sort by

286 publications mentioning hsa-mir-148a (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-148a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 383
Other miRNAs from this paper: hsa-mir-21, hsa-mir-148b
As shown in Fig 2C, ectopic expression of miR-148a suppressed migration of NCI-N87 (pSilencer/miR-148a group, 119 ± 16 cells per field; pSilencer/nc group, 217 ± 16 cells per field; wild type group, 228 ± 23 cells per field; P < 0.05) and, conversely, miR-148a knockdown accelerated migration of SGC-7901 (miR-148a inhibitor group, 239 ± 18 cells per field; inhibitor control group, 92 ± 8 cells per field; mock group, 110 ± 15 cells per field; P < 0.05) and MKN-45 (miR-148a inhibitor group, 213 ± 32 cells per field; inhibitor control group, 82 ± 9 cells per field; mock group, 105 ± 12 cells per field; P < 0.05). [score:14]
Ectopic Expression of miR-148a Inhibits Tumorigenicity in vivoWe next examined whether enforced miR-148a expression could suppress tumor growth in vivo. [score:9]
Up-regulation of miR-148a depressed CCK-BR protein level in gastric cancer cells, and down-regulation of miR-148a enhanced CCK-BR protein level. [score:7]
To explore the mechanism responsible for proliferation and migration-suppressive effects of miR-148a, TargetScan and PicTar database were used and CCK-BR was identified as the potential target of miR-148a. [score:7]
Basing on relative expression ratios of < 0.5, the 41 clinical cases were divided into two groups: miR-148a low expression group (n = 22) and miR-148a high expression group (n = 19). [score:7]
The results showed that miR-148a expression vector (p Silencer/miR-148a) and miR-148a inhibitor could dramatically affect miR-148a expression in gastric cell lines. [score:7]
However, enforced miR-148a expression effectively down-regulated p-STAT3 and p-Akt protein levels in NCI-N87/miR-148a cells (Fig 7A). [score:6]
Taken together, these data suggest that miR-148a may inhibit the expression of CCK-BR by directly binding to its BS4 site within 3’UTR. [score:6]
Further, knockdown of CCK-BR can mimic proliferation and migration -suppressive effects induced by enhanced miR-148a expression. [score:6]
Our job clarified that miR-148a is down-regulated in human gastric cancer and functions as a suppressor in cell proliferation, migration in vitro and tumor formation in vivo. [score:6]
Given the down-regulation of miR-148a in gastric cancer tissues, we predicted that miR-148a may function as a tumor suppressor. [score:6]
Using miRNA microarray, we identified the miRNA expression profile in gastric cancer tissues in comparison with the matched normal mucosal tissues, and miR-148a was found significantly down-regulated in cancer tissues. [score:6]
Conversely, CCK-BR protein level in SGC-7901 cells was up-regulated by miR-148a inhibitor transfection. [score:6]
Moreover, 54% (22/41) of the tumor tissues showed more significant down-regulation of miR-148a (relative expression ratio < 0.5). [score:6]
Extensive analysis showed that, of the 41 gastric cancer tissues, 73% (30/41) showed miR-148a down-regulation in comparison with the matched normal mucosal tissues (relative expression ratio < 1.0). [score:6]
Taken together, these data indicated that miR-148a inhibits proliferation, migration and tumorigenicity in gastric cancer cells via targeting CCK-BR. [score:5]
Ectopic Expression of miR-148a Inhibits Tumorigenicity in vivo. [score:5]
Low expression of miR-148a in gastric cancer tissues indicated that miR-148a may function as a tumor suppressor. [score:5]
In our study, we disclosed that miR-148a inhibits cell proliferation and migration by targeting CCK-BR through inactivation of STAT3 and/or Akt pathway, resulting in inactivation of multiple downstream survival factors. [score:5]
To explore the molecular mechanism by which miR-148a functions in gastric carcinogenesis, TargetScan and PicTar algorithms were used and 5 predicted target genes (ATP6AP2, CCK-BR, MEOX2, MITF, SNN) attracted our attention for their high scores in both algorithms (S3 and S4 Tables). [score:5]
Taken together, our results suggest that miR-148a may inhibit proliferation and migration by targeting CCK-BR via inactivating STAT3 and Akt, as well as subsequent modulation of their downstream molecules. [score:5]
As shown in Fig 5C and 5D, an inverse correlation was observed between CCK-BR expression and the miR-148a expression level. [score:5]
Putative target genes of miR-148a were obtained from TargetScan and PicTar database. [score:5]
For this reason, among the aberrantly expressed miRNAs, miR-148a was chosen as the candidate for further study for its suppressive effects to EMT and the CSCs-like properties in several types of human cancer [19– 21]. [score:5]
CCK-BR was predicted as a potential target gene of miR-148a using the TargetScan and PicTar algorithms. [score:5]
0158961.g005 Fig 5(A) CCK-BR protein was detected in NCI-N87 cells stably transfected by p Silencer/miR-148a (or p Sliencer/nc vector) or in SGC-7901 cells transfected by miR-148a inhibitor (or inhibitor control). [score:5]
In the current study, we detected miR-148a expression in gastric cancer tissues and the matched normal mucosal tissues using quantitative real-time PCR (qRT-PCR), and analyzed the correlation between miR-148a expression and the clinicopathologic features. [score:5]
By comparing miRNA expression profiles, we found that miR-148a was dramatically down-regulated in gastric cancer tissues compared with the matched normal mucosal tissues. [score:5]
MiR-148a expression is Down-regulated in Gastric Cancer and Correlates with Clinicopathologic Parameters. [score:5]
The silencing of miR-148a expression by DNA hypermethylation was crucial in early pancreatic carcinogenesis, indicating miR-148a’s role as a tumor suppressor [29]. [score:5]
Using qRT-PCR, the miR-148a expression in NCI-N87/miR-148a cells was proved dramatically up-regulated compared with that in NCI-N87/nc and parent NCI-N87 cells. [score:5]
Therefore, we predicted that ectopic expression of miR-148a could suppress the oncogenic activity of gastric cancer cell lines. [score:5]
We next examined whether enforced miR-148a expression could suppress tumor growth in vivo. [score:5]
Thus, our data demonstrated that ectopic expression of miR-148a suppresses tumorigenicity in vivo. [score:5]
Some current studies have revealed the miR-148a-involved mechanism underlying human gastric carcinogenesis with ROCK1, DNMT1 and MMP7 as the direct targets of miR-148a [32, 43, 44]. [score:4]
Using bioinformatics and experimental method, CCK-BR was mechanistically identified as a direct target of miR-148a. [score:4]
In conclusion, our results suggest that miR-148a functions as a gastric cancer suppressor through regulation of CCK-BR and its downstream effectors. [score:4]
Western blot was carried out and CCK-BR protein was significantly down-regulated by miR-148a mimics. [score:4]
Since CCK-BR was verified as the target gene of miR-148a in gastric cancer, specific knockdown of CCK-BR should elicit similar phenotypes induced by miR-148a in gastric cancer cells. [score:4]
Therefore, we further tested whether CCK-BR was a direct target of miR-148a in gastric cancer. [score:4]
Collectively, these results provided sufficient evidence that miR-148a was prominently down-regulated in gastric cancer. [score:4]
Conversely, down-regulation of miR-148a significantly enhanced p-STAT3 and p-Akt protein levels in SGC-7901 cells (Fig 7B). [score:4]
MiR-148a expression was down-regulated in gastric cancer tissues and gastric cancer cell lines compared with the corresponding controls. [score:4]
Basing on this rationale, 5 candidate genes (ATP6AP2, CCK-BR, MEOX2, MITF, SNN) that scored high in both algorithms were selected for experimental verification and CCK-BR protein was proved down-regulated by miR-148a mimics. [score:4]
MiR-148a involves in DNA methylation process via targeting DNMT-1 and, more importantly, serves as a tumor suppressor in hepatocellular carcinogenesis [13, 30– 32]. [score:4]
To experimentally validate whether CCK-BR was a direct target of miR-148a, a wide-type 3’UTR fragment of CCK-BR was cloned downstream of Firefly luciferase gene in the pMIR-REPORT luciferase vector. [score:4]
MicroRNA-148a suppresses the epithelial-mesenchymal transition and metastasis of hepatoma cells by targeting Met/Snail signaling. [score:4]
MiR-148a expression correlates inversely with CCK-BR protein expression in gastric cancer. [score:4]
MiR-148a Expression Correlates inversely with CCK-BR Protein Expression in Gastric Cancer. [score:4]
These data provided strong evidence to support that miR-148a negatively regulates CCK-BR expression at the post-transcription level. [score:4]
To verify our hypothesis, ectopic expression as well as knockdown of miR-148a was carried out in gastric cancer cell lines. [score:4]
In our previous study, we also found that miR-148a was down-regulated in gastric cancer cell lines relative to normal gastric mucosa [15]. [score:4]
Construction of miR-148a Expression Vector. [score:3]
Although these studies obtained similar results to ours, our work not only reinforces miR-148a’s role as a tumor suppressor in human gastric carcinogenesis, but also unveils a new miR-148a-involved mechanism in gastric carcinogenesis for the first time. [score:3]
Relationship between miR-148a expression level and clinicopathologic parameters in 41 gastric cancer patients. [score:3]
As shown in Fig 1C, miR-148a was dramatically down-regulated in gastric cancer tissues compared with matched normal tissues (63.34 ± 25.23 vs 396.82 ± 98.98, P < 0.05). [score:3]
0158961.g004 Fig 4(A, B) Putative binding sites of miR-148a in the CCK-BR 3’UTR (white sequences) predicted by TargetScan. [score:3]
As shown in Fig 1B, miR-148a expression in these nine gastric cancer cell lines was significantly lower than that in a pooled normal gastric mucosa tissue. [score:3]
We found that the low miR-148a expression group frequently had more lymph node metastasis (P = 0.017, Table 2). [score:3]
The results showed that the tumor formation was significantly inhibited in mice injected with NCI-N87/miR-148a cells in comparison with the control or the parental cells (Fig 3A and 3B and S1 Table). [score:3]
MiR-148a mimics and negative control, miR-148a inhibitors and negative control were purchased from GenePharma (Shanghai, China). [score:3]
The effect of miR-148a can be rescued by down-expressed CCK-BR. [score:3]
CCK-BR is a validated target of miR-148a. [score:3]
The relationship between the miR-148a expression level and clinicopathologic parameters was explored by the Pearson x [2] test. [score:3]
Stable Transfection of miR-148a Expression Vector. [score:3]
The mean and standard deviation of miR-148a expression levels are shown. [score:3]
Subsequent studies disclosed that the luciferase activity of NCI-N87/miR-148a cells with enforced miR-148a expression was significantly attenuated (Fig 4D). [score:3]
From these results, we concluded that miR-148a functions as a suppressor in cell proliferation and migration in gastric cancer cells. [score:3]
MiR-148a Targets CCK-BR Directly. [score:3]
In our study, CCK-BR was validated as a target gene of miR-148a. [score:3]
To confirm whether CCK-BR protein expression could be negatively regulated by miR-148a, western blot and qRT-PCR assays were performed. [score:3]
Conversely, SGC-7901 and MKN-45 cells transfected with miR-148a inhibitor grew faster than the control and the parental cells, respectively (Fig 2B). [score:3]
Furthermore, we detected miR-148 expression in 41 pairs of gastric cancer tissues and the matched normal mucosal tissues. [score:3]
Moreover, we disclosed that CCK-BR protein level in gastric cancer tissues was significantly higher than in the matched normal mucosal tissues and, consistently, miR-148a expression level in gastric tumor tissues was lower. [score:3]
After construction of miR-148a expression vector (p Silencer/miR-148a) and selection of stably transfected NCI-N87 cells, cell proliferation assay was performed in the same way. [score:2]
Dysregulation of miR-148a was also reported in chronic lymphocytic leukemia, hepatoblastoma, breast cancer, cholangiocarcinoma and gastric cancer [10– 14]. [score:2]
Dual-luciferase reporter assays revealed that enforced miR-148a expression significantly attenuated the activity of firefly luciferase with the wild-type 3’UTR, mutant BS1 3’UTR, mutant BS2 3’UTR and BS3 mutant 3’UTR, whereas this effect was abrogated when the BS4 sequence was mutated (Fig 4C). [score:2]
MiR-148a inhibits activation of STAT3 and Akt in gastric cancer cells. [score:2]
MiR-148a Inhibits Activation of STAT3 and Akt in Gastric Cancer Cells. [score:2]
MiR-148a inhibits activation of STAT3 and Akt in xenograft tumor tissues. [score:2]
More importantly, we successfully proved that miR-148a directly binds CCK-BR and conduct its anti-cancer effects via inactivating STAT3 and Akt, as well as subsequent modulation of their downstream gene products. [score:2]
MiR-148a Inhibits Proliferation and Migration of Gastric Cancer Cells. [score:2]
The in vitro and in vivo assay results confirmed that miR-148a could inhibit proliferation, migration in gastric cancer cells and tumor formation in nude mice, respectively. [score:2]
MiR-148a inhibited tumor growth in vivo. [score:2]
NCI-N87 cells were seeded into 6-well plates and transfected with p Silencer/miR-148a or p Silencer/nc vector. [score:1]
Tumor weight of mice in NCI-N87, NCI-N87/nc and NCI-N87/miR-148a groups. [score:1]
NCI-N87/miR-148a, NCI-N87/nc or NCI-N87 cells were injected into male nude mice, and tumor formation was monitored. [score:1]
Subsequently, we embarked a comprehensive study of miR-148a in gastric cancer and demonstrated that miR-148a exerts anti-oncogenic effects in vitro and in vivo. [score:1]
0158961.g007 Fig 7 (A) Western blot indicated alterations of STAT3, p-STAT3, Akt, p-Akt, CCK-BR protein levels in NCI-N87/miR-148a, NCI-N87/nc and NCI-N87 group. [score:1]
The effect of miR-148a on the proliferation and migration of NCI-N87, SGC-7901 and MKN-45 cells. [score:1]
As shown in Fig 5A, CCK-BR protein level was reduced in NCI-N87/miR-148a cells in comparison with the control group. [score:1]
These results indicated that miR-148a slower the proliferation in gastric cancer cells. [score:1]
Given the important role of STAT3 and Akt activation in cell growth, proliferation and survival in many human cancers [24– 27], including gastric cancer [28], further studies were designed to explore the effects of miR-148a on activation of STAT3 and Akt in gastric cancer cells. [score:1]
NCI-N87 cells stably transfected with pSilencer/miR-148a grew more slowly than the control or the parental cells group (Fig 2B). [score:1]
In this study, we aimed to clarify the function and molecular mechanism of miR-148a in the initiation and progress of gastric cancer. [score:1]
Since four predicted miR-148a binding sites reside within CCK-BR 3’UTR, four mutant 3’UTR fragments were engineered and cloned downstream of Firefly luciferase gene and the four resulting constructs were pMIR/CCK-BR/mut1, pMIR/CCK-BR/mut2, pMIR/CCK-BR/mut3 or pMIR/CCK-BR/mut4. [score:1]
A volume of 100 μl PBS containing 1×10 [6] cells of NCI-N87/miR-148a, NCI-N87/nc or NCI-N87 was injected into the right flank region of 4-week-old male nude mice (Institute of Zoology, Chinese Academy of Sciences, Shanghai, China), which were housed at a specific pathogen-free environment. [score:1]
CCK-BR 3’UTR reporter construct and four mutant 3’UTR reporter constructs were co -transfected into HEK 293T cells with miR-148a mimics and the luciferase activity was detected on 48h post-transfection. [score:1]
The average tumor weight in NCI-N87/miR-148a group was 978.3 ± 181.3 mg, which was significantly lower (P < 0.05) than that in NCI-N87/nc group (2267.0 ± 512.5 mg) or that in NCI-N87 group (2410.0 ± 398.3 mg; Fig 3C and S2 Table). [score:1]
S1 Fig Western blot analysis of STAT3, p-STAT3, Akt, p-Akt and CCK-BR protein levels in the xenograft tumor tissues of NCI-N87/miR-148a, NCI-N87/nc and NCI-N87 groups. [score:1]
G418 (800 mg/l; Sigma Chemical, St Louis, MO, USA) containing medium was used for selection for three weeks and two stably transfected cell clones named as NCI-N87/miR-148a and NCI-N87/nc were chosen and maintained in medium containing 400 mg/l G418 for further study. [score:1]
Bars, S. D. (C) Average weight of tumors derived from NCI-N87/miR-148a, NCI-N87/nc or wild type NCI-N87 cells. [score:1]
In addition, we measured miR-148a expression level and CCK-BR protein level in 4 pairs of gastric cancer tissues and the matched normal mucosal tissues. [score:1]
Tumor volume of mice in NCI-N87, NCI-N87/nc and NCI-N87/miR-148a groups. [score:1]
Western blot analysis of STAT3, p-STAT3, Akt, p-Akt and CCK-BR protein levels in the xenograft tumor tissues of NCI-N87/miR-148a, NCI-N87/nc and NCI-N87 groups. [score:1]
As S1 Fig shown, CCK-BR, p-STAT3 and p-Akt protein levels were decreased in the tumor tissues in the NCI-N87/miR-148a group. [score:1]
Deciphering the molecular basis of miR-148a’s role in human gastric cancer may extend our understanding in molecular mechanism underlying gastric carcinogenesis, and lay a theoretical foundation for further exploration in early diagnosis, clinical behavior prediction, chemotherapy and biotherapy. [score:1]
All these strengthened our decision for choosing miR-148a for further research. [score:1]
The expression level of mature miR-148a in cell lines and tissue samples was detected by qRT-PCR and calculated as described [16]. [score:1]
[1 to 20 of 109 sentences]
2
[+] score: 380
Since expression of miR-148a is down-regulated in 4T1 cells, we ectopically expressed miR-148a in 4T1 cells by viral infection (Figure 2C) and determined the effects of this manipulation on various aspects of cancer development. [score:9]
In the current study, we identified miR-148a as a suppressor of metastasis, particularly for TNBC, as its expression pattern is inversely correlated with tumor grade and metastatic potential, but directly correlated with prognosis of those patients since lower expression of miR-148 is associated with poor survival. [score:8]
To determine whether expression of miR-148a in the primary tumor and presence of distal metastasis are directly associated with patient outcome, we first correlated disease-specific survival with expression of miR-148a in patients with or without metastasis separately. [score:8]
In addition, miR-148a has been reported to suppress angiogenesis through down-regulation of ERBB3 and IGF1R [50, 51]. [score:6]
Consistent with this, our results show that miR-148a suppresses breast cancer metastasis possibly through down-regulation of WNT1. [score:6]
To directly determine whether the expression level of miR-148a is associated with metastatic development in breast cancer patients, we also analyzed a patient database annotated with time from initial diagnosis to metastasis development (GSE22220). [score:6]
In addition, correlation analysis between expression profiles of these mRNAs and miR-148a in TCGA database showed that expression of WNT1 and NRP1 is inversely correlated with levels of miR-148a (Figure 5D). [score:5]
Overexpression of miR-148a suppresses 4T1 lung metastasis. [score:5]
Theoretically, levels of target genes in human breast cancers should inversely correlate with miR-148a expression. [score:5]
4T1 control cells with expression of iRFP (VEC, red) and 4T1cells with expression of miR-148a and GFP (miR-148a, green) were mixed and implanted into the mammary fat pad of Balb/c mice. [score:5]
Figure 2(A) Expression levels of miR-148a were determined in M-I, M-II, M-III, and M-IV cells and normalized to the expression level in M-II. [score:5]
To directly test whether miR-148a suppresses extravasation of 4T1 cells in vivo, we administrated cancer cells directly into the blood system of the mouse through tail vein injection, and subsequently examined lung colonization. [score:5]
With expression of miR-148a in MDA-MB-231 cells being about 50% of its level in MCF7-Ras cells, we hypothesized that lower expression of miR-148a is correlated with TNBC metastasis. [score:5]
We utilized a microRNA sponge targeting miR-148a to decrease its expression in 4TO7 cells (Supplementary Figure 3). [score:5]
Through correlation analysis of gene expression profiles between candidate genes and miR-148a in the TCGA breast cancer patient database, we further narrowed down targets of miR-148a to four genes, INHBB, PIK3C2B, WNT1 and NRP1. [score:5]
Moreover, we identified WNT1 and NRP1 as potential targets of miR-148a involved in its tumor suppressive functions. [score:5]
Interestingly, overexpression of miR-148a caused at least a 50% reduction in the numbers of MDA-MB-231 cells present in the lung (Figure 4G), which supported our hypothesis that miR-148a likely suppresses cancer cells extravasation. [score:5]
Overexpression of miR-148a alters cancer cell propagation in vivo It has been reported that the tumor microenvironment contains many types of non-cancer cells that regulate cancer development and immune response [33, 34]. [score:5]
We therefore further analyzed multiple breast cancer patient databases annotated with both miRNA expression and metastatic status, and discovered that primary tumors from patients who were diagnosed with detectable distant metastasis have lower expression of miR-148a than primary tumors from patients without metastasis (Supplementary Table 3). [score:5]
Previous studies have shown that INHBB acts to suppress tumorigenesis and targeting PIK3C2B impairs cell proliferation in a cell-autonomous manner [37, 38], functions that are inconsistent with the theoretical characteristics of miR-148a target genes to modulate tumor microenvironment in our experimental setting. [score:5]
Although overexpression of miR-148a did not alter cell-autonomous behaviors in vitro, it suppressed breast cancer metastasis in vivo, achieved mainly through reducing cancer cell extravasation. [score:5]
Finally, we analyzed the expression of miR-148a in different subtypes, and found that patients with either Basal or Luminal B subtype primary tumors are more likely to be classified as having low miR-148a expression (Supplementary Table 2 and Figure 6C). [score:5]
Moreover, the correlation of miR-148a expression to metastatic development occurs in ER -negative patients but not ER -positive patients (Figure 7G and 7H). [score:4]
One possible explanation for this observation is that miR-148a regulates genes encoding proteins secreted or localized to the outer plasma membrane and interacting with the tumor microenvironment to suppress cancer metastasis. [score:4]
In this study, we show that miR-148a is down-regulated in breast cancer cell lines with high metastatic potential. [score:4]
Overexpression of miR-148a regulates cancer cell lung colonization. [score:4]
Based on the observation that overexpression of miR-148a did not alter tumor nodule size in the lung (Figure 4A, 4C, and 4E), we tested more directly if extravasation was altered. [score:4]
We first confirmed that expression of miR-148a was similar to that achieved in previous experiments (Supplementary Figure 2A), and that relative cell growth of the lines in vitro when mixed 1:1 was similar at multiple time points, indicating that miR-148a overexpression did not alter relative cell growth compared to control (Supplementary Figure 2B). [score:4]
MiR-148a overexpression suppresses TNBC metastasis. [score:4]
As discussed earlier, although many targets of miR-148a have been identified in various cancers, they mainly function in regulating cancer cell-autonomous behaviors [43, 47– 49]. [score:4]
We also tested if our findings on the suppressive effects of miR-148a on metastasis in the mouse cell lines were applicable to human cells. [score:3]
Low expression of miR-148a is associated with worse diagnosis of breast cancer patients. [score:3]
Consistent with the suppressive function of miR-148a in cancer cell lung colonization, decreasing in miR-148a promoted lung colonization of 4TO7 cells when they were inoculated intravenously (Figure 4C and 4D). [score:3]
Consistent with our postulation, miR-148a expression gradually decreased in this series in accordance with increased metastasis potential (Figure 2A). [score:3]
Taken together with the correlation of miR-148a expression to survival time of patients with metastasis, these results indicate that miR-148a might serve as a potential prognostic marker for TNBC patients. [score:3]
Consistently, lower expression of miR-148a in the primary tumor was correlated with shorter survival for patients with metastasis but not for patients without metastasis (Figure 7B and 7C). [score:3]
These results suggest that the extravasation process, in which circulating cancer cells penetrate the endothelial barrier of blood vessels and gain access to the lung, may be suppressed by miR-148a. [score:3]
The expression of miR-148a was significantly decreased in metastatic tissue (Figure 7A). [score:3]
Data was extracted from METABRIC data [55] (A) miR-148a expression was analyzed in patients stratified by tumor grade. [score:3]
Low expression of miR-148a correlates with poor breast cancer patient prognosis. [score:3]
These data indicated that low expression of miR-148a is correlated with higher metastatic potential in multiple independent TNBC cell lines. [score:3]
To investigate how miR-148a suppresses breast cancer metastasis, we took a systematic approach to identify target genes of miR-148a in MDA-MB-231 cells (Figure 5A). [score:3]
Identification of WNT1 and NRP1 as target genes of miR-148a in MDA-MB-231 cells. [score:3]
We next implanted 4T1 cells with or without miR-148a overexpression into the mammary fat pad of female Balb/c mice, and found that primary tumors formed and progressed with similar kinetics (Figure 2G). [score:3]
Instead, our results indicate that miR-148a likely suppresses cancer cell extravasation in vivo, which requires interactions with the tumor microenvironment. [score:3]
Only genes with mRNA levels decreased by at least 20% were selected for further validation as possible target genes of miR-148a. [score:3]
Moreover, overexpression of miR-148a did not affect primary tumor formation by MDA-MB-231 cells (Supplementary Figure 4G), but reduced lung colonization after their administration into the venous system of nude mice (Figure 4E and 4F). [score:3]
To further examine whether decrease in miR-148a level is a major factor promoting cancer cell metastasis, we manipulated expression of miR-148a in cancer cells with low metastatic potential and examined the lung metastasis of these cells. [score:3]
To test this, we utilized additional two series of mammary epithelial and TNBC cell lines and determined expression levels of miR-148a. [score:3]
E and F, MDA-MB-231 cells with over expression of miR-148a and control cells. [score:3]
Identification of WNT1 and NRP1 as potential target genes of miR-148a. [score:3]
Instead, we made the finding that in our system miR-148a targets WNT1 and NRP1. [score:3]
Two levels of miR-148a overexpression (150× and 20×) were achieved in MDA-MB-231 cells. [score:3]
Quantification of tumor burden by qRT-PCR also demonstrated that miR-148a overexpression caused a dramatic decrease in the lung colonization of cancer cells (Figure 4B). [score:3]
Plasmid DNA used for ectopic overexpression of miR-148a was constructed by inserting synthesized pri-miR-148a into pMSCV-Puro vector (Clontech) either alone or together with GFP open reading frame. [score:3]
Lower expression of miR-148a was detected in both 66c14 cells and 4T1 cells (Figure 2B). [score:3]
Importantly, low expression of miR-148a was significantly associated with worse overall survival in patients classified as ER -negative HER2 -negative (Figure 1C), which is consistent with our finding of reduced miR-148a level in the metastatic MDA-MB-231 cell line. [score:3]
Interestingly, the expression of miR-148a is significantly associated with the time to develop metastasis (Figure 7F). [score:3]
To rule out the possibility that the observation was due to different immune response to fluorescent proteins, we used GFP for vector control and BFP for miR-148a overexpression. [score:3]
Basal subtype (D) and LumB subtype (E) of patients with metastasis were further analyzed using Kaplan-Meier curves for high and low expression of miR-148a. [score:3]
Furthermore, we determined miR-148a expression level in patient tissue samples from primary tumors and metastasis. [score:3]
Therefore, miR-148a suppresses lung metastasis of 4T1 cells in this syngeneic mouse mo del. [score:3]
In our experimental setting, miR-148a did not appear to affect angiogenesis at the primary tumor site (Supplementary Figure 7), although we cannot rule out the possibility that miR-148a could suppress neo-angiogenesis in the lung during colonization. [score:3]
Quantitative RT-PCR was performed to validate these mRNA alterations by enhanced overexpression of miR-148a. [score:3]
Taken together, these results indicate NRP1 and WNT1 as molecular targets of miR-148a with biological functions relevant to TNBC metastasis. [score:3]
Therefore, we focused on validating NRP1 and WNT1 as targets of miR-148a in this study. [score:3]
By analyzing different subtypes of patients with metastasis, we found that the expression of miR-148a was significantly correlated with survival time only for patients with Basal or Luminal B subtype primary tumors (Figure 7D, 7E, and Supplementary Figure 5A–5C). [score:3]
Figure 3Overexpression of miR-148a alters 4T1 cancer cell propagation in vivo(A) Illustration of the procedure for tracking cancer cell propagation in vivo. [score:3]
NRP1 has recently been identified as a target gene of miR-148a in medulloblastoma [52]. [score:3]
Consistently, no correlation between patient tumor size and expression of miR-148a was observed (Supplementary Figure 6). [score:3]
The reduction of β-catenin and NRP1 proteins was confirmed in MDA-MB-231 cells with two different levels of miR-148a overexpression (Figure 5C). [score:3]
Therefore, although the macroscopic parameters of the primary tumors that arose from 4T1 cells with overexpression of miR-148a are similar to those of tumors derived from control cells, it is possible that miR-148a affects cancer cell propagation in vivo without presenting noticeable differences in tumor size. [score:3]
4T1 cells with overexpression of miR-148a formed fewer colonies in the lungs than control 4T1 cells (Figure 4A). [score:3]
In contrast, expression of miR-203 did not display a statistically significant association with patient prognosis in this cohort (Figure 1D), so we focused our study on the role of miR-148a in metastasis of breast cancer, in particular the triple -negative subtype. [score:3]
Previously we demonstrated that TNBC patients with low expression of miR-148a tend to have a worse prognosis (Figure 1C). [score:3]
Low expression of miR-148a is associated with poor prognosis of breast cancer patients. [score:3]
Furthermore, the 3′-UTRs of both NRP1 and WNT1 contain perfect binding sites for miR-148a (Figure 5E), as predicted by the TargetScan algorithm. [score:3]
In addition, we quantified the percentage of patients with low or high expression of miR-148a in each grade. [score:3]
Figure 5(A) Illustration of strategy used to identify target genes of miR-148a. [score:3]
We also examined miR-148a expression in the 4T1 series of murine breast cancer cell lines that also resemble TNBC cells. [score:3]
Overexpression of miR-148a alters cancer cell propagation in vivo. [score:3]
Therefore, we performed a microarray analysis to determine mRNA level alterations in an unbiased fashion in MDA-MB-231 cells with enhanced overexpression of miR-148a. [score:3]
4TO7 cancer cell line is well-known to have a low metastatic potential, as well as having a higher expression of miR-148a than the more metastatic 4T1 cell line, and is thus ideal for probing this issue (Figure 2B and [31]). [score:3]
Our discovery indicates that miR-148a suppresses breast cancer metastasis in multiple xenograft mouse mo dels. [score:3]
Although miR-148a does not alter cell-autonomous behaviors including cell growth, viability, or migration in vitro, it suppresses cancer cell extravasation in vivo. [score:3]
Low expression of miR-148a correlates with poor prognosis in breast cancer. [score:3]
Using statistical analysis of multiple databases of breast cancer patients, we found that low expression of miR-148a is associated with diagnosis of high-grade primary tumors and poor prognosis of breast cancer patients, particularly for patients with Basal and Luminal B subtypes. [score:3]
Figure 6Data was extracted from METABRIC data [55] (A) miR-148a expression was analyzed in patients stratified by tumor grade. [score:3]
Manipulation of miR-148a expression alters lung colonization of breast cancer cells. [score:3]
Figure 7(A) Levels of miR-148a expression were determined in primary (Tumor) and metastatic (Mets) tumor samples from breast cancer patients [19] and normalized to the levels of miR-148a in primary tumors. [score:3]
Therefore, we propose that the expression status of miR-148a could serve as a molecular biomarker for the diagnosis of primary tumors in breast cancer patients. [score:3]
Through statistical analysis, we found that the higher the grade of the primary tumor, the lower the expression of miR-148a (Figure 6A). [score:3]
To test this possibility, we labeled control 4T1 cells with iRFP (marked as red for convenience) and miR-148a -overexpressing cells with GFP (green) for engraftment in the same mouse with easy detection and quantification of different cells via flow cytometry. [score:3]
Overexpression of miR-148a alters 4T1 cancer cell propagation in vivo. [score:3]
Furthermore, after co-implantation of 4T1 cells into the mammary fat pad of recipient mice, we discovered that cancer cells with overexpression of miR-148a dominate the proportion of cancer cells in the primary tumor compared with control cancer cells (Figure 3B). [score:2]
Out of these 29 miRNAs detected at comparable levels, six miRNAs (miR-205, miR-200c, miR-200b, miR-148a, miR-203, miR-24) were found to be expressed at markedly lower levels in MDA-MB-231 cells compared to HMEC cells (top 6 miRNAs in Figure 1A). [score:2]
Four of these miRNAs, miR-148a, miR-203, miR-200b, and miR-200c, also displayed significantly reduced expression in the MDA-MB-231 cells compared to MCF7-Ras cells, suggesting that they may play roles in modulating metastasis (Figure 1B). [score:2]
In addition, miR-148a has been previously characterized as a tumor suppressor with functions in regulating cell proliferation, apoptosis, and migration/invasion, all of which are cell-autonomous behaviors [43, 47– 49]. [score:2]
Finally, we analyzed the impact of miR-148a on lung metastasis by counting macroscopic tumor nodules on the surface of the lungs and found approximately half as many tumor nodules with 4T1 cells overexpressing miR-148a compared with control 4T1 cells (Figure 2H and 2I). [score:2]
Figure 4(A– F) The lung colonization ability of cancer cells with manipulated levels of miR-148a and control cells were determined by quantification of lung nodules raised from cancer cells administered directly into the blood. [score:2]
Deregulation of miR-148a has been reported in several types of cancer, including non-small-cell lung cancer, osteosarcoma, gastric cancer, ovarian cancer, glioblastoma, pancreatic cancer, bladder cancer, hepatocellular carcinoma, and breast cancer [42– 46]. [score:2]
We first overexpressed miR-148a in MDA-MB-231 cells (Supplementary Figure 4A), and evaluated their cell-autonomous behaviors, including cell growth, viability in culture, and migration. [score:1]
On the other hand, several previous studies have implicated NRP1 and WNT signaling in various types of cancer growth and progression [39– 41], which are consistent with the expected characteristics of miR-148a target genes. [score:1]
Although 4T1-miR-148a cells were more abundant in the blood, they occupied a smaller proportion of the total cancer cells in the lung, comprising less than 20% of cancer cells in that tissue (Figure 3D). [score:1]
Patients with low miR-148a in the primary tumor occupied 31% of the pool in grade 1, 44% in grade 2, and about 60% in grade 3 (Figure 6B). [score:1]
4T1-miR-148a and 4T1-VEC cells were then mixed at a 1:1 ratio and implanted into the mammary fat pad of Balb/c mice. [score:1]
