sort by

16 publications mentioning mmu-mir-292a

Open access articles that are associated with the species Mus musculus and mention the gene name mir-292a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 188
Upon STI treatment (42 hrs, 1 µM) we observed a decrease in GFP expression relative to tomato red expression, in the miR290-5p or miR292-5p sponges, suggesting that the sponges were engaging with the target miRNAs (Figure S2). [score:7]
qPCR analysis of κGT expression in RNA purified from E2A+/+ AMuLV cells expressing a miR290-5p or miR292-5p sponge knockdown construct, and cultured in the presence of STI571 (2.5 µM) for the indicated lengths of time. [score:6]
3B, C. qPCR analysis of (B) κGT or (C) Rag1 expression in RNA purified from wild-type primary pro-B cells transduced with either a miR129-2_3p control knockdown sponge, or a miR290-5p or miR292-5p knockdown sponge. [score:5]
analysis of HF4 AMuLV cells expressing His-FLAG-E2A, at endogenous levels, and over -expressing either miR129-2_3p, miR290-5p, or mir292-5p. [score:5]
Figure S3 Over -expression of miR290-5p or miR292-5p do not decrease E2A mRNA expression. [score:5]
0043805.g002 Figure 22A, B. qPCR analysis of (A) κGT or (B) Rag1 expression in RNA purified from E2A+/+ AMuLV cells over -expressing either miR290-5p or miR292-5p, cultured in the absence or presence of STI571 (2.5 µM, 12 hr). [score:5]
To determine if factors upstream of NF-κB are affected by miR290-5p/miR292-5p expression, we examined IκBα (18035), a known inhibitor of NF-κB [29]. [score:5]
To confirm our miRNA knockdown results that implicated both miR290-5p and miR292-5p as playing a role in activating the kappa locus, we used the miR290 cluster knockout mice to analyze κGT expression in pro-B, large pre-B (B220+, CD43−, IgM− FSC−Hi), and small pre-B cell (B220+, CD43−, IgM− FSC-Lo) populations. [score:5]
miR290-5p and miR292-5p are independently able to induce expression of κGT expression as well as increase DNA binding activity of NF-κB and E2A. [score:5]
2A, B. qPCR analysis of (A) κGT or (B) Rag1 expression in RNA purified from E2A+/+ AMuLV cells over -expressing either miR290-5p or miR292-5p, cultured in the absence or presence of STI571 (2.5 µM, 12 hr). [score:5]
It is possible that the target of miR290-5p/miR292-5p is an unknown inhibitor of one or both of these transcription factors, or a factor that is further upstream in the pathway. [score:5]
Over -expression of miR290-5p or miR292-5p induces κGT expression in AMuLV cells. [score:5]
To confirm that the apparent role of miR290-5p and miR292-5p in the activation of κGT observed in these experiments was not an artifact of over -expression, we generated miRNA sponge constructs to perform knockdown experiments. [score:4]
The gene encoding a known inhibitor of E2A activity, ID2 [28] (15902), has predicted binding sites for miR290-5p/miR292-5p in its 3′UTR. [score:3]
To confirm whether miR290-5p, miR292-5p, and more broadly the miR290 cluster are involved in B cell development, we analyzed B cell development in miR290 cluster knockout as compared to wild-type mice [7]. [score:3]
These data indicate that miR290-5p or miR292-5p expression induces binding of NF-κB to Eκi within the kappa locus. [score:3]
Together these data indicate that miR290-5p and miR292-5p independently contribute to the induction of κGT expression in primary pre-B cells. [score:3]
We observed increased p50 binding to Eκi in both miR290-5p and miR292-5p over -expressing cells and this binding was further increased in the presence of STI571 (Fig. 4b). [score:3]
So we asked if miR290-5p or miR292-5p over -expression enhances E2A binding to Eκi in vivo. [score:3]
