sort by

520 publications mentioning hsa-mir-1-2 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-1-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 533
Upregulation of several miR-1 targets including FoxP1, MET, and HDAC4 in primary human HCCs and downregulation of their expression in 5-AzaC -treated HCC cells suggest their role in hepatocarcinogenesis. [score:11]
Overexpression of miR-1 not only inhibits prostate cancer cell proliferation, migration, wounding-healing, and invasion activity but also inhibits the expression of PNP in these cell lines [50]. [score:9]
miR-1 also has a tumor suppressor function in colorectal cancer by directly downregulating the MET oncogene both at RNA and protein level, and reexpression of miR-1 leads to MET -driven reduction of cell proliferation and motility, identifying the miR-1 downmodulation as one of the events that could enhance colorectal cancer progression [44]. [score:9]
Overexpression of miR-1 in these cells led to growth inhibition and downregulation of genes in pathways regulating cell cycle progression, mitosis, DNA replication/repair, and actin dynamics [51]. [score:9]
For example, enforced expression of miR-1 in lung, colon, RMS, and chordoma cells dramatically suppressed Met expression and inhibited tumor cell growth [42, 44, 69]. [score:9]
Exogenous miR-1 significantly reduced expression of oncogenic targets, MET and Pim-1. MET and Pim-1 are frequently upregulated in lung cancer and promote the growth and survival of cancer cells. [score:8]
Reduction in expression of miR-1 has been found in serum of patients with chronic obstructive pulmonary disease (COPD), and miR-1 is downregulated in myocardial infracted tissue [30]. [score:8]
Overexpression of metastasis -associated in colon cancer 1 (MACC1) and downregulation of miR-1 are associated with MET overexpression. [score:8]
Retrovirus -mediated overexpression of miR-1 markedly enhanced expression of muscle creatine kinase, sarcomeric myosin, and alpha-actinin, while the effects on myogenin and MyoD expression were modest. [score:7]
The inhibition of cell cycle progression and induction of apoptosis after reexpression of miR-1 are some of the mechanisms by which DNA hypomethylating agents suppress hepatocarcinoma cell growth [39]. [score:7]
A search for the targets of miR-1 revealed that transgelin 2 (TAGLN2) was directly regulated by miR-1. Silencing of TAGLN2 significantly inhibited cell proliferation and invasion in HNSCC cells [65]. [score:7]
Downregulation of miR-1 and upregulation of TAGLN2 were confirmed in HNSCC clinical specimens [65]. [score:7]
More recent studies have shown that transfection of miR-1 in rhabdomyosarcoma cells suppressed c-Met expression, leading to inhibited cell proliferation and tumor growth [70, 71]. [score:7]
miR-1 has tumor suppressor functions in colorectal cancer by directly downregulating MET oncogene both at RNA and protein level. [score:7]
miR-1 also inhibits head and neck cancer cell growth by targeting different miR-1 targeted genes [62– 64]. [score:7]
Depletion of Slug inhibited EMT during tumorigenesis, whereas ubiquitous expression of miR-1 inhibited both EMT and tumorigenesis in human and mouse mo del systems [53]. [score:7]
Herein, we have reviewed the expression of miR-1 and miR-1 regulated molecular targets in various types of cancer, and it is anticipated that further research will provide more convincing support for further miR-1 based therapy strategies. [score:6]
While use of miR-1 has been effective for short-term gene inhibition in mammalian cell lines, its use for stable long-term transcriptional knockdown of target genes has been shown to be problematic [79, 80]. [score:6]
Genome-wide molecular target search and luciferase reporter assays showed that prothymosin- α (PTMA) and PNP are directly regulated by miR-1. Silencing of these two genes significantly inhibited cell proliferation and invasion and increased apoptosis in bladder cancer cells. [score:6]
Studies have found downregulation of miR-1 stabilizes the expression of PAX3 and CCND2 in both embryonal (ERMS) and alveolar (ARMS) RMS types. [score:6]
Another interesting study used an integrated functional miR-target interaction with mRNA and miR expression to infer mRNA -mediated miR-miR interactions and revealed that miR-1 is a key player in regulating prostate cancer progression. [score:6]
miR-1 reexpression therapy constitutes a novel approach to inhibit oncogenes and arrest tumor development [77]. [score:6]
Downregulation of miR-1 thus contributes to oncogene overexpression and to the metastatic behavior of gastrointestinal cancer cells. [score:6]
These results suggest that reexpression of miR-1 may be an effective therapy that prevents cancer malignancy by converting cells from a mesenchymal phenotype to an epithelial phenotype via the downregulation of Slug. [score:6]
Transfection of miR-1 in ERMS cell line showed significant downregulation of PAX3 protein expression [69]. [score:6]
When chordoma cell lines were transfected with miR-1, downregulation of known miR-1 targets was observed. [score:6]
In a human colon cancer study, miR-1 was downregulated in 84.6% of the tumors; this decrease significantly correlated with MET overexpression, particularly in metastatic tumors. [score:6]
Formation of myotubes was significantly augmented in miR-1 -overexpressing cells, indicating that miR-1 expression enhanced both myogenic differentiation and maturation into myotubes [23]. [score:5]
Overexpression of miR-1 may inhibit rhabdomyosarcoma cell migration and proliferation through apoptosis and arrest cell cycle in vitro and restrain tumor growth in vivo [69]. [score:5]
A more recent study showed that miR-1 induction can directly downregulate Notch3 and allow differentiation of myoblast cells [24], suggesting that myogenic differentiation -induced miR-1 is critical for differentiation at least partly by turning off Notch3. [score:5]
As aberrantly expressed miR-1 plays key roles in the development of human cancer, correcting miR-1 dysregulation and deficiencies by restoring miR-1 function will provide a significant advance in cancer therapy. [score:5]
miR-1 expression is further reduced in distant metastasis and is a candidate predictor of disease recurrence. [score:5]
Consistent with a suppressive role of miR-1, when ubiquitously expressed in vitro in colon cancer cells, reduced MET levels and impaired MET -induced invasive growth were seen [42]. [score:5]
These extensive studies indicate that miR-1 acts as a tumor suppressor in prostate cancer by influencing multiple cancer-related processes and by inhibiting cell proliferation and motility. [score:5]
By transducing miR-1 expressing lentiviruses into primary mammary organoids derived from muscle from which these tumors arise, reexpression of miR-1 rescued the myogenic differentiation program and blocked the tumorigenic phenotype [71]. [score:5]
These data indicate that miR-1 is a tumor suppressive miR in HNSCC, and TAGLN2 may have an oncogenic function regulated by miR-1. This identification of novel miR-1-regulated cancer pathways could provide new insights into potential molecular mechanisms of HNSCC carcinogenesis. [score:5]
Another study found miR-1 expression is significantly downregulated in thyroid carcinomas as compared to normal thyroid tissue, suggesting miR-1 may also play a role in thyroid carcinogenesis [66]. [score:5]
Ectopic expression of miR-1 in HCC cells inhibited cell growth and reduced replication potential and clonogenic survival [39– 41]. [score:5]
Similarly, the levels of two additional targets, FoxP1, a transcription factor with ontogenetic property, and HDAC4, that represses differentiation-promoting genes, were also reduced in miR-1 -expressing cells. [score:5]
3. Expression of miR-1 in Noncancer Human Diseases. [score:5]
Meanwhile, this study found 6 genes (TAGLN2, WDR78, C4orf34, PNP, LASS2, and STXBP4) had putative target sites for miR-1 in their 3′UTR by Target Scan Program [50]. [score:5]
Expression of miR-1 in non-miR expressing lung cancer cells reversed their tumorigenic properties of growth, replication potential, motility/migration, clonogenic survival, and tumor formation in nude mice [34]. [score:5]
The results show that not only the patients with low miR-1 expression but also those with high PIK3CA expression had significantly higher incidences of lymph node metastases and recurrences in one year after surgery than other patients. [score:5]
Meanwhile, one study about miR-1 and NSCLC found that almost 70% of the NSCLC tissue samples showed low miR-1 expression and high PIK3CA expression [35]. [score:5]
Studies have shown abnormal miR-1 expression in heart diseases including myocardial infarction, arrhythmias, and heart failure [27– 29]. [score:5]
A gene set enrichment analysis revealed that the miR-1 -mediated tumor suppressor effects are globally similar to those of histone deacetylase inhibitors. [score:5]
miR-1 has crucial functions in the development and physiology of muscle tissues and related diseases [25, 26]. [score:4]
PTMA and PNP were identified as new target genes regulated by miR-1 in bladder cancer. [score:4]
The dysregulated miR-1 is not limited to a particular tumor type and, in some cases, the aberrantly expressed miRs correlate with clinical status such as the tumor stage and patient survival. [score:4]
These effects were achieved through regulating the various miR-1 targeted genes. [score:4]
miR-1 inhibits cell proliferation and viability during selection of human colon cancer cell lines that exhibit dysregulated Wnt signaling. [score:4]
Researchers analyzed miR expression profiles of HNSCC and adjacent normal tissues by miR microarray, which showed six miRs (miR-21, miR-1, miR-133a, miR-205, miR-206, and let-7d) exhibiting low expression levels as compared to normal specimen [61]. [score:4]
Recently, studies from our group and others have shown that downregulation of miR-1 is one the most frequent events in some cancers. [score:4]
The author proposed that loss of 3′UTR of PAX3 and/or the downregulation of miR-1 are oncogenic events in rhabdomyosarcomagenesis. [score:4]
Similar results were observed with the knockdown of miR-1 targeted gene SRSF9 [58]. [score:4]
miR-1 has also been found to be downregulated in osteosarcoma cell lines [74]. [score:4]
More recently, Slug has been identified as a miR-1 target in lung cancer A549 cells by TargetScan and picTar and a luciferase reporter assay with plasmids containing luciferase-Slug 3′-UTR [37]. [score:4]
Downregulation of miR-1 in RMS has been confirmed by northern blot analysis. [score:4]
miR-1 is a potential regulator of PAX3 expression by binding to its 3′UTR. [score:4]
Another more recent study showed miR-1 is among the most consistently downregulated miRs in primary human prostate tumors [51]. [score:4]
In another recent study by the same group, novel molecular targets regulated by miR-1 in bladder cancer were identified [59]. [score:4]
miR-1 has been shown to be significantly downregulated in vinyl carbamate- (VC-) induced mouse lung tumor mo dels [33]. [score:4]
miR-1 can also regulate the expression of CCND2, a cell cycle gene [72]. [score:4]
