sort by

320 publications mentioning hsa-mir-205 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-205. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 376
Therefore, we expected enrichment of target mRNAs in miR-205 over -expressing cells, or depletion of targets in cells with miR-205 inhibition. [score:9]
miR-205 Inhibition and OverexpressionFor miR-205 inhibition, CaSki cells were transiently transfected with 50 nM of Anti-miR-205 (Applied Biosystems/Ambion). [score:7]
Table S1 Expression of Cluster 1–6 gene transcripts enriched at miR-205 over -expression or depleted at miR-205 suppression. [score:7]
Indeed, we observed significant enrichments of CYR61 (P = 0.050) and CTGF (P = 0.007) mRNAs in HeLa cells with overexpression of miR-205, and depletions of both transcripts in CaSki cells with miR-205 inhibition (P<0.001 for both targets; Figure 4C and 4D). [score:7]
Loss of miR-205 expression leads to induction of epithelial-to-mesenchymal transition (EMT) [23], [24], while silencing of CYR61 expression inhibits EMT [48]. [score:7]
Among the 75 candidate targets listed in Table 1, 71 were also predicted as miR-205 targets in at least one prediction program (Table S3), and four targets (BOD1, SEPT2, AAGAB and DCAF13) were not predicted by any of the programs used in this study. [score:7]
We focused on the six clusters (including 270 transcripts/252 annotated genes) in which the expression patterns displayed enrichment in miR-205 overexpression and depletion in miR-205 suppression experiments (Figure S3 and Table S1). [score:7]
A plausible explanation is that CTGF can be regulated by multiple miRNAs or factors, and modulating miR-205 expression alone was not sufficient to yield significant changes on CTGF protein expression level. [score:6]
We observed that inhibition of miR-205 expression in CaSki cells led to a significant decrease in cell growth (∼15%; P<0.001), while overexpression of miR-205 in HeLa and SW756 cells resulted in significant increases of cell proliferation (∼20% and ∼11%, respectively; P<0.05), as compared to the respective negative controls (Figure 2A). [score:6]
In this study, we did not perform CYR61 and CTGF inhibition in cervical cancer cells, it is possible that other direct target(s) contributes to the miR-205 -mediated effects on cellular proliferation and migration. [score:6]
For examples, miR-205 has been shown to suppress cell migration/invasion through epithelial-to-mesenchymal transition in both human prostate and breast cancer cells [23], [24], as well as to target HER3 tyrosine kinase receptor in breast cancer cells [22]. [score:5]
Furthermore, miR-21 expression is not expected to be influenced in both miR-205 overexpressing and depleted cells. [score:5]
Among the 7 cell lines analyzed, miR-205 was found highly expressed in ME-180, C4I and CaSki, while low expression/barely detectable levels were found in HeLa, SW756, SiHa and C33A (Figure 1C). [score:5]
0046990.g003 Figure 3 CYR61 and CTGF mRNAs expression in human cervical samples, and their correlations with miR-205 expression. [score:5]
Identification of miR-205 Target GenesTo further understand the biological function of miR-205, we identified miR-205 targets using in vivo crosslinking and RNA immunoprecipitation coupled with microarray (CLIP-Chip). [score:5]
Here, we performed CLIP-Chip experiments for both miR-205 overexpression in HeLa cells and inhibition in CaSki cells. [score:5]
CYR61 and CTGF mRNAs expression in human cervical samples, and their correlations with miR-205 expression. [score:5]
Next we transfected CaSki cells with a miRNA inhibitor (Anti-miR-205), and HeLa and SW756 cells with a miRNA mimic (Pre-miR-205), and determined the effect of miR-205 silencing or overexpression on cell proliferation, apoptosis and migration. [score:5]
Our findings suggest that miR-205 and its targets (e. g. CYR61 and CTGF) may play important roles in the pathogenesis of cervical cancer, and that miR-205 (and its targets) may provide potential diagnostic values for cervical pathology. [score:5]
Expression of miR-205 was significant reduced after treatment with a miRNA inhibitor (C), or increased upon treatment with a miRNA mimic (D). [score:5]
Computational Analysis of miR-205 TargetsFunctional annotation of potential miR-205 target genes obtained from CLIP-Chip data was performed using GENECODIS 2.0 (http://genecodis. [score:5]
For CTGF, we observed a slight decrease or increase (but not statistically significant) protein expression in miR-205 -overexpressing or -depleted cells, respectively. [score:5]
This figure shows six clusters of enriched and depleted genes in miR-205 overexpression and suppression experiments, respectively. [score:5]
Depletion of miR-205 and CYR61 expression inhibits Akt signaling in keratinocytes, oral squamous cell carcinoma cells [14] and glioma cells [37]. [score:5]
CYR61 and CTGF as Novel Targets of miR-205 Because of its functional complexity, we applied a biochemical approach (CLIP-Chip) to identify the miR-205-target interactions in vivo. [score:5]
Table S3 Candidate targets from CLIP-Chip experiments were also identified as miR-205 targets by computational methods. [score:5]
To further understand the expression relationship between miR-205 and CYR61 or CTGF, we determined the expression of CYR61 and CTGF in 28 matched pairs of cervical cancer and normal tissues using qRT-PCR. [score:5]
Inhibition of endogenous miR-205 expression in CaSki cells significantly increased CYR61 protein level (∼15%, P = 0.016). [score:5]
As shown in Figure 4 (A and B), miR-205 over -expression in HeLa cells resulted in a significant decrease in CYR61 protein expression (∼30%, P = 0.045). [score:5]
By contrast, increased expression of miR-205 was found to suppress cell proliferation in melanoma [17] and breast cancer cells [27], as well as cell migration in a variety of cancer cell lines, including SK-LU-1 small cell lung cancer [28], U87 glioblastoma [28] and A498 renal cancer [19]. [score:5]
miR-205 Inhibition and Overexpression. [score:5]
Validation of CYR61 and CTGF as miR-205 Target GenesTo determine if CYR61 and CTGF could be targets of miR-205 in human cervical cancer cells, we applied two different approaches. [score:5]
Interestingly, the expression patterns of these two selected genes were inversely correlated with the miR-205 expression (CYR61, Corr = -0.241, P = 0.091; CTGF, Corr = -0.304, P = 0.032; Figure 3D). [score:5]
The observed inverse expression patterns, together with the predicted miR-205 binding sites (Table S3, Figure S4), provide further evidence for CYR61 and CTGF as miR-205 targets. [score:5]
Observations of increased or decreased expression of miR-205 in different tumor types suggest that miR-205 may have different functions in cancer development depending on the cell type involved. [score:4]
In 19 cases (∼70%) the expression of miR-205 was strongly increased in the tumor samples as compared to their normal counterparts; while in the remaining 8 cases, the cancer and normal samples exhibited low but comparable expression levels of miR-205 (Figure 1B). [score:4]
For miR-205 inhibition, CaSki cells were transiently transfected with 50 nM of Anti-miR-205 (Applied Biosystems/Ambion). [score:3]
Comparisons of miR-21 (A) and miR-30a-5p (B) expression levels before and after immunoprecipitation using anti-Ago2 or anti-IgG isotype control in Pre-miR-205 -treated and mock transfected HeLa cells. [score:3]
Taken together, these findings further support the dual function of miR-205 as a tumor suppressor or an oncogene. [score:3]
CYR61 and CTGF as Novel Targets of miR-205. [score:3]
To confirm the altered expression level of miR-205 in cervical cancer, we measured miR-205 expression by real-time quantitative reverse transcription-PCR (qRT-PCR) in 27 matched pairs of cervical cancer and normal tissue. [score:3]
By contrast, reduced expression of miR-205 has been reported in melanoma [17] and cancers of the esophagus [18], kidney [19], bladder [20], [21], breast [22], and prostate [23]. [score:3]
miR-205 Expression in Human Cervical Cancer Samples. [score:3]
Interestingly, both CYR61 and CTGF can function as tumor suppressors or oncogenes depending on the cellular context (see examples below); which is similar to the dual function of miR-205. [score:3]
0046990.g001 Figure 1Real time quantitative RT-PCR of miR-205 expression in human cervical tumors, normal cervices and cervical cancer cell lines, normalized to the geometric mean of RNU6B and RNU43. [score:3]
In summary, we report functional effects on tumor phenotypes and novel targets of miR-205 in human cervical cancer cells. [score:3]
Treatment with miR-205 mimic in HeLa or inhibitor in CaSki cells did not result in any significant change of apoptosis (Figure S1). [score:3]
Like CYR61 and miR-205, CTGF has also been demonstrated to play both oncogenic and suppressor roles in a wide range of cancer cell types [45], [47], [49]– [51], and it is also involved in both EMT [52], [53] and the Akt pathway [54]– [56]. [score:3]
Selected functional categories of miR-205 targets obtained from CLIP-Chip experiments *. [score:3]
miR-205 Expression in Human Cervical Cancer SamplesWe previously identified a set of miRNAs that could distinguish cervical cancer samples from their normal counterparts using a sequencing -based miRNA profiling approach [9]. [score:3]
First, we evaluated the protein expression levels of CYR61 and CTGF in both miR-205 -overexpressing and -depleted cervical cancer cells using Western blot analysis. [score:3]
miR-205 predicted targets were retrieved from miRecords (http://mirecords. [score:3]
Similarly, wound closure was retarded upon silencing of miR-205 expression in CaSki cells (Figure 2C). [score:3]
Because of its functional complexity, we applied a biochemical approach (CLIP-Chip) to identify the miR-205-target interactions in vivo. [score:3]
Real time quantitative RT-PCR of miR-205 expression in human cervical tumors, normal cervices and cervical cancer cell lines, normalized to the geometric mean of RNU6B and RNU43. [score:3]
Based on the above studies, miR-205 may function as an oncogene or tumor suppressor gene depending on the cellular contexts. [score:3]
For miR-205 overexpression, HeLa and SW756 cells were transfected with 10 nM Pre-miR-205, and Pre-miR Negative control #1 (Applied Biosystems/Ambion) or mock were used as negative controls. [score:3]
These results suggest that both CYR61 and CTGF are targets of miR-205 in human cervical cancer cells. [score:3]
Table S2 Functional annotations of miR-205 targets from CLIP-Chip using GENECODIS 2.0. [score:3]
Two of the potential miR-205 mRNA targets were further validated in cell culture experiments. [score:3]
We further identified a set of putative miR-205 targets using a biochemical approach. [score:3]
To determine if CYR61 and CTGF could be targets of miR-205 in human cervical cancer cells, we applied two different approaches. [score:3]
Functional annotation of potential miR-205 target genes obtained from CLIP-Chip data was performed using GENECODIS 2.0 (http://genecodis. [score:3]
To further understand the biological function of miR-205, we identified miR-205 targets using in vivo crosslinking and RNA immunoprecipitation coupled with microarray (CLIP-Chip). [score:3]
Paired student’s t-test was conducted to compare miR-205 expression in paired clinical samples, and to analyze differences between two experimental groups. [score:3]
In both miR-205 -overexpressing cells (HeLa and SW756), we observed significant effects on cell proliferation and migration. [score:3]
Furthermore, we identified a set of novel miR-205 targets using a combination of biochemical and microarray approach. [score:3]
Using this approach, we identified a set of miR-205 targets from both gain- and loss-of-function experiments. [score:3]
However, miR-205 suppression in CaSki cells did not lead to a significant decrease of cell migration (Figure 2B). [score:3]
Validation of CYR61 and CTGF as miR-205 Target Genes. [score:3]
Similar to the functional consequences of miR-205 observed in this study, CYR61 has been shown to suppress cell growth in lung cancer [32] and hepatocellular cancer [35]. [score:3]
For example, miR-205 overexpression led to an increased cell proliferation in mouse mammary epithelial cell progenitors [25] and cell migration in human keratinocytes [26]. [score:3]
Computational Analysis of miR-205 Targets. [score:3]
miR-205 Regulates Cell Proliferation and Migration in Human Cervical Cancer CellsHere, we first confirmed by qRT-PCR that miR-205 is significantly overexpressed in cervical cancer samples as compared to their normal counterparts. [score:3]
In support of an oncogenic function, miR-205 was found to target SHIP2 for Akt survival signaling in head and neck squamous cell carcinoma cells [14]. [score:3]
CTGF protein expression was slightly repressed in HeLa cells treated with Pre-miR-205, and slightly increased in CaSki cells treated with Anti-miR-205, but the effect was not statistically significant. [score:3]
Identification of miR-205 Target Genes. [score:3]
In our CLIP-Chip analysis, we excluded one of the replicate microarrays from the miR-205 overexpression experiments due to poor hybridization signals. [score:3]
Pearson’s correlation analysis was used to determine the association between miR-205 and CYR61 or CTGF expression levels. [score:3]
Increased expression of miR-205 has also been observed in endometrial adenocarcinoma [13], head and neck squamous cell carcinoma cell lines [14], squamous cell lung carcinoma [15] and ovarian cancer [16]. [score:3]
In agreement with the sequencing -based results, miR-205 was found significantly overexpressed in human cervical cancer as compared with their normal counterparts P<0.001; Figure 1A). [score:2]
Here we describe the functional consequences of miR-205 regulation in human cervical cancer cells. [score:2]
0046990.g002 Figure 2Functional analyses of miR-205 regulation in cervical cancer cell lines. [score:2]
qRT-PCR analysis of CYR61 (C) and CTGF (D) mRNA in the Ago2-immunoprecipitated RNAs of miR-205 -overexpressing or -depleted cells as compared to mock-transfection control. [score:2]
In gain- and loss-of-function experiments, we demonstrate that miR-205 regulates cell proliferation and migration in human cervical cancer cells. [score:2]
Functional Consequences of miR-205 Regulation in Human Cervical Cancer Cells. [score:2]
Functional Consequences of miR-205 Regulation in Human Cervical Cancer CellsThe functional consequences of altered miR-205 expression were investigated in cervical cancer cell lines with high or low levels of endogenous miR-205. [score:2]
Using the Transwell assay, we showed that cell migration was significantly enhanced by miR-205 overexpression in both HeLa and SW756 cell lines (∼20% and ∼30%, respectively; P<0.05). [score:2]
Given the observed increased expression of miR-205 in cervical cancer tissues, we further investigated the functional consequences of miR-205 regulation in human cervical cancer cells. [score:2]
Several of these miRNAs have consistently been reported as dysregulated in cervical cancer (e. g. miR-143, miR-145, miR-21 and miR-205). [score:2]
miR-205 Regulates Cell Proliferation and Migration in Human Cervical Cancer Cells. [score:2]
Here, we first confirmed by qRT-PCR that miR-205 is significantly overexpressed in cervical cancer samples as compared to their normal counterparts. [score:2]
Functional analyses of miR-205 regulation in cervical cancer cell lines. [score:2]
Our findings provide an important lead for further insights into the functional role of miR-205 in human cervical cancer development. [score:2]
In the second approach, we quantified CYR61 and CTGF mRNAs in Ago2-immunoprecipitated mRNAs in both miR-205 -overexpressing and depleted cells using qRT-PCR, and compared their levels with mock -transfected controls. [score:2]
In that classifier, miR-205 had the highest score, suggesting an important function in cervical cancer development. [score:2]
The amplified RNAs were fluorescently labeled by coupling to NHS-Cy3 (for Anti-miR-205 or Pre-miR-205 treated cells) or NHS-Cy5 (for mock transfected cells used as negative control). [score:1]
Figure S4 miR-205 binding site predictions of CYR61 (A) and CTGF (B) by RNAhybrid. [score:1]
mock control in CaSki cells and Pre-miR-205 vs. [score:1]
In this study, we examined the functional role of miR-205 in human cervical cancer. [score:1]
Transfection efficiency was measured by quantification of the endogenous miR-205 expression using qRT-PCR. [score:1]
Following miR-205 inhibition in CaSki cells, proliferation was significantly decreased, however the effect on cell migration was only revealed in the wound healing assay but not in the Transwell migration assay. [score:1]
Interestingly, miR-205, CYR61 and CTGF are involved in common functional processes and pathways. [score:1]
The functional consequences of altered miR-205 expression were investigated in cervical cancer cell lines with high or low levels of endogenous miR-205. [score:1]
Evaluation of CYR61 and CTGF as targets of miR-205. [score:1]
RNAs obtained by Ago2 IP (∼250 ng of each sample) from six replicate experiments (Anti-miR-205 vs. [score:1]
In control experiments efficient transfection was demonstrated by significantly altered miR-205 level, and significant induction of apoptosis was observed after camptothecin treatment (Figure S1). [score:1]
The wound healing migration assay revealed that miR-205 overexpression in HeLa cells enhanced the ability to close the wound compared with the Pre-miR negative control -treated and mock -transfected cells. [score:1]
We show that miR-205 plays an oncogenic role in human cervical cancer by promoting cell proliferation and migration. [score:1]
For this purpose miR-205 was quantified in human cervical cancer cell lines by qRT-PCR. [score:1]
0046990.g004 Figure 4Evaluation of CYR61 and CTGF as targets of miR-205. [score:1]
[1 to 20 of 111 sentences]
2
[+] score: 323
In line with this, cellular E-cadherin expression was substantially reduced, whereas N-cadherin expression emerged in ESCC cells transfected with anti-miR-205 inhibitor to suppress ZEB2, and they were endowed with properties allowing augmented invasion through EMT. [score:9]
Enforced expression of miR-205 was shown to inhibit cell invasion and suppress lung metastasis of breast cancer cells in nude mice, possibly through targeting ErbB3 [35]. [score:9]
Downregulation of miR-205 decreased cellular E-cadherin expression, and instead, N-cadherin appeared in the OE21 cells transfected with anti-miR-205 inhibitor (Figure 4C), indicating acquisition of the EMT-like phenotype [16]. [score:8]
The downregulation of miR-205 decreased cellular E-cadherin expression, and instead, N-cadherin appeared in the OE21 cells transfected with anti-miR-205 inhibitor. [score:8]
Of note, ectopic expression of miR-205 significantly inhibited cell proliferation and anchorage-independent growth in breast cancer cells, possibly via targeting HER (human epidermal growth factor receptor) [34]. [score:7]
These results imply that miR-205 is an ESCC-specific miR that exerts tumor-suppressive activities with EMT inhibition by targeting ZEB2. [score:7]
Knockdown of miR-205 by transfection with anti-miR-205 inhibitor significantly increased the invaded cell numbers on the Matrigel invasion assay, while overexpression of miR-205 by miR-205 precursor transfection significantly inhibited the transmembrane ability (Figure 4A). [score:7]
revealed that knockdown of miR-205 expression in ESCC cells substantially enhanced expression of zinc finger E-box binding homeobox 2, accompanied by reduction of E-cadherin, a regulator of epithelial mesenchymal transition. [score:7]
Figure 5 MiR-205 directly targets ZEB2 and miR-205 expression level in invasive ESCC tumors with poor differentiation is higher than in intraepithelial ESCC tumors. [score:6]
In the present study, knockdown of miR-205 expression substantially enhanced cellular expression of ZEB2 in ESCC cells. [score:6]
Knockdown of miR-205 by transfection with 50 nM anti-miR-205 inhibitor significantly increased the invaded cell numbers on the Matrigel invasion assay as described in Materials and, while overexpression of miR-205 by 50 nM miR-205 precursor transfection significantly inhibited the transmembrane ability compared to control scramble oligonucleotides (A). [score:6]
Co-transfection of the reporter plasmid along with miR-205 precursor resulted in a significantly reduced ZEB2-3'-UTR-luciferase expression, suggesting that miR-205 is likely to target ZEB2 directly (Figure 5A). [score:6]
Consistent with this, knockdown of miR-205 by anti-miR-205 inhibitor transfection enhanced cellular expression of ZEB2 but not ZEB1 in OE21 cells (Figure 4C). [score:6]
showed that knockdown of miR-205 by 50 nM anti-miR-205 inhibitor transfection leaded to enhanced expression of zinc finger E-box binding homeobox (ZEB) 2 but not ZEB1 in OE21 cells (C). [score:6]
The miR-205 expression levels did not differ among the histological subclasses of ESCC differentiation, but invasive ESCC with poor differentiation showed more significantly increased expression of miR-205 than intraepithelial ESCC (D). [score:5]
Overexpression of miR-205 by its precursor did not affect the expression levels of E- and N-cadherin. [score:5]
There are no significant difference in the miR-205 expression levels between the ESCC tumors (white bars) and their paired surrounding non-tumor tissues (black bars), though miR-205 is highly expressed in the tumors of 16 of 28 cases examined (B). [score:5]
Kimura et al. reported that miR-205 showed highest expression in both benign and malignant squamous epithelia including ESCC, although it was less expressed in cell lines and tissues other than squamous epithelia. [score:5]
shows the intense miR-205 expression in OE21 cells despite its nominal expression in Het-1A cells (Figure 2C). [score:5]
Using miR target prediction algorithms, ErB3, E2F1, E2F5, ZEB1, ZEB2, and protein kinase Cε have been indentified as putative miR-205 targets [36]. [score:5]
Overexpression of miR-205 by its precursor (50 nM) did not affect the expression levels of ZEBs and E- and N-cadherin. [score:5]
On the other hand, overexpression of miR-205 by its precursor did not have impact on the expression of ZEBs. [score:5]
Modulation of miR-205 expression by transfection with its precursor or anti-miR-205 inhibitor did not affect ESCC cell proliferation and apoptosis, but miR-205 was found to be involved in cell invasion and migration. [score:5]
Transfection of miR-205 precursor or anti-miR-205 inhibitor with sufficient concentrations substantially increased or decreased miR-205 expression levels in OE21 cells, respectively, assessed by quantitative RT-PCR (A). [score:5]
MiR-205 also exerts inhibitory effects on cellular invasiveness and migration in prostate cancer and glioblastoma cells, through down-regulation of the protein kinase Cε and low-density lipoprotein receptor-related protein 1, respectively [36, 37]. [score:5]
These findings establish the tumor-suppressive role of miR-205, which may serve as a unique therapeutic target for ESCC. [score:5]
There were no significant differences in the relative miR-205 expression levels between the ESCC tumors and their paired surrounding non-tumor tissues, though miR-205 was highly expressed in the tumors of 16 of 28 cases examined (Figure 5B). [score:5]
showed the intense miR-205 expression in OE21 cells despite its nominal expression in Het-1A cells (C). [score:5]
Transfection of anti-miR-205 inhibitor but not miR-205 precursor reduced cellular expression of phospho-Akt (C). [score:5]
Transfection with 50 nM miR-205 precursor significantly inhibited the distance of OE21 cell migration, while transfection with 50 nM anti-miR-205 inhibitor tended to promote in vitro wound healing as described in Materials and, though it is not significant (B). [score:5]
Again, transfection of anti-miR-205 inhibitor but not miR-205 precursor reduced cellular expression of phospho-Akt, consistent with recent studies [20, 21]. [score:5]
Consistent with the results of the in vitro Matrigel invasion assay, transfection with miR-205 precursor significantly inhibited the distance of OE21 cell migration, while transfection with anti-miR-205 inhibitor tended to promote in vitro wound healing, though it was not significant (Figure 4B). [score:4]
miR-205 induces an epithelial-mesenchymal transition (EMT)-like phenotype through regulating zinc finger E-box binding homeobox 2 (ZEB2) expression. [score:4]
miR-205 directly targets ZEB2. [score:4]
Gregory et al described that the miRNA-200 family (miR-200a, miR-200b, miR-200c, miR-141, and miR-429), as well as miR-205, was markedly downregulated in breast and colon cancer cells that had undergone EMT [15]. [score:4]
miR-205 is specifically upregulated in ESCC cells. [score:4]
Although the ESCC cells examined in this study did not express ZEB1 sufficiently, direct interaction of miR-205 with ZEB1 3'-UTR was shown in other cell types but not in ESCC cells examined in this study [15, 17]. [score:4]
Transfection of miR-205 precursor or anti-miR-205 inhibitor with sufficient concentrations to increase or decrease miR-205 expression levels, respectively (Figure 3A), had no significant impact on the optical densities of MTS assays (Figure 3B). [score:4]
Among them, miR-205 and -212 were listed among the highest miRs in expression [29]. [score:3]
Among the significantly altered miRs, miR-205 expression levels were exclusively higher in 5 ESCC cell lines examined than any other types of malignant cell lines and Het-1A. [score:3]
Then, 50 nM anti-miR-205 inhibitor, miR-205 precursor, or each scrambled negative control was transfected. [score:3]
Similarly, total RNAs extracted from the neoplastic and non-neoplastic samples (esophagoscopic biopsies) were subjected to real-time quantitative RT-PCR for quantitation of miR-205 expression levels. [score:3]
The miR-205 expression levels were higher in ESCC cells than in any of the other cell lines derived from different malignancies. [score:3]
The miR-205 expression did not differ significantly between intraepithelial and invasive ESCC samples. [score:3]
The miR-205 expression in ESCC tumor samples was assessed using real-time RT-PCR. [score:3]
Figure 2 MiRNA-10a and miR-205 expression levels in various malignant cell types. [score:3]
Further studies are warranted to assess whether miR-205 expression levels could be a predictive biomarker for clinical outcomes in ESCC. [score:3]
Again, there were no significant differences in the percentages of apoptotic cells between the OE21 cells transfected with 50 nM miR-205 precursor and anti-miR-205 inhibitor (Figure 3C). [score:3]
OE21 cells were seeded at a density of 2.0 × 10 [6]/well on 60-mm Petri dishes, and 24 hours later, the cells were transfected with either 50 nM anti-miR-205 inhibitor or scrambled negative control. [score:3]
Furthermore, breast cancer cell lines expressed lower levels of miR-205 than the non-malignant mammary cells examined in their study [34]. [score:3]
OE21cells were transfected with either 50 nM anti-miR-205 inhibitor or scrambled negative control. [score:3]
Activities of the firefly luciferase with the ZEB1 or ZEB2 3'-untranslated region (UTR) in the presence of co -transfected negative control (white bar) or miR-205 precursor (black bar). [score:3]
The miR-205 expression levels were not associated with histological differentiation of human ESCC. [score:3]
These results indicate that overexpression of miR-205 could be specific to ESCC cells, and hence, we sought to determine the functional roles of miR-205 in ESCC. [score:3]
In zebra fish, miR-205 is predominantly expressed in the epidermis, while in mice, it was detected in the footpad, tongue, epidermis, and corneal epithelium, but not in the small intestine, brain, heart, liver, kidney, and spleen [5, 32, 33]. [score:3]
For each well, anti-miR-205 inhibitor molecule, miR-205 precursor, or each scrambled negative control was introduced into each well at a concentration of 50 nM. [score:3]
In most clinical cases of ESCC, miR-205 expression was more enhanced in ESCC tumors than in the paired non-cancerous esophageal mucosa. [score:3]
Similar to our observations, miR-205 was found to function as a tumor suppressor in diverse cell types [34- 37]. [score:3]
MiR-205 precursor and anti-miR-205 inhibitor transfection. [score:3]
In the present study, miR-205 was exclusively overexpressed in ESCC. [score:3]
The miR-205 expression levels did not differ among the histological subclasses of ESCC differentiation (Figure 5C), albeit those in invasive ESCC with poor differentiation were significantly lower than in intraepithelial ESCC (Figure 5D). [score:3]
Figure 4 MiR-205 reduces epithelial-mesenchymal transition(EMT) through regulating zinc finger E-box binding homeobox2 (ZEB2) expression. [score:3]
Transfection of miR-205 precursor, anti-miR-205 inhibitor, or each negative control (all purchased from Applied Biosystems) at indicated concentrations was introduced into the cell using 20 μl siPort NeoFX Transfection Agent (Applied Biosystems) in 500 μl Opti-MEM (GIBCO™, Invitrogen, Carlsbad, CA) according to the manufacturer's recommendations. [score:3]
Among the significantly altered miRs, only the miR-205 and -10a expression levels were substantially increased and decreased, respectively, in all ESCC cell lines (OE21, TE5, TE8, TE10, and TE11) compared to Het-1A cells on quantitative RT-PCR (Figure 2A, 2B). [score:2]
In reporter assay using the ZEB1 3'-UTR, however, miR-205 precursor was unable to reduce the luciferase reporter expression (Figure 5A). [score:2]
There were no significant differences between OE21 cells transfected with miR-205 precursor and anti-miR-205 inhibitor at the indicated concentrations in the optical densities of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assays (B). [score:2]
Collectively, miR-205, along with members of the miR-200 family, can be a key regulator of EMT to wi dely enforce the indolent epithelial-like phenotype, not limited to ESCC. [score:2]
On the other hand, the miR-205 expression levels are exclusively increased in each ESCC cell line compared to those in any other malignant cell types examined and Het-1A cells (Figure 2B). [score:2]
Iorio et al reported that miR-205 was significantly underexpressed in breast tumors compared with matched normal mammary tissue. [score:2]
MiR-205 expression was specifically increased in ESCC cells. [score:2]
In addition, two miR-205 binding sites were indentified in ZEB2 [15, 17], suggesting EMT could be also regulated by miR-205. [score:2]
Another study identified miR-205 as one of a set of 6 miRs that were differentially expressed in pulmonary squamous cell lung carcinoma compared to adenocarcinoma [30]. [score:2]
Although miR-205 did not affect cellular proliferation, apoptosis, and differentiation of ESCC in the present study, knockdown of miR-205 significantly promoted the locomotion and invasion of ESCC cells. [score:2]
On the other hand, the miR-205 expression levels were exclusively increased in each ESCC cell line compared to those in any other malignant cell types examined and Het-1A cells (B). [score:2]
It has been reported that miR-205 could be a discriminator between esophageal squamous and metaplastic epithelium (Barrett's esophagus) [11]. [score:1]
Thus, miR-205 could be a specific miR in ESCC. [score:1]
In clinical settings, lower levels of miR-205 were significantly associated with loco-regional recurrence and poor survival of patients with head and neck squamous cell carcinoma [41]. [score:1]
MiR-205 is a highly conserved miR with homologs in diverse species [30, 32, 33]. [score:1]
These observations suggest that miR-205 might represent a stratified squamous epithelium miR. [score:1]
We confirmed successful transfections using real-time RT-PCR for miR-205. [score:1]
miR-205 modulates cellular invasion and migration of ESCC. [score:1]
miR-205 is not involved in cellular differentiation of ESCC tumors. [score:1]
These data are in agreement with previous reports that miR-205 was abundant in squamous cells in humans [30, 31]. [score:1]
To assess the effect of miR-205 on reporter activity, either 50 nM of miR-205 precursor (Applied Biosystems) or the negative control was co -transfected. [score:1]
Oligonucleotides complementary to mature miR-205 were labeled with digoxigenin by terminal transferase -mediated 3' end-labeling and used as probes. [score:1]
There were no significant differences in the percentages of apoptotic cells with morphological characteristics between the OE-21 cells transfected with miR-205 precursor and anti-miR-205 inhibitor at the indicated concentrations (C). [score:1]
The miR-205 expression levels in ESCC tumor samples and matched non-cancerous surrounding mucosa of the esophagus were measured using quantitative RT-PCR. [score:1]
miR-205 is not involved in cellular proliferation or apoptosis of ESCC. [score:1]
In this context, miR-205 could interfere with the phosphatidylinositol-3 kinase/Akt survival pathway mediated by HER [34]. [score:1]
[1 to 20 of 89 sentences]
3
[+] score: 302
This was further supported by the findings that decreased miR-205 expression with miR-205 inhibitor up-regulated TCF21 mRNA expression. [score:10]
Data presented as mean ± S. E. M, * P < 0.05 and ** P < 0.01 To further confirm miR-205 regulates TCF21 expression, we transfected TCF21 expression vectors, miR-205 mimic and miR-205 inhibitor into OVCAR-5, OVCAR-8 and S KOV-3 cells. [score:8]
Data presented as mean ± S. E. M, * P < 0.05 and ** P < 0.01 To further confirm miR-205 regulates TCF21 expression, we transfected TCF21 expression vectors, miR-205 mimic and miR-205 inhibitor into OVCAR-5, OVCAR-8 and S KOV-3 cells. [score:8]
Fig. 6TCF21 inhibits ovarian cancer cell invasion and miR-205 attenuates its inhibition of cell invasion (a) Photographs of invasive cells on Transwell membrane after transfection with TCF21 expression plasmid and 205 -mimic. [score:7]
We identified an inverse relationship of increased miR-205 expression and decreased TCF21 expression in ovarian cancer tissue which was more prominent in the advanced stages of the disease. [score:7]
In prostate cancer, miR-205 re -expression induces the tumor suppressor genes IL24 and IL32 by targeting specific sites in their promoter regions [11]. [score:7]
miR-205 inhibited TCF21 expression and as a consequence blunted the inhibitory effect of TCF21 on cell invasion. [score:7]
