sort by

177 publications mentioning mmu-mir-143 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-143. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 369
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-145b
We also provided evidence that restoration of ERBB3 expression can reverse miR-143/145 -suppressed cell proliferation and invasion, suggesting that the targeting of ERBB3 is one mechanism by which the miR-143/145 cluster exerts its tumor suppressive function. [score:9]
The expression levels of miR-143/145 and target mRNA were examined by relative quantification RT-PCR, and the expression levels of target protein were detected by Western blot. [score:9]
Furthermore, by overexpressing or knocking down miR-143/145 in MCF-7 cells, we experimentally validated that miR-143/145 directly inhibited ERBB3 translation. [score:9]
We hypothesized that the high levels of ERBB3 are a consequence of miRNA regulation, and we subsequently identified a cluster of miRNAs, including miR-143 and miR-145, that directly target and regulate the expression of ERBB3 protein in breast cancer cells. [score:8]
In this study, we predicted that ERBB3 is a target of miR-143 and miR-145, which are a cluster of miRNAs that have been reported in many studies to be downregulated and to function as tumor suppressors in most cancers [17, 18]. [score:8]
We identified specific targeting sites for miR-143 and miR-145 (miR-143/145) in the 3’-untranslated region (3’-UTR) of the ERBB3 gene and regulate ERBB3 expression. [score:8]
Taken together, our findings provide the first clues regarding the role of the miR-143/145 cluster as a tumor suppressor in breast cancer through the inhibition of ERBB3 translation. [score:7]
Because the targeting of ERBB3 has the potential to enhance the efficacy of other RTK inhibitors, combinatory treatments with both miR-143/145 and ErbB -targeted drugs may offer a viable strategy for breast cancer therapy. [score:7]
Furthermore, we showed that miR-143/145 inhibited ERBB3 expression and consequently suppressed the proliferation and invasion of breast cancer cells. [score:7]
To overexpress ERBB3, an expression plasmid designed to specifically express the full-length ORF of ERBB3 without the miR-143/145-responsive 3’-UTR was also constructed and transfected into MCF-7 and MBA-MD-231 cells. [score:7]
When MCF-7 cells were infected with these viral vectors, the expression of mature miR-143 and miR-145 was found to be 4–6-fold higher than the endogenous miRNA levels (Additional file 1: Figure S1E), and ERBB3 protein expression was significantly inhibited (Additional file 1: Figure S1F). [score:7]
Taken together, our results not only reveal a critical role for miR-143 and miR-145 as tumor suppressors in breast carcinogenesis through repression of ERBB3 translation but also show that different miRNAs within a cluster can simultaneously and cooperatively repress a given target mRNA. [score:7]
MCF-7 cells were either infected with a lentiviral expression vector to express miR-143 and miR-145 or transfected with an ERBB3 plasmid to overexpress ERBB3. [score:7]
In conclusion, our results demonstrated that miR-143/145 directly recognized and bound to the 3’-UTR of the ERBB3 mRNA transcript and synergistically suppressed ERBB3 expression in breast cancer cells. [score:6]
To determine the regulatory level at which miR-143/145 influenced ERBB3 expression, we repeated the above experiments and examined the expression of ERBB3 mRNA after transfection. [score:6]
A mammalian expression plasmid (pReceiver-M02-ERBB3) designed to specially express the full-length open reading frame (ORF) of human ERBB3 without the miR-143/145–responsive 3’-UTR was purchased from GeneCopoeia (Germantown, MD, USA). [score:5]
miR-143 and miR-145 suppress proliferation and invasion of breast cancer cells by targeting ERBB3. [score:5]
Figure 2 miR-143/145 directly regulate ERBB3 expression at the post-transcriptional level. [score:5]
To generate viral expression constructs, 300-bp fragments containing the genomic sequences of miR-143 and miR-145 were obtained by PCR amplification of human DNA and were then cloned into a lentiviral expressing vector. [score:5]
Finally, we showed that miR-143/145 inhibited ERBB3 expression and consequently promoted the proliferation and invasion of breast cancer cells, both in vitro and in vivo. [score:5]
Our results showed that ERBB3 mRNA levels were unchanged in the tumors from the miR-143/145 -overexpressing group but increased in tumors from the ERBB3 -overexpressing group (Figure  4E). [score:5]
Furthermore, the expression of ERBB3 protein was significantly increased in MCF-7 cells transfected with anti-miR-143 or anti-miR-145, and the greatest increase in expression occurred when both anti-miR-143 and anti-miR-145 were used simultaneously (Figure  2A). [score:5]
Untreated MCF-7 cells or MCF-7 cells infected with the miR-143/145 overexpression lentiviral vector or transfected with the ERBB3 expression plasmid were injected subcutaneously into C57BL/6 J mice (1 × 10 [7] cells per mouse, 7 mice per group). [score:5]
Likewise, when MCF-7 and MBA-MD-231 cells were simultaneously transfected with pre-miR-143/145 and the ERBB3 overexpression plasmid, ERBB3 dramatically rescued the suppressive effect of miR-143/145 on cell invasion (Figure  3C-F; lower panel). [score:5]
As anticipated, overexpression of miR-143 or miR-145 significantly suppressed ERBB3 protein levels in MCF-7 cells (Figure  2A). [score:5]
These results indicated that the suppressive effects of miR-143 and miR-145 on ERBB3 protein expression was not an individual response but was instead a synergistic effect. [score:5]
We hypothesize that a combination replacement treatment with both miR-143 and miR-145 will be a promising strategy for cancers showing downregulation of miR-143 and miR-145. [score:4]
We demonstrated that the repression of ERBB3 by miR-143/145 suppressed the proliferation and invasion of breast cancer cells, and that miR-143/145 showed an anti-tumor effect by negatively regulating ERBB3 in the xenograft mouse mo del. [score:4]
For luciferase reporter assays, MCF-7 cells were seeded in 6-well plates and co -transfected with 2 μg of firefly luciferase reporter plasmid, 2 μg of β-galactosidase (β-gal) expression plasmid (Ambion), and equal amounts (100 pmol) of miR-143/145 mimic, inhibitor, or scrambled negative control RNA using Lipofectamine 2000 (Invitrogen). [score:4]
These results demonstrated that miR-143/145 specifically regulate ERBB3 expression at the post-transcriptional level, which is the most common mechanism for animal miRNAs. [score:4]
In support of the notion that miR-143 and miR-145 function as tumor suppressive miRNAs [9], MCF-7 and MBA-MD-231 cells transfected with pre-miR-143/145 showed decreased proliferation; in contrast, knockdown of miR-143/145 had the opposite effect on cell proliferation (Figure  3A and B; left and middle panel). [score:4]
For example, miR-143 and miR-145 (miR-143/145), which are located in a cluster within the 5q32-33 chromosomal region, are downregulated in many types of cancers, including colon cancer and breast cancer [17, 18]. [score:4]
To determine whether the negative regulatory effects of miR-143/145 on ERBB3 expression were mediated through the binding of miR-143/145 to the presumed sites in the 3’-UTR of the ERBB3 mRNA, the full length 3’-UTR of ERBB3 containing the two presumed miR-143/145 binding sites was placed downstream of the firefly luciferase gene in a reporter plasmid. [score:4]
After determining the levels of miR-143 and miR-145 in the same six pairs of breast cancer tissues and corresponding noncancerous tissues, we showed that miR-143 and miR-145 levels were indeed downregulated in breast cancer tissues (Figure  1D). [score:4]
Overexpression or knockdown of miR-143/145 did not affect ERBB3 mRNA stability in MCF-7 and MBA-MD-231 cells (Figure  2C and D). [score:4]
Knockdown of miR-143/145 was achieved by transfecting cells with anti-miR-143 and/or anti-miR-145, which are chemically modified antisense oligonucleotides that are designed to specifically target mature miR-143 and miR-145. [score:4]
The correlation between miR-143/145 and ERBB3 was further examined by evaluating ERBB3 expression in the human breast cancer cell line MCF-7 and MBA-MD-231 after overexpression or knockdown of miR-143/145. [score:4]
We observed a significant and marked reduction in the sizes and weights of the tumors in the miR-143/145 -overexpressing group compared to control group, whereas the size and weight of the tumors in the ERBB3 -overexpressing group was increased (Figure  4B and C). [score:4]
The efficient overexpression and knockdown of miR-143/145 in MCF-7 cells are shown in Additional file 1: Figure S1A and B. Cellular miR-143/145 levels were increased approximately 400-fold when MCF-7 cells were transfected with pre-miR-143/145, and these levels dropped to approximately 20% of the normal level when MCF-7 cells were treated with anti-miR-143/145. [score:4]
Validation of ERBB3 as a direct target of miR-143/145. [score:4]
Consistent with the cellular levels of miR-143/145 after transfection, ERBB3 protein levels were downregulated when MBA-MD-231 cells were treated with pre-miR-143/145, but their levels were unaffected by treatment with anti-miR-143/145 (Figure  2B). [score:4]
Moreover, tumors from the miR-143/145 -overexpressing group displayed reduced ERBB3 protein levels compared to tumors from the control group, whereas the tumors from the ERBB3 -overexpressing group showed elevated ERBB3 protein levels (Figure  4F). [score:4]
This mutated luciferase reporter was unaffected by either overexpression or knockdown of miR-143/145 (Figure  2E). [score:4]
Interestingly, co-treatment of cells with both pre-miR-143 and pre-miR-145 enhanced the suppressive effect on ERBB3 protein expression compared to treatments with either pre-miR-143 or pre-miR-145 alone (Figure  2A). [score:4]
After 28 days of xenograft growth in vivo, tumors from the miR-143/145 -overexpressing group showed a significant increase in the expression of mature miR-143 and miR-145 compared to tumors from the control group (Figure  4D). [score:4]
Moreover, compared to MCF-7 and MBA-MD-231 cells transfected with pre-miR-143/145, the cells transfected with pre-miR-143/145 and the ERBB3 overexpression plasmid exhibited significantly higher proliferation rates (Figure  3A and B; right panel), suggesting that miR-143/145–resistant ERBB3 rescued the suppression of ERBB3 by miR-143/145 and attenuated the anti-proliferative effect of miR-143/145. [score:4]
These results further supported a synergistic effect of miR-143 and miR-145 on ERBB3 downregulation in MCF-7 cells. [score:4]
Figure 3 miR-143/145 regulate proliferation and invasion of breast cancer cells by targeting ERBB3. [score:4]
Therefore, the modulation of ERBB3 by miR-143/145 may explain why the downregulation of miR-143/145 during breast carcinogenesis can promote cancer progression. [score:4]
Construction of miR-143/145 overexpression lentiviral vector. [score:3]
We next analyzed the biological consequences of the decreased expression of miR-143 and miR-145 in breast cancer cells. [score:3]
In our study, bioinformatic analyses of the 3’-UTR of ERBB3 revealed two non-overlapping target elements for miR-143 and miR-145. [score:3]
We next analyzed the biological consequences of the miR-143/145 -driven repression of ERBB3 expression in breast cancer cells. [score:3]
Co-treatment with miR-143 and miR-145 synergistically suppress proliferation and invasion in breast cancer cells. [score:3]
These results demonstrated that ERBB3 is crucial to the proliferation and invasion of breast cancer cells, and that miR-143/145 can inhibit these cell functions through the silencing of ERBB3. [score:3]
miR-143/145 levels were significantly increased when MBA-MD-231 cells were transfected with pre-miR-143/145, but their levels were unchanged when MBA-MD-231 cells were treated with anti-miR-143/145 (Additional file 1: Figure S1C and D), which may be due to the low expression level of miR-143/145 in MBA-MD-231 cells. [score:3]
Interest in the miR-143/145 cluster was also supported by the recent identification of these two miRNAs as candidate breast cancer suppressors [9]. [score:3]
Figure 4 Effects of overexpression of miR-143/145 or ERBB3 on the growth of breast cancer cell xenografts in mice. [score:3]
Interestingly, co-treatment with both miR-143 and miR-145 at the same time suppressed the luciferase reporter containing the miR-143/145–responsive 3’-UTR to a greater extent than when either miR-143 or miR-145 was introduced alone. [score:3]
The predicted interactions between miR-143/145 and the targeting sites within the 3’-UTR of ERBB3 are illustrated in Figure  1C. [score:3]
Interestingly, miR-143 and miR-145 showed a cooperative repression of ERBB3 expression and cell proliferation and invasion in breast cancer cells, such that the effects of the two miRNAs were greater than with either miR-143 or miR-145 alone. [score:3]
Experimental validations supported the hypothesis that miR-143 and miR-145 exhibited a cooperative repression of ERBB3 expression and luciferase activity that was stronger than with either miR-143 or miR-145 alone. [score:3]
miR-143/145 overexpression lentiviral vector was added to MCF-7 cells at 70% confluence in 6-well plates or 10-cm dishes at an MOI of 10 together with polybrene at a final concentration of 5 μg/mL according to the manufacturer’s instructions. [score:3]
For overexpression of miRNAs, 100 pmol of pre-miR-143, 100 pmol of pre-miR-145 or 50 pmol of both pre-miR-143 and pre-miR-145 were used. [score:3]
The target genes of miR-143 identified and verified thus far are primarily MAPK signaling molecules, such as ERK5 and KRAS [19, 20]. [score:3]
In these experiments, overexpression was achieved by transfecting cells with pre-miR-143 and/or pre-miR-145, which are synthetic RNA oligonucleotides that mimic the miR-143 and miR-145 precursors. [score:3]
Thus, ERBB3 was determined to be a miR-143/145 target, based on both computational predictions and the inverse correlation between miR-143/145 levels and ERBB3 protein levels, but not mRNA levels, in human breast cancer. [score:3]
The minimum free energy values of the hybridizations between miR-143 and ERBB3 and between miR-145 and ERBB3 were −25.9 and −28.2 kcal/mol, respectively, which are well within the range of genuine miRNA-target pairs. [score:3]
A 300-bp fragment containing genomic miR-143 and miR-145 sequences was generated by PCR amplification from human DNA and subsequently cloned into the Lenti-PacTM human immunodeficiency virus (HIV) expression packing system (Invitrogen). [score:3]
These results demonstrated that miR-143 and miR-145 synergistically suppress proliferation and invasion in breast cancer cells. [score:3]
Identification of conserved miR-143 and miR-145 target sites within the 3’-UTR of ERBB3. [score:3]
Furthermore, the biological consequences of the targeting of ERBB3 by miR-143/145 were examined by cell proliferation and invasion assays in vitro and by the mouse xenograft tumor mo del in vivo. [score:2]
As a result, co-treatment with both miR-143 and miR-145 synergistically suppressed the growth and invasion of breast cancer cells compared with a single treatment with either miR-143 or miR-145. [score:2]
For knockdown of miRNAs, 100 pmol of anti-miR-143, 100 pmol of anti-miR-145 or 50 pmol of both anti-miR-143 and anti-miR-145 were used. [score:2]
Meanwhile, although miR-143 and miR-145 can individually suppress cell proliferation and invasion, the simultaneous introduction of both miR-143 and miR-145 showed a cooperative repression of cell proliferation and invasion compared to effects of either miR-143 or miR-145 alone. [score:2]
These results were consistent with the findings of the in vitro assays, which firmly validated the biological role of miR-143/145 in breast tumorigenesis through the targeting of ERBB3. [score:2]
In this study, co-treatment with miR-143 and miR-145 showed a synergistic anti-tumor effect both in vitro and in vivo through the negative regulation of ERBB3 in human breast cancer. [score:2]
The results delineate a novel regulatory network employing miR-143/145 and ERBB3 to fine-tune cell proliferation and invasion. [score:2]
Furthermore, we introduced point mutations into the corresponding complementary sites in the 3’-UTR of ERBB3 to eliminate the predicted miR-143/145 binding sites. [score:2]
We next evaluated the effects of miR-143 and miR-145 overexpression on the growth of human breast cancer cell xenografts in mice. [score:1]
One goal of this study was to determine whether miR-143 and miR-145 function individually or synergistically. [score:1]
Using these approaches, miR-143 and miR-145 were identified as candidate miRNAs. [score:1]
The results are displayed as the ratio of firefly luciferase activity in the miR-143/145 -transfected cells to the activity in the control cells. [score:1]
However, for miRNAs in a cluster that do not share homology (e. g., miR-143 and miR-145), their individual and combined functionalities are less clear. [score:1]
miR-143 and miR-145 were thus selected for further experimental verification. [score:1]
Synthetic RNA molecules, including pre-miR-143, pre-miR-145, anti-miR-143, anti-miR-145 and scrambled negative control RNA (pre-miR-control and anti-miR-control), were purchased from GenePharma (Shanghai, China). [score:1]
Future studies are required to investigate whether miR-143 and miR-145 are involved in the mechanism of resistance to ErbB -targeted drugs in breast cancer. [score:1]
Total RNA was subsequently extracted from each xenograft and was used to evaluate the expression of mature miR-143 and miR-145. [score:1]
The resulting plasmid was transfected into MCF-7 cells along with a transfection control plasmid (β-gal) and either pre-miR-143/145, anti-miR-143/145 or scrambled negative control RNAs. [score:1]
MCF-7 cells were co -transfected with firefly luciferase reporters containing either wild-type (WT) or mutant (Mut) miR-143/145 binding sites in the ERBB3 3’-UTR and pre-miR-control, pre-miR-143, pre-miR-145 or both pre-miR-143 and pre-miR-145, or with anti-miR-control, anti-miR-143, anti-miR-145 or both anti-miR-143 and anti-miR-145. [score:1]
miR-143 and miR-145 are two miRNAs that are located within the same cluster, but they do not share sequence homology. [score:1]
One predicted hybridization was observed between both miR-143 and miR-145 and the 3’-UTR of ERBB3. [score:1]
In contrast, the luciferase activity was significantly increased in cells transfected with either anti-miR-143 or anti-miR-145, and a maximal increase in activity was observed when cells were transfected simultaneously with both anti-miR-143 and anti-miR-145 (Figure  2E). [score:1]
Detection of an inverse correlation between miR-143/143 and ERBB3 levels in breast cancer tissues. [score:1]
Furthermore, the miR-143/145 binding sequences in the ERBB3 3’-UTR were highly conserved across species. [score:1]
miR-143 and miR-145 decrease the growth rate of breast cancer cells in vivo. [score:1]
In future studies, an effective drug delivery system needs to be developed for the application of miR-143 and miR-145 for breast cancer therapy. [score:1]
After measuring the expression levels of miR-143/145 and ERBB3 in human breast cancer tissue and paired noncancerous tissue, we detected an inverse correlation between miR-143/145 levels and ERBB3 protein levels. [score:1]
Figure 1 Inverse correlation between miR-143/145 levels and ERBB3 protein levels in human breast cancer tissues. [score:1]
As expected, the luciferase activity was markedly reduced in cells transfected with pre-miR-143 or pre-miR-145, and the potency was increased when pre-miR-143 and pre-miR-145 were used in combination (Figure  2E). [score:1]
To test the binding specificity, the sequences that interact with the seed sequence of miR-143 and miR-145 were mutated (from UUGGGAG to AACCCUC for the miR-143 binding site; and from UUGGGAG to AACCCUC for the miR-145 binding site), and the mutant ERBB3 3’-UTR was inserted into an equivalent luciferase reporter plasmid. [score:1]
We identified an inverse correlation between miR-143/145 levels and ERBB3 protein levels, but not between miR-143/145 levels and ERBB3 mRNA levels, in breast cancer tissue samples. [score:1]
The levels of miR-143/145 in breast cancer cells transfected with synthetic RNA oligonucleotides or infected with lentivirus. [score:1]
The showed that the percentage of invaded cells was significantly lower in MCF-7 and MBA-MD-231 cells transfected with pre-miR-143/145 and higher in cells transfected with anti-miR-143/145 (Figure  3C-F; upper and middle panel). [score:1]
miR-143 and miR-145 have frequently been reported to be involved in drug resistance in many cancer types, although little evidence has been detected in breast cancer. [score:1]
microRNA miR-143 miR-145 ERBB3 Breast cancer Proliferation Invasion Breast cancer is the most common cancer and principle cause of death from cancer in women worldwide [1, 2]. [score:1]
miR-143 and miR-145 have been shown to possess anti-tumorigenic activity, with involvement in various cancer-related events such as proliferation, invasion and migration. [score:1]
[1 to 20 of 107 sentences]
2
[+] score: 303
To identify miR-143/145 target genes and regulated genes that contribute to the reduced cell contraction and actin filaments in miR-143/145 silenced HTM cells, the expression of a list of predicted and/validated miR-143/145 target/regulated genes was examined by qRT-PCR. [score:9]
To further confirm whether miR-143 and miR-145 directly regulate their target genes, the activity of the 3′-untranslated region (UTR) of the target genes was analyzed by a reporter assay. [score:8]
Expression of PDGFRA and ABLIM-2, which are miR-143 and miR-145 target genes respectively, was specifically upregulated by miR-143 and miR-145 respectfully. [score:8]
PDGFRA was upregulated by miR-143 silencing, and ABLIM2 was upregulated by miR-145 silencing. [score:7]
That is consistent with the Targetscan prediction that PDGFRA is a miR-143 target gene [25], and the PicTar prediction that ABLIM-2 is a miR-145 target gene [26]. [score:7]
However, it was downregulated in HTM cells upon miR-143/145 silencing, which suggests cell-type specific regulation of miR-143/145 target genes. [score:7]
Specifically, ARPC-2, and -5 was significantly upregulated by either miR-143 or miR-145 silencing, while ARPC-3 was significantly upregulated by miR-143 only. [score:7]
The expression of the other predicted miR-143 and/or miR-145 target genes in the list, including KLF4, SSH2, PRKCE, and ROCK1, was not significantly regulated by miR-143 and or miR-145 silencing. [score:6]
Among the ARPC genes, ARPC-2 and ARPC-5 were confirmed as direct miR-143 target genes, while ARPC-3 is probably regulated by miR-143/145 through indirect mechanisms. [score:6]
PDGFRA and ABLIM-2 expression was upregulated by miR-143 and miR-145 silencing, respectively. [score:6]
miR-143 antagomiR only specifically silenced miR-143 expression, without affecting expression of miR-145; and vice versa. [score:5]
miR-143/145 expression in HTM cells appeared to be less but comparable to the expression in human aortic smooth muscle cells (HASMC), but more abundant than in human umbilical vein endothelial cells (HUVEC) (Fig.   1A,B). [score:5]
MLCK expression was repressed by either miR-143 or miR-145 silencing, although it is not a predicted miR-143/145 target. [score:5]
Human TM (HTM) cells were isolated from donor eyes with no history of eye disease, and the expression of miR-143 and miR-145 was examined by qRT-PCR. [score:5]
Mechanistically, miR-143 and miR-145 are required for maintaining actin-cytoskeletal dynamics and contractility in HTM cells, possibly through regulating or directly targeting multiple genes involved in actin dynamics and contractility. [score:5]
Surprisingly, KLF5 was downregulated by either miR-143 or miR-145 silencing. [score:4]
Figure 5Regulation of miR-143/145 target genes and glaucoma-related genes by miR-143/145. [score:4]
