitro, both in the presence of exogenously delivered miRNA mimics and as naturally occurring levels of miR-125 and miR-142. [score:3]
However, we did not see additive effects when miR-125 and miR-134 target sequences were combined for the purpose of enhancing the safety of vesicular stomatitis virus (44). [score:3]
Murray MY, Rushworth SA, Zaitseva L, Bowles KM, Macewan DJ 2013 Attenuation of dexamethasone -induced cell death in multiple myeloma is mediated by miR-125b expression. [score:3]
However, in RAW 264.7 macrophages, viruses encoding either miR-125b or miR-142 target sequence replicated with diminished kinetics or did not replicate at all, resulting in significantly lower peak viral yields. [score:3]
miR-125b is ubiquitously expressed in all cell lineages of the brain, whereas miR-124 is highly enriched in neurons (28 – 33). [score:3]
To enhance its safety profile, microRNA target sequences complementary to miR-124 or miR-125 (enriched in nervous tissue), miR-133 and miR-208 (enriched in cardiac tissue), or miR-142 (control; enriched in hematopoietic tissues) were inserted into the vMC [24] NCRs. [score:3]
miR-125b is enriched in hematopoietic stem cells, and macrophages express a high concentration relative to those of other immune cells and tissues (42). [score:3]
Sequences complementary to miR-142, miR-124, miR-125, miR-133, and miR-208 were successfully incorporated (individually or in combination) into the 5′ and 3′ NCRs of the vMC [24] genome. [score:1]
[1 to 20 of 14 sentences]
20
[+] score: 38
Circulating miR-125b was found downregulated in chronic kidney disease (CKD) in hypertensive patients suffering from cardiovascular disease [36]. [score:8]
Surprisingly, the use of antagomirs for miR-125b-5p and miR-26a-5p resulted in slight but significant downregulation of LMOD1, ADAMTS19 and NAV1 (Fig.   2b–d), a result opposite than the predicted regulation, which possibly indicates an indirect mechanism of effect of these two miRNAs on these targets. [score:8]
In another study upregulation of miR-125b protected against cisplatin -induced kidney injury via inhibition of Nuclear factor erythroid-2-related factor 2 [37]. [score:6]
Expression of let-7a (a), miR-125b-5p (b), miR-16-5p (c), miR-26a-5p (d) and miR-29b-3p (e) was assessed by RT-PCR in HK2 cells treated or not with antagomirs. [score:3]
Few data is available for miR-125b and kidney disease. [score:3]
Expression of E3 ubiquitin-protein ligase DXT4 (DTX4) (a), leiomodin-1 (LMOD1) (b), a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19 (ADAMTS19) (c) and neuron navigator 1 (NAV1) (d) was assessed by RT-PCR in HK2 cells treated or not with antagomirs against let-7a, miR-125b-5p, miR-16-5p, miR-26a-5p or miR-29b-3p. [score:3]
no 67488991), hsa-miR-125b-5p (ref. [score:1]
Antagomirs for miR-125b-5p, miR-16-5p and miR-29b-3p showed no effect on DTX4, LMOD1 and ADAMTS19, respectively (Fig.   2a–c). [score:1]
In addition, a slight but significant inverse correlation with pelvic diameter was also observed for miR-let-7a-5p and miR-125-5p and with hydronephrosis grade for miR-let-7a-5p and miR-26a-5p, and a slight but significant positive correlation with age for miR-let-7a-5p and miR-16-5p (Table  4). [score:1]
In the presence of antagomirs, the detected signal of let-7a, miR-16-5p, miR-125b-5p, miR-26a-5p and miR-29b-3p was significantly decreased (Fig.   1). [score:1]
These five miRNAs were let-7a-5p miR-16-5p, miR-29b-3p, miR-125b-5p and miR-26a-5p (Table  3). [score:1]
Correlation of the urinary abundance of the five miRNAs in UPJ patients with clinical parameters showed that miR-125-5p was inversely correlated with hydronephrosis grade (spearman r = −0,63, p = 0,003, Table  4). [score:1]
MiRNAs let-7a-5p, miR-125b-5p, miR-16-5p, miR-26a-5p and miR-29b-3p were consistently modified in mice and humans. [score:1]
[1 to 20 of 13 sentences]
21
[+] score: 37
miRNA Number of targets in miRNA-gene bigraph network P-value miR-20a 9 8.16E-09 miR-17 10 1.30E-07 miR-34a 9 2.78E-07 miR-155 14 2.16E-07 miR-18a 5 4.04E-06 miR-22 5 6.18E-06 miR-26a 6 9.29E-06 miR-101 5 3.30E-05 miR-106b 5 3.30E-05 miR-125b 8 8.37E-05 It is well known that AD is a complex disease and devastating neurodegenerative disorder without effective disease-modifying or preventive therapies. [score:7]
MiR-125b was significantly found to be up-regulated in AD brain tissues (Lukiw, 2007; Lukiw and Pogue, 2007; Lukiw and Alexandrov, 2012), and it was proposed to be involved in driven pathogenic signaling in neurodegenerative diseases, including human prion disease and Down's syndrome (Wang et al., 2010; Lukiw and Alexandrov, 2012). [score:7]
MiR-125b is involved in the targeting and down-regulation of complement factor-H (CFH) mRNA and CFH expression. [score:7]
The top 10 miRNAs with P ≤ 8.37 e [5] were listed in Table 3. They are miR-20a, miR-17, miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b, indicating that these ten miRNAs could regulate the expression of nodes (genes) in the sub-network of SAMP8 mice and might be one cause inducing SAMP8 mice to exhibit significant nodes (or genes) and to display a distinct genetic sub-network in the brain. [score:4]
In addition, microRNAs, including miR-20a, miR-17, miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b might regulate the expression of genes (nodes) in the sub-network, thereby disrupting the fine-tuning of genetic networks in SAMP8 mice. [score:4]
Furthermore, the gene expression of CDKN2A and MCM3AP were changed, and miRNAs, including miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b are important in SAMP8 mice in the present study. [score:3]
miRNA Number of targets in miRNA-gene bigraph network P-value miR-20a 9 8.16E-09 miR-17 10 1.30E-07 miR-34a 9 2.78E-07 miR-155 14 2.16E-07 miR-18a 5 4.04E-06 miR-22 5 6.18E-06 miR-26a 6 9.29E-06 miR-101 5 3.30E-05 miR-106b 5 3.30E-05 miR-125b 8 8.37E-05 Differentially expressed mRNA in the hippocampus and cerebral cortex of SAMP8 and SAMR1 mice at 2, 6, and 12 months were investigated using cDNA microarray (Cheng et al., 2007b). [score:3]
Based on the miRNA-gene bipartite graph network in the brain of SAMP8 mice, we identified the top 10 miRNAs with P ≥ 8.37E-05, including miR-20a, miR-17, miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b (Table 3). [score:1]
In these miRNAs, we first indicated that miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b were important in SAMP8 mice. [score:1]
[1 to 20 of 9 sentences]
22
[+] score: 37
We observed in our tumor samples a downregulation of miR-125a-5p, miR-125b, miR-126, miR-145 and let-7g genes, which have been shown to be related to hormonal settings and ErbB2 status of the tumor: miR-125a-5p and miR-125b downregulate ErbB2 and ErbB3 expression [31], miR-126 and let-7g are upregulated in ErbB2 -negative tumors, whereas miR-145 is upregulated in ErbB2 -negative tumors and upregulated in estrogen-receptor -positive and progesterone-receptor -positive tumors [13]. [score:18]
miR-125b, miR-126, miR-10b, miR-10a and miR-191 were underexpressed in cancer samples, whereas miR-26b, miR-607 and miR-135b were overexpressed. [score:5]
In fact, miR-125b, miR-126, miR-10b, miR-10a and miR-191 were underexpressed whereas miR-26b, miR-607 and miR-135b were overexpressed in cancer samples examined, in comparison with the gynecomastia samples. [score:5]
On the other hand, miR-145 [10, 20], miR-10b [10], let-7g [19], miR-125a-5p [10, 31], miR-125b [31] and miR-126 [40] have been described as downregulated. [score:4]
Previous studies have demonstrated that there is a large number of deregulated miRNAs in human breast cancer (in particular, miR-10b, miR-17-5p, miR-21, miR-27a, miR-27b, miR-125a, miR-125b, miR-126, miR-145, miR-155, miR-200c, miR-206, miR-336 and the let-7 family) [9- 31]. [score:2]
To confirm the results of microarray analysis, we performed quantitative real-time PCR analysis on a limited number of samples (19 cancer samples, five gynecomastia samples) using probes corresponding to miR-125b, miR-126, miR-10b, miR-10a, miR-191, miR-26b, miR-607 and miR-135b (Figure 2). [score:1]
analysisTo confirm the results of microarray analysis, we performed quantitative real-time PCR analysis on a limited number of samples (19 cancer samples, five gynecomastia samples) using probes corresponding to miR-125b, miR-126, miR-10b, miR-10a, miR-191, miR-26b, miR-607 and miR-135b (Figure 2). [score:1]
According to previous reports in female breast carcinogenesis, the most interesting and promising miRNAs of this male breast cancer signature are miR-10b, miR-126, miR-125a-5p and miR-125b [14, 31, 40]. [score:1]
[1 to 20 of 8 sentences]
23
[+] score: 35
As regards miR-125b, which is expressed in neurons and astrocytes and seems to be involved in the astrogliosis that occurs in Alzheimer disease [49], we found that this miRNA was significantly down-regulated in SVZ and hippocampus – areas in which differentiating NSPCs were significantly increased in G93A-SOD1 mice compared to control – but significantly up -regulated in primary motor cortex in association with reduced levels of Sox6. [score:8]
