sort by

108 publications mentioning dme-bantam (showing top 100)

Open access articles that are associated with the species Drosophila melanogaster and mention the gene name bantam. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 256
When bantam was over expressed by Mz1369-Gal4, omb expression was greatly decreased or totally abolished in most lamina and medulla glial cells (Figure 5B, 5D), showing that bantam regulates omb expression. [score:8]
bantam regulates proliferation of glial cells through omb omb is known to be expressed in glial cells and is important for axonal projections [32] and since bantam and omb are expressed in glial cells, we wondered if bantam regulates omb in this developmental context. [score:8]
omb is known to be expressed in glial cells and is important for axonal projections [32] and since bantam and omb are expressed in glial cells, we wondered if bantam regulates omb in this developmental context. [score:7]
Other fly strains used include a bantam sensor that contains tub-EGFP with two copies of the bantam target sequence cloned in the 3′UTR [9], and omb-lacZ [57] for detecting the expression of omb. [score:5]
By examining bantam sensor expression in the third instar larval visual system, we found that bantam is expressed differentially in the third larval optic lobe. [score:5]
bantam sensors displayed low expression levels in the neuroepithelial cells of the OPC (white arrows in Figure 1C,1F, 1I), cells at the GPC areas (yellow solid arrows in Figure 1F, 1I, 1J, 1M), and also in the mature glial cells (asterisks in Figure 1C, 1E), which indicates high bantam expression levels in those cells (Figure 1). [score:5]
We asked whether expression of omb is capable of rescuing the glial cell phenotype caused by bantam over expression. [score:5]
Because bantam is highly expressed in these regions, and is also important for proliferation, we reasoned that expression level changes of the genes affecting proliferation in these regions might affect the pool of neural stem cells. [score:5]
The next question we asked was whether the regulation of glial cells by bantam is dependent on the down-regulation of omb. [score:5]
The ability of bantam to promote cell proliferation in various tissues suggests that bantam might target molecules that directly, but negatively, affect cell-cycle machinery. [score:4]
bantam is a conserved miRNA originally discovered in Drosophila that is expressed in a spatio-temporally restricted manner throughout development [9], [10]. [score:4]
In the central nervous system (CNS), bantam targets clock, a core circadian clock gene that regulates circadian rhythms [16]. [score:4]
To study the function of bantam in the development of the visual system, we first examined bantam expression patterns in the optic lobe of third instar larval brains. [score:4]
We found that bantam is highly expressed in the OPC, GPC areas, and glial cells in the optic lobe, where cells are mitotically active. [score:3]
First, bantam shows high expression in the OPC and GPC areas in the optic lobe, where stem cells are located. [score:3]
In bantam null mutants and in animals over -expressing bantam in the visual system, we did not see much change in the number of R cells (Figure 3H, 3G), but an altered R axon projection was observed. [score:3]
Given that miRNAs are abundantly expressed in the brain, including bantam, the question arises what role bantam plays in the function of the Drosophila brain. [score:3]
In the Drosophila nervous system, bantam inhibits polyQ- and tau -induced neurodegeneration [14], [15]. [score:3]
However, our results demonstrated that glial cell defects by bantam are cell-autonomous, as neuronal over expression of bantam did not show any affect on glial cells. [score:3]
bantam is highly expressed in mitotically active cells in the optic lobe bantam has been previously shown to function in cell proliferation in the wing and eye disc [9], [21], which suggests it may play a broader role in proliferation. [score:3]
Future experiments to determine bantam's target genes responsible for glial cell migration will be of interest. [score:3]
Glial cell expression of bantam is crucial for glial cell proliferation and distribution. [score:3]
In addition, when bantam was over expressed by Mz1369-Gal4 (Figure 3F, 3F′), we found similarly disrupted R axon projection patterns like those observed in ban [Δ1]/ban [Δ1] larval brains, even though Mz1369-Gal4> ban brains showed a bigger size (compare Figure 3F, 3H). [score:3]
Similarly, disrupted R axon projection patterns were also seen when bantam was over expressed with a different optic-lobe driver, omb-Gal4 (Figure 3I, 3I′). [score:3]
But when bantam was over expressed by eyeless-Gal4 (Figure 3C, 3C′), we observed that R axon projection patterns appeared like wild type, although an overgrowth of eye discs was present. [score:3]
bantam is highly expressed in mitotically active cells in the optic lobe. [score:3]
Glial cell numbers in the optic lobe were greatly increased, in a cell-autonomous manner, by an over expression of bantam. [score:3]
bantam is over expressed in the optic lobe by omb-Gal4. [score:3]
These are designed with two copies of a perfect target sequence, in this case bantam binding sites, introduced in the 3′UTR of a green fluorescent protein (GFP) construct. [score:3]
If bantam is expressed in cells containing this sensor, then the perfect binding of the miRNA to the 3′UTR will result in degradation of the GFP mRNA and consequently the intensity of GFP. [score:3]
On the other hand, bantam over expression causes brain size to increase, along with increased proliferation in the OPC and GPC. [score:3]
This indicates that bantam expression levels are low in those cells. [score:3]
This construct is therefore used as the negative indicator of bantam expression levels [9]. [score:3]
When bantam was over expressed, the distribution of mature glial cells was disturbed, in that the three lamina glia layers were not clearly distinguishable, and less glial cells were present around the lamina plexus (Figure 4G). [score:3]
When bantam was over expressed in the optic lobe by the Mz1369-Gal4 driver, the crescent shape of the R axon projection pattern was disrupted (Figure 3G, 3G′). [score:3]
Recently, a report showed that bantam targets Mei-P26, which has ubiquitin ligase activity, causing the oncogene c-Myc to degrade in the wing imaginal disc [39]. [score:3]
To test this hypothesis, we first examined the brain size of the wild type, bantam null mutant, and over-expressed bantam. [score:3]
By targeting the pro-apoptotic gene head involution defective [9], bantam plays a role in modulating ionizing radiation -induced apoptosis [11]. [score:3]
When bantam was over expressed by elav-Gal4 (Figure 4J, 4J′), the brain remained wild-type size, and there was a normal glial cell distribution observed along with a wild-type R axon projection pattern. [score:3]
We did not see much change in the proliferation patterns in the optic lobes of bantam null mutants or in animals over expressing bantam, but did notice that the size of the GPC region was greatly affected by changes of bantam levels (Figure 2G). [score:3]
When bantam was over expressed, the three-layer organization of glial cells was disturbed. [score:3]
The following UAS reporters were used: UAS-omb [32], UAS-CD8-GFP was used to label only the membrane [54], GS-bantam, which contains an insertion of the Gene Search UAS element upstream near the bantam gene, allowing bantam to be over expressed by Gal4 [55], and UAS-ban (obtained from I. Edery, Rutgers University), which contains about 300 bp of the bantam gene [56] in the pUAST vector. [score:3]
Because Mz1369-Gal4 and omb-Gal4 are expressed both in neurons and glial cells, we cannot tell which type of cells bantam is acting in to cause the change in glial cell numbers and distribution. [score:3]
When bantam was over expressed by repo-Gal4 (Figure 4I, 4I′), brains were slightly larger because of a dramatic increase in the number of glial cells. [score:3]
The bantam sensor showed high expression in differentiated neurons in the optic lobe, and in the photoreceptor neuron cells in the eye discs (Figure 1C, 1J). [score:3]
0032910.g001 Figure 1 bantam is differentially expressed within the optic lobe. [score:3]
Figure S2 Over expression of bantam causes ectopic glial cells in the lamina. [score:3]
However, when bantam was over expressed by Mz1369-Gal4, there were many glial cells present under the lamina furrow (Figure 4H). [score:3]
We first examined the R axon projection patterns in the optic lobe by modulating bantam expression. [score:3]
bantam is differentially expressed within the optic lobe. [score:3]
In this paper, we report the detailed expression pattern of bantam in the optic lobe of the third instar larval brain, and show that it is required for maintaining stem cell pools in the OPC and GPC regions of the optic lobe. [score:3]
These results indicate that regulation of omb by bantam is important in maintaining glial cell number and distribution in the optic lobe. [score:2]
bantam down regulates omb in the optic lobe. [score:2]
Further work has showed that bantam plays important roles in many different processes and functions during development. [score:2]
To determine where bantam acts to cause this phenotype, we compared the R axon projection patterns when different Gal4 drivers were used to over express bantam. [score:2]
0032910.g005 Figure 5 bantam down regulates omb in the optic lobe. [score:2]
When bantam was over expressed in the optic lobe (Figure 2F), a dramatic increase of in the GPC region was increased (Figure 2G, p-value<0.0001), compared to the wild type. [score:2]
When bantam was over expressed in the optic lobe by the Mz1369-Gal4 driver (Figure 2C), a bigger brain was observed compared to wild-type brains. [score:2]
bantam regulates proliferation of glial cells through omb. [score:2]
When bantam was over expressed (Figure 4B), the total glial cell number significantly increased (Figure 4D, p-value<0.0016) compared to the wild type. [score:2]
In the peripheral nervous system (PNS), bantam functions in epithelial cells to non-autonomously regulate scaling growth of class IV dendrites of dendrite arbor (da) sensory neurons [17]. [score:2]
When bantam was over expressed by ombC-Gal4 (Figure 6B, 6B′), the number of glial cells significantly increased (Figure 6E, p-value<0.0005) compared to the wild type. [score:2]
In terms of glial cell distribution, about 66% of brains (n = 15) had almost wild-type like glial cell distribution (Figure 6C), and about 34% of brains (n = 15) had a partially rescuing effect (Figure 6D), showing that less ectopic glial cells were present in the lamina compared to when bantam was expressed alone (Figure 6B). [score:2]
In our work, we also provided evidence that bantam's function on glial cell numbers is dependent on its negative regulation of omb in a small subgroup of differentiated glial cells, as evidenced by the ability of omb to rescue bantam's effect on glial cell numbers and distribution (Figure 6C, 6D). [score:2]
All of these findings indicate that bantam is important for regulation of glial cell number and organization in the optic lobe. [score:2]
The function of bantam on glial cells is largely dependent on its down regulation of the T-box transcription factor, omb. [score:2]
Future experiments studying whether bantam employs this same mechanism in regulating the cell cycle of stem cells in the optic lobe will be informative. [score:2]
All these results indicate that bantam is required for cell proliferation in the OPC and GPC regions of the optic lobe. [score:1]
Previous studies also found low bantam levels in the photoreceptor neurons [28]. [score:1]
0032910.g004 Figure 4 bantam promotes glial cell proliferation in the optic lobe. [score:1]
bantam promotes glial cell proliferation in the optic lobe. [score:1]
In the adult ovary, bantam is required for germline stem cell (GSC) maintenance [12], [13]. [score:1]
bantam is required for proliferation in the optic lobe. [score:1]
With antibody staining for Repo, we did not see any obvious defects in larvae caused by bantam, further supporting the idea that bantam increases glial cell numbers independent of Gcm-Repo. [score:1]
ban [Δ1] is a null allele resulting from a bantam gene deletion [10]. [score:1]
Besides promoting glial cell numbers, bantam also affects the mobility of glial cells, as we observed an increase in glial cells located under the lamina furrow, the migrating path for glial cells. [score:1]
This led us reason that bantam might be critical in those cells for cell proliferation in the developing brain. [score:1]
bantam acts in the brain for proper R axon projection patterns. [score:1]
Second, bantam is critical for cell proliferation in the OPC and GPC areas. [score:1]
bantam has been previously shown to function in cell proliferation in the wing and eye disc [9], [21], which suggests it may play a broader role in proliferation. [score:1]
We also checked the effect of bantam on glial cell distribution. [score:1]
0032910.g003 Figure 3 bantam affects photoreceptor-neuron axon projection in the optic lobe. [score:1]
bantam has been known to promote cell proliferation in other tissues as well [4], [9]. [score:1]
Figure S1 bantam causes abnormal distribution of glia cells with increased numbers in the optic lobe. [score:1]
bantam acts in the brain for proper R axon projection patternsThe OPC and GPC regions are sources of progenitor cells for neurons and glial cells for the optic lobe. [score:1]
0032910.g006 Figure 6 omb rescues bantam. [score:1]
bantam acts in glial cells but not in neurons. [score:1]
Together, this indicates that bantam is acting in glial cells to autonomously affect glial cell number and distribution, and cannot reactivate post-mitotic cells. [score:1]
0032910.g002 Figure 2 bantam is required for proliferation in the optic lobe. [score:1]
Our results also showed that bantam autonomously affects glial cell number and distribution, and non-autonomously affects photoreceptor axon projection patterns. [score:1]
Conversely, a loss of bantam led to a dramatic decrease in glial cells in the optic lobe. [score:1]
We think bantam does not affect glial cell differentiation because the loss of bantam in null mutants still maintains Repo -positive differentiated glial cells. [score:1]
This indicates that bantam is acting in the optic lobe but not in R neurons for the correct R axon projection. [score:1]
To exam whether bantam affects glial cell numbers in the optic lobe, we quantified the total glial cells present, except for the surface glia in the optic lobe. [score:1]
Figure S3 bantam causes ectopic glial cell clusters in the lamina. [score:1]
bantam acts in glial cells but not in neuronsIn the developing optic lobe, R axons and glial cells affect each other in order to maintain the integrity of the visual system. [score:1]
We examined the possible role of bantam in the Drosophila visual system, which is composed of a pair of compound eyes and the optic ganglia. [score:1]
bantam is required for proliferation in the optic lobe bantam has been reported to promote growth in the wing and eye tissues [9], [21]. [score:1]
bantam has been reported to promote growth in the wing and eye tissues [9], [21]. [score:1]
Our results provide evidence that bantam is important for stem cell maintenance in the optic lobe. [score:1]
bantam affects photoreceptor-neuron axon projection in the optic lobe. [score:1]
bantam was found to increase proliferation of both glia precursor cells (Figure 2F) and differentiated glia (Figure 6B). [score:1]
