sort by

162 publications mentioning mmu-mir-150 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-150. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 386
Other miRNAs from this paper: mmu-mir-186, hsa-mir-150, hsa-mir-186
Over -expression of miR-186 and miR-150 inhibits the synthesis of P2X [7] mRNA, while inhibition of miR-186 and miR-150 up-regulates the synthesis of P2X [7] mRNA and increases ligand -induced P2X [7] pro-apoptotic effects [8]. [score:10]
These data indicated that miR-150 inhibitors can efficiently reduce tumor growth in vivo via down-regulation of miR-150 and up-regulation of P2X [7]. [score:9]
Although the tissue structure and cell morphology of MDA-MB-231 xenografts treated with miR-150 inhibitors were not different from those treated with miR-150 inhibitor NC or vector alone, transfection with miR-150 inhibitors significantly reduced the percentage of tumor cells expressing proliferating cell -associated antigen (PCNA) (Figure 4E, Figure S4C). [score:9]
In the in vivo study, transfection of miR-150 inhibitors into MDA-MB-231 xenografts implanted subcutaneously in nude mice suppressed tumor growth, which was related to P2X [7] up-regulation, reduced proliferation, and increased apoptosis of xenograft tumor cells. [score:8]
In line with miR-150 down-regulation, the descreased expression of miR-150 dramatically enhanced the expression of P2X [7] mRNA in the breast cancer xenografts (Figure 4D). [score:8]
Furthermore, we experimentally showed that miR-150 directly targets the 3′UTR of P2X [7] to suppress its expression. [score:8]
Down-regulation of miR-150 inhibits breast cancer cell proliferation and induces apoptosis in vitro To corroborate the function of miR-150 during tumorigenesis, breast cancer cells lines, MCF-7 and MDA-MB-231, were transfected with miR-150 mimics or miR-150 inhibitors. [score:8]
In addition, transfection with miR-150 inhibitors, but not with the irrelevant miR-NC inhibitor, dramatically increased P2X [7] expression, suggesting that P2X [7] silencing in breast cancer cells is possibly mediated by miR-150. [score:7]
Transfection with miR-150 inhibitors, increased the percentage of TUNEL -positive cells by 6-fold in MCF-7 cells, and by 8-fold in MDA-MB-231cells (Figure 2E, Figure S2C; P<0.05 or P<0.01), but not in cells transfected with miR-150 inhibitor NC, suggesting that miR-150 may inhibit cancer cell death, whereas blockade of miR-150 leads to cell apoptosis. [score:7]
In addition, transfection with miR-150 inhibitors, but not with the irrelevant miR-150 inhibitor NC, dramatically increased P2X [7] expression, suggesting that P2X [7] silencing in breast cancer cells is possibly mediated by miR-150 (Figure 3E–3G, Figure S3A– S3B). [score:7]
Thus, our findings suggested that blockade of miR-150 retards breast cancer development in vivo, probably by inhibiting proliferation and inducing apoptosis of cancer cells via P2X [7] receptor up-regulation. [score:7]
A breast xenograft tumor mo del was established by mammary fat pad injection of MDA-MB-231 cells stably expressed miR-150 inhibitors or miR-150 inhibitor NC into female BALB/c-nu mice. [score:7]
Thus, our data strongly suggested that miR-150 negatively regulates the expression of P2X [7] by directly targeting the 3′UTR of P2X [7] transcript. [score:7]
Down-regulation of miR-150 inhibits breast cancer cell proliferation and induces apoptosis in vitro. [score:6]
Down-regulation of miR-150 by antagomirs inhibited both the colony formation numbers and sizes. [score:6]
Tumors with high malignancy expressed high levels of miR-150, suggesting that miR-150 up-regulation was associated with tumor progression (Figure 1A, Table S1, P<0.01). [score:6]
In addition, the expression of miR-150 in MCF-7 and MDA-MB-231 cells transfected with miR-150 inhibitors was identified by FISH staining (Figure 3C). [score:5]
After 24h incubation, the cells were treated with miR-150 inhibitors, anti-miR-NC (miR-NC inhibitor), miR-150 mimics, miR-150-NC mimics and mock for 48 hours. [score:5]
In this study, we reported that the expression levels of miR-150 and its target proteins P2X [7] in breast cancer cell lines as well as tumors and normal tissues of breast-cancer patients. [score:5]
with the anti-P2X [7] antibody further confirmed that miR-150 inhibitors increased the expression of P2X [7] in cancer cells of MDA-MB-231 xenografts (Figure 4E, Figure S4B). [score:5]
These data suggested that miR-150 inhibitors retarded tumor growth partly by inhibiting the proliferation of cancer cells. [score:5]
MDA-MB-231 breast cancer cells (1×10 [6]/mouse) (untransduced or transduced with miRNA -expressing vector LV4-miR-150 inhibitor-GFP-Luc or LV4-NC-GFP-Luc were injected subcutaneously into the mammary fat pad of 5-week-old BALB/c-nu mice. [score:5]
When we transfected double-stranded miR-150 mimics oligonucleotides (miR-150 mimics) and the full-length 3′UTR-P2X [7] luciferase reporter into HEK 293 cells, which lack endogenous expression of the P2X [7] receptor, we found that miR-150 inhibitors increased luciferase activity, whereas miR-150 mimics decreased luciferase activity. [score:5]
Furthermore, we found a reverse-correlation in the expression of miR-150 and its target protein P2X [7] receptor in examined malignant tissues. [score:5]
miR-150 promotes human breast cancer growth by targeting the pro-apoptotic purinergic P2X [7] receptorPrevious studies have shown the pro-apoptotic gene P2X [7] is targeted by miR-150 instably in HeLa cells or E10 cells [8], [25]. [score:5]
In recent years, important advances have been made in the knowledge of functions and mechanisms of miR-150 in various human tumors, and several important targets, such as c-myb [4], EGR2 [6], MUC4 [7], P2X [7] [8], AKT2 [9] and CXCR4 [10] have been identified and experimentally tested for their functional participation in the disease process. [score:5]
The expression level of miR-150 in MDA-MB-231 xenografts infected with miR-150 inhibitors was much lower than that in MDA-MB-231 xenografts transfected with miR-150 NC (Figure 4C). [score:5]
Finally, our data revealed a discordant expression of P2X [7] receptor at the transcript and protein levels, which is inversely associated with miR-150 expression in malignant clinical specimens. [score:5]
For this, HEK 293 cells were transiently transfected with miR-150 mimics or miR-150 NC (non -targeted mimics) and a firefly luciferase reporter plasmid containing a region of P2X [7] 3′UTR harboring miR-150 target site (Figure 3A). [score:5]
These data suggested that miR-150 up-regulation is correlated with tumor progression and may play a role in the progression of breast cancers. [score:4]
As shown in Figure 4A and 4B, reduction of miR-150 induced (Figure 4A–4B, Figure S4A) a significant inhibition in tumor growth, compared with mice treated with miR-150 NC inhibitor or vector alone. [score:4]
Our results are in accordance with previous results reported by Zhou et al. [8] that post-transcriptional regulation of P2X [7] mRNA expression involves miR-150. [score:4]
In the in vitro study, miR-150 promoted growth and proliferation of breast cancer cell lines, which was partially mediated by retrieving P2X [7] expression. [score:3]
The study sheds new light on the specific function of miR-150 and its mechanism in breast cancer proliferation, and suggests that targeting miR-150 may provide a potential therapeutic strategy for blocking proliferation in breast cancer. [score:3]
These observations supported previous findings that P2X [7] is one of target genes silenced by miR-150 [8]. [score:3]
These data suggested that the reduced expression of P2X [7] in cancer epithelial cells is the result of high steady-state levels of miR-150 in cancer cells, which activate the instability domains and decrease P2X [7] mRNA levels, possibly by inducing degradation of the transcript. [score:3]
Therefore, inhibition of miR-150 may provide novel therapeutic strategy against breast cancers. [score:3]
To further confirm the role of miR-150 during breast cancer progression, we determined the expression of miR-150 in fresh tumor specimen and adjacent normal breast tissue from 9 patients by using quantitative reverse transcription-PCR. [score:3]
The transcription factor Myb is regulated by miR-150 post-transcriptionally and modulates cell fates in megakaryocyte-erythrocyte progenitors (MEP) [32], B-cell differentiation [33] and embryonic development [34]. [score:3]
P2X [7], a key factor of apoptosis in epithelial tissues, was also shown as a target of miR-150 [8]. [score:3]
miR-150 inhibitors reduces tumorigenesis of breast cancer xenografts. [score:3]
miR-150 over -expression in human skin BJ cells decreased caspase-3 activity, indicating an anti-apoptotic effect [31]. [score:3]
The high-aggressive cells showed high expression levels of miR-150 while the opposite was true in the low-aggressive cells (Figure. [score:3]
miR-150 is over-expressed in breast carcinomas tissues and cell lines. [score:3]
Recent studies have indicated that abrogation of miR-150 markedly increased CXCR4 protein expression and enhanced BM-derived mononuclear cells mobilization and migration [9]. [score:3]
miR-150 stimulates a decrease in P2X [7] mRNA steady-state levels by targeting instability sites within the 3′UTR of the P2X [7] gene. [score:3]
The expression level of miR-150 was different between MDA-MB-231 (a high-aggressive breast cancer cell line) and MCF-7 (a low-aggressive breast cancer cell line). [score:3]
0080707.g002 Figure 2(A–B) Proliferation curves of breast cancer cells transfected with miR-150 mimics (150- mim), miR-150 inhibitors (150-inh) and matched negative control (NC) (150- mim NC or 150-inh NC). [score:3]
In line with a significant decrease in PCNA, reduction expression of miR-150 significantly increased TUNEL -positive cells (apoptotic cells) in breast cancer xenografts (Figure 4E, Figure S4D). [score:3]
Previous studies have shown the pro-apoptotic gene P2X [7] is targeted by miR-150 instably in HeLa cells or E10 cells [8], [25]. [score:3]
miR-150 promotes the cell growth and inhibits the cell apoptosis of breast cancer cells. [score:3]
The results strongly support that over -expression of miR-150 enhances the levels of cancer cell survival factors and promotes cancer cell growth [6]. [score:3]
Finally, our findings in MDA-MB-231 xenografts demonstrated that inhibition of miR-150 reversed growth features of breast cancer cells and induced them to apoptosis. [score:3]
miR-150 promotes human breast cancer growth by targeting the pro-apoptotic purinergic P2X [7] receptor. [score:3]
Most of the studies have indicated that miR-150 is significantly over-expressed in multiple kinds of cancers, including malignant lymphoma, and gastric, lung, endometrial, and pancreatic cancers [5], [6], [7], [8], and displays various effects on cellular proliferation, differentiation, apoptosis, migration, and invasion. [score:3]
In addition, staining of P2X [7] receptor in breast cancer tissues was inversely correlated with miR-150 expression (Figure 1A-1B, Table S1; P<0.001). [score:3]
0080707.g004 Figure 4(A) Tumor volume of mice inoculated with MDA-MB-231 cells that stably expressing miR-150 inhibitor were measured up to 5 weeks. [score:3]
miR-150 expression was examined by in situ hybridization [41] on the formalin-fixed and paraffin-embedded sections of breast cancers. [score:3]
Expression levels of miR-150 in breast cancer tissues were much higher than those in non-tumor tissues (Figure 1A–1C; P<0.05, P<0.01 or P<0.001). [score:3]
Transfecting MCF-7 and MDA-MB-231 cells with miR-150 inhibitors, significantly reduced their sensitivity to the growth effect (Figure 2D, Figure S2B; P<0.05). [score:3]
In this study, we found miR-150 was over-expressed in breast cancer cell lines and tissues. [score:3]
The chi-squared test was used to compare the the clinicopathological status and the expression of miR-150 or P2X [7]. [score:3]
Mechanisms that induce reduced expression of P2X [7] receptor in cancer epithelial cells involve hypermethylation of the P2X [7] gene and decreased transcription; enhanced degradation of the P2X [7] transcript occurs through the action of microRNAs miR-186 and miR-150 [8], [11], [24]. [score:3]
We also examined the miR-150 expression in breast cancer cell lines MCF-7 and MDA-MB-231 along with the non-malignant breast epithelial cell MCF-10A. [score:3]
Expression levels of miR-150 were closely associated with the degree of malignancy of tumors. [score:3]
To corroborate the function of miR-150 during tumorigenesis, breast cancer cells lines, MCF-7 and MDA-MB-231, were transfected with miR-150 mimics or miR-150 inhibitors. [score:3]
Since the role of miR-150 as a tumor suppressor or as an oncogene of tumor cell growth and metastasis in various cancers has been extensively studied [6], [7], [9], [30], we focused on its potential effectiveness in breast cancer. [score:3]
Therefore, miR-150 seems to be a useful treatment target for various kinds of malignant tumors. [score:3]
These data suggest that miR-150 stimulates a decrease in P2X [7] mRNA steady-state levels by targeting instability sites within the 3′UTR of the P2X [7] gene. [score:3]
Reduction in miR-150 suppresses tumor growth in MDA-MB-231 cells xenografts implanted in BALB/c-nu mice. [score:3]
The levels of P2X [7] expression in MCF-7 and MDA-MB-231 cells by transfected with miR-150 were much lower than that in the control cells (Figure 3D–3F). [score:3]
These data confirmed previous report that more abundant expression of miR-150 in cancer than in normal cells [8], [19]. [score:3]
Table S1 Correlation among clinicopathological status and the expression of miR-150 or P2X7 in breast cancer patients. [score:3]
To correct transfection efficiency, a luciferase reporter vector without the miR-150 target was transfected in parallel. [score:3]
Figure S3 miR-150 target the pro-apoptotic purinergic P2X [7] receptor. [score:3]
The level of P2X [7] expression in MDA-MB-231 and MCF-7 cells transfected with miR-150 was much lower than in the control cells. [score:3]
These data provided evidence that ectopic miR-150 expression promotes breast cancer cell proliferation and growth. [score:3]
As a control, we also generated P2X [7] 3′UTR mutant in the miR-150 target region to disrupt its binding site, which was used in co-transfection of breast cancer cells with miR-150 or miR-150 NC. [score:3]
As the miR-150 inhibitors reduces breast cancer cell growth in vitro, we further assessed its effect on tumor growth in vivo. [score:3]
Mechanisms that induced reduced expression of P2X [7] receptor in cancer epithelial cells involved hypermethylation of the P2X [7] gene and decreased transcription; enhanced degradation of the P2X [7] transcript occurs through the action of miR-186 and miR-150 [8], [10], [16]. [score:3]
The data suggest that the reduced expression of P2X [7] receptor in cancer epithelial cell is the result of high steady-state levels of miR-150 in cancer cells, which activate the instability domains and decrease P2X [7] mRNA levels possibly by inducing degradation of the transcript. [score:3]
Our findings also demonstrated that miR-150 over -expression leads to induced growth, clonogenicity and reduced apoptosis in breast cancer cells. [score:3]
However, little is known about the expression and biological role of miR-150 in breast cancer. [score:3]
In the present study, we have investigated the role of miR-150 in the regulation of P2X [7] receptor expression in breast cancer cells. [score:2]
A previous report reveals that miR-150 levels are lower in both ER [+] and triple -negative breast tumor specimens compared to adjacent normal epithelium, with triple -negative tumors having the lowest expression [20]. [score:2]
The clonogenic ability was decreased by 67% and 63% in miR-150 inhibitors transfected MCF-7 and MDA-MB-231 cells, respectively, as compared with their respective controls (Figure 2C, Figure S2A). [score:2]
miR-150 has also been identified as the best hit in several medium-scale profiling experiments designed to detect miRNAs dysregulated in tumors, including cancers of the lung [5], stomach [6], pancreas [7], and malignant lymphoma [35]. [score:2]
Our data demonstrated that relative cell growth was significantly facilitated in miR-150 mimics transfected MCF-7 (∼41.2%) or MDA-MB-231 (∼58.9%) cells on day 5 compared with their respective controls (miR-150 mimics NC or inhibitor NC transfected cells) (Figure 2A). [score:2]
MiR-150 target the pro-apoptotic purinergic P2X [7] receptor. [score:2]
To further investigate whether the miR-150 antagonism inhibits breast cancer development by inducing apoptosis, we used TUNEL-TMR staining to detect DNA fragmentation during programmed cell death. [score:2]
In conclusion, our study suggests that miR-150 is an anti-apoptotic factor in breast cancer that maintains tumor cell growth, and thus, may play an important role for the development of malignancy. [score:2]
As shown in Figure 2B, our data show that cell growth was decreased obviously in miR-150 inhibitors transfected MCF-7 (∼82.1%) or MDA-MB-231 (∼85.8%) cells on day 5 compared with their matched controls. [score:2]
miR-150, a hematopoietic cell-specific miRNA, was shown to affect B-cell differentiation and development [4]. [score:2]
P2X [7] transcription may be regulated by miR-150 in uterine epithelial cells [8]. [score:2]
We observed that miR-150 expression was significantly increased in breast cancer tissue compared with adjacent normal breast tissue (Figure 1A). [score:2]
To evaluate the function of miR-150, the 3′UTR of P2X [7] with a miR-150 targeting sequence was cloned into a pGL3-promoter luciferase reporter vector (Ibsbio, China). [score:1]
Decrease of miR-150 retarded the progression of breast cancer xenografts. [score:1]
Standard curves were generated, and the relative amount of miR-150 or P2X [7] was normalized to the amount of U6 snRNA or GAPDH, respectively. [score:1]
The miR-150 level of tumors was also determined by using qRT-PCR. [score:1]
MCF-7 or MDA-MB-231 cells transfected with miR-150, instead of miR-150 mimics negative control (NC) or mock transfection, showed a substantial (33% or 35%) increase in BrdU staining (Figure 2D, Figure S2B; P<0.05). [score:1]
Corrected P-value =  p-value * n<0.05 Figure S1 The level of miR-150 correlates inversely with P2X [7] in breast cancer cell lines. [score:1]
It is tempting to hazard a suggestion that miR-150 may have potential diagnostic or prognostic significance. [score:1]
Our findings demonstrated that the 3′UTR of P2X [7] receptor contains a putative binding site for miR-150, which is highly conserved across several mammalian species. [score:1]
20NC D'Amato, H Gu, M Lee, R Heinz, NS Spoelstra, et al. (2012) A functional role for miR-150 in breast cancer. [score:1]
We next examined the effect of miR-150 on the anchorage -dependent clonogenic ability of the breast cancer cells. [score:1]
The human P2X [7] 3′UTR contains binding sites for miR-186 and miR-150 that confer instability to the P2X [7] transcript. [score:1]
miR-150 levels correlate inversely with P2X [7] in breast carcinomas and breast cancer cell lines. [score:1]
[1 to 20 of 107 sentences]
2
[+] score: 308
In this study, we present evidences to show that (i) in STHdh [Q111]/Hdh [Q111] cells decreased expression of miR-146a is mediated through decreased expression and activity of RelA/NFkB, (ii) increased expression of p53 in the same cells could be due to decreased expression of miR-125b and miR-150, (iii) p53 and RelA/NFkB regulate the expression of miR-146a and (iv) neuronal cells expressing N-terminal HTT with 83Q coded by exon1 exhibit decreased miR-125b and miR-150 expressions, increased p53 expression and reduced RelA/NFkB expression and activity and miR-146a expression. [score:22]
Among the down regulated miRNAs, expression of miR-146a was decreased in all the four cell mo dels whereas expression of miR-125b and miR-150 were decreased in three of the four cell mo dels excepting Neuro2A where expressions of those were up regulated. [score:9]
This result shows that mutant HTT aggregates directly or indirectly increased p53 expression, reduced RelA/NFkB expression and activity and also reduced miR-146a, miR-125b and miR-150 expressions. [score:9]
As we have shown above that miR-150 might target p53, we also expressed miR-150 in STHdh [Q111]/Hdh [Q111] cells and as expected, significant increase (n = 3, p = 0.039) in the expression of miR-146a was observed (Figure 7C ), possibly due to down regulation of p53 by miR-150. [score:8]
However, co -expression of HYPK together with mutant HTT exon1 reduced the aggregates, reduced p53 expression and recovered the activity of NFkB and miR-146a, miR-125b and miR-150 expressions (Figures 10A–10D ). [score:7]
Report that expressions of miR-125b and miR-150 are decreased in STHdh [Q111]/ [Q111] cells [33] and p53 is one of the targets of these two miRNAs provides an explanation for the increased expression of p53 in these cells. [score:7]
The mo del shows that mutant HTT modulates the expression of both p53 and p65 subunit of NFkB (RelA/NFkB) expression and activity and miR-146a, miR-125b and miR-150 expressions. [score:7]
Such increase in miR-146a expression (n = 3, p = 0.0079), miR-125b expression and miR-150 expression were also observed with STHdh [Q7]/Hdh [Q7] cells 48 hours post transfection with 83Q DsRed and Hsp70-GFP. [score:7]
Thus, out of the thirteen miRNAs whose expressions have been studied, expressions of eight miRNAs including miR-146a, miR-125b and miR-150 were decreased, expressions of two miRNAs (viz. [score:7]
This result shows that decrease in p53 expression by miR-150 could be compensated here by the exogenous expression of p53 which does not have the 3′-UTR region bearing the target site of miR-150. [score:7]
0023837.g012 Figure 12 The mo del shows that mutant HTT modulates the expression of both p53 and p65 subunit of NFkB (RelA/NFkB) expression and activity and miR-146a, miR-125b and miR-150 expressions. [score:7]
Since the expressions of miR-125b and miR-150 were decreased in STHdh [Q111]/Hdh [Q111] cells compared to those obtained in STHdh [Q7]/Hdh [Q7] cells, we expressed these miRNAs in STHdh [Q111]/Hdh [Q111] cells and detected the endogenous expression of p53 as shown in Figure 5D. [score:6]
0023837.g005 Figure 5(A) No change in relative luciferase activity of p50-3′UTR (bearing no predicted recognition site for miR-125b or miR-150) in cells co -transfected with pre- miR-125b and pre-miR-150 compared to cells co -transfected with empty vector U61; (B) RT-PCR showing (i) reduction in p53 mRNA in cells expressing exogenous pre-miR-150 and pre-miR-125b compared to cells expressing empty vector U61, (ii) no reduction in p53 mRNA in cells expressing exogenous pre-miR-19a and pre-miR-146a compared to cells expressing empty vector U61. [score:6]
Similar increase (n = 6, p = 0.029) in relative luciferase activity of NFkB-RE was observed in STHdh [Q7]/Hdh [Q7] cells 48 hours post transfection with 83Q DsRed and Hsp70-GFP; (D) Similarly, miR-146a expression (n = 3, p = 0.033), miR-125b expression and miR-150 expression were significantly increased in STHdh [Q7]/Hdh [Q7] cells 48 hours post transfection with 83Q DsRed and HYPK-GFP compared to STHdh [Q7]/Hdh [Q7] cells transfected with 83Q DsRed and empty vector GFP-C1. [score:6]
Reduction of p53 expression in STHdh [Q111]/Hdh [Q111] cells by expressing miR-150 that targets p53, significantly increased NFkB activity (n = 4, p = 0.0482) as detected by luciferase reporter assay (Figure 8B ). [score:6]
The results given in Table S1 show that expressions of miR-100, miR-125b, miR-135a, miR-138, miR-150, miR-146a, miR-221 which were decreased in HD cell mo del [33] were also decreased in and the expressions of miR-127-3p and miR-214 were increased in both STHdh [Q111]/Hdh [Q111] cells [33] and the R6/2 mouse mo del. [score:5]
Thus, decreased expressions of miR-125b and miR-150 in STHdh [Q111]/Hdh [Q111] cells could result in increased expression of p53. [score:5]
The mo del shows that mutant HTT modulates the expression of p53 and p65 subunit of NFkB (RelA/NFkB), NFkB activity and miR-146a, miR-125b and miR-150 expressions. [score:5]
The results shown in Table S1 suggests that although there is a heterogeneity in the expressions of miRNAs in different cell lines exogenously expressing mutated exon1 of HTT, miR-146a, miR-125b and miR-150 were preferentially decreased than others in the presence of poly Q aggregates. [score:5]
The mo del shows that mutant HTT modulates the expressions of both p53 and RelA/NFkB, NFkB activity and decreases miR-146a, miR-125b and miR-150 expressions. [score:5]
Expression of miR-146a was also significantly (n = 4, p = 0.011) decreased along with the expression of miR-125b and miR-150 as shown in Figure 9C, similar to that which has been shown in STHdh [Q111]/Hdh [Q111] cells [33]. [score:5]
Moreover, over expression of pre-miR-150 decreased the endogenous expression of p53 in STHdh [Q111]/Hdh [Q111] cells (n = 3, p = 0.043) as shown by Western blot analysis (Figure 4D ). [score:5]
Besides, we also show that expressions of miR-125b, miR-146a, miR-150 and RelA/NFkB were decreased while the expression of p53 was increased in striatal tissues of mo dels of HD. [score:5]
Since miR-125b and miR-150 target p53, we postulate that in the presence of mutant HTT aggregates there is an initial decrease in miR-125b and miR-150 expression. [score:5]
To address the specificity of such alteration of miR-146a, miR-125b and miR-150 in the presence of poly Q aggregates, mutated exon1 of HTT gene that translated to N-terminal HTT with 83 Q was exogenously expressed in four different cell lines viz. [score:5]
For over expression studies 1 µg of p53-CFP and 1 µg of empty vector (CFP) were separately co -transfected with NFkB response element construct in STHdh [Q7]/Hdh [Q7] cells and for knocking down p53, 1 µg of p53 siRNA construct was transfected in HeLa cells (data not shown) and STHdh [Q7]/Hdh [Q7] cells and 1 µg of miR-150 was transfected in STHdh [Q111]/Hdh [Q111] cells along with 1 µg of NFkB luciferase construct. [score:4]
Reducing the expression of p53 either by siRNA or by expressing exogenous miR-150 increased NFkB activity as detected by the luciferase assay. [score:4]
The results obtained indicate that despite differences in miRNA expressions in various mo dels, miR-146a, miR-125b and miR-150 were preferentially down regulated than others in the presence of poly Q aggregates. [score:4]
However, when p53 was co -transfected with miR-150, no increase in the expression of miR-146a was observed. [score:3]
Mature miR-146a expression was increased significantly (n = 3, p = 0.03) in cells transfected with pre-miR-150 which has been shown to reduce p53. [score:3]
Although endogenous p53 level was decreased by over expressing miR-125b or miR-150, there was no change in p53 level either in the presence of exogenous miR-19a or miR-146a (Figure 5B and 5C ). [score:3]
Over expression of p53 in STHdh [Q111]/Hdh [Q111] cells: role of miR-125b and miR-150. [score:3]
Exogenous expression of cloned pre-miR-150 construct decreased the reporter luciferase activity of p53-UTR2 in both STHdh [Q7]/Hdh [Q7] (n = 3, p = 0.021) and STHdh [Q111]/Hdh [Q111] cells (n = 3, p = 0.040) as shown in Figure 4C. [score:3]
In the presence of exogenous miR-150, decreased expression of the same luciferase reporter in STHdh [Q7]/Hdh [Q7] cells (Figure 4C ) and reduction of endogenous p53 in STHdh [Q111]/Hdh [Q111] cells (Figure 4D ) were also observed. [score:3]
Poly Q aggregates alter the expressions of miR-125b, miR-150, p53, RelA/NFkB and miR-146a. [score:3]
Similar increase in miR-146a expression was observed when STHdh [Q7]/Hdh [Q7] cells were transfected with miR-150. [score:3]
NFkB activity and expression of miR-146a, miR-125b and miR-150 were also reduced in such condition (Figures 9B and 9C ). [score:3]
This result indicated that miR-150 could also target p53. [score:3]
Although endogenous p53 level was decreased by over expressing miR-125b and miR-150, there was no change in p53 level either in the presence of exogenous miR-19a or miR-146a (negative control), which bears no predicted recognition site in the 3′UTR of p53 (Figure 5B ). [score:3]
Mouse p53 (Trp53) could also be a target of miR-150 at 3′ UTR position 260–287 as shown in Figure S1 (C) using RNAhybrid [53]. [score:3]
0023837.g004 Figure 4Reduced miR-150 also targets p53 in STHdh [Q7]/Hdh [Q7] and STHdh [Q111]/Hdh [Q111] cells. [score:3]
This result shown in Figure 11B reveals that the alterations in the expressions of p53, RelA/NFkB, miR-125b, miR-146a and miR-150 might be involved in the pathogenesis of HD. [score:3]
In the presence of mutant HTT aggregates, miR-125b and miR-150 expressions decrease leading to an increased level of p53. [score:3]
We have already shown in the earlier section that Poly Q aggregates cause decrease in the expressions of miR-146a, miR-125b and miR-150 and removal of aggregates by chaperones rescue such changes. [score:3]
Expressions of p53, RelA/NFkB, miR-125b, miR-146a and miR-150 in striatal region of the brains of. [score:3]
These results show that miR-150 also targets p53. [score:3]
Further, results obtained with mutant HTT aggregates led us to postulate that in the presence of the aggregates there is an initial decrease in miR-125b and miR-150 expression. [score:3]
We confirmed the prediction that human p53 could be a target of miR-150 at human p53 3′-UTR position 234–256. [score:3]
This indicates that (D) Average IOD showing relative expression of p53 protein level in cell extracts prepared from STHdh [Q7]/Hdh [Q7], STHdh [Q111]/Hdh [Q111] and in STHdh [Q111]/Hdh [Q111] cells transfected with miR-125b or miR-150. [score:3]
This result showed that the decrease in the luciferase activity by exogenous expression of miR-150 was specific. [score:3]
Increased expression of luciferase reporter with predicted recognition site of miR-150 at the 3′-UTR of human p53 (p53-UTR2) in STHdh [Q111]/Hdh [Q111] cells in comparison to that in STHdh [Q7]/Hdh [Q7] cells was observed (Figure 4A ). [score:3]
In order to see whether miR-146a, miR-125b and miR-150 were specifically down regulated than others in striatal region of the brains of, we determined the expression levels of additional ten miRNAs in the mouse mo del and compared the results with that obtained earlier by us in HD cell mo del [33]. [score:3]
Moreover, removal of aggregates by HYPK and Hsp70 also rescued the expression of miR-146a, miR-125b and miR-150 (Figure 10D ). [score:3]
Reduced miR-150 also targets p53 in STHdh [Q7]/Hdh [Q7] and STHdh [Q111]/Hdh [Q111] cells. [score:3]
These results indicate that p53 could be targeted by miR-150 as well. [score:3]
Taken together, these results show that p53 is specifically targeted by miR-125b and miR-150. [score:3]
miR-125b and miR-150 were down regulated by more than 1.5 fold in five of the mo dels including whereas miR-146a was down regulated in all the mo dels. [score:3]
p53 is specifically targeted by miR-125b and miR-150 in HD cell mo del. [score:3]
org/) and observed that human p53 could also be targeted by miR-150, which is decreased in STHdh [Q111]/Hdh [Q111] cells [33]. [score:3]
If this down regulation of miR-125b and miR-150 are confirmed along with increased p53 in the post mortem brains of HD, then it may explain the cause for elevated p53 and its role in HD pathogenesis as observed in other studies [4], [10], [11]. [score:2]
Indeed miR-146a was down regulated when p53 was co -transfected with miR-150. [score:2]
It is to be noted that the ability to recover the expressions of miR-125b, miR-146a and miR-150 by Hsp70 was higher compared to that obtained with HYPK, reasons remaining unknown. [score:2]
Significant decrease of mature miR-150 was detected in STHdh [Q111]/ [Q111] cells compared to that obtained in STHdh [Q7]/Hdh [Q7] cells [33] and also in neuronal cells expressing mutated exon1 of the HTT gene as well as in the post mortem brain of HD mice R6/2. [score:2]
Increased p53 level in HD mo dels could be mediated through down regulation of miR-125b and miR-150. [score:2]
For over expression studies, 200 ng of pmiR-Report with desired clone and 300 ng of cloned pre-miR-125b or pre- miR-150 were co -transfected and luciferase assay was done following the same procedure. [score:2]
miR-146a expression was increased significantly (n = 3, p = 0.039) in STHdh [Q111]/Hdh [Q111] cells 72 hours post transfection with pre-miR-150 compared to STHdh [Q111]/Hdh [Q111] cells transfected with empty vector U61. [score:2]
Besides, cDNA prepared using stem-loop specific primers for mature miR-125b, miR-146a and miR-150 also revealed a decrease in the expressions of these miRNAs (n = 3, p<0.01), similar to that obtained in STHdh [Q111]/Hdh [Q111] cells [33]. [score:2]
mmu-miR-150 binds to the 3′UTR of mouse Trp53. [score:1]
Their predicted stable RNA -RNA duplex formed by the binding of miR-150 to the 3′UTR of mouse Trp53 is shown in panel (II). [score:1]
As a negative control, we tested 213 bp (position 145–359 of the 3′ UTR) of p50 sub-unit of NFkB (also known as NFkB1) containing no predicted recognition sites for either miR-125b or miR-150 and did not observe any change in the luciferase activity significantly when the construct (p50-UTR) was co -transfected with cloned pre-miR-125b or pre-miR-150 in STHdh [Q7]/Hdh [Q7] cells (Figure 5A ). [score:1]
Precursor miRNA-125b (Chr11: 121970465–121970552, - strand) and precursor miRNA-150 (Chr19: 50004042–50004125, - strand) were amplified by PCR from human genomic DNA and respectively cloned into pU61 Hygro (Genescript, USA) vector using BamHI and HindIII (NEB, USA) sites. [score:1]
We cloned 136 bp (position 234–256) of the 3′-UTR of p53 (p53-UTR2) containing the predicted recognition site of miR-150 in luciferase reporter vector as described above. [score:1]
Our investigation using HD cell lines provides important observations that miR-146a is regulated by p53 and RelA/NFkB and increased p53 could be mediated through down regulation of miR-125b and miR-150. [score:1]
show that the extent of p53 up regulation found in STHdh [Q111]/Hdh [Q111] cells when compared to STHdh [Q7]/Hdh [Q7] cells was reduced when STHdh [Q111]/Hdh [Q111] cells were transfected with miR-125b or miR-150. [score:1]
We next cloned pre-miR-150 in pRNA-U61 vector. [score:1]
Expression of miR-17-5p was used as endogenous control; (C) Reduced luciferase activity of p53-UTR2 co -transfected with pre-miR-150 in STHdh [Q7]/Hdh [Q7] cells (n = 3, p = 0.021) and STHdh [Q111]/Hdh [Q111] cells (n = 3, p = 0.04) compared to those obtained in respective empty vector U61 transfected cells; (D) Typical Western Blot showing reduction in p53 protein level in STHdh [Q111]/Hdh [Q111] cells 72 hours following transfection with pre-miR-150 compared to STHdh [Q111]/Hdh [Q111] cells transfected with empty vector U61. [score:1]
Figure S1 (A) hsa-miR-150 binds to the 3′UTR of human p53. [score:1]
In addition, we showed that increased level of p53 in STHdh [Q111]/Hdh [Q111] cells could be due to decreased level of miR-150 and miR-125b. [score:1]
However, 213 bp (145–359) of the 3′ UTR of NFkB1 (p50-UTR) containing no predicted binding site for either miR-125b or miR-150 showed no change in its luciferase activity (negative control) when the construct was co -transfected with cloned pre-miR-125b or pre-miR-150 (Figure 5A ). [score:1]
For NFkB1 (p50), 213 bp (position 145–359) of the 3′ UTR of NFkB1 containing no predicted recognition site for either miR-125b or miR-150 was cloned into the vector using SpeI and MluI (NEB) sites and was named p50-UTR. [score:1]