There were also more 4T1-miR-148a cells than control 4T1 cells in the blood at day 7, although the disparity was not as great as in the primary tumors (Figure 3C). [score:1]
In contrast to these reports, we did not detect cell-autonomous alterations mediated by miR-148a in TNBC in vitro. [score:1]
At day 7, the presence of 4T1-miR-148a remained dominant, with a slightly increased presence (Figure 3B). [score:1]
The cell-autonomous properties, including cell growth, viability in culture, and in vitro migration ability, of 4T1 cells with ectopically elevated miR-148a were indistinguishable from control 4T1 cells in these three aspects (Figure 2D, 2E, and 2F). [score:1]
Our previous results demonstrated that miR-148 does not strongly influence MDA-MB-231 cell-autonomous behaviors. [score:1]
Since two of these miRNAs (miR-148a and miR-203) have not been previously reported to affect metastasis, we determined their clinical relevance by analyzing the survival time of patients with low or high levels of these miRNAs in the TCGA breast cancer patient database (Figure 1C, 1D, and Supplementary Figure 1). [score:1]
At day 5, 4T1-miR148a cells dominate the primary tumor, constituting about 80% of the total cancer cell population. [score:1]
Consistently, the presence of 4T1-miR-148a remained dominant (Supplementary Figure 2C). [score:1]
Thus, miR-148a may be used as a prognostic biomarker for certain subtypes of breast cancer, including TNBC. [score:1]
Similar to the results found in 4T1 cells, overexpression of miR-148a did not alter cell-autonomous characteristics of MDA-MB-231 cells (Supplementary Figure 4B–4F). [score:1]
To determine whether miR-148a can be used as a potential biomarker for prognosis estimation, we analyzed the Metabric breast cancer patient database, which contains patient status with tumor grade and metastasis. [score:1]
Together with statistical analyses demonstrating that miR-148a may serve as a prognostic biomarker for TNBC metastasis, further efforts should be made to investigate whether administration of miR-148a could be therapeutically efficacious to suppress the metastasis of breast cancer. [score:1]
In agreement with this observation, mRNA abundance of ERBB3 or IGF1R was not affected by miR-148a in our microarray analysis. [score:1]
It will be interesting to test in the future whether the proliferation and viability of 4T1 cells are altered by miR-148a in vivo through changing the interactions between cancer cells and microenvironment. [score:1]
[1 to 20 of 120 sentences]
3
[+] score: 313
Other miRNAs from this paper: hsa-mir-148b
To investigate whether GADD45A expression is downregulated by miR-148a, we transfected U87 cells with miR-148a mimics, mimics-NC, miR-148a inhibitor, or inhibitor-NC for 48 h. Upregulation of miR-148a expression by miR-148a mimics significantly increased miR-148a levels and miR-148a inhibitors significantly reduced miR-148a expression (Figure 4A–4B). [score:17]
In addition, we found that miR-148a was upregulated in IDH1 [R132H] glioma tissue and inhibited the tumor suppressor function of GADD45A by downregulating its expression. [score:13]
To determine the effect of miR-148a on GADD45A -mediated control of β-catenin, MMP-9, and EMT marker expression, we upregulated or downregulated miR-148a in IDH1 [WT] or IDH1 [R132H] glioblastoma cells overexpressing GADD45A (Figure 5A–5C and Figure 6A–6C). [score:11]
Upregulation of miR-148a only significantly increases β-catenin, MMP-9, and EMT marker expression in IDH1 [R132H] glioblastoma cells by downregulating GADD45A. [score:9]
Figure 10GADD45A inhibits the effects of miR-148a on β-catenin, MMP-9, and EMT marker expression in IDH1 [R132H] glioblastoma cells (A) Western blot analysis of β-catenin, N-cadherin, E-cadherin, and fibronectin expression in membrane extracts. [score:7]
In IDH1 [WT] cells, miR-148a inhibitors increased GADD45A mRNA and protein expression and miR-148a mimics reduced GADD45A expression (Figure 4E–4G). [score:7]
Inhibition of miR-148a significantly reduced β-catenin, EMT marker, and MMP-9 expression in IDH1 [R132H] glioblastoma cells and these effects were prevented by GADD45A knockdown (Figure 10). [score:6]
The IDH1 R132H mutation decreases GADD45A while increases miR148a expression in glioblastoma cell linesWe stably expressed IDH1 [WT] or IDH1 [R132H] in U87 cells, U251 cells, and the glioblastoma stem cell (GSC) line 0308 by lentiviral infection. [score:6]
Inhibition of miR-148a enhanced this effect, while only upregulation of miR-148a increased β-catenin staining in the nucleus in IDH1 [R132H] cells (Figure 8B). [score:6]
The effect of GADD45A on glioblastoma cell proliferation was inhibited by miR-148a inhibitors and increased by miR-148a mimics in IDH1 [WT] and IDH1 [R132H] glioblastoma cells. [score:5]
MiR-148a stimulates β-catenin, MMP-9, and EMT marker expression by downregulating GADD45A. [score:5]
In contrast, miR-148a significantly promotes the self-renewal ability of IDH1 [R132H] GSC 0308 cells by inhibiting GADD45A expression. [score:5]
We observed that miR-148a controls β-catenin expression by targeting GADD45A. [score:5]
GADD45A mRNA expression was reduced (Figure 2B) and miR-148a expression was increased in IDH1 [R132H] cells (Figure 2C). [score:5]
Figure 11GADD45A inhibits the effects of miR-148a on IDH1 [R132H] GSC neurosphere formationGSCs were transfected with miR-148a inhibitor before transfection with GADD45A siRNA1# or scrambled controls. [score:5]
In contrast to previous reports that IDH1 R132H mutations promote survival, we confirmed that miR-148a increased cell migration and invasion by downregulating GADD45A in IDH1 [R132H] glioblastomas. [score:5]
Figure 1GADD45A and miR-148a expression in normal tissues and IDH1 [WT] or IDH1 [R132H] glioma tissues (A–B) qRT-PCR analysis of GADD45A and miR-148a mRNA expression in the three tissue types. [score:5]
In conclusion, we have demonstrated that the tumor suppressor gene GADD45A and the miR-148a are differentially expressed in IDH1 [R132H] gliomas. [score:5]
In IDH1 [R132H] glioblastoma cells, miR-148a inhibitors significantly increased and miR-148a mimics significantly decreased GADD45A expression (Figure 4H–4J). [score:5]
GADD45A siRNA1#, pcDNA3.1- gadd45a, miR-148a mimics or miR-148a inhibitor (GenePharma, Shanghai, China) were transfected into U87, U251, and GSC 0308 cells that stably expressed IDH1 [WT] or IDH1 [R132H] using Lipofectamine 2000 (Invitrogen). [score:5]
The authors showed that miR-148a exerted an oncogenic effect and reduced patient survival by targeting the EGFR regulator MIG6 and the apoptosis regulator BIM [16]. [score:5]
These results indicated that miR-148a significantly inhibits GADD45A expression in IDH1 [R132H] GSCs. [score:5]
Figure 4 (A-B) U87 cells were transfected with miR-148a mimics, mimics-NC, miR-148a inhibitor, or inhibitor-NC for 48 h. The miR-148a levels were determined by qRT-PCR. [score:5]
GADD45A inhibits the effects of miR-148a on β-catenin, MMP-9, and EMT marker expression in IDH1 [R132H] glioblastoma cells. [score:5]
GADD45A siRNA1# rescued the effects of miR-148a inhibition on protein expression. [score:5]
To determine whether inhibiting GADD45A affected miR-148a -mediated effects, IDH1 [WT] or IDH1 [R132H] U87 cells were transfected with an miR-148a inhibitor and GADD45A siRNA1# or scr. [score:5]
This contradicts our finding that miR-148a is upregulated in IDH1 [R132H] glioma tissues. [score:4]
These results suggested that miR-148a negatively regulates GADD45A expression by binding to a specific sequence in the 3′-UTR. [score:4]
GADD45A -mediated regulation of the EMT was inhibited by miR-148a. [score:4]
miR-148a partly increases cell migration and invasion and β-catenin distribution by downregulating GADD45A in IDH1 [WT] glioblastoma cells. [score:4]
Upregulation of miR-148a promotes malignancy and reduces patient survival [16, 19]. [score:4]
MiR-148a expression was enhanced and growth arrest and DNA-damage-inducible protein (GADD45A) expression was reduced in human IDH1 [R132H] gliomas. [score:4]
These findings provided further support that miR-148a is a direct target of GADD45A in IDH1 [R132H] glioma cells and GSC. [score:4]
Further support for our findings comes from another study showing that miR-148 is upregulated in >500 human glioblastoma tissues [16]. [score:4]
miR-148a partly stimulates β-catenin, MMP-9, and the epithelial-mesenchymal transition by downregulating GADD45A in IDH1 [WT] glioblastoma cells. [score:4]
MiR-148a promotes malignancy in these gliomas by inhibiting the tumor suppressor function of GADD45A. [score:4]
The IDH1 R132H mutation decreases GADD45A while increases miR148a expression in glioblastoma cell lines. [score:4]
Figure 9MiR-148a increases GSC neurosphere formation by downregulating GADD45A in IDH1 [WT] and IDH1 [R132H] cellsGSCs were transfected with pcDNA3.1- GADD45A without or with miR-148a inhibitor, miR-148a mimics, or controls and neurosphere formation was measured *P<0.05, **P<0.01. [score:4]
MiR-148a was reported to be downregulated in IDH1 [R132H] gliomas due to miR148a promoter hypermethylation [35]. [score:4]
IDH1 [R132H] glioblastoma cells were transfected with scrambled or GADD45A siRNA together with miR-148a inhibitors. [score:3]
In the present study, we confirmed the oncogenic potential of miR-148a and identified a novel miR-148a target, GADD45A. [score:3]
IDH1 [R132H] U87 and U251 cells were transfected with miR-148a inhibitor before transfection with GADD45A siRNA1# or scrambled controls. [score:3]
Briefly, IDH1 [WT] or IDH1 [R132H] GSCs were transfected with either miR-148a inhibitor or miR-148a mimics for 72 hours. [score:3]
GADD45A inhibits the effects of miR-148a on IDH1 [R132H] GSC neurosphere formation. [score:3]
GADD45A siRNA1# rescued the effects of miR-148a inhibition on neurosphere formation. [score:3]
MiR-148a inhibition increased the formation of IDH1 [R132H] GSC neurospheres and this effect was eliminated by GADD45A knockdown (Figure 11). [score:3]
GADD45A overexpression removed β-catenin from the nucleus and this effect was antagonized by miR-148a. [score:3]
The expression of mature miR-148a was determined by real-time PCR analysis following stem-loop RT and data were normalized to U6 snRNA. [score:3]
miR-148a stimulates β-catenin, MMP-9, and the epithelial-mesenchymal transition by inhibiting GADD45A in IDH1 [R132H] glioblastoma cells. [score:3]
This is in agreement with previous findings that miR-148a inhibits metastasis by blocking the EMT [33, 34]. [score:3]
GADD45A and miR-148a expression in IDH1 [WT] and IDH1 [R132H] glioma tissues. [score:3]
Taken together, these findings show that GADD45A suppresses the effects of miR-148a in I IDH1 [R132H] gliomas. [score:3]
miR-148a increases cell migration and invasion and β-catenin distribution by inhibiting GADD45A in IDH1 [R132H] U87 and U251 cells. [score:3]
GADD45A and miR-148a expression in IDH1 [WT] and IDH1 [R132H] glioma tissuesTo investigate which genes are differentially expressed in IDH1 wild type (IDH1 [WT]) and IDH1 [R132H] glioma cells, we performed microarray analysis (Supplementary Figure 1). [score:3]
The expression patterns of GADD45A and miR-148a were opposite in human glioma tissues. [score:3]
GSCs were transfected with miR-148a inhibitor before transfection with GADD45A siRNA1# or scrambled controls. [score:3]
We showed that miR-148a partly reverses GADD45A -inhibited effects in IDH1 [WT] GSC 0308 cells. [score:3]
MiR-148a increases GSC neurosphere formation by downregulating GADD45A in IDH1 [WT] and IDH1 [R132H] cells. [score:3]
Taken together, these findings show that miR-148a stimulates the cellular distribution of β-catenin by inhibiting GADD45A in IDH1 [R132H] glioma cells. [score:3]
These findings suggested that miR-148a inhibits GADD45A in IDH1 [R132H] gliomas cells. [score:3]
This indicates that miR-148a significantly inhibits GADD45A to increase the migration and invasion of IDH1 [R132H] glioma cells. [score:3]
MiR-148a mimics or miR-148a inhibitors were transfected into IDH1 [WT] and IDH1 [R132H] U87, U251, and 0308 cells. [score:3]
GADD45A and miR-148a expression in normal tissues and IDH1 [WT] or IDH1 [R132H] glioma tissues. [score:3]
We used luciferase reporter assays to confirm regulation of GADD45A expression by miR-148a. [score:3]
MiR-148a stimulates GSC neurosphere formation by inhibiting GADD45A. [score:2]
MiR-148a targets GADD45A. [score:2]
In contrast, miR-148a expression was lower in normal tissues compared with glioma tissues (Figure 1B) and was higher in IDH1 [R132H] glioma tissue than IDH1 [WT] gliomas (P<0.01). [score:2]
MicroRNA 148a (MiR-148a) is aberrantly expressed in cancer tissues [15]. [score:2]
To confirm differential expression of GADD45A and miR-148a, we measured GADD45A and miR-148a mRNA levels in the same human glioma tissues using qRT-PCR. [score:1]
GSCs were transfected with pcDNA3.1- GADD45A without or with miR-148a inhibitor, miR-148a mimics, or controls and neurosphere formation was measured *P<0.05, **P<0.01. [score:1]
GADD45A mediates the effects of miR-148a in IDH1 [R132H] glioblastoma cells and stem cells. [score:1]
To explore the effect of miR-148a and GADD45A on the cellular distribution of β-catenin, we performed immunofluorescence staining experiments. [score:1]
GADD45A mediates the effects of miR-148a in IDH1 [R132H] glioblastoma cells and stem cellsWe investigated whether miR-148a-stimulated oncogenesis is inhibited by GADD45A. [score:1]
miR-148a binds GADD45A. [score:1]
HEK293 cells were co -transfected with the luciferase reporter systems and miR-148a mimics/miR-NC as indicated in the Figure legends. [score:1]
Our findings provide a deeper insight into how miR-148a is increased in IDH1 [R132H] gliomas. [score:1]
The luciferase reporter plasmid containing wild type or mutant GADD45A 3′-UTR sequences was co -transfected into HEK-293 cells with miR-148a mimics or miR-NC (Figure 4D). [score:1]
Five nucleotides in the miR-148 binding site were mutated in the 3′-UTR of GADD45A. [score:1]
We investigated whether miR-148a-stimulated oncogenesis is inhibited by GADD45A. [score:1]
[1 to 20 of 79 sentences]
4
[+] score: 292
Other miRNAs from this paper: hsa-mir-20a, mmu-mir-182, hsa-mir-182, mmu-mir-148a, mmu-mir-20a
Meanwhile, IHC and immunoblotting revealed that MMP9 and VEGF expression was upregulated in miR-148a–overexpressing tumors, while that of QKI was downregulated; the effects were attenuated in miR-148a–inhibited tumors (Figure  6A and B). [score:13]
Ectopically expressing miR-148a had no effect on GFP–γ-tubulin expression, but robustly inhibited the expression of GFP with a complete, wild-type QKI-3′UTR in glioblastoma cells (Figure  2D). [score:9]
Herein, we report that miR-148a was induced by NF-κB and directly targeted and suppressed the 3′ untranslated regions (3′ UTRs) of multiple genes that function as negative regulators of TGF-β, leading to TGF-β hyperactivation and GBM aggressiveness. [score:9]
Lastly, but no less importantly, analyzing miR-148a expression and TGF-β–regulated gene signatures via GSEA of published TCGA patient expression profiles allowed us to confirm that miR-148a expression levels were positively correlated with the TGF-β–activated gene signatures (Figure  3I). [score:8]
Here, we report microRNA-148a (miR-148a) overexpression in glioblastoma and that miR-148a directly suppressed Quaking (QKI), a negative regulator of TGF-β signaling. [score:7]
Analysis using three publicly available algorithms (TargetScan, PicTar, miRanda) revealed that the QKI-3′UTR contains conserved critical nucleotides that may serve as a legitimate target of miR-148a (Figure  2A), which is substantially overexpressed in glioblastoma [34]. [score:7]
Taken together, our result indicates that the NF-κB pathway induced miR-148a expression by directly targeting the MIR148A promoter. [score:6]
Expression and correlation of miR-148a with MMP9 and VEGF mRNA expression, p-Smad3 expression, and NF-κB activity (detected by an EMSA assay) in 10 human glioblastoma samples. [score:6]
The key finding of the present study is that NF-κB increases miR-148a expression to sustain the TGF-β/Smad signaling pathway by downregulating QKI and SKP1. [score:6]
It is notable that miR-148a expression also correlated with the expression of NF-κB–regulated gene signatures (Additional file 3: Figure S3A). [score:6]
Notably, the luciferase reporter assay showed that miR-148a inhibitor abolished the inhibitory effect of miR-148a linked with QKI-3′UTR, whereas miR-148a into which a mutation had been introduced lost the ability to reduce luciferase activity despite the presence of QKI-3′UTR (Figure  2E). [score:5]
MiRNA expression was defined based on the comparative threshold (Ct); relative expression levels were calculated as 2 - (Ct miR-148a - Ct U6) after normalization with reference to the quantification of U6 small nuclear RNA expression. [score:5]
More importantly, Kaplan–Meier analysis demonstrated that mice bearing miR-148a–overexpressing glioblastomas had significantly shorter survival than control animals; in contrast, mice bearing miR-148a–inhibited tumors survived longer than the control mice (Figure  6C). [score:5]
Furthermore, miR-148a overexpression increased Smad luciferase reporter activity of Smad2/3 phosphorylation, while miR-148a inhibition reduced it (Figure  3E and F). [score:5]
Importantly, miR-148a expression also correlated with the expression of glioblastoma progression–related gene signatures (Figure  4E), suggesting that miR-148a plays significant roles in glioblastoma progression and that its levels are associated with poor overall survival in patients with glioblastoma. [score:5]
As predicted, ectopic expression of miR-148a in U87 and U138MG cells decreased SKP1 expression and ROC1-SCF [Fbw1a] ubiquitination activity (Figure  3B and C). [score:5]
Interestingly, we found that NF-κB activation increased the expression of miR-148a, whose promoter contains NF-κB target elements. [score:5]
Interestingly, there was a marked increased in miR-148a expression in glioblastoma cells treated with tumor necrosis factor-α (TNF-α), whereas TGF-β had minimal effects on miR-148a expression (Figure  8A). [score:5]
From the above results, we conclude that NF-κB signaling is probably hyperactivated in glioblastoma, thereby inducing miR-148a expression but reducing QKI expression. [score:5]
Furthermore, miR-148a overexpression reduced the luciferase activity of SKP1-3′UTR in a consistent and dose -dependent manner, but miR-148a inhibition increased it. [score:5]
We demonstrate that NF-κB binds directly to the miR-148a promoter to regulate miR-148a expression. [score:5]
Notably, the borders of miR-148a–overexpressing tumors exhibited spike-like structures invading into the surrounding brain tissues, whereas the control tumors exhibited sharp edges (Figure  6A), indicating that miR-148a overexpression induced glioblastoma cell invasion into the brain. [score:5]
Consistent with this, microarray analysis showed that miR-148a was significantly upregulated in glioblastoma (Figure  4C). [score:4]
Analyses using publicly available algorithms and the present results identified QKI as a direct target of miR-148a in glioblastoma. [score:4]
Immunoblotting analysis showed that QKI expression was decreased in miR-148a–transduced cells and increased in miR-148a inhibitor–transfected cells compared to the negative control cells (Figure  2B). [score:4]
Here, we showed that miR-148a directly repressed QKI and SKP1, which inhibited the TGF-β pathway. [score:4]
Figure 2 miR-148a directly targets QKI. [score:4]
Importantly, pyrrolidine dithiocarbamate (PDTC, a NF-κB inhibitor) and a TNF-α–neutralizing antibody prevented the stimulatory effect of TNF-α on miR-148a (Figure  8B). [score:3]
From analysis using a published microarray -based high-throughput assessment, we found that miR-148a expression is significantly higher in GBM tissues than in normal brain tissue. [score:3]
Furthermore, QKI and SKP1 are bona fide targets of miR-148a. [score:3]
In the attempt to understand the role of QKI and SKP1 repression in miR-148a–induced invasiveness and angiogenesis, the effects of QKI and SKP1 (without and with the 3′ UTRs) were examined in miR-148a–overexpressing cells. [score:3]
Collectively, these results demonstrate that QKI is a bona fide target of miR-148a. [score:3]
Interestingly, we found that NF-κB induced miR-148a expression, leading to enhanced-strength and prolonged-duration TGF-β/Smad signaling. [score:3]
These findings suggest that miR-148a expression could be sufficient for activating TGF-β/Smad signaling. [score:3]
These results support the notion that hyperactive NF-κB signaling induces miR-148a expression, resulting in TGF-β/Smad pathway activation and consequently leading to the promotion of malignant phenotypes of glioblastoma and poor clinical prognosis of clinical glioblastoma. [score:3]
As shown in Figure  8F, p-Smad2/3 were also elevated in TNF-α–treated cells, but miR-148a inhibitor halted the effect. [score:3]
Figure 8 NF-κB induces miR-148a expression. [score:3]
NC2 is a chemically synthesized single-stranded RNA molecule used as negative control for miR-148a inhibitor. [score:3]
Figure 3 MiR-148a directly targets SKP1 and activates TGF-β signaling. [score:3]
As both QKI and SKP1 are bona fide targets of miR-148a, we suspect that miR-148a is involved in TGF-β activation. [score:3]
However, ectopically expressing miR-148a had no effect on the NF-κB luciferase reporter activity (Additional file 3: Figure S3B). [score:3]
MiR-148a upregulation augmented glioblastoma aggressiveness in vitroand in vivo. [score:3]
Thus, these results support the view that miR-148a overexpression is linked to glioblastoma progression. [score:3]
These findings uncover a plausible mechanism for NF-κB–sustained TGF-β/Smad activation via miR-148a in glioblastoma, and may suggest a new target for clinical intervention in human cancer. [score:3]
Taken together, our results suggest that suppressing QKI and SKP1 plays an important role in miR-148a promotion of invasiveness and angiogenesis. [score:3]
Stable cell lines expressing miR-148a and miR-148a sponge were generated via retroviral infection using HEK293T cells as described by Li et al. [52] and selected with 0.5 μg/mL puromycin for 10 days. [score:3]
Real-time PCR analysis of miR-148a expression in (A) three normal brain tissues and 12 glioma tissues, and (B) NHAs and seven glioblastoma cell lines. [score:3]
As shown in Figure  5A and B, miR-148a overexpression dramatically increased both LN18 and U138MG cell migration and invasiveness. [score:3]
Interestingly, we also found that NF-κB induced miR-148a expression. [score:3]
Interestingly, SKP1 is the theoretical target gene of miR-148a (Figure  3A). [score:3]
As shown in Figure  9, there was positive correlation between the miR-148a levels in 10 freshly collected glioblastoma samples with MMP9 (r = 0.674, P < 0.001) and VEGF mRNA levels (r = 0.748, P < 0.001), the DNA -binding activity of NF-κB (r = 0.895, P < 0.001), and p-Smad3 expression (r = 0.754, P = 0.001). [score:3]
Taken together, our results demonstrate that SKP1 is also a bona fide target of miR-148a in glioblastoma. [score:3]
Ectopic miR-148a expression dramatically promoted glioblastoma aggressiveness both in vitro and in vivo. [score:3]
We used a stable miRNA sponge to inhibit miR-148a in vivo. [score:3]
Meanwhile, miR-148a overexpression strongly promoted the ability of glioblastoma cells to induce vessel formation (CAM, Figure  5C and D). [score:3]
Moreover, suppressing miR-148a yielded results to the contrary (Additional file 2: Figure S2A and S2D). [score:3]
Understanding the precise role played by miR-148a in GBM progression will not only increase our knowledge of the pathogenesis of gliomas, but also will enable the development of novel therapeutic strategies and the identification of an effective biomarker for predicting outcomes for patients with malignant gliomas. [score:2]
MiR-148a upregulation augmented glioblastoma aggressiveness in vitroand in vivoAs glioblastomas are highly angiogenic and generally kill via invasiveness, we investigated whether miR-148a could modulate glioblastoma cell angiogenesis and invasiveness. [score:2]
We synthesized cDNA using a TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) and quantified miR-148a expression using a miRNA-specific TaqMan MiRNA Assay Kit (Applied Biosystems). [score:2]
MiR-148a overexpression correlated with glioblastoma progression. [score:2]
Immunoblotting analysis and immunofluorescence (IF) staining revealed that miR-148a–expressing cells exhibited a marked increase in nuclear Smads, which was confirmed by the cellular fraction assays (Figure  3G and H). [score:2]
Our findings suggest an essential role of miR-148a in regulating GBM cell progression. [score:2]
Figure 4 MiR-148a is overexpressed in gliomas. [score:2]
MiR-148a expression correlated with NF-κB activity and TGF-β/Smad pathway hyperactivation in clinical glioblastoma. [score:2]
However, transfection of the miR-148a-mut, containing mutations in the miR-148a seed region, did not decrease the luciferase activity of SKP1-3′UTR (Figure  3D). [score:2]
MiR-148a targeted SKP1 and activated TGF-β signaling. [score:2]
MiR-148a targeted QKI. [score:2]
Co-transfecting QKI or SKP1 with miR-148a significantly reduced glioblastoma cell invasiveness and decreased the ability of glioblastoma cells to induce HUVEC tube formation (Figure  7A and B). [score:1]
Figure 7 QKI and SKP1 play important roles in miR-148a promotion of the aggressive phenotypes of glioblastoma. [score:1]
Thus, it is plausible that miR-148a modulates NF-κB–mediated TGF-β activation through multiple mechanisms. [score:1]
QKI and SKP1 played important roles in miR-148a–induced glioblastoma cell invasiveness and angiogenesis. [score:1]
Taken together, our results suggest that miR-148a induced glioblastoma cell invasiveness and angiogenesis in vitro and in vivo. [score:1]
On the other hand, analysis of the TCGA datasets indicated that miR-148a promotes glioblastoma aggressiveness. [score:1]
miR-148a QKI NF-κB TGF-β Aggressiveness Glioblastomas Glioblastoma multiforme (GBM) is the most common and lethal primary brain tumor in adults; it has a spectrum of aberrantly aggressive phenotypes [1]. [score:1]
Cells were cotransfected with a plasmid that encodes hemagglutinin-tagged (HA)-Ago1 and miR-148a (100 nM), followed by HA-Ago1 immunoprecipitation (IP) using an anti-HA antibody. [score:1]
These results indicate that miR-148a was involved in TNF-α–mediated TGF-β/Smad activation. [score:1]
Figure 9 Clinical relevance of the NF-κB/miR-148a/TGF-β/Smad axis in human glioblastoma. [score:1]
NF-κB induced miR-148a in glioblastoma. [score:1]
The human MIR148A gene was PCR-amplified from genomic DNA and cloned into a pMSCV-puro retroviral vector. [score:1]
Figure 6 miR-148a promotes the aggressive phenotype of glioblastoma cells in vivo. [score:1]
Hence, the NF-κB/miR-148a/TGF-β pathway represents a critical mechanism for promoting glioblastoma aggressiveness. [score:1]
Via TCGA database analysis, we found that miR-148a was significantly associated with shorter overall survival in patients with glioblastoma, and correlated positively with TGF-β/Smad signaling activity (P < 0.05). [score:1]
Analysis of the MIR148A promoter region using ConSite (http://consite. [score:1]
Real-time PCR analysis revealed that miR-148a was markedly overexpressed in the eight primary glioblastoma tissues compared to that of the normal brain tissues, and in the seven glioblastoma cell lines compared with the NHAs (Figure  4A and B). [score:1]
Importantly, the significant correlation detected among miR-148a levels, NF-κB, and TGF-β/Smad signaling hyperactivation was confirmed in a cohort of human glioblastoma samples. [score:1]
In summary, the present study provides an important link between NF-κB and TGF-β signaling via miR-148a in glioblastoma. [score:1]
Lastly, we examined whether activation of the NF-κB/miR-148a/TGF-β/Smad axis identified in our glioblastoma cell mo dels would also be evident in clinical glioblastoma tumors. [score:1]
The biological role of miR-148a in promoting the aggressive phenotype of glioblastoma was further examined in vivo by stereotactically implanting engineered glioblastoma cells into the brains of nude mice. [score:1]
MiR-148a sponge was constructed by annealing, purifying, and cloning oligonucleotides containing six tandem “bulged” miR-148a–binding motifs into the pMSCV vector. [score:1]
Furthermore, statistical analysis revealed that miR-148a levels were inversely correlated with survival (P < 0.001, Figure  4D). [score:1]
Negative control 1(NC1) is a chemically synthesized double-stranded small RNA used as negative control for miR-148a mimic. [score:1]
Notably, these findings were consistent with the significant correlation between miR-148a levels with NF-κB hyperactivation and activated TGF-β/Smad signaling in a cohort of human glioblastoma specimens. [score:1]
We found that miR-148a enhances the strength and prolongs the duration of TGF-β/Smad signaling. [score:1]
[1 to 20 of 93 sentences]
5
[+] score: 276
Downregulation of endogenous Wnt1 (Fig. 5B) also promoted adipogenesis in hMSCs-Ad (Fig. 5C, Fig. S5) and increased the expression of the adipocyte-related genes PPARγ2 (Fig. 5D), C/EBP-α (Fig. 4E), and Fabp4 (Fig. 5F), consistent with the results of miR-148a overexpression in hMSCs-Ad (Fig. 2). [score:8]
However, previous studies on hMSCs-Ad undergoing adipogenesis reported that miR-21 13, miR-22 14, miR-196 15, miR-27b 20, and miR-138 31 were either upregulated or downregulated, and miR-148a was not reported in hMSCs-Ad. [score:7]
Wnt1 or Wnt10b inhibits the differentiation of mesenchymal stem cells 40 and blocks adipogenesis in vivo 41; thus, miR-148a expression rescued the negative effect of Wnt1 expression in hMSCs-Ad. [score:7]
We further identified Wnt1 as a direct translational target of miR-148a, where it directly bound to the 3′-UTR of Wnt1 and not to the related Wnt10b, which is also consistent with previous studies 36. [score:7]
Overexpression of miR-148a partially restored differentiation in Wnt1 -suppressed hMSCs-Ad as assessed by lipid accumulation (Fig. 5C, last two columns; Fig. S5), as well as PPARγ2 (Fig. 5G), C/EBP-α (Fig. 5H), and Fabp4 (Fig. 4I) mRNA expression. [score:7]
miR-148a was highly expressed in hMSCs-Ad during adipogenesis relative to its negative regulatory effect on Wnt1 expression. [score:6]
Meanwhile, knockdown of miR-148a obviously inhibited adipogenesis, as indicated by the expression of adipocyte-specific factors PPARγ2, C/EBP-α, and FABP4 (Figs. 3B–D), triacylglycerol content (Fig. 3E), and oil red O staining (Fig. 3F). [score:6]
Overexpression (D) and knockdown (E) CREB in hMSC-Ad were used to examine the expression level of miR-148a by qRT-PCR. [score:6]
To further understand the mechanism underlying the regulation of adipogenesis by miR-148a, candidate target genes were examined by bioinformatics analysis using TargetScan, miRanda, and PicTar. [score:6]
Exogenous expression of miR-148a in hMSCs-Ad significantly increased TG content, GPDH activity, and adipogenesis relative to an increase in differentiation-specific factors at both transcriptional and translational levels. [score:5]
The miR-148a lentiviral expression vector pGLV3-H1-GFP-puro-miR-148a, miR-148a sponge (four repeat complimentary sequences) lentiviral expression vector, and the negative control vector pGLV3-H1-GFP-puro were purchased from GenePharma (Shanghai, China). [score:5]
In our study, we examined the effect of miR-148a on TLX-2 reporter gene, which is a downstream target for BMP signaling in the primitive streak where BMP-4 and other TGF-related factors are expressed. [score:5]
Bioinformatics analysis using TargetScan, miRanda, and PicTar revealed that the Wnt (Wnt1, Wnt10b), cell cycle (E2F3), and DNA methylation pathways (DNMT1, DNMT3B) were candidate targets of miR-148a. [score:5]
However, other studies have found little or no change in Wnt1 or Wnt10b expression by miR-148a or miR-148b in gastric cancer cells 38 39, suggesting that inhibition is dependent on cellular context. [score:5]
miR-148a was highly expressed in CREB overexpressed hMSC-Ad (n = 3). [score:5]
Interestingly, miR-148a can inhibit the Wnt1 expression at post-transcriptional level. [score:5]
To determine whether miR-148a directly affected adipocyte differentiation, hMSCs-Ad were transduced with a lentivirus expressing miR-148a or an empty virus for 48 h before transferring to differentiation medium. [score:4]
Therefore, we examined whether endogenous miR-148a expression was regulated by CREB in hMSCs-Ad. [score:4]
miR-148a was also upregulated sixfold in hMSCs-Ad. [score:4]
Qin et al. 32 found that miR-148a was downregulated in activation of Wnt signaling in 3T3-L1 cells. [score:4]
We tested whether miR-148a levels were altered in brown adipose tissues and observed downregulated levels, opposite to the changes observed in epididymal white adipose tissues. [score:4]
This hypothesis was first proved by identification of a direct miR-148a target protein. [score:4]
Knockdown miR-148a in hMSCs-Ad inhibits adipogenic differentiation. [score:4]
Mutation of the miR-148a binding site abolished its inhibitory effect on Wnt1 reporter activity (Fig. 4C). [score:4]
To determine whether miR-148a can rescue Wnt1 -suppressed adipogenesis, hMSCs-Ad was co-infected with Wnt1 and miR-148a. [score:3]
We then examined the role of these differentially expressed miRNAs in adipocyte differentiation by PPREx3-TK report gene, representing PPAR -dependent transcription as a major factor in adipogenesis 23. miR-148a increased PPREx3-TK activity by about twofold (Fig. S1A). [score:3]
Bioinformatics and identification of miR-148a target sites. [score:3]
As control, the expression of miR-152, which belongs to the same family of miR-148a, as well as miR-1908 and let-7a, was unchanged (Fig. S2B), suggesting that miR-148a did not disrupt other endogenous miRNA pathways. [score:3]
org) were used to predict the target consensus sequences for miR-148a. [score:3]
HEK-293T cells were transfected with lentiviral packaging vectors (ABM, Richmond, BC, CA) and lentiviral vectors expressing miR-148a, CREB, or Wnt1 by Lipofectamine 2000. [score:3]
Additionally, qRT-PCR (Fig. 2E) and Western blot (Fig. 2F) analyses indicated that the adipocyte-specific factors PPARγ2, C/EBP-α, and FABP4 increased significantly after transduction with the miR-148a -expressing lentivirus. [score:3]
Canonical Wnt signaling was repressed following miR-148a expression, as indicated by the marked reduction of Wnt1 protein (Fig. 5A, Day 0), increased phosphorylation of GSK-3β (p-GSK-3β) (Fig. 5A, Day 10), and reduced nuclear β-catenin (Fig. 5A, Day 10). [score:3]
Expression of miR-148a during hMSC-Ad differentiation was quantitated by TaqMan miR -based qRT-PCR. [score:3]
Overexpression of miR-148a promoted adipogenesis as indicated by oil red O staining (Fig. 2B), triacylglycerol content (Fig. 2C), and GPDH activity (Fig. 2D). [score:3]
Differential miR-148a expression in obese mice and human subjects. [score:3]
Identification of miR-148a -binding sequence in target genes. [score:3]
Expression of miR-148a increased in these subjects in proportion to increasing BMI (Fig. 7B, r = 0.63, P < 0.001, Pearson’s correlation). [score:3]
The expression of miR-148a was increased 38-fold at Day 0 and remained high throughout differentiation (Fig. 2A). [score:3]
Additionally, miR-148a decreased the expression of Wnt1 protein but not Wnt1 mRNA in hMSCs-Ad (Figs. 4D and 4E), suggesting that miR-148a modulated Wnt1 post-transcriptionally. [score:3]
Overexpression (F) and knockdown (G) CREB in HEK293 were used to examine the promoter activity of miR-148a by Luciferase assay. [score:3]
Further research may elucidate whether miR-148a can modulate adipogenesis in vivo and possibly provide a novel therapeutic target for the management of obesity. [score:3]
This new role for miR-148a was only previously recognized as modulator function of tumor suppressor genes in gastrointestinal tumors 30. [score:3]
miR-148a expression gradually increased after induction of adipocyte differentiation in hMSCs-Ad and peaked after 10 d (Fig. 1C). [score:3]
Differential miR-148a expression in lean and obese human subjects and mice. [score:3]
CREB is bound to miR-148a promoter in hMSCs-Ad, and CREB is required for miR-148a expression. [score:3]
Our results revealed that human and mouse adipocyte differentiation-related molecules, namely, Wnt (Wnt1, Wnt10b), cell cycle (E2F3), and DNA methylation (DNMT1, DNMT3B), were the candidate targets of miR-148a (Figs. S4A and S4B). [score:3]