It will be interesting to learn how bantam affects the cell cycle machinery of stem cells in the OPC and GPC regions. [score:1]
In our work, we also found that bantam is required for glial cell growth in the optic lobe. [score:1]
omb rescues bantam. [score:1]
bantam was reported to be important for germline stem cell (GSC) maintenance in adult Drosophila [12], [13], but the detailed underlying mechanism remains to be determined. [score:1]
Because these last two bantam lines yielded similar results, we used either in this work. [score:1]
These results indicate that bantam is required for maintaining the correct R axon projection patterns. [score:1]
[1 to 20 of 108 sentences]
2
[+] score: 236
To assess the impact of increased target expression in the type II lineage, we used Elav-Gal4 to express UAS -RNAi transgenes to lower their expression in the bantam mutant MARCM clones. [score:9]
As an independent test for bantam activity, we made use of a sensor transgene that reports bantam activity through downregulation of a ubiquitously expressed GFP transcript containing bantam target sites in its 3′ UTR (Brennecke et al., 2003). [score:8]
Bantam regulates prospero, brat and numbComputational target prediction programs have not identified known regulators of neuroblast lineages as potential targets of bantam (e. g. www. [score:7]
Reciprocally, overexpression of bantam in neuroblasts with insc- Gal4 driving a UAS-bantam transgene reduced the level of target gene expression to about half that of normal (Fig.  S7). [score:7]
Computational target prediction programs have not identified known regulators of neuroblast lineages as potential targets of bantam (e. g. www. [score:6]
Selectively depleting individual targets in bantam mutant clones allows a direct test of whether their elevated expression contributes to the mutant phenotype. [score:6]
The effects of the bantam mutant, mediated via misregulation of prospero are consistent with an earlier report showing that Prospero overexpression can suppress INP proliferation (Bayraktar et al., 2010). [score:6]
Bantam promotes cell growth and proliferation by limiting expression of negative growth regulators, as well as limiting apoptosis by repressing Hid expression (Brennecke et al., 2003; Herranz et al., 2012a, b). [score:5]
To allow for the possibility of target sites with atypical features, including GU base pairing to the miRNA seed sequence, we scanned the known regulators of type II lineage development using RNAHybrid (Rehmsmeier et al., 2004) and found potential sites for bantam in the prospero, brat and numb transcripts (Fig.  4A). [score:5]
Projection of a series of optical sections showed that bantam-lacZ was expressed in all Dpn [+] cells (Fig.  1A), indicating that bantam is expressed in the neuronal progenitor cells of the larval central brain. [score:5]
To isolate the effect of type II lineage reduction, we used the wor-Gal4, ase-Gal80 combination to direct expression of a bantam sponge in the type II lineage. [score:4]
bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. [score:4]
They provide evidence that upregulation of brat contributes to the growth defect in bantam mutant neuroblasts. [score:4]
Similarly, they provide evidence that upregulation of prospero contributes to the reduced proliferation of bantam mutant clones, consistent with the later role of Prospero to limit neuroblast proliferation and to promote differentiation (Li and Vaessin, 2000; Choksi et al., 2006). [score:4]
The effect of bantam on regulation of prospero expression appears to be direct, based on comparing intact and mutant versions of the prospero 3′ UTR in luciferase reporter assays (Fig.  S9). [score:4]
Evidence for a role of a third bantam target, the Notch pathway regulator numb, is equivocal. [score:4]
The increase in prospero transcript was larger in the bantam mutant, and we observed a change in Prospero protein expression in the mutant INP cells. [score:3]
bantam is expressed in neural progenitors of the larval CNS. [score:3]
There was no significant difference in the average size of bantam mutant clones with or without Diap1 expression (Fig.  S3). [score:3]
Our findings provide evidence that bantam miRNA limits premature Prospero expression in the type II lineage. [score:3]
Labeling as in panel B. Note the higher level of sensor (green) in the neuroblast and INPs due to loss of bantam -mediated repression of GFP expression. [score:3]
Fig. 4. Bantam targets multiple regulators of type II lineage progression. [score:3]
Progeny were identified as cells in the clones expressing Eyeless, but not Deadpan (n=12 control clones and 17 bantam mutant clones; P<0.0001, Mann–Whitney test). [score:3]
bantam-lacZ was also expressed in the Dpn [+] cells in the optic lobes, albeit at lower levels (Fig.  S1). [score:3]
Fig. 1. bantam expression in larval brain neuroblasts. [score:3]
To determine whether the reduced number of mutant INPs was due to increased cell death, we expressed UAS-Diap1 to block apoptosis in the bantam mutant MARCM clones. [score:3]
We observed potential target sites for both the bantam-5p and bantam-3p miRNAs in the 3′ UTR of prospero and in both coding and 3′ UTR exons of brat (Fig.  4B). [score:3]
Arrows indicate INPs in the bantam [Δ1/Δ1] mutant clone expressing Dpn and nuclear Prospero. [score:3]
The pattern of bantam activity revealed by the bantam GFP sensor was consistent with the expression reported by the bantam-lacZ transgene. [score:3]
Increased INP proliferation probably contributes to suppression of the bantam mutant phenotype. [score:3]
We identify brat and prospero as functionally significant targets through which bantam controls type II neural progenitor growth and proliferation in the Drosophila brain. [score:3]
Together, these observations indicate that bantam is expressed in the proliferating neuroblast and INP cells of the type II lineage. [score:3]
Premature Prospero expression in the bantam mutant probably contributes to the reduction of INP numbers. [score:3]
High levels of bantam-lacZ were observed in large superficial cells that expressed the transcription factor Deadpan (Dpn), a neuroblast marker. [score:3]
In mature third instar larvae, bantam-lacZ expression was detected in the central brain, optic lobes and ventral nerve cord. [score:3]
bantam is expressed in neural progenitors of the larval CNSAs a first step to characterize the expression of bantam in brain neuroblasts, we examined a lacZ reporter transgene inserted at the bantam locus. [score:3]
bantam- lacZ expression was detected in type I (Dpn [+]Ase [+]) neuroblasts and in type II (Dpn [+]Ase [−]) neuroblasts (Fig.  1B). [score:3]
bantam-lacZ expression was highest in Dpn [+]Ase [−] type II neuroblasts (Fig.  3B, large arrow). [score:3]
bantam is required for optic lobe development and glial cell proliferation. [score:2]
The bantam 5p sponge sequence [GCGGCCGCA(AGTCAAACCAATACAAAACCGGGATA) [9]AGTCAAACCAATACAAAACCGGTCTAGA] contains ten binding sites that are complementary to the mature bantam sequence and has a central bulge to prevent direct mRNA cleavage. [score:2]
Taken together, these findings provide evidence that misregulation of brat and prospero, and perhaps also numb, contributes to the consequences of removing bantam activity from the type II neuroblast lineage. [score:2]
Together, these data provide evidence that bantam regulates prospero, numb and brat in central brain neuroblasts. [score:2]
Fig. 5. Genetic evidence that bantam acts via regulation of brat and prospero. [score:2]
As a first step to determine whether any of these transcripts are regulated by bantam in neuroblast lineages, we examined mRNA levels by quantitative RT-PCR in RNA isolated using the method (Miller et al., 2009). [score:2]
Earlier studies on bantam showed a role in regulation of tissue growth and cell proliferation (Hipfner et al., 2002; Brennecke et al., 2003). [score:2]
Given that ecdysone acts negatively on larval neuroblast proliferation (Homem et al., 2014), it is possible that the reduction in neuroblast number in bantam [Δ1] mutants could reflect a non-autonomous consequence of its regulation of ecdysone signaling. [score:2]
The bantam gene regulates Drosophila growth. [score:2]
bantam is required for larval CNS growthEarlier studies on bantam showed a role in regulation of tissue growth and cell proliferation (Hipfner et al., 2002; Brennecke et al., 2003). [score:2]
UAS -RNAi mediated depletion of brat transcript significantly increased the average size of bantam type II neuroblasts (Fig.  5A). [score:1]
Sensor levels were higher in the more differentiated progeny of the lineage located deeper in the brain cortex, indicative of lower bantam activity. [score:1]
To determine the number of progeny produced by bantam and normal control neuroblasts, the number of GFP [+] cells was counted (excluding the Dpn [+] neuroblast). [score:1]
The difference in bantam-sensor levels between the proliferating cells and their differentiating progeny disappeared in the bantam mutant brain (Fig.  3D). [score:1]
Control: n=35 brains; bantam [Δ1/Δ1] n=42 brains. [score:1]
bantam is required for larval CNS growth. [score:1]
The decrease in total INP number (Fig.  3H) probably reflects a reduction in INP proliferation in the bantam mutant clones. [score:1]
n=34 clones for the bantam mutant with prospero RNAi and n=16 with numb [1]. [score:1]
These observations suggest that bantam is active in type I and type II neuroblasts and their immediate progeny, and that this activity is lower or absent in the differentiated progeny of these cells. [score:1]
n=25 clones for the control, bantam [Δ1/Δ1] mutant and bantam mutant with brat RNAi. [score:1]
Nuclear Prospero protein was not detectable in the Dpn [+] INPs in control brains, but we observed low levels of Prospero together with Dpn in the nuclei of INPs in bantam mutant clones (Fig.  4D, arrows). [score:1]
Bantam-sensor GFP levels were low in the Dpn [+] neuroblast and in the adjacent INP cells, indicative of bantam activity. [score:1]
The average numbers of type I and type II neuroblasts were lower in bantam [Δ1] mutant brains (Fig.  2D,E). [score:1]
S2 cells were transfected in 24-well plates with 250 ng of pBS-Actin-Gal4, 125 ng of pUAST-dsRed- bantam-3p or - 5p sponge plasmid or empty pUAST-dsRed vector, 25 ng of firefly luciferase reporter plasmid, and 25 ng of Renilla luciferase DNA as a transfection control. [score:1]
The bantam primary transcript produces two mature miRNA products, processed from the two arms of the pre-miRNA hairpin. [score:1]
bantam has both cell-autonomous and systemic effects on tissue growth (Brennecke et al., 2003; Li and Padgett, 2012; Boulan et al., 2013; Huang et al., 2014). [score:1]
The control and bantam mutant samples are the same as those shown in Fig.  3J. [score:1]
In the bantam mutant brain, GFP was detected in type I (Dpn [+]Ase [+]) neuroblasts and type II (Dpn [+]Ase [−]) neuroblasts, and in their GMC and INP daughters (Fig.  1D; additional examples in Fig.  S2). [score:1]
The increased level of prospero transcript in the bantam mutant neuroblast lineages presumably leads to premature nuclear accumulation of Prospero protein in INP cells. [score:1]
n=25 clones for the control, bantam [Δ1/Δ1] mutant and bantam mutant with brat or prospero RNAi and n=16 with numb [1]. [score:1]
As might be expected, based on its role in supporting INP expansion and proliferation, removing bantam activity was able to partially offset the effects of depleting brat by RNAi selectively in type II lineages using the wor-Gal4 ase-Gal80 combination (Fig.  S10). [score:1]
org) and is the form detected by the bantam-sensor transgene. [score:1]
bantam-3p is considerably more abundant (www. [score:1]
For subsequent experiments, 170 dissected CNS tissues from the following genotypes were used: inscGal4>UAS-UPRT2.1-HA; Dr or TM2/+ (control) vs inscGal4>UAS-UPRT2.1-HA; bantam [Δ1/Δ1] (mutant). [score:1]
Bantam regulates prospero, brat and numb. [score:1]
bantam miRNA promotes systemic growth by connecting insulin signaling and ecdysone production. [score:1]
Selective depletion of brat or prospero resulted in a significant increase in the proportion of pH3 [+] mitotic INPs in bantam mutant clones (Fig.  5C; representative images are in Fig.  S8). [score:1]
Control: n=35; bantam mutant n=42; with brat RNAi n=36 clones. [score:1]
We also observed a reduction in the size of the type I lineages in bantam clones (Fig.  3K). [score:1]
Although both control and bantam mutant clones contained only one large Dpn [+]Ase [−] neuroblast per clone, the Dpn [+] neuroblasts were smaller on average in bantam mutant type II clones than in the control clones (Fig.  3E). [score:1]
bantam mutants have fewer neuroblasts and show a cell-autonomous effect on neuroblast growth and proliferation in the larval central brain, resulting in a reduction in the total number of post-mitotic neurons. [score:1]
ANOVA: P<0.0001 comparing bantam mutant with and without brat RNAi and P=0.0005 comparing bantam mutant with/without prospero RNAi. [score:1]
We did not observe a significant decrease in the number of immature INPs in the bantam mutant type II clones (Fig.  3H; identified by the absence of nuclear Dpn and presence of nuclear Ase). [score:1]
numb transcript contains predicted sites for bantam-3p (Fig.  4B). [score:1]
This is consistent with a truncation of the type II lineage due to reduced proliferation of INPs in the bantam mutant. [score:1]
The control and bantam mutant samples are the same as those shown in Fig.  3G. [score:1]
ANOVA: P<0.0001 comparing control and bantam mutant; P=0.0008 comparing bantam mutant with and without brat RNAi. [score:1]
bantam is required cell-autonomously for neuroblast growth and proliferation. [score:1]
Fig. 2. bantam is required for larval central brain growth. [score:1]
Alternatively, loss of neuroblasts could be a consequence of cell-autonomous effects of bantam on neuroblast growth and/or survival. [score:1]
bantam-lacZ (P{lacW}banL1170a) is described by Hipfner et al. (2002). [score:1]
Fig. 3. bantam is required cell-autonomously in type II NB lineages. [score:1]
To generate positively labeled MARCM clones, hsFLP, elav-Gal4; UAS-mCD8::GFP, UAS-lacZ/ CyO; FRT2A, tubP-Gal80/TM6b were crossed to FRT2A or FRT2A, bantam [Δ1]/TM6b or UAS- pros- RNAi/UAS- pros- RNAi; FRT2A, bantam [Δ1]/TM6b or UAS- brat- RNAi/ UAS- brat- RNAi; FRT2A, bantam [Δ1]/TM6b or numb [1]/CyOKrGFP; FRT2A, bantam [Δ1]/TM6b or UAS-ban [A]/CyOKrGFP; FRT2A, bantam [Δ1]/TM6b. [score:1]
Small arrow indicates lower levels of bantam-lacZ observed in Dpn [+]Ase [−] immature INP and in Dpn [+]Ase [+] mature INP. [score:1]
bantam [Δ1], bantam sensor and UAS- bantam are described by Brennecke et al. (2003) and UAS- bantam-3p sponge in (Becam et al., 2011); UAS-DIAP1 is described by Wang et al. (1999). [score:1]
The effect of removing one copy of numb was not statistically significant by ANOVA (P=0.07, comparing all samples in the experiment), but was significant in a pairwise comparison of the bantam mutant with and without numb RNAi using an unpaired t-test (P=0.013 assuming unequal variance). [score:1]
Bantam miRNA has been implicated in maintenance of ovarian stem cells (Shcherbata et al., 2007). [score:1]
The control and bantam mutant samples are the same as those shown in Fig.  3E. [score:1]
Notch -mediated repression of bantam miRNA contributes to boundary formation in the Drosophila wing. [score:1]
Consistent with this, we observed a decrease in the number of INPs labeled with the mitotic marker phosphohistone H3 in bantam mutant clones (Fig.  3I), providing evidence for reduced INP proliferation. [score:1]