The RNA strand in green represents mmu-miR-150 and the RNA strand in brown represents 260–287 of the 3′UTR in the mouse Trp53 transcript. [score:1]
However, the reduction was less in cells when p53 was co -transfected with pre-miR-150 (n = 3, p = 0.044). [score:1]
The position (234–256) in human p53-3′UTR predicted by miRBase as the recognition site for hsa-miR-150. [score:1]
[1 to 20 of 83 sentences]
3
[+] score: 294
As shown in Fig. 1c, over -expression of miR-150 by pre-miR-150 plasmid inhibited FOXO4 expression, while inhibition of miR-150 by miR-150 inhibitor enhanced expression of FOXO4 in these two cell lines. [score:13]
Based on the protein expression levels and previous reports, FOXO4 were picked up on account of the following reasons: (1) Among these molecules, only FOXO4 displayed dramatic reverse changed in its expression in response to altered expression of miR-150 (Supplementary Fig. S1); (2) Previously, the decreased expression of FOXO4 was associated with increased malignance in gastric and prostate cancers 25 26, suggesting that FOXO4, as a putative tumor suppressor gene, is implicated in the development of human cancers. [score:12]
Consistently, western blot results showed that over -expression of miR-150 or knockdown of FOXO4 was able to promote NF-κB and snail expression, further suppress E-cadherin expression (Fig. 5c and d). [score:10]
A previous study showed that FOXO4 inhibited the transcriptional activity of NF-κB and that loss of FOXO4 induced NF-κB activity in vivo 27, which is consistent with our observations that knockdown of FOXO4 or over -expression of miR-150 increased NF-κB expression, whereby resulting in an increase in snail expression and eventually promoting EMT progression. [score:10]
Correspondingly, the mesenchymal markers N-cadherin, vimentin and snail were up-regulated while epithelial marker E-cadherin was down-regulated by miR-150 over -expression or FOXO4 knockdwon. [score:10]
Moreover, up-regulation of E-cadherin, and down-regulation of NF-κB and Snail by single-knockdown of miR-150 were also reversed by dual knockdown of FOXO4 and miR-150 (Fig. 6c). [score:9]
Knockdown of endogenous FOXO4 expression is able to promote tumor cell metastasis and hinder metastasis inhibition effects caused by inhibition of miR-150, suggesting that FOXO4 is a key downstream metastatic effector of miR-150. [score:8]
The MiR-150 inhibitor, inhibitor negative control (NC -inhibitor), small interfering RNA (siRNA) targeting FOXO4, and an unrelated sequence was used as a negative control of siRNA (siNC) were synthesized by GenePharmaCo. [score:8]
The results showed that prominent higher expression of miR-150 transcript was observed in all five NSCLC cell lines while the expression of FOXO4 was dramatically down-regulated in all five NSCLC cell lines in comparison with the normal lung cell line (Fig. 2a and b). [score:8]
The results showed that compared to non-neoplastic lung tissues, miR-150 expression was frequently up-regulated in non-metastatic NSCLC tissues (p = 0.0011), especially in metastatic NSCLC tissues with higher expression levels (p = 0.0025) (Fig. 2c). [score:7]
In vitro assay demonstrated that miR-150 directly targets 3′-UTR of FOXO4, resulting in the suppression of FOXO4 expression. [score:7]
This result shows that miR-150 plays a role in negatively regulating FOXO4 expression by directly targeting its 3′UTR in NSCLC cells. [score:7]
Up-regulation of miR-150 and down-regulation of FOXO4 occur frequently in metastatic tumor cell lines and NSCLC tissues. [score:7]
Exogenous expression of miR-150 showed positive potent inhibitory effect on the protein expression of FOXO4 with a significant statistical difference when compared to other miRNAs in NSCLC (Supplementary Fig. S2), implying that there is a critical miR-150-FOXO4 interaction in NSCLC. [score:6]
To further confirm whether FOXO4 was directly involved in the pro-metastatic effect mediated by miR-150 in NSCLC, miR-150 inhibitor and FOXO4 siRNA were co -transfected into H460 and A549 cells to simultaneously silence miR-150 and FOXO4 expression. [score:6]
Therefore, we detected the expression levels of NF-κB and snail in response to altered miR-150 or FOXO4 expression. [score:5]
Moreover, an obviously decrease in FOXO4 expression was also display in IHC slices of miR-150 over -expression group in comparison with the control group (Fig. 4h). [score:5]
Therefore, miR-150 -targeting interference combined with recovery of expression of FOXO4 may be a potential therapeutic strategy in metastatic NSCLC patients. [score:5]
Further, qRT-PCR and western blot analysis demonstrated that the stripped tumors from the miR-150 over -expression group had higher levels of miR-150 transcript and lower FOXO4 protein expression levels than those in the control group (Fig. 4d and e). [score:5]
Representative images of the wound healing assay using H460 (c) and A549 (d) cells transfected with pre-miR-150 plasmid/null vector and miR-150 inhibitor/NC -inhibitor. [score:4]
Furthermore, a comparison was made in their negative regulatory effects on FOXO4 protein expression between miR-150 and several other potential up-stream miRNAs of FOXO4 (miR-421, miR-664a-3p, miR-499a-5p). [score:4]
However, this suppressive effect was abolished by the creation of a point mutation in the miR-150 -binding region of in the FOXO4 3′UTR (Fig. 1a and b). [score:4]
As expected, decreased expression levels of total E-cadherin and increased expression levels of N-cadherin and vimentin occurred in pre-miR-150 plasmid and FOXO4 siRNA -transfected A549 and H460 cells when compared to their corresponding counterpart (Fig. 5c and d). [score:4]
Contrary to miR-150, down-regulation of FOXO4 were frequently observed in NSCLC clinical specimens and metastatic tumor cell lines. [score:4]
As expected, knockdown of miR-150 suppressed cell migration ability (Fig. 3a,b,c and d). [score:4]
As a direct downstream target of miR-150, similar results were observed in A549 cells transfected with FOXO4 siRNA (Fig. 5b). [score:4]
MiR-150 inhibitor/NC inhibitor or siFOXO4/NC siRNA were transfected into cells using Lipofectamine 2000 (Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions. [score:4]
These results indicated that over -expression of miR-150 likely enhances EMT-like changes in NSCLC cells through FOXO4 -mediated NF-κB/snail/YY1/RKIP circuitry regulation. [score:4]
Representative images of the Transwell migration assay using H460 (a) and A549 (b) cells transiently transfected with pre-miR-150 plasmid/null vector and miR-150 inhibitor/NC -inhibitor. [score:4]
Over -expression of miR-150 or knockdown of FOXO4 promoted NSCLC cell migration in vitro. [score:4]
Specially, compared with 95C cells, expression of miR-150 was increased in high metastatic potential 95D cells which showed lower expression levels of FOXO4. [score:4]
As shown in the Fig. 4a, the H460-stably over -expressing miR-150 showed a significant increase in colony number compared to the control cell line, which indicating that the H460-stably over -expressing miR-150 is of a hallmark of malignant tumor cells in vitro. [score:4]
FOXO4 is a direct binding target of miR-150 in NSCLC. [score:4]
Over -expression of miR-150 and knockdown of FOXO4 promoted NSCLC cell migration in vitro. [score:4]
Representative results showed that subcutaneous tumors from the miR-150 over -expression group grew faster than those from the control group during tumor development (Fig. 4b). [score:4]
Taken together, our study found that the dysregulation of miR-150-FOXO4 axis was frequently present in NSCLC, and miR-150 promotes cellular migration at least partially through its regulation of FOXO4 in vitro and in vivo. [score:3]
Next, we confirmed the inverse relationship between the expression of FOXO4 and miR-150 in H460 cells and A549 cells. [score:3]
However, another study reported that miR-150 was highly expressed in NSCLC and promoted the proliferation of tumor cells in vitro 7. In this study, our findings support miR-150 functions as a pro-metastatic miRNA in NSCLC. [score:3]
Over -expression of miR-150 or knockdown of FOXO4 promoted NSCLC cell migration in vitroTo determine the role of miR-150-FOXO4 axis in NSCLC metastasis, transwell migration and wounding healing assay were performed in H460 and A549 cells. [score:3]
Impaired cell migration ability of H460 and A549 induced by the single-knockdown of miR-150 were partially restored by dual knockdown of FOXO4 and miR-150 (Fig. 6a and b). [score:3]
We further examined whether FOXO4 was a direct target of miR-150 in NSCLC cells using a dual-luciferase reporter assay. [score:3]
Therefore, an H460 cell line stably over -expressing miR-150 was established. [score:3]
H&E staining revealed that the metastatic incidence in the lungs of the miR-150 over -expression group were also markedly increased (Fig. 4g). [score:3]
FOXO4 is a down-stream target of miR-150. [score:3]
Up-regulation of miR-150 was frequently observed in NSCLC metastatic tissues and metastatic tumor cell lines compared with adjacent non-tumor tissues or non-metastatic tissues and normal lung cell lines. [score:3]
Pro-metastatic effect of miR-150 was partially attributed to targeted silencing of FOXO4. [score:3]
Moreover, ectopic expression of miR-150 resulted in a significant increase in tumor cell metastasis in vitro and lung metastases in a nude mouse xenograft mo del. [score:3]
Consistently, the average tumor volume of the miR-150 over -expression group was significance larger that of the control group (Fig. 4c). [score:3]
Dysregulation of miR-150-FOXO4 signaling promoted tumor cell migration by stimulating EMT. [score:2]
These data establish a significant relevance between dysregulation of miR-150-FOXO4 signaling and significantly enhanced tumorigenesis and metastasis ability of NSCLC cells in vivo. [score:2]
Here, our results reveal that the dysregulation of the miR-150-FOXO4 axis may maintain tumor cells in a relatively undifferentiated state through EMT induction. [score:2]
Relative expression was determined using U6 snRNA (primers from RiboBio, China) as an internal control for miR-150 and GAPDH as an internal control for FOXO4. [score:2]
Dysregulation of miR-150-FOXO4 signaling induced tumorigenesis and metastasis in mice. [score:2]
Sun et al. showed that a significant decrease in miR-150 expression levels was found in tumors tissues compared with normal tissues or tumor-adjacent tissues 32. [score:2]
These data imply that the dysregulation of miR-150-FOXO4 axis is frequently observed in NSCLC progression, and FOXO4 and miR-150 potentially play opposite roles (pro-tumor and anti-tumor) in the tumor progression. [score:2]
Changes of these EMT-related molecules may be the molecular representation of the phenotypic changes of tumor cells brought about as a consequence of dysregulation of miR-150-FOXO4 axis. [score:2]
The results show that over -expression of miR-150 enhanced tumor cell migratory ability compared to empty vector transfected cells. [score:2]
EMT -associated molecules (NF-κB, Snail, E-cadherin, N-cadherin and vimentin) potentially mediated pro-metastatic effects of the dysregulation of miR-150-FOXO4 axis. [score:2]
How to cite this article: Li, H. et al. MiR-150 promotes cellular metastasis in non-small cell lung cancer by targeting FOXO4. [score:2]
To evaluate whether the change in cell shape caused by dysregulation of miR-150-FOXO4 axis was associated with EMT-related molecules, we further examined the protein expression levels of the EMT markers E-cadherin, N-cadherin and vimentin. [score:2]
For intravenous inoculation, 30 days after injection, more lung metastatic nodules were observed in the lungs of the miR-150 over -expression group compared with the control group (Fig. 4f). [score:2]
Consistent with the pro-metastatic effect caused by over -expression of miR-150, knockdown of FOXO4 by FOXO4 siRNA was also able to promote the migratory ability of H460 and A549 cells compared to corresponding siRNA NC -treated cells, as analyzed by the transwell migration and wound-healing assays (Fig. 3e and f ). [score:2]
The human FOXO4 wild type or mutated 3′-UTR sequence containing the miR-150 binding site was cloned into the psiCHECK-2 vector. [score:1]
Pre-miR-150 plasmid/control vector were transfected into NSCLC cells and screened for 3–4 weeks with 1 μg/ml puromycin after a 48 h transfection. [score:1]
Pre-miR-150 plasmids were transfected into the cells and transfection efficiency was demonstrated by qRT-PCR (Supplementary Fig. S3). [score:1]
H460 and H1299 cell lines were grown in RPMI-1640 medium (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA) and penicillin 100 (U/ml)/streptomycin (100 μg/ml) at 37 °C in a humidified atmosphere with 5% CO [2. ]Pre-miR-150 plasmids and paired null vectors were constructed by our lab 22. [score:1]
However, the oncogenic effects of miR-150 are determined by its ability to induce tumorigenesis and/or metastasis in vivo. [score:1]
Given that previous studies about proliferation-related role of miR-150 in lung cancer are mainly restricted to in vitro systems. [score:1]
We observed that A549 cells with over -expression of miR-150 or with knockdown of FOXO4 displayed morphological changes from a cobble stone-like to a spindle-like shape that is characteristic of mesenchymal cells when compared with their parental cells. [score:1]
H460 and H1299 cell lines were grown in RPMI-1640 medium (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA) and penicillin 100 (U/ml)/streptomycin (100 μg/ml) at 37 °C in a humidified atmosphere with 5% CO [2. ] Pre-miR-150 plasmids and paired null vectors were constructed by our lab 22. [score:1]
miR-150, miR-421, miR-664a-3p, miR-499a-5p mimics and miRNA mimic NC were synthesized by Ribobio Technology Co. [score:1]
Here, we report that FOXO4 is involved in the miR-150 -induced tumor cell metastasis. [score:1]
These data show that FOXO4 is a key downstream metastatic effector of miR-150 and mediates, in part, the phenotypic and molecular effects of miR-150 in NSCLC. [score:1]
Therefore, the targets of miRNA-150 were investigated. [score:1]
To determine whether miR-150 is an EMT-regulatory miRNA in NSCLC, we first compared the cellular morphology change between miR-150 plasmid and empty vector- transfected A549 cells. [score:1]
However, studies about the role of miR-150 in NSCLC are mainly confined to tumor growth and controversial in the limited published studies. [score:1]
Briefly, A549 cells were seeded on coverslips in 6-well dishes and transfected with the miR-150 plasmid and the corresponding control vector for 48 h and then were fixed, permeabilized, blocked and stained, according to the manufacturers’ instructions, with Alexa Fluor 488 Phalloidin (Invitrogen, Carlsbad, USA). [score:1]
[1 to 20 of 77 sentences]
4
[+] score: 276
Other miRNAs from this paper: mmu-mir-221
Given that eukaryotic translation initiation factor 4E -binding protein 1 (4E-BP1) is a downstream target of Akt (4E-BP1 negatively regulated eukaryotic translation initiation factor 4E [eIF4E], a key rate-limiting initiation factor for cap -dependent translation[35]), we further examined the level of 4E-BP1 and p-4E-BP(Thr37/46); we observed that both 4E-BP1 and p-4E-BP(Thr37/46) were higher in the miR-150 KO livers than the WT livers after Jo2 injection (Fig 4D). [score:10]
In the wild type mice, miR-150 is highly expressed in the spleen, moderately expressed in the lung, liver and heart, and slightly expressed in the kidney; as expected, miR-150 was undetectable in any of the tissues from the miR-150 KO mice (Fig 4B). [score:7]
Given that miR-221 is one of the highly upregulated miRNAs in response to Fas -induced apopotosis[31], we also examine the level of miR-221 in the livers; we observed a 2.3-fold increase in miR-221 expression in both WT and miR-150 KO mice after Jo2 injection (Fig 4C). [score:6]
Upregulation of miR-150* and miR-630 induces apoptosis in pancreatic cancer cells by targeting IGF-1R. [score:6]
miR-150, a microRNA expressed in mature B and T cells, blocks early B cell development when expressed prematurely. [score:6]
miR-150 down-regulation also contributes to the constitutive type I collagen overexpression in scleroderma dermal fibroblasts via the induction of integrinβ3[15]. [score:6]
In our study, the role of Akt in miR150 deficiency -mediated resistance to Fas -induced hepatocyte apoptosis is supported by the following observations: (1) the protein levels of Akt1 and Akt2 are higher in miR-150 KO hepatocytes and liver tissues; (2) miR-150 directly targets the 3’UTR of Akt1 and Akt2 in hepatocytes; (3) inhibition of Akt restores Fas -induced hepatocyte apoptosis and liver injury in miR-150 KO mice. [score:6]
Specifically, 4 μL of Virofect enhancer (Targetingsystems, El Cajon, CA) was first added to 800 μL of culture medium in each well; following 2 h incubation, 200μL of medium containing 2μL of Targefect F2 (Targetingsystems, El Cajon, CA) and 50nM miR-150 mimic- (Qiagen, Valencia, CA) or control scrambled miRNA (Qiagen, Valencia, CA) was added. [score:5]
While the current study details the regulation of Akt1/2 by miR-150 in hepatocytes, it remains unknown whether miR-150 may also regulate the expression of Akt in other cell types in the liver. [score:5]
As shown in Fig 4D, with Jo2 treatment the miR-150 KO livers expressed higher levels of Akt1, Akt2, total Akt and p-Akt(Ser473) than the WT livers, although under baseline condition (without Jo2 treatment), the miR-150 KO and WT livers express comparable levels of Akt1, Akt2 and total Akt. [score:5]
The search revealed that both Akt1 and Akt2 are predicted targets of miR-150 in mice, and Akt2 is predicted target of miR-150 in human. [score:5]
MiR-150 is downregulated in hepatic stellate cells during liver fibrosis and its overexpression causes decreased hepatic stellate cell activation[17]. [score:5]
miR-150 has recently been identified as a key regulator of immune cell differentiation and activation, as it is preferentially expressed in mature B and T cells as well as NK cells and other cell types of the hematopoietic system including megakaryocytes[1– 7]. [score:4]
miR-150 directly targets Akt1 and Akt2 in hepatocytes. [score:4]
These observations demonstrate that both Akt1 and Akt2 are direct targets of miR-150 in mouse primary hepatocytes. [score:4]
Our findings point toward a key role of miR-150 in hepatocytes for regulation of the Fas apoptotic pathway and suggest the possibility of inhibiting miR-150 for liver injury repair. [score:4]
These observations suggest that upregulation of miR-150 during Fas induced liver injury may be a potential mechanism for decreased Akt activation in wild type mice. [score:4]
In summary, this study provides the first evidence that miR-150 deficiency protects against Fas -induced hepatocyte apoptosis and liver injury through upregulation of the Akt pathway. [score:4]
Our bioinformatics analysis also reviewed other predicted targets of miR-150, including GSK-3β and cJun. [score:3]
We utilized qRT-PCR analysis to examine the expression of miR-150 in various tissues from the wild type and miR-150 KO mice. [score:3]
We used lentiviral vector to restore miR-150 expression in miR-150 KO mice. [score:3]
Thus, inhibition of miR-150 may confer pro-proliferative and anti-apoptotic effects which may facilitate the repair of liver injuries. [score:3]
Relative expression of miR-150 was normalized to U6. [score:3]
miR-150 regulates the development of NK and iNKT cells. [score:3]
Given the documented importance of LPS in the pathogenesis of liver diseases and liver injuries[24] and the emerging role of miR-150 in LPS-initiated response, we utilized miR-150 ΚΟ mice to determine whether miR-150 might influence LPS/D-GalN- and Fas -induced liver injuries. [score:3]
To evaluate the effect of Akt inhibitor V on Jo2 -induced liver injury, WT and miR-150 KO mice were pretreated with vehicle or Akt inhibitor V (1 mg/kg) 30 minutes prior to the administration of Jo2 (0.5 μg/g body weight) or PBS, and the animals were sacrificed 3 hours after Jo2 injection. [score:3]
To predict the potential targets of miR-150, the following bioinformatics prediction systems were used: http://www. [score:3]
Successful hepatic expression of miR-150 in mice injected with pre- miR-150 lentiviral particles was confirmed by qRT-PCR analysis (approximately 60 fold increase, see S2 Fig). [score:3]
Restoration of miR-150 expression enhances Fas -induced apoptosis in miR-150 KO mice. [score:3]
Increased expression of Akt1, Akt2, total Akt and p-Akt(Ser473) in miR-150 KO livers. [score:3]
Given the emerging function of miR-150 in liver parenchymal and nonparenchymal cells, further studies are warranted to detail its mechanism of actions in liver cells and liver diseases. [score:3]
Thus, modulation of Fas -induced hepatocyte apoptosis by miR-150 may have broad implication in various acute and chronic liver diseases. [score:3]
For example, miR-150 has recently been reported to inhibit the growth and survival of pancreatic cancer cells[11, 12]. [score:3]
0132734.g005 Fig 5(A) WT and miR-150 KO mice were injected intraperitoneally with vehicle or Akt inhibitor V (1mg/kg of body weight) 30 minutes before PBS administration (n = 3 each group). [score:3]
The levels of miR-150 and miR-221 in the livers were determined by qRT-PCR (Data are expressed as mean ± SD, * p<0.05). [score:3]
It was reported that miR-150 was associated with chronic lymphocytic leukemia disease[8– 10]. [score:3]
miR-150 directly targets Akt1 and Akt2 in hepatocytesThe basal levels of Akt1, Akt2 and total Akt were higher in the miR-150 KO hepatocytes compared to the WT hepatocytes (Fig 7A). [score:3]
To identify the potential targets of miR-150, we utilized several bioinformatics prediction systems (including http://www. [score:3]
As expected, qRT-PCR analysis showed that miR-150 is expressed in the hepatocytes isolated from the wild type mice, but not in hepatocytes isolated from miR-150 KO mice (Fig 6A). [score:3]
miR-150 targets Akt1 and Akt2 in hepatocyte. [score:3]
After 2 hours of incubation to allow attachment, hepatocytes were transfected with miR-150 mimic or control miRNA mimic using Targefect F2 plus Virofect enhancer (Targetingsystems, El Cajon, CA). [score:3]
Noticeably, inhibition of several microRNAs including miR-150 is associated with enhanced cell proliferation and successful liver regeneration[58]. [score:3]
C57BL/6 wild type (WT) mice and miR-150 knockout (KO) mice were obtained from the Jackson Laboratory (Bar Harbor, ME), and the colonies were maintained at the Tulane University Health Sciences Center Animal Facility. [score:2]
The levels of caspase-3/7, caspase-8, and caspase-9 activities in miR-150 KO livers were significantly lower compared to the WT livers (the data are expressed as mean ± SD) ** p<0.01. [score:2]
Interestingly, the expression of miR-150 is found to be higher in CD133- compared to CD133+ HCC stem-like cells[18]. [score:2]
In the liver, miR-150 has been reported to regulate the production of type I and V collagen by hepatic stellate cells[16]. [score:2]
Consistent with the role of miR-150 in regulation of immune response, miR-150 has been implicated in host response to the endotoxin lipopolysaccharide (LPS). [score:2]
miR-150 is implicated in the maturation of endothelial progenitor cells[13] in the regulation of endothelial cell migration[14]. [score:2]
These findings indicate that miR-150 knockout ameliorates Fas -induced hepatocyte apoptosis and liver injury. [score:2]
We observed that pretreatment with Akt inhibitor V reversed Jo2 -induced liver injury in miR-150 KO mice, as documented by histopathological examination of the liver tissues (Fig 5B), analysis for serum transaminases (Fig 5C), TUNEL assay (Fig 5D), immunostain for cleaved caspase-3 (Fig 5E), as well as assessment for caspase-3/7, caspase-8 and caspase-9 activities (Fig 5F). [score:2]
As Akt1 and Akt2 each contain a single miR-150 binding site in 3’-UTR, we generated reporter constructs containing 3’-UTR of Akt1 and Akt2 with mutation of the miR-150 binding site (indicated in Fig 7B). [score:2]
These findings provide direct evidence for miR-150 in hepatocytes for protection against Fas -induced apoptosis. [score:2]
miR-150 deficiency prevents Fas -induced liver injury. [score:1]
The miR-150 KO mice showed lower mortality, lower aminotransferase levels, less liver tissue damage, fewer apoptotic hepatocytes and lower caspase activities after Jo2 treatment. [score:1]
Role of CXCR4 and microRNA-150. [score:1]
of the liver tissue sections showed less hepatocyte apoptosis in the miR-150 knockout mice compared to the wild type mice (Fig 2D and 2E). [score:1]
The levels of GSK-3β and c-Jun in WT and miR-150 KO livers. [score:1]
Eight-week-old male C57BL/6 WT and miR-150 KO mice were used in this study. [score:1]
According to the paper previously described[25], the conservation alignment for the miR-150 was performed using USSC Genome Bioinformatics (http://genome. [score:1]
Deletion of miR-150 prevents Fas -induced activation of caspase-3/7, 8 and 9. miR-150 deficiency protects against Fas -induced caspase and PARP cleavage. [score:1]
These findings were further corroborated by the Western blot analyses showing decreased cleavage of caspase-3, caspase-8, caspase-9 and PARP in miR-150 KO livers (Fig 3B). [score:1]
0132734.g001 Fig 1 (A) WT and miR-150 KO mice were intraperitoneally injected with LPS/GalN (30ng/g body weight LPS in combination with 800 μg/g body weight of D-GalN) (n = 12 per group). [score:1]
To determine the contribution of hepatocyte miR-150 in Fas -mediated apoptosis, primary hepatocytes were isolated from WT mice and miR-150 KO mice; the cultured hepatocytes were treated with Jo2 plus CHX to determine parameters of apoptosis. [score:1]
Deletion of miR-150 prevents Fas -induced liver injury. [score:1]
The level of circulating miR-150 is increased in patients with hepatocellular carcinoma[19] and intrahepatic cholangiocarcinoma[20]. [score:1]
Thus, delivery of miR-150 to miR-150 KO mice is able to restore Fas -induced liver injury, in vivo. [score:1]
Thus, we performed Western blotting analysis to determine the levels of Akt1, Akt2, total Akt and p-Akt(Ser437) in the livers of WT mice and miR150 KO mice with or without Jo2 treatment. [score:1]
Under H&E staining, the WT livers showed prominent hepatocyte apoptosis and dropout with parenchymal collapse, massive hemorrhage and congestion, whereas the miR-150 KO livers showed much less degree of hepatocyte apoptosis with only mild congestion and no significant parenchymal collapse (Fig 2C). [score:1]
WT and miR-150 KO mice were intraperitoneally injected with LPS/GalN (30ng/g body weight LPS in combination with 800 μg/g body weight of D-GalN) (n = 6 per group). [score:1]
The Akt1 and Akt2 3’-UTR or their corresponding mutants were transfected into the primary hepatocytes isolated from the wild type mice, with cotransfection of miR-150 mimic, to determine luciferase reporter activity. [score:1]
Hepatocytes were isolated from eight-week-old male WT mice and miR-150 KO mice. [score:1]
Our findings provide novel evidence for an important role of Akt in protection against Fas -induced hepatocyte apoptosis in miR-150 KO mice. [score:1]
Total RNAs from various tissues (heart, liver, spleen, lung and kidney) were isolated from eight-week-old male WT and miR-150 KO mice by Trizol (Invitrogen, Grand Island, NY). [score:1]
For example, injection of LPS into healthy humans causes reduction of miR-150 in leukocytes[21]. [score:1]
Delivery of miR-150 enhances Fas -induced apoptosis in miR-150 KO mice. [score:1]
The role of miR-150 in Fas -induced apoptosis of primary hepatocytes. [score:1]
On the other hand, our data support a key role of miR-150 in Fas -induced hepatocyte apoptosis; this observation is noteworthy, given that Fas -induced apoptosis is implicated in the pathogenesis of hepatitis and hepatic failure[31, 49– 51]. [score:1]
There was no significant difference in the levels of serum ALT and AST between the WT and miR-150 KO groups (Fig 1C). [score:1]
Thus, miR-150 deficiency is unable to prevent LPS/D-GalN -induced liver injury. [score:1]
In this protocol, the miR-150 KO mice and age/sex matched WT mice were injected intraperitoneally with a single dose of Jo2 (0.35 μg/g of body weight). [score:1]
As shown in Fig 2B, although at 2 h the livers of wild type and miR-150 KO mice had similar gross appearance, at 4 h the livers of the WT mice turned dark red due to massive hepatic hemorrhaging whereas the livers of the miR-150 KO mice only appeared slightly red. [score:1]
0132734.g006 Fig 6Primary hepatocytes were isolated from eight-week-old male WT mice and miR-150 KO mice. [score:1]
Previous studies have shown that the plasma levels of miR-150 are decreased in patients with sepsis[22] and that low serum miR-150 levels are associated with an unfavorable prognosis of septic patients[23]. [score:1]
There is no difference between WT and miR-150 KO mice of control group and after 2h Jo2 treatment. [score:1]
WT and miR-150 KO mice were intraperitoneally injected with 0.5μg/g of body weight Jo2 (n = 6 or 8 per group, respectively). [score:1]
WT and miR-150 KO mice were intraperitoneally injected with or without 0.5 μg/g of body weight Jo2 (n = 6–8 per group). [score:1]
The current paper details our experimental findings in LPS- and Fas -induced acute liver injuries in the miR-150 KO mice. [score:1]
miR-150 KO fails to protect mice against LPS/D-GalN induced liver injury. [score:1]
The levels of miR-150 and Akt in WT and miR-150 KO mice. [score:1]
The latter observation is corroborated by the finding in our current study that miR-150 deficiency protected against Fas -induced hepatocyte apoptosis and liver injury through activation of Akt. [score:1]
Accordingly, circulating miR-150 is emerging as a potential prognostic marker in assessing sepsis and associated organ damage[23]. [score:1]
Decreased caspase-3/7 activation in miR-150 KO livers was also confirmed by the immunohistochemical staining (Fig 3C). [score:1]
After Jo2 injection, twelve C57BL/6 WT mice and nine miR-150 KO mice showed moribund states and euthanized by CO [2] asphyxiation; three miR-150 KO mice survived. [score:1]
Primary hepatocytes were isolated from eight-week-old male WT mice and miR-150 KO mice. [score:1]
Surprisingly, we noticed that miR-150 deficiency protected against Fas -induced liver injury. [score:1]
Both the WT and miR-150 KO groups of mice died at a similar time frame (within approximately 6 hours) after LPS/D-GalN challenge. [score:1]
Our further experiments indicated that the primary hepatocytes isolated from miR-150 KO mice also protected against Fas -induced apoptosis, in vitro. [score:1]
Lentiviral delivery of miR-150. [score:1]
0132734.g008 Fig 8Eight-week-old miR-150 KO mice were administrated lentiviral particles containing pre- miR-150 (LV- miR-150, 1.01×10 [9] copies/mouse) (n = 6) or lentiviral particles containing scrambled miRNA (LV- scrambled-miRNA, 4.8×10 [8] copies/mouse) (n = 6) by tail vein injection in a volume of 200 μL of sterile saline. [score:1]
Although miR-150 was initially appreciated as a key miRNA in hematopoietic and immune cells, emerging evidence suggests that it also mediates cell functions outside of the hematopoietic system. [score:1]
Our data showed that the miR-150 KO and wild type (WT) mice did not differ significantly in liver injury after LPS/D-GalN injection. [score:1]
Eight-week-old miR-150 KO mice were administrated lentiviral particles containing pre- miR-150 (LV- miR-150, 1.01×10 [9] copies/mouse) (n = 6) or lentiviral particles containing scrambled miRNA (LV- scrambled-miRNA, 4.8×10 [8] copies/mouse) (n = 6) by tail vein injection in a volume of 200 μL of sterile saline. [score:1]
The role of miR-150 in Fas -induced primary hepatocyte apoptosis. [score:1]
Deletion of miR-150 does not prevent LPS -induced liver injury. [score:1]
0132734.g003 Fig 3WT and miR-150 KO mice were intraperitoneally injected with 0.5μg/g of body weight Jo2 (n = 6 or 8 per group, respectively). [score:1]
Purified lentiviral particles containing pre- miR-150 or scrambled control miRNA were obtained from GeneCopoeia (Rockville, MD, USA). [score:1]
The viability of hepatocytes was higher in miR-150 KO hepatocytes than in the WT hepatocytes after Jo2 treatment (Fig 6E). [score:1]
These results suggest that miR-150 deficiency prevents Fas -induced caspase activation in the liver. [score:1]
Our findings suggest that miR-150 modulates liver injury depending on the context of the liver injuries. [score:1]
To further investigate the role of Akt for protection against Fas -induced liver injury, we assessed the extent of Jo2 -induced liver injury in WT and miR-150 KO mice pretreated with Akt inhibitor V (Triciribine). [score:1]
Mature miR-150 contains 22 nucleotides; it is highly conserved through the species and has the same sequence among mice, human, rat, dog and gorilla (Fig 4A). [score:1]
To further evaluate the role of miR-150 in Fas -induced liver injury, we utilized lentiviral vector to restore miR-150 expression in miR-150 KO mice. [score:1]
The role of miR-150 in Jo2 -induced liver injury was further supported by the fact that lentiviral delivery of miR-150 enhanced Jo2 -induced liver injury in miR-150 KO mice. [score:1]
To determine the potential role of miR-150 in LPS -induced liver injury, we utilized a mouse mo del of acute liver injury induced by LPS plus D-Galactosamine (D-GalN). [score:1]
As shown in Fig 7C, miR-150 mimic significantly decreased the 3’-UTR luciferase reporter activity of Akt1 and Akt2; this effect was abolished when the miR-150 binding site was mutated. [score:1]
While all of the wild type mice became lethargic and died within 10 hours, approximately 25% miR-150 KO mice were alive (3/12 miR-150 KO mice survived). [score:1]
However, we observed different Akt1 and Akt2 levels in miR-150 KO hepatocytes without Jo2 treatment. [score:1]
These findings suggest that the levels of Akt1 and Akt2 in hepatocytes are influenced by miR-150. [score:1]
0132734.g004 Fig 4(A) Mature miR-150 sequence was aligned among mouse, human, rat, dog and gorilla. [score:1]
Total RNA was isolated from eight-week-old male WT and miR-150 KO mice. [score:1]
We observed that LV- miR-150 injection enhanced Jo2 -induced liver injury, as reflected by more evident tissues damage and more prominent increase in serum transaminases, caspase activation and PARP cleavage in comparison to injection of LV-scrambled control miRNA (Fig 8). [score:1]
Patients with sepsis show reduced plasma levels of miR-150[22]; low miR-150 serum level is associated with an unfavorable prognosis of patients with hepatic or renal dysfunction[23]. [score:1]
In this system, delivery of pre- miR-150 or control lentiviral particles did not alter liver tissue histology or transaminase levels (S2 Fig). [score:1]
The miR-150 KO mice showed significantly lower levels of serum ALT and AST than the WT mice after Jo2 treatment. [score:1]
Eight-week-old miR-150 KO mice were administered lentiviral particles containing pre- miR-150 (LV- miR-150, 1.01×10 [9] copies/mouse), or lentiviral particles containing scrambled miRNA (LV- scrambled-miRNA, 4.8×10 [8] copies/mouse) by tail vein injection in a volume of 200 μL of sterile saline. [score:1]
In this study, we demonstrate that miR-150 deficiency protects against Fas -induced hepatocyte apoptosis in vivo and in vitro. [score:1]