miR-1 is downregulated in bladder cancer tissues [55]. [score:4]
This study demonstrated that miR-1 was further decreased in dMMR tumors relative to pMMR tumors, indicating that expression of miR-1 is associated with tumor cell differentiation. [score:3]
Restoration of miR-1 expression leads to MET -driven reduction of cell proliferation and motility [44]. [score:3]
miR-1 expression is not only significantly reduced in primary lung cancer tissues but also in many lung cancer cell lines [34– 36]. [score:3]
miR-1 is downregulated in colon tumors as compared to the normal tissues. [score:3]
In order to translate miR-1 from an experimental approach to a clinical-viable therapeutic strategy that can benefit cancer patients, a specific and efficient delivery system is needed. [score:3]
Several experimental approaches can identify actual miR-1 target genes in tumor cells. [score:3]
The rationale for exploring the therapeutic potential of miR-1 is based on the observation that a single miR-1 can regulate multiple oncogenes and oncogenic pathways that are commonly deregulated in different cancers (Figure 3). [score:3]
In lung cancer, reexpression of miR-1 induced apoptosis in cancer cells in response to the potent anticancer drug doxorubicin [75]. [score:3]
4. Aberrant Expression of miR-1 in Human Cancers. [score:3]
miR-1 also functions as a tumor suppressor in bladder cancer. [score:3]
FoxP1 and MET genes harbor three and two miR-1 binding sites in their 3′-untranslated regions, respectively. [score:3]
Additional data showed evidence that miR-1 alters the cellular organization of F-actin and inhibits tumor cell invasion and filopodia formation [51]. [score:3]
Of those miRs, miR-1, miRNA-206, miRNA-133a, and miRNA-133b are the members of the muscle-specific miRs and often show decreased expression in RMS. [score:3]
Enhanced activation of caspases 3 and 7, cleavage of their substrate PARP-1, and depletion of antiapoptotic Mcl-1 contributed to the sensitivity of miR-1 -expressing cells to doxorubicin. [score:3]
miR: MicroRNA mRNA: Messenger RNA miR-1: miRNA-1 UTR: Untranslated region. [score:3]
Levels of miR-1 expression have been shown to be associated with chemosensitivity [47]. [score:3]
Using high-throughput miR microarray technology and quantitative RT-PCR (qRT-PCR) for validation, many studies have found decreased expression of miR-1 in various types of human cancers (Table 1). [score:3]
miR-1 were identified as diagnostic and prognostic biomarkers in the 11 miRs that act as tumor suppressor miRs [52]. [score:3]
These data suggest that expression of miR-1 may contribute to COPD -associated skeletal muscle dysfunction. [score:3]
Expression of FoxP1 and MET was markedly reduced by ectopic miR-1 transfection. [score:3]
Expression of miR-1 was markedly decreased in both chordoma tissues and cell lines. [score:3]
Moreover, expression of miR-1 has been reported to promote apoptosis. [score:3]
PTMA is one of the miR-1 target genes involved in miR-1 inducing apoptosis. [score:3]
Upon induction of myogenic differentiation, miR-1 was highly expressed. [score:3]
miR-1 is downregulated in prostate tumor tissue as compared to nontumor tissue by microarray analysis. [score:3]
Interestingly, ATF cDNA induction led to the reactivation of tumor suppressive miRs such as miR-1 [78]. [score:3]
So, the expression levels of miR-1 and PIK3CA in NSCLC tissues may be useful for predicting lymph node metastasis and postoperative recurrence in patients with NSCLC [35]. [score:3]
Literature review suggests miR-1 to be expressed specifically in the normal cardiac and skeletal muscle tissues. [score:3]
Expression of miR-1 was associated with smoking history and lung function. [score:3]
The effect of overexpressing miR-1 on the E-cadherin-actin filaments and vinculin complex may reflect the underlying mechanisms of miR-1 on cell migration and invitation. [score:3]
Interestingly, the structural and tumorigenic properties induced by miR-1 were associated with the reduced expression of Slug, which was a transcriptional repressor of E-cadherin or an inducer of epithelial-to-mesenchymal transition [37]. [score:3]
In order for miR-1 to be effective as a cancer target, the therapeutic agents must be administered systemically, allow for specific and efficient delivery to the tumor tissue, and be taken up by tumor cells into the cytoplasm, where they can be available in intact form. [score:3]
Conversely, depletion of miR-1 increased cell growth with associated elevation of these target genes [34]. [score:3]
These targets potentially contribute to specific functional readouts of miR-1 as described above. [score:3]
We will review the expression of miR-1 and its potential functions in lung cancer, gastrointestinal cancer, genitourinary cancer, head and neck cancer, and sarcoma. [score:3]
Associations between miR-1 expression levels and tumor type, grade, response to treatment, and prognosis have also been reported in recent studies. [score:3]
Western blot analysis has confirmed that miR-1 represses its target gene exprotin 6 and protein tyrosine kinase 9 (also termed A6/twinfilin) on the protein level in two prostate cancer cell lines [49]. [score:3]
Transfected miR-1 into bladder cancer cell lines inhibits tumor cell viability, invasion, migration activity, and proliferation [56– 58]. [score:3]
These studies have identified an oncosuppressive role of miR-1 in different gastrointestinal cancers. [score:3]
miR-1 expression was negatively correlated with phosphorylation of the Akt kinase [31]. [score:3]
Similarly, another study demonstrated significantly lower expression of miR-1 in prostate cancer tissues [50]. [score:3]
Furthermore, the protein levels of histone deacetylase 4 (HDAC4), a miR-1 target gene, were increased in the patients with COPD. [score:3]
In this context, the loss of 3′UTR region of PAX3 due to formation of fusion transcript may allow the fusion transcript PAX3-FOXO1 to escape miR-1 -mediated regulation. [score:2]
miR-1 is consistently dysregulated across many cancers. [score:2]
miR-1 also regulates CCND2 transcript and protein levels. [score:2]
Finally, functional studies have directly documented the potent antitumorigenic activity of miR-1 both in vitro and in vivo. [score:2]
Slug and miR-1 act in a self-reinforcing regulatory loop, leading to amplification of EMT. [score:2]
Further in vitro experiments showed miR-1 is epigenetically silenced in human prostate cancer, although the mechanisms underlying miR-1 deregulation in cancer are not well understood. [score:2]
In genitourinary carcinomas, miR-1 is mainly dysregulated in prostate, bladder, and renal cancers. [score:2]
Slug is also a direct repressor of miR-1 transcription. [score:2]
miR-1 expression is significantly reduced in primary human hepatocellular carcinomas (HCCs) compared with matching normal liver tissues [39]. [score:2]
miR-1 provide critical functions downstream of classic oncogenic signaling pathways such as those controlled by Met, HDAC4, PIM-1, Wnt, Cyclin D, FOXP1, Slug, and TAGLN2. [score:1]
4.2. miR-1 in Gastrointestinal Cancer. [score:1]
Similar to other nucleic acid constructs, miR-1 has stability and delivery problems for clinical applications. [score:1]
miR-1 has been shown to be antitumorigenic in lung cancer cells [34, 36, 37]. [score:1]
As reviewed above, miR-1 contributes to several biological processes of the tumor cell, including differentiation, proliferation, and apoptosis. [score:1]
Additionally, recent studies have observed a functional contribution of miR-1 to cellular transformation, tumorigenesis, apoptosis, and drug sensitivity. [score:1]
Inside the cell, miR-1 is transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give ~22 nucleotide mature products. [score:1]
miR-1 has also been shown to act upstream from β-catenin of the canonical Wnt pathway [75]. [score:1]
Downmodulation of miR-1 has been identified as one of the events that enhance colorectal cancer progression [44]. [score:1]
5. Therapeutic Potential of miR-1 Modulation. [score:1]
The mature sequence comes from the 3′ arm of the miR-1 precursor. [score:1]
Additionally, the reason that miR-1 is silenced in colorectal cancer is likely due to DNA hypermethylation, as miR-1 is methylated frequently in early and advanced colorectal cancer [45, 46]. [score:1]
In another study, lung cancer A549 cells overexpressing miR-1 exhibited a significant morphological change from a mesenchymal to an epithelial phenotype characterized by cell polarization and intercellular junctions [37]. [score:1]
Transfection of miR-1 in bladder cancer cell lines significantly increased caspase-3/7 activities. [score:1]
4.1. miR-1 in Lung Cancer. [score:1]
Therefore, developing safe and effective nonviral miR-1 delivery systems is very important. [score:1]
Moreover, there is a significant relationship between the expression levels of miR-1 and PIK3CA in NSCLC and clinical characteristics and prognosis [35]. [score:1]
4.5. miR-1 in Sarcoma. [score:1]
These findings suggest the potential use of Wnt-modulating miR-1 as diagnostic and therapeutic tools in Wnt -dependent cancers, such as colorectal cancer. [score:1]
4.3. miR-1 in Genitourinary Cancer. [score:1]
These data support the notion that miR-1 holds substantial clinical potential as differentiation therapy for RMS and perhaps other solid tumors. [score:1]
Among them, miR-1 is the most consistently decreased miR in various human cancers, suggesting the great potential miR-1 replacement therapy holds for cancer treatment. [score:1]
In addition, the promotion of cell apoptosis and cell cycle arrest was demonstrated following miR-1 transfection of cancer cells. [score:1]
Most miR-1 and sarcoma studies were on rhabdomyosarcoma (RMS). [score:1]
These results demonstrate that miR-1 may have a functional effect on chordoma tumor pathogenesis [14, 73]. [score:1]
There are two different precursors of miR-1 in human, miRNA-1-1 and miRNA-1-2, both of which are processed into an identical mature form of miR-1. miRNA-1-1 and miRNA-1-2 are located in two distinct chromosomal regions in human genome, −20q13.33 and 18q11.2, respectively (Figure 2). [score:1]
2. Basic Biology of miR-1 and Validated Functions of miR-1 in Normal Tissues. [score:1]
Gain-of-function studies using miR-1 revealed significant decreases in HNSCC cell proliferation, invasion, and migration. [score:1]
4.4. miR-1 in Head and Neck Cancer. [score:1]
[1 to 20 of 144 sentences]
2
[+] score: 406
Other miRNAs from this paper: hsa-mir-206, hsa-mir-1-1
org) algorithm predicted that VEGF-A, EDN1, and MET were directly targeted by miR-1. Furthermore, a protein array assay showed that these three targets were downregulated in miR-1 -overexpressed cells compared with control cells (data not shown). [score:9]
control, WT wild type, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001 To determine whether miR-1 can inhibit VEGF-A and EDN1 expression by targeting their binding sites in their 3′ UTRs, the PCR product containing each intact target site or mutant site of the miR-1 seed recognition sequence (Fig.   4a) was inserted into the luciferase reporter vector. [score:9]