miR-125b was significantly down-regulated in G93A-SOD1 SVZ and hippocampus (p < 0.01) and significantly up-regulated in primary motor cortex (p < 0.01). [score:7]
In G93A-SOD1 brainstem motor nuclei and primary motor cortex, miR-9 and miR-124a were significantly up-regulated, miR-125b expression was also increased. [score:6]
In the present study we have found that in whole brain and brain regions concerned with neurogenesis (SVZ and hippocampus) and affected by motor neuron degeneration (primary motor cortex and brainstem motor nuclei), altered expression of neural fate miR-124a and miR-9 (but not miR-134), cell cycle-related miR-19a and -19b, astrocyte-related miR-125b and oligodendrocyte -related miR-219 occur in late stage disease (18 weeks). [score:5]
miR-125b and miR-219 tended to be expressed at higher levels (not significant) in cervical, thoracic and lumbar spinal cord of ALS than control mice (Additional file 2: Figure S2). [score:3]
We next analyzed the expression of miR-9, miR-124a, miR-19a and -19b, miR-125 and miR-219 in manually dissected SVZ, hippocampus, primary motor cortex and brainstem motor nuclei in 18-week-old ALS mice compared to same age controls. [score:2]
RT-PCR analysis of miR-125b and miR-219, implicated in astrocyte and oligodendrocyte functional regulation, in cervical, thoracic and lumbar spinal cord regions. [score:2]
Here we investigated neural miR-9, miR-124a, miR-125b, miR-219, miR-134, and cell cycle-related miR-19a and -19b, in G93A-SOD1 mouse brain in pre-symptomatic and late stage disease. [score:1]
These data suggest that miR-125b overexpression in primary motor cortex and also spinal cord (Additional file 2: Figure S2) is functionally associated with the corticospinal tract degeneration characteristic of ALS. [score:1]
[1 to 20 of 9 sentences]
24
[+] score: 33
When the DLBCL cells were treated with OncomiR inhibitors, the expression levels of some target genes were changed, PTEN was upregulated by the inhibitors for miR-21, miR-125b and miR-155; p27kip1 was upregulated by the inhibitors for miR-21, miR-155 and miR-221; TIMP3 was upregulated by the inhibitors for miR-21, miR-155, miR-221 and miR-17; RECK was upregulated by all the tested inhibitors (Figure 4A). [score:27]
Strong miR-125a/miR-125b expression directly inhibits the activity of tumor necrosis factor alpha -induced protein 3 (TNFAIP3), thereby activating the NF-κB signaling pathway and promoting the progression of DLBCL [28]. [score:6]
[1 to 20 of 2 sentences]
25
[+] score: 31
To the contrary, in the pre-B cell malignancy, B-ALL, Bright expression was down-regulated compared to levels found in healthy pre-B cells as a consequence of 30- to 600-fold higher expression of miR125b, resulting in the oncogenic properties of increased proliferation and cell survival (61). [score:7]
Although it is unclear whether some of these effects may be mediated through suppression of Bright, others have shown that Bright is a direct target of miR125b in B cell progenitors (61). [score:6]
In addition, these studies indicated that over -expression of miR125b inhibited B cell differentiation and affected survival of myeloma cells. [score:5]
Previous studies characterized expression of the miR125 family of micro RNAs in human B lymphocytes at various stages of differentiation, showing members of this family were differentially expressed according to the maturation state of the cells (60). [score:3]
Expression of miR125b in human pre-BI cells increased their proliferation in culture. [score:3]
Interestingly, increased expression of miR125b did not block in vitro pre-B differentiation (61). [score:3]
An important microRNA family regulating transcript levels during hematopoiesis is miRNA125. [score:2]
Myeloid lineage fate decisions have been reported to be regulated by miR125b, pushing granulocyte-macrophage progenitors for the myeloid lineage toward macrophage differentiation (59). [score:2]
[1 to 20 of 8 sentences]
26
[+] score: 31
Description miR-451[39] Upregulated in heart due to ischemia miR-22[40] Elevated serum levels in patients with stablechronic systolic heart failure miR-133[41] Downregulated in transverse aortic constrictionand isoproterenol -induced hypertrophy miR-709[42] Upregulated in rat heart four weeks after chronicdoxorubicin treatment miR-126[43] Association with outcome of ischemic andnonischemic cardiomyopathy in patients withchronic heart failure miR-30[44] Inversely related to CTGF in two rodent mo delsof heart disease, and human pathological leftventricular hypertrophy miR-29[45] Downregulated in the heart region adjacent toan infarct miR-143[46] Molecular key to switching of the vascular smoothmuscle cell phenotype that plays a critical role incardiovascular disease pathogenesis miR-24[47] Regulates cardiac fibrosis after myocardial infarction miR-23[48] Upregulated during cardiac hypertrophy miR-378[49] Cardiac hypertrophy control miR-125[50] Important regulator of hESC differentiation to cardiacmuscle(potential therapeutic application) miR-675[51] Elevated in plasma of heart failure patients let-7[52] Aberrant expression of let-7 members incardiovascular disease miR-16[53] Circulating prognostic biomarker in critical limbischemia miR-26[54] Downregulated in a rat cardiac hypertrophy mo del miR-669[55] Prevents skeletal muscle differentiation in postnatalcardiac progenitors To further confirm biological suitability of the identified miRNAs, we examined KEGG pathway enrichment using miRNA target genes (see ). [score:31]
[1 to 20 of 1 sentences]
27
[+] score: 29
Moreover, analyzing miRNAs expression in a mouse mo del (TH- MYCN/p53ER [TAM]) possessing a transgenic p53 allele that drives the expression of an inactive protein, we identified miR-125b-3p and miR-676 as directly or indirectly regulated by the level of functional p53. [score:8]
miR-125b inhibits neuroblastoma cell proliferation and promotes cell differentiation in in vitro mo dels [49], [50], so that down-regulation of this miRNA could potentially be contributing towards the more aggressive phenotype of the TH- MYCN/p53-ER [TAM] tumor phenotype. [score:6]
Interestingly, miR-125b has been identified as both a target of p53 [47] and a regulator of the p53 transcript itself [48]. [score:4]
The only two miRNAs that were down-regulated in TH- MYCN tumors from TH- MYCN/p53ER [TAM] mice were miR-125b-3p and miR-676. [score:4]
Although cluster analysis based on all miRNAs did not distinguish tumors with respect to p53 genotype, miR-125b-3p and miR-676 were significantly down-regulated (p<0.03) in TH- MYCN/p53ER [TAM] tumors (Figure 1B–C) based on the Wilcoxon Rank Sum Test with p-values corrected for multiple comparisons (n = 440). [score:4]
Expression of miR-125b-3p and miR-676 in TH- MYCN (n = 9) and TH- MYCN/p53ER [TAM] tumors (n = 13). [score:3]
[1 to 20 of 6 sentences]
28
[+] score: 28
A notable example is the evolutionarily conserved neural-expressed miR-125b, which targets both VAChT and AChE-R (Table 2) and associates with all five groups: inflammation and anxiety (Manca et al., 2011; Xu et al., 2011; Danielsson et al., 2012; Matsukawa et al., 2013), brain damage (Rink and Khanna, 2011), neurodegenerative diseases (Lukiw and Alexandrov, 2012) and cardiac diseases (Voellenkle et al., 2010) and diverse pain syndromes (Imai et al., 2011; Kynast et al., 2013; Monastyrskaya et al., 2013; Sakai et al., 2013). [score:9]
MiR-125b, a microRNA downregulated in psoriasis, modulates keratinocyte proliferation by targeting FGFR2. [score:5]
Note that miR-132 and miR-125b associate with all disease groups. [score:3]
Altered expression of miR-21, miR-125b, and miR-203 indicates a role for these microRNAs in oral lichen planus. [score:3]
MicroRNA-125b regulates the expression of aggrecanase-1 (ADAMTS-4) in human osteoarthritic chondrocytes. [score:3]
Oxidative stress activation of miR-125b is part of the molecular switch for Hailey-Hailey disease manifestation. [score:3]
Notable examples involve the conserved neurodevelopment -associated hsa-miR-125b (Martino et al., 2009) and the primate-specific hsa-miR-608 and -765 (primate specificity determined by HomoloGen conservation score [1]). [score:2]
[1 to 20 of 7 sentences]
29
[+] score: 26
For the first time, we report depot specific differences in ER stress related miRNAs including; downregulation of miR-125b-5p and upregulation of miR-143-3p, and miR-222-3p in VAT following HFD and upregulation of miR-30c-2-3p only in BAT following a HFD in mice. [score:10]
MiR-143-3p and miR-222-3p were significantly upregulated (p < 0.05), while miR-125b-5p was significantly down regulated (p < 0.05) in VAT-HF than VAT-LF (Figure 6A). [score:5]
We observed depot-specific downregulation of miR-125-5p only in VAT of HFD than LFD mice. [score:4]
However, depot specific differences in expression of ER stress related miR-30c-2-3p, miR-125b-5p, miR-143-3p and miR-222-3p in HFD induced obesity are novel findings, but these are yet to be confirmed in clonal adipocytes. [score:3]
