sort by

264 publications mentioning mmu-mir-122 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-122. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 398
Other miRNAs from this paper: rno-mir-122
Taken together, these results suggest that IL-6 and TNF-α decrease miR-122 expression directly by downregulating its transcription factors C/EBPα and HNF3β and indirectly by upregulating c-myc, which blocks the association of C/EBPα with the miR-122 promoter. [score:11]
healthy liver samples from an array dataset [19] revealed that miR-122 target expression increased in chronic hepatitis; on the contrary, the expression of targets of miR-33a, another highly expressed liver mRNA, did not change. [score:11]
Two major inflammatory cytokines in CHB, IL-6 and TNF-α, suppressed miR-122 expression both by downregulating the miR-122 transcription factors C/EBPα and HNF3β and by inducing c-myc -mediated C/EBPα inhibition. [score:10]
IL-6 and TNF-α suppressed miR-122 expression by inhibiting C/EBPα expression and transcriptional activity (Figure 2 and 3), and decreased miR-122 may result in elevated Ccl2 (Figure 1H). [score:9]
Our previous studies show that miR-122 is downregulated in chronic hepatitis B (CHB) and HCC, and upregulation of its target PBF promotes HCC growth and invasion [10, 18]. [score:9]
In turn, miR-122 downregulation promotes further inflammation both directly by increasing inflammatory cytokine expression and indirectly by recruiting inflammatory cells in the liver. [score:8]
Inflammatory cytokine -induced C/EBPα downregulation and c-myc -mediated C/EBPα inhibition suppresses miR-122. [score:8]
Decreased miR-122 expression and increased expression of miR-122 target genes are observed in HCC tumors compared to nontumor tissues, and loss of miR-122 expression is associated with hepatocarcinogenesis, metastasis, poor prognosis, and reduced response to chemotherapy [3, 4]. [score:8]
Our findings demonstrate that inflammatory IL-6 and TNF-α suppress miR-122 by both directly downregulating C/EBPα and indirectly reducing its transcriptional activity, as shown in Figure 6F. [score:8]
As in previous studies, IL-6 and TNF-α increased c-myc expression (Figure 3A), and overexpression and knockdown studies both showed that c-myc suppressed miR-122 expression as measured by real-time PCR (Figure 3B) and northern blotting (Figure 3C). [score:8]
Downregulation of miR-122 results in ADAM17 upregulation, which leads to increased TNF-α production [38]. [score:7]
Given that IL-6 and TNF-α upregulate c-myc expression [25, 26] and that c-myc and miR-122 reciprocally regulate each other in HCC [27], we further investigated whether IL-6 and TNF-α also affect miR-122 expression via c-myc. [score:7]
Moreover, IL-6- and TNF-α -induced decreases in miR-122 expression were largely abolished by simultaneous transfection with C/EBPα siRNA (Figure 2D), indicating that IL-6 and TNF-α suppress miR-122 expression mainly by decreasing the levels of its transcription factor C/EBPα. [score:7]
As shown in Figure 1H, miR-122 mimic -transfected HepG2 cells displayed decreased Ccl2 expression, whereas the inhibition of endogenous miR-122 in Huh-7 cells increased Ccl2 expression. [score:7]
Given that an miR-122 target, Ccl2, may induce the production of IL-6 and TNF-α by lymphocytes in miR-122 KO mice [6], we further determined whether miR-122 regulates Ccl2 expression in hepatocytes. [score:6]
In conclusion, this study indicates that chronic inflammation reduces miR-122 expression through C/EBPα in hepatocytes during chronic hepatitis, and miR-122 downregulation in turn promotes inflammation. [score:6]
miR-33a and miR-122 targets predicted by TargetScan (TS) and miR-122 targets validated by reporter assay (mirbase) were analyzed. [score:6]
Furthermore, in miR-122 KO mice, upregulation of the miR-122 target Ccl2 results in liver inflammation and hepatic infiltration of IL-6- and TNF-α-producing inflammatory cells [6]. [score:6]
As expected, the restoration of miR-122 in DEN -treated mice blocked upregulation of most of the miR-122 target genes implicated in hepatocarcinogenesis, including cyclin G1, PKM2, ADAM10, and iqgap (Figure 6E). [score:6]
IL-6 and TNF-α suppress miR-122 by downregulating C/EBPα. [score:6]
The mean fold change in expression of miR-122 targets was compared to miR-33a targets or all genes; the number of genes in each group is shown. [score:6]
In rat and mouse DEN -induced HCC mo dels, elevated IL-6 and TNFα expression and reduced miR-122 expression were observed in the liver before HCC development. [score:6]
Together with these studies, our current work suggests that proinflammatory cytokines inhibit the transcription factor C/EBPα by repressing both its autoregulation and its transcriptional activity via c-myc, ultimately leading to decreased miR-122 expression in chronic hepatitis. [score:6]
Liver miR-122 expression is decreased, whereas IL-6 and TNF-α expression are increased, in a DEN -induced rat hepatoma mo del. [score:5]
Expression of miR-122 target oncogenes, namely cyclin G1, ADAM10, PKM2, and iqgap, was also increased in the tumors that developed (Figure 6E). [score:5]
Importantly, restoration of miR-122 strongly inhibits tumorigenesis and reduces tumor incidence in miR-122 KO mice, indicating that miR-122 acts as an HCC tumor suppressor [5, 6]. [score:5]
Additionally, miR-122 suppresses Ccl2 expression in hepatocytes, which actively modulate immune responses and inflammation locally in the liver [40]. [score:5]
Notably, blocking DEN -induced miR-122 downregulation with agomiR-122 treatment significantly attenuated HCC development in mice. [score:5]
Competition with purified His-tagged c-myc protein expressed in Escherichia coli showed that c-myc inhibited C/EBPα binding to the miR-122 promoter in a dose -dependent manner (Figure 3J, left), indicating that c-myc binds to C/EBPα and blocks its association with the miR-122 promoter. [score:5]
We then performed a meta-analysis of published miR-122 target gene expression microarray data from chronic hepatitis patients (Figure 1D). [score:5]
Importantly, decreased miR-122 expression enhanced proinflammatory chemokine Ccl2 expression. [score:5]
IL-6 and TNF-α suppress miR-122 by c-myc -mediated C/EBPα inhibition. [score:5]
H. HepG2 cells were transfected with miR-122 mimic or control mimic (left) and Huh-7 cells were transfected with miR-122 inhibitor or control inhibitor (right). [score:5]
Moreover, similar changes in miR-122 primary transcript (pri-miR-122) levels were observed after IL6 or TNF-α treatment (Figure 1G), indicating that these cytokines downregulate miR-122 at the transcriptional level. [score:4]
Mice were treated with DEN 15 days after birth, and agomir-122 or control agomir [30] was intravenously injected 20 times at a dose of 5 nmol/mouse after 5 months (Figure 6A), when miR-122 was significantly downregulated but microscopic tumors had not yet developed. [score:4]
In this study, we demonstrated that major proinflammatory cytokines reduced miR-122 expression, which contributed to HCC development. [score:4]
Thus, both chronic inflammation and viral replication (e. g., transcripts) may be involved in miR-122 downregulation in the liver by HBV or HCV infection. [score:4]
Next, we explored the mechanism of IL-6- and TNF-α -induced miR-122 downregulation. [score:4]
These results indicate that miR-122 downregulation contributes to inflammation -induced HCC. [score:4]
Furthermore, delivery of miR-122 using agomir suppressed HCC development in the context of chronic hepatitis. [score:4]
As IL-6 and TNF-α are major inflammatory factors in chronic hepatitis, these results suggest that chronic inflammation may contribute to miR-122 downregulation in CHB. [score:4]
Moreover, c-myc inhibited miR-122 promoter activity in luciferase reporter assays (Figure 3D), indicating that c-myc affects miR-122 expression at the transcriptional level. [score:4]
C/EBPα overexpression increased, whereas RNAi -induced C/EBPα knockdown decreased, miR-122 levels (Figure 2C). [score:4]
To assess whether miR-122 downregulation is involved in DEN -induced hepatocarcinogenesis, we utilized a cholesterylated stable miR-122 mimic with two oxygen methylation modifications and sulfur -modified phosphate, agomir-122, to deliver miR-122 to mouse livers. [score:4]
Furthermore, increased c-myc levels reduced C/EBPα -mediated activation of the miR-122 promoter (Figure 3K), and c-myc suppressed the activity of the wild type miR-122 promoter but not a promoter with mutations in the two C/EBPα binding sites (Figure 3L). [score:4]
miR-122 was downregulated in a dose -dependent manner 4 hours after treatment with between 1 and 1,000 U/ml of IL6 or TNF-α (Figure 1F). [score:4]
Inflammatory cytokines suppress miR-122 in CHB. [score:3]
G. Huh-7 cells were treated with 1000 IU/ml IL-6 or TNF-α for 12 h. The expression of pri-miR-122 was analyzed by real-time PCR. [score:3]
A. Analysis of miR-122 expression in liver biopsy specimens from CHB patients, HCC tumors, and healthy controls (HC) by real-time PCR. [score:3]
Expression of IL-6 and TNF-α in the liver increased 3-6 months after DEN treatment (Figure 5B), and miR-122 levels simultaneously decreased (Figure 5C). [score:3]
Restoration of miR-122 levels by agomir-122 delivery suppressed DEN -induced hepatocarcinogenesis. [score:3]
Although chronic inflammation causes metachronous multicentric hepatocarcinogenesis, it is still unclear if inflammation affects miR-122 expression. [score:3]
As chronic inflammation may elevate serum alanine aminotransferase (ALT) levels in CHB, we further examined the correlation between ALT and miR-122 expression in CHB patients. [score:3]
Figure 1 A. Analysis of miR-122 expression in liver biopsy specimens from CHB patients, HCC tumors, and healthy controls (HC) by real-time PCR. [score:3]
E. Real-time analysis of miR-122 levels and levels of the miR-122 target genes in liver tissues. [score:3]
As shown in Figure 3G, c-myc did not influence the expression of miR-122 transcription factors. [score:3]
In contrast to its supportive role in HCV, miR-122 reduces HBV expression and replication [18, 31], suggesting that miR-122 treatment might be most effective for HCC arising in the context of HBV infection. [score:3]
Agomir-122 restores miR-122 levels and suppresses DEN -induced hepatocarcinogenesis. [score:3]
Several studies indicate that HBV X protein suppresses miR-122 transcription via binding to PPARγ, and HBV and HCV RNA/mRNAs with miR-122 binding sites sequester endogenous miR-122, which decreases its levels [10, 33, 34, 35]. [score:3]
E. Huh-7 cells were treated with 1000 IU/ml IL-6, TNF-α, IL-1α, IL-1β, TGF-β, IFN-γ, IFNα, or PBS as a control for 12 h. miR-122 expression was detected by real-time PCR. [score:3]
A panel of cytokines implicated in chronic liver hepatitis, including IL-1α, IL-1β, IL6, TNF-α, TGF-β, IFN-γ, and IFN-α [11, 13], was screened to assess their effects on miR-122 expression. [score:3]
Multiple genes targeted by miR-122 are involved in hepatocarcinogenesis, including the oncogenes cyclin G1, a disintegrin and metalloprotease family 10 (ADAM10), serum response factor (SRF), insulin-like growth factor 1 receptor (Igf1R), Wnt1, RhoA, pituitary tumor-transforming gene 1 (PTTG1) binding factor (PBF), and AKT3, as well as the glycolytic gene pyruvate kinase M2 (PKM2) [2, 3, 7– 10]. [score:3]
However, activity of full-length and truncated miR-122 promoter fragments with no c-myc binding sequences was similarly inhibited in pcDNA3.1-c-myc plasmid -transfected cells (Figure 3F). [score:3]
As shown in Figure 1E, treating Huh-7 cells that constitutively express miR-122 with IL-6 or TNF-α decreased miR-122 levels by 51.2% and 51.7%, respectively (p<0.01 for both). [score:3]
In this mo del, miR-122 acts as an HCC suppressor, and inflammation -induced decreases in miR-122 levels contribute to hepatocarcinogenesis. [score:3]
Major inflammatory cytokines in CHB suppress miR-122. [score:3]
F. Schematic figure showing how IL-6/TNF-α- C/EBPα-miR-122 may mediate inflammation and HCC development in hepatitis. [score:2]
miR-122 is involved in various physiological and pathological processes in the liver, such as liver development, lipid metabolism, stress responses, and viral infections [2]. [score:2]
In this study, we identified an inflammation-C/EBPα-miR-122 regulatory loop in chronic hepatic inflammation. [score:2]
Compared to untreated rats, DEN -treated rats had higher IL-6 and TNF-α expression and lower miR-122 levels in liver tissues after 20 weeks of treatment (Figure 4B). [score:2]
Similar results were observed with a miR-122 promoter containing mutated c-myc binding sites (data not shown), indicating that the negative regulation of miR-122 by c-myc is independent of its binding to the miR-122 promoter. [score:2]
Next, we investigated the mechanisms underlying c-myc -mediated miR-122 downregulation. [score:2]
There is growing evidence that miR-122 is important in the development and metastasis of hepatocellular carcinoma (HCC). [score:2]
Therefore, in this study we investigated the possible mechanisms underlying miR-122 downregulation during liver inflammation. [score:2]
In addition, miR-122 knockout (KO) mice develop hepatitis, fibrosis, and HCC. [score:2]
Our results also suggest that the restoration of miR-122 levels may be a novel therapeutic approach for preventing HCC development in patients with chronic hepatitis. [score:2]
miR-122 levels were much higher in patients with low ALT levels (normal range: 10-40 U/L) than in patients with higher ALT levels (0.84±0.072 vs. [score:1]
Furthermore, elevated IL-6 and TNF-α and decreased C/EBPα and miR-122 levels were also observed in DEN -induced rat and mouse HCC mo dels. [score:1]
Decreased miR-122 is correlated with IL-6 and TNFα induction in diethylnitrosamine (DEN) -induced inflammation and HCC in mice and rats. [score:1]
A. Schematic diagram of agomir-miR-122 treatment in mice. [score:1]
miR-122 levels were assessed 48 h after transfection by real-time PCR. [score:1]
As shown in Figure 6B, treatment with agomir-122 largely restored miR-122 levels in DEN -treated mice; their miR-122 levels were similar to those in untreated control mice. [score:1]
To verify three predicted c-myc binding sites on the miR-122 promoter, pGl-122 (−5.3/−3.8k) containing 2 c-myc binding sites and pGl-122 (−5.3/−4.6k) containing no binding sites were constructed using KpnI & XhoI double digestion. [score:1]
Importantly, miR-122 restoration effectively reduced inflammation -mediated HCC incidence, suggesting that miR-122 may be a useful therapy in chronic hepatitis. [score:1]
Decreased miR-122 is correlated with IL-6 and TNF-α induction in a DEN -induced mouse HCC mo del. [score:1]
Two truncated miR-122 promoter fragments, pGL-122 (−5.3/−3.8k) and pGL-122 (−5.3/−4.6k), were constructed. [score:1]
B. Real-time PCR detection of IL-6 and TNF-α mRNA levels (left) and miR-122 levels (right) in liver tissues. [score:1]
miR-122 levels were assessed 48 h after transfection by real-time PCR (B) and northern blotting (C). [score:1]
Several lines of evidence show that decreased miR-122 may be associated with inflammation. [score:1]
This C/EBPα-miR-122 inflammatory feedback circuit may contribute to maintaining an inflammatory microenvironment and promote inflammation -driven HCC. [score:1]
B. and C. Curves showing changes in TNF-α mRNA (left), IL-6 mRNA (right) (B), and miR-122 (C) levels over time in mouse liver tissues after DEN injection. [score:1]
D. Huh-7 cells were cotransfected with pc3.1-c-myc or pcDNA3.1 as a control or with c-myc siRNA or control siRNA, as well as with pGL-122 with a luciferase reporter under the miR-122 promoter, and pRL-TK. [score:1]
3′-biotin-labeled complementary oligonucelotide pairs containing the C/EBPα binding sequences from the miR-122 promoter were chemically synthesized and annealed. [score:1]
This positive miR-122 feedback loop may initiate a well-described pathogenic sequence of persistent inflammation that would predispose patients to HCC [39]. [score:1]
B. Real-time PCR analysis of miR-122 levels in CHB patients with ALT below and above 40 U/L. [score:1]
Three predicted c-myc binding sites were found in the miR-122 promoter region (-5565nt to -4186 nt) using TESS analysis (http://www. [score:1]
Ten weeks after the last agomir-miR-122 or control agomir injection, all mice were sacrificed and the livers were excised. [score:1]
E. The miR-122 promoter pGL-122 contained three predicted c-myc binding sites (−5.7/−3.8k). [score:1]
Despite the key role of miR-122 in HCC pathogenesis, very little is known regarding its functional relevance in inflammation -mediated HCC. [score:1]
The specificity of C/EBPα binding to the miR-122 promoter was confirmed by depleting C/EBPα in Huh-7 extracts with a C/EBPα antibody (Figure 3J right). [score:1]
The construct pGL-122 (−5.7/−3.8k), containing a luciferase reporter gene under the control of the miR-122 promoter, and pCDNA3.1-C/EBPα was kindly provided by Shi-Mei Zhuang (Sun Yat-Sen University, China). [score:1]
Five and a half months after DEN injection, mice were randomly divided into two groups (5/group) and were intravenously injected with 5 nmol agomir-miR-122 or agomir control. [score:1]
Real-time PCR analysis for miR-122 was performed using a TaqMan miRNA kit (Applied Biosystems, Foster City, CA, USA). [score:1]
Two groups of mice were intravenously injected with 5 nmol cholesterol-conjugated miR-122 (agomir-miR-122) in 0.1 ml saline buffer. [score:1]
Notably, miR-122 levels negatively correlated with ALT levels in CHB patients (p<0.05) (Figure 1C). [score:1]
We purchased cholesterol-conjugated miR-122 mimic and negative control from Ribobio (Guangzhou, China) for RNA delivery in vivo. [score:1]
Together, these results suggest a positive feedback loop between pro-inflammatory cytokines and miR-122 in chronic hepatitis. [score:1]
D. Correlations between miR-122 and TNF-α or IL-6 mRNA levels in all mouse livers by Spearman analysis. [score:1]
Dramatic decreases in miR-122 levels are observed in patients with chronic HBV or HCV infections [18, 32]. [score:1]
As the most abundant liver-specific miRNA, miR-122 accounts for about 70% of the total miRNA population in the adult liver. [score:1]
The liver-enriched transcription factors HNF1α, HNF4α, HNF3β, and C/EBPα were examined first as these cytokines may influence miR-122 transcription [23, 24]. [score:1]
B. Curve showing changes in miR-122 levels over time in mouse liver tissues determined by real-time PCR. [score:1]
C. Correlation analysis of miR-122 levels and serum ALT levels in CHB patients. [score:1]
miR-122 levels in HC were arbitrarily set to 1.0. [score:1]
Spearman analysis revealed a negative correlation between miR-122 levels and IL-6 (r=−0.67, p<0.05) and TNF-α (r=−0.78, p<0.01) levels (Figure 5D). [score:1]
EMSA experiments were then performed using C/EBPα -transfected Huh-7 cell extracts and a biotin-labeled oligonucleotide probe containing the C/EBPα -binding sequence from the miR-122 promoter. [score:1]
Figure 6Five and a half months after DEN injection, mice were randomly divided into two groups (5/group) and were intravenously injected with 5 nmol agomir-miR-122 or agomir control. [score:1]
Liver specimens from 19 CHB and 22 HBV-infected HCC patients were collected for miR-122 analysis. [score:1]
F. miR-122 levels were analyzed after treatment with the indicated amounts of IL-6 (left) or TNF-α (right). [score:1]
To determine whether miR-122 expression is affected by chronic hepatitis, we measured miR-122 levels in liver tissues by real-time PCR. [score:1]
[1 to 20 of 120 sentences]
2
[+] score: 389
Therefore, our data strongly suggest that miR-122 is a tumor suppressor by targeting AKT3 expression to modulate HCC cell transformation, and that over -expression of miR-122 or down-regulation of AKT3 may prove beneficial as therapeutic potentials for HCC patients. [score:12]
Our data clearly demonstrate that targeting and specific down-regulation of AKT3 by miR-122 over expression (as shown in Figure 4B) was able to block migration and this inhibition was rescued by reconstitution of AKT3 expression. [score:12]
Since the phenotypes induced by miR-122 over expression were rescued by a transient expression of ectopic AKT3, we propose that miR-122 regulation of AKT3 expression is necessary and sufficient for modulating tumorigenesis and cellular transformation in human HCC cell lines. [score:8]
Concurrently, AKT3 expression level is up-regulated in all three HCC cell lines (Hep3B2, SNU-182 and SNU-475) with little or no expression of miR-122 (Figure 3A). [score:8]
The lack of regulation observed in Huh-7 cells with miR-122 over -expression could again be contributed to the maintained endogenous miR-122 expression in these cells indicating that increasing miR-122 expression in these cells is not sufficient to alter their tumorigenic abilities. [score:8]
To further confirm that the decreased pBAD and increased cleaved caspase 3 in miR-122 over -expressing SNU-182 cells is due to AKT3 down regulation, AKT3 rescue experiments were performed and data showed that ectopic transient expression of AKT3 is able to partially rescue the effects of miR-122 over -expression in SNU-182 cells (Figure 5D). [score:8]
In summary, our data demonstrate that AKT3 expression is inversely correlated to miR-122 levels in HCC cell lines, and that over -expression of miR-122 in a subset of HCC cell lines decreases AKT3 mRNA and protein levels by directly binding to the 3’UTR of AKT3, which subsequently leads to inhibition of cell proliferation and migration. [score:8]
Furthermore, restoring miR-122 expression in these cell lines not only induced apoptosis and inhibited migration, but also dramatically suppressed tumorigenesis. [score:7]
Over -expression of miR-122 in SNU-182 and Huh-7 did not significantly alter the AKT1 or AKT2 expression, as shown in Figure 4B, again suggesting that miR-122 specifically targets AKT3. [score:7]
These data taken together strongly suggest that miR-122 over -expression in SNU-182 cells decreases cell migration and increases apoptosis through its direct regulation of AKT3 translation. [score:7]
We next examined the effects of miR-122 over expression in human HCC cell lines, SNU-182, SNU-475, Hep3B2, and Huh-7. miR-122 was sub-cloned in a lentiviral expression vector and was successfully over expressed in these cell lines (Figure 4A). [score:7]
shown in Figure 5B clearly indicate that transient over expression of AKT3 in miR-122-GFP expressing SNU-182 cells rescues the migratory inhibition described above by approximately 70%. [score:7]
Therefore, restoration of miR-122 can induce anti-tumor activities through specific targeting of AKT3, suggesting that miR-122 can function as a tumor suppressor in HCCs which harbor diminished miR-122 expression. [score:7]
Importantly, restoring miR-122 expression suppresses HCC cell migration and in vivo tumor growth and induces apoptosis by its direct and specific regulation of AKT3. [score:7]
These data indicate that restoration of miR-122 in HCC cell lines mediates phosphorylation and up-regulation of BAD to promote apoptosis in SNU-182 cells but not in Huh-7 cells, which endogenously express miR-122. [score:6]
In conclusion, we have shown that miR-122 directly and specifically binds to the 3’UTR of human AKT3, and over -expression of miR-122 in HBV-transformed HCC cell lines is able to decrease AKT3, at both the transcript and protein level, to block cell migration, induce apoptosis, and inhibit cell proliferation and tumor growth in mice. [score:6]
Ectopically expressed AKT3 is able to rescue these anti-tumor characteristics induced by miR-122 over -expression indicating that the regulation of tumorigenesis by miR-122 is mediated through targeting AKT3 in these HCCs. [score:6]
Here we show that miR-122 functions as a tumor suppressor in the HBV-transformed HCC human cell lines and report AKT3 as a novel and direct target of miR-122. [score:6]
Interestingly, sustained AKT1 and AKT2 expression in SNU-182 cells was not sufficient in maintaining cell migration in miR-122 over -expressing cells, suggesting that AKT3, but not AKT1 or AKT2, is necessary and sufficient in regulating migration and metastasis in some HCCs. [score:6]
Over -expression of miR-122 in HCC down-regulates AKT3. [score:6]
Using real-time, we also confirmed that miR-122 expression was significantly down-regulated or completely abolished in a variety of human HCC cell lines including Hep-3B2, SNU-182, SNU-475, as well as a hepatoblastoma cell line Hep-G2. [score:6]
In this study, we show that the HBV transformed cells show both significantly decreased miR-122 expression as well as an enhanced expression of AKT3 which seems to regulate tumorigenesis in this subclass of highly aggressive and transformed HCCs. [score:6]
Restoring miR-122 expression in HBV-transformed HCC cell lines inhibited cell migration and induced apoptosis. [score:5]
In vivo, over -expression of miR-122 in a HCC cell line, SNU-182, also inhibited xenograft tumor growth in nude mice. [score:5]
In this study, we demonstrate that miR-122 directly targets AKT3 to regulate the cellular transformations and tumorigenesis in non-HCV transformed human HCC cell lines (Figure 2). [score:5]
SNU-182 cells stably over -expressing miR-122-GFP were established and subcutaneously implanted in nude mice, and tumor growth was monitored over time (SNU182 cells stably expressing GFP alone as well parental cell lines were used as control). [score:5]
In Huh-7 cells, which express some endogenous miR-122, over -expression of miR122 also decreased AKT3 protein levels but this change was only visible on the immunoblot with long exposure time due to the low endogenous AKT3 levels in this cell line (Figure 4A). [score:5]
miR-122 directly binds to the 3’UTR of hs-AKT3 to regulate its expression. [score:5]
miR-122 over -expression inhibited in-vitro cell proliferation and in-vivo tumor growth in a highly transformed HCC SNU-182 xenograft mouse mo del. [score:5]
This construct was used for co-transfection with miR-122 construct in SNU182 (cells lacking endogenous miR-122 expression) and Huh7 (cells harboring some endogenous miR122 expression) cell lines. [score:5]
SNU-182 cells over -expressing miR-122 exhibited decreased phosphorylation of BAD, in addition to an increase in total BAD levels in comparison to the parental cells and Huh-7 cells over -expressing miR-122 (Figure 5C). [score:5]
The inhibition of cell proliferation was rescued by ectopic expression of AKT3 in miR-122 harboring SNU-182 cells (Figure 6B). [score:5]
To confirm that miR-122 induced inhibition in cell migration is due to the decreased level of AKT3 in SNU-182 and SNU-475 cells, we performed a rescue experiment by transiently transfecting a vector encoding the human AKT3 cDNA in the SNU-182 cells, which stably expressed GFP or miR-122-GFP. [score:5]
Furthermore, these miR-122 inhibited migratory responses were rescued by partial restoration of AKT3 expression. [score:5]
Since Huh7 already expresses miR-122, over -expression of this miRNA did not alter cell migration in these cells. [score:5]
Restoring miR-122 expression decreased AKT3 translation. [score:5]
Although the HCV-transformed HCC cell line Huh-7 also showed reduced expression of miR-122, it still maintained a significant level of miR-122 expression, as shown in Figure 1B. [score:5]
Taken together, the migration assays suggest that miR-122 over -expression in SNU-182 cells down regulates AKT3, which in turn inhibits the HGF -induced cell migration in these cells. [score:5]
Therefore, over -expression of miR-122 in the highly transformed SNU-182 HCC cell line induced in-vitro and in-vivo anti-tumor activity classifying miR-122 as a HCC tumor suppressor. [score:5]
Therefore, we next investigated whether inhibition of AKT3 by restoring miR-122 expression would have anti-tumor effects in SNU-182 and SNU-475 in comparison to a HCC cell line (Huh-7) with endogenous miR122 expression. [score:5]
Over -expression of miR-122 inhibits cell migration and induces apoptosis. [score:5]
We first confirmed that miR-122 is exclusively expressed in normal human liver tissue by comparing its expression in other normal tissues (Figure 1A). [score:5]
Therefore, miR-122 expression is specific to liver and is highly suppressed in the human HCC cell lines tested. [score:5]
Over -expression of miR-122 decreased the HGF -induced cell migration in the HBV-transformed SNU-182 and SNU-475 but not in the HCV-transformed Huh-7 cells (Figure 5A) indicating the critical role of AKT3 in regulating migration in SUN-182 and SNU-475 cells. [score:4]
Not surprisingly, down regulation of AKT3 by miR-122 over -expression decreased Bad phosphorylation, increased total Bad accumulation, elevated cleaved caspase 3 levels, and induced programmed cell death. [score:4]
Interestingly, in the hepatoblastoma cells tested (HepG2), AKT3 is not expressed even though miR-122 is highly down regulated. [score:4]
Therefore, miR-122 regulation of AKT3 expression is necessary and sufficient in modulating HCC cellular migration in HBV-transformed cells. [score:4]
Not only is miR-122 crucial to normal liver development and function, including fatty acid and cholesterol metabolism, but it also seems to play pivotal roles in various liver diseases such as the Hepatitis C Virus (HCV) replication [14], [15]. [score:4]
Although Cyclin G1, MDR, ADAM17, and CUTL1 have been proposed as targets of miR-122, the mechanism behind miR-122 regulation of tumorigenesis in HCCs remains poorly understood [18], [21]– [23]. [score:4]
In this study, we identify AKT3 as a novel and direct target of miR-122 in human HCCs. [score:4]
This miR-122 induced apoptosis was rescued by partially restoring AKT3 expression, indicating that AKT3 is not only essential in regulating cellular migration, but also plays pivotal roles in apoptosis and proliferation. [score:4]
Therefore, these results support the hypothesis that miR-122 negatively regulates AKT3 translation in HCC cell lines. [score:4]
0079655.g003 Figure 3(A) The AKT3 transcript level normalized to its expression in normal liver (right Y axis) and normalized miR-122 expression (left Y axis) were measured in various HCC cell lines. [score:3]
Therefore, we next studied the effects of miR-122 over -expression on apoptosis/proliferation. [score:3]
We next examined the expression levels of miR-122 and AKT3 in the normal human liver and human HCC cell lines. [score:3]
demonstrate that miR-122 expression remarkably decreased the firefly luciferase activity in SNU-182 cells indicating miR-122 binding to 3’UTR (Figure 2C). [score:3]
AKT3 expression is inversely correlated to miR-122 levels in HBV transformed HCC cell lines. [score:3]
These miR122 induced anti-tumor activities were rescued by ectopic expression of AKT3. [score:3]
In fact, mice with germline knockout or liver specific knockout of miR-122 develop steatohepatitis, fibrosis and spontaneous tumors resembling HCC [19], [20]. [score:3]
Consequently, we were able to rescue these miR-122 induced anti-tumor activities by reconstituting AKT3 expression. [score:3]
The tumor suppressor functions of miR-122 restoration were observed in all three HBV transformed cell lines tested (Hep3B2, SNU-182, and SNU-475). [score:3]
miR-122 expression in tumor cell lines from other organs was very low (Figure 1B), further confirming that miR-122 is a liver-specific miRNA as reported. [score:3]
The Huh-7 AKT3 levels are not surprising considering the endogenous expression of miR-122 in these cells. [score:3]
Figure 6D shows a dramatic reduction in tumor growth in miR-122 over -expressing SNU-182 xenograft mo dels. [score:3]
As expected, we observed a lower basal firefly luciferase activity in Huh-7 relative to SNU-182, due to the endogenous expression of miR-122 in Huh-7 cells, as indicated in Figure 1B. [score:3]
0079655.g005 Figure 5These miR122 induced anti-tumor activities were rescued by ectopic expression of AKT3. [score:3]
As expected, over -expression of miR-122 decreased both the mRNA and protein levels of AKT3 in SNU-182 cells as shown in Figure 4A. [score:3]
AKT3 expression is inversely correlated to miR-122 levels in HCC cell lines. [score:3]
Over -expression of miR-122 induces in-vitro as well as in-vivo anti-tumor activities in aggressive HCC cell line, SNU-182 cells. [score:3]
Furthermore, HBV-transformed cell lines SNU-182 and Hep-3B2 (data not shown) cells over -expressing miR-122 showed elevations of cleaved caspase 3 levels, another pro-apoptotic protein marker (Figure 5C). [score:3]
This suggests that this cell lines likely lacks the mechanism necessary for tumorigenesis and down regulation of miR-122 is not sufficient to induce that change. [score:2]
As shown in Figure 1 and Figure 3A, miR-122 expression is greatly reduced in the HCC cell lines compared to that in normal liver. [score:2]
miR-122 is down regulated in human hepatocellular carcinoma cell lines. [score:2]
As expected and in agreement with our apoptotic assays, over expression of miR-122 dramatically slowed down cell proliferation in SNU-182 but not in Huh-7 cells (Figure 6A and 6C). [score:2]
miR-122 has previously been shown to be dramatically down regulated in most HCCs and is generally indicative of poor prognosis and higher risk of metastasis [16]– [18]. [score:2]
miR-122 directly binds to the 3’UTR of hsa-AKT3. [score:2]
The assay was carried out simultaneously in SNU-182 and Huh-7 cells, over -expressing miR-122 GFP or the GFP vector alone, as well as parental cells co -transfected with the pGL3-3’UTR construct containing AKT3 3’UTR. [score:2]
Although several targets have been reported for miR-122 to date [18], [21]– [23], none can fully account for the wide range of cellular transformation and tumorigenic characteristics observed in the miR-122 down regulated HCCs. [score:2]
Firefly luciferase activity will be reduced if there is a direct binding between miR-122 and the 3’UTR of AKT3 sequence inserted in the vector. [score:2]
To confirm specificity, we also examined alterations in the other 2 AKT family members in these miR122 transduced cells. [score:1]
We had noticed that the HCC cells transduced with miR-122 showed slower growth rates in culture relative to their parental cell lines. [score:1]
TaqMan miRNA assays (Life Technologies, CA) were used to quantify the expression levels of mature miR-122 as well mRNAs for AKT1, 2, 3. Total RNA extracted by miRvana (life technologies) was reverse transcribed in reaction mixture containing miR-specific stem-loop RT primers. [score:1]
Cell proliferation was measured in (A) SNU-182 and (C) Huh-7 parental cells and cells stably over -expressing miR-122-GFP or GFP alone. [score:1]
As expected due to a lack of miR-122 binding site, although highly homologous, AKT1 and AKT2 mRNA levels only showed slight increases in the HCC cell lines in comparison to normal liver (Figure 3B). [score:1]
After establishing the modulation of the apoptotic pathways by miR-122 in HCC cell lines, we next explored the effects of miR-122 on cell proliferation. [score:1]
miR-122 is the most abundant miRNA in the liver, constituting 70% of the total hepatic miRNAs [12], [13]. [score:1]
Transfection of DNA constructs and miR-122 mimics. [score:1]
Therefore, the luciferase reporter assay confirms direct binding of miR-122 to hsa-AKT3 3’UTR. [score:1]
These results indicate that miR-122 level is inversely correlated to the AKT3 mRNA and protein levels in the HCC cell lines. [score:1]
Transfection of miR-122 into Huh-7 cells did however decrease the luciferase activity, albeit to a lower degree (Figure 2C). [score:1]
0079655.g004 Figure 4(A) AKT3 mRNA and protein levels were measured in SNU-182 and Huh-7 cells stably over -expressing miR-122-GFP or GFP alone. [score:1]
We finally investigated the effects of miR-122 over -expression on in-vivo tumor growth. [score:1]
0079655.g002 Figure 2(A) Sequence alignments of miR-122 with 3’UTR of AKT3 from 3 mammalian species shows partial complementarity. [score:1]
Even though miR-122 and AKT3 expression are inversely correlated in the HBV-transformed cell lines tested, whether this correlation is specifically related to the HBV-transformation needs to be investigated in more detail. [score:1]
[1 to 20 of 94 sentences]
3
[+] score: 347
FXR upregulates the expression of miR-122 in HCC cells by binding directly to the DR2 element (−338 to −325) in miR-122 promoter region, which in turn downregulates the expression of miR-122 target genes including IGF-1R and cyclin G1. [score:14]
Furthermore, inhibition of miR-122 by its antagomir abolished the GW4064 -mediated downregulation of miR-122 target genes (Fig  2g and h), demonstrating that FXR suppressed the expression of miR-122 target genes in a miR-122 -dependent manner (Namely, the FXR -induced miR-122 is functional). [score:14]
FXR upregulates miR-122 expression and in turn downregulates the expression of miR-122 target genes in HCC cells. [score:13]
Activation of FXR in HCC cells upregulated miR-122 expression and in turn downregulated the expression of miR-122 target genes including insulin-like growth factor-1 receptor and cyclin G1. [score:13]
Knockdown of FXR by small interfering RNA (siRNA) significantly attenuated the GW4064 -mediated upregulation of miR-122 and downregulation of its target genes (Fig.   2d– f), indicating that the effect of GW4064 on miR-122 expression is FXR-specific. [score:12]
In this study, we show for the first time that FXR upregulates miR-122 expression by binding directly to the DR2 element in miR-122 promoter region, and, moreover, that this upregulation plays an important role in the FXR -mediated growth suppression of HCC cells in vitro and in vivo. [score:12]
Fig. 2FXR upregulates miR-122 expression and suppresses the expression of miR-122 target genes. [score:12]
miR-122 is a novel target gene of FXR, and the upregulation of miR-122 by FXR represses the growth of HCC cells, suggesting that FXR may serve as a key transcriptional regulator for manipulating miR-122 expression, and the FXR/miR-122 pathway may therefore be a novel target for the treatment of HCC. [score:11]
As shown in Fig.   2a– c, GW4064 dose -dependently upregulated the expression of primary miR-122 (pri-miR-122) and mature miR-122 (Fig.   2a), while downregulated the expression of IGF-1R and cyclin G1 (Fig.   2b and c). [score:11]
FXR upregulated the expression of miR-122 by directly binding to the directed repeat separated by two nucleotides (DR2 element) (−338 to −325) in miR-122 promoter region, indicating that miR-122 is a novel target gene of FXR. [score:10]
They found that treatment with the DNA methylation inhibitor 5′-aza-2′deoxycytidine and histone deacetylation inhibitor 4-phenylbutyric acid increased the association of PPARγ/RXRα, but decreased that of its corepressors (N-CoR and SMRT), with miR-122 regulatory elements, leading to an upregulation of miR-122 transcription. [score:9]
It can be directly downregulated by miR-122, and the expression of cyclin G1 and miR-122 is inversely correlated in HCC tissues [42]. [score:7]
Functional experiments showed that the FXR -mediated upregulation of miR-122 suppressed the proliferation of HCC cells in vitro and the growth of HCC xenografts in vivo. [score:6]
The FXR -mediated upregulation of miR-122 suppresses the proliferation of HCC cells in vitro and the growth of HCC xenografts in vivo in nude mice. [score:6]
Fig. 6FXR agonist represses the growth of HCC xenografts and upregulates miR-122 expression in vivo. [score:6]
These results suggest that FXR may serve as a key transcriptional regulator for manipulating miR-122 expression, and that the FXR/miR-122 pathway may be a novel target for the treatment of HCC. [score:6]
These results also suggest that FXR could serve as a key transcriptional regulator for manipulating miR-122 expression, and that the FXR/miR-122 pathway may be a novel target for the treatment of HCC. [score:6]
Although more studies are warranted to understand the detailed molecular mechanisms by which miR-122 regulates its target genes in HCC cells, our findings demonstrate that miR-122 is a novel target gene of FXR. [score:6]
These results suggest that FXR exerts its anti-HCC effects through upregulating miR-122 expression in vivo. [score:6]
Moreover, miR-122 is an important tumor suppressor of HCC [11, 13], and its downregulation in human HCC tissues [8, 12] is associated with metastasis and poor prognosis [30, 31]. [score:6]
Activation of FXR upregulates miR-122 expression in HCC cells. [score:6]
Functional experiments showed that FXR -mediated upregulation of miR-122 suppressed the proliferation of HCC cells in vitro and the growth of HCC xenografts in vivo. [score:6]
Previous reports have also shown that its expression is specifically reduced in primary HCC [11– 13], so the upregulation of miR-122 should be beneficial in the prevention and treatment of HCC. [score:6]
e and f After transfection with control siRNA or FXR siRNA for 24 h, Hep3B cells were treated with vehicle DMSO or 5 μM GW4064 for 24 h, and then the expression of miR-122 and its target genes including IGF-1R and cyclin G1 was determined by qRT-PCR (e) and (f). [score:5]
miR-122 suppresses IGF-1R expression and attenuates IGF-1R/Akt signaling, which sustains the activity of glycogen synthase kinase 3 beta and in turn represses cancer cell proliferation [30]. [score:5]
As shown in Fig.   5, inhibition of miR-122 by its antagomir markedly attenuated the GW4064 -induced growth repression of HCC cells, strongly suggesting that the FXR -mediated cell growth suppression is largely dependent on miR-122 induction. [score:5]
qRT-PCR was also used to detect the expression of miR-122 target genes at mRNA level, while was used to analyze that of their protein products. [score:5]
Inhibition of miR-122 dramatically attenuates the FXR -mediated growth suppression of HCC cells. [score:5]
Subsequently, the mice were sacrificed, and the tumors were harvested for analysis of the expression of Ki67, miR-122 and its target genes including IGF-1R and cyclin G1. [score:5]
b and c Hep3B cells were treated with GW4064 (0.5 or 5 μM) or vehicle DMSO for 48 h, and then the expression of miR-122 target genes including IGF-1R and cyclin G1 was separately examined by qRT-PCR (b) and (c). [score:5]
Aberrant expression of miR-122 is closely related with liver diseases. [score:5]
Consistent with the in vitro findings, the activation of FXR by GW4064 in vivo markedly increased miR-122 expression and decreased that of miR-122 target genes including IGF-1R and cyclin G1 in HCC xenografts (Fig.   6d and e). [score:5]
Therefore, it is not clear whether FXR can epigenetically regulate miR-122 expression in the same way as PPARγ, which requires further study. [score:4]
β-actin was used as a control for FXR examination, while U6 snRNA as a control for miR-122 detection To investigate the regulation of miR-122 by FXR, Hep3B cells were treated with the FXR agonist GW4064, then the expression of miR-122 and its target genes including insulin-like growth factor-1 receptor (IGF-1R) and cyclin G1 were examined by qRT-PCR and. [score:4]
miR-122 FXR Hepatocellular carcinoma Cell proliferation Gene regulation microRNAs (miRNAs), a family of small (~22-nucleotide) endogenous noncoding RNAs [1], play important roles in many cellular processes by targeting an estimated 10–30 % of all protein-coding genes [2, 3]. [score:4]
Recently, Song et al. demonstrated that the nuclear receptor peroxisome proliferator-activated receptor gamma (PPARγ) epigenetically regulates miR-122 expression in HCC cells [33]. [score:4]
Many target genes of miR-122 are involved in hepatocarcinogenesis, HCC growth and metastasis, including IGF-1R, cyclin G1, Wnt1, serum response factor, a disintegrin and metalloprotease 10 (ADAM10), ADAM17, cut-like homeobox 1, pyruvate kinase muscle isozyme 2, and pituitary tumor-transforming gene 1 binding factor [24, 38, 39]. [score:3]
Moreover, FXR expression was positively correlated with that of miR-122 in HCC tissues (R [2] = 0.61, P < 0.01) (Fig.   1c). [score:3]
HepG2, Huh7, PLC and SMMC-7721 cells were separately treated with GW4064 (5 μM) or vehicle DMSO for 24 h, and then the expression of pri-miR-122 (A) and mature miR-122 (B) was examined by qRT-PCR. [score:3]
Previous studies have shown that the transcriptional factors hepatocyte nuclear factor 4 alpha (HNF4α) and CCAAT/enhancer binding protein alpha (C/EBPα) can modulate miR-122 expression [30, 32]. [score:3]
The expression of FXR was positively correlated with that of miR-122 in HCC tissues and cell lines. [score:3]
As shown in Fig.   1a and b, the expression of both FXR and miR-122 in HCC tissues was lower than that in the adjacent noncancerous tissues. [score:3]
Moreover, FXR activation also promoted miR-122 expression in other HCC cell lines including Huh7, HepG2, PLC and SMMC-7721 cells (Additional file 1: Figure S1). [score:3]
The influence of FXR on tumor growth and miR-122 expression in vivo was monitored using HCC xenografts in nude mice. [score:3]
d and e The expression of miR-122, IGF-1R and cyclin G1 in HCC xenografts was separately detected by qRT-PCR (d) and (e). [score:3]
a and b The expression of FXR mRNA (a) and mature miR-122 (b) in 20 human HCC tissues and the corresponding adjacent noncancerous tissues was detected by qRT-PCR. [score:3]
b Huh7 cells were co -transfected with renilla luciferase expression vector pRL-TK and one of a series of luciferase reporter constructs containing different fragments of miR-122 promoter region. [score:3]
FXR -induced miR-122 is involved in the growth suppression of HCC xenografts in vivo. [score:3]
FXR binds directly to the FXRE/DR2 in miR-122 promoter region. [score:2]
However, it is unclear whether the anti-HCC effect of FXR is involved in the regulation of miR-122. [score:2]
FXR bound directly to the DR2 element (−338 to −325) in miR-122 promoter region, and enhanced the promoter’s transcriptional activity. [score:2]
a Hep3B cells were treated with GW4064 (0.5 or 5 μM) or vehicle DMSO for 24 h, and then the expression of pri-miR-122 and mature miR-122 was assayed using qRT-PCR. [score:2]
d The expression of FXR mRNA and mature miR-122 in HCC cell lines (HepG2, Hep3B, Huh7, PLC, SMMC-7721, MHCC97L and MHCC97H) and hepatic cell line L02 was assayed by qRT-PCR. [score:2]
Farnesoid X receptor (FXR), a transcription factor with multiple functions, plays an important role in protecting against liver carcinogenesis, but it is unclear whether the anti-HCC effect of FXR is involved in the regulation of miR-122. [score:2]
Because of many important roles of miR-122, it is necessary to understand its regulatory mechanisms. [score:2]
As shown in Fig.   4c, demonstrated that the anti-FXR antibody precipitated the DNA fragment containing the DR2 element, indicating that FXR binds directly to the FXRE/DR2 in miR-122 promoter region in HCC cells. [score:2]
These results suggest that FXR is involved in the regulation of miR-122. [score:2]
The expression of mature miR-122 was assayed using an all-in-one miRNA quantitative reverse transcriptase PCR detection kit according to the manufacturer’s protocol, normalizing to U6 small nuclear RNA (snRNA). [score:2]
Mutation of FXRE/DR2 (−338 to −325) within the construct pGL3-F4 abolished the GW4064 -induced luciferase activity (Fig.   3c), indicating that the FXRE/DR2 is important for FXR-enhanced transcriptional activation of miR-122 promoter. [score:2]
Besides its regulation on miR-122, FXR uses other mechanisms to protect against HCC including the repression of NF-κB activation in hepatocytes [20], indicating that its anti-inflammatory properties may contribute to HCC prevention. [score:2]
e The correlation between the levels of FXR and miR-122 in HCC cell lines was analyzed using Pearson’s test (R [2] = 0.95, P < 0.01). [score:1]
For examination of the mRNAs (including FXR, IGF-1R and cyclin G1 mRNAs) and pri-miR-122, total RNA was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA), and then the first-strand cDNA was synthesized using M-MLV reverse transcriptase (Invitrogen). [score:1]
Fig. 4FXR binds to the FXRE/DR2 in miR-122 promoter region. [score:1]
Fig. 3FXR enhances the transcriptional activity of miR-122 promoter. [score:1]
β-actin was used as a control for the examination of FXR, pri-miR-122, IGF-1R and cyclin G1, while U6 snRNA as a control for the detection of mature miR-122. [score:1]
Fig. 1The level of FXR is positively correlated with that of miR-122. [score:1]
c The correlation between the levels of FXR and miR-122 in HCC tissues was analyzed using Pearson’s test (R [2] = 0.61, P < 0.01). [score:1]
Relative levels of the mRNAs and pri-miR-122 were normalized to that of β-actin mRNA. [score:1]
microRNA-122 (miR-122) is the most abundant and specific miRNA in the liver. [score:1]
The levels of miR-122 and FXR in HCC tissues and cell lines were examined by quantitative real-time PCR (qRT-PCR). [score:1]
Our data show that the level of FXR is positively correlated with that of miR-122 in HCC tissues and cell lines. [score:1]
Putative FXREs in human miR-122 promoter region were predicted using an online algorithm (NUBIScan: http://www. [score:1]
To investigate the relationship between FXR and miR-122, their expression levels were examined using quantitative real-time PCR (qRT-PCR) in 20 human HCC tissues and the corresponding adjacent noncancerous tissues. [score:1]
Similarly, the level of FXR was also paralleled to that of miR-122 in HCC cell lines (Fig.   1d) and there was a positive correlation between them (R [2] = 0.95, P < 0.01) (Fig.   1e). [score:1]
The level of FXR is positively correlated with that of miR-122 in HCC tissues and cell lines. [score:1]
The fragments were then separately inserted between KpnI and HindIII sites of the pGL3-basic vector (Promega), and the resulting plasmids were named as follows with the fragment of miR-122 promoter region specified: pGL3-F1 (−1100 to +130), pGL3-F2 (−1000 to +130), pGL3-F3 (−900 to +130), pGL3-F4 (−400 to +130) (also named pGL3-F4(DR2)-WT), pGL3-F5 (−200 to +130), pGL3-F6 (−150 to +130), pGL3-F7 (−50 to +130) and pGL3-F8 (+5 to +130). [score:1]
a Potential FXREs in miR-122 promoter region were predicted using an online algorithm (NUBIScan: http://www. [score:1]
miR-122 is the most abundant miRNA (constituting 70 % of the total miRNA population) in the liver [4– 6]. [score:1]
FXR enhances the transcriptional activity of miR-122 promoter. [score:1]
The putative FXR response elements (FXREs) in miR-122 promoter region were predicted using an online algorithm (NUBIScan: http://www. [score:1]
In the present study, we demonstrated that the level of FXR was positively correlated with that of miR-122 in HCC tissues and cell lines. [score:1]
For examples, miR-122 represses hepatitis B virus (HBV) replication, and is decreased in the livers of HBV -positive patients [28, 29]. [score:1]
[1 to 20 of 82 sentences]
4
[+] score: 303
Because SLC7A1 is a direct target of miR122 in vitro [17] and miR122 expression levels are frequently decreased in HCC tissues [6, 18, 19], we first analyzed the genome-wide mRNA and miRNA profiles of clinical HCC tumors infected with chronic hepatitis B (n = 192) and hepatitis C (n = 89) using the public data [20– 23] to determine the correlation in the expression levels of between miR122 and SLC7A1 in clinical HCC samples. [score:8]
