sort by

131 publications mentioning mmu-mir-182 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-182. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 348
Other miRNAs from this paper: mmu-mir-23a
These data are in agreement with in vivo observations of reduced Bcat2 expression in PlGF mice concurrently with the upregulation of miR-182 and the development of hypertrophy and complete restoration of Bcat2 expression and inhibition of hypertrophic response with anti-miR-182 treatment (Figs 3 and 4b). [score:11]
Consequently, the expression of miR-182 and myocardial hypertrophy were inhibited by the concomitant transgenic expression of PlGF and RGS4, or the expression of PlGF in eNOS [−/−] mice. [score:9]
Coincident with the upregulation of miR-182 expression in PlGF mice, there was significantly reduced expression of Bcat2, Foxo3 and Adcy6 transcripts (Fig. 4b). [score:8]
Indeed, in NO -treated NRCs, the upregulation of miR-182 (Fig. 2b) suppressed Bcat2 expression by 50% (Fig. 7b). [score:8]
Our results expand upon these findings by showing that miR-182 directly regulates Bcat2 expression and that Bcat2 downregulation activates Akt [Ser473] and mTORC1/p70-S6K [Thr389] and promotes cardiomyocyte hypertrophy. [score:8]
To better understand the regulation of the Akt/mTORC1 pathway and to identify the miR-182 targeted genes, which might be linked to the hypertrophic response subsequent to angiogenesis, we conducted comparative mRNA expression profiling in PlGF mice (angiogenesis with hypertrophic response) and PlGF/RGS4 mice (angiogenesis with inhibition of hypertrophic response). [score:8]
Next, we hypothesized that miR-182 negatively regulates Bcat2 expression in NO -treated NRCs and that the treatment with anti-miR-182 restores Bcat2 expression and inhibits hypertrophic response. [score:8]
Inhibition of miR-182 prevents NO -induced cardiomyocyte hypertrophy in vitroNext, we determined whether NO can directly induce miR-182 expression in cardiomyocytes by treating neonatal rat cardiomyocytes (NRCs) with the NO donor (DETA-NONOate). [score:6]
Interestingly, consistent with the inhibition of hypertrophic response 11, we found abrogation of miR-182 upregulation in PlGF -induced eNOS [−/−] mice (Fig. 1c). [score:6]
These results indicate that the downregulation of Bcat2 strongly relates to the increase in miR-182 expression that is present in PlGF, but not in PlGF/RGS4 or control mice. [score:6]
We found significant upregulation of miR-182 expression in response to NO donor (Fig. 2a). [score:6]
Microarray profiling of miRNAs in LV myocardium in PlGF mice after 3 and 6 weeks of angiogenic stimulation revealed the upregulation of miR-182 expression at 6 weeks (Supplementary Fig. S1 on line). [score:6]
Together these data indicate that miR-182 upregulation subsequent to PlGF -induced angiogenesis is dependent on NO -induced RGS4 degradation mechanism, whereas PlGF has no direct effect on miR-182 regulation. [score:6]
These data indicate that both the upregulation of miR-182 and the hypertrophic response are prevented when RGS4 expression is maintained. [score:6]
The present data, also provide insight into potential mechanisms by which miR-182 might regulate the hypertrophic response, including suppression of Bcat2, Foxo3 and Adcy6 expression. [score:6]
Next, we assessed the expression of miR-182 and targeted genes in pathological hypertrophy induced by LV pressure overload. [score:5]
Consequently, the treatment with anti-miR-182 partially restored the expression of Adcy6 and completely restored the expression of Bcat2 and Foxo3 to control levels (Fig. 4b). [score:5]
Of these targets, 3 miR-182 targets: Bcat2, Foxo3 and Adcy6 were further validated by qPCR analysis (Fig. 4a). [score:5]
During glucocorticoid -induced atrophy in skeletal muscle, a decrease of intracellular miR-182 and increased release of miR-182 into exosomes augmented the Foxo3 expression and activation of the atrophy-related gene expression 16. [score:5]
To further investigate the role of miR-182 in angiogenesis -induced cardiac hypertrophy, we determined its expression in the PlGF/RGS4 mouse, where induced cardiac expression of RGS4 concurrently with PlGF inhibits the hypertrophic response 11. [score:5]
Our findings reveal that miR-182 suppressed Bcat2, Foxo3 and Adcy6 expression, raising the possibility that one or more of these actions contributed to the angiogenesis -induced hypertrophic response in the heart. [score:5]
Because NO treatment activates Akt [Ser473] and downstream mTORC1 target p70-S6K [Thr389 ] 11, we tested whether the inhibition of miR-182 blocked the activation of Akt/mTORC1 pathway in NO -treated NRCs. [score:5]
Previously, it has been shown that miR-182 directly modulates Adcy6 expression to regulate mammalian circadian rhythm 19 20. [score:5]
The overexpression of miR-182 decreased Foxo3 expression and attenuated skeletal muscle atrophy 16. [score:5]
Anti-miR-182 treatment completely restored Bcat2 and Foxo3 expression and partially restored Adcy6 expression in PlGF mice. [score:5]
Thus, miR-182 upregulation does not appear to be associated with pressure overload -induced or pathological hypertrophy. [score:4]
miR-182 downregulates Bcat2, Foxo3 and Adcy6 in PlGF mice and MEFs. [score:4]
However, a recent study provides evidence that miR-182 also directly decreases Foxo3 expression. [score:4]
Next, we addressed whether miR-182 negatively regulated the expression of Bcat2, Foxo3 and Adcy6 transcripts in an isolated cell system. [score:4]
Consistent with the lack of a direct hypertrophic effect, PlGF also did not induce miR-182 expression in cardiomyocytes. [score:4]
These findings show that Adcy6 and Foxo3 are downregulated in response to pressure overload with a greater reduction in PlGF mice, suggesting an additive effect of pressure overload and miR-182. [score:4]
miR-182 is upregulated subsequent to angiogenic stimulation and is dependent on NO -induced RGS4 degradation. [score:4]
We found that miR-182 upregulation in the heart occurs subsequent to PlGF -induced angiogenesis and requires endothelial-derived NO production, which triggers RGS4 degradation in cardiomyocytes. [score:4]
miR-182 targets Bcat2, Foxo3, and Adcy6 to potentially regulate the hypertrophic response. [score:4]
miR-182 upregulation in the heart subsequent to PlGF -induced angiogenesis is dependent on NO -induced RGS4 degradation mechanism. [score:4]
Furthermore, qPCR analysis confirmed the specific increase of miR-182 expression (by ~9-fold) in PlGF mice at 6 weeks concurrent with the development of hypertrophy, but not at 3 weeks when only angiogenesis was apparent (Fig. 1a). [score:4]
A recent study showed that the conditioned medium from miR-182 transfected liver cancer cell lines promoted HUVEC angiogenesis potentially related to downregulation of RAS p21 protein activator 1 (RASA1) 40. [score:4]
Myocardial hypertrophy subsequent to angiogenesis requires endothelial-NO production to induce RGS4 degradation 11, and thus we investigated whether miR-182 upregulation in PlGF mice was NO dependent by inducing PlGF expression in eNOS [−/−] mice. [score:4]
Next, we determined whether NO can directly induce miR-182 expression in cardiomyocytes by treating neonatal rat cardiomyocytes (NRCs) with the NO donor (DETA-NONOate). [score:4]
Inhibition of miR-182 prevents NO -induced cardiomyocyte hypertrophy in vitro. [score:3]
As shown in Fig. 2b, the treatment with anti-miR-182 antagonized miR-182 expression and attenuated the hypertrophic response induced by the treatment with NO donor (Fig. 2c,d). [score:3]
Consistent with our observations that miR-182 modulates the angiogenesis -induced hypertrophic response, there was also a 7-fold increase in miR-182 expression in PlGF mice at both time points (Fig. 6c). [score:3]
Thus, these in vivo results are consistent with the in vitro data showing an inhibitory effect of anti-miR-182 on Akt [Ser473] and p70-S6K [Thr389] levels and hypertrophy in NRCs (Fig. 2c–g). [score:3]
These data are the first to show that endothelium to cardiomyocyte communication can induce the expression of miRNAs in the heart, and that miR-182 induction is critical for the hypertrophic response that links angiogenesis to cardiomyocyte growth. [score:3]
The in vivo LNA anti-mmu-miR-182-5p probe and control miR-scramble (Exiqon) were packed into the MaxSuppressor [TM]. [score:3]
miR-182 is not induced in PlGF/RGS4 mice, where hypertrophic response is inhibited. [score:3]
In contrast, the treatment of NRCs with PlGF, or the cardiac hypertrophic GPCR agonist Ang II did not affect miR-182 expression (Fig. 2a). [score:3]
miR-182 seed sequence and the corresponding target sites are indicated in green box. [score:3]
In agreement with the inhibition of the hypertrophic response, anti-miR-182 also diminished the phosphorylation of Akt [Ser473] and p70-S6K [Thr389] in NO -treated NRCs (Fig. 2e–g). [score:3]
Using this approach, we identified 9 potential miR-182 targets associated with the hypertrophic response in PlGF mice (Supplementary Table S1 on line). [score:3]
In contrast to the PlGF mice, miR-182 expression in PlGF/RGS4 mice was low and similar to control mice (Fig. 1a). [score:3]
The lack of miR-182 induction after TAC is in accord with in vitro data showing that AngII, a cardiac hypertrophic GPCR agonist, also did not induce miR-182 expression (Fig. 2a). [score:3]
Inhibition of miR-182 prevents NO -induced cardiomyocyte hypertrophy. [score:3]
Consistent with the echocardiographic parameters, anti-miR-182 treatment also inhibited the increase in the heart weight to body weight ratio (HW/BW) in PlGF mice (Fig. 3b). [score:3]
Despite the lack of increase in miR-182, pressure overload significantly decreased the expression of Adcy6 and Foxo3 in control and PlGF/RGS4 mice (Fig. 6d). [score:3]
In contrast, despite the induction of hypertrophy after TAC, there was no increase in miR-182 expression in either control or PlGF/RGS4 mice (Fig. 6c). [score:3]
Consequently, the treatment of NO -treated NRCs with anti-miR-182 restored Bcat2 expression (Fig. 7b) and prevented the hypertrophic response (Fig. 2c,d). [score:3]
Thus, angiogenesis -induced and pressure overload -induced hypertrophy may have some convergence and thus additive effects on selected downstream miR-182 targets. [score:3]
Our data show that miR-182 inhibition with antagomir prevented phosphorylation at Akt [Ser473] and p70-S6K [Thr389] and hypertrophy in both NO -treated cardiomyocytes and PlGF mice, despite the loss in RGS4 protein. [score:3]
We also analyzed miR-182 targeted genes in PlGF, PlGF/RGS4 and control mice at 2 and 6 weeks post-TAC. [score:3]
The mechanism by which miR-182 expression is controlled downstream of RGS4 is not known and future studies are required to address this issue. [score:3]
Inhibition of miR-182 prevents the hypertrophic response subsequent to angiogenesis in heart. [score:3]
Inhibition of miR-182 prevents myocardial hypertrophy and Akt/mTORC1 activation. [score:3]
In conclusion, miR-182 is a novel target of endothelium to cardiomyocyte communication and plays an important role in the activation of the Akt/mTORC1 pathway and the hypertrophic response induced by angiogenesis in heart. [score:3]
In order to assess whether miR-182 plays a role in NO -induced cardiomyocyte hypertrophy we inhibited miR-182 in NO -treated NRCs with antagomir. [score:3]
The treatment of MEFs with a miR-182 mimic resulted in a ~65% reduction of Adcy6 and a ~45% reduction of Bcat2 and Foxo3 expression (Fig. 4c), consistent with our in vivo observations. [score:3]
Although our study has implicated cardiomyocyte miR-182 as a target of endothelium to cardiomyocyte communication, we cannot exclude the possibility that miR-182 may conversely modulate cardiomyocyte to endothelial cell communication and promote angiogenesis. [score:3]
To assess whether miR-182 has a direct hypertrophic effect, we treated NRCs with a miR-182 mimic. [score:2]
Thus, taken together, these results indicate an important regulatory effect of miR-182 on the Akt/mTORC1 pathway that is independent of NO -induced RGS4 degradation. [score:2]
Consistent with the quantitative PCR data in heart homogenates, in situ hybridization of miR-182 detected higher expression of miR-182 within the ventricular myocardium in PlGF mice, compared with PlGF/RGS4 mice and controls (Fig. 1b). [score:2]
To determine whether miR-182 directly binds to the Bcat2-3’ UTR, we utilized a Gaussia luciferase (GLuc) /secreted Alkaline Phosphatase (SEAP) dual-reporter pEZX-MT05 vector (GeneCopoeia). [score:2]
The results showed a significant inhibition of cardiomyocyte hypertrophy in anti-miR-182 -treated PlGF mice, compared with either untreated or miR-scramble treated PlGF mice (Fig. 3d,e). [score:2]
To determine the direct binding of miR-182 to Bcat2-3′ UTR, we co -transfected HEK293T cells with wild-type or mutant Bcat2-3′ UTR reporter plasmid and either a miR-182 mimic or a miR-scramble negative control. [score:2]
We did not find evidence of miR-182 induction during either LV pressure overload in vivo or in response to the GPCR agonist Ang II in vitro. [score:1]
These results indicate that miR-182 has an important role in the hypertrophic response induced by angiogenesis in heart. [score:1]
Transfection of MEFswith mmu-miR-182-5p mimic (Ambion) (50 nM) and control miR scramble (Ambion) (50 nM) were carried out using Lipofectamine RNAiMAX (Invitrogen). [score:1]
miR-182 detection and localization by in situ hybridization (ISH) ISH was performed on LV sections, fixed in 4% PFA and embedded in paraffin, using a specific double-digoxigenin (DIG) labeled miRCURY LNA mmu-miR-182 detection probe (Exiqon). [score:1]
Moreover, there was no impairment of LV contractile function in PlGF mice, and LV ejection fraction (EF) was also unaffected by the treatment with anti-miR-182 (Fig. 3c). [score:1]
Finally, to determine whether miR-182 has any effect on angiogenesis, we examined endothelial cell sprouting in vitro. [score:1]
There was a significant increase of LV posterior wall (LVPW) thickness in PlGF mice, which was blocked by anti-miR-182 treatment, but not by control miR-scramble treatment (Fig. 3a). [score:1]
Transfection of HUVECs with miR-182 mimic did not affect endothelial cell sprouting in response to VEGFA, as compared with miR-scramble, suggesting no direct effect of miR-182 on angiogenesis (Fig. 2i,j). [score:1]
PlGF mice were treated with intravenous injection of anti-miR-182 or control miR-scramble during the hypertrophic phase (the last 3 weeks of the 6 week angiogenic stimulation period) (Supplementary Fig. S4 on line). [score:1]
These data in conjunction with the more dramatic reciprocal effects of anti-miR-182 treatment in NO -treated NRCs indicate that the activation of the Akt/mTORC1 pathway downstream of NO initiates the hypertrophic response, whereas miR-182 functions as a modulator. [score:1]
Also, the treatment with anti-miR-182 did not affect PlGF -induced angiogenesis, based on the findings that the increase in vessel density was sustained during either control miR-scramble or anti-miR-182 treatment (Fig. 3g). [score:1]
Bcat2 is another potential mechanism that might contribute to the hypertrophic response induced by miR-182. [score:1]
Transfection of NRCs with anti-rno-miR-182 5p (Ambion), rno-miR-182 mimic 5p (Ambion), control miR scramble (Ambion), Bcat2 siRNA (Ambion), and AllStars Negative Control siRNA (Qiagen) were carried out using Lipofectamine RNAiMAX (Invitrogen). [score:1]
Similarly, in PlGF mice there was a 40% increase in LV mass, which was prevented by the treatment with anti-miR-182, but not by miR-scramble (Fig. 3a). [score:1]
One report related miR-182 to cardiac hypertrophy in rejecting cardiac allografts 23, while other two provided evidences of increased circulated miR-182 in patients undergoing coronary artery bypass surgery 24 and patients with chronic congestive heart failure 25. [score:1]
miR-182 did not reduce the activity of mutant (Mut) Bcat2-3′UTR luciferase reporter. [score:1]
In contrast to PlGF and miR-scramble -treated PlGF mice that had increased phosphorylation at Akt [Ser473] (2-fold) and 70-S6K [Thr389] (4-fold), the levels of phosphorylated Akt [Ser473] and p70-S6K [Thr389] in anti-miR-182 -treated PlGF mice were not increased and were comparable with controls (Fig. 3f). [score:1]
Consistent with the pro-hypertrophic effect in NRCs, miR-182 induced a significant increase in p70-S6K [Thr389] phosphorylation (Supplementary Fig. S3 on line). [score:1]
Furthermore, the co-staining of miR-182 with cardiomyocyte marker, cardiac troponin T confirmed the presence of miR-182 in cardiomyocytes (Supplementary Fig. S2 on line). [score:1]
n = 4 (controls); 4 (PlGF); 4 (PlGF + control miR-scramble); 5 (PlGF + anti-miR-182). [score:1]
Anti-miR-182 treatment led to a 40% reduction (p = 0.057) in liver, whereas in kidney miR-182 content was not affected (Supplementary Fig. S4 on line). [score:1]
HEK293T cells were co -transfected with 1 μg of wild type or mutated Bcat2-3′UTR GLuc/SEAP dual-reporter pEZX-MT05 plasmid and mmu-miR-182-5p mimic (Ambion) or control miR-scramble (Ambion) (100 nM) with Lipofectamine 2000 (Invitrogen). [score:1]
n = 9 (controls); 9 (PlGF); 6 (PlGF+miR-scramble); 6 (PlGF+anti-miR-182). [score:1]
LNA anti-miR-182 and control miR-scramble were delivered via tail vein injection, 20 μg/mouse/ injection on day 1, 4 and 7 during 3 weeks treatment period. [score:1]
miR-182 is not associated with LV pressure overload or pathological hypertrophy. [score:1]
ISH was performed on LV sections, fixed in 4% PFA and embedded in paraffin, using a specific double-digoxigenin (DIG) labeled miRCURY LNA mmu-miR-182 detection probe (Exiqon). [score:1]
Only a few previous studies have addressed the potential function of miR-182 in the heart. [score:1]
miR-182 is not associated with the hypertrophic response induced by LV pressure overload. [score:1]
Together with our findings, these data indicate that miR-182 favors cellular growth in skeletal and cardiac muscle. [score:1]
Furthermore, the minor LV dilation observed in PlGF mice was also prevented by the treatment with anti-miR-182 (Fig. 3a). [score:1]
miR-182 detection and localization by in situ hybridization (ISH). [score:1]
To the extent that miR-182 promotes an increase in vasculature and blood perfusion, it could provide an additional mechanism responsible for developing and sustaining myocardial hypertrophy. [score:1]
We then proceeded to study whether miR-182 has an important role in modulating the hypertrophic response in vivo. [score:1]
However, in the case of Bcat2 a greater reduction was associated with miR-182 than that detected with pressure overload. [score:1]
How to cite this article: Li, N. et al. miR-182 Modulates Myocardial Hypertrophic Response Induced by Angiogenesis in Heart. [score:1]
The treatment of NRCs with miR-182 and NO donor did not stimulate the cell growth further than the effect observed with NO donor alone (Fig. 2h). [score:1]
The ISH detection was optimized for 50 nM miR-182 and miR-control probe and 25 nM for U6 positive control. [score:1]
For the purpose of this study, we focused on miR-182 and its important downstream role to modulate the Akt/mTORC1 pathway. [score:1]
[1 to 20 of 111 sentences]
2
[+] score: 187
Other miRNAs from this paper: mmu-mir-155, mmu-mir-183, mmu-mir-214
Given that (1), both miRs-155 and -182 were up-regulated following Cm infection (Figures 1, 4); (2), co-culture of unmanipulated CD4 [+] T cells with over-expressed miR-155 DCs (Figure 3), or unmanipulated DCs with over-expressed miR-182 CD4 [+] T cells (data not shown) respectively, lead to reduction in Ag-specific IFN-γ; (3), miR-182 was observed to be up-regulated in vaccinated mice protected against a subsequent Cm infection where protection may be mediated by production of Ag-specific IFN-γ (Figure 4) and (4), miRs act by damping the target gene/ gene product, that additional investigation is warranted on IFN-γ signaling specific genes and regulators whose function is altered by these two miRs and result in Ag-specific IFN-γ (Figure 6) required for controlling Cm infection. [score:12]
Additionally, despite miR-183 being co-regulated with miR-182 (Figure 4d), miR-182 inhibitor failed to significantly downregulate miR-183 expression in day 12 splenic CD4 [+] T cells thereby indicating the specificity of the depletion regime for miR-182. [score:9]
Significant regulation in miR-182 expression in c. genital tract (down-regulation compared to mock) and d. splenic CD4 [+]T cells (up-regulation compared to mock) collected at indicated time points (n = 3/ group/ time point) was observed. [score:8]
Taken together our results (Figures 4- 5) demonstrate that miR-182 upregulated in Ag-specific CD4 [+] T cells directly contributes to Ag-specific IFN-γ and Cm infected associated disease pathogenesis in vivo. [score:7]
Additionally, comparable levels of bacterial shedding in miR-182 inhibitor treated and control groups of mice is in agreement with our previous report on the down-regulation of miR-182 in murine genital tracts following Cm infection or colonization within infected hosts [11]. [score:6]
Our results also demonstrate the down-regulation of transcription factor FOXO-1, and up-regulation of its controlling microRNA, i. e., miR-182 [35], in CD4 [+] T cells isolated at day 12 post infection from Cm infected mice compared to mock infected animals (Figure 4). [score:6]
We next, determined expression of miR-182 previously reported to regulate FOXO-1 expression [34, 35]. [score:6]
P < 0.05 using ANOVA with Tukey B Comparison Test in c., * miR-182 inhibitor treated Cm infected mice compared to Cm infected mice; [§] miR-182 inhibitor treated Cm infected mice compared to scramble treated Cm infected mice and d. significant increase in miR-182 and miR-183 expression * compared to mock infected mice; [§] compared to miR-182 inhibitor treated Cm infected mice. [score:5]
MiR-182 was observed to be significantly up-regulated in day 12 CD4 [+] T cells from Cm infected mice compared to mock infected animals (Figure 4b) demonstrating an inverse correlation between miR-182 and FOXO-1 expression in CD4 [+] T cells. [score:5]
Importantly, similar heat intensity profiles (light to dark) of a non-supervised hierarchical clustergram were indicative of probable co-regulation and expression of miR-182 and -183 in vaccinated mice; thereby, suggesting similar roles for both miRs in Ag-specific immune responses (Figure 4d). [score:4]
Given that miR-182 is down-regulated in Cm infected mice, the in vivo depletion regimen (Figure 5a) resulted in an environment that would aid Cm colonization in the genital tract [11]. [score:4]
Figure 5Murine miR-182 significantly regulates Ag-specific immune responses and disease pathology in Chlamydia muridarum infected miceC57BL/6 mice (n = 16/group) were challenged intravaginally with 5 × 10 [4] IFU Cm. [score:4]
While comparable bacterial shedding profiles between mock -treated, scramble- or miR-182 inhibitor treated Cm infected mice over a 30 day post infection period using culture (Figure 5f) or 16s PCR (at indicated time points, namely days 6, 12 and 80 post infection, Figure 5g) were observed, we found significant reduction in oviduct pathology (Figure 5h) and total cellular infiltrates (Figure 5i) in miR-182 inhibitor treated mice compared to Cm infected mice or scramble treated mice. [score:4]
Given that miR-182 was up-regulated in Ag-specific CD4 [+] T cells from Cm infected and vaccinated mice, we determined the in vivo relevance of miR-182 in genital Cm infection. [score:4]