Hepatocytes were isolated from eight-week-old male WT and miR-150 KO mice by an adaptation of the calcium two-step collagenase perfusion technique as we described previously[30]. [score:1]
These findings suggest an important role of Akt for protection against Fas -induced liver injury in miR-150 KO mice. [score:1]
Specifically, 8 week-old miR-150 KO mice were administered lentiviral particles containing pre- miR-150 (LV- miR-150) or scrambled control miRNA (LV-scrambled-miRNA) by tail vein injection. [score:1]
Although miR-150 deficiency protects the liver from Fas -induced apoptosis, it did not prevent LPS/D-GalN -induced liver injury. [score:1]
0132734.g002 Fig 2(A) WT and miR-150 KO mice were intraperitoneally injected with 0.35 μg/g of body weight Jo2 (n = 12 per group). [score:1]
We observed that Jo2 treatment induced approximately 1.7-fold increase of liver miR-150 in the WT mice; this phenomenon was not observed in the miR-150 KO mice (Fig 4C). [score:1]
After Jo2 treatment for 4h, the livers of WT mice turn dark red because of massive hepatic hemorrhaging, the livers of miR-150 KO mice only showed slightly red. [score:1]
Histopathological examination of the liver tissues from the WT mice and miR-150 KO mice showed similar degree of liver damage (Fig 1B). [score:1]
The mature miR-150 sequence in mouse, human, rat, dog and gorilla was downloaded from http://www. [score:1]
We did not observe difference in Akt1 and Akt2 levels in WT and miR-150 KO livers under basal conditions (without Jo2 treatment). [score:1]
However, we observed that the protein levels of GSK-3β and cJun did not differ between the WT and miR-150 KO livers (with or without Jo2 treatment) (S1 Fig). [score:1]
Hepatocytes were isolated from WT mice and cotransfected with miR-150 mimic plus the reporter plasmid containing the 3’-UTR of Akt1, Akt2 or their mutants. [score:1]
In the LPS/D-GalN mo del, D-GalN blocks gene transcription in the liver and LPS in turn induces an acute cytokine -dependent liver inflammation accompanied by massive liver apoptosis and death of the animals[24, 47, 48]; our results in the current study suggest that miR-150 is not essential in these processes. [score:1]
Specifically, 8 weeks old male C57BL/6 WT and miR-150 KO mice were injected intraperitoneally with LPS/D-GalN (30 ng/g body weight of LPS in combination with 800 μg/g body weight of D-GalN). [score:1]
[1 to 20 of 140 sentences]
5
[+] score: 231
Since HFD -induced diabetes exacerbated the DR neovascularization in miR-150 [-/-] mice more than in WT (Fig 3), and overexpression of miR-150 significantly down-regulated VEGFR2 in endothelial cells (Fig 4), we postulate that chronic obesity -induced suppression of miR-150 may lead to the inflammation in ocular tissues and further aggravate the DR neovascularization through up -regulating VEGF/VEGFR2. [score:9]
MiR-150 expression or secretion is up-regulated by oxidative stress and down-regulated in hypoxic conditions [31, 32] suggesting that it could be a biomarker coordinating cell to cell communication in the vascular system. [score:8]
However, there are other direct targets of miR-150 that could also contribute to the regulation of VEGFR2 expression. [score:7]
All of the above support the notion that even though VEGFR2 might not be a direct target of miR-150, deletion of miR-150 enhances angiogenesis under pathological conditions in part through the up-regulation of VEGFR2. [score:7]
The down-regulation of VEGFR2 by miR-150 could be indirect and mediated by other known miR-150 targets, such as c-Myb, Early growth response 2 (Egr2), or Glycoprotein nonmetastatic melanoma protein B (GPNMB) [10, 53– 55]. [score:7]
Among those candidates targeted directly by miR-150, c-Myb has been verified as a consensus target in several studies [10, 29, 66]. [score:6]
Therefore, downregulation of Egr2 by miR-150 inhibits VEGFR2 activation. [score:6]
Therefore, c-Myb is the most likely downstream target of miR-150 that regulates the VEGFR2 expression in endothelial cells. [score:6]
The expression of miR-150 is significantly suppressed in pathological neovascularization in mice with hyperoxia -induced proliferative retinopathy [33]. [score:5]
org) to determine whether miR150 could target the 3’-untranslated region (UTR) of VEGFR2. [score:5]
Nonetheless, miR-150 might be a potential new therapeutic target to reduce the retinal vascular complications caused by DR or other retinal degenerative diseases because of its functional association with inflammation and neovascularization. [score:5]
However, whether VEGF, the most potent angiogenic factor, is a direct target of miR-150 remains controversial [33, 34, 61– 64]. [score:4]
To determine whether miR-150 was able to regulate the VEGFR2 level in endothelial cells, we transfected human umbilical vein endothelial cells (HUVECs) with a miR-150 expression vector and detected the protein levels of VEGFR2. [score:4]
Downregulation of miR-31, miR-150, and miR-184 in ischemic retina stimulates ocular neovascularization by increasing VEGF and PDGF [32]. [score:4]
Overexpression of miR-150 in HRECs inhibited VEGFR2 level (0.51 ± 0.10 fold) compared to the control scramble (1.00 ± 0.21 fold; Fig 4B). [score:4]
Therefore, we concluded that VEGFR2 is not a direct downstream target of miR-150. [score:4]
One question that remained is whether VEGFR2 is a direct downstream target of miR-150. [score:4]
Among these miRNAs that are altered in the diabetic retina, miR-150 is highly expressed in retinal vascular endothelial cells [27]. [score:3]
Vascular endothelial growth factor receptor 2 (VEGFR2) is a downstream target of miR-150. [score:3]
While overexpression of miR-150 in the mouse retina is able to block neovascularization in hyperoxia -induced retinopathy mice [33], it is unclear how miR-150 might affect retinal function under diabetic conditions. [score:3]
The cells were transfected with a miR-150 expression vector (GeneCopoeia) using the Lipofectamine LTX & PLUS reagent (Thermo Fisher Scientific) and harvested 60 hours after transfection. [score:3]
Our results suggest that the suppression of angiogenesis by miR-150 is in part through VEGFR2, a principal receptor of VEGF that mediates specific intracellular signaling cascades leading to proliferation, migration, survival, and permeability of vascular endothelial cells [65]. [score:3]
Myeloblastosis (c-Myb) is one of the known targets of miR-150 [10, 53– 55] and as such was used as a positive control. [score:3]
Our data presented in this report show that miR-150, a circulating miRNA but also expressed in retinal endothelial cells [27], contributes to the pathogenesis of DR vascular complications. [score:3]
Conversely, the miRNAs predicted to target the 3’-UTR (1479 bp) of mouse VEGFR2 gene do not include miR-150. [score:3]
This observation suggests that miR-150 is involved in neovascular complications in ocular diseases. [score:3]
In a mouse mo del of oxygen -induced proliferative retinopathy, miR-150 is a suppressor of pathological ocular neovascularization [33]. [score:3]
In this study, we found that the serum miR-150 level was significantly suppressed in WT HFD -induced type 2 diabetic mice (Fig 1). [score:3]
The cells were transfected with a miR-150 expression vector (GeneCopoeia, Rockville, MD, USA) using an in vitro transfection kit (Signagen Lab, Rockville, MD, USA) and harvested 60 hours later. [score:3]
Since miR-150 is largely present in the blood after it is expressed and secreted from the spleen, mesenteric lymph nodes, and the thymus [30], we next determined whether the serum level of miR-150 was altered by HFD. [score:3]
Overexpression of miR-150 decreased VEGFR2 protein level in endothelial cells. [score:3]
We further examined the HFD -induced DR in miR-150 null mutant (miR-150 [-/-]) mice and determined the functional role of miR-150 in neovascularization under diabetic conditions, as well as the downstream target(s) of miR-150 by using ERG recordings for retinal light responses, morphological staining for retinal vasculature, and other biochemical / molecular assays. [score:2]
Specifically for the animal studies, the 2-way ANOVA followed by Tukey's post hoc test for unbalanced n were used to determine the statistical significance among all 4 groups (WT-normal diet, WT-HFD, miR-150 [-/-]-normal diet, and miR-150 [-/-]-HFD), as well as whether there was an interaction between the two factors: HFD regimen and miR-150 null mutation (miR-150 [-/-]). [score:2]
Even though miR-150 mutation did not exacerbate HFD -induced decreases of retinal light responses, we further examined whether deletion of miR-150 affected neo-microvasculature by fluorescent staining of retinal blood vessels. [score:2]
Thus, the ability of miR-150 to regulate angiogenesis is in part through VEGFR2. [score:2]
There was no statistically significant difference in the interaction between the two factors, miR-150 null mutation and HFD regimen (2-way ANOVA). [score:2]
In addition, there was no statistically significant difference in the interaction between the two factors, miR-150 null mutation and HFD regimen (2-way ANOVA). [score:2]
MiR-150 [-/-] null neonates display an increased capillary network, decreased inflammation, and less alveolar damage after hyperoxia -induced lung injury due to concurrent induction of GPNMB expression [55]. [score:2]
Overexpression of miR-150 (hsa-miR-150) in HUVECs caused a decrease of VEGFR2 (0.55 ± 0.03 fold) and c-Myb (0.46 ± 0.04 fold) compared to the control transfected with a scramble microRNA (Scramble, 1.00 ± 0.09 fold; Fig 4A). [score:2]
The miR-150 [-/-] mice display exacerbated obesity -associated tissue inflammation and systemic insulin resistance [73], indicating that miR-150 might be involved in the chronic ocular tissue inflammation that leads to the development of DR. [score:2]
This observation might be due to the fact that normally the neural retina has very low expression of miR-150 compared to the hematologic and endothelial cells in the blood vessels [27, 31], so under chronic diabetic stress, deletion of miR-150 has a much higher pathological impact on ocular vasculature than neural retina. [score:2]
There is a significant difference between WT (both normal chow and HFD) and miR-150-/-, indicating the impact of miR-150 null mutation on the scotopic ERG a-wave. [score:2]
There is no statistical interaction between miR-150 null mutation and HFD regimen (2-way ANOVA). [score:2]
There is a significant difference between WT (both normal chow and HFD) and miR-150-/-, indicating the impact of miR-150 null mutation on the photopic ERG a-wave. [score:2]
There is a statistical significant difference in the interaction between miR-150 null mutation and HFD regimen (2-way ANOVA; #). [score:2]
Since deletion of miR-150 increased microvascular density and angiogenesis in mouse retina under diabetic conditions, we suspected that miR-150 might regulate VEGF signaling. [score:2]
Data of scotopic and photopic ERG a- and b-waves and OPs are listed in Tables 1 and 2. Even though miR-150 mutation did not exacerbate HFD -induced decreases of retinal light responses, we further examined whether deletion of miR-150 affected neo-microvasculature by fluorescent staining of retinal blood vessels. [score:2]
Moreover, there was a statistically significant difference in the interaction between miR-150 mutation and HFD regimen in vascular area and microaneurysms ([#] p <0.05; 2-way ANOVA; Fig 3B and 3C) indicating that miR-150 [-/-] mice are more sensitive to HFD -induced diabetic insults during the development of DR vascular complications compared to the WT. [score:2]
The serum level of miR-150 was significantly suppressed in HFD mice compared to mice fed with a normal diet (student’s t-test; the relative abundance of miR-150/ miR-39 for Normal is 0.02819 ± 0.00199, and for HFD is 0.02032 ± 0.00194. n = 5 for each group. [score:2]
The protein levels of c-Myb and VEGFR2 are significantly lower in HUVE cells with overexpression of miR-150 compared to the scramble (student’s t-test; * p < 0.05). [score:2]
In addition, we found that the VEGFR2 level in the miR-150 [-/-] mouse retinas was higher than the age matched WT mouse retinas (under both normal chow and HFD; Fig 4C). [score:1]
Scotopic ERG b-wave: * denotes miR-150 [-/-]-HFD significantly different from WT-Normal. [score:1]
Among these miRNAs mentioned above, miR-150 and miR-126 are circulating miRNAs present in the plasma, platelets, erythrocytes, and nucleated blood cells of blood [59, 60]. [score:1]
These results indicated that HFD had a detrimental impact on the inner retina, and deletion of miR-150 did not further aggravate the decreased retinal light responses in HFD -induced diabetic mice. [score:1]
Both WT and miR-150 [-/-] HFD mice displayed significantly higher blood glucose levels in a non-fasted state compared to mice fed with normal chow, but there was no statistically significant difference in the interaction between miR-150 null mutation and HFD regimen in systemic glycemia, which indicated that hyperglycemia was mainly induced by chronic HFD (2-way ANOVA analysis; WT-normal diet: 114.8 ± 16.5 mg/dl; WT-HFD: 267.8 ± 37.5 mg/dl; miR-150 [-/-]-normal diet: 122.4 ± 12.9 mg/dl; miR-150 [-/-]-HFD: 298.2 ± 23.6 mg/dl; Fig 1B). [score:1]
There is a significant difference between mice with normal chow (both WT and miR-150 [-/-]) and HFD-mice (both WT and miR-150 [-/-]), indicating the impact of HFD on the scotopic ERG b-wave. [score:1]
# denotes miR-150-/—HFD significantly different from miR-150-/—Normal. [score:1]
Scotopic ERG Oscillatory Potentials: ^ denotes both WT-HFD and miR-150-/—HFD significantly different from both WT-Normal and miR-150-/—Normal, indicating the impact of HFD on scotopic ERG OPs. [score:1]
There is a significant difference between mice with normal chow (both WT and miR-150-/-) and HFD-mice (both WT and miR-150-/-), indicating the impact of HFD on the photopic ERG a-wave. [score:1]
Scotopic and photopic light responses are decreased in WT and miR-150 [-/-] mice fed with HFD. [score:1]
0157543.g002 Fig 2Scotopic and photopic light responses are decreased in WT and miR-150 [-/-] mice fed with HFD. [score:1]
We examined both neuronal and vascular changes in the retina of age matched wild type (WT) and miR-150 [-/-] mice fed with a HFD for 27 weeks to determine the functional role of miR-150 in DR pathogenesis. [score:1]
The photopic a-wave amplitudes recorded from miR-150 [-/-]-HFD are significantly lower than WT-normal (#) at 3, 10, and 25 cd. [score:1]
Thus, deletion of miR-150 does not further exacerbate the neural retina as much as ocular vasculature under diabetic insults. [score:1]
[#] denotes miR-150 [-/-]-HFD significantly different from miR-150 [-/-]-Normal. [score:1]
However, there was no statistically significant difference in the interaction between the two factors, HFD regimen and miR-150 null mutation, on ERG a-waves (2-way ANOVA), even though miR-150 [-/-] mice fed with HFD had the lowest a- and b-wave amplitudes under both scotopic and photopic conditions compared to the other three experimental groups. [score:1]
The relative abundance of miR-150 / miR-39 for Normal is 0.02819 ± 0.00199, and for HFD is 0.02032 ± 0.00194. n = 5 for each group. [score:1]
The photopic b-wave amplitudes recorded from miR-150 [-/-]-HFD are significantly different from the other 3 groups (&) at 25 cd. [score:1]
Thus, deletion of miR-150 accelerated the pathological neovascularization in HFD -induced diabetic retina. [score:1]
0157543.g004 Fig 4The HUVE cells were transfected with miR-150 (has-miR-150) or a scramble microRNA (Scramble) and cultured for an additional 60 hr. [score:1]
There is a significant difference between mice with normal chow (both WT and miR-150-/-) and HFD-mice (both WT and miR-150-/-), indicating the impact of HFD on the scotopic ERG a-wave. [score:1]
Deletion of miR-150 itself did not affect OPs. [score:1]
MiR-150 deletion did not have any impact on ERG b-wave amplitudes, suggesting that miR-150 deletion did not affect inner retinal physiology. [score:1]
Because the pathogenesis of DR neovascularization is complex, and the development of DR vascular complication is chronic, it is our interest to investigate the role of miR-150 in pathological angiogenesis at different stages of DR development. [score:1]
The retinal light responses were decreased in miR-150 [-/-] HFD mice. [score:1]
A statistical significance in the interaction between HFD and miR-150 [-/-] would indicate that miR-150 [-/-] exacerbated the HFD-caused effects. [score:1]
By using the miR-150 null (miR-150 [-/-]) mouse mo del, we were able to reveal how miR-150 contributed to the pathogenesis of DR vascular complications in HFD -induced type 2 diabetes. [score:1]
The retinal light responses were decreased in miR-150 [-/-] HFD miceWe further examined whether the retinal light responses were compromised in miR-150 [-/-] null mutant mice at the end of a HFD regimen for 27 weeks. [score:1]
We further examined whether the retinal light responses were compromised in miR-150 [-/-] null mutant mice at the end of a HFD regimen for 27 weeks. [score:1]
Our result showed that the c-Myb level was decreased in the endothelial cells transfected with miR-150. [score:1]
There is no statistical difference between WT-HFD and miR-150 [-/-]-HFD. [score:1]
However, the gene encoding VEGFR2 (KDR) is not listed as a potential candidate for miR-150 because of a lack of compatible paired sequences. [score:1]
By the end of the HFD regimen, both WT and miR-150 [-/-] HFD mice had twice the body weights of mice fed with a normal chow diet (WT: HFD vs normal chow, 51.8 ± 2.0 g vs 25.5 ± 2.7 g; miR-150 [-/-]: HFD vs normal chow, 45.4 ± 2.2 g vs 28.7 ± 2.0 g; Fig 1A). [score:1]
Deletion of miR-150 itself did not seem to cause any vascular abnormality in the mouse retina, but miR-150 [-/-] mice fed with HFD had significantly increased vasculature networks (Fig 3A). [score:1]
0157543.g001 Fig 1Systemic status of WT and miR-150 null mutant (miR-150 [-/-]) mice with normal chow diet or HFD. [score:1]
The presence of VEGFR2 in the retinal vasculature obtained from the miR-150 [-/-] under HFD was higher than that of the WT (Fig 4C). [score:1]
The HUVE cells were transfected with miR-150 (has-miR-150) or a scramble microRNA (Scramble) and cultured for an additional 60 hr. [score:1]
# denotes miR-150-/—HFD significantly different from WT-Normal. [score:1]
Deletion of miR-150 in mice mildly affected photoreceptor light sensitivities (as shown by ERG a-waves), but it did not have any significant impact on the inner retinal light sensitivities (shown in ERG b-waves and OPs) or general retinal vasculature. [score:1]
Deletion of miR-150 exacerbates HFD -induced DR neovascularization and microaneurysms. [score:1]
Systemic status of WT and miR-150 null mutant (miR-150 [-/-]) mice with normal chow diet or HFD. [score:1]
Deletion of miR-150 exacerbates HFD -induced DR microvascular complications. [score:1]
MiR-150 was first known as a circulating miRNA that is secreted into macrovesicles by blood cells and monocytic cells [28– 30]. [score:1]
Therefore, miR-150 levels were influenced by diet, which could play a crucial role in the pathogenesis of DR. [score:1]
Hence, we postulate that miR-150 might contribute to the pathogenesis of DR vascular complications. [score:1]
Photopic ERG Oscillatory Potentials: ^ denotes both WT-HFD and miR-150 [-/-]-HFD significantly different from both WT-Normal and miR-150 [-/-]-Normal, indicating the impact of HFD on photopic ERG OPs. [score:1]
We monitored the body weight and systemic blood glucose levels of WT and miR-150 [-/-] mice under normal chow and HFD conditions. [score:1]
There is a significant difference between mice with normal chow (both WT and miR-150-/-) and HFD-mice (both WT and miR-150-/-), indicating the impact of HFD on the photopic ERG b-wave. [score:1]
There was no statistically significant difference in the interaction between miR-150 deletion and HFD regimen in regards to body weight, as the body weights between WT and miR-150 [-/-] mice in the same diet were similar (2-way ANOVA analysis). [score:1]
# denotes WT-HFD significantly different from miR-150-/—Normal. [score:1]
& denotes miR-150-/—HFD significantly different from all other 3 groups. [score:1]
MiR-126, miR-31, miR-150, and miR-184 are involved in ischemia -induced retinal neovascularization. [score:1]
Wild type (WT) and miR-150 [-/-] mice were fed with a normal chow diet (Normal) or HFD for 27 weeks. [score:1]
There is no statistical difference between WT fed with HFD (WT-HFD) and miR-150 [-/-]-HFD. [score:1]
MiR-150tm1Rsky/J (miR-150 [-/-]) mice were originally purchased from the Jackson Laboratory (Bar Harbor, ME, USA). [score:1]
WT-Normal: n = 6; WT-HFD: n = 8; miR-150 [-/-]-Normal: n = 6; miR-150 [-/-]-HFD: n = 8. p < 0.05 (denoted as *, #). [score:1]
[1 to 20 of 106 sentences]
6
[+] score: 215
This is relevant to JMML, since LIN28B has been reported to be upregulated in these patients and may be one of the factors involved in the downregulation of miR-150-5p in this disease [21]. [score:9]
Bone marrow and splenic cells from a Ptpn11 mutated murine mo del resembling JMML exhibit miR-150-5p expression downregulation and STAT5b upregulation. [score:9]
Here we report miR signatures associated with JMML molecular subtypes and found that miR-150-5p, which expression is downregulated in JMML cases, targets STAT5 isoform b (STAT5b). [score:8]
Two miRs, miR-630 and miR-150-5p, are up- and down-regulated respectively, in all JMML molecular subtypes more than 2 fold, while miR-1260, miR-146b-5p and miR-4454 were downregulated in both KRAS and NRAS mutants only. [score:7]
In leukemias, miR-150-5p act as a tumor suppressor in MLL-rearranged and other subtypes of acute myeloid leukemia (AML), by targeting HOXA9 and MEIS1, either directly or indirectly [23, 33]. [score:7]
In a Ptpn11-mutated animal mo del that recapitulates a myeloproliferative condition resembling JMML [25], we found STAT5b mRNA and Stat5 protein upregulation together with miR-150-5p downregulation in whole BM cells, splenocytes and c-kit+ cells. [score:7]
We hypothesized that the loss of miR-150-5p expression in JMML myeloid precursors may lead to the overexpression and consequent activation of its target Stat5b in the cytoplasm, contributing to GM-CSF hypersensitivity. [score:7]
As shown in Figure 2C, we found a slight STAT5b mRNA downregulation after miR-150-5p overexpression in all the three cell lines (Supplemental Figure 1). [score:6]
Remarkably, it has been reported that MLL in combination with MYC and LIN28B downregulates miR-150-5p expression in AML [23]. [score:6]
Functionally, miR-150-5p directly inhibits the translation of STAT5b mRNA. [score:6]
To gain insight on potential miR-150-5p targets that may be relevant to JMML pathogenesis, we performed in silico target prediction analysis using miRWalk2 (http://zmf. [score:5]
Altogether, our results indicate that deregulated miR-150-5p may play a role in the upregulation of key components of the GM-CSF signaling pathways, thus contributing to JMML pathogenesis. [score:5]
We have shown that miR-150 overexpression dampens STAT5b expression and activity and decreases significantly the cell proliferation of primary JMML samples. [score:5]
The increased availability of the substrate (STAT5b) caused by downregulation of miR-150-5p, may enhance the phosphorylation activation of STAT5b caused by the gain of function mutations in the RAS/ERK pathway key genes, such as KRAS, NRAS, NF1 and PTPN11 in JMML. [score:5]
Next, we overexpressed miR-150-5p mimic or control oligonucleotides in three different AML cell lines (K562, OCI-AML-3 and KG1a) that do not express miR-150-5p, using nucleoporation as described in Methods, and measured STAT5b mRNA and protein expression. [score:5]
To assess the impact of miR-150-5p expression on JMML cells sensitivity to GM-CSF, mononuclear cells from the BM of three JMML patients were transduced with lentiviral particles containing either empty control vector or miR-150-5p overexpressing GFP+ vector. [score:5]
After validating STAT5b as bona-fide target of miR-150-5p, we attempt to demonstrate whether miR-150-5p, STAT5b mRNA and Stat5 protein were also deregulated in a murine mo del of JMML. [score:4]
Taken together, our results identify miR-150-5p downregulation in JMML patients and in a JMML animal mo del. [score:4]
As shown in Figure 1, miR-150-5p was significantly downregulated in all JMML cases with respect to controls (Figure 1B; P<0.001). [score:4]
The expression of miR-150-5p is deregulated in various solid cancers, such as lung, gastric, colorectal, breast and pancreatic cancer [32]. [score:4]
We validated the global downregulation of miR-150-5p but not of miR-630 in all JMML patient samples with respect to controls using a different method of miR detection (qRT-PCR). [score:4]
JMML murine mo del recapitulates miR-150-5p deregulation and STAT5 overexpression found in human patient samples. [score:4]
MiR-150-5p directly targets STAT5b. [score:3]
Restoration of miR-150-5p levels could be a novel approach to target the aberrant signaling in JMML. [score:3]
A. MiR-150-5p expression levels in BM mononuclear cells from two JMML patients infected with miR-150-5p overexpressing lentivirus or empty vector (Control) evaluated by qRT-PCR. [score:3]
D. Western Blotting analysis of Stat5, phosphorylated Stat5 (p-Stat5) and β-actin (loading control) expression in OCI-AML-3, K562 and KG1a cell lines after transfection with miR-150-5p or empty vector control (CTR). [score:3]
As shown in Figure 4B, overexpression of miR-150-5p decreased significantly cell proliferation with respect to empty vector. [score:3]
Furthermore, we demonstrated that restoring miR-150-5p expression in JMML mononuclear cells decreases the sensitivity to GM-CSF. [score:3]
Expression levels of U44 were used to normalize the raw miR-150-5p Cq values. [score:3]
We first assessed miR-150-5p expression by qRT-PCR in whole BM cells and splenocytes from two different Ptpn11-mutated mice and their respective controls (Mx1-Cre transgenic mice on a C57BL/6 background). [score:3]
Last, the ectopic overexpression of miR-150-5p in mononuclear cells from JMML patients blocks the GM-CSF effects on cell proliferation. [score:3]
MiR-150-5p overexpression was obtained using AMAXA Nucleofector (Lonza, Basel, Switzerland) using Kit V, Kit L and Kit T for K562, KG1a and OCI-AML-3 respectively, transfecting 2.5μg of pEZX-MR04 miRNA precursor plasmid (Genecopoeia, Rockville, MD, USA) for each condition carrying full length miR-150-5p precursor clone, following manufacturer's instructions. [score:3]
Expression levels of U44 were used to normalize the raw miR-150-5p values. [score:3]
Using this program, we identified 626 putative targets for miR-150-5p. [score:3]
Cell Lines and miR-150-5p overexpression. [score:3]
Here, we show that STAT5b is a bona fide target of miR-150-5p. [score:3]
MiR-150-5p shows significant downregulation in all the different mutation subsets compared to controls, with the only relevant exception of NRAS-mutated patients (Figure 1C). [score:3]
Figure 4 A. MiR-150-5p expression levels in BM mononuclear cells from two JMML patients infected with miR-150-5p overexpressing lentivirus or empty vector (Control) evaluated by qRT-PCR. [score:3]
The ectopic overexpression of miR-150-5p in myeloid cell lines decreases both STAT5b mRNA and Stat5 protein level. [score:3]
After validation, we focused our studies on miR-150-5p and aimed to identify potential targets of this miR and to provide functional insights. [score:3]
Cells were transduced with lentiviral particles containing either empty control vector or miR-150-5p overexpressing vector. [score:3]
We also evaluated miR-150-5p levels in earlier progenitor cells (c-kit (CD117) receptor positive selected cells) from mouse spleens and found downregulation of miR-150-5p in c-kit [+] selected cells, as well as c-kit [−] cell populations (Figure 3C and 3D). [score:2]
MiR-150-5p was found downregulated in the two mouse samples, both in whole BM cells and splenocytes compared to controls (Figure 3A and 3B). [score:2]
MiR-150-5p overexpression decreases hypersensitivity of JMML bone marrow (BM) mononuclear cells to GM-CSF. [score:2]
MiR-150-5p targets STAT5b. [score:2]
The loss of miR-150-5p in JMML may increase the availability of Stat5b to undergo phosphorylation and activation, which may further enhance the GM-CSF sensitivity caused from gain of function mutations. [score:2]
Next, we validated the nCounter profiling results using qRT-PCR for the common deregulated miRs in all JMML subtypes: miR-630 and miR-150-5p. [score:2]
MiR-150-5p overexpression decreases hypersensitivity of JMML BM mononocuclear cells to GM-CSF. [score:2]
To validate this interaction, we used a luciferase reporter vector containing the 3′UTR sequence of STAT5b predicted to interact with miR-150-5p (Figure 2A) and co -transfected with miR-150-5p mimic or control (scrambled) into 293T cells. [score:1]
As shown in Figure 2b, asignificant reduction of luciferase activity was detected for STAT5b 3′UTRs in presence of miR-150-5p mimic with respect to controls. [score:1]
A. miR-150-5p expression in whole BM cells, B. unselected splenocytes and C. c-kit (CD117) positive or D. c-Kit negative selected splenocytes of Mx1-Cre; LSL-Ptpn11-D61Y (DY) mice and control mice (Mx1-Cre or CRE) as measured by qRT-PCR. [score:1]
Figure 2 A. Graph showing the interaction between the miR-150-5p seed sequence and the STAT5b 3′UTR. [score:1]
Furthermore, the observed luciferase reduction was abrogated when we co -transfected a luciferase reporter vector containing the mutated 3′UTR sequence of STAT5b along with the miR-150-5p mimic or controls (Figure 2B). [score:1]
Since miR-150-5p has a critical role in hematopoiesis [22] and has been shown to act as a tumor suppressor in myeloid leukemias [23], we further investigated the functional role of this miR in JMML. [score:1]
Figure 3 A. miR-150-5p expression in whole BM cells, B. unselected splenocytes and C. c-kit (CD117) positive or D. c-Kit negative selected splenocytes of Mx1-Cre; LSL-Ptpn11-D61Y (DY) mice and control mice (Mx1-Cre or CRE) as measured by qRT-PCR. [score:1]
Altogether, our data suggest that the loss of miR-150-5p may contribute to the aberrant GM-CSF hypersensitivity observed in JMML patients. [score:1]
C. miR-150-5p expression according to the molecular subset of JMML and controls as measured by qRT-PCR (KRAS P=0.002; PTPN11 P=0.001; UNKN P=0.045). [score:1]
Mutant STAT5b 3′UTR contsructs (MUT) were also co -transfected with miR-150-5p mimic or SCR oligonucleotides. [score:1]
Third generation lentiviral vectors containing the mature human miR-150-5p sequence were purchased from GeneCopoeia (Rockville, MD, USA) (CatN: LPP-HmiR0306-MR03-050). [score:1]
B. Histograms showing miR-150-5p expression in a subset of JMML patients (n=30) vs controls (n=8) as measured by qRT-PCR (P<0.001). [score:1]
A. Graph showing the interaction between the miR-150-5p seed sequence and the STAT5b 3′UTR. [score:1]
C. STAT5b mRNA expression in OCI-AML-3 (P=0.006), K562 (P<0.001) and KG1a (P=0.027) cell lines after transfection with miR-150-5p or empty vector control (CTR) as measured by qRT-PCR. [score:1]
Firefly Luciferase (FLuc) activities obtained from 293T cells co -transfected with wild type (WT) STAT5b 3′UTR construct and miR-150-5p mimic (P=0.026) or scrambled (SCR) oligonucleotides (control). [score:1]
The frequency of GFP positive cells in control versus miR-150-5p overexpressing JMML cell populations was calculated for a maximum period of 7 days after sorting the cells. [score:1]
Ten pmoles of miR-150-5p mimic or negative control mimic miRNA (ThermoFisher miRIDIAN, Waltham, MA, USA) (Catalogue Number: C-300632-03 and CN00-1000-01 for miR-150-5p and negative control respectively) was transfected into 293T cells together with 2 ug of either wild type or mutated pEZX-MT06 clones using Lipofectamine 2000 according to manufacturer's protocol. [score:1]
Successful overxepression of miR-150-5p was demonstrated by qRT-PCR (Figure 4A). [score:1]
[1 to 20 of 66 sentences]
7
[+] score: 212
Other miRNAs from this paper: mmu-mir-15b, hsa-mir-15b, hsa-mir-150
Importantly, suppressing the expression of any of the four targets inhibited leukemia cells growth as well as induced apoptosis in consistent with the effect of miR-150 (Figures 7b and c). [score:9]
Furthermore, we showed that knockdown PKC α expression inhibited leukemia cell growth, supporting that PKC α is an essential target and has critical roles in miR-150 -mediated antagonism to leukemia. [score:8]
Among the miR-150 downregulated genes, we identified 42 of them that overlapped with a subset of the 558 miR-150 target genes (Figures 4b and 5a) predicted according to TargetScan. [score:8]
After ectopic transfection of miR-150, 1792 probes (1491 genes) were significantly upregulated and 1266 probes (1046 genes) downregulated (Figure 4b). [score:7]
These results support that ectopic expression of miR-150 suppresses leukemia by simultaneously inhibiting multiple oncogenes. [score:7]
[30] Herein, we showed that forced expression of miR-150 significantly repressed endogenous expression of PKC α, and luciferase reporter/mutagenesis assays confirmed that PRKCA is a transcriptional target of miR-150. [score:6]
Furthermore, we investigated the molecular bases of miR-150 tumor suppressor function and identified the pathways regulated by miR-150 using microarray analysis in conjunction with TargetScan, a wi dely used methodology for the identification of miRNA targets. [score:6]
We demonstrated that miR-150 exerts a tumor suppressor function in vitro by inhibiting proliferation and inducing apoptosis in both leukemia cell lines and primary AML cells, and in vivo by reducing the growth of human leukemia engraftments in nude mice. [score:5]
As expected, markedly decreases in the expression of all four target proteins were detected both in vitro cultured cells and in xenograft tumors of the miR-150 -treated group (Supplementary Figure S4). [score:5]
These results show that the expression of miR-150 directly or indirectly affects many biological processes. [score:5]
In the present study, we show that miR-150 expression is markedly downregulated in most human ALL, AML, and CML specimens tested compared with healthy controls. [score:5]
Of note, Jiang et al. [12] recently showed that miR-150 inhibits MLL/AF9 -mediated leukemia transformation through targeting MYB and FLT3. [score:5]
To delineate the molecular basis of miR-150 tumor suppression roles in leukemia, we performed gene expression analysis in K562 cells transfected with miR-150 or the empty lentiviral vector control. [score:5]
As shown in Figure 2b, the overexpression of miR-150 inhibited the cell growth of all three leukemia cell lines. [score:5]
We used specific short hairpin RNA (shRNA) to knockdown one of four representative miR-150 targets (EIF4B, FOXO4, PRKCA, or TET3). [score:4]
21, 22, 23 We, therefore, speculate that miR-150 suppresses leukemia transformation through regulating multiple genes that involve in and coordinate several biological processes and pathways. [score:4]
To confirm the deregulation of miR-150 in leukemia, we analyzed miR-150 -expressing profile in samples from various de novo human leukemia at the diagnosis including ALL, AML, and CML, and healthy controls using quantitative RT-PCR (qRT-PCR). [score:4]
Knockdown of EIF4B, FOXO4, PRKCA, or TET3 significantly decreased the colony formation of K562 cells, similar as the effect seen in the miR-150-overexpression group (Figure 7d). [score:4]