Hep3B cells expressing the miR122 precursor showed enhanced miR122 function (Figure 4a) and suppressed luciferase expression from a reporter carrying the 3′ UTR of the SLC7A1 gene (Figure 4b), with lower expression of SLC7A1 protein compared with the control cells (Figure 4c). [score:8]
GFP -positive (miR122-silenced) Huh7 cells and GFP -negative (miR122-non -overexpressing) Hep3B cells were more concentrated after sorafenib treatment of mixtures of infected (GFP -expressing) and non-infected (non-GFP -expressing) cells cultured in bulk (Figure 4f and g), confirming that decreased miR122 function was related to sorafenib resistance. [score:7]
Control cells (control), miR122 precursor -expressing cells (miR122 precursor), cells cultured in arginine -depleted media (Arg depleted), and miR122 precursor -expressing cells with expression of SLC7A1 (miR122 precursor + SLC7A1) were tested. [score:7]
Because stable overexpression of SLC7A1 in the miR122 precursor-stably expressing Hep3B cells reversed the effects of intracellular NO contents, changes in intracellular NO levels appeared dependent on changes in the SLC7A1 expression levels (Figure 4d). [score:7]
SLC7A1 expression levels in Hep3B cells were suppressed by PD407824, and this was reversed by the stable expression of antisense miR122 construct (Figure 5c). [score:7]
To determine the clinical relevance of miR122 deregulation on SLC7A1 expression, previously generated genome-wide mRNA and miRNA profiles of a hepatitis B-related HCC cohort (n = 192) [20, 21] and a hepatitis C-related HCC cohort (n = 89) [22, 23] (NCBI Gene Expression Omnibus; accession numbers GSE6857, GSE14520, GSE20594, and GSE9843) were analyzed. [score:6]
Similarly, the NO content in the cell lysate was downregulated by PD407824, which was antagonized by the stable expression of SLC7A1 or antisense miR122 construct (Figure 5d). [score:6]
The miR122 precursor in the eGFP -expressing plasmid (pCDH-miR122 with eGFP) and the H1 promoter -driven antisense miR122 stem-loop-stem RNA -expressing plasmid (pmiRZIP122 with eGFP) were purchased from System Biosciences (Mountain View, CA, USA). [score:5]
SLC7A1 expression was decreased in Hep3B cells treated with PD407824 (PD), which was antagonized by expressing the antisense miR122 construct (PD + miR122-silenced). [score:5]
miR122-silenced Huh7 cells and miR122 precursor -expressing Hep3B cells showed GFP co -expression. [score:5]
Consistent with previous reports [27], luciferase expression from a reporter construct containing the 3′ UTR of the SLC7A1 gene was increased, and SLC7A1 expression was increased by miR122-silecing (Figure 2b and 2c). [score:5]
Therefore, it is possible that the decreased expression of miR122 in the liver in pathological states such as HCC may cause the abnormally increased expression of SLC7A1 and the subsequent metabolic changes due to amino acid imbalances. [score:5]
Our results may provide a basic rationale for HCC treatments targeting arginine, especially in the presence of reduced miR122 expression. [score:5]
The percentage of GFP -expressing cells (~50% before sorafenib treatment) increased in the miR122-silenced Huh7 cells and decreased in the miR122 precursor -expressing Hep3B cells after 5 μM sorafenib treatment for 48 h, as determined by flow cytometry. [score:5]
Forced miR122 expression in HCC cells decreased SLC7A1 expression and intracellular NO levels. [score:5]
In summary, we have shown that decreased miR122 expression in HCC leads to increased intracellular arginine and NO levels through elevated SLC7A1 expression, which may be involved in chemoresistance. [score:5]
Relative Hep3B cell numbers were counted after treatment with or without PD407824 (PD) for 48 h. Control cells (Control), sorafenib treated cells (Sorafenib), sorafenib -treated cells with stable expression of SLC7A1 (Sorafenib + SLC7A1) or stable expression of the antisense miR122 construct (Sorafenib + miR122-silenced) were tested. [score:5]
To determine the converse effects, the miR122 precursor was stably expressed in Hep3B cells, because these cells naturally expressed only minimal levels of miR122 [5]. [score:5]
From the results of the initial screening, we focused on the increased intracellular arginine content with miR122 silencing, because SLC7A1, a well-known target of miR122 [27], is the transporter for arginine and the increased arginine levels were explained by changes in the expression levels of this gene. [score:5]
Using Hep3B cells, which naturally express low levels of miR122, the enhanced expression levels of miR122 after treatment with PD407824 or Ellipticine for 24 h were confirmed by quantitative RT-PCR (Figure 5b). [score:5]
Because 293T cells also express miR122 [57] and these cells were efficient at gene-editing, the above Cas9 expressing construct and the donor vector were transfected into 293T cells and selected with 2 μg/ml puromycin; subsequently 12 colonies were picked up. [score:5]
These results suggested that miR122-silenced HCC cells were more resistant to sorafenib because they contained higher intracellular arginine and NO levels, possibly through elevated expression of SLC7A1, an arginine transporter and a target of miR122. [score:5]
The combinatorial effects of PD407824 and sorafenib were antagonized by the stable expression of SLC7A1 or the antisense miR122 construct (Figure 5e), suggesting that the synergistic effects of PD407824 with sorafenib on Hep3B cells were mediated by enhanced miR122 expression via PD407824. [score:5]
Interestingly, although SLC7A1 is expressed almost ubiquitously, its expression is absent in the adult normal liver [43], possibly because of high miR122 levels in the healthy liver. [score:5]
Control cells (control), miR122 precursor -overexpressing cells (miR122 precursor) and cells with stable overexpression of both the miR122 precursor and HA-tagged SLC7A1 (miR122 precursor + SLC7A1) were tested. [score:5]
Our results suggest that deprivation of arginine or combination of sorafenib and miR122 expression-enhancing drugs may be useful in the management of a subset of HCCs with reduced miR122 expression levels. [score:5]
Although numerous genes have been recognized as candidates, few have been confirmed experimentally as direct targets of miR122. [score:4]
Among the genes identified, cationic amino acid transporter member 1 (CAT1, also known as solute carrier family 7, SLC7A1) is the best-known direct target of miR122. [score:4]
Intracellular NO levels were elevated in miR122-silenced Huh7 cells without deregulated NO synthetase expression (Figure 2e and Supplementary Figure 2). [score:4]
Arginine depletion blocked upregulation of intracellular NO levels in miR122-silenced HCC cells. [score:4]
The targeting site by the guide RNA with the protospacer adjacent motif (PAM) sequences at the 11 bases upstream of miR122 precursor lesions was determined using the CRISPRdirect database (http://crispr. [score:4]
Because SLC7A1 is a well-known arginine transporter [15], it was hypothesized that repressed miR122 expression in HCC would lead to deregulated levels of intracellular amino acids, especially arginine, which may affect the biological phenotype of HCC. [score:4]
Figure 4 (a, b) The effects of miR122 on the reporter constructs carrying miR122 responsive elements (a) and the SLC7A1 3′UTR (b) in control and miR122 precursor -expressing Hep3B cells. [score:3]
These results suggested that the combination of PD407824 and sorafenib may act favorably against HCCs through increasing miR122 expression levels. [score:3]
To confirm the above screening results in vitro, we used miR122-silenced Huh7 cells, well-differentiated HCC cells which stably express miR122 antisense constructs and have impaired miR122 function [5] (Figure 2a). [score:3]
Control cells (Control), PD407824 treated cells (PD), and PD407824 treated cells with stable expression of HA-tagged SLC7A1 (PD + SLC7A1) or the antisense miR122 construct (PD + miR122-silenced) were tested. [score:3]
The miR122 precursor -expressing plasmid with the puromycin resistance gene (pCDH-miR122 with puro), which was constructed by replacing the eGFP gene with the puromycin resistance gene via the FseI site, was constructed as described previously [5]. [score:3]
The gene-editing target site by Cas9 is located just before the miR122 precursor locus. [score:3]
Relative cell numbers were counted after treatment for 48 h with 5 μM sorafenib with or without PTIO in miR122 precursor -expressing Hep3B cells. [score:3]
These results suggest that miR122-silenced HCC cells are more resistant to chemotherapeutic drugs, and that depletion of arginine in extracellular environments may be effective for the clinical management of an HCC subset with reduced miR122 expression levels. [score:3]
The correlation between SLC7A1 and miR122 expression levels was assessed by Spearman correlation tests. [score:3]
Huh7 cells were chosen for the experiments using the antisense miR122 construct because they have endogenously high miR122 expression levels [27] and the effects of miR122-silecing are more easily observed. [score:3]
PD407824 increases miR122 expression and sensitizes Hep3B cells to sorafenib treatment. [score:3]
In vivo studies inhibiting miR122 function also showed effects on fatty acid and iron metabolism [7, 9– 13], suggesting that miR122 had pleiotropic metabolic effects [14]. [score:3]
The firefly luciferase -based reporter carrying a miR122-responsive element in its 3′ untranslated region (UTR), used to examine miR122 function, and the internal control Renilla luciferase -based plasmids have been described previously [5]. [score:3]
pmiRZIP122 without the eGFP gene (pmiRZIP122 with puro) for miR122 silencing was constructed by excision of the eGFP-coding sequences via the Xba I and Pst I sites, followed by ligating the cut ends annealed with oligonucleotides (5′-CTA GAC GCC ACC ATG CTG CA-3′ and 5′-GCA TGG CGT-3′) to maintain the expression of the downstream puromycin resistance gene. [score:3]
MiR122 functionally silenced transgenic C57BL/6 mice which expressed antisense miR122 oligonucleotides under the control of the H1 promoter were described in detail in our previous study [5]. [score:3]
Because arginine is an amino acid which is transported into cells via SLC7A1 [26], a target of miR122, we focused on the reproducibly increased arginine content of miR122-silenced tissues, in subsequent studies. [score:3]
Because increased intracellular NO synthesis is also a property of cancer-progenitor cell-like features [30, 32– 34], the expression levels of HCC cancer-progenitor cell markers, such as EpCAM and CD13 [35] were examined, which were significantly increased in miR122-silenced cells (Supplementary Figure 3). [score:3]
Control cells (control), miR122-silecend cells (miR122-silenced), miR122-silenced cells cultured in arginine -depleted media (miR122-silenced + Arg depleted), and miR122-silenced cells with expression of shSLC7A1 (miR122-silenced + shSLC7A1) were tested. [score:3]
In this study, we demonstrate that miR122-silenced HCC cells and tissues have higher SLC7A1 expression, intracellular arginine, and NO contents, which may be linked to the sorafenib chemosensitivity, consistent with the previous reports that miR122 is linked with sorafenib sensitivity in HCC cells [38, 39]. [score:3]
Thus, the reporter expression levels reflected the transcription levels of the miR122 pri-precursor lesion. [score:3]
Although the molecular mechanisms of how those compounds enhanced the miR122 precursor transcription remain unclear, combination therapy with sorafenib may provide a promising approach to the treatment of resistance in HCC by enhancing miR122 expression and reducing SLC7A1 levels. [score:3]
The expression of miR122, a liver-specific microRNA (miRNA), is frequently repressed in human HCC [4], and this is functionally linked with aggressive phenotypes in HCC cells [5, 6]. [score:3]
Expression levels of miR122 and SLC7A1 were negatively correlated, modestly but significantly, in both human cohorts (  p < 0.001) (Supplementary Figure 1a and 1b). [score:3]
Identification of chemical compounds that enhanced miR122 expression levels. [score:3]
assessment of SLC7A1 protein expression in control cells (black line) and miR122-silenced cells (pink line) was performed. [score:3]
The results obtained led us to hypothesize that if it were possible to enhance miR122 expression levels in HCC cells using chemical compounds, such compounds could augment the chemosensitivity of HCCs to sorafenib. [score:3]
In addition, because knockdown of SLC7A1 in miR122-silenced cells through expression of shSLC7A1 also prevented an increase in intracellular NO, it was considered that the increased NO levels in miR122-silenced cells were due to increased SLC7A1 levels (Figure 3b). [score:3]
Forced miR122 expression sensitizes Hep3B cells to sorafenib treatment. [score:3]
It was noted that miR122 expression had a positive effect on the sorafenib -treated Hep3B cells, similar to the effects of removing NO with PTIO (Figure 4e). [score:3]
Finally, a comprehensive screen was performed of chemical compounds that increased miR122 expression levels in HCC and that could alleviate the observed resistance to sorafenib. [score:3]
To exclude any possible influences of stable cell line specificity or differences in the culture conditions of the individual cell lines, Huh7 or Hep3B cells were transduced with miR122-silencing or miR122 -overexpressing lentiviruses with GFP, but without selection. [score:3]
In addition, the compounds identified also possess anti-cancer properties at appropriate doses, irrespective of the effects of increased miR122 expression levels, which may also be beneficial for the treatment of HCCs in combination with sorafenib. [score:3]
To undertake a comprehensive screen of possible compounds, a knock-in reporter construct was created by inserting a firefly luciferase gene in the miR122 precursor genomic locus by genome-editing using the CRISPR-Cas9 system (Figure 5a and Supplementary Figure 4). [score:2]
Figure 5 (a) A schematic of the knock-in reporter at the miR122 pri-precursor locus. [score:2]
To screen those chemical compounds that had the potential to increase miR122 precursor transcription, knock-in reporter cells were prepared using the CRISPR/Cas9 gene editing system. [score:2]
Relative cell numbers were counted after treatment for 48 h with 5 μM sorafenib with or without PTIO in miR122-silenced Huh7 cells. [score:1]
These results showed that reduced intracellular arginine and NO levels in miR122-silecend cells can be achieved by the depletion of arginine in the extracellular media. [score:1]
In this study, changes in amino acid levels in miR122-silenced mouse liver tissues, caused by impaired miR122 function, were first assessed. [score:1]
From these results, we proposed possible interventional methods for a subset of HCCs with repressed miR122 levels. [score:1]
Thus, to gain insights regarding the physiological effects on amino acid metabolism induced by miR122 silencing, changes in amino acid levels in miR122-silenced liver tissues were determined in this study. [score:1]
These cells were screened with over 1,200 chemical compounds to identify molecules which potentially enhance miR122 pri-precursor transcription. [score:1]
Intracellular arginine and NO levels were increased in miR122-silenced HCC cells. [score:1]
Figure 3 (a) Intracellular arginine levels decreased in miR122-silenced cells under arginine -depleted conditions. [score:1]
Of the 20 amino acids examined, arginine showed reproducible differences in levels in between the control and miR122-silenced liver tissues from two individuals per group (Figure 1). [score:1]
Mice lacking the gene encoding miR122 suffer from liver steatosis and HCC, suggesting a critical role of miR122 in metabolic homeostasis and oncogenesis in the liver [7, 8]. [score:1]
A Renilla luciferase -based reporter constructed with the SLC7A1 3′UTR, which contains three miR122 responsive elements, was kindly provided by Prof. [score:1]
Liver tissues from two control C57BL/6 mice and from two miR122-silenced transgenic mice were subjected to comprehensive analyses of amino acid levels, as described previously [53]. [score:1]
WT, control mice; miR122-silenced, miR122-silenced transgenic mice. [score:1]
Changes in amino acid levels in liver tissues from miR122-silenced mice. [score:1]
A liver-specific miRNA, miR122, has been linked with pleiotropic physiological functions [14]. [score:1]
Figure 2 (a) The firefly luciferase -based reporter with miR122 3′UTR responsive elements was transfected along with the Renilla luciferase -based control reporter. [score:1]
Another important finding of this study was the identification of those compounds that enhanced transcription of the miR122 precursor. [score:1]
Next, based on the results, chemoresistance of HCC cells with impaired miR122 function against sorafenib was determined. [score:1]
To determine the biological effects of impaired miR122 function on amino acid levels, the latter were comprehensively quantified in miR122-silenced mouse liver tissues [5]. [score:1]
As expected, miR122-silenced cells showed more resistance to sorafenib, determined by the number of the survival cells after sorafenib treatment for 48 hrs (Figure 2e). [score:1]
Results of amino acid analyses of liver tissues from control and miR122-silenced transgenic mice (n = 2 each). [score:1]
Hybridization was performed overnight at 42°C in ULTRAhyb-Oligo Buffer (Ambion) containing a biotinylated probe specific for miR122 (caa aca cca ttg tca cac tcc a), which had previously been heated to 95°C for 2 min. [score:1]
Figure 1Results of amino acid analyses of liver tissues from control and miR122-silenced transgenic mice (n = 2 each). [score:1]
Reduced miR122 is linked with resistance against sorafenib. [score:1]
Arginine depletion decreases NO levels in miR122-silenced Huh7 cells. [score:1]
Although intracellular arginine levels were increased in miR122-silenced cells in the arginine-content media, this increase was not seen when the cells were cultured under arginine -depleted conditions (Figure 3a). [score:1]
[1 to 20 of 94 sentences]
5
[+] score: 303
Here we found that TGF-β significantly downregulated miR-122 expression, whereas restoration of miR-122 expression dramatically attenuated fibrosis-promoting effect of TGF-β by directly suppressing the expression of FN1 and SRF, and subsequently abrogating the transcription of COL1A1 and α-SMA in HSCs and fibroblasts. [score:13]
Furthermore, the expression of α-SMA, a marker for fibrogenic cell activation, was upregulated in TGF-β -treated primary HSCs (Figure 1C, lanes 1 and 2), but this effect was significantly inhibited by restoration of miR-122 expression (Figure 1C). [score:10]
Here we showed that introduction of miR-122 inhibited the expression of FN1 and SRF, and inhibition of miR-122 elevated FN1 and SRF expression in both HSCs and fibroblasts. [score:9]
In agreement with our findings, it is recently reported that miR-122 is downregulated in HSCs from CCl [4]- and bile duct ligation -induced fibrotic livers of mice and miR-122 inhibits collagen maturation in vitro by targeting P4HA1, a component of prolyl 4-hydroxylase that promotes the procollagen to form triple helix of collagen molecule [17]. [score:8]
The above results revealed that overexpression of miR-122 downregulated FN1 expression at protein (Figure 2C and 2D; Supplementary Figure 3D) but not mRNA level (Supplementary Figures 2 and 3C). [score:8]
Both in vitro and in vivo studies disclosed that miR-122 significantly suppressed the activation of fibrogenic cells and the TGF-β -induced expression of fibrosis-related genes, thus inhibiting the hepatic fibrogenesis. [score:7]
miR-122 directly suppresses FN1 expression and indirectly attenuates the transcription of α-SMA and COL1A1. [score:7]
Consistently, the 3′-untranslated region (3′-UTR) of FN1 mRNA contained binding sequence of miR-122 and overexpression of miR-122 inhibited the activity of reporter with wild-type but not mutant 3′-UTR of FN1. [score:7]
Furthermore, TGF-β treatment downregulated miR-122 expression, indicating that reduction of miR-122 level may represent a critical event to promote liver fibrosis. [score:6]
However, ectopic expression of miR-122 abrogated TGF-β -induced upregulation of FN1 protein level in LX2 and NLFs (Figure 2C and 2D). [score:6]
We next explored the mechanisms responsible for miR-122 -induced downregulation of α-SMA and COL1A1 expression. [score:6]
These data indicate that miR-122 may directly suppress FN1 expression by binding to its 3′UTR. [score:6]
All these data suggest that FN1 and SRF are bona fide targets of miR-122, and miR-122 may suppress hepatic fibrosis by simultaneously blocking multiple aspects of fibrogenesis, including collagen production, fibril assembly and ECM contraction. [score:5]
These results imply that miR-122 may suppress FN1 translation and attenuate SRF -induced transcription of α-SMA and COL1A1. [score:5]
miR-122 inhibits the TGF-β -induced expression of fibrosis-related genes. [score:5]
Dual-luciferase reporter analysis showed that co -expression of miR-122 significantly inhibited the activity of firefly luciferase with wild-type but not mutant 3′UTR of FN1 (Figure 3B). [score:5]
All oligonucleotide sequences are listed in Supplementary Table 1. Firefly luciferase reporter plasmid was used to verify the miR-122 -targeted 3′ untranslated region (UTR). [score:5]
miR-122 suppresses FN1 expression by binding to its 3′UTR. [score:5]
miR-122 inhibits TGF-β -induced expression of fibrosis-related genes. [score:5]
Lenti-ctrl, negative control lentivirus without miRNA expression cassette; Lenti-miR-122, miR-122 -expressing lentivirus. [score:5]
Restoration of miR-122 expression inhibits hepatic fibrogenesis in vivo. [score:5]
Collectively, these data suggest that miR-122 may suppress TGF-β -induced activation of fibrogenic cells and in turn attenuate the expression of fibrosis-related genes. [score:5]
All oligonucleotide sequences are listed in Supplementary Table 1. Firefly luciferase reporter plasmid was used to verify the miR-122 -targeted 3′ untranslated region (UTR). [score:5]
As expected, we found that introduction of miR-122 repressed SRF expression (Figure 4A), whereas inhibition of endogenous miR-122 elevated SRF level (Figure 4B) in both LX2 and NLFs. [score:5]
Lentivirus expression vector pCDH-miR-122 was utilized to express the mouse miR-122 precursor (mmu-pre-miR-122). [score:5]
Furthermore, similar to miR-122 overexpression, knockdown of SRF (Supplementary Figure 5) significantly attenuated TGF-β -induced elevation of α-SMA and COL1A1 levels (Figure 4C-E). [score:4]
Consistent with primary HSCs, TGF-β stimulation induced downregulation of miR-122 in LX2 cells (Figure 1D). [score:4]
In addition to hepatocytes, miR-122 has been detected in human skin fibroblasts, where it regulates p53 expression and cellular senescence [11, 12], suggesting that miR-122 is more wi dely distributed than originally thought and the biological function of miR-122 is not only restricted to hepatocytes. [score:4]
In this study, we detected a substantial miR-122 expression in HSCs and fibroblasts, and revealed an important role of miR-122 in repressing the activation of fibrogenic cells and the development of liver fibrosis. [score:4]
Moreover, knockdown of SRF mimiced the suppressive effects of miR-122 on TGF-β -induced increase of α-SMA and COL1A1. [score:4]
These results suggest that miR-122 downregulation may facilitate TGF-β -induced activation of HSCs. [score:4]
The mechanisms mediate miR-122 downregulation remains unclear. [score:4]
Here, we showed that miR-122 expression was markedly reduced in the TGF-β-activated HSCs. [score:3]
Figure 4(A) Transfection of miR-122 repressed the expression of SRF. [score:3]
Moreover, administration with Lenti-miR-122 obviously reduced the expression of FN1 and SRF protein in the livers of CCl [4] -treated mice (Figure 5E and 5F). [score:3]
LX2 cells were transfected with the inhibitor of miR-122 (anti-miR-122) or its negative control (anti-NC) for 48 hours before immunoblotting. [score:3]
Taken together, miR-122 may repress different etiologies-elicited hepatic fibrosis by suppressing activation of both HSCs and fibroblasts. [score:3]
Serum response factor (SRF) is an identified target for miR-122 in HCC cells [6], and SRF interacts with myocardin-related transcription factor to drive transcription of α-SMA and COL1A1 [2, 13, 14]. [score:3]
We then explored whether reintroduction of miR-122 could inhibit CCl [4] -induced hepatic fibrosis in vivo. [score:3]
However, we could not identify any Smad binding element in the miR-122 promoter region, suggesting that TGF-β may regulate miR-122 expression indirectly and the underlying mechanisms need further investigation in the future. [score:3]
Figure 1(A) The expression of miR-122 is detected in different types of cells. [score:3]
miR-122 expression was analyzed in mouse primary HSCs, human NLFs, SFs and LX2 cells. [score:3]
These findings imply that the remission of liver fibrosis in our mo del may be attributed to the suppressive effects of miR-122 on fibrogenic cells but not the decrease of hepatocyte injury. [score:3]
These data suggest that miR-122 may suppress hepatic fibrogenesis in vivo. [score:3]
Furthermore, a significant downregulation of miR-122 was observed in the fibrotic livers collected from CCl [4] -treated mice, compared to the non-fibrotic livers isolated from vehicle -treated group (Supplementary Figure 6B). [score:3]
Previous studies from us and others have demonstrated the inhibitory function of miR-122 on proliferation, metastasis and angiogenesis of HCC [6- 10]. [score:3]
Furthermore, bioinformatic analysis using the RNAhybrid algorithm predicted a putative miR-122 binding site in the 3′-untranslated region (UTR) of FN1 (Supplementary Figure 4). [score:3]
As shown, miR-122 was substantially expressed in mouse primary HSCs (Figure 1A; Supplementary Figure 1), human primary fibroblasts obtained from normal livers (NLFs) or foreskins (SFs), and an immortalized human HSC cell line, LX2 cells (Figure 1A). [score:3]
We used the following miRNA and small interfering RNA (siRNA) oligonucleotides (Genepharma, Shanghai, China): miR-122 mimics, and siSRF targeting human SRF (901–921 nt, NM_003131.2) transcript. [score:3]
The miR-122 inhibitor (anti-miR-122), which was complementary to the sequence of mature miR-122, and its control (anti-NC) consisted of 2′-O-methyl -modified oligonucleotides (RiboBio, Guangzhou, China). [score:3]
For (A-F), six-week-old Balb/c mice were treated with CCl [4] twice a week for 4 weeks, and control (Lenti-ctrl) or miR-122 -expressing lentiviruses (Lenti-miR-122) were administered intravenously at both the 5 [th] and 7 [th] days after the first CCl [4]-injection. [score:3]
On both the 5 [th] and 7 [th] days after the first CCl [4] injection, mice were administered intravenously with lentiviruses containing empty vector (control, Lenti-ctrl) or miR-122 -expressing cassette (Lenti-miR-122). [score:3]
Figure 2(A-D) Introduction of miR-122 repressed the TGF-β-stimulated expression of α -SMA, COL1A1 and FN1. [score:3]
Herein, we revealed that infection with miR-122 -expressing lentiviruses significantly enhanced miR-122 levels and meanwhile reduced the amount of FN1 and collagen fibrils in the livers of CCl [4] -treated mice. [score:3]
Figure 6 (A) Administration with miR-122 -expressing lentiviruses enhanced miR-122 levels in murine livers. [score:3]
Restoration of miR-122 expression inhibits hepatic fibrogenesis in vivoTo further evaluate the in vivo effect of miR-122 on hepatic fibrogenesis, a hepatic fibrosis mo del was first established by injecting mice with CCl [4] twice a week for 4 weeks. [score:3]
We found that miR-122 attenuated TGF-β-promoted α-SMA expression at both mRNA (Figure 2A and 2B; Supplementary Figure 3A) and protein levels in LX2, NLFs and SFs (Figure 2C and 2D; Supplementary Figure 3D). [score:3]
More importantly, introduction of miR-122 into CCl [4] -treated mice attenuated the expression of FN1 and SRF in fibrotic livers, and alleviate hepatic fibrosis in vivo. [score:3]
Figure 5Reintroduction of miR-122 ameliorates hepatic fibrosis in CCl [4] -treated mice(A) Administration with miR-122 -expressing lentiviruses enhanced miR-122 levels in murine livers. [score:3]
Figure 6 To investigate whether miR-122 regulates TGF-β -induced activation of fibrogenic cells, we first examined its expression level in HSCs and fibroblasts, the major sources of fibrogenic cells in liver tissues. [score:2]
To date, it remains unknown whether miR-122 is deregulated during TGF-β -induced activation of fibrogenic cells and whether miR-122 can abrogate hepatic fibrogenesis. [score:2]
Figure 3(A) Knockdown of endogenous miR-122 enhanced FN1 protein levels. [score:2]
Compared with Lenti-ctrl injection, treatment with Lenti-miR-122 markedly inhibited the formation of collagen fibrils in the livers of CCl [4] -treated mice, as shown by the decrease in Sirius red staining (Figure 5B and 5C). [score:2]
miR-122 is a liver-abundant miRNA and is implicated in different physiological and pathological processes in the liver, including hepatitis C virus replication [4], lipid metabolism [5], and HCC development [6- 10]. [score:2]
To investigate whether miR-122 regulates TGF-β -induced activation of fibrogenic cells, we first examined its expression level in HSCs and fibroblasts, the major sources of fibrogenic cells in liver tissues. [score:2]
For (A, B and D), the level of miR-122 was examined by qPCR and normalized to that of U6. [score:1]
Consistently, TGF-β significantly induced contraction of collagen matrix that contained LX2 cells, and this effect was significantly attenuated when LX2 cells were transfected with miR-122 duplex (Figure 2E). [score:1]
Significantly, the livers with more pronounced elevation of miR-122 displayed more obvious reduction of collagen fibrils (Figure 5D). [score:1]
Most of the previous publications about miR-122 have been dedicated to exploring its biological function in hepatocytes, because miR-122 is present at approximately 50,000 copies per hepatocyte [15]. [score:1]
Schematic overview on the TGF-β-miR-122-FN1/SRF signaling cascade and its implication in hepatic fibrogenesis. [score:1]
Taken together, our results elucidate a novel TGF-β-miR-122-FN1/SRF signaling network and its implication in hepatic fibrogenesis (Figure 6). [score:1]
However, little is known about the role of miR-122 in hepatic fibrosis, the precancerous lesion of HCC. [score:1]
We found that miR-122 level was significantly reduced in both human and mouse fibrotic livers. [score:1]
We further showed that miR-122 -induced remission of fibrosis was not attributed to the decrease of liver injury, because the serum alanine transaminase (ALT) levels were comparable between Lenti-ctrl- and Lenti-miR-122 -treated mice (Supplementary Figure 7). [score:1]
Mouse primary HSCs were cultured for 3 days, then transfected with negative control (NC) or miR-122 duplex for 24 hours, followed by stimulation with 2 ng/ml TGF-β (+) or remained untreated (−) for 48 hours before immunoblotting. [score:1]
Our findings identify a novel TGF-β-miR-122-fibronectin 1/serum response factor signaling cascade and suggest miR-122 as a critical molecule in preventing hepatic fibrogenesis. [score:1]
These results provide in vivo evidences to support the anti-fibrosis role of miR-122. [score:1]
As shown, infection with Lenti-miR-122 significantly enhanced miR-122 level in murine livers (Figure 5A). [score:1]
This study discloses a novel TGF-β-miR-122-FN1/SRF signaling cascade and further identifies the importance of miR-122 in preventing hepatic fibrogenesis and therefore substantially extends our understanding about the function of miR-122 and the molecular mechanisms of hepatic fibrosis. [score:1]
Notably, the level of miR-122 significantly decreased when primary HSCs were activated by TGF-β treatment (Figure 1B). [score:1]
We further investigated how miR-122 attenuated expression of fibrosis-related genes. [score:1]
miR-122 decreases in the TGF-β-stimulated HSCs. [score:1]
LX2 cells (A, C) and NLFs (B, D) were transfected with negative control (NC) or miR-122 duplex for 24 hours, and then stimulated with 2 ng/ml TGF-β (+) or remained untreated (control, -) for 48 hours before qPCR analysis (A, B) or immunoblotting (C, D). [score:1]
miR-122 level was analyzed by qPCR. [score:1]
Reintroduction of miR-122 ameliorates hepatic fibrosis in CCl [4] -treated mice. [score:1]
Consistently, antagonism of miR-122 significantly elevated the level of FN1 protein (Figure 3A). [score:1]
Interestingly, introduction of miR-122 attenuated TGF-β -induced elevation in α-SMA and COL1A1 mRNA levels (Figure 2A and 2B), but did not affect TGF-β-promoted increase of FN1 mRNA (Supplementary Figure 2A and 2B). [score:1]
293T cells were co -transfected with NC or miR-122 duplexes, pRL-TK and a firefly luciferase reporter plasmid carrying either the wild-type (WT) or the mutant (MUT) 3′UTR of FN1. [score:1]
Furthermore, the extent of miR-122 elevation was significantly correlated with that of collagen reduction. [score:1]
[1 to 20 of 89 sentences]
6
[+] score: 275
Other miRNAs from this paper: hsa-mir-122
Our findings demonstrate that miR-122 normally downregulates PEG10 protein expression and this regulation is lost in HCC (Fig.   5), suggesting that the combination of downregulation of miR-122 and upregulation of PEG10 protein can be serve as early biomarkers for identifying an HCC subpopulation that is at high risk for poor outcome. [score:13]
In HCC patient tissue, there was no strong relationship between miR-122 and PEG10 levels in normal and tumor tissue, suggesting that other factors regulate PEG10 expression in HCC patients miR-122 suppressed PEG10 expression at translation level but not the mRNA level in cell lines and mouse mo del via direct binding to the 3′-UTR of PEG10 transcript. [score:11]
In some cases, PEG10 mRNA was downregulated whereas the protein expression was upregulated relative to normal adjacent tissue, which is consistent with miR-122 -mediated translational repression of PEG10; however, there was still no correlation between PEG10 and miR-122 levels in HCC patients. [score:11]
In this study, we identified PEG10 as a potential miR-122 target by an in silico approach and suppresses it’s expression via miR-122 direct binding to the 3′-UTR of the PEG10 transcript. [score:8]
miR-122 downregulated the expression of PEG10 protein through binding to 3′-untranslated region (UTR) of the PEG10 transcript. [score:8]
These results indicate that miR-122 downregulated the PEG10 expression in liver was at the translational but not transcriptional level. [score:8]
These results indicate that miR-122 downregulates the PEG10 expression via direct binding to site 2310 in the 3′-UTR of PEG10. [score:7]
c Overexpression of miR-122 upon HepG2 cells transfection with miR-122S and miR-122AS, as determined by qRT-PCR We further to confirm miR-122 mediates the expression of PEG10 protein in vivo, the total RNA and whole cell lysate were extracted from liver tissue of the and then quantified the relative expression of PEG10 mRNA and protein by qRT-PCR and western blotting, respectively. [score:7]
miR-122 is downregulated while PEG10 is upregulated in HCC patients. [score:7]
miR-122 has many mRNA targets, including cyclin G1, Bcl2- like protein 2, CCAAT- displacement protein, and paternally expressed gene 10 (PEG10), all of which are overexpressed in HCC patients [12]. [score:7]
c Overexpression of miR-122 upon HepG2 cells transfection with miR-122S and miR-122AS, as determined by qRT-PCRWe further to confirm miR-122 mediates the expression of PEG10 protein in vivo, the total RNA and whole cell lysate were extracted from liver tissue of the and then quantified the relative expression of PEG10 mRNA and protein by qRT-PCR and western blotting, respectively. [score:7]
miR-122 downregulates PEG10 protein expression. [score:6]
A qRT-PCR analysis of 12 HCC tumors reveal that miR-122 expression levels were downregulated relative to adjacent non-cancerous tissue (Fig.   4a). [score:6]
miR-122 suppresses PEG10 expression via direct binding to the 3′-UTR of the PEG10 transcript. [score:6]
Previous studies shown that PEG10 highly expressed in hepatoma cell lines and miR-122 downregulated in HCC tissue [4, 7, 39, 40]. [score:6]
miR-122 expression was found to be downregulated in HCC tissue, suggesting that miR-122 is associated with hepatocarcinogenesis and can serve as a biomarker for liver cancer [8– 15]. [score:6]
The miR-122 positive control targeting sequence, 5′-CTA GCA CAA ACA CCA TTG TCA CAC TCC AGA ATT CAC AAA CAC CAT TGT CAC ACT CCA C-3′, was also cloned into NheI/ XhoI sites downstream of the luciferase gene in the pmiR-GLO plasmid to obtain pmiR-GLO-miR122 PTS (positive targeted sequence). [score:5]
We also showed with a luciferase reporter assay that miR-122 directly bound to the 3′-UTR of the PEG10 transcript (2006–2872 bp) and further suppress the translation of PEG10. [score:5]
Fig.  2PEG10 is upregulated by miR-122 deficiency in miR-122 knockout (KO) mice. [score:5]
In our study, we did not observe significant correlation between the downregulation of miR-122 and relative change of endogenous PEG10 protein levels in HCC (Fig.   4b); only 8 of 12 (67 %) HCC patients had higher PEG10 protein expression in tumor as compared to normal adjacent tissue (Fig.   4b). [score:5]
Several studies have found an association between downregulation of miR-122, a liver-specific miRNA, and upregulation of paternally expressed gene 10 (PEG10) in HCC; however, the correlation between low miR-122 and high PEG10 levels still remains to be defined and require more investigations to evaluate their performance as an effective prognostic biomarker for HCC. [score:5]
Liver-specific transcription factors regulate miR-122, which in turn targets cut-like homeobox 1 during liver development [35]. [score:5]
In cell cultures, binding of miR-122 to sites 2310 and 2403 in the 3′-UTR of the PEG10 transcript suppressed PEG10 protein expression. [score:5]
In contrast, the protein level of PEG10 was upregulated in miR-122 knockout as compared to wild-type mice (Fig.   2c). [score:4]
miR-122 is specifically expressed in the liver, where it accounts for 70 % of the total miRNA population [4, 5] and regulates lipid metabolism to maintain normal liver function [6, 7]. [score:4]
Further studies are needed in order to determine whether other factors besides miR-122 regulate PEG10 expression in HCC. [score:4]
These suggesting that factors other than miR-122 are also involved in regulation of PEG10 expression in HCC. [score:4]
Indeed, mice with targeted deletion of the miR-122 gene exhibited a variety of phenotypes associated with human liver disease, providing a useful mo del for investigating the effects of miR-122 dysregulation in HCC patients [7]. [score:4]
An in silico approach was used to isolate PEG10, a potential miR-122 target implicated in HCC development. [score:4]
In order to clarify the regulatory interaction between miR-122 and PEG10, the expression levels of these two factors were examined in normal and tumor tissue from HCC patients. [score:4]
Fig.  5 Regulation of PEG10 expression by miR-122 in different mo del systems. [score:4]
We found that miR-122 was expressed at low levels in normal tissue adjacent to tumors in all patient samples, while PEG10 levels varied between specimens. [score:3]
These findings imply that expression of miR-122 and PEG10 is inversely related in HCC. [score:3]
In this study, we performed a luciferase reporter assay to determine whether PEG10 expression is directly mediated by miR-122. [score:3]
To investigate the relationship between miR-122 and PEG10, pre-miR-122 was overexpressed in 293T and HepG2 cells and determined the mRNA and protein expression levels of PEG10 by qRT-PCR and western blotting, respectively. [score:3]
The mRNA level of PEG10 was unaltered upon miR-122 or miR-122AS overexpression in 293T cells (Fig.   1a). [score:3]
The forward 47-bp fragments included a 29-bp upstream flanking sequence, 7- or 8-bp miR-122 seed, and an 11-bp downstream flanking sequence in the 3′-UTR of putative miR-122 targeted genes (Fig.   3c). [score:3]
The 293T and HepG2 cells were transfected with the specified concentration of miR-122 (pSM-miR-122S) or anti-sense miR-122 (pSM-miR-122AS), then cultured for 72 h, with PEG10 expression analyzed by western blotting. [score:3]
a miR-122 expression levels in HCC. [score:3]
Briefly, 293T cells were co -transfected with miR-122 (pSM-miR-122S), antisense miR-122 (pSM-miR-122AS), or target reporter plasmid. [score:3]
a PEG10 mRNA expression levels were determined by qRT-PCR in the liver of wild-type (WT) and miR-122 KO mice and normalized to that of GAPDH. [score:3]
These results suggest that miR-122 has a tumor suppressor function in hepatocarcinogenesis. [score:3]
Sense (pSM-miR-122S) and antisense (pSM-miR-122AS) miR-122 expression vectors were provided by Dr. [score:3]
The protein level of PEG10 was only significantly decreased when miR-122 overexpressed but not miR-122AS in both 293T and HepG2 cells (Fig.   1b, c). [score:3]
miR-122 is downregulated in human HCC and has been considered as part of the miRNA signature for HCC. [score:3]
d Identification of the miR-122 target sequence in the 3′-UTR of PEG10 transcript. [score:3]
b miR-122 expression in the liver of WT and miR-122 KO, as determined by qRT-PCR. [score:3]
b Identification of the miR-122 target region in the 3′-UTR of PEG10 transcript. [score:3]
Figure  2a shows that there is no obvious correlation in mRNA expression level of PEG10 between miR-122 -deficient and wild-type mice. [score:3]
This decrease was abrogated by introducing a 6-bp mutation in the miR-122 binding site. [score:2]
The results of our study demonstrated a negative regulatory relationship between miR-122 and PEG10 in two different cell lines. [score:2]
Direct interaction of miR-122 with 3′-UTR of PEG10. [score:2]
miR-122 knockout mice. [score:2]
The oligonucleotides containing the putative miR-122 binding site(s) were designed and subcloned by ligating annealed oligonucleotides into the NheI/ XhoI-digested pmiR-GLO vector in the forward direction (Fig.   3c); the resultant constructs pmiR-GLO-PEG10 TS, pmiR-GLO-PEG10 MTS, and pmiR-GLO 122 PST were transiently transfected into 293T cells. [score:2]
Fig.  1PEG10 is regulated by miR-122 at the post-transcriptional level in 293T and HepG2 cells. [score:2]
Recent studies suggest a role for PEG10 in HCC progression [19, 25– 27]; thus, overexpression of PEG10 is considered as a potential biomarker for HCC [28, 29], although the relationship between miR-122 and PEG10 remains not well understood. [score:2]
293T cells were co -transfected with either miR-122S or empty vector along with pmiR-GLO-PEG10-3′-UTR TS, pmiR-GLO-PEG10-3′-UTR MTS, or pmiR-GLO-miR122 PTS constructs To clarify the interaction between miR-122 and PEG10 3′-UTR, sequences corresponding to miR-122 seed binding sites (Fig.   3c) were constructed [35]. [score:1]
The analysis results indicate that there are nine putative miR-122 binding sites located in the 3′-UTR of PEG10 transcript, i. e., 64, 102, 564, 934, 1310, 1735, 2310, 2403 and 3420 (Fig.   3a). [score:1]
293T cells were co -transfected with either miR-122S or empty vector along with pmiR-GLO-PEG10-3′-UTR TS, pmiR-GLO-PEG10-3′-UTR MTS, or pmiR-GLO-miR122 PTS constructsTo clarify the interaction between miR-122 and PEG10 3′-UTR, sequences corresponding to miR-122 seed binding sites (Fig.   3c) were constructed [35]. [score:1]
Chimeric mice were produced by crossing with wild-type C57BL/6 mice for germline transmission of the miR-122 allele. [score:1]
Total RNA was extracted from 12 paired cancerous and adjacent normal tissues from HCC patients and miR-122 level was quantified by qRT-PCR. [score:1]
An expanded view of the seed region of miR-122 in the PEG10-3′-UTR is shown. [score:1]
The effect of miR-122 on PEG10 mRNA levels was examined by quantifying the mRNA levels of PEG10 as well as miR-122S and miR-122AS in cells transiently transfected with pSM-miR-122S or pSM-miR-122AS constructs (Fig.   1). [score:1]
293T cells were co -transfected with miR-122S and the negative control (Vector) along with pmiR-GLO-PEG10-3′-UTR F1, pmiR-GLO-PEG10-3′-UTR F2, pmiR-GLO-PEG10-3′-UTR F3, pmiR-GLO-PEG10-3′-UTR F4, pmiR-GLO-PEG10-3′-UTR F5, or pmiR-GLO-miR122 PTS; luciferase activity was determined at 48 h post-transfection. [score:1]
However, it is still not clear how miR-122 contributes to liver tumor progression. [score:1]
These results are consistent with the study which transient transfected pre-miR122 into HepG2 cells caused a decrease in PEG10 protein level without altering the mRNA level [38]. [score:1]
c Schematic illustration of putative miR-122 binding site in the 3′-UTR of PEG10 transcript. [score:1]
Homozygous miR-122 [−/−] mice were obtained by crossing heterozygous offspring [7]. [score:1]
Nine putative miR-122 binding sites were identified by bioinformatic analysis (top) at positions 64, 102, 564, 934, 1310, 1735, 2310, 2403 and 3420. [score:1]
In mice, PEG10 protein level was increased by miR-122 deficiency. [score:1]
miR122 PEG10 HCC Hepatocellular carcinoma (HCC) is the fifth most common cancer around the world and is the cause of nearly 745,000 deaths worldwide each year [1]. [score:1]
In and HCC patients, the deficiency of miR-122 was associated with HCC progression. [score:1]
[1 to 20 of 72 sentences]
7
[+] score: 261
Combined regulation of the E1A gene by the CgA promoter and miR122 target sequences, acts together and can efficiently repress E1A protein expression in cells expressing miR122. [score:8]
When miR122 -positive HuH7.5 was transduced with Ad[CgA-E1A] weak E1A expression was observed while E1A expression was completely abolished after transduction with the miR122-detargeted viruses (Figure 3B). [score:7]
The CgA promoter strongly supports E1A protein expression, with efficiency comparable to the wild-type E1A promoter of Ad5 wt, in neuroendocrine tumor cells and expression was not altered by incorporation of miR122 target sequences in the viral genome (Figure 3C). [score:7]
Transduction of normal hepatocytes with Ad[CgA-E1A] resulted in far lower E1A protein expression than wild-type Ad5 (Ad5 wt) and E1A expression was completely suppressed after transduction with Ad[CgA-E1A-miR122] and Ad[CgA-E1A-miR122×2] at MOI 1 (Figure 3A), indicating very efficient silencing. [score:7]
On the other hand, transduction with the double -targeted Ad[CgA-E1A-miR122] virus yielded 100-fold and 70-fold less genome copies than Ad5 wt and Ad[E1Ap-E1A], respectively, indicating an additive effect of combining promoter targeting with miRT detargeting. [score:7]
We next constructed two miR122 -targeted oncolytic adenoviruses, Ad[CgA-E1A-miR122] and Ad[CgA-E1A-miR122×2], where E1A gene expression is driven by the CgA promoter and further controlled by six or twelve tandem repeats of miR122 target sequence in the 3′UTR of E1A (Figure 1). [score:7]
In this study, we present further modification of Ad[CgA-E1A], by introducing miRT sequences for the liver-specific miR122 in the 3′UTR of E1A to down-regulate E1A expression and thereby viral replication in hepatocytes. [score:6]
Both publications use the wildtype E1A promoter to control E1A and demonstrated that incorporation of miR122 target sequences in the 3′UTR of E1A gene reduces E1A expression in hepatic cells. [score:5]
The miR122 expression level was approximately 7-fold higher in human hepatocytes than in HuH7.5, while miR122 was not expressed in the hepatoma cell line HepG2 or in the non-hepatic neuroendocrine tumor cells lines BON (pancreatic carcinoid), SH-SY-5Y, SK-N-BE(2), Kelly (all neuroblastomas) or in primary carcinoid cells (Supporting Figure S1). [score:5]
Transfection with siRNA that mimics miR122 reduced luciferase expression in HepG2 to below 10% while a negative control siRNA only reduced the expression to 75%, giving further evidence of miR122-specific silencing (Supporting Figure S3). [score:5]
Suppression of luciferase activity was as expected not observed in the neuroendocrine tumor cell lines BON, SH-SY-5Y, SK-N-BE(2), Kelly (Figure 2A) while addition of siRNA mimicking miR122 silenced transgene expression (Supporting Figure S3). [score:5]
miR122 is specifically expressed in hepatocytes and it is the most abundant miRNA molecule expressed in the adult liver where it makes up 70% of all miRNAs [15]. [score:5]
E1A protein expression was not suppressed in miR122 -negative HepG2 (Figure 3B). [score:5]
We observed E1A suppression and replication arrest of the miR122-detargeted adenovirus in normal hepatocytes, while the two viruses killed carcinoid cells to the same degree. [score:5]
We sequenced two clones with the insert in the correct orientation, one with six miR122 target sequences: pShuttle(i/CgA-E1A-miR122) and one with 12 tandem repeats of the miR122 target sequence: pShuttle(i/CgA-E1A-miR122×2). [score:5]
Reduced E1A Protein Expression and Arrest of Viral Replication Occurs Only in miR122-Expressing Hepatic Cells. [score:5]
Our data show that while introduction of a miR122 target sequence in the 3′UTR of the E1A gene leads to reduced killing of hepatic cells, it does not affect the desired killing of miR122 -negative target cells. [score:5]
miR122 -mediated suppression of adenoviral protein expression in hepatic cells. [score:5]
In order to further restrict adenoviral replication in hepatocytes we set out to regulate E1A gene expression by the liver-specific miR122. [score:4]
Furthermore, the miR122 target sequence was excised from the pGA4 plasmid and cloned into the unique XbaI site directly downstream of the luciferase stop codon in pShuttle vectors. [score:4]
Furthermore, a miR122-detargeted adenovirus with the wild-type E1A promoter showed reduced replication in hepatic cells compared to wild-type Ad5 but not to the same extent as the miR122-detargeted adenovirus with the neuroendocrine-selective CgA promoter. [score:4]
Ad[CgA-E1A-miR122], where E1A expression is further controlled by six tandem repeats of the target sequence for the liver-specific miR122, was constructed and compared to Ad[CgA-E1A]. [score:4]
We constructed two serotype 5 adenoviral vectors with CgA promoter-controlled luciferase expression with or without miR122 target sequences in the 3′UTR of luciferase as presented in Figure 1. Transduction of freshly isolated hepatocytes with Ad[CgA-Luc-miR122] demonstrated more than 99% reduction of luciferase activity, compared to Ad[CgA-Luc] while no reduction was observed in freshly isolated carcinoid cells (Figure 2A). [score:4]
The pShuttle(i/PPT-Luc) plasmid [19] was digested with XbaI (unique site directly downstream of the luciferase stop codon), made blunt end by Klenow fragment, followed by insertion of the HpaI/SmaI-excised miR122 target sequences (six copies) to construct pShuttle(i/PPT-Luc-miR122). [score:4]
Luciferase expression was reduced by approximately 80% in the miR122 -positive hepatoma cell line HuH7.5, while no reduction was observed in the miR122 -negative hepatoma cell line HepG2 (Figure 2A), which strongly indicates miR122-specific silencing. [score:3]
Two recent publications have described miR122-detargeting of the human serotype 5 adenovirus (Ad5) to reduce adenovirus -induced liver toxicity [9], [10]. [score:3]