KLF5 is involved in vascular SMC proliferation and upregulated in miR-143/145 d KO aortas [16]. [score:4]
These results suggest that miR-143 and miR-145 regulate genes involved in actin dynamics and cell contractility through both direct and indirect mechanisms. [score:4]
Elia, L. et al. The knockout of miR-143 and -145 alters smooth muscle cell maintenance and vascular homeostasis in mice: correlates with human disease. [score:4]
In addition, multiple members of the ARPC complex, including ARPC-2, -3 and -5, are upregulated by miR-143 or miR-145 silencing. [score:4]
We have identified a 5.5 kb miR-143/145 upstream regulatory sequence that drives miR-143/145 expression in smooth muscle cells, pericytes, ciliary muscles and extraocular muscles. [score:4]
However, reporter gene activity was not detected in TM cells or corneal epithelial cells, suggesting that other regulatory regions may drive miR-143/145 expression in these cell types. [score:4]
To further determine whether a 5.5 kb miR-143/145 upstream regulatory sequence drives miR-143/145 expression in the eye, beta-galactosidase (LacZ) staining was performed in transgenic mice in which a 5.5 kb of genomic DNA upstream of miR-143/145 was fused to a lacZ reporter [16]. [score:4]
When different ocular cell types were compared, miR-143/145 expression in HTM cells was ~100–1000 times higher than that in human ARPE-19 or human choroidal endothelial cells (HCEC), confirming the SMC and TM enrichment of miR-143/145 expression (Fig.   1C). [score:4]
Alternatively, the regulatory elements driving miR-143/145 in TM cells and corneal epithelial cells may not be conserved between human and mouse, or the reporter gene may not be sensitive enough to detect miR-143/145 expression in TM cells and corneal epithelial cells. [score:4]
By simultaneously regulating multiple genes involved in actin dynamics, cell contractility and IOP regulation, miR-143/145 may provide distinct mechanisms to regulate IOP in glaucoma patients. [score:4]
Future work should focus on examining the expression of miR-143/145 in glaucoma patients and testing the efficacy of miR-143/145 silencing in regulating IOP in vivo [15]. [score:4]
Interestingly, neither miR-143 nor miR-145 significantly influenced the ARPC-3 3′-UTR activity, although they are capable of regulating its expression at mRNA level (Fig.   5H). [score:4]
miR-143 and miR-145 expression plasmids were described in ref. [score:3]
The miR-143/145 miRNA cluster is expressed in the smooth muscle and the TM in the eye. [score:3]
Our data demonstrate that miR-143 and miR-145 are expressed in smooth muscle cells and TM cells in the eye. [score:3]
Accordingly, overexpression of miR-143 repressed the PDGFRA 3′-UTR activity in a dose -dependent manner, while miR-145 failed to influence its activity (Fig.   5E). [score:3]
Although not homologous, miR-143 and miR-145 share a number of common target genes involved in actin dynamics and contractile function 16, 18, 19. [score:3]
PDGFRA and ARPC-5 UTRs contain canonical target sites for miR-143 and miR-145 respectively (Fig.   5C,D). [score:3]
However, miR-143/145 expression level was not detectable in corneal or retinal epithelium in the LacZ reporter mice (Fig.   1D). [score:3]
MLCK expression was repressed by either miR-143 or miR-145 silencing. [score:3]
ARPC-2, ARPC-3, ARPC-5 and PDGFRA 3′UTRs were cloned downstream of the coding region of luciferase in a cytomegalovirus (CMV) -driven luciferase vector, and tested for luciferase activity after co-transfection with miR-143 or miR-145 expression plasmids in COS-1 cells. [score:3]
The increased expression of ARPC5, and/or ARPC2/3 could potentially explain the reduced actin filament length upon miR-143/145 silencing. [score:3]
Expression of miR-143/145 in the eye. [score:3]
By qRT-PCR, the expression of miR-143 and miR-145 in human TM cells is less but comparable to the aortic SMC cells, but much higher than in choroidal endothelial cells and RPE cells. [score:3]
Here we show that the miR-143/145 cluster is expressed in the smooth muscle and TM cells in the eye. [score:3]
However, miR-143 also repressed the 3′-UTR activity of ARPC-2 and ARPC-5, suggesting the existence of non-canonical miR-143 targeting sites in the 3′-UTR of these two genes (Fig.   5F,G). [score:3]
miR-143 and miR-145 have been reported to be expressed in corneal epithelial cells, especially limbal stem cells 20, 21. [score:3]
Mechanistically, miR-143/145 regulates actin dynamics and TM cell contractility, consistent with its regulation of actin-related protein complex (ARPC) subunit 2, 3, and 5, as well as myosin light chain kinase (MLCK) in these cells. [score:3]
Figure 1Expression of miR-143 and miR-145 in the eye as revealed by qRT-PCR and LacZ staining. [score:3]
miR-143/145 silencing represses the expression of APRC, PDGFRA and MLCK genes. [score:3]
Targeted deletion of miR-143 and miR-145 results in reduced IOP, consistent with an ~2-fold elevation in outflow facilities. [score:3]
PDGFRA was further confirmed by 3′UTR luciferase assay to be a direct miR-143 target gene. [score:3]
To establish a potential role of miR-143/145 in IOP regulation, we first examined their expression in TM cells and compared them with that in SMC cells. [score:3]
Based on these data, we conclude that miR-143 and miR-145 are enriched in the SMCs, pericytes, CMs and extraocular muscle in the mouse eye, but are also expressed in the TM cells. [score:3]
Expression of miR-143 and miR-145 in smooth muscle and TM cells in the eye. [score:3]
miR-143 and miR-145 have been shown to regulate contractility and maintain actin stress fibers in smooth muscle cells 16– 19. [score:2]
With regard to the miR-143/145 functional mechanism, we showed that miR-143 and miR-145 regulate actin-cytoskeletal dynamics and contractility in TM cells. [score:2]
In line with observed phenotypes in HTM cells, multiple genes involved in actin dynamics and cell contractility are regulated by miR-143/145 as revealed by qRT-PCR. [score:2]
Our results demonstrate that miR-143/145 regulates IOP and outflow facilities in vivo, suggesting that manipulating miR-143/145 level may have therapeutic implications in glaucoma. [score:2]
Similarly, miR-143 and miR-145 have been shown to regulate the contractility of vascular SMCs [19]. [score:2]
More than 90% knockdown of miR-143/145 in HTM cells was achieved as shown by qRT-PCR (Fig.   4A). [score:2]
Normal gross ocular morphology in miR-143/ 145 d KO miceEncouraged by the smooth muscle- and TM-enriched expression of miR-143 and miR-145 in the eye, we set to characterize the ocular phenotype in the miR-143/ 145 double knockout (d KO) mice that we had previously generated [16]. [score:2]
We provide genetic evidence that miR-143 and miR-145 regulate IOP in vivo. [score:2]
Encouraged by the smooth muscle- and TM-enriched expression of miR-143 and miR-145 in the eye, we set to characterize the ocular phenotype in the miR-143/ 145 double knockout (d KO) mice that we had previously generated [16]. [score:2]
These results suggest that the aqueous humor production is largely normal but the outflow facilities are increased by miR-143/ 145 knockout, which results in the decreased IOP in those mice. [score:2]
Cordes, K. R. et al. miR-145 and miR-143 regulate smooth muscle cell fate and plasticity. [score:2]
16. miR-143, or miR-145, expression plasmid was co -transfected with the reporter plasmids in COS1 cells and reporter assays were performed as described [36]. [score:2]
To further examine whether miR-143 and miR-145 are required for regulating IOP under high IOP conditions, we induced intraocular hypertension in these mice by polystyrene microbead injection, and examined the effects of miR-143/ 145 deletion on IOP elevation 22, 23. [score:2]
These results suggest that miR-143/145 regulates the contractility of HTM cells, with miR-143 having a more dominant role than miR-145. [score:2]
Regulation of multiple genes involved in actin dynamics and contractility by miR-143/145 in HTM cells. [score:2]
miR-143 and miR-145 regulate actin dynamics and contractility of HTM cells. [score:2]
Together, these results suggest that miR-143/145 is not required for the development of iridocorneal and retinal structures. [score:2]
Regulation of actin dynamics and cell contractility by miR-143/145 in HTM cells. [score:2]
Future studies are needed to identify additional miR-143/145 regulated genes using an unbiased genome-wide approach. [score:2]
Together, our results show that multiple genes involved in actin dynamics and cell contractility, including ARPC-2, -3 and -5, PDGFRA, ABLIM-2 and MLCK, are regulated by miR-143/145 in HTM cells. [score:2]
To further dissect the mechanism whereby miR-143 and miR-145 regulate outflow facilities, we tested the effect of miR-143/145 silencing on the actin dynamics and contractility of TM cells. [score:2]
We found multiple genes listed above were regulated by miR-143/145 silencing in HTM cells (Fig.   5A,B). [score:2]
Our findings that miR-143 and miR-145 regulate IOP have important therapeutic implications. [score:2]
In other reports, miR-143/145 has been shown to regulate actin dynamics and contractility in smooth muscle cells 16, 19. [score:2]
Regulation of outflow facilities and IOP by miR-143/145. [score:2]
The results of this study reveal an important role for miR-143 and miR-145 in regulating IOP in mice. [score:2]
LacZ plus eosin counter-staining was performed in ~2-month old transgenic mice in which LacZ is driven by a 5 kb miR-143/145 enhancer. [score:1]
HTM cells show significantly reduced stress fiber length upon miR-143/145 silencing, suggesting a more relaxed or less stretched state in these cells. [score:1]
To visualize the actin stress fibers in miR-143/145 silenced HTM cells, the amount and distribution of filamentous F-actin and the number of stress fibers were visualized by labeling with phalloidin (Fig.   4B,C). [score:1]
Deletion of miR-143 and miR-145 results in a significant reduction (~14% decrease) in systolic blood pressure due to reduced vascular tone [19]. [score:1]
To study the mechanisms whereby miR-143 and miR-145 regulate outflow facilities, we investigated how these miRNAs regulate actin-cytoskeletal dynamics and contractility in TM cells. [score:1]
Stress fiber length was significantly reduced in HTM cells transfected with miR-143 and miR-145 antagomiRs (p < 0.001). [score:1]
Figure 4Effect of miR-143/145 silencing on stress fiber length and cell contractility in HTM cells. [score:1]
miR-143/ 145 d KO mice and the 5.5 kb miR-143/145 enhancer/promoter element-LacZ transgenic mice were generated as described [16]. [score:1]
Xin, M. et al. MicroRNAs miR-143 and miR-145 modulate cytoskeletal dynamics and responsiveness of smooth muscle cells to injury. [score:1]
The miR-143/145 cluster has been shown to be enriched in vascular smooth muscle cells 16– 19. [score:1]
After 24-hour transfection with miR-143 or miR-145 antagomiRs, HTM cells were embedded in the collagen preparation before pouring, and polymerized at 37 °C, 5% CO [2] for 30 minutes. [score:1]
Microbeads obstruct the aqueous humor outflow, and can be used to determine whether the aqueous humor production or aqueous humor outflow is affected in miR-143/ 145 d KO mice. [score:1]
Although the IOP in miR-143/ 145 d KO mice was still significantly less than that in the WT littermates at 1 or 2 weeks after microbead injection (P < 0.0001), the IOP elevation was comparable (10.5 and 10.3 mmHg increase in WT vs 9.5 and 8.4 mmHg in d KO at 1 and 2 weeks post injection, respectively) in both mice after microbead injection. [score:1]
miR-143/145 AntagomiR transfection and phalloidin staining were performed as described [36]. [score:1]
Therefore, the IOP in miR-143/ 145 d KO mice was ~19% less than that in the WT littermates (P < 0.0001). [score:1]
miR-143, miR-145 and control antagomiRs were ordered IDT. [score:1]
The reporter activity was not detectable in the TM of the reporter mice, although miR-143 and miR-145 was detected in HTM cells by qRT-PCR. [score:1]
The sequences include: 2′-O-methyl anti-miR-143: 5′-mGmAmG mCmUA CAG UGC UUC AmUmC mUmCmA3′; 2′-O-methyl anti-miR-145: 5′-mAmGmG mGmAU UCC UGG GAA AAC mUmGmG mAmC-3′; 2′- O-me-scrambled miR: 5′-mAmAmAmAmCCUUUUGACCGAGCmGmUmGmUmU-3′. [score:1]
Normal gross ocular morphology in miR-143/ 145 d KO mice. [score:1]
These data demonstrate that the decreased IOP in the miR-143/ 145 d KO mice results from a ~2-fold elevation in the outflow facilities in these mice. [score:1]
Figure 3Reduced IOP and increased outflow facilities in miR-143/ 145 d KO mice. [score:1]
Transfection of HTM cells with miR-143 antagomiR resulted in a significant decrease in cell contraction in two of the three primary HTM cell lines analyzed (p < 0.0018) and had no significant effect in the other cell line (p < 0.3) (Fig.   4D). [score:1]
Although the effect of miR-143/145 silencing on cell contraction was variable in primary HTM cells from different donors, our results suggest that these miRNAs, particularly miR-143, contribute to TM cell contractility. [score:1]
In miR-143/145 d KO mice, the IOP increased from ~12.7 mmHg to ~22.2 mmHg (22.2 ± 0.3, N = 12) at 1 week and to ~21.1 mmHg (21.1 ± 0.4, N = 12) at 2 weeks after microbeadinjection (Fig.   3B). [score:1]
We also examined whether miR-143/145 silencing affects HTM cell contractility. [score:1]
While the average IOP in the WT mice was ~15.7 mmHg (15.7 ± 0.6 mmHg, N = 23), the IOP in miR-143/ 145 d KO mice was only ~12.7 mmHg (12.7 ± 0.3 mmHg, N = 24) (Fig.   3A). [score:1]
Reduced IOP in miR-143/ 145 d KO mice. [score:1]
Figure 2Normal histology in the eyes of miR-143/ 145 d KO mice. [score:1]
Deletion of miR-143 and miR-145 in mice results in an ~19% decrease in IOP, which is consistent with an ~2-fold increase in outflow facilities. [score:1]
miR-143 and miR-145 antagomiRs were used to silence these two miRNAs, respectively. [score:1]
[1 to 20 of 108 sentences]
3
[+] score: 301
miR-143 downregulates the expression of c-Myc, cyclin D1 and c-jun through inhibiting ERK5 expression, and upregulates miR-145, probably by elevating the common transcript of endogenous pri-miR-143/pri-miR-145. [score:13]
Forced Expression of miR-143 Induced miR-145 Expression in the Small Intestine Tumors of Apc [Min/+] Mice and Suppressed the Tumor DevelopmentTo express miR-143 ubiquitously in whole body, we made a construct which carried ∼300 bp human pri-miR-143 fragment under the CAG regulatory unit, composed of CMV enhancer and chicken β-actin promoter, and injected it into the fertilized mice eggs [17] (Fig. 1A). [score:11]
Since Sachdeva et al. recently revealed that miR-145 when activated by p53 directly suppressed c-Myc expression, it is likely that miR-143 and miR-145 complement each other to downregulate c-Myc expression in our experimental systems [24]. [score:11]
The data of our transfection experiments, together with these previous studies, suggest that miR-143 probably inhibits tumor development by downregulating c-Myc expression in cooperation with miR-145 in our transgenic mice. [score:9]
Forced Expression of miR-143 Induced miR-145 Expression in the Small Intestine Tumors of Apc [Min/+] Mice and Suppressed the Tumor Development. [score:8]
As shown in Fig. 5B (3 [rd] panel), miR-145 mimic inhibited p72 expression, while neither miR-143 mimic nor siRNA for ERK5 seemed to have significant effect, which data demonstrate that the downregulation of p72 in the small intestine tumors of Tg/APC may be mainly elicited by miR-145. [score:8]
Effect of miR-143 and miR-145 converge on the repression of c-Myc, leading to the decrease of p68 expression, while miR-145 directly inhibits p72 expression. [score:8]
Corresponding to the miR-143 expression, ERK5 expression in the small intestine tumors of Tg/APC was downregulated compared to W/APC, whereas no significant difference was observed in the colon (Fig. 4A). [score:7]
These findings suggest that miR-143 and miR-145 might act in concert to inhibit both ERK5/c-Myc and p68/p72/β-catenin signaling, and thereby suppress the expression of cyclin D1, c-jun and c-Myc itself. [score:7]
Moreover, Suzuki et al. reported that the processing of pri-miR-143 and pri-miR-145 required the interaction of the tumor suppressor p53 and the Drosha complex through the association with p68/p72 in colon cancer cells, suggesting that the full expression of miR-143 and miR-145 might be involved in tumor suppressing signaling driven by p53 [14]. [score:7]
These data implied that failure of suppression of p68 expression by mimics of miR-143 and miR-145 in colon cancer cells might be due to insufficient c-Myc inhibition. [score:7]
Figure 3B indicated that both of pri-miR-143 and pri-miR-145 expression was upregulated in the small intestine tumors of Tg/APC. [score:6]
Indeed, this notion was supported by the following studies, which revealed that the downregulation of miR-143 and miR-145 could be involved in B-cell malignancy [5] and that colon tumor cell proliferation was suppressed by transfection with miR-143 [6]. [score:6]
Michael et al. initially reported that the expression of miR-143 and miR-145 was downregulated in many colorectal neoplasms, suggesting their potential action as tumorsuppresors [4]. [score:6]
We also present that the expression of c-Myc and p72 is downregulated by miR-143/miR-145 and miR-145, respectively, in a human colon cancer cell lines, DLD-1 and Lovo cells. [score:6]
It should be noted that miR-143 mimic significantly downregulated the expression of ERK5 although it was weaker than the effect of siRNA for ERK5 (Fig. 5B 2 [nd] panel). [score:6]
Here, we present that forced expression of miR-143, which is in vivo processed from pri-miRNA, induces miR-145 expression and represses the small intestine tumor formation in Apc [Min/+] mice. [score:5]
These data suggested that forced expression of miR-143 should be sufficient for ERK5 repression, but that miR-145 induction might be a crucial event for full inhibition of cyclin D1, c-jun and c-Myc through retardation of 68/p72/β-catenin signaling. [score:5]
c-Myc expression was not significantly suppressed by either miR-143 or miR-145 mimic when individually transfected. [score:5]
To examine whether miR-143 induces the miR-145 expression in human colon tumor cells, we introduced miR-143 mimic into DLD-1 cells and Lovo cells, and analyzed the miR-145 expression by qRT-PCR. [score:5]
As far as we examined, none of miR-143 and miR-145 mimics significantly inhibited p68 expression in DLD-1 cells and Lovo cells (Fig. 5B, 4 [th] panel, Fig. S3B, 3 [rd] panel). [score:5]
Thus, the forced expression of miR-143 in the small intestine tumors may induce the transcription of a bicistronic pri-miR-143/miR-145 to promote the expression of miR-145, and possibly miR-143. [score:5]
However as most of these studies used synthetic miR-143 and miR-145 mimics, their expression was transient and usually far beyond the level normally expressed in living organisms. [score:5]
As shown in Fig. 3A, miR-143 was highly expressed in the small intestines tumors of Tg/APC whereas the colon tumors generally expressed lower. [score:5]
In summary, miR-143 and miR-145 likely work together to inhibit at least two signaling pathways involving ERK5/c-Myc and p68/p72/β-catenin in the intestine tumors of Apc [Min/+] mice, and thereby suppress their common downstream effectors. [score:5]
Thus, a significant level of miR-143 expression might be necessary for ERK suppression, or colon cells might have low sensitivity of ERK5 to miR-143. [score:5]
To express miR-143 ubiquitously in whole body, we made a construct which carried ∼300 bp human pri-miR-143 fragment under the CAG regulatory unit, composed of CMV enhancer and chicken β-actin promoter, and injected it into the fertilized mice eggs [17] (Fig. 1A). [score:4]
This synergistic effect of miR-143 and miR-145 on c-Myc downregulation was also observed in another human colon cancer cell line, Lovo (Fig. S3B, 1 [st] panel). [score:4]
Consistent with the results of MEK5 transfection, siRNA for ERK5 clearly repressed c-Myc expression (Fig. 5B, 1 [st] and 2 [nd] panels), suggesting that ERK5 could be one of the molecules through which miR-143 regulates c-Myc. [score:4]
Thus, the sufficient expression of miR-143 appears to restrain tumor development in living animals. [score:4]
Next, we tried to identify the direct target molecule of miR-143 which would contribute the retardation of small intestine tumors. [score:4]
In contrast, we detected only little enhancement of miR-145 in Tg/APC colon tumors even though one of the tumors examined strongly expressed miR-143 (see Fig. 3A #13). [score:3]
Next, we examined the effect of miR-143, miR-145 or siRNA for ERK5 on c-Myc expression in DLD-1 cells. [score:3]
Thus, it is possible that p68 and c-Myc might form a positive feedback loop, which suggests that miR-143 and miR-145 might inhibit p68 in part through the repression of c-Myc. [score:3]
These data implicated that suppression of c-Myc might be at least partly involved in the elevation of miR-145 and probably of miR-143 in the transgenic intestine tumors. [score:3]
To examine whether the upregulation of miR-145 in Tg/APC tumors was due to the increase of pri-miRNA, we performed qRT-PCR analysis of the mouse endogenous pri-miR-143 and pri-miR-145 with two sets of primers covering each pre-miRNA region. [score:3]
0042137.g003 Figure 3 A) Polyacrylamide Northern blot analysis of expression of miR-143 and miR-145 of gut tumors. [score:3]
Hence, given qRT-PCR analysis of pri-miR-143/145 and Western blot analysis of transgenic tumors, forced -expression of miR-143 might trigger c-Myc/pri-miR-145 signal more easily in the small intestine tumors than in the colon tumors. [score:3]
As far as we are aware, this is the first report that miR-143 suppresses tumors spontaneously developing in living organisms. [score:3]
The incidence of transgenic colon tumor development, which exhibited poor miR-143 expression, unexpectedly increased compared to non-transgenic littermates. [score:3]
The expression of mouse pri-miR-143 and pri-miR-145 of the small intestine tumors from Tg/APC (gray bars, n = 5) and their non-transgenic littermates (W/APC) (open bars, n = 4) was examined. [score:3]
miR-143 and miR-145 have emerged as tumor suppressing miRNAs, particularly for colon cancers. [score:3]
Hence, we examined the effect of miR-143 and miR-145 on p68/p72 expression in DLD-1 cells. [score:3]
Here, we establish transgenic mice in which miR-143 is ubiquitously expressed in a variety of organs. [score:3]
So far, several candidates for miR-143 targets in cancer cells have been identified. [score:3]
Moreover, miR143 expression also increased by c-Myc siRNA (Fig. 5G). [score:3]
The expression of mouse pri-miR-143 and pri-miR-145 of tumors from Tg/APC (gray bars, n = 3) and their non-transgenic littermates (W/APC) (open bars, n = 3) was examined in the same way as B). [score:3]
The 4 [th] panel represents quantitative analysis of miR-143 expression in the 1 [st] panel. [score:3]
Interestingly, the level of c-Myc was closely related to that of ERK5 (Fig. 4B 3 [rd] and 4 [th] panels), strongly implicating that c-Myc was one of the major downstream targets of miR-143 through ERK5. [score:3]
Unexpectedly, the expression of miR-145 of transgenic small intestine tumors also increased in proportion to that of miR-143 (Fig. 3A). [score:3]
A) Polyacrylamide Northern blot analysis of expression of miR-143 and miR-145 of gut tumors. [score:3]
Indeed, although miR-143 was strongly expressed in one colon tumor of transgenic mice, the induction of miR-145 was poor (Fig. 3A #13). [score:3]
Recently, ERK5 was found to be a target of miR-143 in adipocytes [19]. [score:3]
Hence, additional events other than miR-143 expression seemed necessary for substantial induction of miR-145 in colon cancer cells. [score:3]
Since only one strain (Line C) strongly expressed miR-143, we used this strain for further analysis (Fig. 1B and Fig. S1A). [score:3]
