sort by

272 publications mentioning hsa-mir-10a (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-10a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 433
Thus, we did not detect any elevated target gene expression by miR-10a knockdown; however, target gene expression was downregulated by miR-10a mimic transfection because these genes bear a miR-10a binding site. [score:13]
Its expression was highly upregulated at 48 hours while KLF4 and MAP3K7 were significantly upregulated at 30 hours after miR-10a inhibitor transfection (Fig.   6). [score:11]
Furthermore, anti-dsDNA antibodies downregulated miR-10a expression, which induces various target genes resulting in HMC proliferation and IL8 gene expression (Fig.   8). [score:10]
In contrast, gene expression in miR-10a mimic transfectants showed significant downregulation of most genes, of which included CREB1, PIK3CA, and MAP4K4 at 24 hours after transfection (Fig.   6), whereas NFAT5 and SMAD2 showed a non-significant downregulation. [score:9]
For example, a previous study in a mouse mo del of autoimmune inflammatory bowel disease showed that downregulated miR-10a in dendritic cells resulted in the upregulation of IL-12/IL-23p40 [37]. [score:9]
Figure 6The kinetic expression of potential miR-10a target genes in miR-10a transient knockdown or miR-10a overexpressing human mesangial cells. [score:8]
Surprisingly, miR-10a knockdown HMCs slightly upregulated NFAT5 at 24 hours whereas other genes (CREB1, MAP4K4, PIK3CA, and SMAD2) were not significantly upregulated. [score:8]
miR-10a is downregulated in kidney biopsies isolated from LN patients and promote HMC proliferations in vitroIn the likely manner with qPCR, the expression of miR-10a in kidney biopsies from class III and IV LN patients (n = 26) were downregulated compared with cadaveric donor kidneys (n = 6) (Fig.   5A). [score:8]
Real-Time PCR results confirmed that only IL8 was upregulated in miR-10a knockdown cells, whereas MMP10 was slightly, but non-significantly upregulated (Fig.   7B). [score:8]
Transcriptomic profiling of miR-10a knockdown HMCs indicates IL8 is a novel targetFurther analysis to identify novel miR-10a target genes in HMCs was conducted using transcriptomic profiling in miR-10a inhibitor -transfected HMCs. [score:8]
It should be noted that the miR-10a expression increased to 30–50% at 48 and 72 hours after miR-10a inhibitor transfection whereas the miR-10a mimic transfection showed a consistent overexpression of miR-10a from 24 to 72 hours. [score:7]
An important finding in this study is that downregulation of miR-10a upregulates IL8. [score:7]
Unexpectedly, TNFA was significantly upregulated in miR-10a knockdown HMCs, but there was no effect on IL6 and IL1B expression (Fig.   6). [score:7]
However, in LN patients with mixed proliferative LN (MPLN; the proliferative LN co-exist with membranous LN, class III + V or IV + V), the miR-10a expression was not significantly downregulated. [score:6]
Lastly, we identified 81 predicted miR-10a/b target genes that were downregulated in HMCs treated with anti-dsDNA IgG antibodies (Supplementary Table  5). [score:6]
Consistently, miR-10a overexpression significantly downregulated IL8 at 48 hours after transfection (Fig.   7B). [score:6]
However, the expression of IL6 was significantly downregulated after miR-10a mimic transfection at 48 hours. [score:6]
As mentioned previously, NFAT5 was slightly upregulated upon miR-10a inhibitor transfection. [score:6]
Moreover, the kinetic expression of miR-10a target genes shows dynamic miR-10a regulatory function. [score:6]
The qPCR results confirmed that miR-10a/b, miR-30a and let-7a were significantly downregulated, while miR-654 was significantly upregulated in HMCs upon anti-dsDNA IgG antibody stimulation compared to IgG control. [score:6]
This finding was strengthening by the fact that miR-10a expression was significantly downregulated in kidney biopsies from LN patients with severe mesangial cell proliferation (proliferative LN; PLN, class III and IV). [score:6]
The current study suggested that anti-dsDNA IgG antibodies disrupted cell proliferation and cytokine production in HMCs, partly by downregulating miR-10a expression. [score:6]
As for microarray results, we unexpectedly detect only two genes which were significantly upregulated after miR-10a inhibitor transfection for 24 hours. [score:6]
To confirm that IL8 mRNA is a direct target of miR-10a, we used a pmiR-Glo plasmid that contained the 3′UTR of IL8 and co -transfected it with a miR-10a mimic, miR-10a inhibitor, or scramble negative control compared with the parent pmiR-Glo plasmid. [score:5]
Although miR-10a expression is not kidney-specific, it is predominantly expressed in mouse and human kidneys [40]. [score:5]
Using integrative analysis between predicted target genes for specific microRNA and total RNA profiling from the same condition, the important significant pathway revealed from miR-10a target genes in HMCs is the WNT signalling pathway. [score:5]
We performed integrative analysis between mRNA profile with putative target genes of miR-10a, miR-10b (noted that they have similar seed region and target genes), let-7a, miR-30a and miR-654. [score:5]
Upon LPS stimulation, the effects of miR-10a inhibitor and miR-10a overexpression was enhanced (Fig.   5B). [score:5]
Differentially expressed gene (DEG) analysis revealed 1264 genes were altered after miR-10a inhibitor transfection (raw p-value < 0.05). [score:5]
Graphs show the correlation between miR-10a expression and disease severity determined by urine protein creatinine index (UPCI) [a] (Middle) or creatinine clearance (CCr) [b] (Right). [score:5]
Furthermore, direct mutation at 3′UTR of IL8 which is a seed region of miR-10a abrogated the effects observed from transfection of both miR-10a inhibitor and its mimic (Fig.   7D). [score:5]
In the likely manner with qPCR, the expression of miR-10a in kidney biopsies from class III and IV LN patients (n = 26) were downregulated compared with cadaveric donor kidneys (n = 6) (Fig.   5A). [score:5]
Figure 5The miR-10a expression in kidney biopsy from LN patients and the effect of miR-10a inhibitor or miR-10a mimic transfection in human mesangial cell proliferation. [score:5]
Further analysis to identify novel miR-10a target genes in HMCs was conducted using transcriptomic profiling in miR-10a inhibitor -transfected HMCs. [score:5]
miR-10a is downregulated in kidney biopsies isolated from LN patients and promote HMC proliferations in vitro. [score:4]
We therefore hypothesised that the downregulation of miR-10a might result in HMC over expansion. [score:4]
This indicated that miR-10a directly controls IL8, but not NFAT5, expression. [score:4]
This suggested that IL8 is a novel direct target gene of miR-10a. [score:4]
We therefore suspect that NFAT5 is a direct target of miR-10a. [score:4]
Although miR-10a and miR-10b showed similar expression patterns, miR-10b is predominantly shown to control cell metastasis and cell proliferation while miR-10a is a regulator of various inflammation processes [36]. [score:4]
At 24 hours after mimic transfection, the miR-10a overexpression was greater than 100% but was less than 5% after miR-10a inhibitor transfection compared to scramble controls (Fig.   5B). [score:4]
The miR-10a was significantly downregulated in HMCs in the presence of anti-dsDNA IgG as well as in kidney biopsies of LN patients. [score:4]
The previous experiment showed downregulated miR-10a promoted myeloid cells hyperproliferation [21]. [score:4]
Hence, we hypothesized that downregulated miR-10a by anti-dsDNA IgG antibodies might be an important contributing factor to LN pathogenesis. [score:4]
Figure 7Transcriptomic profiling after miR-10a transient knockdown indicates IL8 is a miR-10a target. [score:4]
Studies in rheumatoid arthritis also indicated that TNF-α and IL-1β stimulation of fibroblast-like synoviocytes (FLSs) also downregulated miR-10a via an NF-κB dependent mechanism by inducing YY1 transcription factor [38]. [score:4]
The miR-10a is downregulated and enhances cell proliferation or apoptosis through HOXA1, KLF4, and CREB1. [score:4]
Taken together, these results suggest that the miR-10a downregulation is involved in HMC proliferation, possibly mediated by HOXA1, KLF4 and MAP3K7. [score:4]
We next tested whether miR-10a knockdown might affect pro-inflammatory cytokine gene expression. [score:4]
Transcriptomic profiling of miR-10a knockdown HMCs indicates IL8 is a novel target. [score:4]
IL8 or CXCL8 are putative direct targets of miR-10a. [score:4]
There were 4 miRNAs, miR-10a, miR-10b, miR-30a, miR-let-7a that were significantly downregulated by qPCR. [score:4]
Because one miRNA is capable of regulating many key phenotypes of HMC, which are important in LN pathogenesis, the manipulation of key miRNA including miR-10a might be a potential target for therapy. [score:4]
Apart from miR-10a that we fully validated, let-7a and miR-30a were another 2 downregulated miRNAs in HMCs upon stimulation with anti-dsDNA IgG antibodies that were interesting and needed further validation. [score:4]
In this study, we particularly focused entirely on miR-10a/b, which were the first 2 miRNAs that were significantly downregulated with the highest fold change difference. [score:4]
Since the upregulation of genes in the WNT signalling pathway usually results in increased cell proliferation and differentiation [20], we hypothesized that miR-10a/b might have an important role in HMCs activated by anti-dsDNA IgG antibodies. [score:4]
This suggested that anti-dsDNA IgG antibodies promote HMCs expansion by downregulating miR-10a. [score:4]
miR-10a is linked to pathogenesis of autoimmune diseases and inflammatory cytokine regulation. [score:4]
As expected, the miR-10a inhibitor transfection increased HMC proliferation significantly (Fig.   5B). [score:3]
The log (10) transform was applied to show transfection efficiency in miR-10a overexpression. [score:3]
Human mesangial cells (HMCs) were transfected with miR-10a inhibitor (▲), miR-10a mimic (▼) or scramble negative controls (●) using Lipofectamine RNAiMAX (siRNA concentration = 5 pmol). [score:3]
For LPS stimulation, the cells were transfected with miR-10a inhibitor, miR-10a mimic and scramble for 24 hours. [score:3]
Furthermore, the IL8 gene was identified as a new target of miR-10a in mesangial cells. [score:3]
In this study, we also demonstrated miR-10a downregulation in kidney biopsies from LN patients when compared with levels in cadaveric kidney donors. [score:3]
Therefore, we further validate miR-10a expression in kidney biopsy and characterized target genes of miR-10a in HMCs. [score:3]
Luciferase assays confirmed IL8 as a direct target for miR-10a in HMCs. [score:3]
Luciferase activity in pmiR-Glo containing the 3′UTR of IL8 was dramatically decreased by miR-10a mimic transfection; in contrast, the activity was greatly increased by miR-10a inhibitor transfection (Fig.   7D). [score:3]
This was likely resulted from decreased efficiency of transient inhibitor transfection rather than the induction of miR-10a since the level of miR-10a was stable over time in the scramble controls (data not shown). [score:3]
The HMCs were transfected with a miR-10a inhibitor, miR-10a mimic and scramble controls using Lipofectamine RNAiMax (oligonucleotides 5 pmol: RNAiMax 1.5 µL/well) (Thermo Fisher Scientific) for 24, 48 and 72 hours. [score:3]
miR-10a mimic transfection exhibited the opposite result for HOXA1 expression. [score:3]
There was no significant correlation between miR-10a expression and urine protein (UPCI) or creatinine clearances (CCr) (Fig.   5A). [score:3]
HMCs were transiently transfected with a miR-10a inhibitor and a miR-10a mimic for 24, 48 and 72 hours. [score:3]
We selected previous target genes of miR-10a for validation by real-time PCR. [score:3]
Using a similar process, we found no reduction or implementation of luciferase activity upon either miR-10a mimic or miR-10a inhibitor transfection (Fig.   7D). [score:3]
Using target predicted bioinformatics, we showed that miR-10a conserved seed regions bound complementarily to the 3′UTR of IL8 (mfe = −23.1, mirSVR score = −0.1843, PhastCons score = 0.6004, Fig.   7C). [score:3]
These genes contain a conserved region for the miR-10a binding site in their 3ʹUTR as determined by TargetScan version 7 (released August 2015) with a high confidence score. [score:3]
pmirGlo containing the 3′UTR of IL8 or the 3′ of NFAT5 was co -transfected with miR-10a inhibitor, miR-10a mimic or scramble sequences for 48 hours using Lipofectamine 2000 (DNA 500 ng: 15 pmol RNA: Lipofectamine 2.5 µL/24 wells) (Thermo Fisher Scientific). [score:3]
This represents the remaining percentage of miR-10a expression. [score:3]
Interestingly, the KEGG-pathway analysis showed that miR-10a/b target genes in HMCs were present significantly in the WNT-signalling, similarly to microarray results of HMCs treated with anti-dsDNA IgG autoantibodies (Fig.   4A). [score:3]
Furthermore, an ischemic-reperfusion kidney injury mouse mo del showed marked decrease in miR-10a expression in the kidney, which was later identified as an acute kidney trauma marker [39]. [score:3]
The miR-10a binding sites and binding capacity in the presence of the 3′UTR of IL8 and NFAT5 were predicted using TargetScan [57], miRanda [62] and RNAhybrid [63] (Fig.   7C). [score:3]
Validation of miR-10a target genes in HMCs. [score:3]
Regarding to the miR-10a transfection, experimental validated target genes including HOXA1, KLF4 and MAP3K7 were studied. [score:3]
It should be noted that the miR-10a knockout mice did not show any abnormal phenotypes [24]; however; carcinogen administration in those mice can promote intestinal neoplasia. [score:2]
The miR-10a/b is encoded in the HOX cluster (HOXB and HOXD) of developmental genes [31]. [score:2]
Unfortunately, we did not use any stimuli in our miR-10a knockdown microarray experiment. [score:2]
The microarray data from anti-dsDNA IgG antibody stimulated HMCs and transient knockdown of miR-10a in HMCs were deposited in the GEO database (repository numbers GSE80364 and GSE79574, respectively). [score:2]
However, the mechanism by which miR-10a regulate cell proliferation is still unknown. [score:2]
Moreover, the bioinformatics prediction showed that miR-10a bound directly to the 3′UTR of NFAT5. [score:2]
In this study, we were focusing on miR-10a due to its potential role to regulate different phenotypes of HMCs. [score:2]
We also conducted a luciferase assay for NFAT5, which is another potential novel target of miR-10a. [score:2]
This is interesting because it was consistent with a previous report in miR-10a knockout mice [24]. [score:2]
These results present the spatial and temporal regulation of miR-10a. [score:2]
The experiments to examine a clear molecular mechanism in which miR-10a regulate HMCs proliferation might be useful for further study. [score:2]
For, two sets of experiment were performed as the following: 1) RNA from pooled anti-dsDNA IgG antibody stimulated HMCs VS pooled IgG control stimulated HMCs (Noted that these were the same samples used in miRNA sequencing experiment, but triplicate samples per group were used in experiments) and 2) transient miR-10a knockdown HMCs VS scramble control (N = 3/group). [score:2]
However, the miR-10a expression was not significantly different in LN patients with mixed classes (class III + V (n = 8) or class IV + V (n = 8)) compared to control. [score:2]
Since WNT signalling pathways are important in cell development, proliferation and differentiation [20], we therefore hypothesize that miR-10a is crucial in the HMC propagation. [score:2]
Proliferation assays confirmed that miR-10a regulated HMC proliferation in both conditions (LPS stimulation or unstimulated). [score:1]
Based on integrative analysis, miR-10a was predicted to control SMAD2, CREB1, PIK3CA, MAP4K4, and NFAT5 which were crucial for generating extracellular matrix, responses to stress activation, and inflammatory responses (Supplementary Table  5). [score:1]
The target genes of miR-10a in HMC were investigated. [score:1]
In this study, we focused mainly on miR-10a. [score:1]
In addition, miR-10a and miR-10b were the most abundant microRNA present in HMCs. [score:1]
In order to examine the role of miR-10a under stimulatory condition, LPS was used to stimulate HMCs. [score:1]
[1 to 20 of 103 sentences]
2
[+] score: 397
To build up the direct link between the activation of Akt and increased cell survival, we used an inhibitor (Akt Inhibitor VI) to inhibit the phosphorylation (activation) of Akt in the miR-10a -overexpressed old hBM-MSCs (O-10a-P-AKT Inh; Additional file  9: Figure S8A). [score:10]
Furthermore, inhibition of miR-10a target gene KLF4 also increased both cell survival and the antiapoptotic-related protein expression while it decreased cellular apoptosis and the proapoptosis-related protein expression. [score:9]
Expression of Akt phosphorylation in miR-10a -overexpressed old hBM-MSCs (O-10a) inhibited by Akt Inhibitor VI during 72-h culture under hypoxia conditions. [score:9]
In addition, we found that miR-10a overexpression or KLF4 downregulation increased VEGF and SDF expression and secretion. [score:8]
Downregulation of miR-10a or overexpression of KLF4 in old hBM-MSCs increased apoptotic gene expression. [score:8]
Lentiviral vectors used to transduce old hBM-MSCs to downregulate miR-10a expression (O-anti10a) or overexpress KLF4 (O-KLF4). [score:8]
Angiogenesis and expression of angiogenic factors determined in mice that received implantation of control vector-transduced young hBM-MSCs (Y-c), control vector-transduced old hBM-MSCs (O-c), miR-10a -overexpressed old hBM-MSCs (O-10a), or KLF4 -inhibited old hBM-MSCs (O-antiKLF4) into border region immediately following MI. [score:7]
miR-10a upregulation or KLF4 downregulation increased old hBM-MSC survival and decreased apoptosis by activating AKT. [score:7]
To inhibit Akt phosphorylation in the miR-10a -overexpressed old hBM-MSCs, 50 μM Akt Inhibitor VI (catalog number 124013; Merck) was used to treat the cells for 72 h under hypoxia conditions following the manufacturer’s instructions. [score:7]
Through lentivirus -mediated upregulation of miR-10a and downregulation of KLF4 in aged hBM-MSCs in vitro, we revealed that miR-10a decreased hypoxia -induced cell apoptosis and increased cell survival of aged hBM-MSCs by repressing the KLF4–BAX/BCL2 pathway. [score:7]
miR-10a -overexpressed or KLF4 -downregulated old hBM-MSCs (3 × 10 [5] cells/mouse) implanted into infarcted mouse hearts. [score:6]
Fig. 6Implantation of miR-10a -overexpressed or KLF4 -downregulated old hBM-MSCs into ischemic area of mouse hearts improved cardiac function after MI. [score:6]
However, overexpression of miR-10a (O-10a) or inhibition of KLF4 (O-antiKLF4) increased VEGF and SDF mRNA (Additional file  10: Figure S9B) and protein expression compared with that in O hBM-MSCs (Fig.   8g, h). [score:6]
In vivo, miR-10a -overexpressed or KLF4 -downregulated old hBM-MSCs were implanted into infarcted mouse hearts after myocardial infarction (MI). [score:6]
Fig. 4Downregulation of miR-10a or overexpression of KLF4 in old hBM-MSCs increased hypoxia -induced apoptosis and decreased cell survival. [score:6]
Transplantation of miR-10a -overexpressed or KLF4 -downregulated old hBM-MSCs activated AKT and stimulated angiogenesis in the ischemic hearts, thereby improving cardiac function. [score:6]
miR-10a -overexpressed or KLF4 -downregulated hBM-MSCs increased angiogenesis in infarcted mouse hearts. [score:6]
DAPI 4′,6-diamidino-2-phenylindole, TUNEL terminal deoxynucleotidyl transferase dUTP nick end labeling, RFU relative fluorescence units KLF4 is one of the targets of miR-10a and was upregulated in O hBM-MSCs. [score:6]
Our data show that miR-10a overexpression or KLF4 downregulation activated AKT both in aged hBM-MSCs and in ischemic mouse hearts. [score:6]
Lentivirus which carries KLF4 vector used to infect miR-10a -upregulated old hBM-MSCs (O-10a) to restore KLF4 expression (O-10a-KLF4). [score:6]
The molecular mechanism study revealed that transplantation of miR-10a -overexpressed or KLF4 -downregulated O hBM-MSCs activated AKT in infarcted mouse hearts, which led to increased survival of implanted cells. [score:6]
DAPI 4′,6-diamidino-2-phenylindole, KLF4 Krüpple-like factor 4, TUNEL terminal deoxynucleotidyl transferase dUTP nick end labeling, RFU relative fluorescence units To further confirm that KLF4 is indeed the direct target of miR-10a in mediating hypoxia -induced O hBM-MSC apoptosis, KLF4 expression was restored by a rescue experiment (Additional file  3: Figure S2E). [score:6]
However, overexpression of miR-10a (O-10a) or inhibition of KLF4 expression (O-antiKLF4) increased cell survival but decreased cell apoptosis when compared with the group receiving O hBM-MSCs (O-c). [score:6]
Implantation of miR-10a -overexpressed or KLF4 -downregulated old hBM-MSCs into infarcted mouse hearts improved cardiac function after MI. [score:6]
In the present study, miR-10a was overexpressed or KLF4 was downregulated in old hBM-MSCs by lentiviral transduction. [score:6]
However, overexpression of miR-10a (O-10a) or inhibition of KLF4 e (O-antiKLF4) increased VEGF and SDF mRNA and protein expression when compared with the O-c group (Fig.   8e, f). [score:6]
Downregulation of miR-10a or overexpression of KLF4 in old hBM-MSCs increased hypoxia -induced apoptosis and decreased cell survival. [score:6]
For this purpose, miR-10a -overexpressed O hBM-MSCs were transduced with a lentivirus which carried the KLF4 vector and the restoration of KLF4 expression was confirmed (O-10a-KLF4). [score:5]
Cell survival and biochemical changes determined in mice that received implantation of control vector-transduced young hBM-MSCs (Y-c), control vector-transduced old hBM-MSCs (O-c), miR-10a -overexpressed old hBM-MSCs (O-10a), or KLF4 -inhibited old hBM-MSCs (O-antiKLF4) into border region immediately following MI. [score:5]
Lentiviral constructs for overexpression of miR-10a (O-10a), KLF4 (O-KLF4), or inhibition of miR-10a and KLF4 (O-anti10a and O-antiKLF4) in hBM-MSCs were purchased from GenePharma as reported previously [7]. [score:5]
Overexpression of miR-10a in old hBM-MSCs decreased apoptotic gene expression. [score:5]
To test whether the reverse would post a detrimental effect, miR-10a was effectively inhibited in O hBM-MSCs (Additional file  3: Figure S2C) or KLF4 was overexpressed in O hBM-MSCs (Additional file  3: Figure S2D). [score:5]
Overexpression or inhibition of miR-10a or KLF4 in hBM-MSCs was achieved through lentiviral transduction. [score:5]
In the current study, we investigated whether upregulation of miR-10a or downregulation of KLF4 can rejuvenate aged hBM-MSCs and improve aged hBM-MSC survival when transplanted into ischemic mouse hearts. [score:5]
Cardiac function was determined by echocardiography in mice that received implantation of control medium (Media), control vector-transduced young hBM-MSCs (Y-c), control vector-transduced old hBM-MSCs (O-c), miR-10a -overexpressed old hBM-MSCs (O-10a), or KLF4 -inhibited old hBM-MSCs (O-antiKLF4) into the border region immediately following MI. [score:5]
Mechanistic studies revealed that overexpression of miR-10a in aged hBM-MSCs activated Akt and stimulated the expression of angiogenic factors, thus increasing angiogenesis in ischemic mouse hearts. [score:5]
Cardiac function determined by echocardiography in mice that received implantation of control medium (Media), control vector-transduced young hBM-MSCs (Y-c), control vector-transduced old hBM-MSCs (O-c), miR-10a -overexpressed old hBM-MSCs (O-10a), or KLF4 -inhibited old hBM-MSCs (O-antiKLF4) into border region immediately following MI. [score:5]
Accordingly, restoration of the miR-10a level in O hBM-MSCs increased the antiapoptotic-related protein expression and decreased the proapoptosis-related protein expression. [score:5]
They also found that downregulation of miR10a/10b in clonal cells interfered with cell proliferation and enhanced cell apoptosis by activating the NF-κB -dependent p53 pathway [13]. [score:4]
However, overexpression of miR-10a (O-10a) or inhibition of KLF4 (O-antiKLF4) increased capillary and arteriole formation when compared with the group receiving O hBM-MSC implantation only. [score:4]
To the contrary, the expression of KLF4, which was one of the targets of miR-10a, was significantly increased in O hBM-MSCs compared with Y hBM-MSCs (Fig.   1h). [score:4]
To the contrary, downregulation of miR-10a in aged hBM-MSCs increased hypoxia -induced apoptosis and decreased cell survival. [score:4]
The percentage of apoptotic cells (TUNEL [+]) was significantly higher in miR-10a -inhibited old hBM-MSCs (O-anti10a) and KLF4 -overexpressed old hBM-MSCs (O-KLF4) compared with the control vector-transduced old hBM-MSCs (O-c) that were cultured for 72 h under hypoxia conditions (Fig.   4a). [score:4]
Expression of miR-10a and KLF4 in old hBM-MSCs regulated by lentiviral vector. [score:4]
In addition, Bim, the proapoptotic factor, is directly targeted by miR-10a, resulting in repressing Casp9 which is a crucial factor in the apoptotic pathway [27]. [score:4]
Consistent with previous data, we also found that upregulation of miR-10a in aged hBM-MSCs decreased hypoxia -induced apoptosis and increased cell survival. [score:4]
Another study has also shown that miR-10a inhibited KLF4 and RB1-inducible coiled-coil 1(RB1CC1) regulated cell apoptosis in acute myeloid leukemia (AML) [14]. [score:4]
On the other hand, KLF4, one of the miR-10a target genes, has been reported to play a role in regulating cell apoptosis. [score:4]
Upregulation of miR-10a in old hBM-MSCs decreased hypoxia -induced apoptosis and increased cell survival. [score:4]
All of these data implied the possible link between the downregulation of miR-10a and the increased O hBM-MSC apoptosis. [score:4]
miR-10a -upregulated old hBM-MSCs (O-10a) also infected by the control lentivirus (O-10a-c). [score:4]
DAPI 4′,6-diamidino-2-phenylindole, KLF4 Krüpple-like factor 4, TUNEL terminal deoxynucleotidyl transferase dUTP nick end labeling, RFU relative fluorescence units To evaluate whether modifying miR-10a or KLF4 levels in O hBM-MSCs can maximize the beneficial effects of stem cell therapy, miR-10a -overexpressed or KLF4 -downregulated old hBM-MSCs were implanted into infarcted mouse hearts. [score:4]
In our previous paper, using a luciferase reporter assay, we reported that KLF4 is a direct target of miR-10a. [score:3]
DAPI 4′,6-diamidino-2-phenylindole, KLF4 Krüpple-like factor 4, TUNEL terminal deoxynucleotidyl transferase dUTP nick end labeling, RFU relative fluorescence units All of this evidence suggested that miR-10a, through suppression of KLF4, may rescue O hBM-MSCs from hypoxia -induced apoptosis. [score:3]
The percentage of apoptotic cells (TUNEL [+]) was decreased in miR-10a -upregulated O hBM-MSCs (O-10a) compared with the control vector-transduced O hBM-MSCs (O-c) that were cultured for 72 h under hypoxia conditions (Fig.   2a). [score:3]
miR-10a expression was significantly higher in O-10a than in control vector-transduced (O) hBM-MSCs (A). [score:3]
We also found that miR-10a increased differentiation and decrease senescence in old hBM-MSCs through the target gene Krüpple-like factor 4 (KLF4) [7]. [score:3]
Implantation of miR-10a -overexpressed old hBM-MSCs into the ischemic area of mouse hearts improved cell survival and cardiac function after MI. [score:3]
Previous studies have found that expression of miR10a/10b was controlled by TWIST-1 and via the NF-κB and P53 axis, to control TNF-α -induced (and stroma -dependent) apoptosis in clonal myeloid cells. [score:3]
After restoring the expression of KLF4, miR10a lost its antiapoptotic effect on O hBM-MSCs. [score:3]
miR-10a overexpression increased old hBM-MSC survival and decreased apoptosis by activating AKT. [score:3]
DAPI 4′,6-diamidino-2-phenylindole, hBM-MSC human mesenchymal stem cell, KLF4 Krüpple-like factor 4, MI myocardial infarction, SDF stromal cell-derived factor, VEGF vascular endothelial growth factor The present study demonstrated that restoring the miR-10a level in O hBM-MSCs increased cell survival and decreased apoptosis under in-vitro hypoxia and in-vivo ischemic conditions by repressing the expression of KLF4. [score:3]
All of this evidence led us to postulate that miR-10a may mitigate cellular apoptosis of aged hBM-MSCs through its target gene KLF4. [score:3]
miR-10a expression was significantly lower in O-anti10a than in control vector-transduced O hBM-MSCs (C). [score:3]
Our study demonstrated that miR-10a decreased aged hBM-MSC apoptosis and increased cell survival through suppression of KLF4. [score:3]
Furthermore, transplantation of miR-10a or anti-KLF4-pretreated O hBM-MSCs increased the expression and secretion of angiogenic factors VEGF and SDF, which increased angiogenesis in infarcted mouse hearts. [score:3]
Fig. 2Overexpression of miR-10a in old hBM-MSCs decreased hypoxia -induced apoptosis and increased cell survival. [score:3]
Overexpression of miR-10a in both young and old hBM-MSCs decreased hypoxia -induced apoptosis and increased cell survival. [score:3]
We also examined the effects of miR-10a on Y hBM-MSCs and found that cell apoptosis was decreased (Additional file  5: Figure S4A) and cell survival (Additional file  5: Figure S4B) was increased in miR-10a -upregulated Y hBM-MSCs (Y-10a) compared with the control vector-transduced Y hBM-MSCs (Y-c). [score:3]