These results demonstrate that miR-150 regulates EIF4B, FOXO4, PRKCA, and TET3 expression through binding with their 3′-UTR. [score:4]
The study not only broadens our understanding of the complex mechanisms underlying the pathogenesis of miR-150 deregulation in leukemia but also provides a rationale to target miR-150 for the treatment of leukemia. [score:4]
Next, the studies were done with random mutations in the recognition sequence in 3′-UTR, as described in the upper panel of the illustration (Figure 6), which resulted in impairment of the reporter inhibition by miR-150. [score:4]
The in vivo results support the tumor suppression function of miR-150 in leukemia. [score:3]
K562 cells were transfected in vitro with pseudoviral particles expressing miR-150. [score:3]
We next investigated whether these targets indeed are involved in miR-150 -mediated tumor suppression in leukemia. [score:3]
[32] Here we substantiated that FOXO4 is a bona fide target of miR-150. [score:3]
The microarray analysis showed a different pattern of gene expression between miR-150 and empty lentivirus -transfected cells (Figure 4a; class comparison, P<0.03, false discovery rate (FDR)<0.05). [score:3]
A total of 5 × 10 [6] viable K562 cells transiently overexpressing miR-150 and its counterpart control cells were inoculated subcutaneously in the flank of immunocompromised nude mice (eight per group). [score:3]
In addition, we identified EIF4B and TET3 as important targets of miR-150. [score:3]
These results suggest that miR-150 suppresses leukemia by controlling genes in multiple biological processes and signaling cascades. [score:3]
According to TargetScan, there are three predicted interaction sites for miR-150 in the EIF4B 3′-UTR and two sites are predicted to interact with miR-150 in the FOXO4, PRKCA, and TET3 3′-UTR. [score:3]
Another groups identified CBL and EGR2 as bona fide targets of miR-150 in MLL/AF9-transformed leukemia, [13] and loss of CBL sensitizes leukemia to chemotherapy. [score:3]
As expected, the observed luciferase activity reduction was abrogated when all of the miR-150 interaction sites in 3′-UTR of these targets were mutated. [score:3]
We also assessed its expression in leukemia patients with bone marrow remission and found that the miR-150 level was similar to that of normal controls (Figures 1b; 1.65±1.63 versus 1.00±1.32, P=0.29). [score:3]
To further validate the tumor-suppressing role of miR-150 in leukemia, we tested whether miR-150 could reduce tumorigenicity in a xenograft mo del. [score:3]
Moreover, miR-150 overexpression promoted caspase-3 activation and increased spontaneous apoptosis in these cells (Figures 2c and d). [score:3]
This moderate effect might be because miR-150 expression levels decreased gradually as tumor growing (Supplementary Figure S3a). [score:3]
Functional annotation of miR-150 -targeted genes. [score:3]
miR-150 suppresses cell growth and induces apoptosis in leukemia cell lines and primary AML samples. [score:3]
Next, we determined whether miR-150 overexpression sensitizes the antileukemia effect of cytarabine (Ara-C), a drug commonly used in the treatment of leukemia. [score:3]
The miR-150 -overexpressing vector is a feline immunodeficiency virus -based construct (GeneCopoeia, Guanzhou, China) consisting of the stem loop structure of miR-150 and its flanking genomic sequence cloned into the pEZX-MR plasmid. [score:3]
To explore the biological effects of miR-150 in leukemia, we overexpressed miR-150 in three leukemia cell lines (K562, Kasumi-1, and THP-1) by lentiviral infection (Figure 2a) and examined cell growth and viability. [score:3]
miR-150 inhibits leukemic growth in a xenograft murine mo del. [score:3]
miR-150 overexpression was confirmed by qRT-PCR. [score:3]
When the tumor volume reached ~50 mm [3] (day 19), we injected the synthetic miR-150 or scramble oligonucleotides directly into the tumors at days 1, 4, 7, and 10 for a total of four doses (Figure 3d). [score:2]
The expression levels of miR-150 were markedly decreased in ALL, AML, and CML, compared with that of healthy controls (Figure 1a). [score:2]
miR-150 is deregulated in human leukemia. [score:2]
The tumor growth was significantly slower after 25 days in the group overexpressing miR-150 compared with the control group (Figure 3a). [score:2]
These results indicated that dysregulation of miR-150 is ubiquitous in ALL, AML, and CML. [score:2]
When the tumor reached ~50 mm [3], 5  μg of synthetic miR-150 or scrambled oligonucleotides diluted in Lipofectamine (Invitrogen, Carlsbad, CA, USA) solution was injected directly into the tumors at days 1, 4, 7, and 10. [score:2]
[19] Using this approach, we identified 42 potential miR-150 target genes that were confirmed by qRT-PCR and some of them were further validated by luciferase reporter assays. [score:2]
Finally, we infected primary AML samples (n=2) with miR-150 lentivirus or empty lentivirus vector and treated them with Ara-C. Both miR-150 and Ara-C induced apoptosis in primary leukemia cells. [score:1]
Effects of miR-150 on gene transcriptions and various biological processes. [score:1]
Total RNA was extracted and purified from K562 cells transfected with miR-150 and the empty vector using the TRizol and RNeasy kit (Qiagen, Hilden, Germany). [score:1]
Similarly, miR-150 synergized with Ara-C in apoptosis induction (Figure 2e). [score:1]
We were able to detect a high level of miR-150 in the tumors (Supplementary Figure S3b). [score:1]
Importantly, most of these 42 genes were previously uncharacterized targets for miR-150. [score:1]
At day 16, the average tumor weights for the miR-150, scrambled, and control groups were 0.12 g±0.04, 0.24 g±0.05, and 0.27 g±0.05, respectively (Figures 3f and g). [score:1]
K562 cells were transduced with these shRNAs or miR-150. [score:1]
Collectively, our results help to delineate a complex signaling network mediated by miR-150 in leukemia. [score:1]
A marked reduction in the luciferase activity was observed when EIF4B, FOXO4, PRKCA, or TET3 construct was co -transfected with synthetic miR-150, but not with the scrambled oligonucleotides (Figures 6a–d). [score:1]
For each well, 100 nM (final concentration) of synthetic miR-150 or scrambled oligonucleotides was used. [score:1]
At day 34, the average tumor weights for the miR-150 and the control groups were 0.20 g±0.04 and 0.24 g±0.02, respectively (P=0.01; Figures 3b and c). [score:1]
As shown in Figure 3e, at 13 days after the first injection, tumors injected with miR-150 were significantly smaller than the ones injected with scrambled oligonucleotide or controls injected with the equivalent PBS (P<0.001). [score:1]
Functional characterization of miR-150 targets. [score:1]
To evaluate miR-150 expression in bone marrow mononuclear cells, real-time qRT-PCR for miRNA was performed. [score:1]
The 3′-untransted region (3′-UTR) of EIF4B, FOXO4, PRKCA, and TET3 predicted to interact with miR-150 were cloned into a pMIR reporter luciferase vector and co -transfected with miR-150 into 293T cells. [score:1]
Three cell lines were infected with lentivirus-containing miR-150 construct and cultured with Ara-C for 24 and 48 h. Cell viability, as determined by CCK8 test, decreased in a time -dependent manner after miR-150 or/and Ara-C treatment, and an enhanced antileukemia effect was observed in the miR-150 plus Ara-C group (Supplementary Figure S2). [score:1]
For the transduction, leukemic cells were infected with miR-150 lentivirus with an efficiency of ~50% as measured by GFP expression under an Olympus digital fluorescence microscope (Olympus, Tokyo, Japan). [score:1]
[1 to 20 of 68 sentences]
8
[+] score: 208
Other miRNAs from this paper: hsa-mir-150, dre-mir-150
However, analysis of the targeting of MYB 3' UTR by miR-150 in the various species in which functional target sites have been validated has shown that miR-150 targeting seems to be dependent on the use of different target sites. [score:9]
A comparative in silico analysis of the miR-150 target sites of MYB 3'UTRs from different species led to the identification of a single set of putative target sites in amphibians and zebrafish, whereas two sets of putative target sites were identified in chicken and mammals. [score:7]
We identified four putative miR-150 target sites in the chicken MYB 3'UTR (Fig. 3A), all matching the criteria for miRNA target recognition and target site sequence context within the 3'UTR [35, 61- 63]. [score:7]
The mutation of target site 2 completely abolished the repressor effect of gga-miR-150, as observed with the mt1234 reporter construct, in which all target sites were mutated. [score:6]
Thrombopoietin also induces megakaryopoiesis by downregulating MYB expression through the effects of miR-150 [39]. [score:6]
The expression pattern of the avian gga-miR-150 is similar to that of the human hsa-miR-150, which is expressed in normal human haematopoietic cell lineages but not in immortalised cell lines [16, 41]. [score:5]
The avian miR-150 bound to the same target sites in chicken cells and in the human cell line used to identify mammalian miR-150 target sites, demonstrating the specificity of this pattern of binding to the avian MYB 3'UTR. [score:5]
Although both target sites, s2 and s4, display strong base pairing with the gga-miR-150 seed sequence, only site s2, which also displays base pairing for 7 nt at its 3' end, is a functional target for gga-miR-150 (Fig. 3A and 3B). [score:5]
Functional miR-150 target sites have been validated in human, murine and zebrafish MYB 3'UTRs [16, 37] and orthologous functional target sites of miR-150 have been identified in mammals, but are not conserved in zebrafish. [score:5]
Detailed analysis of the sequence of the 3' UTR of MYB from various species showed that the short 3'UTRs of MYB (frog and medaka) and the 3' UTR of MYB orthologs of zebrafish contained two miR-150 target sites close together in the proximal region, less than 150 nt downstream from the stop codon, and that the large 3'UTR of chickens and mammals contained two additional miR-150 target sites located close together, between 800 and 970 nt from the stop codon (Fig. 4A). [score:5]
We identified no functional role for target sites 3 and 4 in chicken MYB, whereas gga-miR-150 targeted and repressed MYB mt3 or mt4 reporter constructs but not MYB mt2 reporter construct. [score:5]
Thus, gga-miR-150 specifically targets the 3'UTR of avian MYB, acting principally through target site s2 in both avian DF-1 cells and human 293FT cells. [score:5]
Our findings show that the number of putative miR-150 target sites has increased during evolution, with chicken and mammals displaying an additional set of target sites, but with only one of the sites in chicken being functional, that identical to the functional site in zebrafish. [score:5]
This specific miR-150 site usage was not cell-type specific and persisted when the chicken c-myb 3'UTR was used in the cell system to identify mammalian target sites, showing that this miR-150 target site usage was intrinsic to the chicken c- myb 3'UTR. [score:5]
Our study of the avian MYB/gga-miR-150 interaction shows that, despite the involvement of c-myb in development and haematopoiesis in a wide range of organisms, from zebrafish to humans, and its regulation principally through miR-150, the conservation of miR-150 target site functionality observed between chicken and zebrafish does not extend to mammals. [score:5]
We used a reporter assay to identify the functional targets of miR-150 in the avian MYB 3'UTR and performed a comparative in silico analysis of predicted and experimentally validated functional target sequences in the vertebrate MYB 3'UTR (frog, fishes, chicken, mammals). [score:4]
The 3' untranslated region (UTR) fragment (1259 nt from the stop codon) of the avian MYB cDNA (GenBank accession number NM_205306.1), which contains four putative miR-150 target sites, was amplified by PCR with primers 682 and 683, using genomic DNA from the thymus of a four-week-old chicken as the template. [score:4]
The mutation introduced into target site 3 of the chicken MYB, resulting in the sequence involved in base pairing to the miR-150 seed sequence being one nucleotide shorter than in mammals (Fig. 4B, Additional file 3), may account for the loss of function of this mutant site. [score:4]
The intermediate evolutionary position of chickens in the vertebrate group may provide insight into the evolution of MYB/miR-150 target sites. [score:3]
Moreover, miR-150 controls B-cell differentiation by targeting murine MYB in a dose -dependent manner [37]. [score:3]
We cloned avian mature miRNA-150-5P (Gallus gallus, gga-miR-150) from small -RNA libraries derived from spleen or peripheral blood leukocytes before and at advanced stages of Marek's disease virus (MDV) -induced lymphomagenesis in chickens (69 reads). [score:3]
Overall, in haematopoietic lineages and the B-cell subsets of tonsil tissues, miR-150 and MYB display opposite patterns of expression [40]. [score:3]
Recent studies have demonstrated that MYB targeting by miR-150 has been conserved throughout evolution, as it is observed in mice, humans and zebrafish [16, 37]. [score:3]
MYB is an evolutionarily conserved miR-150 target experimentally validated in mice, humans and zebrafish. [score:3]
The stable expression of constructs encoding miR-150 or miR-150mut in PA9 cells was obtained by electroporation with the pmiR-150 and pmiR-150mut plasmids, respectively, using the Amaxa nucleofector device (Lonza): plasmid (2.5 μg) was added to 2 × 10 [6 ]cells, with a pcDNA control used in parallel, and cells were cultured in complete RPMI-1640 medium without selection for 24 hours. [score:3]
c-myb is the only member of the MYB family of transcription factor genes targeted by miR-150. [score:3]
Opposite patterns of miR-150 and MYB expression are also observed in immortalised cell lines, in which no miR-150 is detected [41]. [score:3]
Chicken gga-miR-150 targets avian MYB. [score:3]
Click here for file Predicted binding structures for miR-150 and the four putative target sites (s1, s2, s3, s4) from different species, through evolution. [score:3]
Our study of the avian MYB/gga-miR-150 interaction shows a conservation of miR-150 target site functionality between chicken and zebrafish that does not extend to mammals. [score:3]
By targeting MYB, miR-150 also drives the differentiation of murine megakaryocyte-erythrocyte progenitors into megakaryocytes, indicating a key role for miR-150 in controlling lineage commitment [38]. [score:3]
Predicted binding structures for miR-150 and the four putative target sites (s1, s2, s3, s4) from different species, through evolution. [score:3]
Figure 3 The avian MYB 3'UTR contains a functional miR-150 target site. [score:3]
We used a miR-150 mutant plasmid (pmiR-150mut) as a control, with the deletion of one C residue within the miR seed sequence (Fig. 1), to prevent pairing between gga-miR-150 and putative targets in the avian MYB 3'UTR. [score:3]
Thus, in chickens, as in humans [16], the repression of MYB WT reporter activity by miR-150 does not seem to be cell type-specific and gga-miR-150, like its orthologues in humans, mice and zebrafish [16, 37], specifically targets the 3'UTR of MYB. [score:3]
Features common to all miR-150/MYB target sites have been identified in studies of different species: a perfect seed match of eight to nine nucleotides is required, with either additional 3' pairing or synergy with another closely located site. [score:3]
gga-miR-150 uses a target site orthologous to that of zebrafish. [score:3]
org was used to list potential miR-150 target sites from mammalian, frog and chicken MYB 3'UTRs. [score:3]
We used human 293FT cells, originating from the HEK-293T cell line, as a reference heterologous system, because the HEK-293T cell line has been used to identify miR-150 target sites in mice, humans and zebrafish [16, 37]. [score:3]
Figure 4Putative miR-150 target sites in MYB 3'UTR conserved through evolution. [score:3]
The use of target site s2 by gga-miR-150 therefore seems to result from the intrinsic properties of the chicken MYB 3'UTR. [score:3]
The chicken MYB 3'UTR contains the same four putative miR-150 target sites as observed in mammals, but retains the same functional site as zebrafish. [score:3]
We generated MYB mutant reporters, containing mutations (poly-T or A-replacing sequences) generating mismatches within the "seed region" of miR-150, using a PCR -based protocol, as previously described [65]. [score:2]
The production of miR-150 in mature B and T cells has been shown to block early B-cell development, and its ectopic production in haematopoietic stem cells and progenitor cells has been shown to result in significantly lower than normal numbers of mature B cells [36]. [score:2]
Reporter assays showed that gga-miR-150 acted on the avian MYB 3'UTR and identified the avian MYB target site involved in gga-miR-150 binding. [score:2]
These findings are consistent with the deletion of one nucleotide from the mature mutated gga-miR-150, confirming the successful transcription and maturation of synthetic avian pre-miR-150 from vectors with pol II promoters [60]. [score:1]
BM screened the spleen and blood leukocyte small -RNA libraries, isolated gga-miR-150 and helped with northern-blot analysis. [score:1]
This observation highlights the importance of extended 3' pairing for gga-miR-150. [score:1]
Hairpin structures of threedifferent mammalian pre-miR-150 sequences and of the synthetic Gallus gallus pre-miR-150. [score:1]
We assessed the functionality of gga-miR-150, by establishing stable lymphoid chicken MDV cell lines ectopically producing gga-miR-150 or mutated gga-miR-150. [score:1]
Additional Blast analysis of the miR-150 sequence against the MYB 3'UTR sequence of each species analysed was carried out with the accessory application "local blast" available in BioEdit version 7.0.5 sequence alignment software. [score:1]
We identified the avian mature miRNA-150-5P, Gallus gallus gga-miR-150 from chicken leukocyte small -RNA libraries and showed that, as expected, the gga-miR-150 sequence was highly conserved, including the seed region sequence present in the other miR-150 sequences listed in miRBase. [score:1]
Cloning of mature avian gga-miR-150. [score:1]
The seed sequence (nt2 to nt8) of miR-150 is shown in red, bold. [score:1]
gov/projects/genome/guide/chicken/ and we were unable to identify pri-miRNA gga-miR-150 on the basis of synteny with human and zebrafish. [score:1]
Additional pairing to the middle and the 3' end of gga-miR-150 was also observed, extending from one individual match to seven consecutive matches, for sites s4 and s2, respectively (Fig. 3A). [score:1]
We normalised luciferase activity, taking the value for MDVT-150mut cells as 100%, as mutated gga-miR-150 did not repress activity in MDVT-150mut cells. [score:1]
cgi?acc=GPL6541 contain the seed region (nt2 to nt8) sequence (CUCCCAA) identified in the other twelve miR-150 sequences listed in miRBase [55, 56] http://microrna. [score:1]
The mature miR-150 is shown in italics and the seed sequence is shown in red. [score:1]
However, the functional miR-150 sites of humans and mice are orthologous, whereas that of zebrafish is different. [score:1]
Northern blots showed the ectopic production of a mature gga-miR-150 of the same size by MDVT-150 cells and spleen cells, whereas a slightly smaller mature mutated gga-miR-150 was detected in MDVT-150mut cells (Fig. 2A). [score:1]
By contrast, gga-miR-150 was not detected in libraries derived from chicken immortalised lymphoid cell lines [52, 53]; [our unpublished data]. [score:1]
The sequence of the precursor pri-miRNA gga-miR-150 is not present in the released sequence of the Gallus gallus genome [57] http://www. [score:1]
The activity of the MYB WT reporter was specifically repressed by gga-miR-150 in PA9 and MSB-1T-150 cells (by up to about 80%) (Fig. 2B). [score:1]
We therefore constructed a synthetic avian pre-miR-150, based on a comparison of various mammalian pre-miR-150 sequences and stem loop structures (Additional file 1). [score:1]
All mature miR-150 sequences begin with a uracil (U) residue and only four positions have been found to harbour changes (Fig. 1). [score:1]
The mature gga-miR-150 sequence differed from its human and murine counterparts by one residue, and from the zebrafish sequence by two residues (Fig. 1). [score:1]
Despite the sequence conservation between avian and mammalian MYB 3'UTRs making it possible to align these sequences, our observations suggest that the intrinsic characteristics of the avian MYB 3'UTR result in avian miR-150 selecting a target site different from its mammalian orthologs. [score:1]
Avian DF-1 fibroblasts were used to assess gga-miR-150 site usage in the homologous system. [score:1]
Figure 1 Comparison of the sequence of avian gga-miR-150 with all miR-150 sequences from the miRBase. [score:1]
MDV cells ectopically producing gga-miR-150 (MDVT-150) or mutated gga-miR-150 (MDVT-150mut) and control pcDNA -transfected cells (MDVT) were then isolated by selection on neomycin. [score:1]
Click here for file Hairpin structures of threedifferent mammalian pre-miR-150 sequences and of the synthetic Gallus gallus pre-miR-150. [score:1]
The sequences of miRNAs seem to have been conserved during evolution, because the mature gga-miR-150 cloned from our libraries and the recently released sequence [54] http://www. [score:1]
Isolation of lymphoid cells ectopically producing miR-150 or miR-150mut. [score:1]
By contrast, miR-150 acts at sites s3 and s4 in mice and humans (Fig. 4B)[16, 37]. [score:1]
The sequence of the mutated gga-miR-150 (gga-miR-150mut) that we constructed is shown. [score:1]
Figure 2 gga-miR-150 ectopically produced in stable lymphoid chicken PA9 and MSB-1 cells represses the avian MYB reporter. [score:1]
We investigated the targeting of avian MYB by gga-miR-150, by inserting the 3'UTR fragment of the chicken MYB cDNA into a pRL-TK vector downstream from the Renilla luciferase reporter gene. [score:1]
[1 to 20 of 78 sentences]
9
[+] score: 180
Other miRNAs from this paper: mmu-mir-675
673 miR-150 directly suppresses the expression of target genes, Elk1, Myb, Etf1, which are 674 critical mediators of activation of the B cell receptor (BCR) signaling cascade. [score:8]
Surprisingly, our results indicated that knockdown of these miR-150 targets reduced expression of upstream BCR signaling pathway components (i. e. src and lyn), suggesting the potential involvement of miR-150 in modulating a feedback circuit in B cell activation. [score:6]
In contrast, mutation of the miR-150 binding site in the 3′ untranslated regions (UTR) of Elk1 and Etf1 prevented inhibition of luciferase activity by miR-150 (Fig. 7A). [score:6]
n = 3. (B) After 72-hour activation, the expression of miR-150 target genes in splenic WT or miR-150 KO B cells. [score:5]
Intriguingly, knockdown of Myb, Etf1, or Elk1 significantly decreased activation of B cells with respect to activation of BCR signaling pathways and MHC II membrane expression, as compared to miR-150 KO B cells infected with a control vector harboring scrambled target sites (Fig. 7C,D). [score:5]
Expression of miR-150 target genes Elk1, Etf1, and Myb was also enhanced in miR-150 KO B cells during in vitro activation (Fig. 7B). [score:5]
Briefly, the full 3′-untranslated region (3′-UTR) sequence of the predicted target gene or at least 250-bp flanking the predicted miR-150 binding site was cloned into the psiCheck2 Vector (Promega) downstream of the Renilla luciferase-coding region. [score:5]
Using a luciferase reporter assay, we confirmed that Elk1 and Etf1 are bona fide miR-150 target genes as evidenced by suppression in their luciferase activities in the presence of miR-150 (Fig. 7A). [score:4]
n = 3. (C) The activation of BCR signaling pathways in miR-150 KO B cells with knockdown of miR-150 target genes in response to LPS stimulation. [score:4]
n = 3. (D) MHC II production by miR-150 KO B cells after knockdown of miR-150 target genes in response to LPS stimulation. [score:4]
Several genes targeted by miR-150 mediate its regulation of B cell functions. [score:4]
These miR-150 target genes, Myb, Elk1, and Etf1, are known to be important in regulating B cell differentiation and function. [score:4]
Ectopic expression of miR-150 in all tissues or in hematopoietic stem cells, significantly and specifically impairs B lineage development by blocking the transition from pro-B to pre-B stages. [score:4]
Repressive effects of miR-150 on target genes were plotted as the percentage repression in three biological repeats that each contained three technical repeats. [score:3]
Next, we determined whether loss of miR-150 alters B cell, T cell or macrophage activation directly or indirectly using two sets of experiments: (a) purified cell populations subjected to activation; or (b) co-culture analysis to examine cell-cell interaction mediated activation. [score:3]
miR-150 controls B cell functions through multiple target genes. [score:3]
The ability of miR-150 to simultaneously target multiple genes allows it to exert a potent impact by altering signaling networks governing adipose tissue B cell function (Fig. 8). [score:3]
Higher levels of IgA and IgG subtypes IgG1 and IgG2b, and enhanced interferon γ (IFNγ) expression post stimulation, were observed in plasma of HFD-miR150 KO mice (Fig. 4C,D,E). [score:3]
In this study, we found that miR-150, a hematopoietic enriched microRNA exerting profound regulatory effects on B cell formation and function, is a novel molecule regulating obesity -associated adipose tissue inflammation and insulin resistance. [score:3]
n = 4. (F) The gene expression of B cell receptor (BCR) signaling pathway components in WT or miR-150 KO B cells. [score:3]
In this study, we demonstrate that miR-150, a B cell enriched regulatory microRNA, plays a role in modulating the pathogenesis of obesity associated adipose tissue inflammation and insulin resistance, which are major contributors to metabolic syndrome and development of type 2 diabetes. [score:3]
n = 6. (E–H) The expression level of BMDM activation-related surface markers and key genes after 48 hours co-cultured with activated WT or miR-150 KO B cells. [score:3]
Transplantation of WT B cells into obese VAT also increased VAT inflammatory gene expression, which was further elevated in B [miR-150 KO] transplanted animals (Supplementary Figure S16). [score:3]
These results demonstrated that Myb, Elk1 and Etf1 are bona fide targets of miR-150, and play critical roles in mediating miR-150’s effects on B cell functions. [score:3]
We observed dramatically reduced expression of miR-150 in VAT B-cells isolated from obese mice (Fig. 5A). [score:3]
For example, expression of TNFα, IL1β, IL6 and CCL2 was significantly higher in the visceral fat pads from HFD-miR-150 KO mice than from HFD-WT mice (Fig. 2C,D). [score:3]
miR-150 deficiency directly enhances adipose tissue B cell function. [score:2]
Taken together, these results suggest that miR-150 is a crucial regulator of metabolic function in adipose tissue of mice with diet -induced obesity. [score:2]
miR-150 may modulate obesity -associated insulin resistance and tissue inflammation by regulating B cell interactions with other immune cells. [score:2]
miR-150 is an important regulator of adipose tissue B cell function. [score:2]
miR-150 regulates B cell -dependent interactions with macrophages and T cells ultimately altering adipose tissue function. [score:2]
miR-150 regulates obesity -induced inflammation. [score:2]
In addition to the dysregulated metabolic phenotype observed in miR-150 KO mice, our analysis of individual immune compartments in VAT revealed that the enhanced ATB activation profile in obesity was further exacerbated by miR-150 deficiency (Supplementary Figure S5). [score:2]
How to cite this article: Ying, W. et al. miR-150 regulates obesity -associated insulin resistance by controlling B cell functions. [score:2]
In summary, these results suggest that miR-150 deficiency does not directly affect macrophage polarization or T cell activation, but can enhance B cell activity in response to stimuli. [score:2]
Furthermore, obese miR150 KO ATMs displayed a more proinflammatory phenotype compared to WT obese ATMs as demonstrated by increased proportions of proinflammatory CD206-CD11c+ M1 macrophages and significantly enhanced proinflammatory gene expression (Supplementary Figure S6). [score:2]
Further investigation regarding the mechanisms of miR-150 and B cell action will greatly facilitate development of therapeutics treating obesity -associated complications by targeting microRNAs and modulating B cells. [score:2]
Previous studies identified several hematopoietic enriched microRNAs including miR-150, which is a critical regulator of B cell formation 20 21. [score:2]
miR-150 KO ATBs are critical contributors to obesity associated glucose intolerance. [score:1]
HFD-miR-150 KO mice exhibited higher amounts of immunoglobulin in plasma than HFD-WT mice (Fig. 4C); therefore we purified immunoglobulins using the NAb [TM] Protein L Spin kit (Supplementary Figure S17). [score:1]
The lentiviral supernatants were collected after 72 h transfection and used to infect purified splenic miR-150 null B220+ B cells. [score:1]
Surprisingly, glucose intolerance was similar in mice receiving purified immunoglobulin from miR-150 KO or WT mice (Supplementary Figure S18). [score:1]
First, we co-cultured purified mature adipocytes from HFD-WT mice with activated WT or miR-150 KO B cells. [score:1]
The reporter constructs were cotransfected with miR-150 mimic oligonucleotides or negative control oligonucleotides into HEK293 cells. [score:1]
Several important components of this pathway were significantly increased, including Syk (spleen tyrosine kinase), Lyn(v-yes-1 yamaguchi sarcoma viral related oncogene homolog) and Src (v- src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog), suggesting that enhanced B cell responses due to miR-150 deficiency are likely BCR -dependent (Fig. 4F). [score:1]
We found that loss of miR-150 KO did not significantly change the activation profiles of macrophages with respect to polarized or acute phase stimulation (Supplementary Figures S7 and S8). [score:1]
Therefore, we examined activation of T cells and macrophage in the presence of B cells with or without miR-150 deletion. [score:1]
Although loss of miR-150 did not significantly alter activation states of macrophages and T cells under the obese stress(Supplementary Figures S4 and S5) 21, the overall proinflammatory profile was enhanced (Fig. 2). [score:1]
miR-150 deficiency -dependent insulin resistance is mediated by adipose tissue B cells. [score:1]
After 12-week on a HFD, spleens were collected from HFD-fed WT and miR-150 KO mice and mechanically dissociated. [score:1]
We confirmed that miR-150 KO B cells can enhance both T cell and macrophage activation profiles (Fig. 6) which can impair insulin tolerance in adipose tissue transplanted with miR-150 KO B cells (Fig. 5D). [score:1]
More importantly, miR-150 significantly affects antigen presentation on the B cell membrane, as evidenced by a higher abundance of MHC II on miR-150 null B cells in response to stimuli (Fig. 4). [score:1]
HFD-B [null]-B [miR-150 KO], HFD-fed B [null] mice injected with miR-150 KO B cells; HFD- B [null]-B [WT], HFD-fed B [null] mice injected with WT B cells. [score:1]
Activated WT B cells or miR-150 KO B cells were also co-cultured with WT M1 or M2 BMDMs at a ratio of 1:10 using a trans-well plate. [score:1]
miR-150 ablation exacerbates obesity -induced systemic insulin resistance. [score:1]
All T cells, B cells, and BMDMs were derived from 4–6 week old miR-150 KO or WT chow diet fed mice. [score:1]
The overall proinflammatory pattern of cytokines in plasma was even greater in miR-150 KO mice fed a HFD (Fig. 2A,B). [score:1]
n = 7–10 (D) Immune cell components in VAT of HFD-fed WT and miR-150 KO mice detected by immunostaining analysis. [score:1]
Immunoglobulin proteins were isolated from plasma of HFD-WT or miR-150 KO mice using NAb [TM] Protein L Spin kit (Cat. [score:1]
Although miR-150 depletion in macrophages did not alter their activation (Supplementary Figure S4), proinflammatory M1 macrophages co-cultured with miR-150 KO B cells displayed a significantly enhanced proinflammatory activation profile, including activation-related surface markers and production of cytokines (Fig. 6E,F). [score:1]
miR-150 deficiency exacerbates obesity -induced metainflammation and systemic insulin resistance. [score:1]
Although our results do not totally rule out the importance of total immunoglobulins in controlling obesity -induced glucose intolerance, it is likely that the effects of miR-150 on obesity -induced insulin resistance are not related to production of pathogenic antibodies. [score:1]
Under both fed and fasted conditions, HFD-miR150 KO mice exhibited significantly higher plasma levels of glucose (Fig. 3A) and insulin (Fig. 3B) than HFD-WT mice; whereas both glucose and insulin levels were similar in mutant and wild type mice on chow diet (Fig. 3A,B). [score:1]
Similarly, isolated miR-150 KO CD4+ or CD8+ T cells responded to stimuli identically to wild type T cells with respect to surface marker induction and cytokine production (Supplementary Figures S7 and S9). [score:1]
Winer et al. suggested that immunoglobulin production by B cells could contribute to insulin resistance 19; however, we failed to observe such a contribution in response to purified immunoglobulins from HFD-miR-150 KO or HFD-WT mice. [score:1]
The generation of miR-150 -deficient (miR-150 KO) and B [null] B6 mice has been previously described 21 26. [score:1]
Moreover, transplantation of B [miR-150 KO] cells into HFD-B [null] mice exacerbated the glucose intolerance observed in HFD-B [null]-B [WT] mice (Fig. 5E). [score:1]
miR-150 KO B cells also exhibited higher membrane levels of MHCII complex than wild type B cells exposed to TD stimuli (Fig. 4B). [score:1]
Interestingly, deletion of miR-150 resulted in undetectable changes in hematopoietic lineages and non-hematopoietic tissues, but increased B cell activation in response to stimuli. [score:1]
We observed that B cells lacking miR-150 displayed a slight increase in immunoglobulin production, which could partially contribute to higher circulating levels of IgG and IgA in plasma of mice fed a HFD. [score:1]
The elevated inflammatory milieu in HFD-miR-150 KO mice was further confirmed by enhanced activation of JNK pathway in visceral white fat (Fig. 2E). [score:1]
Schematic mo del of miR-150 -mediated molecular network in B cells. [score:1]
Engraftment of B [miR-150 KO] or B [WT] cells in the adipose tissue was confirmed using flow cytometric analysis (Fig. 5B). [score:1]
Taken together, our results suggest that B cells in adipose tissue are primary contributors to adipose tissue inflammation and systemic insulin resistance in obese miR-150 KO mice. [score:1]
Taken together, these results suggest that miR-150 potentially modulates obesity induced adipose tissue inflammation through controlling B cell function interactions with macrophages and T cells. [score:1]
Although loss of miR-150 did not significantly affect the responses of purified T cells or macrophages to stimuli, it is possible that enhanced activation of ATBs enhances their activities in VSCs from obese individuals through cell-cell interactions. [score:1]