Repression of p68/p72 may impair β-catenin signaling to repress the expression of c-Myc, cyclin D1 and c-jun, and concurrently retard the processing of pri-miR-143/miR-145 to prevent the overproduction of miR-143 and miR-145. [score:3]
Nonetheless, our study with their report indicates that regulatory circuits between miR-143 and miR-145 might exert anti-tumor effect in a variety of neoplasms in living animals. [score:2]
Since no techniques, however, have been available to discriminate the human and the mouse mature miR-143, we could not confirm an auto-regulatory loop of miR-143. [score:2]
Since KRAS mutation is not a usual event in tumors of Apc [Min/+] mice [9], [10], the induction of miR-145 by miR-143 in our transgenic mice would be dependent on a molecular mechanism distinct from KRAS-RREB1 signaling. [score:2]
Schematic mo del of the regulation of APC signaling by miR-143 in the small intestine tumors. [score:2]
Other investigators recently reported that a positive feedback circuit between miR-143 and miR-145 could work through suppressing KRAS-RREB1 signaling in pancreatic cancer cells, although they did not mention the cross-regulation at the mature miRNA levels [36]. [score:2]
Establishment of CAG/miR-143 transgenic mice and Northern blot analysis. [score:1]
To construct CAG/EGFP, the insert fragment of pMXs-puro-EGFP -miR-145/miR-143 [39] was subcloned into XhoI site of pCAGGS vector, and pri-miR-145 fragment was excised by ClaI and NotI. [score:1]
0042137.g006 Figure 6 The complex of p53, p68 and p72 with DGCR8 and Drosha reinforces the processing of pri-miR-143/pri-miR-145. [score:1]
On the other hand, neither of pri-miR-143 nor pri-miR-145 significantly increased in the transgenic colon tumors (Figure 3C). [score:1]
Tumor incidence in Apc [Min/+] mice with or without CAG/miR-143 transgene. [score:1]
The complex of p53, p68 and p72 with DGCR8 and Drosha reinforces the processing of pri-miR-143/pri-miR-145. [score:1]
0042137.g002 Figure 2Tumor incidence in Apc [Min/+] mice with or without CAG/miR-143 transgene. [score:1]
F) qRT-PCR of miR-145 (F), miR-143 (G) and pri-miR-145 (H) in DLD-1 cells and Lovo cells. [score:1]
The expression of mature miR-143 and miR-145 was assayed with the Taqman MicroRNA Assays (Applied Biosystems) specific for hsa-miR-143 (P/N: 4395360) and hsa-miR-145 (P/N: 4395389), respectively. [score:1]
A SalI and HindIII fragment of CAG/miR-143 was purified from agarose gels with ELUTIP-D (GE Healthcare UK Ltd. [score:1]
DEAD-box RNA helicase subunits p68/p72, which are components of Microprocessor, promote the processing of pri-miR-143 and pri-miR-145 [13], [14]. [score:1]
∼2.6 kb SalI and HindIII fragment of CAG/miR-143 was injected to mice eggs. [score:1]
miR-143 and miR-145 were transcribed as a bicistronic unit, a common pri-miRNA, in DGCR8 -null embryo bodies [18]. [score:1]
miRNA mimics of miR-143, miR-145, miR-34a and miR-26a were purchased from Qiagen GmbH (Hilden, Germany), and miR-206 mimic was obtained from Ambion. [score:1]
10 p mol of each miRNA mimic was transfected for a combination of miR-143 and miR-145. [score:1]
The membrane was hybridized with the probes for miR-143(1 [st] panel), miR-145 (2 [nd] panel) and 5S rRNA (3 [rd] panel). [score:1]
B) Quantitative Real-Time PCR (qRT-PCR) analysis of the mouse endogenous pri-miR-143 and pri-miR-145. [score:1]
The membrane was hybridized with the probes for miR-143(upper panel), miR-145 (middle panel) and 5S rRNA (lower panel). [score:1]
For making the CAG/miR-143, ∼300 bp human pri-miR-143 fragment was subcloned into the EcoRI site of pCAGGS vector. [score:1]
C) qRT-PCR analysis of the mouse endogenous pri-miR-143 and pri-miR-145 of the colon tumors. [score:1]
[1 to 20 of 81 sentences]
4
[+] score: 299
Other miRNAs from this paper: hsa-mir-21, hsa-mir-143, mmu-mir-21a, mmu-mir-21b, mmu-mir-21c
Interestingly, ERK5 is the most wi dely reported direct target of miR-143, which is downregulated by miR-143 overexpression [11], [12]. [score:9]
Similar to the effects we reported after exposure of HCT116 colon cancer cells overexpressing miR-143 to 5-fluorouracil [12], exposure of MDA-MB-231 breast cancer cells to genistein induced cell growth suppression and induction of apoptosis, with down-regulation of ERK5, p-ERK5, NF-κB and Bcl-2 steady state levels. [score:8]
Furthermore, miR-143 may be involved in apoptosis proceeding via the intrinsic and/or extrinsic pathways, since it down-regulates anti-apoptotic protein Bcl-2, and is up-regulated after Fas -mediated apoptosis. [score:7]
However, a recent report in ulcerative colitis patients, which are at increased risk for development of colorectal cancer, demonstrated that miR-143 expression is downregulated up to 20-fold, compared to normal colon [37]. [score:6]
miR-143 directly regulates the expression of several proteins involved in crucial biological processes, whose deregulation is commonly associated with cancer. [score:6]
Importantly, transient overexpression of miR-143 mimetics in HCT116 [12], SW480 and DLD-1 [11] colon cancer cell lines has been shown to down-regulate ERK5 steady-state levels. [score:6]
Increased expression of mature miR-143 was found to occur following p53 up-regulation by doxorubicin in HCT116 colon cancer cells [22], and also in response to 5-FU exposure [12]. [score:6]
miR-143 expression has been reported as down-regulated in colon cancer, both in adenomas [9], [10] and colon carcinomas [6], [9], as well as in colon cancer cell lines [11], [12]. [score:6]
These results further expand previous reports of miR-143 -mediated ERK5 expression knockdown in colon cancer cell lines in vitro [11], [12], and are in agreement with reduced ERK5 expression following repeated (3x) miR-143 intratumoral injection and in vivo electroporation in prostate cancer cell tumor xenografts [20]. [score:6]
In addition, miR-143 is considered a pivotal regulator of gene expression, since it directly targets multiple mRNAs coding for proteins involved in cell proliferation, differentiation, survival and apoptosis, including KRAS [22], [23], DNMT3A [24], ELK1 [25], MYO6 [26], Bcl-2 [17] and ERK5 [27]. [score:6]
All reported effects were similar in both overexpression cell lines as compared to controls, with no marked changes in the effects from the miR-143 overexpression single clone cell line to the miR-143 overexpression cell population. [score:6]
To further validate the experimental mo del, cells were co -transfected with anti-miR inhibitors, by adding 50 nM anti-miR-143 or anti-miR-control inhibitors (Applied Biosystems, Foster City, CA) to the vector mixture described above. [score:5]
In our previous in vitro studies, we have used a single clone with miR-143 overexpression in parallel with a miR-143 overexpressing cell population [12], similar to the one used in the present study. [score:5]
miR-143 overexpression decreases ERK5 expression and activation in tumor xenografts. [score:5]
Further, we and others have previously demonstrated that miR-143 expression is reduced in human colon cancer [6], [7], [10], and also that miR-143 overexpression markedly reduces the viability of several colon cancer cell lines in vitro [11], [12]. [score:5]
ERK5 is the most wi dely reported miR-143 direct target in colon cancer, and ERK5 signaling is involved in the regulation of cell survival, differentiation, proliferation and apoptosis. [score:5]
Thus, miR-143 overexpression induces apoptosis and reduces proliferation of human colon carcinoma cells xenografted in mice, further re-enforcing the potential deleterious effects arising from loss of miR-143 expression in human colon cancer. [score:5]
Mature miR-143 overexpression increases cell growth inhibition. [score:5]
Our results demonstrate that miR-143 overexpression increased colon tumor cell growth inhibition in vitro, and decreased the growth of tumor cells xenografted in mice. [score:5]
In addition, miR-143 overexpression in human tumor xenografts in mice leads to significantly reduced NF-κB activation, and ERK5 expression and activation. [score:5]
Our results clearly demonstrate that miR-143 overexpression in colon cancer cells, delays xenografted tumor growth, highlighting the relevance of miR-143 as a putative therapeutic agent for the treatment of this disease. [score:5]
This was performed by co-transfection of pCR3-pri-miR-143 (miR-143 expression vector), a firefly luciferase miR-143 reporter for mature miR-143 detection (miR-143 sensor), and with either miR-143 specific inhibitor (anti-miR-143), or control (anti-miR-control). [score:5]
To evaluate the in vivo effect of miR-143 overexpression on colon cancer tumor xenograft growth, we next created HCT116-derived stable miR-143 overexpressing cells, and confirmed in at least three independent batches evaluated at multiple random selection times that miR-143 expression was consistently highly increased in Over-143 versus Empty cells, attesting to the robustness of miR-143 overexpression in our cell mo del. [score:5]
This suggests that miR-143 overexpression diminishes ERK5 expression and activation, which in turn may lead to reduced NF-κB activation, thus reducing tumor cell proliferation and growth in this in vivo tumor mo del. [score:5]
In addition, modulating mature miR-143 levels by transient co-tranfection of miR-143 mimetics and inhibitors regulates ERK5 protein [12]. [score:4]
Further, miR-143 relevance as a putative cancer biomarker is growing, as it is down-regulated in various other human cancers, including B-cell malignancies [13], non-small cell lung cancer [14], esophageal squamous cell carcinoma [15], esophageal adenocarcinoma [16], osteosarcoma [17], bladder [18], cervical [19], prostate [20], and gastric [21] cancer. [score:4]
Specifically, miRNA-143 (miR-143) is down-regulated in human colon cancer. [score:4]
Initially, we demonstrated transient miR-143 overexpression from pCR3-pri-miR-143 in HCT116 cells, which significantly increased cell growth inhibition as compared to pCR3-empty transfection, in accordance with our previous results [12]. [score:4]
In addition to colon cancer, miR-143 has been reported down-regulated in oesophageal squamous cell carcinoma [15], oesophageal adenocarcinoma [16], and gastric cancer [21]. [score:4]
This suggests that miR-143 overexpression in colon cancer cells may be an important strategy to reduce tumor growth and aggressiveness, and increase chemotherapy response. [score:3]
miR-143 increases HCT116 cell growth inhibition. [score:3]
Interestingly, genistein exposure markedly reduced NF-κB DNA binding activity, via MEK5/ERK5 pathway inhibition [46], which raises the possibility that miR-143 may also be involved in genistein mechanism of cytotoxicity. [score:3]
Here, we show that Over-143 versus Empty xenografts displayed decreased steady-state levels of Bcl-2, and increased caspase-3 activation and PARP processing, suggesting that miR-143 overexpressing xenografts may present higher levels of tumor cell apoptosis. [score:3]
miR-143 overexpression resulted in reduced tumor xenograft growth, with tumors presenting decreased proliferation and increased apoptosis. [score:3]
Real-time PCR was performed to determine the expression level of mature miR-143, as previously described [12]. [score:3]
Such a high differential expression has not been reported before for miR-143 in human colon cancer samples. [score:3]
Twenty-four hours after plating, cells were transfected with 4 µg of miR-143 expression vector (pCR3-pri-mir-143) [48] or 4 µg of the respective empty vector control (pCR3-empty), using lipofectamine 2000 (Invitrogen), according to the manufacturer's instructions, to originate Over-143 and Empty cell lines, respectively. [score:3]
miR-143 overexpressing tumor xenografts display reduced ERK5 steady-state levels, and NF-κB nuclear translocation. [score:3]
This suggests that in human colon cancer cell tumor xenografts, ERK5 is targeted by miR-143, leading to reduced protein steady-state levels and activation. [score:3]
HCT116 cells were transiently transfected with miR-143 overexpression vector, coding for the miR-143 precursor (pCR3-pri-miR-143), and miR-143 sensor, comprising two sequences complementary to mature miR-143 sequence (pGL3-miR-143 sensor) [48]. [score:3]
miR-143 overexpression decreases the growth of HCT116 human colon carcinoma cells xenografted in mice. [score:3]
miR-143 overexpression decreases NF-κB nuclear translocation in tumor xenografts. [score:3]
In the following week, the impairment of tumor growth in result of miR-143 overexpression was already evident, becoming statistically significant 9 days later, at 23 days after cell implantation. [score:3]
To our knowledge, this is the first demonstration that miR-143 overexpression induces apoptosis in human colon tumor cells xenografted in mice, and are in agreement with reported decreased proliferation ratio of LNCaP and C4-2 prostate cancer xenograft tumors injected with miR-143 and electroporated in vivo [20]. [score:3]
B, Total RNA was extracted from Over-143 and Empty cells prior to implantation into animals (t = 0 days) and from snap frozen tumor xenograft samples (t = 40 days), and used to quantify mature miR-143 expression. [score:3]
miR-143 overexpression reduces Bcl-2, and increases caspase-3 processing and PARP cleavage in tumor xenografts. [score:3]
miR-143 was confirmed to be significantly overexpressed in Over-143 versus Empty xenografts, by TaqMan® Real-time PCR (p<0.05). [score:3]
The early loss of miR-143 expression in the transition of normal colon to adenoma [9], may be a key event in colon cancer tumorigenesis by allowing unchecked cell proliferation, and this may also contribute to tumor growth and progression. [score:3]
Transfection of miR-143 vectors and anti-miR-143 inhibitor. [score:3]
We initially confirmed the production of mature miR-143 from the pCR3-pri-miR-143 vector, and the effect of transient miR-143 overexpression from this DNA vector on HCT116 colon carcinoma cell growth. [score:3]
Generation of HCT116 cells with stable expression of miR-143. [score:3]
Forty-eight hours after release from dual-thymidine block, 5×10 [5] miR-143 overexpressing (Over-143), or control (Empty) cells, were s. c. injected into the flanks of nude mice. [score:3]
In this regard, it has been demonstrated that miR-143 overexpression significantly decreases the steady-state levels of anti-apoptotic protein Bcl-2 [12], [17], inducing apoptosis and sensitization to Fas -induced apoptosis [27]. [score:3]
miR-143 overexpression and control cell lines were prepared from HCT116 cells as previously described [12]. [score:3]
miR-143 overexpressing tumor xenografts display increased apoptosis and reduced proliferation. [score:3]
To evaluate the impact of miR-143 overexpression on the growth of human colon cancer cells xenografted in mice, we next produced HCT116 cells with stable miR-143 overexpression (Over-143) and control cell lines (Empty), by transfection with pCR3-pri-miR-143 or pCR3-empty, respectively, followed by selection and propagation of stably transfected cells with G418. [score:3]
miR-143 overexpression decreases human colon carcinoma cell tumor xenograft growth in nude mice. [score:3]
miR-143 overexpression increases apoptosis and decreases proliferation in tumor xenografts. [score:3]
In addition, we have recently demonstrated that miR-143 overexpression significantly increases in vitro HCT116 colon cancer cell sensitivity to 5-FU, with a marked decrease in ERK5, NF-κB, and Bcl-2 steady-state levels [12]. [score:3]
0023787.g002 Figure 2Forty-eight hours after release from dual-thymidine block, 5×10 [5] miR-143 overexpressing (Over-143), or control (Empty) cells, were s. c. injected into the flanks of nude mice. [score:3]
The n-fold change in miR-143 expression was obtained using the formula: 2-ΔΔC t. Total protein extracts were prepared from tumor xenograft tissues and cell lines. [score:3]
Mature miR-143 expression. [score:3]
Importantly, miR-143 overexpression significantly increased apoptosis, and decreased proliferation, which is consistent with the marked reduction in tumor growth. [score:3]
Importantly, our results show that high and stable mature miR-143 expression was consistently obtained in Over-143, as compared to Empty cells (Figure 1B) (p<0.01). [score:2]
Stable miR-143 overexpression significantly decreased the rate of xenografted tumor growth, as clearly evidenced by the reduced Over-143 tumor xenograft volumes as compared to Empty. [score:2]
Importantly, we have also shown that miR-143 expression is 100-fold lower in SW480 as compared to HCT116 cells [12]. [score:2]
In addition, miR-143 overexpresion reduced ERK5 steady-state levels, ERK5 activation, and NF-κB nuclear translocation, suggesting regulation of colon cancer cell survival, and proliferation capabilities. [score:2]
Collectively, these data underscore the relevance of ERK5/NF-κB signaling for xenografted tumor proliferation and growth, and highlight the pivotal role of miR-143 in the regulation of this molecular signaling pathway. [score:2]
Importantly, after 40 days of xenograft growth in vivo, Over-143 xenografts still presented a significant increase in mature miR-143 expression compared to Empty xenografts (p<0.05) (Figure 2B). [score:2]
Our results clearly show that mature miR-143 was expressed from pCR3-pri-miR-143, since reduction of mature miR-143 bioavailability via anti-miR-143 co-transfection led to a significant increase in firefly activity (Figure 1A, left panel, middle bar), as compared to controls (p<0.05). [score:2]
Additional studies are needed to further explore the re-introduction of miR-143 in colon cancer cells, as this may prove to be a valid a therapeutic approach for colon cancer treatment. [score:1]
This data re-enforce the notion that induction of apoptosis is part of the in vivo mechanism of action of miR-143 in this xenografted tumor mo del. [score:1]
HCT116 cells with stable miR-143 overexpression (Over-143) and control (Empty) cells were subcutaneously injected into the flanks of nude mice, and tumor growth was evaluated over time. [score:1]
In addition, we have also shown that miR-143 induces sensitization of HCT116 colon cancer cell line to 5-fluorouracil -induced apoptosis [12], which in turn is Fas -dependent in this cell type [28]. [score:1]
Interestingly, this is in agreement with a recent study using prostate cancer cell lines, in which repeated xenograft intratumoral injection (3x) of miR-143 mimetics at 5000 nM, followed by in vivo electroporation, resulted in tumor growth abrogation or decrease, in mice grafted with LNCaP and C4-2 prostate cancer cells, respectively [20]. [score:1]
Our results are also in line with another recent study where liposome entrapped 3′ -modified miR-143 mimetics were administered by intravenous injection following a regimen of weekly administration (5x), in mice xenografted with human DLD-1 colon cancer tumors [9]. [score:1]
In particular, miR-143 is gaining increasing relevance as putative cancer biomarker and therapeutic tool in human cancer. [score:1]
Finally, growing evidence supports an anti-proliferative, pro-apoptotic and chemosensitizer role for miR-143 in colon cancer, since it reduces cell viability and increases sensitivity to 5-fluorouracil (5-FU), the drug of choice in colorectal cancer treatment and a known inducer of apoptosis in colon cancer cell lines [28], [29]. [score:1]
After three weeks of selection, miR-143 expression was evaluated by TaqMan® Real-time RT-PCR; after confirming miR-143 overexpression in Over-143, cells were xenografted in mice for evaluation of tumor growth in an in vivo mo del. [score:1]
The mechanism of miR-143 action in this mo del is suggested to involve modulation of ERK5/NF-κB signaling pathways. [score:1]
Another important aspect of miR-143 allowing the control of tumor growth may be its putative pro-apoptotic role. [score:1]
Collectively, our data re-enforces the notion that miR-143 loss may be a pivotal event in colon cancer, suggesting an important function for miR-143 in the control of tumor progression in vivo. [score:1]
In the present study, we evaluated the role of miR-143 overexpression on the growth of human colon carcinoma cells xenografted in nude mice (immunodeficient mouse strain: N: NIH [(s)] II- nu/nu). [score:1]
RNAs were then used to evaluate mature miR-143 expression. [score:1]
These results underscore the relevance of miR-143 in colon cancer, suggesting an important role in the control of tumor progression in vivo, and expanding its anti-proliferative, pro-apoptotic and chemosensitizer role that we had previously demonstrated in vitro. [score:1]
Our results suggest that reduced tumor volume in Over-143 versus Empty xenografts may result from increased apoptosis and decreased proliferation induced by miR-143. [score:1]
miR-143 expression levels in different samples were calculated on the basis of ΔΔC [t] method. [score:1]
The results presented herein provide additional knowledge on miR-143 mechanism of action in human colon tumor cells xenografted in mice. [score:1]
Importantly, transient miR-143 overexpression significantly increased cell growth inhibition (Figure 1A, right panel, middle bar), compared to empty vector transfected cells (p<0.05), as evaluated by the MTS metabolism assay. [score:1]
Here, we demonstrate that we are able to maintain higher levels of mature miR-143 expression throughout the xenografted tumor growth evaluation period, by transfecting HCT116 cells in vitro and selecting with G418 prior to subcutaneous injection, which resulted in a marked decrease in colon cancer xenograft tumor growth. [score:1]
In the present study, we evaluated the effect of miR-143 overexpression on HCT116 human colon cancer tumor xenograft growth in nude mice. [score:1]
Having validated our cell mo del in vitro, we next evaluated the in vivo effect of miR-143 overexpression on HCT116 tumor xenograft growth. [score:1]
Our results show that miR-143 markedly reduces human colon cancer cell xenograft growth in vivo, causing increased tumor cell apoptosis and decreased proliferation. [score:1]
B, HCT116 cells were transfected with pCR3-pri-miR-143 and pCR3-empty and selected with G418, to generate Over-143 and Empty cells, respectively. [score:1]
miR-143 expression levels were calculated by the ãã C [t] method, using Empty cells as calibrator. [score:1]
In the present study, we evaluated the role of miR-143 overexpression on growth of HCT116 human colon carcinoma cells xenografted in mice, and the putative involvement of apoptosis and proliferation on miR-143 mechanism of action. [score:1]
[1 to 20 of 96 sentences]
5
[+] score: 265
Furthermore, miR-145, miR-192, and miR-378 also showed inhibitory role in the expression of B7-DC, CTLA4 and PD-1. Taken together, our present study provides the first evidence that under-regulated miRNAs play significant roles in inhibiting translation of B7 co -inhibitory molecules, especially miR-143 in B7-H3 and B7-H4. [score:12]
We found that TGF-β1 upregulated the expression of miR-155, while downregulating the expression of miR-143, miR-145, miR-192, and miR-378 (Figure 4A). [score:11]
Enforced expression of miR-143/145 via systemic intravenous delivery with nanoparticles has been shown to inhibit tumor growth of orthotopic pancreatic xenografts by downregulating K-RAS and RREB-1, respectively [48]. [score:8]
Our present study shows that TGF-β1 upregulates co -inhibitory molecules B7-H3 and B7-H4 in the membrane and cytoplasm of colorectal cells via the miR-155/mir-143 axis, which in turn induces T cells to secrete immunosuppressive cytokines to maintain a tumor microenvironment. [score:8]
These findings indicate that the lowly expressed miRNAs, especially miR-143, contributed a lot to the over -expression of co -inhibitory molecules in CRC, which consequently led to cancer immune evasion. [score:7]
Finally, the inhibition of B7-H3 and B7-H4 expression by miR-143 inhibited tumor growth in mice. [score:7]
The miR-143 mimics also repressed the expression of B7-H3 and B7-H4 proteins in HCT-116 cells and the expression was restored by miR-143 inhibitors (Figure 6D). [score:7]