Therefore, the TWIST-1/miR10/p53 axis can serve as a potential new target for therapeutic interventions in advanced myelodysplastic syndromes [13]. [score:3]
In vivo, transplantation of miR-10a -overexpressed aged hBM-MSCs promoted implanted stem cell survival and improved cardiac function after MI. [score:3]
Indeed, some studies have shown that miR-10a and KLF4 regulate cell apoptosis in other cell types [13, 14]. [score:2]
The expression of miR-10a was significantly decreased in O hBM-MSCs compared with Y hBM-MSCs (Fig.   1g). [score:2]
On the other hand, knockdown of miR-10a in the NPM1 mutated cell line OCI-AML3 decreased cellular survival and clonogenic growth [14]. [score:2]
DAPI 4′,6-diamidino-2-phenylindole, hBM-MSC human mesenchymal stem cell, KLF4 Krüpple-like factor 4, MI myocardial infarction, TUNEL terminal deoxynucleotidyl transferase dUTP nick end labeling To determine whether angiogenesis is also affected by regulating the miR-10a or KLF4 level in O hBM-MSCs, capillary and arteriole densities were quantified by isolectin stain (Fig.   8a, b) and α-smooth muscle actin (α-SMA) stain (Fig.   8c, d) respectively in all four experimental groups at 3 and 7 days post MI. [score:2]
We speculated that miR10a may also have additional effects related to cellular apoptosis and survival to regulate aged hBM-MSC function. [score:2]
Expression of (g) miR-10a and (h) KLF4 compared in Y and O hBM-MSCs. [score:2]
However, other studies have suggested that miR-10a may have additional effects other than regulating cell senescence and differentiation. [score:2]
miR-10a is also reported to regulate cell apoptosis in the human cumulus–oocytes complex [26]. [score:2]
All of these data clearly demonstrated that modifying the miR-10a or KLF4 level in O hBM-MSCs enhanced the beneficial effects of stem cell therapy and further improved cardiac function. [score:1]
miR-10a delivered by exosomes sustains the number of chemotherapy-damaged granulosa cells and reduces the number of chemotherapy-damaged apoptotic granulosa cells following nitrogen mustard treatment for 24–48 h [28]. [score:1]
To determine whether KLF4 was involved in miR-10a -mediated cellular apoptosis, we effectively inhibited KLF4 in O hBM-MSCs (Additional file  3: Figure S2B) and evaluated cell apoptosis. [score:1]
Here, we have shown that restoring miR-10a in aged hBM-MSCs increased cell survival and decreased apoptosis when transplanted into the ischemic mouse hearts. [score:1]
We believe these results showed that miR-10a, through activating Akt, increased cell survival whereas inactivation of Akt reversed this effect. [score:1]
miR-10a has also been reported as a prosurvival factor. [score:1]
miR-10a rejuvenated aged hBM-MSCs which improved angiogenesis and cardiac function in injured mouse hearts. [score:1]
miR-10a and KLF4 -modified stem cells could be a potent vehicle to combine cell and gene therapies to improve heart function after injury. [score:1]
Fig. 5Antiapoptotic effect of miR-10a attenuated by restoration of KLF4. [score:1]
To evaluate the antiapoptotic effect of miR-10a in vivo, the survival of implanted cells was detected by lentiviral -mediated GFP expression in the border region of the mouse hearts at 3 days (Fig.   7a, b) and 7 days (Fig.   7c, d) post MI. [score:1]
miR-10a transduced into young (Y-10a) and old (O-10a) hBM-MSCs by lentiviral vector. [score:1]
Antiapoptotic effect of miR-10a attenuated by restoration of KLF4 quantified by RT-qPCR. [score:1]
miR-10a transduced into old hBM-MSCs by lentiviral vector (O-10a). [score:1]
We demonstrated previously that miR-10a is significantly decreased in aged hBM-MSCs and restoration of the miR-10a level attenuated cell senescence and increased the differentiation capacity of aged hBM-MSCs by repressing Krüpple-like factor 4 (KLF4). [score:1]
Our data suggested that miR-10a increased the survival of aged hBM-MSCs which in turn secreted more VEGF and SDF to stimulate angiogenesis in the infarcted hearts. [score:1]
The effect of miR-10a on cellular apoptosis has been reported recently. [score:1]
After culture for 72 h under hypoxia conditions, apoptosis was detected with the TUNEL assay (Additional file  9: Figure S8B) and cell survival was detected by CCK-8 assay in control vector-transduced (O-c), miR-10a -overexpressed (O-10a), and O-10a-P-AKT Inh old hBM-MSCs. [score:1]
We believe the antiapoptotic effect of miR-10a may be mediated through activation of AKT. [score:1]
Also, miR-10a decreased cell senescence in aged hBM-MSCs by repressing KLF4 [7]. [score:1]
The antiapoptotic effect of miR-10a is attenuated by the restoration of KLF4. [score:1]
All of these effects of miR-10a ultimately led to enhanced efficacy of stem cell therapy and the improvement of cardiac function after MI. [score:1]
Lentiviral vector carrying miR-10a sequence used to transduce old hBM-MSCs (O-10a) and control vector-transduced old hBM-MSCs (O-c) served as control. [score:1]
All of these findings support the notion that miR-10a is a prosurvival factor, which counteracts the apoptotic signals. [score:1]
In vivo, miR-10a -overexpressed hBM-MSCs were implanted into the border region of mouse hearts following myocardial infarction (MI), and cardiac function and related biological changes were investigated. [score:1]
The Lenti-miR-10a sequence was TACCCTGTAGATCCGAATTTGTG. [score:1]
Lentiviral vector carrying anti-miR-10a sequence used to transduce old hBM-MSCs (O-anti10a). [score:1]
Collectively, these data revealed that miR-10a, through activation of AKT, increased hBM-MSC survival, thus improving cardiac function. [score:1]
Our previous study found that miR-196a, miR-486-5p, miR-664-star, and miR-378-star were significantly increased whereas miR-10a, miR-708, and miR-3197 were decreased in old hBM-MSCs. [score:1]
The effects of miR-10a on Y hBM-MSC apoptosis and survival followed the same trend as in O hBM-MSCs but at a much lower magnitude. [score:1]
DAPI 4′,6-diamidino-2-phenylindole, KLF4 Krüpple-like factor 4, TUNEL terminal deoxynucleotidyl transferase dUTP nick end labeling, RQ relative quantity, RFU relative fluorescence units Next, to further test whether miR-10a was related to O hBM-MSC apoptosis, miR-10a was overexpressed in O hBM-MSCs (Additional file  3: Figure S2A) and cellular apoptosis was evaluated. [score:1]
These findings suggested that restoring the miR-10a level reduced hypoxia -induced apoptosis in O hBM-MSCs. [score:1]
[1 to 20 of 110 sentences]
3
[+] score: 348
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-183, hsa-mir-137
a Luciferase reporter constructs containing downstream wild-type (WT) and mutated (MUT) binding sequences in TFAP2C; b the luciferase activity of the WT and MUT groups suggests that TFAP2C is a direct target of miR-10a-5p; c miR-10a-5p did not change the TFAP2C mRNA levels in the AsPC-1 cell line; d miR-10a-5p expression up-regulation decreased the TFAP2C protein level in the AsPC-1 cell line; e miR-10a-5p expression did not change the TFAP2C mRNA levels in the T3M4 and Su86.86 cell lines; f miR-10a-5p expression up-regulation decreased the TFAP2C protein level in the T3M4 and Su86.86 cell lines; g TFAP2C expression up-regulation in AsPC-1 cells stably overexpressing miR-10a-5p significantly increased gemcitabine chemosensitivity; h TFAP2C expression up-regulation in AsPC-1 cells stably overexpressing mimics control also significantly increased gemcitabine chemosensitivity; i TFAP2C expression up-regulation in AsPC-1 cells stably overexpressing miR-10a-5p significantly increased gemcitabine -induced cell apoptosis; j TFAP2C up-regulation in AsPC-1 cells stably overexpressing mimics control significantly increased gemcitabine -induced cell apoptosis. [score:42]
a MiR-10a-5p overexpression promoted T3M4 and AsPC-1 cell migration, while miR-10a-5p knockdown decreased Su86.86 and AsPC-1 cell migration; b miR-10a-5p overexpression promoted T3M4 and AsPC-1 cell invasion, while miR-10a-5p knockdown decreased Su86.86 and AsPC-1 cell invasion; c miR-10a-5p expression up-regulation decreased E-cadherin and Caudin-1 protein levels while increasing Vimentin, Slug and Snail levels, as determined by using western blotting. [score:12]
The pmirGLO dual luciferase miRNA target expression vector (Promega, E1330) was used to assess miR-10a-5p regulation of miRNA target sites. [score:8]
a MiR-10a-5p was significantly up-regulated in AsPC-1-Gem cells (AsPC-1/GR), as determined using quantitative RT–PCR; b transient and stable miR-10a-5p transfection efficiency in the AsPC-1 cell line; c miR-10a-5p mimics significantly increased gemcitabine resistance in AsPC-1 cells; d miR-10a-5p inhibitor significantly decreased gemcitabine resistance in AsPC-1 cells; e miR-10a-5p levels in six PDAC cell lines; f transfection efficiency of miR-10a-5p in T3M4 and Su86.86 cell lines; g miR-10a-5p mimics significantly increased gemcitabine resistance in T3M4 cells; h miR-10a-5p inhibitor significantly decreased gemcitabine resistance in Su86.86 cells; i pictures of tumors from nude mice 4 weeks after the gemcitabine treatment; j tumor growth in nude mice after the gemcitabine injections; k tumors with high miR-10a-5p levels were significantly larger than control tumors 4 weeks after treating with gemcitabine. [score:8]
d The relative intensity of the grayscale band values revealed the changes with miR-10a-5p overexpression or knockdown in PDAC cells; the data are presented as the means ± SD (Student’s t-test; *, P < 0.05) TFAP2C was predicted as a potential target of miR-10a-5p using the bioinformatics database (TargetScan; http://www. [score:8]
In NSCLC [8], miR-10a-5p expression is higher in highly metastatic cells rather than in weakly metastatic cells or normal tissues, as determined by miRNA expression microarray, and relative factor analysis reveals that high miR-10a-5p expression is associated with later lymph node (N) and metastasis (M) stages. [score:7]
Silencing miR-10a-5p in DDP-resistant cells increases cell chemosensitivity to DDP, induces cell apoptosis and up-regulates caspase 3/8 expression and activity [13]. [score:6]
The data revealed that the miR-10a-5p expression level was significantly up-regulated in the AsPC-1-Gem cells (Fig.   1a). [score:6]
Oligonucleotides/Primer Sequence (5′–3′) MiR-10a-5p mimics sense CAAAUUCGGAUCUACAGGGUAUU MiR-10a-5p mimics antisense UACCCUGUAGAUCCGAAUUUGUG Mimics control sense UUCUCCGAACGUGUCACGUTT Mimics control antisense UACCCUGUAGAUCCGAAUUUGUG MiR-10a-5p inhibitor CACAAAUUCGGAUCUACAGGGUA Inhibitor control CAGUACUUUUGUGUAGUACAA TFAP2C sense ATCTTGGAGGACGAAATGAGAT TFAP2C antisense CAGATGGCCTGGCTGCCAA GAPDH sense CGGAGTCAACGGATTTGGTCGTAT GAPDN antisense AGCCTTCTCCATGGTGGTGAAGAC To determine if miR-10a-5p is potentially associated with gemcitabine resistance in PDAC, we first performed quantitative RT–PCR to validate miR-10a-5p expression in the previously established gemcitabine-resistant PDAC cell line AsPC-1-Gem. [score:6]
In non-small cell lung cancer (NSCLC), in vitro experiments revealed that miR-10a-5p overexpression promoted NSCLC cell proliferation, migration and invasion by directly targeting PTEN [8]. [score:6]
As shown in Fig.   2a, compared with control AsPC-1 and T3M4 cells, the AsPC-1 and T3M4 cells with miR-10a-5p overexpression by mimics transfection presented with a significantly increased migration capacity, while miR-10a-5p knockdown by transfection inhibitors significantly decreased the number of migrated AsPC-1 and Su86.86 cells. [score:5]
Among the matched tumor-adjacent tissues, 56 presented with low miR-10a-5p expression, whereas 34 presented with high expression. [score:5]
We then tested the miR-10a-5p expression level in the six PDAC cell lines and found that T3M4 cells had the lowest expression level, while Su86.86 cells had the highest expression level (Fig. 1e); therefore, these two cell lines were chosen for further investigation (Fig. 1e and f). [score:5]
Finally, survival analysis revealed that high miR-10a-5p expression levels and low TFAP2C expression levels were both independent adverse prognostic indicators in patients with PDAC. [score:5]
Left pictures in each row are negative ISH controls; b the miR-10a-5p expression levels in 90 PDAC tissue samples and matched tumor-adjacent tissues were analyzed using the Pearson χ2 test; c Kaplan-Meier survival analysis revealed that a high miR-10a-5p expression level in tumors was significantly associated with reduced survival in patients with PDACWe assessed the correlation between miR-10a-5p levels and clinicopathological parameters (Table 1). [score:5]
Next, we confirmed that transcription factor activating protein 2 gamma (TFAP2C) is a target of miR-10a-5p, and TFAP2C overexpression resensitizes PDAC cells to gemcitabine, which is initiated by miR-10a-5p. [score:5]
Finally, survival analysis demonstrated that high miR-10a-5p expression levels and low TFAP2C expression levels were both independent adverse prognostic factors in patients with PDAC. [score:5]
Left pictures in each row are negative ISH controls; b the miR-10a-5p expression levels in 90 PDAC tissue samples and matched tumor-adjacent tissues were analyzed using the Pearson χ2 test; c Kaplan-Meier survival analysis revealed that a high miR-10a-5p expression level in tumors was significantly associated with reduced survival in patients with PDAC We assessed the correlation between miR-10a-5p levels and clinicopathological parameters (Table 1). [score:5]
We also demonstrated that high miR-10a-5p expression and low TFAP2C expression are significantly associated with poor prognosis in patients with PDAC. [score:5]
In breast cancer [12], one article reported that miR-10a-5p was significantly down-regulated in malignant cells compared with normal or benign glandular cells, indicating that miR-10a-5p might act as a tumor suppressor. [score:5]
As shown in Fig. 2c, miR-10a-5p overexpression in AsPC-1 and T3M4 cells increased the Vimentin, Slug and Snail levels, while the E-cadherin and Caudin-1 expression levels was decreased. [score:5]
Among the 90 PDAC samples, 35 samples presented with low miR-10a-5p expression, and 55 samples presented with high expression. [score:5]
We found that miR-10a-5p is up-regulated in gemcitabine-resistant PDAC cells and enhances PDAC cell gemcitabine resistance in vitro and vivo. [score:4]
However, miR-10a-5p up-regulation decreased the TFAP2C protein level in the AsPC-1 and T3M4 cell lines (Fig. 3d and f). [score:4]
We found that miR-10a-5p was significantly up-regulated in gemcitabine-resistant cells and promoted PDAC cell migration and invasion in vitro. [score:4]
We then found that miR-10a-5p was up-regulated in the gemcitabine-resistant PDAC cells AsPC-1-Gem and enhanced PDAC cells resistance to gemcitabine in vitro and vivo. [score:4]
Mechanistically, miR-10a-5p directly targeted TFAP2C to confer gemcitabine resistance. [score:4]
Next, we confirmed that TFAP2C is a direct target gene of miR-10a-5p. [score:4]
These results suggest that TFAP2C is a direct target of miR-10a-5p. [score:4]
In conclusion, we used quantitative RT–PCR to identify miR-10a-5p up-regulation in gemcitabine-resistant PDAC cell lines. [score:4]
In contrast, compared with cells transfected with inhibitor controls, PDAC cells transfected with miR-10a-5p inhibitors were more sensitive to gemcitabine (Fig. 1d and h). [score:4]
In addition, miR-10a-5p promoted the migratory and invasive ability of PDAC cells though up -regulating EMT-related gene expression. [score:4]
In the present study, we identified that miR-10a-5p was up-regulated in gemcitabine-resistant PDAC cells and found that miR-10a-5p enhanced PDAC cell resistance to gemcitabine in vitro and vivo. [score:4]
Previously, miR-10a-5p has been reported to be overexpressed and to act as an important mediator of metastasis formation in PDAC [5, 6]. [score:3]
The miRCURY LNA detection probe (18017-15; Exiqon, Vedbaek, Denmark) was used to detect the miR-10a-5p expression levels in tissue microarrays. [score:3]
Thus, all these results revealed that miR-10a-5p targets TFAP2C to increase gemcitabine resistance. [score:3]
As shown in Fig. 1c and g, the miR-10a-5p mimics transfection decreased the inhibition rate of PDAC cells, which meant that miR-10a-5p significantly increased cell gemcitabine resistance. [score:3]
Wang et al. [7] found that miR-10a-5p suppresses the miR-10a-EphA4 axis, promoting cell proliferation, invasion and EMT in hepatic cell cancer. [score:3]
Oligonucleotides/Primer Sequence (5′–3′) MiR-10a-5p mimics sense CAAAUUCGGAUCUACAGGGUAUU MiR-10a-5p mimics antisense UACCCUGUAGAUCCGAAUUUGUG Mimics control sense UUCUCCGAACGUGUCACGUTT Mimics control antisense UACCCUGUAGAUCCGAAUUUGUG MiR-10a-5p inhibitor CACAAAUUCGGAUCUACAGGGUA Inhibitor control CAGUACUUUUGUGUAGUACAA TFAP2C sense ATCTTGGAGGACGAAATGAGAT TFAP2C antisense CAGATGGCCTGGCTGCCAA GAPDH sense CGGAGTCAACGGATTTGGTCGTAT GAPDN antisense AGCCTTCTCCATGGTGGTGAAGAC The human pancreatic ductal adenocarcinoma (PDAC) cell lines AsPC-1, BxPC-3, MiaPaCa-2, PANC-1, Su86.86 and T3M4 cells were donated by Dr. [score:3]
To determine if miR-10a-5p is potentially associated with gemcitabine resistance in PDAC, we first performed quantitative RT–PCR to validate miR-10a-5p expression in the previously established gemcitabine-resistant PDAC cell line AsPC-1-Gem. [score:3]
To further determine the effects of miR-10a-5p on chemosensitivity in vivo, we established AsPC-1 cell lines that stably overexpressed miR-10a-5p, and we subcutaneously injected these cells into nude mice treated with gemcitabine (Fig. 1i). [score:3]
Li et al. [18] identified a relationship between the miR-10a-5p level and both disease-free survival and OS in gastric cancer. [score:3]
In cervical cancer [10], miR-10a-5p promotes cell colony formation, migration and invasion by targeting CHL1. [score:3]
Our study used ISH to reveal that miR-10a-5p is up-regulated in PDAC tissue samples compared with matched tumor-adjacent tissues. [score:3]
Previous studies have shown that microRNA-10a-5p (miR-10a-5p) is overexpressed in PDAC and acts as an oncogene to promote the metastatic behavior of PDAC cells. [score:3]
Univariate survival analysis indicated that miR-10a-5p expression levels, lymph node staging and TNM staging were the potential prognostic factors in PDAC (P = 0.020) (Fig. 5c). [score:3]
Together, these results indicate that miR-10a-5p/TFAP2C may be new therapeutic target and prognostic marker in PDAC. [score:3]
The above results demonstrated that miR-10a-5p targeted TFAP2C to promote gemcitabine resistance in PDAC, but the role of TFAP2C in PDAC remains unclear. [score:3]
Among these miRNAs, miR-10a-5p had a high expression level (≥ 5-fold change). [score:3]
Tissue samples were scored for high or low miR-10a-5p expression as described in Materials and. [score:3]
MiR-10a-5p has also been reported to be overexpressed in cancer cells compared with normal tissues [10, 15– 17] and to be up-regulated in metastatic [16] or recurrent [9] tumor cells compared with primary cancer cells. [score:3]
In contrast, miR-10a-5p inhibition induced the opposite effect in AsPC-1 and Su86.86 cell lines (Fig. 3d and f). [score:3]
MiR-10a-5p also enhances gemcitabine resistance in vitro and in vivo by directly targeting TFAP2C. [score:3]
Cells transfected with miR-10a-5p mimics, inhibitors or paired control oligonucleotides were transferred to the top of the upper chambers or to the ECM gel in the serum-free culture. [score:3]
Consistently, TFAP2C overexpression resensitized PDAC cells to gemcitabine, which was triggered by miR-10a-5p. [score:3]
Therefore, these results together indicate that miR-10a-5p/TFAP2C may be new therapeutic targets and prognostic markers in PDAC. [score:3]
The miR-10a-5p mimics, miR-10a-5p inhibitor and matched controls were synthesized by Genepharma (Shanghai, China). [score:3]
However, univariate and multivariate survival analysis both indicated that miR-10a-5p expression (high) is an independent adverse prognostic factor in PDAC. [score:3]
In this regard, our data indicated that miR-10a-5p/TFAP2C were valuable prognostic predictors of PDAC and appeared to be promising targets for PDAC therapy. [score:3]
Multivariate analysis demonstrated that miR-10a-5p expression (high) was an independent adverse prognostic factor (P = 0.000, hazard ratio [HR] = 2.878, 95% confidence interval [CI]: 1.614-5.131). [score:3]
However, in ER -positive breast cancer [14], Cox regression analysis revealed that increased miR-10a-5p expression is associated with a long relapse-free time following tamoxifen treatment. [score:3]
In addition, tumor weight was significantly increased in the PDAC cells overexpressing miR-10a-5p (Fig. 1k). [score:3]
MiR-10a-5p targets TFAP2C to increase gemcitabine resistance. [score:2]
To further determine the molecular mechanisms underlying the migratory and invasive properties of miR-10a-5p observed in the PDAC cells above, we used western blotting to investigate the expression levels of EMT-related genes potentially regulated by miR-10a-5p. [score:2]
In breast cancer [9], miR-10a-5p promotes cell migration, which is positively regulated by RUNX2. [score:2]
The CCK-8 assay was performed to detect the gemcitabine chemosensitivity of Lv-AsPC-1-miR-10a-5p and Lv-AsPC-1-NC cells overexpressing TFAP2C. [score:2]
The data are presented as the means ± SD (Student’s t-test; *, P < 0.05)To further confirm whether TFAP2C is regulated by miR-10a-5p, we used qRT–PCR and western blotting to verify the mRNA and protein level changes, respectively, in respect to changes in the miR-10a-5p level. [score:2]
Thus, we presumed that miR-10a-5p might be involved in drug resistance development in PDAC. [score:2]
The data are presented as the means ± SD (Student’s t-test; *, P < 0.05) To further confirm whether TFAP2C is regulated by miR-10a-5p, we used qRT–PCR and western blotting to verify the mRNA and protein level changes, respectively, in respect to changes in the miR-10a-5p level. [score:2]
By contrast, opposing effects were observed in AsPC-1 and Su86.86 cells with miR-10a-5p knockdown. [score:2]
a The miR-10a-5p expression level in 90 PDAC tissue samples and matched tumor-adjacent tissues evaluated by in situ hybridization (ISH). [score:1]
The data are presented as the means ± SD (Student’s t-test; *, P < 0.05) We next evaluated by ISH the miR-10a-5p expression levels in 90 PDAC tissue samples and matched tumor-adjacent tissue samples (Fig.   5a). [score:1]
It has been reported that miR-10a-5p plays varying but important roles in multiple cancers. [score:1]
We then investigated whether miR-10a-5p-enhanced gemcitabine resistance was dependent on TFAP2C expression. [score:1]
MiR-10a-5p expression was considered to be low if the final score was less than the median value and high if the final score was the median value or above. [score:1]
In gastric cancer, miR-10a-5p represses cell growth, migration and invasion through silencing HoxA1 [11]. [score:1]
In summary, these data indicated that miR-10a-5p promoted the migratory and invasive ability of PDAC cells. [score:1]
AsPC-1 cells stably transfected with miR-10a-5p lentiviral vectors or control (Lv-AsPC-1-miR-10a-5p or Lv-AsPC-1-NC) were injected subcutaneously into the right flank of 6-week-old female BALB/c mice (Shanghai, Chinese Academy of Sciences, China) (5 × 10 [6] cells in 250 μl of PBS per mouse). [score:1]
Our study was the first to investigate the differential miR-10a-5p expression in gemcitabine-resistant and parental cell lines. [score:1]
The Lv-AsPC-1-miR-10a-5p and Lv-AsPC-1-NC cells transfected with the TFAP2C vector were more sensitive to gemcitabine than the cells transfected with negative controls (Fig. 3g and h). [score:1]
Survival analysis demonstrated that a high miR-10a-5p level and low TFAP2C are both independent adverse prognostic factors in PDAC. [score:1]
We found no correlation between miR-10a-5p levels and clinicopathological parameters. [score:1]
Additional studies demonstrated that miR-10a-5p promotes PDAC cell migration and invasion. [score:1]
Thus, these results suggest that miR-10a-5p decreases gemcitabine -induced cytotoxicity in vitro and in vivo. [score:1]
Studies have shown that miR-10a-5p is associated with cisplatin (DDP) resistance in lung cancer. [score:1]
However, the role of miR-10a-5p in PDAC chemoresistance remains unclear. [score:1]
The results revealed that miR-10a-5p did not affect TFAP2C mRNA levels in AsPC-1, T3M4 and Su86.86 cells (Fig. 3c and e). [score:1]
Wild-type (WT) or mutant (MUT) miR-10a-5p binding site sequences in the 3’-UTR of TFAP2C were synthesized by Invitrogen and cloned into pmirGLO vectors at the 3′-end of the firefly luciferase gene. [score:1]
MiR-10a-5p expression was significantly increased in PDAC tissues compared with tumor-adjacent tissues (P = 0.003) (Fig. 5b). [score:1]
High miR-10a-5p level is associated with poor prognosis. [score:1]
The effects of miR-10a-5p on biological behaviors were analyzed. [score:1]
No correlation was observed between the miR-10a-5p levels and clinicopathological parameters. [score:1]
However, in other studies, miR-10a-5p acts very differently. [score:1]
Vectors and miR-10a-5p mimics or mimics controls were co -transfected into 293A cells with Lipofectamine 2000 reagent in 12-well plates. [score:1]
In addition, we also found that miR-10a-5p promoted the migratory and invasive ability of PDAC cells by activating the EMT signaling pathway. [score:1]
Regarding tumor chemosensitivity, miR-10a-5p also plays controversial roles. [score:1]
Meanwhile, we also determined that miR-10a-5p promotes the migratory and invasive ability of PDAC cells. [score:1]
The relative expression of miR-10a-5p and mRNAs was calculated through the 2 [-ΔΔCT] method. [score:1]
Further studies revealed that miR-10a-5p enhances gemcitabine resistance in vitro and vivo. [score:1]
miR-10a-5p TFAP2C PDAC Chemoresistance Prognosis Pancreatic ductal adenocarcinoma (PDAC) is the most deadly malignancy, with a overall survival rate of 7% 5 years after diagnosis [1]. [score:1]
However, the essential role and underlying mechanism of miR-10a-5p in PDAC chemoresistance remain unclear. [score:1]
The in vivo results revealed that in mice treated with gemcitabine, the tumors generated from the Lv-AsPC-1- miR-10a-5p cells grew significantly faster than from Lv-AsPC-1-NC (Fig. 1j). [score:1]
[1 to 20 of 102 sentences]
4
[+] score: 327
Other miRNAs from this paper: hsa-mir-10b, hsa-mir-193a, hsa-mir-200c, hsa-mir-429
Figure 4 A. PTEN was identified as potential regulatory target of miR-10a by considering the down-regulation genes from the gene expression profiles and using prediction tools, including TargetScan, miRWalk and miRanda. [score:11]
A. PTEN was identified as potential regulatory target of miR-10a by considering the down-regulation genes from the gene expression profiles and using prediction tools, including TargetScan, miRWalk and miRanda. [score:11]
These results suggest that miR-10a down-regulated PTEN expression by directly targeting its 3′UTR. [score:9]
In addition, miR-10a and the expression of PTEN were inversely associated in NSCLC tissues, suggesting that the down-regulation of PTEN might at least partially reflect the up-regulation of miR-10a. [score:9]
Moreover, we used to demonstrate that high expression of miR-10a dramatically suppressed the protein level of PTEN, whereas the inhibition of miR-10a significantly enhanced the expression of PTEN (Figure 4C). [score:9]
As expected, knockdown of PTEN expression attenuated the suppression effects of the miR-10a inhibitors on migration and invasion in SPC-A-1sci cells (Figure 5E). [score:8]
Ovcharenko D et al. recently showed that miR-10a overexpression is associated with NPM1 mutations and MDM4 down-regulation in intermediate-risk acute myeloid leukemia [34]. [score:7]
We also found that the expression of miR-10a was up-regulated in NSCLC tumor tissues compared to corresponding noncancerous tissues, and its expression was correlated with metastasis and tumor node metastasis in NSCLC tissue. [score:7]
B. and D. Down-regulation of miR-10a inhibits SPC-A-1sci cell growth. [score:6]
In order to explore the mechanism through which miR-10a initiates NSCLC cells progression, we searched for potential regulatory targets of miR-10a using several bioinformatics methods, including TargetScan, miRWalk and miRanda. [score:6]
We selected potential target genes of miR-10a by using mRNA microarray and prediction tools to identify down-regulated genes in SPC-A-1sci cells (Figure 4A). [score:6]
Additionally, we also found that PTEN (phosphatase and tensin homolog), an important tumor suppressor, was the direct target gene of miR-10a. [score:6]
In the present study, we demonstrated that the expression of miR-10a is significantly up-regulated in NSCLC tissues compared with non-cancerous tissues, especially in higher tumor stage tissues. [score:5]
Conversely, miR-10a inhibitor suppressed the phosphorylation of AKT and ERK. [score:5]
Consistently, the expression of PTEN was negatively correlated with the expression of miR-10a in NSCLC tissues. [score:5]
D. of PTEN expression in SPC-A-1sci cells after transfection with anti-miR-NC, miR-10a inhibitors and si-PTEN. [score:5]
We found that miR-10a expression was significantly up-regulated in high metastatic lung cancer cells (A549, H1299 and SPC-A-1sci) compared with weakly metastatic lung cancer cells (SPC-A-1, H460 and H358) (Figure 2A). [score:5]
Ohuchida K et al. reported that microRNA-10a is overexpressed in human pancreatic cancer and involved in its invasiveness, partially via suppression of the HOXA1 gene [33]. [score:5]