Despite the observed RNA increases in bantam mutant neuroblasts, we were unable to detect Brat or Numb proteins above background in these cells with the available antibodies. [score:1]
Selective depletion of prospero was sufficient to restore the number of mature INP cells in the bantam mutant clones (Fig.  5B), whereas depletion of brat or removal of one functional copy of numb had no significant effect on mature INP number (Fig.  5B). [score:1]
In this context, it is interesting that bantam activity is required for the formation of ovarian tumors resulting from removal of the Brat-related TRIM-NHL protein Mei-P26 (Neumüller et al., 2008). [score:1]
Mutual repression by bantam miRNA and Capicua links the EGFR/MAPK and Hippo pathways in growth control. [score:1]
On this basis, we conclude that the RNAi rescue worked by offsetting the increase in transcript levels in the bantam mutant. [score:1]
We were interested to examine how bantam activity is deployed in the more complex type II lineage. [score:1]
As a first step to characterize the expression of bantam in brain neuroblasts, we examined a lacZ reporter transgene inserted at the bantam locus. [score:1]
We did not observe a change in Prospero levels in bantam mutant type I neuroblasts (Fig.  S4B). [score:1]
Brat and Prospero mediate the effects of bantam on neuroblast growth and proliferation. [score:1]
ANOVA: P=0.029 comparing bantam mutant with and without prospero RNAi. [score:1]
Therefore, a reduction in the number of INP daughter cells in bantam mutant clones could indicate increased cell death, as well as reduced proliferation. [score:1]
MicroRNA Neural stem cell Bantam Prospero Brat In recent years, Drosophila neural stem cells have emerged as an important mo del for understanding stem cell function and regulation. [score:1]
[1 to 20 of 110 sentences]
3
[+] score: 139
Therefore, feeding of the DCPTN-PT containing culture media did not depress the regulatory microRNAs (miR-2, miR-13 and miR-14) that control the translation of three pro-apoptotic host genes (miR-2 and miR-13 targets rpr, grim and miR-14 targets Drice), suggesting that DCPTN-PT compound is not an inhibitor of all proapoptotic genes but very specific to oncomiR bantam. [score:10]
The misexpression of proto-oncomiRNA, bantam might be responsible for diseases of cell proliferation that inhibit programmed cell death in Drosophila and vertebrates. [score:7]
To further address the issue whether misregulation of bantam by the DCPTN-PT up regulate endogenous hid expression in larvae, a quantitative Western blot analysis was performed with different genotypes. [score:5]
This indicates that the over expression of the HID protein due to repression of bantam miRNA is probably due to reduction in the translation blockage of the hid mRNA. [score:5]
In this study, it is found that DCPTN-PT acts as a negative regulator for bantam microRNA that reduces mature miRNA dramatically and increases target protein level (as HID) that might be a positive regulator of cell apoptosis or cell death. [score:5]
Therefore, less bantam miRNA production may not be sufficient to bind to 3′ end of the target gene hid, thereby leading to translational blockage for the production of Hid protein significantly. [score:5]
Therefore DCPTN-PT not only acts as a HDAC inhibitor but also reduces bantam oncomiRNA activity simultaneously to increase EGFP expression in the larva of sensor line. [score:5]
Therefore in the sensor line, bantam miRNA binds to the target sequence at the 3′ end of the trans gene and blocks EGFP expression. [score:5]
In control and bantam sensor larvae hid expression was relatively less when compared to the expression seen in larvae fed with DCPTN-PT at two different concentrations. [score:4]
It is noted that bantam miRNA is expressed at all developmental stages in varying levels. [score:4]
Similar to bantam sensor, tubulin-EGFP- hid3′UTR sensor showed an immense up regulation of EGFP expression, when larvae were fed with DCPTN-PT (12 μM in 3 ml of food) containing culture media (Fig. 6A). [score:4]
Therefore hid pro apoptotic gene acts as a target for regulation by 21 nucleotide bantam miRNA. [score:4]
Interestingly, EGFP expression was strongly increased upon feeding in bantam sensor lines. [score:3]
Based on the modulation of apoptotic signature and non significant effect on major pro-apoptotic genes, we tested, whether DCPTN-PT mis-expresses bantam oncomiRNA or not. [score:3]
The conservation of these sequences suggests a functional relationship between bantam miRNA and target gene hid. [score:3]
Here changes in bantam activity introduced by triazole analogues developmentally up regulated programmed cell death in mo del organism (Fig. 8). [score:3]
Though there was a significant increment in the production of HID proteins by the reduction of bantam miRNA, as a result of continuous feeding of DCPTN-PT molecules, there was no change in the hid mRNA expression (Fig S5). [score:3]
Based on such specificity, we can assume that DCPTN-PT might be affected only on bantam misexpression. [score:3]
Thus bantam miRNA can block expression of a transgene containing the hid 3′ UTR in tubulin-EGFP reporter. [score:3]
To assess whether there is an effect on the hid gene, we fed the compound to transgenic larvae that contained predicted bantam target sites (tubulin-EGFP reporter transgene fused to the 3′UTR on the hid mRNA). [score:3]
The bantam sensor expresses EGFP protein in adult flies. [score:3]
As a result, Hid proteins increase in amount by breaking bantam miRNA translation blockage of hid 3′ UTR. [score:3]
Previous studies have shown that bantam miRNA has three independent targets in 3′UTR of the apoptosis-inducing gene head involution defect (hid) 15. [score:3]
The HDAC inhibitor, DCPTN-PT was further tested against the bantam miRNA, by feeding to control, sensor and mutant transgenic larvae. [score:3]
In wild type larvae, a bantam RNA of 21 nt long was expressed normally whereas in bantam sensor transgenic line, pre microRNA (70 nt) and processed mature microRNA (21 nt) were enriched. [score:3]
In other words, DCPTN-PT feeding blocks bantam oncomiRNA production in the wing discs, enhancing the EGFP expression. [score:3]
No change in EGFP expression was seen upon feeding of the same compound neither in control sensor nor in the mutant bantam [∆1] lines (Fig. 5). [score:3]
In depth characterization of DCPTN-PT will show additional predicted targets that determine how bantam regulates apoptosis. [score:2]
It demonstrated that feeding of DCPTN-PT blocked the production of mature bantam oncomiRNA and leads to hid up regulation. [score:2]
In search of whether misregulation of bantam miRNA is a general defect of microRNA processing or specific for bantam, we have estimated the amount of core genes that are involved in microRNA processing. [score:2]
It was shown that bantam microRNA control pro-apoptotic gene hid directly 15. [score:2]
It therefore seems likely that DCPTN-PT may reduce bantam oncomiRNA through hid mRNA and a yet to be identified positive regulator of cell death via Caspase-3 dependent pathway. [score:2]
The DCPTN-PT dependent misregulation of bantam microRNA reduces tissue growth unlike bantam [∆1]. [score:2]
These findings showed that the effect of DCPTN-PT is very specific and can be potent candidate for bantam regulated process. [score:2]
Moreover, a construct carrying a large deletion of the chromosomal fragment of the bantam endogenous locus was used as null allele (bantam [Δ1]) 15 (Fig. 4A). [score:1]
These larvae carried either a control or bantam miRNA transgenic construct. [score:1]
Endogenous removal of the bantam gene enhances hid induced apoptosis 15. [score:1]
This confirmed that continuous feeding of DCPTN-PT to Drosophila larvae misprocesses the synthesis of bantam oncomiRNA. [score:1]
Interestingly no distortion was found in the eye phenotype and ommatidial structure of adult flies that emerged from bantam [∆1] (stock in which the bantam microRNA sequences were totally deleted) larvae fed with DCPTN-PT containing culture media (Fig. 6B). [score:1]
Interestingly feeding of DCPTN-PT compound to the same bantam sensor larvae did not produce even a trace amount of mature bantam RNA. [score:1]
A tRNA probe was used as a loading control as described [[1]] Drosophila bantam 5′ end labelling probe ACAAGTGAGATCATTTTGAAAGCTGATTTTGT. [score:1]
Continuous feeding of DCPTN-PT compound misprocesses the normal bantam mature microRNA biogenesis. [score:1]
Continuous feeding of DCPTN-PT to bantam sensor showed normal growth of homozygous adult and pupae relative to unfed bantam [∆1] mutants (Fig. 4C). [score:1]
Defective biogenesis reduces bantam microRNA production. [score:1]
The resulting EGFP pattern observed in the wing disc was identical to that produced by the bantam sensor. [score:1]
The deleted (bantam [∆1]) homozygous pupae lack some or all imaginal discs and show undergrowth. [score:1]
Drosophila bantam gene encodes a 21 nucleotide miRNA that promotes cell proliferation and reduces apoptosis. [score:1]
We identified a novel function of a newly synthesized triazole derivative that reduces drastically a critical oncomiRNA from bantam coded gene responsible for promoting cell proliferation and blocking apoptosis 15. [score:1]
The reduction of bantam microRNA by the continuous feeding of DCPTN-PT may not be sufficient at the 3′ UTR endogenous binding of the hid locus. [score:1]
Schematic diagrams of control and bantam sensor. [score:1]
It suggests that DCPTN-PT orchestrates multifactor aspects of apoptosis, apart from degradation of bantam microRNA prominently, but also affects mitochondrial apoptotic pathway. [score:1]
[1 to 20 of 51 sentences]
4
[+] score: 82
We used transgenic reporter constructs to identify the regulatory modules directing bantam's wing and eye expression, ultimately scanning >40 kb of the ban locus (Figure 5A). [score:5]
Additionally, the enhancer is strongly activated in clones ectopically expressing Hth posterior to the morphogenetic furrow, in regions of the disc where neither hth nor bantam are normally expressed (Figure 6B). [score:5]
Similar loss of expression was also seen using a hth allele (hth [100.1]) that only expresses homeodomain-less isoforms of Homothorax, suggesting that full-length Hth is required for activation of bantam in the anterior eye (Figure S4A). [score:5]
Together these results suggest that Sd+Yki directly regulate the bantam wing enhancer and that Dpp+Yki independently regulate this element close to the AP compartment boundary. [score:4]
Moreover, Sd and Hth regulate bantam expression in the wing and the eye, respectively [48]– [50]. [score:4]
Although tissue-specific binding is abundant for both Sd and Hth, the bantam wing and eye enhancers direct tissue-specific, patterned expression even though overall Sd/Hth/Yki binding is similar between both tissues at these regions (Figure 4). [score:4]
Together with the ChIP data, these genetic and enhancer mutagenesis experiments support a mo del in which Hth+Exd+Yki directly activate bantam expression in the progenitor domain of the eye via an enhancer more than 30 kb upstream of the bantam hairpin. [score:4]
In the case of the bantam eye and wing enhancers, Sd and Hth binding in BLUE chromatin is direct and apparently able to drive tissue-specific, rather than ubiquitous, expression patterns. [score:4]
Altogether, the bantam wing enhancer contains seven putative Sd binding sites, and mutation of all seven eliminated the vast majority of expression in the wing pouch and wing hinge (Figure 7B). [score:4]
Two Gal4 enhancer traps near the promoter of this primary transcript each capture bantam's expression pattern (Figure 4A–C and data not shown). [score:3]
Hth and Sd regulation of bantam The above findings indicate that tissue-specific binding is a key variable influencing the regulatory specificity of Sd and Hth. [score:3]
Sd and Yki are required for expression of bantam in the wing imaginal disc [49]. [score:3]
We also identified and characterized separate but adjacent wing and eye enhancers from the bantam (ban) gene, a previously described direct target of the Hippo pathway, and show that their activities are dependent on direct Sd and Hth binding, respectively. [score:3]
Two Gal4 enhancer trap insertion lines, coupled with UAS-GFP, were used to assess bantam expression pattern: NP3256 and NP0016 (DGRC, Kyoto). [score:3]
None of the other regions tested, including fragments that show strong binding and one that is activated when Hippo signaling is compromised [47], drove a bantam-like expression pattern in wing or eye discs. [score:3]
These observations are consistent with a previous report showing that Dpp is an activator of bantam expression in a Yki -dependent manner [47]. [score:3]
Drosophila geneticsTwo Gal4 enhancer trap insertion lines, coupled with UAS-GFP, were used to assess bantam expression pattern: NP3256 and NP0016 (DGRC, Kyoto). [score:3]
1003753.g006 Figure 6Hth and Yki regulate the bantam eye enhancer. [score:2]
Sd and Yki regulate the bantam wing enhancer. [score:2]
1003753.g007 Figure 7Sd and Yki regulate the bantam wing enhancer. [score:2]
Figure S4Hth and Exd regulate the bantam eye enhancer. [score:2]
Hth and Yki regulate the bantam eye enhancer. [score:2]
Hth and Sd regulation of bantam. [score:2]
For example, we observe Sd, Hth, and Yki binding to several well-characterized transcriptional targets of the Hippo pathway in a primarily tissue-nonspecific manner (Figure 4A, Figure S3), including the microRNA (miR) encoding gene bantam (ban) [48]– [50], [78]– [80]. [score:1]
1003753.g005 Figure 5 bantam eye and wing enhancers. [score:1]
Yki, Sd, and Hth binding at the bantam locus. [score:1]
We carried out similar experiments on the newly identified bantam wing enhancer (ban-wing). [score:1]
Overlapping DNA fragments covering >40 kb of the bantam locus were PCR amplified and introduced in lacZ-bearing reporter vectors. [score:1]
1003753.g004 Figure 4Yki, Sd, and Hth binding at the bantam locus. [score:1]
bantam eye and wing enhancers. [score:1]
[1 to 20 of 30 sentences]
5
[+] score: 73
This increase in apoptosis can be attributed to a repressive effect of superactivation of TOR on the expression of DIAP1 protein and the bantam microRNA (Fig 6E–6G; S9F and S9F’ Fig), both targets of Yki regulation that have antiapoptotic activity [55]. [score:6]
GFP- bantam while coexpressing rheb increases disc size by 70% (M), without obviously suppressing cell death. [score:5]
To resupply bantam, GAL4 -dependent transgene expression was not used, since bantam overexpression itself induces growth [58, 59], rendering synergistic outcomes difficult to interpret. [score:5]
1002274.g006 Fig 6Superphysiological TOR activity causes excess, Yki-independent growth that is offset by a negative feedback that down-regulates the anti apoptic factors DIAP and bantam. [score:4]
Hyperplasia is further increased by the addition of bantam expression under the direct control of the Tubα1 promoter (M). [score:4]
Instead, a transgene was constructed that expresses GFP at low levels under the direct control of the Tubα1 promoter, with the 3’UTR containing a minimal 100 bp genomic bantam fragment that includes the 21 bp bantam microRNA [58]. [score:4]
In principle, DIAP repression could be a secondary consequence of bantam repression, since DIAP1 protein is negatively regulated by the Head involution defective protein (Hid) [57], a bantam target [58]. [score:4]
Superphysiological TOR activity causes excess, Yki-independent growth that is offset by a negative feedback that down-regulates the anti apoptic factors DIAP and bantam. [score:4]
