sort by

106 publications mentioning mmu-mir-183 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-183. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 384
Other miRNAs from this paper: mmu-mir-182, mmu-mir-21a, mmu-mir-96, mmu-mir-21b, mmu-mir-21c
Transcriptome analysis of miR-183 family -expressing versus control mESCs revealed upregulation of 25 genes and downregulation of 11 genes, while miR-183 family -expressing iMOP cells exhibited upregulation of 28 genes and downregulation of 51 genes (n = 3, linear fold change ≥ 1.5 and ANOVA p<0.05) (Fig 3C and 3D). [score:17]
In Atoh1/miR-183 family -expressing mESCs, 49 genes were upregulated including 5 enriched in P0 HCs (Tagap1, Oxct2b, Glb1l2, Ptpn20 and Gm9999), and 13 genes were downregulated including 5 that showed lower expression in P0 cochlear HCs relative to supporting cells [13] (Snora44, Snorad35a, Rnu73b, Gm11517 and Fat4). [score:11]
Combined expression of Atoh1 and miR-183 family in iMOP cells was sufficient to specifically upregulate some HC enriched genes including Nhlh1, Chrnb1 and Myo6 that were not upregulated in Atoh1 -expressing cells. [score:11]
In Atoh1/miR-183 family -expressing iMOP cells, 68 genes were upregulated including 7 genes enriched in HCs (Chrnb1, Nhlh1, Sema7a, Abcd2, Zfp457, Myo6 and Gadd45g), and 32 genes were downregulated including 4 that showed lower expression in P0 cochlear HCs relative to supporting cells [13] (Helt, Myo1c, Mnd1 and Trdn) (Fig 8). [score:11]
In both Atoh1 - and Atoh1/miR-183 family -expressing iMOP cells, upregulation was validated for Atoh1, Dll3, Helt, Mical1, Rab15, Rab25 and Sema7a, and Atoh1/miR-183 family -expressing cells additionally validated upregulation of Actc1, Lzts1, Mfap4, Chrnb1, and Selm (n = 3, Student’s t-test p<0.05) (Fig 9B). [score:11]
0180855.g006 Fig 6(A) Venn diagram depicting the commonality of differentially downregulated miR-183 family predicted target genes among miR-183 family -expressing and the Atoh1/miR-183 family -expressing iMOP cells (n = 3, linear fold change <-1.25). [score:10]
Since there were considerably greater numbers of predicted target genes showing repression in transfected iMOP cells, we searched for common repressed predicted target genes in miR-183 family -expressing and Atoh1/miR-183 family -expressing iMOP cells and found 26 genes (Fig 6A). [score:9]
In both Atoh1 - and Atoh1/miR-183 family -expressing mESCs, upregulation was verified for Atoh1, Dll3, Dll1, Snai2, Hes6, Lbh, Id2, Id3, Ebf2, Prtg, Pknox2, Nr2f2, Pou3f1, Smad3, lama1, Peg3, Pim2, Car2, Gfra3 and Sema6a, and downregulation was verified for Nanog, Sox15, Prdm14 and Nr5a2 (n = 3, Student’s t-test p<0.05) (Fig 9A). [score:9]
Our data revealed Tbx1 as another predicted target gene that is downregulated in iMOP cells expressing the miR-183 family. [score:8]
No upregulation in expression of either Atoh1 or the miR-183 family was observed in iMOP cells, indicating that the cell mo del is derived from cochlear progenitors prior to Atoh1 expression. [score:8]
Among differentially expressed genes in Atoh1/miR-183 family -expressing mESCs and iMOP cells, there were only 6 upregulated genes in common (Cdc25b, Chrnb1, Dll1, Dll3, Frrs1l and Lzts1) (Fig 7B). [score:8]
Among the miR-183 family predicted target genes within the list of downregulated genes in miR-183 family -expressing iMOP cells are sprouty homolog proteins. [score:8]
Some genes showed upregulation in Atoh1 -expressing iMOP cells, but no change with combined Atoh1/miR-183 family expression, including Helt. [score:8]
To determine how combined Atoh1/miR-183 family expression differs from only Atoh1 expression, we compared the transcriptomes of Atoh1/miR-183 family -expressing cells to Atoh1 -expressing cells (linear fold change ≥ 1.5 and ANOVA p<0.06) (Fig 8). [score:8]
Expression of the miR-183 family alone was not sufficient to drive the expression of HC-specific genes in either cell culture mo del, but the combination of miR-183 family and Atoh1 showed a substantial increase in the number of upregulated HC genes in both cell mo dels. [score:8]
Differentially expressed genes for each cell type were selected based on comparison of Atoh1/miR-183 family -expressing cells to Atoh1 -expressing cells (n = 3, linear fold change ≥1.5 and ANOVA p<0.06). [score:7]
Gene ontological analysis of upregulated genes in Atoh1/miR-183 family -expressing mESCs and iMOP cells showed enrichment of common categories including differentiation, cell fate commitment, developmental proteins and neuron differentiation (Fig 7C and 7D). [score:7]
To determine the effects of expressing different combinations of Atoh1 and the miR-183 family in each cell culture mo del, we determined the number of differentially expressed genes following transfection with each expression vector relative to control pT transfection (n = 3, linear fold change ≥ 1.5 and ANOVA p<0.05). [score:7]
This role for the miR-183 family is supported by a previous study in which overexpression of miR-182 was shown to inhibit the expression of Tbx1 in the cultured otic progenitor/stem cells [48]. [score:7]
Differences in transcriptomes were detected between control and miR-183 family -expressing cells as one group, and Atoh1 -expressing cells and Atoh1/miR-183 family -expressing cells as another group. [score:7]
The number of downregulated genes was similarly greater in mESCs except that miR-183 family expression alone exhibited a greater impact on iMOP cells. [score:6]
The genes were selected by comparing Atoh1/ miR-183 family -expressing cells to control for each cell type (n = 3, linear fold change ≥1.5 and ANOVA p<0.05), and they represent the most upregulated genes in mESCs (left heat map) and iMOP cells (right heat map). [score:6]
Expression of repressed miR-183 family predicted target genes during inner ear development. [score:6]
mESCs expressing both miR-183 family and Atoh1 upregulated 267 genes, 56 of which are enriched in HCs (21%). [score:6]
0180855.g009 Fig 9 Graphs show linear fold change of differentially expressed genes by Taqman qPCR detection in Atoh1 -expressing cells (blue) and Atoh1/miR-183 family -expressing cells (red) compared to control in mESCs (A) and iMOP cells (B). [score:6]
The genes were selected by comparing miR-183 family -expressing cell to control for each cell type (n = 3, linear fold change <-1.25), and they represent the most downregulated genes in mESCs (left heat map) and iMOP cells (right heat map). [score:6]
Graphs show linear fold change of differentially expressed genes by Taqman qPCR detection in Atoh1 -expressing cells (blue) and Atoh1/miR-183 family -expressing cells (red) compared to control in mESCs (A) and iMOP cells (B). [score:6]
miR-183 family expression upregulated 28 genes, none of which are enriched in HCs. [score:6]
Cells expressing both Atoh1 and miR-183 family exhibited upregulation in 94 genes, 35 of which are enriched in HCs (38%). [score:6]
For mESCs, the most upregulated genes were Mir96, Mir182, Mir183, Lama1, Hes6, Fgf5, Dll3, Cdc25b and Foxi3, whereas for iMOP cells the most upregulated genes were: Mir182, Mir96, Mir183, Sema7a, Rab25, Mfap4, Atoh1, Nhlh1, Mical1 and Rab15 (Fig 7A). [score:6]
0180855.g008 Fig 8 (A) Linear fold change in gene expression for Atoh1 -expressing mESCs (blue) and Atoh1/miR-183 family -expressing mESCs (red) compared to control. [score:6]
To assess potential direct effects of the miR-183 family, we utilized the Target Scan Mouse database 7.1 release [25] to identify the predicted target transcripts for all members of this family. [score:6]
miR-183 family expression upregulated 25 genes, none of which are enriched in HCs. [score:6]
By comparison, iMOP cells showed greater percentages of upregulated genes identified as enriched in HCs, where Atoh1 expression alone yielded 28% and the combination of Atoh1/miR-183 family yielded 38%. [score:6]
Although our data show multiple novel downstream effects for Atoh1 and the miR-183 family, further studies are required to distinguish direct versus indirect gene targets for each factor. [score:5]
All values represent statistically significant differences for mESCs except for Ndnf expression in Atoh1/miR-183 family -expressing cells, and statistically significant differences are indicated by asterisks for iMOP cells (n = 3, Student’s t-test p<0.05). [score:5]
In mESCs expressing the miR-183 family, 36 predicted target genes were repressed more than 25% with only 3 genes showing statistical significance (ANOVA p<0.05) (Fig 5C). [score:5]
Differentially expressed genes in cells expressing Atoh1 and the miR-183 family. [score:5]
The expression dynamics of Nhlh1 correlate well with miR-183 family member expression suggesting a possible role for the miR-183 family in Nhlh1 induction. [score:5]
By repressing Spry4 gene expression, the miR-183 family may reduce MAPK signaling inhibition and thereby potentially affect multiple cellular processes including proliferation and survival. [score:5]
miR-183 family impact on predicted target genes’ expression. [score:5]
Out of the 26 common repressed predicted target genes in miR-183 family -expressing iMOP cells, 14 genes showed consistent repression in cochlear HCs versus non-HCs between E16 and P7 including Spry4, Plod2, Egr1, Lphn2 and Ankrd27 (Fig 6C). [score:5]
Repression of Sprouty protein expression might be one possible way through which the miR-183 family supports HC survival during development and differentiation. [score:4]
To examine the effect of combined Atoh1/miR-183 family expression in each cell culture mo dels, the transcriptome of Atoh1/miR-183 family -expressing cells was compared to control in each case. [score:4]
A number of miRNAs are expressed in the mammalian inner ear and may contribute to proper development of the sensory epithelia including the miR-183 family (miR-183, miR-96 and miR-182). [score:4]
This timing directly follows the expression of Atoh1 and the miR-183 family [50]. [score:4]
In addition, utilization of two different developmental cell culture mo dels facilitated understanding of the contextual prerequisite for Atoh1 and miR-183 family roles during development. [score:3]
HEK293 cells were used to validate miR-183 family and Atoh1 expression from vectors derived from the parent construct (Fig 1A). [score:3]
Genes are ordered by greatest repression in miR-183 family -expressing iMOP cells (top) to the least (bottom). [score:3]
Genes are ordered by greatest fold change in Atoh1/miR-183 family -expressing cells (top) to least (bottom). [score:3]
In iMOP cells transfected with the miR-183 family, 115 predicted target genes showed more than 25% repression with 10 genes showing statistical significance (ANOVA p<0.05) (Fig 5C). [score:3]
The data suggest that the miR-183 family contributes to repression of these predicted target genes in vivo. [score:3]
Shown is fold change in expression of miR-21, miR-183, miR-96, and miR-182 in total RNA from Ad-183T infected cells relative to Ad-T. miRNA detection levels were normalized to U6 snRNA. [score:3]
Atoh1 -expressing mESCs exhibited approximately 20% with no substantial difference between Atoh1 alone or in combination with the miR-183 family. [score:3]
Our work describes how different combinations of Atoh1 and miR-183 family expression promote HC fate in pluripotent and multipotent cells. [score:3]
Our study also demonstrates for the first time that the combination of Atoh1 and miR-183 family is more efficient than Atoh1 alone in driving the expression of HC genes. [score:3]
Vector expression of miR-183 family members and Atoh1 protein. [score:3]
0180855.g001 Fig 1 (A) Schematic diagram of the parent expression vector p183AT for combined production of miR-183 family members (miR), Atoh1 transcription factor, and red fluorescent protein (RFP). [score:3]
Our data suggest that the miR-183 family is involved in modulating the expression of Tbx1 to facilitate proper HC differentiation. [score:3]
0180855.g005 Fig 5 (A) Heat maps depicting linear fold changes for 34 genes among miR-183 family predicted target genes in the transcriptomes of transfected mESC and iMOP cells compared to controls. [score:2]
Previous studies investigated the role of miR-183 family in HC development and maintenance [18– 20], yet few target genes have been validated. [score:2]
Atoh1 and miR-183 family synergism in HC development. [score:2]
qRT-PCR analysis of mature miRNA expression demonstrated a statistically significant increase in miR-183 (55 fold), miR-96 (6 fold) and miR-182 (33 fold) in cells infected with Ad-183T compared to cells infected with the control vector Ad-T (Fig 1B). [score:2]
Our study provides novel insight into the contextually -dependent role of Atoh1 and miR-183 family in HC development. [score:2]
In this work, we investigate the impact of Atoh1 and/or miR-183 family expression on the transcriptomes of two different cell mo dels; pluripotent mouse embryonic stem cells (mESCs) representing a developmentally naive context and mouse multipotent otic progenitor (iMOP) cells as an otic fate-restricted context. [score:2]
MicroRNA-183 family conservation and ciliated neurosensory organ expression. [score:2]
The data demonstrate substantially different gene expression profiles for the cell culture mo dels, which can be considered as distinctly different platforms for assessing the roles of Atoh1 and the miR-183 family. [score:2]
This finding suggests a role for the miR-183 family in repressing Atoh1 -induced effects that are not HC specific, thereby contextually reinforcing the HC fate. [score:1]
We determined a set of ~1600 combined predicted transcripts with conserved sites for the three miRNAs; miR-183, miR-96 and miR182. [score:1]
Impact of Atoh1/miR-183 family on mESC and iMOP cell transcriptomes. [score:1]
MicroRNA-183 family members regulate sensorineural fates in the inner ear. [score:1]
Genes are ordered by greatest repression in miR-183 family -transfected cells (top) to least (bottom). [score:1]
Unique combinational influence of Atoh1 and miR-183 family. [score:1]
Our data indicate that iMOP cells are more receptive to HC programming, and that the miR-183 family works synergistically with Atoh1 in this cell culture mo del. [score:1]
Three miR-183 family members (miR-183, miR-96, and miR-182) were inserted into the human beta globin intron, and the GFP-Puro cassette was replaced with a bicistronic cassette encoding Myc-tagged murine Atoh1 and a tandem dimer Tomato red fluorescence protein (RFP). [score:1]
miR-183 family has greater impact on iMOP cells. [score:1]
[1 to 20 of 76 sentences]
2
[+] score: 343
In the present study, we found that the expression of NICD3 and NICD4, two surrogate markers for activated NOTCH signaling [22], were downregulated in the NPC cells overexpressing miR-96 or miR-183 (Fig.   4a). [score:8]
Among the differentially expressed miRNAs identified in NPC spheroids, several stemness-inhibiting miRNAs including miR-96 and miR-183 were downregulated in the NPC CSCs. [score:8]
It is likely that the downregulation of multiple stemness -inhibitory miRNA including miR-96, miR-183, and miR-203 targets various pluripotent stem cell transcription factors in NPC CSCs. [score:8]
Aberrantly downregulated expression of miR-96 and miR-183 in NPC CSCsThe miRNA expression profiles of NPC CSCs and parental C666-1 cells were determined by microarray analysis following our previous study [7]. [score:8]
NPC cells stably expressing miR-96 and miR-183 show reduced tumor sphere-forming capacitiesTo further examine the effect of overexpression of miR-96 and miR-183 on NPC CSCs, lentiviral -based vectors expressing miR-96 and miR-183 were used to establish stably transfected C666-1 cells. [score:7]
Significant inhibition of tumor formation was observed in the C666-1 cells stably expressing miR-183 (** P < 0.01) but not in the cells stably expressing miR-96. [score:7]
As shown in Fig.   2c, the inhibitory effect of miR-96 and miR-183 overexpression on anchorage-independent growth was negated by anti- miR-96 and anti- miR-183 expression, respectively. [score:7]
Although the overexpression of miR-96 and miR-183 showed an obviously suppressive effect on anchorage -dependent C666-1 growth (Fig.   2a, P = 0.08), a significant inhibition in anchorage-independent growth was observed (Fig.   2b, P < 0.01). [score:7]
Student’s t-test was used to determine statistical significance between the two groups Despite the growth inhibitory effects observed above, no aberrant expression of pluripotency-related stem cell transcription factors OCT4, SOX2, and PcG protein BMI1 and cell surface marker CD44 were detected in the NPC cells expressing miR-96 or miR-183 by flow cytometry when compared with that of the negative control (Fig.   2d, all P > 0.05). [score:6]
The downregulation of stemness markers and NICDs by miR-183 also supports its function in the inhibition of NPC CSC properties (Fig.   4a). [score:6]
The role of miR-96 and miR-183 in the regulation of NPC CSC properties was also supported by the finding of reduced NICD3 and NICD4 expression in C666-1 cells stably expressing miR-96 and miR-183 (Fig.   4a). [score:6]
This study indicated that according to its suppressive function in NPC CSCs, miR-183 might be a therapeutic target for the development of new treatment strategies. [score:6]
Aberrantly downregulated expression of miR-96 and miR-183 in NPC CSCs. [score:6]
Student’s t-test was used to determine statistical significance between the two groupsDespite the growth inhibitory effects observed above, no aberrant expression of pluripotency-related stem cell transcription factors OCT4, SOX2, and PcG protein BMI1 and cell surface marker CD44 were detected in the NPC cells expressing miR-96 or miR-183 by flow cytometry when compared with that of the negative control (Fig.   2d, all P > 0.05). [score:6]
Significant downregulation of miR-200a, miR-96, miR-183, and miR-203 expression was found in the nasopharyngeal carcinoma cancer stem-like cells. [score:6]
To further examine the effect of overexpression of miR-96 and miR-183 on NPC CSCs, lentiviral -based vectors expressing miR-96 and miR-183 were used to establish stably transfected C666-1 cells. [score:5]
Transient miR-96 and miR-183 expression inhibits colony formation and anchorage-independent growth in vitro. [score:5]
Fig. 3Effects of stable overexpression of miR-96 and miR-183 in C666-1. a C666-1 cells stably expressing miR-96 and miR-183 were established by lentiviral transfection. [score:5]
In addition to that of miR-183, overexpression of miR-96 transiently inhibited both anchorage -dependent and anchorage-independent tumor cell growth (Fig.   2). [score:5]
miR-96 and miR-183 repress stemness transcription factors and NOTCH signalsWestern blotting showed reduced expression of stem cell transcription factors SOX2 and OCT4 in C666-1 cells stably expressing miR-96 or miR-183 (Fig.   4a). [score:5]
Reduced NICD3 and NICD4 in miR-96- and miR-183 -expressing NPC cells suggests the involvement of the NOTCH signaling pathway in their tumor suppressive function. [score:5]
Overexpression of miR-183 in NPC C666-1 cells significantly inhibited cell growth and tumor formation in vivo (Figs.   2, 3 and 4). [score:5]
a The expression of stem cell transcription factors NICD3, NICD4, and CYCLIND D1 in the C666-1 cells stably expressing miR-96 and miR-183 was detected by Western blot. [score:5]
Thus, prima facie, the overexpression of miR-96 and miR-183 would affect NPC tumorigenesis via suppression of the stemness properties of NPC cells. [score:5]
This study provides evidences supporting the stemness -inhibitor miRNA miR-183 to be tumor suppressor in EBV -associated NPC. [score:5]
The diminished properties of NPC CSCs in the stable miR-96- or miR-183 -expressing NPC cells were also indicated by the suppression of pluripotent stem cell transcription factors SOX2 and OCT4 (Fig.   4a). [score:5]
Fig. 4Overexpression of miR-183 inhibits stemness and tumorigenic potential in C666-1 cells. [score:5]
Reduced expression of SOX2, OCT4, NICD3, and NICD4 was found in the C666-1 cells with overexpression of miR-96 or miR-183. [score:5]
Our findings demonstrated that the ectopic expression of miR-96 and miR-183 suppressed the colony- and sphere-forming ability of NPC cells in vitro. [score:5]
Finally, we showed that the tumorigenicity of cells stably expressing miR-183 was significantly inhibited in the in vivo nude mice mo del. [score:5]
As shown in Fig.   1, we confirmed that only the expression of miR-96 and miR-183, but not miR-182, was significantly downregulated in NPC CSCs when compared to parental C666-1 cells. [score:5]
Student’s t-test was used to determine statistical significance between the two groups (n = 3, ** P < 0.01, *** P < 0.001) Transient miR-96 and miR-183 expression inhibits colony formation and anchorage-independent growth in vitroTo evaluate the function of miR-96 and miR-183 in NPC, the effects of the ectopic expression of these miRNAs on cancer stem-like properties were studied in transiently transfected C666-1 cells. [score:5]
These findings suggest that miR-96 or miR-183 modulates NPC CSC properties by suppressing the expression of pluripotent stem cell transcription factor and NOTCH signal activity. [score:5]
The diminished capacity of tumor sphere formation in the NPC cells expressing miR-96 or miR-183 suggested that these miRNAs exert a suppressive role on the sphere-forming subpopulation of cells (Fig.   3c). [score:5]
However, only NPC cells stably expressing miR-183 could inhibit tumor formation in vivo in a nude mice mo del. [score:5]
The NPC cells stably expressing miR-96 and miR-183 were indicated by the expression of green fluorescent protein. [score:5]
Using transient or stable transfection, we showed that ectopic expression of miR-96 and miR-183 suppressed cell growth and tumor sphere formation in NPC. [score:5]
showed reduced expression of stem cell transcription factors SOX2 and OCT4 in C666-1 cells stably expressing miR-96 or miR-183 (Fig.   4a). [score:5]
Fig. 2Transient expression of miR-96 and miR-183 inhibits colony and tumor sphere formation in NPC cells. [score:5]
Fig. 1Down-regulation of miR-96 and miR-183 in NPC sphere-forming cells. [score:4]
b Tumor sphere formation in C666-1 cells expressing miR-96 and miR-183 was significantly inhibited when compared to that of the negative control (n = 3, ** P < 0.01). [score:4]
Contrary to SOX2 and OCT4, the expression of BMI1 was not regulated by miR-96 or miR-183 (Fig.   4a). [score:4]
Among the downregulated miRNAs in the microarray analysis, we found that miR-96 and miR-183 showed the highest fold changes in NPC CSCs. [score:4]
Downregulation of miR-96 and miR-183 was confirmed in NPC spheroids. [score:4]
The expression of miR-96, miR-182, and miR-183 in sphere-forming and parental C666-1 cells was determined by qRT-PCR. [score:3]
Histograms confirmed elevated expressions of miR-96 and miR-183 in the respective cells stably transfected with miR-96 and miR-183 (n = 3, all * P < 0.05). [score:3]
The number of tumor spheres in the C666-1 cells stably expressing miR-96 and miR-183 and the vector control is illustrated in the histogram according to the sizes of the tumor spheres formed (<50 μm, 50–100 μm, > 100 μm) (mean data from 6 wells of a 6-well plate per group). [score:3]
C666-1 cells stably expressing miR-96 and miR-183 failed to form tumor spheres of diameter larger than 100 μm. [score:3]
Wellner et al. showed that overexpression of miR-183, miR-203, and miR-200c decreases the sphere-forming capacity of pancreatic cancer cells [12]. [score:3]
miR-183 inhibits in vivo NPC tumor formation. [score:3]
miR-183 is a tumor-suppressive miRNA in EBV -associated NPC. [score:3]
MiR-96 and miR-183 expression in NPC CSCs was detected by qRT-PCR. [score:3]
We then performed a functional study to elucidate whether miR-96 and miR-183 are NPC tumor suppressors that repress CSC properties. [score:3]
No significant changes in OCT4, NANOG, CD44, SOX2, and BMI1 expression were observed in the cells transfected with miR-96 and miR-183 (n = 3, all P > 0.05). [score:3]
With this study, we provide the first evidence that miR-183 exerts tumor-suppressive effects on NPC by repressing CSC properties. [score:3]
The findings indicate that miR-96 and miR-183 exert differential inhibitory effects in C666-1 cells. [score:3]
c Both the number and size of the tumor spheres were reduced in the C666-1 cells expressing miR-96 and miR-183. [score:3]
Transient and stable transfection was performed in EBV -positive NPC C666-1 cells to examine the effects of ectopic expression of miR-96 and miR-183 on repressing cell growth and CSC properties. [score:3]