Taken together, these findings indicate that miR-205 directly targets TCF21, and promotes cell invasion by repressing TCF21 expression in human ovarian epithelial carcinomas. [score:6]
We conclude that miR-205 regulates invasive behavior of epithelial ovarian cancer cells by targeting the tumor suppressor, TCF21. [score:6]
miR-205 directly targets TCF21 and represses TCF21 expression in ovarian cancer cells. [score:6]
miR-205 targets TCF21 and regulates TCF21 mediated MMP expression in ovarian cancer cell invasion. [score:6]
These results indicate that miR-205 directly targets TCF21 and represses TCF21 expression in ovarian cancer. [score:6]
Our results showed that miR-205 expression was significantly up-regulated in stage I to stage IV ovarian cancer tissue: 3.5-fold higher in stage I; 4.3-fold higher in stage II; 9.5 -fold higher in stage III; and 15.9 -fold higher in stage IV. [score:6]
Real time qRT-PCR and confirmed that miR-205 in ovarian cancer cells down-regulated TCF21 expression. [score:6]
OVCAR-5, OVCAR-8 and S KOV-3 cells were seeded in 6 well plates at 0.5 × 10 [6] cells per well with DMEM or RPMI medium1640 and 10% FBS for 24 h. Synthetic miR-205 mimic, miR-205 inhibitor or TCF21 expression plasmid were transfected into the cells with Lipofectamine 2000™ (Life Technologies). [score:5]
Co-transfection of TCF21 expression plasmid with miR-205 mimic diminished the inhibitory effect of TCF21 on MMP-2 and MMP-10 in ovarian cancer cells. [score:5]
miR-205 inhibitor significantly increased TCF21 mRNA expression in the OVCAR-5, OVCAR-8 and S KOV-3 cells (Fig. 5d). [score:5]
Data presented as mean ± S. E, * P < 0.05 and ** P < 0.01 We then co -transfected TCF21 expression plasmids and miR-205 mimic into OVCAR-5, OVCAR-8 and S KOV-3 cells, and performed invasion assays to test the direct impact of miR-205 on the inhibition of cell invasion properties mediated by TCF21. [score:5]
Co-transfection TCF21 expression plasmid with miR-205 mimic attenuated the TCF21 -mediated inhibition of cell invasion (Fig. 6a-b). [score:5]
When co -transfected with miR-205 mimic and TCF21 expression plasmids, the expression of MMP-2 was unchanged in OVCAR-5 and OVCAR-8 cells, but increased in S KOV-3 cells. [score:5]
However, TCF21 expression was significantly decreased when miR-205 mimic was co -transfected with TCF21 expression plasmid in the OVCAR-5, OVCAR-8 and S KOV-3 cells (Fig. 5a-c). [score:5]
In the present study, we found that miR-205 expression was up-regulated in all stages (I – IV) of ovarian cancer tissue and ovarian cancer cell lines compared to normal ovary. [score:5]
b miR-205 expression in OVCAR-5, OVCAR-8 and S KOV-3 cells after miR-205 inhibitor transfection. [score:5]
d Quantitative reverse-transcription PCR result showing MMP-2, MMP-7, MMP-9 and MMP-10 expression levels in OVCAR-5, OVCAR-8 and S KOV-3 cells after transfection with TCF21 expression plasmid and miR-205 mimic. [score:5]
The synthetic miR-205 mimic, miR-205 inhibitor, or TCF21 expression plasmid transfected cells in 500 μl of serum-free culture medium were placed on the matrigel-coated upper cell insert chambers (24-well inserts; pore size, 8 mm). [score:5]
Data presented as mean ± S. E, * P < 0.05 and ** P < 0.01 We then co -transfected TCF21 expression plasmids and miR-205 mimic into OVCAR-5, OVCAR-8 and S KOV-3 cells, and performed invasion assays to test the direct impact of miR-205 on the inhibition of cell invasion properties mediated by TCF21. [score:5]
d Quantitative reverse-transcription PCR result showing TCF21 expression after miR-205 inhibitor transfection in OVCAR-5, OVCAR-8 and S KOV-3 cells. [score:5]
a Quantitative reverse-transcription PCR result showing TCF21 expression after TCF21 expression plasmid and miR-205 mimic co-transfection in OVCAR-5, OVCAR-8 and S KOV-3 cells. [score:5]
miR-205 directly targeted TCF21, which was significantly decreased in ovarian cancer tissue. [score:4]
The results provide a new understanding of miR-205 and TCF21 expression and insight into the mechanisms in ovarian cancer tumorigenesis which could lead to the development of new anticancer therapies. [score:4]
However, TCF21 protein expression didn’t show significant difference compared with control after miR-205 inhibitor transfection (data not shown). [score:4]
The results suggest that upregulated miR-205 in ovarian cancer tissue and cell lines may correlate with ovarian cancer carcinogenesis. [score:4]
We found that miR-205 expression was significantly increased and TCF21 (a tumor suppressor gene) significantly decreased in epithelial ovarian carcinomas compared with normal ovary. [score:4]
We further confirmed the miR-205 expression in three ovarian cancer cell lines: OVCAR-5, OVCAR-8 and S KOV-3. The expression of miR-205 significantly increased in three ovarian cancer cell lines compared with normal ovarian tissue: 2.5-fold higher in OVCAR-5; 7-fold higher in OVCAR-8; and 17-fold higher in S KOV-3 (Fig. 1b). [score:4]
There was no significant difference of miR-205 expression between stage I and stage II ovarian cancer, but miR-205 expression significantly increased in stage III and stage IV compared with stage I ovarian cancer (Fig. 1a). [score:4]
miR-205 expression increased in ovarian cancer tissue and ovarian cancer cell lines. [score:3]
miR-205 expression was increased in ovarian cancer and it promoted the invasive behavior of ovarian cancer cell lines (OVCAR-5, OVCAR-8 and S KOV-3). [score:3]
However, the transfection of miR-205 mimic into ovarian cancer cells diminished TCF21 -mediated inhibition of cell invasion. [score:3]
miR-205 appears to have an important role in the spread of ovarian cancer by targeting TCF21. [score:3]
The TCF21 segment containing the target site of miR-205 or mutant 3’UTR sequences were inserted downstream of the firefly luciferase reporter gene (Fig. 4a). [score:3]
Human miR-205 is located on chromosome 1 and the effect of cancer on its expression is tissue and type specific. [score:3]
The TCF21 segment containing target site (2593-2600) of miR-205 or mutant TCF21 segment were PCR amplified using Hotstar HiFi delity™ Polymerase kit (Qiagen). [score:3]
In contrast, it was decreased after miR-205 inhibitor transfection (Fig. 2b). [score:3]
TCF21 has been predicted using computational methods to be a potential target gene of miR-205. [score:3]
a Quantitative Reverse-Transcription PCR demonstrating expression of miR-205 in OVCAR-5, OVCAR-8 and S KOV-3 cells after miR-205 mimic transfection. [score:3]
Multiple investigators have reported that miR-205 is up-regulated in lung, kidney and bladder cancers [9, 10], but down regulated in prostate, esophageal, melanoma, and breast cancers [11– 14]. [score:3]
Quantitative real-time polymerase chain reaction and western blot were performed to assess miR-205 and transcription factor 21 (TCF21) expression in ovarian cancer and normal ovary samples. [score:3]
miR-205 attenuated the Inhibition of TCF21 mediated cell invasion in vitro. [score:3]
b The Western blot illustrating TCF21 protein levels after TCF21 expression plasmid and miR-205 mimic transfection in three ovarian cancer cell lines. [score:3]
This is supported by our findings that miR-205 targets TCF21 and reverses TCF21 -mediated decreases in ovarian cancer cells invasion. [score:3]
For example, miR-205 inhibited cancer cell proliferation and invasion in prostate, esophageal, melanoma, and breast cancer [11– 14, 24– 27], but promoted tumorigenesis in lung and cervical cancer [28, 29]. [score:3]
The experiments were performed at the same time with miR-205 inhibitor (Fig. 2c) and therefore, the same scrambled controls were used in the analysis of invasion. [score:3]
Data presented as mean ± S. E. M, * P < 0.05 and ** P < 0.01 Using bioinformatics software tools, we found that miR-205 targets TCF21. [score:3]
Furthermore, co-transfection of TCF21 expression plasmid with miR-205 blocked the effects of TCF21 on MMPs. [score:3]
These results demonstrate that miR-205 promotes ovarian cancer cells invasion by targeting TCF21 in ovarian cancer cells. [score:3]
For transfection, cells were seeded at 0.5 × 10 [6] cells per well in 6 well plates and cultured for 24 h. The synthetic miR-205 mimic (Qiagen, final concentration 50 nM), miR-205 inhibitor (Qiagen, final concentration 100 nM) and TCF21 plasmid (2.5 μg per well) were co -transfected into OVCAR-5, OVCAR-8 and S KOV-3 cells using Lipofectamine 2000™ (Life Technologies) 10 μl/well. [score:3]
a Quantitative Reverse-Transcription PCR analysis of miR-205 expression levels in normal ovarian tissue and ovarian cancer tissue stage I-IV (Stage I n = 8; StageII n = 7; Stage III n = 7; Stage IV n = 8). [score:3]
a Algorithms predicted TCF21 contains miR-205 binding site on its 3′-untranslated regions. [score:3]
c Photograph result of invasive cells on Transwell membrane after transfection with scrambled control, miR-205 mimic or miR-205 inhibitor. [score:3]
The mean number of cells penetrating the Transwell membrane was significantly increased 5 to 6-fold by the miR-205 mimic compared to scrambled controls while the miR-205 inhibitor significantly decreased the number of cells (2 to 3-fold) crossing the membrane (Fig. 2c-d). [score:2]
In order to understand the impact of miR-205 on TCF21 -induced inhibition of cell invasion, we co -transfected miR-205 mimic into ovarian cancer cells along with the TCF21 expression vector, and then measured invasion properties using Transwell invasion assay. [score:2]
miR-205 expression levels were associated with ovarian cancer stages, and increased significantly in stage III and stage IV ovarian cancer compared with stage I and II ovarian cancer. [score:2]
Data presented as mean ± S. E. M, * P < 0.05 and ** P < 0.01 To confirm the targeting of TCF21 by miR-205, we performed a luciferase reporter assay. [score:2]
b The relative expression levels of miR-205 in three ovarian cancer cell lines compared with normal ovarian tissue. [score:2]
Data presented as mean ± S. E. M, * P < 0.05 and ** P < 0.01 miR-205 mimic and miR-205 inhibitor were transfected into OVCAR-5, OVCAR-8 and S KOV-3 cells and subjected to Transwell invasion assays to assess whether the invasive properties were modified by transfection. [score:2]
The Dual-Luciferase Assay revealed that the luciferase activity of TCF21 reporter vector was suppressed by transfection of the miR-205 mimic (Fig. 4b). [score:2]
To better understand how the regulation of TCF21 by miR-205 affects invasion we investigated MMP expression. [score:2]
In this investigation, we test the hypothesis that miR-205 regulates TCF21 mediated tumor suppression in ovarian cancer leading to tumor progression. [score:2]
Data presented as mean ± S. E. M, * P < 0.05 and ** P < 0.01 To confirm the targeting of TCF21 by miR-205, we performed a luciferase reporter assay. [score:2]
miR-205 expression was significantly increased after transfection with the miR-205 mimic in three cell lines compared with scrambled controls (Fig, 2a). [score:2]
We further confirmed our hypothesis in three ovarian cancer cell lines: OVCAR-5, OVCAR-8 and S KOV-3. Increasing miR-205 in ovarian cancer cells caused a significant reduction in TCF21 activity as measured using a luciferase reporter construct containing the miR-205 target site. [score:1]
The increases of miR-205 in ovarian cancer cells: OVCAR-5, OVCAR-8 and S KOV-3 enhanced their invasive behavior. [score:1]
To better understand the mechanism of miR-205 and TCF21 on ovarian cancer cells invasion properties, we tested the hypothesis that MMPs were important for invasive behavior. [score:1]
b Dual-luciferase assay revealed the direct interaction between miR-205 mimic and TCF21 reporter vector in OVCAR-5, OVCAR-8 and S KOV-3 cells. [score:1]
Data are presented as mean ± S. E. M. We investigated the expression level of miR-205 in ovarian cancer and normal ovarian tissues using SYBR-Green qRT-PCR analysis. [score:1]
miRNA-205 mimic (50 nM) (Qiagen), TCF21 reporter vector or mutant vector (0.25 μg), and the internal control pRL reporter vector (0.002 μg) were transfected into ovarian cancer cell lines using Lipofectamine 2000™ (Life Technologies). [score:1]
Several studies suggested that miR-205 is involved in tumorigenesis. [score:1]
These findings suggest miR-205 promotes ovarian cancer cell invasion and acts as a tumor oncogene in ovarian cancer tumorigenesis. [score:1]
miR-205 promotes ovcar-5, ovcar-8 and skov-3 cell invasion in vitro. [score:1]
In this study, we provide evidence that TCF21 is also modulated by miR-205. [score:1]
miR-205 mimic was co -transfected into ovarian cancer cell lines along with the TCF21 wild-type or mutant reporter vectors and internal control pRL reporter vectors. [score:1]
Presently, we investigate the molecular mechanisms and target of miR-205 in ovarian cancer. [score:1]
These findings are consistent with miR-205 being a tumor oncogene in ovarian cancer with important roles in tumor invasion and metastasis. [score:1]
We investigated the expression level of miR-205 in ovarian cancer and normal ovarian tissues using SYBR-Green qRT-PCR analysis. [score:1]
[1 to 20 of 84 sentences]
4
[+] score: 248
Using stable transfection with miRNA precursors or inhibitors, we generated (see ) miR-205 -expressing and miR-373 -expressing Caco-2 [WT] clones (Caco-2 [WT]/miR-205; Caco-2 [WT]/miR-373) as well as miR-205-inhibiting and miR-373-inhibiting Caco-2 [D299G] clones (Caco-2 [D299G]/α-miR-205; Caco-2 [D299G]/α-miR-373). [score:11]
We chose stable transfection to overexpress the precursors or inhibitors of miR-205/miR-373 in Caco-2 [WT] or Caco-2 [D299G], because only this approach allowed long-term study of miRNA -mediated induction or inhibition of individual phenotypic effects and permanent gene target modulation. [score:9]
Furthermore, we detected (Fig 4A and 4B) that KLF4 was constitutively increased on mRNA and protein levels in IEC expressing miR-205 (Caco-2 [WT]/miR-205; Caco-2 [D299G]/α-miR-c), which correlated with upregulated expression of MUC2 and TGFβ1 as well as activation of several cell cycle regulators (RB, CDC2, and CCND2). [score:9]
This result resembled the pattern seen in Caco-2 [D299G]/α-miR-c. Reversely, stable inhibition of miR-205 in Caco-2 [D299G] restored protein expression of PKCε, which correlated with suppressed AKT activity. [score:7]
Overexpression of the miR-205- and miR-373- inhibitors led to decreased expression of mature miR-205 and miR-373 in Caco-2 [D299G]. [score:7]
Finally, miR-205 and miR-373 may target (directly or indirectly) many more genes and affect expression of numerous other proteins than identified in this study. [score:7]
The opposite expression pattern was observed when miR-205 expression was basally low (Caco-2 [WT]/miR-c) or ectopically inhibited (Caco-2 [D299G]/α-miR-205). [score:7]
Clones of eGFP-tagged miExpress [™] precursor miRNAs of miR-205 (cat# HmiR0026-MR04) and miR-373 (cat# HmiR0347-MR04) and corresponding precursor miRNA scrambled control clone (miR-c) for vector pEZX-MR04 (cat# CmiR0001-MR04) as well as clones of mCherry-tagged miArrest [™] miRNA inhibitors of miR-205 (α-miR-205; cat# HmiR-AN1314-AM02), miR-373 (α-miR-373; cat# HmiR-AN0461-AM02) and corresponding miRNA inhibitor scrambled control clone (α-miR-c) for vector pEZX-AM02 (cat# CmiR-AN0001-AM02) were obtained from GeneCopoeia (Rockville, USA). [score:7]
Using realtime qPCR, we found (Fig 1C) that Caco-2 [WT] showed low levels of miR-205 and miR-373 expression, while both miRNAs were significantly upregulated in Caco-2 [D299G]. [score:6]
Here, we show that expression levels of miR-205 and miR-373 are specifically upregulated only in mucinous CRC. [score:6]
Expression of miR-205 and miR-373 is upregulated in colon carcinoma cells in-vitroNext, we aimed to determine the effects of miR-205 and miR-373 on cellular biology and function in normal and neoplastic intestinal epithelium in-vitro. [score:6]
Expression of miR-205 and miR-373 is upregulated in colon carcinoma cells in-vitro. [score:6]
The overexpressed pre-miR-205 and pre-miR-373 were successfully processed to increase expression of mature miR-205 and miR-373 in Caco-2 [WT], respectively, as confirmed by qPCR analysis (Fig 1D). [score:5]
Finally, overexpression of miR-205 enhanced chemoresistance of Caco-2 [WT] to MTX, while inhibition of miR-205 promoted chemosensitivity of Caco-2 [D299G] (Fig 6D). [score:5]
0156871.g001 Fig 1Expression levels of (A) miR-205 and (B) miR-373 are significantly upregulated in human mucinous (n = 20) and chronic UC (n = 13) CRC tumor areas compared to matched R [0] margins, as determined by qPCR. [score:5]
Importantly, using the reverse approach, we demonstrate that inhibition of miR-205 in colon carcinoma-like Caco-2 [D299G] suppressed in part these signaling events and and promoted sensitivity to chemotherapy. [score:5]
Expression levels of (A) miR-205 and (B) miR-373 are significantly upregulated in human mucinous (n = 20) and chronic UC (n = 13) CRC tumor areas compared to matched R [0] margins, as determined by qPCR. [score:5]
Overexpression of miR-205 in Caco-2 [WT] mediated derangement of the actin -based cytoskeleton and decreased the expression of ZO-1 in the cell membrane, but did not alter mitotic figures. [score:5]
Overexpression of miR-205 induces increased mucin production, while overexpression of miR-373 causes dedifferentiation. [score:5]
Second, to gain insight into the functional effects of miR-205/miR-373 signaling, as a proof-of-principle, we used a colon cancer cell-culture mo del based on the IEC line Caco-2 which reflected the endogenous miR-205/miR-373 expression pattern in correlation with human disease in patients with MAC. [score:5]
As shown in Fig 6A, Caco-2 [WT]/miR-373 showed loose patches of fibroblast-like, spindle-shaped mesenchymal cells after brief trypsinization, comparable to Caco-2 [D299G]/α-miR-c. In contrast, Caco-2 [D299G]/α-miR-373 maintained adhesive cobblestone-like epithelial morphology after treatment with trypsin, comparable to Caco-2 [WT]/miR-c. No changes in cell adhesion were evident by overexpression or inhibition of miR-205 in Caco-2 [WT] or Caco-2 [D299G], when compared to control clones. [score:4]
Further studies will need to identify the mechanisms that directly control expression of miR-205 and miR-373 during mucinous carcinogenesis in the colon. [score:4]
Overexpression of miR-205 drives goblet cell expansion and modulates cell cycle regulation. [score:4]
miR-205 caused upregulation of two central mediators of intestinal goblet cell expansion, KLF4 and TGFβ1. [score:4]
miR-205 induces expression of distinct molecules related to goblet cell differentiation and cell cycle regulation, as assessed by (A) western blot, (B) qRT-PCR and (C) IPA analysis. [score:4]
In contrast, miR-205/miR-373 expression levels were not elevated in sporadic AC, implying the presence of this specific miRNA signature only in mucin -associated subentities of CRC. [score:3]
miR-205 signaling has recently been implicated to target PKCε [41] and maintain a high phospho-AKT level [26]. [score:3]
First, we showed that the expression patterns of miR-205 and miR-373 differed between human mucinous vs. [score:3]
0156871.g003 Fig 3Expression of miR-205 and miR-373 differentially (A) alters actin cytoskeletal architecture, influences (B) ZO-1 and (C) phospho-β-CATENIN -associated barrier integrity, and (D) induces formation of multinucleated cells with multipolar spindles. [score:3]
Remarkably, Caco-2 [D299G] /α-miR-373 showed normal mitotic metaphases, comparable to Caco-2 [WT]/miR-c. However, inhibition of miR-205 in Caco-2 [D299G] did not change the fibroblast-like appearance with actin cytoskeletal disorganization, cytoplasmic redistribution of ZO-1 and aberrant mitotic figures. [score:3]
No significant differences in miR-205 and miR-373 expression were identified in paired colonic tumor tissue and corresponding normal mucosa from patients with conventional colonic adenocarcinoma (non-mucinous). [score:3]
We used Ingenuity Pathway Analysis (IPA) to build a hypothetical signaling mo del based on these molecules differentially expressed in Caco-2 [WT]/miR-205 vs. [score:3]
Expression levels of miR-205 and miR-373 are increased in mucin-producing human colon cancers. [score:3]
Stable overexpression of miR-205 in Caco-2 [WT] induced formation of secretory cells containing large vesicles with pale lucent contents occupying almost the entire cytoplasm (Fig 2A). [score:3]
In contrast, no significant differences in miR-205 and miR-373 expression are observed between paired conventional CRC (n = 18) tumor tissue and corresponding normal mucosa. [score:3]
We show in patients that elevated expression levels of miR-205 and miR-373 are associated with mucinous colon cancers and mucin-producing UC-colon cancers, but not with sporadic colonic AC that lack mucinous components. [score:3]
S4 FigExpression levels of (A) miR-205, (B) miR-373, (C) miR-1, (D) miR-10a and (E) miR-133a in different human colonic adenocarcinoma cell lines (LS 174T, HT-29, HCT 116 and SW480), in comparison to naïve (untransfected) Caco-2, Caco-2 [WT] and Caco-2 [D299G] cells, as determined by qPCR (n ≥ 2 samples/cell line). [score:3]
Expression levels of miR-205 and miR-373 were specifically increased in the two subgroups of colonic adenocarcinoma associated with mucin production (mucinous and chronic UC-related colorectal cancers) relative to adjacent normal colonic mucosa (Fig 1A and 1B). [score:3]
Expression of miR-205 and miR-373 differentially (A) alters actin cytoskeletal architecture, influences (B) ZO-1 and (C) phospho-β-CATENIN -associated barrier integrity, and (D) induces formation of multinucleated cells with multipolar spindles. [score:3]
Among the 2–7 remaining candidates per plasmid, individual subclones were chosen based on best expression levels of mature miR-205 and miR-373 using qPCR analysis. [score:3]
Abundant mucin production and MUC2 expression, which represent key features of goblet cells and MAC, were enhanced by miR-205 signaling. [score:3]
Expression levels of miR-205 and miR-373 in human CRC patient samples and Caco-2 subclones. [score:3]
Overexpression of miR-205 and miR-373 differentially alter morphological features of intestinal epithelial barrier integrity. [score:3]
However, we did not identify any correlations between miR-205 and miR-373 expression levels and cancer stages (including histological grade) in any subtype. [score:3]
Future studies must determine whether such mutations may influence activity and outcome of miR-205/miR-373 signaling and whether aberrant TLR4 signaling may be directly involved in MAC pathogenesis. [score:3]
Of note, conditioned media from Caco-2 [D299G] stimulated enhanced expression of miR-373, but not miR-205, in Caco-2 [WT] (Fig 5D). [score:3]
Reversely, the conditioned media from Caco-2 [D299G] induced expression of miR-373, but not miR-205, in Caco-2 [WT], suggesting that secretory products from the tumor cells may have the capacity to promote miR-373 signaling in a paracrine/autocrine manner, which may contribute to malignant transformation. [score:3]
0156871.g002 Fig 2(A-D) Caco-2 [WT] overexpressing miR-205 or miR-373 display significant morphologic changes when compared to control Caco-2 [WT]/miR-c. In contrast, suppression of miR-373 reverses some of the neoplastic characteristics of Caco-2 [D299G]. [score:2]
Of note, expression of miR-205 was slightly higher in UC -associated cancer compared to (non-UC) mucinous cancer. [score:2]
miR-205 promotes goblet cell differentiation and cell cycle regulation. [score:2]
Functionally, miR-205 directs the intestinal epithelial cell fate decision toward a mucin-producing goblet cell-like lineage and miR-373 drives inflammation -associated tumor progression by decreasing cell-cell adhesion and increasing invasion. [score:2]
Collectively, our findings imply that miR-205 activates a complex regulatory circuit whose orchestration induces enhanced mucinous differentiation in colonic epithelial cells. [score:2]
Signaling via miR-205 and miR-373 can favor epithelial-to-mesenchymal transition (EMT) and cancer cell migration in certain tumor entities [24, 31– 33]. [score:1]
miR-205 and miR-373 disturb intestinal epithelial barrier integrity. [score:1]
However, the possible roles of miR-205 and miR-373 in CRC pathogenesis remain so far unknown. [score:1]
In contrast, activation or inactivation of miR-205 did not influence the invasive migration pattern. [score:1]
Caco-2 [D299G]/α-miR-205, which is shown in Fig 4C. [score:1]
Next, we aimed to determine the effects of miR-205 and miR-373 on cellular biology and function in normal and neoplastic intestinal epithelium in-vitro. [score:1]
To further understand the morphologic changes induced by miR-205 and miR-373, we performed a series of immunofluorescence staining experiments to assess the effects on structural organization of the actin cytoskeleton (Fig 3A), distribution of barrier -associated tight junctional ZO-1 (Fig 3B) and phospho-β-CATENIN (Fig 3C) and formation of the mitotic spindle (Fig 3D). [score:1]
Recently, independent reports have variably reported miR-205 and miR-373 to be associated with CRC [21– 23], but individual cases were not classified into histological subtypes. [score:1]
We found that PKCε was repressed in Caco-2 [WT]/miR-205, which was associated with enhanced AKT phosphorylation (Fig 4A). [score:1]
In conclusion, to the best of our knowledge, this study provides first evidence that miR-205 and miR-373 may correlate with mucinous CRC in humans and functionally induce different features of mucinous -associated neoplastic progression in Caco-2 subclones. [score:1]
miR-205 interacts with members of the miR-200 family (miR-200a/-200b) [24] and represents an epithelial-specific miRNA [25], essentially involved in normal cell functions, such as regeneration and stem cell expansion [26]. [score:1]
We investigated the role of miR-205 and miR-373 in the pathophysiology of different histological subtypes of colorectal cancer by assessing their expression, together with that of other miRNAs, in specimens of conventional, mucinous and UC -associated human colonic adenocarcinoma. [score:1]
0156871.g006 Fig 6. Functional analysis of miR-205 and miR-373 in colon cancerogenesis. [score:1]
Our results indicate that miR-205 and miR-373 may differentially contribute to the aggressive behavior of mucinous malignancy in CRC. [score:1]
Thus, we provide first evidence that distinct signaling effects of miR-205 and miR-373 may differentially contribute to the unique phenotype of MAC in CRC. [score:1]
We tested the single miRNAs individually, and not the combined miR-205/miR-373 phenotype. [score:1]
Functional analysis of miR-205 and miR-373 in colon cancerogenesis. [score:1]
Both KLF4 and TGFβ1 induce cell cycle arrest via CYCLIN D2 [48, 49], which was also increased by miR-205 in Caco-2 [WT]. [score:1]
Functionally, miR-205 conferred resistance to chemotherapy of goblet cell-like Caco-2 [WT], potentially through enhanced secretion of MUC2 [50]. [score:1]
Forced introduction of miR-205 into normal-like Caco-2 [WT] conferred a gain-of-function phenotype, leading to accumulation of mucus-secreting goblet cell-like cells, which strikingly resembled the mucinous component of MAC. [score:1]
Both miR-205 and miR-373 seem to exert pleiotropic effects on tumorigenesis, depending on the cell or tissue of origin. [score:1]
miR-205 and miR-373 drive different functions of colon cancer progression. [score:1]
miR-205 induces increased mucin production, while miR-373 causes dedifferentiation. [score:1]
analysis confirmed increased production of MUC2 in Caco-2 [WT]/miR-205 (Fig 2D). [score:1]
[1 to 20 of 76 sentences]
5
[+] score: 232
Other miRNAs from this paper: mmu-mir-205, hsa-mir-214, mmu-mir-214, hsa-mir-494, mmu-mir-494
Therefore, we hypothesized that some tumor suppressor genes targeted by miR-205 are downregulated in OC as miR-205 was upregulated in OC. [score:11]
Finally, SMAD4 and PTEN were selected for further study since these two genes were found to be the lowest expression in both HO-8910 and S KOV-3 cells overexpressing miR-205, and also have been reported to be down-regulated in OC previously and is closely involved in OC cell proliferation, migration, invasion and chemoresistance. [score:8]
Taken together, these data indicate that miR-205 can repress the expression of SMAD4 or PTEN in OC cells by directly targeting the 3′ UTR of SMAD4 or PTEN mRNA. [score:6]
Our data showed that miR-205 was upregulated in OC tissues and cells in comparison to the controls, and miR-205 overexpression was significantly associated with poor overall survival in OC patients. [score:6]
MiR-205 was upregulated in ovarian cancer and overexpression of miR-205 promoted ovarian cancer cell proliferation, metastasis both in vitro and in vivo. [score:6]
Furthermore, the function of miR-205 in ovarian cancer may be exerted via downregulation of the target genes SMAD4 and PTEN, which play an important role in the function of miR-205 in ovarian cancer. [score:6]
Furthermore, the cisplatin-resistant OC cells S KOV-3/DDP showed a significant higher expression of miR-205, and lower PTEN expression compared with its parent cancer cells S KOV-3. Therefore, these findings showed that miR-205 could be a new member of the miRNAs that were involved in ovarian cancer cisplantin resistance, which was involved in AKT signal pathway through targeting PTEN. [score:6]
6) mice with higher miR-205 expression had lower expression of SMAD4 and PTEN than that of controls. [score:5]
Next, to verify the high expression of miR-205 in ovarian cancer patients, miR-205 expression of 110 ovarian cancer tissues paired with three normal ovarian tissues were detected by qRT-PCR. [score:5]
Therefore, we predicted potential targets of miR-205 by bioinformation analysis and several target genes were identified. [score:5]
From the miRWALK, hundreds of potential targets were found to be targeted by miR-205. [score:5]
How to cite this article: Li, J. et al. Upregulation of MiR-205 transcriptionally suppresses SMAD4 and PTEN and contributes to human ovarian cancer progression. [score:5]
The mice group that stably overexpressing miR-205 expressed significantly higher luciferase luminescence activities. [score:5]
Taken together, these results strongly suggest that miR-205 is correlated with poor prognosis, and is upregulated in ovarian cancer, suggesting that miR-205 functions as an oncogene in ovarian cancer development. [score:5]
But it is unclear whether and how these confirmed miRNAs such as miR-205, miR-494, miR-214 directly targeting PTEN co-regulate the PTEN/Akt pathway, further effects the DDP resistance and other biological function in a collaborative or antagonistic manner. [score:5]
In our study, we demonstrated that overexpression of miR-205 led to an obvious cisplatin resistance in OC cells and is negatively correlated with PTEN expression. [score:5]
Among these genes, 14 tumor-suppressor genes were identified after reading literatures and then screened in our two stably expressing miR-205 cell lines (Supplementary Figure S1). [score:5]
SMAD4 and PTEN are direct target of miR-205 in OC. [score:4]
SMAD4 and PTEN are direct transcriptional targets of miR-205 in OC cells. [score:4]
Therefore, this research indicates that miR-205 may play an important role in ovarian cancer progression and could be targeted for the development of novel treatment for OC in the future. [score:4]
These finding suggested that miR-205 might act as an oncogene whose upregulation contributed to the progression and metastasis of OC. [score:4]
To confirm that SMAD4 or PTEN was directly inhibited by miR-205, a dual-luciferase reporter system was used. [score:4]
Moreover, another study showed that miR-205 was a suppressor of prostate cancer development, and loss of miR-205 was associated with prostate cancer progression 35. [score:4]
miR-205 is upregulated in ovarian cancer. [score:4]
MiR-205 inhibited the firefly luciferase reporter activity of wild-type SMAD4 and PTEN 3′ UTR, but this inhibition was less changed for 3′ UTR with mutated binding sites (Fig. 4E). [score:4]
Furthermore, overexpression of miR-205 could promote cell proliferation, migration, invasion and chemoresistance of ovarian cancer cells. [score:3]
Kaplan-Meier analysis indicated that the 5-year overall survival (OS) rates of ovarian cancer patients with high miR-205 expression was significantly lower (Fig. 1A). [score:3]
In agreement with these observations, upregulation of miR-205 was also confirmed in 6 ovarian cancer cell lines (HO-8910, HO-8910PM, S KOV-3, S KOV-3ip, S KOV-3/DDP, and COC1) compared with a pool of 3 normal ovarian tissues as a normal control (Fig. 1C). [score:3]
Overexpression of miR-205 also increased the chemoresistance of OC cells. [score:3]
First, endogenous SMAD4 and PTEN mRNA or protein levels were markedly decreased in HO-8910 and S KOV-3 cells stably expressing miR-205 compare to that of control cells (Fig. 4B,C). [score:3]
Establishment of stably expressing miR-205 ovarian cancer cell lines. [score:3]
We infected HO-8910 and S KOV-3 cells with lentiviral vector harboring miR-205 (LV-miR-205) to establish two stably expressing miR-205 cells. [score:3]
We detected miR-205 expression in 110 archived clinical ovarian cancer tissues. [score:3]
The HO-8910 cells (1 × 10 [6] cells) stably expressing either LV-miR-205 or LV-miR-Ctrl were injected intraperitoneally (i. p. ) into two groups. [score:3]
Moreover, High expression of miR-205 was also found in cervical cancer cell lines as well as clinical patient samples 33. [score:3]
In bladder cancer, miR-205 was found to be significantly upregulated compared to normal tissue 32. [score:3]
We examined the relationship between miR-205 expression and cell sensitivity to a chemotherapeutic drug, Cisplatin (Sigma-Aldrich, St. [score:3]
In accordance with this hypothesis, we found that ectopic expression of miR-205 decreased SMAD4 or PTEN both mRNA and protein levels in OC cells. [score:3]
MiR-205 is upregulated in OC and correlated with poor survival. [score:3]
HO-8910 cells stably expressing miR-205 or control cells were injected intraperitoneally (i. p. ) into nude mice in each group. [score:3]
These information suggesting that oncogenic activity of miR-205 is possible, in part, through targeting SMAD4 and PTEN. [score:3]
Overexpression of miR-205 significantly promoted tumor dissemination. [score:3]
Thus, to predict potential miR-205 targets, we used the miRWALK (http://zmf. [score:3]
Consistent with above results, there was also a negative correlation between miR-205 expression and mRNA or protein levels of PTEN in S KOV-3/DDP and S KOV-3 cells (Fig. 4D). [score:3]
