sort by

28 publications mentioning dme-mir-2c

Open access articles that are associated with the species Drosophila melanogaster and mention the gene name mir-2c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 72
As a first step to address how Yki might regulate miR-2 expression, we sought to identify cis-regulatory control elements that direct expression of miR-2 loci in S2 cells. [score:8]
Although ectopically expressing members of miR-2 family could suppress undergrowth of yki RNAi tissue, the negative result with the miR-2a reporter suggests that the effects of Yki on reaper are not mediated by regulation of miR-2a expression in the wing discs. [score:8]
Yki regulates miRNA expression to control reaper levelPrevious reports have shown that microRNAs of the miR-2 seed family (Fig.  3A) can regulate reaper, grim and skl (Stark et al., 2003; Leaman et al., 2005; Brennecke et al., 2005; Thermann and Hentze, 2007). [score:5]
As a member of the miR-2 seed family, miR-11 is expected to regulate the same targets as miR-2. Regulation of reaper by miR-11 has been confirmed in the embryo by Leaman et al. and Ge et al. (Leaman et al., 2005; Ge et al., 2012). [score:5]
Drosophila miR2 induces pseudo-polysomes and inhibits translation initiation. [score:5]
miR-2 has been shown to regulate translation of repaer mRNA (Thermann and Hentze, 2007). [score:4]
In some tissues, Yki acts independently via members of the miR-2 family to regulate expression of reaper post-transcriptionally. [score:4]
microRNAs of the miR-2 seed family have also been shown to regulate the expression of the proapoptotic genes reaper, grim and skl (Stark et al., 2003; Brennecke et al., 2005; Leaman et al., 2005; Thermann and Hentze, 2007) and to limit apoptosis in the developing nervous system (Ge et al., 2012). [score:4]
These findings suggest that the Hippo pathway contributes to control of apoptosis through regulation of miR-2 expression in some but not all tissues. [score:4]
*** indicates statistically significant increase in the width of the ptc-Gal4 expression domain when miR-2 cluster level was increased (P<0.001). [score:3]
Expression of miR-2 family mediates tissue growth of Hippo pathway. [score:3]
To further assess this regulation in vivo, we first asked whether overexpressing members of the miR-2 family could rescue the ptc-Gal4 UAS-yki [RNAi] undergrowth assay. [score:3]
Here we provide evidence for additional parallel pathways involving Yki, p53 and the miR-2 family of microRNAs in controlling the expression of reaper another key proapoptotic gene. [score:3]
Yki acts in parallel in some tissues via regulation of miR-2 family miRNAs to regulate reaper activity. [score:3]
As a first step we asked which of the miR-2 family miRNAs is subject to regulation by the Hippo pathway in S2 cells. [score:2]
Yorkie further mediates reaper levels post-transcriptionally through regulation of members of the miR-2 microRNA family to prevent apoptosis. [score:2]
Previous reports have shown that microRNAs of the miR-2 seed family (Fig.  3A) can regulate reaper, grim and skl (Stark et al., 2003; Leaman et al., 2005; Brennecke et al., 2005; Thermann and Hentze, 2007). [score:2]
Student's t-test for miR-2 vs U27: * P<0.05, ** P<0.01. [score:1]
Fig. 3. (A) Sequence alignment of Drosophila miR-2 family miRNAs. [score:1]
Student's t-test for miR-2 vs U14: * P<0.05, ** P<0.01. [score:1]
microRNAs of miR-2 family were represented as black dots. [score:1]
[1 to 20 of 21 sentences]
2
[+] score: 23
grim is the only target of this group not recovered by PicTar, because it has only a 6mer nucleus for miR-2. A recent algorithm for the prediction of microRNA targets did not rely on evolutionary information, but incorporated the 3′ UTR secondary structure to compute putative microRNA targets [12]. [score:7]
