sort by

294 publications mentioning mmu-mir-200b (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-200b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 444
To determine whether down-regulation of the miR-200 family plays a role in arsenic -induced cell malignant transformation, we first transiently re-expressed miR-200b or -200c in arsenic-transformed cells and found that re -expression of miR-200b or -200c alone or together restored E-cadherin expression and the epithelial-like cellular morphology, and reduced the formation of colonies in soft agar. [score:10]
To determine whether miR-200 suppresses metastasis by targeting ZEB1, the ZEB1 expressing cDNA lacking the 3′UTR was engineered into the MDA-MB-231 LM2 cells that stably expressed miR-200b. [score:9]
Importantly, it was found when C2 was stably expressed the other cluster (C1) also showed a significant increase in expression levels; however, C1 overexpression did not increase the expression levels of C2 miR-200 members. [score:9]
Expressing a WAVE3 mRNA that is resistant to miR-200b targeting also reversed the inhibitory effects of miR-200b on cell invasion, further suggesting a critical role for miR-200b in the inhibition of WAVE3 -dependent cellular invasion. [score:9]
Pin1, peptidylprolyl cis/trans isomerase, NIMA-interacting 1, was confirmed as a direct target of miR-200b, and simultaneously expressing miR-200b and an untargetable Pin1 resulted in a decreased number of cells undergoing anoikis in culture. [score:8]
In the highly migratory arsenic-transformed cells and basal mesenchymal-like triple negative breast cancer cells, we found that PKCα expression levels are significantly higher, and re -expression of miR-200b reduced PKCα levels and inhibited cell migration as well as mammary tumor metastasis [42, 66]. [score:7]
Through down -regulating ZEB1 and ZEB2 expression, the miR-200 family can effectively up-regulate cellular E-cadherin level and maintain a cell in a more epithelial-like state. [score:7]
In contrast, enforced expression of PKCα reversed the inhibitory effect of miR-200b on cell migration and tumor metastasis with no significant effect on ZEB1 expression. [score:7]
Using specific miR-200 inhibitors, this group found that the miR-200 inhibitors increased cell migration of Madin-Darby canine kidney epithelial cells, suggesting that the miR-200 family inhibits cell migration. [score:7]
It was found that miR-200b was still able to inhibit metastasis when ZEB1 was forcibly expressed, which implies that miR-200b can inhibit metastasis in a ZEB1-independent manner. [score:7]
Additionally since these studies have shown that it is the overexpression of the miR-200c/141 cluster that causes the increase in metastatic colonization, it is possible that the miR-200c/141 cluster may act as a suppressor for early steps of metastasis, but facilitates post-extravasation events while the miR-200b/a/429 cluster suppresses metastasis at all steps. [score:7]
Of these nine targets, three were confirmed as direct targets of miR-200: cofilin 2 (Cfl2), low-density lipoprotein receptor-related protein 1 (Lrp1) and Sec23a, a key component of COPII vesicles. [score:6]
Furthermore, these and others have shown that the miR-200 family is a strong inhibitor of EMT, and that EMT resulting from the loss of the miR-200 family depends on ZEB1 and/or ZEB2 up-regulation. [score:6]
Our additional mechanistic studies suggested that this reduction of angiogenesis by miR-200b is likely due to down-regulation of VEGF levels resulting from β-catenin sequestration at the plasma membrane by increased expression of E-cadherin. [score:6]
By applying the Ago-HITS-CLIP technology for transcriptome-wide identification of direct miRNA targets in living cells, Bracken et al recently identified a good number of miR-200a and miR-200b targets [67]. [score:6]
Completing these studies will lead to the discovery of more miR-200 targets and ultimately the development of novel and targeted therapeutic options for the treatment of cancer. [score:6]
It was further confirmed that PLCγ1 was a direct target of the miR-200b/c/429 cluster, and PLCγ1 knockdown resulted in reduced cell viability and increased caspase activity. [score:5]
By culturing cholangiocarcinoma cells (Mz-ChA-1) with gemcitabine in the presence or absence of miR-141 or miR-200b inhibitors, they were able to determine that the inhibition of miR-200b decreased gemcitabine -induced apoptosis. [score:5]
Therefore, it was concluded that the miR-200 family elicits this inhibitory effect on cell migration by targeting both ZEB1/2. [score:5]
These studies suggest that even though the miR-200 reduces the number of cancer cells in the bloodstream, probably by strongly inhibiting the early metastatic steps, those cancer cells that have high expression levels of miR-200s and do manage to get through the extravasation step are more capable of colonizing a distant organ. [score:5]
Then we overexpressed miR-200b in parental p53 [low]HBECs and found that forced expression of miR-200b prevented cellular transformation by chronic low dose arsenic exposure [35]. [score:5]
Recent studies have shown that the miR-200 family can inhibit angiogenesis because the family targets multiple key players in this process. [score:5]
This suppressive effect on metastasis was not seen when miR-141 was stably expressed in these cells suggesting that the functional group I miR-200s (miR-200b/-200c/-429) is able to repress metastasis in these cells. [score:5]
These data suggests that the miR-200 family targets pathways involved in inhibiting metastatic colonization. [score:5]
Additionally, miR-200a and miR-200b have also been shown to directly target the pro-angiogenic ligands interleukin 8 (IL-8) and chemokine (C-X-C motif) ligand 1 (CXCL1) to regulate angiogenesis in ovarian cancer [50]. [score:5]
Then we generated miR-200b stable expression cells and found that stably re -expressing miR-200b in arsenic-transformed cells abolished their ability to form colonies in soft agar, and tumors in nude mice when injected subcutaneously. [score:5]
Results from this experiment showed that expression of miR-200b and miR-200c enhance the sensitivity of LY2 breast cancer cells to growth inhibition by both 4-OHT and fulvestrant. [score:5]
Recent studies suggest that the miR-200 family is pivotal in regulating EMT by targeting ZEB1 and ZEB2 via direct interactions with their 3′UTRs [61– 63]. [score:5]
It was determined that the promoter regions of the miR-200 family were indeed highly methylated upon treatment with the carcinogen, and demethylation induced by DNA methyltransferase inhibitors or demethylation chemicals increased the expression of the miR-200 family. [score:5]
The expression levels of the miR-200 family members was determined by qPCR in MCF-7 cells that were either sensitive or resistant (LY2) to endocrine treatment, and showed that the expression of miR-200b, -200a, and -200c was significantly decreased in the endocrine-resistant cell lines. [score:5]
In contrast, injection of the modified C2 or C1+C2 4TO7 cells (cell lines that both express high levels of all five miR-200 members) formed more lung metastases than the parental or C1 alone overexpressing 4TO7 cells [72]. [score:5]
Xu and colleagues were able to show that miR-200 family expression was significantly correlated with the status (benign, non-recurrent or recurrent primary, or metastatic) of a melanoma tumor, therefore expanding the potential role of the miR-200 family as a prognostic marker in this disease [91]. [score:5]
It has been shown that stably expressing both miR-200 cluster members reduced the ability of cancer cells to enter the blood stream, and that E-cadherin overexpression can also decrease the number of cells in the blood stream [72]. [score:5]
These findings suggest that miR-200b suppresses cell migration and metastasis by targeting PKCα, which is independent of its effect on ZEB1. [score:5]
Not only has the miR-200 family been shown to inhibit cellular malignant transformation, but studies have also shown that they are capable of suppressing tumor growth. [score:5]
Another study looked at the effects of miR-200 on targets that regulate the reorganization of the actin cytoskeleton to promote invasiveness [56]. [score:4]
A summary of the validated direct targets of the miR-200 family. [score:4]
Therefore, downregulation of miR-200 family levels in tumor cells can help the cell survive within the bloodstream by reducing apoptosis. [score:4]
Studies have shown that the miR-200 family plays a role in reducing chemoresistance by targeting these genes known to play a direct role in developing this resistance. [score:4]
This work showed for the first time a global regulatory network directly regulated by miR-200 family, which provided a novel mechanistic insight for miR-200 family maintaining the key features of the epithelial phenotype and preventing cell migration. [score:4]
Through invasion assays and luciferase reporter assays, it was determined that miR-200b regulates cell migration and metastasis by targeting moesin, and restoration of moesin prevents miR-200b from suppressing cell migration and metastasis. [score:4]
The expression of the miR-200 family can be regulated through interactions with, and modifications of their promoters. [score:4]
Studies on the miR-200 family have enhanced our knowledge of the crucial roles that they may play in cancer development and progression through targeting a variety of important proteins. [score:4]
Further analysis revealed that miR-200b directly targets WAVE3 through interaction with its 3′UTR in MDA-MB-231 breast, LNCaP prostate, and HT29 colorectal cancer cells. [score:4]
Together, these studies suggest that loss of miR-200 expression may play an important role in the early stage of carcinogenesis. [score:3]
Recent research done in our laboratory has been the first to show an important role of the miR-200 family in inhibiting and preventing cell malignant transformation by a carcinogen exposure [35]. [score:3]
However, ours and other recent studies also suggest that the miR-200 family can inhibit cell migration independent of its effect on ZEB1/ZEB2. [score:3]
In contrast, it was found that low expression of cluster I miR-200s (miR-200b, -200a and -429) correlated with poorer overall survival in ovarian and endometrial cancer [94, 95]. [score:3]
A miRNA microarray analysis showed that the expression levels of miR-200 family were drastically reduced in arsenic-transformed cells. [score:3]
However, ZEB1 and ZEB2 can also bind to the E-box sites close to the transcription start site of each of the miR-200 clusters inhibiting their transcription, resulting in a negative feedback loop [64, 65]. [score:3]
In striking contrast to the strong inhibitory effect of miR-200 family has on the early metastatic steps, studies have shown that miR-200 may promote metastatic colonization [72, 81]. [score:3]
The miR-200 family is highly conserved among vertebrate species and highly expressed within epithelial cells. [score:3]
A recent paper by Manavalan et al. has also shown a link between the miR-200 family and targeted therapy resistance in breast cancer cells [109]. [score:3]
To study the role of the miR-200s in metastatic colonization, Korpal et al. stably expressed cluster I (miR-200b/a/429: which will be referred to as C1), cluster II (miR-200c/141: C2) or clusters I and II (C1+C2) in the weakly metastatic 4TO7 cells. [score:3]
Together, these findings suggest that loss of miR-200 expression plays a causal role in arsenic -induced cell malignant transformation and tumorigenesis. [score:3]
Early studies on the miR-200 family have shown that the miR-200 family can suppress cell migration. [score:3]
Moreover, profiling a group of mouse breast cancer cell lines (67NR, 168FARN, 4TO7, and 4T1) with different metastatic capabilities (67NR cells are unable to intravasate; 168FARN cells cannot extravasate efficiently; 4TO7 cells do not colonize distant organs well; and 4T1 cells are capable of completing all steps of metastasis) revealed that the most metastatic cells (4T1) had the highest level of miR-200 family expression. [score:3]
These findings suggest that decreased expression of miR-200b may play a critical role in chemoresistance. [score:3]
In this regard, two separate studies have shown that miR-200b directly targets vascular endothelial growth factor A (VEGFA) [46, 47], a ligand that is considered the master determinant for the activation of the angiogenic program. [score:3]
This again suggested that other targets of the miR-200 family are more important in colonization efficacy of a cancer cell. [score:3]
Since some of the data on the role of miR-200 family in cancer is controversial and cellular context dependent, it is important for future studies to tease apart which miR-200 family members act as a tumor suppressor and which may promote cancer progression. [score:3]
However, the reported effects of miR-200b on xenograft tumor growth are less consistent as some studies including ours have shown that expression of miR-200b decreased tumor growth [41, 42] while others have shown that it has little or no effect on tumor growth [43, 44]. [score:3]
Through microarray and mass spectrometry analysis nine potential miR-200 targets were identified. [score:3]
For example, in A549 lung cancer cells, Choi and colleagues demonstrated that transient miR-200b expression reduced Flt1 (VEGF receptor 1) and KDR (VEGF receptor 2) protein level, and a luciferase reporter assay confirmed the direct interaction between miR-200b and the 3′UTR of these proteins. [score:3]
In the case of apoptosis, Uhlmann et al. found that in MDA-MB-231 breast cancer cells, overexpression of the miR-200b/c/429 cluster significantly reduced cell viability and increased apoptosis [73]. [score:3]
Li and colleagues found that mammary fat pad injection of the metastatic MDA-MB-231 LM2 breast cancer cells resulted in metastasis to the lung and bone, and this was greatly reduced by the stable expression of miR-200b or miR-200c [43]. [score:3]
Some representative miR-200 targets involved in each step of the metastatic cascade are shown. [score:3]
Research in our lab has also shown an important role of miR-200b in inhibiting tumor angiogenesis. [score:3]
The identified miR-200 targets are critically involved in Rho-ROCK signaling, invadopodia formation, matrix metalloproteinase activity, and focal adhesions. [score:3]
Functional analysis in vitro and in vivo revealed that miR-200 increased metastatic colonization by targeting Sec23a. [score:3]
Further functional validation of the identified miR-200 targets revealed that they constitute subnetworks that play crucial roles in enabling cancer cells to migrate and invade. [score:3]
However, Kolesnikoff and colleagues also showed that Sp1 -mediated activation of miR-200b/200a/429 transcription can be disrupted by the expression and interaction of ZEB1/2 with its binding sites within the promoter. [score:3]
To study the role of miR-200b in this process, we used conditioned media from arsenic-transformed cells that stably expressed miR-200b. [score:3]
Transient transfection of miR-200c reduced both formin homology domain-containing protein 1 (FHOD1) and Mg [2+]/Mn [2+] -dependent protein phosphatase 1F (PPM1F) levels, and inhibition of the miR-200b/c/429 cluster in MCF7 breast cancer cells increased FHOD1 and PPM1F levels. [score:3]
When bound, ZEB1 and ZEB2 can inhibit the transcription of the entire miR-200 family, while Sp1 and p53 binding has been shown to lead to activation of transcription of the miR-200b/200a/429 [32, 33] and the miR-200c/141 [33, 34] clusters, respectively. [score:3]
Further experiments revealed that expression of miR-200b and -200c were significantly reduced after 4 week carcinogen treatment. [score:3]
Figure 3 Some representative miR-200 targets involved in each step of the metastatic cascade are shown. [score:3]
Subsequent luciferase reporter assays revealed that miR-200b directly targets the 3′UTR of PKCα. [score:3]
It was found that HUVECs cultured in conditioned media from arsenic-transformed cells stably expressing miR-200b formed significantly less tubes. [score:3]
These two studies described above both looked at epigenetic silencing as a possible mechanism for the carcinogen -induced miR-200 expression loss seen in the HBECs. [score:3]
Therefore, the miR-200 family also plays a role in sensitivity to the specific targeted therapies available for breast cancer. [score:3]
Recent studies suggest that modifications to the promoter regions of each of the miR-200 clusters can cause the loss of the expression of the miR-200 family in cancer. [score:3]
Together, these findings provide additional evidence supporting that miR-200b is capable of inhibiting tumor angiogenesis. [score:3]
Using the same techniques as Kovalchuk et al., Pogribny and colleagues found that in MCF-7 cells miR-200b and -200c expression were inversely correlated with resistance to cisplatin [105]. [score:3]
Furthermore, the miR-200 family has also been shown to target the VEGF receptors. [score:3]
Recent research has suggested that the miR-200 family plays an important role in inhibiting cell malignant transformation and preventing tumor initiation. [score:3]
Gregory et al. first reported the inhibitory effect of miR-200 on cell migration using a transwell migration assay [61]. [score:2]
Our recent studies have also implicated the miR-200 family in the ZEB1-independent regulation of cell migration and metastasis. [score:2]
Furthermore, the immunofluorescence staining of CD31, a marker of blood vessel endothelial cells, on xenograft tissues resulting from the injection of arsenic-transformed cells stably expressing miR-200b showed a drastic reduction compared to CD31 staining on xenograft tumors resulting from the injection of arsenic-transformed vector control cells [54]. [score:2]
Comparing the expression levels of the miR-200 family members in gastric cancer cell lines, Valladares-Ayerbes and colleagues found that miR-200c levels were much significantly higher in cancer cells compared to normal cells [90]. [score:2]
A miRNA microarray done by Meng et al. in cholangiocyte cell lines showed that miR-200b and -141 are dysregulated in malignant cholangiocytes [107]. [score:2]
To study the effects of WAVE3 on cell invasion, a Matrigel-invasion assay showed that cells treated with WAVE3 siRNA or that overexpression of miR-200b reduced the invasive capability, while using an anti-miR-200b oligonucleotide increased the number of invading cells. [score:2]
Taken together, these data suggest that the miR-200 family plays crucial roles in the metastatic cascade by down -regulating important players involved in angiogenesis. [score:2]
Similarly, Dykxhoorn et al. reported that the 4TO7 cells, lacking the capability of colonizing distant organs, had almost undetectable expression levels of the miR-200b/c/429 cluster compared to the strongly metastatic 4T1 cells [81], suggesting a potential role for the miR-200b/c/429 cluster in colonization. [score:2]
Effect of the miR-200 family on tumor cell intravasation. [score:1]
Although current studies on the miR-200 family have shown promising results, more work is needed to further understand the role this family plays in cancer. [score:1]
The potential role of miR-200 family in cancer therapy. [score:1]
Effect of the miR-200 family on epithelial-to-mesenchymal transition and tumor cell migration. [score:1]
Figure 1The miR-200 family consists of two clusters: Cluster I (miR-200b, - 200a, and - 429 is located on chromosome 1) and Cluster II (miR-200c and - 141 is located on chromosome 12). [score:1]
Studies showed potential in the use of members of the miR-200 family for cancer diagnosis. [score:1]
Indeed, Pecot et al. recently reported that higher miR-200 levels in ovarian, lung, renal and basal-like breast adenocarcinomas are associated with improved clinical outcome. [score:1]
Effect of the miR-200 family on tumor cell survival in circulation. [score:1]
Therefore, arsenic or tobacco carcinogens may induce cell transformation by increasing the methylation of the promoter regions of, and subsequently leading to silencing of, the miR-200 family. [score:1]
This is probably partly due to the difficulty in measuring intravasated cells in the blood stream, and that the miR-200 family has a strong suppressive effect on the earlier steps of the metastatic cascade. [score:1]
However, there has been little research done with respect to the mechanism by which miR-200 family reduces cancer cell intravasation. [score:1]
Alternatively, the miR-200 family members can also be divided into two functional groups based upon the similarities of their seed sequences (Figure 2). [score:1]
The miR-200 family as potential diagnostic and prognostic tools. [score:1]
The miR-200 family consists of two clusters: Cluster I (miR-200b, - 200a, and - 429 is located on chromosome 1) and Cluster II (miR-200c and - 141 is located on chromosome 12). [score:1]
These studies suggest that body fluid miR-200 family levels may have different diagnostic values for different types of cancers. [score:1]
Effect of the miR-200 family on tumor cell extravasation and metastatic colonization. [score:1]
MiR-200 family members have been shown to regulate apoptosis and anoikis, and therefore may have an effect on tumor cell survival in circulation. [score:1]
However, higher levels of miR-141 are significantly associated with worse clinical outcome of luminal subtypes breast cancer [50], suggesting that miR-200 may exhibit differential functions among different breast cancer subtypes. [score:1]
Thus, ZEB1 and ZEB2 can keep a cell in a mesenchymal phenotype by repressing the transcription of both E-cadherin and the miR-200 family. [score:1]
Developing new and robust mo dels for the study of intravasation and extravasation steps of metastasis are also needed to advance our knowledge on the miR-200′s role in these critical processes. [score:1]
Alternatively, the promoter regions of the miR-200 family can be bound by the transcription factors zinc finger e-box bind homeobox 1 (ZEB1) and 2 (ZEB2 also known as SIP1), specificity protein 1 (Sp1), and p53. [score:1]
Given the contradictory results observed, the role of individual members of the miR-200 family in anoikis still needs to be further studied. [score:1]
Therefore more work is needed to determine the role of the miR-200 family in this early step of metastasis. [score:1]
Though much of the research on the miR-200 family in cancer drug resistance has focused mostly on miR-200b and -200c, it is possible that the other members of the miR-200 family may also play similar roles in the process due to their similar seed sequences. [score:1]
Zhang and colleagues also studied the role of miR-200 in anoikis in breast cancer [78]. [score:1]
The miRNA-200 (miR-200) family consists of five members, which form two clusters located in two different genomic regions. [score:1]
The miRNA-200 family. [score:1]
The miR-200 family is among the most wi dely studied miRNAs in cancer, this review will focus specifically on the role of the miR-200 family in cancer initiation, metastasis, diagnosis and treatment. [score:1]
Functional Group I is composed of miR-200b, -200c, and -429 and Functional Group II consists of miR-141 and -200a. [score:1]
Figure 2The miR-200 family members can also be separated into two functional groups based upon their seed sequences. [score:1]
Moreover, most of the research done on individual miR-200 family members focuses on miR-200b or -200c, therefore more work is needed on miR-200a, -141 and -429 and their individual role in cancer. [score:1]
Separately, Rui and colleagues also found that decreased miR-200b levels are associated with resistance to docetaxel in a lung adenocarcinoma cell line (SPC-A1 and SPC-A1/docetaxel) [108]. [score:1]
Therefore, the interplay between the miR-200 family and ZEB1/ZEB2 plays an important role in driving the cell in to and out of EMT. [score:1]
The miR-200 family two clusters are located on two different chromosomes. [score:1]
The miR-200 family in cell transformation and tumorigenesis. [score:1]
Effect of the miR-200 family on tumor growth, angiogenesis, and nearby tissue invasion. [score:1]
To study the role of miR-200 in the last step of the metastatic cascade, Korpal and colleagues profiled the levels of the miR-200 family in primary and metastatic samples and found that the miR-200 family was higher in metastatic secondary tumors [72]. [score:1]
Of these 17 miRNAs, four of them were from the miR-200 family (miR-200b, -200a, -200c, and -141), and this group concluded that miR-200b was the best miRNA for determining CTC -positive MBC patients. [score:1]
Moreover, it was also found that the poorly metastatic 4TO7 cells can take up miR-200 from 4T1 EVs and become metastatic in a miR-200–dependent manner [82]. [score:1]
The miR-200 family in cancer metastasis. [score:1]
As shown in Figure 1, the Cluster I miR-200s in humans contains miR-200b, -200a, and -429 (miR-200b/200a/429) located in an intergenic region of chromosome 1, and cluster II miR-200s contains miR-200c and -141 (miR-200c/141) located on chromosome 12 [27, 28]. [score:1]
Current research on the miR-200 family has shown that the family can affect each step of the metastatic cascade. [score:1]
Together, these findings suggest that miR-200 levels may have the potential to serve as indicators of cancer prognosis. [score:1]
The miR-200 family members can also be separated into two functional groups based upon their seed sequences. [score:1]
Future work on the miR-200 family can help with better understanding the mechanism by which miR-200s affect cancer initiation, metastasis, and relapse. [score:1]
The sequences of the mature miRNA-200 family members. [score:1]
To further determine the underlying mechanism behind miR-200 promotion of metastatic colonization, Korpal and colleagues used a tail vein injection mo del with the modified 4TO7 cells described above. [score:1]
The role of the miR-200 family in apoptosis has already been discussed above in the survival in circulation section; therefore this section will focus primarily on the effect of miR-200s on chemoresistance. [score:1]
Since much work has focused on the effect of whole clusters/groups on metastasis, more work is also needed to be done on individual members of the miR-200 family to elucidate their role in each step of the metastatic cascade. [score:1]
Furthermore, a high level of circulating miR-141 was found to be associated with high-risk (Gleason score ≥ 8) tumors [92], while a lower level of cluster I of the miR-200 family was correlated with relapse [93] in prostate cancer. [score:1]
Transfection of miR-200b in MDA-MB-231, BT549, and Hs578T TNBC cells increased the number of apoptotic cells in suspension-culture. [score:1]
The promoter region of the miR-200c/-141 cluster has been shown to be hypermethylated [29, 30], whereas the miR-200b/-200a/-429 cluster has been shown to be silenced primarily through polycomb group -mediated histone modifications [31] in cancer. [score:1]
MiR-200b, -200c, and -429 (Functional Group I) all share the same seed sequence and miR-200a and -141 (Functional Group II) both share the same seed sequence, with the two functional groups only differing in the seed sequence by one nucleotide (AA UACUG for miR-200b/200c/429 and AA CACUG for miR-200a/141). [score:1]
However, more research is needed to discern the function of each cluster as a whole and to elucidate the effect of each individual member of the miR-200 family on the metastatic cascade. [score:1]
[1 to 20 of 148 sentences]
2
[+] score: 266
They found that miR-200 family inhibitors down-regulated pro-SP-C and SP-B expression. [score:8]
Of note, we did not observe upregulation of the primary direct targets of the miR-200 family in the transcriptome analysis of miR-200b [−/−] lungs. [score:7]
Others have shown that miR-200 is down-regulated in a mouse mo del of fibrotic lung disease and human patients with idiopathic pulmonary fibrosis (IPF) [21]. [score:6]
Our immunofluorescence studies indicate that Vimentin and Twist expression are upregulated in the peripheral lung tissues of miR-200b [−/−] mice. [score:6]
Down-regulation of CDH26 in our knockout lungs can explain the fibroblast-like phenotype of the lungs in our knockout mice and the role of miR-200b in maintaining an epithelial cell phenotype. [score:6]
Knocking down miR-200b in our mice resulted in down-regulation of mature miR-200a and miR-429. [score:5]
Although miR-200a and miR-429 were expressed lower in miR-200b [−/−] lungs, their expression was not undetectable like miR-200b. [score:5]
We transfected BEAS-2B cells with miR-200b inhibitors and 18 h later, we observed 25% less scratch wound closure in the control group, whereas, in cultures transfected with miR-200b inhibitors, wound closure was enhanced by 75%. [score:5]
Xiao P Liu W Zhou H miR-200b inhibits migration and invasion in non-small cell lung cancer cells via targeting FSCN1Mol. [score:5]
Therefore, changes in proteins of the direct gene targets of the miR-200 family might not be reflected in the transcriptome of miR-200b [−/−] lungs. [score:4]
We generated a miR-200b [−/−] (KO) mouse by replacing the complete miR-200b gene by targeted homologous recombination in C57Bl/6N mouse embryonic stem cells using the NorCOMM knockout cassette (online data supplement). [score:4]
The targeted miR-200b gene was highlighted in the resulting knockout allele (KO Allele). [score:4]
Cadherin-26 (CDH26) is another significantly down-regulated mRNA in the miR-200b [−/−] lungs. [score:4]
Palate lung and nasal epithelial clone (Plunc) is one of the mRNAs that was down-regulated more than four times in miR-200b [−/−] lungs. [score:4]
Generation of C57BL/6; miR-200b [tm1.1(NCOM)MFGC] miceWe generated a miR-200b [−/−] (KO) mouse by replacing the complete miR-200b gene by targeted homologous recombination in C57Bl/6N mouse embryonic stem cells using the NorCOMM knockout cassette (online data supplement). [score:4]
miR-200b deficient mice had stiffer lungs due to disturbed distal airway branching, thicker alveolar walls and downregulation of epithelial cell differentiation. [score:4]
Our data suggests that miR-200b is involved in the translation regulation of these genes in the lung. [score:4]
Down-regulation of CYP2A5 suggests the involvement of miR-200b in lung metabolism. [score:4]
Based on our studies, we cannot exclude that downregulation of miR-200a and miR-429 contributed to the observed lung phenotype in miR-200b deficient mice. [score:4]
miR-200b is highly expressed during different stages of lung development. [score:4]
These include the developing inner ear [24], palate [25] and mammary buds [26] (Supplementary Fig. 3), consistent with prior reports suggesting that miR-200b expression is highly coordinated and associated with control of the development of these organs 27– 29. [score:4]
We confirmed complete knockout of miR-200b expression by RT-qPCR in fetal lungs (Fig.   1f) and lungs from 8-week old mice (Supplementary Fig. 5). [score:4]
Benlhabib H Guo W Pierce BM Men delson CR The miR-200 Family and Its Targets Regulate Type II Cell Differentiation in Human Fetal LungJ. [score:4]
Yao, Y. et al. MiR-200b expression in breast cancer: a prognostic marker and act on cell proliferation and apoptosis by targeting Sp1. [score:4]
Notably, we observed high LacZ-miR-200b expression in other organs where development also hinges on epithelial-mesenchymal interactions and branching morphogenesis. [score:4]
This down-regulation can result from the removal of the miR-200b gene on the promotor activity or can be a post transcriptional effect of miR-200b on processing of the other microRNAs. [score:4]
Members of the miR-200 family are down-regulated in the lungs of patients with IPF and a mouse mo del of lung fibrosis [21]. [score:4]
Cyp2a5 (cytochrome P450, family 2, subfamily a, polypeptide 5) mRNA is one of the most down-regulated mRNAs in miR-200b [−/−] lungs. [score:4]
We found that miR-200b inhibitors promoted accumulation of fibroblast cell markers following down regulation of miR-200b (Fig.   3g). [score:4]
Based on this high and dynamic expression of miR-200b, we focused first on the role of miR-200b during the early stages of lung development. [score:4]
However, it is unclear at this point what the influence of downregulation of miR-200a and miR-429 on the lung phenotype of miR-200b deficient mice is. [score:4]
Our data suggest that miR-200b is required to achieve the necessary balance in development of lung epithelial cells and fibroblasts to ensure development of a structurally and functionally effective respiratory organ. [score:3]
Our in vivo studies demonstrate a new role for miR-200b in distal lung airway development by regulating epithelial and fibroblast cell differentiation. [score:3]
The cell cultures were washed with PBS to remove the debris followed by transfection with miR-200b inhibitors. [score:3]
Our miR-200b deficient mice have lung function abnormalities, surfactant biophysical dysfunction with compromised pro-Surfactant Protein-C and surfactant protein-B expression. [score:3]
We generated miR-200b [−/−] mice by targeted deletion of miR-200b in ES cells. [score:3]
Here, we show that miR-200b [−/−] lungs have dysfunctional surfactant and compromised expression of these two proteins. [score:3]
Human bronchial epithelial cells, BEAS-2B (ATCC, Manassas, VA, USA), cells were transfected with 0.01 μg/ml of LNA-hsa-miR200b inhibitor or negative control oligonucleotides Exiqon, Denmark). [score:3]
Also, miR-200b can inhibit migration and invasion of non-small cell lung cancer cells [22]. [score:3]
We generated miR-200b [−/−] (KO) mice by replacing the complete miR-200b gene with a LacZ-reporter by targeted homologous recombination in C57Bl/6N mouse embryonic stem cells using the NorCOMM cassette (Fig.   1a,b, Supplementary Fig.   1). [score:3]
Briefly, BEAS-2B cells were plated in 12 well plates and transfected with 0.01 μg/ml of LNA-hsa-miR200b inhibitors or negative control oligonucleotides. [score:3]
In the same study, we found that higher miR-200b expression in the fetal tracheal fluid of CDH fetus is associated with a better response to fetoscopic endoluminal tracheal occlusion (FETO, a prenatal therapy to promote lung growth) [16]. [score:3]
The complete miR-200b non-coding gene (WT allele) was replaced by a NorCOMM cassette via targeted homologous recombination in C57Bl/6N mouse C2 ES cells. [score:3]
We demonstrate for the first time that miR-200b plays a role in peripheral lung development by maintaining an epithelial cell phenotype. [score:2]
To evaluate if the absence of miR-200b resulted in compensatory upregulation of other family members, we assessed the abundance of all family members in fetal lung explants using RT-qPCR (Fig.   1f). [score:2]
Also, miR-200b [−/−]lungs showed higher expression of Twist 1 protein – a transcription factor and marker for EMT - compared to miR-200b [+/+] lungs (Fig.   3e,f). [score:2]
The role of miR-200b during normal lung development has yet to be defined. [score:2]
Shin JO MiR-200b is involved in Tgf-β signaling to regulate mammalian palate developmentHistochem. [score:2]
Using human fetal lung cultures, Benlhabib, et al. showed previously that miR-200 family members regulate epithelial type II cell differentiation and function [33]. [score:2]
Du, J. T. et al. MicroRNA-200 family members are weakly expressed in the neurosensory epithelia of the developing zebrafish (Danio rerio) inner ear. [score:2]
The expression of miR-200c and miR-141 did not change in the miR-200b [−/−] fetal lungs compared to miR-200b [+/+] lungs, suggesting that there were no compensatory effects on other family members. [score:2]
The goal of this study was to delineate the role of miR-200b during lung development using loss of function mo dels in vivo. [score:2]
Consistent with development of a low compliance or “fibrotic” lung, miR-200b [−/−] mice also showed significantly higher tissue elastance upon MCh-challenge (12 mg/ml and higher) (Fig.   2b). [score:2]
MiR-200b belongs to the miR-200 family (miR-141, miR-429, miR-200a, miR-200b and miR-200c) and regulates epithelial-to-mesenchymal transition (EMT) in cancer and organ fibrosis 17– 20. [score:2]
Our data suggest a functional role for miR-200b in development of surfactant properties, resulting in reduced lung compliance in miR-200b [−/−] mice. [score:2]
In contrast to miR-200b/miR-429 [−/−] mice reported by others [23], our miR-200b [−/−] mice carried a lacZ-reporter gene that we exploited to localize miR-200b promoter activity during development (Fig.   1c). [score:2]
miR-200b [−/−] lungs have dysfunctional surfactant and denser parenchyma with more fibroblast- like cellsSome of the lung function abnormalities in miR-200 [−/−] could result directly from changes in surfactant function or distal airway branching. [score:2]
Newborn miR-200b [+/−] and miR-200b [−/−] mice did not display any breathing difficulties after birth, and together, these results indicate that proximal airway branching is not influenced by absence of miR-200b during development. [score:2]
The expression of miR-200c and miR-141 did not change in the miR-200b [−/−] lungs compared to miR-200b [+/+] lungs, suggesting that there were no compensatory effects on other family members (Fig.   1f and Supplementary Fig. 5). [score:2]
Mature microRNAs transcribed in the same cluster–miR-200a and miR-429–were still expressed, albeit lower compared to miR-200b [+/+] lungs (wt). [score:2]
We showed that mature microRNAs transcribed in the same cluster - miR-200a and miR-429 - were still expressed, albeit lower compared to miR-200b [+/+] lungs (Fig.   1f, Supplementary Fig. 5). [score:2]
Some of the lung function abnormalities in miR-200 [−/−] could result directly from changes in surfactant function or distal airway branching. [score:2]
MiR-200b [−/−] lungs have decreased distal airway branching, a denser lung parenchyma with thicker alveolar walls, a higher number of fibroblast-like cells and over -expression of a marker for EMT: Twist. [score:2]
mRNA-Seq whole transcriptome analysis demonstrated that mRNAs of epithelial cell differentiation and surfactant genes are most affected in miR-200b [−/−] lungsIn order to evaluate the effect on downstream targets and associated pathways owing to loss of miR-200b on the lung tissue transcriptome, we performed Next Generation Sequencing (NGS) on total RNA samples from lungs of three 8-week-old miR-200b [−/−] mice and three miR-200 [+/+] (wt) mice. [score:1]
At baseline, airflow resistance in conducting airways (Newtonian resistance) was not different between different groups of mice, but was significantly higher in miR-200b [−/−] mice challenged with high concentrations of MCh (Fig.   2c). [score:1]
miR-200b absence does not affect proximal airway branching. [score:1]
Therefore, we assessed the biophysical function of surfactant from miR-200b [−/−] and miR-200 [+/+] lungs using capillary surfactometry. [score:1]
Using PANTHER Gene Ontology classification system [31], we identified Notch and Wnt signalling among the most affected biological pathways and cytoskeletal as well as immunity proteins among the most affected protein class in miR-200b [−/−] lungs compare to miR-200b [+/+](Fig.   4b,c). [score:1]
These findings suggest a “partial EMT” in the lung parenchyma of miR-200b deficient mice. [score:1]
Generation of C57BL/6; miR-200b [tm1.1(NCOM)MFGC] mice. [score:1]
Finally, miR-200b [−/−] mice demonstrated significantly lower hysteresivity (elastic hysteresis) in pressure-volume loops obtained before and after MCh challenge, consistent with the increased elastance we observed in these animals (Fig.   2d, Supplementary Fig. 4). [score:1]
Thus, both studies suggest that the observed peripheral airway obstruction is due to thicker alveolar walls reducing the airspace inside miR-200b [−/−] lungs. [score:1]
We recently discovered that miR-200b is elevated in abnormal lungs of human CDH babies. [score:1]
Eight-week-old male miR-200b [+/+](wt) or miR-200b [−/−] (ko) mice (at least six mice for each group) were anesthetized with intra-peritoneal sodium pentobarbital (90 mg/kg). [score:1]
For mice lung explant culture, lungs were isolated from E11.5 embryos (offspring from a miR-200b [+/−] cross) and transferred to porous membranes (IsoporeTM) filters with dimensions of 1 mm × 1.5 mm pore size (Millipore, USA) in a 12-well plate for a semidry floating explant culture and cultured for four days in a 1:1 mixture of DMEM and Ham’s F-12 Nutrient supplemented with 100 μg/ml streptomycin, 100 units/ml penicillin, 0.25 mg/ml ascorbic acid. [score:1]
miR-200b [−/−] mice have higher lung tissue damping and elastance with lower hysteresivity. [score:1]
Three miR-200b [−/−] and three miR-200b [+/+] 8-week-old lungs were inflation-fixated and embedded in paraffin. [score:1]
To evaluate the effect of miR-200b on maintaining human bronchial epithelial cell phenotype, we transfected BEAS-2B cells with miR-200b inhibitors and performed double-immunofluorescence with cytokeratin and vimentin to mark epithelial cells and fibroblasts, respectively. [score:1]
Using in vivo micro-CT scanning on alive animals, we found higher parenchymal density with significantly less air-filled distal alveoli in miR-200b [−/−] mice. [score:1]
miR-200b absence was confirmed. [score:1]
Although miR-200c has the exact same seed sequence as miR-200b, the abundance of this microRNA along with miR141 was not changed in lungs and kidneys of 8-week old miR-200b [−/−] mice suggesting the absence of any compensatory effects of these two miR-200 family members in miR-200b deficient mice. [score:1]
Our miR-200b [−/−] mice did not show any obvious breathing problems after birth, but lung function studies demonstrated severe peripheral airway obstruction in 8-week-old miR-200b [−/−] mice. [score:1]
miR-200b [−/−] lungs have dysfunctional surfactant and denser parenchyma with more fibroblast- like cells. [score:1]
Our current findings revealed that the three most affected biological processes in miR-200b [−/−] mice lungs were related to cell cycle, apoptosis and protein transport (Fig.   4d). [score:1]
Hertzano R Cell type-specific transcriptome analysis reveals a major role for Zeb1 and miR-200b in mouse inner ear morphogenesisPLoS Genet. [score:1]
mRNA-Seq whole transcriptome analysis demonstrated that mRNAs of epithelial cell differentiation and surfactant genes are most affected in miR-200b [−/−] lungs. [score:1]
Removal of the hβact promoter driven ∆TK1-T2A-neomycin cassette was performed by mating male miR200b [tm1(NCOM)MFGC] mice harboring the miR-200b KO allele with female CMV-Cre transgenic mice. [score:1]
Taken together, these results indicate that even though miR-200b [−/−] mice do not experience obvious breathing difficulties, their lungs display a functional phenotype similar to lung fibrosis and lung hypoplasia observed in children with CDH. [score:1]
Three 8-week-old miR-200b [−/−] or miR-200b [+/+] lungs were inflated intratracheally with 1 ml of 10% formalin via the cannula by gentle infusion. [score:1]
Using NGS analysis, we identified changes in the transcriptome in miR-200b [−/−] lungs. [score:1]
At rest, miR-200b [−/−] mice did not exhibit altered peripheral tissue/airway resistance (tissue damping), however after challenge with methacholine (MCh; 6 mg/ml and higher) a substantive increase in tissue damping was revealed (Fig.   2a). [score:1]
miR-200b maintained human bronchial epithelial phenotype and function. [score:1]
Three miR-200b [−/−] and three miR-200b [+/+] male mice were anesthetized in an anesthetic chamber with 5% isoflurane and scanned for 32 minutes, while the mice were breathing normally under an anesthetic mask, using the SkyScan 1176 x-ray microtomography system equipped with a large format 11 megapixel x-ray camera (Small animal mo del imaging core facility, University of Manitoba). [score:1]
In order to evaluate the effect on downstream targets and associated pathways owing to loss of miR-200b on the lung tissue transcriptome, we performed Next Generation Sequencing (NGS) on total RNA samples from lungs of three 8-week-old miR-200b [−/−] mice and three miR-200 [+/+] (wt) mice. [score:1]
Like what we observed in fetal lungs, adult miR-200b [−/−] lungs had lower miR-200ba and miR-429 abundance, but no changes in miR-200c and miR-141 abundance (Supplementary Fig. 5). [score:1]
We then scanned three complete sections per lung of three miR-200b [+/+] and three miR-200 [−/−] lungs using an Axio Scan. [score:1]
Others have suggested a role for miR-200b in lung fibrosis before [21]. [score:1]
Taken together, the observed lung function abnormalities in miR-200b [−/−] mice can be due to a mesenchymal-skewed, “fibrosis”-like lung phenotype. [score:1]
We found that the surface tension-reducing capacity of surfactant in miR-200b [−/−] mice was markedly reduced (Fig.   2e), a finding that correlated with compromised labeling of Surfactant protein-B (SP-B) (Fig.   2f,g) and pro-Surfactant Protein-C (SP-C) in these lung tissues. [score:1]
Figure 4Next Generation Sequencing and Gene ontology (GO) showed the most affected pathways in the lungs of miR-200b [−/−] mice. [score:1]
We also observed lower miR-200a and miR-429 in kidney tissues of miR-200b [−/−] mice (Supplementary Fig. 6). [score:1]
These two miR-200 family members share the same transcript with miR-200b. [score:1]
Our lung morphometry studies corroborated these results by showing that the percentage of airspace in miR-200b [−/−] lungs was lower than in miR-200b [+/+] lungs. [score:1]
MiR-200b knockout (ko) mice have denser lung parenchyma (gray area in the peripheral area) and a lower number of distal airways (smaller distance between the large airways). [score:1]
Interestingly, this was not confirmed in our NGS studies of miR-200b [−/−] lungs. [score:1]
To examine if the absence of miR-200b influenced the expression of other family members and therefore contributed to the observed phenotype, we measured the abundance of all miR-200b family members in 8-week-old wt and miR-200b [−/−] lungs. [score:1]
We observed lower percentages of airspace in miR-200 [−/−] lungs (Fig.   3d). [score:1]
Immunofluorescence studies for vimentin showed that miR-200b [−/−] lungs have more vimentin -positive cells, suggesting an increased presence of fibroblasts-like, mesenchymal cells (Fig.   3c,d). [score:1]
Gene ontology analysis showed that different signaling pathways are affected by miR-200b absence. [score:1]
Figure 1Generation and validation of miR-200b [−/−] mice (miR200b [tm1.1(NCOM)MFGC]). [score:1]
Lower levels of Plunc can explain the increased elastance and airway resistance observed in the miR-200b [−/−] lungs. [score:1]
