sort by

178 publications mentioning mmu-mir-132 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-132. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 410
Other miRNAs from this paper: mmu-let-7b
Tat uptake into neurons induces miR-132 expression through CREB phosphorylation, down-regulates MecP2 and BDNF expression in neurons, and impairs neurite outgrowth and neuron survival; alternatively, Tat expression in astrocytes resulting from HIV-1 infection or Tat uptake into astrocytes induces miR-132 expression through CREB phosphorylation and down-regulates BDNF expression. [score:17]
With miR-132 inhibitor expression, we were able to conclude that overexpression of miR-132 was responsible for neurite shortening in neurons treated with exosomes from Tat -expressing astrocytes (Fig.   10a), as antagonizing miR-132 improved neurite lengths even in presence of Tat-containing exosomes. [score:9]
Tat significantly induced miR-132 expression, ensuing down-regulation of miR-132 target genes in astrocytes and neurons. [score:8]
miR-132 plays a crucial role in the development of neurons by regulating two targets in charge of controlling neurite outgrowth: MecP2, which is a potentiating factor of neurite growth, and p250GAP, which inhibits the outgrowth of neurites [27, 106]. [score:7]
Thus, we determined whether Tat expression altered expression of those miR-132 target genes MecP2, p250GAP, and BDNF. [score:7]
In fact, the studies that discovered p250GAP as a target of miR-132 only found repression of this target in immature neurons [84] and showed that miR-132 overexpression led to the enhancement of neurite outgrowth due to the repression of p250GAP. [score:7]
Then, we determined the relationship between Tat expression and miR-132 target gene expression in primary mouse astrocytes from WT or iTat mice. [score:7]
Tat expression down-modulated expression of miR-132 target genes. [score:7]
Alternatively, Tat-impaired neurite outgrowth results from HIV-1 infection and Tat expression in astrocytes, pCREB, miR-132 induction, and BDNF down-regulation. [score:6]
To discern the direct detrimental effects of Tat on neurons from miR-132 overexpression, we employed synthetic miR-132 inhibitor in our experiments. [score:6]
The question is then which direction miR-132 expression takes the neurons in regard to neurite growth while this microRNA represses both an enhancer and an inhibitor of neurite outgrowth. [score:6]
miR-132 induction in astrocytes leads to increased miR-132 release into exosomes from astrocytes, uptake of exosome -associated miR-132 into neurons, and down-regulation of MecP2 and BDNF expression in neurons and impairs neurite outgrowth and neuron survival. [score:6]
Fig. 2Effects of Tat expression on miR-132 targets in astrocytes. [score:5]
The data were representative of three independent experiments To determine the effects of Tat on miR-132 expression, we first expressed Tat in human astrocytoma cells U373. [score:5]
To ascertain Tat -induced miR-132 expression, we took advantage of the doxycycline (Dox)-inducible astrocyte-specific Tat-transgenic mice (iTat) [40, 57], in which Tat expression level and resulting neuropathologies following doxycycline treatment are comparable to those in the brain of HIV-infected subjects. [score:5]
Tat basic domain deletion mutant and miR-132 mimic and inhibitor were used to determine the specificity of the relationship between Tat and miR-132 and its effects on astrocytes and neurons and the underlying mechanisms of Tat -induced miR-132 expression. [score:5]
Fig. 3 Effects of Tat expression on miR-132 targets in neurons. [score:5]
BDNF transcription is directly controlled by MecP2, and therefore, BDNF is an indirect target of miR-132. [score:5]
Although miR-132 inhibitor expression consistently negated the Tat -induced down-modulation of MecP2 in astrocytes (Fig.   2a, d) and neurons (Fig.   3), its effects on rescuing BDNF levels were not consistent across cell types. [score:5]
The data were representative of three independent experimentsWe also assessed the protein levels of miR-132 targets in relation to Tat, miR-132m, and miR-132i expression in SH-SY5Y. [score:5]
Fig. 6Effects of miR-132 induction on GFAP expression, cytokine/chemokine expression, and astrocyte survival. [score:5]
Both Tat and miR-132 expression led to a lower level of MecP2 and BDNF protein expression in PHA (Fig.   2a). [score:5]
Brain-derived neurotrophic factor (BDNF) is directly and positively regulated at the transcription level by MecP2 and thus can be considered an indirect target of miR-132 [31, 32]. [score:5]
Tat expression and HIV infection -induced miR-132 expression in astrocytes and neurons. [score:5]
qRT-PCR and were performed to determine Tat effects on expression of miR-132 target genes methyl CpG -binding protein 2, Rho GTPase activator p250GAP, and brain-derived neurotrophic factor. [score:5]
Notably, dysregulation of miR-132 has been reported in a number of psychiatric, neurodevelopmental, and neurodegenerative diseases [33– 35]. [score:5]
The relationship between Tat expression and miR-132 expression was first determined using reverse transcription quantitative PCR (qRT-PCR) in Tat -transfected astrocytes and neurons, astrocytes from Tat-transgenic mice, and HIV-infected astrocytes. [score:5]
The data were representative of three independent experiments We also assessed the protein levels of miR-132 targets in relation to Tat, miR-132m, and miR-132i expression in SH-SY5Y. [score:5]
” To determine the effects of Tat on miR-132 expression, we first expressed Tat in human astrocytoma cells U373. [score:5]
Taken together, these results indicate that Tat expression resulted in down-modulation of miR-132 target genes through miR-132 induction. [score:5]
MAP-2 protein levels were consistent with the miR-132 -dependent reduction in neurite lengths by Tat and increase in neurite lengths by miR-132 inhibition despite of Tat expression. [score:5]
Tat -induced miR-132 expression contributed to Tat direct neurotoxicity. [score:4]
Tat impairs neurite outgrowth through its uptake into neurons, CREB phosphorylation (pCREB), miR-132 induction, and MecP2 and BDNF down-regulation. [score:4]
In addition, BDNF down-regulation in astrocytes deprives neurons of BDNF, which further impairs neurite outgrowth and neuron survival In this study, we report for the first time the induction of miR-132 by Tat and its contribution to Tat -induced neurite shortening and neurotoxicity. [score:4]
Antagonizing miR-132 in presence of Tat rescues MecP2 levels as the direct target of miR-132. [score:4]
We showed that HIV-1 Tat protein significantly up-regulated miR-132 in astrocytes and neurons (Fig.   1). [score:4]
Outside the CNS, miR-132 has been shown to be highly up-regulated in HIV-infected CD4 [+] T cells [36]. [score:4]
Tat -induced miR-132 expression contributes to both direct and astrocyte -mediated Tat neurotoxicity and supports the important roles of miR-132 in controlling neurite outgrowth. [score:4]
Improper timing or duration of miR-132 expression has been shown to be neurotoxic, indicating the delicate balance in the regulation of this axis [122]. [score:4]
Considering the significance of exosomal glia-neuron communications [94] and the direct link between the miRNA processing pathway and exosomal biogenesis [95], we determined the miR-132 content of Tat -expressing astrocyte exosomes. [score:4]
This major target of miR-132 in the CNS has been found to be dysregulated in HAND [112]. [score:4]
miR-132 induction in astrocytes increases exosome -associated miR-132 release from astrocytes, uptake of exosome -associated miR-132 into neurons, and MecP2 and BDNF down-regulation of MecP2 in neurons. [score:4]
As a target of miR-132, MecP2 is ultimately repressed, leading to the repression of BDNF due to the negative regulatory feedback nature of this axis. [score:4]
In this study, we used a combined molecular, cellular, and genetic approach and determined the direct relationship between Tat and miR-132 expression and its possible contribution to Tat -induced changes in neurite outgrowth and synapse formation. [score:4]
This might in part be due to the well-documented activity -dependent nature of miR-132 expression in neurons which happens rapidly and in a transient fashion [97]. [score:3]
Thus, we determined the possibility of the involvement of CREB phosphorylation in Tat -induced miR-132 expression. [score:3]
Correspondingly, the miR-132 level in exosomes from Tat -expressing astrocytes shows significant increase and leads to neurite shortening and neurotoxicity following uptake in neurons. [score:3]
In addition to MecP2 and BDNF, the protein level of p250GAP, a neuron-specific target of miR-132, was analyzed. [score:3]
We also show that Tat -induced miR-132 leads to the repression of MecP2 and BDNF, known targets of miR-132 in the brain. [score:3]
ΔBD Basic domain- deleted Tat mutant BDNF Brain-derived neurotrophic factor cART Combination antiretroviral therapy CNS Central nervous system CREB cAMP response element -binding protein pCREB Phosphorylated CREB Dox Doxycycline GFAP Glial fibrillary acidic protein HAD HIV-1 -associated dementia HAND HIV -associated neurocognitive disorders HIV-1 Human immunodeficiency virus type 1 iTat Dox-inducible astrocyte-specific Tat-transgenic mouse LDH Lactate dehydrogenase MAP-2 Microtubule -associated protein 2 MCMD Minor cognitive and motor disorder MecP2 Methyl CpG -binding protein miR (miRNA) microRNA miR-132 microRNA-132 miR-132i miR-132 inhibitor miR-132m miR-132 mimic p250GAP Rho GTPase-activating protein 32 PHA Primary human astrocytes PSD-95 Postsynaptic density protein 95 SYP Synaptophysin Tat Transactivator of transcription WT Wild-type Not applicable. [score:3]
MG and human neuroblastoma SH-SY5Y and determined miR-132 expression in those cells. [score:3]
Fig. 9Effects of Tat expression and exosomal miR-132 induction on neurite outgrowth. [score:3]
Involvement of CREB phosphorylation and Tat basic domain in Tat -induced miR-132 expression. [score:3]
HMI0190, mature sequence ACCGUGGCUUUCGAUUGUUACU) and miR-132 inhibitor (Mission microRNA, hsa-miR-132, Cat. [score:3]
The data were representative of three independent experimentsThen, to determine the role of CREB phosphorylation in Tat -induced miR-132 expression, PHA and SH-SY5Y were transfected with Tat, along with miR-132m or miR-132i. [score:3]
The data were representative of three independent experiments Fig. 11Effects of Tat expression and exosomal miR-132 induction on synaptic formation. [score:3]
Tat expression significantly induced miR-132 level in U373. [score:3]
The images were representative of three independent experiments Fig. 12Changes of SYP and PSD-95 expression by Tat and exosomal miR-132. [score:3]
The data were analyzed using one-tailed Student’s t test, and the comparisons were made between the C3 control and Tat As mentioned above, the mRNA targets of miR-132 within the CNS include MecP2 and p250GAP. [score:3]
Fig. 5CREB phosphorylation and miR132 expression. [score:3]
We confirmed that miR-132 inhibitor transfection efficiently antagonized miR-132 (data not shown). [score:3]
Myc, miR-132 mimic (miR-132m), and/or miR-132 inhibitor (miR-132i), cultured for 48 h and harvested for cell lysates, followed by (a), or RNA isolation, followed by qRT-PCR for MecP2 (b) and BDNF (c). [score:3]
The data were representative of three independent experiments Then, to determine the role of CREB phosphorylation in Tat -induced miR-132 expression, PHA and SH-SY5Y were transfected with Tat, along with miR-132m or miR-132i. [score:3]
Myc plasmid (Tat) or the cloning vehicle pcDNA3 (C3) and cultured for 48 h and harvested for RNA extraction, followed by qRT-PCR for miR-132 level (upper panels), or cell lysates, followed by for Tat expression using an anti-C-MYC antibody (lower panels). [score:3]
Taken together, these results suggest that miR-132 induction is unlikely involved in Tat -induced astrocyte activation and that Tat expression itself does not affect astrocyte survival. [score:3]
Next, we determined whether miR-132 induction was involved in Tat -induced GFAP, CCL-2, IL-6, and TNF-α expression. [score:3]
For miRNA transfection, cells were plated and cultured in a 24-well plate and transfected with miR-132 mimic (5 nM/well) and miR-132 inhibitor (50 nM/well) using Lipofectamine 2000 (Invitrogen). [score:3]
We showed the CREB-responsive miR-132 expression through the phosphorylation of CREB by Tat (Fig.   5). [score:3]
Thus, we first determined whether Tat -induced miR-132 expression would lead to increased miR-132 in astrocyte-derived exosomes. [score:3]
Studies performed on adult neurons, however, showed the complete opposite; overexpressing miR-132 in adult neurons leads to a significant decrease in dendritic growth [108], which is due to MecP2 repression. [score:3]
These results together suggest that CREB phosphorylation and Tat basic domain are likely involved in Tat -induced miR-132 expression. [score:3]
miR-132i expression significantly decreased Tat -induced miR-132 packaging into the exosomes from astrocytes, further supporting the notion that miR-132 is sorted into the exosomes. [score:3]
Deletion of Tat basic domain (ΔBD) completely abrogated Tat -induced CREB phosphorylation and miR-132 expression. [score:3]
Antagonizing miR-132 expression also led to reduced exosomal levels of miR-132 (Fig.   8a). [score:3]
These results show that miR-132 was significantly induced in Tat -expressing astrocytes and neurons and HIV-infected astrocytes. [score:3]
Next, we showed that miR-132 overexpression was at least in part responsible for Tat neurotoxicity (Fig.   7). [score:3]
Myc, miR-132 mimic (miR-132m), and/or miR-132 inhibitor (miR-132i), cultured for 48 h and harvested for cell lysates, followed by. [score:3]
MG and primary human astrocytes (PHA) were infected with VSV-G-pseudotyped HIV (+), cultured for 3 days and harvested for RNA extraction, followed by qRT-PCR for miR-132 level or cell lysates, followed by for p24 expression using an anti-p24 antibody. [score:3]
However, lack of consistency between the effects of miR-132 inhibition on the two proteins and reduction in protein levels of neurons treated with WT exosomes prevent us from concluding that miR-132 affected synaptic protein levels or synapse formation. [score:3]
Tat expression led to increased miR-132 level in astrocyte-derived exosomes. [score:3]
Tat expression led to phosphorylation of CREB (Fig.   4a) and miR-132 induction (Fig.   4b). [score:3]
To further determine whether Tat -induced down-modulation of MecP2 and BDNF was mediated through miR-132, we included miR-132 inhibitor (miR-132i) in the experiments. [score:3]
Compared to the C3 control, increased miR-132 was detected in exosomes derived from Tat -expressing cells (Fig.   8a). [score:2]
miR-132 level was normalized to snRNA U6 level and expressed as fold changes compared to the control. [score:2]
Following Tat expression, however, astrocytes showed significantly higher fold changes in miR-132 compared to neurons. [score:2]
These results confirm that Tat has direct neurotoxic activity and suggest that miR-132 induction could contribute to Tat neurotoxicity. [score:2]
In this study, we aimed to determine the molecular mechanisms of Tat -induced neurite shortening, specifically the roles of miR-132, an important regulator of neurite morphogenesis in this process. [score:2]
We found significant levels of miR-132 in exosomes from these astrocytes which were taken up by neurons (Fig.   8) and resulted in neurite shortening (Fig.   9 and 10) but were not directly involved in reduction of synaptic protein levels by Tat (Figs.   11 and 12). [score:2]
In this study, we first determined the potential of Tat in the induction of miR-132, a brain-enriched microRNA with substantial roles in the regulation of synaptodendritic plasticity. [score:2]
miRNA-132 induction had no effects on astrocyte activation or survival but was involved in the direct neurotoxicity of Tat. [score:2]
In fact, an axis of regulation exists in the brain involving BDNF, miR-132, and MecP2 [29], in which BDNF induces miR-132 through phosphorylation of CREB [120, 121]. [score:2]
These results showed that Tat -induced miR-132 in astrocytes adversely affected neurite outgrowth and contributed to astrocyte -mediated Tat neurotoxicity. [score:1]
Exosomal miR-132 was normalized to let-7b. [score:1]
The primary sequence, the seed region, and the gene structure of miR-132 are well conserved between humans and mice [27]. [score:1]
Synthetic miR-132 mimic (Mission microRNA hsa-miR-132, Cat. [score:1]
Therefore, it has been suggested that miR-132 may affect the strength of excitatory synapses [127]. [score:1]
Similarly, we also showed that exosomal miR-132 contributes to neurotoxicity (Fig.   9b). [score:1]
These results show that Tat -induced miR-132 is packaged into astrocyte-derived exosomes, which can be taken up by neurons. [score:1]
Fig. 8Exosomal miR-132 and its transfer to neurons. [score:1]
miR-132 mimic (miR-132m) was included as a control. [score:1]
Among those is miR-132. [score:1]
RNA was isolated from exosomes and analyzed for qRT-PCR for miRNA-132 level (a). [score:1]
CREB phosphorylation also promotes the binding of phosphorylated CREB to CBP, which leads to the transactivation of the miR-132 loci containing CREB-responsive elements [98]. [score:1]
We ruled out the possibility of miR-132 involvement in Tat activation of astrocytes (Fig.   6). [score:1]
miR-132 labeling was performed using a Mirus Label IT miRNA Cy [3] Kit (Madison, WI) according to the manufacturer’s protocol. [score:1]
His) plasmid, cultured for 48 h and harvested for cell lysates, followed by (a), or RNA isolation, followed by qRT-PCR for miR-132 level (b). [score:1]
C3 was used as the control, and snRNA U6 was used to normalize miR-132 level. [score:1]
data from these neurons also showed consistent reduction in both SYP and PSD-95, and although there was no change in PSD-95 with miR-132i, SYP levels showed improvement with reduced exosomal miR-132 (Fig.   12b). [score:1]
b Primary astrocytes were isolated from wild-type (WT) mice and doxycycline (Dox)-inducible and astrocyte-specific HIV Tat-transgenic mice (iTat), cultured in the presence of 5 mg/ml Dox (+) or in the absence of Dox (−) for 48 h and harvested for RNA isolation, followed by qRT-PCR for miR-132 level (upper panel) or semi-quantitative RT-PCR for Tat (lower panel). [score:1]
Our data showed complete abrogation of CREB phosphorylation and lack of miR-132 induction following transfection with basic domain- deleted Tat (Fig.   4a, b), further supporting Tat effects on CREB phosphorylation and the requirement of Tat basic domain for this effect. [score:1]
Moreover, reducing miR-132 levels in exosomes did not change the significant loss of these proteins (Figs.   11a, b and 12a). [score:1]
Astrocyte-derived miR-132 shortened neurites. [score:1]
Next, we determined whether miR-132 was induced in astrocytes in the context of HIV infection. [score:1]
These findings raise the possibility that miR-132 plays important roles in HIV infection and pathogenesis in the CNS. [score:1]
The Western blots and the flow cytometry histograms were representative of three independent experiments We next sought to determine whether transfer of exosome -associated miR-132 from astrocytes to neurons would affect the morphology of neuron dendrites and formation of synapse. [score:1]
miR-132 was present in astrocyte-derived exosomes and was taken up by neurons, causing neurite shortening. [score:1]
The images were representative of three independent experiments Fig. 10Changes of neurite lengths and neuron survival by Tat and exosomal miR-132. [score:1]
We then demonstrated that miR-132 induction was likely due to the ability of Tat to induce phosphorylation of CREB (Fig.   5) and subsequent binding of phosphorylated CREB to CREB-responsive elements within the transcriptional control locus of miR-132 [84]. [score:1]
miR-132 induction did not contribute to Tat -induced astrocyte activation. [score:1]
miR-132 was significantly induced in Dox -treated astrocytes derived from iTat mice but not in other astrocytes (Fig.   1b). [score:1]
The results show that Tat induces miR-132 by activating CREB, the transcriptional control locus of miR-132. [score:1]
The data (b, d, e) were mean ± SD of triplicates and representative of three independent experiments To determine whether Tat -induced miR-132 contributed to Tat direct neurotoxicity, SH-SY5Y were transfected with Tat and miR-132i and assayed for the LDH release from those cells. [score:1]
To determine whether miR-132 in the form of exosomes could be transferred from astrocytes to neurons, we labeled miR-132m with Cy [3] and transfected it into U373. [score:1]
Fig. 7Role of miR-132 induction in Tat neurotoxicity. [score:1]
miR-132 induction was associated with phosphorylation of cAMP response element -binding protein and required the basic domain of Tat. [score:1]
miR-132 levels were normalized to snRNA U6 (cells), or let-7b (exosomes) [72], calculated as fold change based on the 2 [-ddCT] method, and expressed in log [10] values. [score:1]
HIV-1 Tat miR-132 MeCP2 BDNF p250GAP Neurite outgrowth Neurotoxicity Human immunodeficiency virus type 1 (HIV-1) enters the central nervous system (CNS) during the acute phase of the infection and results in the production of viral proteins and activation of microglia/macrophages and eventually injury to neurons [1, 2]. [score:1]
miR-132 has been shown to increase the width of dendritic spines, which are storage sites for post synaptic density, contain glutamate receptors, and increase the contact points between neurons [108]. [score:1]
miR-132 is one of the best defined miRNA in the CNS, and its roles in dendrite morphology and synapse function have been characterized [26, 27], through two extensively studied miR-132 target genes in dendrites: Rho GTPase activator p250GAP [28] and methyl CpG -binding protein 2 (MecP2) [29, 30]. [score:1]
[1 to 20 of 129 sentences]
2
[+] score: 404
In our microarray analysis of PC12 cells, knockdown of miR-132 results in the upregulation of 335 and downregulation of 224 genes. [score:8]
To see if there was a pattern to the transcriptional changes elicited by miR-132 knockdown, we focused on the set of upregulated genes that would be expected to include genes directly targeted by miR-132. [score:8]
Thus to examine the synaptic phenotype of miR-132 knockdown more directly, we co -injected a mCherry -expressing control retrovirus (redRubi) and the EGFP -expressing miR-132 sponge virus. [score:7]
Infection of the inverse reporter cell line with the retrovirus overexpressing miR-132 resulted in a loss of mCherry expression in infected cells (Fig. 1c, upper row), but did not alter mCherry expression in the reporter control cell line (Fig. 1c. [score:7]
For example, overexpression of the miR-132 target, GTPase activating protein (p250GAP), mimicked the in vitro effects of miR-132 knockdown on spine formation and synapse function [16], [17], [18]. [score:6]
By 21 DPI (bottom row), mCherry showed higher expression in cells expressing inverse reporter+sponge compared to inverse reporter alone, consistent with lower levels of miR-132 in sponge -expressing cells. [score:6]
Further, IL-6 expression was increased at 21 days post-infection for granule neurons expressing the miR-132 sponge compared to control neurons expressing only mCherry (Fig. 8c). [score:6]
0019077.g007 Figure 7 a, We injected equal titers of the mCherry expressing control retrovirus (redRubi) and the EGFP expressing miR-132 sponge retrovirus (miR-132sp) in vivo, which resulted in the labeling of control granule cells (red) situated in close proximity to miR-132 knockdown cells (green), as shown for a brain slice on the electrophysiology set-up. [score:6]
a, We injected equal titers of the mCherry expressing control retrovirus (redRubi) and the EGFP expressing miR-132 sponge retrovirus (miR-132sp) in vivo, which resulted in the labeling of control granule cells (red) situated in close proximity to miR-132 knockdown cells (green), as shown for a brain slice on the electrophysiology set-up. [score:6]
miR-132 Knockdown Correlates to Increased Expression of Molecules Regulated by Immune Signaling Pathways. [score:5]
c, Infection of PC12 cells with the miR-132 sponge resulted in a 32% reduction in miR-132 expression, but did not reduce the expression of miRs-187, 218, 301, or 212 (p>0.3; ANOVA with Tukey post-hoc). [score:5]
Spontaneous excitatory postsynaptic currents (sEPSCs) were recorded in voltage-clamped (Vh = −70 mV) granule cells labeled with a retrovirus expressing mCherry at 21DPI (control, black trace) or in granule cells expressing miR-132 sponge and GFP (green trace). [score:5]
e,f, In NeuN immunopositive mature granule cells (green), there was virtually no overlap with expression of the miR-132 inverse reporter (red), whereas the control was expressed in numerous mature granule cells. [score:5]
The miR-132 expression virus resulted in a 5.5±1.9 fold increase in miR-132 expression (p<0.02 ANOVA with Tukey post-hoc test; n = 2 cultures per condition). [score:5]
This inverse reporter design results in suppression of mCherry expression in the presence of miR-132. [score:5]
To determine if the inverse reporter was sensitive to miR-132 expression we constructed a lentivirus and a retrovirus that expresses EGFP and mature miR-132. [score:5]
d, We co -injected equal titers of the GFP -expressing FUGW virus and either the mCherry -expressing miR-132 inverse reporter virus or the reporter control virus into 8 week old mice. [score:5]
An exhaustive identification of direct miR-132 targets will improve our understanding of the mechanisms by which miR-132 regulates neuronal function. [score:5]
Retroviral -mediated miR-132 sponge expression attenuated the endogenous onset of miR-132 expression during adult neurogenesis, and markedly decreased dendritic spine density and functional synaptic activity. [score:5]
In contrast to the EGFP virus (FUGW, Fig. 1d, left panel, upper row), the expression of the miR-132 inverse reporter, as detected by mCherry expression (Fig. 1d, center panel, upper row), was limited to cells along the subgranular zone of the dentate gyrus. [score:5]
Infection of a proportion of the cells with a miR-132 -expressing retrovirus (green) suppressed mCherry in the inverse reporter cells (black silhouettes in red panel, top row), but not in inverse reporter control cells (red panel, bottom row). [score:5]
To determine the effect of miR-132 induction on a target, we measured mCherry expression in a monoclonal PC12 cell-line expressing the miR-132 inverse reporter. [score:5]
To test for off-target effects of the sponge on other microRNAs, we determined the microRNA expression profile of HEK293 cells infected with the miR-132 sponge. [score:5]
The incomplete knockdown by the sponge presumably reflects an imbalance between the endogenous levels of miR-132 and the number of targets introduced [28]. [score:4]
To determine the ensemble of genes affected by knockdown of miR-132 we performed a microarray analysis in PC12 (ATCC) cells expressing the miR-132 sponge. [score:4]
Another miR-132 target, MeCP2, has been postulated to form a regulatory feedback system guiding synaptic maturation [42]. [score:4]
The pattern of miR-132 expression we observed is consistent with a role for miR-132 in the maturation of neurons during development as well as for newborn neurons in the adult. [score:4]
The timing of expression, and the impact of knockdown on excitatory synapse formation, indicates that miR-132 coordinates an instructive transcriptional program that is necessary for the integration of newborn neurons into the adult central nervous system. [score:4]
To address whether the CREB-regulated miR-132 [16], [17], [18] influences the functional integration of newborn neurons into the adult dentate gyrus in vivo, we developed a set of novel tools to examine its expression and function. [score:4]
To make a ‘sponge’ vector for miR knockdown, the retroviral miR-132 inverse reporter+U6 sponge was constructed by adding four additional perfect miR-132 targets downstream of the U6 promoter. [score:4]
To test the functional role of miR-132, we designed a retrovirus to knockdown its expression. [score:4]
The sponge prevented the NGF -induced increase in miR-132 levels, and prevented the NGF -induced downregulation of the inverse reporter (Fig. 4a). [score:4]
a, We assessed the effects of miR-132 knockdown on the dendrites of newborn neurons using a retroviral miR-132 sponge (miR-132sp) with four perfect miR-132 targets downstream of the U6 promoter and with EGFP downstream of the ubiquitin promoter. [score:4]
The knockdown in our hands was efficacious in that the sponge doubled the expression of the inverse reporter, but it did not restore the inverse reporter to the levels seen in cells lacking miR-132. [score:4]
In contrast, the mCherry expressing miR-132 inverse reporter virus primarily labeled cells along the subgranular zone of the dentate gyrus (top row, middle panel). [score:3]
a, Functional grouping of genes that increased when miR-132 was knocked down indicated a significant enrichment in genes regulated by signaling pathways that are involved in immune function. [score:3]
We developed such an inverse fluorescent reporter to track miR-132 expression in vivo (Fig. 1). [score:3]
0019077.g001 Figure 1An Inverse Reporter for Detecting miR-132 Expression In Vivo. [score:3]
The results above indicate that miR-132 is expressed at the right time and in the right place to influence newborn neurons as they integrate into the adult hippocampal circuitry. [score:3]
To test the efficacy of the sponge we examined whether it altered miR-132 expression in rat PC12 cells. [score:3]
Using lenti- and retroviral delivery systems, we were able to show not only the pattern, but also the timing of expression of miR-132 in newborn neurons in the adult brain. [score:3]
a, We generated an inverse miR-132 reporter lentivirus by placing two perfectly complementary miR-132 target sequences (miR-132 MRE) downstream of mCherry driven by an internal ubiquitin promoter (pUbiquitin). [score:3]
As expected, NGF treatment significantly reduced mCherry expression and this reduction was blocked by the miR-132 sponge. [score:3]
Several miR-132 targets have been explored as possible mediators of a neuronal phenotype. [score:3]
We do not identify direct targets of miR-132, but characterize the overall effect that miR-132 knockdown produces at the cellular and molecular level. [score:3]
An Inverse Reporter for Detecting miR-132 Expression In Vivo. [score:3]
Two perfect miR-132 target sites with 100% homology to the mature miR sequence (indicated by capital letters below) or their reverse complement were then cloned into the EcoRI site downstream of mCherry by annealing and ligating the following oligos: 5′ aattc CGACCATGGCTGTAGACTGTTA ggcgcgcc CGACCATGGCTGTAGACTGTTA g 5′ aattc TAACAGTCTACAGCCATGGTCG ggcgcgcc TAACAGTCTACAGCCATGGTG g The top sequence was used to construct the inverse reporter and the reverse complement sequence was used as the reporter control as shown in Figure 1. A BstBI site was introduced into pSie [30] by ligating a linker into the BamHI/XbaI digested vector. [score:3]
Precursor cells obtained from nestin-GFP mice [19] showed very low expression of miR-132 whereas newborn neurons from POMC-GFP mice [20], or the cell fraction containing mature granule neurons (non-fluorescent cells sorted from the dentate gyrus of POMC-GFP animals) had increasing levels of miR-132 (Fig. 2h, left). [score:3]
We cloned four perfect miR-132 target sites downstream of the U6 promoter to sequester endogenous miR-132, and placed this cassette into the pRubi (Retrovirus with internal ubiquitin promoter; see methods) retroviral vector. [score:3]
b, To test the specificity of the sponge we examined the microRNA expression profile of HEK293 cells infected with the miR-132 sponge. [score:3]
Thus the immunohistochemical and real-time PCR profiling validate the pattern defined by the inverse reporter, indicating that miR-132 expression increases as granule neurons differentiate and mature. [score:3]
In neurons expressing the miR-132 sponge, the evoked EPSC was much smaller than in the control cell (63.2±11.9% reduction, n = 4, Fig. 7c,d), but there was no change in the paired-pulse ratio (PPR; Fig. 7e,f, 1.36±0.19, control; 1.32±0.19, sponge). [score:3]
As a reporter control we cloned the reverse complement of the miR-132 targets into the mCherry UTR (Fig. 1b). [score:3]
Thus to detect endogenous levels of miR-132 in vivo, we designed an inverse reporter whose expression was blocked by miR-132 activity. [score:3]
Two perfect miR-132 target sites with 100% homology to the mature miR sequence (indicated by capital letters below) or their reverse complement were then cloned into the EcoRI site downstream of mCherry by annealing and ligating the following oligos: 5′ aattc CGACCATGGCTGTAGACTGTTA ggcgcgcc CGACCATGGCTGTAGACTGTTA g 5′ aattc TAACAGTCTACAGCCATGGTCG ggcgcgcc TAACAGTCTACAGCCATGGTG g The top sequence was used to construct the inverse reporter and the reverse complement sequence was used as the reporter control as shown in Figure 1. pRubi (Retrovirus with internal ubiquitin promoter) and redRubiA BstBI site was introduced into pSie [30] by ligating a linker into the BamHI/XbaI digested vector. [score:3]
Our results indicate that miR-132 is expressed at basal levels of neuronal activity in vivo. [score:3]
Several microRNAs have been identified as putative CREB targets including miR-132 [13]. [score:3]
In neurons expressing the sponge, there was a decrease in dendritic spines and very little spontaneous excitatory activity indicating that miR-132 is necessary for robust excitatory synapse formation. [score:3]
However, cells expressing the sponge showed significantly greater fluorescence at 14 and 21 days post-injection (Fig. 3b, bottom right panel), indicating that the sponge reduced endogenous miR-132. [score:3]
As detected with a lentiviral reporter, miR-132 was first expressed after transient amplifying cells differentiate into neurons, and then increased further in mature granule cells. [score:3]
The miR-132 transcript was highest in mature neurons as supported by the expression of calbindin transcript, whereas the nestin transcript was highest in precursor cells. [score:3]
At 7 days post-injection, the expression of the sponge did not alter the fluorescence of the inverse reporter, consistent with the low levels of miR-132 in newborn neurons at this stage (Fig. 3b, top panels). [score:3]
b, The reporter control virus was generated by placing the reverse complement of the miR-132 target (RC miR-132 MRE) downstream of mCherry. [score:3]
As shown in Figure 2a,b, the majority of nestin -positive precursor cells showed the same level of expression of the inverse reporter as for the reporter control (74.1±8.1% inverse reporter; 67.5±11.9% control), indicating that miR-132 was low or absent in precursor cells. [score:3]
A recent report indicates that inhibition of miR-132 with a ‘sponge’ had little effect on dendritic spines in cultured neurons [37]. [score:3]
We confirmed the pattern of miR-132 expression detected by the inverse reporter by using real-time PCR from cell populations isolated by fluorescence-activated cell sorting (FACS). [score:3]
Increases in BDNF mRNA expression parallel the seizure -induced increase in miR-132 (data not shown). [score:3]
The EGFP virus had an identical ubiquitin promoter but lacked the miR-132 target sequences. [score:3]
Two perfect miR-132 target sites with 100% homology to the mature miR sequence (indicated by capital letters below) or their reverse complement were then cloned into the EcoRI site downstream of mCherry by annealing and ligating the following oligos: 5′ aattc CGACCATGGCTGTAGACTGTTA ggcgcgcc CGACCATGGCTGTAGACTGTTA g 5′ aattc TAACAGTCTACAGCCATGGTCG ggcgcgcc TAACAGTCTACAGCCATGGTG g The top sequence was used to construct the inverse reporter and the reverse complement sequence was used as the reporter control as shown in Figure 1. pRubi (Retrovirus with internal ubiquitin promoter) and redRubiA BstBI site was introduced into pSie [30] by ligating a linker into the BamHI/XbaI digested vector. [score:3]
0019077.g004 Figure 4To test the efficacy of the sponge we examined whether it altered miR-132 expression in rat PC12 cells. [score:3]
We generated a miR-132 inverse reporter by cloning two perfect miR-132 target sites in the 3′ UTR of mCherry in a lentiviral vector (Fig. 1a). [score:3]
a, Treatment of PC12 cells with NGF resulted in a 1.7 fold increase in mature miR-132 expression (p<. [score:3]
We selected HEK293 cells because they have a very low abundance of miR-132, thus limiting possible indirect effects on other microRNAs as a result of miR-132 knockdown. [score:3]
miR-132 is expressed in maturing neurons. [score:3]
c,d, In the subset of progenitor cells and newborn neurons labeled by doublecortin immunostaining (green), there were fewer doublecortin positive cells expressing the miR-132 inverse reporter than the control. [score:3]
miR-132 Expression Correlated with Maturation of Newborn Granule Neurons in the Adult Dentate Gyrus. [score:3]
HEK293 cells have a low abundance of miR-132, thus limiting the possibility of indirect effects due to miR-132 knockdown. [score:3]
a, The inverse reporter cassette was placed in a retroviral vector, and contained two perfect miR-132 target sequences (miR-132 MRE) downstream of mCherry driven by the ubiquitin promoter (pUbiquitin). [score:3]
A retrovirus expressing the miR-132 sponge and EGFP (Fig. 5a) resulted in brightly labeled cells suitable for electrophysiological and morphological analysis. [score:3]
Single cells were cultivated to generate clonal cell lines expressing the miR-132 inverse reporter (top row) or the inverse reporter control (bottom row). [score:3]
To determine the effectiveness of this U6 “sponge” in vivo, we co-expressed it with the miR-132 inverse reporter (Fig. 3a). [score:3]
We then stimulated the perforant path and made simultaneous recordings from control neurons and neighboring miR-132 sponge -expressing neurons (Fig. 7b). [score:3]
To determine whether genes identified in PC12 cells also were regulated by miR-132 knockdown in vivo, we used IL-6 as a test case because of its involvement in nervous system function [21]. [score:3]
To assess the validity of the approach, HEK293 (ATCC) cells were infected with these viruses, and individual cells were isolated to develop clonal cell lines expressing either the miR-132 inverse reporter or the reporter control. [score:3]
c, At 21 days post-injection miR-132 sponge expressing neurons (green) had an increase in IL-6 immunofluorescence (compare blue in white outlined areas in 3rd panel from the left) as compared to control redRubi infected neurons (red), consistent with the result for IL-6 in the microarray. [score:2]
The increased fluorescence indicates the ability of the sponge cassette to knockdown miR-132 activity relieving repression of the inverse reporter cassette. [score:2]
This configuration allowed us to identify control cells (red) and miR-132 knockdown cells (green) that have the same birthdate in a single animal (Fig. 7a). [score:2]
Paired recordings from neighboring newborn neurons confirmed that miR-132 knockdown resulted in decreased integration into the perforant path circuit. [score:2]
It is likely that a complete knockout of miR-132 would have a more severe effect on newborn neurons. [score:2]
miR-132 knockdown increases “inflammatory” signaling. [score:2]
miR-132 was knocked down in PC12 cells infected with the miR-132 sponge virus (Figure 4). [score:2]
Knockdown of miR-132 activity in vivo caused a decrease in dendritic spine density, sEPSC frequency, and evoked EPSCs in newborn neurons. [score:2]
miR-132 knockdown impairs functional integration. [score:2]
We tested the level of miR-132 (TaqMan real-time PCR assays) in primary hippocampal cultures infected with the miR-132 expression virus and the miR-132 inverse reporter. [score:2]
An equal titer of lentiviral inverse reporter for miR-132 or the reporter control was injected into the 6 to 8-week-old mouse dentate gyrus and the expression pattern compared at 7 days post-injection. [score:2]
0019077.g008 Figure 8miR-132 was knocked down in PC12 cells infected with the miR-132 sponge virus (Figure 4). [score:2]
The fluorescence intensity of neurons expressing the miR-132 sponge was 2.93±0.63 compared to 0.23±0.94 for control (p<0.05; t-test; n = 24 and 20 cells, respectively). [score:2]
miR-132 Knockdown Decreases Dendritic Spine Density In Vivo. [score:2]
In non-neuronal cells miR-132 is an important regulator of immune signaling [43], [44]. [score:2]
To knockdown miR-132 in newborn neurons, we developed a retroviral “sponge”, and then assessed synaptic function after 21 days using whole-cell recording. [score:2]