Immunoblot analysis of E2A+/+ AMuLV cells expressing either an empty vector control, miR290-5p, or miR292-5p and cultured in either the absence or presence of STI571 (2.5 µM, 12 hr). [score:3]
qPCR analysis of miR291-5p, miR290-3p, and miR292-3p expression levels in RNA purified from primary wild-type pro-B (B220+, CD43+, IgM−) or pre-B (B220+, CD43−, IgM−) cells. [score:3]
analysis of E2A+/+ AMuLV cells over -expressing either miR129-2_3p, miR290-5p, or mir292-5p, in the absence or presence of STI571 (1 µM, 16 hr). [score:3]
We stably expressed miR129-2_3p, miR290-5p, or miR292-5p in this cell line and performed with anti-FLAG or anti-IgG antibodies. [score:3]
Two of the miRNAs identified in the screen as having expression consistently and significantly increased across all three independently transformed AMuLV-transformed pro-B cell lines (Fig. 1a) were miR290-5p and miR292-5p. [score:3]
QPCR analysis of E2A+/+ AMuLV cells expressing either an empty vector control, miR290-5p, or miR292-5p for (A) E12 or (B) E47. [score:3]
Protein levels for IκBα are repressed upon miR290-5p or miR292-5p over -expression to similar levels as observed in the STI571 -treated control sample. [score:3]
Using qPCR to analyze the precipitated DNA, we observed increased E2A-FLAG binding to Eκi in both miR290-5p and miR292-5p over -expressing cells (Fig. 4a). [score:3]
We stably expressed miR129-2-_3p, miR290-5p, or miR292-5p in this cell line and performed with anti-p50 (18033) (an NF-κB subunit) or anti-IgG antibodies. [score:3]
Together, these data indicate that members of the miR290 polycistronic cluster, miR290-5p and miR292-5p are involved in the activation of the kappa locus as indicated by expression of κGT. [score:3]
Over -expression of miR290-5p or miR292-5p induces activation of E2A and NF-κB. [score:3]
There are few validated targets for miR290-5p or miR292-5p, but this group may include p16 [38] (12578) and Lats1 (16798), two genes implicated in cell cycling. [score:3]
However, in the presence of the miR290-5p or miR292-5p sponges, IL7 withdrawal resulted in a significantly diminished induction of κGT expression (Fig. 3b). [score:3]
Likewise, a known inhibitor of E2A, ID2 [28], has predicted binding sites for miR290-5p/miR292-5p in its 3′UTR, but the ID2 3′UTR was not repressed by the miRNAs. [score:3]
Upon stable over -expression of either miR290-5p or mir292-5p, we observed an induction in κGT (Fig. 2a), but not to the levels seen in wild-type AMuLV-transformed pro-B cells treated with STI571. [score:3]
miR129-2_3p is expressed at similar levels as miR290-5p and miR292-5p at the pre-B stage, and is not induced at the pro-to pre-B stage in primary B cells or upon STI571 treatment of AMuLV-transformed pro-B cells (data not shown). [score:3]
We did not observe an increase in E2A mRNA levels upon miR290-5p/miR292-5p over -expression. [score:3]
These data indicate that miR290-5p or miR292-5p expression induces binding of E2A to Eκi within the kappa locus. [score:3]
Over -expression of miR290-5p or miR292-5p Induces Germline Igκ Transcription in AMuLV Cells. [score:3]
This study demonstrates that developing B cells induce expression of miR290-5p and miR292-5p at the pre-B stage to fully activate the germline Igκ locus, a critical event in the pro-to-pre-B cell transition. [score:3]
qPCR analysis of miR290-5p or miR292-5p expression levels in RNA purified from E2A+/+ AMuLV cells cultured in the absence or presence of STI571 (2.5 µM, 12 hr). [score:3]
To further test the role of miR290-5p and miR292-5p in the activation of the kappa locus observed in our AMuLV mo del system, we performed similar sponge knockdown experiments in a primary developing B cell culture system. [score:2]