Recently, Tang et al. showed that miR-183 expression negatively correlates with lymph node status in primary NPC [30]. [score:3]
NPC cells stably expressing miR-96 and miR-183 show reduced tumor sphere-forming capacities. [score:3]
The colony number of C666-1 cells expressing miR-183 is obviously lower than that of the control (n = 3, P = 0.18). [score:3]
Anchorage -dependent (colony formation) and anchorage-independent (tumor sphere formation) growths of these miR-96 and miR-183 expressing cells were determined. [score:3]
The effects of miR-96 and miR-183 overexpression in NPC cells were assessed by their (b) colony-forming and (c) sphere-forming capacities. [score:3]
a of C666-1 cells with miR-96 and miR-183 overexpression. [score:3]
The histogram shows the percentage of cells expressing these proteins in C666-1 cells transfected with miR-96 and miR-183 and that of the negative control. [score:3]
The correlation is likely to be due to the suppressive role of miR-183 in NPC CSCs. [score:3]
Expression of miR-96 and miR-183 was significantly decreased in sphere-forming C666-1 cells. [score:3]
b The tumorigenic potential of the C666-1 cells stably expressing miR-96 and miR-183 was assessed by tumor growth in an in vivo nude mice mo del. [score:3]
C666-1 cells were transiently transfected with miR-96, miR-183, Ambion® anti-miR™ miRNA inhibitors, or negative controls (Ambion, Austin, TX, USA) by Lipofectamine™ 2000 (Invitrogen) according to the manufacturer’s instructions. [score:3]
Although miR-96 and miR-183 have been suggested to be oncogenic, promoting tumor cell migration and invasion in various cancers [23– 26], studies have also shown that they play a critical role in epithelial-mesenchymal transition, via inhibition of cell migration and invasion, downstream of the p53-p21 pathway [27]. [score:3]
b The histogram shows the number of colonies formed in the C666-1 cells expressing miR-96 or miR-183 compared to that of the vector control. [score:2]
c No change in tumor sphere formation in the C666-1 cells co -transfected with miR-96 or miR-183 and the corresponding anti-miR inhibitors was observed when compared to negative controls (n = 3, all P > 0.05). [score:2]
Interestingly, a decrease in the number of spheres formed was observed in cells stably expressing miR-96 or miR-183 when compared to those with the vector (Fig.   3c). [score:2]
MiR-183 has a potent effect on the suppression of CSC properties in vitro and in vivo and may play a contributory role in NPC tumorigenesis. [score:2]
Lower panel: Representative photomicrographs reveal the difference in size of the spheres between each treatment groupC666-1 cells with stable miR-183 overexpression showed an observable decrease in the number of colonies formed when compared to those transfected with vectors (Fig.   2b, P = 0.18). [score:2]
Student’s t-test was used to determine statistical significance between the two groups (n = 3, ** P < 0.01) In Fig.   4b, the C666-1 cells stably expressing miR-183 showed a significant reduction in in vivo tumor formation when compared to those transfected with the vector in the nude mice mo del (P < 0.01). [score:2]
Significantly increased miR-96 and miR-183 expressions were detected in the stably lentiviral -transfected C666-1 lines by qRT-PCR when compared to that of non -transfected cells (Fig.   3a, P < 0.05). [score:2]
Lower panel: Representative photomicrographs reveal the difference in size of the spheres between each treatment group C666-1 cells with stable miR-183 overexpression showed an observable decrease in the number of colonies formed when compared to those transfected with vectors (Fig.   2b, P = 0.18). [score:2]
miR-96 and miR-183 repress stemness transcription factors and NOTCH signals. [score:1]
In the present study, we confirmed that miR-96 and miR-183 have the highest fold changes. [score:1]
The tumorigenicity of the stable miR-96- and miR-183 -transfected NPC cells was examined in an in vivo nude mice mo del. [score:1]
Among these miRNAs, miR-96 and miR-183 showed the highest fold change and were selected to elucidate their role in repressing NPC CSC properties. [score:1]
Student’s t-test was used to determine statistical significance between the two groups (n = 3, ** P < 0.01, *** P < 0.001) To evaluate the function of miR-96 and miR-183 in NPC, the effects of the ectopic expression of these miRNAs on cancer stem-like properties were studied in transiently transfected C666-1 cells. [score:1]
Nevertheless, further study of the stability and mode of delivery of miR-183 is required to develop an efficacious miRNA -based therapeutic approach for patients with NPC. [score:1]
The numbers of colonies formed by C666-1 cells transfected with miR-96 and miR-183 were obviously lower than those of the negative control (n = 3, P = 0.08). [score:1]
[1 to 20 of 85 sentences]
3
[+] score: 312
To determine whether ATPase/helicase activity of Ddx3x is required for inhibition of L-pri-miR-183/96/182 processing, we knocked down endogenously expressed Ddx3x in HEK293T cells by siRNAs and expressed siRNA-resistant (siRes) Ddx3x mutants bearing single amino-acid substitutions within the GKT (motif I; MutK230E) and SAT (motif III; MutS382L) motifs. [score:8]
We hypothesized that pri-miR-183/96/182 processing in the early postnatal retina is repressed by an inhibitor expressed in photoreceptors and that Rncr4 interferes with this inhibitor function in late postnatal and adult photoreceptors. [score:7]
We then tested whether inhibition of miR-183/96/182 activity in vivo increases Ddx3x expression by injecting retinas at P0 with AAV expressing a miR-183/96/182 triple sponge and enhanced GFP (EGFP) marker under the photoreceptor-specific mCAR promoter (Supplementary Fig. 3d). [score:7]
Possibly, in photoreceptors of the late postnatal or adult retina the Ddx3x regulatory function in processing of pri-miR-183/96/182 is suppressed by abundantly expressed Rncr4. [score:6]
This weakening is due to the suppressed expression of Crb1 by miR-183/96/182, which slowly starts to accumulate after P5 in response to Rncr4. [score:5]
Computational predictions identified Ddx3x mRNA as a potential target of miR-183, miR-96 and miR-182, bearing two conserved miRNA -binding sites in the 3′-untranslated repeat (UTR; Supplementary Fig. 3a), suggesting that miR-183/96/182 may act as a feedback signal controlling Ddx3x levels. [score:5]
Plasmids expressing individual green fluorescent protein (GFP)-tagged proteins were transfected into HEK293T cells together with a vector expressing L-pri-miR-183/96/182. [score:5]
We postulate a mo del (Fig. 7) of how the developmentally timed regulation of miR-183/96/182 and its target Crb1 could contribute to uniform layer architecture in the retina. [score:5]
Premature miR-183/96/182 accumulation inhibits Crb1 expression. [score:5]
Using HEK293T cells, we tested several variants of L-pri-miR-183/96/182 containing terminal and/or internal deletions and identified a truncated 0.5-kb-long version of L-pri-miR-183/96/182 termed T2-pri-miR-183/96/182 (Supplementary Fig. 4a), which was not subject to inhibition even in cells overexpressing Ddx3x (Supplementary Fig. 4b). [score:5]
Expression of T2-pri-miR-183/96/182 in mature retina, following AAV administration at P30, produced no changes in the organization of the photoreceptor layer at P46, despite a three- to fourfold increase in miR-183/96/182 expression (Supplementary Fig. 6). [score:5]
We then asked whether miR-183/96/182 inhibits Ddx3x expression in photoreceptors in vivo. [score:5]
As indicated above, in HEK293T cells depleted of endogenous Ddx3x, expression of siRes wild-type Ddx3x but not its ATPase/helicase mutants resulted in significant overaccumulation of co-expressed L-pri-miR-183/96/182 and a decrease in the level of mature miRNAs (see Supplementary Fig. 2). [score:5]
Our finding that the mCAR promoter is only functional in photoreceptors (Supplementary Fig. 5b) is consistent with the expression of Crb1 being post-transcriptionally regulated by miR-183/96/182 in these cells. [score:4]
The indirect influence of Rncr4 on the processing of pri-miR-183/96/182 by counteraction of the repressive effect of Ddx3x represents a novel form of gene expression control by lncRNAs. [score:4]
In contrast, expression of Ddx3x had a pronounced inhibitory effect on the processing of L-pri-miR-183/96/182, resulting in a 10-fold increase in pri-miR-183/96/182 and a concomitant 5-fold decrease in mature miR-183/96/182 levels compared with controls. [score:4]
We conclude that premature accumulation of miR-183/96/182, brought about either by Ddx3x knockdown or expression of constitutively processed T2-pri-miR-183/96/182, causes uneven distribution of cells within retinal photoreceptor and inner nuclear layers. [score:4]
This suggested direct targeting of Crb1 mRNA by miR-183/96/182. [score:4]
Alternatively, the accumulation of both could be regulated by the same factors, for example, transcription factors influencing the expression of both Rncr4 and pri-miR-183/96/182. [score:4]
The triple sponge was previously shown to effectively upregulate the investigated miR-183/96/182 targets in mouse retina 32. of protein extracts from the laser-dissected photoreceptors of P28 retina revealed that infection with AAV-mCAR-EGFP-triple sponge resulted in a marked increase in Ddx3x protein level compared with retina infected with the AAV-mCAR-EGFP/control, indicating that Ddx3x is also regulated by miR-183/96/182 in vivo (Supplementary Fig. 3e). [score:4]
Why would the precocious accumulation of mature miR-183/96/182, in response to either Ddx3x knockdown or T2-pri-miR-183/96/182 expression, lead to variability in the thickness of the photoreceptor and inner nuclear layers? [score:4]
Ddx3x inhibits the pri-miR-183/96/182 processing. [score:3]
The network incorporates a feedback loop in which miR-183/96/182 targets Ddx3x mRNA. [score:3]
Eyes were injected subretinally at P0 with scAAVs expressing GFP and either T2-pri-miR-183/96/182 or control RNA. [score:3]
Cells were transfected with a mixture of two siRNAs (siDdx3x-I and -II) and plasmid expressing L-pri-miR-183/96/182. [score:3]
Taken together, our data indicate that Rncr4 acts as an inhibitor of Ddx3x while Ddx3x represses pri-miR-183/96/182 processing. [score:3]
Crb1 is targeted by prematurely accumulating miR-183/96/182. [score:3]
To explore the link between Rncr4 and miR-183/96/182 biogenesis in a more physiological setting, we analysed the expression of pri-miR-183/96/182 in the mouse retina during development and compared it with the accumulation of mature miR-183/96/182 and Rncr4. [score:3]
In early postnatal photoreceptors, Ddx3x helicase inhibits processing of pri-miR-183/96/182 to mature miRNAs. [score:3]
Alternatively, the Ddx3x inhibitory effect on pri-miR-183/96/182 processing may involve a further cofactor present in early postnatal but not late postnatal or adult photoreceptors. [score:3]
We used reporters with a firefly luciferase (FL)-coding sequence fused to the Ddx3x 3′-UTR, containing either wild-type or mutant miRNA -binding sites, to test a potential inhibitory influence of miR-183/96/182 on Ddx3x mRNA function. [score:3]
Lack of miR-183/96/182 allows high Crb1 expression essential for establishment of a strong OLM that in turn ensures that photoreceptor cells form a uniform layer. [score:3]
We then injected retinas at P0 with scAAVs expressing T2-pri-miR-183/96/182 under control of either ubiquitous EF1a or photoreceptor-specific mCAR promoter (Fig. 5a and Supplementary Fig. 5a). [score:3]
Co -expression of Vax2OS1 or CrxOS1 RNA had no effect on L-pri-miR-183/96/182 processing (Fig. 1g). [score:3]
In HEK293T cells depleted of endogenous Ddx3x, neither of the overexpressed Ddx3x mutants repressed L-pri-miR-183/96/182 processing, while wild-type Ddx3x efficiently rescued the repression (Supplementary Fig. 2). [score:3]
In addition, miR-183/96/182 targets Ddx3x, possibly leading to further potentiation of pri-miR-183/96/182 processing. [score:3]
Ddx3x is a target of miR-183/96/182 in photoreceptors. [score:3]
Lane 3 represents an additional control showing that overexpression of Ddx3x-GFP further represses L-pri-miR-183/96/182 processing; n=3. [score:3]
RT–qPCR analysis of Rncr4 expression in retinas at embryonic (E) days 14.5, 16.5 and 18.5 and postnatal (P) days 5, 10, 16 and 28 revealed a pattern very similar to the accumulation of miR-183/96/182. [score:3]
Ddx3x inhibits pri-miR-183/96/182 processing. [score:3]
It will also be interesting to find out whether, apart from being an miRNA source, the pri-miR-183/96/182 transcript has other functions that would justify its early P5 expression. [score:3]
Construction of miR-183/96/182 -expressing vectors. [score:3]
Although Ddx3x can directly interact with different proteins 44, given the observed specificity of regulation towards pri-miR-183/96/182, it is unlikely that Ddx3x binds to and modifies the Dgcr8/Drosha complex; such a situation would be expected to affect miRNA maturation more globally. [score:3]
Rncr4 antagonizes inhibitory effect of Ddx3x on pri-miR-183/96/182 processing. [score:3]
Reverse transcription quantitative–PCR (RT–qPCR) analysis of total RNA from different mouse tissues revealed highly enriched Rncr4 expression in the retina, similar to that of pri-miR-183/96/182 and mature miR-183/96/182 (Fig. 1b and Supplementary Fig. 1a,b). [score:3]
Cells treated with control siRNA or a mixture of two Ddx3x-specific siRNAs (siRNA-I and siRNA-II) were co -transfected with plasmid expressing L-pri-miR-183/96/182. [score:3]
Computational predictions identified Crb1 as a potential target of miR-183 and possibly also of miR-182 and miR-96, since they contain seed regions related to that of miR-183. [score:3]
Similar patterns of Rncr4 and miR-183/96/182 expression. [score:3]
Since miR-183/96/182 is predominantly expressed in photoreceptors 29 31, we used laser-capture microscopy together with RT–qPCR to determine the time course of Rncr4 and miR-183/96/182 accumulation in isolated photoreceptor layers (Fig. 1e,f). [score:3]
Surprisingly, co -expression of Rncr4 resulted in strongly enhanced processing of L-pri-miR-183/96/182. [score:3]
In this network, referred to as the ncRNA–Ddx3x network, Ddx3x inhibits processing of pri-miR-183/96/182 to mature miRNAs in early postnatal photoreceptors. [score:3]
Values for mixture (Mix) of all RNA samples were set to 1. (b) RT–qPCR analysis of miR-183/96/182 and pri-miR-183/96/182 levels in HEK293T cells expressing L-pri-miR-183/96/182 and different helicases reveals repressive effect of Ddx3x, but not Ddx5 and Ddx17, on pri-miR-183/96/182 processing; n=3. [score:3]
The cells were co -transfected with plasmids expressing the central 5.5-kb region of pri-miR-183/96/182 (referred to as long (L)-pri-miR-183/96/182) encoding all three miR-183/96/182 miRNAs and either Rncr4, or one of two further retinal lncRNAs, Vax2OS1 or CrxOS (ref. [score:3]
In early photoreceptors, when mature miR-183/96/182 is not present, Crb1 is expressed at a high level and ensures the formation of a strong adhesion belt between Müller glia and photoreceptors. [score:3]
Supplementary Figures 1-8, Supplementary Tables 1 Supplementary Figures 1-8, Supplementary Tables 1 (a) Schematic representation of the mouse miR-183/96/182 gene locus with Rncr4 expressed as an opposite-strand transcript relative to pri-miR-183/96/182. [score:3]
We suggest that Crb1, demonstrated here to be a target of miR-183/96/182 in vitro and in vivo, forms one of the links between the miRNA level and disruption of retinal architecture. [score:3]
We asked whether Crb1 mRNA is a target of miR-183/96/182 repression. [score:3]
The perturbation of the network by premature Ddx3x depletion or precocious accumulation of mature miR-183/96/182 decreases the Crb1 expression, resulting in weakening of OLM and, consequently, a large regional variation in the thickness of the photoreceptor layer and the adjacent inner nuclear layer (not shown in the scheme). [score:3]
Data were normalized to 18S rRNA (Figs 1b–f,h–i and 2a,g and Figs 5b, and Supplementary Figs 1a,b,f and 3f, 5c, and 6a) or a control gene carried by pri-miR-183/96/182 -expressing plasmids (Figs 1g, 2b,c and 3a and Supplementary Figs 2 and 4b). [score:3]
We investigated the relationship between Rncr4 and miR-183/96/182 expression first using HEK293T cells, which do not endogenously express either miR-183/96/182 or lncRNA (corresponding to Rncr4) at appreciable levels. [score:3]
Taken together, the data show that targeting of Crb1 mRNA by miR-183/96/182 prematurely accumulating in early postnatal photoreceptors results in a decrease in the Crb1 protein level, which affects integrity of the outer limiting membrane in the developing retina. [score:3]
The specific association of pri-miR-183/96/182 with Ddx3x but not Drosha/Dgcr8 in extracts of the P5 retina suggested, as in HEK293T cells, that Ddx3x also inhibits pri-miR-183/96/182 processing in the retina. [score:3]
We now found that co -expression of wild-type Ddx3x and Rncr4 in HEK293T cells resulted in strongly enhanced processing of L-pri-miR-183/96/182, with a significant fourfold increase in mature miRNAs and a fivefold decrease in L-pri-miR-183/96/182 levels compared with the controls (Fig. 3a). [score:2]
Inspection of the pri-miR-183/96/182 locus revealed that lncRNA Rncr4 is transcribed in the opposite direction from a region upstream of the pri-miR-183/96/182 gene (Fig. 1a). [score:2]
Rncr4 is encoded by a region upstream of pri-miR-183/96/182 and is transcribed in the opposite direction to pri-miR-183/96/182. [score:2]
The corresponding DNA was chemically synthesized by GENEWIZ (South Plainfield) and cloned into the XhoI-cleaved beta-globin intron of the pEGP backbone (to yield pEGP-T2-pri-miR-183/96/182) or into pCMV-MIR vector (OriGene Technologies) directly downstream of the CMV promoter (to yield pCMV-T2-pri-miR-183/96/182). [score:2]
We have described a regulatory network consisting of lncRNA Rncr4, RNA helicase Ddx3x and miR-183/96/182 that controls the timing of miR-183/96/182 accumulation in photoreceptors. [score:2]
Furthermore, immunostaining of the P16 scAAV-mCAR-dsRed-T2-pri-miR-183/96/182-infected retina revealed a strong decrease in Crb1 expression in the outer limiting membrane compared with the control retina (Fig. 6c). [score:2]
Taken together, our findings suggest that Ddx3x and miR-183/96/182 form a reciprocal -negative regulatory loop that mutually influences their levels and activities in developing photoreceptors. [score:2]
To test whether the increased variance in photoreceptor layer thickness in Ddx3x-knockdown retina can be explained by premature formation of miR-183/96/182, we precociously induced miR-183/96/182 accumulation. [score:2]
Studies of pri-miR-183/96/182 processing in HEK293T cells were performed with both types of constructs, those containing pri-miRNA sequences cloned into human beta-globin intron of pEGP and those cloned into pCMV backbone, directly downstream of the CMV promoter. [score:2]
Expression of Ddx5 and Ddx17 had no significant effect on L-pri-miR-183/96/182 processing compared with the controls (Fig. 2b). [score:2]
At P16, Ddx3x knockdown increased mature miR-183/96/182 levels in photoreceptors by 1.5-fold over the control (Fig. 2f,g). [score:2]
Most importantly, we found that premature accumulation of miR-183/96/182 processed from T2-pri-miR-183/96/182 resulted in a phenotype similar to that seen in the early knockdown of Ddx3x, with retinas at P10 and later having a wavy form with pronounced folds in the photoreceptor layer, as well as large regional variation in thickness (Fig. 5c,d and Supplementary Fig. 5d,e). [score:2]
We conclude that Rncr4 accumulates in retinal photoreceptors with developmental kinetics similar to those of sensory-neuron-enriched miR-183/96/182. [score:2]
The effect also requires that Ddx3x is catalytically proficient since mutations in its GKT and SAT motifs eliminated the pri-miR-183/96/182 repressor activity of the protein. [score:2]
The first indication of a possible biological role for the delay in the formation of mature miR-183/96/182 in developing photoreceptors came from the examination of mice subjected to photoreceptor-specific knockdown of Ddx3x at P0. [score:2]
The tight control of miR-183/96/182 maturation in the retina by Rncr4 may be just one example of a more widespread lncRNA -dependent regulation of miRNA processing. [score:2]
Truncated pri-miR-183/96/182 version 2 (T2) was designed in silico to retain pre-miR-183 and pre-miR-96 (chr6 30169427-30169777; minus strand) and pre-miR-182 (chr6 30165904-3030166007; minus strand) hairpins and some flanking sequences as annotated in miRBASE v. 20 (www. [score:1]
Premature miR-183/96/182 accumulation leads to changes in the retinal architecture. [score:1]
While pri-miR-183/96/182 levels decreased two- to threefold between P5 and P28, miR-183/96/182 and Rncr4 increased during that time by ∼10-fold and 4- to 10-fold, respectively. [score:1]
Having established that Rncr4 acts as an activator and Ddx3x as an inhibitor of pri-miR-183/96/182 processing, we investigated the mechanisms involved, first by studying the relationship between Ddx3x and Rncr4 in HEK293T cells. [score:1]
The effect of Rncr4 was specific since two other retinal lncRNAs, Vax2OS1 and CrxOS1, had no effect on L-pri-miR-183/96/182 processing. [score:1]
In adults, Rncr4 antagonizes the repressive effect of Ddx3x on pri-miR-183/96/182 what leads to high miR-183/96/182 accumulation. [score:1]
For, L-pri-miR-183/96/182 and pri-miR-128-1 RNAs were in vitro transcribed using the pCMV backbone constructs as templates and MEGAscript T7 kit (Ambion). [score:1]
The pri-miR-183/96/182 gene is an intergenic unit located on mouse chromosome 6 between the two protein-coding genes Ube2H and Nrf1. [score:1]
We next tested whether endogenous Ddx3x present in retinal extracts interacts with L-pri-miR-183/96/182. [score:1]
The RNA pull-down experiment identified Ddx3x as strongly bound and Drosha and Dgcr8 as weakly bound by L-pri-miR-183/96/182 at P5 (Fig. 2d). [score:1]
To determine whether the observed delay in accumulation of mature miRNAs was specific to pri-miR-183/96/182, we measured the levels of pri-miRNAs and mature miRNAs for neuronal miR-128 and ubiquitously expressed miR-16 in developing retina. [score:1]
Significantly, we found that precocious formation of miR-183/96/182 not only results in a dramatic decrease in Crb1 but also, likely as a consequence of the Crb1 changes, in altered distribution of several other components of the outer limiting membrane, compromising its structural integrity (Fig. 6c). [score:1]
This resulted in a significant increase in mature miR-183/96/182 levels already at P5, that is, at a time when mature miR-183/96/182 are normally very low (see Fig. 2g). [score:1]
No delays in processing, similar to that seen for miR-183/96/182, were observed for miR-128 or miR-16 (Supplementary Fig. 1f). [score:1]
Moreover, as is the case of miR-183/96/182 (ref. [score:1]
We conclude that Ddx3x acts as a repressor of pri-miR-183/96/182 processing in transfected HEK293T cells and that this function requires ATPase/helicase activity of the protein. [score:1]
To evaluate the properties of the T2-pri-miR-183/96/182 -expressing retinas, we analysed rod- and cone -mediated photoresponses using a high-density microelectrode array at P16 (ref. [score:1]
For this, we engineered a pri-miR-183/96/182 form that is immune to Ddx3x -mediated repression. [score:1]
Precocious accumulation of mature miR-183/96/182 would lead to premature weakening of the outer limiting membrane barrier, resulting in a bag with a less robust wall. [score:1]
We conclude that Rncr4 has the potential to antagonize the repressive effect of Ddx3x on pri-miR-183/96/182 processing. [score:1]
Consistent with the results of previouss (see Fig. 2d), RT–PCR also revealed a markedly higher association of Ddx3x with pri-miR-183/96/182 in P10 than in P28 retinas (Fig. 3b). [score:1]
The photoreceptor-specific knockdown of Ddx3x resulted in a threefold decrease in pri-miRNA and fivefold increase in mature miR-183/96/182 levels in photoreceptors of P5 and P10 retinas compared with control shRNA. [score:1]
T2-pri-miR-183/96/182 processing to mature miRNAs is not a subject of Ddx3x -mediated repression, which suggests that elements other than junction structures within pri-miRNA hairpins are important for initiating Ddx3x binding. [score:1]
In HEK293T cells, the activity of a pFL-Crb1_wt_3′UTR reporter, bearing a wild-type Crb1 3′UTR, was significantly reduced by a co -transfected miR-183 mimic and less strongly reduced by miR-96 and miR-182 mimics compared with the reporter having mutations in the miR-183/96/182 sites (Fig. 6a). [score:1]