In Paired Recording, Evoked AMPA Currents Were Smaller in miR-132 Knockdown Granule Cells. [score:2]
miR-132 Knockdown Markedly Decreased sEPSC Frequency. [score:2]
At 14 and 21 days post-injection as endogenous miR-132 increased, cells expressing only the inverse reporter showed a decreased fluorescence compared to 7 days post-injection (Fig. 3b, bottom left panel). [score:2]
Thus the decrease in the evoked EPSC amplitude suggests that there are fewer synapses or fewer AMPA receptors at individual synapses in miR-132 knockdown cells. [score:2]
The role of miR-132 in activity -dependent development of newborn neurons. [score:2]
0019077.g002 Figure 2An equal titer of lentiviral inverse reporter for miR-132 or the reporter control was injected into the 6 to 8-week-old mouse dentate gyrus and the expression pattern compared at 7 days post-injection. [score:2]
Although the sequence in this molecular cascade remains to be elucidated, the evidence supports the notion that miR-132 contributes to the activity- and CREB -dependent development of adult-generated neurons. [score:2]
Previous studies have used the 2′ O-methyl technique to knockdown miR-132 in vitro. [score:2]
0019077.g003 Figure 3Retroviral Sponge Knockdown of miR-132 Activity In Vivo. [score:2]
Our microarray analysis of miR-132 knockdown suggests a link to inflammatory genes in this program. [score:2]
Whole rat genome microarrays were probed to screen for changes in miR-132 knockdown cells vs. [score:2]
Taken together, the decreases in spine density, sEPSC frequency, and evoked EPSC amplitude indicate that miR-132 knockdown resulted in decreased synapse formation on newborn neurons. [score:2]
Newborn neurons are a good cell type to explore the ensemble of gene products regulated by miR-132 during synapse formation. [score:2]
Retroviral Sponge Knockdown of miR-132 Activity In Vivo. [score:2]
The miR-132 inverse reporter. [score:1]
IL-6 immunofluorescence was measured using Image J and manually circling GFP positive miR-132 sponge expressing neurons or mCherry positive control neurons. [score:1]
Furthermore, the inverse reporter has little or no effect on the endogenous levels of miR-132 in hippocampal cultures. [score:1]
RNA isolated from NGF -treated PC12 cells infected either with the miR-132 sponge or an EGFP control virus were hybridized to Agilent whole rat genome microarrays. [score:1]
Transcript levels of calbindin, a marker of mature granule cells, increased in parallel with miR-132. [score:1]
The mature miR-132 sequence is 100% conserved in mice, rats, and humans. [score:1]
Likewise, pilocarpine -induced seizures also cause a rapid increase in miR-132 (data not shown; [32]), as well as an associated increase in dendritic outgrowth and synapse formation in vivo [11]. [score:1]
Our results suggest that miR-132 plays a central role in the genetic program that drives activity -dependent integration of newborn neurons into the hippocampal circuitry. [score:1]
The inverse reporter resulted in a slight decrease in miR-132 levels that did not reach statistical significance (0.77±0.22 fold; p>0.9 ANOVA with Tukey post-hoc; n = 2 cultures per condition). [score:1]
Further, miR-212, which has a similar sequence to miR-132, was not reduced. [score:1]
Further, the inverse reporter, which had 2 MREs driven by ubiquitin had little or no effect on endogenous miR-132 levels and had no effect on dendritic spine density (data not shown). [score:1]
Our results show that miR-132 levels increase just as newborn neurons begin to receive neuronal activity. [score:1]
825 ng of Cy3 labeled control (redRubi infected) and Cy5 labeled experimental (miR-132 sponge infected) cRNA were combined and hybridized overnight to Agilent whole rat genome microarrays. [score:1]
We used the sponge to examine the effect of reducing miR-132 levels on dendrite outgrowth, spine formation and synaptic activity of newborn neurons. [score:1]
These experiments indicate that the inverse reporter can be used as a sensor for miR-132 activity. [score:1]
Infection with the miR-132 sponge prevented this miR-132 induction. [score:1]
These results indicate that the sponge is highly specific for miR-132. [score:1]
miR-132 Sponge Efficacy and Specificity. [score:1]
The synaptic phenotype of miR-132. [score:1]
miR-212 is highly homologous to miR-132 and generated from the same transcript, making it a particularly good specificity control. [score:1]
[1 to 20 of 134 sentences]
3
[+] score: 381
# p < 0.05; ** p < 0.01; ## p < 0.005, compared with the negative control (NC) miR-132 promotes Cyp19a1 expression by downregulating Nurr1miRNAs suppress translation by targeting the 3'-UTRs of mRNAs. [score:11]
In addition, the induction of miR-132 during Kaposi’s sarcoma -associated herpes virus infection represses the expression of p300, a co-activator of CREB, which acts as part of a negative feedback loop that leads to the inhibition of miR-132 expression and the restoration of p300 expression [43]. [score:9]
Nurr1, an orphan nuclear receptor that suppresses Cyp19a1 expression, was found to be a direct target of miR-132. [score:8]
In contrast, compared to treatment with inhibitors NC, knockdown of miR-132 using miR-132 inhibitors led to increased Nurr1 protein expression in mGCs (Fig.   5e). [score:7]
Our study demonstrates that miR-132 suppressed Nurr1 expression by targeting its 3'-UTR (Fig.   5b). [score:7]
Our loss-of-function study also demonstrated that the knockdown of miR-132 could downregulate the expression of Cyp19a1. [score:7]
The results demonstrated that the synthesis of E [2] was suppressed by miR-132 knockdown and downregulation of miR-132 prevented a cAMP -mediated increase of E [2] in mGCs (Fig.   3b). [score:7]
org/vert_61/) revealed that the orphan nuclear receptor Nurr1, which suppresses aromatase expression via its PII promoter in KGN cells [29], is a putative target gene of miR-132. [score:7]
We hypothesized that miR-132 promotes Cyp19a1 expression by suppressing a Cyp19a1 inhibitor. [score:7]
miR-132 induces Cyp19a1 by directly suppressing the expression of Nurr1. [score:6]
miR-132 promotes Cyp19a1 expression by downregulating Nurr1. [score:6]
Our in vitro analysis of miR-132 expression in cultured mGCs treated with 8-Br-cAMP demonstrated that miR-132 levels were significantly upregulated and peaked at 12 h (Fig.   1e). [score:6]
In summary, our study demonstrated that cAMP induces the expression of miR-132 in mGCs; E [2] synthesis is subsequently induced by miR-132 via the upregulation of Cyp19a1. [score:6]
Conceivably, miR-132 expression could contribute to the decline of Nurr1 and the subsequent upregulation of Cyp19a1. [score:6]
After transfecting mGCs with Flag-Nurr1, which upregulated Nurr1 protein levels independent of miR-132 repression due to the absence of the 3'-UTR binding sequence for miR-132 in the pFLAG-CMV-2 expression plasmid, the stimulatory effect of miR-132 on E [2] synthesis was largely abrogated (Fig.   6e). [score:6]
In a recent study of embryonic stem cell differentiation, miR-132 was demonstrated to directly regulate the expression of Nurr1, which is an important transcription factor in dopamine neuron development and differentiation [29]. [score:6]
Compared to controls, the overexpression of miR-132 significantly decreased luciferase activity, and the knockdown of miR-132 significantly increased luciferase activity in transfected mGCs (Fig.   5b), indicating that Nurr1 is a direct target of miR-132. [score:6]
Our study also identified Nurr1 as a direct target of miR-132, which mediates the regulation of E [2] synthesis by miR-132 in mGCs. [score:5]
Six hours after transfection, mGCs were cultured in the absence or presence of 8-Br-cAMP for another 48 h. The inhibition of endogenous miR-132 by specific inhibitors was validated by qRT-PCR. [score:5]
A previous study demonstrated that miR-132 is regulated by CREB via CRE motifs upstream of miR-132 [31]; this finding explains the observed upregulation of miR-132 by cAMP activation in GCs. [score:5]
e of Nurr1 and Nur77 protein expression in mGCs 48 h after transfection with 100 nM of miR-132 mimics, miR-132 inhibitors or the corresponding negative controls. [score:5]
In summary, miR-132 post-transcriptionally inhibits the translation of Nurr1 and weakens its repressive effect on Cyp19a1 transcription. [score:5]
Consequently, the increased levels of miR-132 after 8-Br-cAMP treatment could contribute to the extended suppressive effect of miR-132 inhibitors on Cyp19a1. [score:5]
However, the expression of Cyp11a1, a key gene for progesterone synthesis, was not influenced by the overexpression of miR-132 (Fig.   4a). [score:5]
Direct suppression of Nurr1 via its 3'-untranslated region by miR-132 were further verified using luciferase reporter assays. [score:5]
This finding indicates that in mGCs, miR-132 induces Nurr1 translation inhibition but not mRNA degradation by binding to the 3'-UTR of Nurr1. [score:5]
Our findings were further supported by the observation that the induction of the NR4A family was observed after the inhibition of endogenous miR-132 via miR-132 inhibitors (Fig.   5d). [score:5]
In contrast, the observed effect of miR-132 inhibitors on Cyp19a1 levels was similar to the suppression in E [2] levels (Fig.   3b), and this effect became notable after 8-Br-cAMP treatment in mGCs (Fig.   4c). [score:5]
The E [2] synthesis was primarily elevated after Nurr1 knockdown via siNurr1 transfection compared to siNC (Fig.   6c, the left panels), which was similar to the previously observed effect of the downregulation of Nurr1 by miR-132. [score:4]
We hypothesized that miR-132 stimulates E [2] synthesis via translational regulation of an orphan nuclear receptor -Nurr1. [score:4]
In addition, we studied miR-132-related loss-of-function by knocking down endogenous miR-132 via the transient transfection of miR-132 inhibitors into mGCs (Fig.   3a). [score:4]
The knockdown of Nurr1 primarily elevated the synthesis of estradiol and partially attenuated the miR-132 -induced estradiol elevation, and the ectopic expression of Flag-Nurr1 abrogated the stimulatory effect of miR-132 on estradiol synthesis in mouse GCs. [score:4]
The observed pattern of miR-132 upregulation is consistent with reported increases in steroid hormone release from mGCs, suggesting that miR-132 is involved in cAMP -mediated pathways, such as those that are important for the differentiation of GCs. [score:4]
Knockdown of Nurr1 partially attenuates the effects of miR-132 and re -expression of Nurr1 abrogates the stimulatory effect of miR-132 on E [2] synthesis. [score:4]
These results indicated that Nurr1 is a direct target gene of miR-132. [score:4]
Previous studies have demonstrated that miR-132 levels are elevated in periovulatory mGCs and upregulated by hCG/LH, cAMP and FSH [19– 21]. [score:4]
The treatment of mouse ovaries with an ovulatory dose of LH/hCG revealed that miR-132 was highly upregulated in periovulatory mGCs [21]. [score:4]
This regulatory network may contribute to the observed decline in miR-132 levels after peak expression is reached during cAMP treatment. [score:4]
Significant changes in Nurr1 mRNA levels were not observed after either the overexpression or knockdown of miR-132 (Fig.   5f). [score:4]
Significant effects on Cyp11a1 expression were not observed after the knockdown of miR-132 in the presence or absence of 8-Br-cAMP treatment (Fig.   4b). [score:4]
Among the miRNAs that are involved in the cAMP signaling pathway, miR-132 has been demonstrated to be upregulated in rat GCs by either cAMP [19] or FSH treatment [20] and in periovulatory mouse granulosa cells (mGCs) after LH/hCG induction [21]. [score:4]
Fig. 6Knockdown of Nurr1 partially attenuates the effects of miR-132, and re -expression of Nurr1 abrogates the stimulatory effect of miR-132 on E2 synthesis. [score:4]
This miR-132 -mediated reduction of Nurr1 repression leads to Cyp19a1 upregulation and increased E [2] synthesis. [score:4]
The synthesis of estradiol increased after the overexpression of miR-132 in mouse GCs. [score:3]
The real-time PCR results demonstrated that miR-132 induced the expression of Cyp19a1 significantly. [score:3]
The expression level of the Nur77 protein was not influenced by miR-132 (Fig.   5e) in our study. [score:3]
Fig. 2Overexpression of miR-132 enhances E2 synthesis in mGCs. [score:3]
In contrast to the previously reported transient peaks in NR4A expression, the cAMP -mediated induction of miR-132 resulted in a delayed elevation pattern [29]. [score:3]
miR-132 expression is responsive to 8-Br-cAMP stimulation. [score:3]
A recent study in polycystic ovary syndrome patients found that the expression levels of miRNA-132 in follicular fluid were significantly lower in patients than in controls [22]. [score:3]
mGCs were transfected with 100 nM miR-132 mimics, miR-132 inhibitors or the corresponding negative controls. [score:3]
The expression level of miR-132 in cultured mouse GCs was significantly elevated during 48 h of treatment with 8-Br-cAMP. [score:3]
Fig. 18-Br-cAMP treatment increases miR-132 expression and steroidogenesis in mGCs. [score:3]
Analysis of Nurr1 levels via demonstrated that Nurr1 protein expression was significantly lower in mGCs that were transfected with miR-132 mimics than in mGCs that were transfected with mimics NC. [score:3]
To examine the effect of miR-132 on Cyp11a1 and Cyp191a1 transcription, mGCs were transfected with 100 nM of miR-132 mimics (a) or 100 nM of miR-132 inhibitors in the absence (b) or presence of 8-Br-cAMP (c) for 48 h as indicated, or the corresponding negative controls. [score:3]
In a genome-scale screen of steroid hormone release influenced by miRNAs in human primary ovarian GCs, 51 miRNAs were found to suppress E [2] release, whereas none of the miRNAs (including miR-132) studied were found to have a stimulatory effect on the E [2] level [14]. [score:3]
They also found that overexpression of miR-132 increased E [2] secretion from KGN, a steroidogenic human granulosa-like tumor cell line. [score:3]
We constructed the luciferase reporter plasmid pmirGLO-Luc-Nurr1 3'-UTR WT, which contained the 3'-UTR of mouse Nurr1 and the putative binding site for the ‘seed sequence’ of miR-132 (Fig.   5a), and co -transfected it into mGCs with either miR-132 mimics/inhibitors or the corresponding negative controls. [score:3]
These findings suggest that miR-132 promotes E [2] synthesis via the transcriptional regulation of aromatase but has little effect on progesterone synthesis due to its failure to regulate the transcription of Cyp11a1. [score:3]
3'-UTR 3'-untranslated region cAMP Cyclic adenosine monophosphateE [2] Estradiol GCs Granulosa cells miR-132 microRNA-132 This work was supported by the National Natural Science Foundation of China (No. [score:3]
However, the E [2] levels significantly increased after miR-132 overexpression. [score:3]
Louis, MO, USA) for 0, 3, 6, 12, 24 or 48 h. Total RNA was isolated, and the expression of miR-132 was analyzed using quantitative polymerase chain reaction (PCR). [score:3]
a mGCs were transfected with 100 nM miR-132 inhibitors or negative controls. [score:3]
A recent study in polycystic ovary syndrome patients showed that the expression levels of miR-132 in follicular fluid were significantly lower in patients than in controls [22]. [score:3]
Quantitative real time PCR and western blot were performed to identify the effect of miR-132 on Cyp19a1, Cyp11a1 and an orphan nuclear receptor-Nurr1 expression in GCs. [score:3]
The detection of estrogen synthesis-related genes using real-time PCR revealed that a 1.6-fold increase in the expression of Cyp19a1 (P < 0.01), the P450 aromatase gene required for E [2] synthesis, was induced by miR-132 mimics (Fig.   4a). [score:3]
To determine whether miR-132 is induced by the cAMP signal transduction pathway, primary mGCs were exposed to 8-Br-cAMP for 0 to 48 h. During this period, miR-132 expression was continuously elevated, peaking at 12 h (~5-fold increased) and dropped to basal level after 24 h (Fig.   1e). [score:3]
In KGN cells, overexpression of miR-132 increased E [2] levels [22], which is consistent with our findings in mGCs. [score:3]
microRNA-132 Estradiol Granulosa cell Nurr1 Cyp19a1 Ovarian steroid hormones such as estradiol (E [2]) play important roles in many biological processes, including ovarian follicular development, oocyte maturation, endometrial proliferation and mammary gland development [1, 2]. [score:3]
Some targets of miR-132, including p250GAP [40] and MeCP2 [41], have been identified. [score:3]
Interestingly, the Nurr1 protein levels in mGCs were dramatically decreased by the overexpression of miR-132 (Fig.   5e), whereas the Nurr1 mRNA levels were only slightly changed (Fig.   5f). [score:3]
Our findings suggest that miR-132 is involved in the cAMP signaling pathway and promotes estradiol synthesis via the translational repression of Nurr1 in ovarian GCs. [score:3]
These findings suggest that miR-132 may play diverse roles such as steroidogenesis in different developmental stage of granulose cells. [score:2]
Nurr1 was suppressed by miR-132, as indicated by a luciferase assay and Western blotting. [score:2]
In preovulatory mGCs, knockdown of miR-132 failed to affect estradiol or progesterone after cAMP treatment [21]. [score:2]
In addition, we constructed the pmirGLO-Luc-Nurr1 3'-UTR MU plasmid, which had two mutations in the ‘seed sequence’ of the miR-132 binding site, as indicated in Fig.   5a. [score:2]
The mutant sequence contained two mutations in the ‘seed sequence’ of the miR-132 binding site, which is indicated in Fig.   5a. [score:2]
The precise regulatory role of miR-132 and its functions in GCs remain to be elucidated. [score:2]
The dysfunctions of miR-132 in the development of polycystic ovary syndrome and premature ovarian failure are to be elucidated in future studies. [score:2]
The observed effects of miR-132 on physiological processes in GCs may be useful for regulating reproduction and treating steroid-related disorders. [score:2]
The luciferase assay demonstrated that miR-132 suppressed the luciferase activity of the NBRE-Luc reporter gene. [score:2]
However, a study in equine follicle development found that miR-132 was increased in granulose cells from luteinizing follicles with higher progesterone and lower estradiol concentration in the follicular fluid [34]. [score:2]
miR-132 may exhibit diverse functions at specific stages of GCs development. [score:2]
A previous study demonstrated that in neurons, miR-132 is regulated by multiple factors, such as BDNF [39], and is required for both neuronal morphogenesis and long-term synapse activation [28]. [score:2]
Our study suggests that miR-132 may exert differential effects on reproductive endocrine regulation (e. g., the promotion of estrogen synthesis). [score:2]
miRNA profiling in LβT2 cells exposed to gonadotropin-releasing hormone revealed the significant induction of miR-132, which subsequently regulated cellular motility [42]. [score:2]
Our data suggest that E [2] production and the Cyp19a1 mRNA levels in mGCs are elevated by miR-132 directly. [score:2]
Chemically synthesized single-stranded RNAs that mimic mature endogenous miR-132 [GeneBank: NR_029546.1] after transfection into cells were used as miR-132 mimics, and mimics NC were used as negative controls. [score:1]
At least four cAMP-response element (CRE) sites are involved in miR-132 transcription in mice [28]. [score:1]
GCs were cultured and treated with the stable cyclic adenosine monophosphate analog 8-Br-cAMP or transfected with miR-132 mimics, Nurr1-specific small interfering RNA oligonucleotides and Flag-Nurr1 plasmids. [score:1]
The miR-132 levels were detected by qRT-PCR 48 h after transient transfection. [score:1]
This study aimed to determine the effect of microRNA-132 (miR-132) on estradiol synthesis in GCs. [score:1]
These results suggest that Nurr1 plays an important role in miR-132 -induced E [2] synthesis. [score:1]
The induction of miR-132 was also observed in FSH or cAMP -treated rat GCs [19, 20]. [score:1]
Scale bar: 100 μm miR-132 enhances the synthesis of E [2] in mGCsNext, we assessed whether miR-132 has an effect on steroidogenesis in mGCs. [score:1]
Taken together, miR-132 was induced by cAMP and likely mediated the FSH pathway in the primary cultured mGCs that we studied because of its stimulatory effect on E [2] synthesis. [score:1]
In addition, further in vivo studies, such as a study using floxed miR-212/132 mice [44] to specifically ablate miR-132 in GCs, could improve our understanding of the effect of miR-132 on E [2] synthesis. [score:1]
a mGCs were transfected with miR-132 mimics or negative controls at the indicated concentration. [score:1]
To elevate miR-132 levels in mGCs, we transiently transfected mGCs with miR-132 mimics (i. e., chemically modified oligonucleotides) and confirmed the increased miR-132 levels using qRT-PCR (Fig.   2a). [score:1]
The g and a shown in red indicate the miR-132 binding site in the mutant form of Nurr1. [score:1]
To determine the effects of 8-Br-cAMP on mGC function, mGCs were treated with medium alone or with 1 mM 8-Br-cAMP (Sigma) for 24 h or 48 h. To determine the effects of miR-132 on mGCs, the medium was changed 6 h after transfection with miR-132 mimics/inhibitors or the corresponding negative controls, and the cells were cultured for an additional 48 h. To determine the effect of Nurr1 on mGCs, siNurr1 was transfected into cells 24 h prior to the transfection of miR-132 mimics, and the cells were cultured for an additional 24 h or 48 h. Culture medium was collected at the indicated time points, and the concentrations of E [2] and progesterone in the culture medium were determined using the Access Immunoassay System 2 (Beckman Coulter, Brea, CA, Germany), an automated random-access chemiluminescence -based assay. [score:1]
miR-21, which in addition to miR-132 and miR-212, is an LH -induced miRNA, blocks apoptosis in mGCs [32]. [score:1]
To better understand the functions of miR-132 in GCs of terminal differentiation (e. g. apoptosis), further studies are needed. [score:1]
Interest in the involvement of miR-132 in endocrine biology has emerged recently. [score:1]
miR-132 failed to affect the luciferase activity of the mutagenized Nurr1 3'-UTR plasmid (Fig.   5c). [score:1]
In light of the important roles of both miR-132 and estrogen in brain function, it would be of interest to determine whether miR-132 influences local estrogen synthesis in the nervous system. [score:1]
miR-132 enhances the synthesis of E [2] in mGCs. [score:1]
The results of previous studies are consistent with our findings, which demonstrated that miR-132 was induced by hormonal stimulation and activation of the cAMP pathway in GCs. [score:1]
In addition, our research elucidated some of the molecular mechanisms that underlie the stimulatory effect of miR-132 on E [2] synthesis. [score:1]
Followed by transfection of miR-132 mimics for 48 h, miR-132 significantly promoted E [2] synthesis as expected in siNC group, while miR-132 failed to further contribute to the elevation of the E [2] synthesis in siNurr1 group (Fig.   6c, the right panels). [score:1]
Scale bar: 100 μm Next, we assessed whether miR-132 has an effect on steroidogenesis in mGCs. [score:1]
This increase was dose dependent; 35 % and 72 % increases in the E [2] levels were observed when cells were transfected with 50 nM and 100 nM miR-132 mimics, respectively (Fig.   2c). [score:1]
In the 3'-UTR of Nur77, which has also been identified as a repressor of aromatase in NR4A family members, no putative binding site for miR-132 was found via bioinformatics screening. [score:1]
The concentrations of progesterone (c) and E [2] (d) per 10 [5] cells in culture medium were determined after 8-Br-cAMP treatment for 24 h and 48 h. e At the indicated time points after treatment with 8-Br-cAMP, the miR-132 levels in mGCs were determined using qRT-PCR. [score:1]
The above findings suggest that miR-132 can serve as a stimulator for E [2] synthesis in GCs. [score:1]
The functions of miR-132 may be related to the fact that cAMP mediates divergent pathways depending on the differential status of GCs [23]. [score:1]
a The putative site in the Nurr1 3′-UTR that contains the ‘seed sequence’ for miR-132 binding. [score:1]
These findings also suggest that miR-132 mediates functions of the cAMP pathway during the differentiation process of GCs. [score:1]
[1 to 20 of 118 sentences]
4
[+] score: 296
Other miRNAs from this paper: mmu-mir-16-1, mmu-mir-16-2, mmu-mir-212
To confirm that the knockout did not express either miR-132 or miR-212, total RNA was isolated from cortex or cerebellum of the mice, and analysed for the expression of mature miR-132 and miR-212 by qPCR (Fig. 2A, B). [score:6]
Interestingly, these studies also showed that while the miR-132 levels were increased, this did not affect the protein levels of the putative miR-132 targets MeCP2 or p250GAP [6], a finding that is consistent with our observation that miR-132/212 knockout did not affect the expression levels of MeCP2 and p250GAP in cultured neurons (Fig. 6). [score:6]
Overexpression of miRNA mimetics or inhibitory oligos for miR-132 has suggested roles for miR-132 in dendritic branching and spine formation in neurons [4], [16], [17], [18], angiogenesis during tumour growth [10] and in the regulation of immunity and viral replication [11], [19], [20]. [score:6]
These observations are consistent with previous miR-132 over -expression studies [17] and suggest that miR-132/212 regulates cell surface expression of post-synaptic AMPA receptors at these synapses. [score:6]
Recently it has been demonstrated that knockout of miR-132 can affect the dendritic growth and arborization of newborn neurons in the hippocampus [9] while similar results have been observed following retroviral expression of a miR-132 inhibitory sponge complex [36]. [score:6]
While it is clear that all 4 miRNA sequences are expressed from this locus, the expression level for miR-132 is much higher that for the other three miRNAs [3], [9]. [score:5]
For instance overexpression of miR-132 mimetics or inhibitors have been shown to have major effects on neuronal morphology in culture [4]. [score:5]
Interestingly expression of both miR-132 and miR-212 could be detected in the cortex and cerebellum of either MSK1/2 knockout or CREB Ser133Ala knockin mice, although there was a trend for reduced levels in the cortex. [score:5]
Much of the initial work on miR-132 and miR-212 function has relied on the use of the overexpression of miRNA mimetics or inhibitors. [score:5]
In their study it was found that miR-132 inhibited the anti-viral response to KSHV at least in part by targeting the transcriptional co-activator p300. [score:5]
Interestingly while miR-132 and miR-212 have similar seed sequences, suggesting they could have some targets in common, the seed sequences of miR-132* and miR-212* are different suggesting they would have distinct targets in vivo. [score:5]
In line with this, transfection of miR-132 inhibitory oligos or miR-132 mimetics affects these processes in cultured neurons [4], and miR-132 over -expression increased the number of mushroom and stubby spines, but decreased overall spine number [17]. [score:5]
No miR-132 or miR-212 expression could be detected in the miR-132/212 knockout brain tissue. [score:4]
Analysis of the mRNA levels in the cortex for the potential miR-132 targets p250GAP, MeCP2 and p300 did not demonstrate any significant difference between the knockout and floxed mice (Fig. 2C). [score:4]
Conditional knockout mice for miR-132 and miR-212 were generated by insertion of loxP sites in the 5′ region of the intron encoding miR-132 and miR-212 and in exon2 using the targeting strategy shown in Fig. 1A. [score:4]
Previously we have shown that in cortical neuronal cultures miR-132 expression is regulated by an MSK-CREB dependent pathway in response to neurotrophins [3], while others have shown a strong CREB dependence for miR-132 is cell culture systems [4]. [score:4]
As judged by qPCR, miR-132/212 knockout did not significantly affect the levels of the potential miR-132 targets p250Gap or MeCP2 (Fig. 6E). [score:4]
bearing this floxed allele were then further crossed to constitutive Cre expressing mice, resulting in heterozygous knockout alleles for the miR-132/212 locus. [score:4]
This indicates that other mechanisms in addition to the MSK-CREB dependent pathway promote miR-132 and miR-212 expression during development of the CNS. [score:4]
The transcription of pri-miR-132/212 is regulated by CREB, and is reduced by inhibitors or genetic manipulations that block CREB phosphorylation [3], [4]. [score:4]
In response to viral infection, miR-132 has been suggested to control CREB -dependent signalling by targeting the CREB co-activator p300 [13]. [score:3]
This has led to the suggestion that miR-132 is the only functional miRNA expressed from this locus in neurons [9], however this may not reflect the situation in all cell types. [score:3]
Correctly targeted ES cells were used to generate a conditional miR-132/212 allele in mice using standard techniques. [score:3]
were crossed to Flp transgenic mice to excise Neomycin resistance cassette and then Cre expressing mice to delete miR-132 and miR-212. [score:3]
The expression of both miR-132 and miR-212 has been shown to be increased after the induction of LTP by high frequency stimulation in the dentate gyrus. [score:3]
Tetanus -induced LTP studies were conducted on eight miR-132/212 knockout mice (11 slices) and four fl/fl mice (6 slices), whilst theta-burst LTP experiments were conducted on five miR-132/212 knockout mice (13 slices) and 2 fl/fl mice (6 slices). [score:3]
Through the generation of a miR-132/miR-212 double knockout, we have shown that these miRNAs are not essential for development or fertility. [score:3]
Both wild-type and mice homozygous for the floxed allele had comparable levels of both miR-132 and miR-212, indicating that the insertion of the loxP sites did not affect the expression of the two miRNAs. [score:3]
Several targets have been proposed for miR-132 or miR-212, including MeCP2, p250GAP, p120GasGAP, p300, SirT1, Foxp2 and MMP9 [4], [10], [11], [12], [13], [14], [15]. [score:3]
Expression or miR-132 and miR-212 in the CNS. [score:3]
The deletion of miR-132 and miR-212 was achieved by crossing these mice to transgenic mice expressing Cre recombinase under a constitutive promoter (Taconis Artemis), following deletion mice were crossed away from the Cre transgene before experimental mice were generated. [score:3]
In addition, miR-132 has also been suggested to regulate sirT1, a deacetylase that regulates NFκB, a transcription factor central to the production of cytokines in response to TLR agonists [11]. [score:3]
Following infection of fibroblasts with Sendai virus, the RNA levels of the CREB -dependent genes nur77 and pri-miR-132/212 were repressed suggesting that Sendai virus may inhibit CREB function. [score:3]
Briefly, the targeting vector was designed to introduce LoxP sites either side of the region encoding miR-132 and miR-212. [score:3]
In the immune system, roles for miR-132 have been proposed in the regulation of NFκB, the response to viral infection and in the regulation of immune responses [11], [13], [20], [35]. [score:3]
These mice still express normal levels of miR-132 and miR-212 (Fig. 2). [score:3]
Crossing of heterozygous miR-132/212 knockout mice showed that the homozygous miR-132/212 knockout mice were viable and obtained at close to the expected Men delian frequency (23.3%, n = 172). [score:3]
In the present study we found that LTP in area CA1 of hippocampal slices induced by conventional tetanic stimulation (100 Hz/1sec) was no different between control and miR-132/212 knockout mice, whereas LTP induced by theta-burst stimulation was enhanced in miR-132/212 knockouts. [score:3]
miR-132 or miR-212 do however have roles in regulating synaptic transmission and synaptic plasticity, and it would therefore be of interest to examine the effect of miR-132/212 knockout in behavioural mo dels. [score:3]
Inhibition of miR-132 using retroviral constructs impaired synaptic transmission in hippocampal dentate gyrus granule cells, with a net effect of a reduction in the amplitude of evoked EPSCs, which likely reflects a reduction in the number of synapses since neither mEPSC amplitude nor the probability of transmitter release was affected, whereas the frequency of mEPSCs was greatly reduced. [score:3]
Overexpression of miR-132 has been shown to both increase paired-pulse facilitation but not mEPSC amplitude, suggesting a presynaptic action on the probability of neurotransmitter release [31], and increase both mEPSC amplitude and frequency [17]. [score:3]
In acute hippocampal slices a deficit in synaptic transmission between CA3 and CA1 neurons was observed, with the knockout showing a consistently smaller fEPSP by ∼30% over a stimulation range of 50–300 µA (Fig. 7A), whilst paired-pulse facilitation, an indicator of the probability of vesicle release from the pre-synaptic terminal, was no different between miR-132/212 knockout mice and fl/fl mice (n = 17 slices from 8 KO and 11 slices from 6 fl/fl mice; Fig. 7B). [score:3]
In addition, deletion of miR-132 and miR-212 in mice has shown a role for these miRNAs in mammary gland development [12] and cardiovascular function [21]. [score:2]
Despite this, initial analysis of the miR-132/212 knockout has not yet revealed any major defects in the innate immune system. [score:2]
Knockout of miR-132 and 212 did not affect the induction of TNF, Il-10, IL-13, IL-12, KC, MCP-1, Mip-1a or Mip-1b (Fig. 5). [score:2]
However, as expected, mature miR-132 and miR-212 could not be detected in the knockout cells (Fig. 6D). [score:2]
Wild-type or miR-132/212 knockout mice were given an intraperitoneal injection with either PBS or LPS (2 mg/kg). [score:2]
No differences were seen between the miR-132/212 knockout and wild-type macrophages for the production of TNF, IL-6, Il-12p40 and IL-10 (Fig. 4). [score:2]
It would therefore be of interest to examine the effects of miR-132 knockout in mo dels of monocular deprivation. [score:2]
miR-132/212 knockout mice were generated by insertion of LoxP sites in the 1 [st] intron and exon2 of the small non coding RNA gene that contains miR-132 and miR-212 (A). [score:2]
Normal Innate Immune Responses in miR-132/212 Knockout. [score:2]
0062509.g006 Figure 6 Cultures of cortical neurons were established on coverslips from P0 pups from either wild-type or miR-132/212 knockouts. [score:2]
In addition to its proposed roles in immunity miR-132 has been suggested to play roles in neuronal development and synaptic function [5], [16], [17], [30], [31]. [score:2]
Although this is consistent with the normal cytokine responses in the miR-132/212 knockout BMDMs, it is possible that these miRNAs may play a greater role in different macrophage subtypes or other immune cells. [score:2]
Previous studies have suggested roles for miR-132 in the regulation of innate immunity. [score:2]
MEFs from wild-type or miR-132/212 knockout mice were infected with Sendai virus for the indicated times. [score:2]
To further examine the roles for miR-132 or miR-212 in innate immunity, bone marrow derived macrophages (BMDMs) were isolated from the knockout mice and stimulated with a panel of TLR agonists including LPS (TLR4), CpG (TLR9), Pam3-CSK4 (TLR1/2), Pam2-CSK4 (TLR2/3) and CL097 (TLR7). [score:2]
0062509.g004 Figure 4 BMDMs were isolated from wild-type or miR-132/212 knockout mice. [score:2]
miR-132/212 Knockout Affects Synaptic Strength and Plasticity. [score:2]
As the total miR-132/212 knockout was viable, these mice were used for subsequent studies. [score:2]
miR-132/212 knockout mice were fertile, and gave similar litter sizes and survival of pups to weaning as either heterozygous crosses or homozygous matings for the floxed allele (Fig. 1D and E). [score:2]
miR-132/212 knockout mice were generated using the strategy described in Fig. 1A by TaconicArtemis. [score:2]
In relation to this there are several genes, such as Nos2 and Nme1, close to miR-132 on chr11 that have been implicated in mammary gland development [33], [34]. [score:2]
Generation of miR-132/212 knockout mice. [score:2]
In contrast, in cultured cortical neurons we did not observe major differences between the morphology of wild-type and miR-132/212 knockout neurons, while spine density in the mature CA1 hippocampal neurons was similar. [score:2]
In hippocampal slices, LTP in the CA3/CA1 pathway induced by tetanic stimuli (100 Hz/1s) was unaffected by miR-132/212 knockout (n = 11 slices from 8 KO mice and 6 slices from 4 fl/fl mice; Fig. 7C). [score:2]
miR-132 and miR-212 do not regulate LPS -induced cytokine production in vivo. [score:2]
Cultures of cortical neurons were established on coverslips from P0 pups from either wild-type or miR-132/212 knockouts. [score:2]
Hippocampal slices were prepared as previously described [43] Briefly, control (fl/fl) or miR-132/212 knockout mice were killed by cervical dislocation in accordance with the UK Animal (Scientific Procedures) Act, 1986 and local Ethical Review procedures. [score:2]
The effects of Sendai virus infection on IFNβ or nur77 mRNA was unaffected by the knockout of miR-132 and miR-212 (Fig. 3B and D). [score:2]
0062509.g001 Figure 1miR-132/212 knockout mice were generated by insertion of LoxP sites in the 1 [st] intron and exon2 of the small non coding RNA gene that contains miR-132 and miR-212 (A). [score:2]
In contrast to hippocampal LTP, LTP induced in the neocortex by theta-burst stimulation was found to be significantly decreased in the miR-132/212 knockout (Fig. 8F). [score:2]
Similar to the mRNA results, western blotting did not detect significant differences in the levels of MeCP2 protein in miR-132/212 knockout samples relative to wild-type cells (Fig. 6F). [score:2]
Gross morphology of the brain by visual inspection was unaffected by miR-132/212 knockout (data not shown). [score:2]
The average amplitude and quantal size of glutamatergic mEPSCs recorded in pyramidal neurons of somatosensory cortex of miR-132/212 knockout mice was almost 40% lower than mEPSCs recorded from neurons of fl/fl mice (Fig. 8A, B). [score:2]
Data was obtained from sections from four miR-132/212 knockout mice and three fl/fl mice. [score:2]
Another miR-132/212 knockout has also recently been reported which used a similar strategy by replacing the miRNA sequence with a LacZ reporter gene. [score:2]
0062509.g002 Figure 2 Total RNA was isolated from the cortex (A) or cerebellum (B) of wild-type (+/+), miR-132/212 floxed (fl/fl), miR-132/212 knockout (−/−) mice. [score:2]
In the miR-132/212 knockout reported here, normal paired-pulse facilitation, and hence probability of transmitter release was observed in the hippocampus, but the amplitude of both evoked and spontaneous synaptic transmission was decreased in the hippocampus and neocortex. [score:2]
miR-132/212 knockout cortical cultures exhibit normal morphology. [score:2]
Therefore, to further examine miR-132/212 function we generated a knockout mouse lacking these two miRNAs. [score:2]
Consistent with previous studies in primary neurons [28], pri-miR-132/212 induction was reduced, but not abolished, in MSK1/2 double knockout MEFs (Fig. 3A). [score:2]
In contrast, theta-burst LTP in the neocortex was reduced in the miR-132/212 knockouts relative to controls. [score:2]
As we were unable to identify a good antibody to p250-Gap we were unable to determine the effect of the miR-132/212 knockout on the levels of p250-Gap protein. [score:2]
Total RNA was isolated from the cortex (A) or cerebellum (B) of wild-type (+/+), miR-132/212 floxed (fl/fl), miR-132/212 knockout (−/−) mice. [score:2]
Generation of miR-132/212 Knockout. [score:2]
BMDMs were isolated from wild-type or miR-132/212 knockout mice. [score:2]
Recordings of basal transmission and paired-pulse facilitation (slope 2 [nd] fEPSP/slope 1 [st] fEPSP) were made from eight miR-132/212 knockout mice (17 slices) and six fl/fl mice (11 slices). [score:2]
While we have previously been able to replicate this finding we were unable to show induction of pri-miR-132/212 in BMDMs in response to LPS [3], [29]. [score:1]
Pri-miR-132/212 could be induced in MEFs in response to PMA, an activator of the ERK1/2 MAPK pathway (Fig. 3A). [score:1]
LPS has been shown to induce miR-132 in the THP-1 human monocyte cell line [8]. [score:1]
Consistent with this, little induction of pri-miR-132/212 was seen and, by 4 h post infection, the levels pri-miR-132/212 were actually repressed relative to uninfected controls (Fig. 3C). [score:1]
D) Cumulative distributions of mEPSCs amplitudes pooled for 7 fl/fl (black line) and 8 miR-132/212 KO neurons (grey line) showing a consistent leftward shift towards reduced mEPSC amplitude in miR-132/212 KO neurons. [score:1]
Deletion of miR132/212 influences synaptic transmission and plasticity in the neocortex. [score:1]
