sort by

92 publications mentioning mmu-mir-138-2

Open access articles that are associated with the species Mus musculus and mention the gene name mir-138-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 393
Other miRNAs from this paper: hsa-mir-31, hsa-mir-138-2, hsa-mir-138-1, mmu-mir-31, mmu-mir-138-1
The levels of BIRC5 mRNA were down-regulated upon miR-138-5p overexpression, whereas the levels of BIRC5 mRNA were up-regulated upon miR-138-5p knockdown (Fig.   2f). [score:10]
We experimentally validated the direct inhibition of Survivin translation by miR-138-5p by overexpressing and knocking down miR-138-5p in bladder cancer cells. [score:9]
miR-138-5p overexpression was achieved by transfecting bladder cancer cell lines with an miRNA mimic (a synthetic RNA oligonucleotide duplex mimicking the miRNA precursor), and knockdown was achieved by transfecting a miRNA inhibitor (a chemically modified single-stranded antisense oligonucleotide designed to specifically target the mature miRNA). [score:8]
By overexpressing or knocking down miR-138-5p in bladder cancer cells, we experimentally confirmed that miR-138-5p directly recognizes the 3′-UTR of the BIRC5 transcript and regulates Survivin expression. [score:8]
Tumors with both miR-138-5p and BIRC5 overexpression exhibited significantly higher levels of Survivin compared to tumors with miR-138-5p overexpression alone (Fig.   4, d and g), suggesting that BIRC5 overexpression could rescue the Survivin suppression caused by miR-138-5p. [score:8]
As predicted, overexpressing miR-138-5p significantly suppressed the Survivin protein levels in T24 and J82 cells, whereas miR-138-5p knockdown had the opposite effect on Survivin expression in these cells (Fig.   2d and e). [score:8]
In summary, this study revealed a critical role of miR-138-5p as a tumor suppressive miRNA in bladder carcinogenesis, explored the molecular mechanisms by which aberrant miR-138-5p expression contributes to bladder cancer progression and identified Survivin as a direct target of miR-138-5p. [score:8]
Interestingly, we further observed that the restoration of Survivin expression by an overexpressing plasmid can successfully attenuate the anti-proliferative and anti-invasive effect of miR-138-5p on bladder cancer cells, although miR-138-5p may also have many other targets. [score:7]
For example, miR-138-5p could inhibit the translation of ZEB2 mRNA and suppress the ZEB2 -mediated metastatic potential of bladder cancer [31]. [score:7]
Taken together, our findings provide the first clues regarding the role of miR-138-5p as a tumor suppressor in bladder cancer by inhibiting BIRC5 translation. [score:7]
To overexpress Survivin, an expression plasmid designed to specifically express the full-length ORF of Survivin without the miR-138-5p-responsive 3′-UTR was also constructed and transfected into T24 cells. [score:7]
In conclusion, our results demonstrated that miR-138-5p directly recognizes and binds to the 3′-UTR of the Survivin mRNA transcript to inhibit Survivin translation in bladder cancer cells. [score:6]
Xenografts with both miR-138-5p and BIRC5 overexpression exhibited increased cell mitosis compared to xenografts with only miR-138-5p overexpression (Fig.   4i), suggesting that Survivin overexpression could attenuate the anti-proliferative effect of miR-138-5p. [score:6]
T24 cells were infected with either a control lentivirus or a lentivirus containing a plasmid that overexpressed miR-138-5p and then transfected with either a control plasmid or a BIRC5 overexpression plasmid. [score:5]
In the present study, we found that elevated expression of Survivin was related to the decrease of tumor suppressor miR-138-5p. [score:5]
c Quantitative RT-PCR analysis of the expression levels of miR-138-5p in T24 and J82 cells transfected with equal doses of the miR-138-5p mimic (mim-miR-138-5p), miR-138-5p inhibitor (anti-miR-138-5p) or corresponding scrambled negative control RNA (mim-scramble and anti-scramble, respectively). [score:5]
To investigate the role of this new pathway in the network of bladder carcinogenesis signaling, we overexpressed miR-138-5p in bladder cancer cells and found that proliferation and invasion of bladder cancer cells were inhibited, which mimic the function of Survivin reduction by targeted siRNA. [score:5]
A 300-bp fragment containing the genomic miR-138-5p sequence was cloned into a lentiviral expression plasmid and produced into lentivirus-miR-138-5p, which was used to infect T24 cells and overexpress miR-138-5p. [score:5]
To determine how miR-138-5p influenced the expression of Survivin in bladder cancer, we repeated the abovementioned experiments and examined the expression of Survivin mRNA after transfection. [score:5]
These results confirmed that targeting Survivin is an important mechanism of the tumor-suppressive function of miR-138-5p. [score:5]
Immunohistochemical staining also revealed the presence of lower levels of Survivin in tumors from mice implanted with miR-138-5p -overexpressing cells, whereas the tumors from the BIRC5 -overexpressing mice showed increased Survivin protein levels. [score:5]
miR-138-5p could also suppress cell proliferation by targeting Bag-1 in gallbladder carcinoma [32]. [score:5]
However, when T24 cells were co -transfected with mim-miR-138-5p and the Survivin overexpression plasmid, Survivin dramatically attenuated the suppressive effect of miR-138-5p on cell invasion (Fig.   4d and f). [score:5]
Additionally, BIRC5 overexpression attenuated the repressive effect of miR-138-5p on tumor growth (Fig.   4, c and e), suggesting that miR-138-5p might inhibit tumor growth by silencing Survivin. [score:5]
Using three publicly available algorithms (TargetScan, miRanda and PicTar), miR-138-5p was identified as a candidate miRNA that could target BIRC5. [score:5]
In addition, we showed that in cultured bladder cancer cells, miR-138-5p inhibited Survivin expression as well as cell proliferation and invasion; furthermore, miR-138-5p also slowed tumor growth in a xenograft mouse mo del. [score:5]
The predicted interaction between miR-138-5p and its target sites in the BIRC5 3′-UTR is illustrated in Fig.   2a, which shows that miR-138-5p has 2 potential target sites in the 3′-UTR of the BIRC5 mRNA sequence. [score:5]
In the in vivo study, the Survivin overexpression plasmid significantly rescued the suppressed tumor growth induced by cells transduced with lentivirus-miR-138-5p. [score:5]
We identified 2 specific targeting sites for miR-138-5p in the 3′ untranslated region (3′-UTR) of BIRC5. [score:5]
The invasive ability of T24 cells transfected with either mimics or inhibitors (mim-miR-138-5p or anti-miR-138-5p, respectively), BIRC5 siRNA and/or the overexpression plasmid was tested in a Transwell Boyden chamber (6.5 mm; Costar). [score:5]
Zhao L, Yu H, Yi S, Peng X, Su P, Xiao Z, et al. The tumor suppressor miR-138-5p targets PD-L1 in colorectal cancer. [score:5]
Likewise, BIRC5 overexpression attenuated the pro-proliferative effect caused by miR-138-5p overexpression (Fig.   4, i and j). [score:5]
The mice were randomly divided into 4 groups and subcutaneously injected with T24 cells (2 × 10 [6] cells per mouse, 5 mice per group, Fig.   4a) that were infected with either control lentivirus or a lentivirus that overexpressed miR-138-5p followed by co-transfection with a control plasmid or a BIRC5 overexpression plasmid. [score:5]
To determine whether the negative regulatory effects of miR-138-5p on Survivin expression were mediated through the binding of miR-138-5p to the presumed sites in the 3′-UTR of the Survivin mRNA, the full-length 3′-UTR of BIRC5 containing the 2 presumed miR-138-5p binding sites was cloned downstream of the firefly luciferase gene in a reporter plasmid. [score:4]
Tumors with both miR-138-5p and BIRC5 overexpression exhibited increased Survivin protein levels compared to xenografts with only miR-138-5p overexpression (Fig.   4i and k). [score:4]
Furthermore, hematoxylin and eosin (H&E) staining of xenograft tissues showed confluent necrotic areas and reduced cell mitosis in the group implanted with the cells expressing the miR-138-5p lentiviral vector compared with the control group, whereas an increase in cell mitosis was observed in the xenografts from the BIRC5 overexpression group (Fig.   4i). [score:4]
The correlation between miR-138-5p and Survivin was further examined by evaluating Survivin expression after either overexpressing or knocking down miR-138-5p in the human bladder cancer cell lines T24 and J82. [score:4]
Validation of Survivin as a direct target of miR-138-5p. [score:4]
A significant decrease in the size and weight was observed in tumors from the miR-138-5p -overexpressing group compared to those of the control group, whereas the size and weight of the tumors in the group implanted with cells containing the BIRC5-overexpression plasmid were dramatically increased (Fig.   4, c and e). [score:4]
Fig. 2The negative regulation of Survivin expression by miR-138-5p in bladder cancer cells. [score:4]
Tumors from the miR-138-5p -overexpressing group displayed a reduction in the Survivin protein levels compared to tumors from the control group, whereas the tumors from the BIRC5 -overexpressing group showed elevated Survivin protein levels. [score:4]
Overexpression or knockdown of miR-138-5p. [score:4]
Treatment with miR-138-5p exhibited an anti-tumor effect both in vitro and in vivo by negatively regulating Survivin expression. [score:4]
After determining the levels of miR-138-5p in the same 12 pairs of bladder cancer tissues and adjacent noncancerous tissues, we found that miR-138-5p levels were notably down-regulated in bladder cancer tissues (Fig.   2b). [score:4]
Moreover, compared with cells transfected with mim-miR-138-5p alone, T24 cells transfected with both mim-miR-138-5p and the Survivin overexpression plasmid exhibited significantly higher proliferation rates (Fig.   3b), suggesting that miR-138-5p-resistant Survivin is sufficient to rescue the suppression of Survivin by miR-138-5p and to attenuate the anti-proliferative effect of miR-138-5p on bladder cancer cells. [score:4]
The efficient overexpression and knockdown of miR-138-5p in T24 and J82 cells are shown in Fig.   2c. [score:4]
These results were consistent with the findings of the in vitro assays, which firmly validated the role of miR-138-5p as a tumor suppressor by targeting BIRC5. [score:4]
Knockdown of miRNA was achieved by transfecting cells with anti-miR-138-5p, which is a chemically modified antisense oligonucleotide designed to specifically target mature miR-138-5p. [score:4]
The correlation between miR-138-5p and Survivin was further examined by evaluating Survivin expression in human bladder cancer cell lines that either overexpressed or knocked down miR-138-5p. [score:4]
Down-regulation of miR-138-5p has also been reported in other cancers [28– 30]. [score:4]
Fig. 3The role of miR-138-5p targeting Survivin in regulating the proliferative and invasive abilities of bladder cancer cells. [score:4]
After 28 days of xenograft growth in vivo, tumors from the miR-138-5p-overexpression group showed a significant increase in miR-138-5p expression compared to tumors from the control groups (Fig.   4f). [score:4]
This mutated luciferase reporter was unaffected by either overexpression or knockdown of miR-138-5p (Fig.   2g). [score:4]
A. Western blotting analysis of Survivin protein levels in T24 cells transduced with either lentivirus-miR-138-5p (MOI = 5) and/or different doses of the Survivin overexpression plasmid. [score:3]
Identification of conserved miR-138-5p target sites within the 3′-UTR of BIRC5. [score:3]
After measuring the expression levels of miR-138-5p and Survivin in human bladder cancer tissues and adjacent noncancerous tissue samples, we detected an inverse correlation between miR-138-5p expression and Survivin protein levels. [score:3]
A mammalian expression plasmid encoding the full-length human BIRC5 open reading frame (ORF) without the miR-138-5p-responsive 3′-UTR was purchased from Ribobio (Guangzhou, China). [score:3]
A lentiviral vector that overexpresses miR-138-5p was purchased from Invitrogen. [score:3]
Thus, Survivin was deduced to be a miR-138-5p target not only by computational prediction but also based on the inverse correlation between miR-138-5p and Survivin protein levels in human bladder tissues. [score:3]
Construction of the miR-138-5p overexpression lentiviral vector. [score:3]
In this study, we searched for miRNAs that can target Survivin and identified miR-138-5p as a candidate. [score:3]
The BIRC5 mRNA was significant reduced in the tumors with miR-138-5p overexpression, which was consistent with the in vitro results (Fig.   4h). [score:3]
Furthermore, we experimentally investigated the direct regulation of Survivin by miR-138-5p as well as the biological role of miR-138-5p targeting Survivin in human bladder cancer cell lines and in a mouse tumor xenograft mo del. [score:3]
These results indicate that miR-138-5p might inhibit cell proliferation and invasion by silencing Survivin. [score:3]
Overexpression of miRNA was achieved by transfecting cells with mim-miR-138-5p, which is a synthetic RNA oligonucleotide that mimics the miR-138-5p precursor. [score:3]
The next day, the T24 cells were transfected with mim-miR-138-5p, anti-miR-138-5p, BIRC5 siRNA and/or the overexpression plasmid, and the medium was replaced with RPMI 1640 medium supplemented with 2% FBS. [score:3]
T24 cells were infected with either a control lentivirus or lentivirus-miR-138-5p (MOI = 5); the resulting cells were then co -transfected with a control plasmid or a BIRC5 overexpression plasmid (6 μg/ 75 cm [2]) to produce 4 cellular phenotypes. [score:3]
In this study, we predicted that Survivin was a target of miR-138-5p. [score:3]
A luciferase reporter assay was performed to test the direct binding of miR-138-5p to the target gene BIRC5. [score:3]
All these results suggested that miR-138-5p may work as a tumor suppressor in bladder cancer. [score:3]
To test the direct binding of miR-138-5p to the target gene BIRC5, a luciferase reporter assay was performed as previously described. [score:3]
We further analyzed the biological consequences of the miR-138-5p -driven repression of Survivin expression in bladder cancer cells. [score:3]
b Quantitative RT-PCR analysis of the relative expression levels (miR-138-5p vs. [score:3]
Furthermore, the biological consequences of the targeting of BIRC5 by miR-138-5p were examined in vitro via cell proliferation and invasion assays and in vivo using a mouse xenograft tumor mo del. [score:2]
g Direct recognition of the Survivin 3’-UTR by miR-138-5p. [score:2]
For the luciferase reporter assays, HEK293 cells were cultured in 24-well plates, and each well was transfected with 0.4 μg of firefly luciferase reporter plasmid, 0.4 μg of a β-galactosidase (β-gal) expression plasmid (Ambion), and equal amounts (20 pmol) of mim-miR-138-5p, anti-miR-138-5p, or the scrambled negative control RNAs using Lipofectamine2000 (Invitrogen). [score:2]
Thus, it is hypothesized that a replacement treatment with miR-138-5p mimics could be a promising strategy for cancers characterized by down-regulation of miR-138-5p. [score:2]
a The CCK-8 viability assay was performed 12, 24, 36, and 48 hours after T24 cells were transfected with miR-138-5p mimic (mim-miR-138-5p), miR-138-5p inhibitor (anti-miR-138-5p) or corresponding scrambled negative control RNA (mim-scramble and anti-scramble, respectively). [score:2]
Bladder cancer miR-138-5p Survivin post-transcriptional regulation Bladder cancer is the most common malignancy of the urogenital system and is one of the major causes of cancer-related death among Chinese patients. [score:2]
These results demonstrated that post-transcriptional regulation of Survivin mRNA by miR-138-5p may partially contribute to the mRNA degradation of this gene. [score:2]
The role of miR-138-5p in regulating Survivin in bladder cancer cells. [score:2]
As expected, T24 cells transfected with mim-miR-138-5p showed decreased cell proliferation; in contrast, knocking down miR-138-5p had the opposite effect on cell proliferation (Fig.   3a). [score:2]
Furthermore, we introduced point mutations into the corresponding complementary sites in the 3′-UTR of Survivin to eliminate the predicted miR-138-5p binding sites (i. e., the two binding positions were mutated). [score:2]
The results demonstrated a novel regulatory network involving miR-138-5p and Survivin to fine-tune the proliferation and invasion of bladder cancer. [score:2]
We demonstrated that BIRC5 repression by miR-138-5p suppressed the proliferative and invasive characteristics of bladder cancer cells and that miR-138-5p exerted an anti-tumor effect by negatively regulating BIRC5 in a xenograft mouse mo del. [score:2]
Regulation of Survivin by miR-138-5p might explain why the decrease of miR-138-5p during bladder carcinogenesis can promote cancer progression. [score:2]
For miRNA knockdown, equal amounts of anti-miR-138-5p or anti-scramble were used. [score:2]
The MOI value of lentivirus-miR-138-5p used here was 5, and the amount of pCDNA3.1-BIRC5 transfected was 9 μg/75 cm [2]. [score:1]
[15] A sequence containing the presumed miR-138-5p binding site was designed from the human BIRC5 3′-UTR. [score:1]
Synthetic mim-miR-138-5p, anti-miR-138-5p and the corresponding negative control scrambled RNAs (mim-scramble and anti-scramble) were purchased from GenePharma (Shanghai, China). [score:1]
U6) of miR-138-5p in human bladder cancer specimens (BC) and normal adjacent tissues (NAT). [score:1]