The result showed that miR-205 was significantly overexpressed in ovarian cancer tissues (Fig. 1B). [score:3]
In our study, the tumor-promotive role of miR-205 in vivo was treated by intraperitoneally injecting HO-8910 cells stably expressing miR-205 and monitored by IVIS system. [score:3]
The migration assay demonstrated that HO-8910 and S KOV-3 cells overexpressing miR-205 were found to have significantly higher rate of migration than control cells (Fig. 2D). [score:2]
Our study is the first to show that miR-205 functions as a tumor-promotive miRNA through directly binding to SMAD4 and PTEN in OC. [score:2]
Furthermore, qRT-PCR analysis of the implanted tumors showed that SMAD4 and PTEN mRNA expression were significantly reduced in the LV-miR-205 group compared with the LV-miR-Ctrl group (Fig. 5D), further supporting the notion that miR-205 promoted OC tumorigenesis via SMAD4 and PTEN. [score:2]
Similarly, the Matrigel invasion assay indicated that overexpression of miR-205 significantly promoted the invasiveness of HO-8910 and S KOV-3 cells (Fig. 2E). [score:2]
Further qRT-PCR analysis indicated the negative regulation of miR-205 to SMAD4 or PTEN. [score:2]
Overexpression of miR-205 led to an obvious increase in the IC50 value of cisplatin in both HO-8910 (IC50; miR 15.69 ± 1.05 control 7.35 ± 1.04) and S KOV-3 cells (IC50; miR 14.87 ± 1.03 control 9.22 ± 1.03) when compared with that in the control group (Fig. 3A). [score:2]
After this, miR-205 expression was further found to be higher in S KOV-3/DDP cells compared with that in S KOV-3 (Fig. 3C). [score:2]
We then examined the tumor promotive role of miR-205 in ovarian cancer progression using an in vivo tumor mo del. [score:1]
The wild-type or mutated 3′ UTR of SMAD4 and PTEN mRNA were inserted downstream of the luciferase reporter gene, and LV-miR-205 was co -transfected with each construct in HEK-293T cells. [score:1]
Both SMAD4 and PTEN mRNAs had one possible binding site for miR-205 (Fig. 4A). [score:1]
In summary, this study identified miR-205 as a novel oncogenic miRNA that is stimulated in both in vitro and in vivo studies in OC. [score:1]
Having observed the association of miR-205 expression and poor survival in OC patients, we set out to functionally characterize the effects of miR-205 on ovarian cancer cells. [score:1]
We counted the number of peritoneal implants and found that the implants number in LV-miR-205 group were significantly more than that in LV-miR-Ctrl group (Fig. 5C). [score:1]
To our knowledge, the role and mechanism of miR-205 in OC have not been completely understood. [score:1]
To further verify the promoting effect of miR-205 on cell chemoresistance, we also detect miR-205 expression in the cisplatin-resistant S KOV-3/DDP cells and its parent cancer cells S KOV-3. First, using the sulforhodamine B (SRB) assay, we proved that S KOV-3/DDP cells were indeed significantly more resistant to the therapy of cisplatin compared with S KOV-3 (IC50; S KOV-3/DDP 35.67 ± 1.06 S KOV-3 9.27 ± 1.03) (Fig. 3B). [score:1]
miR-205 promotes the chemoresistance of OC cells. [score:1]
miR-205 promotes OC tumorigenesis in vivo. [score:1]
We then used the Cell Counting Kit-8 (CCK-8) assay to assess the effects of miR-205 on cell proliferation, the result showed that miR-205 overexpression significantly increased the growth rates of HO-8910 and S KOV-3 cells (Fig. 2B), and the promoting effect of miR-205 on cell proliferation was further confirmed by colony formation assay (Fig. 2C). [score:1]
To our knowledge, there is no study on miR-205 and OC tumorigenicity in an animal mo del. [score:1]
For the detection of miR-205, RNA was reverse transcribed into cDNA using All-in-One™ miRNA First-Strand cDNA Synthesis Kit (GeneCopoeia, Guangzhou, China), and then was used to perform qRT-PCR using All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Guangzhou, China). [score:1]
MiR-205 promotes OC cell proliferation, migration and invasion in vitroHaving observed the association of miR-205 expression and poor survival in OC patients, we set out to functionally characterize the effects of miR-205 on ovarian cancer cells. [score:1]
miR-205 promotes OC cell proliferation, migration and invasion in OC cell lines. [score:1]
In contrast, low levels of miR-205 is observed in head and neck squamous cell carcinomas and associated with increased recurrence and poor prognosis 34. [score:1]
Collectively, these data clearly show that miR-205 is a promoter of proliferation, migration and invasion in OC cells. [score:1]
However, the mechanisms underlying how miR-205 affects tumor progression were not clear. [score:1]
The 3′ UTR wild-type report plasmid or 3′ UTR mutant report plasmid of SMAD4 or PTEN were transfected into 293 T cells, and LV-miR-205 or LV-miR-Ctrl was co -transfected with each plasmid in 293 T cells. [score:1]
These finding suggest that miR-205 may play an important role in promoting carcinogenesis and chemoresistance of OC. [score:1]
MiR-205 promotes OC tumorigenesis in vivoWe then examined the tumor promotive role of miR-205 in ovarian cancer progression using an in vivo tumor mo del. [score:1]
This data thus prove that miR-205 promotes chemoresistance of OC cells. [score:1]
293 T cells were cultured in 24-well plates and co -transfected with 3′ UTR wt plasmid or 3′ UTR mut plasmid in the presence of either miR-205 or negative control. [score:1]
The lentivirus vectors containing firefly luciferase, LV-hsa-miR-205 or LV-hsa-miR-Ctrl, were obtained from GENECHEM (Shanghai, China). [score:1]
[1 to 20 of 77 sentences]
6
[+] score: 228
MiR-205 reduces SMAD4 expression by directly targeting its 3. Expression of miR-205 is upregulated in NSCLC tissues and inversely correlated with SMAD4 expression. [score:13]
MiRNAs can inhibit or suppress various biological processes including cell proliferation by targeting proliferation-related genes [22], and Huang et al. [23] showed that in silico, SMAD4 was a target gene of miR-205; therefore, we hypothesized that miR-205 could inhibit SMAD4 expression by binding to the SMAD4 3′-UTR region. [score:13]
Taken together, the results suggested that miR-205 binds directly to the target site the 3′-UTR of SMAD4 in NSCLC cells to inhibit its expression. [score:8]
Figure 5Expression of miR-205 is upregulated in NSCLC tissues and inversely correlated with SMAD4 expression(A) Relative miR-205 levels in 52 NSCLC tissues (T) and paired noncancerous lung tissues (N). [score:8]
Furthermore, Gene Expression Omnibus set (GSE36681) showed that miR-205 expression was upregulated in human NSCLC tissues (Figure 5B). [score:8]
In conclusion, our study shows that miR-205 suppresses the expression of tumor suppressor gene SMAD4 promotes NSCLC cells growth in vitro and in vivo. [score:7]
All these data indicated that re -expression of miR-205 could promote lung cancer cell growth in vivo by inhibiting the expression SMAD4. [score:7]
SMAD4 expression is regulated by miR-205 through targeting its 3′-UTR in NSCLC. [score:6]
Our findings also highlighted the therapeutic potential of miR-205 in the treatment of NSCLC and supported the development of effective therapeutic strategies that target miR-205 (or its targets, such as SMAD4) via a genetic or pharmacological approach. [score:6]
In addition, the expression of p21 was increased in cell ectopically expressing miR-205 (Figure 7C). [score:5]
We found that overexpression of miR-205 mimics had no effect on cell apoptosis (Figure 7B), whereas ectopic expression of miR-205 led to a significant reduction in the number of cells in the G1 phase (Figure 7A). [score:5]
In addition, the resected tissues from the agomir -treated xenograft tumors were analyzed to verify PTEN and SMAD4 expression using IHC: consistent with the above observations, significant loss of SMAD4 expression was shown in miR-205 agomir group comparied with the NC group (Figure 9D). [score:5]
Overexpression of an miR-205 mimic inhibits NSCLC cell viability and proliferation. [score:5]
As shown in Figure 9A, the miR-205 agomir increased the expression of miR-205 significantly and decreased the expression of SMAD4. [score:5]
Figure 9Overexpressing miR-205 in lung carcinoma xenografts promotes tumor growth in vivo(A) QRT-PCR analysis of miR-205 levels and SMAD4 mRNA expression in excised tumors transfected with miR-205 agomir and NC agomir; U6 and β-actin were used as internal controls, respectively. [score:5]
In addition, another study showed that low miR-205 expression in mammary epithelial cells promoted EMT, while its overexpression repressed cancer cells stemness [14]. [score:5]
Moreover, overexpression of miR-205 reduced SMAD4 expression in NSCLC cells remarkably (Figure 6A). [score:5]
These findings indicated that the stimulation or inhibition of miR-205 expression, as well as its biological functions, might be tissue or cancer-type dependent. [score:5]
MiR-205 is significantly downregulated in NSCLC cell lines; therefore, an miR-205 agomir was prepared for replacement therapy. [score:4]
Furthermore, to determine the function of miR-205 in NSCLC, taking into account that miR-205 is downregulated significantly in NSCLC cell lines [27, 28], we overexpressed miR-205 in NSCLC cells using miR-205 mimics and then evaluated the effect of miR-205 on cell growth (Figure 6A). [score:4]
MiR-205 is significantly downregulated in NSCLC cell lines [24, 25]; therefore, we only transiently cotransfected the reporter construct with miR-205 mimics into A549 cells. [score:4]
SMAD4 mRNA expression in A549 cells transfected with miR-205 mimics or NC. [score:3]
Thus, it remains important to understand thoroughly the molecular mechanisms underlying the differential biological effects and targets of miR-205 in NSCLC and other cancer types. [score:3]
The y-axis represents the log10 transformed fold change of T/N expression ratios of miR-205 levels and SMAD4 mRNA. [score:3]
In the present study, miR-205 expression was increased while SMAD4 was decreased in NSCLC, such that that the ratio of miR-205 level (T/N) was inversely correlated with that of the SMAD4 mRNA level (T/N) in 52 paired tissues (P = 0.0065). [score:3]
The results showed that the miR-205 mimics significantly inhibited the luciferase activity in cells transfected with the wild-type SMAD4 3′-UTR but did not repress the luciferase activity in cells containing the mutant construct (Figure 4B). [score:3]
Our results indicated the importance of miR-205 as a potential target in clinical therapy and demonstated that this miRNA merits further investigation as a promising gene therapy target to treat NSCLC. [score:3]
For example, miR-205 suppresses cell migration and invasion via the epithelial-to-mesenchymal transition in human prostate and breast cancer cells [13, 34], In support of its oncogenic function, miR-205 was binds to PETN and PHLPP2 to modulate PI3K/AKT signaling and promote cell proliferation in NSCLC [12]. [score:3]
A549 cells and stable cell lines overexpressing SMAD4 were plated in 6-well plates under normal culture conditions, and then transfected with si-SMAD4 and NC or miR-205 mimics. [score:3]
Interestingly, we also observed lower expression of miR-205 in adenocarcinomas than in squamous cell lung carcinoma (Table 1). [score:3]
Overexpression of miR-205 accelerates the cell cycle in NSCLC cells. [score:3]
Overexpression of an miR-205 mimic had no effect on cell apoptosis, but promoted the cell cycle in NSCLC cells. [score:3]
We next sought to clarify the cellular mechanisms underlying miR-205 -mediated tumor suppression. [score:3]
Further analysis showed that 42 NSCLC tissues had high miR-205 level while 37 tissues (88.1%) had low expression of SMAD4 mRNA. [score:3]
Eight NSCLC tissues had low miR-205 level, while three tissues (37.5%) had high expression of SMAD4 mRNA (Figure 5D). [score:3]
The primary tumors and adjacent normal tissues in a cohort of 52 patients were analyzed by quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) for the expression of miR-205 and SMAD4. [score:3]
mRNA expression values of Smad4 and miR-205 were normalized to the internal controls ACTB and U6, respectively. [score:3]
The x and y-axes represent the log10 transformed fold change of T/N mRNA expression ratios of miR-205 and SMAD4, respectively. [score:3]
To determine how miR-205 promotes cell proliferation in NSCLC cells, we examined cell apoptosis and the distribution of cell cycle phases in A549 cells overexpressing miR-205 and NC. [score:3]
The miR-205 level is increased in NSCLC tissues and ectopic miR-205 expression can promote NSCLC cell proliferation. [score:3]
Differences in miR-205 and SMAD4 expression between NSCLC tissues (T) and adjacent noncancerous lung tissues (N) were analyzed using a paired t test (two-tailed). [score:3]
The above studies suggested that miR-205 acts either as an oncogene or tumor suppressor gene, depending on the cellular environment. [score:3]
Overexpressing miR-205 in lung carcinoma xenografts promotes tumor growth in vivo. [score:3]
Briefly, a 215-bp fragment containing predicted miR-205 target site (positions 262–269) was chosen for the luciferase assay. [score:2]
Moreover, the expression of miR-205 was higher in squamous cell lung carcinoma compared with other types of NSCLC [10]. [score:2]
Dysregulation of miR-205 was observed in many types of tumors, including lung cancer [12]. [score:2]
As illustrated in Figure 5A, among 52 randomly selected paired tissues from NSCLC patients, miR-205 expression was significantly increased in tumor tissues compared with paired noncancerous tissues. [score:2]
miR-205 agomir and NC agomir (RiboBio Co, Ltd) were injected directly into the implanted tumor at a dose of 1 nmol (in 20 ml PBS) per mouse every 4 days, seven times. [score:2]
MiR-205 and SMAD4 mRNA levels are expressed as relative indexes normalized against U6 and β-actin, respectively. [score:2]
Considering the important functions of miR-205 and SMAD4 in NSCLC, the potential therapeutic use of miR-205 attracted our attention. [score:1]
Briefly, cells transfected with miR-205 mimics and si-SMAD4 or NC were diluted in complete culture medium and 200 cells were reseeded in a 60 mm plate. [score:1]
Clinical characteristics and levels of miR-205 and Smad4 mRNA expression in NSCLC tissues. [score:1]
Interestingly, the ratio of miR-205 level (Tumor/Normal; T/N) was inversely correlated with the ratio of SMAD4 mRNA levels (T/N) in 52 paired tissues (P = 0.0065; Figure 5C). [score:1]
Bar charts showing clonogenic growth of A549 cells transfected with miR-205 mimics or NC. [score:1]
To test this possibility, we subcloned the SMAD4 3′-UTR, containing the putative miR-205 binding site (both the wild type and mutated sites, separately) into vector psiCHECK-2 (Figure 4A). [score:1]
Figure 6(A) QRT-PCR analysis of miR-205 levels in A549 cells transfected with miR-205 mimics or NC for 72 h. U6 was used as the internal control. [score:1]
Given the complexity of its function, it would be interesting to investigate the correlation miR-205 expression with the activity of the TGF-beta signaling pathway in NSCLC. [score:1]
Collectively, the results suggested that miR-205 promotes cell proliferation by accelerating NSCLC cell cycle. [score:1]
Figure 7(A) Flow cytometry cell cycle analysis of A549 cells with miR-205 mimics or NC. [score:1]
CCK-8 assays showed that NSCLC cells overexpressing miR-205 had significantly higher proliferation abilities compared with control cells (Figure 6B). [score:1]
Cells were transfected with miR-NC, miR-205, Si-NC or Si-SMAD4. [score:1]
Subsequently, A549 cells were plated in a 24-well plate and cotransfected with the wild-type or mutated plasmid, control pRL-TK plasmid and with either miR-205 mimics or miR -negative control (NC) using Lipofectamine 2000 (Life Technologies). [score:1]
Recently, it was demonstrated that loss of miR-205 promoted the epithelial to mesenchymal transition (EMT) during tumor progression [13]. [score:1]
According to the instructions of the Cell Cycle Analysis Kit (Beyotime, Shanghai, China), cells were cultured in 6-well plates, transfected with miR-NC, miR-205, Si-NC or Si-SMAD4 for 72 h. The cells were then collected, washed with cold phosphate-buffered saline (PBS), fixed in 70% ethanol at 4°C for 24 h, washed with cold PBS again and stained in a Propidium Iodide (PI)/RNase A mixture. [score:1]
Furthermore, to validate these observations, we also transfected miR-205 mimics into NSCLC cells and injected miR-205 agomirs into implanted tumors: similar results were observed. [score:1]
Predicted duplex formation between miR-205 and the wild-type or mutant of miR-205 binding site is indicated. [score:1]
[1 to 20 of 66 sentences]
7
[+] score: 210
Other miRNAs from this paper: hsa-mir-25, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3
To identify downstream targets of miR-205, we searched for putative miR-205 targets using three programs that predict the mRNA targets of a particular miRNA: miRanda [25], TargetScan [26] and PicTar [27]. [score:9]
Our data indicate that miR-205 down-regulates the expression of PTEN through direct interaction with the putative binding site in the 3′-untranslated region (3′-UTR) of PTEN. [score:9]
The expression of miR-205 in cancer is controversial because reports have indicated that it is up-regulated or down-regulated in different tumor tissues compared with normal tissues. [score:8]
Significantly, we show that miR-205 directly targets PTEN by binding to its 3′-UTR, leading to the inhibition of PTEN translation and the activation of the AKT pathway. [score:8]
Of interest, miR-205 was expressed in a low level and functioned as a tumor suppressor gene in breast cancer and prostate cancer [12- 14]; however, in studies of non-small cell lung cancer, bladder cancer and head and neck squamous cell carcinoma [15], miR-205 was overexpressed and acted as an oncogene. [score:7]
For the first time, we demonstrate that the expression of PTEN is directly regulated by miR-205 in endometrial cancer cells and leads the inhibition of cellular apoptosis. [score:7]
Therapeutic targeting of this dysregulated miR-205 may provide a novel treatment strategy for the disease. [score:6]
Moreover, we documented the functional interactions of miR-205 and PTEN, which have a downstream effect on the regulation of the AKT pathway, explaining, at least in part, the inhibitory effects on Ishikawa cell apoptosis of enhancing miR-205 expression. [score:6]
Using Ishikawa cells as mo del systems, we up-regulated miR-205 expression by transient transfection with miR-205 mimics. [score:6]
These results indicated that miR-205 acts as an oncogene and suppresses cellular apoptosis in EC by targeting the PTEN/AKT pathway. [score:5]
Figure 3 MiR-205 down-regulates PTEN expression and leads to activation of the AKT pathway. [score:5]
MiR-205 directly targets PTEN expression through binding to the 3′-UTR region of PTEN. [score:5]
In the present study, we intend to prove that the gene PTEN (phosphatase and tensin homolog deleted on chromosome ten) is a target gene of miR-205 and to investigate the suppressive effects on PTEN transcriptional activity by enhancing miR-205 expression in endometrial cancer Ishikawa cells. [score:5]
To analyze whether miR-205 was expressed differently between endometrial cancer cells and normal endometria, we utilized qRT-PCR to detect miR-205 expression levels. [score:5]
In the present study, we sought to determine whether there are any target relationships between miR-205, the tumor suppressor gene PTEN and their underlying mechanisms in Ishikawa cells. [score:5]
We also show that enhanced miR-205 expression inhibited cellular apoptosis in EC cells. [score:5]
These results indicated that miR-205 expression is inversely correlated with PTEN expression and leads to the activation of the AKT pathway in EC cells. [score:5]
Using a target gene prediction system, we proposed that PTEN (phosphatase and tensin homolog deleted on chromosome ten) is a putative target gene of miR-205. [score:5]
Furthermore, the levels of phosphorylated AKT, which is a critical target of PTEN, were elevated by the enhanced expression of miR-205 (Figure 3C). [score:5]
From several candidates, we selected the tumor suppressor gene PTEN as a putative miR-205 target. [score:5]
In addition, the western blot analysis indicated that the enhanced expression of miR-205 reduced the PTEN protein expression (Figure 3B). [score:5]
miR-205 negatively regulates PTEN expression and leads to activation of the AKT pathway. [score:4]
Here, we found that the cell apoptosis rate was inhibited by miR-205 (Figure 4), which may promote endometrial cancer development. [score:4]
Our results are consistent with previous studies that showed decreased p53 protein levels and increased BCL-2 protein levels after up -regulating miR-205 expression. [score:4]
Our study not only demonstrated the inhibition of cell apoptosis by miR-205 but also provided a possible downstream pathway (the PTEN/AKT pathway) regulated by miR-205 that triggers endometrial cancer progression. [score:4]
Figure 1 Expression of miR-205 in the Ishikawa cell line. [score:3]
These findings indicated that enhanced miR-205 expression in EC cells may be important for EC progression. [score:3]
Of these miRNAs, we focused on miR-205, which was found to be overexpressed in EC [8], a finding that is consistent with other studies [9- 11]. [score:3]
The difference in miR-205 expression between Ishikawa cells and normal endometria was statistically significant (95% CI 0.89-2.35, p = 0.002). [score:3]
In addition, we described herein that miR-205 blocks PTEN translation and results in the activation of the AKT pathway (Figure 3). [score:3]
The enhanced expression of miR-205 reduced PTEN protein levels, and the AKT pathway was significantly regulated compared with the NC miRNA group (p-AKT, p = 0.004, p53, p = 0.02, BCL-2, p = 0.002). [score:3]
PTEN was predicted to be a target of miR-205 by previous studies [18, 19]; however, this prediction has not been validated in EC. [score:3]
A luciferase reporter assay revealed that miR-205 directly interacted with the PTEN 3′-UTR (Figure 2C), and the overexpression of miR-205 diminished PTEN mRNA and protein levels in Ishikawa cells. [score:3]
As PTEN is a putative target for miR-205, we next located potential binding sites of miR-205 in the PTEN 3′-UTR region (Figure 2A). [score:3]
In the present study, we observed that miR-205 was markedly up-regulated in the Ishikawa cell line compared with normal endometrium. [score:3]
miR-205 expression has an inverse correlation with the PTEN protein using the non-parametric Spearman correlation analysis [17]. [score:3]
To determine whether PTEN was indeed directly regulated by miR-205, the wild type 3′-UTR of PTEN and the mutant (Figure 2A) were constructed and inserted into the pmiR-RB-REPORT luciferase plasmid (Figure 2B). [score:3]
To further assess the correlations between the endogenous levels of miR-205 and PTEN, qRT-PCR and western blot analyses were used to detect the miR-205 and PTEN expression levels in transfected Ishikawa cells. [score:3]
Taken together, these results indicated that miR-205 inhibits the cellular apoptosis of endometrial cancer cells. [score:3]
In contrast, low miR-205 expression was detected in normal endometria. [score:3]
Therefore, we suggest that miR-205 is a specific oncogene in EC and a novel target for EC therapy. [score:3]
Figure 2 MiR-205 targets PTEN at 3′-UTR. [score:2]
Figure 4 MiR-205 inhibits Ishikawa cell apoptosis in vitro. [score:2]
qRT-PCR verified that miR-205 was highly expressed in Ishikawa cells compared with normal endometrium (p = 0.002). [score:2]
A luciferase reporter assay, qRT-PCR and western blotting assays were used to verify whether PTEN is a direct target of miR-205. [score:2]
MiR-205 inhibits EC cell apoptosis in vitro. [score:2]
There are few studies on the role of miR-205 in EC. [score:1]
The wild type or mutant vectors were co -transfected with miR-205 mimics or negative control miRNA in Ishikawa cells. [score:1]
MiR-205 mimics, designed to mimic endogenous mature miR-205, were purchased from GenePharma (Shanghai, China) as well as scrambled oligonucleotides, which did not produce identifiable effects on miR-205 function, used as negative control miRNA. [score:1]
MiR-205 is expressed at higher levels in Ishikawa cells compared with normal endometrial tissues. [score:1]
Cells were grown to 60% confluence and miR-205 mimics or negative controls were transiently transfected using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s specifications. [score:1]
The 3′-UTR of human PTEN contains a region (nucleotides 559–585, Figure 2A) that matched to the seed sequence of miR-205. [score:1]
These results may suggest an oncogenic role for miR-205 in EC. [score:1]
Although many properties of miR-205 have been revealed, its targets and its role in EC remain to be evaluated. [score:1]
Recently, miR-205 has been associated with a variety of tumors. [score:1]
As expected, PTEN mRNA levels were significantly decreased in miR-205 mimic -transfected cells (Figure 3A). [score:1]
[1 to 20 of 56 sentences]
8
[+] score: 208
miR-153 overexpression in HEK293 cells downregulate SNCA whilst miR-205 overexpression in HEK293 cells has been shown to downregulate LRRK2 [8, 9]. [score:11]
In response to miR-153-3p inhibition cofilin-1 was down-regulated (Table 1, spot 32), verified by western blot analysis (Fig 5B), whilst miR-205-5p overexpression resulted in cofilin-1 up-regulation (Table 1, spot 18). [score:11]
Interestingly, a jun co-activator, Nascent-polypeptide -associated complex alpha (HSD48), was up-regulated (Table 1, spot 16) by miR-205-5p overexpression whilst its expression decreased (Table 1, spot 33) by miR-205-5p inhibition [43, 44]. [score:10]
As microRNAs are most commonly involved in translational regulation, the up-regulation of eukaryotic translation initiation factor 5A-1 isoform B (EIF5A) (Table 1, spot 17) and (EIF3I) (Table 1, spot 23), in response to miR-205-5p was not surprising. [score:9]
Transfections were performed, in triplicate, with scrambled control mimic, miR-153-3p mimic, miR-205-5p mimic, scrambled control hairpin inhibitor, miR-153-3p hairpin inhibitor and miR-205 hairpin inhibitor, all mirVana [TM] (Life Technologies), at a final concentration of 20 nM. [score:7]
The serine/arginine-rich splicing factor 1 (SRSF-1) (Table 1, spot 28), which ensures splicing accuracy and regulates alternative splicing, is up-regulated in response to miR-205-5p inhibition [54]. [score:7]
In response to miR-205-5p perturbations twelve protein spots were up-regulated whilst six protein spots were down-regulated (Fig 3, Table 1). [score:7]
Nm23, a gene expression modulator, is also regulated by miR-205-5p showing decreased levels in response to miR-205-5p inhibition (Table 1, spot 31) [57]. [score:6]
Galectin-1, a beta-galactoside binding protein associated with cell proliferation and differentiation is also down-regulated in response to miR-205-5p inhibition (Table 1, spot 30) [45]. [score:6]
miR-205-5p inhibition down-regulates Nm23 (Table 1, spot 31) and Protein SET (Fig 2, spot 33). [score:6]
miR-205-5p also up-regulates Annexin A1 (Table 1, spot 20), a protein that regulates phospholipase A [2] activity [53]. [score:5]
Overexpression and inhibition of miR-153-3p and miR-205-5p in SH-SY5Y cells. [score:5]
Similarly, miR-205-5p was successfully overexpressed using miR-205-5p mimic and inhibited using miR-205-5p antagomir (Fig 1A and 1B). [score:5]
This suggests that the proteins identified in this study represent a combination of direct and indirect targets of miR-153-3p and miR-205-5p. [score:5]
Overexpression and inhibition of miR-153-3p and miR-205-5p and their effect on cell viability in SH-SY5Y cells. [score:5]
In terms of PD, miR-7/miR-153 and miR-205-5p have been shown to down-regulate SNCA and LRRK2, respectively whilst DJ-1 and Parkin are regulated by miR-34b/c [8, 9, 10]. [score:5]
Several of the protein targets identified are associated with neuronal processes and key regulatory pathways, indicating that miR-153-3p and miR-205-5p are involved in a wide variety of biological processes. [score:4]
Furthermore, miR-205-5p down-regulates isocitrate dehydrogenase [NAD] subunit alpha (IDH3A) (Table 1, spot 25), a key enzyme in the TCA cycle and GAPDH (Table 1, spot 25)[51, 52]. [score:4]
Similar to miR-153-3p, miR-205-5p also down-regulates Serpin A12 (Table 1, spot 26). [score:4]
miR-205-5p inhibition also causes increased abundance of the TAR DNA -binding protein 43 (TDP-43) (Table 1, S3 Table, spot 27) that promotes CFTR exon skipping and regulates transcription [56]. [score:4]
Protein association network showing interconnecting relationships between miR-153-3p and miR-205-5p target proteins through key regulatory pathways. [score:4]
Indeed, HSD48 (Table 1, spot 16 & 33), which is regulated by miR-205-5p, is a transcription regulator [55]. [score:3]
Numbers (1–15) represent differentially expressed protein spots identified by MS, reported in Table 1. Two-dimensional gels of control mimic, miR-205-5p mimic, control antagomir and miR-205-5p antagomir transfected cells. [score:3]
Combined these results indicate that miR-153-3p and miR-205-5p may play a role in cell proliferation and migration involving various target proteins. [score:3]
miR-205-5p expression levels in response to mimic (A) and antagomir (B) transfections. [score:3]
Indeed, overexpression of miR-153-3p and miR-205-5p causes significant ROS reduction (Fig 5E). [score:3]
The targets of miR-153-3p and miR-205-5p were used as input queries for the Partek Genomics Suite software, version 6.6 (Partek) to perform Gene ontology (GO) analysis and generate interactive maps and pathways. [score:3]
Numbers (16–33) represent differentially expressed protein spots identified by MS, reported in Table 1. We identified thirty-three protein spots that showed significant abundance changes (fold change > 1.4, n = 3, p-value < 0.05) between control transfected and miR-153-3p/miR-205-5p -transfected SH-SY5Y cells. [score:3]
S2 Fig Proteasome subunit alpha type-1 isoform 2 (PSMA1) (regulated by miR-153-3p and miR-205-5p) and proteasome subunit p42 (PSMC6) (regulated by miR-205-5p) are integral parts of the 26S proteosome. [score:3]
The aim of this study was to combine microRNA and proteomics technologies to identify new miR-153-3p and miR-205-5p targets in neuronal SH-SY5Y cells. [score:3]
Our data indicates that both miR-205-5p and miR-153-3p influence direct and peripheral processes associated with neurodegenerative disorders, providing clues towards the possible regulation of key pathways (S4 Table, Fig 4). [score:3]
miR-205-5p overexpression also increased the abundance of proteasome subunit p42 (PSMC6) (Table 1, spot 24; S2 Fig) and proteasome subunit alpha type-1 isoform 2 (PSMA1) (Table 1, spot 21). [score:3]
miR-205-5p appears to be affecting the abundance of proteins that influence mRNA expression and processing (Table 1 and Fig 2). [score:3]
Verification of differentially expressed proteins by Western blot analysis and ROS changes in response to miR-153-3p and miR-205-5p. [score:3]
Numbers (16–33) represent differentially expressed protein spots identified by MS, reported in Table 1. We identified thirty-three protein spots that showed significant abundance changes (fold change > 1.4, n = 3, p-value < 0.05) between control transfected and miR-153-3p/miR-205-5p -transfected SH-SY5Y cells. [score:3]
We next sought to identify additional targets of miR-153-3p and miR-205-5p in SH-SY5Y cells using analysis. [score:3]
The regulation of PRDXs by miR-153-3p and miR-205-5p suggest that miR-153-3p and miR-205-5p may affect cellular ROS levels. [score:2]
Collectively, miR-153-3p and miR-205-5p appears to regulate proteins involved in metabolic pathways and in particular carbohydrate metabolism (S4 Table). [score:2]
Peroxiredoxins are regulated by both miR-153-3p and miR205-5p. [score:2]
Cellular processes and pathway analysis of the differentially regulated proteins in response to mimics and antagomirs of miR-153-3p and miR-205-5p. [score:2]
miR-153-3p and miR-205-5p have roles in regulating proteins involved in metabolic pathways. [score:2]
miR-205-5p is associated with transcriptional regulation. [score:2]
List of differentially regulated proteins in SH-SY5Y cells in response to mimics and antagomirs of miR-153-3p and miR-205-5p. [score:2]
HSD48 (NACA) regulation by miR-205-5p was confirmed by western blot analysis (Figs 5C and 4D). [score:2]
miR-153-3p and miR-205-5p alter known cell cycle regulators. [score:2]
Western blot analysis confirmed cofilin-1 regulation by the miR-205-5p mimic (Fig 5C) and the antagomir (Fig 5D). [score:2]
Regulation of key neuronal processes by miR-153-3p and miR-205-5p. [score:2]
Combined this indicate that miR-153-3p and miR205-5p influence PRDX levels, which may affect ROS levels (Fig 5F). [score:1]
MicroRNA biology is complex and we have shown that miR-153-3p and miR-205-5p influences the abundance of numerous proteins integral to many biological processes in neuroblastoma cells (Fig 4, S3 Table). [score:1]
We also found that altered levels of miR-205-5p affect proteins associated with tumor proliferation and invasion (Table 1). [score:1]
The same comparative analyses were performed for SH-SY5Y cells transfected with the miR-205-5p mimic and the miR-205-5p antagomir (Fig 3). [score:1]
Western blot analysis showing effect of miR-153-3p mimic on (A) PRDX2 and HMGB1 levels (B) effect of miR-153-3p antagomir on Cfl1 levels, (C) effect of miR-205-5p mimic on PRDX2, NACA and Cfl1 levels, (D) effect of miR-205-5p antagomir on NACA and Cfl1 levels. [score:1]
We verified the miR-153-3p- and miR-205-5p -mediated increase in PRDX2 by western blot analysis (Fig 5A and 5C). [score:1]
Similar effects were also observed for miR-205-5p (Table 1, spot 19 & 29). [score:1]
However, before performing analysis we showed that miR-153-3p and miR-205-5p transfections had no significant effect on SH-SY5Y cell viability ensuring that any observed protein changes were due to changes in miR-153-3p and miR-205-5p levels (Fig 1D). [score:1]
0143969.g003 Fig 3Two-dimensional gels of control mimic, miR-205-5p mimic, control antagomir and miR-205-5p antagomir transfected cells. [score:1]
0143969.g005 Fig 5Western blot analysis showing effect of miR-153-3p mimic on (A) PRDX2 and HMGB1 levels (B) effect of miR-153-3p antagomir on Cfl1 levels, (C) effect of miR-205-5p mimic on PRDX2, NACA and Cfl1 levels, (D) effect of miR-205-5p antagomir on NACA and Cfl1 levels. [score:1]