Thus, activation of IRE1α by HFD -induced ER stress may lead to reduced expression of miR-125b-5p, which may cause increased levels of Casp2 and Mkk7, and promote apoptosis in VAT of HFD fed mice (Supplementary Figure 4). [score:3]
We also performed qPCR for selected miRNAs that were related to ER stress (miR-125b-5p, miR-143-3p and miR-222-3p, miR-30c-2-3p, and miR-455-3p), in BAT and VAT of LFD and HFD fed mice (Figure 6). [score:1]
[1 to 20 of 6 sentences]
30
[+] score: 25
In addition, we validated and obtained 4 downregulated miRNAs (i. e., hsa-let-7a, hsa-miR-125b, hsa-miR-145, and hsa-miR-195) from over 250 tumors from the TCGA-COAD database which granted us the opportunity to systematically analyze the potential molecular mechanisms associated with the pathophysiology of CRC. [score:4]
Four downregulated miRNAs (hsa-let-7a, hsa-miR-125b, hsa-miR-145, and hsa-miR-195) were demonstrated to be potentially useful diagnostic markers in the clinical setting. [score:4]
In this study, we found that hsa-let-7a, hsa-miR-125b, and hsa-miR-145 were downregulated in CRC and correlated with improved survivals of CRC patients. [score:4]
For hsa-let-7a, hsa-miR-125b, and hsa-miR-145, previous reports have shown their downregulation was correlated with the antitumor effect in CRC [31, 32]. [score:4]
Only hsa-let-7a, hsa-miR-125b, hsa-miR-145, and hsa-miR-195 were significantly downregulated in CRC tumors (Fig.   1c), and each of these miRNAs could provide a high accuracy on CRC tissue classification as estimated by ROC curve analysis (Fig.   2a; Additional file 10: Figure S1a). [score:4]
Four downregulated miRNAs (hsa-let-7a, hsa-miR-125b, hsa-miR-145, and hsa-miR-195) can be potentially useful diagnostic markers in the clinic. [score:4]
In contrast, low levels of let-7, miR-125b, or miR-145 in TCGA CRC tissues were correlated with improved overall survivals (Additional file 10: Figure S1b). [score:1]
[1 to 20 of 7 sentences]
31
[+] score: 24
Auxiliary pairing regulates miRNA–target specificity in vivoAs a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:7]
identified functional, non-canonical regulation globally for miR-128 and miR-124 (Fig. 2), and for individual miR-9, miR-181, miR-30 and miR-125 targets (Fig. 4f and Fig. 8b–m). [score:4]
As a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:4]
Constructs expressing miR-30a from the miR-30c locus and miR-125b from the miR-125a locus were also made, in an effort to control for processing efficiency. [score:3]
Analysis of miR-125 and miR-181 families revealed additional intra -family target preferences (Supplementary Fig. 9a–d). [score:3]
Genomic fragments for miR-125b, miR-30a and miR-30c spanning ∼200 nucleotides upstream and downstream of primary hairpins were synthesized as gBlocks (IDT) and inserted into the SBI vector between EcoRI and BamHI. [score:1]
Evaluation of miR-125a (blue), miR-125b (red) and negative control miRNA (black) overexpression on (j) a miR-30 site as a negative control for miR-125 paralogs and (k– m) sites with predicted miR-125a preference. [score:1]
Evaluation of miR-30a (red), miR-30c (blue) and negative control miRNA (black) overexpression on (b) a full miR-30 8mer site as a positive control for miR-30 paralogues; (c) a miR-125 site as a negative control for miR-30 paralogues; (d, e) sites with predicted miR-30a preference; and (f– i) sites with predicted miR-30c preference. [score:1]
[1 to 20 of 8 sentences]
32
[+] score: 24
Next to miR-204, the next most highly expressed MG miRNAs (with less than 20% expression in neurons) were miR-125b, and miR-9. These two miRNAs are also highly expressed in P7 FAC-sorted astrocytes of the forebrain, along with several others of the most highly expressed mGliomiRs (miR-99a, miR-204, miR-135a) and shared miRs (miR-720, let-7b, miR-29a, and miR-30d) 40. [score:9]
Three of the top four miRNAs expressed in adult MG, miR-204, miR-125-5p and miR-181a, showed large increases in their expression between the P11 and adult, while miR-9, did not increase. [score:5]
In glioma-derived stem cells, low miR-125 levels lead to increased proliferation due to a change in Lin-28, a target of miR-125b 50. [score:3]
miR-204, miR-125b-5p, and miR-9 are the top 3 mGliomiRs, and showed 18, 9 and 7 fold higher levels of expression in MG than in neurons. [score:3]
A role for miR-125b and miR-9 has been described for retinal development, particularly in the transition from early (non-gliogenic) to late (gliogenic) progenitors 41, as well as its role during neurogenesis 42 43. [score:2]
miR-125-5p and miR-720 are miRNAs which further increased with maturation in vivo and also increased their levels in vitro, although these levels were lower than those of freshly isolated adult MG (Fig. 5C’). [score:1]
Thus, miR-125 and miR-9 appear to have general roles in neural progenitors to convey competency to generate glia. [score:1]
[1 to 20 of 7 sentences]
33
[+] score: 23
The reconstitution of TFF1 expression significantly reduced miR-504 expression, but not miR-125, in AGS (A) and STKM2 (B) cells; the levels of TFF1 mRNA expression are shown. [score:7]
To test this hypothesis, we first checked the microRNA expression of miR-125 and miR-504 in response to TFF1 expression. [score:5]
The quantitative real time PCR data showed that the reconstitution of TFF1 expression significantly decreased miR-504 levels, but not miR-125, in AGS (p<0.05, Figure 4A) and STKM2 (p<0.01, Figure 4B) cells, suggesting that. [score:3]
Recent studies showed that some microRNAs, such as miR-504 and miR-125, may directly regulate p53 by reducing its protein levels [28, 34, 35]. [score:3]
Protein levels and function of p53 have been shown to be regulated by miRNAs including miR-125 [43], miR-18 [23], and miR-504 [28]. [score:2]
Figure 4 AGS and STKM2 cells were transiently transfected with PTT5 empty vector or TFF1 and subjected to quantitative real-time PCR of mature miR-125, miR-504, and TFF1 48 hours post transfection. [score:1]
The miRNA levels of endogenous mature miR-125 and miR-504 were analyzed and normalized with miR-191. [score:1]
AGS and STKM2 cells were transiently transfected with PTT5 empty vector or TFF1 and subjected to quantitative real-time PCR of mature miR-125, miR-504, and TFF1 48 hours post transfection. [score:1]
[1 to 20 of 8 sentences]
34
[+] score: 21
MiR-155 and miR-125b were found to be up-regulated and down-regulated, respectively, in Raw 264.7 macrophages in response to LPS. [score:7]
When murine macrophages were incubated with docetaxel at 0.8 μg/ml for 1 h, only miR-146a expression was significantly increased in comparison with the control (Figure 7D); 3 hours later, the expression of miR-155, miR-150 and miR-146a was significantly increased (Figure 7B, C, D) while miR-181a and miR-125b had no significant changes (Figure 7A, E). [score:5]
Expression levels of microRNAs (miR-181a, miR-155, miR-150, miR-146a and miR-125b) were detected according to our lab previously described by Yuan et al. [21]. [score:3]
Three hours later, miR-155, miR-150 and miR-146a expressions were enhanced (Figure 7B, C, D), while miR-181a and miR-125b showed no significant change (Figure 7A, E). [score:3]
In this study, miR-181a, miR-155, miR-150, miR-146a and miR-125b were analyzed to identify microRNAs possibly involved in responses to docetaxel stimulation (Figure 7). [score:1]
Previous studies have shown that miR-155, miR-150, miR-146a, miR-181a and miR-125b are involved in the innate immune reactions. [score:1]
Real-time PCR was performed to determination of miR-181a (A), miR-155 (B), miR-150 (C), miR-146a (D) and miR-125b (E) as described in methods. [score:1]
[1 to 20 of 7 sentences]
35
[+] score: 21
In contrast, expression of miR-125b was found to be downregulated in hepatocytes after alcohol feeding (Figure 2). [score:6]
However, the physiological relevance of miR-125b downregulation in ALD has yet to be explored. [score:4]
Downregulation of miR-125b has been reported in HCC and is associated with increased placenta growth factor (PIGF) [55]. [score:4]
MiR-146a is linked with endotoxin tolerance, where it regulates IRAK-1 and TRAF-6 and acts as a negative regulator of TLR4 signaling [41], whereas miR-125b limits TNF alpha production in RAW 264.7 macrophage [42]. [score:3]
Contrary to this observation, no significant changes were observed in miR-125b and -146a expression (Figure 1). [score:3]
In this study, we also found decreased miR-125b in hepatocytes of alcohol-fed mice (Figure 2). [score:1]
[1 to 20 of 6 sentences]
36
[+] score: 20
Other miRNAs from this paper: mmu-mir-125a, mmu-mir-125b-1, mmu-mir-504
However, the effect of obesity on miR-125b and miR-504, which negatively regulate p53 through direct binding in the 3′ untranslated region of the gene, resulting in decreased p53 protein translation (7,8), is unclear. [score:7]
Data not meeting assumptions of normality were transformed by natural log; this included the data on serum insulin and leptin, p21 expression in Wnt-1 p53 [+/−] tumors, and miR125-b expression in both tumor genotypes. [score:5]
The mRNA expression of Mdm2, Sirt1 and miR-125b, each of which negatively regulates p53 activity, was not modulated by DIO, relative to control, in Wnt-1 p53 [+/+] or Wnt-1 p53 [+/−] mammary tumor tissue (Figure 6). [score:4]