Overexpression of miR-1 in GC cells inhibited proliferation, migration, and tube formation of endothelial cells by suppressing expression of vascular endothelial growth factor A (VEGF-A) and endothelin 1 (EDN1). [score:9]
control, WT wild type, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001 MiR-1 interacts with a putative binding site in the VEGF-A and EDN1 3′ UTRTo determine whether miR-1 can inhibit VEGF-A and EDN1 expression by targeting their binding sites in their 3′ UTRs, the PCR product containing each intact target site or mutant site of the miR-1 seed recognition sequence (Fig.   4a) was inserted into the luciferase reporter vector. [score:9]
Overexpression of miR-1 significantly weakened malignant behavior of GC cells and tube formation of endothelial cells by directly suppressing VEGFA and EDN1 expression. [score:8]
Our data revealed a remarkable upregulation of mature miR-1 expression in all the GC cell lines examined, which is in accordance with previous findings, indicating hypermethylation may partly contribute to miR-1 suppression in GC. [score:8]
We also knocked down miR-1 in MKN28 and GES-1 cells using antago-miR-1, and showed that inhibition of miR-1 expression significantly enhanced expression of MET and VEGF-A at the mRNA level and the protein level. [score:8]
In addition, we identified VEGF-A and EDN1 as two direct targets of miR-1. These findings could partially explain why overexpression of miR-1 could suppress the aggressiveness of GC. [score:8]
The results revealed that inhibition of miR-1 expression significantly enhanced the expression of VEGF-A, EDN1, and MET at both the mRNA level and the protein level (see Online Resource 3b and c in the electronic supplementary material). [score:7]
MiR-1 expression also exhibited negative correlation with d VEGF-A (R = −0.35, 95% CI −0.46 to −0.24), e MET (R = −0.18, 95% CI −0.30 to −0.06), and f EDN1 (R = −0.06, 95% CI −0.18 to −0.0)) in the GC patients from The Cancer Genome Atlas cohort Supplementary material 3 (PDF 69 kb) Online Resource 3. Inhibition of miR-1 increases expression of angiogenesis-related factors at both the messenger RNA level and the protein level. [score:7]
As shown in Fig.   3a and b, ectopic expression of miR-1 significantly inhibited VEGF-A, EDN1, and MET expression in GC cell lines at both the transcription level and the protein level. [score:7]
We used antago-miR-1 to knock down its expression in highly differentiated MKN28 tumor cells and immortalized GES-1 gastric epithelial cells, both of which naturally express a relatively high level of miR-1. We found that transfection of MKN28 and GES-1 cells with antago-miR-1 caused a more than tenfold decrease in miR-1 expression compared with the negative control or the wild type (see Online Resource 3a in the electronic supplementary material). [score:7]
We thus hypothesized that GC cells may downregulate miR-1 expression to tilt the balance toward stimulatory angiogenic factors to drive vascular growth, resulting in the development of GC metastasis. [score:7]
These phenomena may be explained by our observation that aberrant expression of miR-1 direct targets, VEGF-A, EDN1, and MET, enhanced GC progression and stimulated angiogenesis. [score:6]
These results were consistent with the negative prognostic value of downregulated miR-1 expression in prostate cancer [27], colon cancer [28], and breast cancer [29]. [score:6]
Expression of miR-1 in human GC cell lines and primaryPreviously we reported that miR-1 was the most significantly downregulated miRNAs in GC on the basis of TCGA data [5]. [score:6]
Fig.  1MiR-1 expression in cultured gastric cancer (GC) cells and primary GC tissues samples, and its correlation with prognosis of GC patients a MiR-1 expression in GC cell lines compared with the immortalized gastric cell line GES-1. b Quantitative PCR levels showing reexpression of mature miR-1 in GC cell lines after 5-aza-2′-deoxycyridine (5-aza-dC) treatment. [score:6]
control, Mut mutant, Wt wild type, * P < 0.05, ** P < 0.01 Since VEGF-A and EDN1 have been implicated in the angiogenesis and metastasis [23, 24], and the expression of both VEGF-A and EDN1 was inhibited by miR-1 in our study, it is possible that miR-1 might participate in angiogenesis. [score:5]
Thus fold changes of tumor to nontumor miR-1 expression were adopted for evaluation—namely, a patient with a ratio less than one third was defined as having low expression, and a patient with a ratio greater than or equal to one third was defined as having high expression. [score:5]
These results were supported by the negative correlation between miR-1 expression and mRNA expression of MET and VEGF-A in our Chinese cohort (see online resource 2a and b in the electronic supplementary material) as well as the GC patients recruited in TCGA (see Online Resource 2d and e in the electronic supplementary material). [score:5]
The rows denote different miRNAs Supplementary material 2 (PDF 188 kb) Online Resource 2. MiR-1 expression was negatively correlated with a VEGF-A [R = −0.23, 95% confidence interval (CI) −0.42 to −0.03], b MET (R = −0.21, 95% CI −0.40 to −0.01), and c EDN1 (R = −0.18, 95% CI −0.38 to 0.03) expression in Chinese patients with gastric cancer. [score:5]
Fig.  2Overexpression of miR-1 suppressed the proliferation and migration capability of GC cells. [score:5]
a The target sites for miR-1 in the VEGF-A (NM_001025369.2), and EDN1 (NM_001955.4) 3′ UTR were identified with the TargetScan database. [score:5]
a Transfection with antago-miR-1 inhibited miR-1 expression in MKN28 and GES-1 cells. [score:5]
As shown in Fig.   1a, miR-1 was obviously downregulated in GC-derived cell lines compared with normal stomach-derived cells (GES-1), and the expression level tended to be decreased with poor differentiation. [score:5]
We quantified miR-1 expression in both tumor and corresponding nontumor tissues, and analyzed the relationships between the levels of miR-1 expression and clinicopathological parameters in 90 Chinese patients with GC. [score:5]
Western blot, qRT-PCR, and ELISA confirmed that overexpression of miR-1 in four GC cell lines significantly decreased VEGF-A, EDN1, and MET expression. [score:5]
Conversely, inhibition of miR-1 with use of antago-miR-1 caused an increase in expression of VEGF-A and EDN1 in nonmalignant GC cells or low-malignancy GC cells. [score:5]
Since miR-1 was downregulated in most of the GC cell lines, our gain-of-function experiments demonstrated that overexpression of miR-1 in GC cells attenuated the evil character of GC cells, such as proliferation and invasiveness, significantly compared with control groups. [score:5]
We found that miR-1 was frequently downregulated in tumor tissues compared with corresponding nontumor tissues, and that low expression of miR-1 was correlated with poor prognosis. [score:5]
Stahlhut et al. [20] demonstrated that miR-1 negatively regulated angiogenesis by suppressing VEGFA during zebrafish development. [score:5]
Overexpression of miR-1 suppressed proliferation and migration of GC cells. [score:5]
After treatment with the demethylation agent 5-aza-dC, the level of miR-1 expression was restored significantly in all the GC cell lines examined compared with the wild-type cells, suggesting that DNA hypermethylation may account for miR-1 downregulation in GC cells (Fig.   1b). [score:5]
Logarithmically growing BGC823, SGC7901, AGS and HGC27 cells were seeded in a 10-cm dish (6 × 10 [6] cells per flask), and then transfected with 16 μg GV268-miR-1 (hsa-miR-1-1) or a nonspecific GV268-ctrl plasmid (GeneChem, China) for miR-1 overexpression and 30 nM antago-miR-1 or antago-miR negative control for miR-1 suppression (Ambion, Austin, TX, USA) with Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA). [score:5]
control, HMVEC human microvascular endothelial cell, WT wild type, * P < 0.05, ** P < 0.01, *** P < 0.001 Previous findings obtained from miRNome analysis of GC patients from TCGA revealed that miR-1 was the most downregulated miRNA in GC (see Online Resource 1 in the electronic supplementary material). [score:4]
Intriguingly, some studies suggested an upregulation of plasma miR-1 in GC patients, including those who developed resistance to chemoagents [13, 14], by comparison with healthy individuals. [score:4]
To investigate the direct effect of miR-1 on these predicted target genes in GC cells, the expression change of these genes was analyzed by qPCR and Western blotting at 48 h after miR-1 transfection. [score:4]
Microarray analysis on biopsy samples from 90 GC patients and 34 healthy volunteers by Kim et al. [12] revealed that miR-1 was one of the mostly downregulated miRNAs in GC. [score:4]
control, HMVEC human microvascular endothelial cell, WT wild type, * P < 0.05, ** P < 0.01, *** P < 0.001 Previously we reported that miR-1 was the most significantly downregulated miRNAs in GC on the basis of TCGA data [5]. [score:4]
MiR-1 inhibited VEGF-A, EDN1, and MET expression in GC cells. [score:4]
In this study, overexpression miR-1 in GC cells affected the endothelial cell tubular formation activity in a co-culture system study, implying that miR-1 may modulate gastric-tumor-related angiogenesis by regulating VEGF-A and EDN1. [score:4]
MiR-1, sharing a similar seed sequence with miR-206, was originally described as muscle specific, and has been shown to downregulate MET, FOXP1, KRAS, PIK3CA, and NAIP, which are important oncogenes relating to tumorigenic properties of various cancer types [6– 10] and even tumor -associated macrophages [11]. [score:4]
We recently reported that miR-1 was one of the most significantly downregulated microRNAs in gastric cancer (GC) patients from The Cancer Genome Atlas microRNA sequencing data. [score:4]
Downregulated miR-1 not only promotes cellular proliferation and migration of GC cells, but may activates proangiogenesis signaling and stimulates the proliferation and migration of endothelial cells, indicating the possibility of new strategies for GC therapy. [score:4]
Supplementary material 1 (PDF 149 kb) Online Resource 1. MiR-1 was the most markedly downregulated microRNA (miRNA) in gastric cancer (GC) according to the heatmap illustrating miRNome profiles from 295 gastric cancer cases from The Cancer Genome Atlas (TCGA). [score:4]
Taken together, our data imply a possible major role of miR-1 in downregulating VEGF-A and MET rather than EDN1. [score:4]
We found miR-1 directly targeted MET, which was supported by a recent report [33]. [score:4]
The human VEGF-A and EDN1 3′ untranslated region (UTR; 1938 and 1126 bp respectively) containing the putative binding sites of miR-1 (wild type) or an identical sequence with mutations of the miR-1 seed sequence (mutant) was amplified by PCR and then inserted into the firefly luciferase reporter vector pEZX-MT06. [score:4]
On the other hand, the reporter vector lacking the miR-1 recognition site (mutant) fully rescued the miR-1 repression of both VEGF-A and EDN1 luciferase activity (Fig.   4b), indicating that miR-1 directly and specifically interacts with the target site in the VEGF-A and EDN1 3′ UTRs. [score:4]
