sort by

236 publications mentioning mmu-mir-133a-1 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-133a-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 297
A 95-fold overexpression of miR-133a led to 38% downregulation of Prdm16 (Fig. S2B), accompanied by 50% downregulation of Pparγ2 and ∼70% downregulation of Ucp1, Cidea and Lhx8 (Fig. S2C). [score:12]
Downregulation of miR-133a is accompanied by upregulation of Prdm16 during brown adipocyte commitment and differentiationPrdm16 is a transcriptional regulator that controls brown adipocyte fate determination [3]. [score:8]
This paradox led us to hypothesize that within the BAT, there are different populations of cells that express high levels of miR-133a or Prdm16, respectively, with the notion that miR-133a is highly expressed in cells expressing low levels of Prdm16, and vice versa. [score:7]
Together, these data indicate that miR-133a downregulation along the commitment and differentiation of brown adipocytes might play a role in Prdm16 upregulation during brown adipogenesis. [score:7]
Downregulation of miR-133a led to 40% upregulation of Pparγ2 and ∼3-fold increases of Prdm16, Ucp1, and Cidea (Fig. 3G). [score:7]
Downregulation of miR-133a with upregulation of Prdm16 along brown adipocyte commitment and differentiation. [score:7]
Downregulation of miR-133a is accompanied by upregulation of Prdm16 during brown adipocyte commitment and differentiation. [score:7]
Importantly, the effects of miR-133a overexpression were totally reversed by concomitant overexpression of Prdm16, and even led to ∼3 fold increase (overshoot) in adipogenic marker expression (Fig. 3D–E). [score:7]
Our data suggest that BAT adipogenesis is inhibited by overexpression, and promoted by inhibition, of miR-133a. [score:7]
1003626.g002 Figure 2Downregulation of miR-133a with upregulation of Prdm16 along brown adipocyte commitment and differentiation. [score:7]
Figure S3Knockdown of miR-133a upregulates UCP1 expression. [score:7]
Inhibition or knockout of miR-133a significantly increases Prdm16 expression and the thermogenic gene program in white adipose tissues, resulting in dramatically enhanced insulin sensitivity in animals. [score:6]
By contrast, Prdm16 is expressed at levels several fold lower in the SAT and the loss of miR-133a can therefore lead to an upregulation of Prdm16. [score:6]
Second, the loss of miR-133a may be insufficient to further upregulate Prdm16, which is already highly expressed in the BAT. [score:6]
Within the 3′ UTR of Prdm16, there are putative target sites for miR-1, miR-206, miR-133a and miR-128 (Fig. 1C), raising the possibility that these miRNAs target Prdm16 mRNA. [score:5]
First, miR-133b, another miR-133 family member, is also highly expressed in BAT (than in WAT) and maintains its expression in the miR-133a d KO BAT. [score:5]
Together, the in vivo and in vitro gene expression analysis demonstrate that inhibition of miR-133a predispose white preadipocytes to become adaptive beige adipocytes upon differentiation. [score:5]
To examine if miR-133a directly regulates Prdm16 and plays a role in BAT adipogenesis, we overexpressed miR-133a in cultured BAT APCs (Fig. 3A). [score:5]
The loss of both miR-133a and miR-133b in SAT might have led to the upregulation of Prdm16 and activation of the BAT and thermogenic gene program. [score:4]
qPCR analysis of relative expression of genes in inguinal WAT tissue after 5 day exposure of wildtype (WT) and miR-133a knockdown (KO; miR-133a1 [−/−]a2 [+/−]) mice at 4°C. [score:4]
Genetic ablation of miR-133a upregulates the thermogenic gene program in SATmiR-133a has two alleles, miR-133a1 and miR-133a2, which have identical sequences and are located in different chromosomes. [score:4]
Genetic ablation of miR-133a upregulates the thermogenic gene program in SAT. [score:4]
To examine if the observed upregulation of brown adipose and mitochondrial specific genes in SAT of miR-133a mutants are associated with browning of white adipose, we conducted histological analysis. [score:4]
qPCR analysis of relative gene expression in inguinal WAT tissue (n = 3 pairs) and cultured WAT adipocytes from SVF (n = 4 pairs) of wildtype (WT) and miR-133a knockdown (KO; miR-133a1 [−/−]a2 [+/−]) mice. [score:4]
1003626.g006 Figure 6qPCR analysis of relative expression of genes in inguinal WAT tissue after 5 day exposure of wildtype (WT) and miR-133a knockdown (KO; miR-133a1 [−/−]a2 [+/−]) mice at 4°C. [score:4]
1003626.g007 Figure 7qPCR analysis of relative gene expression in inguinal WAT tissue (n = 3 pairs) and cultured WAT adipocytes from SVF (n = 4 pairs) of wildtype (WT) and miR-133a knockdown (KO; miR-133a1 [−/−]a2 [+/−]) mice. [score:4]
Notably, miR-133b is dramatically downregulated in the asWAT and ingWAT of miR-133a d KO mice for unknown reasons. [score:4]
Previous study indicates that compared to wildtype mice, knockout of either miR-133a1 or miR-133a2 led to a 40%–50% downregulation of miR-133a in skeletal and cardiac muscles [13], [14]. [score:4]
Mutation of the miR-133a target sequence in the 3′ UTR of Prdm16 totally abolished the repression of luciferase activity by miR-133a (data not shown). [score:4]
As miR-133a targets the 3′ UTR of Prdm16, we sought to examine if miR-133a is involved in Prdm16 -mediated brown adipocyte commitment and differentiation. [score:3]
Notably, qPCR results demonstrate that miR-133a is decreased by 80%, but miR-128 is not significantly altered, in the mG [+] cells (Fig. 2D), suggesting that miR-133a is more likely to target Prdm16 in vivo. [score:3]
In consistency with our study, two recent studies demonstrated that miR-133 can target Prdm16 in both satellite cells and brown adipose cell lines [17], [18]. [score:3]
Our results suggest that miR-133a represents a potential drug target against obesity and Type2 diabetes. [score:3]
miR-133a inhibits brown adipocyte biogenesis in BAT and SAT. [score:3]
The luciferase reporter assay, gain- and loss-of-function studies provide direct evidence that miR-133a target Prdm16. [score:3]
miR-133a targets the 3′ UTR of Prdm16. [score:3]
We examined the ingWAT of miR-133a1 [−/−]a2 [+/−] and wildtype mice to address if reduction of miR-133a predisposes white preadipocytes to become beige cells that express unique beige markers and common BAT markers [15]. [score:3]
Analysis of miR-133a knockout mice confirmed the in vivo function of this microRNA in regulating the adaptive plasticity of white adipocytes. [score:3]
Our results together suggest that miR-133a represses BAT adipogenesis and WAT browning through targeting Prdm16. [score:3]
Here we report that the microRNA miR-133a specifically targets Prdm16 at the posttranscriptional level. [score:3]
Electroporation -mediated gene transfer resulted in 213-fold increase in the expression of miR-133a (Fig. 3B). [score:3]
miR-133a inhibits brown adipocyte biogenesis of BAT progenitors. [score:3]
Consistently, miR-133a but not miR-128 was significantly downregulated in the differentiated mature adipocytes compared to APC (Fig. 2F). [score:3]
Figure S2 miR-133a inhibits adipocyte browning in SAT. [score:3]
These results suggest that miR-133a and miR-128 targets the 3′ UTR of Prdm16. [score:3]
Similarly, we overexpressed miR-133a in SAT preadipocytes (Fig. S2A). [score:3]
This complete reversal and overshoot can be explained as overexpression of the miR-133a insensitive Prdm16 cDNA (lacking 3′ UTR) overrides the repression of miR-133a on endogenous Prdm16. [score:3]
Here we showed that miR-133a inhibits white adipocyte browning, it would be interesting to study if miR-133a is involved in the repression of hormone stimulated adipocyte browning process. [score:3]
miR-133a and miR-128 target the 3′ UTR of Prdm16 in HEK293 cells. [score:3]
Conversely, we used antisense oligonucleotide LNAs to specifically inhibit miR-133a in BAT APCs. [score:3]
Knockdown of miR-133a leads to browning of WAT and improves body insulin sensitivity in vivo. [score:2]
Based on this discovery, we conducted gain- and loss- of function studies to demonstrate that miR-133a regulates brown adipocyte biogenesis and browning of white adipocytes through the repression of Prdm16. [score:2]
miR-133a knockout mice were previously described [13]. [score:2]
However, we found both miR-133a and Prdm16 are expressed at very high levels in BAT compared to WAT. [score:2]
Orchestrated with this notion is the observation that compared to APCs, differentiated brown adipocytes nearly lost the expression of miR-133a. [score:2]
Due to the extremely low survival rate of the miR-133a1 [−/−]a2 [−/−] d KO mice [13], [14], we used miR-133a1 [−/−]a2 [+/−] that had three out of the four miR-133a alleles knocked for most in vivo studies. [score:2]
We reasoned that if we can detect phenotype in mice with 75% reduction of miR-133a, then there should be even more robust effects if miR-133a is completely knocked out. [score:2]
In this study we showed that miR-133a negatively regulates Prdm16 and miR-133a KO mice have dramatic phenotype including adipocyte browning, improved glucose metabolism and insulin sensitivity. [score:2]
To directly test how miR-133a affects insulin sensitivity and glucose metabolism, we conducted glucose tolerance test (GTT) and insulin tolerance test (ITT). [score:2]
The expression level of miR-133a is reduced by 95% in the ingWAT of miR-133a1 [−/−]a2 [+/−] mice compared to the wildtype mice (Fig. 7A). [score:2]
Knockdown of miR-133a promotes the activity of cold-inducible thermogenesis gene program in vivo. [score:2]
These results together provide strong in vivo evidence that miR-133a regulates the normal physiological function of adipose tissues. [score:2]
Depots of asWAT and ingWAT were harvested from widltype (WT) and miR-133a knockdown (KO; miR-133a1 [−/−]a2 [+/−]) mice that were housed at room temperature or at 4°C for 5 days. [score:2]
Interestingly, we identified four miRNAs (miR-1, miR-206, miR-133a and miR-128) that are expressed at significantly lower levels in the ingWAT compared to the asWAT (Fig. 1B, Fig. S1). [score:2]
Due to high perinatal lethality (76%) and cardiac myopathy-related postnatal sudden death of the few surviving miR-133a d KO mice [13], [14], we used in the subsequent studies miR-133a1 [−/−]a2 [+/−] mice that had three out of the four miR-133a alleles knocked out but had normal cardiac and skeletal muscles. [score:2]
1003626.g005 Figure 5Wildtype (WT; miR-133a1 [+/+]a2 [+/+]) and miR-133a knockdown (KO; miR-133a1 [−/−]a2 [+/−]) mice were used. [score:2]
Mutation of miR-133a predispose white preadipocytes to become adaptive beige adipocytes upon differentiation. [score:2]
We identified miR-133a as a regulator of Prdm16 in vivo. [score:2]
Wildtype (WT; miR-133a1 [+/+]a2 [+/+]) and miR-133a knockdown (KO; miR-133a1 [−/−]a2 [+/−]) mice were used. [score:2]
Compared to the more primitive cells (aP2 [−]), aP2 [+] cells express increased Prdm16 and decreased miR-133a. [score:2]
Previous studies have demonstrated that several myogenic microRNAs (i. e. miR-1, miR-206 and miR-133) are enriched in BAT in relative to WAT [7]. [score:1]
The mixtures (1 ml) were added to each well of BAT APCs, which have been recovered for 8–12 hours after the electroporation of miR-133a. [score:1]
miR-133a has two alleles, miR-133a1 and miR-133a2. [score:1]
As SAT is responsible for cold- and hormone -induced browning, these data suggest that miR-133a represses browning of white adipocytes in vivo under physiological conditions. [score:1]
Consistent with our observation, blockage of endogenous miR133 by antisense nucleotides in mice can greatly lower blood glucose levels [18]. [score:1]
We conclude that miR-133a plays a repressive role in adipocyte browning. [score:1]
Therefore, reduced level of miR-133a promotes the activity of cold-inducible thermogenesis gene program in vivo. [score:1]
Interestingly, miR-133a d KO mouse has adipocyte browning in SAT but has no overt phenotype in BAT. [score:1]
Plasmids carrying luciferase gene linked to 3′ UTR of Prdm16 were cotransfected to HEK293 cells, along with control miRNA, miR-133a (D) or miR-128 (E) at indicated doses. [score:1]
The miR-133a-d KO mice (miR-133a1 [−/−]; miR-133a2 [−/−]) were obtained by intercrossing mice with the genotype of miR-133a1 [−/−]; miR-133a2 [+/−]. [score:1]
After 5 d exposure at 4°C, the level of miR-133a in miR-133a1 [−/−]a2 [+/−] ingWAT is about 2% of that in wildtype ingWAT (Fig. 6A), but the level of Ucp1 is about 130 times higher in miR-133a1 [−/−]a2 [+/−] ingWAT (Fig. 6B). [score:1]
Reduced level of miR-133a predispose white preadipocytes to become adaptive beige adipocytes upon differentiation. [score:1]
miR-133a has two alleles, miR-133a1 and miR-133a2, which have identical sequences and are located in different chromosomes. [score:1]
1003626.g004 Figure 4Genetic ablation of miR-133a promotes the browning and thermogenic gene program in SAT but not BAT. [score:1]
1003626.g001 Figure 1(A–B) qPCR analysis of miR-1, miR-206, miR-133a, miR-128 and Prdm16, for asWAT and ingWAT of wildtype mice. [score:1]
Reduced level of miR-133a promotes the activity of cold-inducible thermogenesis gene program in vivo. [score:1]
These data imply that miR-133a -mediated Prdm16 repression occurs mainly in uncommitted stem cells to restrict their differentiation towards brown fat, and maintain their multipotency. [score:1]
Plasmids carrying Renila luciferase gene linked to a fragment of Prdm16-3′UTR harboring miR-133a putative binding sites were cotransfected to HEK293 cells, along with control miRNA or miR-133a mimic (Invitrogen). [score:1]
To investigate if inhibition of miR-133a promotes the adaptive thermogenesis of white adipose, we exposed miR-133a1 [−/−]a2 [+/−] and wildtype mice to cold environment. [score:1]
Reduced level of miR-133a leads to browning of WAT and improves body insulin sensitivity in vivo. [score:1]
As the increased beige adipocytes absorb more glucose and increase insulin sensitivity, it will be interesting to investigate if miR-133a could be a potent drug target for clinical purposes. [score:1]
SAT SVFs were transfected with synthetic miRNA133a by electroporation and cultured to confluence, followed by adipogenic induction and differentiation for 4 days each. [score:1]
Strikingly, GTT indicates that the miR-133a mutants had ∼50% lower overnight fasting glucose levels than WT mice (Fig. 5G). [score:1]
The mutant 3′ UTR of Prdm16 was performed by mutagenesis of the miR-133a recognized sequences from GGACCAA into TTGGTCC. [score:1]
Genetic ablation of miR-133a promotes the browning and thermogenic gene program in SAT but not BAT. [score:1]
It remains to be investigated if inhibition of miR-133a can increase system energy expenditure in the ob/ob and db/db background. [score:1]
Our study revealed that miR-133a represses white adipocyte browning and beige adipocyte formation in the mouse mo del. [score:1]
Surprisingly, neither BAT markers (Prdm16, Ucp1 and Cidea) nor mitochondria and lipolysis markers (Cox8a, Hsl, Atgl and Cpt2) were significantly affected in BAT tissue of miR-133a d KO mice (Fig. 4B–C). [score:1]
These results indicate that reduced miR-133a level is associated with improved insulin sensitivity and glucose disposal in vivo. [score:1]
[1 to 20 of 99 sentences]
2
[+] score: 263
a Ischemic upregulated miR-133 expression in MI hearts, while t-AUCB suppressed miR-133 expression in a dose -dependent manner. [score:10]
In addition, miR-133 overexpression inhibited expression of the target mRNA, whereas t-AUCB reversed the effects. [score:9]
First, the proarrhythmic factor miR-133 is upregulated in response to MI, and the sEHI t-AUCB negatively regulates miR-133 expression. [score:7]
In line with this, up-regulation of miR-133 and down-regulation of KCNQ1 and KCNH2 mRNA/protein were observed in ischemic myocaridum, whereas administration of sEHIs produced an opposite effect. [score:7]
In addition, Chen et al. [20] showed that SRF is a target of miR-133 and that miR-133 overexpression inhibited the SRF 3′ UTR luciferase reporter gene. [score:7]
Here, we demonstrate for the first time that the sEHI t-AUCB dose -dependently suppresses miR-133 upregulation in the ischemic myocardium, which might be responsible for the anti-arrhythmic effect of the sEHI. [score:6]
SRF protein upregulation might be a mechanism by which sEHIs reduce miR-133 expression. [score:6]
Fig. 3t-AUCB prevented upregulation of miR-133 and restored the expression of KCNQ1 and KCNH2 mRNA in ischemic myocardium. [score:6]
A study has revealed that miR-133 upregulation increases action potential duration and thereby prolongs the QT interval by decreasing functional expression of the KCNQ1 (potassium voltage-gated channel subfamily Q member 1)-encoded slow delayed rectifier K [+] current (I [Ks]) channel in human cardiac progenitor cells [16]. [score:6]
In line with this, Angelini et al. [34] reported that miR-133 was downregulated in transgenic mice with cardiac-specific overexpression of SRF. [score:6]
The result further demonstrated that sEHi indirect effected the expression of KCNQ1 and KCNH2 mRNA via suppression miR-133. [score:6]
SRF controls the muscle-specific expression of miR-133; miR-133 represses SRF expression. [score:5]
In agreement with its miR-133–reducing effect, we demonstrate that t-AUCB restored the expression of the miR-133 target genes, i. e., KCNQ1 and KCNH2 mRNA and protein, in the ischemic myocardium. [score:5]
Therefore, we speculated that a sEHI would affect KCNQ1 and KCNH2 mRNA and protein expression, in part by suppressing miR-133. [score:5]
By contrast, it has been proposed that SRF suppresses miR-133 expression [15, 20, 24, 33]. [score:5]
TargetScan indicated that some arrhythmia-related mRNA encoding K channels, such as KCNQ1 and KCNH2, as possible targets of miR-133. [score:5]
To this end, we determined the effects of the sEHI trans-4-[4-(3-adamantan-1-yl-ureido)-cyclohexyloxy]-benzoic acid (t-AUCB) on the expression of miR-133, its target arrhythmia–related genes (KCNQ1 and KCNH2), and serum response factor (SRF), an important transcriptional factor in cardiomyocytes. [score:5]
Furthermore, miR-133 can also inhibit the expression of KCNH2 (potassium voltage-gated channel subfamily H member 2), which encodes the ether-a-go-go related gene (ERG) channel subunit responsible for delayed rectifier K [+] current (I [kr]), resulting in slowed repolarization and prolonged QT interval in the heart [17]. [score:5]
miR-133 knockdown by the antisense molecule AMO-133 prevented QT prolongation and QRS widening by restoring ERG protein expression. [score:4]
Of these, the muscle-specific miR-133 was downregulated in the ischemic myocardium. [score:4]
Moreover, Belevych et al. [25] reported that miR-133 upregulation led to abnormal myocyte Ca [2+] handling and increased propensity for arrhythmogenesis. [score:4]
Many studies have shown that miR-133 upregulation might be a proarrhythmic factor in the heart. [score:4]
However, the mechanism responsible for miR-133 downregulation by t-AUCB remains poorly understood. [score:4]
Finally, the activator SRF might trigger the t-AUCB–induced miR-133 downregulation. [score:4]
Among them, two proarrhythmic miRNAs, i. e., miR-1 and miR-133, were downregulated in the MI mice after t-AUCB treatment (Additional file 1: Figure S2B). [score:4]
Therefore, sEHI downregulation of miR-133 might confer protection against arrhythmia. [score:4]
b The upregulation of miR-133 was exacerbated by agomir in MI hearts, but alleviated by t-AUCB. [score:4]
KCNQ1 and KCNH2 mRNA and protein are directly negatively modulated by miR-133, which can target the 3′ UTR of KCNQ1 and KCNH2 mRNA [14, 28, 29]. [score:4]
The upregulated miR-133 was abrogated in a dose -dependent manner in MI mice treated with t-AUCB (Fig. 3a). [score:4]
We found that the SRF protein downregulation was accompanied by increased miR-133 levels after MI. [score:4]
Here, we observed the upregulation of miR-133 in ischemic myocardium at 24 h post-MI compared with sham group by using miRNA microarray in a mouse mo del of MI. [score:3]
However, t-AUCB showed no effect on the expression of miR-133 in sham-operated mice. [score:3]
We used computational predictions to identify the possible miR-133 targets. [score:3]
As miRNAs can affect the stability of specific target mRNAs through post-transcriptional repression, we investigated the effects of miR-133 on the expression of KCNQ1 and KCNH2 mRNA. [score:3]
This could be explained by the fact that surviving cardiomyocytes can release miR-133a–containing exosomes into the circulating blood after calcium ionophore stimulation, resulting in decreased miR-133 expression in the border zone of the infarcted myocardium and elevated levels of circulating miR-133. [score:3]
Therefore, miR-133 could be a new target for treating ischemic arrhythmias. [score:3]
Abnormal miR-133 expression provokes cardiac arrhythmias by repressing several K [+] channel genes. [score:3]
Shan et al. [17] reported that increased miR-133 expression contributed to arsenic -induced cardiac electrophysiological disorders by repressing ERG protein levels in a guinea pig mo del. [score:3]
More important, we further demonstrated that sEHi t-AUCB could restore the expression of KCNQ1 and KCNH2 mRNA, which were repressed by the agonist miR-133 agomir. [score:3]
The miR-133 activator agomir-133 was transfected into cells to construct the miR-133 overexpression mo del. [score:3]
More strikingly, the aberrant expression of miR-133 has been linked to many cardiac disorders, such as cardiac hypertrophy, heart failure, myocardial infarction and cardiac arrhythmia [15]. [score:3]
In MI mice, sEHI t-AUCB can repress miR-133, consequently stimulating KCNQ1 and KCNH2 mRNA and protein expression, suggesting a possible mechanism for its potential therapeutic application in ischemic arrhythmias. [score:3]
Consistently, the present study demonstrates an inverse relationship between SRF protein and miR-133 expression. [score:3]
To confirm the microarray results, the changes in miR-133 expression were validated using qRT-PCR. [score:3]
It is therefore expected that t-AUCB can restore the impaired SRF protein after ischemia by suppressing miR-133 levels. [score:3]
For example, miR-133 was enriched in muscle tissues and myogenic cells, and it was found to be involved in diverse physiological processes including carcinogenesis, myocyte differentiation, and disease. [score:3]
Effects of different doses of agomir-133 (15, 25, 40 nM) on expression of miR-133 in ischemic myocardium. [score:3]
In contrast, Kuwabara et al. [26] reported that miR-133 expression was decreased in the border zone at 24 h after coronary ligation in a mouse mo del of MI; in situ hybridization determined that the hybridization signal of miR-133 had almost disappeared. [score:3]
Here, we determined the effects of t-AUCB on miR-133 expression in the ischemic myocardium of MI mice. [score:3]
Soluble epoxide hydrolase inhibitors, miR-133 Ischemic arrhythmia Life-threatening ischemic arrhythmias occurring following myocardial infarction (MI) are a common cause of sudden cardiac death. [score:3]
miR-133 overexpression can enhance myoblast proliferation by repressing SRF protein. [score:3]
In conclusion, the sEHI t-AUCB increases KCNQ1 and KCNH2 mRNA and protein by suppressing miR-133 under ischemic arrhythmia conditions. [score:3]
MicroRNA-133 mediates cardiac diseases: mechanisms and clinical implications. [score:2]
As miR-1 and miR-133 have the same proarrhythmic effects in the heart, we assumed that the beneficial effects of sEHIs might also relate to the regulation of miR-133. [score:2]
miR-133 expression was increased by 3.3-fold in the MI group as compared with the sham group (Fig.   3a, P < 0.05). [score:2]
As we have previously demonstrated the role of miR-1 in the ischemic arrhythmia–related gene network [18, 19], we wanted to explore the regulatory function of miR-133 in arrhythmia in the present study. [score:2]
miR-133 expression was increased by 3.1-fold in the MI group as compared with the sham group. [score:2]
Furthermore, SRF might participate in the negative regulation of miR-133 by t-AUCB. [score:2]
Fig. 5SRF signaling pathway participated in regulation of miR-133 by sEHi. [score:2]
Moreover, miR-133 regulates the proteins involved in Ca [2+] handling [37]. [score:2]
Therefore, we hypothesize in the present study that the beneficial effects of sEHIs might also be related to the regulation of miR-133. [score:2]
However, co-application of 0.1 mg/L t-AUCB and miR-133 agomir could rescue this effect. [score:1]
miR-133 level were quantificated by real-time PCR with RNA samples isolated from mice hearts 24 h after MI. [score:1]
As miR-1 and miR-133 are clustered on the same chromosome loci and transcribed together in a tissue-specific manner [20], we speculated that miR-133 might also contribute to the anti-arrhythmic action of sEHIs. [score:1]
The elevated plasma miR-133 was believed to mainly originate from the infarcted myocardium and the border zone. [score:1]
This increased tendency of miR-133 was abolished by pretreatment with t-AUCB. [score:1]
Second, we demonstrate, for the first time, that t-AUCB can abolish the repressing effects of miR-133 on KCNQ1 and KCNH2 mRNA and protein in MI mouse hearts. [score:1]
In contrast, transfection of miR-133 agomir promoted ischemic arrhythmias. [score:1]
The aim of the present study was to complement and extend our earlier studies by investigating whether the beneficial effects of sEHIs are also related to miR-133 expression except miR-1 in a mouse mo del of MI. [score:1]
In fact, there was a negative feedback loop between miR-133 and SRF protein. [score:1]
The mRNA levels of miR-133, its target genes (KCNQ1 [potassium voltage-gated channel subfamily Q member 1] and KCNH2 [potassium voltage-gated channel subfamily H member 2]), and serum response factor (SRF) were measured by real-time PCR; KCNQ1, KCNH2, and SRF protein levels were assessed by western blotting. [score:1]
MI group; & P<0.05 vs agomir-133 + MI group, n = 5 We injection the agonist miR-133 agomir (25 nM) via the tail vein and found that agomir treatment caused a 13.0-d increase in miR-133 level in the MI mice (Fig. 3b, P < 0.05). [score:1]
Similarly, Zile et al. [27] reported that patients with acute MI had significantly increased serum levels of miR-133a and that it could be used as a biomarker of cardiomyocyte death. [score:1]
MI group; & P<0.05 vs agomir-133 + MI group, n = 5We injection the agonist miR-133 agomir (25 nM) via the tail vein and found that agomir treatment caused a 13.0-d increase in miR-133 level in the MI mice (Fig. 3b, P < 0.05). [score:1]
We not examine the relationship between the incidence of ischemic arrhythmia and miR-133 levels in the ischemic myocardium. [score:1]
Agomir of miR-133 (25 nM of ribonucleotide diluted in 0.2 mL saline) were injected via the tail vein after occlusion. [score:1]
In contrast, Niu et al. [35] showed a positive correlation between SRF protein and miR-133. [score:1]
Potential role of SRF in miR-133 reduction by t-AUCB. [score:1]
miR-1 and miR-133 have the same effects on cardiac arrhythmia, as they are both proarrhythmic [17, 25]. [score:1]
Effects of t-AUCB on miR-133, KCNQ1 and KCNH2 mRNA levels in MI mice. [score:1]
MI group [&] P<0.05 vs agomir-133 + MI group, n = 5–10 for each group miR-133 plays an important role in ischemic arrhythmogenesis. [score:1]
[1 to 20 of 81 sentences]
3
[+] score: 218
A comparison of TargetScan targets with this refined list identified 27 miR-133a-3p targets when considering both major isomiRS and 4 miR-133a-5p targets, with no targets in common. [score:11]
When all TargetScan-predicted targets were considered, there was substantial concordance across species with 514 (78%) of human miR-133a-3p targets and 259 (78%) of human miR-133a-5p targets shared by mouse. [score:8]
Only 26 (6%) of the total 402 TGGTCCC human miR-133a-3p isomiR targets overlapped with the predicted targets for the abundant human miR-133a-5p, and similarly, 30 (6%) of the total 502 TTGGTCC isomiR targets overlapped with those predicted for human miR-133-5p. [score:7]
When the TargetScan and RISC-seq data were compared, there were 168 miR-133a-3p targets when considering both major isomiRs, and 75 miR-133a-5p targets, only 6 of which were common. [score:6]
Predicted gene targets of murine miR-133a were matched against mRNAs that in which expression levels were altered by at least 1.5 fold in microarray data from miR-133a knockout mice [21]. [score:6]
We then cross-referenced all the predicted murine targets to a set of mRNAs identified by Liu and colleagues [21] that showed altered expression levels in miR-133a knockout mice. [score:6]
We hypothesized that increases in miR-133a-5p associated with the 79T > C MIR133A2 variant could result in selective down-regulation of a distinctive set of target mRNAs. [score:6]
To assess the potential impact of the 79T > C MIR133A2 variant, we searched for differences in miR-133a-3p and miR-133a-5p predicted mRNA targets using the respective human and murine seed regions and a set of genes known to be differentially regulated in miR-133a knockout mice [21]. [score:5]
Overall, only 44 (7%) of the total 657 human miR-133a-3p predicted targets from both abundant isomiRs overlapped with the targets predicted for miR-133a-5p (Figure 2C). [score:5]
Gene targets for human and murine miR133a were predicted using TargetScan Custom (v5.2) [33] with the “seeds” (nt 2–8) of the most abundant miR-133a-3p and miR-133a-5p isomiRs that were identified via deep sequencing used as inputs. [score:5]
To compare murine miR-133a-3p and miR-133a-5p targets, we used the two predominant 3p and single predominant 5p murine isomiR seed regions to search for predicted mRNA binding sites in TargetScan. [score:5]
In the Ingenuity Knowledge Base, the TargetScan-predicted human miR-133a-3p and 5p target mRNAs are associated with a range of cardiac and extra-cardiac biological functions (Figure 3). [score:5]
Significant associations were found in the Ingenuity Knowledge Base between predicted human target mRNAs of miR-133a-3p and miR-133a-5p and a range of cardiac and extra-cardiac biological functions and/or disease states. [score:5]
This produced a list of 61 predicted targets for miR-133a-3p and 35 predicted targets for miR-133a-5p, only 4 of which were in common (Figure 2D). [score:5]
On Northern blotting the 79T allele showed strong expression of miR-133a-3p with weak expression of miR-133a-5p. [score:5]
Similar to the human data, only a minority of murine miR-133a-3p targets (31 [5%]) overlapped with 5p targets (Figure 2D). [score:5]
Matkovich and colleagues reduced their list of 1640 targets to 209 by analyzing transgenic mice that overexpress miR-133a [16]. [score:5]
With the 79T > C MIR133A2 variant, no changes in miR-133a-3p target gene expression would be expected. [score:5]
It is notable that at least 25% of the lowest-abundance miR-133a-5p targets include mRNAs involved in regulation of transcription, signaling and membrane transport. [score:4]
Verified mRNA targets of miR-1 and miR-133 include those encoding proteins that are involved in cardiac development, ion channel function, hypertrophy, and fibrosis [11- 16]. [score:4]
We also compared our TargetScan outputs to a list of 1640 miR-133a targets identified by Matkovich and colleagues in mouse heart using RISC-seq [16]. [score:4]
To explore what these cardiac genes might be, we used the seed sequences of the two most abundant human miR-133a-3p isomiRs and the single abundant miR-133a-5p isomiR identified by deep sequencing to look for predicted human mRNA binding sites in TargetScan. [score:3]
Bioinformatics analyses indicate that the major miR-133a-3p and 5p isomiRs have numerous predicted target mRNAs, only a few of which are in common. [score:3]
To test these predictions, we prepared two constructs that replicated the 79T and 79C genotypes of mature miR-133a, transfected these into the HeLa cell line that does not detectably express endogenous miR-133a and performed Northern blotting. [score:3]
In contrast, the relative increase in miR-133a-5p could have a relatively greater impact and give rise to selective repression of the 5p suite of targets. [score:3]
In human and murine atrial tissues, miR-133 was the most highly expressed miRNA, comprising approximately 20% of all miRNA sequences. [score:3]
Click here for file TargetScan outputs for human miR-133a-3p and miR-133a-5p (from Figure 2C) that were used as inputs for Ingenuity Pathway Analysis. [score:3]
org, MirTarget2, PicTar, PITA, RNA22, RNAhybrid) were unable to be utilized because human and/or murine miR-133a-5p sequences were unable to be inputted and/or analyzed. [score:3]
The TargetScan outputs for human miR-133a-3p and miR-133a-5p were imported into Ingenuity Pathway Analysis software (Ingenuity® Systems, http://www. [score:3]
Figure 3 Functional analysis of human miR-133a-3p and miR-133a-5p targets. [score:3]
These results showed that only a minority of predicted miR-133a targets were shared, and that most were unique to either 3p or 5p forms. [score:3]
These findings collectively suggest that miR-133a isomiRs have distinctive target spectra. [score:3]
Multiple miR-133a isomiRs with potential different mRNA target profiles are present in the atrium in humans and mice. [score:3]
The 79T allele had strong expression of miR-133a-3p with low amounts of miR-133a-5p. [score:3]
Altered expression of miR-133 itself has been observed in cardiac tissues from patients with AF [18, 19], and conditions that predispose to AF, such as atrial dilation, ventricular hypertrophy, and myocardial ischemia [12, 31]. [score:3]
For example, our group has recently demonstrated that the two most abundant miR-133a isomiRs in murine atrial HL-1 cells have different targeting properties [8]. [score:3]
For the two abundant human miR-133a-3p isomiRs, the seed sequences TGGTCCC and TTGGTCC had 402 and 502 predicted targets, respectively, of which 247 were in common. [score:3]
The 79T > C MIR133A2 variant is positioned directly adjacent to the Drosha cleavage site in the stem-loop structure at the 3 [′] end of miR-133a-3p (Figure 1C). [score:2]
Further studies are required to determine whether changes in miR-133a-5p directly alter levels of these critical molecules and have biologically-significant functional effects. [score:2]
Consequently, the 79T > C variant lies within the duplex and would directly prevent base-pairing and weaken thermostability at this site, favoring incorporation of miR-133a-5p into RISC. [score:2]
MiR-133a mRNA target profiles. [score:2]
The 79T > C variant (red) is located at the 3′end of miR-133a-3p directly adjacent to the Drosha cleavage site. [score:2]
Our data suggest that the MIR133A2 variant increases the relative abundance of miR-133a-5p. [score:1]
A number of isomiRs with variations at 5 [′] and 3 [′] ends were identified for both miR-133a-3p and miR-133a-5p, with 2 predominant miR-133a-3p isomiRs and one predominant miR-133a-5p isomiR. [score:1]
There were two predominant isomiRs processed from the miR-133a 3p arm in both the human and murine atria (Figures 2A and 2B). [score:1]
Second, we report a novel MIR133A2 variant that alters strand abundance during miRNA processing and results in accumulation of miR-133a-5p. [score:1]
Altered levels of miR-1 and miR-133 have been observed in atrial tissue samples from patients with AF in several studies [17- 19]. [score:1]
In the normal human atrium, almost all the miR-133a is comprised of miR-133a-3p with negligible amounts of miR-133a-5p. [score:1]
To determine the diversity and abundance of miR-133a-3p and 5p processed species that are normally present in the atrium, small RNA libraries were prepared from human and murine heart tissue samples and were subjected to deep sequencing. [score:1]
Together, the abundance of these tags represented >99% of all tags derived from the miR-133a hairpin. [score:1]
This variant lies within the duplex at the 3 [′] end of the mature strand, miR-133a-3p, and is predicted to prevent base-pairing and weaken thermostability at this site, favoring incorporation of the passenger strand, miR-133a-5p, into RISC. [score:1]