DIO did not appear to target Mdm2, Sirt1 or miR-125b. [score:3]
miR-125b data was natural log transformed to meet statistical test assumptions. [score:1]
[1 to 20 of 5 sentences]
37
[+] score: 20
Figure 2B shows the results of miRNA abundance in bar-graph format of these 3 miRNAs in aluminum-fed over magnesium-sulfate fed controls; both miRNA-9 and miRNA125b showed modest up-regulation to ~1.8 and 2.1-fold over control, respectively, in aluminum sulfate fed animals; the most significantly up-regulated miRNA in these studies was the inflammation and neurodegeneration -associated miRNA-146a to about ~9.1-fold over controls in blood serum after 5 months. [score:7]
miRNA increases appear to be the consequence, in part, of an inducible miRNA-9, miRNA-125b and miRNA-146a being up-regulated under conditions of stress as has been observed in both human neuronal-glial (HNG) primary cells and in human brain obtained from short post-mortem interval AD tissue samples [18, 21, 22]. [score:4]
The purpose of the current research work was to quantify the concentrations and clarify the contributions of CRP, IL-6, TNFα and the levels of the pro-inflammatory microRNAs, including miRNA-9, miRNA-125b and miRNA-146a, in the blood serum of wild-type C57BL/6J mice that were fed aluminum-sulfate in their diet over a time course of 0, 1, 3 and 5 months. [score:1]
After 5 months of aluminum-sulfate ingestion by C57BL/6J mice, all 6 biomarkers (CRP, IL-6, TNFα, miRNA-9, miRNA-125b and miRNA-146A) were found to exhibit increases in the blood serum, indicating a significant stimulation of SI biomarkers in aluminum-sulfate fed animals. [score:1]
This study is the first to show that the circulating cytokines IL-6 and TNFα, CRP and the pro-inflammatory microRNAs miRNA-9, miRNA-125b and miRNA-146 are elevated in mouse blood serum after ingestion of physiologically realistic amounts of aluminum (as sulfate) in the diet. [score:1]
Systemic Inflammation, CRP, IL-6, TNFα, miRNA-9, miRNA-125b and miRNA-146a. [score:1]
sncRNA abundance analysis including microRNA (miRNA) abundance analysis for miRNA-9, miRNA-125b, miRNA-146a, miRNA-183 and 5S RNA were quantified using microfluidic sncRNA and miRNA arrays as previously described in detail (LC Sciences, Houston TX, USA) [11, 18, 21]. [score:1]
Increases in small non-coding RNA (sncRNA) microRNAs miRNA-9, miRNA-125b and miRNA-146a. [score:1]
While miRNA-9 and miRNA-125b displayed modest increases in abundance in the blood serum of C57BL/6J mice after aluminum-sulfate treatment, miRNA-146a exhibited the most significant increase in aluminum -treated animals after 5 months (Figures 2A and 2B). [score:1]
The pro-inflammatory microRNAs miRNA-9-1 (encoded in humans at chr 1q22), miRNA-125b (encoded at chr 11q24) and miRNA-146a (encoded at chr 5q33.3): (i) are detectable in human biofluids including extracellular fluid (ECF) and cerebrospinal fluid (CSF) [11, 17, 20]; (ii) are increased in ECF and CSF to various degrees in AD patients [17, 20]; and (iii) are each stress -induced miRNAs that contain binding sites for the pro-inflammatory transcription factor NF-kB (p50/p65 complex) in their gene promoters [11, 17, 20, 44– 46]. [score:1]
Figure 2A shows the levels of 3 serum and brain-abundant microRNAs (miRNA-9, miRNA-125b and miRNA-146a) and controls (miRNA-183 and 5S RNA); C1 and C2=blood serum from 2 control C57BL/6J mice receiving magnesium sulfate in their diet; A1 and A2=blood serum from 2 C57BL/6J mice receiving aluminum sulfate in their diet. [score:1]
[1 to 20 of 11 sentences]
38
[+] score: 20
In addition to this group of down-regulated miRs, CSCs can be distinguished from embryonic heart cells on the basis of seven up-regulated miRs: let-7a, let-7b, miR-24, miR-125b, miR-132, miR-149 and miR-223 (Fig. 2C). [score:7]
Among the six up-regulated miRs in CSCs we find the four most highly expressed miRs in these cells: miR-125b, miR 126, miR-133a and miR-24. [score:6]
Comparative profiling of CSCs and embryonic heart cells identified the let-7 miR family members, let-7a, let-7b, miR-125a and miR-125b, as well as miR-223 as being upregulated in CSCs. [score:4]
As mentioned above, miR-24, miR-125b and miR-132 are among the top expressed miRs in CSCs. [score:3]
[1 to 20 of 4 sentences]
39
[+] score: 20
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Of the miRNAs found to be up-regulated in the metastatic xenografts, miR-125b has been reported to be up-regulated in prostate cancer and shown to be oncogenic [24], [29], [40]; other studies, however, have reported miR-125b to be down-regulated in prostate cancer [23], [24], [27]– [29]. [score:10]
Furthermore, some of the differentially expressed miRNAs have been reported to play a role in the metastasis of other types of cancer, for example, the up-regulated miRNAs, let-7i, miR-9, miR-30a, miR-125b, miR-142-5p, miR-151-3p, miR-450a and the down-regulated miRNAs, miR-24, mir-145, miR-146b-5p, miR-185, miR-186, miR-203 and miR-335. [score:9]
miR-125b-2, a component of the miR-125b cluster, has been identified as part of an androgen receptor -mediated transcriptional network [57]. [score:1]
[1 to 20 of 3 sentences]
40
[+] score: 19
miR-125a and miR-125b, containing the same seed sequences, are induced during classical macrophage activation and potentiate M1 polarization through direct inhibition of anti-inflammatory Tnfaip3 (A20) and Irf4 expression [24, 81, 82]. [score:6]
However, miR-125b shows opposite regulation during in vitro and in vivo alternative macrophage activation, though regulation of miR-125b expression was not studied at early time points of nematode infection -induced M2 macrophage activation [19]. [score:5]
For instance, miR-125b-5p, miR-199b, and miR-378-3p showed elevated expression in nematode infection-elicited alternative macrophage activation [19]. [score:3]
It has been previously described that the common miR-125a/miR-125b target gene Irf4 facilitates M2 macrophage polarization and host response against helminth infection [83, 84]. [score:3]
These findings collectively suggest a complex role of miR99b, miR-125a, and miR-125b in the regulation of alternative macrophage activation. [score:2]
[1 to 20 of 5 sentences]
41
[+] score: 19
LPS has been shown to down-regulate the expression of miR-125b in the Raw macrophage cell line [10], however it was found to be up-regulated in a cholangiocyte cell line in response to LPS or Cryptossporidium parvum infection [12]. [score:9]
With LPS only 4 miRNAs, miR-155, miR-125-5p and 3p and miR-146a, showed greater than 2-fold up-regulation on the two arrays with a p value of less than 0.05 (Table 2). [score:4]
Consistent with pri-miR-125 and pri-miR-455 being co-transcribed with Ncrna00085 and Col27a1 respectively, the induction of both these mRNAs was also blocked by IKKβ inhibitors (data not shown). [score:3]
To extend the results from the array experiment, the transcriptional regulation of miR-125-5p and 3p, miR-155, miR-146a, miR-146b and miR-455 by either heat killed C. albicans or LPS was examined using Taqman qPCR based methods, in samples from BMDMs generated independently from those used for the array studies. [score:2]
An unusual feature of this locus is that pri-miR-125 actually overlaps an intron exon boundary, suggesting that processing of the miRNA would occur in competition with splicing of the mRNA. [score:1]
[1 to 20 of 5 sentences]
42
[+] score: 18
The other tested miRs were up or downregulated during pneumonia as found by gene expression profiling, except for mmu-miR-125b-5p, which was significantly down in the profiling study but was wi dely variable in the verification study. [score:6]
The consensus DE miRs whose expression is anti-correlated with their DE predicted targets (mmu-miR-125a-5p/mmu-miR-125b-5p, mmu-let-7b-5p/mmu-let-7c-5p/mmu-let-7d-5p/mmu-let-7e-5p/mmu-let-7f-5p, mmu-miR-126-3p, mmu-miR-335-5p and mmu-miR-23b-3p) are designated as candidate key regulatory miRs (miRhubs), which may represent major control points in the network-level neutrophil response to S. pneumoniae. [score:6]
A complementary approach using miRHub analysis 37, 38 identified candidate key regulatory miRs based on conserved target sites in DE mRNAs, of which 10 individual miRs are differentially expressed (mmu-miR-125a-5p/mmu-miR-125b-5p, mmu-let-7a-5p/ mmu-let-7c-5p/mmu-let-7d-5p/mmu-let-7e-5p/mmu-let-7f-5p, mmu-miR-126-3p, mmu-miR-335-5p and mmu-miR-23b-3p; see Fig.   6 and Supplementary Tables  8 and 9). [score:6]
[1 to 20 of 3 sentences]
43
[+] score: 18
For example, the expression of miRNA-146a, miRNA-155and miRNA-21 are up-regulated in monocytes challenged by LPS [4, 6, 7], whereas that of miRNA-125b is down-regulated [5]. [score:9]
TNF-α, an important inflammatory factor, is inhibited indirectly by miRNA-146a, which targets TRAF6 and IRAK1 [4], and directly by miRNA-125b, which targets the 3’UTR of TNF-α mRNA[5]. [score:9]
[1 to 20 of 2 sentences]
44
[+] score: 17
