sort by

34 publications mentioning mmu-mir-186

Open access articles that are associated with the species Mus musculus and mention the gene name mir-186. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 415
Over -expression of CRNDE inhibited miR-186 expression, down regulation of CRNDE or over -expression of miR-186 inhibited the expression of XIAP and PAK7. [score:14]
The mechanism underlying the suppression of GSCs by down -regulating of CRNDE is schematically presented in Figure 8. Figure 8 In summary, this is the first study that discovered and proved that CRNDE was up-regulated while miR-186 was down-regulated in GSCs. [score:10]
To verify whether CRNDE was involved in the regulation of XIAP and PAK7 expression as well as the biological behavior of GSCs through the miR-186 pathway, GSCs were transfected with over-express or down-regulate CRNDE and miR-186. [score:9]
Results showed that the overexpression of CRNDE increased the mRNA and protein expression levels of XIAP and PAK7, whereas the overexpression of miR-186 reduced their expression levels. [score:9]
Knockdown of CRNDE combined with overexpression of miR-186 significantly inhibited tumor growth in vivoTo determine the functions of CRNDE and miR-186 in vivo, we analyzed the effects of CRNDE knockdown, miR-186 overexpression and their combination on the glioma growth in tumor-bearing nude mice. [score:9]
The combination of CRNDE overexpression and miR-186 knockdown produced higher XIAP and PAK7 expression levels than those in either CRNDE or miR-186 overexpression group alone. [score:8]
Compared with the pGPU6-NC group, the expression of XIAP and PAK7 protein was down-regulated in the miR-186 group but was upregulated in the sh-miR-186 group. [score:8]
This evidence indicated that miR-186 played a role in regulating the expression levels of caspase 3, BAD, cyclin D1 and MARK2 through negative regulation of XIAP and PAK7 expression, which might be the mechanism in the regulation of the biological behavior of GSCs. [score:8]
Effect of CRNDE and miR-186 on proliferation, migration, invasion and apoptosis on GSCs and over -expression CRNDE elevated levels of the expression of XIAP and PAK7 by downregulating miR-186. [score:8]
Quantitative RT-PCR results demonstrated that miR-186 expression was down-regulated in the pEX2-CRNDE group compared with the pEX2-NC group, whereas it was up-regulated in the sh-CRNDE group compared to the sh-CRNDE NC group (Figure 4A). [score:7]
The mice were divided into five groups randomly: control group (only GSCs), miR-186-NC group (miR-186-NC stable GSCs), miR-186 group (empty vector of miR-186 group), sh-CRNDE-NC group (empty vector of sh-CRNDE group), sh-CRNDE group (CRNDE inhibition stable GSCs), sh-CRNDE+miR-186 group (CRNDE inhibition and miR-186 overexpression stable GSCs). [score:7]
To determine whether miR-186 could target XIAP and PAK7 on their 3′UTR region, and affect GSCs' behavior by regulating the expression of caspase3, cyclin D1, BAD and MARK2, cells were divided into four groups:miR-186-NC+XIAP-NC group (transfected with both pGPU6 and empty plasmid of XIAP), miR-186+XIAP-NC group (transfected with both miR-186-5p and empty plasmid of XIAP), miR-186+XIAP group (transfected with both miR-186-5p and XIAP full length plasmid (with 3′UTR)), miR-186+XIAP (non-3′UTR) group (transfected with both miR-186-5p and XIAP without 3′UTR plasmid); miR-186-NC+PAK7-NC group (transfected with both pGPU6 and empty plasmid of PAK7), miR-186+PAK7-NC group (transfected with both miR-186-5p and empty plasmid of PAK7), miR-186+ PAK7 group (transfected with both miR-186-5p and PAK7 full length plasmid (with 3′UTR)), miR-186+PAK7 (non-3′UTR) group (transfected with both miR-186-5p and PAK7 without 3′UTR plasmid). [score:6]
Overexpression of CRNDE or knockdown of miR-186 regulated the biological behavior of GSCs by regulating XIAP and PAK7. [score:6]
Knockdown of CRNDE combined with overexpression of miR-186 significantly inhibited tumor growth in vivo. [score:6]
XIAP and PAK7 protein expression levels in the pEX2-CRNDE+sh-miR-186 group were significantly increased compared with the pEX2-CRNDE+miR-186 group, while they were significantly decreased in the sh-CRNDE+miR-186 group compared with the sh-CRNDE+sh-miR-186 group (Figure 5D), indicating that CRNDE inhibited miR-186 expression and accordingly regulated the biological behavior of GSCs. [score:6]
Moreover, MiR-186 could also regulate the expression of caspase3, BAD, cyclin D1 and MARK2 by binding to the target genes and negatively regulating XIAP and PAK7. [score:6]
Previous studies have shown that miR-186 acted as a tumor suppressor and was down-regulated in many tumors such as lung adenocarcinoma, esophageal and colorectal cancers. [score:6]
CRNDE full length (pEX2-CRNDE) plasmid, four hairpin CRNDE (sh-CRNDE, CRNDE-homo-420, CRNDE-homo-452, CRNDE-homo-572, CRNDE-homo-787) plasmids and their respective non -targeting sequence (negative control, NC); miR-186-5p plasmid, sh-miR-186-5p plasmid and their respective non -targeting sequence (negative control, NC) were synthesized (GenePharma, Shanghai, China). [score:5]