As expected, luciferase activity was markedly reduced in the cells transfected with mim-miR-138-5p and increased in the cells transfected with anti-miR-138-5p (Fig.   2g). [score:1]
The effect of miR-138-5p and Survivin on bladder tumor growth in vivo. [score:1]
Furthermore, the miR-138-5p binding sequences in the BIRC5 3′-UTR were highly conserved across multiple species. [score:1]
The expression levels of miR-138-5p and Survivin protein were measured in 12 resected bladder cancer specimens. [score:1]
We further identified an inverse correlation between miR-138-5p and Survivin protein levels in bladder cancer tissue samples. [score:1]
d and e Western blotting analysis to detect Survivin protein levels in T24 and J82 cells transfected with equal amounts of mim-miR-138-5p, anti-miR-138-5p, mim-scramble or anti-scramble. [score:1]
a Schematic description of the hypothetical hybridizations formed by the interactions between the binding sites in the BIRC5 3′-UTR (top) and miR-138-5p (bottom). [score:1]
The resulting plasmid was transfected into HEK293 cells along with mim-miR-138-5p, anti-miR-138-5p, or corresponding scrambled negative control RNAs (mim-scramble and anti-scramble, respectively). [score:1]
The cell proliferation rate as indicated by the percentage of Ki-67 -positive tumor cells was increased in the group implanted with cells containing the BIRC5 plasmid and decreased in the group implanted with cells containing the miR-138-5p lentiviral vector. [score:1]
Detection of an inverse correlation between miR-138-5p and Survivin levels in bladder cancer tissues. [score:1]
Effects of miR-138-5p and Survivin on the growth of bladder cancer cell xenografts in mice (supplemental animal experiment). [score:1]
c and e, transwell analysis of invading T24 cells treated with equal amounts of mim-miR-138-5p, anti-miR-138-5p, mim-scramble or anti-scramble. [score:1]
f Quantitative RT-PCR analysis of Survivin mRNA levels in T24 and J82 cells transfected with equal amounts of mim-miR-138-5p, anti-miR-138-5p, mim-scramble or anti-scramble. [score:1]
Firefly luciferase reporters containing either wild-type (WT) or mutant (MUT) miR-138-5p binding sites in the Survivin 3′-UTR were co -transfected with equal doses of mim-miR-138-5p, anti-miR-138-5p or the corresponding scrambled negative control RNA (mim-scramble and anti-scramble, respectively) into HEK293 cells. [score:1]
To test the binding specificity, the sequences that interacted with the miR-138-5p seed sequence were mutated (site 1 from CACCAGC to GTGGTCG, and site 2 from ACCAGCA to TGGTCGT), and the mutant BIRC5 3′-UTR was inserted into an equivalent luciferase reporter. [score:1]
Cellular miR-138-5p levels were increased approximately 500-fold when T24 and J82 cells were transfected with mim-miR-138-5p, and these levels dropped to approximately 10% of the normal level when T24 and J82 were treated with anti-miR-138-5p. [score:1]
This finding suggested that these binding sites strongly contribute to the interaction between miR-138-5p and Survivin mRNA. [score:1]
We also investigated the biological role of miR-138-5p targeting to Survivin in bladder cancer cell lines both in vivo and in vitro. [score:1]
Equal amounts of either mim-miR-138-5p or mim-scramble were used in each well. [score:1]
The seed regions of miR-138-5p and the seed-recognition sites in the BIRC5 3′-UTR are indicated in red. [score:1]
In this study, we found that the levels of miR-138-5p in bladder cancer were much lower than those in normal adjacent bladder mucosa. [score:1]
d and (f), transwell analysis of invading T24 cells treated with equal amounts of mim-scramble plus control vector (pCDNA3.1), mim-miR-138-5p plus control vector, mim-scramble plus BIRC5 plasmid (pCDNA3.1-BIRC5), or mim-miR-138-5p plus BIRC5 plasmid. [score:1]
[1 to 20 of 113 sentences]
2
[+] score: 295
Other miRNAs from this paper: mmu-mir-138-1
In accordance with these findings, our study confirmed that miR-138 directly targets Bag-1 to regulate the expression of Bax, caspase-3, and BCL-2. Moreover, the significant effects caused by overexpression of miR-138 on gallbladder carcinoma cell growth and apoptosis were reversed partially following restoration of the expression of Bag-1 with a consequential elevation of BCL-2 as well as a suppression of Bax and caspase-3 levels. [score:13]
Overexpression of miR-138 inhibited cell proliferation by directly suppressing the expression of Bag-1. These results suggest that miR-138 plays an important role in inhibiting the growth of gallbladder carcinoma. [score:12]
Because it is not clear whether the negative regulation of Bag-1 by miR-138 contributes to the suppression of gallbladder carcinoma cell proliferation, we silenced Bag-1 with its specific siRNA and found that downregulation of Bag-1 can inhibit cell proliferation and induce apoptosis in gallbladder carcinoma cells. [score:9]
Compared with their paired normal gallbladder samples, the gallbladder carcinoma samples had decreased expression of miR-138 and increased expression of Bag-1. Overexpression of miR-138 inhibited the proliferation of gallbladder carcinoma cells. [score:8]
The overexpression of Bag-1 significantly reversed the inhibitory effect of miR-138 on the growth of gallbladder carcinoma cells and also, resulted in an inhibition of apoptosis induced by miR-138 (Fig 5D). [score:7]
We further demonstrated that a decreased expression of BCL-2, increased expression of Bax, and increased cleavage of caspase-3 were found in the miR-138 -overexpressing cells, which supports the results attained from silencing Bag-1 (Fig 4E). [score:7]
These results strongly suggest that miR-138 negatively regulates the expression of Bag-1 by directly targeting its 3′-UTR. [score:7]
In neuroblastoma, hTERT was regulated by miR-138 with an increase of Bax expression and decrease of BCL-2 expression [21]. [score:6]
The results from the present study showed that miR-138 has a tumor suppressing function through regulation of its target gene Bag-1. These findings will help us understand the role and mechanism of miR-138 in gallbladder carcinoma. [score:6]
We concluded that miR-138 directly targets Bag-1 in gallbladder carcinoma cells, thus, suppresses cancer cell growth and induces apoptosis. [score:6]
The expression of miR-138 was normalized to that of U6, and the expression of Bag-1 mRNA was normalized to that of β-actin in each sample. [score:5]
Furthermore, overexpression of miR-138 markedly inhibited the growth of tumors in the gallbladder carcinoma xenograft mo del in nude mice. [score:5]
In this study, it was found that miR-138 was frequently decreased in the tumor tissues of patients with gallbladder carcinoma, and restoring miR-138 expression resulted in an inhibition of cell proliferation and an enhancement of cell apoptosis in gallbladder carcinoma. [score:5]
0126499.g001 Fig 1(A) A schematic representation showing the putative target site of Bag-1 and mutated target site for miR-138 with the seed region and base substitutions underlined. [score:5]
Consistent with these results, we found that overexpression of miR-138 significantly inhibits cell proliferation abilities and induces apoptosis in vitro. [score:5]
A correlation analysis between the expression of miR-138 and Bag-1 was performed, and the results showed that there is a significant inverse correlation between the mRNA expression levels of miR-138 and Bag-1 (Pearson’s correlation R = −0.58, P<0.05) in gallbladder carcinoma (Fig 2C). [score:5]
The overexpression of miR-138 inhibits cell proliferation and colony formation [20]. [score:5]
Overexpression of miR-138 suppressed the growth of tumor in vivo. [score:5]
Furthermore, overexpression of miR-138 inhibits cell growth in vitro and the growth of tumors in vivo and is associated with cell cycle arrest. [score:5]
Overexpression of miR-138 inhibited cell growth and induced apoptosis in gallbladder carcinoma. [score:5]
0126499.g005 Fig 5(A) Expression of Bag-1 protein in OCUG-1 and NOZ cells stably expressing miR-138 transfected with pcDNA3.1 vector as a control or Bag-1 vector was detected using Western blot at 48 h after transfection. [score:5]
The data suggests that the reduced expression of miR-138 and increased expression of Bag-1 are frequently observed in human gallbladder carcinoma specimens. [score:5]
To identify the potential target genes of miR-138, online algorithms TargetScan and PicTar were used. [score:5]
It was also identified that Bag-1 (Bcl-2 -associated athanogene-1) is a direct and functional target of miR-138 in gallbladder carcinoma. [score:4]
The results from this study indicate that the target gene of miR-138 Bag-1 can regulate the apoptosis -associated genes in gallbladder carcinoma cells. [score:4]
Recent studies indicate that alterations in miR-138 expression are associated with the development and progression of human tumors such as leukemia, nasopharyngeal carcinoma, neuroblastoma, and lung cancer [20– 23]. [score:4]
miR-138 overexpression is more powerful than hTERT knockdown to potentiate apigenin for apoptosis in neuroblastoma in vitro and in vivo. [score:4]
Downregulation of miR-138 in neuroblastoma and thyroid carcinoma is associated with the human telomerase reverse transcriptase (hTERT), which promotes malignant cell growth of many tumors [21, 22]. [score:4]
MiR-138 represses the expression of Bag-1 by targeting its 3′-UTR. [score:4]
Bag-1 is a direct target of miR-138. [score:4]
Furthermore, our results showed that miR-138 directly targets Bag-1 by binding its 3′-UTR sites. [score:4]
These results provide the first evidence that miR-138 is downregulated and plays an important role in gallbladder carcinoma. [score:4]
MiR-138 is frequently downregulated in different cancer types and is thought to be involved in the progression of tumorigenesis. [score:3]
Two-sample t-tests were performed to compare the expression of miR-138 between gallbladder carcinoma and normal tissues. [score:3]
To detect the expression of miR-138, stem-loop reverse transcription—polymerase chain reaction (RT-PCR) was performed using a PrimeScript miRNA RT-PCR Kit (Takara, Dalian, China) according to the manufacturer’s instructions. [score:3]
More importantly, NOZ cells transduced with miR-138 showed a significant growth inhibition when the cells were examined in xenograft tumors in vivo. [score:3]
Bag-1 was defined as a novel target of miR-138. [score:3]
By injecting NOZ cells expressing normal amounts of miR-138 or control vector into the dorsal flank of nude mice, we established the gallbladder carcinoma xenograft mo dels. [score:3]
miR-138 inhibits the growth of tumor in vivo. [score:3]
Targets of miR-138 were predicted using bioinformatics and validated using luciferase reporter and Western blot analyses. [score:3]
In this study, we found that the expression of miR-138 was significantly lower in gallbladder carcinoma specimens. [score:3]
The expression of miR-138 in 49 gallbladder carcinoma samples and paired normal gallbladder samples was analyzed using quantitative reverse transcription–polymerase chain reaction. [score:3]
To determine the function of Bag-1, the Bag-1 vector was transfected into the gallbladder carcinoma cells expressing miR-138. [score:3]
A psi-CHECK-2 construct containing the Bag-1 3′-UTR with mutations in the seed sequence of miR-138 was synthesized using a QuikChange Site-Directed Mutagenesis Kit (Stratagene, Palo Alto, CA) and named as Bag-1-UTR-MUT. [score:3]
Cells transfected with MUT 3′-UTR were resistant to the suppressor activity of miR-138 (Fig 1B and 1C). [score:3]
Restoring expression of Bag-1 eliminates the effects of miR-138 on cell proliferation and apoptosis. [score:3]
Expression of miR-138 and Bag-1 in gallbladder carcinoma specimens. [score:3]
Based on these algorithms, Bag-1 was focused on as a new target of miR-138. [score:3]
MiR-138 has been reported as one of the known tumor suppressor miRNAs. [score:3]
This inhibition effect of miR-138 on cancer cell growth was partly due to the increased number of apoptotic cells (Fig 3D). [score:3]
It was found that the tumors of cancer cells overexpressing miR-138 grew substantially more slowly than the control vector group (Fig 6A). [score:3]
Overexpression of miR-138 suppressed the growth of tumor in vivo The effect of miR-138 on cell growth reduction in vitro prompted us to further investigate its biological significance in vivo. [score:3]
Consequently, miR-138 transfected in OCUG-1 and NOZ cells effectively decreased the expression of the endogenous Bag-1 both at mRNA and protein levels (Fig 1D and 1E). [score:3]
At 96 hours after transduction, the increased expression level of miR-138 was verified using qRT-PCR in both the OCUG-1 and NOZ cells (Fig 3A). [score:3]
Both gain- and loss-of-function studies revealed that Bag-1 is a new target of miR-138. [score:3]
Furthermore, a significant inverse correlation was observed between the expression levels of miR-138 and Bag-1 mRNA in the gallbladder carcinoma tissues. [score:3]
Both the inhibition of Bag-1 by miR-138 and the silencing of Bag-1 by siRNA led to alterations of apoptosis-related proteins such as Bcl-2 and Bax. [score:3]
Expression of miR-138 and Bag-1 in gallbladder carcinoma tissues. [score:3]
Bag-1 was identified as one of the candidate effectors of miR-138 based on the putative target sequence of 25–48 bp on Bag-1 3′-UTR (Fig 1A). [score:3]
To identify the role of miR-138 in gallbladder carcinoma cell lines, two gallbladder carcinoma cell lines, OCUG-1 and NOZ, expressing low levels of miR-138 were transduced with either the control vector or the miR-138 vector. [score:3]
Some studies have indicated that miR-138 is a master regulator of cell proliferation and apoptosis pathways [20, 23]. [score:2]
Using qRT-PCR, it was found that the expression levels of miR-138 were reduced in 40 out of 49 (81%) cases of gallbladder carcinoma specimens (P<0.001) compared with those of the adjacent non-neoplastic tissues (Fig 2A). [score:2]
These results indicate that miR-138 regulates cell growth and apoptosis of gallbladder carcinoma cell lines. [score:2]
MiR-138 plays an important role in different types of cancer and functions as a tumor suppressor gene. [score:2]
0126499.g002 Fig 2 (A) The expression of miR-138 was determined in gallbladder carcinoma tissues compared with matched normal adjacent gallbladder tissues using qRT-PCR. [score:2]
Expression of miR-138 is frequently reduced in gallbladder carcinoma when compared to normal cells. [score:2]
0126499.g003 Fig 3(A) The qRT-PCR analysis confirmed that the expression of miR-138 was clearly increased in cells transduced with miR-138 compared with the control vector. [score:2]
Although we partially demonstrated the functions and regulations of miR-138 and its target gene Bag-1, the relationships between the expression level of miR-138 and clinical characteristics and prognosis of patients with gallbladder carcinoma have not yet been investigated. [score:2]
Relative quantification of miR-138 and Bag-1 expression was calculated using the 2 [-ΔΔCT] method. [score:1]
To examine whether there is a direct interaction between miR-138 and Bag-1 mRNA, the reporter gene assay was performed in 293T cells. [score:1]
To investigate the role of miR-138 in gallbladder carcinoma, the expression levels of miR-138 were examined in 49 gallbladder carcinoma specimens and their paired adjacent non-neoplastic tissues. [score:1]
The oligonucleotides encoding the pre-miR-138 sequence were synthesized as follows: 5′-AATTCCCCTGGCATGGTGTGGTGGGGCAGCTGGTGTTGTGAATCAGGCCGTTGCCAATCAGAGAACGGCTACTTCACAACACCAGGGCCACACCACACTACAGGG-3′ and 5′-CCTGTAGTGTGGTGTGGCCCTGGTGTTGTGAAGTAGCCG TTCTCTGATTGGCAACGGCCTGATTCACAACACCAGCTGCCCCACCACACCATGCCAGGGG-3′. [score:1]
The in vitro and in vivo experiments imply that strategies of introducing miR-138 into cancer cells might have a potential therapeutic value in tumorigenesis. [score:1]
However, the molecular mechanism of miR-138 involvement in gallbladder carcinoma still remains unknown. [score:1]
It was observed that the relative luciferase activity of the vectors with a miR-138 binding site was significantly decreased in miR-138 -transfected cells at 24 and 48 hours. [score:1]
Recent studies have indicated that miR-138 is frequently reduced in leukemia and lung cancer and associated with drug resistance [23, 24]. [score:1]
These data strongly indicate that the biological functions of Bag-1 are correlated to miR-138 in gallbladder carcinoma. [score:1]
The in vivo effects of miR-138 were examined using subcutaneous inoculation of gallbladder carcinoma cells in Balb/c nude mice. [score:1]
The cells were then co -transfected with 100 ng of either control vector or miR-138 and 800 ng of either Bag-1-UTR-WT or Bag-1-UTR-MUT using Lipofectamine 2000 (Invitrogen). [score:1]
NOZ cells control vector (n = 6) and miR-138 (n = 6) were trypsinized, collected by centrifugation, and suspended in RPMI-1640. [score:1]
Effect of miR-138 on gallbladder carcinoma cell proliferation and apoptosis. [score:1]
[1 to 20 of 81 sentences]
3
[+] score: 202
Other miRNAs from this paper: hsa-mir-138-2, hsa-mir-138-1, mmu-mir-138-1, hsa-mir-630
As shown in Additional file 5: Figure S3B, overexpression of ANGPTL1 significantly enhanced miR-138 expression by 1.51-fold (P < 0.0001), whereas miR-138 level was markedly (86%) inhibited by knockdown of ANGPTL1 (P < 0.0001), indicating that ANGPTL1 may regulate the expression of miR-138. [score:11]
These findings suggest that ANGPTL1 directly or indirectly up-regulates the expression of miR-138, and miR-138 is involved in ANGPTL1 -mediated inhibition of migration of CRC cells. [score:10]