For instance, miR-223 was reported to negatively regulate both the proliferation and activation of neutrophils by targeting myeloid Elf1-like factor 2C [18]; miR-125b and let-7 were down-regulated in response to lipopolysaccharide (LPS) stimulation in macrophages, in which the miR-125b regulated the immune response by targeting tumor necrosis factor (TNF)-α mRNA [19], whereas let-7 through a mechanism of targeting IL-6 mRNA [20]; miR-21 has also been found to be able to further negatively regulate LPS-activated TLR4 signaling by targeting the tumor suppressor gene, Programmed Cell Death 4 (PDCD4), which in turn decreased nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) activation and resulted in the production of anti-inflammatory cytokine IL-10 [21]. [score:17]
[1 to 20 of 1 sentences]
45
[+] score: 17
Many of these upregulated miRNAs were known oncomiRs in breast cancer, such as miR-200, miR-141 and miR-223 [21– 23], Also, many of down-regulated miRNAs in MCF7 HER2 cells were tumor suppressors, such as miR-125b, miR-31 and miR-99a [24– 26]. [score:9]
Our qRT-PCR data demonstrated that miR-489, miR-125b and miR-99a at least partially restored their expression profile after inhibition of HER2 phosphorylation (Figure 1C). [score:5]
A comparison of our data with these published expression signatures revealed several miRNAs previously found to be associated with HER2 such as miR-125, miR-99a and miR-21 [30, 33, 34]. [score:3]
[1 to 20 of 3 sentences]
46
[+] score: 17
Boissart et al. [20] have shown that antagonizing miR-125 isoforms, independently or in combination, compromised to the same extent the efficiency of neural induction and that both are able to target Lin28, an RNA -binding protein promoting the proliferative capacity of neural progenitor cells in brain development [21]. [score:4]
More recently, miR-125b has been shown to target Lin28 during mouse embryoid body formation [22]. [score:3]
In addition, when both miR-125 isoforms were antagonized simultaneously, expression of all pluripotency markers (including OCT4 and NANOG) was significantly induced [20]. [score:3]
In agreement, increased levels of Lin28 associated with decreased expression of miR-125b after radiation treatment, strongly suggest a less differentiated status of Ptch1 [+/−] compared with WT GCPs. [score:2]
Accordingly, there was a lower miR-125b expression level (Fig.   3f) in sham-irradiated Ptch1 [+/−] GCPs compared with WT counterparts (P < 0.001) and this difference was exacerbated after irradiation (2.3-fold decrease), again indicating a less differentiated phenotype of irradiated Ptch1 [+/−] GCPs. [score:2]
We therefore investigated the expression levels of Lin28 and miR-125b in Ptch1 [+/−] and WT GCPs. [score:1]
In order to extend our investigation of cell reprogramming as part of the DDR response in Ptch1 [+/−] GCPs, we also tested the expression level of the RNA binding protein Lin28 and miR-125b, as it is known that their equilibrium maintains stem cell self-renewal and plasticity or drives neuronal lineage commitment and differentiation [29]. [score:1]
miR-125 isoforms promote neural conversion of human embryonic stem cells. [score:1]
[1 to 20 of 8 sentences]
47
[+] score: 17
On the other hand, an elevated expression of Nrf2 in specific tumour cell lines was shown to be associated with a downregulated expression of miR-1 and miR-206 [186] and the up- and downregulation of miR-125-b1 and miR-29-b1, respectively [187]. [score:11]
The Nrf2 -dependent induction of miRNAs was shown to interact with other molecular pathways, as miR-125b is increased by Nrf2, and inhibited aryl hydrocarbon receptor (AhR) repressor, which contributed to the protection from acute kidney injury [192]. [score:3]
Joo M. S. Lee C. G. Koo J. H. Kim S. G. miR-125b transcriptionally increased by Nrf2 inhibits AhR repressor, which protects kidney from cisplatin -induced injuryCell Death Dis. [score:3]
[1 to 20 of 3 sentences]
48
[+] score: 17
The TaqMan® Array Human MicroRNA Card contained all 13 possible miRs predicted to target IRAK-1, and 24 h HG-stimulation caused the downregulation of seven endothelial miRs: miR-146a-5p, miR-339-5p, miR-874-3p, miR-125-3p, miR-431-5p, miR-192-5p, and miR-215-5p (Figure 2A). [score:6]
Real-time PCR analyses of 24 h HG-stimulated HAECs showed that only miR-146a-5p, miR-339-5p, miR-874-3p, and miR-125-3p expression were significantly downregulated compared to the unstimulated control (Figure 2B). [score:5]
HG stimulation for 24 h revealed that seven miRs, miR-146a-5p, miR-339-5p, miR-874-3p, miR-125-3p, miR-431-5p, miR-192-5p, and miR-215-5p, were downregulated by HG, as compared with unstimulated control. [score:3]
HG stimulation for 24 h decreased miR-146a-5p, miR-339-5p, miR-874-3p, and miR-125-3p expression levels to 18, 20, 28, and 54% of the control level, respectively. [score:3]
[1 to 20 of 4 sentences]
49
[+] score: 16
This statistical analysis further revealed that miR-125b and miR-10b were upregulated in cultures exposed to either damaged lysate, while hsa-miR-34a expression was down-regulated in both LPS and lysate treated cultures (Table 2). [score:9]
Hsa-miR-214 expression clustered with other miRs (such as miR-10b and miR-125b) when donor PBMCs were exposed to both types of cell lysate (Figure 1A, middle panel). [score:3]
Importantly, miR-125b deregulation has been observed in breast cancer [24]. [score:2]
Some of the other “DAMPmiRs” that clustered together with miR-214 include miR-125b and miR-10b, where the latter can be involved in metastasis [22], [23]. [score:1]
Using a Taqman microRNA profiling low-density PCR array we identified several microRNA genes, including miR-34c, miR-214, miR-210, miR-125b and miR-10b in human PBMCs, which are involved in the inflammatory response to damaged cells. [score:1]
[1 to 20 of 5 sentences]
50
[+] score: 15
In the nerve graft, miR-125-3b and miR-672 were significantly upregulated in the mice that received an allograft with FK506 only at 7 d after nerve allotransplantation. [score:4]
In the nerve graft, only miR-125-3b and miR-672 were significantly upregulated in the mice receiving allograft with FK506 only at 7 d, but not at 1, 3, 10, or 14 d, after nerve allotransplantation (Figure  2C). [score:4]
In the nerve graft, 1 miRNA (miR-125b-3p) was upregulated in the mice receiving allografts without FK506, compared to those with untreated isografts. [score:3]
In addition, there was significant expression of 3 miRNAs (miR-125b-3p, miR-672, and miR-467b*) in the mice receiving an allograft with FK506, when compared to those mice receiving an allograft without FK506. [score:2]
Three miRNAs (miR-320, miR-762, and miR-423-5p) in the circulation and 3 miRNAs (miR-125b-3p, miR-672, and miR-467b*) in the nerve graft were subjected to further quantification and validation. [score:1]
However, the increase of miR-125-3b and miR-672 at 7 d was only a little, albeit significantly. [score:1]
[1 to 20 of 6 sentences]
51
[+] score: 15
mir-125, involved in Erbb2 suppression, was downregulated by ECS in females but not in males. [score:6]
A similar selective inhibition of lung tumors was observed in MCS-exposed female Swiss H mice [21], in which 3 miRNAs (miR-10a, miR-125, and miR-130a) involved in estrogen and HER2 pathways were differentially expressed in adenoma-bearing male and female mice [27]. [score:5]
Some of them, such as miR-30b, miR-92a, and miR-125b, have been reported to undergo intergender differences in expression during lung development [34]. [score:4]
[1 to 20 of 3 sentences]
52
[+] score: 15
In the present study, we showed that the expression of several miRNAs is altered during the development of PC and that licofelone reverses the altered expression of the majority of these miRNAs with up-regulation of miR-21, miR-222, Let-7, miR-125, miR-142 and down-regulation of miR-1, miR-122 and miR-148. [score:12]
For example, Lee EJ 2007 et al. [44] showed that the miRNAs miR155, miR21, miR222, Let7, miR376a, miR301, miR100, miR125, miR142 and others are overexpressed significantly in human PC. [score:3]
[1 to 20 of 2 sentences]
53
[+] score: 15
Interestingly, p53 has been shown to suppress the expression of miR-125b and miR-22 [56], indicating that it could repress its negative regulators to increase its expression. [score:8]
p53 expression is inhibited by miR-125b [2], while p63 is inhibited by miR-302, miR-21, and miR-92 [3], [4], [5]. [score:7]
[1 to 20 of 2 sentences]
54
[+] score: 14
In the STHdhQ111/HdhQ111 striatal cell mo del of HD, exogenous expression of miR-214, miR-150, miR-146a, and miR-125b reduced mutant huntingtin expression and aggregation whereas mutations to these miRNAs prevented, and loss of function reversed, their effect [147]. [score:6]
Based on these findings, upregulation of miR-9, miR-9*, miR-22, miR-34b, miR-125b, miR-137, miR-146a, miR148a, miR-150, miR-196a, and miR-214 may have therapeutic potential against mutant HTT, REST, HDAC4, apoptosis, and other pathobiological factors in HD. [score:4]
These functional data support some (miR-22, miR-125b, miR-146a, miR-150) and contradict other (miR-34b, miR-148a, and miR-214) Table 2 miRNA targets. [score:3]