We observed indistinguishable induction of Rag1 gene expression upon IL7 withdrawals in miR292-5p as compared to miR129-2_3p negative control sponge cultures (Fig. 3c). [score:2]
It was reported previously that upon IL7 withdrawal, the amount of bound E2A increases at Eκi [20] and knockdown of miR290-5p or mir292-5p upon IL7 withdrawal blunts κGT induction as shown above. [score:2]
We propose a novel role for miR290-5p and miR292-5p in the activation of the kappa locus during B cell development. [score:2]
Using specific Taqman qPCR assays, we confirmed that both miR290-5p and miR292-5p display a modest increase in expression upon STI571 treatment (Fig. 1c). [score:2]
This blunting of κGT induction upon knockdown of endogenous drug -induced miR290-5p or miR292-5p indicates that these miRNAs partially contribute to the activation of the kappa locus upon STI571 treatment of AMuLV-transformed cells. [score:2]
Despite having predicted miR290-5p/miR292-5p binding sites in its 3′UTR, a luciferase mRNA fused to the IκBα 3′UTR was not directly repressed by these miRNAs. [score:2]
κGT induction is blunted upon knockdown of miR290-5p or miR292-5p. [score:2]
Rag1 induction remained intact in both the AMuLV pro-B cells as well as the IL7 -dependent primary B cell cultures, upon knockdown of miR290-5p or mir292-5p, while κGT induction was blunted. [score:2]
Figure S4 miR290-5p or miR292-5p do not directly repress the ID2 3′UTR. [score:2]
Our studies have uncovered a novel role for miR290-5p and miR292-5p in this key developmental process. [score:2]
In an effort to elucidate the pathway through which miR290-5p or miR292-5p induce κGT, we examined transcription factors known to be involved in the induction of κGT by direct binding to either the 3′ kappa enhancer (3′Eκ) or the kappa intronic enhancer (Eκi). [score:2]
miR290-5p and miR292-5p are members of the miR290 polycistronic cluster [6]. [score:1]
In our study we observe a more modulatory role for the CUCAAA members of this cluster, miR290-5p and miR292-5p. [score:1]
Binding sites were as follows: miR129-2_3p: ATGCTTTTTGTTTGAAGGGCTT, miR290-5p: AAAGTGCCCCACCCGTTTGAGT, miR292-5p: CAAAAGAGCCAAACGTTTGAGT. [score:1]
E2A+/+ AMuLV cells were stably transduced with tandem tomato marked sponge constructs for miR129-2_3p, mir290-5p, or miR292-5p. [score:1]
The miR30 cassette was replaced with either miR129-2_3p, miR290-5p, or miR292-5p. [score:1]
Interestingly, the AAGUCC miRNAs, including miR* counterparts miR290-3p and miR292-3p, are not detected in our system (Figure S1). [score:1]
In summary, we identified two miRNAs, miR290-5p and miR292-5p, that are induced in pre-B cells. [score:1]
Schematic depiction of the shared seed sequence of the mature miR290-5p and miR292-5p microRNAs. [score:1]
However, we observed a blunting of normal κGT induction in the miR290-5p or miR292-5p sponge lines (Fig. 3a). [score:1]
We then retrovirally transduced the expanded pro-B cell culture with either the negative control, miR290-5p, or miR292-5p sponges. [score:1]
miR290-5p and miR292-5p Enhance DNA Binding Activity of E2A and NF-κB. [score:1]
qPCR analysis of miR290-5p or miR292-5p in primary wild-type pro-B (B220+, CD43+, IgM−) cells or pre-B (B220+, CD43−, IgM−) cells. [score:1]
miR290-5p and miR292-5p are induced at the pro-B to pre-B transition. [score:1]
It is possible that miR290-5p/miR292-5p induction upon STI571-treatment of Abelson cells and IL7 attenuation in primary B cell cultures, is a consequence of either cell cycle arrest or activation of the apoptosis pathway known to occur under these circumstances. [score:1]