miR-132 and miR-212 are two related miRNAs that are encoded from the same intron of a small non-coding gene that is located on chromosome 11 in mice and chromosome 17 in humans. [score:1]
In summary, miR-132 and miR-212 are two related miRNAs that can be induced by a variety of signals and in various cell types and have proposed functions in both the CNS and immunity. [score:1]
Next, we examined the effect of miR-132/212 on synaptic function. [score:1]
miR-132 and miR-212 are not critical for IFNβ induction in MEFs infected by Sendai virus. [score:1]
The average quantal size of mEPSCs in miR-132/212 KO mice was 8.4±1.4 pA (n = 8) whereas the same parameter for fl/fl neurons was 12.9±1.7 pA (n = 7; p<0.01; Fig. 8E). [score:1]
In these experiments to control for the insertion of the loxP site, homozygous miR-132/212 floxed mice were used as controls. [score:1]
These differences could be due to several reasons; Sendai virus is an RNA virus while KSHV is a DNA virus and it is possible that miR-132 is only involved in the response to a subset of viruses or cell types. [score:1]
Additionally miR-132 did not affect the levels of IFNβ mRNA induced in response to Sendai virus infection. [score:1]
Similar to pri-miR-132/212, this was followed by a repression of nur77 mRNA levels at later time points after infection (Fig. 3D). [score:1]
In mice, miR-132 and miR-212 are encoded in the 1 [st] intron of a small non-coding gene on chromosome 11. [score:1]
Electrophysiological experiments however do indicate that miR-132 or miR-212 play a role in synaptic function. [score:1]
Total RNA was isolated and pri-miR-132/212 levels determined by qPCR as described in the methods (A). [score:1]
Nonetheless, the effect of the miR-132/212 on cortical LTP is perhaps significant, given the recent findings that miR-132 is involved in plasticity in the visual cortex [23], [24]. [score:1]
Long-term potentiation of excitatory synaptic transmission is impaired in the neocortex of miR-132/212 KO mice. [score:1]
Initially we examined the role of miR-132 and miR-212 in mouse embryonic fibroblasts. [score:1]
Previous studies have suggested roles for miR-132 in the CNS and immune system. [score:1]
C) Superimposition of corresponding amplitude distributions of mEPSCs recorded in the fl/fl neuron (black) and miR-132/212 KO (grey) neuron. [score:1]
Analysis of cortical neuronal cultures demonstrated that knockout of miR-132 and miR-212 did not result in significant differences in neuronal morphology compared to wild-type control cultures between 2 and 4 days in vitro. [score:1]
Together this would suggest that while miR-132 may play a role in newly developing neurons in the CNS, over time neurons can compensate for the loss of miR-132 in terms of dendrite outgrowth and spine formation. [score:1]
0062509.g008 Figure 8 A) Representative examples of miniature spontaneous currents recorded in pyramidal neurons of the somatosensory cortex of a control (fl/fl mice, left panels) and miR-132/212 KO slice (right panels). [score:1]
Lagos et al. (2010) reported that miR-132 was induced in response to infection with Kaposi’s sarcoma -associated herpes virus (KSHV) in human lymphatic endothelial cells. [score:1]
Total RNA was isolated and the levels of IFNβ (B), pri-miR-132/212 (C) and nur77 (D) determined by qPCR. [score:1]
The levels of pri-miR-132/212, miR-132, miR-212 (D), p250-Gap and MeCP2 (E) were determined. [score:1]
Processing of the pri-miR-132/212 transcript has been shown to give rise to 4 miRNA species; miR-132, miR-212 as well as the star sequences for both miR-132 and miR-212 [3]. [score:1]
In cells, the transcription of the primary transcript for miR-132 and miR-212 can be induced by a variety of signals, including BDNF stimulation and synaptic activity in neurons, PMA and anisomycin in fibroblasts and LPS in THP-1 cells [3], [4], [5], [6], [7], [8]. [score:1]
As miR-132 is induced by CREB and p300 is a co-activator for CREB, this suggests that induction of miR-132 could set up a negative feedback loop to limit CREB -dependent transcription [13]. [score:1]
The insets show the average fEPSP (20 each) waveforms recorded before (smaller of the two traces) and 60 min after theta-burst stimulation (larger of the two traces) in cortical slices of fl/fl (black lines) and miR-132/212 KO (grey lines) mice. [score:1]
Significantly however, this was independent of miR-132 and miR-212 indicating that in this system it did not require modulation of p300 levels by miR-132. [score:1]
Stimulation of the cultured neurons with the glutamate receptor agonist NMDA was able to increase miR-132 and miR-212 levels in wild-type cells (Fig. 6D). [score:1]
In vivo miR-132 and miR-212 have been linked to several processes in the brain including circadian rhythms, cocaine addiction and ocular dominance [22], [23], [24], [25], [26]. [score:1]
A) Representative examples of miniature spontaneous currents recorded in pyramidal neurons of the somatosensory cortex of a control (fl/fl mice, left panels) and miR-132/212 KO slice (right panels). [score:1]
The levels of mature miR-132 and miR-212 were determined by qPCR. [score:1]
Each point represents the mean ± SD for 11 cortical slices of fl/fl mice (black circles) and 14 cortical slices of miR-132/212 KO mice (grey circles). [score:1]
Germline transmitting chimeric mice were crossed to Flpe transgenic mice (also on a C57Bl/6 background) to delete the neomycin cassette, resulting in mice with a conditional allele for miR-132 miR-212. [score:1]
miR-132 and miR-212 are not required for cytokine induction in BMDMs. [score:1]
[1 to 20 of 129 sentences]
5
[+] score: 274
In both mice and humans, fully conserved miRNAs, such as miR-132, might regulate different targets, or present differential preference for suppressing shared targets, for several reasons: first, alternative transcript variants of a given gene may contain different 3′-untranslated regions (3′-UTR domains), which could either include or exclude MREs (Zhu et al. 2007) or be differently susceptible to miRNA regulation (Mishra et al. 2017). [score:11]
This analysis revealed a complex pattern of reciprocal interactions between the targets themselves; for example, the EP300 and RB1, validated targets of miR-132, and its FoxO3 putative target emerged as interacting with SIRT1, another validated target (Fig.   4). [score:9]
Specifically, transgenic overexpression of miR-132 increases dendritic spine density while causing significant deficits in novel object recognition (Hansen et al. 2010) via suppression of a specific miR-132 target, the p250 GTPase-activating protein (P250GAP) (Wayman et al. 2008); also, miR-132 controls dendritic plasticity by modulating the expression of the stress-sensitive transcription factor methyl CpG -binding protein 2 (MECP2) (Fyffe et al. 2008; Klein et al. 2007) known for its role in the Rett syndrome (Amir et al. 1999). [score:9]
We found that the validated target RASA1 and the putative target Paip2 were significantly downregulated upon increase in miR-132-3p levels (n = 3, fold change = 0.62, 0.74, 724 respectively; Student’s t test: p < 0.05). [score:8]
Worth mentioning is the case of hsa-miR-132-3p and hsa-miR-212-3p that exhibit similar mature sequences and share the same seed region, yet only few targets were demonstrated to be targeted by both of them, and each of these miRNAs may also repress specific targets (Wanet et al. 2012). [score:7]
To find its predicted targets, we uploaded the human miR-132-3p to Diana microT-CDS (Paraskevopoulou et al. 2013; Reczko et al. 2012), with a default threshold of 0.7; and identified those targets that were co-predicted with both Diana microT-CDS and TargetScan (Agarwal et al. 2015). [score:7]
”To further support the expected effect of miR-132-3p on its validated and putative targets, we overexpressed miR-132 in the HEK 293T human cell line and examined selected transcripts for their expression level. [score:7]
” To further support the expected effect of miR-132-3p on its validated and putative targets, we overexpressed miR-132 in the HEK 293T human cell line and examined selected transcripts for their expression level. [score:7]
Interactions between the targets and putative targets themselves are indicated with dashed-lines (Color figure online) We examined the pathways affected by miR-132-3p both in human and mouse through its targets and the proteins they interact with. [score:7]
These interactions further suggest that miR-132-3p targets may be regulated both in a direct and indirect fashion, and that this regulation could be stress-affected. [score:7]
MiR-132 is overexpressed in bacterial lipopolysaccharide (LPS)-stimulated primary human macrophages as well as in LPS -treated mice, where it attenuates inflammation by suppressing its stress-related target AChE (Shaked et al. 2009). [score:6]
Consequently, mice expressing an AChE transgene devoid of the miR-132 binding site develops high basal miR-132 expression levels, yet are incapable of controlling stress (Shaltiel et al. 2013) or inflammation (Shaked et al. 2009) via ACh. [score:5]
Further, human patients with inflammatory bowel disease exhibit increased levels of miR-132-3p in intestinal tissue biopsies, with corresponding decreases in circulatory AChE activity, relative to healthy controls (Maharshak et al. 2013), suggesting miR-132 involvement in IBD alongside with its stress-related target AChE. [score:5]
Surprisingly, the fraction of shared validated targets of miR-132-3p in the two species is less than a half, although miR-132 is fully conserved and 56–88% of the targets present a conserved MRE (validated and predicted MREs, respectively). [score:5]
Compatible with the overlapping elevation of miR-132 in anxiety and metabolic impairments, our enrichment analysis revealed several metabolic disorders, such as non-alcoholic fatty liver disease (NAFLD, FDR = 2.8E−04), inflammatory bowel disease (IBD, FDR = 1.4E−02), and Type II diabetes mellitus (FDR = 8.5E−05), alongside with metabolic-related pathways, such as the Insulin signaling pathway (FDR = 5.3E−09). [score:5]
This figure was designed using the Vienna RNAfold webserver based on minimum free energy prediction (Color figure online) To gain an insight into potentially shared targets of murine and human miR-132-3p, we searched for its validated human and murine targets in published data and in online bioinformatics tools such as miRTarBase (Chou et al. 2015) and explored the literature for their method of validation. [score:5]
miRNA-132 Stress miRNA Pathway analysis Cholinergic system MicroRNAs (miRNAs) are short, approximately 20–25 nucleotides long single-stranded RNA molecules that bind to complementary sequences in the 3′-untranslated regions (3′-UTR) of target mRNAs (Lai 2002), referred to as miRNA response elements (MREs). [score:5]
Validated and putative miR-132-3p targets in human were then submitted to String (Szklarczyk et al. 2014) with the following parameters: organism—Homo sapiens; prediction methods—Neighborhood, Gene Fusion, Co-occurrence, Co -expression, Experiments, Databases (text mining was excluded); required confidence (score)—highest (0.900). [score:5]
Validating the functional relevance of this interaction, we have recently shown that mouse mo dels of hepatic steatosis or non-alcoholic steatohepatitis (NASH) display dramatic increases in liver miR-132 levels and corresponding reduction in selected miR-132 targets, whereas antisense oligonucleotide -mediated miR-132 silencing increases the levels of its targets and consequently reduces the steatotic phenotype (Hanin et al. 2017). [score:5]
This analysis yielded 19 mRNA transcripts as validated targets of human miR-132-3p (TJAP1, CRK, TLN2, RFX4, RB1, SOX5, ZEB2, CDKN1A, SIRT1, IRAK4, FoxO1, STAT4, SOX4, NR4A2, AChE, EP300, RASA1, HBEGF, and MECP2) (Fig.   2a; Table  1), and 17 as validated targets of murine miR-132-3p (FoxO3, Pten, Paip2, Lrrfip1, Btg2, Cacnb2, Ptbp2, P250GAP, Kdm5a, Mmp9, Cyp2e1, NR4A2, AChE, EP300, RASA1, HBEGF, and MECP2) (Fig.   2a; Table  2), 6 of which were shared between both species. [score:5]
Those non-validated transcripts were further included in the analysis, as they have a high potential for being viable targets of miR-132-3p, and were hence referred to as “putative targets. [score:5]
To compare the impact of miR-132 regulation in mice and humans, and to explore its implications in stressful situations, we examined both the conservation levels of miR-132-3p targets, and the potential of their interaction with other proteins and the pathways involved in mice and humans. [score:4]
Notably, the expression of miR-132 is impaired in Alzheimer’s disease (AD) brains (Lau et al. 2013; Soreq 2015), while Mmp9 levels were shown to be elevated in the plasma of AD patients as compared to controls (Lorenzl et al. 2003). [score:4]
The miR-132 predicted binding sites in its target transcripts show consistently lower conservational levels compared to miR-132-3p itself, corresponding to the global phenomenon in which mammalian, and especially primate brain-expressed miRNA genes are evolutionarily more conserved than their predicted binding sites (Barbash et al. 2014). [score:4]
Predictably, some of the targets do not contain an MRE for miR-132-3p in one or more of their 3′-transcript variants, indicating alternative splicing -dependent regulation. [score:4]
Two transcription factors control the miR-132 locus: the cAMP-response element binding protein (CREB), indicating up-regulation under elevated Ca [++]; and the Repressor Element 1 silencing transcription factor/neuron-restrictive silencer factor (REST/NRSF), known to be modulated under aging (Lu et al. 2014) and in AD (González-Castañeda et al. 2013; Lu et al. 2014; Orta-Salazar et al. 2014). [score:4]
This finding is supported by experimental evidence, where introduction of miR-132 into primary cortical neurons decreased MECP2 protein levels, while its introduction into L6 muscle cells, which express the shorter MECP2 transcript, did not reduce MECP2 levels (Klein et al. 2007), presenting heterogeneous susceptibility of MECP2 to miR-132 regulation as a result of alternative polyadenylation, similarly to the case of AChE (Mishra et al. 2017). [score:4]
Further, miR-132 is required for the dendritic growth and arborization of newborn neurons in the adult mouse hippocampus (Magill et al. 2010) and regulates structural plasticity of dendritic spines in the mouse through its target matrix metalloproteinase 9 (Mmp9) (Jasińska et al. 2015). [score:4]
Moreover, some proteins, such as Tumor Protein P53 (TP53) and Ubiquitin C (UBC), interact with more than one target of miR-132-3p (Fig.   4). [score:3]
One subtype of neurotrophin, BDNF (brain-derived neurotrophic factor), increases miR-132 expression upon its administration to cultured primary cortical mouse neurons (Remenyi et al. 2010). [score:3]
UBC, a stress-inducible gene (Figueiredo-Pereira et al. 1997; Tsirigotis et al. 2001), binds the miR-132-3p targets SIRT1, FoxO3, PTEN, PAIP2, RB1, and CDKN1A. [score:3]
miR-132 Overexpression. [score:3]
a Venn diagram of validated miR-132-3p targets in mice and humans. [score:3]
Identifying the Genomic Location and Structure of miR-132 and Its Predicted Targets. [score:3]
Network presentation of miR-132, its targets, and their interactors was modified from Cytoscape tool (Shannon et al. 2003). [score:3]
AChE, a shared validated target of miR-132-3p in human and mouse, is responsible, together with the homologous enzyme butyrylcholinesterase (BChE), for terminating cholinergic signaling by rapid hydrolysis of ACh in the synaptic cleft (Soreq 2015). [score:3]
Fig.  2Validated and predicted miR-132-3p targets in mice and humans. [score:3]
Human and Murine miR-132-3p Share 6 Validated Targets. [score:3]
GnRH is known to induce the expression of miR-132 in mouse pituitary gonadotroph cells. [score:3]
Interestingly, one REST and several CREB binding site controllers of miR-132 transcription appear in all mammals, suggesting an evolutionarily conserved involvement of CREB and REST as controllers of miR-132 expression (Remenyi et al. 2010; Wanet et al. 2012; Wei et al. 2013). [score:3]
We found that the MRE for miR-132-3p is present only in the long variant, which is expressed predominantly in the brain. [score:3]
Fig.  3Human MECP2 3′-UTR The MREs for miR-483-5p (green) and miR-132-3p (red) and their locations in the 3′-UTR of MECP2 are marked (Color figure online) To predict miR-132-3p-regulated pathways, we extended our dataset to include proteins which could potentially be affected by miR-132-3p in an indirect manner. [score:3]
b Venn diagram of validated and predicted targets of miR-132-3p in human (not to scale). [score:3]
We found that human and murine share 6 validated targets, and that 9 additional transcripts contain a conserved MRE for miR-132-3p. [score:3]
Both validated and putative miR-132-3p targets in human and mouse, and the proteins they interact with were pursued. [score:3]
Targets without miR-132-3p MRE are marked in black. [score:3]
Predicting that other targets have not yet been validated, we further searched for transcripts which are validated in murine but not in human; yet share MREs for miR-132-3p in their 3′-compete with each other. [score:3]
MiR-132 is also a major regulator of cholinergic signaling (Meerson et al. 2010; Ponomarev et al. 2011; Shaltiel et al. 2013), which is both modulated under stressful insults and subject to complex miRNA regulation (Soreq 2015). [score:3]
A schematic representation of the interactions between miR-132-3p (pink), its validated (yellow), or putative (green) target genes and the proteins they interact with (blue). [score:3]
At the transcript level, surface plasmon resonance analysis showed that miR-132 selectively targets the soluble splice variant of the acetylcholine hydrolyzing enzyme AChE-R (Mishra et al. 2017). [score:3]
Thus, both direct and secondary processes may jointly lead to miR-132-3p network interactions. [score:2]
Specifically, exposing mice to predator scent induces long-lasting hippocampal elevation of miR-132, accompanied by reduced AChE activity (Shaltiel et al. 2013; Zimmerman et al. 2012) as well as by epigenetic regulation via histone deacetylase 4 (Sailaja et al. 2012). [score:2]
We selected for our current study to focus on miR-132, the stress regulatory capacities of which have been studied for over a decade, especially in the brain, and its many roles were extensively explored using transgenic in vivo mo dels, among other research systems (Edbauer et al. 2010; Jimenez-Mateos et al. 2011; Luikart et al. 2011; Mellios et al. 2011; Nu delman et al. 2010). [score:2]
Taken together, these studies demonstrate inter-related stress/inflammation/neurodevelopment links for miR-132 but failed to identify any evolutionary modifications in any of those, excluding an option of primate and/or human-specific roles for this context. [score:2]
The role of miR-132 in the cholinergic system was demonstrated in numerous studies (Meerson et al. 2010; Ponomarev et al. 2011; Shaked et al. 2009; Shaltiel et al. 2013), compatible with its regulatory effect on synaptic transmission (Remenyi et al. 2013). [score:2]
To examine a possible interaction between miR-132-3p and miR-483-5p regulation on MECP2, we checked the MREs of both miR-132-3p and miR-483-5p in the MECP2 3′-UTR, and found that they are distant enough to ensure that they are unlikely to compete with each other (the 3′-UTR sequence and MREs are presented in Fig.   3). [score:2]
Searching for differences between the regulation of miR-132-3p in man and mice failed to identify any significant differences. [score:2]
Likewise, 16 of the tested genes in the GnRH (Gonadotropin-Releasing Hormone) signaling pathway were found to be related to miR-132-3p regulation (Online Resource 1, FDR = 3.9E−05). [score:2]
For each selected pathway, the numbers (out of 247 genes), percentage of involved genes, and FDR are shown Yet more specifically, our analysis re-confirmed miR-132′s involvement in cholinergic synapses (FDR = 9.6E−05). [score:1]
Repressive effects of miR-132 on the 3′-UTR of SIRT1 were observed in HEK293T cells (Zhou et al. 2012) and in the liver (Hanin et al. 2017). [score:1]
Murine and Human miR-132 Genes Share Key Properties. [score:1]
miR-132 3p and 5p are indicated in bold. [score:1]
Another well-studied context of miR-132 is its activity in the immune system, known to be functionally involved in psychological stress responses (Mehta et al. 2015; Molnár et al. 2012; Taganov et al. 2006). [score:1]
A prominent example is the immune system, demonstrated by the predicted involvement of miR-132-3p in T cell and B cell receptor signaling pathways, chemokine signaling pathway, Leukocyte transendothelial migration, and natural killer cell -mediated cytotoxicity (FDR = 4.8E−14, 5.4E−09, 5.2E−12, 5.6E−06, 3.7E−04, respectively), which is compatible with the potentiation by miR-132 of the cholinergic blockade of inflammation (Mishra et al. 2017; Shaked et al. 2009). [score:1]
We performed numerous tests in search for potential primate- and/or human-specific interactions of miR-132-3p. [score:1]
The metabolic and stress links of miR-132-3p thus point at multiple ailments as stress -associated. [score:1]
Figure  1a-d presents these shared features for the genomic origin and structure of miR-132 in mice and humans. [score:1]
Those studies showed involvement of miR-132 in neuronal functions, including process extension and neuronal activity. [score:1]
MiR-132 Presents a Complex Regulation Network. [score:1]
Fig.  4Human miR-132 interaction network. [score:1]
In this context, miR-132 is especially suitable, as its interaction with AChE had been shown to control anxiety. [score:1]
Overall, these studies present miR-132′s involvement in overcoming stress -induced damage to protect cognitive function via its cholinergic control. [score:1]
We extracted the mature and pre-miRNA sequences of miR-132 in different organisms from miRBase (Kozomara and Griffiths-Jones 2014), and used the Vertebrate Multiz Alignment & Conservation (100 Species) track in the UCSC genome browser (Kent et al. 2002) and the T-Coffee multiple alignment tool (Notredame et al. 2000) to test for miR-132 conservation. [score:1]
b Stem-loop sequence of miR-132 in different organisms. [score:1]
For each selected pathway, the numbers (out of 247 genes), percentage of involved genes, and FDR are shown Yet more specifically, our analysis re-confirmed miR-132′s involvement in cholinergic synapses (FDR = 9.6E−05). [score:1]
Furthermore, the genomic site harboring miR-132 displays high conservation levels across vertebrates, mammals, and primates (Wanet et al. 2012). [score:1]
c, d Sequence and predicted stem-loop structure of human (c) and mouse (d) pre-miR-132. [score:1]
Thus, miR-132 serves as a most appropriate test case for exploring rodent-primate links of the stress-related mode of miRNA functioning. [score:1]
We found that 32 of our tested genes were enriched in the neurotrophin signaling pathway (FDR = 7.7E−19), indicating a potential involvement of miR-132 in both murine and human neurotrophin signaling. [score:1]
Inversely, mice treated with anti-miR-132 oligonucleotide showed elevated activity of the synaptic variant AChE-S, which may suppress the stress-characteristic hyper-activation of synaptic neurotransmission (Mishra et al. 2017). [score:1]
MiR-132 is a highly conserved miRNA that originates from intergenic regions on human chromosome 17 and mouse chromosome 11. [score:1]
In a mouse mo del of psychological stress, miR-132 was elevated in the hippocampus, accompanied by and associated with reduced AChE activity, which predictably potentiates ACh signaling, and exacerbates anxiety (Meshorer and Soreq 2006; Shaltiel et al. 2013; Soreq 2015). [score:1]
a Human miR-132′s genomic location, conservation, and promoter-related H3K4Me3 histone modification, adapted from the UCSC genome browser. [score:1]
A related cell specific example was shown for miR-132 and SIRT1 interaction. [score:1]
Also, contextual fear conditioning increases pri-miR-132 levels in the hippocampus of chronically stressed rats (Meerson et al. 2010), as well as in the murine hippocampus (Ponomarev et al. 2011). [score:1]
Taken together, these findings could indicate miR-132 involvement in several fundamental processes in the cell by affecting key proteins, such as TP53 and UBC. [score:1]
In addition, intriguing non-cancerous pathways were found to be enriched with genes of interest (Table  3), and some of those pathways showed experimentally validated relation to miR-132 in mouse. [score:1]
[1 to 20 of 87 sentences]
6
[+] score: 253
miR-132 can also inhibit the translation of methyl CpG -binding protein 2 (MeCP2) that in turn regulates BDNF expression. [score:8]
Overexpression of miR-132 in the Mature Neurons Regulates Dendritic Spine Structure by Direct Targeting of MMP-9 mRNA. [score:7]
Moreover, we have checked the level of miR-132 expression in the hippocampi of wt and Fmr1 KO mice and we have not observed statistically significant differences in the level of miR-132 expression between the two genotypes, suggesting that basal miR-132 expression is not affected by the lack of FMRP protein. [score:7]
This data suggest that overexpression of miR-132 in mature hippocampal neurons can regulate structural plasticity of dendritic spines through downregulation of matrix metalloproteinase 9 and may reverse the aberrant morphology of Fmr1 KO spines. [score:7]
Our data strongly support a role for miR-132 in the regulation of activity -dependent synaptic translation of MMP-9. In the previous studies, miR-132 has been shown to bind and regulate the MMP-9 3’UTR during the development of the mammary glands in mice [38]. [score:6]
MiR-132 was shown to be rapidly upregulated in mo del conditions of the synaptic plasticity, e. g., in the primary visual cortex after eye opening [6] and conversely, downregulated by mononuclear deprivation [7]. [score:6]
Western blot analysis with specific anti-MMP-9 antibody further confirmed the downregulation of MMP-9 protein by miR-132 in neurons overexpressing miR-132 (Fig.   2f). [score:6]
As shown in Fig.   2b, miR-132 specifically downregulates the expression of the miR-132 seed containing sensor but not the one containing the miR-9 sequence. [score:6]
We observed that translational inhibition of MMP-9 mRNA by miR-132 was regulated by neuronal activity. [score:6]
Hippocampal neurons from wt or Fmr1 KO mice were transfected at 14 days in vitro (DIV14) with plasmid for miR-132 overexpression or plasmid expressing EGFP. [score:5]
The expression of mature miR-132 from the commercial vector (pEZX-MR04 from Gene Copoeia) was validated on the FF-luc reporter constructs containing perfect-match miRNA target-sites for miR-132 and miR-9 (sensors). [score:5]
The cortical neurons in culture were transfected with the luciferase reporters together with the miR-132 overexpressing vector or EGFP expressing vector as a control. [score:5]
Primary neurons in culture express spontaneous action potentials that activate the neuronal network and this can be responsible for the baseline expression level of miR-132. [score:5]
The unique feature of MMP-9, the new miR-132 target that we describe here, is that it is secreted at the synapse to directly regulate the morphology of dendritic spines. [score:5]
We did not observe the significant changes in spine density between wt neurons and Fmr1 KO neurons transfected either with EGFP expressing vector or the one overexpressing miR-132. [score:5]
Our findings provide an insight into a molecular mechanism that involves miR-132-regulated MMP-9 expression in neurons and their function for structural plasticity of dendritic spines. [score:4]
Interestingly, the miR-132 knockout (resulting in miR-132/miR-212 double knockout, as they are coded by the same gene) is not essential for development or fertility of mice; however, its function is related to specific aspects of synaptic plasticity [13]. [score:4]
miR-132 was shown to regulate the expression of synaptic mRNAs involved in the modulation of synaptic excitability. [score:4]
Error bars indicate SEM, n = 3, ** p < 0.01 by Student’s t test To validate if miR-132 can regulate the level of endogenous MMP-9 in neurons, we transfected primary cortical cultures with miR-132 precursor hairpin to overexpress the mature microRNA. [score:4]
Overexpression of miR-132 reduced the level of secreted MMP-9 protein by about 40 % when compared to the control neurons transfected with EGFP expressing vector (Fig.   2e). [score:4]
Error bars indicate SEM, * p < 0.05; *** p < 0.01; *** p < 0.001 by Mann-Whitney test Fig. 5Mo del depicting the role of miR-132 in the regulation of MMP-9 mRNA translation in response to synaptic stimulation at dendritic spines. [score:4]
d Schematic representation of the pSyn-Luc-3’UTR-MMP9 luciferase reporter construct and its mutated version—the mutation was introduced in the putative miR-132 target site of MMP-9 3’UTR, four nucleotides were changed. [score:4]
Impey and collaborators showed that miR-132 -mediated inhibition of a Rho GTPase activator, p250GAP, activates the RAC1-PAK actin-remo deling pathway and thereby regulate activity -dependent spine plasticity in hippocampal neurons [39, 12]. [score:4]
Error bars indicate SEM, n = 3, ** p < 0.01 by Student’s t testTo validate if miR-132 can regulate the level of endogenous MMP-9 in neurons, we transfected primary cortical cultures with miR-132 precursor hairpin to overexpress the mature microRNA. [score:4]
miR-132 Targets 3’UTR of MMP-9 mRNA and Regulates the Level of MMP-9 Protein in Neurons. [score:4]
These results suggest that miR-132 can reversibly regulate MMP-9 mRNA translation at synapses downstream of mGluR signaling. [score:4]
In our study, the overexpression of miR-132 in neurons led to the increase in the dendritic spines heads; however, modulation of spine shape was more pronounced in case of wild-type cells than Fmr1 KO neurons. [score:3]
The opposite dendritic spine shape changes were observed due to the miR-132 overexpression [18]. [score:3]
Another described target of miR-132 is the deacetylase sirtuin 1 (SIRT1) [43]. [score:3]
The shape of thin and stubby spines was not affected by the overexpression of miR-132 (Figs.   4i–n and 5). [score:3]
The reporter construct was then cotransfected with the miR-132 expressing vector to the HEK293 cells together with a plasmid encoding Renilla reniformis luciferase (RR-luc), used for normalization. [score:3]
The FF-luc reporter constructs were cotransfected with plasmid expressing miR-132 in primary rat cortical neurons, along with a plasmid encoding Renilla reniformis luciferase (RR-luc) for normalization. [score:3]
We have observed a dose -dependent effect of miR-132 inhibition on luciferase activity (Fig.   2c). [score:3]
MiR-132 is present in the dendrites and at synapses [10– 12], what makes it a potential unique regulator of locally translated synaptic proteins. [score:3]
The perfect seed match sequences for miR-132 or miR-9 were cloned downstream of the firefly luciferase in the FF-luc expressing vector. [score:3]
pEZX-MR04 plasmid (GeneCopoeia) was used for the overexpression of miR-132. [score:3]
e Cortical neurons were electroporated with EGFP or miR-132 precursor hairpin to overexpress the mature microRNA. [score:3]
Mir-132 is a neuronal activity-regulated microRNA, which expression is induced by plasticity-implicated transcription factor CREB—cAMP response element -binding protein [5]. [score:3]
Neurons were transfected at DIV14 with vectors for miR-132 or EGFP overexpression using Lipofectamine® 2000 (Life Technologies). [score:3]
a– d Hippocampal neurons isolated from wild-type or Fmr1 KO mice were transfected (DIV14 + 3) with EGFP- or miRNA-132 expressing vectors. [score:3]
Fig. 4The effect of mir-132 overexpression on the dendritic spines morphology of wt and Fmr1 KO neurons. [score:3]
When ectopically expressed in hippocampal neurons, miR-132 induces enlargement of dendritic spines [18, 6]. [score:3]
Activity-Dependent Translation of MMP-9 Involves miR-132. [score:3]
DHPG treatment resulted in the significant increase of miR-132 level in fraction 1, representing mRNPs, what can suggest its dissociation from MMP-9 mRNA which can be now translated and was shown to associate with polyribosomes in stimulated synaptoneurosomes. [score:3]
Medium from cortical neurons transfected by electroporation with plasmids overexpressing miR-132 or EGFP was collected 36 h after transfection. [score:3]
Primary rat cortical neurons were transfected by electroporation with plasmids overexpressing miR-132 or EGFP. [score:3]
Based on the published studies [45, 18] and our own results, we hypothesize that activity -dependent release of MMP-9 protein at the synapse is regulated by miR-132 and FMRP, and leads to the structural changes of dendritic spines In the present study, we provide evidence for the regulation of MMP-9 mRNA by miR-132 in neurons. [score:3]
Therefore, we used this experimental mo del of endogenous MMP-9 overexpression to observe the effect of miR-132 on dendritic spine morphology of mature neurons in culture. [score:3]
We have observed a significant increase in spine head area (22 % for wt and 15 % for Fmr1 KO), spine head length (10 % for wt and 9 % for Fmr1 KO), and spine head width (12 % for wt and 7 % for Fmr1 KO) after overexpression of miR-132 in wt and Fmr1 KO neurons only for the spines classified as mushroom spines. [score:3]
The expression levels of the primary and precursor forms of miR-212 and miR-132 were induced during long-term potentiation (LTP; an electrophysiological mo del of the synaptic plasticity) in the rat adult dentate gyrus [8] and upon brain-derived neurotrophic factor (BDNF) stimulation of primary cortical mouse neurons [9]. [score:3]
Our discovery strengthens the importance of the activity-regulated miR-132 as a crucial controller of neuronal plasticity. [score:2]
Thus, both, miR-132 and MMP-9 have been implicated in the regulation of structural plasticity in neurons. [score:2]
This would implicate that the FMRP has an additional regulatory effect on the miR-132-MMP-9 interaction. [score:2]
In the present study, we provide evidence for miR-132 -dependent regulation of MMP-9 mRNA in neurons that result in structural changes of dendritic spines. [score:2]
miR-132 failed to regulate the mutated MMP-9 3’UTR luciferase reporter, suggesting that it binds to the predicted sequence. [score:2]
Overexpression of miR-132 in cortical neurons significantly reduced the luciferase activity by about 30 % compared to the control. [score:2]
During the development of hippocampal neurons, miR-132 promotes dendritic arborization and neurite outgrowth [14– 17]. [score:2]
Importantly, miR-132 failed to regulate the mutated MMP-9 3’UTR luciferase reporter, confirming the functionality of the predicted sequence within the 3’UTR of MMP-9 (Fig.   2d). [score:2]
Overexpression of miR-132 in wt and Fmr1 KO neurons resulted in spine head enlargement, when compared to the EGFP transfected controls (Fig.   4e–h). [score:2]
pSyn-Luc-3’UTR-MMP9-MUT construct was obtained by site-directed mutagenesis of four nucleotides within the putative biding site for miR-132 in the pSyn-Luc-3’UTR-MMP9 plasmid. [score:2]
Both miR-132 and MMP-9 are well-described regulators of synaptic plasticity. [score:2]
In the same culture media samples, the level of matrix metalloproteinase 2 (MMP-2) did not change, indicating that mir-132 specifically regulates endogenous MMP-9 in neurons. [score:2]
This result suggests that the association of miR-132 with the 3’UTR of MMP-9 can be regulated by neuronal activity. [score:2]
Based on the published studies [45, 18] and our own results, we hypothesize that activity -dependent release of MMP-9 protein at the synapse is regulated by miR-132 and FMRP, and leads to the structural changes of dendritic spines miR-132, as well as several other miRNAs, is associated with FMRP in mouse brain [18]. [score:2]
Furthermore, the binding region complementary to the miR-132 was found to be conserved between species. [score:1]
The average spine densities (spines/10 μm stretch of dendrite) were wt, 4 (±0.9, n = 27); wt + miR-132, 4.7 (±1.2, n = 27); FX, 4.9 (±1.4, n = 27); and FX + miR-132, 4.3 (±1.1, n = 27). [score:1]
In aggregate, in the present study, we provide evidence that neuronal stimulation -driven rapid MMP-9 protein synthesis can be an effect of miR-132 -dependent derepression of MMP-9 mRNA. [score:1]
In mature neurons, the effect of miR-132 is mostly related to the changes in spine morphology and synaptic transmission. [score:1]
b The level of miR-132 on polisomal fractions isolated from synaptoneurosomes in control conditions and after gp1 mGluR stimulation with DHPG. [score:1]
a Alignment of the murine 3’UTR sequence of MMP-9 with miR-132. [score:1]
a MMP-9 and miR-132 recovery from FMRP-immunoprecipitation of wt and Fmr1 KO mice. [score:1]
Previous studies have shown the effect of miR-132 on dendritic spine shape [18, 6, 11]. [score:1]
FMRP is found in protein -RNA complex with MMP-9 mRNA and miR-132. [score:1]
Herein, we show that a fraction of miR-132 is associated with polysomes in unstimulated synaptoneurosomes and the stimulation of gp1 mGluRs promotes the association of miR-132 with fraction 1 corresponding to mRNPs. [score:1]
As shown in Fig.   1b, c, both MMP-9 mRNA and miR-132 were significantly enriched in the wild-type FMRP precipitates when compared to the Fmr1 KO synaptoneurosomes, suggesting indirectly the interaction between those two RNAs. [score:1]
Further study is needed to reveal this question for MMP-9 mRNA and miR-132. [score:1]
Matrix metalloproteinase 9 (MMP-9) miR-132 Structural plasticity of dendritic spines Reorganization of the neuronal networks supports physiological phenomena of learning and memory, as well as major neuropsychiatric pathologies, such as epilepsy, addiction, schizophrenia, to name just a few. [score:1]
Fig. 1MMP-9 mRNA and miR-132 associate with FMRP in synaptoneurosomes. [score:1]
miR-132, as well as several other miRNAs, is associated with FMRP in mouse brain [18]. [score:1]
Error bars indicate SEM, n = 3, * p < 0.03; ** p < 0.01; *** p < 0.001 by Student’s t test In silico analysis of the murine MMP-9 mRNA sequence revealed the presence of putative miR-132 binding site within the 3’UTR of the transcript (Fig.   2a). [score:1]
miR-132 and MMP-9 mRNA were not studied together in the context of FMRP; however, these findings suggested that they could be a part of the same protein -RNA complex. [score:1]
Therefore, we have checked whether the diminished neuronal activity will influence the level of endogenous miR-132. [score:1]
b– d RT-qPCR analysis of RNAs immunoprecipitated by anti-FMRP antibody— b miR-132, c MMP-9, and d PSD-95 (positive control) RNAs detected in the wt over Fmr1 KO immunoprecipitates. [score:1]
MMP-9 mRNA and miR-132 Associate with FMRP in Synaptoneurosomes. [score:1]
[1 to 20 of 84 sentences]
7
[+] score: 228
The combined analysis of miRNAs and mRNAs in the visual cortex of wt and miR-132/212 null mice revealed that genes downregulated with age and upregulated by miR-132/212 deletion are highly enriched with miR-132-3p targets and, to a much lesser extent, with targets of miR-212-5p, the only two members of the miR-132 family abundantly expressed in the visual cortex. [score:13]
Thus, in the absence of miR-132 family the developmental downregulation of a significant number of miR-132-3p targets does not occur, confirming the importance of miR-132-3p developmental regulation in defining the transcriptomic changes occurring between P10 and P28 in the visual cortex. [score:9]
The pathogenetic relevance of miR-132 regulated processes during development is further supported by the presence of brain disease related genes among the developmentally regulated miR-132 targets altered in the miR-132/212 mutant including MeCP2 (ref. [score:9]
Importantly, there was an overlap (39 genes) between the miR-132-3p targets and genes that were both downregulated by age and upregulated by miR-132/212 deletion (Fig. 1d). [score:9]
Intriguingly, KEGG pathway analysis revealed that 53 out of the 61 KEGG categories enriched with genes upregulated in miR-132/212 null mice were also present in the KEGG categories downregulated during normal development, suggesting that a substantial part of the rearrangement in molecular pathways occurring during normal development is altered in miR-132/212 mutants. [score:9]
Since many neurodevelopmental disorders including autism are related to alterations of neuronal connectivity and synaptic plasticity, miR-132 dysregulation and subsequent abnormal expression of miR-132 target genes could contribute to some pathological traits present in these diseases. [score:9]
Triple intersection between miR-132-3p putative targets, genes down regulated during development and genes upregulated in miR-132/212 null mice. [score:8]