Liver-Specific Expression of miR122. [score:3]
In conclusion, the double -targeted Ad[CgA-E1A-miR122] virus has potential for the treatment of neuroendocrine tumors that metastasize to the liver. [score:3]
miRNA are know to be evolutionary conserved across species and H. sapiens and M. musculus miR122 precursors are clustering in the same clade, which implicates recognition of similar target sequences. [score:3]
The miR122 target sequence was excised from the pGA4 plasmid with HpaI and SmaI and blunt-end cloned into the unique HpaI site in the 3′UTR region of E1A of pShuttle(i/CgA-E1A), located approximately 30 bp downstream of the E1A stop codon and 40 bp upstream of the E1A polyadenylation signal. [score:3]
0008916.g001 Figure 1 Ad[CgA-Luc] and Ad[CgA-Luc-miR122] are E1- deleted Ad5 -based vectors with luciferase gene expression controlled by the human CgA promoter. [score:3]
A synthetic dsDNA sequence containing six tandem repeats, complementary to the mature hsa-miR-122 target sequences (http://microrna. [score:3]
Ad[CgA-Luc] and Ad[CgA-Luc-miR122] are E1- deleted Ad5 -based vectors with luciferase gene expression controlled by the human CgA promoter. [score:3]
In BON cells Ad[E1Ap-E1A], Ad[E1Ap-E1A-miR122], Ad[CgA-E1A] and Ad[CgA-E1A-miR122] yielded similar levels of genome copies (Figure 6B), showing that introduction of miR122 target sequence in the viral genomes does not affect virus replication in miR122 negative cells. [score:3]
Six and twelve repeats of the miR122 target sequence were inserted in the 3′UTR of the E1A gene in Ad[CgA-E1A-miR122] and Ad[CgA-E1A-miR122x2], respectively. [score:3]
Ad[CgA-Luc-miR122] has six repeats of the miR122 target sequence in the 3′UTR of the luciferase gene. [score:3]
High and specific miR122 expression was confirmed in normal human liver, Balb/c mice liver and in the hepatoma cell line HuH7.5 (Supporting Figure S1). [score:3]
0008916.g002 Figure 2Specific silencing of luciferase expression in liver cells by miR122 in vitro and in vivo. [score:3]
miR122-Detargeting of Adenovirus Leads to Reduced Liver Toxicity. [score:3]
A Recombinant Adenoviral Vector with miR122 Target Sequences Shows Markedly Reduced Activity in Human Hepatocytes In Vitro and Mouse Liver In Vivo. [score:3]
Cawood et al also kept the wild-type E1A promoter and used four miR122 target sequences in the 3′UTR of E1A to reduce Ad5 activity in hepatic cells [9]. [score:3]
There was no difference between the two miRT -modified viruses in terms of replication in hepatocytes, indicating that six copies of miR122 target sequences are sufficient to completely attenuate genes controlled by the CgA promoter. [score:3]
Replication arrest and reduced cytolytic activity in hepatic cells for adenoviruses carrying miR122 target sites. [score:3]
Specific silencing of luciferase expression in liver cells by miR122 in vitro and in vivo. [score:3]
As expected, miR122 -mediated inhibition of replication was not observed for any of the viruses in HepG2 (Figure 4A). [score:3]
Figure S1Analysis of endogenous miR122 expression. [score:3]
Importantly, in carcinoid cells and in BON, the CgA promoter -driven oncolytic viruses, either with or without miR122 target sequences, replicate equally well and follow the pattern of Ad5 wt replication (Figure 4A). [score:3]
In a recent paper Ylosmaki et al, incorporated miR122 target sequences in the 3′UTR of E1A of an Ad5 virus, which retained the wild-type E1A promoter [10]. [score:3]
Analysis of Endogenous miR122 Expression. [score:3]
Furthermore, we made side-by-side comparisons of three miR122-detargeted viruses; one with the wild-type E1A promoter, one with the neuroendocrine cell-selective CgA promoter and one with the prostate cell-specific iPPT promoter. [score:3]
Figure S2 miR122-specific silencing of luciferase expression. [score:3]
The single targeted Ad[E1Ap-E1A-miR122] and Ad[CgA-E1A] viruses yielded approximately 7-fold and 5-fold less genome copies than Ad5 wt and Ad[E1Ap-E1A], respectively in HuH7.5 (Figure 6A). [score:3]
Our data suggests that in order to reduce virus replication in hepatic cells, miR122-detargeting alone is effective but not efficient enough to completely attenuate virus replication. [score:3]
Moreover, our miR122 -targeted oncolytic adenoviruses fully retain replication capacity and killing ability in neuroendocrine tumor cells. [score:3]
The miR122 expression levels were normalized against the U6 snRNA transcript levels. [score:3]
However, complete replication arrest can be obtained as demonstrated by our double -targeted Ad[CgA-E1A-miR122] virus in HuH7.5 and also in normal human hepatocytes. [score:3]
They did not report whether insertion of miR122 target sequences was enough to attenuate virus replication in HuH7. [score:3]
Based on our results and those studies, we designed a target sequence with six tandem repeats with perfect complementarity to the mature strand of the miR122 duplex. [score:3]
We therefore compared the silencing effect of Ad[CgA-E1A-miR122] with two other miR122-detargeted adenoviruses, one where E1A is controlled by the wild-type E1A promoter Ad[E1Ap-E1A-miR122] and one where it is controlled by the prostate cell-specific iPPT promoter, Ad[iPPT-E1A-miR122]. [score:2]
Cawood et al reported reduced liver toxicity in mice after one intravenous injection of 5×10 [10]vp for their miR122-detargeted virus compared to wild-type Ad5 [9]. [score:2]
The potency of miR122-silencing was next examined in vivo. [score:1]
cDNA (diluted 1∶100) was used for QRT-PCR together with the miR122. [score:1]
We next verified that Ad[CgA-E1A-miR122] and Ad[CgA-E1A-miR122×2] lyse BON cells to a similar degree as Ad[CgA-E1A]. [score:1]
Repeated intravenous injections of Ad[CgA-E1A] induced liver toxicity in mice while Ad[CgA-E1A-miR122] injections did not. [score:1]
Viruses (5×10 [10] vp) were injected intravenously (tail vein) on day 1, 4 and 7 and blood was drawn and analyzed on day 9. We found that mice injected with Ad[CgA-E1A] had significantly elevated serum levels of ALT, which is indicative of liver toxicity, while no mice injected with Ad[CgA-E1A-miR122] had elevated ALT levels (Figure 5). [score:1]
Lack of hepatotoxicity in mice injected with Ad[CgA-E1A-miR122]. [score:1]
Cells were transduced in suspension with Ad[CgA-Luc] and Ad[CgA-Luc-miR122] at a multiplicity of infection (MOI) of 10 FFU/cell. [score:1]
Ad[CgA-E1A] had weak activity and could kill HuH7.5 cells to a certain degree (cell viability of 65%) when transduced at MOI 1, while Ad[CgA-E1A-miR122] and Ad[CgA-E1A-miR122×2] had no effects (Figure 4B). [score:1]
Plasmids with full length E1B- deleted adenovirus genomes: Ad[CgA-Luc], Ad[CgA-Luc-miR122], Ad[CgA-E1A], Ad[CgA-E1A-miR122], Ad[CgA-E1A-miR122x2], Ad[E1Ap-E1A], Ad[E1Ap-E1A-miR122] and Ad[iPPT-E1A-miR122] were obtained through homologous recombination in BJ5183 between pAdEasy(E3) [19] and described pShuttle plasmids. [score:1]
For liver toxicology studies, female Balb/c mice were injected in the tail vein on days 1, 4 and 7 with 5×10 [10]vp of Ad[CgA-E1A] or Ad[CgA-E1A-miR122]. [score:1]
Our data demonstrate partial attenuation of replication for Ad[E1Ap-E1A-miR122] (wild-type Ad5 E1A promoter) in HuH7.5, especially at MOI 10. [score:1]
Replication of Ad[CgA-E1A-miR122] and Ad[CgA-E1A-miR122×2] was completely attenuated in HuH7.5 without production of progeny viral DNA, in contrast to Ad[CgA-E1A] and Ad5 wt, which have replication indexes of 330 and 7200, respectively, after 3 days (Figure 4A). [score:1]
Transduction of HuH7.5 with Ad[CgA-E1A-miR122] at MOI 1 did not reduce cell viability, while Ad5 wt, Ad[E1Ap-E1A], Ad[E1Ap-E1AmiR122] and Ad[CgA-E1A] transduction results in killing of 95%, 85%, 80% and 45% of the cells, respectively (Figure 7A). [score:1]
pShuttle(E1Ap-E1A) and pShuttle(E1Ap-E1A-miR122) were created by replacing the iCgA promoter with the E1A promoter using KpnI and HindIII. [score:1]
In addition, cells were co -transfected with 10 nM of mimic siRNA (acting as hsa-miR-122) or negative control siRNA (non-related). [score:1]
We had to inject 5×10 [10]vp of Ad[CgA-E1A] at three occasions before we started to see elevated ALT levels and with the Ad[CgA-E1A-miR122] virus we did not see elevated ALT levels even after three injections. [score:1]
Transduction of HuH7.5 and BON with the prostate cell-specific Ad[iPPT-E1A] and Ad[iPPT-E1A-miR122] viruses did not result in significant numbers of genome copies after two days, indicating strongly abolished replication capacity of these viruses in hepatic cells (Figure 6A and 6B). [score:1]
Cells were transduced with Ad[CgA-Luc] and Ad[CgA-Luc-miR122] at MOI 10 and plated in 12-well plates. [score:1]
Some cells were subsequently transfected with 10 nM of chemically synthesized siRNA that acts as hsa-mir-122 (miRIDIAN Mimic, Thermo Scientific Dharmacon, Chicago, IL) or non-related siRNA (miRIDIAN Negative Control) using INTERFERin (Polyplus Transfection, New York, NY) according to the manufacturer's protocol. [score:1]
Ad[CgA-E1A-miR122] and Ad[iPPT-E1A-miR122] start to yield reduced cell viability at MOI 10 and 100, respectively, indicating that at those MOIs the viral E1A mRNA molecules may outnumber cellular miR122 molecules in HuH7.5. [score:1]
They managed to improve miR122-responsivness of their recombinant adenovirus by modifying the 5′UTR of the E1A gene. [score:1]
Female Balb/c mice, 6–8 weeks of age (B&K Universal, Sollentuna, Sweden), were injected intravenously (tail vein) with 5×10 [10]vp of Ad[CMV-Luc], Ad[CgA-Luc] or Ad[CgA-Luc-miR122] in 200 μl of buffer (10 mM Tris-HCL (pH 8.0), 2 mM MgCl [2] and 4% sucrose). [score:1]
Transduction of BON cells at an MOI of 1 results in at least 75% cell killing, for all oncolytic viruses except Ad[iPPT-E1A] and Ad[iPPT-E1A-miR122] (Figure 7B). [score:1]
The PPT promoter was replaced with the CgA promoter both in pShuttle(i/PPT-Luc) and pShuttle(i/PPT-Luc-miR122) using NotI and HindIII to construct pShuttle(i/CgA-Luc) and pShuttle(i/CgA-Luc-miR122). [score:1]
Luciferase activity was observed in all mice injected with Ad[CMV-Luc] and Ad[CgA-Luc] (Figure 2B and C) already after 6 hours, while no luciferase activity was detected in any of the mice injected with Ad[CgA-Luc-miR122], despite long (10 minutes) exposure times (Figure 2D). [score:1]
Freshly isolated primary cells and cell lines were transduced with Ad[CgA-Luc] and Ad[CgA-Luc-miR122] at MOI 10 and plated in 12-well plates. [score:1]
Mice were injected intravenously (tail vein) with a single dose of 5×10 [10] vp of the following vectors: Ad[CMV-Luc], Ad[CgA-Luc] and Ad[CgA-Luc-miR122]. [score:1]
[1 to 20 of 87 sentences]
8
[+] score: 253
miR-122 expression value>0.39 was designed as the high expression group, while miR-122 expression value<-0.58 was designed as the low expression group. [score:9]
To further investigate whether miR-122 targets TGFβ1 in humans, but TGFβR1 in mice, we analysed four more liver cell lines When two human liver cell lines, SMMC-7721 and LM9, were transfected with the miR-122 overexpression plasmid, both transcriptional and translational expression levels of TGFβ1 were decrease by over 50% and the levels of TGFβR1 remains unchanged. [score:7]
When miR-122 was overexpressed in NIT-1 cells, which is a pancreatic β-cell line established from a transgenic non-obesity diabetes (NOD/Lt) mouse, the expression level of TGFβR1 was decreased by 40% and the expression level of TGFβ1 was unchanged. [score:7]
It is highly possible that the imbalance of TGFβ1 due to the dysregulation of miR-122 makes a direct contribution to the development of these diseases. [score:6]
In addition to cancer, the downregulation of miR-122 has been reported in many types of liver disease 35. [score:6]
Thus, miR-122 directly targets a noncanonical site in TGFβ1 5′UTR in humans, but it targets TGFβR1 in mice. [score:6]
Consistent with this, when Huh7 cells were treated with the miR-122 sponge expression construct, there was a twofold increase in TGFβ1 expression (Fig. 1a; Supplementary Fig. 1c). [score:5]
The overexpression of miR-122 in these two cell types resulted in a decrease of the TGFβ1 level by 80% and 70%, respectively, and no change in the expression level of TGFβR1 (Fig. 1c). [score:5]
Similarly, the ratio of the p-Smad2 to Smad2 level was inhibited when miR-122 was overexpressed in NIT-1 cells, and the decreased ratio was reversed by TGFβR1 (Fig. 1g). [score:5]
HepG2 cells were transfected with the miR-122 overexpression plasmid (transient expression). [score:5]
These tissue miRNAs are highly expressed, such as miR-122 outnumbering any single mRNA target by as much as 500-fold 50. [score:5]
Furthermore, in the most recent common ancestor of humans and the chimpanzee, a second mutation (A–>G, blue in Fig. 3e) occurred, and this mutation further destroyed the binding affinity of miR-122 and the target sites. [score:5]
Quantification of the expression levels of miR-122, TGFβ1 and TGFβR1 in these tissue samples revealed an eightfold decrease in miR-122 expression and an eightfold increase in the TGFβR1 level in tumour samples (Fig. 6a,b). [score:5]
In this study, we demonstrate that miR-122 targets different components in the TGFβ pathway, namely, TGFβ1 in humans and TGFβR1 in mice, thus providing the first evidence for species -dependent miRNA targeting within a pathway. [score:5]
Mice were subcutaneously implanted with HepG2 cells stably expressing NC, miR-122 or both miR-122 and TGFβ1 (122-TGFβ1), or with Hepa1-6 cells stably expressing NC or miR-122 sponge (122sp) in each group. [score:5]
The selection was carried out for 3–5 weeks, and the stable cell lines of HepG2 were referred to as HepG2-NC, HepG2-122 (overexpressing miR-122) and HepG2-122-TGF (overexpressing miR-122 as well as TGF-β1), respectively. [score:5]
Consistent with the results of our cell studies, the expression of TGFβR1 was not associated with overall survival (Supplementary Fig. 6b, representative data of miR-122, TGF-β1 and TGF-βR1 expression shown in Supplementary Fig. 6c–e). [score:5]
This mutation abolishes a pairing between miR-122 and the target site. [score:4]
However, western blot assay demonstrated that miR-122 inhibits the expression level of TGFβR1 in rat or pig cell lines(Fig. 3c). [score:4]
Subsequent mutation experiments, in which three nucleotides most affecting the stability of the predicted RNA secondary structure was mutated one by one, identified the exact targeting sequence, which may pair to the 3′ region of miR-122, rather than to its seed sequence (Fig. 2g). [score:4]
The ago protein immunoprecipitation (AGO-IP) assay showed that the miR-122 expression level increased 60-fold, while the expression of TGFβ1 decreased to 54% (Fig. 1a; Supplementary Fig. 1b) 23. [score:4]
On the other hand, in the most recent ancestor of mouse and rat, a G–> A mutation (green in Fig. 3e) created a pairing site for miR-122, which in principle enhances the binding specificity of miR-122 and the target site. [score:4]
miR-122 inhibits TGFβ1 in human cells, but TGFβR1 in mouse cells. [score:3]
A conserved mechanism of miR-122 switching targets. [score:3]
Evolutionary analysis of miR-122 targeting TGFβ1/TGFβR1 in vertebrates. [score:3]
miR-122 targets human TGFβ1 5′UTR in a non-‘seed-region' base-pairing manner. [score:3]
Similarly, the overexpression of miR-122 in HepG2 or SMMC-7721 resulted in the increase of E-cadherin as well as the decrease of vimentin, regardless of treating Huh7 or MCF cells (Fig. 4c–e). [score:3]
We then switched our attention to coding sequences (CDS), in which a group of candidate miR-122 target sites were identified (Supplementary Table 2). [score:3]
miR-122 targets TGFβ1 5′UTR in humans. [score:3]
However, the silencing of miR-122 in Hepa1-6 cells resulted in no change of TGFβ1, but a twofold increase in TGFβ receptor 1 (TGFβR1) expression (Fig. 1a; Supplementary Fig. 1d). [score:3]
miR-122 inhibits TGFβ1 in humans but TGFβR1 in mice. [score:3]
miR-122 was overexpressed in HepG2 cells to generate a stable cell line, which is referred to as HepG2-122. [score:3]
Supplementary Figures 1-18, Supplementary Tables 1-7 Supplementary Figures 1-18, Supplementary Tables 1-7 (a) Western blot analysis of TGFβ1 and TGFβR1 in HepG2, Huh7 or Hepa1-6 cells when treated with an miR-122 expression plasmid (122), miR-122 sponge (122sp) or scramble sequence as an negative control (NC), respectively. [score:3]
Within these cohorts, a low expression of miR-122 was associated with poor survival (Fig. 6d). [score:3]
miR-122 significantly silenced the reporter containing the rhesus monkey TGFβ1 5′UTR, which contained a target sequence exactly the same as that found in humans (Fig. 3b; Supplementary Table 1). [score:3]
First, we experimentally determined whether miR-122 targets TGFβ1/TGFβR1 in the rhesus monkey, pig or rat. [score:3]
Together, these data demonstrate that miR-122 inhibits TGFβ1 in humans, but TGFβR1 in mice. [score:3]
How to cite this article: Yin, S. et al. Differential TGFβ pathway targeting by miR-122 in humans and mice affects liver cancer metastasis. [score:3]
Second, we examined the respective expression levels of miRNA-122, TGFβ1 and TGFβR1 in human and mouse hepatocellular carcinoma samples. [score:3]
miR-122 significantly inhibited the reporter containing the TGFβ1 5′UTR of the manetee, in which 1C is changed into 1T (Fig. 2g). [score:3]
Surprisingly, no miR-122 target site was identified in either the TGFβ1 or TGFβR1 UTRs in pigs or rats (Fig. 3a; Supplementary Fig. 3a–c). [score:3]
Differential targeting of TGFβ1/TGFβR1 is the underlying reason for the distinct impact of miR-122 on EMT in human or mouse cells. [score:3]
The reporter containing the 3′UTR of mouse TGFβR1 was decreased to 60% by miR-122 treatment, whereas the reporter containing the 3′UTR of human TGFβ1 or TGFβR1 was unchanged, indicating that there is no target site in their 3′UTRs (Fig. 2b,c). [score:3]
The conversion of 21C to 21T, accompanied by the insertion of either one or a small number of bases between the 11th and 12th bases, resulted in a total loss of the inhibition by miR-122, such as those found in the mouse, rat, dog and pig (Fig. 3b; Supplementary Fig. 3b,d). [score:3]
Consistent with the data in Hepa1-6 cells, the overexpression of miR-122 in two mouse liver cell lines, H22 and NCTC1469, resulted in the decrease of TGFβR1 in both protein and mRNA levels, but no change of TGFβ1 (Supplementary Fig. 1e,f). [score:3]
Since the sequence of miR-122 is identical in vertebrates, we performed an analysis of the degree of conservation of miR-122 target sites in TGFβ1/TGFβR1 in different species. [score:3]
HepG2 has a low level of miR-122 expression, whereas both Huh7 and Hepa1-6 have a high level (Supplementary Fig. 1a). [score:3]
Quantitative analysis of miR-122 expression showed that it decreased ∼40% in the cancer samples (Supplementary Fig. 6f). [score:3]
In case of targeting CAT-1, miR-122 was used as a positive control while let-7a as a negative control 34. [score:3]
That is, HepG2 or SMMC-7721 cells were treated with TGFβ1 antibody, miR-122 overexpression or both, and then their supernatants were treated to Huh7 or MCF cells, respectively. [score:3]
The overexpression of TGFβ1 in HepG2-122 reversed the effect of miR-122 on both local invasion and distant metastasis. [score:3]
The gain of the miR-122 target site occurs in the common ancestor of the manatee and humans as well as other primates (black arrow), while the loss of this site in the pig, dog, rat or mouse due to the insertion of a few of bases between the 11th and 12th bases (red arrow). [score:3]
proved that a miR-122 target site exists in the TGFβR1 CDSs of pigs or rats, but not humans or monkeys. [score:3]
We found that miR-122 expressing tumours were well encapsulated and non-invasive (Fig. 5c). [score:3]
By comparative genomic analysis of the miR-122 target sites across representative species in the animal phylogenetic tree, we traced the evolutionary trajectory. [score:3]
In contrast, the expression of TGFβR1 remained unchanged in response to miR-122 or its sponge in human liver cancer cells (Fig. 1a). [score:3]
No homologous sequence was identified in the TGFβ1 5′UTR of the more distantly related vertebrates, such as the birds or fish, indicating that the gain of the miR-122 target site occurs in the common ancestor of the Afrotheria and Primate. [score:3]
Switch of miR-122 targeting from TGFβR1 to TGFβ1 generates different metastatic effects in human xenografts or mouse allografts. [score:3]
The luciferase assay further excluded VEGF as a target of miR-122 (Supplementary Fig. 4d). [score:2]
Therefore, this is a good demonstration of the evolutionary scenario in which the TGFβR1 CDS regulated by miR-122 in the mouse evolved to the TGFβ1 5′UTR in humans. [score:2]
We first examined the effect of decreased miR-122 on the development of liver cancer using human xenografts or mouse allografts. [score:2]
For the predicted miR-122 target site in each species, the luciferase assay was performed. [score:2]
It was reported that miR-122 repression coincides with the acquisition of a liver invasive phenotype 14 15. [score:1]
Given that miR-122 is a liver-specific molecule, the TGFβR1 increase was constrained to liver cancer cells. [score:1]
Distinct metastatic traits by miR-122 loss in humans or mice. [score:1]
To further confirm the effect of miR-122 on EMT was mediated through TGFβ1, HepG2 and HepG2-122 culture supernatants were treated with a TGFβ1 neutralizing antibody (TGFβ1-Ab) and TGFβ1, respectively. [score:1]
These in vitro data showed that miR-122 -mediated TGFβ1/TGFβR1 activity generated distinct metastasis-relevant traits in human or mouse cells. [score:1]
Species-specific effect of miR-122 on liver cancer metastasis. [score:1]
Loss of miR-122 resulted in the different metastatic effects in humans or mice liver cancers in vivo. [score:1]
miR-122 levels are reduced in clinical samples of HCC 14 15. [score:1]
Taken together, these results demonstrated that miR-122 repression resulted in different patterns of pathological liver function in humans and mice in vivo, including tumour weight as well as angiogenesis and metastasis. [score:1]
Unexpectedly, the reporter containing the sixth fragment was resistant to the silence of miR-122. [score:1]
Furthermore, the similar results were found in another human liver cancer cells, SMMC-7721, when transfected with miR-122 or miR-122 together with TGFβ1 (Fig. 1f). [score:1]
Quantitative analysis showed that miR-122 levels were decreased >10-fold in human tumour samples relative to normal adjacent samples (Fig. 6a). [score:1]
Here our results clearly prove that a loss of miR-122 exerts markedly different effects on metastatic liver cancer in humans and mice. [score:1]
They used the anti-miRNA-122 agent miravirsen to treat HCV and reported no dose-limiting adverse events for <1 month. [score:1]
To further confirm that a miR-122 -mediated repression affected EMT in human cells, we demonstrated three more experiments. [score:1]
Only the reporter containing the 5′UTR of human TGFβ1 was decreased to 75% by miR-122 (Fig. 2d,e). [score:1]
We found that the reporters containing the fourth fragment or seventh fragment were silenced by miR-122 (Fig. 2f). [score:1]
We first assessed the effect of miR-122 on the endogenous levels of TGFβ1 in three liver cell lines. [score:1]
The change of TGFβ1 or TGFβR1 mRNAs demonstrated the similar pattern to their protein one in these non-liver cell lines (Fig. 1d), indicating the mechanism of mRNA degradation by miR-122. [score:1]
We thus hypothesized that the loss of miR-122 in liver cancers would generate distinct pathological effects in humans and mice, mainly with regard to tumour metastasis-relevant traits. [score:1]
We next studied whether the repressive effect of miR-122 is specific to TGFβ isoforms or passes on the downstream signalling components. [score:1]
[1 to 20 of 83 sentences]
9
[+] score: 241
Other miRNAs from this paper: mmu-mir-451a, mmu-mir-451b
Experiments were then conducted to determine whether an inhibition of miR-122 induces AMPK activation using miR-122 inhibitor RNA, a 2′-methoxy modified and single stranded RNA complementary to hsa-miR-122 which was designed to repress function of the target miRNA. [score:7]
The miR-122 inhibitor (inhibitor RNA) is a chemically synthesized and modified single-strand RNA (5′ UGGAGUGUGACAAUGGUGUUUG) which specifically inhibits endogenous miR-122 function after transfection into cells. [score:7]
The results presented in this study also suggest that the PB -mediated down-regulation of miR-122 is an early and key event linked to the CAR -mediated transactivation of target genes. [score:6]
However, an inhibitor of ERK1/2 pathway (U0126) had apparently no effect on the PB -mediated down-regulation of the transactivation of the mir-122 promoter in HuH-7 cells (data not shown). [score:6]
Consequently, all of these data suggest that PB releases AMPK from suppressive control through the down-regulation of miR-122, resulting in the nuclear translocation of CAR and CYP2B transactivation. [score:6]
Transfection of the miR-122 inhibitor RNA significantly augmented the CAR-stimulated PBREM-reporter activity (Fig. 5-C), suggesting that the suppression of miR-122 function activates AMPK and in turn induces the CAR -mediated PBREM transactivation. [score:5]
As described above, unlike most other hepatoma cell lines including HepG2 cells, HuH-7 cells express a higher level of miR-122 [18], [22], i. e. approximately 14% of that expressed in mouse liver (Fig. 2-B). [score:5]
Transfection of HepG2 cells with the control RNA showed virtually no change in the gene expression of cut-like homeobox 1 (CUX1), a transcriptional repressor in which the mRNA is targeted by miR-122 [18]. [score:5]
It is possible that PB -mediated miR-122 down-regulation is not directly linked to AMPK or its upstream signaling molecules. [score:5]
The inhibitor or mimic RNA for miR-122 induces activation or suppression, respectively, of CAR -mediated PBREM transactivation in HepG2 cells. [score:5]
MiR-122 is expressed in a liver-specific manner and is a major hepatic miRNA, accounting for more than 70% of total miRNA expressed in the liver [16]. [score:5]
0041291.g005 Figure 5The inhibitor or mimic RNA for miR-122 induces activation or suppression, respectively, of CAR -mediated PBREM transactivation in HepG2 cells. [score:5]
In contrast, the PBREM reporter activity induced by the ectopic expression of CAR was almost completely suppressed by co-transfection of the miR-122 mimic RNA (Fig. 5-D). [score:5]
Transfection of the miR-122 inhibitor RNA resulted in a significant increase in CUX1 gene expression (Fig. 4-A), indicating that the function of miR-122 is in fact repressed. [score:5]
Further study is needed to clarify the PB -induced intracellular signaling that is connected to the down-regulation of the constitutive miR-122 transcription. [score:4]
PB induces the down-regulation of miR-122 at the transcriptional level. [score:4]
Down-regulation of miR-122 induces AMPK activation. [score:4]
Although it has been shown that miR-122 plays an important physiological role in lipid metabolism and liver development [16], it is likely there are also as yet unknown functions carried out by this miRNA in view of both its amount and the specificity of its liver expression pattern. [score:4]
PB induces reciprocal changes in AMPK activation and miR-122 down-regulation. [score:4]
0041291.g001 Figure 1PB induces reciprocal changes in AMPK activation and miR-122 down-regulation. [score:4]
A high concentration of PB is reportedly capable of activating ERK1/2 in vitro [30], suggesting that deterioration of C/EBPα transactivity could be involved in miR-122 down-regulation by PB. [score:4]
Our preliminary miRNA microarray experiments which preceded the present study suggested that PB induces a down-regulation of miR-122 in the mouse liver. [score:4]
These observations prompted us to hypothesize that PB down-regulates miR-122, which in turn activates AMPK, leading to CAR activation and subsequently to the induction of cyp2b transactivation. [score:4]
0041291.g003 Figure 3AMPK activation does not cause a miR-122 down-regulation. [score:4]
Because mature miRNA is relatively stable, it was expected that the initial transcript of mir-122 gene should be decreased more extensively if down-regulation of miR-122 by PB is caused at the transcriptional step. [score:4]
The suppressive effect of PB on the MIR-122 promoter appeared in a concentration -dependent manner and 1 mM PB decreased approximately 50% of the activity in the reporter assay using the p-(−5.7/−3.8)/pGL4.10 vector which exhibits reduced non-specific expressions (Fig. 2-E). [score:4]
These results suggest that PB induced the activation of AMPK and down-regulation of miR-122 in an inversely correlated manner in the mouse liver as well as HepG2 cells. [score:4]
Down-regulation of miR-122 is frequently observed in hepatocellular carcinoma tissues [19]. [score:4]
The current study demonstrates that PB induces down-regulation at the transcriptional level of liver enriched miR-122, which is implicated in hepatic differentiation and function. [score:4]
These results strongly suggest that the down-regulation of miR-122 induces AMPK activation. [score:4]
AMPK activation does not cause a miR-122 down-regulation. [score:4]
The miR-122 inhibitor RNA conversely induced the PBREM transactivation and increased the nuclear distribution of GFP-CAR. [score:3]
Mir-122 is an intergenic miRNA which expression is controlled by its own promoter. [score:3]
0041291.g004 Figure 4Cells were transfected either with the miR-122 inhibitor or the control RNA (20 pmol). [score:3]
Furthermore, co-transfection of the miR-122 inhibitor RNA with the GFP-CAR plasmid increased and the mimic RNA inversely decreased the number of cells displaying nuclear signals (Fig. 6-B). [score:3]
Inhibition of miR-122 induces AMPK activation in HepG2 cells. [score:3]
Anti-hsa-miR-122 miScript miRNA inhibitor (MIN0000421), syn-hsa-miR-122 miScript miRNA mimic (MSY0000421) and the AllStars Negative Control siRNA were purchased from Qiagen (Valencia, CA). [score:3]
Transfection of the inhibitor RNA, which specifically blocks the miR-122 function, induced AMPK activation in HepG2 cells. [score:3]
It is interesting to note that a significant decrease in the basal level of PBREM reporter activity was observed in cells transfected with the miR-122 mimic RNA in the absence of the ectopic CAR expression. [score:3]
The precise mechanism that governs the inhibitory effect of miR-122 on AMPK activation has not been elucidated in this study. [score:3]
On the other hand, AMPK activation induced by metformin or AICAR had little effect on miR-122 levels, suggesting that miR-122 plays a role in the suppression of AMPK activity. [score:3]
On the other hand, a considerable increase in the promoter activity was observed in HuH-7 cells (Fig. 2-C), which express higher levels of miR-122, estimated at 14% of the mouse liver (Fig. 2-B). [score:3]
C, Cells were transfected either with the miR-122 inhibitor or the control RNA (40 pmol) in conjunction with the PBREM/pGL3-120 (0.12 μg), pRL-TK (0.04 μg) and CAR/pcDNA3.1 (0.04 μg) vectors. [score:3]
Cells were transfected either with the miR-122 inhibitor or the control RNA (20 pmol). [score:3]
B, HuH-7 cells were transfected either with the miR-122 inhibitor, the mimic or the control RNA (20 pmol) in conjunction with CAR/pQBI25 vector (0.2 μg). [score:3]
Moreover, it has been reported [17] that miR-122 inhibition by systemic administration of an antisense oligonucleotide against miR-122 promotes the activation of hepatic AMPK. [score:3]
Under these experimental conditions, the miR-122 inhibitor RNA significantly induced AMPK phosphorylation (Fig. 4-B). [score:3]
In HepG2 cells in which the expression of miR-122 is approximately 0.04% of the mouse liver (Fig. 2-B), transfection of the miR-122 reporter vector resulted in only a trace increase in transcriptional activity (Fig. 2-C). [score:3]
The miR-122 mimic RNA effectively suppressed the CAR -mediated PBREM transactivation in HepG2 cells and increased the cytoplasmic distribution of GFP-CAR in HuH-7 cells. [score:3]
The MIR-122 promoter residing between −5.3 to −4.8 kb upstream of miR-122 precursor was characterized and shown to be involved in the down-regulation during the carcinogenesis [19] as well as hepatocyte differentiation [18]. [score:2]
These observations imply a miR-122 -mediated mechanism regulating LKB1 activity. [score:2]
It has been reported [13] that LKB1 is involved in PB -induced AMPK activation, suggesting that miR-122 may regulate LKB1 function. [score:2]
It has been reported that the function of C/EBPα including the transactivation of mir-122 gene is activated by GSK3β [19], [28], which is phosphorylated and inactivated by extracellular signal-regulated kinases (ERK1/2) [29]. [score:2]
It is possible that miR-122 may promote a decrease in PBREM reporter activity independent of CAR in addition to the CAR -mediated mechanism. [score:1]
Therefore, these results suggest that miR-122 level affects CAR -mediated PBREM transactivation. [score:1]
Further progress in understanding miRNA function will be required to ultimately reveal the mechanistic relationship between miR-122 and AMPK. [score:1]
B, Total RNA samples from mouse liver, HepG2 and HuH-7 cells were subjected to quantitative RT-PCR using a TaqMan probe for mouse or human miR-122. [score:1]
D, Cells were transfected with the miR-122 mimic RNA or the control RNA (10 pmol) in conjunction with CAR/pcDNA3.1 or pcDNA3.1 vector (0.04 μg) as well as the PBREM/pGL3-120 (0.12 μg) and pRL-TK vector (0.04 μg). [score:1]
The mir-122 gene is independently transcribed, driven by its own promoter [18], [19]. [score:1]
These results are consistent with a report [17] showing that in vivo treatment with an antisense oligonucleotide for miR-122 induced hepatic AMPK activation. [score:1]
These results indicate that GFP-CAR was preferentially distributed in the cytoplasm of miR-122 enriched HuH-7 cells and suggest that there exists a miR-122 -dependent machinery which is involved in the cytosolic retention of CAR. [score:1]
The present study sought to demonstrate a link between miR-122 and AMPK based on the fact that PB induced reciprocal changes in the miR-122 levels and AMPK activity in both mouse liver and HepG2 cells. [score:1]
Treatment of HepG2 cells with 5-aminoimidazole-4-carboxamide 1-β-D-ribonucleoside (AICAR), another typical AMPK activator, which action is caused by mimicking an increased AMP/ATP ratio, induced the AMPK phosphorylation but apparently showed no effect on the miR-122 level (Fig. 3-B). [score:1]
A significant decrease in the pri-miR-122 level was observed between 1 to 12 h after the treatment and tended to return to the basal level gradually. [score:1]
Modulation of miR-122 induces changes in GFP-CAR distribution in HuH-7 cells. [score:1]
Fig. 1-A and C demonstrate changes in the miR-122 levels in mouse liver during the course of the AMPK activation induced by PB. [score:1]
was subjected to quantitative RT-PCR using a TaqMan probe for pri-miR-122. [score:1]
PB induces a decrease in miR-122. [score:1]
The most significant decrease in hsa-miR-122 was observed 4 h after PB in these cells. [score:1]
A luciferase reporter construct p-(−5.7/−3.8) containing the −5645 to −3726 bp region of the human mir-122 gene (chr18: 54263641–54265560) in the pGL3-basic vector [19] was kindly donated by Shi-Mei Zhuang (Sun Yat-Sen University, China). [score:1]
Treatment of HuH-7 cells with PB promoted a significant decrease in the reporter activity of the MIR-122 promoter (Fig. 2-D). [score:1]
There is no information that connects miR-122 and PKC at the present time; however, elucidation of relationship between changes in the miRNA level and phosphorylation states of CAR would be attractive and hopefully shown in the following project. [score:1]
Total RNA samples from mouse liver (C) and HepG2 cells (D) were subjected to quantitative RT-PCR using a TaqMan probe for mouse (mmu-) and human (hsa-) miR-122, respectively. [score:1]
The effects of loss or gain of function of miR-122 on PBREM transcriptional activity were evaluated using this ectopic CAR-expressed in vitro system. [score:1]
The miR-122 mimic (mimic RNA) is a synthetic double strand RNA (5′ UGGAGUGUGACAAUGGUGUUUG) which mimics mature endogenous miRNA after transfection. [score:1]
The miR-122 level affects CAR -mediated PBREM transactivation. [score:1]
UCP2 mRNA (the third panel) and miR-122 (the last panel) levels were determined by the quantitative RT-PCR, were normalized with β-actin and the U6 snRNA, respectively, and are illustrated as the % of control group. [score:1]
Therefore, the effect of PB on primary miR-122 (pri-miR-122) was determined by real-time RT-PCR specific for pri-miR-122. [score:1]
The treatment of mice with PB significantly decreased the hepatic mmu-miR-122 levels (Fig. 1-C). [score:1]
However, this protocol of metformin treatment apparently had no effect on the miR-122 levels in the mouse liver (Fig. 3-A). [score:1]
The mmu-miR-122 level slowly returned to the basal level over 24 h. PB induced the significant and sustained activation of AMPK in human hepatoma HepG2 cells as well (Fig. 1-B). [score:1]
The pri-mir-122 level was decreased to approximately 25% of the basal one as early as 1 h (Fig. 2-A) after PB. [score:1]
It is important to note that a 30% decrease in mature miR-122 in the PB -treated mouse liver may elicit significant biochemical effects because it accounts for more than 70% of the total hepatic miRNA [16]. [score:1]
The p-(−5.7/−3.8) reporter vector containing the promoter region 5′-upstream of the human MIR-122 gene was used to assess the transcriptional activity of miR-122 [19]. [score:1]
MiR-122 regulates the CAR distribution pattern. [score:1]
PB treatment of the mouse induced a considerable decrease in hepatic pri-miR-122. [score:1]
0041291.g006 Figure 6Modulation of miR-122 induces changes in GFP-CAR distribution in HuH-7 cells. [score:1]
[1 to 20 of 87 sentences]
10
[+] score: 239
However, no significant difference in miR-122's ability to down-regulate the expression of Nocturnin 3′-UTR reporter was observed between genotypes (Fig. 5A), suggesting that the deadenylase activity of Nocturnin is not necessary for miR-122 to down-regulate Nocturnin expression. [score:11]
Nocturnin is a target of miR-122 in cultured cellsAlthough target mRNAs frequently have multiple copies of miRNA target sites in their 3′-UTR [7], examination of the Nocturnin mRNA sequence revealed a single potential target sequence for miR-122 in its 3′-UTR (Fig. 1A). [score:9]
We thus co-expressed miR-122 and Nocturnin reporter genes (Fig. 2A) in Mouse Embryonic Fibroblasts (MEFs) derived from Noc [+/+], Noc [+/−], and Noc [−/−] mice to see if loss of a functional Nocturnin deadenylase would affect the down-regulation of Nocturnin expression mediated by miR-122. [score:8]
Endogenous Nocturnin is a target of miR-122 in vivo To test whether the effects of miR-122 on Nocturnin in cell culture could also be observed in vivo, we analyzed endogenous expression of Nocturnin in liver using mice in which miR-122 expression was knocked down by injecting miR-122 specific antisense oligonucleotides (ASOs). [score:8]
The deadenylase activity of Nocturnin is not necessary for miR-122 mediated self regulationMiRNAs not only repress translation but can also trigger deadenylation and degradation and/or translational silencing of their target mRNAs [30], [31]. [score:8]
Although target mRNAs frequently have multiple copies of miRNA target sites in their 3′-UTR [7], examination of the Nocturnin mRNA sequence revealed a single potential target sequence for miR-122 in its 3′-UTR (Fig. 1A). [score:7]
To test whether the effects of miR-122 on Nocturnin in cell culture could also be observed in vivo, we analyzed endogenous expression of Nocturnin in liver using mice in which miR-122 expression was knocked down by injecting miR-122 specific antisense oligonucleotides (ASOs). [score:6]
In addition, the proper expression of miR-122 in liver is critical for lipid metabolism, since overexpression of miR-122 increased and knockdown of miR-122 decreased cholesterol and fatty acid biosynthesis [15], [18]. [score:6]
In this study, we identified Nocturnin as one of the target mRNAs of miR-122 in mouse liver and we propose that miR-122 is important for shaping the appropriate circadian expression profile of Nocturnin. [score:5]
Nocturnin is up-regulated by miR-122 knock-down in vivo. [score:5]
These data were consistent with previous reports that listed Nocturnin mRNA as one of a set of mRNAs that were up-regulated by knocking down miR-122 in vivo [15], [18]. [score:5]
0011264.g006 Figure 6Nocturnin is up-regulated by miR-122 knock-down in vivo. [score:5]
In contrast, miR-122 overexpression did not affect the luciferase activity of constructs with mutated or deleted miR-122 target sequences (Fig. 2B). [score:5]
Since Nocturnin expression exhibits high amplitude rhythms in liver [3], [4], we tested whether miR-122 expression might also be rhythmic in liver. [score:5]
Loss of Nocturnin expression also did not affect the expression level of miR-122 in mouse liver (Fig. 5B). [score:5]
When these miRNAs were co-expressed with Nocturnin 3′-UTR reporter genes, both miR-125a and -125b failed to repress the luciferase activity of Nocturnin 3′UTR WT, even under conditions where miR-122 was able to effectively repress reporter gene expression (Fig. 3A). [score:5]
Many mRNAs have been predicted to be potential targets of miR-122, but only a few genes such as cationic amino acid transporter1 (Cat1), cyclinG1, or Smarcd1/Baf60a have been demonstrated to be bona fide targets [15], [22], [23], [24], [25]. [score:5]
Although overexpression of miR-122 did not affect the RNA level of the Nocturnin reporter gene (Fig. 2C), the knock down of miR-122 was able to significantly increase Nocturnin mRNA levels in mouse liver. [score:4]
These results indicated that Nocturnin is a potential direct target of miR-122, and miR-122 recognizes the putative recognition site present in the Nocturnin 3′-UTR. [score:4]
Taken together, our findings suggest that the regulation of Nocturnin expression by miR-122 is an important connection between circadian clocks and hepatic lipid metabolism. [score:4]
miR-122 down-regulates Nocturnin WT luciferase reporter activity but not its RNA level. [score:4]
0011264.g003 Figure 3Effect of miR-122 on Nocturnin reporter expression is specific. [score:3]
Our data thus demonstrate that this robustly rhythmic expression of Nocturnin in liver is shaped, at least in part, by miR-122. [score:3]
Therefore, the changes in luciferase activity must be due to miR-122 mediated inhibition of protein synthesis rather than to RNA decay. [score:3]
D. Nocturnin protein expression in PBS, miR-122 ASO, or miR-124 ASO treated mouse liver (mean ± S. E. ) at ZT0 and ZT12. [score:3]
Proper miR-122 expression is important for normal liver function [15], [16]. [score:3]
The firefly/ Renilla ratios without miR-122 expression were set as 1 for each reporter gene. [score:3]
B. Relative luciferase activities (means ± S. E. Three independent experiments in duplicate) of Nocturnin 3′-UTR reporters with various levels of miR-122 overexpression in NIH3T3 cells. [score:3]
Mature miR-122 expression is not rhythmic in liver. [score:3]
Endogenous Nocturnin is a target of miR-122 in vivo. [score:3]
Asterisks represent p<0.005 versus no miR-122 overexpression (white bars). [score:3]
miR-122 expression is not rhythmic. [score:3]
Effect of miR-122 on Nocturnin reporter expression is specific. [score:3]
C. Relative RNA levels of reporter genes (means ± S. E. Two independent experiments in duplicate) with miR-122 overexpression in NIH3T3 cells. [score:3]
Blocking miR-122 expression leads to the reduction of plasma cholesterol and triglyceride levels in both rodents and primates, [15], [17], [18], [19]. [score:3]
There is also a functional connection between miR-122 and circadian rhythms, because the transcription of miR-122 is rhythmic, and circadian transcripts are enriched in a gene set that is misregulated by miR-122 knock-down in vivo [22]. [score:3]
A. Relative luciferase activities (means ± S. E. Three independent experiments in duplicate) with miR-122 overexpression in MEFs (White bars; +/+, Gray bars; +/−, Black bars; −/−). [score:3]
The mature form of miR-122 expression was not rhythmic (Fig. 4; white arrowhead), consistent with the fact that the half-life of miRNAs can be well over 24 hours [29]. [score:3]
Nocturnin is a target of miR-122 in cultured cells. [score:3]
Since most mRNAs undergo either deadenylation and degradation and/or inhibition of protein synthesis after miRNA recognition and binding [6], [7], we investigated whether miR-122 overexpression affected the Nocturnin 3′-UTR reporter RNA levels. [score:3]
C. Representative Western blots of Nocturnin expression in PBS, miR-122 ASO, or miR-124 ASO treated mouse liver (two mice per group) at ZT0 and ZT12. [score:3]
When miR-122 was expressed in NIH3T3 cells with the WT Nocturnin 3′-UTR, we observed a dose -dependent decrease in relative luciferase activity (Fig. 2B). [score:3]
Subsequently, mutations into the putative miR-122 recognition site were introduced by QuikChange Site Directed Mutagenesis kit (Stratagene). [score:3]
These results are consistent with the previous report that the expression of both pri-miR-122 and pre-miR-122 is rhythmic but that mature miR-122 is not [22]. [score:3]
Nocturnin mRNA expression remained rhythmic after miR-122 ASO administration, but the amplitude was significantly increased (Fig. 6A). [score:3]
Same amount of plasmid DNA (1 µg) to express miR-122, -125a, and -125b was transfected into HEK293 cells. [score:3]
0011264.g005 Figure 5Deadenylase activity of Nocturnin was not involved in miR-122 -mediated self-regulation. [score:2]
Deadenylase activity of Nocturnin was not involved in miR-122 -mediated self-regulation. [score:2]
Moreover, mice in which miR-122 is knocked down are resistant to diet -induced hepatic steatosis [18], supporting a role for this miRNA in fatty acid and cholesterol metabolism in liver. [score:2]
The deadenylase activity of Nocturnin is not necessary for miR-122 mediated self regulation. [score:2]
Furthermore, both miR-122 and Nocturnin are implicated to play a role in circadian rhythms [4], [22]. [score:1]
B. miR-122 expression was measured from Noc [+/+] and Noc [−/−] livers. [score:1]
miR-122 ASO) was not significant (p = 0.32). [score:1]
MicroRNA-122 (miR-122) is a liver-specific miRNA. [score:1]
We also generated constructs in which the 7 bp “seed” sequence (CACUCCA) within the putative miR-122 site was either mutated or deleted (Fig. 2A). [score:1]
After electroblotting and cross-linking onto Hybond-N [+] membrane (Amersham), the blots were probed at 42°C in QuickHyb (Stratagene) with terminally radiolabeled oligonucleotides complementary to miR-122 (5′-ACAAACACCATTGTCACACTCCA-3′), miR-125a (5′-TCACAGGTTAAAGGGTCTCAGGGA-3′) miR-125b (5′-TCACAAGTTAGGGTCTCAGGGA), or U6 (5′-CATCCTTGCGCAGGGGCCATGC-3′), followed by washing with 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-0.1% sodium dodecyl sulfate (SDS), and then with 0.5× SSC-0.1% SDS at 42°C. [score:1]
miR-122 ASO). [score:1]
A. Nocturnin mRNA expression was measured by qRT-PCR from livers collected at the times indicated from mice that were previously treated with miR-122 ASO or PBS (mean ± S. E. ). [score:1]
The levels of miR-122 were determined by Northern blotting from liver samples taken at various circadian times as indicated. [score:1]
White and black arrowheads indicate mature miR-122 and pre-miR-122, respectively. [score:1]
B. Nocturnin protein expression in PBS or miR-122 ASO treated mouse liver (mean ± S. E. ) around the clock was measured on Western blots and then quantitated using Image J software. [score:1]
Four doses of miR-122 ASO or PBS control were injected intraperitoneally into mice, and 14–15 days after the first injection (corresponding to 2–3 days after the last injection), livers were harvested around the clock at 4hr intervals. [score:1]
Although the overall RNA levels of control reporter (lacking any of the Nocturnin 3′-UTR) were higher than those containing the 3′-UTR sequence, in no case was there an effect of miR-122 (Fig. 2C). [score:1]
However, we detected another more slowly migrating band in our Northern blot analysis, which was rhythmic with highest levels at night (Fig. 4; black arrowhead) and probably corresponded to pre-miR-122. [score:1]
0011264.g001 Figure 1The Nocturnin 3′UTR possesses one putative miR-122 recognition site. [score:1]
Since the Nocturnin gene encodes a deadenylase, we wondered whether Nocturnin's deadenylation activity could contribute to the miR-122 effect on the Nocturnin message. [score:1]
In humans, the level of miR-122 is repressed in hepatocellular carcinomas and in patients with nonalcoholic steatohepatitis [20], [21]. [score:1]
Endogenous Nocturnin protein expression was also measured around the clock with or without miR-122 ASO, and we found that Nocturnin protein was significantly higher during the night (ZT12) in the miR-122 ASO injected mice than in those injected with PBS (Fig. 6B). [score:1]
B. miR-122 recognition sequences of Nocturnin gene in Homo sapiens (NM_012118; nt1930–1953), Mus musculus (NM_009834, nt2100–2121), Rattus norvegicus (NM_138526, nt1680–1702), and Bos taurus (NM_001082454, nt1693–1715). [score:1]
The Nocturnin 3′UTR possesses one putative miR-122 recognition site. [score:1]
Analysis of livers from miR-122 -depleted animals relied on the same samples as in [22]. [score:1]
As described in [22], miR-122 depletion was >85% on average, but showed some time point -dependent variation due to the rhythmic production of miR-122. [score:1]
Luciferase activities were normalized as described in Figure 2. Asterisks represent p<0.005 versus no miR-122. [score:1]
Then, inserts were cut out by BamHI/EcoRV (miR-122 and miR-125a) or SpeI/NotI (miR-125b) and ligated into pcDNA3.1/V5-HisB (Invitrogen). [score:1]
Asterisks represent p<0.005 miR-122 versus no miR-122, miR-125a, or miR-125b. [score:1]
In order to test whether this sequence was indeed a miR-122 recognition site, we used a cell -based luciferase reporter system in which the mouse Nocturnin 3′-UTR was cloned downstream of the Firefly luciferase gene. [score:1]
Interaction between Nocturnin and miR-122 is specific. [score:1]
The larger effect of miR-122 ASO at night is likely due to the high levels of Nocturnin mRNA during this phase of the circadian cycle. [score:1]
A. The sequence of WT Nocturnin 3′-UTR (top) and miR-122 (bottom) around the putative miR-122 recognition site. [score:1]
However, this single site contained a miR-122 seed sequence that was highly conserved in human, mouse, rat, and cow (Fig. 1B). [score:1]
A. Relative luciferase activities (means ± S. E. Two independent experiments in triplicate) when reporter genes were co -transfected with either miR-122, miR-125a, or miR-125b in NIH3T3 cells. [score:1]
Red characters represent the seed sequence for miR-122 recognition. [score:1]
[1 to 20 of 82 sentences]
11
[+] score: 216
Other miRNAs from this paper: hsa-mir-122
Huh7 hepatocellular carcinoma cells resemble normal hepatocytes in that they express significant amounts of the liver-specific miR122 [27], and have previously been used as an in vitro mo del for adenovirus infection of liver cells to demonstrate the capacity of miR122 target sites to down-regulate E1A expression [22], [23]. [score:10]