To determine whether CRNDE -mediated regulation of miR-186 expression could regulate the behavior of GSCs, cells were divided into seven groups: control group, pEX2-NC+pGPU6-NC group (transfected with both pEX2-NC and pGPU6-NC), pEX2-CRNDE+miR-186 group (transfected with both pEX2-CRNDE and miR-186-5p), pEX2-CRNDE+sh-miR-186 group (transfected with both pEX2-CRNDE and sh-miR-186-5p), sh-NC+pGPU6-NC group (transfected with both sh-NC and pGPU6-NC), sh-CRNDE+sh-miR-186 group (transfected with both sh-CRNDE and sh-miR-186-5p), sh-CRNDE+miR-186 group (transfected with both sh-CRNDE and miR-186-5p). [score:5]
This evidence indicated that miR-186 could be regarded as a tumor suppressor gene that inhibited the biological behavior of GSCs, which was consistent with the results observed in non-small cell lung cancer. [score:5]
Furthermore, the pEX2-CRNDE+sh-miR-186 group had a significant lower apoptotic rate than pEX2-CRNDE+miR-186 group, suggesting that CRNDE inhibited miR-186 expression and further prevented the apoptosis of GSCs. [score:5]
MiR-186-3′UTR, XIAP 3′-UTR and PAK7 3′-UTR sequences were amplified by PCR and cloned into a pmirGlo Dualluciferase miRNA Target Expression Vector (Promega, Madison, WI, USA) to construct 3′-UTR-luciferase reporter vector (miR-186-WT, XIAP-WT, PAK7-WT) (GenePharma). [score:5]
D. Representative images of experiments of (red) of GSCs with the expression of with the expression of CRNDE and miR-186 changed. [score:5]
Similarly, the protein expression levels of MARK2 and BAD in the miR-186+PAK7 group were decreased, while cyclin D1 was significantly up-regulated compared with the miR-186+PAK7 group (Figure 6C). [score:5]
CRNDE expression in GSCs and miR-186 expression in glioma tissues and GSCs. [score:5]
was performed to detect the protein expression levels of XIAP and PAK7 in the GSCs at different expression levels of CRNDE and miR-186. [score:5]
The present study showed that CRNDE was highly expressed in the GSCs, while miR-186 was lowly expressed in glioma tissue and GSCs. [score:5]
CRNDE was highly expressed in GSCs while miR-186 was lowly expressed in glioma tissue and GSCs. [score:5]
The XIAP and PAK7 protein expression levels were determined by at different expression levels of CRNDE or miR-186 in GSCs (Figure 4B). [score:5]
In summary, CRNDE could bind to miR-186 and negatively regulate its expression, which contributes to the regulation of GSC biological properties. [score:5]
Experimental findings indicated that CRNDE and miR-186 can exert biological effects by regulating XIAP and PAK7 expression. [score:4]
CRNDE could promote GSCs proliferation, migration, invasion and inhibit GSCs apoptosis by negatively regulating miR-186. [score:4]
Knockdown of miR-186 promoted the proliferation, migration and invasion of GSCs and inhibited the apoptosis. [score:4]
was performed to determine whether miR-186 could regulate the expression of XIAP, PAK7, caspase3, BAD, cyclin D1 and MARK2. [score:4]
CRNDE attenuated miR-186 -induced inhibition of XIAP and PAK7 and affected the biological behavior of GSCs through negative regulation of miR-186. [score:4]
The present study showed that miR-186 was lowly expressed in glioma tissue compared to normal brain tissue, and the expression was also lower in the GSCs than that in the non-stem cells. [score:4]
D. qRT-PCR and western blot analysis for miR-186 regulated XIAP and PAK7 expression in GSC-U87 and GSC-U251. [score:4]
A. qRT-PCR analysis for CRNDE regulated miR-186 expression in GSCs. [score:4]
miR-186 regulated caspase3, cyclin D1, BAD and MARK2 by targeting XIAP and PAK7′s 3′-UTR. [score:4]
Results of the present study showed that, the pro-caspase 3 protein expression was significantly increased while cleaved caspase3 protein expression was significantly decreased in the miR-186+XIAP (non-3′UTR) transfected GSCs compared to the miR-186+XIAP transfected GSCs. [score:4]
miR-186 bound to the 3′UTR of XIAP and PAK7 and regulated the expression of caspase 3, BAD, cyclin D1 and MARK2. [score:4]
To verify whether the two factors were involved in the CRNDE or miR-186 -induced regulation of GSC biological behavior, we transfected GSCs to alter the expression of CRNDE and miR-186. [score:4]
Flow cytometry analysis results showed that the apoptosis rates were 14% ± 1.31%, 20% ± 1.65% and 8% ± 1.19% in pGPU6-NC, miR-186 over -expression and miR-186 knockdown groups respectively (Figure 3C). [score:4]
Figure 4 A. qRT-PCR analysis for CRNDE regulated miR-186 expression in GSCs. [score:4]
We further investigated whether miR-186 affected the GSC properties by regulating PAK7 and found that the miR-186+PAK7(non-3′UTR) -transfected GSCs had significantly higher expression levels of BAD and MARK2 proteins and lower expression level of cyclin D1 protein than the miR-186+PAK7 -transfected GSCs. [score:4]
Furthermore, we found that miR-186 might negatively regulate XIAP and PAK7, thus affecting the expression levels of caspase3, BAD, cyclin D1 and MARK2. [score:4]
To determine the functions of CRNDE and miR-186 in vivo, we analyzed the effects of CRNDE knockdown, miR-186 overexpression and their combination on the glioma growth in tumor-bearing nude mice. [score:4]
The protein expression levels of pro-caspase3 in the miR-186+XIAP (non-3′UTR) group were significantly increased, while the expression of cleaved caspase 3 was significantly decreased compared with the miR-186+XIAP group (Figure 6B). [score:4]