of small RNA libraries prepared from normal human and murine atria confirmed that nearly all the mature miR-133a was comprised of miR-133a-3p and that levels of miR-133a-5p were very low. [score:1]
DNA oligonucleotide probes (5 [′]- tacagctggttgaaggggaccaaa -3 [′], 5 [′]- gatttggttccattttaccagct -3 [′], 5 [′]- tgtgctgccgaagcaagcac -3 [′]) complementary to mature miR-133a (miR-133a-3p), passenger miR-133a (miR-133a-5p) and U6 sequences, respectively, were end-labeled with [32]P using T4 Polynucleotide Kinase (New England Biolabs, Ipswich, MA, USA) and purified by Microspin G-25 columns (GE Healthcare) according to manufacturer’s instructions. [score:1]
We identified a human 79T > C MIR133A2 variant that alters miRNA processing and results in accumulation of the miR-133a-5p strand that is usually degraded. [score:1]
In contrast, the 79C allele had no effect on miR-133a-3p but there was a significant increase (mean 3.6-fold) in miR-133a-5p levels. [score:1]
In the absence of sequence data for human miR-133a-5p in miRBase, this location was initially deduced from 3p dominant processed sequence listed for mouse. [score:1]
MirBase-annotated miR-133a-3p and 5p sequences are shown in black with ‘seed’ regions (nt 2–8) underlined. [score:1]
Here we find that both (mature) miR-133a-3p and (passenger) miR-133a-5p are present in the atrium in humans and mice, with miR-133a-5p normally representing <1% of all miR-133a species. [score:1]
If the conventional murine miR-133a-5p sequence as annotated by miRBase (v18) represented the predominant isomiR in the normal human heart, then the nt corresponding to position 79 would lie just outside the base-paired region of the processed miRNA duplex. [score:1]
Less than 1% of all sequences that mapped to the miR-133a hairpin aligned to the 5p arm. [score:1]
of human and murine atrial tissue was performed and revealed an unexpected diversity of miR-133a isomiRs, with nearly all the miR-133a tags comprised of the 2 major miR-133a-3p isomiRs and <1% comprised of miR-133a-5p species. [score:1]
To assess the potential effects of this variant, we first needed to catalogue the abundance and diversity of miR-133a isomiRs in the normal heart. [score:1]
The sequences for the miR-133a high-abundance isomiRs were identical in the two species. [score:1]
We re-sequenced the MIR1-1, MIR1-2, MIR133A1, MIR133A2, and MIR133B genes, that encode the cardiac-enriched miRNAs, miR-1 and miR-133, in 120 individuals with familial atrial fibrillation and identified 10 variants, including a novel 79T > C MIR133A2 substitution. [score:1]
MiR-1 and miR-133 sequence variants. [score:1]
The main effect of the 79T > C MIR133A2 variant is to alter the relative ratio of miR-133a-3p and 5p strands. [score:1]
The muscle-enriched miRNAs, miR-1 and miR-133, are amongst the most abundant of the miRNAs present in the normal heart [9, 10]. [score:1]
Analysis of sequencing tags that map to a miR-133a locus showed an extensive range of 5 [′] and 3 [′] isomiRs for miR-133a-3p and miR-133a-5p in both human and mouse (Additional file 3: Table S3 and Additional file 4: Table S4). [score:1]
Although multiple 5 [′] and 3 [′] isomiRs are present, there are only 2 major miR-133a-3p isomiRs and one major miR-133a-5p isomiR. [score:1]
Two genes, MIR1-1 and MIR1-2, encode miR-1-1 and miR-1-2, while three genes, MIR133A1, MIR133A2, and MIR133B, encode miR-133a-1, miR-133a-2, and miR-133b, respectively. [score:1]
Click here for file Sequences and abundance of different 5 [′] and 3 [′] murine miR-133a isomiRs identified by sequencing of murine atria. [score:1]
Click here for file Sequences and abundance of different 5 [′] and 3 [′] human miR-133a isomiRs identified by sequencing of human atria. [score:1]
There was a single predominant miR-133a-5p isomiR in human atrium, which started one nt upstream from the murine miRBase entry. [score:1]
In this study, we hypothesized that genetic variation could alter the functional effects of miR-1 and miR-133 and contribute to AF pathogenesis. [score:1]
We have identified a missense MIR133A2 variant that alters miR-133a duplex processing and strand abundance with accumulation of miR-133a-5p in HeLa cells. [score:1]
There was also only one major murine miR-133a-5p isomiR that had an identical 5 [′] sequence to the major human miR-133a-5p isomiR. [score:1]
79T > C MIR133A2 variant increases levels of miR-133a-5p. [score:1]
MiR-133a-1 and miR-133a-2 have identical mature sequences, with miR-133b differing only by a single nt at the 3 [′] end. [score:1]
The 5 loci encoding miR-1 and miR-133 precursor transcripts were re-sequenced in 120 probands with a family history of AF. [score:1]
However, our deep sequencing data clearly show that the −1 isomiR is the most abundant miR-133a-5p species in the human atrium. [score:1]
Figure 2 Abundance of miR-133a 5 [′ ] isomiRs in atrial tissue. [score:1]
Note that there is no miRBase annotation for human miR-133a-5p. [score:1]
Despite the importance of miR-133a in atrial biology, miR-133a genetic variants are not a common cause of familial AF. [score:1]
Parameters that achieved statistical significance (P < 0.05) are shown for miR-133a-3p (left) and miR-133a-5p (right), with the relative proportions determined on the basis of the negative logarithm of the P values. [score:1]
The scaled miR-133a values were then normalized to the scaled U6 values to adjust for any loading bias. [score:1]
[1 to 20 of 85 sentences]
4
[+] score: 202
We also revealed a novel molecular mechanism for H [2]S -mediated inhibition of CSE in cardiomyocytes, where H [2]S directly inhibits SP1, an inducer for CSE, to suppress CSE and indirectly upregulates miR-133a that targets CSE. [score:14]
Altogether, we show a novel mechanism for H [2]S -mediated regulation of CSE in cardiomyocytes, where it can directly inhibit CSE by suppressing SP1 and indirectly reduce CSE levels by upregulating miR-133a that targets CSE. [score:13]
On contrary, H [2]S suppresses CSE directly by inhibiting SP1 and indirectly by inducing miR-133a that targets CSE, which results in CBS upregulation. [score:12]
Since miR-133a is anti-hypertrophic to the cardiomyocytes/heart 19, 37, 38, we proposed that H [2]S upregulates miR-133a, whereas Hcy downregulates miR-133a, and differentially regulate cardiomyocytes hypertrophy (Fig.   8G). [score:8]
Therefore, H [2]S indirectly downregulates SP1 by upregulating miR-133a. [score:8]
These results further support that Na [2]S have an indirect role, via upregulation of miR-133a, to suppress CSE in cardiomyocytes. [score:7]
Notably, H [2]S may indirectly reduce CSE by upregulating miR-133a (Fig.   4A). [score:5]
The present results support the fact that H [2]S -mediated upregulation of miR-133a reduces cardiomyocyte hypertrophy (Figs  5A– 7F). [score:4]
The effect of H [2]S on upregulation of miR-133a is not novel and is previously reported by our group [17] and others [39]. [score:4]
Moreover, our group has shed light on the underlying molecular mechanism by which H [2]S mitigates Hcy -mediated downregulation of miR-133a in cardiomyocytes [17]. [score:4]
We have reported that Na [2]S upregulates miR-133a in HHcy cardiomyocytes [17]. [score:4]
The upregulation of miR-133a by H [2]S also mitigates Hcy -mediated hypertrophy of cardiomyocytes. [score:4]
Although H [2]S upregulates miR-133a in cardiomyocytes [17], the dose -dependent effect of Hcy or H [2]S on miR-133a is unclear. [score:4]
To determine whether miR-133a targets CSE, we performed luciferase reporter assay using normal 3′ untranslated region (WT CSE UTR) and mutant 3′UTR (Mut CSE UTR) of CSE. [score:4]
Hcy has an opposite effect on miR-133a levels and increasing doses of Hcy downregulates miR-133a (Fig.   4B). [score:4]
MiR-133a is a cardioprotective miRNA, which is downregulated in the failing heart of humans and mice 18, 19. [score:4]
It is documented that even 30 minutes of H [2]S donor pre-treatment is able to mitigate phenylepinephrine -mediated hypertrophy in cardiomyocytes by upregulating anti-hypertrophic miR-133a [39]. [score:4]
Hcy downregulates CBS and miR-133a. [score:4]
We found that Na [2]S mitigates Hcy -mediated cardiomyocyte hypertrophy by upregulating anti-hypertrophic miR-133a [17]. [score:4]
HHcy also downregulates anti-hypertrophic miR-133a causing cardiomyocyte hypertrophy. [score:4]
It is unclear that how much Hcy or H [2]S enters into the cardiomyocytes after treatment with Hcy or Na [2]S. Examining the levels of intracellular Hcy or H [2]S and correlating that with the expression of CSE, CBS, and miR-133a will provide more clarity to the cross-talk among these molecules. [score:3]
To corroborate the specificity of miR-133a binding to CSE UTR, we also used 2 μM and 4 μM Mut CSE UTR, which had 7 mismatches with the target site of miR-133a. [score:3]
N = 5. In silico analyses showed that CSE is a potential target for miR-133a (Fig.   3A). [score:3]
Altogether, our results showed that miR-133a targets CSE. [score:3]
These findings are consistent with previous report demonstrating that increased level of Hcy causes cardiomyocyte hypertrophy 17, 29, H [2]S blunts Hcy -mediated cardiomyocyte hypertrophy [17], and cardiac hypertrophy is suppressed by miR-133a 18, 31. [score:3]
Even though we have elucidated the underlying mechanism for H [2]S-, and Hcy -mediated regulation of CBS, CSE, and miR-133a, further molecular studies are required to uncover the regulatory signaling mechanisms. [score:3]
Moreover, there was no change in luciferase activity after miR-133a mimic treatment to Mut CSE UTR (Fig.   3B) supporting that miR-133a targets CSE 3′UTR. [score:3]
In the present study, we reveal that miR-133a targets CSE (Fig.   3A–D). [score:3]
For this reason even the short-term presence of H [2]S may be adequate to induce miR-133a transcription in Hcy -treated cardiomyocytes, and high levels of miR-133a is able to inhibit cardiomyocyte hypertrophy even in the absence of H [2]S. Overall, we demonstrate a novel yin-yang effect of H [2]S versus Hcy on CBS and CSE in the heart using in vitro and in vivo approaches. [score:3]
Hcy is involved in pathological cardiac remo deling 32– 35, and miR-133a prevents pathological remo deling by suppressing cardiac hypertrophy 18, 31 and fibrosis 16, 36. [score:3]
We found that miR-133a decreased relative luciferase activity in WT CSE UTR with respect to scm, suggesting that miR-133a targets WT CSE UTR. [score:3]
H [2]S inhibits hypertrophy by inducing miR-133a. [score:3]
MiR-133a mitigates cardiac hypertrophy by targeting RhoA, a cardiac hypertrophy regulating protein, and cdc42, a kinase involved in hypertrophy [18]. [score:3]
To confirm that miR-133a target CSE, we performed RNA-EMSA (miRNA-mRNA interaction analysis by EMSA) using WT CSE UTR and Mut CSE UTR, a 22-mer RNA sequence for the 3′UTR corresponding to CSE, and miR-133a and anti-miR-133a probes. [score:3]
Although Na [2]S -mediated reduction of hypertrophy in HHcy cardiomyocytes indicates that reduced H [2]S production in HHcy cardiomyocytes may be a major cause for hypertrophy [17], it is unclear whether Hcy or H [2]S regulates miR-133a levels in a dose -dependent manner. [score:2]
MiR-133a targets CSE. [score:2]
MiR-133a also targets SP1, an inducer of CSE. [score:2]
Similarly, 1 μM WT CSE UTR RNA displays single band (Fig.   3C, lane 5), however, incubation of different doses (2 μM and 4 μM) of WT CSE UTR RNA with miR-133a reduces electrophoretic mobility and form a second band of miR-133a-WT CSE UTR complex (Fig.   3C, lanes 6 and 7). [score:1]
Reduced levels of miR-133a induces cardiac hypertrophy, which is reflected by increased levels of atrial natriuretic peptide (ANP) and beta-myosin heavy chain (β-MHC), the molecular markers for cardiac hypertrophy. [score:1]
Dose -dependent effects of H [2]S and Hcy on miR-133a levels in cardiomyocytesTo determine the dose -dependent effects of Na [2]S on miR-133a levels, we treated HL1 cardiomyocytes with the same doses of Na [2]S that was used for determining the CSE levels (Fig.   1D). [score:1]
In the present study, we demonstrate that above 5 µM of Hcy, the increasing doses of Hcy is associated with decreasing levels of miR-133a in cardiomyocytes (Fig.   4B). [score:1]
We have reported that Hcy-treatment reduces the levels of miR-133a in cardiomyocytes and induces c-fos, an early marker for hypertrophy, in HL1 cardiomyocytes [17]. [score:1]
We observed no gel-shift in Mut CSE UTR suggesting an absence of miR-133a- Mut CSE UTR complex formation. [score:1]
To determine the dose -dependent effects of Na [2]S on miR-133a levels, we treated HL1 cardiomyocytes with the same doses of Na [2]S that was used for determining the CSE levels (Fig.   1D). [score:1]
These cells were transfected with either GFP-tagged miR-133a (cat # MmiR3445-MR03) or GFP-tagged scrambled miRNA (cat# CmiR0001-MR03), which were purchased from GeneCopoeia, Rockville, MD, USA. [score:1]
Lack of CBS induces cardiac hypertrophy (Fig.   8E,F); plausibly via HHcy, that reduces anti-hypertrophic miR-133a (Fig.   4B). [score:1]
We found no significant change in the levels of miR-133a when the cardiomyocytes were treated with the below 25 µM dose of Na [2]S. However, miR-133a level was markedly increased when treated with above 50 µM dose of Na [2]S (Fig.   4A). [score:1]
In RNA-EMSA, miR-133a displays one band (Fig.   3C, lane 3). [score:1]
Further, there was no second band for the two doses (2 μM and 4 μM) of Mut CSE UTR (Fig.   3C, lanes 8 and 9), demonstrating the specificity of miR-133a binding to CSE 3′UTR. [score:1]
The sequences used were LNA mmu-miR-133a* 5′GCTGGTAAAATGGAACCAAAT3′, mmu-CSE WT UTR; 5′rGrArArArArArUrUrArUrArUrArArUrUrArCrCrArUrA3′, and mmu-CSE mutant UTR 5′rGrArArArArArArArArUrUrCrArArUrArUrCrUrArUrA3′. [score:1]
N = 5. Since miR-133a is an anti-hypertrophic miRNA [18], we sought to determine whether Na [2]S can attenuate Hcy -mediated hypertrophy in cardiomyocytes. [score:1]
This second band corresponds to the specific binding of the miR-133a with WT CSE UTR RNA (Fig.   3C, lane 6). [score:1]
Overall, our results suggest that Hcy and H [2]S have an opposite effect on miR-133a levels in cardiomyocytes. [score:1]
The upper bands in lanes 6 and 7 represents the specific binding between miR-133a and WT CSE UTR RNA. [score:1]
The incubation of miR-133a with an equimolar concentration of anti-miR-133a reduces the mobility of miR-133a band due to formation of miR-133a- anti-miR complex (Fig.   3C, lane 4). [score:1]
However, effect of miR-133a, the most abundant miRNA in the heart [50], on CSE was unknown. [score:1]
Based on these findings, we infer that elevated levels of Hcy attenuates miR-133a in cardiomyocytes in a dose -dependent manner. [score:1]
Dose -dependent effects of H [2]S and Hcy on miR-133a levels in cardiomyocytes. [score:1]
N = 5. H [2]S mitigates homocysteine -mediated hypertrophy in cardiomyocytesSince miR-133a is an anti-hypertrophic miRNA [18], we sought to determine whether Na [2]S can attenuate Hcy -mediated hypertrophy in cardiomyocytes. [score:1]
On contrary, above 50 µM of Na [2]S, increasing doses of Na [2]S is associated with increasing levels of miR-133a in cardiomyocytes (Fig.   4A). [score:1]
In Mut CSE UTR, the miR-133a binding sequence on 3′UTR of CSE was deleted. [score:1]
These results elicit the dose -dependent effect of Hcy or H [2]S on miR-133a levels in cardiomyocytes, which may be important for future studies on Hcy or H [2]S -mediated cardiac remo deling. [score:1]
We have demonstrated that elevated levels of H [2]S increases miR-133a (Fig.   4A), whereas HHcy reduces miR-133a (Fig.   4B). [score:1]
H [2]S also mitigates Hcy -mediated hypertrophy of cardiomyocytes by increasing the levels of miR-133a (Fig.   8G). [score:1]
Since Na [2]S increased miR-133a in a dose -dependent manner (Fig.   4A), we determined whether Hcy has a dose -dependent effect on miR-133a levels in cardiomyocytes. [score:1]
It was interesting to note that dose -dependent effect of Hcy and H [2]S are unique for CBS, CSE, and miR-133a, and the dose effect of H [2]S in normal cardiomyocytes and Hcy -treated cardiomyocytes are different. [score:1]
Figure 4Dose -dependent effect of Na [2]S or Hcy on miR-133a levels in HL1 cardiomyocytes. [score:1]
Our results demonstrated that above 25 µM dose of Hcy, the levels of miR-133a was significantly decreased (Fig.   4B). [score:1]
MiR-133a transcription is regulated by myocyte enhancer factor-2C (Mef2c) [52]. [score:1]
Since the effect of H [2]S concentration on cellular activity is poorly understood [24] and a high dose of H [2]S could be toxic to the cell, treatment with a slow H [2]S-releasing donor such as SG1002 can be a better approach for in vivo experiments to assess the effect of H [2]S on CBS, CSE, miR-133a, and cardiac remo deling in the pathological hearts. [score:1]
Kesherwani V Nandi SS Sharawat SK Shahshahan HR Mishra PK Hydrogen sulfide mitigates homocysteine -mediated pathological remo deling by inducing miR-133a in cardiomyocytesMol. [score:1]
LNA-mmu-miR-133a* were incubated in EMSA binding buffer (10 mM MgCl2, 100 mM NaCl, 50 mM HEPES pH 7.2 and 5% glycerol) for 30 min at 37 °C with corresponding WT or mutant CSE RNA oligonucleotides. [score:1]
[1 to 20 of 72 sentences]
5
[+] score: 190
Unbiased transcriptional profiling and molecular analysis of putative miR-1/133a target molecules up-regulated in miR-1/133a d KO mutants uncovered several direct targets of miR-1 and miR-133a including myocardin, Kcnmb1 and BMP-10. [score:9]
We also detected a conserved miR-133a target site in the 3′-UTR of Kcnmb1 [23] (Fig. 5D), which is normally specifically expressed in smooth muscle cells but up-regulated in miR-1/133a d KO mutant hearts. [score:8]
miR-133a -mediated inhibition of Kcnmb1 and miR-1 -mediated suppression of myocardin render Kcnmb1 expression dependent on the balance of miR-1/133a and myocardin concentrations in the cell, which might be important for the regulation of pathophysiologic conditions. [score:8]
Hence, we screened for predicted target sites of miR-1 and miR-133a in transcripts that were up-regulated in miR-1/133a d KO mutant hearts using Targetscan (v6) and miRanda (microrna. [score:8]
27 out of 382 genes, which were up-regulated at least 1.5-fold, contained conserved target sites for miR-1 or miR-133a. [score:6]
Note that the miR-133a and miR-1 target genes Kcnmb1 and BMP-10 are not significantly up-regulated in myocardin transgenic embryonic hearts. [score:6]
In contrast, we did not observe transcriptional up-regulation of a number of previously described miR-1 or miR-133a target molecules like SRF, IRQ5, Hand2 or HDAC4 in d KO hearts (Fig. 4). [score:6]
50% reduced expression of miR-1 and miR-133a expression in single cluster knock-out embryonic hearts and complete loss in miR-1/133 d KO embryonic hearts at E10.5 using Taqman probes. [score:6]
Overexpression of myocardin leads to up-regulation of miR-1 and miR-133a. [score:6]
Expression analysis at E10.5 confirmed a complete loss of miR-1 and miR-133a expression in d KO embryos (Fig. 2A,H, I). [score:5]
Co-transfection of either miR-1 or miR-133a together with corresponding reporter plasmids efficiently suppressed luciferase activity whereas reporter plasmids carrying mutated miRNA binding sites were not affected (Fig. 5E, F) confirming our assumption that myocardin and Kcnmb1 are primary targets of miR-1 and miR-133a, respectively. [score:5]
Expression levels of miR-133a dropped slightly after TAC in both single cluster mutants suggesting that the respective remaining miR-1/133a gene cluster possesses only a limited ability to react to the loss of individual alleles by increased expression both under baseline and pathological conditions (Fig. 1I). [score:5]
1003793.g008 Figure 8 (A) qRT-PCR expression analysis of pri-miR1-1, pri-miR1-2, pri-miR133-a1 and pri-miR133a-2 in Myocardin overexpressing embryonic hearts. [score:5]
We concluded that miR-1 and miR-133a control the faithful expression of genes in a functionally redundant manner by adjustment of myocardin levels to allow specification of early cardiomyocytes with hybrid expression of cardiomyocyte and smooth muscle specific markers to more differentiated fetal cardiomyocytes. [score:5]
Knock out, transgenic mice and cell cultureThe miR-1-1/133a-2 genomic region was deleted by homologous recombination with a targeting vector inserting an IRES-lacZ-neomycin resistance cassette into the NdeI site of pre-miR-1-1 deleting the miR-1-1 and miR-133a-2 coding regions down to the BamHI site located 140 bp 3′ of miR-133a. [score:4]
No significant increase of miR-1 expression in miR-1-1/133a-2 and miR-1-2/133a-1 mutants after TAC compared to sham-operated mice while expression levels of miR-133a dropped slightly after TAC in both single cluster mutants. [score:4]
The miR-133a target Kcnmb1 that is controlled at the transcriptional level by myocardin is another component of this regulatory network. [score:4]
In contrast to the miR-1/miR133a cluster, miR-206 and miR-133b are expressed mainly in somites during skeletal muscle development [11] and later become confined to slow skeletal muscle fibers. [score:4]
As expected, miR-1 overexpression resulted in a significant reduction of myocardin mRNA (Fig. 5G) and protein (Fig. 5H) while miR-133a overexpression caused a significant decline of Kcnmb1 mRNA (Fig. 5I) and protein (Fig. 5J) concentrations compared to miRNA controls (Fig. 5H′, J′). [score:4]
To validate the regulatory interactions between miR-1 and myocardin or miR-133a and Kcnmb1 we inserted the respective miRNA binding sites as well as mutant target sites into the 3′-UTR of a luciferase reporter (Fig. 5C, D). [score:4]
It is tempting to speculate that the joint regulation of two different miRNA genes targeting different genes by myocardin is a reason for the evolutionary conservation of miR-1 and miR-133a linkage. [score:4]
Similarly, we did not detect a compensatory increase of miR-1 and miR-133a expression in embryonic hearts of single miRNA cluster knock-out mice at E10.5 (Fig. 2A). [score:4]
Next, we generated mice that lack both clusters and hence completely fail to express miR-1 and miR-133a. [score:3]
Taken together our results suggested that myocardin represents a primary target for miR-1 and Kcnmb1 for miR-133a miRNAs in vivo at E10.5. [score:3]
Primary sequences of mature miR-1 or miR-133a are identical and both gene clusters show similar expression in the heart and skeletal muscle. [score:3]
The putative miR-133a targets SRF (Fig. 5B, B′) and Hand2 (Suppl. [score:3]
The pattern of miR-1 expression was not altered in single cluster mutants as visualized by whole mount in situ hybridization using LNA-probes (Fig. 2B–G) again indicating that miR-1-1 and miR-1-2, respectively miR-133a-1 and miR-133a-2 might substitute for each other. [score:3]
The miR-1-1/133a-2 genomic region was deleted by homologous recombination with a targeting vector inserting an IRES-lacZ-neomycin resistance cassette into the NdeI site of pre-miR-1-1 deleting the miR-1-1 and miR-133a-2 coding regions down to the BamHI site located 140 bp 3′ of miR-133a. [score:3]
Myocardin and Kcnmb1 are primary targets of miR-1 and miR-133a. [score:3]
Taken together, our results suggest that miR-1 mediated repression of myocardin limits transcriptional activation of both miR-1 and miR-133a clusters thereby adjusting its expression (and of miR-133a) in a negative feedback loop (Fig. 7P). [score:3]
The function of intronic myomiRs has been addressed in a number of elegant papers suggesting functions mainly under cardiac stress and in disease conditions [8], [9] while the exact role of miRNAs miR-1 and miR-133a is less clear, in part due to putative compensatory actions of these highly similar miRNAs. [score:3]
miR-1 and miR-133a represent a particularly intriguing example since the two gene clusters, which encode mir-1-1/133a-2 and miR-1-2/133a-1, are completely identical and apparently expressed in the same tissue: heart and skeletal muscle [6], [7]. [score:3]
Surviving miR-133a mutants showed dilated cardiomyopathy with increased proliferation of cardiomyocytes and increased smooth muscle cell gene expression. [score:3]
Mature miR-1-1/miR-1-2 and miR-133a-2/miR-133a-1 differ from each other indicating different target genes. [score:3]
The miR-1-2/133a-1 genomic region was deleted by homologous recombination with a targeting vector that replaced the genomic region coding for pre-miR-133a to pre-mir-1-2 with the IRES-LacZ-neomycin cassette. [score:3]
Primary sequences of mature miR-1 or miR-133a are identical and both gene clusters show similar expression patterns suggesting that these miRNAs serve at least partially overlapping functions. [score:3]
Analysis of miR-1 and miR-133a concentrations in individual cluster mutants revealed no significant change of miR-1 expression after TAC compared to sham-operated mice (Fig. 1H). [score:2]
Expression of miRNAs was quantified using FAM labeled TaqMan microRNA Assays (miR-1: #002222, miR-133a: #002246). [score:2]
Additional RT-PCR based Taqman assays designed to detect pri-miR-1-1, pri-miR-1-2, pri-miR-133a-2, and pri-miR-133a-1 unveiled increased expression of all pri-miRNAs (Fig. 8A) indicating that both miR-1/133a clusters are activated by myocardin. [score:2]
Intriguingly, the genetic linkage of miR-1 and miR-133a allows concomitant regulation of both genes by myocardin thereby including miR-133a into the negative feedback loop constituted by miR-1 and myocardin. [score:2]
In principle, it is possible that the concomitant deletion of both miR-1-2 and miR-133a-1 rescues a potential phenotype caused by the inactivation of miR-1-2 alone but it seems more likely that deletion of miR-1-2, which is located in an intron of the mib1 gene and close to the transcriptional start-site of RP24-66N1, a non-coding antisense transcript, has affected regulation of neighboring genes [32], [33]. [score:2]
The lack of developmental abnormalities in single miR-1/133a gene cluster mutants corroborates previous findings on miR-133a-1 and miR-133a-1 KO animals [15]. [score:2]
Interestingly, concomitant deletion of both miR-133a genes causes a fetal heart phenotype of variable penetrance with ventricular septum defects (VSD) suggesting that miR-133a does not play a major role in early embryonic development. [score:2]
All three loci produce bicistronic transcripts containing one miRNA from the miR-1/206 family and one from the miR-133 family essentially forming functional units [12] that are under the transcriptional control of heart and muscle specific regulatory programs [13], [14]. [score:2]
In contrast to the analysis of miR-133a-1 and miR-133a-2 double mutants, only single miR-1-2 mutants have been analyzed. [score:1]
70%-confluent HEK293 cells were transfected with 50 ng of the respective plasmid/24-well with or without 50 pmol of miRIDIAN microRNA mimic miR-1 or miR-133a (Thermo) using Lipofectamine 2000 (Invitrogen). [score:1]
In the mammalian genome two distinct gene clusters located on two different chromosomes encode miR-1 and miR-133a: the miR-1-1/133a-2 and the miR-1-2/133a-1 cluster. [score:1]
The miR-1/133a d KO phenotype differs significantly from the previously described defect of miR-133a d KO mice, which becomes apparent only at later stages [15] suggesting fundamentally different mechanisms. [score:1]
The lack of gross morphological abnormalities after genetic inactivation of single miR1-1/miR-133a gene cluster mutants seems to indicate redundant functions but does not rule out a differential requirement of individual miR-1/133a gene clusters under specific conditions. [score:1]
Potential overlapping functions of miR-133a-1 and miR-133a-2 have been investigated by deletion of miR-133a coding regions without impairing miR-1 expression. [score:1]
To further validate these findings, we transfected miR-1, miR-133 or control miRNA into isolated embryonic cardiomyocytes. [score:1]
The phenotype of miR-133a double mutants has been primarily ascribed to the loss of miR-133a -mediated repression of cyclinD2 and SRF [15]. [score:1]
The vector contained 3 kb genomic region flanking pre-mir-1-2 at the 5′ and 3.5 kb genomic sequence flanking pre-miR-133a at the 3′. [score:1]
In contrast, mature miR-1-1 is identical to miR-1-2 and miR-133a-2 is identical to miR-133a-1, suggesting potentially overlapping functions. [score:1]
In the mammalian genome, two distinct gene clusters code for miR-1 and miR-133a. [score:1]
A third miRNA cluster on mouse chromosome 1, related to miR-1/miR133a, encodes for miR-206 and miR-133b. [score:1]
[1 to 20 of 56 sentences]
6
[+] score: 175
Other miRNAs from this paper: mmu-mir-25, mmu-mir-133a-2, mmu-mir-133b, mmu-mir-133c
These results provide evidence that in gastric smooth muscle RhoA expression is negatively regulated by miR-133a and a decrease in miR-133a expression in diabetes causes an increase in RhoA expression. [score:8]
In conclusion, the present studies demonstrate that the expression of RhoA is negatively regulated by miR-133a and a decrease in its expression in diabetes leads to an increase in RhoA expression, agonist -induced Rho kinase activity, and muscle contraction. [score:8]
These results indicate that the expression of RhoA in smooth muscle is negatively regulated by miR-133a and that decrease in miR-133a expression in both ob/ob mice and in hyperglycemia in vitro lead to an increase in RhoA expression and ACh -induced Rho kinase pathway. [score:8]
Similarly, expression of miR-133a was inhibited in smooth muscle of WT mice treated with HG and the inhibition was reversed by co-treatment of cells 1 mM NAC (Fig 6E). [score:7]
In the present study, we tested the hypothesis that down-regulation of miRNA-133a due to oxidative stress mediates up-regulation of RhoA/Rho kinase pathway leading to hypercontractility and delayed gastric emptying in diabetes. [score:7]
Expression of miR-133a was inhibited in smooth muscle of ob/ob mice and the inhibition was reversed by treatment with NAC (300 mg/kg) for 24 h (Fig 6A). [score:7]
Upregulation of RhoA expression by miR-133a in diabetes. [score:6]
Our studies provided a link between oxidative stress, miR-133a, and RhoA in diabetes -induced hypercontraction and demonstrated that oxidative stress in response to hyperglycemia causes a decrease in miR-133a expression leading to upregulation of RhoA/Rho kinase pathway. [score:6]
We tested the hypothesis that the upregulation of RhoA/Rho kinase pathway in diabetes is due to decrease in miR-133a expression. [score:6]
The aging -induced increase in miR-133a expression was associated with a decrease in RhoA expression and IAS tone [54]. [score:5]
In addition to the regulation of RhoA by miR-133a, studies in human bronchial smooth muscle have identified a transcriptional regulation of RhoA expression [44, 45]. [score:5]
The decrease in miR-133a expression in response to oxidative stress leads to an increase in RhoA expression, Rho kinase activity, MYPT1 phosphorylation and muscle contraction. [score:5]
IP injection of pre-miR-133a caused a decrease in RhoA expression in smooth muscle of WT mice and blocked the increase in RhoA expression in smooth muscle of ob/ob mice (Fig 3A and 3B). [score:5]
The decrease in the expression of miR-133a in diabetes causes the increase in RhoA expression. [score:5]
Transfection of pre-miR-133a caused a decrease in RhoA expression in NG -treated cells and blocked the increase in RhoA expression in HG -treated cells (Fig 3C). [score:5]
RhoA protein expression is negatively regulated by miR-133a in bronchial smooth muscle and cardiomyocytes [42, 44, 45]. [score:4]
Although our studies did not identify the mechanism for the decrease in miR-133a in diabetes, several studies showed that activation of RAGE by AGE causes activation of redox-sensitive transcription factors and regulation of their target genes including miRNAs [66]. [score:4]
Regulation of RhoA expression and Rho kinase activity by miR-133a in diabetes and hyperglycemia. [score:4]
Previous studies showed the expression of miR-133a in smooth muscle and binding sites for miR-133a in the 3’UTR of RhoA mRNA [43]. [score:3]
The effect of hyperglycemia on miR-133a expression and RhoA/Rho kinase pathway and muscle contraction was reversed by anti-oxidant NAC treatment both in vivo and in vitro. [score:3]
Similarly, transfection of pre-miR-133a in vitro in cultured muscle cells caused an increase in mature miR-133a expression in both NG- and HG -treated cells (Fig 2B). [score:3]
Changes in the miRNA-133a levels and miR-133a -driven RhoA expression in diabetes could be due to increase in oxidative stress. [score:3]
The effect of NAC on gastric emptying in ob/ob mice is consistent with its effect on oxidative stress marker H [2]O [2] and on the expression of miR-133a and RhoA and muscle contraction in ob/ob mice in vivo and in smooth muscle treated with HG in vitro. [score:3]
An importance of oxidative stress in mediating these changes in diabetes was demonstrated using NAC which is capable of reversing the effect of diabetes on the miR-133a and RhoA expression, Rho kinase activity, muscle contraction and gastric emptying (Fig 8). [score:3]
These results suggest that the increase in oxidative stress in diabetes in vivo and hyperglycemia in vitro causes a decrease in miR-133a expression leading to an increase in RhoA/Rho kinase pathway and muscle contraction. [score:3]
Expression of microRNA-133a in diabetes and hyperglycemia. [score:3]
The miR-133 family of miRNAs is the most highly expressed miRNAs in cardiac myocytes [42]. [score:3]
Intraperitoneal (IP) injections (5 mg/kg of body weight over 3 days) of pre-miR-133a caused an increase in mature miR-133a expression in smooth muscle of WT (60±8% increase) and ob/ob (240±25% increase) mice (Fig 2A). [score:3]
In both systems, the increase in RhoA expression was blocked by treatment with pre-miR-133a, whereas the increase was augmented by treatment with antagomiR-133a. [score:3]
Our studies also provide evidence that the decrease in miR-133a expression and increase in RhoA/Rho kinase pathway in diabetes were due to increase in oxidative stress. [score:3]
miR-133a and miR-25 expression by qRT-PCR. [score:3]
The link between miR-133a and RhoA expression was analyzed using pre-miR-133a, which causes an increase in mature miR-133a, and antagomiR-133a, which blocks the effect of mature miR-133a, both in vivo and in vitro. [score:3]
Effect of N-acetylcysteine (NAC) on the expression of miR-133 and RhoA, and muscle contraction in diabetes and hyperglycemia. [score:3]
The effect of diabetes in vivo and hyperglycemia in vitro on the expression levels of miR-133a and RhoA and on ACh -induced Rho kinase activity and muscle contraction was blocked with NAC. [score:3]
The link between miR-133a and RhoA expression was demonstrated using pre-miR-133a and antagomiR-133a both in vivo in ob/ob mice and in vitro in smooth muscle treated with HG. [score:3]
Consistent with the decrease in RhoA expression, transfection of pre-miR-133a attenuated ACh -induced Rho kinase activity in NG -treated smooth muscle cells (230±25% increase vs. [score:3]
The expression levels of miR-133a and miR-25 were detected by qRT-PCR assay. [score:2]
A similar decrease in miR-133a expression (50±6% decrease) was obtained in smooth muscle cells from WT mice treated with HG compared to muscle cells treated with NG (Fig 2B). [score:2]
The RNA hybrid analyses of human and mouse mRNAs for RhoA revealed putative binding sites of miR-133a in their 3’UTR [43]. [score:1]
65±8% increase with miR-133a) (Fig 3D). [score:1]
0178574.g002 Fig 2 (A) Expression of microRNA-133a (miR-133a) was measured by qRT-PCR in RNA isolated from the smooth muscle of WT or ob/ob mice with or without intraperitoneal injections of pre- miR-133a (5 mg/kg of body weight over 3 days). [score:1]
Induction of antagomir miR-133a (antagmiR-133a) and precursor miR-133a (pre-miR-133a). [score:1]
50±5% increase with miR-133a) and blocked the augmentation of Rho kinase activity in HG -treated cells (285±30% increase vs. [score:1]