Genotyping data from breeding miR-200b [+/−] x miR-200b [+/−] mice revealed an expected Men delian distribution, indicating that these mice experience no embryonic lethality, and they were viable, fertile and appeared morphologically normal. [score:1]
[1 to 20 of 112 sentences]
3
[+] score: 241
The miR-200 target gene Zeb2 is down-regulated and E-cadherin is up-regulated in 4T1 cells. [score:9]
Over -expression of miR-200b and/or miR-200c in 4TO7 cells, either by transient transfection of miRNA mimics or infection with a miR-141-200c cluster -expressing retrovirus, led to a loss of Zeb2 expression, an increase in E-cadherin expression and the acquisition of an epithelial-like morphology. [score:9]
Over -expression of miR-200 in 4TO7 cells down-regulates Zeb2 expression, resulting in increased E-cadherin. [score:8]
Co-transfection of the reporter plasmid with miR-200b and/or 200c in the 4TO7 cells significantly reduced luciferase expression (∼5-fold, p<0.0002), confirming previous reports [30], [32], [35] that these miRNAs suppress Zeb2 expression by recognizing sites in its 3′-UTR (Figure 3B). [score:7]
The low expression of Zeb2 protein in 4T1 cells relative to 168FARN and 4TO7 cells is consistent with inhibition of Zeb2 translation by miR-200. [score:7]
Expression of miR-200, which promotes a mesenchymal to epithelial cell transition (MET) by inhibiting Zeb2 expression, unexpectedly enhances macroscopic metastases in mouse breast cancer cell lines. [score:7]
As a consequence of miR-200 expression, 4T1 cells have reduced Zeb2 expression and high E-cadherin expression compared to 4TO7 cells. [score:6]
The most prominent change in miRNA expression by microarray analysis between the three cell lines not able to colonize distant sites (67NR, 168FARN and 4TO7 cells) and 4T1 cells was up-regulation of several members of the miR-200 family in 4T1 cells (Figure 1A, Table S1). [score:6]
The TargetScan5.0 algorithm identified the zinc finger E-box binding homeobox 2 (Zeb2/SIP1/ZFXH1B) gene as the highest likelihood target gene of the miR-200 family with 6 potential miR-429/miR-200b/miR-200c binding sites and an additional 3 potential miR-141/miR-200a binding sites in its 3′UTR. [score:5]
Over -expression of miR-141 or miR-200b is associated with an increase in proliferation, while inhibition of these miRNAs impairs cell proliferation. [score:5]
Over -expressing either miR-200b or miR-200c or both led to a loss of Zeb2 expression and a concomitant increase in E-cadherin (Cdh1) levels (Figure 3A). [score:5]
Protein expression of Zeb2 protein negatively correlates and E-cadherin positively correlates with miR-200 expression. [score:5]
The effect of exogenous miR-200 expression on E-cadherin expression and cell morphology of 4TO7 cells was also analyzed by fluorescence microscopy (Figure 4). [score:5]
To determine whether a gene was also a predicted target of miR-200b and c, the presence of miR-200 family binding sites was analyzed using TargetScan 5.0 (www. [score:5]
miR-200 over -expression in 4TO7 cells reduces Zeb2 and Snai1 and increases E-cadherin expression. [score:5]
0007181.g003 Figure 3 (A) Zeb2 expression decreases and E-Cadherin (Cdh1) expression increases, analyzed by immunoblot relative to Gapdh, after transfection of 4TO7 cells with miR-200b and/or miR-200c. [score:5]
The cells incapable of colonization had very low to undetectable expression of all miR-200 family members, while 4T1 cells expressed miR-429, miR-200b and miR-200c. [score:5]
This miRNA -mediated silencing of Zeb2 was the result of the directed targeting of the Zeb2 3′UTR by the miR-200 family, as previously reported [30]– [37]. [score:4]
This up-regulation of miR-200 family members was particularly pronounced in serous and endometroid histotypes. [score:4]
To test the direct targeting of Zeb2 by miR-200, the complete Zeb2 3′-UTR was cloned downstream of a Renilla luciferase reporter gene. [score:4]
To determine whether miR-200 regulates Zeb2 and E-cadherin expression in these breast cancer cell lines, we transfected 4TO7 cells with mimics of miR-200b or miR-200c alone or in combination. [score:4]
The miR-200 family is up-regulated in 4T1 cells. [score:4]
4TO7 cells over -expressing miR-200 or knocked down for Zeb2 morphologically resembled 4T1 cells. [score:4]
No significant signal was detected for miR-200a and 141 (N. D.  = not detected), averaged signal for all samples below 500), but the remaining miR-200 family members were highly expressed in 4T1 cells relative to the less metastatic 67NR, 168FARN, and 4TO7 cells. [score:3]
In addition, over -expression of miR-141 and miR-200b correlates with resistance to gemcitabine treatment [55]. [score:3]
These findings are surprising since the miR-200 family was previously shown to promote epithelial characteristics by inhibiting the transcriptional repressor Zeb2 and thereby enhancing E-cadherin expression. [score:3]
Figure S1 The Zeb1 3′-UTR is a target of the miR-200 family of miRNAs. [score:3]
Moreover, over -expressing miR-200 in 4TO7 cells enabled them to metastasize to lung and liver. [score:3]
In fact, expression of miR-429, miR-200b and miR-200c was elevated in the highly metastatic 4T1 cells but absent from 4TO7 cells, which can perform all of the steps leading up to the establishment of lung metastases except establishing the secondary tumor. [score:3]
Based on the EMT hypothesis of cancer metastasis, it is expected that miR-200 expression would lead to a decrease in metastasis. [score:3]
Altering miR-200 or Zeb2 expression did not significantly change the number or size of colonies (Figure 6A, data not shown). [score:3]
Moreover, over -expression of the miR-200 family significantly correlated with decreased survival. [score:3]
Surprisingly, our results with this series of isogenic mouse mammary tumor cells showed the opposite effect - expression of miR-200 family members either endogenously in 4T1 cells or by retroviral transduction in 4TO7 cells enhanced both in vitro motility and in vivo metastases. [score:3]
We cannot rule out that some of the 4T1 or miR-200 -expressing 4TO7 cells transiently became E-cadherin- and more mesenchymal in vivo under the influence of local stromal factors. [score:3]
4T1 cells and miR-200 -expressing 4TO7 cells did not differ from parental 4TO7 cells in proliferative rate in vitro or growth in soft agar, but they both established primary tumors more rapidly and were capable of colonizing distant tissues. [score:3]
Transfection of miR-200b and/or miR-200c in 4TO7 cells increased E-cadherin expression, which also concentrated at cell junctions and shifted 4TO7 morphology from spindle-shaped cells to cobblestone-forming epithelial cells. [score:3]
Although highly homologous, the miR-200 family members (miR-141, miR-429, miR-200a, miR-200b and miR-200c) can be divided into two functional groups based on their seed sequences, nucleotides 2 to 7 of the miRNA, which play an important role in target recognition. [score:3]
miR-200 expression does not alter colony formation or cell proliferation, but enhances cell motility in vitro. [score:3]
0007181.g001 Figure 1 (A) miRNA microarray analysis of miR-200 family expression in 4 isogenic mouse breast cancer cell lines. [score:3]
The members of the miR-200 family of miRNAs (miR-200b, miR-200c and miR-429) were highly expressed in 4T1 cells but undetectable in 4TO7 cells. [score:3]
Higher expression of the miR-200 family in the cell line capable of forming distant metastases was unexpected since the miR-200 family has been linked to epithelial differentiation [30]– [36] that is normally associated with decreased metastatic potential. [score:3]
Exogenous miR-200 expression enhances the epithelial morphology of 4TO7 cells. [score:3]
4TO7 cells treated with either of the miR-200 mimics adopted an epithelial-like morphology and expressed high levels of E-cadherin, similar to the highly metastatic 4T1 cells. [score:3]
Croce and colleagues found that the miR-200 family (miR-200a, miR-200b, miR-200c and miR-141) were upregulated in human ovarian cancers compared to normal ovarian tissue [51]. [score:3]
miR-200 expression in 4TO7 cells confers in vivo metastatic potential. [score:3]
Transient over -expression of miR-200b and/or miR-200c in 4TO7 cells increased the number of migrating cells to that of 4T1 cells. [score:3]
These studies also showed that miR-200 expression enforces an epithelial phenotype in tumor cells, as we confirmed here in these mouse breast cancer cells. [score:3]
In addition, they are encoded from 2 gene clusters in mice - miR-200c and miR-141 on chromosome 6 and miR-200b, miR-200a and miR-429 on chromosome 4. In agreement with recent papers [30]– [37], we found that the miR-200 family members target the transcriptional repressor Zeb2. [score:3]
However, the 4T1 and miR-200 -expressing 4TO7 cells retained some vimentin expression, suggesting that they may have some characteristics of both epithelial and mesenchymal cells. [score:3]
Although there was a delay in detecting 4TO7 primary tumors relative to 4T1 or miR-200 -expressing 4TO7 tumors, once tumors became palpable, mathematical mo deling did not show any significant change in their doubling times (data not shown). [score:3]
Over -expression of miR-200 in 4TO7 cells converts fibroblastic cells to an epithelial morphology. [score:3]
In fact, the more epithelial 4T1 and miR-200 -expressing 4TO7 cells were better able to traverse an artificial basement membrane in vitro than their more mesenchymal relatives. [score:3]
Unlike Zeb2, Snai1 is not a predicted target of the miR-200 family. [score:3]
In addition, members of the miR-200 family of miRNAs, miR-141 and miR-200b, were found to be over-expressed in malignant cholangiocarcinoma cells compared to non-malignant cells [55]. [score:2]
MiR-200 family member expression distinguishes highly metastatic 4T1 cells from 67NR, 168FARN, and 4TO7 cells. [score:2]
4T1 cells that form macroscopic metastases had elevated expression of miR-200 family miRNAs compared to related cells that invade distant tissues, but are unable to colonize. [score:2]
Although this paper is the first to show the direct enhancement of metastasis by the miR-200 family, changes in miR-200 family levels have been associated with enhanced tumorigenesis. [score:2]
Expression of some members of the miR-200 family of miRNAs (miR-429, miR-200b, and miR-200c) was increased more than 100-fold in 4T1 cells compared to 4TO7 cells. [score:2]
We next performed transwell migration assays to determine the effect of miR-200b and miR-200c expression on the ability of 4TO7 cells to penetrate through an 8-µm porous membrane overlaid with basement membrane components (laminin, collagen IV, heparan sulfate proteoglycans, entactin/nidogen). [score:2]
In particular, it would be worthwhile to examine whether the miR-200 family might have a role in regulating the metastasis of different human breast cancer subtypes. [score:2]
The 2 groups differ by a single seed nucleotide - miR-200b, miR-429 and miR-200c share the 5′-AAUACU-3′seed sequence and miR-200a and miR-141 have the 5′-AACACU-3′ seed. [score:1]
Cells were co -transfected with psiCheck2 vector that contains the full length Zeb1 3′-UTR and with miR-200b and/or miR-200c miRNA mimics. [score:1]
To evaluate the effect of miR-200 and Zeb2 on tumor formation and metastasis, we next engineered retroviruses encoding the miR-141-200c cluster mature miRNAs or control virus expressing firefly luciferase shRNA or Zeb2 shRNA within the miR-30 stem. [score:1]
4TO7 and 4T1 cells were plated on glass cover slips and either left untreated or treated with miR-200b and/or miR-200c or a control miRNA mimic. [score:1]
0007181.g004 Figure 4 (A) Phase contrast microscopy of 4TO7 cells that were either mock treated or transfected with the miRNA control (ctl), miR-200b, or miR-200c mimic. [score:1]
4TO7 cells were co -transfected with the Zeb2 3′-UTR luciferase plasmid or a control vector and either the control (ctl), miR-200b and/or miR-200c miRNA mimics. [score:1]
4TO7 cells were transfected with miRNA mimics (miR-200b and/or miR-200c) (Dharmacon) or Zeb2 or firefly luciferase siRNAs using Lipofectamine 2000 (Invitrogen). [score:1]
Transfection of both miR-200b and miR-200c had no added effect, presumably because these miRNAs redundantly bind to the same miRNA recognition sites (MRE). [score:1]
miR-200 enhances 4TO7 cells migration through a basement membrane, but does not affect cell proliferation. [score:1]
[1 to 20 of 69 sentences]
4
[+] score: 240
Other miRNAs from this paper: mmu-mir-200a, mmu-mir-200c
The relevant regulatory mechanisms may be indirect because some of them are up-regulated on miR-200 overexpression, and even down-regulated genes lack miR-200 binding sites on their 3′-UTRs, with the exception of Tgfb2 [30]. [score:11]
Yellow: genes up-regulated by miR-200 overexpression; blue: genes down-regulated by miR-200 overexpression. [score:11]
miR-200 down-regulates Bmp4 through GATA4 and GATA6To identify the mediators of miR-200’s suppressive effect on Bmp4 expression, we first searched for putative transcriptional regulators that act on the Bmp4 promoter. [score:9]
ZEB1, a transcription suppressor of miR-200, enhanced Bmp4 expression in a low metastatic lung cancer cell line (393P), but miR-200 suppressed Bmp4 expression in 344SQ (Fig.   1c) and 531LN2 (Additional file 1: Figure S4), which was confirmed by (Fig.   1d). [score:9]
Transcriptional profiling revealed that expression of several cytokines/chemokines and their receptors is up- or down-regulated by miR-200 overexpression (Fig.   1a). [score:8]
miR-200 down-regulated BMP4 via direct targeting of the GATA4 and GATA6 transcription factors that stimulate Bmp4 transcription. [score:7]
Of interest, Jag2-KD suppressed Bmp4 mRNA expression (Fig.   6g), which may be mediated by enhancing the expression of miR-200 family members, especially, miR-200b/200a/429 (Fig.   6h). [score:7]
In addition, miR-200b repressed Gata4 and Gata6 mRNA expression in 344SQ cells (Fig.   2d), and ectopic GATA4 or GATA6 expression in 344SQ_miR-200 cells reinstated the Bmp4 mRNA level suppressed by miR-200 (Fig.   2e). [score:7]
Recently, we published our findings that the miR-200/ZEB1 negative-feedback loop regulates CD8 [+] tumor-infiltrating lymphocytes by directly targeting PD-L1 expression [29], which strongly supports the idea that modulation of the immune system is a prerequisite to cancer metastasis. [score:7]
Mean + SD, n = 3; p, two-tailed Student’s t-test In the present study, we showed that miR-200 suppresses BMP4 indirectly through the GATA4 and GATA6 transcription factors and that BMP4 knockdown inhibits cancer cell growth, migration, invasion, and metastasis. [score:7]
On the basis of these data, we propose that miR-200 down-regulates Bmp4 through direct targeting of its transcription factors, GATA4 and GATA6. [score:7]
To identify the mediators of miR-200’s suppressive effect on Bmp4 expression, we first searched for putative transcriptional regulators that act on the Bmp4 promoter. [score:6]
Indirect regulation by miR-200 could be achieved through targeting of transcription factors such as ZEB1 [8], ETS1 [31], and GATA4/6, as proposed herein, which would vastly expand miR-200’s regulatory network. [score:6]
Bmp4 is down-regulated in miR-200 -overexpressing cells. [score:6]
The effect of miR-200 on BMP4 expression may not be mediated via direct 3′ -untranslated region (UTR) binding because there is no putative miR-200 binding site on Bmp4’s 3′ -UTR (http://www. [score:6]
Up-regulation of BMP4 in metastatic-prone, mesenchymal lung cancer cells was first observed in our previous study, which aimed to identify the target genes of miR-200 systematically through a proteomic analysis coupled with stable isotope labeling by amino acids in cell culture (SILAC) and mass spectrometry [31]. [score:6]
org), and less chromosomal DNA of the Bmp4 promoter region was immunoprecipitated by an RNA polymerase II (Pol-II) antibody from 344SQ_miR-200 cells than from 344SQ_vec control cells (Fig.   1e), which clearly suggests transcriptional regulation of Bmp4 mRNA expression by miR-200 via indirect mechanisms. [score:5]
miR-200b and 200c suppressed Gata4 3′ -UTR activity, and miR-200a inhibited Gata6 3′ -UTR activity as reported previously [13], which were restored by mutating the miR-200 binding sites on their 3′-UTRs (Fig.   2b and 2c). [score:5]
Among hundreds of genes down-regulated by miR-200, we focused on bone morphogenetic protein 4 (BMP4), a member of the transforming growth factor β (TGF-β) superfamily, which is involved not only in early embryonic development but also in cellular growth, differentiation, and tumorigenesis [9]. [score:5]
Ectopic expression of a miR-200 cluster (miR-200b/200a/429) in a highly metastatic murine lung adenocarcinoma cell line (344SQ) blocks EMT and metastasis and induces global gene expression changes [6]. [score:5]
miR-200 down-regulates Bmp4 through GATA4 and GATA6. [score:4]
j Diagram of a regulatory loop involving BMP4, JAG2, and miR-200 To clarify the roles of BMP4 in lung tumorigenesis and metastasis, we analyzed the expression levels of Bmp4 mRNA and miR-200 family members in 13 KP cell lines (Fig.   1b and Additional file 1: Figure S1). [score:4]
ZEB1 and miR-200 form a double -negative feedback loop [7, 8] that plays a key role in determining the metastatic fate of epithelial cancers through the regulation of downstream target genes and microRNAs (miRNAs). [score:4]
BMP4 up-regulated JAG2, an upstream factor of miR-200; therefore,. [score:4]
In addition, Bmp4-KD increased miR-200b/200a/429 expression (Fig.   6i) by removing the negative regulator of miR-200, JAG2. [score:4]
We have clearly demonstrated here that BMP4 is indirectly suppressed by miR-200 and that BMP4 promotes tumor cell migration/invasion and metastasis. [score:4]
Previously, we reported that GATA factors are down-regulated by miR-200 [12, 13]. [score:4]
Based on these findings, we concluded that BMP4 is one of the key downstream factors that mediate miR-200’s effects on lung tumorigenesis and metastasis and is a candidate target for directed cancer therapy. [score:4]
MicroRNA-200 (miR-200) suppresses the epithelial-mesenchymal transition of various cancer cells, including lung adenocarcinoma cells. [score:3]
Expression of BMP4 is inversely correlated with that of miR-200. [score:3]
Mesenchymal-like cells exhibited higher Bmp4 mRNA expression than did epithelial-like cells, and Bmp4 tended to correlate negatively with miR-200 members. [score:3]
To clarify the roles of BMP4 in lung tumorigenesis and metastasis, we analyzed the expression levels of Bmp4 mRNA and miR-200 family members in 13 KP cell lines (Fig.   1b and Additional file 1: Figure S1). [score:3]
We found that bone morphogenetic protein 4 (BMP4) was decreased in miR-200 -overexpressing cells and epithelial-like lung cancer cells. [score:3]
To identify genes downstream of miR-200, we performed microarray -based transcriptional profiling in KP cells overexpressing a miR-200 cluster, miR-200b/200a/429 [6]. [score:3]
Promoter and 3′-untranslated region (UTR) luciferase reporter assays were performed to discover the mechanism of regulation of BMP4 by miR-200. [score:3]
j Diagram of a regulatory loop involving BMP4, JAG2, and miR-200 In this study, we investigated the function of BMP4, a TGF-β superfamily member, which is down-regulated by miR-200 in murine lung adenocarcinoma cell lines. [score:3]
Phase contrast microscope images of 3-D acini were taken 12 days after cell seeding We previously reported that JAG2, a Notch ligand, promotes lung adenocarcinoma metastasis by suppressing miR-200, which is mediated by GATA3 [12]. [score:3]
Similar to ectopic expression of miR-200, depletion of BMP4 also induced abnormal shape and multiple-lumen formation of 3-D acini (Fig.   4), which could be caused by misorientation of mitotic spindles [17, 18]. [score:3]
Fig. 2GATA4 and GATA6, transcription factors of BMP4, are miR-200 target genes. [score:3]
JAG2, miR-200, and BMP4 form a regulatory loop. [score:2]
BMP4 functions as a pro-tumorigenic factor in a murine lung cancer mo del, and its transcription is regulated by miR-200 and GATA4/6. [score:2]
Fig. 6JAG2, miR-200, and BMP4 form a regulatory loop. [score:2]
In addition, we integrated BMP4 into the JAG/Notch signaling pathway and proposed a regulatory loop consisting of JAG2, GATA3, miR-200, and BMP4 (Fig.   6h), suggesting that BMP4 interconnects with various cell signaling partners to induce tumorigenesis and metastasis in lung adenocarcinomas. [score:2]
From the tumors of these KRAS/p53-mutant mice (KP mice), we also established several murine lung cancer cell lines (KP cells) that exhibit various levels of metastatic potential mainly regulated by ZEB1 and microRNA-200 (miR-200) [6]. [score:2]
It is also noteworthy that miR-200 can regulate a variety of immune-related genes, including cytokines (e. g., Il11, Ifna1, Csf1, Tgfb2, Il7), chemokines (e. g., Cxcl12, Ccl6, Cxcl7), and their receptors (e. g., Tlr12, Lepr, Tlr1) (Fig.   1a). [score:2]
Collectively, we propose a regulatory loop comprising JAG2, GATA3, miR-200, GATA4/6, and BMP4 (Fig.   6j). [score:2]
Similarly, 344SQ_miR-200 cells formed irregular acini with multiple lumens (Fig.   4c), suggesting that the miR-200/BMP4 pathway regulates normal acinus formation in Matrigel 3-D culture. [score:2]
In summary, BMP4 functions as a pro-tumorigenic factor in a murine lung cancer mo del and is regulated by miR-200 and GATA4/6. [score:2]
Mean + SD, n = 3; p, two-tailed Student’s t-test Bmp4 knockdown suppresses migration, invasion, tumorigenesis, and metastasis of lung cancer cellsNext, to investigate the biological role of Bmp4 repression by miR-200, we depleted BMP4 in 344SQ cells (Fig.   3a) and H157 human lung cancer cells (Additional file 1: Figure S5A) by stable transfection of shRNAs. [score:2]
The miR-200b/200a/429 cluster seems to be more influenced by BMP4–JAG2–GATA3 pathway than the miR-200c/141 cluster, which might be caused by differential binding preference of transcription factors and co-regulators. [score:2]
Similar negative correlations between Bmp4 and miR-200 members were also observed in human lung adenocarcinomas and breast invasive carcinomas (Additional file 1: Figure S2 and S3). [score:1]
Negative correlation between BMP4 and miR-200 family members in human lung adenocarcinomas. [score:1]
Negative correlation between Bmp4 and miR-200 family members in murine lung adenocarcinoma cells. [score:1]
3′-UTR reporters (500 ng) and pGL3-control (50 ng, Promega) were co -transfected into 344SQ cells seeded on 24-well plates (1x10 [5] cells/well) in the presence or absence of Pre-miR™ miR-200 precursors (5 nM, Ambion). [score:1]
i qRT-PCR of miR-200 family members in 344SQ-NTC and Bmp4-KD (#2 and #3) cells. [score:1]
BMP4 miR-200 Lung cancer Metastasis Lung cancer is the leading cause of cancer-related death in both men and women worldwide [1]. [score:1]
Interestingly, Gata4 and Gata6 have conserved miR-200 binding sites on their 3′-UTRs: Gata4 has a miR-200b/200c/429 site and Gata6 has a miR-200a/141 site (http://www. [score:1]
To test for direct interaction between miR-200 and these 3′-UTRs, we made Gata4 and Gata6 3′ -UTR reporter constructs and performed luciferase assays after co-transfection with miR-200 mimics. [score:1]
Blue: DAPI, red: β-catenin, green: ZO-1. c Matrigel 3-D culture of 344SQ_vec and miR-200 cells. [score:1]
Negative correlation between BMP4 and miR-200 family members in human breast invasive carcinomas. [score:1]
d qRT-PCR of Gata4, Gata6, and Zeb1 in 344SQ cells transfected transiently with control (con) or miR-200b mimic. [score:1]
h qRT-PCR of miR-200 family members (200a, 200b, 200c, 141, and 429) in 344SQ- Jag2-KD and 344SQ-NTC. [score:1]
344SQ cells were co -transfected with control (con) or miR-200 mimics and 3′-UTR reporter constructs. [score:1]
[1 to 20 of 63 sentences]
5
[+] score: 207
Importantly, overexpression of miR-200b in MDA-MB-231 and 4T1 cells inhibited Kindlin-2 expression, concomitant with downregulation of EMT genes, while it also resulted in a significant reduction of the metastatic burden in vivo. [score:10]
Mechanistically, we found the Kindlin-2 regulation of EMT is mediated through microRNA miR-200b, an established master regulator of EMT 9, 14. miR-200b specifically targets and regulates Kindlin-2 expression through a conserved seed sequence in the 3′UTR in both the human and mouse FERM2 genes, and expression levels of miR-200b inversely correlate with that of Kindlin-2 and with the aggressiveness of BC cell lines. [score:10]
In addition, targeting and inhibition of Kindlin-2 by miR-200b in BC also resulted in the regulation of the EMT program leading to the inhibition of BC invasion and metastasis in vivo. [score:8]
Our study revealed similar activity of miR-200b in BC by targeting Kindlin-2 in vitro; loss of adhesion and spreading, inhibition of focal adhesion formation, and inhibition of invadopodia and extracellular degradation. [score:7]
Thus, miR-200b specifically binds to its target sequence within the 3′UTR of Kindlin-2 and inhibits its expression. [score:7]
Figure 6The miR-200b -mediated downregulation of Kindlin-2 inhibits BC metastasis. [score:6]
The miR-200b -mediated downregulation of Kindlin-2 inhibits BC metastasis. [score:6]
Korpal M Lee ES Hu G Kang Y The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2J Biol Chem. [score:6]
In fact, the miR-200 microRNAs have been established as master regulators of the EMT program in both physiological and pathological conditions 19, 21, 27, 31. miR-200b was recently shown to suppress invasiveness and to modulate the cytoskeletal and adhesive machinery by targeting Kindlin-2 in oesophageal squamous cell carcinoma cells [32]. [score:6]
Zhang HF miR-200b suppresses invasiveness and modulates the cytoskeletal and adhesive machinery in esophageal squamous cell carcinoma cells via targeting Kindlin-2Carcinogenesis. [score:5]
Expression levels of N-Cadherin, Fibronectin and Vimentin were significantly downregulated (p < 0.05) in the tumours derived from the miR-200b-overexressing MDA-MB-231 (miR200) cells compared to the tumours from the control (Scram) counterparts (Fig.   6F–H, respectively). [score:5]
Finally, we assessed the effect of overexpression of miR-200b on expression of EMT markers in the tumours using qt-RT-PCR. [score:5]
MDA-MB-231 cells, which express very low levels of miR-200b, were engineered to express a pmirGlo construct where the wild-type form of Kindlin-2 3′-UTR (Wild-type K2-3′UTR) was subcloned upstream of the luciferase gene (231-wild-type K2-3′UTR). [score:5]
In silico analyses, using several microRNA prediction algorithms (Target Scan, miRanda and PITA), identified microRNA miR-200b as one of the top predicted microRNAs that targets Kindlin-2 (Fig.   5A). [score:5]
Thus, inhibition of Kindlin-2 expression is induced by miR-200b. [score:5]
Overexpression of miR-200b slowed the growth of primary tumours; at the 5-week time point when all the primary tumours were removed, the average volume of the tumours derived from the miR-200 -overexpressing MDA-MB-231 cells (miR200b) was more than 3-fold less (p < 0.01) than those derived from the control (Scram) cells (Fig.   6A). [score:5]
We found the amounts of human DNA present in the lungs of mice injected with the miR-200b-overexpressin MDA-MB-231 (miR200b) to be more that 120-fold less than in the control (Scram) counterparts (Fig.   6D), confirming the inhibitory effect of miR-200b on metastasis. [score:5]
First, we quantified the expression levels of Kindlin-2 and miR-200b in representative BC cell lines, and found Kindlin-2 expression levels to be low in the non-aggressive MCF7 and SKBR3 cells while it was comparatively high in the more aggressive and metastatic BT549 and MDA-MB-231 cells (Fig.   5B). [score:5]
We showed that (i) Kindlin-2 enhances tumour cell adhesion and spreading, as well as formation of focal adhesion complexes; (ii) Kindlin-2 activates the formation of invadopodia structures that are required for the degradation of the ECM; (iii) in in vivo mouse mo dels, Kindlin-2 is required for the spreading and metastasis of BC tumours; (iv) the extent of tumour metastasis depends on the activation of the EMT program as measured by the expression of EMT markers; and (v) the Kindlin-2 -mediated regulation of the EMT program depends on the capacity of miR-200b to regulate the expression levels of Kindlin-2 in tumour cells. [score:5]
Figure 5Kindlin-2 is a direct target of microRNA miR-200b. [score:4]
Gregory PA The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat Cell Biol. [score:4]
Having demonstrated that miR-200b specifically targets and inhibits Kindlin-2 expression in vitro, we extended our investigation to in vivo setting in the spontaneous metastasis assay. [score:4]
Kindlin-2 is a direct target of microRNA miR-200b. [score:4]
Collectively, our data provide the underpinnings of a new signalling axis, in which miR-200b regulates Kindlin-2, which in turn regulates EMT, thereby suggesting a novel role of Kindlin-2 in the regulation of BC progression and metastasis. [score:4]
Conversely, when we transfected MCF7, a cell line that expresses high levels of miR-200b, with anti-miR-200b oligonucleotides (Fig.   5F), we observed a ~2-fold increase (p < 0.05) in Kindlin-2 transcript levels compared to the parental MCF7 cells or MCF7 cells transfected with the non -targeting microRNA (NT-miR). [score:4]
MDA-MB-231 cells with stable expression of miR-200b mimics or a scrambled control were injected into the mammary fat pads NSG mice and the metastasis burden was assessed 3 weeks after resection of the primary tumours by quantifying the number of lung metastasis foci. [score:3]
For co-transfection experiments, microRNA mimics or miR negative control (5 nM) or anti-miR200b microRNA inhibitor or anti-miR negative control (20 nM) were added to the transfection mix. [score:3]
Mutation of the seed sequence of miR-200b in the 3′-UTR of K2 (K2 3′UTR with scrambled miR-200 seed sequence) abrogated the effect of the exogenous miR-200b (Fig.   5H); the levels of luciferase activity did not show any significant difference when compared to the control cells or those treated with the non -targeting microRNA (Fig.   5H). [score:3]
To verify that miR-200b represses expression of Kindlin-2 by binding directly to Kindlin-2 transcripts, we used a luciferase gene reporter assay (pmirGlo [25]). [score:3]
Together, these data demonstrate that Kindlin-2 modulates the growth and metastasis of BC tumours through the regulation of the EMT program and this regulation takes place downstream of miR-200b microRNA. [score:3]
Of note, expression levels of miR-200b in these cell lines showed an inverse pattern: High in MCF7 and SKBR3, and low in BT549 and MDA-MB-231 cells (Fig.   5C). [score:3]
Thus, we demonstrate an inverse correlation between Kindlin-2 and miR-200b in the aggressive and mesenchymal BC cells vs their non-aggressive and epithelial counterparts, which strongly suggest the involvement of Kindlin-2 in the miR-200b -mediated regulation of the EMT and that miR-200b is involved in the regulation of Kindlin-2 during this process. [score:3]
Park SM Gaur AB Lengyel E Peter ME The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2Genes Dev. [score:3]
In fact we showed that the seed sequence of miR-200b is a perfect match to a target sequence in the 3′UTR of Kindlin-2 (Fig.   5A). [score:3]
These cells remained either untreated (Ctrl) or transfected with either a non -targeting micro -RNA (NT-miR) or the miR-200b mimics (miR200). [score:3]
Next, using both western blot (Fig.   5E) and qRT-PCR (Fig.   5F) analyses, we showed that transient transfection of MDA-MB-231 cells with miR-200b resulted in ~60% knockdown (p < 0.05) of Kindlin-2 protein levels (Fig.   5E), compared to the parental cells or those transfected with non -targeting microRNA (NT-miR). [score:3]
Further reinforcing our focus on miR-200b as a potential regulator of Kindlin-2 in BC are published findings that this microRNA is a master regulator of EMT in several cancer types 14, 19– 21. [score:3]
The present study demonstrated that Kindlin-2 function is involved in the enhancement of BC metastasis by regulating the EMT program downstream of microRNA miR-200b. [score:2]
qt-RT-PCR analyses of total RNA from the primary tumours showed that Kindlin-2 mRNA levels were significantly lower in the tumours derived from the miR-200b -expressing MDA-MB-231 (miR200) cells (Fig.   6E) compared to those derived from the control (Scram) counterparts. [score:2]
The miR-200b/Kindlin-2/EMT signalling axis may not be the only mechanisms through which Kindlin-2 regulates cancer metastasis. [score:2]
miR-200b showed a negative correlation: its expression levels were more that 5-fold lower in the 4T07 cells compared to 67NR and was almost undetectable in the 4T1 cells. [score:2]
This study demonstrates that Kindlin-2 supports BC metastasis and does so at least in part by regulating the EMT program downstream of microRNA miR-200b. [score:2]
In the present study, we show that Kindlin-2 is also involved in the process of BC metastatic colonization to the lung by regulating the EMT program downstream of miR-200b. [score:2]
Sossey-Alaoui K Bialkowska K Plow EF The miR200 family of microRNAs regulates WAVE3 -dependent cancer cell invasionJ Biol Chem. [score:2]
Therefore, our study together with the data published by Yu et al. [33] show that EMT and the resultant invasion metastasis cascade in BC seems to be regulated trough a miR-200b/Kindlin-2 feedback loop. [score:2]
We used the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA), as per the manufacturer’s instructions, to generate the K2 3′-UTR variants, where seed sequences that are recognized by miR200 microRNA were deleted. [score:2]
Thus, we have established a miR-200b ⇔ Kindlin-2 signalling axis as key regulator of the EMT program, which in turn modulates BC tumours progression and metastasis. [score:2]
More importantly the number of lung metastasis foci was reduced by ~4-fold (p < 0.01) in the mice injected with the miR-200b -overexpressing MDA-MB-231 cells (miR200b), compared to their control (Scram) counterparts (Fig.   6B,C). [score:2]
Burk U A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cellsEMBO Rep. [score:1]
Kindlin-2 was also reported to promote BC invasion through epigenetic silencing of members of the miR-200 gene family [33]. [score:1]
In contrast, transfection of the 231-wild-type K2-3′UTR cells with miR-200b mimics (miR200) resulted in ~60% reduction (p < 0.05) in luciferase activity (Fig.   5G). [score:1]
Spaderna S Brabletz T Opitz OG The miR-200 family: central player for gain and loss of the epithelial phenotypeGastroenterology. [score:1]
On the other hand, anti-miR-200b had no significant effect on Kindlin-2 protein levels (Fig.   5E). [score:1]
Korpal M Kang Y The emerging role of miR-200 family of microRNAs in epithelial-mesenchymal transition and cancer metastasisRNA Biol. [score:1]
The nucleotide sequence and location of the seed sequence with respect to the 3′UTR is shown, as well as its alignment with the miR-200b sequence. [score:1]
The miR-200 family is no stranger to EMT. [score:1]
In fact, miR-200b was almost undetectable in these aggressive BC cell lines, which are of mesenchymal phenotype 22, 23, while it was abundant in the MCF7 and SKBR3 which are of epithelial phenotype (Fig.   5C) 22, 23. [score:1]
[1 to 20 of 57 sentences]
6
[+] score: 204
Interestingly, miR-200b levels were notably decreased after E2F3b up-regulation in SPC-A1 and H1299 cells (p<0.01), while few changes were observed after E2F3a up-regulation (Figure 2B). [score:7]
According to our results, up-regulation of miR-200b or down-regulation of E2F3b could not only enhance docetaxel-resistant LAD cell apoptosis but also arrest cells at G2/M phase, suggesting a stonger mitotic checkpoint and a lower threshold of apoptosis activation brought by the miR-200b/E2F3 feedback loop. [score:7]
In SPC-A1/DTX and H1299/ DTX cells, down-regulation of E2F3b significantly lessened the colony formation amount, and the effect could also be partially reversed by miR-200b inhibitor introduction (p<0.01) (Figure 5C). [score:6]
Coincide with our previous study, the expression levels of miR-200b were enormously down-regulated in both SPC-A1/DTX and H1299/DTX cells in comparison with the parental SPC-A1 and H1299 cells, respectively (p<0.01) (Figure 2A). [score:6]
In both SPC-A1 and H1299 cells, introduction of E2F3b, not E2F3a, resulted in a pronounced up-regulation of miR-200b expression (p<0.01). [score:6]
E2F3b negatively regulates miR-200b expression and docetaxel chemosensitivity of LAD cells in vitroReal-time quantitative RT-PCT (qRT-PCR) and Western Blot analysis showed that E2F3a and E2F3b levels were notably up-regulated at both mRNA and protein levels in docetaxel-resistant LAD cells compared with the parental cell lines (p<0.01) (Figure 3A). [score:6]
The above results suggested that E2F3b, rather than E2F3a, could negatively regulate miR-200b expression and docetaxel chemosensitivity of LAD cells through direct binding upon miR-200b gene. [score:5]
Moreover, when the binding sequences were mutated, the suppressive effects of E2F3b on luciferase activity were attenuated (Figure 2E), suggesting the direct negative regulation of E2F3b on the promoter region of miR-200b. [score:5]
Quantifications of miR-200b expression in docetaxel-resistant LAD cells (SPC-A1/DTX and H1299/DTX) and their parental cells (SPC-A1 and H1299) before A. and after B. manipulated E2F3a and E2F3b expressions were achieved by qRT-PCR. [score:5]
In addition, miR-200b expression levels were remarkably up-regulated in pSil/shE2F3 groups compared with the control groups in both SPC-A1 (p<0.05) and SPC-A1/DTX cells (p<0.01) via qRT-PCR (Figure 6C). [score:5]
Figure 2Quantifications of miR-200b expression in docetaxel-resistant LAD cells (SPC-A1/DTX and H1299/DTX) and their parental cells (SPC-A1 and H1299) before A. and after B. manipulated E2F3a and E2F3b expressions were achieved by qRT-PCR. [score:5]
Peng et al. reported that miR-200 and its targets Sox2 and E2F3 were engaged in an unilateral negative feedback loop to direct cell-cycle exit and differentiation of neural progenitors [42]. [score:4]
Restoration of miR-200b could boost in vitro and in vivo chemosensitivity of LAD cells by, at least partially, post-transcriptional down-regulation of E2F3, which was critical for the maintenance of normal cell cycle progression [21]. [score:4]
E2F3b negatively regulates miR-200b expression and docetaxel chemosensitivity of LAD cells in vitro. [score:4]
E2F3b negatively regulates miR-200b expression and docetaxel chemosensitivity of LAD cells in vivoTo better understand the biological mechanisms underlying E2F3b-related docetaxel resistance of LAD cells in vivo, pSil/shE2F3 and pSil/shE2F3-NC–transfected SPC-A1 and SPC-A1/DTX cells were subcutaneously inoculated into nude mice. [score:4]
Figure 5The role of miR-200b in the in vitro regulation of E2F3b on LAD cellsPcDNA-NC, pcDNA/E2F3b vectors were transfected into SPC-A1 and H1299 cells without (or with) previous transfection of miR-200b mimics; sh-NC, pSil/shE2F3 vectors were transfected into SPC-A1/DTX and H1299/DTX cells without (or with) previous transfection of miR-200b inhibitors. [score:4]
On the other hand, in both SPC-A1/DTX and H1299/DTX cells, miR-200b expression levels were significantly increased after artificial knockout of E2F3 gene (p<0.01) (Figure 3C). [score:4]
The primers used for pSil/shE2F3-1∼3 and pSil/shcontrol were presented in Supplementary Table 1. MiR-200b mimics, miR-200b mimics control, miR-200b inhibitor, and miR-200b inhibitor control were all purchased from GenePharma (Shanghai, China). [score:4]
E2F3b negatively regulates miR-200b expression and docetaxel chemosensitivity of LAD cells in vivo. [score:4]
The regulation of E2F3a/b on miR-200b expression and chemosensitivity of LAD cells. [score:4]
Now we further demonstrate that miR-200b expression is negatively regulated by E2F3b, suggesting a double -negative feedback loop between E2F3b and miR-200b, which could be a potential mechanism for reversing chemoresistance of LAD. [score:4]
Cell cycle analysis showed that up-regulation of E2F3b dramatically decreased the percentage of cells in G2/M phase in SPC-A1 and H1299 cells, which could be partially reversed by miR-200b introduction (p<0.01), vice versa in SPC-A1/DTX and H1299/DTX cells (p<0.01) (Figure 5E). [score:4]
Based on our previous study, E2F3 was validated as a direct target of miR-200b [21]. [score:4]
The primers used for pSil/shE2F3-1∼3 and pSil/shcontrol were presented in Supplementary Table 1. MiR-200b mimics, miR-200b mimics control, miR-200b inhibitor, and miR-200b inhibitor control were all purchased from GenePharma (Shanghai, China). [score:4]
The sequence of miR-200b inhibitor was 5′-UCAUCAUUACCAGGCA GUAUUA-3′. [score:3]
Based on our previous miRNA microarray data, miR-200b was identified as the most down-regulated miRNA in docetaxel-resistant human lung adenocarcinoma (LAD) SPC-A1/DTX cells compared with parental SPC-A1 cells [20]. [score:3]
In detail, pcDNA-NC, pcDNA/E2F3b vectors were transfected into SPC-A1 and H1299 cells without (or with) previous transfection of miR-200b mimics; sh-NC, pSil/shE2F3 vectors were transfected into SPC-A1/DTX and H1299/DTX cells without (or with) previous transfection of miR-200b inhibitors. [score:3]
C. Quantifications of miR-200b expression in different manipulated LAD cell lines as indicated was also achieved by qRT-PCR. [score:3]
The miRNA 200 family members, consisting of miR-200b, miR-200c, miR-429, miR-200a and miR-141, were considered to be tumor suppressor miRNAs in cancer development and progression [25, 26]. [score:3]
The in vivo effects of E2F3b on miR-200b expression and chemosensitivity of LAD cells. [score:3]
The augment of E2F3b significantly suppressed the luciferase activity of miR-200b luciferase promoter constructs (p<0.01). [score:3]
Figure 6The in vivo effects of E2F3b on miR-200b expression and chemosensitivity of LAD cellsSPC-A1 and SPC-A1/DTX cells were transfected with pSil/shE2F3 or pSil/shE2F3-NC and injected subcutaneously into nude mice. [score:3]
A. Quantification of miR-200b expression was achieved by qRT-PCR. [score:3]
Similarly, the increased colony formation capacity of SPC-A1 and H1299 cells owing to overexpression of E2F3b could be decayed after miR-200b mimics introduction. [score:3]
PcDNA-NC, pcDNA/E2F3b vectors were transfected into SPC-A1 and H1299 cells without (or with) previous transfection of miR-200b mimics; sh-NC, pSil/shE2F3 vectors were transfected into SPC-A1/DTX and H1299/DTX cells without (or with) previous transfection of miR-200b inhibitors. [score:3]
This anti-apoptotic effect was also observed after co-transfection of pSil/shE2F3and miR-200b inhibitors in docetaxel-resistant LAD cells (p<0.01) (Figure 5D). [score:3]
In conclusion, we describe here a novel mechanism in which E2F3b and miR-200b each suppresses the other, suggesting a novel functional double -negative feedback loop. [score:3]
Functional identification of the direct binding of E2F3b upon miR-200b gene. [score:2]
For instance, the regulatory feedback loops such as Notch/miR-326 [32], E2F1/miRNA-223 [33], NF-κB/miR-200b [34], ZEB/miR-200 [22], p53/miR-200 [35] and C/EBPα-miR-34a-E2F3 [36] have been illuminated their molecular networks one after another. [score:2]
S-M Ahn et al. concluded that Smad3 could directly bind to a Smad -binding element located in the promoter region of miR-200b/a and function as a transcriptional activator [29]. [score:2]
Previous studies have explored some possible mechanisms of miR-200 dysregulation in cancer cells at both transcription and epigenetic modification levels. [score:2]
It was found that inhibition of E2F3 significantly elevated the levels of miR-200b in both SPC-A1/DTX and H1299/DTX cells compared with the control groups (p<0.01). [score:2]
QRT-PCR results indicated that the negative regulation of E2F3b upon miR-200b in SPC-A1 and H1299 cells could be abolished by co-transfection of miR-200b mimics, vice versa in SPC-A1/DTX and H1299/DTX cells (p<0.01) (Figure 5A). [score:2]
To further confirm the direct binding and function of E2F3b upon miR-200b, both wild and mutated miR-200b promoter sequences (towards P1 and P2, respectively) were designed and cloned into the pGL4 basic firefly luciferase reporters and co -transfected with E2F3b plasmid vectors into SPC-A1 and SPC-A1/DTX cells (Figure 2D). [score:2]
For instance, Bracken CP et al. showed that ZEB1 and SIP1 could negatively regulate miR-200b∼200a∼429 transcription in Madin-Darby canine kidney (MDCK) cells and human breast cancer cells by binding paired E-box sites [22]. [score:2]
Functional evidence of the direct binding of E2F3b upon miR-200b gene. [score:2]
Bioinformatical evidence of the direct binding of E2F3 upon miR-200b gene. [score:2]
D. Schematic representation of miR-200b gene promoter with the putative E2F3b -binding sites and the sequences of the point mutations. [score:2]
The role of miR-200b in the in vitro regulation of E2F3b on LAD cells. [score:2]
Bioinformatical identification of the direct binding of E2F3 upon miR-200b gene. [score:2]
The results of the present study confirmed the existance of this feedback loop and showed, for the first time, that the double -negative feedback loop between E2F3b and miR-200b could regulate docetaxel chemosensitivity of human LAD cells mainly through cell proliferation, cell cycle distribution and apoptosis. [score:2]
Artificial controls on this circuit through ectopic miR-200b delivery or E2F3b knockoff may be potential reversal strategies in overcoming lung cancer chemoresistance. [score:2]
MiR-200b inhibitor/NC sequence was 5′-UUCUCCGAACGUGUCACGUTT-3′. [score:2]
Moreover, E2F3 was bioinformatically identified as a potential transcriptional regulator of pre-miR-200b gene promoter, suggesting a double -negative feedback minicircuitry comprising E2F3b and miR-200b. [score:2]
E2F3b exerts in vitro functions in a miR-200b -dependent manner in LAD cells. [score:1]
Intriguingly, the increasing effects of E2F3b on the IC50 values for docetaxel could be partially abrogated by co-transfection of miR-200b mimics in SPC-A1 and H1299 cells (p<0.01), vice versa in SPC-A1/DTX and H1299/DTX cells (p<0.01) (Figure 5B). [score:1]
edu/tools/CoreBoost_HM/), two separated promoters (P1 and P2) of miR-200b were identified 4.5 kb and 2 kb upstream the miR-200b gene, respectively (Figure 1A), which was in accordance with previous studies [22, 23]. [score:1]
To determine whether E2F3 could directly interact with miR-200b promoter, chromatin immunoprecipitation (ChIP) assay was applied. [score:1]