Schematic profile showing that TGF-β1 through SMAD3 and SMAD4 elevated miR-155 expression, which in turn attenuated the expression of CEBPB and consequently the expression of miR-143. [score:7]
Since miR-143 plays an important role in suppressing the expression of co -inhibitory molecules, we then evaluated the inhibitory role of miR-143 agomir on the tumor growth in mice. [score:7]
In this study, we provided evidence that TGF-β1 through SMAD3 and SMAD4 elevated miR-155 expression, which in turn attenuated CEBPB expression and consequently miR-143 expression. [score:7]
Ectopic expression of miR-143/145 can actively deregulate signaling pathways through the Ras-Raf-MEK-ERK (MAPK cascade) in addition to modulating other proliferative signaling networks such as the PI3K-AKT pathway, TGF-β signaling via targeting TGF-β activated kinase (TAK1, MAP3K7) and Jun-N-terminal Kinase (JNK) [45]. [score:6]
MiR-143 inhibited the growth of CRC cells in vitro and in vivoGiven the important role of down-regulated miRNAs in cancer immune escaping, we assessed the impact of miR-143, miR-145, miR-192, and miR-378 on the growth of HCT-116 cancer cells. [score:6]
The inhibition of CEBPB resulted in an attenuation of miR-143, indicating a regulatory role for CEBPB in the expression of miR-143 (Figure 5E). [score:6]
Therefore, the role of miR-143/145 in the tumor suppression cannot be ignored, and collectively, these studies highlight the potential use for miR-143 to target genes or networks commonly dysregulated in epithelial cancers. [score:6]
Administration of miR-143 agomir attenuated B7-H3 and B7-H4 expression, resulting in inhibited growth of xenograft tumors in mice. [score:5]
However, neither miR-143 mimics nor miR-143 inhibitors impacted the expression of B7-H3 and B7-H4 mRNAs in HCT-116 cells (Figure 6E). [score:5]
miR-143 inhibited the expression of B7-H3 and B7-H4 in CRC cells. [score:5]
This present study is the first to show that miR-143 suppresses colorectal xenografts tumor growth by diminishing the expression of B7-H3 and B7-H4. [score:5]
In turn, the decrease in miR-143 disinhibited co -inhibitory molecules B7-H3 and B7-H4 on colorectal cancer cells. [score:5]
Fifty nM synthetic RNAs including siSMAD2, siSMAD3, siSMAD4, siCEBPB, siCYMC, miR-155 mimics/inhibitor, and miR-143 mimics/inhibitor (GenePharma, Shanghai, China; see Supplementary Table S5), were transfected into HCT-116 cells with lipofectamine 2000 (Invitrogen) for 72 h before the experimental treatments. [score:5]
We also found that miR-143 apparently suppressed the expression of the CTLA4/3′-UTR/pGL3 and B7-DC/3′-UTR/pGL3 constructs (Supplementary Figure S3). [score:5]
In this study, the co -inhibitory molecules B7-H3 and B7-H4 have been experimentally validated as the novel targets of miR-143 in vitro and in vivo. [score:5]
Secondly, the expression of B7-H3 and B7-H4 was significantly abolished in CRC cells with stable expression of miR-143 and was increased in CRC cells with miR-143 silence. [score:5]
The decrease in miR-143 disinhibited co -inhibitory molecules B7-H3 and B7-H4 on colorectal cancer cells. [score:5]
We found that miR-143 significantly inhibited the expression of the B7-H3/3′-UTR/pGL3 and B7-H4/3′-UTR/pGL3 constructs (Figure 6B and 6C). [score:5]
The results from Figure 6B–6E demonstrate that miR-143 can inhibit the expression of B7-H3 and B7-H4 proteins to the same extent. [score:5]
However, the data in Figure 8E–8F indicate that miR-143 can only suppress the expression of B7-H3 protein in vivo. [score:5]
Interestingly, we found that the expression of miR-155 was inversely proportional to those of miR-143, miR-145, miR-192, and miR-378 in normal tissues (Figure 3D and 3E; Supplementary Table S3), conversely to the expression in adenoma and carcinoma tissues (Figure 3F and 3G). [score:5]
In addition, we also provided evidence to support that miR-143 disinhibited the expression of B7-DC, CTLA4 and PD-1, thereby facilitating tumor immune escaping (Supplementary Figure S3). [score:5]
Given the important role of down-regulated miRNAs in cancer immune escaping, we assessed the impact of miR-143, miR-145, miR-192, and miR-378 on the growth of HCT-116 cancer cells. [score:4]
In the adenoma tissues, we found that the expression of miR-155, miR-143, miR-145, miR-192, and miR-378 were initially deregulated (Figure 3H). [score:4]
was used to determine the effect of the down-regulated miRNAs, including miR-143, miR-145, miR-192, and miR-378, on the proliferation of HCT-116 cells. [score:4]
We found that miR-143 and miR-145 were mostly related to the TGF-β signaling pathway (Supplementary Table S4), suggesting a regulatory role of TGF-β1 in their expression. [score:4]
Down-regulation of miR-143, miR-145, miR-192, and miR-378 has also been well documented in many types of human tumors including colorectal cancer [38– 40]. [score:4]
MiR-143 inhibited the expression of B7-H3 and B7-H4. [score:4]
Restoring the level of miR-143 and thus blocking this regulatory pathway suppresses tumor growth in vitro and in vivo. [score:4]
The data suggested that local administration of miR-143 agomir induced a specific inhibitory effect in tumor cells. [score:3]
The mir-143 has been reported to be repressed by miR-155 via targeting C/EBPβ (a transcriptional activator for mir-143) [29]. [score:3]
The induction of miR-143/145 expression in various epithelial cancers such as colon, gastric, cervical, pancreatic carcinomas and adenocarcinomas blocked tumorigenesis both in vitro and in vivo [46, 47]. [score:3]
MiR-155 diminished the expression of miR-143 through CEBPB. [score:3]
Furthermore, we found that the expression of B7-H3 and B7-H4 proteins were negatively correlated with miR-143 in CRC cell lines (Supplementary Figure S4). [score:3]
Besides, we found that the expression of miR-143 was negatively correlated to miR-155 in CRC cell lines (Supplementary Figure S2). [score:3]
Numerous studies have explored the role of an increased expression of miR-143/145 in epithelial malignancies. [score:3]
Figure 4(A) Impact of TGF-β1 on the expression of miR-143, miR-145, miR-155, miR-192, and miR-378 in HCT-116 cells. [score:3]
For instance, the expression levels of miR-143 are quite different among these cell lines (Supplementary Figure S4). [score:3]
Fourthly, the expression of B7-H3 and B7-H4 in xenograft tumors was heavily repressed even at 15 days after the last treatment with miR-143 agomirs. [score:3]
MiR-155 abated miR-143 expression through CEBPB. [score:3]
Additionally, the repression of miR-155 increased the expression of miR-143 (Figure 5E). [score:3]
Interestingly, the expression of both B7-H3 and B7-H4 in the xenograft tumors was markedly repressed even at 15 days after the last administration of miR-143 agomirs (Figure 8E and 8F). [score:3]
The miR-143 and miR-145 mimics significantly inhibited the proliferation of the HCT-116 cells in vitro as compared with the scramble miRNA control (Figure 8A). [score:2]
MiR-143 inhibited the growth of CRC cells in vitro and in vivo. [score:2]
Furthermore, we provided evidence to clarify the regulatory mechanism of TGF-β1 through the miR-155/miR-143 axis in a SMAD3/4 -dependent pathway. [score:2]
Meanwhile, the miR-143 agomir did not have any effect on the mice body weights (Figure 8D), indicating that the miR-143 agomir was safe for anti-tumor therapy. [score:1]
Figure 6(A) Predicted binding-sites of miR-143 and miR-378 in the 3′-UTRs of B7-H3 and B7-H4 genes. [score:1]
Two nmol of miR-143 agomir was intratumorally (i. t. ) administered 3 times, once every 3 days after the tumors have reached a volume of 150–200 mm [3]. [score:1]
Thirdly, we found an inverse correlation between B7-H3 and B7-H4 proteins and miR-143 in CRC cells (Supplementary Figure S4). [score:1]
In contrast, i. t. injections of miR-143 agomir prevented the outgrowth of viable tumors (Figure 8B and 8C). [score:1]
Local injections were repeated on days 17 and 20 to maintain increased levels of miR-143 in the tumor tissues. [score:1]
Next, we found that there were four potential binding sites for CEBPB in the promoter of miR-143 host gene (MIR143HG; Figure 5D). [score:1]
Figure 8(A) Impact of miR-143, miR-145, miR-192, and miR-378 mimics on the growth of HCT-116 cells in vitro. [score:1]
We found that the miR-155 node was close to those of miR-143, miR-145, and miR-192, etc. [score:1]
On day 14 after xenograft implantation, a group of tumor-bearing mice received intratumoral (i. t. ) injections of 1 mg/kg/day of miR-143 agomir or the negative control. [score:1]
Firstly, we confirmed by luciferase reporter assay that miR-143 directly recognize the 3′-UTR of B7-H3 and B7-H4 transcripts. [score:1]
The arrows indicate the intratumor treatments of miR-143 agomir at a dose of 2 nmol every three days for three times. [score:1]
[1 to 20 of 64 sentences]
6
[+] score: 258
Strikingly, ERK5 expression was inversely correlated with miR-143 expression, as analyzed by in situ hybridization, suggesting that ERK5 could be a bona fide miR-143 target (Fig. 3C, compare upper to lower panels). [score:7]
Moreover, decreased ERK 5 expression in mir-143 treated cells also correlated with decreased expression of Jun, which is a known ERK5 target (Fig. 3E). [score:7]
These results suggested that downregulation of miR-143 expression could be a required event for cancer development or progression. [score:7]
Since miR-143 was found to be down-regulated in prostate cancer cells, we wanted to analyze its expression in human prostate cancer, and test the ability of miR-43 to arrest prostate cancer cell growth in vitro and in vivo. [score:6]
First, we show that miR-143 expression is clearly downregulated during prostate cancer progression. [score:6]
Finally, expression of ERK5 protein is inversely correlated to miR-143 expression in human prostate cancers. [score:5]
Interestingly, ERK5 expression was inversely correlated with miR-143 expression in these cell lines (Fig. 1A). [score:5]
It has been shown that ERK5 might be a direct or indirect target of miR-143 [32]. [score:5]
Decreased ERK5 expression correlated with decreased proliferation in these cell lines upon expression of miR-143 (Fig. 2). [score:5]
In summary we have shown that miR-143 is a tumor suppressor miRNA in prostate cancer, that controls cell proliferation and survival through modulation of, at least in part ERK5 expression. [score:5]
Furthermore, miR-143 inhibits expression of a reporter protein when this binding site replaces the 3′UTR of the luciferase mRNA. [score:5]
miR-143 expression could not be detected specifically in prostate cancer cells of high Gleason score, whereas miR-143 was expressed in normal prostate epithelium, and prostatic glands (Fig. 1C). [score:5]
Other studies have pointed to a tumor suppressor role of miR-143 in colon, and other cancer cells [26], particularly through inhibition of KRAS, and ERK5 proteins [26], [31]. [score:5]
Ectopic expression of miR-143 in LNCaP, and C4-2 prostate cancer cell lines resulted in a significant decrease in ERK5 protein expression, compared to cells transfected with non-relevant miRNA, or with the antisense miR-143. [score:4]
We show now and we provide enough evidence to demonstrate that ERK5 is a direct target of miR-143 in prostate cancer. [score:4]
We have analyzed the expression and the effects of miR-143 on prostate cancer development and progression. [score:4]
miR-143 was expressed 5- and 12-fold higher in transfected LNCaP, and C4-2 cells respectively, compared to control cells transfected with either non-relevant miRNA, or with anti-miR-143, which is a miR-143 inhibitor (Fig. 2A). [score:4]
Furthermore, we show that the effects of miR-143 are mediated, at least in part by the inhibition of extracellular signal-regulated kinase-5 (ERK5) activity. [score:4]
Consistent with our findings expression of miR-143 has been found to be decreased also in other cancers, such as colon cancer [25], B-cell malignancies [26], prostate cancer [27], pituitary tumors [28], or cervical cancer [29]. [score:3]
Luciferase activity of the 3′ UTR ERK-Luc construct was decreased in the presence of miR-143, whereas luciferase activity of mutated -Luc construct was not affected, suggesting that miR-143 modulate ERK5 expression through binding to ERK5-3′UTR (fig 3F). [score:3]
Rescue of miR-143 expression decreases tumor progression in mice. [score:3]
C, QPCR analysis of miR-143 expression in C4-2 (white bars) and LNCaP xenografts (black bars), normalized to RNU48. [score:3]
B, QPCR of miR-143, normalized to the amount of RNU48 target in prostate tissue samples. [score:3]
miR-143 is as a new target for prostate cancer treatment. [score:3]
Decreased proliferation and increased apoptosis in miR-143 -expressing prostate cancer cells. [score:3]
A, Schematic representation of the predicted target site of miR-143 in the 3′ UTR of ERK5 mRNA. [score:3]
A, Quantitative real-time PCR (QPCR) of miR-143, normalized to the amount of RNU48 target in prostate cancer cell lines. [score:3]
miR-143 overexpression in C4-2 cells and LNCaP cells. [score:3]
Global analysis of micro RNA expression in these treated cells correlated increased miR-143 with growth arrest. [score:3]
The anti-miR-143 is able to inhibit miR-143 present in cells by hybridization. [score:3]
Finally, analysis of ERK5 protein level by immunohistochemistry indicated that ERK5 expression was decreased in presence of miR-143 in LNCaP and C4-2 tumors (Fig. 4E). [score:3]
0007542.g003 Figure 3 A, Schematic representation of the predicted target site of miR-143 in the 3′ UTR of ERK5 mRNA. [score:3]
This down-regulation of miR-143 in prostate cancer samples has been suggested to reflect the lower differentiation stage of the tumor tissue compared the normal tissue [30]. [score:3]
We wanted to identify miR-143 targets that could be implicated in prostate cancer progression. [score:3]
In spite of the expected miR-143 rapid degradation in vivo, expression of miR-143 remained significantly increased in miR-143 electroporated tumors (Fig. 4C). [score:3]
To test this hypothesis miR-143 was ectopically expressed in C4-2 and LNCaP prostate cancer cell lines. [score:3]
Expression of miR-143 in prostate cancer. [score:3]
To more precisely analyze expression of miR-143, in situ hybridization was performed in high-density tissue arrays, containing 40 prostate cancer tissues vs. [score:3]
In the present study we investigated the expression of miR-143 in prostate cancer and found that the expression level of miR-143 was significantly decreased. [score:3]
miR-143 expression is decreased during prostate cancer progression. [score:3]
F, Western blot analysis of endogenous c-Jun expression in LNCaP cells 48 h after transient transfection of the indicated miR-143. [score:3]
Some studies have previously shown that miR-143 could play a role in tumorigenesis since its expression is decreased in several cancers [19]. [score:3]
We show here that ERK5 is a miR-143 target in prostate cancer. [score:3]
Furthermore, cell cycle analysis showed an increase in the G [0]-G [1] population, concomitant to a decrease in S-phase in miR-143 expressing cells (Fig. 2F). [score:3]
We proved, for the first time that miR-143 is a tumor suppressor in mice. [score:3]
Expression of miR-143 was analyzed in human prostate cancers by quantitative PCR, and by in situ hybridization. [score:3]
Identification of ERK5 as a miR-143 target. [score:3]
0007542.g001 Figure 1 A, Quantitative real-time PCR (QPCR) of miR-143, normalized to the amount of RNU48 target in prostate cancer cell lines. [score:3]
Further prospective studies to validate miR-143 as a predictive target of prostate cancer progression are warranted. [score:3]
ERK5 is a miR-143 target gene. [score:3]
Decreased expression in prostate cancer suggested that miR-143 could have anti-proliferative effects. [score:3]
Finally, bioinformatics analyses identified ERK5 as a potential target gene for mir-143. [score:3]
D, Western blot analysis of endogenous ERK5 expression in C4-2 and LNCaP cells 48 h after transient transfection of the indicated miR-143. [score:3]
In sharp contrast, cell number was inversely correlated to the expression levels of miR-143 in both LNCaP, and C4-2 cell lines (Fig. 2B–C). [score:3]
Rescue of miR-143 expression in cancer cells results in the arrest of cell proliferation and the abrogation of tumor growth in mice. [score:3]
Taken together these results proved that miR-143 functions as a tumor suppressor in prostate cancer cells. [score:3]
The second major finding of our study is the observation that rescue of miR-143 expression in prostate cancer cells results in the abrogation of cancer cell growth, both in vitro and in mice. [score:3]
Values are normalized to beta-galactosidase activity and expressed in fold versus absence of miR-143. [score:3]
Taken together these findings suggest that mir-143 could be a tumor suppressor and a potential novel diagnostic or prognostic marker in prostate cancer. [score:3]
Consistent with this observation, the expression of miR-143 was strongly decreased in human prostate cancer, compared to normal prostate tissues (fig. 1B). [score:2]
A first indication of the participation of miR-143 in prostate cancer was the observed decreased expression of this miRNA in LNCaP, and C4-2 prostate cancer, compared to normal epithelial cell lines, as analyzed by quantitative RT-PCR (Fig. 1A). [score:2]
Therefore, persistent decreased levels of mir-143 in cancer cells may be directly involved in carcinogenesis through activation of the mitogen-activated protein kinase (MAPK) cascade via ERK5. [score:2]
This suggested that miR-143 negatively regulates cell proliferation. [score:2]
Bioinformatics analysis and luciferase -based assays were used to determine miR-143 targets. [score:2]
Furthermore, levels of transcribed miR-143 were inversely correlated with histopathological grade in human prostate cancer, reaching the limit of detection in high-grade cancers (Gleason >7; Fig. 1B). [score:1]
D, Analysis of cell proliferation by PCNA staining on xenograft sections of athymic Nude mice injected subcutaneously with C4-2 (white bars) or LNCaP (black bars) cells after three electroporations with scrambled miR or miR-143 precursor. [score:1]
Effects of miR-143 rescue in mice mo del of prostate tumors. [score:1]
We show in this study that miR-143 levels are inversely correlated with advanced stages of prostate cancer. [score:1]
Cells were transfected with miR-143, negative control miR. [score:1]
E, Blue trypan incorporation in C4-2 (white bars) and LNCaP (black bars) cells 48 h after transfection in absence or presence of miR-143 or in presence of antimiR-143. [score:1]
H, Relative active Caspase 3 concentration in C4-2 (white bars) and LNCaP (black bars) cells 48 h after transfection in absence or presence of miR-143 or in presence of antimiR-143. [score:1]
0007542.g002 Figure 2 A, QPCR of miR-143 in C4-2 cells (white bars) and LNCaP cells (black bars), normalized to RNU48 48 h after transfection with scrambled miR (control), miR-143 precursor or antimiR-143. [score:1]
Bioinformatics analysis indicated that the 3′ UTR of the human ERK-5 gene harbors a putative consensus site for miR-143 binding (nucleotides 2917-2932) (fig 3A). [score:1]
Altogether, these data suggested that miR-143 negatively controls cell proliferation and positively controls cell death of prostate cancer cells. [score:1]
Two weeks after inoculation of the cells, when tumors reached a mean volume of 392 mm [3], miR-143 rescue experiments were performed. [score:1]
This is supported by the presence of miR-143 binding site in the 3′UTR of ERK5 mRNA. [score:1]
COS cells were co -transfected with 0.5 µg of pGL3 -based vectors and different concentrations of miR-143 precursor as indicated, using Lipofectamine 2000. [score:1]
No differences in cell numbers were observed when non-relevant miRNA or anti-miR-143 were used in these cells. [score:1]
C, Representative immunohistochemical staining of ERK5, and in situ hybridization of miR-143 in consecutive sections of high-density tissue array. [score:1]
Transfection of LNCaP and C4-2 cells in vitro with precursor miR-143, or electroporation of miR-143 in prostate cancer xenografts in mice demonstrated that miR-143 negatively contributes to prostate cancer cell growth. [score:1]
500pmole of miR-143 precursor or scrambled miR were injected in 100 µL PBS into the xenograft. [score:1]
Consistent with the observed decrease in tumor growth, the proliferation ratio of LNCaP and C4-2 tumors was also decreased, as quantified by PCNA staining in tumors electroporated with miR-143 (Fig. 4D). [score:1]
miR-143 was introduced in cancer cells in vivo by electroporation. [score:1]
F, Percentage of cells in different phases of cell cycle in LNCaP and C4-2 cell lines 36 hours following transfection with control 5 (non relevant), miR-143 or antimiR-143. [score:1]
Nude mice injected subcutaneously with C4-2 (white bars) or LNCaP (black bars) cells after three electroporations with scrambled miR or miR-143 precursor. [score:1]
C, Representative in situ hybridization staining of miR-143 in human non-tumor and tumor prostate tissue. [score:1]
Intratumoral injection of miR-143, followed by electroporation as described in material and methods section resulted in the abrogation or decrease in tumor growth in mice grafted with LNCaP and C4-2 cells respectively (Fig. 4A and 4B), whereas electroporation of control non-relevant miR had no effect on tumor growth (Fig. 4A and 4B). [score:1]
B–C, Cell growth in LNCaP (B) or C4-2 (C) cells during 48 h after transfection with scrambled miR (black rhombus), miR-143 precursor (black cross) or antimiR-143 (white triangle). [score:1]
D, Quantification of BrdU incorporation 48 h after transfection in C4-2 and LNCaP cells in absence of miR-143 (top), in presence of miR-143 (middle) or antimiR-143 (bottom). [score:1]
A–B, Tumor growth of LNCaP (A) or C4-2 (B) cells injected subcutaneously and electroporated three times with non-relevant miR (control, white squared) or miR-143 precursor (black rhombus). [score:1]
A, QPCR of miR-143 in C4-2 cells (white bars) and LNCaP cells (black bars), normalized to RNU48 48 h after transfection with scrambled miR (control), miR-143 precursor or antimiR-143. [score:1]
G, FACS analysis of apoptosis in C4-2 (white bars) and LNCaP (black bars) cells 48 h after transfection in absence or presence of miR-143 or in presence of antimiR-143. [score:1]
Transfections with miR-143 precursor, anti-miR 143 (hsa-mir-143, Ambion) were performed at concentration of 50 nM with Dharmafect 2 (Dharmacon, Lafayette, CO). [score:1]
0007542.g004 Figure 4 Effects of miR-143 rescue in mice mo del of prostate tumors. [score:1]
Finally, to further prove that transient transfection experiments were performed using the 3′UTR region of ERK5 containing the putative miR-143 matching site, mutated or not, downstream of the luciferase open reading frame. [score:1]
Our finding that miR-143 is at the limit of detection in aggressive prostate cancer could help to identify such patients. [score:1]
[1 to 20 of 96 sentences]
7
[+] score: 174
Given our observation of significant downregulation of miR-143 and miR-145 and upregulation of miR-223 in cells treated with 3.5 mM Pi, we used RT-qPCR to determine the expression levels of representative VSMC phenotypic marker genes - most of which are targeted by these miRNAs [8], [10]. [score:11]
These changes were evidenced by significant downregulation of miRNA-143 (miR-143) and miR-145 and concomitant upregulation of their targets and key markers in synthetic VSMCs, such as Krüppel-like factors−4 and −5 and versican. [score:9]
Elevated Pi significantly downregulates expression of miR-143 and miR-145 and upregulates miR-223. [score:9]
Furthermore, downregulation of miR-143 and miR-145 in the presence of high Pi implies the upregulation of their targets (such as KLF4, KLF5, PDGFRα and VSCN). [score:9]
In contrast, some of the synthetic phenotypic markers (such as Krüppel-like factor 4 [KLF4], KLF5, platelet derived growth factor receptor-α [PDGFR α] and versican [VSCN]) which are all targeted by miR-143 and/or miR-145 [7] were significantly upregulated; this was expected, given the observed downregulation of the corresponding miRNAs (Figure 2A). [score:9]