In contrast, when we considered the interaction between miR-1 expression and tumor stage, our multivariate analysis revealed the interaction between miR-1 expression and tumor stage was the only independent factor associated with worse prognosis of GC (P < 0.001). [score:4]
To identify the potential target of miR-1, we combined a bioinformatics prediction (TargetScanHuman) and a protein array assay. [score:4]
Kaplan–Meier survival curves showed that overall survival was worse in GC patients with low miR-1 expression compared with GC patients with high expression (P = 0.0027, Fig.   1d). [score:4]
Furthermore, downregulation of miR-1 was negatively associated with 5-year survival rate. [score:4]
Patients with low miR-1 expression had significantly shorter overall survival compared with those with high miR-1 expression (P = 0.0027). [score:4]
MiR-1 acts as a tumor suppressor by inhibiting angiogenesis-related growth factors in human gastric cancer. [score:4]
The proportion of patients with low miR-1 expression tended to increase with advanced TNM stages (P = 0.143). [score:3]
EDN1 exerted a weak correlation with miR-1 expression (see Online Resource 2c and f in the electronic supplementary material), however, the correlation failed to reach statistical significance in both cohorts. [score:3]
Changes in miR-1 expression were normalized to SNORD48 expression, and calculated with the 2 [−ΔΔCt] method. [score:3]
Expression of miR-1 was obviously decreased in GC cell lines and primary tissues. [score:3]
Low miR-1 expression was positively related to lymph node involvement, vascular invasion, and distant metastasis. [score:3]
Multivariate analysis was then performed on the following factors known to impact survival: tumor stage, tumor location, tumor size, vascular invasion, age, sex, and miR-1 expression. [score:3]
Our previous study analyzing miRNA sequencing data of GC from The Cancer Genome Atlas (TCGA) website revealed that miR-1 was markedly downregulated in GC compared with adjacent nonmalignant tissue samples. [score:3]
Thus, we propose miR-1 as an additional target to improve antiangiogenesis therapy in GC. [score:3]
Collectively, low miR-1 expression is strongly associated with a poorer prognosis in patients with GC as well as metastasis progression. [score:3]
Hence, our results suggest that loss of miR-1 expression was significantly correlated with metastasis and poor prognosis in primary GC. [score:3]
As shown in Table  1, GC patients with low miR-1 expression showed a higher potential to develop vascular invasion, lymph node involvement, and distant metastasis (respectively 55.6% vs 30.8%, P = 0.033; 44.8% vs 30.4%, P = 0.040; and 81.8% vs 44.3%, P = 0.020). [score:3]
Expression of miR-1 in human GC cell lines and primary GC samples. [score:3]
To assess the miR-1 expression pattern in Chinese patients with GC, we firstly performed qPCR in GC cell lines and paired primary tissues from 90 GC patients with or without metastasis at diagnosis. [score:3]
In our multivariate analysis, low miR-1 expression alone exerted a marginal effect on the prognosis of GCs. [score:3]
The results showed that miR-1 significantly inhibited both cell proliferation (Fig.   2a–d, P < 0.05) and cell mobility (Fig.   2e–h) in all the GC cells examined. [score:3]
We treated GC cell lines with a demethylating agent, 5-aza-dC, and assessed miR-1 expression by qPCR. [score:3]
In this study, we also observed an association between miR-1 expression and clinicopathological factors. [score:3]
Intriguingly, the interaction between miR-1 and stage was an independent factor for GC prognosis in the multivariate mo del, indicating that a strong association between miR-1 expression and tumor stage plays a profound role in GC pathogenesis. [score:3]
These results further indicate that miR-1 might act as a tumor suppressor in GC. [score:3]
Recent studies have shown that EDN1 [37] and VEGF-A [38] promoted tumor progression via an angiogenesis-independent action of epithelial–mesenchymal transition, which may provide a plausible explanation for our observations that miR-1 inhibited the proliferation and migration of GC. [score:3]
WT wild type, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001 We then analyzed the association of miR-1 expression status with clinicopathological features in GC patients. [score:3]
c Relative expression levels of miR-1 in primary gastric tumors and adjacent nontumor tissues (n = 90). [score:3]
Patients with high expression of serum miR-1 showed resistance to fluoropyrimidine -based chemotherapy [14]. [score:3]
To identify the target genes of miR-1, bioinformatic analysis and protein array analysis were performed. [score:3]
We further tested the changing level of VEGF-A, EDN1, and MET after miR-1 knockdown. [score:2]
Moreover, the regulation mechanism of miR-1 with regard to these predicted targets was investigated by quantitative PCR (qPCR), Western blot, ELISA, and endothelial cell tube formation. [score:2]
In this study, qPCR analysis revealed that loss of miR-1 expression was frequently observed in primary gastric tumors compared with adjacent normal tissues, which was consistent with the data observed in breast, lung, colon, and hepatocellular carcinoma [7– 10]. [score:2]
The putative binding site of miR-1 on target genes was assessed by a reporter assay. [score:2]
MiR-1 suppressed HMVEC proliferation, migration, and tube formation. [score:2]
MiR-1 was also frequently downregulated in primary tumors compared with paired nontumor tissues (P < 0.0001) (Fig.   1c). [score:2]
MiR-1 expression did not retain statistical significance with regard to survival (P = 0.108, Table  2). [score:2]
Further study will be warranted to confirm the antiangiogenetic biological effect of miR-1 and to determine whether miR-1 is directly involved in epithelial–mesenchymal transition in GC by use of an animal mo del. [score:2]
Gene-specific reverse transcription for miR-1 and SNORD48 was carried out using about 500 ng of purified total RNA, 0.15 μL of 100 mM dNTPs (with dTTP), 1.5 μL MultiScribe reverse transcriptase (50 U/μL), 1.5 μL 10× reverse transcription buffer, 0.188 μL RNase inhibitor, 3.0 μL 5× TaqMan miRNA reverse transcription primer, and 4.162 μL nuclease-free water. [score:2]
As expected, HMVECs showed remarkable inhibition of cell growth, migration, and tube formation when cultured in conditioned medium derived from the miR-1 -transfected cells compared with control ones (P < 0.05, Fig.   5). [score:2]
d Kaplan–Meier curves of overall survival for all patients with miR-1 -high versus miR-1-low GC tissue. [score:1]
Supernatant from the BGC823 and AGS cells transfected with GV268-miR-1 or a nonspecific GV268-ctrl plasmid or the wild type was collected and centrifuged at 400g for 5 min. [score:1]
Previously, methylation -mediated silencing of miR-1 was found in hepatocellular carcinoma [7], prostate cancer [27], and colorectal cancer [30]. [score:1]
After overnight incubation, about 70% confluent cells were transiently transfected with 150 μL Opti-MEM (Gibco, USA) containing 0.15 μL Lipofectamine 3000 reagent (Invitrogen, USA) and 0.2 μL P3000 reagent, 100 ng luciferase reporter plasmids, and 120 ng GV268-miR-1 or GV268-ctrl plasmid per well. [score:1]
Considering VEGF-A is a paracrine growth factor, and the protein level in culture medium derived from BGC823 and AGS cells transfected with miR-1 or control was also assessed by ELISA. [score:1]
VEGF-A and EDN1 firefly luciferase activity normalized to Renilla luciferase activity was significantly reduced in cells co -transfected with miR-1 (P < 0.05), but such reduction was not found on negative control transfection (Fig.   4b). [score:1]
COS-7 cells were transfected with these plasmids together with the GV268-miR-1 plasmid or GV268-ctrl plasmid. [score:1]
VEGFA and miR-1 are well conserved across all species, indicating that the same phenomenon may possibly occur during carcinogenesis. [score:1]
Here we aim to elucidate the role of miR-1 in gastric carcinogenesis. [score:1]
Relationship between miR-1 expression and clinicopathological characteristics. [score:1]
We measured miR-1 expression in human GC cell lines and 90 paired primary, and analyzed the association of its status with clinicopathological features. [score:1]
After both BGC823 and AGS cells had been transfected with GV268-miR-1 or GV268-ctrl plasmid respectively, the conditioned medium was collected and the effects of conditioned medium on human microvascular endothelial cell proliferation (a), migration (b), and tube formation (c) were assessed. [score:1]
One immortalized gastric mucosal epithelial cell line (GES-1) and 6 GC cell lines (SGC7901, MKN28, NCI-N87, BGC823, AGS, and HGC27) were cultured for miR-1 expression evaluation. [score:1]
Furthermore, no study has investigated the clinical significance of miR-1 expression in GC tissue samples. [score:1]
c Relative protein levels of vascular endothelial growth factor A (VEGF-A) in supernatant of gastric cancer cells transitorily transfected with pri-miR-1 plasmid determined by ELISA. [score:1]
Fig.  5Effects of miR-1 on the proliferation, migration and tube formation of human microvascular endothelial cells. [score:1]
e Transfection efficiency of miR-1 in GC cells by qPCR. [score:1]
miR-1 Gastric cancer Vascular endothelial growth factor A Angiogenesis Gastric cancer (GC) is the third commonest cause of cancer deaths worldwide [1]. [score:1]
[1 to 20 of 107 sentences]
3
[+] score: 305
Other miRNAs from this paper: hsa-mir-1-1
The above results may imply that miR-1 regulated HK2 and MCT4 expression by directly target HIF-1α expression; however, it is still unknown that the miR-1 decreased HIF-1α expression at mRNA level, which further attracted us to uncover the underlying mechanism. [score:11]
We found that depletion of Smad3 in colorectal cancer cells reduced HIF-1 α expression, which was consistent with another work from our team also exhibited that Smad3 contributed to tumor glycolysis, which is key regulator in tumor glycolysis (data not shown, unpublished), these results implied that miR-1 regulated tumor glycolysis not only by directly targeting HIF-1 α but also by Smad3 -mediated HIF-1 α, HK2 and MCT4 expression. [score:10]
We found that phospho-Smad3 Ser213 was decreased in HT-29 and CaCO [2] cells expressing miR-1, which further inhibited Smad3 binding to the promoter thereby suppressing translation. [score:9]
MiR-1 inhibited cell proliferation in vitroRecently, Wei et al. showed by massively parallel sequencing that a large proportion of genes upregulated after deletion of miR-1 s were associated with the cardiac fetal gene program and fetal sarcomeres and regulated cell proliferation, glycolysis or glycogenesis, [21] suggesting that miR-1 has a key role in regulation of energy metabolism. [score:8]
Interestingly, HIF-1 α, well known for its role in tumorigenesis and tumor progression, is a critical regulator in regulation of HK2 and MCT4 during tumor Warburg 27, 28 and we also found that miR-1 had an effect on HK2, HIF-1 α and MCT4 mRNA expression levels (Figures 3b, d and f), indicating that these glycolytic metabolic enzymes were regulated by miR-1 may not only at mRNA transcriptional level but also at protein expression level. [score:8]
