sort by

69 publications mentioning mmu-mir-144

Open access articles that are associated with the species Mus musculus and mention the gene name mir-144. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 328
Data did not support Trim30 being a direct target of miR-144 since expression of the 3’-UTR of Trim30, which contains the predicted miR-144-target sequence, in a luciferase construct was not modulated by miR-144 expression (Fig 4C). [score:10]
S5 Fig(A) Microarray transcriptional analysis of LET1 cells stably expressing miR-144, miR-451, or vector alone were infected with influenza virus for 1 h. The heatmap depicts fold-change relative to a vector control for the set of genes whose expression in TC-1 cells following influenza virus infection was affected more than 2-fold (p<0.05) by miR-144/451 over -expression (Fig 3A) with red and green representing up- and down-regulation respectively. [score:10]
We excluded this as a mechanism underlying the observed miR-144 phenotype since ectopic expression miR-144 did not alter Tpl2/Map3K8 expression and chemical inhibition of the kinase did not recapitulate the effect of miR-144 overexpression on viral load (S6A and S6B Fig and GSE50742). [score:9]
Mutation of 7 nucleotides in the predicted miR-144 target sequence in site 2 completely abrogated the suppressive effect of miR-144 on expression of the reporter construct, while mutating the same nucleotides in site 1 had no effect (Fig 4E). [score:8]
These data support the network mo del depicted in Fig 5F, where miR-144 suppresses expression of the TRAF6-IRF7-IFN-regulated gene expression network to diminish the antiviral capacity of influenza virus-infected cells. [score:8]
Ectopic expression of miR-144 did not alter expression of a full-length Irf7-luciferase construct; thus decreased Irf7 mRNA levels in miR-144 -expressing cells do not result from a direct interaction between Irf7 and miR-144 (Fig 4C). [score:8]
The suppressive effect of miR-144 on the expression of this group of antiviral genes was confirmed in LET1 lung epithelial cells ectopically expressing miR-144 (S5A and S5B Fig) and we measured increased expression of this gene module in miR-144 [null] primary type I epithelial cells (Fig 3C). [score:7]
We observe concordant decreased expression of a module of antiviral genes in cells over -expressing miR-144, TRAF6 shRNAs, and IRF7 -deficient cells (Fig 5E, blue), and reciprocal expression in miR-144 -deficient cells (Fig 5E red). [score:7]
One caveat of our study is that it utilized transcriptional profiling of miR-144 overexpressing cells to identify potential miR-144 target genes, which will not identify miRNA-mRNA interactions that impact protein translation. [score:7]
Expression of miR-144 significantly decreased the expression of 48 genes and increased the expression of 9 genes by >2 fold in TC-1 cells (Fig 3A) and similarly impacted the transcriptional profile of LET1 cells (S5 Fig). [score:7]
A dominant feature of the array data was the suppressed expression of genes associated with antiviral and immune interferon responses in cells over -expressing miR-144 (enriched gene ontology (GO) functional categories: defense response to virus and immune response (p<0.05)). [score:7]
We hypothesized a central role for IRF7 in the regulation of the miR-144-regulated transcriptional network because it was the only transcription factor that was differentially expressed and computational predictions identified IRF7 binding motifs within the cis-regulatory elements of the majority of miR-144-regulated genes (Fig 3A). [score:7]
TRAF6 has also been shown to be regulated by miR-146a [43, 44]; however, miR-144 expression did not alter miR-146a expression in cells (S6C Fig), and therefore we have no data to suggest that miR-144 regulates TRAF6 via miR-146a. [score:7]
Therefore, while decreasing TRAF6 levels by a similar extent through expression of miR-144 or TRAF6 shRNAs was sufficient to impair the antiviral capacity of epithelial cells, it is probable that miR-144 also regulates other target genes to mediate this cellular phenotype. [score:6]
As TRAF6 -dependent K63-ubiquitination of IRF7 is necessary for its transcriptional activity [40], our data support a mo del whereby miR-144 modulates the expression of a network of IRF7-regulated genes by targeting the 3’-UTR of Traf6 mRNA. [score:6]
To establish a potential mechanism for miR-144 inhibiting Irf7 expression, we used Cytoscape to examine the InnateDB protein-protein interaction database [30] for proteins known to interact directly with IRF7 or with its nearest network neighbors. [score:6]
microRNA-144 suppresses TRAF6 levels and impairs the gene expression program regulated by the transcription factor IRF7. [score:6]
For example, expression of Ifi203, Rsad2, Trim30, Oas2, and Mpa2l is impaired when TRAF6 levels are suppressed by specific shRNA (Fig 5B) or miR-144 (Figs 3B and S5B). [score:5]
Total RNA was isolated using Trizol from TC-1 cells expressing either MSCV empty vector or MSCV-miR-144+451 and infected with PR8 influenza virus for 24 h. Labeled RNA was hybridized to Affymetrix GeneChip Mouse Exon ST 1.0 arrays, probe-set intensities RMA normalized, and differential expression analysis performed using the Bioconductor package limma. [score:5]
We hypothesized that cells expressing shRNAs specific for Traf6 should have a similarly impaired antiviral capacity as cells expressing miR-144 if reduced steady state TRAF6 levels are mechanistically linked to impaired IRF7 -dependent transcription. [score:5]
To identify which of the miR-144-regulated genes are controlled both directly and indirectly by IRF7, we compared gene expression in the lungs of influenza virus-infected IRF7 -null and wild type mice. [score:5]
miR-144 directly regulates TRAF6 expression. [score:5]
S6 Fig(A) Ectopic expression of miR-144 in TC-1 or LET1 cells did not alter Tpl2/Map3K8 expression. [score:5]
We employed primary lung epithelial cells and cell lines since they are a relevant replicative niche for influenza virus, and ectopically expressed miR-144 at physiological levels as a strategy to identify biologically relevant targets of miR-144. [score:5]
miRWalk, TargetScan, and RNA22 predicted the miR-144 target sequences in Traf6. [score:5]
miR-144 (mmu-miR-144-3p) expression was much higher in type I lung epithelial cells than in CD45 [+] hematopoietic cells, whereas miR-451 (mmu-miR-451a) was expressed in both hematopoietic and epithelial cells (Fig 1A). [score:5]
We tested whether Irf7 mRNA is a direct target of miR-144 in a luciferase assay, despite its lack of a computationally predicted miR-144 target sequence. [score:5]
Therefore, to develop a mo del that matches the expression of miR-144/miR-451 in vivo, we generated lines of TC-1 and LET1 [14] cells stably over -expressing miR-144, miR-451, miR-155 (as a negative control), or vector alone (S4 Fig). [score:5]
miRWalk was used to predict potential miR-144 targets using multiple algorithms (TargetScan, RNA22, PITA, PICTAR4, PICTAR5, RNAHybrid, miRWalk, miRDB, miRanda, and DIANAmT). [score:5]
Wild type and mutant miR-144 target sequences in the Traf6 3’-UTR were generated by annealing complementary 45-mer oligos containing the sequences shown in the figure flanked by restriction sites, and cloning directly into the luciferase vector. [score:4]
Expression of miR-144 and miR-451 in primary type I lung epithelial cells was compared to the expression level in primary polarized tracheal epithelial cells (mTEC), cultured primary lung alveolar epithelial type I cells (LET1), mouse TC-1 epithelial cell lines with or without stable transduction of microRNAs, and 293T cells. [score:4]
As expected, we observed that the absence of IRF7 significantly reduced the expression of type I and III interferons (Ifnα2, Ifnα4, Ifnα14, Ifnλ3, Ifnβ1), as well as miR-144-regulated genes in Fig 3 with predicted antiviral functions (Oas2, Ifi203, Mpa2l, Trim30, Rsad2) (Fig 4B). [score:4]
deficient in miR-144 showed improved control of influenza virus replication, leading us to speculate that constitutive expression of this negative regulatory mechanism must not be deleterious and could be advantageous in some contexts. [score:4]
miR-144 is not detected in plasmacytoid dendritic cells [48, 56] suggesting that our observations of the effect of miR-144 in lung epithelial cells do not extend to regulation of basal IRF7 -dependent antiviral gene expression in plasmacytoid dendritic cells. [score:4]
miR-144 negatively regulates IRF7 activity and TRAF6 expression. [score:4]
A similar increase in viral load was observed when LET1 cells expressing miR-144 were compared with cells expressing miR-451. [score:4]
These data suggest that IRF7 is necessary for normal expression of the network of genes that is regulated by miR-144. [score:4]
In contrast, miR-144 expression did not decrease levels of Irf3, Irf1, or Irak1, showing specificity in the transcriptional regulation of a unique subset of antiviral genes (Fig 3B and GSE50742 and GSE31957). [score:4]
Together, while miR-144 may interact with other target mRNAs to contribute to this antiviral phenotype, these luciferase data and quantification of TRAF6 mRNA and protein abundance indicate that miR-144 can negatively regulate TRAF6 levels. [score:4]
This indicates that miR-144 can post-transcriptionally regulate Traf6 expression. [score:4]
miR-144/451 -deficient mice exhibit mild anemia due to dysregulated erythroid development and a 2-fold splenic enlargement due to erythroid hyperplasia, but possess an otherwise normal hematopoietic compartment [12, 15, 16]) and normal lung architecture. [score:3]
miR-144 and miR-451 are expressed in lung epithelial cells. [score:3]
The expression of miR-144 and miR-451 in three tractable cell culture mo dels is significantly lower than in freshly isolated lung epithelial cells (S4 Fig). [score:3]
to identify miR-144 binding sites in the coding and non-coding sequences of the genes that belonged to this expanded network suggested only three candidates where we could hypothesize plausible mechanisms connecting them to our observed viral infection phenotype: Tpl2/Map3k8, Trim30, and Traf6, which each have at least one predicted canonical target sequences in their 3’-UTRs. [score:3]
We observed a significantly reduced level of Traf6 mRNA and protein in cells expressing miR-144 (Figs 4F and 4G, S5C and S5D) and higher TRAF6 mRNA in miR-144 -deficient cells (Fig 3C). [score:3]
1006305.g003 Fig 3(A) Heat map depicting microarray analysis of influenza-infected TC-1 cells stably expressing miR-144+miR-451 or vector alone, with genes grouped by functional annotation. [score:3]
Constructs expressing both murine mmu-miR-144-3p and mmu-miR-451a were cloned with 145 bp upstream of pre-miR-144 and 330 bp downstream from the end of pre-miR-451. [score:3]
No evidence for miR-144 affecting Tpl2/Map3K8 or miR-146a expression. [score:3]
1006305.g001 Fig 1(A) Expression of miR-144 and miR-451 in total lung cells and FACS-purified lung hematopoietic and epithelial cell populations were measured by qRT-PCR and plotted in arbitrary units relative to sno-202 expression. [score:3]
miR-144 expression significantly increased infectious virion production in cells infected with the negative-sense single-stranded RNA viruses influenza and vesicular stomatitis virus (VSV) and the positive-sense ssRNA encephalomyocarditis virus (EMCV), indicating that the effect of miR-144 is not restricted to influenza virus infection (Fig 2E). [score:3]
TRAF6 protein expression relative to actin was quantified by densitometry of Western blots: Uninfected: miR-451, 0.70; miR-144, 0.37; Infected: miR-451: 1.0; miR-144: 0.66. [score:3]
Ectopic expression of miR-144 significantly increased levels of viral genomes and protein (Fig 2B–2E). [score:3]
Traf6 is predicted to contain two miR-144 target sequences in its 3’-UTR. [score:3]
We generated luciferase constructs containing individual intact or mutated miR-144 target sites (Fig 4D). [score:3]
miR-451 is adjacent to miR-144 on mouse chromosome 11 and both miRNAs are co-expressed in erythroid cells as one transcript that is processed into two mature miRNAs. [score:3]
To test this hypothesis, we generated immortalized lung type I epithelial cells with TRAF6 protein levels reduced by miR-144 or specific shRNAs, along with control cells expressing miR-451 or a non-functional shRNA (Fig 5A). [score:3]
The role of TRAF6 as the proximal component in the TRAF6-IRF7-IFN antiviral network is further supported by the observation that decreased TRAF6 levels brought about by two independent approaches (overexpressed miR-144 or anti-TRAF6 shRNA) are associated with significantly increased viral replication (Fig 2 and Fig 5C and 5D, respectively). [score:3]
miR-144 negatively regulates an IRF7 -dependent transcriptional network. [score:2]
miR-144 regulates the IRF7 transcriptional network in LET1 cells. [score:2]
miR-144 was cloned with 145 bp upstream of pre-miR-144 and 198 bp downstream of the end of pre-miR-451; the activity of miR-451 included in this construct was ablated using site-directed mutagenesis of 7 bp of the mature miR-451. [score:2]
We measure expression levels of miR-144 that is four orders of magnitude higher in primary normal human bronchial epithelial cells, the host cell targeted by influenza A virus, compared with the 293T kidney cell line (S4 Fig). [score:2]
Negative regulation of TRAF6 levels by miR-144 provides an additional layer of post-transcriptional control of IRF7. [score:2]
To elucidate the mechanism whereby miR-144 increases influenza virus replication within lung epithelial cells, we compared the transcriptional profiles of influenza-infected wild-type and miR-144 over -expressing cells. [score:2]
Impact of miR-144 deficiency on histopathology and inflammatory cell infiltration during influenza virus infection. [score:1]
miR-144 impacts viral replication in vivo and in lung epithelial cells infected in vitro. [score:1]
The predominant effect of miR-144 deficiency was to decrease viral load rather than modulate inflammatory responses within the virus-infected lung, and better control of very early viral replication within epithelial cells significantly decreased morbidity. [score:1]
miR-144 also increased virion production following infection with VSV, a negative-sense single-stranded RNA viruses, and EMCV, a positive-sense ssRNA encephalomyocarditis virus, indicating that the effect of miR-144 is not restricted to influenza virus. [score:1]
miR-144 deficiency affects specific populations of cells infiltrating the lung following influenza virus infection. [score:1]
Reciprocal data obtained from gain- and loss-of-function studies shows that miR-144 modulates an antiviral transcriptional network within lung epithelial cells. [score:1]
Influenza virus -induced lesions are similar in character but are decreased in severity or extent in miR-144/451 [-/-] with both genotypes demonstrating acute and chronic changes. [score:1]
Control shRNA, 1; TRAF6 shRNA, 0.47±0.12; miR-144, 0.68±0.09; miR-451, 1.16±0.26. [score:1]
Generation of an in vitro mo del to study the mechanism of miR-144’s effect on host antiviral response. [score:1]
Control shRNA, 1; TRAF6 shRNA, 0.43±0.15; miR-144, 0.52±0.12; miR-451, 0.79±0.12. [score:1]
Other chronic lesions noted in this example from a miR-144/451 [-/-] d12 mouse include mild goblet cell hyperplasia in the large airway and diffuse lymphocytic interstitial pneumonia and alveolitis with mild hemorrhage. [score:1]
We observed a significantly lower viral load in type I epithelial cells isolated from miR-144/451 -deficient mice relative to wild-type cells following in vitro influenza virus infection (Fig 2A). [score:1]
1006305.g002 Fig 2(A) miR-144/451 KO or WT lung epithelial cells were infected with influenza virus. [score:1]
Here, we demonstrate that miR-144 attenuates a module of antiviral interferon -induced genes controlled by TRAF6 and IRF7. [score:1]
Mean relative intensities for 5 (miR-144) or 2 (miR-451) independent experiments using 5 (vector alone) control samples are shown. [score:1]
Flu -induced lesions were similar in character but decreased in severity and extent in miR-144/451 -deficient mice. [score:1]
S1 Fig of miR-144/451 [-/-] lungs infected with influenza virus. [score:1]
miR-144/451 -deficient mice showed increased cellularity in the BAL within the first day of infection and reduced numbers of recruited inflammatory cells at days 3 and 12 (S2 and S3 Figs). [score:1]
miR-144 and miR-451 bind to unique sequences in target genes to play non-redundant roles in erythroid lineage differentiation [12, 15, 16] but are not well-characterized in the lung. [score:1]
Low power overviews (upper row scale bars = 8mm for all) demonstrate regional distribution of lesions (darker consolidated areas) with decreased extent in the miR-144/451 [-/-] sections. [score:1]
C57BL/6 mice (Jackson Laboratories), IRF7 [null] mice (C57BL/6 background, provided by T. Taniguchi, University of Tokyo, Tokyo, Japan), and miR-144/miR-451 [null] mice were housed in a specific pathogen-free barrier facility. [score:1]
miR-144/miR-451 [null] mice [12] were backcrossed 5 times onto the C57BL/6 background (verified to be >95% C57BL/6), and wild type littermates used for infection experiments. [score:1]
These data suggest that miR-144/miR-451 affects influenza virus replication in epithelial cells, as the largest difference in viral load was observed within the first 12 hours of infection, prior to substantial inflammatory cell recruitment. [score:1]
We evaluated the effect of miR-144 and miR-451 on viral replication since they are expressed within the natural host cells for influenza [17– 19]. [score:1]
Lung architecture was assessed to be normal in uninfected miR-144/miR-451 [null] mice. [score:1]
miR-144/451 -deficient mice had decreased viral load in the lung and in bronchoalveolar lavage (BAL) fluid over the first 3 days of infection (Fig 1B), exhibited a delayed onset of weight loss, an established correlate of morbidity and viral load, and recovered their starting weights sooner than wild-type littermates (Fig 1C). [score:1]
Our findings in isolated lung epithelial cells were consistent with the effects observed in influenza virus-infected mice lacking miR-144. [score:1]
Therefore, the impact we observe of miR-144 on influenza virus replication in lung epithelial cells could not be mo deled by the in vitro system employed in those two studies. [score:1]
In contrast, we observe a significant impact of the loss of the miR-144/451 locus on lung viral load rather than cytokines (Fig 1). [score:1]
miR-144 attenuates the IRF7 transcriptional network. [score:1]
In this study, we show that microRNA-144 impairs the ability of host cells to control the replication of three viruses: influenza virus, EMCV, and VSV. [score:1]
Means ± SEM are plotted for n = 5 (miR-144 and vector) or n = 2 (miR-451); *p = 0.013. [score:1]
S4 FigGeneration of an in vitro mo del to study the mechanism of miR-144’s effect on host antiviral response. [score:1]
miR-144 impairs control of viral replication by murine lung epithelial cells. [score:1]
Viral load in influenza-infected cells was quantified as in A. Means ±SEM for 3–7 independent experiments are shown and p-values calculated for miR-144+miR-451 and miR-144 -expressing cells relative to each other cell line. [score:1]
[1 to 20 of 98 sentences]
2
[+] score: 295
Other miRNAs from this paper: mmu-mir-486a, mmu-mir-495, mmu-mir-486b
This study presents that miR-144 is a tumor suppressor in CCA through inhibition of AKT and also finds its direct target LIS1, which is the major effector in the tumor suppression process. [score:10]
The target genes of miR-144 were obtained from public databases (miRanda, PicTar, and Target ScanS) according to the following two criteria: the target gene contained the conserved 8-mer and 7-mer sites that match the seed region of miR-144, and the target gene was predicted by at least two programs. [score:9]
We found that miR-144 is down-regulated in CCA, and our results suggest that miR-144 inhibits CCA cell growth and invasion through decreasing p-AKT and directly targeting LIS1. [score:9]
Our results revealed that the expression of LIS1 is remarkably increased in CCA tissues, and knockdown of LIS1 by siRNA has similar inhibition effect on the growth and motility properties of CCA cell lines with miR-144 overexpression. [score:8]
To explore the underlying mechanisms by which miR-144 inhibits the proliferation and invasion of CCA cells through suppression of AKT, the direct target genes of miR-144 were obtained from public databases. [score:8]
Moreover, overexpression of miR-144 expression could suppress tumor growth in nude mice. [score:7]
Then we tried to find the direct target of miR-144, which would explain how miR-144 suppresse AKT. [score:6]
Here, we predicted that LIS1 is a potential target of miR-144 based on the evolutionally conserved 3′-UTR sequence by bioinformatics analysis and we also proved that it is a direct target of miR-144. [score:6]
Luciferase assays and western blots verified LIS1 as a direct target of miR-144, and knocking-down LIS1 has similar effect with overexpression of miR-144 in CCA cell lines. [score:6]