Moreover, a significant enrichment in miR-132-3p targets was present in the genes upregulated in the miR-132/212 mutant cortex (54 genes, odds ratio 5.07; Fisher exact test P<0.0001, ), whereas the enrichment in miR-212-5p targets was not significant (14 genes, odds ratio 1.50; Fisher exact test P=0.13, ). [score:8]
Mir-29a, miR-219, miR-338 and miR-132 were the miRNAs undergoing the strongest upregulation during development, a result confirmed by reverse transcription PCR (Supplementary Fig. 1) and in agreement with previous data 8, whereas miR-298, miR-149 and miR-331 were the top downregulated miRNAs. [score:8]
Most importantly, among the miR-132 target genes downregulated with age in wt mice, but remaining at significant high levels in miR-132/212 null mice, there are genes potentially involved in binocular matching like MeCP2 (ref. [score:6]
MiR-212-5p targets were also significantly enriched in age -downregulated genes albeit with a minor odds ratio than miR-132-3p (, 132 genes, odds ratio=1.74; Fisher exact test P<0.0001). [score:6]
Importantly, there was a highly significant and specific overlap between the predicted targets of miR-132-3p and the genes downregulated with age (, 181 genes, odds ratio 2.10; Fisher exact test P<0.0001). [score:6]
Mice of three genotypes were used as experimental animals: mice carrying the forebrain specific deletion of miR-132/212 (Emx1:Cre-miR-132/212 [−/−]), mice expressing the floxed allele but not Cre-recombinase (miR132/212 [fl/fl]), and mice expressing Cre-recombinase but not carrying the floxed allele (Emx1:Cre-miR-132/212 [+/+]). [score:5]
This result is in agreement with the hypothesis that miR-132/212 age-regulated increase contributes to repress the expression of a significant number of genes during visual cortical development. [score:5]
To target miR132/212 deletion to excitatory neurons in the forebrain we used a mouse 40 expressing Cre recombinase under the Emx1 promoter (Emx1:Cre). [score:5]
Moreover, we found that miR-132/212 deletion mainly affected the response properties of broad-spiking cells (Fig. 3e) and morphological analysis of miR-132/212 null mice crossed with mice expressing green fluorescent protein in layer V pyramidal neurons showed a small but significant reduction spine density with respect to wt littermates (t-test, P<0.05 Fig. 6a,b and Supplementary Fig. 6), suggesting that excitatory cells could be a specific cellular target of miR-132 family. [score:5]
Taken together, these data demonstrate that miR-132 family contributes to shape the developmental regulation of visual cortex transcriptome and prompted us to analyse the effects of genetic deletion of the miR-132/212 locus on functional development of the visual cortex. [score:4]
A possible scenario emerging from these observations is that visual experience after eye opening endows cortical cells with plasticity mechanisms, such as the post-transcriptional target regulation by miR-132/212, necessary for refinement of binocular connections onto visual cortical neurons. [score:4]
These data show that the deletion of miR-132/212 locus does not impinge on the development of narrow-spiking units suggesting that the disruption of binocular matching in null mice was not due to an alteration of narrow-spiking inhibitory neurons. [score:4]
This hypothesis is based on previous data showing that miR-132 and its primary precursor are strongly downregulated by MD (refs 8, 9). [score:4]
Previous studies showed that miR-132 family is preferentially expressed by excitatory cells 39. [score:3]
Thus, a strategic modulation of miR-132/212 expression may offer a new therapeutic approach for these severe disorders. [score:3]
A more likely possibility is that miR-132 family could be involved in experience -dependent processes occurring also in this region 14 at the age when miR-132/212 is expressed. [score:3]
To study spine density, miR-132/212 transgenic and wt mice crossed with the mouse line expressing green fluorescent protein in layer V pyramidal neurons (line M (ref. [score:3]
Impaired binocular matching in Emx1:Cre-miR-132/212 [−/−] micePrevious studies showed that miR-132 family is preferentially expressed by excitatory cells 39. [score:3]
This process occurs in coincidence with the rise of miR-132 expression in the visual cortex 8, with simple cells reaching adult levels of binocular matching of orientation preference before complex cells 23. [score:3]
MiR-132 family is expressed in an activity -dependent manner also in the monocular visual cortex 8 therefore it seems unlikely that these miRNAs are specifically dedicated to the formation of binocular cells. [score:3]
Then, we investigated the impact of developmental regulation of miR-132-3p and miR-212-5p on gene expression by analysing the transcriptome in the same samples used for the small. [score:3]
How could the transcriptional regulation of miR-132/212 cluster control experience -dependent development of functional properties of visual cortical neurons? [score:3]
To further analyse the role of miR-132/212 in visual cortical development, we assessed binocular matching of orientation preference in P27-28 null and wt mice. [score:2]
These results demonstrate that miR-132/212 is necessary for experience -dependent development of binocular processes in the visual cortex. [score:2]
RNA and small RNA sequencing reveal a role of miR-132/212 in shaping the age-regulated transcriptome. [score:2]
To directly investigate this possibility, we generated a novel mouse mo del (Emx1:Cre-miR-132/212 [−/−]) in which floxed miR-132/212 alleles are specifically deleted in forebrain glutamatergic neurons and in some glial cells by using the Emx1 promoter to drive Cre-recombinase expression 40. [score:2]
No OD plasticity and binocular matching in miR-132/212 miceIt has been reported that binocular matching of orientation preference is an experience -dependent process 19 sharing molecular regulatory mechanisms with OD plasticity 23. [score:2]
in a P30 wild-type mouse in a P30 miR-132/212 null mouse in a P60 wild-type mouse in a P60 miR-132/212 null mouse (a) Scatter plot of miRNAs regulated between P10 and P28 in the mouse visual cortex (N=4 mice for each age). [score:2]
These results are in line with the hypothesis that miR-132 family is particularly important for the late development of binocular neuronal properties. [score:2]
These data indicate that the action of miR-132 family in excitatory forebrain cells is required for the normal development of binocular matching of orientation preference in the primary visual cortex. [score:2]
Error bars represent s. e. m. (a) Contralateral to ipsilateral eye (C/I) VEP ratio in wt (N=10 mice), MD wt (wt-md, N=5 mice), miR-132/212 null (ko, N=7 mice) and MD miR-132/212 null animals (ko-md, N=6 mice). [score:1]
We found that miR-132/212 mutant mice showed a significantly reduced preference for the shallow side with respect to wt mice (Kruskal–Wallis One-way ANOVA on ranks, post hoc Dunn's method, P<0.05; Fig. 5e, Supplementary Fig. 5C and Supplementary Movies 1 and 2). [score:1]
Impaired depth perception in miR-132/212 null mice. [score:1]
A series of in vitro and in vivo studies revealed that miR-132 family has an active role in brain structural plasticity. [score:1]
These genotypes were obtained in the same litter by crossing male miR132/212 [+/fl] male mice with female Emx1:Cre-miR-132/212 [+/fl] females. [score:1]
In addition, the effect reported was not due to abnormal levels of anxiety or general exploratory activity in mutant mice as indicated by the equal time spent in the central and peripheral portion of the apparatus, and the comparable path length and locomotion velocity shown by wt and miR-132/212 null mice. [score:1]
We found that the effect of MD on binocular matching was occluded by the deletion of miR-132/212: while wt-md animals displayed a significant impairment of binocular matching with respect to non-deprived mice (Two-way ANOVA, genotype × condition interaction P<0.05, post hoc Holm-Sidak test P<0.001), the closure of one eye did not further deteriorate the mismatch of orientation preference observed in miR-132/212 null animals (post hoc Holm-Sidak test P=0.767; Fig. 4c). [score:1]
We employed the visual cliff task to explore the effects of miR-132/212 deletion on stereoscopic visual abilities. [score:1]
In tight accordance with binocular matching results, depth perception impairment in miR-132/212 null mice persisted in adulthood: stereoscopic abilities of mutants at P60, indeed, appeared markedly altered with respect to age-matched wt animals (t-test, P<0.05; Fig. 5h, Supplementary Fig. 5E and Supplementary Movies 3 and 4). [score:1]
The same was true for miR-132/212 null animals (one-sample t-test versus 50%; ko P=0.622, Fig. 5c). [score:1]
Previous work had already shown that miR-132 is necessary for OD plasticity 9, however a temporally restricted block of miR-132 availability using a miR-132 sponge was adopted. [score:1]
Analysis of average binocular matching of single mice confirmed the presence of an impairment exclusively in Emx1:Cre-miR-132/212 [−/−] mice (One-way ANOVA P<0.05, post hoc Holm-Sidak test, miR-132/212 [fl/fl] versus Emx1:Cre-miR-132/212 [−/−] P<0.05; Emx1:Cre-wt versus Emx1:Cre-miR-132/212 [−/−] P<0.05; Emx1:Cre-wt versus miR-132/212 [fl/fl] P=0.808; Supplementary Fig. 7). [score:1]
Since narrow-spiking units are known to be poorly orientation selective 32, an abnormally high presence of narrow-spiking units in miR-132/212 null mice could contribute to the low binocular matching of orientation preference observed in mutant mice. [score:1]
The electrophysiological characterization of these mutants at P27-28 revealed no differences in monocular properties, with OSI, tuning width and DSI being not significantly different between Emx1:Cre-miR-132/212 [−/−] mice and their age-matched littermates expressing exclusively the floxed miR-132/212 allele (miR-132/212 [fl/fl] mice) or the Cre-recombinase allele (Emx1:Cre-wt mice; One-way ANOVA, P=0.167, P=0.300 and P=0.893 respectively; Fig. 6c–e). [score:1]
Among the members of the miR-132 family, miR-132-3p and miR-212-5p were the only miRNAs represented at high levels. [score:1]
These results also suggest that miR-132 could be mainly involved in the maturation of response properties of excitatory cortical neurons. [score:1]
In contrast, binocular orientation matching appeared to be significantly impaired in Emx1:Cre-miR-132/212 [−/−] animals (One-way ANOVA P<0.01, post hoc Holm-Sidak test P<0.01; Fig. 6f,g), thus recapitulating the phenotype of ubiquitary null mice. [score:1]
To rule out the possibility that the significant difference in visual capacities reflect changes in the ability to cope with stress in challenging task conditions, we analysed general activity and anxiety-related behaviour of wt and miR-132/212 mutant mice in the visual cliff arena. [score:1]
Even with this analysis, binocular matching resulted to be strongly impaired in miR-132/212 null mice both at P27-28 and P60 (Two-way ANOVA, effect of genotype P<0.001; post hoc Holm-Sidak test, wt versus KO: P27-28 P<0.01, P60 P<0.001; Supplementary Fig. 2B). [score:1]
No OD plasticity and binocular matching in miR-132/212 mice. [score:1]
Intriguingly, the defective binocular matching of orientation preference present in P27-28 miR-132/212 null mice persists into adulthood. [score:1]
We found that 5.4% of miR-132/212 mutant units belonged to the narrow-spiking class. [score:1]
Our data show that miR-132/212 mutants display an impaired maturation of binocular depth perception revealed using the visual cliff test that relies on binocular vision. [score:1]
Error bars represent s. e. m. (a) Image of a dendritic branch from wt and miR-132/212 null (ko) mice at postnatal day P30, showing decreased spine density. [score:1]
Therefore, we first controlled whether OD plasticity was also blocked by our genetic deletion of miR-132/212. [score:1]
No difference between wt and null mice was present for all these indexes (One-way analysis of variance (ANOVA), P=0.159, P=0.595 and P=0.262 respectively; Fig. 2a–e) indicating that the maturation of these properties does not require miR-132/212. [score:1]
MiR132/212 [+/fl] male mice 26 were crossed with Emx1:Cre females to generate a mouse line carrying the floxed miR132/212 and Emx1:Cre alleles. [score:1]
Depth perception impairment in miR-132/212 null miceWe then asked whether the disruption of binocular matching for orientation preference caused by miR-132/212 deletion in the visual cortex could affect animals' perception abilities. [score:1]
Consistently, the analysis of binocular matching of orientation preference exclusively in broad-spiking cells showed a significant disruption of this property in miR-132/212 mutants (t-test, P<0.01; Fig. 3h) with no change in orientation selectivity (One-way ANOVA P=0.165; Fig. 3i). [score:1]
Moreover, the time spent by miR-132/212 mutant mice in the central portion of the apparatus was not different from that recorded for wt animals (t-test, P=0.126, Supplementary Fig. 5D), excluding the hypothesis that a combination of abnormal anxiety and activity levels might be related to their altered performance in the visual cliff arena. [score:1]
Our data also show that the impairment of binocular matching and depth perception due to miR-132/212 deletion is comparable to that observed in MD wt mice. [score:1]
Binocular matching of orientation preference is impaired in miR-132/212 null mice. [score:1]
Mice with ubiquitary deletion of miR132/212 and wt littermates were used 26. [score:1]
Deletion of miR-132/212 in excitatory neurons reproduces the binocular matching deficit of null mice. [score:1]
in a P30 wild-type mouse in a P30 miR-132/212 null mouse in a P60 wild-type mouse in a P60 miR-132/212 null mouse Supplementary Figures. [score:1]
Impaired binocular matching in Emx1:Cre-miR-132/212 [−/−] mice. [score:1]
We first performed an electrophysiological assessment of visual acuity (VA) in P27-28 miR-132/212 null mice 34. [score:1]
Mir-132/212 null mice show impaired binocular matchingPrevious data showed that after orientation selectivity completes its developmental trajectory, there is a process of binocular matching of preferred orientation 19. [score:1]
To independently test this hypothesis, we performed on P28 visual cortical samples obtained from mice with germ-line deletion of the miR-132/212 locus. [score:1]
We found that total activity levels of animals were not affected by the deletion of miR-132/212 (distance moved: t-test, P=0.285; velocity: t-test, P=0.303; Fig. 5f,g). [score:1]
We found that mutant mice had a significantly worse binocular matching of orientation preference with respect to wt age-matched littermates (Two-way ANOVA, effect of genotype P<0.001; post hoc Holm-Sidak test, P<0.01; Fig. 3a,b), suggesting that the lack of miR-132 family specifically disrupts this late developing property of visual cortical neurons while keeping monocular tuning properties intact. [score:1]
Depth perception impairment in miR-132/212 null mice. [score:1]
Interestingly, the impairment in stereoscopic abilities detected in miR-132/212 null mice was reminiscent of that observed in animals subjected to a 3-day MD and tested after the restoration of binocular vision (that is, 2 h after the reopening of the deprived eye, wt-md; Kruskal–Wallis One-way ANOVA on ranks, post hoc Dunn's method, Fig. 5e, Supplementary Fig. 5C). [score:1]
Analysis of the effect of miR-132/212 deletion on visual cortical transcriptome. [score:1]
It has been proposed that the response of visual cortical neurons to the inputs from the two eyes need to be tuned to similar orientations to encode binocular disparity of stimulus phase 19 50, suggesting that impaired matching of binocular orientation preference induced by miR-132/212 deletion underlies the defective depth perception of mutants. [score:1]
Moreover, the effects of MD on binocular matching were occluded by miR-132/212 deletion suggesting that MD might act on binocular matching by reducing miR-132/212 levels. [score:1]
Then, we analysed the influence of visual experience on binocular matching level in P27-28 miR-132/212 null and wt mice subjected to a 3-days MD. [score:1]
Our data support this possibility by showing that the absence of miR-132/212, that resulted in no OD plasticity, was associated with a specific impairment of binocular matching of orientation preference. [score:1]
We then asked whether the disruption of binocular matching for orientation preference caused by miR-132/212 deletion in the visual cortex could affect animals' perception abilities. [score:1]
[1 to 20 of 86 sentences]
8
[+] score: 195
Other miRNAs from this paper: mmu-mir-212
In combination with bioinformatics target site prediction algorithms (Targetscan), we selected Rasa1, Spred1 and Spry1 which have a high prediction context score and are conserved among species, as shown in Figure 4A and D. Since Rasa1 was already a confirmed miR-132 target 10, we only cloned the 3′UTR of Spred1 and Spry1 into a luciferase reporter vector and analysed whether miR-132 and miR-212 could suppress luciferase activity in HEK293 cells. [score:9]
As microRNA functions by inhibiting its targets, we reason that knockdown of Spred1, Spry1 and Rasa1 should have similar effect as overexpression of miR132 and miR-212. [score:8]
To the best of our knowledge, this is the first study showing a single microRNA family, and probably mediated via the more abundantly expressed miR-132, that can facilitate the arteriogenic responses by suppressing multiple targets within the Ras-MAPK pathway. [score:7]
Human umbilical venous endothelial cells (Lonza, Breda, the Netherland) were cultured in EGM2 according to manufacturer’s instructions, and all experiments were performed before passage 7. HUVECS were transfected with either 20 nmol/l Spred1 (s46287), Spry1 (s20026), Rasa1 (120290), Silencer select negative control#1 (4390843), or with mirVana miRNA mimic negative control (4464085), hsa-miR-132-3p mimics (MC10166), hsa-miR-212-3p mimics (MC10340), mirVana miRNA inhibitor negative control1 (4464077), hsa-miR-132-3p inhibitor (AM10166), hsa-miR-212-3p inhibitor (AM10340; all from Life Technologies) using Lipofectamine 2000 (Life Technologies). [score:7]
By using a non-linear one-phase exponential decay mo del and interpolation of the time of phosphorylated ERK1/2T [1/2] to reach 50%, we observed that T [1/2] was prolonged both by overexpression of miR-132/212 and by knockdown of its targets (Fig. 5E). [score:6]
Spred-1, Spry1 and Rasa1 are direct targets of the microRNA-132/212 familyBased on Ago-Hits-clip 27, PAR-CLIP 28 and CLASH studies 29 and our results above, we decided to focus on targets related to growth factor signalling. [score:6]
Following overexpression of miR-132 and miR-212 in HUVECs in the co-culture assays, we detected reduced levels of Spred1, Spry1 and Rasa1 protein; while inhibition of the miR-132 and miR-212 led to elevated Spred1, Spry1 and Rasa1 expression. [score:6]
We confirmed that Rasa1 is a direct target of miR-132 and miR-212, and further expanded their target spectrum thereby including Spred1 and Spry1. [score:6]
Knockdown of these three targets mimicked overexpression of miR-132 or miR-212 in the in vitro neovascularization assay and on the modulation of phosphorylated ERK1/2. [score:5]
To determine suppression efficiency of miR-132 and 212 on these targets, HEK293 cells were co -transfected with 200 ng of pMIR-REPORT- 3′UTR Luciferase vectors, or one of the mutated vectors, and a pMIR-REPORTβ-gal control plasmid to normalize for transfection efficiency. [score:5]
Figure 7 Expression of miR-132/212 targets and phosophorylated ERK1/2 in ischaemia limb. [score:5]
As expected, subsequent knockdown of Spred1, Spry1, Rasa1 and a combination of these three via siRNA knockdown in HUVECs (Fig. 6C) showed similar neovascularization responses as overexpression of miR-132 or miR-212, total number of junctions, tubules and tubule length were increased compared to control conditions (Fig. 6A and B). [score:4]
It has previously been shown that miR-132 is upregulated in endothelial cells by various pro-angiogenic stimuli such as hypoxia 15, VEGF 10, 15, and angiotensin II 16. [score:4]
Spred-1, Spry1 and Rasa1 are direct targets of the microRNA-132/212 family. [score:4]
MiRNA-132 and miR-212 is upregulated upon hind-limb ischaemia. [score:4]
Furthermore, we demonstrate that this effect is attributable to miR-132/212 modulation of the Ras-MAPK signalling pathway through direct targeting of Spred1 and Rasa1. [score:4]
Here, we show that upregulation of miR-132 and miR-212 upon hindlimb ischaemia is involved in the arteriogenic response: microRNA-132/212 KO animals display delayed perfusion restoration upon femoral artery occlusion. [score:4]
Very low density lipoprotein receptor knockout (KO) mice, displayed an aberrant neovascularization in the retina, associated with increased expression of miR-132. [score:4]
miR-132 and miR-212 were inhibited or enhanced in HUVECs only, either by using anti-miR-132 and anti-miR-212, or by supplementing miR-132 mimics and miR-212 mimics, respectively. [score:3]
Our results demonstrate a new role for miR-132 and miR-212 in the facilitation of the arteriogenic responses after hind-limb induced by targeting and enhancing Ras-MAPK signalling. [score:3]
A 1 kb fragment, which flanks conserved miR-132 -binding sequences of the spred1 untranslated region (UTR), and the full-length Spry1 3′UTR were cloned into the pMIR-REPORT Luciferase vector (Ambion, USA), as described previously 23. [score:3]
As expected, we found that miR-132 is expressed in endothelial cells (lectin BS-1 positive cells) of blood vessels and in cells surrounding the endothelial cell layer in WT mice only (Fig.  S1B). [score:3]
However, it is still possible that a specific cell population, highly expressing miR-212 but not miR-132, is more important for the vascular growth after hindlimb ischaemia. [score:3]
miR-132/212 family modulates Ras-MAPK signalling by targeting Spred1, Spry1 and Rasa1 in vivo. [score:3]
We therefore tested whether miR-132/212 could prolong Ras-MAPK signalling by inhibiting Spred1, Spry1 and Rasa1 in HUVECs. [score:3]
To further understand its function, we analysed which cell types express miR-132 in hind-limb tissue by in situ hybridization. [score:3]
Overexpression of miR-132 in human umbilical venous endothelial cells (HUVECs) promoted proliferation and migration in vitro, and transplanting these cells promoted vascularization in vivo 17. [score:3]
Compared with siRNA controls and miR controls, overexpression of miR-132 and miR-212 or knockdown of Spred1, Spry1and Rasa1, indeed prolonged ERK1/2 phosphorylation (Fig. 5A– D). [score:3]
Moreover, inhibition of miR-132 in the retina could reduce aberrant neovascularization 18 or corneal neovascularization 19. [score:3]
Figure 4Identification of Spred1 and Spry1 as direct miR-132/212 targets by luciferase assay and in cultured HUVECs. [score:3]
Conversely, inhibiting miR-132 and miR-212 using anti-miRs resulted in some decline in the total number of junctions, tubules and tubule length (Fig. 3B). [score:3]
In cancer, miR-132 promoted angiogenesis by suppressing one of the GTPase-activating proteins, called RASA1 10. [score:3]
The expression of miR-132/212 targets Spred1, Spry1 and Rasa1 in wildtype thigh blood vessels characterized by immunofluorescent staining. [score:3]
Although Spred1 and Rasa1 protein levels were higher in miR-132/212 KO mice, Spry1 expression levels were similar between WT and KO mice. [score:3]
To understand the function of miR-132 and miR-212 in arteriogenesis, we performed hind-limb ischaemia on WT mice and checked the expression of these two microRNAs in the thigh muscle at different time points after hind-limb ischaemia. [score:3]
The increased expression upon hindlimb ischaemia and the vascular localization of miR-132 suggests that miR-132 may play a role in vascular growth, for example, in arteriogenesis. [score:3]
Although these two miRNAs share the same seed sequences and hereby belong to the same miRNA family, the level of mature miR-132 expression is significantly higher than that of miR-212 in the thigh muscle, indicating that miR-132 might be more active in the arteriogenic response, as previously reported for miR-212 being a more dominant miRNA in angiogenesis (Fig. 1A). [score:3]
Given the fact that the expression of the mature miR-132 is 40-fold higher than miR-212 (Fig.  S1A), we tend to believe that miR-132 plays a major role in the arteriogenic response after hindlimb ischaemia. [score:3]
Figure 6Knockdown targets of miR132 and miR212 Rasa1, Spred1 and Spry1 mimics effect of miR-132 and miR-212 in HUVECs pericytes neovascularization assay. [score:3]
This indicates that these genes are also regulated by miR-132/212 in HUVECs (Fig. 4G and H). [score:2]
To further investigate the effect of microRNA-132/212 on vascular growth, we modulated miR-132/212 activity with overexpression or inhibition approaches in different in vitro neovascularization assays. [score:2]
In line with this hypothesis, a recent study showed that miR-212 is stronger in the regulation of vasodilatation than miR-132 40. [score:2]
miR-132/212 promotes endothelial cells neovascularization responses in vitroTo further investigate the effect of microRNA-132/212 on vascular growth, we modulated miR-132/212 activity with overexpression or inhibition approaches in different in vitro neovascularization assays. [score:2]
The expression of the miR-132/212 and their roles in Ex vivo neovascularization assay. [score:2]
Using 3′UTR reporters of Spred1 and Spry1, we demonstrated a direct binding of miR-132 and 212, which was abolished by disrupting the corresponding binding sites. [score:2]
We found that both miR-132 and miR-212 can significantly suppress the Spred1-3′UTR and Spry1-3′UTR luciferase activity at 25 nmol/l, compared with scramble control miRNAs (Fig. 4B and E). [score:2]
Hind-limb ischaemia was applied on 10–12 week old mice [10 WT (C57B6) and 13 miR-132/212 KO] as described previously 21. [score:1]
miR-132/212 modulates growth factor-activated Ras-MAPK signalling in HUVECs. [score:1]
Generation and genotyping of miR-132/212 KO mice. [score:1]
This extends the role for miR-132 beyond the ischaemic challenges and promoting angiogenesis. [score:1]
Aortas from both WT and miR-132/212 KO mice were surgically isolated, cleaned, dissected into 0.5 mm segments and embedded into fibrin as described before 25. [score:1]
was applied on 10–12 week old mice [10 WT (C57B6) and 13 miR-132/212 KO] as described previously 21. [score:1]
In addition, 25 nmol/l miR mimic controls, miR-132 mimics or miR-212 mimics were introduced by using Lipofectamine 2000 (Life Technologies). [score:1]
Note the sustain ERK1/2 phosphorylation is prolonged after miR-132, 212 transfection or siRNA against Spred1, Spry1, Rasa1 or combinations of the three. [score:1]
The biological function of miR-132 and miR-212 may be different, although they share the same seed sequence. [score:1]
miR-132/212 promotes endothelial cells neovascularization responses in vitro. [score:1]
Since both miR-132 and miR-212 are removed in the KO mice, it is impossible to determine which one should be responsible for the impaired arteriogenesis response. [score:1]
Note the higher percentage in the small vessels (≦400 a. u. ) but lower in the larger vessel in the miR-132/212 KO mice (N = 10 for WT and 13 for KO. [score:1]
Interestingly, transfection of miR-132 mimics rescued, and even significantly enhanced activation via increasing vascular branching. [score:1]
miR-132 and 212 are transcribed as a single transcript and further processed into two mature microRNAs, which are highly conserved among different species (Fig.  S1A). [score:1]
To monitor the effects of miR-132 and miR-212 in angiogenesis, transfected HUVEC-GFP and PKH26 stained pericytes were suspended in a 2.5 mg/ml collagen type I (BD Biosciences, USA) as described by Stratman et al. 26. [score:1]
Figure 3Effect of miR132 and miR212 in HUVECs angiogenesis in co-culture with pericytes. [score:1]
By qRT-PCR, we found that miR-132 and miR-212 levels were significantly increased on day 4 and day 7 (Fig. 1A and B) after hindlimb ischaemia in the adductor muscle. [score:1]
Hybridization was performed following manufacturer’s suggestions with DIG labelled miRCURY LNA miRNA detection probes (Exiqon, Vedbaek, Denmark) for miR-132 (38031-15), negative control miR-159 (99003-15) and positive control U6 (99002-15). [score:1]
Our in vitro observations were confirmed in vivo where levels of Rasa1 and Spred1 were significantly higher in the adductor muscle in the miR-132/212 KO mice upon hind-limb ischaemia. [score:1]
The generation of miR-132/212 KO mice has been described as previously 20. [score:1]
[1 to 20 of 66 sentences]
9
[+] score: 191
Other miRNAs from this paper: mmu-mir-125a, mmu-mir-122, mmu-mir-212, mmu-mir-375
In addition, hepatic leukemia factor -induced down-regulation of miR-132 suppresses TTK expression to inhibit proliferation, metastasis, and radioresistance in glioma cells [22]. [score:10]
Targetscan software revealed that Bmi-1 was a target of miR-132, which can also inactivate the protein kinase B (Akt)/mammalian target of rapamycin (mTOR) signaling pathway, suppressing proliferation, migration, and invasion in hepatocellular cancer [31]. [score:9]
In cervical cancer, Zhao et al. demonstrated that levels of microRNA-122 (miR-212) and miR-132, both of which are from the same gene cluster, are reduced in cancerous tissues compared to adjacent normal tissues; furthermore, over -expression of miR-212/132 increased cell cycle arrest at the G1/S phase, inhibited cell proliferation, increased E-cadherin levels, decreased vimentin levels, and inhibited EMT, migration, and invasion in cervical cancer cells by targeting Smad2 [26]. [score:8]
In summary, we identified a mechanism through which miR-132 affected the radiosensitivity of CC cells; up-regulation of miR-132 might sensitize CC cells to radiation by down -regulating Bmi-1 and might serve as a potential therapeutic target in the treatment of CC patients. [score:7]
Our results indicate that miR-132 was down-regulated in cervical cancer tissues and that its expression increased as radiation intensity increased. [score:6]
The median relative expression values of 1.96 for miRNA-132 and 5.11 for Bmi-1 mRNA were used as thresholds to separate CC patients into low and high expression groups. [score:5]
Cells were divided into six groups: the blank group, the miR-132 NC group, the miR-132 inhibitor group, the miR-132 mimics group, the siBmi-1 group, and the miR-132 inhibitor + siBmi-1 group. [score:5]
In addition, miR-132 expression in CC tissues was negatively correlated with Bmi-1 mRNA expression (r = -0.654, P < 0.05) (Figure 2B). [score:5]
Zhang and colleagues reported that miR-132 levels are lower in non-small cell lung cancer tissues than in adjacent noncancerous tissues and that miR-132 -mediated changes in the transforming growth factor β1 (TGF β1)/Smad2 axis suppress tumor cell metastasis by inhibiting cell migration, invasion, and epithelial-mesenchymal transition (EMT) [20]. [score:5]
Decreased miR-132 and increased Bmi-1 expression were more common in CC patients with locally advanced disease (stages IIa and IIIa), those with low- and moderately- differentiated tumors, and those with larger maximum focus tumor diameters (≥ 4 cm) (all P < 0.05). [score:5]
Over -expression of miR-132 and the resulting inhibition of Bmi-1 might be a biomarker for enhanced response to radiation. [score:5]
Initially, we found that miR-132 expression was reduced and Bmi-1 expression was elevated in cervical cancer tissues. [score:5]
Bmi-1 was confirmed as a possible target gene of miR-132 by Targetscan and miRanda software; the 3′-UTR of Bmi-1 mRNA contained a site that was complementary to the seed region of miRNA-132 (Figure 5A). [score:5]
Figure 2 (A) miR-132 expression and Bmi-1 mRNA expression were detected using qRT-PCR. [score:5]
miR-132 expression was higher and Bmi-1 mRNA expression was lower in radiotherapy-sensitive CC patients than in those who were insensitive (both P < 0.05, Figure 2A). [score:5]
Target relationship between miR-132 and Bmi-1. Target relationship between Bmi-1 and miR-132. [score:5]
In addition, cell apoptosis and miR-132 expression increased, while Bmi-1 mRNA expression decreased, as X-ray dose increased. [score:5]
In addition, miR-132 expression increased, while Bmi-1 mRNA expression decreased, as the X-ray dose increased. [score:5]
Mokutani et al. also found that miR-132 down-regulation and the resulting effects on anoctamin 1 are associated with poor prognosis in colorectal cancer [25]. [score:4]
Associations between miR-132 and Bmi-1 expression and radiotherapy sensitivity in HeLa, SiHa, and C33A cells. [score:3]
A small amount of tumor tissue was then removed for qRT-PCR, which revealed that miR-132 expression was higher in the miR-132-agomir + 8 Gy group than in the NC-agomir + 8 Gy group (P < 0.05, Figure 8D). [score:3]
Comparison of miRNA-132 and Bmi-1 expression in CC cells after different radiation doses. [score:3]
In this study, we explored the effects of miR-132 on Bmi-1 expression and radiosensitivity in HeLa, SiHa, and C33A CC cells, CC patients, and a xenograft CC mo del in mice. [score:3]
However, miR-132 and Bmi-1 expression were not associated with age, lymph node metastasis, or SCC-Ag (all P > 0.05, Table 1). [score:3]
Comparison of miR-132 and Bmi-1 expression in tumor and adjacent normal tissues. [score:3]
Proliferation was higher in the miR-132 inhibitor group than in the blank group after the radiation doses of 2, 4, 6 and 8 Gy (all P < 0.05). [score:3]
In addition, Zhang et al. found that miR-132 inhibited metastasis in non-small cell lung cancer by promoting epithelial-mesenchymal transition (EMT) through the Smad2 signaling pathway [20]. [score:3]
Associations between miR-132 and Bmi-1 expression and radiotherapy sensitivity. [score:3]
Comparison of miR-132 and Bmi-1 expression in radiotherapy-sensitive and insensitive patients. [score:3]
Correlation of miR-132 expression with radiosensitivity in a xenograft mouse mo del. [score:3]
This result was consistent with the bioinformatics prediction and confirmed that miR-132 was able to bind to the seed region in the Bmi-1 3′-UTR, indicating that Bmi-1 is a target gene of miR-132. [score:3]
MiR-132 expression was decreased (Figure 1A), while Bmi-1 mRNA and protein expression (Figure 1B–1D) were elevated, in CC tissues compared to adjacent normal tissues (all P < 0.05). [score:3]
The CCK-8 assay indicated that cell proliferation did not differ among the miR-132 NC, miR-132 inhibitor + siBmi-1, and blank groups after the 0, 2, 4, 6 or 8 Gy radiation doses (all P < 0.05). [score:2]
MiR-132 inhibitor and siBmi-1 were purchased from Guangzhou RiboBio Co. [score:2]
MiR-132 expression was increased (Figure 3B, 3E, and 3H) and Bmi-1 mRNA expression (Figure 3C, 3F, and 3I) was decreased at the 6 and 8 Gy doses compared to the 0, 2 and 4 Gy doses and at the 8 Gy dose compared to the 6 Gy dose (all P < 0.05). [score:2]
In this study, we investigated the mechanism by which the miRNA miR-132 affects the radiosensitivity of HeLa, SiHa, and C33A cervical cancer cells via regulation of Bmi-1 expression. [score:2]
However, few studies have examined the regulatory network downstream of miR-132 in CC. [score:2]
A quick change site-directed mutagenesis kit (Stratagene, La Jolla, California, USA) was used to mutate the binding regions of Bmi-1 and miR-132, and the mutated 3′-UTR was cloned into the PGL3 carrier to obtain the MT-3′UTR (mutant 3′-UTR). [score:2]
Cell apoptosis rates after the 0, 2, 4, 6 or 8 Gy doses of radiation did not differ in the miR-132 NC or miR-132 inhibitor + siBmi-1 groups compared to the blank group (all P > 0.05). [score:2]
These results suggest that miR-132 enhances radiosensitivity of CC cells by regulating cell apoptosis. [score:2]
Luciferase activity did not differ among the Bmi-1 3′–UTR-WT, miR-132 mimic, and miR-132 NC groups (Figure 5B). [score:1]
miRNA-132 mimics and miRNA NC plasmids were purchased from Guangzhou RiboBio Co. [score:1]
miR-132 promotes apoptosis in HeLa, SiHa, and C33A cells. [score:1]
In addition, tumor volumes were decreased in the miR-132-agomir + 8 Gy and siBmi-1 + 8 Gy groups. [score:1]
Cells were divided into four groups: WT + mimics group cells were transfected with miR-132 mimics + Bmi-1-WT; MT + mimics group cells were transfected with miR-132 mimics + Bmi-1-MT; WT + NC group cells were transfected with miR-132 NC + Bmi-1-WT; and MT + NC group cells were transfected with miR-132 NC + Bmi-1-MT. [score:1]
Using U6 as the internal reference for miR-132 and β-actin as the internal reference for Bmi-1, the reliability of PCR results was evaluated using a dissolution curve, and relative expression of target genes was calculated using the 2 [−ΔΔCt] method. [score:1]
The average tumor weights of 1.46 ± 0.24 g in the miR-132-agomir + 8 Gy group and 1.79 ± 0.13 g in the siBmi-1 + 8 Gy group were lower than the average tumor weight of 2.57 ± 0.57 g in the NC-agomir + 4 Gy group (all P < 0.05, Figure 8C). [score:1]
In addition, each mouse was injected with 2 nmol of either NC-agomir, miR-132-agomir, or siBmi-1 24 h before each radiotherapy dose. [score:1]
Figure 7Effects of miR-132 on apoptosis in (A) HeLa, (B) SiHa, and (C) C33A cells at different doses of X-ray radiation. [score:1]
Associations between miR-132 and Bmi-1 expression and clinicopathological characteristics in cervical cancer patients. [score:1]
After treatment with miRNA Agomir beginning on the 22 [nd] day, tumor growth was slower in the miR-132-agomir + 8 Gy and siBmi-1 + 8Gy groups than in the NC-agomir + 8 Gy group; this difference increased as treatment continued. [score:1]
Effects of miR-132 on proliferation in HeLa, SiHa, and C33A cells after different doses of radiation. [score:1]
Figure 5 (A) Binding site in miR-132 and the 3′-UTR of the Bmi-1 gene. [score:1]
Cell proliferation was lower in the miR-132 mimics and siBmi-1 groups than in the blank group after the 2, 4, 6 and 8 Gy doses (all P < 0.05). [score:1]
The mice were then divided among the NC-agomir + radiotherapy, miR-132-agomir + radiotherapy, and siBmi-1 + radiotherapy groups. [score:1]
Tumor weights were higher in the NC-agomir + 8 Gy group than in the miR-132-agomir + 8Gy and siBmi-1 + 8 Gy groups. [score:1]
Thirty-four days after tumor transplantation, the average tumor volumes of 1226.44 ± 138.30 mm [3] in the miR-132-agomir + 8 Gy group and 1446.88 ± 246.15 mm [3] in the siBmi-1 + 8 Gy group were lower than the average tumor volume of 2056.19 ± 204.82 mm [3] in the NC group. [score:1]
Correlations between miR-132 and Bmi-1 expression and clinicopathological characteristics in cervical carcinoma patients. [score:1]
Effects of miR-132 on apoptosis in (A) HeLa, (B) SiHa, and (C) C33A cells at different doses of X-ray radiation. [score:1]
Effects of miR-132 on the proliferation of HeLa, SiHa, and C33A cells. [score:1]
Effects of miR-132 on proliferation in (A) HeLa, (B) SiHa, and (C) C33A cells at different doses of X-ray radiation doses. [score:1]
Furthermore, our data revealed that miR-132 enhanced the radiosensitivity of CC cells by promoting cell apoptosis and proliferation. [score:1]
Effects of miR-132 on the radiosensitivity of Hela cell -induced tumors in nude mice. [score:1]
Figure 6Effects of miR-132 on proliferation in (A) HeLa, (B) SiHa, and (C) C33A cells at different doses of X-ray radiation doses. [score:1]
Figure 1 (A) miR-132. [score:1]
After tumors formed, the mice were irradiated with 60-Co γ and miR-132-agomir or NC-agomir was injected into the tumors. [score:1]
Effects of miR-132 on apoptosis in HeLa, SiHa, and C33A cells after different doses of radiation. [score:1]
[1 to 20 of 67 sentences]
10
[+] score: 189
After inhibiting miRNA-132 expression, Bax expression significantly increased (P < 0.05), but Bcl-2 expression significantly reduced (P < 0.05) compared with the miRNA-132 mimics group. [score:8]
Nevertheless, after inhibiting miRNA-132 expression, SOD expression significantly diminished (P < 0.05), but MDA expression significantly increased (P < 0.05) compared with the miRNA-132 mimics group. [score:8]
After suppressing miRNA-132 expression, TGF- β1 and p-smad3 expression significantly increased compared with the miRNA-132 mimics group (P < 0.05). [score:6]
This study revealed that overexpression of miRNA-132 has antioxidative stress and antiapoptotic effects, laying a theoretical foundation for the research and development of clinical targeted drugs. [score:6]
Wang et al. [7] have found that miRNA-132 inhibits the proliferation of human breast cancer cells by directly targeting FOXA1 gene. [score:6]
Downregulation of miRNA-132 Expression in Peripheral Blood of HF Patients. [score:6]
After overexpression of miRNA-132, Bax expression significantly diminished (P < 0.05), but Bcl-2 expression significantly increased (P < 0.05) compared with the mo del group. [score:6]