In accordance with our previous findings [11], we observed a significant reduction in miR-182 expression in genital tracts (Figure 5c) or in CD4 [+] T cells (Figure 5d) isolated from miR-182 inhibitor treated mice compared to control -treated or mock treated mice post Cm infection. [score:4]
Murine miR-182 significantly regulates Ag-specific immune responses and disease pathology in Chlamydia muridarum infected mice. [score:4]
We used a depletion regimen for up to day 80 post infection (Figure 5a) which had no differential effect on weight change (Figure 5b), obvious health and wellness of mice and as expected, lead to significant reduction in miR-182 expression in genital tract (Figure 5c) or splenic CD4 [+] T cells (Figure 5d) isolated from miR-182 inhibitor treated mice following Cm infection compared to Cm infected mice at the assessed time points. [score:4]
MiR-182 expression was also observed to be significantly up-regulated in Cm vaccinated + Cm infected mice compared to mock vaccinated + Cm infected mice or Cm vaccinated + mock infected animals (Figure 4c). [score:4]
To this end, miR-182 inhibitors were formulated in polymeric, PEI -based nanoparticles for in vivo delivery [51, 52]. [score:3]
For miR-182 depletion studies, using a timeline (Figure 5a), mice were treated intraperitoneally (i. p) with 10 mg / mouse/ time point scramble- and miR-182 inhibitors. [score:3]
The significant reduction in Ag-specific IFN-γ was associated with significant decrease in development of upper genital pathology in miR-182 inhibitor treated mice compared to Cm infected mice (Figure 5e). [score:3]
a. Using a i. p depletion regimen, miR-182 was depleted using miR-182 inhibitor or controls (scramble treated, mock treated) at each of the time points indicated by dashed lines b. Monitoring of weight on indicated days revealed no significant changes due to treatment. [score:3]
Additional studies using lineage specific mice will delineate the contribution of miR-182 cluster regulation of Th [1] and Th [17] specific host immunity and its relative effect on development of upper genital pathology following Cm infection [59]. [score:3]
Moreover, following Cm infection, miR-182 inhibitor treated mice displayed significant reduction in development of upper genital pathology compared to scramble or mock treated mice. [score:3]
In order to corroborate these findings, we utilized our in vivo depletion regimen (Figure 5a) and isolated splenic CD4 [+] T cells from mock treated, scramble treated and miR-182 inhibitor treated mice at day 12 post Cm infection. [score:3]
Additionally miR-183 (a member of the miR-182 family [35]) was found to be significantly up-regulated in day 12 CD4+ T cells from Cm infected mice (Figure 4b), and in Cm vaccinated + Cm infected mice (Figure 4c) compared to control. [score:3]
Splenic CD4 [+]T cells were purified at day 6 post infection and miR-182 and -183 expression was assessed. [score:3]
We observed significant up-regulation of miR-182 in day 6 splenic CD4 [+] T cells from Cm vaccinated + Cm infected mice compared to mock vaccinated + mock infected animals (Figure 4c). [score:3]
In brief, 5 mg of the inhibitor mmu-miR-182-5p or the scrambled negative control oligonucleotide (IDT, Coralville, IA) were dissolved in 5 ml HN buffer (10 mM HEPES, 150 mM NaCl, pH 7.4), yielding a 400 nM stock solution. [score:3]
Importantly, this significant difference in IFN-γ levels was ‘lost/ rescued in’ upon co-culture of Cm infected miR-155 [−/−] BMDC with CD4 [+] T cells from miR-182 inhibitor treated mice and was comparable to levels in Cm infected WT BMDC cocultured with CD4 [+] T cells from Cm infected mice (Figure 6a). [score:3]
Figure 4Murine FOXO-1 and miR-182 is significantly regulated in Chlamydia muridarum infected CD4 [+]T cellsC57BL/6 mice (n = 3) were challenged intravaginally with 5 × 10 [4] IFU Cm. [score:2]
Significant reduction in upper genital pathology and total cellular infiltrates in miR-182 inhibitor treated mice, compared to mock or scramble treated mice, following Cm infection (Figure 5h, 5i) were in accordance with previous reports on the reduced inflammatory cellular infiltrates contributing to reduced genital pathology [53, 55- 58]. [score:2]
Additionally, using a miR-155 [−/−]BMDC: miR-182 depleted CD4 [+] T cell co-culture (Figure 6a), we corroborated the interaction of the 2 miRs and the co-regulatory effect on IFN-γ production (as summarized in Supplementary Table 2). [score:2]
[§] compared to Cm infected WT BMDC co-cultured with CD4 [+]T cells isolated from miR-182 inhibitor treated Cm infected mice. [score:2]
[§] compared to miR-182 inhibitor treated Cm infected mice. [score:2]
Expression of miR-182 and -183 using miR-specific RT-PCR was performed as described below and bacterial burdens (days 6, 12, 80 for Chlamydia 16s encoding gene PCR from genital tract) were determined using primers and PCR parameters as described by Wooters et al [67]. [score:2]
Interferon-γ production in C. muridarum infected dendritic cells and CD4 [+] T cells is co-regulated by miRs-155 and -182Since IFN-γ is the key cytokine involved in adaptive immunity against Cm infection, and is produced by Ag-specific CD4 [+] T cells from Cm infected or vaccinated mice [27], we determined the contribution of miR-182 in generation of Ag-specific IFN-γ. [score:2]
Taken together, regulation of miR-182 in Ag-specific CD4 [+] T cells from Cm infected and vaccinated mice suggests its contribution to generation of Ag-specific immune responses and protective immunity. [score:2]
As shown in Figure 6b, Ag-specific IFN-γ levels were significantly reduced in Cm infected WT BMDC cocultured with CD4 [+] T cells from miR-182 inhibitor treated mice compared to Cm infected mice. [score:2]
[§]Cm infected mice compared to miR-182 inhibitor treated Cm infected mice. [score:2]
Murine FOXO-1 and miR-182 is significantly regulated in Chlamydia muridarum infected CD4 [+]T cells. [score:2]
We thus employed a miR-182 depletion strategy to demonstrate the direct contribution of miR-182 to Ag-specific IFN-γ production. [score:2]
We observed significant reduction in Ag-specific IFN-γ levels in splenocytes isolated from miR-182 inhibitor treated mice compared to Cm infected mice or scramble treated mice at day 12 post infection (Figure 5e). [score:2]
Expression of miR-182 correlated with protection against subsequent Cm infection at day 6 post infection as determined by production of Ag-specific IFN-γ (determined by) (Figure 4e), and resolution of infection (Figure 4f) from all mice (Figure 4g) in Cm vaccinated + Cm infection compared to control groups. [score:2]
Ag-specific IFN-γ production was abrogated in total splenocytes from miR-182 inhibitor treated mice compared to scramble treated or mock treated Cm infected mice. [score:2]
d. Non-supervised hierarchical clustergram depicting miR-182 and -183 co-regulation in vaccinated and infected groups. [score:2]
These findings were further corroborated by comparable IFN-γ production in miR-155 [−/−] BMDC cocultured with CD4 [+] T-cells from miR-182 inhibitor treated mice compared to WT BMDC co-cultured with CD4 [+] T-cells from Cm infected mice. [score:2]
Importantly, miR-182 and its family member, miR-183 were significantly co-regulated in CD4 [+] T cells isolated from vaccinated mice protected at day 6 after a subsequent intravaginal Cm infection (Figure 4c, 4d). [score:2]
We further hypothesized that miR-182 regulation in Ag-specific CD4 [+] T cells (i. e., the primary effector cells during the adaptive immune phase of a genital Cm infection [27]) might potentially be involved in protection against a subsequent genital Cm infection. [score:2]
We established a role for miR-182 in regulating IFN-γ production in an Ag-specific manner (Figure 6). [score:2]
Collectively, these results suggest miR-182 may potentially be critically involved in initiation of adaptive immunity following Cm infection (isolated at day 12 post infection) and may also be involved in vaccine mediated protection (isolated at day 6 post infection in vaccinated mice). [score:1]
Groups of mice were depleted for miR-182 using regimen described in Figure 5a. [score:1]
Since IFN-γ is the key cytokine involved in adaptive immunity against Cm infection, and is produced by Ag-specific CD4 [+] T cells from Cm infected or vaccinated mice [27], we determined the contribution of miR-182 in generation of Ag-specific IFN-γ. [score:1]
Results are representative of 3 (FOXO-1) and 4 (miR-182 and-183) independent experiments. [score:1]
Real time PCR was performed for murine a. FOXO-1; and b. miR-182 and -183. [score:1]
MiR-182 is significantly regulated in CD4 [+] T cells from Chlamydia muridarum infected or vaccinated mice and contributes to Ag-specific immune response in vivoEfficient Ag presentation by DC results in clonal proliferation of effector T-cell populations for generation of anti-Cm immunity [1, 26]. [score:1]
Importantly, IFN-γ production in miR-155 mimic treated BMDC co-cultured with miR-182 mimic treated Ag-specific CD4 [+] T-cells was comparable to untransfected co-cultures. [score:1]
Taken together, data from both studies suggest that the miR-182 family is involved in genital Cm infection, and has cell- and tissue-specific function in infected mice. [score:1]
d CD4 [+]T cells were mock transfected or transfected with miR-182 mimic. [score:1]
MiR-182 is significantly regulated in CD4 [+] T cells from Chlamydia muridarum infected or vaccinated mice and contributes to Ag-specific immune response in vivo. [score:1]
CD4+ T-cells were manipulated with miR-182 mimic prior to co-culture with treated BMDC. [score:1]
[1 to 20 of 61 sentences]
3
[+] score: 176
Small interfering RNA (siRNA) targeting mouse Wasf2, Dock1, or Itga4 (Bioneer, Korea) genes were transfected into mIMCD cells at 20 nM using Lipofectamine RNAiMAX reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions for 24 to 48 h. miRNA mimics and inhibitors for mmu-miR-182-5p (Ambion) were reverse -transfected into mIMCD cells at 10 nM using siPORT NeoFX transfection reagent (Ambion) for 24 to 48 h. The control experiments were transfected with scramble miRNA (Pre-miR miRNA Precursor and miR-Vana miRNA inhibitor Molecules, Negative Control #1, Ambion). [score:7]
Furthermore, we observed that the expression patterns of the target genes of miR-182-5p, Wasf2, Dock1, and Itga4, were restored in mice treated with inhibitory miR-182-5p lentivirus (Fig.   6F). [score:7]
We found that miR-182-5p directly bound to the 3′UTR of these candidate target mRNAs related to actin cytoskeleton, negatively regulating their translation (Fig.   3D and Supplementary Fig.   S5B). [score:7]
Finally, overexpressing miR-182-5p increased cyst growth, while inhibiting miR-182-5p inhibited cyst formation (Fig.   5C). [score:7]
Intriguingly, we found that overexpressing miR-182-5p inhibits actin cytoskeleton organization, particularly lamellipodium formation, by repressing marker genes related with the actin cytoskeleton, ultimately affecting cyst development in vitro (Fig.   5B and C). [score:6]
Candidate target mRNAs of miR-182-5p were downregulated in the kidney tissues of Pkd1 [f/f]:HoxB7-cre mice over time (Fig. 3C and Supplementary Fig.   S5A). [score:6]
Inhibiting miR-182-5p attenuates cyst growth in a Pkd1 conditional knockout mouse mo delTo evaluate the therapeutic effect of miR-182-5p inhibition, a lentiviral particle -mediated miRNA inhibition system was introduced. [score:6]
Collectively, these results indicated that inhibiting miR-182-5p was effective for inhibiting cyst growth and restoring renal function. [score:5]
We also observed that miR-182-5p inhibition by systemic injection of lentiviral particle -mediated inhibitory miRNA attenuated cyst progression in vivo. [score:5]
In Pkd1 [f/f] at P3, interestingly, miR-182-5p expression was observed in the renal tubule domain, but the glomerulus and Bowman’s capsule cells did not exhibit miR-182-5p -expressing cells (Supplementary Fig.   S4G–I). [score:5]
However, miR-182-5p directly targets and regulates Wasf2, Dock1, and Itga4 in Pkd1 -deficient mice, but not in Pkd2 -deficient mice (Supplementary Fig.   S10). [score:5]
Inhibiting miR-182-5p attenuates cyst growth in a Pkd1 conditional knockout mouse mo del. [score:4]
Interestingly, we observed that all miR-182 family members, miR-182-3p, miR-182-5p, miR-183-5p, and miR-96-5p, were significantly upregulated in P7 Pkd1 [f/f]:HoxB7-cre mice kidney tissues. [score:4]
The miRNA and its target genes, other than miR-182-5p, may play more important regulatory functions in Pkd2 conditional KO mice. [score:4]
Moreover, western blotting analysis revealed that miR-182-5p negatively regulated the target genes Wasf2, Dock1, and Itga4 (Fig.   5A). [score:4]
We identified, Wasf2 as a novel direct target of miR-182-5p. [score:4]
Kidney weight-to-body weight ratios, BUN levels, and miR-182-5p expression in kidney tissues were reduced upon treatment with the inhibitory miR-182-5p lentivirus compared with those in con-lentivirus -treated Pkd1 [f/f]:Aqp2-cre mice (Fig.   6B–E). [score:4]
Overall, we present strong evidence that miR-182-5p upregulation is Pkd1 -dependently associated with defects in the actin cytoskeletal pathway, which can cause symptoms of PKD. [score:4]
We also found that Dock1 is a novel direct target of miR-182-5p. [score:4]
n = 5, control lentivirus- and n = 6, inhibitory miR-182-5p lentivirus -injected mice, respectively * P < 0.05; ** P < 0.01; *** P < 0.001. [score:3]
Considering our observations in this study, miR-182-5p should be a potential therapeutic target. [score:3]
We confirmed that the expression of Wasf2, Dock1, and Itga4 were restored in the miR-182-5p lentivirus -injected Pkd1 [f/f]: Aqp2-cre mice. [score:3]
The glomerulus showed especially strong miR-182-5p expression in P1 Pkd1 [f/f] mice (Supplementary Fig.   S4A–C). [score:3]
Remarkably, miR-182-5p had multiple candidate targets involved in actin cytoskeleton signaling (Fig.   2C). [score:3]
To evaluate the therapeutic effect of miR-182-5p inhibition, a lentiviral particle -mediated miRNA inhibition system was introduced. [score:3]
Most miRNAs, including miR-182-5p, showed a similar expression pattern between qRT-PCR and sequencing results (Fig.   3A). [score:3]
To identify alterations of spatiotemporal miR-182-5p expression in the mouse postnatal kidney, section miRNA in situ hybridization (ISH) was performed. [score:3]
Integrin alpha 4 (Itga4), which we identified as a novel target of miR-182-5p, may play a crucial role in migratory events and we showed that it can affect cyst growth rate in vitro. [score:3]
In the Pkd1 [f/f]:HoxB7-Cre mice, as expected, miR-182-5p was strongly expressed in the cyst-lining epithelial cells (Supplementary Fig.   S4D–F and J–L). [score:3]
Interestingly, miR-182-5p -expressing cells were observed in the cuboidal epithelial lining cells of the cyst in Pkd1 [f/f]:HoxB7-Cre mice at P7 (Fig.   3B). [score:3]
Ectopic expression of miR-182-5p prevented the reorganization of actin filaments in mIMCD cells. [score:3]
miR-182-5p inhibitor -transfected mIMCD cells showed reduced of cyst lumen size. [score:3]
Expression of miR-182-5p was detected in the Pkd1 [f/f] medulla region and glomerulus. [score:3]
M, medulla; C, cortex; G, glomerulus; Cy, cyst; black arrow, miR-182 -expressing glomerulus; black dotted box, high magnification region; red dotted line, cyst lining epithelial cells. [score:3]
Figure 6The effect of miR-182-5p inhibition in attenuating cyst growth in vivo. [score:3]
A control lentivirus or inhibitory miR-182-5p lentiviral particles (final conc. [score:3]
At P7, the expression pattern of miR-182-5p is detected by section in situ hybridization (ISH) in Pkd1 [f/f] and Pkd1 [f/f]:HoxB7-Cre mice. [score:3]
However, miR-182-5p inhibition could not slow cyst growth in Pkd2 [f/f]:Aqp2-cre mice because Wasf2, Dock1, and Itga4 play significant roles in Pkd1 but not in Pkd2 conditional KO mice. [score:3]
Prior to staining, mRNA and protein levels of Pkd1, Pkd2, and miR-182-5p target genes were determined in recovered mIMCD spheroids (Supplementary Fig.   S7). [score:3]
The 3′UTR of mmu-miR-182-5p candidate target mRNAs were amplified by PCR using PrimeSTAR GXL DNA polymerase (Takara Bio Inc. [score:3]
Indeed, our data showed that miR-182-5p was associated with cystogenesis by regulating the actin cytoskeleton signaling pathway in both mouse mo dels. [score:2]
These data suggest that miR-182-5p may play a critical role as a novel inducer of cystogenesis by regulating the actin cytoskeleton. [score:2]
From our results, we identified that key proteins involved in the actin cytoskeleton were regulated by several miRNAs, including miR-182-5p, that control cyst progression. [score:2]
The cysts in miR-182-5p precursor -treated cells were bigger than cysts in NC treated cells. [score:1]
Figure 5Role of miR-182-5p in renal cystogenesis linked to defects in the actin cytoskeleton. [score:1]
Mutating the seed sequence of miR-182-5p induced rescued luciferase activity of the psiCHECK-2 vector. [score:1]
The seed sequences of miR-182-5p were mutated using a PCR -based approach. [score:1]
Upon considering both small RNA-seq raw data and qRT-PCR, we concluded that miR-182-5p was the most suitable subject for future research. [score:1]
They confirmed nine candidate miRNAs, including miR-182 and miR-96, by qPCR and suggested that several miRNAs may be associated with ADPKD-related signaling pathways. [score:1]
For transfection, mIMCD cells (2 × 10 [5]) were plated into 6-well plates and 1.5 μg of luciferase constructs and 15 nM of negative control mimics or mmu-miR-182-5p mimics (Ambion) were co -transfected into the cells one day after seeding using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instruction. [score:1]
miR-182-5p was localized in the overall kidney region at P1 and P3, including the medulla and cortex regions (Supplementary Fig.   S4). [score:1]
Hybridization was conducted at 53 °C for overnight using miR-182 locked nucleic acid (LNA) modified probe (Exiqon). [score:1]
[1 to 20 of 52 sentences]
4
[+] score: 160
Other miRNAs from this paper: mmu-mir-183, mmu-mir-96
We reasoned that if the expression levels of the miR-182 target genes were upregulated in the KO mice, the genes with high Z-ratio values would be enriched with miR-182 target sites. [score:10]
These data do not support the notion that miR-182 target gene expression is upregulated in the KO mice. [score:8]
To examine the effects of the mir-182 null mutation on the expression of miR-182 target genes, we analyzed data using a protocol described by Rodriguez et al. [14] and Giraldez et al. [18]. [score:6]
In addition to its possible roles in the retina, the expression of miR-182 is downregulated during the differentiation of 3T3-L1 pre-adipocytes into adipocytes [32]. [score:6]
Gene expression profiling was performed using a mouse genome 430.2 microarray chip (Affymetrix, Santa Clara, CA) and the effects of the mir-182 null mutation on target genes were analyzed essentially as previously described by Rodriguez et al. [14], Giraldez et al. [18], and Cheng and Li [19]. [score:6]
Figure 7Fluctuation of miR-182 target gene expression in the KO and wild-type mice. [score:5]
Furthermore, we did not observe any significant fluctuation in the expression of target genes in the miR-182–depleted retinas. [score:5]
MiR-182, miR-183, and miR-96 have similar seed sequences, target genes, expression patterns, and genomic loci [9], suggesting they may act in a coordinated manner, compensating for each other in vivo. [score:5]
In line with previous reports [8, 9, 26], miR-182 was highly expressed in the retina, suggesting it may play important roles in both retinal development and maintenance. [score:4]
Previously, other groups have shown the early developmental and postnatal expression patterns of miR-182 using in situ hybridizations [8- 10, 26]. [score:4]
To determine the role of miR-182 during eye development, we identified the specific cells that express miR-182. [score:4]
MicroRNA-182 (miR-182) is expressed abundantly in the mammalian retina and is therefore thought to perform important roles for the retinal development and the function. [score:4]
Recently, several groups reported the retinal expression of a polycistronic miRNA cluster, which includes miR-182, miR-183, and miR-96 in the retina [9, 10]. [score:3]
We focused on miR-182 because this miRNA is robustly expressed in retinas. [score:3]
Figure 4A gene targeting strategy used to generate miR-182 KO mice. [score:3]
The precursor sequence of miR-182 was replaced by the neomycin resistance gene under the control of the phosphoglycerate kinase 1 promoter in a targeting construct. [score:3]
Gene targeting and generation of miR-182 KO mice. [score:3]
Expression levels of miR-182 in fibroblasts isolated from normal skin were also analyzed (v). [score:3]
Figure 2In situ hybridization analysis of miR-182 expression in P3 eyes. [score:3]
Our in situ hybridization data obtained using LNA -modified probes showed that miR-182 is strongly expressed in both embryonic and P3 inner retinas, especially in the ganglion cell layer. [score:3]
Because the precursor sequence of miR-182 was only 75 bp, the entire gene was replaced by the PGK-Neo cassette in the targeting construct. [score:3]
revealed that mature miR-182 was not expressed in the eyes of homozygous KO mice (Figure 4C). [score:3]
Data analysis and miR-182 target searching. [score:3]
Expression levels of miR-96, miR-182, and miR-183 in lymph node (lane a), skin (b), skeletal muscle (c), white fat (d), brown fat (e), liver (f), kidney (g), adrenal gland (h), spleen (i), testis (j), stomach (k), small intestine (l), large intestine (m), thymus (n), lung (o), cardiac ventricle (p), thyroid gland (q), submandibular gland (r), cerebrum (s), cerebellum (t), and eye (u) tissues of wild-type mice were analyzed by northern blotting. [score:3]
northern blotting was performed to confirm the robust expression of miR-182 in the eye. [score:3]
Total RNA was isolated from eyes of wild-type (+/+), heterozygous (+/−), and homozygous (−/−) KO mice and the expression levels of miR-96, miR-182, and miR-183 were analyzed by northern blotting. [score:3]
MiR-182 is highly expressed in the mouse eye. [score:2]
Thus, the miR-182 gene cluster may play a critical role in retinal development and physiology. [score:2]
We attempted to elucidate the specific roles of miR-182 in retinal development by generating a miR-182 KO mouse line. [score:2]
To test this hypothesis, we generated miR-182 knockout mice. [score:2]
To further examine the biologic role of miR-182 during the retinal development, we generated a miR-182 KO mouse line. [score:2]
The absence of significant transcriptional and phenotypic changes in miR-182–depleted retinas suggests that miR-182 is not a major determinant of retinal development or delamination. [score:2]
Thus, miR-182 deficiency alone does not adversely effect normal retinal development or maintenance. [score:2]
Generation of miR-182–deficient mice. [score:1]
An 11.9 kb DNA fragment encoding the hairpin precursor of miR-182 was obtained from the murine 129 SvEv genomic library and subcloned into a 2.4 kb backbone vector. [score:1]
B: Sequences of miR-96, miR-182, and miR-183 are shown. [score:1]
The miR-182 KO mice appeared to have no major phenotypes regarding their growth, however. [score:1]
Thus, we also hypothesized that miR-182 KO mice could become obese due to increased numbers of adipocytes. [score:1]
Matched LNA probes specific for miR-182 (miR182LNA, upper panels) or a control probe containing a single-base mismatch (miR182LNA/MM, lower panels) was used for the hybridization. [score:1]