To complement these in vitro findings, we also observed significant downregulation of miR-143 and miR-145 and upregulation of miR-223 in aorta samples collected from ApoE knock-out mice, which display vascular calcification. [score:8]
Evidence from our studies suggests that Pi alters cell proliferation and migration, reduces the amount of the actin cytoskeleton, downregulates miR-143 and miR-145 and upregulates miR-223. [score:7]
miR-143 and miR-145 are downregulated and miR-223 is upregulated in ApoE- KO mice. [score:7]
There was significant downregulation of miR-143 and miR-145 and concomitant upregulation of miR-223 in 20-week-old ApoE- KO mice. [score:7]
Here, we showed that high Pi treatment results into downregulation of SMαA and MYO, with a concomitant downregulation of miR-143 and miR-145. [score:7]
Our in vivo results in a well-established murine mo del thus reflected our in vitro findings, i. e. downregulation of miR-143 and miR-145 and upregulation of miR-223 in the presence of calcium-Pi deposits. [score:7]
The expression of miR-143 and miR-145 was also downregulated in Pi -treated cells. [score:6]
These events affected downstream processes by reducing the size of the actin cytoskeleton, disturbing cell morphology, upregulating miR-143 and miR-145 targets and, ultimately, leading to increased calcification and a greater VSMC migration rate. [score:6]
Additionally, we normalized the expression of miR-223 to the expression of the VSMC-specific miR-143 (Figure S3). [score:5]
The latter authors also determined that expression levels of miR-143 and miR-145 are low in the aortas of apolipoprotein E gene knockout (ApoE- KO) mouse. [score:4]
MiR-143 and miR-145 (the most extensively studied species) have been correlated with human cardiovascular diseases, since VSMC maintenance and vascular homeostasis are altered in mir-143 and mir-145 knock-out (KO) mice [8]. [score:4]
We found significant downregulation of the vascular miRNAs miR-143 and miR-145 and a number of contractile phenotypic marker genes, such as MYO and SMαA [7]– [10]. [score:4]
Similarly, PDGFRα is a direct target of miR-143 and is one of the factors required for VSMC migration [32]. [score:4]
Here, we expanded on Elia et al. results by finding that downregulation of miR-143 and miR-145 in mouse aortas was not detected in younger mice but became significant in 20-week-old mice (which also display vascular calcification [23]). [score:4]
Interestingly, we also found that miR-143 and miR-145 are downregulated in vivo in the aortas of ApoE- KO mice. [score:4]
MiR-143 and miR-145 negatively regulate the expression of many genes that are specific for the VSMC synthetic phenotype [7], [10]. [score:4]
Figure S7 Effect of pre-miR-223 and anti-miR-223 on expression of miR-143 and miR-223 in VSMCs. [score:3]
Vascular smooth muscle cells transfected with pre-miR (over -expression) and anti-miR (knock-down) specific for miR-143 and miR-223 were compared with a scrambled RNA control (Figure 3A). [score:3]
Accordingly, the expression of miR-143 was unaffected in either of the conditions. [score:3]
RNAs extracted from mouse aorta collected from 8- and 20-week-old ApoE- KO and wild-type mice were used for the qPCR expression analysis of miR-143, miR-145 and miR-223. [score:3]
There was a significant downregulation (20–25%) of both miR-143 and miR-145 in 3.5 mM Pi treated cells, when compared with control cells (Figure 1E). [score:3]
Expression of miR-143, miR-145 and miR-223 in wild-type and ApoE- KO mice. [score:3]
0047807.g006 Figure 6 RNAs extracted from mouse aorta collected from 8- and 20-week-old ApoE- KO and wild-type mice were used for the qPCR expression analysis of miR-143, miR-145 and miR-223. [score:3]
Figure S3 Expression of miR-223 relative to miR-143 in control or Pi treated VSMCs. [score:3]
Recently, the chondroitin sulfate proteoglycan VSCN was identified as a new target for miR-143 [31]. [score:3]
As observed with VSMCs in culture, the expression levels of both miR-143 and miR-145 were significantly lower in ApoE- KO mice than in WT mice. [score:3]
The relative expression of miR-223 compared to miR-143 at basal level, i. e. in control cells is approximately 1000 times lower than the VSMC specific miR-143. [score:2]
We thus investigated the expression of miRNAs miR-143 and miR-145 in the presence of high Pi. [score:1]
Anti-miR-143 treatment did not affect motility, whereas pre-miR-143 treatment was associated with moderately (20%) but significantly greater migration than in control experiments. [score:1]
Boettger and colleagues also demonstrated that the mouse mir-143/145 cluster is necessary for acquisition of the contractile VSMC phenotype [9]. [score:1]
In our in vitro and in vivo mo dels, we confirmed the previously described impacts of miR-143 and miR-145 on normal and pathological cardiovascular events. [score:1]
Transfection of pre-miR-143/223 or anti-miR-143/223. [score:1]
Lastly, we sought to study the fate of miR-143, miR-145 and miR-223 under in vivo vascular calcification conditions. [score:1]
Our results suggest that miR-143, miR-145 and miR-223 are potential biomarkers of vascular calcification. [score:1]
[1 to 20 of 39 sentences]
8
[+] score: 133
Figure 4 (A) Tube formation photos of HMEC-1 cells at 10x magnification with i) no vector ii) control vector iii) miR-143-3p over -expression vector or iv) miR-145-5p over -expression vector v) graph of tube formation on HMEC-1 endothelial cells with no direct over expression (-) and direct over expression of miR-scramble (SCR), miR-143 (143) and miR-145 (145). [score:11]
To confirm that the observed increases in tube formation were at least in part caused by the presence of miR-145-5p or miR-143-3p, we examined the tube forming ability of HMEC-1 cells that directly over-expressed miR-145 and miR-143 (as opposed to being over-expressed via EVs). [score:6]
Figure 5 (A) of CAMK1D and Histone 3 in HMEC-1 cells after direct over expression of miR-143, miR-145 and miR-Scramble within HMEC-1 cells and after incubation with EVs isolated from H1437 over expressing miR-143, miR-145, miR-Scramble and unmodified cell. [score:6]
EVs over -expressing miR-143 and miR-145, as well as miR-Scramble EVs (using a miRNA scramble, but still expressing normal levels of miR-143-3p and miR-145-5p in the EVs) were collected and incubated with HMEC-1 cells for 24 hours, along with HMEC-1 cells receiving no EVs. [score:5]
Our results show that miR-143-3p and miR-145-5p are in fact expressed by LAC cells; however, they are packaged into EVs so efficiently that expression of these miRNAs in the donor cells is typically not detected. [score:5]
We over-expressed miR-143, miR-145 and a miR-Scramble individually in H1437 cells, and H2073 cells which resulted in >100-fold over -expression of these miRNAs in the EVs derived from these cells. [score:5]
Over -expression (OE) cell lines were created using the FIV lenti-vectors HmiR0085-MR01 for miR-145, HmiR0084-MR01 for miR-143, or CmiR0001-MR01 (miR-Scramble) for a scramble sequence control (GeneCopoeia), vectors express both 3p and 5p miRNAs. [score:5]
Dimitrova et al. (2016) first showed that stromal expression of miR-143/miR-145 promotes neoangiogenesis by targeting CAMK1D [20]. [score:5]
HMEC-1 cells were grown without EVs or in the presence of EVs over -expressing miR-143, EVs over -expressing miR-145 or control EVs (endogenous EV levels of miR-143 and miR-145). [score:5]
The addition of EVs over -expressing miR-145-5p or miR-143-3p further increased the length of tubes formed compared to miR-Scramble over -expressing EVs (Figure 4I). [score:4]
Herein, we also demonstrated that miR-143-3p and miR-145-5p derived from LAC cell EVs can target the endothelial cell function of CAMK1D, a negative regulator of angiogenesis. [score:4]
Once packaged the EVs are capable of shuttling miRNA cargo to endothelial cells where miR-143-3p and miR-145-5p down-regulate CAMK1D, promoting angiogenesis. [score:4]
Once in the EVs, miR-143/miR-145 can enter endothelial cells and down-regulate CAMK1D protein levels. [score:4]
Figure 4I demonstrates that direct over -expression was capable of increasing tube formation by 36% and 34% for miR-145 and miR-143, respectively (p<0.04 for both). [score:4]
HMEC-1 cells over -expressing miR-143 and miR-145 had decreased CAMK1D protein levels (87% and 96%, respectively) compared to HMEC-1 cells over -expressing the miR-Scramble (Figure 5A and 5B). [score:4]
Given their increased EV expression in both LAC cell lines and LAC patient serum samples, we reasoned that EV -mediated miR-145-5p and miR-143-3p activity might promote lung tumorigenesis. [score:3]
They also reported that expression of miR-143/miR-145 occurs in a small population of endothelial cells, but not lung epithelial cells [20]. [score:3]
Both miRNAs have been previously implicated as mediators of neo-angiogenesis and our analysis shows that when transferred through tumor derived EVs miR-143-3p and miR-145-5p promote tube formation through targeting of CAMK1D in endothelial cells. [score:3]
It was suggested that miR-143/145 was not expressed by the tumor epithelial cells, but rather was produced by a subset of endothelial cells driving neoangiogenesis. [score:3]
Recent work demonstrated that miR-145-5p and miR-143-3p are capable of promoting neoangiogenesis by targeting CAMK1D in endothelial cells, and that loss of the miR-145/miR-143 cluster in these cells led to decreases in neoangiogenesis via CAMK1D [20]. [score:3]
HMEC-1 cells incubated with miR-Scramble over -expressing EVs (with normal miR-145-5p and miR-143-3p levels within EVs) showed an increase in miR-145-5p >5 fold and a slight increase in mR-143-3p by >2 fold (Figure 3). [score:3]
MiR-143-3p and miR-145-5p are important tumor suppressors in many cancer types including lung, bladder, colon, and breast [32– 35]. [score:3]
Analysis of CAMK1D targeting by miR-143 and miR-145. [score:3]
We show that miR-145-5p and miR-143-3p are in fact produced by lung adenocarcinoma cells; however, no expression is observed in the epithelial cells, as these miRNAs are efficiently packaged into EVs and exported from the cell. [score:3]
MiR-145-5p and miR-143-3p increased by ~14-fold and ~6-fold in HMEC-1 cells incubated with EVs over -expressing miR-143 and miR-145 respectively when compared to HMEC-1 cells that were not incubated with EVs (Figure 3). [score:2]
Cross referencing with miRNA profiles obtained from serum collected from blood directly draining from the tumor suggests a biological role for miR-143-3p and miR-145-5p in lung tumorigenesis. [score:2]
MiR-143-3p and miR-145-5p, two miRNAs enriched within LAC EVs, were also found enriched within serum obtained from blood draining directly from LAC tumor bearing lungs indicating a biological significance. [score:2]
Figure 3 Intracellular fold change analysis of miR-143-3p, miR-145-5p and miR-346 in HMEC-1 cells incubated with EVs from H1437 cells over expressing miR-143, miR-145 and miR-Scramble, compared to HMEC-1 cells receiving no. [score:2]
The addition of EVs from H1437 miR-Scramble over -expressing cells (with normal miR-145-5p and miR-143-3p levels within EVs) significantly increased the ability of HMEC-1 cells to form tubes compared to the HMEC-1 cells receiving no EVs (p<0.01) (Figure 4I). [score:2]
A greater decrease was observed in HMEC-1 cells incubated with EVs over -expressing miR-145 or miR-143, showing a 79% and 83% decrease respectively compared to HMEC-1 cells receiving no EVs (Figure 3B). [score:2]
MiR-143-3p and miR-145-5p are enriched within serum draining directly from LAC tumors. [score:2]
Intracellular fold change analysis of miR-143-3p, miR-145-5p and miR-346 in HMEC-1 cells incubated with EVs from H1437 cells over expressing miR-143, miR-145 and miR-Scramble, compared to HMEC-1 cells receiving no. [score:2]
To the best of our knowledge, this is the first time miR-143-3p and miR-145-5p are reported as enriched within EVs released directly from LAC cells. [score:2]
MiR-143-3p has been shown to target KRAS and IGF1R in colorectal cancer [27, 28]. [score:2]
In the present study, using LAC cell lines, we identified several miRNAs (miR-142-3p, miR-143-3p, miR-145-5p, miR-150-5p, miR-223-3p, miR-451a, miR-486-5p, and miR-605-5p) that are selectively packaged into EVs and released into the tumor microenvironment. [score:1]
Of the remaining EV miRNA candidates, miR-143-3p and miR-145-5p were enriched in tumor draining effluent samples. [score:1]
Significance was reached for miR-145 (p=0.03) but not for miR-143 (p=0.1) (Figure 4I). [score:1]
Our remaining miRNA candidates (miR-143-3p, miR-145-5p, miR-223-3p, and miR-605-5p) appear to be more specific to lung adenocarcinoma. [score:1]
Impact of miR-143 and miR-145 on tube formation. [score:1]
MiR-145-5p and miR-143-3p promote tube formation in endothelial cells. [score:1]
We next sought to determine if the transfer of EVs, and in particular miR-143-3p and miR-145-5p, within the EVs is capable of inducing tube formation changes in endothelial cells. [score:1]
All HMEC-1 cells that received EVs containing miR-143-3p or miR-145-5p showed a decrease in CAMK1D protein by western blot. [score:1]
To interrogate the impact of EV -associated miR-143-3p and miR-145-5p, the levels of these miRNAs within EVs must be manipulated. [score:1]
[1 to 20 of 43 sentences]
9
[+] score: 99
Other miRNAs from this paper: mmu-mir-130b, hsa-mir-143, hsa-mir-130b
These data suggest that the downregulation of PNPO expression by TGF-β1 is at least in part via the upregulation of miR-143-3p. [score:9]
MiR-143-3p is upregulated upon TGF-β1 stimulation and interacts with the 3′-UTR of PNPO mRNA, leading to a downregulation of PNPO expression. [score:8]
We speculate that the loss of TGF-β responsiveness or a defect in TGF-β signalling may lead to the downregulation of miR-143-3p and, in turn, the upregulation of PNPO. [score:7]
PNPO is downregulated by the TGF-β signalling pathway through the upregulation of miR-143-3p. [score:7]
Treating SK-OV-3 cells with miR-143 mimics resulted in decreased PNPO protein expression (P < 0.05; Fig.   7 i and j), whereas treating cells with miR-143 inhibitor (anti-miR-143) resulted in increased PNPO protein expression (Fig.   7k). [score:7]
These data suggest that TGF-β -mediated PNPO expression is at least in part controlled through the upregulation of miR-143-3p. [score:6]
We found that TGF-β1 upregulated miR-143-3p and that PNPO was a target gene of miR-143-3p. [score:6]
k Effect of miR-143 inhibitor (anti-miR-143) (150 n m for 72 h) on PNPO protein expression detected by western blot in OVCAR-3 cells. [score:5]
To determine the correlation between PNPO mRNA expression and miR-143 expression in patients with ovarian tumours, we performed a qRT-PCR in ovarian tissues of 14 patients (4 benign, 3 borderline, 7 malignant tumours) and 5 normal controls. [score:5]
PNPO expression is regulated by the TGF-β signalling pathway via miR-143-3p. [score:4]
Furthermore, PNPO is mediated by the TGF-β signalling pathway through the upregulation of miR-143-3p. [score:4]
l Effect of TGF-β1 (0, 1 and 10 ng/ml for 3 h) on primary miR-143 (Pri-miR-143) expression detected by qRT-PCR in OVCAR-3 cells. [score:3]
Using miRWalk 2.0 database [33], we found that PNPO is a potential target of miR-143-3p. [score:3]
After seeding at a density of 2×10 [5] cells/well into a six-well plate and incubation for 16 h, OVCAR-3 cells were transfected with 50 n m miR-143-3p mimics, 50 n m miR -negative control (miR-Ctrl), 150 n m miR-143-3p inhibitors (anti-miR-143) or 150 n m anti-miR -negative control (anti-miR-Ctrl) (Supplementary Table  S2) (RiboBio Co. [score:3]
It has been shown that a chemically modified miR-143 significantly suppresses the tumour formation in a colorectal cancer mo del [41]. [score:3]
m Effect of TGF-β1 (0, 1 and 10 ng/ml for 3 h) on mature miR-143 expression detected by qRT-PCR in OVCAR-3 cells. [score:3]
Kitade Y Akao Y MicroRNAs and their therapeutic potential for human diseases: microRNAs, miR-143 and -145, function as anti-oncomirs and the application of chemically modified miR-143 as an anti-cancer drugJ. [score:3]
Notably, TGF-β1 enhanced primary and mature miR-143-3p expression (P < 0.05; Fig.   7 l and m). [score:3]
i Effect of miR-143 mimics (50 n m for 72 h) on PNPO protein expression detected by western blot in OVCAR-3 cells. [score:3]
The 3′-UTR mutant pEZX-PNPOmut was generated in the consensus miR-143-3p binding site by using a QuikChange II site-directed mutagenesis kit (Stratagene). [score:2]
The current study utilized clinical samples that showed a slight negative-correlation between PNPO and its regulator miR-143. [score:2]
The interaction of miR-143-3p with the PNPO mRNA at 3′-UTR in HEK293T cells was confirmed (n = 3). [score:1]
g A schematic diagram illustrated the sequences of the putative miR-143-3p binding site in the PNPO 3′-UTR and its mutant. [score:1]
In order to confirm the interaction of miR-143-3p with PNPO mRNA, we constructed two plasmids: a wild-type PNPO 3′-UTR containing a miR-143-3p binding site (position at 1260−1266 of 3′-UTR) and a mutated PNPO 3′-UTR in which the binding site was changed (Fig.   7g). [score:1]
[1 to 20 of 24 sentences]
10
[+] score: 96
siRNA -mediated knockdown of DCLK1 in BxPC-3 results in decreased expression of DCLK1 mRNA (A), increased expression Let-7a, miR-144 and miR-143/145 (B), decreased expression of c-MYC and NOTCH1 (C), and decreased expression of NANOG, KLF4, OCT4 and SOX2 (D). [score:10]
Knockdown of DCLK1 resulted in increased expression of miR-143/145 cluster and downregulation of its downstream target KRAS (Figure 3D). [score:9]
In this report, following the knockdown of DCLK1 using nanoparticle-encapsulated siRNA (NPsiDCLK1) in tumor xenografted mice, we observed a significant increase in: (A) miR-143/145 cluster, which resulted in downregulation of key pluripotency markers (OCT4, SOX2, KLF4 and NANOG); (B) let- 7a, which resulted in decreased pluripotency factor LIN28B; and (C) miR-200a, b and c, which resulted in downregulation of EMT and angiogenic factors. [score:8]
Following the knockdown of DCLK1, we observed increase expression miR-143/145 and significant downregulation of KRAS and RREB1. [score:7]
Knockdown of DCLK1 also resulted in the downregulation of KRAS (D) and RREB1 (E) mRNA, downstream targets of miR-143/145 miRNA cluster, analyzed using real-time RT-PCR. [score:7]
The miRNA restitution was confirmed in treated xenografts by significant upregulation of the corresponding miRNA and significant decreases in specific miRNA targets (KRAS2 and RREB1 for miR-143/145). [score:6]
Figure S3 NPsiRNA -mediated knockdown of DCLK1 downregulates c-MYC via Let-7a, NOTCH1 via miR-144 and pluripotency factors via miR-143/145 in BxPC-3 cells. [score:5]
With these data, we speculate that DCLK1 plays a role in post-transcriptional regulation of miR-143/145 cluster and thereby downregulates KRAS and RREB1 in pancreatic tumor xenografts. [score:5]
Following the knockdown of DCLK1 in AsPC-1 tumor xenografts, a significant upregulation of miR-143/145 cluster (A) and miR-145 miRNA (B) by real-time RT-PCR. [score:5]
The miR-143/145 cluster, cooperate and inhibit the expression of KRAS2 and its downstream effector, RREB1 [29]. [score:5]
It has been recently demonstrated that ectopic expression of miR-143/145 results in repressed metastasis and increased adhesion of pancreatic cancer cells [30]. [score:3]
Furthermore, in another published work, it was demonstrated that EGFR suppress miR-143 and miR-145 in a murine mo dels of colon cancer [56]. [score:3]
Additionally, KRAS and RREB1 are downstream targets of miR-143/145 [29]. [score:3]
Additionally, KRAS and RREB1 are targets of miR-143/145, demonstrating a feed-forward mechanism that potentiates RAS signaling -mediated PDAC tumor progression [29]. [score:3]
Reduced miR-143/145 expression is a common feature of many tumor types including colorectal carcinoma and PDAC [29, 50, 51]. [score:3]
DCLK1 negatively regulates miR-143/145. [score:2]
The studies presented clearly implicate DCLK1 in the regulation of miR-143/145, miR-200, EMT, pluripotency, angiogenesis, NOTCH1, and cancer stemness. [score:2]
0073940.g003 Figure 3DCLK1 negatively regulates miR-143/145. [score:2]
Similarly, here we observed a significant induction (1.5-fold) of pri-miR-143/145 cluster miRNA (Figure 3A) and pri-miR-145 miRNA (Figure 3B) following the knockdown of DCLK1 in AsPC-1 tumor xenografts. [score:2]
These data taken together indicate that there is a negative feedback loop mechanism between EFGR and miR-143/145 similar to KRAS/RREB1 and miR-143/145. [score:1]
RREB1 is known to repress the transcription of miR-143/145 by binding to its promoter region. [score:1]
Repression of miR-143 and miR-145, two co-transcribed miRNAs located on human chromosome 5q, has been reported in pancreatic cancer. [score:1]
It has been previously demonstrated that a feedback loop mechanism exists between miR-143/145 and KRAS and RREB1. [score:1]
The loss of miR-145 (miR-143/145 cluster) is observed in KRAS mutated pancreatic cancers, and therapeutic restoration of these miRNAs abrogates tumorigenesis [29, 30]. [score:1]
Furthermore, Ras-responsive element binding protein 1 (RREB1) represses miR-143/ miR-145 promoter activity, which indicates that repression is an early event in pancreatic cancer initiation and progression [29]. [score:1]
[1 to 20 of 25 sentences]
11
[+] score: 62
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-mir-34c, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, mmu-mir-346, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, hsa-mir-381, mmu-mir-375, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-346, hsa-mir-196b, mmu-mir-196b, hsa-mir-18b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, mmu-mir-92b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Several miRNAs are upregulated in adipose tissue in animal mo dels of metabolic disease and/or obesity, e. g. mir-125a [31], mir29 [32], and mir-143 [33], while adipose tissue miR-519d expression is associated with human obesity [15]. [score:8]
Both miR-21 and miR-143 show an altered expression level in cancer: miR-21 is upregulated 5-fold in colorectal cancer, when compared with adjacent non-tumour tissue, while miR-143 is downregulated 3-fold [54]. [score:8]
Mir-21 showed higher expression in persons with a BMI >30, while mir-143 showed lower expression in persons with a BMI >30 (p < 0.05), see Figure 4. There was a strong positive correlation of mir-21 expression in human adipose tissue with BMI (p < 0.001, see Figure 5). [score:7]
Of these 10 miRNAs, only mir-21, mir34c and mir-143 were differentially expressed between mature adipocytes and preadipocytes (p < 0.05), see Table 1 and Figure 2. Mir-34c upregulation during brown adipocyte maturation was in contrast to our microarray data and this result must be treated with caution. [score:6]
Nevertheless, the miRNAs mir-34c, mir-143, mir-24, mir-720 and mir-21 showed robust expression in the adipocyte cultures, and these 5 miRNAs were thus profiled in subcutaneous adipose tissue from healthy humans with different BMIs to examine their regulation in adipose tissue expansion. [score:4]
We also decided to follow up on miR-143, which we found upregulated in both white and brown adipocytes, as mir-143 is induced upon differentiation of human preadipocytes and 3T3-L1 fibroblasts [25- 27]. [score:4]
miR-143 and also miR-103 can induce adipogenesis in 3T3-L1 adipocytes and augment or accelerate expression of several key adipogenesis-regulated genes, such as FABP4 and adiponectin [27]. [score:4]
MiR-143 and miR-181a were expressed in both white and brown adipocytes during both developmental stages and showed a trend for a 2-fold enrichment in white adipocytes, similarly to what was found by Walden et al. [16]. [score:4]
Xie et al. [27] identified miR-143, miR-148a, miR-30c, miR146b as being upregulated during in vitro differentiation of 3T3-L1 cells, which is identical to our findings. [score:4]