Our screen identified two miRNAs, miR290-5p and miR292-5p, that originate from the miR290 Cluster transcript and share an identical seed-sequence. [score:1]
We sorted pro-B (B220+, CD43+, IgM−) and pre-B (B220+, CD43−, IgM−) cells from wild-type mouse bone marrow by flow cytometry, purified total RNA, and performed qPCR for quantification of miR290-5p and miR292-5p. [score:1]
[1 to 20 of 68 sentences]
2
[+] score: 57
0108519.g005 Figure 5(A) Predicted secondary structures of the duplexes formed between miR-292-3p+1 and miR-371-3p+1 with the 3-7CG-B target and of miR-293-3p+2 and miR-371-3p+2 with the 4-7CGC-B target. [score:5]
Surprisingly, rescue experiments in miR-290-295 knockout ES cells revealed that the silencing of the 2-7C-S reporter was not absolutely dependent on the presence of the pre-miR-292 hairpin (Figure 4C, +Δ292, rescue with an expression vector lacking pre-miR-292). [score:4]
Importantly, the inefficient silencing of the 4-7CG-B reporter demonstrates that 6mer seed (positions 2–7) pairing of any putative 3p+2 isoforms does not contribute significantly to the silencing of 7mer target 3-7CG-B. Rescue experiments in miR-290–295 knockout ES cells confirmed that silencing of the 3-7CG-B reporter depends on pre-miR-292 and silencing of the 4-7CGC-B reporter depends on pre-miR-293 (Figure 5C, D). [score:4]
Furthermore, the lack of high confidence targets for the pre-miR-290/pre-miR-292/pre-miR-293 seeds in HITS-CLIP data from mouse ES cells suggests that the corresponding miRNAs might be physiologically relevant in other biological contexts such as the extraembryonic lineages and/or TS and XEN cells. [score:3]
The pre-miRNA relationships deduced from the seed expression data are also consistent with the clustering of pre-miR-371, pre-miR-290, pre-miR-292 and pre-miR-293 in a separate branch of the multiple sequence alignment UPMGA tree (Figure 1A). [score:3]
Mo dels of the miR-290–295/miR-371–373 target interaction networks should incorporate the pre-miR-371/pre-miR-290/pre-miR-292/pre-miR-293 seeds. [score:3]
Thus, silencing of the bulge reporters proves that active miR-292-3p+1 and miR-293-3p+2 isoforms are expressed in mouse ES cells. [score:3]
The incorporation of 3-7CG-S, 4-7CGC-S and 3-7UA-S seed only target sites, designed to interact with miR-292-3p+1, miR-293-3p+2 and miR-295-3p+1 respectively resulted in either no silencing or very inefficient silencing of the reporters (Figure 4E). [score:3]
Thus, miR-292-3p0 does not appear to expand the target repertoire of the mouse cluster. [score:3]
From the 5p-reporters, only the miR-290-5p and miR-292-5p target sites confer robust silencing despite the fact that all 5p-reporters are highly similar to each other (Figure 1A, Figure S2). [score:3]
Given the involvement of the 2-7U seed in cell proliferation and survival, it is likely that the phenotypes caused by the loss of the 2-7U seed miRNAs in the miR-290-295 knockout mouse mask any specific phenotypes due to the loss of function of pre-miR-290, pre-miR-292 and pre-miR-293 [20]. [score:2]
Nevertheless, we note that the 3-7UA-S seed only reporter, which corresponds to the putative miR-295-3p+1 isoform, had the same activity in wild type and miR-290-295 knockout ES cells, whereas silencing of the 3-7CG-S and 4-7CGC-S reporters, which correspond to the active miR-292-3p+1 and miR-293-3p+2 isomiRs was consistently lower in the wild type ES cells (Figure 4E). [score:2]
If this hypothesis is correct, then processing of the corresponding mouse pre-miR-290, pre-miR-292 and pre-miR-293 might also be differentially regulated. [score:2]