Sequence of T2-pri-miR-183/96/182, with mature miRNAs underlined, is: 5′-cctctgcagggtctgcaggctggagagtgtgactcctgtcctgtg tatggcactggtagaattcactgtgaacagtctcagtcagtgaattaccgaagggccataaacagagcagagacagatccgcgagcaccttggagctcctcacccctttctgcctagacctctgtttccaggggtgccagggtacaaagacctcctctgctccttccccagagggcctgttccagtaccatctgcttggccgat tttggcactagcacatttttgcttgtgtctctccgctgtgagcaatcatgtgtagtgccaatatgggaaaagcgggctgctgcggccacgttcacctcccccggcatcccataataaaaacaagtatgctggaggcctcccaccatt tttggcaatg gtagaactcacaccggtaaggtaatgggacccggtggttctagacttgccaactatggtgtaagtgctgagct-3′. [score:1]
Further work will establish the molecular basis of the controlled processing of pri-miR-183/96/182. [score:1]
Rncr4 stimulates processing of pri-miR-183/96/182. [score:1]
Triple sponge sequence specific for mouse miR-183/96/182 miRNAs was designed and obtained as described 32. [score:1]
Hence, by antagonizing the repressive effect of Ddx3x, Rncr4 is an activator of pri-miR-183/96/182 processing in late postnatal photoreceptors (see). [score:1]
Rncr4 antagonizes effect of Ddx3x on pri-miR-183/96/182. [score:1]
To generate pEGP-L-pri-miR-183/96/182 and pEGP-T1-pri-miR-183/96/182 constructs, pri-miR-183/96/182 sequences corresponding to the chr6 30165145-30170699 (minus strand) for L-pri-miR-183/96/182 or chr6 30165358-30166397 fused to 30169118-30170157 (minus strand) for T1-pri-miR-183/96/182 were PCR-amplified using mouse retinal cDNA as a template and cloned into human β-globin intron of the pEGP-mir null backbone (Cell Biolabs) digested with XhoI (New England Biolabs). [score:1]
Control scAAV-EF1a-GFP-Control and scAAV-mCAR-dsRed-Control constructs contained fragments of β-globin intron (sequence from pEGP-mmu-miR-182 plasmid; Cell Biolabs) of the length corresponding to T2-pri-miR-183/96/182. [score:1]
LncRNA Rncr4 accumulates parallel to miR-183/96/182 and stimulates pri-miR-183/96/182 processing. [score:1]
The similar accumulation profiles of Rncr4 and miR-183/96/182 may arise in at least two different ways. [score:1]
Immobilized L-pri-miR-183/96/182 was incubated with cell lysates of retinas from P5 and P28 mice and the L-pri-miR-183/96/182-bound proteins were analysed using western blot analysis. [score:1]
To generate pCMV-L-pri-miR-183/96/182 and pCMV-pri-miR-128-1, L-pri-miR-183/96/182 and pri-miR-128-1 (chr1: 128202201–128202739) sequences were PCR-amplified from mouse cDNA and cloned into pCMV-MIR vector. [score:1]
The scAAV-EF1a-GFP-T2-pri-miR-183/96/182 and scAAV-mCAR-dsRed-T2-pri-miR-183/96/182 constructs were obtained by cutting scAAV2-MCS (Cell Biolabs) with BalI/NotI. [score:1]
The results with HEK293T suggested that Rncr4 has a stimulatory effect on the processing of pri-miR-183/96/182 rather than on the transcription of its gene. [score:1]
To determine whether integrity of the outer limiting membrane is modified by the precocious miR-183/96/182 accumulation, we examined by immunostaining the status of several proteins known to localize to the structure. [score:1]
It is possible that Rncr4 interferes with the Ddx3x/pri-miR-183/96/182 interaction through base pairing or structural contacts with pri-miRNA. [score:1]
The Ddx3x protein level decreased gradually in photoreceptors between P5 and P28 (Supplementary Fig. 3c), consistent with a gradual accumulation of miR-183/96/182 (see Fig. 1f). [score:1]
Taken together, the results of these in vitro and in vivo experiments support a mo del in which Rncr4 specifically stimulates conversion of pri-miR-183/96/182 to mature miR-183/96/182 in developing photoreceptors. [score:1]
In contrast, L-pri-miR-183/96/182 pulled down less Ddx3x but more Drosha and Dgcr8 at P28 than at P5. [score:1]
We tested whether these DEAD-box proteins influence the biogenesis of miR-183/96/182. [score:1]
The transgene cassettes containing EF1a (sequence from pEGP-mmu-miR-182 plasmid; Cell Biolabs) or mCAR promoter 40, EGFP (from pEGP-mmu-miR-182 plasmid; Cell Biolabs) or dsRed 52, T2-pri-miR-183/96/182 sequence, WPRE motif and 5′-BalI and 3′-NotI adapters were chemically synthesized by GENEWIZ and inserted into the scAAV backbone. [score:1]
We did not find extensive complementarity regions between Rncr4 and pri-miR-183/96/182, suggesting that the assumed interactions involve structural rather than sequence determinants. [score:1]
We observed the scAAV -dependent accumulation of miR-183/96/182 already at P5, consistent with the failure of Ddx3x to repress T2-pri-miR-183/96/182 in early postnatal retina (Fig. 5b and Supplementary Fig. 5c). [score:1]
Notably, pri-miR-183/96/182 levels in isolated retinas or laser-captured photoreceptor layers were already close to or at their maximum at P5 (Fig. 1h,i), that is, at the stage when the accumulation of both mature miR-183/96/182 and Rncr4 was just beginning (Fig. 1c–f). [score:1]
If Ddx3x functions in a similar way, this may explain why it affects processing of all three pri-miRNA hairpins present in pri-miR-183/96/182. [score:1]
We conclude that Ddx3x acts as a repressor of pri-miR-183/96/182 processing in early postnatal photoreceptors. [score:1]
Such junction structures are present in T2-pri-miR-183/96/182, the extensively deleted form of pri-miR-183/96/182. [score:1]
Thus, Ddx3x binding may modify the structure of pri-miR-183/96/182 such that it is no longer efficiently recognized and processed by the Dgcr8/Drosha complex. [score:1]
[1 to 20 of 130 sentences]
4
[+] score: 256
Other miRNAs from this paper: hsa-mir-96, mmu-mir-182, hsa-mir-182, hsa-mir-183, mmu-mir-96
Sylamer analysis of 912 miRNA target heptamers, including all conserved 8mer, 7mer-m8, 7mer-1A sites from TargetScan 6.2, revealed significant depletion of two miR-183 cluster target heptamers (GTGCCAA, TGCCAAA) in downregulated Tg [1MDW/1MDW] P5-OC 3′UTRs (Fig.   6A), complementing the TargetScan 6.2 -based hypergeometric analysis (Table  5, Fisher’s Exact Test P = 0.017). [score:12]
In miR-183C [GT/GT] 5wk-retina, our hypergeometric analysis demonstrates that combined loss of all miR-183 cluster miRNAs results not only in enrichment (Odds Ratio 1.65–1.70, FDR-adjusted P < 0.05, Table  5) of miR-183 cluster targets in miR-183C [GT/GT] upregulated genes (uncorrected P < 0.05, fold change >+ 1.05), but also the reciprocal depletion of miR-96 and miR-182 targets (Odds Ratio 0.52, 0.58, respectively, FDR-adjusted P < 0.05, Table  5) in miR-183C [GT/GT] downregulated genes (uncorrected P < 0.05, fold change <−1.05). [score:11]
The effects mediated by miRNAs on inner ear morphogenesis, neurosensory cell identity, function and homeostasis indicate that gene regulation through miRNAs are critical to the biology of the inner ear 1– 6. The polycistronic cluster of Mir96, Mir182 and Mir183 genes are abundantly expressed in afferent cochlear and vestibular neurons and their peripheral innervating targets: auditory and vestibular hair cells (HCs) 7– 9. From an evolutionary viewpoint, the miR-183 cluster of miRNA genes are syntenic, highly conserved and co-expressed in neurosensory organs of animals representing several taxonomic phyla, suggesting that the control of gene expression through by this miRNA cluster is highly coordinated and under extraordinary selective pressure [10]. [score:10]
Since Notch signaling is regulated by miRNAs in Drosophila [43], one testable hypothesis using Tg [1MDW/1MDW] is to ask whether SC miR-183 cluster expression affects Notch -mediated cell fate specification and/or homeostasis as the mechanism for how targeted misexpression of the HC specific miR-183 cluster may increase the propensity of SCs to transdifferentiate into HCs, an emerging paradigm for treating hearing loss 44– 46. [score:8]
In the P5-OC, the majority of changed genes (27/32) were downregulated (Fig.   5A, Table  2), whereas in P18-cochlea, the majority were upregulated (37/45), not counting Prm1 and miR-183 cluster miRNAs (Fig.   5B, Table  3). [score:7]
The majority of downregulated genes observed by microarray (Table  2) at P5 are glial cell specific, supporting a significant influence of miR-183 cluster gene regulation on glial cell misexpression, most likely from Schwann cells that underlie the greater epithelial ridge (GER) and inner sulcus in the P5 OC microdissected tissue. [score:7]
This mammalian miRNA misexpression mo del demonstrates the potency of small non-protein coding miRNAs and should be useful in genomic/transcriptomic/proteomic studies to identify primary miR-183 cluster target genes and regulatory, structural and/or metabolic pathways affected by their dysregulation. [score:7]
Given that miR-183 cluster expression requires Atoh1 -mediated HC specification [9], the miR-183 cluster likely serves a crucial function in HC differentiation by downregulating Sox2, Notch1, and Hes1, thus contributing to Atoh1 specific HC fate determination. [score:6]
For each miR-183 cluster miRNA, we found enrichment (Odds Ratio 1.43–1.45, FDR-adjusted P < 0.05, Table  5) of evolutionarily conserved 3′UTR seed targets in P5 Tg [1MDW/1MDW] downregulated genes (uncorrected P < 0.05, fold change <−1.05). [score:6]
This transcriptome level microarray analysis validates the engineered intent of Tg [1MDW], i. e. miR-183 cluster SC misexpression to downregulate genes that are disproportionate with respect to miR-183 cluster 3′UTR-bearing seed sequences. [score:6]
miR-183 cluster mediated translational repression of select target genes. [score:5]
The presence of additional HCs in this mouse mo del of SC miR-183 cluster misexpression is consistent with previous studies in both zebrafish and chicken where overexpression of miR-183 cluster miRNAs increased inner ear HC numbers 11, 12. [score:5]
Based on these data, we hypothesized that the miR-183 cluster, if misexpressed in SCs, would, in the context of mutual exclusion, perturb SC gene expression. [score:5]
In WT OC, the cell-specific mutual exclusion of miR-183 cluster expression from their respective mRNA targets ensures that HCs enforce repression of genes both temporally and spatially, relative to those same genes in SCs. [score:5]
Taken together, the hypergeometric analysis of Tg [1MDW/1MDW] demonstrates that at P5 in the OC, miR-183 cluster target genes, defined by both miRNA and 3′UTR seed site evolutionary conservation, are reduced concomitantly with transgenic overexpression of miR-183, mir-96 and miR-182. [score:5]
The mutual exclusion hypothesis of miRNA function [16] predicts that miR-183 cluster misexpression in adjacent and lineage-related SCs should repress evolutionarily conserved target genes essential to SC identity/function. [score:5]
The mutual exclusion hypothesis of miRNA function [16] predicts that in Tg [1MDW/1MDW], miR-183 cluster misexpression, driven by the GFAP promoter in adjacent and lineage-related SCs (compare Fig.   1A,B) should repress evolutionarily conserved target genes that are simultaneously essential to SC function and incompatible for attaining and/or maintaining the HC fate. [score:5]
Overall, sensory HC degeneration in Tg [1MDW/1MDW] mice suggests a significant potency of these three miRNAs in effecting tissue homeostasis through GFAP promoter -driven miRNA-183 cluster misexpression and represents a novel biological reagent useful to identify molecular pathways and mRNAs targeted by the miR-183 cluster. [score:5]
So, while there is evidence for reciprocal effects on miR-183 cluster target sites, these mo dels do exhibit common gene expression changes, as well. [score:5]
To direct misexpression of miR-96, miR-182 and miR-183 in the SCs of the inner ear, we modified an established GFAP promoter -driven reporter construct (pGFA-nlac, Michael Brenner, UAB) by substituting the nLacZ gene with the miR-183 cluster coding sequences [23]. [score:4]
Phenotypic correlation of extra IHCs in SC-specific single-gene mutants are consistent with negative regulation of these predicted miR-183 cluster target genes. [score:4]
These extra IHCs phenocopy single-gene hypomorphic and null mutations in genes that specify SC identity and that are predicted targets of miR-183 cluster miRNAs (Fig.   2D) 25– 29, 36– 38. [score:4]
We confirmed transgenic SC miR-183 cluster expression directly by dual whole mount ISH/IHC using LNA-DIG labeled probes against miR-182 and an antibody against MYO6 (Fig.   1A–D). [score:4]
In this process, presumptive HCs upregulate the TF Atoh1, notch ligands Delta1 (Dll1) and Jagged 2 (Jag2), and the miR-183 cluster. [score:4]
Mutations in genes that are predicted targets of the miR-183 cluster phenocopy Tg [1MDW/1MDW] -mediated increases in IHCs. [score:4]
Rapid age-related demise of HCs, observed in this mo del both histologically (Figs  7, 8) and physiologically (Fig.   9), suggests a specific potency to dysregulation of miR-183 cluster target genes on postnatal OC homeostasis and function. [score:4]
To test this hypothesis, we engineered Tg(GFAP- Mir183,Mir96,Mir182) (Tg [1MDW]) mice to drive ectopic miR-183 cluster expression using the core human promoter of the glial fibrillary acidic protein (GFAP). [score:3]
Irrespective of age, the most upregulated Affymetrix probesets were genetic elements of Tg [1MDW]: Mir183, Mir96, Mir182 and Prm1 (boxed probesets). [score:3]
Alternatively, the miRNA/mRNA interactions could include non-conserved and/or off-target effects of the miR-183 cluster. [score:3]
Taken together, these results confirm ectopic miR-183 cluster expression in OC SCs, spiral limbus cells and the Schwann cells that ensheathe neuronal processes projecting to and from the OC. [score:3]
MYO6 is a marker of HC differentiation, suggesting that miR-183 cluster misexpression and its cytoplasmic localization are positive effectors of HC identity. [score:3]
However, further evidence of transgenic SC miR-183 cluster expression was obtained through quantitative RT-PCR, which showed 2.9-, 2.7- and 2.2-fold higher levels of miR-182, miR-96 and miR-183, respectively, in Tg [1MDW/1MDW] versus WT P18-cochlear total RNA (Fig.   1E). [score:3]
This is likely due to G:U wobble base pairs at nucleotides 4 and 5 of miR-183 which, while thermodynamically favorable, can drastically reduce the efficacy of miRNA -mediated translational repression [30]. [score:3]
2009.01.003 19602392 9. Weston MD MicroRNA-183 family expression in hair cell development and requirement of microRNAs for hair cell maintenance and survivalDev. [score:3]
Name Use Sequence (5′-3′) Length Atoh1-U PCR CTGAAAACTGAGACAACCAAATGC 23 Atoh1-L PCR AAGGGTGCAGGGATATTTGTCA 21 Atoh1-Hex 5′ nuclease probe HEX™-TCCTAGCGCGCGGGAAGCC-BHQ-1® 19 Tg-U PCR AACAGCCAGATCACCTTTCACTGC 24 Tg-L PCR GCGCTCTTCCCACAGTTAACACAA 24 Tg-Fam 5′ nuclease probe 6-FAM™-AGGGATATCGGGCTTGAGGAGGTTT-BHQ-1® 25 While there appears to be compelling evidence for wider effects on conserved miRNA targets in P18-cochlea, the hypergeometric analysis did not reveal convincing miR-183 cluster effects in the P18-cochlea microarray data. [score:3]
The spatiotemporal expression pattern of Mir96, Mir182 and Mir183 in the developing vertebrate inner ear and the effects induced by modulating levels of these miRNAs on HC fate determination in zebrafish and chicken argue that these miRNAs collectively function, to some degree, in the transition from inner ear prosensory cells towards a HC fate 8, 9, 11, 12. [score:3]
Interestingly, this extra IHC patterning in Tg [1MDW/1MDW] phenocopies both hypomorphic and null mutants of genes (i. e. Jag1, Sox2, Hes1) that are: 1) markers of differentiated SCs and; 2) predicted targets of miR-183 cluster miRNAs (Fig.   2D) 25– 29. [score:3]
Irrespective of age, the most upregulated Affymetrix probesets were genetic elements of Tg [1MDW]: Mir183, Mir96, Mir182 and Prm1 (Fig.   5A,B, boxed probesets), with fold changes + 5.67 (P18- Prm1) to + 16.97 (P18- Mir182). [score:3]
Importantly, this enrichment is consistent with repression of miR-183 cluster target genes at evolutionarily conserved sites in Tg [1MDW/1MDW] P5-OC. [score:3]
While it can’t be ruled out that integration of Tg [1MDW] may have disrupted an endogenous gene critical for hair cell survival, comparing Tg [1MDW/1MDW] whole transcriptome effects to those from previously published miR-183 cluster mouse loss-of-function mutants (Fig.   6, Table  5) revealed reciprocal effects on miR-183 cluster target sites. [score:3]
By E15.5, miR-183 cluster expression distinguishes differentiated cochlear HC, which suggests a role for these miRNAs in this cell type transition [9]. [score:3]
Unfortunately, we were unable to identify clear differences in miR-183 cluster expression in WT versus Tg [1MDW/1MDW] at earlier ages (i. e. P5 and P10, data not shown). [score:3]
Transgenic Tg [1MDW/1MDW] mice were developed to misexpress miR-183 cluster in OC SCs to further explore the role of these HC-specific miRNAs on OC cell differentiation. [score:3]
Name Use Sequence (5′-3′) Length Atoh1-U PCR CTGAAAACTGAGACAACCAAATGC 23 Atoh1-L PCR AAGGGTGCAGGGATATTTGTCA 21 Atoh1-Hex 5′ nuclease probe HEX™-TCCTAGCGCGCGGGAAGCC-BHQ-1® 19 Tg-U PCR AACAGCCAGATCACCTTTCACTGC 24 Tg-L PCR GCGCTCTTCCCACAGTTAACACAA 24 Tg-Fam 5′ nuclease probe 6-FAM™-AGGGATATCGGGCTTGAGGAGGTTT-BHQ-1® 25While there appears to be compelling evidence for wider effects on conserved miRNA targets in P18-cochlea, the hypergeometric analysis did not reveal convincing miR-183 cluster effects in the P18-cochlea microarray data. [score:3]
Taken together, these results suggest that Sox2, Notch1, and Hes1 are genuine miR-183 cluster targets. [score:3]
As expected, relative luciferase activity in cells co -transfected with miR-182 and reporter vector containing the Sox2 3′ UTR is reduced by nearly 20%, confirming previous findings that Sox2 is a miR-183 cluster target [9]. [score:3]
For P18-cochlea, Sylamer analysis showed no significant (conserved, non-conserved and/or off-target) effects attributable to miR-183 cluster (Fig.   6B). [score:3]
One possibility is that miR-183 cluster primary effects on gene expression observed at P5 are masked by increasing secondary effects at P18. [score:3]
Jag1, however, failed to validate as a target of any miR-183 cluster member with statistical significance. [score:3]
While the mechanism for the genesis of these extra IHCs is unknown, one possibility is that the transgenic miR-183 cluster expression promotes SC-to-HC transdifferentiation. [score:3]
Indeed, our dual luciferase assays validated Sox2, Notch1 and Hes1 3′UTRs as targets for post-transcriptional repression by miR-183 cluster members (Fig.   4). [score:2]
The miR-183/miR-96 PCR product was directionally cloned into the XmaI-EcoRV sites within the polycloning region of pIRES-hrGFPII (Stratagene) to create p183-X-E. The miR-182 PCR product was subsequently cloned into the EcoRV-NotI sites of p183-X-E to create p182-10. [score:2]
Line name FISH localization Intercross genotypes scoredMen delian ratio χ [2] P-valueTg genotype (log2 [−∆∆CT]) MGI submission # WT = 154 N/ATg [1MDW] Chr 9E3 Het = 240 0.017 5.9 ± 1.3 MGI:5436579 Homo = 113 10.6 ± 2.4 WT = 23 N/ATg [2MDW] Chr 16C1~3.1 Het = 36 0.40 7.5 ± 2.8 MGI:5436582 Homo = 25 15.6 ± 6.7 WT = 25 N/ATg [3MDW] Chr 16 A~B2 Het = 49 0.98 2.2 ± 0.3 MGI:5436584 Homo = 22 3.9 ± 0.7 FVB/NClr-Tg(GFAP- Mir183,Mir96,Mir182)1MDW miceSCs in the postnatal inner ear organ of Corti (OC) express endogenous GFAP and human GFAP-promoter driven GFP and LacZ reporters 21, 22. [score:2]
Indeed, the common HC phenotypes in regards to stereocilia defects, ABR threshold elevation and HC death, while more severe in Mir96 [+/ddl] heterozygotes, are similar and suggest a narrow range of tolerance for modulations in miR-183 cluster miRNA levels, and therefore the genes they regulate. [score:2]
HEK293 cells transfected with p182-10 verified expression and processing of significantly elevated levels of mature miR-183 cluster miRNAs using commercial miRNA PCR assays (Ambion, data not shown). [score:2]
Pierce ML MicroRNA-183 family conservation and ciliated neurosensory organ expressionEvol. [score:2]
To evaluate transcriptome effects directly attributable to the miR-183 cluster, we performed hypergeometric analyses using a non-redundant set of evolutionarily conserved miRNA/3′UTR seed sequences: 153 vertebrate miRNAs and 62,793 3′UTR seed sites (8mer, 7mer-m8, 7mer-1A, 3comp, TargetScan 6.2 [29]). [score:2]
Luciferase activity is significantly repressed in cells co -transfected with synthetic miR-96 or miR-183 and pmirGLO-Notch1 3′ UTR, suggesting that these miR-183 cluster members directly interact with and silence Notch1. [score:2]
To determine whether miR-183, miR-182, or miR-96 directly regulate select SC genes important to HC/SC differentiation (i. e. Jag1, Sox2, Hes1, Notch1) dual luciferase assays were performed. [score:2]
For those effects attributable to the miR-183 cluster in the vertebrate inner ear, these functional distinctions in miRNA regulation might be segregated temporally: in a switch-like manner in the case of HC cell fate assignment, then in a fine-tuning manner in the case of HC morpho-functional maturation and homeostasis. [score:2]
The results quantitate statistically significant (ΔCT values, 2 sample t-test, P < 0.001) increases in miR-182 (2.9 fold), miR-96 (2.7 fold) and miR-183 (2.2 fold) in Tg [1MDW/1MDW] cochlea at P18. [score:1]
These reciprocal effects are consistent with a reduction of miR-183 cluster miRNAs in sensory cells 2, 33 versus a gain of miR-183 cluster miRNAs in SCs (this study). [score:1]
Microarray analysis reveals miR-183 cluster-specific changes in P5-OC transcriptome. [score:1]
Relative expression levels of mature miR-96, miR-82, miR-183 were assayed using ABI Taqman assays according to the ΔΔCt method using snoRNA-202 (Supplementary Figure  S1) or snoRNA-135 as the normalization control. [score:1]
Li H Kloosterman W Fekete DM MicroRNA-183 family members regulate sensorineural fates in the inner earJ. [score:1]
Lumayag S Inactivation of the microRNA-183/96/182 cluster results in syndromic retinal degenerationProc. [score:1]
All highlighted plots are miR-183 cluster heptamers and include two (2) predicted to complement Mir96 [ddl] mutant miR-96. [score:1]
Histograms of mean relative luciferase activity in HEK293 cells co -transfected with a dual reporter vector (pmirGLO) containing cloned DNA sequences corresponding to the 3′ UTR of the indicated genes plus synthetic miRNA duplexes representing miR-96, miR-182, miR-183, or all three (ALL) normalized to scrambled siRNA control (CTRL). [score:1]
Each were co -transfected in HEK293 cultures with synthetic RNA duplexes representing miR-96, miR-182, or miR-183 alone or in combination. [score:1]
The miR-183, miR-96 and miR-182 levels were normalized to Sno135. [score:1]
HEK293 cells (~2 × 10 [5] cell/well; 24-well plate) were co -transfected using Lipofectamine 2000 (Invitrogen) with 200 ng reporter vector and 20 pmol synthetic RNA duplex representing scrambled control siRNA (Integrated DNA Technologies), miR-96, miR-182, or miR-183, or with 30 pmol combined miRNAs (10 pmol each). [score:1]
[1 to 20 of 71 sentences]
5
[+] score: 248
It is interesting to consider that the levels of the miR-183 family are physiologically relevant to retinal function, since they are down-regulated during dark adaptation and up-regulated in light-adapted retina [55]. [score:7]
Functional testing of pGFP-183F expression vector in vitro To examine the role of the miR-183 family in HC development, we employed an overexpression strategy modified from a design reported previously [30]. [score:6]
These developmental expression profiles led Weston and colleagues [24] to propose that the miR-183 family might enforce reciprocal longitudinal gradients on HC target genes that could underlie, at least in part, the acquisition of phenotypic traits responsible for frequency selectivity. [score:6]
AAVs encoding short hairpin RNAs that resemble pre-miR-183 and pre-miR-182 were injected into the retinas of DGCR8-conditional knockout mice in which miRNA biogenesis was blocked, leading to re -expression of miR-183 and miR-182 in Cre -expressing cone photoreceptors and prevention of the loss of outer segments and cone opsins [59]. [score:6]
Gene knockdowns or knockouts in the retina have revealed that down-regulation or loss of the miR-183 family leads to progressive degeneration of photoreceptors and increased susceptibility to light damage [21, 58]. [score:6]
Also, a miRNA target prediction algorithm (TargetScan, version 6.2) applied to the 3’UTR of chicken Sox2 failed to find predicted binding sites for any of the miR-183 family members. [score:5]