C. Quantification of miR-200b in the transplanted tumor tissues by qRT-PCR. [score:1]
On miR-200b/E2F3 signaling pathway [21], E2F3 is a member of the transcription factor E2F family and has two distinct isoforms, E2F3a and E2F3b, which share DNA binding, heterodimerisation and pocket protein binding domains and differ only in their N-termini [37]. [score:1]
Emily C. Knouf et al. identified p73 and p63 as activators of miR-200 family transcription [28]. [score:1]
It was therefore concluded that E2F3b affected cell proliferation, apoptosis, cell cycle distribution, and docetaxel chemosensitivity of LAD cells in vitro, at least partially, in a miR-200b -dependent manner. [score:1]
edu/tools/CoreBoost_HM/) on-line analysis was used to identify the promoter regions of miR-200b (named as P1 and P2). [score:1]
6 and 7 primers corresponding areas within the promoter site of miR-200b, while in SPC-A1/DTX cells, E2F3 regulation site was only located in no. [score:1]
Furthermore, immunostaining analysis and TUNEL staining revealed a lower positive rate of proliferating cell nuclear antigen (PCNA) and Ki67 as well as a higher apoptotic rate of tumors formed from pSil/shE2F3 transfected LAD cells in comparison with the control groups (Figure 6D), suggesting the critical role of E2F3b/miR-200b axis in modulating chemosensitivity of docetaxel-resistant LAD cells in vivo. [score:1]
no:8090/cgi-bin/CONSITE/consite) on-line softwares were performed to find the potential E2F3 binding sites in miR-200b promoter. [score:1]
To determine whether E2F3b affected LAD cell proliferation, apoptosis, and cell cycle distribution in a miR-200b -dependent manner, rescue experiments were performed. [score:1]
Among them, miR-200b was validated as a chemosensitivity restorer in cancers including NSCLC, mainly via signaling pathways of epithelial-mesenchymal transition (EMT), cancer stem cell self-renewal, angiogenesis, cell cycle distribution, and apoptosis [12, 27]. [score:1]
The pLUC firefly luciferase vectors contained empty, wild-type, and mutant miR-200b 3′-UTR sequence, respectively. [score:1]
E2F3b exerts in vitro functions in a miR-200b -dependent manner in LAD cellsTo determine whether E2F3b affected LAD cell proliferation, apoptosis, and cell cycle distribution in a miR-200b -dependent manner, rescue experiments were performed. [score:1]
[1 to 20 of 70 sentences]
7
[+] score: 198
While some downregulated miRNAs were observed, we focused on the significantly upregulated miR-200 family members (miR-141, -200a, -200b, -200c, and -429) and the miR-183 family members (miR-96, -182, and -183), which had higher expression levels in 10-month-old Tg2576 mice (fold-change > 2.0, unpaired Student’s t-test; p < 0.05; Fig 1A). [score:9]
In conclusion, miR-200b/c -targeted inhibition of S6K1 expression might contribute to a reduction in Aβ secretion and/or Aβ–induced spatial memory impairment by promoting activation of the insulin signaling pathway in AD mo dels. [score:7]
Although their diminished levels did not correspond with the number of target sites or scores predicted from the 3'-UTR sequence in silico, all candidate genes were demonstrated to have direct target sites for miR-200b or miR-200c. [score:6]
Taken together, we speculate that miR-200b and miR-200c expression in neuronal cells has the potential to suppress the cytotoxic damage caused by Aβ, especially Aβ1–42, in the early stages of AD by regulating Aβ secretion. [score:6]
Both miR-200b and miR-200c expression levels in PMNCs were markedly increased by Aβ1–42 stimulation after 36 h of treatment, and the peak in the elevation of miRNA expression was observed at 72 h, with a six-fold increase being found (Fig 2A). [score:5]
This could include downstream genes of target genes post-transcriptionally inhibited by miR-200b or miR-200c. [score:5]
The findings from our in vitro study suggest that miR-200b and/or miR-200c targeting of S6K1 could suppress Aβ generation through amelioration of insulin resistance. [score:5]
Effect of miR-200b and miR-200c on Aβ -induced toxicity in vitroTo verify whether expression of miR-200b and miR-200c are altered in response to the neuronal damage induced by Aβ1–42, we treated PMNCs with Aβ1–42 peptides and examined miRNA expression levels using qRT-PCR. [score:5]
After 48 h, using Lipofectamine 3000 (Invitrogen), the cells were co -transfected with 25 nM pre-miR-200b, -200c, or NC (Ambion) and with 0.5 μg of pEZX-MT01 plasmid (GeneCopoeia, Rockville, MD, USA) expressing the 3'-UTR target sequence clone, ribosomal protein S6 kinase B1 (S6K1; cat no. [score:5]
The above-mentioned network consisted of differentially expressed genes in 10-month-old Tg2576 mouse cortex presenting highly expression of miR-200 family (Fig 1C). [score:5]
To verify whether expression of miR-200b and miR-200c are altered in response to the neuronal damage induced by Aβ1–42, we treated PMNCs with Aβ1–42 peptides and examined miRNA expression levels using qRT-PCR. [score:5]
To elucidate the miR-200b and miR-200c signaling pathways involved in Aβ -induced toxicity, we explored their direct targets using RIP-Chip. [score:4]
The marked upregulation of members of the miR-200 family was confined to the phase of increasing Aβ deposition, and disappeared in the plateau phase (17-month-old mice). [score:4]
In this study, we showed that miR-200 family members were upregulated in the cortices of 10-month-old Tg2576 mice, which might bring about compensative effects in relation to Aβ -induced toxicity. [score:4]
First, using in vitro mo dels, we successfully reproduced the Aβ -induced upregulation of miR-200b and -200c in the media of cultured neurons. [score:4]
analysis for anti-phospho IRS-1 on serine (S) 302/307, S307/312, S636/639, and S1097/1101 revealed that downstream regulation of S6K1 was inhibited by miR-200b and miR-200c. [score:4]
data showed that ZEB1 was clearly downregulated in miR-200b and miR-200c transfected SH-SY5Y cells (Fig 4C). [score:4]
0196929.g005 Fig 5 analysis for anti-phospho IRS-1 on serine (S) 302/307, S307/312, S636/639, and S1097/1101 revealed that downstream regulation of S6K1 was inhibited by miR-200b and miR-200c. [score:4]
The miRNAs that were upregulated were members of the miR-200 and miR-183 families. [score:4]
Growing evidence indicates that the miR-200 family is involved in cancer cell migration via the targeting of ZEB1 and ZEB2 [45– 48]. [score:3]
In the oAβ group, miR-200b/c -treated mice spent significantly more time in the target quadrant than by chance (p < 0.01), although NC -treated mice spent a similar amount of time in all quadrants (p = 0.72). [score:3]
A total of 171 and 204 genes were immunoprecipitated as candidate targets of miR-200b and miR-200c, respectively (fold-change > 2.0, t-test; p < 0.05; S1 Table). [score:3]
The results for miR-200b (left) and miR-200c (right) are shown as expression of miRNA in the treated sample relative to that of the DMSO treated control sample at each time point. [score:3]
We used ZEB1, which has been shown to be a target for miR-200b and miR-200c, as a positive control in these experiments. [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
Intriguingly, miR-8 in flies (homologous to miR-200 in mammals) has been revealed to target FOG2, which binds to a subunit of PI3K and activates insulin signaling [51]. [score:3]
Based on the results from the gene expression assay and protein assays, S6K1 was a plausible target for miR-200b and/or -200c. [score:3]
We infused the miRNA-Invivofectamine® duplex i. c. v. to transfect miR-200b/c, and verified their overexpression in the hippocampus using in situ hybridization (Fig 3A). [score:3]
We postulated that miR-200b and/or miR-200c would inhibit S6K1, which would result in a reduction in the insulin resistance induced by oAβ. [score:3]
On the other hand, the mice overexpressing miR-200b/c in their hippocampi maintained the ability to memorize the spatial location. [score:3]
0196929.g002 Fig 2Suppressive effect of miR-200b and miR-200c on Aβ generation in vitro. [score:3]
Suppressive effect of miR-200b and miR-200c on Aβ generation in vitro. [score:3]
Identification of miR-200b and miR-200c targets. [score:3]
To detect miR-200b expression, a 3′ and 5′-digitoxin (DIG)-labeled locked nucleic acid (LNA) probe was purchased from Exiqon (Woburn, MA, USA). [score:3]
The Accutarget miRNA mimic miR-200b/c (a mixture containing equal molar concentrations of miR-200b and miR-200c) or Negative control #1 (NC) (HPLC-grade; Bioneer, Daejon, Korea) was prepared for intracerebroventricular (i. c. v. ) transfection into mouse brains, using Invivofectamine® 2.0 reagent (Invitrogen) in accordance with the manufacturer’s protocol. [score:3]
The members of the miR-200 family and related differentially expressed mRNA network are implicated in insulin signaling in the cortex of 10-month-old Tg2576 mice. [score:3]
Surprisingly, Aβ1–42 secretion was markedly suppressed in miR-200b and miR-200c transfected PMNCs, and the impairment of Aβ secretion in the conditioned medium was dependent on the miRNA concentrations used (Fig 2B). [score:3]
The reduction in S302/307 and S1097/1101 phosphorylation suggests that S6K1 is a target of miR-200b and/or miR-200c. [score:3]
Although neurological reports for the miRNA-200 family are few, one neurological study has shown that members of the miR-200 family contribute to olfactory neurogenesis [49], and a microarray study showed that miR-200c is differentially expressed in AD brains [50]. [score:3]
The chi-square test results for the 300-s probe test clarified that both NC- and miR-200b/c -treated mice in the vehicle group stayed in the target quadrant significantly longer than by chance, i. e., 25% (NC: p < 0.005; 200b/c: p < 0.005). [score:3]
The miR-200 family was upregulated in the cortices of 10-month-old Tg2576 mice as compared with age-matched WT mice in the microarray analysis. [score:3]
The hippocampi from the mice overexpressing miR-200b/c exhibited higher intensity digitoxin labeling than NC hippocampi. [score:3]
Given that S6K1 is a target of miR-200b and/or miR-200c, we evaluated its downstream regulation. [score:2]
In this study, we investigated the function of the miR-200 family, the upregulation of which may represent an innate defense response rather than being the result of Aβ -induced toxicity. [score:2]
Predictably, the inhibitory effects on each gene were low, although significant differences were observed in ZEB1 and S6K1 levels in SH-SY5Y cells transfected with miR-200b and miR-200c compared to NC (Fig 4B). [score:2]
Lower images: In situ hybridization image showing detection of the miR-200b probe in the hippocampi of NC (left) and miR-200b/c (right) i. c. v. -infused mice. [score:1]
The results of the probe test showed that spatial learning in miR-200b/c-infused mice was not influenced by oAβ (Chi-square test, * p < 0.01). [score:1]
Effect of miR-200b and miR-200c on Aβ -induced toxicity in vitro. [score:1]
0196929.g003 Fig 3Defensive effect of miR-200b/c on oligomeric Aβ -induced learning impairments in vivo. [score:1]
MiR-200b and/or miR-200c may play a defensive role with regard to intracellular Aβ production, as well as extracellular Aβ -induced toxicity by promoting insulin signaling. [score:1]
Defensive effect of miR-200b/c on oligomeric Aβ -induced learning impairments in vivo. [score:1]
Moreover, transient transfection of neurons with miR-200b/c in particular diminished the secretion of Aβ into the conditioned media. [score:1]
Effects of miR-200b and miR-200c on Aβ -induced toxicity in vivo. [score:1]
The list of immunoprecipitated (IP) genes were two-fold greater in SH-SY5Y cells transfected with miR-200b or miR-200c than in NC cells (t-test; p < 0.05). [score:1]
Likewise, in the training session for the oAβ -injected group, there was no effect of NC or miR-200b/c treatment (F (1, 10) = 0.018, p = 0.90) or treatment-by-session interaction (F (4, 36) = 0.70, p = 0.60) on the latency time (Fig 3B). [score:1]
SH-SY5Y cells transfected with 25 nM pre-miR-200b, -200c, or NC (Ambion) for 48 h were harvested with radioimmunoprecipitation (RIPA) buffer (Sigma–Aldrich). [score:1]
images showed that S6K1 -dependent phosphorylation of IRS-1 on S307 and S1101, but not IRS-1 itself, were decreased in miR-200b- and miR-200c -transfected SH-SY5Y cells (Fig 5). [score:1]
In each group, an additional 3 μL of NC (vehicle: n = 5; oAβ: n = 5) or miR-200b/c (vehicle: n = 5; oAβ: n = 6)-Invivofectamine® duplex was co -injected with the vehicle or oAβ at a flow rate of 1 μL/min; mice were handled gently to minimize stress. [score:1]
We observed that S6K1 -dependent phosphorylation of IRS1 on S307 and S1101 was diminished in SH-SY5Y cells treated with miR-200b and miR-200c. [score:1]
These findings suggest that miR-200b and miR-200c have defensive roles against Aβ -induced toxicity. [score:1]
For the successive 5 days of training sessions, a two-way ANOVA revealed that there was no NC or miR-200b/c treatment effect (F (1, 9) = 0.94, p = 0.36) or treatment-by-session interaction (F (4, 32) = 2.38, p = 0.072) for the vehicle group. [score:1]
Our in vivo finding showed that miR-200b/c relieved oAβ -induced impairment of spatial memory. [score:1]
The SH-SY5Y cells transfected with 5 nM pre-miR-200b, -200c, or NC (Ambion) for 24 h were lysed with 500 μL of lysis buffer. [score:1]
S1 TableThe list of immunoprecipitated (IP) genes were two-fold greater in SH-SY5Y cells transfected with miR-200b or miR-200c than in NC cells (t-test; p < 0.05). [score:1]
We used a non-viral transfection reagent, Invivofectamine®, to transfect miR-200b/c in mice in vivo, and examined whether these miRNAs could palliate spatial memory impairments induced by oAβ by using the Barnes maze test. [score:1]
S6K1 -dependent serine phosphorylation of IRS-1. S6K1 -dependent serine phosphorylation of IRS1 in SH-SY5Y cells transfected with miR-200b and miR-200c. [score:1]
The therapeutic potential might be explained by further study to demonstrate protecting synapses from extracellular oAβ in miR-200b/c-infused mo dels. [score:1]
NC- and miR-200b/c -treated mice showed improved performance with increasing session number, and there was a significant effect on the latency time (F (4, 40) = 50.0, p < 0.00001). [score:1]
In both groups, NC- and miR-200b/c -treated mice showed improved performance with the number of sessions (two-way ANOVA, F (4, 40) = 50.0, p < 0.00001). [score:1]
In order to evaluate the inhibitory effect of miR-200b/c on Aβ -induced toxicity in vivo, the spatial memory of oAβ injected mice was tested using the Barnes maze. [score:1]
Effects of miR-200b and miR-200c on Aβ -induced toxicity in vivoIn order to evaluate the inhibitory effect of miR-200b/c on Aβ -induced toxicity in vivo, the spatial memory of oAβ injected mice was tested using the Barnes maze. [score:1]
The activities of all of these were significantly reduced by miR-200b and/or miR-200c transfection (Fig 4A). [score:1]
Thus, miR-200b/c may have defensive effect against Aβ -induced toxicity in vivo. [score:1]
[1 to 20 of 73 sentences]
8
[+] score: 191
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-191, mmu-mir-199a-1, mmu-mir-205, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, mmu-mir-429, mmu-mir-449a, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, mmu-mir-449c, mmu-mir-449b, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-124b
These results argue that lfng and zfhx1 can be efficiently downregulated by the miR-200 family alone, whereas foxg1 and neuroD, although likely genuine targets, may require the combined action of several miRNA species in addition to miR-200 action, in order to be efficiently downregulated. [score:9]
In wild-type animals, the expression of OMP and miR-200b is partially overlapping, with OMP exclusively expressed by differentiated neurons located in the apical half of the neuroepithelium, while miR-200b is expressed throughout the neuroepithelium in both mature and immature neurons (Figure 3B). [score:7]
Our data show that expression patterns of genes expressed throughout the brain and in areas devoid of miR-200 family expression were comparable between wild-type and triple MO morphants, indicating that widespread neural defects were absent in the morphant fish (Figure 7D). [score:7]
Intriguingly, miR-200 family members are coordinately expressed from different loci, yet members express different 5′ seed heptamers, changes in which are thought to alter the binding specificity to target mRNA (Doench and Sharp, 2004; Lewis et al., 2005). [score:7]
Knocking down the expression of mature miR-200 family members led to impairment of mature olfactory marker expression and expansion of the early marker, foxg1, in the olfactory primordium. [score:6]
Expression of the miR-200 family can be detected in olfactory placodes as early as E9.5, which is the first identifiable stage of olfactory development, with continued expression within the MOE anlage in the posterodorsal aspect of the olfactory pit at E11.5 (Figure 2B). [score:6]
In addition, in situ hybridization analyses (Figure 7C) show that a mixture of all three morpholinos (Triple MO mix: miR-141 MO, miR-200b MO, and miR-429 MO) was sufficient to simultaneously inhibit the expression of all five mature zebrafish miR-200 family members to threshold levels of detection. [score:5]
From E13.5 onward, miR-200b expression becomes evenly expressed throughout the MOE at the exclusion of the supporting cell layer (Figure 2B). [score:5]
We conclude that foxg1, zfhx1, and lfng are likely to be genuine targets for miR-200 family members in both mouse and zebrafish olfactory systems, while neuroD might only be a target in the fish. [score:5]
Northern blot analysis confirmed that the level of miR-200b expression throughout the entire olfactory epithelium is reduced by ∼50%, due to the absence of miRNA processing in OMP -expressing neurons, while it remains in immature precursor cells (Figure 3B). [score:5]
Antisense morpholino experiments in zebrafish reveal that the inhibition of expression of a single miRNA family, miR-200, largely phenocopies the defect in terminal olfactory differentiation resulting from lack of Dicer function in mouse olfactory progenitor cells. [score:5]
Exogenous miR-200 duplex RNA was able to reduce expression of the lfng and zfhx1 reporters, while miR-200 duplexes did not affect GFP expression levels for the foxg1 and neuroD reporters (Figure 8B). [score:5]
Moreover, increased foxg1 expression observed in the zebrafish morpholino experiments and in the mouse conditional Dicer microarray experiments (Table S3) also suggests that foxg1 may be a genuine miR-200 family target. [score:5]
Embryos injected with either miR-141/miR-200a or miR-200b/miR-429 pairs of antisense morpholinos showed lack of expression of the corresponding miR-200 members with a given 5′ seed but did not display any change in OMP expression relative to wild-type controls (data not shown). [score:5]
As predicted from sequence analyses and thermal stability calculations, miR-141 MO specifically inhibited miR-200a and miR-141, miR-200b MO specifically inhibited miR-200b and miR-200c, and miR-429 MO specifically inhibited miR-429 (Figure S4B). [score:5]
Finally, 8 of 24 miRNA probes, including miR-200a and miR-200b, as well as miR-96, miR-141, miR-182, miR-183, miR-191, and miR-429, revealed robust expression in the MOE and VNO neuroepithelium, with weaker expression in the adjacent respiratory epithelium (Figure 2A, right column, and Table S3). [score:5]
In situ hybridization analyses using LNA antisense probes to detect mature miRNAs indicated that 4 ng per embryo per miR-200 family member was the minimal dose required to knock down miRNA expression to threshold levels of detection (data not shown). [score:4]
Taken together, these results indicate that in the absence of miR-200 family expression during olfactory placodal development, zebrafish olfactory progenitors are unable to undergo normal terminal differentiation and, instead, undergo apoptosis. [score:4]
We conclude that mature zebrafish miR-200 family members can be specifically and efficiently knocked down in various combinations in the developing olfactory system using antisense morpholinos without confounding “off-target” effects. [score:4]
Due to the molecular and cellular similarity of mouse and zebrafish olfactory development processes and the high degree of conservation between the miR-200 miRNAs in the respective organisms, we reasoned that physiologically meaningful targets were likely to be conserved between the zebrafish and mouse genomes. [score:4]
Preliminary data suggest that lunatic fringe (lfng) and zinc-finger homeobox 1 (zfhx1), two key factors associated with Notch and BMP pathways, respectively, as well as foxg1, a transcription factor required for normal olfactory development, may be relevant miR-200 targets. [score:4]
However, miR-141 and -200a express different 5′ seed heptamers from miR- 200b, -200c, and -429 and are thus likely to form two functional subgroups within the miR-200 family (Figure 2C; Doench and Sharp, 2004; Lewis et al., 2005). [score:3]
A subset, including the miR-200 family, shows high olfactory enrichment and expression patterns consistent with a role during olfactory neurogenesis. [score:3]
In the adult, the expression pattern of all miR-200 family members is restricted to the immature and mature neuronal cell layers of the MOE and is excluded from the basal and sustentacular cell layers (Figure 2B). [score:3]
The strong, specific, and coordinated expression of miR-200 members in the MOE anlage and in the mature and immature MOE is consistent with a potential role of this miRNA family during MOE neurogenesis. [score:3]
In order to further validate the physiological requirement for miR-200's action on these targets, we generated GFP reporters containing the full-length 3′ UTRs for zebrafish neuroD, foxg1, zfhx1, and lfng (Giraldez et al., 2006). [score:3]
Notch and TGFβ Signaling Pathways and Foxg1 Are Candidate Targets of the miR-200 Family. [score:3]
In addition, other predicted miR-200 family targets may also contribute to the olfactory phenotypes observed in morphant fish and the Foxg1-Cre;Dicer [loxP/loxP] mutant mice. [score:3]
In addition, our preliminary microarray and GFP-sensor experiments suggest that foxg1 itself, as well as lunatic fringe (lfng) and zinc-finger homeobox 1 (zfhx1), two key factors associated with Notch and BMP pathways, respectively, may be genuine miR-200 targets. [score:3]
From the over 100 distinct miRNAs identified in olfactory tissues, the most abundant miRNAs isolated from our study include species that are wi dely expressed in many neural tissues (miR-124a and let-7 variants), as well as a highly restricted family of miRNAs (miR-200). [score:3]
Recently, independent reports have demonstrated that the miR-200 family is highly expressed in skin epidermal cells (Yi et al., 2006). [score:3]
By contrast, we identified 12 miRNAs corresponding to 9 families (miR-199, miR-140, miR-152, miR-214, miR-205, miR-200, miR-183, miR-182, miR-96) that displayed highly enriched expression in the olfactory system (Figure 1A). [score:3]
To gain further insights into the role of the miR-200 family in mediating olfactory differentiation, we used a bioinformatic approach to predict and validate potential miR-200 targets. [score:3]
In contrast, upon Cre -mediated deletion of Dicer in OMP -positive cells, miR-200b expression is abolished from the apical portion of the neuroepithelium, while it is maintained within basal immature neurons (Figure 3B). [score:3]
Thus, the regulatory step involving the miR-200 family, and shown here to be essential for olfactory neurogenesis, may be employed by other systems of epithelial origin to ensure the proper mediation of critical signaling cascades during development. [score:3]
Accordingly, we decided to focus our efforts on potential functions mediated by the miR-200 family, which is among the most highly and most specifically miRNA subset expressed in the developing olfactory system. [score:3]
All individual members of the miR-200 family display similar expression patterns. [score:3]
We designed three morpholino antisense oligonucleotides predicted to each target the mature sequence of one or a few members of the miR-200 family (Figure S4A). [score:3]
Morpholinos targeting the miR-200 family were generated as described in. [score:3]
Moreover, as shown in the mouse, miR-200 family members display early expression in zebrafish (Wienholds et al., 2005) and appear highly enriched in olfactory tissues by the time olfactory placodes arise at 26 hpf (Figure 7A). [score:3]
The function of miR-200 during olfactory development is likely to be conserved throughout evolution, as judged from the absolute conservation of miR-200 orthologs between mouse and zebrafish with respect to the relative genomic clustering position, the conserved seed region sequences, the conserved size of the family, and the conserved arm of the hairpin that generates the mature miRNA (Figure S3). [score:2]
The morpholino knockdown experiments show that miR-200 family members are likely to act redundantly, even though they display different 5′ seed regions. [score:2]
The intriguing specificity and intensity of expression of the miR-200 family members in the MOE prompted us to pursue an in-depth investigation of their distribution during embryonic development and in the adult. [score:2]
These results indicate that the functional loss of the miR-200 family precludes normal differentiation of olfactory progenitor cells into mature olfactory neurons and thus phenocopies an important aspect of the Dicer knockout phenotype observed both in mice and zebrafish. [score:2]
The miR-200 family is therefore among the first neuronal miRNA families in vertebrates with a loss-of-function phenotype. [score:1]
We used the MicroCosm system that interfaces the miRanda prediction software with miRBase, the accepted database of miRNA classification, to confirm that mouse orthologs of zebrafish neuroD, foxg1, zfhx1, and lfng have conserved miR-200 seeds in their 3′UTRs (Griffiths-Jones et al., 2006) (Figure 8A). [score:1]
In mouse, the miR-200 family is composed of five family members (miR-141, -200a, -200b, -200c, -429) clustered into two loci of chromosomes 4 and 6 (Figure 2C). [score:1]
These results suggest that the loss of miR-200 family function disrupts terminal differentiation of olfactory progenitor cells, thus phenocopying an important aspect of the defects observed in mouse Foxg1-Cre; Dicer [loxP/loxP] mutant MOE. [score:1]
We subsequently performed immunohistochemical identification of proliferating and apoptotic cells in order to determine whether miR-200 morphant olfactory phenotypes are accompanied by increased cellular apoptosis, as observed in Dicer null mouse olfactory placodes. [score:1]
In order to test the specificity of each morpholino (MO) sequence, we systematically injected one-cell zebrafish embryos with either miR-141 MO, miR-200b MO, or miR-429 MO and performed in situ hybridization against all five miRNAs of the miR-200 family. [score:1]
To evaluate the contribution of specific miRNAs, we focused on the miR-200 family, which is highly and specifically expressed in the developing olfactory system. [score:1]
By contrast, miR-200 morphant olfactory epithelia presented significantly increased numbers of apoptotic cells relative to wild-type controls (mean ± SEM, WT 12.55 ± 1.46, n = 11; mutant 30.67 ± 2.59, n = 12, p < 0.01, Student's t test) (Figure 7F), as detected by TUNEL staining. [score:1]
One of these families, miR-200 family comprising miR-200a, miR-200b, miR-200c, miR-429, and miR-141, also highly detected by microarray, was among the most frequently cloned species in all olfactory tissues examined (Table S2). [score:1]
How does the miR-200 family mediate its control of olfactory neurogenesis? [score:1]
miR-200 Family Members Are Required for the Proper Differentiation of Olfactory Progenitor Cells. [score:1]
We next wished to determine whether the distinct 5′ seeds contributed differentially to the physiological function of the miRNA-200 family. [score:1]
Loss of function of the miR-200 family phenocopies the terminal differentiation defect observed in absence of all miRNA activity in olfactory progenitors. [score:1]
Finally, we eliminated the function of all miR-200 family members by injecting embryos simultaneously with the Triple MO mix. [score:1]
[1 to 20 of 58 sentences]
9
[+] score: 189
Other miRNAs from this paper: mmu-mir-141, mmu-mir-200a, mmu-mir-34a, mmu-mir-200c, mmu-mir-429
Western blotting showed that the over -expression of miR-200b and miR-200c obviously reduced the level of JUN protein (Figure 4C), while the inhibition of miR-200b and miR-200c significantly elevated the expression of JUN in Hep1-6 cells (Figure 4D), demonstrating that jun is a target gene of miR-200b and miR-200c. [score:9]
jun is a target gene of miR-200b and miR-200cTo explore the specific mechanism by which miR-200b and miR-200c regulate lipogenesis in hepatocytes, miR-200b and miR-200c target genes were identified through the bioinformatics websites miRBase, TargetScan and RNA22. [score:8]
Additional experiments conducted in Hep1-6 and NCTC1469 cells revealed that the reduced expression of miR-200b and miR-200c led to abnormal lipid accumulation in hepatocytes, whereas the up-regulation of miR-200b and miR-200c impaired lipid accumulation and the expression of lipogenic proteins such as SREBP1 and FAS. [score:8]
These results suggest that the up-regulation of miR-200b and miR-200c expression in the liver may prevent the accumulation of hepatic triglycerides in HFD-fed mice by suppressing JUN-SREBP1-stimulated lipogenesis. [score:8]
To determine whether miR-200b and miR-200c are involved in abnormal hepatic lipid accumulation, the expression of miR-200b and miR-200c was suppressed in two murine liver cell lines, Hep1-6 and NCTC1469, by transfection with miR-200b and miR-200c inhibitors. [score:7]
The up-regulation of miR-200b and miR-200c expression in the liver prevents hepatic lipid accumulation in HFD-fed mice. [score:6]
The up-regulation of miR-200b and miR-200c expression in the liver prevents hepatic lipid accumulation in mice fed a HFD. [score:6]
To explore the specific mechanism by which miR-200b and miR-200c regulate lipogenesis in hepatocytes, miR-200b and miR-200c target genes were identified through the bioinformatics websites miRBase, TargetScan and RNA22. [score:6]
Previously, we examined miRNA expression in the livers of db/db mice and found that the expression of the miR-200 family members miR-200a, miR-200b and miR-200c was reduced in response to hepatic insulin resistance [23]. [score:5]
The reduced expression of miR-200b and miR-200c contributes to abnormal hepatic lipid accumulation by stimulating JUN expression and activating the transcription of srebp1. [score:5]
To determine whether miR-200b and miR-200c are involved in hepatic lipid accumulation in vivo, miR-200b and miR-200c were over-expressed in the livers of HFD-fed mice through the use of recombinant adenovirus expressing miR-200b and miR-200c mimics (Ad-miR-200b & Ad-miR-200c), respectively. [score:5]
The findings suggest that the reduced expression of miR-200b and miR-200c participated in abnormal hepatic lipid accumulation by stimulating JUN expression and activating the transcription of srebp1. [score:5]
More importantly, we demonstrated that down-regulation of miR-200b and miR-200c could partially reverse sitagliptin -induced decreased levels of SREBP1 and FAS, and reduced contents of intracellular triglyceride in Hep1-6 cells (Figure 7F, 7G). [score:4]
Researchers demonstrated that the miR-200 family influences cancer development and progression by targeting various important signaling factors. [score:4]
Importantly, the expression of miR-200b and miR-200c was suppressed in the livers of NAFLD patients (Figure 1F), and the levels of lipogenic proteins such as SREBP1 and FAS were elevated compared with the healthy controls (Figure 1G). [score:4]
More importantly, the knockdown of jun could partially ameliorate the miR-200b and miR-200c inhibition -induced increased SREBP1 and FAS levels in Hep1-6 cells (Figure 5G). [score:4]
This was accompanied by decreased SREBP1 and FAS levels (Figure 2G and 2H), indicating that miR-200b and miR-200c mimics have a suppressive role in lipid accumulation. [score:3]
Elevated miR-200b and miR-200c expression is associated with sitagliptin-reduced hepatic lipid accumulation in mice fed a HFD. [score:3]
These results indicate that miR-200b and miR-200c suppressed hepatic lipogenesis. [score:3]
In this study, we provide preliminary evidence that the elevated expression of miR-200b and miR-200c might contribute to the sitagliptin -induced reduction of hepatic lipid accumulation in HFD-fed mice. [score:3]
And the adenovirus vector expressing mimics of miR-200b or miR-200c was constructed by Genechem (Shanghai, China). [score:3]
Instead, a transcription factor, jun, was predicted to be a target gene of miR-200b and miR-200c (Figure 4A). [score:3]
Figure 3(A, B) Oil red O staining of Hep1-6 and NCTC1469 cells pre -treated with a mixture of oleic acid/palmitic acid (2:1, M/M) for 24 h. (C, D) Western blots showing the expression of SREBP1 and FAS in Hep1-6 and NCTC1469 cells pre -treated with a mixture of oleic acid/palmitic acid (2:1, M/M) for 24 h and then transfected with miR-200b and miR-200c mimics. [score:3]
Figure 4miR-200b and miR-200c bind to the 3′UTR of jun(A) TargetScan-predicted miR-200b and miR-200c bind to the 3′UTR of jun. [score:3]
Furthermore, the mutant of jun 3′UTR was inserted into the pmirGLO plasmid, but overexpression of miR-200b and miR-200c could not decrease the relative luciferase activity of pmirGLO- jun-3′UTR-Mut (Figure 4B). [score:3]
In contrast, the over -expression of miR-200b and miR-200c significantly reduced lipid accumulation in Hep1-6 and NCTC1469 cells transfected with miR-200b and miR-200c mimics (Figure 2E and 2F). [score:3]
Figure 7(A) Real-time reverse-transcription PCR analysis of miR-200b and miR-200c expression in Hep1-6 cells pre -treated with a mixture of oleic acid/palmitic acid (2:1, M/M) for 24 h and then treated with 1 μM sitagliptin for 24 h. (B) Quantification of miR-200b and miR-200c in the livers of HFD-fed mice treated with sitagliptin. [score:3]
To identify the potential role of the miR-200 family in lipid metabolism, relative expression patterns were analyzed in the steatotic livers of HFD-fed mice and NAFLD patients. [score:3]
These data indicated that an increase in miR-200b and miR-200c expression might be associated with the sitagliptin -induced reversal of hepatic lipid accumulation in HFD-fed mice. [score:3]
The over -expression of miR-200b and miR-200c reverses oleic acid/palmitic acid -induced lipid accumulation in hepatocytes. [score:3]
This finding suggests that reduced miR-200b and miR-200c expression might contribute to abnormal lipid accumulation in hepatocytes. [score:3]
In the present study, Hep1-6 cells were pre -treated with a mixture of oleic acid/palmitic acid (2:1, M/M) for 24 h and then treated with 1 μM sitagliptin for 24 h. Real-time reverse-transcription PCR indicated that sitagliptin rescued the oleic acid/palmitic acid–induced reduction of miR-200b and miR-200c expression in Hep1-6 cells (Figure 7A). [score:3]
In this manuscript, we identified jun as a target gene of miR-200b and miR-200c. [score:3]
Reduced miR-200b and miR-200c expression contributes to abnormal lipid accumulation in Hep1-6 and NCTC1469 cells. [score:3]
More importantly, this enhancement of hepatic miR-200b and miR-200c expression led to a significant reduction in liver weight and in the liver weight-to-body weight ratio (Figure 6B, 6C). [score:3]
jun is a target gene of miR-200b and miR-200c. [score:3]
Taken together, these data suggest that miR-200b and miR-200c are involved in lipogenesis through stimulation of JUN expression and the subsequent activation of srebp1 transcription. [score:3]
As shown in Figure 2A and 2B, the transfection of both Hep1-6 and NCTC1469 cells with miR-200b and miR-200c inhibitors resulted in a significant increase in intracellular triglyceride levels. [score:3]
Elevated miR-200b and miR-200c expression is associated with sitagliptin-reduced hepatic lipid accumulation in HFD-fed mice. [score:3]
The miR-200 family, including miR-200a, miR-200b, miR-200c, miR-141 and miR-429, has been reported to be dysregulated in several types of cancers including gastric cancer, breast cancer and bladder cancer [20– 22]. [score:2]
To further assess the requirement of miR-200 in sitagliptin's effect, miR-200b and miR-200c were knocked down in the Hep1-6 cells pre -treated with a mixture of oleic acid/palmitic acid and treated with sitagliptin. [score:2]
Moreover, knock down of miR-200b and miR-200c could partially rescue sitagliptin -induced reduced levels of SREBP1 and FAS, and decreased contents of intracellular triglyceride in Hep1-6 cells In conclusion, our findings may shed light on the specific molecular mechanism by which miR-200b and miR-200c are correlated with hepatic lipid metabolism. [score:2]
The aim of this study was to explore the potential role of the miR-200 family in the regulation of hepatic lipid metabolism. [score:2]
As shown in Figure 4B, the miR-200b and miR-200c mimics significantly reduced the relative luciferase activity of pmirGLO- jun-3′UTR, indicating a direct binding. [score:2]
Interestingly, the levels of miR-200b and miR-200c were increased in the livers of HFD-fed mice treated with sitagliptin. [score:1]
miR-200b and miR-200c bind to the 3′UTR of jun. [score:1]
As shown in Figure 1D, the levels of miR-200b and miR-200c, but not the levels of other members of the miR-200 family including miR-200a, miR-141 and miR-429, were obviously reduced in the livers of HFD-fed mice. [score:1]
Interestingly, the transfection of both Hep1-6 and NCTC1469 cells with miR-200b and miR-200c mimics partially reversed the formation of the O/P -induced lipid droplets (Figure 3A and 3B) and the elevation of SREBP1 and FAS levels (Figure 3C and 3D). [score:1]
To further investigate the suppressive role of miR-200b and miR-200c mimics in lipid accumulation, Hep1-6 and NCTC1469 cells were pre -treated with a mixture of oleic acid and palmitic acid (2:1, M/M) for 24 h. Oil red O staining revealed that pre-treatment with oleic acid/palmitic acid (O/P) significantly promoted lipid accumulation in Hep1-6 and NCTC1469 cells (Figure 3A and 3B). [score:1]
The levels of miR-200b and miR-200c are reduced in the steatotic livers of HFD-fed mice and NAFLD patients. [score:1]
In this study, we found that only miR-200b and miR-200c were decreased in the livers of NAFLD patients and mice fed a HFD. [score:1]
However, the role of the miR-200 family in hepatic lipid metabolism remains unknown. [score:1]
These data suggest that miR-200b and miR-200c may be involved in hepatic lipogenesis. [score:1]
Seven days after administration of Ad-miR-200b and Ad-miR-200c to the mice by tail vein injection, the hepatic levels of miR-200b and miR-200c were elevated by 3.43- and 2.93-fold, respectively (Figure 6A). [score:1]
Figure 2(A, B) The measurement of triglyceride levels in Hep1-6 and NCTC1469 murine liver cells transfected with miR-200b and miR-200c inhibitors. [score:1]
Bioinformatics predictions revealed that there were conserved miR-200b and miR-200c binding sites in the 3′UTR of jun. [score:1]
In a previous study, we demonstrated that the reduction of miR-200a, miR-200b and miR-200c in hepatocytes contributed to IL -induced insulin resistance [23]. [score:1]
Interestingly, miR-200b and miR-200c were enhanced in the livers of HFD-fed mice treated with sitagliptin (Figure 7B). [score:1]
The levels of miR-200b and miR-200c are reduced in the steatotic livers of NAFLD patients and mice fed a HFD. [score:1]
The miR-200 family has been extensively studied in different tumors [29– 31]. [score:1]
[1 to 20 of 60 sentences]
10
[+] score: 180
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-214, hsa-mir-200b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, hsa-mir-200c, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-200a, hsa-mir-130b, hsa-mir-376a-1, mmu-mir-376a, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, hsa-mir-429, mmu-mir-429, hsa-mir-450a-1, mmu-mir-450a-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-130b, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, hsa-mir-450a-2, dre-let-7j, hsa-mir-376a-2, mmu-mir-450a-2, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Some of the miR-9 and miR-200-class targets upregulated in the mutant OE (Qk, Foxf2) are mesenchymally-expressed rather than OE-expressed, while other targets were actually downregulated in the absence of Dlx5 (Akap6, Elmod1, Snap25) (Table 1C). [score:15]
We found eight miRs differentially expressed, six down-regulated (miR-9, miR-141, miR-200a, miR-200b, miR-429 and miR-376a) and two up-regulated (miR-450a-5p and miR130b*) in the Dlx5 [−/−] OE (Fig.  1a). [score:9]
To determine whether the forced expression of DLX5 may result in an upregulation of miR-9 and miR-200-class RNAs, SH-SY5Y cells were transfected with myc-tagged wild-type DLX5 or Q178P mutant DLX5 expression vectors, and the relative abundance of miR-9 and miR-200 was quantified by Real-Time qPCR. [score:8]
In summary, since miR-9 and miR-200-class are down-modulated in the absence of Dlx5, while Foxg1 protein level is up-regulated, and since the 3′ UTR of the Foxg1 mRNA is a predicted target of these miRs, we can infer that the Dlx5-miR-Foxg1 regulation is most likely a direct one. [score:8]
Two possible explanations: either changes in the abundance of miR-9 and miR-200-class cause changes in the abundance of target RNAs that are too modest to pass the imposed cut-off value, or these miRs preferentially affect translation and not stability of the target mRNAs. [score:7]
For chromatin immunoprecipitation (ChIP) we used the human SHSY-5Y neuroblastoma cells, which express low endogenous levels of Dlx5, miR-9 and miR-200, transfected with 5 μg of DLX5-myc-tag expression vector (from Open-Biosystem) or with the same vector in which the Q178P mutation (Shamseldin et al., 2012) was introduced (BioFab, Rome, sequence verified). [score:6]
A significant enrichment of miR-9 and miR-200-class target sequences was detected in the 3′ UTR of genes up-regulated in the Dlx5 [−/−] OE (Table 1A, B). [score:6]
myc-tagged version of either the WT or the Q178P mutant DLX5 were expressed in the SH-SY5Y human neuroblastoma cells, which express DLX5, miR-9 and miR-200 endogenously. [score:5]
We also show that Dlx5 promotes expression of miR-9 and miR-200 class, thereby tends to repress Foxg1 protein translation. [score:5]
•Dlx5 controls the expressions of miR9 and miR-200, which target the Foxg1 mRNA • miR-9 and -200 are needed for olfactory neurons differentiation and axon extension • miR-9 and -200 are required for the genesis and position of GnRH neurons. [score:5]
2.9To downmodulate endogenously expressed miR-9 and miR-200 we used the commercially available Ambion anti-miR inhibitors (Life Technologies). [score:5]
To downmodulate endogenously expressed miR-9 and miR-200 we used the commercially available Ambion anti-miR inhibitors (Life Technologies). [score:5]
On the contrary, DLX5 overexpression did not induce changes in miR-200 expression, either in SH-SY5Y (Fig.  2d) or in GN11 (neuroendocrine) or in U2OS (osteosarcoma) cells (data not shown). [score:5]
For miR-200b/ c/ 429/ 548a, the enriched functional categories included forebrain generation of neuron, cell motility, projection development, regulation of locomotion, regulation of phosphorylation and regulation of transcription (Suppl. [score:5]
Next we intersected the predicted miR-9 and miR-200-class targets with the coding mRNAs found to be differentially expressed in the Dlx5 [−/−] OE compared to the WT (Garaffo et al., 2013). [score:4]
To overexpress miR-9 and miR-200 exogenously we used commercially available Ambion pre-miR precursors (Life Technologies). [score:3]
miR-200a, miR-200b, miR-141 and miR-429 share the same seed sequence and likely target the same mRNAs; for this reason they are grouped in a single miR class (named miR-200-class). [score:3]
The 3′ UTR of tetrapod and zebrafish Foxg1 mRNAs hosts miR-9 and miR-200 target sequences. [score:3]
To functionally demonstrate a role of miR-9 and miR-200-class for olfactory development, and the involvement of Foxg1 in this regulation in vivo, the zebrafish mo del was again used. [score:3]
3.7To determine whether miR-9 and miR-200-class play a role in GnRH neuronal differentiation and migration, we used the GnRH3:GFP transgenic zebrafish strain, in which the GFP reporter is expressed under the transcriptional control of a fragment of the z- GnRH3 promoter. [score:3]
Searching for functionally relevant targets of miR-9 and miR-200 clsss in the OE. [score:3]
Here we show that mouse and fish foxg1 mRNA is a target of miR-9 and miR-200 class, both of which are down-modulated in the Dlx5 null embryonic OE. [score:3]
We also show that miR-9 and miR-200-class target (amongst others) the foxg1 mRNA, through which they likely exert their functions. [score:3]
Instead, we could easily monitor the number and position of early GFP -expressing neurons, and noted that upon depletion of miR-200 class they appear reduced in number but normally clustered. [score:3]
To determine whether miR-9 and miR-200-class play a role in GnRH neuronal differentiation and migration, we used the GnRH3:GFP transgenic zebrafish strain, in which the GFP reporter is expressed under the transcriptional control of a fragment of the z- GnRH3 promoter. [score:3]
The results presented here indicate that loss of Dlx5 causes a down-modulation of miR-9 and of miR-200-class, which results in the over -expression of the Foxg1 protein. [score:3]
3.6To functionally demonstrate a role of miR-9 and miR-200-class for olfactory development, and the involvement of Foxg1 in this regulation in vivo, the zebrafish mo del was again used. [score:3]
In the same cells, the expression of pre -miR-200 led to a 3.9-fold decrease in Foxg1 proteins level (Fig.  3c). [score:3]
The most abundant miRs expressed in the developing mouse OE are: the miR-200-class (- 200a, - 200b, - 200c, - 141 and - 429), miR-199, miR-152, miR-214, miR-205, miR-183, miR-182 and miR-96 (Choi et al., 2008). [score:3]
Examining olfactory development more thoroughly we now can implicate the miR-9 and miR-200-class networks in a more complex phenotype reminiscent of the Kallmann syndrome (see below). [score:2]
Another indication comes from a study in zebrafish, showing a role of miR-200-class for olfactory development (Choi et al., 2008). [score:2]