Results of in vivo studies showed that the overexpression of CRNDE combined with knockdown of miR-186 reduced the tumor volumes and weights of tumor-bearing nude mice. [score:4]
Moreover, we found that CRNDE bound to miR-186 and negatively regulated its expression. [score:4]
The stably transfected stem cell lines with overexpression or knockdown of miR-186 were established. [score:4]
MiR-186 could bind to XIAP and PAK7 3′UTR and accordingly played a negative role on regulating the expression of caspase3, BAD, cyclin D1 and MARK2. [score:3]
In human colon cancer HCT116 cells, miR-186 also acted as a tumor suppressor to promote the cellular senescence through p53–p21 Cip1/WAF1 pathway [9– 11]. [score:3]
However, the expression and function of miR-186 in gliomas still remain unclear. [score:3]
The expression levels of CRNDE and miR-186 in GSCs, non-stem cells (non-GSCs) and glioma tissues of different grades were detected with qRT-PCR. [score:3]
In non-small cell lung carcinoma, miR-186 could inhibit the proliferation by inducing G(1)-S checkpoint arrest. [score:3]
These results implied that CRNDE served as an oncogene while miR-186 acted as a tumor suppressor gene and both of them would be involved in the biological processes of GSCs. [score:3]
Results of dual-luciferase gene reporter assay showed that the luciferase activity in the pEX-2-CRNDE+miR-186-3′UTR-Wt group was lower than that in the pEX-2-CRNDE-NC+miR-186-NC group (Figure 4B), indicating that CRNDE binded to miR-186 and negatively regulated its expression. [score:3]
As previously described, miR-186 was lowly expressed in glioma tissue and GSCs. [score:3]
In contrary to CRNDE, miR-186 might serve as a tumor suppressor and affect the proliferation, migration, invasion and apoptosis of the GSCs. [score:3]
As previously described, CRNED bound to and negatively regulated miR-186 and both factors affected the biological characteristics of GSCs through regulating the expression of XIAP and PAK7. [score:3]
However, the expression and functions of miR-186 in glioma are poorly understood. [score:3]
As shown in figure 4A, the expression level of endogenous miR-186 was negatively correlated with the CRNDE. [score:3]
C. Flow cytometry analysis of GSCs with the expression of miR-186 changed. [score:3]
After infection, the stable expressing cells of miR-186 and sh-CRNDE were picked. [score:3]
Therefore, we suggested that CRNDE/miR-186 played an important role in GSCs and the present study provided evidence for novel targets in glioma treatment. [score:3]
According to the bioinformatics database (Targetscan, Pictar, miRanda), miR-186 might bind to XIAP and PAK7 3′UTR region. [score:3]
MiR-186 expression in glioma tissues was significantly decreased compared with the normal brain tissue (NBTs) and the expression was negatively correlated with the increasing pathological grades of glioma (Figure 1B). [score:3]
C. Flow cytometry analysis of GSC-U87 and GSC-U251 with the expression of CRNDE and miR-186 changed. [score:3]
We then investigated whether CRNDE -induced negative regulation of miR-186 would influence the biological characteristics of GSCs and found that the overexpression of CRNDE and knockdown of miR-186 promoted the proliferation, migration and invasion while inhibited the apoptosis in GCSs. [score:3]
MiR-186 3′UTR region was identified as the binding site between PAK7 and XIAP by the biological softwares (Targetscan, Pictar, miRanda). [score:3]
In addition, miR-186 was found to inhibit the proliferation, migration, invasion and promoted apoptosis in GSCs. [score:3]
B. Expression levels of miR-186 in glioma tissues of different grades and normal brain tissues (NBTs). [score:3]
The miR-186-5p and short-hairpin RNA targeting human CRNDE were ligated into the pLenti6.3/V5eDEST vector and LV3-CMV-GFP-Puro vector (GenePharma, Shanghai, China), respectively. [score:3]
B. Quantification of migration and invasion cells with the expression of CRNDE and miR-186 changed. [score:3]
C. Relative expression of miR-186 in non-GSCs and GSCs. [score:3]
B. Quantification of migration and invasion cells with the expression of miR-186 changed. [score:3]
D. Representative images of experiments of (green) of GSCs with the expression of miR-186 changed. [score:3]
The miR-186 group had a lower expression level of XIAP and PAK7 mRNA than pGPU6-NC group, while the sh-miR-186 group showed the contrary results. [score:3]
This result implied that CRNDE regulated GSC proliferation through miR-186 pathway. [score:2]
B. of the pro-caspase3 and cleaved caspase3 regulated by miR-186 and XIAP in GSC-U87 and GSC-U251. [score:2]
The above results have shown that CRNDE or miR-186 might be involved in the regulation of the biological behavior of GSCs. [score:2]
E. for CRNDE and miR-186 regulated IDVs of XIAP and PAK7, they are shown using GAPDH as endogenous control. [score:2]
In this study, we aimed at investigating the expression levels of CRNDE and miR-186 in glioma stem cells and the effects of CRNDE on miR-186 -induced regulation of XIAP and PAK7 as well as the underlying mechanism in the process. [score:2]
CRNDE bound to and negativelyregulated miR-186. [score:2]