To study the possible role of miRNAs that inhibit CCA cell proliferation and metastasis, we focused on miR-144, as it is significantly downregulated in CCA samples. [score:6]
In another word, even there is other direct target of miR-144, the inhibition effect of miR-144 in CCA is mainly through decreasing LIS1. [score:6]
As predicted, miR-144 overexpression reduced the expression of the MMP2 which explained why the cell incvasion activity decreased in both HCCC-9810 and CCLP1 cells (Figure  2G). [score:5]
E. showed the expression of LIS1 in HuCTT1 and RBE cells transfected with negative control oligonucleotide (NC) or miR-144 inhibitor (anti- miR-144). [score:5]
Our results showed that miR-144 was reduced in CCA tissues and suggested that miR-144 may be an essential suppresser of CCA cell proliferation and invasion through targeting LIS1. [score:5]
On the contrary, western analysis showed that LIS1 protein expression was significantly increased in miR-144 inhibitor transfected cells (Figure  3). [score:5]
A. Relative miR-144 expression level in HCCC-9810 and CCLP1 cells transfected with the control (empty vector) or miR-144 -expressing vector (miR-144). [score:5]
Taken together, these results demonstrated that miR-144 inhibited the expression of LIS1 through post-transcriptional repression. [score:5]
For transfection, HuCC-T1 and RBE cells were transfected with anti-miR-144 inhibitors (anti-miR-144) or Anti-miRNA Inhibitors Negative Control #1 (NC) (Applied Biosystems, Foster City, CA, USA) in a final concentration of 20 nM using X-tremeGENEsiRNA Transfection Reagent (Roche, Indianapolis, IN, USA), according to the manufacturer’s instructions. [score:5]
These observations indicated that miR-144 inhibits cell growth and invasion through suppression of AKT signaling pathway. [score:5]
All these showed that miR-144 inhibits CCA cell growth and invasion through suppressing AKT. [score:5]
Furthermore, MMP2, a collagenase which promotes cell invasion and is activated by AKT, was downregulated by miR-144. [score:4]
There is no evidence that miR-144 suppresses AKT activity directly. [score:4]
It suggests that the regulation of LIS1 by miR-144 is in the upstream of AKT and LIS1 may be a upstream activator of AKT directly or undirectly. [score:4]
We found that miR-144 was significantly down-regulated in CCA tissues and CCA cell lines. [score:4]
LIS1 is a direct target of miR-144. [score:4]
The miR-144 is downregulated in CCA tissues and cell lines. [score:4]
We focused on miR-144 which was significantly down-regulated in CCA tissues. [score:4]
First, our data show that miR-144 is significantly downregulated in CCA tissues and cell lines. [score:4]
To validate the expression of miR-144 in miRNA microarray data, we confirmed that the expression of miR-144 was remarkably reduced in the three CCA samples compared with the corresponding normal bile duct tissues (data not shown). [score:4]
Figure 3 LIS1 is a new target regulated by miR-144. [score:4]
Next, we compared the expression of miR-144 in a panel of human CCA cell lines (HCCC-9810, CCLP1, HuCCT1, and RBE) and the non-malignant cell line BEC, and the results showed that miR-144 expression was significantly decreased in these CCA cell lines (P <0.05) (Figure  1B). [score:4]
Although the research on the true biological relevance of miR-144 in cancer is still in its infancy, in this study, we focused on the expression and function of miR-144 in CCA. [score:3]
However, future studies examining the correlation between miR-144 expression status and clinic pathological parameters and elucidating the precise signal transduction pathways of miR-144 are warranted. [score:3]
To elucidate the mechanism of miR-144 inhibiting cancer, first, we tested the AKT signaling pathway, which is usually activated in cancer and increase cell growth. [score:3]
To further examine the relative contribution of the two candidate miR-144 -binding sites, mutations of four nucleotides in each seed -binding site (MUT1 and MUT2) and a mutation of two binding sites (MUT) were included, which abolish the putative miRNA-mRNA interactions (Figure  3A). [score:3]
So after we saw the inhibition effect of miR-144 on CCA cell proliferation, the first thing we thought about was to detect the status of pAKT (S473). [score:3]
The wild-type (WT) or mutated LIS1 3′-UTR reporter gene vector was co -transfected with vector or miR-144 (MUT1 and MUT2: mutations of each binding site; MUT: mutation of both binding sites). [score:3]
To verify LIS1 as a direct target of miR-144, we co -transfected HEK293T cells with a LIS1 luciferase reporter vector which contains a wild-type or mutated binding site for miR-144 together with or without miR-144, followed by luciferase reporter assay. [score:3]
C. Relative expression of miR-144 in CCA tissues was significantly lower than that in corresponding normal bile duct tissues. [score:3]
The inhibitory effect of miR-144 was also confirmed in CCA cells in vivo. [score:3]
G. analysis to assess the protein levels of AKT, p-AKT, and MMP2 in HCCC-9810 and CCLP1 cells with miR-144 overexpression. [score:3]
Figure 5 miR-144 suppresses tumor growth in vivo. [score:3]
HCCC-9810 and CCLP1 cells were grown in log phase and then transfected with either pCDH-CMV-EF1-copGFP (vector) or PCDH-miR-144 for 12 h. Stable cell lines were screened by mass sorting on a FACSAria flow cytometer (BD Biosciences, Mountain View, CA, USA) based on the expression of GFP carried by the lentviral vector 72 h after transfection. [score:3]
Furthermore, LIS1 silencing could imitate the phenomenon of miR-144 overexpression. [score:3]
Furthermore, we found that forced expression of miR-144 could significantly attenuate cell proliferation, migration, and invasion in vitro. [score:3]
Our previous studies showed that miR-144 restoration inhibited cell growth and invasiveness in vitro. [score:3]
C. q-PCR analysis examined the mRNA level of LIS1 after overexpression of miR-144 in HCCC-9810 and CCLP1 cells. [score:3]
All these findings further indicated the tumor suppressive effect of miR-144 on CCA both in vitro and in vivo. [score:3]
To generate the lentiviral vector pCDH-miR-144 that overexpresses miR-144, a fragment encoding the pre-miR-144 sequence was amplified by PCR from HEK293T cell genomic DNA and then cloned into the BamHI/EcoRI sites of the pCDH-CMV-EF1-copGFP vector (SBI, Mountain View, CA, USA). [score:3]
F. Expression of miR-144 was inversely correlated with LIS1 in CCA tissues. [score:3]
The expression levels of miR-144 were quantified 24 h after transfection, and the cells were examined by western blot analysis 48 h after transfection. [score:3]
LIS1 is a functional target of miR-144 and is inversely correlated with miR-144 levels. [score:3]
Furthermore, we measured the expression levels of miR-144 in the 70 pairs of human primary CCA tumor and adjacent, normal bile duct tissue samples and found that miR-144 was significantly downregulated in CCA cancer tissues compared with adjacent non-neoplastic tissues (P <0.01) (Figure  1C). [score:3]
LIS1 was one of the predicted targets, and we examined the 3′-UTR of LIS1 mRNA and identified two conserved putative miR-144 binding sites by computational algorithms (Figure  3A). [score:3]
These results confirmed LIS1 as a functional downstream target of miR-144. [score:3]
The relationship between miR-144 and LIS1 expression was carried out by Spearman’s correlation. [score:3]
Here, we found that miR-144 acts as a possible tumor suppressor in CCA. [score:3]
We also identified LIS1 as a novel target gene of miR-144. [score:3]
We saw activity of AKT was decreased significantly by overexpression of miR-144. [score:3]
These results showed that both putative miR-144 -binding sites contribute to the regulation of LIS1. [score:2]
In addition, overexpression of miR-144 resulted in decreased endogenous mRNA and protein levels of LIS1 in CCA cells compared with cells transfected with the control vector (Figure  3C and D). [score:2]
Scratch assays showed that miR-144 -overexpressed cells retained a larger scratch area (P <0.05) (Figure  2E,F). [score:2]
MiR-144 suppresses cell proliferation, migration and invasion in CCA cells. [score:2]
These data indicated that miR-144 was decreased in CCA cancer tissues and cells, and thus it might be involved in human CCA development. [score:2]
The data showed that the level of p-AKT was significantly decreased in cells overexpressing miR-144 compared with control cells (Figure  2G). [score:2]
Quantitative analyses of the results indicated that migration of miR-144 -overexpressed cells was decreased at 48 h compared with control cells (P <0.05) (Figure  2D). [score:2]
B and C. Effects of stably expressing miR-144 on CCA cell proliferation were determined by cell proliferation assay. [score:2]
Figure 2 MiR-144 suppressed proliferation and invasion of cholangiocarcinoma cell lines through the AKT Pathway. [score:2]
MiR-144 has been implicated in both oncogenic or tumor suppressor roles in different tumors [32– 34], but its role in CCA is not yet clarified. [score:2]
Overexpression of miR-144 reduced cell invasion abilities of the CCA cells compared with the control cells (Figure  2D). [score:2]
miR-144 expression was compared in CCA tissues and matched adjacent, non-tumor bile duct tissues by the paired Student’s t test. [score:2]
Analysis of tumor weight revealed that miR-144 overexpression markedly reduced tumor growth after 5 weeks compared with vector tumors (P <0.01) (Figure  5B). [score:2]
For miR-144 detection, TaqMan miRNA expression assays were used to evaluate the expression of miR-144 using the StepOnePlus™ system (Applied Biosystems). [score:2]
Reintroduction of miR-144 in CCA cell lines not only inhibited cell growth, but also significantly reduced cell migration and invasion capacities compared with controls. [score:2]
Targeting of LIS1 by miR-144 was confirmed by luciferase reporter assays. [score:2]
B. Endogenous levels of miR-144 in HCCC-9810, CCLP1, HuCC-T1, RBE, and BEC cells detected by q-PCR analysis. [score:1]
Our data indicated that miR-144 attenuated the luciferase activity of the wild-type 3′-UTR of LIS1 (P <0.01) and reduced the luciferase activity of both the individual binding site mutants (P <0.05) (Figure  3B), but the activity of the double mutant 3′-UTR vector remained unaffected. [score:1]
The sequences of the LIS1 3′-UTR containing putative seed sequences of miR-144 were amplified from CCLP1 genomic DNA and cloned into the psiCHECK™-2 vector (Promega, Madison, WI, USA). [score:1]
To investigate the role of miR-144 in cancer cells, we examined the cellular effects of miR-144 overexpression. [score:1]
HEK293T cells at 50% confluence in 96-well plates were co -transfected with hsa-miR-144 or anti-miR-144, along with reporter vectors using Lipofectamine™ 2000. [score:1]
For production of viral particles, we co -transfected the lentivirus -mediated miR-144 packaging system containing pCDH-CMV-EF1-copGFP or PCDH-miR-144, Rec, TAT, Gag, and Vsvg into HEK293T cells with Lipofectamine™ 2000 (Invitrogen) according to the manufacturer’s instructions. [score:1]
The bar graph showed quantification of cell invasion between the miR-144 -transfected cells and the control cells. [score:1]
Of interest, an inverse correlation was observed between miR-144 and LIS1 in human CCA tissues (Figure  4F). [score:1]
Four-week-old female nude mice (BALB/c-nude) were injected subcutaneously in the upper back with 5 × 10 [6] CCLP1 cells stably transfected with empty vector or miR-144 vector in 150 μL sterile PBS. [score:1]
[1 to 20 of 84 sentences]
3
[+] score: 266
In our study, ectopic expression of miR-26a or miR-144 alone in ESCC cells was not strong enough to inhibit tumor growth, while co -expression of both miR-26a and miR-144 led to the inhibition of ESCC cell proliferation and stronger suppression of ESCC metastasis, compared with the similar effects of the individual miRNAs. [score:10]
In this study, we found that overexpression of miR-26a or miR-144 alone was not strong enough to inhibit proliferation of ESCC cells, but they still can inhibit COX-2 expression in cancer cells. [score:9]
Our findings provide direct evidence to support that miR-26a and miR-144 are tumor suppressors in ESCC and inhibit ESCC by repressing COX-2 expression. [score:8]
For example, microRNA-375, miR-29c, miR-195, miR-625, miR-203, miR-302b, miR-133a, miR-101, miR-27a, miR-655 and miR-200b can suppress the growth of ESCC cells by regulating the expression of a variety of molecules, including IGF1R (insulin-like growth factor 1 receptor), cyclin E, Cdc42, Sox2, Ran, ErbB4, FSCN1 and MMP14, enhancer of zeste homolog 2 (EZH2), KRAS, ZEB1, TGFBR2 and Kindlin-2. In this study, we revealed the inhibitory effects of both miR-26a and miR-144 on proliferation and metastasis of ESCC. [score:8]
CCK8 assay data showed that proliferation of EC9706 and EC109 cell lines stably transfected with miR-26a or miR-144 was not inhibited, while the percentage of growth inhibition in co-expressed miR-26a and miR-144 was significantly inhibited (Figure 2A). [score:8]
COX-2 is confirmed as a direct target of miR-26a or miR-144, and inhibition of COX-2 expression might be the action mechanism underlying their anti-tumor functions. [score:8]
Co -expression of miR-26a and miR-144 potently inhibits the tumor formation and metastasis of ESCC in vivoCo -expression of miR-26a and miR-144 in ESCC cell lines significantly inhibited the growth of xenograft tumors in nude mice, compared with mice inoculated with parental EC9706 or EC109 cells (Figure 5A). [score:8]
To clarify whether co -expression of miR-26a and miR-144 in ESCC cells has an additive effect, we constructed a special expression plasmid that can express both miR-26a and miR-144 simultaneously. [score:7]
We searched the databases TargetScan, PicTar, miRwalk, DIANAmT, microRNA, Microcosm Targets and MicroRanda for miRNAs that might bind to the 3′ -UTR of COX-2. Four candidates including miR-101, miR143, miR-26a and miR-144 were found via computational prediction of microRNA targets. [score:7]
This suggests that there is an additive inhibitory effect by the co-expressed miR-26a and miR-144 on COX-2 expression and cell proliferation and metastasis in ESCC. [score:7]
Our study showed that miR-26a and miR-144 inhibit proliferation and metastasis of ESCC by inhibiting COX-2 expression. [score:7]
In conclusion, expression of miR-26a and miR-144 is downregulated in cell lines and tumor tissue specimens of ESCC. [score:6]
Ectopic expression of miR-26a, and miR-144, or both in ECC cells inhibited the metastasis ability of tumor cells. [score:5]
analysis showed that overexpression of miR-26a, miR-144, or both in EC9706 and EC109 cells significantly reduced COX-2 expression at the protein level (Figure 4C). [score:5]
In our in vitro and in vivo studies, co -expression of both miR-26a and miR-144 in ESCC resulted in the inhibition of either proliferation or metastasis. [score:5]
Thirdly, the inhibited proliferation of cells co-overexpression of miR-26a and miR-144 was promoted when PGE2 was added to the culture medium (Figure 4E; P < 0.001). [score:5]
Co -expression of miR-26a and miR-144 cooperate to inhibit the proliferation of ESCC cells. [score:5]
Compared to adjacent normal tissues, the expressions of miR-26a and miR-144 were significantly downregulated in tumor tissues (Figure 1A, 1B). [score:5]
Co -expression of miR-26a and miR-144 potently inhibits the tumor formation and metastasis of ESCC in vivo. [score:5]
Downregulation of miR-26a and miR-144 in human ESCC tissues and cell lines. [score:4]
MiR-26a and miR-144 are frequently downregulated in human ESCC tissues and cell lines. [score:4]
Similar results were also found in 11 ESCC cell lines, suggesting that both miR-26a and miR-144 are downregulated in human ESCC. [score:4]
Co -expression of miR-26a and miR-144 in ESCC cell lines significantly inhibited the growth of xenograft tumors in nude mice, compared with mice inoculated with parental EC9706 or EC109 cells (Figure 5A). [score:4]
Although several reports showed that miR-144 is downregulated in hepatocellular carcinoma [71], non-small cell lung cancer [72], osteosarcoma [73], prostate cancer [74], cervical squamous cell carcinoma [75] and colorectal cancer [76– 77], other studies showed that miR-144 can promote growth of HeLa cells [78] and cell proliferation, migration, and invasion in nasopharyngeal carcinoma [79]. [score:4]
Thirdly, COX-2 as a direct target of miR-26a and miR-144 in ESCC cells was confirmed by means of luciferase reporter, western blot and ELISA. [score:4]
Firstly, the predicted binding sites of hsa-miR-26a and hsa-miR-144 in the 3′-UTR of COX2 mRNA is shown according to computational prediction, from which the luciferase reporters containing mutant binding sites were constructed (Figure 4A), to verify whether COX-2 is a direct target of miR-26a or miR-144 in human ESCC. [score:4]
COX-2 expression is regulated by miR-26a and miR-144 in ESCC cells. [score:4]
B. The expression levels of miR-26a or miR-144 in stably transfected ESCC cell lines. [score:3]
Co-transfection of both miR-26a and miR-144 inhibited the proliferation of ESCC cells. [score:3]
The data revealed that co -expression of miR-26a and miR-144 in ESCC cell lines significantly induced both apoptosis and cell cycle arrest at G0 / G1 phase (Figure 2B, 2C and Table 1). [score:3]
Co -expression of miR-26a and miR-144 in ESCC cells decreased cell proliferation by inducing apoptosis and cell cycle arrest at G0 / G1 phase. [score:3]
Figure 5Co-transfection of miR-26a and miR-144 inhibited both growth and metastasis of ESCC cells in vivo A. 1.5 × 10 [6] cells stably transfected with either vector or the combination of two miRNAs were implanted subcutaneously in both the right and left dorsal flank areas of nude mice (5 mice per group). [score:3]
The expression levels of miR-26a and miR-144 in stable clones were verified via real-time RT-PCR. [score:3]
COX-2 was involved in the inhibitive effect of miR-26a and miR-144 on ESCC cells. [score:3]
Firstly, we examined the expression levels of miR-26a and miR-144 in ESCC. [score:3]
Figure 1The expression levels of miR-26a A. and miR-144 B. in 30 pairs of ESCC tumor tissues and corresponding normal tissues were determined by quantitative real time RT-PCR as described in Materials and Methods. [score:3]
The expression levels of miR-26a C. and miR-144 D. in eleven ESCC cell lines and a human immortalized esophageal squamous cell line (Het-1A) were also quantified. [score:3]
Taken together, all of the data from the in vitro and in vivo studies indicated that miR-26a and miR-144 may function as tumor suppressors in ESCC. [score:3]
Co-transfection of miR-26a and miR-144 inhibited both growth and metastasis of ESCC cells in vivo. [score:3]
To verify whether COX-2 is a target of miR-26a or miR-144 in human ESCC, we performed the following experiments. [score:3]
The expression levels of miR-26a and miR-144 in EC9706 or EC109 stably transfected with miR-26a or miR-144 or both increased significantly (Figure 4B). [score:3]
The expression levels of miR-26a A. and miR-144 B. in 30 pairs of ESCC tumor tissues and corresponding normal tissues were determined by quantitative real time RT-PCR as described in Materials and Methods. [score:3]
MiR-26a and miR-144 inhibit migration and invasion of ESCC cells. [score:3]
A comparison between 30 pairs of ESCC tumor and adjacent normal tissues showed that the expression levels of miR-26a and miR-144 were significantly decreased in ESCC tumor (P < 0.001). [score:3]
In our preliminary experiments to examine the effect of those 4 miRNAs on proliferation function of ESCC cell lines, we found that miR-101 or miR-143 could inhibit the proliferation of ESCC cell lines, but miR-26a or miR-144 alone did not. [score:3]
Introduction of the expression plasmids carrying miR-26a, miR-144, and miR-26a-144 into EC9706 and EC109 cells was performed using Lipofectamine 2000 (Invitrogen, USA) in accordance with the manufacturer's instructions. [score:3]
The expressions of miR-26a and miR-144 in clinical specimens of ESCC and corresponding adjacent normal tissues obtained from 30 patients with ESCC. [score:3]
Since COX-2 is considered a potential therapeutic target of ESCC, our findings suggest that miR-26a and miR-144 may contribute to a novel therapeutic approach for ESCC. [score:2]
Another common feature of miR-26a and miR-144 is their discrepant functions in cancer development. [score:2]
Results showed that reporter activity of WT pMIR-COX-2 was significantly decreased in cells that over-expressed miR-26a or miR-144, as compared with the control cells (P < 0.01; Figure 4G). [score:2]
The expression plasmid for the miR-26a-144 cluster was made in three steps: 1) An integrated plasmid of miR-26a and miR-144 was prepared by PCR (miR-26a, 368 bp; miR-144, 236 bp) with primers: miR-26a, sense 5′-GC T / CTAGA (XBaI) TGACTGTAAGCATGACTGGCCTG-3′; miR-26a, anti-sense 5′-TCTCC TGCCCTTTGCA TGTAG A / AGCTT (HindIII) GGG-3′; miR-144 sense, 5′-CG G / GATCC (BamHI) TCACAGTGCTTTTCAAGCCATG-3′; miR-144, anti-sense TACTGACTGCCAGGGCAC TTGG T / CTAGA GC (XBaI)-3′. [score:2]
In this study, we focused on the potential roles of miR-26a and miR-144 in ESCC development. [score:2]