The miRNAs targeting Sirt1 include miR-143, miR-23b miR-34c as well as mir-34a [51, 52]. [score:3]
Figure 2 Expression levels of mir-21, mir-34c and mir-143 in primary murine brown and white preadipocytes and mature adipocytes (n = 3+3 for each tissue). [score:3]
Of the miRNAs we described in the murine primary cell cultures, miR-21 and miR-143 were differentially expressed in healthy non-obese persons (BMI <30) versus obese persons (BMI >30). [score:3]
Five miRNAs (mir-21, mir-143, mir-34c, mir-24 and mir-720) were profiled in subcutaneous adipose tissue from healthy humans with varying degrees of obesity. [score:1]
The first miRNA found to play a role in maturation of human adipocytes was miR-143 [25, 26]. [score:1]
Of the 10 miRNAs that showed expression in the adipocyte cultures, we chose a subset of 5 miRNAs (mir-34c, mir-143, mir-24, mir-720 and mir-21) to measure in human adipose tissue RNA samples from obese persons (BMI >30, n = 10) and non-obese persons (BMI <30, n = 10). [score:1]
Figure 4 Expression levels of mir-21, mir-24, mir-34c, mir-143 and mir-720 were measured in subcutaneous adipose tissue of obese (BMI >30, n = 10) and non-obese (BMI <30, n = 10) healthy persons. [score:1]
[1 to 20 of 16 sentences]
12
[+] score: 49
Other miRNAs from this paper: mmu-mir-103-1, mmu-mir-103-2, mmu-mir-107, mmu-mir-221, mmu-mir-222
Its expression increases in differentiating adipocytes, and antisense oligonucleotides against miR-143 inhibit human cultured adipocyte differentiation and lead to a decrease in triglyceride accumulation and the downregulation of PPARγ2, adipocyte fatty acid binding protein and Glut4 [8], although this has not been found in 3T3-L1 cells [9]. [score:8]
Later on it was demonstrated that in mesenteric fat, miR-143 expression is upregulated in mice fed a high-fat diet and this was associated with elevated body and mesenteric fat weight as well as with markers of adipocyte differentiation [16]. [score:6]
Regarding the minor changes observed in miR-143 expression, no differences in expression of adipogenic markers were observed. [score:5]
A set of miRNAs (including miR-103, miR-107 and miR-143) are induced during adipogenesis, which may play a role in accelerating fat cell development, and then be downregulated in the obese state [11]. [score:5]
Accordingly, a decrease in expression of miR-143 by CLA would justify a lower adipogenic capacity and, would therefore contribute to the decrease of fat stores observed in adipose tissue with CLA treatment. [score:3]
As potential targets of the action of CLA, we focused the study on five selected miRNAs (miR-143, miR-103, miR-107, miR-221 and miR-222) which, to a certain extent, have been shown to be involved in adipocyte differentiation and/or associated with obesity. [score:3]
In Exp1, miR-143 correlated positively with adiponectin (r = 0.357, P<0.05) and leptin expression (r = 0.358, P<0.05); miR-103 was correlated with two key markers of lipid metabolism, fatty acid synthase (Fasn, r = 0.378, P<0.05) and muscle carnitine palmitoyltransferase 1b (Cpt1b, r = 0.404, P<0.05); miR-107 correlated with genes involved in fatty acid oxidation such as uncoupling protein 2 (Ucp2, r = −0.339, P<0.05) and Cpt1b (r = 0.467, P<0.01) as well as with C/EBPα (r = 0.370, P<0.05) (Table 3). [score:3]
The lowest dose of CLA did not cause any change in miR-143 expression, either in experiment 1 (Exp1) or experiment 2 (Exp2). [score:3]
Consequently, expression levels of selected miRNAs (miR-143, miR-103, miR-107, miR-221 and miR-222) which seem to be related to adipose biology were studied in adipose tissue of mice treated with CLA. [score:3]
However, our data showed small changes, if any, in the expression levels of miR-143. [score:3]
Only the highest CLA dose assayed in each experiment caused a slight decrease in miR-143 expression, but not significantly different from controls. [score:2]
MiR-143 was the first miRNA associated with regulation of adipocyte differentiation. [score:2]
We determined retroperitoneal adipose tissue (rWAT) expression of five miRNAs related to adipocyte differentiation (miRNA-143) and lipid metabolism (miRNA-103 and -107) and altered in obesity (miRNA-221 and -222), using the TaqMan®MicroRNA Assay (Applied-Biosystems). [score:2]
This strong association was partially lost in Exp2, with CLA treatment under high-fat feeding, in which the only correlations maintained were between miR-103 and miR-143; mir103 and miR-107; and miR-221 and miR-222 (Table 1). [score:1]
[1 to 20 of 14 sentences]
13
[+] score: 45
In oral cancer, the expression of OIP5 may not be regulated at the post-transcription level as the miR-143/145, miR-200 and let-7 family microRNAs were reported to be downregulated in oral cancer 9, 11, 14. [score:7]
However, OIP5 was targeted by stemness regulatory miR-143/145, EMT associated miR-200 family and oral cancer-specific tumor suppressor let-7 family. [score:6]
Moreover, systematic epigenomic analysis of OIP5-AS1 suggested that the positive transcriptional regulation of OIP5-AS1 by co-expressed NEAT1, TUG1 and HOTAIR by recurring miR-143/145 targeting the stemness associated transcription factors might account for the maintenance of stemness and dedifferentiation in tumors and accounts for poor prognosis. [score:6]
Further, all 3 lncRNAs harbored interaction sites for miRNAs targeting Yamanaka factors, especially for miR-143/145 suggesting that overexpressed NEAT1, HOTAIR and TUG1 could modulate the post-transcriptional control of the stemness factors by sponging miR-143/145. [score:5]
Therefore, the co -expression of lncRNA NEAT1, HOTAIR and TUG1 has pivotal role not only in sponging stemness TFs targeting miR-143/145 but also interacts with active euchromatins to maintain stemness properties. [score:5]
Interestingly, we also found many MREs for stemness regulatory miRNAs miR-143/145 family, EMT regulatory miRNA miR-200a/miR-200b/miR-141, TP53 induced miR-34a, let-7, and several other oral cancer specific tumor suppressive miRNAs in OIP5 mRNA 3′-UTR (Supplementary Table  S7). [score:5]
OIP5-AS1 in addition activates co -expression of NEAT1, TUG1 and HOTAIR which sponges stemness regulatory miR-143/145 and maintains the steady state level of stemness TFs. [score:4]
The sponging of miR-143/145 also facilitates the overexpression of OIP5 mRNA. [score:3]
However, all the lncRNAs harbor binding sites for miR-143/145 which regulates the Yamanaka factors suggesting that these lncRNAs can collectively maintain stemness in tumors by modulating the Yamanaka factors (Supplementary Table  S7). [score:2]
One such important function of miR-200 family is regulation of epithelial to mesenchymal transition and miR-143/145 is to maintain the stemness 9, 14. [score:2]
[1 to 20 of 10 sentences]
14
[+] score: 41
Prior to validating whether miR-583 and miR-143 contributed to targeted suppression of IL2Rγ expression, we analyzed the expression kinetics of miR-583 and miR-143, as well as the well-known miRNAs miR-223 and miR-150, during NK cell differentiation using real-time qPCR (Fig. 3b). [score:9]
Based on the data presented in Fig. 2, we chose the 4 miRNAs (miR-583, miR-143, miR-200b and miR-1181) that were significantly downregulated in mNK cell, which suggested an inhibition of target genes by the predicted miRNAs. [score:8]
To determine whether IL2Rγ expression is regulated by the miR-583 and miR-143 miRNAs as predicted, we examined the mRNA and protein expression of IL2Rγ during NK cell differentiation. [score:6]
Our results were consistent with the microarray data presented in Fig. 2 showing that the expression of miR-583, miR-143 and miR-223 were decreased; however, the expression of miR-150 was increased during NK cell differentiation. [score:5]
Given these collective data, we hypothesized that miR-583 or miR-143 may play a role in NK cell differentiation through the regulation of IL2Rγ expression. [score:4]
To investigate the biological effects of miRNAs on NK cell development, miR-583 and miR-143 were validated as regulators of NK cell differentiation by targeting IL2Rγ. [score:3]
The expression of miR-143, miR-223, miR-150 and miR-583 was analyzed by real-time qPCR. [score:3]
Importantly, both miR-583 and miR-143 were highly correlated with subunit IL2Rγ of the IL2 receptor, related to the IL-15 signaling pathway. [score:1]
0108913.g005 Figure 5(a) Differentiating cells were transfected with miR-143, a miR-583 mimic or negative control miRNA. [score:1]
In contrast, the introduction of a miR-143 mimic resulted in similar percentages of mature CD56 [+]CD3 [−] NK cells and mimic controls (Fig. 5a). [score:1]
[1 to 20 of 10 sentences]
15
[+] score: 36
Jordan et al. demonstrated that increased expression of miR-143 in the liver could induce insulin resistance through down-regulation of ORP8, subsequently preventing AKT activation by insulin [6]. [score:6]
2008.09.050 18809385 6. Jordan S. D. Kruger M. Willmes D. M. Redemann N. Wunderlich F. T. Bronneke H. S. Merkwirth C. Kashkar H. Olkkonen V. M. Bottger T. Obesity -induced overexpression of miRNA-143 inhibits insulin-stimulated AKT activation and impairs glucose metabolism Nat. [score:5]
However, the importance of miR-103, miR-143 and miR-483-3p in human glucose and lipid metabolism, and the relative impact of genetic and environmental factors in the regulation of their expression, are undisclosed. [score:4]
Using murine mo dels of T2D, Trajkovski et al. demonstrated that miR-103 silencing improved glucose homeostasis, insulin sensitivity and decreased the amount of adipose tissue [4], while Takanabe et al. have found miR-143 levels associated with markers of adipocyte differentiation, and up-regulated in adipose tissue of high-fat diet -induced obese mice [5]. [score:4]
Figure 1Multivariate analyses were performed to study the association between (A) age, birth weight, BMI and sex and miR-103, miR-143 and miR-483-3p expression in adipose tissue from elderly twins and the association between (B) miR-103, miR-143 and miR-483-3p and 2 h glucose values after an oral glucose tolerance test, hemoglobin A1c (HbA1c), homeostatic mo del assessment of insulin resistance (HOMA-IR) and triglycerides shown for all subjects (black), dizygotic (DZ) twins (blue) and monozygotic (MZ) twins (orange). [score:3]
Using SAT biopsies from a unique cohort of 244 elderly MZ and DZ twins, we estimated the genetic influence on the expression of miR-483-3p, miR-103 and miR-143, and found low heritability estimates. [score:3]
In conclusion, we have demonstrated that the expression levels of miR-483-3p, miR-103 and miR-143 in SAT are mainly influenced by age, obesity and birth weight in a non-genetic manner. [score:3]
In the DZ twins we found a statistically significant positive association between the levels of miR-143 and Hba1c levels. [score:1]
However, our study revealed no associations between miR-143 and HOMA-IR. [score:1]
The interclass correlations for MZ and DZ twins were not significantly different for any of the miRNAs and all heritability estimates were low (0.21, 0.12 and ~0 for miR-483-3p, miR-143 and miR-103 respectively). [score:1]
Importantly, using twins gives us a unique opportunity to explore the relative influence of genetic versus environmental factors on the levels of miR-483-3p, miR-103 and miR-143 in human SAT. [score:1]
We evaluated the associations between glucose metabolism (2-hour (2 h) glucose from an OGTT and hemoglobin A1c (HbA1c)), insulin resistance (HOMA-IR) and lipid metabolism (triglyceride levels); and miR-483-3p, miR-103 and miR-143 expression levels (Figure 1B). [score:1]
Age: We found that a ~5 year increase in age was associated with a ~33% decrease in miR-483-3p levels (p = 0.05) and with a 77% increase in miR-143 levels (p = 0.02). [score:1]
There were no differences or associations between zygosity and miR-143 or mir-483-3p levels. [score:1]
We evaluated the associations between age, sex, birth weight and BMI; and the expression levels of miR-483-3p, miR-103 and miR-143 (Figure 1A). [score:1]
[1 to 20 of 15 sentences]
16
[+] score: 34
For the first time, we report depot specific differences in ER stress related miRNAs including; downregulation of miR-125b-5p and upregulation of miR-143-3p, and miR-222-3p in VAT following HFD and upregulation of miR-30c-2-3p only in BAT following a HFD in mice. [score:10]
MiR-143-3p and miR-222-3p were significantly upregulated (p < 0.05), while miR-125b-5p was significantly down regulated (p < 0.05) in VAT-HF than VAT-LF (Figure 6A). [score:5]
Significant upregulation of miR-143-3p in VAT may increase cell death via repression of BCL2 [34]. [score:4]
Also, miR-143-3p and miR-222-3p were upregulated in VAT of HFD than LFD mice in our study. [score:4]
However, depot specific differences in expression of ER stress related miR-30c-2-3p, miR-125b-5p, miR-143-3p and miR-222-3p in HFD induced obesity are novel findings, but these are yet to be confirmed in clonal adipocytes. [score:3]
Interestingly, we were able to identify 8 differentially expressed miRNAs related to UPR including miR-30c-2-3p, miR-455, miR-125a-5p, miR-17-5p, miR-143-3p, miR-16-5p, miR-181d-5p and miR-34a-5p in VAT/BAT based on literature and IPA [®] (Figure 3). [score:3]
Same direction of fold change was observed for seven miRNAs including miR-455-3p, miR-30c-2-3p, miR-222-3p, miR-99b-5p, miR-199a-3p, miR-143-3p, and let-7a-5p. [score:2]
We also performed qPCR for selected miRNAs that were related to ER stress (miR-125b-5p, miR-143-3p and miR-222-3p, miR-30c-2-3p, and miR-455-3p), in BAT and VAT of LFD and HFD fed mice (Figure 6). [score:1]
Mir-143-3p and miR-222-3p showed an increasing trend due to HFD in BAT similar to VAT, but were not statistically significant (p value = 0.077 and 0.118) (Figure 6B). [score:1]
The miRNAs we tested were let-7a-5p, miR-30a-5p, miR-30c-2-3p, miR- 99b-5p, miR-143-3p, miR-199a-3p, miR-221-3p, miR-222-3p, miR-455-3p, and miR-708-5p. [score:1]
[1 to 20 of 10 sentences]
17
[+] score: 33
significantly decreased when the expression of down-regulated miR-143 was recovered (pooled MD = [-4.14]; 95% confidence interval [CI]: [-5.77]- [-2.50]; p= 0.97; Figure 9, part 2) [41]. [score:6]
significantly decreased when the expression of down-regulated miR-143 was recovered (pooled MD = [-3.64]; 95% confidence interval [CI]: [-7.35]- [0.06]; p < 0.00001; Figure 4, part 2) [17, 46]; there were 12 mice in the intervention arm and 12 in the control arm. [score:6]
As we could see in Figure 4A, the effect on inhibiting tumor weight was most significant when the aberrantly expressed oncogene miR-214 was corrected, and followed by rescuing miR-143, then miR-195 or miR-34a. [score:5]
As we could see in Figure 9, the effects on inhibiting tumor volume were most significant when the aberrantly expressed miR-34a, miR-143 and miR-214 were corrected, and then followed by miR-195 and miR-133a Figure 9 SD, standard deviation; CI, confidence interval. [score:5]
As we could see in Figure 9, the effects on inhibiting tumor volume were most significant when the aberrantly expressed miR-34a, miR-143 and miR-214 were corrected, and then followed by miR-195 and miR-133a Figure 9 SD, standard deviation; CI, confidence interval. [score:5]
This resulted 5 different miRNAs were analyzed, including 4 tumor suppressor miRNAs(miR-195, miR-143, miR-34a and miR-133) and 1oncogene(miR-214). [score:3]
This resulted 4 different miRNAs were anylyzed, including 3 tumor suppressor miRNAs(miR-195, miR-143 and miR-34a) and 1 oncogene(miR-214). [score:3]
[1 to 20 of 7 sentences]
18
[+] score: 31
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-21a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c
Since the smooth muscle genes and miR-143/145 were predominantly expressed in the smooth muscle compartments, loss of smooth muscle tissues in the oviducts during the formation of oviductal diverticula could potentially lead to reduced expression of smooth muscle genes or associated miRNAs in the Tgfbr1 c KO oviducts. [score:5]
Figure S7Expression of target genes of miR-143/145 in Tgfbr1 c KO mice. [score:5]
We found that two newly identified vascular smooth muscle associated miRNAs, miR-143 and miR-145 [57]– [60], were down-regulated in the oviducts of Tgfbr1 c KO mice (Figure 5C). [score:4]
However, dramatic reductions in the expression of smooth muscle genes and miR-143 and miR-145 were not detected at this stage (data not shown). [score:3]
Moreover, the downstream targets of miR-143/145 (i. e., transcription factors Elk1, Klf4, and Camk2d) were not altered in the oviducts of Tgfbr1 c KO mice (Figure S7). [score:3]
Therefore, the decreased expression of miR-143/145 and smooth muscle genes in the 3–4 week old Tgfbr1 c KO mice is likely caused by reduced smooth muscle components. [score:3]
1002320.g005 Figure 5Dysregulation of smooth muscle genes and miR-143 and miR-145 in the oviducts of Tgfbr1 c KO mice at 3–4 weeks of age. [score:2]
Dysregulation of smooth muscle genes and miR-143 and miR-145 in the oviducts of Tgfbr1 c KO mice at 3–4 weeks of age. [score:2]
We found a global reduction of expression of smooth muscle genes, as well as two miRNAs, miR-143 and miR-145, in the Tgfbr1 c KO oviducts compared with controls. [score:2]
Relative mRNA levels of smooth muscle genes (A) and Myocd (B) were normalized to Gapdh, while levels of miR-143, miR-145, and miR-21 (C) were normalized against snoRNA202. [score:1]
We confirmed by quantitative PCR that miR-143 was not significantly altered in the Tgfbr1 c KO oviducts. [score:1]
[1 to 20 of 11 sentences]
19
[+] score: 31
Description miR-451[39] Upregulated in heart due to ischemia miR-22[40] Elevated serum levels in patients with stablechronic systolic heart failure miR-133[41] Downregulated in transverse aortic constrictionand isoproterenol -induced hypertrophy miR-709[42] Upregulated in rat heart four weeks after chronicdoxorubicin treatment miR-126[43] Association with outcome of ischemic andnonischemic cardiomyopathy in patients withchronic heart failure miR-30[44] Inversely related to CTGF in two rodent mo delsof heart disease, and human pathological leftventricular hypertrophy miR-29[45] Downregulated in the heart region adjacent toan infarct miR-143[46] Molecular key to switching of the vascular smoothmuscle cell phenotype that plays a critical role incardiovascular disease pathogenesis miR-24[47] Regulates cardiac fibrosis after myocardial infarction miR-23[48] Upregulated during cardiac hypertrophy miR-378[49] Cardiac hypertrophy control miR-125[50] Important regulator of hESC differentiation to cardiacmuscle(potential therapeutic application) miR-675[51] Elevated in plasma of heart failure patients let-7[52] Aberrant expression of let-7 members incardiovascular disease miR-16[53] Circulating prognostic biomarker in critical limbischemia miR-26[54] Downregulated in a rat cardiac hypertrophy mo del miR-669[55] Prevents skeletal muscle differentiation in postnatalcardiac progenitors To further confirm biological suitability of the identified miRNAs, we examined KEGG pathway enrichment using miRNA target genes (see ). [score:31]
[1 to 20 of 1 sentences]
20
[+] score: 30
Table S1 provides the human orthologs of all predicted target genes: 747 conserved targets for miR-26b (832 conserved and 248 poorly conserved sites); 1003 conserved targets for miR-27a (1098 conserved and 440 poorly conserved sites); 276 conserved targets for miR-143 (289 conserved and 105 poorly conserved sites) and 201 conserved targets for miR -150 (207 conserved and 109 poorly conserved sites). [score:11]
747 conserved targets for miR-26b (832 conserved and 248 poorly conserved sites); 1003 conserved targets for miR-27a (1098 conserved and 440 poorly conserved sites); 276 conserved targets for miR-143 (289 conserved and 105 poorly conserved sites) and 201 conserved targets for miR -150 (207 conserved and 109 poorly conserved sites). [score:9]
As shown in Figure 3, the expression levels of several miRs were significantly decreased, including miR-26b (0.46±0.17, p = 0.02), miR-27a (0.77±0.27, p = 0.03) and miR-143 (0.73±0.28, p = 0.02), in the exercised group at day 7. Furthermore, we detected a remarkable increase in miR-150 expression at 35 days (1.87±0.31, p = 0.01) of training. [score:5]
We detected a reduction in miR-143 expression at 7 days after training initiation in the exercised group, and these data are in agreement with previously published results [14]. [score:3]
The qRT-PCR analysis demonstrated an increase in miR-150 levels after 35 days and a decrease in miR-26b, miR-27a and miR-143 after 7 days of voluntary exercise. [score:1]
Additionally, selected miRs that were significantly altered in our microarray, such as miR-26b, miR-27a, miR-143, miR-150, miR-328, miR-341*, miR-680 and miR-1224, were validated. [score:1]
[1 to 20 of 6 sentences]
21
[+] score: 26
Opposite effects have been observed after ectopical expression of miR-143 in 3T3-L1 cells which led to the up-regulation of adipocyte marker genes [24]. [score:6]
Besides the regulation of miR-103/107 and miR-143, we could also confirm the up-regulation of miR-422b, miR-148a, miR-30c, and miR30a-5p found in differentiating 3T3-L1 cells by Xie and colleagues [24]. [score:5]
Besides miR-103/107 and miR-143, miR-30c was also upregulated. [score:4]
Besides these, miR103/107 and miR-143, were also found to be upregulated in the adipogenesis mo del analyzed here. [score:4]
In this mo del, blocking of miR-143 reduced the expression of adipocyte differentiation markers by 50% [25]. [score:3]
The direct involvement of miR-143 in adipocyte differentiation has been studied by using antisense oligonucleotides in cultured human pre-adipocytes. [score:2]
Among the 66 miRNAs found in our study to be differentially regulated in MSC-derived adipocytes, miR-103/107 and miR-143 have already been found to play a crucial role in adipocyte differentiation [23], [24]. [score:2]
[1 to 20 of 7 sentences]
22
[+] score: 26
Similarly, expressions of miR-16 and miR-143 inhibit cell proliferation and suppress tumorigenesis, and miR-143 has been observed to be down-regulated in cervical cancer [36]. [score:10]
For bats, 3 out of 4 up-regulated miRNA (miR-101-3p, miR-16-5p, miR-143-3p) likely function as tumor suppressors against various kinds of cancers, while one down-regulated miRNA (miR-221-5p) acts as a tumorigenesis promoter in human breast and pancreatic cancers. [score:9]
The summary of the six DE miRNA common to all species is described in Fig.   5. Briefly, all DE candidates were single copy miRNA across all libraries, and 4 DE miRNA (miR-101-3p, miR-16-5p, miR-143-3p and miR-155-5p) were up-regulated in bats while 2 (miR-125-5p and miR-221-5p) were down-regulated. [score:7]
[1 to 20 of 3 sentences]
23
[+] score: 26
The IPA software analysis showed that of the 124 miRNAs that were downregulated in Srf KO samples, 11 were known miRNAs (including SMC-specific miR-143 and miR-145), 8 were predicted miRNAs and 105 were unknown miRNAs that may have been directly or indirectly induced by SRF (Figure 4d). [score:6]
[22] As SRF -induced miR-143 and miR-145 expression promotes GI SMC differentiation and suppression of proliferation, [10] deficiency of Dicer, which prevents generation of mature miRNAs, can lead to degeneration of SMCs in GI smooth muscle. [score:5]
Among the miRNAs predominately expressed in SMCs, miR-143 and miR-145 are the most well established, and not surprisingly, these two miRNAs account for 78% of all miRNAs expressed in the smooth muscle of our in vivo Srf KO mo del (Supplementary Table 1). [score:5]
This includes miR-143/145 that function to target and inhibit apoptotic proteins (Figure 6). [score:5]
This finding can be partly explained by the fact that miR-143 and miR-145 are generated from the same primary transcript, and binding of SRF to a conserved CArG box located in the distal promoter region modulates their expression. [score:3]
Our results were further validated by the finding that 12 of the 36 SRF -dependent miRNAs, including miR-143 and miR-145 that were discovered through in vitro Srf knock-down were also found to be SRF dependent in the in vivo Srf KO mo del. [score:2]