However, we failed to observe any effect of overexpressing or removing bantam on DIAP1 protein levels (S9G and S9H Fig), from which it appears that TOR superactivation does not act via bantam to repress DIAP. [score:3]
To gauge if abnormally high levels of TOR activity indeed repress DIAP and bantam to offset tissue overgrowth, these gene products were resupplied to discs overexpressing rheb under hdc. [score:3]
Moreover, the effects on DIAP1 and bantam are seemingly Yki-independent, since the repression of DIAP1 appears to be posttranscriptional (S9A and S9B Fig), and ChIP experiments indicate that Yki binding to its target enhancer in the bantam gene is not reduced in Tsc1 [—]wing discs (Fig 6I) [56]. [score:3]
GFP- bantam did not fully suppress cell death (compare Caspase staining in S9L and S9M Fig). [score:3]
Our finding that excess activity of TOR appears to cause excess growth that is compensated by cell death via reduced DIAP1/ bantam expression (Fig 7C) reveals that the circuit linking TOR and Yki is additionally stabilized by negative feedback, constraining organ growth in the event of erroneous, superphysiological TOR activity. [score:3]
In sum, the effects of reintroducing DIAP1 and bantam reveal a novel effect of superphysiological TOR activity: the repression two key Yki target genes, albeit by Yki-independent mechanisms, to induce cell death and counterbalance the excessive tissue growth that would otherwise result from TOR hyperactivity. [score:3]
Thus, TOR overactivation appears to cause cell death independently of the Wts/Hpo/Yki pathway, possibly mediated by reduced expression of both DIAP1 and bantam. [score:3]
This indicates that native DIAP1 levels are regulated independently of bantam in the wing. [score:2]
GFP- bantam rescues a bantam homozygous mutant animal, producing a normally sized adult. [score:1]
However, the repression of DIAP1 and bantam does not appear to be due to enhanced Wts kinase activity, as Tsc1 [—]discs showed a mild reduction rather than an increase in phospho-Yki S168 levels (Fig 6H). [score:1]
For ChIP at the bantam locus, chromatin was prepared from ~150 wild type and Tsc1 [Q87X]/ Tsc1 [PA23] mutant wing discs, and subjected to pulldown with ant-Yki or IgG control antibodies as explained above. [score:1]
GFP-bantam (P). [score:1]
EGFP with a 3’UTR containing a 100 bp fragment encompassing the bantam hairpin [58] was inserted as a KpnI-XbaI fragment into p(Tuba1>DsRed, y [2] >)AttB, and the construct was inserted into the genome at 25C7. [score:1]
Tor [ΔP] FRT40A (T. Neufeld), ex [e1] FRT40A (G. Halder), FRT82B rheb [AV4] (Bloomington), bantam [Δ1] FRT2A, FRT82B wts [X1], FRT82B akt [q] (S. Cohen), FRT82B foxo [25] (E. Hafen), FRT42D yki [B5] (D. Pan), pten [1] FRT40A (C. Wilson), pten [dj189] FRT40A (D. Pan), FRT82B Tsc1 [Q87X] (I. Hariharan), FRT82B Tsc1 [PA23] (G. Halder), wts [p2] (G. Halder), ds6k [I–1] (E. Hafen), Thor [2] and sd [GFP] (Bloomington). [score:1]
tubulin-bantam. [score:1]
GFP- bantam transgene does not itself stimulate overgrowth (Fig 6N; S1 Data) but produces enough bantam to rescue a homozygous null bantam animal to adulthood, producing a normally sized and patterned animal (S9O and S9P Fig). [score:1]
GFP- bantam together caused the disc to more than double in size (N). [score:1]
GFP- bantam produces a level of bantam activity comparable to homozygosity for the endogenous bantam gene. [score:1]
GFP- bantam led to still more growth, with the wing disc more than doubling in size (110% larger; Fig 6H and 6N; S1 Data). [score:1]
GAL4 control (F) causes a reduction in DIAP accumulation (red), as well as bantam micro -RNA activity, the latter indicated by relief of repression of a bantam-GFP sensor (green) [54]; peak activity of the ptc. [score:1]
Likewise, in H, bantam homozygous mutant clones (labelled by absence of magenta ß-galactosidase) show a very strong increase in bantam sensor levels (green) but no discernable change in DIAP1 protein levels (red). [score:1]
dll-lacZ, ex [e1] -lacZ (ex [e1], G. Halder), fj-lacZ, diap [2B2C] -lacZ (D. Pan), diap [j5c8]- lacZ, and the bantam sensor [58] were used. [score:1]
[1 to 20 of 30 sentences]
6
[+] score: 69
Here, by examining the temporal sequence of Dll and Lim1 gene expressions, lineage restriction, and tissue morphogenesis, we report that the boundary separating the most proximal segment (Lim1 -expressing, A1), from the more distal parts (Dll -expressing) of the antenna involves a Notch -dependent downregulation of bantam microRNA and de-repression of Enable (Ena). [score:10]
bantam -overexpressing clones showed significantly reduced Ena levels and inhibited EAD fold (Fig 7I), as well as mixing of Lim1 and Dll cells (Fig 7J). [score:5]
The bantam-overexpression clones within a single field did not exhibit altered Lim1 and Dll expression, indicating that the cell mixing phenotype was not the result of a changed cell fate (Fig 7K). [score:5]
Although N signaling has been reported to be involved in many developmental processes, a role in inducing actomyosin -dependent apical constriction and epithelial fold is a novel described function for N. For the A1 boundary, N activity is possibly mediated through repression of bantam and consequent upregulation of Ena. [score:5]
bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. [score:4]
There, it represses the micro -RNA bantam, which itself represses its target Enabled (Ena), that is a positive regulator of actin polymerization. [score:4]
The numbers of discs analyzed in control, N [DN], and bantam overexpression were 11, 12, and 16 (proliferation), and 12, 11, and 12 (apoptosis) respectively. [score:3]
We assessed endogenous bantam level by RNA in situ hybridization in combination with a N activity reporter, Su(H)Gbe- lacZ, and Ena to study their relative expressions in the EAD. [score:3]
When N signaling or actomyosin was disrupted, or when bantam was overexpressed, the epithelial fold was disrupted and Dll and Lim1 cells become mixed. [score:3]
Our results suggest that N acted through bantam and Ena (possibly by repressing bantam to allow Ena expression) to induce actomyosin assembly and thus epithelial constriction and formation of the A1 fold. [score:3]
Mitosis (phospho-Histone H3) and apoptosis (cleaved caspase 3, S8E and S8F Fig) were examined in N [DN] or bantam overexpression mutants driven by dpp-GAL4 from L2 (dpp [L2]). [score:3]
By repressing bantam, N enhances Ena expression, thereby establishing the actomyosin cable -based D/V boundary [19]. [score:3]
N signaling then induced apical constriction and epithelial fold, possibly through repression of bantam to allow levels of the bantam target Ena to become elevated, with this latter inducing the actomyosin network. [score:3]
Concomitant blocking of N signaling (through N [DN]) and a reduction of bantam (by expressing bantam [sponge]) in hth>N [DN] +bantam [sponge] mutants rescued the disrupted A1 fold and the lineage mixing phenotype (Fig 7I and 7K, 23% phenotype, compared to 81% in hth>N [DN] in Fig 7A). [score:2]
The Notch/ bantam axis has been shown to regulate cell proliferation and apoptosis [58, 59]. [score:2]
N activity then represses bantam, resulting in the de-repression of Ena, which triggers non-cable actomyosin -dependent cytoskeleton reorganization to drive apical constriction and epithelial fold. [score:1]
In the wing D/V boundary, N signaling is also mediated through bantam and Ena, but the outcome is formation of actomyosin cables, i. e., without apical constriction and epithelial fold [19]. [score:1]
Thus, the N/ bantam/Ena pathway for tissue morphological changes is apparently context -dependent. [score:1]
In e-L3, a relatively lower bantam level was observed in the A1 fold region, whereas Su(H)Gbe- lacZ and Ena level were both elevated (S8D and S8D” Fig arrows). [score:1]
6. was from Jessica Treisman (New York University), fng- lacZ [92], Su(H)Gbe- lacZ was from Sarah Bray (University of Cambridge, UK), E(spl)mβ- lacZ [93], UAS- N [act] [55], UAS- N [DN] [94], UAS- bantam and UAS-bantam [sponge] [19] were from Marco Milán (Institute for Research in Biomedicine, Barcelona). [score:1]
S8 FigPatterns for Notch activation, bantam, and Ena during EAD A1 fold formation, and their effects on cell proliferation and apoptosis. [score:1]
The bantam RNA in situ signals recapitulated the patterns reported previously in the wing D/V boundary [19] (S8A Fig). [score:1]
Patterns for Notch activation, bantam, and Ena during EAD A1 fold formation, and their effects on cell proliferation and apoptosis. [score:1]
In l-L2 antennal discs, bantam and Ena levels were generally low, with little correlations with Su(H)Gbe- lacZ level (S8C Fig). [score:1]
The 5’- or 3’-DIG-labeled probes for bantam detection and the control sequence were: aatcagctttcaaaatgatctcacttgtatg (bantam), and gtgtaacacgtctatacgccca (scramble-miR, EXIQON). [score:1]
Mean values of proliferation/apoptosis, in control, N [DN], and bantam were 0.55/0.19, 0.39/0.06, and 0.38/0.12, respectively. [score:1]
[1 to 20 of 26 sentences]
7
[+] score: 54
Other miRNAs from this paper: dme-mir-1, gga-mir-1a-2, gga-mir-1a-1, gga-mir-1b, gga-mir-1c
The strong genetic interaction between ban and dFmr1 in the regulation of GSCs suggests that dFmrp could use the bantam miRNA to regulate the translation of specific mRNAs in ovary, which in turn modulates the behavior of GSCs. [score:5]
Given our findings, the next important step becomes identifying the mRNA target(s) of the bantam miRNA that could regulate GSCs. [score:4]
Identifying those mRNAs that are co-regulated by dFmrp and the bantam miRNA in Drosophila ovary will provide an important system for further study of the role(s) that dFmrp plays in miRNA -mediated translational control. [score:4]
This phenotype could be rescued by the expression of the bantam miRNA (Figure 3G). [score:3]
To determine whether dFmr1 regulates germline development through the bantam miRNA, we first explored whether the bantam miRNA plays similar roles to dFmr1 in repressing primordial germ cells (PGCs) and GSC differentiation during the larval and adult stages. [score:3]
Generation of New Alleles for bantam To determine whether dFmr1 regulates germline development through the bantam miRNA, we first explored whether the bantam miRNA plays similar roles to dFmr1 in repressing primordial germ cells (PGCs) and GSC differentiation during the larval and adult stages. [score:3]
The rest of this study focuses on the role of the bantam miRNA and its potential interaction with dFmr1 in regulating GSCs. [score:2]
In summary, here we show that, as an extrinsic factor regulating GSCs, dFmrp is selectively associated with specific miRNAs, including the bantam miRNA, in Drosophila ovary. [score:2]
Furthermore, we show that bantam genetically interacts with dFmr1 to regulate the fate of GSCs. [score:2]
Even more importantly, though, we show that bantam genetically interacts with dFmr1 to regulate the fate of GSCs. [score:2]
We found that, besides the intrinsic role of the miRNA pathway in general, specific miRNAs, such as the bantam miRNA, could also function as a niche factor to regulate GSCs. [score:2]
These data suggest that dFmr1 could potentially regulate the fate of GSCs through the bantam miRNA. [score:2]
To determine the role of the bantam miRNA, we generated null alleles of ban and examined the role of the bantam miRNA in the maintenance and fate specification of GSCs. [score:1]
Thus, these results demonstrate that the bantam miRNA is required for maintaining GSCs in Drosophila ovary. [score:1]
In this paper, we found that the bantam miRNA is associated with dFmrp in Drosophila ovary. [score:1]
Here we show that dFmrp is associated with specific miRNAs, including the bantam miRNA, in Drosophila ovary. [score:1]
The Bantam miRNA Is Required for Repressing PGC Differentiation. [score:1]
Mature bantam miRNA is indicated in green. [score:1]
Northern blots detecting the sense and anti-sense strands of the bantam miRNA in both input and IP RNAs from WT and dfmr1 [3] mutants are shown. [score:1]
Since the bantam miRNA is among those miRNAs specifically associated with dFmrp in ovary, we further confirmed their specific association by quantitative RT-PCR and Northern blot (Figure 1C and 1D). [score:1]
In this study, we found that dFmrp is associated with specific miRNAs, including the bantam miRNA, in Drosophila ovary. [score:1]
In this study, we chose to focus on a specific miRNA, the bantam miRNA. [score:1]
Like dFmr1, the bantam miRNA is not only required for repressing primordial germ cells (PGCs), but also functions as an extrinsic factor for GSC maintenance. [score:1]
The bantam miRNA is required for repressing primordial germ cell (PGC) differentiation. [score:1]
Generation of New Alleles for bantam. [score:1]
The bantam miRNA is required for GSC maintenance. [score:1]
The Bantam miRNA Plays a Non-Autonomous Role in GSC Maintenance. [score:1]
Given that the sterility of flies carrying ban [20]/Df(3L)emc-E12 and the lethality of flies carrying ban [12]/Df(3L)emc-E12 could be rescued by transgenic flies carrying P{banP-ban} (>90% could be rescued), we conclude that the phenotypes associated with ban [20] and ban [12] alleles are due to loss of the bantam miRNA. [score:1]
Since the hypomorphic allele of bantam (ban), ban [EP3622], was fertile and exhibited no apparent defects in germ cells, including PGCs and GSCs, we performed a mutagenesis through imprecise mobilization of the P-element from ban [EP3622] to generate stronger alleles for the ban gene. [score:1]
The bantam miRNA plays a non-autonomous role in GSC maintenance. [score:1]
Here, we show that dFmrp is associated with specific microRNAs (miRNAs), including the bantam miRNA, in Drosophila ovary. [score:1]
The Bantam miRNA Is Required for GSC Maintenance. [score:1]
[1 to 20 of 32 sentences]
8
[+] score: 41
Next we tested if the expression of the Yorkie target genes four-jointed (fj-lacZ) 33, expanded 34 and the microRNA bantam 35 correlates with the subcellular translocation of Yorkie during reactivation. [score:5]
Yorkie activates the bantam microRNA during reactivationNext we tested if the expression of the Yorkie target genes four-jointed (fj-lacZ) 33, expanded 34 and the microRNA bantam 35 correlates with the subcellular translocation of Yorkie during reactivation. [score:5]
Thus, we conclude that bantam is an important target of Yorkie during reactivation of NSCs, yet other unknown targets are likely involved in growth and proliferation of NSCs. [score:5]
We combined the bantam sensor with wts -RNAi and examined an early activity of bantam at 4 h ALH (Fig. 4b), suggesting that premature reactivation by wts -RNAi expression causes early activation of the Yorkie downstream target bantam. [score:5]
Although quiescent NSCs have active Hippo signalling and thus no active Yorkie, the non-quiescent NSCs show constant nuclear Yorkie and constant expression of the known Yorkie-targets bantam and Four-jointed. [score:5]
The loss of GFP expression and thus the activity of bantam coincides with the activation of Yorkie, as quiescent NSCs (4 h ALH) show strong GFP staining (Fig. 4a, upper panels) and reactivated NSCs (24 h ALH) have markedly reduced GFP signals monitoring bantam activity (Fig. 4a, lower panels). [score:3]
In both populations of stem cells Yorkie activates its well-established target bantam. [score:3]
Testing the SHW we observed constant nuclear Yorkie levels in MBNBs (Fig. 7c) and expression of Fj-lacZ, expanded and activity of bantam (Fig. 4a and Supplementary Fig. 3a,b) confirming a continuous Yorkie activity. [score:3]
Quiescent NSCs (cyan circles) do not have active bantam (GFP -positive), whereas reactivated NSCs (white circles) or the MBNB (yellow circles) have active ban. [score:1]