For example, miR-138 expression can be decreased by methylation of its DNA [27] and up-regulated by a histone deacetylase inhibitor [28] and overexpression of P 19 H-Ras [29]. [score:10]
Among these candidates, miR-138 was reported to be down-regulated in CRC tissues, and its down-regulation was associated with more severe metastasis in vitro and in vivo by targeting TWIST2 [17]. [score:9]
In addition, miR-138 was down-regulated in CRC tissues, and this down-regulation was associated with more severe metastasis in vitro and in vivo by targeting TWIST2 [17]. [score:9]
In SW620-ANGPTL1 cells, the expression of miR-138 was significantly enhanced compared to control cells (P < 0.0001), while it was markedly inhibited in SW480-shANGPTL1 cells (P < 0.0001) The level of miR-138 was further determined in cells with ANGPTL1 overexpression and knockdown. [score:7]
a SW620-Ctrl cells treated with miR-138 inhibitor showed enhanced migratory capacity (P = 0.01), and miR-138 inhibitor reversed the inhibition of migration in SW620-ANGPTL1 cells (P = 0.001). [score:7]
As shown in Fig.   5a-b, SW620-Ctrl cells treated with miR-138 inhibitor showed enhanced migratory capacity (P = 0.01), and miR-138 inhibitor reversed the inhibition of migration in SW620-ANGPTL1 cells (P = 0.001). [score:7]
In SW620-ANGPTL1 cells, the expression of miR-138 was significantly enhanced compared to control cells (P < 0.0001), while it was markedly inhibited in SW480-shANGPTL1 cells (P < 0.0001) The level of miR-138 was further determined in cells with ANGPTL1 overexpression and knockdown. [score:7]
Specifically, miR-138 overexpression inhibits EMT process by targeting Vimentin and EZH2, thus reducing breast cancer invasion [30]. [score:7]
B. miR-138 inhibitor or mimics decreased or enhanced the expression of miR-138, respectively, whereas the negative controls had no significant effects on its expression. [score:7]
In vitro and in vivo experiments showed that ANGPTL1 suppressed migration and invasion of CRC cells and prolonged overall survival (OS) in mouse mo dels, which may be mediated by the up-regulation of microRNA-138 (miR-138). [score:6]
miR-138 was up-regulated by ANGPTL1 and involved in ANGPTL1 -mediated inhibition of migration of CRC cells. [score:6]
ANGPTL1 might directly or indirectly regulate miR-138 expression via the above mechanisms. [score:6]
MicroRNA-138 expression was positively correlated with ANGPTL1 mRNA level in CRC tissues and up-regulated by ANGPTL1 in CRC cells. [score:5]
In addition, the microRNA-138 inhibitor or mimics could reverse or promote the ANGPTL1 -mediated inhibition of the migratory capacity of CRC cells, respectively. [score:5]
In CRC patients, miR-138 targets TWIST2, a crucial regulator of EMT, to attenuate metastasis [17]. [score:4]
In this study, we found that miR-138 was up-regulated by ANGPTL1, but the mechanism of its biogenesis remains unexplored. [score:4]
b Level of miR-138 in cells with overexpression and knockdown of ANGPTL1. [score:4]
d Representative images of transwell migration assay in cells treated with/without miR-138 mimics In this study, we compared the gene expression profiles of paired cancerous and normal tissues from TCGA datasets, and identified ANGPTL1 as a down-regulated gene in CRC. [score:4]
Because ANGPTL1 has also been reported to regulate EMT to attenuate metastasis [7], it is likely that EMT might be a potential mechanism in the ANGPTL1-miR-138 -induced inhibition of metastasis in CRC, which requires further exploration. [score:4]
Future studies are warranted to investigate the underlying mechanisms by which ANGPTL1 regulates the transcription of miR-138, and the target genes that are involved in the ANGPTL1-miR-138 -induced inhibition of metastasis in CRC. [score:4]
As reported by Jiang et al. [25], ectopic transfection of miR-138 contributed to the reduced migration and invasion in oral tongue squamous cell carcinoma by targeting RhoC and ROCK2, which are involved in the remo deling of cellular cytoskeleton. [score:3]
With respect to the potential targets of miR-138, EMT, the TGF-β pathway, the RhoC-Erk-MMP-2/9 pathway, and the cofilin pathway have been identified to participate in the reduced migratory and invasive activity induced by miR-138 [24]. [score:3]
The specific data for expression levels of ANGPTL1 and miR-138 in tumor tissues are plotted in Additional file 5: Figure S3A. [score:3]
miR-138 inhibitor, mimics and negative controls were synthesized by GenePharma (Shanghai, China) and were dissolved in DEPC -treated H [2]O. The lentiviral vectors for ANGPTL1 were purchased from Cyagen Biosciences (Guangzhou, China), including pLV (Exp)-Puro-CMV > hANGPTL1/HA-IRES-eGFP and its control vector, pLV (Exp)-Puro-CMV > IRES-eGFP. [score:3]
As reported, epigenetic and transcription factors, as well as many other molecules, are correlated with miR-138 expression [24]. [score:3]
The final concentration of the miR-138 inhibitor or mimics and their corresponding negative controls was 50 nmol/l. [score:3]
A. Expression data of ANGPTL1 and miR-138 in 8 CRC tumor tissues from patients extracted from the GSE35982 dataset. [score:3]
A number of studies have demonstrated that miR-138 regulates various molecular pathways and is associated with initiation and progression of cancer, and thus is considered as a potential tumor suppressor [24]. [score:3]
For miR-138 inhibitor, the single-stranded RNA sequence was 5′-CGGCCUGAUUCACAACACCAGCU-3′. [score:3]
In clear cell renal cell carcinoma cells, miR-138 reduced the expression of hypoxia-inducible factor-1 alpha, which in turn enhanced apoptosis and decreased cell migration [26]. [score:3]
Our results also confirmed that miR-138 expression is positively correlated with ANGPTL1 mRNA level in CRC tissues and is involved in ANGPTL1 -induced attenuated migration of CRC cells, which was consistent with the reports of Long et al. [17]. [score:3]
Cells were transiently transfected with a miR-138 inhibitor, mimics or negative controls at 50 nmol/l using Lipofectamine 2000. [score:3]
Finally, we found that ANGPTL1 exerts its effect by up -regulating miR-138. [score:2]
We demonstrate that ANGPTL1 represses migration and invasion of CRC cells by up -regulating miR-138. [score:2]
d Representative images of transwell migration assay in cells treated with/without miR-138 mimics To identify genes of tumorigenic potential, we analyzed gene expression profiles of paired cancerous and normal tissues from TCGA datasets. [score:2]
b Representative images of transwell migration assay in cells treated with/without miR-138 inhibitor. [score:2]
Then, we conducted transwell migration assay to determine whether miR-138 is involved in ANGPTL1 -mediated inhibition of migration of CRC cells. [score:2]
miR-138 was suggested to be of great priority of being involved in ANGPTL1-regulated metastasis. [score:2]
For quantifying mature miR-138, reverse transcription was performed using a miRNA 1st Strand cDNA Synthesis kit (Sangon Biotech, Shanghai, China) according to the manufacturer’s protocol. [score:1]
ANGPTL1 repressed migration and invasion of CRC cells, and that miR-138 was involved in this process. [score:1]
ANGPTL1 repressed migration and invasion of CRC cells, and microRNA-138 was involved in this process. [score:1]
For miR-138 mimics, the sequences of oligonucleotides were 5′-AGCUGGUGUUGUGAAUCAGGCCG-3′ (sense), and 5′-GCCUGAUUCACAACACCAGCUUU-3′(antisense). [score:1]
To validate this finding, we explored the association between transcript levels of ANGPTL1 and miR-138 in another GSE dataset (GSE35982). [score:1]
In addition, in SW480-shANGPTL1 cells transfected with miR-138 mimics, the shANGPTL1 -induced increase in migratory capacity was significantly attenuated (P = 0.006, Fig.   5c-d). [score:1]
Among the miRNAs, the level of miR-138 was significantly higher in the samples with high levels of ANGPTL1 (P = 0.01). [score:1]
c SW480-Ctrl cells treated with miR-138 mimics showed decreased migratory capacity (P = 0.006), and miR-138 mimics reversed the promotion of migration in SW480-shANGPTL1 cells (P = 0.006). [score:1]
The mature miR-138 level was normalized with U6 determined by, as described previously. [score:1]
Pearson correlation analysis suggested that ANGPTL1 mRNA level was positively correlated with miR-138 level in CRC tumor samples (Pearson correlation value = 0.94, P = 0.001). [score:1]
The levels of ANGPTL1 and miR-138 were positively correlated (Pearson correlation value = 0.94, P = 0.001). [score:1]
[1 to 20 of 51 sentences]
4
[+] score: 180
Other miRNAs from this paper: mmu-mir-138-1
The results suggested that the NGAL gene was a target of miR-138, which down-regulated NGAL protein expression via post-translational modification. [score:10]
NGAL mRNA expression levels appeared to be inversely related to the expression levels of miR-138 in the cancer cell lines; thus, NGAL mRNA had high expression levels and miR-138 low expression levels in AsPC-1, RL95-2 and OVCAR-3 cells, whereas the reverse was the case for MCF-7 and HeLa cells. [score:9]
We also examined NGAL expression in AsPC-1 cells after transfection with miR-138 and observed that transfection with 50 nM miR-138 down-regulated NGAL expression (Fig. 3B). [score:8]
Furthermore, transfection of miR-138 into AsPC-1 and RL95-2 cell lines suppressed NGAL expression, indicating that miR-138 contributed to the regulation of NGAL expression in cancer cells; it has been suggested that this may occur in a tissue-specific manner [21]. [score:8]
For the MCF-7 cells, we transfected the cells with 100 nM miR-138 inhibitor to eliminate the effect on expression of miR-138, and then observed NGAL expression and cell migration behavior. [score:7]
Expression of miRNA in CancerBecause expression of miR-138 may be involved in the development of tumors, we chose six carcinoma cell lines for our preliminary investigation into the relative expression levels of NGAL mRNA and miR-138. [score:6]
The miR-138 expression levels, however, showed the opposite behavior to NGAL mRNA expression in all three cell lines, and a high level of miR-138 was found only in the MCF-7 cell line (Fig. 2B). [score:5]
Our study has shown that NGAL expression and cell migration capability were lowered in AsPC-1 and RL95-2 cells after miR-138 transfection, suggesting that NGAL suppression may result in the loss of the ability to undergo epithelial-mesenchymal transition, a step that is essential for malignancy in tumor metastasis [19]. [score:5]
Effect of miR-138 inhibitor on NGAL expression. [score:5]
The results showed there was no difference in the protein expression level and cell migration before and after transfection with the miR-138 inhibitor (Figs. 4A and 4B). [score:5]
0052979.g001 Figure 1 Cross-matching results from four different miRNA target identification websites revealed the miR-138 target sequence (shown in bold, underlined) in the 3′ UTR sequence of NGAL. [score:5]
Cross-matching results from four different miRNA target identification websites revealed the miR-138 target sequence (shown in bold, underlined) in the 3′ UTR sequence of NGAL. [score:5]
This revealed that NGAL or miR-138 did not regulate cell migration in the MCF-7 cell line, and it hinted at the miR-138 regulation of NGAL expression shown in the cell-type specificity. [score:5]
This suggested that miR-138 suppression of NGAL expression might be more effective than NGAL antibody treatment in reducing tumor growth. [score:5]
0052979.g004 Figure 4(A) NGAL mRNA expression levels, and (B) cell migration assay for miR-138 -inhibitor transfected MCF-7 cells. [score:4]
The miR-138 targeting gene was still obscure; however, this analysis showed the high possibility of the regulation in NGAL 3′ UTR. [score:4]
Liu et al. [13] have shown that miRNA-138 (miR-138) suppresses an EMT in squamous carcinoma cell lines and regulates cell migration and invasion. [score:4]
A comparison of the results showed that the microRNA target sequence (CACCAGC) of miR-138 was present in the 3′ UTR of NGAL (Fig. 1) in a higher estimated score than other microRNA, suggesting that transcriptional regulation of NGAL may be under miR-138 control. [score:4]
To further confirm target specificity between miR-138 and NGAL, we performed a luciferase reporter assay in the 293T cell line in using an NGAL 3′ UTR target site containing a downstream luciferase reporter gene. [score:4]
This implied that the regulation NGAL gene expression via miR-138 was important within the mammalian system. [score:4]
Because expression of miR-138 may be involved in the development of tumors, we chose six carcinoma cell lines for our preliminary investigation into the relative expression levels of NGAL mRNA and miR-138. [score:4]
Liu et al. [22] have shown that the down-regulation of miR-138 in a carcinoma squamous cell line is associated with the enhancement of cell migration via mesenchymal transition. [score:4]
Relative expression levels of NGAL mRNA and miR-138 in various cancer cell lines determined by qPCR. [score:3]
AsPC-1 cells transfected with 100 nM miR-138 caused a reduction of NGAL expression and a concomitant slowing of cell migration (Fig. 3C). [score:3]
Effect of miR-138 on NGAL expression and cell migration. [score:3]
After miR-138 transfection to AsPC-1 cells for 48 h, Ki-67 and TPX2 gene expression levels were significantly reduced (Fig. 7A, p<0.001). [score:3]
This finding led to our investigation of the role of miR-138, a multi-functional molecular regulator which may regulate NGAL expression and thereby play a role in NGAL -induced tumorigenesis. [score:3]
Both of the data of miR-138 transfection and antibody neutralization showed the suppression of the cell growth (Fig. 7) could explain the observation that when NGAL was neutralized by its antibody, tumorigenicity was diminished (Fig. 6D). [score:3]
Identification of miR-138-specific target in the 3′ UTR sequence of NGAL. [score:3]
miR-138 target sequence identified in the 3′ UTR sequence of NGAL. [score:3]
This indicated the existence of a relationship between miR-138 and NGAL gene expression in these cell lines. [score:3]
Expression of NGAL mRNA, miR-138 and the NGAL protein in three different cancer cell lines. [score:3]
NGAL expression may, therefore, be associated with tumorigenesis, and the phenomenon eliminated by miR-138 and NGAL antibody. [score:3]
In brief, approximately 2 × 10 [5] AsPC-1 cells were transfected with lentiviral particles (HyClone, Thermo Scientific, USA) containing either miR-138 (VISMHS_000912) or a non -targeting control sequence (HMR 5872). [score:3]
The target sequence of miR-138 (CACCAGC) was conserved in the 3′ UTR of human as well as mouse and rat. [score:3]
0052979.g005 Figure 5(A) Base pairing between miR-138 and wild-type NGAL-3′ UTR (NGAL-WT) or mutant NGAL-3′ UTR (NGAL-MUT) at the miR-138 target site. [score:3]
HEK293T cells were seeded in 24-well plates, and then cotransfected 0.5 µg of pGL3-NGAL-3′UTR or pGL3-NGAL-3′UTR-mut with 50 ng pRL-TK for 24 h, and then transfected with miR-138 mimic or non -targeting control RNA using Lipofectamine 2000. [score:3]
For the RL95-2 cell line, 25 nM miR-138 minimized NGAL expression (Fig. 3 D (a)); reduced cell migration was also observed when 100 nM miR-138 was transfected into RL95-2 cells (Fig. 3D (b)). [score:3]
Of course, we could not exclude miR-138 from the regulation of other genes to slow down cell proliferation. [score:2]
Effect of miR-138 on Cell Migration. [score:1]
Tumorigenicity was clearly reduced (by more than 50%; p<0.001) for the mice inoculated with miR-138 -transfected AsPC-1 cells. [score:1]
Apart from HCT-116 cells where there was no obvious correlation, the other five cell lines examined showed high levels of NGAL occurring with low levels of miR-138 (for example in AsPC-1 cells) or vice versa. [score:1]
The relative expressions levels of NGAL mRNA and miR-138 were measured for the six cell lines (Table 1). [score:1]
Two groups of nude mice (five mice per group) were inoculated with AsPC-1 cells and miR-138 -transfected AsPC-1 cells (1×10 [6] cells/mouse). [score:1]
NC: negative control, transfection with a random oligomer instead of miR-138. [score:1]
Approximately 1–5×10 [6] cells from each of the four cell types: AsPC-1, RL95-2, MCF-7 and miR-138-AsPC-1, were suspended in 50 µl of cell culture media. [score:1]
This suggested that the presence of miR-138 had a marked effect on tumorigenicity. [score:1]
The left column in white (or in black) indicates the control miR -transfected cells, and the right column in white (or in black) indicates the miR-138 transfected cells. [score:1]
Since NGAL is highly expressed in AsPC-1 cells, and is related to tumorigenesis, we investigated the effect of miR-138 on the tumorigenesis of AsPC-1 cells in nude mice. [score:1]
[1 to 20 of 49 sentences]
5
[+] score: 156
Other miRNAs from this paper: hsa-mir-138-2, hsa-mir-138-1, mmu-mir-138-1
In support of a crucial role of MiR-138 in the regulation of endothelial S100A1 expression, we found that levels of MiR-138 were significantly increased in samples taken from both human patients with CLI (Figure 6A) and ischemic mouse gastrocnemius muscles (Figure 6B), while expression of housekeeping small nucleolar RNAs RD44 and RD47 did not change, demonstrating that tissue ischemia leads to an increase in MiR-138 that could potentially be responsible for the observed downregulation of S100A1. [score:8]
It is tempting to speculate that one or both of the MiR-138 genes may be direct targets of Hif1-α, since we have shown here that this transcription factor is indispensable for the hypoxia -induced expression of MiR-138 and the subsequent repression of S100A1. [score:5]