Expression of RhoA and Rho kinase activity was measured in the smooth muscle of WT or ob/ob mice with or without intraperitoneal injections pre-miR-133a or antagomiR-miR133a (5 mg/kg of body weight over 3 days) (A, B, E and F) and in smooth muscle cells treated with NG or HG for 48 h in the presence or absence of transfection with pre-miR-133a or antagomiR-133a (C and G). [score:1]
Pre-miR-133a and antagomiR-133a were dissolved in saline as the final concentration is 10 μg/μl and respective groups of mice were given consecutive doses of 5 mg/kg of body weight over 3 days or an equal volume of saline to control mice. [score:1]
0178574.g003 Fig 3 Expression of RhoA and Rho kinase activity was measured in the smooth muscle of WT or ob/ob mice with or without intraperitoneal injections pre-miR-133a or antagomiR-miR133a (5 mg/kg of body weight over 3 days) (A, B, E and F) and in smooth muscle cells treated with NG or HG for 48 h in the presence or absence of transfection with pre-miR-133a or antagomiR-133a (C and G). [score:1]
0178574.g006 Fig 6 (A and E) Expression of miR-133a was measured by qRT-PCR in RNA isolated from the smooth muscle of WT or ob/ob mice with or without intraperitoneal (IP) injections of NAC (300 mg/kg) and in RNA isolated from smooth muscle cells treated with NG or HG for 48 h in the presence or absence of NAC (1 mM). [score:1]
Confluent smooth muscle cells in the first passage on six-well plates were transiently transfected with the pre-miR-133a or antagomiR-133a using Lipofectamine 2000 according to the manufacturer's instructions. [score:1]
Briefly, 10 nM pre-miR-133a vector in 125 μl Opti-MEM medium were mixed with 5 μl Lipofectamine 2000 in 125 μl Opti-MEM. [score:1]
Transfection of pre-miR-133a or antagomiR-133a in cultured smooth muscle cells. [score:1]
[1 to 20 of 50 sentences]
7
[+] score: 153
Diabetes (ntg/D) caused significant up-regulation of (A) EP300 mRNA expression in association with (B) reduced miR-133a expression in the hearts. [score:8]
Given the significance of miR-133a as one of the predominantly expressed miRs in the cardiac tissue, and its prominent role in various events, starting from cardiac cell development to regulation of cell death and hypertrophy [4– 5], makes miR-133a a therapeutic target in the heart, in diabetes. [score:7]
Connective tissue growth factor is another important target of miR-133a, and we demonstrated a partial but significant reduction in its mRNA expression when miR-133a was overexpressed in the hearts of diabetic mice. [score:7]
The protective response we observed during miR-133a overexpression during diabetes involves down-regulation of TGF-β1 and decreased phosphorylation of SMAD2 and reduced ERK1/2 activation (Fig.   5 Summary Diagram). [score:6]
Figure 2Regulation of angiotensinogen (AGT) and endothelin-1 (EDN1) mRNA expression during diabetes in the absence and presence of miR-133a overexpression. [score:6]
Hyperglycaemia, through down-regulation of endogenous miR-133a expression, diminishes possible innate protection against fibrosis. [score:6]
However, we found that miR-133a was able to decrease TGFβ1 mRNA expression, a known target of miR-133a (http;//www. [score:5]
We found that AGT mRNA was increased in the heart in diabetes (Fig.   2A) almost twofold and this effect was reversed by miR-133a overexpression (Fig.   2A), suggesting that miR-133a inhibits activation of the local renin–angiotensin system. [score:5]
In this study, we have demonstrated that miR-133a overexpression can prevent diabetes -induced increased ECM protein expression and focal cardiac fibrosis. [score:5]
Cardiac miR-133 overexpression inhibits vasoactive mediators of fibrosis. [score:5]
We explored the influence of cardiac miR-133a overexpression on the expression of fibrosis markers. [score:5]
In the heart, miR-1 and miR-133a are among the most cardiac-specific miRNAs that are abundantly expressed, and are known to regulate cardiac cell differentiation, survival and hypertrophic growth [20, 21]. [score:4]
Figure 1Effects of Cardiac miR-133 overexpression on fibrosis regulators during diabetes. [score:4]
Diabetes -induced up-regulation of these transcripts was prevented in the miR-133a animals. [score:4]
Diabetes -induced specific protein up-regulation/and phosphorylation were prevented in the miR-133a animals. [score:4]
It was previously demonstrated that major targets of miR-133a include genes involved in development, cell cycle, cellular transport, metabolism and mitogenic signalling [21]. [score:4]
We have shown down-regulation of miR-133a in the heart in diabetes [20]. [score:4]
In pressure overload hypertrophy, miR-133a overexpression can prevent cardiac fibrosis [20]. [score:3]
Such changes were prevented in the miR-133a overexpressing animals with diabetes (Fig.   4C). [score:3]
Diabetes is also accompanied by a decreased expressed of miR-133a. [score:3]
One notable observation is that miR-133a–mediated attenuation of fibrosis occurred even without reversal of hyperglycaemia (Fig.  S2), which indicates that miR-133a could also become a therapeutic target along with or without insulin for treating diabetic patients. [score:3]
The observed increases in COL4A1, FN1 and phosphorylation of both ERK1/2 and SMAD-2 were prevented when miR-133a was overexpressed in the heart in diabetes (Fig.   4B). [score:3]
We suggest that miR-133a could be a potential therapeutic target for combatting cardiac fibrosis. [score:3]
In summary, this study demonstrated a novel molecular mechanism by which miR-133a overexpression in the heart protects cardiac tissue from undergoing fibrosis during hyperglycaemia. [score:3]
Two miRs, which are selectively expressed in heart and which have been used as early markers of cardiac tissue damage, are miR-1 and miR-133a [3]. [score:3]
Cardiac miR-133a overexpression decreases mRNA levels of fibrosis markers in the diabetic mouse heart. [score:3]
In keeping with such findings, this study also showed that overexpression of miR-133a prevents diabetes -induced increased ECM production leading to specific structural changes, i. e. focal myocardial fibrosis. [score:3]
Fibronectin, FGF1 and TGF-β1 showed an almost twofold increase in diabetic hearts, while COL showed a fivefold increase; the increases in FN1, FGF1 and TGF-β1 were attenuated in diabetic miR-133a overexpressed hearts. [score:3]
Hearts of the animals from the four groups (ntg, ntg/D, miR-133a and miR-133a/D) were isolated and mRNA expression for AGT (A) and EDN1 (B) for these groups was analysed by real-time PCR. [score:3]
Quantification of the proteins in controls and miR-133a overexpressed mice with and without diabetes Introduction. [score:3]
miR-133a overexpression in the heart mitigates diabetes -induced fibrosis. [score:3]
Interestingly, when animals were overexpressed with miR-133a in the heart, there was a significant attenuation of mediators and markers of fibrosis along with decreased fibrotic heart lesions. [score:3]
In this study of STZ -induced diabetes, we observed that diabetes increased EP300 mRNA levels concurrent with a decrease in miR-133a in the heart (Fig.   3A and B) suggesting a possible negative regulation of miR-133a in diabetes. [score:2]
In this study, we showed for the first time that miR-133a plays a specific role in the development of cardiac fibrosis in diabetes and indicate possible pathways involved in this process. [score:2]
ERK1/2 activation in the context of reduced miR-133a in diabetes may further cause alteration of multiple fibrogenic factors and ECM protein production, leading to structural changes in the heart in diabetes. [score:1]
The exact mechanism of protection afforded by miR-133a is not clear. [score:1]
A reciprocal relationship of p300 and miR-133a was observed in the heart in diabetes. [score:1]
In this study, we have made use of the previously documented miR-133a transgenic (Tg) mice [4] to study the role of this miR in response to glucotoxic effects of diabetes, and explored the protective role of miR-133a in preventing cardiac fibrosis. [score:1]
5SrRNA has been used for miR-133a and 18S was used as the loading control for EP300 mRNA, n = 6–8/group, values are mean ± SEM. [score:1]
Figure 3Influence of diabetes on miR-133a and EP300 mRNA levels in the heart. [score:1]
In particular, miRNA-133a has been shown to protect against myocardial fibrosis without affecting hypertrophy in pressure-overloaded adult hearts [4]. [score:1]
Four groups of animals were used: wild-type non-transgenic (ntg), non-transgenic with 2 months of streptozotocin (STZ) -induced diabetes (ntg/D), non-diabetic cardiac miR-133a TG (miR-133a) and cardiac miR-133a TG with STZ -induced diabetes (miR-133a/D). [score:1]
*Significantly different from ntg group, &significantly different from miR-133a group, @different from all other groups, P < 0.05. [score:1]
The increase in EP300 and decrease in miR-133a mRNA levels following diabetes were normalized to control levels in miR-133a TG diabetic mice (Fig.   3A and B). [score:1]
Similar to AGT, we found that EDN1 mRNA levels were also increased in diabetes (Fig.   2B), an effect that was normalized in the miR-133a/D group (Fig.   2B). [score:1]
No changes in FN1 and COL4A1 mRNA levels were observed between the non-transgenic and miR-133a TG non-diabetic hearts, but TGF-β1 levels showed a decreasing trend. [score:1]
The friend leukaemia virus B mice strain was used to study the role of miR-133a in the heart, by cloning the genomic sequence of miR-133a into the α-Myosin heavy-chain promoter that is cardiac specific as previously described [5]. [score:1]
Furthermore, there are no reports exploring the role of miR-133a in fibrosis in response to chronic metabolic stress like diabetes. [score:1]
Such alterations were prevented in the hearts of transgenic miR-133a animals with diabetes (miR-133a/D). [score:1]
[1 to 20 of 49 sentences]
8
[+] score: 148
Effect of miR-133a via EVs on the expression of genes associated with apoptosis and differentiation in C [2]C [12] cellsWe next investigated whether the effect miR-133a via EVs on the survival of myotubes was regulated by its target genes directly or indirectly through the targeting functions of miRNA. [score:8]
On the other hand, in the muscle of mdx mice, miR-1 and miR-133a levels have been shown to be downregulated, whereas miR-206 levels are upregulated [26, 27]. [score:7]
In addition, some previous reports indicated that caspase-9 is a possible direct target of miR-133a, and the inhibition of miR-133a increases caspase-9 and caspase-3 activity as well as the number of apoptotic cells in cardiomyocytes [53, 55– 57]. [score:6]
It has also been reported that miR-1 and miR-133a levels are downregulated in dystrophic muscle and recover to normal levels by the rescue of dystrophin expression [26, 27]. [score:6]
These findings indicated that the protective effects against apoptosis of C [2]C [12] cells by EVs might be in part controlled by regulation of the expression of genes targeted by miR-133a. [score:6]
Exosomes extracted from differentiating human myoblasts include various gwoth factors, such as basic FGF, hepatocyte growth factor, insulin like growth factors-I, and vascular endothelial growth factor receptor, which are significantly upregulated in miR-133a -overexpressed adult mouse CPCs [43, 53]. [score:6]
We next investigated whether the effect miR-133a via EVs on the survival of myotubes was regulated by its target genes directly or indirectly through the targeting functions of miRNA. [score:6]
Moreover, it was reported that miR-133a is a direct target for apoptotic protease- activating factor 1and has a protective effect on apoptosis by repressing the expression of apoptotic genes [60]. [score:6]
Moreover, miR-133a attenuates hypoxia -induced apoptosis by suppressing caspase-8 signals via its inhibition of the TAGLN2 gene in cardiomyocytes [61]. [score:5]
In cardiomyocytes, the inhibitory action of miR-133a maintains low basal IP3RII expression. [score:5]
It was recently demonstrated that miR-133a inhibits injury -induced cardiomyocyte apoptosis by targeting the DAPK2 gene [62]. [score:5]
Expression of the inositol 1,4,5-triphoshate receptor II (IP3RII) calcium channel was constitutively suppressed by miR-133a [55]. [score:5]
In this study, miR-133a in EVs exerted protective effects against C [2]C [12] cell stress, via the suppression of the expression of apoptosis -associated genes, despite the EVs including various bioactive molecules, such as mRNA, protein, and DNA. [score:5]
To test this hypothesis, we quantified the expression levels of putative target genes in C [2]C [12] cells cultured with or without EVs containing a large amount of miR-133a. [score:5]
It was reported that the overexpression of these myomiRs had little effect on the proliferation or apoptosis of cardiac progenitor cells (CPCs) under basal conditions, whereas miR-133a increased cell survival under oxidative stress in part through targeting of the potent proapoptotic factors, Bim and Bmf [53]. [score:5]
The decline in miR-133a levels resulted in the upregulation of Ca [2+] levels. [score:4]
These reports suggest that the secretion of EVs may be regulated by increases in intracellular Ca [2+] concentrations, which is induced by IP3RII targeting by miR-133a. [score:4]
Effect of myomiRs via EVs on the survival of C [2]C [12] myoblasts and myotubesNext, to analyze the effect of myomiRs via EVs on cell survival, we performed gain-of-function experiments of miR-1, miR-133a, and miR-206, which were upregulated within EVs during the differentiation of C [2]C [12] cells (S7 Fig), using C [2]C [12] cells and EVs extracted from C [2]C [12] cells transfected with each miRNA (Fig 4A, S8 Fig). [score:4]
Next, to analyze the effect of myomiRs via EVs on cell survival, we performed gain-of-function experiments of miR-1, miR-133a, and miR-206, which were upregulated within EVs during the differentiation of C [2]C [12] cells (S7 Fig), using C [2]C [12] cells and EVs extracted from C [2]C [12] cells transfected with each miRNA (Fig 4A, S8 Fig). [score:4]
This upregulation in myomiR levels is not limited to DMD patients, as increased levels of miR-1 were found in the sera of Becker muscular dystrophy (BMD), facioscapulohumeral muscular dystrophy, and limb-girdle muscular dystrophy patients, and increased levels of miR-133a and miR-206 were found in BMD patients [25]. [score:4]
qRT-PCR demonstrated that the levels of miR-133a were significantly upregulated by the incubation of cells with the EVs (Fig 5A). [score:4]
Transgenic overexpression of miR-133a in skeletal muscle. [score:3]
The expression of miR-1 and miR-133a in skeletal muscle can be restored by rescue of the dystrophin protein using exon-skipping techniques [27, 28]. [score:3]
To elucidate whether myomiR levels in the serum are positively associated with muscle degeneration, the levels of three myomiRs, namely, miR-1, miR-133a, and miR-206, in the sera of transgenic (tg) mdx mice, overexpressing a truncated dystrophin transcript with a deletion from exon 45 to 55, mdx mice, and wild-type (wt) mice were quantified by qRT-PCR. [score:3]
Effect of miR-133a via EVs on the expression of genes associated with apoptosis and differentiation in C [2]C [12] cells. [score:3]
In addition, overexpression of miR-133a in the skeletal muscle of mice did not result in any overt muscle defects [54]. [score:3]
The transport of miR-133a via EVs regulates the viability of C [2]C [12] cells under conditions of cellular stress. [score:2]
These results suggest that the survival of myotubes may be partially regulated by miR-133a via EVs. [score:2]
We found significant decreases in the levels of miR-1, miR-133a, and miR-206 in the serum of tg mice (mdx mice overexpressing a truncated dystrophin protein showing normal muscle activities) compared with those of mdx mice at 7 weeks of age. [score:2]
Three DNA fragments, namely, precursors of miR-1a, miR-133a, and miR-206 (pre-miR-1a, pre-miR-133a, and pre-miR-206) were synthesized (Bioneer, Alameda, CA), and inserted into the intron site of the pEM-157 vector, which contains the cytomegalovirus promoter driving transcription of the dsRed-fluorescent protein-coding sequence interrupted by an intron. [score:1]
Secondary structure of the myomiRs, miR-1 (A), miR-133a (B), and miR-206 (C) based on ΔG values. [score:1]
Myotubes were incubated in serum -depleted medium, with 0.8 μg (A), 2 μg (B) of EVs extracted from the medium of C [2]C [12] cells transfected with miR-1, miR-133a, miR-206, or their four possible combinations (miR-1/miR-133a, miR-1/miR-206, miR-133a/miR-206, and miR1/miR-133a/miR-206) for the indicated times. [score:1]
S7 FigmiR-1, miR-133a, and miR-206 levels within EVs extracted from the culture medium of C [2]C [12] cells at different stages of differentiation. [score:1]
Moreover, the transport of miR-133a via EVs into C [2]C [12] cells increases cell survival under conditions of cellular stress. [score:1]
Levels are shown relative to that of the non -transfected cells, which was set to 1. (TIFF) Myoblasts (A) and myotubes (B), differentiated for 4 days, were incubated with or without low (0.7 μg), medium (2 μg), or high (6 μg) concentrations of EVs extracted from the medium of C [2]C [12] cells transfected with miR-1, miR-133a, or miR-206, or non -transfected (non-TF EVs) for 24 hrs in serum -depleted medium (A) or in the presence of H [2]O [2] (10 mM) (B). [score:1]
miR-1, miR-133a, and miR-206 levels within EVs extracted from the culture medium of C [2]C [12] cells at different stages of differentiation. [score:1]
The sequences of the three fragments were as follows: pre-miR-1a: 5′-GTTTAAACCCAGGCCACATGCTTCTTTATATCCTCATAGATATCTCAGCACTATGGAATGTAAGGAAGTGTGTGGTTTTGGACTAGT-3′, pre-miR-133a: 5′-GTTTAAACAGAAGCCAAATGCTTTGCTGAAGCTGGTAAAATGGAACCAAATCAGCTGTTGGATGGATTTGGTCCCCTTCAACCAGCTGTAGCTGCGCATTGATCACGCCGCAACTAGT-3′, pre-miR-206: 5′-GTTTAAACGCTTGGGACACATACTTCTTTATATGCCCATATGAACCTGCTAAGCTATGGAATGTAAAGAAGTATGTATTTCAGGCACTAGT-3′. [score:1]
In our study, caspase-3 activity was decreased by miR-133a via EVs in C [2]C [12] cells under conditions of cell stress. [score:1]
C [2]C [12] cells were cultured and transfected with miR-1, miR-133a, miR-206, miR-1/miR-133a, miR-1/miR-206, miR-133a/miR-206, or miR1/miR-133a/miR-206. [score:1]
These findings indicate that miR-133a within EVs in the absence of cellular stresses may not affect muscle survival. [score:1]
miR-1, miR-133a, and miR-206 levels (B) and CK levels (C) in the serum were quantified by RT-quantitative PCR and the Fuji Dri-Chem system, respectively. [score:1]
After the administration of GW4869, the levels of miR-1, miR-133a, and miR-206, as well as the level of CK, which is indicative of sarcolemmal leakage, were quantified. [score:1]
Several groups, including our own, previously reported that three myomiRs, namely, miR-1, miR-133a, and miR-206, were increased in the sera of animal mo dels of muscular dystrophy as well as in patients [22– 24]. [score:1]
These findings indicate that modification of apoptosis by miR-133a might be a novel therapeutic strategy for DMD. [score:1]
Levels of miR-133a (A) and relative mRNA levels of putative target genes (B) were measured by RT-quantitative PCR. [score:1]
S9 FigMyoblasts (A) and myotubes (B), differentiated for 4 days, were incubated with or without low (0.7 μg), medium (2 μg), or high (6 μg) concentrations of EVs extracted from the medium of C [2]C [12] cells transfected with miR-1, miR-133a, or miR-206, or non -transfected (non-TF EVs) for 24 hrs in serum -depleted medium (A) or in the presence of H [2]O [2] (10 mM) (B). [score:1]
[1 to 20 of 46 sentences]
9
[+] score: 145
miR-133a/b was upregulated in response to 5α-DHT treatment and mirR-206 expression was downregulated in response to to testosterone treatment ([*] P < 0.05) (A). [score:9]
miR-1, miR-133a and miR-133b expression is upregulated with aging in men. [score:6]
An ordinary Two-Way ANOVA revealed an overall effect of both gender and age on miR-133a and miR-133b expression (B,C) ([**] P < 0.01) and a significant interaction for miR-1 expression ([**] P < 0.01). [score:5]
An overall effect of LHRH-agonist treatment was observed for miR-133a and miR-133b expression (P < 0.05), but not in miR-1 or miR-206 expression (P > 0.05). [score:5]
An ordinary Two-Way ANOVA revealed a markedly effect of both gender and age on miR-133a and miR-133b expression (P < 0.01), where both factors are associated with an overall higher expression of both mature miRNA transcripts. [score:5]
miR-133a and miR-133b are down-regulated in castrated mice. [score:4]
In contrast to our results from the current study, their microarray data pointed toward a downregulation of miR-133a/b in elderly men. [score:4]
5α-dihydrotestosterone regulates miR-133a, miR-133b, and miR-206 expression in human primary myocytes. [score:4]
Importantly, we also show that physical activity overrides the regulatory effect of testosterone on miR-133a/b expression. [score:4]
Interestingly, one validated target of miR-133a/b is the insulin-like growth factor-1 receptor (IGF-1R) in skeletal muscle (Huang et al., 2011), making miR-133a/b a likely regulator of growth factor signaling through the AKT signaling pathway (Schiaffino and Mammucari, 2011). [score:4]
When using Bonferroni multiple comparison post-hoc test it was demonstrated that miR-1 (A), miR-133a (B), and miR-133b (C) expression levels were higher in elderly compared to younger men ([*] P = 0.02, [*] P = 0.03, [***] P = 0.008, respectively) There was no effect of age or gender on mir-206 expression (D) (P > 0.05). [score:4]
Our collective data from three independent mo dels, indicate that testosterone up-regulates miR-133a, and 133b. [score:4]
Androgenic control of miR-133a/b expression therefore seems to be a separate regulatory mechanism that may play a role during certain physiological conditions, such as physical inactivity. [score:4]
Thus, it is possible that the regulation of mir-133a/b expression by testosterone occurs through a post-transcriptional processing of the pri- and/or pre-miRNA transcripts. [score:4]
miR-133a and miR-133b are down-regulated in testosterone blocked participants. [score:4]
Therefore, it is likely that the decline in physical activity is the main determining factor involved in the age -dependent up-regulation of miR-1 and miR-133a/b. [score:4]
Surprisingly, a bonferroni multiple comparison test revealed reduced miR-133a/b expression (miR-133a, P = 0.02. miR-133b, P = 0.03. ) [score:3]
Consistent with our findings in the LHRH-agonist treated men with low circulating testosterone, castrated mice had a lower expression of mir-133a (P < 0.05) and mir-133b (P < 0.001) (Figure 4A). [score:3]
An unpaired t-test demonstrated a significant lower expression of mir-133a ([*] P < 0.05) and mir-133b ([***] P < 0.001) in the skeletal muscle of castrated mice. [score:3]
The observed effects of testosterone and age as inducers of miR-133a and miR-133b expression are seemingly in opposition. [score:3]
Bonferroni multiple comparison post-hoc tests revealed a significant lower expression of mir-133a (B) ([*] P = 0.02) and mir-133b (C) ([*] P = 0.03), but not mir-1 (A) or miR-206 (D) in testosterone blocked patients at rest before training. [score:3]
In addition, miR-133a (F) and miR-133b (G) expression were negatively correlated with testosterone levels in men (n = 18) (P < 0.05, R [2] = 0.33 and P < 0.05, R [2] = 0.26). [score:3]
Drummond found that 18 miRNAs, including miR-133a and miR-133b, were differentially expressed. [score:3]
Specific requirements of MRFs for the expression of muscle specific microRNAs, miR-1, miR-206 and miR-133. [score:3]
Furthermore, circulating testosterone levels in men was negatively correlated with miR-133a and miR 133b expression (Figures 2F,G) (P < 0.05, r [2] = 0.33 and P < 0.05, r [2] = 0.26). [score:3]
Gender and age affects miR-133a and miR-133b expression. [score:3]
Regardless of pre-exercise intervention level, training equalized the expression of miR-133a and miR-133b between healthy and LHR -treated participants to a lower level. [score:3]
MicroRNA-1 and microRNA-133a expression are decreased during skeletal muscle hypertrophy. [score:3]
Our findings suggest that an age -dependent decline in testosterone and increase of miR-133a/b expression are independent events. [score:3]
Partly in line with our previous results (Nielsen et al., 2010), a Two-Way ANOVA (RM) demonstrated a main effect of training in terms of decreased expression in all four myomiRs (miR-1, P < 0.0001. miR-133a, P < 0.01. miR-133b, P < 0.0001, miR-206 P < 0.05). [score:3]
In the current study, we found that the expression of miR-1, miR-133a, and miR-133b was higher in the skeletal muscle of elderly compared to younger men and that miR-133a/b was higher expressed in women compared to men. [score:3]
miR-1, miR-133a, miR-133b, and miR-206 belong to a group of muscle specific miRNAs (myomiRs) crucial for the regulation of skeletal muscle development and function (Chen et al., 2006; van Rooij et al., 2008). [score:3]
However, our subsequent studies demonstrated that testosterone positively regulated miR-133a/b. [score:2]
We thus show a physiological role of testosterone in the regulation of miR-133a and miR-133b in human and murine skeletal muscle. [score:2]
Insulin-like growth factor-1 receptor is regulated by microRNA-133 during skeletal myogenesis. [score:2]
Interestingly, the women had a markedly increase in miR-133a and miR-133b expression compared to men. [score:2]
Thus, we conducted subsequent experiments addressing the potential role that circulating testosterone and/or aerobic fitness might play in regulating skeletal muscle miR-133a/b in men. [score:2]
We found an increased expression of miR-1 (P = 0.02), miR-133a (P = 0.03) and miR-133b (P = 0.008) in elderly men compared to younger men (Figures 1A–C). [score:2]
Consistent with the in vivo experiments suggesting a role for testosterone in regulating miR-133a/b, 5α-DHT incubation in culture increased miR-133a and miR-133b (P < 0.05) (Figure 5A). [score:2]
miR-133a/b was inversely correlated with an age -dependent decrease of testosterone in men. [score:1]
ARE motifs near the miR-1/miR-133a loci, have not yet been identified. [score:1]
miR-1, miR-133a, and miR-133b (A–C) were inversely correlated with maximal oxygen uptake in women and men (n = 36) (P < 0.05, 0.01 and 0.001, R [2] = 0.11, 0.24, and 0.33). [score:1]
A Two-Way ANOVA (RM) (miR-1, [****] P < 0.0001. miR-133a, [**] P < 0.01. miR-133b, [***] P < 0.001, miR-206 [*] P < 0.05). [score:1]
To address a potential involvement of miR-1, miR-133a, and miR-133b in the age-related decline in muscle function for both genders, we used a bonferroni multiple comparison post-hoc test. [score:1]
Furthermore, it has been shown that miR-133a and miR-206 are lower in skeletal muscle of people with type 2 diabetes (Gallagher et al., 2010). [score:1]
In line with our previous findings (Nielsen et al., 2010) aerobic fitness in all subjects was negatively correlated with miR-1 and miR-133a and miR-133b (Figures 2A–C) (P < 0.05, 0.01 and 0.001, r [2] = 0.11, 0.24, and 0.33, respectively). [score:1]
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
However, in addition to miR-133a/b, miR-1 was induced in the elderly group. [score:1]
[1 to 20 of 48 sentences]
10
[+] score: 137
Consistent with others' findings [15], both miR-1 and miR-133 were found to be robustly up-regulated during C2C12 differentiation whereas YY1 expression was gradually down-regulated (Fig. 2A). [score:9]
However, YY1 expression level was found to be up-regulated at all time points examined (Fig. 2D, right), indicating that the down-regulation of miR-1 and miR-133 could be caused by elevated YY1 levels. [score:9]
Although miR-1 and miR-133 are clustered on the same chromosomal loci and transcribed together as a single transcript, there seems to be a stronger regulation on miR-133 by YY1 than on miR-1 as depleting YY1 increased miR-133 to a much higher levels than that of miR-1 (Fig. 2F) and over -expressing YY1 also down-regulated miR-133 more than miR-1 (data not shown). [score:7]
As expected, both miR-1 and miR-133 levels were up-regulated (Fig. 2C, middle and right), showing an inverse relationship with YY1 expression. [score:6]
In contrast, synthesis of miR-133 inhibits myogenesis through the down-regulation of serum response factor (SRF) which maintains myoblasts in a proliferative state [15]. [score:6]
Expression folds are shown with respect to siNC where miR-1 and miR-133 levels were set to a value of 1. (G) Expression of the primary transcripts of miR-1-2/miR-133a-1 was detected by qRT-PCR in C2C12 transfected with siYY1 or siNC oligos, and normalized to GAPDH. [score:5]
Expression folds are shown with respect to TNF treated cells where miR-1 or miR-133 levels were set to a value of 1. (B) Expression of miR-1 and miR-133 was measured in C2C12 myoblasts stably expressing Vector or the IκBα-SR transgene. [score:5]
Figure S2 NFκB suppresses miR-1 and miR-133 expression through YY1. [score:5]
from qRT-PCR analysis (Fig. 6D) revealed that the expressions of miR-1 and miR-133 were up-regulated in siYY1 injected muscles compared to siNC injected muscles at all three time points (day 2, 4 and 6) during muscle regeneration. [score:5]
Expression folds are shown with respect to siNC where miR-1 and miR-133 levels were set to a value of 1. (E) Western blotting was performed to analyze the expression of YY1, Pax7, MyoD and Myogenin. [score:5]
Collectively, our data from the above studies suggest that YY1 negatively regulates miR-1 and miR-133 expression both in physiological and pathological muscle conditions. [score:4]
It was demonstrated that E2 is essential to direct miR-1-2/miR-133a-1 expression in the somite myotomes and through the skeletal musculature in embryogenesis [31]. [score:4]
Among all the putative YY1 target miRNAs, miR-1 and miR-133 families are particularly attractive considering the pivotal roles of these muscle miRs in regulating myogenesis [5]. [score:4]
We reasoned there may be two possibilities: first, it may be attributed to the fact that three copies of miR-133 are under regulation by YY1 whereas only two copies of miR-1 are subjected to YY1 regulation (Fig. 3A–C). [score:3]
In addition, our studies focused on the regulation of YY1 on miR-1 and its downstream event; it will be interesting to explore how YY1 regulated miR-133 affect satellite cell proliferation and differentiation processes. [score:3]
Since YY1 is a transcriptional target of NF-κB [19], we reasoned that miR-1 and miR-133 should also come under negative control of NF-κB. [score:3]
The rapid induction of miR-133 during differentiation and its high expression level in muscle tissue seems to contradict its documented role as growth-stimulatory and anti-myogenic. [score:3]
miR-1 is shown to promote myoblast differentiation while miR-133 promotes myoblast proliferation and inhibits myogenic differentiation [15]. [score:3]
Second, in addition to regulating the transcription of primary miR-1/133 transcripts, YY1 may also exert regulation at a later stage of miR-1/133 biogenesis, resulting in different rates of miR-1 and miR-133 production. [score:3]
Expression folds are shown with respect to 3 day old mice where miR-1 and miR-133 levels were set to a value of 1. (D) TA muscles were isolated from 3 w, 4 w, 5 w, 8 w and 10 w old C57BL/6 wild type mice or mdx mice. [score:3]
Consistent with this thinking, treatment of C2C12 myoblasts with TNFα as an activator of NF-κB reduced miR-1 and miR-133 expression (Suppl. [score:3]
Expression folds are shown with respect to wild type where miR-1, miR-133 or YY1 levels were set to a value of 1. (E) C2C12 myoblasts or (F) primary myoblasts were transfected with either negative control (siNC) or siRNA oligos against YY1 (siYY1). [score:3]
Expression folds are shown with respect to day 0 where miR-1 and miR-133 levels were set to a value of 1. Quantitative values are represented as means ± S. D. (B) YY1 expression was measured by Western blotting. [score:3]
The expression profiles of miR-1 and miR-133 were examined by qRT-PCR analysis. [score:3]
These findings suggest that miR-1 and miR-133 are subjected to regulation by NF-κB-YY1 signaling. [score:2]
Thus miR-1, miR-133 and miR-206 play central regulatory roles in muscle biology and are called muscle miRs. [score:2]
The expression of miR-133 displayed a similar change but the decrease in degeneration stage was much stronger (∼10 fold) and the elevation in regeneration stage was lower compared to miR-1 level. [score:2]
When performed in primary myoblasts, knocking down of YY1 led to an even more significant increase of miR-1 and miR-133 (13.5 and 273 fold, respectively) (Fig. 2F). [score:2]
Similar to mature miR-1 and miR-133, the level of pri-miR-1/133 transcripts was found to be induced upon siYY1 knockdown (Fig. 2G). [score:2]
As shown in Fig. 2B, when induced to differentiation by serum withdrawal, a sharp increase of both miR-1 and miR-133 expression was detected compared to GM cells. [score:2]
Our view is consistent with a recent report demonstrating that miR-1 and miR-133 produced opposing effects on apoptosis in cardiomyocytes despite the similar regulation [38]. [score:2]
Total RNAs were collected from cells differentiated (DM) for 0, 1, 3 or 5 days and used for measuring miR-1 and miR-133 expression levels. [score:1]
0027596.g003 Figure 3 (A) Two conserved enhancers (E1 and E2) were identified in the promoter region and intragenic region of miR-1-2/miR-133a-1 cluster, respectively. [score:1]
Findings from the current studies demonstrate a repression of miR-1, miR-133 and miR-206 by YY1. [score:1]
The above findings thus confirm the presence of a transcriptional repression of miR-1 and miR-133 by YY1. [score:1]
As visualized by Cytoscape, miR-1, miR-133, miR-206 as well as miR-29 are all under transcriptional repression by YY1. [score:1]
miR-1 and miR-133 expression was then measured by qRT-PCR normalized to U6. [score:1]
As mentioned earlier, miR-1-2/miR-133a-1 cluster is transcribed from a bicistronic miRNA precursor on the antisense strand of Mib gene on mouse chromosome 18. [score:1]
s were then cultured for 48 hours, at which time miR-1 and miR-133 expressions were measured by qRT-PCR and normalized to U6. [score:1]
Total RNAs were isolated and qRT-PCR was subsequently performed to measure the expression of miR-1 and miR-133, normalized to U6 (middle and right). [score:1]
Real-time PCR was performed to measure the expression levels of miR-1 and miR-133 normalized to U6 (middle). [score:1]
E1 is located approximately 2 kb upstream of miR-1-2 while E2 is located in an intron separating miR-1-2 and miR-133a-1 coding regions. [score:1]
By qRT-PCR assay, both miR-1 and miR-133 levels increased over two folds upon YY1 depletion (Fig. 2E), suggesting that there is a negative regulation of miR-1 and miR-133 by YY1. [score:1]
Muscles miRs constitute two distinct families, the miR-1 family (miR-1-1, miR-1-2, and miR-206) and the miR-133 family (miR-133a-1, miR-133a-2, and miR-133b). [score:1]
The miR-1-2/miR-133a-1 cluster is transcribed from a bicistronic miRNA precursor on the antisense strand of the Mindbomb (Mib) gene on mouse chromosome 18 and the primary transcript has been cloned [31]. [score:1]
RNAs and proteins were then extracted from injected muscles at the indicated days post-injection, and qRT-PCR was performed to measure the expression of miR-1 and miR-133, normalized to U6. [score:1]
We noticed that the level of miR-1 rose faster during both C2C12 myoblast differentiation and CTX induced muscle regeneration, leading us to speculate that the predominant increase in miR-1 overweighs that in miR-133, favoring the progression of myogenic differentiation. [score:1]
[1 to 20 of 47 sentences]
11
[+] score: 134
Of extreme relevance, WB analysis showed that the combination of miRNA499 plus miRNA133 upregulated the protein expression of both Cx43 and cTnT (Fig. 6B). [score:6]
Gene and protein expression analysis showed that miRNA499 and miRNA133 are able to induce the differentiation of AMSC into cells expressing typical cardiac markers such as Nkx2.5, GATA4, cTnT, Cx43, Ryr2, and Cav1.2. [score:5]