To determine whether miR-9 and miR-200-class may modulate Foxg1 protein level, the effect of introduction of pre-miR-9 or depletion of endogenous miR-9 on Foxg1 protein level was assayed by Western blot analysis in SH-SY5Y cells, which express DLX5, miR-9, miR-200-class and Foxg1 endogenously. [score:2]
Thus, both miR-9 and miR-200 negatively regulate Foxg1 protein level. [score:2]
Genomic regulation of miR-9 and miR-200 by Dlx5. [score:2]
miR-9 and miR-200-class regulate Foxg1. [score:2]
In this work we define the role of miR-9 and miR-200-class in the development of the olfactory system, with functions ranging from ORN differentiation to axon guidance, glomerulus formation and GnRH neuron migration. [score:2]
Starting from profile data obtained from a mouse mo del of Kallmann syndrome, we functionally examined this pathway in zebrafish showing that miR-9 and miR-200-class are required for normal differentiation of the ORNs, for the extension and connectivity of the olfactory axons, and for the migration of the GnRH neurons from the nasal primordium to the forebrain. [score:1]
It has also been shown that miR-200 represses neural induction of human embryonic stem cells, via modulation of Pax6 and Zeb transcription factors (Du et al., 2013). [score:1]
miR200a and miR200b could not be tested by in situ hybridization due to high sequence conservation between all members of the miR-200-class. [score:1]
To complement the previous (static) data with live images of the migrating GnRH3 neurons, we carried out few time-lapse video recordings on untreated (4) and z- miR-200-class MO injected (4) embryos at earlier ages (36–52 hpf), in order to observe the first appearance of these neurons. [score:1]
We depleted the miR-200 class in fish zygotes, by injecting a mix of anti -miR-200 MO previously described and found to efficiently down-modulate several miR of the class-200 and to affect ORN differentiation (Choi et al., 2008). [score:1]
We previously verified that the depletion of miR-9 and miR-200-class in zebrafish embryos leads to higher level of z-foxg1 mRNA (no Ab efficiently recognizes the z-foxg1 protein). [score:1]
The 3′ UTR of the mammalian and fish Foxg1 mRNA contains seed sequences for miR-9 and miR-200 (Suppl. [score:1]
The abundance of z-hoxa-7a and z-hoxa-10b mRNAs did not greatly change, indicating that the differentiation delay observed upon depletion of miR-200-class is specific. [score:1]
We carried out the same prediction and categorization analyses for the miR of the -200 class; in this case the two subfamilies (miR-141/ 200a and miR-200b/ c/ 429/ 548a) were examined separately, and indeed yielded lists which were similar but not identical. [score:1]
Thus, our results provide the first evidence of the participation of miR-9 and miR-200-class in these early events. [score:1]
z-foxg1 mRNA level increased by three-folds when either miR-9 or miR-200-class were depleted (Figs.  5e and 6f). [score:1]
In control embryos, we counted an average of 13 (+/− 2) GnRH3::GFP + neurons/embryo at 72 hpf, while in miR-9 and miR-200 MO injected embryos the average number was, respectively, 5 (+/− 1) and 6 (+/− 1) (Suppl. [score:1]
3.4The 3′ UTR of the mammalian and fish Foxg1 mRNA contains seed sequences for miR-9 and miR-200 (Suppl. [score:1]
Since miR-200a, miR-200b, miR-141 and miR-429 share very similar seed sequences (Suppl. [score:1]
Depletion of miR-9 and miR-200-class in zebrafish results in altered GnRH neuron genesis and position. [score:1]
Previous results in which zebrafish embryos were injected with anti- miR-200 class MOs found a delayed ORN differentiation, but axonal organization and GnRH neuron migration was not assessed (Choi et al., 2008). [score:1]
com/request/, while the anti- z-miR-200 MO mix was as previously published (Choi et al., 2008). [score:1]
Similarly, the depletion of miR-200-class (N = 23) resulted in a reduced number of GFP + neurons in 22% of GFP + embryos with the phenotype “reduced number” and 50% of the cases showing the phenotype “scattered position” (Fig.  7). [score:1]
We used the same MOs indicated above to deplete miR-9 and miR-200 class in GnRH3::GFP zygotes, and examined the effect on the number and position of the GFP + neurons associated to the terminal nerves, between 36 and 72 hpf. [score:1]
In Danio rerio (zebrafish) the miR-200-class is required for the proliferation, differentiation and survival of ORNs (Choi et al., 2008). [score:1]
Upon injection of the anti-miR-200 MO mix, only about 24% of examined embryos turned out CFP + (vs. [score:1]
Using reporter zebrafish strains to visualize the embryonic olfactory axons (Miyasaka et al., 2005; Sato et al., 2005; Yoshida et al., 2002) or the GnRH + neurons (Abraham et al., 2008, 2009, 2010), we show that miR-9 and miR-200-class play a role in ORN differentiation and axonal organization. [score:1]
miR-9 and miR-200 mediate the Dlx5-Foxg1 cascade. [score:1]
Depletion of miR-9 and miR-200-class in zebrafish results in delayed ORN differentiation. [score:1]
We injected anti- miR-9 and anti- miR200 (or control) MOs in WT zygotes, then at 48 hpf we extracted total -RNA from these and carried out Real-Time qPCR analyses. [score:1]
Recently, miR-200b and miR-429 have been linked to pituitary endocrine functions controlling ovulation and fertility in female mice (Hasuwa et al., 2013). [score:1]
[1 to 20 of 62 sentences]
11
[+] score: 178
Other miRNAs from this paper: mmu-mir-141, mmu-mir-200a, mmu-mir-200c, mmu-mir-429
On the basis of previous data, In general, the predicted miR-200 family target genes were downregulated in DMPCs because miR-200 family expression was upregulated in DMPCs. [score:11]
Relative to miR-200 family inhibition cells (miR-200s inhibitors DMPC group; 65.2 ± 8.9%), a decrease cells in G0/G1 phase of the cell cycle was observed following miR-200 family inhibition combining with overexpression of RSAD2 in DMPC (RSAD2-DMPC group; 58.4 ± 1.7%, P < 0.05) (Fig. 6a). [score:9]
Then, we further predicted the miR-200 family target genes by comparing the upregulated miRNAs and the downregulated mRNAs on two web sites: http://www. [score:9]
Up-regulation of miR-200 family inhibits the RSAD2 protein expression, the process of which significantly promotes podocyte differentiation (right). [score:8]
Down-regulation of miR-200 family fail to inhibit the RSAD2 protein expression in undifferentiated podocytes (left). [score:8]
The miR-200 family directly regulates RSAD2 expression by targeting the 3′-UTR of RSAD2. [score:7]
In this study, we found that miR-200a, miR-200b and miR-429 were upregulated in DMPCs, whereas the expression of miR-200c and miR-141 were not affected (Fig. 1). [score:6]
More intriguingly, miR-200 family directly inhibited the RASD2 expression, which can reverse miR-200a/200b/429 -mediated promotion of cell differentiation (Fig. 8). [score:6]
Furthermore, the blockade of miR-200 family by RNA interference inhibited the expression of RASD2 and arrested cellular differentiation. [score:5]
As shown above, overexpression of miR-200 family inhibited RSAD2 in HEK293 cells. [score:5]
Over -expression of RSAD2 combining with restraint of miR-200 family revealed inhibition of cell differentiation and proliferation. [score:5]
Consequently, we studied the effect of miR-200 family inhibition on the rearrangement of cytoskeleton and expression of biomarkers, which would reveal the effect of miR-200 family on podocyte differentiation. [score:5]
Notably, the three miR-200a/200b/429 are all located on chromosome 4, which indicates a potential key role of the three members on chromosome 4 in podocyte differentiation, but not the other two members (miR-200c and miR-141) on chromosome 6. Thus, a negative control or miR-200a, miR-200b and miR-429 inhibitors were all co -transfected together into DMPCs for 48 h. We found that restraint of miR-200 family significantly inhibited podocyte differentiation (Figs 2 and 3). [score:5]
To confirm the biological function of miR-200 family in podocyte differentiation, we examined cell cycle distribution after a simultaneous inhibition of the expression of miR-200a, miR-200b and miR-429. [score:5]
If this also holds true for podocytes, one might predict that restraint of miR-200 family expression combining with higher expression of RSAD2 may restrict podocyte differentiation. [score:5]
All together, these results suggested that miR-200 family directly regulated the expression ofRSAD2 by interacting with its 3′-UTR. [score:5]
Compared with DMPC group (76.3 ± 0.5%), a significant decrease of cells in the G0/G1 phase of cell cycle was observed following miR-200a, miR-200b and miR-429 co -inhibition (miR-200a/200b/429 inhibitors-DMPC group; 63.3 ± 4.5%, P < 0.001)(Fig. 2a). [score:4]
Upregulation of miR-200a, miR-200b and miR-429 during the differentiation of podocytes. [score:4]
showed that miR-200a (P < 0.01), miR-200b (P < 0.05) and miR-429 (P < 0.05) significantly down-regulated the luciferase activity of RSAD2 construct (Fig. 5a), whereas luciferase activity was not generated from the mutant construct (Fig. 5b). [score:4]
In the present study, we demonstrated that miR-200a, miR-200b and miR-429 are significantly up-regulated during the podocyte differentiation. [score:4]
Our further assay by restraint of miR-200 family expression combining with higher expression of RSAD2 in podocytes showed a restriction of podocyte differentiation (Fig. 6), which further confirmed the pivotal role of miR-200s/RSAD2 signaling in podocyte differentiation. [score:4]
RSAD2 is a predicted target gene of miR-200 family. [score:3]
Over -expression of RSAD2 combining with restraint of miR-200 family revealed promotion of cell dedifferentiation and proliferation. [score:3]
Restraint of miR-200 family revealed inhibition of cell differentiation and apoptosis. [score:3]
Since restraint of miR-200 family inhibited podocyte differentiation, we further explored the effect of restraint of miR-200 family on podocyte apoptosis. [score:3]
We then looked for miR-200 family putative targets. [score:3]
Both of the web sites showed the same sequences of RSAD2 targeting by miR-200 family (Fig. 4a). [score:3]
Total RNA isolation and qPCR for detecting miR-200a, miR-200b, miR-429 and RSAD2 mRNA expression were carried out by the following procedures. [score:3]
The miRNA microarray showed that miR-200a, miR-200b and miR-429 expressions were significantly increased in differentiated podocytes (Fig. 1a). [score:3]
The results showed that miR-200 family modulated cell differentiation through the inhibition of RSAD2. [score:3]
To investigate the expression level of miR-200 family during the differentiation of podocytes, a recent study in our laboratory has identified the miRNAs and mRNA expression levels in undifferentiated and differentiated podocytes using miRNA and mRNA microarray 16. [score:3]
Hence, these findings indicate that miR-200 family may potentially promote podocyte differentiation through repression of RSAD2 expression. [score:3]
RSAD2 was a predicted target gene of miR-200 family. [score:3]
Several genes have been reported to be the targets of the miR-200 family, including ZEB1 29, ZEB2 30, Foxf2 31 and SIP1 32. [score:3]
MiR-200 family restraint reveals a significant inhibition in podocyte differentiation. [score:2]
Together, functional assays in podocytes demonstrated that miR-200 family inhibited RSAD2 to promote podocyte differentiation. [score:2]
Further real-time quantitative PCR (qPCR) assay showed that miR-200a (1996 ± 470, P < 0.01), miR-200b (543 ± 92, P < 0.01) and miR-429 (463 ± 74, P < 0.01) expressions were significantly increased in differentiated podocytes (Fig. 1b). [score:2]
Notably, the three members are all located on chromosome 4, which indicated a potential key role of the three members of miR-200 family in podocyte differentiation. [score:1]
Proposed mechanism of miR-200 family modulating RSAD2 protein and their roles in podocyte differentiation. [score:1]
Though the members of the miR-200 family (the miR-200b/200c/429 group and the miR-200a/141 group) share the similarities of their seed sequences 25, the biological function of miR-200a/200b/429 subfamily in our study may undergo a chromosome -dependent molecular mechanism. [score:1]
In the present study, we show a relationship between miR-200 family and RSAD2 in podocyte differentiation. [score:1]
Restraint of miR-200 family affects cell cycle and apoptosis. [score:1]
Restraint of miR-200 family affects differentiation marker and reveals rearrangement of cytoskeleton. [score:1]
The miR-200a, miR-200b and miR-429 mimics and vectors containing the 3′-UTR of RSAD2 were transiently transfected into HEK293 cells. [score:1]
How to cite this article: Li, Z. et al. miR-200 family promotes podocyte differentiation through repression of RSAD2. [score:1]
Since report has revealed the critical role of mir-200 family in cell proliferation 33, These results indicated that the novel role of the miR-200s/RSAD2 signaling in podocyte proliferation. [score:1]
[1 to 20 of 46 sentences]
12
[+] score: 172
Furthermore, qPCR was performed again to validate the downregulated and upregulated expression of selected miRNAs that may be relevant to development and confirmed that miR-135, miR-302, miR-449a, miR-200b, miR-200c, miR-193b, miR-130, and miR-141 were downregulated, whereas miR-10a, miR-181, and miR-470 were upregulated by RA treatment (Fig 4C and 4D). [score:16]
Representative miRNAs that were downregulated after treatment with 1 μM RA for 24 h. (E, F, and G) MiR-200a, miR-200b, and miR-200c relative expression levels after transfection with the expression vector PCDH-miR-200b or PCDH-miR-200c for 48 h. (H) qPCR revealed enhanced Oct4 and Nanog expression levels after transfection with the expression vectors PCDH-miR200a, PCDH-miR200b, or PCDH-miR200c for 48 h (without RA). [score:12]
Moreover, miR-200b and miR-200c expression antagonized RA -induced differentiation, whereas inhibition of miR-200b and miR-200c expression enhanced RA -induced suppression of the pluripotency genes Oct4 and Nanog and promoted RA -induced Nestin upregulation. [score:12]
To provide further confirmation that deficiency of miR-200b or miR-200c caused mESCs differentiation, mESCs were transfected with the expression vector for miR-200b or miR-200c and 24 h later treated with RA for an additional 24 h. Both qPCR and western blotting indicated that miR-200b/200c antagonized RA -induced Nestin upregulation (Fig 5H and 5I) as well as Oct4 and Nanog downregulation in mESCs (Fig 5G and 5I). [score:9]
We chose members of the miR-200 family, miR-200a, miR-200b, and miR-200c because these are abundantly expressed in mESCs and demonstrated that upregulation of miR-200b or miR-200c increased the expression of two key embryonic stemness genes Oct4 and Nanog, thereby promoting pluripotency [65]. [score:8]
From the significantly altered miRNAs, we examined the roles of two pluripotency -associated miRNAs, miR-200b and miR-200c [43], and further confirmed that RA partially induced mESC differentiation by inhibiting miR-200b and miR-200c expression, which in turn led to the downregulation of pluripotency genes that normally serve to retard differentiation into ectoderm germ cells. [score:8]
To test this idea, we transfected mESCs with the miR-200b inhibitor or miR-200c inhibitor and verified the effect of the inhibitor by q-PCR (Fig 5A and 5B). [score:7]
In addition, we found that miR-200b and 200c, two of the downregulated miRNAs, significantly increased the expression of two pluripotent genes Oct4 and Nanog in mESCs. [score:6]
Thus, downregulation of the expression of miR-200b or miR-200c promoted the differentiation of mESCs. [score:6]
We confirmed that RA inhibited miR-200b and 200c (Fig 4C), factors that serve to increase the expression of the pluripotent genes Oct4 and Nanog (Fig 4G). [score:5]
Retinoic acid inhibited the pluripotency of stem cells by supressing the expression of miR-200b and miR-200c. [score:5]
In this mo del, RA treatment inhibited miR-200 family expression. [score:5]
0132566.g005 Fig 5 (A and B) MiR-200b/c inhibitor and their negative controls were transfected into J1 ES cells, and the expression of miR-200b or 200c was detected by qPCR. [score:5]
Therefore, RA could inhibit miR-200b/c to activate Gata4 and Ntf3 and could repress Nanog plus Oct4 and upgrade Nestin expression. [score:5]
Some recent research found that the endoderm lineage markers Gata4, transcription factor Tcfap2a, and neural development markers Ntf3 were the targets of miR-200b/c [65, 67, 68]. [score:4]
These observations strongly suggest that the two important stemness markers, Nanog and Oct4, were regulated by RA through its repression of miR-200b/c expression, and miR-200b and miR-200c play vital roles in RA -induced differentiation of mESCs. [score:4]
In particular, miR-200b and miR-200c play vital roles in RA -induced differentiation of mESCs by suppressing genes associated with the maintenance of pluripotency. [score:3]
We constructed expression vectors for miR-200a,miR-200b, and miR-200c (Fig 4E, 4F and 4G). [score:3]
Our data demonstrated that the expression of miR-200b and miR-200c antagonized RA -induced differentiation in mESCs, consistent with the observation that miR-200b/200c deficiency in mESCs promoted differentiation in the absence of RA. [score:3]
Loss of AP activity confirmed the differentiation of mESCs and loss of pluripotency after transfection of miR-200b and miR-200c inhibitors (Fig 5F). [score:3]
Retinoic acid -induced differentiation is mediated by the suppression of miR-200b and miR-200c. [score:3]
The pri-miRNA miR-200a, miR-200b and miR-200c were amplified from the J1 genome and were inserted into the multiple cloning site (MCS) of the expression vector pCDH-CMV-MCS-EF1-copGFP (System Biosciences, CA, USA). [score:3]
We found that Oct4 and Nanog were significantly increased after the overexpression of miR-200b/c and miR-200a had no effect on Oct4 and Nanog (Fig 4H). [score:3]
This foundational description of an RA-miR-200b/200c-gene regulation network will aid in the further study of retinoid functions in embryonic development. [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
The relative levels of Sox2 (A) and Klf4 (B) detected by western blot after miR-200b and miR-200c expression vectors into J1 ES cells for 24 h and treatment with RA for an additional 24 h. (TIF) Fold change values were provided in comparison with J1 mESCs treated by DMSO. [score:3]
Thus, miR-200b and miR-200c are RA-modulated miRNAs that control changes in downstream gene expression patterns required for RA -induced differentiation. [score:3]
To further clarify the miR-200b/c roles in RA -induced differentiation, we used an inhibitor of miR-200b and miR-200c to substitute the RA -induced deficiency. [score:3]
The relative levels of Sox2 (A) and Klf4 (B) detected by western blot after miR-200b and miR-200c expression vectors into J1 ES cells for 24 h and treatment with RA for an additional 24 h. (TIF) Click here for additional data file. [score:3]
The overexpression of miR-200b/c could block the stemness markers Klf4 and Sox2 (S1 Fig) [71]; however, Sox2 is also required for the maintenance of self-renewal of neural stem/progenitor cells. [score:3]
The miR-200 family is considered essential for tumor development by regulating epithelial transition [63]. [score:2]
The microRNA-200 family regulates epithelial to mesenchymal transition. [score:2]
S1 Fig of Sox2 and Klf4 with miR-200b/c transfected and RA treatment. [score:1]
Therefore, we concluded that RA induced the differentiation of mESCs by repressing miR-200b and miR-200c factors essential for maintaining the pluripotency of mESCs. [score:1]
Our data demonstrated that RA modifies pluripotency genes via miR-200b/200c. [score:1]
We conclude that RA induced mESC differentiation by repressing miR-200b and miR-200c factors is essential for maintaining the pluripotency of mESCs. [score:1]
Moreover, AP activity was maintained upon RA -treated mESCs transfected with miR-200b or miR-200c (Fig 5J). [score:1]
Western blot analysis of Sox2 and Klf4 with miR-200b/c transfected and RA treatment. [score:1]
Let-7 and miR-200 microRNAs. [score:1]
We found that repressed miR-200b and miR-200c could reduce the pluripotency of mESCs in the absence of RA. [score:1]
Therefore, we only focussed on miR-200b/c in the following research. [score:1]
[1 to 20 of 41 sentences]
13
[+] score: 170
Other miRNAs from this paper: mmu-mir-141, mmu-mir-146a, mmu-mir-200a, mmu-mir-200c, mmu-mir-429
miR-200a/200b mimics inhibit HG -induced endothelial OGT expression, protein O-GlcNAcylation, and inflammatory phenotypesTo examine the potential regulation of OGT expression by the miR-200 family, transfection assays with 200a/200b mimics or inhibitors were performed to determine whether miR-200a/200b mimics modulates OGT gene expression. [score:11]
McArthur et al. observed miR-200b downregulation and vascular endothelial growth factor (a target of miR-200b) upregulation in streptozotocin -induced diabetic rat retinas. [score:9]
To determine whether HG -induced downregulation of miR-200 members also modulates ZEB-1 gene expression, we examined the effects of HG on ZEB-1 expression. [score:8]
To examine the potential regulation of OGT expression by the miR-200 family, transfection assays with 200a/200b mimics or inhibitors were performed to determine whether miR-200a/200b mimics modulates OGT gene expression. [score:7]
Interestingly, the miR-200 family members were not predicted to bind to the mouse ICAM-1 3′-UTR; however, our results show that miR-200a/200b mimics significantly attenuated endothelial ICAM-1 expression, suggesting that ICAM-1 expression was indirectly regulated by miR-200a/200b mimics in the db/db diabetic mice. [score:7]
While we did not investigate the role of miR-141 and miR-200c/429 in regulating OGT expression, it is possible that all members of the miR-200 family can regulate OGT expression, as they have the same seed sequence as either miR-200a or miR-200b. [score:5]
The transcriptional inhibitor ZEB-1 is a well-known target of the miR-200 family members through a reciprocal repression mechanism to promote epithelial-mesenchymal transition and cancer invasion (Burk et al., 2008). [score:5]
miR-200a mimic, miR-200b mimic, miR-200a inhibitor, miR-200b inhibitor, and negative control (NC) were transfected into the HAECs as previously described (Wang et al., 2014; Lo et al., 2017). [score:5]
Reddy et al. reported that vascular smooth muscle cells and aortic tissue from db/db mice showed increased miR-200b/429 expression, and an miR-200b mimic increased monocyte binding to db/+ vascular smooth muscle cells, whereas an miR-200b inhibitor decreased monocyte binding in the db/db vascular smooth muscle cells (Reddy et al., 2012). [score:5]
The miR-200 family is now known to play an inhibitory role in cancer progression because of the strong suppressive effects of its members on cell transformation, migration, proliferation, invasion, and metastasis (Humphries and Yang, 2015). [score:5]
Although HG caused a significant decrease in the miR-200a and miR-200b expression levels, the osmotic control LG did not modulate the expression levels of miR-200a and miR-200b (Figure 2C). [score:5]
org) did not identify functional group 2 members as targeting ICAM-1; however, we found that the miR-200b mimic significantly decreased ICAM-1 expression in HAECs. [score:5]
Belgardt et al. reported that β-cell specific overexpression of miR-200 family induced β-cell apoptosis and type 2 diabetes, whereas miR-200 family knock-out reduced β-cell apoptosis and improved type 2 diabetes symptoms (Belgardt et al., 2015). [score:4]
However, this study confirmed that the miR-200 family is dysregulated in HG-stimulated HAECs, and both in vitro and in vivo experiments revealed that miR-200a/200b have therapeutic potential in treating diabetic vascular disease. [score:4]
Figure 2OGT is a direct target of miR-200a and miR-200b. [score:4]
Magenta and colleagues reported that miR-200 family members were increased in H [2]O [2]-stimulated human umbilical endothelial cells, which play a critical role in ROS -mediated senescence and apoptosis by downregulating the zinc-finger E-box binding homeobox 1 (ZEB-1) (Magenta et al., 2011). [score:4]
OGT is a direct target of miR-200a and miR-200b. [score:4]
Furthermore, intraocular injection of an miR-200b mimic prevented an increase in vascular endothelial growth factor expression and vascular permeability. [score:3]
These findings suggest that the miR-200 family has cytoprotective roles, consistent with its role as a tumor suppressor. [score:3]
Real-time PCR data revealed that the most highly expressed miRs among functional groups 1 and 2 were miR-200a and miR-200b, respectively. [score:3]
A segment of the OGT 3′-untranslated region (UTR) that includes both miR-200a and miR-200b binding sites was constructed into the pmirGLO vector (Promega, Madison, WI, USA). [score:3]
non-diabetic samples), suggesting that the miR-200 family has various roles in inflammation -associated diseases, including diabetes. [score:3]
Similarly, HG stimulation for 24 h caused a significant decrease in the miR-200a, miR-141, miR-200b, miR-200c, and miR-429 expression levels to 27, 18, 39, 71, and 39%, respectively, of the levels in the unstimulated control. [score:3]
In addition, the miR-200b mimic not only decreased the expression levels of protein O-GlcNAcylation, but also decreased OCA mRNA. [score:3]
Importantly, human retinal tissue from diabetic enucleated eyes showed lower miR-200b expression than non-diabetic retina (McArthur et al., 2011). [score:3]
As shown in Figure 2B, real-time PCR analyses showed that HG stimulation for 12 h resulted in a significant decrease in miR-200a, miR-141, miR-200b, miR-200c, and miR-429 expression levels to 53, 38, 11, 42, and 33%, respectively, of the levels in the unstimulated control. [score:3]
Furthermore, downregulation of miR-200 family members in the HG-stimulated HAECs can modulate the expression levels of ZEB-1. To investigate whether miR-200a/200b can interact with the 3′-UTR of OGT mRNA, we performed a luciferase reporter assay. [score:3]
In the endothelial layers, quantification of immunoreactivity signals showed that OGT expression was decreased significantly—to 0.37- and 0.43-fold in the db/db (miR-200a mimic) and db/db (miR-200b mimic) groups compared with that in the db/db (negative control) group. [score:2]
As shown in Figure 2F, cotransfection of pmirGLO-OGT-3′-UTR and either the miR-200a or miR-200b mimic resulted in a decrease in the luciferase signal to 83 and 74%, respectively, of that in the negative control, confirming direct binding of miR-200a/200b to the 3′-UTR of OGT mRNA. [score:2]
This suggests that either miR-200b can bind the miR-200a binding site of the ICAM-1 3′-UTR through G:U wobble binding, or ICAM-1 was indirectly repressed by miR-200b. [score:2]
ICAM-1 expression in the endothelial layers was also decreased significantly—to 0.34- and 0.33-fold in the db/db (miR-200a mimic) and db/db (miR-200b mimic) groups compared with that in the db/db (negative control) group (Figure 5C). [score:2]
The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. [score:2]
The microRNA-200 family regulates pancreatic beta cell survival in type 2 diabetes. [score:2]
All members of the miR-200 family were showed homology with the 3′-UTR of human OGT mRNA in their seed sequences (Figure 2A), indicating potential regulation of OGT by miR-200 members. [score:2]
There is conflicting evidence regarding the regulatory role of miR-200 family members in diabetes. [score:2]
Similarly, 24 h HG stimulation decreased miR-200a, miR-141, miR-200b, miR-200c, and miR-429 expression levels to 27, 18, 39, 71, and 39% of the control level, respectively N = 5. ** p < 0.01 and *** p < 0.001 compared with control. [score:2]
Particularly, members of the miR-200 family are highly sensitive to ROS. [score:1]
A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells. [score:1]
Fourteen-week-old db/db mice were injected with 100 μL miR-200a mimic, miR-200b mimic, or NC (13 μg per week, three times) by tail-vein injection using equal volume mixtures of Lipofectamine™ 2000 and miR-200a mimic, miR-200b mimic, or NC. [score:1]
The five known miR-200 members are located on two chromosomes (chromosome 12: miR-141 and miR-200c; chromosome 1, miR-200a, miR-200b, and miR-429) and are highly conserved in higher vertebrates (Gheldof et al., 2012). [score:1]
P160621-009 F07; miR-200b: Cat No. [score:1]
Based on manual sequence alignment, both human OGT and mouse Ogt 3′-UTRs share an identical nucleotide sequence (5′-AGUAUU-3′) that is complementary to the seed sequence of miR-200 functional group 2, suggesting that human OGT 3′-UTR also binds to miR-200b/200c/429, similar to mouse Ogt. [score:1]
These findings support that the miR-200a::OGT and miR-200b::OGT interactions are functional. [score:1]
The sequence is listed in Supplemental Data 2. HAECs were cotransfected with 1 μg of constructed plasmids and 100 nM of miR-200a mimic, miR-200b mimic, or NC using Lipofectamine™ 2000 (Invitrogen). [score:1]
MicroRNA-200 is induced by thioredoxin-interacting protein and regulates Zeb1 protein signaling and beta cell apoptosis. [score:1]
Alternatively, G:U wobble pairing may explain the binding of miR-200b (seed sequence: 3′-GUCA UAA-5′) to the miR-200a binding site on OGT 3′-UTR (5′-CAGU GUU-3′), as Doench et al. reported that thermodynamically favorable G:U pairing in the seed region can retain significant gene repressive effects (Doench and Sharp, 2004). [score:1]
However, the miRanda-mirSVR database identified all five miR-200 family members as potential binding partners of the mouse Ogt 3′-UTR. [score:1]
MicroRNA-200b regulates vascular endothelial growth factor -mediated alterations in diabetic retinopathy. [score:1]
In this study, web -based bioinformatics analysis using miRanda-mirSVR and miRDB database revealed that the members of the miR-200 functional group 1, but not of group 2, may bind to the 3′-UTR of human OGT mRNA. [score:1]
In contrast, the miR-200 family has also been reported to have protective effects. [score:1]
However, reports of miR-200 family members in diabetes -associated studies are conflicting. [score:1]
The microRNA-200 family: still much to discover. [score:1]
Therefore, miR-200a and miR-200b were selected for further analysis. [score:1]
Immunoreactivity signals observed in the endothelial layers of the db/m (vehicle), db/db (negative control), db/db (miR-200a mimic), and db/db (miR-200b mimic) groups were quantified as previously described (Federici et al., 2002). [score:1]
Mitra et al. also reported the application of miR-200b nanoparticles for treating diabetic retinopathy in mice (Mitra et al., 2016). [score:1]
The miR-200 family has been reported to have a detrimental effect. [score:1]
Although ROS is involved in modulating the miR-200 family and protein O-GlcNAcylation, the interplay between these factors is not clear. [score:1]
Transfection of miR-200a and miR-200b mimics. [score:1]
The seed sequence 5′-AA CACUG-3′ defines functional group 1 (miR-141/200a), while 5′-AA UACUG-3′ defines functional group 2 (miR-200b/200c/429) (Senfter et al., 2016). [score:1]
Nanoparticle -mediated miR200-b delivery for the treatment of diabetic retinopathy. [score:1]
Some studies showed that miR-200 family members have harmful effects on diabetes progression (Filios et al., 2014; Belgardt et al., 2015), diabetes -induced inflammation (Reddy et al., 2012), and diabetes -induced endothelial dysfunction (Zhang et al., 2016), while others showed that members of the miR-200 family have protective effects because of their anti-inflammatory (McArthur et al., 2011) and anti-fibrotic properties (Wei et al., 2014). [score:1]
[1 to 20 of 61 sentences]
14
[+] score: 168
Other miRNAs from this paper: mmu-mir-200a, mmu-mir-200c
Genes associated with angiogenesis were also enriched, with increased expression of 5/6 anti-angiogenic gene decreased expression of 11/15 pro-angiogenic genes (Supplementary Fig.   5B), suggesting that miR-200 -targeted genes may play a role in the inhibition of angiogenesis. [score:9]
Relative RNA expression of miR-200b/c -depleted vs scramble -treated Ishikawa and MFE-280 cells, and miR-200c -overexpressed vs non -targeting control treated SNU-685 and JHUCS-1 cells, are shown. [score:7]
Secondly, the miR-200 knockdown we achieved was sufficient to increase expression of ZEB1 and ZEB2, which are direct targets of miR-200c. [score:7]
Using mutational profiling and analysis of miRNA and mRNA expression, we confirmed that our mo del cell lines match miR-200 and EMT gene expression profiles representative of EACs (specifically, endometrioid and serous histologic subtypes) and UCSs. [score:6]
In UCS cell lines, we also observed increased expression of ZEB1 and ZEB2, transcription factors upstream in the EMT pathway that are targeted by miR-200 for degradation (Fig.   1C). [score:5]
Specifically, ectopic miR-200 expression was shown to decrease metastasis, inhibit angiogenesis, and induce normal vascularization. [score:5]
Figure 4Differential expression of EMT/MET-related genes in EAC-miR-200 depleted and UCS-miR-200 overexpressed cells. [score:5]
In summary, our mo del cell lines are representative of EAC and UCS, based on both mutational landscape and miR-200/EMT expression features. [score:4]
Firstly, we used miR-200b and miR-200c inhibitors to ensure knockdown of both miR-200 gene clusters. [score:4]
Whole transcriptome sequencing confirms MET changes in miR-200 overexpressed UCS cells and suggests a role for miR-200 in the regulation of angiogenesis. [score:4]
We did not observe changes in cellular morphology after miR-200 depletion in either of the EAC cell lines after 40 days of growth (Supplementary Fig.   1), suggesting that the increase in ZEB1/2 expression alone is not sufficient to drive EAC cells to undergo EMT. [score:3]
Finally, we show that miR-200 overexpression in UCS cells leads to decreased tumor growth and aggressiveness both in vitro and in vivo. [score:3]
While miR-200 overexpression in JHUCS-1 cells resulted in MET functional changes (increased cell adhesion and decreased cell migration and invasion), we did not observe the same changes in SNU-685 cells (decreased cell adhesion, no significant change in cell migration or invasion). [score:3]
miR-200 overexpression can induce MET 22, 23, 31; however, miR-200 -driven MET in UCS has not been previously reported. [score:3]
A recent study exploring the clinical outcomes related to miR-200 expression found that miR-200 plays an important role in metastasis and angiogenesis [32]. [score:3]
Four days after seeding, proliferation was decreased by ~37% and ~67% in miR-200 overexpressing SNU-685 and JHUCS-1 cells, respectively. [score:3]
pathologic) are ultimately determined by a complex interplay between pro-angiogenic and anti-angiogenic factors, it appears that miR-200 is associated with inhibition of angiogenesis. [score:3]
Figure 3Effects of ectopic miR-200 overexpression in UCS cell lines. [score:3]
Given that EMT is a reversible process, we sought to explore whether miR-200 overexpression in UCS cells would cause MET. [score:3]
Ishikawa and MFE-280 cell lines were transiently transfected with miR-200b/c inhibitor every 4 days for a total of 40 days (D = day, C = transfection cycle). [score:3]
Ectopic expression of miR-200 has been shown to increase sensitivity of ovarian, breast and endometrial cancer cells to chemotherapeutic agents 48– 51 and enhance radiosensitivity in lung cancer [52]. [score:3]
This may be one mechanism by which increased miR-200 expression in UCS cells leads to decreased tumor growth and metastasis. [score:3]
As expected, constitutive miR-200b/c depletion resulted in increased expression of ZEB1 and ZEB2 in both cell lines by 1.4- to 5.9-fold and 1.9- to 3.5-fold, respectively (Fig.   2B). [score:3]
Taken together, our data suggest that the only consistent EMT-like changes achievable in EAC cells, either by constitutive miR-200 depletion or exogenous TGF-β treatment, are increases in ZEB1 and ZEB2 expression. [score:3]
In conclusion, although miR-200 depletion and increase in ZEB1/2 expression resulted in a modest decrease in cellular adhesion, there was no evidence of molecular or functional complete EMT. [score:3]
We demonstrate that xenografted UCS tumors with miR-200 overexpression show striking changes in morphologic and immunohistochemical phenotype, becoming more epithelial and less mesenchymal-like. [score:3]
Bar graphs represent relative miR-200b/c expression. [score:3]
The cells were transiently transfected with miR-200b/c inhibitors or negative control (scramble) every 4 days. [score:3]
Our data show that, despite miR-200 depletion and subsequent increases in ZEB1/2 expression in EACs, there is no evidence of complete EMT induction. [score:3]
After selecting our cell lines, we sought to examine whether their miR-200 expression and EMT signature profiles were consistent with their named histologic subtypes. [score:3]
Notably, 913 differentially expressed genes were identified in UCS cells with miR-200c OE, whereas only 185 genes were identified in EAC cells with miR-200b/c KD. [score:3]
We hypothesized that miR-200 overexpression in UCS cells would result in a less aggressive, epithelial-like phenotype. [score:3]
Similar to the results from our gene expression studies, miR-200b/c KD in Ishikawa and MFE-280 cells resulted in subtle EMT changes overall. [score:3]
miR-200 -depleted EACs exhibit increased ZEB1 and ZEB2 expression without significant changes in other EMT markers. [score:3]
Upon consecutive transient depletion of miR-200b/c in EAC cell lines, we found increased expression of ZEB1/2 and decreased cellular adhesion, as expected in EMT. [score:3]
Successful miR-200b/c knockdown was confirmed by TaqMan® Real-Time PCR (Fig.   2A). [score:2]
Compared to the EACs, UCSs had undetectable expression of miR-200b/c (Fig.   1B). [score:2]
There were no statistically significant differences in migration, invasion or proliferation between miR-200b/c knockdown and scramble -treated cells. [score:2]
Fold-change in migration or invasion was calculated by comparing miR-200 knockdown or miR-200 expressing cells to their negative controls. [score:2]
Changes in miR-200, mRNA and protein expression were assayed 15 days after the treatment. [score:2]
We examined the gene expression of miR-200 and several well-established EMT markers (ZEB1, ZEB2, E-cadherin, N-cadherin and vimentin) using TaqMan® Real-Time PCR Assays (Fig.   1B–D). [score:2]
Proliferation for either miR-200 knockdown or miR-200 expressing cells was calculated relative to negative controls. [score:2]
Taken together, our in vitro and in vivo data strongly support the conclusion that JHUCS-1 cells readily undergo miR-200 driven MET, leading to decreased tumor aggressiveness. [score:1]
Although UCSs are hypothesized to evolve from EACs 4, 18, 19, 30, the role of miR-200 -driven EMT in the oncogenesis of UCSs has not been previously studied. [score:1]
Our results suggest that while UCSs do not appear to develop from EACs by miR-200 -dependent EMT, UCS cell lines readily undergo miR-200 -induced MET resulting in decreased tumor growth and aggressiveness. [score:1]
Levels of miR-200b and miR-200c remained decreased over 10 transfection cycles. [score:1]
Lack of functional changes in miR-200 -depleted EACs further confirms the absence of complete EMT. [score:1]
Altogether, our results lead us to conclude that UCSs are unlikely to develop from EACs via EMT in a miR-200 -dependent and exclusive manner. [score:1]
Thirdly, these cells were consecutively depleted of miR-200b/c for a prolonged period of time. [score:1]
Figure 2Effects of consecutive transient miR-200 depletion in EAC cell lines. [score:1]
Here, we test the hypothesis that UCSs arise from a carcinomatous origin via miR-200 -driven EMT. [score:1]
We tested the hypothesis that UCSs evolve from EACs by EMT in a miR-200 -dependent manner. [score:1]
Scramble (Scr) represents control for miR200b/c KD (200KD) samples. [score:1]
To investigate whether EACs undergo a miR-200 -driven EMT resulting in a UCS phenotype, we depleted miR-200b/c in Ishikawa and MFE-280 cells using single-stranded RNAs that inhibit endogenous microRNAs. [score:1]
Failure to induce miR-200 -dependent EMT in EAC cell lines due to transient and/or insufficient miR-200 depletion is unlikely for several reasons. [score:1]
There was no difference in proliferation between miR-200b/c -depleted EAC cells and control cells (Fig.   2F). [score:1]
There is also abundant evidence linking miR-200 to treatment sensitivity [47]. [score:1]
We show that while EAC cell lines are resistant to full EMT, UCSs readily undergo miR-200 -induced MET. [score:1]
This suggests that miR-200b/c depletion does not drive EACs into a complete EMT. [score:1]
Additionally, EMT is a reversible process, and mesenchymal-epithelial transition (MET) has been shown to decrease tumor aggressiveness 22, 23. miR-200 has been identified as a key element in the EMT pathway 24– 26. [score:1]
Relative to controls, migration and invasion were not significantly different in miR-200b/c -depleted EAC cells (Fig.   2E). [score:1]
Thus far, our data indicate that EACs undergo only partial EMT, and that neither miR-200b/c depletion nor TGF-β treatment is sufficient to induce a full transition from an EAC to a UCS phenotype. [score:1]
DAVID analysis failed to demonstrate any significant enrichment in EAC cells that underwent miR-200b/c KD. [score:1]
To explore whether EACs are able to undergo complete EMT by mechanisms other than miR-200 depletion, we treated Ishikawa, HEC-251 and MFE-280 cells with TGF-β, a well-defined and potent inducer of a full EMT response (Supplementary Fig.   2). [score:1]
To test the hypothesis that UCSs develop from a carcinomatous phenotype in a miR-200 -dependent manner, we selected endometrial adenocarcinoma (EAC) cell lines based on histologic and genetic profiles (Fig.   1A). [score:1]
[1 to 20 of 65 sentences]
15
[+] score: 168
These EMT-type cells also showed decreased expression of miR-200 or let-7, and reversal of EMT by forcing expression of miR-200 significantly inhibited clonogenic and prostasphere-forming ability, which was consistent with the inhibition of Notch1 and Lin28B expression. [score:11]
Loss of miR-200b and miR-200c lead to increased ZEB1, Notch1 and Lin28B expression, resulting in decreased expression of let-7. Downregulation of let-7 leads to the up-regulation of Sox2, Nanog and Oct4, which together with Notch1 and Lin28B contribute to stem cell signatures. [score:11]
The expression of ZEB1 was found to be down-regulated by forced expression of miR-200b and miR-200c (Fig. 4C), which was consistent with the reversal of EMT phenotype (Fig 4A). [score:8]
These results suggest that miR-200b and miR-200c but not miR-200a inhibited self-renewal of PC3 PDGF-D cells by controlling target gene expressions of miR-200b and miR-200c. [score:7]
Reversal of EMT by re -expression of miR-200 inhibited prostasphere-forming ability of EMT-type cells and reduced the expression of Notch1 and Lin28B. [score:7]
Interestingly, recent studies have also shown that miR-200 family not only could regulate the processes of EMT by targeting E-box binding protein ZEB1 and ZEB2 [15] but was also associated with stem-like cell signatures by regulating the expression of Bmi1 [16], [17]. [score:7]
Our results presented above showed that the miR-200b and miR-200c inhibited lin28B expression (Fig. 4C), which is known to bind to primary let-7 and pre-let-7 RNA and inhibits the accumulation of mature let-7 miRNA [19]. [score:7]
Moreover, knock-down of Lin28B markedly increased let-7 expression, suggesting that miR-200 and let-7 could act as a target for the prevention of tumor recurrence and metastasis in PCa. [score:6]
Down-regulation of Notch1 by miR-200 was partially responsible for the inhibition of colonogenic and prostasphere-forming ability of PC3 PDGF-D cells. [score:6]
Thus, we assessed the expression of the putative targets of miR-200b and miR-200c such as Notch1, Bmi1 and lin28B in PC3 PDGF-D cells transfected with miR-200 family because miR-200b and miR-200c have three or one putative binding sites in the 3′UTR of Lin28B, Bmi1 mRNA (Fig. S3) and Notch1 mRNA. [score:5]
The miR-200b and miR-200c transfection dramatically reduced the expression of Notch1 and lin28B, but had no effect on the expression of Bmi1 (Fig. 4C). [score:5]
More importantly, re -expression of miR-200b and miR-200c significantly inhibited the prostasphere-forming ability of PC3 PDGF-D cells (Fig. 4B). [score:5]
We found that re -expression of miR-200b and miR-200c dramatically reduced the sphere-forming ability concomitant with decreased expression of Lin28B and Notch1 in PC3 PDGF-D cells. [score:5]
Moreover, re -expression of miR-200b or miR-200c dramatically reduced the activity of 3′UTR of Notch1 luciferase in PC3 PDGF-D cells, while re -expression of miR-200a with one base of seed sequence different from miR-200b and miR-200c had no effects on the activity of 3′UTR of Notch1 luciferase (Fig. 5B). [score:5]
Moreover, miR-200 and let-7 played a critical role in linking EMT phenotype with stem cell signatures by regulating the expression of Lin28B and Notch1. [score:4]
To determine whether Notch1 is the direct target of miR-200b and miR-200c, we analyzed the activity of 3′ UTR of Notch1 in PC3 Neo and PC3 PDGF-D cells transfected with 3′UTR of Notch1 luciferase plasmid as well as PC3 PDGF-D cells co -transfected with 3′UTR of Notch1 luciferase plasmid and miR-200b or miR-200c. [score:4]
These results suggest that the miR-200b and miR-200c regulate the Notch1 expression by binding to 3′UTR of Notch1 mRNA. [score:4]
These results suggest that miR-200 mediated down-regulation of Notch1 was partially responsible for self-renewal capacity and colonogenic growth of EMT-like cells having stem cell features. [score:4]
Interestingly, recent studies have shown that some natural agents could up-regulate miR-200 and reverse the EMT phenotype [44], [45]. [score:4]
The miR-200, especially miR-200b and miR-200c were identified to be mechanically linked with EMT phenotype and stem cell signatures in these cells via regulation of Notch1 and/or Lin28B expression. [score:4]
In our previous studies, we found significant down-regulation of miR-200 family in PC3 PDGF-D cells with EMT phenotype [28], which was consistent with our miRNA microarray data (Table S3). [score:4]
Interestingly, miR-200b and miR-200c were significantly decreased in PC3 PDGF-D cells and miR-200c was down-regulated in ARCaP [M] cells. [score:4]
Two evolutionary conserved families, miR-200 and let-7 have been shown to regulate the differentiation processes during the development. [score:3]