Expression of U6 RNA was used to normalize the expression of miR-138. [score:5]
In this light it is interesting to note that MiR-138 has been reported to directly target Hif1-α in cultured cells [17], [18], potentially allowing for feed-back control of MiR-138 expression during hypoxia. [score:5]
Here we report that MiR-138 targets the 3′UTR of S100A1 and regulates its expression in a hypoxia -dependent manner specifically in ECs. [score:5]
Specific inhibition of the prolyl-hydroxylase 2 enzyme by IOX2 leads to the stabilization of Hif1-α in endothelial cells [5] (Figure 7A), and greatly increased MiR-138 levels (Figure 7B), concomitant with reduced S100A1–3′UTR reporter gene expression. [score:4]
0078684.g003 Figure 3 Murine C2C12 skeletal myoblasts (left panels) or differentiated myotubes (right panels) were subjected to hypoxia for 24 h. Protein extracts were immunoblotted for S100A1 protein expression (upper panels) and expression of MiR-138 by qPCR (lower panels). [score:4]
Since NO production contributes to the pro-angiogenic actions of VEGF [13], these experiments provide conclusive evidence for the pathophysiological relevancy of increased MiR-138 expression and subsequent suppression of S100A1 in ECs. [score:4]
Neither skeletal muscle myoblasts, differentiated myotubes (Figure 3), nor primary human vascular smooth muscle cells (HVSMCs, Figure 4) display much of a change of S100A1 or MiR-138 expression when subjected to hypoxia, even though all of these cell types express both S100A1 and MiR-138. [score:4]
Murine C2C12 skeletal myoblasts (left panels) or differentiated myotubes (right panels) were subjected to hypoxia for 24 h. Protein extracts were immunoblotted for S100A1 protein expression (upper panels) and expression of MiR-138 by qPCR (lower panels). [score:4]
While MiR-138, like all other microRNAs, has a large number of potential targets, its suppression of S100A1 in ECs may be especially important for vascular physiology since we have shown here that restoration of S100A1 levels in ECs with increased MiR-138 is sufficient to reverse EC dysfunction, as manifest by restored stimulus -dependent NO generation and Matrigel tube formation capability. [score:4]
Pathophysiologic relevance may be derived from the observation that S100A1 levels are severely downregulated [3], while MiR-138 levels are increased, in both human muscle biopsies procured from patients with CLI, as well as mice with induced limb ischemia (Figure 6). [score:3]
The hypoxia -induced increase in MiR-138 led us to examine the contribution of the transcription factor hypoxia -induced factor 1-α (Hif1-α) to the regulation of MiR-138 expression. [score:3]
The critical role of Hif1-α in the induction of MiR-138 in ECs was proven by siRNA -induced silencing of Hif1-α, which completely prevented the hypoxia -induced downregulation of reporter gene activity (Figure 7D). [score:3]
Overall homology of the 3′UTR is 72%, homology of the miR-138 target is 95% (21/22). [score:3]
Alternatively, in some experiments we used a cholesterol-conjugated antagomir-138 (1 µmol/L) to inhibit MiR-138 [6]. [score:3]
Confirmation of the role of MiR-138 in the regulation of S100A1 was obtained by deleting the putative 22 nucleotide MiR-138 target site within the S100A1–3′UTR of the luciferase reporter. [score:3]
This indicates that hypoxia regulates S100A1 expression in ECs predominantly via MiR-138 (Figure 5A). [score:3]
The predicted miR-138 target region (deleted in the DMiR138 construct) is outlined in red. [score:3]
Endothelial dysfunction develops when these carefully balanced multiple feedback loops become dysregulated allowing for prolonged MiR-138 expression with consequent loss of S100A1 and reduced eNOS activity. [score:3]
To inhibit activity of microRNA-138, 40 nmoles of a hairpin antimir (Dharmacon ThermoFisher cat # IH-300605-0005) to MiR-138 was transfected into EA. [score:3]
However, we can not rule out other ways by which MiR-138 expression is controlled since processing of the mature MiR-138 from the pre-MiR-138 also appears to be a regulated step in some tissues [19]. [score:3]
Here we show for the first time that S100A1, a central co-activator of eNOS activity, is drastically downregulated by hypoxia -induced MiR-138 in endothelial cells. [score:3]
This was specifically due to the induction of MiR-138 since co-transfection with the antimir-138 completely reversed the decrease in reporter gene expression (Figure 7C). [score:3]
In order to assess the physiological relevance of endogenously produced MiR-138, we inhibited the function of endogenously generated MiR-138 by incubating primary HMVECs with a specific antagomir to MiR-138 [6]. [score:3]
Infection with recombinant adenovirus expressing S100A1 [11] re-established S100A1 levels to near normal in MiR-138 mimic transfected cells (Figure 8B), and re-established tube formation capability (Figure 8A). [score:2]
0078684.g006 Figure 6A) Gastrocnemius muscle biopsy specimens from patients with CLI and non-ischemic control [3] were analyzed for expression levels of MiR-138 and the housekeeping small nucleolar RNAs snoRD44 and snoRD47 by qPCR. [score:2]
Real Time PCR for MiR-138 Expression in Mice. [score:2]
This change in eNOS phosphorylation also was normalized upon re -expression of physiologic levels of S100A1, even in the continued presence of the MiR-138 mimic. [score:2]
Re -expression of S100A1 reverses the MiR-138 induced EC dysfunction. [score:2]
In order to examine the physiological relevance of increased EC MiR-138 expression we transfected primary HMVEC with the MiR-138 mimic and tested the ability of these cells to form capillary-like tube networks on Matrigel matrix. [score:2]
MiR-138 Targets the S100A1-3′UTR in ECs. [score:2]
Furthermore it is clear that hypoxia, per se, does not increase MiR-138 levels in all cells, as we have shown that C2C12 skeletal muscle cells, while expressing both MiR-138 and S100A1, do neither increase MiR-138, nor decrease S100A1 when subjected to hypoxia. [score:2]
A) Gastrocnemius muscle biopsy specimens from patients with CLI and non-ischemic control [3] were analyzed for expression levels of MiR-138 and the housekeeping small nucleolar RNAs snoRD44 and snoRD47 by qPCR. [score:2]
In order to verify the potential targeting of S100A1 by MiR-138, we co -transfected a MiR-138 mimic (Dharmacon) together with the S100A1–3′UTR reporter into EA. [score:2]
MiR-138 decreases S100A1 gene expression in Endothelial Cells. [score:2]
MiR-138 compromises VEGF-stimulated NO production by inhibiting S100A1. [score:2]
Real Time PCR for MiR-138 Expression inRNA was isolated from mice as well as cell samples using RNAzol RT according to manufacturer’s instruction (MRC, Inc cat# RN190). [score:2]
While total eNOS levels remained unchanged in MiR-138 mimic transfected ECs, the reduction of S100A1 greatly increased eNOS phosphorylation on Thr-495, a demonstrated eNOS inhibitory site [12] (Figure 8B). [score:2]
While a recent report by Li et al. demonstrated a hypoxia -induced increase of MiR-138 in airway smooth muscle cells [20], we did not observe a significant hypoxia -induced change in either MiR-138 or S100A1 expression in primary human vascular smooth muscle cells, however it is likely that the significant differences in smooth muscle cell type (airway vs. [score:2]
B) Expression levels of MiR-138 were assessed by qPCR in extracts prepared from EA. [score:2]
Specific inhibition of MiR-138 prevents the hypoxia -induced loss of S100A1 in ECs. [score:2]
MiR-138 compromises EC Matrigel -induced capillary formation by inhibiting S100A1. [score:2]
B) Expression of MiR-138 was by qPCR. [score:2]
B) Gastrocnemius muscle biopsy specimens from mice post femoral artery resection (FAR) and non-ischemic contralateral control were analyzed for expression levels of MiR-138 and the U6 small nuclear housekeeping RNA by qPCR at times indicated. [score:2]
A gene block (IDT) comprising the entire S100A1 3′UTR, but lacking specifically the 22 nucleotide putative MiR-138 target site, was subcloned NheI to XhoI into the luciferase reporter vector to generate the ΔMiR-138 construct. [score:2]
MiR-138 Induces EC Dysfunction Specifically via Inhibition of S100A1. [score:2]
hy926 ECs were transfected with either the wild-type (WT) S100A1–3′UTR luciferase reporter gene or a S100A1–3′UTR with deletion of the 22 nucleotide putative MiR-138 target site (ΔMiR138). [score:2]
The most important finding of our work is the identification of MiR-138 as a crucial determinant of S100A1 expression in ECs subjected to hypoxia. [score:2]
Indeed hypoxia (induced by either low oxygen or chemical reagents) drastically increased expression of MiR-138 in both EA. [score:2]
As strategies to manipulate microRNA levels in vivo become more mature [6], [28], MiR-138 might represent an attractive target for the treatment of pathologies that have underlying EC dysfunction. [score:2]
Together, these findings strongly suggest that hypoxia induces cell-type selective expression of MiR-138 and that this induction can drastically reduce S100A1 protein levels in ECs. [score:2]
The MiR-138 mimic reduced reporter gene expression by over 95% after 24 h (Figure 2A). [score:2]
Hif1-α Activation is Required for the Hypoxia -induced Expression of MiR-138. [score:2]
Figure S2 A) Alignment of miR-138 with the human S100A1-3′UTR as predicted by miRANDA. [score:1]
It is clear that MiR-138 itself is dynamically regulated in response to low oxygen levels in a cell-type specific manner. [score:1]
Proposed Scheme of S100A1 regulation by MiR-138. [score:1]
Confirmation of this was also obtained by co-transfecting a hairpin anti-MiR-138 (antimir-138, Dharmacon) into EA. [score:1]
[1 to 20 of 58 sentences]
6
[+] score: 140
To elucidate the effect of miR-138 on p53 in humans, we overexpressed miR-138 in p53 wild-type human H460 cells found no downregulation of the p53 mRNA expression levels (Fig. 5B). [score:8]
To explore the relation of p53 to miR-138, we firstly silenced p53 expression in human lung cancer H460 cells (p53 wild-type cells) using a p53 siRNA, and observed that the expression levels of miR-138 and its precursors were significantly downregulated in H460 cells (Fig. 1A). [score:8]
Overexpression of miR-138 in human H460 cells could not knock down p53 mRNA expression, while the p53 mRNA level decreased significantly in NIH/3T3 and H9C2 cells (Fig. 5B). [score:6]
org) in combination revealed that the 3′ UTRs of mouse and rat p53 mRNA have miR-138 target sites, but the 3′ UTR of human p53 mRNA has lost the miR-138 target sites because of mutations (Fig. 5E,F). [score:6]
In this study, we found that p53 could regulate miR-138 and was regulated by miR-138, and the mutual regulation between p53 and miR-138 was confirmed as species-specific; i. e., the regulatory effects between p53 and miR-138 are unidirectional in mouse and human cells, which would lead to different biological effects on the molecules downstream of p53 and miR-138. [score:6]
To further determine the regulations of miR-138 by p53 in human lung cancer cells, we compared the expressions of p53 and miR-138 in H460 and H1299 cells, which lack p53 expression. [score:5]
Correspondingly, the expression levels of mature miR-138 and its precursors increased significantly after overexpression of wild-type p53 in H1299 cells (Fig. 1D). [score:5]
Further analysis of the possible target sites of miR-138 in the 3′ UTRs of mouse, rat and human p53 mRNA using TargetScan (http://www. [score:5]
We found that miR-138 decreased significantly after p53 “knock down” and restored when p53 overexpression in human normal breast cell HBL-100 and normal liver cell L02 (Fig. 7A,B). [score:4]
To test the regulation of p53 on miR-138 in other species, we silenced the p53 expression in mouse NIH/3T3 cells and rat H9C2 cells (both p53 wild-type cells) using p53 siRNA. [score:4]
To further elucidate the differences in p53 regulation by miR-138 among mouse, rat and human, we performed further bioinformatic analysis of the target sites for miR-138 in p53. [score:4]
We further compared the relation between p53 and miR-138 in a series of human and rat tissues, and found a nearly positive expression correlation between miR-138 and p53 in human tissues (placenta, lung, breast, gallbladder and thyroid) while a negative expression correlation in rat tissues (placenta, heart, lung, kidney and liver) (Fig. 7D,E). [score:4]
Considering that miR-138 regulates p53 only in mouse and rat cells and that miR-138 could be regulated by p53 only in human cells, suggested that it is difficult to form the “ transcription factor – miRNA feedback loop” with same miRNA in the same cells, which may be important in stable gene regulation. [score:4]
Under these conditions, the mature level and the primary level of miR-138 were significantly upregulated (Fig. 1B). [score:4]
Surprisingly, the expression levels of miR-138 and its precursors showed no significant changes in these cells, which suggested that p53 regulation of miR-138 is species specific (Fig. 4A,B and Supplementary Fig. S3). [score:4]
Conversely, p53 was not downregulated by miR-138 (Fig. 7C). [score:4]
miR-138 is a transcriptional target of p53. [score:3]
However, unlike miR-138, miR-125b specifically target human p53 instead of mouse and rat (Fig. 6A,B). [score:3]
To elucidate whether p53 directly regulates the transcription of human miR-138 as a transcription factor, we searched for the potential binding sites of p53 in the 5 kb upstream and downstream genomic regions of the miR-138 transcript using p53MH algorithm 32 and BioSun software 33. [score:3]
To test whether p63 and p73 have transcriptional activation functions for these two binding sites in human miR-138 genes, we overexpressed the wild-type p63 and p73 in H1299 cells and co -transfected them with the reporter vector containing p53 binding sites. [score:3]
The expression level of miR-138 was significantly higher in H460 cells than in H1299 cells under both the natural state and under stimulation by ionizing radiation (Fig. 1C). [score:3]
Surprisingly, when we reviewed previous report concerning the regulation of p53 by miR-138 30, we found that the experiments were done only in mouse embryonic fibroblast cells and the majority of reports on the regulation of p53 by miRNAs were done in human cells (Fig. 5A). [score:3]
To rule out tissue and cell type-specific regulation differences, we further chosed human normal cell lines instead of other cancerous cell lines to test the regulation between p53 and miR-138. [score:3]
Mutual regulation differences of p53 - miR-138 in human, mouse and rat. [score:2]
How to cite this article: Li, J. et al. Species-specific mutual regulation of p53 and miR-138 between human, rat and mouse. [score:2]
MiR-138 targeting p53 shows divergence between species. [score:2]
P53 regulation of miR-138 shows divergence between species. [score:2]
The p53 -binding sites oligonucleotides (bold) contains XhoI at the 5′-end and HindIII sequence (italic) at the 3′-end (miR-138-1: 5′- CTCGAG ATCCTTGTCTGAAAGACATGGCC AAGCTT-3′; miR-138-2: 5′- CTCGAG TGTCTTGTTCCCTGTGGTGCCTCCCTTGCCT AAGCTT-3′) were separately inserted upstream of a minimal promoter of the luc2 gene and named pGL4-138-1 and pGL4-138-2. Reporter plasmids for the miRNA target assay: The almost full length human P53 3′ UTR (1496 nt, GenBank accession NM_001126114) was PCR amplified using genomic DNA from H460 cells. [score:2]
These results could confirm the existence of species-specific differences of the regulations between miR-138 and p53. [score:2]
Similarly, the transcriptional regulation of p53 on miR-138 was significantly stronger than that of p63 and p73 in H1299 cells (Fig. 3D). [score:2]
The p53 -binding sites oligonucleotides (bold) contains XhoI at the 5′-end and HindIII sequence (italic) at the 3′-end (miR-138-1: 5′- CTCGAG ATCCTTGTCTGAAAGACATGGCC AAGCTT-3′; miR-138-2: 5′- CTCGAG TGTCTTGTTCCCTGTGGTGCCTCCCTTGCCT AAGCTT-3′) were separately inserted upstream of a minimal promoter of the luc2 gene and named pGL4-138-1 and pGL4-138-2. Reporter plasmids for the miRNA target assay: The almost full length human P53 3′ UTR (1496 nt, GenBank accession NM_001126114) was PCR amplified using genomic DNA from H460 cells. [score:2]
P53 regulates miR-138 in human non-small cell lung cancer cells. [score:2]
Taken together, these results indicated that p53 acts as a transcriptional activator after interaction with the binding sites in the miR-138 gene. [score:1]
P53 -mediated activation of miR-138 in human NSCLC cells. [score:1]
The predicted p53 binding region of miR-138 was amplified from immunoprecipitates of anti-p53, anti-Histone H3 or normal rabbit IgG control. [score:1]
Nevertheless, when we mutated the miR-138 binding site in the 3′ UTR of human p53 mRNA, we found that miR-138 could obviously interact with the mutated binding and reduce the activity of the luciferase reporter (Fig. 5G). [score:1]
The human miR-138 family comprises hsa-miR-138-1 and hsa-miR-138-2, located on chromosomes 3p21.32 and 16q13, respectively. [score:1]
The mutated human P53 3′ UTR containing a predicted miR-138 binding site was cloned into pGL3-Control Vector and named H p53 mut-3′UTR. [score:1]
In fact, not only miR-138, miR-125b regulation of p53 also has species specificity, compared with miR-485 without this feature. [score:1]
ChIP analysis failed to identify p53 binding sites in the mouse and rat miR-138 gene region, which explains the lack of response of miR-138 transcription to p53 in mouse and rat cells (Fig. 4C,D). [score:1]
p53 binds to the predicted p53 binding site of hsa-miR-138. [score:1]