This finding is also supported by the high expression of miR-148a in diet -induced obese mice, as well as our finding that miR-148a levels in human adipose tissues achieve proportion to an increase in BMI, providing new insights into the roles of miRNAs in obesity and related metabolic disorders. [score:3]
By contrast, miR-148a inhibited activity of Wnt1 but not Wnt10b by 50% (Fig. 4B). [score:3]
miR-148a expression levels also increased 10-fold in murine 3T3-L1 preadipocytes undergoing differentiation (Fig. S1B), further suggesting that miR-148a is associated with adipocyte differentiation. [score:3]
Overexpression of miR-148a promotes adipogenesis in hMSCs-Ad. [score:3]
Overexpression of miR-148a in hMSCs-Ad enhances adipogenic differentiation. [score:3]
By contrast, brown adipose tissues from mice fed HFD decreased in miR-148a expression compared with animals fed SD (Fig. S7D). [score:2]
As mentioned above, whether miR-148a acted as an additional adipogenic regulator in hMSCs-ad or differentiation factor should be elucidated. [score:2]
By contrast, the level of miR-148a decreased by about 70% upon CREB knockdown (Fig. 7E). [score:2]
Epididymal adipose tissues from mice fed HFD significantly increased in miR-148a expression compared with animals fed SD (Fig. 8A). [score:2]
Following transduction of hMSCs-Ad with a lentivirus expressing CREB, the level of miR-148a increased 2.6-fold compared with control cells (Fig. 7D). [score:2]
These findings suggested that miR-148a may function differently in brown fat tissues to influence the occurrence and development of mouse obesity. [score:2]
Thus, these data in both mouse mo del and human subjects suggested a correlation between miR-148a and development of obesity. [score:2]
miR-148a regulates adipogenesis in hMSC-Ad via Wnt. [score:2]
These findings suggest that miR-148a is an upstream regulator rather than an effector of adipogenesis. [score:2]
Considering these results suggested miR-148a as a positive regulator of adipogenesis, possible mechanisms were explored by reporter gene analysis. [score:2]
miR-148a regulates adipogenesis in hMSCs-Ad via Wnt. [score:2]
miR-148a and miR-26b were highly expressed in differentiated hMSCs-Ad by over fivefold compared with undifferentiated hMSCs-Ad. [score:2]
Thus, our findings provide a basis for the role of miR-148a in adipogenesis, which may underlie the development of obesity and associated metabolic disorders. [score:2]
Four sets of primers were designed to target different regions of the pri-miR-148a promoter (Supplementary Table 3). [score:2]
The miR-148a -binding sites in the reporter vector were mutated using the Quick Change Site-Directed Mutagenesis Kit (Agilent Technologies Inc. [score:2]
The expression of miR-148a was decreased by about 60% at Day 0 compared with the control (Fig. 3A). [score:2]
The upstream region of miR-148a was examined using the UCSC genome browser (http://genome. [score:1]
By contrast, TGF-β (Fig. S3B) and BMP signaling (Fig. S3C) were unchanged by miR-148a. [score:1]
Analysis revealed potential miR-148a binding sites in the 3′-UTRs of Wnt1, Wnt10b, E2F3, and DNMT1, as well as in the coding sequence of DNMT3B (Fig. 4A). [score:1]
The effects of miR-148a (miRNA sponge) loss on adipogenesis were also determined. [score:1]
Importantly, miR-148a as a biomarker of obesity was elevated in adipose tissues of obese mice, as well as in human subjects. [score:1]
Identification of miR-148a promoter. [score:1]
Knockdown of miR-148a also significantly influenced adipogenesis compared with the control. [score:1]
To assess the utility of miR-148a as a biomarker in the development of obesity, miR-148a expression was measured in adipose tissues from obese eight-week-old C57BL/6J mice fed high-fat diet (HFD) and compared with age-matched controls fed standard diet (SD). [score:1]
In summary, our data provide the first evidence of miR-148a as a CREB- dependent and adipogenic-specific miRNA in hMSCs-Ad, which mediates this effect through modulation of Wnt signaling. [score:1]
Our results showed that miR-148a cannot bind to the 3′-UTRs of E2F and DNMT1/3B. [score:1]
miR-148a represses Wnt signaling. [score:1]
To further examine the interaction of CREB and E2F with the miR-148a promoter region in vivo, ChIP analysis was performed in hMSCs-Ad (Fig. 7C). [score:1]
The miR-148a minigenes, including the upstream and downstream sequences of the pre-miRNA and open reading frame of CREB and Wnt1, were amplified by PCR and ligated into the BamHI and EcoRI sites of pGLV3-H1-GFP-puro. [score:1]
The UCSC browser identified a putative promoter region in the miR-148a locus at Chr7p15.2: 25,986,556–25,989,530 (Fig. 6A). [score:1]
Promoter analysis of the miR-148a locus indicated it as an intergenic miRNA with putative CREB binding sites in the core promoter region. [score:1]
Changes in miR-148a, miR-26b, miR-30, and miR-199a-3p were confirmed by qRT-PCR (Fig. 1B), and these findings closely mirrored the array data. [score:1]
After 24 h, the cells were transfected with 100 ng of pGLV3-H1-GFP-puro-miR-148a or control vector and 100 ng of the reporter genes PPRE × 3-TK (Addgene, Cambridge, MA) 23, Super 8x TOPFlash/Super 8x FOPFlash (Super 8x TOPFlash mutant) (Addgene, Cambridge, MA) 26, SBE4 (Addgene, Cambridge, MA) 27, and TLX-2 (Addgene, Cambridge, MA) 28, as well as 2.5 ng of Renilla luciferase vector (pRL-TK), using Lipofectamine 2000 in accordance with the manufacturer’s instructions. [score:1]
EMSA and ChIP analyses demonstrated that CREB bound to the miR-148a promoter in hMSCs-Ad, suggesting interplay between CREB and the pri-miR-148a proximal promoter. [score:1]
com/scientificreports How to cite this article: Shi, C. et al. miR-148a is associated with obesity and modulates adipocyte differentiation of mesenchymal stem cells through Wnt signaling. [score:1]
Our results showed that TLX-2 luciferase activity was unchanged by miR-148a. [score:1]
In comparison, sequences −2146 to −1984 (CREB), −1734 to −1566 (CEBP), and −1566 to −800 (E2F) did not bind to the miR-148a promoter region (Fig. S6). [score:1]
The predicted pre-miR-148a promoter region of 2,974 bp was cloned into the pTB-Cherry vector to generate plasmids pTB-miR-148a1-Cherry (−1752 to −1) and pTB-miR-148a2-Cherry (−2974 to −1752), and the activity was detected by fluorescence microscopy upon transfection of HEK293 cells (Fig. 6B). [score:1]
A recent study demonstrated that miR-148a silencing resulted in Wnt10b -mediated stimulation of tumor cell motility in cancer -associated fibroblasts 36 37. [score:1]
CREB bound to the promoter region of miR-148a in hMSCs-Ad (lane 5). [score:1]
Luciferase activity of HEK293 cells cotransfected with reporter vector containing either wild-type (B) or mutant Wnt1 3′-UTR and miR-148a or control (C). [score:1]
After 24 h, the cells were transfected with 50 ng of pSi-CHECK-2 and 100 ng of pGLV3-H1-GFP-puro-miR-148a or the control virus using 0.3 μl of Lipofectamine 2000 (Invitrogen, Life Technologies Corporation, Carlsbad, CA). [score:1]
Among these miRNAs, miR-148a exhibited the most effects on increasing PPRE luciferase activity. [score:1]
Our data also showed a 10-fold increase in miR-148a in differentiated 3T3-L1 preadipocytes in accordance with the study of Xie et al. 16, which supported our thesis that miR-148a may play a key role in adipogenesis. [score:1]
The levels of miR-148a, miR-26b, miR-30, and miR-199a were increased in differentiating hMSCs-Ad. [score:1]
Thus, the role of miR-148a in obesity was clarified in the present study. [score:1]
CREB is bound to miR-148a promoter in hMSC-Ad. [score:1]
Reporter activity of E2F3, DNMT1, and DNMT3B was unaffected by miR-148a (Fig. 4B). [score:1]
The minimum match is the conservation reached in at least 80% of sites, and the minimum match number of sites is 5. The predicted promoter regions, namely, pTB-miR-148a1-Cherry (−1 to −1752) and pTB-miR-148a2-Cherry (−1752 to −2974) of miR-148a (chr7p15.2: 25,986,556–25,989,530, 2974 bp), were cloned into pTB-Cherry constructed from pTA-Luc (Clontech, Mountain View, CA) and pTB-Cherry 53 using the NsiI and XhoI restriction sites. [score:1]
To determine the adipogenesis-related transcription factors associated with the miR-148a promoter region, putative response elements were identified using TFSEARCH (http://mbs. [score:1]
Thus, miR-148a may play a critical role in adipocyte differentiation and be identified as the robust candidate miRNA for further research. [score:1]
To verify miR-148a binding, the 3′-UTRs of Wnt1, Wnt10b, E2F3, and DNMT1 and the DNMT3B cDNA were cloned into pSi-Check2, then cotransfected with miR-148a or control vector into HEK293 cells. [score:1]
[1 to 20 of 103 sentences]
6
[+] score: 229
These results provide evidence that low and high miR-148a expression may discriminate the survival rates of HCC patients, and MVI versus non-MVI, and that of the new targets up-regulated due to miR-148a dysregulation, a significant inverse correlation existed between miR-148a and USP4. [score:9]
Using TargetScan algorithms, we extracted the ‘core genes’ having the greatest interaction partner genes with miR-148a and performed experiments using miR-148a mimic, antisense oligonucleotide (ASO), 3'-untranslated region (UTR) reporter, and constructs encoding for the targets. [score:7]
As a continuing effort to verify the targets of miR-148a, we determined whether miR-148a inhibits USP4 and S1P1 by directly interacting with the 3'-UTR of the mRNAs. [score:6]
Collectively, our results support the concept that dysregulation of miR-148a is associated with the poor prognosis of HCC and may account for the tumor progression to advanced stages, and that, of the newly identified targets, USP4 overexpression may contribute to HCC progression towards more aggressive feature presumably by facilitating TGF-β signaling pathways, growth advantage and migrating capability. [score:6]
However, S1P1 levels in the HCC samples were not significantly correlated with miR-148a dysregulation, which may be due to differences in the miRNA affinity to different targets and the nature of multiple miRNAs interaction with a single target. [score:6]
We next assessed whether overexpression of the identified targets by miR-148a dysregulation causes epithelial-mesenchymal transition (EMT) using cell mo dels. [score:6]
miR-148a expression low (n=30) high (n=29) p-valueAgeMean ± SD52.8±10.0556.1±11.020.470 [1]GenderMaleFemale24618110.128 [2]Tumor size (cm)≤5>5161419100.341 [2]Tumor stage *TNM ITNM II-III1020245<0.001 ** [2]Vascular invasionNoYes1317272<0.001 ** [3]Satellite noduleNoYes2732720.669 [3]E-S grade (MC)I-IIIII- IV20102450.156 [2]AFP (ng/ml)≤20>2072318110.003 ** [2]EtiologyHBVHCVAlcoholIdiopathic25113222230.759 [3] 1 modified AJCC 2 p<0.01, [1]Student's t- test, [2]Chi-square test, [3]Fisher's exact test Abbreviation: AFP, α-fetoprotein; AJCC, American Joint Committee on Cancer; HBV, hepatitis B virus;To elucidate the molecules involved in HCC progression, we attempted to find miR-148a target(s) responsible for the induction of metastatic phenotype. [score:5]
miR-148a expression low (n=30) high (n=29) p-valueAgeMean ± SD52.8±10.0556.1±11.020.470 [1]GenderMaleFemale24618110.128 [2]Tumor size (cm)≤5>5161419100.341 [2]Tumor stage *TNM ITNM II-III1020245<0.001 ** [2]Vascular invasionNoYes1317272<0.001 ** [3]Satellite noduleNoYes2732720.669 [3]E-S grade (MC)I-IIIII- IV20102450.156 [2]AFP (ng/ml)≤20>2072318110.003 ** [2]EtiologyHBVHCVAlcoholIdiopathic25113222230.759 [3] 1 modified AJCC 2 p<0.01, [1]Student's t- test, [2]Chi-square test, [3]Fisher's exact test Abbreviation: AFP, α-fetoprotein; AJCC, American Joint Committee on Cancer; HBV, hepatitis B virus; To elucidate the molecules involved in HCC progression, we attempted to find miR-148a target(s) responsible for the induction of metastatic phenotype. [score:5]
Gene targets of miRNA-148a with conserved seed-match were predicted by TargetScan algorithm. [score:5]
The findings that miR-148a transfection attenuated CD90 and CD44 (cancer stem cell markers) expression in HCC [21] along with the fact that miR-148a as a hepatospecific miRNA is highly expressed in adult liver [22] suggest that the decrease of miR-148a in HCC is likely to reflect repression of the miRNA in cancer cells rather than stromal cells. [score:5]
Inhibition of USP4 or S1P1 translation by miR-148a. [score:5]
Analyses of miR-148a and its target expression levels in original HCC or engrafted tumors. [score:5]
Twenty miRNAs including miR-148a had been shown to be down-regulated in HCC with distant metastasis [25]. [score:4]
To determine the effect of USP4 or S1P1 overexpression on the progression of HCC in association with miR-148a dysregulation, we used a panel of tumor-derived cell lines and xenograft animal mo del. [score:4]
Our results demonstrate that overexpression of USP4 and S1P1 due to miR-148a dysregulation contributes to the growth advantage or migrating capability of liver tumor. [score:4]
In this study, we identified overexpression of USP4 or S1P1 in the human HCC samples as a consequence of miR-148a dysregulation. [score:4]
Our results provide evidence that miR-148a has the ability to directly inhibit de novo synthesis of USP4 and S1P1. [score:4]
In the xenograft tissues, USP4 or S1P1 levels were notably diminished, showing that an approach modulating the upstream regulator of miR-148a creates the expected changes in USP4 or S1P1 expression in vivo. [score:4]
miR-148a is also down-regulated in other tumors such as colorectal and gastric cancers [18, 19]. [score:4]
Consistently, miR-148a levels were down-regulated in the cells, being consistent with a recent report [27]. [score:4]
Zhang JP Zeng C Xu L Gong J Fang JH Zhuang SM MicroRNA-148a suppresses the epithelial-mesenchymal transition and metastasis of hepatoma cells by targeting Met/Snail signalingOncogene 2013 28. [score:4]
Here, we report the identification of USP4 and S1P1 as the direct targets of miR-148a. [score:4]
USP4 and S1P1 as direct targets of miR-148a. [score:4]
Our result shown in a heterotropic patient-derived HCC xenograft mo del verified the overexpression of USP4 in G1 and G2 tumors when miR-148a was dysregulated. [score:4]
Thus, USP4 overexpression elicited by dysregulation of miR-148a and other miRNA(s) may facilitate HCC progression. [score:4]
Collectively, USP4 is overexpressed as a result of miR-148a dysregulation, which may reflect a shift in the expansion phase of tumorgraft. [score:4]
Moreover, low miR-148a expression also significantly reduced the recurrence free survival rate of the HCC patients (Figure 1B, right; the drop at 70 months was due to recurrence of one patient among remaining 3 patients). [score:3]
miR-148a mimic transfection decreased luciferase expression from Luc-USP4-3'-UTR construct in HEK293 cells. [score:3]
Other known targets of miR-148a include bcl-2, rho -associated protein kinase 1, c-Myc, and HPIP in cancers including gastric cancer, colorectal cancer, and HCC [6, 38- 40]. [score:3]
Filled colors indicate subset core (red) and member (blue), whereas border colors do predicted targets of miR-148a (yellow). [score:3]
Next, we divided HCC patients into two groups, low and high expression of miR-148a, according to the median level of miR-148a and analyzed survival rates of the HCC patients using Kaplan-Meier method. [score:3]
Yan H Dong X Zhong X Ye J Zhou Y Yang X Shen J Zhang J Inhibitions of epithelial to mesenchymal transition and cancer stem cells-like properties are involved in miR-148a -mediated anti-metastasis of hepatocellular carcinomaMol Carcinog 2013 22. [score:3]
Interestingly, the overall survival rate was significantly lower in a group of HCC patients having low miR-148a expression (Figure 1B, left). [score:3]
Indicated cells transfected with control ASO or miR-148a ASO for 72 h (or with control mimic or miR-148a mimic for 48 h), wild type HepG2 or those overexpressing USP4 (or S1P1) were plated at a density of 1×104 cells per well in a 48-well plate. [score:3]
The effect of miR-148a, USP4, and S1P1 on the expression of EMT markers. [score:3]
To elucidate the molecules responsible for HCC progression, we attempted to find miR-148a target(s) leading to the induction of metastatic phenotype. [score:3]
Therefore, USP4 was the bona fide target of miR-148a. [score:3]
The ability of miR-148a to directly inhibit de novo synthesis of USP4 or S1P1 was supported by the results of cell -based assays. [score:3]
Furthermore, miR-148a expression was significantly associated with tumor node metastasis (TNM) stage (p<0.001) and α-fetoprotein levels (p<0.001) (Table 1). [score:3]
In addition, miR-148a ASO transfection increased luciferase activity from the construct in HepG2 cells, which corroborates the inhibitory effect of miR-148a on USP4 (Figure 3A, left). [score:3]
Chi-square tests were used to compare the associations of categorical variables with low or high miR-148a expression. [score:3]
Thus, we focused USP4 and S1P1 as the putative targets of miR-148a for HCC progression. [score:3]
In the combined analyses, the levels of USP4, but not S1P1, was inversely correlated with miR-148a expression (Figure 7C). [score:3]
Moreover, miR-148a dysregulation may discriminate MVI versus non-MVI and tumor size. [score:2]
Hence, dysregulation of miR-148a may contribute to progression of HCC to advanced stages. [score:2]
Hence, it is highly likely that USP4 induction is closely linked to miR-148a dysregulation for a shift in the expansion phase of tumorgraft. [score:2]
However, whether dysregulation of miR-148a deteriorates the prognosis of HCC patients was elusive. [score:2]
miR-148a belongs to abundant miRNAs in hepatocytes, and is severely deregulated in several tumors including HCC [5, 6]. [score:2]
Consistently, S1P1 induction by miR-148a dysregulation promoted proliferation or migration of hepatoma cells, and the causal effect relationship was strengthened by the experiments using siRNA (data not shown) and miR-148a mimic. [score:2]
Our findings that miR-148a dysregulation correlated with USP4 in the tumor samples and that patients having high USP4 showed a tendency to have high TNM stage (TNM stage II-III) support the role of USP4 in the transition of HCC to a malignant phenotype. [score:2]
Our findings may provide key information on the role of miR-148a dysregulation and the relevant changes in USP4 for HCC progression and/or malignancy. [score:2]
Survival and MVI rates of HCC patients in association with miR-148a dysregulation. [score:2]
This possibility may have been reflected by the lack of statistical change between miR-148a and S1P1 in our HCC samples obtained from the patients who had no distant metastasis but only MVI in a certain fraction. [score:1]
miR-148a levels were confirmed after transfection of miR-148a mimic or ASO into liver tumor cells. [score:1]
As expected, transfection of either Huh7 or HepG2 cells with miR-148a ASO resulted in the induction of USP4, which was accompanied by the stabilization of TβRI (Figure 3B, left). [score:1]
The cells were transfected with 100 nM control mimic or miR-148a mimic for 48 h, and this procedure was repeated four more times. [score:1]
In SK-Hep1 cells, miR-148a mimic transfection attenuated the band intensities of USP4 and TβRI. [score:1]
To understand the relationship between miR-148a expression and HCC progression, we first investigated miR-148a levels in HCC patients. [score:1]
Similarly, HepG2 cells were transfected with 2'-O-methyl miR-148a and the 3'UTR reporter, and were incubated for 24 h. The cells were harvested 48 h after change of medium. [score:1]
In the subsequent experiments, we determined the role of USP4, S1P1, or miR-148a in tumor cell migration and growth. [score:1]
The sequence of human miR-148a is 5'-UCAGUGCAUCACAGAACUUUGU-3'. [score:1]
The following sequences were used: miR-148a mimic, 5'-UCAGUGCACUACAGAACUUUGU-3' (guide) and 5'-AAAGUUCUGUAGUGCACUGACU-3' (passenger). [score:1]
Modulations of miR-148a using mimic or ASO altered the migrating or growing capability of Huh7 and SK-Hep1 cells (Figure 6C). [score:1]
miR-148a ASO transfection promoted the induction of S1P1 in Huh7 or HepG2 cells, whereas miR-148a mimic transfection diminished it in SK-Hep1 cells (Figure 3B, right). [score:1]
Moreover, the molecules controlled by miR-148a in relation to HCC progression remained minimally known. [score:1]
Moreover, repetitive transfections with miR-148a minimally changed EMT marker levels (Figure 5D). [score:1]
Moreover, highly conserved miR-148a recognition sites were present in the 3'-UTR regions of USP4 and S1P1 mRNAs (Figure 1C, right). [score:1]
USP4 mRNA levels were also correspondingly changed by the modulations of miR-148a, suggesting that miR-148a may destabilize USP4 mRNA. [score:1]
Briefly, HEK293 cells were transfected with miR-148a mimic and USP4 (or S1P1) 3'UTR reporter construct in an Opti-MEM medium in 6-well plates, and the medium was changed with DMEM -high glucose 12 h after transfection. [score:1]
The cells in each well (6-well plates) were transiently transfected with 100 pmoles of control mimic (Santa Cruz, CA) or miR-148a mimic, or 100 pmoles of 2'-O-methyl miR-148a ASO or respective negative control ASO using FuGENE HD Reagent (Roche, Indianapolis, IN). [score:1]
In this mo del, S1P1 levels were not significantly correlated with decrease of miR-148a. [score:1]
In this experiment, we took an advantage of the ability of Gα [12] to promote liver tumor EMT and of the fact that this effect accompanies decrease of miR-148a (Yang et al, submitted). [score:1]
Gα [12] -depletion using a shRNA approach (shR) increased miR-148a level in SK-Hep1 cells (mesenchymal-type), which was lessened but maintained in tumors formed from the cell (Figure 6D). [score:1]
We further assessed the effects of miR-148a modulations on USP4 and S1P1 levels in three different liver-tumor cell lines. [score:1]
Poor prognosis of patients by decrease of miR-148a with the induction of USP4 and S1P1. [score:1]
In the HCC samples, the levels of USP4 inversely correlated with those of miR-148a, whereas those of S1P1 did not (Figure 1F). [score:1]
miR-148a, USP4, and S1P1 levels in a patient-derived tumorgraft mo del. [score:1]
As expected, miR-148a levels were lower in SK-Hep1 and SNU423 (mesenchymal-type) than in Huh7 and HepG2 (epithelial-type) (Figure 5A). [score:1]
However, decreases of miR-148a in human specimens correlated with the changes in USP4, but not S1P1. [score:1]
More importantly, decrease of miR-148a further discriminated between HCC patients with MVI and those with non-MVI. [score:1]
Towards the end, we employed a PDX animal mo del to further assess the relationship between miR-148a and USP4 (or S1P1). [score:1]
Indicated cells were transfected with control mimic (or ASO) or miR-148a mimic (or ASO) in combination with reporter construct. [score:1]
A sequence of miR-148a and its binding sites within the 3'-UTR regions of USP4 and S1P1 mRNAs were shown in the right. [score:1]
In addition, we verified the inverse relationship between miR-148a and USP4 (or S1P1) in a tumor xenograft mo del. [score:1]
2'-O-methyl control ASO and miR-148a used for cell culture experiments were custom-synthesized from Bioneer (Daejeon, Korea). [score:1]
In addition, miR-148a levels in endometrial cancer were lower than in matched normal tissue fibroblasts [20]. [score:1]
[1 to 20 of 86 sentences]
7
[+] score: 213
miR-148a over -expression significantly reduced the expression levels of these target genes, while their expression levels were significantly elevated in anti-miR-148a inhibitor -transfected tumor cells (t-test, P < 0.05, Figure 3A). [score:11]
We next ascertained whether miR-148a -mediated down-regulation of PAI-1, VAV2, ITGA5, and ITGB8 expression resulted in the inhibition of malignant progression of tumor cells. [score:8]
Among 16 down-regulated miRNAs, we found that the miR-148a is down-regulated in gastric cancer and its regulated PIN was associated with tumor metastasis-related functions, such as integrin -mediated signaling, cell-matrix adhesion, wound healing and blood coagulation. [score:8]
These observations suggest that miR-148a plays a significant role in affecting the biological functions of gastric cancer cells by regulating the expression of target genes within its regulated PIN. [score:7]
Herein, we showed that their expression levels were reduced in response to miR-148a over -expression but elevated in response to anti-miR-148a inhibitor treatment. [score:7]
These genes were identified as up-regulated targets of miR-148a within its regulated PIN and have been reported to have a high oncogenic potential and are associated with aggressive tumor cell phenotypes [26- 33]. [score:7]
P-value of each enriched GO terms: cell-matrix adhesion: 9.5619E-6, wound healing: 5.8018E-5, blood coagulation: 8.0094E-4, cell surface receptor linked signal transduction: 5.3054E-5, integrin -mediated signaling pathway: 3.1108E-6, enzyme linked receptor protein signaling pathway: 2.3001E-4. Four target genes of miR-148a were identified to be up-regulated within its regulated PIN, including PAI-1 (a coagulation factor), ITGB8 (an adhesion factor), VAV2 and ITGA5 (involved in the integrin -mediated signaling pathway). [score:7]
Taken together, these observations indicate that miR-148a can inhibit cell invasion, migration, adhesion and growth, thereby acting as a potent regulator of tumor suppression. [score:6]
It includes the analyses of clinical data of oncomirs, enriched functions of oncomir-regulated PIN, the expression of miR-148a targets in tumor tissues, the relationship between miR-148a and clinical factors, and the detailed methods. [score:6]
Lujambio et al. found miR-148a inhibited metastasis formation in xenograft mo dels [36] and Chen et al. showed that expression level of miR-148a in human gastric cancer was significantly lower than that in their matched nontumor adjacent tissues [37]. [score:5]
Additionally, patients with high miR-148a expression levels exhibited a significantly better overall survival rate than those with low miR-148a levels, suggesting that miR-148a might function as a tumor suppressor and could potentially serve as a diagnostic and prognostic marker for gastric cancer. [score:5]
While miR-148a over -expression led to a significant reduction in the invasive, migratory, adhesiveness and growth properties of gastric cancer cells, miR-148a inhibitor -treated tumor cells enhanced these effects. [score:5]
Additionally, tumor cell growth was observed to be reduced in response to miR-148a over -expression (Figure 4A and 4C), but elevated in response to anti-miR-148a inhibitor treatment (Figure 4B and 4D). [score:5]
We constructed each putative miR-148a target sites or its site mutation in sequences corresponded to seed sequence of miR-148a into a pMIR-REPORT luciferase expression vector (Additional file 1, Figure S3A) and analyzed reporter assays (Additional file 1, Figure S3B-S3E). [score:5]
In particular, miR-148a was identified as a potential prognostic marker in gastric cancer patients, with the ability to function as a tumor suppressor through its regulated PIN. [score:4]
These results suggest that these four genes are direct targets of miR-148a. [score:4]
Among these was the miR-148a-regulated PIN, which was involved in metastasis-related biological processes that were associated with tumor suppression. [score:4]
The present data suggest that miR-148a could be a potential prognostic biomarker of gastric cancer and function as a tumor suppressor through repressing the activity of its regulated PIN. [score:4]
These findings suggest that miR-148a is not only a potential prognostic marker that can be used for the detection of human gastric cancer, but it can also suppress gastric cancer progression through the regulation of its associated network. [score:4]
Cut-off value of 0.101 was determined based on the finding that miR-148a expression levels in 60% of patients (37 out of 62) that survived for a period of 2 to 140 months after surgical resection were above 0.101. [score:3]
Clinical analyses revealed that high expression levels of miR-148a significantly correlated with a reduction in distant metastasis (t-test, P = 0.043), organ invasion (t-test, P = 0.013) and peritoneal invasion (t-test, P = 0.04) (Table 1). [score:3]
In particular, miR-148a was shown to inhibit tumor invasion, migration, adhesion and cell growth, and prolonged patient survival. [score:3]
The results showed that over -expression of miR-148a in these cell lines significantly reduced tumor cell invasion, while anti-miR-148a -treated tumor cells showed elevated tumor cell invasion (Figure 3B). [score:3]
Human gastric cancer AGS, SC-M1 and MKN-45 cell lines were transfected with a miR-148a precursor or an anti-miR-148a inhibitor. [score:3]
The results indicated that miR-148a reduced tumor cell growth (t-test, P = 0.23, A and P < 0.001, C), while miR-148a inhibitor -transfected tumor cells showed increased cell growth (t-test, P < 0.001, B and P < 0.001, D). [score:3]
Over-expressed miR-148a reduces invasion (B), migration (C) and adhesion (D) of tumor cells. [score:3]
Figure 4 Over-expressed miR-148a reduces cells growth. [score:3]
Black and gray solid lines represent miR-148a precursor and inhibitor, respectively. [score:3]
To further confirm the abundance of miR-148a in tumor tissues, we performed qRT-PCR in 62 paired tumor and normal tissues and found its expression levels in tumor tissues were significantly lower than those in normal tissues (P < 0.0001, paired t-test) (Figure 2A), which was consistent with our miRNA microarray data. [score:3]
Additionally, the impact of miR-148a expression levels on the prognosis of gastric cancer patients by Kaplan-Meier survival analyses was studied in the 62 paired tissues. [score:3]
Overall, these results suggest that miR-148a influences the tumor progression-related biological functions of cancer cells by regulating a small subset of cancer-relevant genes within its regulated PIN. [score:3]
To further explore whether miR-148a affected cancer metastasis through its regulated PIN, a luciferase reporter assay was performed to analyze the relationship between miR-148a and these target genes. [score:3]
PAI-1, ITGB8, VAV2 and ITGA5 Are Oncogenes and Direct Targets of MiR-148a. [score:3]
Cells were transfected with a miR-148a precursor and a miR-148a inhibitor. [score:3]
These three enriched GO functions suggest that miR-148a is related to cancer metastasis and is likely to regulate these three functions through its regulated PIN. [score:3]
Our findings indicated that over-expressed miR-148a significantly reduced tumor cell migration and adhesion, while anti-miR-148a -treated tumor cells showed significantly elevated migratory and adhesive abilities (Figure 3C and 3D). [score:3]
After incubation, cells were transfected with a miR-148a precursor and inhibitor and the growth of living cells were monitored in real-time. [score:3]
These findings were validated by over -expressing miR-148a in AGS, SC-M1 and MKN-45 gastric cancer cell lines. [score:3]
All four genes showed higher expression levels in tumor tissues compared with normal tissues (Additional file 1, Figure S4), indicating that they might have potential oncogenic functions and were likely to be key downstream effectors of miR-148a in this network. [score:2]
Figure 2 miR-148a and its regulated PIN. [score:2]
Interestingly, the miR-148a-regulated PIN was the only network that was associated with cancer metastasis-related functions, such as integrin -mediated signaling, cell-matrix adhesion and wound healing. [score:2]
MiR-148a Inhibits Cell Invasion, Migration, Adhesion and Growth. [score:2]
To determine whether miR-148a over -expression also affected tumor progression, migration, adhesion and proliferation assays were performed on miR-148a -transfected tumor cells. [score:2]
In vitro invasion assays were performed to examine whether miR-148a suppressed more aggressive forms of tumors. [score:2]
Patients with high miR-148a expression levels showed significantly higher 5-year overall survival rates (71.4%, log-rank test, P = 0.03; Figure 2B) compared with patients with low miR-148a levels (32.1%, log-rank test, P = 0.03). [score:2]
These results support our findings, miR-148a regulates malignant progression in gastric cancer. [score:2]
Interestingly, our findings revealed that several functions, including migration (integrin -mediated signaling pathway) and adhesion, were identified within the miR-148a-regulated PIN and were also associated with an aggressive tumor phenotype. [score:2]
The miR-148a-regulated PIN was visualized in Figure 2D and the enriched biological processes of this network are shown in Figure 2E. [score:2]
One miRNA, miR-148a, was identified and its function is to decrease tumor proliferation and metastasis through its regulated PIN. [score:2]
This indicates that miR-148a likely plays an important role in regulating the malignant progression of tumor cells. [score:2]
Solid and dotted lines represent high (≧0.101, N = 50) and low (<0.101, N = 12) miR-148a levels. [score:1]
Our results showed that the repressions by miR-148a in these four genes were completely abolished. [score:1]
Furthermore, we found that miR-148a could reduce the invasiveness, migratory and adhesive activities of gastric tumor cells. [score:1]
On multivariate analysis, miR-148a retained an independent prognostic power on overall survival (HR = 1.69; P = 0.002) (Additional File 1, Table S6). [score:1]
These results indicate that miR-148a could discriminate between normal and tumor tissues and serve as an effective prognostic marker for gastric cancer. [score:1]
ROC curve analysis of miR-148a showed that it had an AUC of 0.84 (ROC curves analysis, P = 0.0001, Figure 2C). [score:1]
The relationship between miR-148a levels and all clinical factors was shown in Additional file 1, Table S7. [score:1]
Invasive, migratory and adhesive activities of tumor cells were measured after transfection for 48hr with miR-148a precursor (light gray bar) and inhibitor -treated (dark gray bar) AGS, SC-M1 and MKN-45 cell lines. [score:1]
The Correlation Between miR-148a and Clinicopathological Factors. [score:1]
Therefore, miR-148a was chosen for the further studies. [score:1]
The function of a specific miRNA, miR-148a, was further examined by clinical data analysis and cell -based experiments. [score:1]
To evaluate the clinical significance of miR-148a in gastric cancer, the relationship between miR-148a expression levels in tumor tissues and the degree of metastasis was analyzed (see in Additional file 1). [score:1]
Based on these results, we conclude that miR-148a is highly associated with gastric cancer. [score:1]
The AUC was then used as an indicator of the capacity of miR-148a to act as a diagnostic marker, with higher AUC values reflecting a higher diagnostic potential. [score:1]
Most importantly, elevated miR-148a level in gastric cancer tissues was strongly correlated with distant metastasis, organ and peritoneal invasion and reduced survival rate. [score:1]
These results suggest that miR-148a reduces the aggressiveness of gastric cancer. [score:1]
MiR-148a-regulated PIN and Its Potential Functions in Gastric Cancer. [score:1]
Figure 3 The relationship between miR-148a and PAI-1 (P), VAV2 (V), ITGB8 (I-8) and ITGA5 (I-5). [score:1]
Univariate analysis showed that miR-148a and early stages correlated with better survival, whereas peritoneal and vascular invasion predicted very poor outcomes. [score:1]
Moreover, of the 16 oncomirs, miR-29c, miR-768-3p, miR-26a, miR-143 and miR-148a were found to give an AUC of more than 0.7 (P < 0.05) individually. [score:1]
[1 to 20 of 70 sentences]
8
[+] score: 208
Note that EGFR expression in PCa cells is negatively regulated by MIG6 [337], which is a direct target of miRNA-148a [278]. [score:7]
Whereas veterinary medicine unintentionally further increases the burden of miRNA-148a for the human milk consumer, lipidologists are concerned about high expression of miRNA-148a in the context of dyslipidemia and cardiovascular disease and recommend miRNA-148a inhibition as a promising therapeutic approach [406]. [score:7]
Furthermore, miRNA-148a directly downregulates the expression DNMT3B [121]. [score:7]
miRNA-29 via targeting DNMT3B and miRNA-148a via targeting DNMT1 may decrease FTO promoter methylation associated with higher FTO expression resulting in decreased m [6]A levels in mRNAs. [score:7]