At the 14 days time point, WB showed that miRNA1 alone had no effect on both Cx43 and cTnT, miRNA133 increased only the expression of cTnT, while miRNA499 was able to markedly increase the expression of both Cx43 and cTnT (Fig. 3A). [score:5]
The coexpression of miRNA499 and miRNA133 further increased the expression of the atrial marker Mlc. [score:5]
Expression of cardiac cytoskeletal protein (α-sarcomeric actinin) and of other important proteins involved in cardiac excitation/contraction (EC)-coupling (Cav1.2, SERCA2a, and RyR2) was analyzed by ICC on EB coexpressing miRNA499 and miRNA133, selected from the same batch of EB showing caffeine-responsiveness. [score:5]
ICC further confirmed that miRNA499 and miRNA133 coexpression was able to induce the expression of cardiac-specific proteins like cTnT, Cx43, Serca2a, and Cav1.2 (Fig. 6C) even in the absence of DMSO. [score:5]
When miRNA499 and miRNA133 were coexpressed, we documented a significant increase in both GATA4 and Nkx2.5 expression compared with all other conditions tested (Fig. 2A, 2B). [score:4]
However, the coexpression of miRNA499 and miRNA133 resulted in a significantly higher expression of both cardiac markers compared with the other conditions tested (Fig. 7A). [score:4]
Recently, it has been suggested that certain miRNA are powerful regulators of cardiac differentiation processes [32], and it has been shown that miRNA1, miRNA133, and miRNA499 are highly expressed in muscle cells [32]. [score:4]
Most importantly, by simultaneously over -expressing miRNA499 and miRNA133 the number of P19 cells expressing cTnI was 30-fold greater compared with the standard differentiation protocol. [score:4]
Real-time PCR analysis showed that also in P19 cells not exposed to DMSO, treatment with miRNA499 and miRNA133 upregulated GATA4 (+4.9-fold, p < . [score:4]
However, when we coexpressed miRNA499 together with miRNA133 the results were significantly and strikingly superior compared with the over -expression of miRNA499 alone. [score:4]
The Combination of miRNA499 and miRNA133 Increases the Expression of Cardiac-Specific Genes. [score:3]
ICC experiments confirmed that Cx43 and cTnT were convincingly turned on upon over -expression of miRNA449 alone and even more so in combination with miRNA133 (Fig. 3B). [score:3]
In particular, untreated EB showed responses compatible with Ca [2+] -dependent electrical activity, typical of immature CMC, while Na [+] -dependent excitability was recorded in EB over -expressing miRNA499 and miRNA133. [score:3]
CMC derived from P19 cells over -expressing miRNA499 and miRNA133 develop EC-coupling properties typical of mature CMC. [score:3]
miRNA133 increased the expression of Nkx2.5 (+1.3-fold vs. [score:3]
Coexpression of miRNA499 and miRNA133 sharply increased the proportion of caffeine-responsive cells. [score:3]
Importantly for translational purposes, we have also shown that the same combination miRNA499 and miRNA133 is a powerful inducer of cardiac differentiation for human MSC. [score:3]
WB (Fig. 7B) and ICC (Fig. 7C,D) analysis confirmed that AMSC treated with miRNA499 and miRNA133 differentiated in cells expressing Cx43 and cTnT (Fig. 7B, 7C) but also Cav1.2 and Ryr2 (Fig. 7D). [score:3]
Coexpression of miRNA499 and miRNA133 induced a 3.5-fold increase in the number of responsive cells with respect to cells exposed to DMSO (p < . [score:3]
WB and ICC analysis confirmed that cardiac proteins are indeed expressed at higher levels when P19 cells are cotransfected with miRNA499 plus miRNA133. [score:3]
Cardiac-Specific Proteins Are Highly Expressed in P19 Cells Treated with miRNA499 and miRNA133. [score:3]
As already observed in P19 cells, the combination of miRNA499 with miRNA133 triggered the over -expression of both the nuclear transcription factor GATA4 (+13-fold, p < . [score:3]
In addition, the expression of genes encoding for cardiac-specific transcription factors, such as GATA4 and Nkx2.5, and cardiac-specific proteins, such as Cx43 and cTnT, was enhanced in cells treated with miRNA499 plus miRNA133. [score:3]
It is currently unknown whether the concomitant over -expression of miRNA1, miRNA133, and miRNA499 or if the combination of two of these miRNA would result in a synergistic action, further increasing the efficiency of cardiac differentiation. [score:3]
After 14 days, Cx43 was significantly over-expressed in cells treated with miRNA133 or miRNA499 and cTnT was significantly higher in the miRNA499 group compared with naïve cells (Fig. 7A). [score:2]
At day 14, the over -expression of miRNA1 or miRNA133 alone or their combination did not increase the number of beating clusters compared with DMSO treatment (Fig. 1A). [score:2]
It has been shown that miRNA1 and miRNA133 are important regulators of embryonic stem cell (ESC) differentiation into CMC. [score:2]
naïve, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1; †, p < . [score:1]
To strengthen our observation, we aimed to test whether treatment with miRNA499 plus miRNA133 in the absence of DMSO exposure was sufficient to trigger cardiac differentiation. [score:1]
The treatment of EB with both pre-miRNA499 and pre-miRNA133 resulted in the strongest activation of the cTnI promoter (Fig. 1B). [score:1]
001), 4.1-fold versus miRNA133 alone (p < . [score:1]
Figure 7Amniotic mesenchymal stromal cells (AMSC) differentiation using miRNA499 and miRNA133 precursors. [score:1]
Figure 5MEA and twitch recordings of embryoid bodies treated with pre-miRNA499 together with pre-miRNA133. [score:1]
001), and miRNA133 (+2.7-fold; p < . [score:1]
It was impossible to document the same results using different combination of miRNAs, confirming that only the couple miRNA499/miRNA133 triggers the differentiation of MSC toward a cardiac-like phenotype. [score:1]
naïve, scramble miRNA, miRNA133, miRNA1 + 499 and p < . [score:1]
DMSO, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1, and p < . [score:1]
These data strongly suggest a synergistic effect of miRNA499 and miRNA133. [score:1]
In particular, miRNA133 seems more crucial in controlling cell proliferation by repressing serum response factor and cyclin D2 [17, 24]. [score:1]
In summary, we demonstrated that miRNA499 and miRNA133 act in a synergic manner inducing P19 differentiation into CMC even in the absence of DMSO. [score:1]
Therefore, the effect of miRNA499 and miRNA133 synergism on cardiogenic differentiation was further tested based on the notion that mature excitation-contraction coupling relies on the presence of Ryrs-operated intracellular Ca [2+] stores. [score:1]
Finally, functional analysis showed that the percentage of responsive EB grown without DMSO but transfected with pre-miRNA499 and pre-miRNA133 did not significantly differ from the percentage of EB grown in the presence of 0.5% DMSO (Fig. 6D). [score:1]
After 14 days, quantification of late cardiac-specific genes confirmed the synergistic effect exerted by miRNA499 and miRNA133 (Fig. 2C, 2D). [score:1]
DMSO and miRNA133; *, p < . [score:1]
DMSO, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1; †, p < . [score:1]
The Synergic Effect of miRNA499 and miRNA133 on AMSC. [score:1]
To verify whether miRNA499 and miRNA133 exert their effects also on other cell types, we tested our protocol on AMSC. [score:1]
DMSO, miRNA1 and miRNA133; ‡, p < . [score:1]
In particular, it has been clearly shown that miRNA133 and miRNA1 promote myoblast proliferation and differentiation, respectively, and that miRNA499 enhances the differentiation of cardiac progenitor cells into CMC [17– 20]. [score:1]
Although miRNA1 and miRNA133 are cotranscribed, the function of miRNA133 is different from miRNA1. [score:1]
naïve, scramble miRNA, miRNA1, miRNA133, and miRNA1 + 499; #, p < . [score:1]
After 4 days, the EB were transferred to plastic culture dishes in the presence of differentiation medium, and transfected with precursor molecules (pre-miRNA) for miRNA499 (PM11352, 10 nM), miRNA1 (PM10617, 10 nM), and miRNA133 (PM10413, 5 nM) in different combinations or with scrambled miRNA used as a negative CTRL (AM17110, 5 nM) (Supporting Information Table S1). [score:1]
Our results clearly showed that miRNA499 is a powerful activator of cardiac differentiation, particularly in comparison with miRNA1 and miRNA133. [score:1]
naïve, scramble miRNA, miRNA1, miRNA133, miRNA1 + 499 and p < . [score:1]
Furthermore, the spontaneous mechanical activity response of miRNA499 and miRNA133 transfected cells to modulators of Ca [2+] handling effectors (CaV, RyRs, and IP3R) is consistent with that expected for cardiac but not skeletal muscle. [score:1]
miRNA precursors were diluted in Opti-MEM I medium at the following concentration: miRNA1 and miRNA499 precursors 10 nM, miRNA133 precursor and scrambled miRNA 5 nM. [score:1]
In order to confirm the synergic action of miRNA499 with miRNA133, we tested this combination also in AMSC. [score:1]
The synergistic effect exerted by the combination of miRNA133 and miRNA499 was confirmed by activation of the cTnI cardiac-specific promoter (Fig. 1B). [score:1]
[1 to 20 of 60 sentences]
12
[+] score: 126
The result showed that miR-2 and miR-133 downregulated the luciferase activity by targeting the 3′-UTR of the cyclin B (Figure  5), indicating that miR-2 and miR-133 are involved in inhibiting the expression of the crab cyclin B gene. [score:10]
Thus we postulated that the high expression of miR-2 and miR-133 at MI arrest might be related to translation inhibition of the cyclin B. To test this hypothesis, the direct interactions between the miRNAs and their target sites of the crab cyclin B gene were examined using a luciferase 3′-UTR reporter assay. [score:9]
Further expression analysis using double-luciferase reporter genes assay showed that miR-2 and miR-133 can downregulate the 3′-UTRs of the crab cyclin B gene, indicating that they could inhibit the translation of the cyclin B. confirmed that cyclin B protein is completely disappeared in fertilized egg at the metaphase-anaphase transition of meiosis I, suggesting that miR-2 and miR-133 could function in destruction of cyclin B near the end of MI. [score:9]
These results indicated that miR-2 and miR-133 can downregulate the target gene expression by miRNA binding sites in the 3′-UTR of cyclin B. Figure 5 s of the miRNAs silence effects using pGL3/cyclin B 3′-UTR (A) and pGL3/cyclin B 3′-UTR mutant (B) reporter vectors. [score:8]
Furthermore, expression analysis revealed that miR-2 and miR-133 exhibited higher expression at MI arrest of meiosis and both of miR-2 and miR-133 can bind the 3′-UTR of the crab cyclin B, indicating that miR-2 and miR-133 is involved in the regulation of cyclin B expression during meiotic maturation of oocyte in the mitten crab. [score:8]
Although miR-2 and miR-133 displayed a higher expression at MI meiosis, no significant difference of the expression level was found for all the selected miRNAs including miR-2 and miR-133 in 24 hours post GnRH injection, indicating GnRH cannot induce expression of the miRNAs. [score:7]
This result strongly suggest that miR-2 and miR-133 are involved in regulating the expression of the cycin B at the transition from MI to anaphase of meiosis I, and that miRNAs might have not been globally suppressed during meiosis of the crab oocyte. [score:6]
After normalized against U6 snRNA, the relative expression level of miR-2 and miR-133 significantly increased at MI (Figure  4) whereas the other eight miRNAs exhibited stable expression from GV to MI among all the groups (data no shown). [score:5]
Surprisingly, no significant difference of the expression level was found for the both miRNAs tested in 24 hours (data no shown), indicating GnRH cannot induce expression of miR-2 and miR-133. [score:5]
miR-2 and miR-133, which were predicted to target the crab cyclin B gene, displayed high expression in MI arrest stage relative to GV stage. [score:5]
To further test whether the differential expression of miR-2 and miR-133 at MI results from the induction of GnRH, we examined the detail expression profile of miR-2 and miR-133 in a period of 24-hour after injection of GnRH. [score:5]
The result was confirmed by western blot analysis and, in which the crab cyclin B protein disappeared and cyclinB-cdc2 kinase activity sharply dropped to the basal level in fertilized eggs at the transition from MI to anaphase I of meiosis, supporting the notion that cyclin B could be a direct target for miR-2 and miR-133 and the degradation of cyclin B is required for the fertilized egg to exit from MI to anaphase I of meiosis. [score:4]
miR-2 and miR-133 exhibit differential expression during the meiotic maturation of the oocytes and have activity in regulating the 3′-UTR of the crab cyclin B gene. [score:4]
There must be other unknown mechanism for regulation of differential expression of miR-2 and miR-133 during oocyte maturation. [score:4]
The present study showed that two miRNAs (miR-2 and miR-133) exhibited significantly increased expression from GV to MI stage (Figure  4). [score:3]
GnRH can induce GVBD but has not effect on miR-2 and miR-133 expression. [score:3]
To determine whether there are direct interactions between miR-2, miR-133, miR-7, miR-79 and their target sites of the crab cyclin B gene, we used a luciferase 3′-UTR reporter assay to measure the inhibitory effects of these miRNAs. [score:3]
Luciferase reporter genes assay demonstrated that miR-2 and miR-133 have activity and can downregulate the 3′-UTRs of the cyclin B gene. [score:3]
To identify miRNAs differentially expressed during the crab oocyte maturation, the relative abundance of miR-2, miR-7, miR-79, miR-133 and other six selected miRNAs in the ovaries at GV and MI stages was assessed by quantitative real-time PCR. [score:3]
As shown in Figure  2, the 5′ seed sequences of miR-2, miR-7 miR-79 and miR-133 were revealed to be complementary to their corresponding target sites such as GY-box, Brd-box, and K-box in 3′-UTR of the crab cyclin B gene. [score:3]
Figure 4 Quantitative real-time PCR analysis of miR-2 (A) and miR-133 (B) expression in the ovaries of the mitten crab. [score:3]
Therefore, we inferred that the increased expression of miR-2 and miR-133 observed at MI was independent of GnRH injection. [score:3]
Figure 2 The potential miRNA target sites of miR-2, miR-7, miR-79 and miR-133 in the 3′-UTR of the crab cyclin B as detected by RNAhybrid [19]. [score:3]
miR-2 and miR-133 were revealed to have a role in the regulation of 3′-UTR of the crab cyclin B gene. [score:2]
miR-2 and miR-133 can regulate the 3′-UTR of the crab cyclin B gene. [score:2]
To verify whether the protein level of cyclin B drops during meiosis of oocytes, GV-, GVBD-oocytes and fertilized eggs were submitted to western blot analysis using an antibody against the crab cyclin B. The results showed that the crab cyclin B protein was present in GV- and GVBD-oocytes but disappeared in fertilized eggs at the time of transition from MI to anaphase of meiosis (Figure  6A), suggesting the potential role for the miR-2 and miR-133 in regulating the destruction of the cyclin B protein. [score:2]
The 5′ seed sequences of four miRNAs, miR-2, miR-7, miR-79 and miR-133, were revealed to complementary to miRNA binding sites in 3′-UTR of the cyclin B. Quantitative real time PCR analysis showed that miR-2 and miR-133 are much more abundant in the first metaphase (MI) of meiosis than in germinal vesicle (GV) stage. [score:1]
The miR-133 was identified with the smallest free energy value (Figure  2). [score:1]
Interestingly, many putative binding sites for miRNAs including miR-2 and miR-133 were found in 3′-UTR of the crab cyclin B transcript (Figure  3). [score:1]
After cotransfected HEK 293 T cells, miR-2 and miR-133 mimics significantly reduce the luciferase activity from the reporter construct containing the cyclin B 3′-UTR, whereas miR-7, miR-79 and negative control mimics have no effect on the luciferase activity (Figure  5A). [score:1]
[1 to 20 of 30 sentences]
13
[+] score: 124
mRNA as well as protein expression of several previously described direct miR-1 or miR-133a target molecules was analyzed in heart tissue of WT and respective single miR-1/133a cluster knock-out animals to validate the regulation of these targets in our in vivo mo dels. [score:10]
0113449.g004 Figure 4 mRNA as well as protein expression of several previously described direct miR-1 or miR-133a target molecules was analyzed in heart tissue of WT and respective single miR-1/133a cluster knock-out animals to validate the regulation of these targets in our in vivo mo dels. [score:10]
Of note Kcne1 was upregulated in both knock-out mo dels, however many other previously described miR-1 or miR-133a targets were not regulated after loss of roughly 50% miR-1 or miR-133a. [score:8]
In contrast the miR-133a target SRF is significantly upregulated in the heart of miR-1-1/133a-2 knock-out mice (B, D). [score:7]
Although the miR-133a target SRF was increased in miR-133a double mutant hearts [6], it was not increased in embryonic hearts after complete deletion of miR-1/133a [7], indicating that there are also developmental stage specific components modulating miRNA mediated regulation of target protein abundance. [score:7]
Unbiased transcriptome analysis did not reveal prominent changes in the expression of components of the adrenergic signaling cascade that may be target of miR-1 or miR-133a regulation (Table 2). [score:6]
At the protein level we observed upregulation of the miR-133a target gene SRF in the miR-1-1/133a-2 mutant mice, but not in the miR-1-2/133a-1 mutant mice (Figure 4B, D). [score:6]
However, complete deletion of both miR-133a copies from the genome reduced viability of newborn animals, led to increased proliferation of neonatal cardiomyocytes and ectopic expression of smooth muscle genes, an effect described to be mediated by the direct miR-133a target SRF [6]. [score:6]
Taken together, although we did not identify a single miR-1 or miR-133a target molecule responsible for the modulation of adrenergic signaling in our mo dels, numerous molecules related to this pathway are potential targets of miR-1/133a regulation. [score:6]
On the other hand, adenoviral overexpression [8] or increased expression of miR-1 or miR-133a in rabbit cardiomyocytes during chronic heart failure [9] have been linked to modulation of intracellular calcium release and promotion of arrhythmogenesis due to dysregulation of phosphatase activities. [score:6]
Previously we have shown that the clustered miRNAs miR-1 and miR-133a act as functional units, with miR-1 negatively regulating the abundance of myocardin that in turn enhances the expression of the miR-1/133a clusters by direct transcriptional activation [7]. [score:5]
We only found few transcriptional changes in molecules previously described to be direct targets of miR-1 or miR-133a regulation (Table 1). [score:5]
miRNA expression analysis demonstrates that expression of miR-1 and miR-133a is confined to cardiomyocytes (C). [score:5]
Reduction of miR-1 to approximately 70% (miR-1-2/133a mutants) or 40% (miR-1-1/133a-2 mutants) and concomitant miR-133a reduction revealed gradual regulation of several previously described miR-1/133a targets like Kcne1 [18] and connexin43 [39] and SRF [6]. [score:4]
Although several components of the adrenergic signaling cascade are potential direct targets of repression by miR-1 or miR-133a no particularly significant change in the abundance of these molecules in vivo or in isolated cardiomyocytes was detected. [score:4]
Indeed only after more than 50% reduction of mature miR-1 and miR-133a we observed a moderate impact on SRF expression and concomitant increase of few smooth muscle markers in the adult heart. [score:3]
Using northern blot analysis (Figure 1A) as well as qRT-PCR (Figure 1B) we demonstrate here tissue specific expression of miR-1 and miR-133a in adult heart, skeletal muscle and with reduced abundance in bladder. [score:3]
In summary, we suggest that modulation of components of adrenergic signaling regulating the action potential duration of cardiomyocytes might be subject to complex regulation by miR-1 and miR-133a. [score:3]
Indeed the rescue of the long QT-phenotype either by inhibition of the adrenergic signaling or by Verapamil -induced modulation of L-type calcium channel activity in vivo indicates that the miRNAs miR-1 and miR-133a modulate an important functional property of the heart (Figure 9). [score:3]
The miRNAs miR-1 and miR-133a are abundantly expressed in skeletal muscle. [score:3]
Of the 177 molecules analyzed to be related to adrenergic signaling 39 were predicted potential targets of miR-1 or miR-133a. [score:3]
This was different compared to a recent study using transgenic overexpression of miR-133 [34], but in line with our data that showed that there is no hypertrophic growth after loss of single miR-1/133a clusters [7] that could potentially be attributed to increased adrenergic signaling [28]. [score:2]
The miRNAs miR-1 and miR-133a are the most abundant miRNAs found in the heart and these miRNAs are encoded in two clusters in the genome. [score:1]
Deletion of miR-133a from the one or other genomic cluster did not cause an apparent phenotype [6]. [score:1]
Deletion of either miR-1/133a cluster resulted in significant reduction of miR-1 or miR-133a in the adult tissues. [score:1]
Northern blot (A) as well as quantitative RT-PCR (B) detected the miRNAs miR-1 and miR-133a in total RNA isolated from heart (ht), skeletal muscle (m. tibialis anterior) and bladder. [score:1]
Deletion of single miR-1/133a clusters led to a reduced abundance of miR-1 or miR-133a in the heart detected by northern blot (A) or qRT-PCR (D). [score:1]
Thus the miR-1/133a clusters and myocardin constitute a feedback-loop and myocardin activates transcription of smooth muscle-related genes, amongst others the potassium channel Kcnmb1 that on the other hand is repressed by miR-133a. [score:1]
5 µg of RNA were separated in a 15% denaturing polyacrylamide TBE-Urea gels (Invitrogen) and blotted to a Hybond-XL membrane (Amersham) that was subsequently hybridized with (γ-32P)ATP labeled miR-1 (ATACATACTTCTTTACATTCCA) or miR-133a (CAGCTGGTTGAAGGGGACCAAA) and U6 snRNA (ATATGGAACGCTTCACGAATT) probe diluted in ULTRAhyb buffer (Ambion) at 30°C overnight. [score:1]
The miR-1-1/133a-2 cluster on mouse chromosome 2 and the miR-1-2/133a-1 cluster on mouse chromosome 18 give rise to identical mature miR-1 or miR-133a molecules, respectively. [score:1]
0113449.g001 Figure 1 Northern blot (A) as well as quantitative RT-PCR (B) detected the miRNAs miR-1 and miR-133a in total RNA isolated from heart (ht), skeletal muscle (m. tibialis anterior) and bladder. [score:1]
[1 to 20 of 31 sentences]
14
[+] score: 109
We found that the expression of muscle miRNAs, including miR-1a, miR-133a and miR-206, was up-regulated in the skeletal muscle of mdx mice. [score:6]
miR-133 also inhibits the translation of polypyrimidine tract -binding protein (nPTB), which controls differential transcript splicing during skeletal-muscle differentiation [20]. [score:5]
Because the MCK promoter also directed miR-133a-1 overexpression in the heart, albeit at lower level, we determined whether heart development was affected in the transgenic mice. [score:5]
However, transgenic overexpression of miR-133a-1 in skeletal muscle did not result in a noticeable change in skeletal muscle development and morphogenesis. [score:4]
We have previously reported that the expression of muscle-specific miR-1 and miR-133 is induced during skeletal muscle differentiation and miR-1 and miR-133 play central regulatory roles in myoblast proliferation and differentiation in vitro. [score:4]
Transgenic overexpression of miR-133a-1 in the skeletal muscle. [score:3]
Genomic DNA from mouse chromosome 18 encoding the miR-133a-1 gene was inserted into an expression vector (Figure 2A). [score:3]
Total RNAs were isolated from indicated tissues, and the overexpression of miR-133a-1 was clearly detected in the skeletal muscle, and to a much less extent, the cardiac muscle, but not in the liver of transgenic mice (Figure 2C, D). [score:3]
Furthermore, miR-1 and miR-133 are also important regulators of cardiomyocyte differentiation and heart development [22- 24]. [score:3]
The overexpression of miR-133a-1 in germline-transmitted stable transgenic mice was confirmed by Northern blot analyses. [score:3]
We found that the expression miR-133a, together with that of miR-206 and miR-1a, was induced in the skeletal muscle of mdx mice. [score:3]
We also generated transgenic mice to overexpress miR-133a in skeletal muscle. [score:3]
We found that the expression levels of miR-1, miR-133 and miR-206 were higher in the skeletal muscle of one month-old mdx mice (Figure 1A). [score:3]
However, in the current study, we did not observe any overt muscle defect in mice expressing the MCK-miR-133a-1 transgene. [score:3]
A subset of miRNAs, miR-1, miR-133, miR-206 and miR-208, are either specifically or highly expressed in cardiac and skeletal muscle and are called myomiRs [6, 7, 13]. [score:3]
Among them, miR-133 was shown to promote the proliferation of myoblasts and inhibits their differentiation in cultured skeletal muscle myoblasts. [score:3]
Additionally, embryonic stem (ES) cell differentiation towards cardiomyocytes is promoted by miR-1 and inhibited by miR-133 [22]. [score:3]
Together, these data suggest that miR-133a is dispensable for the normal development and function of skeletal muscle. [score:2]
Surprisingly, skeletal muscle development and function appear to be unaffected in miR-133a transgenic mice. [score:2]
Analysis of mice that lost either miR-133a-1 or miR-133a-2 revealed that both miRNAs are dispensable for development or viability under normal physiological conditions. [score:2]
Recently, miR-133 genes (miR-133a-1 and miR-133a-2) were knocked out from the mouse genome. [score:2]
Our study therefore suggests that miR-133a is dispensable for skeletal muscle development. [score:2]
Paradoxically, miR-1 and miR-133 exert opposing effects to skeletal-muscle development despite originating from the same miRNA polycistronic transcript. [score:2]
Normal skeletal muscle development in miR-133 transgenic mice. [score:2]
In this study, we demonstrate that miR-133a is dispensable for the normal development and function of skeletal muscle. [score:2]
Additional analyses indicated that skeletal muscle development and function were not altered in miR-133a-1 transgenic mice. [score:2]
Figure 3 Normal cardiac and skeletal muscle development in miR-133a transgenic mice. [score:2]
Our results indicate that miR-133a is dispensable for the normal development and function of skeletal muscle. [score:2]
In order to further analyze muscle development, skeletal muscle from the diaphragms of six month old miR-133a-1 transgenic mice was collected and examined by tissue histology (n = 4). [score:2]
miR-133 enhances myocyte proliferation, at least in part, by reducing protein levels of SRF, a crucial regulator for muscle differentiation [18, 19]. [score:2]
As shown in Figure 4, hematoxylin and eosin (H&E) staining of diaphragms indicated that the tissue thickness, muscle cell size and numbers were comparable between miR-133a-1 transgenic mice and the control wild type mice. [score:1]
Figure 5 Histology of skeletal muscle from wild type and miR-133a transgenic mice. [score:1]
Similarly, we examined the skeletal muscle of the extensor digitorum longus (EDL) from six month old of both miR-133a-1 transgenic and wild type control mice (n = 4). [score:1]
Briefly, 20 μg of total RNAs isolated from skeletal muscle of 1 month old mdx and the control mice (Figure 1), or from the heart, skeletal muscle and liver tissues of miR-133a-1 transgenic and the control mice (Figure 2), were used and miRNA oligonucleotides with corresponding miRNAs (miR-1a, miR-133a and miR-206) sequences were used as probes. [score:1]
In order to further investigate the function of miR-133 in vivo, we took a gain-of-function approach and generated transgenic mice to overexpress miR-133a-1 in skeletal muscle. [score:1]
There was not difference in skeletal muscle formation or body fat deposit between miR-133a-1 transgenic mice and their littermate controls (Figure 3C, D). [score:1]
The MCK-miR-133a-1 transgenic construct was injected into fertilized mouse eggs and multiple transgenic founder lines were obtained, as verified by PCR genotyping (Figure 2B). [score:1]
H&E staining suggested that there was no difference in skeletal muscle morphology between miR-133a-1 transgenic mice and their control littermates (Figure 5A). [score:1]
Hematoxylin and eosin (H&E) staining for skeletal muscle tissue sections of diaphragm from 6 month old wild type (Wt) and miR-133a transgenic mice (MCK-miR-133). [score:1]
We used the well-characterized muscle creatine kinase (MCK) promoter to drive miR-133a-1 expression in skeletal muscle (and to a less extend, cardiac muscle). [score:1]
Our results are consistent with a recent report in which miR-133 loss-of-function mice did not induce overt defects in skeletal muscle [24]. [score:1]
Among them, miR-1, miR-133, miR-206, miR-208 and miR-499 have been described as muscle specific miRNAs, or myomiRs [6, 13]. [score:1]
All miR-133a-1 transgenic mice were viable and fertile without overt abnormality (Figure 3A, B). [score:1]
In this study, we attempted to determine the function of miR-133 in skeletal muscle. [score:1]
Interestingly, miR-1 and miR-133 also produce opposing effects on apoptosis [21]. [score:1]
The miR-133a-1 transgenic construct was injected into the pronuclei of C57/Bl6 X C3H hybrid embryos and implanted into pseudo-pregnant recipient females by the University of North Carolina Animal Mo dels Core. [score:1]
However, our results showed that there was no difference in the gross morphology of the adult hearts of miR-133a-1 transgenic mice and wild type controls (Figure 3E, F). [score:1]
Figure 2 Generation of miR-133a transgenic mice. [score:1]
We employed a gain-of-function approach and generated transgenic mice to overexpress miR-133a-1 in skeletal muscle, using the well-characterized muscle creatine kinase (MCK) promoter. [score:1]
The body weight and size between wild type and miR-133a-1 transgenic adult mice (ages from 2 to 12 months) were indistinguishable (n = 40, data not shown). [score:1]
Figure 4 Histology of skeletal muscle from diaphragm of wild type and miR-133a transgenic mice. [score:1]
Surprisingly, we found that miR-133a-1 transgenic mice appear to be normal. [score:1]
In order to generate miR-133a-1 transgenic mice, a genomic fragment encoding the precursor and franking sequences of the miR-133a-1 gene, which is located on mouse chromosome 18, was amplified by PCR using mouse genomic DNA as a template. [score:1]
[1 to 20 of 53 sentences]
15
[+] score: 108
We observed that approximately 1/10 of the recently identified 578 miRNAs are highly expressed in the mouse heart; SRF overexpression in the mouse heart resulted in altered expression of a number of miRNAs, including the down-regulation of mir-1 and mir-133a, and up-regulation of mir-21, which are usually dysregulated in cardiac hypertrophy and congestive heart failure [3, 13- 16]. [score:14]
In conclusion, our current study demonstrates that cardiac-specific overexpression of SRF leads to altered expression of cardiac miRNAs, especially the down-regulation of miR-1 and miR-133a, and up-regulation of miR-21, the dysregulation of which is known to contribute to cardiac hypertrophy. [score:12]
Real-time RT-PCR analysis revealed that mildly reduced SRF resulted in the down-regulation of miR-21 expression, but up-regulation of both miR-1 and miR-133a (Figure 5A). [score:9]
As shown in Figure 6, when pri-mir-1-1 and pri-mir-1-2 transcripts were down-regulated, so was miR-1 mature form; when pri-mir-133a1 and pri-mir-133a2 transcripts were down-regulated, the same was true for miR-133a mature form. [score:7]
Reducing cardiac SRF level using the antisense-SRF transgenic approach led to the expression of miR-1, miR-133a and miR-21 in the opposite direction to that of SRF overexpression. [score:6]
The up-regulation of miR-21, and the down-regulation of miR-1 and miR-133a were observed in SRF-Tg compared to wild-type (WT) mouse heart (P < 0.01**, n = 3). [score:6]
Our findings demonstrate for the first time that it is possible to regulate at the same time the expression of three miRNAs, miR-1, miR-133a and miR-21, through targeting the components of SRF -mediated signaling pathway. [score:6]
Interestingly, the down-regulation of miR-21, but up-regulation of miR-1 and mir-133a were observed in Anti-SRF-Tg compared to wild-type mouse heart (p < 0.01**, n = 3). [score:6]
When the mouse cardiac SRF level was reduced using the antisense-SRF transgenic approach, we observed an increase in expression of miR-1 and miR-133a miRNA, and a decrease in expression of miR-21. [score:5]
miR-1 ranks number 1 in expression, miR-133a ranks number 7 in expression. [score:5]
Our data revealed that the down-regulation of miR-1 correlates closely with that of miR-133a in the SRF-Tg at various time points from 7 days to 6 months of age (Figure 7B). [score:4]
Mir-1 and mir-133a are down-regulated in cardiac hypertrophy and cardiac failure, suggesting that they may play a role in the underlying pathogenesis [14, 43]. [score:4]
The down-regulation of miR-1 correlates closely with that of miR-133a in SRF-Tg at various time points from 7 days to 6 months of age (p < 0.05, n = 3 for all time points, except n = 6 for miR-21 at 6 months). [score:4]
The expression levels of miR-1, miR-133a and miR-21 were observed to be in the opposite direction with reduced cardiac SRF level in the Anti-SRF-Tg mouse. [score:4]
These findings suggest that SRF may regulate these two miRNAs at the level of polycistronic transcription, rather than at each individual miRNA (pri-mir-1 or pri-mir-133a) transcription, thereby keeping the expression of both miRNAs closely correlated. [score:4]
Another important miRNA, mir-133a, was ranked number seven in terms of level of expression. [score:3]
In addition, serum response factor (SRF), an important transcription factor, participates in the regulation of several cardiac enriched miRNAs, including mir-1 and mir-133a [4, 6]. [score:2]
Similarly, the mature miR-133a is derived from both mir-133a1 gene (on chromosome 18) and mir-133a2 gene (on chromosome 2). [score:1]
It is plausible that increasing mir-1 and mir-133a level at a specific time point may have potentially beneficial effects against the pathological conditions. [score:1]
The mouse pri-mir-1-1 and pri-mir-133a-2 are transcribed into a polycistronic transcript that is 10 kb in length, and the pri-mir-1-2 and pri-mir-133a-1 are transcribed into another polycistronic transcript that is 6 kb in length [42]. [score:1]
Both miR-1 and miR-133a are produced from the same polycistronic transcripts, which are encoded by two separate genes in the mouse and the human genomes [42]. [score:1]
Both guide strand and passenger strand (*) of mir-133a are decreased in SRF-Tg vs. [score:1]
Matkovich et al reported that an increase of mir-133a level in the postnatal heart has beneficial effects against cardiac fibrosis after transverse aortic constriction [44]. [score:1]
Generally, the pri-miRNA transcript contains one miRNA (e. g pri-mir-21), but it can also contain more than one miRNAs (e. g. mir-1 and mir-133a). [score:1]
[1 to 20 of 24 sentences]
16
[+] score: 83
miR-1 and miR-206 promoted differentiation of myoblasts through downregulation of HDAC4 and the p180 subunit of DNA polymerase alpha, while miR-133 promoted proliferation through downregulation of serum response factor (SRF) in C2C12 cells (11– 13). [score:7]
miR-133a represses IGF-1R expression and signaling pathway during skeletal myogenesis (15), suggesting it may be a potential therapeutic target in muscle diseases. [score:7]
A reduction in miR-1a expression in soleus of HFD-fed animals was observed, and, particularly, miR-133a was upregulated after 12 weeks of HFD compared to control mice. [score:5]