Thus, while ectopic HCs are occasionally observed in embryos subjected to electroporation, overexpression of the miR-183 family does not appear to increase the likelihood of their appearance, assuming that GFP is a reliable reporter of miRNA overexpression (Fig 4A–4C). [score:5]
The same study showed that expression of the miR-183 family also varies across the radial axis of the mouse organ of Corti, and that this expression pattern changes with maturation, even as overall levels decrease. [score:5]
We were specifically interested in whether inner ear sensory organs showed evidence of the miR-183 family expression at the prosensory stages, or whether expression was only limited to HCs. [score:5]
We reasoned that genes responsible for imparting neural versus abneural identity to the prosensory cells might be post-transcriptionally regulated by this miR-183 family expression gradient. [score:4]
We hypothesize that expression gradients of the miR-183 family reported along and across the mammalian cochlear axis are meaningful for HC development, and thus would be evolutionarily conserved in the bird BP. [score:4]
During BP development, the miR-183 family is expressed in a gradient along the longitudinal (tonotopic) axis, with highest levels found at the apex. [score:4]
Morpholino -mediated knockdown of the miR-183 family members decreased the number of HCs and otic neurons at 48 hours post fertilization (hpf), while overexpression of miR-96 or miR-182 resulted in ectopic and expanded sensory patches at 26 hpf [26]. [score:4]
To examine the role of the miR-183 family in HC development, we employed an overexpression strategy modified from a design reported previously [30]. [score:4]
Perhaps HCs cannot persistently overexpress the miR-183 family due to the presence of an unknown regulatory pathway that can negatively feedback on the transcription, processing or stability of these miRNAs when their levels are artificially raised. [score:4]
The reductions obtained were 89% knockdown for the miR-96 reporter, 82% knockdown for the miR-182 reporter and 88% knockdown for the miR-183 reporter. [score:4]
Nonetheless, this finding provides indirect evidence that some of the targets for the miR-183 family may be present at the prosensory stage, and may be modulated by changes in the level of the miR-183 family. [score:4]
However, using our experimental approach, ectopic expression of the miR-183 family was insufficient to redirect the differentiation of HCs towards specific radial or longitudinal phenotypes. [score:4]
0132796.g003 Fig 3The bifunctional pT2K-CAG-EGFP-183F plasmid expresses functional members of the miR-183 family in vitro. [score:3]
The bifunctional pT2K-CAG-EGFP-183F plasmid expresses functional members of the miR-183 family in vitro. [score:3]
Until now, deliberate experimental manipulation of the miR-183 family members has mainly relied on knockdown or knockout approaches [21, 58]. [score:3]
We interpret weak hybridization signal for the miR-183 family in developing sensory domains as consistent with the presence of thin cytoplasmic tails of HCs within the SC layer, although we cannot definitely exclude expression in prosensory cells or SCs of the vestibular organs at these immature stages. [score:3]
Ectopic expression of miR-183 family can bias progenitor cells towards HC fate. [score:3]
Thus, the miR-183 family belongs to a small group of genes reported as being differentially expressed across the radial axis of the BP as early as E7, when the proximal organ, while postmitotic, is still at the prosensory stage. [score:3]
Expression of the miR-183 family in the BP at mid to late gestation. [score:3]
Ectopic expression of miR-183 family is confirmed in vivo at S31 and S40. [score:3]
At S28, miR-183 is weakly expressed in the anterior and posterior cristae (A), the saccular macula and the vestibular ganglion (B), but is not detected in the cochlear duct (C). [score:3]
Overexpression of the miR-183 family in vivo. [score:3]
Unlike previous results in zebrafish [26], overexpression of the miR-183 family did not reproducibly induce ectopic HCs beyond the sensory domains. [score:3]
Ectopic expression of miR-183 family does not alter HC fate along and across the BP. [score:3]
To explore the function of the miR-183 family, expression levels were systematically altered in the developing zebrafish [26]. [score:3]
We conclude that in the BP, delivery of the miR-183 family expression plasmid does not impact the differentiation of THC versus SHC phenotypes. [score:3]
Nonetheless, we asked whether ectopic expression of the miR-183 family decreased the level of Sox2 protein in avian SCs, providing a possible mechanism by which they might be pushed toward a HC fate. [score:3]
Our conclusion for the chicken BP stands in contrast to data from the mouse, where qualitative differences in the expression of the miR-183 family were observed for IHCs versus OHCs in both whole mounts and sections [24, 25]. [score:3]
Prior to the appearance of a longitudinal gradient, we observed an early radial gradient in the expression of the miR-183 family (highest on the neural side) in the prosensory BP. [score:3]
Specifically, we speculated that HCs located on the abneural half of the BP, which normally become SHCs, might acquire the morphological phenotypes of THCs if they are forced to overexpress the miR-183 family beginning at the prosensory stage. [score:3]
However, the expression of the miR-183 family in zebrafish inner ear was not detected in prosensory cells, but was only found in HCs [39]. [score:3]
Overexpression of the miR-183 family in vivo Once the functionality of the miRNAs processed from the pGFP-183F construct was confirmed in vitro, pGFP-183F and pT2TP were injected and then electroporated into the right otic cup (S11–12) or otocyst (S15–S16) of chicken embryos. [score:3]
In situ hybridization was used to detect the expression of mature miR-183, miR-96 and miR-182 on sections through the embryonic chicken inner ear at stages when nascent HCs are present in vestibular and auditory sensory organs (E5/S28 and E7/S31, respectively). [score:3]
Both miR-182 and miR-183 were reported to be broadly expressed in the E9.5 mouse otocyst, and present in both prosensory tissues and non-sensory domains in the E12.5 mouse cochlea [25]. [score:3]
Since the miR-183 family was ectopically expressed as early as S26, before cells in the BP begin to pull out of division, we asked whether this experimental manipulation would push bipotential progenitor cells toward a HC fate rather than a SC fate. [score:3]
At S31, miR-183 is strongly expressed in HCs of all the vestibular organs (D-E) and the apical part of the BP (D-F). [score:3]
The ectopic expression of the miR-183 family was observed at S26 (S6 Fig), before the majority of HCs in the inner ear have exited the cell cycle [40]. [score:3]
There are several technical caveats that might explain why the delivery of a miR-183 family overexpression vector ectopically to the inner ear on E2/E3 did not alter HC phenotypes 10–14 days later. [score:3]
To ensure that mature members of the miR-183 family were produced from the miRNA expression plasmid, HEK293T cells were transfected with pGFP-183F, and their lysates were analyzed using. [score:3]
HC morphologies and HC subtypes are unaltered by transfection with a miR-183 family expression vector. [score:3]
The overexpression of the miR-183 family persisted for two weeks, as HCs were differentiating. [score:3]
The expression of miR-183 in the inner ear at S28 and S31. [score:3]
At S28 when HCs in the basal (proximal) BP start to exit the cell cycle [40], there was no detectable expression of the miRNA-183 family anywhere along its length (n = 3 embryos; S2 and S3 Figs). [score:3]
Progenitor cells are biased toward an HC fate by transfection with a miR-183 family expression vector. [score:3]
The 3 members of the miR-183 family (miR-183, miR-96, miR-182) are processed from a single primary transcript [20, 21] and are expressed in sensory cells in mice and zebrafish [20, 22, 23]. [score:3]
Ectopic HCs in non-sensory epithelia did not correlate with delivery of a miR-183 family expression vector. [score:3]
Thus, robust expression of the miR-183 family in BP HCs is tightly linked to the initiation of HC differentiation. [score:3]
With the exception of a mild bias toward the HC fate within the middle regions of the sensory BP, there were no obvious changes in HC or hair bundle morphologies induced by the delivery of the overexpression vector for the miR-183 family. [score:3]
Expression of the miR-183 family was specific to HCs throughout these ages (Fig 2B–2E), and began to decline after S40. [score:3]
We predicted that increasing the expression of the miR-183 family might cause basal HCs to acquire the characteristics of apical HCs, because the apex is where their expression levels are normally highest. [score:3]
Inner ear expression of the miR-183 family at E5 and E7. [score:3]
0132796.g004 Fig 4Ectopic expression of miR-183 family is confirmed in vivo at S31 and S40. [score:3]
Therefore, we posited that overexpression of miR-183 family might also induce non-sensory epithelia to take on a sensory fate in the chicken inner ear. [score:3]
This suggests that delivery of miR-183 family expression plasmids does not generate a persistent mixed HC-SC phenotype, when assayed with the markers used. [score:2]
Samples (600ng of small RNA) were subsequently probed for miR-183 family expression using DNA probes against the mature miRNA human sequences (Signosis) in conjunction with a chemiluminescence system, the High Sensitive miRNA Northern Blot Assay Kit (Signosis), according to the manufacturer’s instructions. [score:2]
While confirmed that the miRNA-183 family members were expressed from an artificial intron housed within a Tol2 construct, we sought evidence that each mature miRNA was processed and functional in chicken cells by using an in vitro dual luciferase assay. [score:2]
Compared to the controls (cells transfected with pGFP), HEK 293T cells transfected with pGFP-183F display expression of mature miR-183, -96, and -182. [score:2]
All 3 members of the miR-183 family exhibit dynamic longitudinal gradients postnatally in the mouse organ of Corti [24]. [score:1]
In the apical (distal) BP at the same stage, all three members of the miR-183 family were detected in nascent HCs (Fig 1C for miR-182; S2 and S3 Figs). [score:1]
Genomic sequences from the murine miR-183/96 and miR-182 loci were fused and placed within an artificial intron, which is located downstream of the EGFP reporter gene. [score:1]
We found that manipulating the levels of the miR-183 family can mildly influence the HC-SC fate decision. [score:1]
At both stages, the miR-183 family members were detected in the statoacoustic ganglion neurons and in vestibular HCs of the anterior crista, posterior crista, lateral crista, utricular macula and saccular macula (Fig 1A–1C, S2 and S3 Figs). [score:1]
To evaluate a possible role in establishing or maintaining HC phenotypic gradients in the chicken BP, the miR-183 family was overexpressed in the inner ear prior to and during HC differentiation. [score:1]
The miRNA reporters, composed of two complementary miRNA binding sites (to either miR-183, miR-96, or miR-182) housed downstream of the Renilla luciferase gene, were co -transfected into DF-1 cells with pGFP-183F or pGFP. [score:1]
An approximately 800 base pair fragment containing genomic sequences from the mouse miR-183 family locus, flanked by splice donor and acceptor sites, was obtained from pME-MCS-sd-miR183F-sa [30]. [score:1]
In this study, we show that the miR-183 family briefly presents with a neural-to-abneural gradient in the chicken BP at E7 and that it also displays an apical-to-basal gradient at E16-18. [score:1]
There are two studies using gain-of-function approaches of the miR-183 family. [score:1]
The detection of the miR-183 family members in both immature HCs and in statoacoustic neurons is similar to that previously described for both mouse [24, 25] and zebrafish [26]. [score:1]
A similar gradient was evident in adjacent sections probed for miR-183 (n = 3/4 ears from 2 embryos) or miR-96 (n = 2/5 ears from 3 embryos, S3 Fig bracket). [score:1]
The miR-183 intron was inserted into pT2K-CAG-EGFP-attR through a Gateway LR recombination reaction, creating pT2K-CAG-EGFP-183F (abbreviated pGFP-183F). [score:1]
miR-96 is conserved among the four species, while miR-182 and miR-183 show differences in the last few nucleotides at their 3’ ends. [score:1]
We suspect that we are too close to the detection threshold to always see radial gradients of miR-96 and miR-183 in the BP, but they are probably present nonetheless. [score:1]
The longitudinal gradient of miR-183 family was observed after S42. [score:1]
The LNA probes used were dre/hsa-miR-183, hsa-miR-96 and dre-miR-182. [score:1]
These data suggest that the precise level of the miR-183 family members can influence HC specification. [score:1]
In the mouse, all 3 miR-183 family members are derived from a common transcript and are located within an intronic region of a potential protein-coding gene [21]. [score:1]
miR-183 family is present in HCs in S38–S45 BPs. [score:1]
To ask whether delivery of miR-183 family expression plasmids could affect these morphological parameters, pGFP-183F -transfected BPs were triple-labeled with antibodies to GFP (to identify transfected cells), HCS-1 (to measure HC cross-sectional areas) and phalloidin (to label HC bundles). [score:1]
S1 Fig shows a comparison of the miR-183 family mature sequences among human (hsa), mouse (mmu), chicken (gga) and zebrafish (dre). [score:1]
Although many HCs were obviously GFP+ when viewed in immunostained whole-mounts, we were unable to confirm that the miR-183 family levels exceeded endogenous levels in HCs by whole mount in situ hybridizations of the BP (Fig 4D). [score:1]
However, miR-183 was significantly weaker on than the other two miRNAs. [score:1]
Arrows point to examples where GFP+ cells superimpose with a higher intensity of signal for miR-183. [score:1]
The sequence of miR-96 is fully conserved between these species, while miR-182 and miR-183 differ by 1–3 nucleotides at their 3’ ends, but are otherwise identical. [score:1]
S1 Fig miR-96 is conserved among the four species, while miR-182 and miR-183 show differences in the last few nucleotides at their 3’ ends. [score:1]
A further correlation between the miR-183 family and the tonotopic organization of the mouse cochlea is seen by in situ hybridization. [score:1]
Sequence comparison of the miR-183 family members among human, mouse, chicken and zebrafish. [score:1]
Gallus gallus mature miR-183 (gga-miR-183) sequence was obtained from miRBase while the miR-182 and miR-96 sequences were obtained from published Gallus gallus short RNA sequencing reads [31]. [score:1]
[1 to 20 of 93 sentences]
6
[+] score: 214
Other miRNAs from this paper: mmu-mir-10b, mmu-mir-182, mmu-mir-96
To confirm the link between PP1 inhibition and the upregulation of miR-183/96/182 cluster, PP1 was knocked down in N2A cells using a pool of siRNAs targeting the 3′UTR of PP1γ, an isoform predominantly linked to nuclear functions (Supplementary Fig. 6a). [score:9]
PP1 inhibition up-regulates pre-miR-183/96/182 expression. [score:8]
While ActD treatment significantly reduced pri-miRNA transcript (Fig. 2d), it had minimal effect on the up-regulation of pre-miRs induced by PP1γ knockdown (Fig. 2e), suggesting that PP1γ inhibition likely acts downstream of RNA Pol II -dependent transcription to regulate miR-183/96/182 level. [score:8]
e. m. (a) Expression level of target genes in the hippocampus of miR-183/96/182 overexpressing mice: Cacnb4 (t6=5.42, ** P<0.01), Gabra1 (t6=1.768, P=0.127), Prkcz (t6=3.675, * P<0.05), Nrg1 (t5=2.212, [#] P<0.1), Ppp2ca (t6=8.159, *** P<0.001), Grm5 (t5=3.246, * P<0.05), Gria1 (t6=3.261, * P=0.05), Usp13 (t6=2.98, * P=0.05), Hdac9 (t10=3.25, ** P<0.01) and Nufip2 (t10=2.74, * P<0.05); controls, n=3–7; miR-183/96/182, n=4–5. [score:7]
In the hippocampus, pre-miR-183 and pre-miR-182 were upregulated in the nuclear fraction and downregulated in the cytoplasmic fraction (Fig. 2a,b). [score:7]
Interestingly, inhibiting HDACs induces substantial upregulation of miR-183/96/182 cluster in neuroblastoma cells 54, suggesting a possible feedback regulatory loop between HDACs and miRNAs. [score:7]
miR-183/96/182 is upregulated by PP1 inhibition or learning. [score:6]
Since the miR-183/96/182 cluster is upregulated in the adult hippocampus following NOR training, we next examined whether inducing its expression in the hippocampus at the time of learning affects object memory. [score:6]
We examined if HDAC9 is a direct target of miR-183/96/182 using a luciferase -based expression system containing a predicted miR-182 binding site of HDAC9 3′UTR. [score:6]
We overexpressed miR-183/96/182 in hippocampus area CA1 in adult mice in vivo using a self-complementary adeno -associated virus (scAAV) vector expressing truncated pri-miR-183/96/182 fused with GFP. [score:5]
Interfering with miR-182 targeting of HDAC9 in mice overexpressing miR-183/96/182 cluster significantly reduced object exploration during training and testing under the weak NOR protocol, without affecting overall locomotion or novel object discrimination (Fig. 7a–e). [score:5]
To confirm the implication of miR-183/96/182 in long-term memory, we also expressed a sponge construct that competitively inhibits the miRNA cluster in the mouse hippocampus (Supplementary Fig. 12a,b). [score:5]
To validate some of these targets, we measured their level of expression in the hippocampus of mice overexpressing miR-183/96/182. [score:5]
We observed that processing of both pri-miR-183 and pri-miR-182, but not a control pri-miR-10b, was significantly increased upon inhibition of nuclear PP1 by NIPP1 overexpression (Fig. 3b–d). [score:5]
Our finding that miR-183/96/182 overexpression improves memory differs from a previous report showing that miR-182 overexpression impairs long-term auditory fear memory and that its level is lower in the lateral amygdala after auditory fear conditioning 22. [score:5]
The present results further show that both overexpression and knockdown of the miR-183/96/182 cluster in the mouse hippocampus alter performance in novel object discrimination. [score:4]
The reason for this difference is unknown but may result from differential regulation of miR-183/96/182 or miR-182 in the cluster in different brain areas, and/or their action on different targets. [score:4]
While miR-183/96/182 overexpression improves object memory, miR-183/96/182 knockdown impairs memory. [score:4]
Similarly, neuronal activity induced by KCl treatment led to a rapid upregulation of pri-miR-183/96/182 and corresponding pre-miR transcripts in N2A cells (Supplementary Fig. 6c). [score:4]
Some of the miRNAs identified by deep sequencing were similarly upregulated in an independent set of experiments in both non-trained NIPP1* mice (c, miR-183: controls, n=11; NIPP1*, n=11; t20=2.19, * P<0.05; miR-182: controls, n=11; NIPP1*, n=11; t20=2.68, * P<0.05); and control mice trained on NOR (d; miR-183: non-trained, n=12; trained, n=13; t23=2.07, * P⩽0.05; miR-182: non-trained, n=13; trained, n=13; t24=2.32, * P<0.05). [score:4]
Many of the predicted targets of the miR-183/96/182 cluster are involved in biological pathways relevant for neuronal signalling and plasticity, and epigenetic regulation (Supplementary Fig. 17). [score:4]
A closer look at these miRNAs revealed that the miR-183/96/182 cluster is upregulated in the hippocampus in both, NIPP1* transgenic mice and NOR-trained controls. [score:4]
Further, miR-183/96/182 is only one among many other targets of PP1, so manipulating its level is expected to affect only a fraction of PP1 pathways and therefore, it is not surprising that the effects are moderate. [score:3]
PP1 inhibition affects miR-183/96/182 biogenesis. [score:3]
Besides HDAC9, our results revealed numerous plasticity-related genes as targets of the miR-183/96/182 cluster including Cacnb4, Gabra1, Grm5 and Gria1. [score:3]
miR-183/96/182 overexpressing mice and controls similarly explored the objects during acquisition (Supplementary Fig. 10b). [score:3]
For miRNA overexpression experiments, the scAAV2-EF1a-pri-miR-183/96/182-GFP construct was produced by cutting scAAV2-MCS (Cell Biolabs) by BalI/NotI (New England Biolabs). [score:3]
miR-183/96/182 cluster decreases the expression of genes involved in plasticity and altered by NOR training, including HDAC9. [score:3]
Together, these results suggest that inhibition of PP1γ facilitates the increase in miR-183/96/182 level triggered by neuronal activity by favoring pre-miRNA production at the microprocessor level. [score:3]
To suppress the level of endogenous miRNAs, a triple sponge for the miR-183/96/182 cluster containing four binding sites for each miRNA (perfectly complementary and containing a bulge) separated by a 15 nt spacer sequence were prepared as described previously 23. [score:3]
They show that PP1 inhibition increases the level of the miR-183/96/182 cluster, and identify this cluster as an important modulator of memory formation. [score:3]
Even if the effect size is modest (15–20% increase or decrease in performance), such bidirectional effect is a strong indication that miR-183/96/182 cluster is directly implicated in memory formation with no obvious functional redundancy or compensation. [score:3]
Similar to the strong protocol, training with the weak protocol increases the expression of precursor and mature forms of miR-183/96/182 cluster (Supplementary Figs 8 and 13). [score:3]
To further evaluate the importance of HDAC9 targeting by miR-183/96/182, we interfered with miR-182/ HDAC9 interaction in vivo by injecting locked nucleic acid (LNA) modified target site blockers (TSB) (Supplementary Fig. 14). [score:3]
However, since object exploration is a prerequisite for proper learning and memory formation is preceded by learning and does depend on it, our results place HDAC9 as one of the early targets of miR-183/96/182 cluster involved in long-term memory. [score:3]
Effect of miR-182/HDAC9 TSB on NOR performance in mice overexpressing miR-183/96/182. [score:3]
Because our NOR training protocol was repeated and spaced, it elicited strong memory that may have masked the effect of miR-183/96/182 overexpression. [score:3]
Comparison of miR-183/96/182 overexpressing mice and controls with this protocol showed no difference between the groups in overall locomotor activity in an open field test or during training in the NOR task (Supplementary Fig. 11a–c). [score:3]
Quantitative polymerase chain reaction (qPCR) confirmed a consistent increase (about 50%) in miR-183 and miR-182, while miR-96 was expressed at low level (Fig. 1c,d). [score:3]
e. m. (a) Pre-miR-183/96/182 expression in the nuclear fraction of the hippocampus from NIPP1* and control mice (pre-miR-183: controls, n=11; NIPP1*, n=11; t20=2.12, * P<0.05; pre-miR-182: controls, n=11; NIPP1*, n=11; t20=2.92, ** P<0.01). [score:3]
Importantly, during the second test, miR-183/96/182 overexpressing mice had significantly better memory than control mice (Fig. 5b). [score:3]
Overall locomotor activity was similar in mice overexpressing miR-183/96/182 and controls (Supplementary Fig. 10e,f). [score:3]
This in turn suggests that miR-183/96/182 cluster likely mediates its effects on memory formation through the concerted action of several target genes. [score:3]
Future studies examining the regulatory functions of miR-183/96/182 cluster in synaptic mechanisms may help further explain the behavioural phenotypes. [score:2]
Interestingly, a recent study demonstrated a developmentally timed processing of pri-miR-183/96/182 involved in neuronal organization. [score:2]
PP1γ knockdown increased the level of miR-183 and miR-182 (Supplementary Fig. 6b), confirming that nuclear PP1 is implicated in the synthesis of these miRNAs. [score:2]
miR-183/96/182 regulates plasticity-related genes. [score:2]
Further, PP1γ knockdown reduced the level of KCl -induced pri-miR-183/96/182 and cytoplasmic pre-miR-183/96/182 but had no effect on a control miRNA (Fig. 2d, Supplementary Fig. 6d,e), suggesting a selective effect. [score:2]
This effect of ActD is prevented by PP1γ knockdown (e: miR-183, t4=1.68, P=0.17; mir-96, t4=0.20, P=0.85; miR-182, t4=2.09, P=0.10). [score:2]
Future studies examining the role of miR-183/96/182 cluster in other hippocampus -dependent and -independent learning paradigms should help determine the exact role of the cluster in different cognitive processes. [score:1]
How to cite this article: Woldemichael, B. T. et al. The microRNA cluster miR-183/96/182 contributes to long-term memory in a protein phosphatase 1 -dependent manner. [score:1]