After overexpression of miRNA-132, SOD expression significantly increased (P < 0.05), but MDA expression significantly reduced (P < 0.05) compared with the mo del group. [score:6]
Downregulation of miRNA-132 Expression in a Mouse Mo del of HF. [score:6]
These findings suggested that overexpression of miRNA-132 could obviously inhibit oxidative stress induced by H [2]O [2] in H [9]C [2] cells. [score:5]
Overexpression of miRNA-132 Lessens the Expression of TGF- β1 and smad3. [score:5]
Overexpression of miRNA-132 Suppresses Oxidative Stress of H [9]C [2] Cells. [score:5]
MicroRNA-132 expression was downregulated in HF patients' blood. [score:5]
Previous studies showed that miRNA-132 plays a role in inhibiting cell proliferation by acting on the retinal tumor suppressor gene Rb [17, 18]. [score:5]
We found that, after overexpression of miRNA-132, TGF- β1 and smad3 expression noticeably diminished. [score:5]
miRNA-132 expression was detected with real-time fluorescence quantitative PCR after transfection with NC, miRNA-132 mimics, and miRNA-132 inhibitor (Figure 3(b)). [score:5]
These findings suggested that overexpression of miRNA-132 could dramatically suppress H [9]C [2] cell apoptosis induced by H [2]O [2]. [score:5]
Overexpression of miRNA-132 Suppresses Oxidative Stress of H [9]C [2] CellsTo verify miRNA-132 function, ELISA was utilized to detect SOD and MDA levels in the supernatant. [score:5]
Overexpression of microRNA-132 dramatically increased the antioxidant stress and antiapoptotic ability of H [9]C [2] cells and decreased the expression of TGF- β1 and smad3. [score:5]
After overexpression of miRNA-132, TGF- β1 and p-smad3 expression significantly decreased compared with the mo del group (P < 0.05). [score:4]
miRNA-132 expression significantly diminished after transfection with miRNA-132 inhibitor compared with the NC group (P < 0.05). [score:4]
Overexpression of miRNA-132 Lessens the Expression of TGF- β1 and smad3Western blot assay and real-time fluorescence quantitative PCR were utilized to measure the expression of TGF- β1 and p-smad3. [score:4]
The mouse HF mo del was established, and the expression of miRNA-132 was detected by PCR. [score:3]
Our results demonstrated that miRNA-132 expression obviously reduced in peripheral blood. [score:3]
These findings indicated that overexpression of miRNA-132 increased the stability of H [9]C [2] cells. [score:3]
H [9]C [2] cells were divided into three groups: NC group, miRNA-132 mimics group, and miRNA-132 inhibitor group. [score:3]
3.4. miRNA-132 Overexpression Enhances the Stability of H [9]C [2] CellsTo further verify the effect of miRNA-132 in mouse mo dels, we selected H [9]C [2] cell line. [score:3]
3.4. miRNA-132 Overexpression Enhances the Stability of H [9]C [2] Cells. [score:3]
In the present study, H [9]C [2] cells were transfected with miRNA-132 mimics and miRNA-132 inhibitor. [score:3]
Alzahrani et al. [6] have found that increased expression of miRNA-132 can reduce the incidence of chronic colitis associated tumors. [score:3]
Overexpression of miRNA-132 Mitigates H [9]C [2] Cell Apoptosis. [score:3]
After overexpression of miRNA-132, H [9]C [2] cells could obviously resist oxidative stress and apoptosis induced by H [2]O [2]. [score:3]
RT-qPCR was used to determine microRNA-132 expression. [score:3]
We assumed that miRNA-132 may play a negative regulatory role in the occurrence and development of HF. [score:3]
miRNA-132 mimics and miRNA-132 inhibitor lentiviral vectors (GenePharma, Shanghai, China) were constructed. [score:3]
H [9]C [2] cells were transfected with miRNA-132 mimics and miRNA-132 inhibitor. [score:3]
Data suggested that miRNA-132 expression significantly increased after transfection with miRNA-132 mimics compared with the NC group (P < 0.05). [score:2]
Real-time fluorescence quantitative PCR results showed that miRNA-132 expression significantly diminished in peripheral blood of HF patients compared with the control group (Figure 1). [score:2]
Real-time fluorescence quantitative PCR results confirmed that miRNA-132 plays a negative regulatory role in HF. [score:2]
In vitro experiments simulated the occurrence of HF to further explore miRNA-132 effect, which provides the theoretical basis for the research and development of HF drugs. [score:2]
Data suggested that miRNA-132 expression significantly reduced in HF group compared with the sham group (P < 0.05) (Figure 3(a)). [score:2]
Overexpression of miRNA-132 Mitigates H [9]C [2] Cell ApoptosisWestern blot assay and real-time fluorescence quantitative PCR were used to measure apoptosis related factors Bax and Bcl-2 expression. [score:2]
However, cell stability significantly reduced after transfection with miRNA-132 inhibitor compared with the NC group (P < 0.05; Figure 3(d)). [score:2]
After microRNA-132 transfection and H [9]C [2] cell apoptosis induced by H [2]O [2], antioxidant stress and antiapoptotic ability of the H [9]C [2] cells obviously increased. [score:1]
The present study investigated the effect of miRNA-132 in HF mo dels in vivo and in vitro to provide a theoretical basis for targeted therapy of clinical drugs. [score:1]
To further verify the effect of miRNA-132, we simulated HF mo dels in vitro. [score:1]
The study of miRNA-132 in pancreatic cancer is adequate. [score:1]
Real-time fluorescence quantitative PCR was used to determine miRNA-132 transfection. [score:1]
We further determined the stability of cells transfected with miRNA-132. [score:1]
To verify miRNA-132 function, ELISA was utilized to detect SOD and MDA levels in the supernatant. [score:1]
This study established a mouse mo del of HF to explore miRNA-132 effect. [score:1]
Nevertheless, the role of miRNA-132 in chronic HF has not been reported yet. [score:1]
We assumed that miRNA-132 may play a role in inhibiting cardiomyocyte fibrosis through TGF- β1 signaling pathway, but the precise mechanism requires further investigations. [score:1]
To further verify the effect of miRNA-132 in mouse mo dels, we selected H [9]C [2] cell line. [score:1]
To investigate the effect of miRNA-132 on HF, real-time fluorescence quantitative PCR was used to determine miRNA-132 expression in mouse myocardium. [score:1]
To explore the effect of microRNA-132 of heart failure and provide theoretical guidance for clinical treatment of heart failure (HF). [score:1]
[1 to 20 of 56 sentences]
11
[+] score: 184
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-1a-2, mmu-mir-1b
Indeed, two very recent studies did observe increases in spontaneous mEPSC frequency following either overexpression of miR132 [17] or downregulation of p250GAP, a target of miR132 [18]. [score:8]
In culture, upregulation of miR132 increases dendritic outgrowth in an activity -dependent fashion via suppression of a GTPase-activating protein [3], [4]. [score:6]
Thus, while Ca [v]2.1 is an intriguing computationally predicted target of miR132, its regulation by miR132 remains to be demonstrated and the expected phenotypic effect of such regulation is debated. [score:5]
Figure 3 shows that there was no change in either the size (EGFP 26.2±2.0 pA; miR132 24.4±2.3 pA; miR1 23.21±1.6 pA; all groups n = 15; One way ANOVA, P>0.5), or frequency (EGFP 5.9±1.7 Hz; miR132 6.8±1.3 Hz; miR1 5.8±1.3 Hz; all groups n = 15; One way ANOVA P>0.8) of mEPSCs in miR132 -overexpressing neurons relative to EGFP- and miR1 -overexpressing control neurons. [score:5]
Neurons overexpressing miR132 demonstrate significantly reduced synaptic depression during the train relative to EGFP and miR1 -overexpressing controls at all time points (P<0.05), but no change in recovery after the train. [score:5]
At 2–3 days in culture, hippocampal neurons were infected with Lentivirus encoding one of the following: 1) the miR132 primary transcript along with EGFP as a real-time visual reporter of infection, 2) miR1 primary transcript along with EGFP as a control for nonspecific microRNA overexpression, or 3) EGFP alone as a control for viral infection and EGFP expression. [score:5]
This result was slightly unexpected given that upregulation of miR132 was previously reported to increase neurite outgrowth [3], [4]. [score:4]
It is conceivable that a molecular target of miR132 negatively regulates processes such as postsynaptic receptor mobility or recovery from postsynaptic AMPAR desensitization. [score:4]
A gene ontology search of all the computationally predicted targets listed for miR132 in the mouse genome revealed the intriguing possibility that miR132 may negatively regulate the mRNA of the pore forming α [1A] subunit of the P/Q-type calcium channel (Ca [v]2.1). [score:4]
0015182.g001 Figure 1(A) Representative traces showing typical paired-pulse responses from EGFP-, mir132-, and miR1 -overexpressing neurons with stimulus artifacts and presynaptic action currents blanked for clarity. [score:3]
Overexpression of miR132 decreases synaptic depression in response to a train of stimuli, but does not affect the rate of refilling of the RRP. [score:3]
In the present study, we provide evidence that overexpression of miR132 in cultured hippocampal neurons leads to selective changes in short-term synaptic plasticity. [score:3]
Overexpression of miR132 did not affect postsynaptic receptor desensitization. [score:3]
Calcium dependence of release is not altered by overexpression of miR132. [score:3]
Calcium dependence of release is not altered by miR132 overexpression. [score:3]
Thus, the reduction in synaptic depression seen in miR132 -overexpressing neurons in response to either pairs of stimuli or a longer train is not likely due to an increase in the rate of refilling of the RRP. [score:3]
Whereas both EGFP and miR1 control neurons demonstrated paired-pulse depression (i. e. the second response was smaller than the first), expression of miR132 led to paired-pulse facilitation (i. e. the second response was larger than the first) and a significant change in the PPR (Figure 1C; EGFP 0.77±0.04, n = 34; miR132 1.06±0.06, n = 21; miR1 0.87±0.05, n = 13; One way ANOVA, P<0.0005). [score:3]
Overexpression of miR132 enhanced paired-pulse facilitation. [score:3]
Overexpression of miR132 did not affect basal synaptic transmission. [score:3]
miR132 overexpression had no significant effect on the calcium dependence of release (for all groups, n = 9, t-test for 1 mM and 10 mM P>0.05; scale bar for representative traces: 1nA, 10 ms). [score:3]
0015182.g003 Figure 3(Top) Traces show typical spontaneous mEPSCs recorded from control and miR132 -overexpressing neurons (Scale bars, 20 pA, 100 ms). [score:3]
Using this method, we found no difference between the sizes of the RRP in control versus miR132 -overexpressing neurons (Figure 4A; EGFP 25.7±3.6 nA, n = 21; miR132 27.3±4.3 nA, n = 21; P>0.75). [score:3]
While there are likely some residual errors in our peak current measurements, these are expected to be comparable between all groups—given the lack of effect of miR132, miR1 and EGFP expression on EPSC size—and are therefore not responsible for the effects on short-term plasticity observed with miR132 expression. [score:3]
To achieve overexpression of miR132, we engineered replication -deficient Lentivirus to encode the primary transcript of miR132 (pri-miR132). [score:3]
Overexpression of miR132 did not affect the size of the RRP or P [VR]. [score:3]
Overexpression of miR132 did not affect mEPSC size or frequency. [score:3]
miR132 has also been shown to regulate cellular excitability in cultured cells, possibly via regulation of ion channels [5]. [score:3]
The fact that we observed no change in either EPSC size or the frequency of spontaneous mEPSCs suggests that there was no change in the number of synapses made by miR132 -overexpressing neurons. [score:3]
The ratio of the ratio of total asynchronous to synchronous release during a train in miR132 overexpressing neurons, while reduced, was not significantly different from EGFP controls (EGFP 2.32+/− 0.27, n = 21; miR132 1.66+/− 0.25, n = 20; P>0.05). [score:3]
Overexpression of the mature miR132 transcript was verified by quantitative real-time PCR. [score:3]
Decreased synaptic depression in miR132 -overexpressing neurons is not due to a change in the size of the readily releasable pool or vesicular release probability. [score:3]
These findings suggest that the overexpression of miR132 does not affect the number of functional excitatory synapses or postsynaptic sensitivity to glutamate in hippocampal neurons. [score:3]
Here we show that overexpression of miR132 increases the paired-pulse ratio and decreases synaptic depression without affecting initial presynaptic release probability or postsynaptic sensitivity to neurotransmitter. [score:3]
Overexpression of miR132 increases short-term facilitation without affecting basal release probability. [score:3]
Because a change in release probability would be expected to change EPSC size, this lack of effect suggests that the overexpression of miR132 does not influence basal release probability. [score:3]
Averaged over 3 biological replicates, miR132 -overexpressing neurons had a roughly 45-fold increase in the amount of mature miR132 transcript relative to EGFP-infected and miR1-infected controls at the age of recording (13–15 days in culture; fold increase of miR132 transcript relative to EGFP: miR132 47.3±7.7, n = 3; miR1 1.2±0.3, n = 2). [score:3]
However, when the rate of refilling of the RRP was monitored using the response to a test stimulus delivered 1.5 s following the RRP-depleting train, there was no difference in the extent of recovery in neurons overexpressing miR132 (Figure 2B; EGFP 0.82±0.06, n = 33; miR132 0.89±0.08, n = 21; miR1 0.78±0.07, n = 13; One way ANOVA, P>0.5). [score:3]
The increase in PPR and the reduction of synaptic depression seen in miR132 expressing neurons could be consistent with a reduction in basal release probability [7]. [score:3]
Overexpression of miR132 did not affect the size of the RRP or P [VR] Depression during a train is commonly interpreted to represent depletion of the RRP [8], [9], [10]. [score:3]
We found a pronounced decrease in the rate of depression throughout the train in miR132 expressing neurons, relative to EGFP and miR1 controls (Figure 2B; 10 [th] Stimulus: EGFP 0.34±0.04, n = 33; miR132 0.69±0.07, n = 21; miR1 0.28±0.04, n = 13; One way ANOVA, P<0.0001; 40 [th] Stimulus: EGFP 0.15±0.02, n = 33; miR132 0.35±0.06, n = 21; miR1 0.09±0.02, n = 13; One way ANOVA, P<0.0005). [score:3]
Given that miR132 has been linked with dendritic outgrowth, a decrease in calcium sensitivity of release concomitant with an increase in synapse number in miR132 overexpressing neurons could conceivably explain the results observed in the present study. [score:3]
Overexpression of miR132 decreased synaptic depression. [score:3]
In order to detect possible changes in postsynaptic sensitivity to neurotransmitter or in the number of functional synapses, we tested the effect of miR132 overexpression on spontaneous miniature EPSCs (mEPSCs). [score:3]
While CTZ led to a slight (non-significant) decrease in the PPR in both EGFP controls and neurons overexpressing miR132, there was no difference in the magnitude of the effect of CTZ on the PPR of these two groups (PPRctz/PPRctrl: EGFP 0.83±0.09, n = 8; miR132 0.83±0.06, n = 8; P>0.99), indicating that miR132 does not enhance facilitation through postsynaptic effects on AMPAR mobility or desensitization. [score:3]
Our analyses revealed no significant difference in P [VR] between miR132 overexpressing neurons and EGFP controls (P [VR:] EGFP 0.06±0.01, n = 8; miR132 0.06±0.01, n = 8; P>0.90). [score:3]
0015182.g004 Figure 4(A) The average RRP size was not different between miR132 -overexpressing neurons and EGFP control neurons using the cumulative amplitude method. [score:3]
Like the fast synchronous component of release, the slower asynchronous component also tended to be greater at the end of the train in miR132 overexpressing neurons. [score:3]
Expression of mature miR132 was verified by quantitative real-time PCR using the TaqMan miRNA assay from Applied Biosystems, Inc. [score:2]
Our findings suggest that miR132 can modulate the computational properties of hippocampal neurons by regulating short-term plasticity in ways that promote facilitation and/or reduce synaptic depression without affecting basal synaptic transmission. [score:2]
Exposure to light also induces transcription of miR132 in the SCN in vivo, where it plays a role in regulating entrainment of the circadian clock [5]. [score:2]
These data indicate that miR132 selectively influences short-term plasticity without altering basal synaptic transmission. [score:1]
MicroRNA-132 (miR132) is a highly conserved miRNA that is induced by the neurotrophin BDNF in a CREB -dependent manner [3]. [score:1]
Therefore, our data suggest that miR132 does not affect the calcium dependence of release. [score:1]
The normalized peak EPSC amplitudes were not significantly different between groups at either 1 mM or 10 mM external calcium (Figure 5; 1 mM Ca [2+]: EGFP 0.35±0.04, miR132 0.33±0.04, P>0.70; 10 mM Ca [2+]: EGFP 1.66±0.21, miR132 1.83±0.26, P>0.60; n = 9 for all groups). [score:1]
To control for the specificity of miR132, in some experiments we also infected neurons with a Lentivirus encoding the primary transcript of miR1, a non-neural, heart specific miRNA. [score:1]
Together, these results suggest that the effects of miR132 on spontaneous release and neuronal morphology are complex, and likely influenced by undetermined variables. [score:1]
These data suggest that miR132 modulates a mechanism that influences the short-term plasticity of both synchronous and asynchronous neurotransmission, although the effect on synchronous release appears to be greater. [score:1]
Because miR132 has been found to affect neuronal morphology and excitability, we investigated the effects of miR132 overexpression on synaptic transmission and short-term plasticity. [score:1]
To study the effects of miR132 overexpression on synaptic transmission, we monitored the paired-pulse ratio (PPR; Figure 1A), a measure that is commonly used to identify changes in presynaptic release probability [7], in autaptic hippocampal neurons (Figure 1B). [score:1]
However, we found no effect of miR132 or miR1 on EPSC size (Figure 1D; EGFP 4.37±0.43 nA, n = 21; miR132 3.78±0.52 nA, n = 21; miR1 3.98±0.97 nA, n = 21; One way ANOVA, P>0.7). [score:1]
To rule out the possibility that overexpression of miR132 modifies the calcium dependence of release, we varied the external calcium concentration and measured the corresponding changes in EPSC peak amplitudes (normalized to EPSCs in the standard 2.5 mM external calcium) in miR132 and EGFP infected neurons. [score:1]
miR132 does not affect the size or the frequency of spontaneous mEPSCs. [score:1]
miR132 -mediated reduction in synaptic depression might be caused by an increase in the rate of refilling of the readily releasable pool of synaptic vesicles (RRP), leading to a larger steady-state synaptic response at the end of the train. [score:1]
The molecular mechanism of this effect remains elusive, and future studies will be aimed at evaluating candidate mRNA targets of miRNA132 that might mediate this phenotype. [score:1]
Furthermore, it cannot be explained by miR132 -induced changes in the calcium sensitivity of release or postsynaptic receptor desensitization. [score:1]
We have recently demonstrated that miR132 is rapidly transcribed in the hippocampus in vivo following enhanced neuronal activity and contextual fear conditioning [6]. [score:1]
These results show that miR132 influences short-term plasticity, perhaps by modulating release probability. [score:1]
Furthermore, post-hoc analysis showed that membrane resistance, membrane capacitance, and series resistance did not differ between groups (R [m]: EGFP 111.5±16.8 MΩ, n = 26; miR132 116.8±15.8 MΩ, n = 21, P>0.80; C [m]: EGFP 42.7±2.6 pF, n = 27; miR132 40.6±4.0 pF, n = 11, P>0.65; R [S]: EGFP 9.0±0.7 MΩ, n = 27; miR132 7.7±0.6 MΩ, n = 11, P>0.19). [score:1]
[1 to 20 of 68 sentences]
12
[+] score: 155
Other miRNAs from this paper: hsa-mir-212, hsa-mir-132, mmu-mir-212
We found a significant enrichment of miR-132 targets in the set of upregulated (but not downregulated) genes in 3xTg-AD [KO] mice (Fig. 2c). [score:9]
We first confirmed Sirt1 downregulation upon miR-132 overexpression in Neuro2a-APPSwe and HEK293-APPSwe cells (Fig. 3c). [score:6]
As expected, we observed a strong enrichment of miR-132 targets in the set of downregulated genes in Neuro2a [132] cells. [score:6]
Accordingly, all genes were downregulated upon miR-132 overexpression in Neuro2a cells (Fig. 2f). [score:6]
To this end, we introduced miR-132 mimics in Neuro2a and HEK293 cells stably expressing human APPSwe (Neuro2a-APPSwe, HEK293-APPSwe) 7. In both cell lines, miR-132 caused a significant downregulation of (soluble) human Aβ40 and Aβ42 levels as determined by (Fig. 3a). [score:6]
Another interesting observation is a physiological “switch” between miR-132 and Sirt1 expression levels during aging 40, which could be affected is disease conditions. [score:5]
This task is even more challenging as miR-132 targets likely change according to age, gender, cell type, species, and/or disease state. [score:5]
Note that the prediction tools (PITA, TargetScan, Pictar) made no distinction between miR-132 and miR-212 targets, as both miRs share the same seed sequence 20. [score:5]
At this moment, the physiological meaning of this correlation is uncertain, as miR-132 could be implicated in various steps of Aβ deposition (including propagation) by targeting various genes during disease progression. [score:5]
Strikingly, 3 out of 5 validated miR-132 targets have previously documented roles in the regulation of Aβ metabolism and/or pathology, including Sirt1, MAPK/ERK, and Tau (see). [score:4]
In Neuro2a cells overexpressing miR-132, we identified 4996 genes (5772 transcripts) that were misregulated using the same criteria. [score:4]
Gene ontology (GO) terms related to miR-132 networks included neuron projection development (GO: 0031175), negative regulation of transcription (GO: 0000122), and regulation of protein phosphorylation (GO: 0001932), all of which are important for brain function and maintenance (see Supplementary Table S4). [score:4]
Importantly, we identified a number of miR-132 targets with documented roles in the regulation of Aβ metabolism, providing a potential mechanism for the effects observed in cells, mice and humans. [score:4]
Consistent with this hypothesis, Sirt1 is downregulated in human AD samples, alongside of miR-132. [score:4]
Regulation of Aβ by miR-132 and its target Sirt1. [score:4]
Positive miR:target correlations in vivo have been documented before 61, including between miR-132 and Sirt1 in adults 40. [score:3]
How to cite this article: Hernandez-Rapp, J. et al. microRNA-132/212 deficiency enhances Aβ production and senile plaque deposition in Alzheimer’s disease triple transgenic mice. [score:3]
Identification of miR-132/212 targets in vivo. [score:3]
Right panel: overlap of transcripts (targets) between miR-132/212 networks in mice and cells. [score:3]
The fact that Sirt1 inhibition does not totally reproduce the effects of miR-132 on Aβ40 and Aβ42 (88.4% vs. [score:3]
It is clear that a combination of approaches [e. g., HITS-CLIP 59 and RISC-trap 60] will help determine the precise number of miR-132 targets in vivo. [score:3]
The miR-132 network comprised a total of 74 genes (as defined by PITA, TargetScan and Pictar) in 3xTg-AD mice and 143 genes in Neuro2a cells (Fig. 2b and Supplementary Table S3). [score:3]
We next asked if miR-132 can directly regulate Aβ production in cells. [score:3]
Using GeneMANIA 36, we found that most of miR-132 targets were highly interconnected (see Supplementary Fig. S2). [score:3]
Clinical association between miR-132 and Aβ in Alzheimer’s disease. [score:3]
Another interesting miR-132 target is Mapk1/ERK2. [score:3]
Interestingly, close to 40% (1057/2847) of affected genes in the 3xTg-AD [KO] mice were also changed in forebrain-specific miR-132/212 adult knockout mice 43. [score:2]
Regulation of Aβ production by miR-132. [score:2]
In this study, we used miR-132/212 knockout mice 28 that we crossed with triple transgenic AD (3xTg-AD) mice 23. [score:2]
This is a direct follow-up of our previous work linking miR-132 function to Tau pathology in AD. [score:2]
At first glance, this may seem contradictory to our results in mice and cells; however, we anticipate many compensatory mechanisms in the human AD brain that would compromise the delicate balance between miR-132 and Sirt1 regulation. [score:2]
We have shown that CREB (and BDNF) is indeed affected in miR-132/212 knockout mice 19, consistent with our RNA-Seq results. [score:2]
In AD mice, we identified a total of 2847 genes (3311 transcripts) that were misregulated in the absence of miR-132/212 (Fig. 2b and Supplementary Table S2). [score:2]
The fact that Tau is hyperphosphorylated in miR-132/212 knockout mice 16 is consistent with this hypothesis. [score:2]
Cortical and hippocampal tissues were isolated from 3xTg-AD mice with (3xTg-AD [WT]) or without (3xTg-AD [KO]) the miR-132/212 cluster (see). [score:1]
Thus, additional studies with a higher number of patients are necessary to draw definitive conclusions with regard to the clinical link between miR-132/212 and Aβ. [score:1]
Notably, no correlation was found between miR-132 (or miR-212), Sirt1 and Aβ in individual groups (controls, MCI, AD) (see Supplementary Table S5). [score:1]
Nearly 25% (32/144) of genes in the miR-132 networks were found in common between 3xTg-AD [KO] mice and Neuro2a [132] cells. [score:1]
We have previously shown that miR-132/212 deficiency in mice promoted Tau hyperphosphorylation and aggregation 16. [score:1]
In conclusion, we provide strong evidence that the miR-132/212 network controls various aspects of AD pathologies in mice, including Aβ pathology (herein), Tau pathology, and memory impairments. [score:1]
In an independent cohort (Douglas Bell Canada brain bank) 16, we confirmed a decrease of Sirt1 in AD brains (Fig. 4h), and also correlated with miR-132 (Fig. 4i). [score:1]
We have recently shown that miR-132/212 deficiency in 3xTg-AD mice leads to enhanced Tau pathology and memory impairment, which can be rescued in part by the reintroduction of miR-132 mimics 16. [score:1]
For comparative purposes, we also included RNA from Neuro2a cells treated with miR-132 mimics (Neuro2a [132]) or a scrambled control (Neuro2a [Scr]). [score:1]
Next steps include to identify key miR-132/212 target genes and to evaluate the precise role of miR-132/212 networks in various physiological and pathological contexts. [score:1]
It is interesting to note that miR-132/212 loss has a particularly strong impact on (mouse and human) Aβ42 production and aggregation, an effect related to yet unknown mechanisms. [score:1]
We also found a significant correlation between miR-132 and Aβ suggesting a clinical relationship between miR-132 levels and AD progression. [score:1]
In attempt to provide clinical support for our observations, we first observed a good correlation between miR-132 and Sirt1 (protein) in humans. [score:1]
In these latter conditions ectopic miR-132 levels reached ~600 fold over endogenous levels (see Supplementary Fig. S3). [score:1]
Identification of miR-132 gene networks in vivo. [score:1]
51.9%, respectively) supports a cooperative mode of action of the miR-132 network. [score:1]
Correlation between miR-132 and Aβ in humans. [score:1]
Thus, loss of miR-132/212 in mice promotes Aβ production, aggregation and deposition. [score:1]
One example is a feedback loop between miR-132, BDNF and CREB 20 57, a pleiotropic transcription factor involved in cell proliferation and survival. [score:1]
Lastly, neither miR-132/212 levels nor the other settings (insoluble Aβ42, amyloid plaques, Sirt1) correlated with age of death of patients (see Supplementary Fig. S5). [score:1]
It is notable that most (~97%) genes affected in our mouse or cell systems do not harbor miR-132/212 binding sites. [score:1]
To uncover miR-132 networks, we performed genome-wide transcriptomics using (RNA-Seq). [score:1]
The goal of this study was to determine the impact of miR-132/212 loss on Aβ metabolism. [score:1]
We found a significant correlation between miR-132, insoluble Aβ42 levels (Fig. 4a), and amyloid plaque count in all cases (Fig. 4b). [score:1]
We finally asked if miR-132 could be clinically related to Aβ. [score:1]
Sirt1 correlated with miR-132 (Fig. 4c) as well as insoluble Aβ42 (Fig. 4g). [score:1]
The generation of 3xTg-AD mice lacking the miR-132/212 cluster has been described previously 16. [score:1]
miR-132/212 deficiency in mice promotes Aβ pathology. [score:1]
Analysis of Aβ metabolism in miR-132/212 -deficient AD mice. [score:1]
[1 to 20 of 63 sentences]
13
[+] score: 152
However, while overexpression of miR-132 suppressed light -induced Per1 expression consistent with reduced behavioral phase shifts, down regulation of miR-132 by antagomir treatment also caused reduced light induced PER2 expression, in apparent contradiction to an enhanced behavioral phase shifting [28, 29]. [score:10]
Importantly, it has been reported that miR-132 target genes Poly(A) binding protein interacting protein 2 (Paip2a) and B-cell translocation gene 2, anti-proliferative (Btg2) dampen basal Per expression and attenuate PER protein translation, and thereby accelerate the inhibition of Per gene transcription [29, 44]. [score:9]
In particular, Methyl-CpG -binding protein 2 Mecp2, which is involved in chromatin remo deling and a target of miR-132 and miR-212, activates Per transcription while the miR-132 target genes PAIP2A and BTG2 attenuate PER protein translation, both of which may result in a dampening of light induced Per expression or accelerated PER decay [29, 44], thus, influencing behavioral resetting. [score:9]
Contradictory results between knockout, knockdown and overexpression studies (summarized in Table 1) might be explained by parallel, but independent effects of miR-132 and miR-212 on behavioral resetting and Per gene expression in the SCN. [score:7]
Diurnal variation of miR-132 and miR-212 expression data was tested by fitting a cosine wave (equation y = B + (A * cos (2 * π * ((x–Ps) / 24)))) to gene expression data, where B is the baseline, A is the amplitude, Ps is the phase shift, with a fixed 24-hour period; significance was determined by F-test. [score:5]
It has been reported that, miR-132 transcription itself is also light inducible and miR-132 induction inhibits light induced Per1 and Per2 expression [28]. [score:5]
Direct targets of miR-212 and miR-132 in the SCN are known to interact with Per genes [29, 44]. [score:4]
Future studies are required to identify the miR132/212 targets whose regulation may mediate this effect. [score:4]
Nevertheless, we cannot exclude that some of the observed effects might be mediated by miR effects in SCN-afferent tissues such as the retina where miR-132/212 expression has been found [45] or the bed nucleus of the stria terminalis. [score:3]
We found that miR-132 [-/-] /212 [-/-] C57BL/6N mice did not exhibit a change in Per expression upon light stimulation, which is consistent with their unaffected behavioral resetting. [score:3]
Due to their identical “seed” sequence [27] and in order to avoid redundancy effects after targeting of either miR-132 or miR-212 alone, we have used mice lacking both miRs (miR-132 [-/-] /212 [-/-]). [score:3]
Interestingly, neither overexpression nor knockdown of miR-132 had an effect on the core clock mechanism (results from different studies are compared in Table 1). [score:3]
The miR-132/212 gene knockout used in our study results in a complete loss-of-function whereas a knockdown approach might not be as efficient. [score:3]
miR-132 and miR-212 expression in the SCN. [score:3]
In accordance, miR-132 overexpression in C57BL/6 mice resulted in reduction of light -induced PER1/2 levels and photic resetting of behavior [29]. [score:3]
Circadian profiles of miR-132 and miR-212 expression were determined in the SCN of 129/Sv wildtype mice. [score:3]
Interestingly, although light responsiveness of Per1 and Per2 expression in the SCN was completely abolished in miR-132 [-/-] /212 [-/-] 129/Sv mice, they demonstrated enhanced phase-shifting behavior. [score:3]
For all experiments, 2–3 months old in-house bred WT and homozygous miR-132 [-/-] /212 [-/-] (KO) littermate mice in either of the background strains (C57BL/6N and 129/Sv) were used The miR-212/132 null mouse line has been generated by genomic targeting of the miR-212/132 locus in ES cells that has been derived from inbred wild-type 129/Sv (full name: 129S2/SvPasOrlRj) background. [score:3]
We found the clock modulator miR-132 and miR-212 to be expressed rhythmically in the central circadian clock. [score:3]
This is in accordance with previous reports using miR-132 antagomirs in C57BL/6J mice which led to a marked reduction of light induced Per1 gene expression and enhanced phase shifts [28]. [score:3]
Our data confirm previous experiments using miR-132 intra-cerebral antagomir infusion and overexpression in the forebrain showing that miR-132 acts as a negative modulator of light -induced resetting of the SCN pacemaker [28, 29]. [score:3]
miR-212 and miR-132 share the same seed region and they can therefore target the same mRNAs [27]. [score:3]
miR-212 and miR-132 are strongly expressed in the SCN of 129/Sv mice (Fig 1A and 1B) and exhibit rhythmic transcription profiles under constant darkness (DD) conditions (Fig 1C and 1D). [score:3]
This role for miR-132 as modulator of clock phase shifting was supported by overexpression experiments [29]. [score:3]
Antagomir application had previously identified miR-132 as modulator of light -induced clock gene expression in the SCN and activity resetting [28]. [score:3]
Data are represented as mean ± SEM, ** p < 0.01, *** p < 0.001. miR-212 and miR-132 are strongly expressed in the SCN of 129/Sv mice (Fig 1A and 1B) and exhibit rhythmic transcription profiles under constant darkness (DD) conditions (Fig 1C and 1D). [score:3]
However, other mechanisms than Per regulation may play a role in determining resetting in miR-132 [-/-] /212 [-/-] mice, e. g. it can be speculated that the weaker adaptation ability of miR-132 [-/-] /212 [-/-] mice, similar to Per1 -deficient mice, may be the result of a weakened circadian oscillator, indicated by reduced circadian pacemaker amplitude, as was also suggested for Clock mutant mice [49]. [score:2]
This link between Per gene modulation and phase shift regulation by the miR-132/212 family, however, needs to be further examined. [score:2]
Our double knockout is also efficiently circumventing a potential miR-132 and miR-212 redundancy. [score:2]
miR-132/212 regulate core clock properties in a background -dependent manner. [score:2]
Our work highlights strain-specific functions of miR-132/212 in the regulation of the murine SCN pacemaker. [score:2]
We found that knockout of miR-132/212 affects SCN period length and photic resetting differentially in C57BL/6N and 129S2/SvPasOrlRj (129/Sv) inbred mouse strains. [score:2]
Thus, to avoid possible redundancy, we have examined the circadian role of the miR-132/212 family in double knockout mice. [score:2]
miR-132/212 regulates phase shifts in a background -dependent manner. [score:2]
0176547.g003 Fig 3(A-D) Representative double-plotted actograms of WT (A, B) and miR-132 [-/-] /212 [-/-] (C, D) mice in constant light conditions. [score:1]
Our results further suggest a strain and light-regimen specific function of miR-132/212 in the clock machinery itself, as revealed by strain -dependent effects on the free-running period length in DD and LL. [score:1]
Indeed, we found that miR-132/212-deficiency in 129/Sv mice modulates circadian light responses, with respect to resetting and Per gene induction. [score:1]
Interestingly, miR-132/212-deficiency abolished elevation of Per1 and Per2 mRNA levels after photic stimulation in 129/Sv mice, even though behavioral phase delays were increased (compare Fig 4A, 4C and4E and Fig 5A–5D, 5E and 5G). [score:1]
Loss of miR-132/212 did not affect LL period length in 129/Sv mice (Fig 3A, 3C and 3G), but increased the circadian day length in mice on a C57BL/6N background (Fig 3A–3D and 3G). [score:1]
Taken together, we have shown that miR-132/212 are background -dependent modulators of the circadian clock. [score:1]
Indeed, miR-132/212 loss-of-function on a 129/Sv background evoked a marked increase of light pulse -induced behavioral phase delays (Fig 4A, 4C and 4E). [score:1]
Increased phase shifts in miR-132/212 -deficient 129/Sv mice are accompanied by diminished light induction of Per gene transcription in the SCN. [score:1]
Circadian phenotypes in miR-132 [-/-] /212 [-/-] mice were generally more pronounced in the 129/Sv than in the C57BL/6N strain. [score:1]
In contrast, no significant effect on free-running period length was observed in miR-132 [-/-] /212 [-/-] mice in C57BL/6N background (Fig 2B, 2D and 2I). [score:1]
Significant rhythms are illustrated with fitted cosine curves (Cosine-wave regression, F-test: (C) miR-132: p < 0.01, (D) miR-212: p < 0.05). [score:1]
Such period changes indicate that miR-132/212-deficiency significantly impairs the properties of the endogenous circadian clockwork in both strains. [score:1]
Thus, miR-132/212-deficiency may enhance the free-running period in miR-132 [-/-] /212 [-/-] mice via this mechanism. [score:1]
miR-132 and miR-212 are produced from a single transcript encoded by the murine miR-132/212 locus on chromosome 11 [24]. [score:1]
Of note, Per1 -deficient mice exhibit an increased phase shifting capacity similar to the one documented in miR-132 [-/-] /212 [-/-] 129/Sv mice [48]. [score:1]
Nevertheless, loss-of-function of, both, miR-132 and miR-212 on the 129/Sv background seemed to further enhance the previously described circadian resetting phenotype. [score:1]
We found that miR-132/212-deficiency affects SCN clock properties as manifested by lengthening of the free-running period length in both inbred strains examined. [score:1]
Indeed, the main functions of miR-212 and miR-132 overlap in the context of neuronal or immune functions. [score:1]
Influence of miR-132/212 deletion on the period length in constant darkness. [score:1]
Such apparent discrepancies between studies may be caused, at least in part, by genetic background effects on miR-132 function. [score:1]
miR-132 and miR-212 show overlapping circadian oscillations in the SCN with slightly different phases. [score:1]
To test whether loss-of-function of miR-132/212 affects light induced Per transactivation in different mouse lines, we examined photic induction of Per1 and Per2 in response to a 15-min light pulse (20 lux) at CT15 in both genotypes and strains by in situ hybridization on SCN-containing sections. [score:1]
miR-132/212-deficiency differentially affects photic phase shifts in C57BL/6N and 129/Sv strains. [score:1]
Influence of miR-132/212 deletion on behavioral phase shifts after single light pulses. [score:1]
Influence of miR-132/212 deletion on the period length in constant light. [score:1]
miR-132/212-deficiency differentially affects the free-running period length of locomotor activity in 129/Sv and C57BL background strains. [score:1]
Taken together, miR-132/212-deficiency lengthened the circadian period of the SCN pacemaker in a strain- and light regimen -dependent way. [score:1]
Loss of miR-132/212 prolonged the free-running period in constant darkness in the 129/Sv background, while increasing the free-running period in constant light conditions in the C57BL/6N strain. [score:1]
0176547.g001 Fig 1(A, B) Gene expression patterns of miR-132 (A) and miR-212 (B) in the brain of 129/Sv mice measured by ISH. [score:1]
[1 to 20 of 63 sentences]
14
[+] score: 147
Interestingly, expression of methyl CpG–binding protein 2 (MeCP2) is also tightly regulated by miR132 [18], and altered expression of MeCP2 has been shown to be an underlying element in the development of Rett syndrome, a neuro-developmental disorder in which dendritic development and synaptogenesis are affected [19]– [21]. [score:9]
Bitransgenic expression of tTA::miR132 in vivo To explore the functional role of miR132 in vivo, our lab generated a tetracycline response transgenic mouse strain, which bidirectionally drives the expression of miR132 and cyan fluorescent protein (CFP). [score:6]
Relative to tTA littermates, mice over -expressing miR132 showed a decrease in MeCP2 expression within the excitatory cell layers of the hippocampus. [score:5]
Immunohistochemical labeling revealed significant decreases in MeCP2 expression in both the CA1 cell layer and GCL of tTA::miR132 mice, relative to control littermates that only express tTA (Fig. 4A-C). [score:5]