The perfect-matched LNA-probe against miR-182 (miR182LNA) or the single-base mismatched control probe (miR182LNA/MM) was used for in situ hybridization. [score:1]
A: The pre-miR-182 locus was replaced with the Neo cassette flanked by LoxP sites (black triangles). [score:1]
C: Mature miR-182 is indeed absent in the eyes of KO mice. [score:1]
It should be noted that miR-96, miR-182, and miR-183 have similar sequences in their 5′ seed regions [6, 23] and that 18 of 22 nucleotides in miR-183 were identical to those in miR-182 (Figure 1B). [score:1]
We examined the tissue distribution of miR-96, miR-182, and miR-183 in normal adult mice (Figure 1A). [score:1]
Nucleotides that are identical between miR-182 and miR-96, and miR-182 and miR-183 are denoted in red. [score:1]
Immunohistochemical analysis of the miR-182–deficient retinas did not reveal any apparent structural abnormalities in the retinas. [score:1]
In approximately16-week-old mir-182 null mutant mice, however, we did not observe any alterations of the retinal organization. [score:1]
MiR-182 likely is not a major determinant of retinal development, maintenance, or cell survival. [score:1]
For comparison, the fold enrichment of the average frequency of sequences targeted by miR-182 was calculated in each group. [score:1]
As shown in Figure 7A, however, the average frequency of sequences complementary to the miR-182 seed was slightly lower for the genes with higher Z ratios. [score:1]
B: Genotyping the miR-182 KO mice. [score:1]
Although probes for miR-182 and miR-183 cross-reacted, they were distinguishable from each other because of differences in their sizes and signal intensities; miR-183 (22 mer) was shorter than miR-182 (25 mer), and the signal intensities from the cross-reaction were weaker than the specific signal intensities. [score:1]
Hybridization was performed overnight at 42 °C (miR-96) or 35 °C (miR-182 and miR-183), and the signals were detected using a BAS2500 image analyzer (Fuji Photo Film, Tokyo, Japan). [score:1]
In this study, we investigated miR-182 expression in both the embryonic and postnatal eyes using miR-182 KO mice. [score:1]
In this study, we used sequences with four different lengths as those complementary to the 5′ to 3′ sequence of the miR-182 seed sequence: n2–6 (GCCAA), n2–7 (TGCCAA), n1–7 (TGCCAAA), and n1–8 (TTGCCAAA). [score:1]
These results support the notion that miR-182 is eye-specific [9, 26]. [score:1]
Oligonucleotide probes specific for miR-96, miR-182, and miR-183 (IDT Technologies, Coralville, IA) were labeled with [α- [32]P]dATP. [score:1]
Synthesized miR-96, miR-182, and miR-183 were used as controls for northern blotting (lanes 1–3 in Figure 1A). [score:1]
Locked nucleic acid (LNA) -modified oligonucleotide probes specific for miR-182 and a negative control containing a single-base mismatch were labeled at the 3′ end with digoxigenin and used for the hybridization. [score:1]
Sequences complementary to the miR-182 5′-seed sites [6, 23] were examined in the 3′-UTR sequences. [score:1]
Figure 3In situ hybridization analysis of miR-182 in eyes of normal embryonic mice. [score:1]
The AC scores of miR-182 (−6.16) is marked with a red bar. [score:1]
Figure 1Tissue distribution of miR-96, miR-182, and miR-183 in the mouse. [score:1]
In brief, we successfully generated a miR-182 KO mouse line, which showed no major alterations in their retinal structure. [score:1]
Synthetic miR-96 (lane 1), miR-182 (lane 2), and miR-183 (lane 3) were used as controls. [score:1]
As shown in Figure 7B, however, miR-182 was ranked as an inactive miRNA in the wild-type mice relative to the KO mice. [score:1]
We then attempted to generate miR-182 KO mice. [score:1]
Here, we report the results from our initial examination of the miR-182 KO mice. [score:1]
Four different complementary sequences were used to analyze the potential miR-182 5′ seeds: n2–6 (GCCAA), n2–7 (TGCCAA), n1–7 (TGCCAAA), n1–8 (TTGCCAAA). [score:1]
A matched LNA probe specific for miR-182 (LNA) or a control probe containing a single-base mismatch (LNA/MM) was used for the hybridization. [score:1]
[1 to 20 of 70 sentences]
5
[+] score: 140
Other miRNAs from this paper: mmu-mir-185, hsa-mir-182, hsa-mir-185
Furthermore, the significant suppression of both endogenous mRNA and protein expression of SLC30A1, SERPINB2 or AKR1C1 in A549 and H446 cells was verified by transfection of cells with miR-182 or miR-185 mimic (all P < 0.01), and this microRNA -induced suppression of gene expression could be rescued when the specific miRNA inhibitor was co -transfected (Figure 3a– 3c). [score:11]
Figure 6Aberrant expression of SLC30A1 a. SERPINB2 b. and AKR1C1 c. in human lung cancer and paired normal tissues (up panel, squamous cell carcinoma and lower panel, adenocarcinoma) Data were retrieved from the TCGA database Data were retrieved from the TCGA database In the present study, we showed that down-regulation of miR-182 and miR-185 in HBE cells exposed to DMSO extracts of PM [2.5] resulted in increased SLC30A1, SERPINB2 and AKR1C1 gene expression and ectopic expression of these genes can respectively lead to neoplastic transformation in NIH3T3 cells. [score:10]
We then examined the correlation between the expression of microRNAs and mRNAs to predict the potential targets of microRNAs and found 3 genes, SLC30A1, SERPINB2 and AKR1C1, whose expression was inversely correlated with miR-182 and (or) miR-185 expression (Figure 1c). [score:9]
Mutations in the core microRNA binding sites are shown e Figure 3Suppression of endogenous mRNA (up panel) and protein (lower panel) of SLC30A1 a. SERPINB2 b. and AKR1C1 c. in A549 and H446 cells transfected with miR-182 mimic, miR-185 mimic or their inhibitor. [score:6]
The upregulation of SLC30A1, SERPINB2 and AKR1C1 and downregulation of miR-182 and miR-185 in HBE cells exposed to PM [2.5] extract detected by microarray were further confirmed by using quantitative real-time PCR (qRT-PCR) and Western blot assays (Supplementary Figure S1a and S1b). [score:6]
Mutations in the core microRNA binding sites are shown e Figure 3Suppression of endogenous mRNA (up panel) and protein (lower panel) of SLC30A1 a. SERPINB2 b. and AKR1C1 c. in A549 and H446 cells transfected with miR-182 mimic, miR-185 mimic or their inhibitor. [score:6]
We also detected depressed expression of miR-182 and perhaps miR-185 in human subjects exposed to high level of PM [2.5] and overexpression of SLC30A1, SERPINB2 and AKR1C1, which we have first demonstrated to be target genes of miR-182 and/or miR-185, in human lung cancer compared with the corresponding normal lung tissues. [score:6]
The most significant finding in the present study is that we identified at the first time that miR-182 and miR-185 are target regulators of SLC30A1, SERPINB2 or AKR1C1 that function as potential oncogenes because they were able to induce neoplastic transformation in NIH3T3 cells and were overexpressed in human lung cancer. [score:6]
Mutations in the core microRNA binding sites are shown e. Suppression of endogenous mRNA (up panel) and protein (lower panel) of SLC30A1 a. SERPINB2 b. and AKR1C1 c. in A549 and H446 cells transfected with miR-182 mimic, miR-185 mimic or their inhibitor. [score:6]
Among them, overexpression of SLC30A1, SERPINB2 as well as AKR1C1, mediated by downregulation of miR-182 and (or) miR-185, can induce neoplastic transformation in NIH3T3 cells. [score:6]
Figure 1Altered global microRNA a. and mRNA b. expression in human bronchial epithelial cells exposed to DMSO extracts of airborne PM [2.5], and potential interactions between microRNAs and mRNAs suggested by integrate and in silico analysis c. The experimental conditions are described in Materials and Methods SLC30A1, SERPINB2 and AKR1C1 are bona fide target genes of miR-182 or miR-185To test whether SLC30A1, SERPINB2 and AKR1C1 are bona fide targets of miR-182 or miR-185, a series of assays were conducted. [score:6]
For example, miR-182 was reported to suppress lung tumorigenesis and lung cancer cell proliferation through downregulation of RGS17 or RASA1 [21, 22]. [score:6]
In another study, downregulation of miR-182 was shown to contribute to renal cell carcinoma proliferation via activation of AKT/FOXO3a signaling pathway [23]. [score:4]
These results suggested that SLC30A1, SERPINB2 and AKR1C1 may be regulatory targets for miR-182 and miR-185. [score:4]
*, P < 0.05 compared with vector control Figure 5Xenograft tumor formation in nude mice of NIH3T3 cells ectopically and stably expressing SLC30A1, SERPINB2, AKR1C1, or vector control a. Histological analysis showed that all tumor cells had similar morphology and were diagnosed as fibrosarcoma b. Immunohistochemical staining c. demonstrated a high expression of SLC30A1 (up panel) or SERPINB2 (lower panel), respectively, in tumors induced by each of these two genes Reduced expression of miR-182 and miR-185 in human subjects exposed to PM [2.5]Plasma miR-182 and miR-185 were measured in 109 subjects living at the same region (Wuhan, China) but exposed to different levels of PM [2.5] and PM [10] monitored by personal sampler for 24 h. The median levels of individuals' exposure to PM [2.5] and PM [10] were 124.8 μg/m [3] and 179.3 μg/m [3], respectively, with the ranges of 18.7 to 274.2 μg/m [3] for PM [2.5] and 39.8 to 383.3 μg/m [3] for PM [10] (Supplementary Table S1). [score:4]
It has been shown that miR-182 is overexpressed in many types of cancer including lung cancer and is thought to be associated with cancer development and prognosis [19, 20]. [score:4]
Figure 1Altered global microRNA a. and mRNA b. expression in human bronchial epithelial cells exposed to DMSO extracts of airborne PM [2.5], and potential interactions between microRNAs and mRNAs suggested by integrate and in silico analysis c. The experimental conditions are described in Materials and Methods To test whether SLC30A1, SERPINB2 and AKR1C1 are bona fide targets of miR-182 or miR-185, a series of assays were conducted. [score:4]
SLC30A1, SERPINB2 and AKR1C1 are bona fide target genes of miR-182 or miR-185. [score:3]
These results provided further evidence that SLC30A1, SERPINB2 and AKR1C1 are respective bona fide target genes of miR-182 or miR-185 in human cells. [score:3]
In the present study, we identified SLC30A1, SERPINB2 and AKR1C1 as potential oncogenes targeted by miR-182 and (or) miR-185, respectively. [score:3]
Depression of plasma miR-182 and miR-185 in subjects exposed to high levels of PM [2.5] and overexpression of SLC30A1, SERPINB2 and AKR1C1 in human lung cancer tissues were detected. [score:3]
Reduced expression of miR-182 and miR-185 in human subjects exposed to PM [2.5]. [score:3]
We also observed reduced levels of plasma miR-182 and perhaps miR-185 in human subjects exposed to high levels of PM [2.5] compared with those exposed to low levels of PM [2.5] residing at the same region, directly connecting PM [2.5] exposure to microRNA expression in vivo. [score:3]
Figure 2Relative activity of reporter gene constructed with wild type of 3′UTR of SLC30A1 a. SERPINB2 b. or AKR1C1 c. gene or their mutant types d. cotransfected with miR-182 or mir-185 or their inhibitors in A549 and H446 cells. [score:3]
Relative activity of reporter gene constructed with wild type of 3′UTR of SLC30A1 a. SERPINB2 b. or AKR1C1 c. gene or their mutant types d. cotransfected with miR-182 or mir-185 or their inhibitors in A549 and H446 cells. [score:3]
Indeed, miR-182 has also been shown to act as a tumor suppressor. [score:3]
*, P < 0.05 compared with vector control Figure 5Xenograft tumor formation in nude mice of NIH3T3 cells ectopically and stably expressing SLC30A1, SERPINB2, AKR1C1, or vector control a. Histological analysis showed that all tumor cells had similar morphology and were diagnosed as fibrosarcoma b. Immunohistochemical staining c. demonstrated a high expression of SLC30A1 (up panel) or SERPINB2 (lower panel), respectively, in tumors induced by each of these two genes Plasma miR-182 and miR-185 were measured in 109 subjects living at the same region (Wuhan, China) but exposed to different levels of PM [2.5] and PM [10] monitored by personal sampler for 24 h. The median levels of individuals' exposure to PM [2.5] and PM [10] were 124.8 μg/m [3] and 179.3 μg/m [3], respectively, with the ranges of 18.7 to 274.2 μg/m [3] for PM [2.5] and 39.8 to 383.3 μg/m [3] for PM [10] (Supplementary Table S1). [score:2]
Transfection of these plasmids with miR-182 or miR-185 mimic showed no significant change in luciferase activity compared with transfection of these plasmids with microRNA control (Figure 2d), suggesting that the interactions between the two microRNAs and 3′UTR of three target genes are sequence-specific. [score:2]
The expression of miR-182 and miR-185 was calculated relative to U6 small nuclear RNA. [score:1]
Plasma miR-182 and miR-185 in subjects exposed to different levels of PM [2.5] and PM [10]. [score:1]
However, little has been known about the effect of miR-182 on lung cancer initiation. [score:1]
For analysis of plasma miR-182 and miR-185, the input RNA was reverse transcribed using TaqMan miRNA Reverse Transcription Kit (Applied BioSystems, Foster City, CA). [score:1]
Transient transfection of these reporter plasmids to human lung cancer cell lines A549 and H446 with miR-182 or miR-185 mimic or microRNA control showed that transfection with miR-182 significantly reduced the luciferase activity caused by 3′UTR of SLC30A1 or SERPINB2 while transfection with miR-185 significantly reduced luciferase activity caused by 3′UTR of AKR1C1 (all P < 0.05). [score:1]
[1 to 20 of 33 sentences]
6
[+] score: 115
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
The expression levels of miR-183, miR-96, and miR-182 were most highly up-regulated, whereas miR-122, miR-503, and miR-139-3p exhibited the greatest down-regulation as a result of 17α-E2 treatment. [score:9]
The expression levels of miR-183 (4.61-fold), miR-96 (4.56-fold), and miR-182 (4.29-fold) were most highly up-regulated, whereas miR-122 (9.79-fold), miR-503 (5.88-fold), and miR-139-3p (1.94-fold) showed the greatest down-regulation as a result of 17α-E2 treatment. [score:9]
ACTH up-regulated the expression of miRNA-212, miRNA-182, miRNA-183, miRNA-132, and miRNA-96 and down-regulated the levels of miRNA-466b, miRNA-214, miRNA-503, and miRNA-27a. [score:9]
Real-time PCR (qRT-PCR) measurements demonstrated that ACTH treatment upregulated the expression of miRNA-212, miRNA-183, miRNA-182, miRNA-132 and miRNA-96, while down -regulating the expression of miRNA-466b, miRNA-214, miRNA-503 and miRNA-27a. [score:7]
Treatment of MLTC-1 cells with Bt [2]cAMP for 6 h increased the expression of miRNA-212, miRNA-183, miRNA-132, miRNA-182 and miRNA-96 and inhibited the expression of miRNA-138 and miRNA-19a (Fig. 4B ). [score:7]
The levels of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377, and miRNA-96 were up-regulated, whereas miR-125b, miRNA-200b, miR-122, miRNA-466b, miR-138, miRNA-214, miRNA-503 and miRNA27a were down-regulated in response to 17α-E2 treatment. [score:7]
qRT-PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats (Fig. 3 ). [score:7]
Real-time quantitative PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats. [score:7]
Treatment of MLTC-1 cells with Bt [2]cAMP for 6 h increased the expression of miRNA-212, miRNA-183, miRNA-132, miRNA-182 and miRNA-96, and inhibited the expression of miRNA-138 and miRNA-19a. [score:7]
Bt [2]cAMP stimulation of granulosa cells caused down-regulation of a majority of miRNAs, including miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, miRNA-138 and miRNA-19a, but expression levels of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 were significantly increased. [score:6]
qRT-PCR measurements indicated that exposure of primary rat granulosa cells to Bt [2]cAMP for 24 h inhibited the expression of miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, and miRNA-138 and miRNA-19a while enhancing the expression of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 (Fig. 4 ). [score:5]
NR5A1 was predicted to be the target gene of miR-342, while LDL-R was predicted to be the target gene of miR-182 and miR-466b. [score:5]
Here, we directly assessed the binding of miRNA-138, miRNA-132 and miRNA-182/miRNA-214 to the 3′UTR of StAR, SREBP-1c, and LDLR, respectively, and regulation of their expression levels, by carrying out luciferase reporter gene assays. [score:4]
Real-time PCR (qRT-PCR) confirmed ACTH -mediated up-regulation of miRNA-212, miRNA-183, miRNA-182, miRNA-132 and miRNA-96. [score:4]
Microarray data demonstrated that the levels of miR-183 and miR-182 were up-regulated with 17α-E2 treatment, but not with ACTH (p = 0.065) treatment; qRT-PCR measurements, however, showed significant increases in their expression in response to either ACTH or 17α-E2 treatment. [score:4]
In contrast, no inhibitory effect of pre-miRNA-138 on the StAR 3′ UTR (with 2 putative binding sites) reporter construct and pre-miRNA-182 on the LDLR 3′UTR (with a single putative binding site) reporter construct was detected. [score:3]
We next evaluated the effects of Bt [2]cAMP stimulation of rat ovarian granulosa cells and of mouse MLTC-1 Leydig tumor cells on the expression of twelve miRNAs (miRNA-212, miRNA-122, miRNA-183, miRNA-200b, miRNA-466b, miRNA-182, miRNA-96, miRNA-27a, miRNA-132, miRNA-214, miRNA-138 and miRNA-19a) whose adrenal expression was differentially altered in response to treatment of rats with ACTH, 17α-E2 or DEX. [score:3]
The levels of expression of miRNA-212, miRNA-122, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96, miRNA-466b, miRNA-200b, and miRNA-19a are shown. [score:3]
More specifically, we assessed the impact of Bt [2]cAMP treatment on the expression of miRNA-212, miRNA-122, miRNA-27a, miRNA-466b, miRNA-200b, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96 and miRNA-19a. [score:3]
CHO cells were co -transfected individually with StAR 3′-UTR (containing the putative site I or site II for miRNA-138 binding) ± pre-miRNA-138-5p (panel B), SREBP-1c 3′-UTR (containing the putative binding site for miRNA-132) ± pre-miRNA-132-3p, LDLR 3′-UTR (containing the putative binding site for miRNA-182), or LDLR 3′-UTR (containing the putative site I, site II or site III for miRNA-214 binding) ± pre-miRNA-214-3p for 36h, followed by determination of luciferase activities. [score:1]
Seed sequences of the putative miRNA-138-5p, miRNA-132-3p and miRNA-182-5p/miRNA-214-3p binding sites in the 3′-UTR of mouse StAR, SREBP-1c and LDLR genes, respectively. [score:1]
Individual fragments of the 3′ UTR region of the StAR gene containing site I or site II binding site for miRNA-138-5p, the 3′-UTR of SREBP-1c containing a binding site for miRNA-132-5p, the 3′-UTR of LDLR containing a binding site for miRNA-182-5p or the 3′-UTR of LDLR containing site I, site II, or site III binding site for miRNA-214-3p were inserted downstream of the luciferase open reading frame of pMIR-REPORT vector. [score:1]
CHO cells were co -transfected individually with the StAR 3′-UTR (containing putative site I or site II for miRNA-138 binding) ± pre-miRNA-138-5p (panel B), the SREBP-1c 3′-UTR (containing putative binding site for miRNA-132) ± pre-miRNA-132-3p (panel C), the LDLR 3′-UTR (containing putative binding site for miRNA-182) (panel D), or the LDLR 3′-UTR (containing putative site I, site II or site III for miRNA-214 binding) ± pre-miRNA-214-3p for 36 h (panel E). [score:1]
Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
0078040.g003 Figure 3Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
[1 to 20 of 25 sentences]
7
[+] score: 110
In order to confirm that miR-200 family miRNAs and miR-182/96/183 family miRNAs are involved in ULM and/or ULM-related gene expression, we compiled a list of potential targets of these miRNAs in various ULM mRNAs using three computational target prediction programs: TargetScan (www. [score:9]
We also show in SHSY5Y cells that inhibition of miR-200 family and/or miR-182 family miRNA activity makes cells more tolerant to oxygen/glucose deprivation (OGD), perhaps via an increase in post-translational modification of cellular proteins by various ULM species. [score:5]
We found quite a few potential target sites for miR-200 and miR-141, and some for miR-182/183/96 in SUMO-related genes and other ULMs as shown in Table 2. miRNA::mRNA target prediction is based on assumptions of certain values for temperature, salt and other conditions and the results are all too often dependent on the algorithm employed by each tool. [score:5]
html) We have established that the miR-200 family and the miR-182 family miRNAs target SUMO and other ULMs, and that inactivation of these miRNAs increases both global SUMOylation and global conjugation of other ULMs resembling the changes in posttranslational modifications that have been noted in ground squirrels during hibernation torpor. [score:5]
In order to examine whether some (if not all) of these predicted target sites are really recognized by either miR-200 family or miR-182/183/96 family miRNAs, we made firefly luciferase reporter constructs containing individual predicted target sequences for the miRNAs of interest. [score:5]
We could confirm that miR-200, miR-182, miR-183, miR-141, miR-96, miR-122 and miR-429 were indeed down regulated, and miR-34 and miR-206 were upregulated during hibernation torpor (Fig. 2B). [score:5]
The endogenous level of miR-182 is much higher than those of other miRNAs tested, thus showing greater apparent inhibition by its specific inhibitor, but a reduced fold increase by mimics. [score:5]
We have established that the miR-200 family and the miR-182 family miRNAs target SUMO and other ULMs, and that inactivation of these miRNAs increases both global SUMOylation and global conjugation of other ULMs resembling the changes in posttranslational modifications that have been noted in ground squirrels during hibernation torpor. [score:5]
The results strongly suggest that theses predicted target sites are real and SUMO and other ULM mRNAs are indeed targeted and controlled by the miR-200 family and the miR-182 family miRNAs. [score:5]
Effect of inhibition or overexpression of the miR-200 family and the miR-182 family miRNAs on OGD -induced cell death in SHSY5Y cells. [score:5]
Human neuroblastoma SHSY5Y cells were transfected with miRNAs (miR200c, miR183, miR182, miR141, miR-96) mimics or inhibitors (Thermo Scientific Dhamacon miRIDIAN microRNA Mimics & Hairpin Inhibitors) using Lipofectamine RNAimax (Invitrogen). [score:5]
The roles of miR-200 family and miR-182 family miRNAs, which we found to be down-regulated during hibernation torpor, have been examined in various areas of research, especially cancer, but the studies have generally been correlational. [score:4]
The clear increase in expression of miR-200 and miR-182 family miRNAs at the 3 hour timepoint may have reflected the sublethal ischemic stress that induces ischemic tolerance, but at the times that OGD tolerance was tested, these miRNA levels may well have been depressed. [score:3]
These results suggest that inhibiting miR-200 family and miR-182 family miRNAs does protect SHSY5Y cells from OGD -induced cell death. [score:3]
Interestingly, SHSY5Y cells became more tolerant to OGD -induced cell death when activities of miR-200 family and/or miR-182 family miRNAs were inhibited (Fig. 6B), and more sensitive when mimics of these miRNAs were transfected (Fig. 6B). [score:3]
Cells transfected with miRNA inhibitors, especially miR-200 family (miR-200c and miR-141) showed much far less cell death (Fig. 6B), but cells transfected with miRNA mimics, especially from the miR-182 family, caused more cell death (Fig. 6B). [score:3]