We next examined the potential link between miR-183/96/182 cluster and PP1. [score:1]
We observed that KCl stimulation decreases the level of mature miR-183/96/182 after 30 min but significantly increases it after 4 h (Fig. 4a,b). [score:1]
Sequence of T-pri-miR-183/96/182 was as follows with mature miRNAs underlined:5′cctctgcagggtctgcaggctggagagtgtgactcctgtcctgtg tatggcactggtagaattcact gtgaacagtctcagtcagtgaattaccgaagggccataaacagagcagagacagatccgcgagcaccttggagctcctcacccctttctgcctagacctctgtttccaggggtgccagggtacaaagacctcctctgctccttccccagagggcctgttccagtaccatctgcttggccgat tttggcactagcacatttttgcttgtgtctctccgctgtgagcaatcatgtgtagtgccaatatgggaaaagcgggctgctgcggccacgttcacctcccccggcatcccataataaaaacaagtatgctggaggcctcccaccatt tttggcaatggtagaactcacaccggtaaggtaatgggacccggtggttctagacttgccaactatggtgtaagtgctgagct. [score:1]
This occurs in a background of mature miR-183/96/182 consumption upon neuronal stimulation and continued replenishment by increased transcription. [score:1]
Taken together, these results provide evidence for a permissive role of the miR-183/96/182 cluster in the hippocampus in long-term object memory. [score:1]
The transgene cassette containing Ef1a promoter (sequence from pEGP-mmu-miR-182 plasmid; Cell Biolabs), engineered truncated (T)-pri-miR-183/96/182, EGFP (from pEGP-mmu-miR-182 plasmid; Cell Biolabs), WPRE motif and 5′-BalI and 3′-NotI adaptors was chemically synthesized by GENEWIZ (South Plainfield, USA) and cloned into the scAAV backbone. [score:1]
Briefly, fragments of pri-mir-182 and pri-mir-183, and the control pri-miR-10b, containing the hairpin and 100 bp flanking sequence were amplified from genomic DNA. [score:1]
The scAAV2-EF1a-pri-miR-183/96/182-GFP allowed the generation of mature miR-183-5p, miR-96-5p and miR-182-5p sequences annotated in miRBASE v. 20 (www. [score:1]
We therefore explored the link between the miR-183/96/182 cluster and HDAC9. [score:1]
Control scAAV2-EF1a-control-GFP construct contained fragment of beta-globin intron (sequence from pEGP-mmu-miR-182 plasmid; Cell Biolabs) of length corresponding to T-pri-miR-183/96/182. [score:1]
Dual-luciferase reporters with pri-mir-182 and pri-mir-183 were transfected in N2a cells using cationic liposomes (Lipofectamine 2,000 reagent, Invitrogen). [score:1]
miR-183/96/182 modulation in the hippocampus affects long-term object memory. [score:1]
To examine whether this process is affected by PP1, we measured the level of miR-183/96/182 transcripts at different time points, with and without transcriptional inhibition. [score:1]
e. m. (a) Mature miRNAs level is lower 0.5 h after KCl treatment (miR-183: t4=1.66, P=0.17; miR-96: t4=2.28, [#] P<0.1; miR-182: t4=7.2, ** P<0.01). [score:1]
Together, these results identify HDAC9 as one of the mediators of miR-183/96/182 on cognitive processes. [score:1]
[1 to 20 of 66 sentences]
7
[+] score: 214
Mechanistically, we showed that AGGF1 blocked ERK1/2 activation, repressed expression of ZEB1, and induced expression of miR-183-5p, which then inhibited expression of CHOP, the key inducer of apoptosis. [score:9]
We have found that AGGF1 induces expression of miR-183-5p, which then reduces the CHOP expression by a post-transcriptional suppression mechanism through binding to the 3′-UTR of CHOP (Fig.   5). [score:7]
Because CHOP is the key regulator of ER stress and its expression is regulated by miR-183-5p, we assessed the direct role of miR-183-5p on ER stress -induced apoptosis. [score:6]
Fig. 5AGGF1 downregulates expression of CHOP via miR-183-5p. [score:6]
It is interesting to note that the Ago-miR-183-5p mimics and Antagomir-miR-183-5p inhibitor also have a major impact on cardiac hypertrophy and dysfunction upon pressure overload regardless of Aggf1 expression or AGGF1 protein treatment, respectively (Figs.   7 and 8). [score:5]
These data suggest that miR-183-5p negatively regulates the expression of CHOP by directly binding to the 3′-UTR of CHOP. [score:5]
MiR-183-5p mimics, Ncontrol miRNA mimics (Ncontrol), a miR-183-5p inhibitor, a miR-183-5p inhibitor control, and stabilized miRNAs (Ago-miR-183-5p and control Ago-miR-NC) were from Guangzhou RioboBio. [score:5]
d Real-time RT-PCR analysis for miR-183-5p expression in H9C2 cells after AGGF1 treatment with or without ZEB1 overexpression (n = 3/group, ** P < 0.01). [score:5]
The Antago-miR-183-5p inhibitor increased CHOP expression in TAC mice (Supplementary Fig.   10). [score:5]
AgomiR-183-5p (100 nmol/kg), AntagomiR-NC (100 nmol/kg), a miR-183-5p inhibitor (200 nmol/kg), and a miR-183-5p inhibitor control (200 nmol/kg) were administered by intramuscular injection into the left ventricle myocardium at multiple sites in 0.2 ml of saline 24 h prior to TAC. [score:5]
Fig. 6Mechanism for AGGF1 regulation of miR-183-5p expression. [score:4]
These data are consistent with our results that AGGF1 acts upstream of miR-183-5p in regulation of CHOP expression. [score:4]
On the basis of our mo del, AGGF1 knockdown reduces the level of miR-183-5p due to increased ZEB1; therefore, ZEB1 knockdown is expected to rescue the effect of AGGF1 knockdown. [score:4]
Together, all these data again indicate that miR-183-5p post-transcriptionally downregulates Chop. [score:4]
We further demonstrated that AGGF1 negatively regulates activation of ERK1/2, leading to a decreased level of transcriptional repressor ZEB1, resulting in increased expression of miR-183-5p (Fig.   6). [score:4]
The studies with the miR-183-5p inhibitor showed that AGGF1 acts upstream of miR-183-5p in regulating cardiac hypertrophy and heart failure (Fig.   8). [score:4]
More interestingly, AGGF1 treatment significantly rescued the loss of miR-183-5p expression caused by TAC (Fig.   5h). [score:3]
Fig. 8Ago-miR-183-5p inhibitor blocks therapeutic effect of AGGF1. [score:3]
h Real-time RT-PCR analysis for miR-183-5p expression in the hearts of TAC or Sham mice with or without AGGF1 treatment (left, n = 6/group, ** P < 0.01). [score:3]
Moreover, miR-183-5p also inhibited myocardial apoptosis, reduced cardiac hypertrophy and heart failure, and restored myocardial function (Fig.   7). [score:3]
Real-time RT-PCR analysis for miR-183-5p expression in H9C2 cells transfected with AGGF1-specific siRNA (siAGGF1) or siNC (right, n = 3/group, ** P < 0.01). [score:3]
After 24 h, we co -transfected 200 ng of either pMIR-CHOP-wt or pMIR-CHOP-mut together with 100 nM of miR-183-5p mimics or non-target miRNA mimics as well as 20 ng of the pRL-TK vector containing the renilla luciferase gene (Promega, Madison, WI, USA) using Lipofectamine 2000. [score:3]
was carried out by a Student’s two-tailed t-test In order to further confirm the above results, we assessed the levels of Chop mRNA using real-time RT-PCR analysis in H9C2 cells transfected with miR-183-5p mimics or non-target negative control (Ncontrol) miRNA mimics (Fig.   5d). [score:3]
c Luciferase activity of pMIR-CHOP-wt or mutant pMIR-CHOP-mut reporters in the presence of miR-183-5p mimics, a negative control miRNA mimics (Ncontrol), or a miR-183-5p specific inhibitor (n = 3/group, ** P < 0.01). [score:3]
Transfection of the miR-183-5p inhibitor increased luciferase activities from the WT reporter, whereas this effect was abolished in the case of the mutant reporter (Fig.   5c). [score:3]
Similarly, echocardiography showed that AGGF1 increased LVEF and LVFS in TAC mice, but the effect was abolished in the presence of the Antago-miR-183-5p inhibitor (Fig.   8b, c). [score:3]
To test the hypothesis that miR-183-5p is involved in AGGF1 -mediated treatment of hypertrophy and heart failure after TAC, we assessed the effect of AGGF1 protein treatment with or without an Antago-miR-183-5p inhibitor in mice after TAC. [score:3]
showed that the level of the CHOP protein was significantly decreased by miR-95-3p mimics and increased by miR-183-5p inhibitor (Fig.   5e). [score:3]
AGGF1 reduced the cross-sectional diameter of cardiomyocytes in TAC mice, but the reduction was abolished in the presence of the Antago-miR-183-5p inhibitor (Fig.   8f). [score:3]
Moreover, the miR-183-5p inhibitor significantly increased the level of Chop mRNA. [score:3]
Increased miR-183-5p expression will reduce the level of CHOP, which blocks ER stress -induced apoptosis and heart failure. [score:3]
We also examined the level of CHOP in TAC mice with or without Antago-miR-183-5p inhibitor. [score:3]
The quantitative RT-PCR analysis showed that reduced ERK1/2 expression by siRNA significantly increased the level of miR-183-5p (Supplementary Fig.   13). [score:3]
g Real-time RT-PCR analysis for miR-183-5p expression in H9C2 cells 48 h after AGGF1 treatment (left, n = 3/group, ** P < 0.01). [score:3]
To identify the molecular mechanism by which AGGF1 regulates the level of miR-183-5p, we analyzed the promoter/regulatory region of miR-183-5p and found that it contained two binding sites for a transcriptional repressor, Zinc Finger E-Box Binding Homeobox 1 (ZEB1) 47, 48. [score:3]
f Real-time RT-PCR analysis showing decreased miR-183-5p expression in TAC mice (n = 5/group, * P < 0.05) or in an ISO -induced H9C2 cell mo del for cardiac hypertrophy (n = 3/group, * P < 0.05). [score:3]
Quantitative RT-PCR analysis also showed that AGGF1 treatment increased the level of miR-183-5p, but overexpression of ZEB1 abolished the stimulatory effect of AGGF1 on the level of miR-183-5p (Fig.   6d). [score:3]
Real-time RT-PCR analysis for miR-183-5p expression in the hearts of WT (Aggf1 [+/+]) or Aggf1 [+/−] mice after TAC or sham surgeries (right, n = 6/group, * P < 0.05, ** P < 0.01). [score:3]
was carried out by a Student’s two-tailed t-test In order to further confirm the above results, we assessed the levels of Chop mRNA using real-time RT-PCR analysis in H9C2 cells transfected with miR-183-5p mimics or non-target negative control (Ncontrol) miRNA mimics (Fig.   5d). [score:3]
AGGF1 rescued the HW/BW ratio and the LW/BW ratio in TAC mice, but the effect was abolished in the presence of the Antago-miR-183-5p inhibitor (Fig.   8d, e). [score:3]
H&E staining showed that AGGF1 therapy reduced cardiac hypertrophy and heart failure in 6-week-old TAC mice, but the therapeutic effect was lost in the presence of the Antago-miR-183-5p inhibitor (Fig.   8a). [score:3]
b– g Ago-miR-183-5p inhibits cardiac hypertrophy and improves cardiac function. [score:3]
These data suggest that miR-183-5p inhibits cardiac hypertrophy and improves myocardial function. [score:3]
We then analyzed whether AGGF1 regulates the level of miR-183-5p. [score:2]
AGGF1 regulates ER stress signaling by a novel AGGF1-ERK-ZEB1-miR-183-CHOP signaling pathway. [score:2]
The miR-183-5p -binding site at the 3′-UTR of CHOP was mutated in the pMIR-CHOP-wt reporter using PCR -based site-directed mutagenesis as described previously [54], resulting in a mutant reporter, pMIR-CHOP-mut. [score:2]
Together, our data indicate that AGGF1 negatively regulates activation of ERK1/2, which leads to a reduced level of ZEB1, resulting in an increased level of miR-183-5p. [score:2]
These data suggest that ZEB1 acts downstream of AGGF1 in regulation of the level of miR-183-5p (Supplementary Fig.   12). [score:2]
It is important to note that miR-183-5p is the first microRNA identified for post-transcriptional regulation of CHOP. [score:2]
MiR-183-5p mimics inhibits cardiac hypertrophy. [score:2]
e for CHOP abundance in H9C2 cells with transfection of miR-183-5p mimics or a miR-183-5p -specific inhibitor compared with Ncontrol. [score:2]
Fig. 7AGGF1 regulates ER stress and hypertrophy upstream of miR-183-5p. [score:2]
MiR-183-5p inhibitor induces cardiac hypertrophy. [score:2]
The ER stress activator TM increased the abundance of CHOP, ERO1α, and DR5, which was suppressed by miR-183-5p compared with Ncontrol (Supplementary Fig.   15). [score:2]
d for the level of the CHOP mRNA in H9C2 cells with transfection of miR-183-5p mimics or a miR-183-5p-specific inhibitor compared with Ncontrol (n = 3/group, ** P < 0.01). [score:2]
b Schematic diagram showing the wild type (wt) pMIR-CHOP-wt or mutant pMIR-CHOP-mut reporter with the miR-183-5p -binding site mutated. [score:1]
The cross-sectional diameter of cardiomyocytes was decreased in the Ago-miR-183-5p treatment groups (Fig.   7g). [score:1]
The Ago-miR-183-5p mimics significantly reduced the level of CHOP (Supplementary Fig.   10). [score:1]
We examined the level of CHOP in TAC mice with or without Ago-miR-183-5p mimics. [score:1]
Therefore, miR-183-5p by itself may have an impact on cardiac pathology independent from AGGF1. [score:1]
a Bioinformatic analysis of the CHOP mRNA sequence identified a binding site for miR-183-5p at the 3′-UTR. [score:1]
Similarly, in H9C2 cells treated with ISO (a cell mo del for hypertrophy), the level of miR-183-5p was also significantly decreased (Fig.   5f). [score:1]
a ChIP–qPCR analysis for the interaction between ZEB1 and miR-183-5p promoter DNA (n = 4/group, ** P < 0.01). [score:1]
We constructed a miR-183-5p promoter/luciferase reporter gene (Fig.   6b). [score:1]
Because cardiac function was only partially rescued in Chop KO mice in a TAC mo del [24], whereas AGGF1 protein therapy almost completely restored myocardial function, the AGGF1-ERK-ZEB1-miR-183-CHOP signaling pathway may be one of several pathways by which AGGF1 restores myocardial function. [score:1]
H&E staining and echocardiography showed that there is an additive effect for Aggf1 haploinsufficiency and TAC in inducing cardiac hypertrophy and heart failure, which was rescued by Ago-miR-183-5p (Fig.   7b–g). [score:1]
The level of miR-183-5p was significantly decreased in TAC mice (Fig.   5f). [score:1]
We discovered a noncanonical signaling pathway, AGGF1-ERK-ZEB1-miR-183-5p-CHOP, that blocks ER stress -induced apoptosis and cardiac hypertrophy. [score:1]
All these data suggest that the therapeutic effect of AGGF1 protein is dependent on miR-183-5p and AGGF1 acts upstream of miR-183-5p. [score:1]
was carried out by a Student’s two-tailed t-test To establish the role of miR-183-5p in cardiac hypertrophy and heart failure and to explore the relationship between miR-183-5p and AGGF1 during the process, we performed TAC procedures for both WT and Aggf1 [+/−] mice, which were followed by intramuscular injection of Ago-miR-183-5p and control Ago-miR-NC. [score:1]
The finding that miR-183-5p can rescue the effect of Aggf1 haploinsufficiency suggests that Aggf1 acts upstream of miR-183-5p. [score:1]
Either in WT mice or in TAC mice, AGGF1 treatment increased the level of miR-183-5p (Fig.   5h). [score:1]
Furthermore, the level of miR-183-5p was significantly decreased in Aggf1 [+/−] mice with or without TAC (Fig.   5h). [score:1]
showed that miR-183-5p reduced the abundance of CHOP, ERO1α, cleaved PARP, and cleaved caspase-3 in the Veh-siNC group (Fig.   7a). [score:1]
This effect of miR-183-5p on ER stress -induced apoptosis was not affected by siAGGF1 (Fig.   7a, compare the Veh-siAGGF1 group to the Veh-siNC group). [score:1]
Consistent with this finding, ChIP analysis showed that the interaction between ZEB1 and miR-183-5p promoter DNA was reduced by AGGF1 because AGGF1 resulted in reduced ZEB1 levels (Fig.   6a). [score:1]
b Schematic diagram showing that the miR-183-5p promoter-luciferase reporter with two ZEB1 -binding motifs. [score:1]
Quantitative RT-PCR analysis also showed that siAGGF1 decreased the level of miR-183-5p, but siZEB1 abolished the effect of AGGF1 on the level of miR-183-5p. [score:1]
Therefore, our data identify a novel non-canonical CHOP pathway for ER stress signaling, i. e., AGGF1-ERK-ZEB1-miR-183-CHOP (Fig.   6i). [score:1]
Our luciferase assays showed that siAGGF1 decreased the luciferase activity from the miR-183-5p promoter luciferase reporter (pGL3-miR-183-5p), and siZEB1 abolished the effect of AGGF1 knockdown on the reporter in H9C2 cells (Supplementary Fig.   12). [score:1]
The analysis revealed a potential binding site for miR-183-5p at the 3′-UTR of CHOP (Fig.   5a). [score:1]
Ago-miR-183-5p decreased the HW/BW ratio (Fig.   7e) and the LW/BW ratio (Fig.   7f) in both Aggf1 [+/−] mice and WT mice after TAC. [score:1]
[1 to 20 of 82 sentences]
8
[+] score: 103
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
The expression levels of miR-183, miR-96, and miR-182 were most highly up-regulated, whereas miR-122, miR-503, and miR-139-3p exhibited the greatest down-regulation as a result of 17α-E2 treatment. [score:9]
ACTH up-regulated the expression of miRNA-212, miRNA-182, miRNA-183, miRNA-132, and miRNA-96 and down-regulated the levels of miRNA-466b, miRNA-214, miRNA-503, and miRNA-27a. [score:9]
The expression levels of miR-183 (4.61-fold), miR-96 (4.56-fold), and miR-182 (4.29-fold) were most highly up-regulated, whereas miR-122 (9.79-fold), miR-503 (5.88-fold), and miR-139-3p (1.94-fold) showed the greatest down-regulation as a result of 17α-E2 treatment. [score:9]
Real-time PCR (qRT-PCR) measurements demonstrated that ACTH treatment upregulated the expression of miRNA-212, miRNA-183, miRNA-182, miRNA-132 and miRNA-96, while down -regulating the expression of miRNA-466b, miRNA-214, miRNA-503 and miRNA-27a. [score:7]
qRT-PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats (Fig. 3 ). [score:7]
The levels of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377, and miRNA-96 were up-regulated, whereas miR-125b, miRNA-200b, miR-122, miRNA-466b, miR-138, miRNA-214, miRNA-503 and miRNA27a were down-regulated in response to 17α-E2 treatment. [score:7]
Real-time quantitative PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats. [score:7]
Treatment of MLTC-1 cells with Bt [2]cAMP for 6 h increased the expression of miRNA-212, miRNA-183, miRNA-132, miRNA-182 and miRNA-96, and inhibited the expression of miRNA-138 and miRNA-19a. [score:7]
Treatment of MLTC-1 cells with Bt [2]cAMP for 6 h increased the expression of miRNA-212, miRNA-183, miRNA-132, miRNA-182 and miRNA-96 and inhibited the expression of miRNA-138 and miRNA-19a (Fig. 4B ). [score:7]
Bt [2]cAMP stimulation of granulosa cells caused down-regulation of a majority of miRNAs, including miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, miRNA-138 and miRNA-19a, but expression levels of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 were significantly increased. [score:6]
qRT-PCR measurements indicated that exposure of primary rat granulosa cells to Bt [2]cAMP for 24 h inhibited the expression of miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, and miRNA-138 and miRNA-19a while enhancing the expression of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 (Fig. 4 ). [score:5]
Microarray data demonstrated that the levels of miR-183 and miR-182 were up-regulated with 17α-E2 treatment, but not with ACTH (p = 0.065) treatment; qRT-PCR measurements, however, showed significant increases in their expression in response to either ACTH or 17α-E2 treatment. [score:4]
Real-time PCR (qRT-PCR) confirmed ACTH -mediated up-regulation of miRNA-212, miRNA-183, miRNA-182, miRNA-132 and miRNA-96. [score:4]
We next evaluated the effects of Bt [2]cAMP stimulation of rat ovarian granulosa cells and of mouse MLTC-1 Leydig tumor cells on the expression of twelve miRNAs (miRNA-212, miRNA-122, miRNA-183, miRNA-200b, miRNA-466b, miRNA-182, miRNA-96, miRNA-27a, miRNA-132, miRNA-214, miRNA-138 and miRNA-19a) whose adrenal expression was differentially altered in response to treatment of rats with ACTH, 17α-E2 or DEX. [score:3]
MiR-183, miR-96 and miR-19a were predicted to target the ABCA1 gene. [score:3]
The levels of expression of miRNA-212, miRNA-122, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96, miRNA-466b, miRNA-200b, and miRNA-19a are shown. [score:3]
More specifically, we assessed the impact of Bt [2]cAMP treatment on the expression of miRNA-212, miRNA-122, miRNA-27a, miRNA-466b, miRNA-200b, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96 and miRNA-19a. [score:3]
0078040.g003 Figure 3Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
Dexamethasone treatment decreased miRNA-200b, miR-122, miR-19a, miRNA-466b and miRNA27a levels, but increased miRNA-183 levels. [score:1]
Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
[1 to 20 of 20 sentences]
9
[+] score: 98
Notably, the miR-183/96/182 cluster is regulated by light; it is down-regulated in dark-adapted and up-regulated in light-adapted retinas 8. Pathways potentially regulated by miR-183 include GABA receptor activation, L1cam -mediated interactions and L1 signal transduction (Fig. 2b). [score:9]
Linking our results to current knowledge suggests that in retina, parallel to activation of Rac1  46, light up-regulates expression of the miR-183/96/182 cluster 8, which in turn may provide negative feedback to Rac1 translation. [score:8]
In silico miRNA Target Selection PipelineTarget sites for mmu-miR-1a-3p (miR-1), miR-133a-1 (miR-133), miR-142a-3p (miR-142), miR-183-5p (miR-183), miR-96-5p (miR-96) and miR-182-5p (miR-182) were predicted employing Diana-microT (v. 3.0) 61, miRanda (Aug 2010 release) 62 and TargetScan tools (v. 6.2) 4, and filtered for sites predicted by at least two prediction tools. [score:7]
Atp1b3, Paip2b and Slc1a1 have been previously identified as retinal targets for miR-183/96/182 8. Our data further validates Atp1b3 and possibly Slc1a1 targeting by this miR cluster in R347 retina as their expression increased by 31.6% (p < 0.001) and 38.9% (p > 0.05), respectively; Paip2b was not detected. [score:7]
Considerable overlap among miR-183, miR-96 and miR-182 target genes was observed; e. g. 21 targets were potentially co -targeted by miR-96 and miR-182 (Supplementary Table S3). [score:7]
Apart from the conserved miR-96/182 target site, eight additional miR-183/96/182 target sites in Rac1 were predicted (Fig. 4d and Table 3). [score:5]
Target sites for mmu-miR-1a-3p (miR-1), miR-133a-1 (miR-133), miR-142a-3p (miR-142), miR-183-5p (miR-183), miR-96-5p (miR-96) and miR-182-5p (miR-182) were predicted employing Diana-microT (v. 3.0) 61, miRanda (Aug 2010 release) 62 and TargetScan tools (v. 6.2) 4, and filtered for sites predicted by at least two prediction tools. [score:5]
Remarkably, expression of miR-183/182 is sufficient to maintain outer segments and expression of cone opsins in cone photoreceptors 17. [score:5]
In Silico Target SelectionAltered expression of miR-1, miR-133, miR-142 and miR-183/96/182 in the R347 mouse mo del has been observed 12. [score:5]
Our data suggest that miR-183/96/182 cluster has a significant influence on Rac1 expression and that this regulatory circuit may play an important role in both healthy and RP retinas. [score:4]
Rac1 and miR-183/96/182 are co-expressed in retinal cells (Fig. 3a,b and Table 2) 12. miR-96/182 targeting of Rac1 was validated for both miRNAs by in vitro 3′UTR assays (Fig. 3g,h). [score:4]
Focusing on predicted targets for modulated miRNAs in R347 retina, including miR-1/133, miR-142 and miR-183/96/182, high-throughput proteome analysis provided a unique opportunity to explore miRNA regulation in a mo del system for inherited retinopathy. [score:4]
Another interesting target identified for the miR-183/96/182 cluster was Rac1 (Fig. 3a,b and Table 2). [score:3]
Altered expression of miR-1, miR-133, miR-142 and miR-183/96/182 in the R347 mouse mo del has been observed 12. [score:3]
Specifically, 23, 10, 6, 18, 35 potential target genes were identified for miR-1, miR-133, miR-142, miR-183, miR-96 and miR-182, respectively (Supplementary Table S3). [score:3]
Additionally, reduced expression of miR-183/96/182 cluster in R347 retinas may decrease efficacy of this feedback mechanism and contribute to elevated Rac1 levels. [score:3]
Pathway over-representation analysis 24 of miRNA-specific target gene lists identified a number of enriched pathway -based sets for miR-1 and miR-183/96/182 (Fig. 2b). [score:3]
Beside miR-183/96/182, a number of other miRNAs were both predicted to target the Rac1 3′UTR and were significantly enriched in Rac1-miR-CATCH. [score:3]
Our results highlight widespread effects of these miRNAs in retina, in particular, miR-1 and the miR-183/96/182 cluster; we validated a number of specific miRNA-target interactions in vitro and in vivo. [score:3]
While the miR-183/96/182 cluster has an essential role in sensory organs, these miRNAs are also implicated in regulation of non-sensory cells and disorders (e. g. cancer) 54. [score:2]
Previously established functions for miR-183/96/182 include regulation of circadian rhythm, apoptosis 54, photoreceptor differentiation and synaptic connectivity 15. [score:2]
Apart from the conserved miR-96/182 site, two additional miR-96, four additional miR-182 (combined and unique) and two miR-183 sites were identified for the miR-183/96/182 cluster (Fig. 4d and Table 3a). [score:1]