To further explore the mechanisms, qRT-PCR and Western blot assays were performed to detect the effects of CRNDE or miR-186 on the mRNA and protein expression levels of XIAP and PAK7. [score:2]
C. of the cyclin D1, BAD and MARK2 regulated by miR-186 and PAK7 in GSC-U87 and GSC-U251. [score:2]
MiR-186 expression in GSCs was lower than that in non-GSCs (Figure 1C). [score:2]
The schematic cartoon of the mechanism of CRNDE as a oncogene negative regulation of miR-186 of GSCs. [score:2]
sh-CRNDE+sh-miR-186 group; [▲] P < 0.05 vs. [score:1]
A. The predicted miR-186 binding sites in the 3′-UTR region of XIAP (XIAP-3′-UTR-Wt) or PAK7 (PAK7-3′-UTR-Wt) and the designed mutant sequence (XIAP-3′UTR-Mut or PAK7-3′UTR-Mut) were indicated. [score:1]
From 2 [th] to 4 [th] week, sh-CRNDE group and miR-186 group developed significantly smaller tumors than pEX2-NC group and pGPU6-NC group. [score:1]
pEX2-CRNDE+miR-186 group; [#] P < 0.05 vs. [score:1]
The lentiviruses of miR-186 were transduced in sh-CRNDE stably transfected cells to generate miR-186+sh-CRNDE cells. [score:1]
The cells were divided in five groups: control group, miR-186 WT+pEX2-CRNDE NC (transfected with miR-186-WT and pEX2-CRNDE-NC), miR-186 WT+ pEX2-CRNDE group (transfected with miR-186-WT and pEX2-CRNDE), miR-186 Mut+ pEX2-CRNDE NC group (transfected with miR-186-Mut and pEX2-CRNDE-NC), miR-186 Mut+ pEX2-CRNDE group (transfected with miR-186-Mut and pEX2-CRNDE); control group, XIAP WT+miR-186 NC (transfected with XIAP-WT and pGPU6-NC), XIAP WT+miR-186 group (transfected with XIAP-WT and miR-186-5p), XIAP Mut+miR-186 NC group (transfected with XIAP-Mut and pGPU6-NC), XIAP Mut+miR-186 group (transfected with XIAP-Mut and miR-186-5p); control group, PAK7 WT+miR-186 NC (transfected with PAK7-WT and pGPU6-NC), PAK7 WT+miR-186 group (transfected with PAK7-WT and miR-186-5p), PAK7 Mut+miR-186 NC group(transfected with PAK7-Mut and pGPU6-NC), PAK7 Mut+miR-186 group(transfected with PAK7-Mut and miR-186-5p) The stably transfected GSCs were used in the in vivo study. [score:1]
miR-186+PAK7-NC group. [score:1]
To determine the effect of miR-186-5p on GSCs, cells were divided into four groups: control group, pGPU6-NC (also shown as miR-186 NC) (transfected with empty plasmid), miR-186 group (transfected with miR-186-5p plasmid), sh-miR-186 group (transfected with sh-miR-186-5p plasmid). [score:1]
The aforementioned experiments demonstrated the controversial functions of CRNDE and miR-186 in GSCs. [score:1]
And then pLenti6.3/V5eDEST-miR-186 and LV3-CMV-GFPPuro-sh-CRNDE vectors were generated. [score:1]
HEK-293T cells were seeded in 96-well plates and the cells were co -transfected with miR-186-WT(or miR-186-Mut) or XIAP-WT (or XIAP-Mut) or PAK7-WT (or PAK7-Mut) and pEX2-CRNDE or miR-186 plasmids when they reached 50–70% confluence. [score:1]
The sequence of sh-miR-186-5p was: 5′-CACCGCGCCCAA AAGGAGAATTCTTTGTT CAAGAGACAAAGAATTCCTTTTGGGCTTTTTTT G-3′, 5′-GATCCAAAAAAAGC CCAAAAGGAATTCT TTGTCTCTTGAACAAAGAATTCTCCTTTTGGGCT C-3′. [score:1]
The sequence of miR-186-5p was 5′-CACCGCAAAGAATTCTCC TTTTG GGCTTTCAAGAGAAGCCCAAAGAGAATTC TTTG TTTTTG-3′, 5′-GATCCAAAAAACAAAGAATT CTCTTTGGGCTTC TCTTGAAAGCCCAAAAGGAGA ATTCTTTGC-3′. [score:1]
Results of dual-luciferase reporter assay showed that CRNDE was capable of binding to miR-186, suggesting that CRNDE might affect the biology of GSCs by regulating miR-186. [score:1]
The apoptotic rate was significantly increased in the sh-CRNDE+sh-miR-186 and sh-CRNDE+miR-186 groups (Figure 5C). [score:1]
The volumes and weights of transplanted tumors were reduced in the sh-CRNDE group or miR-186 group compared with control group, and in co -transfected sh-CRNDE+miR-186 group, the inhibition of transplanted tumors were enhanced compared with either sh-CRNDE or miR-186 group alone (Figure 7A, 7B). [score:1]
However the numbers of migrating and invading GSCs in the sh-CRNDE+miR-186 group were significantly lower than those in the sh-CRNDE+sh-miR-186 group. [score:1]
Figure 6 A. The predicted miR-186 binding sites in the 3′-UTR region of XIAP (XIAP-3′-UTR-Wt) or PAK7 (PAK7-3′-UTR-Wt) and the designed mutant sequence (XIAP-3′UTR-Mut or PAK7-3′UTR-Mut) were indicated. [score:1]
miR-186 group; [Ψ] P < 0.05 vs. [score:1]
miR-186+XIAP group; [#] P < 0.05 vs. [score:1]
Our hypothesis was confirmed by the dual-luciferase reporter assay, suggesting that miR-186 possibly affected the biological behavior of GSCs through the negative regulation of XIAP and PAK7. [score:1]
According to the bioinformatics databases (RNAhybrid), we predicted that CRNDE might be associated with the miR-186 binding sites. [score:1]
Effect of miR-186 on proliferation, apoptosis, migration and invasion of GSCs. [score:1]
miR-186+PAK7 group; [#] P < 0.05 vs. [score:1]
The sequence of putative binding site was replaced as indicated (miR-186-Mut, XIAP-Mut, PAK7-Mut) to mutate the putative binding site of CRNDE or miR-186 in the 3′-UTR-containing vector. [score:1]
Lentivirus encoding miR-186-5p was generated using pLenti6.3/V5eDEST Gateway Vector Kit (Life Technologies Corporation, Carlsbad, CA, USA). [score:1]
miR-186+XIAP-NC group. [score:1]
XIAP-WT & miR-186 NC group and PAK7-WT & miR-186 NC group. [score:1]