Rho -associated coiled-coil containing protein kinase 1 (ROCK1), a known inhibitor of myogenesis, has been identified as a direct target of miRNA-148a (Table 2) [261]. [score:6]
Milk miRNA-148a -mediated suppression of DNMT1 may thus impair the binding of MeCP2 and thus HDAC recruitment resulting in histone hyperacetylation thereby promoting the expression of developmental genes such as the NR4A subfamily of orphan nuclear receptors (Figure 2). [score:6]
Downregulation of miRNA-148a expression plays a critical role in CRC carcinogenesis and progression [339, 340, 341]. [score:6]
Milk-derived DNMT -targeting exosomal miRNAs (miRNA-148a, miRNA-152, miRNA-21, miRNA-29s) may play a pivotal epigenetic role in reducing CpG methylation of critical gene regulatory sites of FTO resulting in increased FTO expression required for increased postnatal mRNA transcription (Figure 2) [135]. [score:6]
Remember that miRNA-148a directly targets the pivotal genes regulating triglyceride synthesis (FAS), cholesterol homeostasis (LDLR), cholesterol efflux (ABCA1), and β-oxidation (CTPA1) [106]. [score:5]
The expression of DNMT1 is inversely related to the expression miRNA-148a and miRNA-152 [119, 120]. [score:5]
ACL -mediated suppression of DNMT1 occurs at least in part by promoting expression of miRNA-148a, which represses DNMT1 [244]. [score:5]
In the pathogenesis of PCa, miRNA-148a is apparently a critically ‘oncomiR’ such as miRNA-21 [342, 343, 344, 345], which is one of the earliest identified cancer-promoting ‘oncomiRs’, targeting numerous tumor suppressor genes associated with proliferation, apoptosis and invasion [346, 347, 348]. [score:5]
Pan W. Zhu S. Yuan M. Cui H. Wang L. Luo X. Li J. Zhou H. Tang Y. Shen N. MicroRNA-21 and microRNA-148a contribute to DNA hypomethylation in Lupus CD4+ T cells by directly and indirectly targeting DNA methyltransferase 1 J. Immunol. [score:5]
Key miRNAs that are abundantly expressed in lactating bovine MECs that promote lactation performance, lipid and protein synthesis include the DNMT -targeting miRNA-148/152- and the miRNA-29 family [116, 117, 122]. [score:5]
Based on our translational insights, we have identified a fundamental epigenetic signaling motive of milk that involves the transfer of DNMT -targeting miRNAs, such as milk’s most abundant miRNA-148a, to the milk recipient. [score:5]
Continued consumption of cow’s milk and persistent uptake of bovine exosomal miRNA-148a, which is identical with human miRNA-148a, may represent an epigenetic mechanism suppressing DNMT1, which via SNCA demethylation may increase the expression of α-synuclein, a key aggregating protein in PD (Table 5). [score:5]
Milk-derived exosomal miRNAs that target DNMT1 (miRNA-148a, miRNA-21) and DNMT3B (miRNA-148a, miRNA-29b) have been suggested to play a fundamental epigenetic role for milk -induced FoxP3 expression and Treg stabilization [130, 193, 194]. [score:5]
Importantly, it has recently been demonstrated that miRNA-148a via targeting DNMT1 increased FABP4 promoter hyomethylation thereby enhancing FABP4 expression [243, 307]. [score:5]
miRNA-148a via targeting DNMT1 and subsequent promoter hypomethylation enhances adipogenic gene expression including insulin (INS), insulin-like growth factor-1 (IGF1), caveolin-1 (CAV1), leptin (LEP), PPAR-γ2 (PPARG2), fatty acid -binding protein 4 (FABP4), and lipoprotein lipase (LPL) [170, 174, 175, 179, 243]. [score:5]
Murata T. Takayama K. Katayama S. Urano T. Horie-Inoue K. Ikeda K. Takahashi S. Kawazu C. Hasegawa A. Ouchi Y. miR-148a is an androgen-responsive microRNA that promotes LNCaP prostate cell growth by repressing its target CAND1 expression Prostate Cancer Prostatic Dis. [score:5]
Milk exosomal DNMT -targeting miRNAs (miRNA-148a, miRNA-21 and miRNA-29s) may thus enhance insulin secretion required for mTORC1 -driven translation and anabolism (Figure 2). [score:5]
The DNMT1 -targeting miRNA-148a plays a critical role for the regulation of neurological development in the brain of the zebrafish [391]. [score:5]
Kim J. Zhang Y. Skalski M. Hayes J. Kefas B. Schiff D. Purow B. Parsons S. Lawler S. Abounader R. microRNA-148a is a prognostic oncomiR that targets MIG6 and BIM to regulate EGFR and apoptosis in glioblastoma Cancer Res. [score:4]
Notably, overexpression of miRNA-148a and miRNA-17-5p promoted triacylglycerol synthesis while knockdown of miRNA-148a and miRNA-17-5p impaired triacylglycerol synthesis in goat MECs [108]. [score:4]
Importantly, DNMT1 is a direct target of miRNA-148a [118]. [score:4]
Furthermore, miRNA-148a directly targets the mRNAs of ABCA1, LDLR and CPT1A, thus attenuates cholesterol efflux, hepatic LDL uptake, and mitochondrial fatty acid β-oxidation [106]. [score:4]
It is important to mention that MIG6 has been identified as a direct target of miRNA-148a (Table 2) [278]. [score:4]
Importantly, miRNA-148a targets the largest number of known PCa drivers [334]. [score:3]
Intriguingly, in bovine MEC cultures, the expression of miRNA-148a was stimulated by treatment with dexamethasone, insulin, and prolactin (DIP) [117]. [score:3]
Goedeke L. Rotllan N. Canfrán-Duque A. Aranda J. F. Ramírez C. M. Araldi E. Lin C. S. Anderson N. N. Wagschal A. de Cabo R. MicroRNA-148a regulates LDL receptor and ABCA1 expression to control circulating lipoprotein levels Nat. [score:3]
Blocking the function of miRNA-148a with a 2′-O-methylated antisense oligonucleotide inhibitor repressed C2C12 myoblast differentiation [260]. [score:3]
Overexpression of miRNA-148a significantly promoted myogenic differentiation of both C2C12 myoblast and primary muscle cells. [score:3]
Exosomal transfer of DNMT1 -targeting miRNA-148a via cow’s milk consumption may decrease APOE and FTO methylation. [score:3]
Additionally, milk miRNA-148a -mediated FTO promoter demethylation may further enhance RNA transcription of the key adipogenic transcription factors RUNX1T1, PPARγ, CEBPα, and PGC1α via erasing m [6]A marks on their target mRNAs. [score:3]
The generation of DNMT -targeting miRNAs (miRNA-152, miRNA-148a, miRNA-29, miRNA-21) is thus a fundamental epigenetic mechanism increasing lactation-specific gene transcription thereby enhancing lactation performance as well as milk yield in domestic animals. [score:3]
In comparison to nonlactating mammary glands of the Chinese swamp buffalo, the expression of miRNA-148a among other lactation-related miRNAs significantly increased during lactation [107]. [score:3]
The medium-to-cell expression ratio of miRNA-148a was significantly elevated in these DIP -treated bovine MECs, suggesting extracellular secretion of miRNA-148a into the culture medium after hormonal stimulation of lactation [117]. [score:3]
Intriguingly, the expression of miRNA-148a was significantly elevated by DIP treatment in bovine MEC culture medium [117]. [score:3]
Zhang J. Ying Z. Z. Tang Z. L. Long L. Q. Li K. MicroRNA-148a promotes myogenic differentiation by targeting the ROCK1 gene J. Biol. [score:2]
Chen Z. Luo J. Sun S. Cao D. Shi H. Loor J. J. miR-148a and miR-17-5p synergistically regulate milk TAG synthesis via PPARGC1A and PPARA in goat mammary epithelial cells RNA Biol. [score:2]
Hu C. W. Tseng C. W. Chien C. W. Huang H. C. Ku W. C. Lee S. J. Chen Y. J. Juan H. F. Quantitative proteomics reveals diverse roles of miR-148a from gastric cancer progression to neurological development J. Proteome Res. [score:2]
In goat MECs, miRNA-148a and miRNA-17-5p have been shown to synergistically increase milk triacylglycerol synthesis via regulation of PPARGC1A and PPARA. [score:2]
In this regards, milk-miRNA-148a and miRNA-29b -mediated DNMT suppression resulting in DNA demethylation features just the opposite epigenetic signaling compared to metformin -induced DNA methylation. [score:2]
Xu Q. Jiang Y. Yin Y. Li Q. He J. Jing Y. Qi Y. T. Xu Q. Li W. Lu B. A regulatory circuit of miR-148a/152 and DNMT1 in modulating cell transformation and tumor angiogenesis through IGF-IR and IRS1 J. Mol. [score:2]
Intruigingly, a recent study provided evidence that genome-wide miRNA binding site variation between extinct wild aurochs and modern cattle identifies candidate miRNA-regulated domestication genes including MIR148a [111]. [score:2]
Taken together, miRNA-148a, the most abundant miRNA of milk, is epigenetically involved in the differentiation of Tregs, adipogenesis, myogenesis and osteogenesis. [score:1]
miRNA-148a, miRNA-148b, and miRNA-152 are three members of the miRNA-148/152 family that share substantial homology in their seed sequence. [score:1]
It should be noticed that in contrast to fermented milk, nonfermented milk contains higher amounts of bioactive miRNAs including miRNA-148a, the most abundant miRNA of cow’s milk [63]. [score:1]
It has been reported that miRNA-148a-3p levels increased after homogenization and thus pressure -induced dispersion of MFGs [130]. [score:1]
Intriguingly, recent evidence links miRNA-148a to the promotion of LNCaP prostate cell growth [334]. [score:1]
Notably, miRNA-148a is highly expressed in human and bovine milk fat [49, 130] and has been measured in substantial amounts in bovine skim milk and human milk exosomes [43]. [score:1]
Milk-derived miRNA-148a and miRNA-21 are critically involved in adipogenesis. [score:1]
Muroya et al. [117] reported that elevated miRNA-148a levels in DIP -treated bovine MECs are associated with their increase in milk during the bovine lactation period. [score:1]
It is of critical importance to appreciate that the nucleotide seeding sequences of miRNA-148a-3p, miRNA-21-5p, and miRNA-29b-1-3p of Homo sapiens and Bos taurus are identical (mirbase. [score:1]
The addition of cow milk as an exogenous source of miRNA-148a to LNCaP prostate cancer cells in vitro stimulated PCa cell growth producing an average increase in growth rate of over 30% [335]. [score:1]
Taken together, cow’s milk transfers obesogenic and orexigenic miRNAs, predominantly miRNA-148a and miRNA-21, that maintain an epigenetic status that is intimately involved in the pathogenesis of diabesity. [score:1]
miRNA-148a-3p is by far the most abundant miRNA detected in human milk, bovine colostrum and bovine mature milk, porcine colostrum and porcine mature milk [37, 40, 41, 43, 130]. [score:1]
Thus, milk-derived miRNA-148a loaded exosomes may substitute miRNA-148a deficiency in colorectal adenoma cells thereby preventing their further progression to CRC. [score:1]
miRNA-148a is not only involved in adipogenesis but also enhances myogenic differentiation. [score:1]
Exosomal milk-derived miRNA-148a and miRNA-21 may thus provide oncogenic signals inducing an epigenetic landscape for tumorigenesis maintained by the consumption of cow’s milk in the majority of cancers except CRC. [score:1]
It is thus conceivable that milk-derived exosomal miRNA-148a and miRNA-29 support the epigenetic program of myogenesis. [score:1]
It is possible that MFGs of nonpasteurized cow’s milk release miRNA-148a carried in crescent exosomes [52]. [score:1]
One of the five most abundant exosomal miRNAs isolated from bone marrow derived mesenchymal stem cells, which is involved in osteogenic differentiation, is miRNA-148a [270]. [score:1]
In this regard, milk-derived exosomal miRNA-148a may promote epidermal proliferation as well as proliferation of other EGFR -dependent cells (Table 4) [279]. [score:1]
[1 to 20 of 64 sentences]
9
[+] score: 180
In conclusion, the present study identified S1PR1 as a direct target of miR-148a in hepatocellular carcinoma cells, and suggested that miR-148a plays a suppressive role in the regulation of hepatocellular carcinoma cell invasion, at least partially through the direct downregulation of S1PR1 expression. [score:13]
In addition, the suppressive effect of miR-148a upregulation on cell invasion was reversed by S1PR1 overexpression. [score:8]
As shown in Fig. 4, the upregulation of miR-148a and inhibition of S1PR1 notably inhibited HepG2 cell invasion. [score:8]
In the present study, the expression level of miR-148a was shown to be notably reduced in hepatocellular carcinoma tissues and cells compared with that in normal tissues; however, the protein expression of S1PR1 was markedly upregulated. [score:7]
Accordingly, the present data suggest that miR-148a is downregulated whereas S1PR1 is upregulated in hepatocellular carcinoma. [score:7]
The inhibition of S1PR1 expression in HepG2 cells was used to determine whether miR-148a played a suppressive role in hepatocellular carcinoma cell invasion. [score:7]
miR-148a is downregulated and S1PR1 is upregulated in hepatocellular carcinoma tissues and cells. [score:7]
For instance, the expression level of miR-148a was reduced in gastric cancer tissues and cell lines, and it could regulate various target genes and pathways involving tumor proliferation, invasion and metastasis (10). [score:6]
Consistently, the expression of miR-148a was downregulated in the hepatocellular carcinoma HepG2 cells. [score:6]
Gailhouste et al (14) demonstrated that miR-148a exerted its tumor-suppressive effect by directly targeting the c-Met oncogene. [score:6]
In the present study, it was also found that miR-148a upregulation had an inhibitory effect on hepatocellular carcinoma HepG2 cell invasion. [score:6]
The findings showed that the protein level of S1PR1 was significantly reduced following the upregulation of miR-148a but was increased in HepG2 cells transfected with miR-148a inhibitor (Fig. 3B). [score:6]
Deregulation of miR-148a has additionally been shown to affect the poor prognosis of hepatocellular carcinoma, associated with the overexpression of ubiquitin-specific protease 4, an identified target of miR-148a (9). [score:6]
miR-148a has also been found to suppress the epithelial-mesenchymal transition and metastasis of hepatocellular carcinoma cells by targeting Met/Snail signaling (13, 14). [score:5]
In addition, the current study suggested that the suppressive effect of miR-148a on hepatocellular carcinoma cell invasion is, at least partly, via the inhibition of S1PR1. [score:5]
Further investigation identified S1PR1 as a direct target of miR-148a, and the protein expression of S1PR1 was negatively regulated by miR-148a in hepatocellular carcinoma cells. [score:5]
It was found that overexpression of miR-148a led to a notable inhibition of the invasive properties of hepatocellular carcinoma cells, whereas silencing of miR-148a promoted hepatocellular carcinoma cell invasion (14). [score:5]
Recently, Gailhouste et al (14) showed that miR-148a could promote the hepatospecific phenotype, and acted as a tumor suppressor by targeting the c-Met oncogene. [score:5]
To verify whether S1PR1 was a direct target of miR-148a, the wild and mutant types of S1PR1 3′-UTR were generated. [score:4]
According to these and the current findings, we suggest that deregulation of miR-148a is involved in the development and progression of hepatocellular carcinoma; however, the detailed role of miR-148a in hepatocellular carcinoma, particularly the molecular regulatory mechanism, remains to be fully elucidated. [score:4]
S1PR1 expression is negatively regulated by miR-148a at a transcriptional level in hepatocellular carcinoma cells. [score:4]
It was found that miR-148a was the only downregulated miRNA in hepatoblastoma tissues (17). [score:4]
To further investigate the role of miR-148a in the regulation of S1PR1 expression in hepatocellular carcinoma cells, HepG2 cells were transfected with scrambled miRNA, miR-148a mimics and miR-148a inhibitor, respectively. [score:4]
These findings indicate that miR-148a plays a negative role in the regulation of S1PR1 expression at a post-transcriptional level in hepatocellular carcinoma cells. [score:4]
S1PR1 is a direct target of miR-148a. [score:4]
Firstly, the expression level of miR-148a in hepatocellular carcinoma tissues, their matched adjacent normal tissues and hepatocellular carcinoma HepG2 cells was examined. [score:3]
S1PR1 acts as a downstream effector in the miR-148a -induced inhibition of hepatocellular carcinoma cell invasion. [score:3]
In the present study, S1PR1 was found to be involved in the miR-148a -mediated inhibition of hepatocellular carcinoma invasion. [score:3]
Among these miRNAs, miR-148a has been demonstrated to act as a tumor suppressor in several types of cancer, including gastric, non-small cell lung and colorectal cancer (10– 12). [score:3]
For miR-148a functional analysis, the HepG2 cells were transfected with the scrambled miRNA as a negative control, miR-148a mimics or miR-148a inhibitor (Invitrogen Life Technologies). [score:3]
Furthermore, it was shown that S1PR1 was an important downstream effector of the miR-148a -induced inhibition of cell invasion in hepatocellular carcinoma HepG2 cells. [score:3]
As shown in Fig. 2B, the luciferase activity was significantly reduced in HepG2 cells co -transfected with the wild-type 3′-UTR of S1PR1 and miR-148a mimics, but unchanged in HepG2 cells co -transfected with the mutant S1PR1 3 UTR and miR-148a mimics, indicating that miR-148a directly binds to the 3′-UTR of S1PR1 in HepG2 cells. [score:2]
As shown in Fig. 1A, the expression level of miR-148a in the hepatocellular carcinoma tissues was significantly reduced compared with that in the normal tissues. [score:2]
The present study aimed to explore the role of miR-148a in the regulation of hepatocellular carcinoma cell invasion. [score:2]
Deregulation of miRNAs, such as miR-204, miR-331, miR-125b, miR-148b and miR-148a, has been demonstrated to play an important role in hepatocellular carcinoma (5– 9). [score:2]
In the present study, the expression level of miR-148a was shown to be notably reduced in hepatocellular carcinoma tissues and cells compared with that in normal tissues. [score:2]
Following the study by Magrelli et al (17), Yuan et al (18) suggested that miR-148a may be associated with hepatitis-B-virus -associated hepatocellular carcinoma. [score:1]
Furthermore, it was determined whether sphingosine-1-phosphate receptor 1 (S1PR1) acted as a downstream effector of miR-148a in hepatocellular carcinoma cells. [score:1]
org/) and the findings showed that the putative seed sequences for miR-148a at the 3′-UTR of S1PR1 were highly conserved (Fig. 2A). [score:1]
miR-148a may, therefore, serve as a potential therapeutic agent for hepatocellular carcinoma. [score:1]
Once HepG2 cells were cultured to ~70% confluence, they were transfected with psiCHECK™-2-S1PR1-3-UTR or psiCHECK™-2-mutant S1PR1-3-UTR vector, with or without 100 nM miR-148a mimics. [score:1]
HepG2 cells were transfected with miR-148a mimics or S1PR1-specific siRNA or co -transfected with miR-148a mimics and S1PR1 plasmid. [score:1]
[1 to 20 of 42 sentences]
10
[+] score: 166
Other miRNAs from this paper: hsa-mir-152, hsa-mir-148b, hsa-mir-489
SPIN1, which is direct target of miR-148a-5p/148b-5p/152-5p, promotes chemoresistance via upregulating ABCB4, CYP2C8, UGT2B4 and UGT2B17As for the drug metabolizing enzymes and transporter, we observed a positive relationship between mRNA expression of SPIN1 and ABCB4, CYP2C8, UGT2B4 and UGT2B17 in the xenograft tumors (Fig.   5g-j). [score:9]
In conclusion, we have presented evidence that SPIN1, a novel target of the miR-148/152 family, is upregulated in drug-resistant breast cancer cells and tissues and confers Adriamycin resistance by upregulating drug metabolizing enzymes and transporter in breast cancer. [score:9]
SPIN1, which is direct target of miR-148a-5p/148b-5p/152-5p, promotes chemoresistance via upregulating ABCB4, CYP2C8, UGT2B4 and UGT2B17 As for the drug metabolizing enzymes and transporter, we observed a positive relationship between mRNA expression of SPIN1 and ABCB4, CYP2C8, UGT2B4 and UGT2B17 in the xenograft tumors (Fig.   5g-j). [score:9]
We further investigated the miR-148/152 family -mediated SPIN1 suppression and found that expression of the SPIN1 protein was significantly downregulated in miR-148/152 overexpressing MCF-7 and MDA-MB-231 cells (Fig.   4c-d). [score:8]
SPIN1 was directly targeted and suppressed by the miR-148/152 familyMicroRNAs (miRNAs) are critical gene regulators and chemotherapy modifiers in different tumor types [27]. [score:7]
Our results establish that SPIN1, negatively regulated by the miR-148/152 family, enhances Adriamycin resistance in breast cancer via upregulating the expression of drug metabolizing enzymes and drug transporter. [score:7]
j-l Data from MIRUMIR and miRpower showed that breast cancer patients with low expression of miR-148a, miR-148b or miR-152 had shorter survival time than those with high expression Our results showed the chemoresistant MCF-7/ADM cells exhibited lower miR-148a-3p, miR-148b-3p and miR-152-3p expression levels compared with chemosensitive MCF-7 cells (Fig.   4e). [score:6]
SPIN1 was directly targeted and suppressed by the miR-148/152 family. [score:6]
Interestingly, downregulation of SPIN1 protein is significative after overexpression of miR-148a-3p in particular (Fig.   4c-d). [score:6]
f Expression of miR-148a-3p (r = − 0.7478, P = 0.0162), miR-148b-3p (r = − 0.6524, P = 0.0473) or miR-152-3p (r = − 0.8512, P = 0.0032) were inversely related with SPIN1 protein expression. [score:5]
Moreover, expression levels of the miR-148/152 family were inversely related with SPIN1 mRNA (Fig.   5a-c) and protein (Fig.   5d-f) expression. [score:5]
In addition, high expression of SPIN1 or low expression of the miR-148/152 family predicts poorer survival in patients with breast cancer. [score:5]
SPIN1 expression in breast cancer cells and miR-148a-3p/148b-3p/152-3p expression in xenograft tumors. [score:5]
a-c Expression levels of miR-148a-3p, miR-148b-3p or miR-152-3p were inversely related with SPIN1 mRNA expression in MCF-7/ADM xenograft tumors (n = 20). [score:5]
In order to validate the miR-148/152 –SPIN1 –downstream effectors axis in vivo, we established an MCF-7/ADM derived xenograft tumor mo del, by suppressing SPIN1 expression [11]. [score:5]
Moreover, high expression of SPIN1 or low expression of the miR-148/152 family predicted poorer survival in breast cancer patients. [score:5]
SPIN1 is identified as a novel target of the miR-148/152 family and enhances Adriamycin resistance by regulating drug metabolizing enzymes and transporter CYP2C8, UGT2B4, UGT2B17 and ABCB4 in breast cancer (Fig.   5i). [score:4]
Notably, SPIN1 was identified as a direct target of the miR-148/152 family (miR-148a-3p, miR-148b-3p and miR-152-3p). [score:4]
Mechanistically, the miR-148/152 family could directly target SPIN1 and increase Adriamycin sensitivity in breast cancer cells. [score:4]
MiR-148a inhibits breast cancer migration, invasion and angiogenesis by suppressing WNT-1 [39], MMP-13 [42], ERBB3 [43]. [score:4]
b The relative luciferase activity was significantly reduced in the miR-148a/148b/152-3p overexpressing cells ([*] P < 0.05) and these effects could be abolished by mutation of SPIN1 3’-UTR. [score:4]
Analysis on the xenograft tumors showed that expression of miR-148a-3p, miR-148b-3p or miR-152-3p was positively intercorrelated (Additional file 1: Figure S2). [score:3]
e The expression levels of miR-148a-3p, miR-148b-3p and miR-152-3p were lower in MCF-7/ADM cells than that in MCF-7 cells. [score:3]
from the web-tool miRpower [33] showed that breast cancer patients with low expression of miR-148a had shorter survival time (METABRIC dataset, n = 1262, P = 0.00054). [score:3]
And here we further showed that SPIN1 was also targeted by three members (miR-148a/148b/152-3p) of the miR-148/152 family [38]. [score:3]
The correlation between miR-148/152 family, SPIN1, and ABCB4/CYP2C8/UGT2B4/UGT2B17 expression was determined by Spearman’s correlation. [score:3]
Here we found that miR-148-3p, miR-148b-3p and miR-152-3p were downregulated in Adriamycin-resistant MCF-7/ADM cells compared with the parental MCF-7 cells. [score:3]
c-d The SPIN1 protein expression was clearly reduced after the transfection of miR-148a-3p, miR-148b-3p or miR-152-3p. [score:3]
By luciferase assay, we observed a significant suppression of luciferase activity in cells transfected with miR-148a-3p, miR-148b-3p or miR-152-3p (Fig.   4a-b). [score:2]
On the contrary, when the binding sites of these three miRNAs in the SPIN1 pmirGLO-3’UTR were mutated, its responsiveness to miR-148a-3p, miR-148b-3p or miR-152-3p regulation was abrogated (Fig.   4b). [score:2]
Of the candidates, the miR-148/152 family (miR-148a-3p, miR-148b-3p and miR-152-3p), was of particular interest in light of its reported roles in regulating drug sensitivity of cancer cells [28– 30]. [score:2]
l A schematic mo del of miR-148/152–SPIN1–ABCB4/CYP2C8/UGT2B4/UGT2B17 regulation of breast cancer chemoresistance. [score:2]
Transfection of miR-148a-3p, miR-148b-3p or miR-152-3p resulted in a significant decrease in survival of MCF-7/ADM and MCF-7 cells in Adriamycin-added medium (Fig.   4f-i). [score:1]
Furthermore, we determined the prognostic value of the miR-148/152 family using publicly available data. [score:1]
Fig. 5Validation of the miR-148/152–SPIN1–ABCB4/CYP2C8/UGT2B4/UGT2B17 signaling in xenograft tumors. [score:1]
Our study demonstrated a newly-identified involvement of the miR-148/152 family in breast cancer Adriamycin resistance and further study is underway to confirm this in clinical samples. [score:1]
The pmirGLO vector (Promega) was used to construct the recombinant plasmid pmirGLO- SPIN1 containing the SPIN1 mRNA 3’-UTR fragments which possess binding sites of miR-148a-3p, miR-148b-3p and miR-152-3p [11]. [score:1]
However, the function and mechanism of the miR-148/152 family in breast cancer chemoresistance have not yet been reported. [score:1]
f-g Transfection of miR-148a-3p, miR-148b-3p, miR-152-3p, or cotransfection of these three miRNAs significantly increased the miRNAs levels. [score:1]
As expected, miR-148a-3p, miR-148b-3p or miR-152-3p could increase Adriamycin sensitivity in breast cancer cells in vitro. [score:1]
The miR-148/152 family decreased Adriamycin resistance in breast cancer cells and was associated with patients’ survival. [score:1]
Moreover, a microarray analysis by Kovalchuk et al. found that two members (miR-148a and miR-152) of the family displayed more than 370-fold decreases in MCF-7/ADM cells versus MCF-7 cells [31], further indicating their possible involvement in breast cancer chemoresistance. [score:1]
a The 3’-UTR element of SPIN1 mRNA is partially complementary to miR-148a-3p, miR-148b-3p and miR-152-3p. [score:1]
Breast cancer Adriamycin resistance SPIN1 miR-148/152 Drug metabolizing enzymes Drug transporter Chemoresistance is a major obstacle for effective breast cancer chemotherapy [1]. [score:1]
Validation of the miR-148/152–SPIN1–ABCB4/CYP2C8/UGT2B4/UGT2B17 signaling axis in xenograft tumors. [score:1]
Moreover, analysis of publicly available data revealed that the miR-148/152 family was associated with patients’ survival in breast cancer. [score:1]
h-i miR-148a-3p, miR-148b-3p and miR-152-3p decreased Adriamycin resistance in MCF-7/ADM and MCF-7 cells. [score:1]
[1 to 20 of 47 sentences]
11
[+] score: 159
When both binding sites were functional miR-148 downregulated reporter gene expression to 50–60% compared to expression from the vector alone in 501mel cells (p = 0.0140) (Fig. 3A). [score:7]
P-values are: miR-148a expression in 501mel  = 0.0940 and in MeWo  = 0.0148. miR-148b expression in 501mel  = 0.0023 and in MeWo  = 0.0065. miR-152 expression in 501mel  = 0.0054 and in MeWo =  0.9316. [score:7]
However, when the 148/152B binding site was mutated, miR-148 was no longer able to downregulate reporter gene expression (p = 0.3929). [score:6]
When the 148/152A binding site was mutated, miR-148 downregulated reporter gene expression to 47% (p = 0.0049). [score:6]
These results indicate that miR-148 is able to downregulate Mitf expression by binding to the 148/152B binding site. [score:6]
Higher endogenous expression in HEK293 cells might explain why transfected miR-148 had no effect on reporter gene expression in HEK293 cells, except at the highest concentration. [score:5]
miR-148 and affect expression of the endogenous MITF In order to test if these miRNAs affect the level of endogenous MITF mRNA in melanoma cells, we used qRT-PCR to determine MITF mRNA expression after transfecting MeWo melanoma cells with the miRNAs miR-124, and miR-148. [score:5]
Of these potential target genes, 66 are common targets of both and miR-148. [score:5]
The microRNAs and miR-148 have many other potential target genes according to online prediction programs (Targetscan). [score:5]
Expression of miR-152 in 501mel was 2.7 fold lower than in HEK293 cells and was much lower then the expression of miR-148a and miR-148b in all cell types (see Table 2). [score:5]
Low expression of miR-148a, 148b and 152 in the melanoma cell lines is therefore consistent with the relatively high level of MITF expression in these cells. [score:5]
Simultaneous transfection with and miR-148 did not result in further effects on MITF expression as it reduced expression to 67% (Cp value 22.3, p = 0.0051), which is similar to the reduction seen with alone (Fig. 4A). [score:5]
miR-148 expression has been shown to be downregulated in tissue samples from undifferentiated gastric cancer compared to normal tissue [49]. [score:5]
The microRNAs miR-148a and miR-148b have similar expression levels in all the cell types tested. [score:3]
Similarly, the effects of and miR-148 on endogenous MITF mRNAs are inhibited when MeWo cells were co -transfected with anti-miRNAs (Fig. 5B). [score:3]
miR-148 affected reporter gene expression more significantly in 501mel cells. [score:3]
miR-148 has 536 conserved targets, with a total of 581 conserved sites and 134 poorly conserved sites. [score:3]
0011574.g006 Figure 6. Expression of endogenous miRNAs miR-148a, miR-148b and miR-152 in HEK293, 501mel and MeWo cells. [score:3]
The mutations are shown in Fig. 1C and the primers used for mutagenesis in Table 1. There are two target sites for miR-148/152 in the mouse Mitf 3′UTR sequence. [score:3]
miR-148 and affect expression of the endogenous MITF. [score:3]
There are two target sites for miR-148/152 in the mouse Mitf 3′UTR sequence. [score:3]
Consistent with previous results, cells simultaneously transfected with the luciferase vector construct, the miR-148 and the anti-miR-148 showed that the anti-miR148 molecule effectively inhibited the effects of miR-148 (Fig. 5A). [score:3]
In 501mel cells, miR-148 had significant effects on expression of the mouseMitf-3′UTR-luciferase reporter (Fig. 2A). [score:3]
The mutations are shown in Fig. 1C and the primers used for mutagenesis in Table 1. There are two target sites for miR-148/152 in the mouse Mitf 3′UTR sequence. [score:3]
Role of the miR-148/152 target sites. [score:3]
This indicates a possible negative feedback loop where higher amounts of MITF would lead to more miR-148 expression which in turn adjusts MITF protein at desirable levels. [score:3]
Expression of endogenous miRNAs miR-148a, miR-148b and miR-152 in HEK293, 501mel and MeWo cells. [score:3]
In order to test if these miRNAs affect the level of endogenous MITF mRNA in melanoma cells, we used qRT-PCR to determine MITF mRNA expression after transfecting MeWo melanoma cells with the miRNAs miR-124, and miR-148. [score:3]
It has not been shown previously that miR-148 and/or miR-152 can target Mitf. [score:3]
of anti-miR-148 and miR-148 simultaneously with the Mitf-3′UTR-luciferase vector inhibits the effect of miR-148. [score:3]
A. of anti-miR-148 and miR-148 simultaneously with the Mitf-3′UTR-luciferase vector inhibits the effect of miR-148. [score:3]
A. Expression of human MITF mRNA in MeWo cells transfected with miR-124,, miR-148 or and miR-148 combined. [score:3]
The effects of and miR-148 when transfected seperatly, are blocked when the cells are transfected with and miR-148 inhibitors. [score:3]
These results show that the and miR-148 have the same effects on expression of the endogenous MITF gene as seen using the luciferase reporter assay. [score:2]
In melanoma cells, Mitf is regulated by and miR-148/152. [score:2]
We show that and miR-148 negatively affect Mitf mRNA in melanoma cells through conserved binding sites in the 3′UTR sequence. [score:1]
Combining both and miR-148 did not result in added effects on endogenous MITF mRNA levels. [score:1]
anti-microRNA where purchased from Ambion and are the following: anti-miR-137 (Product ID: AM10513) and anti-miR-148 (Product ID: AM10263). [score:1]
A. The line indicates the 3′ UTR region of the mouse Mitf gene, including the coding region of exon 9. Potential binding sites for miR-27, miR-124/506, miR-25/32/92/363/367, miR-148/152, and miR-101/144 in the mMitf 3′UTR sequence are indicated below the line and potential PAS sites above. [score:1]
Black bars: miR-124/506 binding sites, dark grey bars: binding sites, light grey bars: miR-148/152 binding sites, white bars: miR-27, miR-25/32/92/363/367 and miR-101/144. [score:1]
In the case of one of the miR-148 binding site, 148/152A, only 4 bases were mutated as a clone with the fully mutated binding site was not generated successfully. [score:1]
miR-148/152 affects mMitf RNA in melanoma cells. [score:1]
We tested the effects of microRNAs which have conserved binding sites in the 3′UTR region of Mitf, including miR-27a (located at 229–235 in the mouse Mitf 3′UTR sequence), miR-25/32/92/363/367 (1491–1497), miR-101/144 (3023–3029), miR-124/506 (1639–1646) and miR-148/152 (1674–1680 and 2931–2937) (Fig. 1A and 1B). [score:1]
When the 148/152B binding sites were mutated, the effects of miR-148 were eliminated. [score:1]
The roles of and miR-148 were analysed further by mutating the binding sites in the mouseMitf-3′UTR-luciferase reporter construct. [score:1]
A. Effects of miR-148 on the mouseMitf-3′UTR-luciferase reporter when the potential binding sites are mutated. [score:1]
The 3′UTR sequences of Mitf in 11 vertebrate species all contain the two conserved miR-148/152 binding sites. [score:1]
miR-148/152 affects mMitf RNA in melanoma cellsTo test the functionality of the miRNA binding sites, the mouse Mitf 3′UTR sequence was cloned downstream of a luciferase reporter gene. [score:1]
When the cells were transfected with either, miR-148 or simultaneously with both and miR-148, MITF protein levels were reduced. [score:1]
and are the following: hsa-miR-27a (Product ID:PM10939), hsa-miR-32 (Product ID:PM10124), hsa -miR-101 (Product ID:PM10537), mmu-miR-124a (Product ID:PM10691), mmu-miR-137 (Product ID: PM10513), hsa-miR-148a (Product ID:PM10263), hsa-miR-182. [score:1]
B. analysis on MITF protein levels in MeWo cells, when transfected with miR-124,, miR-148 or and miR-148 combined. [score:1]
Similarly, hypermethylation of the miR-148, 124a3 and miR-152 genes was found in 34-86% of primary human breast cancer specimens [50]. [score:1]
miR-148 affected the reporter only when transfected at the highest concentration (1pmol) (Fig. 2B). [score:1]
ND (1/9) ND (0/9) 34.69 (7/9) 37.39 (1/3) miR-124 34.37 (9/9) 34.73 (5/9) 35.09 (2/9) 32.68 (3/3) miR-506 35.19 (2/9) 34.73 (3/9) 32.87 (9/9) ND (0/9) miR-148a 27.90 (9/9) 28.29 (9/9) 28.82 (9/9) 33.12 (3/3) miR-148b 28.37 (9/9) 28.65 (9/9) 29.37 (9/9) 35.19 (1/3) miR-152 34.08 (9/9) 35.12 (9/9) 34.26 (9/9) 35.05 (2/3) miR-16 contr. [score:1]
and miR-148 both led to reduced levels of MITF mRNA and protein. [score:1]
miR-148 and miR-152. [score:1]
P-values are: Scramble  = 0.0396; miR-124 = 0.2228; = 0.0069; miR-148 = 0.0051;+148 = 0.0051. [score:1]
The p-values are; miR-neg  = 0.14 miR-148 = 0.007, miR-148+anti-miR-148 = 0.119. [score:1]
[1 to 20 of 58 sentences]
12
[+] score: 159
In HCC patients, miR-148a overexpression was found to suppress cell invasion and affects prognosis by directly targeting sphingosine-1-phosphate receptor 1(S1PR1) [40, 41]. [score:8]
Downregulated miR-148a expression was found in gastric tumor compared with non-neoplastic mucosa, and this was correlated with advanced tumor invasiveness and poor prognosis by targeting MMP7 [35]. [score:7]
Kim et al also found that miR-148a acted as a tumor suppressor and holds vital potential for renal carcinoma therapy by directly targeting Rab14 [43]. [score:6]
A total of 8 independent studies reported DFS/RFS/PFS analysis and revealed a protective significance of upregulated miR-148/152 family expression in multiple human neoplasms (HR=0.37, 95% CI: 0.16-0.88; Figure 2B). [score:6]
The miR-148/152 family consists of three highly homologous members (miR-148a, miR-148b, and miR-152), of which ectopic expression was observed in multiple diseases such as: atherosclerosis, diabetes, and cancers [13– 15]. [score:5]