The microRNA bantam is active during reactivation and necessary for NSC growth and proliferation. [score:1]
To test if bantam is also necessary for NSC reactivation, we analysed bantamΔ1 deletion mutants at 24 h ALH and observed NSC reactivation in the brain, but markedly reduced cell size and proliferative capacity (Fig. 4c–f). [score:1]
Yet, loss of bantam severely impaired growth and proliferation of the VNC NSCs, whereas the effects were milder in brain NSCs. [score:1]
Yorkie activates the bantam microRNA during reactivation. [score:1]
Indeed, we could monitor a premature activation of bantam (loss of GFP) in NSCs upon glial crb/ed RNAi (Fig. 5d). [score:1]
To show that the premature growth initiation in NSCs upon glial -RNAi of crb and/or ed is through altering the SHW pathway in NSCs, we made use of the bantam activity sensor. [score:1]
[1 to 20 of 15 sentences]
9
[+] score: 35
Consistent with these results, a bantam sensor (mic32-GFP) signal was upregulated in Par-1 -RNAi flip-out clones (Figure 3F–3F′) or wing discs expressing Par-1 -RNAi-2 by hh-Gal4 (Figure S2G–S2G″), suggesting a restriction of microRNA bantam expression by knockdown of Par-1. Thus, this evidence suggested that the inactivation of Par-1 resulted in abnormal growth by antagonizing the expression of Hpo-responsive genes. [score:11]
In the absence of suppression from the Hpo pathway, Yki associates with transcription factors, primarily Scalloped (Sd) [20]– [22] and other factors, including Homothorax [23], Teashirt, and Mad [24], in the nucleus to promote proliferation and to inhibit apoptosis by inducing the expression of target genes, such as bantam, cyclinE, and diap1 [25]. [score:9]
Note the reduced organ size induced by Par-1 RNAi-2. (E–G′) Wing discs expressing Par-1 RNAi-2 in the P-compartment with hh-Gal4 were immunostained to demonstrate the expression of ex-LacZ (E–E′), diap1- GFP3.5 (F–F″), and bantam sensor mic32-GFP (G–G″). [score:5]
Note the downregulation of diap1-lacZ and bantam-lacZ in the absence of Par-1. The clone regions are indicated by arrows. [score:4]
D. melanogaster third-instar larval eye discs containing par-1 [W3] clones were dissected and examined to determine the expression of diap1-lacZ (I–I″) and bantam-lacZ (J–J″). [score:3]
Other stocks included: bantam sensor mic32-GFP, ex-lacZ, diap1-GFP3.5, hh-Gal4, GMR-Gal4, MS1096, act > CD2 > Gal4, eyless-Gal4, diap1-lacZ, UAS-Yki, UAS-Yki -RNAi, UAS-Sd -RNAi, hpo [BF33], wts [latsX1], and Sav [SH13], which have all been previously described [20], [53]. [score:1]
As shown in Figure 3I–3I″ and 3J–3J″, in par-1 null clones, the diap1 transcriptional level was reduced (Figure 3I–3I″), and bantam-lacZ was decreased (Figure 3J–3J″). [score:1]
The following transgenes were used in this study: bantam-lacZ (a gift from Wei Du, The University of Chicago), UAS-ex -RNAi (V22994, VDRC), UAS-fat -RNAi (V9396, VDRC), and UAS-Tau -RNAi (V25024, VDRC). [score:1]
[1 to 20 of 8 sentences]
10
[+] score: 32
Other miRNAs from this paper: dme-mir-33
If Lig regulates the Hippo pathway and/or bantam miRNA, we would expect an upregulation of a minimal Hippo response element (DIAP4.3-GFP) and downregulation of the bantam sensor. [score:8]
Consistently, overexpression of lig did not upregulate the bantam sensor (S8C''). [score:6]
bantam miRNA is a known target of the Hippo signaling pathway [27], [28] and inhibits the pro-apoptotic gene hid [29]. [score:5]
For example, FMR1 binds bantam miRNA, an inhibitor of the pro-apoptotic gene hid [29], and regulates cbl, which encodes a component of the EGFR signaling pathway, in germline stem cells [30]. [score:4]
However, bantam miRNA is not regulated by FMR1 in epithelial cells [36], and Lig was unable to regulate a bantam miRNA reporter. [score:3]
Figure S8Lig does not regulate bantam miRNA, EGFR signaling, Myc, Hippo signaling, Insulin signaling, Wnt signaling and Hedgehog signaling. [score:2]
Additional fly strains used in this study were: nubbin-Gal4 [51], da-Gal4 (BDSC), DE-Gal4 [52], ey-Gal4 (insertion on 2nd chromosome) [53], UAS-CycE [54], EP-Diap1 (BDSC), P{Fmr1.14} [55], UAS-p35 (BDSC), DIAP1-GFP4.3 [56], 10xSTAT92E-GFP [57], MIR33 bantam sensor (gift from Stephen Cohen), pnt-lacZ (P{lacW}pntS0998, former stock collection of Szeged, No. [score:1]
FMR1 binds to the miRNA bantam to control the fate of germline stem cells [6]. [score:1]
Genotypes: (A) y w hsFLP/ y w; FRT42 arm-lacZ/FRT42 lig [1]; DIAP1-GFP4.3/+ (B) y w hsFLP/ y w; FRT42 arm-lacZ/FRT42 lig [3]; MIR33 bantam reporter/+ (C) y w/ y w; UAS-lig/ +; MIR33 bantam reporter/ DE-Gal4, UAS-RFP (D) y w hsFLP/ y w; FRT42 ubiGFP/FRT42 lig [1]; pnt-lacZ/+ (E, F, G, H, I, J, K, L) y w hsFLP/ y w; FRT42 ubiGFP/FRT42 lig [1]. [score:1]
In Drosophila, FMR1 maintains germline stem cells in ovaries using the miRNA bantam [6], and brains of FMR1 mutants display increased neuroblast proliferation rates with altered Cyclin E levels [7]. [score:1]
[1 to 20 of 10 sentences]
11
[+] score: 31
In Drosophila, the transcriptional coactivator Yorkie mediates Hippo pathway activity to control the expression of cyclin E and Myc to promote cell proliferation, as well as the expression of bantam miRNA and DIAP1 to inhibit cell death. [score:7]
Genetic studies have identified functional targets of Yki with positive roles in cell proliferation, including cycE and Myc, as well as negative regulators of apoptosis, including the Drosophila Inhibitor of Apoptosis Protein (DIAP1) and the antiapoptotic microRNA bantam (Moberg et al., 2001; Moberg et al., 2004; Huang et al., 2005; Nolo et al., 2006; Thompson and Cohen, 2006; Neto-Silva et al., 2010). [score:6]
The bantam microRNA is a target of the hippo tumor-suppressor pathway. [score:5]
In addition, Yki mediated regulation of bantam miRNA expression (Nolo et al., 2006; Thompson and Cohen, 2006) controls hid transcript levels (Brennecke et al., 2003). [score:4]
bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. [score:4]
The Hippo pathway regulates the bantam microRNA to control cell proliferation and apoptosis in Drosophila. [score:2]
Previous studies in Drosophila have shown that the bantam microRNA acts to repress hid to limit proliferation induced apoptosis (Brennecke et al., 2003). [score:1]
bantam mediates interaction between the EGFR and Hippo growth control pathways (Herranz et al., 2012). [score:1]
Mutual repression by bantam miRNA and Capicua links the EGFR/MAPK and Hippo pathways in growth control. [score:1]
[1 to 20 of 9 sentences]
12
[+] score: 27
The reporter line contains a GFP construct with three bantam miRNA target sites, so that GFP mRNA is degraded when bantam is expressed; GFP expression therefore indicates to little or no bantam expression. [score:9]
The bantam- GFP sensor is a GFP construct containing bantam miRNA target sites, such that low or absent GFP expression indicates bantam expression and activity. [score:7]
We also assessed Yki activity by analyzing expression of the downstream target genes expanded (ex) [21], diap1 (also called thread) [21] and bantam [22]. [score:5]
S2 FigExpression of (A–D, K) diap1-LacZ and (E–H, L) bantam-GFP reporters in larval ovarian cell types. [score:3]
The bantam-GFP sensor also suggested low or absent Yki activity in GCs (S2H–H’, L Fig. ). [score:1]
E–H show merged images with bantam-GFP sensor in green, nuclear marker Hoechst 33342 in cyan, and TFC marker anti-Engrailed in red (A). [score:1]
E’-H’ show bantam-GFP sensor signal only. [score:1]
[1 to 20 of 7 sentences]
13
[+] score: 27
Expression Patterns of sli-miR-14, sli-miR-2a and sli-bantam from S. lituraThe expression patterns of the putative miRNAs, sli-miR-14, sli-miR-2a and sli-bantam were also studied to make a further validation of this method. [score:5]
Expression Patterns of sli-miR-14, sli-miR-2a and sli-bantam from S. litura. [score:3]
Three known miRNAs, miR-14, miR-2a and bantam, play important roles in the developmental stages in D. melanogaster [23, 24], such as regulating steroid hormone signaling [25] and apoptosis [12, 26, 27]. [score:3]
The expression patterns of the putative miRNAs, sli-miR-14, sli-miR-2a and sli-bantam were also studied to make a further validation of this method. [score:3]
The homologues of miR-14, miR-2a and bantam were cloned from Spodoptera litura, a prevalent agriculture pest in China, by stem-loop RT-PCR, and their expression patterns in different developmental stages were also investigated to confirm the results of sequence analysis. [score:2]
Amplification and Identification of sli-miR-14, sli-miR-2a and sli-bantam from S. lituraTo identify the availability of stem-loop RT-PCR technology for cloning conserved miRNAs from non-mo del insects, the sequences of miR-14, miR-2a and bantam in mo del insects were searched from miRBase (Table S1). [score:1]
The putative homologue of the three miRNAs in S. litura, namely sli-miR-14, sli-miR-2a and sli-bantam were cloned by a stem-loop RT-PCR technique. [score:1]
PCR of sli-miR-14, sli-miR-2a and sli-bantam. [score:1]
Three homologues of known miRNAs, miR-14, miR-2a and bantam in mo del insects, were cloned from S. litura by stem-loop RT-PCR, and named sli-miR-14, sli- miR-2a and sli-bantam. [score:1]
Some miRNAs with evolutional variation in their 5′ region, such as bantam, cannot show accurate sequences in non-mo del insects and toned to be identified together by other methods. [score:1]
Instead, abnormal amplification appeared in qPCR of sli- bantam, there is no significant difference in Ct values in the presence or absence of cDNA added to the RT reactions (data not shown). [score:1]
To identify the availability of stem-loop RT-PCR technology for cloning conserved miRNAs from non-mo del insects, the sequences of miR-14, miR-2a and bantam in mo del insects were searched from miRBase (Table S1). [score:1]
Although putative sli-bantam could be cloned by stem-loop RT-PCR, no stable results of qPCR could be obtained here (data not shown). [score:1]
Amplification and Identification of sli-miR-14, sli-miR-2a and sli-bantam from S. litura. [score:1]
When Group 1 was used for amplification of miR-14, miR-2a and bantam, PCR products were 86 bp, 89 bp, 89 bp, respectively (Figure 1a); when Group 2 was used, PCR products were 76 bp, 79 bp and 79 bp in length, respectively (Figure 1b). [score:1]
MiR-14 and miR-2a are more conserved members of miRNAs family than bantam in mo del insects including D. melanogaster and B. mori (Table S1). [score:1]
[1 to 20 of 16 sentences]
14
[+] score: 24
Here we define a role for the Drosophila protein Ctp, a member of the LC8 protein family, in regulating expression of two Hippo target genes, th/diap1 and bantam, in larval disc cells. [score:6]
Analysis of a second well-validated Yki target, the pro-growth bantam (ban) microRNA, was carried out to determine whether the requirement for Ctp is unique to th/diap1 transcription, or can be extended to other well-validated Yki-target genes as well. [score:5]
Ctp loss elevates transcription of the bantam microRNA locusAnalysis of a second well-validated Yki target, the pro-growth bantam (ban) microRNA, was carried out to determine whether the requirement for Ctp is unique to th/diap1 transcription, or can be extended to other well-validated Yki-target genes as well. [score:5]
Ctp represses expression of the bantam locus. [score:3]
Ctp loss elevates transcription of the bantam microRNA locus. [score:1]
Activity reporters of two Yki-responsive genes, thread/diap1 and bantam, each respond to ctp loss in pouch cells and these effects map to smaller regions of the thread/diap1 and bantam promoters that contain Yki-responsive elements. [score:1]
Confocal images of control (en > + in (A,C)) or Ctp -depleted (en >  ctp [IR] in (B,D)) L3 wing discs in the background of the bantam reporters ban3-GFP (A’,B’) or brC12-lacZ (C’,D’). [score:1]
The mechanism through which Ctp achieves its unique effects on thread/diap1 and bantam is not known. [score:1]
While Ctp supports Yki activity on the thread/diap1 promoter, it restricts activity of the bantam promoter, and has no effect on a third Yki reporter, ex-lacZ. [score:1]
[1 to 20 of 9 sentences]
15
[+] score: 24
De-repression by crol and bantam is limited to cycling cellsIf accelerated cell cycles induced by crol over -expression cause de-repression, then crol over -expression in post-mitotic cells should have no effect on silencing. [score:5]
In contrast, de-repression of silencing by crol or bantam over -expression is abrogated by a contemporaneous expression of p21. [score:5]
The bantam microRNA promotes cell growth, and indeed, late over -expression of this factor with GMRGAL leads to both de-repression of silencing and expansion of the eye (Figure 6). [score:3]
We found that eliminating the last cell cycle greatly reduces de-repression caused by bantam over -expression (Figure 6). [score:3]
To determine whether the de-repressive effects of bantam are also limited to cycling cells, we tested if de-repression could occur when p21 was also expressed. [score:3]
Both insertions are upstream of the bantam microRNA precursor gene (4 Kb and 2.5 Kb, respectively) and oriented so that GAL4 induction may over-produce this transcript. [score:1]
Our identification that the proliferation-inducing bantam microRNA also de-represses silencing confirms that cell cycle progression affects bw [D] silencing. [score:1]
These insertions appear to generate functional bantam microRNAs, because induction by GMRGAL produces enlarged eyes in adults, consistent with the role of bantam in promoting cell division and growth [34]. [score:1]
The bantam and crol factors are exceptional, in that they are only effective in cycling cells. [score:1]
De-repression by crol and bantam is limited to cycling cells. [score:1]
[1 to 20 of 10 sentences]
16
[+] score: 23
In this study we show that the bantam microRNA is a direct transcriptional target of the N signaling pathway, and that bantam feedback regulates N by negatively regulating the expression of Numb, an inhibitor of N. This feedback regulation of N helps maintain the robustness of NSC fate. [score:11]
bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. [score:4]
Sequences containing two putative Su(H) -binding sites (S1 and S2) that matched the consensus sequence RTGRGAA, and a control sequence that does not contain Su(H) -binding site (ban con) in the upstream regulatory region of pre- bantam are indicated. [score:2]
We further show that bantam also impinges on a Numb-Myc axis of cell growth regulation, apparently in a N-independent manner. [score:2]
In this study we set out to examine the role of the bantam (ban) microRNA in the regulation of NB homeostasis in the Drosophila brain. [score:2]
Mutual repression by bantam miRNA and Capicua links the EGFR/MAPK and Hippo pathways in growth control. [score:1]
Control of Drosophila Type I and Type II central brain neuroblast proliferation by bantam microRNA. [score:1]
[1 to 20 of 7 sentences]
17
[+] score: 22
After controlling for the generation of adventitious target sites in the luciferase vector for other microRNAs expressed in S2 cells, only six microRNAs are found to repress their targets at levels greater than expected (bantam-5p, miR-33-5p, miR-8-3p, miR-307a-3p, miR-308-5p and miR-8-3p). [score:7]
We also observe that the most abundant microRNAs (bantam-3p, bantam-5p, miR-184-3p, miR-33-5p, miR-8-3p) repress their targets by similar amounts, despite representing a more than 30-fold difference in expression. [score:5]
This is exemplified by the bantam microRNA, which is highly expressed in S2 cells and is involved in a number of important cellular processes such as cell proliferation, apoptosis, development and the circadian clock [50], [51]. [score:4]