Consistent with these findings, miR-10a inhibitors suppressed cell growth in SPC-A-1sci cells in both a dose and time dependent way (Figure 3B and 3D). [score:5]
Further, miR-10a expression was up-regulated in NSCLC that had lymph node or distal metastasis (n = 39) compared with those that had not spread (n = 34) (Figure 1D). [score:5]
To further validate whether PTEN was a target gene for miR-10a, we analyzed the expression of PTEN in highly metastatic (H1299 and SPC-A-1sci) and weakly metastatic (SPC-A-1 and H358) NSCLC cells. [score:5]
C. The protein expression level of PTEN was detected in SPC-A-1sci cells transfected with miR-10a inhibitor or anti-miR-NC and SPC-A-1 cells transfected with miR-10a mimics or miR-NC. [score:5]
B. The expression of miR-10a was overexpressed in NSCLC tissues compared with the noncancerous tissues. [score:4]
Hudson et al. reported that overexpression of miR-10a may be important for tumor development in medullary thyroid carcinoma [35]. [score:4]
miR-10a is up-regulated in human NSCLC tissues and associated with NSCLC progression. [score:4]
To explore whether PTEN is involved in miR-10a -induced promotion of NSCLC cell migration and proliferation, we knocked down endogenous PTEN expression using specific siRNA in SPC-A-1 cells. [score:4]
MiR-10a expression was significantly up-regulated in tumor tissue samples (64%) compared to the controls (Figure 1A and 1B). [score:4]
To conclude, we have shown that miR-10a might promote the migration, invasion and growth of NSCLC cells through direct targeting of the PTEN/AKT/ERK signaling pathway. [score:4]
D. The up-regulation of miR-10a in NSCLC was associated with tumor metastasis; the patients were classified into tumor metastasis negative and positive groups (lymph node metastasis and/ or distal metastasis) Error bars represent SEM. [score:4]
Taken together, we have provided further evidence that PTEN is a direct and functional target gene of miR-10a on NSCLC. [score:4]
PTEN is a direct target gene of miR-10a. [score:4]
To date, up-regulation of miR-10a has been found in several different tumor types. [score:4]
PTEN is the direct downstream target of miR-10a. [score:4]
miR-10a can directly bind the PTEN seed sequence, possibly decreasing the expression of PTEN. [score:4]
Moreover, there was an inverse relationship between miR-10a and PTEN expression in NSCLC tissues (Figure 6C and 6D). [score:3]
To determine whether PTEN is regulated by miR-10a through direct binding to its 3′UTR, we constructed the 3′UTR fragment of PTEN, including the miR-10a binding site (Figure 4D), with the corresponding mutant counterpart inserted downstream of the firefly luciferase reporter gene. [score:3]
The relationship between miR-10a expression and their Clinicopathologic parameters in 73 of NSCLC Patients. [score:3]
Analysis of the 3′UTR sequence of PTEN using TargetScan revealed one possible binding site for miR-10a, which is strongly conserved in human, mouse, rat, macaque, chimpanzee, dog and cattle (Figure 4E). [score:3]
We further assessed whether miR-10a promoted NSCLC cell growth and metastasis through repression of PTEN expression. [score:3]
Long MJ et al. reported that microRNA-10a promotes cell growth, migration and invasion in human cervical cancer cells by targeting CHIL1 [36]. [score:3]
C. The expression level of PTEN was measured in the presence of low and high miR-10a expression levels. [score:3]
After wound-healing assays, we observed that migration rates were suppressed in SPC-A-1sci cells transfected with miR-10a inhibitors compared to anti-miR-NC (Figure 2B). [score:3]
A. and C. Overexpression of miR-10a promotes SPC-A-1 cell growth. [score:3]
These results showed that overexpression of miR-10a increased the invasion and migration of human NSCLC cells. [score:3]
Interestingly, Zeng T et al. also showed that miR-10a enhanced the metastatic potential of cervical cancer cells by targeting PTEN [39]. [score:3]
D. Paired analyses between miR-10a and PTEN expression in NSCLC tissues. [score:3]
To clarify the biological role of miR-10a in NSCLC cells, we first detected the expression of miR-10a using quantitative RT-PCR (qRT-PCR) in 73 pairs of human NSCLC tissue samples and their corresponding noncancerous lung tissue controls. [score:3]
B, different dose of miR-10a inhibitor or anti-miR-NC was transfected into SPC-A-1sci cells. [score:3]
We also found that the target gene could mediate the function of miR-10a in the migration, invasion and growth of NSCLC cells. [score:3]
E. of P-AKT and P-ERK in SPC-A-1sci cells transfected with miR-10a inhibitor or anti-miR-NC and SPC-A-1 cells transfected with miR-10a mimics or miR-NC. [score:3]
F. Western bolt analysis of P-AKT and P-ERK in SPC-A-1sci cells transfected with anti-miR-NC, miR-10a inhibitor and si-PTEN. [score:3]
D, miR-10a inhibitors or anti-miR-NC was transfected into SPC-A-1sci cell. [score:3]
As PTEN can regulate the activity of AKT and ERK pathways [26, 27], we examined whether miR-10a could regulate phosphorylated protein levels downstream of these pathways. [score:3]
Figure 3 A. and C. Overexpression of miR-10a promotes SPC-A-1 cell growth. [score:3]
Therefore, miR-10a could enhance the growth and metastasis of NSCLC by activating the PTEN/AKT/ERK signaling pathway, thus providing a potential molecular therapeutic target for treatment of NSCLC patients. [score:3]
We co -transfected both siRNA against PTEN (si-PTEN) and miR-10a inhibitors into SPC-A-1sci cells. [score:3]
Moreover, we demonstrated that PTEN was identified as the direct target of miR-10a by Western blot and dual-luciferase reporter assays. [score:3]
The miRNA-10a inhibitors were synthesized by BioMics (Nantong, China). [score:3]
To verify the effects of miR-10a on lung cancer cell migration and invasion, we transfected SPC-A-1 cells with miR-10a mimics and SPC-A-1sci cells with miR-10a inhibitors. [score:3]
miR-10a is inversely correlated with PTEN expression in NSCLC tissues. [score:3]
MiR-10a is overexpressed in NSCLC and correlated with clinical stage and tumor metastasis. [score:2]
B. and C. Would-healing assay for SPC-A-1sci and SPC-A-1 were performed with miR-10a inhibitors, anti-miR-NC (SPC-A-1sci), miR-10a mimics, miR-NC (SPC-A-1). [score:2]
These results suggest that miR-10a influences the NSCLC progression by regulating the PTEN/AKT/ERK signaling pathway. [score:2]
Yan Y et al. showed that miR-10a controls glioma migration and invasion through regulating epithelial-mesenchymal transition via EphA8 [37]. [score:2]
For cell motility assay, the lung cancer cells were transiently transfected with miR-10a mimics, miR-10a inhibitors, miR-control and anti-control. [score:2]
Invasion and migration ability was decreased in SPC-A-1sci cells infected with miR-10a inhibitors compared to control cells (Figure 2D). [score:2]
D. and E. Transwell migration and invasion assays for SPC-A-1sci and SPC-A-1 were determined after transduction with the miR-10a inhibitors, anti-miR-NC, miR-NC and miR-10a mimics. [score:2]
These data indicate that miR-10a promoted the invasion and growth of NSCLC cells by regulating the PTEN/AKT/ERK signaling pathway. [score:2]
C. MiR-10a expression was detected in different clinical stages of NSCLC. [score:2]
We also confirmed that miR-10a inhibitors enhanced a G2/M population in SPC-A-1sci cells compared with anti-miR-NC (Figure 3E). [score:2]
To gain insight into the function of miR-10a, we examined the effect of miR-10a on cell cycle progression. [score:1]
However, we found that miR-10a levels were increased in lung cancer with advanced (stage III and IV, n = 37) to early stages (stage I and II, n = 36) (Figure 1C). [score:1]
We showed that miR-10a mimic promoted the migration, invasion and proliferation of NSCLC cells. [score:1]
PTEN is involved in the miR-10a -induced promotion of NSCLC cell growth and metastasis. [score:1]
We then analyzed the effect of miR-10a on cell growth in both cell lines, SPC-A-1 and SPC-A-1sci. [score:1]
D. The sequences of the putative miR-10a binding sites in wild type (emphasized with shadow) and mutant (red) PTEN-3′UTR. [score:1]
Additionally, si-PTEN also mediated miR-10a's ability to promote cell growth and wound healing in NSCLC cells (Figure 5F and 5G). [score:1]
We measured the endogenous expression levels of miR-10a in six lung cancer cell lines (A549, H1299, SPC-A-1sci, SPC-A-1, LC-2 and H358) by using qRT-PCR. [score:1]
The mixture of 50 ng pluc-3′UTR, 10 ng Renilla and 5 pmol miRNA-10a mimic or negative control were co -transfected into HEK-293T cells according to the recommended instruction by using the Lipofectamine 2000. [score:1]
Figure 1 A. The expression levels of miR-10a in 73 paired NSCLC and corresponding noncancerous tissues were measured by TaqMan real-time PCR and normalized against an endogenous U6 RNA control. [score:1]
The miRNA-10a mimics, and miR-control that were used with transient transfection were designed and synthesized by RiboBio (Guangzhou, China). [score:1]
A, different doses of miR-10a mimics or miR-NC was transfected into SPC-A-1 cells. [score:1]
C, miR-10a mimics or miR-NC was transfected into SPC-A-1 cells. [score:1]
Our findings indicate that miR-10a might act as an oncogene in NSCLC. [score:1]
MiR-10a regulates the PTEN/AKT/ERK signaling pathway. [score:1]
Although miR-10a is strongly conserved across species (Supplementary Figure S1), its role in lung cancer metastasis is unclear. [score:1]
A. The expression levels of miR-10a in 73 paired NSCLC and corresponding noncancerous tissues were measured by TaqMan real-time PCR and normalized against an endogenous U6 RNA control. [score:1]
Statistical significance was observed between the wild type and the mutant groups transfected with miR-10a. [score:1]
PTEN critically mediates miR-10a in NSCLC cells. [score:1]
It has been reported that miR-10a silencing reverses cisplatin resistance in human lung cancer cell lines via the transforming growth factor-β/Smad2/STAT3/STAT5 pathway [38]. [score:1]
A. Transwell analysis to determine the migration and invasion of A549, H1299, SPC-A-1sci, SPC-A-1, H460 and H358 cells and miR-10a expression was measured in different NSCLC cells. [score:1]
Consistently, miR-10a has been reported to enhance migration, invasion and growth in other cancer cells. [score:1]
Figure 2 A. Transwell analysis to determine the migration and invasion of A549, H1299, SPC-A-1sci, SPC-A-1, H460 and H358 cells and miR-10a expression was measured in different NSCLC cells. [score:1]
miR-10a promotes the migration and invasion of NSCLC cells. [score:1]
As shown in Figure 6E, miR-10a mimic promoted the phosphorylation of AKT (ser473) and ERK (thr202/thr204). [score:1]
Which were co -transfected with the miR-10a mimic or miR-control. [score:1]
E. The potential binding sequences for miR-10a within the PTEN-3′UTR of human (Hsa), mouse (Mmu), rat (Rno), macaca mulatta (Mml), pan troglodytes (Ptr), dog (Cfa), bos taurus (Bta). [score:1]
We also showed that miR-10a could promote the phosphorylation of AKT and ERK. [score:1]
However, the association of miR-10a with lung cancer metastasis has not yet been reported. [score:1]
As shown in Table 1, there were no differences in miR-10 levels associated with age, gender, tumor size, differentiation and local invasion. [score:1]
These findings suggest that miR-10a promoted cell growth during the G2/M phase. [score:1]
Furthermore, we clarified that PTEN could mediate the effect of miR-10a on the phosphorylation of AKT and ERK (Figure 6F). [score:1]
miR-10a enhances proliferation of NSCLC cells during G2/M phase. [score:1]
We then conducted stratified analyses to assess miR-10a expression in NSCLC patients with specific clinical characteristics. [score:1]
We then showed that miR-10a promoted the migration, invasion and proliferation in NSCLC cell lines. [score:1]
We found that miR-10a mimics increased proliferation of SPC-A-1 cells in both a dose and time dependent way (Figure 3A and 3C). [score:1]
[1 to 20 of 106 sentences]
5
[+] score: 304
Other miRNAs from this paper: hsa-mir-125a
MiR-10a directly targets the 3′-UTR of BimThe target of miR-10a was predicted using target prediction programs online by TargetScan (www. [score:10]
Figure 8Impact of SNP on miR-10a target genes and the expression of miR-10a and Bim in human decidual tissuesThe relative luciferase activity of reporter vector with 3′-UTR of Bim containing normal or mutated target sites was detected in the presence of pCR3.1-miR-10a-AA, pCR3.1-miR-10a-TT or pCR3.1-miR-10a-A/T (A). [score:7]
MiR-10a inhibitor is chemically modified, single stranded nucleic acid and designed to specifically bind endogenous mature miR-10a and inhibits its expression. [score:7]
The target of miR-10a was predicted using target prediction programs online by TargetScan (www. [score:7]
MiR-10a reversely adjusts Bim expression in vitroThe endogenous Bim expression was detected in cells transfected with miR-10a mimic or inhibitor by western blot (Figure 5D) and qRT-PCR (Figure 5E). [score:7]
Then we analyzed whether miR-10a low expression could inhibit Bim knockdown -mediated the promotion of cell growth and metastasis (Figures 6 and 7). [score:6]
All these facts show that normal A allele positively regulate cell proliferation and migration, but rare T allele can attenuate the A allele -mediated reinforcement effects on cell growth and metastasis by inhibiting miR-10a expression. [score:6]
The expression of Bim mRNA in miR-10a mimic and inhibitor -treated cells were detected by qRT-PCR (E). [score:5]
MiR-10a mimic, miRNA mimic negative control, miR-10a inhibitor or miRNA inhibitor negative control were separately co -transfected with Bim-pGL (Figure 5B). [score:5]
For example, miR-10a is overexpressed in pancreatic cancer cells, and the invasiveness of pancreatic cancer cells is decreased by miR-10a inhibitor [13]. [score:5]
A to T substitution in miR-10a rs3809783 promotes Bim expressionTo study whether miR-10a rs3809783 affect Bim expression, Bim-pGL or Bim-pGL-mu was transfected into cells together with pCR3.1-miR10a-AA, pCR3.1-miR10a-TT or pCR3.1-miR10a-A/T (Figure 8A). [score:5]
In conclusion, this study first discovered that miR-10a rs3809783 could increase the risk of RSA acquisition in northern Chinese Han population by down -regulating of miR-10a level and up -regulating Bim expression. [score:5]
Impact of SNP on miR-10a target genes and the expression of miR-10a and Bim in human decidual tissues. [score:5]
All these facts reveal that A to T substitution in miR-10a rs3809783 increases Bim expression by inhibiting the production of miR-10a. [score:5]
The dynamics of miR-10a and Bim expression in the decidual tissues in patients with two or more consecutive missed abortionThe expression levels of miR-10a and Bim in the decidual tissues from patients with two or more consecutive missed abortion were detected by qRT-PCR (Figure 8B and 8C). [score:5]
The endogenous Bim expression was detected in cells transfected with miR-10a mimic or inhibitor by western blot (Figure 5D) and qRT-PCR (Figure 5E). [score:5]
Bim is the functional target of miR-10aTo determine whether Bim was the functional target of miR-10a, we first tested the roles of Bim. [score:5]
HEK-293T cells were co -transfected with miR-10a mimic, miR-10a inhibitor, miRNA mimic negative control or miRNA inhibitor negative control, and Bim-pGL for dual-luciferase assay (B). [score:4]
Moreover, Bim knockdown -mediated the promotion of cell growth was partially attenuated by miR-10a low expression. [score:4]
MiR-10a expression vectors, cell transfection and treatmentTo construct pri-miR-10a expressing vectors, the fragments including pre-miR-10a and its flanking regions were amplified from human genomic DNA using the primers as follows: pri-miR10a-F/HindIII 5′-TTAAGCTTGAATCTGACTT CGTGGC AGC-3′; pri-miR-10a-R/XbaI 5′-CCTCTAGACCATAG AGGTGACCCAC ACAG-3′. [score:4]
MiR-10a expression and allele in different cell lines MiR-10a expression in HEC-1B, HeLa, HEK-293, HEK-293T and VCT cells was detected by qRT-PCR. [score:4]
Compared with miRNA inhibitor negative control, the luciferase activity was obviously strengthened by miR-10a inhibitor (P < 0.01). [score:4]
The results were coincidental with our foregoing results of miR-10a expression from different genotypes that A allele promoted mature miR-10a expression compared with T allele. [score:4]
The rare T allele in miR-10a rs3809783 could diminish cell proliferation ability and enhance cell apoptotic level by up -regulating the expression level of Bim. [score:4]
Figure 2 MiR-10a expression and allele in different cell lines MiR-10a (A) and Bim expression (B) in HEC-1B, HeLa, HEK-293, HEK-293T and VCT cells was detected by qRT-PCR. [score:4]
The expression of miR-10a (B) and Bim (C) in the decidual tissues in patients with two or more consecutive missed abortion was detected by qRT-PCR. [score:3]
The cell proliferation (P < 0.05), migration and invasion capacities were lower and apoptosis level was higher in cells co -transfected with Bim siRNA and miR-10a inhibitor than that transfected with Bim siRNA alone (Figure 9E–9H). [score:3]
Taken together, these results indicate that miR-10a executes functions partially by targeting Bim. [score:3]
Bim is the functional target of miR-10a. [score:3]
To validate above presumption, the mature miR-10a expression level was detected in cells transfected with different genotypes. [score:3]
To determine whether Bim was the functional target of miR-10a, we first tested the roles of Bim. [score:3]
To study whether miR-10a rs3809783 affect Bim expression, Bim-pGL or Bim-pGL-mu was transfected into cells together with pCR3.1-miR10a-AA, pCR3.1-miR10a-TT or pCR3.1-miR10a-A/T (Figure 8A). [score:3]
A to T substitution in miR-10a rs3809783 inhibits cell proliferation. [score:3]
Figure 7Cell migration and invasion in VCT cells transfected by Bim siRNA with or without miR-10a inhibitor(A and B) Photomicrographs of migration and invasion cells 24 h after inoculation. [score:3]
The results further confirmed that Bim was the functional target of miR-10a. [score:3]
The expression level of miR-10a in VCT cells was lower than that in HEC-1B, HeLa, HEK-293 and HEK-293T cells (P < 0.01; Figure 2A). [score:3]
A to T substitution in miR-10a rs3809783 was confirmed to be associated with an increased risk of RSA, which could decrease the production of mature miR-10a and inhibit cell growth. [score:3]
We found that the expression level of mature miR-10a in AA homozygote was markedly higher than that in TT homozygote and A/T heterozygosity, confirming that A to T substitution impeded the production of mature miR-10a. [score:3]
The dynamics of miR-10a and Bim expression in the decidual tissues in patients with two or more consecutive missed abortion. [score:3]
The relative luciferase activity of reporter vector with 3′-UTR of Bim containing normal or mutated target sites was detected in the presence of pCR3.1-miR-10a-AA, pCR3.1-miR-10a-TT or pCR3.1-miR-10a-A/T (A). [score:3]
A to T substitution in miR-10a rs3809783 promotes Bim expression. [score:3]
VCT cells transfected with pri-miR-10a expressing vectors were placed on the top chamber of 24-well plate with or without 40 μl of 1 mg/ml Matrigel (BD, Franklin Lakes, NJ, USA). [score:3]
Figure 1Sequencing, secondary structure prediction and miR-10a expression detection(A) An example of chromatographs showing the rs3809783 in pri-miR-10a. [score:3]
BIM protein level was significantly diminished by miR-10a mimic compared with miRNA mimic negative control (P < 0.01), while miR-10a inhibitor markedly enhanced BIM protein level as compared to miRNA inhibitor negative control (P < 0.01). [score:3]
MiR-10a directly targets the 3′-UTR of Bim. [score:3]
Cell migration and invasion in VCT cells transfected by Bim siRNA with or without miR-10a inhibitor. [score:3]
Our previous study has found that miR-125a and miR-10a are differentially expressed in rat uterus between the implantation and the pre-implantation period [8]. [score:3]
Therefore, we speculate that rs3809783 A > T in pri-miR-10a may be able to inhibit the functions of progesterone, and then result in the increase of the risk of RSA acquisition. [score:3]
, secondary structure prediction and miR-10a expression detection. [score:3]
Moreover, we found that the expression level of Bim was inverted with that of miR-10a in HEC-1B, HELA, HEK-293, HEK-293T and VCT cells (Figure 2B). [score:3]
The prediction and confirmation of the miR-10a target gene. [score:3]
Cell growth analysis in VCT cells transfected by Bim siRNA with or without miR-10a inhibitor. [score:3]
A to T substitution in miR-10a rs3809783 inhibits cell proliferationThe proliferation capacity in VCT cells transfected by different genotypes was detected by (Figure 3A and 3A1). [score:3]
Mutating miR-10a target sites in the 3′- UTR of Bim was used as control (called Bim-pGL3-mu). [score:3]
BIM protein level in miR-10a mimic or inhibitor -treated cells was detected by western blot (D). [score:3]
The expression of miR-10a was detected by TaqMan miRNA RT-Real Time PCR using TaqMan MicroRNA Reverse Transcription Kit and TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA). [score:3]
Therefore, we speculated that miR-10a rs3809783 might diminish the expression level of miR-10a. [score:3]
The expression levels of miR-10a and Bim in the decidual tissues from patients with two or more consecutive missed abortion were detected by qRT-PCR (Figure 8B and 8C). [score:3]
Similarly, Bim mRNA level was significantly reduced by miR-10a mimic (P < 0.01) and raised by miR-10a inhibitor (P < 0.01). [score:3]
To further explore the possible molecular mechanisms of miR-10a rs3809783 executing function, the binding status of miR-10a rs3809783 and its target gene was analyzed. [score:3]
Compared with the A allele, T allele significantly decreased the expression level of mature miR-10a (P < 0.01). [score:2]
MiR-10a reversely adjusts Bim expression in vitro. [score:2]
Figure 6Cell growth analysis in VCT cells transfected by Bim siRNA with or without miR-10a inhibitorCell proliferation was determined by EdU assay (A and A1) and (B). [score:2]
MiR-10a mimic and inhibitor were synthesized by GenePharma (Shanghai, China) and Bim siRNA was purchased from RiboBio (Guangzhou, China). [score:2]
To construct pri-miR-10a expressing vectors, the fragments including pre-miR-10a and its flanking regions were amplified from human genomic DNA using the primers as follows: pri-miR10a-F/HindIII 5′-TTAAGCTTGAATCTGACTT CGTGGC AGC-3′; pri-miR-10a-R/XbaI 5′-CCTCTAGACCATAG AGGTGACCCAC ACAG-3′. [score:2]
MiR-10a expression vectors, cell transfection and treatment. [score:2]
MiR-10a expression in HEC-1B, HeLa, HEK-293, HEK-293T and VCT cells was detected by qRT-PCR. [score:2]
MiR-10a expression and allele in different cell lines. [score:2]
Figure 5The prediction and confirmation of the miR-10a target gene MiR-10a binding sites in the 3′-UTR region of Bim were compared in cross-species (A). [score:2]
MiR-10a (A) and Bim expression (B) in HEC-1B, HeLa, HEK-293, HEK-293T and VCT cells was detected by qRT-PCR. [score:2]
Bim was confirmed to be the target gene of miR-10a by luciferase reporter assay and western blot. [score:2]
Therefore, we speculate that A to T substitution in miR-10a rs3809783 may be able to disrupt the endometrium decidualization, and then result in the occurrence of RSA by up -regulating Bim. [score:2]
A to T substitution in the miR-10a rs3809783 attenuates the sensibility to progesterone and its antagonist mifepristoneIn order to analyze the sensibility of different genotypes on the abortion and its therapeutic drug, cells transfected with different genotypes were treated by mifepristone or/and pregesterone, and then cell proliferation was detected by (Figure 9). [score:1]
Figure 9 MiR-10a rs3809783 attenuates the sensibility to progesterone and mifepristoneCells transfected with pCR3.1-miR-10a-AA, pCR3.1-miR-10a-TT or pCR3.1-miR-10a-A/T were administered with mifepristone or/and pregesterone. [score:1]
According to the data from NCBI dbSNP database, three SNPs (rs72631828, rs3809783, rs34242602) were predicted in the region of pri-miR-10a from −200 bp to +200 bp relative to pre-miR-10a sequence. [score:1]
However, only one SNP (rs3809783) located at position +22 relative to pre-miR-10a was found in the region in Chinese Han women (Table 1 and Figure 1A). [score:1]
The functions of miR-10a rs3809783 are similar with the role of miR-10a in some tumors. [score:1]
The allele of miR-10a rs3809783 in HEC-1B, HELA, HEK-293, HEK-293T and VCT cells was detected by sequencing (C). [score:1]
The apoptosis in VCT cells transfected with pCR3.1, pCR3.1-miR-10a-AA, pCR3.1-miR-10a-TT and pCR3.1-miR-10a-A/T was determined by flow cytometry analysis (Figure 3C). [score:1]
A to T substitution in miR-10a rs3809783 represses cell migration. [score:1]
A/T heterozygosity of miR-10a rs3809783 was significantly associated with an increased risk of RSA (OR = 3.152807, 95% CI = 2.049834∼4.849266, P < 0.01). [score:1]
Cells transfected with pCR3.1-miR-10a-AA, pCR3.1-miR-10a-TT or pCR3.1-miR-10a-A/T were administered with mifepristone or/and pregesterone. [score:1]
The genotype distribution of miR-10a rs3809783 in controls was conformed to be in Hardy-Weinberg equilibrium. [score:1]
Bim-pGL-mu (mutating putative miR-10a binding region in the 3′-UTR of Bim) was used as control. [score:1]
The genotype distributions of miR-10a rs3809783. [score:1]
The allele of miR-10a rs3809783 in HEC-1B, HELA, HEK-293, HEK-293T and VCT cells was detected by sequencing. [score:1]
A to T substitution in miR-10a rs3809783 slightly increases cell apoptosis. [score:1]
Recently published articles from tumor research have demonstrated that miR-10a can effectively modulate cell growth and metastasis [12– 14]. [score:1]
Figure 4Cells migratory and invasive capacities were detected in VCT cells transfected by pCR3.1, pCR3.1-miR-10a-AA, pCR3.1-miR-10a-TT or pCR3.1-miR-10a-A/T. [score:1]
A to T substitution in miR-10a rs3809783 slightly increases cell apoptosisThe apoptosis in VCT cells transfected with pCR3.1, pCR3.1-miR-10a-AA, pCR3.1-miR-10a-TT and pCR3.1-miR-10a-A/T was determined by flow cytometry analysis (Figure 3C). [score:1]
A to T substitution in the miR-10a rs3809783 attenuates the sensibility to progesterone and its antagonist mifepristone. [score:1]
MiR-10a mimic is small, chemically modified double-stranded RNA and designed to mimic endogenous mature miR-10a molecule when transfected into cells. [score:1]
The secondary structure prediction of A or T haplotypes showed that A to T substitution in miR-10a rs3809783 altered the loop location and descended the predicted ΔG, suggesting the stability of construction was destroyed. [score:1]
In this study, we explored the possible relationship between the SNP in pri-miR-10a and RSA. [score:1]
In order to further confirm the role of miR-10a rs3809783 in cell viability, the proliferation capacity of VCT cells was determined by (Figure 3B). [score:1]
The relative level of miR-10a was normalized to U6. [score:1]
And it will be an interesting question whether the polymorphisms of miR-10a are associated with RSA. [score:1]
Figure 3pCR3.1, pCR3.1-miR-10a-AA, pCR3.1-miR-10a-TT or pCR3.1-miR-10a-A/T was transfected into VCT cells. [score:1]
There is a conservative 7nt miR-10a responsive element in 3′-UTR of Bim (Figure 5A). [score:1]
The cells were then transfected with pCR3.1 -based plasmid, miR-10a-AA, miR-10a-TT, miR-10a-TT/AA, respectively. [score:1]
In order to further research the possible reasons that A to T substitution in miR-10a rs3809783 increased the risk of RSA, we analyzed the sensibility of different genotypes on the abortion and its therapeutic drug. [score:1]
cgi) was used to predict the secondary structure of 1,020 bp pri-miR-10a sequence including rs3809783 (Figure 1B). [score:1]
These results uncover that A to T substitution in miR-10a rs3809783 is not conducive to the production of mature miR-10a. [score:1]
In this study, we found the significant association between miR-10a rs3809783 and acquiring RSA. [score:1]
TaqMan miRNA RT-Real Time PCR was used to detect the influence of different genotypes on the production of mature miR-10a (Figure 1C). [score:1]
Our survey suggests that the rs3809783 A > T in pri-miR-10a is significantly associated with the increase of the risk of RSA acquisition in Han-Chinese population. [score:1]
In order to confirm the binding sites of miR-10a in the 3′-UTR of Bim, the conservative 7nt miR-10a responsive element in 3′-UTR of Bim was mutated (Figure 5C). [score:1]
Mature miR-10a level was significantly lower in A/T heterozygosity than that in A allele (P < 0.05) and higher than that in T allele (P < 0.01). [score:1]
It was allele A at position +22 relative to pre-miR-10a sequence (Figure 2C). [score:1]
We found significant differences in genotype distribution of rs3809783 in pri-miR-10a between RSA patients and normal controls. [score:1]
MiR-10a level was detected in cells transfected with the empty pCR3.1 vector, pCR3.1-miR-10a-AA, pCR3.1-miR-10a-TT or pCR3.1-miR-10a-A/T by TaqMan miRNA RT-Real Time PCR. [score:1]
RNA fold web server was used to predict the secondary structure of pri-miR-10a. [score:1]
A to T substitution in miR-10a rs3809783 hinders the production of mature miR-10a. [score:1]
Cells migratory and invasive capacities were detected in VCT cells transfected by pCR3.1, pCR3.1-miR-10a-AA, pCR3.1-miR-10a-TT or pCR3.1-miR-10a-A/T. [score:1]