The effects of psychotropics on the other miRNAs listed in Table 2, particularly miR-9, miR-9*, miR-22, miR-34b, miR-125b, miR-137, miR-146a, miR148a, miR-150, miR-196a, and miR-214, as well as on REST, deserve study in HD mo dels. [score:1]
[1 to 20 of 4 sentences]
55
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
The relative expression intensities of miR-125 were 2.8 ± 1.6 in adenoma-free mice and 5.6 ± 2.7 in adenoma-bearing mice, thus accounting for a 2.0-fold upregulation. [score:6]
Our study showed that no miRNA was different between males and females in adenoma-free mice, while 3 miRNAs (miR-10a, miR-125, and miR-130a) were differentially expressed in adenoma-bearing male and female mice. [score:3]
The panels report the amplification curves for each one of the 20 mouse lung fragments tested, either adenoma-free (green) or adenoma-bearing (purple), relatively to miRNAs miR-125, miR-374, and miR-669k. [score:1]
According to volcano-plot analyses, no miRNA was different in males and females from adenoma-free mice, whereas 3 miRNAs (miR-10a, miR-125, and miR- 130a) from adenoma-bearing mice showed intergender differences. [score:1]
In particular, miR-10a is related to estrogen dependent cancer promotion [112, 113], miR-130a both to the estrogen and HER2 pathways [114, 115], and miR-125 to HER2/erbb2 estrogen sensitive oncogene activation [116, 117]. [score:1]
Validation of microarray data was performed by real time-qPCR for miR-125, miR-374, and miR-669k. [score:1]
Figure 4 The panels report the amplification curves for each one of the 20 mouse lung fragments tested, either adenoma-free (green) or adenoma-bearing (purple), relatively to miRNAs miR-125, miR-374, and miR-669k. [score:1]
[1 to 20 of 7 sentences]
56
[+] score: 14
Other miRNAs from this paper: mmu-mir-146a, mmu-mir-195a, mmu-mir-223, mmu-mir-125b-1, mmu-mir-501
Interestingly, when we directly compared gene expression profiles of the IR sample and the sham sample, we found that the DE genes (microRNAs and mRNAs) were associated with the Toll-like receptor signaling pathway in which miR-125b-5p and miR-501-3p were down-regulated at reperfusion stage, leading to the increased expression of their target Myd88, c-Fos and A20 (Fig 6). [score:10]
Particularly, miR-125b-5p and miR-501-3p are down-regulated and activate the Toll-like receptor signaling pathway in response to hepatic IR injury. [score:4]
[1 to 20 of 2 sentences]
57
[+] score: 13
In murine macrophages, miR-125b was shown to be induced by LPS and to target TNFα [18] and in H69 epithelial cells it was upregulated upon C. parvum infection via NF-κB [22]. [score:6]
However, miR-125b was not upregulated in our arrays, which is not surprising since the two miRNAs derive from transcripts located on different chromosomal locations, and are probably regulated differently in BMDMs infected with L. monocytogenes compared to other types of infection. [score:4]
MiR-125a-5p shares the same 5′-UTR sequence (seed region) with miR-125b and may therefore target the same mRNAs. [score:3]
[1 to 20 of 3 sentences]
58
[+] score: 13
In Group 1, the most significantly up-regulated miRNAs were miR-1187, miR-125a-3p, miR-466c-5p, miR-5105 and miR-3472, whereas the most significantly down-regulated was miR-125b-5p. [score:7]
The miR-125b was the highest up-regulated miRNA, and thus it was associated with a decrease in apoptosis-related gene expression. [score:6]
[1 to 20 of 2 sentences]
59
[+] score: 13
Our resultsidentified 20differentially expressed miRNAs in aortas from WT mice and 12-week-old OPG [−/−] mice, with miR-32, miR-125b, miR-30a, miR-29a, miR-210, miR-33, miR-133a exhibitingsignificantly altered expression in aortas fromOPG [−/−] mice relative to their expression in aortas from WT mice. [score:7]
Several miRNAsidentified as calcification modulators, such as miR-125b [17],exhibited a consistent increasein expression in the aortasofOPG [–/–]mice. [score:3]
miR-125b regulates calcification of vascular smooth muscle cells. [score:2]
Because miR-133a, miR-125b, miR-29a, and miR-210 werepreviously implicated in the progression of vascular calcification [13, 17, 36, 37],we were able to confirm the validity of OPG [−/−] mice as suitable mo dels for the screening of miRNA profiles associated with vascular calcification. [score:1]
[1 to 20 of 4 sentences]
60
[+] score: 13
We also mention that the same miRNA may exert opposite functions in different tumors: for instance, the overexpression of miR-125b that down-regulates p53 in colorectal cancers [87], seems to induce cell cycle arrest and apoptosis in Ewing sarcoma cells, possibly by p53 activation through down-regulation of PI3K and phospho-AKT [88]. [score:9]
For instance, it has been observed that miR-125b [84] and miR-504 [85], when overexpressed, keep the p53 level low by direct binding to the p53 mRNA. [score:4]
[1 to 20 of 2 sentences]
61
[+] score: 12
The concurrent down-regulation of the miR-let7 cluster, known to promote differentiation in most cells and de-differentiation when it is inhibited [76], miR-125, a highly abundant miRNA in adult retina [45], and miR-7, known to promote photoreceptor differentiation [44] is consistent with Müller cell de-differentiation under the influence of ESMVs. [score:6]
miR-7, which represses the expression of Yan protein and promotes photoreceptor differentiation [44], as well as miR-125-2b, highly abundant in adult retina [45], were down-regulated over 48 hours post-ESMV treatment. [score:6]
[1 to 20 of 2 sentences]
62
[+] score: 12
Several down-regulated (i. e. miR-1, miR-7, miR-34a, miR-122, miR-125b, miR-200) or up-regulated (i. e. miR-17, miR-18, miR-19, miR-155, miR-93, miR-221/222) miRNAs have been identified as tumor suppressor or oncomirs, respectively, by targeting and regulating genes involved in cell proliferation, apoptosis, angiogenesis and metastasis [13]. [score:12]
[1 to 20 of 1 sentences]
63
[+] score: 12
Our analysis of miRNA expression revealed that miR-9, miR-133a, miR-133b, miR-125a-5p, miR-125b-5p, miR-30a, miR-30b, and miR-146a are all expressed in the developing forebrain, adult dorsal striatum and in the developing kidney (S4 Table). [score:5]
Our data also suggest that miR-125a-5p, miR-125b-5p, miR-30a, and miR-30b are possible regulators of GDNF expression. [score:4]
We examined the miRNAs miR-133a, miR-133b, miR-125a-5p, miR-125b-5p, miR-30a, miR-30b, miR-96, miR-9, and miR-146a, which were selected based on their co -expression with Gdnf in several brain areas [17, 19, 32, 33]; see also www. [score:3]
[1 to 20 of 3 sentences]
64
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
Overexpression of miR-125a and miR-125b decreased ERBB2 and ERBB3 mRNA and protein levels, inhibited phosphorylation of ERK1/2 and AKT, and inhibited the anchorage-independent growth of ERα -negative/ErbB2 -overexpressing SKBR3 breast cancer cells [195]. [score:9]
E [2] decreased miR-146a, miR 125a, miR-125b, let-7e, miR-126, miR-145, and miR-143 and increased miR-223, miR-451, miR-486, miR-148a, miR-18a, and miR-708 expression in mouse splenic lymphocytes [199]. [score:3]
[1 to 20 of 2 sentences]
65
[+] score: 12
Likewise, mmu-mir-21, mmu-mir-125b, mmu-mir-16b, mmu-mir-143 and mmu-mir-199a-3p were expressed abundantly in all libraries despite of changes in expression with development thus suggesting its role in basic reproductive activities. [score:6]
Others predominantly expressed miRNAs e. g., mmu-mir-125b, mmu-mir-199a-3p, mmu-mir-29a and mmu-mir-15b targets several ovarian genes and involved in several biological functions like cell signaling, cell death, cell cycle regulation, cellular growth and differentiation and endocrine system [37]. [score:6]
[1 to 20 of 2 sentences]
66
[+] score: 11
Interestingly, inhibition of miR-125b was demonstrated to overcome dexamethasone resistance in MM cells by activation of p53 downstream targets [109]. [score:5]
Murray M. Y. Rushworth S. A. Zaitseva L. Bowles K. M. Macewan D. J. Attenuation of dexamethasone -induced cell death in multiple myeloma is mediated by miR-125b expression Cell Cycle Georget. [score:3]
Similarly, other microRNAs such as miR-125b, miR-125a and miR-1285 have been described as negative regulator of TP53 [104, 105, 106]. [score:2]
Le M. T. N. Teh C. Shyh-Chang N. Xie H. Zhou B. Korzh V. Lodish H. F. Lim B. MicroRNA-125b is a novel negative regulator of p53 Genes Dev. [score:1]
[1 to 20 of 4 sentences]
67
[+] score: 11
We also explored the effects on the signalling pathways of the first nine highly expressed miRNAs and discovered that miR-666-3p, miR-540-3p, miR-125b-5p and miR-450b-3p potentially promote FoxO1 expression, whereas miR-883b-5p, 666-3p, miR-450b-3p and miR-151-3p may play an essential role in down-regulation of Glut4 expression. [score:10]
According to the microRNA microarray analysis, the first nine highly expressed miRNAs (miR-883b-5p, miR-666-3p, miR-770-5p, miR-804, miR-540-3p, miR-882, miR-125b-5p, miR-450b-3p, and miR-151-3p) were selected out for further investigation. [score:1]
[1 to 20 of 2 sentences]
68
[+] score: 11