Although two miR-138 precursor molecules (pre-miR-138-1 and pre-miR-138-2) exist in human, mouse and rat, distributed on different chromosomes, the sequences of mature miR-138 were completely consistent in human, mouse and rat (Fig. 5C). [score:1]
shtml) of the 5 kb upstream and downstream genomic regions of the miR-138 gene in human, mouse and rat showed little homology between humans and mice or rats (Supplementary Fig. S1). [score:1]
The double-stranded oligonucleotides harbouring the p53 binding sequence (miR-138-1 sense: 5′-ATCCTTGTCTGAAAGACATGGCC-3′; miR-138-1 antisense: 5′-GGCCATGTCTTTCAGACAAGGAT-3′; miR-138-2 sense: 5′-TGTCTTGTTCCCTGTGGTGCCTCCCTTGCCT-3′, miR-138-2 antisense: 5′-AGGCAAGGGAGGCACCACAGGGAACAAGACA-3′) were end labelled by biotin (Invitrogen, Carlsbad, CA, USA). [score:1]
To amplify the potential p53 -binding sites from the upstream or downstream genomic regions of miR-138, real-time PCR was performed. [score:1]
These results further confirmed the existence of p53 REs in the upstream and downstream of the has-miR-138 gene and that p53 transcriptionally activates miR-138 by binding to these sites. [score:1]
That is, similar relation between p53 and miR-138 was found both in non-cancerous human cell lines and in NSCLC cell lines. [score:1]
A putative p53 binding site (BS) located −4285 to −4263 bp upstream of miR-138-1; a predicted p53 binding site located downstream (1569 to 1599 bp) of miR-138-2. (B) ChIP-qPCR analyses were preformed using digested chromatin from H460 cells. [score:1]
The relation between p53 and miR-138 in non-cancerous human cell lines and tissues. [score:1]
First, we analysed the conservation of miR-138, which showed that miR-138 is highly conserved in many vertebrates. [score:1]
After 48 h, quantitative RT-PCR was performed to examine miR-138 and pri-miR-138 levels. [score:1]
The miRNA mimic and siRNA sequences were as follows: miR-138 mimic, 5′-AGCUGGUGUUGUGAAUCAGGCCG-3′ (sense); p53 siRNA, 5′-UAUGAAUCGUCGUCCUAUUC-3′ (sense). [score:1]
[1 to 20 of 52 sentences]
7
[+] score: 131
In line with gene expression and bioinformatic analyses, we hypothesized that EGR2 induces transcriptional upregulation of miR-138, and miR-138 helps EGR2 to downregulate the negative regulators, driving myelination forward. [score:10]
In SC, miR-138 levels have previously been shown to be significantly upregulated during development and drastically reduced in the sciatic nerves of Dicer1 c KOs and Dgcr8 c KOs 4, 11. miR-138 is predicted to target several immature SC mRNAs and negative regulators of myelination, including Ccnd1, Sox2 and Jun, although the functional effects in luciferase assays were modest 4, 17. [score:7]
Therefore, EGR2 regulates miR-138 upregulation during development at the transcriptional level. [score:6]
To test whether the upregulation of miR-138 by EGR2 during development is regulated at the level of transcription, we stained whole mount P7 sciatic nerves of Egr2 [−/−]; mir-138-1:: lacZ and mir-138-1:: lacZ control mice with Xgal. [score:6]
Thus, at least miR-138 and miR-338-3p expression resemble that of other key regulators in the network, displaying mirror image expression in differentiation versus dedifferentiation situations [20]. [score:6]
For example, Ccnd1 is targeted by miR-138, but it is also targeted by miR-34a, miR-16, miR-195, miR-153, miR-503 and many other microRNAs [50]. [score:5]
Our previous study demonstrated that miR-138 is upregulated during postnatal SC development [4]. [score:5]
miR-138 is downregulated upon nerve injury. [score:4]
miR-138 was significantly downregulated in injured nerves (Fig. 1A,B). [score:4]
Findings from the study of miR-138 conditional knockouts under these physiological stresses are likely to provide new understanding of disease pathophysiology and uncover opportunities for therapeutic intervention. [score:4]
Since miR-138 expression resembles that of a positive regulator of myelination, we would expect that the loss of miR-138 may delay remyelination after nerve injury. [score:4]
Thus, EGR2 is either directly or indirectly upstream of miR-138, miR-338, and miR-146b in vivo. [score:3]
miR-138 is also expressed in oligodendrocytes [16]. [score:3]
However, when we applied stringent statistical analysis, including adjusting the p-value for false discovery rate with ExpressionSuite software, miR-138 was the only microRNA that was significantly altered (fold change = 0.038 of normal, p-value = 0.042). [score:3]
Thus, in addition to EGR2 repression of antecedent gene expression programs via NAB corepressors [46], EGR2 induction of miR-138, and potentially miR-338 and miR-146b, may be a second mechanism by which EGR2 carries out or reinforces the repression. [score:3]
For mir-138-1 and mir-138-2 expression studies, we crossed β-Actin:: Cre [+] mice (Jackson Laboratory) to mir-138-1 [flox/wt] mice and mir-138-2 [flox/wt] mice obtained from Mutant Mouse Regional Resource Centers (MMRRC) [21] to obtain heterozygous lacZ-tagged mir-138-1 [del/wt] mice and heterozygous lacZ-tagged mir-138-2 [del/wt] mice. [score:3]
The reduction of miR-138 in Egr2 [−/−] could be because microRNA processing is affected in this mutant or because miR-138 is a transcriptional target of EGR2. [score:3]
A third possible explanation for the lack of phenotype, is that there is genetic redundancy from microRNAs that do not share seed sequences with miR-138 but have overlapping sets of targets [2]. [score:3]
Quantitative RT-PCR expression levels of selected SC genes and miR-138, 338-3p and 146b in injured nerves ((A) crushed nerve, (B) transected nerve) (gray bars) and contralateral controls (black bars) (* p < 0.05, ** p < 0.001, ***p < 0.005). [score:3]
Here, we examined the expression of miR-138 and its role in SC differentiation. [score:3]
The majority of individual microRNA conditional knockout mice examined thus far, like our miR-138 c KO, do not exhibit overt developmental phenotypes 2, 51. [score:3]
Together, these results suggest that loss of miR-138 in SC during development does not block myelination or significantly alter the timing of myelination in sciatic nerves. [score:2]
One possible explanation of this result is that miR-138 plays a significant biological role in early SC development and P0::Cre deleted miR-138 too late. [score:2]
To test whether miR-138 is required in SC development, we conditionally removed miR-138 in SC by crossing mir-138-1 [flox/ flox] mice to P0:: Cre [+], mir-138-1 [flox/wt] mice. [score:2]
However, conditionally knocking out miR-138 did not reveal any major myelination deficit. [score:2]
To determine which locus is transcribed in SC during development, we obtained mir-138-1 [flox/wt] mice and mir-138-2 [flox/wt] mice from Mutant Mouse Regional Resource Centers (MMRRC). [score:2]
There are two distinct genetic loci, mir-138-1 (chromosome 9) and mir-138-2 (chromosome 8), that may give rise to mature miR-138. [score:1]
In humans and mice, miR-138 may be transcribed from the mir-138-1 locus or mir-138-2 locus [44]. [score:1]
The above results suggest that the mir-138-1 locus is the major contributor to mature miR-138 levels in SC. [score:1]
miR-138 level is 28 fold lower in the sciatic nerves of the mir-138-1 [del/ del] homozygous mutants than the controls (N ≥ 3, p = 0.0019), while miR-138 level in the mir-138-2 [del/ del] homozygous mutants does not significantly differ from the controls (***p < 0.005). [score:1]
These data demonstrate that the mir-138-1 locus is the major contributor to miR-138 levels in SC, although a small contribution from the mir-138-2 locus cannot be ruled out. [score:1]
Here we sought to fill this gap, focusing on miR-138. [score:1]
By contrast, in the mir-138-2 mutants, miR-138 levels did not significantly differ from the controls (Fig. 2C). [score:1]
miR-138 has been shown to be involved in the proliferation of various cell types 31– 34. [score:1]
For miR-138 loss-of-function studies, we bred P0:: Cre [+]  [58], mir-138-1 [flox/wt] mice to mir-138-1 [flox/ flox] mice and P0::Cre [+], mir-138-1 [flox/wt], mir-138-2 [flox/wt] mice to mir-138-1 [flox/ flox], mir-138-2 [flox/ flox] mice. [score:1]
We observed no obvious behavioral abnormality from the resulting P0::Cre [+], mir-138-1 [flox/ flox], mir-138-2 [flox/ flox] mutants (mir-138-1/-2 c KOs) at two months old, and semi-thin analysis of adult mir-138-1/-2 c KO sciatic nerve cross sections showed, similar to the controls, normal myelin sheaths visible by dark blue staining of Toluidine blue (Fig. 6A). [score:1]
In oligodendrocytes, miR-138 has been identified as a pro-differentiation factor [16]. [score:1]
Another way to reveal the function of miR-138 could be by crossing mir-138-1 c KO mice to Egr2 [Lo/Lo] mutant mice [10]; this may exacerbate the hypomyelination phenotype if miR-138 is indeed induced by EGR2 to perform part of the downstream functions of EGR2 as a repressor of antecedent gene programs. [score:1]
Additionally, the Egr2 transcript itself has a miR-138 predicted binding site in the 3′UTR, possibly to modulate levels of EGR2 as part of a feedback mechanism [17]. [score:1]
Egr2 [−/−] sciatic nerves display very little transcriptional activity at the mir-138-1 locus and consequently, mature miR-138 levels are extremely low in these nerves. [score:1]
To test the hypothesis that miR-138 may alter proliferation and/or cell cycle exit in SC, we injected mice with EdU for 2 hours, performed immunohistochemistry on harvested sciatic nerves and quantified EdU+/DAPI+ cells at P4 (Fig. 5A). [score:1]
P0::Cre is turned on around E15 in immature SC [47], but since microRNAs are stable [48], if there were low levels of miR-138 in early SC, then timing of deletion could make a difference. [score:1]
We considered the possibility that the mir-138-2 locus may contribute very low but significant levels of miR-138 in SC that is sufficient for myelination even in the absence of mir-138-1. To test this possibility, we bred mir-138-1 [flox/ flox], mir-138-2 [flox/ flox] mice to P0::Cre [+], mir-138-1 [flox/wt], mir-138-2 [flox/wt] mice to generate double knockouts that completely lack miR-138. [score:1]
On the other hand, transcription of the mir-138-2 locus was undetectable in newborn or P14 nerves. [score:1]
It is possible that the functional role of miR-138 may be revealed in an injury paradigm. [score:1]
Consistent with this, we found that the mir-138-1 locus is the predominant source of miR-138 in SC. [score:1]
Levels of miR-138 were drastically decreased in Egr2 null samples. [score:1]
We used the same ChIP-Seq database and found that both SOX10 and EGR2 bound to an enhancer near the mir-138-1 locus marked by histone H3K27Ac (red arrow in Fig. 3C), but did not bind near the mir-138-2 locus (not shown). [score:1]
We crossed mir-138-1 mice and mir-138-2 mice with germline deleter β-actin:: Cre [+] mice to produce mice with a lacZ-tagged deleted allele that lacked the β- actin promoter-neomycin casette (del). [score:1]
We studied the function of miR-138 in vivo with loss-of-function experiments, hypothesizing that miR-138 may facilitate the transition of SC from undifferentiated to myelinating states. [score:1]
To test this, we evaluated the expression of miR-138, its dependence on Egr2, and the impact of its loss of function in SC. [score:1]
Extrapolating from findings on the role of microRNAs in oligodendrocyte differentiation [16], we hypothesized that miR-138 may have a functional role in promoting timely myelination. [score:1]
We harvested sciatic nerves from the resulting heterozygous lacZ-tagged mir-138-1 [del/wt] mice and heterozygous lacZ-tagged mir-138-2 [del/wt] mice at P0 (newborn) and P14. [score:1]
This result implies that the mir-138-1 locus is transcribed at P14, but is undetectable by this assay in newborn SC, a pattern consistent with miR-138 levels during development [4]. [score:1]
Based on these analyses, we conclude that miR-138 is largely dispensable for SC myelination. [score:1]
In SC, miR-138 could potentially repress cell cycle genes such as Ccnd1 4, 35. [score:1]
[1 to 20 of 56 sentences]
8
[+] score: 94
The 6 upregulated miRNAs (mmu-miR-5132-5p, mmu-miR-3104-5p, mmu-miR-669c-5p, mmu-miR-705, mmu-miR-760-3p, mmu-miR-1962) and the 9 downregulated miRNAs (mmu-miR-146a, mmu-miR-138, mmu-miR-5123, mmu-miR-196b, mmu-miR-5099, mmu-miR-150, mmu-miR-145, mmu-miR-27a, mmu-miR-23a) chosen for validation were also based on their target genes predicted, whose functions are well relevant to inflammation and cancer. [score:9]
Clin Respir J. 39 Long L, Huang G, Zhu H, Guo Y, Liu Y, et al (2013) Down-regulation of miR-138 promotes colorectal cancer metastasis via directly targeting TWIST2. [score:7]
Among them, all the 16 colorectal cancers showed downregulated miR-138 and miR-150 levels (Figures 3A and 3D), and 15 out of the 16 colorectal cancers showed lower miR-145 and miR-146a expression levels than normal control (Figures 3B and 3C). [score:6]
As shown in Figure 3, in overall, the expression level of miR-138, miR-145, miR-146a and miR-150 were downregulated by approximately 3.37, 3.39, 2.56 and 4.99 fold in colorectal cancers than those in the matched adjacent normal mucosa (p<0.0001). [score:6]
Among the markedly changed miRNAs, the downregulated miRNAs, miR-138, 145, 146a and 150, were validated in both mouse and human tissues, particularly, in human colitis and colorectal cancer tissues, suggesting suppressing roles of miR-138, 145, 146a and 150 in colitis malignant transition via interacting with cytokines and inflammatory factors. [score:6]
miR-138 inhibited cancer cell growth and tumorigenesis in non-small cell lung cancer and nasopharyngeal cancer by targeting 3-phosphoinositide -dependent protein kinase-1 (PDK1) and CCND1 [38]– [40]. [score:5]
Unfortunately, no common inflammation- and cancer -associated targets for all of the 4 miRNAs (miR-138, 145, 146a and miR-150) were identified using miRNA target prediction tools. [score:5]
Please be noted that CCT3 and PAPPA were the common targets for miR-138, miR-146a and miR-150, and ZHX2 was the common target for miR-138, miR-145 and miR-150. [score:5]
As shown in Figure 5 and Table 2, there were 21, 13 and 25 common targets between miR-138 and miR-145, miR-146a and miR-150, respectively; there were 16 and 15 common between miR-145 and miR-146a and miR-150, respectively; and there were 7 common targets between miR-146a and miR-150. [score:5]
Although the observations were obtained from small sized samples, the trends of significant downregulation of miRNAs (miR-138, 145, 146a and miR-150) strongly suggested their clinical importance of linkage to chronic colitis and colitis -associated colorectal cancer, indirectly indicating their potential biological functions of involving in colitis malignant transformation. [score:5]
Our study further identified some common targets of the miR-138, 145, 146a and miR-150 (Table 2 and Figure 5), such as PAPPA (pregnancy -associated plasma protein A), CCT3 (chaperonin containing TCP1, subunit 3) and ZHX2 (zinc fingers and homeoboxes 2), which were the common targets of three miRNAs. [score:5]
Most recent studies reported that downregulated miR-138 sustained inflammatory factor NF-kB activation and promoted esophageal cancer progression [42], and that miR-138 response to pro-inflammatory cytokines depends on the stabilization of HIF1-α in primary human microvascular endothelial cells [43]. [score:4]
A, miR-138 was significantly downregulated in colitis. [score:4]
A, miR-138 was significantly downregulated in colorectal cancers. [score:4]
0099132.g003 Figure 3A, miR-138 was significantly downregulated in colorectal cancers. [score:4]
0099132.g004 Figure 4A, miR-138 was significantly downregulated in colitis. [score:4]
Previous studies have demonstrated tumor suppressor roles of miR-138 in cancer biology. [score:3]
Numbers of the common targets of the miRNAs (miR-138, 145, 146a and miR-150), and their network. [score:3]
In colorectal and ovarian cancers, miR-138 suppressed cancer cell migration and metastasis through interfered with TWIST2, SOX4 and HIF1-a [39], [41]. [score:3]
Back to our findings, that were, cytokines were significantly increased (Figure 6) and miR-138, 145, 146a and miR-150 were significantly decreased in Muc2 [−/−] mouse colon and human colitis and colorectal cancer, incorporating with the published observations, strongly support our hypothesis that the cytokine -associated miRNAs, miR-138, 145, 146a and miR-150, play important roles in chronic colitis malignant transformation through interfering with cytokines and inflammatory factors. [score:1]
[1 to 20 of 20 sentences]
9
[+] score: 90
Other miRNAs from this paper: mmu-mir-140, mmu-mir-338, mmu-mir-138-1, mmu-mir-146b, mmu-mir-709
Overexpression of miR-709 and/or an inhibitor of miR-138 (antimiR-138) lead to down-regulation of Egr2 protein expression in Schwann cells. [score:10]
In addition, we wanted to use two miRNAs with opposing function in PNS injury (miR-138 is down-regulated while miR-709 is up-regulated) to emphasize that the final outcome of gene expression is molded by a synchronized action of opposing signals. [score:9]
Finally, to show that the addition of the CMV-miR vector has no effect on luciferase expression in the empty sensor vector we analyzed the effect of the pCMV-miRNA expressing vectors, as well as miR-709 and miR-138 on the expression of luciferase from pMIR-report vector. [score:7]
For instance, during development, miR-138 and miR-338 lead to the repression of Sox-2, c-Jun and other anti-myelinating factors to initiate differentiation of glial cells [19], [23] while these transcripts are translated following peripheral nerve injury despite having sites for other upregulated miRNAs (Fig. 2). [score:7]