The specific primers for establishing expression plasmids of miR-26a and miR-144 were: miR-26a, sense 5′- CG G / GATCC (BamHI) TGACTGTAAGCATGACTGGCCTG-3′; miR-26a, anti-sense 5′-CTACATGCAAAGG GCAGGAGA A / AGCTT (HindIII) GGG-3′; miR-144, sense 5′- CG G / GATCC (BamHI) TCACAGTGCTTTTCAAGCCATG-3′; miR-144, anti-sense 5′-CAAGTGCCCTGGCAGTC AGTA A / AGCTT (HindIII) GGG-3′. [score:2]
These present results suggest that miR-26a and miR-144 might be involved in the occurrence and development of cancer and the function of miR-26a and miR-144 in cancer is complicated and highly tissue-specific. [score:2]
The specific primers for establishing expression plasmids of miR-26a and miR-144 were:miR-26a, sense 5′- CG G / GATCC (BamHI) TGACTGTAAGCATGACTGGCCTG-3′;miR-26a, anti-sense 5′-CTACATGCAAAGG GCAGGAGA A / AGCTT (HindIII) GGG-3′;miR-144, sense 5′- CG G / GATCC (BamHI) TCACAGTGCTTTTCAAGCCATG-3′; miR-144,anti-sense 5′-CAAGTGCCCTGGCAGTC AGTA A / AGCTT (HindIII) GGG-3′. [score:2]
Finally, to determine whether miR-26a or miR-144 can directly bind to the 3′-UTR of COX-2 mRNA, luciferase reporter activity of WT or MT pMIR-COX-2 plasmid in ESCC cells that overexpressed miR-26a or miR-144 was measured. [score:2]
The expression levels of miR-26a and miR-144 in 11 ESCC cell lines were also significantly lower compared with that of Het-1A, a human immortalized esophageal epithelia cell line (Figure 1C, 1D). [score:2]
The functions of miR-144 in human cancer development are also unclear. [score:2]
The results showed that the migration and invasion abilities of ESCC cells stably transfected with miR-26a, or miR-144, or both were significantly suppressed, compared with the parent cells or vector-control cells (Figure 3B). [score:2]
To measure the expression levels of mature miR-26a and miR-144, real-time quantitative RT-PCR was performed as previously described [48]. [score:1]
However, Guo et al. found that miR-26a and miR-144 were associated with the different tumor stage classifications (Table 1 in the reference paper [42]) [42]. [score:1]
Apoptosis and cell cycle arrest in cells stably transfected with miR-26a, miR-144, or both were analyzed via flow cytometry. [score:1]
Secondly, we investigated the correlation of miR-26a or miR-144 with COX-2 expression in ESCC cells. [score:1]
Precursors of miR-26a (351 bp) and miR-144 (220 bp) were cloned into the pSilencer 4.1-CMV vector (Ambion, Geneworks), in accordance with the manufacturer's instructions. [score:1]
We further evaluated the inhibitory effect of miR-26a and miR-144 on ESCC using an in vivo study. [score:1]
This phenotype implied that miR-26a or mir-144 might affect metastasis of ESCC cells. [score:1]
The controversial functions of miR-26a and miR-144 in different types of cancers have been recently reported in the literature. [score:1]
Secondly, we showed that miR-26a and miR-144 can reduce the migration and invasion abilities of ESCC cells. [score:1]
Addition of PGE2 into the culture medium resulted in a significant increase in migration and invasion ability of cells stably transfected with miR-26a, or miR-144, or both (Figure 4F; P < 0.001). [score:1]
Figure 4 A. The predicted binding sites of hsa-miR-26a and has-miR-144 in the 3′ -UTR of COX-2 mRNA and their mutant counterparts. [score:1]
Luciferase reporters of COX-2 with mutant binding sites (underlined and italicized) of miR-26a or miR-144 were made using two DNA fragments with 5′ SacI and 3′ HindIII sites (underlined) and protective bases. [score:1]
A. The predicted binding sites of hsa-miR-26a and has-miR-144 in the 3′ -UTR of COX-2 mRNA and their mutant counterparts. [score:1]
Fold changes for the expression levels of miR-26a and miR-144 were calculated using the comparative cycle threshold (CT) method (2 [−ΔΔCT]). [score:1]
A mutant of the miR-144 binding site (144 bp): GCCACA GAGCT / CAATAATAATGACGATAATACTTCTTTTCCACATCTCATTGTCACTGACATTTAATGGAC GGTTATATTACTTAATTTATTGAAGATTATTATTTATGTCTTATTAGGACACTATGGTTATA / AGCTT CCGCAT; and a mutant miR-26a binding site (144 bp): GCCACAGAGCT / CTTAAGTTTGGAAAACAGTTTTT ATTCT GTTTT ATAAACCAGAGAGAAATGAGTTTTGACGTCTTTT CGTGCCAATTTCAACTTATATTATAAGAACGAAAGTAAAGATGTTTGAATACTTA / AGCTT CCGCAT. [score:1]
The reaction mixture was used for real-time RT-PCR of miR-26a and miR-144, using an Applied Biosystems 7500 Fast System and standard TaqMan PCR reagents. [score:1]
This may be the first report of miR-144 / COX-2 pathway in human cancer. [score:1]
The mature sequences of miR-26a and miR-144 are located at chromosomes 12q14.1 and 17q11.2, respectively. [score:1]
One of the common features of miR-26a and miR-144 is that both are located on chromosomal regions associated with various human cancers [80– 82]. [score:1]
No visible metastatic nodules on the lung, kidney, or spleen were found in either the miR-26a or miR-144 groups or in the control groups. [score:1]
)Precursors of miR-26a (351 bp) and miR-144 (220 bp) were cloned into the pSilencer 4.1-CMV vector (Ambion, Geneworks), in accordance with the manufacturer's instructions. [score:1]
The number of metastatic nodules on the surfaces of the liver was significantly less in mice inoculated single miRNA or two miRNAs -transfected ESCC cells than that of negative control mice (parent and vector groups), especially in the group with co -transfected miR-26a and miR-144 (Figure 5B, P < 0.001). [score:1]
[1 to 20 of 81 sentences]
4
[+] score: 266
Other miRNAs from this paper: mmu-mir-143, hsa-mir-143, hsa-mir-144
The decrease in E [2] levels before term leads to down-regulation of c-fos gene expression, which in turn results in the down-regulation of miR-144 and COX2 expression, and miR-144 directly and indirectly targets c-fos and COX2, all of which reduce the secretion of PGE2 throughout most of pregnancy (Fig. 7). [score:15]
With the increased expression of c-fos, the expression of COX2 is also upregulated, but miR-144 partially inhibits COX2 expression, thus slightly reducing the PGE2 secretion. [score:12]
After the transduction of the c-fos overexpression plasmid and the COX2 target protector, the protein levels of COX2 increased (Fig. 5H), as did PEG2 synthesis (Fig. 5I), thus indicating that miR-144 can partly inhibit COX2 via the up-regulation of c-fos. [score:10]
In the present study, the overexpression analysis of miR-144 mimics in cultured human WISH cells indicated that miR-144 downregulates the expression of c-fos and COX2 and that c-fos interference inhibits the synthesis of PGE2 in the amnion during pregnancy and labor. [score:10]
To test this hypothesis, we transfected WHIS cells with either miR-144 mimics/COX2 target protector/c-fos target protector or miR-144 mimics/COX2 target protector/c-fos target protector negative control (NC). [score:9]
From these collective findings, we conclude that the increase in miR-144 and COX2 that occurs during late gestation in response to LPS treatment is attributable to the rise of c-fos expression but that the decrease in miR-144 and COX2 that occurs before late gestation is attributable to the down-regulation of c-fos expression. [score:8]
This increase up-regulates the expression of the c-fos gene, which leads to the increased expression of miR-144 and COX2. [score:8]
miR-144 directly and indirectly targets c-fos and COX2, and inhibits the synthesis of PGE2. [score:7]
As shown above, because c-fos can increase the expression of COX2, we hypothesized that miR-144 might indirectly regulate COX2 expression via c-fos. [score:7]
c-fos to promote the expression of miR-144 and COX2, but with the increase of COX2, miR-144 partially inhibited the COX2 expression, thereby reducing slightly the secretion of PGE2, implying that miR-144 reduces PGE2 secretion by section to avoid preterm delivery. [score:7]
To assess whether miR-144 directly targets c-fos and COX2, we transfected HeLa cells separately with miR-144 mimics and a luciferase reporter plasmid containing a portion of the c-fos 3′UTR or COX2 3′UTR, which resulted in significant down-regulation of the luciferase activity of both the c-fos 3′UTR and COX2 3′UTR. [score:7]
Together, these data indicate that during pregnancy, the expression of c-fos is lower and that miR-144 directly or indirectly targets both c-fos and COX2, ultimately decreasing the PGE2 levels. [score:7]
After the transduction of miR-144 and c-fos target protector, the protein levels of COX2 increased (Fig. 5G), thus implying that miR-144 can indirectly target COX2 via c-fos. [score:6]
These findings suggest that up-regulation of the expression of miR-144, c-fos and COX2 in anmion may play a role preterm labor. [score:6]
Because c-fos regulates the transcription of miR-144 and COX2 and because, we hypothesize that with the increase in c-fos and COX2 that occurs in labor, miR-144 might partially inhibit COX2 expression. [score:6]
To investigate whether c-fos regulates miR-144 and COX2 expression in the amnion, a pcDNA3.1 expression plasmid was used for the c-fos transfection of WISH cells to augment c-fos expression at both the mRNA and protein levels (Fig. 3A,B); this transfection led to an increase in the mRNA and protein levels of miR-144 and COX2 (Fig. 3C–E). [score:6]
c-fos upregulates miR-144 and COX2 expression in WISH cells. [score:6]
miR-144 inhibited COX2 mRNA expression (D), reduced c-fos and COX2 protein levels (E), and decreased PGE2 levels (F). [score:5]
For the miRNA target protector studies, the cells were transfected with 1000 nM c-fos miScript Target Protector (QIAGEN) and 20 nM miR-144 mimic using Lipofectamine RNAiMAX Reagent (Invitrogen). [score:5]
miR-144, c-fos and COX2 are up-regulated in pregnant and near term mice. [score:4]
Transfecting the WISH cells with miR-144 mimics significantly decreased the protein level of c-fos and the mRNA and protein levels of COX2 as well as the concentration of PGE2 in the cell supernatants; in contrast, transfecting the WISH cells with miR-144 inhibitors significantly increased the protein level of c-fos and the mRNA and protein levels of COX2 but did not significantly regulate the mRNA level of c-fos (Fig. 5C–F). [score:4]
miR-144, c-fos, and COX2 are up-regulated in a mouse mo del of preterm labor. [score:4]
Further tests indicated that miR-144 indirectly targets COX2 via c-fos. [score:4]
In a previous deep sequencing analysis of Large White sows placentas before and at the onset of labor, we found that miR-144, c-fos and COX2 were significantly up-regulated near term 18. [score:4]
miR-144, c-fos and COX2 are up-regulated in a mouse mo dels of preterm labor. [score:4]
The results of the cotransfection experiments indicate that miR-144 directly targets the c-fos 3′UTR and the COX2 3′UTR. [score:4]
c-fos up-regulates miR-144 and COX2 in WISH cells. [score:4]
The up-regulation of c-fos was associated with a significant increase in miR-144(C) and COX2 mRNA (D) and protein (E) levels. [score:4]
In summary, c-fos is a key E [2] target gene in amnion that promotes the synthesis of PGE2, and it is associated with COX2 and miR-144. [score:3]
To assess the effects of E [2] on the expression of miR-144, c-fos and COX2 in the amnion, WISH cells were treated with 10 nM E [2], and mice were administered an amniotic sac injection of E [2]. [score:3]
Together, these results indicated that the expression patterns of miR-144, c-fos and COX2 during pregnancy are similar in pigs and mice. [score:3]
To determine whether the changes in the expression of miR-144, c-fos and COX2 were associated with preterm labor, preterm labor was induced by injecting LPS into the amniotic sacs of 15.5 dpc mice 19. [score:3]
How to cite this article: Li, H. et al. miR-144 and targets, c-fos and cyclooxygenase-2 (COX2), modulate synthesis of PGE2 in the amnion during pregnancy and labor. [score:3]
LPS treatment promoted miR-144 expression in the amnion (Fig. 2A) and increased the mRNA and protein levels of c-fos and COX2 (Fig. 2B–D). [score:3]
E [2] injection, which led to a moderate increase in the expression of miR-144, c-fos and COX2 in both the amnion and WISH cells (Fig. 6). [score:3]
miR-144 targets c-fos and COX2. [score:3]
LPS treatment increased the expression of miR-144 (A) c-fos, and COX2 at the mRNA (B,C) and protein (D) levels. [score:3]
Collectively, these findings suggest that E [2] promotes the expression of miR-144, c-fos and COX2 and that miR-144 and COX2 are probably mediated, in part, via the induction of c-fos by E [2]. [score:3]
COX2 protein levels increased in cells transfected with miR-144 and the c-fos target protector. [score:3]
Additionally, we investigated whether miR-144 inhibits endogenous c-fos and COX2 expression in human WISH cells. [score:3]
For the miRNA mimic studies, the cells were transfected with 20 nM scrambled control mimic, the miR-144 mimic or the miR-144 inhibitor (Ribobio, Guangzhou, China) using Lipofectamine RNAiMAX Reagent (Invitrogen). [score:3]
To confirm whether the expression pattern of miR-144, c-fos and COX2 is conserved in mice, qRT-PCR analysis of mouse amniotic tissue at 15.5 and 18.5 dpc was performed, and the results showed that miR-144 (Fig. 1A) as well as c-fos and COX2 (Fig. 1B,C) were increased. [score:3]
To further examine whether c-fos regulates miR-144, the miR-144 promoter region was isolated from a luciferase reporter construct, referred to as pGL3-promoter-2225, containing a 2.2-kb region upstream of the precursor miR-144. [score:2]
miR-144, c-fos, COX2 and PGE2 are coordinately regulated during pregnancy and near term in the mouse amnion. [score:2]
E [2] regulates miR-144, c-fos and COX2 in WISH cells and amnion of pregnant mice. [score:2]
In contrast, the siRNA -mediated knockdown of c-fos in WISH cells decreased the mRNA and protein levels of miR-144 and COX2 (Fig. 3F–J). [score:2]
E [2] regulates miR-144, c-fos and COX2 in WISH cells and amnion of pregnant miceE [2] promotes an inflammatory response in the uterus and antagonizes the anti-inflammatory actions of P [4]/PR 4 23. [score:2]
For the analysis of the 3′UTR mutations, four nucleotides in the putative miR-144 binding site were mutated (c-fos 3′UTR CCATGTACTGT-5′ to 3′-CCATGTAAGTG-5′ and COX2 3′UTR 3′-CATTTAATGGTACTGTA-5′ to 3′-CATTTAATGGTACGAGC-5′). [score:2]
E [2] regulates miR-144, c-fos and COX2 in the amnion of pregnant mice and in WISH cells. [score:2]
Recently, Liu et al. have demonstrated the functional significance of miR-144 and the regulation feedback loop of c-fos in the migration and invasion of hepatoma cells 33. [score:2]
These results clearly demonstrate that c-fos regulates the transcription of miR-144 and COX2 by binding the potential sites in its promoter. [score:2]
The miR-144 promoter reporter plasmids with specific single mutations in the miR-144 binding site of the AP-1 transcription factor AP-1 binding site were generated by using fusion PCR. [score:2]
Transcriptional regulation of miR-144. [score:2]
Schematic diagram of the regulation of E [2] during pregnancy and labor via the miR-144/c-fos/COX2/PGE2 axis. [score:2]
We also synthesized primers targeting the miR-144 promoter sequence that did not contain the c-fos binding site (Nbs). [score:2]
As mentioned above, the 3′UTR of c-fos and COX2 was found to contain putative binding sites for miR-144. [score:1]
org) was used to identify the putative miR-144 binding sites in the 3′UTRs of mouse and human c-fos and COX2. [score:1]
E [2] treatment increased miR-144 (A) c-fos, and COX2 mRNA (B,C) and protein (D) levels. [score:1]
Three putative AP-1 binding sites were identified in the region 1-kb upstream of the miR-144 precursor. [score:1]
These results indicated that the promoter activity that triggers miR-144 transcription resides in the region -360 bp upstream of the precursor miR-144. [score:1]
This repression was reversed when the putative miR-144 binding sites were mutated (Fig. 5A,B). [score:1]
To construct the pGL3-promoter-2225, promoter-1075, promoter-757, promoter-360 and promoter-191 luciferase reporter plasmids, each region of the miR-144 promoter was amplified from human genomic DNA and cloned into the pGL3-basic plasmid (Promega). [score:1]
The luciferase activity in cells cotransfected with miR-144 relative to luciferase activity in cells transfected with the NC are plotted. [score:1]
E [2] treatment increased miR-144 (E) c-fos, and COX2 mRNA (F,G) and protein (H) levels. [score:1]
Synthetic complementary oligonucleotides containing the AP-1 -binding site of the miR-144 promoter were 3′-biotinylated and annealed. [score:1]
Similarly, the association between c-fos and miR-144 has not previously been reported. [score:1]
Further, the expression relationship among miR-144, c-fos and COX2 after E [2] addition at different time points could be investigated in the subsequent experiment. [score:1]
The effect of miR-144 on c-fos and COX2 was abolished when the putative miR-144 binding sites were mutated. [score:1]
We hypothesize that miR-144 reduces PGE2 secretion by section to avoid the onset of premature delivery. [score:1]
We examined the DNA probes corresponding to the AP-1 binding sites 1, 2 and 3, which contained the putative AP-1 binding sequences and the regions flanking them on both sides in the human miR-144 promoter. [score:1]
[1 to 20 of 70 sentences]
5
[+] score: 251
As COX-2 was identified as a direct target of miR-144, and the transcription factor CP2 upregulated mature miR-144 expression, we hypothesize that CP2 can affect COX-2 expression and PGE2 production. [score:11]
42, 43 We confirm that miR-144 suppresses PGE2 production by targeting COX-2. Therefore, this study provides a new mechanism by which miR-144 regulates ovulation via targeting COX-2 and then suppressing PGE2 production. [score:10]
CP2 overexpression significantly promoted miR-144 as determined by, whereas knockdown of CP2 suppressed miR-144 expression (Figure 6a). [score:8]
CP2 regulates the miR-144/451 cluster and COX-2 expression in mGCsTo further verify that CP2 regulates miR-144 expression, the pcDNA3.1-CP2 vector or siRNA-CP2 was transfected into mGCs, respectively. [score:7]
qRT-PCR and western blot analyses revealed that COX-2 mRNA and protein expression levels were significantly suppressed after miR-144 mimics was transfected into mGCs and pig kidney (PK-15) cells, whereas inhibition of miR-144 increased COX-2 mRNA and protein in mGCs and PK-15 cells (Figures 1d, e and Supplementary Figure S2). [score:7]
These studies further confirm that miR-144 regulates COX-2 expression indirectly by targeting Smad4, but not c-Fos, in mGCs. [score:7]
These results indicate that CP2 binds to the core promoter of miR-144, induces the expression of mature miR-144 and miR-451, and eventually suppresses COX-2 expression and PGE2 production. [score:7]
As shown in Figure 7a, Supplementary Figures S7 and S8, miR-144 overexpression promoted apoptosis of mGCs, and miR-144 inhibition suppressed mGC apoptosis. [score:7]
Thus, miR-144 may regulate mGC apoptosis through Smad4 or COX-2. However, either overexpression or inhibition of COX-2 had no effect on apoptosis of mGCs (Figure 7b, Supplementary Figures S9 and S10). [score:6]
The potential mechanism underlying the suppression of PGE2 production by miR-144 involves direct targeting of COX-2 and Smad4 genes. [score:6]
[45] In our study, we demonstrate that Smad4 is a target of miR-144 in mGCs, and Smad4 regulates COX-2 expression via the TGF- β signalling pathway. [score:6]
Mouse GCs were transfected with miR-144 mimics, mimics NC, miR-144 inhibitor or inhibitor NC and harvested 48 h after transfection. [score:5]
Interestingly, miR-144 suppressed PGE2 production by reducing the expression of COX-2 (Figure 1f). [score:5]
TargetScan and RNAhybrid were used to detect potential target genes of miR-144. [score:5]
miR-144 directly targets the Smad4 gene in mGCsIncreasing evidence has indicated that many members of the TGF- β superfamily have important roles in follicular development and ovulation. [score:5]
miR-144 mimics, mimics NC, miR-144 inhibitor or inhibitor NC was transfected into mGCs. [score:5]
miR-144 was a negative regulator of COX-2 expression, which prompted us to examine the transcriptional regulation of miR-144 in ovarian follicles. [score:5]
12, 15 Thus, it is essential to determine whether miR-144 affects PGE2 production in mGCs by regulating COX-2 expression. [score:4]
CP2 regulates the miR-144/451 cluster and COX-2 expression in mGCs. [score:4]
In contrast, knockdown of CP2 suppressed miR-144 promoter activity. [score:4]
To further verify that CP2 regulates miR-144 expression, the pcDNA3.1-CP2 vector or siRNA-CP2 was transfected into mGCs, respectively. [score:4]
[25] Paired box gene 4 (PAX4), which regulates human epithelial cancer metastasis, decreases miR-144 and miR-451 expression levels by binding to the promoter region of miR-144/451. [score:4]
These results show that miR-144 affects ovulation by regulating COX-2 expression level and PGE2 production in mGCs. [score:4]
miR-144 negatively regulates COX-2 in mGCsmiR-144 was one of the differentially expressed miRNAs and showed a 5.59-fold change in pre-ovulatory ovarian follicles between LW and CT sows with Solexa deep sequencing technology. [score:4]
[46] We found that miR-144 regulated c-Fos expression in mGCs directly through dual-luciferase reporter assays, qRT-PCR and western blot analyses (Supplementary Figure S13). [score:4]
[24] Here, we find that CP2 regulates the expression of miR-144 and miR-451 in mGCs, which is consistent with previous studies. [score:4]
A previous study suggests that miR-144 regulates COX-2 by targeting c-Fos. [score:4]