Altered levels of miR-153-3p and miR-205-5p results in protein changes associated with a spectrum of biological processes. [score:1]
[1 to 20 of 58 sentences]
9
[+] score: 194
When normally expressed, miR-205-5p can inhibit its targets such as ZEB1 and ZEB2 and consequently result in the expression of E-cadherin, keeping cell polarity and cell-cell junction integrity [32]. [score:9]
In addition to the miR-205-5p downregulation in high grade tissue biopsies, the presence of blood circulating miR-205-5p, indicating an overall high expression correlated with tumor chemo sensitivity and higher rates of disease free survival [28]. [score:8]
A simultaneous correlation between mRNA overexpression and miR-205-5p downregulation during in situ to metastatic transition in 21T cells was used as a filter for a subsequent identification of miR-205-5p binding sites in the selected mRNAs. [score:6]
The comparison between in situ tumoral cells (21PT/21NT) with metastatic cells (21MT1/21MT2) surprisingly revealed miR-205-5p as the only differentially expressed miRNA, with a 5.4 times downregulation (Fig 2A). [score:6]
Differential expression of miRNAs in 21T series reveals miR-205-5p downregulation during breast cancer progression. [score:6]
miR-205-5p appeared as the only deregulated microRNA in the transition carcinoma in situ to metastatic, showing a significant 5.4 times downregulation. [score:5]
miR-205-5p expression levels were obtained by qRT-PCR and the expression fold change was calculated in comparison to the average of miR-205-5p expression in non-tumoral breast biopsies. [score:5]
In addition to the already known miR-205-5p targets we could by crossing mRNA and miRNA expression levels predict other genes involved in tumor progression that can contributing to the transition to a mesenchymal and more proliferative phenotype. [score:5]
The miR-200 family and miR-205-5p can modulate epithelial to mesenchymal transition (EMT) mainly by e-cadherin regulation via ZEB-1 inhibition [5]. [score:4]
Downregulation of miR-205-5p during breast cancer progression in 21T series. [score:4]
The downregulation of miR-205-5p observed between 21PT/21NT and 21MT1/21MT2 cells, representing the transition hyperplasia/ in situ to metastasis suggest a specific role of miR-205-5p in cell invasion. [score:4]
miR-205-5p downregulation is observed in high-grade breast cancer biopsies. [score:4]
Our data support the notion that miR-205-5p downregulation contributes to breast cancer progression to metastasis. [score:4]
As shown in Fig 3, we could demonstrate a significant downregulation of miR-205-5p displayed in the most aggressive Elston grade III breast tumors in comparison to normal breast tissues. [score:4]
Microarray analysis (p≤0.05; cut-off 2.0-fold change) revealed miR-205-5p as the only down-regulated miRNA in the comparison between 21PT and 21NT in situ vs. [score:4]
In all cases, miR-205-5p downregulation was linked to a worse prognosis. [score:4]
The validation of microarray data was done by qPCR confirming that miR-205-5p is down-regulated through breast cancer progression to metastasis (Fig 2B). [score:4]
miR-205-5p down-regulation was later confirmed by qRT-PCR (Fig 2C). [score:4]
miR-205-5p presented a progressive downregulation during tumor progression (Fig 2A). [score:4]
After this first selection, we performed a search for miR-205-5p binding sites among the overexpressed mRNA, using the software RNA22 [12]. [score:3]
miR-205-5p low expression correlates to 21T cells invasive phenotype. [score:3]
Further studies will help to validate experimentally miR-205-5p target genes involved in this process. [score:3]
miR-205-5p expression can be related to tumor aggressiveness in vivo. [score:3]
Suppression of cell growth and invasion by miR-205 in breast cancer. [score:3]
To increase the accuracy in miR-205-5p in silico target prediction we used as approach a combined miRNA and mRNA transcriptome profiling [10]. [score:3]
miR-205-5p silencing in the non- invasive cell lines (H16N2, 21PT and 21NT) partially increased migration rates while miR-205-5p overexpression in metastatic cells (21MT1 and 21MT2) reduced their migration capacity (S1 Fig). [score:3]
miR-205-5p target prediction. [score:3]
Altogether, our results reveal a shift on the miRNA expression during tumorigenesis in 21T cells and highlight miR-205-5p as a major player on breast tumor evolution from carcinoma in situ to metastasis. [score:3]
The percentage of 21T cells able to transmigrate to the lower part of the membrane is shown in Fig 4. These results confirm our assumption that miR-205-5p expression levels are inversely related to the invasion capacity. [score:3]
miR-205-5p has potential cancer-related targets. [score:3]
21MT1 and 21MT2 metastatic showing 5.42 fold change p- value 0.003. miR-205-5p expression can be related to tumor aggressiveness in vivo. [score:3]
The predicted miR-205-5p targets comprises genes with functions related to cell invasion such as SOCS3, PTPRN2, and MMP3 and on epithelial to mesenchymal transition such as TGFB1 (Table 1). [score:3]
miR-205-5p validated targets, besides ZEB1 and ZEB2, include E2F1, HER3, VEGF-A, PTEN and NOTCH2 [6, 29, 33– 35]. [score:3]
Fig A: miR-205-5p expression levels in paraffin-embedded formalin fixed breast tissue samples. [score:3]
miR-205-5p binding sites and estimated folding energy for the predicted targets. [score:3]
This observation correlates to the cells invasive potential in Boyden chamber assay and was strengthened, with the in vivo downregulation of miR-205-5p in aggressive breast tumors. [score:3]
To verify if the exclusive change in miR-205-5p expression levels is able to alter the 21T cells invasiveness, we transfected 21MT1 and 21MT2 cells with the miR-205-5p precursor and H16N2, 21PT and 21NT cells with a miR-205-5p silencer. [score:3]
Our results show that cell migratory capacity inversely correlates with miR-205-5p expression, (Fig 4). [score:3]
miR-205-5p fold change in breast cancer tissue samples were calculated in comparison to miR-205-5p mean expression of 6 biopsies obtained from normal breast tissues (Fig A in S2 File) for the non- normalized distribution of the miR-205-5p expression). [score:3]
Changes in 21T cell lines status of invasiveness by switching miR-205-5p expression. [score:3]
Derived from the same patient, 21T cells have a decreasing expression of miR-205-5p from non-tumoral H16N2 to metastatic 21MT1/2 consequently promoting higher proliferation behavior and tumor aggressiveness. [score:3]
Indeed, miR-205-5p expression decreased with the tumor stage from Elston histological grade I through III (Fig 3), where grade III indicates tumor aggressiveness and patient poor survival [13]. [score:3]
Our results show miR-205-5p as a tumor suppressor miRNA and contribute to understanding breast cancer progression to an invasive phenotype. [score:3]
Eight miR-205-5p potential target mRNAs were selected (Table 1). [score:3]
The most likely interaction sites (p≤0.05) were considered as possible miR-205-5p target. [score:2]
Also, miR-205-5p can be negatively regulated by HER-2, possibly contributing for the worse prognostic associated to HER-2 enriched subtype [7]. [score:2]
In breast tumors, miR-200 family, miR-21 and miR-205-5p were shown to regulate cell proliferation and invasion [5, 6]. [score:2]
MiR-205-5p expression levels in paraffin-embedded formalin fixed biopsies in breast cancer cases of invasive ductal carcinomas, classified according to Elston grade (EG). [score:2]
miR-205-5p has an established role in regulating epithelial to mesenchymal transition (EMT) and tumorigenesis [29– 31]. [score:2]
A total of eleven miR-205-5p binding sites were identified using this approach (S1 Table). [score:1]
miR-205-5p expression was analyzed by qRT-PCR in paraffin embedded formalin fixed biopsies of breast tissue samples (S5 Table with patient description and tumor characteristics). [score:1]
[1] Number of miR-205-5p binding sites predicted by RNA22 software. [score:1]
Microarray experiment was done in duplicate and expression levels of miR-205-5p was confirmed by qPCR in 3 independent measures. [score:1]
Gene name (symbol) Cancer-related gene ontologyNumber of miR-205-5p predicted binding sites [1]mRNA Fold Change (21MT1 vs. [score:1]
Although not statistically significant, these observations suggest that miR-205-5p plays an important role reverting breast cancer cells to a less aggressive behavior. [score:1]
Similar results were also observed in other clinical breast cancer cohorts where miR-205-5p expression levels were measured by qRT-PCR [25, 26] and by in situ hybridization [27]. [score:1]
SOCS3 draws special attention by having three miR-205-5p binding sites and for being able to promoting growth, metastasis and EMT in breast cancer [37, 38]. [score:1]
These findings correlate to our both observations in 21T cell lines and breast tumors highlighting the need of including miR-205-5p in more comprehensive clinical studies. [score:1]
We observed a lower migration rate in Boyden chamber after miR-205-5p transfection in 21MT1 and 21MT2 (S3). [score:1]
The opposite trend was also observed: higher migration rates were observed after miR-205-5p was silenced in non- invasive cell lines. [score:1]
The present study was aimed to evaluate changes in microRNA expression in the 21T series of cell lines, representing different stages of breast cancer progression, and accumulate evidence of a key role of miR-205-5p in cell migration and metastasis. [score:1]
Predicted miR-205-5p genes in 21T cell lines. [score:1]
Although not significant, it indicates that miR-205-5p contributes but it´s not the only factor responsible to 21T series invasiveness. [score:1]
A putative role for microRNA-205 in mammary epithelial cell progenitors. [score:1]
[1 to 20 of 64 sentences]
10
[+] score: 172
showed that VEGF-A expression was up-regulated in H4 cells with knockdown of miR-205, whereas down-regulated in U87 cells overexpressing miR-205 (Fig. 5C), compared to control or scramble treated cells. [score:11]
Further, we knocked down expression of miRNA-205 in H4 cells, which exhibited elevated level of miR-205, and ectopically expressed miRNA-205 in U87 cells with low endogenous miRNA-205 expression (Fig. 1). [score:8]
The results showed that in normal brain tissues, miRNA-205 exhibited a relative high level expression, whereas the expression of miRNA-205 was significantly (P<0.01) down-regulated in glioma samples (WHO I, II, III and IV). [score:8]
While miR-205 is down-regulated in glioma, breast (25) and esophageal cancer (26), it has been shown to be up-regulated in various types of cancers, including lung cancer, bladder cancer, ovarian cancer and head and neck cancer cell lines (6, 27– 30). [score:7]
The significant suppression of miRNA-205 expression in tumors and cancer cell lines suggests a tumor suppressor role in glioma. [score:7]
To understand the molecular mechanisms by which miRNA-205 inhibited glioma cells growth and invasion, we searched for putative miRNA-205 targets as predicted by the commonly cited programs such as TargetScan, miRanda and PicTar and found 3′UTR of VEGF-A containing the highly conserved putative miRNA-205 binding sites (Fig. 5A). [score:7]
Therefore, identification of VEGF-A as a direct target for miRNA-205 may imply that miRNA-205 is a novel target for glioma therapy. [score:6]
In the present study, the direct interaction between miRNA-205 and VEGF-A mRNA is supported by several lines of evidence: 1) the 3′UTR of human VEGF-A mRNAs contain a putative binding site for miRNA-205 with significant seed match; 2) miRNA-205 suppresses the activity of a luciferase reporter fused with the 3′UTR of VEGF-A mRNA, 3) miRNA-205 represses the endogenous expression of VEGF-A at both the mRNA and protein level. [score:6]
We further demonstrated that miRNA-205 could specifically suppress expression of VEGF-A by directly interacting with the putative miRNA-205 binding site at the 3′-UTR. [score:6]
In the present report we detected the miRNA-205 expression level in human glioma samples and found that the decreased expression level of miRNA-205 was negatively correlated with the increased malignancy of glioma. [score:5]
miRNA-205 mimics and inhibitor and non -targeting control were obtained from Dharmacon. [score:5]
Moreover, we demonstrated that miRNA-205 plays a key role in the malignancy of glioma cells by directly regulating VEGF-A expression. [score:5]
About 13.64±2.85% and 14.18±2.47% inhibition rates of miRNA-205 transfectants in U87 and LN229 cells at 24 h time point were shown in Fig. 2A and the maximum inhibition rate was at 36-h time point. [score:5]
Previously, it has been reported that miRNA-205 is down-regulated in breast tumor tissues and breast cancer cell lines (14). [score:4]
These results indicate that miRNA-205 directly modulate VEGF-A expression by binding 3′UTR of VEGF-A in glioma cells. [score:4]
Reporter assay revealed that overexpression of miRNA-205 significantly suppressed the activity of pGL3-WT-VEGF-A-3′UTR plasmid in U87 and LN229 cells, without change in luciferase activity of pGL3-MUT-VEGF-A-3′ UTR plasmid (Fig. 5D). [score:4]
miRNA-205 is down-regulated in glioma cell lines and tissue specimens. [score:4]
In the present study, we showed that the expression of VEGF-A was significantly elevated with the ascending order of glioma grade, accompanying the decrease of miRNA-205. [score:3]
Taken together, the present study for the first time provides evidence that miRNA-205 is a glioma-specific tumor suppressor. [score:3]
The significant reduction of miRNA-205 expression in glioma cell lines and tissue specimens prompted us to explore the possible biological significance of miRNA-205 in tumorigenesis. [score:3]
miRNA-205 inhibits the proliferation of glioma cells in vitro. [score:3]
This is the first study demonstrating that miRNA-205 inhibits malignant properties of glioma cells indicating the therapeutic potential of miRNA-205 in the treatment of glioma. [score:3]
Further investigation revealed that in glioma cell lines, miRNA-205 functioned as a tumor suppressor and overexpression of miRNA-205 reduced cell proliferation, induced G0/G1 phase arrest, decreased cell invasive capacity and increased apoptosis. [score:3]
We also examined expression levels of miRNA-205 in glioma cell lines (H4, U87, LN229 and U251), and normal brain tissues as control. [score:3]
The expression of miRNA-205 was negatively correlated with tumor grade. [score:3]
To determine whether the inhibition of growth induced by miRNA-205 in cells was anchorage-independent, the cells were plated on soft agar 24 h after RNA transfection in U87 and LN229 cells. [score:3]
In this study, the expression of miRNA-205 in glioma cell lines and the tissues specimens from glioma patients with certain grades was studied by real-time PCR analysis. [score:3]
These results imply that miRNA-205 might function as a tumor suppressor in glioma cells in vitro. [score:3]
VEGF-A is a potential target of miRNA-205 in glioma cells. [score:3]
These results suggest that miRNA-205 induces cell cycle arrest and inhibits proliferation of glioma cells. [score:3]
These findings may imply that miRNA-205 could play a dual role in tumorigenicity, depending on tissue type and specific targets. [score:3]
In conclusion, we showed there is significant low -expression of miRNA-205 in glioma cell lines and tissue specimens. [score:3]
However, the expression of miRNA-205 in tissues of glioma patients has not been well documented. [score:3]
Herein, we found that the expression of VEGF-A was significantly elevated with the ascending order of glioma grade (P<0.01), accompanying the decrease of miRNA-205 (Fig. 5B). [score:3]
To quantitate the expression level of mature miRNA-205, the isolated RNA was reverse transcribed and amplified using the mirVana™ qRT-PCR miRNA detection kit (Ambion) according to the manufacturer's protocol. [score:3]
They demonstrated the same expression patterns as miRNA-205 in primary tumors and the normal tissues (Fig. 1). [score:3]
In U87 cells, miRNA-205 inhibited invasive activity by ~50%, as 36.24±4.12 cells/field invaded the matrigel layer compared to 68.78±3.25 and 64.54±3.47 cells/field in the control and scramble -treated groups, respectively. [score:2]
Similarly, miRNA-205 significantly inhibited invasive activity of LN229 cells, as 36.26±4.02 cells/field invaded the matrigel layer compared to 58.32±3.46 and 56.57±3.12 cells/field in the control and scramble -treated groups, respectively (Fig. 4). [score:2]
Luciferase reporter (500 ng), 50 pmol (miRNA-205 mimics or NC) and 40 ng of pRL-TK were added in each well. [score:1]
After four weeks, the cells transfected with miRNA-205 mimics formed significantly fewer colonies on soft agar than control and scramble treated cells (Fig. 2B). [score:1]
pGL3-MUT-VEGF-A-3′UTR-Luc reporter was generated from pGL3-WT-VEGF-A-3′UTR-Luc reporter by deleting the binding site for miRNA-205. [score:1]
miRNA-205 induces apoptosis in glioma cell lines. [score:1]
miRNA-205 depresses the invasion of glioma cells in vitro. [score:1]
The results revealed that U87 and LN229 cells transfected with miRNA-205 mimics had an obvious cell cycle arrest at the G0/G1 phase (Fig. 2C). [score:1]
Our further investigation revealed that overexpression of miRNA-205 reduced cell proliferation, induced G0/G1 phase arrest, decreased cell invasive capacity and increased apoptosis in glioma cells. [score:1]
We also analyzed the effect of miRNA-205 on apoptosis in glioma cells by conducting Annexin V and PI double staining. [score:1]
These results demonstrate that miRNA-205 significantly reduces glioblastoma cell invasion capacity. [score:1]
[1 to 20 of 47 sentences]
11
[+] score: 150
Moreover, the downregulation of miR-205 expression in colorectal cancer tissue could predict the risk of lymph node metastasis [17]. [score:6]
As shown in Figure  3, cervical cancer patients with higher miR-205 expression had significantly poorer survival than those with lower expression of miR-205 (log-rank test: P = 0.003). [score:5]
The 5-year overall survival rate of cervical cancer patients with high serum miR-205 expression (16.67%) was significantly lower than that of cervical cancer patients with low serum miR-205 expression (53.33%, P = 0.003). [score:5]
Serum miR-205 was significantly upregulated in cervical cancer patients compared with healthy donors (p < 0.01), and a high level of miR-205 expression was correlated with poor tumor differentiation (p = 0.009), lymph node metastasis (p = 0.015) and increased tumor stage (p = 0.001). [score:5]
In addition, miR-205 is significantly overexpressed in human cervical cancer tissues and promotes proliferation and migration of cervical cancer cells by targeting CYR61 and CTGF [13]. [score:5]
The 5-year overall survival rate in cervical cancer patients with lower serum miR-205 expression was 53.33%, whereas that of patients with higher miR-205 expression was 16.67%. [score:5]
MiR-205 acts as an oncogene by modulating the expression of multiple cancer-related target genes [12]. [score:4]
Serum miR-205, which is upregulated in cervical cancer, represents a predictive biomarker for the prognosis of cervical cancer patients. [score:4]
Here, we report that serum miR-205 is upregulated in cervical cancer and represents a predictive biomarker for the prognosis of cervical cancer patients. [score:4]
The present data suggested that miR-205 might be a valuable circulating marker for cervical cancer with the potential to be translated into clinical applications. [score:3]
The expression of miR-205 in cervical cancer patient serum was higher that in normal controls (P < 0.01). [score:3]
Our findings are suggestive of an oncogenic role for miR-205, with higher circulating expression of miR-205 in cervical cancer patients with a lower survival rate. [score:3]
As shown in Table  1, miR-205 expression was significantly higher in the serum of patients with advanced FIGO stage cervical cancer than those with early FIGO stage (P = 0.001, Table  1). [score:3]
The concentration of circulating miR-205 may be an important blood biomarker for cervical cancer screening and represents a potentially useful biomarker for disease progression. [score:3]
Summarized data from all individuals indicated that the relative expression of miR-205 in cervical cancer patients’ serum (1.18 ± 0.57) was significantly higher than that in healthy donors’ serum (0.2 ± 0.12) (P < 0.01, Figure  1). [score:3]
There was a tendency for less well differentiated tumors to express higher levels of miR-205 (P = 0.009, Table  1). [score:3]
Figure 2 The expression of miR-205 in cervical cancer tissues. [score:3]
In addition, Kaplan-Meier survival analysis showed that cervical cancer patients with high miR-205 expression tended to have shorter overall survival. [score:3]
The average expression levels of miR-205 were normalized against miR-16 or U6 using the 2 [-ΔCt] method. [score:3]
We also assessed whether the miR-205 expression level could function as a tumor marker to distinguish advanced stage from early stage, metastatic cervical cancer from non-metastatic samples and poorly differentiated tumors from differentiated tumors. [score:3]
The results showed that among the 60 cervical cancer samples analyzed, serum miR-205 was upregulated 5.74-fold in cervical cancer patients compared with the level in healthy donors. [score:3]
MiR-205 is frequently dysregulated in many cancers and acts as a tumor suppressor or an oncogene depending on cellular context [15]. [score:3]
However, there was no correlation between miR-205 expression and other clinical features, such as age and HPV infection. [score:3]
In this study, we first confirmed by qPCR that miR-205 levels are significantly higher in the serum of cervical cancer patients, and that a high level of miR-205 expression correlated with poor tumor differentiation, lymph node metastasis and increased tumor stage. [score:3]
Notably, patients with high serum miR-205 levels had a significantly lower survival rate than those with low expression levels, and serum miR-205 was an independent risk factor for poor prognosis. [score:3]
Thus, high levels of miR-205 expression were correlated with poor tumor differentiation, metastasis and increased tumor stage. [score:3]
Figure 1 Expression analysis of miR-205 in the serum of cervical cancer patients. [score:3]
Higher expression of miR-205 in cervical cancer tissues. [score:3]
In this study, we identified that miR-205 expression was significantly increased in cervical cancer tissues compared with paracancerous tissues. [score:2]
MiR-205 expression was significantly higher in human cervical cancer than in normal tissue, and it also promotes cervical cancer cell proliferation and migration [13]. [score:2]
To better understand the potential roles of serum miR-205 in cervical cancer development and progression, the relationships between miR-205 and various clinical features of cervical cancer were determined. [score:2]
qPCR results showed that miR-205 expression was considerably higher in the cervical cancer tissues compared with para-carcinoma tissues (**P < 0.01). [score:2]
The expression of miR-205 was also higher in the cervical cancer tissues compared with the para-carcinoma tissues. [score:2]
Tumor tissue miR-205 or serum miR-205 are associated with the development and prognosis of tumors [15]. [score:2]
The expression of miR-205 in lymph node metastasis -positive patients was significantly increased compared to that in lymph node metastasis -negative patients (P = 0.015, Table  1). [score:2]
As shown in Figure  2, the miR-205 expression was significantly increased (>3-fold higher) in cervical cancer tissues (n = 3) compared with paracancerous tissues (n = 3) (p < 0.01), which is consistent with an oncogenic role of miR-205. [score:2]
Our data also revealed that high levels of serum miR-205 and LNM are independent predictors of poor prognosis. [score:1]
Therefore, as a potential prognostic biomarker in cervical cancer, the use of miR-205 might improve patients’ risk stratification and guide their treatment. [score:1]
This may be explained by miR-205 being released from cervical cancer cells into the peripheral blood, which is consistent with previous reports [15]. [score:1]
Figure 4 Receiver operating characteristic (ROC) analysis was performed to determine the sensitivity and specificity of the miR-205 expression level using area under the ROC curve (AUC) analysis. [score:1]
Circulating miR-205 and let-7f together are diagnostic biomarkers for ovarian cancer [18]. [score:1]
ROC curve analysis also revealed that serum miR-205 was a valuable biomarker to distinguish well to moderately differentiated from poorly differentiation tumors, with a sensitivity of 76.5%, a specificity of 73.1% and an AUC of 0.717 (p = 0.004, Figure  4C). [score:1]
An increase in serum miR-205 may create a cancer- and metastasis-promoting environment. [score:1]
Serum miR-205 correlates with prognosis of cervical cancer patients. [score:1]
In addition, we confirmed, for the first time, that cervical cancer patients had significantly elevated miR-205 levels in their serum samples. [score:1]
Serum miR-205 expression was investigated in 60 cervical cancer patients and 60 healthy normal controls by using real-time PCR. [score:1]
We observed that serum miR-205 levels could distinguish patients with cervical cancer from healthy controls. [score:1]
Taken together, this analysis revealed that serum miR-205 is a novel and efficient biomarker for cervical cancer prognosis. [score:1]
Capability of miR-205 to function as a biomarker for cervical cancer prognosis. [score:1]
However, the clinical significance of circulating miR-205 levels in cervical cancer remains unclear. [score:1]
To determine the possibility of serum miR-205 as an independent risk factor for poor prognosis, both clinicopathological factors and the level of serum miR-205 expression were evaluated by multivariate Cox regression analysis. [score:1]
The serum miR-205 level was capable of separating advanced stage from early stage metastatic cervical cancer from non-metastatic samples and poorly differentiated tumors from differentiated tumors with an area under the curve values of 0.74, 0.694 and 0.717, respectively. [score:1]
Aushev et al. revealed that the level of plasma miR-205 strikingly decreased in patients after removal of lung squamous cell carcinoma [19]. [score:1]
ROC analysis revealed that miR-205 had a sensitivity of 76.5%, a specificity of 73.1% and an area under the curve (AUC) of 0.74 (p = 0.002, Figure  4A) when comparing stages Ib ~ IIa and stage IIb ~ IIIa. [score:1]
Correlations between miR-205 expression and the clinicopathological features and prognosis of cervical cancer patients were then evaluated. [score:1]
Therefore, the level of miR-205 was determined in the serum of the cervical cancer patients. [score:1]
Higher levels of miR-205 in the serum of cervical cancer patients. [score:1]
Lebanony et al. reported that miR-205 in tissue samples is a highly accurate marker for distinguishing squamous from nonsquamous non-small-cell lung carcinoma [16]. [score:1]
The results showed that lymph node metastasis and high level of serum miR-205 were independent factors to predict the overall survival of cervical cancer patients (Table  2). [score:1]
Differences between the groups were presented as ΔCt, indicating the difference between the Ct value of miR-205 and the Ct value of miR-16 or U6. [score:1]
Correlation of clinicopathological features of cervical cancer with circulating miR205. [score:1]
In cervical cancer, miR-205 functions as an oncogene, promoting proliferation and migration of cancer cells [13]. [score:1]
In this study, our analysis suggested that serum miR-205 might be a novel biomarker for detecting LNM in cervical cancer patients. [score:1]
These results suggested that serum miR-205 could be used as a potential predictor of prognosis in cervical cancer. [score:1]
Circulating miR-205 has been reported as a biomarker for the detection and diagnosis of lung cancer, particularly at its very early stage [14]. [score:1]
To further demonstrate the role of miR-205 in cervical cancer, its expression was measured in cervical cancer tissues. [score:1]
The purpose of this study was to determine serum miR-205 levels in cervical cancer patients and explore its association with clinicopathological factors and prognosis. [score:1]
However, the level and clinical relevance of circulating miR-205 transcripts in human serum of cervical cancer patients are unclear. [score:1]
We found serum miR-205 was a valuable biomarker for cervical cancer patients. [score:1]
In multivariate Cox regression analysis, miR-205 was identified as an independent prognostic marker. [score:1]
[1 to 20 of 70 sentences]
12
[+] score: 130
Shown in Figure 3D and 3E, overexpression of miR-200b/a/429 cluster dramatically inhibited the invasion, while overexpression of miR-205 was only moderately inhibitory. [score:9]
We cannot rule out the possibility that ERG might regulate miR-205HG transcription by a long distance looping mechanism, or a transcription factor regulated by ERG regulates miR-205 expression. [score:6]
However, the expression levels of miR-200b, miR-200a, miR-429, and miR-205 in transgenic mice are similar to that of wild type litter mates, indicating that ERG cannot induce the expression of these four miRNAs in murine prostate. [score:5]
miR-205 is oncogenic in the mammary gland by targeting the tumor suppressor PTEN [30]. [score:5]
In contrast, miR-205 was highly expressed in PC3, but weakly expressed in other cell lines. [score:5]
miR-205 expression levels were significantly lower in prostate cancer than in normal prostate, suggesting a tumor suppressor function [33]. [score:5]
On the other hand, miR-205 can also inhibit tumor invasion by targeting ZEB1 and ZEB2 [21]. [score:5]
As a result, reduced miR-205 expression in human prostate cancer is probably caused by the loss of basal cells, instead of being lost in luminal cells as a tumor suppressor. [score:5]
Interestingly, ERG is not expressed in PC3 cells, suggesting that miR-205 expression in prostate cancer cell line can be ERG-independent. [score:5]
However, overexpression of miR-205 alone did not inhibit the cell proliferation. [score:5]
In this study, we found that, out of 369 miRNAs, the expression levels of four miRNAs, including three members of the miR-200b subfamily and miR-205, are positively associated with ERG expression in MSKCC prostate cancer data sets. [score:5]
Shown in Figure 3C, overexpression of miR-200b/a/429 gene cluster alone, or in combination with miR-205, significantly inhibited the cell proliferation rate as determined by the MTT assay. [score:4]
Additionally in prostate tissue, miR-205 is regulated by TP63 [45] and highly enriched in the basal epithelial cells of the prostate [31], while TMPRSS2 promoter -driven ERG is expressed in the luminal epithelial cells. [score:4]
The mutual exclusive expression pattern suggests that association of ERG and miR-205 in human prostate cancers might be through an indirect mechanism. [score:4]
Real-time qPCR was used to determine expression levels of human ERG, and mouse miR-200b, miR-200a, miR-429 and miR-205. [score:3]
Log2 values of average expression for ERG positive/negative PCa and p-value for the four miRNAs that are the focus of this study are: miR-200a (10.85/9.49, p = 1.88e-05), miR-200b (11.99/10.51, p = 1.42e-06), miR-205 (11.50/9.84, p = 9.85e-04), miR-429 (9.73/8.22, p = 1.59e-05). [score:3]
However, in normal prostate, miR-205 is preferentially expressed in basal epithelial cells [31]. [score:3]
To construct a lentiviral vector for the expression of miR-205 in mammalian cells, 410 bp of human miR-205 genomic DNA was amplified by PCR and cloned into EcoRI/BamHI site of the pCDH-CMV-MCS-Puro, resulting in pCDH-miR-205. [score:3]
Using lentivirus, we generated stable cell lines that express miR-200b/a/429 cluster and/or miR-205 in PC3 cells. [score:3]
To express all four miRNAs, 410 bp of human miR-205 genomic DNA was amplified by PCR and cloned into BamHI/NotI site of the pCDH-miR-200b/a/429 vector, resulting in pCDH-miR-200b/a/429/205. [score:3]
Figure 3(A) Expression levels of miR-200a, miR-200b, miR-429, miR-205, and ERG in commonly used prostate cancer cell lines, including LNCaP, VCaP, 22RV1, PC3, DU145. [score:3]
On the other hand, expression of miR-205 was undetectable in VCaP cells by qPCR. [score:3]
As shown in Figure 1, out of 369 miRNAs, the average expression levels of four miRNAs including miR-200a, miR-200b, miR-429, and miR-205 were significantly higher in ERG -positive human prostate cancer samples. [score:3]
On the other hand, expression of miR-205 is transcribed from its host gene miR-205HG on chromosome 1. Surprisingly, no ERG binding peak was identified within 25 kbp upstream or downstream of the miR-205HG gene. [score:3]
In normal murine prostate, miR-205 is preferentially expressed in basal epithelial cells, but not in luminal epithelial cells [31]. [score:3]
A quite surprising finding is that miR-205 expression is positively correlated with ERG, however, the underlying mechanism is unknown. [score:3]
However, the expression of ERG and miR-205 is mutually exclusive in cultured prostate cancer cells (Figure 3A). [score:3]
Therefore miR-205 and ERG are expressed in different cell compartments in the prostate. [score:3]
Therefore, we cannot determine whether miR-205 is regulated by ERG in prostate cancer cells. [score:2]
Finally, miR-200b subfamily members and miR-205 are not induced by ERG in murine prostate derived from the pbsn-ERG transgenic mice, suggesting that ERG transgenic mice do not fully mimic the TMRPSS2/ERG -dependent prostate cancer development in human. [score:2]
Because basal epithelial cells are lost during prostate cancer development, it is possible that TMPRSS2/ERG -dependent prostate tumors retain more basal cells, resulting in high levels of miR-205 in the tumors. [score:2]
Role of miR-200b subfamily and miR-205 on prostate cancer proliferation and invasion. [score:1]
ChIP-seq analyses reveal no ERG binding site near the miR-205 host gene (+/− 25 kbp) in VCaP cells. [score:1]
By taking advantage of published ERG chromatin immunoprecipitation (ChIP-Seq) data sets, we investigated if ERG directly binds to the regulatory regions near the miR-200b/a/429 cluster and miR-205 gene in prostate cancer cells. [score:1]
Expression of miR-205 in PC3 cells suggests that PC3 cells might have acquired certain basal/progenitor cell characteristics. [score:1]