The sequence of the negative control of miR-186-5p and sh-miR-186-5p (pGPU6-NC) was: 5′-CACCGTTCTCCGAACGTGTGT CACGTCACGT CAAGAGATTACGTGACACGTTCGGAGAATTTTTG -3′, 5′-GATCCAAAAAATTCTCCGAA CGTGTCACG TGTCACGTAATCTCTTGACGTGACACGTTCGGAG AA C-3′. [score:1]
[1 to 20 of 118 sentences]
2
[+] score: 119
In our study, we found that mimics to miR-186 or miR-24 significantly downregulated Gabra4 expression in AW8 neurons, which may suggest that alcohol downregulates Gabra4 expression via these two miRNAs. [score:11]
Transfection of mimics of miR-186, miR-24, and/or miR-375 downregulates Gabra4 expressionWe assessed the effects of mimics or inhibitors of miR-155, miR-186, miR-24, or miR-375 on changes in Gabra4 expression in control and AW8 neurons. [score:10]
Transfection with molecular mimics of miR-186, miR-24, or miR-375 also downregulated Gabra4 expression, whereas transfection with the corresponding inhibitors of these microRNAs normalized Gabra4 expression in AW neurons to the level measured in control neurons. [score:8]
This may suggest that the upregulation in expression of miR-186, miR-24 and/or miR-375 during AW modulates Gabra4 expression at the posttranscriptional level. [score:8]
Figure 5Time course of upregulation of miR-155, miR-186, miR-24, and miR-375 gene expression during AW in cultured mouse cortical neurons. [score:6]
This study provides evidence for a novel role for miR-186, miR-24 and/or miR-375 in mediating the effects of AW on downregulation of Gabra4 expression in cultured mouse cortical neurons. [score:6]
Figure 6Transfection of mimics to miR-186, miR-24, or miR-375 into cortical neurons downregulates Gabra4 expression during AW. [score:6]
Transfection of mimics of miR-186, miR-24, and/or miR-375 downregulates Gabra4 expression. [score:6]
We determined changes in miR-155, miR-186, miR-24, and miR-375 expression at various time intervals after onset of AW, and found that these miRNAs were significantly upregulated at AW5 min, AW6, AW8, AW12, and/or AW24 h (Fig. 5A– D). [score:6]
microRNA profiling in neurons undergoing AW revealed upregulation in the expression of miR-155, miR-186, miR-24, and miR-375 after 8 h of AW. [score:6]
We assessed the effects of mimics or inhibitors of miR-155, miR-186, miR-24, or miR-375 on changes in Gabra4 expression in control and AW8 neurons. [score:5]
We found that miR-186 mimic (M) significantly downregulated Gabra4 expression in AW8 + M neurons compared to control neurons (control + Scr) or AW neurons that were transfected with a scrambled oligo (AW8 + Scr). [score:5]
Conversely, a miR-186 inhibitor normalized Gabra4 expression to a level comparable to that seen in control neurons (Fig. 6A). [score:5]
The sequence of upregulated miRNAs (miR-155, miR-186, miR-24, and miR-375) from TLDA card was verified as the 5p or 3p strand using www. [score:4]
Several bioinformatic databases and prediction algorithms showed that the selected miRNAs (miR-155, miR-186, miR-24, miR-27b, and miR-375) have a large number of potential target genes including Gabra4. [score:3]
Promoter-reporter experiments supported the idea that miR-155, miR-186, miR-24, miR-27b, or miR-375 bind to the 3′UTR of Gabra4 and thereby inhibit protein production. [score:3]
2. These alcohol -induced epigenetic changes may have altered miRNAs expression such as miR-186/miR-24. [score:3]
To address this, we focused on the effects of miR-155, miR-186, miR-24 and/or miR-375 on changes in Gabra4 expression during AW. [score:3]
Cortical neurons were seeded at 10 [6] cells/mL in a 12-well plate then transfected at DIV8 for 2–3 h with mimic or inhibitor of miR-155, miR-186, miR-24, or miR-375 following the manufacturer’s instructions. [score:3]
We confirmed changes in expression of selected miRNAs (miR-155, miR-186, miR-24, miR-375) by qPCR. [score:3]
Control neurons (C) or AW8 neurons were transfected with scrambled oligos (30 nmol/L), mimic (30 nmol/L) or inhibitor (100 nM) of (A) miR-186, (B) miR-24, (C) miR-375, (D) miR-155. [score:3]
miR-24 has a poorly conserved seed match among vertebrates at position 628 (8mer), a position that is very close to the presumed binding site of miR-186 along Gabra4 3′UTR. [score:1]
miR-155, miR-186, miR-24, miR-27b, and miR-375 have predicted binding sites along the 3′UTR of Gabra4 (1965 bp, NM_010251) (www. [score:1]
miR-155 has a potential binding site that is close to that of miR-186 and more distally located from the other miRNAs. [score:1]
Figure 7Transfection of miR-155, miR-186, miR-24, miR-27b, or miR-375 mimics decreases luciferase activity and Gabra4 protein levels in cultured mouse cortical neurons. [score:1]
For example, miR-186 has a conserved seed match among mammals at position 73–79 (8mer) of the 3′UTR of Gabra4 and 3 poorly conserved seed matches at positions 180–186 (7mer-1A), 668–674 (7mer-m8), and 865–871(7mer-1A) of Gabra4 3′UTR. [score:1]
Cortical neurons were cotransfected with pMIR-Gal + pMIR-Luc (Gal/Luc), pMIR-Gal + pMIR-Luc-3′UTR in the absence (Gal/Luc-3′UTR) or presence of scrambled oligo (Gal/Luc-3′UTR + Scr) or mimic of miR-155 (m155), miR-186 (m186), miR-24 (m24), miR-27b (m27b), or miR-375 (m375). [score:1]
[1 to 20 of 27 sentences]
3
[+] score: 34
Figure 3 presents these findings, demonstrating directly associated changes in the intestinal levels of the miR-186 and its two cholinergic regulating targets. [score:5]