miR-144 directly targets the Smad4 gene in mGCs. [score:4]
In addition, miR-144 was upregulated by CP2 (Figure 8a). [score:4]
35, 36, 37, 38 Importantly, we revealed that the COX-2 gene was a target of miR-144 in both mGCs and PK-15 cells. [score:3]
To confirm that CP2 can regulate the activity of the core promoter of mouse miR-144, site-directed mutagenesis was performed using the wild-type pGL3-miR-144-D6 construct as a template. [score:3]
miR-144 was one of the differentially expressed miRNAs and showed a 5.59-fold change in pre-ovulatory ovarian follicles between LW and CT sows with Solexa deep sequencing technology. [score:3]
COX-2 was predicted to be a target of miR-144. [score:3]
We co -transfected miR-144 mimics and a luciferase reporter vector containing the mouse 233 bp COX-2-3′ -UTR (pmirGLO-COX-2-3′- UTR) into Chinese hamster ovarian (CHO-K1) cells, and luciferase activity was significantly suppressed. [score:3]
Our studies demonstrated that Smad4 and COX-2 were two target genes of miR-144. [score:3]
The expression patterns of seven known miRNAs (let-7a, miR-125a, miR-144, miR-2423, miR-3613-5p, miR-331* and miR-4028-3p) were successfully validated using qRT-PCR analyses. [score:3]
To identify the core promoter of mouse miR-144, a series of deletions of the mouse miR-144 potential promoter were used to drive luciferase gene expression, and luciferase activity was determined. [score:3]
qRT-PCR and western blot analysis revealed that miR-144 significantly inhibited the Smad4 mRNA level and protein level (Figures 2d and e). [score:3]
Quantitative real-time PCR (qRT-PCR) analyses showed that the expression profiles of seven miRNAs (let-7a, miR-125a, miR-144, miR-2423, miR-3613-5p, miR-331* and miR-4028-3p) were consistent with the results from deep sequencing (Supplementary Figure S1). [score:3]
The pmirGLO-Smad4-3′ -UTR luciferase reporter was co -transfected with miR-144 mimics or mimics negative control (NC) into CHO-K1 cells, and luciferase activity was significantly suppressed by miR-144. [score:3]
[21] Here, we predicted that Smad4, a key gene in the TGF- β pathway, may be a target of miR-144. [score:3]
As shown in Figure 4c, overexpression of CP2 significantly increased miR-144 promoter activity. [score:3]
miR-144 was differentially expressed in CT and LW sows. [score:3]
In summary, our study provides direct evidence that miR-144 participates in mammalian ovulation by regulating PGE2 production. [score:3]
[48] In this study, we find that transcription of miR-144 is regulated by CP2 in both mGCs and CHO-K1 cells. [score:2]
There is increasing evidence that miR-144 and miR-451 are transcribed on a single primary RNA and regulated by same transcription factors. [score:2]
These results indicate that miR-144 regulates mGC apoptosis but not through Smad4 and COX-2. To explore the mechanism of ovulation, we investigated whether specific miRNAs displayed breed-modulated expression in the ovarian follicles. [score:2]
miR-144 regulates mGC apoptosis but not via COX-2 and Smad4. [score:2]
We also showed that miR-144 regulated mGC apoptosis but not through Smad4 or COX-2 (Figure 8b). [score:2]
miR-144 regulates mGC apoptosis but not via COX-2 and Smad4Previous studies indicate that follicular atresia is triggered by granulosa cell apoptosis. [score:2]
miR-144 negatively regulates COX-2 in mGCs. [score:2]
Identification of the promoter region and regulatory elements of mouse miR-144. [score:2]
These results indicate that miR-144 regulates mGC apoptosis but not through Smad4 and COX-2. Mammalian folliculogenesis is a complex biological process. [score:2]
18, 26 In this study, we demonstrate that miR-144 regulates apoptosis of mGCs but not via Smad4 and COX-2. These data indicate that miR-144 may be involved in follicular atresia. [score:2]
These results confirm that miR-144 regulates the TGF- β signalling pathway via Smad4 in mGCs. [score:2]
However, luciferase activity was unchanged when we co -transfected miR-144 mimics and pmirGLO-COX-2-3′ -UTR-Mut into mGCs (Figure 1c). [score:1]
[55] We further demonstrate that CP2 affects PGE2 production through the CP2/miR-144/ COX-2/PGE2 axis. [score:1]
s (EMSAs) were used to further detect CP2 binding to the mouse miR-144 promoter in vitro. [score:1]
These results indicate that CP2 specifically binds to the mouse miR-144 promoter region in vivo. [score:1]
18, 26, 27 We hypothesize that miR-144 can affect apoptosis of mGCs. [score:1]
html) was used to predict the transcription factor binding sites in the promoters of both mouse miR-144 and pig miR-144. [score:1]
The pcDNA3.1-CP2, pcDNA3.1, siRNA-CP2 or siRNA NC was co -transfected with the pGL3-miR-144-D6 vector into mGCs. [score:1]
In addition, the miR-144 -binding seed sequences in the COX-2 3′-UTR were highly conserved in mammals (Figures 1a and b). [score:1]
miR-144 and miR-451 are transcribed in the same pri-miRNA. [score:1]
Transcription factor CP2 binds to the miR-144 promoter both in vivo and in vitro. [score:1]
These results suggest that CP2 binds to the mouse miR-144 promoter region in vitro. [score:1]
Nine deletion fragments of the mouse miR-144 potential promoter region were amplified and double-digested with KpnI and HindIII and cloned into the pGL3-basic vector (Promega). [score:1]
The dual-luciferase reporter system was used to analyze the interaction between miR-144 and the COX-2 gene. [score:1]
The miR-144 -binding seed sequences in the Smad4 3′-UTR were also highly conserved in mammals (Figures 2a and b). [score:1]
A luciferase reporter analysis was used to determine the binding sites of miR-144 in the Smad4 3′-UTR. [score:1]
These results indicate that the binding site of CP2 is important for miR-144 promoter activity. [score:1]
Therefore, miR-144 was selected as a candidate miRNA for analysis of ovulation. [score:1]
Luciferase activity analysis in both mGCs and CHO-K1 cells revealed that pGL3-miR-144-D6 (−468 bp to −375 bp) was required for miR-144 transcriptional activity (Figure 4a). [score:1]
33, 34 However, many studies on miR-144 focus on cancer cell proliferation, invasion and erythropoiesis, and few studies have examined the role of miR-144 in folliculogenesis. [score:1]
Meanwhile, miR-144 had no effect on a Smad4 3′-UTR mutated dual-luciferase construct (Figure 2c). [score:1]
[25] GATA -binding protein 4 (GATA4) has been shown to activate the promoter of miR-144/451 and protect against simulated ischaemia/reperfusion -induced cardiomyocyte death. [score:1]
To further assess the transcription factors binding to the core promoter of miR-144, the CP2 transcription factor binding site was identified in the miR-144-D6 region using the transcription factor prediction software BIOBASE (Supplementary Figure S5a). [score:1]
These findings have potential implications in improving female fecundity through the CP2/miR-144/ COX-2/PGE2/ovulation pathway. [score:1]
Oligos corresponding to the CP2 -binding sites of the miR-144 core promoter were synthesized and annealed into double strands. [score:1]
[1 to 20 of 79 sentences]
6
[+] score: 219
These data suggested that, LPS could inhibit CASC2 and AQP1 expression, and upregulated miR-144-3p expression in A549 cell. [score:10]
Meanwhile, the miR-144-3p expression was upregulated by LPS, but transfection of pcDNA-CASC2 inhibited its expression in A549 cell (Fig.   3b). [score:10]
Further, CASC2 and AQP1 were targets of miR-144-3p and CASC2 can indirectly regulate AQP1 expression via miR-144-3p. [score:7]
Co-transfection with pcDNA-CASC2 and miR-144-3p mimic reversed the pcDNA-CASC2 -upregulated AQP1 expression (Fig.   5), which fully demonstrated. [score:6]
These data showed that miR-144-3p could bind to 3′UTR of AQP1 and regulated AQP1 expression in gene transcription and translation levels. [score:6]
In addition, we found that miR-144-3p expression were opposite to CASC2, while Aquaporin-1 (AQP1) expression was opposite to miR-144-3p in LPS -induced A549 cell and ALI mice mo del. [score:5]
Meanwhile, the AQP1 mRNA and protein expression levels were significantly increased in miR-144-3p inhibitor -transfected A549 cells. [score:5]
MiR-144-3p was a tumor suppressive miRNA in many cancer cells [13, 14], while the expression and the role of miR-144-3p in LPS -induced ALI and lung epithelial cells has not been reported. [score:5]
The CASC2 expression was obviously increased, while the miR-144-3p expression was obviously decreased in lung tissues of pcDNA-CASC2 -injected mice (Fig.   8b, c). [score:5]
Previous study showed that the miR-144-3p expression was increased in A549 cell, and miR-144-3p mimic suppressed cell proliferation [22]. [score:5]
Under LPS induced environment, transfection of pcDNA-CASC2 increased AQP1 mRNA expression level, while co-transfection of pcDNA-CASC2 and miR-144-3p mimic reversed the increased AQP1 mRNA expression level. [score:5]
These data suggested that, ALI mice had an increased CASC2 and AQP1 expression, and a decreased miR-144-3p expression. [score:5]
Then the miR-144-3p mimic/inhibitor and their respective control were transfected into AQP1 -overexpressing A549 cells, respectively. [score:5]
Moreover, CASC2 regulated A549 cell apoptosis through regulating miR-144-3p and its target, AQP1. [score:5]
As Fig.   6b showed that the miR-144-3p inhibitor co -transfected with pcDNA-WT-AQP1 or pcDNA-MUT-AQP1, and the result showed that the miR-144-3p inhibitor enhanced the luciferase activity in WT-AQP1 -transfected A549 cell, while have no impact in pcDNA-MUT-AQP1 -transfected A549 cell. [score:5]
The caspase-3 expression in Fig.   7b further revealed that LPS induced A549 cell apoptosis through regulating CASC2/miR-144-3p/AQP1 axis. [score:4]
Fig.  5CASC2 controlled AQP1 expression by regulating miR-144-3p. [score:4]
In this study, the miR-144-3p expression was opposite to AQP1 expression in LPS -induced ALI mice lung tissue and lung epithelial cell (Figs.   1b and 2b), and the luciferase reporter assay revealed that (Fig.   6). [score:4]
CASC2 controlled AQP1 expression by regulating miR-144-3p. [score:4]
Additionally, mechanism analysis revealed that CASC2 might function as a ceRNA to regulate AQP1 expression by sponging miR-144-3p, thus affecting LPS -induced lung epithelial cell apoptosis and playing a critical role in the pathobiology of ALI. [score:4]
These data suggested that CASC2 regulated AQP1 mRNA and protein expression via miR-144-3p. [score:4]
While the miR-144-3p expression was obviously increased in lung tissue of ALI mice, which was opposite to CASC2 (Fig.   1b). [score:3]
In summary, the expression of CASC2 was decreased, while miR-144-3p was increased in LPS -induced ALI mice and lung epithelial cell. [score:3]
AQP1 was a target of miR-144-3p. [score:3]
b The pcDNA-CASC2 transfection reversed the LPS-increased miR-144-3p expression in A549 cell. [score:3]
The miR-144-3p expression was significantly increased in LPS -induced A549 cell, which was opposite to CASC2 (Fig.   2b). [score:3]
At last, the RT-PCR showed that miR-144-3p expression was significantly increased in CASC2 drop-down compound (Fig.   4d) which further suggested that CASC2 functioned as a miR-144-3p decoy in A549 cells. [score:3]
b The miR-144-3p expression was significantly increased in LPS -induced A549. [score:3]
In addition, bioinformatics software predicted AQP1 was one of the putative target genes of miR-144-3p. [score:3]
d The increased CASC2 mRNA and protein expression in lung tissues of Lv-CASC2 -injected mice To investigate the expression of CASC2, miR-144-3p and AQP1 in ALI, the ALI mice mo del was built by intratracheally instilling with LPS. [score:3]
a The inhibited cell apoptosis by pcDNA-CASC2 was reversed by miR-144-3p mimic, while which was reversed again by pcDNA-AQP1. [score:3]
Fig.  6AQP1 was a target of miR-144-3p in A549 cell. [score:3]
b The miR-144-3p inhibitor enhanced the luciferase activity in WT-AQP1 -transfected A549 cell, while have no impact in MUT-AQP1 -transfected A549 cell. [score:3]
In addition, the CASC2, miR-144-3p and AQP1 expression in lung tissues were also analyzed by RT-qPCR and western blot. [score:3]
d The miR-144-3p expression was significantly higher in CASC2 pull-down compound. [score:3]
In the present study, we found that miR-144-3p expression was increased in LPS -induced ALI mice lung tissue and A549 cell, and miR-144-3p mimic promoted cell apoptosis. [score:3]
c The decreased miR-144-3p expression in lung tissues of Lv-CASC2 -injected mice. [score:3]
Finally, the A549 cell co -transfected with pcDNA-CASC2 and miR-144-3p mimic and then induced by LPS, and the results showed that AQP1 mRNA expression level was lower than that in A549 cell co -transfected with pcDNA-CASC2 and pre-NC. [score:3]
b The miR-144-3p expression was significantly increased in ALI mice. [score:3]
Meanwhile, the AQP1 mRNA and protein expression levels were significantly decreased in miR-144-3p mimic -transfected A549 cells. [score:3]
A549 cell proteins were mixed with biotin-labeled lncRNA-CASC2 RNAs incubated at 4 °C for 1 h. The streptavidin agarose beads (Invitrogen) were added to each binding reaction and incubated at room temperature for 1 h. Western blot was performed to detect AGO2, and the three group of precipitates were used for detecting miR-144-3p expression by RT-PCR according to the standard procedures. [score:3]
The AQP1 mRNA and protein expression were both decreased which was opposite to miR-144-3p in LPS -induced A549 cell (Fig. 2c). [score:3]
Meanwhile, the AQP1 mRNA and protein expression levels were significantly decreased in miR-144-3p mimic -transfected A549 cells (Fig.   6c). [score:3]
Thus, this study raised a question regarding whether miR-144-3p participated in LPS -induced ALI and lung epithelial cells apoptosis by regulating AQP1. [score:2]
Fig.  7LPS induced A549 cell apoptosis by regulating CASC2/miR-144-3p/AQP1 axis. [score:2]
Further experiments were conducted to investigate the biological regulation function of CASC2 with respect to the miR-144-3p and AQP1 expression and cell apoptosis. [score:2]
The pcDNA-CASC2 transfection reversed LPS -induced cell apoptosis, miR-144-3p mimic again reversed pcDNA-CASC2-reduced cell apoptosis, and pcDNA-AQP1 reversed again the effect of pcDNA-CASC2 combined miR-144-3p mimic on cell apoptosis, which implied LPS induced A549 cell apoptosis through regulating CASC2/miR-144-3p/AQP1 axis. [score:2]
LPS induced A549 cell apoptosis by regulating CASC2/miR-144-3p/AQP1 axis. [score:2]
Thus, miR-144-3p participated in LPS -induced ALI and lung epithelial cells apoptosis by regulating AQP1. [score:2]
Thus, we speculated that CASC2 might be involved in ALI by regulating miR-144-3p/AQP1 axis to affect lung epithelial cell apoptosis. [score:2]
A mutant 3′UTR fragment of AQP1 which the mutations was in conserved binding sites for miR-144-3p, was also generated. [score:2]
The Taqman microRNA Reverse Transcription Kit and Taqman Universal Master Mix II with the TaqMan MicroRNA Assay of miRNAs (Applied Biosystems, Foster City, USA) were used for testing the miR-144-3P expression level. [score:2]
MiR-144-3p inhibitor/mimic, pcDNA-CASC2 and their respective negative control/vector was transfected or co -transfected into A549 cells by Lipofectamine 2000 according to the instructions. [score:2]
Long non-coding RNA CASC2 improved acute lung injury by regulating miR-144-3p/AQP1 axis to reduce lung epithelial cell apoptosis. [score:2]
a Prediction of miR-144-3p binding sites on the CASC2 transcript. [score:1]
CASC2 functioned as a decoy for miR-144-3p in A549 cell. [score:1]
b CASC2 and miR-144-3p were both existed in AGO2 antibody coprecipitates. [score:1]
Bioinformatics software predicted that there were binding sites between CASC2 and miR-144-3p. [score:1]
c The miR-144-3p mimic reduced the luciferase activity in WT-AQP1 -transfected A549 cell, while have no impact in MUT-AQP1 -transfected A549 cell. [score:1]
As Fig.   4a displayed that the predicted positions of miR-144-3p binding sites on the CASC2 transcript, and then RNA immunoprecipitation and RNA pull-down were used to demonstrate their relationship. [score:1]
As showed in Fig.   7, pcDNA-CASC2 transfection reversed LPS -induced cell apoptosis, while miR-144-3p mimic reversed pcDNA-CASC2-reduced cell apoptosis. [score:1]
In addition, the AQP1 mRNA and protein were both reduced in lung tissue of ALI mice, which was opposite to miR-144-3p (Fig.   1c). [score:1]
In addition, pcDNA-AQP1 reversed again the effect of pcDNA-CASC2 combined miR-144-3p mimic on cell apoptosis. [score:1]
The 3′UTR of AQP1 including conserved binding sites for miR-144-3p was amplified from human cDNA by PCR. [score:1]
Fig.  4CASC2 functions as a miR-144-3p decoy. [score:1]
Further, we found that pcDNA-AQP1 reversed the effect of miR-144-3p mimic on cell apoptosis. [score:1]
To investigate the expression of CASC2, miR-144-3p and AQP1 in ALI, the ALI mice mo del was built by intratracheally instilling with LPS. [score:1]
As shown in Fig.   4b, the CASC2 and miR-144-3p were both existed and obviously increased in AGO2 antibody coprecipitates, which suggested that both of CASC2 and miR-144-3p could bind to AGO2 protein. [score:1]
The AGO2 was detected by immunoprecipitation-western, and RT-qPCR detected CASC2 and miR-144-3p in the precipitates. [score:1]
In addition, the miR-144-3p mimic reduced the luciferase activity in WT- AQP1 -transfected A549 cell, while have no impact in pcDNA-MUT-AQP1- transfected A549 cell. [score:1]
The A549 cell was transfected or co -transfected of pcDNA-CASC2, miR-144-3p mimic and pcDNA-AQP1 and induced by LPS. [score:1]
a According to the predicted binding site of miR-144-3p in AQP1 transcript, we constructed a mutant plasmid of AQP1. [score:1]
[1 to 20 of 72 sentences]
7
[+] score: 184
As Figure 2(a) has shown, transfection with agomiR-144 significantly upregulated miR-144-5p expression in A549 and H460 cells compared with those of cells transfected with agomiR-NC, whereas transfection of agomiR-NC has no effects on the expression of miR-144-5p. [score:7]
In addition, miR-144-5p expression was downregulated in NSCLC A549, H460, and H2170 cells, compared to normal human airway epithelial 16-HBE cells; whereas miR-144-5p expression was lower in AC A549 and H460 cells than in SCLC H1417 cells (Figure 1(b)). [score:7]
In agreement with these previous studies, we observed that upregulation of miR-144-5p could enhance the radiation -mediated viability inhibition, apoptosis, and growth arrest in NSCLC cells both in vitro and in vivo. [score:6]
In addition, Matsushita et al. [31] have reported that downregulation of the miR-144-3p and miR-144-5p cluster is frequently observed in bladder cancer cells and that miR-144-5p restoration significantly inhibits cancer cell proliferation by inducing cell cycle arrest. [score:6]
In conclusion, our study demonstrated that miR-144-5p expression was downregulated in NSCLC specimens and cell lines. [score:6]
It is well documented that miR-144-3p is downregulated and serves as a tumor suppressor in a variety of tumors, including lung cancer [23], gastric cancer [24], breast cancer [25], pancreatic cancer [26], and hepatocellular carcinoma [27]. [score:6]
Further analysis of the expression of ATF2 mRNA in clinical samples revealed that the level of ATF2 mRNA was lower in normal lung tissues than in lung cancer tissues (Figure 4(d)) and that ATF2 expression was inversely correlated with the miR-144-5p levels (Figure 4(e)). [score:5]
miR-144-5p robustly suppressed ATF2 mRNA and protein expression in NSCLC cells. [score:5]
To explore the underlying mechanism by which miR-144-5p enhances the effects of IR in lung cancer cells, we searched for the targets of miR-144-5p with the help of TargetScan, an online database (http://www. [score:5]
In addition, restoration of ATF2 significantly inhibited miR-144 -mediated suppression of the tumor volume (Figure 5(d)) and weight (Figure 5(e)) in A549 cell xenograft mice exposed to IR. [score:5]
3.3. miR-144-5p Enhances IR-Induced Tumor Suppression In Vitro and In VivoThe above results indicated that restoration of miR-144-5p expression enhanced radiation -induced proliferation arrest and apoptosis in lung cancer cells. [score:5]
Furthermore, overexpression of ATF2 could reverse miR-144-5p -induced cell viability inhibition, apoptosis, and growth arrest in combination with IR. [score:5]
Potential targets of miR-144-5p were searched with TargetScan (http://www. [score:5]
IR treatment further decreased miR-144-5p expression in NSCLC cells and restoration of miR-144-5p sensitized cells to IR in vitro and in vivo via inhibition of ATF2. [score:5]
For its key role in regulating radiosensitivity of tumor cells [14– 16], ATF2 was selected as the potential target of miR-144-5p in present study. [score:4]
In our study, ATF2 was validated to be the direct target of miR-144-5p. [score:4]
In line with previous studies, our study suggests that downregulation of ATF2 is at least partially responsible for the miR-144-5p -mediated increase in radiosensitivity of NSCLC cells. [score:4]
We found that miR-144-5p was downregulated in clinical NSCLC tissues and decreased in NSCLC cells after irradiation (IR). [score:4]
Moreover, we identified activating transcription factor 2 (ATF2) as the direct target of miR-144-5p, which is involved in the radiosensitivity of NSCLC. [score:4]