Among the miRNAs that were significantly upregulated in SAMP8 compared with SAMR1 mice, miR-30e-5p, miR-125b-5p, and miR-128-3p have also been reported to be upregulated in post-mortem human AD hippocampus (Lukiw, 2007; Cogswell et al., 2008). [score:6]
Notably, our study highlights the upregulation of miR-30e-5p, miR-125b-5p, and miR-128-3p as common epigenetic features in the hippocampus of SAMP8 mice and post-mortem hippocampus from AD patients. [score:4]
Moreover, our results support bioinformatic data by Cheng et al. who have recently predicted from a whole genome microarray study that miR-125b-5p may be involved in the brain aging phenotype of SAMP8 mice (Cheng et al., 2013a). [score:1]
[1 to 20 of 3 sentences]
69
[+] score: 11
Using the same experimental approach, these authors have also shown that triple -positive cells isolated from pancreatic cancer lines display a peculiar pattern of expression of several miRNAs: among them, miR-125b was found to be overexpressed in triple -positive cells, and its knockdown elicited a marked inhibition of tumor aggressiveness of these cells, consistent with the downregulation of CD44, EpCAM and EZH2 [164]. [score:11]
[1 to 20 of 1 sentences]
70
[+] score: 11
Interestingly, miR-125 plays important roles in mitochondrial apoptosis pathway by targeting pro-apoptosis or anti-apoptosis genes depending on cellular environment [39]. [score:3]
Shomron and coworkers suggest that the miR-125 family members possess identical seed sequences, which are predicted to share the same target genes [27]. [score:3]
The miR-351 belongs to the miR-125 family, and is shown to perform various roles in cell development, cell death, cancer and inflammation [32– 35]. [score:2]
It is possible that the two-types of cancer cell-death, necrosis and apoptosis, are regulated by miR-125 family members in various living species. [score:2]
Diverse functions of miR-125 family in different cell contexts. [score:1]
[1 to 20 of 5 sentences]
71
[+] score: 11
For example, miR-134 regulates LimK1 at the spine by stimulation of BDNF [19], miR-138 regulates palmitoylation in neurons by inhibiting the translation of LYPLA [16], [18], miR-132 targets p250GAP to enhance spine growth [20] and the FMRP associated miRNA, miR-125b blocks the translation of NR2B resulting in neuronal structural changes [21]. [score:11]
[1 to 20 of 1 sentences]
72
[+] score: 10
Hepatic expression of tumor suppressive miRNAs, miR-26a, miR-26a-1, miR-192, miR-122, miR-22 and miR-125b, and tumor promoting miRNAs, miR-10b and miR-99b in NASH-HCC mo del male and female mice. [score:5]
As shown in Fig. 4, the tumor suppressive miRNAs, miR-26a, miR-26a-1, miR-192, miR-122, miR-22, and miR-125b were lower, whereas the tumor-promoting miRNAs, miR-10b and miR-99b were higher in males than in females in both the STZ-HFD group and the control group. [score:3]
We also observed that tumor-suppressive miRNAs, miR-26a, miR-26a-1, miR-192, miR-122, miR-22, and miR-125b were significantly decreased in STZ-HFD mice compared to controls with significantly lower levels in males than in females. [score:2]
[1 to 20 of 3 sentences]
73
[+] score: 10
Although it has been reported that brain-specific miR-124, miR-125b and let-7 are expressed in mouse and rat eye lenses [27– 30], no studies have involved the spatial and temporal expression profiles of miRNAs in lens development and cataractogenesis. [score:6]
Our data revealed that expression levels of miR7 and miR125b were unchanged in ED16, 4W and 14W lenses. [score:3]
In previous research [27, 29, 30], several miRNAs such as miR124, miR7, miR125b and let7b have been detected in rat lens and in regeneration of new lens by transdifferentiation of pigment epithelial cells of the dorsal iris. [score:1]
[1 to 20 of 3 sentences]
74
[+] score: 10
For example, miR-155 is upregulated and miR-125b is downregulated in lipopolysaccharide (LPS)-stimulated mouse RAW264.7 macrophages, and these miRNAs participate in regulating the response to endotoxin shock by influencing the transcription and translation of TNF-α [12]. [score:10]
[1 to 20 of 1 sentences]
75
[+] score: 10
Unlike miR-150, miR-125b-5p was primarily expressed in stromal tissue, as it was not detected in purified thymocytes (lanes 8–9). [score:3]
MiR-125b-5p was highly expressed in the brain and heart, but it was detected at low levels in other tissues. [score:2]
MiR-125b-5p, miR-150, miR-205, and miR-342-3p were consistently up regulated in the thymic tissue from the LPS injected mice (Figure 2B). [score:2]
Northern blots were performed for the selected miRs A) Mir-125, B) MiR-150, C) MiR-181a, and D) MiR-181d. [score:1]
To determine the temporal alterations in miR levels following LPS or Dex treatments, northern blots were performed with RNA extracted from the thymus at 24, 48, and 72 h. MiR-125b-5p and miR-150 exhibited a transient, 2-fold increase 24 h post-LPS and -Dex injections (Figure 3A, lanes 2 and 5 versus 1). [score:1]
The individual miRs (miR-15a, miR-17, miR-20a, miR-20b, miR-26b, miR-106a, miR-125-5p, miR-342-3p) were detected by Northern blotting. [score:1]
[1 to 20 of 6 sentences]
76
[+] score: 10
We previously found that miR-125b-5p is downregulated during differentiation and controls cardiac differentiation via regulating mesendodermal specification [13]. [score:5]
In the microarray results, some miRNAs showed similar expression pattern to that of miR-142-3p, such as miR-125b-5p, miR-124, and let-7g. [score:3]
We previously found that miR-125b/Lin28 axis is a critical regulator in the control of mesendodermal specification from mouse ESCs (mESCs) and subsequent cardiac differentiation [13]. [score:2]
[1 to 20 of 3 sentences]
77
[+] score: 10
For example, let-7 represses adipogenesis in hMSCs and 3T3-L1 cells 31 32; let-7e, let-7b, miR-28a-5p, and miR-10a are upregulated, while let-7c and miR-125b are downregulated in either preadipocytes or mature adipocytes of obese vs. [score:7]
Moreover, miR-125b is directly and significantly correlated with body mass index 34. [score:2]
LV-miR-125 + 483 further decreased the n-T-ERK1/2 and n-p-ERK1/2 levels. [score:1]
[1 to 20 of 3 sentences]
78
[+] score: 10
A recent study has shown that overexpression of miR-125b in hESC resulted in the upregulation of the early cardiac transcription factors, GATA4 and Nkx2-5, and accelerated the progression of hESC-derived myocardial precursors to an embryonic cardiomyocyte phenotype [107]. [score:6]
By using an in silico approach, let-7, Lin28 and Oct4 were identified as targets of miR-125b, suggesting that the manipulation of miR-125b -mediated pathways may be useful for reprogramming ESC to different lineages. [score:3]
In this context, let-7, miR-125. [score:1]
[1 to 20 of 3 sentences]
79
[+] score: 10
The 3′UTR of human, mouse and rat p53 mRNA all have miR-485 conserved predicted target sites, but only the 3′UTRs of human p53 mRNA has miR-125b target site, (B–D) Quantitative RT-PCR assays were performed to examine p53 mRNA levels in three cell types (H460, NIH/3T3 and H9C2) treated with p53 siRNA and other miRNAs for 48 h. GAPDH served as the internal control (top). [score:4]
However, unlike miR-138, miR-125b specifically target human p53 instead of mouse and rat (Fig. 6A,B). [score:3]
MiR-125b targeting p53 shows divergence between species. [score:2]
In fact, not only miR-138, miR-125b regulation of p53 also has species specificity, compared with miR-485 without this feature. [score:1]
[1 to 20 of 4 sentences]
80
[+] score: 10
Our results showed that in Omp25 -expressing PAMs, the levels of miR-130a-3p, miR-146a, miR-181a, miR-181b, and miR-301a-3p were upregulated, while miR-125a-5p, miR-125b-5p, and miR-146b were downregulated compared to controls (Figure 4A). [score:8]
MiR-146 and miR-125 in the regulation of innate immunity and inflammation. [score:2]
[1 to 20 of 2 sentences]
81
[+] score: 10
miR-125b supports myelopoiesis but not granulocyte colony-stimulating factor -induced granulocytic differentiation, and enforced expression of miR-125b induced an initial myeloproliferative disorder depending upon the ectopic expression levels [17– 19]. [score:5]
Surdziel E Cabanski M Dallmann I Lyszkiewicz M Krueger A Ganser A Enforced expression of miR-125b affects myelopoiesis by targeting multiple signaling pathwaysBlood. [score:5]
[1 to 20 of 2 sentences]
82
[+] score: 10
Other miRNAs from this paper: mmu-mir-125a, mmu-mir-125b-1, mmu-mir-335
Because the ability of miRNAs in general, and of miR-125 family in particular, to regulate target genes is specific to cell type and to the differentiation stage [21], we validated that miR-125a-3p can down-regulate the expression of Fyn in oocytes by microinjecting GV oocytes with miR-125a-3p mimic. [score:9]
Sun Y-M Lin K-Y Chen Y-Q Diverse functions of miR-125 family in different cell contextsJ. [score:1]
[1 to 20 of 2 sentences]
83
[+] score: 9
Moreover, our miR expression data (Fig. 1d) confirm the findings of Xie (2009) [56] and Knelangen [57] that miR-221 and miR-125b-5p are down-regulated during differentiation of 3T3-L1 cells, whereas miR-103 and miR-146b are up-regulated. [score:9]
[1 to 20 of 1 sentences]