Some of these effects appear to be mediated by the down regulation of the miR132 target p250GAP, which, in turn, allows for Rac1-PAK -mediated spinogenesis [12], [13]. [score:4]
To explore the functional role of miR132 in vivo, our lab generated a tetracycline response transgenic mouse strain, which bidirectionally drives the expression of miR132 and cyan fluorescent protein (CFP). [score:4]
Beyond simply validating the function of transgenic miR132, the data presented here, showing a down-regulation of MeCP2, has potentially significant ramifications for cognitive performance. [score:4]
Nevertheless, our data showing that miR132 markedly affects MeCP2 expression in vivo, provide a strong rationale for examining whether dysregulation of miR132 could be contributing to Rett Syndrome and other MeCP2-related disorders. [score:4]
These data reveal a profound cognitive deficit resulting from dysregulation/overexpression of miR132. [score:4]
This observation is of particular interest, given that the expression of endogenous miR132 is under the control of CREB [10], a transcription factor that plays a key role in regulating activity -dependent neuronal plasticity [31]. [score:4]
Further, the work of Impey et al. [13] showed that miR132 regulates synapse formation and function, thus raising the possibility that over -expression of miR132 affects synaptic communication in vivo. [score:4]
The effects of transgenic miR132 on both spine density and MeCP2 expression raised the possibility that miR132 influences cognitive performance. [score:3]
To test the functionality of transgenic miR132 at a molecular level, we examined the expression of MeCP2. [score:3]
Our data are consistent with these findings: transgenic miR132 led to a significant reduction in MeCP2 expression in the hippocampus. [score:3]
Decreased MeCP2 expression in tTA::miR132 mice. [score:3]
Decreased memory capability in mice over expressing miR132. [score:3]
Thus the miR132 transgene was constitutively expressed. [score:3]
Here, we explored the role of miR132 in vivo using a bitransgenic tTA::miR132 mouse mo del, in which miR132 was over expressed in excitatory neurons throughout the forebrain. [score:3]
This observation is consistent with our data on transgenic miR132 over -expression, and raises the interesting prospect that a more moderate increase in transgenic miR132 could reveal a facilitatory role for miR132 in learning and memory. [score:3]
In conclusion, the findings reported here, coupled with prior work, indicate that miR132 is part of an activity -dependent gene expression program that underlies neuronal plasticity. [score:3]
Western analysis of hippocampal lysates, showed a parallel attenuation of MeCP2 expression in tTA::miR132 versus tTA transgenic animals (Fig. 4D and E). [score:3]
To this end, the tTA::miR132 mice were crossed with a transgenic line expressing green fluorescent protein (GFP) under the control of the thy1 promoter. [score:3]
miR132/CFP transgene expression. [score:3]
Consistent with previous in vitro data on miR132, mice that express transgenic miR132 showed a significant increase in spine density in CA1 neuronal dendrites over Thy-1::tTA: control littermates. [score:3]
Overexpression of miR132 impairs novel object recognition memory. [score:3]
One potential explanation for this discord is that miR132 targets a large number of mRNA species, some of which, such as p250 GAP, have been shown to increase neuronal complexity [29], [12]. [score:3]
This examination was based, in part, on recent work showing that the brain-enriched ‘long-form’ 3′ UTR of MeCP2 contains a phylogenetically conserved miR132 binding site, and that miR132 transfection of cortical neurons leads to a marked attenuation of MeCP2 expression [18]. [score:3]
Bitransgenic expression of tTA::miR132 in vivo. [score:3]
To begin to address the potential role of miR132 in vivo, we developed a transgenic mouse strain that over-expresses miR132 in forebrain neurons. [score:3]
Further work examining miR132 functionality in both health and disease in merited. [score:3]
Future studies in which transgenic expression of miR132 is carefully titered with doxycycline will test this possibility. [score:3]
Collectively, these data reveal miR132 as a potent regulator of neuronal structure and CNS function. [score:2]
Of note, MeCP2 expression was significantly reduced in tTA::miR132 mice (n = 7) compared to monotransgenic controls (n = 8) (**P<0.01, *P<0.05). [score:2]
miR132 is processed from the intron of a small non-coding RNA gene and is robustly responsive to an array of physiological and pathophysiological stimuli [10]– [16]. [score:1]
In contrast to monotransgenic littermates (tTA and miR132), which spent more time exploring novel objects than familiar ones, tTA::miR132 mice showed no significant capacity for object discrimination. [score:1]
This effect is somewhat inconsistent with the increase in spine density observed in the miR132 mice. [score:1]
This finding is consistent with recent work using cell culture and brain slice -based methodologies, which showed that miR132 increased spinogenesis [13]. [score:1]
Using a thy1-GFP morphological marker, we demonstrated that in CA1 pyramidal neurons, transgenic miR132 induces an increase in dendrite spine density. [score:1]
Quantitative real-time RT-PCR revealed that the transgene lead to an ∼7-fold increase in the mature form miR132, relative to tTA monotransgenic littermates (Fig. 1B). [score:1]
0015497.g003 Figure 3(A) Representative confocal images of CA1 pyramidal neuron basal dendrites from tTA::miR132 transgenic and tTA monotransgenic tissue. [score:1]
The premiR132 sequence from the pCAG-miR132 vector [10] was subcloned into the multiple cloning site of the pBI-CFP vector to generate the final TET-response element-controlled miR132-CFP vector. [score:1]
A and B: Top panels) Representative immunohistochemical labeling for MeCP2 in the dorsal hippocampus of tTA monotransgenic (A) and tTA::miR132 bitransgenic (B) mice. [score:1]
Transgenic miR132 affects neuronal morphology. [score:1]
These data indicate that miR132 modulates neuronal structural features associated with synaptic communication. [score:1]
Indeed, we found that tTA::miR132 mice performed poorly on a hippocampal -dependent novel object recognition task, which is designed to test the integrity of recognition memory [24], [30]. [score:1]
Thus, miR132 appears to be well-positioned to couple synaptic activity to neuronal structural/functional plasticity. [score:1]
These data support the aforementioned studies and thus, raise the possibility that transgenic miR132 could affect cognitive function. [score:1]
Generation of miR132 transgenic mice. [score:1]
In contrast however, tTA::miR132 bitransgenic mice showed no discrimination between the novel and familiar objects (Fig. 5). [score:1]
Further, quantitative analysis of the immunofluorescence signal intensity did not detect a significant additive effect of Thy-1 GFP and miR132-CFP reporters, relative to Thy-1 GFP labeling alone (data not shown). [score:1]
Within this context, particular attention has been paid to the miRNA132 (miR132). [score:1]
In support of this approach, immunofluorescence labeling of tTA::miR132 tissue with this antibody concentration did not allow for clear visualization of the CFP reporter (Fig. 2D). [score:1]
0015497.g001 Figure 1(A) PCR -based genotyping results for the tTA and miR132; of note, only mouse #4 contains both the tTA and miR132 transgenes. [score:1]
0015497.g004 Figure 4 A and B: Top panels) Representative immunohistochemical labeling for MeCP2 in the dorsal hippocampus of tTA monotransgenic (A) and tTA::miR132 bitransgenic (B) mice. [score:1]
Decreases in MeCP2 levels in the tTA::miR132 hippocampus. [score:1]
Changes in dendritic morphology of tTA::miR132 mice. [score:1]
Scale bars: 200 µm in A, 100 µm in B, 10 µm in C, 200 µm in D. The spine density of CA1 neurons expressing the Thy1-GFP hippocampal neurons was measured from coronal sections over 20 µm lengths of basal dendrites from Thy-1::tTA::miR132 triple transgenic mice and from Thy-1::tTA: control littermates (Fig. 3A, B). [score:1]
With respect to neuronal function, miR132 has been shown to influence dendritic growth and spinogenesis in cultured hippocampal neurons and in brain slices [10], [12], [17]. [score:1]
To elucidate the behavioral ramifications of transgenic miR132, we examined the recall memory of tTA::miR132 mice using a novel object recognition task. [score:1]
As expected in animals with a fully intact recall memory, monotransganic littermate control mice (i. e., tTA mice lacking the responder gene, and miR132 transgenic mice lacking the driver gene) spent more time with the novel object than the familiar one. [score:1]
Morphometric analysis revealed a marked effect of transgenic miR132 on hippocampal neuronal morphology. [score:1]
Given prior work showing that miR132 affects the morphology of cultured neurons, we initially examined neuronal ultrastructure in tTA::miR132 mice. [score:1]
Given recent work using in vitro mo del systems showing that MeCP2 is a target of miR132 [18], we investigated whether transgenic miR132 affected MeCP2 levels in the hippocampus. [score:1]
[1 to 20 of 63 sentences]
15
[+] score: 146
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
ACTH up-regulated the expression of miRNA-212, miRNA-182, miRNA-183, miRNA-132, and miRNA-96 and down-regulated the levels of miRNA-466b, miRNA-214, miRNA-503, and miRNA-27a. [score:9]
Both ACTH and 17α-E2 up-regulated the expression of miRNA-212, miRNA-132, miRNA-154, miRNA-494, miRNA-872, miRNA-194, and miRNA-24-1, but reduced the expression of miRNA-322, miRNA-20b, miRNA-339, miRNA-27a, miRNA-551b, and miRNA-1224. [score:8]
Treatment of MLTC-1 cells with Bt [2]cAMP for 6 h increased the expression of miRNA-212, miRNA-183, miRNA-132, miRNA-182 and miRNA-96, and inhibited the expression of miRNA-138 and miRNA-19a. [score:7]
Treatment of MLTC-1 cells with Bt [2]cAMP for 6 h increased the expression of miRNA-212, miRNA-183, miRNA-132, miRNA-182 and miRNA-96 and inhibited the expression of miRNA-138 and miRNA-19a (Fig. 4B ). [score:7]
qRT-PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats (Fig. 3 ). [score:7]
Real-time PCR (qRT-PCR) measurements demonstrated that ACTH treatment upregulated the expression of miRNA-212, miRNA-183, miRNA-182, miRNA-132 and miRNA-96, while down -regulating the expression of miRNA-466b, miRNA-214, miRNA-503 and miRNA-27a. [score:7]
The levels of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377, and miRNA-96 were up-regulated, whereas miR-125b, miRNA-200b, miR-122, miRNA-466b, miR-138, miRNA-214, miRNA-503 and miRNA27a were down-regulated in response to 17α-E2 treatment. [score:7]
Real-time quantitative PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats. [score:7]
0078040.g006 Figure 6miRNA-132 and miRNA-214 binding sites in the 3′ UTR of the mouse SREBP-1c and LDLR genes mediate the downregulation of SREBP-1c and LDLR expression by miRNA-132 and miRNA-214, respectively. [score:6]
The level of expression of miR-212 and miR-132 was up-regulated (>1.5-fold) by both ACTH and 17α-E2 treatments. [score:6]
Bt [2]cAMP stimulation of granulosa cells caused down-regulation of a majority of miRNAs, including miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, miRNA-138 and miRNA-19a, but expression levels of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 were significantly increased. [score:6]
miRNA-132 and miRNA-214 binding sites in the 3′ UTR of the mouse SREBP-1c and LDLR genes mediate the downregulation of SREBP-1c and LDLR expression by miRNA-132 and miRNA-214, respectively. [score:6]
miRNA-132 and miRNA-214 Suppress SREBP-1c and LDLR by Targeting Specific Site(s) within the 3′ UTR of SREBP-1c and LDLR, Respectively. [score:5]
Significant expression was also observed for miRNA-27a, miRNA-132 and miRNA-214, whereas very low expression was noted for all of the remaining (seven) miRNAs. [score:5]
We also obtained evidence that miR-132 and miRNA-214 inhibit the expression of SREBP-1c and LDLR, respectively. [score:5]
Likewise, expression of another predicted target gene of miR-132, HDAC3, was also unchanged by ACTH, 17α-E2 or DEX treatment (Fig. 5A). [score:5]
qRT-PCR measurements indicated that exposure of primary rat granulosa cells to Bt [2]cAMP for 24 h inhibited the expression of miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, and miRNA-138 and miRNA-19a while enhancing the expression of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 (Fig. 4 ). [score:5]
Here, we directly assessed the binding of miRNA-138, miRNA-132 and miRNA-182/miRNA-214 to the 3′UTR of StAR, SREBP-1c, and LDLR, respectively, and regulation of their expression levels, by carrying out luciferase reporter gene assays. [score:4]
ACTH treatment caused maximum up-regulation of two miRNAs, miRNA-212 and miRNA-132, with a fold-stimulation of 4.23 and 3.43, respectively. [score:4]
Real-time PCR (qRT-PCR) confirmed ACTH -mediated up-regulation of miRNA-212, miRNA-183, miRNA-182, miRNA-132 and miRNA-96. [score:4]
Overexpression of pre-miRNA-132 and pre-miRNA-214 significantly decreased the luciferase activity of the 3′UTR of the SREBP-1c and LDLR reporter containing micRNA-132 and miRNA-214 binding sites, respectively (Fig. 6 ). [score:3]
Three genes, Mecp2, Ctbp1 and p250 GAP, have been recently identified as targets of miR-132 [36]. [score:3]
The levels of expression of miRNA-212, miRNA-122, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96, miRNA-466b, miRNA-200b, and miRNA-19a are shown. [score:3]
We next evaluated the effects of Bt [2]cAMP stimulation of rat ovarian granulosa cells and of mouse MLTC-1 Leydig tumor cells on the expression of twelve miRNAs (miRNA-212, miRNA-122, miRNA-183, miRNA-200b, miRNA-466b, miRNA-182, miRNA-96, miRNA-27a, miRNA-132, miRNA-214, miRNA-138 and miRNA-19a) whose adrenal expression was differentially altered in response to treatment of rats with ACTH, 17α-E2 or DEX. [score:3]
Overexpression of pre-miRNA-132 and pre-miRNA-214 significantly decreased the luciferase activity of the 3′UTR of the SREBP-1c and LDLR reporter containing micRNA-132 and miRNA-214 binding sites, respectively. [score:3]
More specifically, we assessed the impact of Bt [2]cAMP treatment on the expression of miRNA-212, miRNA-122, miRNA-27a, miRNA-466b, miRNA-200b, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96 and miRNA-19a. [score:3]
CHO cells were co -transfected individually with StAR 3′-UTR (containing the putative site I or site II for miRNA-138 binding) ± pre-miRNA-138-5p (panel B), SREBP-1c 3′-UTR (containing the putative binding site for miRNA-132) ± pre-miRNA-132-3p, LDLR 3′-UTR (containing the putative binding site for miRNA-182), or LDLR 3′-UTR (containing the putative site I, site II or site III for miRNA-214 binding) ± pre-miRNA-214-3p for 36h, followed by determination of luciferase activities. [score:1]
Seed sequences of the putative miRNA-138-5p, miRNA-132-3p and miRNA-182-5p/miRNA-214-3p binding sites in the 3′-UTR of mouse StAR, SREBP-1c and LDLR genes, respectively. [score:1]
Individual fragments of the 3′ UTR region of the StAR gene containing site I or site II binding site for miRNA-138-5p, the 3′-UTR of SREBP-1c containing a binding site for miRNA-132-5p, the 3′-UTR of LDLR containing a binding site for miRNA-182-5p or the 3′-UTR of LDLR containing site I, site II, or site III binding site for miRNA-214-3p were inserted downstream of the luciferase open reading frame of pMIR-REPORT vector. [score:1]
CHO cells were co -transfected individually with the StAR 3′-UTR (containing putative site I or site II for miRNA-138 binding) ± pre-miRNA-138-5p (panel B), the SREBP-1c 3′-UTR (containing putative binding site for miRNA-132) ± pre-miRNA-132-3p (panel C), the LDLR 3′-UTR (containing putative binding site for miRNA-182) (panel D), or the LDLR 3′-UTR (containing putative site I, site II or site III for miRNA-214 binding) ± pre-miRNA-214-3p for 36 h (panel E). [score:1]
Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
Moreover, cultured mouse granulosa cells exhibited a robust induction of miRNA-132 and miRNA-212 when challenged with 8BrcAMP [36]. [score:1]
0078040.g003 Figure 3Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
One study reported a robust induction of miRNA-21, miRNA-132 and miRNA-212 following in vivo stimulation of mouse ovaries with LH/hCG [36]. [score:1]
[1 to 20 of 34 sentences]
16
[+] score: 145
Some of the RNA binding proteins such as EWS, HNRNPM, HNRNPU and DHX36 showed an inhibitory effect on mmu-miR-212/132 processing and/or RNA maturation since knocking them down resulted in elevated miR-132, miR-212 and GFP expression (Supplementary Figure 5A). [score:6]
The Luciferase plasmid was co -transfected with a GFP or miR-212/132::GFP expressing plasmid, together with a 2′- O-Methyl oligonucleotide targeting the mir-132 loop sequence or a 2′- O-Methyl oligonucleotide complementary to the human let-7 as negative control. [score:5]
Figure 2D shows that neither the transfection of miR-212/132::GFP nor the inhibition of the miR-132 loop sequence affected the expression of the Luciferase reporter. [score:5]
While miR-132 expression shows steady expression at 4 and 24 hours after BDNF induction the level of the miR-132 loop is much higher at the early time point. [score:5]
p72 was the only protein that influenced the level of miR-132 more than the processing of miR-212 since it’s downregulation significantly decreased the ratio of the mature miRNAs generated from miR-212/132::GFP (Fig. 5A). [score:4]
Next we tested whether the accumulated miR-132 loop sequence was capable of regulating a target RNA through RNAi in cells. [score:4]
Downregulation of FUS, HNRNP2 and HNRNPF increased the GFP level without significantly affecting miR-132 and miR-212 levels suggesting that they may be involved in RNA maturation independently from miRNA processing. [score:4]
hsa-miR-132; mature miRNA Sequence: UAACAGUCUACAGCCAUGGUCG; (ABI/Life Technologies; 4427975); hsa-miR-212; mature miRNA Sequence: UAACAGUCUCCAGUCACGGCC; (ABI/Life Technologies; 4427975); hsa-miR-132-loop; custom-made target sequence: CUGUGGGAACCGGAGGUA; (ABI/Life Technologies; custom-made); hsa-miR-16; mature miRNA Sequence: UAGCAGCACGUAAAUAUUGGCG; (ABI/Life Technologies; 4427975). [score:3]
Since the loop sequence was not enriched in the bound fraction of the Ago2 IP and the reporter designed to be targeted by the miR-132 loop was insensitive to this RNA we concluded that the miR-132 loop fragment is very unlikely to be itself a functional miRNA. [score:3]
It promotes the maturation of a subset of human miRNAs via its association with the Microprocessor complex; however, until now, miR-132 was not known as a p72 targeted miRNA. [score:3]
In the case of the mouse miR-132 we have found that FUS only elevates miR-132 and miR-212 level in vitro if its related protein EWS is inhibited. [score:3]
Affinity purification of miR-132 loop associated complexes using biotinylated 2’- O-Me-oligos Cells were plated onto 10 cm dishes, washed with PBS, harvested in 2× mammalian lysis buffer (100 mM Tris-Cl pH 7.4; 0.3 M NaCl; 0.54 M sucrose; 0.2% NP-40; 0.2% Triton-X; 0.2% 2-mercaptoethanol; EDTA-free mini protease inhibitor). [score:3]
The accumulation of the miR-132 loop small RNA could also be observed in human cells expressing the miR-212/132::GFP plasmid (Fig. 2B). [score:3]
Our findings show similarities to the regulation of the processing of the human miR-18a since we have also demonstrated that the closed secondary structure is a key determinant to the relative efficient processing of mmu-miR132; however, relaxing the loop with introducing mutations had an adverse effect on miR-132 processing in vitro. [score:3]
We generated a Luciferase reporter plasmid that contained three perfect complementary target sites to the miR-132 loop sequence. [score:3]
We tested the miR-132 loop and CCC mutant oligos in a competition assay by cotransfecting them with the miR132/212::GFP reporter and we have found that the miR-132 loop 2′- O-Methyl oligo inhibited the accumulation of the mature miRNAs while the CCC mutant oligo had no effect on the miRNA processing (Supplementary Figure 3B. ) [score:2]
After determination of the structural requirements for the proper processing of mmu-miR-132 we went on to isolate proteins that associate with the miR-132 loop that might regulate its processing. [score:2]
The loop structure is important in regulating the processing efficiency of miR-132. [score:2]
This implies that the thermodynamic state of the loop of mmu-miR-132 is more important for recognizing protein factors rather than influencing directly the cleavage efficiency. [score:2]
miR-132 loop CCC: biotinilated 2′- O-methyl oligo similar to miR-132 loop only three GGG sequence was replaced with CCC (see mutation in Fig. 3B clone: 1483). [score:2]
Among the proteins that were shown to specifically bind to the miR-132 loop sequence and were tested in vitro for miRNA processing, only p72/DDX17 showed a clear ability to favor miR-132 processing over miR-212, in spite of the fact that knock down of p72 resulted in a significant drop of the recombinant pri-miRNA as well as both mature miRNA levels. [score:2]
To test if the affinity purified miR-132 loop associated proteins played roles in the processing of miR-132 we knocked down each of the proteins that bound selectively to the miR-132 loop sequence with siRNA in Hela cells that were then transfected with the miR-212/132::GFP reporter plasmid (Fig. 1B). [score:2]
Among these, only p72 showed preference for facilitating miR-132 maturation, however; knocking down many of the affinity-purified proteins altered the level of the pri-miR-212/132 and/or the abundance of both miRNAs. [score:2]
This is supported by the expression profile of the miR-132 loop sequence compared with miR-132 upon BDNF induction in mouse primary cortical neuronal cells (Fig. 2E). [score:2]
We have shown that the relatively closed loop structure of miR-132 is a key determinant for the favorable processing of miR-132 over miR-212. [score:1]
This is supported by the fact that the reconstitution of the closed loop reinstated the 3–5 fold differences between the levels of the mature miR-132 and miR-212 without significantly affecting the level of miR-212 (Fig. 3D). [score:1]
qPCR analysis of the Ago2 IP showed a strong enrichment of the mature miRNA-132 in the Ago2 bound fraction; however, no miR-132 loop was detected on the Ago2 beads (Fig. 2C). [score:1]
To exclude the possibility that changing the loop structure affected the fi delity of miR-132 processing we repeated the experiment but this time we used Northern blotting which is inherently less sensitive to the heterogeneity of miRNAs, to detect and quantify miR-132 and miR-212 levels. [score:1]
Mutating the loop structure in the GFP reporter plasmid (212/132::GFP, Fig. 1B) influences the efficiency mmu-miR-132 processing. [score:1]
This experiment produced very similar miR132/212 ratios to the qPCR result supporting our original observation that the loop structure influences miR-132 processing (Supplementary Figure 2). [score:1]
In this experiment we incorporated two additional proteins, p72/DDX17, a protein that is necessary for the processing of certain miRNAs and highly related to p68/DDX5 that was also present in the miR-132 loop purified proteome, and KSRP, which also has a well-described function in miRNA processing. [score:1]
This would be consistent with the loop sequence providing a binding platform for auxiliary factors that promote miR-132 processing. [score:1]
How to cite this article: Remenyi, J. et al. The loop structure and the RNA helicase p72/DDX17 influence the processing efficiency of the mice miR-132. [score:1]
We observed that the accumulation of miR-132 was significantly more prominent than the accumulation of miR-212 in both cell lines (Fig. 1C). [score:1]
This was further supported by the fact that processing efficiencies of both pre-miR-132 and pre-miR-212 into their respective mature miRNAs were very similar (Supplementary Figure 1B). [score:1]
This experiments included both affinity purification with the miR-132 loop sequence and a candidate approach involving testing auxiliary factors with known function in miRNA processing. [score:1]
Our data shows that p72 preferably binds to the wild type miR-132 loop supporting the notion that it may be involved in miR-132 processing by recognizing the loop sequence we identified by deep sequencing. [score:1]
miR-132 and miR-212 levels were quantified by qPCR and the absolute values were plotted. [score:1]
The ratios of mature miR-132/212 are indicated in the graph (left panel). [score:1]
Next, we confirmed that a selected list of affinity purified proteins specifically bind to the miR-132 loop by repeating the pull down followed by Western blotting with the individual proteins. [score:1]
The p72 and GFP bound miR-132 levels were quantified by qPCR (left panel). [score:1]
Our data show that miR-132 is significantly more abundant than miR-212 in each of the cells and tissues we examined, suggesting a general mechanism that favors the accumulation of miR-132 over miR-212. [score:1]
Binding of the 2′- O-Me-oligos (mir-132 as; miR-132 loop CCC; miR-132 loop) to Dynabeads [®] M-270 Streptavidin (Invitrogen/Life Technologies) was done in 2× Binding and Washing buffer (10 mM Tris-Cl pH 7.5; 1 mM EDTA; 2 M NaCl) for 30 minutes, then equilibrated with 1× mammalian lysis buffer. [score:1]
The relative miR-132/212 ratios are indicated below the graph. [score:1]
This suggests that other factors in addition to the UGU sequence, exist that determine the efficiency pri-miR-132 processing. [score:1]
Our aim was to identify protein factors that facilitate mmu-miR-132 processing over its co-transcribed and related miRNA, mmu-miR-212. [score:1]
After closer examination of the human and murine miR-132/212 sequences it became clear that the apical UGU sequence is intact in miR-132 but it is missing from miR-212. [score:1]
Next, we transfected HeLa cells with the above-mentioned miR-212/132::GFP expressing plasmids and measured the concentration of both mature miR-132 and miR-212 using qPCR (Fig. 3D). [score:1]
Next, we carried out a large-scale affinity purification with the two biotinylated control oligos and the biotinylated miR-132 loop sequence in duplicate. [score:1]
The small RNA derived from the miR-132 loop sequence is not a miRNA. [score:1]
One explanation for this discrepancy could be the fundamentally different transcriptional organization of miR-132 and miR-212 in mice and humans. [score:1]
The miR-132 loop was likely to be associated with the pri-miRNA processing machinery because the miR-132 loop mimic affinity purified with Drosha while neither the CCC mutant nor the antisense miR-132 loop control oligo were able to capture Drosha (Fig. 4A). [score:1]
mir-132-loop sense 5′-Biotinylated- 2′ -O-methyl oligo: CUGUGGGAACCGGAGGUA; mir-132-loop antisense 5′-Biotinylated-2′- O-methyl oligo: UACCUCCGGUUCCCACAG; CCC mutant of mir-132 loop sense 5′-Biotinylated-2′- O-methyl oligo: CUGUCCCAACCGGAGGUA; let-7 antisense 5′-Biotinylated-2′- O-methyl oligo: UCUUCACUAUACAACCUACUACCUCAACCUU. [score:1]
Functional analysis of the miR-132 loop associated proteins. [score:1]
We have previously reported that there is a significant difference between the steady state levels of mature miR-132 and miR-212 in primary cortical neurons isolated from mice, in spite of the fact that they are co-transcribed in the same intron of a non coding gene 30. [score:1]
The wild type construct again resulted in unequal processing of miR-132 and miR-212 by generating approximately 3 fold more miR-132 than miR-212. [score:1]
However, when we generated mutants in the loop of mmu-pri-miR-132 the UGU sequence was unaltered in the mutants that showed impaired processing. [score:1]
Affinity purification of miR-132 loop associated complexes using biotinylated 2’- O-Me-oligos. [score:1]
An alternative explanation for the accumulation of the 18 nt long miR-132 loop sequence is that it may have a role in the efficient processing of miR-132. [score:1]
In addition, neither Dicer nor Ago2 could be affinity purified by any of these oligos (data not shown), which supports the hypothesis that the relative accumulation of miR-132 is likely a consequence of a more efficient pri-miRNA processing. [score:1]
Uneven processing of the miR-212/132 cluster does not depend on the specific cellular contextWe have previously reported that there is a significant difference between the steady state levels of mature miR-132 and miR-212 in primary cortical neurons isolated from mice, in spite of the fact that they are co-transcribed in the same intron of a non coding gene 30. [score:1]
Mass spectrometry analysis of the samples showed that the miR-132 loop oligo predominantly bound to a wide range of RNA binding proteins, most notably members of the TET protein family (FUS, EWS and TAF15) and multiple HNRNP proteins (Supplementary Figure 4B). [score:1]
Finally, an antisense oligo complementary to the sequenced miR-132 loop was generated as an additional negative control. [score:1]
Deep sequencing of brain-derived neurotrophic factor (BDNF) stimulated primary mouse cortical neuronal cultures revealed that the miR-212/132 miRNA cluster produces five small RNAs, miR-212, miR-212*, miR-132, miR-132* and a 18bp long small RNA derived from the loop of miR-132 30 (Fig. 2A). [score:1]
Our data also shows that competing with both the miR-132 and miR-212 loop sequences results in the decrease of the level of the pri-miRNA, judging from the level of the surrogate GFP protein level. [score:1]
miR-132 loop: biotinylated 2′- O-methyl oligo mimicking the sequence derived from the miR-132 loop. [score:1]
We also obtained constructs in which we reconstructed the loop structure using base pairings that are not part of the natural pri- and pre-mmu-miR-132 sequences (Fig. 3C: construct 1971 and 1967). [score:1]
This modification in the miR-212/132::GFP reporter resulted in a decreased miR-132 level, suggesting that proteins that facilitate miR-132 processing may fail to bind to this sequence (Fig. 3B,D). [score:1]
None of our mutant constructs were mutated in the conserved apical UGU motif when we changed the structure of the miR-132 loop, but if the fi delity of the processing of the mutant miR-132 was compromised it would result in inefficient amplification by the Taqman PCR system, which is sensitive to the 3′ end of the miRNA sequence. [score:1]
HeLa cells were transfected with GFP control plasmid (GFP), the miR-212/132::GFP reporter (wt) and two mutants with relaxed miR-132 loop sequences (Fig. 3B) followed by immunoprecipitation with p72 antibody. [score:1]
We were looking for outcomes that are similar to the effect of miR-132 loop mutants that resulted in a decreased miR-132 processing without drastically changing the level of miR-212 (Fig. 3D). [score:1]
The wild type pri-miR-212/132::GFP was generated using the mouse miR132/212 exon-intron-exon (1.46 kb) sequence which was amplified from a mouse BAC (bacterial artificial chromosome) clone (RP23-142A14), and the purified PCR product was cloned into HindIII/BamHI cloning site of pEGFP-N1 (Clontech) in a ligation reaction using HindIII/BglII sites. [score:1]
The stability of the mature miR-212 and miR-132 is similar. [score:1]
Therefore, we first tested whether the miR-132 loop RNA functions as a miRNA. [score:1]
Another possibility is that FUS is required for miR-132 processing in neuronal cells where both the protein and the miRNA have well described cell type specific functions. [score:1]
These experiments showed that all the tested proteins with the exeption of KSRP were present in the bound fraction purified with the miR-132 loop oligo while they were absent from the beads obtained with the CCC mutant and the control oligo (Fig. 4B). [score:1]
In humans, miR-132 and miR-212 are transcribed independently while in mice these miRNAs share the same pri-miRNA and this dissimilarity may require different sets of auxiliary factors for efficient processing. [score:1]
To further understand this we sought to identify auxiliary factor(s) that promote miR-132 processing. [score:1]
p72/DDX17 influence the stability of pri-miR-212/132 and the level of mature miR-132, miR-212 in vitro. [score:1]
RNA was isolated from the bound fractions and the miR-132 loop sequence RNA was quantified by qPCR. [score:1]
These included an oligo designed to mimic the sequenced miR-132 loop sequence and an oligo similar to the sequenced miR-132 loop but with the GGG motif replaced with CCC as a control. [score:1]
We generated mutants in which we disrupted the relatively closed loop structure of the miR-132 (Fig. 3B: constructs 1483 and 6332) by mutagenizing the sequence that was recovered with deep sequencing (Fig. 3A). [score:1]
Interestingly, both mutants with the more relaxed loop structure significantly decreased the level of the mature miR-132 without affecting the quantity of miR-212, suggesting that the loop structure is necessary for efficient miR-132 processing. [score:1]
mmu-miR-132: UAACAGUCUACAGCCAUGGUCG; mmu-miR-132 complementary sequence: CGACCAUGGCUGUAGACUGUUA (used as a probe for Northern hybridization); mmu-miR-212: UAACAGUCUCCAGUCACGGCC; mmu-miR-212 complementary sequence: GGCCGUGACUGGAGACUGUUA (used as a probe for Northern hybridization); tRNA-Ile complementary sequence: UGGUGGCCCGUACGGGGAUCGA (used as a probe for Northern hybridization). [score:1]
This suggests that a conserved mechanism exists between mice and humans that favors the accumulation of mature miR-132 over miR-212 provided they are co-transcribed. [score:1]
Identification of proteins that are associated with the miR-132 loop derived small RNA. [score:1]
In this study, we dissect the molecular mechanism responsible for the asymmetric production of the co-transcribed miRNAs, miR-212 and miR-132 in mice. [score:1]
To further confirm that p72 specifically recognizes the miR-132 loop, we immunoprecipitated endogenous p72 from HeLa cells that were transfected with wild type mmu-miR-212/132::GFP and the two loop mutants (6332 and 1483 in Fig. 3) that showed impaired miR-132 processing. [score:1]
Validation of the binding specificity of the affinity purified miR-132 loop proteome. [score:1]
This identified several RNA binding proteins that specifically bind to the miR-132 loop. [score:1]
The luciferase reporter plasmid with multiple sites complementary to the miR-132 loop sequence was prepared using the parental vector psiCHECK2 (Promega) containing hRluc and hluc+. [score:1]
This suggests that p72 is responsible for the stability of the primary transcript and additionally could influence the efficiency of mmu-miR-132 processing in vitro. [score:1]
Using the mmu-miR-132 loop in affinity purification we have captured a proteome that partially overlaps with the proteome co-purified with the Microprocessor and it includes DEAD-box, DEAH-box helicases, hnRNP proteins and all members of the TET (FUS, EWS, TAF15) protein family 3. Among these proteins FUS has already been implicated in facilitating the human miR-132 processing in vivo and in vitro by promoting Drosha association to the pri-miRNA 48. [score:1]
miR-132 AS: biotinylated 2′- O-methyl oligo complementary to miR-132 loop. [score:1]
[1 to 20 of 94 sentences]
17
[+] score: 88
LPS down-regulates AChR expression resulting in acetylcholine increase, down-regulates α7 nAChR expression and changes the levels of miR-132/212, miR-9, miR-99 and let-7g. [score:11]
To further understand the down-regulation in expression of the cholinergic α7 nAChR (global) and AChE-S (brain region specific) genes, we performed qRT PCR analysis for quantifying the expression of AChE-S targeting miRs: miR-132 and its co-clustered miR-212 in the above mentioned four brain regions. [score:10]
AChE down-regulation was accompanied by up-regulation of its targeting miRNA-132 (Shaked et al., 2009; Shaltiel et al., 2013) in the frontal cortex and cerebellum of LPS -treated mice. [score:9]
We observed significant LPS -induced increases in the expression levels of miR-212 in all of the tested brain regions, whereas miR-132 showed region-specific (frontal cortex and cerebellum) increases in its expression, correlating to AChE-S expression (Figures 3A,B vs. [score:7]
The general up-regulation of miRNA-212 in all studied brain areas and its significant inhibition by the α7-specific antibody in the frontal cortex, striatum and hippocampus suggests its specific involvement in inflammation-related mechanisms, different from those regulated by miRNA-132. [score:7]
The antibody tended to cause decreases in miR-132 expression that was up-regulated by LPS in the frontal cortex, hippocampus and striatum. [score:6]
Inversely, the antibody supports the integrity of brain mitochondria and attenuates the LPS -induced pro-apoptotic miRNAs up-regulation while stimulating pro-inflammatory signaling and preventing the LPS -induced elevation of the anti-inflammatory miRNA-132/212 (Shaked et al., 2009; Shaltiel et al., 2013; Soreq, 2015). [score:4]
In vivo knockdown of hippocampal miR-132 expression impairs memory acquisition of trace fear conditioning. [score:4]
Regarding our data, it may be suggested that neuro-inflammation up-regulates miRNA-132/212 as an anti-inflammatory reaction, which also protects the brain cells from excessive reactive oxygen species toxicity. [score:4]
The brains of Alzheimer patients demonstrated decreased miR-132/212 level already at stages Braak III and IV of the disease and in a manner related to Tau pathology (Lau et al., 2014). [score:3]
De-repression of FOXO3a death axis by microRNA-132 and -212 causes neuronal apoptosis in Alzheimer’s disease. [score:3]
Nicotine (3 days) failed to significantly affect either miR-132 or miR-212 expression. [score:3]
Hippocampal microRNA-132 mediates stress-inducible cognitive deficits through its acetylcholinesterase target. [score:3]
MicroRNA-132 potentiates cholinergic anti-inflammatory signaling by targeting acetylcholinesterase. [score:2]
Knockdown of miRNA-132 in the hippocampus impairs memory acquisition (Wang et al., 2013), which can be regarded as a marker for cognitive impairment (Xie et al., 2015). [score:2]
MiRNA-132 is reported to increase during inflammation in many tissues (Maharshak et al., 2013; Shaltiel et al., 2013; Nadorp and Soreq, 2015) and is validated to target AChE further to potentiate cholinergic anti-inflammatory pathway (Shaked et al., 2009; Soreq and Wolf, 2011). [score:2]
This region-specific inter-related regulation of miRNA-132/AChE is compatible with the involvement of the cluster harboring miRNA-132/212 in the resolution of inflammation (Nahid et al., 2011; Rao et al., 2015). [score:2]
MicroRNA-132 modulates cholinergic signaling and inflammation in human inflammatory bowel disease. [score:2]
The α7(1–208)-specific antibodies weaken this reaction but do not decrease miRNA-132/212 below the control level. [score:1]
Serum mir-206 and mir-132 as potential circulating biomarkers for mild cognitive impairment. [score:1]
qRT PCR Analysis of miRNA-132/212 in Different Regions of the Brain. [score:1]
In addition to their involvement in inflammation-related processes, both miRNA-132 and miRNA-212 protect neurons against H [2]O [2] -mediated cell death, and their loss causes neuronal apoptosis via elevated levels of the cell death -associated proteins PTEN, FOXO3 and P300 that antagonize Akt pro-survival signaling (Wong et al., 2013). [score:1]
[1 to 20 of 22 sentences]
18
[+] score: 86
In addition, Lyu et al. [45] recently demonstrated that miR-132 inhibits the expression of MeCP2, mutations in which lead to Rett syndrome and autism. [score:6]
The results, which are normalized to GAPDH mRNA levels, are expressed as % of saline -treated control, and are presented as means ± SEM (n = 4 from two VPA and one saline -treated dams) MeCP2 and p250GAP are targets of miR-132 [37, 38]. [score:5]
While the significance of the sex difference in the time course of the VPA -induced increase in miR-132 expression is not known, it is unlikely that dysregulation of miR-132 is related to sex differences in behavior or brain morphology. [score:4]
Abu-Elneel et al. [44] reported that miR-132 levels are downregulated in ASD postmortem brain. [score:4]
The prenatal VPA exposure at E12.5 also decreased mRNA levels of methyl-CpG -binding protein 2 and Rho GTPase-activating protein p250GAP, both of which are molecular targets of miR-132. [score:3]
These findings suggest that the VPA exposure -mediated neuronal activation induces an expression of miR-132. [score:3]
Moreover, it has also been indicated that BDNF induces miR-132 expression [37, 48, 49]. [score:3]
And then, we examined the effects of prenatal VPA exposure on mRNA levels of neuronal activity markers, Arc and c-Fos, brain-derived neurotrophic factor (BDNF) and miR-132 target molecules. [score:3]