n = 3. Splenic B cells were derived from 6–8 week old WT or miR-150 KO chow diet fed mice. [score:1]
Isolated splenic WT or miR-150 KO B cells were activated for 72-hours with 10 μg/mL LPS, 10 ng/mL IL4 or 10 μg/mL anti-CD40 (Cat. [score:1]
These results suggest that the impact of miR-150 deletion is unmasked by HFD -induced obesity. [score:1]
Furthermore, analysis of Akt activation in VAT and liver after portal vein insulin injection indicated that miR-150 deficiency significantly impaired the insulin signaling pathway in mice under obese stress. [score:1]
Despite similar food intake and body weight gain over a 12-week feeding period (Supplementary Figure S3A and B), as well as comparable adiposity (Supplementary Figure S3C), HFD-miR-150 KO mice exhibited severely exacerbated obesity -induced metainflammation and insulin resistance (Figs 2 and 3). [score:1]
M2 cells showed a similar activation status when co-cultured with either WT or miR-150 KO B cells (Fig. 6G,H). [score:1]
Furthermore, we now confirm that deletion of miR-150 in B cells significantly alters B cell activation in response to both T cell -dependent and T cell-independent stimuli with respect to increasing activation of BCR signaling pathways and immunoglobulin production (Fig. 4). [score:1]
Splenic B cells were derived from 6–8 week old miR-150 KO chow-diet fed mice. [score:1]
Following 72-hour activation with 10 μg/mL LPS, 10 ng/mL IL4 or 10 μg/mL anti-CD40, WT or miR-150 KO B cells were mixed with WT CD4+ or CD8+ T cells at a ratio of 1:10 in the presence of anti CD3 and CD28. [score:1]
The population of adipose tissue macrophages (A; ATM), adipose tissue B cells (B; ATB), and adipose tissue T cells (C; ATT) in visceral stromal cells (VSC) of visceral adipose tissues (VAT) of wild type (WT) or miR-150 KO mice with or without high-fat diet (HFD). [score:1]
Surprisingly, mice with miR-150 depletion (miR-150 KO) did not exhibit significantly different proportions of ATMs, ATTs, or ATBs as determined by flow cytometry and immunostaining analysis (Fig. 1A–D). [score:1]
These results suggest that miR-150 deficiency in B cells is sufficient to exacerbate glucose intolerance in obese mice. [score:1]
Although Akt activation in the skeletal muscle did not reach statistical significance, it did display a consistent trend towards decreased activation in miR-150 KO animals (Fig. 3E, Supplementary Figure S4). [score:1]
Furthermore, transplantation of obese B [miR-150 KO] cells significantly increased the elevated fasting plasma insulin and glucose seen in HFD-B [null]-B [WT] mice (Supplementary Figure S15). [score:1]
Body weight gain and adiposity were monitored post transplantation and significance differences were not observed between mice that received 1 × 10 [7] B cells from either HFD-miR-150 KO (B [miR-150 KO]) or HFD-WT (B [WT]) mice (Supplementary Figure S14). [score:1]
[1 to 20 of 91 sentences]
10
[+] score: 174
Figure 4(A) Expression of miR-150 in My-La, HH, and HUT78 cells treated with histone deacetylase inhibitor (HDACI, vorinostat, 5.0 μM), MDM2 inhibitor [nutlin-3a, 2.5 μM (My-La), 20 μM (HH and HUT78)], and/or methyltransferase inhibitor (RG108, 200 μM). [score:9]
The commonly upregulated miRNAs included those of 34 known tumor suppressor genes (e. g., miR-16, miR-96, miR-150, miR-183, miR-186, miR-194, miR-320, and miR-371), nine miRNAs of oncogenes (e. g. miR-454), and 14 miRNAs that show both tumor suppressive and oncogenic function(Supplementary Table S1). [score:8]
Therefore, vorinostat and panobinostat might upregulate tumor suppressive miRNAs including miR-150, leading to migration inhibition. [score:8]
Although we showed that miR-150 was downregulated significantly in the lymph-node tissue samples from advanced CTCL [10], its expression in the early stage has not been examined. [score:6]
These results also support our hypothesis that miR-150 is downregulated by HDAC activation and that the inhibition of migration by miR-150 occurred independently of the p53 status in CTCL. [score:6]
We found that miR-150 was downregulated only in advanced MF cases, and its expression was restored by pan-HDACI treatment, suggesting that this effect might be mediated by epigenetic silencing mechanisms of miR-150 during the progression of MF. [score:6]
To examine whether this methylation mechanism for miR-150 downregulation also occurs in CTCL, we examined the effects of a methyltransferase inhibitor (RG108) on CTCL cells. [score:6]
Pan-HDACIs upregulate various tumor suppressive miRNAs including miR-150 in CTCL cells. [score:6]
Another interesting finding was that the vorinostat- and panobinostat-exposed HH and My-La cells showed very similar miRNA expressions (Figure 2D) and the upregulation of miR-150 in these cells was also confirmed by the northern blot analysis (Figure 2E). [score:6]
We previously demonstrated that the expression level of miR-150 was suppressed in both T/NK cell lymphoma [9] and advanced CTCL [10]. [score:5]
We found that the miR-150, at least, was strongly expressed in normal CD4 [+] cells, but the others showed very low or no expressions. [score:5]
These results suggest that miR-150 expression declines with disease progression in CTCL (Figure 5C). [score:5]
These data strongly suggest that the most likely target miRNA of the pan-HDACIs in metastasis inhibition was the miR-150 in the metastatic CTCL. [score:5]
Based on this finding, we determined whether miR-150 expression was also affected by p53 status by examining the combination effect of vorinostat and nutlin-3a [an inhibitor of MDM2, an activation factor of p53 (refs. [score:5]
#1: miR-150 expression of different clinical courses (MF1, MF6, MF7, and MF22), #2: miR-150 expression of the same patient from different biopsy regions patch/plaque and tumor (MF23, MF24, MF25, and MF28). [score:5]
We demonstrated that the miR-150 expression level was significantly higher in the early specimen than it was in the advanced specimen, although there was no significant difference in the expression between AD and the early samples. [score:5]
Vorinostat has been shown to contribute significantly to a superior survival than chemotherapy only in the advanced-stage of MF [46], suggesting that HDACI may be useful for cases with downregulation of miR-150. [score:4]
Downregulation of miR-150 in advanced CTCL. [score:4]
Expectedly, miR-150 was one of the commonly upregulated miRNA. [score:4]
We demonstrated that the downregulation of miR-150 induced metastasis of CTCL cells [10]. [score:4]
Because there is no current report on genomic alteration of the miR-150 region and no mutation is evident in the pre-miRNA-150 gene [11], we suspected that epigenetic mechanisms such as the activation of histone deacetylases might be responsible for repressing miR-150 expression in advanced CTCL. [score:4]
In this study, we further demonstrated that the interaction between CCR6 and its specific ligand, CCL20, plays an important role in increasing the nutrition -dependent migration in advanced CTCL [11], although the mechanism underlying the downregulation of miR-150 in CTCL is still unclear. [score:4]
miR-150 is downregulated during progression of primary CTCL cases. [score:4]
The western blot analysis demonstrated that CCR6 was commonly downregulated by the transduction of miR-150 in the My-La, HH, and HUT78 cells (Figure 3C). [score:4]
The qRT-PCR demonstrated that the expression of miR-150 was significantly lower in the advanced specimens than it was in samples from patients with AD. [score:3]
We used this in vivo mouse mo del to further determine whether miR-150 inhibits tumor metastasis. [score:3]
However, RG108 in My-La and HH cells could not restore the expression of miR-150 (Figure 4A–4C), suggesting that miR-150-silencing by DNA methylation does not occur in CTCL. [score:3]
We previously reported that xenografted mice transplanted with miR-150-transduced CTCL cells inhibited the invasion and metastasis and prolonged their survival [10]. [score:3]
Thus, administration of miR-150 may have prolonged mouse survival through a metastasis inhibition mechanism. [score:3]
Vorinostat restores miR-150 and inhibits migration independently of p53 status. [score:3]
Therefore, to examine the expression of miR-150 in primary CTCL, we conducted a qRT-PCR analysis of samples from early and advanced cases. [score:3]
The suppression of miR-150 appears to be one of the genetic or epigenetic events that might occur in the late stage of CTCL and underlies the invasiveness/metastasis of CTCL cells. [score:3]
In addition, to examine whether these candidate miRNAs regulate CCR6, we transiently transduced 12 miRNAs including miR-150, miR-96, miR-183, miR-194-5p, miR-320a, miR-371a-5p, miR-3135b, miR-3652, miR-4534, miR-4698, and miR-6088. [score:2]
We compared the miR-150 expression of six individual cases, which were samples from the same patients [four cases each were samples from different clinical time points (#1) and different legions of the same time course (#2)]. [score:2]
A migration assay using these miRNAs was further conducted in the My-La, HH, and HUT78 cells, which revealed that miR-150 inhibited the migration of these three cell lines (Figure 3D). [score:2]
In addition, a previous study showed that miR-150 silencing occurred through a DNA-methylation mechanism in anaplastic large cell lymphomas [31]. [score:1]
Our study further suggests that miR-150 could not only be a powerful biomarker for molecular diagnosis and a predictor of metastasis, but it could also be a novel therapeutic agent for use in advanced CTCL. [score:1]
In vivo administration of mi/siRNA to xenografted miceMature miR-150 (AteloSiLence [®]) was purchased from KOKEN CO. [score:1]
Mature miR-150 (AteloSiLence [®]) was purchased from KOKEN CO. [score:1]
We administered miR-150 or siCCR6 (30 μM each) to the CTCL mice via the tail vein every 5 days. [score:1]
30 μM of siCCR6 or miR-150 plus atelocollagen (200 μl) (AteloGene [®] Local Use “Quick Gelation” kit. [score:1]
This result suggests that only the miR-150 might be functional and tumor significant in CTCL metastasis. [score:1]
The miR-150 levels did not significantly differ between the early and the AD specimens, but a significant difference was detected between the early and advanced specimens (Figure 5B). [score:1]
In vivo administration of miR-150 to CTCL xenograft mouse mo del. [score:1]
In vivo administration of miR-150 to CTCL-xenografted mice prolonged their survival. [score:1]
The results presented in Figure 3 strongly suggest that miR-150 might be epigenetically silenced during the progression of CTCL. [score:1]
Figure 6 In vivo administration of miR-150 to CTCL xenograft mouse mo delSchematic diagram of injection protocol. [score:1]
In vivo administration of miR-150 to CTCL-xenografted mice prolonged their survivalWe previously established a mouse mo del of metastasis and invasion of CTCL in NOD/Shi-scid IL-2γnul (NOG) mice, which were transplantated with 2 × 105 My-La cells and died owing to tumor cell invasion and metastasis to multiple visceral organs/tissues during day 29–35 after the transplantation [10, 11, 18]. [score:1]
Our data suggest that miR-150 is a candidate with prognostic value. [score:1]
Transduction efficacy of miR-150 against CTCL cell lines was described in our previous report [10]. [score:1]
Among the agents investigated, we found that only vorinostat dose -dependently increased the expression of miR-150 in the My-La and HH cells (Figure 4A). [score:1]
[1 to 20 of 51 sentences]
11
[+] score: 164
miR-150 regulates MNC migration by targeting Cxcr4 Since miR microarray analysis revealed that miR-29c, miR-98/let-7 family, miR-150, miR-195 and miR-494 expression was significantly downregulated in BM-derived MNCs, we extensively examined databases for predicted targets of these miRNAs involved in MNC mobilization. [score:11]
Since miR microarray analysis revealed that miR-29c, miR-98/let-7 family, miR-150, miR-195 and miR-494 expression was significantly downregulated in BM-derived MNCs, we extensively examined databases for predicted targets of these miRNAs involved in MNC mobilization. [score:8]
Here we report CXCR4 expression as a target of miR-150 which is downregulated in BM-derived MNCs in response to AMI, leading to MNC mobilization and migration in PB. [score:8]
In this study, we reported here for the first time that the expression of miR-150 was downregulated in BM MNCs in response to myocardial ischemia with simultaneous induction of CXCR4 protein expression. [score:8]
In conclusion, our results demonstrated that miR-150 downregulation by AMI enhanced CXCR4 expression, leading to enhanced BM-MNCs mobilization and migration. [score:6]
As shown in Figure 3C, knockdown of miR-150 by anti-miR-150 markedly reduced CXCR4 protein expression in MNCs, indicating CXCR4 is a putative target of miR-150 in MNCs. [score:6]
Microvesicle -based exogenous miR-150 delivery to human microvascular endothelial cells resulted in downregulation of c-MYB expression and enhanced their migration ability in vitro [25]. [score:6]
Furthermore, lentivirus -mediated knockdown of miR-150 significantly increased CXCR4 expression in MNCs and transplantation of these cells into BM of wild type mice dramatically increased MNC mobilization from BM to PB, indicating that miR-150 is critically associated with stem cell mobilization by regulating Cxcr4. [score:5]
Briefly, 2.5 µl of lentiviral miR-150 inhibitor expression plasmid/control plasmid, 5.0 µl of EndoFectin Lenti and EndoFectin Lenti reagent were added in Opti-MEM I, and formed the DNA-EndoFectine complex. [score:5]
Although these data support our findings to imply miR-150 in cell mobilization, the discrepancy between the two studies may be attributed to; 1) different cell types (endothelial cell vs stem cell), 2) cell maturity (mature vs progenitor cell), 3) exogenous vs endogenous expression of miR-150, 4) disease type (atherosclerosis vs myocardial ischemia), all of which might have led to the different results between these studies. [score:5]
Lentivirus overexpressing miR-150 was generated by using Lenti-Pac HIV Expression Packaging Kit (GeneCopoeia). [score:5]
In our microarray -based miR profiling data indicated that miR-29c, miR-150, and miR-494 expression in BM-MNCs was significantly decreased by 4 fold at 5 days after AMI and the major objective of this study was to determine Cxcr4 as a putative target gene of miR-150. [score:5]
Computational target prediction analysis indicated that Cxcr4 is one of the consensus putative targets of miR-150 relevant to stem cell mobilization (Figure 3A). [score:5]
Our data showed the numbers of PB-MNCs as well as CXCR4 positive MNCs were increased by AMI and identified miR-150 as a key regulator of BM-MNC mobilization by targeting Cxcr4. [score:4]
To knockdown miR-150 in MNCs, transfection was performed with anti-miR-150 (miRCURY LNA microRNA inhibitor, Exiqon) by electroporation system according to the instruction of manufacture (Electroporator II, Invitrogen). [score:4]
In addition, knockdown of miR-150 in MNCs by lentiviral vector significantly increased CXCR4 expression (Figure 4C). [score:4]
Knockdown of miR-150 enhances mobilization of MNCs in vivo To further examine the involvement of miR-150 in stem cell mobilization in vivo, we performed mouse BM transplantation experiments by using irradiated mice and lentiviral miR-150 inhibitor. [score:4]
Lentivirus -mediated knockdown of miR-150 augments CXCR4 expression and mobilization of MNCs. [score:4]
miR-150 regulates MNC migration by targeting Cxcr4. [score:4]
miR-150 targets Cxcr4 and regulates MNC migration. [score:4]
0023114.g003 Figure 3(A) A putative target site of miR-150 highly conserved in the Cxcr4 mRNA 3′-UTR as predicted by computational analysis. [score:3]
0023114.g004 Figure 4 (A) Structures of Lenti-miR-150 inhibitor and Lenti-Sc which contains mCherry reporter gene (red signal), (B) Titeration and transduction efficiency of lentivirus -mediated miR-150 inhibition in MNCs was evaluated by mCherry signal under microsope. [score:3]
In this regard, c-Myb, a transcription factor related to endothelial cell migration and B cell differentiation, is being tipped as a potential target gene of miR-150 [22], [25]. [score:3]
Lentivirus containing mCherry (red, reporter) was generated by co-transfection of 293Ta cells with Lentiviral vectors and miR-150 inhibitor or scramble (Figure 4A). [score:3]
To verify microarray profiling results, we performed real time PCR and confirmed that miR-150 expression was markedly reduced in BM-derived MNCs from AMI mice (Figure 3B). [score:3]
Interestingly, miR-29c, miR-150, and miR-494 expression was further decreased more than 4 fold at 5 days (−7.28, −4.75, and −4.27, respectively), which led us to further study the role of these miRNAs in MNC mobilization. [score:3]
miR-150 overexpressing vector and scramble plasmid were obtained from GeneCopoeia. [score:3]
Interestingly, we found that in vivo transplantation of MNCs lacking miR-150 expression ([anti-miR-150]MNCs) into the irradiated wild type mice resulted in increased number of MNCs in PB released from BM as compared to that of MNCs transducing scramble ([Sc]MNCs), indicating that miR-150 plays a critical role in MNC mobilization in BM through Cxcr4 regulation (Figure 4D). [score:3]
To further examine the involvement of miR-150 in stem cell mobilization in vivo, we performed mouse BM transplantation experiments by using irradiated mice and lentiviral miR-150 inhibitor. [score:3]
Thus, miR-150 may be a novel therapeutic target for stimulating BM cell mobilization to ischemic tissue for participation in the repair process. [score:3]
BM-MNCs from donor mice were infected with Lentivirus overexpressing miR-150 as described above. [score:3]
For miR inhibitor electroporation, 100 nM of anti-miR-150 was added and the loaded cuvettes were placed on ice. [score:3]
Lentivirus -mediated miR-150 inhibition in MNCs. [score:3]
miR-150 is abundantly expressed in monocytes [22] which is altered under various conditions including the immune response and tumorigenesis [23], [24]. [score:3]
Knocking down miR-150 by transfection with its inhibitor in MNCs exhibited the higher response to SDF-1α in migration capacity as compared with scramble -transfected MNCs. [score:3]
Knockdown of miR-150 enhances mobilization of MNCs in vivo. [score:2]
Transfection of wild type MNCs with anti-miR-150 also increased the number of migrating cells. [score:1]
Taken together, these studies indicated the functional significance of miR-150 in immune system and disease control and, warrant further investigations to elucidate the functional role of miR-150 in angiomyogenesis mediated by mobilized MNCs. [score:1]
Interestingly, knockdown of miR-150 by transfection with anti-miR-150 significantly increased the number of migrated MNCs when compared to scramble transfection, suggesting miR-150 is critically involved in MNC migration (Figure 3D, bottom). [score:1]
We produced Lentivirus containing anti-miR-150 and miR-scramble and transduced to MNCs isolated from healthy mice. [score:1]
Therefore, miR-150 is being studied for its participation in addressing different aspects of cellular functions with special focus on its role in mobilization of monocytes. [score:1]
These include miR-1937a (−3.6 fold), miR-494 (−3.39 fold), miR-29c (−3.19 fold), miR-150 (−2.95 fold), miR-486 (−2.37 fold), miR-30c (−2.35 fold) and miR-30b (−2.14 fold). [score:1]
[1 to 20 of 42 sentences]
12
[+] score: 128
Other miRNAs from this paper: hsa-mir-150
The suppression is executed by miR-150 in the exRNA, the miRNA previously shown to be responsible for suppression mediated by CD8+ suppressor T cell-derived exosomes, that also were the source of the exRNA here. [score:7]
Further, association of inhibitory miR-150 alone with Ab coated non-suppressive T cell exosomes from tolerized miR-150 deficient mice restored their suppressive activity [5]. [score:7]
Therefore, these suppressive exosomes that down-regulate CS reaction are a combined product of T cells (the exosomes containing miR-150) and B cells (surface Ab LC). [score:6]
Pure miR-150 Suppresses In Vitro Responsiveness of HT-2 Cells to IL-2 and Anti-miR-150 Reverses Suppression Mediated by QRNA. [score:5]
c. The in vitro HT-2 cell responsiveness to IL-2 was suppressed by QRNA from Ts Sup and this was inhibited by pre-incubation of the QRNA with anti-miRNA-150, but not by anti-miRNA-150* (Groups B and C). [score:5]
Indeed, pure miR-150 supplementation rendered non-suppressive Ag-specific exosomes, likely derived from companion B1a cells, suppressive; even at such small amounts as femtomoles; here a nanomolar concentration (Fig 6b). [score:5]
We previously showed that incubation of non-suppressive exosomes from tolerized miR-150 [-/-] mice with synthetic miRNA-150 rendered them suppressive [5]. [score:5]
Induced during tolerogenesis suppressor T cell-derived exosomes transferred and protected from RNases the suppressive miR-150, as well as other RNAs. [score:5]
Interestingly, the current data suggests that such B1a cells also may produce exosomes coated with Ab or BCR for association with inhibitory free exRNA and even isolated miR-150 to become suppressive. [score:5]
In that case, it would be possible that free exRNA could interact with these B1a cell-derived exosomes to deliver the actual inhibitory entity: miR-150, and Ag-specifically suppress companion CS-effector T cells. [score:5]
Anti-miRNA To miR-150 Blocks Suppression Mediated by the Ts Sup Total QRNA. [score:3]
Further, its suppression was blocked in vivo and in vitro by anti-miR-150 alone; suggesting that miR-150, representing a very small fraction of the total RNA in the PCE and QRNA, is responsible. [score:3]
Ag-Specific B1a Cell Exosomes Mediate Suppression When Supplemented with Pure miR-150 in Minute Amounts. [score:3]
Exosome-producing CD8+ Ts lymphocytes are not classical FoxP3 [+] Treg cells and act in vitro and in vivo to inhibit both CD4+ or CD8+ CS-effector T cells by transferring miR-150 [5], also associated with many other T cell functions [14– 18]. [score:3]
This suggested that miR-150 could be crucial among the mixture of exRNAs, as it is for the Ts Sup exosome mediated suppression [5]. [score:3]
Remarkably, only anti-miR to miR-150 reversed suppression of CS adoptive cell transfer (Fig 4b, group C vs B). [score:3]
This finding was consistent with the results of the experiment with anti-miR to miRNA-150 (Fig 4b) and confirmed that miR-150 is crucial for suppression mediated by Ts Sup QRNA. [score:3]
Indeed, the miR-150 antagonist blocked suppression of the HT-2 cell responsiveness (Fig 6c, group B vs A), while the antagonist of the reverse sequence carrier chain miR-150* was much less efficient (Fig 6c, group C vs B). [score:3]
In the prior study we showed that Ts cell-derived exosomes via a surface coat of Ab LC Ag-specifically delivered miR-150 to suppress CS-effector cells [5]. [score:3]
Suppression mediated by dsRNA is not TLR3 -dependent and can be blocked by anti-miR to miR-150. [score:3]
In a follow-up experiment, the 2-day TNP-Cl exosomes were supplemented with miR-150 alone, and mediated suppression of CS-effector cell adoptive transfer, similarly to QRNA of TNP Ts Sup (Fig 6b, group E and D vs A). [score:3]
Further, a dose response experiment showed that the early Ag-specific B1a cell exosomes supplemented with as little as 750pg (50 femtomoles, 50 x 10 [-15]) of pure miR-150 per recipient suppressed the adoptive transfer of CS-effector cells (Fig 6b, group G). [score:3]
We concluded that miR-150 was responsible for suppression mediated by exosome-free QRNA derived from Ts Sup observed both in vivo (Fig 6b) and in vitro (Fig 6c), which was confirmed with specific antagonists in vivo (Fig 4b, group C) and in vitro (Fig 6c, group B). [score:3]
Among different miRNA antagonists (groups C-G), only anti-miR to miR-150 is able to reverse the suppression of CS mediated by TNP Ts Sup QRNA (group C). [score:3]
We tested if the exosomes from the Ts cell Supernatant (Sup) were required for the delivery of functional exRNA cargo (miR-150) to suppress CS. [score:3]
b. Similarly, two day immune B-1 B cell-derived exosomes, supplemented with decreasing doses of miR-150 alone, mediated suppression of TNP-CS-effector cell adoptive transfer (Groups E-G), down to a dose of 750pg per eventual recipient, which is 50 femtomoles per eventual recipient (Group G). [score:3]
We showed that free exRNA without exosome carrier also mediated Ag-specific suppression due to the delivery of miR-150. [score:3]
Similarly, incubation with miR-150 antagonist blocked suppression mediated by miR-150 containing exosomes from tolerized wild type mice [5]. [score:3]
The free QRNA from Ts Sup PCE functioned similarly to the previously described Ts Sup exosomes that suppressed the CS-effector cell mixture due to their content and delivery of miR-150 [5]. [score:3]
Further, pure miR-150 alone was inhibitory compared to mimic control (Groups F vs G). [score:2]
We aimed to determine if miR-150 might influence the HT-2 cells’ in vitro responsiveness to IL-2. We found that miR-150 alone completely suppressed HT-2 cell responsiveness to IL-2 when compared to mimic control (Fig 6c group F vs G). [score:2]
Suppression by extracellular QRNA from TNP Ts Sup free of exosomes, or miR-150 alone, associating with B-cell derived Ag-specific exosomes from the assayed CS-effector cell mixture. [score:2]
In conclusion, the studied system, that allowed us to unravel a mechanism of exRNA mediated intercellular regulation seemingly free of exosomes, needs three fundamental conditions: a. Ag-specific Ab or BCR, b. its presence on the surface of exosomes c. that carry miR-150. [score:2]
In each case, 3μg of appropriate anti-miR (165 pM for anti-miR to miR-150) was incubated with 3μg of Ts Sup-derived QRNA for 1 h at room temperature, followed by incubation of the mixture with TNP-CS-effector lymphocytes (7x10 [7] cells per recipient) for 30 min in 37°C water-bath. [score:1]
162–0102 [BioRad, Hercules, CA] anti-miRs to miR-150 and miR-150* and other miRNA [Thermo Scientific Dharmacon; Fisher RNAi technologies, Lafayette, CO] were obtained from the suppliers. [score:1]
The 100,000g pelleted exosomes were incubated with QRNA from Sup of either TNP Ts or Normal Cells (3μg QRNA per 8x10 [9] exosomes per eventual recipient; in a total volume of 300μL), and also in other groups with decreasing doses of miR-150 [Dharmacon]; starting with a dose of 3μg (equals 212 pM) of miR-150, again in 300μL. [score:1]
As found recently, the induced CD8+ Ts cells release miR-150 containing exosomes that also require the presence of exosome-bound B1a cell products (i. e. antibody light chains, Ab LC) to act as TsF. [score:1]
We postulated that these observed effects of free exRNA association with exosomes may be due to miR-150 binding to exosome surface lipids, as recently shown for Ab LC [31], and possibly active influx via SID-1 channel [32], that we herein termed transfection. [score:1]
We also investigated whether anti-miR-150 blocked the observed in vitro suppression mediated by the Ts Sup-derived QRNA mixture, likely acting due to its miR-150 content. [score:1]
If 0.01% of this total QRNA fraction is miR-150 (perhaps a conservative estimate) the dose efficient for in vitro function of miR-150 in this mixed material is also in the picogram range; again femtomolar amounts. [score:1]
Supplementation of Exosomes from 2 Day Contact Sensitized Mice with QRNA from Hapten-Specific Ts or Nl Cell Sup, or with Synthetic miR-150. [score:1]
[1 to 20 of 41 sentences]
13
[+] score: 107
To downregulate endogenous c-Myb levels, we used miR-150 -expressing retrovirus pMSCV-miR-150-IRES-eGFP (miR-150-RET) as miR-150 efficiently inhibits c-Myb expression. [score:10]
We presumed that miR-150 could be responsible for downregulation, but its expression was low, only slightly upregulated and soon lowered during differentiation. [score:9]
On a side note, the absence of c-Myb in GM (miR-150-RET) resulted in upregulation of the same set of genes as was inhibited by the c-Myb excess in DM, but there is a possibility that miR-150 could affect the expression profile of the inspected genes in GM as well. [score:8]
In cells infected with the miR-150-RET, only the traces of c-Myb were detected in GM indicating that miR-150 was suppressing c-Myb expression on both transcriptional and translational levels. [score:7]
Considering c-Myb expression having been silenced at the same time, we speculated that miR-150 could play a role in c-Myb downregulation during skeletal muscle development. [score:7]
In order to confirm the published data, we analyzed miR-150 expression in growing and differentiating C2C12 cells and found that it was upregulated on the first day of differentiation (Figure S4). [score:6]
Moreover, miR-150 is expressed at low levels in C2C12 cells [19] and is slightly upregulated in C2C12 cells differentiating for 3 days [20] (See supplementary data). [score:6]
We searched for genes that are expressed differently (≥1.7fold change) in cells overexpressing c-Myb (c-Myb-RET infected cells) in comparison with cells devoid of c-Myb (miR-150-RET infected cells). [score:5]
c-Myb activity is tightly regulated at different levels, including downregulation by several miRNAs: miR-150 [8], miR-15a [9], miR-34a [10], miR-126 [11], miR-200b, miR-200c and miR-429 [12] binding to its 3′ UTR. [score:5]
We searched only for genes that are differently expressed in c-Myb-RET cells in comparison with miR-150-RET cells (the difference in gene expression 1.7 times or more in at least one time point). [score:5]
While analysis of c-Myb transcription levels resulted in expected findings (high constitutive transcription of c-Myb and its variants from integrated retroviruses, downregulation of endogenous c-Myb mRNA during cultivation of cells in DM, reducing of c-Myb mRNA levels in miR-150-RET infected cells), the analysis of c-Myb protein levels by Western blotting (Figure 4A) resulted in one unexpected finding: c-Myb-RET (and c-Mybm-RET as well) infection did not increase c-Myb protein levels in GM. [score:4]
We therefore searched in the literature if some of miRNAs that have already been described to downregulate c-Myb via interacting with 3′ UTR, (miR-150, miR-15a, miR-34a, miR-126, miR-200b, miR-200c and miR-429), were activated during muscle differentiation. [score:4]
Next, we examined whether migration of C2C12 cells with low expression of c-Myb (infection with miR-150-RET) was affected, compared to cells with physiological expression of c-Myb in GM (C2C12 cells) or cells infected with c-Myb-RET, but we found no difference in mobility. [score:4]
Relative expression levels of miR-150 in growing C2C12 cells (GM) differentiating for 24 hours (D24) and 72 hours (D72) normalized to U6 snRNA. [score:3]
The microarray analyses were performed with RNA isolated from C2C12 cells expressing c-Myb, miR-150 and control C2C12 (infected with empty retrovirus) at three time points: cells cultured in GM were harvested before transferring to differentiation medium (D0), after cultivation in the differentiation medium for 24 hours (D24) and 72 hours (D72). [score:3]
However, there is a possibility that miR-150 could also affect the expression of the identified genes in GM. [score:3]
We discovered that proliferation and migration was not influenced by low c-Myb levels again, indicating c-Myb is not involved, but we have to take into consideration the fact that cells also overexpress miR-150 and we cannot exclude the possibility that it could influence the proliferation and migration processes in an opposite way than the lack of c-Myb. [score:3]
By expressing miR-150, we successfully reduced c-Myb levels. [score:3]
Figure S4 Expression of miR-150 in C2C12 cells. [score:3]
To generate miR-150 expressing retrovirus (miR-150-RET), the genomic PCR product (166 bp), containing the entire pri-miR-150 sequence, was obtained using 5′-AGCAGTGCTTTCCGCAGCATC-3′ (sense) 5′-GTCCCTTGGCTGGAGGGAGAA-3′ (antisense) primers and cloned into the retroviral vector. [score:2]
We infected cultured myofibers with retroviruses c-Myb-RET, miR-150-RET and control-RET at a time when about 10 myoblasts were identified around the fiber (it usually takes two or three days of culturing the myofiber in enriched growth medium). [score:1]
In contrast, the infection with control-RET and miR-150-RET generated eGFP [+] myoblasts that can fuse together, the fusion was often observed and one example of cell fusion is documented on Figure 3A showing single frames illustrating the fusion of two eGFP [+] myoblasts (black arrow) with arising myotube. [score:1]
C2C12 cells were infected with control-RET, c-Myb-RET, miR-150-RET, c-Mybm-RET and c-Myb-3′U-RET retroviruses, sorted by FACS 24 hours later to select for eGFP -positive cells, and induced to differentiate by incubation in DM. [score:1]
c-Myb-RET, miR-150-RET and control-RET retroviruses were used to infect myoblasts arisen from cultured myofibers. [score:1]
0076742.g004 Figure 4 C2C12 cells were infected with control-RET, c-Myb-RET, miR-150-RET, c-Mybm-RET and c-Myb-3′U-RET retroviruses, sorted by FACS 24 hours later to select for eGFP -positive cells, and induced to differentiate by incubation in DM. [score:1]
c-Myb-RET infected eGFP [+] cells were 0.95 times faster than c-Myb-RET non-infected cells (eGFP [−]), cells whose proliferation rate was set to 1. miR-150-RET infected eGFP [+] cells were equal with non-infected eGFP [−] cells as well as control-RET. [score:1]
0076742.g002 Figure 2 c-Myb-RET, miR-150-RET and control-RET retroviruses were used to infect myoblasts arisen from cultured myofibers. [score:1]
[1 to 20 of 27 sentences]
14
[+] score: 105
For instance, down-regulation of mouse miR-150 upon activation [26] associates with up-regulation of its target c-Myb, a transcriptional factor that promotes lymphocyte survival by inducing the pro-survival protein Bcl2 [27]. [score:9]
B. Column chart plotting mean and SEM (of a biological triplicate) of fold change of CD4 [+] T lymphocyte intracellular miR-150 down-regulation and parallel c-Myb up-regulation (normalized by expression of internal control MammU6 and relative to Time 0) at the indicated time points upon activation with PHA. [score:9]
We speculate that the release of miR-150 rich vesicles may represent a new and additional layer of regulation of miR-150 expression level and, in turn, of the mRNAs that are targeted by this miRNA and critically control lymphocyte responses. [score:6]
Intracellular down-modulation of miR-150 upon activation of lymphocytes was paralleled by a slight but significant up-regulation of one of its most relevant targets, c-Myb (Figure 4B). [score:6]
In particular, it has been demonstrated that vesicle-packaged miR-150 specifically regulates target gene expression and function in recipient cells [30]. [score:6]
In line with this hypothesis, it is tempting to speculate that the increase of circulating miR-150 level that we observe upon vaccination may be part of a negative regulatory loop aimed at down-modulating adaptive immune responses through the transmission of extracellular messages to other immune cells and the consequent regulation of miR-150 target genes. [score:5]
C. Column charts plotting mean and SEM (of a biological triplicate) of fold change of CD4 [+] T lymphocyte intracellular miR-150 modulation (normalized by expression of internal control MammU6 and relativized to control, i. e. treatment with IL-2 alone) and nanovesicular accumulation (expressed as relative quantities of extracellular nanovesicular miR-150 upon activation compared to control IL-2 alone treated cells) 72 hours upon starting the indicated treatments (PMA for Phorbol 12-Myristate 13-Acetate; PHA for Phytohemagglutinin; SEB for Staphylococcus aureus enterotoxin B). [score:4]