IGF-1 mRNA and IGF-1 signaling via Igf-1R were impaired in soleus muscle of 12 weeks HFD-fed mice compared to that from control mice at the same time miR-133a expression was upregulated; suggesting miR-133a is mainly involved with IGF-1/IGF-1R/PI3K/AKT/Mtor signaling pathway. [score:5]
This pattern of expression is consistent with an increase of miR-133a levels (Figure 2A), which has Igf-1R as target (15). [score:5]
miR-1a, miR-133a, and miR-206 are specifically induced during myogenesis (49) and myogenic transcription factors, such as MyoD, Myf5, Myog, and Mef2, mediate upregulation of these miRNAs (49– 51). [score:4]
Downregulation of miR-1, miR-206, and miR-133 levels has been reported in white adipocytes (41) and in gastrocnemius muscle (42) of DIO mice and in vastus lateralis (43) and plasma (44, 45) of type 2 diabetic patients. [score:4]
In conclusion, as summarized in Figure 6, we provided for the first time data indicating decreased myogenesis in oxidative skeletal muscle of insulin-resistant mice due to dysregulation in expression of myomiRs, mainly miR-1a and miR-133a. [score:4]
Other variables used in the mo del were miR-1a (correlated to glycemia) and miR-206 (correlated to miR-1a levels), and miR-133a, Rheb, Igf-1, Mtor, and Mstn mRNAs expression, and gastrocnemius weight, because they were significantly associated to IR progression. [score:3]
Type 2 diabetes negatively affects skeletal muscle function and mass, which may be a result of increased miR-133a expression together with low Igf-1 in skeletal muscle. [score:3]
Among putative miR-1a, miR-206, and miR-133a targets, IGF-1, IGF-1R, and FSTL1 were already validated (15, 16, 52). [score:3]
Muscle-specific miRNAs, miR-1a, miR-133a, and miR-206, are recognized as important regulators of skeletal muscle development (10). [score:3]
Ectopically overexpression of miR-133 in C2C12 cells reduces IGF-1-stimulated phosphorylation of Akt at Serine-473, the Akt activation site (15), which mediates IGF-1 anabolic and anti-catabolic effects due via mTOR by inactivation of Foxo3. [score:3]
Therefore, our data suggest increased miR-133a expression may be responsible for impaired induction of protein synthesis signaling in obese mice. [score:3]
Feedback circuits in which miR-1a and miR-133a control the level of IGF-1, that in turn regulates miR-1a and miR-133a, have been described during skeletal muscle development (15, 16). [score:3]
Two-way ANOVA revealed an interaction of period of time studied and diet only in miR-133a expression (Figure 2A). [score:3]
Due to the fact that myomiRs are strongly associated to myogenesis and myomiR targets are involved in IGF-1/PI3K/AKT/MTOR pathway, we postulated that decreases in miR-1a and increases in miR-133a levels could be associated with decreased myogenesis in skeletal muscles of insulin-resistant mice. [score:3]
Figure 2 Time-course of muscle-specific microRNAs miR-133a (A), miR-1a (B), and miR-206 (E) expression in soleus muscle of high-fat diet (HFD) and control diet (CD)-fed mice. [score:3]
Different from control mice, animals on HFD showed an increase by twofold of miR-133a expression in soleus muscles after 12 weeks (Figure 2A). [score:3]
Increased expression of miR-133a (after 12 weeks of HFD feeding) was associated to transcriptional repression of IGF-1R and PI3K/AKT pathway in skeletal muscle of DIO mice. [score:3]
miRNA expression was then performed by the Taqman Real-time PCR method using the cDNA 15× diluted, 2× TaqMan Universal PCR master mix, and miRNA assays from Life Technologies: snoRNA-202 (001232), hsa-miR-1 (002222), hsa-miR-133a (002246), and hsa-miR-206 (000510). [score:2]
Therefore, miR-1a may be a candidate for an early marker for increments on glycemia and miR-133a for skeletal muscle wasting in diabetic subjects. [score:1]
Regardless of improving insulin sensitivity, pioglitazone could not restore miR-1a, miR-133a, or miR-206 levels in soleus muscles (Figure 5). [score:1]
We evaluated the evolution of the expression of miR-1a, miR-133, and miR-206 in mice fed a HFD for 4, 8, or 12 weeks. [score:1]
Muscle-specific miRNAs (e. g., miR-1a, miR-133a, and miR-206) have been reported to play critical role in myogenesis. [score:1]
[1 to 20 of 25 sentences]
17
[+] score: 82
Brackets denote sequences used as miRNA mimics in panels D and E. (B) Venn diagrams indicate number and overlap of predicted mRNA targets (Targetscan) for canonical and +1 5′ isomiR variants of miR-133a (top: all predicted targets, bottom: only targets with roles in cardiovascular disease (Ingenuity; #: significant enrichment of gene function term, p<0.01). [score:11]
For example, the MyomiRs miR-208a, -208b and -499 control myosin heavy chain isoform expression [4], miR-133a and miR-1 are crucial regulators of cardiac differentiation and development [1] and miR-195 overexpression is sufficient to induce hypertrophy in mice, while ablation of miR-208a is protective [5]. [score:7]
Expression of 5′ isomiRs can alter the target spectrum of miR-133a. [score:5]
To experimentally test if the 5′ isomiRs of miR-133a can have different targeting properties in vivo, we created two luciferase reporter constructs, each carrying three copies of a different predicted miR-133a target site in their 3′ UTR (Figure 3C). [score:5]
We then focused on abundant 5′ isomiRs and directly demonstrated potential for differential mRNA targeting for two 5′ isomiRs of the key cardiac regulator miR-133a. [score:5]
Thus, mRNA target predictions for major 5′ start site variants of miR-133a suggested convergent biological function at least in part through divergent target spectra. [score:5]
We used the respective seed sequences (base 2–8) of the miR-133a 5′ isomiRs to predict mRNA targets using TargetScan (Figure 3B). [score:5]
miR-133a, a miRNA crucial to cardiac development and associated with a number of cardiac pathologies [1], served as an example here of a miRNA with an array of different sequence variants and demonstrated differential targeting properties of its two major 5′ isomiRs (Figure 3). [score:4]
We further showed that two prevalent 5′ isomiRs of miR-133a can have different targeting properties in vivo, directly demonstrating the biological relevance of miRNA sequence variants. [score:4]
Importantly, we present here a direct experimental validation of differential mRNA targeting by 5′ isomiRs using the example of miR-133a (Figure 3). [score:4]
isomiRs of miR-133a with different targeting properties. [score:3]
Interestingly, alteration to the 3′ end of miR-133a mimics did not affect the level of mRNA repression, suggesting that in this instance the 3′ end is not essential for efficient target binding. [score:3]
Addressing this issue experimentally, we have also been able to provide proof-of-principle evidence for alternative mRNA targeting by the major canonical and major 5′ isomiR variants of miR-133a in living cells. [score:3]
This revealed pronounced preferential targeting by each variant such that there was significantly greater repression of the Ctgf reporter by canonical miR-133a than the isomiR, and vice versa for the Pgam construct (Figure 3D). [score:3]
These sites were derived from two experimentally demonstrated targets of the miR-133a locus, the Ctgf and Pgam1 mRNAs [48]. [score:3]
We saw expression of 5′ isomiRs from both strands of the hairpin (a prevalent 5′ isomiR of miR-133a* is shown in Figure 2F), and we next focussed on mature miR-133a. [score:3]
The reporters were transiently transfected into HeLa cells together with synthetic RNA mimics of the two most abundant mature miR-133a variants, a canonical 5′ start site variant of 23 nt (can/23 nt) and a +1 5′ isomiR of 22 nt (iso/22 nt; Figure 3A), or a mimic of an unrelated miRNA. [score:1]
Base pairing potential between sites and miR-133a isomiRs is also shown. [score:1]
In mammals it is known that miR-133a 5′ isomiRs can be derived from two identical genomic loci, named miR-133a-1 and miR-133a-2, and thus these isomiR proportions are not likely due to processing differences of individual loci [22]. [score:1]
Northern blots of HL-1 cell total RNA were probed for miR-301a, as well as miR-133a and miR-145 for reference (top panel). [score:1]
0030933.g003 Figure 3(A) Major mature miR-133a species and their abundance in HL-1 cardiomyocytes. [score:1]
In addition to tags with the canonical 5′ start position, we detected a highly abundant +1 5′ isomiR of 50.1 % and 53.9% of mature miR-133a tags in HL-1 cells and the heart, respectively (Figure 3A), similar to that seen in the heart on another sequencing platform [22]. [score:1]
Given that the two mimics chosen varied in length (22 versus 23 nt), we tested two further mimics representing the respective other length for each miR-133a variant (can/22 nt and iso/23 nt) and found that repression did not depend on mimic length within this range or vary significantly between different 3′ end sites (Figure 3E). [score:1]
For example, 83% and 96% of miR-133a* tags were contributed by a -1 5′ isomiR in the HL-1 and heart biopsy datasets, repectively. [score:1]
miR-133a is known to have key roles in cardiac biology [45], [46], [47] and its example further illustrates the diversity of hairpin precursor processing. [score:1]
[1 to 20 of 25 sentences]
18
[+] score: 80
Ssc-miR-103 and ssc-miR-107 expression was slightly lower in premolars (Dpm) than in other types of teeth, ssc-miR-133a and ssc-miR-133b expression was much higher in Dpm than in other types of teeth, and ssc-miR-127 expression gradually increased from the incisor (Di) to the molar (Dm) In order to detect the oral developmental specificity of the five selected miRNAs, we further extracted kidney, liver and submandibular gland to contrast the five miRNAs expression (Fig.   5). [score:10]
Ssc-miR-103 and ssc-miR-107 expression was slightly lower in premolars (Dpm) than in other types of teeth, ssc-miR-133a and ssc-miR-133b expression was much higher in Dpm than in other types of teeth, and ssc-miR-127 expression gradually increased from the incisor (Di) to the molar (Dm)In order to detect the oral developmental specificity of the five selected miRNAs, we further extracted kidney, liver and submandibular gland to contrast the five miRNAs expression (Fig.   5). [score:10]
For example, hsa-miR-133a, hsa-miR-200b, hsa-miR-206, and hsa-miR-218 were considered as tooth tissue-specific miRNAs [4]; eight differentially expressed miRNAs were expressed during morphogenesis and seven were expressed in the incisor cervical loop containing the stem cell niche [1]; the three most highly expressed microRNAs in dental epithelium were identified as mmu-miR-24, mmu-miR-200c, and mmu-miR-205, while mmu-miR-199a-3p and mmu-miR-705 were found in dental mesenchyme [2]; and miR-200 was suggested to play an important role in the formation of incisor cervical loop during stem cell–fueled incisor growth [5]. [score:8]
We also found that expression levels of ssc-miR-103 and ssc-miR-107 were slightly lower in Dpm than in other types of teeth, ssc-miR-133 a and ssc-miR-133b expression levels were much higher in Dpm than in other types of teeth, and ssc-miR-127 expression increased in Di, Dc, Dpm, and Dm, in that order. [score:7]
In our study, they were also broadly expressed in all types of teeth at nearly every stage, but the complete lack of expression of ssc-miR-103 and ssc-miR-107 in Dpm during E40 and E50 is worthy of attention, as this could indicate that they exist in bidirectional antagonism with ssc-miR-133a and ssc-miR-133b during premolar morphogenesis in large animal species. [score:6]
Of the five differentially expressed miRNAs that we identified, miR-133 (miR-133a and miR-133b), which is specifically expressed in muscles, is classified as a myomiRNA and is necessary for proper skeletal and cardiac muscle development and function [18]. [score:6]
Combined with the results of our current study, which showed that these two isomiRs are distinctly expressed in Dpm during E60 (late bell stage), we have reason to believe that ssc-miR-133a and ssc-miR-133b may be differentially expressed miRNAs in multiple pathways involved in bicuspid teeth morphogenesis. [score:5]
Both ssc-miR-133a (Fig.   6G1–I4) and ssc-miR-133b (Additional file 6D1–F4) were strongly expressed in the epithelium and mesenchyme of Dpm, in contrast with the other three potentially differentially expressed miRNAs. [score:5]
At E50, miR-133a expression in all four types of teeth stayed nearly the same, but with a lower signal in the incisor (H1–H4). [score:3]
In another study, mmu-miR-133a and mmu-miR-133b were found to be highly expressed at E13.5 in the mouse molar [3]. [score:3]
Expression levels of five miRNAs (ssc-miR-103, ssc-miR-107, ssc-miR-127, ssc-miR-133a, and ssc-miR-133b) were detected by real-time RT-PCR and microarray chip. [score:3]
The present study indicated that these five miRNAs, including ssc-miR-103 and ssc-miR-107, ssc-miR-133a and ssc-miR-133b, and ssc-miR-127, may play key regulatory roles in different types of teeth during different stages and thus may play critical roles in tooth morphogenesis during early development in miniature pigs. [score:3]
We then predicted that the miR-103, and miR-107, miR-133a, and miR-133b isomiRs would be differentially expressed miRNAs. [score:3]
Microarray, real-time RT-PCR, and in situ hybridization experiments revealed that ssc-miR-103 and ssc-miR-107, ssc-miR-133a and ssc-miR-133b, and ssc-miR-127 may play more important roles in Di and Dc, Dpm, and Dm, respectively, during different developmental stages. [score:2]
We also suggested in a previous study that ssc-miR-133 may play key roles in miniature pigs’s tooth development [7]. [score:2]
MiR-133 is one of tissue-specific miRNAs in tooth germ [4], and in Michon’s miRTooth1.0 Database (http://bite-it. [score:1]
For ssc-miR-133a and ssc-miR-133b, we chose the second deciduous premolar to contrast with the three kinds of tissues. [score:1]
This suggests that ssc-miR-133a and ssc-miR-133b may play more important roles in the early morphogenesis of premolar. [score:1]
By clustering analysis, we predicted 11 unique miRNA sequences that belong to mir-103 and mir-107, mir-133a and mir-133b, and mir-127 isomiR families. [score:1]
[1 to 20 of 19 sentences]
19
[+] score: 79
Quantitative PCR assessment revealed that expression levels of serum miR-1 and miR-133a were directly associated with myocardial steatosis, independently of potential confounding factors. [score:4]
Kuwabara Y Increased microRNA-1 and microRNA-133a levels in serum of patients with cardiovascular disease indicate myocardial damageCirc Cardiovasc Genet. [score:3]
Chen S Cardiac miR-133a overexpression prevents early cardiac fibrosis in diabetesJ Cell Mol Med. [score:3]
We observed an increase in miR-1 and miR-133a expression in the in vitro mo del of lipid -loaded cardiomyocytes. [score:3]
Second, increased levels of circulating miR-1 and miR-133a in patients with cardiovascular disease have been previously linked to myocardial ischemia and/or damage 32, 33. [score:3]
In the context of diabetes, the expression of miR-1 and miR-133a are reduced in mouse and rat mo dels of streptozotocin -induced type 1 diabetes 47, 52, 53. [score:3]
Cardiac-specific miR-133a overexpression has also been shown to prevent early cardiac fibrosis in diabetic mice [47]. [score:3]
We observed increased expression of miR-1 (2.4-fold and 2.6-fold for 50 and 100 μg/mL, respectively) and miR-133a (1.3-fold and 1.6-fold for 50 and 100 μg/mL, respectively) after exposure to lipoproteins as compared with control conditions. [score:2]
Here, we found a direct association between myocardial steatosis and serum miR-1 and miR-133a levels in type 2 diabetes patients and in a murine mo del of insulin resistance, even with verified absence of clinically evident myocardial ischemia and/or damage. [score:2]
As shown, in Fig.   1B, we observed a direct association between myocardial steatosis and circulating miR-1 and miR-133a. [score:2]
First, our results show that miRNAs transcribed at the same clusters, such as miR-1 and miR-133a, could be regulated in parallel, at least in response to neutral lipid overaccumulation. [score:2]
Future simplification of the miRNA methodology could allow the development of blood test based on serum miR-1 and miR-133a levels as a non-invasive tool to improve the detection, prediction, and monitoring of cardiac-related complications in the early stages of diabetes. [score:2]
Circulating miR-133a levels were directly associated with plasma triglyceride concentration (β = 0.263, P = 0.041). [score:2]
Univariate analysis (mo del 1) revealed a direct association between circulating levels of miR-1 (β = 0.360, P = 0.006) and miR-133a (β = 0.335, P = 0.008), but not miR-133b (β = 0.157, P = 0.198). [score:2]
Feng B Chen S George B Feng Q Chakrabarti S miR133a regulates cardiomyocyte hypertrophy in diabetesDiabetes Metab Res Rev. [score:2]
Our clinical and in vivo findings suggest that lipid oversupply to the myocardium may underlie the observed alterations in serum miR-1 and miR-133a levels. [score:1]
Circulating cardiomyocyte-enriched miR-1 and miR-133a are released by HL-1 cardiomyocytes following intracellular neutral lipid accumulation. [score:1]
Circulating cardiomyocyte-enriched miR-1 and miR-133a levels are independent predictors of myocardial steatosis in patients with type 2 diabetes. [score:1]
Univariate and multivariate logistic regressions were analysed to explore the association between serum levels of miR-1 and miR-133a, and myocardial steatosis as outcome. [score:1]
The close association between myocardial steatosis and circulating miR-1 and miR-133a in our population of patients with well-controlled type 2 diabetes levels may be explained, at least in part, by the overaccumulation of neutral lipids in cardiomyocytes. [score:1]
miRNAs play a critical role the cellular response to physiologic and pathophysiologic stress [42], and several studies have demonstrated a role for both miR-1 and miR-133a in cardiac function 43– 45. [score:1]
Adjustment for different clinical, biochemical, metabolic or cardiac parameters had no effect on the association between myocardial steatosis content and circulating miR-1 or miR-133a levels (P < 0.010 for all mo dels). [score:1]
A near-significant association was also observed between miR-133a and HDL-C (β = −0.213, P = 0.099). [score:1]
In mo del 2, myocardial steatosis was entered as a dependent variable and age, visceral fat volume, non-HDL-cholesterol, plasma TG, and miR-1 or miR-133a levels were subsequently entered as independent variables. [score:1]
Myocardial levels of miR-1 and miR-133a were similar in both groups (Fig.   2D). [score:1]
Taken together, our findings suggest that miR-1 and miR-133a are robust predictors of myocardial steatosis in type 2 diabetes. [score:1]
In agreement with previous findings, VLDL+IDL dose -dependently induced the release of miR-1 (27.5-fold and 33.9-fold increases for 50 and 100 μg/mL, respectively) and miR-133a (11.4-fold and 12.6-fold increases for 50 and 100 μg/mL, respectively) from HL-1 cells into the culture medium (Fig.   3B). [score:1]
These findings strengthen the clinical applicability of circulating miR-1 and miR-133a as biomarkers of myocardial steatosis in type 2 diabetes patients. [score:1]
Furthermore, we could not discard that other types of cardiac stress, beyond neutral lipid accumulation, could induce the secretion of miR-1 and miR-133a from cardiomyocytes. [score:1]
The highest area under the ROC curve (AUC) was observed for the mo del containing the clinical parameters and both miR-1 and miR-133a [AUC (95% CI) = 0.783 (0.654–0.912) for mo del 1; 0.866 (0.765, 0.967) for mo del 2; 0.825 (0.710–0.940) for mo del 3; 0.883 (0.793–0.972) for mo del 4]. [score:1]
Sensitivity and specificity were 73.7% and 74.2%, for mo del 1, 78.9% and 71.0% for mo del 2, 78.9% and 74.2% for mo del 3 and 78.9% and 77.4% for mo del 4. Levels of circulating cardiomyocyte-enriched miR-1 and miR-133a are increased in an in vivo mouse mo del of high-fat diet -induced insulin resistanceTo validate the association between myocardial neutral lipid accumulation and circulating cardiomyocyte-enriched miR-1 and miR-133a levels, we tested our clinical findings in an animal mo del of insulin resistance induced by a high-fat diet. [score:1]
Our results indicated that miR-1 and miR-133a levels in the systemic circulation may reflect not only myocardial ischemia/damage as previously proposed by other authors [32], but also active responses of cardiomyocytes to stressful conditions. [score:1]
Sensitivity and specificity were 73.7% and 74.2%, for mo del 1, 78.9% and 71.0% for mo del 2, 78.9% and 74.2% for mo del 3 and 78.9% and 77.4% for mo del 4. To validate the association between myocardial neutral lipid accumulation and circulating cardiomyocyte-enriched miR-1 and miR-133a levels, we tested our clinical findings in an animal mo del of insulin resistance induced by a high-fat diet. [score:1]
Neither miR-1, nor miR-133a were detected in the VLDL+IDL preparations added to HL-1 cardiomyocytes. [score:1]
Indeed, miR-133a-containing exosomes secreted by the H9C2 cardiomyoblast cell line are both transferable and functional [32]. [score:1]
miR-1, miR-133a, and miR-133b levels were below the limit of detection in 22.2%, 13.9%, and 4.2% of patients, respectively. [score:1]
To do that, we analysed four logistic regression mo dels: (i) mo del 1: clinical variables statistically associated, or close to be statistically associated, with myocardial steatosis, including age, plasma fasting glucose, visceral fat volume, non-HDL-cholesterol and plasma triglyceride; (ii) mo del 2: mo del 1 + miR-1; (iii) mo del 3: mo del 1 + miR-133a; (iv) mo del4: mo del 1 + miR-1 + miR-133a. [score:1]
Figure 1(A) Quantification by RT-qPCR of serum miR-1 and miR-133a levels in patients with uncomplicated type 2 diabetes in tertiles 1 and 2 (low-intermediate levels; N = 48) or 3 (high levels; N = 24) of myocardial steatosis. [score:1]
The present study demonstrates for the first time that serum levels of cardiomyocyte-enriched miR-1 and miR-133a are predictors of myocardial steatosis in patients with well-controlled and uncomplicated type 2 diabetes of short duration. [score:1]
Circulating miR-1 and miR-133 levels have been consistently associated with conditions such as acute coronary syndrome 16, 32, 33, 40, hypertrophic cardiomyopathy [19], and Takotsubo cardiomyopathy [18]. [score:1]
The fact that miR-1 and miR-133a were poorly associated with other clinical, biochemical, metabolic, hemodynamic, and cardiac parameters in regression mo dels supports the hypothesis that these miRNAs are independent predictors of myocardial steatosis. [score:1]
Type 2 diabetes patients in the third tertile of myocardial steatosis (high levels) showed a higher level of circulating miR-1 and miR-133a than those tertiles 1 and 2 (low-intermediate levels) (Fig.   1A). [score:1]
Quantitative miRNA analysis was restricted to cardiomyocyte-enriched miRNAs: miR-1, miR-133a/b, miR-208a/b, and miR-499. [score:1]
Furthermore, miR-133a levels were higher in patients with uncomplicated type 2 diabetes than in matched healthy subjects, thus paralleling the alterations observed in myocardial steatosis content. [score:1]
After demonstrating an increase in myocardial neutral lipid accumulation in our murine mo del of insulin resistance, we next analysed levels of miR-1 and miR-133a in the serum and myocardium of both diet groups. [score:1]
Interestingly, one of the benefits conferred by miR-133a in stressed hearts is a reduction in diastolic dysfunction [46], a hallmark of diabetic cardiomyopathy. [score:1]
A correlation between the myocardial neutral lipid content and circulating levels of miR-1 and miR-133a was observed (ρ = 0.622, P = 0.031, ρ = 0.755, P = 0.005, respectively). [score:1]
Both miR-1 and miR-133a affect several cellular pathways intimately involved in heart physiology and pathophysiology. [score:1]
Levels of circulating cardiomyocyte-enriched miR-1 and miR-133a are increased in an in vivo mouse mo del of high-fat diet -induced insulin resistance. [score:1]
Using logistic regression mo dels, we explored the association between the levels of myocardial steatosis and different potential predictors, including miR-1 and miR-133a. [score:1]
Corroborating our clinical findings, we observed increases in serum levels of miR-1 (3.3-fold) and miR-133a (2.4-fold) in the Western diet group with respect to the chow diet group (Fig.   2C). [score:1]
Multivariate analysis was performed to explore in detail the relationship between myocardial neutral lipid content and miR-1 and miR-133a levels (Table  3). [score:1]
Given that miRNAs may be packaged in lipoproteins 30, 31, we analysed the presence of both miR-1 and miR-133a in VLDL+IDL preparations to control for possible cross-contamination in our samples. [score:1]
The results obtained from patients and both in vivo and in vitro mo dels suggest that serum miR-1 and miR-133a levels hold significant promise as clinical indicators of myocardial steatosis. [score:1]
The active release of miR-1 and miR-133 from HL-1 cardiomyocytes in response to lipid overload and in the absence of cell damage allows us to speculate about the role of both miRNAs as extracellular mediators in cell-cell communication. [score:1]
A dose -dependent response was specifically observed in miR-133a intracellular levels (Fig.   3C). [score:1]
[1 to 20 of 56 sentences]
20
[+] score: 77
In contrast, as miR-1 and miR-133 are upregulated, expression of their targets may possibly be suppressed in P347S mice. [score:10]
Interestingly, expression of miR-1 and miR-133 were found to be decreased in cardiac hypertrophy, whereas their over -expression inhibited hallmarks of induced cardiac hypertrophy in vitro and in vivo [22]. [score:7]
Additionally, target transcripts for miR-1 and miR-133 comprise mRNA processing factors (for example, Syf11 [SYF2 homolog RNA splicing factor], Prpf8, and Hnrpl [heterogeneous nuclear ribonucleoprotein L]), an apoptosis inhibitor (Faim [Fas apoptotic inhibitory molecule]), and proteins that are involved in intracellular trafficking and motility (for example, Ktn1 [Kinectin 1]), Actr10 [ARP10 actin related protein 10 homolog], and Myh9 [non-muscle myosin heavy chain polypeptide 9]; see). [score:7]
Using a bioinformatics approach, potential target genes for miR-96, miR-183, miR-1, and miR-133 were predicted and screened against genes expressed in the mouse retina [41, 42] and 488 genes linked with eye diseases [40]. [score:7]
Expression of miR-1 and miR-133 decreased by more than 2.5-fold (P < 0.001), whereas expression of miR-96 and miR-183 increased by more than 3-fold (P < 0.001) in Pro347Ser retinas, as validated by qPCR. [score:5]
Similarly, the observed increased expression of miR-1 and miR-133 in the P347S retina may possibly suggest that a compensatory mechanism has been activated in the mutant retina in an attempt to prevent photoreceptor cell death. [score:3]
Expressions of miR-1, miR-9*, miR-26b, miR-96, miR-129-3p, miR-133, miR-138, miR-181a, miR-182, miR-335 and let7-d were explored by in situ hybridization (ISH) using locked nucleic acid (LNA) probes (Exiqon). [score:3]
In light of this, it is unlikely that the significant changes observed in the expression of miR-96, miR-183, miR-1 and miR-133 are due to the altered cellular composition of the P347S retina. [score:3]
Potential retina specific targets of miR-1, miR-96, miR-133, and miR-183 were generated through computational means. [score:3]
A subset of highly ranked potential targets for miR-96, miR-183, miR-1 and miR-133 are implicated in the visual cycle (for example Abca4, Pitpnm1 [membrane associated phosphatidylinositol 1], and Pde6a), in cytoskeletal polarization (for example, Crb1 and Clasp2 [CLIP associating protein 2]), and in transmembrane and intracellular signaling (for example, Clcn3 [chloride channel 3], Grina [N-methyl-D-aspartate -associated glutamate receptor protein 1], Gnb1 [guanine nucleotide binding protein beta 1 polypeptide] and Gnb2 [guanine nucleotide binding protein beta 2 polypeptide]). [score:3]
Note that for a number of miRs (for example, miR-1, miR-133, and miR-96), both Ambion and Exiqon microarrays detected similar alterations in expression between the P347S mutant and wild-type retinas. [score:3]
Among others, expression of miR-96, miR-183, miR-1, and miR-133 exhibited significant alterations in P347S mice by microarray analysis, and these changes were validated by qPCR. [score:3]
Potential target transcripts for miR-96, miR-183, miR-1 and miR-133 predicted by miRanda [39] were retrieved from the Sanger miR Database [37]. [score:3]
lists potential retinal target transcripts with the highest rankings for miR-96, miR-183, miR-1, and miR-133. [score:3]
Many genes encoding factors that are involved in mRNA processing and splicing, and RNA -binding proteins belong to the predicted targets for miR-1 and miR-133. [score:3]
Expressions of mouse microRNA (miR)-96, miR-183, miR-133 and miR-1 were analyzed using Ambion miR microarrays (green, 'A-' in legend), Exiqon miR microarrays (blue, 'E-' in legend), and quantitative real-time reverse transcription polymerase chain reaction (qPCR; magenta). [score:3]
More specifically, significant differences in expression of miR-1, miR-96, miR-133, and miR-183 in retina were observed between RHO mutant and wild-type mice. [score:3]
In contrast, miR-1 and miR-133 levels increased by more than 3-fold in retinas of P347S mice. [score:1]
MiR-1, miR-96, miR-133, and miR-183 are highlighted in red; h and m in labels refer to human and mouse miRs. [score:1]
The above conditions were met by miR-1, miR-96, miR-133, and miR-183 (highlighted in red in Figure 4b,c); these miRs were therefore selected for qPCR quantification. [score:1]
Figure 6 displays corresponding data from the two different microarrays and qPCR analyses for miR-96, miR-183, miR-1, and miR-133. [score:1]
In summary, expression of miR-96 and miR-183 decreased by more than 2.5-fold (P < 0.001) in mutant retinas, whereas miR-1 and miR-133 increased by more than 3-fold (P < 0.001), as measured using qPCR. [score:1]
[1 to 20 of 22 sentences]
21
[+] score: 75
The remarked increase in expression of mir-133a-1-3p and mir-133a-2-3p upon gram -positive bacterial infection in the present study was not accompanied by an increased expression of mir-1-1 or mir-1-2. Whether the upregulation of these circulating miRNAs is attributable to direct stimulation by gram -positive bacterial toxin or by a parallel effect, such as hemodynamic change or an associated illness, is unknown. [score:9]
In this study, there were 8 upregulated miRNAs (mir-193b-3p, mir-133a-1-3p, mir-133a-2-3p, mir-133a-1-5p, mir-133b-3p, mir-434-3p, mir-127-3p, mir-676-3p) and 1 downregulated miRNA (mir-215-5p) present as potential targets for differentiation between gram -negative and gram -positive bacterial infection. [score:9]
Therefore, we focused on these 3 differentially-expressed miRNAs (mir-193b-3p, mir-133a-1-3p, mir-133a-2-3p), and their expression with sequence reads is illustrated in Figure  3. Obviously, the expression of mir-133a-1-3p and mir-133a-2-3p is similar in the 12 libraries. [score:7]
In addition, following exposure to gram -positive bacteria in the cut mo del, only 2 miRNAs (mir-133a-1-3p, mir-133a-2-3p) were upregulated and 1 miRNA (mir-215-5p) was downregulated. [score:7]
Following exposure to gram -positive bacteria in the injection and skin graft mo dels, 7 upregulated miRNAs (mir-193b-3p, mir-133a-1-3p, mir-133a-2-3p, mir-133b-3p, mir-434-3p, mir-127-3p, mir-676-3p) and 1 downregulated miRNA (mir-215-5p) were found. [score:7]
Among them, mir-193b-3p, mir-133a-1-3p, and mir-133a-2-3p presented the most common miRNA targets expressed in the mice exposed to gram -positive bacterial infection. [score:5]
Furthermore, miR-133a is deemed a cardiac and skeletal muscle-specific miRNA [27, 28] and involved in muscle development [29] and many myocardial diseases [29- 32]. [score:4]
Upon gram -positive bacterial infection, 9 miRNAs (mir-193b-3p, mir-133a-1-3p, mir-133a-2-3p, mir-133a-1-5p, mir-133b-3p, mir-434-3p, mir-127-3p, mir-676-3p, mir-215-5p) showed upregulation greater than 4-fold with a p-value < 0.01. [score:4]
Therefore, the 3 most common circulating miRNAs (mir-193b-3p, mir-133a-1-3p, and mir-133a-2-3p) expressed in the mice exposed to Staphylococcus aureus in the absence or presence of Escherichia coli may be potential biomarkers for gram -positive bacterial infection. [score:3]
Figure 3 Comparison of the sequence reads as the expression levels of 3 dominant circulation miRNAs (mir-133a-1-3p, mir-133a-2-3p, and mir-193b-3p) in the sera of the mice receiving bacterial infection. [score:3]
In addition, correlation analyses revealed significant correlations of miR-133a with disease severity, classical markers of inflammation and bacterial infection, and organ failure [12]. [score:3]
In addition, the high expression of mir-133a-1-3p and mir-133a-2-3p upon gram -positive bacterial infection is reduced, although still significant, in those mice with mixed bacterial infection. [score:3]
Notably, genes encoding miR-133, namely miR-133a-1, miR-133a-2, are transcribed as bicistronic transcripts together with miR-1-1 and miR-1-2 [29]. [score:1]
Therefore, the origin and mechanism of the increased expression of mir-133a-1-3p and mir-133a-2-3p may require further investigation prior to their application in a clinical setting. [score:1]
Significant alterations of miR-133a, miR-193b, miR-150, and miR-155 were found in mice after cecal pole ligation and puncture -induced sepsis [12]. [score:1]
It was revealed that a total of 9 miRNAs (mir-193b-3p, mir-133a-1-3p, mir-133a-2-3p, mir-133a-1-5p, mir-133b-3p, mir-434-3p, mir-127-3p, mir-676-3p, mir-215-5p) showed differences greater than 4-fold with p-value < 0.01 between the 2 libraries (Table  1). [score:1]
Among them, there were 52 mature miRNAs with sequence reads ≥ 400 (Additional file 1: Table S4) and 10 mature miRNAs (mir-10b-5p, mir-133a-1-3p, mir-133a-2-3p, mir-191-5p, mir-22-3p, mir-25-3p, mir-3107-5p, mir-486-5p, mir-92a-1-3p, mir-92a-2-3p) with sequence reads ≧ 4000 in at least 1 of the 12 twelve libraries (Additional file 1: Table S5). [score:1]
Small RNA deep sequencing and qPCR results of five selected miRNAs (mir-133a-1-3p, mir-127-3p, mir-25-3p, mir-191-5p, and mir-215-5p) were generally in agreement, with a Pearson correlation value of 0.921 (Additional file 2). [score:1]
A functional role of miR-133a and miR-193b was recently revealed in systemic inflammatory responses associated with infections, myocardial infarction, and cancer. [score:1]
Significantly elevated miR-133a levels were found in critically ill patients at intensive care unit (ICU) admission, especially in patients with sepsis [12]. [score:1]
Among these miRNAs, mir-193b-3p had the highest fold-change of 61.5-fold and 40.4-fold in the injection and skin graft mo dels of gram -positive bacterial infection, respectively, and of 13.9-fold and 13.0-fold in the injection and skin graft mo dels of mixed bacterial infection, followed by mir-133a-1-3p and mir-133a-2-3p in the gram -positive or mixed bacterial infection. [score:1]
This study identified mir-193b-3p, mir-133a-1-3p, and mir-133a-2-3p as potential circulating miRNAs for gram -positive bacterial infections. [score:1]
Peng L Chun-guang Q Bei-fang L Xue-zhi D Zi-hao W Yun-fu L Clinical impact of circulating miR-133, miR-1291 and miR-663b in plasma of patients with acute myocardial infarctionDiagn Pathol. [score:1]
[1 to 20 of 23 sentences]
22
[+] score: 64
Finally, we demonstrate that intra-arterial administration of MuStem cells results in up-regulation of miR-133a and miR-222 concomitantly with a down -expression of two sarcomeric proteins corresponding to miR-222 targets. [score:8]
Secondly, we demonstrate an up-regulation of miR-133a and miR-222 expression after systemic delivery of MuStem cells. [score:6]