To experimentally test for in vivo association of stress -induced changes in the identified miRNAs and their putative target genes, we selected the evolutionarily conserved miR-186 which predictably targets the two soluble cholinesterases, BChE and AChE-R. Of those, AChE-R increases under psychological stress were well documented (Kaufer et al., 1998; Cohen et al., 2002; Meshorer et al., 2005; Shaltiel et al., 2013), including the serum (Sklan et al., 2004), but BChE's involvement was never approached. [score:5]
Top: The nucleotide sequence of the BChE and AChE-R -targeting miR-186 and schemes of its AChE-R and BChE mRNA targets. [score:5]
We found that predator scent stress induces intestinal increases in both the cholinesterases -targeting miR-186 and in the activities of the targeted cholinesterases. [score:5]
In the intestinal biopsies, miR-186 expression normalized to the house-keeping short RNA RNU6 showed a 1.6-fold increase (p < 0.016) in pre-stressed mice. [score:3]
That both miR-186 and its BChE target show intestinal increases under stress may indicate that these miRNA changes reflect a feedback response limiting excessive ACh stimulation; supporting this notion, serum BChE increases in post-stroke patients were associated with better prospects of recovery (Shenhar-Tsarfaty et al., 2013a). [score:3]
To test the relevance of our predictions for in vivo conditions, we subjected mice to the long-lasting predator scent stress (Zimmerman et al., 2012) and tested, 1 week later, for changes in one miRNA, miR-186 and its predicted targets AChE-R and BChE. [score:3]
Our experimental test of miR-186 relevance for stress-related conditions revealed a direct dual association between elevated miR-186 and parallel increases in BChE levels in intestinal tissues from predator scent-injection-stressed mice. [score:2]
# HS-RNU6), miR-186-5p (Quanta, Cat. [score:1]
RNU6 snRNA levels were used to normalize the levels of miR-186. [score:1]
Figure 3 Intestinal miR-186 increases under predator scent stress are accompanied by elevated BChE and AChE activities. [score:1]
[1 to 20 of 11 sentences]
4
[+] score: 33
Other miRNAs from this paper: mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-130a, mmu-mir-200b, mmu-mir-202, mmu-mir-30e, mmu-let-7d, mmu-mir-130b, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-192, mmu-mir-200a, mmu-mir-15a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-19a, mmu-mir-200c, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-466a, mmu-mir-467a-1, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-467b, mmu-mir-669c, mmu-mir-709, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-574, mmu-mir-466d, mmu-mir-467e, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-669e, mmu-mir-467g, mmu-mir-467h, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-21b, mmu-mir-130c, mmu-mir-21c, mmu-mir-30f, mmu-mir-466c-3
We also selected miR-186; whose predicted gene targets involve in kidney fibrosis such as bone morphogenetic protein 7 (BMP7), transcription factor SP1, SMAD family member 1 (SMAD1), and inhibitor of DNA binding 4 (ID4). [score:5]
Compared to the control, miR-21 expression level increased 1.33-fold, miR-186 expression level increased 1.36-fold, while miR-709 decreased to 0.58-fold. [score:4]
SP1 mRNA is downregulated while miR-186 is increased after CsA treatment. [score:4]
MiR-21, miR-186 and miR-709 were selected as the candidate microRNAs to test whether parallel changes in expression level can also be induced in the in vitro cell mo del. [score:3]
The expression level change of miR-21, miR-186 and miR-709 was shown in Fig 4A. [score:3]
A) Expression of miR-21, miR-186 and miR-709 in response to CsA treatment at 1 μg/ml for 24 hours. [score:3]
C) Expression of miR-21 and miR-186 was confirmed by qRT-PCR in vehicle and CsA -treated total kidney mRNA. [score:3]
0175242.g004 Fig 4 A) Expression of miR-21, miR-186 and miR-709 in response to CsA treatment at 1 μg/ml for 24 hours. [score:3]
Fig 2C showed that both miR-21 and miR-186 were significantly overexpressed in the CsA -treated mice compared to control mice, and the trend was consistent with the microarray results. [score:2]
More interestingly, our results discovered some novel miRNAs that have not been reported to be involved in kidney or CsA, such as miR-186, miR-709, and so on. [score:1]
Three microRNAs (miR-21, miR-186, and miR-709) and three mRNAs (SMAD7, SMURF1 and BMPR1a) were selected to validate whether the same trend of change will be induced by CsA treatment in HEK 293 cells. [score:1]
The results observed in the HEK 293 cells (miR-21 and miR-186 increased while miR-709 decrease), were similar to the results observed in the animal mo del. [score:1]
[1 to 20 of 12 sentences]
5
[+] score: 17
Other miRNAs from this paper: mmu-mir-150, hsa-mir-150, hsa-mir-186
Over -expression of miR-186 and miR-150 inhibits the synthesis of P2X [7] mRNA, while inhibition of miR-186 and miR-150 up-regulates the synthesis of P2X [7] mRNA and increases ligand -induced P2X [7] pro-apoptotic effects [8]. [score:10]