A to T substitution in miR-10a rs3809783 hinders the production of mature miR-10aTaqMan miRNA RT-Real Time PCR was used to detect the influence of different genotypes on the production of mature miR-10a (Figure 1C). [score:1]
[1 to 20 of 115 sentences]
6
[+] score: 297
In the rescue experiment, after confirming that LV-miR-10a effectively increased miR-10a expression and inhibited KLF4 expression in hMSCs, the miR-10a -overexpressing hMSCs were infected with LV-KLF4 to restore the expression of KLF4. [score:11]
miR-196a, miR-486-5p, miR-664-star, and miR-378-star were upregulated, and miR-10a, miR-708, and miR-3197 were downregulated in old versus young hMSCs. [score:7]
To further confirm that miR-10a induces hMSC differentiation and reduces cell senescence through inhibition of KLF4, we designed a rescue experiment in which KLF4 expression was restored in hMSCs overexpressing miR-10a. [score:7]
Downregulation of miR-10a suppresses the differentiation potential of hMSCs. [score:6]
Figure 4Downregulation of miR-10a suppresses hMSC differentiation potential. [score:6]
Notably, miR-196a, miR-486-5p, miR-664-star, and miR-378-star were all significantly upregulated, and miR-10a, miR-708, and miR-3197 were downregulated in the hMSCs from old subjects compared with young subjects (Fig. 2B). [score:6]
Upregulation of miR-10a repressed both the endogenous mRNA and protein expression of KLF4 (Fig. 3J,K). [score:6]
Up- or downregulation of miR-10a and KLF4 showed that miR-10a can restore the differentiation capabilities of aged hMSCs through the repression of KLF4 expression. [score:6]
Accompanying the reduction in differentiation, the expression of miR-10a was significantly downregulated in aged hMSCs, implying that miR-10a may play an active role in the aging-related changes in the differentiation ability of hMSCs. [score:6]
Furthermore, we demonstrated that miR-10a can restore hMSC differentiation and can reduce cell senescence by direct suppression of KLF4 expression. [score:6]
Upregulation of miR-10a restored the differentiation ability of aged hMSCs and reduced cell senescence, but cell growth was inhibited. [score:6]
Real-time PCR analysis demonstrated that transduction of hMSCs by LV-miR-10a upregulated the expression of miR-10a 4.5-fold (Fig. 3J). [score:6]
KLF4 was chosen as the potential downstream target of miR-10a by miRNA target prediction. [score:5]
Contrary to the miR-10a expression results, the endogenous KLF4 mRNA and protein expression were much higher in the old than the young hMSCs (Fig. 5E,F). [score:5]
Thus, miR-10a/b promote neuroblastoma differentiation by suppressing NCOR2 expression (Foley et al., 2011). [score:5]
To determine if the change in miR-10a expression in aged hMSCs was associated with a change in HOXB genes, we examined the expression of HOXB3 in young and old hMSCs. [score:5]
The aberrant expression of miR-10a/10b is also implicated in various human diseases, particularly several tumors. [score:5]
However, downregulation of miR-10a expression increased the percentage of SA-β-gal positive cells among the LV-anti-10a-infected groups compared to the LV-control-infected groups, indicating that repression of miR-10a increased hMSC senescence in both young and old hMSCs (Fig. 4H,I). [score:5]
The qRT-PCR results revealed that after differentiation, the expression of adipogenic-related genes (adipsin, AP2, C/EBP-α, PPARG; Fig. 3C), osteogenic-related genes (Runx2, PON, OSTE, ALP; Fig. 3F), and chondrogenic-related genes (aggrecan, sox9, and co12al; Fig. 3G) was upregulated to a greater extent in both LV-miR-10a young and old hMSCs compared with the respective LV-control cells. [score:5]
We also identified that miR-10a expression was significantly decreased with age by comparing the miRNA expression of hMSCs derived from young and aged individuals. [score:5]
We then infected the miR-10a -overexpressing young and old hMSCs with LV-KLF4, resulting in the restoration of KLF4 expression (Fig. 7A,B). [score:5]
As presented in Figure S3F, HOXB3 expression was decreased in the old hMSCs, corresponding with the change in miR-10a expression. [score:5]
Next, to further prove the association of miR-10a with cell differentiation, a lentiviral construct to inhibit miR-10a expression (LV-anti-10a) was produced. [score:5]
Furthermore, after the restoration of KLF4 expression in miR-10a -overexpressing hMSCs, miR-10a could no longer increase cell differentiation and reduce cell senescence. [score:5]
KLF4 gene (A) and protein (B) expression in LV-KLF4 or LV-control infected young (Y) and old (O) hMSCs (LV-KLF4, LV-vc) as well as LV-KLF4 or LV-control infected Y and O hMSCs overexpressing miR-10a (10a-KLF4, 10a-vc). [score:5]
hMSCs were transfected with 200 ng of miR-10a inhibitor or inhibitor scrambled control (GenePharma), 200 ng of pGL4.13-KLF4-3′UTR or pGL4.13-KLF4-3′UTR-mut, and 10 ng of pRL-TK using 1 µl Lipofectamine 2000 (Invitrogen). [score:5]
Lentiviral constructs for overexpression of miR-10a (LV-miR-10a), KLF4 (LV-KLF4), or inhibition of miR-10a and KLF4 (LV-anti-10a and LV-anti-KLF4) were purchased from GenePharma. [score:5]
Through the luciferase reporter analysis, we found that miR-10a directly targets KLF4 mRNA at the 3′-UTR. [score:4]
miR-10a regulates endogenous KLF4 protein expression. [score:4]
Conversely, downregulation of miR-10a resulted in decreased cell differentiation and increased cell senescence. [score:4]
We determined that miR-10a directly and functionally targets KLF4 mRNA. [score:4]
Therefore, we hypothesized that the downregulation of miR-10a may be associated with the decreased differentiation capability of hMSCs from aged individuals. [score:4]
In contrast, cotransfection of hMSCs with a miR-10a inhibitor and the pGL4.13-KLF4-3′-UTR construct increased luciferase activity (Fig. 5D) compared with the groups cotransfected with the inhibitor and pGL4.13-KLF4-3′UTR-mut. [score:4]
To determine if miR-10a would affect endogenous KLF4 expression, we compared KLF4 expression after infecting the hMSCs with LV-miR-10a and LV-anti-10a. [score:4]
Lentiviral constructs were used to up- or downregulate miR-10a in young and old hMSCs. [score:4]
In human breast cancer cells, miR-10a can repress the expression of Hoxd4 by a transcriptional mechanism, thus demonstrating the function of miR-10a in the regulation of human genes (Tan et al., 2009). [score:4]
Upregulation of miR-10a resulted in increased differentiation to adipogenic, osteogenic, and chondrogenic lineages and in reduced cell senescence. [score:4]
By contrast, downregulation of miR-10a increased endogenous KLF4 mRNA and protein levels (Fig. 4J,K). [score:4]
During mouse embryogenesis, miR-10a/10b are expressed after the gene cluster (Mansfield et al., 2004; Tanzer et al., 2005). [score:3]
The sequences for the miR-10a mimic and inhibitor are listed in Table S3. [score:3]
Using a luciferase reporter system, miR-10a/b was proven to target the 3′-UTR of NCOR2. [score:3]
E: The basal expression levels of miR-10a and miR-10b in Y and O hMSCs. [score:3]
However, miR-10a may induce MSCs to a variety of cell types by modulating different downstream targets. [score:3]
LV-miR-10a transduction significantly increased the differentiation of the adipogenic and osteogenic lineages, especially in the young cells overexpressing miR-10a, as demonstrated by Oil Red O (Fig. 3A,B) and Alizarin Red S staining (Fig. 3D,E). [score:3]
The results clearly indicated that the adipogenic, osteogenic, and chondrogenic differentiation of miR-10a -overexpressing hMSCs was counteracted by the restoration of KLF4. [score:3]
miR-10a targets KLF4 mRNA. [score:3]
In addition, lentiviral -mediated overexpression of miR-10a can decrease KLF4. [score:3]
Adipogenic, osteogenic, and chondrogenic cell lineages were induced from young and old hMSCs overexpressing miR-10a. [score:3]
Repression of miR-10a can increase the upstream stimulatory factor (USF2) expression and promote the proliferation of chronic myeloid leukemia cells (Agirre et al., 2008). [score:3]
Therefore, KLF4 was chosen as the potential downstream target of miR-10a. [score:3]
Consistent with previous data (Tian et al., 2010), we also found that similar to miR-10a, miR-10b also targets the 3′-UTR of KLF4 (Fig. S3B–D). [score:3]
Unlike miR-10a, no significant difference was found in the miR-10b expression level between the young and old groups (Fig. S3A). [score:3]
Relative expression of miR-10a and miR-10b. [score:3]
Moreover, overexpression of miR-10a partially restored differentiation to the three lineages in the old hMSCs. [score:3]
The data from qRT-PCR demonstrated that miR-10a was effectively inhibited by transducing the hMSCs with LV-anti-miR10a (Fig. 4J). [score:3]
The sequences of the lentivirus and the miR-10a and miR-10b mimics and inhibitors. [score:3]
J: The expression level of miR-10a and KLF4 was quantified by qRT-PCR in transduced Y and O hMSCs. [score:3]
Therefore, we believe that miR-10a can restore the differentiation capabilities of aged hMSCs through the repression of KLF4 expression. [score:3]
These data are consistent with other studies showing that miR-10a expression is altered along with that of HOXB4 and HOXB5 during CD34 [+] hematopoietic progenitor differentiation to megakaryocytes (Garzon et al., 2006). [score:3]
D: hMSCs were cotransfected with a miR-10a inhibitor or a scrambled control and pGL4.13-KLF4-3′UTR or pGL4.13-KLF4-3′UTR-mut. [score:3]
As shown in Figure 5C, luciferase activity was significantly repressed by the miR-10a mimic, proving the direct binding of the miR-10a to the 3′-UTR of KLF4. [score:2]
To enhance the understanding of aging-related miRNAs in hMSC differentiation, this study compared miRNA expression profiles of hMSCs derived from young and old subjects and found that miR-10a was the most significantly altered with aging. [score:2]
The luciferase activity was significantly repressed by the miR-10a mimic, proving the direct binding of miR-10a to the 3′-UTR of KLF4. [score:2]
All these results suggest that miR-10a may be a key regulator for MSC differentiation. [score:2]
To confirm the bioinformatics prediction, a chimeric luciferase reporter system was used to prove the direct binding of miR-10a to the 3′-UTR of KLF4. [score:2]
Together, these data confirm that miR-10a induces hMSC differentiation and reduces cell senescence by direct repression of KLF4. [score:2]
Investigation of the underlying molecular mechanisms responsible for miR-10a mediated hMSC differentiation showed that miR-10a can restore the differentiation capabilities of aged hMSCs through the repression of KLF4 expression. [score:1]
These constructs were cotransfected with the miR-10a mimic into cells. [score:1]
miR-10a -induced hMSC differentiation is attenuated by the restoration of KLF4. [score:1]
A total of 100 ng of miR-10a mimic or scrambled control (GenePharma), 100 ng of pGL4.13-KLF4-3′UTR or pGL4.13-KLF4-3′UTR-mut containing the firefly luciferase reporter vector, and 5 ng of the control vector containing Renilla luciferase (pRL-TK) were used to transfect 6 × 10 [4] HEK-293T cells or 3 × 10 [4] hMSCs per well in a 48-well plate using 0.5 µl Lipofectamine 2000 (Invitrogen). [score:1]
To investigate the impact of miR-10a on hMSC differentiation, we produced a lentiviral construct to overexpress miR-10a (LV-miR-10a). [score:1]
E: LV-KLF4 and miR-10a cotransduced hMSCs. [score:1]
Figure 3Effects of miR-10a on hMSC differentiation. [score:1]
KLF4 appeared most likely to be the major candidate because the miR-10a seed sequence is reverse complementary to the seed-matched sequence in the 3′-UTR region of human KLF4 (Fig. 5A). [score:1]
In conclusion, miR-10a restores the differentiation capability of aged hMSCs through repression of KLF4. [score:1]
In conclusion, we demonstrated that miR-10a was significantly decreased in old hMSCs and that this reduction was related to the impaired adipogenic, osteogenic, and chondrogenic differentiation of the cells. [score:1]
C: HEK 293T cells and hMSCs were cotransfected with a miR-10a mimic or a scrambled control (SC) and pGL4.13-KLF4-3′UTR or pGL4.13-KLF4-3′UTR-mut. [score:1]
miR-10a is located in the HOXB gene cluster on chromosome 17q21. [score:1]
LV-miR-10a or LV-control was used to transduce young (Y) and old (O) hMSCs (Y-10a, O-10a and Y-vc, O-vc). [score:1]
Further studies on the effects of miR-10a on the regenerative capacity of hMSCs are needed. [score:1]
These constructs were cotransfected with the miR-10a mimic into HEK 293 cells. [score:1]
Indeed, Foley et al. found that by repressing nuclear receptor corepressor 2 (NCOR2), which induces transcriptional alterations, miR-10a/b induced neuroblastoma cell differentiation similar to all-trans-retinoic acid. [score:1]
B: LV-miR-10a-transduced hMSCs. [score:1]
In agreement with the current data, Fang et al. have also shown that the basal level of miR-10b is much lower than that of miR-10a in swine aortic endothelium cells and human aortic endothelial cells (Fang et al., 2010). [score:1]
Furthermore, we found that miR-10a showed the most dramatic decrease with age. [score:1]
Effects of miR-10a on hMSC differentiation. [score:1]
A: miR-10a sequences and the binding sites in KLF4 3′-UTR. [score:1]
[1 to 20 of 87 sentences]
7
[+] score: 271
In MCF7 cells, the 5-aza-dC treatment clearly upregulated the expression of the p15 gene, whose promotor is normally methylated, but did neither affect the expression of the unmethylated gapdh gene nor affect the expression of miR-10a (Fig. 4a). [score:10]
MicroRNA-10a inhibits hoxd4 gene expressionTo explore whether miR-10a can suppress hoxd4 expression, the expression levels of the hoxd4 and hoxb4 mRNAs were compared to those of miR-10a and -10b in several human cell lines including human breast cancer cells MDA-MB-231 and MCF7, human mammary epithelial cells (MCF10A), hepatocellular liver carcinoma cells (HepG2), cervical carcinoma cells (HeLa) and lung adenocarcinoma cells (A549) (Fig. 1c, d). [score:10]
If the transcriptional inhibition of hoxd4 expression is achieved by miR-10a targeting the miR-10b primary transcript, then the possibility remains that it could also target its own primary transcript. [score:9]
MicroRNA-10a decreases hoxd4 gene expression through transcriptional inhibitionTo determine whether miR-10a over -expression would influence the hoxd4 mRNA expression level, 100 nM miR-10a duplex was transfected into MCF7 and MDA-MB-231 cells (Fig. 2a). [score:9]
Transfection with miR-10a-G5' and miR-10a-M inhibited hoxd4 mRNA expression to the same extent as did wildtype miR-10a, however, transfection with miR-10a-G3' produced nearly no inhibition of the hoxd4 mRNA expression (Fig. 2g). [score:9]
The expression of miR-10a is higher than of miR-10b in MCF7 cells, but lower than the miR-10b expression in MDA-MB-231 cells (Fig. 1c), and the expression of miR-10a varies inversely with the expression of hoxd4 in all six cell types. [score:9]
Expression of p15 was upregulated when after treatment with 5-aza-dC, but no changes were observed in the expression level of miR-10a and gapdh gene. [score:8]
To establish that miR-10a inhibits hoxd4 gene expression, we first performed in vitro loss-of-function analyses by silencing the miRNA with antisense oligonucleotides and assessing hoxd4 gene expression. [score:7]
To test whether miR-10a suppresses hoxd4 expression by de novo DNA methylation, MCF7 and MDA-MB-231 cells were treated for 5 days with 0.75 μM 5-Aza-2'-deoxycytidine (5-aza-dC), a DNA methylotransferase (DNMT) inhibitor. [score:7]
To show that miR-10a can silence hoxd4 expression by promoter methylation, MCF7 cells and MDA-MB-231 cells were transfected with either the miR-10a duplexes or anti-miR-10a, and then treated with 1 μM 5-aza-dC for 48 h. We found that after inhibiton of the DNA methylotransferase activity, miR-10a could no longer silence hoxd4 mRNA expression (Fig. 4c). [score:7]
In conclusion, our results demonstrate that miR-10a can regulate human gene expression in a transcriptional manner, and indicate that endogenous small noncoding RNA -induced control of transcription may be a potential system for expressional regulation in human breast cancer cells. [score:7]
MicroRNA-10a -induced transcriptional inhibition of hoxd4 is related to promoter -associated ncRNAsThe human miR-10a and miR-10b sequences deviate in only one nucleotide, and the mature miR-10a could in principle regulate hoxd4 by targeting the primary miR-10b transcript. [score:6]
To explore whether miR-10a can suppress hoxd4 expression, the expression levels of the hoxd4 and hoxb4 mRNAs were compared to those of miR-10a and -10b in several human cell lines including human breast cancer cells MDA-MB-231 and MCF7, human mammary epithelial cells (MCF10A), hepatocellular liver carcinoma cells (HepG2), cervical carcinoma cells (HeLa) and lung adenocarcinoma cells (A549) (Fig. 1c, d). [score:6]
The results show that hoxd4 expression was reduced when transfected with the miR-10a duplexes, and similarly that hoxb4 was downregulated after transfection with miR-10b. [score:6]
Contrarily, when cells were treated with 2'-O-methyl-miR-10a (anti-miR-10a), we found that the extent of methylation decreased and was accompanied by upregulation hoxd4 expression in both cells types (Fig. 4f). [score:6]
Neither miR-10a nor miR-10b reduced the expression of their respective immediate downstream hox locus, possibly indicating that none of these miRNAs are able to target their own primary transcripts (Fig. 3e). [score:5]
No change was observed in the expression levels of the adjacent hoxd3 and hoxd8 loci (Fig. 1f), indicating that the miR-10a -induced hoxd4 gene suppression did not affect other regions on the same chromosome. [score:5]
Here, we show that two miRNAs, miR-10a and miR-10b, mapping to two different chromosomes, can target each other's primary transcipts to repress the expression of neighboring hox genes. [score:5]
Here, we show that microRNA-10a (miR-10a) targets a homologous DNA region in the promoter region of the hoxd4 gene and represses its expression at the transcriptional level. [score:5]
These results thus indicate that the miR-10a -induced inhibition of hoxd4 transcription is accompanied by de novo DNA methylation and H3K27me3 formation in the targeted promoter region. [score:5]
When expressed, the primary hsa-miR-10b transcript would be equivalent to a promoter -associated RNA [15] which could be targeted by miR-10a and thereby mediate induction of transcriptional gene silence of the hoxd4 locus. [score:5]
The expression miR-10a varies inversely with the expression of hoxd4 in all six cell types. [score:5]
It has been reported that miR-10a could target the 3'UTR sequence of the hoxd10 gene [13], but based on current algorithms (miRanda) there are no likely miR-10a target sites in the 3'UTR of the hoxd4 mRNA. [score:5]
This observation gives new insights into the mechanisms by which an increase in the miR-10a expression leads to a concomitant reduction in the hoxd4 expression. [score:5]
The siP1 duplex decreased the expression of hoxd4 even more strongly than did the miR-10a duplex, whereas transfection with the siP2 duplex had no affect on the hoxd4 expression (Fig. 3d). [score:5]
These data indicate that miR-10a specifically decrease hoxd4 expression through transcriptional inhibition, and suggest that the 3'most portion of miR-10a is most important for this activity. [score:5]
Nor was there any change in hoxd4 protein expression levels when MDA-MB-231 cells were transfected with negative control 2'-O-methyl oligos (N. C. ) or anti-miR-196a (Fig. 1g), suggesting the observed increase in hoxd4 expression is a specific effect of the endogenous miR-10a. [score:5]
To determine whether miR-10a over -expression would influence the hoxd4 mRNA expression level, 100 nM miR-10a duplex was transfected into MCF7 and MDA-MB-231 cells (Fig. 2a). [score:5]
The human miR-10a and miR-10b sequences deviate in only one nucleotide, and the mature miR-10a could in principle regulate hoxd4 by targeting the primary miR-10b transcript. [score:4]
MicroRNA-10a inhibits hoxd4 gene expression. [score:4]
An intriguing question is therefore whether miR-10a could regulate hoxd4 gene expression in a transcriptional manner. [score:4]
MicroRNA-10a decreases hoxd4 gene expression through transcriptional inhibition. [score:4]
MiR-10a and -10b couldn't target their own primary transcript to modulate downstream gene expression. [score:4]
When MCF7 cytoplasmic extracts were treated similarly, both miR-10a and si d4 significantly reduced hoxd4 mRNA levels, suggesting that the miR-10a induced hoxd4 gene downregulation is achieved at the transcriptional level. [score:4]
The expression of hoxd4 mRNA was reduced after the transfection of miR-10a duplexes in all six cell types. [score:3]
In the case of the hoxd4 locus, the adjacent pri-miR-10b could serve as a promoter -associated non-coding RNA, mediating induction of transcriptional silencing when targeted by miR-10a. [score:3]
All six cell types showed a similar tendency towards reduced hoxd4 expression when transfected with 100 nM miR-10a (Fig. 2e). [score:3]
Co -transfected with the miR-10a duplex, siAgo1 or siDicer almost completely prevented the reduction in hoxd4 expression induced by miR-10a (Fig. 3f). [score:3]
To establish that the loss of hoxd4 expression was due to transcriptional silencing by miR-10a, we carried out nuclear run-on experiments (Fig. 2d). [score:3]
A recent report has showed that miR-10a could bind the 5'UTR of ribosomal protein mRNAs and enhance their translation [30]. [score:3]
To determine whether miR-10a could induce these repressive histone modifications, we used chromatin immunoprecipitation (ChIP) to screen the hoxd4 promoter for H3K9me2 and H3K27me3 at regions overlapping the miR-10a target site (Chip Box1: -1081 ~ -972) and the bisulphite sequencing PCR (BSP) detection site (Chip Box2: -330 ~ -122). [score:3]
Hoxd4 transcription was almost abolished in MCF7 nucleii when treated with miR-10a duplexes, whereas no changes were observed when MCF7 was transfected with the siRNA si d4 designed to target the hoxd4 mRNA for cleavage. [score:3]
We found that transfection of 100 nM miR-10a duplexes into MCF7 cells caused a 50% decrease in luciferase activity in the reporter containing the hoxd10 3'UTR while no changes was detected in cells expressing the reporter with the hoxd4 3'UTR (Fig. 2c). [score:3]
Dicer and AGO1/3 proteins are involved in miR-10a induced transcriptional gene inhibition. [score:3]
The results suggested that Dicer, AGO1 and AGO3 are required for the induction of transcriptional inhibition by miR-10a duplexes. [score:3]
To assess this possibility and also whether miR-10b might target the primary miR-10a transcript and thereby induce transcriptional inhibition its adjacent hoxb4 locus, the hoxd4 and hoxb4 mRNA levels in MCF7 and MDA-MB-231 cells were evaluated by quantitative RT-PCR. [score:3]
This negative correlation indicates that miR-10a might play a role in modulating hoxd4 gene expression in these cells. [score:3]
The zebrafish miR-10a and miR-10b loci are not always coordinately expressed with their downstream hox gene suggesting that they have independent transcriptional initiation systems [14]. [score:3]
MicroRNA-10a -induced transcriptional gene inhibition requires the presence of Dicer and Argonautes 1 and 3, and it is related to promoter associated noncoding RNAs. [score:2]
MicroRNA-10a -induced inhibition of transcription is associated with DNA methylation of the hoxd4 promotor. [score:2]
MiR-10a/b and miR-320 are both encoded in the promoter region of genes, and the observation that miR-320 has as a cis-regulatory role may be very important in miRNA research[11]. [score:2]
Mutational analysis of the miR-10a sequence revealed that the 3' end of the miRNA sequence is the most critical element for the silencing effect. [score:2]
MicroRNA-10a -induced transcriptional inhibition of hoxd4 is related to promoter -associated ncRNAs. [score:2]
When treated with 100 nM miR-10a duplexes, the expression of Hoxd4 protein was almost abolished compared to transfection with 50 nM miR-10a duplexes or control. [score:2]
MicroRNA-10a -induced inhibition of transcription is associated with DNA methylation of the hoxd4 promotorTranscriptional silencing is commonly associated with epigenetic chromatin modifications. [score:2]
Hsa-miR-10a and hsa-miR-10b deviate in only one nucleotide located at the center of their sequence, and the miR-10 family exhibits strong evolutionary conservation across a number of animal species such as human, mouse, zebrafish, Drosophila/fly and chicken (Fig. 1b). [score:1]
We further demonstrated that trimethylation of histone 3 lysine 27 (H3K27me3) is involved in the miR-10a -induced hoxd4 transcriptional gene silence. [score:1]
To determine which part of the miRNA sequence is most important for the observed effects, we mutated the miR-10a sequence in either the first (or 5'most) five basepairs (G5'), in the middle five basepairs (M), or in the last (or 3'most) five basepairs (G3'), and analyzed the effects of the mutant miR-10a duplexes in MCF7 cells (Fig. 2f). [score:1]
The human hsa-miR-10a locus maps upstream of hoxb4 and the hsa-miR-10b locus is similarly situated in the promoter region of hoxd4 (Fig. 1a). [score:1]
The 3'most portion of miR-10a sequence is most important for miR-10a induced gene silence of hoxd4. [score:1]
Quantitative PCR showed that unlike negative control 2'-O-methyl oligos (N. C. ) or anti-miR-196a, the transfection of a modified 2'-O-methyl miR-10a antisense oligonucleotide (anti-miR-10a) resulted in a 2-fold increase in hoxd4 mRNA levels MDA-MB-231 cells and a 4-fold increase in hoxd4 mRNA levels in MCF7 cells(Fig. 1e). [score:1]
Each of these siRNAs was transfected into MCF7 cells, either alone or in combination with the miR-10a duplex. [score:1]
After transfection with miR-10a, an increase in H3K27me3 in the two analysed regions (Box1 and Box2) was observed in both MCF7 cells and MDA-MB-231 cells (Fig. 4e). [score:1]
To test whether miR-10a -induced suppression of hoxd4 mRNA is common in other human cell lines, MCF10A, HepG2, HeLa and A549 were also investigated. [score:1]
However, upstream of the hoxd4 transcription initiation site there is a site with near perfect complementarity to the miR-10a sequence. [score:1]
[1 to 20 of 65 sentences]
8
[+] score: 253
Other miRNAs from this paper: hsa-mir-204, hsa-mir-1-2, hsa-mir-1-1, hsa-mir-499a, hsa-mir-499b
Our experimental study confirmed that miR-10a down-regulates the expression of GATA6 by directly binding to its 3′UTR and GATA6 overexpression rescues the miR-10a -mediated depressive effect on the hCMPCs proliferation. [score:9]
Western blot showed that miR-10a mimics suppresses the expression of GATA6 by 19.72%, while its inhibitor increases GATA6 protein expression by 38.43% compared with mock (Figure 3B, C ). [score:8]
On the other hand, inhibition of miR-10a causes upregulation of E2F-1, Cdc2, CDK2, CDK4 and PCNA (Figure 1F ). [score:6]
We found that miR-10a mimics significantly downregulates E2F-1, cyclin B, cyclin D1, cyclin E1 as well as Cdc2 and PCNA but does not significantly influence the expression of P21 (Figure 1E ). [score:6]
Next, we verified that 50 nM mimics or inhibitor could successfully up- or downregulate miR-10a in hCMPCs (Figure S2 in File S1). [score:6]
hCMPCs overexpressing miR-10a show G1/S blocking, and the inhibition of miR-10a promotes G1/S transition compare with mock. [score:5]
To further validate whether miR-10a influences the abundance of GATA6 expression, hsa-miR-10a mimics, inhibitor or mock were transfected into hCMPCs; 48 h later, the cells were harvested for protein detection. [score:5]
Potential targets of human miR-10a were searched using Targetscan (http://mirtarbase. [score:5]
We explored whether suppression of the GATA6 protein by miR-10a could account for miR-10a′s inhibitory effect on hCMPCs. [score:5]
miR-10a binds to GATA6 and suppresses GATA6 expression. [score:5]
Figure S2, miR-10a mimics or inhibitor changes expression level of miR-10a. [score:5]
By the use of an online algorithm (Targetscan), we found that GATA6 is among the potential candidates targets of miR-10a. [score:5]
We then cotransfected miR-10a mimics and the GATA6 overexpression plasmid into hCMPCs; overexpression of GATA6 rescued the decreased proliferation caused by miR-10a mimics (Figure 3D, Figure S5 in File S1). [score:5]
This finding may be partly due to the fact that miR-10a does not significantly upregulate CKis, such as P21, which increases during myogenic induction [27]. [score:4]
Up/downregulation of miR-10a was confirmed by qRT-PCR after 48 h of transfection. [score:4]
Thus, miR-10a could regulate the proliferation of hCMPCs by targeting GATA6. [score:4]
BrdU absorbance of hCMPCs transfected with mock, miR-10a mimics and siRNA that downregulated GATA6 are shown. [score:4]
In this work, we revealed the regulation role of miR-10a in hCMPC and confirmed GATA6 as the target. [score:4]
Using human cardiomyocyte progenitor cells (hCMPCs), we show that miR-10a can regulate the proliferation of hCMPCs by targeting GATA6, and it does not influence the differentiation of hCMPCs toward cardiomyocytes. [score:4]
D. Data collected from C. *P<0.05, n = 3. E. Relative expression of cell cycle regulatory genes in hCMPCs transfected with miR-10a mimics. [score:4]
Several targets were identified and proved to mediate the regulation function of miR-10a [11]– [14]. [score:4]