In conclusion, our Luciferase expression data demonstrate that miR-138 and miR-709 can efficiently bind and regulate the expression of Sox-2, c-Jun and Egr2 in the context of an in vitro experiment. [score:6]
MiR-138 and miR-709 show the highest affinity for binding and regulation of Egr2, c-Jun and Sox-2 expression, which are the main gene regulators of the transition between differentiation and dedifferentiation following PNS injury [14]. [score:5]
miRNAs Form Functional Complexes with Their Targeted mRNAs in Association with Ago-2 in vivo Our results show that the protein expression pattern during peripheral nerve injury response (Fig. 1A) is a result of the synchronous and concerted action of miRNAs with similar or opposing roles (e. g. miR-138 and miR-709). [score:5]
Similar effect was observed when miR-138 was inhibited with antimiR-138 confirming our hypothesis that several miRNAs act synergistically to regulate the master regulator of myelination Egr2. [score:5]
MiR-138 is upregulated during Schwann cell differentiation where suppression of anti-myelinating factors is a pre-requisite for the induction of promyelinating factors like Egr2. [score:5]
For instance, Egr2 that has multiple highly accessible sites for both miR-138 and 709 (Table 1) is repressed by endogenous miRNAs (Fig. 3B & 3E first two bars), while Sox-2 and c-Jun with less accessible sites were comparable to the control or even up-regulated (Fig. 3A – 3D, first two bars). [score:4]
miR-138 and miR-709 Bind and Regulate the Expression of Sox-2, c-Jun and Egr2. [score:4]
Cos-7 cells were transfected with individual vectors containing gene of interest with multiple predicted miRNA binding sites in the 3′-UTR of the luciferase gene in the pmiR-Report (50 ng) in presence or absence of 5 nM microRNA oligonucleotides, (anti-miR miRNA-138 or anti-miR miRNA-709, or a negative control oligo, Ambion or 25 ng of pCMV-vectors expressing miR-709 or miR-138). [score:3]
We selected miR-138 and miR-709 for exogenous expression as Sox-2, c-Jun and Egr2 had multiple sites for these two miRNAs (Fig. 2, Table 1). [score:3]
As shown in Fig. S3, when pMIR-luciferase vector was co -transfected with either pCMV-empty vector, or pCMV-miR-709 or pCMV-miR-138 and b-gal transfection control vector the expression of luciferase was not significantly affected. [score:3]
Sox-2, which lacks highly accessible sites for miR-138 and miR-709 show comparable expression to control (A & D, first two bars), while c-Jun (C, first two bars) and Egr2 (B & E, first two bars) that have multiple highly accessible sites for both miR-138 and 709 (Table 1 & Table S2) are highly de-repressed (c-Jun) or highly repressed (Egr2) by endogenous miRNAs. [score:3]
Figure S3 Cos-7 cells were transfected with empty pmiR-Report luciferase vector (50 ng) in presence of pCMV-vectors expressing miR-709 or miR-138 or empty pCMV vector and β-Gal report vector (25 ng each). [score:3]
Our results show that the protein expression pattern during peripheral nerve injury response (Fig. 1A) is a result of the synchronous and concerted action of miRNAs with similar or opposing roles (e. g. miR-138 and miR-709). [score:3]
miR-138 and miR-709 bind and regulate Sox-2, c-Jun and Egr2. [score:2]
Selected miRNA (miR-138 and miR-709) binding regions of the genes of interest were amplified from mouse sciatic nerve RNA or from vectors (Sox-2 expression vector from Origene) cloned downstream of Luciferase gene in pmiR-report vector (Ambion) using the following primers. [score:2]
The combinatorial effect of miR-138 and miR-709 was validated as shown in Fig. 3A-E (last bar). [score:1]
[1 to 20 of 20 sentences]
10
[+] score: 71
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
The levels of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377, and miRNA-96 were up-regulated, whereas miR-125b, miRNA-200b, miR-122, miRNA-466b, miR-138, miRNA-214, miRNA-503 and miRNA27a were down-regulated in response to 17α-E2 treatment. [score:7]
qRT-PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats (Fig. 3 ). [score:7]
Treatment of MLTC-1 cells with Bt [2]cAMP for 6 h increased the expression of miRNA-212, miRNA-183, miRNA-132, miRNA-182 and miRNA-96, and inhibited the expression of miRNA-138 and miRNA-19a. [score:7]
Real-time quantitative PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats. [score:7]
Treatment of MLTC-1 cells with Bt [2]cAMP for 6 h increased the expression of miRNA-212, miRNA-183, miRNA-132, miRNA-182 and miRNA-96 and inhibited the expression of miRNA-138 and miRNA-19a (Fig. 4B ). [score:7]
Bt [2]cAMP stimulation of granulosa cells caused down-regulation of a majority of miRNAs, including miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, miRNA-138 and miRNA-19a, but expression levels of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 were significantly increased. [score:6]
qRT-PCR measurements indicated that exposure of primary rat granulosa cells to Bt [2]cAMP for 24 h inhibited the expression of miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, and miRNA-138 and miRNA-19a while enhancing the expression of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 (Fig. 4 ). [score:5]
Here, we directly assessed the binding of miRNA-138, miRNA-132 and miRNA-182/miRNA-214 to the 3′UTR of StAR, SREBP-1c, and LDLR, respectively, and regulation of their expression levels, by carrying out luciferase reporter gene assays. [score:4]
StAR may be a target gene of miR-376b, miR-150, miR-330 and miR-138. [score:3]
We next evaluated the effects of Bt [2]cAMP stimulation of rat ovarian granulosa cells and of mouse MLTC-1 Leydig tumor cells on the expression of twelve miRNAs (miRNA-212, miRNA-122, miRNA-183, miRNA-200b, miRNA-466b, miRNA-182, miRNA-96, miRNA-27a, miRNA-132, miRNA-214, miRNA-138 and miRNA-19a) whose adrenal expression was differentially altered in response to treatment of rats with ACTH, 17α-E2 or DEX. [score:3]
In contrast, no inhibitory effect of pre-miRNA-138 on the StAR 3′ UTR (with 2 putative binding sites) reporter construct and pre-miRNA-182 on the LDLR 3′UTR (with a single putative binding site) reporter construct was detected. [score:3]
The levels of expression of miRNA-212, miRNA-122, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96, miRNA-466b, miRNA-200b, and miRNA-19a are shown. [score:3]
More specifically, we assessed the impact of Bt [2]cAMP treatment on the expression of miRNA-212, miRNA-122, miRNA-27a, miRNA-466b, miRNA-200b, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96 and miRNA-19a. [score:3]
CHO cells were co -transfected individually with the StAR 3′-UTR (containing putative site I or site II for miRNA-138 binding) ± pre-miRNA-138-5p (panel B), the SREBP-1c 3′-UTR (containing putative binding site for miRNA-132) ± pre-miRNA-132-3p (panel C), the LDLR 3′-UTR (containing putative binding site for miRNA-182) (panel D), or the LDLR 3′-UTR (containing putative site I, site II or site III for miRNA-214 binding) ± pre-miRNA-214-3p for 36 h (panel E). [score:1]
CHO cells were co -transfected individually with StAR 3′-UTR (containing the putative site I or site II for miRNA-138 binding) ± pre-miRNA-138-5p (panel B), SREBP-1c 3′-UTR (containing the putative binding site for miRNA-132) ± pre-miRNA-132-3p, LDLR 3′-UTR (containing the putative binding site for miRNA-182), or LDLR 3′-UTR (containing the putative site I, site II or site III for miRNA-214 binding) ± pre-miRNA-214-3p for 36h, followed by determination of luciferase activities. [score:1]
Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
Individual fragments of the 3′ UTR region of the StAR gene containing site I or site II binding site for miRNA-138-5p, the 3′-UTR of SREBP-1c containing a binding site for miRNA-132-5p, the 3′-UTR of LDLR containing a binding site for miRNA-182-5p or the 3′-UTR of LDLR containing site I, site II, or site III binding site for miRNA-214-3p were inserted downstream of the luciferase open reading frame of pMIR-REPORT vector. [score:1]
Seed sequences of the putative miRNA-138-5p, miRNA-132-3p and miRNA-182-5p/miRNA-214-3p binding sites in the 3′-UTR of mouse StAR, SREBP-1c and LDLR genes, respectively. [score:1]
0078040.g003 Figure 3Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
[1 to 20 of 19 sentences]
11
[+] score: 29
miR-138, whose expression is correlated with many different types of cancers and diseases, is also involved in cardiac patterning, specifically through the regulation of expression of genes such as aldehyde dehydrogenase (Aldh) -1a2 and versican [45]. [score:8]
miR-138 was expressed in the laCL and ameloblasts, as well as in the dental papilla and odontoblasts, and miR-138 expression appeared to be higher in ameloblasts than in the laCL (Fig. 5B). [score:5]
miR-31 showed 14 to 18-fold higher expression in the laCL region compared to the liCL (Figs. 2, 4) and miR-138 showed 6 to 10-fold higher expression in ameloblasts compared to the laCL (Fig. 3, 4). [score:3]
Our results showed high expression of miR-31 in the laCL and miR-138 in ameloblasts, consistent with the microarray and qPCR analyses. [score:3]
Locailization of miR-31 and miR-138 expression. [score:3]
miR-138, -141, -200c, -429 were confirmed to be expressed highly, whereas miR-143, -145 levels were less abundant, in ameloblasts compared to the laCL region (Fig. 4B). [score:2]
Because Aldh1 is a marker of stem cells in certain contexts [46] and versican is a secreted extracellular matrix protein that is present in many mineralized tissues including the dental epithelium of developing tooth germs [47], miR-138 may be involved in the differentiation of stem cells towards enamel matrix-secreting ameloblasts. [score:1]
0024536.g005 Figure 5 In situ hybridization analysis of miR-31 and miR-138. [score:1]
In situ hybridization In situ hybridization was performed on paraffin sections essentially as described [6] except that DIG-labeled LNA probes specific for miR-31 and miR-138 (Exiqon) were hybridized using microRNA ISH buffer (Exiqon). [score:1]
In situ hybridization analysis of miR-31 and miR-138. [score:1]
In situ hybridization was performed on paraffin sections essentially as described [6] except that DIG-labeled LNA probes specific for miR-31 and miR-138 (Exiqon) were hybridized using microRNA ISH buffer (Exiqon). [score:1]
[1 to 20 of 11 sentences]
12
[+] score: 27
Other miRNAs from this paper: mmu-mir-191, mmu-mir-106a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-138-1
Although miR-138 has not previously been analysed in breast tissue samples, on a cellular level it has been implicated as a tumour suppressor [19], [20], [21], potentially through targeting Neutrophil gelatinase -associated lipocalcin(NGAL) [19] or hTERT [21]. [score:5]
In agreement with the microArray data, analysis of all murine samples (n = 45) revealed miR-138 to be significantly elevated in the circulation of animals during disease development (p<0.05, Figure 1A). [score:4]
No significant dysregulation was observed with miR-138 expression when comparing tumour to normal tissue. [score:4]
miR-138 was found to be significantly up-regulated in the circulation of patients with breast cancer (2.05±0.06 log [10] RQ) compared to healthy controls (1.83±0.05, log [10]RQ, p<0.005, Figure 2A). [score:3]
Expression of miR-138, miR-106a and miR-191 was examined in patient samples. [score:3]
Interestingly, however, miR-138 was significantly dysregulated across breast cancer subtypes (ANOVA p<0.01), with higher levels detected in the HER2 and basal subtype tissues (Figure 2B). [score:2]
In the current study, on a tissue level, miR-138 expression was not significantly changed in breast tumour samples compared to healthy controls, but was found to be significanlty altered across epithelial subtype, with the highest levels detected in Her2 amplified samples. [score:2]
miR-138, miR-191, and miR-106a were detectable in the circulation of all breast cancer patients and healthy controls included in the study (n = 166). [score:1]
miR-138 levels in (A) Circulation and (B) tissue of Breast Cancer Patients and healthy controls. [score:1]
miR-138, analysis of which has not previously been reported in patient samples, was identified as a potential circulating marker of breast cancer, with levels significantly elevated over time as tumours progressed in animals. [score:1]
Validation of changes in circulating levels of microRNAs identified using microArray analysis in murine blood samples at week1, week 3 and week 6 following tumour induction (A) Circulating miR-138 (B) Circulating miR-191 (C) Circulating miR-106a. [score:1]
[1 to 20 of 11 sentences]
13
[+] score: 26
In both ALCs (a) and LS8 cells (b), treatment with EMD elicited significant downregulation of miR-3085, miR-298, miR-138, miR-135a and miR-376b. [score:4]
Within both ALCs and LS8 cells, addition of EMD elicited significant downregulation of miR-3085, miR-298, miR-138, miR-135a and miR-376b (P < 0.05) (Fig. 6a,b and). [score:4]
The expression levels of miR-31, miR-21 and miR138 cannot be fully appreciated in the figure and the values are as follows: miR-31 in LS8 1.11 ± 0.0096, miR-21 in ALC 8.47 ± 0.94, miR-21 in LS8 1.35 ± 0.21, miR-138 in ALC 0.015 ± 0.0014. [score:3]
MiR-31, miR-21, miR-135a, miR-138, miR-203 and miR-346 showed statistically significant differential expression between the two ameloblast-like cell mo dels. [score:3]
In addition there were statistically significant differences in the expression of miR-138 and miR-346 in LS8 cells transfected by miR-153 and by negative control siRNA (P < 0.05) (Fig. 3c and). [score:3]
There were statistically significant differences in the expression of miR-138 and miR-346 in LS8 cells transfected by miR-153 and by negative control siRNA. [score:3]
Additionally, miR-31, miR-21, miR-135a, miR-138, miR-203 and miR-346 showed significantly differential expression patterns between ALCs and LS8 cells (P < 0.05) (Fig. 3a and). [score:3]
In the significantly enriched functional categories, such as those labeled with ‘endosome membrane’ or ‘lysosomal lumen’, miR-153 together with miR-3085, miR-298, miR-138, miR-135a, miR376b, miR-203 and miR-346 were predicted to be epigenetic regulators involved in endocytosis and endosomal/lysosomal pathways 11. [score:2]
In order to identify that ALCs and LS8 cells are suitable mo dels for investigating the functional role of miR-153, the baseline expression of miR-153 (along with miR-31, miR-21, miR-223, miR-410, miR-3085, miR-298, miR-135a, miR-138, miR376b, miR-203 and miR-346) was quantified by real-time PCR. [score:1]
[1 to 20 of 9 sentences]
14
[+] score: 20
Finally, miR-375, miR-138 and miR-9 were selected for further analysis due to their down-regulation in clinical samples and their ability to induced phenotypic changes in vitro. [score:4]
To validate the identified phenotypes, the miRNAs that were down-regulated in clinical samples and Top-40 ranked in the phenotype screen (miR-150, miR-375, miR23b, miR-138, miR-139-5p and miR-9) were subjected to detailed functional analysis using HCT116, HT29, LS174T TR4, DLD1 TR7 and SW480 colon cancer cell lines. [score:4]
Figure S4 The expression of miR-9 and miR-138 in laser capture microdissected colorectal cancer tissue. [score:3]
miR-9 and miR-138 were expressed primarily by stromal cells from both normal colon mucosa and adenocarcinomas (Figure S4). [score:3]
The ectopic expression of miR-375, miR-9 and miR-138 significantly reduced the viability of more than one cell line (MTT reduction >20% and p≤0.05) (Figure 2A (HCT116) and Figure S2), possible due to a general anti-proliferative or pro-apoptotic role of these miRNAs. [score:3]
Detection of miR-375, miR-138 and miR-9 in laser microdissected colorectal tissue. [score:1]
To elucidate the cellular origin of miR-375, miR-138 and miR-9, we measured their expression in laser captured microdissected colorectal adenocarcinomas and adjacent normal colon mucosa (Figure 2E and Figure S4). [score:1]
In conclusion, the validation analysis confirmed the anti-proliferative role of miR-9 and miR-138, and the apoptosis inducing capacity of miR-375 as identified in the high-throughput analysis. [score:1]
[1 to 20 of 8 sentences]
15
[+] score: 17
Despite these limitations, 9 mature miRNAs exhibited significant and markedly reduced expression levels, including miR-204, a miRNA found particularly enriched in the proximal mouse epididymis [55] and miR-138-5p, a potential tumor suppressor that inhibits cyclin D1 (Ccnd1) expression [57]. [score:9]
The mature miRNA most affected by Dicer1 inactivation in principal cells is miR-138-5p, as its expression intensity is decreased by a factor of 26 with an intensity level below the threshold of detection in Dicer1 c KO mice. [score:3]
Ctrl)↑ in Dicer1 c KO mmu-miR-138-5p -26,449 0,00106 mmu-miR-204-3p -4,49045 0,00140 mmu-miR-425-5p -4,24086 0,00380 mmu-miR-672-5p -3,74912 0,00271 mmu-miR-99b-3p -2,71028 0,00362 mmu-miR-191-5p -2,65916 0,00001 mmu-miR-200c-3p -2,57172 0,00340 mmu-miR-671-3p -2,47448 0,00744 mmu-miR-652-3p -2,14466 0,00837↓ in Dicer1 c KO mmu-miR-205-5p 2,07404 0,00226 mmu-miR-7019-5p 2,12703 0,00265 mmu-miR-7653-5p 2,3651 0,00209 mmu-miR-466m-5p 3,2093 0,00585 mmu-miR-669m-5p 3,2093 0,00585 We used qRT-PCR to assess the detection level of eight mature miRNA candidates whose expression intensity is changed in the proximal epididymidis of Dicer1 c KO compared with control mice (Fig 1B). [score:2]