Mechanisms that induce reduced expression of P2X [7] receptor in cancer epithelial cells involve hypermethylation of the P2X [7] gene and decreased transcription; enhanced degradation of the P2X [7] transcript occurs through the action of microRNAs miR-186 and miR-150 [8], [11], [24]. [score:3]
Mechanisms that induced reduced expression of P2X [7] receptor in cancer epithelial cells involved hypermethylation of the P2X [7] gene and decreased transcription; enhanced degradation of the P2X [7] transcript occurs through the action of miR-186 and miR-150 [8], [10], [16]. [score:3]
The human P2X [7] 3′UTR contains binding sites for miR-186 and miR-150 that confer instability to the P2X [7] transcript. [score:1]
[1 to 20 of 4 sentences]
6
[+] score: 14
In addition to the polyadenylation site, this region contains a miR-7-3p target site that has been lost from the Pelodiscus sequence (Fig.  2b), a conserved let-7-3p target site (Fig.  2c) and a conserved miR-186 target site (Fig.  2d). [score:7]
The 4.8-kb gigaloop is a putative structure formed by pairing of VCR and a complementary sequence (cVCR) Figure 2. Conserved sequences of stratum 1 (shared by Homo and Callorhinchus IGF1R 3'-UTRs): (a) the 3' end of the long IGF1R transcript; (b) a miR-7-3p target site that has been lost from the Pelodiscus sequence; (c) let-7-3p target site; (d) miR-186 target site; (e) The VCR with predicted binding sites for miR-376c, miR-675 (derived from the imprinted H19 RNA) and miR-16. [score:7]
[1 to 20 of 2 sentences]
7
[+] score: 10
Other miRNAs from this paper: mmu-mir-27a, mmu-mir-32, mmu-mir-20b, mmu-mir-590
Three target prediction algorithms, TargetScan 14, miRanda 15 and PicTar 16, identified the downregulation of five BTG2 -targeting miRNAs, miR-590-5p, miR-27a, miR-186, miR-20b and miR-32, in SETD1A -depleted cells. [score:10]
[1 to 20 of 1 sentences]
8
[+] score: 10
Kim J. Yoon H. Chung D. E. Brown J. L. Belmonte K. C. Kim J. miR-186 is decreased in aged brain and suppresses BACE1 expression J. Neurochem. [score:5]
BACE1 is the target of miR-186 and miR-339 [13, 14]. [score:3]
miR-24, miR-186, and miR-455 are regulators of NCT [12]. [score:2]
[1 to 20 of 3 sentences]
9
[+] score: 9
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Furthermore, some of the differentially expressed miRNAs have been reported to play a role in the metastasis of other types of cancer, for example, the up-regulated miRNAs, let-7i, miR-9, miR-30a, miR-125b, miR-142-5p, miR-151-3p, miR-450a and the down-regulated miRNAs, miR-24, mir-145, miR-146b-5p, miR-185, miR-186, miR-203 and miR-335. [score:9]
[1 to 20 of 1 sentences]
10
[+] score: 8
In particular, we identified 10 over-expressed miRNAs (miR-17-5p, miR-221-3p, miR-93-5p, miR-25-3p, miR-181b-5p, miR-106b-5p, miR-186-5p, miR-222-3p, miR-15b-5p, and miR-223-3p; Figure 2A) that are involved in the activation of major liver carcinogenesis-related gene expression networks, especially the TGF-β- and Wnt/β-catenin signaling pathways, the roles of which are well-established in hepatocarcinogenesis [14]. [score:5]
Among these miRNAs, the over -expression of ten miRNAs (miR-15b-5p, miR-17-5p, miR-25-3p, miR-93-5p, miR-106b-5p, miR-181b-5p, miR-186-5p, miR-221-3p, miR-222-3p, and miR-223-3p) was associated with the activation of major hepatocarcinogenesis-related pathways, including the TGF-β, Wnt/β-catenin, ERK1/2, mTOR, and EGF signaling. [score:3]
[1 to 20 of 2 sentences]
11
[+] score: 8
The commonly upregulated miRNAs included those of 34 known tumor suppressor genes (e. g., miR-16, miR-96, miR-150, miR-183, miR-186, miR-194, miR-320, and miR-371), nine miRNAs of oncogenes (e. g. miR-454), and 14 miRNAs that show both tumor suppressive and oncogenic function(Supplementary Table S1). [score:8]
[1 to 20 of 1 sentences]
12
[+] score: 7
Previous studies have shown that CCND1 is the direct target of miR-186 [33] and miR-545 [34], while both CCND1 and CCND2 are directly targeted by miR-15a and miR-16 [35]. [score:7]
[1 to 20 of 1 sentences]
13
[+] score: 6
These disease -associated miRNAs are also listed in Table 1. In addition, we detected a trend in the up-regulation of the following miRNAs, although the values were not consistent enough to meet the criteria that 5 of the 6 infected mice show a fold change >1.75; miR-200a, miR-200b, miR-26a, miR-186, miR-331-3p, miR-152, miR-221. [score:6]
[1 to 20 of 1 sentences]
14
[+] score: 6
MiR-186, miR-216b, miR-337-3p, and miR-760 cooperatively induce cellular senescence by targeting α subunit of protein kinase CKII in human colorectal cancer cells. [score:3]
For example, it is known that human miR-186-5p, miR-216b-5p, miR-337-3p, and miR-760 cooperatively induce cellular senescence by targeting the gene CSNK2A1 in human colorectal cancer cells [35]. [score:3]
[1 to 20 of 2 sentences]
15
[+] score: 5
miR-186 is decreased in aged brain and suppresses BACE1 expression. [score:5]
[1 to 20 of 1 sentences]
16
[+] score: 5
Two other brain-expressed miRNAs that could potentially target P2rx7 (miR-186 and miR-150) 21, were not uploaded to the RISC in the contralateral hippocampus (Fig. 2J). [score:5]
[1 to 20 of 1 sentences]
17
[+] score: 5
Indeed, several miRNAs target BACE1, including miR-9, miR-29, miR-107, miR-186, miR-188, miR-298, and miR-328, some of which are closely related to synaptic and cognitive function [40, 41]. [score:3]