miR-10a was down-regulated in individuals with TOF (∼2.5 fold), suggesting the potential role of miR-10a in cardiogenesis [28]. [score:4]
As shown in Figure 1C and 1D, hCMPCs overexpressing miR-10a display 15.81% higher proportion of G0/G1 phase but 36.85% and 22.76% lower proportion of S and G2/M phase, respectively compared with mock, suggesting that miR-10a inhibits G1/S transition. [score:4]
Similar to miR-10a, the downregulation GATA6 in hCMPCs reduces proliferation. [score:4]
In summary, our findings show that miR-10a reduces proliferation of hCMPC by suppressing GATA6. [score:3]
D. The same markers were tested in hCMPCs with inhibited miR-10a. [score:3]
Despite the lack of in vivo evidence, miR-10a is still an important potential regulator in cardiac development. [score:3]
Together, miR-10a inhibits the proliferation of hCMPC by decreasing its cell cycle progression. [score:3]
We also examined targets of miR-10a which has been reported to be involved in cardiogenesis and cell proliferation, including HDAC4 and HOXA1. [score:3]
0103097.g004 Figure 4 Hearts of different stages of cardiogenesis were collected for miR-10a expression analysis. [score:3]
To determine the expression pattern of miR-10a, Embryo day 9.5 (E9.5), E11.5, E13.5, E15.5, E17.5, E19.5 and Postnatal day 0 (P0) mouse hearts were harvested for total RNA extraction using the mirVana miRNA Isolation Kit (AM1561, Ambion, USA). [score:3]
hCMPCs were separately transfected with miR-10a mimics (50 nM) or inhibitor (50 nM) for 48 h. BrdU was added to the growth medium, and the mixture was incubated overnight. [score:3]
This evidence suggests that miR-10a is an important potential regulator in cardiac development. [score:3]
A luciferase expression vector containing a predicted binding site of miR-10a in human GATA-6 3′UTR (5′-ACAGGGTA-3′) was cotransfected with mock or miR-10a mimics into 293 cells using Lipofectamine 2000 (11668-019, Invitrogen, USA). [score:3]
hsa-miR-10a mimics (5′-UACCCUGUAGAUCCGAAUUUGUG-3′ and 5′-CAAAUUCGGAUCUACAGGGUAUU-3′), inhibitor (5′-CACAAAUUCGGAUCUACAGGGUA-3′) and negative scramble (mock) were purchased from Genepharm. [score:3]
To determine the possible role of miR-10a in cardiogenesis, we examined the expression pattern of miR-10a in developing hearts from E9.5, E11.5, E13.5, E15.5, E17.5 and E19.5 mouse embryos and P0 mice. [score:3]
hCMPCs were transfected with miR-10a mimics or inhibitor for 48 h. Then, the cells were harvested and lysed with RIPA buffer (Biotime, China) for protein extraction. [score:3]
File S1 Figure S1, Influence of miR-10a mimics or inhibitor on hCMPC viability. [score:3]
We manipulated the expression of miR-10a in hCMPCs, and observed its effect on proliferation. [score:3]
miR-10a Binds to GATA6 and Decreases its Expression. [score:3]
Our findings indicate that miR-10a interferes with the expression of GATA6 by specifically binding its 3′UTR. [score:3]
Futhermore, we detected the protein expression of caspase 3 in the hCMPCs and found miR-10a mimics did not affect the protein levels (Figure S4 in File S1). [score:3]
Based on another set of experiments using the EdU test, miR-10a decreases the EdU incorporation rate by 16.76% (Figure 1B ), whereas the inhibitor does not produce a significant difference from control. [score:3]
B. Data collected from A. *P<0.05, n = 6. C. Relative expression of cardiomyocyte markers in differentiating hCMPCs transfected with miR-10a mimics. [score:3]
miR-10a expression pattern determination. [score:3]
0103097.g002 Figure 2 A. Representative image of differentiating hCMPCs with manipulated expression of miR-10a or mock. [score:3]
0103097.g001 Figure 1 A. miR-10a mimics decrease the BrdU incorporation rate of hCMPCs, whereas a miR-10a inhibitor does not significantly affect the process. [score:3]
Representative image of hCMPCs transfected with mock, miR-10a mimics or inhibitor stained with DAPI (blue) and EdU (red) (×200). [score:3]
We found that miR-10a expression was relatively low in E9.5 and E11.5 hearts and gradually increased from E13.5, peaking at E15.5 through P0 (Figure 4 ). [score:3]
miR-10a Target Gene Analysis. [score:3]
miR-10a mimics and a plasmid that overexpresses GATA6 were cotransfected into hCMPCs, and a reduced BrdU absorbance was not observed. [score:3]
Expression Pattern of miR-10a in Mouse Cardiogenesis. [score:3]
GATA6 Overexpression Rescues the miR-10a -mediated Effect on hCMPCs. [score:3]
We used the expression of sarcomeric proteins, troponin-I and α-actinin, as markers for differentiation, and the results revealed that miR-10a does not significantly change the ratio of differentiating cells (Figure 2A, B ). [score:3]
We showed that the expression of miR-10a increases at E13.5 and peaks at E15.5 through P0. [score:3]
Expression of miR-10a is increased in cardiogenesis. [score:3]
miR-10a Regulates the Proliferation of hCMPC. [score:2]
miR-10a has been suggested to regulate retinoid acid -induced smooth muscle cell (SMC) differentiation from ES cell and endothelial progenitor cell senescence [11], [12]. [score:2]
Other experiments are needed to determine how GATA6 is regulated by miR-10a in cardiogenesis. [score:2]
miR-10a has been reported to regulate cell behaviors in different cell types. [score:2]
According to a previous study, miR-10a is enriched in human embryos, which is indicative of a role in embryonic development [27]. [score:2]
This suggests that miR-10a directly and specifically binds to the 3′UTR of GATA6. [score:2]
Figure S3, miR-10a decreases the proliferation of hCMPCs. [score:1]
miR-10a does not influence hCMPC differentiation toward cardiomyocytes. [score:1]
These data suggest that GATA6 is responsible for the miR-10a -mediated depressive effect on the proliferation of hCMPCs. [score:1]
Next, whether miR-10a inhibits cell cycle progression of hCMPCs was investigated. [score:1]
miR-10a reduces proliferation of hCMPCs. [score:1]
Further experiments are needed to determine whether miR-10a influences hCMPC differentiation into smooth muscle cells and endothelium. [score:1]
Further in vivo studies may determine the pathologic phenotypes of miR-10a in cardiogenesis. [score:1]
F. The same set of genes was measured in hCMPCs with inhibited miR-10a. [score:1]
Our evidence did not support that miR-10a influences the progression of cardiomyocyte differentiation from hCMPCs. [score:1]
The BrdU ELISA assay indicated that miR-10a decreases the BrdU incorporation rate by 31.82% compared with mock, but the miR-10a inhibitor does not interrupt this process (Figure 1A ). [score:1]
However, the role of miR-10a in cardiac progenitor has not been elucidated. [score:1]
This evidence suggests that the decreased hCMPCs proliferation by miR-10a is not involved in cell apoptosis. [score:1]
Figure S4, miR-10a decreases hCMPCs proliferation without affects cell apoptosis. [score:1]
In the present study, we provide solid evidence that miR-10a reduces the proliferation of hCMPCs by blocking G1/S transition and decreasing DNA synthesis, which leads to cell cycle depression. [score:1]
Then, we cotransfected miR-10a and the luciferase reporter that did not contain the predicted binding site of the GATA6 3′UTR and found that the luciferase activity was not altered (Figure 3A ). [score:1]
In the present study, we attempted to investigate whether miR-10a regulates cardiac progenitor cell behavior, and if so, the potential mechanism of the regulation. [score:1]
Quantification of miR-10a level was related to U6. [score:1]
Howerver, how miR-10a influence hCMPC cell processes has never been explored. [score:1]
A. Pmir- glo dual luciferase plasmid containing a wild type or mutant GATA6-3′UTR was cotransfected with miR-10a mimics or mock into 293 cells. [score:1]
No significant changes were observed in hCMPC transefected with miR-10a mimics (data not shown). [score:1]
The same plasmid, except that it was devoid of the predicted binding site (5′-ACAGGGTA-3′), was cotransfected with miR-10a mimics to verify the specificity of the binding. [score:1]
0103097.g003 Figure 3 A. Pmir- glo dual luciferase plasmid containing a wild type or mutant GATA6-3′UTR was cotransfected with miR-10a mimics or mock into 293 cells. [score:1]
To investigate the potential effects of miR-10a on hCMPC, we first used different concentrations of miR-10a mimics and inhibitor to determine the optimal transfection concentration and to avoid cytotoxic effects. [score:1]
Collectively, these findings suggest that miR-10a reduces hCMPC proliferation but does not influence their differentiation into cardiomyocytes. [score:1]
Therefore, we analyzed the potential effect of miR-10a on the differentiation of hCMPCs into cardiomyocytes by quantifying lineage-specific markers. [score:1]
GATA6 rescues the proliferation phenotype of miR-10a in hCMPC. [score:1]
[1 to 20 of 88 sentences]
9
[+] score: 214
Other miRNAs from this paper: hsa-mir-21, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-155
Considering the aggressive nature of the defects leading to eBL development, downregulated miR-10a-5p could also promote the hyperactivation of API5 (apoptosis inhibitor 5), an apoptosis inhibitory protein, which renders tumor cells resistant to T cell initiated apoptosis (Noh et al., 2014). [score:9]
survivors hsa-miR-10a-5p MIMAT0000253 1.12e-05 0.0013 −2.935 Down-regulatedFrom our miRNA sequencing data we observed the expression of 43 known ebv miRNAs in the eBL tumor cells representing on average 2.7% with a wide range from 0.01 to 11.9% of all miRNA expression (Tables S1, S2). [score:8]
survivors hsa-miR-10a-5p MIMAT0000253 1.12e-05 0.0013 −2.935 Down-regulated From our miRNA sequencing data we observed the expression of 43 known ebv miRNAs in the eBL tumor cells representing on average 2.7% with a wide range from 0.01 to 11.9% of all miRNA expression (Tables S1, S2). [score:8]
Figure S5 Pearson correlation scatter plots showing the relationship between hsa-miR-10a-5p expression and its target gene expression in eBL patients. [score:7]
We performed a pairwise correlation coefficient analysis between miR-10a-5p expression levels and the expression levels of its 251 validated target genes with a median count >10 cpm from an RNAseq data set for the eBL patients. [score:7]
Table S3 Validated target genes of miR-10a-5p and miRNA-target mRNA expression correlation coefficients. [score:7]
miRNA target gene identification and correlation of expression profiles between miR-10a-5p and its validated target genes. [score:7]
MiR-10a-5p downregulation in the jaw tumors could lead to hyperactivation of its target CD59 (Helwak et al., 2013), a potent inhibitor of the complement membrane attack complex. [score:7]
The target genes of the down-regulated miR-10a-5p in eBL non-survivors and jaw tumors, were significantly enriched in pathways of cancer (hsa05200) p = 0.014, focal adhesion signaling pathway (hsa04510) p = 0.013, and EBV infection pathway (hsa05169) p = 0.018. [score:6]
The box plot shows the log2 median expression levels of miR-10a-5p, confirmed as downregulated in eBL non-survivor patients, estimated in terms of normalized fluorescence intensity. [score:6]
To gain some insight into the biological functions deregulated by miR-10a-5p, we identified its validated targets and used mRNA expression data to add biological significance by performing a pairwise correlation analysis. [score:6]
The box plot show the log2 median expression levels of miR-10a-5p, confirmed as downregulated in Jaw tumors, estimated in terms of normalized fluorescence intensity. [score:6]
FAK pathway enrichment by the targets of miR-10a-5p, as a result of the upregulation of these genes, would promote apoptotic escape of thus sustaining tumor cell survival or increased tumor burden. [score:6]
Lack of post-transcriptional regulation of CD59 due to miR-10a-5p downregulation in eBL patients would enhance tumor cell survival and possibly increase relapse rates. [score:5]
A significant inverse correlation was observed between miR-10a-5p and CD59 expression, implying a biologically relevant, functional miRNA-mRNA target interaction, which would enhance tumor cell survival and thus render the tumor less sensitive to chemotherapy. [score:5]
These plots show the relationship between hsa-miR-10a-5p expression and CD59 expression levels in eBL patients based tumor site. [score:5]
Experimental re -expression of hsa-miR-10a-5p in CML cells decreased cell growth, thus supporting the functional role of hsa-miR-10a in CML disease progression (Agirre et al., 2008). [score:5]
The qRT-PCR results showed good correlation with sequencing (r = 0.77) based on a correlation test between qRT-PCR miR-10a expression levels and miR-10a expression levels from the sequencing experiment. [score:5]
The plots show the relationship between hsa-miR-10a-5p expression and CD59 expression levels in eBL patients based on patient outcome. [score:5]
Given that miR-10a-5p targets MDM4 and MDM2, inhibitors of p53 (Francoz et al., 2006), this interaction could influence survival of eBL patients (Leroy et al., 2002; Kishore et al., 2011; Yousef and Allmer, 2014). [score:5]
Figure S4 Pearson correlation scatter plots showing a positive correlation between qRT-PCR miR-10a-5p expression levels and miRNA-seq miR-10a-5p expression levels. [score:5]
In support of miR-10a-5p role in cancer, downregulation of miR-10a-5p has also been implicated in other cancer studies (Jansson and Lund, 2012). [score:4]
Down-regulation of hsa-miR-10a in chronic myeloid leukemia CD34 [+] cells increases USF2 -mediated cell growth. [score:4]
Hsa-miR-10a-5p was also downregulated in the eBL non-survivors. [score:4]
abdominal tumor hsa-miR-10a-5p MIMAT0000253 7.67e-06 0.001857 −2.873 Down-regulated Figure 2 (A) A volcano plot displaying the statistically significant (p < 0.01 and FDR < 0.1) results and shows the relationship between the significance of miRNAs detected and the fold-change between eBL jaw and abdominal tumors. [score:4]
abdominal tumor hsa-miR-10a-5p MIMAT0000253 7.67e-06 0.001857 −2.873 Down-regulated Figure 2 (A) A volcano plot displaying the statistically significant (p < 0.01 and FDR < 0.1) results and shows the relationship between the significance of miRNAs detected and the fold-change between eBL jaw and abdominal tumors. [score:4]
A total of 437 genes were identified to be targeted by miR-10a-5p. [score:3]
miR-10a-5p expression was also found to be significantly lower in eBL patients who did not survive after starting chemotherapy treatment. [score:3]
The wilcoxon rank test confirmed the difference in expression level for miR-10a-5p between the jaw and abdominal tumors, and also between eBL survivors and non-survivors (p = 6.29e-05 and 0.0111, respectively). [score:3]
To investigate the potential functional significance of the DE miRNA (miR-10a-5p), its validated target genes were identified from Tarbase (Sethupathy et al., 2006) and miRTarbase (Hsu et al., 2014) in the validated target module of miRWalk2.0 (Table S3). [score:3]
Figure 6 Significantly enriched signaling pathways of the validated targets of miR-10a-5p. [score:3]
We show that there is low expression of miR-10a-5p in eBL patients presenting with jaw tumors and overall in patients who died. [score:3]
Figure 3 qRT-PCR validation of miR-10a-5p expression difference in jaw vs. [score:3]
The potential relevance of the miR-10a-5p in eBL tumors can best be discussed by examining its targets and implications for altering their function. [score:3]
Of the validated target gene set, there are multiple genes with some degree of correlation that would explain miR-10a association with patient survival outcome by impairing apoptotic death, CD59, API5, MDM4, and YY1 showed an inverse relationship with miR-10a levels. [score:3]
Figure S6 Gene ontologies enriched (Biological processes, Cellular components and Molecular functions) by the validated target genes of miR-10a-5p. [score:3]
We show a significant inverse correlation between miR-10a-5p and CD59 expression levels in eBL tumors (Figures 5A,B), pointing to a potentially functional miRNA-mRNA relationship which could promote tumor cell survival, chemoresistance and poor outcomes. [score:3]
In conclusion, we found evidence for an altered miR-10a-5p expression pattern between different tumor sites. [score:3]
The red colored circles represent miR-10a-5p which is differentially expressed with p < 0.01 and FDR < 0.02. [score:3]
Figure 5 (A) Pearson correlation scatter plot showing a negative correlation between hsa-miR-10a-5p and CD59 expression levels in eBL patients. [score:3]
Figure 4 qRT-PCR validation of miR-10a-5p expression difference in eBL survivors vs. [score:3]
Our analysis supports that miR-10a-5p is biologically relevant and that there is a set of targets that potentiate tumor resistance to apoptosis and chemotherapy. [score:3]
API5 has been shown to impair the cytotoxic effect induced by chemotherapeutic drugs (Faye and Poyet, 2010), while miR-10a-5p confers post-transcriptional regulation of API5 gene (Karginov and Hannon, 2013). [score:2]
When the expression of both human and viral miRNAs was compared between jaw and abdominal eBL tumor samples, one miRNA, hsa-miR-10a-5p (log2FC = −2.873, p = 0.0018 and FDR = 7.67e-06), was found to be significantly DE (Table 2; Table S3). [score:2]
Given the levels of miR-10a are very low in a number of samples we examined the upper half (log2miR-10a levels >10) and lower half (log2miR-10a levels <10) separately to look for regulation at higher levels of the miRNAs. [score:2]
miR-10a-5p validation by qRT-PCR. [score:1]
Using next generation sequencing and controlling for multiple comparisons, we identified miR-10a-5p to be DE between the two major eBL tumor presentation sites, and also uncovered pathways that are possibly enriched by this DE miRNA. [score:1]
Our analysis detected only one significant DE miRNA, hsa-miR-10a-5p (log2FC = −2.935, p = 1.12e-05 and FDR = 0.0013) (Table 3), which was significantly lower in non-survivors relative to survivors (Figure 2B; Table S3). [score:1]
An inverse correlation was observed between API5 and miR-10a-5p level, suggesting this interaction may influence response to treatment and eBL patient survival. [score:1]
These findings provide novel insight into the role of miRNA in the pathogenesis of eBL and a basis for future research on miR-10a-5p and CD59 involvement in eBL patient outcomes. [score:1]
miR-10a-5p showed 2.7-fold lower abundance in the jaw vs. [score:1]
To assess the reproducibility and validity of the miR-10a expression levels by deep sequencing we measured its levels by qRT-PCR. [score:1]
We also observed an inverse relation between miR-10a and MDM4 levels. [score:1]
The boxplot in Figures 3, 4, shows the median distribution levels of the log2 normalized relative quantity of miR-10a-5p in the eBL tumors. [score:1]
While only CD59 showed a significant (P < 0.05) inverse correlation with miR-10a levels (Figures 5A,B), overall, this analysis suggests that miRNA is modulating multiple genes in a consistent way that could impair patient survival. [score:1]
[1 to 20 of 55 sentences]
10
[+] score: 212
The cumulative distribution of the FC values for predicted miR-10 targets (red dotted lines; n=182) was significantly lower (shifted to the left) in comparison to that of all other genes, demonstrating that expression of miR-10 target genes is downregulated by expression of miR-10a/b (black lines; n=11,923, *** P<0.0001, Kolmogorov–Smirnov Z-test). [score:12]
We found that human MB cultures overexpressing miR-10a or miR-10b displayed reduced gene and protein expression of the ventral MB markers LMX1A and OTX2 (Fig.  6C-E,G), whereas NKX2.2 and GBX2, which is expressed directly caudal of the MB-HB organizer during human neural development, were upregulated (Fig.  6G). [score:12]
One interesting example of the miR-10 targets that were significantly downregulated by both miR-10a and miR-10b overexpression was Lin28A (Fig.  7D), which is an extensively studied RNA -binding protein implicated in brain development and brain cancer (Shyh-Chang and Daley, 2013; Yang et al., 2015). [score:9]
Thus, expression of miR-10 alone can influence the positional regional identity of human neural progenitors, a phenomenon that appears to be linked to pathways including WNT1 and/or MSX1, as these factors were downregulated by a brief exposure to miR-10 overexpression. [score:8]
We found that overexpression of either miR-10a or miR-10b led to a robust downregulation of both WNT1 and MSX1 (Fig.  7E), which are both expressed in the midbrain/hindbrain boundary and are involved in the patterning of mouse midbrain neurons (Arenas et al., 2015). [score:8]
Thereafter, we selected the putative miR-10 targets that were downregulated by both miR-10a and miR-10b overexpression (Fig.  7C). [score:8]
By contrast, the expression of FOXA2, which is expressed in ventral MB as well as in ventral HB, was unaffected by overexpression of miR-10a/b, indicating that miR-10 did not affect the dorso-ventral patterning of the cells (Fig.  6G). [score:7]
To identify miR-10 target genes in hNPCs, we calculated the fold change for each transcript after miR-10a or miR-10b overexpression, and analysed fold change distributions for transcripts that contain a conserved putative miR-10 target site (TargetScan). [score:7]
In order to identify transcripts that are direct miR-10 targets in human NPCs, we performed an experiment based on a short pulse of miR-10 overexpression, followed by RNA-seq and subsequent bioinformatics analysis (see Fig.  7A for schematic overview of the experiment). [score:6]
We found that miR-10a and miR-10b displayed high levels of expression in the posterior regions, particular the SC, at all developmental time points analysed, while we were unable to detect miR-10 expression in any FB or MB samples (Fig.  5E), confirming the RNAseq data. [score:6]
We identified miR-10 to be highly expressed specifically in the HB and spinal cord (SC), and identified 89 high-confidence miR-10 target genes, enriched for functions related to transcription, actin cytoskeleton and ephrin receptor signalling. [score:5]
We found that both miR-10a and miR-10b overexpression resulted in reduced mRNA levels for the majority of putative miR-10 targets (Fig.  7B), which is in line with the notion that miRNAs predominantly act by reducing mRNA levels (Guo et al., 2010). [score:5]
Finally, two members of the miR-10 family, implicated both in brain development and in cancer development (Lund, 2010; Woltering and Durston, 2008), were highly expressed by and exclusively associated with HB cells (Fig.  3L,M, Table 1). [score:5]
We performed gene ontology analysis on the 89 high-confidence miR-10 targets in hNPCs and found that miR-10 targets were enriched for functions related to transcription, actin cytoskeleton and ephrin receptor signalling (Fig.  7C). [score:5]
Next, we focused our analysis on miR-10, as this was the miRNA with the most distinct expression profile in the RNA-seq experiment, being highly expressed in HB but absent from FB and MB patterned human neural progenitors. [score:5]
Remarkably, we observed by immunocytochemistry that expression of the FB/MB marker OTX2 was suppressed in the vast majority of GFP [+] miR-10-transduced progenitors, whereas patches of OTX2 [+] progenitors were largely restricted to colonies of non-transduced progenitors (Fig.  6D,E). [score:5]
Transduction of hESCs with these vectors at a multiplicity-of-infection (MOI) of 50 resulted in robust expression of miR-10a/b expression upon addition of doxycycline (Fig. 6B-E). [score:5]
These reads in the miR-10 family, which primarily maps to miR-10a and miR-10b, suggest that miR-10 family members have a unique spatial regulation, resulting in very high-level expression only in the hindbrain. [score:4]
This list of 89 high-confidence miR-10 targets in hNPCs contained several interesting transcripts, which are likely to influence brain development and neuronal patterning (supplementary material Table S5). [score:4]
In addition, miR-10 has been linked to differentiation and cancer by regulating multiple target genes (Lund, 2010). [score:4]
Previous experiments in zebrafish have suggested that miR-10 represses its own expression as well as other transcripts in the Hox cluster via a complex autoregulatory loop (Woltering and Durston, 2008). [score:4]
In summary, this expression profiling demonstrated that miR-10a and miR-10b are absent from FB and MB regions of the human developing neural tube. [score:3]
We then extended the miR-10 analysis to also include qRT-PCR analysis of tissue samples dissected, including more caudal levels of the neuroaxis, and found that miR-10a and miR-10b expression is gradually increased in more posterior samples, reaching high levels in the SC (Fig.  5F). [score:3]
The functional analysis in hESCs show that one of the roles for miR-10 in hNPCs is related to patterning, as ectopic expression of miR-10 results in caudalization of these midbrain-patterned hNPCs. [score:3]
Similar enrichment in miR-10 family expression was also found in HB FP cells (Fig.  4E). [score:3]
Thus, miR-10 displays a highly specific regionalized expression pattern in the developing human brain, suggesting a role for miR-10 in caudalization of hNPCs. [score:3]
Overexpression of miR-10 caudalizes midbrain-patterned human neural progenitors. [score:3]
We used the data from the miRNA array of developing human brain samples to verify the HB-specific expression of miR-10. [score:3]
The expression of miR-10 was induced by adding doxycycline to the media on days 11-14, whereas no doxycycline was added to the control groups. [score:3]
At that time point, doxycycline was added to the culture media to activate mir-10 expression, the cells were harvested 3 days later for RNA isolation and used for poly-A enriched mRNA-sequencing (mRNA-seq). [score:3]
The identification of miR-10 as a miRNA that is highly and specifically expressed in the developing human hindbrain suggested a role for this miRNA in caudalization of human neural progenitors. [score:3]
Identification of miR-10 target genes. [score:3]
GFP (C-C‴), but only in a small proportion of the cells in which miR-10a or miR-10b are overexpressed (D-E‴). [score:3]
Expression of the miR-10 family constitutes more than half of all miRNAs in the FP cells of the HB. [score:3]
Doxycycline was added at the start of differentiation, resulting in induction of miR-10a/b expression (Fig.  6F); cells were then analysed using immunocytochemistry and qRT-PCR at day 16 of differentiation. [score:3]
Fig. 7. Identification of miR10 targets in hNPCs. [score:3]
Gene ontology (GO) analysis was performed on the shared targets, revealing miR-10 to be involved in functions related to transcription, actin cytoskeleton and ephrin receptor signalling. [score:3]
Thereafter, cells were differentiated towards a ventral MB fate (which lacks endogenous miR-10 expression) for 11 days. [score:3]
miR-10 display a robust regional-specific expression in the developing human brain. [score:3]
Thus, we conclude that miR-10a/b overexpression results in caudalization of differentiating hNPCs. [score:3]
Fig. 6. Overexpression of miR-10a and miR-10b caudalizes MB-patterned human neural progenitors. [score:3]
To this end, we transduced hESC with the doxycycline-regulated miR-10a and miR-10b lentiviral vectors. [score:2]
Modulation of miR-10 levels in hNPCs is likely to have broad and complex consequences, including influencing midbrain/hindbrain patterning via regulation of WNT1 and MSX1. [score:2]
miR-10 in development and cancer. [score:2]
To investigate whether miR-10a/b has a functional role in human neural patterning, we generated lentiviral vectors that allow for doxycycline-regulated overexpression of miR-10a and miR-10b as well as a GFP-reporter. [score:2]
Cells transduced with miR-10 constructs but grown without doxycycline were used as control. [score:1]
miR-10a. [score:1]
In the HB NE cells, the miR-10 -family represents 35% of all miRNAs, while it is absent from the FB and MB NE cells. [score:1]
However, HB NE cells display a large fraction of reads (35%) mapping to the miR-10 family (Fig.  4C). [score:1]
Our data show that modulation of miR-10 levels affect a large number of genes, resulting in broad transcriptional changes. [score:1]
Finally, gain-of-function experiments suggested a key role for miR-10 in caudalizing human neural progenitors (hNPCs). [score:1]
Finally, we investigated whether the short pulse of miR-10 overexpression also influences genes known to be involved in midbrain/hindbrain patterning. [score:1]
GFP, LV-miR-10a or LV. [score:1]
Both miR-10a and miR-10b are located in the Hox cluster (Woltering and Durston, 2008). [score:1]
Taken together, these data identify a large network of genes controlled by miR-10 in hNPCS. [score:1]
[1 to 20 of 55 sentences]
11
[+] score: 165
Other miRNAs from this paper: mmu-mir-10b, hsa-mir-10b, mmu-mir-10a, rno-mir-10a, rno-mir-10b
Hierarchical clustering of the differentiated expressed genes (DEGs) showed that the DEG expression patterns were quite similar regardless of whether miR-10a or miR-10b was overexpressed in GCs, implying similar functions for miR-10a and miR-10b in GCs (Fig. 4B). [score:7]
To summarize, these results showed that FSH, FGF9 and TGF pathway signalling could inhibit miR-10a and miR-10b expression in hGCs, mGCs and rGCs, which suggests that the FSH/FGF9 and TGF-β pathway may function as an upstream regulator of miR-10a and miR-10b in GCs; these effects were conserved among different species (Fig. 3D). [score:6]