grim is the only target of this group not recovered by PicTar, because it has only a 6mer nucleus for miR-2. A recent algorithm for the prediction of microRNA targets did not rely on evolutionary information, but incorporated the 3′ UTR secondary structure to compute putative microRNA targets [12]. [score:7]
Furthermore, many targets of Notch signaling were also predicted as targets of the Bearded-box microRNAs miR-4 and miR-79 (E(spl)m5, Bearded, E(spl)mγ, and Tom) and of the K-box microRNAs miR-2 and miR-11 (E(spl)m5, E(spl)m2, E(spl)mδ, and E(spl)m3), consistent with previous observations [27]. [score:5]
The proapoptotic genes reaper, grim, and sickle are validated targets of the miR-2 family [4]. [score:3]
For sickle we found one conserved site in all flies for miR-2, miR-13, and miR-6, which share the same nucleus. [score:1]
[1 to 20 of 5 sentences]
3
[+] score: 16
However, the microRNA that switched in the mir-2 family did not contain completely unique mature sequences and relative arm switching may have been over or underestimated. [score:1]
The seven copies of mir-2 that are located on six different scaffolds are all found close to the ends of the scaffolds, and may therefore possibly be fragments of larger mir-71/ mir-2 clusters (fig. 3). [score:1]
In this horseshoe crab we found eight copies of mir-71 located on seven scaffolds, of which six also contain at least one copy of mir-2 (fig. 3). [score:1]
Parasteatoda tepidariorum contains one cluster containing a single copy of mir-71 and three copies of mir-2, and a second cluster, on a different scaffold, also with one copy of mir-71, but with six copies of mir-2 (fig. 3). [score:1]
In the S. mimosarum and C. sculpturatus genomes we found one scaffold containing one copy of mir-71 and four copies of mir-2 (fig. 3), and a second scaffold with one copy of mir-71 and three copies of mir-2 (fig. 3). [score:1]
In the spiders, the scorpion and the horseshoe crab, we consistently found at least two copies of mir-71 and more than two copies of mir-2 (fig. 2). [score:1]
Fig. 3. —The duplicate mir-71/ mir-2 clusters in chelicerate lineages. [score:1]
The mir-71/ mir-2 cluster is duplicated in spiders (purple), the scorpion (magenta), and the horseshoe crab (blue). [score:1]
The mir-71/ mir-2 cluster is an invertebrate-specific microRNA cluster that has expanded in arthropods probably due to tandem duplications of mir-2 (Marco et al. 2010; Marco, Hooks, et al. 2012). [score:1]
There is another scaffold with one copy of mir-71 and one copy of mir-2 located approximately 6 kb from the end of the scaffold. [score:1]
The arrangement of L. polyphemus mir-71/ mir-2 genes is much more fragmented (fig. 3). [score:1]
Therefore the mir-71/ mir-2 and mir-100/ let-7/ mir-125 clusters appear to have been duplicated in spiders and scorpions (Arachnopulmonata) and L. polyphemus but not other chelicerates or mandibulates that we surveyed. [score:1]
In the acariform and parasitiform lineages, the copy numbers of mir-71 and mir-2 are variable, though usually there is one copy of mir-71 and two copies of mir-2 (fig. 2). [score:1]
This could perhaps be caused by the many paralogs of the mir-3791 and mir-2 families, which were generally 3’ dominant, though both of these families do show instances of arm switching (fig. 4 and supplementary fig. S6, online). [score:1]
In A. geniculata there is one complete cluster with one mir-71 and four mir-2 copies, all on one scaffold (fig. 3). [score:1]
There are also two other copies of mir-2, each on approximately 1 kb scaffolds. [score:1]
[1 to 20 of 16 sentences]
4
[+] score: 15
mir-2 and mir-13 repress translation of the target genes, grim, skl and rpr, suggesting that they may be involved in regulating apoptosis [48]. [score:6]
bmo-miR-2b, which is found in the gene cluster bmo-miR-2a-1/bmo-miR-2a-1*/bmo-miR-2a-2/bmo-miR-2b/bmo-miR-13a*/bmo-miR-13b, encodes a newly identified member of the mir-2 family. [score:1]