[1 to 20 of 6 sentences]
24
[+] score: 25
The results of luc reporter assays are summarized in Figure 10, C and D. The data showed that miR-143 and miR-155 down-regulated the WT2 c-Maf 3′-UTR, and miR-301a down-regulated the WT3 c-Maf 3′-UTR (Figure 10C, n = 6, P < 0.05). [score:6]
Expression of the lens-differentiation factor c-Maf was predicted to be regulated by multiple miRNAs and experimentally validated for three miRNAs, including miR-143, miR-155, and miR-301a, in lens cells. [score:4]
Taken together, the present data demonstrate that miR-143 and miR-301a are novel regulatory miRNAs for c-Maf expression in mammalian lens. [score:4]
To determine whether the aforementioned miRNAs identified in rat lens explant system are also expressed during mammalian lens development in vivo, we conducted ISH analysis of miR-9, miR-143, miR-155, miR-301a, miR-381, and miR-455 in E14.5 and newborn (P0) lenses. [score:4]
In addition, c-Maf 3′-UTR contains a miR-143 target sequence (Figure 10, A and B). [score:3]
The miR-143, miR-155, and miR-301a down-regulated expression of c-Maf evaluated in cultured lens cells through the 3′-UTR luciferase reporter assays. [score:3]
At postnatal day P0, the distribution of both miR-9 (B) and miR-143 (D) is largely maintained in all the lens cells previously described for the E14.5 lens, whereas miR-301a (F) is not detected. [score:1]
[1 to 20 of 7 sentences]
25
[+] score: 25
Further, down-regulation of miR-143/145 is sufficient to up-regulate PDGF receptor (PDGF-R), protein kinase C (PKC) epsilon, and fascin, an actin bundling protein of podosomes. [score:7]
Interestingly, one of the first reports regarding the role of miRs in aneurysm disease showed that miR-143/145 expression is reduced in aortas from patients with thoracic aortic aneurysm, permitting dedifferentiation of aortic VSMC with a resultant decrease in contractile function [63]. [score:5]
It has been proposed that shear stress -induced KLF-2 may stimulate expression of miR-143/145 in ECs [88], leading to miR secretion in microvesicles and transfer into VSMCs [84]. [score:3]
Finally, miR-143/145 may be secreted in microvesicles derived from ECs (which otherwise do not usually express these miRs) [84]. [score:3]
Probably the most extensively studied miR in VSMC pathology is the miR-143/145 cluster, which is transcribed as a bi-cistronic transcript from a common promoter, which in turn is regulated by serum response factor (SRF), myocardin, and myocardin-related transcription factor-A [83]. [score:2]
MiR-143/145 is dramatically reduced in several vascular disease mo dels, e. g., carotid balloon/wire injury, carotid ligation in rats, and in ApoE [−/−] mice [83– 85]. [score:2]
miR-143/145 alters SMC phenotypic switching in response to vascular injury, influencing both the synthetic/proliferative and the contractile/differentiated states [63, 83– 86]. [score:1]
EC-derived microvesicles containing miR-143/145 can reduce atherosclerotic lesions when injected into ApoE [−/−] mice [88]. [score:1]
5. miR-143/145. [score:1]
[1 to 20 of 9 sentences]
26
[+] score: 24
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-34a, mmu-mir-145b
Our data show a significant (p < 0.01) increase of miR-145 and miR-143 in cervical cancer cells after treatment with Cucurbitacin D, which clearly indicates that Cucurbitacin D may inhibit the growth of cervical cancer cells via inducing the expression of tumor suppressing miR-145 and miR-143. [score:7]
Studies have also demonstrated that expression of miR-145 and miR-143 are significantly lower in cervical cancer when compared with their normal counterparts and over -expression of these miRNAs inhibit growth of cervical cancer cells 34 35. [score:6]
Studies have reported that miR-145 and miR143 are significantly lower in cervical cancer and expression of these miRNA inhibits growth of cervical cancer cells 34 35. [score:5]
Cucurbitacin D treatment induces the expression of miR-145, miR-143 and miR-34a in cervical cancer cells. [score:3]
Our results illustrated that treatment of CaSki cells with Cucurbitacin D (1 μM) significantly (p < 0.01) induced the expressions of miR-145 (Fig. 5Bii) and miR-143 (Fig. 5Biii) compared to control cells. [score:2]
To investigate the effect of Cucurbitacin D treatment on the expression of miRNAs (miR-145, miR-143 and miR-34a) in cervical cancer cells, we performed qRT-PCR. [score:1]
[1 to 20 of 6 sentences]
27
[+] score: 22
Other miRNAs from this paper: hsa-mir-143
2011.53 21427707 4. Hirahata M. Osaki M. Kanda Y. Sugimoto Y. Yoshioka Y. Kosaka N. Takeshita F. Fujiwara T. Kawai A. Ito H. PAI-1, a target gene of miR-143, regulates invasion and metastasis by upregulating MMP-13 expression of human osteosarcomaCancer Med. [score:9]
Moreover, we identified plasminogen activator inhibitor-1 (PAI-1) as a direct target gene of miR-143 [4]. [score:6]
2015.05.001 26002013 3. Osaki M. Takeshita F. Sugimoto Y. Kosaka N. Yamamoto Y. Yoshioka Y. Kobayashi E. Yamada T. Kawai A. Inoue T. MicroRNA-143 regulates human osteosarcoma metastasis by regulating matrix metalloprotease-13 expressionMol. [score:4]
Toward this end, our group previously reported that intravenous injection of miR-143 significantly suppressed the lung metastasis of human 143B osteosarcoma cells in a mouse mo del [3]. [score:3]
[1 to 20 of 4 sentences]
28
[+] score: 22
Actually, the colonic expression of miR-143 was significantly downregulated in the DSS-colitic mice. [score:6]
Additionally, miR-143 seems to play an important role in maintaining the normal colonic biology; thus, when it downregulates the pro-inflammatory signals of the innate immune system appear (Starczynowski et al., 2010). [score:4]
Moreover, the reduced expression of miR-143 in colitic mice was also restored by the probiotic treatment (0.91 ± 0.06 in EcN group vs. [score:3]
healthy control, p < 0.05) whereas the other two, miR-143 and miR-375, were significantly downregulated in colitic mice compared to non-colitic group (around twofold decrease, p < 0.05). [score:3]
In the present study, we selected five of the eleven changed miRNA, specifically miR-143, miR-150, miR-155, miR-223, and miR-375, and questioned whether their expression was altered following treatment of DSS-colitis mice with E. coli Nissle. [score:3]
Gene Sequence (5′-3′) Annealing temperature (°C) IL-1β FW:TGATGAGAATGACCTGTTCT 55 RV:CTTCTTCAAAGATGAAGGAA IL-12 FW:CCTGGGTGAGCCGACAGAAGC 60 RV:CCACTCCTGGAACCTAAGCAC TGF-β FW:GCTAATGGTGGACCGCAACAAC 60 RV:CACTGCTTCCCGAATGTCTGAC ICAM-1 FW:GAGGAGGTGAATGTATAAGTTATG 60 RV:GGATGTGGAGGAGCAGAG MUC-2 FW:GATAGGTGGCAGACAGGAGA 60 RV:GCTGACGAGTGGTTGGTGAATG MUC-3 FW:CGTGGTCAACTGCGAGAATGG 62 RV:CGGCTCTATCTCTACGCTCTCC ZO-1 FW:GGGGCCTACACTGATCAAGA 56 RV:TGGAGATGAGGCTTCTGCTT OCLN FW:ACGGACCCTGACCACTATGA 56 RV:TCAGCAGCAGCCATGTACTC GAPDH FW:CATTGACCTCAACTACATGG 60 RV:GTGAGCTTCCCGTTCAGC miR-143 UGAGAUGAAGCACUGUAGCUC 55 miR-150 UCUCCCAACCCUUGUACCAGUG 55 miR-155 UUAAUGCUAAUUGUGAUAGGGGU 55 miR-223 UGUCAGUUUGUCAAAUACCCCA 55 miR-375 UUUGUUCGUUCGGCUCGCGUGA 55 SNORD95 TATTGCACTTGTCCCGGCCTGT 55The miRNA from colonic samples was isolated after homogenizing the tissue in QIAzol [TM] (Qiagen, Hilden, Germany) using a Precellys [®]24 homogenizer (Bertin Technologies, Montigny-le-Bretonneux, France). [score:1]
Gene Sequence (5′-3′) Annealing temperature (°C) IL-1β FW:TGATGAGAATGACCTGTTCT 55 RV:CTTCTTCAAAGATGAAGGAA IL-12 FW:CCTGGGTGAGCCGACAGAAGC 60 RV:CCACTCCTGGAACCTAAGCAC TGF-β FW:GCTAATGGTGGACCGCAACAAC 60 RV:CACTGCTTCCCGAATGTCTGAC ICAM-1 FW:GAGGAGGTGAATGTATAAGTTATG 60 RV:GGATGTGGAGGAGCAGAG MUC-2 FW:GATAGGTGGCAGACAGGAGA 60 RV:GCTGACGAGTGGTTGGTGAATG MUC-3 FW:CGTGGTCAACTGCGAGAATGG 62 RV:CGGCTCTATCTCTACGCTCTCC ZO-1 FW:GGGGCCTACACTGATCAAGA 56 RV:TGGAGATGAGGCTTCTGCTT OCLN FW:ACGGACCCTGACCACTATGA 56 RV:TCAGCAGCAGCCATGTACTC GAPDH FW:CATTGACCTCAACTACATGG 60 RV:GTGAGCTTCCCGTTCAGC miR-143 UGAGAUGAAGCACUGUAGCUC 55 miR-150 UCUCCCAACCCUUGUACCAGUG 55 miR-155 UUAAUGCUAAUUGUGAUAGGGGU 55 miR-223 UGUCAGUUUGUCAAAUACCCCA 55 miR-375 UUUGUUCGUUCGGCUCGCGUGA 55 SNORD95 TATTGCACTTGTCCCGGCCTGT 55 The miRNA from colonic samples was isolated after homogenizing the tissue in QIAzol [TM] (Qiagen, Hilden, Germany) using a Precellys [®]24 homogenizer (Bertin Technologies, Montigny-le-Bretonneux, France). [score:1]
FIGURE 5Biochemical evaluation of the effects of Escherichia coli Nissle 1917 (EcN); the expression of (A) miR-150, (B) miR-155, (C) miR-223, (D) miR-143, and (E) miR-375 was quantified by real-time PCR. [score:1]
[1 to 20 of 8 sentences]
29
[+] score: 21
Although scarce details are available on the role of miR-143 and 1246 in islet function, miR-143 was shown to be among the ten most abundant miRNAs expressed in human islets beta cells whereas miR-1246 was predominantly expressed in other islet cell types [35]. [score:5]
Elsewhere, miR-143 expression was found to be essential for human pre-adipocyte differentiation partly through repression of its target gene ERK5 involved in cell growth and proliferation [36]. [score:5]
In contrast mouse islets only expressed miR-143 and very low levels of miR-1246 (Fig.   5b). [score:3]
Further indication for a dysfunctional role of the rs7119 variant in aberrant HMG20A repression was highlighted by the expression of SNP -associated miRNAs, the most abundant being miR-143 and 1246, in human 1.1E7 cells and mouse islets. [score:3]
Notwithstanding, the “mut” allele generates binding sites for six alternative miRNAs (Table  1) of which four, miR-143 (3p and 5p), miR-490-3p, miR-1246, and miR-1261, were expressed in the human 1.1E7 pancreatic cell line (Fig.   5a). [score:3]
Esau C MicroRNA-143 regulates adipocyte differentiationJ. [score:1]
Although it remains to be validated, the potential serendipitous binding of miR-143 to the HMG20A rs7119 gene variant may induce aversely de-differentiation through activation of Pax4 and Rest. [score:1]
[1 to 20 of 7 sentences]
30
[+] score: 19
MACC1 acted as a target gene for miRNAs, and it has been reported that the expression of MACC1 was down-regulated by miR-143 inhibited the cell migration and invasion in colorectal cancer (Zhang et al., 2012) and MACC1 was down-regulated by miR-200a inhibited the hepatocellular carcinoma cell proliferation and migration (Feng et al., 2015). [score:15]
MicroRNA-143 targets MACC1 to inhibit cell invasion and migration in colorectal cancer. [score:4]
[1 to 20 of 2 sentences]
31
[+] score: 18
Together, these data suggest that p53/TA-p73/p63, by negatively regulating the expression of lin-28/TUT4ase through its target miRs, it could increase the processing of the tumor suppressor-miRNAs, let-7, miR-200c, miR-143, and miR-107 [Figure 3]. [score:8]
A) miR-143 has been shown to inhibit the expression of DNMT-3a [62]. [score:5]
p53, TA-p73/p63, and ΔNp63 regulate the processing of the tumor suppressor miRNAs, let-7, miR-200, miR-143, and miR-107. [score:4]
Lin-28 may also mediate uridylation of other miRNAs, such as miR-143, 200c, and 107, as these miRNAs share the sequence motif GGAG. [score:1]
[1 to 20 of 4 sentences]
32
[+] score: 17
Although the majority of the differentially expressed miRNAs originated from different miRNA clusters, mmu-miR-429-3p and mmu-miR-200a-5p belonged to the same cluster (MID < 5 kb) on chromosome 4 and were both up-regulated in myopic retina, while mmu-miR-145-5p and mmu-miR-143-3p localized within the same cluster (MID < 5 kb) on chromosome 18 and were both down-regulated in myopic retina (Table 1) [68]. [score:9]
For example, mmu-miR-145-5p, which was strongly down-regulated in myopic retina (FC = -10.5, p = 8.87 × 10 [−09]), targeted 25 mRNAs (the largest number among all 21 miRNAs) (Table 2); while mmu-miR-429-3p (FC = 7.8, p = 2.05 × 10 [−03]), mmu-miR-143-3p (FC = -2.0, p = 1.43 × 10 [−03]), mmu-miR-223-3p (FC = -2.7, p = 4.84 × 10 [−04]) and mmu-miR-146a-5p (FC = -3.2, p = 2.70 × 10 [−05]) targeted 17, 17, 16 and 14 mRNAs respectively. [score:8]
[1 to 20 of 2 sentences]
33
[+] score: 17
However, miR-26a, let-7b and let-7c and miR-143 up-regulated at implantation sites either doesn't change or is down-regulated in activation group. [score:7]
miR-143 reference sequence was the second dominant form, representing 31.41% of total miR-143 isoforms (Table 5). [score:1]
For let-7a, miR-143 and miR-21, the editing within seed region in delayed implantation is significantly higher than activation group. [score:1]
But the percentage of editing at positions 4 and 5 under delayed implantation was also significantly higher than that under activation group, similar to let-7a and miR-143. [score:1]
However, the most dominant form of miR-143 was one nucleotide deletion from 3′-end. [score:1]
For miR-143, there was a high percentage of editing at positions 4, 5, 13 and at 3′-end (Fig. 1D). [score:1]
The canonical mature miR-143 sequence (reference sequence) is in the top row. [score:1]
The editing rate of each position of the total miRNAs (B), let-7a (C), miR-143 (D) and miR-21 (E) in mouse uteri from delayed implantation and activation are shown. [score:1]
In our study, 41.5% of let-7a and 64.4% of miR-143 sequences are either edited or alternatively spliced. [score:1]
The top 30 editing forms of miR-143. [score:1]
Additionally, we found that the most abundant sequence of miRNA-143 is not the reference sequence reported. [score:1]
[1 to 20 of 11 sentences]
34
[+] score: 17
Physiol Genomics 13 Elia L Quintavalle M Zhang J Contu R Cossu L 2009 The knockout of miR-143 and -145 alters smooth muscle cell maintenance and vascular homeostasis in mice: correlates with human disease. [score:4]
These similarities indicate that although miR-143/145 are not the essential miRNAs for SMC development they are important determinants of SMC differentiation and function in vivo. [score:2]
miR-143/145 are the first miRNAs suggested to be relatively specific for SMCs and play an important role for the regulation of SMC fate and maintenance of the contractile phenotype [6], [11]. [score:2]
Studies on miR-143/145 KO mice later revealed that these miRNAs are important but not essential for VSMC development in vivo [13]– [15]. [score:2]
Interestingly, the drop in blood pressure was more severe in SM-Dicer KO mice compared to previously reported data on miR-143/145 KO mice, suggesting that additional miRNAs may regulate VSMC functions. [score:1]
Firstly, systolic blood pressure of miR-145 and miR143/145 KO mice is reduced by approximately 15–20 mmHg [14], [15] while systolic blood pressure in SM-Dicer KO mice is reduced by 27.7 mmHg. [score:1]
Alternatively, the milder phenotype of the constitutive miR-143/145 KO mice could partly be due to compensatory mechanisms. [score:1]
Secondly, miR-143/145 KO mice exhibit reduced contractile responses to KCl and phenylephrine [15] while these responses are nearly abolished in SM-Dicer KO mice 10 weeks post tamoxifen. [score:1]
Thirdly, both miR-143/145 KO mice and SM-Dicer KO mice have a decreased medial thickness [13]– [15] and a reduced SMC contractile differentiation [13], [15]. [score:1]
The importance of some specific miRNAs for SMC phenotypic modulation has been described previously and recently three separate reports were published presenting vascular phenotype of global miR-143/145 KO mice [13]– [15]. [score:1]
Interestingly, although not lethal, the phenotype of miR-143/145 KO mouse closely resembles that of the inducible SM-Dicer KO mouse in several aspects. [score:1]
[1 to 20 of 11 sentences]
35
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
EGFR signals downregulate tumor suppressors miR-143 and miR-145 in western diet–promoted murine colon cancer: role of G1 regulators. [score:7]
Epidermal growth factor receptors (EGFR) suppress the tumor suppressors miR-143 and miR-145, which coordinately control multiple targets of downstream cell-signaling pathways (i. e., K-Ras or MYC, cdk6, E2F3, and G1/S-specific cyclin-D2 or CCND2) in the AOM rodent mo del (Zhu et al., 2011). [score:7]
For example let-7, miR-18a and miR-143 are strongly linked to KRAS knockdown and activation of the epidermal growth factor receptor-mitogen activated protein kinase (EGFR-MAPK) pathway, whereas miR-21 and miR-126 are associated with augmentation or inactivation of the phosphatidylinositol-3-kinase pathway (Aslam et al., 2012). [score:2]
[1 to 20 of 3 sentences]
36
[+] score: 16
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-27b, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-182, mmu-mir-199a-1, mmu-mir-122, mmu-mir-298, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-27a, mmu-mir-31, mmu-mir-98, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-181b-1, mmu-mir-379, mmu-mir-181b-2, mmu-mir-449a, mmu-mir-451a, mmu-mir-466a, mmu-mir-486a, mmu-mir-671, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-491, mmu-mir-700, mmu-mir-500, mmu-mir-18b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-669e, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-669a-10, mmu-mir-669a-11, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-486b, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-145b, mmu-let-7j, mmu-mir-451b, mmu-let-7k, mmu-mir-126b, mmu-mir-466c-3
For example, miR-127 has been shown to participate in cancer development [85], miR-145 has been shown to control c-Myc expression through p53 [86], miR-199a regulates MET protooncogene and affects NF-KB expression [54], miR-379 affects brain neuronal development [87], [88], miR-451 affects erythroid differentiation [89], miR-126 affects angiogenic signaling and controls blood vessel development [90], miR-143 regulates ERK5 signaling and targets KRAS gene [91], miR-298 regulates CYPA3 expression [92] and miR-486 regulates kinase activity and tumor progression [93]. [score:16]
[1 to 20 of 1 sentences]
37
[+] score: 16
Overexpression of microRNA-143 inhibits growth and induces apoptosis in human leukemia cells. [score:5]
MicroRNA-143 has been experimentally confirmed to represses DNMT3A expression in colon and breast cancer cell lines [60, 61], and inhibit growth by causing apopotosis in leukaemia cells [62]. [score:4]
The tumour suppressor p53 is known to enhance post-transcriptional maturation of multiple miRNAs, including microRNA-143/microRNA-145 (increased in the sperm from HFD fathers), as a response to DNA damage [63]. [score:3]
Moreover microRNA-143 is known to accelerate adipogenesis and is also increased in adipose tissue of mice fed a high fat diet [68]. [score:1]
Overall it remains possible that p53 acts upstream as a result of DNA damage and HFD consumption that ultimately leads to increased microRNA-143/microRNA-145 in sperm in HFD fathers. [score:1]
Moreover microRNA-143/145 have been demonstrated to be delivered by sperm, insofar as they were not detectable in oocytes but were present in both sperm and in early embryos soon after fertilisation [36]. [score:1]
Interestingly increased DNA damage has been previously reported to result from the mo del of male obesity used in this study [22, 44, 64] and this potentially triggers the increased abundance of p53 and thus microRNA-143/microRNA-145. [score:1]
[1 to 20 of 7 sentences]
38
[+] score: 15
miR-143/145 are expressed in both airway SMCs and vSMCs [61]. [score:3]
There is no significant defect in the expression of contractile SMC markers in miR-143/145 null mice[20, 61]. [score:3]
miR-143/145 has been shown to play an important role in SMC development in vivo [20, 61, 64]. [score:2]
Both SMC-specific deletion of Dicer1 and systemic miR-143/145 knockout compromise vascular contractile function and result in lower blood pressure[18, 20, 64, 69]. [score:2]
Unlike miR-29, there is little change in levels of miR-143/145 during embryonic and postnatal development (S2 Table). [score:2]
Major vSMCs defects of miR-143/145 null mice are disarray of actin stress fibers and diminished migratory activity of SMCs. [score:1]
Moreover, miR-143/145 null mice are protected from hypoxia induced pulmonary hypertension[69]. [score:1]
SMC-specific miRNAs have been identified, such as miR-143/145. [score:1]
[1 to 20 of 8 sentences]
39
[+] score: 15
In our system, miR-143/145 were up-regulated (Table 1); however, miR-21 was not altered (data not shown). [score:4]
miR-143/145 are up-regulated upon TGFβ1 treatment, which suggests the interaction of miRNAs and conventional signaling pathways in SMC phenotype switching (16). [score:4]
Davis-Dusenbery B. N., Chan M. C., Reno K. E., Weisman A. S., Layne M. D., Lagna G., and Hata A. (2011) down-regulation of Kruppel-like factor-4 (KLF4) by microRNA-143/145 is critical for modulation of vascular smooth muscle cell phenotype by transforming growth factor-β and bone morphogenetic protein 4. J. Biol. [score:4]
Several microRNAs have been identified to be related to SMC differentiation during the development and the maturation of vascular SMC phenotypes among which miR-143/145 are the most extensively studied (14, 15). [score:2]
Numerous miRNAs are involved in SMC differentiation (15), some of which are induced by TGFβ1 such as miR-143/145 (16) and miR-21 (33). [score:1]
[1 to 20 of 5 sentences]
40
[+] score: 14
Among these, miR-31 is consistently upregulated [12]– [17], [20], [22], [23], [25] and microRNA clusters miR-143/-145 [18], [21]– [23], [37]– [40] and miR-194/-215 [18], [21]– [23], [37], [38], [41] downregulated in colon cancer. [score:7]
Likewise, miR-143 and miR-145 inhibit cell growth, with this action, in part, attributed to through inhibition of target genes such as DNMT3A, IRS-1, YES1, STAT1, and FLI1 [21], [46]– [50]. [score:7]
[1 to 20 of 2 sentences]
41
[+] score: 14
However, some dysregulated miRNAs in Drosha c KO mice are the same as in DGCR8 and Dicer c KO mice (e. g., the miR-143/145 cluster was enriched as the VSMC-specific miRNA and downregulated in all three c KO mice). [score:5]
Previous studies showed that miR-143/145 contributed to the VSMC phenotypic modulation by enhancing VSMC marker gene expression including SMA, SM22, and CNN1 [12], [17]. [score:3]
However, miR-143 and miR-145 were significantly downregulated in Drosha KO VSMCs compared to controls. [score:3]
We found that, in the umbilical arteries of Drosha c KO embryos, the expression of miR-143 and -145 decreased ∼124- and 35-fold compared to controls, respectively (Figure 7B). [score:2]
VSMC-specific miR-143/145 cluster modulates a VSMC phenotypic switch between proliferation and differentiation [11], [12], [13], [14]. [score:1]
[1 to 20 of 5 sentences]
42
[+] score: 14
Other miRNAs from this paper: mmu-mir-31
The inhibition of miR-31 upregulated luciferase activity, while miR-143 had no effect (Fig 3A). [score:6]
0164858.g003 Fig 3(A) CMT-93 cells were co -transfected with a reporter plasmid carrying the full-length 3´-UTR of the Tollip gene and miR-31 inhibitor (α-miR-31), miR-143 inhibitor (α-miR-143) or negative control (cont. [score:5]
Among the candidates, two miRNAs, miR-31-5p (miR-31) and miR-143-3p (miR-143), were expressed at much higher levels in S-IECs than in L-IECs[40]. [score:3]
[1 to 20 of 3 sentences]
43
[+] score: 13
MiR-143 has been shown to inhibit ERK5 mRNA translation 2-fold through a site in its 3′ UTR, miR-20a inhibits translation of the E2F1 mRNA approximately 4-fold, and miR-375 inhibits translation of Myotrophin mRNA 2-fold. [score:13]
[1 to 20 of 1 sentences]
44
[+] score: 13
Interestingly, miR-145 also participates in a regulatory loop involving the tumor suppressor p53 and targets ER-alpha in human breast cancer cells [32], and the processing of the primary miRNAs (pri-miRNAs) of miR-143 and miR-145 by Drosha was also shown to be regulated in a p53 -dependent manner [33]. [score:7]
MiR-143 and miR-145 are co-expressed miRNAs that function as tumor suppressors and their repression by k-Ras potentiates the oncogenic k-Ras signaling by a feed-forward loop [30, 31]. [score:5]
Kent O. A. Chivukula R. R. Mullendore M. Wentzel E. A. Feldmann G. Lee K. H. Liu S. Leach S. D. Maitra A. Men dell J. T. Repression of the miR-143/145 cluster by oncogenic Ras initiates a tumor-promoting feed-forward pathwayGenes Dev. [score:1]
[1 to 20 of 3 sentences]
45