Figure S2 MiR-200b and miR-200c inhibited prostasphere-forming ability of PC3 PDGF-D cells. [score:3]
To reveal whether expressions of miR-200 family are associated with stem cell signatures, PC3 PDGF-D cells were transfected with miR-200a, miR-200b and miR-200c. [score:3]
MiR-200b and miR-200c expression linked cancer stem cell signatures with EMT phenotype. [score:3]
In this study, we found that PCa cells with EMT phenotype displayed stem-like cell features characterized by increased expression of Sox2, Nanog, Oct4, Lin28B and/or Notch1, consistent with enhanced clonogenic and sphere (prostasphere)-forming ability and tumorigenecity in mice, which was associated with decreased expression of miR-200 and/or let-7 family. [score:3]
MiR-200 repressed the self-renewal capacity by regulating Notch1 and Lin28B expression. [score:3]
Lin28B, a Lin28 homolog, was significantly repressed by re -expression of miR-200b and miR-200c in our cell mo del. [score:3]
In order to investigate whether miR-200 family could contribute to the generation of cancer stem-like cell characteristics in ARCaP [M] and PC3 PDGF-D cells by regulating the expression of Nanog, Oct4 and Sox2, Lin28B and other stem cell -associated makers, we have searched targets of miR-200 family in www. [score:2]
Therefore, we analyzed the expression of Lin28B, Notch1 and Bmi1, and performed the sphere-forming assay using ARCaP [M] and PC3 PDGF-D cells transfected with miR-200. [score:2]
Conserved, predicted binding sites for the seed sequences of miR-200b and mir-200c in the 3′UTR of Lin28B or Bmi1 mRNA were shown. [score:1]
0012445.g005 Figure 5 (A) Conserved, predicted binding sites for the seed sequences of miR-200b and mir-200c in the 3′UTR of Notch1 mRNA. [score:1]
MiR-200b and miR-200c reduced the number of prostaspheres. [score:1]
Single cell suspensions of PC3 Neo, PC3 PDGF-D, ARCaP [E], ARCaP [M] and PC3 PDGF-D cells transfected with Sox2, Nanog, Oct4, Lin28B or control siRNA as well as miR-200 and let-7, were plated on ultra low adherent wells of 6-well plate (Corning, Lowell, MA) at 1000 or 2000 cells/well in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen). [score:1]
Table S3 The levels of miR-200 and let-7 family in PC3 Neo and PC3 PDGF-D cells. [score:1]
We found that transfection of miR-200b and miR-200c induced reversal of EMT to MET phenotype (Fig. 4A). [score:1]
0012445.g004 Figure 4PC3 PDGF-D cells were transfected with pre-miR-200. [score:1]
Cells were transfected with 100 nmol/L of Sox2, Nanog, Oct4, Lin28B siRNA or control siRNA (Santa Cruz) as well as 20 nmol/L of miR-200 or let-7 (Ambion, Austin, TX) using DharmaFECT3 siRNA transfection reagent (DHARMACON, Lafayette, CO). [score:1]
Taken together, PC3 PDGF-D cells with EMT signatures showed stem-like cell characteristics through over -expression of Nanog, Oct4 and Sox2, Lin28B and activation of polycomb repressor complex 2. The miR-200 family plays a critical role in mediating EMT phenotype induced by various factors including PDGF-D [28], [40], [41]. [score:1]
We found that miR-200b and miR-200c have three binding sites at the 3′UTR of Lin28B mRNA, one in Notch1, Sox2 and Bmi1. [score:1]
Figure S3 Binding sites of miR-200b and miR-200c in 3′UTR of Lin28B or Bmi1 mRNA. [score:1]
3 days after transfection, cells were split and transfected repeatedly with pre-miR-200 every 3–4 days for 14 days. [score:1]
Thus, miR-200b and miR-200c appear to play a central role in linking EMT with stem cell features in prostate cancer progression. [score:1]
The miR-200b and miR-200c has one binding sites in the 3′UTR of Notch1 (Fig. 5A). [score:1]
PC3 Neo and PC3 PDGF-D cells were seeded at a density of 6×10 [3] cells per well in 96-well plate and incubated for 24 h. The cells were co -transfected with Notch1 3′UTR luciferase plasmid (Switch Gear Genomics, Menlo Park, CA) and pre-miR-200 using DharmaFECT duo transfection reagent (DHARMACON, Lafayette, CO). [score:1]
PC3 PDGF-D cells were transfected with pre-miR-200. [score:1]
[1 to 20 of 47 sentences]
16
[+] score: 167
At 15 dpe in both, control and miR-200 -gof conditions the percentage of GFP + cells expressing calretinin was approximately 2% suggesting that the calretinin expressing neuroblasts at 4 and 7 dpe after miR-200 -gof electroporation either downregulated calretinin or died at later stages. [score:8]
Altogether these results show that knockdown of miR-200 family microRNAs interferes with terminal neuronal differentiation while their premature expression induces in a subset of postnatally generated precursors defined aspects of neuronal maturation: cell-cycle exit and premature expression of a mature neuron marker. [score:6]
These did not express significant levels of either GluR2 or DCX (Fig. 2b), thus likely representing glia and GluR2 negative neurons 28. qRT-PCR analyses to detect miR-200b and miR-141 as representative members of each of the two miR-200 clusters showed strongest expression in the mature GABAergic (GFP-low) population (Fig. 2c), in agreement with the deep-sequencing data (Fig. 1). [score:5]
miR-200 induces calretinin expression through Zeb2 inhibition. [score:5]
The miR-200 -gof and a GFP- expression vectors were co-electroporated into the SVZ and Zeb2 expression was analyzed in the RMS at 4 dpe. [score:5]
Only in the miR-200 over -expression condition GFP + cells expressing calretinin are detected. [score:5]
miR-200 sponge partially rescues the inhibitory activity of the miR-200 expression vector. [score:5]
Moreover, transgenic co -expression of Zeb2 rescued the miR-200 mediated induction in calretinin expression (Fig. 4d). [score:5]
For b-e the qPCR values shown in the histograms result from 2 (b, d) or 3 (c, e) qPCR experiments (4 wells per condition in each experiment) (f) Electroporation of an expression construct driving GFP with regulatory sequences of the human miR-429/miR-200a/miR-200b cluster leads to GFP-labeled cells in the OB. [score:4]
The quantity of NeuN negative cells in the OB after miR-200 knockdown increases by only 5%, while premature expression of the family induces calretinin in less than 10% of all transfected cells. [score:4]
To generate the vector expressing gfp under the control of the human miR-200b/miR-200a/miR-429 regulatory sequence we subcloned gfp from pCX-GFP into the pGL3-1574/ + 120 vector obtained from addgene. [score:4]
microRNA expression in the OB neurogenic system: the miR-200 family. [score:3]
Taken together, the above results demonstrate that miR-200 microRNAs expression increases with maturation in the postnatal neuronal lineage that generates OB interneurons. [score:3]
Such a role for Zeb2 in the differentiation process would account for the appearance of calretinin positive cells in the RMS in the context of miR-200 overexpression. [score:3]
In the glial fraction miR-200b was expressed at a very low level whereas miR-141 presence was significant (Fig. 2e). [score:3]
All miR-200 family members are exclusively expressed in the OB but not in the stem cell or migratory compartments. [score:3]
The observation that miR-200b and miR-141 are also expressed in the GFP-neg fraction indicates that both micro -RNAs are present either in the glial fraction or in GAD67 negative neurons in the OB, like glutamatergic interneurons or projection neurons such as mitral cells. [score:3]
How to cite this article: Beclin, C. et al. miR-200 family controls late steps of postnatal forebrain neurogenesis via Zeb2 inhibition. [score:3]
First, we analyzed the consequences of miR-200 inhibition on neuronal differentiation in the OB using the miR-200-sponge. [score:3]
Our finding that the miR-200 promoter fragment that we used to drive GFP expression is only active in a small fraction of the transfected neurons supports this potential lack of competence. [score:3]
We conclude that regulation of Zeb2 by miR-200 family microRNAs regulates neuronal maturation during postnatal neurogenesis. [score:3]
Together with their synchronized expression this suggested a redundant or cooperative function of the miR-200 family members in the OB. [score:3]
We asked if premature expression of miR-200 family microRNAs interfered with Zeb2 levels in neuronal precursors. [score:3]
As miR-200 expression occurs during late stages of OB neurogenesis, we analyzed the electroporated cells at 15 dpe, a time point of advanced maturation. [score:3]
The miR-200 expression vector (miR-200 -gof) was generated by PCR amplification of both miR-200 clusters from CD1 mouse genomic DNA and sub-cloning of amplified fragments into pCX-MCS2. [score:3]
Altogether, these data strongly indicated that the miR-200 induced increase in neuronal differentiation in the RMS was mediated by inhibition of Zeb2. [score:3]
GFP -expressing cells showed significantly less Zeb2 immunoreactivity when miR-200 -gof was present (Fig. 4b,c). [score:3]
Therefore we aimed at refining miR-200 family expression in the system combining transgenic and sorting approaches. [score:3]
Another question concerns the observation that only a small fraction of neuronal precursors shows altered differentiation after interference with miR-200 expression. [score:3]
First, we constructed an in vivo expression vector that generates a single transcript containing the two genomic regions harboring the miR-200 family clusters under the control of the chicken β-actin promoter (miR-200 -gof, Fig. 3a). [score:3]
The limited effects might be due to the fact that only a subfraction of the transfected cells are responsive to either inhibition or increase of miR-200 microRNAs. [score:3]
qRT-PCR analyses demonstrated that miR-200b and miR-141 expression were highest in the neuronal fraction. [score:3]
Indeed, the five members of the miR-200 -family were exclusively expressed in the OB and densely clustered in the heat map representation (Fig. 1b,c). [score:3]
This demonstrates that miR-200b and miR-141, and therefore likely the entire miR-200 family, are present in the postnatal neurogenic lineages and that their expression level increases with maturation. [score:3]
In mice, three members (miR-429, miR-200a, miR-200b) reside in one intergenic cluster on chromosome 4. These showed particularly high expression levels (Fig. 1c). [score:3]
Moreover, both, Zeb2 loss-of-function and miR-200 gain-of-function led to a comparable phenotype, the premature expression of the late neuronal subtype marker calretinin. [score:3]
However, 4 days after miR-200 -gof electroporation 4.79% ± 1.15%, (Fig. 3g) of the GFP positive cells in the RMS expressed calretinin and this percentage increased to 8.96%; ± 1.82% at 7 dpe (Fig. 3f,g). [score:3]
Simultaneous expression of the miR-200-sponge was able to partially restore luciferase activity (Fig. 3b), altogether demonstrating that both vectors were functional. [score:3]
Knockdown of miR-200 significantly increased the percentage of electroporated cells in the OB that were negative for NeuN, a marker for mature neurons (control: 1.99% ± 0,43%; miR-200-sponge: 7.32% ± 1.76%; Fig. 3c,d). [score:2]
Mir-200 family target Zeb2 in the OB neurogenic system. [score:2]
Next, we aimed at analyzing the regulatory mechanism that underlies the differentiation-inducing function of miR-200 family microRNAs in the system. [score:2]
In cancer cells the interaction between miR-200 and Zeb proteins is a key regulatory event in the control of epithelial-mesenchymal transition (EMT) and has been extensively implicated in the metastasis of different cancer types. [score:2]
Another family of microRNAs that is tightly regulated during postnatal OB neurogenesis is the miR-200 family, that has been implicated in neurogenesis in cultured cells 25 and sensory neurons 26. [score:2]
miR-200 family microRNAs regulate neuronal differentiation. [score:2]
First, repression of Zeb2 by miR-200 microRNAs has a direct impact on differentiation of at least a subfraction of neuronal progenitors. [score:2]
Differences between groups of cells were analyzed pairwise with a t-test (control vs miR-200 calretinin positive P < 2.2e-16; control vs miR-200 calretinin negative P < 2.2e-16); n = number of cells used for analysis; an = number of animals from which analyzed cells were issued. [score:1]
Co-transfection of HeLa cells with miR-200 -gof and the resulting plasmid strongly repressed luciferase activity. [score:1]
The miR-200 family contains two different seed sequences (differing in only one nucleotide) and both sequences are present in the two genomic loci. [score:1]
Finally, we introduced the human sequence upstream of the miR-200b/miR-200a/miR-429 cluster 29 upstream of a GFP-cassette. [score:1]
We then used in vivo brain electroporation to introduce the miR-200-sponge or miR-200 -gof constructs into the OB neurogenic system. [score:1]
In vivo functional analysis of miR-200 microRNAs. [score:1]
The sponge construct was designed according to 58 with 4 repetitions of 2 oligonucleotides (5′-GACACATCGTTACTCTCAGTGTTAGACACGGCATTACTCTCAGTATTA and 5′-GACTTCATCATTACTCCCAGTATTAGACCCATCTTTACTCTCAGTGTTA) partially complementary to any member of the miR-200 family were placed behind a destabilized GFP gene in pCX-d2-GFP plasmid. [score:1]
Differences between groups were analyzed pairwise with the Man and Whitney test (control (n = 5 animals) vs miR-200 (n = 5 animals) P = 0.008816, miR-200 (n = 5 animals) vs miR-200 + Zeb2 (n = 7 animals) P = 0.04236). [score:1]
The best-characterized targets of the miR-200 family, albeit in cancer backgrounds, are the zinc finger proteins Zeb1 and Zeb2 30. [score:1]
We focused our functional analysis on the miR-200 family. [score:1]
It would also explain the lack of differentiation, as measured by decreased NeuN staining, when miR-200 is inhibited. [score:1]
Second, we investigated if expression of the miR-200 members at early stages of OB neurogenesis was sufficient to induce premature neuronal differentiation. [score:1]
To this end we electroporated miR-200 -gof into the lateral ventricular wall and analyzed their progeny. [score:1]
The 3′UTR of the zinc finger/homeodomain transcription factor Zeb2, a well-characterized miR-200 target 30, was cloned downstream the firefly luciferase gene in the pmiRGlo vector (Promega). [score:1]
Second, we designed a miR-200-sponge that contained four repeats capable to bind each of the miR-200 family members (Fig. 3a). [score:1]
We thus investigated whether premature expression of miR-200 can induce premature exit of cell-cycle. [score:1]
[1 to 20 of 61 sentences]
17
[+] score: 161
Other miRNAs from this paper: mmu-mir-141, mmu-mir-200a, mmu-mir-200c, mmu-mir-429
We found that Notch-1 could be one of the target genes of miR-200 family (miR-200b, miR-200c) because over -expression of these miRNAs significantly inhibited Notch-1 expression in prostate cancer [31] and pancreatic cancer (unpublished data). [score:9]
Over -expression of miR-200b decreased the expression of Jagged ligands and Notch target gene such as Hes-1, Hey-1, and Bcl-2, leading to cell growth inhibition. [score:9]
B, Left and middle panel, Re -expression of miR-200b inhibited the expression of Jagged-1 target genes at mRNA and protein levels in Rink-1 cells. [score:9]
Moreover, novel strategies for the re -expression of miR-200 and its consequence could be tested in this animal mo del, which would help in the rational drug design in addition to Notch and NF-κB targeted drugs for the treatment of human PDAC for improving the overall survival of patients diagnosed with this devastating disease. [score:7]
Middle panel, Re -expression of miR-200b did not regulate the expression of Notch receptors in Rink-1 cells. [score:6]
Most interestingly, recent studies have shown that the miR-200 family regulates EMT by targeting ZEB expression. [score:6]
Based on our results, we conclude that one possible mechanism by which the tumors developed in the compound KCI transgenic mice with activated K-ras and Ink4a/Arf deficiency is in part due to the loss of miR-200 family, which leads to the activation of Jagged/Notch and NF-κB signaling pathway, resulting in the up-regulation of NF-κB target genes, such as MMP-9, c-myc, survivin, Bcl-2, cyclin D1, and COX-2 as summarized in the cartoon diagram (Fig. 7) and contributes to tumor aggressiveness. [score:6]
We have reported earlier that miR-200a, miR-200b, and miR-200c are down-regulated in gemcitabine-resistant pancreatic cancer cells, which have high expression of Notch pathway and contributed to the acquisition of EMT phenotype [33], [34]. [score:6]
C, The expression of miR-200 family was down-regulated in the tumors of the KCI mice as assessed by real-time RT-PCR. [score:6]
Furthermore, we have shown that miR-200 family regulates the expression of ZEB1, slug, E-cadherin, and vimentin, and thus suggested the re -expression of miR-200 could be useful for the reversal of EMT phenotype to mesenchymal-to-epithelial transition (MET), which has been partly documented in our recent publication [34]. [score:6]
Right panel, Re -expression of miR-200b regulated the expression of Jagged-1 and Jagged-2 mRNAs in Rink-1 cells. [score:6]
Consistent with this notion, we found loss of miR-200a, miR-200b, and miR-200c expression in the tumors of KCI mice, suggesting that activated Notch pathway could also be due to the loss of expression of miR-200 family. [score:5]
Moreover, we found that over -expression of miR-200b inhibited cell growth in Rink-1 cells (Fig. 6B). [score:5]
Moreover, we found down-regulation of miR-200 family, which could also play important roles in tumor development and progression of PDAC in the compound transgenic mice. [score:5]
The data from western blot analysis demonstrated that over -expression of miR-200b decreased the relative protein levels of Jagged-1 and its target gene such as Hes-1, Hey-1, and Bcl-2 (Fig. 6B). [score:5]
Over -expression of miR-200b inhibited the cell growth through Jagged ligands. [score:5]
The miR-200b inhibited Rink-1 cell growth and Jagged-1 expression. [score:5]
Recently many studies have shown that the miR-200 family regulates EMT by targeting zinc-finger E-box binding homeobox 1 (ZEB1) and ZEB2. [score:4]
The miRNA-200 family was down-regulated in KCI mice. [score:4]
Moreover, we found alterations in the expression of miR-200 family, which could also play important roles in tumor development and progression of PDAC in the compound transgenic mice with activated K-ras and Ink4a/Arf deficiency. [score:4]
Over -expression of miR-200b decreased the relative mRNA levels of Jagged-1, Jagged-2 and their target genes by real time RT-PCR assay (Fig. 6A). [score:4]
Right panel, Re -expression of miR-200b inhibited Rink-1 cell growth test by MTT assay. [score:4]
Our previous studies have shown that miR-200a, miR-200b, and miR-200c were down-regulated in gemcitabine-resistant pancreatic cancer cells, consistent with the observed EMT phenotype [32], [33]. [score:4]
Recently, it has been reported that miR-200 family members target Notch pathway components, such as Jagged-1 [35], [36]. [score:3]
A, Left panel, Re -expression of miR-200b was established in Rink-1 cells by transfection with its precursor. [score:3]
Our previous study has shown that Notch pathway could be one of the target of miR-200b [31]. [score:3]
As expected, the expression of miR-200a, miR-200b and miR-200c was significantly decreased in the tumors of KCI mice (Fig. 3C). [score:3]
To address whether miR-200 family is involved in the tumors of KCI mice which showed high expression of Notch (Notch-2 and 4) signaling pathway, we investigated the expression of miR-200 family. [score:3]
One important miRNA is miR-200 family, which is involved in the regulation of EMT, stem cells and the regulation of Notch pathway [35], [36]. [score:3]
0020537.g006 Figure 6 A, Left panel, Re -expression of miR-200b was established in Rink-1 cells by transfection with its precursor. [score:3]
The miR-200 family have been found to regulate Notch signaling pathway [31]. [score:2]
Our results suggest that the activation of Notch and NF-κB together with the loss of miR-200 family is mechanistically linked with the development and progression of PDAC in the compound K-ras [G12D] and Ink4a/Arf deficient transgenic mice. [score:2]
In order to examine whether miR-200 family regulate Notch pathway, we transfected miR-200b precursor into Rink-1 cells. [score:2]
The miR-200 family has five members: miR-200a, miR-200b, miR-200c, miR-141 and miR-429. [score:1]
Since we found low expression of miR-200 family in the tumors of KCI mice, we assessed the EMT markers to investigate whether the tumors in the KCI mice underwent EMT or not. [score:1]
Cells were transfected with 100 nmol/L of Notch-1, Notch-2, Notch-3, Notch-4, Jagged-1 siRNA or control siRNA (Santa Cruz) as well as 20 nmol/L of miR-200b (Ambion, Austin, TX) using DharmaFECT3 siRNA transfection reagent (DHARMACON, Lafayette, CO) as previously described [31]. [score:1]
We confirmed that the transfection of miR-200b precursor increased the relative level of miR-200b in Rink-1 cells (Fig. 6A). [score:1]
[1 to 20 of 37 sentences]
18
[+] score: 145
In green are the gene targets of miR200/182 members that are down-regulated in brain tissue acutely infected with HSV-1. In grey are putative targets of miR200/182 members whose expression was determined to be unchanged. [score:10]
Amongst these genes, 2260 were also predicted targets of miR-200/182, from which 200 were downregulated and 54 upregulated more than 2-fold in mouse brain following infection. [score:9]
Using the target prediction software TargetScan in conjunction with gene expression profiling, we found that miR-200/182 may in fact modulate the biosynthesis of heparan sulfate proteoglycans (HSPGs). [score:7]
In particular, several miR-200/182 members were downregulated in rabies virus infection [67] and West Nile virus infection [16] of mice while upregulated in HCMV [15, 68] and influenza infection of cell culture [69– 70]. [score:7]
The 7 canonical pathways that were significantly enriched (p-value<0.05) in the group of genes that were downregulated in HSVE and also predicted targets of miR-200/182 are shown in Fig 6A. [score:6]
miR-200/182 expression was upregulated during HSVE. [score:6]
Several miR-200/182 members are able to downregulate the expression of Sdc2, a core protein of HSPGs that is important for attachment of numerous viruses, including HSV-1, for entry into the host cell. [score:6]
However, a report describing the targeting of Myd88 by miR-200b and miR-200c followed by subsequent downregulation of proinflammatory molecules in THP-1 cells exist but is not a common theme in the literature [66]. [score:6]
A number of downregulated genes targeted by miR-200/182 (including the sulfotransferases HS3ST1, HS3ST3A1, HS6ST2 and SDC2) are involved in heparan sulfate proteoglycan (HSPG) biosynthesis (Fig 6C). [score:6]
One heparan sulfate proteoglycan, Sdc2, was predicted by TargetScan to be targeted at multiple conserved sites by at least 5 different members of the miR-200/182 miRNA group; miR-141, miR-200b/c, miR-182, miR-96 and miR-183. [score:5]
Induction of miR-200/182 expression visualized by in situ hybridization in brain tissueWe used ISH to visualize the expression of a subset of induced miRNAs (miR-141, miR-183, miR-200a and miR-155) within the brain of infected mice. [score:5]
TargetScan version 6.2 (June 2012) was used to curate a list of predicted mouse specific miRNA target genes for miR-200/182 members [34]. [score:5]
The induction of miR-200/182 miRNAs in HSV-1 infected brains may therefore play a role as a host mechanism to mitigate virus entry and spread by downregulating SDC2. [score:4]
0169081.g005 Fig 5Detection of miR-200/182 upregulation in HSVE brain tissues by in situ hybridization. [score:4]
Upregulation of miR-200/182 members and miR-155 was detected in HSV-1 infected cortex region. [score:4]
Detection of miR-200/182 upregulation in HSVE brain tissues by in situ hybridization. [score:4]
miR-200/182 and several others were upregulated in HSVE brain samples. [score:4]
Given the upregulation of miR-200/182 members during acute HSV-1 infection, we employed a bioinformatics approach to explore their functionality within the context of HSV-1 -induced encephalitis. [score:4]
miR-200/182 members may regulate expression of heparan sulfate proteoglycan, syndecan-2 (Sdc2). [score:4]
In addition the miR-429, a member of the miRNA-200 family, was upregulated 2-fold showing a similar trend of induction. [score:4]
We also observed the upregulation of 7 miRNAs belonging to the related and often co-transcribed miRNA-200 family (miR-200a,b,c/miR-141/miR-429) and miRNA-182 cluster (miR-182/miR-183), henceforth collectively referred to as miR-200/182. [score:4]
There are, however, reports listing the deregulation of miR-200/182 members in a number of other viral disease mo dels. [score:4]
Overall, our data suggests that miR-200/182 induction may result in downregulation of Sdc2 in an in vivo mouse mo del of HSVE. [score:4]
miR-200/182 expression was induction in HSV-1 positive areas of the brain. [score:3]
The expression of the miR-200 family has been shown to be particularly enriched in epithelial and endothelial tissues [43, 45]. [score:3]
Induction of miR-200/182 expression visualized by in situ hybridization in brain tissue. [score:3]
Based on the staining patterns of miR-200/182 as determined by ISH, it appeared that members of these miRNA families could also be expressed and induced in neurons. [score:3]
Furthermore, we identified the co-ordinate dysregulation of miR-200/182 family members during acute encephalitis. [score:2]
These miRNAs were induced in areas of the tissue heavily infected by HSV-1. In addition, a potential role for miR-200/182 members is the regulation of HSPG synthesis. [score:2]
The induction of multiple members of the highly related, and often co-transcribed, miRNA-200 family and miRNA-182 cluster was our most striking finding. [score:1]
Interestingly, 6 members of the related and often co-transcribed miRNA-200 family (miR-200a,b,c/miR-141/miR-429) and miRNA-182 cluster (miR-182/miR-183), henceforth referred to collectively as miR-200/182, were amongst the highest induced in HSV-1 infected brain. [score:1]
In addition miR-141 is expressed in normal human astrocytes and the role for this miRNA in these cells, and other members of miR-200 family and miR-182 cluster, has not yet been investigated [65]. [score:1]
The role of microRNAs miR-200b and miR-200c in TLR4 signaling and NF-kappaB activation. [score:1]
Total RNA was extracted from these samples and real-time PCR was used to profile for 3 select miR-200/182 members (miR-141, miR-200a and miR-183) as well as miR-155. [score:1]
Previous studies have shown the miR-200 family to be induced by oxidative stress and play a role in apoptosis and so we hypothesized that the significant induction of these miRNAs we saw in our mo del of HSV-1 induced encephalitis may be related to tissue damage during infection [43]. [score:1]
Bioinformatic analysis of miR-200/182 function identifies a potential role in heparan sulfate proteoglycan (HSPG) biosynthesis. [score:1]
[1 to 20 of 36 sentences]
19
[+] score: 131
Consistent with the negative correlation between miR-200b-3p and its target molecules, intravitreal injection of miR-200b-3p mimic significantly suppressed or tended to decrease the expression of ZEB2 (P < 0.05), VEGF-A and FLT1, whereas anti-miR-200b-3p significantly increased or tended to stimulate the expression of these target proteins compared with eyes receiving a scramble miRNA (Fig. 6). [score:10]
miR-200b mimic significantly suppressed ZEB2 and tended to inhibit VEGF-A and FLT1 expression whereas anti-miR-200b significantly increased ZEB2 and VFGE-A and tended to increase FLT1 expression. [score:9]
Collectively, our data indicate that differential expression of miR-200b and its target genes may contribute to the development of vasculopathy in retinal diseases. [score:8]
Of these, miR-200 family members, including miR-200a-3p and miR-200b-3p, were significantly downregulated whereas all others were upregulated (Fig. 1A and Table 1). [score:7]
Our previous study using microarray analysis revealed downregulation of tight junction -associated molecules 3 months after Müller cell disruption 25 42, we found significant downregulation of miR-200a-3p and miR-200b-3p 3 months after Müller cell disruption in this study. [score:7]
In vivo gain and loss of function studies following intravitreal injections of miR-200b regulatorsWe performed intravitreal injections of miR-200b mimic (mirVana mimics, life technologies), miR-200b inhibitor (mirVana inhibitors, life technologies) to study the effects of miR-200b regulators on retinal vasculopathy 3 month after induced Müller cell disruption. [score:7]
We performed intravitreal injections of miR-200b mimic (mirVana mimics, life technologies), miR-200b inhibitor (mirVana inhibitors, life technologies) to study the effects of miR-200b regulators on retinal vasculopathy 3 month after induced Müller cell disruption. [score:6]
It is possible that the lack of effect of miR-200b regulators on more severe vasculopathy might reflect a wide spectrum of interactions between miRNAs and their target gene expression. [score:6]
Analysis using target gene databases revealed that there were more than 500 genes that could be targeted by miR-200b-3p. [score:5]
We have particularly focused on the involvement of miR-200b-3p in the development of deep retinal neavascularisation through target gene validation using qRT-PCR, western blot analysis and immunofluorescence in combination with in vivo gain and loss of function studies after intravitreal injections of miR-200b regulators. [score:5]
Considering the negative correlation between miR-200b and VEGF expression, future studies are warranted to test whether prolonged expression of anti-miR-200b stimulates normal blood vessels to proliferate and whether miR-200b mimic causes retinal capillary atrophy. [score:5]
In order to evaluate the effects of intravitreal injections of the miR-200b-3p mimic and inhibitor on its target protein expression, we performed western blots using retinas collected from eyes receiving scrambled miRNA, the mRNA -mimic and anti-miR (Fig. 6). [score:5]
In vivo gain and loss of function studies following intravitreal injections of miR-200b regulatorsIn order to verify the effect of miR-200b on retinal vasculopathy in vivo, we performed intravitreal injections of both a miR-200b-3p mimic and inhibitor 3 months after induced Müller cell disruption. [score:4]
As expected, anti-miR targeting miR-200b-3p appeared to promote the development of mild vascular lesions (Fig. 5C,F). [score:4]
Our data indicate that miR-200b and its target gene ZEB2 may play an important role in the development of intraretinal neovascularisation caused by prolonged Müller cell dysfunction. [score:4]
Seed matching sequence alignments between miR-200b and its target genes including ZEB1, ZEB2 and FLT1. [score:3]
In addition, we conducted in silico analysis to predict which genes might have been targets of miR-200b-3p. [score:3]
For the eyes which had developed mild vascular lesions, the miR-200b mimic inhibited the established vascular leak whereas anti-miR-200b promoted vascular leak. [score:3]
Western blot analysis of proteins targeted by miR-200b after Müller cell disruption. [score:3]
Of this family, miR-200b is particularly important due to its involvement in the vascular complications of retinal diseases. [score:3]
The negative correlations between miR-200b-3p and its target proteins were more obvious when comparisons were made between mimic- and anti-miR -injected retinas (p < 0.01, Fig. 6). [score:3]
In order to verify the effect of miR-200b on retinal vasculopathy in vivo, we performed intravitreal injections of both a miR-200b-3p mimic and inhibitor 3 months after induced Müller cell disruption. [score:3]
The impact of intravitreal injections of miR-200b mimic and anti-miR-200b on ZEB2, VEGF-A and FLT1 expression. [score:3]
qRT-PCR and western blot analysis found a negative correlation between miR-200b-3p and its target genes, particularly ZEB2. [score:3]
The effects of miR-200b regulators on these proteins were more marked when the values of the miR-200b mimic and anti-miR-200b injected groups were compared directly. [score:2]
In vivo gain and loss of function studies following intravitreal injections of miR-200b regulators. [score:2]
The effects of the miR-200b-3p mimic and inhibitor on established vascular lesions were evaluated by re-examination with FFA 7 days after their intravitreal injection. [score:1]
We conducted gain and loss of function studies to examine the effects of intravitreal injections of miR-200b mimic and anti-miR-200b in transgenic mice that had developed vascular lesions after Müller cell disruption. [score:1]
A total of 18 mice were used for in vivo study: 8 mice received miR-200b mimic in one eye and the contralateral eye in each mouse received scrambled miRNA for comparison, with 2.8 μg/eye. [score:1]
This study also found that neither the miR-200b mimic nor anti-miR-200b had a significant effect on established severe vascular lesions. [score:1]
Future studies using higher doses of miR-200b mimics and anti-miR-200b are warranted to provide a better understanding of the role of miR-200b in different stages of retinal vasculopathy. [score:1]
Western blots for ZEB2 (A), VEGF-A (B) and FLT1 (C) were conducted using retinas collected 10 days after intravitreal injections of miR-200b mimic, anti-miR-200b and a scramble miRNA (control). [score:1]
These included miR-133a-3p, miR-133b-3p, miR-146b-3p, miR-200a-3p, miR-200b-3p, miR-215-5p, miR-223-3p, miR-1936 and miR-202-3p (Fig. 1A and Table 1). [score:1]
Similarly, anti-miR-200b and scrambled RNA were injected in 10 mice. [score:1]
[1 to 20 of 34 sentences]
20
[+] score: 121
The highly conserved miR-200 family is composed of five members, miR-200a, miR-200b, miR-200c, miR-141 and miR-429, which are similar in sequence and are clustered and expressed as two separate polycistronic pri-miR transcripts: the miR-200b/a/429 cluster on chromosome 4 and the miR-200c/141 cluster on chromosome 6. The miR-200 family has been reported to be strongly expressed in lung, kidney and thymus tissues [13]. [score:5]
The TargetScan prediction program was used to identify target genes containing binding sites for the miR paralog miR-200b. [score:5]
Our data showed that the miR-200b/a/429 cluster was most strongly expressed in Gon-fat and least strongly expressed in BAT (Figure 1A). [score:5]
Figure 5miR-200b targets the 3′UTRs of Eps8, Lhfp, Glis2 and Rps6kb1 A. TargetScan identified the conserved predicted miR-200b binding sites on the 3′UTRs of Eps8, Lhfp, Glis2 and Rps6kb1. [score:5]
No difference in Eps8 and Glis2 RNA expression was observed between the AS KO and WT mice (Figure 5F), suggesting that Eps8 and Glis2 genes may be post-transcriptionally regulated by miR-200b/429. [score:4]
Taken together, we propose that the miR-200b/a/429 cluster exerts its regulatory functions via its targets, such as Eps8 and Rps6kb1. [score:4]
Its putative targets were predicted computationally, and luciferase reporter assays suggested that the miR-200b/429 cluster targets the eps8, lhfp, glis2 and rps6kb1 genes. [score:4]
The miR-200 family has also been shown to be involved in the epithelial-to-mesenchymal transition in humans, thereby enhancing cancer cell colonization in distant tissues by targeting zeb1, and in the regulation of olfactory neurogenesis and osmotic stress in zebrafish [16, 17]. [score:4]
Our results showed that the Cre [+]/miR [flox/ flox] mice displayed significantly lower expression levels of miR-200b/a/429 in gonadal fat (Gon-fat, Figure 1B), inguinal fat (Ing-fat, Figure 1C), and BAT (Figure 1D) than the control (Cre [−]/miR [flox/ flox]) littermates (hereafter designated as WT). [score:3]
Figure 4Ablation of miR-200b/a/429 reduces lipolysis and energy expenditure in vivo A. The mRNA expression of lipolysis-related genes in Gon-fat from HFD-fed WT and AS KO mice (n = 6). [score:3]
MiR-200, down-regulated in the livers of db/db mice, also contribute to IL-6 -induced insulin resistance [21]. [score:3]
To ascertain the miR-200b/a/429 allele status, adipose tissue was collected and the expression level of miR-200b/a/429 was detected. [score:3]
Thus, the miR-200b/a/429 cluster may serve as a potential target for therapeutic intervention in obesity and metabolic syndrome. [score:3]
Hasuwa et al revealed the requirement of miR-200 family and their target zeb1 in hypothalamo-pituitary-ovarian axis to support female ovulation [13]. [score:3]
Putative metabolic targets of miR-200b. [score:3]
Expression pattern of miR-200b/a/429 in adipose tissue. [score:3]
In summary, our data reveal the role of adipose miR-200b/a/429 in HFD -induced obesity and insulin resistance, and suggest a promising strategy for addressing the health issues caused by obesity and its associated diseases. [score:3]
In this regard, the precise role of the miR-200b/a/429 cluster on the signaling pathways of IRS-PI3K-Akt in the target organs of insulin resistance must be further explored. [score:3]
Similarly, it has been reported that the absence of Rps6kb1, another putative miR-200b/a/429 target, in mice protects against age- and diet -induced obesity [33]. [score:3]
Expression pattern of miR-200b/a/429 in adipose tissue and generation of the AS KO mice. [score:3]
Relative miR-200b/a/429 expression in BAT, Gon-fat, Ing-fat of WT mice (n = 4). [score:3]
A. TargetScan identified the conserved predicted miR-200b binding sites on the 3′UTRs of Eps8, Lhfp, Glis2 and Rps6kb1. [score:3]
To study the function of miR-200b/a/429 in mammalian energy homeostasis, we generated adipose tissue-specific miR-200b/a/429 knockout (AS KO) mice and revealed the critical role of this miR in modulating lipolysis and energy expenditure, consequently regulating obesity during periods of dietary stress. [score:3]
The miR-200b/a/429 complex undoubtedly targets many genes. [score:3]
miR-200b targets the 3′UTRs of Eps8, Lhfp, Glis2 and Rps6kb1. [score:3]
The generation of a floxed miR-200b/a/429 mouse mo del was described in the Supplemental Methods, and the targeting construct was showed in Supplemental Figure 1A. [score:3]
Figure 1Relative miR-200b/a/429 expression in BAT, Gon-fat, Ing-fat of WT mice (n = 4). [score:3]
As shown in Figure 5C-5E, the luciferase activities were reduced in the cells transfected with a plasmid containing the 3′UTR of Lhfp, Glis2 or Rps6kb1 carrying miR-200b binding sites in the presence of miR-200b mimics, whereas these inhibitory effects were not observed for the non-specific scrambled oligonucleotides (Figure 5C-5E). [score:3]
To obtain mice in which miR-200b/a/429 cluster deletion was restricted to adipose tissue, the miR [flox/ flox] mice were crossed with transgenic mice expressing Cre recombinase driven by the Fabp4/aP2 promoter (Supplemental Figure 1A). [score:3]
Our data suggest either that the role of the miR-200 family in the regulation of body weight homeostasis is not evolutionarily conserved or that mice are not completely analogous to flies. [score:2]
B. - D. MiR-200b/a/429 expression in the Gon-fat B., the Ing-fat C. and the BAT D. of 15-week-old AS KO and WT mice (n = 6). [score:2]
However, when fed the HFD, the AS KO mice developed diet -induced obesity, demonstrating that adipose miR-200b/a/429 does not positively regulate systemic growth of mice. [score:2]
miR-8, the homolog of miR-200 in Drosophila, has been reported to positively regulate body size [18]. [score:2]
Taken together, our data suggested that miR-200b/a/429 deficiency in adipose tissue results in reduced lipolysis, leading to a progressive increase in body weight in the AS KO mice under HFD conditions. [score:1]
Taken together, our data suggested that miR-200b/a/429 deletion from adipocytes leads to a higher body weight due to increased adiposity under HFD conditions. [score:1]
Ablation of miR-200b/a/429 reduces lipolysis and energy expenditure in vivo. [score:1]
It has been reported that Drosophila lacking miR-8, the sole homolog of miR-200b/a/429, exhibit a significantly smaller body size and reduced insulin signaling [18]. [score:1]
Our data showed that baseline NEFA and glycerol release was not affected by miR-200b/a/429 deficiency in adipose tissue (Figure 4C and 4D). [score:1]
Light gray bars, miR-200b; dark gray bars, miR-200a; black bars, miR-429. [score:1]
The predicted miR-200b binding sites on the 3′UTRs of those four genes are shown in Figure 5A. [score:1]
Normally, the low level of serum insulin content is associated with better insulin sensitivity, the opposite observation in our study might due to the failure of the signaling pathways of IRS-PI3K-Akt, as miR-200b has been reported to be involved in this pathway [18, 25, 26]. [score:1]
However, the role of the miR-200b/a/429 cluster in adipose tissue is currently poorly understood. [score:1]
In this study, to explore the potential effect of miR-200b/a/429 in adipocytes on metabolic homeostasis, AS KO mice were successfully generated leaving the host gene Ttll10 intact (data not shown). [score:1]
To detect the miR-200b/a/429 expression levels in metabolic tissues, the abundance of miR-200b/a/429 in inguinal fat (Ing-fat), gonadal fat (Gon-fat), BAT and liver were measured by real-time PCR. [score:1]
The abundance of miR-200b/a/429 in liver, kidney and lung tissues was not altered (Supplemental Figure 1C-1E). [score:1]
Previous studies showed the critical functions of miR-200 family in female reproduction [14, 15]. [score:1]
Recent studies have provided evidence that miR-200b has a role in beta cell apoptosis in vitro and in vivo [19, 20]. [score:1]
[1 to 20 of 47 sentences]
21
[+] score: 120
Other miRNAs from this paper: mmu-mir-141, mmu-mir-200a, mmu-mir-200c, mmu-mir-429
In total, 744 patients were available for analyses of expression of miR-200 s. Most miR-200 s were downregulated in late-stage primary tumors, but all miR-200 s were downregulated in the primary tumors with metastasis (Fig.   3c). [score:9]
Apart from the miR-200-ZEB1/2-E-cadherin axis, miR-200 s inhibit Wnt through CTNNB1, NOTCH through JAG1, and SNAIL through SNAI2, and other direct targets, FN1, MSN, NTRK2, LEPR, and ARHGAP19, all of which are necessary for tumor metastasis [15– 17]. [score:6]
Recent studies suggest that the miR-200c/141 cluster may act as a suppressor for the early stages of metastasis, but facilitate post-extravasation events, and that the miR-200b/a/429 cluster suppresses metastasis at all stages [13, 14, 53]. [score:5]
All experiments were repeated three times To determine if miR-200 is expressed in human breast cancers, the breast invasive carcinoma (n = 1100) expression dataset (RNAseqV2, UNC) from NCI The Cancer Genome Atlas (TCGA) was examined. [score:5]
In cancer cells, miR-200 s induce epithelial differentiation by suppressing ZEB1/2 and subsequently increasing E-cadherin expression [11, 12]. [score:5]
All experiments were repeated three times To determine if miR-200 is expressed in human breast cancers, the breast invasive carcinoma (n = 1100) expression dataset (RNAseqV2, UNC) from NCI The Cancer Genome Atlas (TCGA) was examined. [score:5]
Members of the human and mouse miR-200 family (miR-200 s), including two clusters (cluster 1: miR-200b, 200a, and 429, on chromosome 1, and cluster 2: miR-200c and miR-141, on chromosome 12), inhibit the epithelial-mesenchymal transition (EMT) [11, 12] but promote the mesenchymal-epithelial transition (MET) [13, 14], thereby regulating tumor metastasis by a reversible EMT-MET transition. [score:4]
Our analysis of TCGA database identified downregulation of miR-200 s in primary breast cancer cells in patients with distant metastases. [score:4]
To avoid the potential effect of FOXP3 [+] TILs, we selected the CD25 [low] tumors, indicative of few FOXP3 [+] TILs, to assess the association between expression of FOXP3 and miR-200 s in the TCGA breast cancers (Additional file 1: Figure S2C). [score:3]
These data indicate that miR-200c and miR-141 at miR-200 cluster 2 are downstream targets of FOXP3. [score:3]
Expression of miR-200b, 200a, and 429 in blood cells of Foxp3sf/+ female mice. [score:3]
ZEB1 and ZEB2 both bind to the two miR-200 clusters, causing inhibition of the transcription of all miR-200 s; Sp1 binds the miR-200b/a/429 cluster [44, 54] and p53 binds the miR-200c/141 cluster [44, 55], leading to activation of transcription of miR200s. [score:3]
Association of expression levels of miR-200 s with ER/PR/HER2 status in breast cancer cells. [score:3]
In murine cancers and human xenograft mo dels, miR-200 -expressing tumor cells and extracellular vesicles from these tumor cells promote breast cancer metastasis and confer the capacity for these cells to colonize distant tissues in an miR-200 -dependent manner [20]. [score:3]
In further studies, isolation of circulating CTCs and exosomes from mice or patients with breast cancer and comparison of expression levels of miR-200 s between CTCs and exosomes will address this hypothesis. [score:3]
In total, 542 samples were available for analyses of expression of both miR-200 s and FOXP3. [score:3]
According to our previous ChIP-sequencing data [30], the binding signals of FOXP3 are close (-3.4 kb) to the locus at non-regulated miR-200 cluster 1 (miR-200a/b/429) but distal (-20 kb) to the locus at FOXP3-regulated miR-200 cluster 2 (miR-200c/141) in FOXP3/GFP-Tet-off MCF-7 cells (Additional file 1: Figure S3A-B). [score:3]
Functional studies have found conflicting results on the role of miR-200 s in suppressing or promoting metastasis in different cellular contexts [11– 14]. [score:3]
Associations between expression of FOXP3 and miR-200 s in TCGA breast cancer samples. [score:3]
c Quantification of miR-200 s (by qPCR) as a percentage of RUN6B expression in T47D (left), BT474 (middle), and MDA-MB-468 (right) cells at 48 h after transfection. [score:3]
Decreased levels of miR-200 s in tumor cells have been implicated in the invasion and metastasis of breast cancer [11, 12, 18], but, in preclinical mo dels, restoration of miR-200c reduced metastases [19], suggesting that the miR-200 s function as tumor suppressors. [score:3]
In breast cancer cells, however, expression of miR-200 s was not related to ER/PR/HER2 status (Additional file 1: Figure S5A-C). [score:3]
However, the effect of KAT2B knockdown on the miR-200 cluster 1 miRNAs was not observed in FOXP3/GFP-Tet-off MCF7 cells (Additional file 1: Figure S4). [score:2]
In the present work, we explored the relevance of FOXP3 -mediated transcriptional regulation of miR-200 s in breast cancer cells in mice and humans. [score:2]