As expected, a strong miR122 target element -dependent suppression of reporter gene expression was observed in Huh7 cells, whereas no evidence for miR122 expression in A549, HCT116, or Hep-2 cells could be detected (Figure S1). [score:9]
Thus, placing these toxic or immunomodulatory genes under a dual miR122 control by targeting their mRNAs directly as well as indirectly (via miR122-regulated replication) would provide a synergistic and powerful strategy for excluding their expression in hepatocytes. [score:8]
Although even a strong systemic antagomir -mediated miR122 inhibition used as an experimental HCV therapy did not show any obvious adverse effects on the liver [42], the prominent role of miR122 in hepatocytes might raise concerns of disrupting normal gene regulation in hepatocytes due to a “sponge effect” of expression of multiple miR122 target sites. [score:8]
Reflecting its role as a tumour suppressor [45], [46], the loss of miR122 expression is common in HCC [47], [48], and the Huh7 cells used in this study are exceptional among HCC-derived cell lines in resembling normal hepatocytes by expressing miR122 [27]. [score:7]
In order to bring the replication of this modified Ad5/3 virus effectively under the control of miR122 -mediated E1A regulation, it was necessary to combine the liver-specific, miR122 -mediated inhibition with a mutation that non-specifically decreased E1A translation in all cell types. [score:7]
The success in using miR122 targets for suppressing E1A expression, suggests that similar strategies might also be useful for preventing potentially harmful replication of other therapeutic or vaccine viruses. [score:7]
Using a chimeric Ad5/3 adenovirus containing three miR122 target elements in the E1A 3′UTR, we have previously reported that despite potent suppression of E1A mRNA and protein expression, viral replication was only modestly attenuated in the liver-derived Huh7 cells [22]. [score:7]
Nevertheless, it is interesting to note that despite this limited capacity to replicate in murine cells, our current findings together with the data by Cawood et al. clearly show that the elevated markers of liver damage in mice are a genuine consequence of adenoviral gene expression in hepatocytes rather than due to less direct hepatotoxicity caused by the viral particles, and can thus be counteracted by miR122 -based targeting. [score:6]
In this study we show that targeting of E1A to cell type-specific downregulation by miR122 is sufficient to potently attenuate adenovirus replication in the human liver. [score:6]
In this study we show in normal human liver tissue strong suppression of otherwise unmodified adenovirus 5 carrying six copies of miR122 target elements in E1A 3′ UTR. [score:5]
Of note, when considering intrahepatic tumours, the value of miR122 -based targeting is not limited to metastatic disease, but could also be exploited in virotherapy of primary hepatocellular carcinoma (HCC). [score:5]
By inserting miR122 target elements in the 3′UTR of E1A gene we could strongly reduce E1A expression in cells of hepatic origin. [score:5]
Equally important, miRNA122 is one the most tissue-specific miRNA and apart from minimal expression in some cells of the thymus and brain, it is not expressed outside of the liver [38], [39], [40], [41]. [score:5]
In both cases the suppressive effect of the miR122 target elements on replication and cytopathicity of Ad5T122 in Huh7 cells was almost completely abolished (Figure S2). [score:5]
To generate a miRNA -targeted version of wild-type adenovirus 5 (Ad5 in Fig. 1), we inserted six copies of target elements with perfect sequence complementarity for the liver-specific microRNA miR122 in the 3′UTR of the E1A gene (Ad5T122 in Fig. 1). [score:5]
On the other hand, similar to our earlier study, Leja et al. reported that combining miR122 -mediated E1A mRNA suppression with other inhibitory measures was required to potently suppress adenovirus replication in cultured hepatic cells [25]. [score:5]
Moreover, miR122-control could also be further employed in liver detargeting of oncolytic adenoviruses by placing additional target sequences in other positions in the viral genome. [score:5]
Indeed, miR122 is very highly expressed in normal hepatocytes where it has been estimated to constitute over 70% of all miRNAs expressed [27], [38]. [score:5]
The potent suppression of the current Ad5T122 virus in the normal human liver tissue may be contributed by the higher number of miR122 targets compared to the Ad5/3-derived virus that we have studied earlier [22] (six vs. [score:4]
Specifically, they combined miR122 -mediated downregulation of E1A with deletion of the E1B gene and a tissue-specific promoter showing low activity in the liver to drive E1A transcription. [score:4]
Thus, we concluded that miR122 in normal human liver tissue could exert a powerful negative regulation on the target site-containing virus. [score:4]
This chimeric mRNA was strongly downregulated by miR122, as evidenced by reduced luciferase activity in Huh7 cells and in primary hepatocyte cultures, as well as in the livers of infected mice. [score:4]
This confirmed that inclusion of the miR122 target sites had not compromised the replicative potential of Ad5T122 in the tumour tissue, as we had already observed in cancer cell lines (Figure 2). [score:3]
Finally, it is also important to note that Huh7 cells express only 8% of the miR122 levels observed in primary human hepatocytes [27]. [score:3]
We also examined the effect of miR122 inhibition by a transfected antagomir designed against miR122. [score:3]
To confirm that the attenuation of Ad5T122 in Huh7 cells was indeed specifically due to silencing by miR122 we generated stable cell lines in which the critical miRNA machinery component Argonaute 2 (Ago2) had been targeted for silencing with lentivirally transduced anti-Ago2 shRNAs. [score:3]
In summary, the current study provides a definitive proof of concept and preclinical validation for the use of miR122 target elements for reducing the risk of liver toxicity of therapeutic adenoviruses. [score:3]
pShuttle 6×122 was made as described [22], except inserting six copies of miR122 target elements instead of three. [score:3]
To improve the safety of oncolytic adenoviruses we have introduced a miRNA -based approach for engineering adenoviruses that are suppressed in their replication by the liver-specific miR122 [22]. [score:3]
These results provide a definitive validation for introducing miR122 targets into oncolytic adenovirus constructs as a safeguard of the liver. [score:3]
Our data show that in normal human liver tissue miR122 target elements alone are sufficient to profoundly attenuate Ad5. [score:3]
Based on these data we conclude that the miR122 sites could strongly suppress replication of Ad5T122 in normal human liver tissue without compromising its replication in colorectal cancer liver metastasis tissue. [score:3]
Subsequently Cawood et al. reported the use of a serotype 5 virus in which E1A had been replaced with an E1A-luciferase fusion gene containing four miR122 target elements in its 3′UTR. [score:3]
By itself this uniform decrease of E1A protein production did not have a noticeable effect on Ad5/3 replication in a panel of non-hepatic cancer cell lines, but together with the miR122 -mediated E1A control led to a potent suppression of replication and cytopathicity in Huh7 cells [22]. [score:3]
Moreover, the failure of Ad5T122 to replicate and spread in the liver cells provides another layer of protection against deregulating normal miR122-regulated processes in the liver. [score:3]
However, Leja et al. also used six miR122 targets in their related study design discussed above. [score:3]
The indicated cells lines were co -transfected with an unmodified Firefly luciferase vector (pSIRNALUC-3′MluI) or its derivative containing a miR122 target element in the 3′ UTR (pSIRNALUC-3′1×T122) together with a vector for Renilla luciferase (pcDNA-Renilla). [score:3]
Because of the non-hepatic origin of the latter cell lines they were not expected to express miR122. [score:3]
Figure S2Suppression of Ad5T122 replication in Huh7 cells is miR122-specific. [score:3]
They also showed that serum markers of liver damage as well as viral genome copy numbers in the livers of mice infected with wild-type Ad5 containing four miR122 targets were lower than mice infected with an unmodified virus [23], [24]. [score:3]
B. Effect of miR122 inhibition by a synthetic antagomir oligonucleotide on Ad5T122 replication in Huh7 cells. [score:3]
The number of miR122 target elements is determined by the copy number of E1A mRNAs in the infected cells, which becomes very low in liver cells due to miR122 -guided destruction. [score:3]
To examine the potential of the miR122 -mediated suppression in controlling Ad5T122 replication in human liver we turned into an experimental system based on ex vivo culturing of precision-cut human liver tissue slices [28], [29]. [score:3]
In Ad5T122, six copies of miR122 target elements were introduced in the 3′UTR of E1A gene. [score:3]
Figure S1 Functional quantitation of miR122 expression in different cell lines. [score:3]
Combining such transductional liver-detargeting with the post-transcriptional, miR122 -based approach validated in this study would be straight-forward, and could further minimize the potential damage to hepatocytes by oncolytic adenoviruses, especially when treating tumours outside of the liver. [score:3]
miR122 Inhibitor Assay. [score:2]
To confirm this, we quantified the functional miR122 expression in these cell lines using a previously validated dual luciferase assay [22]. [score:2]
Cawood et al. suggested that four miR122 target sites as compared to the three copies used in our previous study allowed a better control of viral replication. [score:2]
By contrast, cell death caused by Ad5T122 was strongly reduced in Huh7 cells, indicating that replication of Ad5T122 could be attenuated by miR122. [score:1]
Immunohistochemistry of the infected tissues does not provide a quantitative measure of viral replication, and low levels of E1A do not exclude replication of the miR122 -targeted virus. [score:1]
[1 to 20 of 52 sentences]
12
[+] score: 216
Other miRNAs from this paper: mmu-let-7a-1, mmu-let-7a-2, mmu-mir-16-1, mmu-mir-16-2
Among them, HMGCR, a rate-determining enzyme in cholesterol biosynthesis (fold downregulation = 2.9), and FASN (fatty acid synthase), controlling fatty acid synthesis (fold downregulation = 2.7), are known to be reciprocally regulated by miR-122 (Esau et al., 2006). [score:8]
Several genes of cholesterol metabolism that are indirect targets and reciprocally regulated by miR-122 (Elmén et al., 2008) were downregulated along with miR-122 in L.  donovani-infected liver. [score:8]
The murine VL liver displayed altered expression of lipid metabolic genes, many of which are direct or indirect targets of the liver-specific microRNA-122. [score:7]
A more detailed analysis of the microarray data highlighted an interesting finding: several lipid-metabolizing genes showing differential expression in the livers of infected animals are direct or indirect targets of miR-122 (Table S3). [score:7]
Leishmania Infection Reduces miR-122 Levels in Mouse LiverA more detailed analysis of the microarray data highlighted an interesting finding: several lipid-metabolizing genes showing differential expression in the livers of infected animals are direct or indirect targets of miR-122 (Table S3). [score:7]
To understand the mechanism of hepatic miR-122 downregulation in infected animals, we used human Huh7 hepatoma cells that express miR-122. [score:6]
These results further confirm Dicer1 as the primary target of Leishmania to downregulate miR-122 activity in mammalian liver. [score:6]
► Leishmania infection reduces liver miR-122 and lowers serum cholesterol ► Leishmania metalloprotease gp63 is required for inhibition of hepatic miR-122 activity ► gp63 cleaves DICER1 to downregulate miRNP-122 formation in hepatocytes ► Restoration of miR-122 elevates serum cholesterol to reduce liver parasite load Visceral leishmaniasis (VL) is caused by the protozoan parasite Leishmania donovani or Leishmania infantum and is the most fatal form of this parasitic disorder (Murray et al., 2005). [score:6]
Is a parasite-derived secretory factor required for downregulation of miR-122 activity in target cells? [score:6]
This observation was consistent with the prediction of Dicer1 as a target that L. donovani degrades to downregulate miR-122 in infected mouse liver. [score:6]
Restoration of Dicer1 Expression in Parasite-Infected Livers Rescues miR-122 Expression and Reduces Liver Parasite Burden. [score:5]
Overexpressed DICER1 in Huh7 cells inhibited the derepression of miR-122 activity by L.  donovani (Figure 5E). [score:5]
To overexpress miR-122 or NHA-DICER1 in mouse livers, pmiR-122, the pre-miR-122 expression plasmid, or the pCIneoNHA-DICER1 plasmid was injected through the tail vein of mice at a dose of 25 μg plasmid DNA dissolved in 100 μl saline. [score:5]
In order to understand the significance of miR-122 downregulation during the L.  donovani infection process, we aimed to complement the reduced miR-122 level in the livers of infected animals. [score:4]
Internalization of Leishmania Exosomes Is Essential for miR-122 Downregulation in Hepatocytes. [score:4]
From the previous experiments it was evident that the exosomes caused downregulation of miR-122 activity in human hepatoma cells, but it was not clear whether the internalization of the exosomes in heptocytes is required or if its interaction with the membrane of Huh7 cells is sufficient for lowering miR-122 activity. [score:4]
In liver, L.  donovani infects the tissue macrophage Küpffer cells, but how the infection of Küpffer cells induces miR-122 downregulation in hepatocytes is not known. [score:4]
Internalization of Leishmania Exosomes Is Essential for miR-122 Downregulation in HepatocytesEntry of L.  donovani or parasite-derived exosomes into host cells is well documented (Silverman et al., 2010). [score:4]
Real-time quantification revealed a gradual downregulation of miR-122 in mouse livers with progressive infection (Figure 3A). [score:4]
High serum cholesterol caused resistance to L.  donovani infection, while downregulation of miR-122 is coupled with low serum cholesterol in VL mice. [score:4]
Downregulation of gp63 internalization in dynamin 2-compromised cells also reduced the effect of exosomes on miR-122 -mediated repression in Huh7 (Figure S3H). [score:4]
We have shown in this study that L.  donovani infection downregulates miR-122 and genes involved in cholesterol biosynthesis in infected mouse livers to reduce serum cholesterol. [score:4]
To highlight the protective role of miR-122, we injected miR-122 expression plasmid in animals after 15 days p. i. when initial infection was already established. [score:3]
Reduced miR-122 activity could not be due to lower expression of miRNP components, as we did not find any reduction in miRNP-interacting protein RCK/p54 in infected livers (Figure 3C). [score:3]
Interestingly, when a miR-122 mimic that does not require the DICER1 processing step was transfected in Huh7 cells, the inhibition of miRNA activity by Leishmania was lost. [score:3]
L.  donovani infection in mice shows a decrease in liver DICER1 expression accompanied by a concomitant increase of its substrate pre-miR-122. [score:3]
Therefore, the therapeutic potential of miR-122 alone and in combination with cholesterol can open up avenues to combat this deadly disease. [score:3]
miR-122, a miRNA expressed abundantly in liver, modulates a wide range of liver functions. [score:3]
Excess Dicer1 in liver increased liver miR-122 expression and restored the serum cholesterol level (Figures 6H and 6I). [score:3]
It inhibits Dicer1 -mediated pre-miR-122 processing to restrict miRNP formation and prevents miR-122 activity in L.  donovani-interacting hepatocytes. [score:3]
Exosomes preblocked with this anti-gp63 antibody could not prevent the miRNA repression, whereas pretreatment with normal rabbit immunoglobulin G (IgG) failed to reverse the inhibitory role of leishmanial exosomes on miR-122 activity in Huh7 cells (Figure 4J). [score:3]
Concomitant reduction of miR-122 expression was observed in VL liver. [score:3]
Animals were sacrificed at 30 days p. i. along with the control group of animals, and serum lipid profile, liver parasite burden, and miR-122 expression levels were determined. [score:3]
gp63 Cleaves DICER1 to Prevent Effective miRNP Formation and Inhibits miR-122 Activity in Human Hepatocytes. [score:3]
However, in Huh7 cells expressing exogenous pre-miR-122 that required DICER1 processing to generate miRNP-122, L.  donovani -mediated reversal of miR-122 activity was unaffected (Figure 5F). [score:3]
To that end, we injected pmir122, a miR-122 expression plasmid with a constitutive U6 promoter, in noninfected mouse via tail vein and monitored miR-122 levels in its liver until 7 days postinjection. [score:3]
Exogenous Expression of miR-122 Can Rescue Serum Cholesterol and Clear Hepatic Parasite Load. [score:3]
Overexpressing miR-122 in infected liver tissue showed appreciable clearance of hepatic parasite burden with a recovery of serum cholesterol. [score:3]
With human hepatic cells, we have shown that leishmanial metalloprotease gp63 targets DICER1 in human hepatic cells to reduce miR-122 activity. [score:3]
Exogenous Expression of miR-122 and Dicer in Mouse Liver. [score:3]
In order to ascertain the importance of direct interaction between Huh7 and Leishmania for impairment of miR-122 activity in hepatocytes, we used isolated amastigotes or transformed promastigotes of L.  donovani to test their effect, if any, on miR-122 activity in human hepatoma cells. [score:2]
Therefore, L.  donovani infection reduces liver miR-122 to control the serum cholesterol level. [score:1]
Accumulation of Pre-miR-122 and Failed miRNP-122 Formation Accounts for the Reduced miR-122 Activity in L.  donovani-Treated Huh7 CellsInterestingly, unlike the mature form, the pre-miR-122 increased in both parasite-infected mouse livers and L.  donovani -treated Huh7. [score:1]
From the above experiments it was evident that the parasite itself is the probable candidate to cause the effect on hepatic miR-122. [score:1]
We documented an increase in miR-122 level with a concomitant elevation in serum cholesterol (Figures 3F and 3G). [score:1]
This observation further supports the existence of a balance of liver miR-122 and serum cholesterol that get influenced and exploited by Leishmania parasites in infected mammals. [score:1]
We have also found that restoration of miR-122 induces revival of serum cholesterol and reduction in liver parasite count. [score:1]
There was essentially no change in miR-122 activity when Huh7 and PBMC were cultured in the absence of the parasite (data not shown). [score:1]
Conversely, restoration of miR-122 or Dicer1 levels in VL mouse liver increased serum cholesterol and reduced liver parasite burden. [score:1]
In cell extract treated with gp63, we also found reduced association of AGO2 with full-length DICER1, resulting in decreased pre-miR-122 processing (Figure 5J). [score:1]
The miR-122 level was increased and was at a maximum after 3 days, whereas the serum cholesterol level started to show changes at 3 days and reached a maximum at 5 days p. i. (Figure 3D). [score:1]
Leishmania Glycoprotein gp63 Is Responsible for Reversal of miR-122-Mediated Repression in Huh7 Leishmania exosomes, the secretory vesicles released by the parasite, have been documented previously as the carrier of the virulence factors for cellular communication. [score:1]
Levels of miR-122 in the total RNA isolated from the livers of normal and infected animals were determined. [score:1]
The pre-miR-122 also increased 2.5-fold in Huh7 cells after its interaction with L.  donovani (Figure 5B). [score:1]
Therefore, it is an interesting possibility that parasite infection controls liver miR-122 in order to modulate serum cholesterol. [score:1]
miR-122 comprises more than 70% of the liver miRNA pool and is largely responsible for liver homeostasis and lipid metabolism (Chang et al., 2004; Girard et al., 2008). [score:1]
Overall, the present study deals with an interesting connection between altered lipid metabolism during L.  donovani infection and liver miR-122 levels. [score:1]
L.  donovani Interacts with Human Hepatocytes and Impairs miRNA-Mediated RepressionThe in vivo experiments described above confirmed the lowering of miR-122 in L.  donovani-infected mouse liver. [score:1]
Animals manipulated to have excess miR-122 levels in their livers showed resistance to L.  donovani infection (Figures S2B–S2E). [score:1]
A similar decrease in the miR-122 level was also observed in animals infected with L. donovani amastigotes (Figure S2A). [score:1]
The supernatant could not show any effect on miR-122 activity in Huh7 cells (Figure 4F), but supernatant of the Leishmania culture grown at 37°C, the temperature the parasite encounters in mammalian hosts, can reduce miR-122 activity in Huh7 cells (Figure 4F). [score:1]
Thus, Leishmania-free culture media at 37°C should contain a factor(s) that can mediate the anti-miR-122 activity in hepatocytes. [score:1]
Exosomes secreted by the infective parasites caused reduction in miR-122 activity in hepatic cells. [score:1]
Therefore, we may expect reduced miR-122 activity in L.  donovani-infected livers. [score:1]
Hence, we speculate that the exosomes released by the parasites grown at 37°C may contain the key component(s) required for the lowering of miR-122 activity in Huh7 cells. [score:1]
Huh7 cells were transfected with a Renilla luciferase reporter either with no miRNA binding sites (RL-con) or with three imperfect miR-122 binding sites (RL-3xbulge-miR-122; Figure 4A) to assess the miR-122 activity in Huh7 cells before and after interaction with L.  donovani. [score:1]
Real-time quantification of pre-miR-122 confirmed accumulation of the precursor form with progressive infection, which augmented to 3-fold higher than its normal level at 60 days p. i. (Figure 5A). [score:1]
Accumulation of Pre-miR-122 and Failed miRNP-122 Formation Accounts for the Reduced miR-122 Activity in L.  donovani-Treated Huh7 Cells. [score:1]
Interestingly, unlike the mature form, the pre-miR-122 increased in both parasite-infected mouse livers and L.  donovani -treated Huh7. [score:1]
Leishmania Infection Reduces miR-122 Levels in Mouse Liver. [score:1]
When the AGO2 protein was immunoprecipitated from normal and infected Huh7 cell lysates, we documented a 6-fold reduction of miR-122 association with immunoprecipitated AGO2 in L.  donovani -treated Huh7 (Figure 5C). [score:1]
Antisense oligonucleotides against miR-122 confirmed its role in fatty acid and cholesterol metabolism (Elmén et al., 2008; Esau et al., 2006). [score:1]
Animals weighing 20–25 g were used and sacrificed at 1, 3, 5, and 7 days postinjection to determine liver miR-122 levels. [score:1]
Connection between miR-122 and lipid metabolism is well documented in mammals (Girard et al., 2008). [score:1]
For a fixed number of Huh7 cells, with an increase in PBMC-to-parasite ratio, there was a moderate change in miR-122 -mediated repression in Huh7 cells (Figure 4C). [score:1]
It was probed with 5′ end [32]P-labeled oligonucleotide probes against hsa-miR-122 at 37°C for 16 hr in a hybridization oven. [score:1]
The results were normalized against 18S ribosomal RNA (rRNA) for mRNAs and against β-actin for pre-miR-122. [score:1]
The in vivo experiments described above confirmed the lowering of miR-122 in L.  donovani-infected mouse liver. [score:1]
From the previous experiments it was evident that AGO2 failed to get loaded with miR-122 and form active miRNP in L.  donovani-exposed hepatic cells. [score:1]
Interestingly, a substantial decrease in miR-122 activity was noted in cells receiving gp63-containing liposomes (Figure 6C). [score:1]
It is possible that a host secretory factor, probably a pro- or anti-inflammatory cytokine, secreted by the infected macrophage/monocyte cells changes the hepatic microenvironment that leads to compromised miR-122 activity. [score:1]
Overall, these experiments suggest that gp63 glycoprotein, a Leishmania exosomal component, is responsible for the anti-miR122 activity observed in Huh7 cells. [score:1]
Leishmania Glycoprotein gp63 Is Responsible for Reversal of miR-122-Mediated Repression in Huh7. [score:1]
[1 to 20 of 83 sentences]
13
[+] score: 206
In the current study, BBR-treatment inhibited HNF4α mRNA and protein expression and reduced expression of miR122 and this was associated with reduction in gluconeogenesis and lipogenesis gene and protein expression in T2D mice and in PA-incubated HepG2 cells. [score:9]
In addition, treatment of cells expressing HNF-4α with miR122 inhibitor attenuated the increased mRNA and protein expression of SREBP-1, FAS, ACCα and increased mRNA and protein expression of CPT-1 and pACCα similar to that of BBR (Fig 5A, 5D, 5E, 5F and 5G). [score:9]
We show that BBR acts on the HNF-4α regulated miR122 pathway to inhibit gluconeogenic targets and key lipid biosynthesis regulatory factors. [score:7]
Treatment of cells expressing HNF-4α with miR122 inhibitor attenuated the elevated mRNA and protein expression of PEPCK and G6Pase similar to that of BBR (Fig 5A, 5B and 5C). [score:7]
MiR-122 promotes lipogenesis directly through up-regulation of the expression of lipogenic genes, initially activating SREBP-1c, and subsequently FAS and ACC1 [35]. [score:6]
Interestingly, BBR treatment did not alter gene and protein expression of glucose and lipid metabolism enzymes in cells expressing miR122 with knockdown of HNF-4α. [score:6]
These data further indicate that the dual effect of BBR on hepatic glucose and lipid homeostasis is directly regulated through modulation of HNF-4α expression and not miR122. [score:5]
D. Expression of miR-122 in HepG2 cells in the absence (solid bar) presence (open bar) of miR-122 inhibitor. [score:5]
In addition, the HNF-4α mediated expression of hepatic gluconeogenic and lipid metabolism enzymes are directly regulated by miR122. [score:5]
HepG2 cells were incubated in the absence or presence of HNF-4α plasmid or HNF-4α plasmid plus 10 μM BBR or HNF-4α plasmid plus miR122 inhibitor and the expression of gluconeogenic and lipid metabolism enzymes examined (S3 Fig). [score:5]
HepG2 cells were incubated in the absence or presence of HNF-4α plasmid (HNF-4α(+)) or HNF-4α plasmid plus 10 μM BBR (BBR 10 μM) or HNF-4α plasmid plus miR122 inhibitor (miR122(-)) and the expression of gluconeogenic and lipid metabolism enzymes examined. [score:5]
Inhibition of miR-122 in a mouse mo del of diet -induced obesity resulted in decreased plasma cholesterol levels and reduced expression of several hepatic lipogenic genes [17]. [score:5]
MiR122 was shown to downregulate the expression of the Cpt1 gene as well as the rate of fatty acid β-oxidation [35]. [score:5]
To further explore key targets of the BBR -mediated improvement of gluconeogenesis and lipid metabolism in PA -treated HepG2 cells, HNF-4α mRNA and protein expression and miR122 levels were examined. [score:5]
0152097.g005 Fig 5 HepG2 cells were incubated in the absence or presence of HNF-4α plasmid (HNF-4α(+)) or HNF-4α plasmid plus 10 μM BBR (BBR 10 μM) or HNF-4α plasmid plus miR122 inhibitor (miR122(-)) and the expression of gluconeogenic and lipid metabolism enzymes examined. [score:5]
To further explore key targets of the BBR -mediated improvement of gluconeogenesis and lipid metabolism in DM animals, HNF-4α protein expression in liver and the serum and liver miR122 levels were examined. [score:5]
The effect of HNF-4α expression on hepatic gluconeogenesis and lipid metabolism were attenuated by miR122 inhibitor. [score:5]
To further explore the role of miR122 in the BBR -mediated effect on expression of gluconeogenic and lipid metabolism enzymes, HepG2 cells were incubated in the absence or presence of HNF-4α siRNA (HNF-4α(-)) or HNF-4α siRNA plus 10 uM BBR (BBR(10uM) or HNF-4α siRNA plus 10 uM BBR plus miR122 mimic (miR122(+)) and the expression of gluconeogenic and lipid metabolism enzymes examined. [score:5]
The BBR mediated of expression of hepatic gluconeogenesis and lipogenic genes is not regulated through miR122. [score:4]
Our data suggest that BBR exhibits a dual effect on maintenance of both glucose and lipid homeostasis through HNF-4α regulated miR-122 expression. [score:4]
miR-122 is a predominant microRNA in the liver and expression of miR122 was shown to be regulated by HNF4α through its binding to the miR122 promoter in both Huh7 cells and in mouse liver [15]. [score:4]
In addition, we suggest that the HNF-4α regulated miR122 pathway may be a key drug target for maintenance of glucose and lipid homeostasis in T2D. [score:4]
The data strongly support a beneficial role of BBR in improving glucose and lipid homeostasis and suggest that the HNF-4α regulated miR122 pathway is a potential therapeutic target for treatment of T2D with accompanying dyslipidemia. [score:4]
BBR regulates the expression of hepatic gluconeogenic and lipid metabolism genes through HNF-4α and miR122. [score:4]
After grown to 60%–70% confluence, cells were incubated in the absence or presence of 0.3 mM PA or 0.3 mM PA with 10 μM BBR dissolved in DMEM (2ml/well) for 24 h. In some experiments, HepG2 cells were cultured with HNF-4α plasmid or HNF4α siRNA or HNF-4α plasmid combined with 50 nM of miR-122 inhibitor or miR-122 mimic transfected with Lipofectamine 2000 and incubated for 6 h, then treated plus or minus 10 μM BBR for a further 24 h. Cell medium was then collected and the cells washed with PBS. [score:3]
In the present study, we examined expression of miR122, HNF-4α, and key gluconoegenesis and lipid metabolism enzymes in the liver of type 2 diabetic mice and in palmitate-incubated HepG2 cells after BBR treatment. [score:3]
0152097.g006 Fig 6 HepG2 cells were incubated in the absence or presence of HNF-4α siRNA (HNF-4α(-)) or HNF-4α siRNA plus 10 μM BBR (BBR 10 μM) or HNF-4α siRNA plus miR122 plasmid (miR122(+)) and the expression of gluconeogenic and lipid metabolism enzymes examined. [score:3]
These data suggested that the antidiabetic gluconeogenic and lipid metabolism effects of BBR may be related to its action on the expression of HNF-4α and miR122. [score:3]
HepG2 cells were incubated in the absence or presence of 0.3 mM PA or 0.3 mM PA with 10 μM BBR for 24 h and expression of G6Pase, PEPCK, SREBP-1, FAS-1, CPT-1, ACCα, pACCα, HNF-4α, β-actin and miR122 were determined as described in. [score:3]
F. Relative protein expression of serum and liver miR122. [score:3]
Expression of G6Pase, PEPCK, SREBP-1, FAS-1, CPT-1, ACCα, pACCα, HNF-4α, β-actin and miR122 were determined in Control, DM, LB and HB animals as described in. [score:3]
J. miR-122 expression in HepG2 cells. [score:3]
In addition, the expression level of miR122 was elevated in ob/ob mice [36]. [score:3]
The above data indicated that BBR treatment attenuated the increased expression of HNF-4α and miR122 in liver of DM animals. [score:3]
Thus, miR-122 may play a role in the accumulation of hepatic triglycerides by promoting lipogenesis and inhibiting fatty acid β-oxidation [35, 37]. [score:3]
0152097.g003 Fig 3Expression of G6Pase, PEPCK, SREBP-1, FAS-1, CPT-1, ACCα, pACCα, HNF-4α, β-actin and miR122 were determined in Control, DM, LB and HB animals as described in. [score:3]
Thus, the alterations in expression of gluconeogenic and lipid metabolism enzymes and changes in the level of hepatic HNF-4α and miR122 observed in DM mice were similar to that observed in HepG2 cells treated with PA. [score:3]
0152097.g004 Fig 4HepG2 cells were incubated in the absence or presence of 0.3 mM PA or 0.3 mM PA with 10 μM BBR for 24 h and expression of G6Pase, PEPCK, SREBP-1, FAS-1, CPT-1, ACCα, pACCα, HNF-4α, β-actin and miR122 were determined as described in. [score:3]
In contrast, miRNA122 mimic increased mRNA and protein expression of PEPCK, G6Pase, FAS-1 and SREBP-1 to levels greater than that of control cells. [score:3]
In contrast, miRNA122 mimic decreased CPT-1 mRNA and protein expression to below control levels. [score:3]
These data indicate that miR122 is a critical regulator in the downstream pathway of HNF-4α in the regulation of hepatic gluconeogenesis and lipid metabolism in HepG2 cells. [score:3]
BBR treatment attenuates the alteration in gluconeogenesis and lipid metabolism and expression of HNF-4α and miR122 in liver of DM animals. [score:3]
HepG2 cells were incubated in the absence or presence of HNF-4α siRNA (HNF-4α(-)) or HNF-4α siRNA plus 10 μM BBR (BBR 10 μM) or HNF-4α siRNA plus miR122 plasmid (miR122(+)) and the expression of gluconeogenic and lipid metabolism enzymes examined. [score:3]
BBR treatment attenuates the alteration in gluconeogenesis and lipid metabolism and expression of HNF-4α and miR122 in PA -treated HepG2 cells. [score:3]
The mechanism of the BBR -mediated regulation of gluconeogenic and lipid metabolism enzymes through HNF-4α and miR122 was examined. [score:2]
In addition, the effect of BBR on hepatic gluconeogenesis and lipid metabolism is mediated through HNF-4α and is regulated downstream of miR122. [score:2]
miR-122 plasmid, miR122 mimic, miR122, miR156a and U6 primers and miR-122 inhibitor were purchased from Ribobio (Guangzhou, China). [score:2]
In addition, activation of HNF-4α leads to the development of a gluconeogenesis and lipid metabolism disorder through miR122. [score:2]
Thus, miR122 may be one of the downstream factors of the HNF-4α pathway that regulate glucose and lipid homeostasis in liver. [score:2]
MiR-122 is a predominant microRNA in the liver and was shown to be regulated by HNF-4α in both Huh7 cells and in mouse liver [15]. [score:1]
In contrast, miRNA122 mimic increased mRNA and protein levels of ACCα and decreased the ratio of pACCα/ACCα. [score:1]
The relative expression levels were calculated as 2 [-[(Ct miR-122)–(Ct of miR-156a or U6)]]. [score:1]
Isolation of serum RNA and quantification of the miR-122 levels were performed as described previously [30, 31]. [score:1]
Mice with liver specific miR122 gene deletion exhibited reduced fatty acid and cholesterol levels [35]. [score:1]
The presence of BBR attenuated this elevation in miR122 in PA-incubated HepG2 cells. [score:1]
miR-122 quantification. [score:1]
In addition, BBR treatment attenuated the alteration of gluconeogenic and lipid metabolism enzymes and in HNF-4α and miR122 levels in DM mice and HepG2 cells treated with PA in a similar manner. [score:1]
[1 to 20 of 57 sentences]
14
[+] score: 171
To determine whether miR-122 inhibited apoptosis in the corneal keratocytes through CPEB1 downregulation, we treated the corneal keratocyte cell line with inflammatory cytokines and transfected a CPEB1 overexpression plasmid carrying either a wild-type (CPEB1-WT) or miR-122 -binding site-mutated (CPEB1-Mu) 3′-UTR. [score:8]
Although our results showed that miR-122 inhibited apoptosis in corneal stromal cells and significantly decreased the risk of corneal transplantation rejection by reducing the expression of its target CPEB1, whether miR-122 exerts its function only through CPEB1 and the pathways by which CPEB1 regulates corneal stromal cell apoptosis remain unknown. [score:8]
miR-122 overexpression significantly downregulated CPEB1 mRNA (Figure 2d) and protein (Figure 2e) expression compared with the control group. [score:7]
Our results revealed that the inhibition of miR-122 expression or increased CPEB1 expression in a corneal keratocyte cell line significantly increased apoptosis induced by inflammatory cytokines. [score:7]
To further confirm that miR-122 regulates CPEB1 expression, we performed real-time PCR and western blotting to compare CPEB1 expression in the corneal autograft and allograft groups. [score:6]
To validate CPEB1 as a target of miR-122, CPEB1 3′-untranslated regions (UTRs) with or without mutations in the miR-122 -binding site were inserted into the pmiR-RB-REPORT dual-luciferase reporter plasmid. [score:6]
We also confirmed that miR-122 suppressed corneal keratocyte apoptosis through downregulation of CPEB1. [score:6]
Our dual-luciferase reporter assay showed that miR-122 overexpression significantly downregulated the fluorescence of the reporter plasmid containing the wild-type CPEB1 3′-UTR but not the CPEB1 3′-UTR with mutations in the miR-122 -binding sites (Figure 2a). [score:6]
CPEB1, an important mediator of cell ageing and apoptosis, [18–20] was identified as the target gene of both miR-122 and miR-1a, two miRNAs that were downregulated in the allograft group. [score:6]
These results indicate that miR-122 inhibited apoptosis in corneal keratocytes through the downregulation of CPEB1. [score:6]
Our current study revealed that miR-122 expression was significantly downregulated during rejection after keratoplasty. [score:6]
Inhibition of miR-122 expression increased CPEB1 expression (Figure 4a) and promoted cytokine -induced apoptosis in the corneal keratocytes (Figure 4b) compared with the control group. [score:6]
miR-122 was highly expressed in the corneal stromal layer and was not expressed in immune cells. [score:5]
Our results revealed high expression of miRNA-122 in the corneal stromal cells but no expression in immune cells (Figure 3). [score:5]
To examine the effects of miR-122 on apoptosis in corneal keratocytes, we suppressed miR-122 expression using antagomir-122 and treated the cells with inflammatory cytokines. [score:5]
Further investigations demonstrated that miR-122 blocked apoptosis in corneal keratocytes and thus reduced the risk of immune rejection after keratoplasty through the downregulation of its target, cytoplasmic polyadenylation element -binding protein-1 (CPEB1). [score:4]
However, the downregulation of miR-122 may only be correlated with such rejection. [score:4]
Furthermore, local overexpression of miR-122 in the eye, which was accompanied by decreased expression of CPEB1, significantly increased the survival of the mouse grafts compared with the control group. [score:4]
miR-122 blocks apoptosis in a mouse corneal keratocyte cell line through the downregulation of CPEB1. [score:4]
To confirm the involvement of miR-122 in postoperative rejection in different cell types, we examined miR-122 expression in a variety of immune cells and three layers of mouse corneal tissue (the epithelial, stromal and endothelial layers). [score:3]
CPEB1 was a target of miR-122. [score:3]
40, 41 Total RNA was extracted using TRIzol lysis buffer (Invitrogen Life Technologies, Grand Island, NY, USA) from the following tissues and cells: (1) mouse corneal cells of the epithelial, stromal and endothelial layers; (2) corneas at 14 days after corneal transplantation with or without miR-122 overexpression (agomir-122, 20  μM; Guangzhou RiboBio Co. [score:3]
We also overexpressed miR-122 in the TKE2 mouse corneal epithelial cell line and measured CPEB1 expression using real-time PCR and western blotting. [score:3]
Increased miR-122 expression significantly reduces the risk of corneal transplantation rejection. [score:3]
Using miRNA expression profile analysis, this study showed that miR-122 is an important miRNA that was negatively correlated with corneal transplantation rejection. [score:3]
In addition, miR-122 exhibited the largest expression difference among all eight miRNAs identified. [score:3]
Similar results were obtained after miR-122 overexpression (Figure 5b). [score:3]
CPEB1 has been reported to be a target gene of miR-122 in skin fibroblasts. [score:3]
To investigate whether increased miR-122 expression can reduce corneal cell apoptosis and thus decrease the risk of corneal transplantation rejection, we established a mouse PKP mo del and treated mice with either the agomir negative control or agomir-122 (to increase the expression of miR-122). [score:3]
TKE2 (mouse corneal epithelial progenitor cell line) cells were transiently transfected with constructs containing wild-type or miR-122 -binding site-mutated 3′-UTR together with or without miR-122 overexpression using Lipofectamine LTX transfection reagent (Invitrogen, Grand Island, NY, USA). [score:3]
The significance of differences in CPEB1 and miR-122 expression, luciferase activity and apoptosis rate was determined by Student’s t-test. [score:3]
Expression of miR-122 is enriched in corneal stromal cells. [score:3]
Alternatively, miR-122 may directly regulate corneal transplantation rejection. [score:3]
miR-122 has important regulatory roles in physiological functions of the liver, including the growth cycle and lipid metabolism of hepatocytes. [score:2]
miR-122 is considered a liver-specific miRNA; [28–32] its expression level accounts for >70% of all miRNAs in the liver. [score:2]
[39] As CPEB1 has important roles in cell ageing and apoptosis, [18–20] we investigated whether miR-122 regulates corneal stromal cell apoptosis through the reduction of CPEB1 expression. [score:2]
Site-directed mutagenesis of the miR-122 -binding site was performed using the QuickChange kit (Stratagene, Santa Clara, CA, USA) according to the manufacturer’s instructions. [score:2]
Mouse full-length CPEB1 cDNA with a wild-type or miR-122 -binding site-mutated 3′-UTR was cloned into the pZSGreen lentiviral vector. [score:1]
U6 and GAPDH were used as the internal controls for miR-122 and CPEB1 detection, respectively. [score:1]
Alternatively, cells were transfected with a plasmid carrying CPEB1 cDNA with wild-type or miR-122 -binding site-mutated 3′-UTR. [score:1]
Nevertheless, our results indicate that miR-122 is closely associated with corneal transplantation rejection and may have important roles in this process. [score:1]
The microarray result for miR-122 (Figure 1d) was further validated by real-time PCR. [score:1]
Therefore, we next focused on corneal keratocytes to study the functions and mechanisms of miR-122 in corneal transplantation rejection. [score:1]
To elucidate the mechanism underlying the role of miR-122 in corneal transplantation rejection, we evaluated the expression of miR-122 in three types of corneal cells and four types of immune cells with or without stimulation. [score:1]
Therefore, miR-122 and CPEB1 were chosen for further study. [score:1]
miR-122 is an important miRNA associated with corneal transplantation rejection. [score:1]
To investigate the mechanism of miR-122 in corneal transplantation rejection, we first performed bioinformatics analyses and cross-predictions to identify CPEB1 as a miR-122 target in corneal cells. [score:1]
Therefore, the subsequent study focused on the effects of miR-122 on the biology of corneal keratocytes. [score:1]
The role of miR-122 in corneal cells has not been reported. [score:1]
[1 to 20 of 49 sentences]
15
[+] score: 157
Other miRNAs from this paper: mmu-mir-330
As illustrated in Fig.   6a, the miR-122 target genes ADAM10, PKM2, NOD2 and IGF1R were highly expressed in the cells of the RPPH1 overexpression mo del, whereas the expression of Bcl- w, VEGFC and NDRG3 had no significant changes. [score:9]
The level of miR-122 expression had an almost opposite trend with the level of RPPH1 expression in the four kinds of breast cancer cell lines, as well as in the RPPH1 overexpression and knockdown mo dels (Figs.   1a, 4b). [score:8]
The expression levels of the target genes of miR-122: a in the RPPH1 overexpression cell mo del (n = 3), b in the RPPH1 knockdown tumour xenografts (n = 4); * P < 0.05, ** P < 0.01 vs. [score:8]
Addition of miR-122 mimics to cells with overexpressed RPPH1: a inhibits cell proliferation, as shown by thes; b suppresses the cell cycle, as shown by flow cytometry and c decreases the capability of clone formation; n = 3, * P < 0.05, ** P < 0.01 vs. [score:7]
As shown in Fig.   4a, qPCR to detect the expression level of target microRNA in the 20 cases of breast cancer and the corresponding adjacent tissues showed that the expression of miR-122 was higher in cancer tissues than in the adjacent tissues. [score:7]
Moreover, the expression of miR-122 increased after RPPH1 knockdown and decreased after RPPH1 overexpression. [score:6]
control RPPH1 regulated breast cancer via miR-122Because the target gene of RPPH1 was discovered to be miR-122, we added miR-122 mimics into the RPPH1 overexpressed mo del to detect the biological functions of MCF-7 and MDA-MB-231 cells. [score:6]
b In the breast cancer cell lines and mo dels of RPPH1 overexpression and knockdown, the expression of miR-122 is opposite to that of RPPH1. [score:6]
Sercan Biyun Wang et al. [20] found that miR-122 took the crucial role of a tumour suppressor by targeting IGF1R and regulating the PI3K/Akt/mTOR/p70S6K pathway in breast cancer. [score:6]
a In the 20 paired clinical samples, miR-122 expression in cancer tissues is lower than that in adjacent tissues and the relativity expression rate between miR-122 and RPPH1. [score:5]
the RPPH1 group MiR-122, which has been reported to have a role in cancers, has diverse target genes; we chose seven of these to explore the downstream genes of miR-122 when RPPH1 was overexpressed in breast cancer cells. [score:5]
control Because the target gene of RPPH1 was discovered to be miR-122, we added miR-122 mimics into the RPPH1 overexpressed mo del to detect the biological functions of MCF-7 and MDA-MB-231 cells. [score:5]
control miR-122 is a target gene of lncRNA RPPH1Prediction of the possible target binding gene site of lncRNA RPPH1 using the online software microRNA. [score:5]
Overall, our results demonstrated that RPPH1 functions as a tumour promoter and plays an important role in advancing tumorigenesis by targeting miR-122 and may serve as a novel and potential therapeutic, diagnostic or prognostic target in breast cancer. [score:5]
Fig.  6qPCR of the expression of the miR-122 target genes. [score:5]
In the RPPH1 overexpression mo del, there was a target relationship between RPPH1 and miR-122, and some of the downstream genes of miR-122, including ADAM10, PKM2, NOD2 and IGF1R, were increased. [score:5]
Wang B Wang H Yang Z MiR-122 inhibits cell proliferation and tumorigenesis of breast cancer by targeting IGF1RPLoS ONE. [score:4]
Further study by addition of miR-122 mimics into the RPPH1 overexpression mo del showed that the biological function of RPPH1 in breast cancer was related to the regulation of miR-122 and that the cell biological functions, including proliferation, cell cycle and clone formation were changed to some extent. [score:4]
Breast cancer progression can be promoted by directly targeting miR-122 through lncRNA RPPH1. [score:4]
lncRNA RPPH1 miR-122 Breast cancer Targeted regulation Cell proliferation Breast cancer occurs in mammary epithelial tissues of malignant tumours and is one of the world’s three most commonly diagnosed cancers [1]. [score:4]
The possibility of miR-122 and RPPH1 target binding was predicted using an online software miRcode (http://www. [score:3]
Correlation analysis revealed a high value of R [2] = 0.8431, indicating that miR-122 may possibly be the target binding gene of RPPH1 in breast cancer. [score:3]
Another study demonstrated that miR-122 was strongly correlated with the clinical outcomes of breast cancer, including response to neoadjuvant chemotherapy and relapse with metastatic disease. [score:3]
These results indicated that lncRNA RPPH1 and miR-122 in MDA-MB-231 and MCF-7 cells had a targeting effect relationship (Fig.   4c). [score:3]
miR-122 is a target gene of lncRNA RPPH1. [score:3]
Based on the results of previous studies, we chose the miR-122 target genes ADAM10 [19], Bcl- w [22], VEGFC [23], PKM2 [24], NOD2 [25], IGF1R [20] and NDRG3 [26] to explore the downstream genes in breast cancer. [score:3]
showed that the proliferation of both cells was suppressed in the presence of the miR-122 mimics (Fig.   5a). [score:3]
org showed that RPPH1 had a target binding capacity with miR-122, which has complementary pairing of eight bases (Fig.   4c). [score:3]
Therefore, we identified miR-122 as a target gene of RPPH1. [score:3]
RPPH1 regulated breast cancer via miR-122. [score:2]
Clone formation assay showed that the miR-122 mimics inhibited the capacity for clone formation in the RPPH1 cell group (Fig.   5c). [score:2]
Ergun et al. [19] suggested that miR-122-5p was a potential regulator of ADAM10 and trastuzumab resistance. [score:2]
Dual-luciferase assay was used to detect a target relationship between RPPH1 and miR-122. [score:2]
Indeed, the dual-luciferase assay demonstrated that RPPH1 and miR-122 had a relationship of targeted binding. [score:2]
MCF-7 and MDA-MB-231 cells were co -transfected with the vectors and the miR-122 mimics or scramble control. [score:1]
In particular, higher circulating miR-122 levels estimated the occurrence of metastasis in stage II and III breast cancer cases [21]. [score:1]
In addition, we confirmed that RPPH1 and miR-122 interacted with each other. [score:1]
In this study, we focused on the potential effectiveness of miR-122 in breast cancer. [score:1]
MiR-122 regulated several genes in breast cancer cells. [score:1]
In addition, the miR-122 mimics reversed the cell cycle promoting ability of the RPPH1 plasmid (Fig.   5b). [score:1]
[1 to 20 of 40 sentences]
16
[+] score: 132
MiR-122 mimic or inhibitor was transfected to the primarily cultured mouse cardiomyocytes to up-regulate or down-regulate the expression of miR-122, respectively. [score:11]
This study found that miR-122 overexpression suppressed viability and promoted apoptosis of primarily cultured mouse cardiomyocytes, and miR-122 inhibitor had distinct effects. [score:7]
These findings suggest that miR-122 could regulate the expression of caspase-8. Figure 4Expression of caspase-8 in transfected mouse cardiomyocytes. [score:6]
These findings suggest that miR-122 could regulate the expression of caspase-8. Figure 4Expression of caspase-8 in transfected mouse cardiomyocytes. [score:6]
It was denoted that miR-122 overexpression remarkably induced cell apoptosis (P<0.01, Figure 3A and B), while miR-122 down-regulation significantly reduced cell apoptosis compared with NC (P<0.01), indicating that miR-122 might play an important role in inducing cardiomyocyte apoptosis. [score:5]
MiR-122 regulated expression of caspase-8. Expression of caspase-8 in transfected mouse cardiomyocytes. [score:5]
This study aimed to uncover the impact of miR-122 on cardiomyocyte apoptosis, help understand the role of miR-122 on cardiomyocyte apoptosis, and provide potential targets for treating myocardial infarction and other heart diseases. [score:5]
qRT-PCT showed that the mRNA level of caspase-8 was dramatically higher in cardiomyocytes transfected with miR-122 mimic (P<0.01, Figure 4A), and was obviously down-regulated in those transfected with miR-122 inhibitor, compared to NC (P<0.001). [score:5]
The pro-apoptotic function of miR-122 may be related to the regulation of caspase-8. With further detailed elucidation of mechanisms, miR-122 can be a promising molecular target for the therapeutics of myocardial infarction. [score:4]
Our data were partly consistent with this previous study, both the active caspase-8 and total caspase-8 were up-regulated by miR-122 in cardiomyocytes. [score:4]