Ctrl)↑ in Dicer1 c KO mmu-miR-138-5p -26,449 0,00106 mmu-miR-204-3p -4,49045 0,00140 mmu-miR-425-5p -4,24086 0,00380 mmu-miR-672-5p -3,74912 0,00271 mmu-miR-99b-3p -2,71028 0,00362 mmu-miR-191-5p -2,65916 0,00001 mmu-miR-200c-3p -2,57172 0,00340 mmu-miR-671-3p -2,47448 0,00744 mmu-miR-652-3p -2,14466 0,00837↓ in Dicer1 c KO mmu-miR-205-5p 2,07404 0,00226 mmu-miR-7019-5p 2,12703 0,00265 mmu-miR-7653-5p 2,3651 0,00209 mmu-miR-466m-5p 3,2093 0,00585 mmu-miR-669m-5p 3,2093 0,00585We used qRT-PCR to assess the detection level of eight mature miRNA candidates whose expression intensity is changed in the proximal epididymidis of Dicer1 c KO compared with control mice (Fig 1B). [score:2]
Among these, six miRNAs (miR-138, miR-187, miR-375, miR-204, miR-210 and miR-672) are consistently and significantly detected at a lower intensity level (i. e., elevated Cq value or Cq values below the detection threshold) in Dicer1 c KO vs. [score:1]
[1 to 20 of 5 sentences]
16
[+] score: 15
For example, miR-134 regulates LimK1 at the spine by stimulation of BDNF [19], miR-138 regulates palmitoylation in neurons by inhibiting the translation of LYPLA [16], [18], miR-132 targets p250GAP to enhance spine growth [20] and the FMRP associated miRNA, miR-125b blocks the translation of NR2B resulting in neuronal structural changes [21]. [score:11]
On the other hand, miR-134, miR-138 and miR-34b showed bigger changes in the expression of their primary transcripts than their mature forms (Figure 5F to H). [score:3]
Mature forms of miR-138 and miR-324b were not changed after contextual conditioning at any time point, but their primary transcripts were significantly decreased at 3 hours and increased at 24 hours after contextual conditioning. [score:1]
[1 to 20 of 3 sentences]
17
[+] score: 14
Other studies have shown that over -expression of miR-138 inhibits osteogenic and adipogenic differentiation [92], [93]. [score:5]
In addition to miR-335 and miR-138, there are a number of other differentially-expressed miRNAs identified in the present study that will be worth pursuing in the context of cartilage biology; some of these are generally not well-reported in the literature and their functional roles in normal tissue development and homeostasis are unknown so far (e. g. miRs- 301, 502, 532, 660, 1244, 1247, 1290, 1291). [score:4]
Interestingly, it has also been demonstrated that miR-138 can promote induced pluripotent stem cell (iPS) generation via regulation of p53 [94]. [score:2]
This study is the first to report miR-138 in cartilage and that higher expression is associated with differentiated and hypertrophic chondrocytes when compared to precursor cells (∼12 fold and 17 fold difference, respectively; Tables 2 and 3 ). [score:2]
This clearly indicates that miR-138 can control cellular differentiation and may function through different mechanisms depending on the tissue microenvironment. [score:1]
[1 to 20 of 5 sentences]
18
[+] score: 12
Other miRNAs from this paper: cel-let-7, cel-lin-4, hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-29b-1, mmu-mir-101a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-132, mmu-mir-181a-2, mmu-mir-199a-1, hsa-mir-199a-1, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-128-1, hsa-mir-132, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-138-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-92a-2, rno-let-7d, rno-mir-7a-1, rno-mir-101b, mmu-mir-101b, hsa-mir-181b-2, mmu-mir-17, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-101-2, cel-lsy-6, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7a-2, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-92a-1, rno-mir-92a-2, rno-mir-101a, rno-mir-128-1, rno-mir-128-2, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-199a, rno-mir-181a-1, rno-mir-421, hsa-mir-181d, hsa-mir-92b, hsa-mir-421, mmu-mir-181d, mmu-mir-421, mmu-mir-92b, rno-mir-17-2, rno-mir-181d, rno-mir-92b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, mmu-mir-101c, mmu-let-7j, mmu-let-7k, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
A northern blot shows that rno-miR-138 expression was restricted to brain. [score:3]
We found that rat miR-138 also was expressed only in brain (Additional data file 4). [score:3]
A file (Additional data file 4) showing rno-miR-138 brain specific expression. [score:3]
In only a few cases did there seem to be discrepancies; for example, relative levels of expression of miR-138 at P4 compared to adult differed between the northern blots and the microarrays. [score:2]
The probes used were: EAM119 (miR-29b), EAM125 (miR-138), EAM224 (miR-17-5p), EAM234 (miR-199a), EAM131 (miR-92), EAM109 (miR-7), EAM150 (miR-9) and EAM103 (miR-124a). [score:1]
[1 to 20 of 5 sentences]
19
[+] score: 12
In neurons, miR-132 and miR-138 are expressed in response to synaptic activity and have a role in the modulation of morphologic events of neuroplasticity taking place in memory and cognition processes (Wayman et al., 2008; Siegel et al., 2009; Edbauer et al., 2010; Impey et al., 2010; Hansen et al., 2012; Bicker et al., 2014). [score:3]
This study Previous studies miRNA Sample Lower/Higher Sample Lower/Higher Target miR-132 Plasma of 3xTg-AD and WT mice of 2–3 and 14–15 months − AD brain −Cogswell et al., 2008 p250-GAP AD neocortex −Hébert et al., 2013 AD CSF −Burgos et al., 2014 miR-138 − AD CSF −Burgos et al., 2014 APT1 miR-139 − AD CSF −Burgos et al., 2014 miR-146a − AD CSF/plasma −Kiko et al., 2014 IRAK-1 TRAF6 AD CFS −Müller et al., 2014 AD hippocampus ± miR-146b − AD CSF −Cogswell et al., 2008 AD brain − miR-29a − AD cortex −Hébert et al., 2008 BACE1 AD serum −Geekiyanage et al., 2011 AD CSF +Kiko et al., 2014 miR-29c − AD cortex −Hébert et al., 2008 The table contains data obtained from this study (left) and collected from others (right). [score:3]
A functional screen implicates microRNA-138 -dependent regulation of the depalmitoylation enzyme APT1 in dendritic spine morphogenesis. [score:2]
old 3xTg-AD mice, we identified a particular group of miRNAs integrated by miR-132, miR-138, miR-146a, miR-146b, miR-22, miR-24, miR-29a, miR-29c, and miR-34a which show significant differences in plasma levels only in the transgenic group, raising the possibility of age-related changes that specifically occur in the 3xTg-AD mice (Figure 3, Supplementary Table 3). [score:1]
Since memory and cognition are highly impaired in AD, the lower abundance of miR-132 and miR-138 result very interesting for analyzing the evolution of AD at a molecular level. [score:1]
age-matched WT mice, we detected a significant lower abundance of miR-132, miR-138, miR-139, miR-146a, miR-146b, miR-22, miR-24, miR-29a, and miR-29c as well as a higher abundance of miR-346 (Figure 4, Supplementary Table 4). [score:1]
In agreement with our results, lower levels of miR-132, miR-138 y miR-139 have been reported in AD brain and CFS samples (Cogswell et al., 2008; Burgos et al., 2014). [score:1]
[1 to 20 of 7 sentences]
20
[+] score: 12
All miRNAs analyzed were significantly downregulated in Dicer [fl/fl] Dhh-Cre [+] nerves at p4: p≤0.0001 (miR-34a, miR-146b, miR-338-3p, miR-204, miR-27b, miR-140, miR-138, miR-30a), p = 0.0002 (miR-195). [score:4]
Some of the upregulated miRNAs are important for oligodendrocyte differentiation, e. g. miR-338 [11], [12] and miR-138 [11]. [score:4]
Furthermore, miRNAs were confirmed to be upregulated upon myelination: p≤0.0001 (miR-34a, miR-146b), p = 0.04 (miR-338-3p), p = 0.003 (miR-204), p = 0.0007 (miR-27b), p = 0.005 (miR-140), p = 0.0002 (miR-138), p = 0.01 (miR-195), p = 0.0004 (miR-30a). [score:4]
[1 to 20 of 3 sentences]
21
[+] score: 12
The top miRNAs (those with the highest number of targets in each time point) were miR-149-5p, miR-138-5p and miR-16-5p for 15, 30 and 45 dpi, with 14, 22 and 21 targets, respectively (targets described in Supplemental Tables  8– 10). [score:7]
Five out of the 35 DEMs in the network have targets involved in all four of the pathophysiological processes (miR-238-3p, miR-149-5p, miR-143-3p, miR-145-5p and miR-486-5p); an additional six DEMs target genes involved in three of the four processes (miR-138-5p, miR-9-5p, miR-26a-5pmiR-185-5p, miR-200b-3p and miR-335-5p). [score:5]
[1 to 20 of 2 sentences]
22
[+] score: 11
As a control, we also tested the enrichment of FOSL1 mRNA, a known miR-138 targeting gene without a miR-100 targeting site, in the RIP-IP assay. [score:4]
and miR-100 mimic, miR-138 mimic or non -targeting microRNA mimic (Dharmacon). [score:3]
As a control, we also tested the miR-138 -mediated enrichment of FOSL1, a known miR-138 targeting gene [Jin et al.,: Molecular characterization of the microRNA-138-Fos-like antigen 1 (FOSL1) regulatory module in squamous cell carcinoma. [score:2]
As shown in Figure S5C, a statistically significant enrichment of FOSL1 was observed in cells treated with miR-138, and no difference was detected in cells treated with miR-100. [score:1]
An apparent enrichment of FOSL1 was observed in cells treated with miR-138, and no difference was observed in cells treated with miR-100. [score:1]
[1 to 20 of 5 sentences]
23
[+] score: 10
Other miRNAs from this paper: mmu-mir-138-1, mmu-mir-706, mmu-mir-709
We obtained locked nucleic acid (LNA) -modified oligos corresponding to miR-706 and miR-138 (a control miRNA known to be expressed in the bulb; [32]). [score:3]
F) Expression pattern using an LNA oligo for miR-138. [score:3]
The miRNA in situ patterns that have been published in the mouse generally show uniform expression within a given layer or structure (e. g. miR-138), and/or are detected in specific cell-types. [score:3]
These results contrast with those for the miR-138 probe, which bound weakly and uniformly to the nerve layer and EPL (Fig. 3F). [score:1]
[1 to 20 of 4 sentences]
24
[+] score: 10
Other miRNAs from this paper: hsa-mir-138-2, hsa-mir-138-1, mmu-mir-138-1
To that extent, the presence in the vDCP-NBs of SUMO proteins, which were shown in cultured cells to participate in intrinsic antiviral resistance to HSV-1 infection [23], strengthens the idea that PML-NBs in general and vDCP-NBs in particular are nuclear relays of the cellular intrinsic antiviral response to HSV-1. Studies performed in vivo and in vitro showed that VP16 expression likely plays a major role in the onset of the lytic program in neurons [60], and a neuron-specific microRNA, miR-138, targets ICP0 mRNA to prevent its synthesis [53]. [score:5]
Finally, a recent study demonstrated that a neuron-specific microRNA, miR-138, targets ICP0 mRNA, preventing ICP0 synthesis at least in cultured cells [53]. [score:3]
The absence of VP16 axonal transport, the stochastic regulation of its promoter, and the absence of ICP0 synthesis due to miR-138 activity are likely to lead to a nuclear environment that would favor the establishment of latency through the formation of vDCP-NBs and/or ML patterns, depending on the type I IFN signaling context of the infected neuron. [score:2]
[1 to 20 of 3 sentences]
25
[+] score: 9
Other miRNAs from this paper: mmu-mir-138-1
Vimentin expression is regulated by many factors, such as microRNA-138, which inhibits migration and invasion by directly targeting vimentin in renal cell carcinoma. [score:9]
[1 to 20 of 1 sentences]
26
[+] score: 8
Modulation of pulmonary miRNAs targeting p53 (miR-138 and miR-376c) and apoptosis (miR-98 and miR-350) is consistent with the notion that AMPK is involved in the p53 -mediated cell cycle arrest and apoptosis 2. Several miRNAs upregulated in the lung of metformin -treated mice, including miR-30b, miR-138, miR-239a, miR-342, and miR-574, are involved in stress response and inflammation and target NF κB or Tlr9 (Toll-like receptor). [score:8]
[1 to 20 of 1 sentences]
27
[+] score: 8
Other miRNAs from this paper: mmu-mir-338, mmu-mir-212, mmu-mir-138-1
Both miR-212-3p and miR-138-5p were significantly down-regulated in response to METH and were previously demonstrated as important regulators of cocaine addiction and neuronal plasticity 7 38. [score:5]
Examples of negatively correlated interactions include miR-212-3p, miR-338-3p and miR-138-5p and their potential targets involved in neural functions, Arc, Fos and Ntrk1 respectively. [score:3]
[1 to 20 of 2 sentences]
28
[+] score: 8
Other miRNAs from this paper: mmu-mir-122, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-138-1, mmu-mir-709
miR-709 increases, repressing target gene expression, and miR-138 decreases, de-repressing expression 20. [score:7]
In peripheral nerve system (PNS) injury, miR-709 and miR-138 have opposing roles. [score:1]
[1 to 20 of 2 sentences]
29
[+] score: 8
The expression of miR-138 was increased, whereas its target Trp53 was down-regulated [29] (Figure 2E). [score:8]
[1 to 20 of 1 sentences]
30
[+] score: 8
Preferential expression in the retina was also observed for miR-376a, miR-138, miR-338, and miR-136 as compared with the mouse platform; it is notable, however, that these miRs are expressed at higher levels in brain than in retina. [score:4]
Expressions of miR-1, miR-9*, miR-26b, miR-96, miR-129-3p, miR-133, miR-138, miR-181a, miR-182, miR-335 and let7-d were explored by in situ hybridization (ISH) using locked nucleic acid (LNA) probes (Exiqon). [score:3]
Indeed miR-136, miR-138, and miR-338 were previously cloned from the hippocampus and cerebral cortex [19]. [score:1]
[1 to 20 of 3 sentences]
31
[+] score: 7
Increasing studies indicate that miRs (miR-7 and miR-138) could suppress the epithelial-to-mesenchymal transition and metastasis of cancer stem cells by targeting focal adhesion kinase (FAK) expression [16, 17]. [score:7]
[1 to 20 of 1 sentences]
32
[+] score: 7
The results given in Table S1 show that expressions of miR-100, miR-125b, miR-135a, miR-138, miR-150, miR-146a, miR-221 which were decreased in HD cell mo del [33] were also decreased in and the expressions of miR-127-3p and miR-214 were increased in both STHdh [Q111]/Hdh [Q111] cells [33] and the R6/2 mouse mo del. [score:5]
Earlier observations by others showed miR-138, miR-218 and miR-222 to be down regulated in HD mouse mo dels [30], [48] which had also been confirmed by us in HD cell mo del [33]. [score:2]
[1 to 20 of 2 sentences]
33
[+] score: 7
Transfection of human CD4 [+] T cells with miR-138 suppressed expression of CTLA-4, PD-1, and Foxp3 in glioma preclinical mo dels [58]. [score:5]
miR-138 has been reported with a multifaceted role in carcinomas, although its ability to interact with the immune system is unknown. [score:1]
Wei et al. have demonstrated that the combination of miR-138 with a MAb therapy against CTLA-4 provided a strong therapeutic synergism. [score:1]
[1 to 20 of 3 sentences]
34
[+] score: 7
In addition, treatment of inflammatory cytokines to periodontal ligament cells results in expressional changes of various miRNAs, such as miR-138, miR182 18, 19, suggesting that miRNAs which regulate periodontal tissue development and repair may be affected by inflammatory environmental cytokines and could result in impaired periodontal tissue regeneration. [score:5]
Zhou X MicroRNA-138 inhibits periodontal progenitor differentiation under inflammatory conditionsJ. [score:2]
[1 to 20 of 2 sentences]
35
[+] score: 7
However, previous studies on hMSCs-Ad undergoing adipogenesis reported that miR-21 13, miR-22 14, miR-196 15, miR-27b 20, and miR-138 31 were either upregulated or downregulated, and miR-148a was not reported in hMSCs-Ad. [score:7]
[1 to 20 of 1 sentences]
36
[+] score: 7
A total of 11 miRNAs, let-7, miR-9, miR-206, miR-138, miR-133, miR-152, miR-137, miR-128, miR-143, miR-27b and miR-218 were co-expressed by 18 synaptic transmission target genes (Table S6). [score:5]
Again, the GO processes were composed of two sub-trees (Figure 3B), as in development, for shared miRNAs, such as miR-9, miR-206, miR-138, miR-133, miR-152, and miR-128. [score:2]
[1 to 20 of 2 sentences]
37
[+] score: 6
Profiling of miRNAs expression was also performed in the YAC128 and R6/2 mice, showing that nine miRNAs (miR-22, miR-29c, miR-128, miR-132, miR-138, miR-218, miR-222, miR-344, and miR-674*) are commonly down-regulated in 12-month-old YAC128 mice and 10-week-old R6/2 mice (100). [score:6]
[1 to 20 of 1 sentences]
38
[+] score: 6
Xu J Li L Yun HF Han YS MiR-138 promotes smooth muscle cells proliferation and migration in db/db mice through down-regulation of SIRT1Biochem. [score:3]
Of these, rs1052299 was predicted to create novel -binding sites for two highly conserved miRNAs affecting bone and muscle 36– 38 -miR-133a-5p and miR-138-5p—and is more likely to affect miRNA -mediated regulation of TOM1L2. [score:2]
Eskildsen T MicroRNA-138 regulates osteogenic differentiation of human stromal (mesenchymal) stem cells in vivoProc. [score:1]
[1 to 20 of 3 sentences]
39
[+] score: 6
At E16.5, 6 days after the onset of endogenous DBH expression in differentiating sympathetic neurons, microRNAs miR-124 and miR-138 can be detected by locked nucleic acid (LNA)-ISH in sympathetic ganglia of control but not of mutant embryos (Figure  4). [score:3]
Figure 4 Conditional Dicer inactivation suppresses miR-124 and miR-138 signal in sympathetic neurons. [score:3]
[1 to 20 of 2 sentences]
40
[+] score: 6
For HSV-1, recent data has shown that a neuronal-enriched miRNA (miR-138) targets ICP0, which encodes a viral protein that functions to reactivate the virus from latency [28]. [score:3]
As a result, expression of miR-138 promotes viral latency within neurons [29]. [score:3]
[1 to 20 of 2 sentences]
41
[+] score: 6
The analysis for the KC animals compared to controls revealed that miR-150, miR-494, miR-138, miR-148a*, miR-216a, and miR-217 (p-value = 0.01) were significantly downregulated (Table 1), whereas, miR-146b, miR-205, miR-31, miR-192, and miR-21 (p-value = 0.01) were significantly upregulated (Table 2). [score:6]