Effects of inhibitors and mimics for miR-200 family and miR-182 family miRNAs on OGD -induced cell death in SHSY5Y. [score:3]
0047787.g003 Figure 3 (A) SHSY5Y cells were transfected with hairpin inhibitors for human miR-200c, miR-182, miR-183 and miR-141 individually, the levels of these miRNAs were measured by qPCR, and expressed relative (fold change) to endogenous levels. [score:3]
Roh's group [37] reported that miR-200 family and miR-182 family miRNAs increased at 3 hrs after an ischemic preconditioning (15 min transient focal cerebral ischemia) in mice and that overexpressing these miRNAs made mouse neuroblast cells (Neuro-2a) more resistant to OGD (16 h). [score:3]
The DNA sequences of target sites for miR-200 family and/or miR-182 family miRNAs in each gene are shown in the supplemental materials (Table S2). [score:3]
Effect of miRNA inhibitors and mimics for miR-200 family and miR-182 family members on ULM conjugation levels in SHSY5Y cells. [score:3]
We transfected SHSY5Y cells with inhibitors or mimics for several miR-200 family and the miR-182 family miRNAs (miR-200c, miR-141, miR-182, miR-183 and miR-96) in duplicate plates, incubated them for 2 days, and subjected one plate of cells to OGD, and the other plate of cells to normal culture conditiions as a control. [score:3]
miR-200 family and miR-182 family members of miRNAs indeed target various ULM and/or ULM related genes. [score:3]
MiR-182, miR-96, miR-200, miR-183 and miR-141 were among the most highly regulated miRNAs with a 13∼20-fold decrease during the torpor phase of the hibernation cycle. [score:2]
We also report that two miRNA families, miR-200 family (miR-200a/miR-200b/miR-200c/miR-141/miR-429) and miR-182 family (miR-182/miR-183/miR-96), which were consistently lower in the brain samples from torpor phase ground squirrels compared to active animals, are involved in expression of various ULM proteins and their global protein conjugation. [score:2]
30Liu Z, Liu J, Segura MF, Shao C, Lee P, et al. (2012) MiR-182 overexpression in tumourigenesis of high-grade serous ovarian carcinoma. [score:2]
In particular, two miRNA families, the miR-200 family (miR-200a, b, c, miR-496, and miR-141) and the miR-182 family (miR-182, miR-183 and miR-96) were consistently down regulated during torpor phase. [score:2]
Some functions of miR-182 family miRNAs that are not directly related to cancer have also been reported. [score:2]
We wondered whether the tolerance to in vitro “ischemia” by OGD in cultured cells (e. g. SHSY5Y) would change if miR-200 family and/or miR-182 family miRNA activity levels were reduced or increased. [score:1]
From the results of our microRNA array study of ground squirrel brain (comparing active and torpor phase), we found that most miRNAs were unchanged or increased during torpor phase, but certain miRNAs such as miR-200 family (miR-200a, -200b, -200c, -141, -429) and miR-182 family (miR-182, -183, -96) miRNAs were consistently decreased (Fig. 2A and Table S1). [score:1]
The order of endogenous levels of the microRNAs tested in SHSY5Y cells is miR-182>>miR-141≥miR-183>miR-200c. [score:1]
Members of the miR-182 family miRNAs, were also mainly described in cancer-related studies. [score:1]
[1 to 20 of 32 sentences]
8
[+] score: 106
Consequently, MCF-7 cells were transfected with pCMV-MIR182, pCMV-MIR223, and pCMV-MIR (=empty or scrumble vectors) to induce their overexpression and to analyze the protein expression of their targets, that is, IGF-1R, FOXO3A, and FOXO1A. [score:7]
In addition, pair-wise analyses revealed 42 common targets for miR-182 and miR-142-3p, 34 common targets for miR-182 and miR-223, and 7 common targets for miR-142-3p and miR-223 (Table S1, Fig. 2A). [score:7]
The most noteworthy novel finding was that in skeletal muscle, HRT use associates with down-regulation of miR-182, miR-223, and miR-142-3p, which modulate the expression of central players in the insulin/IGF-1 pathway, namely IGF-1R and FOXO3A. [score:6]
Estradiol regulates miR-182 and miR-223 expression and their identified targets leading to activation of insulin/IGF-1 signaling pathway in MCF-7 cells. [score:6]
Figure 4The effects of miR-182 and miR-223 over -expression on protein expression of IGF-1R, FOXO3A, and FOXO1A in MCF-7 cells. [score:5]
We found that miR-182 over -expression represses IGF-1R and FOXO3A in MCF-7 cells (P < 0.05), while the effects on FOXO1A protein expression were milder (Fig. 4A and B). [score:5]
Figure 6The effects of estrogen stimulation on the expression of miR-182, miR-223, and miR-142-3p and their targets in infant female quadriceps femoris-derived myoblasts. [score:5]
First, the down-regulation of miR-182 and miR-223 in the HRT users accorded with the higher mRNA and protein expression of IGF-1R, which in all likelihood leads to higher activity of the following PI3K/Akt-pathway in HRT users compared to nonusers. [score:5]
HEK-293 cells were transfected with 100 ng of pLUC, pLUC-182/223-target or pLUC-182/223-target- del, 0.9 μg of pCMV-MIR182/223 and pCMV-MIR, and 50 ng of pRL -null renilla luciferase. [score:5]
Identification of common pathways targeted by miR-182, miR-223, and miR-142-3p was obtained using the DIANA-microT 3.0 target prediction program (http://diana. [score:5]
FOXO3A and FOXO1A have been identified as direct targets for miR-182 (Guttilla & White, 2009; Segura et al., 2009). [score:4]
We found out that diaphragm muscle cells of young male mouse showed down-regulation of both miR-182 and miR-223 under exposure to 100 n m estradiol for 24 h (Fig. 7A) concomitantly with increased AKT phosphorylation (P < 0.05) (Fig. 7B). [score:4]
This is in line with our previous studies showing that postmenopausal HRT induces an up-regulation of genes belonging to the IGF-1 signaling cascade (Pöllänen et al., 2010; Ahtiainen et al., 2012a) and with other studies showing that miR-182 represses FOXO3A (Guttilla & White, 2009; Segura et al., 2009). [score:4]
The next day, the cells were transfected with pCMV-MIR182/223 and pCMV-MIR (OriGene) or mirVana™ miRNA inhibitors (Ambion, USA) hsa-miR-223 ID:MH12301 (miR-223 antagomir), anti-miR negative control #1 (Mock) (Fig 3). [score:3]
Western blot analysis of target proteins in MCF-7 cells transfected with p-CMV-MIR (empty vector) and p-CMV-MIR182. [score:3]
Previously, it has been shown that miR-182 over -expression represses FOXO1A and FOXO3A in breast cancer and melanoma cells, respectively (Guttilla & White, 2009; Segura et al., 2009). [score:3]
Putative pathways affected by miR-182, miR-223, and miR-142-3p are reported in Table 2. Among the putative target pathways, we found the insulin/IGF1 pathway (Fig. 2B). [score:3]
Table S1 Common targets for hsa-miR-142-3p (250 elements), hsa-miR-182 (841 elements) and hsa-miR-223 (202 elements). [score:3]
Validation by quantitative PCR (qPCR) confirmed that the expression levels of miR-182, miR-223, and miR-142-3p in the HRT users were approximately one-third of that of nonusers (P = 0.05, 0.001 and 0.003, respectively; Fig. 1C), while miR-142-5p and miR-451 were not significantly different between HRT users and their nonuser co-twins. [score:3]
In the present study, we demonstrated, using luciferase assay in HEK-293 cells, that IGF-1R also is a target for miR-182 (Fig. 3A). [score:2]
The plasmids used in the luciferase assays were generated by cloning oligonucleotides bearing wild-type (wt) or deleted (del) miR-182/223 target pairing site of IGF-1R, FOXO1A, and FOXO3A genes downstream of the stop codon in pMIR-REPORT-Luciferase (pLUC, Ambion Inc. [score:2]
As recently we reported that estrogen -based hormone therapy is associated with increased activity in the same pathway (Pöllänen et al., 2010; Ahtiainen et al., 2012a), we focused here on IGF-1R, FOXO3A, and FOXO1A, which in our analysis proved to be regulated by miR-182, miR-223, and miR-142-3p, as described in Fig. 2. Table 2Common pathways of miR-142-3p, miR-182, and miR-223. [score:2]
As recently we reported that estrogen -based hormone therapy is associated with increased activity in the same pathway (Pöllänen et al., 2010; Ahtiainen et al., 2012a), we focused here on IGF-1R, FOXO3A, and FOXO1A, which in our analysis proved to be regulated by miR-182, miR-223, and miR-142-3p, as described in Fig. 2. Table 2Common pathways of miR-142-3p, miR-182, and miR-223. [score:2]
MiR array data showed miR-142-3p, miR-142-5p, miR-223, miR-182, and miR-451 to be hypo-expressed in the HRT users compared to nonusers (Fig. 1B). [score:2]
In the present study, we confirmed that estrogen-regulated miRNAs, that is, miR-182, miR-223 and miR-142-3p, exist in skeletal muscle of postmenopausal women. [score:2]
Specifically, miR-182 and miR-223 participate in the modulation of the insulin/IGF-1 pathway signaling. [score:1]
Instead, we found two miRNAs, miR-182 and -223, participating in the main pathway of the body’s glucose homeostasis. [score:1]
MiR-223 and miR-182 modulate IGF-1R, FOXO1A, and FOXO3A protein levels. [score:1]
P-CMV-MIR182, p-CMV-MIR223, and p-CMV-MIR (empty vector) plasmids were shipped from OriGene (OriGene Technologies Inc. [score:1]
Each pLUC vector was co -transfected into the HEK293T cells with a plasmid-encoding Renilla luciferase along with a plasmid-encoding miR-182 or miR-223 or the empty vector. [score:1]
In addition to repressing FOXO3A, we showed, for the first time, that miR-182 also represses IGF-1R. [score:1]
To determine the effects of gain-of-function of miR-182/223, we used MCF-7 cells known to be highly responsive to E [2]. [score:1]
Note: The expression of miR-182 in these myoblasts was too low to be accurately measured. [score:1]
[1 to 20 of 33 sentences]
9
[+] score: 82
Other miRNAs from this paper: hsa-mir-96, mmu-mir-183, hsa-mir-182, hsa-mir-183, mmu-mir-96
In miR-183C [GT/GT] 5wk-retina, our hypergeometric analysis demonstrates that combined loss of all miR-183 cluster miRNAs results not only in enrichment (Odds Ratio 1.65–1.70, FDR-adjusted P < 0.05, Table  5) of miR-183 cluster targets in miR-183C [GT/GT] upregulated genes (uncorrected P < 0.05, fold change >+ 1.05), but also the reciprocal depletion of miR-96 and miR-182 targets (Odds Ratio 0.52, 0.58, respectively, FDR-adjusted P < 0.05, Table  5) in miR-183C [GT/GT] downregulated genes (uncorrected P < 0.05, fold change <−1.05). [score:11]
The effects mediated by miRNAs on inner ear morphogenesis, neurosensory cell identity, function and homeostasis indicate that gene regulation through miRNAs are critical to the biology of the inner ear 1– 6. The polycistronic cluster of Mir96, Mir182 and Mir183 genes are abundantly expressed in afferent cochlear and vestibular neurons and their peripheral innervating targets: auditory and vestibular hair cells (HCs) 7– 9. From an evolutionary viewpoint, the miR-183 cluster of miRNA genes are syntenic, highly conserved and co-expressed in neurosensory organs of animals representing several taxonomic phyla, suggesting that the control of gene expression through by this miRNA cluster is highly coordinated and under extraordinary selective pressure [10]. [score:10]
Similarly, Hes1 validates as a target of miR-96 and miR-182, with miR-96 downregulation of luciferase activity exceeding 20%. [score:6]
Taken together, the hypergeometric analysis of Tg [1MDW/1MDW] demonstrates that at P5 in the OC, miR-183 cluster target genes, defined by both miRNA and 3′UTR seed site evolutionary conservation, are reduced concomitantly with transgenic overexpression of miR-183, mir-96 and miR-182. [score:5]
We confirmed transgenic SC miR-183 cluster expression directly by dual whole mount ISH/IHC using LNA-DIG labeled probes against miR-182 and an antibody against MYO6 (Fig.   1A–D). [score:4]
To direct misexpression of miR-96, miR-182 and miR-183 in the SCs of the inner ear, we modified an established GFAP promoter -driven reporter construct (pGFA-nlac, Michael Brenner, UAB) by substituting the nLacZ gene with the miR-183 cluster coding sequences [23]. [score:4]
As expected, relative luciferase activity in cells co -transfected with miR-182 and reporter vector containing the Sox2 3′ UTR is reduced by nearly 20%, confirming previous findings that Sox2 is a miR-183 cluster target [9]. [score:3]
To test this hypothesis, we engineered Tg(GFAP- Mir183,Mir96,Mir182) (Tg [1MDW]) mice to drive ectopic miR-183 cluster expression using the core human promoter of the glial fibrillary acidic protein (GFAP). [score:3]
Also, in-situ hybridization (ISH) with an LNA-DIG labeled probe against miR-182 was consistent with RT-PCR, showing Bergmann glial cell localization in Tg [1MDW] cerebellum only, a common cell type expressing GFAP-core promoter transgenes [23] (Supplementary Figure  1B–D). [score:3]
However, further evidence of transgenic SC miR-183 cluster expression was obtained through quantitative RT-PCR, which showed 2.9-, 2.7- and 2.2-fold higher levels of miR-182, miR-96 and miR-183, respectively, in Tg [1MDW/1MDW] versus WT P18-cochlear total RNA (Fig.   1E). [score:3]
Figure 1Supporting cell (SC) expression of miR-182 in Tg [1MDW/1MDW] mice at P18. [score:3]
The spatiotemporal expression pattern of Mir96, Mir182 and Mir183 in the developing vertebrate inner ear and the effects induced by modulating levels of these miRNAs on HC fate determination in zebrafish and chicken argue that these miRNAs collectively function, to some degree, in the transition from inner ear prosensory cells towards a HC fate 8, 9, 11, 12. [score:3]
Irrespective of age, the most upregulated Affymetrix probesets were genetic elements of Tg [1MDW]: Mir183, Mir96, Mir182 and Prm1 (Fig.   5A,B, boxed probesets), with fold changes + 5.67 (P18- Prm1) to + 16.97 (P18- Mir182). [score:3]
Irrespective of age, the most upregulated Affymetrix probesets were genetic elements of Tg [1MDW]: Mir183, Mir96, Mir182 and Prm1 (boxed probesets). [score:3]
The miR-183/miR-96 PCR product was directionally cloned into the XmaI-EcoRV sites within the polycloning region of pIRES-hrGFPII (Stratagene) to create p183-X-E. The miR-182 PCR product was subsequently cloned into the EcoRV-NotI sites of p183-X-E to create p182-10. [score:2]
Line name FISH localization Intercross genotypes scoredMen delian ratio χ [2] P-valueTg genotype (log2 [−∆∆CT]) MGI submission # WT = 154 N/ATg [1MDW] Chr 9E3 Het = 240 0.017 5.9 ± 1.3 MGI:5436579 Homo = 113 10.6 ± 2.4 WT = 23 N/ATg [2MDW] Chr 16C1~3.1 Het = 36 0.40 7.5 ± 2.8 MGI:5436582 Homo = 25 15.6 ± 6.7 WT = 25 N/ATg [3MDW] Chr 16 A~B2 Het = 49 0.98 2.2 ± 0.3 MGI:5436584 Homo = 22 3.9 ± 0.7 FVB/NClr-Tg(GFAP- Mir183,Mir96,Mir182)1MDW miceSCs in the postnatal inner ear organ of Corti (OC) express endogenous GFAP and human GFAP-promoter driven GFP and LacZ reporters 21, 22. [score:2]
To determine whether miR-183, miR-182, or miR-96 directly regulate select SC genes important to HC/SC differentiation (i. e. Jag1, Sox2, Hes1, Notch1) dual luciferase assays were performed. [score:2]
In support of this idea, we detected a discrete number of apparent Deiters’ cells positive for both MYO6 and miR-182 at P18 (Fig.   3A,B, arrows). [score:1]
Cy5 fluorescence of tyramide enhanced miR-182 ISH labeling shows nuclear/cytoplasmic staining in hair cells (HCs A, B) and definitive Tg [1MDW/1MDW] OC SC nuclear staining, including Deiters’, inner pillar, outer pillar, inner phalangeal and inner border cells (B, arrowheads). [score:1]
HEK293 cells (~2 × 10 [5] cell/well; 24-well plate) were co -transfected using Lipofectamine 2000 (Invitrogen) with 200 ng reporter vector and 20 pmol synthetic RNA duplex representing scrambled control siRNA (Integrated DNA Technologies), miR-96, miR-182, or miR-183, or with 30 pmol combined miRNAs (10 pmol each). [score:1]
Arrows point to additional miR-182 positive, medially placed IHCs. [score:1]
Each were co -transfected in HEK293 cultures with synthetic RNA duplexes representing miR-96, miR-182, or miR-183 alone or in combination. [score:1]
Cy5 fluorescence of miR-182 used sheep anti-DIG-POD Fab antibodies (Roche) with a tyramine signal amplification kit (TSA Plus, Perkin Elmer). [score:1]
The miR-183, miR-96 and miR-182 levels were normalized to Sno135. [score:1]
SC labeling with miR-182 was found in spiral limbus cells and myelinated Schwann cells of spiral ganglion neurons (B, arrows). [score:1]
Whole-mount in situ hybridization (ISH) using LNA-DIG labeled probes against miR-182 was performed as previously described [7]. [score:1]
Spiral limbus and Schwann cell nuclei also were stained with LNA-miR-182, similar to other GFAP promoter driven transgenes (Fig.   1B, arrows, Smeti et al., 2011). [score:1]
Histograms of mean relative luciferase activity in HEK293 cells co -transfected with a dual reporter vector (pmirGLO) containing cloned DNA sequences corresponding to the 3′ UTR of the indicated genes plus synthetic miRNA duplexes representing miR-96, miR-182, miR-183, or all three (ALL) normalized to scrambled siRNA control (CTRL). [score:1]
The results quantitate statistically significant (ΔCT values, 2 sample t-test, P < 0.001) increases in miR-182 (2.9 fold), miR-96 (2.7 fold) and miR-183 (2.2 fold) in Tg [1MDW/1MDW] cochlea at P18. [score:1]
[1 to 20 of 29 sentences]
10
[+] score: 80
A longitudinal miRNA gradient may be significant for regulating gene expression, as microarray expression data revealed that predicted targets for both miR-182 and miR-96 were enriched in the basal (proximal) BP at P0, where the miRNA levels are lower [13]. [score:8]
AAVs encoding short hairpin RNAs that resemble pre-miR-183 and pre-miR-182 were injected into the retinas of DGCR8-conditional knockout mice in which miRNA biogenesis was blocked, leading to re -expression of miR-183 and miR-182 in Cre -expressing cone photoreceptors and prevention of the loss of outer segments and cone opsins [59]. [score:6]
The reductions obtained were 89% knockdown for the miR-96 reporter, 82% knockdown for the miR-182 reporter and 88% knockdown for the miR-183 reporter. [score:4]
Morpholino -mediated knockdown of the miR-183 family members decreased the number of HCs and otic neurons at 48 hours post fertilization (hpf), while overexpression of miR-96 or miR-182 resulted in ectopic and expanded sensory patches at 26 hpf [26]. [score:4]
At stage 30, both HCS-1 and miR-182 are now expressed in the HC layer, although HCS-1 expression extends through a larger number of cross-sections along the BP compared with miR-182. [score:4]
There is ectopic expression of miR-182 and miR-96 in the sensory and non-sensory epithelia and also in the vestibular and cochleolagenar ganglion neurons depicted in B, E, I and L. The signals detected by in situ hybridization are comparable to those shown by immunolabeling for GFP in nearby sections. [score:3]
Both miR-182 and miR-183 were reported to be broadly expressed in the E9.5 mouse otocyst, and present in both prosensory tissues and non-sensory domains in the E12.5 mouse cochlea [25]. [score:3]
Similar ectopic expression is observed for both miR-182 and miR-96 four days after plasmid electroporation. [score:3]
C: The expression of miR-182 in the cochlear duct at S31. [score:3]
In situ hybridization was used to detect the expression of mature miR-183, miR-96 and miR-182 on sections through the embryonic chicken inner ear at stages when nascent HCs are present in vestibular and auditory sensory organs (E5/S28 and E7/S31, respectively). [score:3]
Expression of miR-182 in cross sections through the basilar papilla at S43. [score:3]
miR-182 is expressed in HCs and ganglion neurons of inner ear at S28 and S31. [score:3]
Parallel staining of miR-182 and HCS-1 at S29 and S30 (n = 4 ears from 2 embryos at each stage, S4 Fig) suggests that HCS-1 expression in immature HCs begins slightly earlier than miR-182. [score:3]
The 3 members of the miR-183 family (miR-183, miR-96, miR-182) are processed from a single primary transcript [20, 21] and are expressed in sensory cells in mice and zebrafish [20, 22, 23]. [score:3]
In the zebrafish inner ear, overexpression of miR-96 or miR-182 induced ectopic sensory patches and extra HCs at 26 hpf [26]. [score:3]
At S31-32, faint expression of miR-182 was evident in and adjacent to the prosensory domain at the base (proximally), but only on the neural side (n = 7/7 ears from 5 embryos). [score:3]
0132796.g001 Fig 1 (A) of miR-182 shows its presence in cristae and maculae at S28. [score:1]
The LNA probes used were dre/hsa-miR-183, hsa-miR-96 and dre-miR-182. [score:1]
There is weak labeling of a few HCS-1+ cells near the luminal surface of the BP at the apex at S29, whereas miR-182 is not yet detectable in adjacent sections. [score:1]
Weak HCS-1+ HCs are observed at the apex of the BP at S29, but miR-182 is not detected in adjacent sections. [score:1]
Genomic sequences from the murine miR-183/96 and miR-182 loci were fused and placed within an artificial intron, which is located downstream of the EGFP reporter gene. [score:1]
Using a luciferase assay, Weston and colleagues found that the 3’UTR of murine Sox2 mRNA was a target of miR-182 in vitro [24], although we did not find a comparable result for the 3’UTR of human Sox2 mRNA using a luciferase assay [51]. [score:1]
In the apical (distal) BP at the same stage, all three members of the miR-183 family were detected in nascent HCs (Fig 1C for miR-182; S2 and S3 Figs). [score:1]
This difference in hybridization signal has also been reported in the mouse retina, as the level of miR-182 was highest and miR-96 was lowest [20]. [score:1]
Moreover, miR-182 failed to show a longitudinal gradient at even earlier stages S35–S36 (n = 2 embryos). [score:1]
The sequence of miR-96 is fully conserved between these species, while miR-182 and miR-183 differ by 1–3 nucleotides at their 3’ ends, but are otherwise identical. [score:1]
miR-96 is conserved among the four species, while miR-182 and miR-183 show differences in the last few nucleotides at their 3’ ends. [score:1]
Parallel staining of miR-182 and HCS-1 at S29–S31. [score:1]
Here, hsa-miR-96/182/183, mmu-miR-96/182/183 and dre-miR-182 stand for hsa-miR-96/182/183-5p, mmu-miR-96/182/183-5p and dre-miR-182-5p, respectively. [score:1]
The miRNA reporters, composed of two complementary miRNA binding sites (to either miR-183, miR-96, or miR-182) housed downstream of the Renilla luciferase gene, were co -transfected into DF-1 cells with pGFP-183F or pGFP. [score:1]
S1 Fig miR-96 is conserved among the four species, while miR-182 and miR-183 show differences in the last few nucleotides at their 3’ ends. [score:1]
Among the gene sets with miRNA recognition sites statistically over-represented at the high-frequency end were those predicted to bind miR-182 and miR-96. [score:1]
Alternate sections are processed for detection of miR-182 or miR-96 by in situ hybridization, or immunostained for GFP and HCS-1 (to detect HCs) as indicated on the panels. [score:1]
Gallus gallus mature miR-183 (gga-miR-183) sequence was obtained from miRBase while the miR-182 and miR-96 sequences were obtained from published Gallus gallus short RNA sequencing reads [31]. [score:1]
Also, foci of stronger miR-182 signal in the vestibular ganglion correspond to regions showing GFP+ cells. [score:1]
Both HCS-1 and miR-182 are detectable at S30. [score:1]
Within each section, there was no obvious qualitative difference in miR-182 signal intensity between THCs on the neural side and SHCs on the abneural side. [score:1]
[1 to 20 of 37 sentences]
11
[+] score: 79
Other miRNAs from this paper: mmu-mir-10b, mmu-mir-183, mmu-mir-96
In the hippocampus, pre-miR-183 and pre-miR-182 were upregulated in the nuclear fraction and downregulated in the cytoplasmic fraction (Fig. 2a,b). [score:7]