We speculate that miR-122 may regulate the transcription or translation of caspase-8 via other factors in cardiomyocytes. [score:4]
For example, B-cell CLL/lymphoma 2 (BCL2) and BCL extra-long were down-regulated, while p53 was increased by miR-122 in hepatoblastoma cells (25). [score:4]
In this respect, the up-regulation of caspase-8 by miR-122 found in this study was in concordance with the apoptotic role of caspase-8. Moreover, caspase-8 can be activated by miR-122 in hepatoma carcinoma cells BEL-7402/5-FU (30), thus we inferred that caspase-8 may be related to the mechanism of miR-122 in cardiomyocyte apoptosis. [score:4]
Furthermore, tumor necrosis factor (TNF)-related apoptosis-inducing ligand expressing recombinant adenovirus regulated by miRNA response elements of miR-122 has shown an obvious advantage in accelerating apoptosis of breast cancer and esophageal cancer (23, 24). [score:4]
No evidence has been found to support the direct binding of caspase-8 mRNA by miR-122, thus it is reasonable to speculate that miR-122 influences the expression of caspase-8 via the mediation of other factors. [score:4]
MiR-122 stimulated the translation of hepatitis C virus RNA, and thus serves as a potential target for treating hepatitis C (13). [score:4]
To study the mechanism underlying the regulation of cardiomyocyte apoptosis by miR-122, the expression of caspase-8, which has been demonstrated to be the first step of the apoptosis executor caspase cascade (17), was analyzed. [score:4]
Both miR-122 mimic and inhibitor caused significant changes in the miR-122 level, which led to profound alteration in cardiomyocyte viability and apoptosis. [score:3]
Yu et al. (30), have indicated that the activation of caspase-8 can be promoted by miR-122, while the total caspase-8 level is suppressed in hepatocarcinoma cells. [score:3]
Transfection with NC did not significantly change miR-122 level compared to the Control group (Figure 1), but miR-122 mimic or inhibitor significantly elevated or knocked down miR-122 levels (P<0.01 and P<0.001), confirming the effective cell transfection. [score:3]
Suppression of cell viability by miR-122 has also been detected in HepG2 and other tumor cells (19, 20). [score:3]
In line with the above-mentioned evidence, our results also suggest the pro-apoptotic role of miR-122 in cardiomyocytes, and the opposite effects of miR-122 inhibitor. [score:3]
miR-122 also seemed to promote caspases-8 expression in cardiomyocytes. [score:3]
Mouse cardiomyocytes were transfected with miR-122 mimic, miR-122 inhibitor or the negative control (NC). [score:3]
Mouse cardiomyocytes were transfected with miR-122 mimic, miR-122 inhibitor or the negative control (NC), and flow cytometry was performed at 48-h post-transfection. [score:3]
In hepatocellular carcinoma, miR-122 can induce cell apoptosis to suppress tumor progression (14). [score:3]
miR-122 mimic (50 nM), miR-122 inhibitor (100 nM) or the scrambled sequence (100 nM), which served as negative control (NC) (RiboBio, China) were transfected to the cells in antibiotic- and serum-free medium using Lipofectamine 2000 (Invitrogen, USA), according to the manufacturer’s instructions. [score:3]
MiR-122 inhibited viability and promoted apoptosis of mouse cardiomyocytes. [score:2]
MTT assay indicated that the cardiomyocytes transfected with miR-122 mimic showed lower cell viability than those transfected with NC, with significant difference detected at 48 and 72 h post-transfection (P<0.05 or P<0.01, Figure 2), whereas miR-122 inhibitor significantly promoted cell viability at 24, 48 and 72 h post-transfection (P<0.05). [score:2]
Multiple studies have documented that miR-122 can regulate hepatitis C and hepatocellular carcinoma. [score:2]
was performed at 48-h post-transfection to quantify miR-122. [score:1]
To explore the effect of miR-122 on apoptosis of cardiomyocytes, cell apoptosis was analyzed by flow cytometry. [score:1]
The relationship between miR-122 and caspase-8 is intriguing. [score:1]
Levels of miR-122 in transfected mouse cardiomyocytes. [score:1]
qRT-PCR was performed at 48-h post-transfection to quantify miR-122. [score:1]
Previous findings have shown that miR-122 reduced viability but elevated apoptosis of hepatocellular carcinoma cells Huh-7 (18). [score:1]
MiR-122 has been reported to regulate various apoptotic factors in cell apoptosis. [score:1]
In summary, this study uncovered the promotive role of miR-122 in mouse cardiomyocyte apoptosis. [score:1]
Figure 1 Levels of miR-122 in transfected mouse cardiomyocytes. [score:1]
These results pointed out that miR-122 might decrease cell viability of mouse cardiomyocytes. [score:1]
[1 to 20 of 40 sentences]
17
[+] score: 130
Other miRNAs from this paper: mmu-mir-29b-1, mmu-mir-155, mmu-mir-29b-2
Next, to test the hypothesis that the monocyte inflammatory phenotype was due to the decrease in the miRNA-122 targeted HO-1 expression, we introduced HO-1 siRNA via electroporation to knockdown HO-1 expression in THP1 monocytes. [score:8]
We previously showed successful delivery of a miRNA inhibitor/mimic both in vivo and in vitro using an exosome -based delivery method 1. Using the same methodology and exploiting THP1 derived exosomes as delivery vehicles, we loaded a miRNA-122 inhibitor or control inhibitor into the THP1 derived exosomes and treated THP1 cells with these “therapeutic” exosomes for 12 h. After, we washed off the “therapeutic” exosomes and exosomes derived from ethanol -treated Huh7.5 cells (ethanol exosomes) were added, along with groups containing control exosomes, LPS, and electroporated miRNA-122 as a positive control, and other control conditions. [score:7]
To rule out the induction of endogenous expression of miRNA-122 in THP1 cells, we evaluated the expression level of pri-miRNA-122 and found pri-miRNA-122 expression exclusively in hepatocytes but not in monocytes, even after co-culture with exosomes from ethanol -treated hepatocytes (Fig. 5B). [score:5]
We previously showed that exosomes can be used as successful delivery vehicles for functional delivery of RNA interferences in vitro and in vivo 1. Using an optimized method for loading exosomes based on our previously optimized protocol, we loaded THP1 derived exosomes with miRNA-122 inhibitor and used them as vehicles to deliver miRNA-122 inhibitor to the naïve THP1 cells. [score:5]
The targeted delivery of miRNA-122 inhibitor to the monocytes can be a possible therapeutic approach to attenuate alcohol-related inflammatory response. [score:5]
Importantly, we observed a significant decrease in the level of HO-1 expression, a target of miRNA-122 31, after treatment with exosomes from alcohol -treated hepatocytes into THP1 cells (Fig. 5E). [score:5]
MiRNA-122 inhibitor or negative control for miRNA inhibitor (Ambion, Grand Island, NY) at final amount of 300 pmol were added to the exosome sample containing 1 μg/μl exosomal protein. [score:5]
This was demonstrated by decreased levels of TNFα production in THP-1 monocytes that received the “therapeutic” exosomes containing a miR-122 inhibitor prior to exposure to exosomes from ethanol -treated hepatocytes (p < 0.05) (Fig. 7F). [score:3]
We loaded exosomes with miRNA-122 inhibitor and used them as a therapy to attenuate miRNA-122 mediated immune stimulation in monocytes. [score:3]
To prove it was indeed the transferred miRNA-122 via the exosomes that induced pro-inflammatory cytokines, we conducted two independent “simulation experiments”, in which we overexpressed miRNA-122 in both THP1 cells and RAW macrophages. [score:3]
In addition to the well-documented alcohol and alcohol metabolites damages, immune modulation of exosomes through exosome -mediated transfer of miRNA-122 and suppression of the HO-1 pathway, could be an alternative mechanism of sensitization of monocytes/macrophages to LPS in AH. [score:3]
The exosomes were treated with one unit of RNase H to eliminate free-floating miRNA-122 inhibitor or negative control outside the exosomes and re-isolated using ExoQuick-TC™. [score:3]
s of both experiments revealed significantly increased pro-inflammatory cytokine production after miRNA-122 overexpression. [score:3]
Moreover, our data showed that horizontally transferred miRNA-122 is functionally active and could modify the function of monocytes through affecting the miRNA-122 target, HO-1, and augment monocytes inflammatory responses in the presence of LPS. [score:3]
In contrast to the fact that miRNA-122 is not normally expressed in T-cells, in cutaneous T cell lymphoma (CTCL) elevated levels of miRNA-122 were reported which were induced by p53 in response to chemotherapy. [score:3]
Our results showed that introducing miRNA-122 inhibitor “therapeutics” can attenuate the sensitization of THP1 cells to the LPS by exosomes from alcohol-exposed hepatocytes. [score:3]
Because exosome production is strongly increased in hepatocytes after ethanol administration, the blockage of functional effect of the miRNA-122 bearing exosomes could be a therapeutic target in AH. [score:3]
Loading miRNA-122 inhibitor into the exosomes and THP1 pretreatment. [score:3]
Pretreatment of monocytes with miRNA-122 inhibitor was able to prevent the pro-inflammatory induction activity of ethanol exosomes in THP1 monocytes. [score:3]
This mechanistic cross talk leads to sensitizing effects and augmented inflammatory responses in monocytes and can open up a whole new set of possibilities of therapeutic potential of miRNA-122 inhibitor as a preventive approach and treatment of alcoholic hepatitis. [score:3]
The present data provide, for the first time, the evidence of a specific mechanism through which hepatocytes communicate with monocytes by virtue of an active transfer of miRNA-122 into the target cells accomplished by exosomes. [score:3]
The observed increase in miRNA-122 expression in monocytes was a mere consequence of horizontal transfer of genetic material through exosomes, indicated by non-detectable levels of pri-miRNA-122 in human THP1 monocytes. [score:3]
These loaded exosomes were co-cultured with THP1 cells for 12 h. Afterwards, the THP1-derived loaded exosomes were washed off and exosomes derived from ethanol -treated Huh7.5 cells (ethanol exosomes) were added, along with groups containing control exosomes, LPS, direct electroporated miRNA-122 to the THP1 cells as a positive control, and other control conditions. [score:2]
Consistent with the human data, the relative expression levels of miRNA-122 in exosomes isolated from binge alcohol fed-mice (12 h) was significantly increased compared to saline-fed animals (p < 0.05) (Fig. 1D). [score:2]
The RAW 264.7 macrophages transfection of a miRNA-122 mimic using Lipofectamine, significantly decreased the expression level of HO-1 mRNA (p < 0.05) and increased TNFα protein level (p < 0.05), compared to the control group transfected with negative control miRNA (Fig. 7D,E). [score:2]
For direct introduction of miRNA-122 mimic (Ambion, Grand Island, NY) and HO-1 siRNA (Life Technologies) to the cells, THP1 cells were transfected by electroporation as follows: 2 × 10 [5] cells were re-suspended in 150 μl complete RPMI media and 150 μl Gene Pulser® electroporation buffer for 5 min on ice before being electroporated. [score:2]
Moreover, our results indicate that, in our in vitro setting, ethanol per se does not induce significant the pro-inflammatory profile and cytokine production in monocytes, but through its effect on enhancing number of exosomes in hepatocytes which harbor miRNA-122, indirectly induces the pro-inflammatory profile in monocytes. [score:2]
Given that miRNA-122 is reported to be a liver specific miRNA 26, we hypothesized that the source of exosomes that had elevated miRNA-122 were hepatocytes. [score:1]
Our results indicated that the mature form of miRNA-122, a liver-specific miRNA, was increased in the exosomes derived from ethanol -treated Huh7.5 cells and primary human hepatocytes (Fig. 3). [score:1]
These data are in accordance with a previous study from our group, where we found elevated levels of miRNA-122 in the circulating exosomes of mouse mo dels of alcoholic hepatitis (AH), drug (acetaminophen, APAP) -induced liver injury (DILI), and Toll-like receptor (TLR) 9 + 4 ligand -induced inflammatory cell -mediated liver injury 25. [score:1]
These results suggest the concept that exosomes derived from ethanol -treated hepatocytes horizontally transfer miRNA-122 to immune cells and modulate their function in pro-inflammatory cytokine production through affecting the HO-1 pathway. [score:1]
Although the present study is the first report suggesting a role of miRNA-122 in pro-inflammatory pathophysiology of alcoholic hepatitis, elevated levels of miRNA-122 and subsequent increase in type 1 IFN production have been reported in hepatitis B 45. [score:1]
Ethanol -treated Huh7.5 cell derived exosomes horizontally transfer mature form of miRNA-122 to the THP1 cells. [score:1]
As previously reported, miRNA-122 represents 70–80% of the total miRNA in hepatocytes 26. [score:1]
No changes in the number of exosomes or miRNA-122 content of exosomes were seen in the control individuals who received same volume of orange/strawberry juice at various time points (data not shown). [score:1]
How to cite this article: Momen-Heravi, F. et al. Exosomes derived from alcohol -treated hepatocytes horizontally transfer liver specific miRNA-122 and sensitize monocytes to LPS. [score:1]
After isolating exosomes from healthy human subjects following binge alcohol drinking, we found elevated levels of miRNA-122 as early as 4 h after alcohol consumption that may indicate liver damage associated with acute alcohol binge. [score:1]
Next, we asked whether these miRNA-122 harboring exosomes have downstream effects on monocytes. [score:1]
The pro-inflammatory effects of exosomes derived from ethanol -treated hepatocytes are prevented by exosome -mediated miRNA-122 RNAi delivery. [score:1]
We showed that exosomes derived from ethanol treated Huh7.5 cells transfer the mature form of miRNA-122 -liver specific miRNA- to THP1 cells, sensitizing them to LPS stimulus and inducing pro-inflammatory cytokines such as TNFα and IL-1β. [score:1]
First, by an activating effect on the exosome production machinery in hepatocytes indicated by increased number of miRNA-122 harboring exosomes and second, via miR-122 that can augment inflammation in immune cells. [score:1]
Next, we showed that exosomes can mediate successful horizontal transfer of their miRNA-122 cargo to the THP1 cells, indicated by a 5–8 fold increase in the level of the mature form of miRNA-122 in monocytes treated with exosomes derived from ethanol -treated Huh7.5 cells (Fig. 5A). [score:1]
Although Huh 7.5 cells treated with ethanol showed slight increase in miRNA-122 levels, exosomes derived from ethanol -treated Huh7.5 cells, showed significantly elevated levels of miRNA-122 (p < 0.05) (Fig. 3C,D). [score:1]
Altogether, our data showed the successful horizontal transfer of liver specific miRNA-122 after ethanol treatment via exosomes, which is functional and modifies THP1 responses to LPS through modulating the HO-1 pathway. [score:1]
This is in contrast to the pro-apoptotic activity of miRNA-122 in hepatocellular carcinoma and suggests that the role of miRNA-122 could be unique depending on the cell type. [score:1]
In this study we showed that the presence of horizontally transferred miRNA-122 hampered production of cytoprotective HO-1 in response to LPS in the monocytes. [score:1]
These in vitro findings were corroborated by observation of increased miRNA-122 levels in inflammatory cells, Kupffer cells and liver mononuclear cells, isolated from chronic alcohol-fed mice. [score:1]
The use of an in vitro mo del of treatment of THP1 monocytes with hepatocyte-derived exosomes allowed us to demonstrate that the transfer of miRNA-122 through exosomes resulted in functional effects as documented by increased sensitivity of THP1 monocytes to LPS, to induce drastically more pro-inflammatory cytokines. [score:1]
Exosomes derived from ethanol -treated hepatocytes transfer mature form of miRNA-122 to monocytes. [score:1]
To evaluate the therapeutic potential of our observations, we postulated that by introducing a miRNA-122 inhibitor to the recipient immune THP-1 cells, we can attenuate pro-inflammatory immune activation induced by exosomes derived from ethanol -treated hepatocytes (ethanol exosomes). [score:1]
This mimicked the sensitizing effect that we observed in the presence of exosomes derived from ethanol -treated hepatocytes, which abundantly harbor the mature form of miRNA-122. [score:1]
In monocytes, we found only a low copy number of baseline miRNA-122. [score:1]
E) Levels of Heme oxygenase 1(HO-1) mRNA, reciprocal target of miRNA-122, were measured in different experimental groups using quantitative real-time PCR. [score:1]
As shown in Fig. 7B,C, transfection of miRNA-122 mimic resulted in significantly higher protein levels of pro-inflammatory cytokines IL-1β and TNFα in the presence of LPS stimulation in THP1 monocytes (p < 0.05). [score:1]
Cells were seeded 1 day before treatment and different treatment conditions, and controls including miRNA-122 mimic, negative control mimic, miRNA-122 with Lipofectamine ® RNAiMAX, and miRNA-122 control mimic with, were applied for 48 hours. [score:1]
In T-cells, miRNA-122 was able to prevent apoptosis by stimulating the Akt kinase pathway 46. [score:1]
By treating THP1 monocytes with exosomes derived from ethanol -treated Huh7.5 cells, we showed that miRNA-122 which is indigenously almost absent in the monocytes, is horizontally transferred via exosomes from ethanol -treated hepatocytes to the THP1 human monocytes, and modifies their immune function (Supplementary Figure 1). [score:1]
Consistently, levels of miRNA-122 increased significantly after ethanol treatment, explaining the observed elevated levels of miRNA-122. [score:1]
For the introduction of miRNA-122 mimic to RAW macrophages, Lipofectamine® RNAiMAX (Life Technologies) was used based on manufacturer’s protocol for cell transfection. [score:1]
To further confirm that the introduction of miR-122 to THP1 cells can modulate HO-1 and sensitize the monocytes to the LPS, we designed “simulation experiments” and introduced miRNA-122 to human THP1 monocytes and RAW murine macrophages via electroporation and transfection reagents, respectively (Fig. 7A). [score:1]
Similar to Huh7.5 cells, the same profile of elevated levels of miRNA-122 and decreased levels of miRNA-29b were observed in exosomes derived from primary human hepatocytes after alcohol treatment (Fig. 3G,H). [score:1]
We have advanced the understanding of the role of transferred miRNA-122 and subsequent HO-1 pathway modulation by showing interplay between ethanol -treated Huh7.5 cells and THP1 human monocytes. [score:1]
[1 to 20 of 62 sentences]
18
[+] score: 109
Other miRNAs from this paper: mmu-mir-370
Surprisingly, miR-122 and miR-370 levels seem to be also modulated by maternal milk, since pups from control dams suckled by HFD-fed dams showed a decrease in miR-122 and increased expression of hepatic miR-370 as well as upregulation of TAG synthesis markers (Agpat and Gpam) and downregulation of a fatty oxidation marker (Acadvl). [score:9]
Offspring from HFD-fed dams present downregulation of hepatic β-oxidation-related genes and upregulation of genes involved in lipid synthesis, and these alterations seem to be driven by the modulation of miR-122 and miR-370 levels, causing metabolic adaptations that lead to increased ectopic lipid accumulation in the liver of recently weaned mice [25]. [score:7]
In this steatotic hepatocyte mo del, miR-122 expression was downregulated and, importantly, transfection with miR-122 mimic significantly reduced lipids within the hepatocytes [46]. [score:6]
Furthemore, maternal FFA at gestation correlated directly with miR-370 and inversely with miR-122 in the liver of newborns, thus reinforcing the hypothesis that maternal lipids that cross placental barrier are able to modulate miRNAs expression of offspring. [score:4]
Pups fostered to SC dams presented an increase in body weight and Agpat/ Gpam expression at d28 compared to pups fostered to HFD dams and an inverse correlation was observed between miR-122 hepatic expression and offspring serum TAG. [score:4]
Besides, Hsu and colleagues (2012) showed that knockout mice for miR-122 in liver present higher expression of several hepatic enzymes involved in TAG synthesis, including Agpat [56]. [score:4]
Besides, offspring from HFD-dam presents altered serum lipid levels [25] and here, offspring's serum TAG correlated directly with miR-370 and inversely with miR-122 hepatic expression. [score:4]
Interestingly, hepatic miR-122 expression was significantly reduced in CH (2.2-fold), HH (1.5-fold) and HC (2.1-fold) compared to CC, while mir-370 expression was significantly increased in CH (4.4-fold), HH (7.7-fold) and HC (8.9-fold) (Fig.   4i), corroborating the data showing that HFD feeding at gestational period leads to alterations in these miRNAs in offspring and also showing that excessive lipids consumption at lactation period can also lead to these miRNAs modulation. [score:4]
miR-122 is predicted to modulate lipogenic genes and to be potentially targeted by miR-370 which, in turn, can directly bind to carnitine palmitoyltransferase 1α (Cpt1a) gene [20, 21]. [score:4]
Interestingly, liver miR-122 expression in newborn offspring was inversely correlated with maternal serum TAG levels (p = 0.0016 - Fig.   3i). [score:3]
The treatment lead to a decreasing in miR-122 (among 13 to 39%) and an increasing in miR-370 levels (among 31 to 114%; Fig.   2a and b, respectively), indicating that excessive fat could alter the expression of these miRNAs in liver. [score:3]
Maternal HFD consumption in gestational or suckling periods independently alters miR-122 and miR-370 and lipid-related gene expression in the liver of recently weaned offspring. [score:3]
To test the hypothesis that fatty acids could modulate the expression of hepatic miR-122 and miR-370, we performed in vitro analysis in mouse (Hepa1c1c7) and human (HepG2) hepatoma cell lines treated with palmitate. [score:3]
Although the relationship between the levels of miR-122 and miR-370 is still subject to debate [14, 19], we showed that there is an inverse expression of these miRNA in our mo del at different ages. [score:3]
Different letters indicate statistical significance between groups (p ≤ 0.05) Importantly, the modulation of hepatic miRNAs by maternal HFD consumption at gestation and lactation also persists to adult life, since HH showed lower miR-122 (42%) and higher miR-370 (139%) expression in comparison to CC at d82 (Fig.   5i). [score:3]
Different letters indicate statistical significance between groups (p ≤ 0.05) Importantly, the modulation of hepatic miRNAs by maternal HFD consumption at gestation and lactation also persists to adult life, since HH showed lower miR-122 (42%) and higher miR-370 (139%) expression in comparison to CC at d82 (Fig.   5i). [score:3]
Pearson’s correlations were used to determine the relation between miR-122 expression and serum TAG or NEFA and a linear regression ± 95% confidence interval analysis were performed. [score:3]
The presence of fatty acids in maternal blood and milk seem to be responsible for modulating the expression of miR-122 and miR-370, which are involved in liver metabolism. [score:3]
Interestingly, adult offspring from HFD-fed dam still shows decreased miR-122 and increased miR-370 expression in the liver. [score:3]
using liver cell line showed that palmitate could induced decrease in miR-122 and increase in miR-370 expression. [score:3]
In a recent study, we showed that maternal HFD consumption during pregnancy and lactation leads to a decreased miR-122 and increased miR-370 expression in the liver of recently weaned mice [25]. [score:3]
Moreover, miR-122 expression in the liver of recently weaned offspring showed inversely correlation with serum TAG levels (Fig.   4j). [score:3]
The presence of fatty acids in maternal blood and milk seem to be responsible for modulating the expression of liver miR-122 and miR-370, which are involved in liver homeostasis. [score:3]
Moreover, maternal consumption of a HFD during gestation provoked a decrease in miR-122 (50%) and an increase in miR-370 (206%) expression (Fig.   3h). [score:3]
The relative expression of miR-122 and miR-370 (ID 002245 and ID 002275, respectively, Thermo Fisher Scientific) was determined using primers with a TaqMan detection system and U6 spliceosomal RNA (ID 001973, Thermo Fisher Scientific) as endogenous controls. [score:2]
Thus, the aim of the present study was to test the hypothesis that maternal high fat diet could directly modulate miR-122 and miR-370 expression and to investigate the independent contribution of pregnancy and lactation to the altered hepatic lipid metabolism observed in young offspring from obese dams. [score:2]
miR-122 and miR-370 participate in the regulation of hepatic lipid metabolism [20– 26]. [score:2]
However, although our previous results reports that miR-122 and miR-370 may participate in the genesis of metabolic damage associated to fatty liver [25], it is not possible to assign the role of gestational or lactational periods to the effects observed in offspring from obese dams and literature data concerning these phenomena are very controversial. [score:1]
Therefore we hypothesized that the lipids consumed by the dams, specially SFA, could be responsible for miR-122 and miR-370 modulation in the liver of offspring through placental delivery during gestation and/or milk composition during suckling period. [score:1]
In vitro hepatocytes treatment with palmitate alters miR-122 and miR-370 levels. [score:1]
Correlation analysis between hepatic miR-122 from d0 offspring vs. [score:1]
Body weight (a), lee index of obesity (LIO) (b), serum lipids (CHOL and TAG - c), fasting glucose (d) and serum insulin (e), mRNA levels (qRT-PCR) of hepatic Cpt1a and Acadvl (f), and Agpat and Gpam (g), microRNA level (qRT-PCR) of hepatic miR-122 and miR-370 (h) from newborn offspring from C and H groups. [score:1]
Body weight (a), adiposity (b), caloric intake (c), fasting glucose (d) and serum lipids (CHOL and TAG - e), mRNA levels (qRT-PCR) of hepatic Cpt1a and Acadvl (f), and Agpat and Gpam (g), hepatic total lipid content (h), microRNA level (qRT-PCR) of hepatic miR-122 and miR-370 (i), correlation analysis between hepatic miR-122 and serum TAG (j) from recently weaned unfostered offspring (CC and HH) and crossfostered offspring (CH and HC) at d28. [score:1]
As we have speculated, miR-122 and miR-370 may be involved in the impairments of lipid homeostasis of newborns from HFD-fed dams, since we find here that these miRNAs are modulated at d0, as early as the hepatic enzymes involved in lipid metabolism. [score:1]
MicroRNA level (qRT-PCR) - miR-122 and miR-370 - from Hepa1c1c7 mouse hepatoma cell line (1x10 [8]cells/mL) (a) and HepG2 human hepatoma cell line (1x10 [8]cells/mL) (b) 6hs after exposure to palmitic acid (500uM). [score:1]
Body weight (a), adiposity (b), caloric intake (c), fasting glucose (d), mRNA levels (qRT-PCR) of hepatic Cpt1a and Acadvl (e) and Agpat and Gpam (f), serum lipids (CHOL and TAG - g), total hepatic lipid content (h), microRNA level (qRT-PCR) of hepatic miR-122 and miR-370 (i) from adult offspring from CC and HH groups at d82. [score:1]
Here we evaluated whether maternal HFD consumption during gestation and lactation could differently affect liver miR-122 and miR-370 expression leading to metabolic damages observed in offspring. [score:1]
Newborn pups (d0) from obese dams showed a decrease in lipid oxidation markers (Cpt1a and Acadvl), an increase in triacylglycerol synthesis markers (Agpat and Gpam), as well as lower miR-122 and higher miR-370 hepatic content that was inversely correlated to maternal serum NEFA and TAG. [score:1]
As shown in the present study, treatment with palmitic acid, one of the most abundant SFAs in the human diet and blood, leads to a decrease in miR-122 and increased miR-370 levels in hepatocytes. [score:1]
[1 to 20 of 39 sentences]
19
[+] score: 98
Other miRNAs from this paper: mmu-mir-142a, mmu-mir-142b
Nevertheless, although E1A production in mir-122 -positive Huh7 cells in vitro was decreased only about 95% following introduction of 4 mir-122 -binding into the E1A-luciferase reporter virus, in vivo luciferase imaging suggested a greater suppression of E1A expression by mir-122, showing a 50-fold differential after 6 h that rose to 80-fold after 96 h. This may reflect a higher expression of mir-122 in murine hepatocytes in vivo than in human Huh7 cells. [score:7]
In order to confirm that this differential in luciferase expression was due to mir-122 knockdown of E1A, a precursor RNA mimic of mir-122 (Ambion) was introduced into A549 cells to simulate hepatocyte expression. [score:6]
The microRNA insertion into the 3′ UTR did not affect the profile of luciferase expression in these cells, suggesting the modification did not influence the stability of mRNA encoding the E1A-luciferase fusion protein, nor did it inhibit virus replication in these mir-122 -negative cells. [score:5]
However, given that our microRNA target sites are precisely complementary to mir-122 it is likely that argonaut 2 -mediated RNA cleavage is responsible for the majority of the knockdown observed. [score:4]
Mir-122 is highly and selectively expressed in hepatocytes [10], [15], and this modification might prevent expression of E1A within hepatocytes, thereby reducing adenovirus replication and hepatotoxicity whilst maintaining its therapeutic replication within tumour cells. [score:4]
To assess the in vivo activity of these viruses and to observe the effects of time on E1A expression over 96 h, 5×10 [10] vp of Ad5-E1A-Luc and Ad5-E1A-Luc-mir122 were injected intravenously into Balb/C mice. [score:3]
This novel virus (including a modified version containing 4 mir-122 binding sites in the E1A 3′ UTR) produced strong luciferase activity in vitro and in vivo that reported E1A protein levels clearly, enabling non-invasive real-time assessment of protein translation including the effects of virus genome replication. [score:3]
In this study we have explored the use of this approach in engineering a microRNA-controlled wild-type adenovirus, a DNA virus, by expressing binding sites for microRNA mir-122 within the 3′ UTR of E1A. [score:3]
Ad-E1A-Luc-mir122 and either the mir122 pre-cursor, or negative control pre-mir (Ambion) were added to cells and luciferase readings performed after 24 h. showed that the introduction of the pre-mir122 reduced luciferase, and therefore E1A, expression from 9.2×10 [4] RLU (negative control pre-mir) to 3.4×10 [3] RLU (P = 0.0001, Figure 4B). [score:3]
This vector was then further modified to contain four binding sites to mir-122 to allow in vivo imaging of E1A expression (Figure 1). [score:3]
To ascertain whether the microRNA insertion would also be inactive in mir-122- negative cells in vivo, viruses (1×10 [10] v. p. ) were injected subcutaneously in Balb/C mice (n = 3) and animals were imaged after 24 h. demonstrated no significant difference between the expression from the two viruses (data not shown) suggesting no effects of the microRNA at the subcutaneous site. [score:3]
In contrast, Ad5-E1A-Luc-mir122 virus showed significantly less luciferase expression at all time points, reaching only 6.3×10 [4] RLU/µg after 72 h (P = 0.0001 for both 48 and 72 h). [score:3]
For imaging expression of E1A encoded within replication-competent Ad5, E1A-luciferase reporter viruses with and without 4 binding sites for mir122 (Ad5-E1A-luc and Ad5-E1A-luc-mir122) were injected intravenously to Balb/c mice (5×10 [10] v. p. /mouse). [score:3]
Mice were treated with PBS, non-replicating E1, E3- deleted Ad5 expressing GFP (Ad5-GFP), wild-type Ad5, or wild-type Ad5 modified to contain 4 mir-122 binding sites, as indicated. [score:3]
Also of note is the ability of mir-122 in mouse liver to tightly regulate the very high levels of E1A-luciferase fusion protein achieved following hydrodynamic plasmid delivery (Figure 3), some 10-fold higher than those shown by the viruses. [score:2]
The differential in luciferase expression between the viruses with and without microRNA binding sites increased over time, suggesting decreased genome replication of Ad5-E1A-Luc-mir122 compared to Ad5-E1A-Luc. [score:2]
This suggests that the doses of virus used in this study do not even come close to exceeding the regulatory capacity of mir-122. [score:2]
When even higher virus doses were applied, the maximum tolerated dose of Ad5-mir122 was estimated at between 6×10 [10] and 1.2e10 [11]v. p/mouse (9×10 [9]–1.8×10 [10] pfu), and such doses presumably allow the virus to break through regulation by hepatic mir-122. [score:2]
Evaluation of potency of mir-122 regulation in vivo Luciferase expression from the microRNA-controlled plasmids shown in Figure 1 was assessed in murine livers in vivo, using an Ivis100 imaging system. [score:2]
After 6 h, Ad-E1A-Luc showed a luminescence signal of 1.6×10 [8] RLU whilst Ad-E1A-Luc-mir122 showed only 3.0×10 [6], a differential of 52-fold. [score:1]
In order to assess the effects on hepatic toxicity of including mir-122 binding sites within wild-type adenovirus, 5×10 [10] v. p of Ad5WT and Ad5-mir122 were injected intravenously to Balb/C mice. [score:1]
To generate full size adenovirus genome Ad5-BstZ17I-E1ALuc-mir122 and Ad5-BstZ17I-E1ALuc were cleaved with BstZ17I, dephosphorylated and subject to homologous recombination with full size wild-type Ad5 vector (a kind gift from Dr Peter Searle) and selected on kanamycin. [score:1]
The superior performance of the virus reported here may reflect the presence of four microRNA binding sites (rather than three) in the 3′ UTR although it is also possible that Huh7 cells have insufficient mir-122 to achieve the level of virus control seen in primary hepatocytes. [score:1]
Luciferase reporter plasmids sensitive to mir-122 were prepared by introducing concatamers of binding sites for mir-122 (4 or 8 sense or 4 antisense binding sites) into the 3′UTR of the luciferase transcription cassette. [score:1]
To generate full size adenovirus genome Ad5-BstZ17I-mir122 was cleaved with BstZ17I, dephosphorylated and subject to homologous recombination with full size wild-type Ad5 ampicillin resistant vector (a kind gift from Dr Peter Searle) and selected on kanamycin. [score:1]
pCIK-Lux (referred to as pCMV-Luc) was cleaved with Not1 and concatamers of mir-122 binding sites (4 or 8 sense, or 4 antisense; the sequence of the 4 sense insert is shown at the top of the figure) inserted into the luciferase 3′UTR. [score:1]
The 4 microRNA binding sites for mir122 were PCR amplified from pCMV-Luc-mir (described above) to introduce Dra1 sites to each end. [score:1]
For example, introduction of binding sites for mir122 into the Hepatitis A, B or Hepatitis E genome should prevent replication in hepatocytes and abrogate the main viral toxicity, whilst maintaining infection and possible replication at other cellular sites. [score:1]
Pre-mir122 (Ambion) and pre-mir negative control (Ambion) were re-suspended to 50 µM and then further diluted 10 fold. [score:1]
In this study we explored the possibility of achieving this using a DNA virus, wild-type Ad5, engineered to avoid its major toxicity in murine liver by including four binding sites for hepatocyte-specific mir-122 within the 3′UTR of E1A. [score:1]
Adenoviruses containing E1A-luciferase fusion constructs on a background of wild-type Ad5 (Figure 4(iii) and 4(iv)) were used to infect mir-122 -negative A549 and OVCAR-3 cell lines in vitro. [score:1]
1000440.g001 Figure 1 pCIK-Lux (referred to as pCMV-Luc) was cleaved with Not1 and concatamers of mir-122 binding sites (4 or 8 sense, or 4 antisense; the sequence of the 4 sense insert is shown at the top of the figure) inserted into the luciferase 3′UTR. [score:1]
18 h later, 30 pmol/well of pre-cursor mir122 and negative control pre-cursor microRNAs were added to each well in addition to the 500 µl described above. [score:1]
Mir-122 binding sites do not affect adenovirus activity in mir-122–negative cells in vitro and in vivo Adenoviruses containing E1A-luciferase fusion constructs on a background of wild-type Ad5 (Figure 4(iii) and 4(iv)) were used to infect mir-122 -negative A549 and OVCAR-3 cell lines in vitro. [score:1]
Luciferase activity from both Ad-E1A-Luc (containing no mir-122 binding sites) and Ad-E1A-Luc-mir122 (containing 4 mir122 binding sites) increased slowly between 8 and 24 h and then showed a more rapid rise that was sustained up to at least 72 h (Figure 4B and 4C). [score:1]
Immediately following transfection Ad-E1A-Luc-mir122 was added at 10 vp/cell in 450 µl DMEM media (10% FCS). [score:1]
Histological analysis showed a dramatic difference between animals administered wild-type Ad5 and those administered Ad5-mir122. [score:1]
Wild-type Ad5 induced vacuolation, haemorrhaging and abnormal nuclear morphology, while livers from mice administered Ad5-mir122 showed very little pathology, with some mice showing no aberrant morphology in any liver section (Figure 6C). [score:1]
After 24 h 0.5 µg of plasmid DNA (containing 0 (black), 4 (light grey) or 8 (white) sense mir-122 binding sites, or 4 antisense binding sites (dark grey)) was mixed with 2.5 ul DOTAP (Roche) reagent. [score:1]
Groups of four mice were administered intravenously 5×10 [10] virus particles of Ad5-E1A-Luc (left hand group of each pair of images) or Ad5-E1A-Luc-mir122 (right hand group of each pair) and luminescence was quantified using an Ivis100 imaging system after 6 h–96 h. The mouse on the right of all images is an untreated control, mock injected with luciferin for background levels. [score:1]
These products were subcloned using PshA1 and Hpa1 into a plasmid pAd5-Kpn1 (produced by restriction of wild-type Ad5, see below) to produce plasmids (pE1A-Luc and pE1ALuc-mir122) in which E1A was C-terminally fused to the luciferase coding sequence. [score:1]
18 h later, 30 pmol/well of pre-cursor mir122 and negative control precursor microRNAs were added to each well in addition to the 500 µl described above. [score:1]
Animals were found to tolerate higher levels of Ad-mir122 (6×10 [10] v. p., 9×10 [9] PFU) with only mild weight loss, although when this dose of Ad-mir122 was administered on two consecutive days, all mice were showing signs of virus-related toxicity by day 4 following the first injection. [score:1]
This produced vectors pCMV-Luc-mir (shown in Figure 1), pCMV-Luc-mir122X8 and pCMV-Luc-mir122anti, together with the control (hereafter referred to as pCMV-Luc) which contained no mir-122 binding sites. [score:1]
Mice administered Ad5-mir122 showed approximately 15-fold less serum ALT (5 times normal) demonstrating that less liver toxicity had occurred with this virus. [score:1]
In contrast, in mir-122 -positive HUH7 cells, luminescence was decreased from 7.9×10 [5] RLU/µg (anti-sense control plasmid) to 9.9×10 [4] RLU/µg (4 microRNA binding sites, P = 0.001)) and 3.4×10 [4] RLU/µg (8 microRNA binding sites, P = 0.001). [score:1]
MicroRNA binding sites decrease activity of Ad-E1A-luc-mir122 virus in mir122–positive cells in vitro and in vivo Adenoviruses encoding the E1A-luciferase protein with and without four microRNA binding sites were used to infect a monolayer of the mir122 positive cell line Huh7. [score:1]
MicroRNA binding sites decrease activity of Ad-E1A-luc-mir122 virus in mir122–positive cells in vitro and in vivo. [score:1]
1000440.g003 Figure 3(A) Imaging luminescence (8 h from mice administered pCMV-Luc not containing (left panel) and containing (right panel) four binding sites for mir-122 (plasmids pCMV-Luc and pCMV-Luc-mir in Figure 1). [score:1]
Mir-122 binding sites do not affect adenovirus activity in mir-122–negative cells in vitro and in vivo. [score:1]
These findings are consistent with those using the E1A-luciferase reporter viruses, and suggest that inclusion of the mir-122 -binding sites had a dramatic effect on hepatic activity and toxicity of the virus. [score:1]
Adenoviruses encoding the E1A-luciferase protein with and without four microRNA binding sites were used to infect a monolayer of the mir122 positive cell line Huh7. [score:1]
Histological images of liver from a mouse administered 5×10 [10] vp of a non-replicating adenoviral vector are presented for comparison, showing similar or slightly greater liver pathology than was induced by Ad5-mir122. [score:1]
Ad5-Kpn1-mir122 was reconstituted to Ad5-BstZ17I using the Kpn1 gel-extracted fragment from Ad5-BstZ17I. [score:1]
[1 to 20 of 54 sentences]
20
[+] score: 81
Whereas miR-122 interaction with the 3′ untranslated region (UTR) of various transcripts leads to gene repression, miR-122 binding to two target sites in the 5′-UTR of the HCV genome results in HCV -RNA genome stabilization and enhanced replication. [score:5]
Liver-enriched transcription factors regulate microRNA-122 that targets CUTL1 during liver development. [score:5]
Loss of miR-122 expression in liver cancer correlates with suppression of the hepatic phenotype and gain of metastatic properties. [score:5]
Furthermore, Vasilescu et al. revealed circulating miR-150 as a new prognostic marker of patients with sepsis and Wang et al. described prominent upregulation of serum miR-122 and miR-192 after acute hepatic intoxication by paracetamol in mice (Wang et al., 2009). [score:4]
Thus, miR-122 is highly expressed in hepatocytes, due to its liver-specific transcriptional regulation by hepatocyte nuclear transcription factors (HNF1α, HNF3β, and HNF4α) (Coulouarn et al., 2009; Xu et al., 2010). [score:4]
miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. [score:4]
Interestingly, Bala et al. found that after acute paracetamol intoxication of mice, miR-122 and miR-155 were predominantly associated in protein aggregates, whereas after alcoholic liver disease these two miRNAs were mainly found in the vesicular fraction (Bala et al., 2012). [score:3]
Interestingly, miR-122 is transcribed in a circadian fashion affecting gene expression pattern of a wide range of proteins (Gatfield et al., 2009). [score:3]
Integration of microRNA miR-122 in hepatic circadian gene expression. [score:3]
Thus, after non-alcoholic fat liver diseases (Cheung et al., 2008) as well as after chronic hepatitis C infection reduced hepatic miR-122 levels were observed (Sarasin-Filipowicz et al., 2009; Morita et al., 2011). [score:3]
Plasma microRNA-122 as a biomarker for viral-, alcohol-, and chemical-related hepatic diseases. [score:3]
Clinical significance and potential of hepatic microRNA-122 expression in hepatitis C. Liver Int. [score:3]
microRNA-122 stimulates translation of hepatitis C virus RNA. [score:3]
Although miR-122, miR-192, miR-21, and miR-34a are shown by most reports to be increased after experimental or human liver injury (Table 1), high variance and conflicting data exist about miRNA incidence in the blood stream upon different liver diseases. [score:3]
Hence, the liver-specific miR-122 may contribute to HCV liver tropism at the level of translation (Henke et al., 2008; Jopling, 2008). [score:3]
microRNA-122 as a regulator of mitochondrial metabolic gene network in hepatocellular carcinoma. [score:2]
Dysregulation of hepatic miR-122 after liver injury. [score:2]
Regulation of hepatitis C virus by microRNA-122. [score:2]
Liver-specific microRNA-122: biogenesis and function. [score:1]
The extracellular miR-122 levels in serum from patients with acetaminophen based acute liver injury were normalized using small nuclear (sn)U6 spliceosomal RNA which is so far the most commonly applied internal reference of circulating miRNA quantification (Table 1). [score:1]
In addition to miR-122 and miR-192, Zhou et al. identified miR-21, miR-223, miR-26a, miR-27a, and miR-801 in serum of patients with hepatocellular carcinoma (HCC) and proposed this miRNA panel as predictive markers of HCC. [score:1]
However, whereas miRNA is decreased in the injured liver, recent reports pointed to increased levels of circulating miR-122 in the blood stream after acute liver injury -induced by paracetamol intoxication of mice (Wang et al., 2009). [score:1]
Though snU6 RNA is proposed to be also released into the blood stream after cellular damage including liver parenchymal injury, this data interpretation may provide a primary impression of the role of miR-122 in human acute liver failure. [score:1]
However, Ji et al. found no change of miR-122 in 21 patients with HBV -induced acute-on-chronic liver failure, whereas miR-122 in patients with chronic HBV infection was even decreased in comparison to 12 healthy controls (Ji et al., 2011). [score:1]
Thus, Xu et al. identified increased levels of circulating miR-122 and mir-92a as putative markers of chronic HBV infection after normalisation to endogenous miR-181 values, whereas Ji et al. observed decreasing levels of both miRNA after normalisation using snU6 -RNA (Ji et al., 2011; Xu et al., 2011). [score:1]
Decreased levels of microRNA miR-122 in individuals with hepatitis C responding poorly to interferon therapy. [score:1]
Interestingly, circulating miR-122 levels are increased in serum samples before levels of transaminases (ALT) were elevated. [score:1]
Dedifferentiation of hepatocytes during hepatocellular carcinogenesis is associated with the loss of miR-122 (Coulouarn et al., 2009; Burchard et al., 2010; Negrini et al., 2011). [score:1]
In addition to the experiments on acutely intoxicated mice, first data are now available on human, showing high miR-122 levels after acute hepatitis in man (Starkey Lewis et al., 2011; Ding et al., 2012). [score:1]
In addition, during, both, acute and chronic liver damages in response to various noxa such as viral infection, drug or alcohol intoxication, or heriditary disorders, miR-122 is markedly decreased in the injured liver. [score:1]
miR-122, comprising approximately 70% of total miRNA in the healthy liver, takes part in liver-specific functions such as cholesterol metabolism (Esau et al., 2006; Jopling, 2012). [score:1]
Therefore, miR-122 might not only be released after hepatocellular damage and death (2), but also by other mechanisms e. g., inflammatory processes, not yet described (1). [score:1]
Although miR-122 quantification of 68 serum samples of chronic HCV -positive patients was not normalized, the findings of Bihrer et al. definitively demonstrate that miR-122 correlated with alanine aminotransferase (ALT) values indicating liver inflammatory activity (Bihrer et al., 2011). [score:1]
Endogenous miR-122 (red) and spiked RNA (gray) was quantified by Real Time PCR, demonstrating high stability of endogenous miR-122, but degradation of the added non-human RNA. [score:1]
Circulating microRNAs, miR-21, miR-122, and miR-223, in patients with hepatocellular carcinoma or chronic hepatitis. [score:1]
Circulating microRNA-122 as a potential biomarker for liver injury. [score:1]
Previous findings in mice after acute intoxication revealed that miR-122 increased markedly in serum samples before liver transaminases were raised (Wang et al., 2009; Zhang et al., 2010). [score:1]
Interestingly, Bala et al. pointed out that after acute paracetamol intoxication in mice, circulating miR-122 is not predominantly associated to vesicles, but to protein aggregates (Bala et al., 2012). [score:1]
Serum miR-122 as a biomarker of necroinflammation in patients with chronic hepatitis C virus infection. [score:1]
[1 to 20 of 39 sentences]
21
[+] score: 81
, we reasoned that in Mir122a [-/- ]livers, elevated expression of Klf6, a miR-122 target gene [32], is a simple response to the loss of miR-122a; nonetheless, elevated expression of Klf6 is likely to be the sum of a cascade of events involving the loss of miR-122a and the down regulation of 5 other DNmiRs (miR-17-5, -31, 19a, 93-5p and 144-3p). [score:8]
To date we have detected the expression of 79 experimentally-verified miR-122 targets, which represents only 8.9% (79/886) of the differentially expressed genes (DEGs) [32] in Mir122a [-/- ]livers. [score:7]
In addition, a group of 9 miRNAs was found to share miR-122 target genes, indicating synergy between miRNAs and target genes by way of multiplicity and cooperativity. [score:5]
It is worth mentioning that CTCF, an insulator-and chromatin loop -associated protein as well as an epigenetic regulator, is a direct target of miR-122 [33]. [score:5]
The V-shaped nodes correspond to the miRNAs, while the rectangle-shaped nodes are the target genes, the nodes marked by the blue border represent the co-miR-122 targets, and the octagonal nodes represent the transcription factors (TF). [score:5]
A group of 9 miRNAs was found to share miR-122 target genes, indicating synergy between miRNAs and target genes by way of multiplicity and cooperativity. [score:5]
The fact that many target genes of miR-122 are common to both mouse and human it is highly likely that EZH2, MYCBP, RBBP5, SIN3A, SIN3B, SIRT1, SRF and SUZ12 are mouse miR-122a target genes. [score:5]
This result suggests that miR-122 can potentially modulate the expression of 46 miRNAs via its target transcription factors. [score:5]
CTCF [33] is a miR-122 target gene found in the human HCC cell line, while Hif1a [34] is a recently confirmed miR-122a target in mouse hepatocytes. [score:5]
Ten of the 40 curated TFs, potentially regulating 46 miRNAs, are verified as miR-122 target genes. [score:4]
We identified 9 DEmiRs that can simultaneously regulate 39 miR-122 targets (Table S4.1, S4.2). [score:4]
MicroRNA-122 (miR-122) is a highly abundant, developmental-regulated, liver-specific miRNA. [score:3]
Moreover, we demonstrate that loss of imprinting at the chromosome 12qF1 region is associated with miRNA overexpression in human hepatocellular carcinoma and stem cells, suggesting initiation of precancerous changes in young mice deficient in miR-122. [score:3]
The expression ratio between the mir-122 [-/- ]and WT (KO/WT) is shown. [score:3]
Although the target relationship of miR-122 with EZH2, MYCBP, RBBP5, SIN3A, SIN3B, SIRT1, SRF and SUZ12 has not been studied in mouse liver but it has been identified in starBase with human samples. [score:3]
The octagonal nodes represent the transcription factors (TF) and the V-shaped nodes correspond to the miRNAs, while the nodes marked by the blue border represent the miR-122 targets. [score:3]
Remarkably, we demonstrate that loss of imprinting at 12qF1 is associated with miRNA overexpression in human HCC and stem cells, suggesting initiation of precancerous changes in young mice deficient in miR-122. [score:3]
A systematic, genome-wide investigation of the miRNA -mediated regulatory networks will provide important insights into the molecular mechanisms by which miR-122 modulates liver transcriptome and disease. [score:2]
How miR-122 influences epigenetic regulation of DEGs is not clear. [score:2]
Since miR-122 represents ~70% of the liver miRNAs, the imbalance of the miRNA homeostasis in Mir122a [-/- ]liver can give rise to liver damage. [score:1]
[1 to 20 of 20 sentences]
22
[+] score: 80
In contrast, when vectors containing the miR-122 target sequence were used, cells expressed little or no TetR-KRAB protein (Fig. 3f), and there was no change in GFP expression with or without doxycycline (Figs. 3c, e). [score:7]
These results therefore demonstrate well regulated transgene expression when miR-122 target sequences are included in the TetR-KRAB-encoding transcript. [score:6]