mir-2 and mir-7 may be related to the Notch signaling pathway in B. mori; this hypothesis is consistent with previous predictions [38, 53]. [score:1]
4220] of these six genes can bind perfectly to mir-2 (bmo-miR-2a, bmo-miR-2b, bmo-miR-13a* and bmo-miR-13b) and bmo-miR-7, respectively. [score:1]
mir-2 controls HLHm delta, and mir-7 controls HLHm3, HLHm5, HLHmgamma, M4 and TOM, in D. melanogaster; these six genes are involved in the Notch signaling pathway. [score:1]
Searching miRBase, we found that the bmo-miR-2a sequence was identical to the dme-miR-2a, dps-miR-2a, ame-miR-2, and aga-miR-2 sequences, but we failed to identify any other miRNA that had the same sequence as bmo-miR-2b (Figure 5); therefore, bmo-miR-2b is a newly identified member of the mir-2 miRNA family. [score:1]
Genes in the cluster containing bmo-miR-2a-1/bmo-miR-2a-1*/bmo-miR-2a-2/bmo-miR-2b/bmo-miR-13a*/bmo-miR-13b are members of the mir-2 miRNA family. [score:1]
Figure 5Homologous analysis of mir-2 family. [score:1]
We identified two miRNA gene clusters in the B. mori genome, and bmo-miR-2b was identified as a new member of the mir-2 family. [score:1]
Searching the D. melanogaster and A. gambiae miRNAs, we found that corresponding mir-2 and mir-13 family members also assembled into clusters in these two species. [score:1]
[1 to 20 of 10 sentences]
5
[+] score: 15
These genes are not yet known to be miRNA targets, and therefore constitute strong candidates for experimental verification of regulation by members of the miR-2 family. [score:4]
In another case, also in worms, the target sites for two coconserved and distinct miRNAs (or miRNA sets) miR-2/miR-43 (CUGUGAU) and miR-80/miR-81/miR-82 (UGAUCUC), were found to overlap more often than expected by chance (p < 10 [−5]) (note that we limited the extent of the overlap to 4 nt in our coconservation analysis). [score:3]
For example, Figure 5B shows that some worm miRNAs potentially regulate hundreds of genes (e. g., miR-2/ miR-43), while others may regulate fewer than ten genes (e. g., miR-273). [score:3]
Similarly, the target sites for miR-2/43 and miR-1 are coconserved in 12 genes (p < 10 [−6]). [score:3]
As another example, recent in vitro and in vivo experiments suggest that members of the fly miR-2 family (miR-2a/2b/2c) regulate the proapoptotic genes reaper, grim, and sickle in D. melanogaster [9]. [score:2]
[1 to 20 of 5 sentences]
6
[+] score: 10
Therefore, feeding of the DCPTN-PT containing culture media did not depress the regulatory microRNAs (miR-2, miR-13 and miR-14) that control the translation of three pro-apoptotic host genes (miR-2 and miR-13 targets rpr, grim and miR-14 targets Drice), suggesting that DCPTN-PT compound is not an inhibitor of all proapoptotic genes but very specific to oncomiR bantam. [score:10]
[1 to 20 of 1 sentences]
7
[+] score: 9
Drosophila miR2 induces pseudo-polysomes and inhibits translation initiation. [score:5]
In addition, miR-2 is known to bind to the 3′ UTR of reaper, repressing its translation and directing it to P-body-like structures (Thermann and Hentze, 2007). [score:4]
[1 to 20 of 2 sentences]
8
[+] score: 7
For instance, members of the mir-2 family have, in general, the same targets (49, 51, 52). [score:3]
Two of the five clusters, mir-13b-1/mir-13a/mir-2c and mir-2a-2/mir-2a-1/mir-2b-2, are derived from a single ancestral mir-2/mir-13 cluster (48, 49). [score:1]
However, we have previously shown that the mir-2 cluster originally appeared by the de novo birth of the first mir-2 family member within the mir-71 transcript (48, 49). [score:1]
Later, the mir-2 family expanded by duplication and mir-71 was lost in several lineages, including the Drosophila genus (49). [score:1]
All members of the mir-2/mir-13 ancestral cluster belong to the same family (the mir-2 family), suggesting that the ancestral cluster originated by tandem duplication. [score:1]