Intriguingly, we are the first to show that miR-144-5p was downregulated in NSCLC cells in response to IR, in a dose -dependent manner. [score:4]
3.4. miR-144-5p Targets ATF2 in Lung Cancer Cells. [score:3]
The results demonstrated that miR-144-5p inhibited the luciferase activity in hsa-ATF2-wt but not hsa-ATF2-mut (Figure 4(b)), while agomir-NC had little effect on both plasmids. [score:3]
The Expression of miR-144-5p in Lung Cancer Tissues and A549 Cells Treated with IR. [score:3]
Our findings suggest that miR-144-5p is not only a suitable biomarker for radiotherapeutic response, but it is a potential target in sensitizing radiotherapy in NSCLC. [score:3]
To explore the mechanism underlying miR-144-5p -mediated radiosensitivity in NSCLC, we identified ATF2 as a target of miR-144-5p containing the putative miRNA response element within its 3′UTR. [score:3]
We further analyzed the relative expression levels of miR-144-5p in A549 and H460 cells treated with IR. [score:3]
Furthermore, as shown in Figure 3(c), miR-144-5p overexpression significantly decreased the tumor weights of the xenograft mo del mice treated with IR. [score:3]
We first detected the expression of miR-144-5p in lung AC, lung SC, and SCLC. [score:3]
It has been reported that miR-144-5p expression could be used as a prognostic biomarker for esophageal carcinoma [28], gastric cancer [29], and breast cancer [30]. [score:3]
In order to verify ATF2 as a target of miR-144-5p, the luciferase reporter vector pCMV-REPORT-ATF2-3′UTR-wt was constructed by inserting the pCMV-REPORT vector with the DNA sequence of ATF2 3′UTR containing a putative miR-144-5p -binding site (ACUAUAG). [score:3]
IR decreased the expression of miR-144-5p in A549 (Figure 1(c)) as well as in H460 (Figure 1(d)) cells in a dose -dependent manner. [score:3]
As shown in Figure 1(a), the expression of miR-144-5p in the specimens of AC and SC, but not SCLC, was significantly lower than that of normal lung tissue (NLT). [score:3]
3.3. miR-144-5p Enhances IR-Induced Tumor Suppression In Vitro and In Vivo. [score:3]
Our results suggest that targeting the miR-144-5p/ATF2 pathway is an effective strategy to sensitize NSCLC to radiation. [score:3]
org/), revealing that ATF2 is a target of miR-144-5p. [score:3]
Subsequent analysis verified that miR-144-5p expression was negatively related to ATF2 abundance in lung cancer and normal lung tissues. [score:3]
A previous study has indicated that the expression of miR-144-5p, miR-144-3p, miR-142-5p, and miR-19a-3p in whole blood extends the lifespan of rats for 2 weeks after radiation [13]. [score:3]
Moreover, the expression of miR-144-5p in AC and NSCLC cell lines was also significantly lower than in SCLC and SCLC cell lines. [score:3]
Interestingly, miR-144-5p expression in AC was significantly lower than in SCLC. [score:3]
Enforced overexpression of miR-144-5p enhanced the radiosensitivity of A549 and H460 cells in vitro and in vivo. [score:3]
Our findings suggest that the miR-144-5p/ATF2 axis may serve as a potential target for the treatment of NSCLC. [score:3]
The above results indicated that restoration of miR-144-5p expression enhanced radiation -induced proliferation arrest and apoptosis in lung cancer cells. [score:3]
Our findings suggest that the deregulation of miR-144-5p might contribute to the difference of radiosensitivity among various subtypes of lung cancers. [score:2]
The colony formation assay showed that miR-144-5p overexpression decreased the number of the colonies in A549 and H460 cells treated with IR (Figure 3(a)). [score:2]
In the present study, we found that miR-144-5p expression was decreased in AC and SC, but not in SCLC, compared to normal lung tissues. [score:2]
To explore the role of miR-144-5p in A549 and H460 cells treated with IR, cells were transfected with agomiR-144 or agomir-NC, followed by treatment with different doses of IR. [score:1]
To assess the role of ATF2 in miR-144-5p -mediated radiosensitivity of lung cancer cells, the radiosensitivity of NSCLC cells after restoration of ATF2 was measured in miR-144-5p -overexpressing cells. [score:1]
However, little is known about the role of miR-144-5p in modifying the radiosensitivity of lung cancer cells. [score:1]
3.2. miR-144-5p Enhances IR-Mediated Loss of Cell Viability and Induction of Apoptosis in Lung Cancer Cells. [score:1]
The control luciferase vector pCMV-REPORT-ATF2-3′UTR-mut, harboring the mutant miR-144-5p binding site (UG CGCGA), was also constructed. [score:1]
Further apoptosis analysis with annexin V/propidium iodide staining showed that IR at a dose of 8 Gy induced apoptosis in nearly 20% of cells, whereas miR-144-5p significantly enhanced the proapoptotic effects of IR on A549 and H460 cells (Figure 2(c)). [score:1]
Nevertheless, the function of miR-144-5p, the guide strand from pre-miR-144, is largely unknown. [score:1]
There is an 8-mer miR-144-5p binding site located in the 3′UTR of ATF2 (Figure 4(a)). [score:1]
org/) and found that 2078 transcripts including ATF2 mRNA contain miR-144-5p seed sequences. [score:1]
Restoration of ATF2 Prevents miR-144-5p-Mediated Radiosensitivity of Lung Cancer Cells. [score:1]
[1 to 20 of 55 sentences]
8
[+] score: 176
The miR-144-3p mimic or agomir induced significant upregulation of different types of cholesterol at the cellular level and downregulated HDL-C in the body, indicating a critical role of miR-144-3p in the complex homeostatic network in cholesterol metabolism. [score:7]
Data from the current study showed that miR-144-3p mimics (agomir) suppress the expression of ABCA1 and enhance inflammatory factors, both in vitro and in vivo, inhibit cholesterol efflux in THP-1 macrophage-derived foam cells and impair RCT in apoE [−/−] mice fed a high-fat diet (HFD), leading to accelerated pathological progression of atherosclerosis in experimental mice. [score:7]
Notably, miR-144-3p agomir downregulated ABCA1 protein expression in liver, aorta and small intestine (Fig. 3B). [score:6]
0094997.g001 Figure 1(A) hsa-miR-144-3p directly targeted the 3′-untranslated region (3′UTR) of ABCA1. [score:6]
Mutation of binding site 1 or 2 markedly suppressed the effect of hsa-miR-144-3p, while mutation of both binding sites completely reversed the effect of hsa-miR-144-3p. [score:5]
MiR-144-3p may bind to partially complementary sequences in the 3′UTRs of human ABCA1 and downregulate expression. [score:5]
Moreover, miR-144-3p mimics (agomir) enhanced the expression of inflammatory factors, including IL-1β, IL-6 and TNF-α, in vivo and in vitro, inhibited cholesterol efflux in THP-1 macrophage-derived foam cells, decreased HDL-C circulation and impaired RCT in vivo, resulting in accelerated pathological progression of atherosclerosis in apoE [−/−] mice. [score:5]
In addition, miR-144-3p agomir suppressed ABCA1 protein expression in liver, aorta and small intestine in apoE [−/−] mice fed a HFD, and induced a dramatic decrease in RCT to serum, liver and feces. [score:5]
As a result of miR-144-3p mimic or agomir treatment, expression levels of ABCA1 in cultured cells or experimental mice were remarkably inhibited in our study. [score:5]
ABCA1 was identified as a potential target of miR-144-3p, based on the results of bioinformatic analysis and the luciferase reporter assay, and downregulated after transfection of cells with miR-144-3p mimics, as observed with real-time PCR and western blot. [score:5]
Here, we identified a putative miRNA, designated miR-144-3p, which targets human ABCA1, utilizing a combination of TargetScan, miRanda, RNA22, miRDB, miRGen, PITA, EMBL-EBI, starBase, PicTar, RNAhybrid and miRBase. [score:5]
Studies on cultural cells and animal mo dels have shown that treatment of THP-1 macrophage-derived foam cells with miR-144-3p mimics upregulates total cholesterol, free cholesterol and the cholesterol ester content in cells. [score:4]
Treatment of apoE [−/−] mice fed a HFD with the miR-144-3p agomir resulted in significant upregulation of plasma TNF-α, IL-1β and IL-6 by 54.3%, 45.6% and 68.4%, respectively (Table 3), consistent with in vitro findings. [score:4]
Our findings clearly indicate that miR-144-3p is essential for the regulation of cholesterol homeostasis and inflammatory reactions, supporting its utility as a potential therapeutic target of atherosclerosis and a promising diagnostic biomarker of AMI. [score:4]
Interestingly, RCT to serum was downregulated by miR-144-3p agomir in a time -dependent manner (Fig. 2A). [score:4]
3. Effect of miR-144-3p agomir on pathological progress of atherosclerosis in apoE [−/−] miceAtherosclerosis is a progressive disease, and clinical events are usually associated with rupture or erosion of the plaque [20]. [score:3]
In the present study, we identified a putative miRNA, miR-144-3p, which targets 3′UTRs of human ABCA1 and causes post-transcriptional repression. [score:3]
We analyzed the expression levels of miR-144-3p in AMI patients after the onset of symptoms and healthy adults at the time-points of 4 h, 8 h, 12 h, 24 h, 48 h, 72 h and 1 week, respectively, as shown in Table 6. Patients with AMI exhibited a 2.16 (±0.12)-fold, 13.52 (±3.87)-fold and 4.38 (±1.53)-fold increase in serum miR-144-3p at 4, 8 and 12 h, respectively. [score:3]
Human ABCA1 cDNA containing putative (wild-type) and mutated target sites for hsa-miR-144-3p was chemically synthesized, and inserted into pMIR-REPORT vector (Ambion, Austin, TX, USA). [score:3]
Additionally, the serum miR-144-3p level was elevated within 4 h, reached a peak at 8 h, and was suppressed within 12 h after the onset of chest pain. [score:3]
Accordingly, we transfected THP-1 macrophages and human primary macrophages with miR-144-3p mimics or negative control to establish the effect of miR-144-3p on ABCA1 expression. [score:3]
2. Effects of miR-144-3p agomir on RCT and inflammation in vivo A combination of genetic and dietary manipulation results in extensive atherosclerotic disease in mice, which has many features in common with human lesions [19]. [score:3]
In conclusion, our study supports the significance of miR-144-3p as a promising therapeutic target for atherosclerosis and potential candidate biomarker of AMI. [score:3]
1. Effects of miR-144-3p on ABCA1 expression, cholesterol homeostasis, and inflammation in THP-1 macrophages. [score:3]
Effects of miR-144-3p on ABCA1 expression, cholesterol homeostasis and inflammation. [score:3]
These findings collectively suggest that miR-144-3p may be effectively used as a potential therapeutic target of atherosclerosis and promising diagnostic biomarker of AMI. [score:3]
Our results showed that miR-144-3p mimics significantly suppress the ABCA1 mRNA and protein levels in the two cell mo dels (Fig. 1B). [score:3]
U6 RNA expression was used as the endogenous control for analysis of miR-144-3p from cells and tissues. [score:3]
Mir-144-3p targeting ABCA1, the doorkeeper of RCT, resulted in impaired cholesterol efflux and boosted inflammatory response, which effectively accelerated the occurrence and progression of atherosclerosis in apoE [−/−] mice fed HFD. [score:2]
0094997.g003 Figure 3Effects of miR-144-3p on atherosclerosis initiation and development in apoE [−/−] mice. [score:2]
Since elevated levels of serum cholesterol are probably unique in being sufficient to drive the development of atherosclerosis in humans, we aimed to identify whether miR-144-3p agomir affects the lipid parameters in apoE [−/−] mice administered HFD. [score:2]
Effects of miR-144-3p on atherosclerosis initiation and development in apoE [−/−] mice. [score:2]
The miR-144-3p mimic/agomir induced a dramatic increase in the relative levels of types of inflammatory factors levels, both in vitro and in vivo, confirming its pro-inflammatory property, and therefore, activity as a potent negative regulator of CVD. [score:2]
Effects of mir-144-3p agomir on plasma cytokine levels in apoE [−/−] mice. [score:1]
Effects of mir-144-3p agomir on hepatic lipid deposition in apoE [−/−] mice. [score:1]
Treatment of THP-1 macrophage-derived foam cells with miR-144-3p mimics increased inflammatory cytokine levels, including those of TNF-α, IL-1β and IL-6. Similarly, the plasma concentrations of TNF-α, IL-1β and IL-6 in apoE [−/−] mice fed HFD were dramatically enhanced upon treatment with miR-144-3p agomir. [score:1]
Notably, following treatment with miR-144-3p mimics, secretion of inflammatory cytokines, including TNF-α, IL-1β and IL-6, into culture medium was dramatically increased (Fig. 1E). [score:1]
Our data collectively indicate that treatment with miR-144-3p mimics or agomir promotes pro-inflammatory cytokine production, both in vivo and in vitro. [score:1]
THP-1 macrophages were transfected with 50 nM miRNA mimic (hsa-miR-144-3p, UACAGUAUAGAUGAUGUACU) using Lipofectamine 2000 transfection reagent for 48 h, according to the manufacturer's instructions. [score:1]
The serum miR-144-3p concentration was negatively correlated with serum HDL levels, and positively correlated with serum glucose concentrations in all subjects. [score:1]
These findings clearly indicate a negative effect of miR-144-3p agomir in atherosclerotic lesions of apoE [−/−] mice. [score:1]
In the present study, we found that serum miR-144-3p levels were markedly increased in AMI patients after the onset of symptoms and revealed a positive correlation of circulating miR-144-3p with serum CK, CK-MB, LDH and AST in subjects with AMI. [score:1]
Therefore, we investigated the effects of miR-144-3p mimics on inflammatory factor expression in THP-1 macrophage-derived foam cells. [score:1]
Control group (n = 10) Mir-144-3p group (n = 10) TG (mmol/L) 1.41±0.39 1.47±0.42 TC (mmol/L) 27.37±3.35 24.13±3.15* HDL-C (mmol/L) 7.23±1.69 5.37±1.59* LDL-C (mmol/L) 14.32±2.21 13.62±2.05 VLDL-C (mmol/L) 5.82±1.29 5.13±1.36 ApoA1 (g/L) 0.06±0.03 0.06±0.02 ApoB (g/L) 0.16±0.04 0.17±0.03Data are expressed as mean ± S. D. The data were compared using the unpaired Student's t-test. [score:1]
Upon co-transfection of 293T cells with wild-type (pMIR-ABCA1-wt) reporter vectors and hsa-miR-144-3p using Lipofectamine 2000 transfection reagent, luciferase activity was significantly decreased. [score:1]
Our results showed that a miR-144-3p agomir effectively accelerates atheromatous plaque formation in apoE [−/−] mice by simultaneously impairing RCT and promoting pro-inflammatory cytokine production. [score:1]
Since liver, small intestine and aorta are the most ABCA1-rich organs, we further explored the effect of miR-144-3p agomir on ABCA1 protein levels in apoE [−/−] mice. [score:1]
The ROC curve of mir-144-3p revealed a moderate ability to distinguish between the AMI and the healthy control group at 4, 8 and 12 h, with AUC values of 0.81, 0.86, and 0.83, respectively. [score:1]
Oil Red O staining results additionally disclosed that the miR-144-3p agomir significantly accelerates hepatic lipid deposition in apoE [−/−] mice. [score:1]
These results collectively imply that miR-144-3p plays critical roles in the pathophysiological processes of AMI, and circulating miR-144-3p may serve as a promising biomarker for AMI diagnosis. [score:1]
Control group (n = 10) Mir-144-3p group (n = 10) TC (mg/g tissue) 11.56±2.35 14.68±2.79* TG (mg/g tissue) 19.43±2.32 20.57±2.16Data are expressed as mean ± S. D. The data were compared using the unpaired Student's t-test. [score:1]
In addition, treatment of apoE [−/−] mice with miR-144-3p agomir resulted in increased macrophage infiltration in lesions. [score:1]
Mice were randomized into two groups (Control and miR-144-3p agomir, n = 20/group) and injected via the tail vein with either a scrambled miRNA agomir (GuangZhou RiboBio. [score:1]
To further establish the negative effects of miR-144-3p agomir on atherosclerosis, Oil Red O-stained lesions in en face preparations of aortas were quantified. [score:1]
Consistently, treatment of apoE [−/−] mice with miR-144-3p agomir resulted in both impairment of RCT and dramatic decrease in HDL-C in our experiments. [score:1]
As shown in Fig. 1A, human ABCA1 mRNA contains two putative complementary sequences to miR-144-3p. [score:1]
3. Effect of miR-144-3p agomir on pathological progress of atherosclerosis in apoE [−/−] mice. [score:1]
Clinical studies additionally revealed a positive correlation of circulating miR-144-3p with serum CK, CK-MB, LDH and AST in subjects with AMI. [score:1]
Clinical studies additionally revealed a significant association between circulating miR-144-3p and acute myocardial infarction (AMI). [score:1]
Next, we explored the effects of miR-144-3p agomir on RCT efficiency in experimental mice. [score:1]
Thus, whether miR-144-3p may contribute to increased risk of cardiovascular disease in diabetics and the underlying mechanism should to be further investigated. [score:1]
Effects of mir-144-3p agomir on plasma lipid and lipoprotein values in apoE [−/−] mice. [score:1]
Moreover, serum mir-144-3p was negatively correlated with serum HDL and positively correlated with serum glucose concentrations in all subjects. [score:1]
Representative images of randomly selected sections of liver stained for H&E and and Oil Red O in the control and miR-144-3p agomir groups are shown in Fig. 2B. [score:1]
mir-144-3p was detected with the All-in-One miRNA qPCR Kit (GeneCopoeia, Rockville, MD, USA) in a 20 µL reaction volume, using the manufacturer's protocol. [score:1]
In the present study, treatment of THP-1 macrophages with miR-144-3p mimics resulted in a marked decrease in cholesterol efflux to both apoAI and HDL. [score:1]
Here, we reported that the miR-144-3p agomir dramatically accelerates the progress of atheroma in apoE [−/−] mice by simultaneously increasing the CD68+ cell content in plaque areas and promoting pro-inflammatory cytokine production in plasma. [score:1]
Thus, the plasma concentrations of miR-144-3p showed a significant correlation with those of CK, CK-MB and LDH, a series of classic markers of myocardial injury. [score:1]
4. Circulating miR-144-3p is associated with acute myocardial infarction. [score:1]
mir-144-3p [levels] in human AMI patients and healthy adults. [score:1]
In addition, serum miR-144-3p was positively correlated with serum creatine kinase (CK), creatine kinase-MB fraction (CK-MB), lactate dehydrogenase (LDH) and aspartate aminotransferase concentrations in subjects with AMI. [score:1]
The ability of miR-144-3p to distinguish between the AMI and control groups was observed from the ROC curves, with AUC values of 0.81, 0.86 and 0.83, respectively. [score:1]
2. Effects of miR-144-3p agomir on RCT and inflammation in vivo. [score:1]
Control group (n = 10) Mir-144-3p group (n = 10) IL-1β (pg/mL) 17.63±3.98 25.71±6.69 * IL-6 (pg/mL) 86.27±9.63 145.31±19.66* TNF-α (pg/mL) 15.26±5.29 23.56±7.89*Data are expressed as mean ± S. D. The data were compared using the unpaired Student's t-test. [score:1]
Additionally, total cholesterol, free cholesterol and cholesterol ester levels in THP-1 macrophage-derived foam cells were significantly increased as a result of treatment with miR-144-3p mimics (Fig. 1D). [score:1]
or miRNA analog (agomir) of mir-144-3p (GuangZhou RiboBio. [score:1]
Effects of miR-144-3p on RCT and hepatic lipid deposition. [score:1]
As shown in Table 1, the levels of total cholesterol and HDL-C were markedly decreased in miR-144-3p agomir -treated mice, while changes in apoAI, apoB, LDL-C and VLDL-C concentrations were not statistically significant. [score:1]
As shown, treatment of apoE [−/−] mice fed a HFD with miR-144-3p agomir resulted in a dramatic decrease in RCT to serum, liver and feces. [score:1]
Cells were resuspended in ice-cold DMEM, and an aliquot (3×10 [6] cells) injected subcutaneously into individually housed mice treated with either scrambled miRNA agomir or miRNA analog (agomir) of miR-144-3p for 12 weeks, as described above. [score:1]
The absolute amount of mir-144-3p was calculated with software based on sample qRT-PCR numbers and the standard curve, and expressed as pmol/L. [score:1]
Therefore, we subsequently analyzed the effects of miR-144-3p agomir on morphology and lipid content in the liver of apoE [−/−] mice with hematoxylin and eosin (H&E) staining and Oil Red O staining, respectively. [score:1]
Moreover, the relative efficiency of the RCT pathway is affected by miR-144-3p mimics or agomir treatment. [score:1]
[1 to 20 of 83 sentences]
9
[+] score: 95
In this report, we have demonstrated that (a) DCAMKL-1 siRNA encapsulated in PLGA nanoparticles (siDCAMKL-1 NPs) exhibit significant knockdown of DCAMKL-1 mRNA in HCT116 cells; (b) siDCAMKL-1 NPs are similarly potent or more than free liposomal encapsulated siDCAMKL-1 in the ability to down-regulate tumorigenesis, pro-proliferative and oncogenic factors such as c-Myc, in tumor xenografts; (c) siDCAMKL-1 NPs are similarly effective in increasing tumor suppressor miRNA let-7a; (d) siDCAMKL-1 NPs are effective in increasing miR-144 and downregulating Notch-1 and (e) siDCAMKL-1 NPs may serve as a useful vehicle for the delivery of anti-cancer therapy via its effects on EMT through its interaction with miR-200a. [score:10]
Taken together, these data strongly suggest that Notch-1 is a downstream target of miR-144 miRNA and that DCAMKL-1 regulates posttranscriptional control of Notch-1. siRNA -mediated knockdown of DCAMKL-1 inhibits Epithelial-to-Mesenchymal Transition via a miR-200a dependent mechanismEpithelial-to-Mesenchymal Transition (EMT) is a phenotypic conversion in fibrotic diseases and neoplasia [33, 34]. [score:9]