To analyse regulation of transgene expression, NR8383, 293T and Huh7 cells were transduced at a MOI of 10 with a lentiviral vector carrying either miR-142 or miR-122 target sequences. [score:6]
The targets were perfectly complementary to miR-122, which is specifically expressed in cells of hepatic lineage [17]. [score:5]
Four target sequences for miR-122 were absent (left panel) or present (right panel) in the TetR-KRAB -expressing cassettes of the vectors, which also produced GFP (green) constitutively. [score:5]
In Huh7 cells, as shown above, there was no variation in GFP expression when doxycycline was withdrawn after infection with miR-122 target sequence-containing vectors. [score:5]
GFP expression did not change during differentiation in cells transduced with the lentiviral vector carrying miR-122 target sequences. [score:5]
Muscle-specific miR-133, liver specific miR-122, or hematopoietic specific miR-142 target sequences were shown to work synergistically with the TetR-KRAB cassette and enable tissue-specific expression. [score:5]
In NR8383 cells there was a 70% decrease of GFP expression after doxycycline withdrawal when cells were transduced with miR-122 regulated vectors. [score:4]
We designed a regulatory cassette in which four copies of the miR-122 target sequence were inserted immediately downstream of the TetR-KRAB coding region. [score:4]
Lentiviral vectors encoding TetR-KRAB mRNA with four target sequences for miR-122 and GFP gene under the control of a liver specific promoter in 293T and Huh7 cells with or without doxycycline treatment. [score:3]
In Huh7 cells incubated in the absence of doxycycline, we observed a decrease in MFI when lentiviral constructs without the miR-122 target sequences were used (76 to 90%). [score:3]
0051952.g003 Figure 3(a) miR-122 expression levels in Huh7 and 293T cells detected by RT-qPCR. [score:3]
Differentiated or undifferentiated C2C12 cells were transduced at a MOI of 10 with miR-133-CMV-GFP regulated or miR-122-CMV-GFP regulated lentiviral vectors. [score:3]
We used Huh7 cells of hepatic origin, known to express miR-122, and 293T cells derived from human embryonic kidney, which do not produce miR-122 (Fig. 3a). [score:3]
In contrast, in Huh7 cells GFP mRNA levels were unaltered with lentiviral constructs carrying the miR-122 target sequences. [score:3]
0051952.g002 Figure 2(a) & (b) Lentiviral vector encoding four target sequences of miR-122, TetR-KRAB and GFP under the control of a mTTR liver specific promoter (a) or constitutively active CMV promoter (b). [score:3]
miR-122 concentrations and reporter gene expression in transduced cells. [score:3]
The first included a constitutively active promoter (PGK, phosphoglycerate kinase or CMV, cytomegalovirus) driving a TetR-KRAB sequence, which was linked to four tandem repeats of a target sequence designed to be perfectly complementary to miR-122 (TGG AGTGTGACAATGGTGTTTGTGT), miR-142.3p (TCCATAAAGTAGGAAACACTACA) and miR-133 (ACAGCTGGTTGAAGGGGACCAA). [score:3]
In 293T cells we observed a significant decrease in mean fluorescence intensity when doxycycline was withdrawn from cells that had been infected with vectors containing miR-142-mTTR GFP and miR-122-mTTR GFP cassettes. [score:1]
[1 to 20 of 20 sentences]
23
[+] score: 79
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
The expression levels of miR-183, miR-96, and miR-182 were most highly up-regulated, whereas miR-122, miR-503, and miR-139-3p exhibited the greatest down-regulation as a result of 17α-E2 treatment. [score:9]
The expression levels of miR-183 (4.61-fold), miR-96 (4.56-fold), and miR-182 (4.29-fold) were most highly up-regulated, whereas miR-122 (9.79-fold), miR-503 (5.88-fold), and miR-139-3p (1.94-fold) showed the greatest down-regulation as a result of 17α-E2 treatment. [score:9]
DEX treatment up-regulated the expression of miRNA-483, miRNA-181a-1, miRNA-490 and miRNA-181b-1, while it down-regulated the levels of miR-122, miR-466b, miR-200b, miR-877, miR-296, miRNA-27a and precursor of miR-504. [score:9]
qRT-PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats (Fig. 3 ). [score:7]
The levels of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377, and miRNA-96 were up-regulated, whereas miR-125b, miRNA-200b, miR-122, miRNA-466b, miR-138, miRNA-214, miRNA-503 and miRNA27a were down-regulated in response to 17α-E2 treatment. [score:7]
Real-time quantitative PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats. [score:7]
Using qRT-PCR, we confirmed the down-regulation of miRNA-200b, miR-122, miR-19a, miRNA-466b, and miRNA-27a expression (Fig. 3 ). [score:6]
In contrast, dexamethasone down-regulated the expression of several of the miRNAs by more than 1.5 fold, i. e., miR-122 (8.2-fold), miR-466b (2.31-fold), miR-200b (1.9-fold) miR-877 (1.61-fold), miR-296 (1.61-fold)and precursor of miR-504 (1.53-fold) (Fig. 2D ). [score:6]
miR-296 and miR-122 were down-regulated (>1.5 fold) by both 17α-E2 and DEX. [score:4]
The expression levels of miRNA-122 and miRNA-96, however, were not affected by cAMP stimulation. [score:3]
We next evaluated the effects of Bt [2]cAMP stimulation of rat ovarian granulosa cells and of mouse MLTC-1 Leydig tumor cells on the expression of twelve miRNAs (miRNA-212, miRNA-122, miRNA-183, miRNA-200b, miRNA-466b, miRNA-182, miRNA-96, miRNA-27a, miRNA-132, miRNA-214, miRNA-138 and miRNA-19a) whose adrenal expression was differentially altered in response to treatment of rats with ACTH, 17α-E2 or DEX. [score:3]
More specifically, we assessed the impact of Bt [2]cAMP treatment on the expression of miRNA-212, miRNA-122, miRNA-27a, miRNA-466b, miRNA-200b, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96 and miRNA-19a. [score:3]
The levels of expression of miRNA-212, miRNA-122, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96, miRNA-466b, miRNA-200b, and miRNA-19a are shown. [score:3]
Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
Dexamethasone treatment decreased miRNA-200b, miR-122, miR-19a, miRNA-466b and miRNA27a levels, but increased miRNA-183 levels. [score:1]
0078040.g003 Figure 3Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
[1 to 20 of 16 sentences]
24
[+] score: 78
Moreover, primary MEFs (Figure 2D) that we isolated from PKR knockout mice could support only low levels of HCV replication in the presence of miR-122, and primary PKR knockout hepatocytes did not support detectable HCV replication at all (Figure 2E and 2F), despite efficient RNA transfection (based on luciferase expression 2 and 4 hours post-transfection) by both electroporation (Figure 2E) and transfection (Figure 2F). [score:5]
If the EMCV IRES drives translation more strongly than the HCV IRES in mouse cells, then it may lead to more efficient expression of the viral non-structural proteins required for replication and this may overcome a host species barrier in the presence of miR-122. [score:5]
Upon electroporation of primary PKR knockout MEFs acquired from John Bell [42] with sub-genomic HCV RNA and miR-122 (Figure 2A), we observed high levels of luciferase reporter expression, comparable to the levels achieved in Huh7.5 cells, the most common cell line used for HCV research. [score:4]
This suggests that perhaps the knockout cells supported sufficient replication independent from miR-122 for selection (or generation of viral mutants that do not require miR-122), or that the selected cells could express miR-122 or other pro-viral factors. [score:4]
Knockdown of NCoA6 increased luciferase expression from both miR-122 -dependent (WT) and miR-122-independent (S1+S2:p3) sub-genomic replicons (Figure 3C) 1.4 to 1.8-fold at days 2 and 3 post-second electroporation (Figure 3D), but the effect of siNCoA6 treatment was not statistically significant as determined by a two-way ANOVA. [score:4]
We identified one wild-type and two knockout mouse embryonic fibroblast (MEF) cell lines, “GH” wild-type, and NCoA6 and PKR knockout cells, that were permissive to transient, unselected sub-genomic HCV RNA replication when supplemented with miR-122. [score:3]
The MEFs depicted in Figure 1A were permissive to low levels of sub-genomic HCV RNA accumulation when electroporated with synthetic miR-122; however, the raw luciferase expression was approximately a thousand-fold lower than ia typical in Huh7.5 cells, which was reflected in our inability to detect RNA accumulation via northern blot (data not shown). [score:3]
There was no indication of trans -inhibition of SGR replication by full-length HCV RNA, since replication of sub-genomic RNA was not impacted by addition of full-length RNA (SGR+FL [miR-122], Figure 5A), and replication levels were similar to those seen in cells electroporated with SGR RNA alone (SGR [miR-122], Figure 5A). [score:3]
Therefore we show that a single isolate of PKR knockout MEFs was highly permissive for transient HCV RNA replication when supplemented with miR-122. [score:2]
NCoA6 knockout MEFs are permissive to sub-genomic HCV RNA replication upon supplementation with miR-122. [score:2]
PKR knockout MEFs are permissive to sub-genomic HCV RNA replication when supplemented with miR-122. [score:2]
Plasmids pSGR S1+S2:p3 Fluc WT and pSGR S1+S2:p3 Fluc GND have C to G mutations at position 3 in both miR-122 seed binding sites in the HCV 5′ UTR and were described in [26]. [score:2]
We identified wild-type and knockout (PKR and NCoA6) mouse embryonic fibroblasts that were permissive to detectable levels of HCV RNA replication when supplemented with miR-122. [score:2]
Mouse cells with no known knockouts have varying permissiveness to HCV replication when supplemented with miR-122. [score:2]
NCoA6 Knockout MEFs are Permissive to Sub-genomic HCV RNA Replication Upon Supplementation with miR-122, but do not Maintain Their Phenotype Between Passages. [score:2]
0089971.g005 Figure 5NCoA6 knockout MEFs were electroporated with sub-genomic and/or full-length HCV RNA as indicated, and either miControl or miR-122. [score:2]
NCoA6 knockout MEFs were electroporated with sub-genomic and/or full-length HCV RNA as indicated, and either miControl or miR-122. [score:2]
Because Huh7.5 cells already express miR-122, it was not added in this assay. [score:2]
PKR Knockout MEFs are Permissive to High Levels of Sub-genomic HCV RNA Replication when Supplemented with miR-122, but did not Maintain Their Phenotype Between Passages and Isolates. [score:2]
Interestingly, we and others have shown that expression of miR-122 in human liver cell lines previously considered refractory to HCV replication renders the cells permissive to HCV replication [24]– [26]. [score:2]
Thus we hypothesized that PKR knockout MEFs would support efficient transient HCV replication if supplemented with miR-122. [score:2]
E) Primary hepatocytes were isolated from PKR knockout mice and electroporated with sub-genomic RNA and miR-122. [score:2]
When electroporated with sub-genomic HCV and miR-122, these cells demonstrated levels of luciferase (Figure 3A) and HCV RNA (Figure 3B) that, while robust, were not as high as those detected in PKR knockout MEFs, nor in Huh7.5 cells (data not shown). [score:2]
Unlike our study however, in the Vogt report and other previous reports, miR-122 was not required for stable HCV colony selection [4], [28], [29], [41], [51], [52]. [score:1]
Wild-type MEFs from multiple sources were tested for permissiveness to HCV replication by electroporating cells with either wild-type (WT) or replication-incompetent (GND) sub-genomic HCV RNA, and supplementing the cells with either a control miRNA (miControl) or miR-122. [score:1]
miR-122∶5′-UGG AGU GUG ACA AUG GUG UUU GU-3′ and miR-122*: 5′-AAA CGC CAU UAU CAC ACU AAA UA-3′, annealed. [score:1]
Both wild-type (FL WT) and replication -deficient (FL GNN) full-length HCV RNAs were electroporated with either miControl or miR-122 (Figure 4A). [score:1]
In a different wild-type MEF cell line, sub-genomic HCV RNA was unable to replicate in any detectable manner regardless of miR-122 supplementation (Figure 1B). [score:1]
miR-122 is a liver-specific co-factor that is important for HCV RNA replication, and has thus been implicated in defining tissue tropism for the virus, and we confirm this as its addition renders murine embryonic fibroblasts permissive to HCV RNA replication. [score:1]
A host factor that likely influences liver-specificity of HCV replication is miR-122, a liver-specific microRNA that binds to two sites on the 5′ UTR of the HCV genome [17]– [19]. [score:1]
One Wild-type MEF Cell Line is Permissive to HCV Replication When Supplemented with miR-122, While Others are Not. [score:1]
The S1+S2:p3 RNA was tested because it is not responsive to miR-122, but is capable of replicating at low levels without miRNA supplementation, and so may be more sensitive to removal of anti-viral factors because the cell’s machinery is not saturated. [score:1]
Here we demonstrate that supplementing non-permissive mouse cells with miR-122 can render them permissive to transient sub-genomic HCV RNA replication; we bypass the human entry factor requirements by electroporating cells with viral RNA, rather than infecting them. [score:1]
Since PKR MEFs are visually distinct from Huh 7.5 cells, the only other cell line in use in our lab at the time, and our PKR MEFs did not replicate HCV in the absence of miR-122 (Figure 2A, WT+miControl), we omit contamination of the MEF cell line with Huh 7.5 cells as a possible explanation for positive results shown in Figure 2A. [score:1]
The cells were then electroporated again with the indicated siRNA, as well as wild-type (WT) sub-genomic HCV RNA or miR-122 binding site mutant (S1+S2:p3) sub-genomic RNA (Figure 2G). [score:1]
Although sub-genomic HCV RNA, included as a positive control, showed the cells to be permissive for replication of HCV RNA, and a firefly luciferase mRNA was included to confirm consistent electroporation efficiency (data not shown), full-length HCV RNA did not replicate detectably when supplemented with miR-122. [score:1]
0089971.g001 Figure 1 A) Wild-type MEFs obtained from Gregory Hannon were electroporated with either wild-type (WT) or replication-incompetent (GND) sub-genomic HCV RNA and the indicated miRNA (miControl, or miR-122), and luciferase expression was monitored at the indicated time points as a measure of HCV replication. [score:1]
A) Wild-type MEFs obtained from Gregory Hannon were electroporated with either wild-type (WT) or replication-incompetent (GND) sub-genomic HCV RNA and the indicated miRNA (miControl, or miR-122), and luciferase expression was monitored at the indicated time points as a measure of HCV replication. [score:1]
We therefore conclude that some wild-type MEFs are permissive to low levels of transient sub-genomic HCV replication when supplemented with miR-122. [score:1]
As expected, no sub-genomic RNA reporter activity was identified in the sample that contained only full-length RNA (FL [miR-122]), and no sub-genomic replication was detected in cells given sub-genomic RNA without miR-122 (SGR [miControl]). [score:1]
[1 to 20 of 40 sentences]
25
[+] score: 72
We propose that an increase in the expression of cytokine IL-6 stimulates the expression of ferritin and hepcidin, decreasing serum iron levels, which is a stimulus to increase the expression of miR-122. [score:7]
The liver specific miR-122 directly targets HFE and HJV, contributing to the regulation of systemic iron homeostasis by decreasing hepcidin mRNA expression (Chen et al., 2008; Mitchell et al., 2008). [score:7]
CCL2 is upregulated by decreased miR-122 expression in iron-overload -induced hepatic inflammation. [score:6]
Iron overload induces a significantly reduced expression of miR-122, which also increases HFE and HJV expression (Castoldi et al., 2011). [score:5]
Also, miR-155 regulated the expression of CEBPβ and PPARγ in adipocytes (Liu et al., 2011; Chen et al., 2013) and miR-122 participate regulating the levels of cholesterol, fatty acids synthesis, and in the cell differentiation (Kim et al., 2011). [score:5]
Human hemochromatosis protein (HFE) and HJV are directly targeted by miR-122, thus decreasing hepcidin gene (HAMP) transcription (Castoldi et al., 2011). [score:4]
Li et al. (2017) and Tang et al. (2017) have demonstrated that iron overload in mice induces the down-regulation of miR-122. [score:4]
Other mechanism that may be involved in the up-regulate of miR-122 in obese subjects involves NF-κB activity. [score:4]
We only observed an inverse association between serum iron levels and the expression of serum miR-122, considering the total population (controls and obese; rho Spearman = -0.54, p = 0.02). [score:3]
Wang C. et al. (2011) studied miRNAs in seminal plasma and observed an increase of miR-122 expression in asthenozoospermic patients, a term for reduced sperm motility. [score:3]
Based in the previous information, we hypothesize that men with obesity show an increase in the relative expression of microRNAs associated with inflammation (miR-155 and miR-21) and iron homeostasis (miR-122 and miR-200b) at a systemic and spermatic level. [score:3]
Donkin et al. (2016) did not find changes in expression profiles of miR-122 at the spermatic level, by contrast, our data demonstrated that miR-122 in spermatozoa was elevated among obese patients. [score:3]
MiR-122 inhibition increases the amount of mRNA transcribed by genes that control systemic iron levels, such as HFE, HJV, bone morphogenetic protein receptor type 1A (Bmpr1a), and HAMP (Castoldi and Muckenthaler, 2012). [score:2]
In sperm, miR-155 (rho Spearman = 0.84; p = 0.002) and miR-21 (rho Spearman = 0.71; p = 0.03) with serum IL-6. Also, we observed an inverse association between serum iron levels and the expression of miR-122, considering the total population (controls and obese subjects; rho Spearman = -0.54; p = 0.02) Iron content in PBMCs in controls was 0.46 (0.14–0.89) μg/10 [5] cells compared to 0.57 (0.16–1.06) μg/10 [5] cells in obese subjects (p = NS). [score:2]
FIGURE 4Relative expression of miR-155, miR-21, miR-122 and miR-200b in the spermatozoa samples of obese subjects compared with the normal weight controls. [score:2]
We did not find any significant correlation between miR-122 and iron in sperm or seminal plasma. [score:1]
The liver-specific microRNA miR-122 controls systemic iron homeostasis in mice. [score:1]
Also, in patients with iron overload disorders, it was observed that miR-122 was decreased. [score:1]
Elevated circulating microRNA-122 is associated with obesity and insulin resistance in young adults. [score:1]
In contrast, Abu-Halima et al. (2013) found that miR-122 was down regulated in sperm from asthenozoospermic and oligoasthenospermic infertile men, compared to normozoospermic controls. [score:1]
In this study, the increase of miR-122 was related to the obesity and not to differences in the seminal pattern between cases and control subjects. [score:1]
These results coincide with previous studies that demonstrate that circulating miR-122 is elevated in obese patients and exhibit a tendency to increase with the degree of obesity (Ortega et al., 2013; Wang et al., 2015). [score:1]
MiR-122 is highly abundant in liver tissue and is a hepato-specific miRNA (Wrighting and Andrews, 2006). [score:1]
In plasma, miR-122 levels were increased in Ob group (p = 0.029; Figure 3A); however, miR-200b did not show a significant difference (p = 0.059; Figure 3B) between obese and control subjects. [score:1]
The hepatocyte-specific HNF4α/miR-122 pathway contributes to iron overload -mediated hepatic inflammation. [score:1]
In the promoter region of miR-122 was identified a NF-κB binding site, and has been demonstrated that RELA (NF-κB p65 subunit), is an activator of NF-κB, which increased promoter activity of miR-122 (Rivkin et al., 2016). [score:1]
Then, in the current study, we evaluated changes in microRNAs expression related to inflammation (miR-21 and miR155) and iron homeostasis (miR-122 and miR-200b) in peripheral blood mononuclear cells (PBMC), plasma, and spermatozoa of obese and healthy subjects. [score:1]
[1 to 20 of 27 sentences]
26
[+] score: 69
Up-regulation of HIF-1α DNA binding activity and VEGFR1 mRNA in our experimental mo del upholds a role for miR-122 regulated HIF-1α in HCC development and progression. [score:6]
Bcl-w, an anti-apoptotic gene and a target of miR-122, was significantly up-regulated in alcohol-fed DEN -injected mice (Fig. 6b). [score:6]
Overexpression of miR-122 reduces tumorigenic properties in HCC cell lines 56 and recent reports propose a unique therapeutic potential for miR-122 in liver diseases 57. [score:5]
Up-regulation of serum miR-122 co-relates with liver injury markers. [score:4]
miR-122 regulates the expression of cyclin G1, whose high levels have been reported in several human cancers 30. [score:4]
Altered microRNA-122 and HIF-1α expression in liver confirms HCC in mice. [score:3]
Lastly, a significant correlation was seen between serum miR-122 and CD133 expression (Fig. 7d). [score:3]
Hence, we analyzed expression of miR-122 in serum collected at sacrifice from mice. [score:3]
Levels for circulating miR-122 can be useful in predicting liver diseases such as HCC and ongoing liver injury 36. [score:3]
Further, loss of tissue miR-122 expression in liver cancer has been reported to correlate with gain of metastatic properties 29. [score:3]
Consistent with this, we found decreased liver miR-122 and increased expression of molecular markers of HCC in DEN plus alcohol treated mice. [score:3]
miR-122 expression increases during embryogenesis until it constitutes 72% of total miRNA in adult human liver 53. [score:3]
We recently discovered that HIF-1α is a miR-122 target 34. [score:3]
Our lab has recently shown that microRNA-122 regulates HIF-1α in hepatocytes in a diet -induced steatohepatitis mo del 34. [score:2]
The hepatobiliary cancer is characterized by loss of miR-122 and up regulation of its targets cyclinG1 and Bcl-W, increased stemness, progenitor cell markers and enhanced EMT. [score:2]
We found that the expression of miR-122 in the liver tissue was significantly lower in alcohol-fed DEN -injected mice compared to any other groups in this study (Fig. 6a). [score:2]
Decreases in liver tissue miR-122 have been correlated with gain of metastatic properties of liver cancer and increased mortality 29. [score:1]
Our experiments dissected molecular mechanisms involved in early hepatic carcinogenesis and found that markers of stemness (CD133 and nanog), factors involved in epithelial mesenchymal transition (vimentin and hedgehog activation) and miR-122 decrease, were all present in livers with early liver tumors triggered by alcohol plus DEN. [score:1]
In addition, by modulating cyclin G1, miR-122 influences p53 protein stability and transcriptional activity and reduces invasion capability of HCC-derived cell lines 31. [score:1]
How to cite this article: Ambade, A. et al. Alcoholic hepatitis accelerates early hepatobiliary cancer by increasing stemness and miR-122 -mediated HIF-1α activation. [score:1]
Anti-inflammatory and anti-tumorigenic role for hepatic miR-122 has been reported 55. [score:1]
However, decrease in hepatic miR-122 is known to be a tumor-specific event in humans 54 as well as experimental animal mo dels 53. [score:1]
We found a significant positive correlation of serum miR-122 levels with established clinical markers of liver injury, ALT, serum AFP and histology. [score:1]
A correlation of serum miR-122 with clinical chemistry parameters of liver injury, hepatic necro-inflammation is known and therefore use of serum miR-122 levels as prognostic markers in patients with hepatocellular carcinoma is suggested 36. [score:1]
Serum miR-122 increase correlates with liver injury and tumor markers. [score:1]
Recent reports found that the change in plasma miR-122 concentration precedes the increase in aminotransferase activity in the blood, making it one of the earliest markers of liver injury 62. [score:1]
Altered liver microRNA-122 and HIF-1α correlates with HCC in mice. [score:1]
Serum miR-122 was elevated in patients with HCC or chronic hepatitis 64. [score:1]
The most abundant miRNA in the liver is miR-122. [score:1]
Our experimental data here shows a significant increase in serum miR-122 with a concurrent loss of miR-122 in the liver tissue thus acknowledging the proposed the role for miR-122 as a HCC biomarker in animal mo dels. [score:1]
[1 to 20 of 30 sentences]
27
[+] score: 69
Thus, it is reasonable to conceive that miR-122 can be a potentially novel biomarker, modulator and therapeutic target for liver diseases. [score:5]
Extending this study to human patients showed that the up-regulation of serum miR-122 correlates with a severe liver injury in patients with biliary calculi. [score:4]
Differences in miR-122 concentration in the disease group compared with the control group were expressed as fold changes. [score:4]
To determine the expression level of miR-122, stem-loop real-time RT-PCR (SLqRT-PCR) was performed. [score:3]
Among the predicted targets of miR-122 are factors involved in differentiation, cell cycle progression, inflammation, transcription, protein biosynthesis, cholesterol, and carbohydrate metabolism [28]. [score:3]
Ever since the cloning of miR-122 from the liver by Lagos-Quintana et al. [26], numerous attention has been focused on trying to understand the functions of this developmentally regulated liver-specific microRNA [27]. [score:3]
We hypothesized that the level of liver-specific circulating miR-122 may also be used to detect and monitor the pathological development associated with cholestasis -induced liver injuries. [score:2]
MiR-122 was implicated in regulation of fatty-acid and cholesterol metabolism [17], amplification of hepatitis C virus (HCV) genome [18], response to interferon treatment of patients infected with HCV [19], and carcinogenesis of hepatocellular carcinoma [20]. [score:1]
Time courses of serum concentrations of miR-122, ALT, AST, ALP, TBIL and DBIL after BDL. [score:1]
To better understand the time-course of serum ALT, AST, ALP, TBIL, DBIL and miR-122 levels during BDL, 20 mice were randomly grouped into 4 groups with 5 mice in each group. [score:1]
Comparative ROC analysis for miR-122 and ALT /AST for discriminating cholestatic liver injury in human patients. [score:1]
Finally, serum miR-122 was found to show significant diagnostic value for biliary calculi by yielding an AUC of 0.931 with 77.4% sensitivity and 96.4% specificity in discriminating biliary calculi from healthy controls. [score:1]
However, the diagnostic value of circulating miR-122 in other types of liver injury, such as cholestatic liver injury, in animal mo dels and patients remains undefined. [score:1]
Serum miR-122 was found to show significant diagnostic value for biliary calculi by yielding an AUC of 0.931 (95% CI, 0.871–0.991; Figure 4) with 77.4% sensitivity and 96.4% specificity in discriminating biliary calculi from healthy controls at a cut-off value of 659.28. [score:1]
Elevated liver-apecific miR-122 in serum may be a novel sensitive and specific biomarker for early detection of cholestatc liver injury in humans. [score:1]
ROC curve analysis of serum miR-122 concentration for discriminating cholestatic liver injury in human patients. [score:1]
Furthermore, the clinical relevance was noted by the observation that serum miR-122 levels were enhanced significantly in patients inflicted by biliary calculi relative to corresponding healthy controls. [score:1]
Thus miR-122 might evolve as biomarkers in the diagnosis of biliary calculi. [score:1]
In the present study, we serendipitously identified serum miR-122 as a potential novel biomarker for cholestatic liver injury while profiling microRNAs in a rodent mo del of BDL -induced cholestasis. [score:1]
The results indicated that miR-122 as a potential biomarker of cholestatic liver injury was better than ALT/AST. [score:1]
Circulating microRNA-122 (miR-122) has been increasingly reported to be a potential biomarker for drug-, viral-, alcohol- and chemical -induced liver injury. [score:1]
Therefore, we speculated that miR-122 was a more diagnostically sensitive marker for detecting cholestatic liver injury at either end point. [score:1]
Our result that miR-122 was detected at a quite low level in serum from healthy people, but could be easily detected in serum from cholestatic patients revealed for the first time that monitoring the serum levels of miR-122 could also be applied in clinical diagnosis of cholestasis. [score:1]
Collectively, these data suggest that serum miR-122 has strong potential as a novel, specific and noninvasive biomarker for diagnosis of cholestasis -induced liver injury. [score:1]
The values of miR-122 fold change and ALT, AST, ALP, TBIL and DBIL levels are the average of 5 independent samples from each time point, and data are presented as the mean and SD. [score:1]
miR-122 concentrations were shown to be changed significantly across the 31 patients in the 3 subgroups (P<0.001, Figure 3 B). [score:1]
In the present study, we have demonstrated that serum miR-122 increased significantly during BDL -induced cholestatic liver injury and exhibited a similar time course to the concentration of ALT, a classical biomarker of liver injury. [score:1]
Thus the serum miR-122 may be employed as a useful indicator of cholestatic liver injury. [score:1]
Increased serum miR-122 concentrations in BDL mice. [score:1]
Serum miR-122 increased significantly after BDL -induced cholestatic injury and showed a similar time course to ALT concentrations. [score:1]
Serum miR-122 could be used to detect cholestatic liver injury in BDL mice and showed a similar time course to ALT. [score:1]
We further determined miR-122 levels in serum from healthy control and cholestatic patients. [score:1]
Moreover, serum miR-122 level was substantially higher in patients with biliary calculi than that in the healthy control group. [score:1]
In addition, our data demonstrated that the serum concentration of miR-122 showed a good correlation with that of ALT, a classical marker of liver injury, thus clearly supporting the hypothesis that miRNAs may leak out of injured cells into the circulating blood and thereby serve as markers for identifying the type of injured cell. [score:1]
0073133.g001 Figure 1 The values of miR-122 fold change are the average of 5 independent samples from each time point, and the standard derivations are shown as error bars. [score:1]
By showing a significant increase 1 d after BDL(P<0.01; Figure 1), reaching its peak at day 3 (P<0.001; Figure 1) and remaining significantly increased until 14 d after BDL (P<0.01; Figure 3), serum miR-122 was found to be dynamically changed during BDL -induced cholestatic liver injury in a time-course that was similar to ALT (Table S1 and Figure 2), a classical biomarker of liver injury. [score:1]
0073133.g003 Figure 3 (A) Comparison of miR-122 concentrations between healthy controls and patients; (B) Serum miR-122 concentrations in correlation with the liver injury degree (mild injury, 80 U/L300 U/L, n = 9). [score:1]
Through ROC analysis, the present work has led us to identify that miR-122 can be a clinically practicable biomarker for cholestasis diagnosis with high sensitivity and specificity, further indicating that miR-122 might be a good and more reliable biomarker for cholestasis diagnosis. [score:1]
We report here for the first time that the serum level of miR-122 is associated with liver injuries induced by cholestasis, and that miR-122 may serve as a potential novel and reliable blood biomarker for noninvasive cholestasis diagnosis. [score:1]
Serum miR-122 was increased in patients with biliary calculi and showed a significant diagnostic value for cholestatic liver injury. [score:1]
The increase in serum concentration for miR122 was earlier and orders of magnitude higher than other variant. [score:1]
Relative miR-122 production was determined with the △Ct method and reported as 2 [−△Ct], where Ct represents the threshold cycle. [score:1]
0073133.g002 Figure 2 The values of miR-122 fold change and ALT, AST, ALP, TBIL and DBIL levels are the average of 5 independent samples from each time point, and data are presented as the mean and SD. [score:1]
Indeed, recent studies have demonstrated a remarkable antiviral effect in chimpanzees following therapeutic silencing of miR-122 by administration of a locked nucleic acid (LNA) antisense oligonucleotide [21], and miR-122 mimetic alone or in combination with anticancer drugs were demonstrated to be a promising therapeutic regimen against liver cancer [20]. [score:1]
As is shown in Figure 1, BDL -induced miR-122 change was readily apparent, and serum miR-122 level was significantly increased as early as 1 d after administration (P<0.01). [score:1]
In summary, serum miR-122 levels were increased in cholestasis -induced liver injury in both BDL mouse mo dels and patients with biliary calculi, perhaps through increased release of miR-122 from injured hepatocytes. [score:1]
44±103.65 <0.05 DBIL (µmol/L) 4.04±1.27 65.24±86.52 <0.05 MiR-122 241.88±218.87 1476.44±1066.14 <0.001 The values of miR-122 fold change are the average of 5 independent samples from each time point, and the standard derivations are shown as error bars. [score:1]
Both bile-duct ligation (BDL) mice and patients with biliary calculi were employed as cholestatic liver injury mo dels, and serum miR-122 level was determined by stem-loop real-time reverse-transcription PCR (SLqRT-PCR). [score:1]
More importantly, circulating miR-122 was recently confirmed as a sensitive and early marker for drug- [13], viral-, alcohol- and chemical -induced liver injury [14]. [score:1]
The present study was initiated to determine the potential of circulating miR-122 as a biomarker for cholestatic liver injury. [score:1]
Increased serum miR-122 concentrations in patients with cholestatic liver injury. [score:1]
The present study provides the first clinical evidence of circulating miR-122 as a biomarker of cholestasis -induced liver damage. [score:1]
[1 to 20 of 52 sentences]
28
[+] score: 68
The data reported here suggests that the highly abundant microRNA mir122 is capable of regulating more mRNA transcripts than are regulated under normal conditions in hepatocytes and that it is probably expressed in excess of its regulatory requirements. [score:6]
The presence of additional microRNA regulated mRNA could lead to sequestration of mir122 molecules away from their endogenous targets. [score:4]
This proved that the level of mir122 was unaffected by the presence of Ad5mir122 infection however it did not confirm if mir122 was being sequestered away from its endogenous mRNA targets by direct competition. [score:4]
However, Huh7 cells express only 8% of the mir122 levels of primary human hepatocytes [27]. [score:3]
After 72 hours livers were analysed by western blot for the levels of Aldolase A protein, a known mir122 target [31], [32]. [score:3]
In this study we set out to determine whether the dose of Ad5mir122 capable of showing intravenous efficacy in treating cancer would significantly affect hepatic levels of mir122 or its mRNA targets. [score:3]
In this study we have shown that the inclusion of four perfectly complementary binding sites for hepatic specific microRNA mir122 into the 3′ UTR of adenovirus E1A allows efficient mir122-controlled expression of E1A in murine liver, confirmed by RT-QPCR and western blotting. [score:3]
Interestingly, the genome wide profiling of the mRNA levels in livers infected with Ad5mir122 produced 21 mRNAs that were altered ≧2-fold but it was not clear that they were directly regulated by mir122. [score:3]
143 predicted mir122 targets were altered in the microarray analysis. [score:3]
The production of E1A mRNA within hepatocytes that contains multiple microRNA binding sites could lead to the sequestration of mir122 away from its endogenous mRNA targets or depletion of the total mir122 content in the cell. [score:3]
Inhibition of mir122 function is known to increase Aldolase A protein levels although the western blot showed no difference between mice in the different treatment groups (Figure 6c). [score:3]
Although no differences had been observed in the levels of known mir122 regulated mRNAs it was unclear if the quantity of protein produced from these transcripts was altered. [score:2]
The list of mir122 microcosm predicted targets was then compared to all the signals from the microarray profiling to make sure no important signals had been omitted by filtering the results as described above. [score:2]
These mRNAs, which numbered only 21 in total (Table 1), were compared with the predicted mir122 targeted mRNAs in the European Bioinformatics Institutes (EBI) Microcosm database. [score:2]
This data suggests that mir122 regulation of Aldolase A is maintained despite the presence of Ad5mir122 at therapeutic doses. [score:2]
The ability of Ad5mir122 to kill tumour cells not expressing mir122 was compared to Ad5WT. [score:2]
C) Western blot analysis of the mir122 regulated protein Aldolase A in mice treated as above. [score:2]
Mir122 regulated Adolase A levels remain unaffected by Ad5mir122. [score:2]
Briefly, Reverse transcription (RT) reactions (15 µl) were set up according to manufacturer's gui delines to using Multiscribe Reverse Transcriptase (50U/reaction), dNTPs (1 mM final concentration), 0.188 µl RNase inhibitor, 1.5 µl 10X RT buffer, 3 µl 5X mir122 TaqMan MicroRNA RT primer and 5 µl RNA sample (1 ng/µl). [score:2]
Ad5mir122 kills mir122 negative cells with Ad5WT potency. [score:1]
The perfect complementarity between the mir122 binding sites we have inserted and microRNA mir122 should result in substantial E1A mRNA cleavage through a mechanism similar to RNAi. [score:1]
The level and activity of mature mir122 in vivo is unaffected by Ad5mir122. [score:1]
Primary human hepatocytes (1×10 [4]/well) were incubated with either Ad5WT encoding luciferase C-terminally fused to the E1A protein (Ad5WTLuc) or the equivalent virus containing four mir122 binding sites in the E1A-luciferase 3′UTR (Ad5mir122luc). [score:1]
The livers screened in figure 5 by E1A western blot and RT-QPCR were analysed to determine the quantity of mature mir122 RNA. [score:1]
Mir122 levels remain unaffected by Ad5mir122 infection. [score:1]
Interestingly, the cell line most susceptible to killing by both viruses was HepG2 human hepatocellular carcinoma which is reported to be mir122 negative [27]. [score:1]
No transcripts were predicted to contain mir122 binding sites. [score:1]
Given that decreases in mir122 levels in primary hepatomas is an indicator of poor prognosis [28], HepG2 cells represented a promising tumour mo del which should maximise the therapeutic index achieved by Ad5mir122 between tumour tissue and primary liver. [score:1]
0016152.g006 Figure 6The level and activity of mature mir122 in vivo is unaffected by Ad5mir122. [score:1]
To abrogate this toxicity, without affecting viral replication in cancer cells, we inserted four perfectly complementary binding sites for the hepatocyte-specific microRNA mir122 into the 3′ UTR of the E1A transcription cassette (a virus termed Ad5mir122). [score:1]
A) RT-QPCR for mir122 showing nine superimposed amplification curves (from three mice) in each treatment group, before correction against let7a. [score:1]
We have previously shown that the inclusion of microRNA binding sites within the 3′UTR of adenovirus E1A mRNA leads to lower E1A protein in both murine liver in vivo and in the mir122 positive human hepatoma cell line Huh7 in vitro. [score:1]
Mir122 predicted target mRNAs (produced using the Microcosm database) were compared to this list but no positive matches were found. [score:1]
[1 to 20 of 33 sentences]
29
[+] score: 61
Again data from quantitative RT-PCR and bioluminescence analysis indicated a similar miRNA expression pattern, i. e. expression of miRNA-133 and almost undetectable expression of miRNA-122 and -221 in differentiated C2C12 cells (Supplementary Figure S2). [score:7]
As miRNA-122 is exclusively expressed in the liver (32) and miRNA-133 is a muscle-tissue–specific miRNA (34), we enquired whether RILES would have the potential to discriminate the expression of these two miRNAs in the liver of the mice. [score:5]
The observation that, at this same time point, the pRILES/122T is adequately switched-ON in the same cells transfected with synthetic miRNA-122 indicates that the delay for the RNAi machinery to suppress expression of CymR protein is also remarkably fast (Supplementary Figure S7). [score:5]
MiRNA-122 and miRNA-221 were oppositely expressed in HUH7 and HLE cells, while miRNA-133 was not significantly detected. [score:3]
In vivo monitoring of miRNA-122 expression in the liverWe then examined whether similar data could be collected through whole-body imaging of live-anesthetized animals and in real time. [score:3]
No statistical difference was found between the pRILES/122T and the pRILES group, suggesting that, in contrast to the liver, miRNA-122 is not expressed in the skeletal muscles. [score:3]
Several RILES plasmids were constructed (Supplementary Table 1) and denoted for example pRILES/siRNA tGFPT or pRILES/122T when the RNAi targeting cassette contained complementary sequences to detect the siRNA tGFP or miRNA-122, respectively. [score:3]
This indicated that the expression of miRNA-122 in the skeletal muscle is not sufficient to repress a sufficient amount of CymR transcript to switch-ON the RILES in vivo. [score:3]
The transgene expression, e. g. the luciferase reporter gene, was found to be tightly controlled by tissue-specific miRNAs, such as miRNA-122 in the liver and myomiRs-206, -1 and -133 in the skeletal muscles. [score:3]
We also found a significant but lower 6-fold (±1.3, n = 6, P < 0.05) degradation of CymR transcript in the pRILES/122T -treated group, although miRNA-122 is weakly expressed in the skeletal muscles (Figure 4C) and unable to induce significant bioluminescence (Figure 4B). [score:3]
In vivo monitoring of miRNA-122 expression in the liver. [score:3]
Dose–response study of luciferase expression in HEK 293 cells transfected with (A) pRILES/siRNA tGFP T or (B) pRILES/122T in presence of (A) increasing amounts of siRNA tGFP (pU6/shRNA tGFP) and control siRNA (pU6/shRNA Ctl) or (B) increasing concentrations of synthetic miRNA-122. [score:3]
MiRNA-122 was only faintly detected in the skeletal muscle, while miRNA-206, -133 and -1 showed an increasing expression level (Figure 4C versus 4B). [score:3]
Selective luciferase expression in HEK 293 cells transfected either with (C) pRILES/122T, (D) pRILES/133T or (E) pRILES/221T in the presence of two concentrations of synthetic miRNA-122, −133 and −221. [score:3]
Quantitative RT-PCR demonstrated that miRNA-122 is expressed in the liver in contrast to miRNA-133, which was almost undetectable in the liver samples. [score:3]
For this purpose, we exploited the fact that HUH7 and HLE cell lines express opposite levels of miRNA-122 (32) and miRNA-221 (33). [score:3]
These two RILES plasmids, pRILES/siRNA tGFPT and pRILES/122T, were individually transfected in HEK 293 cells in presence of increasing amounts of the shRNA plasmid (Figure 2A) or synthetic precursor miRNA-122 (Figure 2B). [score:1]
In contrast luciferase induction was detected only in cells transfected with pRILES/122T, pRILES/133T and pRILES/221T in presence of the corresponding miRNA-122, miRNA-133 and miRNA-221 (Figure 2C–E). [score:1]
Figure 3. Noninvasive bioluminescence imaging of the liver-specific miRNA-122 in mice. [score:1]
A maximum 9-fold (±0.3, n = 3, P ≤ 0.01) luciferase induction was found in response to 50 ng shRNA tGFP plasmid (Figure 2A) and a maximum of 26-fold (±1.2, n = 3, P ≤ 0.01) was detected in response to 40 nM of miRNA-122 (Figure 2B). [score:1]
As shown in Figure 2A and B, increasing the amount of shRNA tGFP plasmid (Figure 2A) or synthetic miRNA-122 (Figure 2B) in pRILES transfected cells also increased the luciferase fold induction values. [score:1]
[1 to 20 of 21 sentences]
30
[+] score: 59
Knocking down of endogenous miR-122, a miRNA abundantly expressed in the liver, reduces plasma cholesterol concentrations in mice [21], with parallel up-regulation of 363 mRNA transcripts and down-regulation of 305 mRNA transcripts in the liver [21]. [score:10]
Hepatic expression of miR-122 is reduced in the maternal HF adult offspring (Fig. 1), which is consistent with increased expression of PPARα and CPT-1a, two key molecules regulating hepatic fatty acid oxidation (Fig. 1). [score:6]
Among the miRNAs showing reduced expression, let-7c regulates developmental timing [46, 47] and miR-122 regulates fat oxidation [21, 57]. [score:6]
miR-122 is abundantly expressed in the liver and regulates fat metabolism [21], as knocking down miR-122 increases hepatic fatty-acid oxidation [21, 57]. [score:5]
Reduced expression of miR-709 (a highly expressed miRNA), miR-122, miR-192, miR-194, miR-26a, let-7a, let7b and let-7c, miR-494 and miR-483* (reduced by ~4.9 fold) was validated by qPCR. [score:5]
MECP2 is a common predicted target for 5 miRNAs including two abundantly expressed miRNAs (miR-709 and miR-122, Fig. 1). [score:5]
Increased expression of ppar-α and reduced expression of miR-122 may increase hepatic fatty acid oxidation in the offspring. [score:5]
Several key proteins involved in epigenetics are predicted targets for miRNAs, in particular, methyl-CpG binding protein 2 are predicted targets for 5 miRNAs (miR-709, let-7s, miR-122, miR-194 and miR-26a) showing reduced levels in maternal HF fed offspring. [score:5]
Igf1 receptor (Igf1R) and citrate synthase (CS) are predicted targets shared by both miR-122 and miR-494. [score:3]
For example, miR-709 is the most abundantly expressed miRNA in the liver detected with microarray (greater than miR-122). [score:3]
We found that methyl-CpG binding protein 2 was the common predicted target for miR-709, miR-let7s, miR-122, miR-194 and miR-26a using our own purpose-built computer program. [score:3]
We found that ZSWIM3 (zinc finger, SWIM domain containing 3), a protein whose function was yet to be characterised [56], was targeted by 5 miRNAs namely miR-122, miR-192, miR-194, miR-709 and miR-483*. [score:1]
Similar to miR-122, maternal HF offspring have reduced miR-494 levels, which favour increased Igf1R and CS activities. [score:1]
It is likely that increased capacity of fat oxidation (due to reduced miR-122 and increased PPARα and CPT-1a) prior to weaning are maintained until adulthood. [score:1]
[1 to 20 of 14 sentences]
31
[+] score: 55
Other miRNAs from this paper: hsa-mir-122
Tsai et al. [23, 25] applied a miRNA-target interaction database to predict miR-122 target genes in mice and humans (S2 and S3 Tables). [score:5]
The results show upregulated profiles from 2, 6, and 11 months of mir-122 knockout mice liver data (Fig 4C–4E). [score:5]
Interestingly, P-BTK and BTK were upregulated in mir-122 knockout mice livers as early as 2 months of age. [score:5]
In this study, using the KEGG and ExPASy databases, we determined that 20 genes from the set of miR-122 target genes directly encode enzymes listed in the Recon2-hepatocyte mo del. [score:4]
Clearly our results favor the notion that miR-122 plays a major dominant role in regulating these target genes in normal liver. [score:4]
We examined the expression pattern of DDC in mir-122 knockout mice livers to explore the role of DDC. [score:4]
Genes regulated by miR-122 and their regulated reactions in Recon2-hepatocyte mo del. [score:3]
miR122 target genes of human. [score:3]
Four of them, DDC, PKM, ENTPD4, and ALDOA, are miR-122 target genes. [score:3]
Mouse studies have revealed that microRNA-122 (miR-122), which accounts for 70% of the total miRNAs in the liver, plays a pivotal role in liver and has been implicated as a regulator of fatty acid metabolism. [score:2]
In addition, we also examined the role of BTK in the mir-122 knockout mice livers. [score:2]
Since miR-122 knockout mice have increased levels of DDC (Fig 4C–4E), we then set up to determine the association between DDC and liver cancer. [score:2]
Reduced miR-122 levels are associated with hepatocellular carcinoma (HCC), and miR-122 plays a crucial positive role in the regulating hepatitis C virus replication [22]. [score:2]
Most of the miRNAs in Mir122a [–/–]are expressed at low (RPM<10) to moderate (RPM 10–100) levels compared to high level of miR-122-5p in normal mouse liver (RPM 21378.2). [score:2]
Mice liver tissues were harvested from C57BL/6 wildtype and mir-122 knockout mice at 2, 6 and 11 months of age. [score:2]
MicroRNA-122 (miR-122) plays an important role in the regulation of liver metabolism, but its intrinsic physiological functions require further clarification. [score:2]
It consists of 2163 metabolites and 3047 reactions in eight compartments and was used to predict the metabolic capability under a particular condition and to infer the metabolic reprogramming of hepatocytes under miR-122 dysregulation. [score:2]
Since miR-122 is a highly abundant liver-specific miRNAs, an imbalance of the miRNA homeostasis in Mir122a [–/–]liver is anticipated. [score:1]
However, how miR-122 affects the metabolic network of hepatocytes is unclear. [score:1]
However, the intrinsic physiological roles of miR-122 remain largely undetermined. [score:1]
[1 to 20 of 20 sentences]
32
[+] score: 50
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-32, mmu-mir-1a-1, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-144, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-200b, mmu-mir-206, hsa-mir-208a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-214, hsa-mir-200b, mmu-mir-299a, mmu-mir-302a, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-144, hsa-mir-134, hsa-mir-206, mmu-mir-200a, mmu-mir-208a, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-328, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-214, mmu-mir-135a-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, hsa-mir-361, mmu-mir-361, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-377, mmu-mir-377, hsa-mir-328, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-20b, hsa-mir-429, mmu-mir-429, hsa-mir-483, hsa-mir-486-1, hsa-mir-181d, mmu-mir-483, mmu-mir-486a, mmu-mir-367, mmu-mir-20b, hsa-mir-568, hsa-mir-656, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-744, mmu-mir-181d, mmu-mir-568, hsa-mir-892a, hsa-mir-892b, mmu-mir-208b, hsa-mir-744, hsa-mir-208b, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-1307, eca-mir-208a, eca-mir-208b, eca-mir-200a, eca-mir-200b, eca-mir-302a, eca-mir-302b, eca-mir-302c, eca-mir-302d, eca-mir-367, eca-mir-429, eca-mir-328, eca-mir-214, eca-mir-200c, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-mir-133a, eca-mir-144, eca-mir-25, eca-mir-135a, eca-mir-568, eca-mir-133b, eca-mir-206-2, eca-mir-1-2, eca-let-7f, eca-mir-24-2, eca-mir-134, eca-mir-299, eca-mir-377, eca-mir-656, eca-mir-181a, eca-mir-181b, eca-mir-32, eca-mir-486, eca-mir-181a-2, eca-mir-20b, eca-mir-361, mmu-mir-486b, mmu-mir-299b, hsa-mir-892c, hsa-mir-486-2, eca-mir-9021, eca-mir-1307, eca-mir-744, eca-mir-483, eca-mir-1379, eca-mir-7177b, eca-mir-8908j
Normalized expression levels of the most up- (a) and down-regulated (b) miRNA in Pony compared to Warmblood serum as well as eca-miR-200a (c) that is downregulated by HMGA2 We next selected a total of 177 target-genes of eca-miR-122 using TargetScan [28] and performed gene set enrichment analysis with GeneCodis [29] to assess their biological role. [score:12]