For instance, miR-205 is highly enriched in progenitor cells in the mammary gland and prostate, and has a function in stem cell maintenance [30– 32]. [score:1]
Four stable cell lines, PC3-vec, PC3-miR-200b/a/429, PC3-miR-205, and PC3-miR-200b/a/429/205. [score:1]
The roles of miRNA-200 family and miR-205 have been studied in many cancer types. [score:1]
Next, we tested the functions of miR-200b/a/429 and miR-205 in human prostate cancer cell lines. [score:1]
Effects of miR-200b/a/429 cluster and miR-205 on prostate cancer growth and migration. [score:1]
miR-200b/200a/429 subfamily and miR-205 are not induced by ERG in the prostate of Pbsn-ERG transgenic mice. [score:1]
[1 to 20 of 41 sentences]
13
[+] score: 105
We observed by RQ-PCR and Northern blotting that HFKs transduced to express both E6 and E7 onco-proteins resulted in increased miR-24 expression (Fig. 2a and c) and decreased miR-205 expression (Fig. 2b and d). [score:7]
Since miR-205 levels were reduced in HFKs expressing E6 and E7 (Fig. 2a), we wished to examine if miR-205 expression was dependent upon pRb expression. [score:7]
Only two other studies have investigated these miRNAs in differentiation of keratinocytes and our results agree with their observations that miR-205 is up-regulated during differentiation of keratinocytes (Nissan et al., 2011), whilst miR-24 is up-regulated in murine keratinocytes during differentiation (Amelio et al., 2012). [score:5]
Two highly expressed miRNAs were miR-205 and miR-24, both of which showed an increase in expression following differentiation, suggesting they were important in this process. [score:5]
Together, this set of experiments provide strong evidence that miR-205 expression is dependent on pRb levels, and explains how E7 inhibition of pRb may result in decreased miR-205 levels. [score:5]
Knockdown of miR-205 resulted in significantly increased HFK proliferation, with ~40% more cells staining for BrdU incorporation than control cells, whilst knocking down of miR-24 significantly inhibited HFK proliferation by ~21% (Fig. 2h). [score:5]
Since miR-24 and miR-205 have putative roles as an oncogene and a tumour suppressor respectively, we wanted to specifically examine the effect of altering miR-24 and miR-205 expression on proliferation in cycling HFKs. [score:5]
Although no studies have investigated regulation of miR-184 activity, analysis of the promoter region upstream of miR-184 using rVISTA (Loots and Ovcharenko, 2004) reveals putative E2F and MYC-MAX binding sites (Supplementary Fig. 2a), so it is tempting to speculate that either E2F, or E2F -mediated induction of c-MYC expression, could result in increased miR-184 levels, which in turns represses miR-205 expression. [score:4]
Like miR-205, miR-24 also seems to play contrasting roles depending on the setting, but it is generally found to be up-regulated in various cancers including oral squamous cell carcinoma (Lin et al., 2010) and is postulated to have an oncogenic function. [score:4]
To further validate this finding, we stably knocked down pRb in HFKs, using two separate targeting molecules, and again observed a similarly significant decrease in miR-205 levels (Fig. 3c). [score:4]
In our previous study of miR-203 expression in HFKs, we had demonstrated that miR-205 levels were not significantly altered by knockdown of p53 levels (McKenna et al., 2010). [score:4]
Quantitative real-time polymerase chain reaction (RQ-PCR) (Fig. 1a) and Northern blotting (Fig. 1b and c) both show that miR-24 and miR-205 are significantly up-regulated during calcium -induced HFK differentiation. [score:4]
The expression of miR-205 is dependent upon pRb levels, which means it is susceptible to alteration by E7 activity. [score:3]
This rescued the pRb status of the cells and resulted in a restoration of the miR-205 expression (Fig. 3d). [score:3]
Therefore, in this report, we investigate how the expression of miR-24 and miR-205 is affected by expression of HPV onco-proteins in HFKs during proliferation and differentiation. [score:3]
Fig. 3a shows by RQ-PCR and northern blot that when E7 is expressed alone (E6sE7 – E6 with stop codon at 5′ end of E6) or with E6 (E6E7), miR-205 levels are significantly reduced. [score:3]
Taken together, these keratinocyte studies demonstrate that both miR-205 and miR-24 play important roles in keratinocyte proliferation and differentiation, with abnormal expression of either likely to result in altered cell behaviour. [score:3]
miR-205 is dependent upon pRb expression. [score:3]
In contrast, when E6 alone is expressed (E6E7s – stop codon at 5′ end of E7), miR-205 levels are not altered, a finding that is in agreement with our previous observation that p53 levels do not affect miR-205. [score:3]
Firstly, we examined if E7 expression, rather than E6, was responsible for determining miR-205 levels. [score:3]
However, in the case of miR-205, we see a reduction in expression, suggesting it is repressed rather than activated. [score:3]
These results suggest that, in HFKs, miR-24 and miR-205 nominally behave in an oncogenic and tumour suppressor function respectively, observations which agree with the roles proposed for them by other studies in keratinocytes (Lin et al., 2010; Kim et al., 2013). [score:3]
The proliferative effect of knocking down miR-205 was further illustrated by western blots showing increased activity of Akt pathway and increased Cyclin D1 levels (Fig. 2i). [score:2]
Next, we transiently knocked down pRb levels in HFKs and demonstrated that miR-205 levels were subsequently decreased as a result (Fig. 3b). [score:2]
microRNA miR-24 miR-205 HPV Keratinocytes Differentiation Over the past decade, a growing body of evidence has shown that microRNAs (miRNAs) play a fundamental role in the development, function and maintenance of tissues and cells in various organisms. [score:2]
For comparison, we included HFKs with stable knockdown of p53, in which miR-205 levels were not altered, as we expected. [score:2]
In summary, we have provided further data supporting the evidence that that miR-24 and miR-205 play important roles in keratinocytes. [score:1]
To date, several individual miRNAs have been identified as playing fundamental roles in keratinocytes, including microRNA-205 (miR-205) and microRNA-24 (miR-24). [score:1]
Transfection of HFKs with anti-miR-24, pre-miR-24, anti-miR-205, pre-miR-205 and negative controls (all Ambion) was performed using FuGene HD (Roche, Mannheim, Germany) following manufacturer's protocols. [score:1]
We validated these screening results by measuring miR-24 and miR-205 expression in keratinocytes induced to differentiate by calcium treatment, and in organotypic rafts, which are 3-dimensional skin equivalents (McCance et al., 1988), derived from normal HFKs. [score:1]
• miR-24 and miR-205 are induced during keratinocyte differentiation. [score:1]
The membrane was hybridized overnight at 42 °C with DIG -labelled LNA probe specific for miR-24 or miR-205 (0.1 nM) (Exiqon) or DIG -labelled antisense probe to U2snRNA (GGGTGCACCGTTCCTGGAGGTAC) (100 ng/ml). [score:1]
A possible candidate for this repression is another miRNA, miR-184, which has been shown to antagonize miR-205 in corneal epithelial keratinocytes (Yu et al., 2008). [score:1]
miR-205 is now known to play a fundamental role in epithelial biogenesis and maintenance (Qin et al., 2013) and has been wi dely studied in a number of settings. [score:1]
[1 to 20 of 34 sentences]
14
[+] score: 90
Together, these results suggest that miR-205-5p may specifically target 3′-UTR of VEGF mRNA to inhibit its translation in MSCs. [score:7]
Here, we showed that miR-205-5p is expressed in human MSCs, and inhibits VEGF protein translation through its association with VEGF mRNA. [score:7]
MiR-205-5p targets 3′-UTR of VEGF mRNA to inhibit its translation in MSCs. [score:6]
Very recently, VEGF has been found to be a target of miR-205-5p in glioma and miR-205-5p appears to be a glioma-specific tumor suppressor [20]. [score:5]
In the study that reported VEGF as a target of miR-205-5p in glioma [20], a different binding site on the 3′-UTR of VEGF mRNA from the current study was shown, suggesting the possible presence of different regulatory sites by miR-205-5p on the 3′-UTR of VEGF mRNA. [score:4]
Second, direct expression of VEGF may further increase the levels of miR-205-5p in MSCs as a negative feedback, which substantially reduces the systemic efficiency, or even leads to occurrence of ER stress. [score:4]
Here, we knocked down a highly expressed VEGF-antagonizing miRNA -miR-205-5p- in MSCs, which effectively increased VEGF and pro-angiogenic effects of MSCs. [score:4]
The role of miR-205-5p in carcinogenesis has been well documented, in which many targets of miR-205-5p have been defined in cancer cells [15– 19]. [score:3]
Expression of antisense of miR-205-5p (as-miR-205-5p) significantly increased levels of cellular and secreted VEGF by MSCs in vitro and in vivo. [score:3]
Very recently, VEGF has been found to be a target of miR-205-5p in glioma [20]. [score:3]
The results from the current study suggest that suppression of miR-205-5p in MSCs may be a promising strategy to increase their therapeutic potential in treating DF. [score:3]
The null or antisense for miR-205-5p (as-miR-205-5p) was cloned into a pCMV-DsRed-Express Vector (Catalog number: 632416; Clontech, Mountain View, CA, USA) backbone at the site between CMVp and red fluorescent protein (RFP). [score:3]
These data suggest that miR-205-5p may be a VEGF-regulatory miRNA in MSCs. [score:2]
However, a role of miR-205-5p in regulation of the therapeutic potential of MSCs in DF has not been reported. [score:2]
While as-miR-205-5p significantly increased luciferase activity of VEGF 3′-UTR wt, the presence of a mutation abolished this effect (Figure 3H). [score:2]
One week later, ulcers were generated in the right limp and the mice received intradermal transplantation of either mull-MSCs or as-miR-205-5p-MSCs at the site of ulcer. [score:1]
Depletion of miR-205-5p in grafted MSCs does not reverse diabetes. [score:1]
Next, we examined the effects of miR-205-5p depletion on wound healing from DF -associated ulcers. [score:1]
Transplantation of null-MSCs significantly increased vessel density, but the increases in vessel density by transplantation of as-miR-205-5p-MSCs appeared to be greater than transplantation of null-MSCs, shown by representative images (Figure 6B), and by quantification (Figure 6C). [score:1]
Depletion of miR-205-5p in grafted MSCs increases their therapeutic potential in DF. [score:1]
N = 5. Before we examined the effects of miR-205-5p-depletion in MSCs on their therapeutic potential in DF, we checked whether alteration of miR-205-5p levels may alter MSC property. [score:1]
We found that as-miR-205-5p-MSCs were able to be induced to differentiate into chondrocytes (Figure 4A), osteocytes (Figure 4B) and adipocytes (Figure 4C). [score:1]
We found that STZ -treated mice developed sustained hyperglycemia within 1 week, and grafting with either null-MSCs or as-miR-205-5p-MSCs did not reserve hyperglycemia (Figure 5B), which were supported by beta cell mass quantification (Figure 5C), demonstrated by representative immunostaining images for insulin (Figure 5D). [score:1]
Finally, we examined the effects of miR-205-5p-depletion in MSCs on their therapeutic potential in DF. [score:1]
We found that transfection with as-miR-205-5p reduced miR-205-5p levels in MSCs by about 80% (Figure 3D). [score:1]
However, the changes in VEGF levels by miR-205-5p appeared to be modest, and physiologically sound. [score:1]
Thus, depletion of miR-205-5p in MSCs increases their therapeutic potential in DF. [score:1]
Transplantation of null-MSCs improved wound healing, but transplantation of as-miR-205-5p-MSCs on wound healing appeared to have more pronounced effects than transplantation of null-MSCs (Figure 6A). [score:1]
Moreover, surface marker analysis for CD73, CD90, CD105, CD34, CD45 and HLA-DR in as-miR-205-5p-MSCs was consistent with an MSC phenotype (Figure 4D). [score:1]
Evidence of post-transcriptional control for VEGF by miR-205-5p in human MSCs. [score:1]
To confirm that this binding is functional, we transfected MSCs cells with plasmids carrying either as-miR-205-5p, or null as a control. [score:1]
Preservation of MSC properties in as-miR-205-5p -transfected MSCs. [score:1]
Although transfection by as-miR-205-5p did not alter VEGF mRNA in MSCs (Figure 3E), it significantly increased cellular VEGF protein (Figure 3F) and secreted VEGF protein (Figure 3G). [score:1]
MSCs depleted of miR-205-5p had increased therapeutic effects on DF in diabetic NOD/SCID mice. [score:1]
Group 1: untreated mice (UT: no STZ, no MSCs); group 2: STZ -treated mice (STZ; no MSCs); group 3: STZ+null-MSCs (STZ and transplanted with null-MSCs); group 4: STZ+as-miR-205-5p-MSCs (STZ and transplanted with as-miR-205-5p-MSCs). [score:1]
N = 5. Indeed, bioinformatics analyses showed that miR-205-5p bound to 3′-UTR of VEGF mRNA at 150th-157th base site (Figure 3A). [score:1]
One week later, ulcers were generated in the right limb and the mice received intradermal transplantation of either mull-MSCs or as-miR-205-5p-MSCs at the ulcer site. [score:1]
The effects of miR-205-5p-depletion in MSCs on their therapeutic potential in DF were examined. [score:1]
Figure 3(A) Bioinformatics prediction of binding site of miR-205-5p on 3′-UTR of VEGF mRNA (150th-157th base site). [score:1]
Preservation of MSC property by as-miR-205-5p -transfected MSCs. [score:1]
Moreover, the cellular VEGF protein (Figure 2G) and secreted VEGF protein (Figure 2H) were significantly increased only in miR-205-5p antisense (as-miR-205-5p) -transfected MSCs. [score:1]
Figure 5The effects of miR-205-5p-depletion in MSCs on their therapeutic potential in DF were examined. [score:1]
Indeed, bioinformatics analyses showed that miR-205-5p bound to 3′-UTR of VEGF mRNA at 150th-157th base site (Figure 3A). [score:1]
Evidence of presence of post-transcriptional control for VEGF by miR-205-5p in human MSCs. [score:1]
Figure 4(A) Differentiation of as-miR-205-5p-MSCs into chondrocytes by Alcian blue staining. [score:1]
N = 5. (A) Bioinformatics prediction of binding site of miR-205-5p on 3′-UTR of VEGF mRNA (150th-157th base site). [score:1]
Hence, transfection with as-miR-205-5p does not alter MSC properties. [score:1]
[1 to 20 of 47 sentences]
15
[+] score: 84
Even when little information is available for miR-205-3p in the literature, with no experimental validated targets, in silico analysis for predicting targets of miR-205-3p showed that 17 out of 33 validated targets for miR-205-5p could also be targets for miR-205-3p (DDX5, ZEB1, BCL2, VEGF-A, ESRRG, KCNJ10, SMAD4, ERBB3, AR, LRRK2, YES1, SMAD1, ACSL4, PTEN, HMGB3, PHLPP2, YY1) suggesting a similar function for both miRNAs (miRbase and TargetScan 7.1). [score:11]
In order to validate PCR-array results, we evaluated the expression of some target genes belonging to the most differentially expressed miRNAs (VEGF-A, PKCε, MMP9 and NOD2 as targets of miR-205-3p, miR-1, miR-133b and miR-122-5p, respectively). [score:7]
Also a role as a tumor suppressor has been described for miR-205-5p in prostate [86, 87], breast [88], melanoma [89], glioblastoma [90] and colon cancers [91] by targeting cMYC [92], PKCε [86], and VEGF-A [90]. [score:5]
These targeted mRNAs were chosen for their role in oncogenesis and because they have been previously validated in the literature, with the exception of VEGF-A (a miR-205-3p target). [score:5]
Additionally, DDX3X gen (DEAD-box polypeptide 3) was the target with higher probability to be regulated by miR-205-3p. [score:4]
Moreover, overexpression of one of them, miR-205-3p, induced cell death and increased radiosensitivity to low-doses in DLD-1 cells. [score:3]
The most increased miRNA at low doses, miR-205-3p, is expressed together with miR-205-5p mostly in breast, prostate and thymus cancers [81] as well as both miRNAs are significantly increased in non-small cell lung carcinoma and squamous cell carcinoma [82]. [score:3]
Interestingly, overexpression of miR-205-3p significantly reduced proliferation only in the absence of IR (Figure 7B). [score:3]
Transfection of an anti-miR-205-3p (inhibitor) had no effect on viability (Figure 7A). [score:3]
MiR-205-5p has been reported as oncomiR in lung [83] and nasopharyngeal cancers [84] by targeting PTEN [85]. [score:3]
The precise mechanism that miR-205-3p uses to trigger apoptosis is unknown, nor are its targets in colon cancer cell lines. [score:3]
miR-205-3p overexpression increases LDHRS in DLD-1 cells. [score:3]
Prediction of mRNAs targeted by miR-205-3p. [score:3]
Figure 7(A) DLD-1 cells were mock -transfected or transfected with a scrambled miR control, an anti-miR-205-3p (inhibitor) or a miR-205-3p mimic. [score:3]
In order to predict the potential miR-205-3p´s targets, algorithms from miRbase (http://www. [score:3]
MiR-205-3p overexpression increases LDHRS. [score:2]
A MTS assay showed that overexpression of miR-205-3p reduced viability in both absence of IR and doses IR of 0.6 and 12 Gy. [score:2]
When compared to the control group, five differentially expressed miRNAs (adjusted P < 0.05) were identified in cells IR with 0.6 Gy, of which three were augmented (miR-205-3p, miR-1 and miR-133b) and two diminished (miR-122-5p and miR-134-5p) (Figure 5A and Table 1). [score:2]
Importantly, transfection with miR-205-3p significantly increased DLD1-1 radiosensitivity only at low-doses range (0–1 Gy), confirming the effect on LDHRS. [score:1]
DLD-1, HT29, MCF7 and MCF10a cells transfected with the mimetic miR-205-3p were seeded at a density of 500-1000 cells per 6-wells plate and 3 hours later, exposed to 0, 0.3, 0.6, 1, 6 and 12 Gy. [score:1]
miR-205-3p increases radiosensitivity at low doses of radiation. [score:1]
In HT29 colon cancer cells, miR-205-3p increased radiosensitivity at doses above 1 Gy, while in MCF7 and MCF10A breast cancer cells, miR-205-3p had no effect on radiosensitivity at any of the analyzed doses (Supplementary Figure 2). [score:1]
Most publications have focused on miR-205-5p and its dual role in cancer. [score:1]
We found that miR-205-3p, the most augmented miRNA in response to 0.6 Gy, could significantly increase the radiosensitivity of DLD-1 cells, maximizing the LDHRS phenomenon. [score:1]
Transient transfection of cells with miR-205-3p mimic. [score:1]
miR-205-3p transfection efficiency was assessed by qPCR from 24 h to 72 h post-transfection and by transfecting a EGFP-tagged small RNA. [score:1]
This observation suggests that at low doses miR-205-3p induce cell death by apoptosis, but at high doses could augment mitotic catastrophe. [score:1]
mRNAs targeted by: (A) MiR-205-3p (VEGFA), (B) miR-1 (PKCε), (C) miR-133b (MMP9) and (D) miR-1225p (NOD2), were evaluated by RTqPCR in DLD-1 cells, 48 h after irradiation with 0 (Control), 0.6 and 12 Gy. [score:1]
Cells were seeded in 6-well plates (6 × 10 [4] cells per well) in 500 µL of RPMI-1640 plus supplements and transfected with 5 nM of a miR-205-3p mimic (purchased from Qiagen, Crawley, UK) using HiPerFect Transfection Reagent (Qiagen) according to the manufacturer’s protocol. [score:1]
Interestingly, with 12 Gy, mimetic miR-205-3p induced formation of multi- and micronucleated cells, features associated with mitotic catastrophe (Figure 7E and 7F). [score:1]
Interestingly, in cells exposed to 12 Gy, miR-205-3p displayed an augmented number of multi- and micronuclei, a morphological feature associated with mitotic catastrophe [118, 119]. [score:1]
In order to confirm the effect of miR-205-3p on LDHRS, DLD-1 cells were transfected with the mimetic miR or control (Mock), and then exposed to different doses of IR and a colony formation assay was performed Consistent with the previous results, miR-205-3p overexpression increased radiosensitivity in about 23% of cells exposed to 0.6 Gy compared to mock -transfected cells (Figure 8). [score:1]
Figure 6mRNAs targeted by: (A) MiR-205-3p (VEGFA), (B) miR-1 (PKCε), (C) miR-133b (MMP9) and (D) miR-1225p (NOD2), were evaluated by RTqPCR in DLD-1 cells, 48 h after irradiation with 0 (Control), 0.6 and 12 Gy. [score:1]
Interestingly, in DLD-1 cells exposed to low doses of radiation (<1 Gy) miR-205-3p reduced proliferation and induced cell death with an important apoptotic component. [score:1]
[1 to 20 of 34 sentences]
16
[+] score: 84
Down-modulation of miR-205 results in upregulation of the anti-apoptotic protein Bcl2 [50] as well as down-regulation of E-cadherin, increase of Zeb 1 and Zeb2 [23, 51]. [score:7]
Furthermore, the acquisition of docetaxel resistance is associated with down-regulation of miR-205, whose reduced expression has been previously linked to a respiratory phenotype [20]. [score:6]
In our mo del we observed that OXPHOS engagement of PC3-DR cells is correlated to a down-regulation of miR-205 expression with respect to PC3 cells, too (Figure 7A). [score:6]
Indeed, ectopic miR-205 expression results in increased HKII expression and GLUT1 mRNA levels, as well as an increase in lactate production (Supplementary Figure 5 and Figure 7B-7D), suggesting an elevated glycolytic flux. [score:5]
Noteworthy, miR-205, an established regulator of EMT engagement in PC3 cells [8, 21], was found accordingly down-regulated (Figure 5). [score:5]
In the context of prostate cancer progression we demonstrated that OXPHOS induction is a common feature of both CAF induced metabolic reprogramming and miR-205 down-regulation [19– 21] as well as drug resistance. [score:4]
Consistently Puhr et al., demonstrated that miR-205 down-regulation is responsible for the acquisition of EMT in docetaxel resistant PCa cells [8] as well as with the acquisition of respiratory phenotype upon CAF contact [8, 20]. [score:4]
Among the others, down-regulation of miR-205 has been already linked to poor therapeutic outcome of prostate cancer patients [49]. [score:4]
Finally, in agreement with recent results highlighting the key role of microRNA in tumor progression [22], we focused our attention on miR-205 which is down-regulated in both CAF and docetaxel induced EMT [8, 21]. [score:4]
In our previous reports we demonstrated that miR-205 is one of the most down-regulated miRNA in PCa cells undergoing EMT and OXPHOS induction upon CAF contact [20, 21]. [score:4]
For quantification of miR-205 expression levels, total RNA, including small RNAs, was purified using miRNeasy kit. [score:3]
Indeed, we have shown that the ectopic expression of miR-205 reverts the OXPHOS addiction of PC3-DR, closely connected with the detoxifying ability of these cells (Figure 7). [score:3]
A. qRT-PCR analysis of miR-205 expression in PC3 and PC3-DR cells. [score:3]
As expected, ectopic overexpression of miR-205 in PC3-DR cells sensitizes resistant cells to docetaxel treatment (Figure 7G). [score:3]
Furthermore, an increase of glucose uptake and a decrease of mitochondrial glucose oxidation are observed following miR-205 overexpression in PC3-DR cells (Figure 7E-7F). [score:3]
We demonstrated that overexpression of miR-205, associated with a reversion of OXPHOS metabolism, is crucial to sensitize PC3-DR to the drug. [score:3]
Figure 7 A. qRT-PCR analysis of miR-205 expression in PC3 and PC3-DR cells. [score:3]
Indeed, disruption of this metabolic state by drug poisoning OXPHOS or by overexpressing miR-205 make resistant cells more sensitive to the docetaxel, implicating that drug resistance could be circumvented. [score:3]
Re -expression of miR-205 in PC3-DR cells induces a metabolic shift and increase docetaxel sensitivity. [score:3]
The crucial role of OXPHOS in metabolic reprogramming induced by CAF and miR-205 down-regulation [19– 21] as well as in the induction of docetaxel resistance, suggested us to investigate the role of both stroma and miR-205 modulation in chemoresistance. [score:2]
The close correlation between miR-205 and OXPHOS suggested us the possibility to modulate this miRNA to hinder chemoresistance. [score:1]
miR-205 precursor (hsa-miR-205-5p) and negative control were purchased as Pre-miR™ (Ambion). [score:1]
Thus, we evaluated whether miR-205 re -expression could change the metabolic behavior of PCa cells. [score:1]
Moreover, our data suggest a possible modulation of miR-205 to sensitize cells to docetaxel administration. [score:1]
B. Immunoblot analysis of HKII of PC3 and PC3-DR transfected with miR-205 or miR-neg for 48 h and then treated with or without 10 nM docetaxel for 48 h in serum-free medium. [score:1]
The reverse transcription reaction of 1 μg of total RNA was carried on using miScript II RT kit and the quantification of miR-205 expression level was assessed by Real Time PCR using miScript SYBR Green PCR kit and miScript Primer Assay-HsmiR-205. [score:1]
[1 to 20 of 26 sentences]
17
[+] score: 80
By applying a combination of various prediction algorithms, we identified the 3′-UTR of c-FOS as a potential target for miR-181a and miR-181b (down-regulated the in EBV -associated lymphomas), CD44 as a potential target of miR-20a and miR-106a, and the IL1R1 as a target of miR-205 and -125a. [score:10]
The results are compatible with a down-regulation of BCL6 due to an up-regulation of the miR-205 which targets this mRNA. [score:9]
We compared the expression of miR-205, -200c, -145, and -148a (up-regulated) as well as miR-424, -142-3p, -181b, and -20b (down-regulated). [score:8]
The co -expression of miR-205 with a reporter construct featuring the BCL6-3′-UTR showed that this 3′-UTR is a target for miR-205; mutation of the binding site led to non-responsiveness of the reporter. [score:6]
As shown in Figure 4, the miRNAs had no effect on the empty reporter vector (Figure 4A), and only co -expression of miR-205 (Figure 4B) resulted in a significant down-regulation of the BCL6-3′-UTR reporter by approx. [score:6]
Furthermore, ectopic expression of miR-205 resulted in down-regulation of the BCL6-protein level. [score:6]
The sequence analysis had shown a five-fold down-regulation of miR-205 in Thymus tissue as compared to EBV+-NK/T-cell lymphoma while the non-infected T-cell lymphoma showed no expression of this miRNA (Table 1). [score:5]
A computational analysis indicated the BCL6-3′-UTR as a potential target amongst others for miR-205 which was found here to be down-regulated in the EBV -positive NK/T-cell lymphomas and the EBV -negative samples as compared to normal tissue. [score:5]
The Differentially Expressed miR-205 Targets the Oncogene BCL6. [score:5]
For the expression of miR-205, the primers 5′miR205-Eco 5′GGAATTCCGGGTAGGAGTATTCAGGTCC-3′ and 3′miR205_Bam 5′-CGGGATCCTCCCTCTGAAGAAGCACGCA-3′ were used to amplify the genomic luus (416bp) that were then inserted in the pSG5 expression vector [24]. [score:4]
To show that miR-205 indeed reduces the protein level of BCL6, the EBV -negative SUP-T1 T-cell line was transfected with miR-205 expression plasmid and the level of BCL6 protein was determined by Western blot. [score:3]
BCL6 is a target of miR-205. [score:3]
Our data are compatible with the role of miR-205 in repression of BCL6 in normal tissue as expression of miR-205 was higher in thymus than in lymphoma tissues; in addition, miR-205 was virtually undetectable in EBV -negative lymphomas. [score:3]
The comparison of CD56+ primary cells isolated from peripheral blood yielded essentially the same results with the exception of miR-205. [score:1]
D: Influence or miR-205 on the luciferase activity of the empty vector, the wt-3′UTR and the mutated BCL6 3′UTR. [score:1]
E: Transfection of miR-205 reduces the BCL6 protein in SUP-T1 cells. [score:1]
Note that miR-205 was not detectable in the library of the EBV -negative lymphoma by sequencing; therefore, no relative values that compare the EBV -negative samples to the thymus and to the EBV -positive lymphomas can be displayed as log2. [score:1]
C: Schematic overview of the predicted binding site of miR-205 in the 3′UTR of BCL6. [score:1]
SUP-T1 cells transfected with miR-205 or a vector control were analysed in a Western blot with BCL6- and ß-actin- specific antibodies. [score:1]
The seed sequence of potential binding site for miR-205 on the BCL6 3′-UTR (boxed Figure 4C) was then changed by site-directed mutagenesis and assayed again with miR-205. [score:1]
[1 to 20 of 20 sentences]
18
[+] score: 79
Elevated miR-143 expression correlated with BMP-4 and CK8 expression, and elevated miR-205 expression correlated negatively with CK14 expression. [score:9]
miR-203 and miR-205 are expressed at higher levels in squamous mucosa, and miR-143, miR-145, miR-194 and miR-215 are expressed at higher levels in Barrett’s oesophagus. [score:5]
It is possible that up-regulation of miR-143, miR-145 or miR-205, and the associated anti-proliferative effect, might counterbalance hyperplasia in the basal layer of the oesophageal epithelium. [score:4]
Therefore miR-143, miR-145 and miR-205 may regulate gene expression in the nucleus of oesophageal epithelial cells to exert the effects observed in our study. [score:4]
Previous work from our laboratory which compared normal squamous oesophageal mucosa with Barrett’s oesophagus showed increased expression of miR-21, miR-143, miR-145, miR-194 and miR-215, and decreased expression of miR-203 and miR-205 in Barrett’s oesophagus. [score:4]
These changes in miR-143, miR-145 and miR-205 expression appear to be most pronounced in the basal layer of the oesophageal epithelium. [score:3]
In oesophageal squamous mucosa biopsies from individuals with ulcerative oesophagitis, there were significant positive correlations between the expression of miR-143 and CK8 (Rho = 0.802, p = 0.004), miR-143 and BMP-4 (Rho = 0.591, p = 0.032), and a significant negative correlation between miR-205 and CK14 (Rho = −0.587, p = 0.034). [score:3]
Staining for miR-143 (Figure 1B), miR-145 (Figure 1C) and miR-205 probes (Figure 1D) revealed similar expression patterns, with the most intense staining seen in the basal layer of the epithelium. [score:3]
Taken together, these results suggest that miR-143, miR-145 and miR-205 might suppress proliferation or promote apoptosis in the basal layer of the oesophageal epithelium. [score:3]
Endogenous miR-143, miR-145 and miR-205 expression was localised to the basal layer of the oesophageal epithelium. [score:3]
Spatial expression of miR-143, miR-145 and miR-205 in oesophageal biopsies. [score:3]
We sought to identify the spatial expression of miR-143, miR-145 and miR-205. [score:3]
Elevated miR-143, miR-145 and miR-205 expression was observed in oesophageal squamous mucosa of individuals with ulcerative oesophagitis. [score:3]
Restoring miR-143, miR-145 or miR-205 expression in other cell mo dels has also been shown to reduce cell proliferation and increase apoptosis [20- 24]. [score:3]
To assess the impact of selected miRNAs on proliferation and apoptosis in oesophageal epithelial cells miR-143, miR-145 or miR-205 were overexpressed in Het-1A cells, a non-neoplastic oesophageal keratinocyte derived cell line [1, 17]. [score:3]
In oesophageal mucosal biopsies from individuals with ulcerative oesophagitis, the expression of miR-143, miR-145 and miR-205 was predominantly most intense in the basal layer of the epithelium (Figure 1). [score:3]
The expression of miR-143, miR-145, and miR-205 were significantly higher in oesophageal squamous mucosa from subjects with ulcerative oesophagitis compared to squamous mucosa from subjects without pathological reflux. [score:2]
In ulcerative oesophagitis miR-143, miR-145 and miR-205 staining intensity was greatest in the basal layer of the oesophageal epithelium, and it is possible that these miRNAs might direct anti-proliferative and pro-apoptotic effects within this layer. [score:2]
In addition RNA was extracted from the transfected cells using TRIzol®, and miR-143, miR-145 and miR-205 levels were assessed in transfected cell lines using the methods described above. [score:1]
Nuclear staining has been reported for miR-145 [26] in breast myoepithelium, but our study is the first to show nuclear staining for miR-143, miR-145 and miR-205 in the oesophagus. [score:1]
Increasing miR-143, miR-145 and miR-205 activity in Het-1A cells. [score:1]
The median fold increase in miR-143, miR-145 and miR-205 levels, 24 hours after transfection, is presented in Figure 2. Figure 3 summarises the effect of elevating miR-143, miR-145 or miR-205 activity in the Het-1A cell line. [score:1]
In support of this, we identified an inverse correlation between miR-205 and CK14, a marker of basal cell hyperplasia and squamous restoration. [score:1]
The pro-apoptotic effects of transfection with miR-143, miR-145 or miR-205 mimics may reflect the physiological apoptotic response observed in the oesophagus following reflux exposure. [score:1]
Figure 3 Cell proliferation (A) and apoptosis (B) levels in Het-1A cells 48 h after transfection with miR-143, miR-145 or miR-205. [score:1]
Cell numbers at each time point were assessed to compare cell groups transfected with either miR-143, miR-145 or miR-205 with cells transfected with the negative control duplex. [score:1]
Figure 2 Normalised median fold increase in miR-143, miR-145 and miR-205 levels at 24 hours after transfection with respective mimics. [score:1]
In-situ hybridisation staining for miR-143, miR-145 and miR-205 appeared to be both nuclear and cytoplasmic. [score:1]
B, C, D and E: Hybridisation with LNA-probes for miRNAs miR-143 (B), miR-145 (C) and miR-205 (D), and LNA -negative control (E). [score:1]
miRNA levels were increased by transfecting cells with miR-143, miR-145 or miR-205 mimics using the Lipofectamine™ 2000 system (Invitrogen, Mulgrave, Victoria) as per the manufacturer’s protocol. [score:1]
We observed reduced proliferation and increased apoptosis in the cells following transfection with miR-143, miR-145 and miR-205 mimics. [score:1]
The LNA-probes used include miR-143 (#38515-15), miR-145 (#38517-15), miR-205 (#18099-15) and miR-SCR (#99004-15). [score:1]
Cells were transfected using miRNA mimic or negative control duplexes at 33 nM concentration (miR-143 #2988, miR-145 #8480, miR-205 #3391, negative control duplex #1733 all from GenePharma, Shanghai, China). [score:1]
Cells were transfected with either miR-143, miR-145 or miR-205 mimics or a negative control duplex. [score:1]
[1 to 20 of 34 sentences]
19
[+] score: 78
MiR205 that appeared to be up-regulated in several BC tissue samples was previously reported as up-regulated (Gottardo et al., 2007; Dyrskjot et al., 2009; Tao et al., 2011) and down-regulated (Catto et al., 2009; Wiklund et al., 2011) in BC. [score:9]