To determine whether BDNF was direct target of miR-10a and miR-10b, the putative miR-10 target 3′ UTR was cloned into a reporter plasmid downstream of a luciferase gene (Fig. 5F). [score:6]
Similar to GCs overexpressing the miR-10 family, proliferation was inhibited (Fig. 6A) and apoptosis was induced (Fig. 6B) upon BDNF knockdown. [score:6]
To further identify the associated pathways and direct targets of miR-10a and miR-10b in GCs, RNA-seq was performed for miR-10a/b -overexpressing granulosa cells (Fig. 4A). [score:6]
By combining the RNA-seq and miRNA target prediction software results, BDNF was predicted to be a potential direct target of miR-10a/b in GCs (Fig. 5A). [score:6]
In conclusion, we found that miR-10 family members, including miR-10a and miR-10b, are expressed at basal levels in GCs but are highly expressed in theca and stroma cells within the ovary. [score:5]
miR-10a and miR-10b directly targeted BDNF in GCs, suggesting that the miR-10 family might also affect other normal ovary functions apart from GC development. [score:5]
Here, we demonstrated that two members in the miR-10 family, miR-10a and miR-10b, function as anti-proliferation and pro-apoptosis factors in human, mouse and rat GCs by directly targeting the 3′ UTR of BDNF in GCs. [score:4]
Gene ontology results suggested that miR-10a and miR-10b target genes were highly related to cell growth, proliferation, development and reproduction (Fig. 4C and Supplementary Fig. 1D). [score:4]
These results indicated that BDNF was a direct target of miR-10a and miR-10b in GCs. [score:4]
BDNF is a direct target of the miR-10 family in granulosa cells. [score:4]
To prove that the downstream target of the miR-10 family, BDNF, could mediate the function of the miR-10 family in GCs, shRNA was used to knockdown BDNF in GCs (Supplementary Fig. 1G). [score:4]
BDNF is a direct target of miR-10a/b in GCs. [score:4]
miR-10a and miR-10b expression in granulosa cells is regulated by extrinsic/intrinsic signals. [score:4]
To further confirm that the anti-proliferative and pro-apoptotic functions of the miR-10 family in GCs are at least partially via BDNF, recombinant BDNF was used to treat miR-10a/b -overexpressing GCs. [score:3]
miR-10 family expression in normal and atretic granulosa cells. [score:3]
miR-10 family expression was abundant in the remaining GCs in atretic follicles (Fig. 1F). [score:3]
A putative miR-10 binding site in the BDNF 3′-untranslated region (UTR) was also identified (Fig. 5B). [score:3]
Using fluorescence in situ hybridization (FISH), both miR-10a and miR-10b were shown to be expressed in mouse and rat GCs (Fig. 1C and Supplementary Fig. 1C). [score:3]
The opposite expression patterns for BDNF and the miR-10 family in GCs further indicated the repressive effect of miR-10a/b on BDNF (Fig. 5C). [score:3]
By using RNA-seq screening, bioinformatics prediction, qPCR, Western blot analysis, luciferase reporter assays and FISH-IF validation, BDNF was identified as a direct target of the miR-10 family in GCs. [score:3]
As validated by, BDNF was inhibited at the mRNA by the miR-10 family in GCs (Fig. 5D). [score:3]
MiRNAs are small non-coding RNAs that repress mRNA translation at the post-transcriptional level 7. Many miRNAs that share a common “seed sequence” form a family and are located on different chromosomes in the genome; one such example is the miR-10 family, which is a highly conserved family among different species. [score:3]
As shown in Fig. 3B, treatment with these TGF-β superfamily ligands inhibited miR-10a and miR-10b in GCs. [score:3]
By using RNA-seq and qPCR, miR-10a and miR-10b were shown to inhibit many key genes within the TGF-β pathway, including ligands, receptors and transcription factors. [score:3]
As shown in Fig. 5E, miR-10a/b overexpression led to a significant decrease in BDNF protein levels compared with the negative control. [score:2]
Taken together, these results suggest that miR-10a and miR-10b might play a negative role in follicle development. [score:2]
In this study, we found that these critical regulatory factors could repress miR-10a and miR-10b in granulosa cells, further indicating the negative roles of the miR-10 family during folliculogenesis. [score:2]
Both miR-10a and miR-10b could repress proliferation and induce apoptosis in human, mouse and rat granulosa cells, at least partly through repressing BDNF by directly binding to its 3′ UTR. [score:2]
How to cite this article: Jiajie, T. et al. Conserved miR-10 family represses proliferation and induces apoptosis in ovarian granulosa cells. [score:1]
However, the function of the miR-10 family is still unknown in other species, such as humans, mice and rats. [score:1]
The general function of the miR-10 family in granulosa cells. [score:1]
These results indicate that the miR-10a and miR-10b precursors and mature sequences are highly conserved and might have similar functions in mammals. [score:1]
The miR-10 family has two members, miR-10a and miR-10b. [score:1]
miR-10 family members repressed proliferation and induced apoptosis in granulosa cells. [score:1]
Additionally, the TGFβ pathway and miR-10a/b form a negative feedback loop in GCs. [score:1]
Both miR-10a and miR-10b were induced by TGF-β1 in GC. [score:1]
Some essential genes in this pathway, including ACVR2A, ACVR2B, SMAD1, SMAD3, BMP4 and AMH, were significantly repressed by both miR-10a and miR-10b in GCs (Fig. 4E). [score:1]
Taken together, the results showed that BDNF could at least partially mediate the function of the miR-10 family in GCs. [score:1]
All of the cells were transfected with 20 nM of either miR-10a or miR-10b mimic (GenePharma) using the Lipofectamine RNAiMAX transfection reagent and Opti-MEM medium (Life Technologies) according to the manufacturer’s instructions. [score:1]
Effects of exposure to hormone and growth factors on miR-10a and miR-10b in granulosa cells. [score:1]
BDNF rescues miR-10 family-caused effects in GCs. [score:1]
We also identified six asymmetric bulges in the structures of the hsa-miR-10a and hsa-miR-10b duplexes (Fig. 1B). [score:1]
It was also reported that miR-10 could repress proliferation in porcine granulosa cells 19. [score:1]
miR-10a and miR-10b repress proliferation and induce apoptosis in human, mouse and rat granulosa cells. [score:1]
HEK293T cells grown in 24-well plates were transfected with 50 nM miR-10a and miR-10b mimic (GenePharma, China) and 100 ng of pmirGLO vector (Promega, USA) tagged with either a BDNF 3′ UTR that includes the miR-10 binding sites or the empty plasmid using Lipofectamine 2000 (Invitrogen, USA). [score:1]
These data confirmed that the miR-10 family simultaneously represses proliferation and induces apoptosis in GCs; this effect is conserved among humans, mice and rats. [score:1]
BMP4 and BMP15 are from the BMP family, and Activin A is a member of the Activin family, and all are components of the TGF-β pathway 23, suggesting that the TGF-β signalling pathway might also repress the miR-10 family in GCs. [score:1]
Moreover, the miR-10 family and the TGF-β pathway form a negative feedback loop in GCs. [score:1]
Both miR-10a and miR-10b gradually decreased during follicle maturation (Fig. 1D) and increased by follicle atresia, as determined by (Fig. 1E). [score:1]
This study provides new insights into how the miR-10 family functions in the female reproductive system. [score:1]
These results indicate that the miR-10 family has similar functions in GCs in different species. [score:1]
As expected, the mediator of FSH in GCs, cAMP, also greatly repressed miR-10a and miR-10b in GCs (Fig. 3A). [score:1]
The seed region (UCAAGUA) of miR-10 is conserved among vertebrate species. [score:1]
miR-10 family is highly conserved among different species. [score:1]
Consistent with these observations, our data showed that the miR-10 family decreased proliferation and induced apoptosis in granulosa cell. [score:1]
miRCURY LNA miRNA detection probes for miR-10a and miR-10b were purchased from Exiqon (613307–310 and 613028–310, respectively; Vedbaek, Denmark). [score:1]
The results showed that both the miR-10a and miR-10b mimics repressed the fluorescence from the 3′ UTR compared with the negative control, indicating that miR-10a and miR-10b could directly bind to the BDNF 3′ UTR. [score:1]
In contrast, apoptosis was induced by miR-10a and miR-10b in GCs of different species (Fig. 2C). [score:1]
By using Ki-67 staining, the proliferation of GCs was also found to be repressed by the miR-10 family (Fig. 2B). [score:1]
SVOG cells were collected 48 h after transfection with miR-10a/b mimics and/or negative control. [score:1]
BDNF rescues miR-10a- and miR-10b -induced proliferation repression and apoptosis induction in GCs. [score:1]
The effect of the miR-10 family on GCs on a transcriptome-wide scale. [score:1]
The nucleotide sequence of the miR-10a and miR-10b precursors are highly conserved in mammals (Fig. 1A). [score:1]
As expected, BDNF could rescue GC apoptosis caused by miR-10a and miR-10b mimic transfection (Fig. 6D). [score:1]
Therefore, we tested the effect of recombinant TGF-β1 on miR-10a/b in GCs. [score:1]
miR-10 was identified as a specific marker for mouse granulosa cells from previous miRNA-sequencing results 17. [score:1]
We also identified that miR-10a/b and the TGF-β pathway form a negative feedback loop in granulosa cells. [score:1]
The mature hsa-miR-10a-5p and hsa-miR-10b-5p sequences are UACCCUGUAGAUCCGAAUUUGUG and UACCCUGUAGAACCGAAUUUGUG, respectively, and have only one different nucleotide. [score:1]
The results showed that FGF9 could also greatly repress the miR-10 family in GCs (Fig. 3A). [score:1]
miR-10a and miR-10b mimic treatment significantly reduced the viability of human, mouse and rat GCs (Fig. 2A). [score:1]
To further explore whether BDNF mediates the function of the miR-10 family in GC apoptosis, GCs were co -treated with miR-10 family mimics in the presence of recombinant BDNF or vehicle control. [score:1]
Identification of miR-10a and miR-10b in granulosa cells. [score:1]
Follicle-stimulating hormone (FSH) could stimulate granulosa cells to convert androgens to oestradiol via aromatase 20 and maintain GC proliferation and maturation 21. miR-10a and miR-10b were significantly decreased by recombinant human FSH in hGCs, mGCs and rGCs (Fig. 3A). [score:1]
Additionally, many hormones and growth factors in the ovary repressed the miR-10 family in GCs. [score:1]
These results indicate that autocrine and/or endocrine signals from hormones or growth factors during granulosa cell differentiation are involved in repressing the miR-10 family in GCs. [score:1]
Considering that TGF-β superfamily ligands could greatly repress the miR-10 family in GCs, this result suggests that the miR-10 family and the TGF-β pathway might be involved in a negative feedback loop. [score:1]
Based on small RNA-seq from a previous study, miR-10 is a specific marker for mouse granulosa cells 17. [score:1]
[1 to 20 of 79 sentences]
12
[+] score: 123
Our results showed that the expression of miR-10a-5p was down-regulated after stimulation with IL-1β, although the mechanism by which the expression of miR-10a-5p is regulated is not yet clear. [score:9]
Another study also reported that miR-10a expression level was down-regulated in the synovial tissues and FLSs of RA patients [17]. [score:6]
The expression level of miR-10a-5p was significantly up-regulated up to 90% in SW982 cells after transfection with miR-10a-5p mimic (Figure 1B). [score:6]
Summarily, we have proved that TBX5 regulated by miR-10a-5p could promote synoviocyte proliferation and suppress apoptosis, which reveals a new mechanism of miR-10-5p and its target TBX5 in arthritis. [score:6]
Recently, we found that down-regulation of miR-10a-5p in synoviocytes contributes to joint inflammation via targeting T-box transcription factor 5 (TBX5) [14]. [score:6]
Expression level of miR-10a-5p is down-regulated in synoviocytes with IL-1β stimulation. [score:6]
MiR-10a-5p showed gradually down-regulated expression in SW982 cells with the increase in IL-1β concentration, and it was significantly reduced upon 5 and 10 ng/ml IL-1β stimulation (Figure 1A). [score:5]
Overexpression of miR-10a-5p inhibits the proliferation of synoviocytes. [score:5]
A number of studies have proved that unusual expression of miRNAs in disease condition is not by chance but mostly functions in arthritis [16], in which miR-10a-5p is vital one involving in joint inflammation. [score:5]
We found that miR-10a-5p can promote proliferation and inhibits apoptosis in inflamed synoviocytes, suggesting that low expression levels of miR-10a-5p during the pathogenesis of RA could have momentous effects on synovial cell proliferation and apoptosis processes. [score:5]
Our findings suggested that up-regulation of miRNA-10a-5p can resist the proliferation of synoviocytes. [score:4]
We have confirmed that miR-10a-5p targets TBX5 to be involved into joint inflammation, but whether TBX5 also participated in the regulation of cell proliferation and apoptosis remained unclear. [score:4]
First, synovial sarcoma cell line (SW982) was stimulated with different doses of IL-1β for 24 h and relative expression level of miR-10a-5p was determined by RT-qPCR (A). [score:3]
In our previous study, TBX5 was confirmed as a target gene of miR-10a-5p [14]. [score:3]
Therefore, we conclude that miR-10a-5p could inhibit cell proliferation but promote synoviocyte apoptosis, besides contributing to inflammation. [score:3]
We found that miR-10a-5p targeting TBX5 play their role in joint inflammation. [score:3]
In the present study, we intended to explore the role of miR-10a-5p and its target gene TBX5 in apoptosis and proliferation processes of synoviocytes, which would be an important supplement for the function of miR-10a-5p. [score:3]
Hence, miRNA -based therapy is a brilliant method of treating RA, and our findings might present a potential therapeutic target, miR-10a-5p, for the treatment of RA patients. [score:3]
Recently, we have found that miR-10a-5p expression is decreased in the synovium of RA patients as well as in IL-1β stimulated synoviocytes [14]. [score:3]
Overexpression of miR-10a-5p promotes programmed cell death of synoviocytes. [score:3]
Then, SW982 cells were transfected with miR-10a-5p mimic, and relative expression level of miR-10a-5p was determined by RT-qPCR (B). [score:3]
Reduced expression of miR-10a triggers the activation of nuclear factor-κB (NF-κB) signaling pathway and promotes the proinflammatory factors [26], which results in increased cell proliferation, migration, invasiveness or angiogenesis, decreased apoptosis or dedifferentiation. [score:3]
Thus, miR-10a-5p might modulate cell apoptosis, the proliferation of synoviocytes via targeting TBX5, which is an important supplementary mechanism to miR-10a-5p in arthritis. [score:3]
Figure 1First, synovial sarcoma cell line (SW982) was stimulated with different doses of IL-1β for 24 h and relative expression level of miR-10a-5p was determined by RT-qPCR (A). [score:3]
The relative expression level of miR-10a-5p was normalized by U6 snRNA. [score:3]
MiR-10a-5p inhibited the proliferation of SW982 cells. [score:2]
Mounting evidence has reported that miR-10a regulates cell proliferation, migration, and invasion, and hence plays essential roles in a variety of cancers, for example, extrahepatic cholangiocarcinoma, prostate, colon cancer, esophageal squamous cell carcinoma, and head and neck squamous cell carcinoma [22–25]. [score:2]
The regulatory mechanism of the miR-10a-5p-TBX5 will be a target of further investigation in our future study. [score:2]
The results of flow cytometry showed that the percentage of Annexin V-FITC and PI double positive cells was significantly increased in miR-10a-5p mimic transfected group compared with NC group, indicating an increased rate of apoptosis in miR-10a-5p overexpressed synoviocytes (Figure 2A,B). [score:2]
We consider that this molecular mechanism based on miR-10a-5p function would provide useful clues for the treatment of RA patients. [score:1]
After 48 h of transfection with mimic miR-10a-5p or si-TBX5, SW982 cells were treated with trypsin and collected in 1.5 ml tubes. [score:1]
Figure 2SW982 cells were transfected with miR-10a-5p mimic or NC mimic and treated with IL-1β for 24 h, and cell apoptosis was detected by flow cytometer (A). [score:1]
SW982 cells were transfected with miR-10a-5p mimic or NC mimic and treated with IL-1β for 24 h, and cell apoptosis was detected by flow cytometer (A). [score:1]
In our previous study, we found that the level of miR-10a-5p was less in RA synovium than that in osteoarthritis (OA) [14]. [score:1]
Moreover, miR-10a-5p mimic and NC mimic transfected cells were treated with IL-1β, and cell proliferation was detected at 0, 12, 24, and 48 h by using CCK-8 kit (C). [score:1]
Decrease in miR-10a-5p and increase in TBX5 could induce the production of proinflammatory cytokines and chemokine, but the role of miR-10a-5p in other aspects of synoviocytes remains poorly understood. [score:1]
Before the transfection of SW982 cells, cells were cultured in 12-well or 6-well plates for 24 h. MiRNA control mimic (5′-UUG UAC UAC ACA AAA GUA CUG-3′), miR-10a-5p mimic (5′-UAC CCU GUA GAU CCG AAU UUG UG-3′), siRNA of TBX5 (Si-TBX5) (F: 5′-GGG CAC GGA AAU GAU CAU ATT-3′; R: 5′-UAU GAU CAU UUC CGU GCC CTT-3′), and negative control (si-NC) (F: 5′-UUC UCC GAA CGU GUC ACG UTT-3′; R: 5′-ACG UGA CAC GUU CGG AGA ATT-3′) (Gene Pharma, Shanghai, China) were transfected at a final concentration of 50 nM with Lipofectamine 2000 (Invitrogen, U. S. A. ). [score:1]
After transfection with mimic miR-10a-5p or si-TBX5, SW982 cells were cultured in 96-well plates. [score:1]
[1 to 20 of 38 sentences]
13
[+] score: 120
If repression of the WT vector relative to the mut vector was observed, they were then co -transfected with miR-125b or miR-10a inhibitor (125I/10I) or negative control (NC) inhibitor to knock down the miRNA expression and ‘rescue’ the repression. [score:8]
The identity of transcripts exhibiting higher expression in the mature cell types relative to progenitors was combined with target predictions for miR-125b (c) and miR-10a (d), both miRNAs with lower expression in the mature cells. [score:7]
miRIDIAN hairpin inhibitor control siRNA (IN-001005-01-05) or siRNA targeting miR-125b and miR-10a (IH-300595-05, IH-300549-05 respectively, all from Thermo Scientific Dharmacon) were used to suppress miRNA activity. [score:7]
Apart from the validated target HOX1A, qRT-PCR -based target validation suggests the cell growth inducer USF2 as another target of miR-10a important in megakaryocytopoiesis [80]. [score:7]
While the targeting of KLF4 by miR-10a has been previously suggested to be relevant in AML [78], we have shown that the decrease in miR-10a expression upon primary myeloid differentiation and the consequent release of repression may be necessary for monocytopoiesis (Fig.   6c). [score:5]
To experimentally validate these miRNA-target interactions we used HeLa cells in which we had confirmed the presence of endogenously expressed miR-125b and miR-10a by qRT-PCR (Supplementary Figure 4). [score:5]
In summary, luciferase reporter assays confirmed both MCL1 and FUT4 as direct targets of miR-125b and KLF4 as a target of miR-10a. [score:5]
Other hematopoietic regulators that are targets of miR-10a repression include BCL-6 and NCOR2, transcriptional repressors involved in T cell differentiation [79]. [score:4]
miR-10a is another regulator of myeloid and lymphoid differentiation targeting BCL-6 and NCOR2 in lymphopoiesis, USF2 and HOXA1 in megakaryocytopoiesis, and KLF4 in monocytopoiesis. [score:4]
Mean expression of miR-10a was a hundred-fold lower in both monocytes and granulocytes, making the levels too low to be detected from the remaining five monocyte and granulocyte samples. [score:3]
The top 1000 gene candidates that were increased in monocytes and granulocytes versus myeloid progenitors were combined with the target predictions for miR-125b and miR-10a (Fig.   4c and d). [score:3]
Figure 5Gene targets of miR-125b and miR-10a. [score:3]
Identification of predicted targets of miR-125b and miR-10a. [score:3]
The resulting 162 candidates for miR-125b and 161 candidates for miR-10a that were both predicted targets and had inverse expression patterns to the miRNAs were investigated further through literature searches. [score:3]
Increased in Bissels et al. and this studyIncreased in Liao et al. and this studyIncreased in Cattaneo et al. and this study Commonly increased in three studies miR-484 miR-16 nil miR-142-3p miR-425-5p miR-27a miR-142-5p miR-191 Decreased in Bissels et al. and this study Decreased in Liao et al. and this study Decreased in Cattaneo et al. and this study Decreased in Bissels et al. and Cattaneo et al. miR-146a miR-127 miR-126-5p miR-29b-3p miR-146b-5p miR-100 miR-99a miR-10a miR-125b miR-125a-5p These data together suggest a signature of miRNA expression associated with differentiation status and maturation within the myeloid lineage. [score:3]
Increased in Bissels et al. and this studyIncreased in Liao et al. and this studyIncreased in Cattaneo et al. and this study Commonly increased in three studies miR-484 miR-16 nil miR-142-3p miR-425-5p miR-27a miR-142-5p miR-191 Decreased in Bissels et al. and this study Decreased in Liao et al. and this study Decreased in Cattaneo et al. and this study Decreased in Bissels et al. and Cattaneo et al. miR-146a miR-127 miR-126-5p miR-29b-3p miR-146b-5p miR-100 miR-99a miR-10a miR-125b miR-125a-5p These data together suggest a signature of miRNA expression associated with differentiation status and maturation within the myeloid lineage. [score:3]
We focused on two miRNAs miR-125b and miR-10a and uncovered their potential role in this process by identifying their likely mRNA targets. [score:3]
In lymphopoiesis miR-10a expression is induced by retinoic acid and TGFß [79]. [score:3]
As there was a clear association of decreased expression of these miRNAs with more mature phenotypes, we further explored two family members, miR-125b and miR-10a in this context. [score:3]
miR-223, miR-125b, miR-10a, miR-196b and miR-135a showed similar patterns of expression to that observed in the TLDA data. [score:3]
We also identified and experimentally validated some novel targets of miR-125b and another myeloid-relevant miRNA, miR-10a in this particular cellular context. [score:3]
The second miRNA examined in this study, miR-10a, also exhibits decreasing expression during differentiation. [score:3]
These data confirm the decrease in expression of miR-10a and miR-125b during early myeloid differentiation. [score:3]
The 3′ UTRs were cloned into a pSiCHECK2 vector and transfected with or without a specific inhibitor of mir-125b/ miR-10a or a non-specific control at 10 nM or 50 nM. [score:3]
Figure 3Decreased expression of miR-125b and miR-10a is associated with increased lineage commitment of myeloid progenitors. [score:3]
Decreased expression of miR-10 family members is associated with increased lineage commitment. [score:3]
Experimental confirmation of targets of miR-125b and miR-10a by luciferase assays. [score:2]
Figure 6The miR-223, miR-125b and mir-10a regulatory circuits in human hematopoiesis. [score:2]
Previously, a decrease in miR-10a has been reported during megakaryocytopoiesis [75] and knock down of miR-10a in CD133 [+] progenitors can induce megakaryocytic differentiation via the transcription factor HOX1A [76]. [score:2]
Cells were sampled at days 1, 2 and 3 and levels of miR-125b and miR-10a assessed by qRT-PCR. [score:1]
Levels of miR-10a mirrored this and decreased 50% by day 3 with SCF and 80% with IL-3. While SCF and IL-3 by themselves can stimulate granulocyte/macrophage colony formation, the combination of SCF with GCSF is a more potent and specific inducer of myeloid commitment in CD34 [+] cells in liquid and semi-solid cultures [38]. [score:1]
Prior to our experiments in primary CD34 [+] cells, we tested the short-term effects of these cytokines on levels of miR-125b and miR-10a and found them to cause a relatively modest decrease in their levels. [score:1]
Over a similar time course qRT-PCR showed a seven-fold decrease in miR-125b and approximately ten-fold decrease in miR-10a by day 9 (Fig.   3c). [score:1]
The miRBase database lists miR-s-10a, -10b, -125a, -125b, -99a, -99b and -100 as members of the miR-10 family. [score:1]
The KLF4 gene has one predicted binding site for miR-10a in its 3′ UTR. [score:1]
The Hox-cluster encoded miR-10a could be amplified from all the progenitor samples but only from seven monocyte samples and eight granulocyte samples. [score:1]
KLF4 mRNA contains a predicted miR-10a binding site, which is also highly conserved in vertebrate species (Fig.   5a). [score:1]
These include five of the eight members of the miR-10 gene family (miRs-10a, -99a, -100, -125a and -125b, as classified by miRBase) (Fig.   2f, top panel) and also several clustered miRNAs (miRs-20a, -20b and -92, Fig.   2f middle and lower panels). [score:1]
Levels of miR-10a mirrored this and decreased 50% by day 3 with SCF and 80% with IL-3. While SCF and IL-3 by themselves can stimulate granulocyte/macrophage colony formation, the combination of SCF with GCSF is a more potent and specific inducer of myeloid commitment in CD34 [+] cells in liquid and semi-solid cultures [38]. [score:1]
Cytokine mediated in vitro differentiation of progenitors towards the granulocytic phenotype with GCSF (and SCF) resulted in the decrease of both miR-125b and miR-10a to a much greater degree (approx. [score:1]
[1 to 20 of 40 sentences]
14
[+] score: 114
To further demonstrate that GP1BA is a target gene of miR-10a and -10b, we transfected the β/IX -expressing Chinese Hamster Ovary (CHO) cells with a mixture of the human GP Ibα expression vector and miR-10a/b or negative control miRNA mimics, to examine if GP Ibα expression changes at the protein level. [score:9]
When we transfected miR-10a or -10b mimics into either the GP Ibβ/GP IX -expressing cells along with a DNA construct harboring both the coding and 3′-UTR sequences of the human GP1BA gene, or murine lineage negative cells prior to megakaryocytic differentiation, we found that miR-10a and -10b mimics inhibit the GP Ibα mRNA expression and transient expression of GP Ibα protein on the cell surface, as compared to the negative control miRNA or other miRNA mimics tested. [score:8]
Does dysregulated expression of HoxB4 alter normal megakaryopoiesis due to a simultaneous dysregulation of miR-10a production and therein GP Ibα expression? [score:7]
In agreement, it has been reported that the expression levels of miR-10a were significantly down-regulated by ~50-fold [15], which occurred 4 days after in vitro megakaryocytic differentiation of hematopoietic CD34 [+] progenitor cells. [score:6]
Considering the fact that miR-10a and -10b differ in only one nucleotide (Figure 1D, dotted) and have an identical seed sequence, our data demonstrated that miR-10a and -10b can negatively regulate the expression of the GP1BA gene through the base pairing of their seed sequences to the complementary target site in the 3′-UTR of the human GP1BA gene. [score:6]
Thus, our data demonstrate that GP Ibα is a novel regulatory target of miR-10a and -10b, and suggest that a reduction of the miR-10a and -10b levels is essential for the normal progression of the late stage of megakaryopoiesis by promoting a sufficient expression of GP Ibα and subsequent formation of the GP Ib-IX-V complex on the surface of megakaryocytes and platelets. [score:6]
Furthermore, by performing a literature review, we found that miR-10a, miR-10b and miR-107 were previously reported to be involved in the regulation of hematopoietic gene expression [15, 19], and miR-299-3p is predicted to target the 3′-UTRs of both human and mouse GP1BA gene. [score:6]
Interestingly, we found that upon mutation the strong inhibitory effect we observed initially was abolished through use of the mutant constructs (Figure 1E), indicating that the predicted target sites of miR-10a and -10b in the 3′-UTR of the human GP1BA gene are functional. [score:6]
In addition, we also tested miR-10a or -10b inhibitors in this megakaryocyte differentiation system; we observed neither an early expression of GP Ibα mRNA at day 1 nor a significant increase of GP Ibα mRNA level at day 2 (Figure 2C). [score:5]
Based on these previous observations and the data from this study, it is conceivable that active expression of human GP Ibα in the late stage of megakaryocyte differentiation depends on a significant reduction of the miR-10a expression. [score:5]
In particular, we have established a connection between two previous observations, i. e., drastic decrease in the expression of miR-10a and -10b accompanied by a marked production of sufficient amounts of GP Ibα molecules in the late stage of megakaryocyte development, two critical steps for normal megakaryocytic endomitosis and platelet production. [score:4]
Taken together, our study identifies GP Ibα as a novel and physiologically relevant target of miR-10a and -10b, and provides a new piece of information to our pool of knowledge regarding the miRNA -based regulation of megakaryopoiesis. [score:4]
Therefore, we chose to assess four miRNAs (miR-10a, miR-10b, miR-107, and miR-299-3p) and investigate if they can target the 3′-UTR and regulate the expression of human GP Ibα (Figure 1A). [score:4]
Nevertheless, our data demonstrate that miR-10a and -10b can repress human GP1BA gene expression through miRNA -mediated mRNA degradation. [score:3]