The identification of functional capabilities of the non-dominant mature microRNA impacts on work on the identification of targets; for example, some of the observed function of bantam may be attributable to the non-dominant-5p sequence. [score:3]
We do however note two cases where the minor microRNA* product represses the target more effectively than the dominant arm (bantam and miR-986; compare open and filled points in Figure 1B), despite lower concentration in the cell. [score:3]
[1 to 20 of 5 sentences]
18
[+] score: 21
Expression of the VSRs in the posterior compartment of the wing imaginal discs did not suppress the silencing of a GFP reporter targeted by the bantam miRNA (Fig. S2 and Movies S1 and S2). [score:7]
Confocal microscopy of wing imaginal discs expressing the engrailed-GAL4 driver in their posterior half compartment (P) and either a control Tubulin>GFP or a Tubulin>GFP-ban sensor with bantam miRNA target sites in 3′ UTR. [score:5]
The quadrant pattern of GFP silencing by bantam in the wing pouch is not affected by expression of the indicated UAS>VSR transgenes in imaginal disc posterior compartment, indicating no obvious interference with the miRNA pathway by either VSR. [score:3]
To analyze the effect of suppressors of bantam silencing, we recombined the Tubulin>GFP-ban sensor transgene with the engrailed>GAL4 driver on the third chromosome and crossed the resulting homozygous stock to the UAS>VSR lines. [score:3]
Figure S2 VSRs do not suppress silencing by the bantam miRNA. [score:3]
[1 to 20 of 5 sentences]
19
[+] score: 21
A) The microRNA bantam shows a tendency towards synapse reduction which becomes evident by suppressing the synapse increase of PI3K↑, Hiw↑ and Bsk↑. [score:3]
0184238.g005 Fig 5 A) The microRNA bantam shows a tendency towards synapse reduction which becomes evident by suppressing the synapse increase of PI3K↑, Hiw↑ and Bsk↑. [score:3]
Cooperative regulation of growth by Yorkie and Mad through bantam. [score:2]
The bantam gene regulates Drosophila growth. [score:2]
The canonical signaling pathway of Mad/Med includes the transcriptional co-regulator Yorkie and the microRNA bantam [102]. [score:2]
Thus, we tested bantam (Ban) in the context of synaptogenesis. [score:1]
Ban↑Bsk↓ = UAS-Bsk [DN] /+; +/+; D42-Gal4/UAS-bantam. [score:1]
Ban↑PI3K↑ = UAS-PI3K/+; D42-Gal4/UAS-bantam. [score:1]
Thus, bantam should be included in the long list of microRNAs which contribute to synapse control [103]. [score:1]
Ban↑AKT↑ = D42-Gal4/UAS-bantam, UAS-Akt. [score:1]
Ban↑Bsk↑ = UAS-Bsk/+; D42-Gal4/UAS-bantam. [score:1]
Ban↑Ras85D↑ = UAS-Ras85D/+; D42-Gal4/UAS-bantam. [score:1]
Ban↑ = D42-Gal4/UAS-bantam. [score:1]
Ban↑Hiw↑ = UAS-Hiw/+; D42-Gal4/UAS-bantam. [score:1]
[1 to 20 of 14 sentences]
20
[+] score: 20
The molecular mechanism behind the circadian-period regulatory function of bantam involves interactions with three conserved target sites of the clk 3′UTR. [score:4]
Through tiling arrays, Kadener et al. [36] found that disruption of miRNA processing in the nucleus resulted in the accumulation of bantam within fly heads, and overexpression of bantam in the main pacemaker neurons lengthens the circadian period. [score:3]
It appears that bantam has other functions, as restoration of clk levels by expression of clk with a 3′UTR with no bantam binding sites did not rescue the arrhythmicity phenotype of clk [AR]. [score:3]
In addition, deletion of binding sites in clk for the miRNA bantam resulted in a similar phenotype characterized by ectopic expression of VRI and overgrowth of PDF -positive neurons, suggesting that miRNAs regulate the development of circadian neurons [33]. [score:3]
To date, two miRNAs, namely, bantam and let-7, have been found to be involved in the regulation of the free-running period. [score:2]
The miRNA, bantam, was first shown to play vital roles in germline maintenance, peripheral nervous system dendrite growth, and eye development [42– 44]. [score:2]
It is worth noting that bantam was the first miRNA found to affect the circadian rhythms of flies. [score:1]
Like bantam, let- 7 also modulates the circadian period in Drosophila. [score:1]
Table 1 Characteristics of circadian-related miRNAs miRNA Target Orcadian phenotype Oscillation Conservation bantam clk Period N C. elegans and insects let-7 cwo Period and phasePeak at ZT8Trough at ZT16C. [score:1]
[1 to 20 of 9 sentences]
21
[+] score: 20
dMyc expression alone is not sufficient to prevent the elimination of yki mutant cells yki LOF clones generated in a wild type background are not able to grow [16], [25] and the ectopic expression of the antiapoptotic proteins dIAP1 [25] or p35 (Figure S10A) poorly rescues their viability, whereas a Minute background [53] or bantam overexpression within yki clones has been shown to partially rescue their growth [25]. [score:7]
The hyperphosphorylated form of Yki is retained in the cytoplasm [21], [22], thereby preventing the expression of several target genes involved in cell proliferation control (Cyclin E, E2F1, bantam miRNA) [16], [23]– [25], cell death (dIAP1) [16] and cell signaling regulation (dally and dally-like) [26]. [score:6]
yki LOF clones generated in a wild type background are not able to grow [16], [25] and the ectopic expression of the antiapoptotic proteins dIAP1 [25] or p35 (Figure S10A) poorly rescues their viability, whereas a Minute background [53] or bantam overexpression within yki clones has been shown to partially rescue their growth [25]. [score:5]
In addition, recent data indicate that Yki is also able to bind to the homeoprotein Homothorax (Hth) forming a complex which regulates the transcription of bantam in the eye disc [31]. [score:2]
[1 to 20 of 4 sentences]
22
[+] score: 19
We also detected a significant increase in steady-state levels of a subset of target mRNAs for several miRNAs implicated in cell proliferation and apoptosis (Reaper, E2f1 and Socs36E as targets for miR-2b, miR-184 and miR-bantam, respectively) (Fig 1H) [34, 35], consistent with the notion that miRNAs repress target gene expression by inhibiting mRNA translation and promoting target mRNA decay. [score:15]
Importantly, sequences derived from several pri-miRNAs, including Bantam, miR-2 family, miR-11, miR- 33 and miR- 34 were also recovered, thus demonstrating direct interactions between SmD1 and pri-miRNAs (Figs 3C, 5C, 5D and S9; S6 Table). [score:2]
Importantly, levels of several miRNAs, including miR-33, miR-34, miR-276a, miR-317, miR-2b, miR-184 and miR-bantam, were significantly reduced upon SmD1 knockdown (Fig 1B–1G), reminiscent of the phenotype elicited by the loss of the canonical miRNA biogenesis enzyme Drosha. [score:2]
[1 to 20 of 3 sentences]
23
[+] score: 18
For example, almost 80% of the cell lines acquired additional copies of the pri- bantam gene, and there was higher expression of the bantam microRNA (miRNA) in those cell lines. [score:3]
Indeed, pri- bantam and Pvr genes were highly expressed in the cell lines (Additional file 4). [score:3]
bantam is an anti-apoptotic miRNA that suppresses the pro-apoptotic function of Wrinkled (a. k. a. hid) and prevents proliferation -induced cell death [67]. [score:3]
These included dramatic recurrence of increased copy number of the PDGF/VEGF receptor, which is also over-expressed in many cancer cells, and of bantam, an anti-apoptosis miRNA. [score:3]
However, it is also possible that Rev1 copy number is simply driven by linkage to bantam as a passenger. [score:1]
In addition to the cell cycle, or apoptosis-related genes, frequent duplication (15 cell lines) of Rev1, which is near bantam, is also of note. [score:1]
In addition to bantam and Pvr, many genes involved in the JNK pathway [73] showed changes in copy number in the S2-DRSC and Kc167 cell lines. [score:1]
This strongly suggests that additional copies of the bantam gene are drivers providing selective advantages to cell lines. [score:1]
There are six annotated genes in this core duplicated segment (Figure  3C, asterisks): CR43334 (pri -RNA for bantam), UDP-galactose 4′-epimerase (Gale), CG3402, Mediator complex subunit 30 and UV-revertible gene 1 (Rev1). [score:1]
Indeed, bantam was the most abundant miRNA in 25 cell lines, which were surveyed in the small -RNA component of modENCODE [68]. [score:1]
[1 to 20 of 10 sentences]
24
[+] score: 16
Thus far, two major functions of Hth have been uncovered in the DP cell layer: 1) Hth, together with Tsh, suppresses the expression of the late RD genes eya and so, thus slowing down the conversion of early eye progenitors (Ey, Tsh and Hth positive) into more mature (Ey, Tsh, Eya and So positive) eye precursor cells, and 2) Hth together with Tsh and Yki enhances proliferation by inducing expression of the proliferation-promoting microRNA Bantam [14], [17], [23]– [25], [38]. [score:6]
Sd and Yki contribute to the up-regulation of the genes Diap1, Bantam and CyclinE, thereby promoting cell survival and proliferation in the developing wing epithelium [12]– [13], [15]. [score:3]
Recently, the transcription factors Homothorax (Hth), a TALE-type homeobox protein, and Teashirt, a zinc finger protein, have been shown to associate with Yki and contribute to the up-regulation of the pro-proliferation microRNA Bantam in eye progenitor cells [14]. [score:3]
These findings, together with the reported association of the Hth and Yki proteins in S2 cells and on the regulatory region of Bantam [14], suggest a potentially more complex relationship between Hth and Yki in the development of the PE. [score:2]
Mann and colleagues have shown that the homeobox protein Homeothorax (Hth) and Yki bind in vitro and directly regulate transcription of the gene Bantam in eye progenitor cells [14]. [score:2]
[1 to 20 of 5 sentences]
25
[+] score: 16
For expression pattern studies and hormonal treatments, we selected the three miRNAs more highly expressed (M-value between 1.6 and 5.3) in the N5 library (miR-252-3p, miR-276-5p and miR-190-5p) and the four more differentially expressed (M-value between −1.4 and −2.0) in the N6 library (bantam-3p, miR-100-5p, miR-125-5p and let-7-5p). [score:7]
In the cases of miR-276-5p, miR-190-5p, miR-252-5p and bantam-3p, there were expression bursts seen both in N5 and in N6, approximately corresponding to the peaks of 20E (Figure  2). [score:3]
These data do not correlate with quantitative sequencing data, which predicted that miR-276-5p and miR-190-5p should have shown much higher expression levels around the 20E peak of N5, whereas those of miR-252-5p and bantam-3p should have been much lower at this stage. [score:3]
However, the expression levels of miR-1-3p and miR-100-5p were significantly increased after treatment with 20E, whereas those of bantam-3p, miR-125-5p, miR-14-3p, miR-276-3p, miR-34-5p and let-7-5p showed a tendency to increase with respect to controls, although differences were not statistically significant. [score:3]
[1 to 20 of 4 sentences]
26
[+] score: 15
bantam activation in response to cell killing by IR or clonal cell deathTo detect ban activity, we used a published GFP transgene that is expressed from the tubulin promoter and includes 2 perfect ban target sequences in its 3′UTR, allowing for repression by ban [6]. [score:5]
A target of Yki is bantam microRNA [4], but ban was not examined in above-described studies. [score:3]
We found that killing cells by any one of three methods __ ptc-GAL4 -driven expression of dE2F1 [RNAi] or pro-apoptotic genes hid and rpr, exposure to ionizing radiation (IR) and clonal induction of Hid/Rpr __ activated an anti-apoptotic microRNA, bantam. [score:3]
bantam activation in response to cell killing in the ptc domain. [score:1]
We report here that, in the same experimental system, dying cells activate a pro-survival microRNA, bantam, in surviving cells. [score:1]
bantam activation in response to cell killing by IR or clonal cell death. [score:1]
bantam activation in response to cell killing in the ptc domainIn irradiated wing discs or in wing discs with Hid/Rpr clones, cell death was scattered but GFP ban sensor decreased throughout the disc. [score:1]
[1 to 20 of 7 sentences]
27
[+] score: 15
sal promotes microRNA bantam expressionWe previously found that one of the Dpp target genes omb represses ban expression in medial regions of the Drosophila wing discs while plays an opposite role in lateral regions 20. [score:7]
mircoRNA bantam is upregulated by sal. [score:4]
sal promotes microRNA bantam expression. [score:3]
The bantam enhancer reporter line was br-C12-lacZ 35. [score:1]
[1 to 20 of 4 sentences]
28
[+] score: 14
As expected, the expression of its reporter, Bantam sensor GFP, that reversely correlates with the microRNA bantam expression, was downregulated in the P compartment when Ack was overexpressed using hh-Gal4 (Figure 2g–h′), indicating an elevation of bantam transcription. [score:10]
Furthermore, microRNA bantam, a previously reported Yki target, has been shown to control cell proliferation and apoptosis [43, 44]. [score:3]
MS1096-Gal4, GMR-Gal4, hh-Gal4, hpo [BF33], Ex-lacZ, diap1-GFP4.3 and bantam sensor mic32-GFP were described previously [40, 68]. [score:1]
[1 to 20 of 3 sentences]
29
[+] score: 14
To assess the function of loqs in miRNA biogenesis, we isolated total RNA from loqs [f00791] males and determined the steady-state levels of mature and pre-miRNA for miR-277 and bantam (Figure 2A), which are both expressed in adult tissues. [score:3]
Asterisk: the 2S probe was not completely removed before the hybridization with the bantam probe, resulting in an additional band above the mature bantam RNA. [score:1]
We detected a 100-fold increase in pre-miR-277 and a 12-fold increase in pre- bantam RNAs in homozygous mutant loqs [f00791] males, but not in heterozygous loqs [f00791] or heterozygous or homozygous r2d2 mutant males. [score:1]
Relative to an unrelated dsRNA control, dsRNA corresponding to dcr-1 caused a approximately 9-fold and approximately 23-fold increase in steady-state pre-miR-277 and bantam levels, respectively, and dsRNA corresponding to loqs caused a approximately 2-fold and approximately 6-fold increase in steady-state pre-miR-277 and bantam levels, respectively. [score:1]
Eight days after incubating S2 cells with dsRNA corresponding to the first 300 nucleotides of the loqs coding sequence, we determined the steady-state levels of pre-miRNA and mature miRNA for miR-277 and bantam. [score:1]
In contrast, the amount of mature miR-277 or bantam was only slightly reduced in the loqs [f00791] homozygotes. [score:1]
shtml) accession numbers for the genes and gene products discussed in this paper are: bantam (MI0000387), let-7 (MI0000416), miR-277 (MI0000360), miR-7 (MI0000127), and TAR (RF00250). [score:1]
The membrane was first hybridized with the miR-277 probe, stripped and probed for 2S rRNA as a loading control, then stripped again and probed for bantam miRNA. [score:1]
Figure 2(A) Northern analysis of total RNA from wild-type, loqs [f00791] heterozygotes and homozygotes, and r2d2 heterozygotes and homozygotes for whole males, probed for miR-277 and bantam. [score:1]
Thus, Loqs is required for production in vivo of normal levels of miR-7, miR-277, and bantam, and the efficient conversion of pre- let-7 to mature let-7 in vitro. [score:1]
RNAi of dcr-2, r2d2, or drosha did not alter pre-miRNA levels for either miR-277 or bantam, nor did it alter Dcr-1 or Loqs levels. [score:1]
The following probes were used for detection: 5′-UCG UAC CAG AUA GUG CAU UUU CA-3′ for miR-277; 5′-CAG CTT TCA AAA TGA TCT CAC T-3′ for bantam; 5′-ACA ACA AAA UCA CUA GUC UUC CA-3′ for miR-7; 5′-TAC AAC CCT CAA CCA TAT GTA GTC CAA GCA-3′ for 2S rRNA. [score:1]