We showed that miR-1 inhibited tumor proliferation by suppression of glycolysis and negative regulation of Smad3 activity and HIF-1 α expression. [score:8]
Finally, the effects on cell proliferation and glycolysis were not seen in HT-29 and CaCO [2] cells expressing miR-1 inhibitor and Smad3 downregulation (Figure 5d). [score:8]
In addition, we transfected siRNA targeted to HIF-1 α into HT-29 overexpressed miR-1 mimics, which further diminished HK2 and MCT4 expression (Figure 2s). [score:7]
HIF-1 α is a target of miR-1MiR-1 had been associated with the Warburg effect in colorectal tumor cells, but the mechanisms by which miR-1 inhibited glycolysis with affecting HIF-1 α expression needed exploration. [score:7]
34, 35, 36, 37 For example, our finding of miR-1 inhibition of colorectal cancer cell growth is similar to results reported by Kojima et al. [38] and Han et al. [39] that ectopic overexpression of miR-1 suppressed cell proliferation, migration, wound healing, and invasion of gastric cancer cells. [score:7]
The results thus indicated that miR-1 mimics could inhibit glycolysis, and taken together, the gain- or loss-of-function studies led to the conclusion that miR-1 suppressed aerobic glycolysis, or the Warburg effect, in colorectal cancer cells, which further inhibited cell proliferation. [score:7]
As shown in Figures 6a and d, cells expressing the miR-1 mimic generated smaller tumors than control group and those overexpressing Smad3, indicating miR-1 suppressed, while Smad3 promote tumor proliferation in vivo. [score:7]
Ectopic expression of miR-1 mimics markedly abolished this interaction, which largely be attributed to inhibit HIF-1α expression caused by miR-1, resulting in reduction of phosphorylation of Smad3. [score:7]
Cell viability was significantly reduced in colorectal cancer cells expressing miR-1. The contrasting results obtained in cells expressing miR-1 inhibitor (Figures 2c–e) demonstrated that miR-1 had a consistent anti-proliferative role in HCT-116, HT-29 and CaCO [2] of colorectal cells. [score:7]
Downregulation of miR-1 significantly increased HIF-1 α expression, resulting in enhancement of tumor glycolysis and tumor growth. [score:6]
Recently, Wei et al. showed by massively parallel sequencing that a large proportion of genes upregulated after deletion of miR-1 s were associated with the cardiac fetal gene program and fetal sarcomeres and regulated cell proliferation, glycolysis or glycogenesis, [21] suggesting that miR-1 has a key role in regulation of energy metabolism. [score:6]
MiR-1 suppressed glucose uptake, lactate production and cell proliferation by inhibition of HIF-1 α expression, which further uncoupling from Smad3 and dephosphorylation of Ser213 in the Smad3 linker domain, finally the subsequent reduction of Smad3 binding to the promoter and decreased HIF-1 α transactivity, and attenuated cell proliferation. [score:6]
Interestingly, SB431542 treatment as indicated time had no effect on this interaction, but aggravated this inhibition effect of miR-1 mimics (Figure 3s), In summary, these data suggested that Smad3 is the primary regulator of miR-1 -induced inhibition of tumor glycolysis. [score:6]
We found that forced expression of miR-1 mimics significantly suppressed the activity of the luciferase reporter gene containing the wt 3′-UTR of HIF-1 α, but not the gene containing the mutated form (Figure 4b); in contrast, no significant difference in RLU were obtained in psicheck2-MCT4-3′-UTR and psichek2-HK2-3′-UTR compared with control in miR-1 overexpressed HEK293 cells, respectively (Figure 1s). [score:6]
We identified HIF-1 α is a direct target of miR-1, and most important, Smad3 regulated and interacted with HIF-1 α, leading to increasing Smad3 activity, which implies the contribution of a feed forward loop in regulation of tumor glycolysis and proliferation. [score:6]
Ectopic miR-1 expression has been shown as a candidate tumor suppressor in other human cancers. [score:5]
At the same time, glucose uptake and lactate production were increased in cells expressing miR-1 inhibitor (Figures 2f–h). [score:5]
As shown in Figure 1a, the results revealed that miR-1 expression in the SW480, SW620, HCT-116, HT-29 and CaCO [2] of colorectal cancer cell lines was significantly downregulated compared with the normal human colon epithelial cell line NCM460 or the normal tissue of non-cancerous tissue samples. [score:5]
Smad3 overexpression abolished the effect of miR-1 inhibition on glycolysis and cell proliferation. [score:5]
Cell proliferation analysis revealed that ectopic overexpression of Smad3 diminished the inhibitory effect of miR-1 on cell growth (Figure 5c). [score:5]
Cells transfected with miR-1 mimics significantly suppressed HK2, HIF-1 α and MCT4 protein expression in HCT-116, HT-29 and CaCO [2] cells. [score:5]
In contrast, the presence of miR-1 inhibitor increased glycolytic protein expression in HCT-116, HT-29 and CaCO [2] cells (Figures 3a, c and e). [score:5]
MiR-1 had been associated with the Warburg effect in colorectal tumor cells, but the mechanisms by which miR-1 inhibited glycolysis with affecting HIF-1 α expression needed exploration. [score:5]
A luciferase reporter assay was used to determine whether miR-1 could directly target the 3′-UTR regions of HIF-1 α. We cloned the target sequences of wild-type (wt) 3′-UTR or mutant (mt) 3′-UTR into a luciferase reporter vector (Figure 4a), and transfected HEK293 cells with the wt or mt 3′-UTR vector and miR-1 mimics. [score:5]
Most importantly, our results showed that this interaction was dramatically disrupted by transfection of miR-1 mimics (Figure 4h), which may be largely attributed to reduction of HIF-1 α expression by miR-1 mimics, leading to decrease phosphorylation of Smad3 and inhibit tumor glycolysis. [score:5]
We also demonstrated that suppression of tumor glycolysis by the miR-1/Smad3 axis was critical for inhibition of tumor cell proliferation in vivo. [score:5]
Overexpression of Smad3 significantly reversed the inhibition of miR-1 -mediated tumor glycolysis and tumor growth. [score:5]
As shown in Figure 4c, western blots revealed that miR-1 mimics significantly suppressed the Smad3 pathway through decreased phosphorylation of Ser213 on the Smad3 linker region predominant in HT-29 and CaCO [2] cells, a phosphorylation site central to tumor progression, despite luciferase assay showed that Smad3 is not a target of miR-1 (Figure 1s). [score:4]
Collectively, these data indicated that HIF-1 α was a direct target of miR-1 and had a critical role in tumor glycolysis. [score:4]
45, 46, 47, 48, 49 In this study, we found that HIF-1 α was a direct functional target of miR-1 in human colorectal cancer. [score:4]
The above result we found that miR-1 negatively regulated tumor glycolysis and inhibited cell proliferation, which force us to investigate the effect of miR-1 on expression of multiple glycolytic enzymes. [score:4]
Bioinformatic analysis revealed two potential targets of miR-1 binding in fragments in the 3′-UTR region of the HIF-1α gene. [score:3]
We detected miR-1 expression using qRT-PCR in colorectal cancer cell lines. [score:3]
HIF-1 α is a target of miR-1. MiR-1 repressed the Warburg effect by inactivation of Smad3. [score:3]
Consistent with this, overexpression of miR-1 strongly reduced the binding of Smad3 to the promoter in these cells (Figure 5a). [score:3]
These results demonstrated that Smad3 is required for miR-1 -mediated suppression of tumor proliferation and glycolysis in colorectal cancer cells. [score:3]
As expected, Smad3 significantly enhanced glucose uptake and lactate production in transfected HT-29 colorectal cancer cells that overexpressed miR-1 mimics (Figure 5b). [score:3]
The above result showed that miR-1 inhibited cell proliferation in colorectal cancer cells; it is still, however, unclear whether the action of miR-1 in tumor cell proliferation by restraint of tumor glycolysis. [score:3]
Despite the above results demonstrated that HIF-1α is a target of miR-1, the mechanism through which miR-1 mimics decreased Smad3 activity is still unknown. [score:3]
while phosphorylation of Smad3 was significantly enhanced in cells transfected with miR-1 inhibitor (Figure 4d). [score:3]
We thus report a previously unappreciated mechanism to explain, at least partially, the function of miR-1 in inhibition of tumor cell proliferation. [score:3]
Multiple studies have found that miR-1 is downregulated in many cancers compared with the corresponding normal tissue, including lung and head and neck sarcomas in addition to colorectal cancer. [score:3]
As shown in Figure 7, we demonstrated that miR-1 suppressed aerobic glycolysis while Smad3 promoted it via its downstream effecter HIF-1 α and glycolytic enzymes, including HK2, MCT4, in colorectal cancer. [score:3]
The promoter fragment containing the Smad3 site was enriched in cells, in which the miR-1 inhibitor was present. [score:3]
The lentivirus vectors Lv-miRNA-1 mimics, LV-miR-1 inhibitor and LV-miRNA-NC were purchased from Genepharma. [score:3]
To further confirm the possibility that downregulation of these genes transactivation resulting from miR-1 led to reduction of binding of Smad3 to the promoter sequence, ChIP assays were used to determine whether the binding of Smad3 to HIF-1 α, HK2 and MCT4 promoters activated transcription in colorectal cancer cells and confirm the functional importance of miR-1 in recruitment of Smad3. [score:3]
In addition, as shown in Figure 4e, primarily location of Smad3 in nuclear was substantially reduced by miR-1 mimics overexpressed in HT-29 cells, α-tubulin and H3 served as internal control for the cytosolic and nuclear fraction, respectively. [score:3]
MiR-1 suppressed glycolysis in colorectal cancer cells. [score:2]
However, the role of miR-1 in tumor glycolysis and the molecular mechanism through which miR-1 regulates the Warburg effect to affect cell proliferation were not known. [score:2]
MiR-1 significantly decreased glycolytic relative gene expression. [score:2]
Functional role of the miR-1/Smad3/HIF-1 α axis in regulating glucose metabolism and controlling tumorigenesis in vivoGiven the importance of miR-1 in aerobic glycolysis in cancer cells, the results prompted us to examine whether activity of the miR-1/Smad3/ HIF-1 α axis influenced tumor growth in vivo. [score:2]
To test that hypothesis and investigate functional relationships, we established HCT-116, HT-29 and CaCO [2] cells that stably expressed miR-1 mimics or miR-1 inhibitor by virus infection and confirmed by qPCR assay (Figures 2a and b). [score:2]
In summary, our study is the first to unravel the role and mechanism of miR-1 in tumor cell proliferation by regulation of tumor glycolysis in colorectal cancer. [score:2]
MiR-1 was weakly expressed in colorectal cancer. [score:2]
Importantly, western blots revealed that, compared with control group, HK2, MCT4, HIF-1 α and pSmad3 protein expression was significantly reduced in cells with miR-1 mimics. [score:2]