miR-150 expression in human resting lymphocytes and tissues. [score:3]
Moreover, the increment of circulating miR-150 upon vaccination (expressed as fold change T1/T0) was found to significantly correlate with the level of antibodies in wild type mice vaccinated with OVA mixed with either αGalCer or Alum (Figure 7D). [score:3]
The work has been developed by first identifying a potential biomarker, miR-150, based on its very high expression in lymphocytes and strong association with vesicles released upon lymphocyte activation in vitro. [score:3]
D. Correspondence between RT-qPCR (upper panel) and Northern Blot (lower panel) for MammU6 snRNA (used as endogenous control, left) and miR-150 (right) expression level at time 0 and 72 hours upon starting the indicated treatments. [score:3]
The observations that miR-150 is both the most highly expressed miRNA in 17 different lymphocyte subsets from peripheral blood mononuclear cells of healthy donors and highly abundant in spleen, lend supports to the evidence that the major source of serum miR-150 are lymphoid cells [(Figure 6 and [22]]. [score:3]
We report here that upon activation of both human and mouse primary lymphocytes, there is a reduction of miR-150 intracellular expression concomitantly with an extracellular accumulation of exosome -associated mir-150. [score:3]
miR-150 is highly expressed in all lymphocyte populations, hence it is a very general sensor of adaptive immune response but our study also suggests that different lymphocyte populations may display significantly different selective enrichment of specific extracellular miRNAs. [score:3]
B. Column chart plotting mean and SEM (of a biological triplicate) of mature miR-150 relative quantities in the indicated mouse lymphocytes: intracellular level 72 hours upon activation was normalized first by expression of internal control MammU6 snRNA and then by level at T0. [score:3]
White circles indicate miR-150 expression level. [score:3]
B. miR-150 level in a panel of 20 different human tissues (as indicated) by RT-qPCR, relative to the internal control MammU6, and reported in percentage relative expression among tissues. [score:3]
Indeed, in flu vaccinated adults, miR-150 serum levels at T1 were significantly higher in individuals mounting higher antibody response (as surveyed by a hemagglutinin inhibition test assay). [score:2]
Remarkably, miR-150, a key regulator of lymphocyte differentiation and functions, was not only part of the signature of miRNAs strongly associated with circulating nanovesicles, but also specifically enriched in this compartment. [score:2]
We assessed miR-150 relative quantity by RT-qPCR in serum samples of 50 healthy children and 46 healthy adults before (T0) and 30 days (T1) after immunization with pandemic flu vaccine (for children, all aged <36 months and never vaccinated against influenza, who were administered a second vaccine dose, we had also serum collected 30 days after the second dose, T2). [score:1]
Second, we validated our hypothesis through quantitative assessment of miR-150 in a cohort of serum samples from pandemic flu vaccinated individuals and ovalbumin vaccinated mice, showing an increase of serum miR-150 upon vaccination, which correlates with antibody response. [score:1]
In contrast, in mice vaccinated with non-adjuvanted OVA, no antibody production was revealed and circulating miR-150 increase was not detectable after vaccination (Figure 7D). [score:1]
B. Ranking analysis for miR-150 and miR-126 (upper panels) and for miR-19b and miR-92a (lower panels) in 10 paired samples of total serum (TS) and purified nanovesicles (NV) (7 purified by differential centrifugation and 3 by ExoMiR). [score:1]
C. miR-150 quantities relative to exogenous spike-in ath miR-159a in wild type and MHCII [-/-] mice vaccinated with ovalbumin (OVA) adjuvanted with alpha-galactosylceramide (αGalCer) 2 days before vaccination (-2, or T0) and 7 days after vaccination (each treatment normalized to miR mean relative quantity at T0). [score:1]
When MHCII [-/-] mice, that are depleted of mature CD4 [+] T lymphocytes [24], were vaccinated in the same way, circulating miR-150 increment was significantly lower in comparison with wild type mice (Figure 7C), confirming the specificity of the observed phenomenon. [score:1]
miR-150 is among the most represented miRNAs associated with nanovesicles released by human activated lymphocytes. [score:1]
Circulating miR-150 modulation in human serum upon flu vaccination. [score:1]
D. Correlation between anti-OVA total Ig concentration (assessed by ELISA) at T=7 days after vaccination in mice vaccinated with αGalCer + OVA (black) or Alum + OVA (grey) and serum circulating miR-150 fold change T1/T0 (T1=7 days after vaccination). [score:1]
These results together strongly suggest that the increment in the level of circulating miR-150 upon immunization is lymphocyte-derived and dependent on the magnitude of immune response. [score:1]
As hypothesized, miR-150 serum level increased after vaccination in adults at T1 and in children after the second dose (T2) (Figure 5A). [score:1]
A. miR-150 quantities relative to exogenous spike-in ath miR-159a in sera of 50 H1N1-MF59 vaccinated children (samples collected at time of first dose, T0, at time of second dose 30 days after, T1 and 30 days after the second dose, T2) (left) and 46 pairs of samples (time of vaccination, T0 and 30 days after, T1) from H1N1-MF59 vaccinated healthy adults (right). [score:1]
Similarly to what described in the mouse system [19], in human primary CD4 [+] T lymphocytes miR-150 was significantly down-modulated upon activation. [score:1]
Correlation between circulating miR-150 modulation and immune response. [score:1]
Serum circulating miR-150 increases after vaccination. [score:1]
The increase of serum circulating miR-150 depends on adaptive immune response in humans and mice. [score:1]
Concomitant intracellular down-modulation and extracellular enrichment of miR-150 in nanovesicles upon lymphocyte activation. [score:1]
miR-150 intracellular down-modulation and release upon in vitro activation of CD4 [+] T lymphocytes. [score:1]
miR-150 fold changes values for mice vaccinated with non-adjuvanted OVA are also reported (white). [score:1]
Furthermore, consistently with results obtained in vaccinated individuals, mice immunized with ovalbumin (OVA) and alpha-galactosylceramide (αGalCer), an adjuvant leading to a strong activation of lymphocyte response through NKT activation [23], showed a tidy increase of serum miR-150 seven days after vaccination (Figure 7C). [score:1]
Then, if miR-150 is selectively released by activated lymphocytes, then there could be a correlation between its recordable level and the magnitude of the immune response. [score:1]
It has been recently shown that reduced miR-150 serum concentrations are associated with an unfavorable outcome in critically ill patients with sepsis and it has been hypothesized that lower level of circulating miR-150 might lead to a de-repression of genes such as CXCR4 and c-Myb, that are linked to immune response activation and poor prognosis [28]. [score:1]
Ranking analysis also showed miR-150 to be among the most represented miRNAs associated with nanovesicles purified in the extracellular milieu of both CD4 [+] T and B stimulated lymphocytes (Table 3). [score:1]
B. Box plot of miR-150 quantities relative to exogenous spike-in ath miR-159a (whiskers: 10-90 percentile) in the indicated serum compartments of 17 pairs of H1N1-MF59 at T0 (white) and T1 (grey). [score:1]
miR-150 quantities relative to exogenous spike-in ath miR-159a in sera of 50 H1N1-MF59 vaccinated children (samples collected at time of first dose, T0, at time of second dose 30 days after, T1 and 30 days after the second dose, T2) (left) and 46 pairs of samples (time of vaccination, T0 and 30 days after, T1) from H1N1-MF59 vaccinated healthy adults (right). [score:1]
Remarkably, upon vaccination circulating miR-150 increased more significantly in isolated nanovesicles than in total serum, whereas it did not changed in isolated microvesicles, suggesting a specific process of miR-150 release through nanovesicles during immune response (Figure 5B). [score:1]
[1 to 20 of 45 sentences]
15
[+] score: 93
Then the expression of FLT3, the target of miR-150, is inhibited. [score:7]
To validate whether miR-150 expression is regulated by MYSM1, the expression of MYSM1 was recovered in the splenic B1a cells isolated from MYSM1 [−/−] mice by LV-MYSM1. [score:6]
As MYSM1 may recruit transcription factors to regulate the transcription of target genes, we tested whether MYSM1 stimulated transcription of the miR-150 gene. [score:4]
C-Myb is another target of miR-150 and is thought to be involved in B cell development [22]. [score:4]
qRT-PCR results show that the increase of miR-150 or MYSM1 in MYSM1 [−/−] B1a cells represses the expression of FLT3. [score:3]
We observed that the level of miR-150 was significantly increased after the forced expression of MYSM1 in MYSM1 [−/−] B1a cells (Figure 2B, P = 0.0095). [score:3]
Meanwhile, the level of miR-150 was not altered in B1b cells from MYSM1 [−/−] mice indicating a specific role for MYSM1 in miR-150 expression in B1a cells (see Supplementary Figure S2A). [score:3]
Several targets of miR-150 have been identified, including c-myb [22, 32], notch3 [34], and FLT3 (CD135) [32]. [score:3]
Here, we have identified a pathway comprised of MYSM1/miR-150/FLT3, which inhibits B1a cell proliferation. [score:3]
miR-150 inhibits FLT3 in B1a cells. [score:3]
Results showed that the inhibitor of c-Myc blocked the elevation of miR-150 that was induced by restoring MYSM1 (Figure 2L). [score:3]
Given that FLT3 is the target of miR-150, and MYSM1 stimulates the transcription of miR-150 in mice, we next analyzed the level of MYSM1 and miR-150 in both FLT3 positive and negative cells in humans. [score:3]
Further mechanistic studies demonstrate that B1a cell proliferation is inhibited by the pathway composed of MYSM1, miR-150, and receptor tyrosine kinase FLT3. [score:3]
Meanwhile, the attenuation of miR-150 in MYSM1 [−/−] splenic B1a cells was reversed with the restoration of MYSM1 expression (LV-MYSM1). [score:3]
In conclusion, we reveal a novel pathway involving MYSM1, miR-150, and FLT3, which inhibits B1a cell proliferation and a defect in this pathway may contribute to the pathogenesis of SLE. [score:3]
To do so, the level of miR-150 in B1a from MYSM1 [−/−] mice was recovered using miR-150 expressing-lentivirus (LV-miR-150) (see Supplementary Figure S2B). [score:3]
We then demonstrated that ectopic expression of both miR-150 and MYSM1 in MYSM1 [−/−] B1a cells reduced the level of FLT3 (Figure 3D). [score:3]
We found that the level of pri-miR-150 in B1a was decreased (Figure 2K), while the inhibitor of c-Myc had no effect on the level of MYSM1 (Figure 2K). [score:3]
Next we confirmed the regulatory effect of c-Myc on the transcription of miR-150 in B1a cells. [score:2]
These results suggest that MYSM1 recruits transcription factor c-Myc to the promoter of miR-150, thereby positively regulating its transcription. [score:2]
Likewise, there was no observed interaction between c-Myc and the promoter of miR-150 gene in B cells from MYSM1 [−/−] mice (Figure 2G). [score:1]
The similar phenotype of miR-150 deficiency in B1a cell expansion drove us to study the possible function of miRNAs in Mysm1 deficient cells [22]. [score:1]
MYSM1 stimulates transcription of miR-150 in B1a cells with c-Myc. [score:1]
To further verify that MYSM1 is necessary for c-Myc binding to the promoter of miR-150, we first obtained the products captured by the antibody of MYSM1 then added the c-Myc antibody. [score:1]
B1a cells were isolated from MYSM1 [−/−] mice and transduced with the lentivirus containing the miR-150 gene (LV-miR-150) or the MYSM1 gene (LV-MYSM1). [score:1]
We found that the level of miR-150 was significantly decreased with the attenuation of MYSM1 (Figure 2B), which was similar to the results observed in B1a cells from MYSM1 [−/−] mice (Figure 2A). [score:1]
We found that the region approximately 1200–1000 nt upstream of the miR-150 promoter was specifically captured by anti-MYSM1-IgG (Figure 2E), which was inseparably linked with MYSM1 function [16]. [score:1]
c-Myc was predicted to bind to the 1200–1000 nt upstream region of the miR-150 gene by TFSEARCH (ver. [score:1]
These results suggest that c-Myc stimulates the transcription of miR-150 in the presence of MYSM1. [score:1]
RNA isolated from peripheral blood of patients with SLE analyzed with qRT-PCR revealed that the level of MYSM1 and miR-150 was lower in FLT3 [+] B cells than in FLT3 [−] B cells (Figure 4C) suggesting that FLT3 elevation was due to a decrease in MYSM1. [score:1]
In our study, the level of miR-150 in MYSM1 [−/−] mice is significantly lower, and the percentage of splenic and peritoneal B1a cells is increased, which is in accordance with the phenotype observed in miR-150 -deficient mice. [score:1]
Results showed that the c-Myc antibody specifically captured the same region of the miR-150 gene promoter as the anti-MYSM1-IgG in B cells from WT mice (Figure 2G). [score:1]
After 72 h infection of LV-miR-150, the level of surface IgM on B1a cells decreased in an inverse correlation to the increase in miR-150 (Figure 2C). [score:1]
MYSM1 stimulates the transcription of miR-150 in B-1a cells with c-Myc. [score:1]
In miR-150 -deficient mice, splenic B1a cells and peritoneal B1a cells are increased [22]. [score:1]
Figure 2(A) miR-150 is decreased in both spleen and peritoneal cavity B1a cells from MYSM1 [−/−] mice. [score:1]
1. Here, we show that MYSM1 and c-Myc bind to the same region (approximately 1200–1000 nt upstream) of the promoter of miR-150 in B1a cells from WT mice but c-Myc cannot bind to the promoter in MYSM1 [−/−] mice. [score:1]
We further demonstrate that MYSM1 recruits c-Myc and stimulates the transcription of miR-150. [score:1]
These results suggest that MYSM1, together with c-Myc, stimulates the transcription of pri-miR-150. [score:1]
We next sought to test the effect of miR-150 on the phenotype alteration of B1a cells. [score:1]
The miR-150 gene is located at chromosome 19 (50004042–50004125). [score:1]
To generate a luciferase reporter construct, the promoter and mutant promoter of pre-miR-150 were inserted upstream of firefly luciferase in pGL6. [score:1]
The percentage of B1a cells in the spleens and peritoneal cavities of miR-150 [−/−] mice is increased [22], which was similar with the phenomena observed in MYSM1 [−/−] mice. [score:1]
The level of MYSM1 and miR-150 is lower in FLT3 [+] B cells than that in FLT3 [−] B cells. [score:1]
It has been reported that transcription factor c-Myc stimulates the transcription of miR-150 [32]. [score:1]
This suggests that miR-150 is involved in IgM enhancement induced by MYSM1 deficiency (Figure 1C–1E). [score:1]
[1 to 20 of 46 sentences]
16
[+] score: 79
miR-150 down-regulates Early Growth Response 2 (EGR2) expression thereby inhibiting apoptosis (Wu et al., 2010). [score:8]
org) revealed that 4 of the 5 miRNAs up-regulated in our mo del, namely miR-135b, miR-142a, miR-150, and miR155, have potential binding sites within the 3′ UTR of the mRNA of the pro-apoptotic gene TP53INP1 and hence would be able to down-regulate it. [score:7]
Hence, miR-135b, miR-142a, miR-150, and miR155 seem to down-regulate TP53INP1 production via mRNA translational repression but not by mRNA degradation (Figures 2, 4). [score:6]
As previously mentioned, cell survival may also be mediated by inhibition of TP53INP1 translation by miR-135b, miR-142a, miR-150, and miR-155. [score:5]
miR-150 was also reported to inhibit cell proliferation by targeting Myb proto-oncogene (c-Myb) (Xiao et al., 2007). [score:5]
In conclusion, five miRNAs (miR-21a, miR-135b, miR-142a, miR-150, miR-155) are up-regulated in gastric lymphomagenesis in mice, were identified in our study. [score:4]
The final list was: miR-21, miR-135b, and miR-155 [with fold-regulation values > 3 (Table 1)] as well as miR-142a and miR-150 as their over -expression at the lymphoma stage was described by others (Saito et al., 2012; Thorns et al., 2012; Gebauer et al., 2014; Fernandez et al., 2017). [score:4]
Relative expression levels of miR-21a, miR-135b, miR-142a, miR150, and miR-155 in NTx and d3Tx mice. [score:3]
The role of microRNA-150 as a tumor suppressor in malignant lymphoma. [score:3]
An over -expression of miR-150 has already been described in GML (Thorns et al., 2012; Gebauer et al., 2014), as well as in gastric carcinoma (Wu et al., 2010). [score:3]
A single miRNA can act both as an oncogene (miR-21a, miR-135b, miR-142a, miR-150, and miR-155) or a tumor suppressor (miR-135b, miR-150), thus making the mechanisms involved in lymphomagenesis more complex. [score:3]
By using the unique material obtained from a previous study (Chrisment et al., 2014), in which we were able to induce GML in H. pylori-infected d3Tx mice, we showed an over -expression of miR-21a, miR-135b, miR-142a, miR-150, and miR-155 in mice stomachs at the lymphoma stage. [score:3]
MicroRNA-150 is up-regulated in extranodal marginal zone lymphoma of MALT type. [score:3]
Using the material obtained in Chrisment et al. (2014), a set of 5 miRNAs (miR-21a, miR-135b, miR-142a, miR-150, miR-155) was identified as being over-expressed in the stomachs of the GML-developing d3Tx mice. [score:3]
NK/T cell proliferation was also associated with a decrease in miR-150 expression (Watanabe et al., 2011). [score:3]
Our results suggest that this transcript can be targeted also by two other miRNAs, i. e., miR-135b and miR-150. [score:3]
Figure 1Relative expression levels of miR-21a, miR-135b, miR-142a, miR150, and miR-155 in Helicobacter pylori infected and non-infected (NI) NTx and d3Tx mice stomachs. [score:3]
Over -expression of miR-21a, miR-135b, miR-142a, miR-150, and miR-155 was confirmed at the GML stage (Figure 1) compared to d3Tx and to NTx mice (NI and infected). [score:2]
MiR-150 controls B cell differentiation by targeting the transcription factor c-Myb. [score:2]
MiR-150 promotes gastric cancer proliferation by negatively regulating the pro-apoptotic gene EGR2. [score:1]
miR-150 has been proposed to act as an oncomir in gastric lesions. [score:1]
miR-135b, miR-142a, miR-150, and miR155 are potentially able to bind to the 3′ UTR region of the Tumor Protein 53-Induced Nuclear Protein 1 (TP53INP1) mRNA. [score:1]
Relative expression of miR-21a, miR-135b, miR-142a, miR-150, and miR-155 was therefore evaluated in NI and infected d3Tx mice sera by RT-qPCR. [score:1]
It is also possible that miR-150 and miR-155 could promote lymphomagenesis by acting on DNA mismatch repair pathway. [score:1]
In order to confirm the results of the, the expression of miR-21a, miR-135b, miR-142a, miR-150, miR-155 in d3Tx, and NTx mice stomachs was individually performed by RT-qPCR, using the miScript Universal Primer and specific primers for each miRNA (Qiagen) at a final concentration of 0.25 μM and the SYBR® Green Premix Ex Taq™ (Tli RNaseH Plus; Takara, Saint-Germain-en-Laye, France) for qPCR of each miRNA-RT sample. [score:1]
[1 to 20 of 25 sentences]
17
[+] score: 71
The 6 upregulated miRNAs (mmu-miR-5132-5p, mmu-miR-3104-5p, mmu-miR-669c-5p, mmu-miR-705, mmu-miR-760-3p, mmu-miR-1962) and the 9 downregulated miRNAs (mmu-miR-146a, mmu-miR-138, mmu-miR-5123, mmu-miR-196b, mmu-miR-5099, mmu-miR-150, mmu-miR-145, mmu-miR-27a, mmu-miR-23a) chosen for validation were also based on their target genes predicted, whose functions are well relevant to inflammation and cancer. [score:9]
For instance, in cytotoxic T lymphocytes (CTL), IL-2R and inflammatory signals act through Dicer and miRNAs to control the cytolytic program and CTL differentiation, in which miR-139 and miR-150 are downregulated by inflammation in CTLs, and miR-150 regulates the expression of the IL-2 receptor α-chain (CD25) [52]. [score:7]
As shown in Figure 3, in overall, the expression level of miR-138, miR-145, miR-146a and miR-150 were downregulated by approximately 3.37, 3.39, 2.56 and 4.99 fold in colorectal cancers than those in the matched adjacent normal mucosa (p<0.0001). [score:6]
Among them, all the 16 colorectal cancers showed downregulated miR-138 and miR-150 levels (Figures 3A and 3D), and 15 out of the 16 colorectal cancers showed lower miR-145 and miR-146a expression levels than normal control (Figures 3B and 3C). [score:6]
As shown in Figure 5 and Table 2, there were 21, 13 and 25 common targets between miR-138 and miR-145, miR-146a and miR-150, respectively; there were 16 and 15 common between miR-145 and miR-146a and miR-150, respectively; and there were 7 common targets between miR-146a and miR-150. [score:5]
Our study further identified some common targets of the miR-138, 145, 146a and miR-150 (Table 2 and Figure 5), such as PAPPA (pregnancy -associated plasma protein A), CCT3 (chaperonin containing TCP1, subunit 3) and ZHX2 (zinc fingers and homeoboxes 2), which were the common targets of three miRNAs. [score:5]
Please be noted that CCT3 and PAPPA were the common targets for miR-138, miR-146a and miR-150, and ZHX2 was the common target for miR-138, miR-145 and miR-150. [score:5]
Unfortunately, no common inflammation- and cancer -associated targets for all of the 4 miRNAs (miR-138, 145, 146a and miR-150) were identified using miRNA target prediction tools. [score:5]
Although the observations were obtained from small sized samples, the trends of significant downregulation of miRNAs (miR-138, 145, 146a and miR-150) strongly suggested their clinical importance of linkage to chronic colitis and colitis -associated colorectal cancer, indirectly indicating their potential biological functions of involving in colitis malignant transformation. [score:5]
D, miR-150 was significantly downregulated in colorectal cancers. [score:4]
D, miR-150 was significantly downregulated in colitis. [score:4]
As to miR-150, quite a lot of reports have demonstrated its tumor inhibitory function [48]– [51]. [score:3]
Numbers of the common targets of the miRNAs (miR-138, 145, 146a and miR-150), and their network. [score:3]
In addition, IFN-γ production is significantly increased in the miR-150 knockout mice [53]. [score:2]
Back to our findings, that were, cytokines were significantly increased (Figure 6) and miR-138, 145, 146a and miR-150 were significantly decreased in Muc2 [−/−] mouse colon and human colitis and colorectal cancer, incorporating with the published observations, strongly support our hypothesis that the cytokine -associated miRNAs, miR-138, 145, 146a and miR-150, play important roles in chronic colitis malignant transformation through interfering with cytokines and inflammatory factors. [score:1]
While, that miR-150 interacts with cytokines in lymphocyte differentiation and in inflammation has been studied. [score:1]
[1 to 20 of 16 sentences]
18
[+] score: 69
The unexpected up-regulation of C-Myb (a proto-onco gene with proliferative effects anda recognized target of miR-150) [51], at both time points (day 7 and day 35), may represent a regulation effect based on the interaction of other miRs (off target). [score:9]
Wu et al. observed an increased expression of miR-150 levels in gastric cancer tissue lines, and forced over -expression of miR-150 promoted the proliferation of gastric cancer cells, whereas suppression of miR-150 with antagomirs had the opposite effect. [score:7]
Interestingly, miR-150 was found to directly target the pro-apoptotic gene EGR2 at the translational level [40]. [score:6]
As miR-150 was the most up-regulated microRNA, we analyzed two different potential targets: GSK3B and C-Myb. [score:6]
The increased expression of miR-150 in cancer epithelial cells decreases P2X7 mRNA levels through the activation of the miR-150 instability target sites located at the 3′-UTR-P2X7 [38]. [score:5]
As shown in Figure 3, the expression levels of several miRs were significantly decreased, including miR-26b (0.46±0.17, p = 0.02), miR-27a (0.77±0.27, p = 0.03) and miR-143 (0.73±0.28, p = 0.02), in the exercised group at day 7. Furthermore, we detected a remarkable increase in miR-150 expression at 35 days (1.87±0.31, p = 0.01) of training. [score:5]
Overall, taken together with the evident up-regulation of mir-150 observed in our protocol of physiological LVH, these findings agree with the hypothesis that the regulation of miRs is a dynamic process that depends on the cellular microenvironment and the observed cellular changes most likely reflect the combined actions of multiple miRs [26], [40]. [score:5]
Presumed cardiomyocyte hypertrophy induced by experimental diabetes was recently found to be associated with the reduced expression of miR-150 and increased expression of p300, a transcriptional co-activator with histone acetyl transferase activity [31]. [score:5]
The up-regulation of miR-150 during cell differentiation and proliferation implies that it fulfills a functional role in cell division or, in the case of cardiomyocytes, cell growth. [score:4]
Thoracic aortic banding was reported to down-regulate mir-150 in three studies [26], [28], [37]. [score:4]
Our study identified a remarkable increase in miR-150 expression in the exercised groups after 35 of training. [score:3]
Previous reports also found an anti-growth function for miR-150 inhibitors in cervical and lung cancer-derived cell lines [39]. [score:3]
We also demonstrated a significant decrease in GSK3-beta (a predicted target of miR-150) in the early period of training. [score:3]
For instance, recent studies have reported potential regulatory roles for miR-150 in growth and differentiation in various cell lineages. [score:2]
Additionally, selected miRs that were significantly altered in our microarray, such as miR-26b, miR-27a, miR-143, miR-150, miR-328, miR-341*, miR-680 and miR-1224, were validated. [score:1]
The qRT-PCR analysis demonstrated an increase in miR-150 levels after 35 days and a decrease in miR-26b, miR-27a and miR-143 after 7 days of voluntary exercise. [score:1]
[1 to 20 of 16 sentences]
19
[+] score: 63
with (anti-)miR-150 inhibited the increased expression of miR-150 by 40% (Fig. 3,C). [score:5]
We used PicTar [24], a target prediction algorithm, to identify the potential targets for miR-150 and miR-155 with a prima facie relation to T lymphocytes. [score:5]
To see if these variations in miRNA expression were specific and, more importantly, could be modulated, experiments were repeated where activated T cells were transfected with inhibitory (anti-)miR-150 or stimulatory (pre-)miR-155 precursors on day 2 before culture with IL-15. [score:5]
Identified on the trajectories are the observed variations in miR-150 and miR-155 expression, and the target genes considered. [score:4]
The expression of miR-150 and miR-155 in the IL-15-directed differentiation of central memory T cells was verified by qPCR using day-2 values as the baseline reference. [score:4]
Of interest, miR-150 is suppressed upon T cell activation [33], underscoring the importance of a differential increase in miR-150 along the trajectory of central memory T cells (Fig. 4). [score:3]
miR-150 predicts two targets, KChIP. [score:3]
Expression of miR-150 and miR-155 in central memory T cells by qPCR. [score:3]
Levels of miR-150 and miR-155 expression in central memory CD8 T cells by qPCR. [score:3]
This is consistent with the fact that fate determination is subject to complex regulatory events involving miR-150 which has an early, direct effect on KChIP. [score:3]
A reciprocal miR-150 [low]/miR-155 [high] pattern of regulation was previously reported in B cell chronic lymphocytic leukemia [32]. [score:2]
A second important consideration underscored by this study is a pattern of reciprocal regulation between miR-150 and miR-155 in memory CD8 T cell fate determination. [score:2]
1, these results suggest that miR150 exerts negative feedback regulation on the acquisition of a central memory phenotype by antigen-activated CD8 T cells cultured in IL-15. [score:2]
Combined with the prediction that miR-150 negatively regulates KChiP. [score:2]
Taken together, these lines of evidence suggest that a reciprocal miR-150 [high]/miR-155 [low] regulation guides T cells along the central memory trajectory. [score:2]
In the development of B cells a miR-150/c-Myb partnership has already been demonstrated [27], [28]. [score:2]
Total RNA was extracted from triplicate cultures on day 0, 2, 4, 6 and 8, and subjected to microRNA-specific reverse transcription (RT) followed by qPCR for miR-150 and miR-155 with snoRNA202 as endogenous control. [score:1]
We posit instead that activated T cells committed to a central memory fate (T [CM] precursors) activate a program that enables the acquisition of central memory phenotype through the balancing effects of miR-150/miR-155, and self-renewal characteristics through a decrease expression of let-7 microRNAs, a shared trait between embryonic stem cells and central memory T cells. [score:1]
We decided to verify whether the acquisition of a central memory phenotype could be modulated by treating antigen-activated, day-2 CD8 T cells with the (anti)miR-150. [score:1]
Figure S3Anti-miR-150 accelerates the transcriptional activation of ChIP1 in celntral memory cells. [score:1]
F5 or OT-I T cells were transfected with (anti)miR-150, cultured in the presence of IL-15 and harvested every 2 days. [score:1]
Anti-miR-150 and pre-miR-150 were purchased from Applied Biosystem (Life Technologies, Carlsbad, CA). [score:1]
A marked effect was noted in OT-I cells on day 4 where down-modulation of miR-150 was followed by an increase in the percentage of central memory T cells ∼30% (39−>54%) (Fig. 4,B). [score:1]
In converse, differentiation in the presence of IL-2 down-modulated (green squares) miR-150 and miR-146, albeit the effect on miR-146 was late. [score:1]
Collectively, the data suggest that during the generation of central memory CD8 T cells two microRNAs, miR-150 and miR-155, may play a reciprocal non-static role in the progression of CD8 T cells to central memory phenotype. [score:1]
We noted that differentiation in the presence of IL-15 induced a differential increase of miR-150 (red squares) and a decrease of miR-155. [score:1]
miR-150 was elevated in both F5 and OT-I IL-15-derived memory T cells. [score:1]
In parallel cultures CD8 T cells were transfected with 150 nM of (anti)miR-150 as indicated in. [score:1]
Anti-miR-150 modulates the central memory phenotype. [score:1]
[1 to 20 of 29 sentences]
20
[+] score: 54
2011; 6. 42 Yu ZY, Bai YN, Luo LIXI, Wu H, Zeng Y. Expression of microRNA-150 targeting vascular endothelial growth factor-A is downregulated under hypoxia during liver regeneration. [score:8]
For example, evolutionarily conserved sequences such as miR-451 and miR-150 are highly expressed in bone marrow [15], regulating hematopoiesis, and miR-126 and let-7 family members show high expression in lung [16, 17]. [score:6]
miR-150, a microRNA expressed in mature B and T cells, blocks early B cell development when expressed prematurely. [score:6]
Also, studies using miR-150 knockout mice shows its effect on inhibition of inflammation and apoptotic response after myocardial infarction induced acute kidney injury [39]. [score:4]
The data shows that miR-150-5p expression profiles starting 1 day after WBI exposure is strongly correlated to the end-point (day 7) lymphocyte and neutrophil blood count, suggesting this biomarker could predict for the onset of ARS. [score:3]
miR-150-5p is evolutionarily conserved, and previous studies have shown it as a key regulator of the transcription factor c-Myb, a regulator of hematopoiesis in multiple lineages [36, 37]. [score:3]
Putative targets of miR-150 include Notch receptors and CXCR4, involved in multiple cellular processes including cellular growth, differentiation and cell mobilization and migration [40, 41]. [score:3]
An in vivo gain of function screen has identified miR-150-5p as an inhibitor of hematopoietic recovery upon marrow injury induced by the chemotherapeutic agent 5-flurouracil [38], where depletion of miR-150-5p resulted in enhanced hematopoietic recovery [38]. [score:3]
The levels of miR-150-5p in the circulating system could provide a direct readout of the level of functional marrow, and hence also provide a functional readout for hematological ARS. [score:2]
Particularly, a dose and time dependent decrease in miR-150 was noted, which was proposed as a novel approach for post-exposure dose estimation [22]. [score:1]
One-way ANOVA of the dose response of each sequence on each day suggests that miR-150-5p and miR-574-5p are sensitive to radiation (Fig 6A). [score:1]
For example, the relative abundance of miR-574-5p significantly increases with dose on day 1 (p-value < 0.005), but does not show significant changes in abundance at day 3 or 7. On the other hand, miR-150-5p shows a dose -dependent decrease in abundance in all days, with strong decreases occurring in day 3 and 7 (Fig 3A). [score:1]
But, the overall decrease in bone marrow pool after irradiation itself would reduce the levels of circulating miR-150. [score:1]
Parallel analysis of lymphocyte and neutrophil depletion kinetics with cell-free circulating miR-150-5p further validate the reliability of the later as an early biomarker for radiation biodosimetry. [score:1]
Moreover, an earlier rodent study showed decrease in miR-150 in the whole blood after exposure to high-LET ([56]Fe) radiation [55]. [score:1]
miR-150-5p is abundant in bone marrow and circulating lymphocytes, some of the cell-free circulating miR-150-5p are likely originated from bone marrow and the decrease in circulating miR-150-5p could be partly connected to the depletion in lymphocytes (Fig 5). [score:1]
As bone marrow is highly sensitive to radiation, the levels of circulating miR-150-5p will allow gauging the radiation dose in a range relevant to triage in radiological events. [score:1]
Based on this analysis, hsa-miR-574-5p and hsa-miR-150-5p show significant dose response to WBI. [score:1]
The interaction of miR-150 with CXCR4 level seems inversely correlated and it is likely that lowering of miR-150 would enhance the migration of lymphocytes in circulation. [score:1]
Like in rodents, circulating miR-150-5p was identified as the most sensitive biomarker for radiation biodosimetry. [score:1]
Consistent with our previous report using rodent mo del of WBI, miR-150-5p exhibited the most robust dose and time dependent response. [score:1]
These sequences, miR-1-5p, miR-146a-5p, miR-150-5p, miR-206, miR-342-3p, miR-574-5p, and miR-1283, had time- and dose-specific changes in abundance (Fig 6A). [score:1]
Correlation between neutrophil counts (A), lymphocyte counts (B), and administered dose (C) and miRNA abundance for miR-150-5p for each day. [score:1]
We observed a strong correlation between neutrophil, lymphocyte, and radiation dose and miR-150-5p abundance. [score:1]
miR-150-5p. [score:1]
[1 to 20 of 25 sentences]
21
[+] score: 53
MiR-150 expression is of particular interest: this miRNA is up-regulated during the developmental stages of B and T cell maturation, but down-regulated again during the further differentiation of naïve T cells into effector Th1 and Th2 cells. [score:10]