We examined if HDAC9 is a direct target of miR-183/96/182 using a luciferase -based expression system containing a predicted miR-182 binding site of HDAC9 3′UTR. [score:6]
Our finding that miR-183/96/182 overexpression improves memory differs from a previous report showing that miR-182 overexpression impairs long-term auditory fear memory and that its level is lower in the lateral amygdala after auditory fear conditioning 22. [score:5]
Interfering with miR-182 targeting of HDAC9 in mice overexpressing miR-183/96/182 cluster significantly reduced object exploration during training and testing under the weak NOR protocol, without affecting overall locomotion or novel object discrimination (Fig. 7a–e). [score:5]
Upon miR-182 transfection, we observed destabilization of the construct, indicating targeting of the predicted HDAC9 target site by miR-182 (Fig. 6b). [score:5]
We observed that processing of both pri-miR-183 and pri-miR-182, but not a control pri-miR-10b, was significantly increased upon inhibition of nuclear PP1 by NIPP1 overexpression (Fig. 3b–d). [score:5]
For validation of HDAC9 targeting by miR-182, the same vector system and cloning strategy as described above was used (with the exception that HDAC9 3′UTR sequence containing miR-182 target site was amplified from genomic DNA using the following primers and inserted into the vector: hdac9_F1_NheI-GGCATAgctagcAGGATATGTGCCAGGCAGTC, hdac9_R1_SaII-CGCTTAgtcgacAATGGGCGTCATTGTTCTTC). [score:4]
The reason for this difference is unknown but may result from differential regulation of miR-183/96/182 or miR-182 in the cluster in different brain areas, and/or their action on different targets. [score:4]
Some of the miRNAs identified by deep sequencing were similarly upregulated in an independent set of experiments in both non-trained NIPP1* mice (c, miR-183: controls, n=11; NIPP1*, n=11; t20=2.19, * P<0.05; miR-182: controls, n=11; NIPP1*, n=11; t20=2.68, * P<0.05); and control mice trained on NOR (d; miR-183: non-trained, n=12; trained, n=13; t23=2.07, * P⩽0.05; miR-182: non-trained, n=13; trained, n=13; t24=2.32, * P<0.05). [score:4]
Quantitative polymerase chain reaction (qPCR) confirmed a consistent increase (about 50%) in miR-183 and miR-182, while miR-96 was expressed at low level (Fig. 1c,d). [score:3]
To interfere with miR-182-HDAC9 binding, custom designed miRCURY LNA microRNA Power Target Site Blockers were obtained from Exiqon. [score:3]
Further, disrupted hippocampal miR-182 signalling has been linked to changes in gene expression observed in schizophrenia and other mental illnesses 50. [score:3]
e. m. (a) Pre-miR-183/96/182 expression in the nuclear fraction of the hippocampus from NIPP1* and control mice (pre-miR-183: controls, n=11; NIPP1*, n=11; t20=2.12, * P<0.05; pre-miR-182: controls, n=11; NIPP1*, n=11; t20=2.92, ** P<0.01). [score:3]
To further evaluate the importance of HDAC9 targeting by miR-183/96/182, we interfered with miR-182/ HDAC9 interaction in vivo by injecting locked nucleic acid (LNA) modified target site blockers (TSB) (Supplementary Fig. 14). [score:3]
Effect of miR-182/HDAC9 TSB on NOR performance in mice overexpressing miR-183/96/182. [score:3]
This effect of ActD is prevented by PP1γ knockdown (e: miR-183, t4=1.68, P=0.17; mir-96, t4=0.20, P=0.85; miR-182, t4=2.09, P=0.10). [score:2]
PP1γ knockdown increased the level of miR-183 and miR-182 (Supplementary Fig. 6b), confirming that nuclear PP1 is implicated in the synthesis of these miRNAs. [score:2]
Further studies on the interaction between miR-182 and HDAC9 may shed light on the regulation of cognition and cognitive disorders. [score:2]
The scAAV2-EF1a-pri-miR-183/96/182-GFP allowed the generation of mature miR-183-5p, miR-96-5p and miR-182-5p sequences annotated in miRBASE v. 20 (www. [score:1]
These findings are relevant for cognitive functions beyond those assessed with our mo del, since both miR-182 and HDAC9 have also been implicated in schizophrenia. [score:1]
e. m. (a) Mature miRNAs level is lower 0.5 h after KCl treatment (miR-183: t4=1.66, P=0.17; miR-96: t4=2.28, [#] P<0.1; miR-182: t4=7.2, ** P<0.01). [score:1]
Briefly, fragments of pri-mir-182 and pri-mir-183, and the control pri-miR-10b, containing the hairpin and 100 bp flanking sequence were amplified from genomic DNA. [score:1]
Control scAAV2-EF1a-control-GFP construct contained fragment of beta-globin intron (sequence from pEGP-mmu-miR-182 plasmid; Cell Biolabs) of length corresponding to T-pri-miR-183/96/182. [score:1]
The sequences are: miR-182/HDAC9 TSB: TTTGGCAAAAGTGCTA; negative control TSB: ACGTCTATACGCCCA. [score:1]
Interfering with the interaction between miR-182 and HDAC9 alters object exploration, without affecting long-term memory. [score:1]
The transgene cassette containing Ef1a promoter (sequence from pEGP-mmu-miR-182 plasmid; Cell Biolabs), engineered truncated (T)-pri-miR-183/96/182, EGFP (from pEGP-mmu-miR-182 plasmid; Cell Biolabs), WPRE motif and 5′-BalI and 3′-NotI adaptors was chemically synthesized by GENEWIZ (South Plainfield, USA) and cloned into the scAAV backbone. [score:1]
Controls, n=9; miR-182/HDAC9 TSB, n=8. [score:1]
Dual-luciferase reporters with pri-mir-182 and pri-mir-183 were transfected in N2a cells using cationic liposomes (Lipofectamine 2,000 reagent, Invitrogen). [score:1]
[1 to 20 of 28 sentences]
12
[+] score: 78
MRL-Fas [lpr]/J mice, and the expression levels of miR-96-5p and miR-182-5p showed strong positive correlations with some SLE parametersTo examine whether ASC or cyclophosphamide treatment can modify disease -associated miRNAs, we compared the expression levels of the common lupus disease -associated miRNAs between the different treatment groups. [score:8]
The upregulation of miR-96 and miR-182 may downregulate Foxo1/3a 30 31, leading to the breakdown of T cell tolerance 34 35. [score:7]
Relationships between miR-96-5p expression level and other SLE parameters and between miR-182-5p expression level and other SLE parameters. [score:5]
Cyclophosphamide treatment led to significantly lower miR-96-5p, miR-182-5p, and miR-379-5p expression and significantly higher miR-150-5p expression relative to the saline -treated C3. [score:5]
In the results of the splenocytes from the MRL/lpr mice, ASC treatment did not change the miR expression significantly, but cyclophosphamide treatment decreased the expression of miR-31-5p, miR-96-5p, miR-127-3p, miR-182-5p, miR-183-5p, and miR-379-5p significantly compared with the saline-treatment. [score:4]
The expression level of miR-182-5p also showed a strong negative correlation with percentage of CD4+ CD25+ Foxp3+ cells (Pearson’s correlation, Table 1). [score:3]
In splenocytes from the MRL-lpr mice (the samples in our previous study), the expression levels of miR-18a-5p, miR-31-5p, miR-96-5p, miR-127-3p, miR-182-5p, miR-183-5p, and miR-379-5p were significantly higher, while those of miR-101a-3p and miR150-5p were significantly lower in the C group than in the N group. [score:3]
MRL-Fas [lpr]/J mice, and the expression levels of miR-96-5p and miR-182-5p showed strong positive correlations with some SLE parameters. [score:3]
The expression levels of miR-31-5p, miR-96-5p, miR-127-3p, miR-182-5p, miR-183-5p, and miR-379-5p 5p in the Y group were significantly lower than in the C group (Supplementary Fig. 3). [score:3]
A decrease in miR-96-5p and miR-182-5p expression as well as a decrease in the CD138 proportion and Th1/Th2 ratio might be involved in the mechanisms of therapeutic effects of ASCs in C3. [score:3]
The expression levels of miR-96-5p, miR-182-5p in the H group were significantly lower than in the C group (Fig. 4). [score:3]
The expression levels of miR-31-5p, miR-96-5p, miR-182-5p, miR-183-5p, and miR-379-5p were significantly higher, while those of miR150-5p were significantly lower in C3. [score:3]
The expression levels of miR-96-5p, miR-182-5p, and miR-379-5p were significantly lower, while those of miR150-5p were significantly higher in the Y group than in the C group. [score:3]
Thus, a decrease in miR-96-5p and miR-182-5p expression by ASC or cyclophosphamide treatment might result in reducing the breakdown of T cell tolerance and decreasing the production of autoantibodies, which are thought to be involved in the therapeutic mechanism. [score:3]
Relationships between miR-182-5p expression level and the other SLE parameters analyzed in this study were also examined. [score:3]
The expression levels of miR-31-5p, miR-96-5p, miR-182-5p, miR-183-5p, and miR-379-5p were significantly higher, while those of miR150-5p were significantly lower in the C group than in the N group. [score:3]
The expression level of miR-96-5p showed strong positive correlations (r > 0.7) with SLE parameters of miR-182-5p, spleen weight, lymph node weight, spleen weight/body weight, lymph node weight/body weight, glomerular C3 deposition, anti-dsDNA antibody levels (at 40 weeks of age), percentage of CD138 + cells, percentage of T-bet+ of CD4+ CD25+ cells, and Th1/Th2. [score:3]
The expression level of miR-182-5p showed strong positive correlations with SLE parameters of miR-96-5p, spleen weight, lymph node weight, spleen weight/body weight, glomerular C3 deposition, percentage of CD138+ cells, percentage of T-bet+ of CD4+ CD25+ cells, and Th1/Th2. [score:3]
ASC or cyclophosphamide treatment restored the expression levels of miR-96-5p and miR-182-5p in C3. [score:3]
A representative gating scheme and representative dot plots are presented in Supplementary Fig. 2. ASC or cyclophosphamide treatment restored the expression levels of miR-96-5p and miR-182-5p in C3. [score:3]
ASC treatment also led to significantly lower miR-96-5p and miR-182-5p expression compared with the saline -treated C3. [score:2]
There was strong correlation between miR-96-p5 and the SLE parameters of miR-182-5p, spleen weight, lymph node weight, spleen weight/body weight, lymph node weight/body weight, glomerular C3 deposition, anti-dsDNA antibody levels (at 40 weeks of age), percentage of CD138+ cells, percentage of T-bet+ of CD4+ CD25+ cells, Th1/Th2, and percentage of CD4+ CD25+ Foxp3+ cells. [score:1]
There was also strong correlation between miR-182-p5 and some SLE parameters. [score:1]
[1 to 20 of 23 sentences]
13
[+] score: 76
Some miRNAs were overexpressed in tumors (miR-155, miR-193b, miR-27a, miR-31, miR-99b, miR-484, miR-574-3p, miR-125a-5p, miR-182), whereas others displayed down-regulation (miR-20a, miR-200c, miR-93, miR-340-5p, miR-720) or a comparable level of expression (miR-200a) with respect to non tumor tissues. [score:8]
A number of dysregulated microRNAs in this mo del were already described in the pathogenesis of liver disease and showed concordant level of expression with respect to that already described in literature (miR-155, miR-20a, miR-182, miR-200a, miR-200c, miR-27a, miR-31, miR-99b) or discordant expression level (miR-193b, miR-93, miR-125a-5p). [score:8]
Several studies demonstrated miR-182 involvement in HCC and metastasis, by controlling the expression of genes with tumor suppressor activity, such as the metastasis suppressor MTSS1 [94], Cebpa [95], ephrinA5 [96], and FOXO1 [97]. [score:7]
Our data demonstrate early involvement of miR-182 in the transition of liver injury, which is maintained up to HCC initiation and development, indicating that early deregulation of this microRNA could be one among the factors putatively responsible for the hepatic disease here represented, and for its progression. [score:5]
Wang J Li J Shen J Wang C Yang L Zhang X MicroRNA-182 downregulates metastasis suppressor 1 and contributes to metastasis of hepatocellular carcinomaBMC Cancer. [score:5]
Wang C Ren R Hu H Tan C Han M MiR-182 is up-regulated and targeting Cebpa in hepatocellular carcinomaChin J Cancer Res. [score:5]
MiR-182 was also down-regulated in fibrosis related to NAFLD, where FOXO3 was described as a target [98]. [score:5]
MiR-182 showed marked over -expression, as detected already after 3 months of treatment, whereas miR-125a-5p was always down-regulated in HF compared to LF tissues. [score:5]
Among them, miR-340-5p, miR-484, miR-574-3p, miR-720, whose expression was never described in NAFLD, NASH and HCC tissues, and miR-125a-5p and miR-182, which showed early and significant dysregulation in the sequential hepatic damage process. [score:4]
Interestingly, two miRNAs (miR-125a-5p and miR-182) showed significant early dysregulation, indicating a putative role and involvement starting from the first stages of the liver disease. [score:4]
OncomiR miR-96 and miR-182 promote cell proliferation and invasion through targeting EphrinA5 in hepatocellular carcinoma. [score:3]
Significant miR-182 over -expression was observed in 12 months HF mice (Fig.   6c). [score:3]
MammU6 was used as endogenous control Fig. 6Differential expression of miR-125a-5p and miR-182 in livers and tumors, at the individual level. [score:3]
To assess the strength of data shown in Fig.   5, the expression levels of miR-125a-5p and miR-182 were analyzed in individual livers from HF and LF diet fed mice through experimental time points and in tumors. [score:3]
Significant miR-182 over -expression was detected in 3 months and, although less pronounced and not statistically significant, in 6 months HF diet fed mice (Fig.   6c). [score:3]
MiR-182 showed over -expression already after 3 months of HF diet, and this trend was markedly maintained in mice, also at the individual level, during the treatment and in tumors. [score:2]
MiR-182/ Cebpa/ephrinA5/FOXO1/FOXO3 alignments can be also predicted on Mus musculus, putatively indicating a role of miR-182 in the regulation of those genes. [score:2]
MiR-125a-5p and miR-182 expression was evaluated by taking into consideration a LF reference sample belonging to the same group (Fig.   6). [score:1]
[1 to 20 of 18 sentences]
14
[+] score: 68
Their respective sequences are: miRCURY LNA™ miRNA Inhibitor Negative Control A: GTGTAACACGTCTATACGCCCA; miRCURY LNA™ miR-183 inhibitor: AGTGAATTCTACCAGTGCCAT; miRCURY LNA™ miR-96 inhibitor: GCAAAAATGTGCTAGTGCCAA; miRCURY LNA™ miR-182 inhibitor: TGTGAGTTCTACCATTGCCAA. [score:9]
Compared with EV, overexpression of GSK3β inhibited the expression of miR-96, miR-182 and miR-183 by 2-fold (P < 0.05) (Figure 2D). [score:6]
miR-182 increases tumorigenicity and invasiveness in breast cancer by targeting the matrix metalloproteinase inhibitor RECK (29). [score:5]
Our results showed that both the primary and mature miR-96, miR-182, miR-183 expression levels were significantly upregulated in gastric cancer tissues compared with the adjacent normal control gastric tissues. [score:5]
To investigate the effects of suppression of miR-183-96-182 cluster on gastric cancer cell phenotype, we transfected a miRCURY LNA™ miRNA Inhibitor Negative Control or a mix of miRCURY LNA™ inhibitors for miR-183, miR-96 and miR-182 into AGS cells. [score:5]
Kong et al. (31) found that miR-182 was significantly downregulated in human gastric adenocarcinoma tissue samples. [score:4]
Li et al. (32) reported that miR-96, miR-182 and miR-183 were all upregulated in intestinal-type gastric cancers. [score:4]
Since GSK3β inhibits the expression of miR-96, miR-182 and miR-183 in human gastric epithelial AGS cells, we measured the protein levels of GSK3β and β-Catenin by western blot and miR levels of miR-96, miR-182 and miR-183 by quantitative RT-PCR (qRT-PCR) in eight gastric cancer and matched normal gastric tissue samples. [score:3]
Figure 6. β-Catenin enhances expression of primary and mature miR-96, miR-182 and miR-183. [score:3]
β-Catenin enhances expression of primary and mature miR-96, miR-182 and miR-183. [score:3]
Expression levels of GSK3β, β-Catenin, miR-96, miR-182, miR-183 and primary miR-183-96-182 cluster in human gastric cancer. [score:3]
Overexpression of β-Catenin increased the levels of primary and mature miR-96, miR-182 and miR-183 by 5-fold (Figure 6A and B). [score:3]
Figure 3. Expression levels of GSK3β, β-Catenin, miR-96, miR-182, miR-183 and pri-miR-183 in human gastric cancer. [score:3]
The miR array data revealed that they were increased 6-, 5- or 3-fold, respectively (Table 1 and Figure 2C), suggesting that GSK3β may suppress the generation of miR-96, miR-182 and miR-183. [score:3]
Surprisingly, the primary miR-183-96-182 cluster (pri-miR-183) levels were higher in gastric cancer tissues than that in the matched normal tissues, indicating that GSK3β regulates the production of miR-96, miR-182 and miR-183 through β-Catenin at the transcription level. [score:2]
On the other hand, knockdown of β-Catenin by specific siRNA decreased the primary and mature miR-96, miR-182 and miR-183 levels by 3-fold (Figure 6C and D). [score:2]
We measured pri-miR-183 and mature miR-96, miR-182, miR-183 expression levels in gastric cancer and matched normal gastric tissue by qRT-PCR. [score:1]
The levels of miR-96, miR-182 and miR-183 in gastric cancer were increased by 2-fold (Figure 3C). [score:1]
Of the miRs that were increased the most by GSK3β KO, miR-96, miR-182 and miR-183 are all from the same miR gene cluster. [score:1]
The products of miR-183-96-182 cluster gene, miR-183, miR-96 and miR-182, play important roles in a variety of cancers. [score:1]
The gene encoding miR-96, miR-182 and miR-183 locates to human chromosome 7q32.2. [score:1]
[1 to 20 of 21 sentences]
15
[+] score: 67
As miR-96 and miR-182 target the same conserved target site (TargetScan) 4 at the Rac1 3′UTR (Fig. 3g), the corresponding miRNA enrichment values were summed to reflect combined usage of the miR-96/182 target site, which was ~8.7-fold with both detection methods (Fig. 4c). [score:9]
In silico miRNA Target Selection PipelineTarget sites for mmu-miR-1a-3p (miR-1), miR-133a-1 (miR-133), miR-142a-3p (miR-142), miR-183-5p (miR-183), miR-96-5p (miR-96) and miR-182-5p (miR-182) were predicted employing Diana-microT (v. 3.0) 61, miRanda (Aug 2010 release) 62 and TargetScan tools (v. 6.2) 4, and filtered for sites predicted by at least two prediction tools. [score:7]
Pre-miRNAs reduced luciferase expression from 3′UTR constructs with corresponding predicted target sites by ~50–60% (Fig. 3h), except for the miR-182-Slc6a9 3′UTR combination, which showed no suppression (Fig. 3h). [score:7]
Considerable overlap among miR-183, miR-96 and miR-182 target genes was observed; e. g. 21 targets were potentially co -targeted by miR-96 and miR-182 (Supplementary Table S3). [score:7]
As miR-96 and miR-182 target the same site (TargetScan) 4, the combined miR-96 and miR-182 levels are also given (miR-96/182 target site). [score:7]
In vitro 3′UTR assays confirmed miR-96 targeting of Slc6a9, while miR-182 (a target site with lower conservation) did not suppress Slc6a9 (Fig. 3h). [score:6]
Target sites for mmu-miR-1a-3p (miR-1), miR-133a-1 (miR-133), miR-142a-3p (miR-142), miR-183-5p (miR-183), miR-96-5p (miR-96) and miR-182-5p (miR-182) were predicted employing Diana-microT (v. 3.0) 61, miRanda (Aug 2010 release) 62 and TargetScan tools (v. 6.2) 4, and filtered for sites predicted by at least two prediction tools. [score:5]
As the protein level of Slc6a9 was increased by ~70% in R347 versus wt retinas (Table 2), the data predicted that miR-96 and miR-182 may target Slc6a9. [score:3]
A significant overlap between miR-96 and miR-182 targets was established involving enriched pathways for solute carrier -mediated transmembrane transport and Robo receptor signaling. [score:3]
Specifically, 23, 10, 6, 18, 35 potential target genes were identified for miR-1, miR-133, miR-142, miR-183, miR-96 and miR-182, respectively (Supplementary Table S3). [score:3]
miR-96 and miR-182 levels were ~50% lower (Table 2) 12, while Rac1 protein levels were markedly higher (~3.4-fold, LC-MS/MS) in whole retina samples in R347 versus wt mice (Table 2), suggesting a potential miR-96/miR-182-Rac1 mRNA regulatory axis. [score:2]
Pathways potentially regulated by miR-96 exclusively included execution of apoptosis and integrin mediated cell adhesion (Fig. 2b); whereas those identified for miR-182 comprised transmembrane transport of small molecules, G-protein signaling, synaptic transmission and cell-adhesion (Fig. 2b). [score:2]
As the increase in Rac1 protein level in whole retina samples was more significant, we opted to further analyse the miR-96/miR-182-Rac1 mRNA regulatory axis. [score:2]
Additionally, using miR-CATCH (Fig. 4) 27, we established that both miR-96 and miR-182 interact with Rac1 in vivo in retina. [score:1]
Apart from the conserved miR-96/182 site, two additional miR-96, four additional miR-182 (combined and unique) and two miR-183 sites were identified for the miR-183/96/182 cluster (Fig. 4d and Table 3a). [score:1]
The level of both miR-96 and miR-182 increased significantly (~3-5-fold) in Rac1-capture versus scrambled control samples using both detection techniques (Fig. 4c). [score:1]
Synthetic pre-miRNAs for mmu-miR-1a-3p (PM10617), mmu-miR-96-5p (PM10422), mmu-miR-182-5p (PM13088) and negative control were procured from Ambion (Thermo Fisher Scientific). [score:1]
[1 to 20 of 17 sentences]
16
[+] score: 66
Other miRNAs from this paper: mmu-mir-29b-1, mmu-mir-29a, mmu-mir-29c, mmu-mir-29b-2
Finally, we identified Nogo-C is a target gene of miR-182, which negatively regulated Nogo-C and is downregulated during MI. [score:7]
In vitro expression of miR-182 reduced Nogo-C protein level and Nogo-C 3′-UTR luciferase reporter activity, confirming our prediction that miR-182 negatively regulates Nogo-C expression. [score:6]
Together, our results indicate that miR-182 has an important role in hypoxia-related cardiac diseases through negatively regulating Nogo-C expression. [score:6]
Overexpression of miR-182 dramatically reduced Nogo-C protein expression in cardiomyocytes (Figures 5d and e). [score:5]
In silico analysis predicted that miR-182 targets the 3′ untranslated region (3′UTR) of Nogo-C (Figure 5a). [score:5]
Furthermore, we identified that miR-182 is a negative regulator of Nogo-C, and downregulation of miR-182 may contribute to the increased Nogo-C and cardiac dysfunction during MI. [score:5]
Moreover, the expression of miR-182 was decreased in the border zone of infarct heart and in hypoxic cardiomyocytes, suggesting that miR-182 may be involved in the pathological processes of MI and ischemic heart diseases. [score:5]
Although overexpression of Nogo-C or treatment of CoCl [2] induced cardiomyocyte apoptosis, the overexpression of miR-182 protected cells from either Nogo-C or CoCl [2] -induced apoptosis, as assayed by flow cytometry (Figure 5g). [score:4]
Importantly, miR-182 expression was significantly decreased in the heart during MI (Figure 5b) or in CoCl [2] -treated cardiomyocytes (Figure 5c). [score:3]
In addition, miR-182 decreased Nogo-C 3′-UTR luciferase reporter activity (Figure 5f), further confirming that Nogo-C is a target gene of miRNA-182. [score:3]
MiR-182 negatively regulated Nogo-C expression during MI. [score:3]
[43] Controversially, miR-182 showed tumor-suppressive function in some cancers such as glioblastoma, [44] whereas displayed ongogenic function in other cancers such as lung adenocarcinoma. [score:3]
[34] In the current study, we predicted, according to the 3′UTR region of Nogo-C, that Nogo-C is a target gene of miR-182. [score:3]
MiR-182 has been reported to participate in the regulation of multiple physiological and pathological processes including retinal development and degeneration, 35, 36 cancers, 37, 38, 39, 40 inflammation, 41, 42 and cardiac hypertrophy. [score:2]
The sequence of rno-mir-182 was 5′-ACGCGGGUCUAGCUGCCGGAGGCCUCCCACCGUUUUUGGCAAUGGUAGAACUCACACCGGUA-3′. [score:1]
To test if miR-182 had a role in Nogo-C -induced cardiomyocyte apoptosis, cardiomyocytes were co -transfected with miR-182 and Ad-Nogo-C, or transfected with miR-182 in the presence of CoCl [2]. [score:1]