The miR-292-3p+1/miR-371-3p+1 bulge reporter 3-7CG-B and its corresponding position 2 mismatch control 4-7CG-B (C, E) or the miR-293-3p+2/miR-371-3p+2 bulge reporter 4-7CGC-B and its position 2 mismatch control 5-7CGC-B (D, F) were co -transfected as in Figure 3C, E. We used the 3-7CG-B and 4-7CGC-B reporters described above to test if the human pre-miR-371 produces 3p+1 and 3p+2 isoforms “seed equivalent” to the mouse miR-292-3p+1 and miR-293-3p+2. [score:1]
pre-miR-290, pre-miR-292 and pre-miR293 are co-orthologs of pre-miR-371: evolution of miR-290-295 from a three-hairpin ancestor. [score:1]
Nevertheless, co-transfection of a construct consisting of a single pre-miR-292 hairpin resulted in efficient silencing of the 2-7C-S reporter suggesting that this hairpin does in fact produce an active miR-292-3p0 isoform (Figure 4C, +miR-292 rescue). [score:1]
The miR-292-3p+1/miR-371-3p+1 bulge reporter 3-7CG-B and its corresponding position 2 mismatch control 4-7CG-B (C, E) or the miR-293-3p+2/miR-371-3p+2 bulge reporter 4-7CGC-B and its position 2 mismatch control 5-7CGC-B (D, F) were co -transfected as in Figure 3C, E. We used the 3-7CG-B and 4-7CGC-B reporters described above to test if the human pre-miR-371 produces 3p+1 and 3p+2 isoforms “seed equivalent” to the mouse miR-292-3p+1 and miR-293-3p+2. [score:1]
Conservation of the miR-292-3p+1/miR-371-3p+1 and miR-293-3p+2/miR-371-3p+2 seeds requires that the dinucleotide sequence CG is present at positions 3p+7 and 3p+8 of the pre-miRNA multiple sequence alignment (Figure 1A). [score:1]
The presence of many more 3p- sequences than 5p-sequences in the pre-miR-292 HITS-CLIP data is likely due to the inefficient crosslinking of the active miR-292-5p, whereas the crosslinking of the active miR-290-5p is probably so inefficient that it is close to the background library contamination by inactive miR-290-3p sequences resulting in similar abundance of pre-miR-290 5p- and 3p- reads in the HITS-CLIP dataset (Figure 2). [score:1]
Because the sequences of pre-miR-371 on the one hand and pre-miR-292/pre-miR293 on the other vary, the predicted secondary structures of the complexes formed between 3-7CG-B and 4-7CGC-B and their cognate human and mouse miRNAs differ (Figure 5A). [score:1]
In the mouse, their seeds are represented by miR-290-5p0/miR-292-5p0, miR-292-3p+1 and miR-293-3p+2 respectively (Figure 1A, Table 1). [score:1]
The multiple sequence alignments of pre-miR-290–295/pre-miR-371–373 suggest that pre-miR-371 in the human cluster is capable of producing isomiRs with seeds corresponding to the mouse miR-292-3p0, miR-292-3p+1 and miR-293-3p+2, implied by the sequencing data. [score:1]
From the 5p- short RNA species only miR-290-5p and miR-292-5p represent active miRNAs. [score:1]
Only two active miRNAs, miR-290-5p0 and miR-292-5p0, which share the same (5p)2-7C seed, are processed from the 5p- strands of the pre-miR-290-295 stems in the mouse. [score:1]
The additional 2-7C seed represented by the mouse miR-292-3p0 is not present in the human cluster. [score:1]
This dinucleotide is only present in the promoter-proximal pre-miRNAs of the miR-290–295/miR-371–373 cluster family (pre-miR-290 and pre-miR-371 in human) and the additional paralogs in the mouse miR-290–295 (pre-miR-292 and pre-miR-293). [score:1]
In addition, several hairpins yield two miRNA isoforms with alternative 5′-ends represented by similar numbers of reads in the sequencing libraries (Figure 2, pre-miR-292, pre-miR-295, pre-miR-372). [score:1]
The miR-292-3p+1/miR-371-3p+1 bulge reporter 3-7CG-B and its corresponding position 2 mismatch control 4-7CG-B (C, E) or the miR-293-3p+2/miR-371-3p+2 bulge reporter 4-7CGC-B and its position 2 mismatch control 5-7CGC-B (D, F) were co -transfected as in Figure 3C, E. Our results demonstrate that despite their different pre-miRNA organization the seed repertoires of miR-290–295 in the mouse and miR-371–373 in human are very similar if not identical (Figure 1A, Table 1). [score:1]