[1 to 20 of 5 sentences]
9
[+] score: 6
Other miRNAs from this paper: dme-mir-1, dme-mir-2a-1, dme-mir-2a-2, dme-mir-2b-1, dme-mir-2b-2
The targeting sites of Cow-miRNA-1 and Cow-miRNA-2 were TTAGCATAGTTGCTGCGTAAGA in the 5′-untranslated region (UTR) and CCACAAGAATCGTGATGAGATA in the N region, respectively (see Figure S1B). [score:5]
SP-Flag-Cow, SP-EGFP-Cow, SP-Flag-Cow-mSG1+2, Cow-miRNA-1 and Cow-miRNA-2 were cloned into the pUAST vector [25]. [score:1]
[1 to 20 of 2 sentences]
10
[+] score: 5
Four microRNA families were affected by multiple matching reads: mir-983, mir-281, mir-276 and mir-2. The first three did not show any differential expression between sexes. [score:3]
We recently characterized sex-biased microRNAs in the parasitic Schistosoma mansoni and reported that one of the microRNA clusters (mir-71/mir-2) has two copies, one in the sexual chromosome with no detectable bias and another copy in an autosome with sex-biased expression. [score:1]
To avoid biases due to multiple matches, the mir-2 family was removed from the subsequent analyses. [score:1]
[1 to 20 of 3 sentences]
11
[+] score: 5
The GO analysis revealed that four genes targeted by miR-2 were classified into the autophagy subcategory, including the endogenous autophagosome marker protein microtubule -associated protein 1 light chain 3 (LC3), suggesting that miR-2 had important roles in the autophagy pathway. [score:3]
These showed expression patterns similar to those found by sequencing (Figure 2b); however, a little inconsistency was shown in miR-133, miR-193 and miR-2c compared with the results of sequencing, possibly owing to the low sensitivity of digoxigenin (DIG)-labeled oligodeoxynucleotide probes or for other unknown reasons. [score:2]
[1 to 20 of 2 sentences]
12
[+] score: 5
While hid and other proapoptotic genes are targeted by other miRNAs, including bantam and the miR-2 family [5], [9], [10], none of these interactions has been shown to affect apoptotic pruning. [score:3]
Finally, members of the miR-2 family of miRNAs have been shown to regulate the propaptotic genes, reaper, grim, and sickle in S2 cell over -expression assays or in reporter transgene assays in vivo [10], [38]. [score:2]
[1 to 20 of 2 sentences]
13
[+] score: 5
Other miRNAs from this paper: dme-mir-2a-1, dme-mir-2a-2, dme-mir-2b-1, dme-mir-2b-2, dme-mir-9a, dme-mir-10, dme-mir-12, dme-mir-13a, dme-mir-13b-1, dme-mir-13b-2, dme-mir-276a, dme-mir-133, dme-mir-276b, dme-mir-210, dme-mir-31b, dme-mir-9c, dme-mir-306, dme-mir-9b, dme-mir-31a, dme-mir-309, dme-mir-316, dme-mir-317, ame-mir-12, ame-mir-133, ame-mir-210, ame-mir-276, ame-mir-2-1, ame-mir-2-2, ame-mir-317, ame-mir-9a, ame-mir-9b, bmo-mir-9a, bmo-mir-10, bmo-mir-276, bmo-mir-31, bmo-mir-71, ame-mir-10, ame-mir-137, ame-mir-13a, ame-mir-2-3, ame-mir-29b, ame-mir-31a, ame-mir-375, ame-mir-71, ame-mir-932, dme-mir-193, dme-mir-375, dme-mir-932, dme-mir-970, dme-mir-971, dme-mir-989, dme-mir-137, dme-mir-1006, dme-mir-1007, bmo-mir-2a-1, bmo-mir-2a-2, bmo-mir-2b, bmo-mir-13a, bmo-mir-13b, bmo-mir-133, bmo-mir-210, bmo-mir-317, tca-mir-2-3, tca-mir-2-1, tca-mir-2-2, tca-mir-10, tca-mir-12, tca-mir-13a, tca-mir-13b, tca-mir-31, tca-mir-71, tca-mir-133, tca-mir-137, tca-mir-210, tca-mir-276, tca-mir-317, tca-mir-932, tca-mir-9b, bmo-mir-12, bmo-mir-137, bmo-mir-932, bmo-mir-9b, tca-mir-9a, tca-mir-970, ame-mir-13b, ame-mir-1006, ame-mir-316, bmo-mir-970, lmi-mir-276, lmi-mir-210, lmi-mir-10, lmi-mir-9a, bmo-mir-9c, bmo-mir-306a, bmo-mir-989a, bmo-mir-316, bmo-mir-1175, bmo-mir-9d, bmo-mir-750, bmo-mir-375, bmo-mir-306b, api-mir-137, api-mir-10, api-mir-276, api-mir-13a, api-mir-210, api-mir-29, api-mir-2a, api-mir-2b, api-mir-2c, api-mir-316, api-mir-317, api-mir-71, api-mir-971, api-mir-9a, api-mir-9b, api-mir-306, api-mir-3049, bmo-mir-989b, ame-mir-1175, ame-mir-193, ame-mir-989, ame-mir-3049, ame-mir-971, ame-mir-3770, ame-mir-9c, ame-mir-306, ame-mir-750, tca-mir-9c, tca-mir-316, tca-mir-9d, tca-mir-309a, tca-mir-3049, tca-mir-375, tca-mir-29, tca-mir-1175, tca-mir-750, tca-mir-989, tca-mir-309b, tca-mir-193, tca-mir-6012, tca-mir-9e, ame-mir-6037, ame-mir-6012, ame-mir-2b, tca-mir-309c, tca-mir-971b