Similar outcomes of DFS/RFS/PFS analysis in ethnic subgroups was observed that aberrant miR-148/152 expression contributed to favorable disease progression in Asian population (HR=0.21, 95% CI: 0.06-0.81), but not in Caucasian (HR=0.76, 95% CI: 0.31-1.87). [score:5]
Inhibition of miR-148a might promote DNA hypermethylation in case of the overexpression of DNMT1 [44]. [score:5]
For instance, Qiu et al reported that miR-148a expression was down-regulated in gastric tumor tissues compared with non-tumor tissues. [score:5]
He et al verified that miR-148a inhibited NSCLC cell proliferation and invasion activity through silencing signal transducer and activator of transcription 3 (STAT3), which highlighted miR-148a/STAT3 axis as a potential target for clinical treatment with NSCLC patients [42]. [score:5]
Ma et al confirmed that miR-148a high expression was an independent indicator for unfavorable overall survival and disease-specific survival, respectively [39]. [score:5]
In addition, up-regulated miR-148/152 family correlated with superior OS/CSS in Asian (HR=0.53, 95% CI: 0.44-0.64) than that in Caucasian population (HR=0.96, 95% CI: 0.82-1.13; Figure 3C). [score:4]
In stratified analysis, we found that upregulated miR-148/152 family predicted superior OS/CSS in Asian (HR=0.53, 95% CI: 0.44-0.64), but analysis in Caucasian population failed to obtain the significance (HR=0.96, 95% CI: 0.82-1.13). [score:4]
Previous studies have confirmed that down-regulation of miR-148/152 family is associated with unfavorable survival and prognostic outcomes of patients with malignancies [32– 34]. [score:4]
Besides, DNMT1 was conversely associated with miR-148a/152 expression, which highlighted a potential miR-148a/152-DNMT1 regulatory framework might exist in breast cancer [45]. [score:4]
Results from OS/CSS analysis indicated that up-regulated miR-148/152 family could predict favorable outcomes with a pooled HR of 0.63 (95% CI: 0.54-0.74). [score:4]
Admittedly, miR-148a, miR-148b, and miR-152 are the three members of the miR-148/152 family with the same seed sequence, of which are pivotal for binding to target mRNAs. [score:3]
Zhu et al found that DNMT1 overexpression inactivated miR-148a by hypermethylation of DNA in gastric cancer. [score:3]
In a breast cancer study, Xu et al that high DNMT1 expression was responsible for hypermethylation of miR-148a and miR-152 promoters. [score:3]
Our analyses indicated that high expression of miR-148/152 family could significantly predict a favorable OS/CSS for various human carcinomas, with a combined HR of 0.63 (95% CI: 0.54-0.74, Figure 2A). [score:3]
Stratified analyses indicated that miR-148/152 overexpression was a significant prediction for tumor recurrence and progression in tissues (HR=0.11, 95% CI: 0.01-0.98) but not in plasma/serum (HR=0.67, 95% CI: 0.38-1.18; Figure 4D). [score:3]
Thirdly, a recognized miR-148/152 expression level could hardly to achieve even the majority of articles regarded the median/mean points as the cut-off value. [score:3]
In ethnic subgroups, our analysis suggested that high miR148/152 expression correlated with favorable DFS/RFS/PFS in Asian population (HR=0.21, 95% CI: 0.06-0.81), but failed to obtain a significant consequence in Caucasian (HR=0.76, 95% CI: 0.31-1.87; Figure 4C). [score:3]
Ma et al detected the decreased miR-148a level in bladder carcinoma specimens and reduced miR-148a expression correlated with shorter survival time and increased recurrence risk [20]. [score:3]
A total of 267 studies from published database PubMed, EMBASE, and the Web of Science were identified to focus on the association between miR-148/152 family expression and multiple human malignancies. [score:3]
Additionally, the pooled outcome in the DFS/RFS/PFS analysis indicated that increased miRNA-148/152 expression is predictive of slower cancer progression (HR=0.37, 95% CI: 0.16-0.88). [score:3]
Tumor progression associated with miR-148/152 expression. [score:3]
In addition, Wang et al detected the circulating miR-148a, miR-148b, and miR-152 and revealed that loss of miR-148a expression independently predicted a shorter overall time in patients with HCC than miR-148b and miR-152 [37]. [score:3]
In analysis of microRNA subgroups, our results demonstrated that miR-148a and miR-148b promoted favorable OS/CSS (HR=0.76, 95% CI: 0.69-0.90) and (HR=0.49, 95% CI: 0.39-0.61), nevertheless abnormal miR-152 expression exerted no statistical significance (HR=0.40, 95% CI: 0.12-1.29). [score:3]
Results from subgroups suggested that miR-148a and miR-148b exerted enhanced OS/CSS, with a pooled HR of 0.76 (95% CI: 0.69-0.90) and 0.49 (95% CI: 0.39-0.61), while abnormal miR-152 expression developed no statistical impact (HR=0.40, 95% CI: 0.12-1.29; Figure 3A). [score:3]
Forest plots of pooled analyses associated with miR-148/152 family expression. [score:3]
In summary, this meta-analysis demonstrates that miR-148/152 overexpression can significantly predict favorable prognostic outcomes in diverse human neoplasms, particularly in Asian population and tissues specimens. [score:3]
Patients survival associated with miR-148/152 expression. [score:3]
The majority of studies have considered miR-148/152 family as a tumor suppressor and exerted anti-tumor effect in human neoplasms [16– 18]. [score:2]
Besides, miR-148a/b are promising biomarkers for predicting patients overall outcomes than miR-152. [score:1]
miR-148a, microRNA-148a; miR-148b, microRNA-148b; miR-152, microRNA-152. [score:1]
Considering the limitation of study scale, we sought to carry out this meta-analysis to summarize available findings and clarify the predictive significance of miR-148/152 family in malignancies prognoses. [score:1]
As a member of miRNAs, miR-148/152 family have been reported to develop prognostic role in multiple carcinomas. [score:1]
In this meta-analysis, we first collected available data from published studies to assess the prognostic significance of miR-148/152 family in multiple human malignancies. [score:1]
In stratified analyses with cancer types, 6 studies reporting HCC and 3 reporting NSCLC indicated that miR-148/152 family were particularly associated with favorable OS/CSS (HCC: HR=0.5, 95% CI: 0.39-0.65; NSCLC: HR=0.43, 95% CI: 0.29-0.66; Figure 3B). [score:1]
In this meta-analysis, a significant heterogeneity was observed when we carried out OS/CSS analysis of miR-148/152 family, as well as comparison for DFS/RFS/PFS. [score:1]
Despite these controversial results, miR-148/152 family was still an attractive biomarker for considerable prognostic significance. [score:1]
The key points of the quality assessment included the following: (1) origin of country and definition of study population, (2) clear microRNA subtypes and carcinoma classifications, (3) the study design and cut-off value of miR-148/152 family, (4) detected samples and pathology, (5) description of outcomes and follow-up period of patients. [score:1]
To summarize, our meta-analysis indicated that detection of abnormal miR-148/152 family levels is of great significance in predicting prognosis of various human malignancies. [score:1]
Currently, miR-148/152 family members include miR-148a, miR-148b, and miR-152, of which the three share a common seeds sequence in domains [31]. [score:1]
Diverse prognostic values between miR-148a/b and miR-152 may attributed to different domains of the three, even though they possessed the same seed sequence. [score:1]
Evaluated expression of miR-148a significantly predicted favorable overall survival of patients with gastric cancer [19]. [score:1]
Based on these underlying mechanism, we concluded that miR-148/152 family in specific cancer category might induce particular biological behaviors. [score:1]
After a manual screening of titles and abstracts, 220 studies were excluded on account of the following reasons: review articles or letters, not human studies, unrelated to prognosis or outcomes, no relationship between miR-148/152 family and malignancies. [score:1]
Furthermore, miR-148/152 family was found to involved into DNA methylation by interacting with DNA methyltransferase enzyme 1 (DNMT1) in many malignancies types. [score:1]
Eligible studies to be included in this analysis should meet the following criteria: (1) studies exploring various human malignancies; (2) a relationship between miR-148/152 family and cancer prognosis. [score:1]
Therefore, consensus has not been reached to the reliability of miR-148/152 family as prognostic indicators in various human neoplasms. [score:1]
A literature search through online databases such as PubMed, Embase, and Web of Science were performed up to March 2017, using the following keywords (“microRNA-148a” or “miR-148a” or “microRNA-148b” or “miR-148b” or “microRNA-152” or “miR-152”) and (“cancer” or “carcinoma” or “Neoplasm” or “Tumor”) and (“prognostic” or “prognosis” or “survival” or “outcome” or “recurrence” or “relapse”). [score:1]
Furthermore, malignancies species also had a considerable impact on the prognostic role of miR-148/152 family. [score:1]
The observation of these oncogenic role of miR-148/152 family in multiple cancers might cast doubt on its dominant anti-tumor effects. [score:1]
Seven survival data from OS/CSS analysis indicated that miR-148/152 family play a vital role in overall survival for patients with HCC (HR=0.51, 95% CI: 0.39-0.65), revealing the independent value of miR-148/152 family in HCC [21, 34, 36, 48– 50]. [score:1]
Considering these limitations, the significance of miR-148/152 family as a prognostic indicator in multiple human malignancies might be overestimated. [score:1]
Quantitative real-time PCR (qRT-PCR) was wi dely used in all eligible studies to calculate miRNA-148/152 family expression. [score:1]
For instance, loss level of miR-148 was found to predict longer period of recurrence and favorable overall survival in esophageal adenocarcinoma patients [38]. [score:1]
The prognostic role of miR-148/152 family in human neoplasms may partly attributed to its underlying molecular mechanism, as well as dissimilar biological function. [score:1]
All of these might weaken the pooled results of meta-analysis and cannot explicitly states the prognostic status of miR-148/152 family. [score:1]
Other 4 studies demonstrated that miR-148/152 family exerted no significant function on OS/CSS in CRC patients (HR=0.77, 95% CI: 0.42-1.41; Figure 3B), and 2 studies with gastric cancer obtained a similar result (HR=0.58, 95% CI: 0.25-1.35; Figure 3B). [score:1]
Interesting, stratification analysis of different detected specimens suggested that miR-148/152 served as a significant indicator for tumor recurrence and progression in tissues (HR=0.11, 95% CI: 0.01-0.98) other than plasma/serum (HR=0.67, 95% CI: 0.38-1.18). [score:1]
[1 to 20 of 62 sentences]
13
[+] score: 157
Other miRNAs from this paper: hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-10a, hsa-mir-152, hsa-mir-148b
GLA also upregulated the expression of miR-148a in a dose -dependent manner, miR-148a, which could directly target Wnt-3′-untranslated regions (UTRs), and decreased the expression of Wnt1, leading to β-catenin accumulation in the membranes from the cytoplasm and nucleus. [score:13]
We found the up-regulation of miR-148a, the suppression of Wnt/β-catenin, and the down-regulation of VEGF. [score:9]
Other studies have clarified that miR-148a is significantly decreased in breast cancer cells associated with tumor angiogenesis, function as tumor suppressors to inhibit angiogenesis by targeting ERBB3 [12]. [score:7]
The potential tumor suppressors miR-148a and miR-152 are important for breast cancer cell proliferation, colony formation, and angiogenesis by targeting IGF-IR and IRS1 and inhibiting their downstream PI3K/AKT and MAPK/ERK signaling pathways [13]. [score:7]
In breast cancer cells, miR-148a inhibits tumor angiogenesis via targeting IGF-IR and IRS1 and suppressing their downstream AKT and MAPK/ERK signaling pathways [13]. [score:7]
After miR-148a knockdown, the downregulated protein level of Wnt1, non-phospho (active) β-catenin (Fig. 3b) and mRNA expression of Wnt1, LEF/TCF4 (Fig. 3c and d) induced by GLA were significantly further decreased, suggesting that GLA blocked the Wnt/β-catenin signal pathway through miR-148a. [score:7]
miR-148a knockdown resulted in the decrease of GLA -induced suppression of VEGF expression/secretion (Fig. 4a) and tube formation (Fig. 4b and c) in these cells. [score:6]
Recent studies suggest GLA can upregulate miR-148a, suppress the activation of TGF-β/SMAD2 signaling, and attenuate CSC-like functions in HCC and breast cancer cells [17, 22]. [score:6]
Besides, GLA contributed to the over -expression of miR-148a, which could directly target Wnt1, and promoted the localization in membranes in the cytoplasm and nucleus. [score:6]
The microRNA -inhibitor was used to knockdown microRNA-148a (miR-148a) expression. [score:6]
Downregulation of miR-148a contributed to the reduction of GLA -induced suppression of the Wnt/β-catenin signaling pathway, the angiogenesis and vascular endothelial grow factor (VEGF) secretion. [score:6]
Here, we explored the expression changes of four target genes of miR-148a (ERBB3, PKM2, IGF-IR and IRS1) in MDA-MB-231 cells followed by GLA addiction and silencing of miR-148a in Additional file 5: Figure S3. [score:5]
Our results further indicated that miR-148a -mediated inhibition of the Wnt/β-catenin signal pathway might be involved in GLA induced suppression of angiogenesis, and reduction of VEGF secretion (Additional file 4: Figure S2). [score:5]
Recent studies report that miR-148a is a novel microRNA that directly binds to the Wnt1 3′-UTR, to inhibit the epithelial-mesenchymal transition and cancer stem cell (CSC)-like properties of hepatocellular carcinomas (HCCs) [11]. [score:4]
[**] P < 0.01 and [***] P < 0.001 compared with the control cells A previous study suggested that miR-148a negatively regulated the epithelial to mesenchymal transition (EMT) and CSC-like properties of HCC by directly targeting Wnt1 [11]. [score:4]
Downregulation of miR-148a reversed GLA -induced intervention of the Wnt/β-catenin signal pathway, the angiogenesis, and VEGF secretion. [score:4]
Previous studies have shown that Wnt1 was a direct target of miR-148a [11]; however, little is known concerning the association of miR-148a with Wnt/β-catenin signaling during angiogenesis, so we aimed to uncover whether miR-148a was involved in the blockage of Wnt/β-catenin signaling. [score:4]
miR-148a can regulated various target genes and its corresponding pathways, which is related to cell proliferation [35], invasion and metastasis [36], and angiogenesis [12]. [score:4]
GLA attenuated angiogenesis by the suppression of miR-148a -mediated Wnt/β-catenin signaling pathway in two human breast cancer cell lines (MDA-MB-231 and Hs-578T). [score:3]
MiR-148a also modulates angiogenesis by directly targeting the M2 isoform of pyruvate kinase in mammary tumor cells [37]. [score:3]
MDA-MB-231 cells were pretreated with 0, or 20 μM GLA for 48 h, then the media was removed, the cells were washed with 1× PBS, followed by replacement with fresh media with 1% FBS for 24 h. (A)The expression of miR-148a was analyzed by qRT-PCR (mean ± SD, n = 3). [score:3]
Guo S, Peng Z, Yang X, Fan K, Ye H, Li Z, Wang Y, Xu X, Li J, Wang Y, et al. miR-148a promoted cell proliferation by targeting p27 in gastric cancer cells. [score:3]
We determined the role of miR-148a in breast cancer angiogenesis after transfecting anti-miR-148a into breast cancer cells and found that the decreased expression or secretion of VEGF was reversed, indicating that miR-148a had a negative effect on angiogenesis. [score:3]
While for the detection of miR-148a, U6 snRNA was regarded as an internal control to normalize expression. [score:3]
Fig. 3GLA attenuates the expression/activation of Wnt/β-catenin of breast cancer cells through miR-148a. [score:3]
Our study identified a molecular mechanism of the GLA inhibition of angiogenesis through the Wnt/β-catenin signaling pathway via miR-148a, suggesting that GLA could serve as an adjuvant chemotherapeutic agent for breast cancer. [score:3]
Growing evidence suggests that miR-148a is poorly expressed in various tumors, indicating that miR-148a can serve as a biomarker for diagnosis and prognosis [34]. [score:3]
In the present study, GLA increased the expression of miR-148a in breast cancer cells when exposed to 20 μM GLA for 48 h (Additional file 3: Figure S1B). [score:3]
In the following study, we hypothesized that in breast cancer cells, GLA partially inhibited angiogenesis through the Wnt/β-catenin signaling pathway and that miR-148a was involved in this process. [score:3]
MiR-148a is a member of the miR-148/152 family that is usually regulated by methylation of CpG islands [33]. [score:2]
To test this hypothesis, we treated miR-148a knockdown MDA-MB-231 and Hs-578 T cells with GLA to determine their angiogenic abilities. [score:2]
a- d MDA-MB-231 or Hs-578 T cells were pre -transfected by anti-miR -negative control or anti-miR-148a for 12 h, and then treated with 20 μM GLA for 48 h. a qRT-PCR analyses of miR-148a (mean ± SD, n = 3). [score:1]
After 48 h, anti-miR -negative control and anti-miR-148a (RiBoBio Guangzhou, China) were transfected in cells at 50 nM using Lipofectamine® 2000 (Invitrogen) following the standard protocol. [score:1]
Fig. 4Functions of miR-148a in GLA -induced anti-angiogenesis. [score:1]
MDA-MB-231 or Hs-578Tcells were exposed to 0, 10 or 20 μM GLA for 48 h, (B) qRT-PCR analyses the mRNA level of miR-148a (mean ± SD, n = 3). [score:1]
Functions of miR-148a in GLA -induced anti-angiogenesis in breast cancer cell. [score:1]
MDA-MB-231 cells were pre -transfected by anti-miR -negative control or anti-miR-148a for 12 h, and then treated with 20 μM GLA for 48 h. (A-D) qRT-PCR analyses in triplicate of the mRNA level of ERBB3, PKM2, IRS1, and IGF-IR (mean ± SD, n = 3). [score:1]
Subsequently, we explored whether miR-148a could affect Wnt/β-catenin signaling under the treatment of GLA. [score:1]
Breast cancer Angiogenesis Glabridin microRNA-148a Wnt/β-catenin signaling Angiogenesis plays a crucial role in the pathogenesis of various solid tumors. [score:1]
miR-148a interferes in the Wnt/β-catenin signaling in GLA -treated MDA-MB-231 cells. [score:1]
Nevertheless, whether miR-148a can affect the angiogenesis via Wnt/β-catenin signaling in breast cancer remains largely unclear. [score:1]
[1 to 20 of 41 sentences]
14
[+] score: 116
Indeed, GLA improved the expression of miR-148a, which targeted the SMAD2-3′UTR and down-regulated the SMAD2 expression/activation. [score:10]
0096698.g004 Figure 4. (A) The target sequences of miR-148a in the 3′-UTR of SMAD2; (B) HepG2 cells were treated by 0, 10, or 20 µM GLA for 24 h. qRT-PCR analyses of the expression of miR-148a (mean ± SD, n = 3); (C) HepG2 cells were treated by 0 or 20 µM GLA for 0, 8, 16, 24, or 48 h. qRT-PCR analyses of the expression of miR-148a (mean ± SD, n = 3); (D) Huh-7 and MHCC97H cells were treated by 0 or 20 µM GLA for 24 h. qRT-PCR analyses of the expression of miR-148a (mean ± SD, n = 3). [score:9]
Based on the prediction that there are target sites of miR-148a in SMAD2 mRNA and on that GLA elevated the expression of miR-148a, we hypothesized that miR-148a might be involved in the GLA -induced decreased expression of SMAD2. [score:7]
In addition, inhibition of miR-148a by hyper-methylation is associated with metastasis in many tumor types and with up-regulation of metastasis -associated genes [35]. [score:6]
Further, overexpression of miR-148a decreased the expression/activation of SMAD2 and CSC-like properties in Huh-7 and MHCC97H cells. [score:5]
In MHCC97H cells, knockdown of miR-148a elevated the expression of SMAD2, however, restoration of miR-148a by mimic abolished such effect (Figure. [score:4]
Knockdown of miR-148a abolished the GLA -induced inhibition of TGF-β/SMAD2 and the CSCs-like properties in HCC cells (Figure. [score:4]
In MHCC97H cells, knockdown of miR-148a elevated the expression of CD44 and EpCAM, and improved the formation of spheroids; however, restoration of miR-148a by mimic abolished such effect (Figure. [score:4]
Moreover, knockdown of miR-148a led to significant increases of the expression/activation of SMAD2 and CSCs-like properties in GLA -treated HepG2 cells. [score:4]
Here, knockdown of miR-148a blocked the GLA -induced decreased expressions of CD44 and EpCAM mRNA (Figure. [score:4]
For Huh-7 cells, overexpression of miR-148a attenuated the capacity of anchorage-independent growth (Figures. [score:3]
Meanwhile, overexpression of miR-148a (Figure. [score:3]
by miR-148aSince TGF-β/SMAD2 improves the CSCs-like properties, and since miR-148a targets SMAD2, we hypothesized that GLA attenuates the CSCs-like properties by miR-148a in HCC cells. [score:3]
The repressive effect of miR-148a on TGF-β/SMADs signal pathway is involved in the GLA -induced inhibition of the CSCs-like properties in HCC cells. [score:3]
GLA improves the expression of miR-148a in HCC cells. [score:3]
Previous study suggests that miR-148a is involved in the anti-metastasis of HCC cells by the inhibitions of Wnt1 -mediated EMT and acquirement of CSCs-like properties [24]. [score:3]
The target sites of miR-148a in SMAD2 mRNA were exhibited in Figure. [score:3]
These results suggested that the inhibition of SMAD2 by miR-148a might mediate the GLA-attenuated CSCs-like properties in HCC cells. [score:3]
4B and 4C, GLA improved the expression of miR-148a in a dose/time -dependent manner in HepG2 cells. [score:3]
GLA inhibits the SMAD2 by miR-148a in HCC cells. [score:3]
0096698.g005 Figure 5. (A–C) After HepG2 cells were pre -transfected by anti-con or anti-miR-148a for 12 h, they were exposed to 0 or 20 µM of GLA for 72 h. (A) qRT-PCR analyses of the expression of miR-148a (mean ± SD, n = 3); (B)s analysis of the effects of miR-148a on SMAD2 3′UTR; (C) RT-PCR analyses of SMAD2 and snail (top), and analyses of p-SMAD2 and SMAD2 (bottom). [score:3]
Meanwhile, GLA also elevated the expression of miR-148a in Huh-7 and MHCC97H cells (Figure 4D). [score:3]
We then determined the effects of GLA on the expression of miR-148a in HCC cells. [score:3]
MiR-148a is a pro-apoptotic miRNA by targeting Bcl-2 [34]. [score:3]
Here, by using TargetScan 6.2, we found that miR-148a was predicted to bind the SMAD2-3′ UTR. [score:3]
Since TGF-β/SMAD2 improves the CSCs-like properties, and since miR-148a targets SMAD2, we hypothesized that GLA attenuates the CSCs-like properties by miR-148a in HCC cells. [score:3]
In the liver, miR-148a was first shown to modulate the levels of cytochrome P450 3A4 via post-transcriptionally regulating the 3′UTR of the Pregnane X Receptor (PXR) mRNA [36]. [score:2]
Here, knockdown of miR-148a (Figure. [score:2]
For HepG2 cells, knockdown of miR-148a blocked the GLA -induced decreased formation of spheroids (Figures. [score:2]
GLA attenuates the CSCs-like properties in HCC cells by miR-148a. [score:1]
Anti-con or anti-miR-148a was co -transfected with the reporter constructs respectively, by using Lipofecamine 2000 reagent (Invitrogen) according to the manufacturer's protocol. [score:1]
0096698.g006 Figure 6 by miR-148a. [score:1]
org), we found that miR-148a was predicted to bind the SMAD2-3′ UTR. [score:1]
Anti-con, anti-miR-148a, Con -mimic, and miR-148a -mimic were synthesized by RiBoBio Co. [score:1]
[1 to 20 of 34 sentences]
15
[+] score: 107
Figure 7 (A) qRT-PCR basal expression of miR-148a in the MiaPaca-2 overexpressing miR-148a clone (MiaPaca-2 miR-148a) and MiaPaca-2 scrambled miRNA transfected (MiaPaca-2 Control) (B) qRT-PCR expression of ADAM17 in both MiaPaca-2 Control and MiaPaca-2 miR-148a cells (n=6). [score:7]
For example, miR-106b, miR-107, miR-130a, miR-34 [9], miR-93, miR-155, miR-181a, miR-21, miR-23a, miR-320a [8], miR-193b, miR-320b [13] are significantly up-regulated and miR-148a [11, 14], miR-330-5p [15], miR-373 [16] significantly down-regulated. [score:7]
Among the seven targets analyzed, ADAM17 and EP300, showed significantly decreased expression in the presence of high levels of miR-148a compared to the low miR-148a levels expressed by the control cell line (Figure 7B and 7C). [score:6]
Concordantly, miR-148a, together with miR-374b, are the miRNAs with more miRComb predicted targets (363 and 381, respectively) as shown in Table 2. MiRNAs appearing in that table probably are those playing more central roles in PDAC because they are the ones with more targets and they would regulate a huge number of mRNAs simultaneously. [score:6]
In that sense, functional enrichment analysis according to miR-148a targets by KEGG, Reactome and GO revealed significant target enrichment in the Notch signaling pathway, among others. [score:5]
In order to check those proposed miR-148a targets in the context of pancreatic cancer we took advantage of the pancreatic cancer cellular mo del (MiaPaCa-2) stably overexpressing miR-148a, that we have previously generated [11]. [score:5]
Figure 6 miR-148a miRComb targets (mRNAs that are negatively correlated with miR-148a -FDR < 0.05- and predicted in at least one database of TargetScan, miRVR or miRDB) are highlighted in red. [score:5]
In order to experimentally evaluate these predicted interactions, we analyzed the expression of these targets in a pancreatic cancer cell mo del overexpressing miR-148a in a stable way. [score:5]
miR-148a miRComb targets (mRNAs that are negatively correlated with miR-148a -FDR < 0.05- and predicted in at least one database of TargetScan, miRVR or miRDB) are highlighted in red. [score:5]
Target enrichment analysis of these miR-148a targets by KEGG revealed significant enrichment only in the Notch Signaling Pathway (FDR<0.02). [score:5]
In this study we have confirmed the involvement of miR-148a-ADAM17, miR-148a-EP300, miR-21-PDCD4 and miR-21-BTG2 interactions in the pancreatic cancer cell with the help of genetically modified pancreatic cancer cellular mo dels (stable overexpression or CRISPR/Cas9 knock-out, respectively). [score:4]
These results show that the expression of Notch Signaling components ADAM17 and EP300 is, at least in part, regulated by miR-148a in a pancreatic cancer context. [score:4]
Figure 6 shows proteins involved in that Notch pathway highlighting those that appeared as miRComb predicted targets for miR-148a as NUMB, DTX4, DTX3L, PSEN1, APH1A, ADAM17 and EP300. [score:3]
Interestingly, among the miRNAs participating in the 50 most significant miRNA-mRNA interactions we can find: miR-106b, miR-93, miR-148a, miR-330-5p that could be interacting with more than 4 different targets at the same time. [score:3]
MiaPaca-2 cells stably overexpressing miR-148a (MiaPaca-2 miR-148a) and MiaPaca-2 scrambled miRNA transfected (MiaPaca-2 Control) were obtained by us as previously described [11]. [score:3]
Assessment of miR-148a targets from Notch pathway in a pancreatic cancer cellular mo del. [score:3]
MiR-148a miRComb predicted targets (FDR < 0.05) detected in at least one database were used. [score:3]
Two components of the Notch signaling pathway, ADAM17 and EP300, could be confirmed as miR-148a targets in that cellular mo del. [score:3]
Evaluation of miR-148a targets in a pancreatic cancer cellular mo del overexpressing miR-148a. [score:3]
Interestingly, most of these miRNAs are coincident with those appearing in Table 1 (miR-374b, miR-148a, miR-181a, miR-373, miR-320a, miR-93, miR-106b, miR-497, miR-23a, miR-19b, miR-107, miR-15a, miR-330-5p, miR-144), indicating that, apart from being targeting many mRNAs, these miRNAs are participating in the most reliable interactions. [score:3]
Figure 6 shows as 7 key members (NUMB, DTX4, DTX3L, PSEN1, APH1A, ADAM17 and EP300) of that pathway are predicted as miRComb miR-148a targets in our pancreatic cancer samples. [score:3]
MiR-148a overexpression in MiaPaca-2 cells. [score:2]
MiR-148a targets involved in Notch signaling pathway from KEGG analysis, in the context of pancreatic cancer. [score:2]
It is worth noting that these 10 miRNAs together (miR-374b, miR-148a, miR-181a, miR-373, miR-320a, miR-448, miR-93, miR-106b, miR-217, miR-539) could potentially be regulating 41% of the mRNAs significantly altered in PDAC. [score:2]
We measured the expression of key members of the Notch Signaling Pathway (NUMB, DTX4, DTX3L, PSEN1, APH1A, ADAM17 and EP300) in the MiaPaCa-2-miR-148a by qRT-PCR, and compared it with the basal levels of the control pancreatic cancer cell line MiaPaCa-2, expressing very low levels of miR-148a (Figure 7A). [score:2]
Consistently, evidences about miR-148a regulation of Notch pathway members have been recently reported in hepatocellular carcinoma [26]. [score:2]
It is likely that miR-148a is involved in more pancreatic cancer pathways than those reported so far for apoptosis and cell survival [17, 18]. [score:1]
These miRNA-mRNA interactions are miR-106b-LRRC55, miR-21-PDCD4, miR-148a-YWHAB, miR-93-FAM129A, miR-330-5p-GPI, miR-330-5p-BHLHE40, miR-93-LRIG1, miR-23a-LRIG1, miR-148a-ARF4, miR-106b-FAM129A, miR-148a-ACVR1, miR-148a-CTTNBP2NL. [score:1]
However, no relationships between miR-148a and Notch signaling pathway have been described so far in pancreatic cancer and more studies would be needed to confirm and explore this relationship. [score:1]
It is interesting to highlight that miR-148a also appears on the top list from Table 2, emphasizing its importance in pancreatic carcinogenesis. [score:1]
It is important to highlight the high number of miR-148a interactions that appear among the most significant (12/50), suggesting it may have a central role in pancreatic tumorigenesis. [score:1]
For example, miR-148a and miR-148b are members of the miR-148 family and appear close to each other on the left part of the network (Figure 3A and 3B). [score:1]
[1 to 20 of 32 sentences]
16
[+] score: 95
0059141.g004 Figure 4 Hsa-miR-148a Grouping or Cirrhosis Grouping didn’t Associate with the Expression of PXR or CYP3A4 The relative expression of hsa-miR-148a seems to aggregate into two groups with a split point as 1.0 as shown in Figure 3. We compared the relative expression of PXR and CYP3A4 between high and low hsa-miR-148a expression groups. [score:8]
0059141.g004 Figure 4 The relative expression of hsa-miR-148a seems to aggregate into two groups with a split point as 1.0 as shown in Figure 3. We compared the relative expression of PXR and CYP3A4 between high and low hsa-miR-148a expression groups. [score:6]
However, our results suggest that hsa-miR-148a may not be involved in the regulation of PXR expression or further CYP3A4 expression. [score:6]
Therefore, we asked whether their results could be replicated in Chinese Han population and whether the effect of hsa-miR-148a on PXR translation could indirectly influence CYP3A4 expression in the population. [score:6]
Their results suggested the indirect regulatory function of hsa-miR-148a in CYP3A4 expression. [score:5]
Further replications with larger sample sizes and different ethnic populations were warranted to fully elucidate the exact role of hsa-miR-148a in the regulation of PXR expression and then CYP3A4 transcription. [score:4]
In the present study, we found that hsa-miR-148a might not play a major role in the regulation of PXR or CYP3A4 expression in human livers from Chinese Han population. [score:4]
Thus, our results didn’t support the significant effect of hsa-miR-148a in PXR expression in human livers. [score:3]
In summary, we failed to replicate the significant correlation between liver hsa-miR-148a level and the translational efficiency of PXR in Chinese Han population. [score:3]
After in vitro investigation with reporter system, they further found that the translational efficiency of PXR (PXR protein/PXR mRNA ratio) was inversely correlated with the expression level of hsa-miR-148a in human livers [10]. [score:3]
Furthermore, hsa-miR-148a did not show significant effect on CYP3A4 expression either. [score:3]
Hsa-miR-148a was not correlated with the translational efficiency (A) or protein level (B) of PXR. [score:3]
As a replication study, we tried to correlate the hsa-miR-148a level with the translational efficiency of PXR in our liver samples. [score:3]
The non-significant correlation of hsa-miR-148a level with PXR and CYP3A4 expression still exceeded this more stringent threshold. [score:3]
In 2008, Takagi et al. found that hsa-miR-148a could bind to the 3′-UTR region of PXR and influence its expression both in vitro and in vivo. [score:3]
0059141.g002 Figure 2 Hsa-miR-148a did not Affect Expression of PXR in Chinese Han PopulationWe calculated the PXR protein/PXR mRNA ratio as an index of the translational efficiency of PXR, according to Takagi et al. [10]. [score:3]
To be noticed, mild cirrhosis status didn’t show significant correlation with hsa-miR-148a expression (p = 0.472). [score:3]
The expression of PXR, CYP3A4 and hsa-miR-148a in groups according to hsa-miR-148a level and cirrhosis status. [score:3]
Hsa-miR-148a Grouping or Cirrhosis Grouping didn’t Associate with the Expression of PXR or CYP3A4. [score:3]
Hsa-miR-148a did not Show Influence on the Expression of CYP3A4 in Chinese Han Population. [score:3]
The relative expression of PXR, CYP3A4 and hsa-miR-148a in human liver samples. [score:3]
0059141.g003 Figure 3 Hsa-miR-148a did not Show Influence on the Expression of CYP3A4 in Chinese Han PopulationTo investigate whether hsa-miR-148a could indirectly regulate CYP3A4 transcription, we examined the relationship between hsa-miR-148a level and CYP3A4 mRNA level. [score:3]
There was no significant correlation between the translational efficiency of PXR and the hsa-miR-148a level in liver samples using Spearman’s rank method (p = 0.850) or linear regression (p = 0.217), as shown in Figure 3A. [score:3]
Hsa-miR-148a did not Affect Expression of PXR in Chinese Han Population. [score:3]
Several differences may contribute to the inconsistency of the influence of hsa-miR-148a between Takagi et al. ’s conclusion and ours. [score:1]
No correlation between hsa-miR-148a level and CYP3A4 mRNA (A) or protein (B) levels in livers. [score:1]
The hsa-miR-148a level was not significantly correlated with PXR protein level either (Spearman’s rank p = 0.923; Figure 3B). [score:1]
As shown in Figure 4, hsa-miR-148a level in human livers was not significantly in Spearman’s rank correlation with CYP3A4 mRNA level (p = 0.848) or protein level (p = 0.248). [score:1]
0059141.g003 Figure 3 To investigate whether hsa-miR-148a could indirectly regulate CYP3A4 transcription, we examined the relationship between hsa-miR-148a level and CYP3A4 mRNA level. [score:1]
[1 to 20 of 29 sentences]
17
[+] score: 95
We confirmed that WNT10B expression was downregulated by ectopic overexpression of miR-148a and was upregulated by the miR-148a inhibitor (Additional file 7: Figure S4C and D). [score:13]
The anti-mir-15a and miR-148a inhibitors, MC10235 and MC10263, were obtained from Ambion®, Thermo Scientific, whereas a negative control inhibitor, mirVana™ miRNA inhibitor negative control #1, were used as the scrambled miRNA inhibitor. [score:9]
Taken together, these lists of target genes with the overexpressed genes in CCFs studied by cDNA microarray [8] and highly expressed proteins in the CM (unpublished data), propose several target genes of interest for miR-15a including VEGFA, PAPPA, NRG1, FGF2, PAI-2, AXIN2, FGF7, and WNT3A (Fig.   3a) and for miR-148a are TNFRSF6B, CD62L (L-selectin), TGFA, WNT1, and WNT10B (Additional file  7: Figure S4A). [score:9]
Cells (SFs) were transfected with 75 nM of miR-15a inhibitor, miR-148a inhibitor and negative control miRNA inhibitor using Lipofectamine RNAi Max. [score:7]
The potential target genes of miR-15a and miR-148a were determined using TargetScanHuman 6.2 (http://targetscan. [score:7]
In our study, miR-148a was also downregulated and WNT10B was identified as a target gene in CCFs. [score:6]
Bars represent mean ± SD of three measurements To predict the potential mRNA targets of miR-15a and miR-148a, TargetScan miRNA target prediction database was used. [score:5]
In this study, we focused on downregulated miRNAs including miR-15a and miR-148a. [score:4]
Here, miR-15a and miR-148a were downregulated in both in vitro CCFs and clinical CCA tissues. [score:4]
In this study, changes of miRNA expression of CCA CCFs were investigated and miR-15a and miR-148a were selected as the most promising down-regulated miRNAs. [score:4]
Investigation of miR-148a function demonstrated that overexpression of miR-148a in CAFs significantly impaired the migration and invasion of cancer cells by directly targeting WNT10B [17, 37]. [score:4]