During tumor progression in the Foxp3 [sf/+] female mice, there were increased levels of plasma miR-200c and miR-141 at miR-200 cluster 2 (Fig.   3d, the time points of breast tumor development are indicated by vertical arrows) but not at miR-200 cluster 1 (Additional file 1: Figure S6). [score:2]
To validate our observation in breast cancer cells, we used heterozygous Foxp3 [sf/+] breast cancer mice to analyze the regulation of mouse miR-200 s during tumor progression. [score:2]
These data suggest the presence of a FOXP3-KAT2B-miR200c/141 axis in breast cancer cells and a differential mechanism of transcriptional regulation between the two miR-200 clusters. [score:2]
Likewise, high levels of all miR-200 s were validated in FOXP3 [high] tumors relative to those in FOXP3 [low] tumors (Additional file 1: Figure S2C). [score:1]
However, in peripheral blood cells, no significant changes in the miR-200 s levels were evident (Figs.   5d and Additional file 1: Figure S9). [score:1]
[d]Normal healthy women without family history of breast cancer Two independent cohorts of human subjects were divided for assessment and validation of the miR-200 family as potential biomarkers. [score:1]
Potential binding signals of FOXP3 in the promoter regions of the miR-200 family and KAT2B gene. [score:1]
As shown, miRs-200c and miR-141 at miR-200 cluster 2 (2.0-fold to 3.2-fold miR-200c induction; 1.8-fold to 2.6-fold miR-141 induction), but not miRs-200b, 200a, and 429 at miR-200 cluster 1, were induced after FOXP3 induction (Fig.   1b). [score:1]
Thus, circulating miR-200 s are promising biomarkers for breast cancer metastasis. [score:1]
c Concentrations of cluster 1 and cluster 2 miR-200 s in human breast cancer samples at various tumor stages (tumor-node-metastasis (TNM) staging classifies cancers based on T1-T4, N, and M), as determined from data for 271 patients listed in the NCI The Cancer Genome Atlas (TCGA). [score:1]
The transcriptional activity of miR-200b/a/429 on miR-200 cluster 1 after FOXP3 induction and KAT2B silencing in breast cancer cells. [score:1]
High levels of all miR-200 s were present in FOXP3 [high] tumors relative to those in FOXP3 [low] tumors (Additional file 1: Figure S2A). [score:1]
b Relative quantification (by quantitative (q)PCR) of miR-200 clusters 1 and 2 in FOXP3/GFP-Tet-off MCF7 cells without Dox at 0, 24, and 48 h. The concentrations of miR-200 s at 0 h were used as a reference. [score:1]
Levels of miR-200 s in the FOXP3/GFP-Tet-off MCF-7 cell lines were assessed by use of qPCR at 24 and 48 hours after FOXP3 induction. [score:1]
All experiments were repeated three times To determine the levels of miR-200 s in circulation during tumor progression, plasma was collected monthly from Foxp3 [sf/+] female mice after 1 year of age. [score:1]
As circulating miR-200 s reflect the CTC status of patients with breast cancer [21], they may be released from CTCs through exosomes rather than from blood cells or primary tumor cells. [score:1]
Levels of miR-200b, 200a, and 429 in FOXP3-Tet-off MCF7 cells, culture medium, and exosomes. [score:1]
Further, high levels of circulating miR-200 s in breast cancer patients are associated with increased numbers of circulating tumor cells (CTCs) [21], which are a predictor of metastasis up to 2 years prior to clinical diagnosis [22] and of shorter brain-metastasis-free survival [23]. [score:1]
[d]Normal healthy women without family history of breast cancer Two independent cohorts of human subjects were divided for assessment and validation of the miR-200 family as potential biomarkers. [score:1]
However, the cellular origin, mechanism of release, and function of circulating miR-200 s during tumor progression and metastasis remain elusive. [score:1]
Participants (259), including patients with breast cancer or benign breast tumors, members of breast cancer families, and healthy controls, were assessed for tumor and circulating levels of the miR-200 family. [score:1]
b Levels of cluster 1 and cluster 2 miR-200 s (measured by quantitative (q)PCR) as percentages of snoRNA202 expression in microdissected breast epithelial cells and tumor cells. [score:1]
Conversely, some studies suggest that, in cancer cells, miR-200 s promote tumor metastasis through promotion of tumor colonization at metastatic sites [13, 14]. [score:1]
There were, however, no significant differences in the amounts of miR-200b, miR-200a, or miR-429 in MCF7 cells, cell culture medium, or exosomes (Additional file 1: Figure S8A–C). [score:1]
All experiments were repeated three times To determine the levels of miR-200 s in circulation during tumor progression, plasma was collected monthly from Foxp3 [sf/+] female mice after 1 year of age. [score:1]
In patients with breast cancer, increased levels of circulating miR-200 s may be a predictor of CTCs [21], metastasis up to 2 years prior to clinical diagnosis [22], and poor survival [23]. [score:1]
Levels of plasma miR-200b, 200a, and 429 in Foxp3sf/+ female mice during tumor progression. [score:1]
Fig. 3Changes in miR-200 s in tumor cells and plasma during breast cancer progression. [score:1]
[1 to 20 of 52 sentences]
22
[+] score: 114
Other miRNAs from this paper: mmu-mir-141, mmu-mir-192, mmu-mir-200a, mmu-mir-200c, mmu-mir-429
miR-200b ameliorates up-regulation of vimentin and down-regulation of cytokeratin 18. g, real-time PCR confirms that miR-200b precursor reverses up-regulation of type I,III collagen and fibronectin of UUO day-6 kidneys. [score:10]
Conversely, there are several reports that miR-200 family members and miR-192 can be down-regulated by TGF-beta, and this promotes EMT in cancer and other cell lines via subsequent up-regulation of targets ZEB1 and ZEB2 to repress E-cadherin [1]– [4]. [score:9]
Thus, TGF-beta -induced increase in the expression of microRNAs (miR-192 and miR-200 family members) might coordinately down-regulate E-box repressors Zeb1 and Zeb2 to inhibit EMT and fibrosis of kidneys. [score:8]
Previous studies showed that inhibition of EMT by miR-200 family members was mediated by their inhibition of the expression of the E-cadherin repressors ZEB1 and ZEB2 through binding to the 3′-UTR region of ZEB1 and ZEB2 mRNAs [1]– [3]. [score:7]
We also observed that Zeb1 and Zeb2 was a target of miR-200 family members that tended to be up-regulated by TGF-beta in kidney tubular cell lines. [score:6]
Several reports have shown that members of the miR-200 family (miR-200a,b,c, miR-141 and miR-429) inhibit EMT through direct targeting of ZEB1 and ZEB2, which encode transcriptional repressors of E-cadherin in kidney tubular cells [1], breast cancer cells [2], and mammary epithelial cells [3]. [score:6]
All miR-200 family precursors tested were capable of inhibiting the reduction of E-cadherin and up-regulation of N-cadherin affected by TGF-beta in HK-2 cells (Fig. 1b, c). [score:6]
We suggest that members of the miR-200 family, and miR-200b specifically, might constitute novel therapeutic targets in various kidney diseases. [score:5]
Finally, an alternative therapeutic approach in kidney disease may be to identify compounds that increase the expression levels of members of the miR-200 family of microRNAs. [score:5]
Conversely, the down-regulation of ZEB1 and ZEB2 by TGF-beta via miR-200 family and miR-192 can affect upstream E-box regions [14]. [score:4]
This study indicates that miR-200 family is up-regulated after ureter obstruction, miR-200b being strongly induced, and that miR-200b ameliorates tubulointerstitial fibrosis in obstructed kidneys. [score:4]
In order to confirm that miR-200 family members target ZEB1 and ZEB2 3′-UTRs, we co -transfected either ZEB1-3′UTR-luciferase or ZEB2-3′UTR-luciferase reporter vectors with miR-200 family precursors in HK-2 cells. [score:3]
miR-200 family members target the transcriptional repressors ZEB1 and ZEB2. [score:3]
In this report, we show that members of the miR-200 family of miRNAs are induced after ureter obstruction and that miR-200b ameliorates tubulointerstitial fibrosis in obstructed kidneys via inhibition of EMT of tubular cells. [score:3]
showed that expression of all members of the miR-200 family tested were increased in a time -dependent manner after ureter obstruction (Fig. 1d); the induction of miR-200b was most pronounced. [score:3]
Given their ability to inhibit EMT, we investigated whether injection of miR-200 miRNA family precursors - chemically modified double strand of RNA which form RNA -induced silencing complex (RISC) like complex and can be processed by endonuclease Dicer into mature miR-200 family in cells - could ameliorate tubulointerstitial fibrosis by inhibition of EMT of tubular epithelial cells in UUO mo del mice. [score:3]
Several articles have shown that the miR-200 family targets ZEB1 and ZEB2 [1]– [4]. [score:3]
To detect the change of the expression of vimentin and cytokeratin 18 in the kidneys of UUO by miR-200b precursor, we examined the localization of them with immunofluorescein staining. [score:3]
Recent reports have indicated that a double -negative feedback loop between ZEB1, ZEB2 and miRNA-200 family members regulates EMT in kidney tubular cells [4]. [score:2]
revealed that injected miR-200b precursor can be converted to mature miR-200b in mouse kidneys (Fig. 2b) 10.1371/journal. [score:1]
In western blotting, each band has been quantitated and subjected to densitometry to determine if statistically significant difference exists between groups d, Changes in miR-200 family levels in UUO mo del mice kidneys, as measured by TaqMan qRT-PCR and normalized to U6 expression. [score:1]
Since the most efficient in vitro inhibition of TGF-beta was mediated by the miR200-b miRNA (Fig. 1b and Fig. 1c) we next evaluated its effect in vivo by injecting miR-200b precursor via the abdominal vein prior to occlusion of the left ureter. [score:1]
E. e, Azan staining of intact Balbc mouse kidney, UUO day-6 kidneys after transfection of negative control pre-miR or miR-200b precursor. [score:1]
miR-200 family members can ameliorate EMT and tubulointerstitial fibrosis in UUO mo del mouse kidneys. [score:1]
We suggest that the therapeutic role of miR-200 family members be investigated in other mo dels of kidney disease, particularly in the context of these factors. [score:1]
Real time PCR analysis confirmed that ZEB1 and ZEB2 were induced in a time -dependent manner after obstruction (Fig. 4a, b), an effect reversed by injection of miR-200b precursor (Fig. 4c). [score:1]
Injected miR-200b precursor can be converted to mature miR-200b in kidneys. [score:1]
These results indicate that members of the miR-200 family of miRNAs are induced after ureter obstruction and that miR-200b ameliorates tubulointerstitial fibrosis in obstructed kidneys. [score:1]
b, c, in HK-2 cells treated with TGF-beta and transfected with control miR or miR-200 members precursors individually. [score:1]
0013614.g003 Figure 3Normalized activity of luciferase reporter with the ZEB1 or ZEB2 3′UTR in HK-2 cells in the presence of co -transfected negative control pre-miR or miR-200 family individually. [score:1]
The renal press -mediated transfection method was used to efficiently deliver the miR-200b precursor to the kidney [10]. [score:1]
7 week old Balbc mice were intravenously injected with 0.5 nM miR-200b precursor (Ambion), immediately followed by pressing the left kidney. [score:1]
To assess the effect of miR-200 family precursor on reporter activity, 50 pM of synthetic precursor miRNAs (pre-miRs) (Ambion) were co -transfected. [score:1]
A single injection of 0.5 nM miR-200b precursor was sufficient to ameliorate tubulointerstitial fibrosis in the kidney 6 days after UUO (Fig. 1e), an observation confirmed by real time PCR analysis of type I collagen, type III collagen and fibronectin and Azan staining (Fig. 1e). [score:1]
The luciferase activity of both reporters was significantly reduced in the presence of all miR-200 family members tested (Fig. 3). [score:1]
b. Changes in miR-200 family levels in Balbc mice kidneys 12, 24, 48 hours after intravenously administration of miR-200b precursor, as measured by TaqMan qRT-PCR and normalized to U6 expression. [score:1]
Injection of miR-200b precursor. [score:1]
To demonstrate that reduction of ZEB1 and ZEB2 levels reduces epithelial to mesenchymal transition, tissue stains for epithelial makers, cytokeratin 18 and for mesenchymal markers, vimentin in animals treated with miR-200b and control animals have shown in Figure 1f. [score:1]
E (n = 8) f, of vimentin and cytokeratin 18 in the kidneys of UUO day6 mice and UUO day6 mice injected by miR-200b precursor. [score:1]
Normalized activity of luciferase reporter with the ZEB1 or ZEB2 3′UTR in HK-2 cells in the presence of co -transfected negative control pre-miR or miR-200 family individually. [score:1]
[1 to 20 of 40 sentences]
23
[+] score: 110
Following the knockdown of DCLK1, miR-200 miRNAs were upregulated and resulted in inhibition of its downstream targets (EMT-transcription and angiogenic factors). [score:9]
siRNA -mediated knockdown of DCLK1 in BxPC-3 cells results in decreased expression of miR-200a, miR-200b and miR-200c (A), decreased expression of ZEB1 and ZEB2 (B), and decreased expression of VEGFR1 and VEGFR2 (C). [score:8]
Furthermore, it was found that overexpression of miR-200 family significantly inhibits the NOTCH pathway in pancreatic cancer cells, which suggests the NOTCH pathway may be one of the miR-200 targets [60]. [score:7]
Nevertheless, in this study, inhibition of DCLK1 results in inhibition of pluripotency markers and induction of miR-200 (EMT inhibitor) and thereby drives the cancer cells towards a differentiated state with reduced invasive properties. [score:7]
Following the knockdown of DCLK1, there was a significant downregulation of miR-200a, miR-200b and miR-200c (Figure 5B) mediated luciferase activity. [score:5]
Similar to miR-200a, we observed a significant upregulation of miR-200b (1.5-fold) (Figure 5A) and miR-200c (2-fold) (Figure 5A) following the knockdown of DCLK1. [score:5]
Figure S4 NPsiRNA -mediated knockdown of DCLK1 downregulates EMT transcription factors ZEB1, ZEB2 and angiogenic factors VEGFR1 and VEGFR2 via miR-200 in BxPC-3 cells. [score:5]
It has been demonstrated that miR-200 inhibits lung adenocarcinoma invasion and metastasis by targeting VEGFR1. [score:5]
These data taken together indicate that knockdown of DCLK1 inhibits EMT and invasion by regulating miR-200 in human pancreatic tumor xenografts and cancer cells. [score:5]
Here, we found DCLK1 regulating miR-200 and its downstream targets. [score:4]
DCLK1 negatively regulates miR-200 and inhibits EMT and invasion. [score:4]
We also observed a subsequent reduction of miR-200 downstream targets ZEB1 and ZEB2 (Figure 5C), SNAIL and SLUG (Figure 5D) following the knockdown of DCLK1 in pancreatic tumor xenografts. [score:4]
These data indicate that DCLK1 regulates miR-200 and its downstream targets in PDAC. [score:4]
0073940.g005 Figure 5DCLK1 negatively regulates miR-200 and inhibits EMT and invasion. [score:4]
A, siRNA -mediated knockdown of DCLK1 results in increased expression of pri-miR-200a, pri-miR-200b and pri-miR-200c by real-time RT-PCR. [score:4]
The let- 7 and miR-200 families are well-known regulators of key differentiation programs during development. [score:3]
These data indicate that VEGFR1 and VEGFR2 are downstream targets of miR-200. [score:3]
Recently, a number of reports have identified the microRNA (miRNA) miR-200 family as fundamental markers and regulators of EMT [10– 12]. [score:2]
A putative binding site for miR-200 was observed in the 3’ UTR of VEGFR1, and it was demonstrated that miR-200 negatively regulates VEGFR1 [48]. [score:2]
DCLK1 regulates miR-200 family genes and EMT in pancreatic cancer. [score:2]
The studies presented clearly implicate DCLK1 in the regulation of miR-143/145, miR-200, EMT, pluripotency, angiogenesis, NOTCH1, and cancer stemness. [score:2]
Next, we wanted to investigate whether DCLK1 regulates the downstream targets of miR-200. [score:2]
Loss of let- 7 in cancer results in progression and dedifferentiation, and the miR-200 family has been shown to be a key regulator of EMT. [score:2]
Recent studies have demonstrated that miR-200a, b and c (miR-200) are known to regulate EMT and angiogenesis [48]. [score:2]
Furthermore, we wanted to investigate the effect of DCLK1 knockdown on expression of miR-200b and c in AsPC-1 tumor xenografts. [score:2]
These data taken together indicate that DCLK1 regulates VEGFR1 and VEGFR2 via miR-200 in PDAC. [score:2]
B, Following the knockdown of DCLK1, a decrease in miR-200a, miR-200b and miR-200c dependent luciferase activity was observed in AsPC-1 cells. [score:2]
Similarly in AsPC-1 tumor xenografts, a 2-fold induction of pri-miR-200 a (p < 0.01) (Figure 5A) was observed. [score:1]
Moreover, alteration of the miR-200 family has been found to be associated with the NOTCH signaling pathway in pancreatic CSCs. [score:1]
Additionally, a recent study demonstrated that VEGFR1 and VEGFR2 has a binding site for miR-200b and based on luciferase -based reporter assay miR-200b regulates these angiogenic factors [49]. [score:1]
Based on previous studies and computational analysis of the 3’ UTR of VEGFR1 and VEGFR2, we observed a putative binding site for miR-200 (miR-200a, b and c) [48, 49]. [score:1]
[1 to 20 of 31 sentences]
24
[+] score: 108
2016.00140/full#supplementary-material Figure S1 miR-200 inhibitors up-regulate PTEN expression. [score:8]
Taken together, the miR-200 family, especially miR-200c, directly targets the 3′UTR of PTEN and inhibits its protein expression. [score:8]
To identify the binding site of miR-200 that plays the most important role in miR-200-regulated PTEN protein expression, we generated three different site-directed mutations on PTEN 3′UTR. [score:6]
To explore the potential roles of miR-200 family members in translational regulation of PTEN expression, we co -transfected a luciferase reporter construct containing PTEN 3′UTR together with different miR-200 family members. [score:6]
We provided evidence showing that upregulation of miR-200 family by ER stress exhibited protective roles via PTEN suppression in early phase of AD. [score:6]
In order to understand the role of miR-200 family in AD development, we employed the TargetScan (version 6.2, 2012) database to predict potential miR-200 target genes. [score:6]
On the other hand, transfection of miR-200 inhibitors to HCT116 colon cancer cells that have high endogenous levels of miR-200 resulted in increased expression of PTEN (Figure S1). [score:5]
Overexpression of miR-200 family inhibitors dramatically enhanced luciferase reading (Figure 1C). [score:5]
Our results showed that miR-200b, c and 429 mainly target site I and II, whereas miR-141, 200a mainly target site III (Figures 1D–F). [score:5]
The mimic or inhibitors of miR-200 family and siPTEN/control siRNAs were synthesized by Life Technologies with sequences shown in Table 1. Table 1 Sequences of synthesized miR mimics/inhibitors or siRNA. [score:5]
The mimic or inhibitors of miR-200 family and siPTEN/control siRNAs were synthesized by Life Technologies with sequences shown in Table 1. Table 1 Sequences of synthesized miR mimics/inhibitors or siRNA. [score:5]
Among them, microRNA-200 family showed a dynamic expression profile during AD development in the APPswe/PSΔE9 transgenic mice. [score:4]
Among the three sites, site II seems to have the most important role in the regulation of PTEN expression by miR-200 family. [score:4]
Among them, miR-200a/b/c, miR-141, and miR-429 in the miR-200 family were significantly upregulated in early age AD in mice. [score:4]
In this study, we identified PTEN as a target of miR-200 family in neuronal cells. [score:3]
As predicted by Targetscan (version 6.2, 2012), three miR-200 family bind sites (Site I and Site III for miR-141/200a, Site II for miR-200b/c/429) are highlighted. [score:3]
HCT-116 cells were transfected with different combinations of miR-200 inhibitors as indicated. [score:3]
Identification of PTEN as a target of miR-200 family. [score:3]
Database prediction indicated that PTEN has three miR-200 family binding sites in its 3′UTR and may be one of the potential targets of miR-200 family (Figure 1A). [score:3]
Among miR-200 family, miR-200c is the major microRNA that targets PTEN. [score:3]
Members of the miRNA-200 family regulate olfactory neurogenesis. [score:2]
Among the five miR-200 family members, miR-200c plays the most important regulatory role and was used to represent miR-200 family in the following parts of the study (Figures 1D–F). [score:2]
Critical role of the miR-200 family in regulating differentiation and proliferation of neurons. [score:2]
In nerve system, miR-200 family is enriched in olfactory and has been implicated in neuronal proliferation and differentiation (Choi et al., 2008; Pandey et al., 2015). [score:1]
pMIR-Reporter constructs containing either wild type or mutant fragments of PTEN 3′UTR were co -transfected into 293T cells with miR-200 family miRs (miR-141/200a, miR-200b/c/429, or miR-200c). [score:1]
For luciferase activity assay, we introduced mutations on each miR-200 family miR binding site by overlap PCR. [score:1]
Name of miRs/siRNAs Sequence miR-200a 5′-UAACACUGUCUGGUAACGAUGU miR-200b 5′-UAAUACUGCCUGGUAAUGAUGA miR-200c 5′-UAAUACUGCCGGGUAAUGAUGGA miR-141 5′-UAACACUGUCUGGUAAAGAUGG miR-429 5′-UAAUACUGUCUGGUAAUGCCGU miR-NC 5′-UAACGUGUCACGUCUCCGACUA Anti-miR-200c 5′-UAACACUUGCCGGGUAAUGGUGUA Anti-miR-NC 5′-UCUUGCCGGGCCCGAUCCAACGA siCont 5′-UUCUCCGAACGUGUCACGU siPTEN 5′-AACCCACCACAGCUAGAACUU 2.3 kb PTEN 3′UTR was amplified by PCR from a human cDNA library. [score:1]
MiR-200 family can be divided into two groups according to the seed sequences (group I: miR-141 and miR-200a; group II: miR-200b, miR-200c, and miR-429). [score:1]
Cotransfection of miR-200b, miR-200c, a mixture of group I, group II or the whole family of miR-200s all resulted in a decrease in luciferase activity (Figure 1B). [score:1]
A series of truncations containing different miR-200 family binding sites were also amplified and cloned into the pMIR-REPORT vector. [score:1]
[1 to 20 of 30 sentences]
25
[+] score: 100
In order to confirm that miR-200 family miRNAs and miR-182/96/183 family miRNAs are involved in ULM and/or ULM-related gene expression, we compiled a list of potential targets of these miRNAs in various ULM mRNAs using three computational target prediction programs: TargetScan (www. [score:9]
Effect of inhibition or overexpression of the miR-200 family and the miR-182 family miRNAs on OGD -induced cell death in SHSY5Y cells. [score:5]
The results strongly suggest that theses predicted target sites are real and SUMO and other ULM mRNAs are indeed targeted and controlled by the miR-200 family and the miR-182 family miRNAs. [score:5]
We found quite a few potential target sites for miR-200 and miR-141, and some for miR-182/183/96 in SUMO-related genes and other ULMs as shown in Table 2. miRNA::mRNA target prediction is based on assumptions of certain values for temperature, salt and other conditions and the results are all too often dependent on the algorithm employed by each tool. [score:5]
html) We have established that the miR-200 family and the miR-182 family miRNAs target SUMO and other ULMs, and that inactivation of these miRNAs increases both global SUMOylation and global conjugation of other ULMs resembling the changes in posttranslational modifications that have been noted in ground squirrels during hibernation torpor. [score:5]
We have established that the miR-200 family and the miR-182 family miRNAs target SUMO and other ULMs, and that inactivation of these miRNAs increases both global SUMOylation and global conjugation of other ULMs resembling the changes in posttranslational modifications that have been noted in ground squirrels during hibernation torpor. [score:5]
In order to examine whether some (if not all) of these predicted target sites are really recognized by either miR-200 family or miR-182/183/96 family miRNAs, we made firefly luciferase reporter constructs containing individual predicted target sequences for the miRNAs of interest. [score:5]
We could confirm that miR-200, miR-182, miR-183, miR-141, miR-96, miR-122 and miR-429 were indeed down regulated, and miR-34 and miR-206 were upregulated during hibernation torpor (Fig. 2B). [score:5]
We also show in SHSY5Y cells that inhibition of miR-200 family and/or miR-182 family miRNA activity makes cells more tolerant to oxygen/glucose deprivation (OGD), perhaps via an increase in post-translational modification of cellular proteins by various ULM species. [score:5]
The roles of miR-200 family and miR-182 family miRNAs, which we found to be down-regulated during hibernation torpor, have been examined in various areas of research, especially cancer, but the studies have generally been correlational. [score:4]
Interestingly, SHSY5Y cells became more tolerant to OGD -induced cell death when activities of miR-200 family and/or miR-182 family miRNAs were inhibited (Fig. 6B), and more sensitive when mimics of these miRNAs were transfected (Fig. 6B). [score:3]
We transfected SHSY5Y cells with inhibitors or mimics for several miR-200 family and the miR-182 family miRNAs (miR-200c, miR-141, miR-182, miR-183 and miR-96) in duplicate plates, incubated them for 2 days, and subjected one plate of cells to OGD, and the other plate of cells to normal culture conditiions as a control. [score:3]
Effect of miRNA inhibitors and mimics for miR-200 family and miR-182 family members on ULM conjugation levels in SHSY5Y cells. [score:3]
Cells transfected with miRNA inhibitors, especially miR-200 family (miR-200c and miR-141) showed much far less cell death (Fig. 6B), but cells transfected with miRNA mimics, especially from the miR-182 family, caused more cell death (Fig. 6B). [score:3]
miR-200 family and miR-182 family members of miRNAs indeed target various ULM and/or ULM related genes. [score:3]
Effects of inhibitors and mimics for miR-200 family and miR-182 family miRNAs on OGD -induced cell death in SHSY5Y. [score:3]
The DNA sequences of target sites for miR-200 family and/or miR-182 family miRNAs in each gene are shown in the supplemental materials (Table S2). [score:3]
Identification of potential targets of miR-200 family and miR-183/96/182 family miRNAs in ULMs and/or ULM-related genes. [score:3]
Roh's group [37] reported that miR-200 family and miR-182 family miRNAs increased at 3 hrs after an ischemic preconditioning (15 min transient focal cerebral ischemia) in mice and that overexpressing these miRNAs made mouse neuroblast cells (Neuro-2a) more resistant to OGD (16 h). [score:3]
25Gravgaard KH, Lyng MB, Laenkholm AV, Sokilde R, Nielsen BS, et al. (2012) The miRNA-200 family and miRNA-9 exhibit differential expression in primary versus corresponding metastatic tissue in breast cancer. [score:3]
The clear increase in expression of miR-200 and miR-182 family miRNAs at the 3 hour timepoint may have reflected the sublethal ischemic stress that induces ischemic tolerance, but at the times that OGD tolerance was tested, these miRNA levels may well have been depressed. [score:3]
These results suggest that inhibiting miR-200 family and miR-182 family miRNAs does protect SHSY5Y cells from OGD -induced cell death. [score:3]
Of these families, miR-200 had the greatest number of differentially regulated members (n = 48) and the largest magnitude difference between means of the LH and ACR states (Δ = −3.04). [score:2]
In particular, two miRNA families, the miR-200 family (miR-200a, b, c, miR-496, and miR-141) and the miR-182 family (miR-182, miR-183 and miR-96) were consistently down regulated during torpor phase. [score:2]
We also report that two miRNA families, miR-200 family (miR-200a/miR-200b/miR-200c/miR-141/miR-429) and miR-182 family (miR-182/miR-183/miR-96), which were consistently lower in the brain samples from torpor phase ground squirrels compared to active animals, are involved in expression of various ULM proteins and their global protein conjugation. [score:2]
MiR-182, miR-96, miR-200, miR-183 and miR-141 were among the most highly regulated miRNAs with a 13∼20-fold decrease during the torpor phase of the hibernation cycle. [score:2]
From the results of our microRNA array study of ground squirrel brain (comparing active and torpor phase), we found that most miRNAs were unchanged or increased during torpor phase, but certain miRNAs such as miR-200 family (miR-200a, -200b, -200c, -141, -429) and miR-182 family (miR-182, -183, -96) miRNAs were consistently decreased (Fig. 2A and Table S1). [score:1]
We wondered whether the tolerance to in vitro “ischemia” by OGD in cultured cells (e. g. SHSY5Y) would change if miR-200 family and/or miR-182 family miRNA activity levels were reduced or increased. [score:1]
Close relationships of miR-200 family miRNAs with cancer cell invasion or cancer metastasis have been reported repeatedly [23]- [26]. [score:1]
[1 to 20 of 29 sentences]
26
[+] score: 80
of databases predicting interaction Names of databases Dcx mmu-miR-200a 6 DIANAmT, miRanda, miRDB, miRWalk, PITA, Targetscan mmu-miR-200b 6 DIANAmT, miRanda, miRWalk, PITA, Targetscan, PICTAR 4 mmu-miR-466a-3p 4 miRanda, miRWalk, PITA, Targetscan mmu-miR-466d-3p 4 miRanda, miRWalk, PITA, Targetscan Pafah1b1 mmu-miR-200a 4 DIANAmT, miRanda, PITA, Targetscan mmu-miR-200b 5. [score:11]
We report novel role of miRNAs mmu-miR-200a, mmu-miR-200b, mmu-miR-466a-3p and mmu-miR-466d-3p in regulating neurogenesis and gliogenesis in vitro by targeting and upregulating Gfap, Map2 and Ng2 proteins either through direct target or through an indirect regulation which needs detailed evaluation. [score:10]
In NSCs from diabetic pregnancy, the significant increase in protein expression of Dcx and Pafah1b1 correlates well with the reduced expression of miRNAs (mmu-miR-200a, mmu-miR-200b, mmu-miR-466a-3p and mmu-miR-466d-3p) (Figs. 2B and 3C) which have been predicted to target Dcx and Pafah1b1 suggesting possible role for miRNA in regulating gene expression. [score:10]
In NSCs, hyperglycemia increased the expression of Dcx (Doublecortin) and Pafah1b1 (Platelet activating factor acetyl hydrolase, isoform 1b, subunit 1) proteins concomitant with decreased expression of four microRNAs (mmu-miR-200a, mmu-miR-200b, mmu-miR-466a-3p and mmu-miR-466 d-3p) predicted to target these genes. [score:7]
DIANAmT, miRanda, miRWalk, PITA, Targetscan mmu-miR-466a-3p 4 miRanda, miRWalk, PITA, Targetscan mmu-miR-466d-3p 4 miRanda, miRWalk, PITA, Targetscan NSCs from normal pregnancy were transferred into 24 well plates with poly lysine coated coverslips and the cells were allowed to adhere for 48 h. 5′ Fluorescein labelled miRCURY LNA ™ probes were purchased for mouse U6, mmu-miR-200b and mmu-miR-466d-3p from Exiqon (Vedbaek, Denmark)(Table S2 in Tables S1). [score:7]
Confocal images showing the expression of Gfap positive cells (A–E), Ng2 positive cells (F–J) and Map2 positive cells (K–O) (red) in differentiated cells following knockdown of miRNAs mmu-miR-200a or mmu-miR-200b or mmu-miR-466a-3p or mmu-miR-466d-3p in NSCs. [score:4]
Knockdown of miRNAs, mmu-miR-200a, or mmu-miR-200b, or mmu-miR-466a-3p or mmu-miR-466d-3p resulted in increased expression of Dcx (1.78±0.57-folds, p<0.05; 1.42±0.34-folds, p<0.05; 2.12±0.40-folds, p<0.05; 2.98±1.05-folds, p<0.05 respectively) (Fig. 4B) and Pafah1b1 (1.93±0.43-folds, p<0.05; 1.69±0.57-folds, p<0.05; 1.64±0.45-folds, p<0.05; 1.68±0.34-folds, p<0.01 respectively) (Fig. 4C) proteins in NSCs. [score:4]
Further, we confirmed that Dcx and Pafah1b1 were targets of miRNAs mmu-miR-200a, mmu-miR-200b, and mmu-miR-466a-3p and mmu-miR-466d-3p by using knockdown approach. [score:4]
miR-200 family has been reported to regulate olfactory neurogenesis in mouse and zebrafish mo dels [47] and the expression of few members of miR-466 family have been shown in mouse ocular tissue [48]. [score:4]
This study is the first to report the expression of miRNAs mmu-miR-200a, mmu-miR-200b, mmu-miR-466a-3p and mmu-miR-466 d-3p in NSCs obtained from mouse embryonic forebrain. [score:3]
0065945.g003 Figure 3(A, B) in situ hybridization reveals expression of miRNAs mmu-miR-200b (A) and mmu-miR-466d-3p (B) in NSCs. [score:3]
Both mmu-miR-200b and mmu-miR-466d-3p were found to be expressed by NSCs (Figs. 3A,B). [score:3]
5′flourescently labelled miRCURY LNA ™ miRNA inhibitors mmu-miR-200b, mmu-miR-466d-3p, and non labeled miRCURY LNA ™ mmu-miR-200a, mmu-miR-466a-3p and were purchased from Exiqon (Vedbaek, Denmark) (Table S3 in Tables S1). [score:3]
The expression levels of miRNA mmu-miR-200a (0.009±0.009 vs 1.06±0.45-folds, p<0.05), mmu-miR-200b (0.021±0.02 vs 1.04±0.37-folds, p<0.05), mmu-miR-466a-3p (0.054±0.01 vs1.01±0.21-folds, p<0.05) and mmu-miR-466d-3p (0.028±0.02 vs 1.01±0.21-folds, p<0.01) were significantly decreased in NSCs from diabetic pregnancy when compared to the control (Fig. 3C). [score:2]
miRNAs, mmu-miR-200a, mmu-miR-200b, mmu-miR-466a-3p and mmu-miR-466d-3p were knocked down individually in NSCs in culture. [score:2]
We performed in situ hybridization of two representative miRNAs (mmu-miR-200b and mmu-miR-466d-3p) selected from each family of miRNA that are investigated in this study (mmu-miR-200 and mmu-miR-466 family) in unbiased manner to detect whether these miRNAs were expressed by NSCs. [score:1]
Similarly, the knockdown of miRNA mmu-miR-200b (128.09±10.46%, p<0.05) or mmu-miR-466d (116.05±6.19%, p<0.05) increased the number of Ng2 positive cells when compared to scrambled transfected cells (Fig. 5F–J,ii). [score:1]
There was significantly increased astrogenesis as indicated by increased Gfap positive cells following knockdown of miRNAs, mmu-miR-200a (120.52±6.54%, p<0.01) or mmu-miR-200b (115±2.24%, p<0.01) or mmu-miR-466a-3p (126.53±18.87%, p<0.05) compared to scrambled (Scr) transfected cells (Fig. 5 A–E, i). [score:1]
[1 to 20 of 18 sentences]
27
[+] score: 76
Other miRNAs from this paper: hsa-mir-200b, mmu-mir-200a, hsa-mir-200c, mmu-mir-200c, hsa-mir-200a
It is of note that further down-regulation of Zeb1 in Zeb1 null MEF cells had little effects on miR-200 expression (Figure  4B), possibly due to [1] the level of Zeb1 protein in het MEF cells is low enough to relieve the repression on miR-200 family, further decrease in Zeb1 expression in null cells will not increase in miR-200 expression accordingly or/and [2] it is also possible that Zeb1 might down-regulate other unknown factor(s) that positively regulates expression of miR-200 family at the same time and thereby makes the regulation network more complex. [score:17]
Our results suggest that E2F-Rb1 binds constitutively to the Ets1 promoter and limits the level of expression, but a second major impact of Rb1 on Ets1 expression is mediated through Rb1 repression of Zeb1 [40] and in turn induction of miR-200, which targets Ets1. [score:7]
miR-200b targets Ets-1 and is down-regulated by hypoxia to induce angiogenic response of endothelial cells. [score:6]
Knockdown of Zeb1 in the T KO MEFs using shRNA lenvirirus, as described previously [17], eliminated much of the induction of Ets1 (Figure  4D), suggesting that induction of Zeb1 and repression of miR-200 as Rb1 family members are mutated is contributing significantly to the upregulation of Ets1. [score:5]
Because miR-200 has been shown to target Ets1 [19], we wondered if Zeb1 might also affect expression of Ets1. [score:5]
We link the effect of Zeb1 to its regulation of miR-200, which in turn target Ets1. [score:4]
Such findings raised the possibility that Zeb1 might feedback to induce Ets1 via its repression of miR-200, and that Rb1 might also influence Ets1 expression via its regulation of Zeb1. [score:4]
Rrm2, ribonucleotide reductase, Ntf3, neurotrophin 3. Zeb1 is a target of the miR-200 family, but in a negative loop Zeb1 feeds back to repress transcription of miR-200 family members [20, 21]. [score:3]
We link Rb1 repression of Zeb1 to induction of miR-200 family members, which in turn target Ets1 mRNA. [score:3]
miR-200 also represses Zeb1, but in a double negative loop Zeb1 binds the promoters of miR-200 family members and represses their expression [20, 21]. [score:3]
These results suggest that Rb1-E2F binds the Ets1 promoter to limit its level of expression, but it is induction of Zeb1 and in turn repression of miR-200 when the Rb1 family activity is lost that is responsible for most of the induction of Ets1. [score:3]
Taken together, our results provide evidence of an amplification loop consisting of Ets1 and Zeb1, which is mediated by miR-200 and regulated by Rb1. [score:2]
Figure 8 Mo del depicting an Ets1-Zeb1 amplification loop that is dependent upon miR-200 and regulated by Rb1. [score:2]
These results imply that CtBP -dependent transcription repression of miR-200 family members by Zeb1 is important for regulation of Ets1 and for thymocyte differentiation. [score:2]
We propose that Ets1 and Zeb1 form an amplification loop that is dependent upon Zeb1 repression of miR-200 and regulated by the Rb1 family (Figure  8). [score:2]
These findings suggest that Ets1 and Zeb1 comprise an amplification loop that is dependent upon miR-200 and regulated by Rb1. [score:2]
As we demonstrated previously [16], mutation of Rb1 family members led to induction of Zeb1 and this induction of Zeb1 was accompanied by repression of miR-200 (Figure  4C) and, as shown above, Ets1 (Figure  1). [score:2]
Zeb1 repression of the miR-200 family is linked to induction of Ets1. [score:1]
Ets1 Zeb1 miR-200 Thymocyte differentiation Lung adenocarcinoma c-Ets1 was identified as a proto-oncogene based on v-ets in the genome of the avian leukemia retrovirus E26, and is the founding member of the Ets family of transcription factors [1]. [score:1]
Recent studies have found that Ets is repressed by miR-200 family members [19]. [score:1]
Taken together, these results suggest an amplification loop between Ets1 and Zeb1, where Ets1 increases transcription of Zeb1, and Zeb1 in turn represses miR-200 to further elevate Ets1. [score:1]
[1 to 20 of 21 sentences]
28
[+] score: 67
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 MiRNAs are small, 19–23 nucleotide non-coding RNAs that function as post-transcriptional repressors of gene expression, either through messenger RNA (mRNA) degradation or translational repression (Bartel, 2009). [score:14]
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 Using microarray analysis, the expression profile of murine miRNAs in the developing lip and PS were analyzed from E10 to E14 (Mukhopadhyay et al., 2010; Warner et al., 2014). [score:12]
miRNA gene or target mRNA Species Genome variation Molecular effect PDGFRa Human Mutation 3′UTR Altered miR-140 bindingRattanasopha et al., 2012 miR-140 Human SNP Altered miRNA-140 processingLi et al., 2010, 2011 Zebrafish Overexpression Altred Pdfra repressionEberhart et al., 2008 MSX1 Human SNP 3'UTR Altered miR-3649 bindingMa et al., 2014 FGF2/5/9 Human SNP3'UTR Altered miR-496/miR-145/miR-187 bindingLi D. et al., 2016 miR-17-92 cluster Mouse Homozygous deletion Altered Tbx113, Fgf10, Shox2 & Osr1 repressionWang et al., 2013 miR-200b Mouse Overexpression Altered Smad2, Snail& Zeb112 repressionShin et al., 2012a, b miR-133b Zebrafish Overexpression UnkownDing et al., 2016 CS, CC, JV: Conception of the work, drafting of the manuscipt, revision of the manuscript, final approval of the manuscript. [score:10]
MiR-200b belongs to the miR-200 family and together with other family members miR-200a and miR-429, it is clustered in an intergenic region on human chromosome 1. MiR-200b is expressed in the epithelium during palatogenesis in the mouse, including in the midline epithelial seam (MES), and its expression gradually decreases as fusion proceeds (Shin et al., 2012a, b). [score:5]
MiR-200b belongs to the miR-200 family and together with other family members miR-200a and miR-429, it is clustered in an intergenic region on human chromosome 1. MiR-200b is expressed in the epithelium during palatogenesis in the mouse, including in the midline epithelial seam (MES), and its expression gradually decreases as fusion proceeds (Shin et al., 2012a, b). [score:5]
In summary, miR-140 regulates the migration of neural crest cells, miR-200b regulates palatal fusion and the miR-17-92b cluster regulates palatal shelf growth. [score:4]
In keeping with this, overexpression of miR-200b results in a failure of fusion due to persistence of the MES (Shin et al., 2012a, b). [score:3]
miR-200b regulates cell migration via Zeb family during mouse palate development. [score:3]
In this respect, miR-200b was shown to target Smad2, Snail, Zeb1, and Zeb2, all genes encoding transcription factors that function as mediators of the Tgf-β signaling pathway. [score:3]
Overexpression of miR-200b also leads to maintenance of the MES by repressing TGF-β during the final stages of palatogenesis and hence results in a failure of the PS to fuse. [score:3]
MiR-200b is involved in Tgf-beta signaling to regulate mammalian palate development. [score:2]
miR-200b as regulator of palatal fusion. [score:2]
Apart from miR-140, the miR-17-92 cluster, and miR-200b (see below), most of the miRNAs have an as yet unknown role in palatogenesis. [score:1]
[1 to 20 of 13 sentences]
29
[+] score: 65
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
DEX treatment up-regulated the expression of miRNA-483, miRNA-181a-1, miRNA-490 and miRNA-181b-1, while it down-regulated the levels of miR-122, miR-466b, miR-200b, miR-877, miR-296, miRNA-27a and precursor of miR-504. [score:9]
The levels of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377, and miRNA-96 were up-regulated, whereas miR-125b, miRNA-200b, miR-122, miRNA-466b, miR-138, miRNA-214, miRNA-503 and miRNA27a were down-regulated in response to 17α-E2 treatment. [score:7]
qRT-PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats (Fig. 3 ). [score:7]
Real-time quantitative PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats. [score:7]
Using qRT-PCR, we confirmed the down-regulation of miRNA-200b, miR-122, miR-19a, miRNA-466b, and miRNA-27a expression (Fig. 3 ). [score:6]
Bt [2]cAMP stimulation of granulosa cells caused down-regulation of a majority of miRNAs, including miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, miRNA-138 and miRNA-19a, but expression levels of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 were significantly increased. [score:6]
In contrast, dexamethasone down-regulated the expression of several of the miRNAs by more than 1.5 fold, i. e., miR-122 (8.2-fold), miR-466b (2.31-fold), miR-200b (1.9-fold) miR-877 (1.61-fold), miR-296 (1.61-fold)and precursor of miR-504 (1.53-fold) (Fig. 2D ). [score:6]
qRT-PCR measurements indicated that exposure of primary rat granulosa cells to Bt [2]cAMP for 24 h inhibited the expression of miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, and miRNA-138 and miRNA-19a while enhancing the expression of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 (Fig. 4 ). [score:5]
We next evaluated the effects of Bt [2]cAMP stimulation of rat ovarian granulosa cells and of mouse MLTC-1 Leydig tumor cells on the expression of twelve miRNAs (miRNA-212, miRNA-122, miRNA-183, miRNA-200b, miRNA-466b, miRNA-182, miRNA-96, miRNA-27a, miRNA-132, miRNA-214, miRNA-138 and miRNA-19a) whose adrenal expression was differentially altered in response to treatment of rats with ACTH, 17α-E2 or DEX. [score:3]
The levels of expression of miRNA-212, miRNA-122, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96, miRNA-466b, miRNA-200b, and miRNA-19a are shown. [score:3]
More specifically, we assessed the impact of Bt [2]cAMP treatment on the expression of miRNA-212, miRNA-122, miRNA-27a, miRNA-466b, miRNA-200b, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96 and miRNA-19a. [score:3]
Dexamethasone treatment decreased miRNA-200b, miR-122, miR-19a, miRNA-466b and miRNA27a levels, but increased miRNA-183 levels. [score:1]
0078040.g003 Figure 3Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
[1 to 20 of 14 sentences]
30
[+] score: 61
miR-200 family knockdown by a single miR inhibitor plasmidBecause one miR inhibitor can potentially inhibit different members of the same miR family, we asked if a PMIS construct containing two inhibitors targeting an miR family could inhibit the complete miR family. [score:14]
To inhibit the miR-200 family, PMIS-miR-200b-200a was constructed and contains a U6 promoter followed by an miR-200b inhibitor, a second U6 promoter followed by miR-200a inhibitor (Figure 1c). [score:7]
This construct allows for the expression of multiple miR inhibitors from one plasmid to inhibit the entire miR-200 family (Figure 4g). [score:7]
[41] To test if the PMIS-miR-200 inhibits miR-200 function in vitro and promotes EMT, a stable MDCK cell line was made that expresses PMIS-miR-200a-200b. [score:5]
Overexpression of miR-200 promotes a mesenchymal-to-epithelial transition in MDCK-Pez cells and conversely inhibition of miR-200 causes EMT in MDCK cells. [score:5]
To determine the relative stability of the miR inhibitor, cells were transduced with lentivirus expressing PMIS-miR-200b. [score:5]
miR-200 family knockdown by a single miR inhibitor plasmid. [score:4]
Quantitative PCR of PMIS expression in two different PMIS transgenic embryos show high levels of PMIS-miR-17-18 and PMIS-miR-200b, respectively (Figure 10f). [score:3]
PMIS constructs for miR-200a or -141 (PMIS-miR-200a or PMIS-miR-141) inhibited the miR-200a/141 subfamily but not the miR-200b/200c/429 subfamily (Figures 4b and c). [score:3]
39, 40 PMIS for miR-200b, -200c or -429 inhibited the miR-200b/200c/429 subfamily efficiently but not the miR-200a/141 subfamily (Figures 4d–f). [score:3]
The miR-17 reporter was used as a control to show that PMIS-miR-200b-200a did not affect endogenous miR-17 activity. [score:1]
The following oligos were also used: miR-200a rf, 5′-TCGAATGACCACATCGTTACCAGACAGTGTTACTCGAGCTGC-3′ and miR-200a rr, 5′-GGCCGCAGCTCGAGTAACACTGTCTGGTAACGATGTGGTCAT-3′ miR-200b rf, 5′-TCGAATGACCTCATCATTACCAGGCAGTATTACTCGAGCTGC-3′ and miR-200b rr, 5′-GGCCGCAGCTCGAGTAATACTGCCTGGTAATGATGAGGTCAT-3′ miR-200c rf, 5′-TCGAATGACCTCCATCATTACCCGGCAGTATTACTCGAGCTGC-3′ and miR-200c rr, 5′-GGCCGCAGCTCGAGTAATACTGCCGGGTAATGATGGAGGTCAT-3′ miR-141 rf, 5′-TCGAATGACCCCATCTTTACCAGACAGTGTTACTCGAGCTGC-3′ and miR-141 rr, 5′-GGCCGCAGCTCGAGTAACACTGTCTGGTAAAGATGGGGTCAT-3′ miR-429 rf, 5′-TCGAATGACCACGGCATTACCAGACAGTATTACTCGAGCTGC-3′ and miR-429 rr, 5′-GGCCGCAGCTCGAGTAATACTGTCTGGTAATGCCGTGGTCAT-3′. [score:1]
36, 37 As controls, the levels of m iR-23a, miR-200b and miR-19 were not affected by PMIS-miR-17-18. [score:1]
The miR-200 family has two subfamilies, miR-200a-3p/141-3p and miR-200b-3p/200c-3p/429-3p (Figure 4a). [score:1]
[57] MG-63 cells were transduced with PMIS-miR-200b lentivirus, and after 48 h, cells were seeded in 6-well plates at the same density (30–40%) with 0.1% dimethyl sulfoxide in Dulbecco's modified Eagle's medium. [score:1]