The structure of the miR-2 cluster in the seven species of insects studied. [score:1]
There is no correlation between the number of miRNA genes in a given family and the time of emergence of the family (MIR-2 family, which is the one that have more genes, appeared with the protostomes, whereas there are many monogenic miRNA families that emerged with the bilaterians) (Fig. 4). [score:1]
Transposable elements could be one of the sources of the miRNA cluster expansions as we observed on B. germanica Mir-71/Mir-2 cluster. [score:1]
Then, 5 families (8%) have between 2 and 3 genes, 4 families (6%) have between 3 and 5, and only one family (MIR-2) that have between 5 and 16 genes (Supplementary Table S8). [score:1]
In the cluster of Blattella germanica it is remarkable the distance between the second and the third copy of miR-2, where it is inserted a TIGD4 sequence. [score:1]
[1 to 20 of 5 sentences]
14
[+] score: 4
Similarly, miR-2 and miR-7 control signal transduction pathways (notch signalling) in both Drosophila sp and B. mori by targeting HLHmδ, HLHm3, HLHm5, HLHmγ, M4 and TOM [33, 34]. [score:3]
The cluster (sfr-mir-2a, sfr-mir-2b, sfr-mir-2c, sfr-mir-13a, sfr-mir-13b) is distributed over the region, 8161–8774 of scaffold 1973 with a size of 20411bp (Fig. 3B, i), while the other (sfr-mir-10494, sfr-mir-10463, sfr-mir-10471) span over 10636bp region of scaffold 6745. [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 4
These included miR-SPs targeting bantam, miR-1, the K-box family (miR-2b, miR-2c and miR-13b displayed strong phenotypes; miR-2a and miR-13a were flight impaired but fell below our stringent cutoff; ), miR-7, the miR-31 family, miR-34, miR-190, miR-957, miR-986, miR-987 and miR-1001. [score:3]
Supporting this argument, several hits in the viability screen belonged to the K-box family (miR-2a, miR-2b and miR-2c, and miR-13a and miR-13b) and the miR-9 family (miR-9b and miR-9c). [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-101-1, dme-mir-1, dme-mir-2a-1, dme-mir-2a-2, dme-mir-2b-1, dme-mir-2b-2, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-101a, mmu-mir-124-3, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-137, mmu-mir-140, mmu-mir-142a, mmu-mir-155, mmu-mir-10b, mmu-mir-183, mmu-mir-193a, mmu-mir-203, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-183, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-222, hsa-mir-223, dme-mir-133, dme-mir-34, dme-mir-124, dme-mir-79, dme-mir-210, dme-mir-87, mmu-mir-295, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, dme-let-7, dme-mir-307a, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-193a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-27a, mmu-mir-34a, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-10a, mmu-mir-210, mmu-mir-223, mmu-mir-222, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-411, hsa-mir-193b, hsa-mir-411, mmu-mir-193b, hsa-mir-944, dme-mir-193, dme-mir-137, dme-mir-994, mmu-mir-1b, mmu-mir-101c, hsa-mir-203b, mmu-mir-133c, mmu-let-7j, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, mmu-mir-124b
Of note, such 5′-isomiR abundance variation has been previously indicated for the miR-2 family which have five members in fruitfly (7). [score:1]
Besides shifted seeds, many well-conserved 5′-isomiRs with the same or nearly identical seed regions had different arm abundances among the four species, exemplified by miR-124, miR-193, miR-210, miR-2 and miR-87 (Table 3). [score:1]