The novel putative intestinal and pancreatic stem cell marker DCAMKL-1 [5- 7], a microtubule -associated kinase is upregulated in colorectal and pancreatic cancers and plays a functional role in tumorigenesis through regulation of the tumor suppressor microRNAs (let-7a, miR-200a and miR-144) and their downstream targets such as c-Myc, KRAS, ZEB1, ZEB2 and Notch-1 [8, 9]. [score:9]
Taken together, these data strongly suggest that Notch-1 is a downstream target of miR-144 miRNA and that DCAMKL-1 regulates posttranscriptional control of Notch-1. Epithelial-to-Mesenchymal Transition (EMT) is a phenotypic conversion in fibrotic diseases and neoplasia [33, 34]. [score:6]
miR-144 is a regulator of embryonic alpha-hemoglobin (α- E1), through targeting the 3'-UTR of Krüppel-like factor D gene and positively regulates erythroid differentiation in hematopoietic stem cells [50]. [score:5]
Figure 4Knockdown of DCAMKL-1 and treatment with DAPT downregulates Notch-1 via miR-144. [score:5]
DCAMKL-1 regulates Notch-1 via a miR-144 dependent mechanismUpregulation of Notch receptors and their ligands have been described in several cancers including cervical, lung, colon, head and neck, renal and pancreatic cancer [24- 28]. [score:5]
A statistically significant reduction in luciferase activity was observed following DCAMKL-1 knockdown (Figure 4F), indicating that DCAMKL-1 may be a posttranscriptional regulator of miR-144 miRNA downstream targets in colorectal cancer. [score:5]
Here we report that NP-siDCAMKL-1 upregulates miR-200a, let-7a and miR-144 in the colorectal cancer tumor xenograft mo del. [score:4]
Knockdown of DCAMKL-1 and treatment with DAPT results in increased expression of pri-miR-144 miRNA in tumor xenografts (E) and decreases luciferase activity (luciferase units) following transfection with plasmid-encoding luciferase containing the miR-144 binding site in HCT116 cells. [score:4]
Administration of NP-siDCAMKL-1 into HCT116 xenografts resulted in tumor growth arrest, downregulation of proto-oncogene c-Myc and Notch-1 via let-7a and miR-144 miRNA -dependent mechanisms, respectively. [score:4]
Lastly, DAPT -mediated inhibition of Notch-1 resulted in HCT116 tumor growth arrest and down regulation of Notch-1 via a miR-144 dependent mechanism. [score:4]
Additionally, the Notch-1 downstream effector HES1 mRNA and protein were decreased following treatment of xenografts with NP-siDCAMKL-1. Here for the first time, we report that DCAMKL-1 regulates Notch-1 via a miR-144 dependent mechanism in colorectal cancer. [score:2]
These data suggest that DCAMKL-1 negatively regulates pri-miR-144 miRNA in human colorectal cancer cells. [score:2]
Furthermore, tumors treated with DAPT and NP-siDCAMKL-1+DAPT demonstrated an 8-fold increase in pri-miR-144 miRNA expression compared to control and NP-siSCR -treated tumors. [score:2]
To investigate the role of DCAMKL-1 in regulating Notch-1 via miR-144 miRNA in colorectal cancer, HCT116 tumor xenografts were analyzed for pri-miR-144 miRNA expression by real-time RT-PCR. [score:2]
While the exact mechanism is unknown, we speculate that DAPT may act on DCAMKL-1 directly, resulting in the induction of miR-144. [score:2]
NP -based-DCAMKL-1 knockdown in HCT116 tumor xenografts resulted in a marked decrease in Notch-1 mRNA (50%), which contains a putative predicted binding site for miR-144 in the 3'UTR. [score:2]
Compared to control and NP-siSCR -treated tumors, there was a 3-fold increase in pri-miR-144 miRNA expression in NP-siDCAMKL-1 -treated tumors (Figure 4E). [score:2]
DCAMKL-1 regulates Notch-1 via a miR-144 dependent mechanism. [score:2]
Representation of the putative binding site for miR-144 at 189 [th ]base pair position on Notch-1 mRNA 3'UTR (source: http://WWW. [score:1]
We previously found a predicted binding site for miR-144 in the Notch-1 3' UTR (at the 189 [th ]base pair) (http://www. [score:1]
Given the inhibitory effect of NP-siDCAMKL-1 on Notch, we evaluated the effects of DAPT on miR-144. [score:1]
Surprisingly, we observed an 8-fold increase in miR-144 and a reduction in DCAMKL-1 mRNA following treatment of tumor xenografts with DAPT. [score:1]
Figure S2: Notch-1 mRNA has putative binding site for miR-144. [score:1]
A corresponding reduction in let-7a and miR-144 specific luciferase activity was observed in vitro. [score:1]
The crossing threshold value assessed by real-time PCR was noted for pri-let-7a, pri-miR-144, and pri-miR-200a miRNAs and normalized with U6 pri-miRNA. [score:1]
To measure let-7a and miR-144 expression in vitro, HCT116 cells were transfected with plasmids encoding the firefly luciferase gene with let-7a and miR-144 miRNA binding sites in the 3'UTR. [score:1]
Click here for file Figure S2: Notch-1 mRNA has putative binding site for miR-144. [score:1]
[1 to 20 of 29 sentences]
10
[+] score: 93
In this study we show that miR-144/451 producing retroviruses at very low concentrations can sufficiently suppress the expression of target genes, highlighting that high levels of miRNAs are not necessary for phenotype change of the target cells or tissues. [score:9]
miR-144/451 gene deletion results in elevated 14-3-3ζ level, which sequesters the transcription factor Foxo3 to cytoplasm, thus, the expression of Foxo3 directly-transcribed anti-oxidant genes, catalase (cat) and glutathione peroxidases 1 (gpx1), are dampened. [score:4]
On the other hand they are the most abundantly expressed miRNAs in erythroid cells, and therefore blood contains very high levels of miR-144/151. [score:3]
Furthermore, the increased mature miR-451 molecules in miR-144/451 KO blood enhance the anti-oxidant ability of erythroid cells by suppressing 14-3-3ζ and thus allowing the transcription of two anti-oxidant genes— cat and gpx1. [score:3]
Dietary miR-451 protects against oxidant stress in miR-144/451 KO erythroid cellsAs our laboratory and others have previously demonstrated, the protective role of miR-451 in erythropoiesis is due, at least partially, to its ability to mediate the inhibition of the cytoplasmic adaptor protein 14-3-3ζ [20, 27]. [score:3]
In addition, gavage-feeding miR-144/451 mutant mice with WT blood cells that express abundant miR-144/451 elevates both miR-451 and miR-144 levels in miR-144/451 KO blood. [score:3]
miR-144/451’s expression in white blood cells or any other non-erythroid cell is negligible. [score:3]
Here we use a simple animal mo del, miR-144/451 gene knockout (KO) mice [20], to clearly demonstrate that ingestion of wild type (WT) blood, that contains abundant miR-451 and miR-144, significantly increases the level of miR-451 and miR-144 in the circulation of miR-144/451 mutant mice. [score:2]
200 μl blood per mouse was delivered directly into the miR-144/451 KO mouse stomach via oral gavage feeding using a bulb tipped gastric gavage needle. [score:2]
Another interesting finding in our study is that although miR-144/451 genes have been knocked out, blood in miR-144/451 KO mice fed with regular chow diet still contains low levels of miR-451. [score:2]
Figure 7Exogenous miR-451 existing in miR-144/451 KO mice enhances anti-oxidant activity in vivo via increasing the activity of Foxo3 pathway (A) Bone marrow erythroblasts were fractionated according to the developmental markers Ter119, CD71, and forward scatter (FSC) intensity. [score:2]
This data suggests that exosomes may be the transportation vesicle for miR-144/451 transferring from the GI tract into peripheral blood, or at least, exosomes are used as the transportation vesicles by miR-451 molecules when they are circulating in vascular system. [score:1]
This explains, at least in part, that oral administration of WT blood allows only limited access of miR-451 and miR-144 to the circulation of miR-144/451 KO animals. [score:1]
The strong elevation of miR-144/451 during erythroid differentiation makes miR-144/451 the most abundant miRNAs in mature red blood cells. [score:1]
miR-451 level in miR-144/451 KO blood was used as control. [score:1]
X-axis shows amount of WT blood fed to miR-144/451 KO mice. [score:1]
The degree of the miR-451 increase in miR-144/451 KO blood was dependent on the amount of blood orally received by the miR-144/451 KO mice, and administrating 200-400 μl of blood gave the maximum increase of miR-451 in blood (Figure 1D). [score:1]
This data suggest that miR-451, even at a very low level, can significantly reduce hemolysis of miR-144/451 KO erythroid cells. [score:1]
Moreover, alteration of erythroid phenotypes can be accomplished by either lowering (special chow diet) or by increasing (gavage-feeding WT blood) the miR-451 level in miR-144/451 KO blood. [score:1]
Change of anemic phenotypes of miR-144/451 KO mice after feeding with wild type blood or special chow diet containing much less miR-451. [score:1]
200 μl WT blood was gavage-fed to miR-144/451 KO mice and 6 hours later 100 μl blood per mouse was collected via retro-orbital bleeding. [score:1]
miR-451 level in miR-144/451 KO blood was used as control and assigned a relative value of 1. (C) qRT-PCR analysis of blood miR-451 level in miR-144/451 KO mice after feeding with a special chow diet that contains a very low level of miR-451 (B). [score:1]
However, the color of blood from miR-144/451 KO mice fed with WT blood was somewhat between red and brown (last tube in Figure 6A). [score:1]
Note: the color of miR-144/451 KO blood turned to brown upon exposure to H2O2 (middle tube), however the color of blood from miR-144/451 KO mice with feeding WT blood was somewhat between red and brown (right tube), suggesting less hemolysis with WT blood feeding. [score:1]
Consistent with our previous finding, the C [T] value for miR-144/451 KO exosomes without gavage feeding of WT blood was around 30 (Figure 1G). [score:1]
As shown in Figure 6C, mean corpuscular volume (MCV) of red blood cells in miR-144/451 KO mice was significantly lower than that in WT control at day 0 (Figure 6C), which was consistent with our previous finding that miR-144/451 mutant mice exhibited microcytosis due to the activation of the Cab39/LKB1/AMPK pathway (manuscript submitted). [score:1]
As expected, the sequence for mature miR-451 (blue color) followed by a poly-A sequence (a link sequence for reverse transcription, red color) existed in PCR products (Figure 1E), confirming that the mature miR-451 molecules were in the circulation of miR-144/451 KO mice. [score:1]
This makes our miR-144/451 KO mo del particularly special. [score:1]
Dietary miR-451 protects against oxidant stress in miR-144/451 KO erythroid cells. [score:1]
Ingestion of wild type blood increases the levels of miR-451 and miR-144 in peripheral blood of miR-144/451 null mice. [score:1]
Our previous study shows that miR-451 and miR-144 are encoded by a bicistronic miRNA locus transcriptionally controlled by GATA1, a “master” nuclear factor in erythroid cells [21]. [score:1]
Whereas feeding miR-144/451 KO mice with a chow diet containing less miR-451 reduces the miR-451 level in miR-144/451 KO blood. [score:1]
WT and miR-144/451 KO blood were used as both negative and positive controls. [score:1]
Figure 5Chow diet-derived miR-451 is present in miR-144/451 KO miceAnalysis of (A) C [T] value and (B) relative level of miR-451 in different mouse chow diet. [score:1]
These results confirm that miR-144/451 KO mice still contain miR-451 primarily coming from the mouse chow diet. [score:1]
The Y-axis shows relative levels of miR-451 in miR-144/451 KO blood. [score:1]
Interestingly, there are only several folds more miR-451 in WT urine than miR-144/451 KO urine (Figure 5D–5E), suggesting that miR-144/451 undergo catabolism before clearance by urinary system. [score:1]
The Y-axis shows relative level of miR-451 in miR-144/451 KO blood. [score:1]
miR-144/451 is highly conserved in different species ranging from human to zebra fish [21]. [score:1]
For example, copy number of miR-451 per μl of miR-144/451 KO blood at 30 C [T] = [21415 copies x (100 μl total RT products / 2 μl RT products used for PCR) x (50 μl total RNA from 200 μl blood / 2.5 μl RNA used for RT)]/200 μl blood = 107035 copies/μl. [score:1]
In conclusion, we use a very simple and an easily reproduced animal mo del, the miR-144/451 KO mo del, to show that miR-451 is sufficiently detected in the circulating blood of miR-144/451 KO mice fed with regular chow diet that contains well conserved miR-451. [score:1]
Both qRT-PCR methods, using small nuclear RNA U6 (snRU6, or U6) as internal loading control, showed that the miR-451 level in peripheral blood of miR-144/451 KO mice rapidly climbed after feeding WT blood and reached a peak after 6 hours (Figure 1A-1C). [score:1]
miR-144/451 KO mice lacking of a 388 bp segment of genomic DNA containing the bicistronic miR-144 and miR-451 locus was described in our published work [20]. [score:1]
Figure 2Ingestion of wild type blood from chickens and pigs increases the level of miR-451 in peripheral blood of miR-144/451 KO mice (A) Multispecies nucleotide sequence alignments showing complete conservation of mature miR-451 in mouse, chicken and pig. [score:1]
Reducing miR-451 level in miR-144/451 KO blood, by feeding a special food that contains much less miR-451, accelerates microcytosis. [score:1]
Although the protection was far less than that of the WT control (light blue line in Figure 6B), it still indicates that the elevated miR-451 level in miR-144/451 KO mice helps to protect erythrocytes from oxidant stress induced hemolysis. [score:1]
To examine whether the potentially existent miR-451 in miR-144/451 KO blood was from food uptake, the miR-144/451 KO mice originally fed with a regular chow diet were fed with the special chow diet. [score:1]
In addition, miR-451 can be sufficiently detected in the circulating blood of miR-144/451 KO mice fed with regular mouse chow diet. [score:1]
However, the MCV of miR-144/451 KO mice decreased even more both 20 and 40 days after feeding the mice with a special chow diet (Figure 6C), although there were no significant changes of total red blood cell count (RBC), hemoglobin level (Hb) and hematocrit (HCT) (data not shown), suggesting that a further compensatory hematopoiesis might occur in miR-144/451 KO mice. [score:1]
Ingestion of wild type blood from chickens and pigs increases the level of miR-451 in peripheral blood of miR-144/451 KO mice. [score:1]
miR-451 levels in the urine of miR-144/451 KO mice are similar to the ones in miR-144/451 KO blood (C [T] value around 30). [score:1]
To estimate the copy numbers of mature miR-451 that existed in miR-144/451 KO blood, a standard curve was made using synthetic miR-451 as input ranging from 0.015625 pg/μl (equivalent to 1338 copies) to 4 pg/μl (equivalent to 685280 copies, http://www. [score:1]
Figure 1Ingestion of wild type blood increases the levels of miR-451 and miR-144 in peripheral blood of miR-144/451 null mice (A) Schematic view for the ingestion of WT blood into miR-144/451 KO mice. [score:1]
Ingestion of wild type blood increases the levels of miR-451 and miR-144 in peripheral blood of miR-144/451 null miceOur previous study shows that miR-451 and miR-144 are encoded by a bicistronic miRNA locus transcriptionally controlled by GATA1, a “master” nuclear factor in erythroid cells [21]. [score:1]
Since the average threshold cycle (C [T]) per PCR reaction for miR-144/451 KO blood sample was around 30, we estimated that the copy number of miR-451 in miR-144/451 KO blood before and after gavage feeding of WT blood were 1.07 x 10 [5] copies/μl and 4.28 x 10 [6] copies/μl blood, respectively. [score:1]
In this study we utilize this mouse mo del to show that oral ingestion of WT blood leads to increased miR-451 and miR-144 levels in the circulating blood of miR-144/451 KO mice. [score:1]
Given that miR-451 is highly conserved among different species such as human, mouse and many different types of fishes including zebra fish, we hypothesized that miR-144/451 KO mice might uptake food-derived miR-451. [score:1]
Upon exposure to H [2]O [2], a physiological reactive oxygen species (ROS) precursor, the color of miR-144/451 KO blood turned from red to brown, while the WT control remained red (first two tubes in Figure 6A). [score:1]
To examine whether the PCR signals are from miR-451, PCR products from miR-144/451 KO blood, either before or after gavage feeding of WT blood, were gel-purified, engineered to TA cloning vector and sequenced. [score:1]
To examine whether miR-451 from chickens and pigs, two animals most common in human diets, can go through the mouse digestive system, blood from chicken and pig, either fresh or cooked, were gavage fed to miR-144/451 KO mice. [score:1]
Interestingly, feeding synthetic miR-451 to miR-144/451 KO mice also increased the miR-451 level in miR-144/451 KO blood, but the degree of which miR-451 increased was far less than when fed with WT blood (Supplementary Figure 1A-1B). [score:1]
Flow cytometric analysis showed that the color change reflected the rescued hemolysis of miR-144/451 KO erythrocytes by gavage feeding WT blood (black vs grey lines in Figure 6B). [score:1]
Exogenous miR-451 existing in miR-144/451 KO mice enhances anti-oxidant activity in vivo via increasing the activity of Foxo3 pathway. [score:1]
X-axis shows the time (day) when the blood was drawn after feeding miR-144/451 KO mice with special chow diet. [score:1]
Chow diet-derived miR-451 is present in miR-144/451 KO mice. [score:1]
miR-144/451 KO mice were gavage fed with 200 μl fresh blood from WT animals. [score:1]
We thus hypothesized that the miR-144/451 signals from qRT-PCRs were either background noise or real signals from regular mouse chow diet containing fish powder as supplement. [score:1]
Figure 6Change of anemic phenotypes of miR-144/451 KO mice after feeding with wild type blood or special chow diet containing much less miR-451 (A) Hydrogen peroxide (H2O2) -induced color change of miR-144/451 KO blood with and without feeding with WT blood. [score:1]
[1 to 20 of 68 sentences]
11
[+] score: 84
Luciferase activity assays showed that mutation of miR-144 binding site removed the translational inhibition exerted by miR-144. [score:5]
Two miRNAs (miR-199a-3p and miR-144) that have been shown to interact with versican 3′UTR [24] were hypothesized to inhibit Rb1 translation (SI Figure S4a). [score:5]
Based on the results of Rb1 targeted by miR-144 and miR-199a-3p, it is anticipated that other miRNAs targeting Rb1 could function in the similar fashion. [score:5]
miR-144, which potentially targets Rb1 as indicated above, was also predicted to target PTEN. [score:5]
This suggests direct targeting of Rb1 by miR-144. [score:4]
Rb1 expression is regulated by miR-199a-3p and miR-144. [score:4]
Computational analysis indicated that both miR-199a-3p and miR-144 targeted a cell cycle regulator, Rb1. [score:4]
The target sequences of miR-199a-3p and miR-144 in the Rb1 3′UTR are conserved in human and mice. [score:3]
Targeting of PTEN by miR-144 and miR-136. [score:3]
The potential binding site of miR-144 on Rb1 3′UTR (nucleotide 674-695) was found to be close to the miR-199a-3p target site. [score:3]
Overexpression of versican 3′UTR would attract endogenous miR-199a-3p, miR-144, and miR-136. [score:3]
In addition, miR-144 and miR-136, which have also been shown to interact with versican 3′UTR, was found to target PTEN. [score:3]
We have chosen to focus on the expression of miR-199a-3p and miR-136 because miR-144 is an erythroid lineage-specific miRNA [33]. [score:3]
Besides miR-144 and miR-136, two other miRNAs, miR-16 and let-7 miRNA, could potentially interact with versican 3′UTR and have hypothetical target site on the PTEN mRNA (SI Figure S5b). [score:3]
0013599.g006 Figure 6 Computational analysis showed that miR-199a-3p, miR-144, and miR-136 potentially targeted versican 3′UTR. [score:3]
These results are summarized in Figure 6, and depict schematically that overexpression of versican 3′UTR driven by a CMV promoter could result in binding of miR-144, miR-199a-3p, and miR-136. [score:3]
Rb1 is targeted by miR199a-3p and miR-144. [score:3]
Rb1 was a potential target of miR-144, another miRNA that binds to versican 3′UTR [24]. [score:3]
Luciferase activity of Luc-Pten-144 was repressed by miR-144 but could be restored when the target sequence was mutated (Figure 4d). [score:3]
The expression of miR-199a-3p and miR-136 were detected in both cells and several primary tissues but miR-144 was not found using RealTime-qPCR (results not shown). [score:3]
Computational analysis showed that miR-199a-3p, miR-144, and miR-136 potentially targeted versican 3′UTR. [score:3]
miR-144 and miR-136 repress PTEN translation. [score:3]
The construct harboring the miR-144 target sequence significantly repressed luciferase activity compared with the control vector harboring a nonrelated fragment (Luc-Ctrl) or the mutated construct (Figure 3e). [score:2]
The binding site of miR-144 located within PTEN 3′UTR are conserved between human and mice. [score:1]
The miR-144 binding site in the 3′UTR of PTEN (nucleotides 2906–2925 bp, GeneBank Accession No. [score:1]
Moreover, this miR-144 site is highly conserved in the human and mouse genome (SI Figure S4). [score:1]