Taken together, these results indicated that miR-1 had a significant role in Smad3 -mediated transactivation of glycolytic enzymes, including HK2, MCT4 and HIF-1 α. As our results demonstrated that miR-1 regulated tumor glycolysis in colorectal cancer cells via inactivation by Smad3, we investigated whether Smad3 was required for miR-1 -mediated inhibition of tumor glycolysis and proliferation. [score:2]
Real-time PCR assay of miR-1 expression was performed on an Applied Biosystems StepOnePlus system, using a SYBR Green I Real-Time PCR kit (GenePharma). [score:2]
Taken together, these results are consistent with regulation of cell proliferation and glycolysis in colorectal cancer cells by a cascade controlled by the miR-1/Smad3/HIF-1 α axis. [score:2]
MiR-1 inhibited cell proliferation in vitro. [score:2]
Functional role of the miR-1/Smad3/HIF-1 α axis in regulating glucose metabolism and controlling tumorigenesis in vivo. [score:2]
These findings greatly extend our insight into the molecular functions of the miR-1/Smad3 axis in tumor progression. [score:1]
Cells were co -transfected with the plasmid psicheck2 dual-luciferase reporter vector containing 3′-UTR or 3′-UTR-mut of HIF-1 α, HK2, MCT4 or Smad3 along with miR-1 mimics or negative controls. [score:1]
[40] The antiproliferation activity of miR-1 and its effect on tumor progression have been previously reported. [score:1]
[13] We wondered whether miR-1 has an impact on glycolysis signaling via modulating phosphorylation of Smad3. [score:1]
However, the current study provides novel insights into the functional role of miR-1 in tumor glycolysis. [score:1]
Measurement of tumor metabolic parameters revealed that cellular lactate production and glucose uptake were significantly decreased in culture of HCT-116, HT-29 and CaCO [2] cells overexpressing miR-1 mimics. [score:1]
Taken together, these results indicated that the critical role of miR-1 in Smad3 nuclear translocation and activity. [score:1]
Given the importance of miR-1 in aerobic glycolysis in cancer cells, the results prompted us to examine whether activity of the miR-1/Smad3/ HIF-1 α axis influenced tumor growth in vivo. [score:1]
[1 to 20 of 73 sentences]
4
[+] score: 244
G6PD mRNA expression was down-regulated by 71% in Hela (Hela-plenti-miR-1, P < 0.01) and by 65% in Siha (Siha-plenti-miR-1, P < 0.01) cells overexpressing miR-1. Treatment with plenti-G6PD partially restored G6PD expression in both Hela-plenti-miR-1 and Siha-plenti-miR-1 cells. [score:10]
G6PD is a novel target of miR-1. G6PD is a potential target of miR-1. Identification of the G6PD mRNA 3′-UTR seed region directly regulated by miR-1. Decreased miR-1 expression is associated with pathological features in HR-HPV-infected cervical cancer patients. [score:9]
In conclusion, we demonstrated that: i) miR-1 bound to the 3′-UTR seed region of G6PD mRNA; ii) decreased miR-1 expression in HR-HPV 16/18-infected cervical carcinoma was correlated with carcinogenic development; iii) overexpression of miR-1 down-regulated G6PD, reduced proliferation, and promoted apoptosis in HR-HPV16/18+ cervical cancer cells; iv) co-transfection of both G6PD siRNA and miR-1 sponge partially reversed miR-1 sponge -induced promotions in cell viability and neoplasm growth. [score:9]
To determine whether miR-1 contributed to carcinogenic events in HR-HPV-infected cervical cancer by targeting G6PD, miR-1 overexpression and/or miR-1 inhibition was established in cultured cervical cancer cells with or without G6PD overexpression. [score:9]
These findings, together with our results, indicate that miR-1 inhibits proliferation and promotes apoptosis in cervical cancer both in vitro and in vivo by targeting G6PD, suggesting that G6PD -targeting treatments may provide a new strategy for cervical cancer therapy. [score:7]
Taken together, these results indicate that miR-1 might suppress the development and progression of HR-HPV-16/18+ cervical cancer by directly targeting G6PD, and that miR-1 might therefore be a valuable novel therapeutic candidate. [score:7]
In this study, we demonstrate that miR-1 might suppress the development and progression of HR-HPV 16/18-infected cervical cancer by targeting G6PD. [score:6]
Together, these in vitro and in vivo results indicate that miR-1 might suppress the development and progression of HR-HPV-16/18+ cervical cancer by targeting G6PD. [score:6]
To further examine whether miR-1 directly targets G6PD mRNA in HR-HPV 16/18-infected (+) cervical cancer cells, G6PD expression was measured using qRT-PCR and Western blot in Hela and Siha cells transfected with miR-1 overexpression or control vectors. [score:6]
These data demonstrated that miR-1 down-regulated G6PD expression by binding to the predicted regions of the G6PD mRNA 3′-UTR. [score:6]
Five mice were randomly assigned to each of the following 17 groups: normal human cervical epithelial H8 cells (H8) -treated group; miR-1 overexpression cervical cancer cell (Hela/Siha-plenti-miR-1) -treated groups; miR-1 deficient human cervical cancer cell (Hela/Siha-miR-1-sponge) -treated groups; matched control groups (Hela/Siha-lemiR and Hela/Siha-CX-control); G6PD rescue groups (Hela/Siha-plenti-miR-1 + plenti-G6PD, Hela/Siha-plenti-miR-1 + G6PD control); and G6PD inhibition groups (Hela/Siha-miR-1-sponge + G6PD-siRNA, and Hela/Siha-miR-1-sponge + Empty-siRNA). [score:5]
Based on the TargetScan, miRanda, and Diana microT computational algorithms, we determined that miR-1, miR-133a, and miR-206 might target a combined site in the G6PD 3′-UTR gene sequence. [score:5]
G6PD protein expression was detected using in Hela and Siha cells transfected with miR-1 overexpression or sponge vectors according to a previously described protocol [5]. [score:5]
Plenti-G6PD treatment partially attenuated the inhibition of proliferation and increase in apoptosis caused by miR-1 overexpression in Hela-plenti-miR-1 and Siha-plenti-miR-1 cells (Figure 5). [score:5]
Plenti-G6PD -induced G6PD overexpression partially reversed the inhibition of xenograft growth resulting from plenti-miR-1 treatment alone. [score:5]
Our results demonstrate that miR-1 inhibited G6PD expression in human cervical cancer cells and tumors. [score:5]
By reducing G6PD expression, miR-1 inhibited proliferation and promoted apoptosis in HR-HPV+ cervical cancer cells, and reduced the growth of tumor xenografts in nude mice. [score:5]
In contrast, inhibition of miR-1 increased G6PD mRNA expression 2.3-fold in Hela cells and 1.8-fold in Siha cells (both P < 0.05) (Figure 3A). [score:5]
In this study, we demonstrated that G6PD is also a direct target of miR-1 in cervical cancer cells. [score:4]
However, partial G6PD knockdown counteracted miR-1 overexpression -induced growth (miR-1-sponge + G6PD-siRNA vs. [score:4]
These results indicate that miR-1 inhibited proliferation and promoted apoptosis and tumor formation in HR-HPV+ cervical cancer by down -regulating G6PD. [score:4]
miR-1 inhibited proliferation and promoted apoptosis in cervical cancer cells by down -regulating G6PD. [score:4]
Wild-type (wt) and mutant (mut) human G6PD mRNA 3′-UTR seed regions, which included the potential target site for miR-1, were cloned. [score:3]
A lentiviral system was used for miR-1 overexpression. [score:3]
All of the databases examined predicted two potential miR-1 target regions in the G6PD mRNA 3′-UTR (“seed regions”) (Figure 3D). [score:3]
Similarly, co-transfection of miR-1-sponge and G6PD-siRNA neutralized the increase in proliferative capacity and inhibition of apoptosis induced by miR-1-sponge treatment alone. [score:3]
We simultaneously used miRNA sponge technology to inhibit miR-1 activity in cultured cervical cancer cells [24, 25]. [score:3]
Levels of these miR-1 targets in miRNPs are also shown following miR-133a/206 transfection. [score:3]
MiR-1 inhibits proliferation and promotes apoptosis in cervical cancer cells by down -regulating G6PD. [score:3]
miR-1 expression in cervical cancer cells and samples. [score:3]
Computational predictions, RIP-Chip assays, and dual-luciferase reporter assays revealed that G6PD mRNA was the most highly-expressed target of miR-1 in cultured HR-HPV+ Hela and Siha cells. [score:3]
The relationship between miR-1 expression and HPV 16/18 infected in CC patients (N = 57). [score:3]
Low miR-1 expression was correlated with FIGO stages I–II (I, P = 0.000; II, P = 0.000), increased cell differentiation (well, P = 0.000; moderate, P = 0.001), and tumor diameter (≤ 4, P = 0.000; > 4, P = 0.03, Table 1). [score:3]
To determine whether increased miR-1 expression was associated with cervical cancer, surgical tissue samples from 57 HR-HPV+ cervical cancer patients and matched controls were examined. [score:3]
These results indicate that the loss of miR-1 -induced G6PD suppression may play a crucial role in pathogenic events in HR-HPV+ cervical cancer. [score:3]
Additionally, Hela/Siha-plenti-miR-1 was co -transfected with plenti-G6PD using the lentiviral overexpression system described above (named Hela/Siha-plenti-miR-1 + plenti-G6PD). [score:3]
Furthermore, regression analysis revealed that increased miR-1 levels in HR-HPV 16/18-infected cervical carcinoma were correlated with cancer inhibition. [score:3]
To verify direct interactions between miR-1 and the seed regions, a wild-type G6PD 3′-UTR (G6PD 3′-UTR-wt) and a chemically synthesized G6PD 3′-UTR with two seed region mutations(G6PD 3′-UTR-mut) were cloned into dual-luciferase reporter plasmids. [score:3]
These findings suggest that miR-1 targets G6PD. [score:3]
Tumor sizes were smaller in the miR-1 overexpression groups (plenti-miR-1 and plenti-miR-1 + G6PD control) than in the other groups between 16 and 27 days post-injection (P < 0.05). [score:3]
The top ten miR-1 targets identified by RIP-Chip are shown in Figure 2B; mRNAs enriched following miR-1 transfection are listed in the Supplemental data. [score:3]
RNA associated with AGO protein complexes was then isolated for microarray profiling to identify transcriptome-wide miR-1/133a/206 targets in cervical cancer cells. [score:3]
Databases were subsequently used to identify the potential target region of miR-1 in the G6PD mRNA 3′-UTR. [score:3]
G6PD-siRNA treatment partially reversed these miR-1 inhibition -induced effects. [score:3]
Dysregulation of miR-1 is involved in carcinogenic events in various cancers, including colon cancer [36, 37], hepatocellular carcinoma [38], and esophageal squamous cell carcinoma (ESCC) [39]. [score:2]
qRT-PCR revealed that decreased miR-1 expression and increased G6PD levels correlated with cancer development and malignant characteristics. [score:2]
Meanwhile, apoptosis rates markedly increased in miR-1 -overexpressing cells compared to control lemiR-infected cells (Figure 5B). [score:2]
miR-1 expression decreased in Hela and Siha cells compared to C33A cells (0.21 ± 0.02 in Hela vs. [score:2]
The vast majority of mRNAs examined were not enriched in miRNPs following miR-1 transfection (A). [score:1]
Luciferase activity decreased by approximately 77% when miR-1 mimics were co -transfected with the G6PD 3′-UTR-wt plasmid (P < 0.01), but not with the G6PD 3′-UTR-mut plasmid (P > 0.05) (Figure 3E). [score:1]
We then used co-IP RIP-Chip to validate these predictions and found that miR-1 had the strongest interaction with G6PD. [score:1]