Similar observations were made for miR-124, miR-137, miR-193, miR-210, miR-2, miR-79 and miR87 across species, with miRNAs following the loop-counting rule having lower arm abundances of 5′-isomiRs. [score:1]
Such variations were also observed for miRNAs conserved only in fruitfly and worm, such as miR-2-3p and miR-87-3p (Table 3). [score:1]
[1 to 20 of 4 sentences]
17
[+] score: 3
In the 13b~2c cluster a wrong conclusion of a lack of correlation of dme-mir-13b-1 to dme-mir-13a and dme-mir-2c can be formally deduced due to the superposition of the expression of the non-clustered paralog dme-mir-13b-2 with identical sequence. [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 3
Interestingly, we have earlier shown that a cluster of three K box miRNAs (mir-2c, mir-13a and mir-13b-1) is specifically expressed throughout the embryonic CNS [8], and other Hox miRNAs (e. g. mir-iab-4 and mir-iab-8) are restricted to specific anterior-posterior domains in the CNS of germband-retracted embryos [51]. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 3
There is an aga-miR-2 in miRBase (derived from two precursors aga-miR-2-1 and aga-miR-2-2), which is reverse complementary to ast-miR-2a. [score:1]
However, ast-miR-2a is reverse complementary to the aga-miR-2 reported in miRBase. [score:1]
Sequence comparison showed that ast-miR-2a is not derived from aga-miR-2* because of the existence of multiple in dels/mismatches between the alignment of aga-miR-2 and aga-miR-2*. [score:1]
[1 to 20 of 3 sentences]
20
[+] score: 2
Importantly, sequences derived from several pri-miRNAs, including Bantam, miR-2 family, miR-11, miR- 33 and miR- 34 were also recovered, thus demonstrating direct interactions between SmD1 and pri-miRNAs (Figs 3C, 5C, 5D and S9; S6 Table). [score:2]
[1 to 20 of 1 sentences]
21
[+] score: 2
In D. melanogaster, the proapoptotic K-box miRNA mir-2, and mir-13 occur jointly. [score:1]
Finally, three copies of ame-mir-2, plus one instance each of ame-mir-13a and ame-mir-71, all occur within intron 3 of GB15727 - a serine/threonine phosphatase lost from Drosophila, but with both vertebrate and more ancient metazoan orthologs. [score:1]
[1 to 20 of 2 sentences]
22
[+] score: 2
A third wave (CoMod-B) that peaks during ED2, contains MIR-2 miRNAs, which are related to cell differentiation, development, morphogenesis and neurogenesis [28]. [score:2]
[1 to 20 of 1 sentences]
23
[+] score: 2
This clustering is conserved across protostomes, and it has previously been shown that the mir-2 family underwent various expansions during evolution [130]. [score:1]
Among the former, there are five homologues of mir-2 localized in close proximity to each other and downstream of mir-71. [score:1]
[1 to 20 of 2 sentences]
24
[+] score: 1
Other miRNAs from this paper: dme-mir-1, dme-mir-2a-1, dme-mir-2a-2, dme-mir-2b-1, dme-mir-2b-2
For chaining, BamHI/XhoI-restricted pre-miR2 -RNAi cassettes were subcloned into pcDNA6.2-GW/EmGFP- SRSF1-miR1 using BglII/XhoI. [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
Number of reads: Tg-proto-miR-1 (158 reads), Tg-proto-miR-2 (109 reads), Tg-proto-miR-3 (138 reads) and Tg-proto-miR-4 (107 reads). [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
This UTR contains two binding sites for miR-2, which exert strong repression in the developing larval eye (Lai and Posakony 1997). [score:1]
[1 to 20 of 1 sentences]
27
[+] score: 1
In the 15 missed reference pre-miRNAs, 4 did not pass the pre-processing filter due to their predicted double-loop structures (mir-2c, mir-31a, mir-31b, mir-286) and another 2 due to their low predicted free energy (mir-309, mir-311). [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
The miR-2 family was predicted to contain the most family members (n = 8), followed by miR-10 (n = 5), and miR-87, -184, -252, -263, -279, -9, -3015 (n = 4). [score:1]
[1 to 20 of 1 sentences]