However, unlike its putative mouse homolog pre-miR-292, pre-miR-371 alone did not silence the 2-7C reporter (Figure 4D, +miR-371). [score:1]
Our data strongly suggest that the mouse pre-miR-290, pre-miR-292 and pre-miR-293 have taken over specialized functions from the single human pre-miR-371 hairpin. [score:1]
[1 to 20 of 30 sentences]
3
[+] score: 40
By contrast miR-292-5p and miR-298 have weaker seed sequence enrichments amongst significantly down-regulated genes following transfection and their proposed targets are not enriched among the genes up-regulated by Dgcr8 depletion. [score:9]
In all cases except miR-292-5p and miR-298 there is clear enrichment of the miRNA targets of each miRNA in the genes up-regulated when miRNAs are depleted, confirming that the gene lists represent the effects of a reversal of Dgcr8 depletion. [score:6]
Briefly, 1500 ng of biotinylated cRNA was hybridised to Illumina expression BeadChips (Mouse-6 v1.1 for mmu-miR-291-3p and mmu-miR-25 mimics and cell line expression profiles, and Mouse-6 v2 for mmu-miR-302, mmu-miR-292-5p, mmu-miR-106a, mmu-miR-21 and mmu-miR-298 mimics. [score:5]
The signal to noise ratio varied form 11.8∶1 for the miR-25 target list to 2.2∶1 for the miR-292-5p target list (Table S2). [score:5]
In all cases, except miR-292-5p, there is an enrichment of corresponding seed sequences within the UTRs of the genes down-regulated by the miRNA transfection (P-value: <0.01) (Figure 3A and Figure S7A). [score:4]
A: Sylamer plots comparing the expression profiles of Dgcr8 [gt1/tm1] cells transfected with a miRNA mimic (miR-25, miR-291a-3p, miR-292-5p or miR-298) and a cel-miR-239b control miRNA. [score:3]
For a full description see Figure 3. B: GSEA enrichment plots [29] judging the enrichment of the transcripts within the miRNA target lists for miR-25, miR-291a-3p, miR-292-5p or miR-298 within regions of a list of transcripts ordered according to log fold change following the depletion of Dgcr8 in homozygous mutant cell lines. [score:3]
A set of miRNAs was transfected including miR-25, miR-291a-3p, miR-292-5p, miR-106a, miR-21, miR-302a and miR-298. [score:1]
miRIDIAN Negative Control #2 (Dharmacon CN-002000-01-05) miRIDIAN mmu-miR-291-3p mimic (Dharmacon C-310470-01-0005) miRIDIAN mmu-miR-25 mimic (Dharmacon C-310564-01-0005) miRIDIAN mmu-miR-302 mimic (Dharmacon C-310483-05-0005) miRIDIAN mmu-miR-292-5p mimic (Dharmacon C-310471-03-0005) miRIDIAN mmu-miR-106a mimic (Dharmacon C-310488-07-0005) miRIDIAN mmu-miR-21 mimic (Dharmacon C-310515-05-0005) miRIDIAN mmu-miR-298 mimic (Dharmacon C-310479-07-0005) Trizol purified RNA was cleaned up with an RNeasy MiniElute Cleanup Kit (Qiagen). [score:1]
miRIDIAN Negative Control #2 (Dharmacon CN-002000-01-05) miRIDIAN mmu-miR-291-3p mimic (Dharmacon C-310470-01-0005) miRIDIAN mmu-miR-25 mimic (Dharmacon C-310564-01-0005) miRIDIAN mmu-miR-302 mimic (Dharmacon C-310483-05-0005) miRIDIAN mmu-miR-292-5p mimic (Dharmacon C-310471-03-0005) miRIDIAN mmu-miR-106a mimic (Dharmacon C-310488-07-0005) miRIDIAN mmu-miR-21 mimic (Dharmacon C-310515-05-0005) miRIDIAN mmu-miR-298 mimic (Dharmacon C-310479-07-0005) Trizol purified RNA was cleaned up with an RNeasy MiniElute Cleanup Kit (Qiagen). [score:1]
In the case of miR-292-5p the enrichment for the corresponding seed sequences failed to reach this level of significance. [score:1]
This large overlap is contrasted with the much lower overlap (0–11%) seen between these two miRNAs and miR-298, miR-21, miR-25 and miR-292-5p (Figure S8). [score:1]