[1 to 20 of 12 sentences]
30
[+] score: 12
Yki acts through thread/DIAP to control tracheal tube lengthSince Yki does not appear to control tracheal size by regulating cell growth, we examined embryos mutant for the known Yki transcriptional targets: thread (th, which encodes the protein DIAP1- Drosophila Inhibitor of Apoptosis), expanded (ex), and bantam (ban). [score:6]
Since Yki does not appear to control tracheal size by regulating cell growth, we examined embryos mutant for the known Yki transcriptional targets: thread (th, which encodes the protein DIAP1- Drosophila Inhibitor of Apoptosis), expanded (ex), and bantam (ban). [score:6]
[1 to 20 of 2 sentences]
31
[+] score: 12
Other miRNAs from this paper: dme-mir-1, dme-mir-277, dme-let-7, dme-mir-137
The role of miR-277 in rCGG -mediated neurodegeneration seems specific, since the other miRNAs we found with altered expression in the presence of fragile X premutation rCGG repeats, including bantam, let-7, and miR-1, had no effect on the rCGG [90] eye phenotype. [score:4]
We generated UAS fly lines that could overexpress Drosophila miR-277, bantam, let-7, or miR-1, as well as bantam mutant lines (ban [12] and ban [20]) that we generated previously [41]. [score:3]
Alterations of the levels of bantam, let-7, or miR-1 by either a gain of function or loss of function had no effect on rCGG -mediated neurodegeneration (Figure 2E–2N). [score:1]
Alteration of bantam, let-7, or miR-1 does not modify the rCGG -induced eye phenotype (F, H, J, L, N). [score:1]
Genotypes are B-gmr-GAL4,UAS-CGG [90]-EGFP/+; C -gmr-GAL4/UAS-miR-277; D-gmr-GAL4, UAS-CGG [90]-EGFP/UAS-miR-277; E- gmr-GAL4/+;UAS-bantam/+; F-gmr-GAL4,UAS-CGG [90]-EGFP/+;UAS-bantam/+; G- gmr-GAL4/+;UAS-Let-7/+; H-gmr-GAL4,UAS-CGG [90]-EGFP/+;UAS-Let-7/+; I- gmr-GAL4/UAS-GFP;UAS-miR-1/+; J-gmr-GAL4,UAS-CGG [90]-EGFP/UAS-GFP;UAS-miR-1/+; K-gmr-GAL4/+;ban [12]/+; L-gmr-GAL4,UAS-CGG [90]-EGFP/+;ban [12]/+; M-gmr-GAL4/+;ban [20]/+; N-gmr-GAL4,UAS-CGG [90]-EGFP/+;ban [20]/+. [score:1]
Moreover, the miRNA bantam is found to be a potent modulator of poly-Q- and tau -associated degeneration in Drosophila [38]. [score:1]
Alteration of bantam, let-7 or miR-1 alone does not cause an abnormal eye phenotype (E, G, I, K, M). [score:1]
[1 to 20 of 7 sentences]
32
[+] score: 12
The mechanism involved in this G1-cell cycle arrest seems to involve downregulation of the dmyc proto-oncogene and the bantam micro -RNA, both of which act positively on E2F activity [42]. [score:4]
If a similar mechanism is involved in the N -mediated G1-arrest observed in socket and sheath cells, we anticipate that dmyc and bantam would be downregulated exclusively in N-on bristle cells, in particular in pIIa, sheath and socket cells. [score:4]
However, the analysis of dmyc and bantam expression in sensory organ cells was not consistent with this idea. [score:3]
Unexpectedly, bantam and dMyc were detected in N-on cell such as pIIa, socket or sheath cells (AA, not shown). [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 11
Notably, hid targeted by bantam has the second highest PicTar score within all our target predictions. [score:5]
For all settings S1–S3, hid is the top-scoring bantam target (PicTar score of 17.3) and has five anchor sites conserved in all flies. [score:3]
The overlap with PicTar predictions across settings S1–S3 is summarized in Table 3. The apoptosis gene hid/wrinkled is targeted by the microRNA bantam [24]. [score:3]
[1 to 20 of 3 sentences]
34
[+] score: 11
Other miRNAs from this paper: dme-mir-34, dme-mir-971, dme-mir-986, dme-mir-1012
For illustration, we chose bantam (Figure 2), a microRNA that is ubiquitously expressed and conserved with widespread associations in development and disease [20]. [score:6]
Our observations of nucleotide changes other than A to G also support this idea (e. g., in bantam and other microRNAs, data not shown). [score:1]
The overall pattern of the NGS analysis of bantam suggests that Dicer cleavage can occur at multiple sites resulting in different isoforms. [score:1]
In the case of bantam, our display may reflect differential biogenesis as in some libraries abundant reads do not match the canonical end sites (Fig. 2, compare the end sites with annotated 5P and 3P forms, shown as grey shades at the bottom). [score:1]
In bantam, we can observe a high number of read counts with the end positions on the 5P arm that differ from known mirBase annotations [21, 22]. [score:1]
Figure 2 The bantam stem-loop edited regions and NGS reads from libraries GSM280082 and GSM280087. [score:1]
[1 to 20 of 6 sentences]
35
[+] score: 11
An important validation of newly identified Hippo pathway components is the demonstration that they regulate expression of Yki target genes such as bantam (ban). [score:6]
Overexpression of tiptop enhances Yorkie -induced eye overgrowth and induces bantam expression. [score:5]
[1 to 20 of 2 sentences]
36
[+] score: 10
The activity of Notch and Wg signaling pathways spatially regulate the activity of bantam micro -RNA and the expression levels of the dMyc to mediate regulation of the E2F transcription factor and the transition of G1 to S-phase [10, 11]. [score:5]
In the EcR RNAi clones, Notch would still be abundant at the D/V boundary to autonomously delay cells in G1, via down regulation of dMyc and Bantam, however, in the absence of EcR these cells would be unable to progress through G2-M due to the decreased expression of CycB (Figures  2 and 4). [score:3]
Interestingly, only two factors, Crol and the bantam micro RNA, were found to de-repress silencing in cycling, but not differentiated cells, both of which have now been implicated in regulating cell cycle across the wing margin (this work, [11, 36, 48]). [score:2]
[1 to 20 of 3 sentences]
37
[+] score: 9
Active Yki translocates to the nucleus, where it forms a complex with the transcription factor Scalloped (Sd) [13], [14], [15] [or Mothers against Dpp (MAD), Teashirt (Tsh) or Homothorax (Hth)] [16] to induce the expression of target genes that promote (a) cell proliferation and cell survival like the bantam miRNA, myc, (b) cell cycle progression e. g., E2F1, cyclins A, B, E, and (c) inhibitors of apoptosis like drosophila inhibitor of apoptosis (diap1) [2], [3], [4], [5]. [score:9]
[1 to 20 of 1 sentences]
38
[+] score: 9
Without suppression from the Hpo signaling pathway, Yki enters nucleus and associates with transcription factors, such as Scalloped (Sd) [9], [10], Homothorax, Teashirt [11], and Mad [12] to induce the expression of such target genes, as bantam, cyclinE, and diap1, thereby promoting proliferation and inhibiting apoptosis. [score:9]
[1 to 20 of 1 sentences]
39
[+] score: 8
Dashed line indicates the levels of bantam-3p as a reference. [score:1]
The microRNA genes studied in that paper were mir-9b, mir-279, and bantam, all of which were detected in this study as maternal. [score:1]
Figure 2 shows the relative abundance of selected microRNAs (with respect to the average level of bantam-3p). [score:1]
The most abundant microRNAs in unfertilized eggs were produced by mir-92b, mir-184, the mir-310/mir-311/mir-312/mir-313 cluster, and bantam genes, which accounted for over half of the microRNA reads. [score:1]
In concordance to the high-throughput sequencing analysis presented in Figure 1, bantam-3p, mir-311-3p, and mir-92-3p were more abundant in the unfertilized egg than in the developing embryo. [score:1]
That is: [miR]/[bantam] = 2 [–ΔCt(miR)]/2 [–ΔCt(bantam)]. [score:1]
Relative expression values in Figure 2 for unfertilized eggs were calculated with respect to the average level of bantam-3p. [score:1]
Although the microRNA level varies substantially across biological replicates, the presence of seven of the maternal microRNAs here described is validated (bantam-3p, mir-311-3p, mir-92b-3p, mir-184-3p, mir-14-3p, mir-995-3p, and mir-9c-5p), although the levels of the latter two were relatively low. [score:1]
[1 to 20 of 8 sentences]
40
[+] score: 8
For example, the miRNA bantam has been shown to bind to the 3′ UTR of hid mRNA, thus regulating its expression (Brennecke et al., 2003). [score:4]
bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. [score:4]
[1 to 20 of 2 sentences]
41
[+] score: 7
Other miRNAs from this paper: dme-mir-5, dme-mir-6-1, dme-mir-6-2, dme-mir-6-3, dme-mir-7
The bantam miRNA predominantly associates with Ago1 [4], [9], [20]. [score:1]
The bantam probe was previously described [29]. [score:1]
For each library, the total number of reads of Drosophila miRNAs (all) is indicated, as well as the number of reads of bantam, miG-1, miG-2 and of the corresponding miR* species. [score:1]
RNA was extracted from I, S and B fractions and analyzed by northern blot using miG-1, miG-2, miG-1*, miG-2* and bantam radiolabeled probes. [score:1]
As expected from their preferential loading in Ago1, bantam (5.03% vs 31.27%) and miG-2 (0.15% vs 0.27%) relative abundances were reduced in the oxidized library. [score:1]
In agreement, we found bantam almost exclusively associated to Ago1. [score:1]
Small RNAs from this cell line were co-immunoprecipitated either with Ago1 or with Ago2-HA and analyzed by northern blotting using miG-1, miG-2, miG-1*, miG2* and bantam probes (Fig. 1E). [score:1]
[1 to 20 of 7 sentences]
42
[+] score: 7
The final wave, represented by CoMod-C, is expressed in late embryos and post-embryonic development and involves bantam, Mir-1, Mir-8, Mir-278, Mir- 281, Mir-252 and Mir-31. [score:4]
The most well-known is bantam, which is associated to basic functions in practically all stages of development [6]. [score:2]
The maternal loading of NFE involves conserved miRNAs such as let-7, Bantam, Mir-34, Mir-305, Mir-8, Mir-71 and Mir-1, all of which play roles in basic biological functions [6], as well as large amounts of MIR-bg5 miRNAs. [score:1]
[1 to 20 of 3 sentences]
43
[+] score: 7
In the progenitor domain, Yki associates with Hth and Tsh, and instead of promoting th expression, it drives expression of the pro-survival micro -RNA bantam, which represses translation of the cell death inducer hid (W) [11]. [score:7]
[1 to 20 of 1 sentences]
44
[+] score: 7
Among Hippo pathway targets are genes that promote cell proliferation and genes that inhibit apoptosis such as cyclin E, microRNA bantam, and diap1. [score:5]
In support of this distinction we note that the loss of the microRNA bantam has been shown to block Yki -driven proliferation in actively dividing cells of the wing disc, as well as cell proliferation during normal development [38], [39]. [score:2]
[1 to 20 of 2 sentences]
45
[+] score: 7
The miRNA-bantam target DNA template was amplified with T7 and T3 primers from pBS-miRNA-bantam-target [45] kindly provided by M. Siomi and H. Siomi. [score:4]
To test our assay system, we screened for the miRNA bantam that is known to be expressed in S2 cells [45]. [score:2]
As shown in Fig. S2D, bantam was readily detected in our pool of S2-specific sRNAs. [score:1]
[1 to 20 of 3 sentences]
46
[+] score: 7
While hid and other proapoptotic genes are targeted by other miRNAs, including bantam and the miR-2 family [5], [9], [10], none of these interactions has been shown to affect apoptotic pruning. [score:3]
However, under normal conditions bantam regulation of hid does not appear to impact upon apoptotic pruning or on survival of sense organs (our unpublished observation). [score:2]
bantam miRNA functions during tissue growth and regulates hid, to prevent proliferation induced apoptosis [9]. [score:2]
[1 to 20 of 3 sentences]
47
[+] score: 6
We used conserved sets obtained from randomized sequences to show that the number of targets we predict is much larger than the number expected by chance (see Figure 5A for an example with bantam, a D. melanogaster miRNA). [score:3]
Figure 5(A) Example showing that the number of predicted targets for D. melanogaster bantam is much larger than expected by chance. [score:3]
[1 to 20 of 2 sentences]
48
[+] score: 6
Other miRNAs from this paper: dme-mir-8, dme-let-7
Briefly, in 1 ml reaction, 10 mM creatine phosphate, 0.5 mM ATP, 30 μg/ml creatine kinase, 0.1 U/ul RNasin, 0.1 μg yeast RNA, and 500 μl nuclear lysate were added, and pri- miR-bantam in 0.5× Buffer A with 100 mM KOAc was further added to the mixture. [score:1]
Oligodeoxynucleotides used as probes were: bantam, 5′- CAGCTTTCAAAATGATCTCAC-3′; miR-8, 5′- GACATCTTTACCTGACAGTATTA-3′; U6 snRNA, 5′- GGGCCATGCTAATCTTCTCTGTA-3′; and let-7, 5′- AACTATACAACCTACTACCTCA-3. ′ The blots were exposed on BAS-MS2040 imaging plates, and signals were quantified using BAS-2500 (Fuji, Tokyo, Japan). [score:1]
shtml) accession numbers for the genes and gene products discussed in this paper are: bantam (MI0000387), let-7 (MI0000416), and miR-8 (MI0000128). [score:1]
We have previously shown that depletion of Dicer-1 by resulted in a marked accumulation of pre- miR-bantam (pre- miR-ban) [60]. [score:1]
The condition used for in vitro pre-miRNA processing with cytoplasmic lysates was the same as that for the in vitro pri- miR-bantam processing. [score:1]
The RNA was separated on a 12% denaturing polyacrylamide gel, transferred to a nylon membrane, and probed with 5′-radiolabeled miR-bantam (miR-ban) antisense oligodeoxynucleotide (top panel) and re-probed for U6 snRNA (bottom panel). [score:1]
[1 to 20 of 6 sentences]
49
[+] score: 6
In C. elegans, the miRNAs lin-4 (Lee et al. 1993; Olsen and Ambros 1999) and let-7 (Reinhart et al. 2000) regulate developmental timing, whereas the Drosophila miRNAs bantam and miR-14 control cell survival by repressing translation of proapoptotic genes (Brennecke et al. 2003; Xu et al. 2003). [score:5]
gov/LocusLink/) ID numbers for the genes discussed in this paper are alg-1 (181504), alg-2 (173468), bantam (117376), let-7 (266954), lin-4 (266860), lin-41 (172760), miR-14 (170868), and rde-4 (176438). [score:1]
[1 to 20 of 2 sentences]
50
[+] score: 6
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, dme-mir-1, dme-mir-8, dme-mir-11, hsa-mir-34a, hsa-mir-210, dme-mir-184, dme-mir-275, dme-mir-92a, dme-mir-276a, dme-mir-277, dme-mir-33, dme-mir-281-1, dme-mir-281-2, dme-mir-34, dme-mir-276b, dme-mir-210, dme-mir-92b, dme-mir-309, dme-mir-317, hsa-mir-1-2, hsa-mir-184, hsa-mir-190a, hsa-mir-1-1, hsa-mir-34b, hsa-mir-34c, aga-bantam, aga-mir-1, aga-mir-184, aga-mir-210, aga-mir-275, aga-mir-276, aga-mir-277, aga-mir-281, aga-mir-317, aga-mir-8, aga-mir-92a, aga-mir-92b, hsa-mir-92b, hsa-mir-33b, hsa-mir-190b, dme-mir-190, dme-mir-957, dme-mir-970, dme-mir-980, dme-mir-981, dme-mir-927, dme-mir-989, dme-mir-252, dme-mir-1000, aga-mir-1174, aga-mir-1175, aga-mir-34, aga-mir-989, aga-mir-11, aga-mir-981, aga-mir-1889, aga-mir-1890, aga-mir-1891, aga-mir-190, aga-mir-927, aga-mir-970, aga-mir-957, aga-mir-1000, aga-mir-309, cqu-mir-1174, cqu-mir-281-1, cqu-mir-1, cqu-mir-275, cqu-mir-957, cqu-mir-277, cqu-mir-252-1, cqu-mir-970, cqu-mir-317-1, cqu-mir-981, cqu-mir-989, cqu-mir-1175, cqu-mir-276-1, cqu-mir-276-2, cqu-mir-276-3, cqu-mir-210, cqu-mir-92, cqu-mir-190-2, cqu-mir-190-1, cqu-mir-1000, cqu-mir-11, cqu-mir-8, cqu-bantam, cqu-mir-1891, cqu-mir-184, cqu-mir-1890, cqu-mir-980, cqu-mir-33, cqu-mir-2951, cqu-mir-2941-1, cqu-mir-2941-2, cqu-mir-2952, cqu-mir-1889, cqu-mir-309, cqu-mir-252-2, cqu-mir-281-2, cqu-mir-317-2, aga-mir-2944a-1, aga-mir-2944a-2, aga-mir-2944b, aga-mir-2945, aga-mir-33, aga-mir-980
Additionally, the prevalence of the miRNA* strand for several miRNAs, such as miR-1889, miR-8, and bantam, expands the potential of miRNA regulation in an organism by adding to the number of possible miRNA seeds and thus adding new mRNA targets. [score:4]