However, PITA prediction showed that only the first five of these seven miRNAs are potentially capable of targeting the human GP1BA gene (miR-10a, -10b, -107, -153, and -299-3p). [score:3]
In the human genome, miR-10a is located upstream of the HoxB4 (Homeobox B4) gene within the HOXB (Homeobox B) gene cluster of chromosome 17q21 and its expression corresponds to that of HoxB4. [score:3]
A half million enriched Lin [−/−] cells were first transfected with 80 nM of miR-10a/b mimics or inhibitors (Qiagen) or negative control miRNA mimics using a HiPerFect Transfection Reagent (Qiagen). [score:3]
As shown in Figure 2B, upon megakaryocytic differentiation, these cells progressively express increasing amounts of human GP Ibα mRNA, the level of which was decreased by ~40% (densitometry analysis, Figure 2D) or 2–3-fold (qPCR quantification, Figure 2E) 4 days after the introduction of exogenous miR-10a or -10b. [score:3]
PCR conditions for miR-10a and miR-10b were as follows: 95 °C for 15 min followed by 40 cycles of 94 °C for 15 s, 57 °C for 30 s and 70 °C for 40 s. The 2−ΔΔ Ct method was used to determine relative expression levels. [score:3]
A total of 173 miRNAs were predicted to bind to the 3′-UTR of the human GP1BA gene by TargetScan, seven of which were also returned by miRanda (miR-10a, -10b, -107, -153, -299-3p, -300 and -381). [score:3]
Interestingly, we also employed the same bioinformatics approach to analyze the 3'-UTRs of other GP Ib-IX-V subunit genes, i. e., GP Ibβ, GP IX and GP V, and found that, of the proteins forming the GP Ib-IX-V complex, miR-10a and -10b specifically regulate the human GP1BA gene only. [score:2]
Meanwhile, because miR-10a and -10b do not introduce any mutations to the GP Ibα coding sequence, and thereby do not alter the amino acid composition in the mature GP Ibα protein, it is unlikely that miR-10a and miR-10b can alter GP Ib-IX-V complex formation. [score:2]
To the best of our knowledge, miR-10a and -10b are the first two miRNAs that have been identified and experimentally validated for human GP1BA gene regulation. [score:2]
To further evaluate the specificity, we mutated the seed sequences of the putative miR-10a and -10b targeting sites in the GP1BA 3′-UTR (Figure 1D, underlined), and tested if miR-10a and -10b mimics could inhibit the activity of the firefly luciferase in the mutant construct as compared to the cells transfected with the wild-type constructs. [score:2]
How is the miR-10a host gene, HoxB4, regulated during megakaryocyte differentiation? [score:2]
We also quantified the levels of miR-10a and -10b mimics within the progenitor cells at day 4, and found the levels of transfected miR-10a and -10b mimics were increased by approximately 30-fold (Figure 2F), a ratio comparable to the degree of reduction of these two miRNAs in the late stage of human megakaryopoiesis (~12–50-fold) [15]. [score:1]
In our study, we searched for potential binding sites for miR-10a and -10b in these two regions of the human GP1BA gene, and found that only the 3′-UTR possesses such sites. [score:1]
One, how is the GP Ibα mRNA degraded by miR-10a in megakaryocytes? [score:1]
Site-directed mutagenesis was performed to remove the putative miR-10a or -10b recognition sites in these constructs (MT-3′-UTR reporter) by using the following two primers (Stratagene): 5′-CCCTCCCTATCAGGGAGTGTTCCTTACCTCCAAC-3′ and 5′-AGGAACACTCCCTGATAGGGAGGGGTCTTAGTTCC-3′. [score:1]
One day after seeding, the cells were transfected with 0.5 μg pDX-hGP Ibα plasmid DNAs along with 80 nM of miR-10a/b or negative control miRNA mimics using an Attractene Transfection Reagent. [score:1]
However, sustaining high levels of miR-10a and miR-10b cause degradation of GP Ibα mRNA, resulting in low amounts of GP Ibα protein. [score:1]
After we co -transfected this reporter construct into HeLa cells along with various concentrations of miRNA mimics (ranging from 5 to 40 nM), only the cells co -transfected with the miR-10a or -10b mimics showed a significant reduction in their firefly luciferase activities (Figure 1C). [score:1]
[1 to 20 of 32 sentences]
15
[+] score: 112
Based on this evidence, we hypothesize that mTOR inhibitors upregulate miR-10a expression, which in turn desensitizes cells to mTOR inhibitors response. [score:10]
All of the genes (including the positive control, HOXA1) were regulated by miR-10a in the same manner: miR-10a mimic significantly suppressed gene expression, while miR-10a inhibitor rescued gene expression (P < 0.05), as shown in Figure 5E. [score:10]
We have also shown that inhibition of mTOR by Rapamycin upregulated miR-10a (Figure 5C), a process that might create a feedback loop resulting in desensitization of cells to mTOR inhibitors. [score:8]
miR-10a inhibitor “rescued” gene expression and mimic repressed gene expression in Caki2 cell line compared with inhibitor negative control or mimic negative control. [score:8]
One microRNA (miR-10a) was shown to desensitize response to mTOR inhibitors (Figure 5D), and also affected the expression of several candidate genes that influenced sensitivity to mTOR inhibitors (Figure 5E). [score:7]
To further pursue the effect of microRNA on gene expression, we performed an association study of miR-10a with mRNAs whose expression levels were highly associated with Rapamycin and Everolimus cytotoxicity (P < 10 [−4]). [score:5]
In addition, Rapamycin treatment significantly enhanced miR-10a expression in a dose dependent manner (Figure 5C, P < 0.05), suggesting that miR-10a might be suppressed by mTORC1 activation. [score:5]
SiRNA duplex for candidate genes and negative control, as well as miR-10a inhibitor, microRNA inhibitor negative control, miR-10a mimic and microRNA mimic negative control were all purchased from Dharmacon Inc. [score:5]
Thirty-one mRNA expression probe sets (28 genes) were determined to be highly associated with miR-10a expression (P < 10 [−4]) (Supplementary Table S7). [score:5]
Therefore, upregulation of miR-10a might be one mechanism for acquired resistance after Rapamycin therapy. [score:4]
However, several genes were found experimentally to be negatively regulated by miR-10a, which was not consistent with the positive association values between miR-10a and mRNA expression (ex. [score:4]
“Yes” indicates miR-10a was verified to regulate gene expression. [score:4]
Down-regulation of hsa-miR-10a in chronic myeloid leukemia CD34+ cells increases USF2 -mediated cell growth. [score:4]
We also demonstrated that miR-10a can be induced by mTOR inhibitors and that genes highly associated with miR-10a were all negatively regulated by miR-10a. [score:4]
MiR-10a, a member of the miR-10 family members, maps to chromosome 17 upstream of the HOX gene cluster and putatively regulates expression of the HOXA1, HOXA3, and HOXD10 genes (Garzon et al., 2006; Han et al., 2007). [score:4]
HOXA1, a known target for miR-10a, was used as a positive control gene (Mansfield et al., 2004; Garzon et al., 2006). [score:3]
miR-10a overexpression (mimic) desensitized Caki2 cell to Rapamycin and Everolimus. [score:3]
One microRNA expression probe, ILMN_3167552 (miR-10a), was highly associated with Everolimus AUC (P = 1.04 × 10 [−4], R = 0.2377), a value that reached genome-wide significance (Figure 5B). [score:3]
miR-10 in development and cancer. [score:2]
Therefore, those 9 genes were tested further for the effect of miR-10a on gene regulation. [score:2]
For siRNA and miR-10a transfection experiments, group mean values for AUC and gene expression were compared by using Student's t-test. [score:2]
Effect of miR-10a on cytotoxicity of rapamycin and everolimus and gene regulation. [score:2]
Gene Association Cytotoxicity (siRNA KD) Colony formation (siRNA KD) miR-10a regulation Caki2 IMR90 U87 Caki2 Caki2 mRNA Exp vs. [score:2]
We also tested the effect of miR-10a on mTORC1 signaling by measuring phosphorylated S6K and 4EBP1 and found that knockdown or overexpression of miR-10a did not result in a change of mTORC1 activity (data not shown). [score:2]
MiR-10a expression was significantly enhanced by Rapamycin treatment compared with controls in Caki2 and U87 cell lines. [score:1]
However, the exact mechanisms by which miR-10a determines mTOR inhibitor response still need to be investigated in future studies. [score:1]
Figure 5 MicroRNA screening and functional validation of miR-10a. [score:1]
Among the 9 genes that we tested, 5 had predicted binding sites for miR-10a. [score:1]
[1 to 20 of 28 sentences]
16
[+] score: 93
Based on the miRNA signature that we have identified in glioblastoma stem cells, we may be able to develop targeted glioblastoma therapies by inhibiting the up-regulated miR-10a or miR-10b function using miR-10 antogonists or overexpressing the down-regulated miR-124 or miR-874. [score:13]
Of note,16 miRNAs that are up-regulated in glioblastoma stem cells (>1.5-fold, Table S1) in our study, including miR-10a and miR-10b, are also up-regulated in malignant astrocytomas (glioblastomas and anaplastic astrocytomas) in a genome-wide miRNA expression profiling between malignant astrocytomas and normal brain samples [40]. [score:9]
miR-10a revealed a dramatic increase of expression in all three glioblastoma stem cell lines tested, with more than 100-fold up-regulation of expression in two of the glioblastoma stem cell lines (Fig. 2A). [score:8]
By using Targetscan algorithm [16], we identified CUB and SUSHI multiple domain protein 1 (CSMD1) as a candidate target for miR-10a and miR-10b, the most highly up-regulated miRNAs in glioblastoma stem cells in our profiling analyses. [score:8]
Together, these results suggest that miR-10 targets the expression of tumor suppressor genes, CSMD1 and HOXD10, in glioblastoma stem cells. [score:7]
Furthermore, treatment of the inhibitors of miR-10a and miR-10b reversed the inhibitory effect of miR-10a and miR-10b on the luciferase reporter activity, respectively (Fig. 4C, D). [score:5]
These results suggest that both miR-10a and miR-10b repress CSMD1 expression through the predicted targeting sites in CSMD1 3′ UTR. [score:5]
Mutation of the miR-10 targeting sites abolished the repression (Fig. 4C, D). [score:4]
Dramatic reduction of CSMD1 mRNA expression was detected in glioblastoma stem cells by RT-PCR analysis, compared to neural stem cells (Fig. 4E), consistent with the observation that CSMD1 expression is repressed by miR-10 (Fig. 4C, D). [score:4]
Consistent with the results from tumor stem cells, miR-10a exhibited a substantial increase of expression in most glioblastoma tissues (Fig. 3A). [score:3]
miR-10a, miR-10b or miR-124 RNA duplexes and/ or their correspondent RNA inhibitors (Dharmacon) were mixed in 50 µl serum free media with Transfectin, incubated at RT for 20 min. [score:3]
Sequence analysis revealed that the seed region of both miR-10a and miR-10b could form complementary base pairs with the 3′ untranslated region (3′ UTR) of human and mouse CSMD1 mRNAs (Fig. 4A, B). [score:3]
Luciferase reporter gene under the control of wild type (WT) or mutant (MT) CSMD1 3′ UTR was transfected into HEK 293 cells along with control, miR-10a RNA duplexes, or the combination of miR-10a RNA duplexes and a miR-10a inhibitor. [score:3]
0036248.g003 Figure 3The expression levels of miR-10a (A), miR-10b (B), miR-124 (C), and miR-874 (D) in 9 glioblastoma tissues and 4 normal brain tissues were determine by real-time RT-PCR analysis, shown in scatted graph and bar graph. [score:3]
The expression levels of miR-10a (A), miR-10b (B), miR-124 (C), and miR-874 (D) in 9 glioblastoma tissues and 4 normal brain tissues were determine by real-time RT-PCR analysis, shown in scatted graph and bar graph. [score:3]
0036248.g002 Figure 2The expression levels of miR-10a (A), miR-10b (B), miR-140-5p (C), miR-124 (D), and miR-874 (E) in three glioblastoma stem cell (GSC) lines were measured by real-time RT-PCR, and compared to their expression in three neural stem cell (NSC) lines. [score:2]
To demonstrate a direct interaction between the 3′ UTR of CSMD1 and miR-10 (miR10a and miR-10b), we inserted the 3′ UTR region of human CSMD1 that contains the putative miR-10 recognition sites and flanking sequences downstream of a Renilla luciferase reporter gene into a siCheck vector. [score:2]
The expression levels of miR-10a (A), miR-10b (B), miR-140-5p (C), miR-124 (D), and miR-874 (E) in three glioblastoma stem cell (GSC) lines were measured by real-time RT-PCR, and compared to their expression in three neural stem cell (NSC) lines. [score:2]
RNA duplexes of mature miR-10a or miR-10b were transfected into human embryonic kidney HEK293 cells along with the reporter gene. [score:1]
A, B. The base-pairing of hsa-miR-10a and hsa-miR-10b with the 3′ UTR of CSMD1 gene. [score:1]
Significant repression of the reporter gene was observed in both miR-10a and miR-10b -transfected cells (Fig. 4C, D). [score:1]
C. miR-10a -mediated repression of luciferase reporter gene downstream of 3′ UTR of CSMD1. [score:1]
0036248.g004 Figure 4 A, B. The base-pairing of hsa-miR-10a and hsa-miR-10b with the 3′ UTR of CSMD1 gene. [score:1]
The miR-10a RNA duplex sense sequence is 5′ TAC CCT GTA GAT CCG AAT TTG TG 3′. [score:1]
[1 to 20 of 24 sentences]
17
[+] score: 90
Previous studies have shown that miR-10a can target IL-12/IL-23p40 expression [32] and pro-apoptotic protein Bim [33], while miR-30d can negatively regulate apoptotic caspase CASP3 [34] and tumor suppressor p53 gene [35]. [score:8]
The study by Shi et al. [8] demonstrated that podocytes strongly expressed four members of the miR-30 family that may target genes such as vimentin, heat-shock protein 20 and immediate early response 3. Through the silencing of these target genes, the miR-30 and miR-10 miRNA families play an essential role in podocyte homeostasis and podocytopathies, which is in agreement with our finding in the present study. [score:7]
Indeed, it has been reported that during nephrogenesis, nephron progenitors highly expressing miR-10a and miR-10a can target Bim [24]. [score:5]
Serving as negative regulators of cell apoptosis, miR-10a and miR-30d have been found to be upregulated in various cancer tissues, such as prostate cancer [36]. [score:5]
This result was further validated using a TaqMan probe -based qRT-PCR, we detected the expression of miR-10a, miR-30d and miR-192 in various mouse organs: the heart, spleen, kidney, colon and lung. [score:3]
Because miR-10a and miR-30d are enriched in kidney tissue (Figure 1), urinary miR-10a and miR-30d are probably derived directly from the kidneys, particularly when kidney injury has occurred. [score:2]
In addition, urinary miR-10a and miR-30d are highly enriched to the kidney; therefore, the elevation of these miRNAs may be directly linked to the injuries of kidney. [score:2]
The elevation of kidney-enriched miR-10a and miR-30d in urine (Figure 2) but not serum (Figure S2) during renal I/R indicated that these miRNAs may be directly correlated with kidney injury. [score:2]
We used both I/R -induced acute kidney injury and STZ diabetes -induced chronic kidney injury animal mo dels and showed that changes in the levels of urinary miR-10a and miR-30d occurred as a result of renal damage. [score:1]
Alteration of the urinary miR-10a and miR-30d levels in FSGS patients. [score:1]
A) Levels of miR-10a and miR-30d in mouse kidney with or without renal I/R. [score:1]
These results collectively suggest that elevation of mouse urinary miR-10a and miR-30d during renal I/R is likely due to the release of mature miR-10a and miR-30d from mouse kidney tissue. [score:1]
Together, these results strongly suggest that urinary miR-10a and miR-30d could serve as sensitive and specific biomarkers for kidney injury. [score:1]
To find out whether the elevation of urinary miR-10a and miR-30d also occurs in patient with kidney injuries, we assessed the levels of urinary miR-10a and miR-30d in FSGS patients. [score:1]
More importantly, the levels of urinary miR-10a and miR-30d were significantly increased in mice with either unilateral ischemia/reperfusion or bilateral ischemia/reperfusion. [score:1]
Interestingly, recent study by Lorenzen et al. [31] showed that miR-10a was released into urine and could be detected in kidney transplant patients at the onset of acute T-cell mediated rejection, which may suggest a mild acute kidney injury during the process of T-cell mediated rejection. [score:1]
Identification of miR-10a and miR-30d as kidney-specific miRNAs. [score:1]
Elevation of the urinary miR-10a and miR-30d levels in mice with renal I/R -mediated injury. [score:1]
The results for the human urine samples further confirmed the feasibility of using the urinary miR-10a and miR-30d levels to detect kidney injury in humans. [score:1]
After bilateral renal I/R, the level of miR-30d in serum was still unchanged, while the level of miR-10a was reduced. [score:1]
High levels of urinary kidney-enriched miR-10a and miR-30d clearly indicate the kidney injuries in FSGS patients. [score:1]
Figure S3 The levels of miR-10a, miR-30d, pre-miR-10a and pre-miR-30d in mouse kidney tissues detected by TaqMan probe -based qRT-PCR with U6 serving as an internal control. [score:1]
Using different mouse renal injury mo dels, we reported that miR-10a and miR-30d were readily detected in urine and that their levels specifically correlated with mouse kidney injury induced by renal ischemia-reperfusion or STZ treatment. [score:1]
Elevation of the urinary miR-10a and miR-30d levels can be detected in mice with unilateral I/R in which the protein levels were not changed, suggesting that the urinary miR-10a and miR-30d levels can reflect mild or early kidney injury. [score:1]
A, the serum miR-10a level was decreased in DS I/R mice but not SS I/R mice. [score:1]
Through decreasing the levels of these apoptotic or pro-apoptotic proteins and inflammatory cytokines, miR-10a and miR-30d might provide a protection to kidney tissues/cells. [score:1]
Interestingly, the levels of pre-miR-10a and pre-miR-30d in mouse kidney tissues were not changed (Figure S3B). [score:1]
Therefore, an elevation of urinary miR-10a/miR-30d levels correlates to a decrease of kidney miR-10a/miR-30d levels, which links to cell apoptosis and kidney injury/damage. [score:1]
As shown in Figure S2, no alteration of miR-10a or miR-30d in mouse serum was observed after unilateral renal I/R. [score:1]
Interestingly, although the chronic hyperglycemia caused an elevation of urinary miR-10a and miR-30d likely due to the kidney damage, a short period of high blood glucose exposure did not increase the level of these kidney-specific miRNAs in urine. [score:1]
The elevation of the urinary levels of miR-10a and miR-30d was also confirmed in urine samples from patients with focal segmental glomerulosclerosis (FSGS). [score:1]
To test whether urinary miR-10a and miR-30d can be biomarkers for diabetes -induced renal injury, we employed streptozotocin (STZ) -treated diabetic mice as another kidney injury mo del. [score:1]
In summary, our study demonstrated that miR-10 and miR-30d are stably present in human and animal urine and that the elevation of the urinary miR-10a and miR-30d levels can serve as a novel urine -based biomarker of kidney injury. [score:1]
Next we determined the levels of miR-10a and miR-30d in mouse kidney tissue with or without renal I/R. [score:1]
Figure S2 Level of serum miR-10a and miR-30d in mice with/without renal ischemia-reperfusion injury. [score:1]
This hypothesis is supported by our observation that the elevation of miR-10a and miR-30d concentrations occurred only in urine and not in serum when mice were treated with renal I/R. [score:1]
Urine samples from normal male C57BL/6J mice (6–8 weeks old, 22–25 g) and male C57BL/6J mice with kidney injuries were collected, and absolute levels of miR-10a and miR-30d were assessed. [score:1]
By challenging 12 h–fasting mice with an intraperitoneal injection of glucose (2 g/kg of body weight), we found no elevation of urinary miR-10a and miR-30d within 1–3 h (data not shown). [score:1]
These results strongly suggest that urinary miR-10a and miR-30d can serve as ideal biomarkers for kidney injury. [score:1]
In the present study, we observed increases in the urinary concentrations of miR-10a and miR-30d corresponding to kidney injuries. [score:1]
These results suggest that the elevation of urinary miR-10a and miR-30d levels may specifically reflect hyperglycemia -induced kidney injury. [score:1]
In contrast, reduction of miR-10a and miR-30d in kidney cells would cause cell apoptosis and damage, which may finally lead to renal dysfunction. [score:1]
Therefore, we also detected the levels of miR-10a and miR-30d in mouse serum with or without renal I/R. [score:1]
For mouse kidney, after rule out the miRNAs with very low total signal, we found that miR-10a and miR-30d, as well as other miRNAs in miR-1 and miR-30 families, were relatively enriched in kidney tissue. [score:1]
Clarifying the role of miR-10a and miR-30d in the tumorigenesis processes of these cancer cells may be helpful for understanding the correlation between urinary miR-10a/miR-30d and kidney injures. [score:1]
C–D, significant elevation of the urinary miR-10a (C) and miR-30d (D) levels in mice with either SS I/R or DS I/R. [score:1]
By comparing the levels of miRNA in sera and urine, we found that kidney-enriched miRNAs, such as miR-10a and miR-30d, were present in urine, and their concentrations were approximately 1/10 of those in sera. [score:1]
However, it could also be true that renal cells and tissues actively release more miR-10a and miR-30d into circulation under the stress. [score:1]
Moreover, pre-miR-10a and pre-miR-30d were not detected in mouse urine by qRT-PCR (data not shown). [score:1]
Next, we tested whether miR-10a and miR-30d are released into animal urine under normal and injury conditions. [score:1]
Elevation of the urinary miR-10a and miR-30d levels but not serum miR-10a and miR-30d in mice with STZ diabetes -associated kidney injury. [score:1]
As shown in Figure 1, we found that mouse kidneys contained a significantly higher level of miR-10a and miR-30d than did other tissues, confirming that these two miRNAs are kidney specific. [score:1]
Importantly, when kidney injury occurred, the levels of miR-10a and miR-30d in urine were strikingly elevated, while their levels in the serum were not increased. [score:1]
Note that the levels of urinary miR-10a (A) and miR-30d (B) were significantly increased in mice with STZ diabetes -induced kidney injury, whereas the levels of serum miR-10a (C) and miR-30d (D) were not altered. [score:1]
As shown in Figure S3A, both miR-10a and miR-30d in mouse kidney were significantly reduced during renal I/R. [score:1]
B) Levels of pre-miR-10a and pre-miR-30d in mouse kidney with or without renal I/R. [score:1]
Identification of miR-10a and miR-30d as mouse kidney-enriched miRNAs. [score:1]
Furthermore, urinary miR-10a and miR-30d exhibited a diagnostic sensitivity that was considerably superior to that of BUN when the results were correlated to the histopathological results. [score:1]
Interestingly, we found that the miR-10a and miR-30d levels in serum were not correlated with kidney injury. [score:1]
Note that, following renal I/R, the levels of mouse kidney miR-10a and miR-30d are decreased whereas the levels of pre-miR-10a and pre-miR-30d are not changed. [score:1]
0051140.g003 Figure 3Note that the levels of urinary miR-10a (A) and miR-30d (B) were significantly increased in mice with STZ diabetes -induced kidney injury, whereas the levels of serum miR-10a (C) and miR-30d (D) were not altered. [score:1]
Elevation of miR-10a and miR-30d levels in the urine of FSGS patients. [score:1]
The role of tissue miR-10a and miR-30d in kidney function also strengthens our conclusion that urinary miR-10a and miR-30d can serve as indicators for kidney injury. [score:1]
As shown in Figure 4, we found that the urinary miR-10a and miR-30d levels in FSGS patients were significantly higher than those in healthy volunteers, indicating the severity of the kidney injuries in these patients. [score:1]
[1 to 20 of 64 sentences]
18
[+] score: 52
Table 1 The role of miRNAs in autoimmune diseases miRNA Predicted/Identified targets Function Related diseases miR-22 IRF8Enhances CD11c [+]CD11b [+]B220 [−] cDC generation at the expense of pDCs miR-142 IRF8Plays a pivotal role in the maintenance of CD4 [+] DCs miR-142-3p IL-6 Specifically inhibits IL-6 expression by moDC MS miR-21 IL-12p35, Wnt1 Negatively regulates the production of IL-12 by moDC; negatively regulate the development of moDC SLE, IBD, UC, MS miR-10a IL-12/IL-23p40 Suppress the production of IL-12 and IL-23 by moDC SLE miR-148/152 Calcium/Calmodulin- dependent protein kinase IIa Suppress the production of IL-12 and IL-6 SLE miR-23b Notch1, NF-κB Inhibits the production of IL-12 while promotes IL-10 production UC miR-155 SOCS1, SHIP1, TAB2 Positively regulates the production of several pro-inflammatory cytokines including IL-6, IL-23, IL-12, and TNF-α RA, IBD miR-146a IRAK1, TRAF6 Negatively regulates TLR4-NF-κB pathway in monocytes RA, SLE, IBD miR-34a JAG1 Negatively regulates the development of moDC MS miR-223 C/EBPβNegatively regulates LCs -mediated antigen-specific CD8 [+] T cell proliferation, production of inflammatory cytokine TNFα, IL-1β, and IL-23 by intestinal DCs. [score:25]
Compared to miR-21 and miR-10a that directly target IL-12 genes, some other miRNAs target the signaling components that will affect multiple downstream targets. [score:7]
Besides, as miR-10a has also been demonstrated to negatively regulate DC function by direct targeting IL-12/IL-23p40 (Xue et al., 2011), its lower expression in SLE patients may also promote the autoimmune responses. [score:7]
Ectopic expression of miR-10a in moDCs suppressed both production of IL-12 and IL-23 (Xue et al., 2011). [score:5]
MiR-10a also directly targets the IL-12 gene. [score:3]
Seven miRNAs (miR-31, miR-95, miR-99a, miR-130b, miR-10a, miR-134, and miR-146a) were expressed at 6-fold lower level in SLE patients than that of healthy controls (Tang et al., 2009). [score:3]
Unlike miR-21, miR-10a negatively regulates the production of IL-12/IL-23p40. [score:2]
[1 to 20 of 7 sentences]
19
[+] score: 46
The set of matching genes downregulated in pancreatic cancer contains MLH1 as a predicted target for miR-155, and FGFR1 as a target of miR-10. [score:8]
Analysis of the expression of individual miRs showed three major trends (Figure 2A–C): First, expression of miR-10, miR-16, miR-21, miR-100 and miR-155 increased in the early PanIN lesions relative to control, and maintained high expression in the late PanIN and adenocarcinoma tissues. [score:7]
0020687.g003 Figure 3Tissues from p48-Cre/Kras [G12D] mice with invasive pancreatic ductal adenocarcinoma (PDAC) and normal pancreata were analyzed for expression of miR-10 and miR-155 relative to the respective candidate target mRNAs, FGFR1 and MLH1 using quantitative RT-PCR. [score:5]
Tissues from p48-Cre/Kras [G12D] mice with invasive pancreatic ductal adenocarcinoma (PDAC) and normal pancreata were analyzed for expression of miR-10 and miR-155 relative to the respective candidate target mRNAs, FGFR1 and MLH1 using quantitative RT-PCR. [score:5]
Indeed, a subset of miRs that includes miR-10 and miR-155 were upregulated in pancreatic cancer tissues of patients and mice as well as in the respective blood samples. [score:4]
These findings with miR-10 and miR-155 and their predicted target mRNAs MLH1 and FGFR1 support the notion of a potential regulatory function of these miRs during malignant progression. [score:4]
In contrast, miR-10 and miR-155 levels in serum are increased during pancreatic malignant transformation in mice and in patients supporting the notion that the diseased organ is a significant contributor to serum levels of these miRs (see Figure 4A and 5A). [score:3]
In a comparison of normal and cancer tissues harvested from the mouse mo dels mRNA expression of MLH1 and of FGFR1 showed a significant, inverse relationship miR-155 and miR-10 respectively (Figure 3). [score:3]
miR-100a and miR-10 were significantly increased in the pancreatic cancer patients compared to non-cancer controls while a number of the other miRs (miR-16, 21, 155, 199, 221, and 223) showed a trend of increased expression that did not reach statistical significance (Figure 5A). [score:2]
In contrast with this increase, miR-148b serum levels were not affected after the drug treatment and serum miR-10 and miR-155 were reduced the most (30- and 60-fold) after the Gemcitabine treatment. [score:1]
Furthermore, serum levels of miR-10 and miR-155 in treated animals with PDAC dropped below the serum levels of treated control animals (Figure 4A & B) suggesting them as potential indicators of tumor specific effects of the treatment. [score:1]
Gemcitabine treatment (Figure 4A, filled bars) reduced serum levels of miR-10, miR-21 and miR-155 in animals with PDAC and in controls by 6- to 60-fold (p<0.05 to <0.01; Figure 4B). [score:1]
Before treatment (Figure 4A, open bars), serum levels of miR-10 and miR-155 were elevated >2-fold (p<0.05) in the PDAC (red) versus control group (black). [score:1]
It is noteworthy that with PDAC reduced serum levels of miR-21, miR-10 and miR-155 by an additional 2-, 3- and 6-fold below the reduction seen in control animals, although only the miR-155 reached statistical significance in the comparison of PDAC and control (Figure 4B; p<0.05). [score:1]
[1 to 20 of 14 sentences]
20
[+] score: 38