[1 to 20 of 12 sentences]
4
[+] score: 12
ch/ElMMo2/) of predicted target transcripts revealed a consensus set of regulated cellular functions for miR-291a-3p, miR-292-3p, miR-294 and miR-295, but not for miR-293 (Dataset S2 for the EIMMo target prediction software and Dataset S3 for the Pictar target prediction software). [score:8]
In agreement with these previous studies, separate time-course analyses of each member revealed that only 4 miRNAs, which share the same AAAGUGC 5′ seed sequence (miR-291a-3p, miR-292-3p, miR-294, miR-295, Figure 2A, blue), likely contribute significantly to the global trend of miR-290 cluster expression (reduced throughout differentiation, PAM class A; Figure 2A, grey). [score:3]
Moreover, these 3 presumptive miRNA* and the class C miR-290-5p all have the same 5′ seed sequence ACUCAAA(C/A), a feature also shared by the class A miR-292-5p (Figure 2A, yellow boxes). [score:1]
[1 to 20 of 3 sentences]
5
[+] score: 12
mmu-miR-292-5p was up-regulated in forestomach, colon and glandular stomach, and down-regulated in lung. [score:7]
mmu-miR-292-5p is predicted to target Erbb2 (miRBase database, http://www. [score:3]
However, confirmation of the interactions of miRNAs and genes, such as mmu-miR-292-5p and Erbb2, needs further supporting evidence, e. g. confirmation of the modulation of mmu-miR-292-5p by BaP with RT-PCR, identification of the mechanism of mmu-miR-292-5p binding to Erbb2, or RNA interference to knock-out miRNA functions, as in the studies of miRNAs in carcinogenesis [101]. [score:2]
[1 to 20 of 3 sentences]
6
[+] score: 10
On the other hand, cumulative graphs for mRNAs with target sites for the glia-enriched miR-21 and the non-neural-expressed miR-292, did not display any obvious enrichment for AGO2 -binding (Supplementary Fig. S1A, two right-most graphs). [score:5]
miR292sp were used to produce cumulative graphs (x-axis) comparing the presence of a computationally predicted and evolutionary conserved target site for five separate miRNAs (miR-124, miR-125, let-7, miR-21, miR-292). [score:3]
The sponge sequences contained 8 imperfectly complementary binding sites for miR-292 (ACACTCAAAACCCACGGCACTT),miR-124(TTAAGGCACGTATGAATGCCA) and miR-125 (TCACAAGTTTAGTCTCAGGGA). [score:1]
As a negative control, we also performed RIP on brains injected with a sponge vector for miR-292, which is a miRNA absent from the brain. [score:1]
[1 to 20 of 4 sentences]
7
[+] score: 9
We chose to profile the ubiquitously expressed miR-16, five ESC-specific miRNAs (miR-290, miR-291-3p, miR-292-3p, miR-294, and miR-295) [23], [24], and two miRNAs that are upregulated in ESCs undergoing differentiation (miR-21 and miR-22) [23], [24]. [score:6]
The miRNAs tested include miR-16 (lane 1), miR-21 (lane 2), miR-22 (lane 3), miR-290 (lane 4), miR-291-3p (lane 5), miR-292-3p (lane 6), miR-294 (lane 7), miR-295 (lane 8), and the small nuclear RNA, RNU6b (lane 9). [score:1]
The abundance of several miRNAs (miR-290, miR-291-3p, miR-292-3p, miR-294, and miR-295) increased in MEFs as early as 1 hour after incubation, suggesting transfer. [score:1]
The difference in Ct values between the negative control (MEFs alone) and each experimental group (miR-290, miR-291-3p, miR-292-3p, miR-294, miR-295, miR-16, and RNU6b) is shown. [score:1]
[1 to 20 of 4 sentences]
8
[+] score: 7
The other miRNAs of the miR-290-295 cluster (miR-290-5p, miR-291a-5p, miR-291b-5p, miR-292-5p, miR-293, miR-293 [*], miR-294 [*], and miR-295 [*]) differing in their seed sequences, are still highly expressed in ESCs with the exception of the hardly detectable [22] minor forms of miR-293, miR-294, and miR-295 (miR-293 [*], miR-294 [*], and miR-295 [*]). [score:3]