miRNA* strands for several miRNAs, including miR-8, miR-1889, and bantam, were sequenced a significant number of times, and thus are annotated with 5p or 3p (Tables 1, 2). [score:1]
For example, in total RNA from C7/10 cells, bantam-3p was sequenced 475 times, and therefore accounts for a greater percentage of the small RNA population than those mature miRNAs sequenced less than 400 times. [score:1]
[1 to 20 of 3 sentences]
51
[+] score: 6
bmo-let-7b, bmo-let-7c, bmo-miR-9, bmo-miR-9*, bmo-miR-100-like, bmo-miR-263a, bmo-miR-31 and bmo-bantam were expressed in larva and pupa, but were not detected in moth; of these miRNAs, bmo-miR-9 and bmo-miR-9* are also complementary miRNAs. [score:3]
We designated these sequences bmo-miR-13a*, bmo-miR-14, bmo-miR-46, bmo-miR-46*, bmo-miR-71, bmo-miR-277 and bmo-bantam. [score:1]
bmo-miR-279 and other mir-279 precursor sequences have sequence similarities of >55%; bmo-miR-277 precursors share >56% sequence similarity; bmo-miR-27 precursors share >57% sequence similarity; bmo-miR-71 precursors share >59% sequence similarity; and bmo-bantam precursors share >60% sequence similarity. [score:1]
Members of the bantam, mir-71, mir-275, mir-277, mir-279 miRNA families have a high degree of similarity in their precursor sequences. [score:1]
[1 to 20 of 4 sentences]
52
[+] score: 6
Studies of other growth drivers, such as the miRNA bantam, have demonstrated that genes stimulating cell proliferation can simultaneously suppress apoptosis [31]. [score:3]
M000369200) 31 Brennecke J, Hipfner DR, Stark A, Russell RB, Cohen SM 2003 Bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. [score:3]
[1 to 20 of 2 sentences]
53
[+] score: 5
These findings suggest that Sox21a and bantam are novel contributors to the damage -induced regulation of ISC activity. [score:2]
Finally, we focus on several additional regulators of ISC proliferation, including Sox21a, bantam, Src non-receptor kinases and the zinc-finger protein Chn. [score:2]
Furthermore, Zhang L and colleagues have provided fascinating new insights into the functional role of bantam, specifically revealing the relationship between precursor-specific bantam and pathogen -induced ISC division [126]. [score:1]
[1 to 20 of 3 sentences]
54
[+] score: 5
The two control miRNAs, bantam-3p and miR-92b-3p, whose expression levels remained consistent across all samples according to RNA-seq data, also showed no significant changes as determined by qRT-PCR. [score:3]
Two miRNAs, bantam-3p and miR-92b-3p were chosen as controls as their levels remained the same in knockdown and parental samples. [score:2]
[1 to 20 of 2 sentences]
55
[+] score: 5
Other miRNAs from this paper: dme-mir-277, dme-mir-34, dme-let-7
For example, the bulk population of the canonical miRNA bantam is sensitive to ß-elimination, and this is due to its dominant sorting to AGO1. [score:1]
Under these conditions, we confirmed substantial depletion of mature bantam and strong accumulation of pre-bantam (Figure 7A). [score:1]
Note though that, depletion of AGO1 results in loss of most bantam signals, whereas a larger isoform of miR-144 accumulates (compare arrowhead versus arrow); subsequent analysis indicated that the larger miR-144 isoform is loaded into AGO2 complex. [score:1]
The canonical loci miR-144 and bantam exhibit the expected dependencies on these miRNA factors. [score:1]
Most of the pool of the canonical miRNA bantam, which is preferentially loaded in AGO1, is amenable to ß-elimination. [score:1]
[1 to 20 of 5 sentences]
56
[+] score: 5
Generation of MRE deletions in Drosophila by CRISPR-Cas9To realize the potential of our strategy in elucidating the functional significance of MREs throughout development, we next investigated the effect of removing a well-studied target site for the miRNA bantam (ban) in the enabled (ena) gene in Drosophila. [score:2]
To realize the potential of our strategy in elucidating the functional significance of MREs throughout development, we next investigated the effect of removing a well-studied target site for the miRNA bantam (ban) in the enabled (ena) gene in Drosophila. [score:2]
The following Drosophila lines were used for analysis of third instar wing imaginal discs: dpp-Gal4, UAS-CD8-EGFP (Bloomington Stock Center); ena-3′UTR-sensor and UAS-bantam were a generous gift from Marco Milan 15. [score:1]
[1 to 20 of 3 sentences]
57
[+] score: 5
When the activity of the kinase cascade is compromised, unphosphorylated or under-phosphorylated Yki enters the nucleus and interacts with the TEAD/TEF family transcription factor Scalloped (Sd) to regulate Hpo pathway target genes including ex, cyclin E, diap1 and the microRNA bantam, which regulate cell growth, proliferation and survival [14, 16, 17]. [score:5]
[1 to 20 of 1 sentences]
58
[+] score: 5
Yki inactivation results in silencing of its target genes, including progrowth and anti-apoptotic factors such as cyclin E, Drosophila inhibitor of apoptosis-1 (DIAP1), and microRNA bantam [25]. [score:5]
[1 to 20 of 1 sentences]
59
[+] score: 4
Additionally, we noted that banA, a CRE from the bantam gene, a known direct Hth target in the eye is also bound by Ey (Fig. 5I) [18]. [score:4]
[1 to 20 of 1 sentences]
60
[+] score: 4
Other miRNAs from this paper: dme-mir-184, dme-mir-972, dme-mir-975, dme-mir-977
Furthermore, mir-977 has higher expression variance in the testes of multiple D. melanogaster lines than the conserved miRNAs that have important developmental functions (miR-184, bantam etc. [score:4]
[1 to 20 of 1 sentences]
61
[+] score: 4
Only one direct transcriptional target of the Hth:Tsh:Yki complex has been functionally validated to date, though, the miRNA-encoding gene bantam (ban) [11]. [score:4]
[1 to 20 of 1 sentences]
62
[+] score: 4
bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. [score:4]
[1 to 20 of 1 sentences]
63
[+] score: 4
It is very important in regulating the transcription of another Yki target, the growth promoting microRNA gene bantam. [score:4]
[1 to 20 of 1 sentences]
64
[+] score: 4
Other miRNAs from this paper: dme-mir-8, dme-mir-219, dme-mir-282
In particular, bantam was shown to regulate CLK expression and thus to affect the amplitude of circadian rhythms [77]. [score:4]
[1 to 20 of 1 sentences]
65
[+] score: 4
Known targets of the Hpo pathway include the cell survival and proliferation regulators cyclin E (cycE) and diap1 and a microRNA, bantam [21], [22]. [score:4]
[1 to 20 of 1 sentences]
66
[+] score: 3
The microRNA bantam regulates a developmental transition in epithelial cells that restricts sensory dendrite growth. [score:3]
[1 to 20 of 1 sentences]
67
[+] score: 3
Several evidence also suggest than B2 sequesters siRNA duplexes, preventing their loading into Ago-2. In contrast, both these VSRs failed to inhibit the silencing of reporter systems by the endogenous miRNAs miR-2b, bantam or miR-7 [35– 37]. [score:3]
[1 to 20 of 1 sentences]
68
[+] score: 3
The ago2 [dop1] Mutation Does Not Interfere with the Activity of the miRNA bantam (ban). [score:2]
Figure S6The ago2 [dop1] Mutation Does Not Interfere with the Activity of the miRNA bantam (ban) To test for miRNA activity, we employed an eye -based reporter assay for the function of ban. [score:1]
[1 to 20 of 2 sentences]
69
[+] score: 3
Most work on tissue growth has focused on Yki target genes that control basic cell parameters, such as survival, mass increase, and proliferation (e. g., diap, bantam, and cyclinE). [score:3]
[1 to 20 of 1 sentences]
70
[+] score: 3
Other miRNAs from this paper: hsa-mir-134
The microRNA bantam regulates the scaling of da neuron arbors in Drosophila. [score:2]
However, bantam functions within the epidermis, not the da neuron (Parrish et al. 2009). [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 3
The Hippo pathway regulates the bantam microRNA to control cell proliferation and apoptosis in. [score:2]
Inactivation of Yki restricts cell growth (for example, due to decreased bantam (ban) transcription [70] and myc transcription [71–72], not pictured) and impairs S-phase entry by decreasing cyclin E transcription [26]. [score:1]
[1 to 20 of 2 sentences]
72
[+] score: 3
When Yki is not phosphorylated, it is imported to the nucleus and interacts with transcription factors such as Scalloped (Sd) to induce target genes such as cyclin E, Myc, Diap, expanded (ex), or bantam to promote cell proliferation and survival [31]. [score:3]
[1 to 20 of 1 sentences]
73
[+] score: 3
In both the haltere and T3 leg, we also observe Ubx binding to two genes in the Hippo signaling pathway, the microRNA bantam (ban) and expanded (ex), which is required for cell proliferation and survival [47], [48] (Figure 5F,G). [score:1]
0014686.g005 Figure 5Ubx and Hth binding profiles at the Dpp pathway components thickveins (tkv) (A), dally (B), and notum (C); at the Wg pathway components frizzled 2 (fz2) (D), and wingless (wg) (E); at the Hippo pathway components bantam (ban) (F) and expanded (ex) (G); and at the Notch pathway components Notch (N) (H), mind bomb 1 (mib1) (I), and fringe (fng) (J). [score:1]
Color scheme and tracks are as described in Figure 4. Ubx and Hth binding profiles at the Dpp pathway components thickveins (tkv) (A), dally (B), and notum (C); at the Wg pathway components frizzled 2 (fz2) (D), and wingless (wg) (E); at the Hippo pathway components bantam (ban) (F) and expanded (ex) (G); and at the Notch pathway components Notch (N) (H), mind bomb 1 (mib1) (I), and fringe (fng) (J). [score:1]
[1 to 20 of 3 sentences]
74
[+] score: 3
Yang Y. Xu S. Xia L. Wang J. Wen S. Jin P. Chen D. The bantam microRNA is associated with drosophila fragile X mental retardation protein and regulates the fate of germline stem cellsPLoS Genet. [score:2]
The tight link between dFMR1 and the miRNA pathway has emerged from the interaction between the Fragile-X protein and the bantam miRNA to control germline stem cells in the ovary of Drosophila [142]. [score:1]
[1 to 20 of 2 sentences]
75
[+] score: 3
Among the highly expressed; bantam, miR-184, miR-81, miR-100, miR-92, miR-2766, miR-279 are listed in the top (S1 Table) and these findings are in concurrence with recent reports [19]. [score:3]
[1 to 20 of 1 sentences]
76
[+] score: 3
These included miR-SPs targeting bantam, miR-1, the K-box family (miR-2b, miR-2c and miR-13b displayed strong phenotypes; miR-2a and miR-13a were flight impaired but fell below our stringent cutoff; ), miR-7, the miR-31 family, miR-34, miR-190, miR-957, miR-986, miR-987 and miR-1001. [score:3]
[1 to 20 of 1 sentences]
77
[+] score: 3
The broadly expressed and non-sex-specific microRNA bantam was used as an internal control and the comparative Ct method was used to compare miRNA amounts between samples. [score:3]
[1 to 20 of 1 sentences]
78
[+] score: 3
Several gene targets of Hippo signaling have been identified in Drosophila, including cyclin E, diap1, and the microRNA bantam, which may modulate cell proliferation and survival [1],[12],[14],[28],[29]. [score:3]
[1 to 20 of 1 sentences]
79
[+] score: 3
Combined we identified seven miRNA lines (Pictured: miR-263a, miR-2a-2, and miR-2491; Not shown: bantam, miR-33, miR-308, and miR-973/974) that reduce the expression of the Or47b reporter. [score:3]
[1 to 20 of 1 sentences]
80
[+] score: 3
First, we observed that activity of the microRNA and Yki target gene bantam was high (Bantam-GFP levels were low) in some APC [−/−] clones (Figures S6A and S6B). [score:3]
[1 to 20 of 1 sentences]
81
[+] score: 2
Oh H. Irvine K. D. (2011) Cooperative regulation of growth by Yorkie and Mad through bantam. [score:2]
[1 to 20 of 1 sentences]
82
[+] score: 2
Other miRNAs from this paper: dme-mir-7
We performed Northern blot analysis to examine the levels of bantam and mir-7, two microRNAs, in wild type and lump [1] mutants. [score:1]
Northern blots for bantam and mir-7 miRNAs reveal no differences in quantity of mature miRNA in lump [1] mutant flies. [score:1]
[1 to 20 of 2 sentences]
83
[+] score: 2
For example, for the bantam miRNAs, which has shown to be involved in the regulation of cell growth [47, 48], the overlap is quite large. [score:2]
[1 to 20 of 1 sentences]
84
[+] score: 2
The Hippo pathway regulates the bantam microRNA to control cell proliferation and apoptosis in Drosophila. [score:2]
[1 to 20 of 1 sentences]
85
[+] score: 2
Transcription factor choice in the Hippo signaling pathway: homothorax and yorkie regulation of the microRNA bantam in the progenitor domain of the Drosophila eye imaginal disc. [score:2]
[1 to 20 of 1 sentences]
86
[+] score: 2
Other miRNAs from this paper: bmo-bantam
Cooperative regulation of growth by Yorkie and Mad through bantam. [score:2]
[1 to 20 of 1 sentences]
87
[+] score: 2
Transcription factor choice in the Hippo signaling pathway: homothorax and yorkie regulation of the microRNA bantam in the progenitor domain of the Drosophila eye imaginal disc. [score:2]
[1 to 20 of 1 sentences]
88
[+] score: 2
The bantam microRNA is associated with drosophila fragile X mental retardation protein and regulates the fate of germline stem cells. [score:2]
[1 to 20 of 1 sentences]
89
[+] score: 2
The Hippo pathway regulates the bantam microRNA to control cell proliferation and apoptosis in Drosophila. [score:2]
[1 to 20 of 1 sentences]
90
[+] score: 2
bantam miRNA is important for Drosophila blood cell homeostasis and a regulator of proliferation in the hematopoietic progenitor niche. [score:2]
[1 to 20 of 1 sentences]
91
[+] score: 2
The microRNA bantam functions in epithelial cells to regulate scaling growth of dendrite arbors in drosophila sensory neurons. [score:2]
[1 to 20 of 1 sentences]
92
[+] score: 2
The microRNA bantam functions in epithelial cells to regulate scaling growth of dendrite arbors in drosophila sensory neurons. [score:2]
[1 to 20 of 1 sentences]
93
[+] score: 2
The microRNA bantam functions in epithelial cells to regulate scaling growth of dendrite arbors in drosophila sensory neurons. [score:2]
[1 to 20 of 1 sentences]
94
[+] score: 2
Transcription factor choice in the Hippo signaling pathway: homothorax and yorkie regulation of the microRNA bantam in the progenitor domain of the Drosophila eye imaginal disc. [score:2]
[1 to 20 of 1 sentences]
95
[+] score: 2
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-29c, hsa-mir-602
Peng H. W. Slattery M. Mann R. S. Transcription factor choice in the hippo signaling pathway: Homothorax and yorkie regulation of the microrna bantam in the progenitor domain of the drosophila eye imaginal disc Genes Dev. [score:2]
[1 to 20 of 1 sentences]
96
[+] score: 1
In both strains, miR-184-3p miRNA was the most abundant among the means of non-normalized reads across triplicate libraries, with miR-8-3p, miR-276a-3p, bantam-3p, and miR-33-5p as the next most abundant miRNAs in both strains (Table 2). [score:1]
[1 to 20 of 1 sentences]
97
[+] score: 1
Bantam-3p and dme-miR-1-3p are primarily enriched in 60S and 80S fractions, respectively (Table 2). [score:1]
[1 to 20 of 1 sentences]
98
[+] score: 1
The UAS-dsxM construct [30] contains most of the male-specific 3′UTR, including a predicted recognition site for the bantam miRNA. [score:1]
[1 to 20 of 1 sentences]
99
[+] score: 1
The Mahakali effect requires tie, which encodes a receptor tyrosine kinase, and occurs through activation of an anti-apoptotic microRNA, bantam, in the protected cells. [score:1]
[1 to 20 of 1 sentences]
100
[+] score: 1
Other miRNAs from this paper: mmu-mir-122, dme-mir-277, dme-mir-289, mmu-mir-16-1, mmu-mir-16-2
The following probes were used for detection: 5′-TGT CGT CCA GAT AGT GCA TTT A-3′ for miR-277; 5′-AGT CGC AGG CTC CAC TTA AAT ATT TA-3′ for miR-289; 5′-CAG CTT TCA AAA TGA TCT CAC T-3′ for bantam. [score:1]
[1 to 20 of 1 sentences]