In addition, patients with low miR-1 levels in cervical cancer samples had higher HR-HPV 16 and HPV 18 infection rates (P < 0.05, Table 2). [score:1]
Quantitative PCR for miR-1/133a/206 was performed using an Applied Biosystems 7300 Sequence Detection system. [score:1]
Multivariate analysis of HPV status and miR-1 levels in women diagnosed as CC (N = 57). [score:1]
miR-1-sponge + Empty-siRNA, P < 0.05). [score:1]
Briefly, 293T cells were seeded in 96-well plates and co -transfected with 100 ng/mL of the individual pGL3-G6PD 3′-UTR-wt/mut vectors and 50 nM miR-1 mimics or NC (Ribobio, Guangzhou, China). [score:1]
Similarly, Hela/Siha-miR-1-sponge was co -transfected with G6PD-siRNA plasmid; co-transfection with Empty-siRNA served as a control (named Hela/Siha-miR-1-sponge + G6PD-siRNA and Hela/Siha-miR-1-sponge + Empty-siRNA, respectively). [score:1]
RIP-Chip consistently indicated that G6PD mRNA was more strongly incorporated into miRNPs following miR-1 transfection than the other mRNAs examined (Figure 2A and Figure 2B). [score:1]
The plasmids were then co -transfected with miR-1 mimics or miRNA negative control (NC). [score:1]
At 27 days post injection, tumors were smallest in the G6PD -deficient siRNA -treated group and the plenti-miR-1 treated group and largest in the miR-1 sponge -transfected groups. [score:1]
Cultured Hela and Siha cells were transfected with pCMV-d2eGFP-miR-1 (destabilized eGFP with the miR-1 sponge in the 3′-UTR, named Hela/Siha-miR-1-sponge) or pCMV-d2eGFP-CXCR4 as a control (destabilized eGFP with the CXCR4 non -binding sponge sequence, named Hela/Siha-CX-control). [score:1]
Hela and Siha cells were transfected with plenti-miR-1, lemiR, plenti-miR-1+plenti-G6PD, plenti-miR-1+G6PD control, miR-1-sponge, CX-control, miR-1-sponge+G6PD-siRNA, or miR-1-sponge+Empty-siRNA. [score:1]
Hela and Siha cells were co -transfected with plenti-miR-1 along with the packaging plasmids psPAX2 and pMD2. [score:1]
Tumor growth was fastest in mice treated with miR-1 sponge -treated cervical cancer cells (miR-1-sponge and miR-1-sponge + Empty-siRNA groups, Figure 6). [score:1]
After 24 hours, cells were transfected with 25 nM “Pre-miRNA” (Ambion) for has-miR-1, has-miR-133a, has-miR-206, or Negative Control (NC, Ambion, Austin, TX, sense sequence AGUACUGCUUACGAUACGG) using RNAiMAX (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions [13]. [score:1]
After confirming successful miR-1/133a/206 transfection, Affymetrix GeneChip microarrays were used to profile mRNAs associated with miRNPs following miR-1/133a/206 transfection. [score:1]
Effects of miR-1/G6PD on tumor formation in nude mice. [score:1]
Figure 4qRT-PCR was used to measure miR-1/133a/206 expression in different cervical cancer cells and in carcinoma samples from cervical cancer patients. [score:1]
G (Addgene), respectively (named Hela-plenti-miR-1 and Siha-plenti-miR-1). [score:1]
Co-immunoprecipitation (co-IP) revealed that transfected miR-1, miR-133a, and miR-206 were specifically incorporated into miRNPs in both Hela (Figure 1A) and Siha cells (Figure 1B). [score:1]
Figure 6H8 cells, Hela and Siha cells transfected with plenti-miR-1, lemiR, plenti-miR-1+plenti-G6PD, plenti-miR-1+G6PD control, miR-1-sponge, CX-control, miR-1-sponge+G6PD-siRNA, or miR-1-sponge+Empty-siRNA were injected into nude mice. [score:1]
miR-1:G6PD mRNA interaction. [score:1]
Relative G6PD enrichment in miRNPs consistently increased more than 50-fold following miR-1 transfection. [score:1]
We then performed regression analysis to examine the association between miR-1 levels and clinicopathologic parameters. [score:1]
Figure 1Northern blot analysis of miRNPs isolated after transfections with miR-1/133a/206 in Hela (A) and Siha (B) cells; these miRNAs were specifically recruited to miRNPs. [score:1]
Hela/Siha-plenti-miR-1 co -transfected with lemiR served as a control (named Hela/Siha-plenti-miR-1 + G6PD control). [score:1]
Therefore, miR-1 may serve as a novel therapeutic candidate in the treatment of HR-HPV 16/18-infected cervical cancer. [score:1]
miR-1/133a/206 expression was evaluated in different cervical cancer cell lines using qRT-PCR. [score:1]
H8 cells, Hela and Siha cells transfected with plenti-miR-1, lemiR, plenti-miR-1+plenti-G6PD, plenti-miR-1+G6PD control, miR-1-sponge, CX-control, miR-1-sponge+G6PD-siRNA, or miR-1-sponge+Empty-siRNA were injected into nude mice. [score:1]
analysis of miRNPs isolated after transfections with miR-1/133a/206 in Hela (A) and Siha (B) cells; these miRNAs were specifically recruited to miRNPs. [score:1]
qRT-PCR revealed that miR-1 levels were lower in neoplasm tissues than in normal tissues (0.34 ± 0.04 vs. [score:1]
Figure 2RIP-Chip revealed that G6PD mRNA was recruited to the miRNPs to the greatest degree following transfection with miR-1. (A-a) Enrichment in AGO-miRNPs after miR-1 transfection, n = 3161; (A-b) Enrichment in AGO-miRNPs after miR-133a transfection, n = 3336; (A-c) Enrichment in AGO-miRNPs after miR-206 transfection, n = 5958. [score:1]
All enrolled patients were then divided into two groups based on miR-1 levels; patients with miR-1 levels less than or equal to the median were assigned to the low level group, while those with miR-1 levels greater than the median were assigned to the high level group [33]. [score:1]
RIP-Chip revealed that G6PD mRNA was recruited to the miRNPs to the greatest degree following transfection with miR-1. (A-a) Enrichment in AGO-miRNPs after miR-1 transfection, n = 3161; (A-b) Enrichment in AGO-miRNPs after miR-133a transfection, n = 3336; (A-c) Enrichment in AGO-miRNPs after miR-206 transfection, n = 5958. [score:1]
Tumors were larger in miR-1 sponge -treated groups than in the other groups 16 days post-injection (P < 0.05). [score:1]
Among the many miRNAs identified, miR-1, miR-133a, and miR-206, each of which were predicted by all three software programs, were chosen for further validation. [score:1]
In control cells, plenti-miR-1 was replaced by control lemiR (named Hela-lemiR and Siha-lemiR). [score:1]
[1 to 20 of 87 sentences]
5
[+] score: 221
In hypertrophic adult rat VCMs, down-regulation of miR-1/miR-133 levels promotes automaticity via up-regulation of HCN2/HCN4, but this defect can be reversed by forced expression of miR-1/miR-133 [10], [11]. [score:9]
It is possible that miR-1 targets a transcriptional or translational repressor or negative functional inhibitor of these ion channels, Adding another level of complexity is our previously reported observation that the transcript levels and functionality of ion channels do not necessarily correlated [27] because ion channel functions (gating and permeation) often depend on the presence of accessory units (such as beta subunit) and other factors (e. g., post-translational modification such as glycosylation). [score:9]
The ventricular-restricted expression pattern of miR-1, -30b, -126, -133, and -499 starkly contrasted the reverse pattern of pluripotency -associated miRs that were differentially expressed in hESCs, and the stable expression levels of miR-188 and -296, which remained relatively unchanged across the different developmental stages examined as reflected by the small variances (Figure 1A, D). [score:8]
We also showed that GATA4 is a probable target of miR-499 but not miR-1. However, our data did not allow us to exclude the possibility that GATA4 down-regulation was merely an indirect or secondary effect. [score:7]
Figure 4A shows that LV-miR-1 transduction led to significant (p<0.05) up-regulation of the Kir2.1, Kv1.4, HERG, and DHPR transcripts and down-regulation of HCN4. [score:7]
These putative miR-1 and -499 targets agreed with our transcriptomic data and met one of two criteria: 1) The gene was expressed below a normalized log [2] value of 1.0 (∼500 signal intensity units) in all CM types assayed or 2) The gene was expressed below a normalized log [2] value of 2.0 (∼1000 signal intensity units) AND was expressed at least 2-fold lower in hE-, hF- and hA-VCMs compared with undifferentiated hESCs. [score:7]
Furthermore, miR-1 overexpression in hESC-VCMs led to the upregulation of some ionic currents. [score:6]
By contrast, I [Ks] was not expressed in hE-VCMs but was up-regulated by LV-miR-1. These results suggest that the effects of miR-1 on VCMs are context -dependent. [score:6]
Among these, GATA4 is a predicted target of miR-499 but not miR-1. Consistent with this prediction, transduction of hE-CMs by LV-miR-499, but not LV-anti-miR-499, led to a 3-fold downregulation of GATA4 (p<0.05). [score:6]
Of the remaining miRs differentially expressed in hE-VCMs, 23 continued to express highly in hF- and hA-VCMs, with miR-1, -133, and -499 displaying the largest fold differences; others such as miR-let-7a, -let-7b, -26b, -125a and -143 were non-cardiac specific. [score:5]
In adult rat ventricular myocytes, miR-1 overexpression has been shown to markedly increase I [Ca,L] [43] and suppress the α and β subunits of I [Ks] (i. e. KCNQ1 and KCNE1) [44]. [score:5]
Similar to the pro-cardiogenic role of miR-1, β-MHC also became significantly upregulated (2.5-fold; p<0.05) in EBs from stably LV-miR-499-transduced hESCs, although α-MHC was unaffected (p>0.05). [score:4]
This observation was consistent with the upregulation of NKX2.5 seen in EBs differentiated from LV-miR-1-transduced, but not LV-miR-133-transduced or WT, H7 hESCs that Srivastava and colleagues reported [8]. [score:4]
Conversely, the expression of miR-1, -499, and -133 varies greatly across developmental stages. [score:4]
Analysis of Putative Transcriptomic Effects of miR-1 and -499 Expression in CM Development and Maturation. [score:4]
Interestingly, LV-miR-499, but not -anti-499 or –miR1, upregulated MEF2C (by ∼2.5-fold, p<0.05). [score:4]
Consistently, Sluijter et al. independently identified the upregulation of miR-1 and -499 in beating cardiomyocytes differentiated from human fetal cardiac progenitors [47]. [score:4]
Interestingly, LV-miR-1-transduction of hE-CMs significantly upregulated GATA4 (by 15-fold; p<0.05). [score:4]
Consistently, after LV-miR-1 transduction, the transcripts of junctin (Jnct), triadin (Trdn) and ryanodine (RyR2) that play a role in Ca [2+] release were significantly up-regulated (p<0.05) whereas that of SERCA2a for Ca [2+] re-uptake was not affected (p>0.05; Figure 6E). [score:4]
Table S4 Summary of the numbers of the corresponding predicted targets of miR-1 or -499 in each of these select pathways. [score:3]
Next we performed target and pathway analyses of miR-1 and -499. [score:3]
Figure 4B shows that LV-miR-1-transduced hE-VCMs expressed nifedipine-sensitive (5 µM) L-type Ca [2+] channels (I [Ca, L]), a depolarizing component that underlies the Phase 2 plateau phase, with current densities, steady-state activation and inactivation properties not different from control hE-VCMs (p>0.05). [score:3]
C) Transcriptional expression of cardiac sarcomeric genes in LV-miR-1-, 133- and 499-transduced hESC-CMs. [score:3]
A) Transcriptomic analysis of predicted targets for miR-1 and -499 involved in select pathways as indicated. [score:3]