b of miR-15a, miR-148a and miR-486 expression levels in 5 CCFs and 2 SFs. [score:3]
From a literature review, among 15 miRNAs, miR-15a, miR-148a and miR-486 targeted several secreted proteins (Additional file  5: Table S3). [score:3]
List of candidate target genes of miR-148a. [score:3]
β-actin was used as a loading controlIt has already been shown that WNT10B is a target of miR-148a in CAFs [17]. [score:3]
The expression levels of these miRNAs in CCFs and SFs were examined and only miR-15a and miR-148a showed decreased levels in all CCFs in comparison to those in SFs (Fig. 2b). [score:3]
This finding is supported by previous reports that miR-148a was downregulated in CAFs from oral cancers compared to normal fibroblasts. [score:3]
β-actin was used as a loading control It has already been shown that WNT10B is a target of miR-148a in CAFs [17]. [score:3]
Cells (CCFs) were transfected with 5 nM hsa-miR-15a, hsa-miR-148a and used as the negative control miRNA mimic using Lipofectamine RNAi Max (Invitrogen) according to the manufacturer’s protocol. [score:1]
The product numbers MH10235 and MH1026 were used as a miR-15a and miR148a mimics. [score:1]
[1 to 20 of 20 sentences]
18
[+] score: 71
Other miRNAs from this paper: hsa-mir-148b
The Hedgehog agonist purmorphamine enhanced cell proliferation and suppressed apoptosis through the RNA -binding protein Msi1 by regulating the expression of an oncoprotein (i. e., c-Myc), a cell cycle regulatory molecule (i. e., p21 [CIP1,WAF1] ) and two miRNAs (i. e., miRNA-148a and miRNA-148b). [score:7]
0056496.g009 Figure 9The Hedgehog agonist purmorphamine enhanced cell proliferation and suppressed apoptosis through the RNA -binding protein Msi1 by regulating the expression of an oncoprotein (i. e., c-Myc), a cell cycle regulatory molecule (i. e., p21 [CIP1,WAF1] ) and two miRNAs (i. e., miRNA-148a and miRNA-148b). [score:7]
In conclusion, we demonstrated that the Hedgehog agonist purmorphamine enhanced cell proliferation and suppressed apoptosis through Msi1 by regulating the expression of an oncoprotein (c-Myc), a cell cycle regulatory molecule (p21 [CIP1,WAF1]) and two miRNAs (miRNA-148a and miRNA-148b) (Fig. 9). [score:7]
Further studies are needed to assess factors for these differential responses Furthermore, we have shown that knockdown of Msi1 increased the expression levels of miR-148a and miR-148b, and purmorphamine treatment partially attenuated the stimulatory effects of Msi1 knockdown on miR-148a and miR-148b expression. [score:7]
The knockdown of Msi1 significantly increased the expression levels of miR-148a and miR-148b (Figs. 7C, D). [score:4]
In these experiments, we found that purmorphamine treatment attenuated the stimulatory effects of Msi1 knockdown on miR-148a and miR-148b expression (Figs. 8A, B). [score:4]
Purmorphamine treatment attenuated the stimulatory effects of Msi1 knockdown on miR-148a (A) and miR-148b (B) expression. [score:4]
The effects of purmorphamine and Msi1 knockdown on miR-148a and miR-148b expression. [score:4]
The regulatory roles of miR-148a and miR-148b as downstream targets of Msi1. [score:4]
Because Hh signaling exerts its functions on MSCs through Msi1, we first assessed whether Msi1 could regulate the expression of miR-148a and miR-148b. [score:4]
We analyzed the expression levels of miR-148a and miR-148b with or without 4 µM purmorphamine treatment using real-time PCR analysis. [score:3]
As shown in Figs. 7A and B, the expression levels of miR-148a and miR-148b were decreased by purmorphamine treatment but it was more marked in miR-148b than miR-148a. [score:3]
The expression levels of miR-148a (A) and miR-148b (B) were decreased by purmorphamine treatment. [score:3]
The transfection of 50 nM Msi1 siRNA increased the expression levels of miR-148a (C) and miR-148b (D). [score:3]
In this study, we showed for the first time that the expression levels of miR-148a and miR-148b were decreased by purmorphamine treatment but it was more marked in miR-148b than miR-148a. [score:3]
These results indicate that miR-148a and miR-148b may be involved in MSC proliferation and apoptosis as novel downstream regulators of Msi1. [score:2]
We further determined whether Msi1 is involved in the interactions between Hh signaling and miR-148a and miR-148b. [score:1]
The effects of purmorphamine on miR-148a and miR-148b are mediated through Msi1. [score:1]
[1 to 20 of 18 sentences]
19
[+] score: 60
Thus, milk orchestrates both pro-survival and anti-apoptotic signaling, a most favorable constellation for the growing infant but a disastrous promoter of diseases in patients associated with disrupted p53 homeostasis such as acne vulgaris and prostate cancer Milk miRNA-148a -mediated DNMT1 suppression may thus modify chromatin structure, unwinding chromatin to allow access to the DNA sequence and subsequent transcription, important regulatory events for the growing mammal. [score:6]
Thus, milk orchestrates both pro-survival and anti-apoptotic signaling, a most favorable constellation for the growing infant but a disastrous promoter of diseases in patients associated with disrupted p53 homeostasis such as acne vulgaris and prostate cancer Milk miRNA-148a -mediated DNMT1 suppression may thus modify chromatin structure, unwinding chromatin to allow access to the DNA sequence and subsequent transcription, important regulatory events for the growing mammal. [score:6]
The expression of DNMT1 is thus inversely related to the expression miRNA-148a and its family homolog miRNA-152 [57, 58]. [score:5]
The increased cellular expression of miRNA-148a was associated with a significant decrease in the expression of DNMT1 [13]. [score:5]
Importantly, DNMT1 is a direct target of miRNA-148a [56]. [score:4]
miRNA-148a homology of DNMT1 -targeting miRNA-148a is regarded as an ancestral epigenetic regulator in various mammalian species [13]. [score:4]
Importantly, it has recently been shown that the expression of miRNA-148a of normal colon cells (CRL1831) and K562 leukemia cells increased after incubation with milk exosomes and the fat layer isolated from human milk [13]. [score:3]
In fact, recent co -expression and network and pathway analyses identified bovine miRNA-148a as a major determinant enhancing milk yield [62]. [score:3]
Genetic and epigenetic selection of dairy cows intended to increase lactation performance and milk yield further enhances the expression of lactation-promoting miRNAs such as miRNA-148a [50, 59]. [score:3]
Thus, reduced DNMT1 expression via continued uptake of milk-derived DNMT1-tageting miRNA-148a may promote EMT and the CSC phenotype facilitating PCa progression [158]. [score:3]
Furthermore, miRNA-148a is highly expressed in human and bovine milk fat [13, 50, 51] and has been detected in substantial amounts in bovine skim milk and human milk exosomes [13, 25, 34]. [score:3]
Lactogenic hormones such as prolactin induce cellular and extracellular miRNA-148a expression in bovine MECs [59]. [score:3]
These data correspond to the findings of Do et al. [53] who confirmed that miRNA-148a belongs to the most abundantly expressed miRNA of bovine milk since it accounts for more than 10% of the read counts in each stage of dairy cow lactation. [score:3]
Golan-Gerstl et al. [13] recently demonstrated that miRNA-148a-3p represents the top one miRNA of pasteurized skim milk (16.09% of all miRNAs) and the top two miRNA of pasteurized milk fat (7.16%), respectively. [score:1]
miRNA-148a is by far the most abundant miRNA detected in human milk, bovine colostrum and mature cow’s milk, porcine colostrum and mature porcine milk [25, 34, 38, 39, 49– 51]. [score:1]
Notably, the vast majority of cow milk-derived miRNA-148a has been shown to survive pasteurization, homogenization, and the attacks of digestive enzymes in comparison to untreated cow’s milk [13, 26, 50]. [score:1]
Notably, there was no significant difference in the levels of miRNA-148a, miRNA-21 and miRNA-25 between in vitro digested exosomes and their respective undigested controls [26]. [score:1]
The absence of miRNA-148a and related DNMT1 signaling may explain why miRNA -deficient milk protein powder did not affect prostate tumor progression in two mouse mo dels of benign and neoplastic lesions [159], whereas commercial milk including bioactive miRNAs added to PCa cells in culture significantly promoted cell proliferation [131]. [score:1]
miRNA-148a, miRNA-148b, and miRNA-152 are three members of the miRNA-148/152 family, which shares substantial homology in their seed sequences [54]. [score:1]
Furthermore, miRNA-148a has been shown to induce milk triacylglycerol synthesis in goat MECs [60]. [score:1]
It is of critical importance to mention that the mature and seed sequences of human and bovine miRNA-148a are identical (Table 1). [score:1]
It is possible that milk fat globules (MFGs) of cow’s milk release miRNA-148a carried in crescent exosomes of MFGs [52], especially after the process of homogenization [50]. [score:1]
[1 to 20 of 22 sentences]
20
[+] score: 51
Overexpression of miR- 148a greatly decreased ERBB3 expression in MCF7-miR-148a cells (Fig. 2B), suggesting that ERBB3 is a downstream target of miR- 148a. [score:7]
To investigate whether miR-148a directly regulates ERBB3 transcriptional expression by binding to the miR- 148a binding site of ERBB3, pre-miR-148a or pre-miR-SCR was co -transfected with plasmid pGL4.74 expressing renilla luciferase and the ERBB3 wild type or mutant reporter plasmid. [score:5]
Fig. 4 MiR-148a inhibited AKT and ERK activation, and HIF-1α expression. [score:4]
MiR-148a inhibited the activation of AKT, ERK, and p70S6K1 and decreased HIF-1α expression. [score:4]
ERBB3 acting as a direct target of miR-148a. [score:4]
To test whether miR- 148a regulates ERBB3 expression at protein level, total proteins prepared from MCF7-miR-148a cells and MCF7-miR-SCR cells were analyzed by Western blotting. [score:4]
MiR-148a inhibited AKT and ERK activation, and HIF-1α expression. [score:4]
However, the biological roles of miR-148a and the target genes in breast cancer have not yet been defined. [score:3]
Endogenous and forced expression of miR-148a in breast cancer cells. [score:3]
Fig. 1Endogenous and forced expression of miR-148a in breast cancer cells. [score:3]
Meanwhile, cell proliferation assay indicated that the growth rate of MCF7-miR-SCR was similar to that of MCF7-miR-148a, indicating that the angiogenesis response was not due to the effect of miR- 148a overexpression on cell proliferation (Fig. 5C). [score:2]
Fig. 3 MiR-148a interacted with ERBB3 3′-UTR to inhibit its transcriptional activation. [score:2]
MiR-148a interacted with ERBB3 3′-UTR to inhibit its transcriptional activation. [score:2]
MCF7-miR-148a or MCF7-miR-SCR stable cells were resuspended in serum-free medium, and mixed with equal volume of Matrigel. [score:1]
We established stable cells with fluorescent and contrast phase representative pictures of MCF7-miR-SCR and MCF7-miR-148a cells (Fig. 1B). [score:1]
The lentiviral vectors with RFP tag carrying scrambled miRNA (pLe-miR-SCR), miR- 148a (pLe-miR-148a), and packaging kit were purchased from Thermo Scientific (Huntsville, AL, USA). [score:1]
C: of MCF7-miR-SCR and MCF7-miR-148a cells was performed using CCK8 kit. [score:1]
[1 to 20 of 17 sentences]
21
[+] score: 46
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-127, mmu-mir-132, mmu-mir-133a-1, mmu-mir-136, mmu-mir-144, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-10b, mmu-mir-185, mmu-mir-190a, mmu-mir-193a, mmu-mir-203, mmu-mir-206, mmu-mir-143, hsa-mir-10b, hsa-mir-34a, hsa-mir-203a, hsa-mir-215, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-144, hsa-mir-152, hsa-mir-127, hsa-mir-136, hsa-mir-146a, hsa-mir-185, hsa-mir-190a, hsa-mir-193a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-337, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-29b-2, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, hsa-mir-337, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-215, mmu-mir-411, mmu-mir-434, hsa-mir-486-1, hsa-mir-146b, hsa-mir-193b, mmu-mir-486a, mmu-mir-540, hsa-mir-92b, hsa-mir-411, hsa-mir-378d-2, mmu-mir-146b, mmu-mir-193b, mmu-mir-92b, mmu-mir-872, mmu-mir-1b, mmu-mir-3071, mmu-mir-486b, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, hsa-mir-203b, mmu-mir-3544, hsa-mir-378j, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-let-7k, hsa-mir-486-2
Down-regulated miRNAs Up-regulated target genes mmu-mir-148a ARL6IP1, ARPP19, ATP2A2, CCNA2, CSF1, EGR2, ERLIN1, ERRFI1, FIGF, GADD45A, GMFB, ITGA5, KLF4, KLF6, LIMD2, MAFB, NFYA, PDIA3, PHIP, PPP1R10, PPP1R12A, PTPN14, RAI14, RSBN1L, SERPINE1, SIK1, SLC2A1, TMEM127, TMSB10, TMSB4X mmu-mir-411 APOLD1, SPRY4 mmu-mir-136 RYBP, ARL10, GLIPR2, UGGT1 Up-regulated miRNAs Down-regulated target genes mmu-mir-34a/c DAB2IP, DMWD, EVI5L, FAM107A, MAZ, SPEG, TFRC, TTC19 mmu-mir-92b COL1A2, DAB2IP, G3BP2, HOXC11, LBX1, NFIX, PKDCC, PRKAB2 mmu-mir-132 ACTR3B, AMD1, GPD2, HBEGF, KBTBD13, KCNJ12, PRRT2, SREBF1, TLN2 mmu-mir-146a IRAK1, TLN2 mmu-mir-152 EML2, GPCPD1, NFIX, RPH3AL, SH3KBP1, TFRC, TRAK1, UCP3 mmu-mir-155 DUSP7, G3BP2 mmu-mir-185 DAB2IP, FAM134C, SYNM, TMEM233 mmu-mir-203 APBB2, CACNG7, FKBP5, GDAP1, HBEGF, KCNC1, SIX5, TMEM182 mmu-mir-206 DMPK, G3BP2, GPD2, KCTD13, MKL1, SLC16A3, SPEG mmu-mir-215 KLHL23 Figure 5The network displays the predicted interactions between age-related miRNAs and mRNAs from the sequencing and was generated using Cytoscape (version 3.0, www. [score:17]
Down-regulated miRNAs Up-regulated target genes mmu-mir-148a ARL6IP1, ARPP19, ATP2A2, CCNA2, CSF1, EGR2, ERLIN1, ERRFI1, FIGF, GADD45A, GMFB, ITGA5, KLF4, KLF6, LIMD2, MAFB, NFYA, PDIA3, PHIP, PPP1R10, PPP1R12A, PTPN14, RAI14, RSBN1L, SERPINE1, SIK1, SLC2A1, TMEM127, TMSB10, TMSB4X mmu-mir-411 APOLD1, SPRY4 mmu-mir-136 RYBP, ARL10, GLIPR2, UGGT1 Up-regulated miRNAs Down-regulated target genes mmu-mir-34a/c DAB2IP, DMWD, EVI5L, FAM107A, MAZ, SPEG, TFRC, TTC19 mmu-mir-92b COL1A2, DAB2IP, G3BP2, HOXC11, LBX1, NFIX, PKDCC, PRKAB2 mmu-mir-132 ACTR3B, AMD1, GPD2, HBEGF, KBTBD13, KCNJ12, PRRT2, SREBF1, TLN2 mmu-mir-146a IRAK1, TLN2 mmu-mir-152 EML2, GPCPD1, NFIX, RPH3AL, SH3KBP1, TFRC, TRAK1, UCP3 mmu-mir-155 DUSP7, G3BP2 mmu-mir-185 DAB2IP, FAM134C, SYNM, TMEM233 mmu-mir-203 APBB2, CACNG7, FKBP5, GDAP1, HBEGF, KCNC1, SIX5, TMEM182 mmu-mir-206 DMPK, G3BP2, GPD2, KCTD13, MKL1, SLC16A3, SPEG mmu-mir-215 KLHL23 Figure 5The network displays the predicted interactions between age-related miRNAs and mRNAs from the sequencing and was generated using Cytoscape (version 3.0, www. [score:17]
Of the down-regulated miRNAs, miR-148a-3p and -127-3p belonged to the 50 most abundant miRNAs in skeletal muscle (Fig. S4, Asterisk). [score:4]
MiR-148a, one of the down-regulated miRNAs, was identified as a myogenic miRNA that promotes myogenic differentiation through the ROCK1 gene. [score:4]
Thus, in accordance with their expression and role in myogenesis, miR-148a and miR-155 might be involved in the aging process through muscle differentiation or regeneration. [score:3]
miRNA Fold Change P-value mmu-miR-337-5p −5.2 0.0149 mmu-miR-3544-3p −5.1 0.0147 mmu-miR-540-5p −4.9 0.0200mmu-miR-337-3p [a] −3.0 0.0324mmu-miR-3544-5p [a] −3.0 0.0308 mmu-miR-434-3p −2.1 0.0001 mmu-miR-3071-5p −2.0 0.0004mmu-miR-136-3p [a] −2.0 0.0004mmu-miR-3071-3p [a] −1.6 0.0000 mmu-miR-136-5p −1.6 0.0000 mmu-miR-143-5p −1.2 0.0004 mmu-miR-190a-5p −1.0 0.0139 mmu-miR-872-3p −0.9 0.0152 mmu-miR-193a-3p −0.9 0.0164 mmu-miR-144-3p −0.8 0.0298 mmu-miR-127-3p −0.7 0. 0002mmu-miR-434-5p [a] −0.6 0.0082 mmu-miR-148a-3p −0.6 0.0130 mmu-miR-411-5p −0.6 0.0091 a miRNA* (passenger) strand processed from opposite arm of the mature miRNA. [score:1]
[1 to 20 of 6 sentences]
22
[+] score: 45
MiR-148a downregulation is reported in multiple malignancies by different authors, and, its over -expression inhibits growth of pancreatic and prostate cancer cells, promotes apoptosis of colorectal cancer, suppresses angiogenesis of breast cancer and represses metastatic potential of gastric cancer-derived cell lines [36, 37, 38, 39, 40]. [score:9]
Another study confirmed a significant down-regulation of miR-148a in HCC, indicating that this miR exerted its tumor-suppressive effect by regulating the c-Met oncogene, regardless of the DNMT1, the DNA methyltransferase 1, expression level [42, 43]. [score:9]
Liffers S. T. Munding J. B. Vogt M. Kuhlmann J. D. Verdoodt B. Nambiar S. Maghnouj A. Mirmohammadsadegh A. Hahn S. A. Tannapfel A. MicroRNA-148a is down-regulated in human pancreatic ductal adenocarcinomas and regulates cell survival by targeting CDC25B Lab. [score:6]
Zheng B. Liang L. Wang C. Huang S. Cao X. Zha R. Liu L. Jia D. Tian Q. Wu J. MicroRNA-148a suppresses tumor cell invasion and metastasis by downregulating ROCK1 in gastric cancer Clin. [score:5]
Yu J. Li Q. Xu Q. Liu L. Jiang B. MiR-148a inhibits angiogenesis by targeting ERBB3 J. Biomed. [score:4]
Zhang and colleagues proved that miR-148a directly target c-Met and abrogate c-Met/Snail signaling in hepatoma cells, providing novel mechanistic insights into the role of miR-148a in ephitelial mesenchymal transition (EMT) and metastasis [41]. [score:4]
Fujita Y. Kojima K. Ohhashi R. Hamada N. Nozawa Y. Kitamoto A. Sato A. Kondo S. Kojima T. Deguchi T. MiR-148a attenuates paclitaxel resistance of hormone-refractory, drug-resistant prostate cancer PC3 cells by regulating MSK1 expression J. Biol. [score:3]
Xu Q. Jiang Y. Yin Y. Li Q. He J. Jing Y. Qi Y. T. Xu Q. Li W. Lu B. A regulatory circuit of miR-148a/152 and DNMT1 in modulating cell transformation and tumor angiogenesis through IGF-IR and IRS1 J. Mol. [score:2]
Zhang H. Li Y. Huang Q. Ren X. Hu H. Sheng H. Lai M. MiR-148a promotes apoptosis by targeting Bcl-2 in colorectal cancer Cell Death Differ. [score:2]
2.4. miR-148a. [score:1]
[1 to 20 of 10 sentences]
23
[+] score: 45
It targets P53and other tumor suppressor genes [33], [34], [35] miR-34a Breast cancer(Luminal A), prostate,pancreaticcancerTargets 3′UTR of MAGE-Athat down regulates P53and Bcl-2. Plays a role as tumor suppressorgene in human pancreatic cancerwith loss of p53 [28] miR-146a Breast andcolorectal cancerDownregulates BRCA1 (3′UTR) [40] miR-148a Several cancer typesDownregulates C-MYC0, CDK6and TGIF2. [score:16]
We analyzed the expression of seven microRNAs (miR-10b; miR-21; miR-34a; miR-146a; miR-148a and miR-182) among the two groups of breast cancer types in both tumor and normal adjacent tissues. [score:3]
However, the difference of the mean fold expression of miR-10, miR-17, miR-34 and miR-148a between the two analyzed groups is not significant; P>0.05 (Table 5). [score:3]
Figure S2 Roc curve of the lymph node metastases occurrence prediction according to miR-10b, miR-21, miR-148a and miR-182 fold expression among triple negative breast cancer cases. [score:3]
In the present study, we explored the expression levels of seven microRNAs: miR-10b, miR-17, miR-21, miR-34a, miR-146a, miR-148a and miR-182 in both triple negative (TNBC) and non triple negative breast carcinoma (NTNBC). [score:3]
miR146a and miR-182 combined together along with miR-148a, were found to play a role in cell growth, angiogenesis, proliferation and invasion, through the silencing of the tumor suppressors tropomyosin-1 (TPM1) and programmed cell death gene-4 (PDCD4) [45]. [score:3]
The age of the first menstruation >13 years in TNBC was associated to the over -expression of miR-10b; miR-17; miR-21; miR-148a and miR-182 (P value, 0.03; 0.006; 0.01; 0.01 and 0.02 respectively) and it was associated only to miR-17 (P value, 0.003) in NTNBC group. [score:3]
Finally we observed that miR-34a correlated weakly with only miR-148a and miR-182 (Spearman’s rho, 0.39 and 0.4 respectively; P<0.05) (Table 6). [score:1]
We also noticed a strong correlation between miR-148a and miR-182 (Spearman’s rho, 0.64; p<0.05). [score:1]
In addition, miR-21′s association with miR-148a and miR-182 in both TNBC and NTNBC according to Spearman’s rank correlation coefficient has been found to be involved in different tumors, including glioblastoma, lung, stomach, pancreatic, colon, prostate and breast, [31] as well as in invasive cancer cells and tumor metastases [31]. [score:1]
We also recorded that miR-17 correlates strongly with miR-21; miR-148a and miR-182 (Spearman’s rho, 0.71, 0.74 and 0.6 respectively; P<0.01). [score:1]
We observed that miR-21 correlated with both miR-148a and miR-182 (Spearman’s rho, 0.72 and 0.65 respectively; P<0.01) along with miR-10a and miR-17. [score:1]
The highest correlation was observed between: miR-10b and miR-21 (Spearman’s rho, 0.83; P<0.01); miR-10b and miR-17 (Spearman’s rho, 0.82; P<0.01); miR-10b and miR-148a (Spearman’s rho, 0.71; P<0.01). [score:1]
However, in TNBC group, miR-10b was associated to lymph node metastases and correlates with miR-17, miR-21, and miR-148a. [score:1]
We also observed that miR-17 correlates strongly with miR-21 and normally with miR-148a (Spearman’s rho, 0.39 and 0.4 respectively; P<0.05) and that miR-21 correlates with miR-146a, miR-148a and miR-182 (Spearman’s rho, 0.39, 0.38 and 0.62 respectively; P<0.05). [score:1]
Considering the triple negative breast cancer, we observed a group of correlating miRs constituted by miR-10b, miR-21, miR-17, miR-148a and miR-182; while miR-34 and miR-146a appeared to be less correlated with the other studied miRs. [score:1]
The objective of the present study is to evaluate the expression profile of the following micro -RNAs: miR-10b, miR-17, miR-21, miR-34a, miR-146a, miR-148a and miR-182, and to determine their possible interaction in triple -negative and non triple -negative primary breast cancers based on clinical outcome. [score:1]
The correlation between miR-182 and miR-148a has already been described to be involved in medulloblastoma and metastases mechanisms [46]. [score:1]
[1 to 20 of 18 sentences]
24
[+] score: 43
The finding of increased miR-148a in female mice at 30 wks of age is significant since miR-148a was reported to be highly upregulated in both human and murine lupus T cells, which contributed to DNA hypomethylation and induction of autoimmune -associated genes by targeting DNA methyltransferase 1 (DNMT1) [36]. [score:6]
We initially analyzed the expression of lupus -associated miRNAs including the miR-96-182-183 cluster, miR-155, miR-31, miR-127, miR-379, and miR-148a in splenocytes from male and female NZB/W [F1] mice at 17–18 wks old, an age before the onset of disease in NZB/W [F1] mice. [score:5]
The estrogen -upregulated miRNA miR-148a was increased in CD4 T cells from human lupus patients and positively correlated with lupus activity [49]. [score:4]
miR-148a was the only miRNA that displayed the increased expression in pre-diseased female NZB/W [F1] mice when compared to those in NZW controls [34]. [score:4]
In this study, we observed that short-term estrogen treatment (4 wks) did not increase miR-148a (Figure  4A), which has been shown to be upregulated by estrogen in orchidectomized wild-type B6 mice [42]. [score:4]
miR-148a showed increased expression in female NZB/W [F1] even before the onset of lupus [34]. [score:3]
Our finding of increased miR-182 cluster, miR-155, miR-31, and miR-148a expression in female NZB/W [F1] mice at an age after the onset of lupus validates our previous report of the association of these miRNAs with lupus manifestation in this mo del. [score:3]
However, our data tends to support that estrogen treatment promoted the expression of selected lupus -associated miRNAs such as the miR-182 cluster, miR-379, and miR-148a in orchidectomized male NZB/W [F1] mice. [score:3]
As shown in Figure  1A, there was no significant difference in the expression of miR-182-96-183 cluster, miR-155, miR-31, and miR-148a between male and female mice. [score:3]
Among the above lupus -associated miRNAs, miR-31 and miR-148a were reported to be dysregulated in human lupus patients and contributed to human lupus pathogenesis by affecting IL-2 production and by causing CD4 [+] T cell hypomethylation and induction of autoimmune -associated genes, respectively [35, 36]. [score:2]
Impressively, we found that after the onset of lupus, the expressions of lupus -associated miRNAs (miR-182-96-183, miR-31, miR-127, miR-379, and miR-148a, miR-155) were significantly increased in female NZB/W [F1] mice when compared to those in age-matched male mice. [score:2]
We noticed that the expression of miR-96, miR-379, and miR-148a was significantly increased in 30-wk-old female mice, but not in 23-wk-old female mice when compared to that in age-matched male mice (Figure  2A). [score:2]
The sex differences in the expression of lupus -associated miRNAs, including the miR-182-96-183 cluster, miR-155, miR-31, miR-148a, miR-127, and miR-379, were markedly evident after the onset of lupus, especially at 30 wks of age when female NZB/W [F1] mice manifested moderate to severe lupus when compared to their male counterparts. [score:2]
[1 to 20 of 13 sentences]
25
[+] score: 43
This mechanism may be relevant in affecting miRNA expression; however, we suggest that an aberrant miRNA expression, i. e. up-regulation of miR-21, miR-148a and miR-222 in NRs, may be important in establishing resistance independently from p53, protecting cells from apoptosis. [score:8]
Among the various miRNAs differentially expressed between NR versus CR patients, miR-21, miR-222 and miR-148a emerged as significantly up-regulated in two different cohorts of refractory patients, both before and after fludarabine administration. [score:6]
In this study, we found that some miRNAs, namely miR-222, miR-148a and miR-21 were differentially expressed between NR and CR CLLs both before and after fludarabine treatment and were all up-regulated in the NR group. [score:6]
MiR-148a is up-regulated in NR CLL patients either before and after fludarabine treatment and it was identified also as resistance predictor in pre CLLs. [score:3]
Interestingly, after validation by quantitative PCR of the most significant miRNAs (miR-21, miR-222 and miR-148a) in an independent population, the prediction of response to therapy for pre-therapy samples was impressive: a predictive score based on miRNA expression levels reached an overall accuracy of 100%. [score:3]
Among the identified microRNAs, miR-148a, miR-222 and miR-21 exhibited a significantly higher expression in non-responder patients either before and after fludarabine treatment. [score:3]
LNA knockdown probe anti-miR-2 and Scramble-miR control were from Exiqon, Negative control, anti-miR-148a and anti-miR-222 were from Ambion. [score:2]
To verify whether the three validated miRNAs (miR-21, miR-148a and miR-222) might be able to predict the efficacy of fludarabine treatment and might therefore become useful in directing patients therapy, we collected a new cohort of 12 patients (test set). [score:2]
classified as NRs displayed a significantly (p < 0.05 at two-tailed t-test) increased expression of miR-21, miR-148a and miR-222 if compared to patients sensitive to treatment. [score:2]
Cells were cultured in 96-well plates the day before LNA-anti-miR-21, anti-miR-222, anti-miR-148a and control transfections (50 nmol). [score:1]
A significant (p < 0.01) increase of caspase 3/7 activity was detected for miR-21 and miR-222 (Figure 5A, B) while no difference was observed for miR-148a (Figure 5C). [score:1]
validation for miR-222, miR148a and miR-21 in CLL patients. [score:1]
We hereby concluded that the high miR-21 and miR-222 levels may be responsible for a weaker apoptotic effect of fludarabine in refractory patients, while the mechanism of action of miR-148a remains to be established. [score:1]
Less clear is the role of miR-148a. [score:1]
Figure 3 validation for miR-222, miR148a and miR-21 in independent CLL patients. [score:1]
For miR-21, miR-222 and miR-148a, a CR vs NR threshold value was determined by calculating and selecting the first integer number above the 98th percentile of expression values (as described in quantitative RT-PCR method) distribution in CR group. [score:1]
LNA-anti-miR-21 and anti-miR-222, but not anti-miR-148a, were able to induce increase apoptosis in MEG-01 cells, which harbor a mutant p53 protein. [score:1]
[1 to 20 of 17 sentences]
26
[+] score: 40
A recent study has demonstrated that miR-148a expression is also upregulated in DCs on maturation and activation induced by TLR3, TLR4, and TLR9 agonists, which, in turn, inhibit the upregulation of MHC class II expression, the production of cytokines including IL-12, IL-6, TNF-alpha, and IFN-beta, and antigen presentation of DCs by directly targeting Calcium/calmodulin -dependent protein kinase II [91]. [score:16]
The upregulated miR-148a in PBMCs of H1N1 critically ill patients may contribute to the regulation of innate and adaptive immune responses. [score:5]
Moreover, TGFBR1 and TP53 were both predicted to be regulated by high-expressed miR-148a. [score:4]
validation of differentially expressed miRNAs and ROC analysisThe microarray data were validated by performing, qRT-PCR for nine miRNAs, including hsa-miR-146b-5p, hsa-miR-148a, hsa-miR-150, hsa-miR-31, hsa-miR-155, hsa-miR-29a, hsa-miR-29b, hsa-miR-342-5p, and hsa-miR-886-3p. [score:3]
The expression of hsa-miR-150, hsa-miR-31, hsa-miR-155, hsa-miR-29a, hsa-miR-29b, hsa-miR-342-5p, and hsa-miR-146b-5p were present in lower abundance, whereas hsa-miR-148a and hsa-miR-886-3p were present in higher abundance in PBMCs from critically ill patients infected with H1N1 influenza virus than that from healthy controls. [score:3]
Their result indicates that miR-148a is a negative regulator of the innate response and antigen presenting capacity of DCs. [score:2]
We found that miR-148a was significantly upregulated compared with the control samples by qRT-PCR assay, indicating that miR-148a has an important function in influenza virus infection. [score:2]
MiR-148a has been associated with different types of cancer [87, 88] and autoimmune diseases, such as multiple sclerosis [23], asthma [89] and systemic lupus erythematosus [90]. [score:2]
ROC curve analyses revealed that miR-31, miR-29a and miR-148a all had significant potential diagnostic value for critically ill patients infected with H1N1 influenza virus, which yielded AUC of 0.9510, 0.8951 and 0.8811, respectively. [score:1]
The microarray data were validated by performing, qRT-PCR for nine miRNAs, including hsa-miR-146b-5p, hsa-miR-148a, hsa-miR-150, hsa-miR-31, hsa-miR-155, hsa-miR-29a, hsa-miR-29b, hsa-miR-342-5p, and hsa-miR-886-3p. [score:1]
ROC curve analyses revealed that miR-31, miR-29a and miR-148a were valuable biomarkers for differentiating critically ill patients from controls: miR-31 yielded an AUC (the areas under the ROC curve) of 0.9510 (95% CI: 0.8734–1.029; P = 0.0001884) with 81.82% sensitivity and 92.31% specificity in discriminating critically ill patients; miR-29a yielded AUC of 0.8951 (95% CI: 0.7412–1.049 P = 0.0001070) with 90.91% sensitivity and 92.31% specificity in discriminating critically ill patients, and miR-148a yielded AUC of 0.8811 (95% CI: 0.7360–1.026 P = 0.001601) with 72.73% sensitivity and 100% specificity in discriminating critically ill patients(Figure 5). [score:1]
[1 to 20 of 11 sentences]
27
[+] score: 37
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-148b
Duursma et al's work [31] has shown that miR-148 can suppress Dnmt3b gene expression, targeting its protein coding region. [score:7]
Hence, miRTar has the potential power to elucidate the regulatory aspect of functional interactions (in which miRNA targets alternatively spliced exons), as shown in Figure 5. Figure 5 miR-148 targets protein coding region of DNMT3b in human. [score:6]
Hence, miRTar has the potential power to elucidate the regulatory aspect of functional interactions (in which miRNA targets alternatively spliced exons), as shown in Figure 5. Figure 5 miR-148 targets protein coding region of DNMT3b in human. [score:6]
According to previous research [31], the miR-148 target is in the coding region of DNMT3b gene. [score:3]
One of its splice variants Dnmt3b3 mRNA lacks the target sites of miR-148. [score:3]
Upon submission of the miRNA miR-148 and Dnmt3b gene using the miRTar web interface, miR-148 target sites prediction in all of the regions (5'UTR, CDS and 3'UTR) of gene transcripts is executed. [score:3]
Subsequently, based on the tables and graphs presented on the miRTar, miR-148 targets to CDS and 3'UTR of the Dnmt3b transcripts. [score:3]
For instance, Duursma et al. reported that human DNA methyltransferase 3b (DNMT3b) gene can be repressed by miR-148 family [31] and that the miR-148 target sites are located in the DNMT3b exons, which is alternatively spliced. [score:3]
Consequently, parts of the Dnmt3b transcripts can splice out the exon, resisting regulation by miR-148. [score:2]
The complementary sequences between of miR-148 and the transcripts are similar to those found in previous research [31]. [score:1]
[1 to 20 of 10 sentences]
28
[+] score: 33
The site#1 MRE-free DNMT3B3 transcript may escape translational suppression by hsa-miR-148a, which is expressed in many tissues, such as human embryonic stem cell [30], brain [31], cervix [32] and other tissues [33]. [score:7]
This phenomenon was observed not only in the hsa-miR-148a-regulated DNMT3B gene, but also in many target genes regulated by hsa-miR-124, hsa-miR-1, and hsa-miR-181a. [score:5]
In the DNMT3B3 gene, site#1 MRE-free transcript may escape repression of hsa-miR-148a without affecting expression of other targeted genes in the brain. [score:5]
The DNA methyltransferase 3b (DNMT3B) gene is known to contain two putative MREs that are targeted by the human microRNA hsa-miR-148a [7]. [score:3]
According to TarBase [35] and miRTarBase [36], hsa-miR-148a has one and seven experimentally verified target messenger RNAs, respectively. [score:3]
The DNMT3B analysis in this study showed that only site#1 MRE is highly complementary to hsa-miR-148a and is highly repressive (repressive ratio ~50%) of protein expression [7]. [score:3]
In other words, embryonic tissue expressed a higher proportion of site#1 MRE-containing transcript than that in all other tissues and might be more responsive to the hsa-miR-148a -mediated protein repression than that in all other tissues. [score:3]
The DNMT3B gene is a good example of the highly repressive splicing-regulated MRE of hsa-miR-148a. [score:2]
Since the proportion of site#2 MRE-containing transcripts was not significantly changed by alternative splicing event, site#2 MRE was not expected to have a great difference in hsa-miR-148a -mediated protein repression. [score:1]
Putative hsa-miR-148 recognition sites in human DNMT3B coding region. [score:1]
[1 to 20 of 10 sentences]
29
[+] score: 32
The quantitative PCR results confirmed the expression of two most upregulated (hsa-miR-361-5p and hsa-miR-214) and downregulated (hsa-miR-1225-5p and hsa-miR-148a) miRNAs in the same 35 GC pairs (Figure 1B). [score:9]
B. Validation of two most differentially upregulated (miR-214 and miR-361-5p) and downregulated (miR-148a and miR-1225-5p) miRNAs in tumor and corresponding nontumorous pairs used for microarray analysis. [score:7]
Two most upregulated (hsa-miR-361-5p and hsa-miR-214) and two most downregulated (hsa-miR-1225-5p and hsa-miR-148a) miRNAs were further validated using qRT-PCR in GC tissue pairs. [score:7]
The average mRNA expression levels in cancerous tissues were increased by 2.81- and 1.92-fold (p < 0.01 for both) for hsa-miR-361-5p and hsa-miR-214, but decreased by 4.76- and 6.25-fold (p < 0.01 for both) for hsa-miR-148a and hsa-miR-1225-5p relative to those in the adjacent normal tissues. [score:3]
For example, miR-148a has been shown to serve as a tumor suppressor in cancers of the liver [24, 25], prostate [26, 27], colon [28, 29], stomach [30], pancreas [31, 32], bladder [33], ovary [34] and breast [35, 36]. [score:3]
MiR-148a was significantly downregulated in both GC cell lines and GC tissue samples compared to the adjacent normal gastric tissues [37– 39] which is consistent with our findings in this study. [score:2]
Among them, previous reports have established the association of hsa-miR-148a, 214 and 361-5p with human cancers. [score:1]
[1 to 20 of 7 sentences]
30
[+] score: 31
The reintroduction of miR-148a and miR-34b/c in cancer cells with epigenetic inactivation inhibited cell motility, reduced tumor growth, and inhibited metastasis formation in xenograft mo dels, with an associated down-regulation of the miRNA oncogenic target genes, such as C-MYC, E2F3, CDK6, and TGIF2. [score:10]