The lack of expression in RAG2-/- spleen and thymus (lanes 5 and 8) confirms that expression in these organs is confined to T and B lymphoid-lineage cells, and that within these lineages, miR-150 expression is restricted to cells that have developed beyond the DN T and pro B stages of development. [score:8]
Note that miR-150 is highly expressed in B cells purified from mouse spleen, but not in pro-B cells isolated from bone marrow of Rag2-/- mice; it is also expressed in naïve T cells but is down-regulated in the Th1 and Th2 T cell clones (Figure 2a, arrow). [score:8]
Strikingly, miR-150 expression in naïve T cells is rapidly down-regulated upon TCR engagement, regardless of whether T cells are stimulated under Th1 or Th2 conditions (Figure 2c, lanes 8-12). [score:6]
The levels of expression of miR-150 were already reduced by ~50% after 12 h of stimulation with plate-bound αCD3 and αCD28 (lane 8), and by >90% after 25 h (lanes 9 and 11), indicating a rapid and highly inducible mechanism of down-regulation. [score:6]
For example, Northern analysis of miR-150 expression confirmed its expression in spleen B but not pro-B cells (Figure 2b, lanes 6 and 7), and in naïve T cells but not the Th1 and Th2 clones, D5 and D10 (Figure 2c, lanes 5-7). [score:5]
Like miR-150, the expression of miR-142s, miR-26a and let7d showed a rapid decline during differentiation of naïve T cells into Th1 or Th2 effectors. [score:3]
Figure 2b also shows that miR-150 is expressed in thymocytes and splenic T cells (lanes 9 and 10), but not in ES cells, mouse embryo fibroblasts or hippocampus (lanes 11-13). [score:3]
Figure 2c confirms that naïve T cells show high level expression of miR-150 (lane 7) whereas the precursor cell line Pu. [score:3]
Together, these results suggest a role for miR-150 either in maintaining the undifferentiated status of naïve T cells or in promoting early steps in T cell differentiation. [score:1]
[1 to 20 of 10 sentences]
22
[+] score: 47
In this study, we have known that, in EV71 severe infection, the altered expression of miR-876-5p (upregulation) and miR-150-5p (downregulation) regulated genes that are related to PI3K-Akt and MAPK signaling pathways. [score:10]
Our results implied that the combination of differentiated expressions of miRNAs (upregulation of miR-876-5p and downregulation of miR-150-5p) should provide an indication of circulating miRNA patterns detected in the serum of patients with mild and severe EV71infections. [score:9]
Hence, the MAPK signaling pathway-related genes, including CACN, FGFR, TGFBR, HGK, MKP, p38, NLK, cPLA2, and p53 proteins, were regulated by miR-150-5p, indicating that the response and regulation of the expression of key genes for survival in patients with severe EV71 infection is highly complex. [score:5]
We quantitated the expression levels of 4 miRNAs in the cultured media by using specific primers: The expression of miR-876-5p increased in EV71-infected neuroblastoma cells compared with the cells of uninfected controls, whereas miR-150-5p expression decreased in the cultured medium of EV71-infected cells. [score:5]
In this study, we identified a focused group of 8 miRNAs comprising has-miR-494, has-miR-29b-3p, has-miR-551a, has-miR-606, has-miR-876-5p, has-miR-30c-5p, has-miR-221-3p, and has-miR-150-5p, which demonstrated an expression pattern in patients infected with EV71 as distinct from the controls. [score:3]
We also observed a significantly reduced expression of miR-150-5p in the serum of a patient with a severe EV71 infection. [score:3]
In a similar manner, the most significantly reduced expression of miR-150-5p in response to a severe EV71 infection occurred in genes related to the MAPK signaling pathway, including CACN, FGFR, TGFBR, HGK, MKP, p38, NLK, cPLA2, and p53 proteins (see Supplementary Fig. S4). [score:3]
The expression of has-miR-494, has-miR-29b-3p, has-miR-876-5p, and has-miR-30c-5p was more abundant in the blood serum of patients with mild or severe EV71 infections, whereas has-miR-551a, has-miR-606, has-miR-221-3p, and has-miR-150-5p were less abundant in the blood serum of patients with mild or severe EV71 infections than they were in the blood serum of healthy controls (Fig. 2). [score:3]
According to our results, many genes involved in the p38 MAPK signaling pathway are regulated by miR-150-5p, indicating that the p38 MAPK pathway is closely associated with severe EV71 infections. [score:2]
MiR-876-5p and miR-150-5p were detected in media from EV71-infected neuroblastoma cells. [score:1]
In addition, functional enrichment analysis on these cellular genes revealed various overrepresented pathways, including the coagulation cascade pathway (miR-494, see Supplementary Fig. S1), Mucin type O-glycan biosynthesis pathway (miR-551a, see Supplementary Fig. S2), PI3K-Akt pathway (miR-876-5p, see Supplementary Fig. S3), and MAPK signaling pathway (miR-150-5p, see Supplementary Fig. S4), which are critical cellular pathways related to EV71 infection. [score:1]
These results suggested that the dysfunction of miR-876-5p and miR-150-5p induced cell apoptosis in response to severe EV71 infections. [score:1]
The expression of miR-150-5p, miR-664-3p, miR-331-3p, and miR-876-5p was evaluated through qPCR. [score:1]
[1 to 20 of 13 sentences]
23
[+] score: 41
Prior to validating whether miR-583 and miR-143 contributed to targeted suppression of IL2Rγ expression, we analyzed the expression kinetics of miR-583 and miR-143, as well as the well-known miRNAs miR-223 and miR-150, during NK cell differentiation using real-time qPCR (Fig. 3b). [score:9]
Our results were consistent with the microarray data presented in Fig. 2 showing that the expression of miR-583, miR-143 and miR-223 were decreased; however, the expression of miR-150 was increased during NK cell differentiation. [score:5]
Notably, miR-150 was previously identified as a regulator of NK cell development by targeting c-Myb in mice [25]. [score:5]
In mouse NK cells, miR-150 regulated NK cell development by targeting c-Myb [25]. [score:5]
In a previous study, miR-150 was reported to regulate the development of NK cell using miR-150 KO mice [25]. [score:3]
The expression of miR-143, miR-223, miR-150 and miR-583 was analyzed by real-time qPCR. [score:3]
As shown in Fig. 2, we found that the expression of miR-150 was strongly increased in mNK cells. [score:3]
Importantly, miR-150 was previously identified as a regulator of mouse NK cell development and cytotoxicity [25], [32], and miR-155 was critically required for NK cell maturation and maintenance at steady state [27]. [score:3]
In these results, we confirmed that the expression of miR-150 and miR-155* were strongly increased in mNK cells. [score:3]
Thus, we assumed that miR-150 could play an important role in humans and in mice. [score:1]
The mature miR-150 sequence in humans, mice and rats are identical [47]. [score:1]
[1 to 20 of 11 sentences]
24
[+] score: 39
These studies indicate that CLCN2 were able to efficiently deliver miR150 inhibitor and mediate suppression of tumor growth. [score:5]
The inhibition of miR-150 expression effectively delayed cell proliferation and promoted apoptosis in the lung carcinoma cells [38]. [score:5]
Tree injections of CLCN2/ miR150 inhibitor were intravenous administrated to H1299 human lung cancer xenografts at the miR150 inhibitor dose of 1.5 mg/Kg. [score:5]
Analysis of tumor growth rate after CLCN2-miR150 inhibitor administration. [score:3]
One group was treated for one week with 3 intravenous injections by tail vein of CLCN2-miR150 inhibitor at 1.5 mg/kg and one group was used as a control group. [score:3]
In previous studies, researchers identified that miR150 promotes the proliferation and migration of lung cancer cells through specifically targeting such as the 3’-UTR of p53, SRCIN1 and BAK1 [36, 37]. [score:3]
In vivo CLCN2-miR150 inhibitor systemic administration H1299 cells were injected into the flank of 6-8-week old nu/nu mice. [score:3]
In this in vivo experiment a miR150 inhibitor was delivered intravenously using CLCN2 to treat H1299 human lung cancer xenografts. [score:3]
In vivo CLCN2-miR150 inhibitor systemic administration. [score:3]
On the basis of these experimental findings, the formulation CLCN2 was conjugated to the tumor suppressor microRNA, miR150 inhibitor [35] and its therapeutic efficacy was evaluated in vivo. [score:3]
CLCN2 were able to efficiently deliver the miR150 inhibitor which resulted in decrease of tumor growth rate as compared to the no treatment control group. [score:2]
The tumor growth rate of the CLCN2-miR150 group was significantly lower than that of the control group (1.9% vs 18.0%, p<0.05, Table 2). [score:1]
[1 to 20 of 12 sentences]
25
[+] score: 39
Thus, EcN was able to significantly reduce the upregulated expressions of miR-155 and miR-223 and downregulate miR-150 expression in comparison with DSS-colitic mice (-37.7%, p < 0.05; Figure 5). [score:11]
Accordingly, the expression of both miR-150 and miR-155 has been reported to be up-regulated in colonic epithelial cells in UC patients and in colitic mice (Bian et al., 2011; Singh et al., 2014; Lu et al., 2017). [score:6]
However, EcN decreased the colonic expression of both miRNAs, whereas it increased miR-150 expression, which could facilitate colonic epithelial cell apoptosis via reduction of c-Myb (Bian et al., 2011). [score:5]
showed that three of them, miR-150, miR-155, and miR-223, were significantly upregulated (around twofold increase vs. [score:4]
In the present study, we selected five of the eleven changed miRNA, specifically miR-143, miR-150, miR-155, miR-223, and miR-375, and questioned whether their expression was altered following treatment of DSS-colitis mice with E. coli Nissle. [score:3]
Both miR-150 and miR-155 have been involved in the regulation of the immune response by controlling the development and function of innate immune cells. [score:3]
Role of miR-150 -targeting c-Myb in colonic epithelial disruption during dextran sulphate sodium -induced murine experimental colitis and human ulcerative colitis. [score:3]
FIGURE 5Biochemical evaluation of the effects of Escherichia coli Nissle 1917 (EcN); the expression of (A) miR-150, (B) miR-155, (C) miR-223, (D) miR-143, and (E) miR-375 was quantified by real-time PCR. [score:1]
Gene Sequence (5′-3′) Annealing temperature (°C) IL-1β FW:TGATGAGAATGACCTGTTCT 55 RV:CTTCTTCAAAGATGAAGGAA IL-12 FW:CCTGGGTGAGCCGACAGAAGC 60 RV:CCACTCCTGGAACCTAAGCAC TGF-β FW:GCTAATGGTGGACCGCAACAAC 60 RV:CACTGCTTCCCGAATGTCTGAC ICAM-1 FW:GAGGAGGTGAATGTATAAGTTATG 60 RV:GGATGTGGAGGAGCAGAG MUC-2 FW:GATAGGTGGCAGACAGGAGA 60 RV:GCTGACGAGTGGTTGGTGAATG MUC-3 FW:CGTGGTCAACTGCGAGAATGG 62 RV:CGGCTCTATCTCTACGCTCTCC ZO-1 FW:GGGGCCTACACTGATCAAGA 56 RV:TGGAGATGAGGCTTCTGCTT OCLN FW:ACGGACCCTGACCACTATGA 56 RV:TCAGCAGCAGCCATGTACTC GAPDH FW:CATTGACCTCAACTACATGG 60 RV:GTGAGCTTCCCGTTCAGC miR-143 UGAGAUGAAGCACUGUAGCUC 55 miR-150 UCUCCCAACCCUUGUACCAGUG 55 miR-155 UUAAUGCUAAUUGUGAUAGGGGU 55 miR-223 UGUCAGUUUGUCAAAUACCCCA 55 miR-375 UUUGUUCGUUCGGCUCGCGUGA 55 SNORD95 TATTGCACTTGTCCCGGCCTGT 55The miRNA from colonic samples was isolated after homogenizing the tissue in QIAzol [TM] (Qiagen, Hilden, Germany) using a Precellys [®]24 homogenizer (Bertin Technologies, Montigny-le-Bretonneux, France). [score:1]
Gene Sequence (5′-3′) Annealing temperature (°C) IL-1β FW:TGATGAGAATGACCTGTTCT 55 RV:CTTCTTCAAAGATGAAGGAA IL-12 FW:CCTGGGTGAGCCGACAGAAGC 60 RV:CCACTCCTGGAACCTAAGCAC TGF-β FW:GCTAATGGTGGACCGCAACAAC 60 RV:CACTGCTTCCCGAATGTCTGAC ICAM-1 FW:GAGGAGGTGAATGTATAAGTTATG 60 RV:GGATGTGGAGGAGCAGAG MUC-2 FW:GATAGGTGGCAGACAGGAGA 60 RV:GCTGACGAGTGGTTGGTGAATG MUC-3 FW:CGTGGTCAACTGCGAGAATGG 62 RV:CGGCTCTATCTCTACGCTCTCC ZO-1 FW:GGGGCCTACACTGATCAAGA 56 RV:TGGAGATGAGGCTTCTGCTT OCLN FW:ACGGACCCTGACCACTATGA 56 RV:TCAGCAGCAGCCATGTACTC GAPDH FW:CATTGACCTCAACTACATGG 60 RV:GTGAGCTTCCCGTTCAGC miR-143 UGAGAUGAAGCACUGUAGCUC 55 miR-150 UCUCCCAACCCUUGUACCAGUG 55 miR-155 UUAAUGCUAAUUGUGAUAGGGGU 55 miR-223 UGUCAGUUUGUCAAAUACCCCA 55 miR-375 UUUGUUCGUUCGGCUCGCGUGA 55 SNORD95 TATTGCACTTGTCCCGGCCTGT 55 The miRNA from colonic samples was isolated after homogenizing the tissue in QIAzol [TM] (Qiagen, Hilden, Germany) using a Precellys [®]24 homogenizer (Bertin Technologies, Montigny-le-Bretonneux, France). [score:1]
Furthermore, miR-21, miR-122a, miR-155, and miR-150 have been associated with impairment of tight junction proteins and increased intestinal epithelial permeability (Bian et al., 2011; Ye et al., 2011). [score:1]
[1 to 20 of 11 sentences]
26
[+] score: 32
The miR-150 has a dynamic expression profile during lymphocyte development, being highly expressed in mature B cells and T cells but not in their progenitors, its expression is then extinguished after further differentiation of naive T cells into the Th1 and Th2 subsets [29]. [score:8]
When murine macrophages were incubated with docetaxel at 0.8 μg/ml for 1 h, only miR-146a expression was significantly increased in comparison with the control (Figure 7D); 3 hours later, the expression of miR-155, miR-150 and miR-146a was significantly increased (Figure 7B, C, D) while miR-181a and miR-125b had no significant changes (Figure 7A, E). [score:5]
MiR-155, miR-150 and miR-146a are up-regulated in Raw 264.7 cells in response to docetaxel. [score:4]
Expression levels of microRNAs (miR-181a, miR-155, miR-150, miR-146a and miR-125b) were detected according to our lab previously described by Yuan et al. [21]. [score:3]
The enhanced immunity was associated with up-expressed microRNAs (miR-155, miR-150 and miR-146a) in docetaxel-stimulated RAW264.7 cells. [score:3]
The enhanced immune responses may be associated with up-expressed microRNAs (miR-155, miR-150 and miR-146a) as detected in docetaxel-stimulated RAW264.7 cells. [score:3]
Three hours later, miR-155, miR-150 and miR-146a expressions were enhanced (Figure 7B, C, D), while miR-181a and miR-125b showed no significant change (Figure 7A, E). [score:3]
Real-time PCR was performed to determination of miR-181a (A), miR-155 (B), miR-150 (C), miR-146a (D) and miR-125b (E) as described in methods. [score:1]
Previous studies have shown that miR-155, miR-150, miR-146a, miR-181a and miR-125b are involved in the innate immune reactions. [score:1]
In this study, miR-181a, miR-155, miR-150, miR-146a and miR-125b were analyzed to identify microRNAs possibly involved in responses to docetaxel stimulation (Figure 7). [score:1]
[1 to 20 of 10 sentences]
27
[+] score: 31
Indeed, miR-150 overexpression led to a drastic inhibition of cell growth and tumor formation through repression of its downstream target MYB, a master regulator of proliferation in ALK(+) ALCL cells [37] (Table 3). [score:8]
Accordingly, miR-150 repression was turned off following treatment with the DNMT inhibitor, decitabine, and in murine NPM/ALK(+) xenograft mo dels miR-150 upregulation was found to induce anti-neoplastic activity [37]. [score:6]
Moreover, epigenetic silencing of miR-150 was due to the activation of STAT3 which regulates DNMT1 expression. [score:4]
2.3.1. miR-101, miR-29a and miR-150: Suppressors of Cell Proliferation and Survival. [score:3]
Furthermore, both the treatment of crizotinib-resistant NPM/ALK(+) KARPAS-299-CR06 cells with decitabine and ectopic miR-150 expression reduced viability and growth [37]. [score:3]
We could show that miR-150 is a tumor suppressor miRNA in ALK(+) ALCL cells. [score:3]
Levels of another tumor suppressor miRNA, miR-150 (mentioned in Section 2.3.1), were also reduced in the NPM/ALK(+) ALCL cell lines and biopsy specimens as a consequence of DNA hypermethylation, with DNA hypermethylation -mediated miR-150 repression also shown to require ALK -dependent pathways [37]. [score:3]
Levels of another miRNA, miR-150, were also shown to be reduced in ALK(+) ALCL cell lines and biopsy specimens as a consequence of the activity of the ALK kinase (further described in paragraph three) [37]. [score:1]
[1 to 20 of 8 sentences]
28
[+] score: 31
At 30 weeks of age, the expression of miR-216 (p-value = 0.016), miR-217 (p-value = 0.0078), miR-150 (p-value =0.023), Let-7b (p-value = 0.031,) and miR-96 were significantly downregulated, whereas the expression of miR-146b (p-value = 0.0078), miR-205, (p-value - 0.0078), miR-21, miR-195 (p-value = 0.031), and miR-34c (p-value = 0.063) were significantly upregulated in KC animals compared to control animals (Figure 2B). [score:10]
The analysis for the KC animals compared to controls revealed that miR-150, miR-494, miR-138, miR-148a*, miR-216a, and miR-217 (p-value = 0.01) were significantly downregulated (Table 1), whereas, miR-146b, miR-205, miR-31, miR-192, and miR-21 (p-value = 0.01) were significantly upregulated (Table 2). [score:6]
We have shown that in tumor samples compared to normal samples, the majority of miRNAs (miR-216, miR-217, miR-100, miR-345, miR-141, miR-483-3p, miR-26b, miR-150, Let-7b, Let-195 and miR-96) were downregulated, and few were upregulated (miR-146b, miR-205, miR-31, miR-192, miR-194 21, miR-379, miR-431, miR-541, and miR-199b). [score:6]
Further, at 50 weeks of age, the expression of miR-216, miR-217, miR-345, miR-141, miR-483-3p, miR-26b, miR-96, Let-7b (p-value = 0.01), miR-100, miR-26a and miR-150 (p-value = 0.094) were further downregulated in KC animals compared to control mice (Figure 2D). [score:5]
The present study also revealed significant downregulation of miR-150 during the progression of PC in both mice and humans (Figure 2A– 2D, 3E). [score:4]
[1 to 20 of 5 sentences]
29
[+] score: 31
Other miRNAs from this paper: hsa-mir-15a, hsa-mir-150, mmu-mir-15a
Furthermore, our results suggest that miR-15a/16 may also indirectly regulate miR-150 whose deficiency was shown to result in an expansion of B1 cells by directly targeting c-Myb transcript [29]. [score:6]
Another microRNA, miR-150, which is known to be expressed specifically in mature lymphocytes but not their progenitors [19] was also expressed at significantly lower levels in NZB and DBA [−/−] B cell sub-populations, which may be due to their incomplete maturation (Figure 1D). [score:5]
This population was sorted and used for analysis in panels C and D. C. Quantification of B1 (left) and B2 (right) cells in DBA, NZB and DBA−/− congenic mice spleen; n = 3. D. TaqMan PCR levels of miR-15a and miR-150 in sorted B2 subpopulation from spleen; RQ is relative quantification normalized to snRNA U6 expression; E. Flow cytometry quantitative analysis of immature IgM+IgDlow B cells; columns are means, bars are SEMs; n≥3. [score:3]
This was further supported by an elevated expression of miR-150 in NZB ES cells (Figure 5F), which was used as a maturation marker in this context. [score:3]
In fact, both miR-150 and miR-15a/16 are confirmed suppressors of this transcription factor [30]. [score:3]
This was accompanied by an accumulation of IgM [+]IgD [low] population and low miR-150 expression in the spleens of congenic animals suggesting a maturation deficiency. [score:3]
However, the loss of miR-150 alone does not lead to a detectable increase in cMyb protein levels in mature B1 cells [29] suggesting that another hit is required to promote B1 cells expansion through cMyb overexpression. [score:3]
1, C. cMyb, D. miR-15a, E. miR-150 in ES (left panels) and iPS (right panels) cells during in vitro differentiation. [score:1]
A. TaqMan real-time PCR quantification of miR-15a and miR-150 levels in sorted B1a subpopulations from spleen; N = 3, columns represent mean RQs, bars are SEMs; B. Flow cytometry staining for B1 CD5+, B220 [dull] cells (gated on CD3-CD19+). [score:1]
However, the DBA [−/−] congenic mice did not have decreased miR-150 relative to the control wild-type DBA strain. [score:1]
Figure 1Comparison of splenic phenotype in control DBA, NZB and DBA congenic (DBA [−/−]) mice A. TaqMan real-time PCR quantification of miR-15a and miR-150 levels in sorted B1a subpopulations from spleen; N = 3, columns represent mean RQs, bars are SEMs; B. Flow cytometry staining for B1 CD5+, B220 [dull] cells (gated on CD3-CD19+). [score:1]
Furthermore, NZB-LSK derived cells harvested on day 11 had reduced miR-150 levels (Figure 3A, right panel) consistent with the significantly increased immature B cells observed during analysis of surface markers. [score:1]
[1 to 20 of 12 sentences]
30
[+] score: 29
While miR-150 is repressed uniformly across MLL subtypes, let-7g is differentially repressed by Lin28B according to expression level, which reinforces high c-Myc expression in MLL leukemias with short disease latency. [score:7]
Negative regulation of miR-150 by Lin28B was observed in all MLL-FP cell lines, which is necessarily downregulated in 11q23 leukemias. [score:5]
An important target of Lin28B in leukemic cells is miR-150 which negatively regulates c-Myc. [score:4]
Mature miR-150 levels are reduced in all MLL-FP subtypes compared to c-Kit [+] bone marrow cells consistent with previous findings that MLL suppresses miR-150 expression through the Myc/Lin28B pathway (Figure 5B) [44]. [score:4]
miR-150 maturation suppression by Lin28B is an important mechanism for MLL-FP mediated leukemic transformation [44]. [score:3]
Of note, miR-150 expression was also significantly lower in AML-ETO9a and E2A-HLF leukemia cell lines compared to c-Kit [+] bone marrow (Supplemental Figure 5A). [score:2]
Both miR-150 and let-7 are repressed by both c-Myc and Lin28B [42]. [score:1]
This is consistent with previous reports showing an association of Lin28B with malignant tumors and miR-150 repression in MLL leukemias [44]. [score:1]
B. Mature miR-150 is repressed in all MLL-FP leukemia cells as detected by qPCR. [score:1]
We observed a striking repression of miR-150 in MLL-FP transformed leukemia cells in comparison to bone marrow. [score:1]
[1 to 20 of 10 sentences]
31
[+] score: 28
Figure 2Cutaneous manifestation of mice was improved after pentoxifylline medication (arrows: skin lesion) (A); Expression of miR-21 was down-regulated by medication with either colchicine or pentoxifylline (B); miR-150 expression was not affected after medication (C). [score:8]
The expression levels of miR-21 and miR-150 were then analyzed by real-time PCR. [score:3]
Figure 1 Expressions of miR-21 and miR-150 in BD mice and miR-21 in BD patients. [score:3]
The expression of miR-21 and miR-150 were significantly (p < 0.05) different between BDN and BD. [score:3]
The expression of miR-150 was not affected by colchicine or pentoxifylline treatment. [score:3]
In mice, the expression of miR-21 and miR-150 was higher in BD than BDN. [score:3]
However, miR-150 expression was unchanged after the treatment of either of the two medications (Figure 2). [score:3]
miR-21 and miR-150 in BD were highly expressed compared to those in BDN (Figure 1). [score:2]
[1 to 20 of 8 sentences]
32
[+] score: 27
Recent genetic studies have shown that overexpression of miRNA-150 results in a slow recovery rate after 5-fluorouracil induced injury in a mouse mo del for bone marrow transplant [30]. [score:3]
A recent miRNA profiling from sorted cell types shows lymphoid enriched expression of miRNA-150, whose plasma levels mirrored the lymphocyte counts [35]. [score:3]
Recent RT-PCR based studies have shown that the plasma levels of miRNA-150 can vary under some disease states [36] and inter-individual variations in lymphocyte counts are expected to contribute to changes in basal levels of serum miRNA-150 [12]. [score:3]
B: Counts from a non-responsive molecule miRNA-23a, comparable to that of miRNA-150 in control animals. [score:1]
A 30% reduction in serum miRNA-150 was observed in animals 24 hrs after 1 Gy total body radiation exposure, which further decreased to 50% by 48 hrs (Figure 6). [score:1]
Dose and time dependent depletion of miRNA-150 in animals exposed to 1, 2, 4, 6 and 8 Gy with reference to controls analyzed at 24 hrs (A) and 48 hrs (B). [score:1]
miRNA-23a, whose counts in controls are comparable to that of miRNA-150 was used as another control (Figure 5B). [score:1]
Recent studies show that miRNA-150 control hematopoiesis [29], [30], [31] and their dose and time dependent changes should provide readouts for the conditioning as well as hematopoietic injury response [31]. [score:1]
A: The dose dependent depletion of serum miRNA-150 at different time points during and after fractionation (p-values: 4 Gy- 0.0003, 8 Gy- 0.0001, 12 Gy- 0.0001). [score:1]
Consistent with data from single acute dose, about 50% reduction in serum counts for miRNA-150 was observed in mice that received 4 Gy by 24 hrs. [score:1]
Several evolutionarily conserved and functionally significant miRNAs, such as miRNA-150, miRNA-21, miRNA-29a and miRNA-23a, were also detected in serum samples [25], [26], [27], [28], [29]. [score:1]
Moreover, miRNA-150 is abundant in serum (ranked among the top 6 miRNAs in serum), and was found to be sensitive even at 1 Gy, the lowest tested dose in the current study. [score:1]
The evaluation of the kinetics of depletion of miRNA-150 during three days of fractionation, using a schedule followed in a clinical setting, signifies the translational potential of this marker. [score:1]
C: Kinetics of depletion of miRNA-150 as a function of dose and time relative to respective controls. [score:1]
A time and dose dependent decrease in serum miRNA-150 was evident with an increase in dose, where a gradual decrease in counts was observed with increasing dose. [score:1]
A: The dose dependent depletion of serum miRNA-150 at 24 hrs (p-values: 1 Gy- 0.0164, 2 Gy- 0.0191, 4 Gy- 0.0026, 6 Gy- 0.0001, 8 Gy- 0.0001). [score:1]
A decrease in levels of miRNA-150 was evident even in animals that received 1 Gy radiation, which further decreased with increasing dose (2, 4, 6 and 8 Gy). [score:1]
The biodosimetry potential of miRNA-150 is evident from its time and dose dependent depletion, correlating with lymphocyte depletion kinetics [1], [9], [32]. [score:1]
Individual miRNAs such as miRNA-150 alone or in combination with other markers have the potential to estimate the dose to which the individual was exposed. [score:1]
We propose miRNA-150 as a sensitive marker for damage to the hematopoietic system, which is the most radiosensitive organ/system. [score:1]
miRNA-150 depletion kinetics indicate that the response is fast and robust with a near complete depletion in 48–72 hrs with 8 Gy acute dose and 8–12 Gy fractionated dose. [score:1]
[1 to 20 of 21 sentences]
33
[+] score: 26
Other miRNAs from this paper: mmu-mir-155
Affected Phenotype Target Effect Reference Hematological system Hematopoietic abnormalities Th cells Spontaneous activation and proliferation; Th1↑/Th17 ↓(36, 39) Treg cells Cells plasticity ↑(36, 44, 48) Dendritic cells Activation; BAFF ↑(19, 36, 49, 50) Autoantibody IgG ↑; Ig class switching ↑(19, 60) Kidney Lupus nephritis Anti-dsDNA IgG Binds and catalyzes SOCS1-KIR(53) miRNA-150 SOCS1 expression ↓; renal fibrosis(67) Macrophages Renal inflammation(70– 72) Skin Cutaneous inflammation Keratinocytes Interferon-γ signaling ↑(78, 81) Brain Neuropsychiatric SLE Astrocytes Activation ↑, inflammatory cytokines and chemokines ↑(88– 90) Microglia Macrophages T cells Liver Lupus hepatitis(95) Lung Pulmonary fibrosis Macrophages Activation ↑, profibrotic cytokines ↑, collagen synthesis ↑(98, 99) Lymphocyte BAFF, B-cell activating factor; KIR, kinase inhibitory region; SOCS1, suppressor of cytokine signaling 1; Th, T helper cells; Treg, T regulatory cells. [score:10]
In podocytes, TGF-β stimulates miR-150 expression, accompanied by decreased SOCS1 and increased COL1 and COL3 expression (68). [score:5]
In proximal tubular and mesangial cells in vitro, miR-150 inhibited SOCS1 expression and increased the production of profibrotic proteins such as fibronectin, collagens I and III, and TGF-β1 (68). [score:5]
In patients with LN, miR-150 is overexpressed in resident cells of kidneys (67). [score:3]
SOCS1 is one of the potential targets of miR-150 (68). [score:3]
[1 to 20 of 5 sentences]
34
[+] score: 25
This suggests that long-term stress could promote a developmental arrest of the DN cells via the up-regulation of miR-150, the target of which is c-Myb [59]. [score:7]
Unlike miR-150, miR-125b-5p was primarily expressed in stromal tissue, as it was not detected in purified thymocytes (lanes 8–9). [score:3]
With the exception of miR-150 and miR-342-3p, the majority of the miRs were down regulated in the DN subset. [score:2]
While miR-150 was identified in both the spleen and thymus, it only appeared up regulated in the thymic tissue following LPS or Dex treatments (Figure 2D). [score:2]
MiR-125b-5p, miR-150, miR-205, and miR-342-3p were consistently up regulated in the thymic tissue from the LPS injected mice (Figure 2B). [score:2]
Contrasting these findings, miR-150 is up regulated 2–3.5 fold in the mature SP subsets, while remaining unchanged in the DP population. [score:2]
It is noteworthy that elevations of miR-150 in the hematopoietic system, via retroviral transduction, cause early developmental arrest of B cells and contribute to myeloid leukemia's [58]. [score:2]
To determine the temporal alterations in miR levels following LPS or Dex treatments, northern blots were performed with RNA extracted from the thymus at 24, 48, and 72 h. MiR-125b-5p and miR-150 exhibited a transient, 2-fold increase 24 h post-LPS and -Dex injections (Figure 3A, lanes 2 and 5 versus 1). [score:1]
MiR-20b, miR-106a and miR-150 were stress responsive, but were only identified in the thymus and spleen. [score:1]
MiR-709, miR-1224, and miR-342-3p/5p are increased several-fold in the DP subset, while miR-150 and miR-342-3p are increased in all the thymocyte subsets. [score:1]
Northern blots were performed for the selected miRs A) Mir-125, B) MiR-150, C) MiR-181a, and D) MiR-181d. [score:1]
The individual miRs (miR-150, miR-205, miR-128, miR-181a, miR-181b, miR-181d) were detected by Northern blotting. [score:1]
[1 to 20 of 12 sentences]
35
[+] score: 24
Analysis of global profiles of miRNA expression in skeletal muscle with microarray shows that expression of 4 miRNAs (miR-29a, miR-29b, miR-29c and miR-150) are up-regulated [23], whereas expression of 11 miRNAs (miR-379, miR-127, miR299-5p, miR-434-3p, miR-335, miR130a, miR-19b, miR-451, miR-148a, miR-199a and miR-152) are down-regulated in skeletal muscle of type 2 diabetic rats [23]. [score:13]
For example, it has been shown that expression of 4 miRNAs (miR-29a, miR-29b, miR-29c and miR-150) is up-regulated [23], whereas expression of 11 miRNAs (miR-379, miR-127, miR299-5p, miR-434-3p, miR-335, miR130a, miR-19b, miR-451, miR-148a, miR-199a and miR-152) is down-regulated in skeletal muscle of type 2 diabetic rats [23]. [score:11]
[1 to 20 of 2 sentences]
36
[+] score: 24
Change of expression in human aHSC (Fold Change) Expression in plasma of liver disease-compared to healthy individuals Source Expression trend Etiology miRNA-150-5p ↓ (870) ↑ HBV Li et al., 2010; Venugopal et al., 2010 miRNA-192-5p ↓ (8.53) ↑ HBV, NASH, NAFLD Tryndyak et al., 2012; Winther et al., 2013; Becker et al., 2015; Pirola et al., 2015 miRNA-200b-3p ↑ (22.55) ↑ NAFLD, HBV/HCV -associated HCC Murakami et al., 2011; Tryndyak et al., 2012 miRNA-122-5p N. D. ↑ HCV, HBV, NASH, NAFLD Arataki et al., 2013; Shrivastava et al., 2013; Tan et al., 2014; Pirola et al., 2015 miRNA-21-5p N. D. = /↑ HBV, NAFLD Yamada et al., 2006; Cermelli et al., 2011; Becker et al., 2015 miRNA-92a-3p N. D. ↑ HBV -associated HCC, HCV Li et al., 2010; Ji et al., 2011; Shrivastava et al., 2013 N. D., non-determined. [score:8]
Liver fibrosis causes downregulation of miRNA-150 and miRNA-194 in hepatic stellate cells, and their overexpression causes decreased stellate cell activation. [score:6]
MiRNA-150, -192, and -200b were selected from this list as potentially important miRNAs, based on their significant deregulation during HSC activation and their changing expression in the blood of patients with liver disease. [score:6]
FIGURE 3 Expression of vesicle -associated miRNA-150, -192, -200b, -92a during early stage HBV- and HCV -induced fibrosis. [score:3]
miRNA Mature miRNA primer miR-92a-3p TATTGCACTTGTCCCGGCCTGT miR-122-5p TGGAGTGTGACAATGGTGTTTG miR-150-5p TCTCCCAACCCTTGTACCAGTG miR-192-5p CTGACCTATGAATTGACAGCC miR-200b-3p TAATACTGCCTGGTAATGATGA miR-21-5p TAGCTTATCAGACTGATGTTGA cel-miR-39-3p AGCTGATTTCGTCTTGGTAATA All primers were ordered from Integrated DNA Technologies (IDT, Leuven, Belgium), and are specific for detection of both human and murine miRNA -expression. [score:1]
[1 to 20 of 5 sentences]
37
[+] score: 22
Similarly to CXCR4, Myb expression decreases during NK cell maturation paralleling the increased expression of miR-150, thus suggesting that reciprocal regulation of these three factors plays a critical role in NK development during homeostasis. [score:7]
This was associated to higher stability of the TF c-Myb, a direct target of miRNA-150 negatively regulated during the transition from CD27 [high]CD11b [low] to CD27 [low]CD11b [high] NK cells (7). [score:5]
Interestingly, miR-150 knockdown significantly increased CXCR4 expression in mononuclear hematopoietic cells and affected their BM localization (53). [score:4]
Differently from miRNA-150, in miRNA-155 [−/−] mice, the immature CD27 [high]CD11b [low]Ly49D [−]Ly49H [−]NK cell subset is reduced, likely because miRNA-155 targets the pro-apoptotic factor Noxa, thus supporting survival and homeostasis of developing NK cells (25). [score:3]
It is likely that the effect of miR-150 on CXCR4 mRNA expression is Myb -dependent as this TF can associate the CXCR4 gene promoter and activate a CXCR4 reporter gene in transfection assays. [score:2]
Accordingly, significant accumulation of more immature CD27 [high]CD11b [low] and a related decrease of IFN-γ production have been observed also within miRNA-150 [−/−] NK cells (23). [score:1]
[1 to 20 of 6 sentences]
38
[+] score: 21
Dot plots show the expression levels of miR-146a, miR-193b, miR-205, miR-215, miR-467a, miR-150, and miR-486 measured for MV, MV-free plasma, and brains from NI, NCM, and CM conditions, expressed as normalized values as compared to the expression of a panel of control miRNA in each case. [score:4]
The differential expression profiles of these selected miRNA (miR-146a, miR-150, miR-193b, miR-205, miR-215, miR-467a, and miR-486) were analyzed in mouse MV, MV-free plasma, and brain tissue by quantitative reverse transcription PCR (RT-qPCR). [score:3]
The direction of regulation in CM conditions was the opposite for MV and brain tissue in the case of miR-150, miR-205, miR-193b, and miR-467a. [score:3]
A further four miRNA—miR-150, miR-215, miR-467a, and miR-486 showed the same directional change in abundance as in the, without reaching significance (Fig.   4). [score:2]
In examining further the brain, all but one miRNA (miR-150) showed increased abundance in the brains of CM mice, as compared with their NI counterparts; interestingly their NCM counterparts demonstrated intermediate levels of expression, further demonstrating the difference in the degree of in severity between the two infections. [score:2]
NI MV OpenArray RT-qPCR hsa-miR-328 − 2.5* ± 0.93Not tested [a] hsa-miR-335* − 3.0* ± 1.13Not tested [a] mmu-miR-16* 2.8** ± 0.65Not tested [a] mmu-miR-21* 5.0** ± 0.88Not tested [a] mmu-miR-297a* 5.8* ± 1.60Not tested [a] mmu-miR-685 3.0* ± 1.00Not tested [a] mmu-miR-1949 5.0* ± 1.69Not tested [a] hsa-miR-590-5p Unique to NINot validated [b] rno-miR-450 Unique to CMNot validated [b] mmu-miR-10b 2.7* ± 0.85Not validated [b] hsa-miR-146a 3.2** ± 0.68 7.2* ± 2.74 hsa-miR-150 1.8* ± 0.64 2.7 (ns) ± 2.26 hsa-miR-205 2.3* ± 0.75 − 0.5 (ns) ± 1.89 hsa-miR-486 2.3*** ± 0.18 4.7 (ns) ± 1. 45 mmu-miR-193b − 2.7** ± 0.62 − 7.5* ± 0 62 mmu-miR-215 2.1* ± 0.554.6 (ns) ± 99.39 [c] mmu-miR-467a − 2.0* ± 0.69 − 5.6 (ns) ± 0.96 The list of significantly differentially expressed miRNA in CM vs NI MV from the was compared with the results obtained by. [score:2]