However, for two miRNAs (miR141 and miR205), contradictory data were reported [up-regulation in Billerey et al. (2001); Aravin et al. (2008); down-regulation in Adachi et al. (2011)]. [score:7]
According to our SSH data, miR141, miR21, and miR29C are down-regulated, and miR205 is up-regulated (online Dataset 1, http://small. [score:7]
MiR205 can specifically suppress VEGF-A expression by directly interacting with the putative miRNA-205 binding site at the 3′-UTR (Yue et al., 2012). [score:6]
The introduction of miR205 into CNE-2 cells suppresses PTEN protein expression followed by the activation of AKT, an increased number of foci formation, and the reduction of post-irradiation cell apoptosis (Qu et al., 2012). [score:5]
MiR205 also regulates the expression of tumor-suppressor, PTEN. [score:5]
Downregulation of miR-205 and miR-31 confers resistance to chemotherapy -induced apoptosis in prostate cancer cells. [score:4]
MicroRNA-205 functions as a tumor suppressor in human glioblastoma cells by targeting VEGF-A. Oncol. [score:4]
We were able to examine 30 published miRNA marker molecules using all three methods, and we observed only one case when all three methods agreed: miR205 was up-regulated according to all three datasets (Figure 1D; online Dataset 4, http://small. [score:4]
ErbB2 down-regulates microRNA-205 in breast cancer. [score:4]
According to the MA test, the AUC values for miR21 and miR205, if considered as the “BC up-regulated” markers, were 0.33 and 0.11, respectively. [score:3]
In this test, only two micro RNAs (miR21 and miR205) showed differential expression in the BC samples under investigation, with the remaining 94% showing no differential expression. [score:3]
MiR-205 determines the radioresistance of human nasopharyngeal carcinoma by directly targeting PTEN. [score:3]
Expression of microRNAs in squamous cell carcinoma of human head and neck and the esophagus: miR-205 and miR-21 are specific markers for HNSCC and ESCC. [score:3]
It was previously shown that ectopic expression of miRNA205 induces apoptosis, cell cycle arrest, impaired cell viability, cloning, and invasive properties of cancer cells (Yue et al., 2012). [score:3]
MiR205 was also reported to be aberrantly expressed in breast (Adachi et al., 2011), prostate (Bhatnagar et al., 2010), lung (Tellez et al., 2011), head, and neck (Kimura et al., 2010), and other cancers. [score:2]
The higher expression level of miR205 in cancer was confirmed by all experimental assays. [score:2]
Therefore, according to our MA test, miR205 and miR21 showed a poor diagnostic value. [score:1]
Coordinated epigenetic repression of the miR-200 family and miR-205 in invasive bladder cancer. [score:1]
EMT and stem cell-like properties associated with miR-205 and miR-200 epigenetic silencing are early manifestations during carcinogen -induced transformation of human lung epithelial cells. [score:1]
Two additional miRNAs (miR199A2 and miR205) showed the Sn value >0.7 only with a soft cut-off criterion R [BC]/R [N] > 2 or < 0.5. [score:1]
[1 to 20 of 21 sentences]
20
[+] score: 68
We analyzed the expression of each of the six putative target genes after having modified the expression of each of the respective microRNAs; again, a miRNA mimic for miR-29b, miR-205, or miR-221 was transfected into cells to mimic miRNA overexpression; separately, an anti-miR-125a-5p oligonucleotide was transfected into cells to inhibit miR-125a-5p activity. [score:11]
In conclusion, our analysis of miRNA expression profiles in CCA cells revealed that miR-29b, miR-205, and miR-221 expression levels were related to the Gem resistance of HuH28 cells, and that ectopic overexpression of any one of these miRNAs could restore Gem sensitivity to these cells. [score:7]
Among these 18 miRNAs, ectopic overexpression of each of three downregulated miRNAs in HuH28 (miR-29b, miR-205, miR-221) restored Gem sensitivity to HuH28. [score:6]
0077623.g004 Figure 4 Ectopic overexpression of miR-29b (A), miR-205 (B), or miR-221 (C) via transfection of a corresponding miRNA mimic and downregulation of miR-125a-5p (D) via transfection of an anti miRNA oligonucleotide made HuH28 cells more sensitive to Gem. [score:6]
Based on these analyses, we predicted that six genes— erythroblastic leukemia viral oncogene homolog 3 (ERBB3), KIT, Leukemia inhibitory factor (LIF), matrix metalloproteinase 2 (MMP-2), phosphoinositide-3-kinase regulatory subunit 1 (PIK3R1) and vascular endothelial growth factor A (VEGFA) — were putative oncogenic targets of miR-29b, miR-205, and/or miR-221. [score:6]
Ectopic overexpression of miR-29b (A), miR-205 (B), or miR-221 (C) via transfection of a corresponding miRNA mimic and downregulation of miR-125a-5p (D) via transfection of an anti miRNA oligonucleotide made HuH28 cells more sensitive to Gem. [score:6]
However, ectopic overexpression of the miR-205 mimic did not change expression levels of ErbB3 or VEGFA. [score:5]
Our results indicated that expression levels of miR-29b, miR-125a-5p, miR-205, and miR-221 may be useful as diagnostic markers of sensitivity to, and that PIK3R1 and MMP-2 could become molecular targets of anti-tumor therapies for patients with CCA. [score:5]
As an anti onco-miRNA, miR-205 targets and suppresses zinc finger E-box binding homeobox 1/2 (ZEB1, 2), E2F transcriptional factor 1 (E2F1), ErbB3, and VEGFA [31]– [34]. [score:5]
Our computer -based search for miR-205 targets also indicated that ErbB3 and VEGFA were cancer-related target genes of miR-205 in HuH28 cells. [score:5]
Transfection of a mimic of miR-29b, miR-205, or miR-221 or inhibition of miR-125a-5p via a complementary oligonucleotide significantly restored Gem sensitivity to HuH28 cells near clinical therapeutic concentration, 1×10 [−4] M (Figure 4). [score:3]
Our results clearly indicated that excess miR-205 could conferred Gem sensitivity to innately Gem-resistant CCA cells. [score:1]
Reportedly, miR-205 is both an anti onco-miRNA and an onco-miRNA [30]. [score:1]
The p values between miR-29b, miR-205 and miR-221 mimic transfection versus non-silencing miRNA mimic (relative cell viability was 82 ± 4 % at 1×10 [−4] M Gem) and anti-miR-125a-5p oligonucleotide transfection versus negative control oligonucleotide (relative cell viability at 1×10 [−4] M Gem was 70 ± 6 %) were smaller than 0.001. [score:1]
[1 to 20 of 14 sentences]
21
[+] score: 66
The migration of fibroblasts was not affected by miR-205 overexpression or knockdown, but knockdown cells exposed to EVs showed faster migration. [score:5]
Next, we carried out qPCR experiments to verify expected changes in cellular miR-205 levels after its overexpression or knockdown. [score:4]
We also examined the effects of miR-205 overexpression and knockdown on AKT activation by performing Western blot analysis of the levels of phosphorylated and total AKT (Figure 7(c)). [score:4]
Human dermal fibroblasts and keratinocytes were seeded at 60–70% confluence and then exposed to a suspension of Lipofectamine 2000 (Thermo Fisher Scientific) with 25 nM siRNA in Opti-MEM (Thermo Fisher Scientific) for 5 h. The siRNAs used were all purchased from Thermo Fisher Scientific: mirVana miRNA inhibitor, hsa-miR-205-5p (assay ID: MH11015; catalog number: 4464084); mirVana miRNA mimic, hsa-miR-205-5p (assay ID: MC11015, catalog number: 4464066); and mirVana miRNA inhibitor negative control number 1 (catalog number: 4464076). [score:3]
To evaluate whether MSC EVs modulated miR-205 expression, qPCR experiments were conducted in fibroblasts and keratinocytes after exposure to EVs for 24 h. We found that treatment with MSC EVs led to a ~3-fold increase in miR-205 expression level (Figure 7(a)). [score:3]
Transfection of 25 nM of miR-205 sequence increased the expression level of this microRNA ~ 6-fold in both fibroblasts and keratinocytes (miR-205 mimic). [score:3]
These results indicated that AKT activation upon exposure to MSC EVs was likely independent of miR-205 expression. [score:3]
Expression levels of miR-205 in cells exposed only to the transfection reagent lipofectamine (lipofectamine group) or lipofectamine plus a scramble sequence (scramble group) did not change, as expected (Figure 7(b)). [score:3]
Exposure of Fibroblasts and Keratinocytes to EVs Increased miR-205 Expression. [score:3]
On the other hand, migration of keratinocytes was increased by miR-205 overexpression. [score:3]
Although miR-205 is present inside the EVs from stem cells, we could not assume at this point that the increased expression observed in qPCR experiments is strictly due to the transfer from EVs to cells with the experiments described here. [score:3]
Taken together, these results suggest that miR-205 is important for keratinocyte migration, but, for the migration effect induced by EVs, its expression seems not to be essential. [score:3]
Accordingly, the knockdown of miR-205 made migration of keratinocytes similar to the levels of control groups, but the knockdown cells exposed to EVs had an increased migration. [score:3]
In human fibroblasts and keratinocytes, miR-205 overexpression did not induce significant AKT phosphorylation compared to the levels detected in cells treated with lipofectamine or scramble RNA. [score:2]
However, miR-205 knockdown led to lower levels of phosphorylated AKT in cells of both types, as previously demonstrated. [score:2]
Finally, we investigate the migration effects of miR-205 overexpression and knockdown in fibroblasts and keratinocytes (Figure 8). [score:2]
The pathway regulated by miR-205 is involved in cell migration and proliferation. [score:2]
We also examined the consequences of miR-205 knockdown in cells before (siRNA group) and after exposure to EVs (siRNA + EVs). [score:2]
This result contrasted with the data reported by Yu et al. [11] who showed that miR-205 could induce AKT activation in keratinocytes. [score:1]
Lack of miR-205 results in epidermal defects caused by impaired proliferation, whereas genetic deletion of miR-205 leads to neonatal mortality in mice [10]. [score:1]
We decided not to increase the concentration of siRNA because we already had a 6-fold change in cells transfected with miR-205 mimic sequence that was around twice the amount of miR-205 found in the cells exposed to EVs. [score:1]
It has been shown that one of the most abundant microRNAs in the skin, miR-205, is an important modulator of AKT pathway activity [11]. [score:1]
Properties of fibroblasts and keratinocytes exposed to MSC EVs were similar when miR-205 was silenced. [score:1]
This could be due to the different cells used or because of the complex network of miR-205 [29]. [score:1]
In summary, our data suggest that cell migration and proliferation, key processes in skin wound healing, can be enhanced by exposure to MSC-derived EVs, which activate the AKT pathway in a miR-205-independent manner. [score:1]
This could be attributed to the miR-205 concentration used. [score:1]
Moreover, we found the presence of miR-205 in EV samples from MSCs, through the Next Generation Sequencing experiments (data not shown). [score:1]
This result suggests that the migration of fibroblasts was independent of miR-205 and that EVs could have other molecules responsible for increasing fibroblast migration. [score:1]
Many studies are showing a complex role of miR-205 in many mo dels [28]. [score:1]
For example, In HaCaT keratinocytes, miR-205 knockdown could promote migration in scratch wound healing assay. [score:1]
Furthermore, we examined whether EV effects on migration and activation of AKT were dependent on miR-205. [score:1]
[1 to 20 of 31 sentences]
22
[+] score: 62
Other miRNAs from this paper: hsa-mir-22, hsa-mir-31, hsa-mir-101-1, hsa-mir-101-2
As shown in Figure 6a, blocking miR-205 with an anti-miR inhibitor in WPE1-NA22 cells (a cell line that expresses high level of endogenous miR-31 [25]) decreased miR-31 expression, and increased EZH2 and E2F6 proteins. [score:7]
Thus, miR-205 may suppress EZH2 indirectly through its action on the molecules that control EZH2 expression. [score:6]
It has been reported that miR-205 suppresses EZH2 expression [30] in prostate cancer cells and miR-205 promotes apoptosis. [score:5]
[30] We hypothesized that the epigenetic silencing of miR-205 (through promoter methylation) will lead to increased expression of EZH2, which in turn epigenetically represses miR-31 expression through histone methylation. [score:5]
Interestingly, the expression levels of miR-205, EZH2, and miR-31 correlate well among the individual patients (Pearson's correlation coefficient test: R=−0.7911 between the levels of EZH2 and miR-31; R=−0.6236 between EZH2 and miR-205). [score:3]
In contrast, overexpression of miR-205 in PC-3 cells caused a decrease of EZH2 and an increase of miR-31, which in turn decreased E2F6 (Figure 6b). [score:3]
At present, we do not know the mechanism of how miR-205 inhibits EZH2. [score:3]
Anti-miR miRNA inhibitor for miR-205 (ID AM11015) was purchased from Life Technologies. [score:3]
There is no target sequence of miR-205 within the 3′-UTR of EZH2 gene (http: // www. [score:3]
We analyzed miR-205, EZH2, and miR-31 expression in eight pairs of human prostate cancer specimens and the adjacent non-malignant tissues using real-time PCR. [score:3]
To test our hypothesis, we examined the effects of miR-205 on miR-31 expression. [score:3]
[39] Epigenetic silencing of miR-205 may result in the increase of these EZH2 activators, which in turn increases EZH2 expression. [score:3]
MiR-205, EZH2, and miR-31 expression in human prostate cancer specimens. [score:3]
We found that miR-205 and miR-31 expression levels were decreased in the cancer samples compared with the normal tissues (Figure 7). [score:2]
MiR-205 regulates miR-31 through EZH2. [score:2]
[25] Interestingly, miR-205 has been shown to decrease EZH2 protein in prostate cancer cells. [score:1]
We have reported that miR-205 is silenced in prostate cancer by promoter hypermethylation. [score:1]
This observation supports our hypothesis that EZH2 may coordinate the silencing of miR-205 and miR-31 in prostate cancer. [score:1]
Thus, DNA methylation -mediated silencing of miR-205 [25] can lead to histone methylation -mediated silencing of miR-31, with EZH2 as the coordinator of the two separate events. [score:1]
For example, low levels of miR-205 in patients PR2647 and PR1107 match to the high levels of EZH2 in the same patients, which in turn lead to the very low levels of miR-31 in these patients. [score:1]
As presented in a conceptual mo del (Figure 8), we propose that EZH2 coordinates the silencing of the proapoptotic miR-205 and miR-31. [score:1]
TM509 for miR-205, TM1100 for miR-31, Hs00544833_m1 for EZH2) from Applied Biosystems (Foster city, CA, USA). [score:1]
miRIDIAN miR-205 mimic (cat. [score:1]
[1 to 20 of 23 sentences]
23
[+] score: 54
Recent data link miR-205 expression with the tumor suppressor Arf claiming that miR-205 overexpression up-regulates the Arf–p53–p21 signaling axis [44]. [score:10]
For example, miR-205 was shown to counteract epithelial-mesenchymal transition and tumor invasion, acting as tumor suppressor while numerous other studies show its overexpression in cancer cells [43]. [score:5]
It is noteworthy that miR-451 and miR-205, which we found among the most downregulated miRNAs in the plasma of lung SCC patients after surgical removal of the tumor, are selectively secreted by lung cancer cells into the medium. [score:4]
As a result, we found five miRNA species, miR-205, -19a, -19b, -20a, -451, and -30b, that displayed strong and specific downregulation in plasma 7–10 days after tumor resection. [score:4]
The strongest effect was observed for miR-205: this miRNA was downregulated in the vast majority of cases of lung SCC after tumor removal, but not in the two control cases (Figure 2). [score:4]
It is noteworthy that miR-451 and miR-205, two species whose levels were most downregulated in the plasma of lung SCC patients after surgical removal of the tumor, were selectively secreted by lung cancer cells into the medium. [score:4]
The latest data confirm that miR-205 expression is increased in tissues and serum for both adenocarcinoma and SCC patients [41]. [score:3]
In agreement with our results, a recent study reported a similar decrease in miR-205 expression in the serum of lung cancer patients after tumor removal [29]. [score:3]
Expression of miR-205, -19a, -19b, -20a, -451, and -30b decreased significantly (p<0.05) after tumor removal (Figure 1). [score:3]
Another recent study suggests miR-205 as a potential biomarker to differentiate adenocarcinoma from SCC, but only for tissue expression [42]. [score:3]
Specificity of this result was further confirmed on other non-NSCLC samples: in two esophageal carcinoma cases, one hamartoma case and two healthy donors, we did not observe miR-205 expression in pre-operative samples (Table S2). [score:3]
As for the biological function of miR-205, this miRNA cannot be unambiguously placed in the cancer development pathway due to its dual role: it can be considered as an oncomiR or a tumor suppressor, depending on the cellular context and signaling pathway. [score:3]
In our results, miR-205 displayed the most consistent decrease after tumor removal. [score:1]
Interestingly, these results were cell line-specific: in A549 lung adenocarcinoma cells miR-205 was much less secreted and in HuH7 liver carcinoma cells miR-205 was not detected neither in cells nor in medium; while miR-30b (cell-retained in A2182) was found to be excreted both in A549 and HuH7 (data not shown). [score:1]
A group of miRNAs on the left side of the plot (miR-205, -19a, -19b, -451, -30b, -20a, and -93) are the most abundant in the plasma of lung SCC patients and are reduced in the plasma after tumor removal. [score:1]
In our samples, we could not find significant differences in the level of circulating miR-205 between these two subtypes but this can be linked to the low number of adenocarcinoma cases tested. [score:1]
Our results suggest a potential diagnostic value of a panel of miRNAs (miR-205, -19a, -19b, -30b, -20a) as blood -based markers. [score:1]
[1 to 20 of 17 sentences]
24
[+] score: 53
For example, the targets of the mir-135 family, a family that was up-regulated in the vestibule, were enriched in a set of proteins down-regulated in this tissue; and the targets of mir-205, a miRNA that exhibited a higher expression in the cochlea, were depleted in a set of proteins also up-regulated in the cochlea. [score:16]
Thus, for six miRNA families – mir-135, mir-205, mir-142-3p, mir-15/16, mir-218 and mir-24 - we obtained evidence for their functional relevance in the inner ear on two levels: (a) the miRNAs were differentially expressed between the two tissues; and (b) their predicted targets were differentially expressed in a manner consistent with the currently accepted mo del of miRNA regulation. [score:8]
For further study, we selected miR-135b and miR-205, for which miRNA target enrichment or depletion, respectively, were detected only at the protein expression level and therefore would not have been identified by analyzing transcript data alone. [score:5]
Almost all cochlear cells, including those of the modiolus, were found to express miR-205. [score:3]
Some of the cells in the auditory apparatus did not show miR-205 expression, including many of the cells facing the scala media. [score:3]
Expression patterns for miR-135b (C) and miR-205 (D) were consistent with the miRNA array analysis. [score:3]
As expected from the miRNA microarray data, miR-205 expression was mainly limited to the cochlea. [score:3]
The spatial expression pattern of miR-135b and miR-205 in the inner ear of P0 mice was determined using in situ hybridization (ISH; Figure 3), and suggested differences in miRNA function across the cochlea and vestibular organs. [score:3]
For two miRNAs, miR-135b and miR-205, we localized their cell specific expression in the inner ear using in situ hybridization. [score:3]
Distinct spatial expression patterns of miR-135b and miR-205 in the newborn mouse inner ear. [score:3]
We found miR-205 to be expressed in cells of the spiral ligament, part of the Reissner's membrane, basilar membrane and apical surface of the spiral limbus. [score:3]
[1 to 20 of 11 sentences]
25
[+] score: 52
Recently, Zaravinos et al. [20] investigated microRNA expression in normal renal tissue and renal tumors (renal cell carcinoma and UUTUC): 21 microRNAs were specifically deregulated in UUTUC (5 microRNAs upregulated and 16 microRNAs downregulated—the UUTUC profile was different from our target microRNAs); miR-10a, miR-200b and miR-205 were upregulated compared to renal tissue. [score:12]
We observed a significant overexpression of miR-21, miR-96, miR-135, miR-141, miR-182, miR-205, miR-429, miR-520b (all p<0.001) in UUTUC; the microRNAs miR-10a (p = 0.012) and miR-200b (p = 0.006) showed a distinct trend towards upregulation, whereas miR-1244 (p = 0.600) was similar in normal and malignant tissue. [score:6]
The expression of eleven microRNAs (miR-10a, miR-21, miR-96, miR-135, miR-141, miR-182, miR-200b, miR-205, miR-429, miR-520b, miR-1244) formerly shown to be upregulated in urothelial bladder cancer were studied in corresponding normal and cancerous tissue samples of patients undergoing nephroureterectomy for UUTUC. [score:6]
MicroRNA expression allowed differentiation of normal and cancerous tissue: miR-21, miR-96, miR-135, miR-141, miR-182, miR-205, miR-429 and miR-520b were significantly overexpressed. [score:5]
Furthermore, miR-205 was upregulated in poorly differentiated UUTUC. [score:4]
miR-205 (p = 0.002) was upregulated in undifferentiated UUTUC (G3 vs. [score:4]
Interestingly, this partly overlaps with the microRNA expression profile earlier established in a prostate cancer study, in which miR-205, miR-96 and miR-182 were found particularly regulated [23]. [score:4]
In order to investigate the role of microRNAs as non-invasive biomarkers in patients with UUTUC, the expression of eleven microRNAs (miR-10a, miR-21, miR-96, miR-135, miR-141, miR-182, miR-200b, miR-205, miR-429, miR-520b, miR-1244) earlier shown to be upregulated in urothelial cancer of the bladder [13– 20], was analyzed [11] in corresponding normal ureter and UUTUC tissue. [score:4]
Especially miR-21, miR-96, miR-135, miR-141, miR-182, miR-205, miR-429 and miR-520b were distinctly overexpressed in UUTUC. [score:3]
Notably, miR-205 [35] and miR-10a [36] were associated with the survival time in patients with bladder cancer. [score:1]
Tumor grade and stage are usually correlated in urothelial cancer, and thus one would expect significant correlations with stage (miR-205) or grade (miR-10a, miR-135), respectively. [score:1]
The miR-205 tissue levels were also correlated with undifferentiated UUTUC, and miR-10a and miR-135 were decreased in serum of patients with muscle-invasive UUTUC. [score:1]
ROC analysis demonstrated an AUC of 0.726 (95% confidence interval 0.609–0.843) for miR-141 as diagnostic biomarker; see Fig. 3 and Table 2. miR-200b (p = 0.041), miR-205 (p = 0.008), miR-425 (p = 0.025), miR-96 (0.013) showed a trend towards higher levels in cancer patients, but the p-value was >0.0065 which was defined as significance level after correction for multiple hypothesis testing. [score:1]
[1 to 20 of 13 sentences]
26
[+] score: 48
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-141, hsa-mir-200c, hsa-mir-200a
Taking into account that forced expression of ΔNp63α reaches cell-physiological levels and is similar to the p63 expression level seen in EP156T cells, it is striking that the p63 target genes and miR-205 are up-regulated but do not reach the expression levels observed in epithelial EP156T cells, indicating a quantitative rather than qualitative restriction of target gene expression. [score:16]
ZEB1 knock-down in EPT1B8 cells was additionally associated with specific re -expression of miR-141 and miR-200c, but neither with re -expression of other miR-200 family members nor with re -expression of miR-205 (Table S12), consistent with previous studies in different mo dels [30]. [score:8]
Among additional reported targets of miR-205, however, is a group of de-ubiquitinating enzymes whose inhibition is associated with increased ubiquitination and proteasomal degradation of p63 [28]. [score:5]
Examination of our p63 ChIP-seq data files revealed peaks corresponding to p63 binding sites within the miR-205 regulatory regions (Figure 4C), suggesting that p63 might induce miR-205 expression. [score:4]
Pronounced down-regulation of all miR-200 family and miR-205 was observed following EMT. [score:4]
In particular, miR-205 was abundantly expressed in EP156T cells, but undetectable in EPT1 cells. [score:3]
The reason for the limited expression of p63 -induced cell adhesion and miR-205 genes is unclear. [score:3]
In turn, ZEB1 is targeted by the microRNA 200 family [27] and by miR-205 [28], [29] to constitute reciprocal feedback loops. [score:3]
In fact, potential positive feedback circuits can be envisaged according to which p63 -mediated induction of miR-205 would lead to ZEB1 reduction (as observed) that next could be expected to alleviate ZEB1 mediated repression of the p63 gene promoter [28]. [score:1]
A significant induction of miR-205 was observed in EPT1ΔNp63α cells, although to a much lower level than in EP156T cells. [score:1]
[1 to 20 of 10 sentences]
27
[+] score: 47
At 30 weeks of age, the expression of miR-216 (p-value = 0.016), miR-217 (p-value = 0.0078), miR-150 (p-value =0.023), Let-7b (p-value = 0.031,) and miR-96 were significantly downregulated, whereas the expression of miR-146b (p-value = 0.0078), miR-205, (p-value - 0.0078), miR-21, miR-195 (p-value = 0.031), and miR-34c (p-value = 0.063) were significantly upregulated in KC animals compared to control animals (Figure 2B). [score:10]
At 40 weeks of age, the expression of miR-216, miR-217, miR-223, miR-141, miR-483-3p (p-value = 0.031), miR-195, Let-7b (p-value = 0.063) and miR-96 were significantly downregulated; on the other hand, the expression of miR-21, miR-205, miR-146b (p-value = 0.031), and miR-34c (p-value = 0.063) were upregulated in KC mice compared to the control animals (Figure 2C). [score:10]
We have shown that in tumor samples compared to normal samples, the majority of miRNAs (miR-216, miR-217, miR-100, miR-345, miR-141, miR-483-3p, miR-26b, miR-150, Let-7b, Let-195 and miR-96) were downregulated, and few were upregulated (miR-146b, miR-205, miR-31, miR-192, miR-194 21, miR-379, miR-431, miR-541, and miR-199b). [score:6]
The analysis for the KC animals compared to controls revealed that miR-150, miR-494, miR-138, miR-148a*, miR-216a, and miR-217 (p-value = 0.01) were significantly downregulated (Table 1), whereas, miR-146b, miR-205, miR-31, miR-192, and miR-21 (p-value = 0.01) were significantly upregulated (Table 2). [score:6]
The expressions of miR-216 and miR-217 were also progressively reduced in KC mice, but the expressions of miR-21, miR-205, miR-146b, miR-34c, and miR-223 progressively increased (Figure 1A, 2A– 2D). [score:5]
Rieu et al. also reported in the KC animals, progressive increases in miR-21 and miR-205 expression from PanIN lesions to full-blown PDAC, with strongest expression of miR-21 in precursor lesions with phenotypic changes in the ducts [69]. [score:5]
Similarly, we also observed upregulation of miR-21 and miR-205 in human PC samples compared to cancer- adjacent normal tissue (Figure 3E). [score:3]
Several reports have also shown elevated expression of miR-21 and miR-205 in a panel of PC cell lines and tissues compared to the normal controls [40– 42, 50, 55, 60, 65– 68]. [score:2]
[1 to 20 of 8 sentences]
28
[+] score: 46
Whereas knocking down miR-205, the inhibition of PTEN expression in the radio-resistant NPC cell line CNE-2R reconciled the inhibition of PTEN expression and the increase of cell apoptosis [17]. [score:10]
It was confirmed that miR-141 and miR-205 were dramatically down-regulated in Splunc 1 expressed cell. [score:6]
Qu et al. demonstrated that introducing miR-205 into the parental cell line CNE-2 can suppress phosphatase and tensin homolog (PTEN) protein expression, followed by activation of AKT, increased number of foci formation and reduction of cell apoptosis after irradiation. [score:5]
For example, monitoring of the down-regulation of miR-133a, miR-133b, miR-205 and let-7d in HNSCC tumours served as indicators in the prognosis of HNSCC patients. [score:4]
By considering the fold-change threshold and percentage of incidence, among the 95 screened miRNAs which have functional significance with regard to potential roles in cancer, cell development and apoptosis, ten miRNAs (miR-205, miR-196a, miR-149, miR-183, miR-224, miR-210, miR-150, miR-136, miR-200c and miR-141) were identified which may play a putative role in cancer development, metastasis and have potential as biomarkers for the detection of NPC. [score:3]
Moreover, expression pattern of miR-205 and miR-149 in HNSCC and ESCC; and miR-210 in ESCC, were opposite to our data. [score:3]
Our results showed that miR-205 is highly expressed in NPC patients who have been clinically confirmed not to be metastatic. [score:3]
Matsushima K MiRNA-205 modulates cellular invasion and migration via regulating zinc finger E-box binding homeobox 2 expression in esophageal squamous cell carcinoma cellsJ. [score:3]
Qu C MiR-205 determines the radioresistance of human nasopharyngeal carcinoma by directly targeting PTENCell cycle. [score:3]
Further investigation of the relative expression difference of miR-205 between metastatic and non-metastatic NPC patients may be promising as a mean of diagnosing metastatic disease as well as accessing the outcome of radiotherapy. [score:3]
The incidence of up and down regulation of these ten miRNAs, including miR-205 (94.1%), miR-196a (88.2%), miR-149 (82.4%), miR-183 (64.7%), miR-224 (58.8%), miR-210 (58.8%), miR-136 (47.1%), miR-200c (64.7%), miR-141 (52.9%) and miR-150 (82.4%) between non-NPC controls and NPC patients ranges from about 47% to 94% incidence rate. [score:2]
They were miR-205, miR-196a, miR-149, miR-183, miR-224, miR-210, miR-136, miR-200c, miR-141 and miR-150. [score:1]
[1 to 20 of 12 sentences]
29
[+] score: 41
The downregulation of miR-205 in metastatic breast cancer cell lines suggests that it is an ideal therapeutic target in cancer treatment. [score:6]
The miR-205 can inhibit breast cancer cell proliferation and improve response to specific targeted therapies as well. [score:5]
The miR-205 inhibits HER3, inactivating the downstream mediator Akt, which results in the suppression of the PI3K/Akt signaling pathway. [score:5]
It revealed that miR-205 directly targets HER3, a receptor tyrosine kinase of the epidermal growth factor receptor (EGFR) family [70]. [score:4]
In addition, transfecting miR-205 in cancer cells resulted in the inhibition of cell proliferation, clonogenicity and invasion [68]. [score:3]
The miR-205 expression is reduced in breast cancer tissue samples in comparison to normal breast tissue. [score:3]
The miR-205 has been implicated as a tumor suppressor in breast cancer [68]. [score:3]
Further support for miR-205’s potential to identify breast tumors from normal tissue revealed reduced expression in breast cancer cell lines MCF-7 and MDA-MB-231 in comparison to normal MCF-10A breast epithelial cells. [score:3]
Another study explored miR-205 target genes in breast cancer patients. [score:3]
The miR-205 can contribute to cancer therapeutics due to its negative regulation of the HER3 receptor, which affects survival and proliferation of breast cancer cells. [score:2]
This suggests that miR-205 activity is very similar to that of the miR-200 family, which is also associated with negative regulation of EMT. [score:2]
The miR-205 was shown to negatively modulate ZEB1 and is thereby negatively linked to the acquisition of EMT [43, 69]. [score:1]
3.4. miRNA-205. [score:1]
[1 to 20 of 13 sentences]
30
[+] score: 40
We found 37 differentially expressed miRNAs in the CD133 [+] spheroid-forming subpopulation of OVCAR3 cells, 34 of which were significantly up-regulated, including miR-205, miR-146a, miR-200a, miR-200b, and miR-3, and 3 of which were significantly down-regulated, including miR-1202 and miR-1181. [score:9]
Specifically, the expression of miR-205 is significantly suppressed in ovarian cancer [18], whereas miR-205 is significantly up-regulated in bladder cancer [19]. [score:8]
In agreement with the microarray results, miR-205, miR-146a, miR-200a, miR-200b, and miR-31 were up-regulated, whereas miR-1202 and miR-1181 were down-regulated in the CD133 [+] spheroid-forming subpopulation (Table 2). [score:7]
Thirty-four miRNAs including miR-205, miR-146a, miR-200a, miR-200b, and miR-31 were significantly up-regulated, while 3 microRNAs including miR-1202 and miR-1181 were significantly down-regulated (Figure 5, Table 1). [score:7]
However, down-regulation of miR-205 was noted in prostate cancer cell lines resistant to chemotherapy [21]. [score:4]
Additionally, miR-205 was found to be highly expressed in stem cell-rich populations and thus may have a function in normal mammary stem cell maintenance [20]. [score:3]
Recent studies have demonstrated that miR-205 has a role in both normal and cancer development, but these results are controversial. [score:2]
[1 to 20 of 7 sentences]
31
[+] score: 40
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The expression of miR-205 was also reported to be down-regulated in prostate cancer cells, and ectopically expressed miR-205 showed a tumor-suppressive effect, including reduction of cell migration and tissue invasion [36]. [score:10]
Of the down-regulated miRNAs a number have been reported to be down-regulated in prostate cancer relative to benign prostate tissues, i. e. miR-16 [23]– [25], miR-24 [26]– [28], miR-29a [26], miR-145 [23], [24], [27], [29], [30], and miR-205 [24], [31], [32]. [score:7]
[Epub ahead of print] 36 Gan dellini P Folini M Longoni N Pennati M Binda M 2009 miR-205 Exerts tumor-suppressive functions in human prostate through down-regulation of protein kinase Cepsilon. [score:6]
The down-regulation of miR-16 [25], miR-34a [33], miR-126* [34], miR-145 [35] and miR-205 [36] correlated with the development of prostate cancer metastasis. [score:5]
Thus some of the miRNAs have already been linked to this phenomenon, in particular down-regulated miRNAs such as miR-16, miR-34a, miR-126*, miR-145 and miR-205, supporting the validity of our analytical approach. [score:4]