For Rac1, miR-183/96/182 interactions were additionally demonstrated using in vivo miR-CATCH. [score:1]
The sensory organ-specific miR-183/96/182 cluster has been studied extensively in retina 15; e. g., its inactivation results in progressive RD in mice 16. [score:1]
[1 to 20 of 24 sentences]
10
[+] score: 83
Because expression of miR-96 and miR-183 is decreased, corresponding targets may potentially be upregulated in P347S mice. [score:8]
Using a bioinformatics approach, potential target genes for miR-96, miR-183, miR-1, and miR-133 were predicted and screened against genes expressed in the mouse retina [41, 42] and 488 genes linked with eye diseases [40]. [score:7]
Expression of miR-1 and miR-133 decreased by more than 2.5-fold (P < 0.001), whereas expression of miR-96 and miR-183 increased by more than 3-fold (P < 0.001) in Pro347Ser retinas, as validated by qPCR. [score:5]
Notably, predicted targets of miR-96 and miR-183 also include apoptosis regulators, such as Pdcd6 (programmed cell death 6) and Psen2 (presenilin 2) and transcription factors (for example, Asb6 [ankyrin repeat and SOCS box-containing protein 6] and Ndn [Necdin]). [score:4]
More specifically, significant differences in expression of miR-1, miR-96, miR-133, and miR-183 in retina were observed between RHO mutant and wild-type mice. [score:3]
In general, a good correlation among data from qPCR and the two microarrays was found, with the exception of miR-183, for which the Exiqon microarray did not pick up the differential expression between mutant and wild-type retinas that was observed by qPCR (Figure 6). [score:3]
In relation to the eye, miR-7 has been shown to play an important role in photoreceptor differentiation in Drosophila [25] and other miRs, such as miR-9, miR-96, miR-124a, miR-181, miR-182, and miR-183, were found to be highly expressed during morphogenesis of the zebrafish eye [16]. [score:3]
Transformation of the qPCR log [2 ]values into fold differences suggested that highly retinal specific miRs (for instance, miR-183 and miR-96) are expressed at more than a 1,000-fold greater degree in the retina than in the mouse platform. [score:3]
In contrast, Xu and coworkers [28] used rd1 mice with severe retinal degeneration to demonstrate retinal expression of miR-96, miR-182, and miR-183 in cells other than photoreceptor cells. [score:3]
Potential target transcripts for miR-96, miR-183, miR-1 and miR-133 predicted by miRanda [39] were retrieved from the Sanger miR Database [37]. [score:3]
Notably, apoptosis and transcription factor genes are among the predicted targets for miR-96 and miR-183. [score:3]
This is in accordance with recent findings reported by Xu and coworkers [28], who demonstrated that expression of miR-96, miR-182, and miR-183 was not exclusive to photoreceptor cells in 4-month-old retinal degenerative 1 mice (rd1 [49]). [score:3]
Potential retina specific targets of miR-1, miR-96, miR-133, and miR-183 were generated through computational means. [score:3]
For example, miR-125a has a similar level of expression in retina, brain, and mouse platform, whereas miR-183 exhibits remarkable specificity for retina. [score:3]
A subset of highly ranked potential targets for miR-96, miR-183, miR-1 and miR-133 are implicated in the visual cycle (for example Abca4, Pitpnm1 [membrane associated phosphatidylinositol 1], and Pde6a), in cytoskeletal polarization (for example, Crb1 and Clasp2 [CLIP associating protein 2]), and in transmembrane and intracellular signaling (for example, Clcn3 [chloride channel 3], Grina [N-methyl-D-aspartate -associated glutamate receptor protein 1], Gnb1 [guanine nucleotide binding protein beta 1 polypeptide] and Gnb2 [guanine nucleotide binding protein beta 2 polypeptide]). [score:3]
Substantial variations in miR relative expression levels between retina and mouse platform were detected, ranging from a value of more than 6 (for miR-183 and miR-96) down to about 1 (miR-125a) on a log [2 ]scale. [score:3]
Among others, expression of miR-96, miR-183, miR-1, and miR-133 exhibited significant alterations in P347S mice by microarray analysis, and these changes were validated by qPCR. [score:3]
In light of this, it is unlikely that the significant changes observed in the expression of miR-96, miR-183, miR-1 and miR-133 are due to the altered cellular composition of the P347S retina. [score:3]
lists potential retinal target transcripts with the highest rankings for miR-96, miR-183, miR-1, and miR-133. [score:3]
Expressions of mouse microRNA (miR)-96, miR-183, miR-133 and miR-1 were analyzed using Ambion miR microarrays (green, 'A-' in legend), Exiqon miR microarrays (blue, 'E-' in legend), and quantitative real-time reverse transcription polymerase chain reaction (qPCR; magenta). [score:3]
For example, a difference in miR-183 expression between retina and platform samples was determined to be approximately 11 on a log [2 ]scale by qPCR, as compared with about 6 on a log [2 ]scale by microarray analysis. [score:2]
The expression of miR-96 and miR-183 was reduced by more than 2.5-fold in P347S retinas compared with wild-type mouse retinas. [score:2]
In mouse, a number of miRs (for instance, miR-181a, miR-182, miR-183 and miR-184) were detected at high levels in various parts of the eye, including the lens, cornea, and retina [26, 27]. [score:1]
Previously, miR-9, miR-29c, miR-96, miR-124a, miR-181a, miR-182, miR-183, and miR-204 were localized in the mouse retina by ISH [26- 28]. [score:1]
In summary, expression of miR-96 and miR-183 decreased by more than 2.5-fold (P < 0.001) in mutant retinas, whereas miR-1 and miR-133 increased by more than 3-fold (P < 0.001), as measured using qPCR. [score:1]
Indeed, recent studies in retina [28, 42], inner ear [52], and dorsal root ganglia [53] suggest that miR-183, miR-96 and miR-182 may represent a conserved sensory organ-specific cluster of miRs, and that these miRs may potentially be under similar transcriptional control. [score:1]
The above conditions were met by miR-1, miR-96, miR-133, and miR-183 (highlighted in red in Figure 4b,c); these miRs were therefore selected for qPCR quantification. [score:1]
Figure 6 displays corresponding data from the two different microarrays and qPCR analyses for miR-96, miR-183, miR-1, and miR-133. [score:1]
MiR-1, miR-96, miR-133, and miR-183 are highlighted in red; h and m in labels refer to human and mouse miRs. [score:1]
[1 to 20 of 29 sentences]
11
[+] score: 71
Their respective sequences are: miRCURY LNA™ miRNA Inhibitor Negative Control A: GTGTAACACGTCTATACGCCCA; miRCURY LNA™ miR-183 inhibitor: AGTGAATTCTACCAGTGCCAT; miRCURY LNA™ miR-96 inhibitor: GCAAAAATGTGCTAGTGCCAA; miRCURY LNA™ miR-182 inhibitor: TGTGAGTTCTACCATTGCCAA. [score:9]
The expression levels of the miR-183 family are upregulated in most cancer types (30). [score:6]
Compared with EV, overexpression of GSK3β inhibited the expression of miR-96, miR-182 and miR-183 by 2-fold (P < 0.05) (Figure 2D). [score:6]
To investigate the effects of suppression of miR-183-96-182 cluster on gastric cancer cell phenotype, we transfected a miRCURY LNA™ miRNA Inhibitor Negative Control or a mix of miRCURY LNA™ inhibitors for miR-183, miR-96 and miR-182 into AGS cells. [score:5]
Our results showed that both the primary and mature miR-96, miR-182, miR-183 expression levels were significantly upregulated in gastric cancer tissues compared with the adjacent normal control gastric tissues. [score:5]
Li et al. (32) reported that miR-96, miR-182 and miR-183 were all upregulated in intestinal-type gastric cancers. [score:4]
Since GSK3β inhibits the expression of miR-96, miR-182 and miR-183 in human gastric epithelial AGS cells, we measured the protein levels of GSK3β and β-Catenin by western blot and miR levels of miR-96, miR-182 and miR-183 by quantitative RT-PCR (qRT-PCR) in eight gastric cancer and matched normal gastric tissue samples. [score:3]
The miR array data revealed that they were increased 6-, 5- or 3-fold, respectively (Table 1 and Figure 2C), suggesting that GSK3β may suppress the generation of miR-96, miR-182 and miR-183. [score:3]
Figure 3. Expression levels of GSK3β, β-Catenin, miR-96, miR-182, miR-183 and pri-miR-183 in human gastric cancer. [score:3]
Expression levels of GSK3β, β-Catenin, miR-96, miR-182, miR-183 and primary miR-183-96-182 cluster in human gastric cancer. [score:3]
Overexpression of β-Catenin increased the levels of primary and mature miR-96, miR-182 and miR-183 by 5-fold (Figure 6A and B). [score:3]
For instance, miR-183 promotes cell growth and motility in prostate cancer cells by targeting Dkk-3 and SMAD4 (27). [score:3]
Figure 6. β-Catenin enhances expression of primary and mature miR-96, miR-182 and miR-183. [score:3]
But the expression levels of miR-183 family in gastric cancer are controversial. [score:3]
β-Catenin enhances expression of primary and mature miR-96, miR-182 and miR-183. [score:3]
Surprisingly, the primary miR-183-96-182 cluster (pri-miR-183) levels were higher in gastric cancer tissues than that in the matched normal tissues, indicating that GSK3β regulates the production of miR-96, miR-182 and miR-183 through β-Catenin at the transcription level. [score:2]
On the other hand, knockdown of β-Catenin by specific siRNA decreased the primary and mature miR-96, miR-182 and miR-183 levels by 3-fold (Figure 6C and D). [score:2]
Of the miRs that were increased the most by GSK3β KO, miR-96, miR-182 and miR-183 are all from the same miR gene cluster. [score:1]
The products of miR-183-96-182 cluster gene, miR-183, miR-96 and miR-182, play important roles in a variety of cancers. [score:1]
The gene encoding miR-96, miR-182 and miR-183 locates to human chromosome 7q32.2. [score:1]
The levels of miR-96, miR-182 and miR-183 in gastric cancer were increased by 2-fold (Figure 3C). [score:1]
We measured pri-miR-183 and mature miR-96, miR-182, miR-183 expression levels in gastric cancer and matched normal gastric tissue by qRT-PCR. [score:1]
[1 to 20 of 22 sentences]
12
[+] score: 62
Both miR-200a and miR-183 were approximately 78-fold upregulated (p-value<0.05) while miR-141 was 23-fold upregulated (p-value<0.001) (Fig 4B). [score:7]
All 4 of these miRNAs were also upregulated in the right cortex of the infected brain but at a lower fold change than for the left cortex (~18-fold for miR-141, ~15-fold for miR-200a, ~49-fold for miR-183 and ~5-fold for miR-155), correlating with the relatively lower number of cells stained for HSV-1. We found that hsv1-miR-H1 expression was also lower in cells extracted from the right versus the left cortex (Fig C in S1 File), however, the viral transcript copy numbers were not determined quantitatively. [score:6]
Induction of miR-200/182 expression visualized by in situ hybridization in brain tissueWe used ISH to visualize the expression of a subset of induced miRNAs (miR-141, miR-183, miR-200a and miR-155) within the brain of infected mice. [score:5]
We performed qRT-PCR to validate the upregulation of 5 miRNAs identified as deregulated by NGS and TLDA miR-141, miR-200a, miR-183, miR-26a, miR-146a, miR-132, miR-34a. [score:5]
One heparan sulfate proteoglycan, Sdc2, was predicted by TargetScan to be targeted at multiple conserved sites by at least 5 different members of the miR-200/182 miRNA group; miR-141, miR-200b/c, miR-182, miR-96 and miR-183. [score:5]
Using luciferase assays, we found that miR-96, miR-141, miR-183 and miR-200c all downregulated the expression of Sdc2. [score:5]
Using luciferase assays, we found that miR-96, miR-141, miR-183 and miR-200c all caused a downregulation of Sdc2 expression. [score:5]
We confirmed that miR-96, miR-141, miR-183 and miR-200c all bound to the Sdc2 3’UTR, resulting in ~2-fold downregulation (p-value<0.001) of the luciferase reporter gene (Fig 6D). [score:4]
We also observed the upregulation of 7 miRNAs belonging to the related and often co-transcribed miRNA-200 family (miR-200a,b,c/miR-141/miR-429) and miRNA-182 cluster (miR-182/miR-183), henceforth collectively referred to as miR-200/182. [score:4]
Using in situ hybridization (ISH), we found that miR-141, miR-200a and miR-183 expression was induced in cells that appeared to include not just myeloid cells but also other resident brain cells such as neurons and endothelial cells. [score:3]
We used ISH to visualize the expression of a subset of induced miRNAs (miR-141, miR-183, miR-200a and miR-155) within the brain of infected mice. [score:3]
In situ hybridization for miR-141, miR-200a and miR-183 further showed that the increased expression was not limited to cells with a glial or lymphocyte phenotype but also included neurons and likely other resident cell-types of the central nervous system (CNS) such as microglia, astrocytes and endothelial cells. [score:3]
In situ hybridizationMiR-141, miR-200a, miR-183 and miR-155 along with U6 (positive control) and a scrambled probe (negative control) within the brain sections were detected by in situ hybridization as previously described [33]. [score:1]
Increased staining in the HSV-1 versus mock-infected brain was clearly evident for miR-141, miR-183, miR-200a and miR-155 throughout the tissue (Fig D in S1 File). [score:1]
Interestingly, 6 members of the related and often co-transcribed miRNA-200 family (miR-200a,b,c/miR-141/miR-429) and miRNA-182 cluster (miR-182/miR-183), henceforth referred to collectively as miR-200/182, were amongst the highest induced in HSV-1 infected brain. [score:1]
was added to the slides and hybridized overnight at either 56°C for miR-141, 52°C for miR-200a, 58°C for miR-183, 49°C for miR-155, 60°C for U6 or 57°C for Scrambled probes. [score:1]
Total RNA was extracted from these samples and real-time PCR was used to profile for 3 select miR-200/182 members (miR-141, miR-200a and miR-183) as well as miR-155. [score:1]
MiR-141, miR-200a, miR-183 and miR-155 along with U6 (positive control) and a scrambled probe (negative control) within the brain sections were detected by in situ hybridization as previously described [33]. [score:1]
Particularly, we saw increased staining for miR-141 and miR-183 in the hypothalamus, a region of the brain acutely affected during HSV-1 infection [44]. [score:1]
[1 to 20 of 19 sentences]
13
[+] score: 44
Five miRNAs, miR-127, miR-21, miR-146b, miR-183, miR-184 were similarly up-regulated in c-Raf transgenic lung and human lung cancer therefore demonstrating clinical relevance of this particular disease mo del. [score:6]
Moreover, miR-96, miR-183, miR-322 were significantly up-regulated in male c-Raf mice. [score:4]
Five miRNAs, miR-127, miR-21, miR-146b, miR-183, miR-184 were similarly up-regulated in c-Raf transgenic mouse lung and human lung cancer thus further validating this mo del as relevant for human lung cancer (Figure 7). [score:4]
The gender bias for miR-183 and miR-322 was not confirmed, but the two miRs were up-regulated in all transgenic animals. [score:4]
Differential miRNA expression was examined by quantitative real time PCR (qRT-PCR) of the eight regulated miRNAs (miR-21, miR-96, miR-127, miR-146b, miR-183, miR-184 and miR-322, miR-433). [score:4]
Shown is the expression of miR-21, miR-146b, miR-127, miR-433, miR-96, miR-183, miR-184 and miR-322 in WT and transgenic male and female mice. [score:3]
The 3′UTR sequence alignment of VLC, SLC10A3, MAPK4, GATA3, ANKRD27, IRS1, CRISPLD2 and ARL2 between Mus musculus and Homo sapiens species may possibly suggest conservation of seed sequences targeted by miR-21 (panel A), miR-146b (panel B), miR-127 (panel C), miR-433 (panel D), miR-96 (panel E), miR-183 (panel F), miR-184 (panel G) and miR-322 (panel H), respectively. [score:3]
0078870.g002 Figure 2 Shown is the expression of miR-21, miR-146b, miR-127, miR-433, miR-96, miR-183, miR-184 and miR-322 in WT and transgenic male and female mice. [score:3]
Specifically, with the Agilent platform a significant regulation of miR-21, miR-96, miR-127, miR-146b, miR-183, miR-184 and miR-322 was observed whereas for the Affymetrix platform significant regulation of miR-127 and miR-433 could only be evidenced. [score:3]
Note, miR-182 is expressed as a cluster with miR-96 and miR-183 and share similar sequences. [score:3]
0078870.g005 Figure 5The 3′UTR sequence alignment of VLC, SLC10A3, MAPK4, GATA3, ANKRD27, IRS1, CRISPLD2 and ARL2 between Mus musculus and Homo sapiens species may possibly suggest conservation of seed sequences targeted by miR-21 (panel A), miR-146b (panel B), miR-127 (panel C), miR-433 (panel D), miR-96 (panel E), miR-183 (panel F), miR-184 (panel G) and miR-322 (panel H), respectively. [score:3]
3) 55.6 AACCCATGGAATTCAGTTCTCA −26.0 59.5 −20 54.0 mmu-miR-146b UGAGAACUGAAUUCCAUAGGCU 40 AGCCTATGGAATTCAGTT(C) (−21.5) 41.5 AGCCTATGGAATTCAGTTCTCA −26.2 47.4 −20.2 39.2 mmu-miR-182 UUUGGCAAUGGUAGAACUCACACCG 48 CGGTGTGAGTTCTAC(C) (−19.9) 62.9 CGGTGTGAGTTCTACCATTGCCAAA −31.9 62.9 −17 58.8 mmu-miR-183 UAUGGCACUGGUAGAAUUCACU 40 AGTGAATTCTACCAGTGC(C) (−23.2) 44.7 AGTGAATTCTACCAGTGCCATA −26.3 46.3 −20.3 40.0 mmu-miR-184 UGGACGGAGAACUGAUAAGGGU 50 ACCCTTATCAGTTCTCCGTCC(A) (−31.9) 57.0 ACCCTTATCAGTTCTCCGTCCA −31.9 57.0 −30.3 56.2 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA 40 TCCAAAACATGAATTGCTGCTG −23.1 37.7 TCCAAAACATGAATTGCTGCTG −23.1 37.7 mmu-miR-433 AUCAUGAUGGGCUCCUCGGUGU 54 ACACCGAGGAGCC(C) (−20. [score:1]
Prefabricated TaqMan MicroRNA Assays (containing microRNA-specific forward and reverse PCR primers and microRNA-specific Taqman MGB probe) were used to determine expression of miR-21 (ABI P/N 000397), miR-146b-5p (ABI P/N001097), miR-127 (ABI P/N000452), miR-433-3p (ABI P/N001028), miR-322 (ABI P/N001076), miR-184-3p (ABI P/N000485), miR-183 (ABI P/N002269), miR-96 (ABI P/N000186), miR-15a-5p (ABI P/N000389), miR-34a-5p (ABI P/N000426), miR-146a-5p (ABI P/N000468) and miR-182-5p (ABI P/N002599). [score:1]
We also analyzed miR-182, whose gene is in proximity to that of miR-96 and miR-183, and miR-146a which differs from miR-146b by only two bases (Table 2). [score:1]
Importantly, miR-183 and miR-96 belong to the same locus, located on chromosome 6 and 7 in mouse and human, respectively. [score:1]
[1 to 20 of 15 sentences]
14
[+] score: 41
Fig. 5. Atm expression is upregulated in Dgcr8 and Dicer c KOs and a target of germline-expressed miR-18, as well as miR-183 and miR-16. [score:10]
The target sites of two other miRNAs, miR-183 and miR-16, clustered in the same region of the Atm 3′UTR as the miR-18 target sites; moreover, the miR-183 and miR-16 target sites were predicted as the second and third strongest sites, respectively, within Atm (Fig.  5C). [score:7]
Taken together, these results indicate that miR-18, miR-183, and miR-16 target sites in Atm are functional and effective at eliciting downregulation in response to very low levels of miRNA. [score:6]
Many miRNAs are predicted to target the Atm 3′UTR, but only three are also expressed in spermatocytes and show depletion in Dgcr8 and Dicer c KOs: miR-18, miR-183 and miR-16. [score:5]
Therefore, miR-18, miR-183 and miR-16 are the strongest candidates for miRNA -mediated regulation of Atm expression in mammalian spermatogenesis. [score:4]
We also identified alterations in many small RNAs, including miR-18, miR-183 and miR-16, among whose targets is the mRNA encoding ATM. [score:3]
Like the miR-18 target sites, the single site for miR-183 (Fig.  5F) and combined miR-16 sites (Fig.  5H) were able to mediate an ∼2-fold repression of the reporter construct at high-to-moderate concentrations (25-nM–1-nM) of miR-183 and miR-16 mimetic. [score:3]
Reporter constructs were transfected into A549 cells along with varying levels of siRNA duplexes corresponding to miR-18 (using RNA oligonucleotides: 5′-UAAGGUGCAUCUAGUGCA-GAU-3′ and 5′-CUGCACUAGAUGCACCUUAAU-3′), miR-183 (5′-UA-UGGCACUGGUAGAAUUCACU-3′ and 5′-UGAAUUCUACCAGUG-CCAGAUA-3′), miR-16 (5′-UAGCAGCACGUAAAUAUUGGCG-3′ and 5′-CCAAUAUUUACGUGCUGUUAUU-3′), or, as a control, miR-124 (Lim et al., 2005). [score:1]
Sites were mutated as follows: the miR-18 site (GCACCUUA) was mutated to GCAggaUA for both miR-18 sites; the miR-183 site (GUGCCAUA) was mutated to GUGaCgUA, the miR-16 sites (GCUGCU) were mutated to either GCcGaU, GaUGgU, GCcGaU (corresponding to the order of the sites within the reporter construct). [score:1]
Our results underscore the significance of specific miRNAs in ensuring the fi delity of gametogenesis, and point to miR-18, miR-183 and miR-16 as miRNAs playing an important role in male fertility. [score:1]
[1 to 20 of 10 sentences]
15
[+] score: 32
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-29a, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-181a-2, mmu-mir-182, mmu-mir-194-1, mmu-mir-200b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-140, hsa-mir-194-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-29a, mmu-mir-96, mmu-mir-34a, mmu-mir-135b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-376c, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-135b, mmu-mir-181b-2, mmu-mir-376b, dre-mir-34a, dre-mir-181b-1, dre-mir-181b-2, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-15a-1, dre-mir-15a-2, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-29a, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-181c, dre-mir-194a, dre-mir-194b, dre-mir-200b, dre-mir-200c, hsa-mir-376b, hsa-mir-181d, hsa-mir-507, dre-let-7j, dre-mir-135b, dre-mir-181a-2, hsa-mir-376a-2, mmu-mir-376c, dre-mir-34b, dre-mir-34c, mmu-mir-181d, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, mmu-mir-124b
In an effort to determine whether the miRNA-183 cluster is further involved in deafness, predicted target genes of the miR-183 miRNA, expressed in the inner ear, were screened in 150 Americans with autosomal dominant NSHL and 576 Iranians with autosomal recessive NSHL (Hildebrand et al., 2010). [score:5]
Expression patterns of miR-96, miR-182 and miR-183 in the development inner ear. [score:4]
Several studies defined targets for members of the miR-183 triad. [score:3]
It appears that mutations affecting gene regulation of the miR-183 family are not typical causes of a deafness phenotype. [score:3]
MicroRNA-183 family expression in hair cell development and requirement of microRNAs for hair cell maintenance and survival. [score:3]
The miR-183/Taok1 target pair is implicated in cochlear responses to acoustic trauma. [score:3]
MiR-183 family regulates chloride intracellular channel 5 expression in inner ear hair cells. [score:3]
miRNA Gene target Experimental system used Reference miR-183 TAO kinase 1 (Taok1) Rat cochlear organotypic cultures transfected with antisense morpholinos. [score:3]
A study demonstrating the role of the miR-183 family in zebrafish by reducing and increasing levels of miRNAs by morpholino (MO) or miRNA injection, respectively, revealed that the miR-183 cluster is crucial for inner ear hair cell and neuronal development (Li et al., 2010). [score:2]
MicroRNA-183 family members regulate sensorineural fates in the inner ear. [score:1]
Inactivation of the microRNA-183/96/182 cluster results in syndromic retinal degeneration. [score:1]
This conserved miRNA triad, composed of miR-183, miR-182, and miR-96, is transcribed in one polycistronic transcript. [score:1]
[1 to 20 of 12 sentences]
16
[+] score: 31
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-18a, hsa-mir-21, hsa-mir-27a, hsa-mir-96, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30b, mmu-mir-99a, mmu-mir-124-3, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-181a-2, mmu-mir-182, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-21a, mmu-mir-27a, mmu-mir-96, mmu-mir-135b, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-200a, hsa-mir-135b, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-15a-1, dre-mir-15a-2, dre-mir-18a, dre-mir-21-1, dre-mir-21-2, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30b, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-135c-1, dre-mir-135c-2, dre-mir-200a, dre-mir-200b, dre-let-7j, dre-mir-135b, dre-mir-181a-2, dre-mir-135a, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
miRNA expression in the zebrafish inner ear was first demonstrated by mir-200a and mir-183 expression in the sensory epithelia (Wienholds et al, 2005). [score:5]
In order to address the essential question of the effect of miRNAs throughout development, a study was conducted examining the expression pattern of the mir-183, mir-182 and mir-96 cluster (Sacheli et al, 2009). [score:4]
These analyses revealed that the conserved cluster of mir-183, mir-182 and mir-96 have a restricted expression to the mouse inner ear, as compared to brain, heart and whole embryo expression. [score:4]