As regards myomiRs, several studies report that miR-1 and miR-133 are under-expressed, while miR-206 is over-expressed in mdx muscles [25– 27]. [score:5]
We show that miR-133a (p = 0.03) and miR-222 (p = 0.03) are up-regulated in GRMD [MuStem] dogs compared to mock GRMD dogs (Fig.   4a), while miR-1, miR-206 and miR-486 expressions appear unchanged. [score:5]
Zebrafish miR-1 and miR-133 shape muscle gene expression and regulate sarcomeric actin organization. [score:4]
In addition, we demonstrate an up-regulation of both miR-133 and miR-222 4 months after MuStem cell transplantation, highlighting their potential use as novel markers for the follow-up of effects associated with MuStem cell delivery in a dystrophic context. [score:4]
In muscle, specific miRNAs (known as myomiRs), such as miR-1, miR-133 and miR-206, are involved in regulation of the proliferation or differentiation of myogenic cells [13– 16] and are especially regulated by transcription factors implicated in muscle growth and development [17, 18]. [score:4]
We also establish a modified expression of miR-133a and miR-222 subsequent to MuStem cell infusion. [score:3]
Our finding on the down -expression of two sarcomeric proteins MYH7 and MHC in GRMD [MuStem] muscle suggests that miR-133a and miR-222 could be involved in the remo delling of the sarcomeric assembly, thus preventing the accumulation of sarcomeric component aggregates observed in dystrophic muscle. [score:3]
Expression levels of miR-1, miR-133a, miR-206, miR-222 and miR-486 were determined in 9-month-old healthy (n = 5) and GRMD (n = 3) dog muscle by real-time PCR and were normalized to RNU6B levels. [score:3]
On the other hand, miR-1, miR-133a, miR-206 expression levels are unchanged in GRMD dogs. [score:3]
Intriguingly, the expression of miR-1, miR-133a and miR-206 does not change. [score:3]
Expression levels of miR-1, miR-133a, miR-206, miR-222 and miR-486 were determined in muscles (right and left Biceps femoris) of three 9-month-old GRMD and six mock GRMD dog by real-time PCR and normalized by RNU6B levels. [score:3]
For this reason, we aim at establishing, for the first time, a description of miRNA dysregulations in GRMD dog skeletal muscle based on a dedicated set: miR-1, miR-133a, miR-206, miR-222 and miR-486. [score:2]
Moreover, the pathway analysis performed to provide functional annotation based on KEGG terms (DIANA-miRPath) shows an enrichment of miR-133 in many pathways linked to ubiquitin mediated proteolysis as well as regulation of the actin cytoskeleton. [score:2]
In addition, we establish that MuStem cell infusion is characterized by an up-regulation of both miR-133a and miR-222, positioning them as potential useful markers to assess the efficacy of a cell -based strategy. [score:2]
Expression levels of miR-1, miR-133a, miR-206, miR-222, and miR-486 were determined in muscles (right and left Biceps femoris) of six 9-month-old GRMD [MuStem] dogs compared to six mock GRMD dogs. [score:2]
Chen J-F, Man del EM, Thomson JM, Wu Q, Callis TE, Hammond SM, Conlon FL, Wang D-Z. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
Unfortunately, we failed to detect significant signal for miR-222 and miR-133a. [score:1]
[1 to 20 of 19 sentences]
23
[+] score: 55
However, after differentiation, TetR-KRAB inhibition of GFP expression was severely impaired, indicating that the miR-133 expression silenced TetR-KRAB production. [score:7]
In contrast, in cells infected with the lentiviral vector carrying miR-133 target sequences we observed a significant reduction of GFP expression in undifferentiated cells after doxycyline removal, indicating that the TetR-KRAB regulation functioned according to the intended design. [score:6]
However, in mice injected with AAV carrying miR-133 target sequences, there was no variation of GFP expression in the absence or presence of doxycycline (Fig. 6d). [score:5]
We designed two DNA cassettes containing the TetR-KRAB coding sequence with four copies of miR-133 or without miRNA target sequences located in the downstream untranslated region. [score:5]
A slight decrease in GFP expression persists in the differentiated cells, which is likely to be a result of a small number of undifferentiated cells expressing little or no miR-133. [score:5]
The intended regulation by doxycyline persisted in muscles injected with AAV that did not contain the miRNA target sequences although no significant effect of doxycycline was recorded in mice injected with the miR-133-regulated vector (Fig. 6c, d). [score:5]
Muscle-specific miR-133, liver specific miR-122, or hematopoietic specific miR-142 target sequences were shown to work synergistically with the TetR-KRAB cassette and enable tissue-specific expression. [score:5]
Differentiated or undifferentiated C2C12 cells were transduced at a MOI of 10 with miR-133-CMV-GFP regulated or miR-122-CMV-GFP regulated lentiviral vectors. [score:3]
The first included a constitutively active promoter (PGK, phosphoglycerate kinase or CMV, cytomegalovirus) driving a TetR-KRAB sequence, which was linked to four tandem repeats of a target sequence designed to be perfectly complementary to miR-122 (TGG AGTGTGACAATGGTGTTTGTGT), miR-142.3p (TCCATAAAGTAGGAAACACTACA) and miR-133 (ACAGCTGGTTGAAGGGGACCAA). [score:3]
To this end we designed lentiviral vectors containing four copies of perfectly complementary miR-133 targets downstream of the Tet-KRAB-encoding sequence. [score:3]
We confirmed that expression of miR-133 increased when C2C12 cells underwent myoblast differentiation (Fig. 5b). [score:3]
AAV carrying miR-133 target sequences were injected in the penile vein of mice (n = 8). [score:3]
We have verified that miR-133-CMV-GFP regulated AAV vectors was efficient in liver in which the endogenous miR is absent. [score:2]
[1 to 20 of 13 sentences]
24
[+] score: 53
Furthermore, BMPC administration upregulated miR-29 expression (P<0.05; Figure 1C), which is known to inhibit fibrosis by targeting collagen and fibrillin-1 [9] and increased miR-133a (P<0.05; Figure 1D), a negative regulator of connective tissue growth factor (CTGF) [10]. [score:11]
Interestingly, BMPC administration modulates the expression of several fibrosis-related miRNAs after MI, specifically up-regulated miR-29 and miR-133a and down-regulated miR-155 and miR-21. [score:9]
For instance, miR-29 has been shown to inhibit fibrosis by targeting collagen and fibrillin-1 [9], miR-133a negatively regulates connective tissue growth factor (CTGF) [10] and miR-21 targets sprouty homologue 1 [8] and phosphatase and tensin homologue [25]]. [score:8]
Given that microRNAs (miRNAs) modulate pathophysiology of cardiovascular diseases through regulation of gene expression [7], [8], [9], [47], we determined whether BMPCs administration after MI regulates miRNAs (like miR-21, miR-27, miR-29, miR-155, miR-30a and miR-133a) that have been shown to play a role in fibrosis in various tissues/organs [8], [11], [12]. [score:7]
Saline -treated (control) MI mice showed a significant up-regulation of miR-21 and miR-155 and decrease in miR-29 and miR-133a expression (Figure 1). [score:6]
To determine whether BMPCs regulate fibrosis-related miRNAs in infarcted heart, we injected mouse BMPCs in infarcted hearts of C57BLKS/J mice and determined (at 3 days post-MI) the expression of miRNAs (miR-21, miR-27, miR-29, miR-155, miR-30a and miR-133a, which have been shown to play a role in fibrosis [9], [10], [11], [24], [25]). [score:4]
BMPC therapy decreased miR-21 (A) and miR-155 (B) and increased miR-29 (C) and miR-133a (D) expression in comparison with saline -treated or sham groups. [score:3]
Figure 1 depicts that saline -treated MI mice showed a significant increase in expression of miR-21 and miR-155 (P<0.01; Figures 1A and 1B) and decrease in miR-29 and miR-133a (P<0.01; Figures 1C and 1D) levels with non-significant reducing trend of miR-27 and miR-30a (Figures S4. [score:3]
Several miRNAs in the myocardium are modulated after MI including those that have been implicated in the regulation of fibrosis like miR-21, miR-29, miR-30, miR-133 and miR-155 [8], [9], [10], [11], [12]. [score:2]
[1 to 20 of 9 sentences]
25
[+] score: 46
MiR-1 and miR-133a were proposed to contribute in muscle hypertrophy by the removal of their transcriptional inhibitory effect on growth factors such as IGF-1. Likewise, a regulatory feedback loop was demonstrated in vitro where IGF-1 downregulated miR-1 via the Akt/FoxO3a pathway [55]. [score:7]
Recent studies demonstrated that miR-29b, miR-133a, and 133b regulate myoblast proliferation and differentiation [38, 44], and miR-1 and miR-133 have been reported to regulate different aspects of skeletal muscle development in vitro and in vivo [23]. [score:4]
Differences in the expression levels of both the miRNAs (miR-133a and miR-206) in skeletal muscle libraries could reflect different roles of these miRNAs in terms of myogenesis regulation [77]. [score:4]
miR-1 and miR-133 modulate skeletal-muscle-cell proliferation and differentiation by repressing the activity of HDAC4 (histone deacetylase 4; a signal -dependent inhibitor of muscle differentiation) and SRF, respectively, thereby establishing negative-feedback loops for muscle-cell differentiation [23]. [score:3]
Similar to miR-133a and miR206, miR-1 also regulate muscle differentiation and development [23, 77– 79]. [score:3]
The expression of miR-133 (miR-133a, miR-133b), miR-1, and miR-181 (miR-181a, miR-181b, and miR-181c) was profiled in muscle from patients affected by myotonic dystrophy type1 and it was observed that they were specifically induced during myogenesis [82]. [score:3]
Of the 57 differentially expressed miRNAs mmu-mir-133a was the most abundant in the wild-type control (32, 12,465.607) and transgenic (57, 10,658.17) mice. [score:3]
In our study, we observed that miR-206 expression level was significantly lower than miR-133a in comparison to previous studies. [score:3]
A total of 57 differentially expressed miRNAs were identified; out of these miR-133a, miR-378a, and miR-26 were highly abundant. [score:3]
miR-206 is reported to be one of the skeletal muscle-specific myomiR and many studies have documented its pivotal role in skeletal muscle differentiation [43, 49, 72– 75] and miR-133a in regulating myogenesis by increasing muscle cell proliferation [23, 38, 76]. [score:2]
The pivotal roles of three muscle-specific miRNAs, miR-1, miR-133, and miR-206, in the regulation of myogenesis have been well documented [17, 31, 32]. [score:2]
The predominance of miR-133a was consistent with its well established function during skeletal muscle development; miR-378a is also reported to play important role during Mus musculus myogenesis. [score:2]
Considering these previous studies, we presume that miR-133a and miR-206 play an important role in skeletal muscle development. [score:2]
MiR-133a [23, 38], miR-378a [50], miR-26a [51], miR-27b [52, 53], miR-21a [56], miR-29a [44], miR-148 [58], and miR-103 are skeletal muscle specific miRNAs and play a vital role in muscle differentiation and proliferation as reported in previous studies. [score:1]
Out of 8 known miRNAs, 6 miRNAs have been functionally linked to myogenesis (i. e., miR-1a, miR-26a, miR-133a and miR-199a, miR-101, and miR-378 [38, 50, 51, 54, 55, 70]). [score:1]
Six isomiRs i. e. mmu-miR-16a-2, mmu-miR-133a-1, mmu-miR-188b-2, mmu-miR-199a-2, mmu-miR-486 and mmu-miR-26b-5P were selected. [score:1]
It is previously reported that miR-133a enhances myoblast proliferation by repressing serum response factor (SRF) [23]. [score:1]
A group of miRNAs, highly enriched in skeletal muscle (referred to as myomiRs), has recently been identified and includes miR-1, miR-133a, miR-133b, miR-206, miR-208, miR-208b, miR-486, and miR-499 [33– 37]. [score:1]
[1 to 20 of 18 sentences]
26
[+] score: 46
In silico miRNA Target Selection PipelineTarget sites for mmu-miR-1a-3p (miR-1), miR-133a-1 (miR-133), miR-142a-3p (miR-142), miR-183-5p (miR-183), miR-96-5p (miR-96) and miR-182-5p (miR-182) were predicted employing Diana-microT (v. 3.0) 61, miRanda (Aug 2010 release) 62 and TargetScan tools (v. 6.2) 4, and filtered for sites predicted by at least two prediction tools. [score:7]
The data above suggest that miR-1 suppresses Ctbp2 in R347 retinas and that miR-1 (and possibly miR-133) may regulate synaptic remo deling at photoreceptor synapses by targeting Ctbp2. [score:6]
In Silico Target SelectionAltered expression of miR-1, miR-133, miR-142 and miR-183/96/182 in the R347 mouse mo del has been observed 12. [score:5]
As the Ctbp2 3′UTR also has a predicted target site for miR-133, miR-1/133 may co-target Ctbp2 (Fig. 3g); however this was not tested in our study. [score:5]
Target sites for mmu-miR-1a-3p (miR-1), miR-133a-1 (miR-133), miR-142a-3p (miR-142), miR-183-5p (miR-183), miR-96-5p (miR-96) and miR-182-5p (miR-182) were predicted employing Diana-microT (v. 3.0) 61, miRanda (Aug 2010 release) 62 and TargetScan tools (v. 6.2) 4, and filtered for sites predicted by at least two prediction tools. [score:5]
The miR-1/133 cluster and Ctbp2 are co-expressed in photoreceptors; expression of both miR-1 and miR-133 is increased by ~20-fold in R347 versus wt photoreceptors (Table 2) 12. [score:5]
Specifically, 23, 10, 6, 18, 35 potential target genes were identified for miR-1, miR-133, miR-142, miR-183, miR-96 and miR-182, respectively (Supplementary Table S3). [score:3]
Of the six miRNAs of interest, the Ctbp2 3′UTR contains predicted target sites for miR-1 and miR-133 (Fig. 3g), the levels of which were significantly increased in R347 versus wt retinas (Table 2) 12. [score:3]
Altered expression of miR-1, miR-133, miR-142 and miR-183/96/182 in the R347 mouse mo del has been observed 12. [score:3]
Ctbp2 protein in R347 versus wt retinas was decreased by ~50% (Table 2, LC-MS/MS) suggesting that miR-1 and miR-133 may target Ctbp2; the potential miR-1-Ctbp2 mRNA interaction was further tested in the study. [score:3]
miR-1 and miR-133 form a miRNA cluster and can influence neuronal function 42. [score:1]
[1 to 20 of 11 sentences]
27
[+] score: 45
C2C12-DF cells (C2C12 cells grown in differentiation medium) was compared; 42 miRNAs were up-regulated with miR-206, miR-133b and miR-133a being commonly up-regulated (2.21, 1.68 and 1.63 fold in log2 ratio, respectively), and miR-487b, miR-6412 and miR-3963 were down-regulated (−1.98, −2.99 and −2.13 fold in log 2 ratio, respectively). [score:9]
We identified 161 miRNAs to be up-regulated, including miR-206, miR-133b and miR-133a (by 5.84, 5.46 and 5.37 fold in log2 ratio, respectively), while only miR-487b, miR-6412 and miR-3963 were down-regulated by about −1.00 in log2 ratio (−1.70, −0.96 and −0.93 fold in log2 ratio, respectively). [score:7]
We identified miR-206, miR-133a, and miR-133b as up-regulated miRNAs and miR-487b, miR-3963 and miR-6412 as down-regulated miRNAs in differentiating cells. [score:7]
We found that miR-206, miR-133a, miR-133b were up-regulated, and miR-487b, miR-3963, and miR-6412 were down-regulated during myogenic differentiation. [score:7]
Consistent with our previous report, transfection of miR-206, and miR-133a resulted in significantly higher troponin T expression. [score:3]
miR-1, miR-206, miR-133a and miR-133b did not affect MyHC expression. [score:3]
Transfection of miR-1 positive control, miR-206 and miR-133a resulted in a significant increase of the troponin T -positive cell ratio, while transfection of miR-487b, miR-3963 and miR-6412 mimics significantly decreased troponin T expression (Figure  1). [score:3]
miR-1, miR-206, miR-133a, miR-133b, miR-6412 did not affect MyHC expression. [score:3]
For example, miR-1, miR-206, miR-133 [13, 14] are known as muscle-specific miRNAs. [score:1]
Therefore, we focused on miR-206, miR-133a, miR-133b, miR-487b, miR-6412 and miR-3963 as a potential myogenic differentiation-related miRNAs, and the effect of transfection of these miRNAs on cell differentiation was assessed. [score:1]
Transfection of miR-487b and miR-3963 mimics resulted in a significant decrease in the MyHC (fast) positive ratio (Figure  2), while miR-1 positive control, miR-206, miR-133a, miR-133b and miR-6412 did not affect the MyHC (fast) positive cell ratio. [score:1]
[1 to 20 of 11 sentences]
28
[+] score: 45
In dystrophic subjects miR-1, miR-133a and miR-133b are downregulated in the muscle and upregulated in the serum while conversely miR-31 is upregulated in the muscle and downregulated in the serum. [score:13]
Downregulation of certain miRNAs, including miRNA-1, miRNA-133a and miRNA-133b in dystrophic muscle ([43] and our unpublished data) coincide with their upregulation in the serum. [score:7]
The miR-133a, miR-133b, miR-1, strongly upregulated in the DAPC -associated myopathy mo dels, were slightly but significantly downregulated in the EDMD mouse mo del. [score:7]
In agreement with our mdx data, this analysis confirmed the upregulation of miR-1, miR-133a, miR-133b and miR-206, previously reported in DMD patients [36] and dystrophic dogs [40]. [score:4]
Two recent studies reported the upregulation of miR-1, miR-133a, miR-133b and miR-206 in the serum of dystrophic animal mo dels and human patients [36], [40]. [score:4]
In agreement with previous results from 10 week old mice (Table 2) we observed a marked upregulation of miR-1, miR-133a, miR-133b and miR-206 in the sera of mdx mice at ages of both 4 and 22 weeks. [score:4]
Three out of the eight dysregulated miRNAs in the EDMD mouse mo del, miR-1, miR-133a and miR-133b, were found to be dysregulated in the DAPC -associated pathologies (Table 3), but with opposite trends. [score:3]
The common dysregulated serum miRNAs in the DAPC -associated pathologies (Table 3) included the four principal muscle enriched miRNAs, miR-1, miR-133a, miR-133b and miR-206 [41], [42]. [score:2]
In agreement with a recent publication [36] we identified strong activation in dystrophic mice of the muscle-enriched miR-1, miR-133a, miR-133b and miR-206. [score:1]
[1 to 20 of 9 sentences]
29
[+] score: 44
We also tested the expression level of other previously identified targets of miR-1a and miR-133a in Trbp knockdown myoblasts, however, we did not detect the alteration of the expression of these targets. [score:10]
Expression of miR-1a and miR-133a was dramatically down-regulated both in vitro and in vivo, when Trbp was inactivated. [score:6]
The impaired muscle differentiation in Trbp mutant mice or Trbp-knockdown cells is associated with reduced expression of miR-1a and miR-133a. [score:4]
As shown in Fig 7B, we found that while CTX -induced muscle injury resulted in reduced level of miR-1a and miR-133a (Fig 7B), loss of Trbp further reduced the expression levels of miR-1a and miR-133a in Trbp [Myf5] muscle (Fig 7B). [score:3]
The functional roles of muscle-enriched miR-1a and miR-133a, and their targets in myogenesis have been reported previously [7, 10, 11]. [score:3]
Consistent with the results in C2C12 cells in vitro, we observed that the expression levels of miR-1a and miR-133a were significantly reduced in the muscle of Trbp [Myf5] mice in vivo (Fig 7B). [score:3]
The muscle enriched miR-1, miR-133, and miR-206 exhibit correlated expression pattern during myogenesis or in muscle regeneration. [score:3]
Interestingly, whereas miR-133 was shown to promote myoblast proliferation by repressing SRF, it is also required for normal myogenic differentiation through the inhibition of uncoupling protein 2 (UCP2) [7, 10]. [score:3]
We analyzed the expression level of several muscle enriched miRNAs, including miR-1a, miR-133a, and miR-206, in siRNA -treated C2C12 cells. [score:3]
In this study, we identified Trbp as a key regulator of myogenic miRNAs, miR-1a and miR-133a, in skeletal muscle cells. [score:2]
As expected, we observed that the levels of miR-1a and miR-133a were significantly reduced when Trbp was knockdown (Fig 7A). [score:2]
miR-133 has also been reported to regulate muscle differentiation. [score:2]
[1 to 20 of 12 sentences]
30
[+] score: 44
Thus, the downregulation of miR-133 and miR-30 may contribute to the development of cardiac fibrosis in DBL mice, as both regulate the profibrotic signalling factor, CTGF [30], which was correspondingly upregulated. [score:9]
The second downregulated miRNA at a pre-disease stage was miR-133a, which belongs to the same transcriptional unit as miR-1 [24]. [score:6]
These include miR-1, miR-133, miR-30 and miR-150 which often show reduced expression, and miR-21, miR-199 and miR-214 which often show increased expression [6], [7], [8], [9], [11], [12], and they may represent miRNAs with a central role in cardiac remo delling. [score:5]
In vitro suppression of miR-133, using an antisense sequence to sequester miR-133, induces hypertrophy, and in-vivo inhibition of miR-133 by infusion of an adenoviral antagomir causes cardiac hypertrophy [24]. [score:5]
Nine miRNAs with the highest expression levels (average Ct value range 19.6–22.5) were common amongst the four groups of mice despite the differences in age and disease state, and they were miR-133a, miR-126-3p, miR-24, miR-30c, miR-30b, miR-1, miR-16, miR-19b and miR-145 (Table S1). [score:5]
Together, these data further implicate downregulation of miR-1 and miR-133 in the development of HCM, and strategies to maintain their levels may represent a therapeutic opportunity. [score:5]
Downregulated miRNAs included miR-1 and miR-133a, which are part of the same transcriptional unit, and three miR-30 family members, namely miR-30b, miR-30c and miR-30e. [score:4]
The expression levels of miR-1 and miR-133a were significantly lower at a pre-disease stage in DBL mice, and this represents the earliest recorded pathological change in our well-characterised mouse mo del of HCM [20]. [score:3]
At a pre-disease stage, the co-transcribed miR-1 and miR-133a were significantly lower in DBL mice compared to NTG mice. [score:2]
[1 to 20 of 9 sentences]
31
[+] score: 41
Taken together, miR-1 and miR-133a are significantly downregulated in dy [3K]/dy [3K] and dy [2J]/dy [2J] muscle while miR-206 expression is upregulated, reflecting the overall regenerative status of the dystrophic muscle. [score:9]
Specifically, we demonstrate that loss of laminin α2 chain leads to downregulation of muscle-specific miR-1 and miR-133a together with increased expression of miR-206 in muscle, consistent with data on other types of muscular dystrophy. [score:6]
Increased proteasomal activity is a feature of MDC1A and recent studies demonstrated that proteasome inhibition partially improves muscle integrity in dy [3K]/dy [3K] mice accompanied by increased expression of miR-1 and miR-133a (Carmignac et al., 2011; Körner et al., 2014). [score:5]
We observed a decreased expression of miR-1 and miR-133a and an increase in miR-206 expression in dy [3K]/dy [3K] and dy [2J]/dy [2J] quadriceps muscle compared with wild-type controls (Figure 1A). [score:4]
Hence, in this study, we have analyzed expression of six miRNAs (miR-1, miR-133a, miR-206, miR-21, miR-29c, and miR-223) in muscle and plasma from two different MDC1A mouse mo dels (dy [3K]/dy [3K] and dy [2J]/dy [2J]). [score:3]
Notably, expression of muscle-specific miR-1 and miR-133a were unaffected at young ages (Figure 4C). [score:3]
In summary, the partial normalization of miR-1 and miR-133a in response to bortezomib administration indicates that these miRNAs are promising disease biomarkers for MDC1A. [score:3]
These observations make it difficult to draw any firm conclusions regarding the impact of miR-133a and miR-1 dysregulation on the MDC1A pathology. [score:2]
In contrast, the precise function of miR-1 and miR-133a in skeletal muscle is less clear. [score:1]
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
Studies on C2C12 myoblasts suggest that miR-133a and miR-1 promote proliferation and differentiation, respectively (Chen et al., 2006). [score:1]
Notably, administration of bortezomib resulted in a partial normalization of plasma levels of miR-1 and miR-133a in dy [3K]/dy [3K] mice (Figure 3C). [score:1]
All oligonucleotide sequences were designed by and ordered from Exiqon with the following product numbers: hsa-miR-1, 204344; hsa-let-7a-5p, 204775; hsa-miR-16-5p, 204409; hsa-miR-21-5p, 204230; hsa-miR-29c-3p, 204729; hsa-miR-133a, 204788; hsa-miR-206, 204616; and hsa-miR-223-3p, 204256. [score:1]
However, mice deficient for miR-133a do not display any skeletal muscle anomalies until they are adult and skeletal muscle from miR-1 -deficient mice is grossly normal (Zhao et al., 2007; Liu et al., 2011). [score:1]
[1 to 20 of 14 sentences]
32
[+] score: 40
Previous reports have demonstrated that β-adrenergic stimulation suppresses microRNA-133 (miR-133) expression in a myocyte enhancer factor 2 (Mef2c) -dependent manner, which results in direct de-repression of PRDM16 expression in brown adipose tissue (BAT) [42– 45]. [score:8]
β-adrenergic stimulation after cold exposure is reported to suppress myocyte enhancer factor 2 (Mef2) expression, which results in remarkable downregulation of microRNA-133 (miR-133) in BAT [42, 44]. [score:8]
The downregulation of mir-133 directly de-repression of PRDM16 expression [43, 45]. [score:7]
EPO upregulates PRDM16 via β-adrenergic receptor/Mef2c/ miR-133 cascade of interscapular brown adipose tissue (iBAT) in high-fat diet induced obese mice. [score:4]
These data suggest that EPO upregulates PRDM16 through EpoR/STAT3 and β-adrenergic receptor/Mef2/miR-133 signaling pathway, which results in the enlargement of iBAT mass. [score:4]
4427975), the expression of microRNA-133a (miR-133a) levels in iBAT were analyzed. [score:3]
Furthermore, the expression of both Mef2c mRNA and miR-133a was significantly decreased in EPO -treated mice under a high-fat diet (Fig 8C and 8D). [score:3]
Effect of erythropoietin (EPO) on the β-adrenergic receptor/Mef2/miR-133 pathway in interscapular BAT. [score:1]
The level of miR-133a was markedly decreased by EPO under both normal chow and high-fat diet conditions (Fig 8D). [score:1]
In summary, we found that: 1) EPO facilitates energy expenditure by increasing classical BAT mass; 2) EPO stimulates EpoR/STAT3 and β-adrenergic receptor/Mef2c/miR-133 pathways, resulting in enhancement of PRDM16 of classical BAT; 3) EPO promoted secretion of classical BAT’s derived-FGF21; and 4) EPO ameliorated obesity and glucose homeostasis in high-fat diet -induced obese mice. [score:1]
[1 to 20 of 10 sentences]
33
[+] score: 36
Again data from quantitative RT-PCR and bioluminescence analysis indicated a similar miRNA expression pattern, i. e. expression of miRNA-133 and almost undetectable expression of miRNA-122 and -221 in differentiated C2C12 cells (Supplementary Figure S2). [score:7]
As miRNA-122 is exclusively expressed in the liver (32) and miRNA-133 is a muscle-tissue–specific miRNA (34), we enquired whether RILES would have the potential to discriminate the expression of these two miRNAs in the liver of the mice. [score:5]
As miRNA-133 is constitutively expressed in the adult stage of skeletal muscles (34), we conducted a bioluminescence kinetic analysis of miRNA-133 expression in the tibialis anterior muscle of the mice. [score:5]
We thus attempted to monitor the expression pattern of miRNA-1, miRNA-133 and miRNA-206 in the skeletal muscles of the anterior tibialis of the mice. [score:3]
No statistical difference (P > 0.05) was found between the pRILES/133T and pRILES groups, indicating, as expected, that miRNA-133 was not expressed in the liver. [score:3]
Quantitative RT-PCR demonstrated that miRNA-122 is expressed in the liver in contrast to miRNA-133, which was almost undetectable in the liver samples. [score:3]
These data indicate that the expression of miRNA-133 in the liver is not sufficient to repress a sufficient amount of CymR transcript to switch-ON the RILES in the liver of the mice. [score:3]
MiRNA-122 and miRNA-221 were oppositely expressed in HUH7 and HLE cells, while miRNA-133 was not significantly detected. [score:3]
Similar specificity of data was also found in C2C12 myoblast cells differentiated in myotubes in vitro to induce expression of the muscle-specific miRNA-133 (34). [score:3]
In contrast luciferase induction was detected only in cells transfected with pRILES/122T, pRILES/133T and pRILES/221T in presence of the corresponding miRNA-122, miRNA-133 and miRNA-221 (Figure 2C–E). [score:1]
[1 to 20 of 10 sentences]
34
[+] score: 36
In addition to miR-320a, we found a group miRNAs which are differentially expressed in CAD patients, among which miRNAs, miR-21, miR-30a, miR-126, and miR-133a were reported to be up-regulated and miR-208a and miR-320a to be downregulated in infarcted myocardium 35, 36. [score:9]
Interestingly, the expression miR-1 and miR-133a, miRNAs regulated by SRF 21, were significantly decreased by miR-320a transfection in vivo and in vitro (Fig. 4F and G). [score:4]
Interestingly, recent studies have shown that SRF regulates the expression of miR-1 and miR-133a, miRNAs important for cardiac and skeletal muscles 46, 47. [score:4]
Indeed, the expression of miR-1 and miR-133a were regulated by miR-320a. [score:4]
We speculate miR-1 and miR-133a are indirect targets of miR-320a downstream of SRF. [score:4]
MiR-1, miR-133a and other targets of SRF may contribute to the development of atherosclerosis and CAD. [score:4]
Seven miRNAs (miR-21, miR-30a, miR-126, miR-133a, miR-195, miR-208a and miR-320a) were confirmed to be differentially expressed between CAD and control samples (Fig. 1B). [score:3]
We detected the expressions of miR-1 and miR-133a by real-time PCR in aorta of miR-320a treated mice and endothelium cells treated with miR-320a. [score:3]
Our data reveal links among SP1, miR-320a, SRF and miR-1/miR-133a in endothelial dysfunction in atherosclerosis. [score:1]
[1 to 20 of 9 sentences]
35
[+] score: 35
Targeted deletions of miR-1 or miR-133 in mice generally result in impaired cardiac development and function (6 – 11). [score:4]
In most higher vertebrates, the miR-1/miR-133a genomic locus was duplicated, with the expression of both loci being maintained in cardiac and skeletal muscle. [score:3]
Although miR-1 and miR-133 cooperate to repress smooth muscle gene expression in the heart (6, 7, 10, 11), miR-1 promotes differentiation of striated muscle progenitors, whereas miR-133 maintains the undifferentiated state in vitro (5, 12, 13). [score:3]
To test whether the interaction of miR-1/miR-206 with TDP-43 occurs in a cellular context, we performed CLIP of TDP-43 from undifferentiated C [2]C [12] cells, which express miR-206 and miR-133b, but not abundant miR-1 or miR-133a (Fig. 1 D). [score:3]
To our knowledge, a selective mature miRNA-protein interaction that limits miRNA activity, independent of miRNA biogenesis, has not been reported and suggests that the differential activity of mature miRNAs, including bicistronically encoded miRNAs, such as miR-1 and miR-133, can be regulated by selective interaction with RNA -binding proteins. [score:2]
Because the miR-1 family promotes differentiation and the miR-133 family keeps muscle in a less mature, more proliferative state (5, 12, 13), the TDP-43- miR-1 family interaction may be important to control the balance of these co-transcribed miRNA families to promote development and maintain adult muscle homeostasis. [score:2]
Given the extended half-life of miRNAs and the observations from deep-sequencing studies that the miR-1 family accounts for up to half of accumulated miRNAs in cardiac and skeletal muscles (20, 21), directly controlling the activity of these critical myogenic regulators and their differential activity as compared with miR-133 may be important to maintain muscle homeostasis. [score:2]
The miR-1 and miR-133 family loci are under transcriptional control of key myogenic proteins including myogenin, MyoD, serum response factor (SRF), myocardin (MYOCD) (3, 4, 16), and myocyte-enhancing factor 2 (MEF-2) (17). [score:1]
Proteins that co-precipitated with biotinylated miR-1 were separated on denaturing polyacrylamide gels (Fig. 1 C), and mass spectrometry was used to identify the bands that emerged in miR-1, but not control or miR-133a, pulldowns. [score:1]
FIGURE 1. TDP-43 interacts with the miR-1/miR-206 family, but not miR-133. [score:1]
A, sequence alignment of the miR-1/miR-206 family or the miR-133 family. [score:1]
We concluded that a protein or complex of proteins in C [2]C [12] cells preferentially interacts with the mature form of the miR-1/miR-206 family, but not miR-133, in vitro. [score:1]
We found a prominent band representing an miRNA-protein complex in C [2]C [12] lysates incubated with labeled miR-1 that was effectively lost with the addition of excess unlabeled miR-1 or miR-206, but not with unlabeled miR-133 (Fig. 1 B). [score:1]
This is consistent with the observation that miR-1 and miR-206 levels greatly exceed those of miR-133 in mature muscle (20, 21). [score:1]
To identify proteins that physically interact with and might regulate activity of the miR-1/miR-206 family, but not the miR-133 family (Fig. 1 A), we performed RNA electrophoretic mobility shift assays (EMSAs) seeking proteins that uniquely bind and alter the migration of these miRNAs. [score:1]
Here, we report that TDP-43, an RNA -binding protein that aggregates in individuals afflicted with ALS, physically associates with the mature form of the miR-1/miR-206 family of miRNAs in muscle cells, but not with the co-transcribed miR-133. [score:1]
The same band was observed when fluorescently labeled miR-206 was incubated with C [2]C [12] lysates and could be competed with either miR-1 family member, but not with miR-133 (Fig. 1 B). [score:1]
These interactions could be competed with unlabeled miR-1 or miR-206, but not with unlabeled miR-133a. [score:1]
The miR-1 family, composed of miR-1 and miR-206, whose mature sequences are nearly identical, and the miR-133 family (1, 2) are highly conserved and are enriched in cardiac and skeletal muscle in species as distantly related as flies and humans (3 – 5) (see Fig. 1 A). [score:1]
TDP-43 decreased activity of mature miR-1 and miR-206, but not the co-transcribed miR-133 family, by preventing the bound miRNAs from associating with the RISC. [score:1]
C, eluates from negative control (Biotin), Bio- miR-133a, or Bio- miR-1 pulldowns were run on denaturing gels. [score:1]
In mammals, up to three genomic loci encode bicistronic transcripts to produce miR-133 and either miR-1 or miR-206. [score:1]
Rao P. K. Missiaglia E. Shields L. Hyde G. Yuan B. Shepherd C. J. Shipley J. Lodish H. F. (2010) Distinct roles for miR-1 and miR-133a in the proliferation and differentiation of rhabdomyosarcoma cells. [score:1]
[1 to 20 of 23 sentences]
36
[+] score: 32
Myostatin may regulates the expression of miRNAs such as miR-133a, miR-133b, miR-1, and miR-206 in skeletal muscle as it has been observed that the expression of those miRNAs are significantly higher in myostatin null mice compared to wild type and heterozygous mice. [score:5]
Over expression of miR-1 and miR-133 during the in-vitro development of embryoid bodies from mouse embryonic stem cells demonstrated that distinct steps in muscle development are specified by cooperative and opposing interactions between miR-1 and miR-133. [score:5]
Similarly, Liu et al. (2007) identified an intragenic MEF2 -dependent enhancer that directed miR-1 and miR-133a expression levels. [score:4]
The miR-1 and miR-206 promote myogenesis, while miR-133 inhibits myoblast differentiation and promotes proliferation by repressing serum response factor and a key splicing factor[17- 20]. [score:3]
001) in miR-1, miR-133a, miR-133b, and miR-206 expression. [score:3]
The expression of miR-133a (p <. [score:3]
The expression level of miR-133a (p < 0.0001), miR-133b (p < 0.001), miR-1 (p < 0.001), and miR-206 (p <. [score:3]
In order to sustain the increased growth observed in Myostatin -null mice elevated satellite cell proliferation, which is regulated by miR-133[19] and differentiation, which is regulated by miR-1 and -206 [19, 19, 21], must occur. [score:3]
In this study, we observed higher miR-1, miR-133a, miR-133b, and miR-206 expression levels in the pectoralis muscle of MSTN [-/- ]mice as compared to MSTN [+/+ ]and MSTN [+/- ]animals. [score:2]