It is unclear why miR-182 functions differentially on cell growth or apoptosis in cancers or in the heart, tissue specific effect might be a possible reason for this discrepancy. [score:1]
Rno-mir-182 mimics (Guangzhou RiboBio) were transfected to rat neonatal cardiomyocytes with Lipofectamine 3000 (Invitrogen). [score:1]
Hela cells were co -transfected with 100 ng Nogo-C 3′UTR reporter plasmid and 2  μg rno-miR-182 mimic or empty vector. [score:1]
[45] In our study, we found that miR-182 protected cardiomyocytes from Nogo-C and hypoxia -induced apoptosis. [score:1]
[1 to 20 of 20 sentences]
17
[+] score: 54
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The reduction of Cxcr3, Fut1, and Rhobtb1 expression was associated with an increased expression of miR-148b, miR-125a, and miR-182, which target Cxcr3, Fut1, and Rhobtb1 mRNAs, respectively, suggesting that, in addition to Aicda and Prdm1, which are already downregulated by HDI, other genes can also be downregulated by HDI through upregulation of their targeting miRNAs. [score:18]
Like miR-182, miR-96, which, based on its sequence, could target all putative miR-182 targeting sites, is also highly expressed by B cells induced to undergo CSR and plasma cell differentiation (Figure 8), would compensate the function of miR-182. [score:7]
Figure 8The Prdm1 targeting miRNAs miR-23b, miR-125a, miR-351, miR-30a/c/d, miR-182, miR-96, miR-98, miR-200b/c, and miR-365 are upregulated by HDI. [score:6]
In addition to miR-23b, miR-30a, and miR-125b, which, as we showed by qRT-PCR and miRNA-Seq, are upregulated by HDI, several other putative Prdm1 targeting miRNAs, including miR-125a, miR-96, miR-351, miR-30c, miR-182, miR-23a, miR-200b, miR-200c, miR-365, let-7, miR-98, and miR-133, were also significantly increased by HDI. [score:6]
Because the precursors of miR-96, miR-182, and miR-183 are transcribed as a single transcript, these findings further support the contention that HDI modulate miRNA expression through regulation of their primary transcript (16). [score:4]
org, in both mouse and human, miR-182 and miR-96 can potentially target Prdm1/PRDM1 3′ UTR at the same site (Figure 8). [score:3]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
In B cells stimulated with LPS plus IL-4, miR-182, miR-96, and miR-183 were all highly expressed. [score:3]
miR-182, miR-96, and miR-183 belong to a polycistronic miRNA cluster that is located within a 4-kb area on mouse chromosome 6q. [score:1]
miR-182 has been identified as the miRNA induced at a high level in B cells stimulated to undergo CSR (60); however, deficiency of this miRNA did not significantly alter the titers of total serum IgM, IgG1, IgG2a, IgG2b, IgG3, IgA, and IgE, and NP -binding IgG1 in mice immunized with NP-CGG (60). [score:1]
miR-182 is a member of the miR-183~182 cluster which includes miR-96, miR-182, and miR-183. [score:1]
These miRNA siblings share similar seed sequences; in fact, the seed sequences of miR-96 and miR-182 are identical. [score:1]
[1 to 20 of 12 sentences]
18
[+] score: 45
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-29a, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-181a-2, mmu-mir-183, mmu-mir-194-1, mmu-mir-200b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-140, hsa-mir-194-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-29a, mmu-mir-96, mmu-mir-34a, mmu-mir-135b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-376c, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-135b, mmu-mir-181b-2, mmu-mir-376b, dre-mir-34a, dre-mir-181b-1, dre-mir-181b-2, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-15a-1, dre-mir-15a-2, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-29a, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-181c, dre-mir-194a, dre-mir-194b, dre-mir-200b, dre-mir-200c, hsa-mir-376b, hsa-mir-181d, hsa-mir-507, dre-let-7j, dre-mir-135b, dre-mir-181a-2, hsa-mir-376a-2, mmu-mir-376c, dre-mir-34b, dre-mir-34c, mmu-mir-181d, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, mmu-mir-124b
Wang et al. (2012) miR-96, miR-182 Chloride intracellular channel 5 (Clic5) Co -expression in mouse auditory HEI-OC1 cells; luciferase assay in A549 cells; down-regulation of target. [score:7]
In the presence of miR-182, the mRNA levels of Tbx1 were restored as compared to infected cells, suggesting target inhibition. [score:4]
Therefore the tightly regulated transcriptional regulation of Tbx1 in the mammalian ear may be influenced in part by miR-182, providing a function in crucial inner ear developmental pathways. [score:4]
Expression patterns of miR-96, miR-182 and miR-183 in the development inner ear. [score:4]
After confirming direct binding between miR-182 and the Tbx1 3′UTR by luciferase assay, degradation of the target on an mRNA level was tested (Wang et al., 2012). [score:3]
To demonstrate that miR-182 is a direct target of Sox2, a luciferase assay was performed both with a luciferase reporter vector with the 3′UTR of Sox2 and a mutated version of the 3′UTR at the seed region of miR-182 (Weston et al., 2011). [score:3]
Clic5, a chloride intracellular channel that is associated with stereocilia in the inner ear, was identified as a target of both miR-96 and miR-182 (Gu et al., 2013). [score:3]
Isolated IHC infected with rA-miR-182 and transfected miR-182 inhibitor were collected and harvested to explore Tbx1 transcription. [score:3]
Moreover, the transcription factor Tbx1 was found to be a target of miR-182. [score:3]
MicroRNA-182 regulates otocyst-derived cell differentiation and targets T-box1 gene. [score:3]
Targeted deletion of miR-182, an abundant retinal microRNA. [score:3]
In a study on cells derived from mouse otocysts, miR-182 promoted differentiation of these cells to a hair cell-like fate (Wang et al., 2012). [score:1]
” For specific miRNAs, the approach taken to examine loss of miR-182 in the retina is a relevant approach (Jin et al., 2009), though not yet exploited in the inner ear. [score:1]
This conserved miRNA triad, composed of miR-183, miR-182, and miR-96, is transcribed in one polycistronic transcript. [score:1]
The mutated 3′UTR could not bind miR-182 and the decrease in luciferase activity that was observed in the wild-type construct was lost. [score:1]
Patel et al. (2013) Early growth response 1 (Egr1) Insulin receptor substrate 1 (Irs1) miR-182 SRY-box containing transcription factor (Sox2) In situ hybridization; luciferase assay in HEK293 cells Weston et al. (2011) miR-182 T-box 1 (Tbx1) Luciferase assay in COS1 cells; overexpression of miR in cultured otic progenitor/stem cells. [score:1]
[1 to 20 of 16 sentences]
19
[+] score: 44
Other miRNAs from this paper: hsa-mir-182
Indeed, FMO3 knockdown increased expression of miR-182 (Fig. 4r) and suppressed FoxO1 (Fig. 4q) and its targets (Supplementary Fig. 4b) in females, just as it did in males. [score:8]
This construct reduced expression of Srebp-2 and its targets, Hmgcr, Ldlr and miR-182 (Supplementary Fig. 2k). [score:5]
Overexpression of miR-182 also reduced FoxO1 protein, but the effects were more modest, suggesting that SREBP-2 may suppress FoxO1 via other mechanisms as well (Fig. 2o). [score:5]
To directly test the roles of SREBP-2 and miR-182 in the regulation of FoxO1, we overexpressed SREBP-2 via an adenovirus in primary mouse hepatocytes (Fig. 2l). [score:5]
Thus, in ob/ob mice, as in LIR KO mice, the knockdown of FMO3 can activate SREBP-2/miR-182 and suppress FoxO1 and hyperglycaemia. [score:4]
It also induced miR-182 (Fig. 2r) and suppressed FoxO1 mRNA, FoxO1 protein and G6pc mRNA (Fig. 2s,t). [score:3]
Overexpression of SREBP-2 was sufficient to induce Ldlr, Hmgcr and miR-182 (Fig. 2m,n). [score:3]
expressing the precursor form of mmu-miR-182 was generated using the AdEasy XL Adenoviral Vector System. [score:3]
Importantly, miR-182 is encoded by a miRNA locus that is activated directly by SREBP-2 (ref. [score:2]
Primer sequences are listed in Supplementary Table 1. The value of the control group was set to 1, but actual Ct values for QPCR are given in Supplementary Table 2. Alternatively, for quantification miR-182 (mmu-miR-182), Taqman assays (Applied Biosystems) were performed on RNA samples prepared using Trizol and the expression was normalized to housekeeper U6 snRNA. [score:1]
Consistent with the induction of SREBP-2 in these livers (Fig. 2i), miR-182 was increased four-fold (Fig. 2k). [score:1]
Primer sequences are listed in Supplementary Table 1. The value of the control group was set to 1, but actual Ct values for QPCR are given in Supplementary Table 2. Alternatively, for quantification miR-182 (mmu-miR-182), Taqman assays (Applied Biosystems) were performed on RNA samples prepared using Trizol and the expression was normalized to housekeeper U6 snRNA. [score:1]
In parallel, it increased Srebp-2, the cholesterologenic enzymes, and miR-182 (Fig. 4k-l). [score:1]
One potential link between FoxO1 and SREBP-2 is miR-182. [score:1]
We therefore measured miR-182 expression in the livers of LIR KO mice treated with FMO3 ASO. [score:1]
[1 to 20 of 15 sentences]
20
[+] score: 40
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30a A notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30aA notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
Figure 3. Conserved microRNA target sequences of stratum 1. (a– c) let-7 target sequences; (d) tandem target sequences for miR-182. [score:7]
The megaloop contains, among other features, a conserved pair of target sites for miR-320a and miR-182 (Fig.  4b) and a conserved triplet of target sites for miR-378, miR-99a and miR-30a (Fig.  4c). [score:5]
Another short region of conservation contains tandem target sequences for miR-182 that are present in Callorhinchus, Pelodiscus, Mono delphis and Callithrix (marmoset) IGF1R genes. [score:3]
Postranscriptional regulation of IGF1R by let-7, miR-7 and miR-182 are plausible candidates for such ancient functions because these microRNA families are themselves ancient, conserved between protostomes and deuterostomes [32–34]. [score:2]
We found that some ancient microRNAs, such as let-7 and mir-182, have predicted binding sites that are conserved between cartilaginous fish and mammals. [score:1]
[1 to 20 of 7 sentences]
21
[+] score: 38
To test if the expression of miR-200c, miR-125b and miR-182 could contribute to the low expression of cMaf in beta cells, Min6 cells were transfected with a combination of 200 nM each miR-200c, miR-125b, and miR-182 exogenous hairpin inhibitors (Dharmacon-Thermo Scientific). [score:7]
E. miR-182 inhibits cMaf and Gcg expression in α-TC6 cells. [score:5]
Over expression of miR-182 (50 nM) for 72 hs inhibits endogenous cMaf and Gcg mRNA, (n = 6), * p = 0.036 for cMaf and Gcg, Wilcoxon signed rank test-2 tails. [score:5]
Among the β-miRNAs potentially targeting cMaf are miR-125b, miR-182 and miR-200c, which are 27.3-, 9.7- and 3.3 fold more expressed in β-cells (Table 1 ). [score:5]
B. Differential expression of β-miRNAs: miR-200c, miR-125b and miR-182 assessed by qRT-PCR. [score:3]
Conversely, inhibition of miR-200c, miR-125b and miR-182 in Min6 cells increased the amount of cMaf transcripts. [score:3]
Moreover, in Min6 the expression of miR-125b, miR-182 and miR-200c is much higher than in alpha TC6. [score:3]
This result strongly suggests that miR-125b and miR-182 regulate cMaf as well. [score:2]
The same experiments were performed with miR-125b (Fig. 4D ) and miR-182 (Fig. 4E ) resulting in down regulation of endogenous cMaf and Gcg mRNAs as well cMaf protein levels. [score:2]
In n = 4 independent experiments we found a 222 fold (Min6 vs alphaTC6) for miR-125b, 27 fold for miR-182 and 166×103 for miR-200c (Fig. 3B ). [score:1]
α-TC6, transfected either with 50 nM mimic miR-200c, mimic miR-182,, mimic miR-125b or irrelevant control were lysed in SDS, Tris-HCL buffer (pH 6.8), and aliquots corresponding to 1.8 to 2.6 µg of protein (for cMaf nuclear proteins) were subjected to. [score:1]
U6 small nuclear RNA was used as endogenous control, mean ± SD (n = 4), * p = 0.005, 0.005 and 0.0022 (t-test, 2 tails) for miR-200c, miR-125b and miR-182. [score:1]
[1 to 20 of 12 sentences]
22
[+] score: 36
There were four up-regulated miRNAs (mmu-miR-709, mmu-miR-467a-3p, mmu-miR-182-5p and mmu-miR-25-5p) and seven down-regulated miRNAs (mmu-miR-615-3p, mmu-miR-409-3p, mmu-miR-680, mmu-miR-129-5p, mmu-miR-151-5p, mmu-miR-142-5p and mmu-miR-30b-5p), as the values presented in Table 1. Then we performed unsupervised hierarchical clustering of the eleven miRNAs. [score:7]
Among the ten miRNAs validated by qRT-PCR, we found that mmu-miR-487b-5p, mmu-miR-709, mmu-miR-182-5p, mmu-miR-214-3p and mmu-miR-467a-3p were up-regulated in HCC-activated Tregs, mmu-miR-142-5p, mmu-miR-30b-5p, mmu-miR-409-3p and mmu-miR-129-5p were down-regulated (P < 0.01), while miR-344e-5p did not change significantly, as shown in Figure 1C. [score:7]
Control) P -valuemmu-miR-25-5p2.210.04mmu-miR-7091.980.02mmu-miR-467a-3p1.820.04mmu-miR-182-5p1.540.05mmu-miR-129-5p0.290.02mmu-miR-6800.340.02mmu-miR-615-3p0.360.00mmu-miR-409-3p0.440.02mmu-miR-30b-5p0.510.05mmu-miR-151-5p0.610.03 mmu-miR-142-5p 0.63 0.04By TargetScan, we found that mmu-miR-25-5p, mmu-miR-615-3p, mmu-miR-151-5p and mmu-miR-680 had few target genes directly relating with Tregs in MeSH database, so we excluded the four miRNAs for further exploration. [score:6]
Compared with the healthy controls, the expression levels of hsa-miR-182-5p, hsa-miR-214-3p, hsa-miR-129-5p and hsa-miR-30b-5p were significantly up-regulated in Tregs from HCC patients while the hsa-miR-409-3p and hsa-miR-142-5p did not show significant changes (Figure 3). [score:5]
Tregs from HCC patients and healthy controls finally confirmed the up-regulation of four miRNAs (hsa-miR-182-5p, hsa-miR-214-3p, hsa-miR-129-5p and hsa-miR-30b-5p). [score:4]
indicated the four miRNAs (hsa-miR-182-5p, hsa-miR-214-3p, hsa-miR-129-5p and hsa-miR-30b-5p) targeted eight signaling pathways involved in Tregs. [score:3]
Interestingly, compared with data from the murine mo del, two of the four miRNAs (hsa-miR-182-5p and hsa-miR-214-3p) showed the similar up-regulation while the other two miRNAs (hsa-miR-129-5p and hsa-miR-30b-5p) showed reverse changes. [score:3]
The functions of these four miRNAs (hsa-miR-182-5p, hsa-miR-214-3p, hsa-miR-129-5p and hsa-miR-30b-5p) in human Tregs are not clear. [score:1]
[1 to 20 of 8 sentences]
23
[+] score: 35
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-18a, hsa-mir-21, hsa-mir-27a, hsa-mir-96, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30b, mmu-mir-99a, mmu-mir-124-3, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-181a-2, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-21a, mmu-mir-27a, mmu-mir-96, mmu-mir-135b, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-200a, hsa-mir-135b, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-15a-1, dre-mir-15a-2, dre-mir-18a, dre-mir-21-1, dre-mir-21-2, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30b, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-135c-1, dre-mir-135c-2, dre-mir-200a, dre-mir-200b, dre-let-7j, dre-mir-135b, dre-mir-181a-2, dre-mir-135a, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
In order to address the essential question of the effect of miRNAs throughout development, a study was conducted examining the expression pattern of the mir-183, mir-182 and mir-96 cluster (Sacheli et al, 2009). [score:4]
Over -expression of miR-182 in a miR-96 knockdown embryo demonstrated a partial rescue effect, and the number of hair cells was increased, as compared to the knockdown. [score:4]
These analyses revealed that the conserved cluster of mir-183, mir-182 and mir-96 have a restricted expression to the mouse inner ear, as compared to brain, heart and whole embryo expression. [score:4]
A conserved miRNA cluster, which includes miR-183, miR-182 and miR-96, was shown to be expressed in the zebrafish in the hair cells, otic neurons and other primary sensory cells. [score:3]
Embryos with miR-182 and miR-96 over -expression exhibited body malformations and produced ectopic hair cells. [score:3]
However, the expression of miR-183 and miR-182 continued in the hair cells, but ceased to be present in hair cells from P11-15, and was only found in the spiral limbus and the inner sulcus. [score:3]
provides another example of the involvement of miRNAs in regeneration, as over -expression of miR-182 and miR-96 resulted in production of ectopic hair cells (Li et al, 2010). [score:3]
In situ hybridization revealed the unique expression pattern of mir-182, mir-183 and mir-96 in inner and outer hair cells of the cochlea, hair cells of the vestibular organs and spiral and vestibular ganglia. [score:3]
By P0, miR-183, miR-182 and miR-96 were strongly expressed in hair cells of the cochlea and the vestibular system, and in the spiral ganglia. [score:3]
Since this report, several studies have focused on the mir-96, mir-182 and mir-183 genes as a source for more deafness mutations. [score:2]
In a different mo del system, zebrafish were used to understand the role of the miR-96, miR-182 and miR-183 cluster in inner ear development (Li et al, 2010). [score:2]
miR-183 and miR-182, but not miR-96, were detected in the otic vesicle in the embryonic early inner ear. [score:1]
[1 to 20 of 12 sentences]
24
[+] score: 33
Mmu-miR-695, mmu-miR-31, mmu-miR-190, mmu-miR-183, mmu-miR-182, and mmu-miR-194 were the most significantly downregulated miRNAs, whereas mmu-miR-34c and mmu-miR-124 were the most significantly upregulated miRNAs. [score:7]
The most significantly downregulated (mmu-miR-31, mmu-miR-455, mmu-miR-744, mmu-miR-695, mmu-miR-181a, mmu-miR-181d, mmu-miR-182, mmu-miR-190, mmu-miR-194) and upregulated miRNAs (mmu-miR-34c, mmu-miR-124, mmu-miR-142–3p, mmu-miR-706, mmu-miR-29c) were analyzed. [score:7]
The results of the miRNA– messenger RNA regulatory networks indicated that the common target gene between mmu-miR-181d and mmu-miR-455 was motile sperm domain containing 1 (MOSPD1); that between mmu-miR-31 and mmu-miR-182 was RNA polymerase II, TATA box -binding protein–associated factor (TAF4A); that between mmu-miR-455 and mmu-miR-182 was reticulon 4 (RTN4); that between mmu-miR-182 and mmu-miR-190 was brain-derived neurotrophic factor (BDNF); that between mmu-miR-142–3p and mmu-miR-34c was protein phosphatase 1, regulatory subunit 10 (PPP1R10); and that between mmu-miR-142–3p and mmu-miR-124 was leucine rich repeat containing 1 (LRRC1). [score:5]
The results showed that the expression of mmu-miR-31, mmu-miR-695, mmu-miR-183, mmu-miR-182, mmu-miR-194, and mmu-miR-190 markedly downregulated in the corneal endothelium of old mice compared to young mice. [score:5]
The common target gene between mmu-miR-181d and mmu-miR-455 was motile sperm domain containing 1 (MOSPD1), that between mmu-miR-31 and mmu-miR-182 was RNA polymerase II, TATA box binding protein (TBP) -associated factor (TAF4A), that between mmu-miR-455 and mmu-miR-182 was reticulon 4 (RTN4), that between mmu-miR-182 and mmu-miR-190 was brain-derived neurotrophic factor (BDNF), that between mmu-miR-142–3p and mmu-miR-34c was protein phosphatase 1, regulatory subunit 10 (PPP1R10), and that between mmu-miR-142–3p and mmu-miR-124 was leucine rich repeat containing 1 (LRRC1). [score:4]
The qRT-PCR results demonstrated a decrease in the expression of mmu-miR-31(34.2±13.4-fold), mmu-miR-695 (19.8±4.79-fold), mmu-miR-183 (26.6±2.53-fold), mmu-miR-182 (55.2±15.3-fold), mmu-miR-194 (42.6±10.2-fold) and mmu-miR-190 (37.1±2.78-fold) in the corneal endothelium of old mice compared to young mice, whereas the expression of mmu-miR-34c and mmu-miR-124 increased 26.4±5.28-fold and 62.7±2.54-fold, respectively (Figure 2). [score:4]
To validate the reproducibility of the results from the miRNA microarray, qRT-PCR analysis of (microRNAs come from mice) mmu-miR-695, mmu-miR-183, mmu-miR-182, mmu-miR-194, mmu-miR-34c, mmu-miR-31, mmu-miR-190, and mmu-miR-124 was performed using the same extracted total RNA as the microarray analysis. [score:1]
[1 to 20 of 7 sentences]
25
[+] score: 30
Taken together with our later observations that targeting of the liver-specific miR-122-5p or poorly abundant miR-195-5p, miR-25-3p, miR-200a/b/c-3p, miR182-5p and the mutant miR-224-5p mut2 by 2′OMe AMOs (but not their LNA/DNA AMO counterparts) also resulted in significant inhibition of immunostimulatory ssRNA sensing, our work establishes sequence -dependent and miRNA-independent off-target inhibitory activity of 2′OMe AMOs on the immune sensing of pathogenic RNA by human and mouse phagocytes. [score:9]
The sequence-specific and miRNA-independent significant inhibition of immunostimulatory ssRNA sensing by 2′OMe AMOs targeting miR-195-5p, miR-25-3p, miR-122-5p, miR-200a/b/c-3p and miR182-5p (Figure 2B) was supported by the lack of inhibitory activity with LNA/DNA AMOs (Figure 2C), and the low abundance of these miRNAs (less than 100-fold the level of the most abundant miRNA in BMMs) (Figure 2A). [score:7]
Next, dose-response studies comparing the activity of highly inhibitory AMOs (miR-182-5p 2′OMe and miR-331-3p LNA/DNA) and that of poorly inhibitory AMOs (miR-224-5p 2′OMe and miR-195-5p LNA/DNA) on both TLR7 and TLR8 sensing were conducted in human PBMCs (Figure 3C and D). [score:5]
The miR-182-5p 2′OMe AMO had a strong inhibitory effect on both TNF-α and IFN-α, and was significantly more inhibitory than the miR-224-5p 2′OMe AMO in a dose -dependent manner (Figure 3C). [score:5]
Critically, this core sequence overlapped with a significantly enriched motif found in all the inhibitory sequences of Class 2 AMOs previously identified, in 5′-3′ orientation (for miR-200a/b-3p, and miR-25-3p) or 3′-5′ orientation (for AMO-NC1, miR-182-5p, miR-122-5p and miR-195-5p) (Figure 4C and Supplementary Table S2). [score:3]
Critically, we found this motif in miR-182-5p and miR-122-5p AMOs, when read in 3′-5′ orientation. [score:1]
[1 to 20 of 6 sentences]
26
[+] score: 29
Conversely, we found that up-regulation of miR-30a-5p, miR-96 and miR-182 at E17.5, and miR-429 at E14.5 were reciprocally correlated with down-regulation of Cpeb3, Sox6, Hdac9, and Ddx3y respectively in Pkd1 [-/- ]mutants (Additional file 21). [score:7]
miR-204 and miR-488 (A) were down-regulated in Pkd1 [-/- ]kidneys whereas miR10a, miR-30a, miR-96, miR-126-5p, miR-182, miR-200a and miR-429 (B) were up-regulated in Pkd1 [-/- ]kidneys. [score:7]
Expression of 9 miRNAs (miR-204, miR-488, miR10a, miR-30a, miR-96, miR-126-5p, miR-182, miR-200a and miR-429), predicted to target significantly regulated genes at E14.5 was assayed using miRNA-qPCR. [score:5]
We tested this hypothesis by determining the differential expression of 9 miRNAs (mmu-miR-10a, mmu-miR-30a-5p, mmu-miR-96, mmu-miR-126-5p, mmu-miR-182, mmu-miR-200a, mmu-miR-204, mmu-miR-429, and mmu-miR-488) between WT and Pkd1 [-/- ]genotypes at E14.5 and E17.5 (Figures 7 and 8). [score:3]
Expression of 9 miRNAs (miR-10a, miR-126-5p, miR-200a, miR-204, miR-429, miR-488, miR-96, miR-182 and miR-30a-5p), predicted to target significantly regulated genes at E17.5 was evaluated using miRNA-qPCR assays. [score:3]
In contrast, at E17.5 miR-96, miR-182 and miR-30a were up-regulated in Pkd1 [-/- ]kidneys compared to WT. [score:3]
We observed that miRNAs: miRs-10a, -30a-5p, -96, -126-5p, -182, -200a, -204, -429, and -488; and the such as miR-126-5p-Fgf10, miR-488-Fgfr3, miR-182-Hdac9, miR-204-P2rx7 and miR-96-Sox6 (as shown in Table 6) have not been previously reported in ADPKD. [score:1]
[1 to 20 of 7 sentences]
27
[+] score: 27