miR-148a functions as a tumor metastasis suppressor in GC, and its down-regulation contributes to GC lymph-node metastasis and progression. [score:6]
Up-regulated miRNAs in NSCLC included miR-142-5p, miR-148b, miR-148a, miR-369-3p, miR-215, miR-152 and miR-155, whereas down-regulated miRNAs were miR-373 and miR-138-I. Some of these miRNAs have a well-characterized association with cancer progression, e. g., miR-10b, miR-21, miR-30a, miR-30e, miR-125b, miR-141, miR-200b, miR-200c, and miR-205 [90]. [score:5]
In addition, overexpression of miR-148a in GC cells reduces mRNA and protein levels of ROCK1, whereas miR-148a silencing significantly increased ROCK1 expression [110]. [score:5]
The authors examined miR-148a levels in 90 gastric cancer samples by qRT-PCR and showed clinicopathological significance with miR-148a expression. [score:3]
Particularly, the involvement of miR-148a, miR-34b/c, and miR-9 hyper-methylation in metastasis formation was also suggested in human primary malignancies because it was significantly associated with the appearance of lymph node metastasis. [score:1]
They also found that GC cells transfected with miRNA-148a had reduced migration and invasion capacities in vitro and metastasis ability in vivo. [score:1]
[1 to 20 of 7 sentences]
31
[+] score: 30
Table 1 The role of miRNAs in autoimmune diseases miRNA Predicted/Identified targets Function Related diseases miR-22 IRF8Enhances CD11c [+]CD11b [+]B220 [−] cDC generation at the expense of pDCs miR-142 IRF8Plays a pivotal role in the maintenance of CD4 [+] DCs miR-142-3p IL-6 Specifically inhibits IL-6 expression by moDC MS miR-21 IL-12p35, Wnt1 Negatively regulates the production of IL-12 by moDC; negatively regulate the development of moDC SLE, IBD, UC, MS miR-10a IL-12/IL-23p40 Suppress the production of IL-12 and IL-23 by moDC SLE miR-148/152 Calcium/Calmodulin- dependent protein kinase IIa Suppress the production of IL-12 and IL-6 SLE miR-23b Notch1, NF-κB Inhibits the production of IL-12 while promotes IL-10 production UC miR-155 SOCS1, SHIP1, TAB2 Positively regulates the production of several pro-inflammatory cytokines including IL-6, IL-23, IL-12, and TNF-α RA, IBD miR-146a IRAK1, TRAF6 Negatively regulates TLR4-NF-κB pathway in monocytes RA, SLE, IBD miR-34a JAG1 Negatively regulates the development of moDC MS miR-223 C/EBPβNegatively regulates LCs -mediated antigen-specific CD8 [+] T cell proliferation, production of inflammatory cytokine TNFα, IL-1β, and IL-23 by intestinal DCs. [score:25]
For example, miR-148/152 suppressed IL-12 as well as IL-6 production; miR-23b suppressed IL-12 production while enhancing IL-10 production (Liu et al., 2010). [score:5]
[1 to 20 of 2 sentences]
32
[+] score: 30
According to the results of TargetScan analysis, totally 2743 bovine genes were predicted as the targets of c-miRNAs significantly down-regulated by grazing (miR-19b, miR-148a, miR-150, miR-221, miR-223 miR-320a, miR-361, and miR-486). [score:8]
In previous studies, miR-148a expression was up-regulated during mouse adipogenesis [41] and shown to promote myogenesis of C2C12 myoblasts [42]. [score:6]
Thus, the lower level of circulating miR-148a in the grazing cattle might affect expression of target genes in their skeletal muscle or adipose tissue. [score:5]
The pattern of changes in the miR-221 expression level was closely similar to that of miR-148a in the present study. [score:3]
Of these c-miRNAs, circulation levels of miR-19b, miR-148a, miR-150, miR-221, miR-223, miR-320a, miR-361, and miR-486 were significantly down-regulated in the grazing cattle compared to housed cattle, whereas the miR-451 level was higher in the grazing than in the housed cattle. [score:3]
The microRNA-148/152 family: multi-faceted players. [score:1]
Exercise-related miRNAs: miR-148a, miR-221. [score:1]
In the present study, miR-148a showed a temporarily higher circulation level at 1 mo in the housed cattle than in the grazing cattle. [score:1]
The circulating level of miR-148a decreased from baseline levels after 12 weeks of endurance training [43]. [score:1]
The results of qRT-PCR normalized with the let-7g level showed that the levels of miR-19b, miR-148a, miR-150, miR-221, and miR-361, and miR-486 in the grazing cattle were lower than those in the housed cattle at 1 mo of grazing (P = 0.013, 0.014, 0.093, 0.011, 0.041, and 0.023, respectively) (Fig 6A). [score:1]
[1 to 20 of 10 sentences]
33
[+] score: 29
MiR-9-5p, miR-148a and miR-125a also have target sites in SCD, which is upregulated in the adipose tissue of the obese minipigs. [score:6]
LEP has target sites for three miRNAs: MiR-30a, miR-148a and miR-9-5p which were all downregulated in obese adipose tissue and muscle. [score:6]
LEP was the gene containing the most miRNA target sites, i. e. is targeted by miR-148a-3p, miR-125a-5p, miR-30a, miR-9-5p and miR-17-5p. [score:5]
MiR-204, miR-148a, miR-30a, miR-196b, and miR-17a were downregulated with fold changes of < -1.5 and p values < 0.05. [score:4]
MiR-30a and miR-148 are both involved in adipocyte differentiation, downregulated in obese adipose tissue in mice and are involved in myogenic differentiation [37– 39]. [score:4]
SCD is also targeted by many of the same miRNAs, namely miR-148a-3p, miR-125a-5 and miR-9-5p. [score:3]
In addition, miR-30a, miR-125a and miR-148a all had fold changes of < -1.5 and p values < 0.05. [score:1]
[1 to 20 of 7 sentences]
34
[+] score: 28
Mature miRNA expression could be classified into two groups: i) cardia-tissues: miRNAs rarely expressed in other tissues but expressed in gastric cardia, including miR-148a, miR-192, miR-200a and miR-200b; ii) quasi-ubiquitous: miRNAs expressed in many tissues and conditions, including miR-29c, miR-21, miR-24, miR-29b, miR-29a, miR-451, miR-31, miR-145, miR-26a, miR-19b and let-7b. [score:9]
The expression of mir-148a and mir-192 had been identified in other normal and cancerous human tissues, but was not over-expressed. [score:5]
Six miRNAs showed a low variable pattern of expression (miR-29b, miR-29c, miR-19b, miR-31, miR-148a, miR-451) and could be considered part of the expression pattern of the healthy gastric tissue. [score:4]
Basal expression of mir-148a has been observed in connective tissue and endocrine tissue [17]. [score:3]
Could observe miRNAs with high interindividual variation, for exempla miR-21, and another with low interindividual variation, e. g. expression pattern slightly variable (miR-29b, miR-29c, miR-19b, miR-31, miR-148a, miR-451). [score:3]
The high expression levels of miRNAs identified by ultra-deep sequencing (in descending order: miR-29c, miR-21, miR-148a, miR-29a, miR-24, miR-29b, miR-192, miR-451, miR-145, miR-31, miR-200a, miR-19b, miR-200b, let-7b and miR-26a) were validated with the TaqMan miRNA assays (Life Technologies). [score:2]
hsa-miR-148a ANKRD52 ; UBN2 ; TNRC6B ; EPS15 ; NFAT5 ; BACH2 ; PTEN ; CDK6 ; PTPRD ; DDX6 ; IGF1 ; CNOT6 ; GMFB ; SH3PXD2A ; KLF4 ; ATXN1 ; DICER1 ; SCML2 ; PIK3R3 ; SP1. [score:1]
Recently, mir-148a was found to be repressed in umbilical cord blood cells [18] and silenced by hypermethylation in colon tumors [19]. [score:1]
[1 to 20 of 8 sentences]
35
[+] score: 27
We performed Monte Carlo analysis on the 2102Ep and NTera-2 differential gene expression datasets and cross-referencing with the results with the differential miRNA expression results revealed 10 miRNAs in 2102Ep cells (mir-26a, miR-28, miR-30c, miR-148a, miR-200b, miR-517b, miR-518a-3p, miR-518b, miR-518c, miR-518f) and two miRNAs in NTera-2 cells (miR-200c and miR-367) to be potential master regulators of their inversely regulated target genes. [score:9]
The significant representation of known and putative miRNA inhibitors of EMT with validated EMT targets (miR-200b, miR-200c, miR-30c, miR-148a and miR-26a) provides functional significance to the wider SOX2-regulated miRNA-target network revealed in this study. [score:8]
Four of these miRNAs, miR-200b, miR-200, miR-30c and miR-148a, are established inhibitors of EMT and metastasis by targeting ZEB1 and ZEB2 (miR-200b/200c), TWF1 and VIM (miR-30c) and mesenchymal-to-epithelial transition (MET) (miR-148a) [68, 73, 74]. [score:5]
Zhang J-P Zeng C Xu L Gong J Fang J-H Zhuang S-M MicroRNA-148a suppresses the epithelial–mesenchymal transition and metastasis of hepatoma cells by targeting Met/Snail signalingOncogene 2013 75. [score:4]
While miR-26a, miR-30c, miR-148a, miR-200b, miR-200c and miR-367 are broadly conserved across vertebrate species, miR-28 is conserved only in mammals and miR-517b, miR-518f, miR-518b, miR-518c, miR-518a-3p, all as members of the C19MC polycistron, are found only in primates. [score:1]
[1 to 20 of 5 sentences]
36
[+] score: 25
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The top negatively correlated (conserved) mouse miRNAs include miR-30a/d (targets Runx2) [57], miR-148a (targets Met/Snail) [58], miR-503 (targets Bcl-2 and Igf1r, implicated in involution) [59], miR-203 (targets the transcription factor p63) [60] and miR-34a (targets Dll1 and CD44, important for stem cell activity) [61, 62]. [score:11]
Luminal-restricted miRNAs included miR-10a (targets KLF4 and PIK3CA) [41, 42], miR-200a/b (targets EMT (epithelial mesenchymal transition) genes) [43], miR-148a (targets Bim) [44] and miR-375 (targets PDK1) [45]. [score:9]
Zhang JP Zeng C Xu L Gong J Fang JH Zhuang SM MicroRNA-148a suppresses the epithelial-mesenchymal transition and metastasis of hepatoma cells by targeting Met/Snail signalingOncogene. [score:4]
In the context of miRNAs that potentially control these pathways, we identified several luminal-restricted miRNAs, including miR-10a, miR-200a/b, miR-203, miR-148a. [score:1]
[1 to 20 of 4 sentences]
37
[+] score: 25
GLUT1 expression is regulated by miR-148a-3p, miR-181a-5p, and miR-182-5p, which were highly expressed in HM cells. [score:6]
Suppressor of cytokine signaling (SOCS) protein family is also responsible for termination of GH-activated STAT signaling [68], where the expression of SOCS1-7 proteins is regulated by HM cell miR-182-5p, let-7f-5p, miR-148a-3p, miR-22-3p, miR-16-5p, miR-181a-5p, miR-141-3p (Figure S6). [score:6]
Specifically, AGPAT6 (1-acylglycerol-3-phosphate O-acyltransferase 6) is known to be regulated by the some of the top most highly expressed HM cell miRNAs (let-7f-5p, miR-182-5p, miR-148a-3p, and miR-22-3p), and has a direct effect on the synthesis of triacylglycerol and long chain acyl-CoA (fatty acids) [61]. [score:5]
miRNAs associated with anti-cancer effects in the breast and other organs (miR-181a-5p/148a-3p/30a-5p/141-3p/22-3p/182-5p and let-7f-5p) as well as with immune responses to disease (miR-148a-3p/ miR-181a-5p/182-5p/16-5p/99b/5p and let-7f-5p) were also identified at high expression levels in HM cells. [score:5]
β4GalT1 is regulated by HM cell miR-181a-5p, whereas α-LA by HM cell miR-148a-3p (Figure 6). [score:2]
The known miRNAs examined were: hsa-let-7f-5p, hsa-miR-181a-5p, hsa-miR-148a-3p, hsa-miR-22-3p, and hsa-miR-182-5p. [score:1]
[1 to 20 of 6 sentences]
38
[+] score: 24
Strikingly, expression levels of 5 miRNAs shown to be increased in centenarians (hsa-miR-148a, hsa-miR-345, hsa-miR-361-5p, hsa-miR-192, hsa-miR-454) have been demonstrated to be down-regulated during cellular senescence (Table 5). [score:6]
Among these, hsa-miR-148a was also found to be down-regulated with age in peripheral blood mononuclear cells (PBMCs) [48]. [score:4]
The 3 [′] UTR of RICTOR and the binding sites for miR-148a and miR-155 (fold change > 1.5) are shown in Figure 5. RICTOR is part of the TOR family of genes which are integral to growth and proliferation, and down-regulation of this pathway is shown to extend lifespan [54]. [score:4]
Among the 24 differentially expressed miRNAs, several have been previously characterized with known validated targets (Additional file 4: Table S4), including hsa-miR-148 and hsa-miR-122 [5, 37, 38]. [score:3]
Five miRNAs (hsa-miR-363*, hsa-miR-1974, hsa-miR-223*, hsa-miR-148a, hsa-miR-148a*) produced expression patterns consistent with the Illumina sequencing data (Figure 3). [score:3]
A subset of identified isomiRs and their compositions within the groups is listed in Table 2. We found variants within our most abundant miRNAs (e. g., hsa-let-7a and hsa-miR-21) and within our differentially expressed miRNAs (e. g., hsa-miR148a and hsa-miR-193b). [score:3]
1E-1653.37hsa-miR-99bCentenarian97 (15.32)276 (83.78)2.15E-244.96E-223.09hsa-miR-181a*Centenarian627 (24.30)1641 (307.63)4.5E-1231E-1202.84hsa-miR-363Centenarian4732 (260.52)11971 (2286.46)002.75hsa-miR-21*Centenarian2529 (286.89)6313 (1153.62)002.71hsa-miR-92b*Centenarian99 (11.67)245 (42.00)2.45E-185.66E-162.69hsa-miR-20b*Centenarian319 (77.91)708 (84.88)5.78E-421.33E-392.41hsa-miR-148aCentenarian11599 (1225.92)25583 (655.62)002.40hsa-miR-1975Centenarian1654 (86.54)3529 (335.65)2. 1E-1884.9E-1862.32hsa-miR-502-3pCentenarian191 (13.48)387 (14.66)4.03E-209.31E-182.20hsa-miR-181cCentenarian153 (6.46)310 (63.42)1.8E-164.15E-142.20hsa-miR-1259Centenarian106 (25.78)210 (29.26)4.01E-119.27E-092.15hsa-miR-148a*Centenarian339 (46.74)656 (14.26)3.38E-307.82E-282.10hsa-miR-192Centenarian7126 (1026.34)13754 (2446.01)002.10hsa-miR-361-5pCentenarian307 (20.35)587 (89.41)1.65E-263.81E-242.08hsa-miR-9Centenarian341 (26.37)629 (37. [score:1]
[1 to 20 of 7 sentences]
39
[+] score: 24
This pattern included the two created target sites for ssc-miR-34a and ssc-miR-34c, both predicted by TargetScan and PACMIT in SLA-1 (Figure 3 A); the disrupted target site for ssc-miR-148a in HSPA1A predicted by PACMIT and TargetSpy (Figure 3 B); the ssc-miR-133b (TargetScan and PACMIT), ssc-miR-133a-3p (TargetScan) and ssc-miR-323 (TargetSpy) created target sites in RNF5 (Figure 3 C); and the disrupted site for ssc-miR-2320 predicted by TargetSpy in SLA-1 (Figure 3D). [score:19]
Allele-specific targeting of HLA-G, a non-classical HLA class I locus, by miR-148a and miR-148b, is associated with risk of asthma [41]. [score:3]
This can be explained by the additional accessibility criterion of PACMIT as sites considered as created or disrupted by PACMIT may only reveal changes in secondary structures which are not predicted by TargetScan (e. g. the created ssc-miR-339-5p and ssc-miR-4334-3p sites in CREBL1 3′-UTR, and the disrupted ssc-miR-148a, ssc-miR-148b and ssc-miR-152 sites in HSPA1A). [score:2]
[1 to 20 of 3 sentences]
40
[+] score: 24
To confirm the microarray hybridization results, qRT-PCR was performed on 8 up-regulated miRNAs (miR-335, miR-146b-5p, miR-26b, miR-30b, miR-21, miR-378, miR-143 and miR-148a) [10] and 3 down-regulated miRNA (miR-155,miR-221, and miR-1275), chosen on the basis of their levels of expression on the microarray and their biological significance. [score:9]
In our previous study, we found that miR-148a, as a biomarker of obesity, promoted adipogenesis by inhibiting Wnt1 [5]. [score:3]
Indeed, our previous study found that miR-148a promotes hMSCs-Ad to differentiate to mature adipocyte by targeting Wnt1 [5]. [score:3]
Among these differentially expressed miRNAs, our group did further research for the adipogenic miRNAs in vivo and in vitro, including miR-148a [5], miR-26b [10], miR-146b [6] and miR-1275. [score:3]
Therefore, our present and previous studies bring in valuable information with respect to human obesity pathology because we have demonstrated that miR-148a, miR-146b, miR-26b and miR-335 are dysregulated in the process of adipocyte differentiation. [score:2]
In particular, our study found that miR-148a through regulating Wnt1, but not Wnt10b, promotes hMSCs-Ad differentiation [5]. [score:2]
We identified that miR-148a, miR-26b, miR-132, miR-365 and miR-1908 were highly expressed in mature adipocytes with over 5-fold compared to SVCs/hMSCs-Ad. [score:2]
[1 to 20 of 7 sentences]
41
[+] score: 23
Intriguingly, miR-148a directly downregulated DNMT1 expression by targeting the protein coding region of its transcript. [score:9]
miR-21 and miR-148a downregulated DNA methyltransferase 1 (DNMT1) expression in vitro and in vivo, decreasing DNMT1 production in T cells. [score:6]
In addition, miR-21 and miR-148a induced the overexpression of methylation-sensitive, autoimmune -associated genes in CD4 [+] T cells including CD70 and LFA-1. Furthermore, the investigators found that the effects were reversed when inhibitors of either miR-21 or miR-148a were transfected into CD4 [+] T cells isolated from SLE patients, implying that hypomethylation in CD4 [+] T cells can potentially be alleviated by inhibiting these miRNAs [71]. [score:5]
While a putative miR-148a binding site has been predicted in the 3′ UTR of DNMT1, there are no predicted binding sites for miR-21. [score:1]
The overexpression of miR-148a has also been investigated in CD4 [+] T cells from patients with lupus as well as lupus-prone mice. [score:1]
Due to the importance of DNA methylation abnormalities in SLE pathogenesis, Pan et al. examined the roles of mir-21 and miR-148a in aberrant CD4 [+] T cell DNA hypomethylation [71]. [score:1]
[1 to 20 of 6 sentences]
42
[+] score: 23
Another study shows miR-148a-5p functions by directly targeting and inhibiting Myc expression, whereas miR-363-3p destabilizes Myc protein by directly targeting and inhibiting USP28. [score:13]
Li et al. demonstrated that miR-148a expression was significantly lower in a cancer stem cell-like subtype, which is clinically aggressive and associated with poor survival, than in other subtypes. [score:3]
However, inhibition of miR-148a-5p or miR-363-3p induces hepatocarcinoma by promoting G1–S-phase cell cycle transition, whereas their activation has the opposite effect [74]. [score:3]
MiR-148a expedites cell proliferation, cell cycle progression, cell migration, and anchorage independent growth by downregulating the PTEN protein [31]. [score:3]
Moreover, the miR-148a–ACVR1-BMP-Wnt circuit could profile/determine an advanced clinical stem cell-like subtype of HCC [83]. [score:1]
[1 to 20 of 5 sentences]
43
[+] score: 23
Ultimately, four down-regulated plasma miRNAs (i. e., miR-26a, miR-142-3p, miR-148a and miR-195) were selected as the candidates for the fist-stage validation (Table 2). [score:4]
In summary, our study revealed four down-regulated miRNAs, miR-148a, miR-142-3p, miR-26a, and miR-195, in GC patients. [score:4]
0151345.g002 Fig 2(A-D) Relative expression levels of miR-26a, miR-142-3p, miR-148a, miR-195, in 50 paired gastric cancer tissues and corresponding noncancerous tissues (log [10] scale on Y -axis). [score:3]
The plot showed that the expression levels of four miRNAs were statistically significant in the GC tissues (P = 0.001, P = 0.002, P < 0.001 and P = 0.003 for miR-26a, miR-142-3p, miR-148a and miR-195, respectively, Figs 2A–2D). [score:3]
Box plots showed the plasma levels of miR-26a (A), miR-142-3p (B), miR-148a (C) and miR-195 (D) in 200 gastric cancer patients and 200 age- and gender-matched healthy controls. [score:1]
ROC curves were constructed to show AUCs of miR-26a (A), miR-142-3p (B), miR-148a (C), miR-195 (D) and the combination of four miRNAs (E). [score:1]
The sensitivity and specificity were 75.4% and 83.1% for miR-148a, 69.2% and 75.4% for miR-195, respectively (Fig 4C and 4D). [score:1]
Comparing TLDA analysis and the result of tissue microarray, four miRNAs(miR-26a, miR-142-3p, miR-148a and miR-195) reduced in GC were selected. [score:1]
The AUCs were 0.842 (95% CI = 0.803–0.882) and 0.765 (95% CI = 0.717–0.812) for miR-148a and miR-195, respectively. [score:1]
S1 Fig The combination of miR-26a and miR-142-3p (A), the combination of miR-26a and miR-148a (B), the combination of miR-26a and miR-195 (C), and the combination of miR-142-3p and miR-148a (D), the combination of miR-142-3p and miR-195(E) and the combination of miR-148a and miR-195 (F) yielded the largest AUCs. [score:1]
0151345.g004 Fig 4 ROC curves were constructed to show AUCs of miR-26a (A), miR-142-3p (B), miR-148a (C), miR-195 (D) and the combination of four miRNAs (E). [score:1]
0151345.g003 Fig 3Box plots showed the plasma levels of miR-26a (A), miR-142-3p (B), miR-148a (C) and miR-195 (D) in 200 gastric cancer patients and 200 age- and gender-matched healthy controls. [score:1]
S2 Fig The combination of miR-26a, miR-142-3p and miR-148a (A), the combination of miR-26a, miR-142-3p and miR-195 (B), the combination of miR-26a, miR-148a and miR-195 (C) and the combination of miR-142-3p, miR-148a and miR-195 (D) yielded the largest AUCs. [score:1]
[1 to 20 of 13 sentences]
44
[+] score: 22
Other miRNAs from this paper: hsa-mir-99a, hsa-mir-34a, hsa-mir-449a, hsa-mir-1297
miR-148a modulates the expression of runt-related transcription factor 3 (RUNX3), an important tumor suppressor, through inhibition of DNMT1 -dependent in gastric cancer [96]. [score:7]
These reports suggest that miR-148a suppression contributes to MEG3 down-regulation in gastric cancer by DNMT-1 activation [97]. [score:6]
miR-148a suppresses tumorigenesis through regulating DNA methyltransferase 1 expression [95]. [score:6]
In addition, a positive correlation is noted between MEG3 and miR-148a expression levels (Figure 5C). [score:3]
[1 to 20 of 4 sentences]
45
[+] score: 22
0114627.g002 Figure 2. TaqMan real-time RT-PCR to validate the expression levels of nine up regulated miRNAs, including let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b (A) and three down regulated miRNAs, including miR-885-5p, miR-181a, and miR-320c (B) from miRNA array were selected for further validation using individual exosomal samples from BMSCs when cultured at 0, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 7 days. [score:5]
TaqMan real-time RT-PCR to validate the expression levels of nine up regulated miRNAs, including let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b (A) and three down regulated miRNAs, including miR-885-5p, miR-181a, and miR-320c (B) from miRNA array were selected for further validation using individual exosomal samples from BMSCs when cultured at 0, 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 7 days. [score:5]
In more detail, the expression level of miR-199b in BSMC exosomes was 3.75±0.81 folds increase at day 4 of osteogenic differentiation compared to that of day 0. miR-218 has a 2.81±1.01 over expression on day 3 osteogenic differentiation relative to that of day 0. There was a 3.11±0.94 increase of expression levels of miR-148a on day 1 compared to that of day 0. miR-135b has 2.99±o. [score:5]
Nine up regulated miRNAs (let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b) and five down regulated miRNAs (miR-221, miR-155, miR-885-5p, miR-181a, and miR-320c) from miRNA array were selected for further validation using individual exosomal samples from BMSCs when cultured at 0, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 7 days. [score:3]
nine up regulated miRNAs (let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b) and five down regulated miRNAs (miR-221, miR-155, miR-885-5p, miR-181a, and miR-320c) from miRNA array were further quantitated by TaqMan miRNA assays (Applied Biosystems). [score:2]
Furthermore, we found that let-7a, miR-199b, miR-218, miR-148a, miR-135b, miR-203, miR-219, miR-299-5p, and miR-302b were significantly increased in individual exosomal samples from human BMSCs. [score:1]
Two-dimensional grid matrix displaying 5 differential miRNAs (miR-199b, miR-218, miR-148a, miR-135b, and miR-221) was obtained by the functional heat-map in R. Columns refer to time course comparison: human BMSC culture at 0, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 7 days. [score:1]
[1 to 20 of 7 sentences]
46
[+] score: 22
In the present study, we showed that the expression of several miRNAs is altered during the development of PC and that licofelone reverses the altered expression of the majority of these miRNAs with up-regulation of miR-21, miR-222, Let-7, miR-125, miR-142 and down-regulation of miR-1, miR-122 and miR-148. [score:12]
MicroRNA-148a is down-regulated in human PDAC and regulates cell survival by targeting CDC25B [49]. [score:6]
Most importantly, the miRNAs most strongly implicated in regulation of arachidonic acid metabolism via COX-2 and 5-LOX — like miR-199a, miR-21, miR-146, miR-29, miR148 — were tremendously modulated by licofelone treatment, clearly demonstrating targeted effects of this agent (Fig. 7C–7G, Supplementary Table 1). [score:4]
[1 to 20 of 3 sentences]
47
[+] score: 22
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-204, hsa-mir-205, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-217, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-370, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-335, hsa-mir-133b, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-574, hsa-mir-605, hsa-mir-33b, hsa-mir-378d-2, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-378j
For example, one of the most highly expressed microRNA in HM, miR-148a-3p [35, 44], which is also found in other species’ milk [51, 52], targets DNA methyltransferase 3b (DNMT3B) and suppresses its expression, potentially to facilitate DNA methylation during development [176]. [score:10]
Also, two highly expressed microRNAs (miR-148a and miR-200c) in bovine milk were differentially expressed among the three different types of infant formula [54]. [score:5]
miR-148a-3p, which has been found to be the most highly expressed microRNA in exosomes of HM [36], bovine [52] and porcine milk [51], has been proposed as a biomarker for raw milk quality control in the dairy industry, and also for artificial infant formulae [52]. [score:3]
In addition to miR-148-3p, controversies exist over miR-494, which has been identified to be present in high concentrations in both HM [48] and bovine milk by Izumi et al. [54], but in very low concentrations in bovine milk by Chen et al. [52]. [score:1]
However, Weber et al. [30] reported a lower concentration of miR-148a in skimmed HM than what was previously shown in bovine skimmed milk by Chen et al., in HM exosomes by Zhou et al., and in porcine milk exosomes by Gu et al. [36, 51, 52]. [score:1]
[30, 44, 52]bta-miR-148hsa-miR-148a-3pUCAGUGCACUACAGAACUUUGUUCAGUGCACUACAGAACUUUGUBovine milk. [score:1]
Of the 10 most abundant, 4 microRNAs were associated with immune functions, including miR-148a-3p, miR-30b-5p, miR- 182-5p, and miR-200a-3p [36]. [score:1]
[1 to 20 of 7 sentences]
48
[+] score: 20
Liffers et al. [52] reported that miR-148a is down-regulated in human pancreatic ductal adenocarcinomas and regulates cell survival through targeting CDC25B. [score:7]
In peak lactation, miR-143, miR-143-3p and miR-148a-3p were predominately expressed with more than 100,000 reads, and these miRNAs constituted 30.71% of the total sequencing reads, suggesting they are abundantly expressed during this period. [score:5]
Zhang et al. [51] reported that miR-148a targets the ROCK1 gene to promote myogenic differentiation. [score:3]
Three other miRNAs, miR-148a-3p, let-7-5p and let-7b were also identified as high-count sequences with more than 1,000,000 reads in both libraries (Table 2 and Tabel S1). [score:1]
In our study, miR-148a has high abundance, it may be involve in mammary gland cell proliferation and apoptosis and play an important role in mammary gland physiology or lactation. [score:1]
However, in late lactation, miR-143, let-7, miR-21, miR-148, miR-30, miR-146, miR-107 and miR-103 were the most abundant, each with more than 100,000 reads. [score:1]
In two libraries, let-7, miR-143, miR-148, miR-378, miR-146 and miR-21 were detected with high abundance (Table S1). [score:1]
In recent years, numerous studies have indicated that miR-148a is involved in cell differentiation or proliferation. [score:1]
[1 to 20 of 8 sentences]
49
[+] score: 20
[21] Out of the nine miRNAs that were screened, four were upregulated (miR-135b, miR-155, miR-205 and miR-206: Figure 1a) and five were downregulated (miR-31, miR-148a, miR-181c, miR-200b and miR-210: Figure 1b). [score:7]
[21]Out of the nine miRNAs that were screened, four were upregulated (miR-135b, miR-155, miR-205 and miR-206: Figure 1a) and five were downregulated (miR-31, miR-148a, miR-181c, miR-200b and miR-210: Figure 1b). [score:7]
[30] Three of the downregulated miRNAs (miR-148a, miR-181c and miR-210) are normally highly expressed during lactation in the mouse mammary gland. [score:6]
[1 to 20 of 3 sentences]
50
[+] score: 20
Other miRNAs from this paper: hsa-mir-152, hsa-mir-148b
The presence of guanine at position +3142 may increase the affinity for miR-148a, miR-148b, and miR-152, which may downregulate the expression of HLA-G by RNA degradation or translation suppression [151, 152]. [score:10]
The binding of miR-148a and miR-152 downregulates the expression of HLA-G by RNA degradation or translation suppression. [score:10]
[1 to 20 of 2 sentences]
51
[+] score: 20
Liffers 43 found that miR-148a exhibited a significant fourfold downregulation in pancreatic ductal adenocarcinoma as opposed to normal pancreatic ductal cells and observed that stable lentiviral mediated overexpression of miR-148a in pancreatic cancer cell line, inhibited tumor cell growth and colony formation. [score:8]
MiR-375 was reported to be consistently downregulated in six studies followed by miR-148a and miR-30d in five studies. [score:4]
In the consistently reported downregulated miRNAs, miR-375 was reported in six studies followed by two miRNAs, miR-148a, and miR-30d in five studies. [score:4]
In this systematic review study, we found miR-148a and miR-30d were consistently reported downregulated in five studies. [score:4]
[1 to 20 of 4 sentences]
52
[+] score: 18
In turn, miR-148a-5p directly targets and inhibits c-Myc expression, whereas miR-363-3p destabilizes c-Myc by directly targeting ubiquitin-specific protease 28. [score:11]
c-Myc directly binds to the promoters of miR-148a-5p/ miR-363-3p genes and represses their expression, inducing hepatocellular tumorigenesis by promoting G1 to S phase progression. [score:4]
Bcl-2 was also regulated by other miRNAs, such as miR-204, [87] miR-148a [88] and miR-365. [score:2]
Using similar approach, Lujambio et al. [50] discovered miR-148a, and miR-34b/c cluster is subject to specific hypermethylation -associated silencing in cancer cells. [score:1]
[1 to 20 of 4 sentences]
53
[+] score: 18
MiR-148a is an established inhibitor of Dnmt1 expression [34], thus Dnmt1- KO SMCs, through increased miR-148a, likely create even further repression of Dnmt1 expression. [score:7]
Nan W MicroRNA-21 and microRNA-148a contribute to DNA hypomethylation in lupus CD4+T cells by directly and indirectly targeting DNA methyltransferase 1J. [score:5]
Furthermore, both miR-10b and miR-148a expression are known to regulated by genomic CpG methylation 31, 35. [score:4]
We also noted increases in miRNAs associated with regulating cellular identity and proliferation including, miR-10b [31], miR-21a [32], miR-486a [33], and miR-148a. [score:2]
[1 to 20 of 4 sentences]
54
[+] score: 18
To further determine whether our finding as described above can be translated into a clinical application, three upregulated (miR-193a, miR-126 and miR-148a) and one downregulated miRNA (miR-196b) found in the exosomes isolated from metastatic liver in a mouse colon cancer were analysed in samples from colon cancer patients by qPCR. [score:9]
However, we demonstrated that knockout of MVP in CT26 cells leads to miR-193a accumulation in the cells without affecting the levels of miR-126a or miR-148a, suggesting that MVP selectively targets miR-193a. [score:4]
qPCR analysis of miR-193a, miR-126a and miR-148a expression in colon cancer tissue and adjacent non-tumour tissue from the same patients (right panel). [score:3]
Although miR-148a increased in the plasma of colon cancer patients, no difference in miR-148a level between tumour tissue and adjacent tissue was evident (Fig. 6c, right panel). [score:1]
The results generated from qPCR show that miR-126a, miR-148a and miR-193a are significantly higher in the exosomes released from metastatic CT26 cells and circulating in the peripheral blood of metastatic colon cancer in the liver, but not from primary colon cancer or subcutaneous xenografts. [score:1]
[1 to 20 of 5 sentences]
55
[+] score: 17
Other miRNAs from this paper: hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-192, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-187, hsa-mir-181a-1, hsa-mir-221, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-152, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-193a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-148b, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-454, ssa-mir-10a-1, ssa-mir-10a-2, ssa-mir-10b-1, ssa-mir-10b-2, ssa-mir-10b-3, ssa-mir-10b-4, ssa-mir-10d-1, ssa-mir-10d-2, ssa-mir-122-1, ssa-mir-122-2, ssa-mir-125b-1, ssa-mir-125b-2, ssa-mir-125b-3, ssa-mir-146a-1, ssa-mir-146a-2, ssa-mir-146a-3, ssa-mir-148a, ssa-mir-148b, ssa-mir-152, ssa-mir-16a-1, ssa-mir-16a-2, ssa-mir-181a-1, ssa-mir-181a-2, ssa-mir-181a-3, ssa-mir-181a-4, ssa-mir-181a-5, ssa-mir-181b, ssa-mir-181c, ssa-mir-192a-1, ssa-mir-192a-2, ssa-mir-192b, ssa-mir-193, ssa-mir-21a-1, ssa-mir-21a-2, ssa-mir-21b, ssa-mir-221, ssa-mir-23a-3, ssa-mir-23a-4, ssa-mir-23a-1, ssa-mir-23a-2, ssa-mir-25-1, ssa-mir-25-2, ssa-mir-25-3, ssa-mir-26a-1, ssa-mir-26a-2, ssa-mir-26a-3, ssa-mir-26a-4, ssa-mir-26a-5, ssa-mir-26a-6, ssa-mir-26b, ssa-mir-26d, ssa-mir-30a-3, ssa-mir-30a-4, ssa-mir-30a-1, ssa-mir-30a-2, ssa-mir-30b, ssa-mir-30c-1, ssa-mir-30c-2, ssa-mir-30d-1, ssa-mir-30d-2, ssa-mir-30e-1, ssa-mir-30e-2, ssa-mir-30e-3, ssa-mir-454, ssa-mir-462a, ssa-mir-92a-1, ssa-mir-92a-2, ssa-mir-92a-3, ssa-mir-92a-4, ssa-mir-92b
With regards to the importance of the MIR146a and MIR148a in regulating key cellular processes in the diseased liver state (Fig 5B), we believe that the modulation of the miRNA expression in the liver of whitefish after 14 and 28 days of the exposure may be linked to the chronic effects of MC-LR exposure [39] and the potential activity of the cyanotoxin as a tumor promoter [1]. [score:6]
We focused on 6 aberrantly expressed miRNAs found in our study (MiR122, MiR92a(b), MiR146a, MiR148a, MiR221) for which contributions to a disease state of liver in humans have been proven. [score:5]
On the other hand, down-regulated MIR148a triggers processes of cell proliferation, progression and migration in hepatocelluar carcinoma [73, 74]. [score:4]
The microRNA-148/152 family: multi-faceted players. [score:1]
Role of miR-148a in hepatitis B associated hepatocellular carcinoma. [score:1]
[1 to 20 of 5 sentences]
56
[+] score: 17
The sequencing results for seven highly expressed miRNAs (hsa-mir-145, hsa-mir-29a, hsa-mir-29c, hsa-mir-21, hsa-mir-451a, hsa-mir-192 and hsa-mir-148a) were validated using singleplex real-time PCR (qRT-PCR) to determine their expression levels in the gastric antrum region of 10 healthy individuals. [score:5]
Of the seven miRNAs that were simultaneously expressed in both tissues, five miRNAs maintained a relatively similar expression level after normalization: hsa-mir-29c, hsa-mir-21, hsa-mir-451a, hsa-mir-192 and hsa-mir-148a (Table 2). [score:5]
The high miRNA expression levels demonstrated by ultra-deep sequencing (in descending order of expression level : hsa-mir-145, hsa-mir-29a, hsa-mir-29c, hsa-mir-21, hsa-mir-451a, hsa-mir-192 and hsa-mir-148a) were validated using TaqMan miRNA assays (Life Technologies). [score:4]
After filtering and aligning using with MirBase, 148 mature miRNAs were identified in the gastric antrum tissue, totaling 3,181 quality reads; 63.5% (2,021) of the reads were concentrated in the eight most highly expressed miRNAs (hsa-mir-145, hsa-mir-29a, hsa-mir-29c, hsa-mir-21, hsa-mir-451a, hsa-mir-192, hsa-mir-191 and hsa-mir-148a). [score:3]
[1 to 20 of 4 sentences]
57
[+] score: 17
Other miRNAs from this paper: hsa-mir-15a, hsa-mir-1290
A series of data demonstrated that miR-148a-3p was downregulated in cisplatin-resistant gastric carcinoma cell lines and its reconstitution sensitized cells to cisplatin treatment through promoting mitochondrial fission and decreasing the AKAP1 expression level, which played a novel role in cisplatin resistance by inhibiting p53 -mediated DRP1 dephosphorylation. [score:8]
MiR-148a-3p (microRNA-148a-3p) reconstitution in resistant cells inhibits cytoprotective autophagy by suppressing RAB12 expression and mTOR1 activation [163]. [score:7]
Li B. Wang W. Li Z. Chen Z. Zhi X. Xu J. Li Q. Wang L. Huang X. Wang L. Microrna-148a-3p enhances cisplatin cytotoxicity in gastric cancer through mitochondrial fission induction and cyto-protective autophagy suppressionCancer Lett. [score:2]