miR-1/-206 and miR-133 play opposing roles in modulating skeletal muscle proliferation and differentiation. [score:1]
[1 to 20 of 10 sentences]
37
[+] score: 31
We have previously reported that miR-206 is upregulated in the TA of 8-week-old mdx relative to wild-type controls, whereas the expression of miR-1 and miR-133a was unchanged (12). [score:6]
Similarly, the same tissues were analysed for expression of (D) miR-1, (E) miR-133a and (F) miR-206 by small RNA TaqMan normalized to miR-16 expression. [score:5]
This difference in expression between these dystromiRs is recapitulated in the results presented here, whereby miR-206 exhibits a dynamic pattern of expression over time in muscle, whereas miR-1 and miR-133a are relatively stable (Figure 4D–F). [score:5]
miR-1 and miR-133a are primarily expressed in skeletal and cardiac muscle, and miR-206 is restricted to skeletal muscle (41) and the role of these ‘myomiRs’ in muscle development and regeneration is already well established (41, 42), suggesting that these extracellular dystromiRs are unlikely to originate in non-muscle tissues. [score:4]
It is possible that all three miRNAs originate from regenerating fibres, although the high levels of miR-1 and miR-133 expression in mature muscle mean that this is not trivial to demonstrate. [score:3]
The dystromiRs miR-1, miR-133 and miR-206 are present at low levels in myogenic precursor cells, are upregulated during myogenic differentiation and can be considered markers of adopting a muscle lineage (8, 41). [score:3]
The results were similar between the dystromirs (miR-1, miR-133a and miR-206) and the control miRNA (miR-223). [score:1]
We (12), and others (13, 14), have shown that the serum of dystrophic animal mo dels (mdx mouse and CXMD [J] dog) and DMD patients is enriched for the dystrophy -associated miRNAs (dystromiRs): miR-1, miR-133 and miR-206. [score:1]
Fluctuations in the abundance of these miRNAs broadly matched miR-1, miR-133a and miR-206 levels in Pip6e-PMO -treated mice, although the baseline levels in the C57Bl/10 and untreated mdx mice showed greater variation. [score:1]
In contrast expression of Myod1, miR-1 and miR-133a was relatively stable over the period measured, with only small changes observed longitudinally between time points and small fold change differences between mdx and Pip6e-PMO treated mdx mice at age-matched time points. [score:1]
miR-223 was analysed, in addition to the dystromiRs miR-1, miR-133a and miR-206, as this miRNA was not expected to change between C57Bl/10 and mdx samples. [score:1]
[1 to 20 of 11 sentences]
38
[+] score: 31
Description miR-451[39] Upregulated in heart due to ischemia miR-22[40] Elevated serum levels in patients with stablechronic systolic heart failure miR-133[41] Downregulated in transverse aortic constrictionand isoproterenol -induced hypertrophy miR-709[42] Upregulated in rat heart four weeks after chronicdoxorubicin treatment miR-126[43] Association with outcome of ischemic andnonischemic cardiomyopathy in patients withchronic heart failure miR-30[44] Inversely related to CTGF in two rodent mo delsof heart disease, and human pathological leftventricular hypertrophy miR-29[45] Downregulated in the heart region adjacent toan infarct miR-143[46] Molecular key to switching of the vascular smoothmuscle cell phenotype that plays a critical role incardiovascular disease pathogenesis miR-24[47] Regulates cardiac fibrosis after myocardial infarction miR-23[48] Upregulated during cardiac hypertrophy miR-378[49] Cardiac hypertrophy control miR-125[50] Important regulator of hESC differentiation to cardiacmuscle(potential therapeutic application) miR-675[51] Elevated in plasma of heart failure patients let-7[52] Aberrant expression of let-7 members incardiovascular disease miR-16[53] Circulating prognostic biomarker in critical limbischemia miR-26[54] Downregulated in a rat cardiac hypertrophy mo del miR-669[55] Prevents skeletal muscle differentiation in postnatalcardiac progenitors To further confirm biological suitability of the identified miRNAs, we examined KEGG pathway enrichment using miRNA target genes (see ). [score:31]
[1 to 20 of 1 sentences]
39
[+] score: 30
Some of the important miRs with known/putative targets and differentially regulated by TWEAK are presented in Figure 3. Our results showed that TWEAK reduced the expression of muscle-specific miR-1, miR-133a, miR-133b and miR-206 in addition to several other miRs including miR-27, miR-23, miR-93, miR-199, miR-107, and miR-192 (Figure 3A). [score:6]
Low density miR array demonstrated that TWEAK inhibits the expression of several miRs including muscle-specific miR-1-1, miR-1-2, miR-133a, miR-133b and miR-206. [score:5]
Low-density miRNA array of TWEAK -treated C2C12 myotubes showed down-regulation of miR-1, miR-133a, miR-133b, miR-206, miR-27, miR-23, miR-93, miR-199, miR-107, and miR-192. [score:4]
We studied the expression of miR-1-1, miR-1-2, miR-133a, miR-133b, miR-206, miR-146a, and miR-455. [score:3]
Expression of miR-1 and miR-133a in embryonic stem cells and other non-muscle cell types showed that they promote the differentiation into the skeletal muscle lineage [35]. [score:3]
Interestingly, our low density miRs array and independent TaqMan QRT-PCR assays demonstrate that TWEAK reduces the expression levels of miR-1, miR-133a, miR-133b, and miR-206 in skeletal muscle cells (Figure 3A and Figure 4A). [score:2]
MEF2C is particularly important for miR-1 and miR-133a and miR-1 further regulates MEF2C levels [42], [43]. [score:2]
Indeed, consensus binding sites for MEF2 have been identified in the enhancer and promoter region of miR-1 and miR-133 [42], [43]. [score:1]
A) TaqMan QRT-PCR analysis of miR-1-1, miR-133a, miR-133b, and miR-146a in skeletal muscles of TWEAK-Tg mice. [score:1]
TaqMan qRT-PCR analysis of miR-1-1, miR-1-2, miR-133a, miR-133b, miR-206, miR-146a, miR-206, miR146a, and miR-455 in TWEAK -treated C2C12 cells. [score:1]
0008760.g005 Figure 5 A) TaqMan QRT-PCR analysis of miR-1-1, miR-133a, miR-133b, and miR-146a in skeletal muscles of TWEAK-Tg mice. [score:1]
Recently, a few muscle-specific miRs such as miR-1, miR-133a, miR-133b, and miR-206 (also called myomiRs) have been identified which are essential for muscle cell proliferation, differentiation, and maintenance [35]. [score:1]
[1 to 20 of 12 sentences]
40
[+] score: 30
However, these miRNAs can act as tumor suppressors in various human cancers [14]; for instance, miR-1 and miR-133a were found to be frequently down-regulated in bladder cancers, and suppress tumor growth by targeting TAGLN2 [15]. [score:10]
of patients Relative levels of miR-206 (mean ± SEM) P-valueGender   Male210.49 ± 0.070.32Female140.40 ± 0.06 Age (years)   ≥60190.45 ± 0.050.93<60160.46 ± 0.09 Diameter (cm)   ≥5130.46 ± 0.090.90<5220.45 ± 0.05 Location   Middle and proximal third230.47 ± 0.060.65Distal third120.42 ± 0.07 Degree of differentiation   well and moderately120.48 ± 0.070.70Poorly230.44 ± 0.07 Local invasion   T1 + T2100.65 ± 0.070.01T3 + T4250.37 ± 0.05 Lymph node metastasis   NO140.57 ± 0. 060.04YES210.38 ± 0.07 TNM stage   I + II120.60 ± 0.070.02 III + IV 23 0.38 ± 0.06   Expression of miR-133a was also found to be down-regulated in the tumors by the above criteria (Additional file 1: Figure S1), but expression of miR-1, whose genes are clustered with those encoding miR-133a [14], was not (Additional file 2: Figure S2). [score:8]
of patients Relative levels of miR-206 (mean ± SEM) P-valueGender   Male210.49 ± 0.070.32Female140.40 ± 0.06 Age (years)   ≥60190.45 ± 0.050.93<60160.46 ± 0.09 Diameter (cm)   ≥5130.46 ± 0.090.90<5220.45 ± 0.05 Location   Middle and proximal third230.47 ± 0.060.65Distal third120.42 ± 0.07 Degree of differentiation   well and moderately120.48 ± 0.070.70Poorly230.44 ± 0.07 Local invasion   T1 + T2100.65 ± 0.070.01T3 + T4250.37 ± 0.05 Lymph node metastasis   NO140.57 ± 0. 060.04YES210.38 ± 0.07 TNM stage   I + II120.60 ± 0.070.02 III + IV 23 0.38 ± 0.06  Expression of miR-133a was also found to be down-regulated in the tumors by the above criteria (Additional file 1: Figure S1), but expression of miR-1, whose genes are clustered with those encoding miR-133a [14], was not (Additional file 2: Figure S2). [score:8]
Click here for file (A) Distribution of miR-133a expression in a cohort of 35 human GC and noncancerous tissues by qRT-PCR. [score:3]
MiR-1-1/miR-133a-2, miR-1-2/miR-133a-1, and miR-206/miR-133b form clusters in three different chromosomal regions in the human genome 20q13.33, 18q11.2, and 6p12.2, respectively. [score:1]
[1 to 20 of 5 sentences]
41
[+] score: 29
Apparently, the concomitant loss of miR-206, miR-133b and the potential miR-133 sponge in linc-MD1 is compatible with normal muscle development and functions, which might be explained by expression of the miR-1/133a clusters in type I myofibers compensating for deletion of miR-206/133b. [score:4]
The targeting strategy also removed the last exon of the ncRNA linc-MD1 including the putative miR-133a/b binding site in linc-MD1 [9], which is identical to the miR-133b* sequence. [score:3]
The mouse genome contains two miR-1/133a gene clusters located on chromosome 2 and 18, giving rise to identical mature miR-1 and miR-133a miRNAs while the structurally related miR-206/133b cluster is located on mouse chromosome 1. The mature miR-133b differs in only one nucleotide from miR-133a and the primary sequence of miR-206 is highly related to miR-1. Importantly, miR-1 and miR-206 do not differ in the seed sequence that is assumed to determine target specificity of miRNAs [1]. [score:3]
The two miR-1/133a clusters generate identical mature miR-1 and miR-133a miRNAs in heart and skeletal muscle, while the cognate miR-206/133b cluster is exclusively expressed in skeletal muscle. [score:3]
The miRNAs miR-1, miR-206 and miR-133a/b are specifically expressed in striated muscle. [score:3]
Since sequences of the miRNAs miR-133a and miR-133b are almost identical, it seems likely that they share potential targets. [score:3]
We have generated a miR-206/133b knock-out allele by deletion of the genomic region spanning from miR-206 to miR-133b and resulting in removal of the third exon of the linc-MD1 that might act as a miR-133 sponge. [score:2]
Generation of skeletal muscle specific miR-1/miR133a//miR-206/133b triple mutants will probably solve this controversy in the future. [score:1]
Three different gene clusters code for the muscle-specific miRNAs miR-206, miR-1 and miR-133a/b. [score:1]
Surprisingly, lack of miR-206/133b and the miR-133 decoy, contained in the third exon of linc-MD1, did not have obvious effects on satellite cell proliferation and differentiation. [score:1]
Due to the presence of miR-133a in skeletal muscles, which differs by only one nucleotide from miR-133b, it was not possible to demonstrate the absence of mature miR-133b in homozygous mutant animals. [score:1]
Theoretically, the inactivation of miR-133b might also be counteracted by the loss of the miR-133 sponge function, although the physiological relevance of endogenous competing RNAs has been questioned making this explanation less likely [34]. [score:1]
The primary sequence (A) of mature miR-1/133a encoded on chromosome 2 and 18 is identical, miR-206 differs in four bases from miR-1, and miR-133b differs in one base from miR-133a (red). [score:1]
In addition, the primary sequence of miR-206 differs from miR-1 while miR-133b is very similar to miR-133a. [score:1]
Deletion of both miR-133a copies affects cardiomyocyte proliferation and heart physiology [4] and results in a centronuclear skeletal myopathy and a shift of muscle fiber identity from glycolytic to oxidative muscle fibers in the soleus muscle [5]. [score:1]
[1 to 20 of 15 sentences]
42
[+] score: 28
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
A few notable exceptions are miR-499, an miRNA abundantly expressed in the heart (Figure 2A), which is represented by only one read (Table 2), and the miR-133 family, which is preferentially and abundantly expressed in the heart (Figure 2), and represented by only 7 reads (Table 1). [score:5]
The expression patterns of miR-1 and miR-133 largely overlapped in many tissues examined in this study (Figure 2). [score:3]
These two miRNA genes – miR-1 and miR-133 – exist as a cluster and thus are always expressed together in mouse [42]. [score:3]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
Like miR-1, miR-133 is a muscle-specific miRNA (Figure 2) because of its abundant expression in many other muscular tissues such as heart and skeletal muscle [45, 46]. [score:3]
Similarly, we found all members of the miR-15, miR-16, miR-18 and miR-133 families in our sequences, suggesting that all members belonging to these miRNA families are expressed in these three (heart, liver and thymus) tissues. [score:3]
Additionally, miR-1 and miR-133 in the heart, miR-181a and miR-142-3p in the thymus, miR-194 in the liver, and miR-143 in the stomach showed the highest levels of expression. [score:3]
For instance, miR-133 is represented only by 4 clones (two reads each for 133a and 133b) in our sequences, which indicates a 100-fold lower expression level compared with that of miR-1 family, if cloning frequency taken as a measure of expression. [score:2]
The discrepancies between the cloning frequency and small RNA blot results for miRNA-1 and miR-133 could not be attributed to the RNA source because the same RNA samples were used for both experiments (cloning and small RNA blot analysis). [score:1]
We also used approximately a similar amount (activity) of [32]P -labelled probe for detection of miR-1 and miR-133. [score:1]
However, our small RNA blot analysis indicated a different picture as miR-133 was detected as abundantly as miR-1 in the heart (Figure 2). [score:1]
[1 to 20 of 11 sentences]
43
[+] score: 27
A dual-detargeted virus named vMC [24]-NC, with miR-124 targets in the 5′ NCR and miR-133 plus miR-208 targets in the 3′ NCR, showed the suppression of replication in both nervous and cardiac tissues but retained full oncolytic potency when administered by intratumoral (10 [6] 50% tissue culture infectious doses [TCID [50]]) or intravenous (10 [7] to 10 [8] TCID [50]) injection into BALB/c mice bearing MPC-11 plasmacytomas. [score:9]
In vivo toxicity testing confirmed that miR-124 targets within the 5′ NCR suppressed virus replication in the central nervous system while miR-133 and miR-208 targets in the 3′ NCR suppressed viral replication in cardiac tissue. [score:9]
This inhibition of viral replication by the 3′ NCR insertions may be due to the presence of miR-142, miR-133, or miR-208 in certain cells or nonspecific effects of the insertions themselves. [score:3]
To enhance its safety profile, microRNA target sequences complementary to miR-124 or miR-125 (enriched in nervous tissue), miR-133 and miR-208 (enriched in cardiac tissue), or miR-142 (control; enriched in hematopoietic tissues) were inserted into the vMC [24] NCRs. [score:3]
Unexpectedly, mice injected with vMC [24]-H2 or vMC [24]-C also had reduced mean viral loads in all three tissues, suggesting that either the placement of the insert can control viral replication in vivo or that there are low to intermediate levels of miR-142, miR-133, or miR-208 present regulating viral tropism. [score:2]
Sequences complementary to miR-142, miR-124, miR-125, miR-133, and miR-208 were successfully incorporated (individually or in combination) into the 5′ and 3′ NCRs of the vMC [24] genome. [score:1]
[1 to 20 of 6 sentences]
44
[+] score: 26
Other miRNAs from this paper: mmu-mir-133a-2, mmu-mir-133b
To provide functional evidence that these are authentic targets of miR-133ab, we selected three predicted targets within cluster E and examined their expression in Neuro2A cells in which levels of miR-133a or miR-133b have been enhanced using microRNA mimics, or suppressed by microRNA inhibitors. [score:11]
Cells were transfected with one of the following: miRCURY LNA Power Inhibitor (Exiqon) targeted towards either miR-133a or miR-133b; miRCURY LNA microRNA Mimic for either miR-133a or miR-133b; or miRCURY LNA microRNA inhibitor negative control. [score:7]
On the other hand, silencing of miR-133a or miR-133b robustly elevated the expression of SH3GL2 but not SYT1 or SV2A (Figures 5D–F). [score:3]
Either one or both mimics of miR-133a and miR-133b strongly suppressed the levels of SH3GL2, SYT1 and SV2A proteins in transfected Neuro2A cells compared with controls (Figures 5D–F). [score:2]
As miR-133ab levels have been reported to be low in the brain [23], we used an ultra-sensitive qRT-PCR approach to quantify levels of mature miR-133a and -133b in the murine SCN (Figure 5B). [score:1]
cDNA synthesis was performed using the Universal cDNA Synthesis Kit II (Exiqon) and 20 ng of total RNA (for miR-133b) or 100 ng of total RNA (for miR-133a). [score:1]
miR-133b abundance was elevated throughout the subjective night, whereas miR-133a levels peaked sharply at CT 14 (Figure 5B). [score:1]
[1 to 20 of 7 sentences]
45
[+] score: 26
The direct proofs showing that miRNAs are involved in cardiac IPost were from recent one report [21], in which the expression of miR-133 and miR-1 were up-regulated by IPost. [score:7]
IPost up-regulated miR-1, miR-15b, miR-21, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-214, miR-208 and miR-499, while down-regulated miR-23a and miR-9 as compared with Sham group. [score:6]
Compared with sham group, the expressions of miR-1, miR-15b, miR-21, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-214, miR-208 and miR-499 were increased in IPost hearts, while miR-9 and miR-23a were down-regulated in IPost mo dels. [score:5]
Then real-time quantitative PCR was performed to quantify the expression level of miR-1, miR-9, miR-15b, miR-21, miR-23a, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-208, miR-214 and miR-499 with SYBR Green PCR Master Mix (Applied Biosystems) according to the manufacturer’s instructions. [score:3]
As previously reported, a collection of miRNAs were abnormally expressed in ischemic mouse hearts in response to I/R injury, such as miR-1, miR-9, miR-15b, miR-21, miR-23a, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-208, miR-214 and miR-499 [20, 21, 28]. [score:3]
Recently, He et al. demonstrated that cardiac miR-1 and miR-133 were significantly increased by IPost during reperfusion in an I/R injury rat mo del, indicating some miRNAs may be involved in the regulation of cardiac IPost during reperfusion [21]. [score:2]
[1 to 20 of 6 sentences]
46
[+] score: 24
Among the six up-regulated miRs in CSCs we find the four most highly expressed miRs in these cells: miR-125b, miR 126, miR-133a and miR-24. [score:6]
miR-133a emerged as the most differentially expressed between the two cell types, with an 100 fold higher expression level in CSCs, followed by a member of the same miR family, miR-133b. [score:5]
Indeed, while miR-1 promotes differentiation of ES cells towards a cardiac fate, miR-133 inhibits differentiation into cardiac muscle [23], [27]. [score:3]
The differential expression of miR-133 in CSCs is therefore clearly indicative of a commitment to the cardiomyocyte lineage, compatible with the maintenance of an undifferentiated, non-proliferative state. [score:3]
[49] miR-133a 29.4±0.6 Regulation of cardiomyocyte differentiation. [score:2]
Additionally, miR-1 and miR-133a are key regulators of cardiomyocyte proliferation and differentiation, assuming antagonistic roles in these processes. [score:2]
The expression of miR-133a, miR-133b and miR-208 is considered a specific mark of cardiomyocyte lineage differentiation [13]– [16]. [score:2]
The muscle specific miR-1 and miR-133a are encoded in the same bicistronic transcriptional unit, under the control of the cardiogenic transcription factors MEF2 and SRF [19], [20]. [score:1]
[1 to 20 of 8 sentences]
47
[+] score: 23
Mutating some of the predicted miRNA seed sites (Fig 5C; see S1 for details) in the Gdnf 3’UTR either reduced or abolished the ability of miR-9, miR-96, miR-133a, and miR-146a to inhibit expression (Fig 5D), suggesting a direct interaction between these miRNAs and some of the predicted sites in the Gdnf 3’UTR. [score:6]
We conclude that miR-9, miR-96, miR-133, and miR-146a interact directly with their binding sites in the Gdnf 3’UTR; moreover, miR-9, miR-96, and miR-146a regulate the expression of GDNF in vitro. [score:5]
Our analysis of miRNA expression revealed that miR-9, miR-133a, miR-133b, miR-125a-5p, miR-125b-5p, miR-30a, miR-30b, and miR-146a are all expressed in the developing forebrain, adult dorsal striatum and in the developing kidney (S4 Table). [score:5]
We examined the miRNAs miR-133a, miR-133b, miR-125a-5p, miR-125b-5p, miR-30a, miR-30b, miR-96, miR-9, and miR-146a, which were selected based on their co -expression with Gdnf in several brain areas [17, 19, 32, 33]; see also www. [score:3]
miR-9, miR-96, miR-133 and miR-146a are novel regulators of GDNF. [score:2]
We identified binding sites for miR-9 and miR-96 in the 3’UTR of Gdnf; in addition, we identified binding sites for miR-133 and miR-146a. [score:1]
Note that miR-9/96/133m contains overlapping sites for miR-9, miR-96, and miR-133, all of which were mutated in this construct. [score:1]
[1 to 20 of 7 sentences]
48
[+] score: 22
Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42]. [score:8]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
Bladder cancer-specific expression of TRAIL genes was achieved by employing MREs of miR-1, miR-133 and miR-218. [score:3]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
Application of MREs of miR-1, miR-133 and miR-218 restrained exogenous gene expression within bladder cancer cells. [score:3]
Ad-TRAIL-MRE-1-133-218 contained MREs of miR-1, miR-133 and miR-218 that were inserted immediately following TRAIL gene. [score:1]
AACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACC AAGCACAAACAAACACC AAGCACAA-3′), which contained two copies of miR-1 MREs, two copies of miR-133 MREs and two copies of miR-218 MREs. [score:1]
[1 to 20 of 7 sentences]
49
[+] score: 22
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-206, mmu-mir-1a-2, mmu-mir-133a-2, mmu-mir-1b
Previously, in muscles from LGMD2A patients, we found Pax7 -positive SCs were highest in specimens from older patients with longer disease duration, correlating with downregulation of miR-1, miR-133a, and miR-206 [12]. [score:6]
Pax7 -positive SCs were highest in the fibrotic group and correlated with microRNA dysregulation as downregulation of miR-1, miR-133a, and miR-206. [score:5]
In muscle biopsied from LGMD2A patients, Pax7 -positive SCs were highest in the fibrotic group and correlated with microRNA dysregulation as downregulation of miR-1, miR-133a, and miR-206 [12]. [score:5]
The change in expression levels of miR-1 (Fig.   4b) and miR-133a (Fig.   4c) were also lower than that in the WT counterparts at both time points followed a similar pattern of slower decline. [score:3]
TGF-β and microRNA (miR-1, miR-206, miR-133a) regulation were also assessed. [score:2]
mirR-206 (a), miR-1(b), miR-133a (c), and TGF-β (d) levels in the regenerating CAPN3- KO and WT are relative to their baseline levels (dashed line), obtained from the uninjected muscles of 4 weeks post injection cohorts in each group. [score:1]
[1 to 20 of 6 sentences]
50
[+] score: 20
To identify putative targets of miR-1, miR-133a, miR-124a-3, miR-134, and miR-206, we searched the literature to identify targets of these miRNAs that had been detected by expression arrays in tumors and had been further validated by other methods. [score:7]
miR-1, miR-133a, and miR-206 are all part of a group of myo-miRs, miRNAs whose expression is enriched in skeletal and cardiac muscle (McCarthy, 2008). [score:3]
Five of the six miRNAs evaluated showed similar fold-differences in expression between microarray and qPCR for FVB/NJ and SPRET/EiJ skin (Fig. 1 and data not shown); however, only miR-1, miR-133a and miR-206 showed statistically significant differences in expression by qPCR (p-value < 0.05). [score:3]
miR-1, along with miR-133a, miR-205 and let-7d, showed decreased expression in SCCs of the head and neck in comparison to normal adjacent tissue (Childs et al., 2009). [score:3]
Following analysis, six miRNAs (miR-1, miR-133a, miR-124a-3, miR-134, miR-206, and miR-9-1) showed a significant difference in average expression and had a 2.0 fold or greater difference across one or more probe sets. [score:3]
Probes were specific to either mature (miR-1, miR-133a, miR-124a-3, miR-206) or precursor (miR-134, miR-206, miR-9-1) miRNAs concordant with the array results. [score:1]
[1 to 20 of 6 sentences]
51
[+] score: 19
While another group has reported that miR-133a is highly expressed in the sheep heart [17], they did not, as has been done in the present study, specify expression of the different isoforms. [score:5]
Four myocardial-enriched miRNAs, miR-1, miR-133, miR-499 and miR-208, were confirmed to be highly expressed in ovine heart tissue. [score:3]
For the first time we report that not only are the four cardiac-enriched miR-1, miR-133, miR-499 and miR-208 highly expressed in sheep LV, but also provide information on their isomiRs. [score:3]
In this study, NGS detected high counts of oar-miR-133, while array yielded high expression of hsa-/mmu-/rno-miR-133a-3p, which is one nt longer at the 5′ end compared to oar-miR-133. [score:2]
Oar-miR-133 was the main form in sheep heart, while hsa-/mmu-/rno-miR-133a-3p and-5p and hsa-/mmu-/rno-miR-133b were detected at much lower counts. [score:1]
Oar-miR-133 is currently the only cardiac specific miRNA listed in miRBase 21. [score:1]
Of these, oar-miRNA-133 is the only one presently recorded in miRBase (v21). [score:1]
MiR-1, miR-133, miR-499 and miR-208 are highly enriched myocardial miRNAs 27, 28 and are highly conserved across multiple species including human [29], mouse [30] rat [31] and porcine [32]. [score:1]
Cardiac-enriched miR-1-3p, miR-133a-3p, miR-133b-3p, miR-208b-3p and miR-499-3p were screened. [score:1]
The most abundant cardiac-specific miRNA-133 in the sheep heart was oar-miR-133 which has one nt different from hsa-/mmu-/rno-miR-133a-3p (previously hsa-miRNA-133). [score:1]
[1 to 20 of 10 sentences]
52
[+] score: 18
[13], [14] Amongst the hundreds of miRs, cardiac fibrosis has been associated with downregulation of miR-29, miR-30, miR-101, and miR-133 families, and with upregulation of miR-21. [score:7]
Cardiac fibrosis is associated with downregulation of miR-29, miR-30, miR-101, and miR-133, and upregulation of miR-21. [score:7]
The intensities for several of these miRs did not change over 3–7 days, including miR-29a, miR-29b, miR-30, miR-101 or miR133 families. [score:1]
There was no significant change in miR-133, miR-30, or miR-101 family members after LPS. [score:1]
[15]– [17] The cardiac fibrosis that develops with decreased miR-133 and miR-30c involves CTGF, [30] which did not change with LPS. [score:1]
Cardiac fibrosis has been associated with decreases in miR-29, [25] miR-133, miR-30, [30] miR-101 [17] and/or increased miR-21 [31], [32] in pathological conditions (e. g. ischemia-reperfusion, hypertrophy and heart failure). [score:1]
[1 to 20 of 6 sentences]
53
[+] score: 18
Given the requisite role of miR-1 and miR-133 in cell survival and development, it is convincing to believe that the redundant transcription complexes directing miR-1 and miR-133a expression are elegantly developed to ensure cells to survive under evolutionary pressure. [score:5]
MiR-1 and miR-133 are muscle-enriched microRNAs, and they have been demonstrated as critical factors involved in both cardiac and skeletal muscle development and diseases [20- 25]. [score:4]
Given the importance of miR-1 and miR-133 in various cardiomyopathy developments, such as cardiac hypertrophy, understanding the precise control of SRF -mediated microRNA gene regulation in the heart will provide an additional perspective for the treatment of SRF dysfunction -mediated cardiomyopathy. [score:3]
Given that individual microRNAs regulate potentially dozens of genes, functions of miR-1 and miR-133 in cardiac muscle and skeletal muscle can be quite distinct [23, 26, 27]. [score:2]
Both miR-1 and miR-133 also participate in cardiomyopathy development including cardiac hypertrophy [25, 28], cardiac fibrosis [29, 30], and arrhythmia [30, 31]. [score:2]
While the deficiency of miR-133a leads to cardiomyocyte proliferation and VSD. [score:1]
For skeletal muscle, miR-1 facilitates myogenesis, and miR-133 promotes myoblast proliferation [20]. [score:1]
[1 to 20 of 7 sentences]
54
[+] score: 18
In hypertrophic adult rat VCMs, down-regulation of miR-1/miR-133 levels promotes automaticity via up-regulation of HCN2/HCN4, but this defect can be reversed by forced expression of miR-1/miR-133 [10], [11]. [score:9]
This observation was consistent with the upregulation of NKX2.5 seen in EBs differentiated from LV-miR-1-transduced, but not LV-miR-133-transduced or WT, H7 hESCs that Srivastava and colleagues reported [8]. [score:4]
Indeed, miR-133 has been implicated in early cardiac differentiation of murine and human ESCs by repressing the non-mesoderm lineages, rather than by directly promoting cardiogenesis per se [8]. [score:2]
The profiles of miR-1, let-7a, let-7b, miR-26b, miR-30b, miR-125a, miR-126, miR-133a, miR-143, and miR-499 in hE/F/A-VCM were confirmed by qPCR (Figure 1B). [score:1]
Consistently, miR-133 exerts no effects on Ca [2+]-handling and contractile proteins when cardiovascular progenitors of later stages were transduced. [score:1]
Interestingly, miR-133a has two sequences located within the same introns where miR1-1 and -1-2 are found [45]. [score:1]
[1 to 20 of 6 sentences]
55
[+] score: 17
Other miRNAs from this paper: mmu-mir-133a-2, mmu-mir-133b, mmu-mir-133c
The muscle-specific miR-133 has critical functions in the heart and is a powerful inhibitor of cardiac hypertrophy [25, 26, 33] and the transcription factor SRF is an important regulator of several hypertrophy associated genes, such as Nppa, Nppb and Acta1 [34]. [score:4]
Above that, two groups have shown impaired myogenic differentiation after silencing of Malat-1 in vitro [23, 24], possibly via regulation of microRNA-133. [score:2]
Interestingly, only an effect of Malat-1 on vascularization of the retina was shown in Malat-1 KO mice [22], whereas its functions in hind limb ischemia, ERK/MAPK signaling, miR-133 scavenging, and possibly diabetic cardiomyopathy were exclusively shown by posttranscriptional knockdown of Malat-1 [22– 24, 29, 39, 40]. [score:2]
These findings argue against a relevant influence of Malat-1 on ERK/MAPK signaling or miR-133/SRF regulation in the heart. [score:2]
However, no critical role for Malat-1 was found in pressure overload -induced heart failure in mice, despite its reported role in vascularization, ERK/MAPK signaling, and regulation of miR-133. [score:2]
Despite its reported function as regulator of vascularization, activator of ERK/MAPK signaling, and scavenger for the muscle-specific miR-133, we conclude that Malat-1 has no important role for cardiac hypertrophy and failure in vivo. [score:2]
Malat-1 modulates hypoxia -induced vessel growth, activates ERK/MAPK signaling, and scavenges the anti-hypertrophic microRNA-133. [score:1]
Scavenging of miR-133 by Malat-1 may therefore increase levels of SRF, an important mediator of cardiac hypertrophy [27]. [score:1]
Additionally, Malat-1 has been proposed to act as a competing endogenous RNA for microRNA-133, thereby attenuating miR-133 mediated repression of serum response factor (SRF) [24]. [score:1]
[1 to 20 of 9 sentences]
56
[+] score: 17
The up-regulation of Pmp22 and Mpz proteins in the spinal cord of MLC/SOD1 [G93A] paralleled that of mRNA expression and supports the evidence that these factors are molecular targets of microRNAs, such as miR-1, miR-9, miR-133, and miR-330, that resulted differently modulated in the spinal cord of MLC/SOD1 [G93A] mice compared to wild type littermates. [score:7]
In particular, we found down regulation of mir-1, mir-330, mir-29, mir-133, and mir-9 family members, whose dysregulation can have profound effects on neuronal physiology and pathology, including Huntington, Alzheimer, and Parkinson diseases (Saito and Saito, 2012). [score:5]
Graphs indicate relative expression of (A) mir-133a (B) mir-133b (C) mir-9 (D) mir-29 (E) mir-330 (F) mir-1. White bar refers to wild type (Wt) and black bar to MLC/SOD1 [G93A] (Tg). [score:3]
Of note, the miRnome profiling revealed the down regulation of mir-330, mir-133, and mir-1, which are involved in denervation and reinnervation processes (Jeng et al., 2009; Tsutsumi et al., 2014). [score:2]
[1 to 20 of 4 sentences]
57
[+] score: 17
The individual expression levels of the myomiRs mmu-miR-1-3p, mmu-miR-133a-3p and hsa-miR-206 are reported in Fig.   3. MiR-133a and miR-1 both significantly increased with time (main effect of time, p < 0.001 and p < 0.01, respectively), while miR-206 expression significantly decreased with time (main effect of time, p < 0.001). [score:5]
MRFs are involved in the transcriptional regulation of muscle enriched miRNAs (myomiRs), including miR-1, miR-133 and miR-206, and regulatory feedback loops have been identified between miRNAs and MRFs in muscle cells [26, 34– 36]. [score:3]
Our study respectively reported a 4-fold and 3-fold increase in mmu-miR-1a-3p and mmu-miR-133a-3p expression levels over the first 12 weeks of age. [score:3]
Box-plots of miRNA expression levels of the myomiRs mmu-miR-1-3p (a), mmu-miR-133a-3p (b) and hsa-miR-206 (c) in mouse quadriceps muscle at 2 days, 2 weeks, 4 weeks and 12 weeks after birth. [score:3]
MiR-1, miR-133a and miR-206 are highly conserved between species. [score:1]
MiR-1, miR-133a and miR-206 were amongst the 3 first identified myomiRs, with miR-1 and miR-133a being part of a bicistronic cluster on the same chromosome [36]. [score:1]
MiR-133a and miR-1 respectively promote myoblast proliferation and differentiation via the repression of Srf and Hdac4 [36]. [score:1]
[1 to 20 of 7 sentences]
58
[+] score: 17
These effects are specific to the inhibition of miR-206, as the over -expression or inhibition of other miRNAs that are enriched in muscle, including miR-133a and the miR-29 family did not have any effect on morphology in similarly differentiated myotubes (Figure S2a-b). [score:7]
Figure S2 Expression or inhibition of miR-133a or the miR-29 family does not affect myotube hypertrophy in vitro. [score:5]
control) expression was increased, whilst miR-133a (*, p=0.02 vs. [score:3]
In contrast to miR-206, we found that manipulation of miR-133a and the miR-29 family in highly differentiated myotubes had no effect on myotube hypertrophy, in spite of their role in the regulation of cardiomyocyte growth [4]. [score:2]
[1 to 20 of 4 sentences]
59
[+] score: 17
Although miR-133a was downregulated in serum-derived exosomes of CL -treated mice, miR-133a expression was neither significantly altered in brown adipocyte-derived exosomes nor in any of the mouse mo dels analysed (Fig. 2b,c). [score:6]
Although miR-92a and miR-133a expression levels showed considerable inter-individual variation in cohort 1, their expression was not different between males and females and was not related to any other parameter such as age, or BMI. [score:5]
Human serum miR-92a and miR-133a expression levels were not normally distributed in cohort 1 according to Shapiro–Wilk test (P=0.000 and P=0.001, respectively). [score:3]
Such correlation was absent for miR-133a (Supplementary Fig. 3b). [score:1]
478511, Life Technologies) was used to quantify miR-133a located on chromosome 18: 19405659-19405746 [−] with the sequence 3′- UUUGGUCCCCUUCAACCAGCUG -5′. [score:1]
For the analysis of human exosomal miRNAs, we focused on miR-92a and miR-133a, whereas miR-34c* was not detectable in human serum exosomes. [score:1]
[1 to 20 of 6 sentences]
60
[+] score: 17