Regarding photoreceptor specific expression, miR-182 has been shown to be strongly and exclusively expressed in rod photoreceptors [26], although the results of the present study also indicate labeling in the outermost part of the INL. [score:5]
In contrast, Xu and coworkers [28] used rd1 mice with severe retinal degeneration to demonstrate retinal expression of miR-96, miR-182, and miR-183 in cells other than photoreceptor cells. [score:3]
In relation to the eye, miR-7 has been shown to play an important role in photoreceptor differentiation in Drosophila [25] and other miRs, such as miR-9, miR-96, miR-124a, miR-181, miR-182, and miR-183, were found to be highly expressed during morphogenesis of the zebrafish eye [16]. [score:3]
Expressions of miR-1, miR-9*, miR-26b, miR-96, miR-129-3p, miR-133, miR-138, miR-181a, miR-182, miR-335 and let7-d were explored by in situ hybridization (ISH) using locked nucleic acid (LNA) probes (Exiqon). [score:3]
This is in accordance with recent findings reported by Xu and coworkers [28], who demonstrated that expression of miR-96, miR-182, and miR-183 was not exclusive to photoreceptor cells in 4-month-old retinal degenerative 1 mice (rd1 [49]). [score:3]
MiR-182 was expressed in the photoreceptor cells in the outer nuclear layer (ONL, Figure 3c). [score:2]
In mouse, a number of miRs (for instance, miR-181a, miR-182, miR-183 and miR-184) were detected at high levels in various parts of the eye, including the lens, cornea, and retina [26, 27]. [score:1]
Additionally, miR-182 labeling was also observed in the outer part of the INL. [score:1]
Eyes from 1-month-old c57 animals were fixed in 4% paraformaldehyde, and 12 μm cryosections were in situ hybridized with 5'-digoxigenin labeled locked nucleic acid (LNA) microRNA (miR) probes for (a) let-7, (b) miR-181a, and (c,d) miR-182. [score:1]
Indeed, recent studies in retina [28, 42], inner ear [52], and dorsal root ganglia [53] suggest that miR-183, miR-96 and miR-182 may represent a conserved sensory organ-specific cluster of miRs, and that these miRs may potentially be under similar transcriptional control. [score:1]
A false-colored (magenta) 4',6-diamidine-2-phenylindole-dihydrochloride (DAPI) nuclear staining is overlaid on the miR-182 in situ hybridization (ISH) label (panel d) to indicate the position of the nuclear layers. [score:1]
Both let-7 and miR-181a were mainly localized in the nuclear layers (Figure 3a,b), in contrast, miR-182 labeling was weaker in the ONL (cell bodies) but was strongly localized in the photoreceptor inner segments and between the ONL and INL, possibly in photoreceptor synapses (Figure 3c,d). [score:1]
It is notable that only the analysis of let-7, miR-181a, and miR-182 produced detectable signals (Figure 3). [score:1]
Previously, miR-9, miR-29c, miR-96, miR-124a, miR-181a, miR-182, miR-183, and miR-204 were localized in the mouse retina by ISH [26- 28]. [score:1]
[1 to 20 of 14 sentences]
28
[+] score: 25
Coherently with this finding, it has been found that in ATC tissues and cell lines, TRIM8 downregulation is significantly correlated with the upregulation of miR-182, which targets TRIM8 mRNA. [score:9]
Moreover, in ATC tissues and cell lines, it has been reported that TRIM8 mRNA and protein levels are kept low via the up-regulation of another miRNA, miR-182, which directly targets TRIM8 mRNA (Figure 3) [26]. [score:7]
Liu Y. Zhang B. Shi T. Qin H. miR-182 promotes tumor growth and increases chemoresistance of human anaplastic thyroid cancer by targeting tripartite motif 8Onco Targets Ther. [score:5]
MiR-182 overexpression induces cellular growth by repressing TRIM8 expression, greatly contributing to the chemoresistance of ATC cells [26]. [score:4]
[1 to 20 of 4 sentences]
29
[+] score: 25
Fig. 2Whole lung homogenate with miRNA and mRNA expression by qPCR of miR-182 (a), miR-155 (b), miR-21 (c), collagen type 3 alpha-1 (Col3a1) (d), MS4A4A (e), and periostin (POSTN) (f) in healthy controls (HC) (n = 5) and patients with systemic sclerosis interstitial lung disease (SSc-ILD) (n = 14). [score:5]
Interestingly enough, some of the recently identified miR-182 targets are strong inhibitors of extracellular matrix degradation [30]. [score:5]
We also showed for the first time that miR-182 is upregulated in the lungs of patients with SSc-ILD. [score:4]
Only a few miRNA from the selected group had validated target genes: miR-155, miR-21, miR-125a, miR-31, miR-205, miR-20a, let-7f, miR-182, let-7e, miR-199b, miR-199a, miR-663, and miR-193a. [score:3]
miR-182 was highly expressed in the lung tissue from patients with SSc-ILD (mean fold-change 17.5 ± 14.8) compared to controls (mean fold-change 1.1 ± 0.6; p = 0.001. [score:2]
miR-182 has been implicated in several types of cancer and it is known to regulate proliferation, invasion, and migration of cancer cells [29]. [score:2]
Sachdeva M, Mito JK, Lee CL, Zhang M, Li Z, Dodd RD, et al. MicroRNA-182 drives metastasis of primary sarcomas by targeting multiple genes. [score:2]
Surprisingly, only four miRNA correlated positively with the delta FibMax (r > 0.4) with miR-155 having the strongest correlation (r = 0.65, p < 0.001, Fig.   3a), followed by miR-182 (r = 0.49, p = 0.06), miR-27a (r = 0.49, p = 0.06), and miR-21 (r = 0.47, p = 0.07). [score:1]
Kouri FM, Hurley LA, Daniel WL, Day ES, Hua Y, Hao L, et al. miR-182 integrates apoptosis, growth, and differentiation programs in glioblastoma. [score:1]
[1 to 20 of 9 sentences]
30
[+] score: 24
Other miRNAs from this paper: mmu-mir-183, mmu-mir-21a, mmu-mir-96, mmu-mir-21b, mmu-mir-21c
This role for the miR-183 family is supported by a previous study in which overexpression of miR-182 was shown to inhibit the expression of Tbx1 in the cultured otic progenitor/stem cells [48]. [score:7]
For mESCs, the most upregulated genes were Mir96, Mir182, Mir183, Lama1, Hes6, Fgf5, Dll3, Cdc25b and Foxi3, whereas for iMOP cells the most upregulated genes were: Mir182, Mir96, Mir183, Sema7a, Rab25, Mfap4, Atoh1, Nhlh1, Mical1 and Rab15 (Fig 7A). [score:6]
A number of miRNAs are expressed in the mammalian inner ear and may contribute to proper development of the sensory epithelia including the miR-183 family (miR-183, miR-96 and miR-182). [score:4]
Shown is fold change in expression of miR-21, miR-183, miR-96, and miR-182 in total RNA from Ad-183T infected cells relative to Ad-T. miRNA detection levels were normalized to U6 snRNA. [score:3]
qRT-PCR analysis of mature miRNA expression demonstrated a statistically significant increase in miR-183 (55 fold), miR-96 (6 fold) and miR-182 (33 fold) in cells infected with Ad-183T compared to cells infected with the control vector Ad-T (Fig 1B). [score:2]
We determined a set of ~1600 combined predicted transcripts with conserved sites for the three miRNAs; miR-183, miR-96 and miR182. [score:1]
Three miR-183 family members (miR-183, miR-96, and miR-182) were inserted into the human beta globin intron, and the GFP-Puro cassette was replaced with a bicistronic cassette encoding Myc-tagged murine Atoh1 and a tandem dimer Tomato red fluorescence protein (RFP). [score:1]
[1 to 20 of 7 sentences]
31
[+] score: 23
Analysis of expression of these miRs at different stages of lung development showed that miR-140-5p and miR-328-3p were expressed at relatively low levels during the pseudoglandular stage of lung development and at relatively higher levels during the saccular stage, while miR-182-5p showed the opposite profile (Fig 3B– 3D). [score:7]
Importantly, several of these miRNAs (miR-24, miR-140, miR-182, miR-183, miR-328) are expressed in fetal or neonatal lung and their relative expression levels are modulated during lung development [26, 27] or in lung cancer [28– 30]. [score:6]
We also show that the Fgf9 3’ UTR is responsive to conserved miRNA-140, miRNA-328, and miR-182, and that miRNA-140 (and miR-328) is an important regulator of lung development. [score:3]
Of these, miR-140, miR-183, and miR-328 suppressed luciferase activity, while miR24 and miR-182 increased luciferase activity (Fig 3F, mouse, and S4A Fig and S4B Fig, human). [score:3]
The human and mouse FGF9 3’ UTR are highly conserved and are similarly regulated by miR-140, miR-182, miR-183, miR-328. [score:2]
Mature microRNA mimics for miR-24, miR-140, miR-182, miR-183, and miR-328 were then screened for their ability to regulate luciferase activity of the human or mouse FGF9 3’ UTR. [score:2]
[1 to 20 of 6 sentences]
32
[+] score: 22
Eight genes simultaneously participated in the axon guidance and MAPK signaling pathways, among which Rasa1was targeted by miR-182 in the Udown group and the other 7 genes were targeted by microRNAs in the Uup group. [score:5]
Interestingly, miR-182 and miR-153 in the Udown group had close relations with the Uup microRNAs through their targets Nfatc3, Ppp3r1, and Robo2 (Fig 6A and Table 1), indicating cooperation between the microRNAs in these two groups in regulating multiple processes. [score:4]
miR-182 in the Udown group together with miR-96, miR-30a, miR-20a, miR-93, miR-106b, miR-17, miR-384-5p, and miR-181a in the Uup group targeted Caln (Fig 6). [score:3]
Since the network analysis showed that miR-182 in the Udown group and miR-17, miR-30a, and miR-124 in the Uup group play dominant roles in the axon guidance pathway, they and their corresponding target genes were selected for further validation. [score:3]
Among the microRNAs, miR-182 in the Udown group together with 8 microRNAs in the Uup group (miR-96, miR-30a, miR-20a, miR-93, miR-384-5p, miR-106b, miR-17, and miR-181a) targeted Ppp3r1. [score:3]
Moreover, miR-182 in the Udown group was potentially involved in axon outgrowth and axon repulsion by acting on the targets Rasa1(also named RasGAP) and Cfl1(also named Cofilin) respectively (Fig 6B). [score:3]
miR-9, miR-200c, and miR-182 in the Udown group were involved in all the three pathways; in contrast, miR-153was predicted to be exclusively involved in the focal adhesion pathway. [score:1]
[1 to 20 of 7 sentences]
33
[+] score: 22
miR-182 plays a critical role in the regulation of activated Th cell proliferation and clonal expansion, but its contribution to autoimmune disease pathogenesis is still not clear. [score:4]
Unlike lupus -associated miRNAs such as the miR-182 cluster that was highly increased in diseased, 36–40-wk-old NZB/W [F1] mice [34], miR-223 and miR-451 were not significantly increased in 36–40-wk-old female NZB/W [F1] mice when compared to pre-diseased NZB/W [F1] or NZW control (Additional file 1: Figure S1). [score:4]
However, its role in autoimmunity is suggested by the finding that the inhibition of miR-182 in T cells reduced ovalbumin (OVA) -induced arthritis in mice [46]. [score:3]
Our finding of increased miR-182 cluster, miR-155, miR-31, and miR-148a expression in female NZB/W [F1] mice at an age after the onset of lupus validates our previous report of the association of these miRNAs with lupus manifestation in this mo del. [score:3]
However, our data tends to support that estrogen treatment promoted the expression of selected lupus -associated miRNAs such as the miR-182 cluster, miR-379, and miR-148a in orchidectomized male NZB/W [F1] mice. [score:3]
At 23 wks of age, the expression levels of miR-182, miR-183, miR-127, and miR-31 were significantly increased in female NZB/W [F1] mice when compared to age-matched male NZB/W [F1] mice (Figure  2A). [score:2]
The direct link between miR-182 and autoimmune inflammation is not definitive thus far. [score:2]
miR-182 is substantially increased in activated T cells, which is critical for the proliferation and expansion of activated T helper (Th) cells [46]. [score:1]
[1 to 20 of 8 sentences]
34
[+] score: 20
Interestingly, most of these differentially expressed miRNAs belonged to miRNA families, including miR-8 and miR-132 families overexpressed in FCx and miR-34 family overexpressed in HP, or miRNA clusters transcribed from the same locus (miR-182|miR-183|miR-96 cluster overexpressed in FCx). [score:9]
The miR-182|miR-183|miR-96 cluster, also identified in our study, has previously been shown to regulate insulin signaling pathway, with miR-96 and miR-183 mainly regulating Irs1 and miR-182 targeting Rasa1 and Grb2 [31]. [score:5]
These included miR-8 family overexpressed in FCx and comprising of miRNAs from two chromosomal clusters, miR-429, miR-200a, miR-200a*, miR-200b, and miR-200b* from chromosome 4, and miR-141 and miR-200c from chromosome 6. Also, a chromosome 6 cluster with miR-182, miR-96, and miR-183 and a chromosome 11 cluster with miR-212 and miR-312 were expressed on a higher level in FCx. [score:5]
These included miR-8, miR-132, and miR-34 families and the miR-182|miR-96|miR-183 cluster. [score:1]
[1 to 20 of 4 sentences]
35
[+] score: 20
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-27b, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-199a-1, mmu-mir-122, mmu-mir-143, mmu-mir-298, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-27a, mmu-mir-31, mmu-mir-98, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-181b-1, mmu-mir-379, mmu-mir-181b-2, mmu-mir-449a, mmu-mir-451a, mmu-mir-466a, mmu-mir-486a, mmu-mir-671, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-491, mmu-mir-700, mmu-mir-500, mmu-mir-18b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-669e, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-669a-10, mmu-mir-669a-11, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-486b, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-145b, mmu-let-7j, mmu-mir-451b, mmu-let-7k, mmu-mir-126b, mmu-mir-466c-3
To validate the miR array data, we studied several differentially expressed miRs (upregulated miRs: miR-122 and miR-181a and downregulated miRs: miR-23a, miR-18b, miR-31, and miR-182). [score:9]
For example, downregulation of miR-182 that has highly complementary sequence with AhR 3′-UTR was responsible for increased expression of this target gene. [score:8]
Similarly, we observed downregulation of miR-23a, miR-18b, miR-31 and miR-182 in TCDD -treated thymocytes when compared to vehicle controls (Fig 2A–B). [score:3]
[1 to 20 of 3 sentences]
36
[+] score: 17
Therefore, just as we recently demonstrated that miR-182 regulates metastasis by targeting multiple genes (Sachdeva et al., 2014), miR-16 may also regulate metastasis through a number of targets, which are differentially regulated in immunocompromised versus immunocompetent mice. [score:8]
Using novel genetically engineered mice to either delete or overexpress miR-182 in primary sarcomas in vivo, we showed that deletion of miR-182 in primary sarcomas significantly decreased the rate of lung metastasis after amputation of the tumor-bearing limb, whereas overexpression of miR-182 significantly increased the rate of lung metastasis (Sachdeva et al., 2014). [score:5]
MicroRNA-182 drives metastasis of primary sarcomas by targeting multiple genes. [score:2]
For example, we recently showed that miR-182 drives metastasis of primary sarcomas in vivo (Sachdeva et al., 2014). [score:1]
For example, we recently showed that a single miRNA (miR-182) modulated sarcoma metastasis in vivo (Sachdeva et al., 2014). [score:1]
[1 to 20 of 5 sentences]
37
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
GSK3β inhibits the expression of miR-96, miR-182 and miR-183 through the β-Catenin/TCF/LEF-1 pathway [51]. [score:5]
Ssc-miR-182, ssc-miR-187, ssc-miR-136, ssc-miR-210, ssc-miR-217 and ssc-miR-10b participate in regulation Neurotrophin signaling pathway by targeting corresponding genes, including BNDF, SHC4, KRAS and FOXO3. [score:4]
We also assessed another three selected miRNAs, ssc-miR-136, ssc-miR-217 and ssc-miR-182, which were found to be more highly expressed in mpiPSCs (Fig 3C). [score:3]
Additionally, ssc-miR-216, ssc-miR-217, ssc-miR-142-5p, ssc-miR-96-5p, ssc-miR-182 and ssc-miR-183 have higher expression levels in mpiPSCs than that in hpiPSCs (Fig 3A). [score:3]
[1 to 20 of 4 sentences]
38
[+] score: 15
As each miRNA can have multiple targets, we performed an analysis to discover additional mRNA genes that are computationally predicted to be targets of the three most highly expressed miRNAs, miR-182, miR-181a and miR-26a. [score:7]
RNA-seq analysis led to the identification of over 500 miRNAs, with miR-182 as the most highly expressed miRNA in both sensory epithelia (Table  1) and accounting for more than 50% of the 20 most highly expressed miRNAs. [score:5]
A few targets have been confirmed for miR-182, including Sox2, Clic5 and Tbx1 [28– 30]. [score:3]
[1 to 20 of 3 sentences]
39
[+] score: 14
Furthermore, seven miRNAs were expressed more highly in C57BL/6J mice and were mainly downregulated across the time course (miR-92b-3p, miR-34b-5p, miR-672-5p, miR-31-5p, miR-34c-5p, miR-34b-3p, and miR-182-5p; listed in descending order according to the heat map in Figure 5). [score:6]
Five of these [miR-34b-3p, miR-34c-5p, miR-34b-5p, miR-92b-3p, and miR-182-5p; as well as miR-31-5p, which was identified through literature search (41)] belonged to the aforementioned seven miRNAs which were expressed more highly in the C57BL/6J mice and downregulated throughout the time course. [score:6]
Two of the 20 miRNAs (miR-31-5p and miR-182-5p) can be linked to adaptive immunity, i. e., T cell activation and regulation of Treg differentiation, respectively (72, 73). [score:2]
[1 to 20 of 3 sentences]
40
[+] score: 13
One heparan sulfate proteoglycan, Sdc2, was predicted by TargetScan to be targeted at multiple conserved sites by at least 5 different members of the miR-200/182 miRNA group; miR-141, miR-200b/c, miR-182, miR-96 and miR-183. [score:5]
We also observed the upregulation of 7 miRNAs belonging to the related and often co-transcribed miRNA-200 family (miR-200a,b,c/miR-141/miR-429) and miRNA-182 cluster (miR-182/miR-183), henceforth collectively referred to as miR-200/182. [score:4]
Hypothalamus region coinsides with miR-141 and miR-182 staining while pons region coinsides with staining for miR-200a. [score:1]
In addition miR-141 is expressed in normal human astrocytes and the role for this miRNA in these cells, and other members of miR-200 family and miR-182 cluster, has not yet been investigated [65]. [score:1]
Interestingly, 6 members of the related and often co-transcribed miRNA-200 family (miR-200a,b,c/miR-141/miR-429) and miRNA-182 cluster (miR-182/miR-183), henceforth referred to collectively as miR-200/182, were amongst the highest induced in HSV-1 infected brain. [score:1]
The induction of multiple members of the highly related, and often co-transcribed, miRNA-200 family and miRNA-182 cluster was our most striking finding. [score:1]
[1 to 20 of 6 sentences]
41
[+] score: 13
Analysis of mouse retinal miRNA transcriptome [50] reveals that miR-9 is highly expressed in neonatal retina, with peak expression near P10; miR-182 interacts with a photoreceptor-specific cluster of genes and increases expression after P1. [score:7]
Four miRNAs, with established expression and studied function in retinal development, were chosen for analysis, including Let7d, miR-9, miR-182 and miR-204 48– 50. [score:4]
Accordingly, our data reveals that subsets of miRNAs are present in mRPC EVs, including miRNA9, miRNA182, miRNA204 and Let7d. [score:1]
Additionally, the miRNAs identified in EVs included Let7d, miR-9, miR-182 and miR-204. [score:1]
[1 to 20 of 4 sentences]
42
[+] score: 12
miR-182 induces cervical cancer cell apoptosis through inhibiting the expression of DNMT3a. [score:5]
MicroRNA-182 aggravates cerebral ischemia injury by targeting inhibitory member of the ASPP family (iASPP). [score:4]
A recent study reported that iASPP expression was decreased in cerebral ischemia and was modulated by miR-182 [35], an apoptosis inducer [36], which was similar to our previous study [17] and the present study. [score:3]
[1 to 20 of 3 sentences]
43
[+] score: 12
In addition, it has been shown that miR-182 targets Mitf 3′UTR sequence in the retina [32], and recently Segura et al. (2009) showed that miR-182 promotes migration and survival of melanoma cells by downregulating Mitf expression [33]. [score:8]
miR-182 has been shown previously to target the 3′UTR of Mitf and was used as a positive control [32]. [score:3]
and are the following: hsa-miR-27a (Product ID:PM10939), hsa-miR-32 (Product ID:PM10124), hsa -miR-101 (Product ID:PM10537), mmu-miR-124a (Product ID:PM10691), mmu-miR-137 (Product ID: PM10513), hsa-miR-148a (Product ID:PM10263), hsa-miR-182. [score:1]
[1 to 20 of 3 sentences]
44
[+] score: 12
Computational predictions identified Ddx3x mRNA as a potential target of miR-183, miR-96 and miR-182, bearing two conserved miRNA -binding sites in the 3′-untranslated repeat (UTR; Supplementary Fig. 3a), suggesting that miR-183/96/182 may act as a feedback signal controlling Ddx3x levels. [score:5]
Computational predictions identified Crb1 as a potential target of miR-183 and possibly also of miR-182 and miR-96, since they contain seed regions related to that of miR-183. [score:3]
Truncated pri-miR-183/96/182 version 2 (T2) was designed in silico to retain pre-miR-183 and pre-miR-96 (chr6 30169427-30169777; minus strand) and pre-miR-182 (chr6 30165904-3030166007; minus strand) hairpins and some flanking sequences as annotated in miRBASE v. 20 (www. [score:1]
In HEK293T cells, the activity of a pFL-Crb1_wt_3′UTR reporter, bearing a wild-type Crb1 3′UTR, was significantly reduced by a co -transfected miR-183 mimic and less strongly reduced by miR-96 and miR-182 mimics compared with the reporter having mutations in the miR-183/96/182 sites (Fig. 6a). [score:1]
The transgene cassettes containing EF1a (sequence from pEGP-mmu-miR-182 plasmid; Cell Biolabs) or mCAR promoter 40, EGFP (from pEGP-mmu-miR-182 plasmid; Cell Biolabs) or dsRed 52, T2-pri-miR-183/96/182 sequence, WPRE motif and 5′-BalI and 3′-NotI adapters were chemically synthesized by GENEWIZ and inserted into the scAAV backbone. [score:1]
Control scAAV-EF1a-GFP-Control and scAAV-mCAR-dsRed-Control constructs contained fragments of β-globin intron (sequence from pEGP-mmu-miR-182 plasmid; Cell Biolabs) of the length corresponding to T2-pri-miR-183/96/182. [score:1]
[1 to 20 of 6 sentences]
45
[+] score: 11
Several of the miRNAs previously noted to be highly expressed in developing retina were up-regulated in ESMV -treated Müller cells, including miR-1, miR-96, miR-182 and miR-183. [score:6]
In addition, we observed the up-regulation of endogenous human miR-1, miR-96, miR-182, and miR-183, the appearance of which marked progression through early retinal development [45], supporting the notion that ESMV treatment shifts Müller cell differentiation towards an early retinal progenitor stage. [score:5]
[1 to 20 of 2 sentences]
46
[+] score: 11
As shown in Fig.   1, we confirmed that only the expression of miR-96 and miR-183, but not miR-182, was significantly downregulated in NPC CSCs when compared to parental C666-1 cells. [score:5]
No significant difference in miR-182 expression was found. [score:3]
The expression of miR-96, miR-182, and miR-183 in sphere-forming and parental C666-1 cells was determined by qRT-PCR. [score:3]
[1 to 20 of 3 sentences]
47
[+] score: 10
Among them, we both found miRNAs with previously reported retinal expression domains e. g. miR-124a, miR-29c, miR-9, miR-182, miR-181a [32], among others, but we also identified at least 70 miRNAs, which, to our knowledge, were not previously described to have a regional expression in the retina in any vertebrate species (Figures 3 and 4). [score:5]
A summary of the ISH signal distributions observed at each developmental stage is shown in Table 1. A detailed annotation of the expression patterns at all time points is listed in Additional file 4. Although broadly in agreement with previously published work, in some cases the ISH images revealed differences in miRNA distribution (e. g. miR-182). [score:4]