Within the miR-290-295 cluster, the seed sequences of ‘AAGUGC’ hexamer are found in miR-290-3p, miR-291a-3p, miR-291b-3p, miR-292-3p, miR-294, and miR-295. [score:1]
miR-290-291a unit replication formed miR-292-291b, and then miR-290, miR-291a and miR-292 (as the same unit) replication resulted in the formation of miR-293, miR-294 and miR-295 ESC and iPSC self-renewals need to eliminate differentiation signal and obtain the pluripotency signal, in addition, the differentiation process trigger the closure of pluripotency procedure and the induction of lineage specification. [score:1]
The miR-290-291 unit replication forms miR-292-291b, and then the miR-290, miR-291a and miR-292 (as the same unit) replication results in the formation of miR-293, miR-294 and miR-295, finally forming the present miR-290-295 cluster [21] (Fig.   1). [score:1]
In addition, due to the stable mRNA level of LRF, it concludes that the reason is the post transcriptional silencing of miRNAs, and the moderator may be the increased miR-292-3P [88]. [score:1]
[1 to 20 of 5 sentences]
9
[+] score: 6
Only miR-292-5p and miR-155, miR-21*, and miR-101a showed upregulated expression in the liver and spleen, respectively. [score:6]
[1 to 20 of 1 sentences]
10
[+] score: 6
Expression levels of these miRNAs were maintained in both male and female germ cells at E12.5 and E13.5, except miR-291-5p and miR-292-3p both of which were slightly down-regulated in E13.5 female PGCs (Figure 1A). [score:6]
[1 to 20 of 1 sentences]
11
[+] score: 5
Surprisingly, all these top miRNAs, including miR-302b, miR-367, miR-294, and miR-292, do not directly target any core factors (Fig.   4a- 4d). [score:4]
a, b, c, d, the shortest paths from miR-302b, miR-367, miR-294, and miR-292-5p respectively to the pluripotent core factors. [score:1]
[1 to 20 of 2 sentences]
12
[+] score: 4
Members of the miR-290-295 cluster (miR-290, miR-291a, miR-292, miR-291b, miR-293, miR-294 and miR-295-1) were the most abundant among known miRNAs that were upregulated in rat PSCs. [score:4]
[1 to 20 of 1 sentences]
13
[+] score: 3
Two miRNAs (miR-1 and miR-292-3p) represented overlapping results from Affymetrix and Febit miRNA platforms. [score:1]
miR-291a-3p, miR-291a-5p, miR-292-3p, miR-290-5p and miR-293 belong to the miR-290-295 cluster [27]. [score:1]
For miR-1 and miR-292-3P, results were consistent for both miRNA array platforms and the data verified these results. [score:1]
[1 to 20 of 3 sentences]
14
[+] score: 3
Membranes were probed for miR-292 and exposed to a phosphoimager before scanning. [score:1]
A DNA probe for the abundant miR-292 was assessed at 5, 7, and 9 days following Dicer deletion, with a probe for U6 to control for loading. [score:1]
Within the mir-290-295 cluster, the ‘AAGUGC’ seed is found in miR-290-3p, miR-291a-3p, miR-291b-3p, miR-292-3p, miR-294, and miR-295. [score:1]
[1 to 20 of 3 sentences]
15
[+] score: 3
Other miRNAs from this paper: mmu-mir-9-2, mmu-mir-293, mmu-mir-16-1, mmu-mir-124-1, mmu-mir-292b
We could confirm this expression pattern for mmu-mir-292 and mmu-mir-293 which are part of a larger pri-miRNA transcript detected exclusively in CCE cells (Figure 4B left panel). [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 2
Using qRT-PCR, we tested for the presence of miRNA-292 and -295 in Müller cells at 8, 24, and 48 hours post-ESMV treatment, using U6 snRNA, a small nuclear RNA ubiquitous in mammalian cells, as normalizer. [score:1]
We had previously demonstrated the presence of pluripotency factors such as the mRNAs encoding Oct4, Nanog and Gata-4 as well as miR-292, -294 and -295 in mouse ESMVs using qRT-PCR [6]. [score:1]
[1 to 20 of 2 sentences]