Previously, several miRNAs have been demonstrated to be involved in post-transcriptional regulation of BACE1, including miR-9, miR-29, miR-107, miR-186, miR-188, miR-298, and miR-328 [40, 41]. [score:2]
[1 to 20 of 2 sentences]
18
[+] score: 5
For example, we found that p53 KO and p53 mutant iPS cells induced the expression of miR-186. [score:3]
Among the miRNAs that are regulated by p53R172H during the MEF to iPS cell transition, several have known functions in stemness and differentiation, for example miR-186, miR-194 and miR-206. [score:2]
[1 to 20 of 2 sentences]
19
[+] score: 4
The BestKeeper analysis of miRNA candidate genes ranked mir-16 as the best RG, followed by sno234 and miR-186 for liver tissue and sno234 followed by sno202 and miR-186 for SI (Table 4, Data S3). [score:1]
The best combination of RGs for analyses in SI would be RPlP0, 18S, HPRT1 and miR-186 and sno234 for mRNA and miRNA normalization, respectively. [score:1]
In the case of miRNA normalization, the best RGs according to geNorm analysis are miR-16 and sno234 for liver tissue and miR-186 and miR-200a for SI. [score:1]
The combined use of 18S/RPlP0/HPRT1 and sno234/miR-186 is recommended for normalization in the samples of small intestine. [score:1]
[1 to 20 of 4 sentences]
20
[+] score: 4
These searches identified 8 miRNAs (miR-7a, miR-7b, miR-28, miR-186, miR-381, miR-876, miR-543, and miR-708) that might target CRX. [score:3]
control miR-7b mimcs CRX 1.005 ± 0.090.43 ± 0.04 [*] miR-7b 1.00 ± 0.042.62 ± 0.16 [*] Con miR-186 mimics CRX 1.05 ± 0.14 1.07 ± 0.09 miR-186 1.00 ± 0.021.25 ± 0.02 [*] Con miR-7a mimics CRX 1.02 ± 0.08 0.91 ± 0.016 miR-7a 1.01 ± 0.15 1.15 ± 0.06 Con miR-876 mimics CRX 1.00 ± 0.04 1.14 ± 0.05 miR-876 1.00 ± 0.09 1.25 ± 0. 14 Con miR-708 mimics CRX 1.00 ± 0.11 1.02 ± 0.10 miR-708 1.00 ± 0.03 0.89 ± 0.07 Con miR-381 mimics CRX 1.01 ± 0.10 1.25 ± 0.15 miR-381 1.00 ± 0.01 0.83 ± 0.09 Con miR-543 mimics CRX 1.00 ± 0.060.39 ± 0.02 [*] miR-543 1.09 ± 0.142.56 ± 0.18 [*] Con miR-28 mimics CRX 1.00 ± 0.040.36 ± 0.02 [*] miR-28 1.00 ± 0.092.08 ± 0. 10 [*] * P < 0.05. [score:1]
[1 to 20 of 2 sentences]
21
[+] score: 4
As shown in Table 2, 15 miRNAs (miR-222, miR-320, miR-24, miR-132, let-7b, miR-106a, miR-19b, miR-16, miR-186, miR-339-3p, miR-17, miR-323-3p, miR-197, miR-20a, and miR-382) were down-regulated in Group 2 and were chosen for subsequent verification analysis. [score:4]
[1 to 20 of 1 sentences]
22
[+] score: 4
MicroRNAs like miR-19a, 34b, 129, 135a, 142-3p, miR-153, miR-186, miR-187, and miR-301a were significantly downregulated in Cs1-ko mice. [score:4]
[1 to 20 of 1 sentences]
23
[+] score: 3
The data was normalized to miR-186 or GAPDH expression levels. [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 3
Interestingly, recent findings suggest that chronic pain is regulated directly by spinal glial miRNA-124 [43], miRNA-29, and miRNA-137 [44], through a combined operation of spinal neuron miRNA-186-5p and glial pain-related gene [36], or extracellularly released miRNA [39]. [score:3]
[1 to 20 of 1 sentences]
25
[+] score: 3
The long noncoding RNA HULC promotes liver cancer by increasing the expression of the HMGA2 oncogene via sequestration of the microRNA-186. [score:3]
[1 to 20 of 1 sentences]
26
[+] score: 3
Right panel: The expression of miR-96 or miR-186 in the stably transfected cells was confirmed by qRT-PCR. [score:3]
[1 to 20 of 1 sentences]
27
[+] score: 3
Three miRNAs (miR-181, miR-186, and miR-590-3p) are predicted to target over 50% of all lupus susceptibility genes [19]. [score:3]
[1 to 20 of 1 sentences]
28
[+] score: 3
However, it remains possible that a strong expression of cross-reacting RNA close to this size might partially alter the array results; we observed such bands for miR-186, miR-188 and miR-321. [score:3]
[1 to 20 of 1 sentences]
29
[+] score: 3
Some miRNAs such as miR-24, miR-186, let-7f and miR-320 showed changes in expression throughout all time points (Figure S2C). [score:3]
[1 to 20 of 1 sentences]
30
[+] score: 2
Other miRNAs from this paper: hsa-mir-186
MicroRNA-186 induces sensitivity of ovarian cancer cells to paclitaxel and cisplatin by targeting ABCB1. [score:2]
[1 to 20 of 1 sentences]
31
[+] score: 1
173 (miR-186-5p, miR-208a-5p, miR-291a-3p, miR-294-3p, miR-295-3p, miR-302a-3p, miR-302b-3p, miR-302c-3p and miR-302d-3p). [score:1]
[1 to 20 of 1 sentences]
32
[+] score: 1
Interestingly, a number of major miRNAs enriched for seedless interactions (for example, miR-9, miR-181, miR-30 and miR-186) have AU-rich seed sites, indicating that weak seed-pairing stability may favour seedless non-canonical interactions 10. [score:1]
[1 to 20 of 1 sentences]
33
[+] score: 1
Additionally, miR-23a [15], miR-24 [16], miR-26 [17], miR-27a [18, 19], miR-27b [20], miR-29 [21], miR-124 [22], miR-128a [23], miR-146b [24], miR-148a [25], miR-155 [26], miR-181 [27], miR-199 [28], miR-186 [29], miR-214 [30], miR-221/222 [31], miR-351 [32], miR-486 [33], miR-489 [34], miR-499 [35] and miR-3906 [36] are reported to be involved in skeletal myogenesis. [score:1]
[1 to 20 of 1 sentences]
34
[+] score: 1
There was a group of patients with lower miR-30b-5p, miR-186-5p, miR-382-5p, miR-27a-3p, miR-15a-3p and miR15a-5p. [score:1]
[1 to 20 of 1 sentences]