U343 cells were co -transfected with miR-144 and the luciferase constructs. [score:1]
This region of Rb1 3′UTR including the potential miR-144 binding site or its mutated version were cloned to generate luciferase constructs. [score:1]
[1 to 20 of 28 sentences]
12
[+] score: 80
We can speculate that high expression of miR-101 observed in the lung samples could contribute to the sustained activation of Erk1/2 (phosphoErk1/2) observed in COPD patients [22] due to lack of dephosphorylation by MKP-1. Regarding miR-144, this miRNA has been found to be elevated in cancer [23]- [25], and was recently identified to be among the top three miRNAs up-regulated in the lung of COPD patients [7]. [score:6]
Taken together, our results indicate that up-regulation of miR-101 and/or miR144 could contribute to the suppression of CFTR observed in COPD patients. [score:6]
The expression of three miRNAs predicted to target CFTR (miR-101, miR-144, and miR-145) was determined. [score:5]
Expression of miR-144 and miR-101 Suppresses CFTR Protein in HBE Cells. [score:5]
Expression of miR-101 and miR-144 decreases expression of CFTR protein. [score:5]
We also determined the role of miR-101 and miR-144 in regulating CFTR expression. [score:4]
Since cadmium is a contaminant of cigarette smoke, it is possible that cadmium present in cigarette smoke was responsible for the up-regulation of miR-101 and miR-144. [score:4]
On the other hand, the fact that both miR-101 and miR-144 target the same region suggests that this 3′UTR region is highly regulated by miRNAs. [score:4]
In order to confirm that miR-101 and miR-144 directly target CFTR, the CFTR 3′UTR was subcloned into the reporter psiCHECK-2 vector. [score:4]
Cigarette Smoke and Cadmium Induce Up-regulation of miR-101 and miR-144. [score:4]
Mature miR-101 and miR-144 could be detected six hours post-transfection and were still highly expressed 48 hours after transfection (Fig. 2B and data not shown). [score:3]
MiR-101 and miR-144 Target CFTR 3′UTR. [score:3]
Similarly, overexpression of miR-144 resulted in ≈30 and 50% decrease in reporter activity when cells were transfected with 30 and 60 nM of pre-miR-144, respectively (Fig. 4). [score:3]
The expression of mature miR-101 and miR-144 was confirmed by quantitative RT-PCR. [score:3]
Since miR-101 and miR-144 are predicted to target the CFTR gene, we evaluated the effect of these miRNAs on the expression of CFTR protein. [score:3]
MiR-101 and miR-144 target the same region of CFTR 3′UTR and share the same seed sequence indicating that these two miRNAs do not act synergistically or additionally. [score:3]
Effect of the air pollutants cigarette smoke and cadmium on expression of miR-101, miR-144, and miR-145. [score:3]
MiR-144 targets 3′UTR of CFTR. [score:2]
Gillen et al. recently reported that CFTR can be regulated by several miRNAs including miRNA-144 but did not observe any effect of miR-101 on CFTR [10]. [score:2]
HEK-293 cells were transfected with 50 ng of psiCHECK-CFTR or psiCHECK empty vector and either scrambled pre-miR, pre-miR-101, or pre-miR-144. [score:1]
Cells were transfected with 50 ng of psiCHECK containing WT or Mut CFTR 3′UTR and either 30 or 60 nM of pre-miR-144. [score:1]
Total RNA was isolated and expression of mature miR-101, miR-144, and miR-145 was measured by quantitative RT-PCR. [score:1]
HBE cells were transfected with 30 nM of pre-miR-101 or pre-miR-144 using Lipofectamine 2000. [score:1]
Both pollutants increased miR-101 and miR-144 but had no effect on miR-145. [score:1]
Exposure of HBE cells to cigarette smoke resulted in ≈80- and 4-fold increases of miR-101 and miR-144, respectively, while cadmium induced miR-101 and miR-144 by ≈40 and 6 fold (Fig. 1). [score:1]
0050837.g004 Figure 4 Cells were transfected with 50 ng of psiCHECK containing WT or Mut CFTR 3′UTR and either 30 or 60 nM of pre-miR-144. [score:1]
0050837.g002 Figure 2 HBE cells were transfected with 30 nM of pre-miR-101 or pre-miR-144 using Lipofectamine 2000. [score:1]
[1 to 20 of 27 sentences]
13
[+] score: 59
Other miRNAs from this paper: mmu-mir-15b, mmu-mir-879, mmu-mir-582
[78] Our study shows that chronic stress via corticosterone upregulates the levels of miRNA-15b-5p, miRNA-144-3p, miRNA-582-5p and miRNA-879-5p as well as downregulates the expression of GAD-67, VGAT and GAT-3 genes and proteins, which impair presynaptic GABA release and uptake. [score:9]
Taken together, our data suggest that GTA-3 is directly targeted by miR-15b-5p and miRNA-879-5p, VGAT is targeted by miRNA-144-3p and miRNA-582-5p, as well as GAD1 is targeted by miRNA-144-3p. [score:8]
In addition, miRNA-15b-5p, miRNA-144-3p, miRNA-582-5p and miRNA-879-5p, which downregulate mRNAs of GAD1, VGAT and GAT-3, respectively, are upregulated (Figures 4 and 5). [score:7]
Thus, CUMS -induced depression is likely caused by a chain reaction of the stress, the upregulated miRNA-15b-5p, miRNA-144-3p, miRNA-582-5p and miRNA-879-5p, the downregulated mRNAs that encode GAD-67, VGAT and GAT-3 as well as the impaired GABA uptake and synthesis (Figure 6). [score:7]
These results suggest that CUMS -induced depression may be caused by the following molecular cascades, the upregulation of miRNA-15b-5p, miRNA-144-3p, miRNA-582-5p and miRNA-879-5p, the downregulation of mRNAs that encode GAD-67, VGAT and GAT-3 as well as the impairment of GABA synthesis, reuptake and release. [score:7]
These results suggest that GAT-3 mRNA is a target of miR-15b-5p and miRNA-879-5p, but not a target of miRNA-144-3p (Figure 5c). [score:5]
GAD1, GAT-3 and VGAT are the direct targets of miRNA-15b-5p, miRNA-144-3p, miRNA-582-5p and miRNA-879-5p. [score:4]
Interestingly, in the validation for miR-144-3p to target GAD1 mRNA, the negative regulation to GAD1 is filled by binding to two sites of GAD1 3′-UTR, which appears to have synergistic effect (Figure 5f). [score:4]
For instance, 3′-UTRs of GAD1 (two areas), VGAT (one area) and GAT-3 (two areas) are targeted by miRNA-144-3p. [score:3]
It is noteworthy that the VGAT suppression disappears while miRNA-144-3p binding site, but not the miRNA-582-5p -binding site, is mutated, indicating the presence of other putative binding sites in 3′-UTR of VGAT. [score:3]
Moreover, the luciferase activity of wild-type reporter for VGAT 3′-UTR is significantly lowered by miRNA-144-3p (Figure 5d) or miRNA-582-5p (Figure 5e). [score:1]
60, 61, 62, 63 In terms of the changes of miRNAs, we paid attention to analyzing miRNA-15b-5p, miRNA-144-3p, miRNA-582-5p and miRNA-879-5p with high-throughput sequencings and qRT-PCR. [score:1]
[1 to 20 of 12 sentences]
14
[+] score: 47
Moreover, CTX significantly changed the expressions of mmu-miR-106b* (down-regulation), mmu-miR-144 (down-regulation), mmu-miR-669k* (down-regulation), mmu-miR-142-3p (up-regulation), mmu-miR-210 (up-regulation) and mmu-miR-223 (up-regulation) in CD34 [+]SCA1 [+] BMHSCs (Figure 3G–3L). [score:21]
To sum up, SHSB granule might cure CTX -induced myelosuppression and increase WBCs via enhancing CD34 [+]SCA1 [+] BMHSCs proliferation (SHSB granule up-regulated the expressions of mmu-miR-106b*, mmu-miR-144 and mmu-miR-669k*, as well as down-regulated the expressions of mmu-miR-142-3p, mmu-miR-210 and mmu-miR-223 in CD34 [+]SCA1 [+] BMHSCs). [score:13]
In addition, mmu-miR-106b* (Figure 3G), mmu-miR-144 (Figure 3H) and mmu-miR-669k* (Figure 3I) in CD34 [+]SCA1 [+] BMHSCs were down-regulated after CTX treatment. [score:4]
Therefore, SHSB might enhance BMHSCs proliferation via up -regulating mmu-miR-106b*, mmu-miR-144 and mmu-miR-669k*, as well as down -regulating mmu-miR-142-3p, mmu-miR-210 and mmu-miR-223. [score:3]
Shuanghuang Shengbai might promote the proliferation of CD34 [+]SCA1 [+] bone marrow hematopoietic stem cells via up -regulating mmu-miR-106b*, mmu-miR-144, and mmu-miR-669k*, as well as down -regulating mmu-miR-142-3p, mmu-miR-210, and mmu-miR-223. [score:3]
Moreover, miR-32*, miR-466i-5p, and mmu-miR-669c in SP [+] lung cancer stem cells were confirmed, as well as mmu-miR-106b*, mmu-miR-144, mmu-miR-669k*, mmu-miR-142-3p, mmu-miR-210, and mmu-miR-223 in CD34 [+]SCA1 [+] bone marrow hematopoietic stem cells. [score:1]
Among these microRNAs, little is known about the role of miR-106b*, mmu-miR-144 and miR-669k* in proliferation or differentiation of hematopoietic stem cells [27, 28]. [score:1]
These results indicated that SHSB reversed the effects of CTX on microRNAs like mmu-miR-106b*, mmu-miR-144, mmu-miR-669k*, mmu-miR-142-3p, mmu-miR-210 and mmu-miR-223 in CD34 [+]SCA1 [+] BMHSCs. [score:1]
[1 to 20 of 8 sentences]
15
[+] score: 47
Altered expression of miR144 causes post-transcriptional repression of the Nuclear factor E2-related factor 2 (Nrf2), a transcription factor that upregulates expression of a battery of antioxidative genes which constitute the cellular response to oxidative stress and xenobiotic damage [43]. [score:8]
After irradiation, its expression increased significantly in WT cells (1.48-fold increase), and was strongly upregulated in Ptch1 [+/−] GCPs (2.5-fold increase); moreover, radio -induced MBs express significantly more miR-144 than spontaneous MBs. [score:8]
Only one miRNA was up-regulated (mmu-miR-206-3p), while 6 out of 8 were down-regulated (i. e., mmu-miR-3107-5p, mmu-miR-1912-3p, mmu-miR-1264-5p, mmu-miR-486-3p, mmu-miR-144-5p and mmu-miR-144-3p). [score:7]
As shown in Figure 3, miRNA enrichment and pathway analysis after irradiation, highlighted only a limited number of altered functions, the most significant of which were related to Nucleotide Excision Repair (NER; Gtf2h2 and Polr2b genes which are predicted targets of mmu-miR-302b-3p and mmu-miR-144-3p, respectively) and the regulation of Insulin-like Growth Factor (IGF) transport and uptake by Insulin-like Growth Factor Binding Proteins (IGFBPs) (Mmp2 and Igfbp2 genes are both predicted target genes of mmu-miR-486-5p). [score:6]
As shown in Figure 8C, 4/5 of the analyzed miRNAs (i. e., let-7a, miR-19a, miR-144 and miR-302b) were significantly differentially expressed in spontaneous and radio -induced MB, according to their deregulation at short-term post-irradiation. [score:4]
In agreement with previous work showing miR-144 upregulation by aberrant Shh activation [42], we found a significantly higher level of miR-144 in unirradiated Ptch1 [+/−] GCPs than in WT cells (2-fold increase). [score:4]
These observations suggest a synergism between irradiation and Shh pathway activation in the control of miR-144 expression level. [score:3]
Thus, it is intriguing to speculate that an impairment of the cellular redox status and adaptive cellular response to oxidative stress in Ptch1 [+/−] GCPs, caused by miR-144 overexpression, contributes to the higher incidence of radio -induced tumors in this mouse mo del. [score:3]
Comparison of these results with miRNAs listed in Table 1, shows that 4 miRNAs, such as members of let-7 family, miR-99a, miR-34c and miR-144 were in common, while only miR-144 is in common with miRNAs listed in Table 2, indicating its potential role in MB development after irradiation. [score:2]
Finally, as shown in Figure 7G and 7H, we evaluated expression levels of miR-144 and mir-302b, both controlling NER machinery (Figure 5), showing for both miRNAs a clear dependence on Ptch1 haploinsufficiency exacerbated by combination with irradiation, although with a reverse pattern. [score:1]
miRNome analysis identified other interesting and significantly altered miRNAs, among which miR-144. [score:1]
[1 to 20 of 11 sentences]
16
[+] score: 39
The miR-196a-5p, -196b-5p, -10b-3p, -10a-5p, -615-3p, and -505-5p were down-regulated, whereas miR-144-5p, -542-3p, -200a-3p, -182-5p and -451a were up-regulated. [score:7]
Of these miRNAs, the down-regulation of miR-196a-5p, -196b-5p, -10b-3p, -10a-5p, -615-3p, and -505-5p and the up-regulation of miR-144-5p, -542-3p, -200a-3p, -182-5p and -451a were further confirmed in the CSF of PD patients. [score:7]
The miR-144-5p, -200a-3p and -542-3p were found to be significantly up-regulated in both A53T-transgenic mice and the CSF samples of PD patients. [score:4]
The expression of miR-144-5p, miR-200a-3p and miR-542-5p showed an increased tendency accompanied with high H&Y scales of PD patients (Figure 4D-4F). [score:3]
Correspondingly, the gender, age and smoking did not significantly contribute to the expression difference of miR-200a-3p (p = 0.69, 0.34 and 0.03), miR-144-5p (p = 0.47, 0.19 and 0.83) and miR-542-3p (p = 0.56, 0.65 and 0.65, Supplementary Figure 4). [score:3]
Similarly, it has been reported that miR-144-5p changed in the brain of Huntington disease and blood of AD [76, 77]. [score:3]
In our results, miR-144-5p, -200a-3p and -542-3p were further selected by their differential expression of high-abundance in sequencing. [score:3]
The relative expression of miR-200a-3p C., miR-144-5p D. and miR-542-3p E. in CSF from PD and health controls by qRT-PCR. [score:3]
The most significant up -regulating miRNAs were miR-144-5p, -200a-3p and -542-3p, as their fold-changes were 3.15 ± 0.08, 3.01 ± 0.12 and 2.66 ± 0.11 respectively in the mouse brain, and 3.24± 0.50, 3.63 ± 0.57 and 2.66 ± 0.19 respectively in the CSF of PD patients (Figure 3C-3E). [score:2]
At the cut-off values of 0.35 for miR-144-5p, 0.05 for miR-200a-3p, and 0.40 for miR-542-3p, the sensitivity and specificity for these markers were 65.91% and 75.56%, 73.17% and 75.61%, 84.09% and 91.11%, respectively (Figure 4A-4C). [score:1]
The ROC results and ordinal regression analysis further suggested the miR-200a-3p, miR-144-5p and miR-542-3p may be potential biomarkers for PD prediction. [score:1]
As a result, the candidate miRNAs were significant increased following the PD severity with the coefficient: 12.51 (95% CI: 7.51-17.51) in miR-200a-3p, 1.33 (95% CI: 0.74-1.92) in miR-144-5p, 4.64 (95% CI: 3.05-6.52) in miR-542-3p respectively (Table 3). [score:1]
The miR-200a-3p D., miR-144-5p E. and miR-542-3p F. were increased in CSF form PD and changed with H&Y scale. [score:1]
[1 to 20 of 13 sentences]
17
[+] score: 36
Suppression of luciferase activity by miR-144 was ablated, indicating that miR-144 directly targets the Meis1 3′UTR via the predicted target sequence (Figure 4D). [score:8]
We tested four of the top predicted targets of miR-144 in luciferase assays, in order to determine whether they were actual direct targets. [score:5]
All four 3′ UTRs were significantly down-regulated in the presence of miR-144, but not in the presence of a control miR (Figure 4A–D). [score:4]
We performed site-directed mutagenesis on the Meis1 3′UTR to delete the predicted miR-144 target site. [score:4]
Applying the same standards to the MEP population, 36 miRs were overexpressed (Table 2), including the miR-144∼451 cluster known to modulate erythroid development [3]. [score:4]
MiR-144 suppressed luciferase activity through the Bach2 (A), Trp53inp1 (B), and MycN(C) 3′UTR sequences, whereas control miR-30b resulted in no luciferase repression in all cases. [score:3]
Site-directed mutagenesis to delete the miR-144 binding site in the Meis1-3′UTR was performed using the QuikChange Lightning Site-Directed Mutagenesis kit according to the manufacturer's protocol (Agilent Technologies). [score:3]
Panel E depicts the miR-144 predicted binding site in the Meis1 3′UTR (bases 200–219 of the 3′UTR are shown). [score:1]
The underlined sequence denotes the nucleotides deleted in the mutant Meis1 construct, with the bolded nucleotides in the mature miR-144 sequence indicating the miR-144 seed sequence. [score:1]
Deletion of these nucleotides abrogated the repression of luciferase activity by miR-144. [score:1]
The miR-144 binding site in the Meis1-3′UTR was further confirmed by testing a mutant Meis1 3′UTR construct (pLuc-Meis-Mut) in which the predicted miR-144 seed sequence was deleted. [score:1]
This includes the clustered miR-144 and miR-451 as modulators of erythropoiesis, miR-223 as a modulator of granulopoiesis, and family members miR-125a/125b as modulators of hematopoietic stem cell proliferation and maintenance [2], [3], [7], [21]. [score:1]
[1 to 20 of 12 sentences]
18
[+] score: 32
siRNA -mediated knockdown of DCLK1 in BxPC-3 results in decreased expression of DCLK1 mRNA (A), increased expression Let-7a, miR-144 and miR-143/145 (B), decreased expression of c-MYC and NOTCH1 (C), and decreased expression of NANOG, KLF4, OCT4 and SOX2 (D). [score:10]
Figure S2 NPsiRNA -mediated knockdown of DCLK1 downregulates NOTCH1 via miR-144. [score:5]
Figure S3 NPsiRNA -mediated knockdown of DCLK1 downregulates c-MYC via Let-7a, NOTCH1 via miR-144 and pluripotency factors via miR-143/145 in BxPC-3 cells. [score:5]
C, Knockdown of DCLK1 results in increased expression of pri-miR-144 miRNA in tumor xenografts. [score:4]
Similarly to our previous studies, following the knockdown of DCLK1, we also observed inhibition of NOTCH1 via miR-144 (Figure S2) in AsPC-1 tumor xenografts. [score:4]
Earlier reports [11, 28, 41] and the data presented above indicate that DCLK1 negatively regulates tumor suppressor miRNAs like let- 7a, miR-144 and miR-200a. [score:4]
[1 to 20 of 6 sentences]
19
[+] score: 27
The combinatorial effect of ten down-regulated miRNAs (miR-144-3p, miR-33-5p, miR-32-5p, miR-1983, miR-136-5p, miR-142-3p, miR-376a-3p, miR-142-5p, miR-3968, and miR-29b-3p) reveals that a total of 61, 51, 48, and 37 target genes are significantly affected in PI3K-Akt, focal adhesion, cancer pathways, and transcriptional misregulation pathway respectively (p<0.001) (Figure 4). [score:7]
Also, targeted pathway clustering analysis revealed that miR-144-3p targets six important signaling pathways, namely, PI3K-Akt, focal adhesion, ECM-receptor interaction, protein digestion and absorption, melanoma, glioma, and amoebiasis. [score:5]
Ten miRNAs (miR-144-3p, miR-33-5p, miR-32-5p, miR-1983, miR-136-5p, miR-142-3p, miR-376a-3p, miR-142-5p, miR-3968, and miR-29b-3p) were differentially expressed (log fold change>1) and down-regulated in chronically treated SKH1 mice compared to untreated controls (Table 1-3). [score:5]
Figure 2Figure 2 A-D. are showing the real time expression pattern of selected miRNAs miR-32-5p, miR-33-5p, miR-144-3p, and miR-376a-3p in untreated, acutely treated, and chronically treated SKH1 mice. [score:3]
All of these miRNAs (miR-32-5p, miR-33-5p, miR-144-3p, and miR-376a-3p) were down-regulated compared to their untreated littermates, and further confirms the findings of miRNA profiling study (Figure 2). [score:3]
Figure 2 A-D. are showing the real time expression pattern of selected miRNAs miR-32-5p, miR-33-5p, miR-144-3p, and miR-376a-3p in untreated, acutely treated, and chronically treated SKH1 mice. [score:3]
To confirm the findings of miRNA data, the validation pattern of miR-32-5p, miR-33-5p, miR-144-3p, and miR-376a-3p was analyzed in no UVR, acute, and chronic treated SKH1 skin samples. [score:1]
[1 to 20 of 7 sentences]
20
[+] score: 25
The upregulated miRNAs included mmu-miR-34a-5p, mmu-miR-129b-5p, mmu-miR-451a, mmu-miR-144-5p and mmu-miR-129b-3p, whereas highly downregulated miRNAs included mmu-miR-100-5p, mmu-miR-99a-5p, mmu-miR-33-5p, mmu-miR-125a-5p, mmu-miR-128-1-5p, mmu-miR-181b-1-3p, mmu-miR-188-5p, mmu-miR-196b-5p, mmu-miR-211-5p, mmu-miR-224-5p, mmu-miR-455-3p, mmu-miR-504-5p, mmu-miR-592-5p, mmu-miR-5107-3p, mmu-miR-5120, and mmu-let-7i-3p. [score:7]
Aberrant Expression of miRNAs in Lin [−]c-Kit [+] Cells of Mice Exposed to BenzeneWe detected the expression of 8 miRNAs (mmu-miR-129b-5p, mmu-miR-451a, mmu-miR-34a-5p, mmu-miR-144-5p, mmu-miR-342-3p, mmu-miR-100-5p, mmu-miR-181a-5p, and mmu-miR-196b-5p) in Lin [−]c-Kit [+] cells through qRT-PCR. [score:5]
No significant difference in miR-144/451 expression, which regulates the erythroid differentiation in Lin [−]c-Kit [+] cells, was observed. [score:4]
We detected the expression of 8 miRNAs (mmu-miR-129b-5p, mmu-miR-451a, mmu-miR-34a-5p, mmu-miR-144-5p, mmu-miR-342-3p, mmu-miR-100-5p, mmu-miR-181a-5p, and mmu-miR-196b-5p) in Lin [−]c-Kit [+] cells through qRT-PCR. [score:3]
Meanwhile, the cluster of miR-144/451 was coexpressed from a common precursor transcript and functional cooperativity in mammalian erythropoiesis. [score:3]
In agreement with the sequencing data, the expression levels of mmu-miR-129b-5p, mmu-miR-451a, mmu-miR-34a-5p and mmu-miR-144-5p increased in the benzene exposure group, whereas the levels of mmu-miR-342-3p, mmu-miR-100-5p, mmu-miR-181a-5p, and mmu-miR-196b-5p decreased in the benzene exposure group (Figure 3). [score:3]
[1 to 20 of 6 sentences]
21
[+] score: 20
In erythrocytes from patients affected by sickle cell disease, miR-144 expression was upregulated while a direct regulatory effect on Nrf2 expression and two putative binding sites for miR-144 in the 3’UTR of Nrf2 mRNA were identified [183]. [score:12]
As such affector miRNAs, that act independently from the interaction of Nrf2 with Keap1, miRNAs miR-153, miR-27-a, miR-142-5p, and miR-144 regulated the Nrf2 expression in neuroblastoma cells [179], and miR-28 targeted the 3’UTR of Nrf2 mRNA decreasing Nrf2 expression in human breast cancer cells [180]. [score:8]
[1 to 20 of 2 sentences]
22
[+] score: 17
Doxycycline treatment induced significant overexpression of microRNA-144-3p that resulted in the prediction of 493 potentially down-regulated microRNA targets involved in protein kinase A (PKA) (P = 9.01E-06), protein kinase B (known as AKT) (P = 2.42E-04) and nuclear factor of activated T-cells (NFAT) signaling pathways (P = 3.81E-04) (Fig. 2C and Supplementary Table 1). [score:8]