The genes of miR-10a and -b are located within the HOX clusters and upregulation of these two miRNAs has been seen in cytogenetically normal AML (CN-AML) patients in association with HOX gene upregulation [53], suggesting that miRNA may be regulated by expression of neighbouring genes. [score:10]
They found one upregulated miRNA (miR-96) and four downregulated (miR-151, miR-150, miR-125a, and miR-10a) that were able to consistently differentiate CML cells from normal CD34+ cells in two separate cohorts [36]. [score:7]
In line with this hypothesis, reexpression of miR-10a in CML CD34+ cells inhibited cell growth, demonstrating its potential role as a tumour suppressor in CML [36]. [score:7]
Gene array studies have identified high expression of the transcription factor upstream stimulatory factor 2 (USF2) in CML patients, and USF2 has been proposed as a miR-10a target through computational algorithms [36]. [score:5]
miR-10a, miR-10b, and members of the miR-29 family were shown to be overexpressed in mutated NPM1 AML patients [52]. [score:3]
The same investigations suggest miR-10a is downregulated in CML patients independent of BCR-ABL activity [36]. [score:2]
A number of deregulated miRNAs in AML have been shown to be involved in haematopoiesis (miR-130a, miR-10a, miR-181, miR-451, and miR-155), suggesting that their aberration might be involved in the oncogenic process [50]. [score:2]
In a study of 30 AML patients, HOXA1, HOXA13, HOXB1, and HOXB13 were the only HOX genes not to show strongly positive or negative correlation with miR-10a and miR-10b [54]. [score:1]
An association between the two was demonstrated, as colon carcinoma R KO cells transfected with pre-miR-10a showed a significant decrease in mRNA levels of USF2 [36]. [score:1]
[1 to 20 of 9 sentences]
21
[+] score: 37
In this study, we also predicted targets of miRNAs, and found the targets of miR-10a miR-10b miR-414 and miR-466 in the HOX clusters (Additional file 9). [score:5]
The prediction of microRNA target analysis showed that several known microRNA targets, such as miR-10, miR-414 and miR-464, were found in the tammar HOX clusters. [score:5]
There was a strikingly high level of conservation of HOX gene sequence and structure and non-protein coding genes including the microRNAs miR-196a, miR-196b, miR-10a and miR-10b and the long non-coding RNAs HOTAIR, HOTAIRM1 and HOXA11AS that play critical roles in regulating gene expression and controlling development. [score:5]
Non-coding RNAs known to be involved in regulation of HOX gene expression [16, 17], include the highly conserved microRNAs [18], such as miR-196[19] and miR-10[20]. [score:4]
Using the tammar as a reference and searching the microRNA database we were able to identify four known HOX microRNAs (miR-196a miR-196b miR-10a and miR-10b), and most significantly, we uncovered one new potential microRNA, meu-miR-6313 in the tammar which was expressed in testis and fibroblasts. [score:3]
By microRNA deep sequencing and comparative genomic analyses, two conserved microRNAs (miR-10a and miR-10b) were identified and one new candidate microRNA with typical hairpin precursor structure that is expressed in both fibroblasts and testes was found. [score:3]
We found that miR-10a and miR-10b were strongly expressed in the testis. [score:3]
Regarding targets of miRNAs in the tammar HOX clusters, valid miRNA hits to miR-10a, miR-10b, miR-414 and miR-466 were confirmed (details referred to Additional file 9). [score:3]
In silico analysis as well in vitro and in vivo experiments have shown that the miRNAs miR-10 and miR-196 target several HOX genes, such as HOXA5/7/9, HOXB1/6/7/8, HOXC8, HOXD8, HOXA1/3/7, HOXB3 and HOXD10 [18- 20, 50, 51]. [score:3]
We examined the presence of known microRNAs, miR-196a1, miR-196a2, miR-196b, miR-10a and miR-10b, previously described in the human, mouse and zebrafish HOX clusters. [score:1]
Interestingly, the long-coding RNAs (HOTAIR, HOTAIRM1 and HOXA11AS) and microRNAs (miR-196a2, miR-196b, miR-10a and miR-10b) were highly conserved in this marsupial. [score:1]
microRNAs miR-10a located between HOXB4 and HOXB5 is highly conserved in all species. [score:1]
[1 to 20 of 12 sentences]
22
[+] score: 36
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-217, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-328, hsa-mir-335, hsa-mir-133b, hsa-mir-409, hsa-mir-484, hsa-mir-485, hsa-mir-486-1, hsa-mir-490, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-506, hsa-mir-509-1, hsa-mir-532, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-33b, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-1224, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-802, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-4262, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-486-2, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Wang F. Yang X. Y. Zhao J. Y. Yu L. W. Zhang P. Duan W. Y. Chong M. Gui Y. H. MiR-10a and miR-10b target the 3'-untranslated region of TBX5 to repress its expression Pediatr. [score:7]
Retinoic acid receptor antagonist has been shown to inhibit the expression of miR-10a in pancreatic cancer cells [140]. [score:5]
Among them, miR-10a and 10b were shown to target homeobox transcription factor expression [140, 141]. [score:5]
miR-10a and miR-10b also target TBX5, a T-box transcription factor involved in embryonic cardiac development [142]. [score:4]
Prenatal ethanol exposure was also shown to up-regulate several microRNAs (miR-9, miR-10a, miR-10b, miR-30a-3p, miR-145, and miR-152) in the fetal brain [139]. [score:4]
It is tempting to speculate that increased retinoic acid could be responsible for the observed increase in the expression of miR-10a and miR-10b during fetal alcohol syndrome. [score:3]
Repeated binge ethanol exposure in adolescent rats was shown to dramatically increase the expression of miR-10a-5p in the hippocampus [119, 121, 122]. [score:3]
Further studies are needed to confirm this hypothesis of ethanol -induced retinoic acid activating retinoic acid receptor (RAR) to enhance miR-10 expression in fetal alcohol syndrome. [score:3]
Supplementation of folic acid prevented the increase in miR-10a caused due to ethanol in the fetal brain [139]. [score:1]
Further studies are needed to confirm the exact role of miR-10a-5p, miR-26a and mi-495 in hippocampal damage during ethanol exposure. [score:1]
[1 to 20 of 10 sentences]
23
[+] score: 36
Other miRNAs from this paper: hsa-mir-10b, hsa-mir-203a, hsa-mir-146a, hsa-mir-146b, hsa-mir-203b
Xue X., Feng T., Yao S., Wolf K. J., Liu C. -G., Liu X., Elson C. O., and Cong Y. (2011) Microbiota downregulates dendritic cell expression of miR-10a, which targets IL-12/IL-23p40. [score:8]
Experimental evidence is provided that miR-146 and miR-10 bind directly to the ACKR2 3′-UTR and lead to a down-regulation of ACKR2 at transcript and protein levels in KCs and LECs, respectively. [score:5]
Both miR-10 and miR-146b transfection significantly down-regulated luciferase activity in HEK cells, although dual transfection with both miRs did not result in an additive decrease. [score:4]
Taken together, immunofluorescence staining of cultured cell monolayers demonstrated that transfection with miR-146b in KCs and miR-10b in LECs led to a reduction in ACKR2 staining in both cell types by 48 h. Figure 5. Transfection of LECs with miR-10 reduced ACKR2 protein expression throughout the cytoplasm. [score:3]
Taken together, immunofluorescence staining of cultured cell monolayers demonstrated that transfection with miR-146b in KCs and miR-10b in LECs led to a reduction in ACKR2 staining in both cell types by 48 h. Figure 5. Transfection of LECs with miR-10 reduced ACKR2 protein expression throughout the cytoplasm. [score:3]
27. b, three microRNAs (miR-10, miR-146, and miR-203) are predicted to bind the ACKR2 3′-UTR and are differentially expressed in psoriasis. [score:3]
Thus, both miR-10 and miR-146b can mediate a decrease in transcript levels through direct interactions with the ACKR2 3′-UTR. [score:2]
miR-10, miR-146, and miR-203 are all differentially regulated in psoriasis (27, 37). [score:2]
d, absolute quantification of ACKR2 transcripts following transfection of LECs with miR-10 (i), miR-146b (ii), and miR-203 (iii). [score:1]
b, absolute quantification of ACKR2 transcripts following transfection of KCs with miR-146b (i), miR-10 (ii), and miR-203 (iii). [score:1]
Having demonstrated that HEK cells could be transfected with functional microRNAs of interest, we next determined whether miR-10 and miR-146b transfection modulated luciferase activity (Fig. 3 b). [score:1]
c and d, representative immunofluorescence microscopy images of confluent monolayers of LECs 48 h after transfection with scrambled miR control (c) or miR-10 (d). [score:1]
In this way, we identified three microRNAs that were present in both lists, miR-10, miR-146, and miR-203. [score:1]
Figure 2. miR-146 and miR-10 transfection reduced AKCR2 transcripts in KCs and LECs, respectively. [score:1]
[1 to 20 of 14 sentences]
24
[+] score: 35
The expression of pluripotence -associated hsa-miR-302 family was silenced and the expression of Hox miRNA hsa-miR-10 family that regulates gene expression predominantly in neuroectoderm was induced to high levels in these hESC-derived neuronal progenitors hESC-I hNuPs [6, 34]. [score:8]
The drastic expression increase of hsa-miR-10 upon exposure of hESCs to RA suggested that RA might induce the expression of Hox genes and co -expression of Hox miRNA hsa-miR-10 to silence pluripotence -associated genes and miRNA hsa-miR-302 to drive a neuroectoderm fate switch of pluripotent hESCs [6, 34]. [score:7]
The miR-10 genes locate within the Hox clusters of developmental regulators and are coexpressed with a set of Hox genes to repress the translation of Hox transcripts [140]. [score:7]
Genome-scale profiling of miRNA differential expression patterns during hESC neuronal lineage-specific progression further identified novel sets of stage-specific human embryonic neurogenic miRNAs, including silencing of the prominent pluripotence -associated hsa-miR-302 family and drastic expression increases of Hox hsa-miR-10 and the let-7 miRNAs [6, 34]. [score:5]
Nuclear translocation of NAD -dependent histone deacetylase SIRT1 and global chromatin silencing lead to hESC cardiac fate determination, while silencing of pluripotence -associated hsa-miR-302 family and drastic up-regulation of neuroectodermal Hox miRNA hsa-miR-10 family lead to hESC neural fate determination. [score:4]
Nuclear translocation of NAD (nicotinamide adenine dinucleotide) -dependent histone deacetylase SIRT1 and global chromatin silencing lead to hESC cardiac fate determination, while silencing of pluripotence -associated hsa-miR-302 family and drastic up-regulation of neuroectodermal Hox miRNA hsa-miR-10 family lead to hESC neural fate determination [6]. [score:4]
[1 to 20 of 6 sentences]
25
[+] score: 34
Among these upregulated miRNAs were miR-10a, which is a candidate tumor suppressor and suppresses apoptosis in leukemia [39], miR-409 that suppresses tumor cell invasion and metastasis in gastric cancer [40], and miR-206 and miR-345, which are frequently downregulated in various types of cancers and are believed to act as tumor suppressors [41], [42]. [score:15]
As shown in Figure 9C, there was excellent concordance in the data from the miRNA profiling and qPCR, the expression of miR-21, miR-26a, miR-24, miR-30b and miR-29a was down-regulated by EF24 treatment both in vitro and in vivo, while the expression of miR-345, miR-409, miR-10a and miR-206 was upregulated by EF24 treatment. [score:11]
Only four miRNAs (miR-10a, miR-409, miR-206 and miR-345) were upregulated both in vitro and in vivo, which reportedly act as tumor suppressors or inhibitors of cell cycle progression. [score:8]
[1 to 20 of 3 sentences]
26
[+] score: 34
Detailed data for all experimental validation studies are presented in Additional file 2. In summary, we identified osteo -inhibitory targets for miR-10a, miR-22, miR-26a, miR-26b, and miR-29b with the highest targeting impact resulting from miR-26a, miR-26b, and miR-29b expression. [score:9]
Figure  3 summarizes the results of experimental validations from all 22 predicted miRNA-target interactions: CDK6 was targeted by miR-22, miR-26a, miR-26b, and miR-29b; CTNNBIP1 was regulated by miR-10a and miR-29b; SMAD1 and TOB1 were both recognized by miR-26a and miR-26b; and HDAC4 was targeted by miR-29b. [score:8]
Bioinformatic target gene prediction indicated that among these microRNAs, miR-10a, -22, -26a, -26b, and -29b recognize transcripts that encode a set of proteins inhibiting osteogenesis. [score:5]
CTNNBIP1 was also regulated by miR-10a and CDK6 [45] was targeted by miR-22, miR-26a, miR-26b and miR-29b. [score:4]
Among the most prominently expressed miRNAs were miR-10a, miR-152, miR-22, miR-26a/b, miR-29b, miR-30b/c, miR-345, and miR-532-5p. [score:3]
The most redundant miRNA-target network involved miR-26a/b and miR-29b and, to a lesser extent, miR-22, miR-10a, and miR-137 (Table  1); subsequent analyses focused on these six miRNAs. [score:3]
In HEK293T-cells we tested the effects of a total of six miRNA -mimics (miR-10a, -22, -26a, 26b, 29b, and -137) on the 3 [′]-UTRs of 8 predicted proteins (CDK6, CTNNBIP1, DUSP2, HDAC4, SMAD1, SMAD6, TGFB3, and TOB1) related to osteogenic differentiation and/or function. [score:1]
It should be noted that attempts to functionally analyze miR-10a and miR-22 failed due to a nearly complete loss of transfected USSC from the culture plates (data not shown). [score:1]
[1 to 20 of 8 sentences]
27
[+] score: 33
Recently, Zaravinos et al. [20] investigated microRNA expression in normal renal tissue and renal tumors (renal cell carcinoma and UUTUC): 21 microRNAs were specifically deregulated in UUTUC (5 microRNAs upregulated and 16 microRNAs downregulated—the UUTUC profile was different from our target microRNAs); miR-10a, miR-200b and miR-205 were upregulated compared to renal tissue. [score:12]
The expression of eleven microRNAs (miR-10a, miR-21, miR-96, miR-135, miR-141, miR-182, miR-200b, miR-205, miR-429, miR-520b, miR-1244) formerly shown to be upregulated in urothelial bladder cancer were studied in corresponding normal and cancerous tissue samples of patients undergoing nephroureterectomy for UUTUC. [score:6]
We observed a significant overexpression of miR-21, miR-96, miR-135, miR-141, miR-182, miR-205, miR-429, miR-520b (all p<0.001) in UUTUC; the microRNAs miR-10a (p = 0.012) and miR-200b (p = 0.006) showed a distinct trend towards upregulation, whereas miR-1244 (p = 0.600) was similar in normal and malignant tissue. [score:6]
In order to investigate the role of microRNAs as non-invasive biomarkers in patients with UUTUC, the expression of eleven microRNAs (miR-10a, miR-21, miR-96, miR-135, miR-141, miR-182, miR-200b, miR-205, miR-429, miR-520b, miR-1244) earlier shown to be upregulated in urothelial cancer of the bladder [13– 20], was analyzed [11] in corresponding normal ureter and UUTUC tissue. [score:4]
Notably, miR-205 [35] and miR-10a [36] were associated with the survival time in patients with bladder cancer. [score:1]
Tumor grade and stage are usually correlated in urothelial cancer, and thus one would expect significant correlations with stage (miR-205) or grade (miR-10a, miR-135), respectively. [score:1]
Serum miR-10a (p = 0.003) was decreased in muscle-invasive UUTUC (pTa/pT1:1.79 vs. [score:1]
Furthermore, we observed lower levels of miR-10a and miR-135 in UUTUC patients. [score:1]
The miR-205 tissue levels were also correlated with undifferentiated UUTUC, and miR-10a and miR-135 were decreased in serum of patients with muscle-invasive UUTUC. [score:1]
[1 to 20 of 9 sentences]
28
[+] score: 33
Upon NaButyrate induction, two of the most upregulated miRNAs common to both cell lines were miR-24 and miR-10a, whose target genes have been shown to inhibit endodermal differentiation. [score:8]
Two of the most upregulated miRNAs common to both of our cell lines were miR-24 and miR-10a, whose target genes have been shown to inhibit endodermal differentiation. [score:8]
These miRNAs were differentially-expressed upon NaB -induced differentiation and represent ES miRNAs (hsa-miR-302a*, hsa-miR-302d, hsa-miR-517b), endodermal miRNAs (hsa-miR-122, hsa-miR-375) and miRNAs that were upregulated in both lines (hsa-miR-10a, hsa-miR-24). [score:6]
According to the data of Laurent et al., miR-122, miR-10a and miR-24 were upregulated in hESC differentiated towards extraembryonic endoderm, while miR-375's expression was unchanged [20]. [score:6]
miR-10a, yet another miRNA to be upregulated by NaB treatment in both lines, is upstream of HOXA1 [40]. [score:4]
Thus, induction of miR-10a and miR-24 in response to NaB may contribute to endodermal differentiation via HOXA1 and Notch repression. [score:1]
[1 to 20 of 6 sentences]
29
[+] score: 32
Interestingly, some miRNAs which were upregulated in tDCs (miR-23b, miR-27b, miR-10a, and miR-30a) are described as negative regulators of TGF- β signaling pathway [43], while miR-196, which is in our study downregulated in tDCs, is negatively regulated by TGF- β [44]. [score:9]
We also found 4 miRNAs (miR-10a, miR-203, miR-210, and miR-449b) upregulated and 3 miRNAs downregulated (miR-134, miR-145, and miR-149) in both tDCs and aDCs. [score:7]
We observed that, at 24 h of maturation, 5 miRNAs (miR-10a, miR-203, miR-210, miR-30a, and miR-449b) were upregulated in both tDCs and aDCs compared with iDCs while 3 miRNAs (miR-134, miR-145, and miR-149) were downregulated. [score:6]
Upregulated miR-10a was identified in T regulatory cells as a specific marker of these cells [49]. [score:5]
Another group found that TGF- β and retinoic acid induce the miR-10a expression, which targets Bcl-6 and constrains the plasticity of helper T cells [50]. [score:5]
[1 to 20 of 5 sentences]
30
[+] score: 31
A total of 10 and 14 miRNAs were upregulated (e. g. miR-1246 and miR-148-a) and down-regulated (e. g. miR- 551b and miR-10a) respectively during megakaryocyte differentiation, all of which were confirmed by qPCR. [score:7]
Thus, down-regulation of miR10a may control Mk differentiation via HOXA1 posttranscriptional suppression. [score:6]
Therefore, 12-, 3- and 4-fold decrease in miR-10a, let-7b and miR-155 may induce overexpression of RUNX-1 as their main target. [score:5]
Studies have shown that down-regulation of miR-10a results in differentiation of megakaryocytes from human umbilical cord blood CD133+ cells (15), while dysregulation of miR-486-3p induces erythroid differentiation from HSC and therefore restrain megakaryocyte differentiation (16). [score:5]
For instance, miR10a, let-7b, miR-181b, miR-125a, miR-99a and miR-155 target the RUNX-1 transcription factor (25). [score:3]
MiR-10a has putative targets in the HOX transcription factor family with the highest sequence compatibility with HOXA1 mRNA. [score:2]
The other 14 miRNA showed significant down- regulation with miR-551b, miR-10a, miR-363 and miR-196b from 12 to 6 fold decrease displayed the highest fold-change. [score:2]
Direct interaction of miR-10a and the 3´UTR of HOXA1 mRNA was demonstrated by a luciferase reporter assay both in vitro and in vivo by Garzon et al. (24). [score:1]
[1 to 20 of 8 sentences]
31
[+] score: 30
Similarly, down-regulation of miR-10a, miR-126-5p, miR-204, and miR-488 at E17.5 were inversely correlated with up-regulation of Ltbp1, Edil3, P2rx7, and Fgfr3 respectively (Additional file 21). [score:7]
miR-204 and miR-488 (A) were down-regulated in Pkd1 [-/- ]kidneys whereas miR10a, miR-30a, miR-96, miR-126-5p, miR-182, miR-200a and miR-429 (B) were up-regulated in Pkd1 [-/- ]kidneys. [score:7]
Expression of 9 miRNAs (miR-204, miR-488, miR10a, miR-30a, miR-96, miR-126-5p, miR-182, miR-200a and miR-429), predicted to target significantly regulated genes at E14.5 was assayed using miRNA-qPCR. [score:5]
For example, miR-30a-5p may be involved in histone deactylase inhibitor pathways, apoptosis, calcium and Wnt signaling (Figure 9); miR-10a may be involved in TGF-β and hedgehog signaling; miR-204 may be involved in calcium signaling while miR-488 may be involved in MAPK signaling by targeting Fgfr3 (Figure 9). [score:5]
Expression of 9 miRNAs (miR-10a, miR-126-5p, miR-200a, miR-204, miR-429, miR-488, miR-96, miR-182 and miR-30a-5p), predicted to target significantly regulated genes at E17.5 was evaluated using miRNA-qPCR assays. [score:3]
We tested this hypothesis by determining the differential expression of 9 miRNAs (mmu-miR-10a, mmu-miR-30a-5p, mmu-miR-96, mmu-miR-126-5p, mmu-miR-182, mmu-miR-200a, mmu-miR-204, mmu-miR-429, and mmu-miR-488) between WT and Pkd1 [-/- ]genotypes at E14.5 and E17.5 (Figures 7 and 8). [score:3]
[1 to 20 of 6 sentences]
32
[+] score: 28
Dysregulation of MIR101, MIR141, and MIR152 to the HIV-1 Gag protein contributes to HIV-1 budding and release via DNA hypermethylation, ubiquitin transfer, and endoplasmic reticulum -associated degradation at the late infection stage Briefly, dysregulation of; dysregulation of MIR9 contributes to HIV-1 infection to hijack CD4+ T cells through dysfunction of the immune and hormone pathways; dysregulation of MIR139-5p, MIRLET7i, and MIR10a contributes to the HIV-1 integration/replication stage through DNA hypermethylation and immune system dysfunction; dysregulation of MIR101, MIR141, and MIR152 contributes to the HIV-1 virus assembly/budding stage through DNA hypermethylation, ubiquitin transfer, and endoplasmic reticulum -associated degradation; dysregulation of MIR302a contributes to not only microvesicle -mediated transfer of miRNAs but also dysfunction of NF-κB signaling pathway in hepatocarcinogenesis. [score:7]
We found that dysregulation of; dysregulation of MIR9 contributes to HIV-1 infection to hijack CD4+ T cells through dysfunction of the immune and hormone pathways; dysregulation of MIR139-5p, MIRLET7i, and MIR10a contributes to the HIV-1 integration/replication stage; dysregulation of MIR101, MIR141, and MIR152 contributes to the HIV-1 virus assembly and budding mechanisms; dysregulation of MIR302a contributes to not only microvesicle -mediated transfer of miRNAs but also dysfunction of NF-κB signaling pathway in hepatocarcinogenesis. [score:6]
Therefore, the expression change of MIR10a (p-value < 0.86) contributes to the expression change of Gag/Pol (p-value < 0.36). [score:5]
Therefore, we proposed that dysregulation of MIR10a is involved in HIV-1 replication via post-transcriptional regulation of HIV-1. The final steps of HIV-1 replication are virus assembly and budding. [score:3]
At the second infection stage, we determined that MIR10a regulates HIV-1 proteins including Gag/Pol (p-value < 1☓10 [-16]), which significantly interacts with small subunit (SSU) processome component, homolog (yeast) (KRR1) (p-value < 1☓10 [-16]), also known as HIV-1 Rev binding protein 2 (HRB2) (Fig.   6). [score:2]
Dysregulation of MIR10a contributes to dysfunction of immune response in CD4+ T cells and viral replication. [score:2]
Additionally, MIR10a is involved in the regulation of immune response in CD4+ T cells [104] and coxsackievirus group B type 3 (CVB3) replication [105]. [score:2]
Moreover, it has been shown that the copy number of loci belonging to the MIRLET7 family and MIR10a is correlated with HIV-1 viral load during viral infection [106]. [score:1]
[1 to 20 of 8 sentences]
33
[+] score: 26
Significant up-regulation of miR-10a was confirmed by qRT-PCR, with ∼40 000 fold (p = 0.005) up-regulation of miR-10a in pre-miR-10a transfected PER-547 and ∼200 000 fold up-regulation in PER-568 cells at 24 h, compared to scrambled negative control cells. [score:9]
Validation of miR-935 and miR-10a target gene regulation in MB. [score:4]
Following small RNA-enriched RNA extraction, significant up-regulation of miR-935 and miR-10a was confirmed by qRT-PCR using two way analysis of variance (ANOVA) and an unpaired t-test, respectively. [score:4]
However, transient over -expression of miR-10a in both MB cell lines, PER-547 and PER-568, did not affect PIK3CA mRNA or protein levels (data not shown). [score:3]
Transient over -expression of miR-10a in the MB cell lines, PER-547 and PER-568 was performed, which has 125 fold and 2200 fold decreased levels of miR-10a relative to normal CD133+ NSCs, respectively. [score:3]
Validation of putative miR-935 and miR-10a targets in MB. [score:3]
[1 to 20 of 6 sentences]
34
[+] score: 24
Other miRNAs from this paper: hsa-mir-16-2, hsa-mir-129-1, hsa-mir-10b, hsa-mir-129-2
The upregulation of the tumorigenic, progrowth miR10a and miR10b, and downregulation of the antiproliferative miR129-5p seen in the Mim23 -expressing cells would be predicted to alter cell growth and invasion properties. [score:9]
Accordingly, HeLa cells stably expressing Mim23-F-DGCR8 showed increased cell proliferation and invasion relative to Mut23-F-DGCR8 and WT-F-DGCR8 -expressing cells, and the progrowth miR-10a and miR-10b were significantly enhanced (Figure 5). [score:5]
MiR-10b is highly expressed in metastatic breast cancer cells, where it positively regulates cell migration and invasion (Ma et al., 2007), and the level of miR-10a affects the capacity of cells to undergo oncogenic transformation (Ørom et al., 2008). [score:4]
Of the 75 upregulated miRNAs, the most abundant (those with the highest total read count) were miR-10a-5p and miR-10b-5p. [score:4]
The miR-10 family of miRNAs is deregulated in several types of cancer (Lund, 2010). [score:2]
[1 to 20 of 5 sentences]
35
[+] score: 24
Because RXRα and TRα were upregulated by T3 during metamorphosis and TRα was the target gene of miR-10a, T3- RXRα-RARα-miR-10a- TRα played the negative feedback role in M. fissipes metamorphosis. [score:6]
In addition, mfi-miR-10a, mfi-miR-10b, mfi-miR-148b, mfi-miR-9a-5p and mfi-miR-9b-5p, which are predicted to target TRα, were up-regulated. [score:6]
Except novel-miR-10, the expression patterns obtained by qRT-PCR for the control and T3 groups were highly consistent with the sequencing results (Fig. 3b). [score:3]
The expression of miR-10a was switched on by RARα, a hormone receptor modulated by RXRα [60]. [score:3]
For example, TRα, which is essential for metamorphosis initiation in M. fissipes, was predicted as the target of 7 miRNAs including mfi-miR-10a, mfi-miR-10b, mfi-miR-148b, mfi-miR-15b, mfi-miR-31a, mfi-miR-9a-5p, and mfi-miR-9b-5p. [score:3]
Elevated expression of TRα and decreased mfi-miR-10a, mfi-miR-10b, mfi-miR-148b, mfi-miR-9a-5p and mfi-miR-9b-5p in the pathway indicated that these miRNAs were essential for the initiation of metamorphosis in M. fissipes. [score:3]
[1 to 20 of 6 sentences]
36
[+] score: 23
Other miRNAs from this paper: hsa-mir-17, hsa-mir-10b, hsa-mir-143, hsa-mir-451a, hsa-mir-451b
The miR-10 miRNAs are often dys-regulated in cancers, and have been shown to act as oncogenes by targeting the HOX genes and other tumor suppressors (reviewed in [68]). [score:6]
Indeed, we did find a statistically significant enrichment for multiple miRNA targeting of the core miR-10 network; however, it is important to remember that we have profiled only one isomiR from each hairpin, where around 20 have been detected above the expression threshold. [score:5]
In our data set, we found that targets of miR-10 miRNAs and isomiRs were enriched in pathways that are directly involved in cancer (such as cell cycle regulation and apoptosis signaling), and in signaling pathways that contain important cancer molecules. [score:5]
<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span><<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>s<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>p<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>a<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>n<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span> <span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>c<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>l<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>a<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>s<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>s<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>=<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>"<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>t<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>e<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>r<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>m<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>"<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>><span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span><<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>/<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>s<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>p<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>a<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span class="term"></span>r<span class="term"></span>m<span class="term"></span>"<span class="term"></span>><span class="term"></span><<span class="term"></span>/<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span>><span class="term"></span>n<span class="term"></span><<span class="term"></span>s<span class="term"></span>p<span class="term"></span>a<span class="term"></span>n<span class="term"></span> <span class="term"></span>c<span class="term"></span>l<span class="term"></span>a<span class="term"></span>s<span class="term"></span>s<span class="term"></span>=<span class="term"></span>"<span class="term"></span>t<span class="term"></span>e<span