[1 to 20 of 1 sentences]
42
[+] score: 6
Other miRNAs from this paper: hsa-mir-138-2, hsa-mir-138-1, mmu-mir-138-1
While miR-138 appeared to be downregulated by Klf5 deletion in mouse prostate tumors, it was unaltered by KLF5 loss in human prostate cancer cells (data not shown). [score:4]
HIF1α can also be regulated by miRNAs including miR-138 [48]. [score:2]
[1 to 20 of 2 sentences]
43
[+] score: 6
Following subacute CS exposure, only miR-138 overlaps as being differentially expressed in both lung and BAL supernatant (Fig.   3a). [score:3]
By focusing on the overlap between subacute and chronic CS exposure within the same compartment, or the overlap between miRNAs with altered expression levels in BAL and lung, we narrowed the pool of interesting miRNAs down to 18: let-7b, let-7c, miR-135b, miR-138, miR-146a, miR-148a, miR-152, miR-155, miR-21, miR-26a, miR-30a-5p, miR-30c, miR-31, miR-31*, miR-322*, miR-342-3p, miR-376b* and miR-449. [score:3]
[1 to 20 of 2 sentences]
44
[+] score: 6
[20] Our previous study has identified microRNA-138 and its target SIRT1 as important regulators of gene expression during mammalian axon regeneration. [score:6]
[1 to 20 of 1 sentences]
45
[+] score: 5
All miRNA mimics (miR-138, miR-18, miR-192, miR-215, miR-19, miR-204 and miR-211), miRNA inhibitors(miR-192 and miR-204) and small interfering RNA (siRNA) duplexes (siHOTTIP-1 and siHOTTIP-2) were products of Genepharma (Shanghai, China). [score:3]
20 nmol/L mimics of miR-138, miR-18, miR-192, miR-215, miR-19, miR-204, and miR-211, two HOTTIP siRNAs (siHOTTIP-1 and siHOTTIP-2)or NC RNA were transfected into SMMC7721,HepG2 and Hep3B HCC cells. [score:1]
* MicroRNAs Seed position Conservation Primates Mammals Other Vertebrates miR-138 chr7:27245289 89% 30% 0% miR-18 chr7:27238346 89% 30% 0% miR-192/215 chr7:27241747 89% 91% 77% miR-19 chr7:27245115 100% 0% 0% miR-204/211 chr7:27245995 89% 43% 0%*Data from miRcode (http://www. [score:1]
[1 to 20 of 3 sentences]
46
[+] score: 5
There were also two interesting differentially expressed microRNAs: miR290 and miR138-2 (Table 1). [score:3]
miR290 is associated with gene regulation in the early embryo and the maintenance of the pluripotent cell state [43], [44] and miR138, the mature form of miR138-2, is associated with the size of dendritic spines in rat hippocampal neurons [45]. [score:2]
[1 to 20 of 2 sentences]
47
[+] score: 5
Yamasaki et al. 42 showed that miR-138 targeted vimentin and inhibited cell migration and invasion in renal cell carcinoma. [score:5]
[1 to 20 of 1 sentences]
48
[+] score: 5
Other miRNAs from this paper: hsa-mir-138-2, hsa-mir-138-1, mmu-mir-138-1, hsa-mir-622
Li JB Overexpression of microRNA-138 alleviates human coronary artery endothelial cell injury and inflammatory response by inhibiting the PI3K/Akt/eNOS pathwayJ. [score:5]
[1 to 20 of 1 sentences]
49
[+] score: 4
Non-coding RNAs, such as miR-138-5p, have also been implicated in the regulation of telomerase, which was shown to regulate telomerase activity in thyroid carcinoma cells [11], similar effects can also be seen through miR-181a regulated tumor-specific anti-cancer effects in liver cancer[12]. [score:4]
[1 to 20 of 1 sentences]
50
[+] score: 4
In the order of the significance score by SAM, 15 up-regulated miRNAs are mmu-miR-127, mmu-miR-410, mmu-miR-433, mmu-miR-138, mmu-miR-181c, mmu-miR-382, mmu-miR-19b, mmu-miR-381, mmu-miR-666-3p, mmu-miR-376a, mmu-miR-873, mmu-miR-181a, mmu-miR-383, mmu-miR-181b, and mmu-miR-99b. [score:4]
[1 to 20 of 1 sentences]
51
[+] score: 4
Several miRNAs are upregulated and associated with tumorigenesis in ESCC, such as miR-21, miR-138, miR-223, miR-92a, miR-9, and mir-208. [score:4]
[1 to 20 of 1 sentences]
52
[+] score: 4
Mmu-miR-31, mmu-miR-351, mmu-miR-672, mmu-miR-339-3p, mmu-miR-138, mmu-miR-210, mmu-miR-25, and mmu-miR-322 were found to be more prominent and may play crucial roles in the regulatory network for their degree were more than 5. 10.1371/journal. [score:2]
Mmu-miR-31, mmu-miR-351, mmu-miR-672, mmu-miR-339-3p, mmu-miR-138, mmu-miR-210, mmu-miR-25, and mmu-miR-322 were found to be more prominent and may play crucial roles in the regulatory network for their degree were more than 5. 10.1371/journal. [score:2]
[1 to 20 of 2 sentences]
53
[+] score: 4
Sossey-Alaoui K Plow E F. miR-138-Mediated Regulation of KINDLIN-2 Expression Modulates Sensitivity to ChemotherapeuticsMol Cancer Res. [score:4]
[1 to 20 of 1 sentences]
54
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Of these miRNAs, 12 were upregulated (miR-34b, miR-138, miR-297a, miR-301, miR-449, miR-466, miR-493, miR-579, miR-582, miR. [score:4]
[1 to 20 of 1 sentences]
55
[+] score: 4
Other miRNAs from this paper: hsa-mir-138-2, hsa-mir-138-1, mmu-mir-138-1
Our previous study demonstrates that miR-138 effectively inhibits GBM cell proliferation in vitro and tumorigenicity in vivo through directly blocking an EZH2 -mediated signal loop [8]. [score:4]
[1 to 20 of 1 sentences]
56
[+] score: 4
miR-138 is enriched at synapses and modulate synaptic development and spine size through the control of acyl-protein thioesterase-1 (APT1) [27] and the depalmitoylation of G protein alpha 13 (GALPHA13), a down-stream target of APT1, which is an activator of Rho down-stream of G-protein coupled receptor (GPCR) [28]. [score:4]
[1 to 20 of 1 sentences]
57
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-mir-34c, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, mmu-mir-346, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, hsa-mir-381, mmu-mir-375, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-346, hsa-mir-196b, mmu-mir-196b, hsa-mir-18b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, mmu-mir-92b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Our results are also mostly in agreement with those of Esau et al. [25] who identified a similar expression pattern regarding miR-130b, miR-30c, miR-30a*, miR-191, miR-30d, miR-196, miR-30b, miR-19b, miR-92, miR-138 and miR-100 during differentiation of cultured human adipocytes. [score:3]
[1 to 20 of 1 sentences]
58
[+] score: 3
A functional screen implicates microRNA-138 -dependent regulation of the depalmitoylation enzyme APT1 in dendritic spine morphogenesis. [score:2]
MicroRNA-138 and SIRT1 form a mutual negative feedback loop to regulate mammalian axon regeneration. [score:1]
[1 to 20 of 2 sentences]
59
[+] score: 3
In this analysis, only four miRNAs were differentially expressed in both human prostate cancer cell lines and tumor samples from TRAMP mice, including miR-34b-3p, miR-34c-5p, miR-138, and miR-224 (Fig 2C and 2D). [score:3]
[1 to 20 of 1 sentences]
60
[+] score: 3
miR-138 +miR-138 suppresses invasion and promotes apoptosis in head and neck squamous cell carcinoma cell lines [34]. [score:3]
[1 to 20 of 1 sentences]
61
[+] score: 3
Specific miRNAs that enhance adipocyte differentiation (miR-30c, miR-143, miR-146b, and miR-378; [21– 24]) or inhibit adipocyte differentiation (miR-27, miR-130, and miR-138; [25– 27]) have been identified. [score:3]
[1 to 20 of 1 sentences]
62
[+] score: 3
H19 triggers EMT progression by binding miR-138-5p and miR-200a-3p, antagonizing their functions and leading to the increase of their endogenous targets [25]. [score:3]
[1 to 20 of 1 sentences]
63
[+] score: 3
Similarly, we found an increased expression of let-7i-5p, miR-29a-3p, miR-29c-3p, miR-30a-5p, miR-98-5p, miR-138-5p, miR-139-5p, miR-140-5p, miR-146b-5p, miR-148b-3p, miR-181a-1-3p, miR-181a-5p, miR-194-5p, and miR-342-3p, all of which have been reported to be altered in different AD tissues (Cogswell et al., 2008; Hebert et al., 2008; Maes et al., 2009; Wang et al., 2011, 2012; Lau et al., 2013). [score:3]
[1 to 20 of 1 sentences]
64
[+] score: 3
These numbers exceeded that of the other proposed miRNA sponge, mouse Sry, which has 16 miR-138 sites [9]. [score:1]
The other circRNA proposed to act as a miRNA sponge, mouse Sry [9], has only one miR-138 site in its human homolog, which indicates that the proposed sponge function is not conserved in mammals. [score:1]
A second circRNA proposed to act as a sponge is the testis-specific transcript of the male sex-determining gene Sry, which contains 16 sites for miR-138 [9]. [score:1]
[1 to 20 of 3 sentences]
65
[+] score: 3
As shown in Figure 3B, except for miR-138-5p, expression levels of 8 out of 9 miRNAs showed consistent alteration in qRT-PCR experiment compared with the Illumina deep sequencing data. [score:2]
Among them, nine miRNAs (miR-99b-5p, miR-7b-5p, miR-7a-5p, miR-501-3p, miR-434-3p, miR-409-5p, miR-331-3p, miR-138-5p and miR-100-5p) showed consistent changes in both groups. [score:1]
[1 to 20 of 2 sentences]
66
[+] score: 3
miR-138, which has been reported to regulate cardiac patterning [28], was only observed to be up regulated in the Affymetrix data but not in the Febit data. [score:3]
[1 to 20 of 1 sentences]
67
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-18a, hsa-mir-21, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-30a, mmu-mir-99a, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, hsa-mir-192, mmu-mir-204, mmu-mir-122, hsa-mir-204, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-138-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-103-1, mmu-mir-103-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-26a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-26a-2, hsa-mir-376c, hsa-mir-381, mmu-mir-381, mmu-mir-133a-2, rno-let-7a-1, rno-let-7a-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-18a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-26a, rno-mir-30a, rno-mir-99a, rno-mir-103-2, rno-mir-103-1, rno-mir-122, rno-mir-126a, rno-mir-133a, rno-mir-138-2, rno-mir-138-1, rno-mir-192, rno-mir-204, mmu-mir-411, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-193b, rno-mir-1, mmu-mir-376c, rno-mir-376c, rno-mir-381, hsa-mir-574, hsa-mir-652, hsa-mir-411, bta-mir-26a-2, bta-mir-103-1, bta-mir-16b, bta-mir-18a, bta-mir-21, bta-mir-99a, bta-mir-126, mmu-mir-652, bta-mir-138-2, bta-mir-192, bta-mir-23a, bta-mir-30a, bta-let-7a-1, bta-mir-122, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-204, mmu-mir-193b, mmu-mir-574, rno-mir-411, rno-mir-652, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-1-2, bta-mir-1-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-138-1, bta-mir-193b, bta-mir-26a-1, bta-mir-381, bta-mir-411a, bta-mir-451, bta-mir-9-1, bta-mir-9-2, bta-mir-376c, bta-mir-1388, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-451b, bta-mir-574, bta-mir-652, mmu-mir-21b, mmu-mir-21c, mmu-mir-451b, bta-mir-411b, bta-mir-411c, mmu-mir-126b, rno-mir-193b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
However, only two precursors of miR-138 were found in human, rat and mouse. [score:1]
The BLAST search of the miRNAs on the bovine genome identified a third precursor, which was a perfect match with bta-mir-138-2 in contig Un. [score:1]
Conserved number copy of miRNA genes between species suggests that bta-mir-138-3 is the same as bta-mir-138-2 and contig Un. [score:1]
[1 to 20 of 3 sentences]
68
[+] score: 3
Interestingly, with the exception of miR-138, all these miRNAs were differentially expressed at stages that are concomitant (secondary spermatocytes) or subsequent (round spermatids) to the association of SAM68 with the CB (Figure 7D). [score:3]
[1 to 20 of 1 sentences]
69
[+] score: 3
In prostate cancer, siRNAs of GNAI2 slowed OXT -induced migration of PC3 cells [20]; and in tongue squamous cell carcinoma, miR-138 reduced cellular proliferation, arrested cell cycle, and increased apoptosis, at least in part, by targeting GNAI2 [21]. [score:3]
[1 to 20 of 1 sentences]
70
[+] score: 3
XPC is a putative miR-138-5p target predicted by DIANA (Fig. 4A). [score:3]
[1 to 20 of 1 sentences]
71
[+] score: 3
In human and animal subjects, hypoxia induces the expression of a number of miRNAs [38] (miR-17, miR-21, miR-138, miR-143/145, miR-204, miR-206, miR-210, and miR-424) that contribute to PH pathogenesis [22], [24]– [26], [29], [44]– [47]. [score:3]
[1 to 20 of 1 sentences]
72
[+] score: 3
Among miRNAs preferentially expressed in the heart (Figure 4) mir-148a, mir-101, and mir-138 are particularly important. [score:3]
[1 to 20 of 1 sentences]
73
[+] score: 3
Only one miRNA, gga-miR-138, was predicted to target SREBP-2. However, we were unable to amplify specific gga-miR-138 from the chicken hepatic samples; therefore we excluded gga-miR-138 from the present study. [score:3]
[1 to 20 of 1 sentences]
74
[+] score: 2
Siegel G. Obernosterer G. Fiore R. Oehmen M. Bicker S. Christensen M. Khudayberdiev S. Leuschner P. F. Busch C. J. L. Kane C. A functional screen implicates microRNA-138 -dependent regulation of the depalmitoylation enzyme APT1 in dendritic spine morphogenesis Nat. [score:2]
[1 to 20 of 1 sentences]
75
[+] score: 2
Hansen TB et al. showed that the circRNA Sry functions as a miR-138 sponge [17]. [score:1]
Another circRNA called Sry was reported to serve as a sponge for miR-138 [17]. [score:1]
[1 to 20 of 2 sentences]
76
[+] score: 2
These included miR-150, miR-351, miR-16, let-7, miR-34, and miR138. [score:1]
The microRNAs that were validated included: hsa-miR-16; mmu-let-7f; mmu-miR-351; has-miR-150; has-miR-425; hsa-miR-196a; hsa-miR-138; and mmu-miR-155 (Applied Biosystems, Foster City, CA). [score:1]
[1 to 20 of 2 sentences]
77
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
A functional screen implicates microRNA-138 -dependent regulation of the depalmitoylation enzyme APT1 in dendritic spine morphogenesis. [score:2]
[1 to 20 of 1 sentences]
78
[+] score: 2
MiR-9-5p, miR-675-5p and miR-138-5p Damages the Strontium and LRP5-Mediated Skeletal Cell Proliferation, Differentiation, and Adhesion. [score:1]
For instance, our recent study showed that miR-9-5p, miR-675-5p and miR-138-5p damaged skeletal cell proliferation and differentiation [2]. [score:1]
[1 to 20 of 2 sentences]
79
[+] score: 2
Modulation of Pri-miR processing is especially relevant to the proper regulation of neuro-specific and neuro-enriched miRNAs, including let-7 family members, miR-128 and miR-138, whose post-transcriptional maturation may dramatically increase with the transition from stem cells to post-mitotic differentiated elements [53- 55]. [score:2]
[1 to 20 of 1 sentences]
80
[+] score: 2
Previous studies have shown that miR-138, miR-34 and miR-200c regulate the tumorigenesis and metastasis of lung cancers [19– 21]. [score:2]
[1 to 20 of 1 sentences]
81
[+] score: 1
Other miRNAs from this paper: mmu-mir-15a, mmu-mir-138-1
Sixty lncRNAs (e. g., Meg3, Atp10b, Rian, Malat1), 29 circRNAs (e. g., Circular_Igf1r, Circular_Gas2, Circular_Cdy, Circular_Ccnb3), and 16 miRNAs (e. g., mmu-miR-424, mmu-miR-15a-5p, mmu-miR-138-5p, mmu-miR-15a-3p) have been included in the ceRNA network. [score:1]
[1 to 20 of 1 sentences]
82
[+] score: 1
The mouse testis-specific circle of the Sry gene may likewise function to bind miR-138 [12], [34]. [score:1]
[1 to 20 of 1 sentences]
83
[+] score: 1
Other miRNAs from this paper: mmu-mir-138-1
Han, L. P., Fu, T., Lin, Y., Miao, J. L. & Jiang, Q. F. MicroRNA-138 negatively regulates non-small cell lung cancer cells through the interaction with cyclin D3. [score:1]
[1 to 20 of 1 sentences]
84
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, hsa-mir-676, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
39E-0218mmu-miR-138-5pmir-1380.2612.849.05E-053.20E-0340mmu-miR-140-3pmir-1400.197.891.23E-031.94E-0246mmu-miR-144-3pmir-1440.256.882.38E-033.30E-0268mmu-miR-145-5pmir-1450.177.038.25E-037.73E-0248mmu-miR-146b-5pmir-1460.167.502.60E-033.38E-0225mmu-miR-152-3pmir-1480.196.472.22E-045.65E-0331mmu-miR-149-5pmir-1490.227.694.26E-048.75E-0314mmu-miR-16-5pmir-150.2910.942.74E-051. [score:1]
[1 to 20 of 1 sentences]
85
[+] score: 1
The miRNAs chosen include highly conserved and ubiquitous miRNAs (let-7, miR-125) as well as representative tissue-specific miRNAs from stem cells (miR-302), muscle (miR-1), blood (miR-150), and nervous system (miR-9, miR-124, miR-128, miR-132, and miR-138). [score:1]
[1 to 20 of 1 sentences]
86
[+] score: 1
Reduced miR-155, miR-134, miR-373, miR-138, miR-205, miR-181d, miR-181c, and let-7 in CAsE-PE cells correlate with increased KRAS protein [47]. [score:1]
[1 to 20 of 1 sentences]
87
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
In addition, it is possible that this phenomenon is not particular of the CNS as a testis-specific circRNA serves as a miR-138 sponge (Hansen et al., 2013). [score:1]
[1 to 20 of 1 sentences]
88
[+] score: 1
47), miR-138 (refs 47, 48), miR-15b (ref. [score:1]
[1 to 20 of 1 sentences]
89
[+] score: 1
Five miR*s: miR-21*, miR-24-2*, miR-138*, miR-297a*, miR-467b* and miR-467e*, were decreased at least 1.5-fold, while miR-24-2* was increased at least 1.5-fold in old versus YA hearts (Figure 11). [score:1]
[1 to 20 of 1 sentences]
90
[+] score: 1
Brain enriched miRNAs such as mir-125b, let-7a,c, mir-138 and mir-181a were also strongly induced after 16 days of differentiation ([47] and Fig. S1F). [score:1]
[1 to 20 of 1 sentences]
91
[+] score: 1
Gene Ontology analysis indicated neuronal regulatory functions for less-characterized brain miRNAs, including miR-26 (for example, axon development and locomotion), miR-138 (neurotransmitter transport and secretion, and calcium transport) and miR-9* (cell migration and motility; ). [score:1]
[1 to 20 of 1 sentences]
92
[+] score: 1
In all, we found moderate (three-fold) region-specific enrichment of 48 miRNAs (e. g. miR-138, miR-195 and miR-218, Figure S2). [score:1]
[1 to 20 of 1 sentences]