[+] score: 12
We found downregulation of miR-143 in Akita heart by NGS, which was not reported in previous study [7]. [score:4]
We validated miR-101c and miR-143, which were up-, and down-regulated in Akita hearts, respectively, by measuring the protein levels of their target genes. [score:4]
For miR-143 target gene, we measured the protein levels of GABA (A) receptor associated protein like1 (GABARAPL1), whose expression does not change in rat cardiomyocytes after treatment with high glucose [14]. [score:3]
Our results demonstrated that there was no change in the protein levels of GABARAPL1 in Akita hearts (Fig 4D), suggesting that decreased levels of miR-143 do not change the GABARAPL1 levels in Akita hearts. [score:1]
[1 to 20 of 4 sentences]
46
[+] score: 12
3) SM genes are indirectly and negatively controlled by SRF through SM miRNAs; we previously found that a large number of SM miRNAs, such as miR-143/miR-145 and miR-199a/miR-214, are SRF targets [26], and SM miRNAs target SM genes (see Table S5). [score:6]
However, half of the SMC miRNAs including miR-145(5p) and miR-143(3p) were still detected in the mutant SMCs although expression levels of most of the SMC miRNAs were significantly reduced in the SMCs (Figure 3C and Table S2). [score:3]
A set of miRNAs including miR-21, miR-133a, miR-143, and miR-145 have been identified as regulators of SMC growth and/or differentiation in cardiovascular disorders [21]– [25]. [score:2]
miR-125a-5p, miR-29c(3p), miR-145(5p), miR-143(3p), miR-337-5p, and miR-380-3p were analyzed on the gels. [score:1]
[1 to 20 of 4 sentences]
47
[+] score: 12
miR-143/145 along with miR-199a (another miRNA that is more highly expressed in cultured MG but absent in MG in vivo) have been recently reported to be highly expressed in cultured MG from P8 mice 25. [score:5]
Another cluster that is highly up-regulated in the cultured MG is miR-143/145. [score:4]
Moreover, there were two miRNAs (miR-21 and miR-145) and three miRNAs (miR-199a-3p/5p and miR-143), which were not or barely expressed in vivo (<500 counts), but increased dramatically in vitro (over 6,900 and over 1,500 counts respectively, Fig. 5F). [score:3]
[1 to 20 of 3 sentences]
48
[+] score: 11
Altered expression of many miRNAs is seen in several tumor types: e. g. B-cell lymphomas (clustered miR-17) [2], [3], malignant lymphomas (miR-15a, miR-16-1; targeting BCL2) [4], glioblastoma tumors (miR-21up-regulation) [5], colorectal neoplasia (miR-143, miR-145 down-regulated) [6], lung cancer (miR-29) [7], and breast cancer (miR-10b) [8], with several more tumor types under analysis. [score:11]
[1 to 20 of 1 sentences]
49
[+] score: 11
The co-occurrence of the over -expression of OLR1 and FAAH and the under -expression of miR-143 strongly indicates that both genes could be regulated by this miRNA. [score:6]
In our study, sequence analysis showed that both genes contain sequences targetable by miR-143. [score:3]
MiRNAs persistently regulating these genes in our mo del are miR-143, miR-27b, miR-141, miR-200a, and miR-148a (Fig.   6b). [score:2]
[1 to 20 of 3 sentences]
50
[+] score: 10
miR-27a and miR-130 suppress adipogenesis by inhibiting PPARγ (Kajimoto et al, 2006), whereas miR-143 induces adipogenesis by downregulating ERK5 (Esau et al, 2004). [score:8]
Several miRNAs, including miR-27a, miR-130 and miR-143, were previously shown to regulate adipogenesis. [score:2]
[1 to 20 of 2 sentences]
51
[+] score: 10
We searched the databases TargetScan, PicTar, miRwalk, DIANAmT, microRNA, Microcosm Targets and MicroRanda for miRNAs that might bind to the 3′ -UTR of COX-2. Four candidates including miR-101, miR143, miR-26a and miR-144 were found via computational prediction of microRNA targets. [score:7]
In our preliminary experiments to examine the effect of those 4 miRNAs on proliferation function of ESCC cell lines, we found that miR-101 or miR-143 could inhibit the proliferation of ESCC cell lines, but miR-26a or miR-144 alone did not. [score:3]
[1 to 20 of 2 sentences]
52
[+] score: 10
Kamatani A. Nakagawa Y. Akao Y. Maruyama N. Nagasaka M. Shibata T. Tahara T. Hirata I. Downregulation of anti-oncomirs miR-143/145 cluster occurs before APC gene aberration in the development of colorectal tumors Med. [score:5]
Noguchi S. Yasui Y. Iwasaki J. Kumazaki M. Yamada N. Naito S. Akao Y. Replacement treatment with microRNA-143 and -145 induces synergistic inhibition of the growth of human bladder cancer cells by regulating PI3K/Akt and MAPK signaling pathways Cancer Lett. [score:4]
2012.11508. x 23452020 8. Akao Y. Nakagawa Y. Hirata I. Iio A. Itoh T. Kojima K. Nakashima R. Kitade Y. Naoe T. Role of anti-oncomirs miR-143 and -145 in human colorectal tumors Cancer Gene Ther. [score:1]
[1 to 20 of 3 sentences]
53
[+] score: 10
In four independent differentiation procedures we could confirm the microarray data (Fig. 5A)–that is, a strong concentration -dependent induction of muscle-specific/abundant miRNA (mir-206, mir-10a, mir-214, mir-145, mir-143, mir-199a) and a significant downregulation of the expression of neuro-specific miRNAs (mir-124, mir-128, mir-137, mir-491, mir-383) in comparison to the solvent control. [score:6]
Comparing to the solvent control, in cells treated with VPA we observed a strong upregulation of myogenic miRNAs (myo- mirs: mir-206, mir-133a,b), or miRNAs shown to be involved in muscle differentiation and specification (mir-10a, mir-143/ mir-145 cluster, mir-214, mir-322, mir-199a). [score:4]
[1 to 20 of 2 sentences]
54
[+] score: 10
We found correlations indicating putative intrathymic functions for some miRNAs, such as miR-183 that direct regulates integrin β1 expression (56), miR-143, suppressing fibronectin directly (57), miR-218 controlling focal adhesion kinase (58), and miR-203 increasing metalloproteinase-1 expression (59). [score:10]
[1 to 20 of 1 sentences]
55
[+] score: 9
Recently, several miRNAs, including miR-143/145, miR-192/194, miR-339–5p and miR-509-5p have been identified to regulate p53 levels and function through directly targeting MDM2 [27, 29, 30, 48, 49]. [score:5]
miR-143/145 were reported to be down-regulated in head and neck squamous cell carcinoma [50]. [score:4]
[1 to 20 of 2 sentences]
56
[+] score: 9
Some of the miRNAs were involved in nutrient metabolism, such as miR-705 (regulation of lipid metabolism and inflammation), miR-143 (regulation of adipocyte differentiation) and miR-375 (regulator of glucagon levels and gluconeogenesis). [score:4]
miR-143 was reported as a regulator of adipocyte differentiation and was significantly down-regulated compared with mice [50, 51]. [score:4]
MiR-122, miR-451 and miR-494 were detected in liver, miR-494, miR-691 and miR-143 in spleen, and miR-223, miR-200a and miR-322 in lung. [score:1]
[1 to 20 of 3 sentences]
57
[+] score: 9
Other miRNAs from this paper: hsa-mir-143
In line with this, suppression of ERK5 expression by forced expression of miR-143/145 inhibited intestinal adenoma formation in the Apc [Min/+] mo del 59, and activated MEK5 correlated with more invasive CRC in human 60. [score:9]
[1 to 20 of 1 sentences]
58
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
miR-143 expression varied substantially among the 14 tissues examined (Figure 3). [score:3]
Additionally, miR-1 and miR-133 in the heart, miR-181a and miR-142-3p in the thymus, miR-194 in the liver, and miR-143 in the stomach showed the highest levels of expression. [score:3]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
[1 to 20 of 3 sentences]
59
[+] score: 9
Hierarchichal clustering of the miRNA data revealed significant upregulation of tumor promoter miRNAs (miR-17, miR-21, miR-31, miR-98 and miR-182) and significant downregulation of tumor suppressor miRNAs (Let7a, miR-143, miR-144, miR145, miR-30a and miR-200a) in the IECs of Apc [Min/+] mice (Figure 4A). [score:9]
[1 to 20 of 1 sentences]
60
[+] score: 9
The proximal let-7-5p target sequence is close to a conserved miR-448 target sequence and the central let-7-5p target sequence close to a conserved miR-143 target sequence (Fig.  3a–b) [29, 30]. [score:9]
[1 to 20 of 1 sentences]
61
[+] score: 8
Further analysis of expression of vascular miRNAs showed that miR-126, miR-143 and miR-145 are not upregulated in the ECs nor released into the endothelial MPs following overexpression of p75 [NTR] (Supplementary Fig. 6C,D). [score:8]
[1 to 20 of 1 sentences]
62
[+] score: 8
Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42]. [score:8]
[1 to 20 of 1 sentences]
63
[+] score: 8
Dozens of miRNAs (such as miR-143/145, miR-21, and miR-34) have been shown to play essential roles in lung tumorigenesis by regulating critical oncogenes or tumor suppressors 15– 17. [score:4]
Yan X MiR-143 and miR-145 synergistically regulate ERBB3 to suppress cell proliferation and invasion in breast cancerMol. [score:4]
[1 to 20 of 2 sentences]
64
[+] score: 8
For example, KLF2 binds to the promoter of the miR-143/145 gene cluster to up-regulate the expression of vascular protective genes in endothelial cells [22]. [score:6]
Additionally, miR-143/145 are regulated by KLF2 in endothelial cells and may contribute to the vasculo-protective functions of KLF2 [22]. [score:2]
[1 to 20 of 2 sentences]
65
[+] score: 8
In DGCR8i KO mutants, miR-143 and 145 were downregulated, ~8 and 22-fold compared with controls, respectively. [score:3]
The miR-143/145 cluster contributes to phenotype switch by inhibiting cell proliferation and promoting differentiation. [score:3]
Both miR-143 and miR-145 are well-studied in regulating VSMC differentiation 11, 24– 26. [score:2]
[1 to 20 of 3 sentences]
66
[+] score: 8
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-145b
For instance, Klf4 was able to promote the odontoblastic differentiation of mouse dental papilla mesenchymal cells by transactivating Dmp1 and overexpression of Dmp1 could partially rescue the effect of Klf4 down-regulation 36. miR-143 and miR-145 controlled odontoblast differentiation through Klf4 and OSX transcriptional factor signaling 37. [score:6]
These studies indicated that Klf4 was able to regulate odontoblast differentiation via the miR-143/145-Nfic-Klf4/Osx-Dspp/Dmp1 pathways. [score:2]
[1 to 20 of 2 sentences]
67
[+] score: 8
Up-regulated microrna-143 transcribed by nuclear factor kappa B enhances hepatocarcinoma metastasis by repressing fibronectin expression. [score:5]
In HCC, Let-7g and miR-122 inhibit cell migration and intrahepatic metastasis (Tsai et al., 2009; Ji et al., 2010), whereas miR-143, miR-16, miR-30a, let-7e and miR-204 can significantly promote HCC metastasis (Zhang et al., 2009; Zeng et al., 2012). [score:3]
[1 to 20 of 2 sentences]
68
[+] score: 7
We confirmed that six of the eight selected down-regulated hsa-miRNAs (miR-145, miR-497, miR-150, miR-342-5p, miR-34b* and miR-100) were significantly down-regulated in NPC tissues, whereas miR-195 and miR-143 exhibited no significant difference between the two groups of subjects (Fig. 1D). [score:7]
[1 to 20 of 1 sentences]
69
[+] score: 7
For instance, miR-21 targets the mRNA for the tropomyosin (Zhu et al., 2007); both miRNA-143 and miR-145 regulate podosome formation in smooth muscle cells (Xin et al., 2009); and miR-145, miR-133a, and miR133b target the fascin homolog 1 (Kano et al., 2010). [score:6]
MicroRNAs miR-143 and miR-145 modulate cytoskeletal dynamics and responsiveness of smooth muscle cells to injury. [score:1]
[1 to 20 of 2 sentences]
70
[+] score: 7
In particular, miR-143 and miR-145 were found to be down-regulated in the colon biopsies of UC patients [41], and miR-7 was observed to be down-regulated in the mucosa of CD patients [42]. [score:7]
[1 to 20 of 1 sentences]
71
[+] score: 7
Obesity -induced over expression of miRNA-143 inhibits insulin-stimulated AKT activation and impairs glucose metabolism. [score:5]
MicroRNAs miR-143 and miR-145 modulate cytoskeletal dynamics and responsiveness of smooth muscle cells to injury. [score:1]
Induction of angiotensin-converting enzyme after miR-143/145 deletion is critical for impaired smooth muscle contractility. [score:1]
[1 to 20 of 3 sentences]
72
[+] score: 7
The 50 highest expressed miRNAs in the mice ovaries are represented in a heatmap in Fig 1 and for miRNA expression levels in Fig 2. The top five most expressed miRNAs in the ovary (all samples combined) were mmu-miR-92a-3p (miR-25 family), mmu-let-7c-5p (let-7 family), mmu-miR-143-3p (miR-143 family), mmu-miR-26a-5p (miR-26 family) and mmu-miR-145a-5p (miR-145 family). [score:7]
[1 to 20 of 1 sentences]
73
[+] score: 7
Vascular smooth muscle cell proliferation is suppressed by increased expression of miR-145 and miR-143 through inhibition of Kruppel-like factor4 and Elk 1, respectively [9]. [score:7]
[1 to 20 of 1 sentences]
74
[+] score: 7
Fang R Xiao T Fang Z Sun Y Li F Gao Y MicroRNA-143 (miR-143) regulates cancer glycolysis via targeting hexokinase 2 geneJ Biol Chem. [score:4]
Moreover, HK2 targeted by other miRNAs could modulate the glycolysis in various cancers, such as miR-199a-5p in liver cancer and miR-143 in breast and lung cancers [39– 41]. [score:3]
[1 to 20 of 2 sentences]
75
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Furthermore, there were seven miRNAs that were only expressed at high levels in one neural tissue, for example let-7b, miR-16, miR-22, miR-206, and miR-143 specifically expressed in olfactory bulb (Fig. 3b). [score:5]
Olfactory bulb let-7b, let-7c-1, let-7c-2, miR-10a, miR-16, miR-17, miR-21, miR-22, miR-28, miR-29c, miR-124a-1, miR-124a-3, miR-128a, miR-135b, miR-143, miR-148b, miR-150, miR-199a, miR-206, miR-217, miR-223, miR-29b-1, miR-329, miR-331, miR-429, miR-451. [score:1]
[1 to 20 of 2 sentences]
76
[+] score: 6
Other miRNAs from this paper: mmu-mir-145a, hsa-mir-143, hsa-mir-145, mmu-mir-145b
Expression of miR-143 and miR-145 has been shown to down-regulate levels of ERK5 [52– 53]. [score:6]
[1 to 20 of 1 sentences]
77
[+] score: 6
A previous study found that miR-18a, miR-126, let-7e, miR-155, and miR-224 were down-regulated while miR-498, miR-187, miR-874, miR-143, and miR-886-3p were up-regulated in asthmatic patients compared to controls [27]. [score:6]
[1 to 20 of 1 sentences]
78
[+] score: 6
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-127, mmu-mir-134, mmu-mir-136, mmu-mir-154, mmu-mir-181a-2, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-21a, rno-mir-329, mmu-mir-329, mmu-mir-1a-2, mmu-mir-181a-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-375, mmu-mir-379, mmu-mir-181b-2, rno-mir-21, rno-mir-127, rno-mir-134, rno-mir-136, rno-mir-143, rno-mir-154, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-196a, rno-mir-181a-1, mmu-mir-196b, rno-mir-196b-1, mmu-mir-412, mmu-mir-370, oar-mir-431, oar-mir-127, oar-mir-432, oar-mir-136, mmu-mir-431, mmu-mir-433, rno-mir-431, rno-mir-433, ssc-mir-181b-2, ssc-mir-181c, ssc-mir-136, ssc-mir-196a-2, ssc-mir-21, rno-mir-370, rno-mir-412, rno-mir-1, mmu-mir-485, mmu-mir-541, rno-mir-541, rno-mir-493, rno-mir-379, rno-mir-485, mmu-mir-668, bta-mir-21, bta-mir-181a-2, bta-mir-127, bta-mir-181b-2, bta-mir-181c, mmu-mir-181d, mmu-mir-493, rno-mir-181d, rno-mir-196c, rno-mir-375, mmu-mir-1b, bta-mir-1-2, bta-mir-1-1, bta-mir-134, bta-mir-136, bta-mir-143, bta-mir-154a, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-329a, bta-mir-329b, bta-mir-370, bta-mir-375, bta-mir-379, bta-mir-412, bta-mir-431, bta-mir-432, bta-mir-433, bta-mir-485, bta-mir-493, bta-mir-541, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-1, ssc-mir-181a-1, mmu-mir-432, rno-mir-668, ssc-mir-143, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-196b-1, ssc-mir-127, ssc-mir-432, oar-mir-21, oar-mir-181a-1, oar-mir-493, oar-mir-433, oar-mir-370, oar-mir-379, oar-mir-329b, oar-mir-329a, oar-mir-134, oar-mir-668, oar-mir-485, oar-mir-154a, oar-mir-154b, oar-mir-541, oar-mir-412, mmu-mir-21b, mmu-mir-21c, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-370, ssc-mir-493, bta-mir-154c, bta-mir-154b, oar-mir-143, oar-mir-181a-2, chi-mir-1, chi-mir-127, chi-mir-134, chi-mir-136, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-181b, chi-mir-181c, chi-mir-181d, chi-mir-196a, chi-mir-196b, chi-mir-21, chi-mir-329a, chi-mir-329b, chi-mir-379, chi-mir-412, chi-mir-432, chi-mir-433, chi-mir-485, chi-mir-493, rno-mir-196b-2, bta-mir-668, ssc-mir-375
For example, miR-273 and the lys-6 miRNA have been shown to be involved in the development of the nervous system in nematode worm [3]; miR-430 was reported to regulate the brain development of zebrafish [4]; miR-181 controlled the differentiation of mammalian blood cell to B cells [5]; miR-375 regulated mammalian islet cell growth and insulin secretion [6]; miR-143 played a role in adipocyte differentiation [7]; miR-196 was found to be involved in the formation of mammalian limbs [8]; and miR-1 was implicated in cardiac development [9]. [score:6]
[1 to 20 of 1 sentences]
79
[+] score: 6
The relative expression of selected miRNA candidates hsa-miR-26a, hsa-miR-124a, hsa-miR-143, hsa-miR-145, hsa-miR-342-3p, and hsa-miR-494 were validated by quantitative reverse transcription PCR (qRT-PCR) analysis using a higher number of animals. [score:3]
C [T]-values derived from 4 independent qRT-PCR experiments comparing the expression of miRNAs hsa-miR-26a, hsa-miR-124a, hsa-miR-143, hsa-miR-145, hsa-miR-342-3p, and hsa-miR-494 in BSE-infected vs. [score:3]
[1 to 20 of 2 sentences]
80
[+] score: 6
Expression of miR-143 and miR-802 is upregulated in the liver of obese mice and impairs glucose metabolism [48]. [score:6]
[1 to 20 of 1 sentences]
81
[+] score: 6
The downregulation of miR-143 and miR-146b has been shown in all types of prostate tumors, which is consistent with our results [31]. [score:4]
In this research, we found 39 microRNAs that were dysregulated after the treatment of morin including miR-143, miR-146b, and miR-155. [score:2]
[1 to 20 of 2 sentences]
82
[+] score: 6
Interestingly, Osbpl8 was recently found to be target of miR-143, a micro -RNA induced in the liver in genetic and dietary mouse mo dels of obesity, and the hepatic ORP8 protein was shown to be down-regulated under these conditions [13]. [score:6]
[1 to 20 of 1 sentences]
83
[+] score: 6
In our in vivo study, the expression of miRNAs targeting Ras (let-7f, miR-135b, miR-143, miR-466h, miR-470, and miR-487b) was regulated in the lung of metformin -treated mice, along with another miRNA (miR-376c) playing an antioxidant role. [score:6]
[1 to 20 of 1 sentences]
84
[+] score: 6
Likewise, mmu-mir-21, mmu-mir-125b, mmu-mir-16b, mmu-mir-143 and mmu-mir-199a-3p were expressed abundantly in all libraries despite of changes in expression with development thus suggesting its role in basic reproductive activities. [score:6]
[1 to 20 of 1 sentences]
85
[+] score: 6
Other miRNAs from this paper: mmu-mir-145a, hsa-mir-143, hsa-mir-145, mmu-mir-145b
Other targets of p53 are caldesmon, a negative regulator of Src -induced podosome formation and ECM degradation [19], and microRNAs (miR-143/miR-145) that target key pathways leading to podosome formation [18]. [score:6]
[1 to 20 of 1 sentences]
86
[+] score: 5
Other miRNAs from this paper: mmu-mir-145a, mmu-mir-21a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c
Activated Ras can suppress miR-143/145 cluster transcription through Ras-responsive element -binding protein (RREB1), which represses the miR-143/145 promoter [22]. [score:3]
Hatley and colleagues have reported that miR-21 increases RAS signaling activity and therefore leads to repression of the miR-143/145 cluster [23]. [score:1]
p53 can induce its transcription and enhance the post-transcriptional maturation of miR-143/miR-145 cluster [15, 20] in response to DNA damage by interacting with the Drosha processing complex [21]. [score:1]
[1 to 20 of 3 sentences]
87
[+] score: 5
To select an effective micro RNA target for our glioma-specific oncolytic virus, we studied miR124, miR143 and miR145 expression profiles in a panel of different human tissues and found that the miRNA 124 level is significantly higher in human brain tissue (Figure 3A). [score:5]
[1 to 20 of 1 sentences]
88
[+] score: 5
Similar effects for hsa-miR143/145 in regulating MDM2 have been reported (Zhang et al., 2013). [score:2]
Loss of microRNA-143/145 disturbs cellular growth and apoptosis of human epithelial cancers by impairing the MDM2-p53 feedback loop. [score:1]
In prostate cancer, hsa-miR-143 was shown to interfere with ERK5 signaling (Clapé et al., 2009). [score:1]
miR-143 interferes with ERK5 signaling, and abrogates prostate cancer progression in mice. [score:1]
[1 to 20 of 4 sentences]
89
[+] score: 5
The top 5 high expression value miRNAs were miR-709, miR-29a, miR-210, miR-810 and miR-143; miR-709 was the most highly expressed with a copy number of 23,676 per cell. [score:5]
[1 to 20 of 1 sentences]
90
[+] score: 5
The miR-143/145 cluster has also been implicated in tumorgenesis of various types of carcinoma by suppressing the RAS, c-Myc, and human telomerase (hTERT) signaling pathways [81], [82]. [score:3]
These miRNAs include miR-135, miR-143/145, miR-189, and miR-204. [score:1]
One miRNA worthy of mention is the miR-143/145 cluster. [score:1]
[1 to 20 of 3 sentences]
91
[+] score: 5
MACC-1 could be targeted by miR-143 to inhibit cell invasion and migration in colorectal cancer [14]. [score:5]
[1 to 20 of 1 sentences]
92
[+] score: 5
Five out of the 35 DEMs in the network have targets involved in all four of the pathophysiological processes (miR-238-3p, miR-149-5p, miR-143-3p, miR-145-5p and miR-486-5p); an additional six DEMs target genes involved in three of the four processes (miR-138-5p, miR-9-5p, miR-26a-5pmiR-185-5p, miR-200b-3p and miR-335-5p). [score:5]
[1 to 20 of 1 sentences]
93
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
This spatial pattern of expression closely mirrors that of miR-23a, miR-143, and miR-150, all of which putatively target the Hoxa11 mRNA. [score:5]
[1 to 20 of 1 sentences]
94
[+] score: 5
Manikandan M. Deva Magendhra Rao A. K. Arunkumar G. Rajkumar K. S. Rajaraman R. Munirajan A. K. Down Regulation of miR-34a and miR-143 May Indirectly Inhibit p53 in Oral Squamous Cell Carcinoma: a Pilot Study Asian Pac. [score:5]
[1 to 20 of 1 sentences]
95
[+] score: 5
Only 15 miRNAs from the 64 DEMs had validated target genes in IPA by target filter analysis, including miR-6349, miR-101a-3p, miR-6394, miR-126a-3p, miR-721, miR-143-3p, miR-497a-5p, miR-93-5p, miR-215-5p, miR-199a-3p, miR-23a-3p, miR-27b-3p, miR-2861, miR-30a-5p, and miR-370-3p. [score:5]
[1 to 20 of 1 sentences]
96
[+] score: 5
Another example of a miRNA showing differential expression patterns in the adipose of obese mice is miR-143. [score:3]
The differences could be due to genetic background or different responses of miR-143 in different fat depots. [score:1]
These results help resolve discrepancies in the literature where miR-143 has been shown to be unchanged [15], decrease [6], or increased [16] in parallel with obesity. [score:1]
[1 to 20 of 3 sentences]
97
[+] score: 5
Spatial and temporal regulation of versican expression is regulated by very diverse pathways, such as the canonical Wnt/β-catenin signaling [29, 30], androgen receptor signaling [31], transcription factor AP-1 [30], microRNA miR-143 [32], and others (reviewed in [33]). [score:5]
[1 to 20 of 1 sentences]
98
[+] score: 5
However, although TLR2 is targeted by several human miRNAs including miR-105, miR-19, miR-1225-5p, miR-143 and miR-154 in a variety of cell types [38– 42], no viral miRNA has been shown to target TLR2—until now. [score:5]
[1 to 20 of 1 sentences]
99
[+] score: 5
A total of 11 miRNAs, let-7, miR-9, miR-206, miR-138, miR-133, miR-152, miR-137, miR-128, miR-143, miR-27b and miR-218 were co-expressed by 18 synaptic transmission target genes (Table S6). [score:5]
[1 to 20 of 1 sentences]
100
[+] score: 4
Among the miRNAs strongly down-regulated at all tested times were miR-199b-5p (decreased 70-fold), miR-214 (decreased 37-fold), and miR-143 (decreased 13-fold), known to promote differentiation of ESCs, neuroblasts, and smooth muscle progenitors, respectively [46], [47]. [score:4]
[1 to 20 of 1 sentences]