A number of these miRNAs (21/104) have previously been reported to show similar down- or up-regulation in prostate cancers relative to normal prostate tissue, and some of them (e. g., miR-16, miR-34a, miR-126*, miR-145, miR-205) have been linked to prostate cancer metastasis, supporting the validity of the analytical approach. [score:4]
Of the down-regulated miRNAs, 24 miRNAs showed a >5-fold decrease, including four miRNAs, i. e. miR-205, miR-503, miR-708 and miR-2115*, which were undetectable in the metastatic line. [score:4]
[1 to 20 of 7 sentences]
32
[+] score: 39
The qRT-PCR analysis indicated that 2 miRNAs (miR-21 and miR-133b) were deregulated in both EAC and GC, and 6 miRNAs (up-regulated: miR-194, miR-31, miR-192, and miR-200a; down-regulated: miR-203 and miR-205) in EAC, as compared to BE but not in GC, indicating their potential unique role in EAC. [score:7]
Our validation confirmed the up-regulation of miR-194, miR-192, miR-21, and miR-200a, and the down-regulation of miR-203, miR-205, miR-133b, and miR-31 in EAC as compared to NS. [score:6]
We showed the up-regulation of miR-194, miR-192, miR-21, miR-31, and miR-200a (Figure 2, Table 3) and the down-regulation of miR-133b, miR-203, and miR-205 in EAC as compared to BE (Figure 3, Table 3). [score:6]
We found that 2 miRNAs (miR-192, and miR-194) were up-regulated and 3 miRNAs (miR-205, miR-203, and miR-31) were down-regulated in BE as compared to NS (Figures 2 and 3). [score:6]
miR-203 and miR-205 were down-regulated in EAC but not in GC (Table 4, Figure 5). [score:4]
The log10 values of fold expression of the 8 miRNAs (miR-192, miR-200a, miR-194, miR-21, miR-203, miR-205, miR-31, and miR-133b) were used for hierarchical clustering. [score:3]
On the other hand, miR-133b, miR-200a, miR-205, and miR-203 did not display any significant differential expression between isolated BE and BE adjacent to HGD (Figure 8, Table 5). [score:3]
miR-194, miR-192, miR-200a, miR-21, miR-203, miR-205, miR-133b, and miR-31 were selected for validation using 46 normal squamous (NS), 23 Barrett’s esophagus (BE), 17 Barrett’s high grade dysplasia (HGD), 34 EAC, 33 gastric adenocarcinoma (GC), and 45 normal gastric (NG) tissues. [score:1]
0064463.g005 Figure 5The expression levels of the 6 miRNAs (miR-194, miR-192, miR-203, miR-205, miR-200a, and miR-31) were measured by means of qRT-PCR in 13 BE, 34 EAC, 45 NG, and 33 GC tissue samples. [score:1]
The expression of 4 miRNAs (miR-205, miR-133b, miR-203, and miR-31) was evaluated using qRT-PCR in 46 NS, 13 BE, 17 HGD, and 34 EAC tissues. [score:1]
0064463.g003 Figure 3 The expression of 4 miRNAs (miR-205, miR-133b, miR-203, and miR-31) was evaluated using qRT-PCR in 46 NS, 13 BE, 17 HGD, and 34 EAC tissues. [score:1]
[1 to 20 of 11 sentences]
33
[+] score: 38
Other miRNAs from this paper: hsa-mir-96, hsa-mir-184
miR-184 seems to play its biological role through the competitive inhibition of the binding of miR-205 to its mRNA target that encodes inositol polyphosphate-like 1 (INPPL1) and integrin, beta 4 (ITGB4) [14]. [score:5]
Furthermore, taking into account the potential inhibitory effect of miR-184 on miR-205, we also examined the relative expression of miR-184 versus miR-205 in normal human cornea samples. [score:5]
Our microRNA sequencing data in postmortem unaffected human ocular samples with Illumina MiSeq identifies the expression of more than 340 mature miRNAs, including both miR-184 and its competitor miR-205 (Figure 3). [score:3]
The expression levels of miR-184 and miR-205 were examined in all 10 ocular samples. [score:3]
Comparing the expression of miR-184 and miR-205 in control versus KC cornea samples as well as corneas of other ocular abnormalities will reveal the contribution of miR-184 and miR-205 to KC and/or other ocular defects. [score:3]
On the other hand, we indicate that miR-205 is also highly expressed in the cornea and the trabecular meshwork with a mean of 2867 and 3729 reads per million sequencing reads, respectively. [score:3]
However, similar to the miR-184 data, miR-205 has a negligible expression in both the ciliary body and the retina. [score:3]
This can be further confirmed by examining the relative expression of miR-184 and miR-205 in KC-affected cornea samples. [score:3]
The potential role of miR-184 as a competitive inhibitor of miR-205 was further confirmed by Hughes and colleagues [14]. [score:3]
The expression of miR-184 is almost 15-fold and 8-fold higher than that of miR-205 in the human cornea and the trabecular meshwork samples, respectively. [score:3]
Accordingly, it was reported that miR-184 prevents knockdown of INPPL1 and ITGB4 by miR-205 and rescued their levels in cell culture [14, 39]. [score:2]
Our data regarding the abundant expression of miR-184 as compared to miR-205 in normal human cornea samples further highlight the potential role of miR-184 in the cornea. [score:2]
[1 to 20 of 12 sentences]
34
[+] score: 36
In agreement with this, we identified miR-205 and miR-211 as cordycepin -upregulated tumor suppressive miRNAs in our miRNAarray data set. [score:6]
By analyzing miRNA array for miRNA differentially expressed from different stages of melanoma, miR-203, miR-205 and miR-211 were identified as the targets [42]. [score:5]
In sharp contrast, miR-200b, miR-200c, miR-205 and miR-211 knockdown did not significantly alter the motility of melanoma, suggesting that miR-33b would be the sole miRNA responsible for cordycepin -mediated suppression of melanoma migration (Figure 4C). [score:4]
However, knockdown of miR-200b, miR-200c, miR-205 and miR-211 did not affect cordycepin -mediated suppression of melanoma migration and invasiveness (Figure 4C and Figure 5A). [score:4]
miR-203, miR-205 and miR-211 were proposed to act as tumor suppressors to limit anchorage-independent growth. [score:3]
qRT-PCR was used to quantify miR-200b, miR-200c, miR-205, miR-33b, and miR-211 and mRNA expressions. [score:3]
The elevated expressions of miR-33b, miR-200b, miR-200c, miR-205 and miR-211 were verified by realtime-PCR (Figure 1A–1B). [score:3]
Among those, miR-33b, miR-200b, miR-200c, miR-205 and miR-211 exhibited more than 5-fold increase in their expression in response to 200 μg/ml cordycepin. [score:3]
Figure 1 (A–B) qRT-PCR reveals upregulation of miR-33b, miR-200b, miR-200c, miR-205 and miR-211 in Lu1205 and A375 melanoma cells which received 200 μg/ml cordycepin compared with their matched untreated controls. [score:3]
miR-200b, miR-200c, miR-205 or miR-211 knockdown did not change cell invasiveness. [score:2]
[1 to 20 of 10 sentences]
35
[+] score: 34
Then, the authors reported, with scratch wound experiments, that the K [IR]4.1 expression was reduced after 24 h, while cells transfected with miR-205 antagomir increased the expression of K [IR]4.1. [score:5]
Inhibition of miR-205 impairs the wound-healing process in human corneal epithelial cells by targeting KIR4.1 (KCNJ10). [score:5]
They observed that when a scratch injury was applied to HCECs, miR-205 expression was elevated, but miR-16, another expressed miR in HCECs, was not altered as determined by qRT-PCR. [score:5]
This further verified that miR-205 modified the expression of K [IR]4.1. [score:3]
These data suggested that miR-205 altered K [IR]4.1 expression. [score:3]
miR-802 and K [IR]1.1. miR-194 and K [IR]1.1. miR-205 suppresses K [IR]4.1 (KCNJ10) in corneal epithelial cells. [score:3]
However, it would have been prudent if the authors had conducted experiments testing the effects of altering the function of voltage-gated Ca [2+] channels while examining the expression of K [IR]4.1 and miR-205 levels. [score:3]
Thus, Lin et al. (2013) suggested that following scratch injury of HCECs, there was down regulation of K [IR]4.1 by miR-205 that caused the cells to depolarize more rapidly, which lead to increased activation of voltage-gated Ca [2+] channels (Lin et al., 2013) increasing the healing process (Figure 2B). [score:2]
Since, down regulation of K [IR]4.1 enhanced cell regrowth, Lin and coworkers hypothesized that miR-205 may modulate K [IR]4.1 in HCECs. [score:2]
The authors tested their hypothesis that miR-205 stimulated wound healing by reducing K [IR]4.1 by examining the effect of barium, a K [+] channel blocker, on HCECs transfected with miR-205 antagomir in the absence and presence of barium. [score:1]
In order to test this, they identified a potential binding region of miR-205 in the 3′UTR of K [IR]4.1. [score:1]
Indeed, they demonstrated that miR-205 agomir stimulated cell migration in wound closure of HCECs, while miR-205 antagomir did not. [score:1]
[1 to 20 of 12 sentences]
36
[+] score: 30
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Top conserved miRNAs in the MaSC/basal population include miR-204 (may target ERα), miR-221/222 (targets ERα and c-Kit) [37, 38], and miR-205 (targets Pten and Bcl-2) [39, 40]. [score:7]
Gregory PA Bert AG Paterson EL Barry SC Tsykin A Farshid G The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat Cell Biol. [score:4]
Verdoodt B Neid M Vogt M Kuhn V Liffers ST Palisaar RJ MicroRNA-205, a novel regulator of the anti-apoptotic protein Bcl2, is downregulated in prostate cancerInt J Oncol. [score:4]
Conversely, miR-146a, miR-221/222, and miR-205, which have been shown to regulate genes expressed in the ductal and alveolar luminal lineages (e. g., Brca1, Gata3, c-kit and Elf5), were restricted to the MaSC/basal population. [score:4]
For example, miR-205 is one the most significantly downregulated miRNAs in human breast cancer relative to normal tissue [22]. [score:4]
In the mouse mammary epithelial cell line, Comma-Dβ [19], the expression of miR-205 and miR-22 but not let-7 and miR-93 was linked to progenitor-like properties, while miR-200c appears to function within the basal cell compartment of normal breast tissue [20]. [score:3]
More specifically, the expression of some miRNAs has been linked to histopathological features such as HER2/ neu or ER/PR status (miR-30), metastasis (miR-126 and miR-335) and the EMT (miR-205 and miR-200 family) [43, 76– 79]. [score:3]
Conversely, we observed derepression of luminal-specific miR-34a, miR-205 and miR-222 in the MaSC/basal subset of Ezh2 -deficient glands (data not shown). [score:1]
[1 to 20 of 8 sentences]
37
[+] score: 29
Specifically, two miRNAs (miR-18a-5p and miR-574-3p) were upregulated in the Mn [2+] -induced NPA mo del, while let-7e-5p was downregulated and miR-205-5p was upregulated in the chlorpromazine -induced NPA mo del. [score:10]
In the lupus-like disease produced by chlorpromazine -induced NPA, let-7e-5p and miR-205-5p were downregulated and upregulated, respectively. [score:9]
Among them, let-7e-5p and miR-205-5p, found only in the mo del produced with chlorpromazine -induced NPA, are known to enhance TLR4 expression (let-7e-5p) [21], provoke ERBB3 downregulation, and decrease apoptosis (miR-205-5p) [47]. [score:6]
The remaining six deregulated miRNAs: let-7e-5p, miR-18a-5p, miR-23b-3p, miR-205-5p, miR-207, and miR-574-3p, which are specific to each of our murine lupus-like mo dels, highlight some differences between them, but also show roles on inflammation and immune disease. [score:4]
[1 to 20 of 4 sentences]
38
[+] score: 29
Although our data did not include the data associated with the correlation between overexpressed miRNAs and clinical prognostic factors due to the limited case number and recurrent cases, the aberrant expression of miR-205 was reported to be correlated with advanced-stage disease and poor patient survival rates in endometrial cancer [15], [20]. [score:7]
To investigate the cellular mechanism for the hypothesis that high miRNA expression is associated with tumor cell progression, we transfected the three miR inhibitors (miR-141*, miR-205, miR-182) into the endometrial cancer cells (Hec1A) to down-regulate miRNA activity. [score:6]
The up-regulated miRNA was miR-200a* miR-205, miR-141*, miR-200b*, miR-141, miR-200b, miR-200a, miR182. [score:4]
Coordinately regulated with the miR-200 family, miR-205 is one of the consistently over-expressed miRNAs in EEC. [score:4]
Among these miRNAs, five were up-regulated in tumor samples where the fold change was more than 5-fold (miR-200a*, miR-205, miR-141*, miR-200b*, miR182). [score:4]
Five miRNA genes (miR-200a*, miR-205, miR-141*, miR-200b*, miR182) were selected because of their notably high differential expression in tumor tissues in the microarray data. [score:3]
We transfected with the five anti-miRNAs (anti-miR-141*, anti-miR-205, anti-miR-182, anti-miR-200a*, anti-miR-200b*) into the Hec1A cells and treated them with IC50 of cisplatin or paclitaxel for 48 hours. [score:1]
[1 to 20 of 7 sentences]
39
[+] score: 29
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
Out of these 25 miRNAs, 18 miRNAs were differentially expressed in a consistent manner between the 2 groups (Figure 4A, highlighted); 8 miRNAs were downregulated in both groups (miR-16, miR-200, miR-205, miR-3064, miR-379, miR-431, miR-485 and miR-491) and 10 miRNAs were upregulated in both groups (miR-194, miR-1894, miR-211, miR-3072, miR- 3077, miR-4436, miR-5128, miR-669a, miR-669c and miR-6967). [score:9]
The study revealed downregulation of miR-205, miR-27, miR-31, and miR-29 in the cbs [+/–] retinas, these miRNAs were also reported to be downregulated in vitreous [68] and plasma of AMD patients [69]. [score:7]
The study revealed downregulation of miR-205, miR-27, miR-31, and miR-29 in the cbs [+/–] retinas. [score:4]
Consistently with the microarray results, miR-205 (p value = 0.001), miR-206 (p value = 0.01) and miR-27 (p value = 0.04) were significantly downregulated in cbs [+/–] compared to control cbs [+/+] (p value < 0.05). [score:3]
Furthermore, the pathway analysis links a group of miRNAs that were differentially expressed in cbs [+/–] retina to oxidative stress pathway such as miR-205, miR-206, miR-217, miR-30, miR-27, miR-214 and miR-3473. [score:3]
Hcy also induces alteration of miRNAs related to tight junctions signaling such as miR-128, miR-132, miR-133, miR-195, miR-3473, miR-19, miR-200, miR-205, miR-214, miR-217, miR-23, miR-26, miR-29, miR-30, miR-31 AND miR-690. [score:1]
Other miRNAs were linked to the hypoxia signaling pathway, for instance, miR-205, miR-214, miR-217, miR-27, miR-29, miR-30 and miR-31. [score:1]
miR-205, miR-27, miR-29 and miR-31 were significantly changed in our cbs [+/–] retina microarray and were also reported to be involved in AMD. [score:1]
[1 to 20 of 8 sentences]
40
[+] score: 28
[21]Out of the nine miRNAs that were screened, four were upregulated (miR-135b, miR-155, miR-205 and miR-206: Figure 1a) and five were downregulated (miR-31, miR-148a, miR-181c, miR-200b and miR-210: Figure 1b). [score:7]
[21] Out of the nine miRNAs that were screened, four were upregulated (miR-135b, miR-155, miR-205 and miR-206: Figure 1a) and five were downregulated (miR-31, miR-148a, miR-181c, miR-200b and miR-210: Figure 1b). [score:7]
Overexpression of miR-155, miR-205 and miR-206 resulted in a complete loss of HC11 dome formation, whereas, overexpression of miR-135b resulted in an increase in HC11 dome formation (Supplementary Figures 1a and b). [score:5]
For example, it is possible that repression of Brca1 in the epithelial compartment of the mammary gland causes upregulation of miR-135b, miR-155 and miR-205 in nonepithelial cells of the mammary gland. [score:4]
In contrast to the analysis of Brca1 -deficient mammary glands (Figure 1a), upregulation of miR-135b, miR-155 and miR-205 was not observed in HC11 cells in which Brca1 levels have been repressed using siRNA (Figure 1c). [score:4]
A role for miR-155, miR-205 and miR-206 in mammary epithelial morphogenesis is consistent with previous studies in other epithelial cell types. [score:1]
[1 to 20 of 6 sentences]
41
[+] score: 28
Down-regulation of miR-144-3p, miR-181b-5p, miR-320a, miR-320c, miR-320d and miR-451a separated melanoma from normal skin; and down-regulation of miR-203, miR-205, miR-211 (and its homologue, miR-204), miR-23b, miR-26a and miR-26 distinguished melanoma from nevus. [score:7]
NS; and miR-203, miR-211-5p (and its homologue miR-204-5p), miR-205-5p, miR-23b-3p, miR-26a-5p and miR-26b-5p were down-regulated in PCM vs. [score:4]
Examining a specific KEGG pathway by down-regulation of miR-203, miR-204-5p, miR-205-5p, miR-211-5p, miR-23b-3p, miR-26a-5p and miR-26b-5p in melanoma highlighted the mitogen-activated protein kinase (MAPK) signaling pathway. [score:4]
NS libraries; and for miR-203, miR-204-5p (and its homologue, miR-211-5p), miR-205-5p, miR-23b-3p, miR-26a-5p and miR-26b-5p down-regulated in PCM vs. [score:4]
For example, miR-205, miR-23b, miR-26a and miR-26b converge on PDGFRA or miR-211 and miR-204 converge on MAPK1, demonstrating a combinatorial effect of miRNAs on the same target. [score:3]
For example, we noted that the most abundant read counts of isomiRs for miR-205, miR-211, miR-15b, miR-26a, miR-203, let-7i, miR-142, miR-150, miR-146a and miR-451a, 6/10 top miRNAs deregulated in the specimens, were not represented as the abundant forms in miRBase (v18). [score:2]
Our previous Sanger sequencing identified 7 of the current top-10 miRNAs: miR-205, miR-211, miR-15b, miR-26a, miR-451a, miR-203 and miR-23b [24]. [score:1]
To elucidate the extent of isomeric differences in melanoma miRNAs, we examined the read counts of isomiRs for miR-205, miR-211, miR-15b, miR-26a, miR-203, let-7i, miR-142, miR-150, miR-146a and miR-451a (Table S7 in file S1). [score:1]
This locus (RP11-372M18.2) corresponded to a now recognized lincRNA (UCSC genome browser AK091113) containing miR-205, corroborating with our top ranking miRNA (Table 2). [score:1]
1 (most abundant isomiR of miR451a), let-7i, miR-203 and miR-205 in two independent cohorts: 1) the very same samples that were sequenced (discovery) and 2) additional, independent specimens (validation, n = 101) (Table S2 in file S1). [score:1]
[1 to 20 of 10 sentences]
42
[+] score: 26
Moreover, overexpression of miR-205 in prostate cancer cells promotes up-regulation of E-cadherin and reduction of cell locomotion and invasion, suggesting a relation with EMT. [score:6]
Target prediction analysis indicates that miR-205 could regulate N-chimaerin, ErbB3, E2F1, E2F5, ZEB2, and protein kinase-C epsilon expression [97]. [score:6]
Up-regulated miRNAs in NSCLC included miR-142-5p, miR-148b, miR-148a, miR-369-3p, miR-215, miR-152 and miR-155, whereas down-regulated miRNAs were miR-373 and miR-138-I. Some of these miRNAs have a well-characterized association with cancer progression, e. g., miR-10b, miR-21, miR-30a, miR-30e, miR-125b, miR-141, miR-200b, miR-200c, and miR-205 [90]. [score:5]
Some studies suggested that miR-205 specifically suppresses the expression of ErbB3 and VEGF-A, which are highly related to metastasis and invasion. [score:5]
Gan dellini and coworkers have suggested that miR-205 is overexpressed in normal prostate tissue and RWPE-1 cells, whereas it is almost undetectable in both androgen -dependent and androgen-independent prostate cancer cells. [score:3]
Apparently, miR-205 interacts with its putative binding site at the 3′-UTR of both genes [96]. [score:1]
[1 to 20 of 6 sentences]
43
[+] score: 26
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-214, hsa-mir-221, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-184, hsa-mir-193a, hsa-mir-1-1, hsa-mir-29c, hsa-mir-133b, dre-mir-205, dre-mir-214, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-mir-1-2, dre-mir-1-1, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-107a, dre-mir-122, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-184-1, dre-mir-193a-1, dre-mir-193a-2, dre-mir-202, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-202, hsa-mir-499a, dre-mir-184-2, dre-mir-499, dre-mir-724, dre-mir-725, dre-mir-107b, dre-mir-2189, hsa-mir-499b, dre-mir-29b3
This network visualization shows that (1) all modules contain at least 2 genes that are predicted targets of a deregulated miRNA identified in this study, except the module “Apoptosis and NAFLD”; (2) dre-miR-2189, the only DE miRNA that was downregulated, targets many genes in modules that are predominantly upregulated such as Cell cycle (4 target mRNAs), Apoptosis and Autophagy (19 targets), Epigenetics and Apoptosis/Autophagy (2 targets) and Receptors (4 targets); (3) certain miRNAs have only 1 target gene in the selected modules, including dre-miR-184 (“Oxidative phosphorylation”), dre-miR-430a and dre-miR-430b (“Apoptosis and Autophagy”); (4) while other miRNAs have common target genes in the same modules, i. e., dre-miR-725/dre-miR-724/dre-miR-193a, dre-miR-202, dre-miR-205 and dre-miR-133a that have several common target genes in modules “Oxidative phosphorylation and NAFLD”, “Apoptosis/Autophagy”, “NAFLD” and “Cell cycle”. [score:26]
[1 to 20 of 1 sentences]
44
[+] score: 26
Also, miR-16 is deleted or down-regulated in Chronic Lymphocytic Leukemia and miR-205 is located in a chromosomal region, which is amplified in lung cancer and is down-regulated in human prostate cancer. [score:7]
Among the miRNAs that were down-regulated between normal and pre-neoplasic cervical samples, but had increased expression in cervical cancer samples, were miR-106a, miR-205, miR-197, miR-16, miR-27a and miR-142-5p. [score:6]
Our data set suggests that miR-16 and miR-205 may have an oncogenic role or at least they seem to promote abnormal cell growth in basal epithelial cells since they are down-regulated in CINI and CINIII compared with normal cervical tissue and are up-regulated in cervical samples. [score:6]
Six miRNAs displayed relative decreased expression in the transition from normal cervix to atypical dysplasia and increased expression in the transition from atypical dysplasia to cervical carcinoma, namely miR-106a, miR-205, miR-197, miR-16, miR-27a and miR-142-5p (Figure 4B). [score:5]
MicroRNA-143 and miR-145 are located in a region, which is deleted in prostate cancer, whereas miR-205 is located in the 12q14.1 region, which is amplified in lung cancer. [score:1]
ERK/MAPK signaling (miR-203), PTEN signaling (miR-27a), VEGF signalling (miR-10a), p53 signaling (miR-205) and apoptosis signalling (miR-512-3p) were found once (Table 2 and table S3). [score:1]
[1 to 20 of 6 sentences]
45
[+] score: 24
At 14 weeks from injection and in the presence of tumor, miR-205-5p was significantly downregulated and miR-214 and miR-574-3p were upregulated. [score:7]
Three of the four miRNAs (miR-205-5p-5p, miR-214, and miR-335-5p) were validated in an independent set of diseased and wild-type mice to be statistically significant (P < 0.05) using a two-sample, two-tailed Student’s t-test comparing the 2 [−ΔCq] values of the two groups MicroRNA-574-3p was not statistically significant in final statistical analysis, but was included in simultaneous studies based on preliminary results (P =  0.15) (Fig. 1). [score:3]
Our studies revealed plasma miR-205-5p was downregulated in GEMM mice with OS compared to wild-type littermate controls, whereas levels of miR-214 and miR-335-5p were significantly higher in GEMM mice. [score:3]
The levels of miR-205-5p, miR-574-3p, and miR-214 were significant from baseline at the time of tumor development (14 week time point). [score:2]
Furthermore, recent evidence suggests that miR-205-5p is highly specific to epithelium, which may explain the results in the DOX experiments which do not show a significant decrease in the disease state compared to baseline likely due to the method of blood sampling. [score:2]
qPCR analysis of miR-205-5p, -574-3p, -214 and -335-5p upon randomization and at time of sacrifice in placebo treated and DOX treated. [score:1]
Therefore, we monitored the levels of miR-205-5p, miR-214, miR-335-5p, and miR-574-3p prior to and serially after transplantation of OS cells. [score:1]
Four miRNAs (miR-205-5p-5p, miR-214, miR-335-5p, and miR-574-3p) were chosen as candidate miRNAs based on reports in published literature, the presence of a conserved known human homologue, and the fold change in the global qPCR analysis. [score:1]
The ΔCq cut-points were 8.34 for miR-205-5p, 10.31 for miR-214, 9.78 for miR-335-5p and 6.08 for miR-574-3p. [score:1]
While our study is the first report of plasma miR-205-5p, miR-214, miR-335-5p, and miR-574-3p to be used as biomarkers, the literature supports that each of these miRNAs may have an important biologic function in OS. [score:1]
Areas under the curve (AUCs) were 0.70 (95% CI 0.576–0.827), 0.80 (95% CI 0.699–0.909), 0.78 (95% CI 0.661–0.898), and 0.88 (95% CI 0.794–0.957) for miR-205-5p, miR-214, miR-335-5p, and miR-574-3p, respectively. [score:1]
As shown in Figure 5A, the areas under the curves (AUCs) were 0.70 (95% CI 0.576–0.827), 0.8 0(95% CI 0.699–0.909), 0.78 (95% CI 0.661–0.898), and 0.88 (95% CI 0.794–0.957) for miR-205-5p, miR-214, miR-335-5p, and miR-574-3p, respectively. [score:1]
[1 to 20 of 12 sentences]
46
[+] score: 23
Emerging evidence demonstrates that miRNAs are critical regulators of lipid synthesis and FAO [81] resulting in defective cell metabolism and carcinogenesis [82] directly targeting key enzymes or transcription factors as oncogenes and tumor suppressors [81] as shown in Table  1. Table 1 miRNAs involved in cancer metabolic plasticity MiRNAs Target Reference miR-122 Cholesterol biosynthesis 88– 90 miR-370 Fatty acid oxidation, CPT1A [91] miR-378/378* Lipid metabolism, CrAT 92, 93 miR-335 Lipid metabolism and adipogenesis [94] miR-205 Lipid metabolism [95] miR-143 Adipocyte differentiation [96] miR-27 Adipolysis [97] miR-33a/b Cholesterol efflux and β-oxidation 98– 100 miR-185 Lipogenesis and cholesterogenesis [101] miR-342 Lipogenesis and cholesterogenesis [101] miR-124 CPT1A [27] miR-129 CACT 27, 102 MiR-122 was the first miRNA identified as tissue-specific, and it is the most abundant in liver involved in lipid metabolic reprogramming [83]. [score:9]
Mir-33a/b and miR-122 target AMPK (activated by metabolic stress) and ACC1/2 respectively, whereas miR-205 targets the acyl-CoA synthetase, indirectly regulating the components of carnitine system. [score:7]
Recently, it has been found that miR-205 deregulates lipid metabolism in hepatocellular carcinoma by targeting acyl-CoA synthetase ACSL1, a lipid metabolism enzyme in liver [95]. [score:4]
Cui M MiR-205 modulates abnormal lipid metabolism of hepatoma cells via targeting acyl-CoA synthetase long-chain family member 1 (ACSL1) mRNABiochem. [score:2]
MiR-143, miR-27, miR-335, miR-14, and miR-205 have been recently associated with lipid metabolism and adipocyte differentiation [91]. [score:1]
[1 to 20 of 5 sentences]
47
[+] score: 23
Second, our studies past and present, have showed the mesenchymal-specific downregulation of miR-200 expression in a panel of OSCC [35] and pancreatic cancer cell lines, respectively, but not miR-205 and miR-655 expression. [score:8]
Recently, the miR-200 family (miR-141, -200a, -200b, -200c, and -429) and miR-205 have been demonstrated as EMT-suppressive miRNAs directly targeting ZEB1 and ZEB2 [17]. [score:6]
Although no correlation between the expression pattern of miR-655 and that of any of these marker genes was found in this panel, these cell lines all showed lower expression of miR-655 than the miR-200 family and miR-205, as compared with a normal pancreas. [score:4]
Although the miR-200 family and miR-205, like miR-655, target ZEB1, their biological functions were found to differ from those of miR-655. [score:3]
First, besides ZEB1, TGFBR2 was characterized as a direct target of miR-655 in our study, but not the miR-200 family and miR-205. [score:2]
[1 to 20 of 5 sentences]
48
[+] score: 22
Luo et al. [313] performed an integrated analysis of miRNAs and mRNA expression profiles in 12 BC cell lines, identifying 35 functional target genes of three significantly down-regulated miRNAs in invasive cell lines (miR-200c, miR-205, and miR-375). [score:8]
Reduced expression of miR-145 and miR-205 was found to play a role in basal like triple negative tumours (ER-/PR-/HER2-) while are normally expressed in normal myoepithelial cells [133]. [score:5]
Wang S, Huang J, Lyu H, Lee CK, Tan J, Wang J, et al. Functional cooperation of miR-125a, miR-125b, and miR-205 in entinostat -induced downregulation of erbB2/erbB3 and apoptosis in breast cancer cells. [score:4]
Gregory PA, Bert AG, Paterson EL, Barry SC, Tsykin A, Farshid G, et al. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. [score:4]
miRNAs with a role in metastasis in BC include miR-7 [138, 139], miR-17/20 [140, 141], miR-22 [142– 144], miR-30 [145, 146], miR-31 [147– 149], miR-126 [150], miR-145 [151], miR-146 [152], miR-193b [153], miR-205 [154], miR-206 [155], miR-335 [156], miR-448 [157], miR-661 [158] and let-7 [159]. [score:1]
[1 to 20 of 5 sentences]
49
[+] score: 21
For example, miRNA-205 increased NPC cells radioresistance by directly targeting PTEN [15], miRNA-221 and miRNA-222 regulated gastric carcinoma cells radioresistance by targeting PTEN [16], downregulation of miRNA-210 expression enhanced radiosensitivity in hypoxic human hepatoma cells [17], overexpression of miRNA-421 lead to a pronounced DSB repair defect and clinical hypersensitivity in SKX squamous cell carcinoma [18], silencing of miRNA-21 increased radiosensitivity through inhibiting a PI3K/AKT pathway and enhancing autophagy in malignant glioma cells [19], and upregulation of NF-κB -dependent miRNA-125b promoted cell survival by targeting p38α upon ultraviolet radiation [20]. [score:21]
[1 to 20 of 1 sentences]
50
[+] score: 20
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
For example, the cluster of miR-512-3p, miR-205, and the miR-302 family illustrated on the heat map demonstrates high expression in undifferentiated ES and early neural progenitor stages, downregulation during the glial restricted and early OP transitions, but then additional high expression during mid to late OP development. [score:9]
Additionally, miR-205 showed a ∼9.2-fold downregulation during the OP3 to OL transition, which contains a conserved 8mer complementary site within the Cldn11 3′-UTR. [score:4]
During the final stage transition, miR-205 showed significant downregulation. [score:4]
As such, the decrease of miR-205 may be partially responsible for the increased expression of Cldn11 at this stage. [score:3]
[1 to 20 of 4 sentences]
51
[+] score: 20
Other miRNAs from this paper: hsa-mir-206, hsa-mir-548i-4
MiR-205 significantly decreased both anchorage -dependent and -independent growth in all three cell lines whereas miR-206 and miR-548i-4 inhibited growth only in the two cell lines with high level of Myc expression, namely MB231 and HepG2 (Figure 3A–3C and Supplementary Figure 2B–2D). [score:5]
Ectopic expression of miR-205 also displayed similar effects (Supplementary Figure 1A–1D). [score:3]
To investigate the potential roles of miR-205, miR-206 and miR-548i-4 on the growth of cell lines with different levels of endogenous Myc expression, we next stably expressed each of the three miRs in MCF-7 and MB231 breast cancer and HepG2 hepatocarcinoma cells (Supplementary Figure 2A). [score:3]
Three miRs, miR-205, miR-206 and miR-548i-4 significantly inhibited all four cell lines by greater than two-fold under conditions of MycER activation (Figure 1C). [score:3]
To study further the effects of miR-205, miR-206 and miR-548i-4 on Myc over -expressing cells, Hela-MycER and HepG2-MycER cells were stably transfected with expression vectors for each miR and the effects of MycER induction on cell growth, anchorage-independent growth and survival were measured. [score:3]
Thus, of the three miRs identified in our initial HeLa-MycER screen, miR-205 and miR-206 demonstrated the most wide-ranging and robust synthetic lethal effect on Myc over -expressing cancer cells. [score:3]
[1 to 20 of 6 sentences]
52
[+] score: 19
Smith et al. [11] demonstrated that miR-143, miR-145, and miR-205 expression levels appear to be elevated in oesophageal squamous mucosa of individuals with ulcerative oesophagitis, while Bus et al. [12] reported that miR-143, miR-145, miR-192, and miR-194 were upregulated in esophageal epithelial cells upon acidic bile salt stimulation. [score:6]
Specifically, Wijnhoven et al. [10] have shown that miR-203 and miR-205 are high in normal squamous epithelium and low in columnar epithelia, while miR-21, miR-143, miR-145, miR-194, and miR-215 are significantly upregulated in columnar tissues compared with normal squamous epithelium. [score:3]
In this study, we hypothesised that miR-143, miR-145, miR-192, miR-194, miR-203, and miR-205 expression might be altered in tongue coating in response to chronic gastroesophageal reflux. [score:3]
To assess differential expression of miRNAs in exfoliated cells of the tongue coating between GERD (n = 24) and Ctrls (n = 24), 6 candidate miRNAs (miR-143, miR-145, miR-192, miR-194, miR-203, and miR-205) were selected. [score:3]
The expressions of miR-143, miR-145, and miR-205 were significantly higher in oesophageal squamous mucosa from subjects with GERD compared to squamous mucosa from subjects without pathological reflux [11]. [score:2]
We evaluated the expression levels of miR-143, miR-145, miR-192, miR-194, miR-203, and miR-205 in exfoliated cells of the tongue coating in patients with GERD and Ctrls across a discovery cohort of 48 specimens. [score:1]
miR-203 and miR-205 are high in normal squamous epithelium and low in columnar epithelia [10]. [score:1]
[1 to 20 of 7 sentences]
53
[+] score: 19
Vosa et al. performed a meta-analysis of 20 published miRNA expression profiling studies in lung cancer and identified a meta-signature of seven up-regulated (mir-21, mir-210, mir-182, mir-31, mir-200b, mir-205, and mir-183) and eight down-regulated (mir-126-3p, mir-30a, mir-30d, mir-486-5p, mir-451a, mir-126-5p, mir-143, and mir-145) miRNAs (Vosa et al., 2013). [score:9]
The mir-200 family and mir-205 function as key negative regulators of the EMT through the direct targeting of ZEB1 and ZEB2 (Gregory et al., 2008; Park et al., 2008). [score:5]
The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. [score:4]
EMT and stem cell-like properties associated with miR-205 and miR-200 epigenetic silencing are early manifestations during carcinogen -induced transformation of human lung epithelial cells. [score:1]
[1 to 20 of 4 sentences]
54
[+] score: 18
We also found seven deregulated miRNAs to target E2F1 transcript, especially emphasizing the importance of miR-203a and miR-205-5p that were strongly down-regulated. [score:7]
miR-205-5p is known to be down-regulated in melanoma and its expression inversely correlated with that of E2F1 [48]. [score:6]
Our microRNA analysis also revealed a consistent deregulation of seven miRNAs in T-LBLs, miR-203a and miR-205-5p being the most representative downregulated microRNAs (Figs. 5 and 6). [score:5]