The decrease of microRNA-144-5p resulted in the prediction of 42 potentially up-regulated microRNA targets involved in cell adhesion (P = 1.12E-03), cytoskeleton (P = 8.73E-04) and metabolism (P = 1.03E-03) pathways. [score:6]
Doxycycline treatment significantly decreased the expression of only 1 microRNA (microRNA-144-5p) after the recovery period in naive T-cells. [score:3]
[1 to 20 of 3 sentences]
23
[+] score: 14
Thus, age -associated miR-144 may contribute to declining brain function in both normal and disease states via the downregulation of longevity/protective factors (Figure 1; Persengiev et al., 2011). [score:6]
Genome-wide analysis of miRNA expression reveals a potential role for miR-144 in brain aging and spinocerebellar ataxia pathogenesis. [score:3]
Importantly, the ATXN1 protein (encoded by the gene mutated in SCA1) is a known target of miR-144. [score:3]
For instance, miR-144 is a strong positive correlate of aged brains in humans, chimpanzees, and rhesus macaques (Persengiev et al., 2011). [score:1]
miR-144 is also enriched in post-mortem tissue from SCA1 and AD patients. [score:1]
[1 to 20 of 5 sentences]
24
[+] score: 12
Through sequencing miRNAs for their quantifications, we show that some known miRNAs (miR-148b-5p, miR-879-5p, miR-144-3p, miR-540-5p, miR-582-5p, miR-15b-5p, miR-210-5p, miR-871-3p, miR-3103-5p, miR-16-1-3p, miR-470-5p, miR-190b-5p, miR-384-5p and miR-490-5p) are upregulated in CUMS -induced depression mice (Table 3), which degrade mRNAs listed in Table 1. In other words, the analysis from miRNA sequencing is consistent to the analysis from mRNA sequencing. [score:4]
These upregulated miRNAs include certain known miRNAs (mmu-miR-148b-5p, mmu-miR-879-5p, mmu-miR-144-3p, mmu-miR-540-5p, mmu-miR-582-5p, mmu-miR-15b-5p, mmu-miR-210-5p, mmu-miR-871-3p, mmu-miR-3103-5p, mmu-miR-16-1-3p, mmu-miR-470-5p, mmu-miR-190b-5p, mmu-miR-384-5p and mmu-miR-490-5p), as well as some novel miRNAs (novel_mir_46, novel_mir_214 and novel_mir_213) with their stem loop structures by Miredp (S3 Fig). [score:4]
In order to validate the finding by miRNA sequencing analysis, four upregulated miRNAs (mmu-miR-879-5p, mmu-miR-582-5p, mmu-miR-144-3p, mmu-miR-15b-5p) were selected for doing qRT-PCR. [score:4]
[1 to 20 of 3 sentences]
25
[+] score: 12
Crtc3 was reduced by miR-144 and miR-21 over -expression, whereas Crtc1 levels where only reduced by miR-21 (Fig. S1a). [score:3]
A less stringent i n silico analysis with only two different target prediction tools identified miR-144 and miR-17 (homo sapiens only) binding sites in the 3′-UTRs of Crtc1 and Crtc3 (Table S1). [score:3]
Additionally, the levels of miR-17, miR-144 and miR-21 significantly correlated with total cell counts in bronchoalveolar lavage (BAL), indicating an increased expression of the miRNAs upon increasing inflammation (Fig. 3b). [score:3]
Ambion [®] Pre-miR Precursors (for miR-17 and miR-144), miRvana miRNA mimics (for miR-21) (Ambion, Austin, USA) or antimiRs (miR-17 and -144) (Ambion, Austin, USA) were transfected in duplicates to a final miRNA concentration of 20 nM per well in a murine lung epithelial cell line (MLE-12) or a human bronchial epithelial cell line (16-HBE14o [−]) 64. [score:1]
To our knowledge the involvement of miR-144 has not been proposed in allergic airway inflammation so far. [score:1]
In total, the 3′UTR of Creb1 contains eight predicted binding sites for miR-17 (three sites), miR-144 (one site), miR-22 (two sites), and miR-181a (two sites) (Fig. 1b). [score:1]
[1 to 20 of 6 sentences]
26
[+] score: 9
Hierarchichal clustering of the miRNA data revealed significant upregulation of tumor promoter miRNAs (miR-17, miR-21, miR-31, miR-98 and miR-182) and significant downregulation of tumor suppressor miRNAs (Let7a, miR-143, miR-144, miR145, miR-30a and miR-200a) in the IECs of Apc [Min/+] mice (Figure 4A). [score:9]
[1 to 20 of 1 sentences]
27
[+] score: 7
The increased expression of mml-miR-451 and mml-miR-144 in the skeletal muscle of old rhesus monkey is reversed by CR [17], but in our study, we did not see any significant effect of CR on the expression of mmu-miR-451, whereas expression of mmu-miR-144 was below the detection threshold. [score:7]
[1 to 20 of 1 sentences]
28
[+] score: 7
Of the four miRNAs identified, miR-19a and miR-19b did not regulate ANO1, while miR-144 regulated ANO1 only indirectly as indicated by preliminary experiments (Supplementary Figs.   1– 6). [score:4]
Four miRNAs were predicted to target ANO1: miR-9, miR-19a, miR-19b, and miR-144. [score:3]
[1 to 20 of 2 sentences]
29
[+] score: 6
Of the eight differentially expressed miRNAs found in both males and females exposed to O [3], a total of six miRNAs were upregulated exclusively in males: miR-338-5p (log fold change = 1.636), miR-222-3p (log fold change = 0.699), miR-130b-3p (log fold change = 0.646), let-7i-5p (log fold change = 0.552), miR-195a-5p (log fold change = 0.543), and miR-144-3p (log fold change = 0.427) (Fig.   2). [score:6]
[1 to 20 of 1 sentences]
30
[+] score: 6
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-32, mmu-mir-1a-1, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-200b, mmu-mir-206, hsa-mir-208a, mmu-mir-122, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-214, hsa-mir-200b, mmu-mir-299a, mmu-mir-302a, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-144, hsa-mir-134, hsa-mir-206, mmu-mir-200a, mmu-mir-208a, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-328, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-214, mmu-mir-135a-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, hsa-mir-361, mmu-mir-361, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-377, mmu-mir-377, hsa-mir-328, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-20b, hsa-mir-429, mmu-mir-429, hsa-mir-483, hsa-mir-486-1, hsa-mir-181d, mmu-mir-483, mmu-mir-486a, mmu-mir-367, mmu-mir-20b, hsa-mir-568, hsa-mir-656, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-744, mmu-mir-181d, mmu-mir-568, hsa-mir-892a, hsa-mir-892b, mmu-mir-208b, hsa-mir-744, hsa-mir-208b, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-1307, eca-mir-208a, eca-mir-208b, eca-mir-200a, eca-mir-200b, eca-mir-302a, eca-mir-302b, eca-mir-302c, eca-mir-302d, eca-mir-367, eca-mir-429, eca-mir-328, eca-mir-214, eca-mir-200c, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-mir-133a, eca-mir-144, eca-mir-25, eca-mir-135a, eca-mir-568, eca-mir-133b, eca-mir-206-2, eca-mir-1-2, eca-let-7f, eca-mir-24-2, eca-mir-134, eca-mir-299, eca-mir-377, eca-mir-656, eca-mir-181a, eca-mir-181b, eca-mir-32, eca-mir-486, eca-mir-181a-2, eca-mir-20b, eca-mir-361, mmu-mir-486b, mmu-mir-299b, hsa-mir-892c, hsa-mir-486-2, eca-mir-9021, eca-mir-1307, eca-mir-744, eca-mir-483, eca-mir-1379, eca-mir-7177b, eca-mir-8908j
More precisely, we identified five miRNAs expressed at the level > 10 cpm solely in PSSM GM muscle: eca-miR-144, eca-miR-20b, ecaub_novel-miR-472, ecaub_novel-miR-568, and ecaub_novel-miR-892. [score:3]
The miR-144 was also expressed at >10 cpm level in bone and eca-miR-20b in bone and liver (Additional file 3: Table S2). [score:3]
[1 to 20 of 2 sentences]
31
[+] score: 5
Decreased miR-144 and miR-451 were found in NASH, where the former elicits and the latter inhibits proinflammatory cytokine production by respectively targeting TLR-2 [29]and AMPK/AKT pathway [30]. [score:5]
[1 to 20 of 1 sentences]
32
[+] score: 5
In addition, only in depleted samples, sensitivity was high enough to detect differentially expressed human-specific miRNAs like hsa-miR-144-5p, a miRNA that is reported to be overexpressed in human neuroblastoma cells 24. [score:5]
[1 to 20 of 1 sentences]
33
[+] score: 5
MiR-451 is genomically located at mouse chromosome 11 B5 and the syntenic region at human chromosome 17q11.2, and is expressed in both species from an intergenic region upstream of miR-144 (miR-144 was not available as part of the RT-PCR miRNA expression panel). [score:5]
[1 to 20 of 1 sentences]
34
[+] score: 5
Cheng C. Li W. Zhang Z. Yoshimura S. Hao Q. Zhang C. Wang Z. MicroRNA-144 is regulated by activator protein-1 (AP-1) and decreases expression of Alzheimer disease-related a disintegrin and metalloprotease 10 (ADAM10) J. Biol. [score:5]
[1 to 20 of 1 sentences]
35
[+] score: 5
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Thus miR-144* was substantially more expressed than miR-144 in both metastatic and non-metastatic libraries; similarly miR-126* was more expressed than miR-126, but only in the non-metastatic library. [score:5]
[1 to 20 of 1 sentences]
36
[+] score: 5
They found that miR-320, miR-378, miR-211, miR-200a,b and miR-184 were significantly down-regulated during both stages of hibernation compared with non-hibernating animals, whereas miR-486, miR-451, miR-144 and miR-142 were significantly overexpressed in late torpor phase [22]. [score:5]
[1 to 20 of 1 sentences]
37
[+] score: 4
Three of these candidate miRNAs were validated as being more highly expressed in the sperm from CORT -treated mice, namely miR-98 (t [(6.4)=]5.26, P=0.002), miR-144 (t [(3.9)]=5.93, P=0.008) and miR-190b (t [(7.4)]=2.73, P=0.028). [score:3]
An independent cohort of CORT -treated animals was generated to validate the five top miRNA candidates, miR-190b, miR-192, miR-449a, miR-98 and miR-144, using SNORD95 as a reference gene (Figure 5d). [score:1]
[1 to 20 of 2 sentences]
38
[+] score: 4
During the course of CIA, six miRNAs (miR-181a, miR-144, miR-17*, miR-202-3p, miR-467a* and miR-500) were up-regulated in peripheral CD3 [+] T lymphocytes of DBA-1/J strain. [score:4]
[1 to 20 of 1 sentences]
39
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, hsa-mir-676, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The miRNA families that change expression in both mouse and human were: let-7, miR-7, miR-15, miR-101, miR-140, miR-152 (all validated by qPCR, P < 0.05), as well as miR-17, miR-34, miR-135, miR-144, miR-146, miR-301, miR-339, miR-368 (qPCR not performed). [score:3]
39E-0218mmu-miR-138-5pmir-1380.2612.849.05E-053.20E-0340mmu-miR-140-3pmir-1400.197.891.23E-031.94E-0246mmu-miR-144-3pmir-1440.256.882.38E-033.30E-0268mmu-miR-145-5pmir-1450.177.038.25E-037.73E-0248mmu-miR-146b-5pmir-1460.167.502.60E-033.38E-0225mmu-miR-152-3pmir-1480.196.472.22E-045.65E-0331mmu-miR-149-5pmir-1490.227.694.26E-048.75E-0314mmu-miR-16-5pmir-150.2910.942.74E-051. [score:1]
[1 to 20 of 2 sentences]
40
[+] score: 4
We found that compared to medium, moDCs stimulated with B0213 showed significantly increased expression of hsa-miR-132-3p, hsa-miR-144-3p, hsa-miR-147a, hsa-miR-155-5p, hsa-miR-503-3p, and hsa-miR-99b-5p and a decreased expression hsa-miR-222-3p (Fig.   3c). [score:4]
[1 to 20 of 1 sentences]
41
[+] score: 4
miR-144-3p and miR-17-5p can respectively recognize 19 and 17 miR-122a targets. [score:3]
These 9 DNmiRs are miR-144-3p, 17-5p, 93-5p, 322-5p, 19a-3p, 31-5p, 145a-5p, 335-5p and 345-5p (Tables S4.1 and S4.2). [score:1]
[1 to 20 of 2 sentences]
42
[+] score: 4
MiR-144 decreased expression of Alzheimer disease-related ADAM10 [49]. [score:4]
[1 to 20 of 1 sentences]
43
[+] score: 4
Our results showed that the expression patterns of miR-1, miR-133a, miR-133b, miR-144, miR-206, miR-299, miR-331 and miR-4286 (Additional file 3: Figure S3) were significantly different in the three stages (p < 0.01), indicating that they may participate in the regulation of follicular transition. [score:4]
[1 to 20 of 1 sentences]
44
[+] score: 3
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-144
Vega-Badillo J. Gutiérrez-Vidal R. Hernández-Pérez H. A. Villamil-Ramírez H. León-Mimila P. Sánchez-Muñoz F. Morán-Ramos S. Larrieta-Carrasco E. Fernández-Silva I. Méndez-Sánchez N. Hepatic miR-33a/miR-144 and their target gene ABCA1 are associated with steatohepatitis in morbidly obese subjectsLiver Int. [score:3]
[1 to 20 of 1 sentences]
45
[+] score: 3
[15] A study in SH-SY5Y cells (a human derived cell line) was the first to identify and verify that the Nrf2 gene is the target gene of miR-153/miR-27a/miR-142-5p/miR-144. [score:3]
[1 to 20 of 1 sentences]
46
[+] score: 3
Several research reported that PTEN function as a target gene of miR-21 [28], miR-214 [29], miR-494 [30], miR-26a [31], miR-144 [32] and miR-153 [33]. [score:3]
[1 to 20 of 1 sentences]
47
[+] score: 3
In an early study of exosome microRNAs in blood and the protective effects of rIPC against ischemia, miR-144 expression levels increased in mouse hearts and plasma after rIPC and reduced myocardial ischemia-reperfusion injury 44. [score:3]
[1 to 20 of 1 sentences]
48
[+] score: 3
As a control, the total list of miRNAs profiled was randomized in order and 9 miRNAs were selected (miR-452, miR-7, miR-205, miR-15a, miR-144, miR-183, miR-463, miR-25, miR-99a), targets and pathway ontology was analyzed as for the candidate list. [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 3
Recently published data indicates that miRs, such as miR-1/106, miR-125b, miR-146a, miR-223, miR-21, miR-144/145, miR-320, miR-494, and miR-92a, are involved in ischemic heart disease [1– 8]. [score:3]
[1 to 20 of 1 sentences]
50
[+] score: 3
In addition, Nrf-2 has been recently demonstrated to be regulated by miR-28 in non-neuronal mo dels, and miR-144, 153, 27a and 142–5p in neurons [17– 19]. [score:2]
Four common miRs (miR-144, 153, 27a and 142–5p) listed in at least 6 individual databases in miRecords were selected. [score:1]
[1 to 20 of 2 sentences]
51
[+] score: 3
Other miRNAs from this paper: mmu-mir-34a, mmu-mir-139
In addition, other miRNAs (miR-34a, miR-144) were also reported to suppress NOTCH1 in CRC [42, 43]. [score:3]
[1 to 20 of 1 sentences]
52
[+] score: 3
Vega-Badillo J Hepatic miR-33a/miR-144 and their target gene ABCA1 are associated with steatohepatitis in morbidly obese subjectsLiver Int. [score:3]
[1 to 20 of 1 sentences]
53
[+] score: 3
Thus far, miR-29a, miR-126, miR-144, and miR-96 have been reported to repress IRS-1 expression and impair insulin signaling [32– 34]. [score:3]
[1 to 20 of 1 sentences]
54
[+] score: 3
The most highly expressed UniPR1331 -induced miRNAs (RQ> 20) were hsa-miR-616-3p and hsa-miR-15a-3p whereas the most UniPR1331-reduced miRNAs (RQ < 0.02) were hsa-miR-593-3p, hsa-miR-144-5p, hsa-miR-501-3p, hsa-miR-326 and hsa-miR-199a-3p. [score:3]
[1 to 20 of 1 sentences]
55
[+] score: 1
Some of the miRNAs (mir-21, mir-34a, mir-27b, mir-9, mir-874, mir-223, mir-144 and mir-153) that were reported to increase in the brain after moderate to severe TBI [20]– [21], [23], [61]– [62] did not show significant modulation in the serum in our experiment. [score:1]
[1 to 20 of 1 sentences]
56
[+] score: 1
Other miRNAs from this paper: mmu-mir-34c, mmu-mir-34b, mmu-mir-34a, mmu-mir-451a, mmu-mir-451b
mir-451 was originally found as a conserved hairpin located in a vicinity of a known miRNA mir-144 and was subsequently shown to associate with Ago2 (Altuvia et al., 2005; Nelson et al., 2007). [score:1]
[1 to 20 of 1 sentences]
57
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-2, hsa-let-7c, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-2, hsa-mir-100, hsa-mir-29b-2, mmu-let-7i, mmu-mir-99b, mmu-mir-125a, mmu-mir-130a, mmu-mir-142a, mmu-mir-155, mmu-mir-183, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-148a, mmu-mir-143, hsa-mir-181c, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-298, mmu-mir-34b, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-130a, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-125a, mmu-mir-148a, mmu-mir-196a-1, mmu-let-7a-2, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-mir-15a, mmu-mir-16-1, mmu-mir-21a, mmu-mir-22, mmu-mir-23a, mmu-mir-24-2, rno-mir-148b, mmu-mir-148b, hsa-mir-200c, hsa-mir-155, mmu-mir-100, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181c, hsa-mir-34b, hsa-mir-99b, hsa-mir-374a, hsa-mir-148b, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7i, rno-mir-21, rno-mir-22, rno-mir-23a, rno-mir-24-2, rno-mir-29b-2, rno-mir-34b, rno-mir-99b, rno-mir-100, rno-mir-124-1, rno-mir-124-2, rno-mir-125a, rno-mir-130a, rno-mir-142, rno-mir-143, rno-mir-144, rno-mir-181c, rno-mir-183, rno-mir-199a, rno-mir-200c, rno-mir-200b, rno-mir-181a-1, rno-mir-298, hsa-mir-193b, hsa-mir-497, hsa-mir-568, hsa-mir-572, hsa-mir-596, hsa-mir-612, rno-mir-664-1, rno-mir-664-2, rno-mir-497, mmu-mir-374b, mmu-mir-497a, mmu-mir-193b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-568, hsa-mir-298, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, hsa-mir-664a, mmu-mir-664, rno-mir-568, hsa-mir-664b, mmu-mir-21b, mmu-mir-21c, rno-mir-155, mmu-mir-142b, mmu-mir-497b, rno-mir-148a, rno-mir-15a, rno-mir-193b
For example, the cluster mmu-mir-144~451 is overlapped by a full length cDNA 'AK158085.1', whose 5'/3' ends coincides with ditags. [score:1]
[1 to 20 of 1 sentences]
58
[+] score: 1
[55] miR-144, miR-28, miR-200 and miR-34 have all been shown to fine tune the Nrf2 pathway. [score:1]
[1 to 20 of 1 sentences]
59
[+] score: 1
Other miRNAs from this paper: mmu-mir-322, mmu-mir-451a, mmu-mir-503, mmu-mir-451b
The miR-451 promoter- LacZ is a transgenic mouse strain with the LacZ gene under the control of the 5-kb promoter of miR-144/451 [16]. [score:1]
[1 to 20 of 1 sentences]
60
[+] score: 1
miR-144 +Introduction of miR-144 affected caspase activation in TRAIL -induced apoptosis pathway [48]. [score:1]
[1 to 20 of 1 sentences]
61
[+] score: 1
Comparing the operated knee with contralateral control showed two miRNAs increased by DMM surgery >1.5-fold at day 1 (miR-144-3p and miR-29b-3p) and two miRNAs at day 3 (miR-370-5p and miR-21-5p). [score:1]
[1 to 20 of 1 sentences]
62
[+] score: 1
Two of the assessed miRNAs (mmu-miR-144-3p and -451a) were increased in response to DEX treatment (Fig 1E). [score:1]
[1 to 20 of 1 sentences]
63
[+] score: 1
Additionally, seven miRNAs exhibited a consistent pattern of no amplification in TEC from infected animals (miR-144, miR-208b, miR-291b-3p, miR-295, miR-302a, miR-488, and miR-654-3p, Figure S4 in). [score:1]
[1 to 20 of 1 sentences]
64
[+] score: 1
Another example is miR-144. [score:1]
[1 to 20 of 1 sentences]
65
[+] score: 1
Murphy CP, Li X, Maurer V, Oberhauser M, Gstir R, Wearick-Silva LE, et al. MicroRNA -mediated rescue of fear extinction memory by miR-144-3p in extinction-impaired mice. [score:1]
[1 to 20 of 1 sentences]
66
[+] score: 1
A 4-fold difference was observed for all candidate miRNAs, except for miR-144-3p, which was eliminated from further analysis. [score:1]
[1 to 20 of 1 sentences]
67
[+] score: 1
The miR-144/451 locus is required for erythroid homeostasis. [score:1]
[1 to 20 of 1 sentences]
68
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-127, mmu-mir-132, mmu-mir-133a-1, mmu-mir-136, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-10b, mmu-mir-185, mmu-mir-190a, mmu-mir-193a, mmu-mir-203, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-10b, hsa-mir-34a, hsa-mir-203a, hsa-mir-215, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-144, hsa-mir-152, hsa-mir-127, hsa-mir-136, hsa-mir-146a, hsa-mir-185, hsa-mir-190a, hsa-mir-193a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-337, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-29b-2, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, hsa-mir-337, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-215, mmu-mir-411, mmu-mir-434, hsa-mir-486-1, hsa-mir-146b, hsa-mir-193b, mmu-mir-486a, mmu-mir-540, hsa-mir-92b, hsa-mir-411, hsa-mir-378d-2, mmu-mir-146b, mmu-mir-193b, mmu-mir-92b, mmu-mir-872, mmu-mir-1b, mmu-mir-3071, mmu-mir-486b, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, hsa-mir-203b, mmu-mir-3544, hsa-mir-378j, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-let-7k, hsa-mir-486-2
miRNA Fold Change P-value mmu-miR-337-5p −5.2 0.0149 mmu-miR-3544-3p −5.1 0.0147 mmu-miR-540-5p −4.9 0.0200mmu-miR-337-3p [a] −3.0 0.0324mmu-miR-3544-5p [a] −3.0 0.0308 mmu-miR-434-3p −2.1 0.0001 mmu-miR-3071-5p −2.0 0.0004mmu-miR-136-3p [a] −2.0 0.0004mmu-miR-3071-3p [a] −1.6 0.0000 mmu-miR-136-5p −1.6 0.0000 mmu-miR-143-5p −1.2 0.0004 mmu-miR-190a-5p −1.0 0.0139 mmu-miR-872-3p −0.9 0.0152 mmu-miR-193a-3p −0.9 0.0164 mmu-miR-144-3p −0.8 0.0298 mmu-miR-127-3p −0.7 0. 0002mmu-miR-434-5p [a] −0.6 0.0082 mmu-miR-148a-3p −0.6 0.0130 mmu-miR-411-5p −0.6 0.0091 a miRNA* (passenger) strand processed from opposite arm of the mature miRNA. [score:1]
[1 to 20 of 1 sentences]
69
[+] score: 1
Class TFS group Motif name miRNA name I 9.1001 MEF2A - 9.2002 FOXO, LEF1, STAT5B, POU1F1, NFAT, TLX-2, GATA-1, STAT5a, MAZ, IRF-7, TAF, FOXF2, JUN, FOXA1, FOXJ1, ZHX2 MIR-23B, MIR-144, MIR-142 6.0110 MEF2A - 15.2112 TGIF - IIa 8.0002 E2F, TCF3, ETS-2, PAX4 - IIb 4.0010 MEF2A - 4.0020 HOXA4, GCM1, RFX1, GATA3 MIR-24 13.2022 TAF - IIc 12.0022 TCF8, FOXO, TAF MIR-524 IIIa 1.1000 STAT5B, STAT5A, PGR, LEF1, TCF3, FOXF2, E4F1 MIR-124A, MIR-17-5P, MIR-20A, MIR-106A, MIR-106B, MIR-20B, MIR-519D", MIR-182, MIR-200B, MIR-200C, MIR-429, MIR-202, MIR-199A, MIR-519E, MIR-9 IIIb 2.0100 MYCN, OLF1, MYOD1 - 2.0200 - MIR-493 - 11.1101 LEF1 -Motifs and miRNAs within each TFS group are listed in order of decreasing enrichment p-value, based on data provided in Additional file 3, Table S3B. [score:1]
[1 to 20 of 1 sentences]