Normalized expression levels of the most up- (a) and down-regulated (b) miRNA in Pony compared to Warmblood serum as well as eca-miR-200a (c) that is downregulated by HMGA2 We next selected a total of 177 target-genes of eca-miR-122 using TargetScan [28] and performed gene set enrichment analysis with GeneCodis [29] to assess their biological role. [score:12]
The most significant up- (eca-miR-122) and down-regulated (eca-miR-328) miRNAs in ponies related to Warmblood are shown on Fig.   7a-b. Fig. 7Significantly differentially expressed miRNA in the serum of ponies. [score:6]
The human miR-122 is involved in glucose and lipid metabolism [45, 46] and it has been proposed as a therapeutic target for metabolic diseases [46]. [score:5]
For instance, we showed an increased expression of circulating serum miR-122 and miR-200 in ponies together with the predicted miRNA target genes that are required in the control of energy metabolism. [score:5]
A total of 50 miRNAs in serum proved to be potential biomarkers to differentiate specific breed types, of which miR-122, miR-200, miR-483 were over-expressed and miR-328 was under-expressed in ponies compared to Warmbloods. [score:4]
The most significantly DEmiR was eca-miR-122, which was highly up-regulated in ponies compared to Warmbloods (Fig.   7a). [score:3]
Ponies are known to be among breeds more prone to develop equine metabolic syndrome (EMS) [47] and therefore miR-122 may be of particular interest for unravelling the molecular mechanism of this disease. [score:3]
[1 to 20 of 8 sentences]
33
[+] score: 48
Some works have evidenced that miR-122 inhibition repressed the expression of many genes and that the expression of HNF-4α could be directly or indirectly (via HNF-6) affected by miR-122. [score:9]
6, 7, 8 Particularly, the expression of HNF-4α is upregulated during overexpression of miR-122 [7] and zebrafish [6] hepatocyte, and not cholangiocyte differentiation. [score:8]
[6] One interesting point to be considered is that the miR-122 expression is regulated in part by HNF-1α and HNF-4α in cultured hepatocellular cancer-derived cells [7] and adult liver [15] raising the possibility that many liver-enriched transcription factors (LETFs) positively feedback on miR-122 expression to control hepatocyte differentiation. [score:5]
6, 7 The miR-122 expression is driven by liver-enriched transcription factors, including hepatocyte nuclear factor (HNF) 6 and 4α that also fine-tune miR-122 dosage during liver development in vivo. [score:4]
Gene expression of ALB, AFP, HNF-4α and miR-122. [score:3]
[20] In conclusion, results of this study showed altered expression of ALB, HNF-4α and miR-122 in HNOD fetus liver. [score:3]
Moreover, this study is the first to describe the influence of diabetes on the expression of hepatic markers (ALB, AFP), HNF-4α and miR-122 in NOD fetus liver. [score:3]
In view of the importance of diabetes for maternal and neonatal health, the objective of the present study was to assess the influence of diabetes on the expression of albumin (ALB), alpha-Fetoprotein (AFP), Hepatic Nuclear Factor-4 alpha (HNF-4α) and miR-122 by liver fetal cells from hyperglycemic and normoglycemic NOD mice at 19, 5 day of gestation. [score:3]
[4] As a result, miR-122 is crucial for liver development, differentiation, homeostasis and functions. [score:2]
The miR-122 expression was significantly reduced in HNOD (0.27±0.10, P<0.05) compared to NNOD (0.88±0.15) (Figure 2). [score:2]
The miR-122 plays a central role in liver development, differentiation, homeostasis and functions. [score:2]
MicroRNA-122 (miR-122) is a highly abundant and liver-specific miRNA that accounts for 70% of the total liver miRNA population. [score:1]
[14] The decrease of miR-122 in HNOD animals could be related to the reduction of HNF-4α by hepatic liver cells. [score:1]
[5] Evidences indicate that the activation of miR-122 plays an important role in guidance hepatocyte differentiation and maturation in vitro and in vivo. [score:1]
The miR-122 fold expression was calculated by application of 2 [−ΔΔ]Ct method. [score:1]
[1 to 20 of 15 sentences]
34
[+] score: 47
Change of expression in human aHSC (Fold Change) Expression in plasma of liver disease-compared to healthy individuals Source Expression trend Etiology miRNA-150-5p ↓ (870) ↑ HBV Li et al., 2010; Venugopal et al., 2010 miRNA-192-5p ↓ (8.53) ↑ HBV, NASH, NAFLD Tryndyak et al., 2012; Winther et al., 2013; Becker et al., 2015; Pirola et al., 2015 miRNA-200b-3p ↑ (22.55) ↑ NAFLD, HBV/HCV -associated HCC Murakami et al., 2011; Tryndyak et al., 2012 miRNA-122-5p N. D. ↑ HCV, HBV, NASH, NAFLD Arataki et al., 2013; Shrivastava et al., 2013; Tan et al., 2014; Pirola et al., 2015 miRNA-21-5p N. D. = /↑ HBV, NAFLD Yamada et al., 2006; Cermelli et al., 2011; Becker et al., 2015 miRNA-92a-3p N. D. ↑ HBV -associated HCC, HCV Li et al., 2010; Ji et al., 2011; Shrivastava et al., 2013 N. D., non-determined. [score:8]
While miRNA-122 levels were significantly up-regulated in total plasma of both HBV and HCV fibrotic patients, we observed a significant down-regulation of miRNA-122 in vesicles of the HCV population, and no change in HBV samples. [score:7]
Its expression in liver reduces upon injury, while significantly more miRNA-122 is detected in total plasma of fibrotic patients. [score:3]
Elevated miR-122 serum levels are an independent marker of liver injury in inflammatory diseases. [score:3]
Significantly higher expression of miRNA-122 in the patient groups confirms earlier reports by Trebicka et al. (2013) and Arataki et al. (2013), which showed that higher miRNA-122 levels reflect early stages of chronic HCV and HBV induced liver fibrosis. [score:3]
During progression of liver fibrosis to cirrhosis, significant reduction of miRNA-122 can be seen in total liver tissue, which is reflected by the reduced circulating miRNA-122 levels during later stages of fibrosis (Trebicka et al., 2013) and potentially the result of less pronounced hepatocyte damage at these stages of disease. [score:3]
MiRNA-122, -192, and -200b Are Up-Regulated in Total Plasma of Early Stage Fibrotic Patients. [score:3]
However, in the research of Bala et al. (2012), elevated levels of vesicle -associated miRNA-122 were found when comparing murine mo dels of alcohol- and inflammation -induced liver disease with a control population. [score:3]
MiRNA-122 was used as positive control, as its changing expression in circulation has already been wi dely described for various causes of liver fibrosis, including HBV (Xu et al., 2011; Waidmann et al., 2012; Winther et al., 2013) and HCV (Cermelli et al., 2011; Wang J. H. et al., 2015; Motawi et al., 2016) and is strongly correlated with hepatocyte damage (Farid et al., 2012; Roderburg et al., 2015). [score:2]
The combination of these 2 predictive values, plus the confirmation of elevated levels of miRNA-122 in the total plasma of our patients, ensured us we had a patient population with exclusively early fibrotic patients. [score:1]
Absolute quantification of serum microRNA-122 and its correlation with liver inflammation grade and serum alanine aminotransferase in chronic hepatitis C patients. [score:1]
miRNA Mature miRNA primer miR-92a-3p TATTGCACTTGTCCCGGCCTGT miR-122-5p TGGAGTGTGACAATGGTGTTTG miR-150-5p TCTCCCAACCCTTGTACCAGTG miR-192-5p CTGACCTATGAATTGACAGCC miR-200b-3p TAATACTGCCTGGTAATGATGA miR-21-5p TAGCTTATCAGACTGATGTTGA cel-miR-39-3p AGCTGATTTCGTCTTGGTAATA All primers were ordered from Integrated DNA Technologies (IDT, Leuven, Belgium), and are specific for detection of both human and murine miRNA -expression. [score:1]
Circulating microRNA-22 correlates with microRNA-122 and represents viral replication and liver injury in patients with chronic hepatitis B. J. Med. [score:1]
In our experiments, the levels of miRNA-122 were not affected in circulating ECVs from early fibrosis stage HBV and HCV patients. [score:1]
Serum microRNA-122 levels in different groups of patients with chronic hepatitis B virus infection. [score:1]
A potential explanation for this event could be the discharge of this miRNA by hepatocytes, as this cell type has inherent abundant levels of miRNA-122 (Pirola et al., 2015). [score:1]
Elevated serum microRNA-122/222 levels are potential diagnostic biomarkers in Egyptian patients with chronic hepatitis C but not hepatic cancer. [score:1]
These findings were later confirmed in in vitro-experiments, where APAP -treated hepatocytes released ECVs that were rich in miRNA-122 (Holman et al., 2016). [score:1]
Also in our experiments, an enhanced presence of miRNA-122 could be found in the total plasma of early stage HBV- and HCV-infected patients. [score:1]
Hepatic and serum levels of miR-122 after chronic HCV -induced fibrosis. [score:1]
Circulating microRNAs, miR21, miR-122, and miR-223, in patients with hepatocellular carcinoma or chronic hepatitis. [score:1]
[1 to 20 of 21 sentences]
35
[+] score: 43
The four upregulated miRNAs, i. e., miR-122, miR-194, miRNA-101b and miRNA-705, in mice treated with or without metformin were consistent with four of the 60 downregulated miRNAs from the control group and MCD-fed mice. [score:7]
By contrast, miRNA-122 and miRNA-194 were significantly upregulated by metformin out of the nine miRNAs that were downregulated in the NASH liver of MCD-fed mice. [score:7]
Notably, miR-122, miR-194, miRNA-101b, and miRNA-705 were upregulated and miRNA-376a, miRNA-127, miRNA-34a, miRNA-300 and miRNA-342-3p were downregulated in the liver tissue of MCD-fed mice treated with or without metformin (Table IB and Fig. 6). [score:7]
Similar to miRNA-122, downregulation of miRNA-194 enhances the expression of frizzled-6 (FZD6) and promotes tumorigenesis in the adult liver (26). [score:6]
Additionally, it has been described that miRNA-122 is downregulated in NASH and may alter lipid metabolism in the liver (13). [score:4]
Taken together, it is suggested that one of the downstream targets of the metformin -induced pathway is miRNA-122 and/or miRNA-194. [score:3]
Hu et al (14) recently reported that miRNA-122 is a liver-specific miRNA and acts as a suppressor of cell proliferation and carcinogenesis in hepatocytes (19). [score:3]
However, the target gene of miRNA-122 involved in lipid metabolism remains elusive (25). [score:3]
Currently, several target genes of miRNA-122 have been shown to be involved in hepatocarcinogenesis, such as a distintegrin and metalloproteinase family 10 (ADAM10), serum response factor (SRF) (21), insulin-like growth factor 1 receptor (Igf1R) (22), cyclin G1 (23) and Wnt1 (24). [score:3]
[1 to 20 of 9 sentences]
36
[+] score: 42
Two mouse strains, C57BL/6 and BALB/c, were employed as schistosomiasis japonica disease mo dels to detect in serum, four host circulating miRNAs, miR-122, miR-21, miR-20a and miR-34a, all of which have been suggested to be correlated with different types of liver disease progression [30– 33]. [score:5]
Temporal abundance analysis of host serum miRNAs in two murine mo dels during S. japonicum infectionTwo mouse strains, C57BL/6 and BALB/c, were employed as schistosomiasis japonica disease mo dels to detect in serum, four host circulating miRNAs, miR-122, miR-21, miR-20a and miR-34a, all of which have been suggested to be correlated with different types of liver disease progression [30– 33]. [score:5]
These observations led us to hypothesise that the up-regulation of serum miR-122, miR-21 and miR-34a levels in BALB/c mice during infection may be mainly due to the massive release of these miRNAs from necrotic hepatocytes. [score:4]
There are consistent observations that miR-122 serum levels are elevated in a number of liver diseases with different etiologies, suggesting that this miRNA may act as a clear biomarker of general liver injury [11, 42]. [score:3]
The advantage of using two mouse strains in this study was the capacity to observe the considerably different dysregulation of circulating host miRNAs, miR-122, miR-21 and miR-34a, in the sera of C57BL/6 and BALB/c mice during S. japonicum infection. [score:2]
M, Ultra low range DNA ladder; lane 1, ath-miR-159a; lane 2, mmu-miR-122; lane 3, mmu-miR-21; lane 4, mmu-miR-20a; lane 5, mmu-miR-34a; lane 6, ath-miR-159a; lane 7, sja-miR-277; lane 8, sja-miR-3479-3p. [score:1]
There were no significant differences in hepatic egg burden between the two mouse strains at any time-point (2-Way ANOVA, P>0.05) (Fig 2A), indicating that differences in hepatic egg burden did not cause the differential serum levels of miR-122, miR-21 and miR-34a observed in the two mouse strains during S. japonicum infection. [score:1]
In BALB/c mice, the elevated serum miR-122 and miR-21 levels showed a much stronger correlation with hepatocellular enzymes than with the level of hepatic necrosis. [score:1]
In addition, the abundance of serum miR-34a showed the strongest association with the degree of liver fibrosis in BALB/c mice during schistosomiasis progression, followed by miR-122 and miR-21 (Fig 4E). [score:1]
With miR-122 and miR-34a, there was a significant difference between the two mouse strains at 4–11 weeks p. i., while for miR-21 and miR-20a, significant difference was only observed at 7 weeks p. i. (Fig 1C). [score:1]
Here, significant correlations between the levels of serum miRNAs (miR-122 and miR-21) and liver enzymes indicate that the passive release from injured tissues may represent a key mechanism for the observed increased levels of these miRNAs. [score:1]
Furthermore, plasma miR-122 has been shown to have a better performance than ALTs in the detection of liver injury [43, 44]. [score:1]
This can be explained by the fact that hepatic necrosis peaked at 6 weeks p. i. in this strain and dramatically decreased thereafter, while the serum levels of miR-122 and miR-21 reached a plateau after 7 weeks p. i., due to accumulation of these miRNAs, which are extremely stable in body fluids [9, 47]. [score:1]
In contrast, apart from miR-20a, the serum levels of the three other host miRNAs were significantly elevated in BALB/c mice by 6 (miR-122) or 7 (miR-21 and miR-34a) weeks p. i. and thereafter (Fig 1B and S3 Fig). [score:1]
For example, the level of liver-specific miR-122 was elevated in the serum of BALB/c mice after S. japonicum infection [24], while it did not change in the serum of C57BL/6 mice between 4–12 weeks post- S. mansoni infection [18]. [score:1]
Similar results were observed by He et al., who found that the levels of miR-122 and miR-34a were significantly elevated in the serum of BALB/c mice at 72 days post- S. japonicum infection [24]. [score:1]
In C57BL/6 mice, the serum concentrations of miR-122, miR-20a and miR-34a did not change at any time point post infection, but the level of serum miR-21 was increased at 6 (1-Way ANOVA, P<0.01) (Fig 1A). [score:1]
Three host circulating miRNAs, miR-122, miR-21 and miR-34a, may, as a panel, serve as indicative biomarkers for hepatopathology progressions. [score:1]
S1 Fig M, Ultra low range DNA ladder; lane 1, ath-miR-159a; lane 2, mmu-miR-122; lane 3, mmu-miR-21; lane 4, mmu-miR-20a; lane 5, mmu-miR-34a; lane 6, ath-miR-159a; lane 7, sja-miR-277; lane 8, sja-miR-3479-3p. [score:1]
This may explain why the significant alteration in miR-122 serum levels could be sensitively detected in BALB/c mice as early as 6 weeks p. i., at the same time when hepatic necrosis is evident. [score:1]
However, miR-21, miR-122 and miR-223 were also shown elevated in the serum of patients with HCC (hepatic cellular carcinoma) and chronic hepatitis and these miRNAs were suggested as novel biomarkers for liver injury but not specifically for HCC [32], thereby providing support that the elevation of serum miRNA-223 level might also be caused by liver necrosis due to S. japonicum infection. [score:1]
MiR-122 is the predominant liver-specific miRNA, constituting about 70% of the total miRNA population in normal liver tissue [41]. [score:1]
Meanwhile, the degree of hepatic granuloma and fibrosis also stabilized after 7 weeks p. i. in BALB/c mice, which resulted in significant positive correlations between the serum miR-122 and miR-21 levels and hepatic fibrosis severity. [score:1]
The serum miR-20a and miR-34a levels showed a significant but weaker correlation with the serum AST and ALT levels than those of miR-122 and miR-21 in BALB/c mice. [score:1]
The inconsistent levels of the host circulating miRNAs, miR-122, miR-21 and miR-34a in serum were confirmed in the two murine mo dels during infection, which limits their potential value as individual diagnostic biomarkers for schistosomiasis. [score:1]
Thus, as summarized in Table 1, the differential levels of miR-122, miR-21 and miR-34a in host sera are mainly the result of hepatopathology caused by the different types of immune response induced in C57BL/6 and BALB/c mice after S. japonicum infection, especially following the onset of egg deposition. [score:1]
In summary, inconsistent serum levels of host miR-122, miR-21 and miR-34a in different murine mo dels during infection may impair their value as diagnostic biomarkers for schistosomiasis. [score:1]
Among these four miRNAs, the serum concentration of miR-122 showed the strongest association with the serum levels of liver injury-related enzymes and the severity of hepatic necrosis in BALB/c mice during S. japonicum infection, and this was followed by miR-21 (Fig 4B–4D). [score:1]
[1 to 20 of 28 sentences]
37
[+] score: 39
To compare miR-27a with other obesity -modified miRNAs, expression levels of hepatic miR-122 and miR-132 were also analyzed and found to be dramatically upregulated in livers of HFD-fed and ob/ob mice (Fig.   S1) as described in previous reports 27, 30. [score:6]
Surprisingly, enforced expression of Fasn and Scd1 could abolish the inhibition effects of excess miR-27a on TG accumulation (Fig.   1g) but not affect those of miR-122 (Fig.   S2b) in primary hepatocytes. [score:5]
Enforced expression of Fasn and Scd1 abolished the inhibition effects of excess miR-27a on TG accumulation (Fig.   2g) but not those of miR-122 (Fig.   S2c) in primary hepatocytes. [score:5]
In consistent with previous studies, levels of miR-122 and miR-132 were upregulated in the fatty livers of obese mice caused by diets feeding (HFD or HCD) or genetic mutation (ob/ob) (Fig.   S1). [score:5]
But in livers of HCD-feeding mice, which hepatic lipogenesis is robustly promoted, miR-27a exhibited an insignificant reduction while miR-122 and miR-132 were dramatically upregulated (Fig.   S2b). [score:4]
Primary hepatocytes were transfected with miR-27a mimics (10 pmol/ml), inhibitors (50 pmol/ml), miR-122 mimics (5 pmol/ml) or negative control (10 pmol/ml) using HiPerFect (Qiagen) as per manufacturer’s instructions and following experiments were performed 48 h after transfection. [score:3]
MiRNA double-stranded mimics for miR-27a and miR-122, and inhibitors for miR-27a were obtained from Qiagen. [score:3]
Furthermore, ectopic expression of miR-27a or miR-122 could block sodium oleate -induced TG accumulation in primary hepatocytes, respectively (Figs  1g and S2b). [score:3]
MiR-122 is the first miRNA which was discovered to be involved in the regulation of lipid synthesis, catabolism and secretion of liver 27, 28. [score:2]
Interestingly, in these fatty livers, miR-27a displayed a similar change as miR-122 and miR-132 did. [score:1]
These results suggest the functions and underlying molecular mechanisms of miR-27a might be different from other obesity -modified miRNAs (e. g. miR-122 and miR-132) in various contexts of fatty livers. [score:1]
Consistently, excess miR-27a alleviated oleate-initiated lipid accumulation of hepatoytes as well as excess miR-122 (Fig. 2g and S2c). [score:1]
[1 to 20 of 12 sentences]
38
[+] score: 38
Taken together with our later observations that targeting of the liver-specific miR-122-5p or poorly abundant miR-195-5p, miR-25-3p, miR-200a/b/c-3p, miR182-5p and the mutant miR-224-5p mut2 by 2′OMe AMOs (but not their LNA/DNA AMO counterparts) also resulted in significant inhibition of immunostimulatory ssRNA sensing, our work establishes sequence -dependent and miRNA-independent off-target inhibitory activity of 2′OMe AMOs on the immune sensing of pathogenic RNA by human and mouse phagocytes. [score:9]
Mutation or deletion of part of this motif resulted in the loss of inhibitory activity for miR-200a-3p, miR-122-5p and NC1 2′OMe AMO variants, while introduction of this motif to the poorly inhibitory miR-224-5p AMO significantly increased the inhibitory activity of the AMO on TLR7. [score:8]
The sequence-specific and miRNA-independent significant inhibition of immunostimulatory ssRNA sensing by 2′OMe AMOs targeting miR-195-5p, miR-25-3p, miR-122-5p, miR-200a/b/c-3p and miR182-5p (Figure 2B) was supported by the lack of inhibitory activity with LNA/DNA AMOs (Figure 2C), and the low abundance of these miRNAs (less than 100-fold the level of the most abundant miRNA in BMMs) (Figure 2A). [score:7]
Critically, this core sequence overlapped with a significantly enriched motif found in all the inhibitory sequences of Class 2 AMOs previously identified, in 5′-3′ orientation (for miR-200a/b-3p, and miR-25-3p) or 3′-5′ orientation (for AMO-NC1, miR-182-5p, miR-122-5p and miR-195-5p) (Figure 4C and Supplementary Table S2). [score:3]
Our analyses of truncated variants of miR-122-5p and miR-200a-3p 2′OMe AMOs also show that disruption of the context of the inhibitory motif can significantly reduce its activity (Figure 4). [score:3]
We speculate that this relates to the position of the motif at the 5′-end of the sequence, which precludes formation of secondary structures necessary for inhibitory activity; similar to what is seen with miR-122-5p short. [score:3]
This is illustrated with the example of the anti-miR-122-5p miRNA, miravirsen, a 15-nucleotide LNA/DNA phosphorothioate AMO with demonstrated therapeutic effect against hepatitis C virus in recent human clinical trials (34). [score:1]
Critically, we found this motif in miR-182-5p and miR-122-5p AMOs, when read in 3′-5′ orientation. [score:1]
Similar results were found for a 15mer variant of miR-122–5p (Figure 4G). [score:1]
To define further the impact of this motif in the modulation of TLR7/8 sensing, we generated a set of AMO mutants and truncated variants (Figure 4D) based on miR-200a/c-3p, miR-122-5p and NC1 2′OMe AMOs. [score:1]
The miR-122-5p AMO (reported as ‘15mer 2′OMe 5′inZEN, 3′ZEN’) was previously found to have similar miR-122–5p inhibitory activity in reported assays, compared to its full-length counterpart (7). [score:1]
[1 to 20 of 11 sentences]
39
[+] score: 37
It is wi dely reported that miRNAs translate across species; for example, we have reported that miR-122-5p reports liver injury in cell mo dels, zebrafish, rodents and humans. [score:3]
Biomarker sensitivity - ROC curve analysis supports the potential for miR-122-5p to predict the development of ALI. [score:2]
For patient stratification at first presentation to hospital miR-122-5p is the lead miRNA candidate for clinical development, possibly in combination with miR-483-3p. [score:2]
The most abundant miRNA species in the liver 20, miR-122-5p, was the highest increased circulating miRNA but other species were elevated to comparable degrees (miR-885-5p, miR-151-3p) or were ranked higher by random forest analysis in terms of ability to report injury (miR-382-5p). [score:1]
ROC analysis revealed that miR-122-5p was superior to ALT activity with regard to predicting APAP-TOX in early APAP patients. [score:1]
In the 67 APAP-early patients, miR-122-5p identified subsequent liver injury when normalized by any of the 6 endogenous miRNA normalizers described above (miR-122-5p area under ROC curve normalized by miR-1913, 0.97 (95% CI 0.92–1.01); miR-671, 0.96 (0.92–1.01); miR-1287, 0.95 (0.90–1.00); let7-d, 0.94 (0.89–1.00); miR-1260, 0.93 (0.88–1.00); miR-324, 0.93 (0.87–1.00) miR-122-5p ROC-AUC significantly larger than all other miRNAs – P < 0.05). [score:1]
miR-885-5p remained elevated longer than miR-122-5p (Fig. 6B). [score:1]
In addition to miR-122-5p, the miRNA species miR-22, miR-29b, miR-29c, miR-130a and miR-193 were increased in both mice and humans. [score:1]
In situ hybridization for miR-122-5p and miR-885-5p was performed on liver explants removed following acetaminophen overdose. [score:1]
Figure (A) Pearson correlation plot of circulating miR-885-5p and miR-122-5p across APAP-TOX and APAP-no TOX patients. [score:1]
The largest fold increase miRNAs (miR-122-5p and miR-885-5p) were highly correlated across patients in the training set (Fig. 3A). [score:1]
At first presentation, miR-122-5p was also superior to other miRNAs with regard to prediction of subsequent liver injury. [score:1]
Images from hematoxylin and eosin (H&E) and in situ hybridization for miR-122-5p and miR-885-5p are presented. [score:1]
When normalized by any of the stable miRNAs, miR-122-5p was superior to ALT. [score:1]
miR-122-5p, miR-885-5p, miR-151-3p and miR-382-5p reported acute liver injury due to causes other than acetaminophen, which is consistent with them being liver specific and demonstrates that this panel has utility in the diagnosis of acute liver injury due to multiple causes. [score:1]
These data suggest release of miR-122 and miR-885 from the same cells attached to the same carrier protein. [score:1]
However, there was no difference in miR-122-5p, miR-885-5p, miR-151a-3p or miR-382-5p (Table 1). [score:1]
The largest fold change miRNAs (miR-122-5p, miR-885-5p and miR-151-3p) and the best discriminating miRNA (miR-382-5p) were taken forward and tested for specificity. [score:1]
Interestingly, combining miR-122-5p with miR-483-3p resulted in an increase in predictive accuracy (as judged by the largest area under the ROC curve). [score:1]
miR-122-5p and miR-885-5p are released from human hepatocytes bound to the carrier protein Ago2. [score:1]
For the first time we demonstrate that human miR-122-5p circulates bound to the protein Ago2 and this fraction increases with liver injury. [score:1]
Comparative biomarker profiles for miR-122-5p, miR-885-5p, miR-151-3p and miR-382-5p are summarized in supplementary Table 5. Although miR-122-5p had the highest fold increase in APAP-TOX patients, it was ranked 11th place in the miRNA panel, suggesting that other microRNA species may have greater clinical utility. [score:1]
The 3 largest fold increase miRNAs (miR-122-5p, miR-885-5p and miR-151a-3p) and the miRNA with the lowest prediction error from the classifier mo del (miR-382-5p) were taken forward and tested for specificity and sensitivity. [score:1]
By contrast with vehicle treated controls (N = 7), acetaminophen toxicity in mice resulted in increased miR-122-5p and miR-151a-3p, and decreased miR-382-5p, in line with our human data (Fig. 5E–H). [score:1]
Figure (B– D) represent the relative Ago2 fraction for miR-122-5p, miR-885-5p and miR-151a-5p respectively in APAP-TOX (N = 6) and APAP-no TOX (N = 6) patients. [score:1]
Figure (E– H) present miR-122-5p, miR-885-5p, miR-151a-3p and miR-382-5p in control mice, APAP overdose mice and cisplatin -induced acute kidney injury (AKI) mice. [score:1]
miR-122-5p very accurately predicted liver injury at first presentation to hospital, especially when combined with the largest decrease miRNA. [score:1]
Figure (A– D) present circulating miR-122-5p, miR-885-5p, miR-151a-3p and miR-382-5p in APAP-no TOX patients and patients with acute liver injury (ALI) induced by APAP overdose or another aetiology (non-APAP). [score:1]
Cisplatin had no effect on miR-122-5p, miR-885-5p, miR-151a-3p or miR-382-5p (Fig. 5E–H). [score:1]
After antibody -mediated pull down of Ago2 (corrected by IgG control), acetaminophen toxicity induced a significant increase in the amount of miR-122-5p and miR-885-5p specifically bound to Ago2 (Fig. 3B,C), consistent with both miRNAs being released bound to this protein. [score:1]
The temporal profiles of the individual miRNAs were different; miR-122-5p concentration was elevated but decreased earlier than ALT (Fig. 6A). [score:1]
The largest median (IQR) increased circulating miRNAs were miR-122-5p 68 (11–277), miR-885-5p 57 (17–372) and miR-151a-3p 57 (16–360) (Fig. 2B). [score:1]
In rats, in addition to miR-122-5p, the increase of miR-22, miR-193 and miR-194 was in accordance with our human data 23. [score:1]
[1 to 20 of 33 sentences]
40
[+] score: 36
Other miRNAs from this paper: mmu-mir-206, mml-mir-122a, mml-mir-206
For example, the microRNA target sites for the liver-specific and the skeletal muscle-specific microRNAs, miR-122 and 206, respectively, have been previously shown to reduce gene expression in liver and muscle following the incorporation of these target sites within an AAV vector genome [32], [33], [34], [35]. [score:7]
Restriction of transgene expression to muscle by the incorporation of miR-122 target sites reduced 201Ig IA expression, although not significantly, to 366 µg/ml (Figure 5E). [score:7]
Initial studies were performed with AAV8 vectors expressing ffLuc from a CMV promoter, with and without miR-122 and miR-206 target sites, in order to confirm the activity of the microRNA target sites. [score:7]
Incorporation of target sites for miR-122 and miR-206 into the 3′ UTR of the transgene produced specific knockdown of gene expression in the liver and muscle of 6.6- and 112-fold, respectively (Figures 5A-D). [score:6]
ffLuc and 201Ig IA plasmids driven by the CMV promoter containing microRNA target sites were produced by insertion of six copies of either the miR-122 or miR-206 target sites into the 3′ UTR region. [score:5]
Therefore, transgene expression could be restricted from either liver by miR-122 or muscle by miR-206. [score:3]
miR-122 (B) or AAV8. [score:1]
[1 to 20 of 7 sentences]
41
[+] score: 36
Sirt6 downregulates miR-122 by deacetylating H3K56, reduces miR-122 expression, and increases fatty acid β-oxidation. [score:6]
Overexpression of Sirt6 in mouse liver reduced miR-122 expression and increased that of fatty acid β-oxidation genes (Elhanati et al., 2016). [score:5]
miR-122, a mammalian liver-specific microRNA, is processed from hcr mRNA and may downregulate the high affinity cationic amino acid transporter CAT-1. RNA Biol. [score:4]
Sirt6 and miR-122 are reciprocally regulated to control the gene expression of fatty acid oxidation (Elhanati et al., 2016). [score:4]
Sirt6 downregulates miR-122 by deacetylating H3K56. [score:4]
miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. [score:4]
MicroRNA-122 (miR-122), a microRNA (miRNA) highly expressed in liver, constitutes 70% of the total miRNA pool in liver (Chang et al., 2004; Bhattacharyya et al., 2006; Jopling, 2012). [score:3]
MiR-122 binds to three sites on the Sirt6 3' untranslated region and reduces its levels. [score:2]
Reciprocal regulation between SIRT6 and miR-122 controls liver metabolism and predicts hepatocarcinoma prognosis. [score:2]
MiR-122 plays an important regulatory role in many metabolic processes, including cholesterol synthesis and fatty acid oxidation (Krützfeldt et al., 2005; Esau et al., 2006). [score:1]
Liver-specific microRNA-122: biogenesis and function. [score:1]
[1 to 20 of 11 sentences]
42
[+] score: 35
Eight miRNAs (miR-101, miR-107, miR-122, miR-29, miR-365, miR-375, miR-378, and miR-802), whose expression was found to be downregulated in c-Myc and/or AKT/Ras liver tumors, were selected and their tumor suppressor activity was assessed in c-Myc and AKT/Ras mice. [score:8]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
In summary, the present results indicate that miR-107, miR-122, miR-29, miR-365, and miR-802 possess weak to moderate tumor suppressive properties, as none of them is able to completely prevent oncogene driven liver tumor development in mice. [score:4]
Weak to moderate tumor suppressor potential of miR-107, miR-122, miR-29, miR-365, and miR-802 in c-Myc and AKT/Ras driven liver tumor development. [score:4]
Overexpression of miR-122 delayed c-Myc induced hepatocarcinogenesis, as two of nine c-Myc/miR-122 injected mice developed high tumor burden 8 weeks post injection (Supplementary Figure 5A and 5B). [score:3]
The tumor suppressor activity of miR-122 against AKT/Ras induced liver tumor was even more pronounced, as all of the AKT/Ras/miR-122 injected mice appeared to be healthy 8 weeks post injection. [score:3]
Among the 8 miRNAs, 4 miRNA (miR-101, miR-29, miR-107 and miR-122) had available human miRNA array data. [score:1]
Macroscopically, livers from AKT/Ras/miR-122 injected mice were pale, but no tumor nodules were detected. [score:1]
Histologically, AKT/Ras/miR-122 livers showed the presence of clusters of lipid-rich preneoplastic hepatocytes occupying most of the liver parenchyma, whereas no frankly malignant lesions were identified (Supplementary Figure 5C and 5D). [score:1]
[1 to 20 of 10 sentences]
43
[+] score: 35
Other miRNAs from this paper: mmu-mir-34a, mmu-mir-33, mmu-mir-370
We examined both mRNA and protein levels of t-ACC and did not find any differences between the two groups; (2) significantly decreased expressions of miR-122 (61% decrease), miR-370 (64% decrease) and miR-33 (70% decrease), which involved in the regulation of lipid metabolism (Fig. 3B); 3) down-regulated the mRNA expression of genes related to fatty acid oxidation, such as carnitine palmytotransferase 1 (Cpt1α), peroxisome proliferator-activated receptor alpha (Pparα) and peroxisome proliferator-activated receptor-gamma coactivator-1 alpha (Pgc1α) (Fig. 4A); (4) resulted in higher mRNA expression of liver X receptor α (Lxrα) and fatty acid translocase (Fat/ Cd36) (Fig. 4A); and 5) decreased mRNA expression of cholesterol efflux genes ATP -binding cassette sub -family G member 5 (Abcg5) and ATP -binding cassette sub -family G member 8 (Abcg8), and bile acid synthesis genes ATP -binding cassette sub -family G member 11 (Abcg11), cytochrome P450 (CYP)7A1 (Cyp7a1) and Cyp8b1 (Fig. 4B). [score:13]
The effects of miR-370 on fatty acids and hepatic TG accumulation might be through the modulation of miR-122 expression, as miR-370 up-regulates the expression of miR-122 49. [score:8]
The decreased expression of miR-122 up-regulated the level of genes associated with triglycerides biosynthesis and storage, subsequent microsteatosis and liver inflammation 48. [score:6]
Our present data showed the significantly decreased expression of miR-122, miR-370 and miR-33, accompanied with the increased expression of lipogenetic proteins ACC and SCD1 induced by HCLD feeding, supported the role of those miRNAs in the pathogenesis of hepatic steatosis. [score:5]
In the present study, we found the significantly decreased expression of miR-122, miR-370 and miR-33 after HCLD treatment, which may provide an additional mechanism regarding the hepatic steatosis induced by HCLD. [score:3]
[1 to 20 of 5 sentences]
44
[+] score: 32
Other miRNAs from this paper: hsa-mir-122
The miR-122 down-regulates target mRNAs to establish tissue-specific gene expression patterns. [score:8]
The decreased expression of AMDHD1 in miR-122 treated liver indicated that AMDHD1 is one of the target genes of miR-122 and is involved in liver development and formation. [score:6]
The expression of AMDHD1 in the liver is inhibited by microRNA miR-122 antisense. [score:5]
The expression of AMDHD1 is negatively regulated by miR-122 in the liver, suggesting that AMDHD1 may be involved in liver development and formation. [score:5]
GDS1729 in the GEO Profiles shows that microRNA miR-122 antisense inhibits the expression of AMDHD1 in the liver (Figure 3B, P <0.01). [score:5]
AMDHD1 does not have miR-122 binding sites (www. [score:1]
org), which indicates that miR-122 is a trans-acting factor for AMDHD1. [score:1]
The miR-122 makes up 70% of all microRNA in the adult liver. [score:1]
[1 to 20 of 8 sentences]
45
[+] score: 32
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-27b, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-182, mmu-mir-199a-1, mmu-mir-143, mmu-mir-298, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-27a, mmu-mir-31, mmu-mir-98, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-181b-1, mmu-mir-379, mmu-mir-181b-2, mmu-mir-449a, mmu-mir-451a, mmu-mir-466a, mmu-mir-486a, mmu-mir-671, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-491, mmu-mir-700, mmu-mir-500, mmu-mir-18b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-669e, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-669a-10, mmu-mir-669a-11, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-486b, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-145b, mmu-let-7j, mmu-mir-451b, mmu-let-7k, mmu-mir-126b, mmu-mir-466c-3
To validate the miR array data, we studied several differentially expressed miRs (upregulated miRs: miR-122 and miR-181a and downregulated miRs: miR-23a, miR-18b, miR-31, and miR-182). [score:9]
To validate the expression of some of the miRs obtained from high-throughput miR array data, we selected 2 upregulated miRs (miR-122 and miR-181b) and 3 downregulated miRs (miR-23a, miR-98, and miR-31). [score:9]
In this study, we noted TCDD -induced upregulation of the following miRs (miR-122, -125a, -151, 181a, -200b, -206, -322, -345, -367b, -296, and -466i) and their expression profile varied from 1.5 to 2.0 fold. [score:6]
Real-Time PCR analysis demonstrated upregulated expression of miR-122 and miR-181a in thymocytes treated with TCDD when compared to vehicle -treated thymocytes (Fig 2A–B). [score:5]
For example, miR-122 that showed increased expression (>2.1 fold) in fetal thymi post-TCDD exposure, plays an important role in liver metabolism, toxicity, and cancer [64], [67]. [score:3]
[1 to 20 of 5 sentences]
46
[+] score: 31
Without the inhibition of miR-122, Ccl2 expression increased [102]. [score:5]
To elucidate the relevance of miR-122 depletion and HCC development, mutant mice with germ line knockout (KO) or liver-specific knockout (L KO) of the miR-122 locus were generated based on the Cre/loxP recombinase system in two studies [85, 99, 100]. [score:4]
In molecular level, it was confirmed that miR-122 negatively regulates Ccl2 expression by binding to the 3′UTR of Ccl2 mRNA. [score:4]
This same system of inducible myc expression was used to study the role of microRNA-26a (miRNA-26a) [84] and miRNA-122 [85] in HCC in subsequent studies. [score:3]
Mir122- KO or L KO mice provide us with a good example to study down-regulated microRNA in vivo. [score:3]
MiRNA-26a and miRNA-122 are found to be suppressed in c-myc induced liver tumors. [score:3]
Moreover, miR-122 exhibited tumor suppressor activity when delivered to livers of a non-inflammatory myc -driven HCC mouse mo del [100]. [score:3]
Constitutive and conditional miR-122 knockout mice. [score:2]
In addition, miR-122 played a protective role against DEN by down -regulating genes involved in proliferation, growth factor signaling, neovascularization, and metastasis [101]. [score:2]
Both mir122- KO (5-week-old) and –L KO (8- to 10-week-old) mice developed microsteatosis and liver inflammation due to triglyceride (TG) accumulation. [score:1]
MiR-122 is the predominant liver miRNA, making up 70% of the total miRNA population [98]. [score:1]
[1 to 20 of 11 sentences]
47
[+] score: 29
For example, miR-122, 24, 106b, 696 and 15b were up-regulated, but miR-126, 145 and 103 were down-regulated (Figure 4). [score:7]
miR-122 expression was most robustly dysregulated (> 6-fold) in ob/ob mouse liver (Figure 2A). [score:4]
For those up-regulated, the top ten were miR-122, 24, 195a, 106b, 15b, 802, 185, 214, 378, and let-7c. [score:4]
0080774.g004 Figure 4 RT-qPCR analysis was performed to quantify the expression levels of miR-122, 126, 145, 24, 106b, 103, 696 and 15b. [score:3]
Overview of the miRNA expression profiles in ob/ob mouse liver, miR-122 is the most abundant miRNA (Figure 2). [score:3]
RT-qPCR analysis was performed to quantify the expression levels of miR-122, 126, 145, 24, 106b, 103, 696 and 15b. [score:3]
It has been demonstrated that miR-370 induces the accumulation of hepatic triglycerides through interacting with miR-122 and Cpt 1α [23]. [score:1]
Accordingly, antagonist of miR-122 used in diet -induced obese mice significantly improved hepatic steatosis and reduced levels of triglyceride accumulation. [score:1]
Taken these previous observations and our data, miR-122 is a risk factor to induce obesity and hepatic metabolic dysfunction. [score:1]
Another study showed that hepatocytes from anti-miR-122 -treated mice showed increased fatty acid oxidation rates and reduced fatty acid synthesis. [score:1]
miR-122 is a liver-specific miRNA which has been identified to play roles in hepatitis C virus infection [13], cholesterol metabolism [14] and hepatocellular carcinoma [15]. [score:1]
[1 to 20 of 11 sentences]
48
[+] score: 28
Other miRNAs from this paper: mmu-mir-192
Finally, the liver appears to be an important source of circulating EVs in NAFLD animals as evidenced by the enrichment in blood with miR-122 and 192 - two microRNAs previously described in chronic liver diseases, coupled with a corresponding decrease in expression of these microRNAs in the liver. [score:5]
The specific compartment was not further assessed in this study and future studies to determine the circulating levels of miR-122 in EVs from patients with fatty liver disease are warranted. [score:3]
As shown in the CDAA mo del, the EVs isolated from HF mice displayed markedly up-regulated levels of miR-122 and miR-192 compared to EVs isolated from chow mice (Fig. 6F). [score:3]
The U6 snRNA was used as an internal control and to normalize miR-122 and miR-192 expression. [score:3]
0113651.g005 Figure 5(A) Expression levels of miR-122 and –192 in EVs and (B) liver isolated from CDAA, CSAA and chow fed mice for 20 weeks. [score:3]
The release of these microRNAs from stressed or damaged hepatocytes in EVs during NAFLD progression may provide an attractive explanation for the decreased expression level of miR-122 found in the livers of patients with advanced NAFLD [44],as well as early stage hepato-carcinogenesis from NASH in both an animal mo del and human tissue samples, as recently reported [52]. [score:3]
Moreover, the circulating EVs from mice on the CDAA diet were enriched in miR-122 and miR-192, two abundant microRNAs in hepatocytes. [score:1]
For isolation and quantification of miR-122 and miR-192, platelet-free plasma was isolated from CDAA-fed, high fat or control mice and incubated with 10 µg/mL of RNase (Roche, Indianapolis, IN, USA) for 30 min at 37°C to remove any RNAs adhering to the external leaflet of circulating EVs. [score:1]
While in healthy individuals, miR-122 has been shown to circulate almost exclusively in a non-membrane bound form associated with a specific protein, Argonaute2 (Ago2), while a recent report demonstrated that in NAFLD patients the majority of serum miR-122 circulates in Ago2-free forms [33]. [score:1]
Amount of miR-122 encapsulated in EVs and associated with Ago2 was determined by miRNeasy Mini kit (QIAGEN). [score:1]
Indeed, a recent study by Pirola et al [33] demonstrated that, as opposed to healthy individuals where miR-122 is present in circulation only in Ago2 complex fraction, in patients with NAFLD the majority of serum miR-122 circulates in Ago2-free forms. [score:1]
Immunoprecipitation of miR-122 associated with Argonaute-2 (Ago2) complexes. [score:1]
We observed that miR-122 was mainly encapsulated in EVs in CDAA-fed mice for 20 weeks while it was primarily associated with Ago2 protein in mice fed with the control diet, where the presence of EVs is very limited (Fig. 5E). [score:1]
Based on these findings and our results, we next tested the hypothesis that in experimental NASH miR-122 is primarily encapsulated in EVs. [score:1]
[1 to 20 of 14 sentences]
49
[+] score: 26
For miRNAs which suppress HBV replication, such as miR-210, miR-199a-3p (47), miR-125a-5p (48), miR-29c (49), miR-122 (50, 51) and miR-141 (52), besides the three which directly target HBV transcripts, most act through targeting a positive regulator of HBV, such as miR-141, which targets peroxisome proliferator-activated receptor alpha (PPARA). [score:11]
Qiu L. Fan H. Jin W. Zhao B. Wang Y. Ju Y. Chen L. Chen Y. Duan Z. Meng S. miR-122 -induced down-regulation of HO-1 negatively affects miR-122 -mediated suppression of HBVBiochem. [score:6]
Li C. Wang Y. Wang S. Wu B. Hao J. Fan H. Ju Y. Ding Y. Chen L. Chu X. Hepatitis B virus mRNA -mediated miR-122 inhibition upregulates PTTG1 -binding protein, which promotes hepatocellular carcinoma tumor growth and cell invasionJ. [score:6]
For miR-122 (53) and miR-15a (54, 55), HBV mRNA harboring complementary sites act as sponges to bind and sequester endogenous miRNA, indicating that the highly redundant HBV transcripts are involved in HBV -mediated miRNA suppression. [score:3]
[1 to 20 of 4 sentences]
50
[+] score: 26
In the present study, we showed that the expression of several miRNAs is altered during the development of PC and that licofelone reverses the altered expression of the majority of these miRNAs with up-regulation of miR-21, miR-222, Let-7, miR-125, miR-142 and down-regulation of miR-1, miR-122 and miR-148. [score:12]
Licofelone dramatically down-regulated the majority of miRNAs overexpressed in association with pancreatic tumor progression and upregulated miR1, miR122 and miR158 by many fold including those that regulate inflammation and CSCs. [score:10]
Similarly, miRNAs — like miR-140, miR-150, miR-122 and miR-31 — that regulate cancer stem cell genes were suppressed significantly by licofelone treatment. [score:4]
[1 to 20 of 3 sentences]
51
[+] score: 25
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Expression analysis of conserved miRNAs in 14 different tissue types revealed heart-specific expression of miR-499 and miR-208 and liver-specific expression of miR-122. [score:7]
Thus, miRNA families (e. g., miR-1 and miR-122) that are specifically or highly expressed in any one of the 3 tissues, or miRNAs that are expressed ubiquitously (e. g., let-7 and miR-26) in all 3 tissues, show a far greater frequency than other miRNAs. [score:5]
We also found miR-194 abundantly expressed in the liver, and its level of expression was comparable with that of miR-122 (Figure 2B). [score:5]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
We observed specific and abundant expression of miR-122 in the liver (Figure 3B). [score:3]
A similar picture has emerged for miR-122, a liver-specific miRNA and one of the highly represented miRNAs in our sequences. [score:1]
As another example, miR-122 is represented by 126 reads (Table 1). [score:1]
[1 to 20 of 7 sentences]
52
[+] score: 25
The study showed that miR-122*, the passenger strand of miR-122, regulated the activity of p53 by targeting MDM2. [score:4]
Therefore, miR-122* has a tumor suppression activity which was previously attributed solely to miR-122. [score:3]
Decreased expression of miR-122 is frequently associated with poorly differentiated cancer, large tumors, metastases, and poor prognosis [62]. [score:3]
Recently, Simerzin and colleagues [63] showed that miR-122*, the passenger strand of miR-122, targeted MDM2 and participated as an important player in MDM2-p53 interaction. [score:3]
In vivo studies showed that miR-122* was capable of inhibiting tumor growth by emphasizing the tumor-suppressor characteristics of miR. [score:3]
One of the abundant miRs in the liver tissue is miR-122, which has been shown to act as a tumor suppressor agent in HCC. [score:3]
By blocking miR-122 in murine livers with an antagomiR-122 (miR inhibitor), miR-122* accumulated, MDM2 was repressed, and then the p53 protein was elevated. [score:3]
Nakao K. Miyaaki H. Ichikawa T. Antitumor function of microRNA-122 against hepatocellular carcinomaJ. [score:1]
There was a significant negative correlation between the levels of miR-122* and MDM2 in human HCC samples. [score:1]
Further studies are needed to assess its effectiveness as a therapeutic agent in HCC and what key differences exist between miR-122* and miR-122. [score:1]
[1 to 20 of 10 sentences]
53
[+] score: 25
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-18a, hsa-mir-21, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-30a, mmu-mir-99a, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-138-2, hsa-mir-192, mmu-mir-204, hsa-mir-204, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-138-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-103-1, mmu-mir-103-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-26a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-26a-2, hsa-mir-376c, hsa-mir-381, mmu-mir-381, mmu-mir-133a-2, rno-let-7a-1, rno-let-7a-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-18a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-26a, rno-mir-30a, rno-mir-99a, rno-mir-103-2, rno-mir-103-1, rno-mir-122, rno-mir-126a, rno-mir-133a, rno-mir-138-2, rno-mir-138-1, rno-mir-192, rno-mir-204, mmu-mir-411, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-193b, rno-mir-1, mmu-mir-376c, rno-mir-376c, rno-mir-381, hsa-mir-574, hsa-mir-652, hsa-mir-411, bta-mir-26a-2, bta-mir-103-1, bta-mir-16b, bta-mir-18a, bta-mir-21, bta-mir-99a, bta-mir-126, mmu-mir-652, bta-mir-138-2, bta-mir-192, bta-mir-23a, bta-mir-30a, bta-let-7a-1, bta-mir-122, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-204, mmu-mir-193b, mmu-mir-574, rno-mir-411, rno-mir-652, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-1-2, bta-mir-1-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-138-1, bta-mir-193b, bta-mir-26a-1, bta-mir-381, bta-mir-411a, bta-mir-451, bta-mir-9-1, bta-mir-9-2, bta-mir-376c, bta-mir-1388, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-451b, bta-mir-574, bta-mir-652, mmu-mir-21b, mmu-mir-21c, mmu-mir-451b, bta-mir-411b, bta-mir-411c, mmu-mir-126b, rno-mir-193b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The expression analysis of selected miRNAs using qRT-PCR also showed that miR-26a and -99a were highly expressed in all tissues, while miR-122 and miR-133a were predominantly expressed in liver and muscle, respectively. [score:7]
The expression profiles of the 11 miRNAs across 11 tissues confirmed that miR-26a and -99a expressed at high levels in all tissues, while miR-122 and -133a exclusively expressed in liver and muscle, respectively. [score:7]
Comparison of miRNA expression profiles among tissues revealed that very few miRNAs expression was tissue specific (e. g., miR-9, -124 in brain, miR-122 in liver, miR-1, miR-133a and -206 in muscle). [score:5]
Our comparison of miRNA expression across 11 tissues from bovine revealed a few tissue specific miRNAs: miR-9, -124 in brain, miR-122 in liver, miR-1, miR-133a and -206 in muscle, which had been previously reported in mouse and human [13, 27]. [score:3]
To validate above miRNA expression patterns, quantitative RT-PCR was performed on tissue-specific miRNAs (miR-122, -133a), high cloning frequency miRNAs (miR-26a, -99a and -150) and low cloning frequency miRNAs (miR-103, -107, -411, -423-5p, -574-3p and -652). [score:3]
[1 to 20 of 5 sentences]
54
[+] score: 25
Figure 5 shows that the miRNAs let-7a-5p, let-7c-5p, miR-122-5p, miR-142-3p, miR-29b-3p, and miR-30c-5p are up-regulated and the miRNA species miR-669n and miR-709 are down-regulated in livers of vaccination -induced self-healing infections on day 11 p. i. in comparison to lethal infections in non-vaccinated mice, thus confirming our microarray analyses. [score:7]