[1 to 20 of 3 sentences]
55
[+] score: 17
For example, miR-200a and miR-200c were upregulated in all subtypes (mucinous, endometrioid, and clear cells), miR-200b and miR-141 were upregulated in serous as well as endometrioid carcinomas, and miR-21, miR-203, and miR-205 were upregulated only in endometrioid carcinomas. [score:10]
The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. [score:4]
Iorio et al. (2007) showed that 11 miRNAs, including miR-21, miR-203, miR-146b, miR-205, miR-30-5p, and miR-30c as the most significantly induced, are differentially expressed after treatment with the demethylating agent 5-AZA. [score:3]
[1 to 20 of 3 sentences]
56
[+] score: 17
The restoration of miR-205 has been shown to restrain cell viability via targeting MED1, miR-124 targets androgen receptor and inhibits proliferation of prostate cancer cells, miR -23b represses proto-oncogene Src kinase, miR-125a and miR-125b suppress the oncogenes ERBB2 and ERBB3 [14– 17]. [score:9]
Schaefer et al. [8] validated that ten microRNAs (hsa-miR-16, hsa-miR-31, hsa-miR-125b, hsa-miR-145, hsa-miR-149, hsa-miR-181b, hsa-miR-184, hsa-miR-205, hsa-miR-221, hsa-miR-222) were downregulated and five miRNAs (hsa-miR-96, hsa-miR-182, hsa-miR-182, hsa-miR-183, hsa-375) were upregulated in prostate cancer. [score:7]
Hulf T Epigenetic -induced repression of microRNA-205 is associated with MED1 activation and a poorer prognosis in localized prostate cancerOncogene. [score:1]
[1 to 20 of 3 sentences]
57
[+] score: 17
We have previously demonstrated that exogenous over -expression of miRNAs miR-200b/-200c and miR-205 functionally altered TAS cells biologic activities by inducing cytokine production and inhibiting cell migration [8]. [score:5]
Specifically, miR-205 and miR-200 family members (in particular miR-200b and miR-200c) were exclusively expressed by pancreatic cancer epithelial cells, and miR-145 and miR-199 family members (miR-199a and miR-199b) were exclusively expressed by TAS cells [8]. [score:5]
As shown in Figure 2C and 2D, expression of TAS-specific miR-145 was detected by qPCR in PDAC cells co-cultured in inserts with TAS cells, and vice versa, epithelium-specific miR-205 and miR-200b/-200c were also detected in TAS cells. [score:3]
It was also noted that miR-205 expression levels were significantly elevated in MVs and EXOs as compared to the parental PDAC cells (difference = 8.53 ± 2.23, p < 0.001 for PDAC-MVs; and 10.55 ± 2.00, p < 0.001 for PDAC-EXOs). [score:2]
Vice versa, concentrations of the epithelial signature miRNA miR-205 were significantly increased in TAS cells fed with PDAC-MVs and PDAC-EXOs (Figure 4F). [score:1]
Indeed, qPCR detected the presence of PDAC signature miRNAs miR-200b, miR-200c and miR-205 in both MVs and EXOs released from PDAC cell lines. [score:1]
[1 to 20 of 6 sentences]
58
[+] score: 17
The miR-200 gene family (miR-200a, miR-200b, miR-200c, miR-141, and miR-429) and miR-205 encode key regulators of EMT that act by directly targeting zinc finger E-box binding homeobox 1 (ZEB1) and ZEB2, which are transcriptional repressors that downregulate E-cadherin (CDH1; Gregory et al., 2008; Korpal et al., 2008; Park et al., 2008). [score:8]
The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. [score:4]
In normal mammary epithelial cells and fibroblasts, expression of miR-200 family and miR-205 genes is regulated by DNA methylation, histone modifications, or a combination of the two (Vrba et al., 2010), but aberrant DNA methylation leads to the silencing of these miRNAs in cancer (Ceppi et al., 2010; Neves et al., 2010; Wiklund et al., 2011). [score:4]
Coordinated epigenetic repression of the miR-200 family and miR-205 in invasive bladder cancer. [score:1]
[1 to 20 of 4 sentences]
59
[+] score: 16
As mentioned above, these miRNAs such as miR-203, miR-204, miR-205 and miR-217 negatively regulate RUNX2 expression, raising a possibility that miRNA -induced down-regulation of RUNX2 contributes to the suppression of malignant properties of pancreatic cancer cells such as drug resistance (Fig. 4). [score:9]
miRNA profiling studies revealed that miR-205 is down-regulated in GEM-resistant pancreatic cancer cells and metastatic pancreatic cancer tissues [170]. [score:4]
It has been shown that the additional miRNAs (miR-23a, miR-34c, miR-133a, miR-135a, miR-205 and miR-217) also attenuate osteogenesis by targeting RUNX2 [162, 163]. [score:3]
[1 to 20 of 3 sentences]
60
[+] score: 16
Re -expression of miR-205 led to downregulation of EMT and Src activation, and restored EGFR -inhibitor sensitivity, suggesting that miR-205 may serve as a predictive biomarker of response to EGFR inhibition [76]. [score:10]
Park et al. [76] discovered that CRIPTO -mediated (an EGF-CFC protein family member involved in transforming growth factor β signaling) downregulation of miR-205, which leads to EMT and activation of the Src oncogene pathway, is a mechanism for EGFR inhibitor resistance in non-small-cell lung cancer. [score:6]
[1 to 20 of 2 sentences]
61
[+] score: 16
Overall, these results show that the levels of miR-890/miR-891a/miR-891b/miR-892a/miR-892b and miR-205, previously reported to be primarily expressed in reproductive tissues, are present at high levels in the distal region of the epididymis, suggesting a role of these microRNAs in the later stages of epididymal sperm maturation or storage. [score:3]
Furthermore, a mammalian miRNA expression array of 26 distinct organ systems and cell types, showed that miRNAs such as mir-205, and miRNAs belonging to the miR-888 and miR-371 clusters, were significantly enriched in human reproductive systems [41]. [score:3]
miR-205 followed the same pattern of expression as miR-890/miR-891a/miR-891b/miR-892a/miR-892b, with higher levels in the distal regions of the epididymis (Fig. 3 C). [score:3]
mir-205 and members of the miR-888 cluster are differentially expressed in the epididymal tubule. [score:3]
On the basis of small RNA libraries sequenced from 26 distinct organ systems, several miRNAs, including miR-205 and members of the miR-888 and miR-371 clusters, are considered to be expressed primarily in reproductive tissues [41]. [score:2]
0034996.g003 Figure 3 (A) (B) and (C): Dot plots showing the Log 2 signal intensity of miRNAs belonging to the miR-888 and miR-371 cluster families, and miR-205 in the different epididymal regions: caput (cap), corpus (cor) and cauda (cau). [score:1]
Our results indicate that members of the miR-888 cluster (i. e. miR-890/miR-891a/miR-891b/miR-892a/miR-892b) and miR-205 exhibit significantly lower levels in the caput relative to the corpus, while the levels of the miR-371 cluster did not differ (Fig. 3 A, B and C). [score:1]
[1 to 20 of 7 sentences]
62
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-93, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-197, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-194-1, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-372, hsa-mir-374a, hsa-mir-375, hsa-mir-328, hsa-mir-133b, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-486-1, hsa-mir-146b, hsa-mir-494, hsa-mir-503, hsa-mir-574, hsa-mir-628, hsa-mir-630, hsa-mir-449b, hsa-mir-449c, hsa-mir-708, hsa-mir-301b, hsa-mir-1827, hsa-mir-486-2
Along with miR-205, this family inhibits epithelial mesenchymal transition by targeting ZEB1 and ZEB2; in lung cancer miR-200c overexpression causes a reduced expression of ZEB1 and derepression of E-cadherin, the trascriptional target of ZEB1 [136]. [score:11]
Similar results were found by Boeri et al., confirming the role of miR-205 and expressions in discriminating between adenocarcinoma and squamous cell carcinoma [160]. [score:3]
Similarly, Xing L. et al. developed a sputum -based biomarker panel based on three miRNAs (miR-205,0 and miR-708) for the diagnosis of squamous cell lung cancer, yielding a sensitivity of 73% and a specificity of 96% [164]. [score:1]
miR-200 family/miR-205. [score:1]
[1 to 20 of 4 sentences]
63
[+] score: 15
Examples of interesting miRNA-target gene pairs that showed this pattern were: expression of miR-205 was 3.11-fold and its target gene ADAMTS9 expression was 0.87-fold; miR-124 was 3.79-fold and its target gene SUCLG2 was 0.42-fold; and expression of miR-183 was 3.01-fold while its target FOXP1 was 0.76-fold. [score:15]
[1 to 20 of 1 sentences]
64
[+] score: 15
In this subset, deregulated expression was confirmed for all miRNAs except miR-21 and miR-205. [score:4]
Members of mir-200 family, which includes miR-200b, miR-200c and miR-205, are the major regulators of EMT pathway, primarily targeting transcriptional factors ZEB1 and SP1 [45], and play a prognostic role in various malignancies [46]. [score:4]
The trend of expression of four miRNAs (miR-31, miR-221, miR-21, and miR-205) analyzed in the large set of samples was opposite to that derived from the results revealed by arrays. [score:3]
Nevertheless, the analysis of both groups of tested material revealed the deregulation of the known tumor associated miRNAs such as miR-205, miR-210, or miRNAs from the family mir-8, as has been demonstrated in a number of solid tumors [29– 32]. [score:2]
MiR-106b# and miR-9 were selected as specific for HPV -positive tonsillar tumors, miR-16, miR-34a, miR-193b, miR-31, miR-221, and miR-21 as specific for HPV -negative tumors, and miR-155, miR-126, and miR-205 as specific for tonsillar tumors of any etiology. [score:1]
From the group of tonsillar specific miRNAs regardless of the virus presence, we selected miR-205, miR-155, and miR-126 which participate in oncogenic pathways including cell proliferation, migration, or invasion and serve as prognostic predictors of patients with HNC [31, 65, 66]. [score:1]
[1 to 20 of 6 sentences]
65
[+] score: 15
Other miRNAs from this paper: hsa-mir-203a, hsa-mir-146a, hsa-mir-324, hsa-mir-203b
Interestingly, the expression of human miR-205 was more intense and more broadly distributed in disease tissues as compared to healthy tissues (Figure 2, fields 5, 12, 19). [score:4]
Specific probes for mature HPV16-miR-H1 and HPV16-miR-H2, together with a probe for hsa-miR-205 expressed in cervical tissue [30], snRNA U6 positive control probe, and a scramble negative control probe were used. [score:3]
In situ hybridization also showed altered distribution of human miR-205, whose high expression has been reported before in CaSki cells and in cervical cancer tissues [44]. [score:3]
Human miR-205 was used as a positive control for miRNA expressed in cervical epithelium. [score:3]
miR-205 was also recently shown to promote proliferation of human cervical cancer cells [45]. [score:1]
0070202.g002 Figure 2 In situ hybridization for HPV16-miR-H1-1 and HPV16-miR-H2-1. (A) Hematoxylin-eoxin (HE) staining, immunohistochemical staining for p16, and in situ (italics) hybridization for scramble (negative control), U6 (positive control), human miR-205 (positive control for cervical tissue), HPV16-miR-H1-1 (16-miR-H1-1) and HPV16-miR-H2-1 (16-miR-H2-1). [score:1]
[1 to 20 of 6 sentences]
66
[+] score: 15
Other miRNAs from this paper: hsa-mir-31, hsa-mir-34a, hsa-mir-214, hsa-mir-34b, hsa-mir-34c
Bhatnagar N. Li X. Padi S. K. Zhang Q. Tang M. S. Guo B. Downregulation of miR-205 and miR-31 confers resistance to chemotherapy -induced apoptosis in prostate cancer cells Cell Death Dis. [score:4]
By downregulating Bcl-w and E2F6, miR-205 and miR-31 promote chemotherapeutic agents -induced apoptosis in prostate cancer cells. [score:4]
The promoter region of the miR-205 gene was found to be hypermethylated in cell lines derived from advanced prostate cancers, contributing to the downregulation of the gene [146]. [score:4]
Anti-apoptotic genes BCL2L2 and E2F6 are targets of miR-205 and miR-31, respectively. [score:3]
[1 to 20 of 4 sentences]
67
[+] score: 15
It was shown that miR-184 interferes with miR-205 repression of the phosphatidylinositol 3-kinase inhibitor, SHIP2 (Yu et al., 2008, Yu et al., 2010), and inhibits cell migration (Yu et al., 2010). [score:5]
These studies link miR-205 with oncogenic properties and its inhibitor, miR-184, as a tumor suppressor. [score:5]
In contrast, miR-125b and miR-205 were shown to be positive regulators of HFSCs (Wang et al., 2013, Zhang et al., 2011). [score:2]
This is in accordance with the role of miR-205 in SC maintenance (Wang et al., 2013) and with our data that miR-184 represses stemness. [score:1]
It is thus conceivable that some of the functions of miR-184 that are described in the current study are mediated by interference with miR-205. [score:1]
In line, the oncogenic miR-205 (Cai et al., 2013) is counteracted by competition with miR-184 (Yu et al., 2008). [score:1]
[1 to 20 of 6 sentences]
68
[+] score: 15
Differential expression of microRNAs during melanoma progression: miR-200c, miR-205 and miR-211 are downregulated in melanoma and act as tumour suppressors. [score:8]
As expected, most majority of the miRNAs, either upregulated in the cancer tissues, such as miR-223-3p [61], miR-421 [62], miR-424-5p [63], miR-1260b [64] etc, or downregulated in the penile cancer, such as miR-205-5p [65], miR-211-5p [65– 66], miR-365-3p [67] and miR-1247 [68] etc, were entitled the similar roles in carcinogenesis of bladder cancer, retinoblastoma, breast cancer, nasopharyngeal cancer, pancreatic cancer and several other cancer types [61– 68]. [score:7]
[1 to 20 of 2 sentences]
69
[+] score: 15
Other miRNAs from this paper: hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-30a, hsa-mir-32, hsa-mir-33a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-147a, hsa-mir-34a, hsa-mir-187, hsa-mir-204, hsa-mir-200b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-138-2, hsa-mir-142, hsa-mir-144, hsa-mir-125b-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-190a, hsa-mir-200c, hsa-mir-155, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-365b, hsa-mir-328, gga-mir-33-1, gga-mir-125b-2, gga-mir-155, gga-mir-17, gga-mir-148a, gga-mir-138-1, gga-mir-187, gga-mir-32, gga-mir-30d, gga-mir-30b, gga-mir-30a, gga-mir-30c-2, gga-mir-190a, gga-mir-204-2, gga-mir-138-2, gga-let-7d, gga-let-7f, gga-mir-146a, gga-mir-205b, gga-mir-200a, gga-mir-200b, gga-mir-34a, gga-mir-30e, gga-mir-30c-1, gga-mir-205a, gga-mir-204-1, gga-mir-23b, gga-mir-142, hsa-mir-449a, hsa-mir-489, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-33b, hsa-mir-449b, gga-mir-146b, gga-mir-147, gga-mir-489, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-144, gga-mir-460a, hsa-mir-147b, hsa-mir-190b, gga-mir-22, gga-mir-460b, gga-mir-1662, gga-mir-1684a, gga-mir-449c, gga-mir-146c, gga-mir-449b, gga-mir-2954, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, gga-mir-365b, gga-mir-33-2, gga-mir-125b-1, gga-mir-190b, gga-mir-449d, gga-mir-205c
Significant upregulation of miR-146b-5p and its corresponding downregulation of CDK2AP1 were observed in the AS pulmonary arteries in our findings, which is consistent with Zhong et al., who reported that significant upregulation of miR-205 targeted the downregulation of CDK2AP1 in the laryngeal squamous cell carcinoma [43]. [score:15]
[1 to 20 of 1 sentences]
70
[+] score: 15
Among identified ∆Np63α-regulated genes there was also one gene encoding miRNA, miR-205, which is a known target of p63 in bladder [45] and prostate carcinomas [46] and which was shown to be down-regulated in TNBC [47] and suggested to play a tumour suppressor role in TNBC cells [48]. [score:9]
In both cases, TP63 itself was the most highly up-regulated transcript and the identification of many previously reported p63 target genes (S100A2, FGFR3, GPX2, MIR205, KRT5 etc. ) [score:6]
[1 to 20 of 2 sentences]
71
[+] score: 14
Interestingly, a recent study showed that miR-205, downregulated in breast tumors compared with normal breast tissue, directly targets HER3 receptor and inhibits the activation of the downstream mediator Akt [26]. [score:8]
It suggested miR-205 as a new oncosuppressor in breast cancer and can improve the responsiveness to specific anticancer therapies. [score:3]
In this study Iorio et al. found that restoration of miR-205 in breast cancer cells increased the responsiveness to tyrosine kinase inhibitors Gefitinib and Lapatinib, abrogating the HER3 -mediated resistance and restoring a potent proapoptotic activity. [score:3]
[1 to 20 of 3 sentences]
72
[+] score: 14
In response to ionizing radiation (IR), tumor cells downregulate miR-205 expression [242]. [score:6]
Downregulation of miR-205 in response to IR would increase tumor radioresistance due to enhanced DNA repair. [score:4]
Zhang et al. showed that a miRNA, miR-205, represses the expression of Ubc13 and the transcription factor zinc finger E-box binding homeobox1 (ZEB1), which effectively impedes the DDR [241]. [score:3]
Zhang et al. demonstrated the therapeutic potential of miR-205, through nanoliposomal delivery of miR-205 to radioresistant tumor cells and xenograft tumors, which had a significant radiosensitizing effect [241]. [score:1]
[1 to 20 of 4 sentences]
73
[+] score: 14
Other miRNAs from this paper: hsa-mir-125b-1, hsa-mir-125a, hsa-mir-125b-2
Further characterization revealed that entinostat upregulated three erbB2/ erbB3 -targeting miRNAs (miR-125a, miR-125b, and miR-205) which acted in concert to inhibit erbB2/erbB3 translation [97]. [score:8]
Our recent data show that entinostat, a class I HDAC inhibitor selectively downregulates erbB2/erbB3 via induction of specific miRNAs, miR-125a, miR-125b, and miR-205 in erbB2+ breast cancer cells. [score:6]
[1 to 20 of 2 sentences]
74
[+] score: 13
miR-205-5p, a miRNA significantly downregulated in GBM, was found to directly interact with the VEGFA 3′-UTR and decreased VEGFA expression in GBM cell lines [54]. [score:7]
The downregulation of miR-205-5p could be, at least partially, responsible for the overexpression of VEGFA in GBM. [score:6]
[1 to 20 of 2 sentences]
75
[+] score: 13
Dysregulated miRs in breast CAF included upregulation of miR-221, miR-31, and miR-221 with the downregulation of miR205, miR-200b, miR-200c, miR-141, miR-101, miR-342, let-7g and miR-26b affecting all aspects of cell differentiation and paracrine regulation (Zhao et al. 2012). [score:9]
Smad4, however, is targeted by miR-130a, miR-182, miR-205 and miR-483 (Hao et al. 2011, Geraldo et al. 2012, Egawa et al. 2016). [score:3]
Although in the epithelia miR-205 and miR-200 family members (miR-200c, miR-200b and miR-141) are associated with EMT progression, in fibroblastic cells they clearly have a different function. [score:1]
[1 to 20 of 3 sentences]
76
[+] score: 13
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-200c, hsa-mir-200a
Interestingly, we have recently discovered that ΔNp63 directly promotes miR205 expression (M. Tran, manuscript in preparation), providing an explanation for the tight correlation between expression of ΔNp63 and epithelial markers in bladder cancer cell lines and primary tumors. [score:6]
miR-205 and the miR-200 family can maintain the epithelial phenotype by suppressing the expression of mesenchymal transcription factors (Zeb-1 and Sip1) and the introduction of miR-205 and miR-200 into mesenchymal cells can reverse mesenchymal cell morphology to an epithelial phenotype [30]. [score:5]
Several recent studies have shown that EMT and “stem-like” phenotype is regulated by micro RNAs (miR-205 and miR-200 family) [28]– [31]. [score:2]
[1 to 20 of 3 sentences]
77
[+] score: 13
A recent experimental evidence suggests that miR-205 can be considered as a potential breast tumor suppressor gene that directly targets HER3 receptor. [score:5]
MiR-203 and miR-205 are also reported as upregulated in lung cancer [30]. [score:4]
A study regarding miRNA expression in esophageal cancer revealed that miR-203 and miR-205 have changed expression in squamous cell carcinomas and esophageal adenocarcinomas compared with normal squamous epithelium. [score:4]
[1 to 20 of 3 sentences]
78
[+] score: 12
Re -expression of miR200 family members or miR205 only partially reverses the stem cell phenotype, an observation that highlights the complex deregulation that occurs in carcinogenesis. [score:4]
Gregory P. A. Bert A. G. Paterson E. L. Barry S. C. Tsykin A. Farshid G. Vadas M. A. Khew-Goodall Y. Goodall G. J. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat. [score:4]
Lebanony D. Benjamin H. Gilad S. Ezagouri M. Dov A. Ashkenazi K. Gefen N. Izraeli S. Rechavi G. Pass H. Diagnostic assay based on hsa-miR205 expression distinguishes squamous from nonsquamous non-small-cell lung carcinomaJ. [score:2]
Tellez C. S. Juri D. E. Do K. Bernauer A. M. Thomas C. L. Damiani L. A. Tessema M. Leng S. Belinsky S. A. EMT and stem cell-like properties associated with miR205 and miR200 epigenetic silencing are early manifestations during carcinogen -induced transformation of human lung epithelial cellsCancer Res. [score:1]
Exposure of lung epithelial cell cultures to tobacco carcinogens leads to epigenetic silencing of miR200b, miR200c and miR205 and phenotypic epithelial to mesenchymal transition (EMT) [69]. [score:1]
[1 to 20 of 5 sentences]
79
[+] score: 12
Other miRNAs from this paper: hsa-mir-184
It is possible that miR-205, which was also upregulated in K+Y -treated LECs (Supplementary Table  S1), is involved in this regulation because miR-184 inhibits the binding of miR-205 to its target mRNA and prevents the knockdown effect by miR-205, thereby rescuing the production of target mRNAs [50]. [score:12]
[1 to 20 of 1 sentences]
80
[+] score: 12
In contrast, the ViTa algorithm found that more of these miRNAs could potentially target the genome, adding bta-miR-205, bta-miR-26b, bta-let-7 g, bta-miR-34a, bta-miR-144, bta-miR-181b, and bta-miR-147 to the list. [score:3]
Of the differentially regulated miRNAs, 16 (bta-miR-23b-5p, let-7 g, bta-miR-22-5p, bta-miR-1224, bta-miR-144, bta-miR-497, bta-miR-455-3p, bta-miR-154a, bta-miR-369-3p, bta-miR-26b, bta-miR-34a, bta-miR-205, bta-miR-181b, bta-miR-146a, bta-miR-17-5p, and bta-miR-31) have previously been described to play a role in cellular proliferation or apoptosis (Fig.   6b, orange circle). [score:2]
Eleven of the miRNAs are encoded in intergenic regions, including: bta-miR-1281, bta-miR-150, bta-miR-181b, bta-miR-497, bta-miR-144, bta-miR-34a, bta-miR-154a, bta-miR-146b, bta-miR-17-5p, bta-miR-205, and bta-miR-31. [score:1]
The non-clustered miRNAs included: let-7 g, bta-miR-26b, bta-miR-150, bta-miR-34a, bta-miR-146a, bta-miR-147, bta-miR-205, bta-miR-455-3p, bta-miR-1224, bta-miR-1281, and bta-miR-31. [score:1]
Bta-miR-205 was the strongest induced miRNA during persistent infection. [score:1]
Also notable is that five of the detected miRNAs (bta-miR-1281, bta-miR-369-3p, bta-miR-26b, bta-miR-34a, and bta-miR-205) are involved in adipogenesis or other lipid metabolic pathways (Fig.   6b, green circle). [score:1]
As shown in the top portion of Table  3: bta-miR-22-5p, bta-miR-147, bta-miR-1224, bta-miR-144, bta-miR-497, bta-miR-154a, bta-miR-17-5p, bta-miR-205, and bta-miR-31, with fold changes of 2.17, 5.28, 5.69, 23.78, 24.62, 24.05, 40.84, 41.22, and 43.37, respectively. [score:1]
The only chromosomes in the Bos taurus genome that were associated with more than one of the identified miRNAs were: chromosome #8 with bta-miR-23b-5p, bta-miR-31, and bta-miR-455-3p; chromosome #16 with bta-miR-34a, bta-miR-181b, and bta-miR-205; chromosome #19 with bta-miR-22-5p, bta-miR-144, and bta-miR-497; and finally chromosome #21 with bta-miR-154a and bta-miR-369-3p. [score:1]
Nine of the miRNAs (bta-miR-26b, bta-miR-34a, bta-miR-205, bta-miR-181b, bta-miR-146a, bta-miR-17-5p, bta-miR-31, bta-miR-150, and bta-miR-147), have been ascribed immune modulatory functions (Fig.   6b, blue circle). [score:1]
[1 to 20 of 9 sentences]
81
[+] score: 12
Furthermore, microRNAs that promote epithelial differentiation by targeting the EMT TFs ZEB1/2 (members of the miR-200 family [29, 30] and miR-205 [31]) were all downregulated in OTBCs (Figure 5d). [score:6]
Levels of miRNA expression in OTBCs of miR-141, miR-200a, miR-200b, miR-200c, and miR-205 were normalized to those of the parental lines (p86 and p48). [score:3]
Compared with their parental lines, OTBCs upregulated the EMT TFs SNAIL, TWIST, and ZEB1/2 as well as microRNAs associated with EMT, such as miR-200s family members and miR-205. [score:3]
[1 to 20 of 3 sentences]
82
[+] score: 12
This analysis revealed that only three miRNA/MRE pairs were predicted by all five algorithms (Table S1): Two MREs, predicted to be targeted by miR-29b and miR-205, have already been shown to regulate VEGFA expression [42], [45], [46], [51]; the third MRE, predicted to be regulated by miR-361-5p, is located in the downstream conserved region. [score:7]
In normal skin samples, the average expression levels of miR-20b (∼62-fold down) and miR-205 (∼51-fold up) strongly deviated from that of the reference RNA (RNU6B), while for all other miRNAs the difference stayed within an order of magnitude (Figure S4A). [score:3]
Next, we measured the expression of miR-361-5p and the known VEGFA -regulating miRNAs miR-20b, miR-34a, miR-93, miR-126 and miR-205. [score:2]
[1 to 20 of 3 sentences]
83
[+] score: 12
Expression of DCN and COL1A2 (upregulated in ASC compared with NTERA-2 cells) was also inversely correlated with expression of the miRNAs with target seed sequences for those genes miR-96, miR-182, miR-205 (DCN) and miR-96 and miR-367 (COL1A2) (downregulated in ASC relative to NTERA-2 cells) (Figure 5). [score:12]
[1 to 20 of 1 sentences]
84
[+] score: 12
From the top downregulated miRNAs, miR205 has been reported as a negative regulator of E-cadherin levels, promoting, through Snail upregulation, a more proliferative and invasive phenotype [32] and silencing of miR-19 has been described to reverse EMT in lung cancer by suppressing E-cadherin [33]. [score:10]
miRNA arrays performed on MDA-231 treated with Hum Hep/NPC derived exosomes showed significant changes in the levels of a select number of miRNAs involved in epithelial cell differentiation and miRNAs, such as miR186, miR23a and miR205, from our top and bottom bins have previously been reported to regulate E-cadherin transcription and MErT induction in various cancer types. [score:2]
[1 to 20 of 2 sentences]
85
[+] score: 12
In addition to miR-205 reported to express constitutively in mouse corneal, limbal and conjunctival basal epithelia [16], we also observed similar expressions of ocular-specific hsa-miR-182 and 204 in LPC and CC samples (Fig. S3). [score:5]
MiR-184 may participate in the terminal differentiation of corneal epithelia and antagonize with miR-205, which down-regulates SH2-containing inositol phosphatase-2 in regulating epithelial cell proliferation [17]. [score:5]
For microRNA profiling using microarray investigation, we studied 4 pairs of LPC and CC samples showing similar miR-205 expression levels (Fig. 1C). [score:1]
In contrast, miR-205 and 217 are present in corneal, limbal and conjunctival epithelia, and epidermis. [score:1]
[1 to 20 of 4 sentences]
86
[+] score: 12
The aims of the present study were to: 1) perform a systematic investigation of the expression of ten candidate miRNAs (miR-22, miR-24, miR-31, miR-106a, miR-125b, miR-137, miR-205, miR-214, miR-221, miR-410) in human HF samples; 2) correlate these data with corresponding HF mRNA expression levels; and 3) test the identified target genes for enrichment in pathways and protein networks in order to delineate regulatory interactions in the human HF. [score:6]
Moreover, no significant correlation was found with mRNA expression for miR-22, miR-125b, or miR-205. [score:3]
The strongest mean log [2] expression (log [2]_value) was found for miR-205 (log [2]_value = 3.73 ± 0.01), and miR-24 (log [2]_value = 3.69 ± 0.03). [score:3]
[1 to 20 of 3 sentences]
87
[+] score: 11
It has been found that, in chronic gastritis, the expression of miR-1 and miR-155 is upregulated, whereas the expression of miR-20, miR-26b, miR-202, miR-203, and miR-205 is downregulated. [score:11]
[1 to 20 of 1 sentences]
88
[+] score: 11
They went on to show that MALAT1 expression was reciprocally correlated with miR-205, a tumor suppressing miR that is downregulated in RCC. [score:8]
Hirata et al. looked at lncRNA MALAT1 in RCC with a specific focus on its transcriptional regulation and its interactions with Ezh2 and miR-205 (Table 1 and Figure 1). [score:2]
Hirata H. Hinoda Y. Shahryari V. Deng G. Nakajima K. Tabatabai Z. L. Ishii N. Dahiya R. Long Noncoding RNA MALAT1 Promotes Aggressive Renal Cell Carcinoma through EZH2 and Interacts with miR-205 Cancer Res. [score:1]
[1 to 20 of 3 sentences]
89
[+] score: 11
Other miRNAs from this paper: hsa-mir-200c
miR-205 is known to inhibit HER3 expression through interaction with HER3 mRNA [43]. [score:5]
We also monitored microRNA-205 (miR-205) expression in ECM1 -expressing cells (Additional file 4: Figure S3C). [score:5]
However, we found no evidence that ECM1 affected miR-205 levels. [score:1]
[1 to 20 of 3 sentences]
90
[+] score: 11
Direct targets of miR-200c and miR-205 were reported to be the transcription factors ZEB1 and ZEB2 that regulate the epithelial-mesenchymal transition [16, 17]. [score:5]
Gregory P. A. Bert A. G. Paterson E. L. Barry S. C. Tsykin A. Farshid G. Vadas M. A. Khew-Goodall Y. Goodall G. J. The mir-200 family and mir-205 regulate epithelial to mesenchymal transition by targeting zeb1 and sip1Nat. [score:4]
The miR-200 family including hsa-miR-200c, hsa-miR-205 and hsa-miR-141 emerged as the most significantly reduced miRNAs (p < 0.001). [score:1]
The relative miRNA amounts were determined by RT-qPCR using TaqMan probes, including miR-200c, miR-205, miR-141, as well as miR 30b and miR-34b (Figure 1B). [score:1]
[1 to 20 of 4 sentences]
91
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
LRRK2 is downregulated by miR-205, and pathogenic mutations in the LRRK2 disrupts the critical signaling mechanism of let-7 and miRNA-184, which causes the deregulation of transcription factor E2F1/DP and cell survival is hampered (Gehrke et al., 2010; Cho et al., 2014). [score:6]
MicroRNA-205 regulates the expression of Parkinson’s disease-related leucine-rich repeat kinase 2 protein. [score:5]
[1 to 20 of 2 sentences]
92
[+] score: 11
Xu Y Brenn T Brown ER Doherty V Melton DW Differential expression of microRNAs during melanoma progression: miR-200c, miR-205 and miR-211 are downregulated in melanoma and act as tumour suppressorsBr J Cancer. [score:8]
Differential expression of four miRNAs (miR-205, miR-23b, miR-146a, and miR-155) distinguishes melanoma cell lines from nevi and primary or metastatic melanoma [19]. [score:3]
[1 to 20 of 2 sentences]
93
[+] score: 11
Moreover, miR-205-5p and members of the miR-200 family target epithelial-mesenchymal transition regulators (ZEB1 and SIP1), apparently being important in tumor progression [57]. [score:4]
Supporting our findings, Tsukamoto and colleagues found correlation between the changes in the expression of a group of endometroid endometrial carcinoma (EEC) -associated (including miR-205) in both tissue and plasma [42]. [score:3]
Importantly, we also found increased expression of miR-205 in HNSCC tumor tissue as compared to healthy tissue from the same patients in a different cohort (unpublished data). [score:2]
Similarly, the relative expression of miR-205-5p was significantly higher in both non-small cell lung carcinoma tissue (compared with cancer-adjacent paired specimens) and serum (compared with serum from benign pulmonary condition patients and healthy volunteers) [55]. [score:1]
As evidenced in Figures 4 and 5, the interaction network approach underscores the key role of let-7a/f, miR-26a/b, miR-103, miR-107, miR-205, and miR-320a/b among others. [score:1]
[1 to 20 of 5 sentences]
94
[+] score: 11
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-141, hsa-mir-200c, hsa-mir-200a, hsa-mir-429
It was also noted that MCAS cells showed predominant overexpression of miR200c, miR141 and miR205 when compared with other cell lines (Figure 4A), which might maintain the expression of E-cadherin and concomitant suppression of TGFβ signaling in a tightly regulated network that includes several negative feedback loops [47], a perturbation in the E-cadherin mRNA expression in the knockdown experiment might result in large MCAS spheroids in Matrigel (Figure 5B). [score:10]
In contrast to these three miRNAs, the patterns shown by miR200c, miR141, and to a lesser extent by miR205, are obviously different. [score:1]
[1 to 20 of 2 sentences]
95
[+] score: 10
In human melanoma cell lines A2058, Mewo, and canine melanoma LMeC cells as well as malignant melanoma tissues the miR-145, miR-203, and miR-205 expression was reported to be downregulated. [score:6]
The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. [score:4]
[1 to 20 of 2 sentences]
96
[+] score: 10
For instance, miR-205 is downregulated in radioresistant subpopulations of breast cancer cells. [score:4]
Zhang P. Wang L. Rodriguez-Aguayo C. Yuan Y. Debeb B. G. Chen D. Sun Y. You M. J. Liu Y. Dean D. C. miR-205 acts as a tumour radiosensitizer by targeting ZEB1 and UBC13 Nat. [score:3]
Because of a positive correlation between miR-205 expression and radiosensitivity, therapeutic delivery of miR-205 mimics via nanoliposomes in a xenograft mo delsensitized the tumor to radiation [40]. [score:3]
[1 to 20 of 3 sentences]
97
[+] score: 10
If GEM suppresses miR-205 function in MIA PaCa-2 cells, HER2 protein translation might be enhanced, leading to the up-regulation of the HER2 protein. [score:8]
In breast cancer, miR-205 down regulates HER2 [27]. [score:2]
[1 to 20 of 2 sentences]
98
[+] score: 9
Some miRNAs were collected to understand the isomiR expression in LUSC, including down-regulated miRNAs (miR-451 and miR-30a) and up-regulated miRNAs (miR-205, miR-210, miR-183, and miR-9). [score:9]
[1 to 20 of 1 sentences]
99
[+] score: 9
In identifying novel approach targeting of erbB3, we discovered that the class I histone deacetylase (HDAC) inhibitor entinostat specifically increased miR-125a, miR-125b, and miR-205, which acted in concert to inhibit erbB3, and subsequently induced apoptosis in erbB2 -overexpressing breast cancer cells [19, 20]. [score:9]
[1 to 20 of 1 sentences]
100
[+] score: 9
In MDA-MB-231 cells expressing the OVOLs, we used to assess expression of miR-200 family members (miR-200a, miR-200b, miR-200c, miR-141, miR-429, miR205, miR-203), relative to controls miR-U6 and miR16. [score:5]
We observed significant upregulation of miR-203 and miR-205 in epithelial cells (Figure 6F). [score:4]
[1 to 20 of 2 sentences]