The results are presented as follows: significant changes in MV – miR-146a and miR-193b, significant changes in the brain—miR-205, miR-215, and miR-467a, no significant changes—miR-150 and miR-486. [score:1]
The results of these are denoted as * = 0.05–0.01, ** = 0.01–0.0001, *** ≤ 0.0001 No significant change in the abundance of miR-150, miR-205, miR-215, miR-467a, and miR-486 in MV following Plasmodium infectionOf the seven miRNA of interest tested by RT-qPCR, miR-146a and miR-193b showed the same significant change in abundance as in the OpenArray (from Fig.   2b). [score:1]
All the remaining miRNA (Table  1, miR-146a, miR-150, miR-193b, miR-205, miR-215, mir-467a, and miR-486) were tested on MV samples as per the and also on MV-free plasma and brain tissue from NI, NCM, and CM mice. [score:1]
No significant change in the abundance of miR-150, miR-205, miR-215, miR-467a, and miR-486 in MV following Plasmodium infection. [score:1]
The database was searched with the full names of each murine miRNA as per the ThermoFisher Scientific product information and miRBase version 21: mmu-miR-16-1-3p, mmu-miR-21a-3p, mmu-miR-146a-5p, mmu-miR-150-5p, mmu-miR-193b-3p, mmu-miR-205-5p, mmu-miR-215-5p, mmu-miR-297a-3p, mmu-miR-328-3p, mmu-miR-335-3p, mmu-miR-467a-5p, mmu-miR-486a-5p, mmu-miR-685, mmu-miR-1949, and rno-miR-10b-5p. [score:1]
[1 to 20 of 11 sentences]
39
[+] score: 19
A microRNA microarray also identified miR-150 as being deregulated in experimental (hyperoxia -driven) BPD, where lung expression of miR-150 was reduced [30]. [score:4]
Consistent with this idea, miR-150 [−/−] mice exhibited increased Gpnmb expression. [score:3]
Additionally, glycoprotein nonmetastatic melanoma protein b (Gpnmb) was identified and validated as a target of miR-150 [30]. [score:3]
These data suggested that decreased miR-150 levels would lead to increased Gpnmb expression, which was indeed observed in experimental BPD [33]. [score:3]
These data provide limited support for a causal role for miR-150 in the aberrant lung development associated with experimental BPD. [score:2]
Furthermore, the lung capillaries in miR-150 [−/−] mouse pups appeared dysmorphic. [score:1]
To date, only two studies have examined a causal role for microRNA in experimental BPD, which addressed miR-150 [33] and miR-489 [26]. [score:1]
To date, three microRNA have received particular attention in the context of BPD: miR-206 [32], miR-150 [33], and miR-489 [26]. [score:1]
When miR-150 [−/−] mouse pups were exposed to hyperoxia, a moderate protection of the lung structure was noted at P9; however, no protection was evident at P13, where miR-150 [−/−] mice and wild-type mice exhibited a comparable blunting of alveolarization in response to hyperoxia exposure. [score:1]
[1 to 20 of 9 sentences]
40
[+] score: 19
Vaccine alone increased the expression of miR-142-5p and miR-150, and downregulated miR-133b and miR-1. RFA alone induced up-regulation of 5 specific microRNA transcripts relative to treatment control: miR-1, -133b, -150, -203, and -205. [score:9]
Vaccine, RFA alone, and RFA combined with vaccine induced a robust increase in expression of miR-150, a tumor suppressor shown to inhibit cancer stem cells in pancreatic cancer [46]. [score:7]
Similar results were observed with miR-1. Expression of miR-150 in MC38-CEA [+] tumors increased 25.2-fold after exposure to RFA alone, and 32-fold after exposure to RFA plus vaccine. [score:3]
[1 to 20 of 3 sentences]
41
[+] score: 19
Analysing miR expression in PTen [wt] prostate cells treated with PI3K/PTEN modifying drugs showed that the mTORC1 inhibitor (Tem) decreased miR-155, miR-150 and miR-132 expression, while inhibition of the ectopically expressed wild type PTEN with the highly selective PTen inhibitors SF1670 [N-(9,10-Dihydro-9,10-dioxo-2-phenanthrenyl)-2,2-dimethyl-propanamide] and bpV(HOpic) [Dipotassium bisperoxo (5-hydroxypyridine-2-carboxyl) oxovanadate] increased miR expression (Fig.   6a). [score:15]
High mir-150 expression is positively correlated with tumour recurrence and metastasis [38]. [score:3]
Dezhong L miR-150 is a factor of survival in prostate cancer patientsJ. [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 18
Analysis of the expression levels of the nine-miRNA panel revealed that three miRNAs (miR-122-5p, miR-150-5p, and miR-375) were similarly altered (all up-regulated) in mice with DSS -induced and TLR5 [−/−] colitis compared to the corresponding healthy controls (Fig.   3A). [score:5]
Finally, miRNA-150 was previously shown to be up-regulated in colonic tissues of DSS -induced colitic mice and UC patients [55]. [score:4]
Thus, among the nine miRNAs of the identified signature, two were deregulated in both intestinal inflammation and arthritis (miR-122-5p and miR-375), one was specifically deregulated in all three intestinal inflammation mo dels (miR-150-5p), and the others appeared to be specific to the IL10 [−/−] mouse mo del. [score:3]
miRNA nameIL10 [−/−] mice mo del Intestinal Inflammation Inflammation mmu-miR-29b-3p x mmu-miR-122-5p x x x mmu-miR-148a-3p x mmu-miR-150-5p x x mmu-miR-192-5p x mmu-miR-194-5p x mmu-miR-146a-5p x mmu-miR-375-3p x x x mmu-miR-199a-3p x We showed that our nine-miRNA signature could discriminate between the different forms of colitis and arthritis, as well as between non-colitic mice with and without a genetic predisposition to develop the disease (WT mice versus non-colitic IL10 [−/−] mice). [score:3]
The expression of miR-150, which was increased in the three mo dels of intestinal inflammation (IL10 [−/−], DSS, and TLR5 [−/−]), was unaltered in the arthritis mo del, as were the remaining miRNAs of the signature (Fig.   3A). [score:3]
[1 to 20 of 5 sentences]
43
[+] score: 18
For example, miR-99a cooperates with miR-150 to repress the expression of the mammalian target of rapamycin (mTor), a known inhibitor of iTreg differentiation (29). [score:7]
Whereas miR-99a expression was upregulated by RA exposure and repressed mTor by binding to the 3′ UTR (29), miR-150 only repressed mTor in the presence of miR-99a (29). [score:6]
Together, these data identify miRNA agonist targets (miR-99a, miR-150, iR-15b-16, miR-100, miR-126, and miR-155) that can be exploited to increase iTreg generation. [score:3]
miR-10b, miR-99a, miR-130a, miR-146b, miR-150, and miR-320 were amongst those found to drive Treg differentiation. [score:1]
miR-150 antagomir exposure led to a reduced iTreg differentiation. [score:1]
[1 to 20 of 5 sentences]
44
[+] score: 17
Cyclophosphamide treatment led to significantly lower miR-96-5p, miR-182-5p, and miR-379-5p expression and significantly higher miR-150-5p expression relative to the saline -treated C3. [score:5]
The expression levels of miR-96-5p, miR-182-5p, and miR-379-5p were significantly lower, while those of miR150-5p were significantly higher in the Y group than in the C group. [score:3]
The expression levels of miR-31-5p, miR-96-5p, miR-182-5p, miR-183-5p, and miR-379-5p were significantly higher, while those of miR150-5p were significantly lower in the C group than in the N group. [score:3]
The expression levels of miR-31-5p, miR-96-5p, miR-182-5p, miR-183-5p, and miR-379-5p were significantly higher, while those of miR150-5p were significantly lower in C3. [score:3]
In splenocytes from the MRL-lpr mice (the samples in our previous study), the expression levels of miR-18a-5p, miR-31-5p, miR-96-5p, miR-127-3p, miR-182-5p, miR-183-5p, and miR-379-5p were significantly higher, while those of miR-101a-3p and miR150-5p were significantly lower in the C group than in the N group. [score:3]
[1 to 20 of 5 sentences]
45
[+] score: 15
miR-150 expression levels were not correlated with gender or EDSS. [score:3]
Multiple sclerosis Cerebrospinal fluid Biomarkers miRNA miR-219 miR-150 Multiple sclerosis (MS) is the most common chronic inflammatory demyelinating central nervous system (CNS) disease of young adults worldwide [1]. [score:3]
We found miR-150 to be significantly upregulated in relapse-onset (RRMS and SPMS) compared to PPMS patients. [score:3]
Pair-wise comparisons showed significant differences in mean levels of miRNA-150 between RRMS and PPMS (p = 0.007), and between progressive-onset (PPMS) and relapse-onset (RRMS + SPMS) disease (p = 0.023), but there were no differences compared to controls (Fig. 1f). [score:2]
e Percentage of CSF samples with undetected miR-219 in cohort 3. f Scatter plot of miR-150 relative expression levels in CSF of individuals with detectable miR-150 levels of cohort 3. miR-150 levels were significantly increased in RRMS compared to PPMS, and in relapse-onset (RRMS, SPMS) compared to progressive-onset (PPMS). [score:1]
However, after correction for age, only trends remained for the differences in the mean miR-150 levels between groups. [score:1]
No significant differences were found between miR-150 levels in relapse-onset patients who did or did not use interferon-beta. [score:1]
miR-150 was detectable in 55 of the 112 CSF samples, while the frequency of undetectable miR-150 was similar between groups in terms of insufficient RNA yield, insufficient total miRNA level, or insufficient miR-150 level. [score:1]
[1 to 20 of 8 sentences]
46
[+] score: 14
Other miRNAs from this paper: mmu-mir-155
These data suggest that a dynamic and tightly regulated expression of miR-150 is required for optimal iNKT cell development. [score:5]
miR-150 regulates the development of NK and iNKT cells. [score:3]
Notably, Zheng et al. described a partial block in thymic and peripheral iNKT maturation in miR-150 KO mice, whereas Lanier’s group showed a substantial reduction of iNKT cells in mice over -expressing miR-150. [score:3]
microRNA miR-150 is involved in Valpha14 invariant NKT cell development and function. [score:2]
On the iNKT cell side, two groups identified miR-150 as the essential microRNA for thymic and peripheral iNKT cell maturation (16, 17). [score:1]
[1 to 20 of 5 sentences]
47
[+] score: 14
In the STHdhQ111/HdhQ111 striatal cell mo del of HD, exogenous expression of miR-214, miR-150, miR-146a, and miR-125b reduced mutant huntingtin expression and aggregation whereas mutations to these miRNAs prevented, and loss of function reversed, their effect [147]. [score:6]
Based on these findings, upregulation of miR-9, miR-9*, miR-22, miR-34b, miR-125b, miR-137, miR-146a, miR148a, miR-150, miR-196a, and miR-214 may have therapeutic potential against mutant HTT, REST, HDAC4, apoptosis, and other pathobiological factors in HD. [score:4]
These functional data support some (miR-22, miR-125b, miR-146a, miR-150) and contradict other (miR-34b, miR-148a, and miR-214) Table 2 miRNA targets. [score:3]
The effects of psychotropics on the other miRNAs listed in Table 2, particularly miR-9, miR-9*, miR-22, miR-34b, miR-125b, miR-137, miR-146a, miR148a, miR-150, miR-196a, and miR-214, as well as on REST, deserve study in HD mo dels. [score:1]
[1 to 20 of 4 sentences]
48
[+] score: 14
By contrast, the overexpression of miR-150 inhibits the transition of proB to preB by targeting c-myb translation [12, 13]. [score:9]
Subsequently, miR-17-92 [29], miR-34a [18], and miR-150 [12] were reported to regulate proB cell to preB cell development, how and whether miRNAs can affect CLPs to develop into B cells are largely unclear. [score:3]
Deficiency of miR-150 leads to B1 cell expansion and enhances the humoral immune response. [score:1]
In 2007, Rajewsky and Lodish found that miR-150 plays a pivotal role in B cell maturation. [score:1]
[1 to 20 of 4 sentences]
49
[+] score: 14
For instance, we have identified miR-150 as an endothelial-enriched miRNA in retinal vessels and its down-regulation leads to pathologic neovascularization 50. [score:4]
Our previous study showed that endothelial miR-150 targets angiogenic genes, such as Fzd4 and Dll4 as validated by 3′UTR luciferase assays, to exert an intrinsic suppressive role in pathologic retinal angiogenesis 50. [score:4]
This comparison demonstrated different groups of miRNAs preferentially altered at different time points in OIR, yet several miRNAs, including miR-150, miR-375, miR-129-5p and miR-129-3p showed consistent pattern of down-regulation at both P15 and P17. [score:4]
MiR-150 is selectively expressed in mature B and T cells as well as abundant in vascular endothelial cells 49 50. [score:2]
[1 to 20 of 4 sentences]
50
[+] score: 13
This is in agreement with a previous observation that miR-150-MV injection suppressed its target c-Myb expression and enhanced cell migration in mice [35]. [score:7]
It was reported that 7 days after miR-150b-MV injection, miR-150 still maintained at a low level in plasma, and its target gene VEGF was repressed and the tumor development was also suppressed [46]. [score:6]
[1 to 20 of 2 sentences]
51
[+] score: 12
MicroRNAs associated with the basal breast cancer subtype, including four members of the miR-17~92 family, miR-25 and miR-150, showed a distinctly different pattern, being equally distributed among clusters 1 and 2. Of particular interest was cluster 4, which in contrast to the global decrease in miRNA expression during lactation and involution showed a specific increase in expression during these stages, paralleled by a decrease in the expression of predicted targets for one of the cluster members, miR-429 (Additional file 7). [score:9]
In contrast, miRNAs overexpressed in the basal breast cancer subtype (four members of the miR-17~92 family, miR-25 and miR-150) were distributed equally among clusters 1 and 2 (Figure 3b). [score:3]
[1 to 20 of 2 sentences]
52
[+] score: 12
Other miRNAs from this paper: mmu-mir-10a, mmu-mir-690
For example, miR-690 activated by RUNX2 positively regulates RUNX2 -induced osteogenic differentiation by inactivating the NF-κB pathway via the downregulation of subunit p65 [7], whereas TNF-α -induced NF-kB activation upregulates microRNA-150-3p and inhibits osteogenesis of mesenchymal stem cells by targeting β-catenin [8]. [score:12]
[1 to 20 of 1 sentences]
53
[+] score: 12
Among the up-regulated miRNAs, mmu-mir-1298 had the highest fold change with 4.025 while mmu-mir-150 was down-regulated more than 3 fold. [score:7]
Among down regulated miRNAs, mmu-mir-150 was down-regulated more than 3 fold during 12d-15d (Fig.   2). [score:5]
[1 to 20 of 2 sentences]
54
[+] score: 11
Interestingly, we found a correlation between BM-MSC-EVs miRNAs/piRNAs and down-regulated genes, indicating at least one target for each EVs miRNAs/piRNAs (e. g., CEBPA/miR-182, EGR2/miR-150 and miR-92, MPO/ hsa_piR_020814_DQ598650). [score:6]
Moreover, another down-regulated gene, Early Growth Response 2 (EGR2), also involved in apoptosis [61] and differentiation [62], is regulated by two different microRNAs, identified in our sequencing data, miR-150 [63] and miR-92 [64]. [score:5]
[1 to 20 of 2 sentences]
55
[+] score: 11
Silencing PRDM14 reduced the expression of miRNAs upregulated in breast cancer tissues (e. g. miR-106a, miR-149, miR-18a, miR-221, miR-222, miR-224, miR-23a, miR-24, miR-27a/b, and miR-493) and increased expression of those that were downregulated (e. g. miR-15a, miR-150, miR-183, and miR-203). [score:11]
[1 to 20 of 1 sentences]
56
[+] score: 11
miR-150, a microRNA expressed in mature B and T cells, blocks early B cell development when expressed prematurely. [score:6]
For instance, miR-181a was found to modulate T cell selection [17] and miR-150 was identified as a controller of B cell development [18– 20] as well as megakaryocytic versus erythrocytic lineage commitment [21]. [score:2]
Many miRNAs are involved in immune cell development and function, like miR-150 for B cells, miR-181a for T cells. [score:2]
For example, miR-150 for B cell [18– 20], megakaryocytic and erythrocytic lineage commitment [21], and miR-223 for granulocytic differentiation [22, 23]. [score:1]
[1 to 20 of 4 sentences]
57
[+] score: 10
The up-regulation of miR-150 was shown to result in a significant increase in tumor metastasis in vitro and lung metastases in a xenograft mo del in nude mice [38]. [score:4]
In addition, miR-106a, miR-146, miR-155, miR-150, miR-17-3p, miR-191, miR-197, miR-192, miR-21, miR-203, miR-205, miR-210, miR-212, and miR-214 have been reported to be up-regulated in lung cancer [12]. [score:4]
Li H MiR-150 promotes cellular metastasis in non-small cell lung cancer by targeting FOXO4Sci. [score:2]
[1 to 20 of 3 sentences]
58
[+] score: 10
We have also shown that a non-coding RNA, microRNA-150 (miR-150), is silenced in advanced CTCL, and that the miR-150 downregulates CCR6 directly and CCL20 indirectly [21]. [score:6]
As for stable miR-150 or siCCR6 transfectants, please see our previous paper [21]. [score:1]
The cells found to be GFP-empty, and were stably transduced with siCCR6 or miR-150. [score:1]
However, the miR-150-transduced cells showed a significant reduction in CCL20 and CCR6 production when compared with a single knockdown of either CCL20 or CCR6 [21]. [score:1]
B. Migration of the CTCL cells treated with neutralizing CCL20 antibody against My-La or HH cells stably transduced with siCCR6 or miR-150 or control (GFP-empty). [score:1]
[1 to 20 of 5 sentences]
59
[+] score: 10
Therefore, the circuits shown in Figure 12 uncovers that the regulatory combinations of MEIS1 and mir-200/mir-29/mir-150 miRNAs play roles in the early stage in the lung development, while their abnormal expressions may result in the tumour progression. [score:5]
Specifically, miR-200 miRNAs are involved in cancer metastasis[62]; mir-150 functions in hematopoiesis, and regulates genes whose downstream products encourage differentiating stem cells towards becoming megakaryocytes rather than erythrocytes [63]; mir-29 miRNAs activates p53, the tumour suppressor [64]. [score:4]
We have noticed that miRNAs are from mir-200 family (mir-200a, mir-200b and mir-429), mir-29 family (mir-29a and mir-29c) and mir-150 family, they are all related to lung cancer[60, 61]. [score:1]
[1 to 20 of 3 sentences]
60
[+] score: 10
The expression of miR-150 and miR-194 were both down-regulated in the fibrotic livers of rats induced by bile duct-ligation (BDL), while over -expression of miR-150 and miR-194 could inhibit the proliferation of LX-2 cells [15]. [score:10]
[1 to 20 of 1 sentences]
61
[+] score: 10
Among the differentially expressed miRNAs in lungs, most were correlated with immune system regulation, including miR-223 (regulation of the immune response), miR-1224 (regulation of tumor necrosis factor), miR-150 (differentiating stem cells towards megakaryocytes and control of B and T cell differentiation), miR-200a (regulation of immune response). [score:7]
Among the six miRNAs mentioned above (except miR-150), the relative expression levels were significantly different from the related miRNAs in mice, which suggested that the lung of M. fortis is one of the main organs in which schistosomula are killed. [score:3]
[1 to 20 of 2 sentences]
62
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
This spatial pattern of expression closely mirrors that of miR-23a, miR-143, and miR-150, all of which putatively target the Hoxa11 mRNA. [score:5]
Similarly, within the differentially expressed pool of miRNAs, 10 were identified that are intimately involved in regulating intracellular trafficking pathways, including: miR-7b-5p, miR-9-5p, miR-31-5p, miR-92a-3p, miR-106-5p, miR-126-3p, miR-150-5p, miR-204-5p, miR-222-3p, and miR-322-5p (S2 Fig). [score:4]
[1 to 20 of 2 sentences]
63
[+] score: 9
miR-150 levels were shown to be significantly down-regulated in sepsis, which correlated with disease severity [31]. [score:6]
Similarly, miR-150 concentrations in the serum of ICU patients upon admission closely correlated with their immediate and long-term survival rates, and low miR-150 levels was indicative of unfavorable prognosis [33]. [score:1]
On the other hand, the levels of some of the identified miRNAs (miR-150, miR-146a, and miR-223) were significantly reduced in sepsis patients. [score:1]
Circulating miR-15a and miR-16 [29], [30], miR-150 [31], miR-146a, and miR-223 [32] have been identified as potential biomarkers of sepsis. [score:1]
[1 to 20 of 4 sentences]
64
[+] score: 9
Other miRNAs from this paper: mmu-mir-130b
MiR-130b preferentially up-regulated in the CD133 [+] liver CSC cells via suppression of 53-inducible protein 1 [7], while miR-150 reduces CD133 [+] cells through downregulation of c-Myb proteins in HCC cells [22]. [score:9]
[1 to 20 of 1 sentences]
65
[+] score: 9
Wang X. Ren Y. Wang Z. Xiong X. Han S. Pan W. Chen H. Zhou L. Zhou C. Yuan Q. Down-regulation of 5S rRNA by miR-150 and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells FEBS Lett. [score:6]
Furthermore, it has been recently demonstrated that in esophageal squamous carcinoma cells, the depletion of 5S rRNA by miR-150 and miR-383 enhances the interaction between uL5 (rpL11) and c-Myc leading to the inhibition of Myc activity [55]. [score:3]
[1 to 20 of 2 sentences]
66
[+] score: 9
Figure 2B displays discrepancies between the miRNA array and RT-qPCR data, showing that only 3 down-regulated miRNAs (miR-150, miR-28 and miR-151-5p) and 8 upregulated miRNAs (miR-let-7e, miR-103, miR-107, miR-27a, miR-23a, miR-21, miR-155 and miR-146a) showed similar trends in altered miRNA levels. [score:7]
Based on our microarray and qPCR results, three miRNA (miR-28, miR-150, miR-151-5p) were confirmed decreased in CD4+PD1+ T cells. [score:1]
miR-28, miR-150, and miR-151-5p levels in CD4+PD1+ T cells decreased by 30%, 45%, and 25%, respectively (Figure 2C). [score:1]
[1 to 20 of 3 sentences]
67
[+] score: 8
Besides, miR-150 and miR-22 are predicted to inhibit the expression of p53 [Table 3]. [score:5]
However, it is important to keep it in mind that miR-150 is expressed only in mature lymphocytes. [score:3]
[1 to 20 of 2 sentences]
68
[+] score: 8
In CD133 [+] HCC cells, miR-130b was overexpressed and enhanced chemoresistance, tumorigenicity and self-renewal [18], whereas miR-150 was down-regulated and significantly inhibited tumor sphere formation and cell growth [30]. [score:8]
[1 to 20 of 1 sentences]
69
[+] score: 8
Other miRNAs from this paper: hsa-mir-150
[48] A recent study shows that inhibition of IRE1 by 4μ8C not only suppresses XBP1 splicing but also diminishes cleavage of miR-150, resulting in decreased expression of aSMA in myofibroblast and reduced fibrosis in vivo. [score:7]
Heindryckx F, Binet F, Ponticos M, Rombouts K, Lau J, Kreuger J. Endoplasmic reticulum stress enhances fibrosis through IRE1alpha -mediated degradation of miR-150 and XBP-1 splicing. [score:1]
[1 to 20 of 2 sentences]
70
[+] score: 8
For example, results from experimental manipulation of expression of miR-150 and its most likely target gene, Myb, together with the observation of adverse effects of the systemic knockout of miR-150 on a single cell type only, the mature lymphocyte, suggest that the main role of this microRNA may be mediated through interaction with a single target gene in a single cell type [16]. [score:8]
[1 to 20 of 1 sentences]
71
[+] score: 8
Plasma miR150 has been shown to be up-regulated after LPS treatment [40]; plasma miR-122 level has been shown to be increased by viral-, alcohol-, and chemical-related hepatic diseases [41]. [score:6]
We found that some of our miRNAs are reported to be enriched in bone marrow (miR-142) and GI tract (miR-142, miR-150, miR-155). [score:1]
miR-150 has one clone in colon [37]. [score:1]
[1 to 20 of 3 sentences]
72
[+] score: 8
In previous studies, Gomafu has been demonstrated to be a target of miR-150-5p and its expression can be regulated by miR-150-5p 16, 21, 22. [score:6]
Furthermore, Gomafu functioned as a competing endogenous RNA to regulate VEGF levels by sponging miR-150-5p in diabetic retinas and endothelial cells [16]. [score:2]
[1 to 20 of 2 sentences]
73
[+] score: 8
For example, the expression levels of miRNA-181a, miR-155, miR-150, miRNA-221, miR-106a, miRNA-221, miR-146a and miR-146b were increased in OVA -induced mouse mo del of asthma [15– 18]; the miR-126, miR-145 and miR-106a expression levels were increased in house dust mite (HDM) -induced experimental asthma mo del [19– 21]; and miR-21 was up-regulated in lung-specific interleukin (IL)-13 -induced asthma mo del [22]. [score:8]
[1 to 20 of 1 sentences]
74
[+] score: 7
In mice, tumor -associated miRNAs were found to modulate the survival and longevity of DC (44), miR-223 was described to negatively regulate and miR-150 to positively regulate the cross-presenting abilities of LC (45, 46), the TGF-β associated miR-27a was reported to inhibit DC -mediated differentiation of Th1 and Th17 cells (47) and in an allergy setting miR-23b was shown to induce tolerogenic DC through inhibition of the Notch1/NF-κB pathway (48). [score:7]
[1 to 20 of 1 sentences]
75
[+] score: 7
We confirmed that six of the eight selected down-regulated hsa-miRNAs (miR-145, miR-497, miR-150, miR-342-5p, miR-34b* and miR-100) were significantly down-regulated in NPC tissues, whereas miR-195 and miR-143 exhibited no significant difference between the two groups of subjects (Fig. 1D). [score:7]
[1 to 20 of 1 sentences]
76
[+] score: 7
miR-31, miR-150 and miR-184 have shown to be downregulated in oxygen -induced retinopathy mice mo dels [20]; miR-23~24~27 cluster was upregulated in laser induced CNV mice mo dels [21]. [score:7]
[1 to 20 of 1 sentences]
77
[+] score: 7
Other miRNAs from this paper: mmu-mir-16-1, mmu-mir-16-2, mmu-mir-29c, mmu-mir-221
In addition, miR-150 overexpression inhibited invasion and metastasis of osteosarcoma cells, which was achieved by decreasing Ezrin expression [35]. [score:7]
[1 to 20 of 1 sentences]
78
[+] score: 7
Target gene Description miRNA ID Osteoblastic genes COL1A1 Type I collagen miR-29a, miR-150, miR-185 BGLAP Osteocalcin – RUNX2 Runt-related transcription factor – Chondrogenic genes COL2A2 Type II collagen miR-7, miR-29a, miR-29b COL10A1 Type X collagen miR-101 SOX9 SRY (sex determining region Y)-box 9 miR-101, miR-124 for the selected genes were carried out with TargetScan, PicTar, or miRanda miRNA target prediction tools. [score:7]
[1 to 20 of 1 sentences]
79
[+] score: 6
Other miRNAs from this paper: mmu-mir-125a, mmu-mir-155, mmu-mir-29a, mmu-mir-200c
Global miRNA expression profiling revealed that miR-150 and miR-155 were specifically expressed in lymphoid lineage cells, including NK cells [10, 11]; in addition, miR-150 was found to contribute to iNKT cell development [12] and miR-155 to NK cell IFN- γ production [13]. [score:6]
[1 to 20 of 1 sentences]
80
[+] score: 6
Hepatology 17 Venugopal SK Jiang J Kim TH Li Y Wang SS 2010 Liver fibrosis causes downregulation of miRNA-150 and miRNA-194 in hepatic stellate cells, and their overexpression causes decreased stellate cell activation. [score:6]
[1 to 20 of 1 sentences]
81
[+] score: 6
Lingrel JB and colleagues recently observed reduced expression of miR-124a and miR-150 in macrophages from myeKlf2 [-/-] mice, thus indicating that KLF2 directly mediates the expression of these two miRNAs in macrophages [30]. [score:6]
[1 to 20 of 1 sentences]
82
[+] score: 6
For instance, miR-150 has been shown to be down-regulated in HSCs isolated from rat fibrotic livers 12, while expression of miR-126 and miR-126* were reduced during in vitro and in vivo activation of rat HSCs 31. [score:6]
[1 to 20 of 1 sentences]
83
[+] score: 6
In contrast, the AAV: miR-206 sponge did not effect the expression of miR-133b or miR-150 (Figure 3g). [score:3]
control), it did not affect expression of miR-133b or miR-150 (N=ND, n=3 per group). [score:3]
[1 to 20 of 2 sentences]
84
[+] score: 6
However, comparison of the seven most highly expressed miRNAs in CD8 [+] T cells with the seven most highly expressed miRNAs in naïve CD4 [+] T cells from this study reveal four in common: miR-150, miR-142-3p, miR-16 and miR-15b [21]. [score:5]
H poly mmu-miR-150 mmu-miR-181a ↓↓ ↓↓ mmu-miR-669f ↓ ↓ mmu-miR-29c ↑ mmu-miR-155 ↑ ↑ mmu-miR-467f mmu-miR-466a/b-3p ↓ ↓ mmu-miR-361 ↑↑ ↓ mmu-miR-547 mmu-miR-1949 mmu-miR-345-3p ↓ ↑ mmu-miR-101b mmu-miR-340-5p mmu-miR-148a ↑ ↑ mmu-miR-139-5p ↓↓ ↓ mmu-miR-132 ↑ ↑ mmu-miR-539 ↓ mmu-miR-125a-5p ↑↑ ↑ ↓ mmu-miR-130b *miRNAs with Nanostring counts that passed the minimum intensity filter and have >2-fold differences among any two-way comparison. [score:1]
[1 to 20 of 2 sentences]
85
[+] score: 6
Subsequently, the secreted miR-150 was taken up by co-cultured microvascular endothelial cells, in which miR-150 inhibited the expression of c-MYB [31]. [score:5]
Zhang et al. reported that THP-1 cells could actively secrete miR-150. [score:1]
[1 to 20 of 2 sentences]
86
[+] score: 6
PLoS One 10;2 10 e1020 15 Zhou B Wang S Mayr C Bartel DP Lodish HF 2007 miR-150, a microRNA expressed in mature B and T cells, blocks early B cell development when expressed prematurely. [score:6]
[1 to 20 of 1 sentences]
87
[+] score: 6
However, the transcription factor Myb was downregulated with concurrent overexpression of miR-15b, miR-16, miR-150 and miR-195 (Figure 3 and Additional file 3). [score:6]
[1 to 20 of 1 sentences]
88
[+] score: 6
In NSCLC, it has been shown that p53 is a direct target of mir-150 [24], mir-453, and mir-98, which are involved in cisplatin -induced lung cancer cells death [27]. [score:4]
Wang D. T. Ma Z. L. Li Y. L. Wang Y. Q. Zhao B. T. Wei J. L. Qi X. Zhao X. T. Jin Y. X. mir-150, p53 protein and relevant miRNAs consist of a regulatory network in NSCLC tumorigenesis Oncol. [score:2]
[1 to 20 of 2 sentences]
89
[+] score: 5
Another study of primary cells from miRNA mutant mice showed that miR-155 in B cells and miR-223 in neutrophils cause significant target mRNA degradation, while miR-150 in B cells and miR-21 in neutrophils have absolutely no effect on their target mRNA abundance [14]. [score:5]
[1 to 20 of 1 sentences]
90
[+] score: 5
Overall, our data revealed that the expression changes in lupus -associated miRNAs such as miR-182-96-183, miR-31, miR-127, miR-379, miR-155, and miR-150 that were observed in splenocytes were also evident in purified splenic B and T cells. [score:3]
Other studies have also revealed that miR-150, miR-155, miR-17-92, and miR-101a play roles in the regulation of antibody responses, germinal center responses, inflammatory responses, and/or autoimmunity [7], [13], [19], [20], [21]. [score:2]
[1 to 20 of 2 sentences]
91
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Olfactory bulb let-7b, let-7c-1, let-7c-2, miR-10a, miR-16, miR-17, miR-21, miR-22, miR-28, miR-29c, miR-124a-1, miR-124a-3, miR-128a, miR-135b, miR-143, miR-148b, miR-150, miR-199a, miR-206, miR-217, miR-223, miR-29b-1, miR-329, miR-331, miR-429, miR-451. [score:1]
Cortex let-7c-1, miR-10a, miR-21, miR-124a-1, miR-128a, miR-135b, miR-150, miR-199a, miR-217, miR-329, miR-451. [score:1]
Dorsal root ganglion let-7c, miR-17, miR-145, miR-150, miR-199a, miR-223, miR-365, miR-451. [score:1]
Brain stem let-7c-1, miR-17, miR-135b, miR-150, miR-199a, miR-218-1, miR-223, miR-329. [score:1]
Hypothalamus miR-17, miR-29c, miR-124a-1, miR-128a, miR-150, miR-199a, miR-217, miR-223, miR-329, miR-429. [score:1]
[1 to 20 of 5 sentences]
92
[+] score: 5
miR-150 suppresses the proliferation and tumorigenicity of leukemia stem cells by targeting the nanog signaling pathway. [score:5]
[1 to 20 of 1 sentences]
93
[+] score: 5
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, mmu-mir-145b
For example, circ-ZNF609 can act as a sponge for miR-150-5p to modulate the expression of AKT3 in Hirschsprung disease [8]. [score:5]
[1 to 20 of 1 sentences]
94
[+] score: 5
miRNA Fold change at 3 dpi Fold change at 5 dpi mmu-miR-466h-3p NS (Not significant) 14.311053 mmu-miR-346-5p NS 3.4766614 mmu-miR-877-3p NS 3.416667 mmu-miR-7a-5p NS 2.1413074 mmu-miR-5107-5p NS −2.047792 mmu-miR-3473a −2.2872427 −2.1317267 mmu-miR-150-5p NS −2.1770155 mmu-miR-3473b −3.2475147 −2.282881 mmu-miR-721 NS −2.6864858 mmu-miR-669b-5p NS −2.9408455 mmu-miR-709 NS −3.0065749 mmu-miR-669n NS −3.0094464 mmu-miR-468-3p NS −3.40051 mmu-miR-466m-5p NS −4.33538 mmu-miR-32-3p NS −4.5324426 mmu-miR-466h-5p NS −4.9673104 mmu-miR-3082-5p NS −6.01648 mmu-miR-466i-5p NS −7.6776285 mmu-miR-1187 NS −8.772696 mmu-miR-574-5p NS −9.259378 To confirm the validity of the differentially expressed miRNAs that had been identified by microarray analysis, we performed real-time PCR on all 20 of these miRNAs using the polyA tailing technique. [score:3]
We found that the majority of the identified miRNAs, including miR-150-5p, -3082-5p, -3473a, -468-3p, -5107-5p, -669n, and -721, were principally involved in MAPK signaling pathway that associated with inflammatory cytokines production (Kaminska et al., 2009). [score:1]
Most of the identified miRNAs, including miR-150-5p, -3082-5p, -3473a, -468-3p, -5107-5p, -669n, and -721 were mainly involved in the MAPK signaling pathway. [score:1]
[1 to 20 of 3 sentences]
95
[+] score: 5
Although many miRNAs are expressed in T cell subsets, one study found 7 miRNAs (miR-16, miR-21, miR-142-3p, miR-142-5p, miR-150, miR-15b, and let-7f) account for almost 60% of all T cell miRNAs. [score:3]
Another recent study found 7 abnormally expressed miRNAs (miR-145, miR-224, miR-150, miR-483-5p, miR-513-5p, miR-516a-5p, and miR-629) in SLE T cells compared to healthy controls. [score:2]
[1 to 20 of 2 sentences]
96
[+] score: 5
In other experimental setting, De Candia et al demonstrated that reduction of intracellular level of miR-150, a key regulator of mRNAs critical for lymphocyte differentiation and functions, via its selective release in the external milieu, may regulate gene expression during lymphocyte activation [33]. [score:5]
[1 to 20 of 1 sentences]
97
[+] score: 5
Other miRNAs from this paper: mmu-mir-155, mmu-mir-10a
qPCR analysis of Dgcr8 mRNA in Tc and Tr (a,b) and miR-150 (c,d). [score:1]
Efficient and Treg-specific deletion of Dgcr8 and miR-150. [score:1]
0066282.g001 Figure 1Efficient and Treg-specific deletion of Dgcr8 and miR-150. [score:1]
Efficient and specific deletion of Dgcr8 and miR-150. [score:1]
The microRNA miR-150 as a representative canonical miRNA was specifically ablated in Treg (Fig. 1c ) but not conventional CD4 [+] T cells (Fig. 1d ). [score:1]
[1 to 20 of 5 sentences]
98
[+] score: 5
Upregulation of mmu-miR-150 (Additional file 7: Table S1) upon SA1 infection will negatively regulate CIITA and thereby help in immune evasion [26]. [score:5]
[1 to 20 of 1 sentences]
99
[+] score: 5
Although we were unable to obtain the raw data from Na et al., a detailed examination of the original expression profiles of miR-26b and miR-150 in Vollmers et al. ’s data suggested that miR-26b, i. e. miR-26b-5p, does not appear to be circadian oscillating (Supplementary Fig. S2a). [score:3]
Only miR-150-5p showed a moderate circadian oscillation in Panda’s data with a peak time around CT8, which is close to that reported in Na et al. ’s data (Supplementary Fig. S2b). [score:1]
Surprisingly, only two miRNAs (miR-26b and miR-150) appeared in common between both circadian miRNA lists. [score:1]
[1 to 20 of 3 sentences]
100
[+] score: 5
To validate the identified phenotypes, the miRNAs that were down-regulated in clinical samples and Top-40 ranked in the phenotype screen (miR-150, miR-375, miR23b, miR-138, miR-139-5p and miR-9) were subjected to detailed functional analysis using HCT116, HT29, LS174T TR4, DLD1 TR7 and SW480 colon cancer cell lines. [score:4]
miR-150 and miR-23b only reduced the viability of one cell line (DLD1 TR7). [score:1]
[1 to 20 of 2 sentences]