Another class of miRNAs (e. g. miR-29c, miR-30d, miR-96, miR-99b, miR-124a, miR-182, miR-183, miR-184, miR-381, miR-425) also stained, in the postnatal retina, the Outer Nuclear Layer (ONL) where rod and cone photoreceptors reside (green arrows in the third column of Figure 4A; Database). [score:1]
[1 to 20 of 3 sentences]
48
[+] score: 10
To validate the up- and downregulated miRNAs identified in the Solexa sequencing, 6 upregulated (mmu-miR-146a-5p, mmu-miR-341-3p, mmu-miR-879-5p, mmu-miR-3470a, mmu-miR-3473a and mmu-miR-3473b) and six downregulated miRNAs (mmu-miR-96-5p, mmu-miR-141-3p, mmu-miR-182-5p, mmu-miR-200a-3p, mmu-miR-200b-3p and mmu-miR-200b-5p), as well as two novel miRNAs (novel-mir-2 and novel-mir-20), were selected. [score:10]
[1 to 20 of 1 sentences]
49
[+] score: 10
Furthermore, miR-182 and −203 were also part of the top ten miRNAs targeting the most genes involved in growth and development in mouse BAT, suggesting their potentials roles in brown adipocyte development [21]. [score:5]
The absence of miR-182 expression in human BAT might contribute to differences between mouse and human BAT development and function. [score:4]
MiR-182 and miR-203 are BAT-specific miRNAs, essential for the maintenance and differentiation of brown adipocytes in vivo [21]. [score:1]
[1 to 20 of 3 sentences]
50
[+] score: 10
Activation of the forkhead box O3 (FoxO3) transcription factor also caused skeletal muscle atrophy, and miR-182 attenuated atrophy-related gene expression by targeting FoxO3 in skeletal muscle [17]. [score:5]
Hudson M. B. Rahnert J. A. Zheng B. Woodworth-Hobbs M. E. Franch H. A. Price S. R. miR-182 attenuates atrophy-related gene expression by targeting FoxO3 in skeletal muscle Am. [score:5]
[1 to 20 of 2 sentences]
51
[+] score: 9
Although microarray assay did not identify the change of miR-96 expression level in lpr mice, Real-time RT-PCR analysis clearly showed that miR-96 was markedly upregulated similar to two other members (miR-182 and miR-183) in the cluster (Fig. 2A). [score:5]
Of particular relevance, the published reports have shown that miR-182 and miR-96 target transcription factors Foxo1, Foxo3a, and microphthalmia -associated transcription factor (MITF), which play critical roles in controlling T and B lymphocyte homeostasis and tolerance, respectively [33], [34], [35], [36], [37]. [score:3]
A report has shown that miR-96 is clustered with miR-182 and miR-183 in mouse chromosome 6 and is likely generated from the same transcript [17]. [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 9
Due to its stable up-regulation, miR-182 represents an additional interesting molecule to be deeply analyzed in order to shed light on diet -induced hepatic cancer initiation and progression. [score:4]
Finally, miR-182, already discussed and described as early over-expressed in HF with respect to LF-HC mice [10], maintained increased levels in HF non tumor hepatic tissues and in tumors after 12 and 18 months. [score:3]
MiR-182 overexpression was revealed by HF livers both after 12 and 18 months. [score:2]
[1 to 20 of 3 sentences]
53
[+] score: 9
In addition, treatment of inflammatory cytokines to periodontal ligament cells results in expressional changes of various miRNAs, such as miR-138, miR182 18, 19, suggesting that miRNAs which regulate periodontal tissue development and repair may be affected by inflammatory environmental cytokines and could result in impaired periodontal tissue regeneration. [score:5]
Wang L Long noncoding RNA related to periodontitis interacts with miR-182 to upregulate osteogenic differentiation in periodontal mesenchymal stem cells of periodontitis patientsCell Death Dis. [score:4]
[1 to 20 of 2 sentences]
54
[+] score: 9
Hierarchichal clustering of the miRNA data revealed significant upregulation of tumor promoter miRNAs (miR-17, miR-21, miR-31, miR-98 and miR-182) and significant downregulation of tumor suppressor miRNAs (Let7a, miR-143, miR-144, miR145, miR-30a and miR-200a) in the IECs of Apc [Min/+] mice (Figure 4A). [score:9]
[1 to 20 of 1 sentences]
55
[+] score: 9
Four additional miRNAs, miR-299, miR-182, miR-23a and miR-125b, representing varying degrees of differential expression were validated using. [score:3]
miR-299, miR-182, miR-23a and miR-125b are representative of varying degrees of differential expression in the array. [score:3]
miR-182 is expressed in the inner ear hair cells and spiral ganglia at this age [31]. [score:3]
[1 to 20 of 3 sentences]
56
[+] score: 8
Another study reported that the cumulative 5 year survival rate of glioma patients was 51.54% in the low miR-182 -expression group, whereas it was only 7.23% in the high miR-182 -expression group. [score:5]
Moreover, multivariate Cox regression analysis indicated that miR-182 expression was an independent prognostic indicator for the survival of glioma patients [27]. [score:3]
[1 to 20 of 2 sentences]
57
[+] score: 8
Interestingly, we found a correlation between BM-MSC-EVs miRNAs/piRNAs and down-regulated genes, indicating at least one target for each EVs miRNAs/piRNAs (e. g., CEBPA/miR-182, EGR2/miR-150 and miR-92, MPO/ hsa_piR_020814_DQ598650). [score:6]
This gene is regulated by miR-182 [60], one of the miRNAs found by sequencing in our BM-MSC EVs. [score:2]
[1 to 20 of 2 sentences]
58
[+] score: 8
Future studies may aim to manipulate the expression of miRNAs such as miR-182 in order to normalize the amygdala -dependent memory impairments in these mice. [score:3]
We demonstrated the presence of miRNAs that had a large fold increase (miR-3535, miR-673-5p) or decrease (miR-182-5p, miR-1964, miR-206-3p), that were normalized by colonization (miR-219a-2-3p (PFC), miR-182-5p, miR-183-5p (amygdala)) and that are known to be implicated in influencing anxiety levels and expression of neurotrophins such as brain-derived neurotrophic factor (BDNF) (miR-183-5p, miR-206-3p) [33, 34]. [score:3]
Within the amygdala, we found that miR-183-5p and miR-182-5p were both decreased and subsequently normalized by colonization. [score:1]
Within the lateral amygdala, miR-182 appears to be essential for long-term amygdala -dependent memory formation assessed by auditory fear conditioning [23]. [score:1]
[1 to 20 of 4 sentences]
59
[+] score: 8
BRCA1 promoter hypermethylation or overexpression of the BRCA1 -targeting micro RNAs (e. g., mir-182) are thought to be mechanisms of downregulation of BRCA1in sporadic cancers [7]. [score:8]
[1 to 20 of 1 sentences]
60
[+] score: 8
miRNAs can act as tumor suppressors (e. g. miR-15a and miR-16-1 [4]), oncogenes (e. g. miR-155 [5], [6] and miR-21 [7], [8], [9], [10]) and as promoters (e. g. miR-10b, miR-182 and miR-29a [11], [12], [13]) or suppressors (e. g. miR-335 and miR-126 [14]) of metastasis. [score:5]
There was a steady increase in miR-182 expression between the 67NR cells and the 4T1 cells with a 3.8-fold increase overall. [score:3]
[1 to 20 of 2 sentences]
61
[+] score: 8
miR-182 regulates Circadian locomotor output cycles kaput (Clock) gene expression in rats by targeting its untranslated region (UTR) [22]. [score:8]
[1 to 20 of 1 sentences]
62
[+] score: 8
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-141, mmu-mir-152, mmu-mir-183, mmu-mir-191, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, mmu-mir-429, mmu-mir-449a, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, mmu-mir-449c, mmu-mir-449b, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-124b
Finally, 8 of 24 miRNA probes, including miR-200a and miR-200b, as well as miR-96, miR-141, miR-182, miR-183, miR-191, and miR-429, revealed robust expression in the MOE and VNO neuroepithelium, with weaker expression in the adjacent respiratory epithelium (Figure 2A, right column, and Table S3). [score:5]
By contrast, we identified 12 miRNAs corresponding to 9 families (miR-199, miR-140, miR-152, miR-214, miR-205, miR-200, miR-183, miR-182, miR-96) that displayed highly enriched expression in the olfactory system (Figure 1A). [score:3]
[1 to 20 of 2 sentences]
63
[+] score: 7
The quantitative RT-PCR analysis confirmed that all four of the selected up-regulated hsa (Homo sapiens)-miRNAs (miR-205, miR-182, miR-135b, and miR-455-3p) were significantly up-regulated in NPC tissues (Fig. 1C). [score:7]
[1 to 20 of 1 sentences]
64
[+] score: 7
While miRNA155 is not involved in T cell suppression after alcohol and burn injury, additional studies should be carried out to explore the role of other miRNAs (e. g. miRNA126, miRNA181a and miRNA182), implicated in T cell development and differentiation, in suppressed T cell IFN-γ after alcohol and burn injury. [score:6]
Several miRNAs (e. g. miR126, miR155, mir181a, miR182 etc. ) [score:1]
[1 to 20 of 2 sentences]
65
[+] score: 7
Note, miR-182 is expressed as a cluster with miR-96 and miR-183 and share similar sequences. [score:3]
We also analyzed miR-182, whose gene is in proximity to that of miR-96 and miR-183, and miR-146a which differs from miR-146b by only two bases (Table 2). [score:1]
Finally, qPCR detected a significant increase of miR15a and 146a in females and of miR-182 and miR-34a in both genders, which had not been observed by the microarray platforms. [score:1]
3) 55.6 AACCCATGGAATTCAGTTCTCA −26.0 59.5 −20 54.0 mmu-miR-146b UGAGAACUGAAUUCCAUAGGCU 40 AGCCTATGGAATTCAGTT(C) (−21.5) 41.5 AGCCTATGGAATTCAGTTCTCA −26.2 47.4 −20.2 39.2 mmu-miR-182 UUUGGCAAUGGUAGAACUCACACCG 48 CGGTGTGAGTTCTAC(C) (−19.9) 62.9 CGGTGTGAGTTCTACCATTGCCAAA −31.9 62.9 −17 58.8 mmu-miR-183 UAUGGCACUGGUAGAAUUCACU 40 AGTGAATTCTACCAGTGC(C) (−23.2) 44.7 AGTGAATTCTACCAGTGCCATA −26.3 46.3 −20.3 40.0 mmu-miR-184 UGGACGGAGAACUGAUAAGGGU 50 ACCCTTATCAGTTCTCCGTCC(A) (−31.9) 57.0 ACCCTTATCAGTTCTCCGTCCA −31.9 57.0 −30.3 56.2 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA 40 TCCAAAACATGAATTGCTGCTG −23.1 37.7 TCCAAAACATGAATTGCTGCTG −23.1 37.7 mmu-miR-433 AUCAUGAUGGGCUCCUCGGUGU 54 ACACCGAGGAGCC(C) (−20. [score:1]
Prefabricated TaqMan MicroRNA Assays (containing microRNA-specific forward and reverse PCR primers and microRNA-specific Taqman MGB probe) were used to determine expression of miR-21 (ABI P/N 000397), miR-146b-5p (ABI P/N001097), miR-127 (ABI P/N000452), miR-433-3p (ABI P/N001028), miR-322 (ABI P/N001076), miR-184-3p (ABI P/N000485), miR-183 (ABI P/N002269), miR-96 (ABI P/N000186), miR-15a-5p (ABI P/N000389), miR-34a-5p (ABI P/N000426), miR-146a-5p (ABI P/N000468) and miR-182-5p (ABI P/N002599). [score:1]
[1 to 20 of 5 sentences]
66
[+] score: 7
In addition, miR-182 promotes cell proliferation and invasion through direct suppression of CHL1 in papillary thyroid carcinoma (PTC; Zhu et al., 2014). [score:4]
miR-182 targets CHL1 and controls tumor growth and invasion in papillary thyroid carcinoma. [score:3]
[1 to 20 of 2 sentences]
67
[+] score: 6
Other miRNAs from this paper: hsa-mir-182
Moskwa P. Buffa F. M. Pan Y. Panchakshari R. Gottipati P. Muschel R. J. Beech J. Kulshrestha R. Ab delmohsen K. Weinstock D. M. miR-182 -mediated downregulation of BRCA1 impacts DNA repair and sensitivity to PARP inhibitorsMol. [score:6]
[1 to 20 of 1 sentences]
68
[+] score: 6
Other miRNAs from this paper: mmu-mir-183, hsa-mir-182, hsa-mir-183
Other compounds such as histone deacetylase inhibitors and synthetic retinoids, which increase SUMOylation by inhibiting the regulatory miRNAs miR-182 and miR-183, have demonstrated protection of cortical neurons in vitro (11). [score:6]
[1 to 20 of 1 sentences]
69
[+] score: 6
Notably, our data revealed that expression of Tnfsf10 (upregulated by ∼2-fold) is likely influenced by several miRNAs including miR-107, miR-145, miR-342-3p, miR-491, miR-494, miR-182, and miR-467a. [score:6]
[1 to 20 of 1 sentences]
70
[+] score: 6
We observed a significant downregulation of miR-182 and miR-183 in the two strains. [score:4]
miR-183 family members include miR-96, miR-182, and miR-183. [score:1]
The anti-apoptotic category of miRNAs includes miR-17, miR-181a/b/d, and miR-182/183 [45]. [score:1]
[1 to 20 of 3 sentences]
71
[+] score: 6
Indeed, a similar regulatory network consisting of miRNAs and Clock may exist, and a feedback loop involving mir-182/96 and Clock has been hypothesized [12]. [score:2]
The results of our luciferase reporter assay showed that six candidates (mir-20a, mir-106a, mir-106b, mir-148a, mir-182 and mir-301a) could be Clock -targeting miRNAs (Additional file 3B and C). [score:2]
Among them, mir-182 was reported to be a modulator of CLOCK in a recent study [20]. [score:1]
Xu et al. showed that the levels of specific miRNAs (e. g., mir-96, mir-124a, mir-103, mir-182 and mir-106b) oscillate in the mouse retina in a circadian pattern [12]. [score:1]
[1 to 20 of 4 sentences]
72
[+] score: 6
miR-105, for example, has been shown to regulate the protein expression of TLR2 in human keratinocytes [52], while miR-182 expression is a biomarker for patients with sepsis [53]. [score:6]
[1 to 20 of 1 sentences]
73
[+] score: 6
Among these differentially expressed miRNAs, let-7b, miR-26b, miR-182, miR-192, let-7d, miR-15b, miR-16, let-7a and miR-378, were confirmed by RT-qPCR to exhibit marked decreases in expression in the intestinal mucosa following intestinal I/R (Table 2). [score:5]
Second, because several miRNAs responded rapidly to intestinal I/R, this study only investigated the function of miR-378 in ischemic intestine; whether other differentially expressed miRNAs (miR-182, miR-192, let-7a, etc. ) [score:1]
[1 to 20 of 2 sentences]
74
[+] score: 6
MiR-182, for example, is an important factor in the development of the inner ear and retina, T-cell development and osteogenesis and has also been implicated in cancer development and metastasis, [48] while miR-497 is a tumour suppressor that has been shown to induce quiescence in skeletal muscle stem cells. [score:6]
[1 to 20 of 1 sentences]
75
[+] score: 6
For example, miR-182 and miR-148a are differentially expressed in weeks 6 and 8, and they regulate ENPEP, EFNB2, S1PR1, and MMP19 - four genes related to blood vessel morphogenesis or vascular endothelial growth factor (VEGF) signaling. [score:4]
For example, miR-182, miR-141, miR-18b, miR-200a, miR-17 and, especially, miR-421 appear recurrently along PyMT cancer progression regulating genes involved in ABC transporters (DNAH8, ABCC5, ABCA8A, ABCB4, and ABCA8B), which are significant in cancer research due to their impact in treatment resistance [47]. [score:2]
[1 to 20 of 2 sentences]
76
[+] score: 6
Other miRNAs from this paper: mmu-mir-183, mmu-mir-96
Rncr4 is also expressed in our RNA-seq data (Supplementary Fig.   S2d) and miR-182 and miR-183 are notably highly expressed in both the vestibule and cochlea at both developmental stages [36]. [score:6]
[1 to 20 of 1 sentences]
77
[+] score: 6
miR-182 can regulate IGF1R expression (Figure 2; Additional file 4). [score:4]
In particular, miR-486, miR-24, miR-182, miR-615-3p and miR-125a-5p are regulated by Tp53 (Figure 2; Additional file 4). [score:2]
[1 to 20 of 2 sentences]
78
[+] score: 5
To validate this result, whole mount in-situ hybridizations were performed on newborn inner ears of wild type mice with a probe for miR-200b, as well as a probe for miR-182 (a miRNA that is expressed in hair cells and ganglion cells of the ear [17]) as a positive control, and a no-probe negative control. [score:3]
Whole-mount in-situ hybridization was performed with probes mmu-miR-182 and mmu-miR-200b (Exiqon) to detect miRNA-182 and 200b, respectively, as previously described [39]. [score:1]
Sections of whole mount in situ hybridizations that were performed on newborn mouse inner ears, with probes for miR200b, miR182 (as a hair cell-specific positive control) and no-probe control. [score:1]
[1 to 20 of 3 sentences]
79
[+] score: 5
miR-182 was among the most downregulated miRNAs between the 2-cell and 4-cell stages of development; between the 4-cell and 8-cell stages, it was among the most induced (Fig d–e). [score:5]
[1 to 20 of 1 sentences]
80
[+] score: 5
Our studies show that the CLOCK 3111T/C SNP has important functional consequences by increasing CLOCK and Per2 mRNA expression over 24 h. These changes may be due to a number of different mechanisms, including miRNA-182 binding sites in the 3′-UTR. [score:3]
It is possible that the 3111C variant may interfere with this site, reducing miRNA-182 binding and thereby increasing stability and elevating levels of CLOCK mRNA. [score:1]
The 3′-UTR of the CLOCK gene also features a binding site for miRNA-182 less than 40 bases from the 3111T/C SNP that may affect stability of the mRNA by preventing or activating degradation mechanisms. [score:1]
[1 to 20 of 3 sentences]
81
[+] score: 5
Elevated expression of miR-182 [39], miR-429 [40], miR-199a, 199a*, 200a, and 200b was positively and significantly correlated to the progression of liver fibrosis [41]. [score:3]
Our analysis also suggests that 6 DEmiRs, miR-17-5p, miR-486b-5p, miR-19a-3p, miR-484, miR-199a-5p and miR-182-5p, are likely to be co-regulated by both Ctcf and Spi1. [score:2]
[1 to 20 of 2 sentences]
82
[+] score: 5
Moreover, the ability to produce copious amounts of IL-2 early after priming also ensures optimal clonal expansion of naïve CD4 T cells by inducing miR-182 that suppresses Foxo1, an inhibitor of CD4 T cell proliferation [44]. [score:5]
[1 to 20 of 1 sentences]
83
[+] score: 5
Sprague-Dawley rats treated with 2-AAF for 12 or 24 weeks exhibited disrupted regulation of the miR-34a-p53 feed-back loop and substantial deregulation of expression of miR-18, miR-21, miR-182, and miR-200 family miRNAs [11]. [score:5]
[1 to 20 of 1 sentences]
84
[+] score: 5
miR-182 inhibits Schwann cell proliferation and migration by targeting FGF9 and NTM, respectively at an early stage following sciatic nerve injury. [score:5]
[1 to 20 of 1 sentences]
85
[+] score: 5
The top ten highly expressed miRNAs (ranked by the mean expression value of three tissues) are miR-199a-3p, miR-199a-5p, miR-146a-5p, miR-146b-5p, miR-125a-5p, miR-200a-3p, miR-200b-3p, miR-142a-5p, miR-486b-5p and miR-182-5p. [score:5]
[1 to 20 of 1 sentences]
86
[+] score: 5
Other miRNAs from this paper: hsa-mir-182
miR-182 inhibits Schwann cell proliferation and migration by targeting FGF9 and NTM, respectively at an early stage following sciatic nerve injury. [score:5]
[1 to 20 of 1 sentences]
87
[+] score: 4
MiR-27b, miR-214, miR-199a-3p, miR-182, miR-183, miR-200a, and miR-322 were found to be downregulated, whereas miR-705 and miR-1224 were increased after 4 weeks of alcohol feeding in mice [26]. [score:4]
[1 to 20 of 1 sentences]
88
[+] score: 4
All of pri-let-7e, pri-let-7g, pri-let-7i, pri-miR-98 and pri-miR-182 harbored G-rich stretches in their terminal loops, as like pri-let-7a-1 and pri-let-7a-3. b KHSRPΔN fusing with SUMO1 decreases its interaction with pri-let-7a-1 and the mature let-7a production. [score:1]
Moreover, by using the RNAstructure software, we analyzed the secondary structures to show short G-rich stretches in the terminal loop of these pri-miRNAs (Additional file  10: Table S4), for instances, pri-let-7a-1, pri-let-7a-3, pri-let-7e, pri-let-7g, pri-let-7i, miR-98 and pri-miR-182 (Fig. 6a). [score:1]
For instances, as like pri-let-7a-1 [9, 10], the secondary structures of pri-miRNAs including pri-let-7a-3, pri-let-7g, pri-let-7i, pri-let-7e, pri-miR-98 and pri-miR-182 contained G-rich stretches (Fig.   6a). [score:1]
To validate the sequencing results, some miRNAs including let-7i-5p, miR-98-5p, miR-182-5p and miR-183-5p were chosen for validation by using the quantitative RT-PCR. [score:1]
[1 to 20 of 4 sentences]
89
[+] score: 4
Other miRNAs from this paper: mmu-mir-134, mmu-mir-34b, mmu-mir-18a, mmu-mir-210
Our result was in line with the work by Wilflingseder et al. (2014), in which expression correlation analysis identified miR-182 as a key regulator of post-transplant AKI (Wilflingseder et al., 2014). [score:4]
[1 to 20 of 1 sentences]
90
[+] score: 4
In particular, re -expression of miR-182 and miR-183 in cone conditional Dgcr8−/− mice prevented outer segment loss suggesting their requirement for cone outer segment maintenance [14]. [score:3]
Notably, inactivation of the miR-182/183/96 cluster results in syndromic photoreceptor degeneration [15]. [score:1]
[1 to 20 of 2 sentences]
91
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-141, mmu-mir-152, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-214, hsa-mir-200b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, hsa-mir-200c, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-200a, hsa-mir-130b, hsa-mir-376a-1, mmu-mir-376a, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, hsa-mir-429, mmu-mir-429, hsa-mir-450a-1, mmu-mir-450a-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-130b, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, hsa-mir-450a-2, dre-let-7j, hsa-mir-376a-2, mmu-mir-450a-2, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The most abundant miRs expressed in the developing mouse OE are: the miR-200-class (- 200a, - 200b, - 200c, - 141 and - 429), miR-199, miR-152, miR-214, miR-205, miR-183, miR-182 and miR-96 (Choi et al., 2008). [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
This analysis also reveals for the first time that miRNA temporal expression patterns can be extremely narrow, as illustrated with members of PAM class C, epitomized here by miR-182 and miR-27a (Figure 1A–1B and Figure S8). [score:3]
[1 to 20 of 1 sentences]
93
[+] score: 3
By combining transcriptome profiling, in situ hybridization and bioinformatics the authors zoomed in on six miRNAs (miR-15a, miR-18a, miR-30b, miR-99a, miR-182, and miR-199a) showing different spatio-temporal expression in new born mouse cochlea and vestibule. [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
Previous studies have identified miR-21, miR-27, miR-96, miR-128, miR-155 and miR-182 as oncogenes, and miR-17, miR-27, miR-125, miR-145, miR-205 and miR-206 as tumor suppressor genes [13- 15]. [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 3
Other miRNAs from this paper: mmu-mir-151, mmu-mir-19b-2, mmu-mir-19a, mmu-mir-19b-1, mmu-mir-494
In the latest studies, for example, miR-182, miR-151-3p, miR-320a and miR-494 have been reported to exert their essential roles in modulating the metastasis of breast cancer cells through targeting SNAI1, TWIST1, MTDH, PAK1 and so on [6– 9]. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
For example miR-263 (consisting of miR-263a and miR-263b) and miR-183 (consisting of miR-96, miR-182 and miR-183) families are found in many organisms including human, mouse, chicken, zebrafish, frog, worm and fruit fly, with high sequence and expression profile similarity particularly in sensory organs [61, 62]. [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
Expression of the mutant microRNA appears unaltered, at least spatially; miR-96, miR-182 and miR-183 are all detected in wildtype and diminuendo mutant hair cells during the first few days after birth (Fig. 3B and C) [23]. [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
miR-182, 708, and 499-5p showed large difference of expression between human iPS/ES and somatic cells but relatively mild difference in mouse case (Fig. 6B). [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
Moreover, PHF8 3′UTR may contain consensus target seed sequences for miRs other than miR-22 (miR-31, miR-182, miR-9 and let-7). [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
Other miRNAs from this paper: mmu-mir-124-3, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-124b
A recent report describes the targeted deletion of miR-182, a highly abundant miRNA in the retina [75]. [score:3]
[1 to 20 of 1 sentences]