The most abundant expressions show the miRNAs miR-122-5p, miR-6366, miR-3963 and miR-5100, while relatively low expression is observed for the miRNAs miR-1196-5p, miR-468-3p and miR-669n. [score:5]
miR-122 – A key factor and therapeutic target in liver disease. [score:5]
However, the up-regulated levels of mir-122-5p, miR-30a, mir-27a, and miR-29, observed in vaccination-protected mice during crisis, may contribute to the accelerated liver regeneration suggested to occur in these mice. [score:4]
Only during the crisis phase, vaccination-protected mice exhibit elevated levels of miR-122-5p, whereas the corresponding levels further decrease in non-vaccinated mice with lethal infections. [score:1]
Our data, however, reveal continuously decreasing levels of miR-122-5p in the liver of both vaccinated and non-vaccinated mice during the precrisis phase of self-healing and lethal P. chabaudi infections, respectively. [score:1]
For instance, injuries of the liver in HIV/HCV patients suffering from necroinflammation and portal hypertension have been recently reported to cause elevated levels of the miR-122, the most abundant miRNA species in the liver (Jansen et al., 2015). [score:1]
Circulating miRNA-122 levels are associated with hepatic necroinflammation and portal hypertension in HIV/HCV coinfection. [score:1]
[1 to 20 of 8 sentences]
55
[+] score: 24
Other miRNAs from this paper: mmu-mir-31
Expression cassettes were incorporated into HD Ads to generate a panel of six vectors that each expressed pri-miR-122/5, pri-miR-31/5, or pri-miR-31/5-8-9 from either the CMV or MTTR Pol II promoters (Figure 1(b)). [score:5]
In the case of the artificial HBV -targeting pri-miRs, natural miR-122 and miR-31 sequences were used as templates to design the exogenous RNAi activators. [score:3]
Artificial monomeric pri-miR sequences, pri-miR-122/5, pri-miR-31/5, used the pri-miR-122 or pri-miR-31 sequences as a scaffold for incorporating a HBV -targeting guide sequence. [score:3]
The complete panel of HD Ads used in this study therefore comprised the previously described HD Ad Δ28, HD Ad HBV CMV pri-miR-31/5, HD Ad HBV CMV pri-miR-122/5, HD Ad HBV CMV pri-miR-31/5-8-9, and newly propagated HD Ad HBV MTTR pri-miR-31/5, HD Ad HBV MTTR pri-miR-122/5, and HD Ad HBV MTTR pri-miR-31/5-8-9, which express antiviral sequences from the MTTR promoter. [score:3]
To generate adenoviral plasmids expressing anti-HBV pri-miRs from the MTTR promoter, a CMV promoter sequence in a previously described pCI-neo plasmid containing anti-HBV single or trimeric pri-miR sequences (pri-miR-122/5, pri-miR-31/5 and pri-miR-31/5-8-9) [11] was substituted with MTTR promoter sequence [26] using Bgl II and Sac I restriction sites. [score:3]
Amplified fragments were then inserted into pTZ57R/T (InsTAclone PCR cloning Kit, Fermentas, MD, USA) to generate pTZMTTR-pri-miR-122/5, pTZMTTR-pri-miR-31/5, and pTZMTTR-pri-miR-31/5-8-9. Following sequencing, the inserts were removed using Asc I and subcloned at the Asc I restriction site of pΔ28E4LacZ adenoviral backbone [28] to generate pΔ28E4LacZ MTTR pri-miR-122/5, pΔ28E4LacZ MTTR pri-miR-31/5, and pΔ28E4LacZ MTTR pri-miR-31/5-8-9. In vitro hepatotropic expression of luciferase from MTTR promoter was determined using the Dual-Luciferase Reporter Assay System according to manufacturer's instructions (Promega, WI, USA). [score:2]
In mice treated with HD Ad HBV pri-miR-122/5 or HD Ad HBV pri-miR-31/5, the serum concentrations of HBsAg increased at time points after one week and were no longer significantly different from the baseline values. [score:1]
This generated pMTTR pri-miR-122/5, pMTTR pri-miR-31/5, and pMTTR pri-miR-31/5-8-9 plasmids. [score:1]
All three anti-HBV HD Ads (HD Ad HBV pri-miR-31/5-8-9 M, HD Ad HBV pri-miR-31/5 M, and HD Ad HBV pri-miR-122/5 M) resulted in a significant dose dependent decrease in HBsAg levels. [score:1]
In agreement with the previous report, significant decrease in HBsAg levels was observed at one week following the injection of mice with either HD Ad HBV pri-miR-122/5, HD Ad HBV pri-miR-31/5, or HD Ad HBV pri-miR-31/5-8-9 (Figure 2(a)). [score:1]
As expected, hybridization to a probe complementary to the guide 8 sequence resulted in detection of a putative guide in RNA samples isolated from cells infected with HD Ad HBV pri-miR-31/5-8-9 but not in HD Ad HBV pri-miR-122/5 or HD Ad HBV pri-miR-31/5. [score:1]
[1 to 20 of 11 sentences]
56
[+] score: 24
Other miRNAs from this paper: mmu-mir-155, hsa-mir-122, hsa-mir-155, mmu-mir-672
D14662) (Invitrogen, San Diego, CA, USA) Top oligo Bottom oligo pCMV-PRDX6miRNA-122 (122–142 nt)TGCTG CCATGAGTCTCCCAGAAAGTC GTTTTGGCCACTGACTGACGACTTTCTGAGACTCATGGCCTGCCATGAGTCTCAGAAAGTC GTCAGTCAGTGGCCAAAAC GACTTTCTGGGAGACTCATGGC pCMV-PRDX6miRNA-251 (251–271 nt)TGCTG AACACTGTCTATTGAAAGGGC GTTTTGGCCACTGACTGACGCCCTTTCTAGACAGTGTTCCTGAACACTGTCTAGAAAGGGC GTCAGTCAGTGGCCAAAAC GCCCTTTCAATAGACAGTGTTC pCMV-PRDX6miRNA-289 (289–309 nt)TGCTG TAAGCATTGATATCCTTGCTC GTTTTGGCCACTGACTGACGAGCAAGGATCAATGCTTACCTGTAAGCATTGATCCTTGCTC GTCAGTCAGTGGCCAAAAC GAGCAAGGATATCAATGCTTAC pCMV-PRDX6miRNA-672 (672–692 nt)TGCTG ATTTCTTGCCAGATGGGAGCT GTTTTGGCCACTGACTGACAGCTCCCATGGCAAGAAATCCTGATTTCTTGCCATGGGAGCT GTCAGTCAGTGGCCAAAAC AGCTCCCATCTGGCAAGAAATC The pcDNA™6.2-GW/EmGFP-miR expression vectors (Invitrogen, San Diego, CA, USA) containing either the PRDX6 miRNA insert (pCMV-PRDX6 miRNA-122, pCMV-PRDX6 miRNA-251, pCMV-PRDX6 miRNA-289 or pCMV-PRDX6 miRNA-672) or the pcDNA™6.2-GW/EmGFP-miR-neg control plasmid (Invitrogen) were transfected into target cells with the Lipofectamine 2000 reagent, according to the manufacturer's instructions. [score:5]
The pcDNA™6.2-GW/EmGFP-miR expression vectors (Invitrogen, San Diego, CA, USA) containing either the PRDX6 miRNA insert (pCMV-PRDX6 miRNA-122, pCMV-PRDX6 miRNA-251, pCMV-PRDX6 miRNA-289 or pCMV-PRDX6 miRNA-672) or the pcDNA™6.2-GW/EmGFP-miR-neg control plasmid (Invitrogen) were transfected into target cells with the Lipofectamine 2000 reagent, according to the manufacturer's instructions. [score:5]
D14662) (Invitrogen, San Diego, CA, USA) Top oligo Bottom oligo pCMV-PRDX6miRNA-122 (122–142 nt)TGCTG CCATGAGTCTCCCAGAAAGTC GTTTTGGCCACTGACTGACGACTTTCTGAGACTCATGGCCTGCCATGAGTCTCAGAAAGTC GTCAGTCAGTGGCCAAAAC GACTTTCTGGGAGACTCATGGC pCMV-PRDX6miRNA-251 (251–271 nt)TGCTG AACACTGTCTATTGAAAGGGC GTTTTGGCCACTGACTGACGCCCTTTCTAGACAGTGTTCCTGAACACTGTCTAGAAAGGGC GTCAGTCAGTGGCCAAAAC GCCCTTTCAATAGACAGTGTTC pCMV-PRDX6miRNA-289 (289–309 nt)TGCTG TAAGCATTGATATCCTTGCTC GTTTTGGCCACTGACTGACGAGCAAGGATCAATGCTTACCTGTAAGCATTGATCCTTGCTC GTCAGTCAGTGGCCAAAAC GAGCAAGGATATCAATGCTTAC pCMV-PRDX6miRNA-672 (672–692 nt)TGCTG ATTTCTTGCCAGATGGGAGCT GTTTTGGCCACTGACTGACAGCTCCCATGGCAAGAAATCCTGATTTCTTGCCATGGGAGCT GTCAGTCAGTGGCCAAAAC AGCTCCCATCTGGCAAGAAATC The pcDNA™6.2-GW/EmGFP-miR expression vectors (Invitrogen, San Diego, CA, USA) containing either the PRDX6 miRNA insert (pCMV-PRDX6 miRNA-122, pCMV-PRDX6 miRNA-251, pCMV-PRDX6 miRNA-289 or pCMV-PRDX6 miRNA-672) or the pcDNA™6.2-GW/EmGFP-miR-neg control plasmid (Invitrogen) were transfected into target cells with the Lipofectamine 2000 reagent, according to the manufacturer's instructions. [score:5]
To evaluate inhibition of PRDX6, RT-PCR, real-time PCR and western blot analysis were performed to compare the expression levels of PRDX6 among the parental, pCMV-PRDX6 miRNA-122 -transfected, pCMV-PRDX6 miRNA-251 -transfected, pCMV-PRDX6 miRNA-289 -transfected, pCMV-PRDX6 miRNA-672 -transfected and pCMV-PRDX6 miRNA-neg -transfected cells 48 hours after transfection. [score:3]
After PCR and DNA sequencing, the four recombinant plasmids targeting PRDX6 (pCMV-PRDX6 miRNA-122, pCMV-PRDX6 miRNA-251, pCMV-PRDX6 miRNA-289 and pCMV-PRDX6 miRNA-672) were transfected into the MDA-MB-231 and MDA-MB-435 cells, respectively. [score:3]
Four different vectors, pCMV-PRDX6 miRNA-122, pCMV-PRDX6 miRNA-251, pCMV-PRDX6 miRNA-289 and pCMV-PRDX6 miRNA-672, were constructed in this study. [score:1]
RT-PCR (a) and real-time PCR (b) illustrated that pCMV-PRDX6 miRNA-672, rather than pCMV-PRDX6 miRNA-neg, pCMV-PRDX6 miRNA-122, pCMV-PRDX6 miRNA-251 or pCMV-PRDX6 miRNA-289, reduced PRDX6 mRNA in MDA-MB-231 cells. [score:1]
Lanes 1 to 6: the parents, pCMV-PRDX6 miRNA-122 -transfected, pCMV-PRDX6 miRNA-251 -transfected, pCMV-PRDX6 miRNA-289 -transfected, pCMV-PRDX6 miRNA-672 -transfected and pCMV-PRDX6 miRNA-neg -transfected cells. [score:1]
[1 to 20 of 8 sentences]
57
[+] score: 24
Conversely miR-122, which has previously been shown to direct mRNA cleavage [21], was expressed at a low level, but had a significant predicted effect upon target gene expression in several samples (combined p = 0.08). [score:8]
CE-RSCs from various species have been shown to have very similar properties and gene expression patterns [38- 41] Of the 4 miRNAs expressed most highly in CE-RSCs according to, miR-24 was also predicted to have a significant effect (p < 0.05) upon mRNA expression and miR-122 had p = 0.08. [score:7]
These miRNAs could also play a role in maintaining the progenitor cell state, as has been shown in other tissues; over -expression of miR-24 causes a delay in maturation of hematopoietic progenitor cells [43] and over -expression of miR-122 delays differentiation of human embryonic stem cells [44]. [score:5]
No expression was observed for miR-122 and miR-378 (data not shown). [score:3]
In addition, miR-122, which had p < 0.1 in CE-RSCs and P4 and adult retina, was of interest because it has been previously characterised as a highly expressed, liver-specific miRNA [19, 22, 30]; the possibility of an alternative role in the retina is intriguing. [score:1]
[1 to 20 of 5 sentences]
58
[+] score: 23
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-210, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-16c, gga-mir-214, sma-let-7, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infectionBetween weeks 6 and 12, female parasites continue to produce ∼300 eggs per day [51], resulting in an increase in the number of granulomas in the liver and the development of fibrosis [45]. [score:4]
However, according to our analysis, although miR-192, miR-122 and miR-194 were down-regulated in the liver during infection, their levels in serum did not change significantly (Fig. 1– 2). [score:4]
As shown in Fig. 2, the levels of miR-192, miR-194 and miR-122 in serum do not change between 4–12 weeks post infection, whereas five of the miRNAs that are up-regulated in the liver are also significantly elevated in serum at 12 weeks post infection (p<0.05), ranging from 2.6 fold (miR-21) to 4.7 fold (miR-214) (Table S2). [score:4]
Among the down regulated miRNAs was the liver-enriched miR-122, which is dysregulated during hepatitis C infection, acetaminophen overdose and hepatocellular carcinoma and is involved in lipid metabolism [49], [50]. [score:3]
A number of reports have demonstrated an increase in miR-122 and miR-192 in plasma or serum upon viral infection as well as chemically induced liver disease [54], [56]. [score:3]
Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infection. [score:3]
Consistent with the array results, there was an increase in miR-199-5p, miR-199-3p, miR-214, miR-21, miR-210, and a reduction of miR-192, miR-194, miR-365, miR-122 and miR-151 in the liver tissue of S. mansoni infected mice as compared to naïve mice; miR-9 and miR-744 did not display differential expression and were not analysed further (Table 1). [score:2]
[1 to 20 of 7 sentences]
59
[+] score: 23
The fact that miR-122 expression correlated with Srebf1 and other lipid metabolism related genes indicated that these genes are not direct targets of miR-122. [score:6]
Blockade of miR-122 expression decreased Srebf-1c, Fasn, Hmgcs1, Sqle and Acaca expression, resulting in the reduction of plasma cholesterol and triglyceride levels in both rodents and primates [80], [81]. [score:5]
Several miRs associated with the regulation of lipid metabolism were differentially expressed in Scap [Δ/Δ] lungs at E18.5, including miR-122, miR-33, miR-29, miR-106 and miR-335 (Table 6). [score:4]
miR122 and miR33 are known to directly regulate lipid metabolism and lipid homeostasis in the liver [75], [76]. [score:3]
miR-122 is highly conserved from human to frogs and most abundantly expressed in liver. [score:3]
miR122 was induced 2.5 fold in Scap [Δ/Δ] vs. [score:1]
The mechanism by which miR122 activates these genes and lipid metabolism is currently unknown. [score:1]
[1 to 20 of 7 sentences]
60
[+] score: 22
The high expression of miR-122 and miR-705 combined with the downregulation of miR-193 and miR-27a might decrease the levels of fatty acid synthesis and lipid metabolism, which might be important in inhibiting the growth and development of S. japonicum in the host environment. [score:9]
Some differentially expressed miRNAs in liver had important functions, such as involvement in nutrient metabolism, including a cholesterol metabolism regulator (miR-122), a lipid metabolism regulator (miR-705), an adipocyte differentiation and regulation factor (miR-27a and miR-193), and erythrocyte differentiation (miR-223 and miR-451). [score:6]
miR-122, reported as an abundant liver-specific miRNA, showed a significantly high expression level in liver of infected M. fortis but no change in spleen and lungs. [score:3]
miR-122 was reported to play an important role to regulate cholesterol and fatty-acid metabolism in the adult liver [33]. [score:2]
MiR-122, miR-451 and miR-494 were detected in liver, miR-494, miR-691 and miR-143 in spleen, and miR-223, miR-200a and miR-322 in lung. [score:1]
Among them, miR-122, miR-705, miR-193 and miR-27a were related to nutrient metabolism. [score:1]
[1 to 20 of 6 sentences]
61
[+] score: 22
Previous studies have shown that liver miR-122 preferentially expressed in lipid-laden hepatocytes and was down-regulated in NASH patients [12]. [score:6]
Time -dependent expression of miR-122, miR-192, miR-21, miR-29a, miR-34a, and miR-505 in study 1. Data were expressed as minus delta Ct with reference to spike-in control miRNA. [score:5]
MicroRNA profiling in two independent cohorts of animals validated the up-regulation of 6 microRNAs (miR-122, miR-192, miR-21, miR-29a, miR-34a and miR-505) in NASH mice, which was designated as the circulating microRNA signature for NASH. [score:4]
Similarly, we observed slightly decrease in the liver miR-122 and miR-192 expression (not statistically significant) in NASH mice compared to lean mice. [score:2]
c Principle component analysis (PCA) of miR-192, miR-122, miR-21, miR-29a, miR-34a, and miR-505 in study 2. Red dots represented NASH mice (mice on 3H diet for 7 months), and green dots represented lean mice. [score:1]
The top six common microRNAs including miR-21, miR-122, miR-192, miR-29a, miR-34a and miR-505, were designated as the circulating microRNA signature for NASH (Fig.   2b). [score:1]
Univariate ROC curve analysis showed that miR-192 and miR-505 achieved the greatest AUROC of 0.923 and 0.919 respectively in discriminating mice had NAS > 3, while miR-122, miR-29a, miR-34a and miR-21 had an AUROC of 0.88, 0.84, 0.80 and 0.79 (Fig.   4a and b). [score:1]
As miR-122 was very abundant in hepatocytes, a small number of hepatocyte degeneration may lead to significant release of miR-122 into circulation. [score:1]
MiR-192 and miR-122 fell into the same category, and both were implicated in liver injury and hepatocyte death [28, 29]. [score:1]
[1 to 20 of 9 sentences]
62
[+] score: 22
The oncogene c-Myc repressed miR-122 gene expression by associating with its promoter and by down -regulating Hnf-3β expression, whereas miR-122 indirectly inhibited c-Myc transcription by targeting Tfdp2 and E2f1 [5]. [score:11]
Two were upregulated (miR-492 and miR-224) and six were downregulated (miR-191, miR-122, miR-192, miR-101, miR-302b, miR-148a) (Figure  1A). [score:7]
It was recently found that miR-122 was downregulated in HCC. [score:4]
[1 to 20 of 3 sentences]
63
[+] score: 21
These include on the one hand the up-regulated miRNAs: mmu-miR-342-3p, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-21, mmu-miR-335-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-674 and mmu-miR-379; and on the other hand the down-regulated ones after HFD -induced obesity: mmu-miR-122, mmu-miR-133p, mmu-miR-1, mmu-miR-30a, mmu-miR-192 and mmu-miR-203. [score:7]
On the contrary, the following miRNAs were down-regulated in WAT after HFD feeding: mmu-miR-141, mmu-miR-200a, mmu-miR-200b, mmu-miR-200c, mmu-miR-122, mmu-miR-204, mmu-miR-133b, mmu-miR-1, mmu-miR-30a*, mmu-miR-130a, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-203, mmu-miR-378 and mmu-miR-30e*. [score:4]
On the other hand, the down-regulation of mmu-miR-122 and mmu-miR-130a during HFD -induced obesity that we report has not been described before. [score:4]
Mmu-miR-122 is mainly expressed in the liver and makes up for the 70% of all the liver miRNAs [51]. [score:3]
The following 22 murine microRNAs were selected for qPCR validation of their expression: mmu-miR-1, mmu-miR-21, mmu-miR-30a*, mmu-miR-30e*, mmu-miR-122, mmu-miR-130a, mmu-miR-133b, mmu-miR-141, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-200b, mmu-miR-200c, mmu-miR-203, mmu-miR-204, mmu-miR-222, mmu-miR-342-3p, mmu-miR-378 and mmu-miR-379. [score:3]
[1 to 20 of 5 sentences]
64
[+] score: 20
Other miRNAs from this paper: hsa-mir-122
[34] Downregulating miR-122 expression decreases polyploid hepatocytes, and this trend is reversible by miR-122 over -expression. [score:8]
47, 48 HCC development is accompanied by decreased expression of miR-122. [score:4]
49, 50, 51 Thus, the data implicate decreased miR-122 level as key to suppressed polyploidization in mouse or rat mo dels of DEN -induced HCC and human HCC. [score:3]
MiR-122 antagonizes the expression of the pro-cytokinesis effectors Cux1, Rhoa, Mapre1, Iqgap1, Nedd4l, and Slc25a34, leading to cytokinesis failure and expansion of binucleated hepatocytes. [score:2]
MiR-122, frequently the most specific miRNA in the liver, is considered necessary and sufficient for liver polyploidization, in addition to being an important tumor suppressor in hepatocellular carcinoma. [score:2]
15, 25, 26, 27, 28, 29, 30, 31, 32, 33 Importantly, a recent study concluded that miR-122 is not only necessary but also sufficient for hepatic polyploidization. [score:1]
[1 to 20 of 6 sentences]
65
[+] score: 18
The expression levels of miR-29b-3p and miR-122-5p were significantly different between colitic non -treated D98 and anti-TNFα -treated D98 mice, with the latter not significantly different from the non-inflamed group (D28), indicating that anti-TNFα therapy efficiently reversed the expression levels of these two miRNAs (Fig.   5F). [score:5]
Analysis of the expression levels of the nine-miRNA panel revealed that three miRNAs (miR-122-5p, miR-150-5p, and miR-375) were similarly altered (all up-regulated) in mice with DSS -induced and TLR5 [−/−] colitis compared to the corresponding healthy controls (Fig.   3A). [score:5]
miRNA nameIL10 [−/−] mice mo del Intestinal Inflammation Inflammation mmu-miR-29b-3p x mmu-miR-122-5p x x x mmu-miR-148a-3p x mmu-miR-150-5p x x mmu-miR-192-5p x mmu-miR-194-5p x mmu-miR-146a-5p x mmu-miR-375-3p x x x mmu-miR-199a-3p x We showed that our nine-miRNA signature could discriminate between the different forms of colitis and arthritis, as well as between non-colitic mice with and without a genetic predisposition to develop the disease (WT mice versus non-colitic IL10 [−/−] mice). [score:3]
Thus, among the nine miRNAs of the identified signature, two were deregulated in both intestinal inflammation and arthritis (miR-122-5p and miR-375), one was specifically deregulated in all three intestinal inflammation mo dels (miR-150-5p), and the others appeared to be specific to the IL10 [−/−] mouse mo del. [score:3]
Expressional analysis of the nine-miRNA signature in sera of CAIA mice revealed that two of the miRNAs (miR-122-5p and miR-375) were increased in arthritic mice compared to non-arthritic control mice (day 2) as it was observed in the IL10 [−/−] mice (Fig.   3A). [score:2]
[1 to 20 of 5 sentences]
66
[+] score: 18
Leishmania donovani targets Dicer1 to downregulate miR-122, lower serum cholesterol, and facilitate murine liver infection. [score:6]
The parasites by using surface protease, gp63, target pre-miRNA processor Dicer 1 and thus inhibit maturation of miR122. [score:5]
Previously, we unveiled the mechanism of hypocholesterolaemia in experimental LD infection and showed that maturation of miR122 in the liver is inhibited via GP63 mediated cleavage of DICER1 [8] and statin induced hypocholesterolaemia show higher organ parasites in experimental infection than the ones without treatment [49]. [score:3]
Thus, due to absence of miR122 the overall cholesterol metabolism is decreased leading to generalized defects in cholesterol biosynthesis in L. donovani infected hosts. [score:1]
miR122 controls cholesterol metabolism in liver and its maturation from pre-miR122 to mature miR122 is controlled by the protein known as 'Dicer 1'. [score:1]
Restoration of miR122 or Dicer 1 level in experimental visceral leishmaniasis increased serum cholesterol and reduced liver parasite burden [8]. [score:1]
As a part of the molecular mechanism to explain how parasite cause generalized defects, we show that miR122 maturation is compromised in L. donovani infection. [score:1]
[1 to 20 of 7 sentences]
67
[+] score: 18
We monitored the endogenous expression of miRNA-122 in the liver of naive mice as well as other endogenously expressed miRNAs in the tibialis anterior muscle of a mouse mo del of muscular atrophy. [score:5]
The miRNA targeting sequences (miR T) used to place the RINES plasmids under control of miRNA-122, -206, -486 and -23a were prepared as previously described and are listed in the S1 Table. [score:3]
SPECT/CT imaging of miRNA-122 expression in the liver of mice. [score:3]
Finally to ascertain whether radiotracer uptake in the liver resulted in the expression of hNIS induced by miRNA-122, we performed a quantitative RT-PCR analysis on liver tissues using specific hNIS primers. [score:2]
In this study, we denoted the RINES plasmids as follows: pRINES/122T when the RINES plasmid contains 4 complementary block sequences to the miRNA-122, and pRINES/23aT when the RINES plasmid contains 4 complementary block sequences to the miRNA-23a. [score:1]
We therefore selected this amount of pRINES/122T to transfect the Hela cells in presence of increasing concentrations of miRNA-122 mimic. [score:1]
A) Hela cells were transfected with pRINES/122T in presence of indicated concentrations of miRNA-122 mimic or, as a control, miRNA-133 and -1 mimics. [score:1]
Indeed, the means of radioactivity were 1.36 ± 0.25 x 10 [6] cpm/mg, 2.76 ± 0.41 x 10 [6] cpm/mg and 3.41 ± 0.52 x 10 [6] cpm/mg, when 1 nM, 5 nM and 10 nM of miRNA-122 mimic were delivered to the cells respectively. [score:1]
As shown in Fig 4A, increasing concentrations of synthetic miRNA-122, from 1 to 10 μM, also increased [99m]TcO [4] [-] uptake values detected in these cells. [score:1]
[1 to 20 of 9 sentences]
68
[+] score: 17
L. donovani target Dicer1 (RNAse II member family), that could result in post-transcriptional regulation of host mRNAs/miRNA interactions (Ghosh et al., 2013); Leishmania-gp63 cleaved Dicer1 impairing the pre-miR122 processing and maturation to miR-122 preventing the binding to RNA -induced silencing complex (RISC), which guides the interaction with target mRNA and leads to gene expression regulation (Bernstein et al., 2001; Schwarz et al., 2003; Vaucheret et al., 2004; Wang et al., 2009; Ghosh et al., 2013). [score:9]
Leishmania donovani targets Dicer1 to downregulate miR-122 lower serum cholesterol, and facilitate murine liver infection. [score:6]
Furthermore, miR-122 can interact with Cat1 mRNA 3′UTR regulating its stability and protein levels in stress conditions (Bhattacharyya et al., 2006). [score:2]
[1 to 20 of 3 sentences]
69
[+] score: 17
By performing microarray screening on exosomes, we found nine inflammatory miRNAs which were deregulated in sera of chronic alcohol-fed mice compared to controls including upregulated miRNAs: miRNA-192, miRNA-122, miRNA-30a, miRNA-744, miRNA-1246, miRNA 30b and miRNA-130a. [score:4]
Comparing the miRNA signature of exosomes from alcohol-fed mice with pair-fed mice showed deregulation of nine inflammatory miRNAs including miRNA-122, miRNA-192 and miRNA-30a. [score:2]
Particularly, miRNA-122, miRNA-30a, and miRNA-192 showed the most substantial increases and revealed an excellent diagnostic value for differentiating alcohol-fed mice versus pair-fed mice. [score:1]
The ROC analyses indicated excellent diagnostic value of miRNA-192, miRNA-122, and miRNA-30a to identify alcohol -induced liver injury. [score:1]
This result might be attributed to the patients’ heterogeneity in terms of being in different stages of alcoholic hepatitis or having different kinetics of miRNA-122 in alcohol -induced liver injury. [score:1]
We found elevated levels of miRNA-122 in the circulation in the Lieber–DeCarli dietary mouse mo del. [score:1]
miRNA-122 showed elevated levels in exosomes isolated from patients with alcoholic hepatitis, but it did not reach statistical significance (Fig.   5d). [score:1]
In particular, in alcoholic hepatitis and in inflammatory liver injury, serum/plasma miRNA-122 and miRNA-155 were predominantly associated with the exosome-rich fraction. [score:1]
Curve of receiver operating characteristic (ROC) analysis constructed using differentially expressed d miRNA-122, e miRNA-192, and f miRNA-30a for discriminating alcohol-fed mice versus control mice. [score:1]
miRNA-192, miRNA-122 and miRNA-30a accurately discriminate the alcohol-fed and control mice. [score:1]
miRNA-122 and miRNA-30a showed an AUC of 0.92 (p < 0.001) and 0.85 (p < 0.05), respectively (Table  3; Fig.   4d–f). [score:1]
Consistent with the highly significant increase of miRNA-122, miRNA-30a, and miRNA-192 (Fig.   4a–c), those miRNAs showed promising diagnostic values. [score:1]
In contrast, we did not observe statistically significant elevation in miRNA-122 in exosomes isolated from sera of patients with alcoholic hepatitis, which may indicate the difference of the Lieber DeCarli alcohol mo del with alcoholic hepatitis in patients. [score:1]
[1 to 20 of 13 sentences]
70
[+] score: 17
However, miR-122 expression was not decreased (Figure 11d), thus several genes and miR-122 associated with liver disease were not affected by the expression of the PMIS. [score:7]
Ndrg3 (N-myc downstream regulated gene 3), Bckdk (branched-chain α-ketoacid dehydrongenase kinase) and Cd320 (Cd320 antigen, putative VLDL receptor), which are also known targets of miR-122, [46] were analyzed for their expression in WT, PMIS-miR-17-18-19-92 and PMIS-miR-200a mice. [score:6]
[50] The recombinant adeno -associated virus expressing anti-miR-122 Tough Decoy reduced serum cholesterol by >30% for 25 weeks in mice. [score:3]
miR-122 is associated with liver homeostasis and decreased levels of miR-122 are seen in hepatocarcinogenesis. [score:1]
[1 to 20 of 4 sentences]
71
[+] score: 16
Several down-regulated (i. e. miR-1, miR-7, miR-34a, miR-122, miR-125b, miR-200) or up-regulated (i. e. miR-17, miR-18, miR-19, miR-155, miR-93, miR-221/222) miRNAs have been identified as tumor suppressor or oncomirs, respectively, by targeting and regulating genes involved in cell proliferation, apoptosis, angiogenesis and metastasis [13]. [score:12]
Karakatsanis A Papaconstantinou I Gazouli M Lyberopoulou A Polymeneas G Voros D Expression of MicroRNAs, miR-21, miR-31, miR-122, miR-145, miR-146a, miR-200c, miR-221, miR-222, and miR-223 in patients with hepatocellular carcinoma or intrahepatic cholangiocarcinoma and its prognostic significanceMol Carcinog. [score:3]
Among them, miR-122, miR-21, miR-155, miR-23a, miR-143, whose target genes have been characterized in both NAFLD (i. e. PPARα, PTEN C/EBPβ, ORP8, G6PC) and HCC (i. e. CCNG1, IGF-1R, ADAM17, PTEN, SOCS1, C/EBPβ, FNDC3B) [14]. [score:1]
[1 to 20 of 3 sentences]
72
[+] score: 16
Overexpression of non-mammalian (drosophila, C. elegans) and endogenous mouse miRNAsIt was previously reported that miRNAs derived from C. elegans or other lower species are difficult to express efficiently in mammalian cells in vitro 1. We therefore sought to compare the expression efficiency of endogenous mouse miRNAs (mir-107, mir-122, mir-675) and exogenous miRNAs from two non-mammalian species, namely drosophila (mir-14 and mir-276), and C. elegans (mir-77, mir-230). [score:7]
It was previously reported that miRNAs derived from C. elegans or other lower species are difficult to express efficiently in mammalian cells in vitro 1. We therefore sought to compare the expression efficiency of endogenous mouse miRNAs (mir-107, mir-122, mir-675) and exogenous miRNAs from two non-mammalian species, namely drosophila (mir-14 and mir-276), and C. elegans (mir-77, mir-230). [score:5]
This approach also led to the effective expression of endogenous mouse miRNAs, including miR-107-3p, miR-122-5p, and miR-675-3p (Fig. 2b). [score:3]
This included the drosophila miR-14 (n = 5–9) and miR-276a (n = 5–15), the C. elegans miR-77 (n = 5–12) and miR-230 (n = 6–10), and mouse miR-107-3p (n = 6–15), miR-122-5p (n = 3–12), and miR-675-3p (n = 6–11). [score:1]
[1 to 20 of 4 sentences]
73
[+] score: 16
Moreover, the following target proteins, involved in resistance to apoptosis were downregulated: BCL-XL, targeted by miR122, BCL-2, targeted by miR122 [36], and in less extent XBP-1, targeted by miR214 [37]. [score:12]
Among miRNAs present in MV-HLSC [10], several ones were associated with potential antitumor activity, such as miR451, miR223, miR24, miR125b, miR31, miR214, and miR122. [score:1]
MVs released from DCR-Kd HLSC (MV DCR−), but not from CTR-A HLSC (MV CTR-A), showed a significant reduction of miR223, miR24, miR31, miR122, and miR214 as detected by qRT-PCR (Fig. 4B). [score:1]
Among miRNAs present in MV-HLSC, we detected several miRNAs with potential antitumor activity including miR451, miR223, miR24, miR125b miR31, and miR122 (Fig. 3A). [score:1]
Silencing Dicer in HLSC resulted in the modulation of different miRNAs, with a significant reduction of the antitumor miR223, miR24, miR31, and miR122 [55] in MVs. [score:1]
[1 to 20 of 5 sentences]
74
[+] score: 15
To identify miRNAs that reflected the schistosome infections and PZQ chemotherapy, six miRNA candidates (miR-146b, miR-122, miR-223, miR-199a-5p, miR-199a-3p, miR-34a) were selected for analysis in serum that were commonly deregulated in human liver diseases. [score:4]
Expression levels of serum miR-223 (B), miR-122 (C), miR-34a (D), miR-199a-5p (E) miR-199a-3p (F), and miR-146b (G) were detected in the three groups of mice. [score:3]
The expression levels of miR-34a, miR-223, miR-122, miR-146b, miR-199a-5p, miR-199a-3p were determined using the SYBR Green Master Mix kit (TaKaRa, Dalian, China). [score:3]
To test this hypothesis, we selected six candidate serum miRNAs for analysis (miR-146b, miR-122, miR-223, miR-199a-5p, miR-199a-3p, miR-34a) in the murine mo del of human schistosomiasis and then performed validation in other host species including rabbits, buffalos and human patients infected with S. japonicum. [score:1]
For example, serum miR-21, miR-122 and miR-223 are elevated in patients with hepatocellular carcinoma and chronic hepatitis and thus, have the potential to serve as novel biomarkers for liver injury [18]. [score:1]
Previous studies have also shown that circulating miRNA-146a and miR-223 were significantly reduced in septic patients [19], while serum miRNA-122 and miRNA-192 were elevated in a mouse mo del of drug -induced liver injury [20]. [score:1]
We analyzed the serum levels of six selected candidate miRNA molecules (miR-146b, miR-122, miR-223, miR-199a-5p, miR-199a-3p, miR-34a) from mice, rabbits, buffalos and humans infected with Schistosoma japonicum using qPCR. [score:1]
In mouse hosts, quantitative PCR result revealed that circulating miR-223, miR-122 and miR-34a were significantly elevated after infection (Figure  1B-D). [score:1]
[1 to 20 of 8 sentences]
75
[+] score: 15
miRNA-122 recognition of engineered target sites in the 3′UTR of the E1A gene to control its expression and prevent viral replication of the adenovirus has been the most wi dely exploited strategy since miR-122 is abundantly expressed in human and murine liver [5, 6]. [score:7]
In this study we have focused on miR-148a, however L5-miRNA targeting could be applied to other miRNAs, such as miR-122, let-7 or miR-199, which have also shown great success in excluding gene expression from the hepatocytes in E1A-miRNA adenoviruses [5, 7, 19- 21]. [score:5]
Substantial decrease in viral replication has been reported in 4 or 8 engineered target sites for miR-122, with highly reduced hepatotoxicity [7]. [score:3]
[1 to 20 of 3 sentences]
76
[+] score: 14
Importantly, miRNA inhibition has been reported to be specific in vivo using the LNA -modified PS oligonucleotide miR-122 inhibitor as an anti-hepatitis C agent [48]. [score:5]
Of particular relevance to our translational aim are the encouraging results of a limited Phase-2 trial for treatment of HCV infections with a miR-122 inhibitor [40]. [score:5]
Moreover, LNA-miR-122 inhibitors has been clinically evaluated in hepatitis C healthy carriers [40], which indicates the clinical feasibility of LNA -based miRNA inhibition. [score:3]
These observations are in accordance with the previously reported prolonged LNA-miR-122 antagonism in primates [48]. [score:1]
[1 to 20 of 4 sentences]
77
[+] score: 13
Some miRNAs such as miR-122, miR-199 family and MiR-124 is downregulated in HCC and act as putative tumor suppressor genes [15]. [score:6]
To explore the mechanism underling the involvement of TAMs in the antitumor activity of propofol, we measured the expression of a number of miRNAs, including miR-142-3p, miR-199a, miR-122, and miR-29, which may act as tumor suppressors in HCC [23]. [score:3]
However, there was no change in the expression of miR-199a, miR-122, and miR-29 (Figure  2B). [score:3]
The levels of miR-142-3p, miR-199a, miR-122, and miR-29 were quantified with a TaqMan PCR kit. [score:1]
[1 to 20 of 4 sentences]
78
[+] score: 12
The most frequently deregulated miRNAs in HCC include the let-7 family (downregulated), miR-122 (downregulated), and miR-221/222 (upregulated) [52, 53]. [score:11]
Of note, miR-122 represents 70% of the total hepatic miRNA population. [score:1]
[1 to 20 of 2 sentences]
79
[+] score: 12
Leishmania donovani targets Dicer1 to downregulate miR-122, lower serum cholesterol, and facilitate murine liver infection. [score:6]
Moreover, L. (L. ) donovani was shown to target Dicer1 and to downregulate miR-122 in mouse liver, leading to increased parasite burden (Ghosh et al., 2013). [score:6]
[1 to 20 of 2 sentences]
80
[+] score: 12
Notably, miR-122, which accounts for over 70% of the total miRNA of hepatocytes [26], was among the most upregulated miRNAs. [score:4]
Well-known hepatic miRNAs, such as miR-122, are upregulated (labeled in red). [score:4]
Hepatocyte -associated miRNAs, such as miR-122, miR-145, miR-192, and miR-194, were also upregulated (Figure 3B). [score:4]
[1 to 20 of 3 sentences]
81
[+] score: 12
To further test the functionality of chimera-identified sites, we examined data from Huh-7.5 cells treated with locked nucleic acid (LNA) against miR-122 or miravirsen, a clinical miR-122 inhibitor 44. [score:3]
CDF plots of LNA-122 induced changes in AGO binding across 3′-UTRs (c) or all regions (d) for sites with miR-122 7-8mer seeds (magenta), miR-122 chimeras (red) or the combination of both (blue). [score:1]
This effect was stronger for sites overlapping miR-122 chimeras and even stronger when both predictors were combined. [score:1]
For miravirsen treatment, miR-122 seed presence alone was predictive in all cases, but miR-122 chimeras enhanced these predictions (Supplementary Fig. 8b,c). [score:1]
pl CAAACACCATTGTCACACTCCA 0 hsa-miR-122-5p > motifs/hsa-miR-122-5p. [score:1]
AGO binding to 3′-UTR regions with miR-122 7mer or 8mer seed matches was specifically reduced in miR-122 LNA versus control cells (Fig. 5c). [score:1]
txt fasta output/hsa-miR-122-5p/ -fasta background/hsa-miR-122-5p. [score:1]
txt -mcheck motifs/hsa-miR-122-5p. [score:1]
When regions outside 3′-UTRs were included, a significant effect was only observed when miR-122 chimeras were present (Fig. 5d). [score:1]
pl foreground/hsa-miR-122-5p. [score:1]
[1 to 20 of 10 sentences]
82
[+] score: 12
In spite of weak or undetectable circadian expression of mature miRNAs, we found that at least 57 circadian miRNA primary transcripts including pri-mir-122 and pri-mir-24 do show strong circadian expression and are under circadian regulation. [score:6]
First, Gatfield et al. 15 suggested that miRNAs such as miR-122 that are arrhythmic at mature level could contribute to the large amplitudes of oscillation of target mRNA transcripts by maintaining their high but constant degradation rates. [score:3]
Also consistent with Gatfield et al. ’s result 15, the primary transcript of miR-122 showed significant circadian oscillation with a peak around CT0 and a trough at CT12. [score:1]
We found that four miRNAs (miR-24-3p, miR-101a-3p, miR-378-3p and miR-122-3p) showed significant circadian oscillations at mature levels with peak times close to those of their primary transcripts. [score:1]
As miR-122 and miR-24 have been previously reported to be involved in circadian rhythm, we wondered if other circadian miRNA primary transcripts also harbor miRNAs with important circadian functions. [score:1]
[1 to 20 of 5 sentences]
83
[+] score: 12
Other miRNAs from this paper: hsa-mir-122
Several mechanisms might account for the inhibition of Foxa1 in NAFLD, including direct repression of Foxa1 via deregulation of the protein kinase C pathway [29] and down-regulation of CCAAT/enhancer binding protein beta (C/EBPβ) [34] or an indirect mechanism via inhibition of the TGF-beta signaling pathway by hepatocyte nuclear factor 6 (HNF-6) [35] or deregulation of miR-122/FOXA1/HNF4a feedback loop [36]. [score:12]
[1 to 20 of 1 sentences]
84
[+] score: 12
Moreover, as already described by others [8], [32]– [34], our system is compatible with the incorporation of binding sites for miR-122 to the 3′-UTR of the transgene expression cassette to further reduce residual expression in the liver. [score:5]
In the context of future therapeutic applications, it is well conceivable that a miRNA -based de -targeting strategy can result in adverse dysregulation of endogenous miR-122. [score:4]
The two studies also differ conceptually as the approach pursued by O'Neill and colleagues required the additional incorporation of binding sites for the liver-specific miR-122 into the vector genome to achieve liver de -targeting. [score:3]
[1 to 20 of 3 sentences]
85
[+] score: 11
Other miRNAs from this paper: dme-mir-277, dme-mir-289, dme-bantam, mmu-mir-16-1, mmu-mir-16-2
When grown under normal conditions, CAT-1 mRNA is targeted by miR-122, leading to its re-localization into P-bodies and translational suppression. [score:7]
Recruitment of HuR causes miR-122 to dissociate, whereby CAT-1 mRNA is released from P-bodies and resumes translation [11]. [score:3]
Upon amino acid starvation, the ARE -binding HuR protein is translocated into the cytoplasm and recruited to an ARE in the CAT-1 mRNA, downstream of the miR-122 binding site. [score:1]
[1 to 20 of 3 sentences]
86
[+] score: 11
For example, miR-122 was the first miRNA therapeutic target for disease. [score:5]
Inhibition of miR-122 by the method of locked nucleic acid was functional in the treatment of hepatitis C, and a phase II clinical trial was begun in 2012 [30]. [score:3]
In addition, a miR-122 mimic delivered by the cationic lipid nanoparticle LNP-DP1 suppressed tumor growth and angiogenesis in hepatocellular carcinoma [31]. [score:3]
[1 to 20 of 3 sentences]
87
[+] score: 11
Rev-erbα participates in the transcriptional regulation of liver specific miR-122, which was differentially regulated in our study, and which regulates Fas and ACC 8 25. [score:4]
Rev-erbα participates in the transcriptional regulation of liver specific miR-122, which regulates Fas and ACC 8 25, and also was differentially regulated in our study. [score:4]
In the control animals a single peak (ZT0) and trough (ZT8) were observed, but the alcohol-fed animals exhibited a bimodal profile, with a dominant peak ZT8 and lower peak at ZT0, and a CG phase advanced by 5-h. Such physiological alterations correlate with the changes in clock gene (Rev-erbα), POG (Dbp, Tef) and CCG expression (miR-122, Insig2, ACC, Fas, Acot1) (Fig. 6b). [score:3]
[1 to 20 of 3 sentences]
88
[+] score: 10
Hepatic expression of tumor suppressive miRNAs, miR-26a, miR-26a-1, miR-192, miR-122, miR-22 and miR-125b, and tumor promoting miRNAs, miR-10b and miR-99b in NASH-HCC mo del male and female mice. [score:5]
As shown in Fig. 4, the tumor suppressive miRNAs, miR-26a, miR-26a-1, miR-192, miR-122, miR-22, and miR-125b were lower, whereas the tumor-promoting miRNAs, miR-10b and miR-99b were higher in males than in females in both the STZ-HFD group and the control group. [score:3]
We also observed that tumor-suppressive miRNAs, miR-26a, miR-26a-1, miR-192, miR-122, miR-22, and miR-125b were significantly decreased in STZ-HFD mice compared to controls with significantly lower levels in males than in females. [score:2]
[1 to 20 of 3 sentences]
89
[+] score: 10
For example, Cheung et al. suggests that miR-122 expression in liver tissue relates to NASH development and the log2 ratio to normal expression was -0.29 [19], which was similar to our result (-0.66 and -0.28 in FLS W and FLS ob/ob liver, respectively). [score:6]
For example, the expression levels of miR-29c, miR-34a, miR-155, and miR-200b in mouse mo del liver and miR-122 and miR-34a in human liver are suggested to be NASH development candidates. [score:4]
[1 to 20 of 2 sentences]
90
[+] score: 10
This property is shared with other recently developed miRNA -dependent oncolytic adenoviruses, like miR-122 -based adenovirus-detargeting vectors, which exhibited a reduced virus-related liver toxicity [9, 50, 51, 52, 53]. [score:3]
However, miR-122 is a liver-specific miRNA and is not expressed in any other tissue, leaving open the possibility that toxicities due to viral replication could eventually affect other tissues. [score:3]
Together with the studies on miR-122 and let- 7, the present study indicates that the knowledge of miRNA expression levels in normal and cancer cells may be applied to the design of oncolytic viruses that combine selective efficacy against cancer cells with minimal adverse toxic effects. [score:3]
Fu and colleagues constructed a LCSOV (liver-cancer-specific oncolytic virus) in which the essential viral glycoprotein H gene (gH gene) was controlled by both an apoE-AAT liver-specific promoter and the presence of complementary sequences to miR-122, miR-124a and let-7a in its 3’ UTR [47]. [score:1]
[1 to 20 of 4 sentences]
91
[+] score: 10
The versatility of iNOP-7 as a delivery vehicle for RNAi molecules was illustrated when it also delivered an anti-miRNA single-stranded oligonucleotide inhibitor targeted to miR-122 [22]. [score:5]
Delivery of iNOP-7-anti-miR-122 complexes to mice silenced the expression of miR-122 levels in the liver by >80% and led to the alteration in expression of genes involved in cholesterol metabolism, resulting in a 30% reduction of total cholesterol [22]. [score:5]
[1 to 20 of 2 sentences]
92
[+] score: 9
Other miRNAs from this paper: mmu-mir-155, mmu-mir-21a, mmu-mir-34a, mmu-mir-21b, mmu-mir-21c
Recently, a role for miRNAs in liver disease has been proposed: hepatic expression profiling has revealed temporal changes in miRNA expression in human and murine NAFLD, and identified several differentially expressed miRNAs including miR-21, miR-34a, and miR-122 [5]. [score:9]
[1 to 20 of 1 sentences]
93
[+] score: 9
mIR-122 may affect type I IFN expression in tissues of immune origin by blocking suppression by cytokine signaling [37]. [score:4]
Importantly, mir-122 participates in natural killer (NK) cell activation by increasing expression of CD69, an activation receptor for NK cells, as well as increasing secretion of IFNγ [38]. [score:3]
Although mIR-122 has been reported to be a liver-specific miRNA; its presence in spleen could be due to species differences or the migration of leukocytes between organs. [score:1]
Most have not been associated with virus infection; however three, miR-122, miR-324 and let-7, have been identified in studies of host responses to viruses [34– 36]. [score:1]
[1 to 20 of 4 sentences]
94
[+] score: 9
The clustering of the differentially expressed miRNAs across the ELF-EMF exposure and sham groups is shown in Tables 1 and 2. The miRNAs that were most highly up- and downregulated at a magnetic field intensity of 1 mT were miR-494-3p (+2.3) and miR-122-5p (-2.6), while the most highly up- and downregulated miRNAs at a magnetic field intensity of 3 mT were miR-494-3p (+3.3) and miR-3084-3p (-3.7) (Tables 1 and 2). [score:9]
[1 to 20 of 1 sentences]
95
[+] score: 9
First, we detected high levels of miR-122, a specific miRNA abundantly expressed in liver but undetected in other tissues 2 3, in the conditioned media of glioma cell lines cultured as a monolayer or neurospheres (Fig. 1a). [score:3]
Considering the lack of miR-122 expression in glioblastoma tumors 4 and cultured glioma cells (Fig. 1a), we rationalized that this finding could be explained by either unusually efficient miR-122 secretion, or more plausibly, culture media as a primary source of this miRNA. [score:3]
Of note, the levels of miR-122 and miR-451 in the vd2D media relative to the crude 2D media were reduced to a different extent, but not entirely abolished. [score:1]
Indeed, miR-122 was highly abundant in fresh unconditioned media utilized for glioma cell cultures (Fig. 1b), indicating that the majority of miR-122 in the conditioned medium comes from the medium components rather than cell secretion. [score:1]
MiR-122 was the most abundant miRNA in the FBS, followed by miR-1246, miR-423-5p, miR-148a-3p, and let-7 family (Fig. 1f). [score:1]
[1 to 20 of 5 sentences]
96
[+] score: 9
Other miRNAs from this paper: mmu-mir-146a, mmu-mir-155
MicroRNAs, such as miR-122, miR-146a, and miR-155, are crucial for IFN immune response by modulating promoter methylation of suppressor of cytokine signaling 3 (SOCS3), activation of NF-κB and expression of suppressor of cytokine signaling 1 (SOCS1) (26– 28). [score:7]
Yoshikawa T. Takata A. Otsuka M. Kishikawa T. Kojima K. Yoshida H. Koike K. Silencing of microRNA-122 enhances interferon-alpha signaling in the liver through regulating SOCS3 promoter methylation Sci. [score:2]
[1 to 20 of 2 sentences]
97
[+] score: 9
AST and ALT were increased when animals were given liver or skeletal muscle toxicants, demonstrating that miR-122 was indicative of liver injury only and not muscle injury, thus displaying an advantage in specificity over ALT and AST. [score:1]
Interestingly, liver enriched miR-122-5p was increased in a dose and time dependent manner while AST and ALT were increased in the 45ug/kg treated dogs with no observed histopatholgic correlate. [score:1]
In a further study miR-122, HMGB1, Cytokeratin 18 and GLDH were able to predict patients who would develop liver failure as a result of acetaminophen overdose even when ALT remained in the normal range [25]. [score:1]
Clinical chemistry parameters including amylase and lipase (markers of pancreas injury), miR-122-5p (liver enriched), miR-133a-3p (muscle enriched), 148a-3p (pancreas enriched), 208a-3p (heart enriched) and pancreas miRNAs conserved between rat and dog (Table  2) were examined for changes in the serum. [score:1]
The rat caerulein study did not generate similar miR-122 increases. [score:1]
It is possible that, due to species differences in injury and physical proximity, pancreatic damage induced by caerulein in dogs caused some perturbation of the membranes of hepatocytes resulting in AST, ALT and miR-122-5p increases in the serum while not producing similar results in the rat. [score:1]
Additionally, miR-122 and liver enriched miR-192 were increased in the serum of patients who had acetaminophen induced hepatotoxicity demonstrating the potential for these miRNAs to be used as both preclinical and clinical biomarkers for liver injury [24]. [score:1]
Interestingly, liver enriched miR-122-5p was increased in a dose and time dependent manner while AST and ALT were increased in the 45 μg/kg treated dogs while no histopatholgic correlate was observed (data not shown). [score:1]
Mice treated with acetaminophen displayed increases of miR-122 in the serum 2 h before an increase of AST/ALT [23]. [score:1]
[1 to 20 of 9 sentences]
98
[+] score: 9
Total RNA was isolated from the whole exosome population and the expression of several selectively secreted microRNAs (cell to the exosome) and/or abundantly expressed (cancer exosomes versus the MCF10A exosomes) (miR-1246, miR-21, miR-122, and let-7a) was analyzed by real-time PCR. [score:5]
b- c Exosomes were isolated from the mouse plasma exosome sample by magnetic-bead based immunoaffinity isolation using an antibody against human CD63, the total RNA was extracted and the expression of miR-1246 and miR-122 were evaluated by qRT-PCR analysis (absolute quantitation) in the immunoaffinity isolated human CD63 -positive exosomes from the plasma of three NSG (n = 3, in triplicate) and nine HCI-PDX mo dels (with available biological replicates as indicated in c, in triplicate); Student’s t test; *** p < 0.001. [score:1]
As shown in Table  2, miR-1246 was most enriched, followed by miR-122 in MCF7 exosomes, and miR-21 was most enriched in MDA-MB-231 cells, followed by let-7a. [score:1]
Total RNA was extracted from the bead-bound exosomes and the expression of miR-1246, miR-451 and miR-122 were measured by qRT-PCR. [score:1]
Based on the selective enrichment and absolute abundance, we identified miR-1246, miR-122, miR-21, and let-7a as candidate exosome microRNAs that may serve as biomarkers indicative of breast cancer. [score:1]
[1 to 20 of 5 sentences]
99
[+] score: 9
Inhibition of miR-122 was previously shown to reduce HCV titer in infected chimpanzees without toxic effects or the development of resistance mutations (Lanford et al., 2010). [score:5]
Recent Phase II results using an anti-miR-122 drug called Miravirsen (Santaris Pharma) have revealed that five injections over the course of a month could reduce HCV viral titer in a dose -dependent fashion, and this effect was long lasting (>3 months) and did not elicit compensatory mutations in the HCV genome (Janssen et al., 2013). [score:2]
Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection. [score:1]
The liver-specific microRNA, miR-122, is required for Hepatitis C virus (HCV) replication (Jopling et al., 2005). [score:1]
[1 to 20 of 4 sentences]
100
[+] score: 8
Gatfield et al. proved PPAR β/ δ as a new target for miR-122, suggesting that PPAR β/ δ might act as a circadian metabolic regulator in miR-122 -mediated metabolic control [53]. [score:4]
miR-122 is a highly abundant, liver-specific microRNA whose transcription is regulated by REV-ERB α. It has previously been shown to regulate lipid metabolism in mouse liver [52]. [score:3]
REV-ERB α and miR-122 may serve as a possible link between PPAR β/ δ and circadian clock. [score:1]
[1 to 20 of 3 sentences]