By P0, miR-183, miR-182 and miR-96 were strongly expressed in hair cells of the cochlea and the vestibular system, and in the spiral ganglia. [score:3]
In situ hybridization revealed the unique expression pattern of mir-182, mir-183 and mir-96 in inner and outer hair cells of the cochlea, hair cells of the vestibular organs and spiral and vestibular ganglia. [score:3]
However, the expression of miR-183 and miR-182 continued in the hair cells, but ceased to be present in hair cells from P11-15, and was only found in the spiral limbus and the inner sulcus. [score:3]
A conserved miRNA cluster, which includes miR-183, miR-182 and miR-96, was shown to be expressed in the zebrafish in the hair cells, otic neurons and other primary sensory cells. [score:3]
Since this report, several studies have focused on the mir-96, mir-182 and mir-183 genes as a source for more deafness mutations. [score:2]
In a different mo del system, zebrafish were used to understand the role of the miR-96, miR-182 and miR-183 cluster in inner ear development (Li et al, 2010). [score:2]
miR-183 was completely depleted in the hair cells of the mutant mice, but not in spiral ganglia. [score:1]
miR-183 and miR-182, but not miR-96, were detected in the otic vesicle in the embryonic early inner ear. [score:1]
[1 to 20 of 11 sentences]
17
[+] score: 31
Other miRNAs from this paper: mmu-mir-182, mmu-mir-96
MiR-182, miR-183, and miR-96 have similar seed sequences, target genes, expression patterns, and genomic loci [9], suggesting they may act in a coordinated manner, compensating for each other in vivo. [score:5]
The expression patterns of miR-96 and miR-183, encoded as precursor genes in the long homology arm of the targeting construct, were not affected by the deletion. [score:5]
Recently, several groups reported the retinal expression of a polycistronic miRNA cluster, which includes miR-182, miR-183, and miR-96 in the retina [9, 10]. [score:3]
Expression levels of miR-96, miR-182, and miR-183 in lymph node (lane a), skin (b), skeletal muscle (c), white fat (d), brown fat (e), liver (f), kidney (g), adrenal gland (h), spleen (i), testis (j), stomach (k), small intestine (l), large intestine (m), thymus (n), lung (o), cardiac ventricle (p), thyroid gland (q), submandibular gland (r), cerebrum (s), cerebellum (t), and eye (u) tissues of wild-type mice were analyzed by northern blotting. [score:3]
Total RNA was isolated from eyes of wild-type (+/+), heterozygous (+/−), and homozygous (−/−) KO mice and the expression levels of miR-96, miR-182, and miR-183 were analyzed by northern blotting. [score:3]
Thus, additional removal of miR-183 as well as miR-96 may be necessary to unravel their exact roles in retinal development. [score:2]
B: Sequences of miR-96, miR-182, and miR-183 are shown. [score:1]
Nucleotides that are identical between miR-182 and miR-96, and miR-182 and miR-183 are denoted in red. [score:1]
Figure 1Tissue distribution of miR-96, miR-182, and miR-183 in the mouse. [score:1]
Hybridization was performed overnight at 42 °C (miR-96) or 35 °C (miR-182 and miR-183), and the signals were detected using a BAS2500 image analyzer (Fuji Photo Film, Tokyo, Japan). [score:1]
We examined the tissue distribution of miR-96, miR-182, and miR-183 in normal adult mice (Figure 1A). [score:1]
Synthetic miR-96 (lane 1), miR-182 (lane 2), and miR-183 (lane 3) were used as controls. [score:1]
It should be noted that miR-96, miR-182, and miR-183 have similar sequences in their 5′ seed regions [6, 23] and that 18 of 22 nucleotides in miR-183 were identical to those in miR-182 (Figure 1B). [score:1]
Although probes for miR-182 and miR-183 cross-reacted, they were distinguishable from each other because of differences in their sizes and signal intensities; miR-183 (22 mer) was shorter than miR-182 (25 mer), and the signal intensities from the cross-reaction were weaker than the specific signal intensities. [score:1]
Oligonucleotide probes specific for miR-96, miR-182, and miR-183 (IDT Technologies, Coralville, IA) were labeled with [α- [32]P]dATP. [score:1]
Synthesized miR-96, miR-182, and miR-183 were used as controls for northern blotting (lanes 1–3 in Figure 1A). [score:1]
[1 to 20 of 16 sentences]
18
[+] score: 27
miR-183 also appears target the expression of ZEB1 [45], TCF-4, and NFKB1, an activator of lin-28, IL-6 and Snail1 (inducers of EMT & metastasis) expression(Target scan). [score:9]
Evidently, TA-p73/p63 appears to increase E-cadherin expression (a negative regulator of EMT), by suppressing ZEB1/2 through its target miRs, such as miR-192, miR-215, miR-145, miR-203, miR-200b, miR-200c, miR-183, miR-92a/b, miR-132, and miR-30a-e [45]. [score:8]
Together, these data suggest that p53, by inducing miR-183 and let-7, it could promote the destabilization/degradation of oncogenic mRNAs (βTrCP1, c-myc, MDR-1, IGF2BP1, ZEB1, TCF-4, NFKB1) and thereby suppress the expression of metastatic factors [79] [Figure 4]. [score:5]
miR-183 has recently shown to be induced in response to p53 expression [56]. [score:3]
Interestingly, both Ago-2 and miR-183 bind to the over lapping region of βTrCP1. [score:1]
It has recently been shown that miR-183 binds to the coding region of β-transducin repeat-containing protein 1 [βTrCP1] mRNA, a substrate recognition protein of the SCF E3 ubiquitin ligase complex, and thereby destabilizes it by recruiting the Ago-2 containing RNA -induced silencing complex [78], [56] [Figure 4]. [score:1]
[1 to 20 of 6 sentences]
19
[+] score: 27
Two miRNAs (miR-9-5p and miR-183-5p) were regulated by O [3], and these were shown to target the NF-kB protein and mRNA experimentally (Western blot and qRT-PCR) [46] and by in silico analysis (TargetScan). [score:6]
Two miRNAs (miR-9-5p and miR-183-5p) were significantly changed by O [3], and these were shown to target the NF-kB mRNA experimentally [46] and by in silico analysis (TargetScan), respectively. [score:5]
This mRNA is targeted by miR-9-5p [47], miR-21-5p, miR-16-5p (TargetScan), miR-183-5p [47], miR-486b-5p [82], and miR-153-3p [47]. [score:5]
miR-183-5p, which was upregulated, probably has the opposite effect. [score:4]
miR-183-5p that was upregulated may have the opposite effect on NF-kB. [score:4]
FOXO1 is targeted by a multitude of miRNAs that are changed in our study miR-9-5p, miR-21-5p, miR-16-5p, miR-183-5p [47], miR-486b-5p, and miR-153-3p. [score:3]
[1 to 20 of 6 sentences]
20
[+] score: 26
Based on qPCR and next generation sequencing, we found that a gene signature, CPEB1, was significantly down-regulated in EEC tissues, which may have been caused by hsa-miR-183-5p up-regulation. [score:7]
It is noteworthy that hsa-miR-183-5p is predicted to bind to position 454-460 of CPEB1 3′-UTR, thus CPEB1 down -expression results in up-regulation of hsa-miR-183-5p. [score:6]
CPEB1 May Be Relevant to up-Regulated hsa-miR-183-5p in EEC Tissues. [score:4]
It has been reported that hsa-miR-183-5p is highly expressed in HEC-1B cells, which is consistent with our miRNA-seq results [32]. [score:3]
It is noteworthy that hsa-miR-183-5p is predicted to bind to position 454–460 of CPEB1 3′-UTR by Targetscan software. [score:3]
CPEB1 has four groups of potential up-stream miRNAs predicted by our prediction methods described in the Materials and Methods section, including hsa-let-7, hsa-miR-129-2-3p, hsa-miR-183-5p, and hsa-miR-96-5p. [score:1]
After we calculated the RPKM value for the four groups of miRNAs, we found that the level of hsa-miR-183-5p expression was significantly higher in EEC samples than corresponding normal samples (p = 0.0458). [score:1]
We still need to validate hsa-miR-183-5p by qRT-PCR in future study. [score:1]
[1 to 20 of 8 sentences]
21
[+] score: 26
Human neuroblastoma SHSY5Y cells were transfected with miRNAs (miR200c, miR183, miR182, miR141, miR-96) mimics or inhibitors (Thermo Scientific Dhamacon miRIDIAN microRNA Mimics & Hairpin Inhibitors) using Lipofectamine RNAimax (Invitrogen). [score:5]
We could confirm that miR-200, miR-182, miR-183, miR-141, miR-96, miR-122 and miR-429 were indeed down regulated, and miR-34 and miR-206 were upregulated during hibernation torpor (Fig. 2B). [score:5]
We transfected SHSY5Y cells with inhibitors or mimics for several miR-200 family and the miR-182 family miRNAs (miR-200c, miR-141, miR-182, miR-183 and miR-96) in duplicate plates, incubated them for 2 days, and subjected one plate of cells to OGD, and the other plate of cells to normal culture conditiions as a control. [score:3]
0047787.g003 Figure 3 (A) SHSY5Y cells were transfected with hairpin inhibitors for human miR-200c, miR-182, miR-183 and miR-141 individually, the levels of these miRNAs were measured by qPCR, and expressed relative (fold change) to endogenous levels. [score:3]
Identification of potential targets of miR-200 family and miR-183/96/182 family miRNAs in ULMs and/or ULM-related genes. [score:3]
MiR-182, miR-96, miR-200, miR-183 and miR-141 were among the most highly regulated miRNAs with a 13∼20-fold decrease during the torpor phase of the hibernation cycle. [score:2]
In particular, two miRNA families, the miR-200 family (miR-200a, b, c, miR-496, and miR-141) and the miR-182 family (miR-182, miR-183 and miR-96) were consistently down regulated during torpor phase. [score:2]
We also report that two miRNA families, miR-200 family (miR-200a/miR-200b/miR-200c/miR-141/miR-429) and miR-182 family (miR-182/miR-183/miR-96), which were consistently lower in the brain samples from torpor phase ground squirrels compared to active animals, are involved in expression of various ULM proteins and their global protein conjugation. [score:2]
The order of endogenous levels of the microRNAs tested in SHSY5Y cells is miR-182>>miR-141≥miR-183>miR-200c. [score:1]
[1 to 20 of 9 sentences]
22
[+] score: 24
Among altered miRNAs, miR-183/96/182 cluster and miR-191-5p both target and downregulate BDNF. [score:6]
The miR-183/96/182 cluster upregulated in the PR+BC tumor-bearing treated and untreated mice was implicated in hepatocellular carcinoma, breast cancer, and glioma [85- 87]. [score:4]
We observed the upregulation of eight miRNAs that make up a related miR-200 family (miR-200a, 200b, 200c, miR-141, miR-429) and a miR-183/96/182 cluster. [score:4]
Among the other miRNAs, the miR-183/96/182 family and miR-10b target BDNF as well [51, 53]. [score:3]
We noted a commonality between all three groups (PR+BC, PR+BC/CRIZ, and PR+BC/TOP): miR 200 family (miR-200a, miR-200b, miR-200c, miR-141, and miR-429), miR-183/96/182 cluster, miR-30d-5p, and miR-191-5p were up-regulated, as compared to intact controls. [score:3]
Chemo and tumor brain -induced miRNA changes involved several miRNA families, such as the miR-200 family and miR-183/96/182 cluster, which were deregulated in PR+BC tumor-bearing and chemotherapy -treated animals. [score:2]
Green arrow - miR-200 family; blue arrow - miR-183/96/182 cluster; red arrow - other common miRNAs. [score:1]
, and stress -induced cellular senescence was also promoted by the miR-183/96/182 cluster [104]. [score:1]
[1 to 20 of 8 sentences]
23
[+] score: 22
As shown, the expression levels of miR-183 and miR-181 were significantly downregulated, while miR-29a and miR-34a were upregulated with aging compared to P21. [score:8]
miRNAs that were significantly downregulated include members of the miR-181 and miR-183 families. [score:4]
The two downregulated miRNAs, miR-181 and miR-183, are important for proliferation and differentiation, respectively [39]– [42]. [score:4]
We observed a significant downregulation of miR-182 and miR-183 in the two strains. [score:4]
For example, miR-124 and the miR-183 family are necessary for neurosensory cell fate determination [14], [15], [17]. [score:1]
miR-183 family members include miR-96, miR-182, and miR-183. [score:1]
[1 to 20 of 6 sentences]
24
[+] score: 20
Interestingly, most of these differentially expressed miRNAs belonged to miRNA families, including miR-8 and miR-132 families overexpressed in FCx and miR-34 family overexpressed in HP, or miRNA clusters transcribed from the same locus (miR-182|miR-183|miR-96 cluster overexpressed in FCx). [score:9]
The miR-182|miR-183|miR-96 cluster, also identified in our study, has previously been shown to regulate insulin signaling pathway, with miR-96 and miR-183 mainly regulating Irs1 and miR-182 targeting Rasa1 and Grb2 [31]. [score:5]
These included miR-8 family overexpressed in FCx and comprising of miRNAs from two chromosomal clusters, miR-429, miR-200a, miR-200a*, miR-200b, and miR-200b* from chromosome 4, and miR-141 and miR-200c from chromosome 6. Also, a chromosome 6 cluster with miR-182, miR-96, and miR-183 and a chromosome 11 cluster with miR-212 and miR-312 were expressed on a higher level in FCx. [score:5]
These included miR-8, miR-132, and miR-34 families and the miR-182|miR-96|miR-183 cluster. [score:1]
[1 to 20 of 4 sentences]
25
[+] score: 19
Other miRNAs from this paper: mmu-mir-155, mmu-mir-182, mmu-mir-214
Additionally, despite miR-183 being co-regulated with miR-182 (Figure 4d), miR-182 inhibitor failed to significantly downregulate miR-183 expression in day 12 splenic CD4 [+] T cells thereby indicating the specificity of the depletion regime for miR-182. [score:9]
P < 0.05 using ANOVA with Tukey B Comparison Test in c., * miR-182 inhibitor treated Cm infected mice compared to Cm infected mice; [§] miR-182 inhibitor treated Cm infected mice compared to scramble treated Cm infected mice and d. significant increase in miR-182 and miR-183 expression * compared to mock infected mice; [§] compared to miR-182 inhibitor treated Cm infected mice. [score:5]
Additionally miR-183 (a member of the miR-182 family [35]) was found to be significantly up-regulated in day 12 CD4+ T cells from Cm infected mice (Figure 4b), and in Cm vaccinated + Cm infected mice (Figure 4c) compared to control. [score:3]
Importantly, miR-182 and its family member, miR-183 were significantly co-regulated in CD4 [+] T cells isolated from vaccinated mice protected at day 6 after a subsequent intravaginal Cm infection (Figure 4c, 4d). [score:2]
[1 to 20 of 4 sentences]
26
[+] score: 19
org), the Serial Analysis of Gene Expression (SAGE) and the literature [37, 38], and commercial hearing loss databases and found four genes to be targeted by both NR2F1 and miRNAs: Crym and Snai2 were both targeted by miR-96 and miR-181b; Gjb2 was targeted by miR-140 and miR-183 (Table S5 in File S1 ). [score:9]
With these criteria a set of 11 miRNAs (miR-17, miR-33, miR-96, miR-140, miR-181b, miR-183, miR-191, miR-194, miR-199b, miR-341, and miR-1192) were selected that might participate to coordinate with NR2F1 to regulate inner ear gene expression. [score:4]
The miR-183 family of miRNAs is expressed and required for maintenance and survival of hair cells [45, 46]. [score:3]
Of the miRNAs expressed, miR-17 and miR-341 have NR2F1 binding sites within their coding regions, miR-140, miR-191 and miR-199b have NR2F1 binding sites within the proximal promoter region of their loci, and miR-183 and miR-181b have NR2F1 binding sites 8 and 15 base pairs immediately upstream of the transcription start sites, respectively. [score:3]
[1 to 20 of 4 sentences]
27
[+] score: 18
Mmu-miR-695, mmu-miR-31, mmu-miR-190, mmu-miR-183, mmu-miR-182, and mmu-miR-194 were the most significantly downregulated miRNAs, whereas mmu-miR-34c and mmu-miR-124 were the most significantly upregulated miRNAs. [score:7]
The results showed that the expression of mmu-miR-31, mmu-miR-695, mmu-miR-183, mmu-miR-182, mmu-miR-194, and mmu-miR-190 markedly downregulated in the corneal endothelium of old mice compared to young mice. [score:5]
The qRT-PCR results demonstrated a decrease in the expression of mmu-miR-31(34.2±13.4-fold), mmu-miR-695 (19.8±4.79-fold), mmu-miR-183 (26.6±2.53-fold), mmu-miR-182 (55.2±15.3-fold), mmu-miR-194 (42.6±10.2-fold) and mmu-miR-190 (37.1±2.78-fold) in the corneal endothelium of old mice compared to young mice, whereas the expression of mmu-miR-34c and mmu-miR-124 increased 26.4±5.28-fold and 62.7±2.54-fold, respectively (Figure 2). [score:4]
It has been reported that miR-183 was increased in H [2]O [2] -induced cellular senescence [36, 37]. [score:1]
To validate the reproducibility of the results from the miRNA microarray, qRT-PCR analysis of (microRNAs come from mice) mmu-miR-695, mmu-miR-183, mmu-miR-182, mmu-miR-194, mmu-miR-34c, mmu-miR-31, mmu-miR-190, and mmu-miR-124 was performed using the same extracted total RNA as the microarray analysis. [score:1]
[1 to 20 of 5 sentences]
28
[+] score: 16
In the results of the splenocytes from the MRL/lpr mice, ASC treatment did not change the miR expression significantly, but cyclophosphamide treatment decreased the expression of miR-31-5p, miR-96-5p, miR-127-3p, miR-182-5p, miR-183-5p, and miR-379-5p significantly compared with the saline-treatment. [score:4]
The expression levels of miR-31-5p, miR-96-5p, miR-182-5p, miR-183-5p, and miR-379-5p were significantly higher, while those of miR150-5p were significantly lower in the C group than in the N group. [score:3]
The expression levels of miR-31-5p, miR-96-5p, miR-182-5p, miR-183-5p, and miR-379-5p were significantly higher, while those of miR150-5p were significantly lower in C3. [score:3]
In splenocytes from the MRL-lpr mice (the samples in our previous study), the expression levels of miR-18a-5p, miR-31-5p, miR-96-5p, miR-127-3p, miR-182-5p, miR-183-5p, and miR-379-5p were significantly higher, while those of miR-101a-3p and miR150-5p were significantly lower in the C group than in the N group. [score:3]
The expression levels of miR-31-5p, miR-96-5p, miR-127-3p, miR-182-5p, miR-183-5p, and miR-379-5p 5p in the Y group were significantly lower than in the C group (Supplementary Fig. 3). [score:3]
[1 to 20 of 5 sentences]
29
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
miR-183, another member of miR-183~182 cluster, was also upregulated by HDI. [score:4]
Because the precursors of miR-96, miR-182, and miR-183 are transcribed as a single transcript, these findings further support the contention that HDI modulate miRNA expression through regulation of their primary transcript (16). [score:4]
In B cells stimulated with LPS plus IL-4, miR-182, miR-96, and miR-183 were all highly expressed. [score:3]
miR-182 is a member of the miR-183~182 cluster which includes miR-96, miR-182, and miR-183. [score:1]
miR-182, miR-96, and miR-183 belong to a polycistronic miRNA cluster that is located within a 4-kb area on mouse chromosome 6q. [score:1]
[1 to 20 of 5 sentences]
30
[+] score: 13
While some downregulated miRNAs were observed, we focused on the significantly upregulated miR-200 family members (miR-141, -200a, -200b, -200c, and -429) and the miR-183 family members (miR-96, -182, and -183), which had higher expression levels in 10-month-old Tg2576 mice (fold-change > 2.0, unpaired Student’s t-test; p < 0.05; Fig 1A). [score:9]
The miRNAs that were upregulated were members of the miR-200 and miR-183 families. [score:4]
[1 to 20 of 2 sentences]
31
[+] score: 13
Importantly, several of these miRNAs (miR-24, miR-140, miR-182, miR-183, miR-328) are expressed in fetal or neonatal lung and their relative expression levels are modulated during lung development [26, 27] or in lung cancer [28– 30]. [score:6]
Of these, miR-140, miR-183, and miR-328 suppressed luciferase activity, while miR24 and miR-182 increased luciferase activity (Fig 3F, mouse, and S4A Fig and S4B Fig, human). [score:3]
Mature microRNA mimics for miR-24, miR-140, miR-182, miR-183, and miR-328 were then screened for their ability to regulate luciferase activity of the human or mouse FGF9 3’ UTR. [score:2]
The human and mouse FGF9 3’ UTR are highly conserved and are similarly regulated by miR-140, miR-182, miR-183, miR-328. [score:2]
[1 to 20 of 4 sentences]
32
[+] score: 12
Other miRNAs from this paper: mmu-mir-182, mmu-mir-96
Rncr4 is also expressed in our RNA-seq data (Supplementary Fig.   S2d) and miR-182 and miR-183 are notably highly expressed in both the vestibule and cochlea at both developmental stages [36]. [score:6]
In the same locus, an additional lncRNA, retinal noncoding RNA 4 (Rncr4), was recently recognized to be expressed in maturing photoreceptors, where it is divergently expressed, compared with the polycistronic miR-183 family [52]. [score:4]
linc_miR96 contains the pri-microRNA for the mir-183/96/182 cluster in its intron (Fig.   5a). [score:1]
This lncRNA was identified as a factor that stimulates pri-miR-183/96/182 processing. [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 12
The vestibular up-regulated miRNAs include all the members of the miR-183/96/182 cluster previously demonstrated to be specifically expressed in the mammalian inner ear hair cells and ganglia [11], [12], [31]. [score:6]
These include the mir-183/96/182 cluster that had a higher expression in the vestibule (fold change of 1.4–1.5) as well as two members of each of the mir-17/92 and mir-106a/363 clusters, which had a higher expression in the cochlea. [score:5]
To date, the only miRNAs identified demonstrating inner ear hair cell specificity are part of the miR-183/96/182 family [31]. [score:1]
[1 to 20 of 3 sentences]
34
[+] score: 11
Several of the miRNAs previously noted to be highly expressed in developing retina were up-regulated in ESMV -treated Müller cells, including miR-1, miR-96, miR-182 and miR-183. [score:6]
In addition, we observed the up-regulation of endogenous human miR-1, miR-96, miR-182, and miR-183, the appearance of which marked progression through early retinal development [45], supporting the notion that ESMV treatment shifts Müller cell differentiation towards an early retinal progenitor stage. [score:5]
[1 to 20 of 2 sentences]
35
[+] score: 11
Silencing PRDM14 reduced the expression of miRNAs upregulated in breast cancer tissues (e. g. miR-106a, miR-149, miR-18a, miR-221, miR-222, miR-224, miR-23a, miR-24, miR-27a/b, and miR-493) and increased expression of those that were downregulated (e. g. miR-15a, miR-150, miR-183, and miR-203). [score:11]
[1 to 20 of 1 sentences]
36
[+] score: 10
Induced overexpression of miR-183 inhibited migration of breast cancer cells [4]. [score:5]
MiR-183 is dysregulated in breast cancer and its expression correlates with estrogen receptor and HER2/neu receptor expression. [score:5]
[1 to 20 of 2 sentences]
37
[+] score: 10
We found correlations indicating putative intrathymic functions for some miRNAs, such as miR-183 that direct regulates integrin β1 expression (56), miR-143, suppressing fibronectin directly (57), miR-218 controlling focal adhesion kinase (58), and miR-203 increasing metalloproteinase-1 expression (59). [score:10]
[1 to 20 of 1 sentences]
38
[+] score: 10
Clinically, miR-183 has been shown to be upregulated in whole blood samples from depressed patients on antidepressant treatment [42], highlighting that miR-183 is highly responsive to emotional stimuli. [score:4]
We demonstrated the presence of miRNAs that had a large fold increase (miR-3535, miR-673-5p) or decrease (miR-182-5p, miR-1964, miR-206-3p), that were normalized by colonization (miR-219a-2-3p (PFC), miR-182-5p, miR-183-5p (amygdala)) and that are known to be implicated in influencing anxiety levels and expression of neurotrophins such as brain-derived neurotrophic factor (BDNF) (miR-183-5p, miR-206-3p) [33, 34]. [score:3]
Specifically, miR-183 has been linked to regulating anxiety-related behaviours in the Indian field mouse through influencing acetylcholinesterase splicing [33]. [score:2]
Within the amygdala, we found that miR-183-5p and miR-182-5p were both decreased and subsequently normalized by colonization. [score:1]
[1 to 20 of 4 sentences]
39
[+] score: 10
The commonly upregulated miRNAs included those of 34 known tumor suppressor genes (e. g., miR-16, miR-96, miR-150, miR-183, miR-186, miR-194, miR-320, and miR-371), nine miRNAs of oncogenes (e. g. miR-454), and 14 miRNAs that show both tumor suppressive and oncogenic function(Supplementary Table S1). [score:8]
In addition, to examine whether these candidate miRNAs regulate CCR6, we transiently transduced 12 miRNAs including miR-150, miR-96, miR-183, miR-194-5p, miR-320a, miR-371a-5p, miR-3135b, miR-3652, miR-4534, miR-4698, and miR-6088. [score:2]
[1 to 20 of 2 sentences]
40
[+] score: 10
The relative higher level of expression of Sox2 in IHCs is consistent with relative higher level expression of miR-183 in IHCs [53]. [score:5]
Sox2 is a predicted target of miR-183 family [53], which is abundantly expressed in HCs, especially in IHCs [53]. [score:5]
[1 to 20 of 2 sentences]
41
[+] score: 9