[*] P < 0.05, [**] P < 0.01, [***] P < 0.001, versus saline -treated control (two-way ANOVA followed by a post hoc Bonferroni’s multiple comparison test) There are several studies indicating that the expression of miR-132 is induced in a neuronal activity -dependent manner [35, 36]. [score:3]
analysis revealed that the prenatal VPA exposure altered expression of a number of psychiatric disorder -associated microRNAs [63– 65] including miR-132 in the mouse embryonic brain 12 h after the exposure. [score:3]
Furthermore, it has been demonstrated that miR-132 -mediated suppression of p250GAP plays a key role in dendritic plasticity [18] and hippocampal synaptogenesis [60]. [score:3]
Several mRNAs are validated as targets of miR-132 [52]. [score:3]
In addition, we demonstrated that the VPA exposure deceased mRNA levels of miR-132 target molecules. [score:3]
We further found that the prenatal exposure to VPA at E12.5 increased mRNA levels of Arc, c-Fos and brain-derived neurotrophic factor in both male and female embryonic brains, prior to miR-132 expression. [score:3]
This suggests that other microRNAs other than miR-132 also play a key role in the expression of ASD-like behavioral abnormalities in the VPA-exposed mice. [score:3]
Several studies have demonstrated that the expression of miR-132 is increased by neuronal activation [35, 36]. [score:3]
Among a variety of microRNAs, miR-132, one of brain enriched microRNAs, is shown to have important roles in the brain, axon, and synaptic development [17– 21]. [score:2]
Therefore, in addition to BDNF, other factors may be involved in the regulation of miR-132 levels, especially prolonged miR-132 increase. [score:2]
These results, taken together with the previous finding that prenatal VPA exposure at E12.5, but not E14.5, causes ASD-like behavioral abnormalities [4], suggest that dysregulation of miR-132 is involved in the pathogenesis of prenatal VPA exposure -induced ASD in the mouse. [score:2]
We found that prenatal VPA exposure at E12.5 increased miR-132 levels, but not miR-9 or miR-124 levels, in the male mouse embryonic brain. [score:1]
Fig. 4Effects of prenatal VPA exposure at E14.5 on miR-132 levels in the male and female mouse embryonic whole brain. [score:1]
A post hoc Bonferroni’s multiple comparison test showed a significant increase in miR-132 levels at 2 h after VPA exposure, and the increase was sustained for at least 24 h after the exposure (1, 2, 12, 18, and 24 h, n = 4/group; 6 h, n = 5/group; 6 d, n = 6/group; 9 d, n = 4–5/group; Fig.   2a). [score:1]
Fig. 2Time course of changes in miR-132 levels in male and female embryonic brains after prenatal VPA exposure at E12.5. [score:1]
Prenatal exposure to VPA at E12.5 also increased miR-132 levels in the female embryonic brain. [score:1]
In comparison, in the female embryonic brain, prenatal VPA exposure increased miR-132 levels 6–18 h after the injection (main effects of drug [F [1,55] = 54.6, P < 0.0001] and time [F [7,55] = 7.1, P < 0.0001]; interaction: F [7,55] = 7.1, P < 0.0001; 1, 2, 12, 18 and 24 h, n = 4/group; 6 h, n = 5/group; 6 d, n = 6/group; 9 d, n = 4–5/group; Fig.   2b). [score:1]
The prenatal VPA exposure at E12.5 caused changes in a number of psychiatric disorders-related microRNA levels including an increase in miR-132 level. [score:1]
Prenatal VPA exposure at E12.5 increased miR-132 level, but not miR-9 and miR-124 levels, in mouse embryonic brain. [score:1]
The VPA exposure caused an approximately 2.5-fold increase in miR-132 levels, but it did not affect the levels of miR-9 or miR-124 (n = 5/group, Fig.   1). [score:1]
In addition, it is likely that miR-132 may be committed in onset of psychiatric disorders, such as depression, bipolar disorder, and schizophrenia [22– 24]. [score:1]
In contrast, prenatal exposure to VPA at E14.5 did not affect miR-132 levels in either male or female embryonic brain. [score:1]
These observations suggest that alteration of psychiatric disorder -associated microRNAs including miR-132 may contribute to the behavioral phenotypes, although the exact relationship among abnormal behaviors is not known. [score:1]
In contrast, the increase in BDNF mRNA levels lasted for 6 h and returned to control levels at 12 h, while the increase in miR-132 levels was sustained for at least 24 and 18 h, in male and female, respectively. [score:1]
Therefore, it is likely that the VPA -induced changes in microRNA levels, especially the increase in miR-132 levels, lead to the disruption of spinogenesis and neuronal maturation followed by the behavioral changes. [score:1]
We also found that prenatal VPA exposure at E14.5 did not affect miR-132 levels. [score:1]
Prenatal exposure to VPA at E12.5 immediately increased miR-132 levels, but not miR-9 or miR-124 levels, in the male embryonic brain. [score:1]
It is likely that the sex difference in the time course of miR-132 levels in mouse embryos is due to BDNF mRNA levels. [score:1]
Thus, we examined the effects of VPA exposure at E14.5 on miR-132 levels in both male and female embryonic mouse brain, and found that it had no effect (main effects of drug [F [1,12] = 1.4, P > 0.05] and sex [F [1,12] = 0.63, P > 0.05]; interaction: F [1,12] = 0.63, P > 0.05 by two-way ANOVA; n = 4/group, Fig.   4). [score:1]
In the present study, miR-132 levels were increased by the exposure to VPA in both male and female embryonic brains, although at 2 h, miR-132 levels were increased in males, but not yet in females. [score:1]
These findings suggest that the neuronal activity -dependent changes in microRNA levels, including an increased level of miR-132, in the embryonic period are involved in the prenatal VPA -mediated ASD-like neuropathology and behavioral abnormalities. [score:1]
Furthermore, analysis revealed that prenatal VPA exposure caused changes in several microRNA levels other than miR-132 in the embryonic whole brain. [score:1]
These findings suggest that the alterations in neuronal activity -dependent microRNAs levels, including an increased level of miR-132, in the embryonic period, at least in part, underlie the ASD-like behaviors and cortical pathology produced by prenatal VPA exposure. [score:1]
Thus, although the exact mechanisms underlying prolonged miR-132 increase remain unclear, the length of half-life of VPA may be related to its persistency. [score:1]
In addition, increase in miR-132 levels was observed in male and female embryonic brain at 2–24 and 6–18 h, respectively, after the exposure. [score:1]
Fig. 1Effects of prenatal VPA exposure at E12.5 on levels of miR-9, miR-124 and miR-132 in the male mouse embryonic whole brain. [score:1]
[1 to 20 of 44 sentences]
19
[+] score: 70
Other miRNAs from this paper: mmu-mir-15b
It has also been described that Mecp2 expression knockdown in primary hippocampal neurons results in increased expression of miR132 (Su et al., 2015), suggesting that there is a regulation interplay between Mecp2 and miR132. [score:7]
We further showed that Mecp2 absence impairs Ryr3 upregulation, compromising miR132 -induced p250GAP downregulation and experience -dependent structural plasticity elicited by EE. [score:7]
To determine if Ryr3 upregulation is associated to p250GAP regulation in experience -dependent plasticity, we evaluated miR132 -dependent p250GAP downregulation in WT mice reared in SC or EE. [score:6]
In vitro experiments have shown that Ryr channels contribute to miR132 upregulation -dependent suppression of p250GAP, contributing to dendritic spine formation by activating the Rac1-PAK actin remo deling signaling pathway (Lesiak et al., 2014). [score:6]
We observed no changes in PAK mRNA levels (Figure 4F), suggesting that EE-elicited Mecp2 and p250GAP downregulation are specific to miR132 targets. [score:6]
Interestingly, in WT mice EE -induced Ryr3 upregulation is accompanied by increased miR132 and diminished p250GAP, a recognized miR132 target (Wayman et al., 2008). [score:6]
It is also of note that as a miR132 target (Klein et al., 2007), Mecp2 mRNA levels were reduced in the hippocampus of EE-reared mice, suggesting that environmental stimulation diminishes Mecp2 expression. [score:5]
The environmental neurotoxicant PCB 95 promotes synaptogenesis via ryanodine receptor -dependent miR132 upregulation. [score:4]
Therefore, it is likely that increased miR132 drives the p250GAP downregulation observed in mice reared in the EE conditions. [score:4]
The miR132 target p250GAP is a negative regulator of synaptogenesis. [score:4]
The Rho -family GTPase Activating Protein p250GAP is a negative regulator of synaptogenesis that modulates the Rac1-PAK actin remo deling signaling pathway (Wayman et al., 2008; Lesiak et al., 2014); it was suggested that RyR channels contribute to activity -induced synaptogenesis through miR132 -dependent suppression of p250GAP (Lesiak et al., 2014). [score:4]
RyR channels contribute to activity -dependent dendritic spine formation by modulating the Rac1-PAK actin remo deling pathway through miR132 -dependent suppression of the Rho -family GTPase Activating Protein p250GAP (Wayman et al., 2008; Lesiak et al., 2014). [score:3]
We observed a significant reduction in Mecp2 mRNA (Figure 4B) and a reduction of 60% in p250GAP mRNA levels (Figure 4C), suggesting that the increase of miR132 elicited by EE is functional and effective in reducing its Mecp2 and p250GAP mRNA targets. [score:3]
Figure 4EE -induced p250GAP regulation is abolished in Mecp2 -null mice: (A) Hippocampal miR132 quantification for EE-reared (n = 4) WT mice relative to SC (n = 3) (t-test, [*] p < 0.05). [score:2]
MeCP2 controls hippocampal brain-derived neurotrophic factor expression via homeostatic interactions with microRNA132 in rats with depression. [score:2]
We then evaluated the miR132 targets Mecp2 and p250GAP. [score:1]
[1 to 20 of 16 sentences]
20
[+] score: 54
Other miRNAs from this paper: hsa-mir-212, hsa-mir-132, mmu-mir-212
Klein et al. have proposed a homeostatic feedback mechanism that as a target of MeCP2, BDNF induces miR-132 synthesis through CREB pathway, miR-132 in turn silence MeCP2 expression [21]. [score:5]
miR-132 that is induced by p-CREB was also downregulated (Figure  4B). [score:4]
Interestingly, miR-132 was downregulated by 3d to 7d after SNI (Figure  4B). [score:4]
B, miR-132 was downregulated by 3d to 7d after SNI. [score:4]
Primers used in quantitative real-time PCR assays were as follows: miR-132 forward, 50-ACCGTGGCTTTCGATTGTTA-30 miR-132 reverse, 50-GGCGACCATGGCTGTAGACT-30 MeCP2 forward, ACAGCGGCGCTCCATTATC MeCP2 reverse, CCCAGTTACCGTGAAGTCAAAA For western blot analysis, total proteins were extracted from mice L4-L6 DRG and spinal cord using FDTMRIPA Buffer add protease inhibitors and phosphatase inhibitors (Roche). [score:3]
Primers used in quantitative real-time PCR assays were as follows: miR-132 forward, 50-ACCGTGGCTTTCGATTGTTA-30 miR-132 reverse, 50-GGCGACCATGGCTGTAGACT-30 MeCP2 forward, ACAGCGGCGCTCCATTATC MeCP2 reverse, CCCAGTTACCGTGAAGTCAAAA For western blot analysis, total proteins were extracted from mice L4-L6 DRG and spinal cord using FDTMRIPA Buffer add protease inhibitors and phosphatase inhibitors (Roche). [score:3]
Primers used in quantitative real-time PCR assays were as follows: miR-132 forward, 50-ACCGTGGCTTTCGATTGTTA-30 miR-132 reverse, 50-GGCGACCATGGCTGTAGACT-30 MeCP2 forward, ACAGCGGCGCTCCATTATC MeCP2 reverse, CCCAGTTACCGTGAAGTCAAAA For western blot analysis, total proteins were extracted from mice L4-L6 DRG and spinal cord using FDTMRIPA Buffer add protease inhibitors and phosphatase inhibitors (Roche). [score:3]
MeCP2 was released to express when miR-132 decrease and provided injury body a protective response. [score:3]
miR-132 forms complementary pairing with 3′UTR of MeCP2 and prevent its expression at post-transcriptional level. [score:3]
We found that expression of miR-132 were detected in Spinal cord after SNI (Figure  4B). [score:3]
MeCP2 Acute pain SNI mo del Spinal cord p-CREB/miR-132 Mutations of methyl-CpG binding protein 2 (MeCP2) lead to Rett syndrome, a severe neurodevelopmental disorder [1]. [score:3]
Thereby, the neuroprotective response of MeCP2 induced by getting rid of miR-132 inhibition is speculated and demonstrated. [score:3]
Several studies have found that MeCP2 can be regulated by miRNAs especially miR-132 in specific areas of the brain. [score:2]
Our study shows that MeCP2 plays an analgesic role in both acute pain transduction and chronic pain formation through regulating CREB-miR-132 pathway. [score:2]
Levels of MeCP2 transcript and miR-132 were analyzed by qPCR. [score:1]
MeCP2 alleviated acute pain and neuropathic pain through P-CREB/miR-132 pathway in spinal cord. [score:1]
Studies showed that miR-132 can be induced by p-CREB [20]and take part in restricting MeCP2 level within a narrow range [21, 22]. [score:1]
Thus we would like to examine levels of miR-132 in SNI experiments. [score:1]
Figure 4Change of MeCP2 transcript, miR-132 and p-CREB after SNI. [score:1]
Transgenic miR-132 alters neuronal spine density and impairs novel object recognition memory. [score:1]
We found that through p-CREB/miR-132 signaling cascade is involved in MeCP2 -mediated pain transduction. [score:1]
The mechanism is through CREB/miR-132 signaling pathway in spinal cord. [score:1]
CREB/miR-132 pathway is involved in the protective response of MeCP2. [score:1]
[1 to 20 of 23 sentences]
21
[+] score: 41
Other miRNAs from this paper: mmu-mir-135a-1, mmu-mir-135b, mmu-mir-135a-2
Importantly, the changes observed for miR-132 expression originated from the alterations in the expression of miR-132 and not in the expression of endogenous standard snoRNA135 (Figure S5 in File S1). [score:7]
Only small variances in the expression of snoRNA135 were detectable whereas the ΔCt values were more affected meaning that miRNA changes originated from radiation -induced differences in miR-132 expression profile. [score:5]
The deregulation of miR-132 seemed to occur predominately in neurons displaying Tau hyper-phosphorylation [45] emphasising the role of miR-132 in cognitive diseases. [score:4]
Also the Rac1 and miR-132 levels were similarly down-regulated as in vitro at this experimental set-up. [score:4]
Additionally, it was shown that miR-132 is down-regulated in temporal cortical areas and in the CA1 region of hippocampal neurons of human Alzheimer's brain [46]. [score:4]
HT22 data highlighted that the observed deregulation of miR-132 is due to miR-132 deregulation itself (Figure S5 E and S5 F in File S1). [score:3]
miR-132 is known to indirectly positively regulate Rac1 activity by blocking the GTPase-activating protein p250GAP [39], [40]. [score:3]
As miR-132 is involved in the regulation of the Rac1-Cofilin pathway via blocking of the GTP hydrolysis protein p250GAP [31], the levels of this microRNA were quantified. [score:2]
RNA isolates of cells and brain tissues (10 ng) were used to quantify microRNA miR-132 expression levels using the TaqMan Single MicroRNA Assay (Applied Biosystems) according to the manufacturer's protocol. [score:2]
Recently, a miRNA profiling cohort study with Alzheimer's patients illustrated a strong decrease in miR-132 levels in the prefrontal cortex and hippocampus [45]. [score:1]
In accordance with decreasing miR-132 levels in HT22 cells 24 hours post-irradiation with 1.0 Gy (Figure 2 C), we observed significantly decreased miR-132 levels in both hippocampus and cortex at 1.0 Gy 24 hours post-irradiation (Figure 4 C). [score:1]
The miR-132 levels were significantly decreased at 0.5 Gy but not at higher doses 4 hours post-irradiation whereas 24 hours post-irradiation miR-132 levels were still significantly decreased at 0.5 Gy and were also decreased at the higher doses (Figure 2 C). [score:1]
Quantification of Rac1 and miR-132 levels demonstrated a dose- and time -dependent reduction in both only at doses of 1.0 Gy and 4.0 Gy and 24 hours post irradiation. [score:1]
Quantification of microRNA miR-132 via quantitative PCR. [score:1]
Figures S5 E and S5 F in File S1 show the variation of the n-fold changes of snoRNA135 used for miRNA normalisation after 4 hours and 24 hours post-irradiation and the ΔCt values between miR-132 and snoRNA135 in irradiated HT22 cells, respectively. [score:1]
Thus a decrease in miR-132 would lead to a decrease in Rac1 activity as we observed. [score:1]
[1 to 20 of 16 sentences]
22
[+] score: 38
We further confirmed the expression levels of 7 miRNAs using qRT-PCR, miR-16-5p, miR-26a-5p, miR-29a-3p, miR-132-3p, miR-140-5p, miR-124a-3p and miR-146a-5p, all of which were up-regulated in infected samples prior to 130 DPI (Figure 6B, C and D ). [score:6]
The phosphorylated CREB activates transcription of many genes, including other transcription factors, within the nuclease resulting in the direct and indirect up-regulation of genes such as CAMK1, CAMK2D, RASGRF2, DOCK1 and microRNAs such as miR-132-3p, miR-124a-3p, miR-29a-3p. [score:6]
We also used in situ hybridization to confirm the expression level of miR-132-3p because the expression level of this miRNA is known to be induced by pCREB. [score:5]
In total, 17 miRNAs were identified as significantly dysregulated between 70–110 DPI and we successfully validated the expression levels of 6 of these miRNAs: miR-16-5p, miR-26a-5p, miR-29a-3p, miR-132-3p, miR-140-5p and miR-146a-5p. [score:4]
We found that miR-132-3p appears to be significantly more abundant at pre-clinical time points in the CA1 granule neurons in infected versus uninfected cells (Figure 6E ), in conjunction with pre-clinical pCREB expression levels. [score:3]
We analyzed the expression levels of 7 miRNAs (miR-16-5p, miR-26a-5p, miR-29a-3p, miR-140-5p, miR-132-3p, miR-146a-5p and miR-124a-3p) using a multiplex qRT-PCR approach. [score:3]
One of the targets of miR-132-3p in hippocampal neurons is the Rho family GTPase-activating protein p250GAP [133]. [score:3]
In fact, miR-29a-3p, miR-26a-5p and miR-132-3p are particularly highly expressed in the hippocampus, being even more abundant than miR-124a-3p, such that 2.63, 1.54 and 0.43% of total miRNA reads were composed of these miRNAs, respectively (Table 2 ). [score:3]
Dark blue/black staining shows the presence of miR-132-3p. [score:1]
We added 50 nM of the linearized DIG-labeled miRNA-132 LNA probe (Exiqon) in ready to use hybridization solution (BioChain Institute, Inc. ) [score:1]
Similarly, neuronal-specific functions have been extensively shown with miR-132-3p levels. [score:1]
Although published studies on the functions of many of these miRNAs are few, a number provide evidence for the function of miR-29a-3p, miR-124a-3p and miR-132-3p in neuronal synapse formation and plasticity. [score:1]
The repression of this gene via miR-132-3p results in a greater dendritic complexity of hippocampal neurons [133]. [score:1]
[1 to 20 of 13 sentences]
23
[+] score: 38
Analysing miR expression in PTen [wt] prostate cells treated with PI3K/PTEN modifying drugs showed that the mTORC1 inhibitor (Tem) decreased miR-155, miR-150 and miR-132 expression, while inhibition of the ectopically expressed wild type PTEN with the highly selective PTen inhibitors SF1670 [N-(9,10-Dihydro-9,10-dioxo-2-phenanthrenyl)-2,2-dimethyl-propanamide] and bpV(HOpic) [Dipotassium bisperoxo (5-hydroxypyridine-2-carboxyl) oxovanadate] increased miR expression (Fig.   6a). [score:15]
MiR-155 inhibitor treatment increased the expression of Nkx3-1, Nkd, and Wee1, while the miR-132 inhibitor increased the expression of Hhip, Fox2p, and Eif4a2. [score:9]
Left hand side = miR155 inhibitor, right hand side = miR132 inhibitor. [score:5]
The microRNAs mmu-miR-155 and mmu-miR-132 were validated by qPCR of the whole cohort of mouse tissues (ko = 8, wt = 11) (see Fig.   2d, upper panel) and were found to be overexpressed by over 3-fold in Pten [−/−] prostates. [score:3]
b Crystal violet cell growth assay of Pten [−/−] tissue-derived cells transfected with a mir-155 or mir-132 inhibitor (or scrambled control) for 48 h. Data are plotted as % cell survival normalised to mock transfected cells. [score:2]
MiR-132 expression is associated with inflammation, inducing proliferation of endothelial cells in the tumour environment [35]. [score:2]
c Crystal violet cell growth assay of Pten [−/−] cells transfected with a mir-155 or mir-132 inhibitor (or scrambled control) and treated with increasing doses of temsirolimus. [score:2]
[1 to 20 of 7 sentences]
24
[+] score: 37
Other miRNAs from this paper: hsa-mir-132
However, miR-132 was found to be upregulated during acute infection regardless of the parasite genotype, a phenomenon related to its effects on infection and inflammation [19]. [score:4]
Given miR-132 was upregulated before entering the chronic phase, this might be a potential cause for the observed deficit. [score:4]
Similar to our previous result [24], we found miR-132 was downregulated during chronic infection in mice with high MAG1 antibody level. [score:4]
Employing qPCR analysis, we found a decrease in the expression of miR-132 in mice with high MAG1 level (F(4,28) = 6.403, p = 0.0009; Ps < 0.05 between IgG+/MAG1+high vs all other groups, Fig 7A). [score:3]
0004674.g007 Fig 7 (B) MAG1 antibody level showed a trend towards negative correlation with miR-132 expression (Spearman’s correlation analysis). [score:3]
The expression of miR-132 showed a trend towards a negative correlation with MAG1 antibody level (r = -0.61, p = 0.0667, Fig 7B) 10.1371/journal. [score:3]
It is worth noting that transgenic mice overexpressing miR-132 exhibited increased neuronal spine density but impaired novel object recognition memory [38, 39]. [score:3]
The expression of miR-132 showed a trend towards a negative correlation with MAG1 antibody level (r = -0.61, p = 0.0667, Fig 7B) 10.1371/journal. [score:3]
Gene expression of miR-132. [score:3]
Another possible reason for cognitive deficit in T. gondii IgG seropositive mice might include miR-132 dysregulation during infection. [score:2]
Lately, miR-132 has been demonstrated to affect multiple neuronal functions and its dysregulation is linked to several neurological disorders [25]. [score:2]
The selection of striatum is based on previous finding where significant change of miR-132 was noticed [19, 24]. [score:1]
For the mouse striatum, gene expression of miR-132 was measured. [score:1]
, et al (2014) MicroRNA-132 dysregulation in Toxoplasma gondii infection has implications for dopamine signaling pathway. [score:1]
[1 to 20 of 14 sentences]
25
[+] score: 34
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-127, mmu-mir-133a-1, mmu-mir-136, mmu-mir-144, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-10b, mmu-mir-185, mmu-mir-190a, mmu-mir-193a, mmu-mir-203, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-10b, hsa-mir-34a, hsa-mir-203a, hsa-mir-215, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-144, hsa-mir-152, hsa-mir-127, hsa-mir-136, hsa-mir-146a, hsa-mir-185, hsa-mir-190a, hsa-mir-193a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-337, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-29b-2, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, hsa-mir-337, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-215, mmu-mir-411, mmu-mir-434, hsa-mir-486-1, hsa-mir-146b, hsa-mir-193b, mmu-mir-486a, mmu-mir-540, hsa-mir-92b, hsa-mir-411, hsa-mir-378d-2, mmu-mir-146b, mmu-mir-193b, mmu-mir-92b, mmu-mir-872, mmu-mir-1b, mmu-mir-3071, mmu-mir-486b, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, hsa-mir-203b, mmu-mir-3544, hsa-mir-378j, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-let-7k, hsa-mir-486-2
Down-regulated miRNAs Up-regulated target genes mmu-mir-148a ARL6IP1, ARPP19, ATP2A2, CCNA2, CSF1, EGR2, ERLIN1, ERRFI1, FIGF, GADD45A, GMFB, ITGA5, KLF4, KLF6, LIMD2, MAFB, NFYA, PDIA3, PHIP, PPP1R10, PPP1R12A, PTPN14, RAI14, RSBN1L, SERPINE1, SIK1, SLC2A1, TMEM127, TMSB10, TMSB4X mmu-mir-411 APOLD1, SPRY4 mmu-mir-136 RYBP, ARL10, GLIPR2, UGGT1 Up-regulated miRNAs Down-regulated target genes mmu-mir-34a/c DAB2IP, DMWD, EVI5L, FAM107A, MAZ, SPEG, TFRC, TTC19 mmu-mir-92b COL1A2, DAB2IP, G3BP2, HOXC11, LBX1, NFIX, PKDCC, PRKAB2 mmu-mir-132 ACTR3B, AMD1, GPD2, HBEGF, KBTBD13, KCNJ12, PRRT2, SREBF1, TLN2 mmu-mir-146a IRAK1, TLN2 mmu-mir-152 EML2, GPCPD1, NFIX, RPH3AL, SH3KBP1, TFRC, TRAK1, UCP3 mmu-mir-155 DUSP7, G3BP2 mmu-mir-185 DAB2IP, FAM134C, SYNM, TMEM233 mmu-mir-203 APBB2, CACNG7, FKBP5, GDAP1, HBEGF, KCNC1, SIX5, TMEM182 mmu-mir-206 DMPK, G3BP2, GPD2, KCTD13, MKL1, SLC16A3, SPEG mmu-mir-215 KLHL23 Figure 5The network displays the predicted interactions between age-related miRNAs and mRNAs from the sequencing and was generated using Cytoscape (version 3.0, www. [score:17]
Down-regulated miRNAs Up-regulated target genes mmu-mir-148a ARL6IP1, ARPP19, ATP2A2, CCNA2, CSF1, EGR2, ERLIN1, ERRFI1, FIGF, GADD45A, GMFB, ITGA5, KLF4, KLF6, LIMD2, MAFB, NFYA, PDIA3, PHIP, PPP1R10, PPP1R12A, PTPN14, RAI14, RSBN1L, SERPINE1, SIK1, SLC2A1, TMEM127, TMSB10, TMSB4X mmu-mir-411 APOLD1, SPRY4 mmu-mir-136 RYBP, ARL10, GLIPR2, UGGT1 Up-regulated miRNAs Down-regulated target genes mmu-mir-34a/c DAB2IP, DMWD, EVI5L, FAM107A, MAZ, SPEG, TFRC, TTC19 mmu-mir-92b COL1A2, DAB2IP, G3BP2, HOXC11, LBX1, NFIX, PKDCC, PRKAB2 mmu-mir-132 ACTR3B, AMD1, GPD2, HBEGF, KBTBD13, KCNJ12, PRRT2, SREBF1, TLN2 mmu-mir-146a IRAK1, TLN2 mmu-mir-152 EML2, GPCPD1, NFIX, RPH3AL, SH3KBP1, TFRC, TRAK1, UCP3 mmu-mir-155 DUSP7, G3BP2 mmu-mir-185 DAB2IP, FAM134C, SYNM, TMEM233 mmu-mir-203 APBB2, CACNG7, FKBP5, GDAP1, HBEGF, KCNC1, SIX5, TMEM182 mmu-mir-206 DMPK, G3BP2, GPD2, KCTD13, MKL1, SLC16A3, SPEG mmu-mir-215 KLHL23 Figure 5The network displays the predicted interactions between age-related miRNAs and mRNAs from the sequencing and was generated using Cytoscape (version 3.0, www. [score:17]
[1 to 20 of 2 sentences]
26
[+] score: 33
miR-132 regulates the differentiation of dopamine neurons by directly targeting Nurr1 expression. [score:7]
In vivo knockdown of hippocampal miR-132 expression impairs memory acquisition of trace fear conditioning. [score:4]
Experience -dependent expression of miR-132 regulates ocular dominance plasticity. [score:4]
miR-132/212 knockout mice reveal roles for these miRNAs in regulating cortical synaptic transmission and plasticity. [score:3]
miRNA-132: a dynamic regulator of cognitive capacity. [score:2]
Arguably the two most extensively studied examples in the context of synapse development are miR-132 and miR-134. [score:2]
CREB -induced miR-132 promotes dendritogenesis and spine growth by down -regulating p250GAP (Wayman et al., 2008; Magill et al., 2010). [score:2]
Regulation of synaptic structure and function by FMRP -associated microRNAs miR-125b and miR-132. [score:2]
microRNA-132 regulates dendritic growth and arborization of newborn neurons in the adult hippocampus. [score:2]
miR-132 enhances dendritic morphogenesis, spine density, synaptic integration, and survival of newborn olfactory bulb neurons. [score:1]
miR-132, an experience -dependent microRNA, is essential for visual cortex plasticity. [score:1]
Convergent repression of Foxp2 3′UTR by miR-9 and miR-132 in embryonic mouse neocortex: implications for radial migration of neurons. [score:1]
MicroRNA-132 regulates recognition memory and synaptic plasticity in the perirhinal cortex. [score:1]
miR-132 mediates the integration of newborn neurons into the adult dentate gyrus. [score:1]
[1 to 20 of 14 sentences]
27
[+] score: 29
miR-132 has not been wi dely implicated in cardiac disease, however, it regulates post-translational expression of the β2-subunit of cardiac L-type calcium channels [29], consistent with changes in electrical conduction in DBL mice. [score:8]
Seven miRNAs showed differential expression (Figure 1a, Figure S2a); miR-1 and miR-542-3p showed decreased expression, whereas miR-132, miR-214, miRNA-31, miR-210 and miR-10b showed increased expression. [score:7]
We confirmed the upregulation of miR-214 and miR-132 during early-stage disease in DBL mice. [score:6]
In addition, we validated the increased expression of miR-132 during HCM, which is not wi dely reported as differentially expressed following cardiac stress and may represent a distinct change in the pathogenesis of severe HCM in DBL mice. [score:5]
The expression levels of miR-132 and miR-214, which were increased at age 10 days in the DBL mice, remained elevated at age 16 days. [score:3]
[1 to 20 of 5 sentences]
28
[+] score: 28
In breast cancer, miR-132 suppresses cell proliferation, invasion, migration and metastasis of different breast cancer cells through direct suppression of hematological and neurological expressed 1 (HN1) [17]. [score:8]
Activation of Ahr by TCDD and DIM decreased the luciferase activities significantly, and these effects were reversed by co-transfection with as-miR-132 (Fig.   4c) and as-miR-212 (Fig.   4d), suggesting a regulatory role of the miRNA cluster on SOX4 gene expression. [score:4]
Over -expression of miR-132 and miR-212 showed inhibitory effects on migration of MDA-MB-231 and expansion of T47D cells in wound healing assay, and invasion in Boyden chamber in both cell lines compared with siNS -transfected controls (Fig.   3a and b). [score:3]
c and d Co-transfection of 3′UTR-SOX4-luc and miRNA antisense, as-miR-132 or as-miR-212, mitigated the inhibitory effects of TCDD and DIM on the luciferase activity in MDA-MB-231 and T47D. [score:3]
Moreover, miR-132 causes expression changes of genes involved in metabolism, DNA damage and cell motility in immortalized fibroblasts co-cultured with epithelial columnar cell hyperplasia (CCH) cells [19]. [score:3]
f Co-transfection of 3′UTR-SOX4-luc and miRNA mimics, miR-132 or miR-212, suppressed the luciferase activity in MDA-MB-231 and T47D. [score:3]
MiR-212 and miR-132 are tandem miRNAs at the same location on chromosome 17 in humans, called miR-212/132 cluster, and they share the same seed sequence and the transcriptional regulatory elements. [score:2]
The role of miR-212/132 cluster on migration of MDA-MB-231, expansion of T47D and invasion of breast cancer cells were examined by the transfection of miRNA mimics, miR-132 and miR-212, or antisense, as-miR-132, as-miR-212. [score:1]
MiR-212 and miR-132 are tandem miRNAs located in an intergenic region on chromosome 17 in humans, and they share the same seed sequence AACAGUCU. [score:1]
[1 to 20 of 9 sentences]
29
[+] score: 26
Glucocorticoid attenuates brain-derived neurotrophic factor -dependent upregulation of glutamate receptors via the suppression of microRNA-132 expression. [score:8]
miR-132 regulates the differentiation of dopamine neurons by directly targeting Nurr1 expression. [score:7]
Thus, it will be an interesting question for future studies if microRNA-132 or other microRNAs are also involved in the translational regulation of iGluRs in stem cells and if those miRNAs are expressed in 46C ESCs as well. [score:6]
Interestingly, microRNA-132 also regulates the expression of GluN2A, GluN2B, and GluA1 through a BDNF -dependent mechanism (Kawashima et al., 2010). [score:4]
It has been shown previously that microRNA-132 plays a critical role during the differentiation of dopaminergic neurons from ESCs (Yang et al., 2012). [score:1]
[1 to 20 of 5 sentences]
30
[+] score: 26
No obvious changes were observed in miR-146a expression and there was minimal increase in miR-132 expression in hepatocytes of alcohol-fed mice (Figure 2). [score:5]
Here, we examined the liver expression of other miRNA including miR-132, -125b, and -146a which also regulate various immune responses. [score:4]
We focused our study on miR-155 and miR-132, as the expression of these miRNAs was increased in the livers after alcohol feeding (Figure 1). [score:3]
Recently, miR-132 was shown to play a role in the innate viral response, where it targets p300, a transcriptional coactivator [40]. [score:3]
MiR-132 was shown to play a role in neuroinflammation [39] and also regulates innate antiviral immunity, where it targets the p300 transcriptional coactivator [40]. [score:3]
We also found a modest increase of miR-132 in hepatocytes of alcohol-fed mice. [score:1]
Increase of miR-155 and miR-132 in Kupffer Cells of Alcohol-Fed Mice. [score:1]
Chronic alcohol use predisposes individuals to infections (bacterial and viral), and the induction of miR-132 after alcohol feeding is of great interest. [score:1]
Induction of miR-132 in alcohol-fed mice is interesting, as the role of this miRNA in innate immunity is not much appreciated. [score:1]
However, the role of miR-132 in the alcohol -mediated TLR response is yet to be elucidated; therefore, in this study, we determined the effect of alcohol on miR-132. [score:1]
We not only showed induction of miR-155, but also miR-132 in the livers and KCs of alcohol-fed mice. [score:1]
Among the miRNAs tested, we found significant induction of miR-132 in the livers of alcohol-fed mice (Figure 1). [score:1]
Interestingly, we not only observed a significant increase in miR-155, which was consistent with our previous report [34], but also induction of miR-132 in the KCs of alcohol-fed mice (Figure 3). [score:1]
[1 to 20 of 13 sentences]
31
[+] score: 24
The results show upregulation of the non-coding RNAs miR-212, miR-132, miR-410, Snord14d and Snord14e following memory acquisition (FC30') and retrieval (RT30') (Figure 5A); although the levels of upregulation observed differ between the two time-points. [score:7]
Differential regulation of miR-132 and miR-212 after memory acquisition and retrieval raises the interesting possibility that they target different genes during those processes, although so far the few known experimentally validated targets are shared between miR-132 and miR-212 [60]. [score:6]
Finally, we examine genome-wide non-coding RNA regulation following memory acquisition and retrieval, pointing to a likely important role of microRNAs miR-132, miR-212, miR-410 and snoRNAs Snord14d and Snord14e in posttranscriptional regulation during both processes as well as a specific role for and miR-219 and its target CAMKIIγ after retrieval. [score:5]
Transgenic expression of miR-132 impairs novel-object recognition memory [67], suggesting that these microRNAs have a functional role in memory storage. [score:3]
The induction of miR-212 and miR-132 is not surprising given that they both are induced by LTP [59] and miR-132 has been shown to increase in response to the Barnes maze learning paradigm [66]. [score:1]
MicroRNA genes miR-212, miR-132 and miR-219 were selected for further validation. [score:1]
MiR-212 and miR-132 are CREB -dependent microRNAs derived from the same precursor that are induced by LTP [59] and play an important role in neuronal plasticity [60]. [score:1]
[1 to 20 of 7 sentences]
32
[+] score: 24
To compare miR-27a with other obesity -modified miRNAs, expression levels of hepatic miR-122 and miR-132 were also analyzed and found to be dramatically upregulated in livers of HFD-fed and ob/ob mice (Fig.   S1) as described in previous reports 27, 30. [score:6]
Hanin, G. et al. miRNA-132 induces hepatic steatosis and hyperlipidaemia by synergistic multitarget suppression. [score:5]
In consistent with previous studies, levels of miR-122 and miR-132 were upregulated in the fatty livers of obese mice caused by diets feeding (HFD or HCD) or genetic mutation (ob/ob) (Fig.   S1). [score:5]
But in livers of HCD-feeding mice, which hepatic lipogenesis is robustly promoted, miR-27a exhibited an insignificant reduction while miR-122 and miR-132 were dramatically upregulated (Fig.   S2b). [score:4]
Subsequent studies in mice demonstrated miR-34a contributing to hepatic steatosis via repressing sirtuin 1 (Sirt1) [29], miR-132 and miR-30 regulating hepatic lipid synthesis and lipoprotein secretion 30, 31, and miR-29 involved in lipogenic programs of liver [32]. [score:2]
Interestingly, in these fatty livers, miR-27a displayed a similar change as miR-122 and miR-132 did. [score:1]
These results suggest the functions and underlying molecular mechanisms of miR-27a might be different from other obesity -modified miRNAs (e. g. miR-122 and miR-132) in various contexts of fatty livers. [score:1]
[1 to 20 of 7 sentences]
33
[+] score: 23
De-repression of FOXO3a death axis by microRNA-132 and -212 causes neuronal apoptosis in Alzheimer's disease. [score:3]
Note that miR-132 and miR-125b associate with all disease groups. [score:3]
An exception is the AChE -targeted miR-132, which shows a drastic decline in the Alzheimer's brain (Lau et al., 2013). [score:3]
Hippocampal microRNA-132 mediates stress-inducible cognitive deficits through its acetylcholinesterase target. [score:3]
MicroRNA-132 potentiates cholinergic anti-inflammatory signaling by targeting acetylcholinesterase. [score:2]
Angiotensin II Regulates microRNA-132/-212 in Hypertensive Rats and Humans. [score:2]
TMEM106B, the risk gene for frontotemporal dementia, is regulated by the microRNA-132/212 cluster and affects progranulin pathways. [score:2]
MicroRNA-132 suppresses autoimmune encephalomyelitis by inducing cholinergic anti-inflammation: a new Ahr -based exploration. [score:2]
MicroRNA-132 modulates cholinergic signaling and inflammation in human inflammatory bowel disease. [score:2]
MicroRNA profiling and the role of microRNA-132 in neurodegeneration using a rat mo del. [score:1]
[1 to 20 of 10 sentences]
34
[+] score: 22
Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0003490 mmu-miR-700-3p mmu-miR-700 CACGCGGGAACCGAGUCCACC 1.6 MIMAT0004238 mmu-miR-743a-3p mmu-miR-743a GAAAGACACCAAGCUGAGUAGA 1.6 MIMAT0000152 mmu-miR-140-3p mmu-miR-140-star UACCACAGGGUAGAACCACGG 1.7 MIMAT0000609 mmu-miR-351-5p mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG 1.8 Decreased in F28-7-A Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0000670 mmu-miR-222-3p mmu-miR-222 AGCUACAUCUGGCUACUGGGU 0.6 MIMAT0004580 mmu-miR-34c-3p mmu-miR-34c-star AAUCACUAACCACACAGCCAGG 0.6 MIMAT0000144 mmu-miR-132-3p mmu-miR-132 UAACAGUCUACAGCCAUGGUCG 0.5 To test whether inhibition/overexpression of these candidate miRNAs in the F28-7 cells modulate FUdR -induced cell death, we have done transfections of the miRNA inhibitors and/or the synthetic miRNA mimics. [score:7]
Using 1.5-fold cut-off, the analysis identified seven differentially expressed miRNAs: in F28-7-A (apoptosis-fated cell), four mature miRNAs (miR-700, miR-743a, miR-140*, miR-351) were expressed at higher levels, and three mature miRNAs (miR-222, miR-34c*, miR-132) were expressed at lower levels than in F28-7 (necrosis-fated cell). [score:7]
In addition, miR-222 and miR-132 were expressed at lower levels in F28-7-A than in F28-7 cells (Fig 1E and 1G). [score:3]
Expression of (A) miR-700, (B) miR-743a, (C) miR-140*, (D) miR-351, (E) miR-222, (F) miR-34c*, (G) miR-132, and RNU6B were analyzed by quantitative real-time PCR using primers for miR-700-3p, miR-743a-3p, miR-140-3p, miR-351-5p, miR-222-3p, miR-34c-3p, miR-132-3p, and RNU6B (see ). [score:2]
Therefore, we assumed that the miR-700, miR-743a, miR-140*, miR-351, miR-222, and miR-132 were candidate miRNAs as cell-death regulators in necrosis and apoptosis. [score:2]
Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0003490 mmu-miR-700-3p mmu-miR-700 CACGCGGGAACCGAGUCCACC 1.6 MIMAT0004238 mmu-miR-743a-3p mmu-miR-743a GAAAGACACCAAGCUGAGUAGA 1.6 MIMAT0000152 mmu-miR-140-3p mmu-miR-140-star UACCACAGGGUAGAACCACGG 1.7 MIMAT0000609 mmu-miR-351-5p mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG 1.8 Decreased in F28-7-A Accession number [a] ID MicroRNA name Sequence Fold difference [b] MIMAT0000670 mmu-miR-222-3p mmu-miR-222 AGCUACAUCUGGCUACUGGGU 0.6 MIMAT0004580 mmu-miR-34c-3p mmu-miR-34c-star AAUCACUAACCACACAGCCAGG 0.6 MIMAT0000144 mmu-miR-132-3p mmu-miR-132 UAACAGUCUACAGCCAUGGUCG 0.5 Total small RNA fractions were prepared from F28-7 and F28-7-A cells (no drug, no incubation). [score:1]
[1 to 20 of 6 sentences]
35
[+] score: 21
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Tumor-suppressor miR-16 (downregulated in some cancers) and miR-132 (which is methylation-silenced in prostate cancer) have been identified as putative endogenous modulators of neuronal tau phosphorylation and tau exon 10 splicing, respectively (Bottoni et al., 2005; Hébert et al., 2010; Formosa et al., 2012; Rivas et al., 2012). [score:6]
MiR-132 and miR-212 are increased in pancreatic cancer and target the retinoblastoma tumor suppressor. [score:5]
Downregulation of miR-132 by promoter methylation contributes to pancreatic cancer development. [score:5]
miR-132 is implicated in prostate and pancreatic tumorigenesis (Park et al., 2011; Zhang et al., 2011; Formosa et al., 2012) and downregulated in progressive supranuclear palsy, a neurodegenerative tauopathy related to the atypical parkinsonism of ALS-PDC (Smith et al., 2011). [score:4]
DNA methylation silences miR-132 in prostate cancer. [score:1]
[1 to 20 of 5 sentences]
36
[+] score: 21
The top striatum hits include the downregulated Mir212/ Mir132 cluster whose knockout has been implicated in impaired synaptic function [18] and down-regulation in neuronal death via the PTEN/FOXO3a signaling pathway [19]. [score:7]