84
[+] score: 9
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
On the other hand, the top upregulated miRNAs at the OP3-OL transition included miRNAs (miR-181a, miR-181b, miR-125b, and miR-184) that are associated with decreased proliferation in maturing CNS cells and decreased malignancy in glioma stem cells [49], [50], [51], [52], [53], [54], [55]. [score:4]
Brain research 55 Henson B Bhattacharjee S O'Dee D Feingold E Gollin S 2009 Decreased expression of miR-125b and miR-100 in oral cancer cells contributes to malignancy. [score:3]
European Journal of Cancer 54 Shi L Zhang J Pan T Zhou J Gong W 2009 MiR-125b is critical for the suppression of human U251 glioma stem cell proliferation. [score:2]
[1 to 20 of 3 sentences]
85
[+] score: 9
For example, sma-miR125b, an abundant miRNAs in schistosome vesicles, has >600 potential human targets based on a conserved 8-mer seed region of the mature miRNA. [score:3]
Five highly abundant schistosome-derived miRNA sequences (Sma-Bantam, Sma-miR-71a, Sma-miR-36-3p, Sma-miR-125a and Sma-miR-125b) were selected for PCR amplification. [score:1]
Some, however, are present at the same or even higher levels; two of the more abundant miRNAs, sma-miR-71a and sma-miR-125b, were both present at about the same level in the two samples, and other miRNAs, such as sma-bantam and sma-miR-36-3P, were moderately enriched in vesicles. [score:1]
RNA was extracted from the purified exosomes and then used for amplification of four S. mansoni miRNAs (Sma-mir-125a, Sma-mir-125b, Sma-mir-71a, Sma-bantam) by qRT-PCR. [score:1]
In contrast, the stem-loop TaqMan probe method was able to specifically detect sma-miR-125a, sma-miR-125b, sma-bantam, sma- miR-71a (Fig.   5). [score:1]
It was also noted that the level of some miRNAs, in particular sma-miR125b, showed a broad variation in the level of miRNA found in the ELVs isolated from the serum of individual mice. [score:1]
This was particularly notable for sma-miRNA-125b (Fig.   5). [score:1]
[1 to 20 of 7 sentences]
86
[+] score: 9
A significant down-regulation in miR-125a-5p and miR-125b was observed in malignant and aggressive breast cancer tissues [42]. [score:4]
MicroRNAs miR-125a and miR-125b constitutively activate the NF-kappaB pathway by targeting the tumor necrosis factor alpha -induced protein 3 (TNFAIP3, A20). [score:3]
MiR-125 play important roles in development and cell differentiation [41]. [score:1]
MiR-125 is a group of miRNA family, whose members include miR-125a-5p and miR-125b etc. [score:1]
[1 to 20 of 4 sentences]
87
[+] score: 9
In agreement with this notion, a recent study demonstrated that overexpression of the microRNA miR-125b inhibits proliferation of CD133 [+] GBM cells in vitro, by targeting E2F2 transcripts, and that such effect on in vitro proliferation is rescued by overexpression of E2F2 (25). [score:9]
[1 to 20 of 1 sentences]
88
[+] score: 9
Other miRNAs from this paper: hsa-mir-125b-1, hsa-mir-125b-2, mmu-mir-125b-1
Indeed, NRIP1 is a target gene of microRNA-125b (miR-125b), which has been found to be underexpressed in ductal carcinomas [15]. [score:5]
Thus, NRIP1 overexpression in breast cancers might also be related to the dysregulation of miR-125b. [score:4]
[1 to 20 of 2 sentences]
89
[+] score: 9
Hierarchical clustering analysis revealed several groups of microRNAs that exhibit similar expression patterns, including a 9-microRNA group (mmu-miR-152, mmu-miR-365, mmu-let-7d*, mmu-miR-125a-5p, mmu-miR-181d, mmu-miR-99a, mmu-miR-100, mmu-miR-30c, mmu-miR-125b-5p, named as cluster X in Figure 1A ) which was down-regulated during the early phase of wound healing (day 1) as compared to unwounded skin (day 0), and returned to basal level during the later phase of wound healing (day 5) (Table 1 ). [score:5]
A 9-microRNA cluster (mmu-miR-152, mmu-miR-365, mmu-let-7d*, mmu-miR-125a-5p, mmu-miR-181d, mmu-miR-99a, mmu-miR-100, mmu-miR-30c, mmu-miR-125b-5p, which exhibited statistical significant down-regulation on day 1 and returned to basal level on day 5) was named as cluster X (marked by solid bar on the right). [score:4]
[1 to 20 of 2 sentences]
90
[+] score: 9
In this work, microRNAs, which may target VEGF, were predicted and among them, both microRNA-125a-5p and miR-125b-5p have been linked in inhibiting endothelin-1 expression in vascular endothelial cells [35]. [score:7]
Levels of five other microRNAs, especially those of miR-125b-5p and miR-34a-5p, were significantly low in patient circulation (Fig. 2). [score:1]
Moreover, levels of miR-342-3p, miR-125b-5p, miR-34a-5p, miR-103a-3p, and miR-125a-5p were even reduced significantly in patient circulation (Fig. 2D). [score:1]
[1 to 20 of 3 sentences]
91
[+] score: 9
In mouse ST2 MSCs, miR-125b inhibited osteoblast differentiation while miR-133 and miR-135 directly targeted Runx2 and Smad5 production, inhibiting the commitment of C2C12 MSCs into bone precursor cells [14], [15]. [score:8]
Although it has been reported that a number of miRNAs, miR-204/211 [13], miR-125b [14], miR-133 and miR-135 [15], miR-141 and miR-200a [16], and miR-29b [17], were involved in osteoblastic differentiation, a few papers have been reported with regard to the functions of miR-10a, miR-10b, miR-9-3p and miR-19b. [score:1]
[1 to 20 of 2 sentences]
92
[+] score: 9
Ectopic expression of miR-29a (Han et al., 2010) and enforced expression of miR-125b in hematopoietic stem cells (HSCs) led to a myeloproliferative disorder which progressed to AML (O’Connell et al., 2010a; Chaudhuri et al., 2012). [score:5]
Oncomir miR-125b regulates hematopoiesis by targeting the gene Lin28A. [score:4]
[1 to 20 of 2 sentences]
93
[+] score: 9
For example, miR-223 is reported to be expressed in myeloid cells [7, 23]; miR-125 and 128 are highly expressed in the brain [13, 14]; and miR-16 is expressed in a wide variety of tissues [7, 14, 23] (see also heat map of expression in Figure 5a). [score:9]
[1 to 20 of 1 sentences]
94
[+] score: 8
Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42]. [score:8]
[1 to 20 of 1 sentences]
95
[+] score: 8
Bai S, Tian B, Li A, MicroRNA-125b promotes tumor growth and suppresses apoptosis by targeting DRAM2 in retinoblastoma. [score:4]
There are previous reports of the involvement of miRNAs in retinal development, function, and photoreceptors survival 1, 2 and also the involvement of different miRNAs in the pathogenesis of various diseases of the retina including miR-9, miR-34a, miR-125b, and miR-155 in macular degeneration, 17, 18 miR-146a and miR-195 in diabetic retinopathy, 19, 20 and miR-125a and miR-17 in retinoblastoma. [score:4]
[1 to 20 of 2 sentences]
96
[+] score: 8
In cerebellar development, VEGF is co-expressed with late-expressed miR-125, whereas E-cadherin and P21 are either not significantly changed or are co-expressed with late miR-9 and miR-22, respectively, in another series (personal communication with J. M. Lee). [score:8]
[1 to 20 of 1 sentences]
97
[+] score: 8
On the other hand, the lipomannan from the non-pathogenic M. smegmatis fails to affect the mIR-125b expression, and instead, the host miRNA response is characterized by the induction the mIR-155 expression, which enhances TNFα mRNA half-life and translation, resulting in a stronger microbiocidal outcome (Rajaram et al., 2011). [score:5]
Mycobacterium tuberculosis lipomannan blocks TNF biosynthesis by regulating macrophage MAPK-activated protein kinase 2 (MK2) and microRNA miR-125b. [score:2]
In particular, the regulatory effect on pro-inflammatory cytokine production via the mIR-125b/mIR-155 axis represents the best described strategy of how Mtb subverts host immunity and potentially enhances its virulence. [score:1]
[1 to 20 of 3 sentences]
98
[+] score: 8
In contrast, miR-125b is downregulated in LPS -treated macrophages for inhibiting TNFα expression [48]. [score:8]
[1 to 20 of 1 sentences]
99
[+] score: 8
Other miRNAs from this paper: hsa-mir-125b-1, hsa-mir-125b-2, mmu-mir-125b-1
As a consequence, there is an increased miR125b expression in keratinocytes, inducing differentiation and proliferation defects through suppression of targets, p63 and Notch1 [23], regulatory signaling components essential for the control of keratinocyte proliferation and differentiation. [score:8]
[1 to 20 of 1 sentences]
100
[+] score: 8
For example, stcl and Podxl were predicted to be targeted by several inversely regulated miRNAs including mmu-miR-125b-5p, mmu-miR-300-3p, mmu-miR-199a-5p, mmu-miR-199a-5p, mmu-miR-199b-5p, and mmu-miR-214b-5p (Figure 8). [score:4]
Mmu-miR-125b-5p, mmu-miR-34c-5p, mmu-miR-199b-5p, mmu-miR-379-5p, and mmu-miR-127-3p were increased in expression in Sca1 [+]CD31 [−] cells compared to Sca1 [+]CD31 [+] cells. [score:2]
Mmu-miR-322-3p/5p, mmu-miR-155-5p, mmu-miR-204-5p, mmu-miR-10a-5p, and mmu-miR-125b-5p participated in cell differentiation, cell cycle, and stem cell differentiation (Figure 3). [score:1]
The miRNAs were mmu-miR-125b-5p, mmu-miR-34c-5p, mmu-miR-199b-5p, mmu-miR-379-5p, mmu-miR-127-3p, mmu-miR-322-5p, mmu-miR-20a-5p, mmu-miR-15a-5p, mmu-miR-503-3p, and mmu-miR-204-5p. [score:1]
[1 to 20 of 4 sentences]