[1 to 20 of 15 sentences]
31
[+] score: 48
HL-1 atrial cardiomyocytes transfected with miR-29 and miR-200 (Fig 8) significantly down-regulate Cacna1c, Hnc4 and Ryr2 expression, while Camk2a was significantly decreased with miR-200 but not miR-29 (Fig 8). [score:6]
We provide herein evidences that miR-29 and miR-200 over -expression also contributes to ion channel expression remo deling. [score:5]
Observe that miR-29 and miR-200 over -expression leads to significant decreased of Cacna1c, Hcn4, Ryr2 and Camk2a (except for miR-29a) expression. [score:5]
miR-29 over -expression in HL1 atrial cardiomyocyte deregulate Cacna1c, Hnc4 and Ryr2, influencing therefore both the calcium handling and pacemaker activity, whereas miR-200 regulated Cacna1c, Ryr2 and Camk2a, in addition to Scn5a as previously reported [64], impacting therefore also in calcium handling. [score:5]
qPCR of left atrial chambers demonstrated that miR-1, miR-26b, miR-29a, miR-30e, miR-106b, miR-133 and miR-200 are up-regulated in HTD rats as compared to controls (Fig 1), demonstrating a similar microRNA expression profile as in atrial-specific Pitx2 deficient mice [14, 16]. [score:5]
0188473.g008 Fig 8Analyses of Scn5a, Kcnj2 and Cacna1c (A), miR-1, miR-29a, miR-106b and miR-200b (B) expression in Pitx2 gain and loss-of-function experiments after H [2]0 [2] administration for 12h and 24h, respectively. [score:3]
HL-1 cells (6 × 10 [5] cells per well) were transfected with plasmids containing expression constructs for Pitx2, Wnt8a (Addgene), Wnt11a (Addgene, Cambridge, MA, USA), premiR-29a, pre-miR-200 (Exiqon) or siRNA-Pitx2c, siRNA-Zfhx3, siRNA-Enpep, siRNA-Sod2 (Sigma, Aldrich, Munich, Germany) as previously described [14, 34]. [score:3]
Thus these data demonstrate that miR-29 and miR-200 impaired expression also contributes to develop pro-arrhythmogenic substrates. [score:3]
miR-29a and miR-200 expression in HL-1 atrial cardiomyocytes transfected cells. [score:3]
Whereas it is wi dely documented that redox signaling can compromise ion channel functioning and calcium homeostasis in cardiomyocytes [67], in our system we observed no influence of H [2]O [2] administration on the regulatory impact of Pitx2 in distinct ion channels such as Scn5a, Kcnj2 and Cacna1c as well as multiple Pitx2-regulated microRNAs such as miR-1, miR-26, miR-29 and miR-200, in which redox impairment impact is less documented [68]. [score:3]
We have previously demonstrated that Pitx2 modulates expression of miR-29 and miR-200, among other microRNAs [16] and furthermore we have demonstrated in this study that modulation of distinct ion channel is greatly influenced by H [2]0 [2] administration while microRNA signature is mostly dependent on Pitx2c but not H [2]0 [2] administration. [score:3]
Several lines of evidence have already reported the key regulatory role of miR-1 [60– 62], miR-26 [63], miR-106b [64], miR-133 [65– 66] and miR-200 [64] in arrhythmogenesis. [score:2]
Modulation of miR-29 and miR-200 alters cardiac action potential determinants. [score:1]
Importantly, miR-29 and miR-200 are not significantly impaired in SHR atrial chambers, suggesting that Wnt-microRNA might be a pivotal candidate establishing fundamental differences between HTD and HTN in atrial arrhythmogenesis susceptibility. [score:1]
[1 to 20 of 14 sentences]
32
[+] score: 48
It has been suggested that different cell lines regulate miR-200 expression through distinct epigenetic mechanisms [27]. [score:4]
Downregulation of miR-200 family members might underlie kidney cyst formation in Dicer mutant kidneys. [score:4]
The miR-200 family consists of five members (miR-200a, miR-200b, miR-200c, miR-141, and miR-429), which are clustered and expressed as the miR-200b-200a-429 cluster at chromosomal location 1p36 and the miR-200c-141 cluster at chromosomal location 12p13. [score:3]
Members of the miR-200 family were highly expressed in the kidney, lung, small intestine, and exocrine glands (Figure 2(a)). [score:3]
Members of the miR-200 family are commonly expressed in tubular tissues, and it is impossible to classify these tissues using only the miR-200 family. [score:3]
As expected, members of the miR-200 family were highly expressed in exocrine glands and epithelial cells. [score:3]
Members of the miR-200 family were highly expressed in the proximal tubule. [score:3]
Members of the miR-200 family were expressed at high levels in each tissue with a tubular structure (Figures 3(a)– 3(c)). [score:3]
In human tissues, the results of the miRNA array analysis showed that miR-200a, miR-200b, and miR-200c (miR-200 family) were highly expressed in the kidney, lung, salivary gland, trachea, colon, prostate, liver, and pancreas (Figure 1). [score:3]
To examine the miR-200 family in the kidney, miRNA array analysis was performed to compare expression in the proximal tubule and mesangial cells. [score:3]
Our results showed that miR-200 family members were expressed at high levels in various tissues with a tubular structure: the kidney (proximal tubule and collecting duct), lung, pancreas (duct cells), small intestine (intestinal villus), bile duct, and exocrine glands (duct cells). [score:3]
The expression of miR-200a, miR-200b, miR-200c, miR-192, miR-194, and miR-449a was validated with real-time RT-PCR in rat tissues in order to discriminate the kidney from other tissues with a tubular structure. [score:3]
Members of the miR-200 family are highly expressed in the kidney and lung. [score:3]
We assessed whether the plasma concentrations of miR-200a, miR-200b, and miR-200c could be used as a biomarker for acute kidney injury (Figure 4). [score:1]
These results suggest that the miR-200 family is closely associated with tubular structure. [score:1]
The 3′-UTR of Pkd1 contains two evolutionarily conserved miR-200b/c binding sites. [score:1]
In the future, we will assess the potential of the urinary miR-200 family as biomarkers of the renal tubular dysfunction in humans. [score:1]
Patel et al. have reported that miR-200 family members play important roles in renal tubule maturation by repressing Pkd1 in the kidney [25]. [score:1]
We assessed whether the miR-200 family could be used as a biomarker for kidney injury. [score:1]
Consistently, the plasma concentrations of the miR-200 family members and miR-192 and miR-194 increased significantly. [score:1]
[1 to 20 of 20 sentences]
33
[+] score: 47
The top 15 differentially expressed microRNAs based on fold change (p<0.05) are presented in Table 1. The most differentially expressed miRNA was mmu-miR-429, a member of the miR-200 family, and 4 of the 5 miR-200f members (miR-141, miR-200b, miR-200c and miR-429) were in the top 15 differentially expressed miRNAs (shaded in Table 1). [score:7]
5-aza-2′-deoxycytidine treatment significantly increased the expression of both miR-200c (4.6-fold) and miR-200b (4.7-fold) suggesting that the expression of both miR-200 clusters are regulated, at least in part, by methylation. [score:6]
Promoter hypermethylation appears to be the primary mechanism for silencing miR-200c/141 expression while histone modifications via the Polycomb group has been reported to be responsible for silencing miR-200b/200a/429 expression [17]. [score:5]
Quantitative RT-PCR was used to validate the differential expression of the miR-200 family and as shown in Table 2, all 5 members of the miR-200f (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) were expressed at significantly higher levels in the PMT samples compared to the RST samples. [score:4]
Expression of the miR-200 clusters appears to be regulated by modifications to the promoter regions of each cluster. [score:4]
Inhibition of angiogenesis by miR-200c is consistent with a study by Pecot et al [92] that showed miR-200 family members could regulate tumor angiogenesis in basal-like breast cancer. [score:4]
miR-200c and miR-200b (first miRNA in miR-200c/141 or miR-200b/200a/429 cluster) levels in RJ423 cells treated daily with DMSO or 3μM of the DNA methyltransferase inhibitor, 5-aza-2′-deoxycytidine (5-aza) for 72hrs (B). [score:3]
One specific example is a study by Shimono et al [18] that compared miRNA profiles between breast cancer stem cells and the remaining non-tumorigenic, breast cancer cells and 3 miRNA clusters, miR-200c/141, miR-200b/200a/429 and miR-183/96/182, were consistently downregulated in breast cancer stem cells [18]. [score:3]
Expression (mean ± SEM) of miR-200a, miR-200b, miR-200c, miR-141 and miR-429 in RJ345 cells, RJ423 cells containing the empty vector control (RJ423EV) or RJ423 cells containing miR-200c (RJ423200c) as determined by Taqman RT-PCR. [score:3]
This family of microRNAs is expressed as two clusters on distinct chromosomes with the miR-200c/miR-141 cluster located on chromosome 12 in humans and chromosome 6 in mice and the miR-200b/miR-200a/miR-429 cluster located on chromosome 1 in humans and chromosome 4 in mice [15]. [score:3]
One family of microRNAs that has garnered considerable attention in cancer biology is the miRNA-200 family (miR-200f) which consists of 5 members, miR-141, miR-200a, miR-200b, miR-200c and miR-429. [score:1]
Figure 3B shows the levels of the first member of each miR-200f cluster (miR-200c and miR-200b) in RJ423 cells treated with the vehicle control (DMSO) or 5-aza-2′-deoxycytidine. [score:1]
miR-200a and miR-141 share the same seed sequence (AACACUG) that is different from the seed sequence of miR-200b, miR-200c and miR-429 by one nucleotide [16]. [score:1]
The seed sequence, the region of the miRNA that determines mRNA binding, is the same in miR-200b, miR-200c, and miR-429 (AAUACUG). [score:1]
At the end of the treatment period, RNA was extracted and Taqman qRT-PCR for miR-200c or miR-200b (first member of each cluster) was performed as described above using SnoRNA202 and SnoRNA234 as normalizers. [score:1]
[1 to 20 of 15 sentences]
34
[+] score: 47
Finally, the set of predicted targets of the miR-200b family were significantly down-regulated in sensory cells of the auditory and vestibular systems while being significantly up-regulated in mesenchymal cells. [score:9]
Importantly, a major mechanism by which miR-200b achieves this function is direct down-regulation of Zeb1 and Zeb2 [22]. [score:5]
The strength of this approach is further demonstrated by the ability to detect not only compartment specific regulators of cell fate (Zeb1/2, c-Ets1/2, miR-128, miR-9 and miR200b) but also miR-96, a miRNA which is expressed only in a subset of the sensory epithelial cells. [score:4]
As predicted by the in silico analysis, miR-200b is expressed in all of the sensory epithelial cells of the newborn mouse inner ear, both in the auditory and the vestibular systems (Figure 4B). [score:3]
Using this strategy, we identified Zeb1 and miR200b as regulators of epithelial and mesenchymal identity in the mouse inner ear, and we further identified the signaling pathway disrupted by the Zeb1 mutation in the Twirler mouse mutant. [score:3]
Finally, utilizing the example of the ZEB1/miR-200b pathway, we present a proof-of-concept that cell type–specific gene expression profiles can be used to identify molecular pathways upstream and downstream of deafness genes. [score:3]
This finding strongly suggests that miR-200b is expressed and active in sensory epithelial cells while its levels are very low in mesenchymal cells of the inner ear, consistent with the documented role of the family of miR-200b in establishing and maintaining an epithelial phenotype of cells. [score:3]
To validate this result, whole mount in-situ hybridizations were performed on newborn inner ears of wild type mice with a probe for miR-200b, as well as a probe for miR-182 (a miRNA that is expressed in hair cells and ganglion cells of the ear [17]) as a positive control, and a no-probe negative control. [score:3]
[B] miR200b is expressed in all epithelial cells of the newborn mouse inner ear. [score:3]
Our in situ hybridization results for miR-200b and immunolocalization for Zeb1 confirm that Zeb1 and miR-200b are expressed in mutually exclusive cell populations in the ear. [score:3]
Furthermore, the expression of miR-200b is epithelial-specific and included both the sensory and non-sensory epithelial cells. [score:3]
Thus, our computational analysis identified the miR-200b-ZEB1/2 pathway as a key regulator of epithelial and mesenchymal identities in the inner ear (Figure 5D). [score:2]
Whole-mount in-situ hybridization was performed with probes mmu-miR-182 and mmu-miR-200b (Exiqon) to detect miRNA-182 and 200b, respectively, as previously described [39]. [score:1]
[D] A mo del for the function of the miR-200 family in the sensory epithelium of the inner ear. [score:1]
Sections of whole mount in situ hybridizations that were performed on newborn mouse inner ears, with probes for miR200b, miR182 (as a hair cell-specific positive control) and no-probe control. [score:1]
[1 to 20 of 15 sentences]
35
[+] score: 40
Other miRNAs from this paper: hsa-mir-200b, mmu-mir-200a, hsa-mir-200c, mmu-mir-200c, hsa-mir-200a
Figure S3 Stable expression of Grhl2 in 4T1 cells leads to up-regulation of primary microRNA of miR-200b∼200a∼429 cluster and a slight down-regulation of Zeb2. [score:9]
Over -expression of Grhl2 caused an up-regulation of primary transcripts of microRNA-200b∼200a∼429 cluster and Epcam, and down-regulation of Zeb2 (Figure S3A, S3B). [score:9]
When Grhl2 was over-expressed, expression levels of the miR-200 family were up-regulated. [score:8]
4T1-control cells recovered from primary tumors were mainly comprised of epithelial cells, and expressed E-cadherin, Grhl2 and miR-200, while 4T1-control cells recovered from lungs were characterized by mesenchymal morphology and did not express E-cadherin, Grhl2 and miR-200 (Figure 4F, 4G, 4H, 4I). [score:3]
Our data suggest that Grhl2 could be the transcription factor that drives the expression of miR-200 in breast cancer cells. [score:3]
Members of the miR-200 family are epithelial specific microRNAs and play a critical role in EMT by targeting Zeb1 and Zeb2 [21], [22]. [score:3]
In contrast, 4T1-Wnt7A2 cells recovered from either primary tumors or lungs had a spindle or round-like mesenchymal morphology and did not express E-cadherin, Grhl2 and miR-200 (Figure 4F, 4G, 4H, 4I). [score:3]
4T1-Wnt7A1 cells recovered from either primary tumors or lungs were characterized by a cobble-stone like epithelial morphology and expressed high levels of E-cadherin, Grhl2 and miR-200 (Figure 4F, 4G, 4H, 4I). [score:1]
Relative expression levels of primary microRNA-200C∼141 cluster, primary microRNA-200b∼200a cluster, and EMT inducers were measured by quantitative realtime PCR. [score:1]
[1 to 20 of 9 sentences]
36
[+] score: 39
According to prior work, the miR-200 family is induced by NO donors and contributes to Zeb2 downregulation during mESC mesendodermal differentiation [28]. [score:4]
Western blot analysis showed that the inhibition of miR-200b, the most NO-sensitive miR-200 family member, rescued Zeb1 levels both in DM and in NO conditions (Supplementary Fig.   3d). [score:3]
Of note, miR-200c and miR-141, belonging to the miR-200 family cluster 2 and mapping to mouse chromosome 6 (Supplementary Fig.   1c, left lower cartoon), were not significantly upregulated by NO compared to controls (Supplementary Fig.   1c, middle lower graph). [score:3]
Kim Y Lineage-specific expression of miR-200 family in human embryonic stem cells during in vitro differentiationInt. [score:3]
Similarly to mESC exposed to an exogenous source of NO (Supplementary Fig.   3a) ESNO+ expressed significantly higher levels of the NO-inducible miR-200b (Fig.   6d) paralleled by a decrease in Zeb1 protein level (Fig.   6e). [score:3]
After sorting, the expression of miR-200b and mesendodermal markers was analyzed in both cell populations. [score:3]
Furthermore, p53 positively regulates the miR-200 family transcription 34, 35 and NO is among the signaling molecules regulating p53 [35]. [score:3]
d miR-200b expression analysis in ESNO+ (white bar) compared to ESNO− (black bar) at 24 h from sorting. [score:2]
Brabletz S Brabletz T The ZEB/miR-200 feedback loop--a motor of cellular plasticity in development and cancer?EMBO Rep. [score:2]
Moreover, ChIP experiments revealed a feedback loop regulation between Zeb1 and miR-200 family in mESC (Supplementary Fig.   3e). [score:2]
To establish whether the NO -mediated Zeb1 down-modulation was regulated by induction of miR-200 family, we analyzed Zeb1 protein levels in mESC transfected with scramble or anti-miR-200b oligonucleotides. [score:2]
In this condition, chromatin immunoprecipitation (ChIP) showed p53 bound to the miR-200 cluster 1 promoter region (Supplementary Fig.   1f). [score:1]
miR200b-LNA nucleofection. [score:1]
To assess NO responsiveness at the molecular level, we evaluated the expression of the miR-200 family members. [score:1]
This evidence suggests the presence of a molecular circuitry involving mir-200, Zeb factors, Hdacs and pluripotency genes contributing to keep mESC undifferentiated [30]. [score:1]
Specifically, we observed an enrichment of Zeb1 binding on miR-200 family cluster 1 promoter in mESC kept in GS, suggesting active repression of the miR-200 family in self-renewal condition. [score:1]
In SM, miR-200b, miR-200a, and miR-429 were induced after LIF withdrawal (DM), an effect enhanced in NO (Supplementary Fig.   1c, middle upper graph) [28]. [score:1]
Conversely, in cells released from GS in the presence of NO, miR-200 family member induction was robust and significant for all cluster components (Supplementary Fig.   1c, right graphs). [score:1]
Further experiments were performed with LNA oligos designed against miR-200b. [score:1]
Nucleofection was performed in 10 [6] mESC cultured in GS using Amaxa P3 primary cell 4D Nucleofector Kit (Lonza) either with 50 µM Mircury scramble or miR-200b LNA-oligonucleotides (Exiqon). [score:1]
[1 to 20 of 20 sentences]
37
[+] score: 37
The expression of the mir-200b-200a-429 cluster located on human chromosome 1, and the expression of the mir-200c-141 cluster located on human chromosome 12 are shown. [score:5]
Our small RNA library sequencing data (Figure 1A) show that the miR-200 family is highly expressed in cultured normal human mammary epithelial cells (HMEC) derived from three different individuals, whereas the isogenic human mammary fibroblast cells (FB) lack miR-200 family expression (Figure 1A). [score:5]
Regulation of the miR-200 family expression in normal and cancer cells is not fully understood. [score:4]
It is apparent from the small RNA library sequencing data (Figure 1A) that the most highly expressed members of the miR-200 family in HMEC are miR-200c and miR-141. [score:3]
The microRNA-200 family participates in the maintenance of an epithelial phenotype and loss of its expression can result in epithelial to mesenchymal transition (EMT). [score:3]
Furthermore, the loss of expression of miR-200 family members is linked to an aggressive cancer phenotype. [score:3]
The CpG island is unmethylated in human miR-200/miR-141 expressing epithelial cells and in miR-200c/miR-141 positive tumor cells. [score:3]
A. miR-200 family expression according to massive parallel sequencing of small RNA libraries from a set of three isogenic pairs of human mammary epithelial cells (HMEC) and fibroblasts (FB). [score:3]
miR-200 family expression according to massive parallel sequencing of small RNA libraries from a set of three isogenic pairs of human mammary epithelial cells (HMEC) and fibroblasts (FB). [score:3]
miR-200c and miR-141 are members of the miR-200 family and are important regulators of the epithelial to mesenchymal transition (EMT) [5], [9], [10], [11]. [score:2]
HMEC samples are shown in green, isogenic FB samples are shown in red, and two miR-200 -negative breast cancer cell lines are in blue. [score:1]
One cluster resides on human chromosome 1 and encodes miR-200b, miR-200a, and miR-429, while the other cluster is located on human chromosome 12, and encodes miR-200c and miR-141. [score:1]
The miR-200 family is comprised of five miRNAs that are encoded within two clusters. [score:1]
[1 to 20 of 13 sentences]
38
[+] score: 36
Several down-regulated (i. e. miR-1, miR-7, miR-34a, miR-122, miR-125b, miR-200) or up-regulated (i. e. miR-17, miR-18, miR-19, miR-155, miR-93, miR-221/222) miRNAs have been identified as tumor suppressor or oncomirs, respectively, by targeting and regulating genes involved in cell proliferation, apoptosis, angiogenesis and metastasis [13]. [score:12]
MiR-200a was found to be up-regulated in NAFLD [51], significantly down-regulated in human HCC samples and, along with miR-200 family members, has been described as a marker able to distinguish between cirrhotic and cancer tissues [52, 53]. [score:7]
It is known that miR-200 family plays a role as tumor suppressor by inhibiting epithelial-to-mesenchymal transition (EMT) and repressing cancer stem cells; in addition, its deregulation has been described in several tumor types, including hepatocarcinoma [50]. [score:6]
MiR-200a and c, members of the miR-200 family, showed different behavior: after expression level’s decrease (6 months), miR-200a increased during the progression of hepatic damage (12 months), whereas miR-200c revealed a trend of down-regulation during HF diet treatment and in tumors. [score:6]
Pogribny IP Starlard-Davenport A Tryndyak VP Han T Ross SA Rusyn I Difference in expression of hepatic microRNAs miR-29c, miR-34a, miR-155, and miR-200b is associated with strain-specific susceptibility to dietary nonalcoholic steatohepatitis in miceLab Invest. [score:3]
Dhayat SA Mardin WA Kohler G Bahde R Vowinkel T Wolters H The microRNA-200 family-A potential diagnostic marker in hepatocellular carcinoma?J Surg Oncol. [score:1]
Feng X Wang Z Fillmore R Xi Y MiR-200, a new star miRNA in human cancerCancer Lett. [score:1]
[1 to 20 of 7 sentences]
39
[+] score: 36
For the six downregulated miRNAs selected from the Solexa sequencing, four of them showed significant reductions in the expression levels in the brains of the three infectious mo dels, while one (mmu-miR-200b-3p) was downregulated in the 139A- and ME7-infected mice but upregulated in the S15-infected group, and another (mmu-miR-200b-5p) was upregulated in 139A- and ME7-infected mice and almost unchanged in the S15-infected group (Figure 2B). [score:15]
To validate the up- and downregulated miRNAs identified in the Solexa sequencing, 6 upregulated (mmu-miR-146a-5p, mmu-miR-341-3p, mmu-miR-879-5p, mmu-miR-3470a, mmu-miR-3473a and mmu-miR-3473b) and six downregulated miRNAs (mmu-miR-96-5p, mmu-miR-141-3p, mmu-miR-182-5p, mmu-miR-200a-3p, mmu-miR-200b-3p and mmu-miR-200b-5p), as well as two novel miRNAs (novel-mir-2 and novel-mir-20), were selected. [score:10]
[30] The miR-200 family is a cluster of miRNAs closely linked to the epithelial–mesenchymal transition (EMT) and is believed to have an essential role in tumour suppression by inhibiting EMT, the initiating step of metastasis. [score:5]
Recent studies have shown that the miR-200 family is also significantly reduced during clinical disease in the scrapie agent RML (RML, mouse prion strain from Rocky Mountain Laboratory)-infected mouse neural synapses. [score:3]
We have also found that five members of the miR-200 family are markedly decreased in the brains of scrapie-infected mice, including mmu-miR-200a-3p, mmu-miR-200a-5p, mmu-miR-200b-3p, mmu-miR-200b-5p and mmu-miR-200c-3p. [score:1]
[31] A number of experimental studies show that changes in miR-200 family levels have been associated with enhanced tumorigenesis and are significantly correlated with decreased survival caused by lung cancer and other cancers. [score:1]
[31] The role of the miR-200 family in TSEs is not very clear. [score:1]
[1 to 20 of 7 sentences]
40
[+] score: 35
Other miRNAs from this paper: mmu-mir-205, mmu-mir-200a, mmu-mir-200c, mmu-mir-429
We then assessed whether overexpression of Etv5 could increase expression levels of any miRNA-200 family members. [score:5]
Expectedly, all the miRNA-200 family members were found to be expressed with higher expression levels in OSKME combination when compared that with OSKM during the first seven days of reprogramming (Fig.   3b). [score:4]
Gregory PA The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat. [score:4]
Five sites (orange) are supposed to be targeted by cluster A of miR-200 family (miR-200b,-200c and -429). [score:3]
Interestingly, there are five sites in 3′ UTR of Zeb1 potentially targeted by cluster A of miRNA-200 family members (miR-200b,-200c, and -429) and three sites by cluster B of miRNA-200 family members (miR-200a and -141) (Fig.   3a). [score:3]
In parallel, Etv5 knockdown can promote specification of epiblast and its derivative mesoendoderm and ectoderm In this study, we demonstrated that Etv5 could promote MET at the early stage of reprogramming through Tet2-miR200- Zeb1 regulation axis, which further increased the final efficiency of iPSCs induction (Fig.   3e). [score:3]
However, Etv5 KD in OSKM combination only led to the decreased expression levels of miR-200a, miR-200b, and miR-429 (Fig.   3b). [score:3]
Three sites (green) are supposed to be targeted by cluster B of miR-200 family (miR-200a, and -141). [score:3]
Wang G Critical regulation of miR-200/ZEB2 pathway in Oct4/Sox2 -induced mesenchymal-to-epithelial transition and induced pluripotent stem cell generationProc. [score:2]
b RT-qPCR analysis of miR-200 family members during the early stage of reprogramming (Day 0–7). [score:1]
Data are shown as mean ± SD (n = 3), OSKM + EV was set as the control, * P < 0.05, ** P < 0.01, *** P < 0.001. c The diagram of genomic structure of miR-200 family on chromosome 4 and chromosome 6. The red regions represent miRNA clusters and green regions represent conserved noncoding sequence (CNS) across mammals. [score:1]
a Predicted binding sites of miR-200 family located in 3′ UTR of Zeb1. [score:1]
This speculation is consistent with the observation that Oct4/ Sox2 can induce MET by miR-200- Zeb2 pathway [14]. [score:1]
We first analyzed the complementation of 3′ UTR of Zeb1 mRNA and miRNA-200 family members. [score:1]
[1 to 20 of 14 sentences]
41
[+] score: 35
As illustrated in Figure 2, TGF-β1 up-regulates miR-21, miR192, miR-377, miR-382, and miR-491-5p, but down-regulates miR-29 and miR-200 families during renal fibrosis (Kantharidis et al., 2011; Kriegel et al., 2012; Lan and Chung, 2012; Chung et al., 2013a, b). [score:7]
The miR-200 family regulates TGF-beta1 -induced renal tubular epithelial to mesenchymal transition through Smad pathway by targeting ZEB1 and ZEB2 expression. [score:6]
The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2. [score:6]
The miR-29 and miR-200 are TGF-β1 -dependent anti-fibrotic miRNAs that are extensively suppressed in the diseased kidneys (Qin et al., 2011). [score:5]
Moreover, recent studies also revealed that overexpression of miR-29, miR-200 or inhibition of miR-21 and miR-192 can effectively decelerate the progression of renal fibrosis (Oba et al., 2010; Chung et al., 2010a; Qin et al., 2011; Zhong et al., 2011, 2013; Chen et al., 2014) (Figure 3). [score:5]
As miR-200 has a major role in maintaining the epithelial differentiation, delivery of miR-200b significantly reduces renal fibrotic response by suppressing the transcriptional repressors of E-cadherin ZEB1 and ZEB2 (Korpal et al., 2008; Oba et al., 2010). [score:3]
miR-200b precursor can ameliorate renal tubulointerstitial fibrosis. [score:1]
The miR-200 and miR-221/222 microRNA families: opposing effects on epithelial identity. [score:1]
The miR-200 family contains miR-200a, miR-200b, miR-200c, miR-429, and miR-141 (Howe et al., 2012). [score:1]
[1 to 20 of 9 sentences]
42
[+] score: 34
Amongst these, oxidative stress -induced upregulation of the miR-200 family caused senescence [103]. [score:4]
It was shown the entire miR-200/182 cluster is upregulated in acute herpes simplex virus 1 encephalitis [80]. [score:4]
We observed the upregulation of eight miRNAs that make up a related miR-200 family (miR-200a, 200b, 200c, miR-141, miR-429) and a miR-183/96/182 cluster. [score:4]
We noted a commonality between all three groups (PR+BC, PR+BC/CRIZ, and PR+BC/TOP): miR 200 family (miR-200a, miR-200b, miR-200c, miR-141, and miR-429), miR-183/96/182 cluster, miR-30d-5p, and miR-191-5p were up-regulated, as compared to intact controls. [score:3]
Overall, much remains to be discovered about the miR-200 family’s roles in various diseases and conditions, including cancer and cancer treatment -associated CNS toxicity. [score:3]
A recent study analyzed and compared the miRNA profiles of gastric adenocarcinomas and brain metastatic carcinomas and identified the upregulation of, among others, the miR-200 family members miR-141-3p and miR-200b-3p in the brain metastatic samples [84]. [score:3]
Both tumor growth and chemotherapy treatment led to the upregulation of the miR-200 family, as compared to intact animals. [score:3]
Therefore, deregulation of the miR-200 family could be involved in brain metastasis via the Zeb/miR-200 family feedback loop. [score:2]
The miR-200 family was associated with brain metastases [84], and miR-30d-5p was implicated in medulloblastoma development [102]. [score:2]
Chemo and tumor brain -induced miRNA changes involved several miRNA families, such as the miR-200 family and miR-183/96/182 cluster, which were deregulated in PR+BC tumor-bearing and chemotherapy -treated animals. [score:2]
The miR-200 family is important for the proper balance between neuronal proliferation and differentiation during development [81]. [score:2]
Green arrow - miR-200 family; blue arrow - miR-183/96/182 cluster; red arrow - other common miRNAs. [score:1]
These miRNAs are often co-transcribed and referred to as the miR-200/182 cluster. [score:1]
[1 to 20 of 13 sentences]
43
[+] score: 34
miR-200 family members directly target Zeb1/Zeb2 and enhance E-cadherin expression, resulting in the suppression of murine mammary tumor cell migration [33, 36]. [score:8]
In contrast, Zeb1 suppresses the expression of miR-200 family members, forming a regulatory feedback loop [37]. [score:6]
However, the function of miR-200a in the initiation of vertebrate embryo development has not been reported (A list of miR-200 family members targets in stem cells and development is shown in Table 1). [score:5]
0068990.g001 Figure 1 (A) The expression of miR-200a, miR-200b and miR-429 in ES cell diferentiation. [score:3]
The miR-200 family consists of five members (miR-200a, -200b, -200c, -141 and -429) that are expressed as two separate polycistronic pri-miRNA transcripts. [score:3]
To determine whether miR-200 family is responsive to ES cell differentiation, we analyzed miR-200 mumbers (miR-200a, miR-200b and miR-429) expression during ES cell spontaneous differentiation by quantitative real-time PCR. [score:3]
miR-200 family menbers in stem cells and development. [score:2]
Previous studies show that miR-200 family members are emerging as important regulators of cell proliferation, differentiation and metastasis [29– 31]. [score:2]
The sequences encoding miR-200b/200a/429 exist as a cluster on mouse chromosomes 4, and those encoding miR-200c/141 exist as a cluster on chromosome 6 [32]. [score:1]
In previous studies, miR-200 family members were shown to promote the mesenchymal-epithelial transition (MET) and to activate the differentiation of pancreatic, colorectal and breast cancer cells into epithelial cells [33– 35]. [score:1]
[1 to 20 of 10 sentences]
44
[+] score: 32
The expression level of these 4 miRNAs was significantly different between F0 and F3 and spearman correlation analysis also showed that the expressions of these miRNAs were strongly and positively correlated with fibrosis grade (n = 105, r = 0.498(miR-199a), 0.607(miR-199a*), 0.639(miR-200a), 0.618(miR-200b), p-values<0.0001) (Figure 3). [score:5]
TGFβ -induced factor (TGIF) and SMAD specific E3 ubiquitin protein ligase 2 (SMURF2), both of which play roles in the TGFβ signaling pathway, are candidate targets of miR-199a* and miR-200b, respectively, as determined by the Targetscan algorithm. [score:5]
In LX-2 cells treated with TGFβ, the expression levels of miR-199a and miR-199a* were significantly higher than in untreated cells; the expression levels of miR-200a and miR-200b were significantly lower than in untreated cells. [score:5]
Recent reports showed that the miR-200 family regulated EMT by targeting EMT accelerator ZEB1 and SIP1 [24]. [score:4]
From our observations, overexpression of miR-200a and miR-200b can be connected to the progression of liver fibrosis. [score:3]
We identified that 4 highly expressed miRNAs (miR-199a, miR-199a*, miR-200a, and miR-200b) that were significantly associated with the progression of liver fibrosis both human and mouse. [score:3]
Furthermore, overexpression of miR-199a, miR-199a*, miR-200a and miR-200b in LX-2 cells resulted significant induction of above fibrosis-related genes compared with control miRNA (Figure 4B). [score:2]
validation of the 4 miRNAs (miR-199a, miR-199a*, miR-200a, and miR-200b). [score:1]
The sequences of mmu-miR-199a-5p, mmu-miR-199b, mmu-miR-199b, mmu-miR-200a, and mmu-miR-200b in mouse miRNA corresponded to the sequences of hsa-miR-199a, hsa-miR-199a*, hsa-miR-199a, hsa-miR-200a, and hsa-miR-200b in human miRNA, respectively (Table S3). [score:1]
The miR-199 and miR-200 families have are circumstantially related to liver fibrosis. [score:1]
The 4 human miRNAs (miR-199a, miR-199a*, miR-200a, and miR-200b) with the largest difference in fold change between the F1 and F3 groups were chosen to validate the microarray results using stem-loop based real-time qPCR. [score:1]
0016081.g003 Figure 3 validation of the 4 miRNAs (miR-199a, miR-199a*, miR-200a, and miR-200b). [score:1]
[1 to 20 of 12 sentences]
45
[+] score: 31
We observed the uncoupling of HMGCR mRNA (up-regulated) and protein (unchanged) in the liver of leptin -treated chicks, which coincided with significantly increased expression of gga-miR-200a gga-miR-200b and gga-miR-429 that were predicted to target the chicken HMGCR gene. [score:8]
Moreover, out of 12 miRNAs targeting SREBP-1c and/or HMGCR, five were significantly up-regulated in liver of leptin -treated chicks, including gga-miR-200b and gga-miR-429, which target both SREBP-1c and HMGCR. [score:8]
Among the five miRNAs predicted to target SREBP-1c, gga-miR-99a, gga-miR-100, gga-miR-200b and gga-miR-429 were found to be significantly (P < 0.05) up-regulated in the liver of leptin -treated chickens. [score:6]
Among the nine miRNAs predicted to target HMGCR, the expression of gga-miR-200a, gga-miR-200b and gga-miR-429 was significantly increased (P < 0.05). [score:5]
It is worth noting that gga-miR-200b and gga-miR-429 were predicted to target both SREBP-1c and HMGCR (Table 5). [score:3]
It is noteworthy that gga-miR-99a and gga-miR-100 belong to the miRNA gene family of miR-99, while the remaining three miRNAs, gga-miR-200a, gga-miR-200b and gga-miR-429, belong to the miRNA gene family of miR-8, located in the same miRNA cluster. [score:1]
[1 to 20 of 6 sentences]
46
[+] score: 30
HMGA2 has also been shown to function as an activator of Snail1 and Slug (Snail2) expression (inhibitors of E-cadherin/miR-200 expression), suggesting that p53/TA-p73/p63, by suppressing the expression of both Snail and Slug, it could induce the expression of E–cadherin and miR-200. [score:13]
Evidently, TA-p73/p63 appears to increase E-cadherin expression (a negative regulator of EMT), by suppressing ZEB1/2 through its target miRs, such as miR-192, miR-215, miR-145, miR-203, miR-200b, miR-200c, miR-183, miR-92a/b, miR-132, and miR-30a-e [45]. [score:8]
Together, p53/TA-p73/p63, by increasing the expression of miR-145, let-7, and miR-200, it could decrease the expression of metastasis promoting factors, and stem cell factors. [score:5]
p53, TA-p73/p63, and ΔNp63 regulate the processing of the tumor suppressor miRNAs, let-7, miR-200, miR-143, and miR-107. [score:4]
[1 to 20 of 4 sentences]
47
[+] score: 30
Other miRNAs from this paper: mmu-mir-200a, mmu-mir-200c
We previously showed that GRHL2 upregulates the expression of miR-200 family genes and other epithelial-specific genes, e. g., p63, K14, E-Cad, and β-catenin, while it suppressed mesenchymal regulators, e. g., fibronectin (FN), N-Cad, ZEB1, and ZEB2 [7]. [score:9]
Generally, GRHL2 regulates epithelial phenotype through direct transcriptional control of its target genes, e. g., E-Cad, p63, hTERT, miR-200 family genes, and EDC genes 4, 5, 7. The current study revealed an alternative pathway, in which GRHL2 determines epithelial phenotype through activation of the MAP kinase signaling, which then suppresses Smad -dependent TGF-β signaling molecules. [score:7]
This pathway is distinct from the transcriptional regulation of the target genes, e. g., E-cadherin, hTERT, p63, and miR-200 family genes, by direct GRHL2 binding at the promoter regions Mechanistic scheme is drawn to depict the functional interaction between GRHL2 and TGF-β signaling through Erk and JNK MAP kinase signaling. [score:5]
This pathway is distinct from the transcriptional regulation of the target genes, e. g., E-cadherin, hTERT, p63, and miR-200 family genes, by direct GRHL2 binding at the promoter regions SCC4, SCC9, FaDu, and SCC15 cell lines were purchased from the ATCC (Manassas, VA) and were cultured in DMEM/Ham’s F-12 (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS) and 0.4 µg/ml hydrocortisone. [score:5]
In addition, GRHL2 is a critical determinant of the epithelial phenotype through transcriptional regulation of the relevant effector molecules, e. g., miR-200 family genes and ZEB1, which also determine cellular plasticity 7– 9. GRHL2 has been shown to suppress epithelial–mesenchyme transition (EMT) induced by TGF-β in human mammary epithelial cells [9], while the mechanisms underlying the functional interaction between GRHL2 and TGF-β are not known. [score:4]
[1 to 20 of 5 sentences]
48
[+] score: 29
We found that five miRNAs were significantly upregulated (miR-429, miR-200a, miR-200b, miR-200c and miR-10b) and one of them was significantly downregulated (miR-29b) in aggressive clone compared to non-aggressive one. [score:6]
This upregulation may be a key event in the aggressive clones of heterogeneous DCIS lesions, and the specific roles of the miR-200 family in our aggressive clones and their contribution to disease progression will be the focus in our future studies. [score:6]
Five of these miRNAs were upregulated (miR-429, miR-200a, miR-200b, miR-200c and miR-10b) and one of them was downregulated (miR29-b) in the aggressive S2B11 clone compared to S2D10 (Figure 6A). [score:6]
We have observed that four members of miR-200 family were upregulated in our aggressive clones. [score:4]
MiR-200b, miR-200c and miR-429 were shown to be upregulated in DCIS lesions compared to normal breast tissues [23]. [score:3]
MiR-200 family regulates epithelial-to-mesenchymal transition (EMT) and mesenchymal-to-epithelial transition (MET) through the inhibition of ZEB1 and ZEB2 [26]. [score:3]
MiR-200 family is an example to such miRNAs. [score:1]
[1 to 20 of 7 sentences]
49
[+] score: 28
miR-200 members regulate global gene expression through RNA silencing and direct or indirect post-transcriptional targeting, thereby modulating many biological processes, including cell cycle control, proliferation, apoptosis, and invasion [1, 2, 4– 8, 23, 24]. [score:8]
The microRNA-200 (miR-200) family consists of five members in two clusters, miR-200c/141 and miR-200b/a/429, which likely target different, but sometimes overlapping genes, thereby regulating many biological processes as oncomiRs or tumor suppressors [1, 2]. [score:6]
Despite advances in our understanding of BC-related miR-200 members, their precise roles in breast cancer cell (BCC) metastasis are largely unknown, in part because each miR-200 has several putative targets with disparate functions. [score:3]
The underlying mechanisms by which miR-200 overexpression promotes metastasis require further study, and genes that serve as intermediaries in miR-200 -associated metastasis are yet be identified. [score:3]
Individual miR-200 family member target genes appear to be cancer type- and context -dependent [3]. [score:3]
In many cancers, miR-200 member expression status serves as a surrogate marker for metastasis, response to drug treatments, and patient outcomes [4– 9]. [score:3]
Korpal M, et al. reported high miR-200 family levels in lung-pleural metastases with reduced BC patient survival and poor prognosis [7]. [score:1]
This is consistent with our xenograft results, and supports the potential role of the miR-200 family in promoting metastasis. [score:1]
[1 to 20 of 8 sentences]
50
[+] score: 27
For example, miR200 targets snai2, zeb1 and zeb2 mRNA [57– 59] whereas miR203 targets snai1 and zeb2 mRNA [59], and miR34 targets snai1 mRNA [60]. [score:7]
The miR200 expression can also be induced by p63 and p73 proteins, while miR34 is only induced by p73 but is down-regulated by p63 [65– 67]. [score:6]
The different isoforms of AKT seem to have opposing roles in the regulation of microRNAs: AKT1 inhibits miR34 and activates miR200 while AKT2 inhibits miR200 and activates miR34 [81]. [score:6]
To make our mo delling more insightful, we reduced the complexity by lumping variables into modules corresponding to signalling pathways: the TGF-β pathway (TGFb_pthw consisting of TGFbeta, SMAD), Notch pathway (Notch_pthw, includes activated Notch intracellular domain (NICD), the WNT pathway (WNT_pthw consisting of DKK1, CTNNB1), the p53 pathway (p53, consisting of p53), the p63-p73 proteins (p63_73 consisting of p63 and p73), the miRNA (miR34, miR200, miR203), the EMT regulators (EMT_reg including Twist1, Zeb1, Zeb2, Snai1, Snai2, Cdh2, Vim), E-cadherin (Ecadh with Cdh1), growth factors (GF), the ERK pathway (ERK_pthw: ERK), p21 is included in the CellCycleArrest phenotype, AKT1 module and AKT2 module. [score:2]
miR200 ZEB2 (SNAI1 | (SNAI2 & TWIST1) | NICD) & ! [score:1]
Cell migration depends on pathways involving AKT, ERK, Vimentin, miR200 and p63 but also on the acquisition of EMT and invasive abilities such as producing MMPs to dissolve the laminae propria enabling migration to distant sites. [score:1]
AKT1 Apoptosis (p53 | p63 | p73 | miR200 | miR34) & ! [score:1]
AKT1 GF !CDH1 & (GF | CDH2) miR200 (p63 | p53 | p73) & ! [score:1]
miR200 & ! [score:1]
miR203 CellCycleArrest (miR203 | miR200 | miR34 | ZEB2 | p21) & ! [score:1]
[1 to 20 of 10 sentences]
51
[+] score: 27
Other miRNAs from this paper: mmu-mir-203, mmu-mir-205, mmu-mir-200a, mmu-mir-200c
Upregulation of CDH1 in OSC-19 RICs may be directly caused by KLF4 [36], since they did not show downregulation of SNAI, ZEB families or up-regulation of miR-200 family. [score:11]
It has been reported that the EMT-inducing transcription factors, which suppress the CDH1 expression, are negatively regulated by the miRNAs (miR-200 family, miR-203, and miR-205, etc. ) [score:6]
The HOC313 RICs showed increased levels of miR-200 family members (miR-200a, -200b, -200c, -141, and -429), miR-203, and miR-205 (Fig 3G), which could down-regulate the SNAI and ZEB families [15– 17]. [score:4]
In accordance with this observation, significant up-regulation of miR-200 family, (miR-200a, -200b, -200c, -141, and -429), miR-203, and miR205 was detected in the RICs from HOC313 cells. [score:4]
The OSC-19 RICs showed increased levels of miR-203 and miR-205, although the miR-200 family members were not altered (Fig 4I). [score:1]
This result is consistent with the previous study showing that OCT3/4 and SOX2 induce the miR-200 family during iPS generation [35]. [score:1]
[1 to 20 of 6 sentences]
52
[+] score: 25
PJ up-regulates genes involved in cell adhesion such as E-cadherin, intercellular adhesion molecule 1 (ICAM1) and myristoylated alanine-rich protein kinase C (MARCKS) and down-regulates genes involved in cell migration such as type I collagen, tenascin C and chimerin 1. In addition, anti-invasive microRNAs such as miR-335 (predicted targets include COL1A1, TNC, SOX4), miR-205 (predicted targets include CHN1, PRKCE), miR-200 (predicted targets include ZEB1, ZEB2), and miR-126 (predicted targets include SLC45A3), are up-regulated, whereas pro-invasive microRNA such as miR-21 (predicted targets include MARCKS, PDCD4, TPM1) and miR-373 (predicted targets include CD44), are down-regulated. [score:25]
[1 to 20 of 1 sentences]
53
[+] score: 24
In epithelial cells, miR-200 family microRNAs and E-cadherin maintain higher level expression by repressing ZEB1, ZEB2 and TGFβ; on the other hand, in mesenchymal cells and tumors, the up-regulation of ZEB factors is triggered by TGFβ and suppresses the transcription of miR-141/200c by binding to their putative common promoter region. [score:8]
In our primary dataset, ZEB1 and ZEB2 were both up-regulated in six out of our eight ccRCC samples and, their expression levels were highly anti-correlated with the miR-200 family in both tumor and normal samples. [score:6]
Recently, several other groups have reported a role for the miR-200 family in the Epithelial-Mesenchymal-transition (EMT) and in cancer cell migration, the latter by directly targeting the transcription factors ZEB1 and ZEB2, which regulate E-Cadherin, a mediator of cell-cell adhesion [84, 85]. [score:5]
We also noted that in our data, the anti-correlation between VEGFA and the miR-200 family was strongest in normal kidney tissue, suggesting that loss of this regulation may be an important factor providing a permissive environment for HIF transcriptional signaling. [score:2]
Five miR-200 family members contain very similar seed sequences - AAUACU for miR-200b/200c/429 and AACACU for miR-200a*/141 [84]. [score:1]
Another example is the miR-200 family which includes two microRNA clusters, one on Chromosome 1p36.3 (miR-200a*/200b/429) and another on Chromosome 12p13 (miR-200c/141). [score:1]
We also found strong anti-correlation between VEGFA and the miR-200 family of microRNA: miR-200a*, 200b, 200c and miR-141. [score:1]
[1 to 20 of 7 sentences]
54
[+] score: 24