[1 to 20 of 3 sentences]
58
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
In this study, three members of this family (miR-148a, miR-148b and miR-152, Figure 12H) showed modest expression levels, suggesting that miR-148 may be a stably expressed miRNA in exosomes of most mammals including pigs. [score:5]
MiR-148a has been reported to be a tumor metastasis suppressor in gastric cancer [59], and ectopic expression of miR-148a was shown to induce apoptosis and silence Bcl-2 in colorectal cancer cells [60]. [score:5]
Furthermore, miR-148a, a potential biomarker for quality control in bovine milk [57] and human milk [28], which was found to be highly expressed throughout the lactation period of Yorkshire sows [29], was only detected at a moderate level in Landrace pigs in our study. [score:3]
By bioinformatics analysis, miR-148a was determined to be possibly related to immunity and gastrointestinal health, but the underlying regulatory mechanism remains unclear. [score:2]
In our study, 8 miRNA families (let-7, mir-1, mir-17, mir-181, mir-148, mir-30, mir-92 and mir-99) were found with at least 3 members among all exosome miRNAs. [score:1]
MiR-148a was reported to be an important biomarker for milk exosome miRNAs [28, 57]. [score:1]
[1 to 20 of 6 sentences]
59
[+] score: 16
Intringuingly, out of the 12 validated miRNA hits, five (miR-148a, miR-17-5p, miR-25, miR-130a, and let-7a) were significantly downregulated by HCV, while others were also suppressed, but to a lesser extent (Fig.   2e). [score:6]
Five miRNAs targeted the replication stage only, as their overexpression significantly enhanced (miR-151-5p) or diminished (miR-130a, miR-196a, miR-148a, and miR-30a-5p) HCV RNA replication but not IRES -mediated translation in the replicon assays (Fig.   3c). [score:6]
Overexpression of let-7a, let-7b, or miR-148a significantly blocked both HCVpp and VSV-Gpp infections (Fig.   3b). [score:3]
Among them, three are proviral miRNAs (miR-122, miR-151-5p, and miR-17-5p), and nine others, including let-7a, let-7b, miR-130a, miR-148a, miR-181a, miR-196a, miR-30a-5p, miR-99b, and miR-25, are antiviral factors (Fig.   2c). [score:1]
[1 to 20 of 4 sentences]
60
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
For example, miR-148a and miR-143 are highly expressed in both bovine and goat mammary glands during lactation [49]; miR-148a and miR-26a have been shown to demonstrate consistent expression patterns in bovine milk throughout the lactation period [50] and miR-21-5p increased in expression remarkably at fresh period compared with dry period [23]. [score:6]
Six (bta-miR-148a, miR-26a, miR-21-5p, miR-27b, le-7f and let-7a-5p), four (bta-miR-30a-5p, miR-26a, miR-21-5p and let-7a-5p) and five (bta-miR-148a, miR-26a, let-7a-5p, miR-143 and miR-21-5p) of the highly expressed miRNAs in our study are also among the top 10 highly expressed miRNAs detected respectively in bovine mammary epithelial cells (MAC-T) [43] and lactating glands [24, 48]. [score:5]
Furthermore, miR-148a can repress WNT (Wingless/INT-1) signaling and thus promote adipogenesis [53] while miR-27b can repress human adipocyte differentiation by directly targeting PPARγ [54]. [score:4]
Accumulating evidence support the notion that miR-148a can promote cell proliferation and differentiation [51, 52]. [score:1]
[1 to 20 of 4 sentences]
61
[+] score: 16
Other miRNAs from this paper: hsa-mir-152, hsa-mir-184, hsa-mir-148b, hsa-mir-675
Based on these data, we drew a conclusion that H19 suppressed miR-148 expression by direct interaction. [score:6]
Collectively, these data indicated that H19 acted as a ceRNA of miR-148 to enhance expression of target gene WNT1 in HA-VSMCs. [score:5]
Furthermore, miR-148 inhibitor exerted its pro-proliferation and anti-apoptosis effects through activating WNT/β-catenin signaling in ox-LDL-stimulated HA-VSMCs. [score:3]
miR-148b is a member of miR-148/miR-152 family, which also contains miR-148a and miR-152 [28]. [score:1]
Yang et al. demonstrated that miR-148a and miR-152 were associated with homocysteine-facilitated foam cell differentiation and atherosclerotic lesion [30]. [score:1]
[1 to 20 of 5 sentences]
62
[+] score: 15
MiR-146a/b and miR-148 directly inhibited UHRF1 and DNMT3b, respectively. [score:4]
MiR-146a/b and miR-148 can regulate RUNX3 expression via the effects of UHRF1 and DNMT1 on promoter methylation. [score:4]
Downregulation of miR-146a/b and miR-148 led to the increase in UHRF1 and DNMT3b, and this effect in turn inactivated RUNX3 via promoter methylation in gastric cancer. [score:4]
Duursma et al. found that miR-148 targets human DNMT3b [96]. [score:3]
[1 to 20 of 4 sentences]
63
[+] score: 15
RT-PCR validation of mostly dysregulated miRs confirmed that miR-138, miR-147b, miR-148a, miR-99a, miR-455-3p and miR-125b were significantly upregulated and miR-31-star, miR-422a, miR-330-3p, mir-330-5p and miR-378d were downregulated in PANC-1-GR cell clones vs. [score:8]
In MIA-PaCa-2-GR cell clones miR-125b, miR-210, miR-21, miR-100, miR-148a, miR-99a and miR-455-3p were significantly upregulated, whereas miR-330-3p, miR-330-5p, miR-486-5p, miR-422a and miR-31-star were significantly downregulated (Fig 6B). [score:7]
[1 to 20 of 2 sentences]
64
[+] score: 15
Expression levels of the other miRNAs were calculated as fold changes based on the miR-214 expression level of 1. miR-148, miR-494, miR-124, miR-193, and miR-300 showed increased expression levels from day 1 to 7. miR-148 showed very high expression levels (2272 to 6517 fold changes compared with that of miR-214) (Figure 3B), while miR-132, miR-186, miR-199, miR-338, and miR-219 showed decreased expression from day 1 to 7 (Figure 3C). [score:8]
The second group that had a low expression level on day 1 and a high expression level on day 7 included miR-148, miR-494, miR-124, miR-193, and miR-300. [score:5]
Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
Figure 3Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
[1 to 20 of 4 sentences]
65
[+] score: 15
A total of 10 and 14 miRNAs were upregulated (e. g. miR-1246 and miR-148-a) and down-regulated (e. g. miR- 551b and miR-10a) respectively during megakaryocyte differentiation, all of which were confirmed by qPCR. [score:7]
In agreement with Petriv et al. (31), we show miR-148 up-regulation in megakaryocytes. [score:4]
MiR-148 targets CDC, SCL and BCL-2, and may decrease the self-renewal property of progenitor cells and apoptosis, leading to the differentiation process (32). [score:2]
Among these, ten were significantly up- regulated in megakaryocytes with the top four being miR1246, miR-148a, miR-22 and miR-188 from 18 to 5 fold increase. [score:2]
[1 to 20 of 4 sentences]
66
[+] score: 14
Particularly interesting is the report of miR-148a overexpression (Table 1) [50] and p27 downregulation in CC tissues [75]. [score:6]
Cell proliferation and cell cycle progression is promoted by miR-148a overexpression through p27 mRNA degradation, a CDK inhibitor [74]. [score:5]
This suggests that miR-148a might promote cervical cell proliferation and CC by repressing p27 expression (Figure 1). [score:3]
[1 to 20 of 3 sentences]
67
[+] score: 14
The analysis for the KC animals compared to controls revealed that miR-150, miR-494, miR-138, miR-148a*, miR-216a, and miR-217 (p-value = 0.01) were significantly downregulated (Table 1), whereas, miR-146b, miR-205, miR-31, miR-192, and miR-21 (p-value = 0.01) were significantly upregulated (Table 2). [score:6]
Similarly, another study showed that the expression of miR-148a/b and miR-375 were significantly downregulated in the PC developed from p48Cre;Kras [G12D] transgenic animals compared to the normal controls [59]. [score:5]
The also revealed decreased expression of miR-148a and miR-451 in mouse PC, an observation consistent with other reports [40, 41, 55– 58]. [score:3]
[1 to 20 of 3 sentences]
68
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-214, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, hsa-mir-1-1, hsa-mir-128-2, hsa-mir-29c, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-148b, hsa-mir-133b, hsa-mir-424, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-128-1, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-503, hsa-mir-411, hsa-mir-378d-2, hsa-mir-208b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-17, ssc-mir-221, ssc-mir-133a-1, ssc-mir-1, ssc-mir-503, ssc-mir-181a-1, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-29a, ssc-mir-199a-2, ssc-mir-128-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-486-1, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-23b, ssc-mir-148b, ssc-mir-208b, ssc-mir-424, ssc-mir-127, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-411, ssc-mir-133a-2, ssc-mir-126, ssc-mir-199a-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-378j, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, hsa-mir-486-2, ssc-mir-378b
Similarly, ssc-miR-148b, -542-3p and -30 family (a-5p/d/e-5p) showed similar expression patterns with ssc-miR-148a and -126, highly expressed and down-regulated at 77 dpc to 180 dpn (Figure 5E), making it possible that they belong to the candidate myogenic miRNAs. [score:8]
MiR-148a has been identified as a novel myogenic miRNA that mediated myogenic differentiation via targeting ROCK1 [27], while miR-126 attenuated insulin signaling [57] and governed vascular integrity and angiogenesis [58], suggesting their interactions with signaling pathways were required for muscle normal development and maintenance. [score:4]
Another DE miRNA (miR-148a), whose average abundance before birth was eight times higher than that in postnatal, might be a part of mechanism implicated in differences between embryonic myogenesis and adult myofiber maturation. [score:1]
In addition to the best-studied myomiRs (miR-1, -206 and miR-133 families), 11 other DE muscle-related miRNAs (miR-378 [24], miR-148a [27], miR-26a [28, 29], miR-27a/b [30, 31], miR-23a [32, 33], miR-125b [34], miR-24 [35], miR-128 [36], miR-199a [37] and miR-424 [38]) with high abundance (average RPM >1,000) and another 14 (miR-181a/b/c/d-5p [26], miR-499-5p [11], miR-503 [38], miR-486 [39], miR-214 [40], miR-29a/b/c [41– 43], miR-221/222 [44] and miR-208 [11] with low abundance (average RPM <1,000) were detected in myogenesis of pig. [score:1]
[1 to 20 of 4 sentences]
69
[+] score: 14
Other miRNAs from this paper: hsa-mir-4721
For instance, MIR148A is upregulated during normal adipogenesis but downregulated in obese adipocytes [73], and its expression is regulated by DNA methylation at its CpG island [74]. [score:10]
Thirty-eight of the associated CpGs were located in gene promoters (MIR148A, BDNF, PTPMT1, NR1H3, MGAT1, SCGB3A1, HOXC12, PMAIP1, PSIP1, RPS10-NUDT3, RPS10, S KOR1, MAP2K5, SIX5, AGRN, IMMP1L, ELP4, ITIH4, SEMA3G, POMC, ADCY3, SSPN, LGR4, TUFM, MIR4721, SULT1A1, SULT1A2, APOBR, CLN3, SPNS1, SH2B1, ATXN2L, and IL27), including eight also located in a gene body (Additional file 4). [score:1]
Consistently, carriers of the risk allele at rs1055144 had higher methylation levels in the promoter of MIR148A. [score:1]
Out of 107 CpG sites, 38 are located in gene promoters, including genes strongly implicated in obesity (MIR148A, BDNF, PTPMT1, NR1H3, MGAT1, SCGB3A1, HOXC12, PMAIP1, PSIP1, RPS10-NUDT3, RPS10, S KOR1, MAP2K5, SIX5, AGRN, IMMP1L, ELP4, ITIH4, SEMA3G, POMC, ADCY3, SSPN, LGR4, TUFM, MIR4721, SULT1A1, SULT1A2, APOBR, CLN3, SPNS1, SH2B1, ATXN2L, and IL27). [score:1]
For clarity and because the number of interactions was skewed, we chose to display the log [10](number of interactions) Thirty-eight of the associated CpGs were located in gene promoters (MIR148A, BDNF, PTPMT1, NR1H3, MGAT1, SCGB3A1, HOXC12, PMAIP1, PSIP1, RPS10-NUDT3, RPS10, S KOR1, MAP2K5, SIX5, AGRN, IMMP1L, ELP4, ITIH4, SEMA3G, POMC, ADCY3, SSPN, LGR4, TUFM, MIR4721, SULT1A1, SULT1A2, APOBR, CLN3, SPNS1, SH2B1, ATXN2L, and IL27), including eight also located in a gene body (Additional file 4). [score:1]
[1 to 20 of 5 sentences]
70
[+] score: 14
In TM4 cells exposed to NP, Ppara was down-regulated at both 3 and 24 h. We thus surmised that miRNAs regulated by Ppara may include miR-378, miR-125a-3p, and miRNA-148a at 3 h, and miR-20a, miR-203, and miR-101a at 24 h. Figure 3 Network analysis of miRNAs the expression of which in TM4 cells was altered by NP (A) 3 h. (B) 24 h. Network analysis was performed using an algorithm supported by IPA. [score:7]
In TM4 cells exposed to NP, Ppara was down-regulated at both 3 and 24 h. We thus surmised that miRNAs regulated by Ppara may include miR-378, miR-125a-3p, and miRNA-148a at 3 h, and miR-20a, miR-203, and miR-101a at 24 h. Figure 3 Network analysis of miRNAs the expression of which in TM4 cells was altered by NP (A) 3 h. (B) 24 h. Network analysis was performed using an algorithm supported by IPA. [score:7]
[1 to 20 of 2 sentences]
71
[+] score: 14
Twelve of them (miR-10b, miR-15a, miR-19a, miR-26b, miR-30a, miR-30c, miR-125a, miR-125b, miR-148a, miR-148b, miR-195 and miR-320) are down-regulated both in dogs and in humans whereas one (miR-494) is up-regulated in both species and four (miR-29a, miR-181a, miR-196a and miR-374a) are down-regulated in dogs but up-regulated in humans. [score:13]
PCA plot reveals the distinct sample clusters for metastatic tumours and non-metastatic tumours The following ten microRNAs were selected for validation of microarray results: cfa-let-7c, cfa-miR-10b, cfa-miR-26a, cfa-miR-26b, cfa-miR-29c, cfa-miR-30a, cfa-miR-30b, cfa-miR-30c, cfa-miR-148a and cfa-miR-299. [score:1]
[1 to 20 of 2 sentences]
72
[+] score: 13
Other miRNAs from this paper: hsa-mir-152, hsa-mir-185, hsa-mir-148b
DNMTs regulation by miR-148/152 family members has been reported in a number of human diseases [18, 19]. [score:4]
Targeting site of miR-148 in the DNMT1 3′UTR. [score:3]
However, the result in our research indicated that only DNMT1 was regulated by miR-148a. [score:2]
Importantly, miR-148a, which is together with miR-148b belonging to miR-148/152 family, plays an important role in improving response to chemotherapy in sensitive and resistant cancers. [score:1]
The microRNA-148/152 family: multi-faceted players. [score:1]
Interestingly, as a member of miR-148/152 family, miR-148a plays an important role in improving response to chemotherapy in sensitive and resistant cancers, such as oesophageal adenocarcinoma and squamous cell carcinoma cells [15] and hormone-refractory prostate cancer [16]. [score:1]
miR-148b is a member of miR-148/152 family, which has the mature structure of 21–22 nucleotides in length and the same seed sequence of approximately 6–7 nucleotides [14]. [score:1]
[1 to 20 of 7 sentences]
73
[+] score: 13
Indeed, nuclear translocation of the NF-κB subunit p65 in stimulated mouse splenic B cells and the induction of miR-155-5p, -34a-5p, -183-5p, and -365a-3p were all inhibited by treatment with NF-κB inhibitor Bay 11-7082, but miR-148a-3p was not affected (Fig. 4D,E). [score:5]
In particular, the target sites of miR-148a-3p and miR-183-5p in the 3′UTR of BACH2 are both highly conserved among vertebrates. [score:3]
miR-148a-3p appeared to indirectly regulate endogenous BCL6 because its conserved binding site was not found in BCL6 3′UTR. [score:3]
Mutating the miR-148a-3p and miR-34a-5p, but not miR-183-5p, binding sites in BACH2 3′UTR partially attenuated the repression of luciferase activity (Fig. 5B). [score:1]
Likewise, disruption of the miR-183-5p, miR-34a-5p, or miR-148a-3p site, but not the miR-365a-3p site, attenuated the repression of FOXP1 3′UTR–mediated luciferase activity (Fig. 5C). [score:1]
[1 to 20 of 5 sentences]
74
[+] score: 13
In this study, we showed that miR-107 and miR-148 are downregulated in FMF patients, whereas miR-21 is upregulated, demonstrating an overall proinflammatory profile of the innate immune system of FMF patients, even in the quiescent phase. [score:7]
Of the total 49 immune miRNAs that appear in the database, three (miR-107, miR-21 and miR-148) were differentially expressed in our cohort. [score:3]
Interestingly, miR-107 and miR-148 were reported to serve as negative regulators of the innate immune system, whereas miR-21 plays a proinflammatory role. [score:2]
Moreover, miR-107, miR-21 and miR-148 were found in InnateDB, which integrates interaction and pathway information from several of the major publicly available databases and aims to capture an improved coverage of the innate immunity interactome. [score:1]
[1 to 20 of 4 sentences]
75
[+] score: 13
Intriguingly, several of the differentially expressed miRNAs have been shown in previous studies to regulate host cell death: miR-145 modulates the expression of KLF4 (Davis-Dusenbery et al., 2011), a transcription factor for TP53, which regulates apoptosis (Rowland et al., 2005); miR-15b and miR-29b are known to be pro-apoptotic in leukemia cells (Cimmino et al., 2005; Garzon et al., 2009); miR-148a promotes apoptosis by targeting BCL2 in colorectal cancer cells (Zhang et al., 2011); miR-181d also targets BCL-2 and promotes apoptosis in glioma cells (Wang et al., 2012). [score:11]
MiR-148a promotes apoptosis by targeting Bcl-2 in colorectal cancer. [score:2]
[1 to 20 of 2 sentences]
76
[+] score: 13
Another report showed that miR-148a interacts with the 3′-UTR of growth arrest-specific gene 1(Gas1) and inhibits target gene expression. [score:7]
Overexpression of miR-148a increases autophagy and apoptosis to suppress the proliferation of hepatic stellate cells [56]. [score:5]
Liu XY Induction of autophagy and apoptosis by miR-148a through the sonic Hedgehog signaling pathway in hepatic stellate cellsAm. [score:1]
[1 to 20 of 3 sentences]
77
[+] score: 13
diagnostic and prognostic biomarker [23, 28, 29, 91] up NPC, HNSCCLoss of imprinting in IGF2-H19 loci and abnormal expression are associated with the oncogenesis and development of HNC [39– 45]; expression in HNC increases DNA methylation by repressing miR-148a-3p [46]. [score:6]
miR-148a-3p is a target of inhibition by, and miR-148a-3p reduces the levels of the DNA methyltransferase enzyme 1 (DNMT1) mRNA and protein, affecting cellular DNA methylation. [score:5]
Thus, regulates the level of cellular DNA methylation through the/miR-148a-3p/DNMT1 cascade, and may promote HNC cell migration, invasion and proliferation by increasing DNA methylation [46]. [score:2]
[1 to 20 of 3 sentences]
78
[+] score: 12
However, other studies revealed that miR-148a was significantly down-regulated in gastrointestinal cancers, and it repressed gastric cancer metastasis by targeting ROCK1 (Ref. [score:6]
The same phenomena were observed for miR-148a, which silenced cell cycle inhibitor p27 to result in cell proliferation (Ref. [score:3]
PLoS ONE 6, e16617 103 Guo S. L. (2011) miR-148a promoted cell proliferation by targeting p27 in gastric cancer cells. [score:3]
[1 to 20 of 3 sentences]
79
[+] score: 12
The top 5 miRNAs were consistently highly expressed and included miR-148a-3p, miR-22-3p, miR-30d-5p, let-7b-5p and miR-200a-3p. [score:3]
Human breast milk samples contain a relatively stable core group of highly expressed miRNAs, including miR-148a-3p, miR-22-3p, miR-30d-5p, let-7b-5p and miR-200a-3p. [score:3]
In particular, miR-148a, miR-30a, let-7a, let-7b and let-7f are reported to be expressed in moderate to high quantities across these species. [score:3]
The five most abundant miRNAs identified in the breast milk samples were miR-148a-3p, miR-22-3p, miR-30d-5p, let-7b-5p and miR-200a-3p. [score:1]
Top 10 miRNAs: miR-148a-3p, miR-30b-5p, let-7f-5p, miR-146b-5p, miR-29a-3p, let-7a-5p, miR-141-3p, miR-182-5p, miR-200a-3p, miR-378-3p. [score:1]
Top 10 miRNAs [b] : mir-148a-3p, let-7a-5p, mir-200c-3p, mir-146b-5p, let-7f-5p, mir-30d-5p, mir-103a-3p, let-7b-5p, let-7g-5p, mir-21-5p. [score:1]
[1 to 20 of 6 sentences]
80
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Analyzing the gene expression profile reveals that miR-148a, miR-222 and miR-21 may cause fludarabine resistance through inhibiting the activation of p53-responsive genes. [score:5]
The B and T lineages of ALL can be distinguished based on relative expression of miR-148, miR-151, miR-424, miRNA-425-5p, miRNA-191, miRNA-146b, miRNA-128, miRNA-629, and miRNA-126. [score:3]
On the other hand, overexpression of miR-21, miR-148a, miR-155 and miR-222 in CLL patients was associated with poor therapeutic response and prognosis [15– 17, 23, 24]. [score:3]
[1 to 20 of 3 sentences]
81
[+] score: 11
In our results, we did not find any correlation between miR-29c expression and the level of IFN- γ. Furthermore, upregulation of the miR-148 family (miR-148a, miR-148b, and miR-152) was observed in DCs stimulated by LPS. [score:6]
The role of miR-148 family in activated DCs is to inhibit the MHC II expression, production of proinflammatory cytokines, and DCs -mediated CD4+ T cell expansion [46]. [score:5]
[1 to 20 of 2 sentences]
82
[+] score: 11
Eight up-regulated miRNAs, including miR-19a-3p, miR-877-3p, miR-148a-3p, miR-212-5p, miR-1825, miR-210-3p, miR-940, and miR-134-5p, and two down-regulated miRNAs, miR-3609 and miR-145-5p, were identified as statistically significant different miRNAs. [score:7]
MiR-148a and miR-19a have been reported to influence the +3142 C/G polymorphism of HLA-G, resulting in the down-regulation of HLA-G in PE[14]. [score:4]
[1 to 20 of 2 sentences]
83
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Ye et al. (2012) examined miRNA expression in the duodenum of E. coli F18-sensitive and -resistant weaned piglets and identified 12 candidate miRNA (ssc-miR-143, ssc-let-7f, ssc-miR-30e, ssc-miR-148a, ssc-miR-148b, ssc-miR-181a, ssc-miR-192, ssc-miR-27b, ssc-miR-15b, ssc-miR-21, ssc-miR-215, and ssc-miR-152) disease markers. [score:5]
Additionally, a number of miRNAs including miR-148a, miR-26a, miR-21-5p, miR-27b, miR-143, bta-miR-30a-5p, let-7a-5p, let-7f, miR-10b, and miR-99a-5p are highly expressed in bovine mammary gland/mammary epithelial cells (Li et al., 2012a, 2014a; Jin et al., 2014a; Le Guillou et al., 2014) suggesting roles in the lactation process and mammary gland functions. [score:3]
Similarly, Jin et al. (2014a) demonstrated a differential expression of nine miRNAs (bta-miR-184, miR-24-3p, miR-148, miR-486, and let-7a-5p, miR-2339, miR-499, miR-23a, and miR-99b) upon challenge of MACT-cells (bovine mammary epithelia cell line) with heat inactivated E. coli and S. aureus bacteria. [score:3]
[1 to 20 of 3 sentences]
84
[+] score: 11
Similarly, DNMT1 is targeted by miR-148a and miR-152 in cholangiocarcinoma cells, and their ectopic expression suppresses DNMT1 and induces expression of the tumor suppressor genes Ras association domain family 1A (RASSF1A) and p16 (Braconi et al., 2010). [score:11]
[1 to 20 of 1 sentences]
85
[+] score: 11
, High Wycombe, UK) analysis of 1733 human microRNAs and validation by qRT-PCR showed microRNA-21, microRNA-99a, microRNA-100, microRNA-125b, microRNA-138, microRNA-147b, microRNA-148a, microRNA-210, microRNA-376a, and microRNA-455-3p to be significantly upregulated, whereas microRNA-31-star, microRNA-330-3p, microRNA-330-5p, microRNA-378d, microRNA-422a, and microRNA-486-5p were significantly downregulated. [score:7]
Further, microRNA-148 was significantly downregulated in PDAC tissues (p = 3.9814E-09). [score:4]
[1 to 20 of 2 sentences]
86
[+] score: 11
miRNA target has-miR302a MECP2 hsa-miR29a TET1, TET2, TET3 has-miR29a/c DNMT3A, DNMT3B has-miR29b-1/2 DNMT1 (Indirect via SP1) hsa-miR148a DNMT3B hsa-miR148a DNMT1 hsa-miR152 DNMT1 has-miR302a DNMT1 (Indirect via AOF2) hsa-miR342 DNMT1 hsa-miR17-92 DNMT1 hsa-miR26a-1/2 EZH2 hsa-miR101-1/2 EZH2/EED hsa-miR214 EZH2 hsa-miR128-1/2 BMI-1 hsa-miR199a-1/2 BRM hsa-miR433 HDAC6 hsa-miR449a HDAC1 hsa-miR138 SIRT1In the first column we report a list of miRNAs which are known to target epigenetic regulators and in the second column the corresponding targets. [score:10]
It is well known (see for instance Gruber and Zavolan, 2013) that Dnmt proteins are strictly controlled in a coordinated way by a number of miRNAs, among them in particular mir-29a/b/c, mir-152, mir148a, mir342, mir302 and various members of the cluster mir17-92. [score:1]
[1 to 20 of 2 sentences]
87
[+] score: 11
For experimental validation in oral tumors, we narrowed down that candidate miRNAs to six (miR-137, miR-148a-3p, miR-30a-5p, miR-30b-5p, miR-338-3p and miR-22-3p) by reviewing the functional evidence present in the literature, analyzing their expression in HNSCC datasets from TCGA and correlating with OIP5-AS1 expression (Supplementary Table  S2). [score:5]
Out of the 8 selected miRNAs, miR-137, miR-140–5p, miR-148a-3p, miR-30a-5p and miR-338-3p were significantly downregulated in the tumors compared with normal tissue (P < 0.001, <0.001, 0.001, 0.001 and 0.0003, respectively) (Fig.   3a). [score:3]
Six miRNAs miR-137, miR-148a-3p, miR-338-3p, miR-30a/b-5p and miR-22-3p known to be associated with several cancers were chosen to study the expression levels in oral tumors 20, 25, 26. [score:3]
[1 to 20 of 3 sentences]
88
[+] score: 10
Our validated colitis signature was therefore composed of nine miRNAs: the up-regulated miRNAs, miR-29b-3p, -122-5p, -192-5p, -194-5p, -375-3p, -150-5p, and -146a-3p, and the down-regulated miRNAs, miR-148a-3p and -199a-3p (Fig.   2B). [score:7]
miRNA nameIL10 [−/−] mice mo del Intestinal Inflammation Inflammation mmu-miR-29b-3p x mmu-miR-122-5p x x x mmu-miR-148a-3p x mmu-miR-150-5p x x mmu-miR-192-5p x mmu-miR-194-5p x mmu-miR-146a-5p x mmu-miR-375-3p x x x mmu-miR-199a-3p x We showed that our nine-miRNA signature could discriminate between the different forms of colitis and arthritis, as well as between non-colitic mice with and without a genetic predisposition to develop the disease (WT mice versus non-colitic IL10 [−/−] mice). [score:3]
[1 to 20 of 2 sentences]
89
[+] score: 10
Seven over-expressed microRNAs that were altered at least four fold, including hsa-miR-671-5p, hsa-miR-542-5p, hsa-miR-542-3p, hsa-miR-1185, hsa-miR-539, hsa-miR-148a and hsa-miR-301a, (Figure 4A) and six over-expressed microRNAs that were highly expressed (normalized data ≥6), including hsa-miR-1290, hsa-miR-136, hsa-miR-424, hsa-miR-30a, hsa-miR-148a and hsa-miR-1246 (Figure 4B), were selected for further qRT-PCR analyses. [score:7]
The qRT-PCR results demonstrated that the expression patterns of hsa-miR-542-5p, hsa-miR-542-3p, hsa-miR-148a, hsa-miR-1290, hsa-miR-424, hsa-miR-30a and hsa-miR-1246 were consistent with the microarray results (Figure 4C). [score:3]
[1 to 20 of 2 sentences]
90
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Of particular note, miR-148a has been shown to control post-transcriptional regulation of PXR and, consequently, affect the expression of CYP3A4 (Takagi et al., 2008). [score:4]
The role of miRNA in the regulation of the expression of CYP3A4 has been reported, Takagi et al. (2008), found that miR-148 modulated inducible and/or constitutive levels of CYP3A4 in human liver cancer. [score:4]
Potential microRNAs that could serve as possible markers of HCC by exposure to aflatoxins are miR-27a, miR-27b, miR-122, miR-148, miR-155, miR-192, miR-214, miR-221, miR-429, and miR-500. [score:1]
miR-148, another candidate. [score:1]
[1 to 20 of 4 sentences]
91
[+] score: 10
In this context, we detected an over -expression of miR-19a, miR-21, miR-29a, miR-92, miR-148a, miR-200b, and a down-regulation of miR-30c, miR-133a and miR-145 (figure 2). [score:6]
Colorectal cancer cell lines with KRAS mutations showed an over -expression of miR-9, miR-9*, miR-95, miR-148a, miR-190 and miR-372, in relation to the human normal colon cell line. [score:4]
[1 to 20 of 2 sentences]
92
[+] score: 9
Six miRNAs were found to be differentially expressed: miR-29b, miR-29c, and miR-200a were upregulated, while miR-134, miR-148, and miR-155 were downregulated after treatment. [score:9]
[1 to 20 of 1 sentences]
93
[+] score: 9
In G2 (up-regulated), miR-148a was markedly the most different between breeds at 2 dpn. [score:4]
In a comparison between the pig breeds, 49 dpc showed the most significant differences in G1 (up-regulated), in which miR-378, miR-30a, miR-148a, and miR-127 showed drastic changes. [score:4]
Figure  3 shows that in G1 (up), we clearly found that 49 dpc showed the most significant differences between breeds; in this group, miR-378, miR-148a and miR-127 showed drastic changes. [score:1]
[1 to 20 of 3 sentences]
94
[+] score: 9
A previous study of an adult liver reported high expression of miR-122 and miR-194, and moderate expression of miR-148 and miR-192 [17], which is similar to our study (Fig. 5), indicating that these liver-specific miRNAs are important for the two developmental stages of the liver. [score:6]
However, the other three liver-specific miRNAs (miR-148, miR192 and miR-194) exhibited moderate expression levels (Fig. 5). [score:3]
[1 to 20 of 2 sentences]
95
[+] score: 9
Human miR-27a and -27b differ by a single nucleotide at position 19. miR-148a and -148b differ by two nucleotides at positions 7 and 8. We found that the miR-27b inhibitor induces a relatively small increase in AP activity in hMSC. [score:3]
AP activity for miR-148a inhibitor treated/transfected cells was extremely variable and fell into an outlier category (data not shown). [score:3]
Similarly, family miR-148 is represented by miR-148a and 148b. [score:1]
Based on these results both miR-27b and miR-148a were excluded from further study. [score:1]
Further experiments demonstrated that miR-148a mimic was able to induce AP activity in hMSC, but it was at least two-fold less potent than the mimic of miR-148b (data not shown). [score:1]
[1 to 20 of 5 sentences]
96
[+] score: 9
Irradiation with 10 Gy and PUFA treatment did not affect the expression of miR-34a, miR-96, miR-148a, miR-148b and miR-152 significantly (Additional file 1: Figure S1). [score:3]
with 10 Gy and PUFA treatment did not alter significantly the expression of miR-34a, miR-96, miR-148a, miR-148b and miR-152. [score:3]
with 10 Gy and PUFA treatment did not affect the expression of miR-34a, miR-96, miR-148a, miR-148b and miR-152 significantly (Additional file 1: Figure S1). [score:3]
[1 to 20 of 3 sentences]
97
[+] score: 9
In Figure 3A, the utmost ten expressed miRNAs are miR-143, miR-148a, miR-21, miR-22, miR-375, miR-10a, miR-30a, miR-192, miR-99b and miR-145. [score:3]
The highly expressed miRNA genes (combined 5p-arm and 3p-arm together) in the STAD cancer group are: miR-21, miR-143, miR-22, miR-148a, miR-10a, miR-192, miR-375, miR-99b, let-7a-2 and miR-30a. [score:3]
Finally, we observe most of highly expressed miRNAs in both the normal and cancer STAD groups, including miR-143, miR-21, miR-22, miR-148a, miR-10a, miR-192, miR-375, miR-99b and miR-30a. [score:3]
[1 to 20 of 3 sentences]
98
[+] score: 9
In addition, Zheng et al (59) identified that overexpression of miR-148 suppressed the metastasis and invasion of GC through repression of a direct target, Rho -associated protein kinase 1 (ROCK1), a potential metastasis promoter. [score:8]
miR-148a. [score:1]
[1 to 20 of 2 sentences]
99
[+] score: 9
Specific knockdown of miR-148 in pancreatic β-cells or in isolated primary islets down-regulates insulin mRNA levels [37]. [score:5]
Specifically, miR-26a (cell proliferation) was the most abundantly expressed, followed by miR-148 (may control insulin content) and miR-21 (cell proliferation). [score:3]
Mammary gland does not synthesize insulin, therefore miR-148 is not included in the “lipid metabolism” cluster. [score:1]
[1 to 20 of 3 sentences]
100
[+] score: 8
Extracellular Transcript Number hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 95 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 57 hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 38 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 29 hsa-miR-27b-3p 3p TCACAG TTCACAGTGGCTAAGTTCTGC Yes 26 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 22 hsa-miR-19a-3p 3p GTGCAA TGTGCAAATCTATGCAAAACTGA Yes 21 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 18 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 12 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 11 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 11 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 11 hsa-miR-320a 3p AAAGCT AAAAGCTGGGTTGAGAGGGCGA Yes 11 hsa-miR-423-5p 5p GAGGGG TGAGGGGCAGAGAGCGAGACTTT Yes 10 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 9 hsa-miR-92a-3p 3p ATTGCA TATTGCACTTGTCCCGGCCTGT Yes 9 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 7 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 6 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 6 ijms-15-15530-t004_Table 4 Table 4 Top 10 novel miRNAs expressed in exosome libraries. [score:3]
Extracellular Transcript Number hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 95 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 57 hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 38 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 29 hsa-miR-27b-3p 3p TCACAG TTCACAGTGGCTAAGTTCTGC Yes 26 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 22 hsa-miR-19a-3p 3p GTGCAA TGTGCAAATCTATGCAAAACTGA Yes 21 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 18 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 12 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 11 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 11 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 11 hsa-miR-320a 3p AAAGCT AAAAGCTGGGTTGAGAGGGCGA Yes 11 hsa-miR-423-5p 5p GAGGGG TGAGGGGCAGAGAGCGAGACTTT Yes 10 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 9 hsa-miR-92a-3p 3p ATTGCA TATTGCACTTGTCCCGGCCTGT Yes 9 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 7 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 6 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 6 ijms-15-15530-t004_Table 4 Table 4 Top 10 novel miRNAs expressed in exosome libraries. [score:3]
Intracellular Transcript Number hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 382,634 hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 243,882 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 91,479 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 82,325 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 66,589 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 41,096 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 30,233 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 28,900 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 26,923 hsa-miR-24-3p 3p GGCTCA TGGCTCAGTTCAGCAGGAACAG Yes 26,085 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 23,649 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 21,557 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 17,757 hsa-miR-182-5p 5p TTGGCA TTTGGCAATGGTAGAACTCACACT Yes 15,213 hsa-miR-425-5p 5p ATGACA AATGACACGATCACTCCCGTTGA No 12,236 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 11,993 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 11,329 hsa-miR-99a-5p 5p ACCCGT AACCCGTAGATCCGATCTTGTG Yes 10,476 hsa-miR-103a-3p 3p GCAGCA AGCAGCATTGTACAGGGCTATGA Yes 10,305 ijms-15-15530-t003_Table 3 Table 3 Common transcripts in extracellular samples that belong to the mid-range category with five to 100 transcripts. [score:1]
Intracellular Transcript Number hsa-miR-21-5p 5p AGCTTA TAGCTTATCAGACTGATGTTGA Yes 382,634 hsa-let-7f-5p 5p GAGGTA TGAGGTAGTAGATTGTATAGTT Yes 243,882 hsa-let-7b-5p 5p GAGGTA TGAGGTAGTAGGTTGTGTGGTT Yes 91,479 hsa-miR-100-5p 5p ACCCGT AACCCGTAGATCCGAACTTGTG Yes 82,325 hsa-let-7a-5p 5p GAGGTA TGAGGTAGTAGGTTGTATAGTT Yes 66,589 hsa-miR-125b-5p 5p CCCTGA TCCCTGAGACCCTAACTTGTGA Yes 41,096 hsa-let-7i-5p 5p GAGGTA TGAGGTAGTAGTTTGTGCTGTT Yes 30,233 hsa-let-7g-5p 5p GAGGTA TGAGGTAGTAGTTTGTACAGTT Yes 28,900 hsa-miR-148a-3p 3p CAGTGC TCAGTGCACTACAGAACTTTGT Yes 26,923 hsa-miR-24-3p 3p GGCTCA TGGCTCAGTTCAGCAGGAACAG Yes 26,085 hsa-miR-19b-3p 3p GTGCAA TGTGCAAATCCATGCAAAACTGA Yes 23,649 hsa-let-7c 5p GAGGTA TGAGGTAGTAGGTTGTATGGTT Yes 21,557 hsa-miR-25-3p 3p ATTGCA CATTGCACTTGTCTCGGTCTGA Yes 17,757 hsa-miR-182-5p 5p TTGGCA TTTGGCAATGGTAGAACTCACACT Yes 15,213 hsa-miR-425-5p 5p ATGACA AATGACACGATCACTCCCGTTGA No 12,236 hsa-miR-26a-5p 5p TCAAGT TTCAAGTAATCCAGGATAGGCT Yes 11,993 hsa-miR-181a-5p 5p ACATTC AACATTCAACGCTGTCGGTGAGT Yes 11,329 hsa-miR-99a-5p 5p ACCCGT AACCCGTAGATCCGATCTTGTG Yes 10,476 hsa-miR-103a-3p 3p GCAGCA AGCAGCATTGTACAGGGCTATGA Yes 10,305 ijms-15-15530-t003_Table 3 Table 3 Common transcripts in extracellular samples that belong to the mid-range category with five to 100 transcripts. [score:1]
[1 to 20 of 4 sentences]