For example, miR-192-5p+1 was 22-fold more highly expressed in human beta cells than in MIN6, miR-10a-5p+1 was 23-fold more highly expressed in human islets than in MIN6, and miR-183-5p+1 was nearly 3-fold more highly expressed in MIN6 than in human beta cells or islets (Fig. 3B). [score:7]
Strikingly, three of the 10 candidate miRNA regulatory hubs in the T2D gene network were 5′-shifted isomiRs: miR-375+1, miR-375-1, and miR-183-5p+1 (Fig. 4A). [score:2]
[1 to 20 of 2 sentences]
42
[+] score: 8
Members of the miR-183 family were upregulated in the liver of NAFLD patients [38] and obese diabetic animal mo dels, such as db/db and ob/ob mice [39, 40]. [score:4]
Although the miR-183 family exhibits the conservation of their genomic organization and sequence homology, many lines of evidence indicate that the levels of these miRNAs can be regulated individually by transcription, DNA methylation, and post-transcriptional processing [26, 27]. [score:2]
Hsa-miR-96 located on chromosome 7q32.2 is a member of the miR-183 family, which consists of three highly conserved miRNAs (miR-96, miR-182 and miR-183) in vertebrates [26]. [score:1]
Based on recent findings, the members of the miR-183 family, despite their sequences being dissimilar, are involved in a wide variety of normal physiological processes and pathological conditions, such as cell proliferation, apoptosis, immunity, and metabolism [26, 28, 29]. [score:1]
[1 to 20 of 4 sentences]
43
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
GSK3β inhibits the expression of miR-96, miR-182 and miR-183 through the β-Catenin/TCF/LEF-1 pathway [51]. [score:5]
Additionally, ssc-miR-216, ssc-miR-217, ssc-miR-142-5p, ssc-miR-96-5p, ssc-miR-182 and ssc-miR-183 have higher expression levels in mpiPSCs than that in hpiPSCs (Fig 3A). [score:3]
[1 to 20 of 2 sentences]
44
[+] score: 8
Similarly, the miRNAs down-regulated in 10-87 HP cells and 10-87 T cells, such as miR-31, miR-200c, miR-218, and miR-183, were also found to be down-regulated in A4497 VERO cells and SF-VERO cells. [score:7]
qRT-PCR analysis confirmed that miR-376a, miR-654-3p, miR-543, miR-382, miR-31, miR-200c, miR-218, and miR-183 paralleled the microarray miRNA levels. [score:1]
[1 to 20 of 2 sentences]
45
[+] score: 8
PTEN, a classic tumor-suppressor gene, was shown to be targeted by at least 5 miRNAs (miR-141-3p, miR-200c-3p, miR-183-5p, miR-29c-3p and miR-221-5p) [31]– [34]. [score:5]
In contrast among the miRNAs which were altered in one group only, only miR-183-5p and miR-342-3p showed consistent trend of altered expression by comparing qRT-PCR result with sequencing (Figure S1A). [score:3]
[1 to 20 of 2 sentences]
46
[+] score: 8
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-191, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, mmu-mir-429, mmu-mir-449a, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, mmu-mir-449c, mmu-mir-449b, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-124b
Finally, 8 of 24 miRNA probes, including miR-200a and miR-200b, as well as miR-96, miR-141, miR-182, miR-183, miR-191, and miR-429, revealed robust expression in the MOE and VNO neuroepithelium, with weaker expression in the adjacent respiratory epithelium (Figure 2A, right column, and Table S3). [score:5]
By contrast, we identified 12 miRNAs corresponding to 9 families (miR-199, miR-140, miR-152, miR-214, miR-205, miR-200, miR-183, miR-182, miR-96) that displayed highly enriched expression in the olfactory system (Figure 1A). [score:3]
[1 to 20 of 2 sentences]
47
[+] score: 7
This resulted in an increased expression of miR-503, miR-30-c2*, miR-183* and miR-198, with miR-503 being the most upregulated (Fig. 1c). [score:6]
21) and miR-183* (ref. [score:1]
[1 to 20 of 2 sentences]
48
[+] score: 7
MEG3 Suppresses human pancreatic neuroendocrine tumor cells growth and metastasis by down-regulation of Mir-183. [score:5]
MEG3 has been described to be a ceRNA that regulates miR-223 (Zhang Y. et al., 2017), miR-183 (Zhang and Feng, 2017), miR-421 (Zhang W. et al., 2017), and miR-127 (Wang and Kong, 2018). [score:2]
[1 to 20 of 2 sentences]
49
[+] score: 6
Although microarray assay did not identify the change of miR-96 expression level in lpr mice, Real-time RT-PCR analysis clearly showed that miR-96 was markedly upregulated similar to two other members (miR-182 and miR-183) in the cluster (Fig. 2A). [score:5]
A report has shown that miR-96 is clustered with miR-182 and miR-183 in mouse chromosome 6 and is likely generated from the same transcript [17]. [score:1]
[1 to 20 of 2 sentences]
50
[+] score: 6
We found that there were a few miRNAs predicted to target Tet1: miR-106a, miR-106b, miR-17, miR-183, miR-20a, miR-20b, miR-26b, miR-29a, miR-29b, miR-29c, miR-302b, miR-372, miR-7a and miR-93. [score:3]
We found that miR-29 family (miR-29a, miR-29b and miR-29c) and miR-183 significantly inhibited the relative luciferase activity while miR-20b increased the relative luciferase activity (Figure 1A). [score:3]
[1 to 20 of 2 sentences]
51
[+] score: 6
MicroRNAs showing higher level of endogenous expression included miR-31 (252% of control), miR-183 (12.5% of control), miR-675-3p (2.2% of control) and miR-3074-5p (3.7% of control). [score:3]
miRNAs for Pik3cg (miR-707), Hbp1 (miR-127, miR-183, and miR-873), Twistnb (miR-718, and miR-691), and Dgkb (miR-489) had no impact on luciferase expression (Figure 2A and data not shown). [score:3]
[1 to 20 of 2 sentences]
52
[+] score: 6
Other miRNAs from this paper: mmu-mir-182, hsa-mir-182, hsa-mir-183
Other compounds such as histone deacetylase inhibitors and synthetic retinoids, which increase SUMOylation by inhibiting the regulatory miRNAs miR-182 and miR-183, have demonstrated protection of cortical neurons in vitro (11). [score:6]
[1 to 20 of 1 sentences]
53
[+] score: 6
For example, HDAC1 in the sensitization of multidrug-resistant neuroblastoma cell lines to cytotoxic agents, [35] HDAC2 in repressing miR-183 -mediated tumor suppression [36] and HDAC3 in negatively regulating tumor suppressor GRHL1. [score:6]
[1 to 20 of 1 sentences]
54
[+] score: 6
Compared to ALK(−) ALCLs, miR-203, miR-135b, miR-886-5p/3p, miR-20b, miR-106a and miR-183 were significantly upregulated in ALK(+) ALCLs while others (miR-155, miR-181a, miR-210, miR-29a/b, miR-342-5p/3p, miR-369-3p miR-374a/b, miR-423-5p, miR-625, miR-205, miR-146a and miR-26a) were down-regulated (Table 1). [score:6]
[1 to 20 of 1 sentences]
55
[+] score: 6
Few of the highly upregulated microRNAs were: miR-79, miR-183, miR-206, miR-207, miR-296-3p, miR-298, miR-380-5p, miR-433, miR-449b, miR-705, miR-761 (S1 Table). [score:4]
Majority of the dysregulated microRNAs e. g. miR-380, miR-207, miR-79, miR-129, miR-153, miR-183, etc. [score:2]
[1 to 20 of 2 sentences]
56
[+] score: 5
Cao et al. have reported that miR-183 might play a role in the expression of BKCaβ1, and that the expression of miR-183 and BKCaβ1 may be related to the pathogenetic pathways of COPD [10]. [score:5]
[1 to 20 of 1 sentences]
57
[+] score: 5
Other miRNAs from this paper: gga-mir-183
We showed that HDAC2 cooperates with MYCN to suppress apoptosis mediated by miR-183 [36], and that HDAC3 interacts with MYCN to transcriptionally repress the GRHL1 transcription factor, which exerts tumor suppressive effects in neuroblastoma [19]. [score:5]
[1 to 20 of 1 sentences]
58
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-25, hsa-mir-33a, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-141, mmu-mir-155, mmu-mir-10b, mmu-mir-129-1, mmu-mir-181a-2, mmu-mir-184, hsa-mir-192, mmu-mir-200b, hsa-mir-129-1, mmu-mir-122, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-183, hsa-mir-210, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-217, hsa-mir-223, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-129-2, hsa-mir-184, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-96, mmu-mir-34a, mmu-mir-129-2, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-10a, mmu-mir-25, mmu-mir-210, mmu-mir-181a-1, mmu-mir-216a, mmu-mir-223, mmu-mir-33, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, mmu-mir-217, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-375, mmu-mir-375, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-33b, mmu-mir-216b, hsa-mir-216b, mmu-mir-1b, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-129b, mmu-mir-216c, bbe-let-7a-1, bbe-let-7a-2, bbe-mir-10a, bbe-mir-10b, bbe-mir-10c, bbe-mir-125a, bbe-mir-125b, bbe-mir-129a, bbe-mir-129b, bbe-mir-133, bbe-mir-1, bbe-mir-183, bbe-mir-184, bbe-mir-200a, bbe-mir-200b, bbe-mir-210, bbe-mir-216, bbe-mir-217, bbe-mir-22, bbe-mir-252a, bbe-mir-252b, bbe-mir-278, bbe-mir-281, bbe-mir-33-1, bbe-mir-33-2, bbe-mir-34a, bbe-mir-34b, bbe-mir-34c, bbe-mir-34d, bbe-mir-34f, bbe-mir-375, bbe-mir-7, bbe-mir-71, bbe-mir-9, bbe-mir-96, bbe-mir-34g, bbe-mir-34h, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
For instance, miR-183, miR-184 and miR-96 dominate the population of expressed miRNAs in sensory organs in vertebrates [33], and these were also detected in amphioxus. [score:3]
For example, the miR-183/miR-96 cluster in amphioxus was also found in humans and zebrafish (Figure 4a). [score:1]
Based on the available nematode, fruitfly, zebrafish, frog, chicken, mouse, rat and human miRNA information [18], 45 conserved amphioxus miRNAs could be classified into three distinct groups: 23 miRNAs (let-7a, miR-1, miR-7, miR-9, and so on) were conserved throughout the Bilateria; 5 miRNAs (miR-252a, miR-252b, miR-278, miR-281 and miR-71) were homologous to invertebrate miRNAs; and 17 miRNAs (miR-141, miR-200a, miR-200b, miR-183, miR-216, miR-217, miR-25, miR-22, miR-96, and so on) were present both in chordates and vertebrates (Table S9 in). [score:1]
[1 to 20 of 3 sentences]
59
[+] score: 4
Finally, we observed subtle variations in the spatiotemporal expression patterns of polycistronically transcribed miRNAs (e. g. the miR-183/96/182). [score:3]
Another class of miRNAs (e. g. miR-29c, miR-30d, miR-96, miR-99b, miR-124a, miR-182, miR-183, miR-184, miR-381, miR-425) also stained, in the postnatal retina, the Outer Nuclear Layer (ONL) where rod and cone photoreceptors reside (green arrows in the third column of Figure 4A; Database). [score:1]
[1 to 20 of 2 sentences]
60
[+] score: 4
In the same sample an unchanging control regulatory miRNA (miRNA-183) and an abundant unchanging structural control 5S RNA were included as two sncRNA controls in the same sample; 5S RNA was loaded at one twentieth the concentration of the microRNAs. [score:2]
sncRNA abundance analysis including microRNA (miRNA) abundance analysis for miRNA-9, miRNA-125b, miRNA-146a, miRNA-183 and 5S RNA were quantified using microfluidic sncRNA and miRNA arrays as previously described in detail (LC Sciences, Houston TX, USA) [11, 18, 21]. [score:1]
Figure 2A shows the levels of 3 serum and brain-abundant microRNAs (miRNA-9, miRNA-125b and miRNA-146a) and controls (miRNA-183 and 5S RNA); C1 and C2=blood serum from 2 control C57BL/6J mice receiving magnesium sulfate in their diet; A1 and A2=blood serum from 2 C57BL/6J mice receiving aluminum sulfate in their diet. [score:1]
[1 to 20 of 3 sentences]
61
[+] score: 4
In addition, miR-134, which is also expressed in the DRG, is pro-nociceptive in chronic pain mo dels [22] and miR-183 cluster controls neuropathic pain-regulated genes in DRG [23]. [score:4]
[1 to 20 of 1 sentences]
62
[+] score: 4
Interestingly, we observed that all miR-182 family members, miR-182-3p, miR-182-5p, miR-183-5p, and miR-96-5p, were significantly upregulated in P7 Pkd1 [f/f]:HoxB7-cre mice kidney tissues. [score:4]
[1 to 20 of 1 sentences]
63
[+] score: 4
MiR-27b, miR-214, miR-199a-3p, miR-182, miR-183, miR-200a, and miR-322 were found to be downregulated, whereas miR-705 and miR-1224 were increased after 4 weeks of alcohol feeding in mice [26]. [score:4]
[1 to 20 of 1 sentences]
64
[+] score: 4
As observed in Figure 7, 12 miRNAs were up-regulated by UniPR1331 administration resulting in the reduction of a series of gene products including VEGF-A (miR-329, miR-263 and mir-34b), WNT5A (miR-183, miR-487b), Twist1 (miR-183 and miR-329) and ANGPT4. [score:4]
[1 to 20 of 1 sentences]
65
[+] score: 4
For example, PDCD4 is regulated by miR-21 (Li et al., 2014) and miR-183 (Yang et al., 2014), and miR-181b can simultaneously target WIF-1 (Ji et al., 2014) and CYLD (Iliopoulos et al., 2010). [score:4]
[1 to 20 of 1 sentences]
66
[+] score: 4
The most significantly up- and downregulated miRNAs in scrapie-infected mice were mmu-miR-3473e (9.48 log2) and mmu-miR-141-5p (−7.33 log2) in the 139A group, mmu-miR-3473e (13.18 log2) and mmu-miR-200a-5p (−7.08 log2) in the ME7 group, and mmu-miR-3473e (14.15 log2) and mmu-miR-183-3p (−10.15 log2) in the S15 group. [score:4]
[1 to 20 of 1 sentences]
67
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-214, hsa-mir-200b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, hsa-mir-200c, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-200a, hsa-mir-130b, hsa-mir-376a-1, mmu-mir-376a, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, hsa-mir-429, mmu-mir-429, hsa-mir-450a-1, mmu-mir-450a-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-130b, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, hsa-mir-450a-2, dre-let-7j, hsa-mir-376a-2, mmu-mir-450a-2, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The most abundant miRs expressed in the developing mouse OE are: the miR-200-class (- 200a, - 200b, - 200c, - 141 and - 429), miR-199, miR-152, miR-214, miR-205, miR-183, miR-182 and miR-96 (Choi et al., 2008). [score:3]
[1 to 20 of 1 sentences]
68
[+] score: 3
For example miR-263 (consisting of miR-263a and miR-263b) and miR-183 (consisting of miR-96, miR-182 and miR-183) families are found in many organisms including human, mouse, chicken, zebrafish, frog, worm and fruit fly, with high sequence and expression profile similarity particularly in sensory organs [61, 62]. [score:3]
[1 to 20 of 1 sentences]
69
[+] score: 3
We extracted 60 different human miRNAs that co-occur with this target gene from 79 PubMed abstracts, and some of them (e. g. hsa-let-7a, hsa-miR-30b, hsa-miR-183) are consistent with microarray -based results discussed by Shalgi et al. [44]. [score:3]
[1 to 20 of 1 sentences]
70
[+] score: 3
Expression of the mutant microRNA appears unaltered, at least spatially; miR-96, miR-182 and miR-183 are all detected in wildtype and diminuendo mutant hair cells during the first few days after birth (Fig. 3B and C) [23]. [score:3]
[1 to 20 of 1 sentences]
71
[+] score: 3
As a control, the total list of miRNAs profiled was randomized in order and 9 miRNAs were selected (miR-452, miR-7, miR-205, miR-15a, miR-144, miR-183, miR-463, miR-25, miR-99a), targets and pathway ontology was analyzed as for the candidate list. [score:3]
[1 to 20 of 1 sentences]
72
[+] score: 3
MiR-96, a miR-183 family member, is expressed in inner ear neurons at an early stage and later in sensory epithelia [34]. [score:3]
[1 to 20 of 1 sentences]
73
[+] score: 3
Other miRNAs from this paper: hsa-mir-96, mmu-mir-182, hsa-mir-182, hsa-mir-183, mmu-mir-96
It is now established that the miR-183 family of miRNAs is expressed specifically in the innerear hair cells and the eye retina in mammals [64, 65], and other studies have reported that at least 100 different miRNAs are present in the developing mouse inner ear [66]. [score:3]
[1 to 20 of 1 sentences]
74
[+] score: 3
A third method used a transgenic mouse expressing a sponge to bind miR-183 and these mice demonstrated retina defects. [score:3]
[1 to 20 of 1 sentences]
75
[+] score: 3
One specific example is a study by Shimono et al [18] that compared miRNA profiles between breast cancer stem cells and the remaining non-tumorigenic, breast cancer cells and 3 miRNA clusters, miR-200c/141, miR-200b/200a/429 and miR-183/96/182, were consistently downregulated in breast cancer stem cells [18]. [score:3]
[1 to 20 of 1 sentences]
76
[+] score: 3
But only 13 miRNAs had significantly differential expression, they were let-7e, miR-30b, miR-30c, miR-34a, miR-96, miR-129-3p, miR-132, miR-134, miR-135a, miR-143, miR-146a, mkiR-154 and miR-183, respectively (Fig. 1C). [score:3]
[1 to 20 of 1 sentences]
77
[+] score: 3
Other miRNAs from this paper: hsa-mir-96, mmu-mir-182, hsa-mir-182, hsa-mir-183, mmu-mir-96
Quantification of HATH1 expression and identification of additional biomarkers, such as Prestin, miR-96, miR-182, and miR183 would provide greater confidence in the ability of hWJCs to commit to a hair cell phenotype [33, 34]. [score:3]
[1 to 20 of 1 sentences]
78
[+] score: 3
Among the subgroup of miRNAs showing circadian regulation in the retina were members of the miR-183/96/182 cluster. [score:2]
Although potentially coincidental, the mature sequence for miR-183 in vertebrates is very similar to that of both D. melanogaster dme-miR-263a and miR-263b (Figs. 4B and 4C). [score:1]
[1 to 20 of 2 sentences]
79
[+] score: 3
Expression of various miRNAs has been demonstrated in the retina [8- 10], notably a sensory organ-specific polycistronic cluster comprising miR-96, miR-182, and miR-183 [11]. [score:3]
[1 to 20 of 1 sentences]
80
[+] score: 3
We validated these miRNA expression levels using four DF subjects’ ECFCs incubated under NG and HG condition and found that miR-370, miR-183-5p and miR-134 were increased under the HG condition compared to the NG treatment condition (Fig 2C), whereas the other seven miRNAs showed no statistically significant change (S3 Fig). [score:2]
We have also identified that HG increases three miRNAs in ECFCs, namely miR-370, miR-183-5p and miR-134. [score:1]
[1 to 20 of 2 sentences]
81
[+] score: 3
Intrathecal miR-183 delivery suppresses mechanical allodynia in mononeuropathic rats. [score:3]
[1 to 20 of 1 sentences]
82
[+] score: 3
In particular, re -expression of miR-182 and miR-183 in cone conditional Dgcr8−/− mice prevented outer segment loss suggesting their requirement for cone outer segment maintenance [14]. [score:3]
[1 to 20 of 1 sentences]
83
[+] score: 2
Most of the other miRNAs distinguishing the mice according to the yield of microadenomas (miR-30, miR-181b, miR-183, miR-301a, miR-350, miR-466a, and miR-466i) were also able to distinguish the mice according to the yield of adenomas. [score:1]
In aspirin -treated mice exposed to MCS, modulation of 9 miRNAs in both lung and blood serum (miR-30c, miR-181b, miR-183, miR-301a, miR-350, miR-466a/i, miR-500, and miR-709) correlated with protection against pulmonary microadenomas, while no miRNA related to protection against pulmonary adenomas was modulated at the same time in both body compartments. [score:1]
[1 to 20 of 2 sentences]
84
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-2, hsa-let-7c, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-2, hsa-mir-100, hsa-mir-29b-2, mmu-let-7i, mmu-mir-99b, mmu-mir-125a, mmu-mir-130a, mmu-mir-142a, mmu-mir-144, mmu-mir-155, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-148a, mmu-mir-143, hsa-mir-181c, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-298, mmu-mir-34b, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-130a, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-125a, mmu-mir-148a, mmu-mir-196a-1, mmu-let-7a-2, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-mir-15a, mmu-mir-16-1, mmu-mir-21a, mmu-mir-22, mmu-mir-23a, mmu-mir-24-2, rno-mir-148b, mmu-mir-148b, hsa-mir-200c, hsa-mir-155, mmu-mir-100, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181c, hsa-mir-34b, hsa-mir-99b, hsa-mir-374a, hsa-mir-148b, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7i, rno-mir-21, rno-mir-22, rno-mir-23a, rno-mir-24-2, rno-mir-29b-2, rno-mir-34b, rno-mir-99b, rno-mir-100, rno-mir-124-1, rno-mir-124-2, rno-mir-125a, rno-mir-130a, rno-mir-142, rno-mir-143, rno-mir-144, rno-mir-181c, rno-mir-183, rno-mir-199a, rno-mir-200c, rno-mir-200b, rno-mir-181a-1, rno-mir-298, hsa-mir-193b, hsa-mir-497, hsa-mir-568, hsa-mir-572, hsa-mir-596, hsa-mir-612, rno-mir-664-1, rno-mir-664-2, rno-mir-497, mmu-mir-374b, mmu-mir-497a, mmu-mir-193b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-568, hsa-mir-298, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, hsa-mir-664a, mmu-mir-664, rno-mir-568, hsa-mir-664b, mmu-mir-21b, mmu-mir-21c, rno-mir-155, mmu-mir-142b, mmu-mir-497b, rno-mir-148a, rno-mir-15a, rno-mir-193b
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
[1 to 20 of 2 sentences]
85
[+] score: 2
MicroRNA-183 family members regulate sensorineural fates in the inner ear. [score:1]
MicroRNA-183 family in inner ear: hair cell development and deafness. [score:1]
[1 to 20 of 2 sentences]
86
[+] score: 2
In this study, we observed that Hmgcs2 (3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2) which encodes an enzyme exhibiting hydroxymethylglutaryl-CoA synthase activity, is potentially regulated by mmu-miR-183, mmu-miR-184, mmu-miR-150*, and mmu-miR-99b. [score:2]
[1 to 20 of 1 sentences]
87
[+] score: 2
Other miRNAs from this paper: mmu-mir-182, mmu-mir-21a, mmu-mir-21b, mmu-mir-21c
Previous studies have shown that microRNAs including miR-182 [39], miR-183 [40] and miR-21 [41] participate in the regulation of PDCD4. [score:2]
[1 to 20 of 1 sentences]
88
[+] score: 2
At 23 wks of age, the expression levels of miR-182, miR-183, miR-127, and miR-31 were significantly increased in female NZB/W [F1] mice when compared to age-matched male NZB/W [F1] mice (Figure  2A). [score:2]
[1 to 20 of 1 sentences]
89
[+] score: 2
Li X Altered spinal MicroRNA-146a and the microRNA-183 cluster contribute to osteoarthritic pain in knee jointsJ. [score:1]
Treatment with exogenous miR-146a and miR-183 mimics alleviates joint pain in rats with medial meniscus transection -mediated knees [15]. [score:1]
[1 to 20 of 2 sentences]
90
[+] score: 1
The observed fold-change difference in miR-183 and let7i content between testis and sperm may be due to the heterogeneous cell composition of testis. [score:1]
[1 to 20 of 1 sentences]
91
[+] score: 1
For example, miR-96, miR-183, miR-1, and miR-133 have been implicated in retinitis pigmentosa [49], while miR-31, miR-150, and miR-184 have been associated with choroidal neovascularization [50] and diabetic retinopathy [51]. [score:1]
[1 to 20 of 1 sentences]
92
[+] score: 1
Aldrich used the spinal nerve ligation mo del of chronic neuropathic pain to investigate the expression of miR-183 family members (miR-96, -182, and -183) in the rat DRG [19]. [score:1]
[1 to 20 of 1 sentences]
93
[+] score: 1
The secretory products are dominated by miRNAs with identical seed sites to mouse miRNAs, many of which are ancient: six are shared among Eumetazoa (lin-4/miR-125 and five miR-100 family members, Fig. 2a, red) and five among Bilatera (miR-79/miR-9, miR-83/miR-29, miR-263/miR-183 and two let-7 family members, Fig. 2a, blue). [score:1]
[1 to 20 of 1 sentences]
94
[+] score: 1
To validate the sequencing results, some miRNAs including let-7i-5p, miR-98-5p, miR-182-5p and miR-183-5p were chosen for validation by using the quantitative RT-PCR. [score:1]
[1 to 20 of 1 sentences]
95
[+] score: 1
When the existence of genomic miRNA clusters were analysed for the miRNAs studied here, two miRNAs were found to be located in clusters, namely miR-199a /miR-214 and miR-96 /miR-182/miR-183. [score:1]
[1 to 20 of 1 sentences]
96
[+] score: 1
Accumulating evidence has shown a strong connection between miRNA (e. g., miRNA-103 [38], let-7b [39], miRNA-7a [40], miRNA-203 [41], miRNA-219 [24], miRNA-365-3p [27], and miRNA-183 cluster [42]) modulation and pain pathways from primary afferent nociceptors, the DRG, the spinal cord, and brain areas in different pain mo dels. [score:1]
[1 to 20 of 1 sentences]
97
[+] score: 1
Additionally, miR-183 functions as an oncogene and promotes tumor cell migration [7]. [score:1]
[1 to 20 of 1 sentences]
98
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, hsa-mir-676, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
25E-0316mmu-miR-15a-5pmir-150.209.185.63E-052.24E-0320mmu-miR-195-5pmir-150.248.631.26E-044.01E-0353mmu-miR-15b-5pmir-150.156.854.15E-034.99E-0244mmu-miR-93-5pmir-170.166.981.73E-032.45E-0221mmu-miR-181d-5pmir-1810.248.471.51E-044.59E-0357mmu-miR-181a-5pmir-1810.209.815.96E-036.44E-0269mmu-miR-182-5pmir-1820.628.718.90E-038.21E-0262mmu-miR-183-5pmir-1830.668.386.90E-036. [score:1]
[1 to 20 of 1 sentences]
99
[+] score: 1
Indeed, miR-182, miR-183 and miR-31 are strongly induced upon MCMV in vivo infection, and interestingly two of these, miR-182 and 183 are also induced upon human CMV infection of fibroblasts [30]. [score:1]
[1 to 20 of 1 sentences]
100
[+] score: 1
We selected the top 9 miRNAs (miR-200a, miR-200b, miR-182, miR-429, miR-183, miR-200c, miR-141, miR-96 and miR-24) showing the highest standard deviations. [score:1]
[1 to 20 of 1 sentences]