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-32, mmu-mir-1a-1, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-144, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-206, hsa-mir-208a, mmu-mir-122, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-214, hsa-mir-200b, mmu-mir-299a, mmu-mir-302a, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-144, hsa-mir-134, hsa-mir-206, mmu-mir-200a, mmu-mir-208a, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-328, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-214, mmu-mir-135a-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, hsa-mir-361, mmu-mir-361, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-377, mmu-mir-377, hsa-mir-328, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-20b, hsa-mir-429, mmu-mir-429, hsa-mir-483, hsa-mir-486-1, hsa-mir-181d, mmu-mir-483, mmu-mir-486a, mmu-mir-367, mmu-mir-20b, hsa-mir-568, hsa-mir-656, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-744, mmu-mir-181d, mmu-mir-568, hsa-mir-892a, hsa-mir-892b, mmu-mir-208b, hsa-mir-744, hsa-mir-208b, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-1307, eca-mir-208a, eca-mir-208b, eca-mir-200a, eca-mir-200b, eca-mir-302a, eca-mir-302b, eca-mir-302c, eca-mir-302d, eca-mir-367, eca-mir-429, eca-mir-328, eca-mir-214, eca-mir-200c, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-mir-133a, eca-mir-144, eca-mir-25, eca-mir-135a, eca-mir-568, eca-mir-133b, eca-mir-206-2, eca-mir-1-2, eca-let-7f, eca-mir-24-2, eca-mir-134, eca-mir-299, eca-mir-377, eca-mir-656, eca-mir-181a, eca-mir-181b, eca-mir-32, eca-mir-486, eca-mir-181a-2, eca-mir-20b, eca-mir-361, mmu-mir-486b, mmu-mir-299b, hsa-mir-892c, hsa-mir-486-2, eca-mir-9021, eca-mir-1307, eca-mir-744, eca-mir-483, eca-mir-1379, eca-mir-7177b, eca-mir-8908j
HMGA2 also down-regulates the expression of miR-200b [51]. [score:6]
For instance, we showed an increased expression of circulating serum miR-122 and miR-200 in ponies together with the predicted miRNA target genes that are required in the control of energy metabolism. [score:5]
Therefore, we can speculate that impaired HMGA2 has decreased capability to inhibit the miR-200 expression in ponies. [score:5]
Both miR-200a and miR-200b were significantly upregulated in pony serum in our study with log2FC >3.5 (Fig.   7c, Additional file 3: Table S2). [score:4]
A total of 50 miRNAs in serum proved to be potential biomarkers to differentiate specific breed types, of which miR-122, miR-200, miR-483 were over-expressed and miR-328 was under-expressed in ponies compared to Warmbloods. [score:4]
[1 to 20 of 5 sentences]
55
[+] score: 23
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
b Barcode plots showing the expression patterns of the mouse and human mRNA targets of the conserved luminal-specific miR-200b. [score:5]
Gregory PA Bert AG Paterson EL Barry SC Tsykin A Farshid G The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat Cell Biol. [score:4]
In human mammary epithelial cell lines, the expression of the miR-200 family was recently found to be subject to epigenetic regulation, whereby DNA methylation and histone modifications were altered during the transition between stem-like and nonstem states [67]. [score:4]
As a representative example, the inverse correlation is displayed by barcode plots for the mouse and human versions of miR-200b (Fig.   2b), which is a key miRNA that targets the EMT genes Zeb1 and Zeb2 [43]. [score:3]
More specifically, the expression of some miRNAs has been linked to histopathological features such as HER2/ neu or ER/PR status (miR-30), metastasis (miR-126 and miR-335) and the EMT (miR-205 and miR-200 family) [43, 76– 79]. [score:3]
Bracken CP Gregory PA Kolesnikoff N Bert AG Wang J Shannon MF A double -negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transitionCancer Res. [score:2]
Lim YY Wright JA Attema JL Gregory PA Bert AG Smith E Epigenetic modulation of the miR-200 family is associated with transition to a breast cancer stem-cell-like stateJ Cell Sci. [score:1]
DNA methylation of the miR-200c-141 cluster and polycomb group -mediated histone methylation of the miR-200b-200a-429 cluster resulted in repression at these loci [67]. [score:1]
[1 to 20 of 8 sentences]
56
[+] score: 23
miR-200b, as a tumor suppressor in multiple tumors including glioma, breast cancer, gastric cancer, and ovarian cancer, is down-regulated in glioma tissues and its lower expression is associated with poor prognosis [66]. [score:8]
Overexpression of miR-200b or knockdown of Rab21, Rab23, Rab18, and Rab3B inhibits breast cancer cell proliferation and invasion in vitro. [score:6]
Members of Rab family, Rab21, Rab23, Rab18, and Rab3B are predicted to be novel targets of miR-200b. [score:3]
These data provide evidence that miR-200b is a prognostic factor in breast cancer targeting multiple members of Rab family [66]. [score:3]
Likewise, the expressions of the four Rabs are repressed by transfection of miR-200b in breast cancer cells. [score:3]
[1 to 20 of 5 sentences]
57
[+] score: 23
Our correlation analysis by Targetscan on angiogenic growth factors and the 177 neonatally up-regulated miRNAs revealed three miRNAs, miR-410, miR-590-5p, and miR-200b, might play key roles in suppressing the expression of angiogenic factors in development (http://www. [score:11]
To determine which of the three miRNAs could effectively suppress VEGFA expression, we synthesized mimics of miR-410, miR-590-5p and miR-200b (Table 4) and transfected them into human umbilical vein endothelial cells (HUVECs) and retinal vascular endothelial cells (HRCECs), cells in which VEGFA is naturally highly expressed. [score:7]
VEGFA expression was suppressed by miR-410 at the molecular level compared with miR-200b and miR-590-5p transfection. [score:4]
These three miRNAs were miR-410, miR-590-5p and miR-200b (Fig 1b). [score:1]
[1 to 20 of 4 sentences]
58
[+] score: 22
Some of the results are in accordance with previous studies, such as the up-regulation of mmu-miR-221 and mmu-miR222 cluster and the down-regulation of the mmu-miR-200 family, as well as of mmu-miR-204, mmu-miR-30a*, mmu-miR-193, mmu-miR-378 and mmu-miR-30e*. [score:7]
On the contrary, the following miRNAs were down-regulated in WAT after HFD feeding: mmu-miR-141, mmu-miR-200a, mmu-miR-200b, mmu-miR-200c, mmu-miR-122, mmu-miR-204, mmu-miR-133b, mmu-miR-1, mmu-miR-30a*, mmu-miR-130a, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-203, mmu-miR-378 and mmu-miR-30e*. [score:4]
Mmu-miR-200b and mmu-miR-200c(members of the mmu-miR-200 family), mmu-miR-203 and mmu-miR-192 target Zeb1 and Zeb2 that regulate epithelial to mesenchymal transition [41] and have recently been implicated in adipogenesis and obesity [42]. [score:4]
The down-regulation of mmu-miR-200b and mmu-miR-200c after HFD -induced obesity, is in accordance with a previous study which showed that the mmu-miR-200 family promotes adipogenesis [43]. [score:4]
The following 22 murine microRNAs were selected for qPCR validation of their expression: mmu-miR-1, mmu-miR-21, mmu-miR-30a*, mmu-miR-30e*, mmu-miR-122, mmu-miR-130a, mmu-miR-133b, mmu-miR-141, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-200b, mmu-miR-200c, mmu-miR-203, mmu-miR-204, mmu-miR-222, mmu-miR-342-3p, mmu-miR-378 and mmu-miR-379. [score:3]
[1 to 20 of 5 sentences]
59
[+] score: 22
d, miR-27b is up-regulated by rhWnt5a in 3D lung aggregate cultures, while neither miR-27b nor miR-200b was affected by rhWnt11. [score:4]
Importantly, both miR-27b as well as another miRNA, miR-200b can inhibit blood vessel branching during angiogenesis [51, 52]. [score:3]
Interestingly, while rhWnt11 had no effect on either miRNAs (Fig.   3d), miR-27b expression was significantly increased by rhWnt5a treatment (Fig.   3d), while miR-200b levels were unaffected. [score:3]
As alternative signaling pathways, such as basic fibroblast growth factor (bFGF), platelet derived growth factor (PDGF) as well as miRNAs, especially the pro-angiogenic miR-27b and the miR-200 family [17, 18] also play a significant role in the regulation of angiogenesis; solely blocking VEGF-A simply cannot provide a therapeutic solution in NSCLCs [19]. [score:2]
As only miR-27b is regulated by Wnt5a, further studies are needed to find the molecules that control miR-200b. [score:2]
Pecot CV Rupaimoole R Yang D Akbani R Ivan C Lu C Tumour angiogenesis regulation by the miR-200 familyNat. [score:2]
c, miR-27b and miR-200b expression levels are significantly lower in AC compared to SCC. [score:2]
Inhibitors of branching and tube formation like miR-200b [63] and miR-27b [51] are both increased in SCC compared to AC potentiating differences in the actual blood vessel formation and pattern in tumors of squamous histology. [score:2]
PPARgamma, VEGF-A, Wnt5a, miR-27b and miR-200b levels were determined in resected adenocarcinoma and squamous cell carcinoma samples by qRT-PCR and. [score:1]
McArthur K Feng B Wu Y Chen S Chakrabarti S MicroRNA-200b regulates vascular endothelial growth factor -mediated alterations in diabetic retinopathyDiabetes [Internet]. [score:1]
[1 to 20 of 10 sentences]
60
[+] score: 21
The miR-200 family was significantly upregulated during T2AECs differentiation in fetal lung; miR-200 induction was inversely correlated with expression of known targets, transcription factors ZEB1/2, and TGF-β2. [score:8]
miR-200 antagonists inhibited thyroid transcription factor (TTF)-1 and surfactant proteins and upregulated TGF-β2 and ZEB1 expression in T2AECs [44]. [score:8]
Benlhabib H Guo W Pierce BM Men delson CR The miR-200 family and its targets regulate type II cell differentiation in human fetal lungJ. [score:4]
Koutsaki M Spandidos DA Zaravinos A Epithelial-mesenchymal transition -associated miRNAs in ovarian carcinoma, with highlight on the miR-200 family: prognostic value and prospective role in ovarian cancer therapeuticsCancer Lett. [score:1]
[1 to 20 of 4 sentences]
61
[+] score: 21
Because ZEB factors induce EMT by suppressing the expression of epithelial marker genes, including E-cadherin [9, 10], the overexpression of miR-200 s decreases expression of ZEB factors and induces epithelial differentiation. [score:9]
We also examined the levels of miR-200c, one of the miR-200 family microRNAs that are expressed in the cells, preserve epithelial phenotypes and function as EMT suppressors. [score:5]
A recent publication showed that the miR-200 family members inhibit TGF-β -induced EMT in a rat alveolar epithelial cell line [11]. [score:3]
The miR-200 family targets the ZEB factors (ZEB1 and ZEB2) that function as transcriptional repressors. [score:3]
The microRNA-200 (miR-200) family can reverse EMT and induce an epithelial phenotype in cancer cells [3- 8]. [score:1]
[1 to 20 of 5 sentences]
62
[+] score: 21
The variation of miR-98, miR-200b and miR-409 plasmatic expression was validated at different time-point of HT1 disease. [score:5]
MiR-98 and miR-200b were shown to be up-regulated from the first week following HT1 onset a moment which corresponds to the previously reported drastic increase in alanine transaminase (hepatocyte inflammation) serum levels 26. [score:4]
Since combined increased expression of miR-98 and miR-200b has also been connected with differentiation stage of cancer phenotype progression 23, the high levels of these molecules in plasma of mice after NTBC removal (Fig. 3c,d), warrants further validation of these molecules as potential biomarkers of liver injury in HT1 patients. [score:3]
Similarly, miR-200b has been found positively correlated with liver fibrosis progression and PI3K/Akt pathway regulation 33 34, mechanisms that are present in HT1 progression 19 26. [score:2]
Graph represents 3 individual per time point and median levels of miR-98-5p (c), miR-200b-3p (d) and miR-409-5p (e) in healthy controls and in NTBC-withdrawn mice (i. e. 1 week off, 4 weeks off and 8 weeks off). [score:1]
Modulation of plasma levels of miR-98, miR-200b and miR-409 after NTBC withdrawal. [score:1]
To confirm the modulation of specific miRNAs during progression of the HT1 -induced liver pathology in fah [−/−] mice after NTBC removal, three miRNAs (namely miR-200b-3p, miR-98-5p and miR-409-5p) were selected for validation by RT-qPCR (Table 2, highlighted miRNAs). [score:1]
Interestingly, among the 16 miRNAs having >1000 normalized reads in at least one plasma sample (Table 2), several miRNAs (e. g. let-7/miR98 family members, miR-200b, miR-21a, miR-142, miR-192, miR-148a) have already been reported for their implication in liver carcinogenesis and other pathological conditions 13 20. [score:1]
Several additional miRNAs that have already been related to pathological conditions and neoplastic lesions were overrepresented among circulating molecules such as miR-155 (part of the miR-17-92 cluster) 22, miR-200 family 23, miR-148a 24 and miR-375 25. [score:1]
Specifically miR-98-5p and miR-200b-3p changed significantly from the early stage of HT1 manifestation (Fig. 3c,d). [score:1]
Interestingly, miR-98-5p and miR200b-3p showed significant changes in circulating levels prior to AFP protein increase in liver, revealing a potential use as diagnostic tools (Figs. 3c,d and 4). [score:1]
[1 to 20 of 11 sentences]
63
[+] score: 20
Importantly, the reduction of miR21, miR19a and miR203, and the increased expression of miR200a, miR200b and miR205 are compatible with a possible reduction in the metastatic potential of 940 cells upon ectopic expression of huΔNp63α, and may explain the indirect regulation of EMT-mediating transcription factors described above. [score:7]
We observed a significant reduction in the expression of miR21, miR34a, miR200c, miR203 and miR19a, whereas miR200a, miR200b and miR205 displayed increased expression in HuΔNp63α -expressing 940 cells (Fig. 2I). [score:7]
In the present study we show that the experimental deregulation of p63 levels promoted altered expression of various miRNA previously involved in EMT and tumor metastasis, including miR-21, miR-34a, miR-200a, miR-200b, miR-203, miR19a and miR205. [score:4]
Of note, several of these miRNAs have been identified in ChIP-seq experiments and display binding sites for p53 (miR-21, miR34a), p63 (miR-200a, miR-200b) or both (miR-205) [20, 60]. [score:1]
These include miR21, miR200 family, miR34 family, miR130a, miR203, miR19a and miR205. [score:1]
[1 to 20 of 5 sentences]
64
[+] score: 20
Importantly, although miR-200a-3p and miR-200b-3p had similar inhibitory activities, miR-200c-3p was a less potent inhibitor (Figure 2B). [score:5]
Relying on the variations between the miR-200a-3p and miR-200b-3p AMOs, we defined a central core UUACCA sequence changed to UUACCC in miR-200c-3p, which is potentially directly involved in the inhibitory activity of these 2′OMe AMOs on TLR7 sensing (Figure 4C). [score:4]
Given that the miR-200b-3p and miR-200c-3p AMOs only differ by two bases, we hypothesized that one of these two variations in the miR-200c-3p AMO was responsible for the decreased TLR7 -inhibitory activity (Figure 4C). [score:3]
We noted that miR-200a-3p, miR-200b-3p and miR-200c-3p 2′OMe AMOs had a strong inhibitory effect on immunostimulatory ssRNA sensing in primary BMMs. [score:3]
To validate the TLR7 -inhibitory function of this motif in the miR-200 2′OMe AMOs, we synthesized two AMO variants of the miR-200a-3p 2′OMe AMO, with one (miR-200a-3p mut1) and three (miR-200a-3p mut2) base changes in the most conserved residues of the enriched motif (Figure 4C and D). [score:3]
While comparing the effects of miR-200 AMO variants, we noted that miR-200c-3p had a lesser capacity to inhibit TNF-α production, compared to miR-200a-3p and miR-200b-3p. [score:2]
[1 to 20 of 6 sentences]
65
[+] score: 20
In oral cancer, the expression of OIP5 may not be regulated at the post-transcription level as the miR-143/145, miR-200 and let-7 family microRNAs were reported to be downregulated in oral cancer 9, 11, 14. [score:7]
However, OIP5 was targeted by stemness regulatory miR-143/145, EMT associated miR-200 family and oral cancer-specific tumor suppressor let-7 family. [score:6]
Interestingly, we also found many MREs for stemness regulatory miRNAs miR-143/145 family, EMT regulatory miRNA miR-200a/miR-200b/miR-141, TP53 induced miR-34a, let-7, and several other oral cancer specific tumor suppressive miRNAs in OIP5 mRNA 3′-UTR (Supplementary Table  S7). [score:5]
One such important function of miR-200 family is regulation of epithelial to mesenchymal transition and miR-143/145 is to maintain the stemness 9, 14. [score:2]
[1 to 20 of 4 sentences]
66
[+] score: 19
To further examine expression patterns throughout lactation, miR-375 and two representative members of the miR-200 family, miR-200a and miR-200c, were absolutely quantified in milk from pups ranging in age from day 1–14 of lactation. [score:3]
Several studies analyzing miRNAs in milk emphasize enrichments in “immune-related” miRNAs such as miR-146b, miR-27b, and the miR-200 family (14, 17, 18, 22), which were also among the more highly expressed miRNAs in murine milk. [score:3]
E–H, results are represented as mean ± S. E. miR-375, designated as the main focus of this study because of its identity as a single-locus miRNA, and miR-200, selected as a secondary example of a milk miRNA, revealed intermediate expression in milk derived from the stomachs of WT mice (Fig. 1 E). [score:3]
E–H, results are represented as mean ± S. E. miR-375, designated as the main focus of this study because of its identity as a single-locus miRNA, and miR-200, selected as a secondary example of a milk miRNA, revealed intermediate expression in milk derived from the stomachs of WT mice (Fig. 1 E). [score:3]
Belgardt B. F., Ahmed K., Spranger M., Latreille M., Denzler R., Kondratiuk N., von Meyenn F., Villena F. N., Herrmanns K., Bosco D., Kerr-Conte J., Pattou F., Rulicke T., Stoffel M. (2015) The microRNA-200 family regulates pancreatic β cell survival in type 2 diabetes. [score:2]
miR-200c, a prototypical epithelial miRNA, is a member of the miR-200 family composed of two chromosomal clusters: miR-200a/200b/429 and miR-200c/141 (28). [score:1]
Because of infertility of the global miR-200 KO mouse (35), we focused on the miR-141/200c KO mo del. [score:1]
Although high sequence similarity between miR-200 family members (28) led to less reliable quantification of miR-200c, analysis of this second miRNA nevertheless provided additional insights into the behavior of milk miRNAs in general. [score:1]
Hasuwa H., Ueda J., Ikawa M., Okabe M. (2013) miR-200b and miR-429 function in mouse ovulation and are essential for female fertility. [score:1]
Determination of a qPCR detection limit was not instructive in this case because of cross-detection of other miR-200 family members, although the lack of change between 200c KO pups receiving WT milk versus 200c KO milk suggests a negligible uptake. [score:1]
[1 to 20 of 10 sentences]
67
[+] score: 19
In MDA-MB-231 cells expressing the OVOLs, we used to assess expression of miR-200 family members (miR-200a, miR-200b, miR-200c, miR-141, miR-429, miR205, miR-203), relative to controls miR-U6 and miR16. [score:5]
Comparing these observations to the MDA-MB-231 mo del, we found no general correlation between the expression of OVOL and the members of miR-200 -family across cell types, suggesting that regulation of miRNA-200s is cell-type specific. [score:4]
Specifically, ZEB1 can induce EMT by repressing epithelial proteins and by downregulating its own miR-200 repressors. [score:4]
It has been proposed that EMT is regulated by reciprocal feedback loops between ZEB1/ZEB2 TFs and members of the MicroRNA miR-200 family [6, 7]. [score:2]
This suggests that, in addition to the previously described mechanism, the OVOL -mediated MET may involve regulation of the miR-200 family. [score:2]
Given evidence of reciprocal feedback loops between ZEB1/2 and miR-200 family members in EMT-MET transformations [7, 26], we explored the contribution of miR-200s as potential inducers of epithelial differentiation in the breast and prostate cancer mo dels. [score:1]
It has been suggested that ZEB1 mediates EMT-MET plasticity through a feedback loop including the microRNA-200 family [26]. [score:1]
[1 to 20 of 7 sentences]
68
[+] score: 19
In this study, we provide strong evidence that KLF8 promotes the expression of EGFR by both directly activating the gene promoter and by repressing its inhibitory microRNA141, a member of the microRNA-200 family to release its translation. [score:8]
miR141 belongs to the microRNA-200 family that is known to inhibit EMT and metastasis [35] by inhibiting the EMT-inducing ZEB1 and SIP1 [28, 36]. [score:5]
In breast cancer, for example, the microRNA-200 family members have been shown to inhibit EMT and invasion in breast cancer [28]. [score:3]
miR141 belongs to the miR-200 family and this family of microRNAs plays a crucial role in inhibiting EMT, invasion and metastasis [30, 31]. [score:3]
[1 to 20 of 4 sentences]
69
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
Out of these 25 miRNAs, 18 miRNAs were differentially expressed in a consistent manner between the 2 groups (Figure 4A, highlighted); 8 miRNAs were downregulated in both groups (miR-16, miR-200, miR-205, miR-3064, miR-379, miR-431, miR-485 and miR-491) and 10 miRNAs were upregulated in both groups (miR-194, miR-1894, miR-211, miR-3072, miR- 3077, miR-4436, miR-5128, miR-669a, miR-669c and miR-6967). [score:9]
MiRNAs (miR-199 and miR-200) were significantly upregulated in cbs [+/–] in comparison with the control ([*] p < 0.05, [**] p < 0.01). [score:4]
However, miR-199 (p value = 0.01) and miR-200 (p value = 0.004) in contrary to the microarray results were significantly upregulated in cbs [+/–] in comparison with the control cbs [+/+] (p value < 0.05). [score:4]
Hcy also induces alteration of miRNAs related to tight junctions signaling such as miR-128, miR-132, miR-133, miR-195, miR-3473, miR-19, miR-200, miR-205, miR-214, miR-217, miR-23, miR-26, miR-29, miR-30, miR-31 AND miR-690. [score:1]
[1 to 20 of 4 sentences]
70
[+] score: 17
Korpal M Lee ES Hu G Kang Y The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2J Biol Chem. [score:6]
The miRNA profiles of the MVs revealed that EPO-MVs changed 212 miRNAs (fold-change ≥ 1.5), including miR-299, miR-499, miR-302, and miRNA-200, and that 70.28 % of these changes involved upregulation. [score:4]
Our findings also demonstrate that miR-299, miR-499, miR-302, and miRNA-200 were upregulated in EPO-MVs (Fig.   8c). [score:4]
In vitro studies have demonstrated that members of the miRNA-200 family inhibit the E-cadherin transcriptional repressors ZEB1 and ZEB2, which are implicated in EMT [45]. [score:3]
[1 to 20 of 4 sentences]
71
[+] score: 17
Downregulated miR-200 in aged LCs may upregulate its target, Gfi1, which could then arrest LCs commitment. [score:9]
Our miRNA array data showed that the expression level of miR-200 that potentially targets Langerin, was downregualted in aged LCs. [score:5]
Gfi1 is a potential target of miR-200. [score:3]
[1 to 20 of 3 sentences]
72
[+] score: 16
Other miRNAs from this paper: mmu-mir-34c, mmu-mir-34b, mmu-mir-200a, mmu-mir-34a, mmu-mir-200c
In particular, our work is consistent with the findings that p53 upregulates miR-200 which in turns downregulates Zeb1 and Zeb2 and reduces EMT in liver cancer cells [43]. [score:7]
In mammary epithelial cells and HCC cell lines, p53 regulates EMT by up -regulating the expression of miR-200, thereby repressing Zeb1 and Zeb2 [42], [43]. [score:5]
In our study, we did find a decreased expression of miR-200 family members when p53 was silenced (Figure S6 in File S1), further supporting the idea that p53 may influence EMT through regulating miR-200 family. [score:4]
[1 to 20 of 3 sentences]
73
[+] score: 15
Therefore, the circuits shown in Figure 12 uncovers that the regulatory combinations of MEIS1 and mir-200/mir-29/mir-150 miRNAs play roles in the early stage in the lung development, while their abnormal expressions may result in the tumour progression. [score:5]
Specifically, miR-200 miRNAs are involved in cancer metastasis[62]; mir-150 functions in hematopoiesis, and regulates genes whose downstream products encourage differentiating stem cells towards becoming megakaryocytes rather than erythrocytes [63]; mir-29 miRNAs activates p53, the tumour suppressor [64]. [score:4]
The miR-200 family is believed to play an essential role in the tumour suppression. [score:3]
We have noticed that miRNAs are from mir-200 family (mir-200a, mir-200b and mir-429), mir-29 family (mir-29a and mir-29c) and mir-150 family, they are all related to lung cancer[60, 61]. [score:1]
We have found that there are five miRNAs participated in both the early and late stages: mmu-mir-200a, mmu-mir-200b, mmu-mir-135b, mmu-mir-494 and mmu-mir-503. [score:1]
MiRNA overlap (Figure 5(c))We have found that there are five miRNAs participated in both the early and late stages: mmu-mir-200a, mmu-mir-200b, mmu-mir-135b, mmu-mir-494 and mmu-mir-503. [score:1]
[1 to 20 of 6 sentences]
74
[+] score: 15
For instance, the mir-200 family of micrornas is down-regulated during TGF-β induced EMT in NMUMG cells; while over -expression of these micrornas inhibites EMT [21]. [score:8]
For example, the mir-200 family of mirnas is specifically down-regulated by TGF-β during EMT in normal mouse mammary gland (NMUMG) cells, whereas up-regulation of mir-200s in epithelial phase NMUMG cells completely abrogates TGF-β pathway signaling and thus TGF-β mediated stimulation of EMT [19]– [22]. [score:7]
[1 to 20 of 2 sentences]
75
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In addition to miR-23b, miR-30a, and miR-125b, which, as we showed by qRT-PCR and miRNA-Seq, are upregulated by HDI, several other putative Prdm1 targeting miRNAs, including miR-125a, miR-96, miR-351, miR-30c, miR-182, miR-23a, miR-200b, miR-200c, miR-365, let-7, miR-98, and miR-133, were also significantly increased by HDI. [score:6]
Figure 8The Prdm1 targeting miRNAs miR-23b, miR-125a, miR-351, miR-30a/c/d, miR-182, miR-96, miR-98, miR-200b/c, and miR-365 are upregulated by HDI. [score:6]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
[1 to 20 of 3 sentences]
76
[+] score: 15
Other miRNAs from this paper: mmu-mir-141, mmu-mir-200a, mmu-mir-200c, mmu-mir-429
By targeting ZEB1 and ZEB2, several members of the miR-200 family (miR-141, miR-200a, miR-200b, miR-200c and miR-429) are considered the main suppressors of EMT. [score:4]
The expressions of such miR-200 family members were all markedly suppressed in ALK-TKI-resistant compared with parental H2228 cells (data are not shown). [score:4]
We confirmed significant downregulation of miR-141, miR-200a, miR-200b, miR-200c and miR-429 in ALK-TKI-resistant cells as determined by qRT-PCR (Figure 2B). [score:4]
We have previously reported that TGF-β1 -induced EMT changes in NSCLC cells with drug insensitivity were associated with low expression of the miR-200 family and the alteration of EMT-related factors such as ZEB1 and ZEB2 [19, 37]. [score:3]
[1 to 20 of 4 sentences]
77
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
For example, in mouse [14], miR-10b is highly expressed in spinal cord; miR-124 is wi dely expressed in brain tissues; miR-200b, miR-128a, miR-128b, miR-429 are specifically expressed in olfactory bulb; miR-200a is highly expressed in olfactory bulb; miR-7b is highly expressed in hypothalamus. [score:11]
Moreover, miR-200b is enriched in zebrafish olfactory bulb; miR-124 and miR-9 expression are detected throughout adult brain [16]. [score:3]
[1 to 20 of 2 sentences]
78
[+] score: 14
Other miRNAs from this paper: mmu-mir-200a, mmu-mir-200c
Patel V. et al. have shown that in Ksp/cre; Dicer [F/F] mice the suppression of the miRNA200 family stimulates Pkd1 expression and consequently the development of cysts [10]. [score:6]
com) the suppression of miRNA200 family in Dicer c KO mice [10] could determine GSK3β cytosolic accumulation and therefore β-catenin inhibition. [score:5]
Since GSK3β mRNA has multiple target sites for several members of the miRNA200 family (www. [score:3]
[1 to 20 of 3 sentences]
79
[+] score: 14
[21]Out of the nine miRNAs that were screened, four were upregulated (miR-135b, miR-155, miR-205 and miR-206: Figure 1a) and five were downregulated (miR-31, miR-148a, miR-181c, miR-200b and miR-210: Figure 1b). [score:7]
[21] Out of the nine miRNAs that were screened, four were upregulated (miR-135b, miR-155, miR-205 and miR-206: Figure 1a) and five were downregulated (miR-31, miR-148a, miR-181c, miR-200b and miR-210: Figure 1b). [score:7]
[1 to 20 of 2 sentences]
80
[+] score: 14
Other miRNAs from this paper: mmu-mir-140, mmu-mir-200c, mmu-mir-429
We observed that as shown for the positive control miR-200b and miR-200c 21 22, miR-140-5p inhibited the luciferase activity of the pmirGLO plasmid with wild-type 3′UTR of Pin1 by about 50% (Fig. 1d), whereas mutation of miR-140-5p seed region in Pin1 3′UTR counteracted the regulating effects of miR-140-5p (Fig. 1e). [score:5]
Among these eleven candidates, miR-140-5p and miR-200s (miR-200b/200c/429) were predicted by all of the three databases (Fig. 1a) and found to be frequently downregulated in HCC 1 45. [score:4]
MiR-140-5p mimic significantly decreased both Pin1 and cyclin D1 levels (Fig. 1f), as shown for miR200b and miR200c, which have been shown to regulate Pin1 expression in other cells 21 22. [score:4]
MiRNA-140-5p, miRNA-200b, miRNA-200c, miRNA-429 and NC mimics were synthesized by Genepharma (Shanghai, China). [score:1]
[1 to 20 of 4 sentences]
81
[+] score: 14
Other miRNAs from this paper: mmu-mir-200a, mmu-mir-200c
A recent study reported that SP1 is a direct target of miR-200b and is involved in miR-200b -induced suppression of breast cancer cell growth [53]. [score:6]
Mechanically, Yang et al. reported that in lung adenocarcinoma cells from Kras/Tp53-mutant animals and human lung cancer cell lines, ZEB1 activates PI3K by depressing miR-200 targets, including amphiregulin (AREG), betacellulin (BTC), and GATA6 [33]. [score:3]
Considering that a double -negative feedback loop between ZEB1 and the miRNA-200 family has been demonstrated in tumorigenesis [54, 55], it is likely that elevated ZEB1 inhibits miR-200b and thus promotes SP1 levels to recruit to the VEGF promoter. [score:3]
Shannon MF, et al (2008) A double -negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transition. [score:2]
[1 to 20 of 4 sentences]
82
[+] score: 14
Many of these upregulated miRNAs were known oncomiRs in breast cancer, such as miR-200, miR-141 and miR-223 [21– 23], Also, many of down-regulated miRNAs in MCF7 HER2 cells were tumor suppressors, such as miR-125b, miR-31 and miR-99a [24– 26]. [score:9]
A recent study has found that hyper-methylation of miR-200b promoter is associated with higher HER2 expression [12]. [score:3]
This feature is evident in the previous observations that the switching ability between epithelial and mesenchymal states can be regulated by the ZEB/miR-200 feedback loop [41]. [score:2]
[1 to 20 of 3 sentences]
83
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-18a, hsa-mir-21, hsa-mir-27a, hsa-mir-96, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30b, mmu-mir-99a, mmu-mir-124-3, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-21a, mmu-mir-27a, mmu-mir-96, mmu-mir-135b, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-200a, hsa-mir-135b, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-15a-1, dre-mir-15a-2, dre-mir-18a, dre-mir-21-1, dre-mir-21-2, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30b, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-135c-1, dre-mir-135c-2, dre-mir-200a, dre-mir-200b, dre-let-7j, dre-mir-135b, dre-mir-181a-2, dre-mir-135a, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The prediction identified the miR-200b family, with potential targets down-regulated in sensory epithelial cells at P0. [score:6]
It has been previously shown that miR-200b directly targets ZEB1 and ZEB2 (Burk et al, 2008), linking the regulatory factors to one another. [score:5]
miR-200b expression was detected by in situ hybridization in all sensory epithelial cells of the inner ear. [score:3]
[1 to 20 of 3 sentences]
84
[+] score: 14
c-Myb activity is tightly regulated at different levels, including downregulation by several miRNAs: miR-150 [8], miR-15a [9], miR-34a [10], miR-126 [11], miR-200b, miR-200c and miR-429 [12] binding to its 3′ UTR. [score:5]
In [24] there is described that some quoted miRNAs were continuously upregulated during differentiation of C2C12 cells from D24 to D72 compared to GM values: miR-15a (from 0.92 times to 2.7 times), miR-126 (from 1.95 times to 2.75 times) and miR-200b (from 1.75 times to 2.73 times), these miRNAs could therefore play a role in extinguishing c-Myb expression. [score:5]
We therefore searched in the literature if some of miRNAs that have already been described to downregulate c-Myb via interacting with 3′ UTR, (miR-150, miR-15a, miR-34a, miR-126, miR-200b, miR-200c and miR-429), were activated during muscle differentiation. [score:4]
[1 to 20 of 3 sentences]
85
[+] score: 13
These included miR-8 family overexpressed in FCx and comprising of miRNAs from two chromosomal clusters, miR-429, miR-200a, miR-200a*, miR-200b, and miR-200b* from chromosome 4, and miR-141 and miR-200c from chromosome 6. Also, a chromosome 6 cluster with miR-182, miR-96, and miR-183 and a chromosome 11 cluster with miR-212 and miR-312 were expressed on a higher level in FCx. [score:5]
For example, in the ceramide pathway (Figure 5), miR132 and miR-212 were predicted to regulate Ras, Pi3k, Pp2a, and Tnfr1, miR-200a to regulate Nsmaf, Pp2a, and Map2k4, and miR-200b, miR-200c, and miR-429 to regulate Ras, Pp2a, Map3k1, and Jun. [score:4]
The Chipster tool was used to visualize the miR-8 family members located on chromosome 4 (miR-429, miR-200a, miR-200a*, miR-200b and miR200b*). [score:1]
0021495.g003 Figure 3The Chipster tool was used to visualize the miR-8 family members located on chromosome 4 (miR-429, miR-200a, miR-200a*, miR-200b and miR200b*). [score:1]
As an example, Figure 3 shows visualization of miR-8 family (miR-429, miR-200a, miR-200a*, miR-200b and miR200b*) located on chromosome 4. 10.1371/journal. [score:1]
As an example, Figure 3 shows visualization of miR-8 family (miR-429, miR-200a, miR-200a*, miR-200b and miR200b*) located on chromosome 4. 10.1371/journal. [score:1]
[1 to 20 of 6 sentences]
86
[+] score: 13
Besides, knock-down of Zeb1 inhibits cell growth via activating the apoptosis pathway [23], and TXNIP/miR-200/ Zeb1/E-cadherin signaling pathway is reported to function in beta cell apoptosis [24], which suggests that Zeb1 plays a crucial role in cell apoptosis. [score:4]
Eggers J. C. Martino V. Reinbold R. Schafer S. D. Kiesel L. Starzinski-Powitz A. Schuring A. N. Kemper B. Greve B. Gotte M. microRNA miR-200b affects proliferation, invasiveness and stemness of endometriotic cells by targeting ZEB1, ZEB2 and KLF4 Reprod. [score:3]
Zeb1 promotes EMT through suppression of CDH1 (encoding E-cadherin, an epithelial maker) and the microRNA-200 [10]. [score:3]
Tang O. Chen X. M. Shen S. Hahn M. Pollock C. A. MiRNA-200b represses transforming growth factor-beta1 -induced EMT and fibronectin expression in kidney proximal tubular cells Am. [score:2]
Filios S. R. Xu G. Chen J. Hong K. Jing G. Shalev A. MicroRNA-200 is induced by thioredoxin-interacting protein and regulates Zeb1 protein signaling and beta cell apoptosis J. Biol. [score:1]
[1 to 20 of 5 sentences]
87
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-138-2, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
miR-200 negatively regulates the expression of Sox2 and E2F3, a pluripotency factor and a cell cycle regulator, respectively (Johnson and Walker, 1999; Peng et al., 2012). [score:5]
The lack of Sox2 and E2F3 regulation by miR-200 results in reduced cell cycle exit and neuronal differentiation of ventral midbrain/hindbrain (vMH) NPs while, overexpression of miR-200 in primary vMH NPs results in the opposite effect (Peng et al., 2012) indicating that these interactions control the proliferative state of vMH NPs (Figure 2). [score:4]
Interestingly, both TFs Sox2 and E2F3 activate miR-200 transcription which establish a negative feedback loop between miR-200 and its target genes that guaranty NPs cell cycle exit and differentiation in the midbrain/hindbrain region (MHR) (Peng et al., 2012). [score:3]
A unilateral negative feedback loop between miR-200 microRNAs and Sox2/E2F3 controls neural progenitor cell-cycle exit and differentiation. [score:1]
[1 to 20 of 4 sentences]
88
[+] score: 13
Change of expression in human aHSC (Fold Change) Expression in plasma of liver disease-compared to healthy individuals Source Expression trend Etiology miRNA-150-5p ↓ (870) ↑ HBV Li et al., 2010; Venugopal et al., 2010 miRNA-192-5p ↓ (8.53) ↑ HBV, NASH, NAFLD Tryndyak et al., 2012; Winther et al., 2013; Becker et al., 2015; Pirola et al., 2015 miRNA-200b-3p ↑ (22.55) ↑ NAFLD, HBV/HCV -associated HCC Murakami et al., 2011; Tryndyak et al., 2012 miRNA-122-5p N. D. ↑ HCV, HBV, NASH, NAFLD Arataki et al., 2013; Shrivastava et al., 2013; Tan et al., 2014; Pirola et al., 2015 miRNA-21-5p N. D. = /↑ HBV, NAFLD Yamada et al., 2006; Cermelli et al., 2011; Becker et al., 2015 miRNA-92a-3p N. D. ↑ HBV -associated HCC, HCV Li et al., 2010; Ji et al., 2011; Shrivastava et al., 2013 N. D., non-determined. [score:8]
MiRNA-200b, was significantly up-regulated in both HBV and HCV fibrotic patients. [score:3]
Especially miRNA-192 (HBV AUC: 0.9802; HCV AUC: 0.9762) and miRNA-200b (HBV AUC: 0.9699; HCV AUC: 0.9841) have an inherent potential to be used as biomarker for the identification of early fibrosis by chronic HBV and HCV infection. [score:1]
miRNA Mature miRNA primer miR-92a-3p TATTGCACTTGTCCCGGCCTGT miR-122-5p TGGAGTGTGACAATGGTGTTTG miR-150-5p TCTCCCAACCCTTGTACCAGTG miR-192-5p CTGACCTATGAATTGACAGCC miR-200b-3p TAATACTGCCTGGTAATGATGA miR-21-5p TAGCTTATCAGACTGATGTTGA cel-miR-39-3p AGCTGATTTCGTCTTGGTAATA All primers were ordered from Integrated DNA Technologies (IDT, Leuven, Belgium), and are specific for detection of both human and murine miRNA -expression. [score:1]
[1 to 20 of 4 sentences]
89
[+] score: 13
Members of the miR-200 family are known to suppress the Zeb2 transcription factor, and its inhibition promotes MET [53]. [score:5]
A number of miRNAs that were found to be upregulated in rat PSCs, such as the miR-290-295 cluster and the miR-200 family miRNAs, are involved in pluripotency induction and maintenance in mice 21, 47. [score:4]
Among the miRNAs upregulated in rat PSCs, we also identified miR-205 and members of the miR-200 family (miR-200a, miR-200b, miR-200c, miR-141 and miR-429), which promote mesenchymal to epithelial transition (MET) in mouse cells, a key step in fibroblast reprogramming [47]. [score:4]
[1 to 20 of 3 sentences]
90
[+] score: 12
[41] In this study the mechanism of CXCR4 upregulation involved another transcription factor targeted by the miR-200 family that is Zinc-Finger-E-Box-Binding-Homeobox-2 (ZEB2), which also binds to and inhibits E-boxes. [score:8]
In keeping with this, the upregulation of CXCR4 by the miR-200 family was already reported in mouse embryonic stem cells upon nitric oxide treatment. [score:4]
[1 to 20 of 2 sentences]
91
[+] score: 12
Further, Kent et al. (2009) reported downregulation of miRNA-200 family members, including miRNA-141, in PC cell lines [48] and observed a positive correlation between the expression of miR-200 family members and E-cadherin expression, as well as a negative correlation with the zinc-finger E-box -binding homeobox 1 (ZEB1) [48, 49]. [score:8]
The transcription of miR-200 family members (miR-141 and miR-200c) is suppressed by ZEB1, which activates epithelial differentiation in PC, colorectal, and breast cancer cells. [score:3]
Epithelial-mesenchymal transformation (EMT) activators, such as transforming growth factor beta 2 and ZEB1, have 3′ UTR binding sites for miR-200 family members. [score:1]
[1 to 20 of 3 sentences]
92
[+] score: 12
We found that microRNA-200 family, let-7 family and miR-204 were markedly downregulated in propogated WT xenografts but to a greater extent in those Xn initiated by, and enriched for, NCAM [+]ALDH [+] cells (miR-204 was reduced 226-fold compared to hFK). [score:3]
In fact, in inducible oncogenesis mo dels, the miR-200 family is inhibited during CIC/CSC formation (Iliopoulos et al, 2010). [score:3]
: Our article reports the establishment of a human WT xenograft mo del system mimicking aggressive malignancy in patients and affording the opportunity to isolate undifferentiated “blastemal” CICs in WT, their prospective isolation in line with the functional criteria of CIC/CSCs and in depth molecular characterization showing elevated transcript levels of renal “stemness” and poor WT prognosis genes, preferential protein expression of phosphorylated PKB/Akt and strong reduction of the miR-200 family a known regulator of EMTs. [score:2]
Furthermore, the PKB/Akt pathway activated in WT CICs has been shown to regulate the EMT process independently (Grille et al, 2003) or by modulation of the miR-200 family (Iliopoulos et al, 2009). [score:2]
: Our article reports the establishment of a human WT xenograft mo del system mimicking aggressive malignancy in patients and affording the opportunity to isolate undifferentiated “blastemal” CICs in WT, their prospective isolation in line with the functional criteria of CIC/CSCs and in depth molecular characterization showing elevated transcript levels of renal “stemness” and poor WT prognosis genes, preferential protein expression of phosphorylated PKB/Akt and strong reduction of the miR-200 family a known regulator of EMTs. [score:2]
[1 to 20 of 5 sentences]
93
[+] score: 12
This was contrary to what was expected, as the levels of some of the miRNAs targeting these mRNAs—such as miR-200 family members—were also reduced, suggesting that knockdown of DICER likely inhibits transcription of these mRNAs rather than suppressing their translation via specific miRNAs. [score:10]
Consistent with our in vitro results, shDICER tumors expressed lower level of let-7b, miR-99b, miR-103a, and miR-200 miRNA family members (miR-429, miR-200c, miR-141 and miR-200b) compared to shControl tumors. [score:2]
[1 to 20 of 2 sentences]
94
[+] score: 12
Also, Akt1 signaling maintains high expression of miR-200 -family microRNAs that suppress epithelial mesenchymal transition and Akt2 upregulates miR-21, which inhibits PTEN expression as noted above [138, 139]. [score:12]
[1 to 20 of 1 sentences]
95
[+] score: 12
Concomitant with the large induction of epithelial -associated genes and repression of mesenchymal regulators, MET -associated miRNAs miR-205-5p and the miR-200 family (miR-200a-3p, miR-200b-3p, miR-200c-3p, miR-141-3p and miR-429-3p) [23- 26] were markedly upregulated (at least four-fold) in the Thy1- to SSEA1+ transition (Figure 2; Additional file 3). [score:5]
Another TGFβ pathway miRNA, miR-203-3p, was not upregulated until the Thy1- to SSEA1+ transition, along with the miR-200 family [35]. [score:4]
The miR-200 family did not significantly decline in the newly reprogrammed Oct4-GFP+ line; however, many of these miRNAs were expressed at lower levels in the iPSC line with higher passages and in the mES cell line, suggesting that, with additional passages, iPSCs more closely resemble mES cells. [score:3]
[1 to 20 of 3 sentences]
96
[+] score: 11
Enforced expression of the miR-200 family was sufficient to prevent TGF-beta induced EMT, while inhibition of the miR-200 family was sufficient to induce EMT in cells [30]. [score:5]
All five members of the miR-200 family were markedly down-regulated in cells that had undergone EMT in response to transforming growth factor (TGF)-beta [30]. [score:4]
It is therefore tempting to speculate that the miR-200 family may act to prevent premature loss of E-cadherin and induction of EMT during lactation. [score:1]
The cluster includes miR-200 family members miR-200a, miR-141 and miR-429. [score:1]
[1 to 20 of 4 sentences]
97
[+] score: 11
Other miRNAs from this paper: mmu-mir-200a, mmu-mir-200c
Schliekelman M. J. Gibbons D. L. Faca V. M. Creighton C. J. Rizvi Z. H. Zhang Q. Wong C. H. Wang H. Ungewiss C. Ahn Y. H. Targets of the tumor suppressor MIR-200 in regulation of the epithelial-mesenchymal transition in cancer Cancer Res. [score:6]
While it is known that miR-200 family members directly target ZEB1, interestingly in a previous report we summarized phytoalexins (including glyceollins) and their emerging role in the regulation of miRNAs and found that the glyceollin mixture did not significantly alter miR-200 family members [23, 32]. [score:5]
[1 to 20 of 2 sentences]
98
[+] score: 11
Other miRNAs from this paper: mmu-mir-200a, mmu-mir-200c
Suliman MA Niclosamide inhibits colon cancer progression through downregulation of the Notch pathway and upregulation of the tumor suppressor miR-200 familyInt. [score:11]
[1 to 20 of 1 sentences]
99
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-29a, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-194-1, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-140, hsa-mir-194-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-29a, mmu-mir-96, mmu-mir-34a, mmu-mir-135b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-376c, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-135b, mmu-mir-181b-2, mmu-mir-376b, dre-mir-34a, dre-mir-181b-1, dre-mir-181b-2, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-15a-1, dre-mir-15a-2, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-29a, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-181c, dre-mir-194a, dre-mir-194b, dre-mir-200b, dre-mir-200c, hsa-mir-376b, hsa-mir-181d, hsa-mir-507, dre-let-7j, dre-mir-135b, dre-mir-181a-2, hsa-mir-376a-2, mmu-mir-376c, dre-mir-34b, dre-mir-34c, mmu-mir-181d, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, mmu-mir-124b
Elkan-Miller et al. (2011) miR-200b Zinc finger E-Box binding homeobox 1 (Zeb1)Global gene expression analysis; complementary patterns of expression validated with in situ and immunohistochemistry Hertzano et al. (2011) After the initial bioinformatic analyzes, each miRNA/gene target must be validated by experimental techniques. [score:7]
miR-200b is ubiquitously expressed in all epithelial cells in the inner ear, both in the cochlea and vestibule at P0 (Weston et al., 2006; Friedman et al., 2009; Sacheli et al., 2009; Soukup et al., 2009; Wang et al., 2010a, b; Elkan-Miller et al., 2011; Hertzano et al., 2011; Yan et al., 2012). [score:3]
Cell type-specific transcriptome analysis reveals a major role for Zeb1 and miR-200b in mouse inner ear morphogenesis. [score:1]
[1 to 20 of 3 sentences]
100
[+] score: 11
The HPO diet significantly up-regulated the expression of the miR-200 family as well as miRs- 143, 191 and 205 in the VA of NZ10 mice but not in SWR mice suggesting complementary roles for diet and genetics in the regulation of these miRNAs (Figure 2). [score:7]
Our results on the expression trends of the miR-200 family: miRs- 200a, 200b, 200c, 141 and 429 are consistent with results reported previously using epididymal fat pads of DIO mice fed high fat diet [15]. [score:3]
Because members of miR-200 family and miR-205 showed significant inhibition in the VA of obese mice, we chose to evaluate whether any of these miRNAs are implicated in adipogenesis. [score:1]
[1 to 20 of 3 sentences]