In integrated analysis of the inverse relationship of expressed miRNAs and mRNAs, mmu-miR-204 expression was reduced in Sca-1 [+]CD31 [−] compared to Sca-1 [+]CD31 [+] cells, using target musculus collagen, type VIII, alpha 1, and musculus enhancer trap locus 4. Reduced levels of miR-1 and miR-133 are observed in mouse ESCs following artificial induction of myocardial differentiation [26]. [score:6]
Analysis of the expression of cardiomyocyte-specific miRNAs miR-1, miR-133a/b, and miR-208a/b and mRNAs MYH6 and TNNT2 showed upregulation of miR-1, miR-133 a/b, miR-208a/b, and MYH6 and TNNT2 in differentiated cardiomyocyte cells compared to freshly isolated Sca-1 [+]CD31 [−] cells (Figure 6). [score:5]
In our study, mmu-miR-1 was not differently expressed and mmu-miR-133 and mmu-miR-208a expression was reduced in Sca-1 [+]CD31 [−] compared to Sca-1 [+]CD31 [+] cells. [score:4]
Analysis of the expression of cardiomyocyte-specific miRNAs miR-1, miR-133a/b, and miR-208a/b and mRNAs MYH6 and TNNT2 revealed miRNA patterns indicative of stem cell characteristics. [score:1]
Among miRNAs expressed in the heart, miR-1, miR-133, miR-208, and miR-499 are the most commonly investigated subtypes. [score:1]
[1 to 20 of 5 sentences]
61
[+] score: 16
Based on the TargetScan, miRanda, and Diana microT computational algorithms, we determined that miR-1, miR-133a, and miR-206 might target a combined site in the G6PD 3′-UTR gene sequence. [score:5]
Levels of these miR-1 targets in miRNPs are also shown following miR-133a/206 transfection. [score:3]
However, neither miR-133a nor miR-206 expression differed in HR-HPV+ cervical cancer cells compared to control cells (Figure 4A). [score:2]
RIP-Chip revealed that G6PD mRNA was recruited to the miRNPs to the greatest degree following transfection with miR-1. (A-a) Enrichment in AGO-miRNPs after miR-1 transfection, n = 3161; (A-b) Enrichment in AGO-miRNPs after miR-133a transfection, n = 3336; (A-c) Enrichment in AGO-miRNPs after miR-206 transfection, n = 5958. [score:1]
Co-immunoprecipitation (co-IP) revealed that transfected miR-1, miR-133a, and miR-206 were specifically incorporated into miRNPs in both Hela (Figure 1A) and Siha cells (Figure 1B). [score:1]
By contrast, G6PD mRNA was not enriched in miRNPs following transfection with either miR-133a or miR-206 (Figure 2A–2B and Figure 2A–2C). [score:1]
After 24 hours, cells were transfected with 25 nM “Pre-miRNA” (Ambion) for has-miR-1, has-miR-133a, has-miR-206, or Negative Control (NC, Ambion, Austin, TX, sense sequence AGUACUGCUUACGAUACGG) using RNAiMAX (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions [13]. [score:1]
Among the many miRNAs identified, miR-1, miR-133a, and miR-206, each of which were predicted by all three software programs, were chosen for further validation. [score:1]
Figure 2RIP-Chip revealed that G6PD mRNA was recruited to the miRNPs to the greatest degree following transfection with miR-1. (A-a) Enrichment in AGO-miRNPs after miR-1 transfection, n = 3161; (A-b) Enrichment in AGO-miRNPs after miR-133a transfection, n = 3336; (A-c) Enrichment in AGO-miRNPs after miR-206 transfection, n = 5958. [score:1]
[1 to 20 of 9 sentences]
62
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Tumour suppressors miR-1 and miR-133a target the oncogenic function of purine nucleoside phosphorylase (PNP) in prostate cancer. [score:5]
miR-145, miR-133a and miR-133b: tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. [score:5]
Most of these pathways have been implicated in AD and/or colon cancer (Kisby et al., 2011a) and, in a separate recent study, some (pathways in cancer, Wnt signaling, MAPK signaling, and calcium-pathway signaling) have been predicted to be regulated by miR-1/miR-133A (Table 2). [score:2]
The right-hand column shows the biological processes or signaling pathways potentially regulated by the miR-1/miR-133a cluster in human cancers examined by *Nohata et al. (2012). [score:2]
The functional significance of miR-1 and miR-133a in renal cell carcinoma. [score:1]
[1 to 20 of 5 sentences]
63
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-18a, hsa-mir-21, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-30a, mmu-mir-99a, mmu-mir-126a, mmu-mir-9-2, mmu-mir-138-2, hsa-mir-192, mmu-mir-204, mmu-mir-122, hsa-mir-204, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-138-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-103-1, mmu-mir-103-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-26a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-26a-2, hsa-mir-376c, hsa-mir-381, mmu-mir-381, mmu-mir-133a-2, rno-let-7a-1, rno-let-7a-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-18a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-26a, rno-mir-30a, rno-mir-99a, rno-mir-103-2, rno-mir-103-1, rno-mir-122, rno-mir-126a, rno-mir-133a, rno-mir-138-2, rno-mir-138-1, rno-mir-192, rno-mir-204, mmu-mir-411, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-193b, rno-mir-1, mmu-mir-376c, rno-mir-376c, rno-mir-381, hsa-mir-574, hsa-mir-652, hsa-mir-411, bta-mir-26a-2, bta-mir-103-1, bta-mir-16b, bta-mir-18a, bta-mir-21, bta-mir-99a, bta-mir-126, mmu-mir-652, bta-mir-138-2, bta-mir-192, bta-mir-23a, bta-mir-30a, bta-let-7a-1, bta-mir-122, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-204, mmu-mir-193b, mmu-mir-574, rno-mir-411, rno-mir-652, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-1-2, bta-mir-1-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-138-1, bta-mir-193b, bta-mir-26a-1, bta-mir-381, bta-mir-411a, bta-mir-451, bta-mir-9-1, bta-mir-9-2, bta-mir-376c, bta-mir-1388, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-451b, bta-mir-574, bta-mir-652, mmu-mir-21b, mmu-mir-21c, mmu-mir-451b, bta-mir-411b, bta-mir-411c, mmu-mir-126b, rno-mir-193b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The expression analysis of selected miRNAs using qRT-PCR also showed that miR-26a and -99a were highly expressed in all tissues, while miR-122 and miR-133a were predominantly expressed in liver and muscle, respectively. [score:7]
Comparison of miRNA expression profiles among tissues revealed that very few miRNAs expression was tissue specific (e. g., miR-9, -124 in brain, miR-122 in liver, miR-1, miR-133a and -206 in muscle). [score:5]
Our comparison of miRNA expression across 11 tissues from bovine revealed a few tissue specific miRNAs: miR-9, -124 in brain, miR-122 in liver, miR-1, miR-133a and -206 in muscle, which had been previously reported in mouse and human [13, 27]. [score:3]
[1 to 20 of 3 sentences]
64
[+] score: 15
Other miRNAs from this paper: mmu-mir-133a-2, mmu-mir-133b, mmu-mir-133c
In addition, Zhang et al., showed that TSA enhances cell resistance to hypoxic insult by upregulating miR-133 expression through activation of MAPK-ERK1/2 [24]. [score:6]
For instance, Zhang et al., demonstrated that TSA enhances cell resistance to hypoxic insult by upregulating miR-133 expression through activation of the mitogen-activated protein kinase (MAPK)/extracellular signal-related kinase (ERK) pathway in neonatal cardiomyocytes [24]. [score:6]
Zhang L. Wu Y. Li Y. Xu C. Li X. Zhu D. Zhang Y. Xing S. Wang H. Zhang Z. Tanshinone IIA improves miR-133 expression through MAPK ERK1/2 pathway in hypoxic cardiac myocytes Cell. [score:3]
[1 to 20 of 3 sentences]
65
[+] score: 15
By directly comparing the expression levels in the liver and EHBDs, we found that miR-133a/b, -195, -200a, -320 and −365 were consistently higher in EHBDs above livers at most time points, whereas miR-30c expression was lower in EHBDs when normalized to the expression level of U6 miRNA as an endogenous control (P < 0.05, Figure  4). [score:8]
Thus, using integrative bioinformatics we could predict a prominent position for miR-30b/c and secondary positions for miR-133a/b, -195, -200a, -320 and −365 in a network based on the number of target genes and 1 [st] tier links with biological processes and pathways that involved the regulation of immunity and organogenesis, two classes of processes previously linked to pathogenesis of biliary atresia [2, 5]. [score:4]
The remaining miR-200a, -320 and -133a/b were linked to organ and tissue development via Ereg (miR-320), Ctgf, Col8a (miR-133a/b) and Runx1 (miR-200a and -30b/c). [score:2]
05mmu-miR-365−4.620.015−4.450.034mmu-miR-133a−3.650.015−2.670.032mmu-miR-200b−3.960.015−2.840.046mmu-miR-133b−4.410.009−4.350.032mmu-miR-200a−5.560.009−3.110.034 mmu-miR-195 −4.93 0.014 −8.71 0.05 * Minus sign implies fold change below controls. [score:1]
[1 to 20 of 4 sentences]
66
[+] score: 14
Surprisingly, miR-133a was upregulated (t [(8)]=2.59, P=0.0320) and miR-19b was downregulated (t [(8)]=2.75, P=0.0250) in the validation study. [score:7]
Only one gene—trinucleotide repeat-containing gene 6B, Tnrc6b—was the common target of two or more miRNAs (miR-19b and miR-133a). [score:3]
Bioinformatics analysis identified the key biochemical signaling and cellular plasticity pathways that are targeted by miR-19b, miR-133a and miR-455. [score:3]
miR-190b and miR-19b-2 were increased and miR-133a-1, miR-133a-2 (same gene sequences mapped to different chromosomes) and miR-455 were decreased. [score:1]
[1 to 20 of 4 sentences]
67
[+] score: 14
BMP treatment regulates multiple miRNA expression during osteoblastogenesis, and a number of those miRNAs feedback to regulate BMP signaling: [176–179] miR-133 targets Runx2 and Smad5 to inhibit BMP -induced osteogenesis; [176] miR-30 family members negatively regulate BMP-2 -induced osteoblast differentiation by targeting Smad1 and Runx2; 177, 178 miR-322 targets Tob and enhances BMP response. [score:14]
[1 to 20 of 1 sentences]
68
[+] score: 14
For example, miRNA-29 regulates the expression of pro-fibrotic genes and is differentially expressed after myocardial infarction in mice [6], while experimentally overexpressed miRNA-133a protects against pressure overload -induced cardiac remo delling [7]. [score:8]
However, miRNA-133a transgenic mice show no sign of cardiac dilation while having a 13-fold induction of mature miRNA levels, with baseline expression levels as high as miRNA-30c [7]. [score:3]
112.267732 12 Duisters RF, Tijsen AJ, Schroen B, Leenders JJ, Lentink V, et al. (2009) miR-133 and miR-30 regulate connective tissue growth factor: implications for a role of microRNAs in myocardial matrix remo deling. [score:2]
Also, the RISC complex may have become saturated with mature miRNA-30c as has been observed in the previously reported miRNA-133 transgenic mice [42], thereby altering general miRNA biogenesis. [score:1]
[1 to 20 of 4 sentences]
69
[+] score: 14
In contrast, miR-1, miR-10a and miR-133a were downregulated in human CRC tumour tissues, regardless of the histological subtype (S1A, S2A and S3A Figs). [score:4]
S3 FigExpression levels of miR-133a are significantly downregulated in (A) human colorectal adenocarcinoma (conventional (n = 18) and mucinous (n = 20), but not in chronic UC (n = 13) -associated CRC) tumor areas compared to matched R [0] margins, and (B) colon carcinoma-like Caco-2 [D299G] cells compared to enterocyte-like Caco-2 [WT], as determined by qPCR. [score:4]
Expression levels of miR-133a in human CRC patient samples and Caco-2 subclones. [score:3]
S4 FigExpression levels of (A) miR-205, (B) miR-373, (C) miR-1, (D) miR-10a and (E) miR-133a in different human colonic adenocarcinoma cell lines (LS 174T, HT-29, HCT 116 and SW480), in comparison to naïve (untransfected) Caco-2, Caco-2 [WT] and Caco-2 [D299G] cells, as determined by qPCR (n ≥ 2 samples/cell line). [score:3]
[1 to 20 of 4 sentences]
70
[+] score: 14
Our group has observed dysregulated miRNA expression in heart samples from CCC patients [21] and acute T. cruzi infection in mice [33] including miR-133 and miR-208, which regulate heart genes related to cardiovascular disease 34– 39. [score:7]
Yu H Lu Y Li Z Wang Q microRNA-133: expression, function and therapeutic potential in muscle diseases and cancerCurr Drug Targets. [score:7]
[1 to 20 of 2 sentences]
71
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-101-1, dme-mir-1, dme-mir-2a-1, dme-mir-2a-2, dme-mir-2b-1, dme-mir-2b-2, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-101a, mmu-mir-124-3, mmu-mir-126a, mmu-mir-137, mmu-mir-140, mmu-mir-142a, mmu-mir-155, mmu-mir-10b, mmu-mir-183, mmu-mir-193a, mmu-mir-203, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-183, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-222, hsa-mir-223, dme-mir-133, dme-mir-34, dme-mir-124, dme-mir-79, dme-mir-210, dme-mir-87, mmu-mir-295, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, dme-let-7, dme-mir-307a, dme-mir-2c, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-193a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-27a, mmu-mir-34a, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-10a, mmu-mir-210, mmu-mir-223, mmu-mir-222, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-411, hsa-mir-193b, hsa-mir-411, mmu-mir-193b, hsa-mir-944, dme-mir-193, dme-mir-137, dme-mir-994, mmu-mir-1b, mmu-mir-101c, hsa-mir-203b, mmu-mir-133c, mmu-let-7j, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, mmu-mir-124b
Moreover, miR-133a had a significant difference of arm abundances between human skin and brain (47% in skin versus 25% in brain); this tissue-specific expression pattern persisted in mouse (43% in skin versus 26% in brain). [score:3]
Conserved pre-miRNAs with small variance of 5′-isomiR arm abundances among the four species (e. g. let-7 in Table 3) have lower folding energies (box to the right) than those with large variance (e. g. miR-133 in Table 3). [score:1]
We observed that miRNA orthologues (miR-10, miR-133, miR-137 and miR-79 in Table 3) swapped major miRNAs and 5′-isomiRs and had largely different 5′-isomiR arm abundances across human, mouse, fruitfly and worm. [score:1]
Such seed shift, as previously reported (50), was also identified in miR-133-3p and miR-137-3p across fruitfly and human/mouse (Table 3), and found in miR-79-3p between fruitfly and worm. [score:1]
For example, the major fruitfly dme-miR-133 with the seed ‘UGGUCCC’ is located 2-nt away from the upstream bulge (few 5′-isomiRs), but in human, the 5′-isomiR with the same seed ‘UGGUCCC’ is 3-nt away from the upstream bulge in pre-miR-133a-1/2 hairpins (Supplementary Figure S3B), thus plausibly accounting for a higher 5′ end heterogeneity of miR-133a-1/2 in human. [score:1]
Two conserved miRNA families with multiple members, i. e. miR-133 and miR-10, had individual members with large differential 5′-isomiR arm abundances. [score:1]
Paralogous miRNAs in a family can make it difficult or even impossible to determine the origin of 5′-isomiRs, particularly when paralogs share nearly identical mature or precursor sequences, e. g. miR-124-1/2/3 and miR-133a-1/2. [score:1]
Some paralogous hairpins had prominent structural and sequence changes, and different arm abundances of 5′-isomiRs were observed among such paralogous miRNAs, e. g. miR-133a-1/2 and miR-133b. [score:1]
In contrast, pre-miR-133a and pre-miR-133b have different sequences and hairpin structures (Supplementary Figure S3B). [score:1]
For example, human miR-133a-1 and -2 together had an overall 47% of sequencing reads on the 3p arms as 5′-isomiRs whereas miR-133b-3p had only 10% of reads as 5′-isomiRs. [score:1]
The same reads can map to both hairpins, thus making the arm abundance of 5′-isomiRs difficult to precisely determine for individual members of miR-133a. [score:1]
pre-miR-133a-1 and -2 have nearly identical hairpin structures with a few nucleotide differences in their loop regions (Supplementary Figure S3). [score:1]
[1 to 20 of 12 sentences]
72
[+] score: 14
We suspect the failure of normal miR-499 down-regulation in our transgenic mice disrupted the normal response to cardiac pressure stress; similar theories have recently been put forward for cardiac transgenic mice expressing miR-133a [53]. [score:6]
We transfected increasing amounts of miR-499 into 293T cells in culture and found dose -dependent inhibition of the Sox6 UTR-luciferase construct, however another cardiac microRNA, miR-133, had no effect regardless of the dose (Fig. 4A ). [score:3]
Several microRNAs, including miR-1, miR-133, miR-206 and miR-208 [17]– [29], are found in cardiac and/or skeletal muscle, and each has a potentially distinct regulatory function. [score:2]
Sox6 3′UTR -mediated repression increased as amounts of miR-499 was increased; this was not observed with miR-133 or when the UTR orientation was reversed, n = 3–4 transfections per condition, *P<0.05. [score:1]
miR-499 was among the top cardiac-enriched microRNAs (Fig. 1A, Table S1), along with the well-studied microRNAs, miR-1 and miR-133. [score:1]
miR-499 is distinct from miR-1 and miR-133 in that it is encoded in only one genomic locus. [score:1]
[1 to 20 of 6 sentences]
73
[+] score: 14
As we could see in Figure 9, the effects on inhibiting tumor volume were most significant when the aberrantly expressed miR-34a, miR-143 and miR-214 were corrected, and then followed by miR-195 and miR-133a Figure 9 SD, standard deviation; CI, confidence interval. [score:5]
As we could see in Figure 9, the effects on inhibiting tumor volume were most significant when the aberrantly expressed miR-34a, miR-143 and miR-214 were corrected, and then followed by miR-195 and miR-133a Figure 9 SD, standard deviation; CI, confidence interval. [score:5]
This resulted 5 different miRNAs were analyzed, including 4 tumor suppressor miRNAs(miR-195, miR-143, miR-34a and miR-133) and 1oncogene(miR-214). [score:3]
there no significantly decreased when the miR-133a was recovered (pooled MD = [-2.48]; 95% confidence interval [CI]: [-4.03]- [-0.92]; p = 0.92; Figure 9, part 4) [40]. [score:1]
[1 to 20 of 4 sentences]
74
[+] score: 14
In fact, extracellular GTP up-regulated the miR-133a and miR133b expression. [score:6]
miR-133a and miR-133b were significantly up-regulated after 24 h of 500 μM GTP stimulation of myoblasts (GTP-undiff) compared to control (CTR-undiff). [score:3]
The graphs show the relative expression of miR-133a, miR-133b, miR-1, and miR-206 both in myoblasts (CTR-undiff), in cells differentiated for 24 h in DM (CTR-diff) and in 500 μM GTP-stimulated myoblasts and differentiating cells (GTP-undiff and GTP-diff, respectively). [score:3]
These phases influence and in turn are influenced both by myogenic regulator factors as Myogenin and by myo-microRNA, specifically miR-1, miR133a/b, and miR-206 (Drummond et al., 2011; Di Filippo et al., 2017). [score:2]
[1 to 20 of 4 sentences]
75
[+] score: 13
miR-133a has sharply increased expression during muscle differentiation and functions not only in the inhibition of muscle differentiation but also in the promotion of myoblast proliferation [42, 43]. [score:5]
However, the roles and expression pattern of miR-140-3p are similar to those of miR-133a, which is an important muscle-specific miRNA during muscle development [42, 43, 44]. [score:4]
Therefore, miR-140-3p may be a positive regulator during muscle development similar to miR-133a. [score:3]
Chen J. F. Man del E. M. Thomson J. M. Wu Q. Callis T. E. Hammond S. M. Conlon F. L. Wang D. Z. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation Nat. [score:1]
[1 to 20 of 4 sentences]
76
[+] score: 13
As far as RP is concerned, Loscher et al. reported upregulation of miR-1a, miR-133a, and miR-142a in four different mouse mo dels of RP linked to genes involved in both autosomal dominant and autosomal recessive forms of the disease, rhodopsin and rds/peripherin, respectively. [score:6]
In any case, differential expression of miR-1a, miR-133a, and miR-142 in our study, as well as in the work of Loscher et al., is observed after the onset of apoptosis. [score:3]
In support of this, selective ablation of Müller cells resulted in photoreceptor death, and an altered expression of miR-1a, miR-133a, and miR-142. [score:3]
He B, Xiao J, Ren AJ, Role of miR-1 and miR-133a in myocardial ischemic postconditioning. [score:1]
[1 to 20 of 4 sentences]
77
[+] score: 13
In the SOD1(G93A) mouse mo del of amyotrophic lateral sclerosis (ALS), miR-133 as well as miR-206 are upregulated at symptomatic stages [13]. [score:4]
Skeletal muscles express a rich assortment of miRNAs, including the highly conserved miR-206/miR-1 and miR-133a/b families of miRNAs [19], [20]. [score:3]
Levels of pre-miR-133b and AChRγ increase dramatically in denervated muscle, while levels of pre-miR-133a-1, pre-miR-133a-2 and GAPDH are unchanged, suggesting differential regulation of miR-133a and miR-133b. [score:2]
In contrast, levels of pre-miR-133a-1/2 and GAPDH RNAs were not detectably changed, demonstrating differential regulation of miR-133a and miR-133b (Fig. 3A). [score:2]
Potential candidates for mediating such responses include the miR-1 and miR-133a families of miRNAs which are highly similar to miR-206 and miR-133b, respectively. [score:1]
Two loci related to 7H4, which encodes miR-206 and miR-133b, are present in the mouse genome; one encodes miR-1-1 and miR-133a-2 and the other encodes miR-1-2 and miR-133a-1 [20]. [score:1]
[1 to 20 of 6 sentences]
78
[+] score: 13
It has been shown that miRNAs are determinants of the physiology and pathophysiology of the cardiovascular system and altered expression of muscle- and/or cardiac-specific miRNAs such as the miRNAs named miR-1, miR-208 and miR-133 in myocardial tissue is involved in heart development and cardiovascular diseases, including myocardial hypertrophy, heart failure and fibrosis [11– 14]. [score:6]
Although, this study focus in the acute phase of the experimental Chagas disease some miRNAs (miR-133, miR-208) were found down regulated at 45 dpi in accordance with previously reported in human heart of Chagas chronic patients [15]. [score:4]
In the study, we have found that the same muscle- and/or cardiac-specific miRNAs, miR-1, miR-133 and miR-208 were downregulated in CCC myocardium as compared to control myocardium [15]. [score:3]
[1 to 20 of 3 sentences]
79
[+] score: 13
Conversely, anti-miR-222 treatment that inhibited endogenous miR-222 exerted no effect on the expression of miR-1, miR-133 and miR-206, probably due to the low miR-222 expression of in C [2]C [12] cells. [score:7]
Several miRs (miR-1, miR-133, and miR-206) have been shown to be specifically expressed in the skeletal muscle [26]– [32]. [score:3]
RNA levels of miR-206, miR-1, and miR-133 in C [2]C [12] cells transfected with miR-222 (5×10 [−8]M) or anti-miR-222 (5×10 [−8]M) were assessed by qRT-PCR; relative gene expression was calculated by the comparative Ct method (2 [−ddCt]). [score:1]
In another series of experiments, C [2]C [12] cells were transfected with miR-222 or antimiR-222 and the expression levels of miR-1, miR-133, miR-206 were measured. [score:1]
Thus, we investigated whether miR-222 is involved in the expression of three myogenic miRs: miR-1, miR-133 and miR-206. [score:1]
[1 to 20 of 5 sentences]
80
[+] score: 12
No changes in miR-133a were observed in TA between wild-type and mdx, or following exercise thus highlighting that expression levels in tissue and abundance in serum do not always correlate (21). [score:3]
As with the primary human myoblasts, cellular and secreted levels of myomiRs in C2C12 cells were likewise strongly correlated (Pearson coefficients: 0.9291 (miR-1), 0.8878 (miR-133a), 0.8937 (miR-206); all P <  0.0001,, Table S7) whereas the non-myomiR controls were not correlated (miR-31 and let7-a) or had weak correlation coefficients (miR-16). [score:1]
Most importantly, miR-1, miR-133a and miR-206 dynamics followed a similar pattern in both mouse strains (P-value of interaction factor P > 0.05 for all myomiRs, i. e. not significant). [score:1]
Furthermore, the exercised and unexercised group behaved significantly different for miR-1 and miR-133a (P-value of group factor P <  0.05). [score:1]
Similarly, post hoc analysis demonstrated a significant increase in miR-1 abundance immediately after exercise and a significant increase in miR-133a abundance 7 days after exercise. [score:1]
Despite slightly differing patterns of release, after 9 days the absolute levels of myomiRs in the media were similar for miR-206 (0.4 million copies/ml) and miR-133a (0.2 million copies/ml) and somewhat lower for miR-1 (0.04 million copies/ml). [score:1]
Notably, cellular miRNA and secreted ex-miRNA levels were positively correlated for all myomiRs (Pearson coefficients: 0.7809 (miR-1), 0.7515 (miR-133a), 0.8219 (miR-206); all P <  0.01,, Table S7). [score:1]
Interestingly, it has been shown that administration of exogenous miR-1, miR-133, and miR-206 oligonucleotides in rats accelerates muscle regeneration (62). [score:1]
Likewise, miR-133a levels increased progressively following exercise and miR-206 exhibited a very similar pattern but failed to reach statistical significance at the P <  0.05 level due to high inter-replicate variation. [score:1]
Notably, miR-1, miR-133 and miR-206 are among the most abundant miRNA species in myocytes (compromising more than 25% of all miRNAs) (26) and are involved in the control of muscle homeostasis by coordinating both myoblast proliferation and differentiation (27, 28). [score:1]
[1 to 20 of 10 sentences]
81
[+] score: 12
MicroRNA expression in the diaphragm of a dystrophin -deficient mouse, a mo del for Duchenne muscular dystrophy, revealed a dramatic increase in expression of the muscle-specific microRNA Mir206 [36], while skeletal muscle hypertrophy induced by functional overloading of the plantaris muscle results in downregulation of miR-1 and miR-133a, which are also muscle-specific miRNAs [37]. [score:8]
Likewise, the microRNA Mir133 is known to be specifically expressed in the mouse embryonic heart and skeletal muscle from E12 onwards, implying a role in mid-gestation development of these tissues [13]. [score:3]
Mice null for both miR-133a-1 and miR-133a-2 have larger ventricular chambers, and thinner ventricular walls than controls, and proved to have aberrant cardiomyocyte proliferation and apoptosis [39]. [score:1]
[1 to 20 of 3 sentences]
82
[+] score: 12
Other miRNAs from this paper: mmu-mir-133a-2, mmu-mir-133b, mmu-mir-133c
In addition, Zhang et al. showed that TSA enhances cell resistance to hypoxic insult by upregulating miR-133 expression through activation of MAPK-ERK1/2 [31]. [score:6]
For instance, Zhang et al. demonstrated that TSA enhances cell resistance to hypoxic insult by upregulating miR-133 expression through activation of the mitogen-activated protein kinase (MAPK)/extracellular signal-related kinase (ERK) pathway in neonatal cardiomyocytes [31]. [score:6]
[1 to 20 of 2 sentences]
83
[+] score: 12
Recent studies showed that both the miR-1/miR-206 family and miR-133 family of miRNAs were upregulated in myocytes during differentiation, but their effects on myogenesis were different. [score:4]
It has been reported that the miR-1/206 family promotes myogenesis; however miR-133 inhibits myogenic differentiation and sustains myoblast proliferation [33]. [score:3]
However, no significant changes were found in the levels of miR-1, miR-133, and miR-208b following HDBR (Figures 4(a), 4(c), and 4(e)). [score:1]
High-intensity exercise also caused increased levels of miR-1, miR-133, and miR-206 in the plasma [32]. [score:1]
Our results indicated that starvation induced C2C12 myotubes atrophy led to the secretion of miR-1, miR-23a, miR-133, miR-206, miR-208b, and miR-499 into the culture medium, which could be used as indicators for muscle atrophy. [score:1]
So, the increased levels of miR-1, miR-133, and miR-206 may be at least in part due to the stress caused by the unloading condition. [score:1]
However, the serum profiles of miR-1, miR-133, and miR-208b were different between human and mice, which required further research. [score:1]
[1 to 20 of 7 sentences]
84
[+] score: 12
Incorporation of miRNA target elements (miRTs) corresponding to two muscle-specific cellular miRNAs (miR-133 and miR-206) was shown to mediate silencing of CVA21 gene expression in cells expressing muscle-specific miRNA mimics, in muscle culture lines and, most importantly, in vivo in mice. [score:7]
Target elements corresponding to muscle-specific (miR-133 and miR-206), hematopoetic-specific (miR-142-3p) or tumor-suppressor (miR-145) miRNAs were incorporated in the 3′UTR of CVA21 and protection of HeLa cells transfected with sequence-complementary miRNA mimics (synthetic dsRNAs corresponding to cellular miRNA duplex intermediates) was analyzed (Figure 1B). [score:5]
[1 to 20 of 2 sentences]
85
[+] score: 12
We recently reported that the miR133 microRNA family, which is induced in murine AEC in the setting of hyperoxia, suppresses GM-CSF expression through direct interaction with sequences in this 3′-untranslated region to decrease mRNA stability (Sturrock et al. 2014). [score:8]
Decreased expression of GM-CSF by murine AEC during oxidative stress in vitro is at least in part a consequence of accelerated turnover of GM-CSF mRNA (Sturrock et al. 2010) as a result of the action of a specific microRNA family, miR133, directly affecting its stability (Sturrock et al. 2014). [score:4]
[1 to 20 of 2 sentences]
86
[+] score: 11
Expression analysis of miR-21, miR-29b, miR-30c and miR-133a (all previously implicated in the regulation of fibrosis [38]– [41]) revealed that the upregulation of miR-21 at weeks 3 and 4 was the only alteration observed between MHC-CnA and WT. [score:7]
Since four miRNAs were previously implicated in the regulation of fibrosis, namely miR-21, miR29b, miR-30c and miR-133a [12], their expression level was also determined. [score:4]
[1 to 20 of 2 sentences]
87
[+] score: 11
Quantitative real-time PCR (qPCR) of miR-133a-3p, previously shown to inhibit brown adipocyte differentiation [52], was upregulated in XX compared to XY mice in the chow-fed, gonadally intact group (Additional file 5: Figure S1A). [score:5]
Some miRNAs with distinct sex-biased patterns in expression, such as miR-133a and miR-221, have been implicated in adipogenesis [28, 52]. [score:3]
Expression was quantified using ΔCt for miR-221 or standard curve for miR-133a, miR-192, and miR-205. [score:3]
[1 to 20 of 3 sentences]
88
[+] score: 11
For instance, miR-21 targets the mRNA for the tropomyosin (Zhu et al., 2007); both miRNA-143 and miR-145 regulate podosome formation in smooth muscle cells (Xin et al., 2009); and miR-145, miR-133a, and miR133b target the fascin homolog 1 (Kano et al., 2010). [score:6]
miR-145, miR-133a and miR-133b: tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. [score:5]
[1 to 20 of 2 sentences]
89
[+] score: 11
Likewise, we observed downregulation of miR-215 in tumors of both types, and downregulation of miR-133a in CAC but not APC tumors. [score:7]
Eight high priority miRNAs were identified: miR-215, miR-137, miR-708, miR-31, and miR-135b were differentially expressed in APC tumors and miR-215, miR-133a, miR-467d, miR-218, miR-708, miR-31, and miR-135b in colitis -associated tumors. [score:3]
In addition, 1 miRNA was uniquely repressed in APC tumors (miR-137), and 3 miRNAs were uniquely induced in CAC tumors (miR-133a, miR-467d, and miR-218). [score:1]
[1 to 20 of 3 sentences]
90
[+] score: 10
On the contrary, miR-133 stimulates myoblast proliferation by targeting SRF (Chen et al., 2006), while miR-206 promotes myoblast differentiation targeting the mRNA of PolA1 (Kim et al., 2006), a DNA polymerase subunit. [score:5]
Highly expressed miRNAs in skeletal muscle tissue are termed myomiRs, which include miR-1, miR-133a, miR133-b, miR-206, miR-208, miR208b, miR486, and miR-499 (Van Rooij et al., 2008). [score:3]
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
miR-1 and miR-133 modulate skeletal and cardiac muscle growth and differentiation. [score:1]
[1 to 20 of 4 sentences]
91
[+] score: 10
As shown in Figure 6A, mRNA targets of several miRNA families were found to be significantly upregulated in hypertrophy (false discovery rate (FDR) <0.05), including those targeted by miR-29, miR-1, miR-9, miR-30, and miR-133. [score:8]
In addition, recent studies have implicated regulation of several microRNAs (miRNAs) in hypertrophy, including miR-1, miR-133, and miR-208 [11], [12], [13]. [score:2]
[1 to 20 of 2 sentences]
92
[+] score: 10
This class of miRNAs, poorly expressed in mdx, was upregulated in exon-skipping -treated animals and included muscle specific (miR-1 and miR-133) and more ubiquitous (miR-29 and miR-30) miRNAs. [score:6]
It has been demonstrated that when dystrophin synthesis was restored the levels of miR-1, miR-133a, miR-29c, miR-30c, and miR-206 increased, while miR-23a expression did not change (Cacchiarelli et al., 2010). [score:3]
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
[1 to 20 of 3 sentences]
93
[+] score: 10
The downregulated or lost miRs in our study, such as miR-1 and its cluster partner miR-133, are tumour suppressor miRs, previously identified as consistently downregulated in primary prostate tumours [39]. [score:9]
Similarly mmu-miR-133a and 181 were found to be reduced (see Fig.   2d, lower panel). [score:1]
[1 to 20 of 2 sentences]
94
[+] score: 10
3.4In addition to myofilament proteins, the expression of four microRNAs (miRNA, miR) involved in cardiac development and function was analysed (Fig. 2B): miR-133a and b, miR-1 and miR-499. [score:4]
In addition to myofilament proteins, the expression of four microRNAs (miRNA, miR) involved in cardiac development and function was analysed (Fig. 2B): miR-133a and b, miR-1 and miR-499. [score:4]
MiR-133a and b (a regulator of myocyte enhancer protein 2) and miR-1 (important in myoblast to myotube differentiation) significantly increased over time in developing mouse hearts yet were present at very low levels in the adult zebrafish heart. [score:2]
[1 to 20 of 3 sentences]
95
[+] score: 10
Inhibition of miR-133 increases the expression of PRDM16 and the mitochondrial activity [29]. [score:5]
Adrenergic stimulation inhibits expression of miR-133 (a muscle-enriched miRNA) to abolish posttranscriptional silencing of PRDM16. [score:5]
[1 to 20 of 2 sentences]
96
[+] score: 9
Three miRNAs (miRNA-21, miRNA-133, and miRNA-223) were identified by qRT-PCR showing significant upregulation of miRNA-223 by more than 50%. [score:4]
Levels of miRNA-21 and miRNA-133 remained no change in the AF group (Fig. 3E) while the miRNA-223 level reciprocally decreased by 2-fold in the miRNA-223 knockdown mice (Fig. 3F). [score:2]
No significant change was observed from the levels of miRNA-21 and miRNA-133 (Fig. 1E,F). [score:1]
The negative controls, miR-21 and miR-133, were unaltered in AF patients. [score:1]
The negative controls, miR-21 and miR-133, were unaltered in A-TP dogs. [score:1]
[1 to 20 of 5 sentences]
97
[+] score: 9
miR-1 and miR-133 are expressed in cardiac and skeletal muscle and are transcriptionally regulated by the myogenic differentiation factors MyoD, Mef2, and SRF [22]. [score:4]
miR-133 expression was not altered in response to END exercise. [score:3]
miR-133 content remained unchanged in both sedentary and forced-endurance exercise groups. [score:1]
On the other hand, miR-133 enhances myoblast proliferation by repressing the serum response factor [59]. [score:1]
[1 to 20 of 4 sentences]
98
[+] score: 9
Similarly, while miR-133a and miR-181 were down-regulated, the mRNA level of their target, pro-survival gene Mcl1 [36, 37] was up-regulated in the CR heart (Fig. A in S2 File). [score:9]
[1 to 20 of 1 sentences]
99
[+] score: 9
miR-206 and miR-133b were clustered on chromosome 1, whereas miR-1 and miR-133a were clustered on chromosome 2. The expression level of miR-206 was markedly higher than miR-133b, and the expression level of miR-1 was markedly higher than miR-133b. [score:5]
Two clusters of miRNAs, miR-206/miR-133b on chromosome 1 and miR-1/miR-133a on chromosome 2 showed the largest magnitude of down-regulation (Table S1). [score:4]
[1 to 20 of 2 sentences]
100
[+] score: 9
In addition, dual fluorescence reporter containing perfect target sequence for miR-430, miR-1, and miR-133 was engineered to monitor the miRNA expression pattern in the zebrafish embryo or mouse embryos (De Pietri Tonelli et al., 2006; Giraldez et al., 2006; Mishima et al., 2009). [score:5]
Zebrafish miR-1 and miR-133 shape muscle gene expression and regulate sarcomeric actin organization. [score:4]
[1 to 20 of 2 sentences]