The strongest negative microRNA-module correlations were observed between striatum module M39 and Mir132 (mean correlation -0.79) and Mir212 (mean correlation -0.75); module M39 is also strongly enriched in predicted targets of both microRNAs (p = 1×10 [−7] for targets predicted by MicroRNA. [score:5]
Other examples of strongly negatively correlated microRNA-module pairs with strong enrichment of predicted targets include Mir132 and module M1 (correlation -0.63, enrichment p-value 2×10 [−6]), Mir181d and module M34 (correlation -0.58, enrichment p-value 4×10 [−6]), and Mir128 and module M39 (correlation -0.58, enrichment p-value 1×10 [−7]). [score:3]
The Mir132/ Mir212 cluster has been implicated in neuronal survival and shows strongest down-regulation in the striatum, followed by cerebellum and cortex. [score:3]
Moreover, Mir132 is induced by neuronal activities [21] and is implicated in regulating the function of the chromatin regulator MeCP2 [22]. [score:2]
The Mir212/ Mir132 cluster has also been implicated in regulation of aging-related processes via interaction with FOXO3 [23]. [score:1]
[1 to 20 of 6 sentences]
37
[+] score: 21
Importantly, the learning impairment caused by supra-physiological upregulation of miR132 in these transgenic mice could be turned into learning enhancement by mitigating miR132 overexpression to a level representing a 1.5- to 2-fold increase (Hansen et al., 2013). [score:6]
However, while memory enhancement was observed if miR132 overexpression is 1.5- to 2-fold (Hansen et al., 2013), which is similar to the increase seen in our study in response to, transgenic mice overexpressing miR132 more than 3-fold exhibit learning impairment (Hansen et al., 2010, Hansen et al., 2013, Scott et al., 2012). [score:5]
We found that miR132 and miR212 were upregulated both in sperm and hippocampus of mice that were exposed to for 10 weeks (Figures 3A and 3B). [score:4]
The following oligonucleotides were used for cloning the miRNA target sequences into pmirGLO: miR-132-3p F: AAACTAGCGGCCGCTAGTCGACCATGGCTGTAGACTGTTA miR-132-3p R: CTAGATAACAGTCTACAGCCATGGTCGACTAGCGGCCGCTAGTTT miR-132-5p F: AAACTAGCGGCCGCTAGTGTAACAATCGAAAGCCACGGTTT miR-132-5p R: CTAGAAACCGTGGCTTTCGATTGTTACACTAGCGGCCGCTAGTTT miR-212-3p F: AAACTAGCGGCCGCTAGTTGGCCGTGACTGGAGACTGTTAT miR-212-3p R: CTAGATAACAGTCTCCAGTCACGGCCAACTAGCGGCCGCTAGTTT miR-212-5p F: AAACTAGCGGCCGCTAGTAGTAAGCAGTCTAGAGCCAAGGT Animals were sacrificed by cervical dislocation. [score:3]
The following oligonucleotides were used for cloning the miRNA target sequences into pmirGLO: miR-132-3p F: AAACTAGCGGCCGCTAGTCGACCATGGCTGTAGACTGTTA miR-132-3p R: CTAGATAACAGTCTACAGCCATGGTCGACTAGCGGCCGCTAGTTT miR-132-5p F: AAACTAGCGGCCGCTAGTGTAACAATCGAAAGCCACGGTTT miR-132-5p R: CTAGAAACCGTGGCTTTCGATTGTTACACTAGCGGCCGCTAGTTT miR-212-3p F: AAACTAGCGGCCGCTAGTTGGCCGTGACTGGAGACTGTTAT miR-212-3p R: CTAGATAACAGTCTCCAGTCACGGCCAACTAGCGGCCGCTAGTTT miR-212-5p F: AAACTAGCGGCCGCTAGTAGTAAGCAGTCTAGAGCCAAGGT were sacrificed by cervical dislocation. [score:3]
[1 to 20 of 5 sentences]
38
[+] score: 21
Other miRNAs, such as miR-23a, miR-31, miR-132, or miR-16, were also significantly downregulated with cardamonin treatment for 24 h compared to that of treatment for 3 h. Since most of miRs have been downregulated and miR-21 was strongly suppressed by cardamonin, we used miR-21 mimics and miR-21 inhibitors to test the function of cardamonin on HUVECs. [score:10]
It is reported that miR-132 plays an important role in angiogenesis in infectious ocular disease [32] and miR-16 affects the angiogenesis by targeting VEGF [33, 34]. [score:5]
It is noted that other miRNAs, for example, miR-132 and miR-16, were also obviously downregulated after treatment with 50  µM cardamonin. [score:4]
We selected 14 of these miRs which might have been involved in regulation of angiogenesis, including miR-17-5p, miR-19a, miR-23a, miR-24, miR-31, miR-34a, miR-126, miR-130a, miR-132, miR-16, miR-21, miR-217, miR-221, and miR-378 for our study. [score:2]
[1 to 20 of 4 sentences]
39
[+] score: 20
Other miRNAs from this paper: hsa-mir-132
If T. gondii increases MiR-132 in dopamine neurons resulting in repression of Nurr1 expression, then the +/- mice would be more vulnerable to attenuated Nurr1 expression, which would likely have a greater effect on dopamine neuron gene expression and dopamine neurotransmission. [score:6]
MiR-132 was also recently found to negatively regulate Nurr1 expression and inhibit the differentiation of embryonic stem cells into dopamine neurons [110]. [score:5]
Since Nurr1 is also expressed in neurons in other brain regions, the effect of the +/- genotype combined with a possible direct effect of T. gondii on Nurr1 expression via MiR-132 could result in abnormal function of other brains regions, such as the ventral subiculum or prefrontal cortex. [score:5]
A recent finding by Xiao et al. reported that acute infection with T. gondii resulted in an increase in expression of MiR-132, a cyclic AMP-responsive element binding regulated microRNA [109]. [score:3]
, Dawson VL, et al MicroRNA-132 dysregulation in Toxoplasma gondii infection has implications for dopamine signaling pathway. [score:1]
[1 to 20 of 5 sentences]
40
[+] score: 19
In addition to this group of down-regulated miRs, CSCs can be distinguished from embryonic heart cells on the basis of seven up-regulated miRs: let-7a, let-7b, miR-24, miR-125b, miR-132, miR-149 and miR-223 (Fig. 2C). [score:7]
In addition to the above mentioned role as a regulator of endothelial differentiation, miR-132 was recently shown to regulate the expression of the β2 subunit of the cardiac L-type calcium channel protein [33], [34] and to function as a paracrine activator of heart healing [13], [36]. [score:5]
As mentioned above, miR-24, miR-125b and miR-132 are among the top expressed miRs in CSCs. [score:3]
[49] miR-132 30.3+0.8 Regulators of endothelial lineage and angiogenesis in cardiovascular development. [score:3]
In particular, miR-132 is an inducer of endothelial cell differentiation and proliferation, pointing to the commitment of CSCs to this lineage [28], [31]. [score:1]
[1 to 20 of 5 sentences]
41
[+] score: 17
In neurons, miR-132 and miR-138 are expressed in response to synaptic activity and have a role in the modulation of morphologic events of neuroplasticity taking place in memory and cognition processes (Wayman et al., 2008; Siegel et al., 2009; Edbauer et al., 2010; Impey et al., 2010; Hansen et al., 2012; Bicker et al., 2014). [score:3]
This study Previous studies miRNA Sample Lower/Higher Sample Lower/Higher Target miR-132 Plasma of 3xTg-AD and WT mice of 2–3 and 14–15 months − AD brain −Cogswell et al., 2008 p250-GAP AD neocortex −Hébert et al., 2013 AD CSF −Burgos et al., 2014 miR-138 − AD CSF −Burgos et al., 2014 APT1 miR-139 − AD CSF −Burgos et al., 2014 miR-146a − AD CSF/plasma −Kiko et al., 2014 IRAK-1 TRAF6 AD CFS −Müller et al., 2014 AD hippocampus ± miR-146b − AD CSF −Cogswell et al., 2008 AD brain − miR-29a − AD cortex −Hébert et al., 2008 BACE1 AD serum −Geekiyanage et al., 2011 AD CSF +Kiko et al., 2014 miR-29c − AD cortex −Hébert et al., 2008 The table contains data obtained from this study (left) and collected from others (right). [score:3]
Regulation of synaptic structure and function by FMRP -associated microRNAs miR-125b and miR-132. [score:2]
miRNA-132: a dynamic regulator of cognitive capacity. [score:2]
MicroRNA-132 potentiates cholinergic anti-inflammatory signaling by targeting acetylcholinesterase. [score:2]
old 3xTg-AD mice, we identified a particular group of miRNAs integrated by miR-132, miR-138, miR-146a, miR-146b, miR-22, miR-24, miR-29a, miR-29c, and miR-34a which show significant differences in plasma levels only in the transgenic group, raising the possibility of age-related changes that specifically occur in the 3xTg-AD mice (Figure 3, Supplementary Table 3). [score:1]
age-matched WT mice, we detected a significant lower abundance of miR-132, miR-138, miR-139, miR-146a, miR-146b, miR-22, miR-24, miR-29a, and miR-29c as well as a higher abundance of miR-346 (Figure 4, Supplementary Table 4). [score:1]
Since memory and cognition are highly impaired in AD, the lower abundance of miR-132 and miR-138 result very interesting for analyzing the evolution of AD at a molecular level. [score:1]
miR-132 has been reported to have an anti-inflammatory effect, blocking acetylcholinesterase, elevating acetylcholine levels and consequently blocking NF-kB (Shaked et al., 2009). [score:1]
In agreement with our results, lower levels of miR-132, miR-138 y miR-139 have been reported in AD brain and CFS samples (Cogswell et al., 2008; Burgos et al., 2014). [score:1]
[1 to 20 of 10 sentences]
42
[+] score: 17
Other miRNAs from this paper: mmu-mir-134, mmu-mir-212
Associated microRNAs are miR-132 regulating Rac1 activity via modulation of a GTP hydrolysis protein (p250GAP) and miR-134 directly suppressing LIMK1 levels. [score:5]
Phosphorylated CREB (CREB-P) regulates the expression of miR-132 and immediate early genes such as c-Fos, Arc and Crem affecting both synaptic morphology and adult neurogenesis. [score:4]
Overexpression of miR-132 in the rat perirhinal cortex impairs short-term recognition memory accompanied with attenuated LTD and LTP [33]. [score:3]
The miR-132 and miR-134 regulate the Rac1-Cofilin pathway [30, 31]. [score:2]
Further, we observed substantial increase in the level of miR-132, especially in the cortex. [score:1]
These changes were coupled to epigenetic modulation via increased levels of microRNAs (miR-132/miR-212, miR-134). [score:1]
Dendritic spines Hippocampus Cortex CREB miR-132 Ionising radiation Proteomics Rac1 Cofilin Alzheimer Ionising radiation remains a first-line treatment for malignancies of the central nervous system (CNS). [score:1]
[1 to 20 of 7 sentences]
43
[+] score: 17
Recently, Mokutani et al. [32] demonstrates that ANO1 (TMEM16A) is a direct target of miR-132, and miR-132 overexpression markedly suppresses ANO1 expression level in colorectal cancer, suggesting that microRNAs may be involved in modulating TMEM16A expression. [score:12]
Recent study revealed that TMEM16A (ANO1) was a direct target gene of miR-132, and was negatively regulated by miR-132 in colorectal cancer [32]. [score:5]
[1 to 20 of 2 sentences]
44
[+] score: 17
The miR-132/mir-212 cluster can also regulate hematopoietic stem cells survival during aging by regulating FoxO3 expression [56]. [score:5]
In fact, this same pattern of regulation was observed for other seven miRNAs (mmu-miR-29c, mmu-miR-296, mmu-miR-130b, mmu-miR-17, mmu-miR-434, mmu-miR-181c, mmu-miR-132), which further confirms the validity of our analysis and suggests miRNA regulation at the gene expression level [48]. [score:5]
miR-132 and -212 are both members of the miR-132 gene family and were also strongly down-regulated in young and old df/df mice in comparison to N mice. [score:4]
miR-132 and -212 are important regulators of cell cycling and renewal as well as survival and autophagy [57]. [score:2]
Deletion of miR-132/212 in hematopoietic cell lines increases their survival by preventing abnormalities during aging in response to nutritional stress [56]. [score:1]
[1 to 20 of 5 sentences]
45
[+] score: 16
Interestingly, most of these differentially expressed miRNAs belonged to miRNA families, including miR-8 and miR-132 families overexpressed in FCx and miR-34 family overexpressed in HP, or miRNA clusters transcribed from the same locus (miR-182|miR-183|miR-96 cluster overexpressed in FCx). [score:9]
For example, in the ceramide pathway (Figure 5), miR132 and miR-212 were predicted to regulate Ras, Pi3k, Pp2a, and Tnfr1, miR-200a to regulate Nsmaf, Pp2a, and Map2k4, and miR-200b, miR-200c, and miR-429 to regulate Ras, Pp2a, Map3k1, and Jun. [score:4]
We identified the ceramide signaling pathway by investigating the predicted biological target pathways of miR-8 and miR-132 families, both of which were expressed on a higher level in FCx compared to HP. [score:2]
These included miR-8, miR-132, and miR-34 families and the miR-182|miR-96|miR-183 cluster. [score:1]
[1 to 20 of 4 sentences]
46
[+] score: 15
In this case, miR-132 regulates the translation of transcriptional co-repressor methyl CpG–binding protein 2 (MeCP2), the levels of which are under tight regulation in the brain as both increases and decreases in it expression have been shown to result in neurodevelopmental defects. [score:8]
BDNF expression is modulated by MeCP2 as part of a feed-back loop in which miR-132 plays a role, perhaps along with other miRNAs. [score:3]
One interesting example is the indirect regulation of the neurotrophic factor BDNF by miR-132 [49]. [score:3]
Only a small number of miRNAs have so far been associated with neurodegenerative processes: miR-133b, miR-9, miR-125b, miR-132, miR-124a, miR-219 and miR-128 [19], [20], [47]. [score:1]
[1 to 20 of 4 sentences]
47
[+] score: 14
Using PSP as a mo del disease, we identified miR-132 to be selectively downregulated in pathological conditions. [score:6]
Interestingly, PTBP2 protein (but not mRNA) levels were increased in PSP patients and correlated significantly with miR-132 expression [26]. [score:3]
), we identified miR-132 and the neuronal splicing regulator PTBP2 as potential regulators of endogenous tau exon 10 splicing in neurons. [score:3]
3. Tau Alternative Splicing Regulation by miR-132. [score:2]
[1 to 20 of 4 sentences]
48
[+] score: 14
For example, miR-134 regulates LimK1 at the spine by stimulation of BDNF [19], miR-138 regulates palmitoylation in neurons by inhibiting the translation of LYPLA [16], [18], miR-132 targets p250GAP to enhance spine growth [20] and the FMRP associated miRNA, miR-125b blocks the translation of NR2B resulting in neuronal structural changes [21]. [score:11]
Among the differentially expressed miRNAs was miR-132, a known activity -dependent miRNA [20]. [score:3]
[1 to 20 of 2 sentences]
49
[+] score: 14
Our data provides a detailed map of miRNA brain expression in rats and shows that there are some differences in the expression in the cerebellum of a subset of the detectable transcripts, which are either highly enriched (miR-206 and miR-497) or nearly depleted (miR-132, miR-212, miR-221 and miR-222). [score:5]
Forebrain enrichment was also seen for the two members of the miR-132 family (miR-132 and miR-212), which were also most highly expressed in the hippocampus and amygdaloid regions. [score:3]
Notably, we found reciprocal expression profiles for a subset of the miRNAs predominantly found (> ten times) in either the cerebellum (miR-206 and miR-497) or the forebrain regions (miR-132, miR-212, miR-221 and miR-222). [score:3]
The selected miRNAs were rno-let-7a (part # 4373169), rno-miR-132 (part # 4373143), rno-miR-206 (part # 4373092) and rno-miR-320 (part # 4395388). [score:1]
The within-region variability of miR-132 (sd = 0.38 and 0.37), miR-320 (sd = 0.38 and 0.44), miR-497 (sd = 0.47 and 0.27) and let-7a (sd = 0.40 and 0.55) did not differ from the regional average of the hippocampus (sd = 0.39) and the hypothalamus (sd = 0.43) respectively (P-values from 0.13 to 0.95). [score:1]
miR-132 has also been related to neuronal morphogenesis [13], [14], and both miR-132 and miR-219 have been shown to modulate the circadian clock [15]. [score:1]
[1 to 20 of 6 sentences]
50
[+] score: 13
Profiling of miRNAs expression was also performed in the YAC128 and R6/2 mice, showing that nine miRNAs (miR-22, miR-29c, miR-128, miR-132, miR-138, miR-218, miR-222, miR-344, and miR-674*) are commonly down-regulated in 12-month-old YAC128 mice and 10-week-old R6/2 mice (100). [score:6]
The regulation of these miRNAs by REST was evaluated in embryonic striatal cell lines, and mir-29a, mir-124a, mir-132, and mir-135b were shown to be significantly upregulated upon loss of REST function and in the cortex of 12-week-old R6/2 mice. [score:3]
Packer et al. (102) used a screen of predicted REST-regulated miRNAs from HD patient brain samples, and found significant decreases of miR-9, miR-9*, and miR-29b as well as a significant increase of miR-132 at late stages. [score:2]
In humans, mir-132 expression level is significantly lower in HD samples compared to control. [score:2]
[1 to 20 of 4 sentences]
51
[+] score: 13
There are also a number of miRNAs such as miR-132, miR-212, miR-130a and miR-152 shown to be upregulated in the pancreatic islets of the wi dely-studied T2D mo del Goto-Kakizaki rats (Esguerra et al., 2011) with active roles in beta cell stimulus-secretion coupling (Malm et al., 2016; Ofori et al., 2017). [score:4]
Among the other miRNAs included in this study, we observed significantly higher expression levels of miR-132 and miR-212 at higher confluences in INS-1 832/13 cells (Figs. 3A– 3B) but only an increasing trend in the human EndoC-βH1 cells (Figs. 3C– 3D). [score:3]
miR-132 and miR-212 expression in INS-1 832/13 cells (A–B) or in EndoC-βH1 cells (C–D) at different confluences. [score:3]
Although we showed that miR-375, which is one of the most enriched beta cell miRNA was not significantly influenced by confluence level in cultured rat and human beta cell lines, we clearly demonstrated that miR-132 and miR-212 are more dependent on cellular densities, as was shown for some miRNAs in other cells types (Hwang, Wentzel & Men dell, 2009; Van Rooij, 2011). [score:1]
We also investigated the influence of confluence on the expression levels of miR-200a, miR-130a, miR-152, miR-132 and miR-212. [score:1]
The following primers from TaqMan [®] Gene Expression and TaqMan [®] miRNA Assays were used for qPCR: Cav1/CAV1 (Rn00755834_m1/Hs00971716_m1), Aifm1/AIFM1 (Rn00442540_m1/ Hs00377585_m1), miR-375 (TM_ 000564), miR-200a (TM_000502), miR-130a (TM_00454), miR-152 (TM_000475), miR-132 (TM_000457) and miR-212 (TM_002551) were used for qPCR. [score:1]
[1 to 20 of 6 sentences]
52
[+] score: 13
Our findings also demonstrated that miR-132-3p participated in the regulation of bone loss induced by simulated microgravity and it can inhibit osteoblast differentiation by reducing Ep300 protein expression, which in turn resulted in suppression of the activity and acetylation of Runx2 [20]. [score:8]
Hu Z miRNA-132-3p inhibits osteoblast differentiation by targeting Ep300 in simulated microgravitySci. [score:5]
[1 to 20 of 2 sentences]
53
[+] score: 12
Other miRNAs from this paper: mmu-mir-125b-2, mmu-mir-146a, mmu-mir-155, mmu-mir-125b-1
Chronic ethanol feeding up-regulated miR-155 and miR-132 expression in mouse cerebellum. [score:6]
Here we found miR-132 and miR-155 upregulation and no changes in miR-125b or miR-146a levels in the cerebellum after chronic alcohol feeding suggesting that miR-132 and miR-155 are involved in the pathophysiology of alcohol -induced neuroinflammation. [score:4]
MiR-155 and miR-132 have broad pro-inflammatory effects, while miR-125b and miR-146a are negative regulators of inflammation in most cell types [29], [30]. [score:2]
[1 to 20 of 3 sentences]
54
[+] score: 12
Following LH/hCG stimulation in the ovarian cells miR-132 and miR-212 were found to be highly up regulated and computational analysis has identified nearly 77 putative mRNA as potential targets of miR-212 and miR-132 in granulosa cells [60]. [score:4]
Besides their multiple roles in neuronal development, increasing evidence point towards an important involvement of miR-212 and miR-132 in mediating many other biological processes, including inflammation [52], immune function [53] and other cellular dysfunctions such as cancer. [score:2]
miR-212 and miR-132 are evolutionary conserved tandem miRNAs, well known for their essential role in the development, maturation and function of neurons [42]. [score:2]
Furthermore, recent evidence has demonstrated that miR-212 and miR-132 play an important role as post-transcriptional regulators in granulosa cells [60]. [score:2]
miR-212 and miR-132 are closely related as they have identical seed sequences and the mature miRNA differs only by four nucleotides. [score:1]
miR-212 arises from the miR-212/132 cluster (which comprises miR-212 and miR-132). [score:1]
[1 to 20 of 6 sentences]
55
[+] score: 12
Activated CaMK4β/CREB signaling may well promote neuronal survival early in prion infection by upregulating the expression of miR132-3p and AID genes. [score:6]
High-throughput analyses have identified changes in many mRNAs and miRNAs, including miR132-3p, in scrapie-infected mice prior to the accumulation of PrP [res] or the onset of clinical disease [68– 73]. [score:3]
CREB also regulates the transcription of miR132-3p [65, 66], which modulates synapse morphology [67]. [score:2]
Elevated levels of miR132-3p and AID genes (gadd45β, gadd45γ, btg2, npas4, nr4a1) were observed at 70–110 dpi after infection with the same scrapie strain and by the same route of inoculation as in the current experiments [72]. [score:1]
[1 to 20 of 4 sentences]
56
[+] score: 11
Furthermore, significantly increased aortic expression of miR-26a, miR-21, miR-126a, miR-132, miR-146 and miR-155 and decreased expression of miR-20a and miR-92a were observed in the vehicle -treated ApoE [−/−] mice. [score:5]
Significantly increased aortic expression of miR-146a, miR-26a, miR-21a, miR-155, miR-126a and miR-132, decreased expression of miR-20a and miR-92a was observed in vehicle -treated ApoE [−/−] mice. [score:5]
Proangiogenic miR-126a [33] and miR-132 [34] and anti-angiogenic miR-92a [35] could be implicated in plaque angiogenesis, which contributes to destabilization and rupture of atherosclerotic lesions and may also lead to increased accumulation of inflammatory cells. [score:1]
[1 to 20 of 3 sentences]
57
[+] score: 11
Consistent with previous studies, genome-wide studies using 39 AD and 25 control brains found significant downregulation of miR132/212 cluster in AD temporal cortex (TC) [24]. [score:4]
Several genes implicated in Tau network, including the transcription factor (TF) FOXO1a, were identified as miR132-3p targets by in silico methods [13]. [score:3]
Knocking out the miR132/212 cluster results in an increase in Tau phosphorylation and aggregation. [score:2]
Interestingly, in an AD mouse mo del, miR132 treatment rescued memory deficits [23]. [score:1]
In AD brains, miR132-3p levels are mainly decreased in neurons enriched with hyper-phosphorylated Tau [13]. [score:1]
[1 to 20 of 5 sentences]
58
[+] score: 11
Aten S. Hansen K. F. Hoyt K. R. Obrietan K. The miR-132/212 locus: A complex regulator of neuronal plasticity, gene expression and cognitionRNA Dis. [score:4]
Hansen K. F. Sakamoto K. Aten S. Snider K. H. Loeser J. Hesse A. M. Page C. E. Pelz C. Arthur J. S. Impey S. Targeted deletion of miR-132/-212 impairs memory and alters the hippocampal transcriptomeLearn. [score:3]
Magill S. T. Cambronne X. A. Luikart B. W. Lioy D. T. Leighton B. H. Westbrook G. L. Man del G. Goodman R. H. microRNA-132 regulates dendritic growth and arborization of newborn neurons in the adult hippocampusProc. [score:2]
The well-studied miRNAs within this group included let-7 family (let-7c/d/f/k), miR-212 cluster (miR-212-3p and miR-132-3p/5p), miR-23a/b, miR-9-3p/5p, miR-411 clusters (miR-299a and miR-329) and miR-466 clusters (miR-466m-5p and miR-669f-5p) (Figure 2 and Table 1). [score:1]
Abnormal ascending of miR-132/212 alters memory and learning by modulating dendritic growth and arborization of newborn neurons via attenuating hippocampal transcriptome [51, 52, 53]. [score:1]
[1 to 20 of 5 sentences]
59
[+] score: 10
Mechanistically, overexpression of miR-132 suppressed EMT process via inhibiting ZEB2-E-cadherin signaling [49]. [score:7]
The expression of miR-132 was significantly decreased in NSCLC cell lines and clinical NSCLC cancer tissues. [score:3]
[1 to 20 of 2 sentences]
60
[+] score: 10
Activity -dependent regulation of miRNA expression was first described in the context of the CREB-responsive miRNA miR-132 [10]. [score:4]
This study and subsequent miR-132-focused studies demonstrated activity dependent upregulation of miR-132 following sustained treatment of primary neuronal cultures with BDNF, KCl, or Bicucullline [28], [29]. [score:4]
These interactions may also be relevant in mammals as FMRP immunoprecipitates a subset of neuronally enriched miRNAs including miR-125b and miR-132 [8]. [score:1]
Two studies recently demonstrated that miR-132 is transcriptionally induced in vivo in response to activity [12], [18]. [score:1]
[1 to 20 of 4 sentences]
61
[+] score: 9
Down-regulation of AChE expression is effected by microRNA (mir)-132, and transgenic mice over -expressing 3´-UTR null AChE (i. e. unresponsive to regulation by mir-132) showed excessive production of inflammatory cytokines by macrophages and an impaired cholinergic anti-inflammatory response [34]. [score:9]
[1 to 20 of 1 sentences]
62
[+] score: 9
We performed qRT-PCR to validate the upregulation of 5 miRNAs identified as deregulated by NGS and TLDA miR-141, miR-200a, miR-183, miR-26a, miR-146a, miR-132, miR-34a. [score:5]
Contrary to the NGS and TLDA data however, no significant downregulation in miR-132 and miR-34a levels was found. [score:4]
[1 to 20 of 2 sentences]
63
[+] score: 9
The differential miR pattern revealed five miRs that were >2-fold upregulated by TPO only in the presence of STAT5A/B: miR-193b, miR-132, miR-125a, miR-331-5p and miR-669a (Fig. 1a and ). [score:4]
wPRE (Schambach 2006) was used to construct the miR-193b and the miR-132/212 expression vectors. [score:3]
The ectopic expression level of mature miR-193b and miR-132 was confirmed via qPCR using an ABI TaqMan microRNA Assay ID002467 and ID000457 (Life Technologies). [score:2]
[1 to 20 of 3 sentences]
64
[+] score: 9
Other miRNAs from this paper: mmu-mir-190a, mmu-mir-190b
Talin2 expression is negatively regulated at the translational level by miR-132 [21] and also by the fragile X related protein FXR1 which binds to the 3′ end of the Tln2 mRNA and represses translation [22] (Fig. S4). [score:8]
Formosa, A. M. Lena, E. K. Markert, S. Cortelli, R. Miano, A. Mauriello, N. Croce, J. Vandesompele, P. Mestdagh, E. Finazzi-Agro, A. J. Levine, G. Melino, S. Bernardini, E. Candi, DNA methylation silences miR-132 in prostate cancer. [score:1]
[1 to 20 of 2 sentences]
65
[+] score: 9
qRT-PCR analysis of L1_ORF2 mRNA levels (C), miR-295 and miR-16 levels (D), and Hmga2 and Btg2 mRNA levels (established targets of mmu-miR-196a and mmu-let-7a and mmu-miR-132, respectively) in the various cell lines depicted in (E). [score:3]
G. Accumulation of the Hmga2 and Btg2 mRNAs, respectively targeted by mmu-miR-196a and mmu-let-7a/mmu-miR-132, analyzed by qRT-PCR before and after deletion of h Ago2. [score:3]
C. Accumulation of the Hmga2 and Btg2 mRNAs, respectively known targets for mmu-miR-196a and mmu-let-7a/mmu-miR-132, analyzed by qRT-PCR before and after Dcr deletion. [score:3]
[1 to 20 of 3 sentences]
66
[+] score: 9
REST directly down-regulates a large number of genes at the transcriptional level, but also probably indirectly activates the expression of other genes at the post-transcriptional level via the repression of many noncoding targets (Conaco et al., 2006; Mortazavi et al., 2006; Wu and Xie, 2006; Visvanathan et al., 2007; Singh et al., 2008; Johnson et al., 2009), including several micro RNAs (miRNAs) considered to be brain-specific (such as miR9, miR124, miR132, miR135, miR139, and miR153; Figure 1). [score:9]
[1 to 20 of 1 sentences]
67
[+] score: 9
That both inhibition (by a TLR9 inhibitor) and non canonic NFkB activation (by BL-7040) decrease AChE activity suggests that either complete TLR9 blockade or TLR9 -mediated alternative activation of NFkB may suppress the downstream regulator(s) controlling AChE levels (such as microRNA-132 [37]); that both of these together have no effect suggests that the two pathways most likely use common adaptor protein(s) (e. g. MyD88) to contact the regulators. [score:9]
[1 to 20 of 1 sentences]
68
[+] score: 9
Among the up-regulated miRNAs, mmu-mir-1298 had the highest fold change with 4.025 during 21d-P6 followed by mmu-mir-212 and mmu-mir-132 with a fold change of 3.71 and 3.28, respectively. [score:4]
miRanda algorithm showed that, activin receptor 1 (ACVR1) is predicted target gene for mmu-mir-193, mmu-mir-294, mmu-mir-295 and mmu-mir132. [score:3]
For example, miR-132 and miR-212 respond to luteinizing hormone (LH)/human chorionic gonadotropin (hCG) thus, these miRNAs play important roles in post-transcriptional regulation of granulosa cells [23]. [score:2]
[1 to 20 of 3 sentences]
69
[+] score: 8
Evidently, TA-p73/p63 appears to increase E-cadherin expression (a negative regulator of EMT), by suppressing ZEB1/2 through its target miRs, such as miR-192, miR-215, miR-145, miR-203, miR-200b, miR-200c, miR-183, miR-92a/b, miR-132, and miR-30a-e [45]. [score:8]
[1 to 20 of 1 sentences]
70
[+] score: 8
Additionally, BDNF controls axon branching of RGCs via the microRNA miRNA-132, which downregulates p250GAP, a GTPase-activating protein that suppresses Rac function. [score:6]
Marler K. J. Suetterlin P. Dopplapudi A. Rubikaite A. Adnan J. Maiorano N. A. Drescher U. (2013) BDNF promotes axon branching of retinal ganglion cells via miRNA-132 and p250GAP. [score:1]
Therefore, BDNF signaling may well control both global branching competence and local branch formation using miRNA-132 -dependent and -independent pathways respectively (Marler et al., 2013). [score:1]
[1 to 20 of 3 sentences]
71
[+] score: 8
Other miRNAs from this paper: rno-mir-132
miR132 is expressed in neurons, and is involved in processes of neurogenesis, regulating for example dendritic growth and arborisation in newborn neurons of adult hippocampus [58]. [score:4]
AChE expression can be regulated by different microRNAs, with one of the most prominent being miR132 [57]. [score:4]
[1 to 20 of 2 sentences]
72
[+] score: 8
Other miRNAs from this paper: mmu-mir-143, mmu-mir-200a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-802
Conversely, in the hippocampus, leptin was recently shown to decrease the expression of several genes directly targeted by miR-132, suggesting that leptin can drive the expression of this particular miRNA [30]. [score:8]
[1 to 20 of 1 sentences]
73
[+] score: 8
The observation of disrupted daily rhythmic patterning in Mecp2 [−/+] mice is consistent with the recent studies that found Mecp2 mRNA to be a direct target of the microRNA miR-132 [30]– [31]. [score:4]
miR-132 expression is robustly induced within neurons of the suprachiasmatic nucleus (SCN) by light stimulation [32], and miR-132 negatively regulates MeCP2 protein levels in these neurons. [score:4]
[1 to 20 of 2 sentences]
74
[+] score: 8
Mature ID Fold Regulation miR-135b −2.6965 miR-363 −2.5995 miR-98 −2.543 miR-132 −2.355 miR-103 −2.1776 miR-99b −2.044 miR-135a −1.8734 let-7d −1.7861 miR-130a −1.6538 miR-152 −1.6246 miR-129-5p −1.6232 miR-298 −1.6169 miR-185 −1.6035 miR-214 −1.5746 miR-140 −1.5688 miR-134 −1.5667 miR-18b −1.5607 miR-194 −1.5509 let-7f −1.5107 miR-149 −1.51 A. Scatterplot showing relative expression of miRNAs by macroarray. [score:4]
Mature ID Fold Regulation miR-135b −2.6965 miR-363 −2.5995 miR-98 −2.543 miR-132 −2.355 miR-103 −2.1776 miR-99b −2.044 miR-135a −1.8734 let-7d −1.7861 miR-130a −1.6538 miR-152 −1.6246 miR-129-5p −1.6232 miR-298 −1.6169 miR-185 −1.6035 miR-214 −1.5746 miR-140 −1.5688 miR-134 −1.5667 miR-18b −1.5607 miR-194 −1.5509 let-7f −1.5107 miR-149 −1.51 Because miRNAs typically regulate translation in animal cells, we compared CXCL10 and STAT1 protein levels in both control and Dicer [d/d] animals and cells. [score:4]
[1 to 20 of 2 sentences]
75
[+] score: 8
Among those, miR-34c-5p/-34c-3p/-362 and miR-132/-424/-146b followed the same differential expression trend seen at the iPSC stage, together with 44.84% of total differentially expressed miRNAs (Fig.   4f). [score:5]
miRNA -targeting cocktails were composed as follows: AMC, miR -mimics for miR-34c-5p/-34c-3p/-362/-210/-590, anti-miRs anti-miR-132/-146b/-424/-212/-181a; PMC, miR -mimics for miR-132/-146b/-424/-212/-181a, anti-miRs anti-miR-34c-5p/-34c-3p/-362/-210/-590 (all oligonucleotides from Sigma-Aldrich). [score:3]
[1 to 20 of 2 sentences]
76
[+] score: 7
Efficiency of transfection has been determined by performing a control transfection using miR-132 -mimic, the pMirTrap Vector and the pMirTrap Control Vector, which express an AcGFP1 fluorescein protein containing a miR-132 target sequence. [score:5]
The efficient enrichment of AcGFP1 fluorescein protein in the RISC was confirmed and compared to that of a non-miR-132 target gene, such as Lef1 mRNA transcript. [score:2]
[1 to 20 of 2 sentences]
77
[+] score: 7
Recently, Wasik and colleagues [185] found Nrf2 and its target gene expressions to be reduced in liver specimens from patients with primary biliary cholangitis, which was associated with an overexpression of miR-132 and miR-34a and increased protein levels of both Keap1 and p62. [score:7]
[1 to 20 of 1 sentences]
78
[+] score: 7
Other miRNAs from this paper: hsa-mir-132
Abnormally increased expression of miR-132 by MS B cells inhibited their SIRT1 expression, resulting in enhanced pro-inflammatory cytokine production. [score:7]
[1 to 20 of 1 sentences]
79
[+] score: 7
Other miRNAs from this paper: mmu-mir-146a, mmu-mir-155, mmu-mir-212
Nahid et al. also showed that PGN stimulation caused rapid upregulation of miR-132 and miR-212 THP-1 monocytes and primary macrophages thereby downregulating IRAK4 and that this induction was induction relative to LPS -induced miR-146a induction [42]. [score:7]
[1 to 20 of 1 sentences]
80
[+] score: 6
In these pups, perturbations to the expression levels of miR-132 were noted, and miR-132 was proposed to play a role in disturbing methyl CpG binding protein 2 expression and, hence, impact the epigenetic regulation of alveolarization [38]. [score:6]
[1 to 20 of 1 sentences]
81
[+] score: 6
Collectively, our results confirm the cornea expression of miRNAs already reported in literature [27, 31, 32] and reveal the corneal-enrichment of others that had not been previously described to be expressed in the eye (e. g. miR-130a, miR-130b, miR-132, miR-129-3p, the miR-200 family, miR-468, miR-874). [score:5]
From the latter group, 11 stained clearly both the corneal epithelium (red arrowheads) and endothelium (blue arrowheads, right column in Figure 5B; Database) while the remaining ones (e. g. miR-106a, miR-130a, miR-132, miR-494, miR-31) were detected only in the epithelium (left column in Figure 5B; Database). [score:1]
[1 to 20 of 2 sentences]
82
[+] score: 6
Overexpression of miR-377 had no effect on the luciferase activity of the mutant reporter (Figure 1C); miR-132 and miR-146b, which have been demonstrated to target the 3′-UTR of SIRT1 were used as positive controls [8, 15]. [score:5]
Several miRNAs, such as miR-132 [15], miR-155 [16], miR-130 [17], miR-145 [18], miR-146b [19], and miR-29 [20] have been indentified in obesity -associated inflammation and insulin-resistance in adipocytes. [score:1]
[1 to 20 of 2 sentences]
83
[+] score: 6
It would be interesting to determine whether ADAMTS-4 may induce mechanisms previously described to downregulate neurotrophic factor production, for instance, by modulating the nuclear translocation of transcription factors such as the histone deacetylase HDAC6 (negative regulator) [35], CREB (cAMP response element -binding protein) or NF-κB (nuclear factor kappa B) (positive regulators) [36– 38], and/or by modulating micro -RNAs (miR) production such as miR-15a, miR-132, miR-134, miR-221 or Let-7 miR [39– 41]. [score:6]
[1 to 20 of 1 sentences]
84
[+] score: 6
Other miRNAs from this paper: mmu-mir-17
Several miRNA including mir132, mir170, and let7 were highly upregulated after Oct4 overexpression in ATSCs. [score:6]
[1 to 20 of 1 sentences]
85
[+] score: 6
Other miRNAs from this paper: hsa-mir-132
One such post-transcriptional regulatory mechanism could be the action of micro -RNAs such as miR132, expression of which has been shown to be increased by 5-aza-2′-deoxycytidine/decitabine [63], and has the ability to repress MeCP2 expression [64]. [score:6]
[1 to 20 of 1 sentences]
86
[+] score: 5
Other miRNAs from this paper: mmu-mir-145a, hsa-mir-132, hsa-mir-145, mmu-mir-145b
We identified two miRNAs, miR-145 and miR-132 as MUC13 suppressing miRNAs (Fig. S2A). [score:3]
PanCa cells, HPAF-II, Capan-I and AsPC-1 cells were transiently transfected with mirVana miR-145 mimics (MC11480; Applied Biosystems), miR-132 mimics (Assay id MC10166; Applied Biosystems) or non -targeting control mimic (NC) (catalog number AM17111; Applied Biosystems). [score:2]
[1 to 20 of 2 sentences]
87
[+] score: 5
Jasińska M, Miłek J, Cymerman IA, Łęski S, Kaczmarek L, Dziembowska M (2015) miR-132 Regulates dendritic spine structure by direct targeting of matrix metalloproteinase 9 mRNA. [score:5]
[1 to 20 of 1 sentences]
88
[+] score: 5
TGF-β inducible miR-132 and miR-31 were found to be upregulated during the transition from the inflammatory to the proliferative phase in human skin promoting keratinocyte proliferation 23, 28. [score:4]
Some notable examples include miR-130a, miR-132, miR-155, miR-198, miR-21, miR-31 and miR-378a 13, 23, 24, 26, 28– 30. miR-155 acts as an important player in controlling the inflammatory response during skin repair; genetic deletion of miR-155 in mice leads to accelerated healing associated with elevated numbers of macrophages and increased type-1 collagen deposition in wounded tissue [30]. [score:1]
[1 to 20 of 2 sentences]
89
[+] score: 5
In THP-1 cells, the transcription of miR-146a/b, miR-132, and miR-155 was found to be up-regulated by LPS stimulation [6]. [score:4]
In this respect it should be noted that LPS is only a weak activator of the Akt pathway in BMDMs (data not shown), and that cell type specific differences in response to LPS have been described for another miRNA, miR-132 [27]. [score:1]
[1 to 20 of 2 sentences]
90
[+] score: 5
Other miRNAs from this paper: mmu-mir-9-3
Mmu-mir-132 and mmu-mir-219-1 are two CREB regulated brain-enriched miRNAs that regulate circadian rythmn and in the case of mir-132, neuronal morphogenesis [27, 28]. [score:3]
In contrast to the mmu-mir-219-1 and mmu-mir-132 loci, the mmu-mir-9-3 locus is specifically bound by CREM and active in testis and not GC1-spg cells (Fig. 6B). [score:1]
A similar observation was made at the mmu-mir-132 locus (data not shown). [score:1]
[1 to 20 of 3 sentences]
91
[+] score: 5
Other miRNAs from this paper: mmu-mir-212, rno-mir-132, rno-mir-212
It was reported that miR-132, one member of the miR-132/212 cluster, is induced by H [2]O [2] to target NR4A2 to aggravate apoptosis [33], but whether NR4A2 is the target of miR-212-3p in cardiomyocytes was unknown. [score:5]
[1 to 20 of 1 sentences]
92
[+] score: 5
For example, miR-625, miR-103/miR-107, miR-21 and miR-301 have been found to promote CRC to invade and metastasize by stimulating multiple metastasis-promoting genes [27– 30], whereas miR-99, miR-137, miR-132 and miR-128 function as tumor suppressors to inhibit the metastasis of CRC [31– 34]. [score:5]
[1 to 20 of 1 sentences]
93
[+] score: 5
Other miRNAs from this paper: mmu-mir-130b
Those differentially expressed miRNAs with a fold-change > 2 and those with roles known to be associated with obesity, nonalcoholic fatty liver disease, and adipogenesis (e. g., mmu-miR-130b and mmu-miR-132) are shown in, Table S7. [score:5]
[1 to 20 of 1 sentences]
94
[+] score: 5
Among the downregulated miRNAs we found the miR-132/212 cluster, which is involved in CNS development and embryonic stem (ES) cell biology [38], [39], [40] and miR-93, which belongs to the miR106b-25 cluster located on murine chromosome 5, in the 13th intron of the host gene mcm7 [41]. [score:5]
[1 to 20 of 1 sentences]
95
[+] score: 4
Lagos D. Pollara G. Henderson S. Gratrix F. Fabani M. Milne R. S. B. Gotch F. Boshoff C. miR-132 regulates antiviral innate immunity through suppression of the p300 transcriptional co-activator Nat. [score:4]
[1 to 20 of 1 sentences]
96
[+] score: 4
MiRNA function in SCN -mediated regulation of circadian rhythms is supported by observations indicating that miR-219 and miR-132 are rhythmically expressed in the SCN and that antagonism of these miRNAs within the SCN region respectively increases the circadian period of behavioral rhythmicity and attenuates circadian photoentrainment [15]. [score:4]
[1 to 20 of 1 sentences]
97
[+] score: 4
Other miRNAs from this paper: rno-mir-132
Leptin induces hippocampal synaptogenesis via CREB-regulated microRNA-132 suppression of p250GAP. [score:4]
[1 to 20 of 1 sentences]
98
[+] score: 4
Leptin induces hippocampal synaptogenesis via CREB-regulated microRNA-132 suppression of p250GAP. [score:4]
[1 to 20 of 1 sentences]
99
[+] score: 4
miR-132 and miR-199a were shown to downregulate SIRT1 in response to nutritional availability and hypoxia, respectively (Rane et al, 2009; Strum et al, 2009). [score:4]
[1 to 20 of 1 sentences]
100
[+] score: 4
Other known examples include that of MiR-132 regulating Rac1 activity and hippocampal spine formation (Impey et al., 2010), and miR-206 targeting the mRNA for the GTPase, Cdc42, in a breast cancer cell line (Liu et al., 2010). [score:4]
[1 to 20 of 1 sentences]