Transient transfection to overexpress miR-1 or -499 in these human progenitors reduces their proliferation by repressing histone deacetylase 4 or Sox6 although no functional properties were reported. [score:3]
A) Transcriptional expression of sarcolemmal ion channels (Kir2.1, HCN4, Kv1.4, Kv4.3, HERG, SCN5A, DHPR) in hESC-CMs after LV-miR-1 transduction. [score:3]
Similar to the reciprocal relationship described for normal and failing adult human CMs [14], we identified multiple functional groups of transcripts that were expressed at low levels (i. e. green) in the miR-1 and miR-499 abundant hE-, hF- and hA-VCMs. [score:3]
Upon cardiac differentiation of stably LV-miR-1-transduced hESCs by EB formation, however, all of α-MHC and β-MHC were significantly upregulated (2- and 3-fold increases, respectively) compared to EBs derived from control WT hESCs (p<0.05). [score:3]
By contrast, miR-1 has no effect on the percent yield of VCMs from hESC differentiation, but it uniquely facilitates electrophysiological and Ca [2+]-handling maturation by altering the expression levels of several immature related components (I [to], I [Kr], I [Kr] and I [f]) to levels closer to those of adults. [score:3]
The numbers of genes in each of these select pathways and the numbers of predicted miR-1 and -499 targets in these pathways are given in Table S4. [score:3]
Figure 7A shows the transcriptional profile heatmaps of miR-1 and -499 predicted targets identified in the selected GO/pathways as indicated. [score:3]
0027417.g004 Figure 4A) Transcriptional expression of sarcolemmal ion channels (Kir2.1, HCN4, Kv1.4, Kv4.3, HERG, SCN5A, DHPR) in hESC-CMs after LV-miR-1 transduction. [score:3]
Quantitative PCR confirmed these patterns and further showed that among all the plateau miRs identified (cardiac-specific or not), miR-1, -133, and -499 were most differentially expressed in hE-, hF- and hA-VCMs relative to hESCs after scaling the ΔCT values of each VCM type by the corresponding hESC value (with ratios of 15.0, 15.8, and 12.9, respectively versus 5.1 to 9.4 of the other seven miRs; Figure 1C). [score:3]
For instance, a 50% decrease in total miR-1 results in embryonic death attributable to ventricular septal defects and cardiac dysfunction [5]; whereas, miR-1 over -expression in adult murine ventricular (V) cardiomyocytes (CMs) promotes arrhythmogenesis by slowing conduction and depolarizing the sarcolemmal membrane via post-transcriptional repression of the Kir2.1-encoded inwardly rectifying current (I [K1]) and connexin (Cx) 43 -mediated gap junction [9]. [score:3]
Hyperpolarizing K [+] currents that are crucial for repolarization such as the transient outward current (I [to]), the slow (I [Ks]) and rapid (I [Kr]) components of the delayed rectifier, pharmacologically separated by their specific blockers 4-aminopyridine (4AP; 100 µM), Chromanol 293B (30 µM) and E4031 (10 µM), respectively, were weakly expressed or absent in control hE-VCMs but became significantly augmented after LV-miR-1 transduction (Figure 5, p<0.05). [score:3]
Indeed, miR-499 and miR-1 shared a number of overlapping targets including those that are known to play important roles in early cardiogenesis. [score:3]
Using established algorithms, we generated a list of 1448 and 1226 predicted mRNA targets for miR-1 and -499, respectively. [score:3]
However, our experiments showed that hE-VCMs already expressed I [Ca,L] at a level comparable to that in adult and I [Ca,L] remained unaltered after LV-miR-1 transduction. [score:3]
0027417.g007 Figure 7A) Transcriptomic analysis of predicted targets for miR-1 and -499 involved in select pathways as indicated. [score:3]
In mouse mo dels, several miRs have been implicated in normal cardiovascular development (e. g., miR-1, 18b, 20b, 21, 106a, 126, 133, 138, and 208) [3]– [8]. [score:2]
Target and pathway analyses of MiR-1 and -499. [score:2]
Subsequently, miR-1 regulates physiological hypertrophy and other changes in cell cycle and size, which in turn lead to a series of well-orchestrated functional changes in electrophysiological, Ca [2+]-handling and contractile properties for maturation. [score:2]
According to these analyses, miR-499 is most closely associated with the regulation of embryonic stemness, cell proliferation, cell size and apoptosis; whereas, miR-1 is implicated in control of embryonic stemness, cell cycle, hypertrophy and cell size. [score:2]
To assess any cytotoxic effect that miR-1, -133 or -499 expression might have on hE-CMs, a colorimetric MTT assay for cellular metabolisms was performed. [score:2]
To study the roles of miR-1 and -499 at a later stage of cardiac induction and chamber specification, we next transduced 20-day old cardiospheres derived by directed differentiation of WT hESCs [17]. [score:2]
Of note, however, a hyperpolarization overshoot followed by a Phase 4-like depolarization, pro-arrhythmic traits not observed in mature adult VCMs, were present in both control and LV-miR-1-transduced cells, indicating that the pro-maturation effect of miR-1 was at best partial. [score:1]
Currents and Current-Voltage Relationships in Control and miR-1 Transduced hE-VCMs. [score:1]
Figure S2 summarizes our criteria for selecting miR-1, -133 and -499 for further experiments. [score:1]
Also, LV-miR-1 but not -499 augmented the immature Ca [2+] transient amplitude and kinetics. [score:1]
LV-anti-miR-1 did not affect these AP parameters (Figure S5). [score:1]
A, C and E) Representative tracings of I [to], I [Kr] and I [Ks] recorded from WT, LV-miR-1-transduced E-VCMs as labeled. [score:1]
0027417.g005 Figure 5A, C and E) Representative tracings of I [to], I [Kr] and I [Ks] recorded from WT, LV-miR-1-transduced E-VCMs as labeled. [score:1]
By contrast, LV-miR-1 transduction did not bias the yield (p>0.05) but decreased APD and hyperpolarized RMP/MDP in hE-VCMs due to increased I [to], I [Ks] and I [Kr], and decreased I [f] (p<0.05) as signs of functional maturation. [score:1]
Calcium Handling in Control and miR-1, -133, and -499 Transduced hE-VCMs. [score:1]
0027417.g003 Figure 3A) Representative AP tracings of Control, LV-miR-1- and -miR-499-transduced hESC-derived ventricular derivatives as labeled. [score:1]
Neither LV-miR-1 nor -499 had effects on hE-derived atrial CMs when their percent distribution and AP parameters were assessed (Figure 2, Figure S4 and Table S2), suggesting that the effects observed were ventricular-specific. [score:1]
By contrast, none of miR-1, -133 and –anti-499 exerted any effect on contractile proteins (p>0.05). [score:1]
We conclude that miR-1 and -499 play differential roles in human cardiac differentiation: While miR-499 promotes ventricular specification in the context of hESC-derived cardiovascular progenitors, miR-1 serves to facilitate their electrophysiological maturation. [score:1]
In stark contrast, MESP1 was affected by none of LV-miR-1, miR-499 or –anti-miR-499 (p>0.05). [score:1]
B) Representative tracings of I [Ca,L] of control and LV-miR-1-transduced hE-VCMs as labeled. [score:1]
E) Representative tracings of I [f] recorded from control and LV-miR-1-transduced hE-VCMs. [score:1]
Figure S4 Representative AP tracings of Control, LV-miR-1- and -miR-499-transduced hE-ACMs, and bar graphs summarizing the AP parameters of the groups. [score:1]
Figure S5 Representative AP tracings of Control (n = 7) and LV-anti-miR-1-transduced (n = 8) hE-VCMs, and bar graphs summarizing the AP parameters of the groups. [score:1]
Figure S6 Representative tracings of Ca [2+] transients recorded from control (n = 6) and LV-anti-miR-1 transduced hESC-CMs (n = 12), and comparison of the amplitude, maximum upstroke velocity (V [max-upstroke], U) and maximum decay velocity (V [max-decay], D) of electrically -induced Ca [2+] transients of the two groups as indicated. [score:1]
No significant differences were observed among the control and experimental LV-miR-1-, 133- and -499-transduced groups (p>0.05; Figure S3). [score:1]
When normalized to the control group, transduction of hE-CMs by LV-miR-1, -133 and -499 led to significant 27.4±1.4-, 2.5±0.3- and 20.7±2.2-fold increase in the corresponding miRs, respectively (p<0.05). [score:1]
Ionic Basis of the effects of miR-1 on hESC-VCMs. [score:1]
Effects of miR-1 transduction on electrophysiological and molecular properties of hESC-derived CMs. [score:1]
Electrophysiological and Molecular Properties of Control and miR-1, -133, and -499 Transduced hE-VCMs. [score:1]
We conclude that miR-1 and -499 play differential roles in cardiac differentiation of hESCs in a context -dependent fashion. [score:1]
0027417.g006 Figure 6A) Representative tracings of Ca [2+] transients recorded from control, LV-miR-1-, 133- and 499-transduced hESC-CMs. [score:1]
While miR-499 promotes ventricular specification of hESCs, miR-1 serves to facilitate electrophysiological maturation. [score:1]
Figure S2 The criteria to select miR-1, -133 and -499 for further experiments. [score:1]
Although the ventricular yield was unchanged by miR-1, however, LV-miR-1 transduction of hE-CMs appeared to uniquely facilitate electrophysiological maturation: APD [50] and APD [90] decreased from 197.0±20.7 ms and 240.8±23.1 ms in control hE-VCMs to 139.7±14.2 ms and 174.7±16.6 ms (n = 17, p<0.05; Figure 3B–C) after miR-1 transduction, respectively. [score:1]
Consistent with the anticipated multi-faceted roles of miRs, miR-1 and -499 exert multiple but specific effects on a range of ion channel, Ca [2+]-handling and contractile proteins known to be important in ventricular biology. [score:1]
The effect on Ca [2+]-handling was consistent with a recent report of miR-1 enhancing excitation-contraction coupling by increasing phosphorylation of L- type and RyR2 channels [43]. [score:1]
B) The percentage distribution of ventricular, atrial and pacemaker phenotypes before and after LV-miR-1 or -miR-499 transduction. [score:1]
A) Representative AP tracings of Control, LV-miR-1- and -miR-499-transduced hESC-derived ventricular derivatives as labeled. [score:1]
Taken collectively, these results suggest that miR-1 and -499 play similar but distinct roles. [score:1]
Pie charts for B) miR-1 and C) -499 summarizing the number of genes (in parentheses) in each selected pathway or Gene Ontology (GO) classification that were found to agree with our transcriptomic data. [score:1]
LV-miR-1 (55.0% or n = 17 of 31, p>0.05), −133 (52.9% or n = 9 of 17, p>0.05) and –anti-499 (44.4% or n = 4 of 9, p>0.05) transduction also did not affect the ventricular yield. [score:1]
AP Parameters of Control and miR-1 and -499 Transduced hE-VCMs. [score:1]
A) Representative tracings of Ca [2+] transients recorded from control, LV-miR-1-, 133- and 499-transduced hESC-CMs. [score:1]
Collectively, our results indicated that miR-1 and -499 had specific and differential effects on ventricular specification and maturation. [score:1]
Specifically, our experiments demonstrate that miR-499 promotes ventricular specification while miR-1 serves to facilitate their electrophysiological maturation. [score:1]
D) Summary of the proposed sequence of biological processes that occur during human cardiogenesis and the actions of miR-1 and -499. [score:1]
The profiles of miR-1, let-7a, let-7b, miR-26b, miR-30b, miR-125a, miR-126, miR-133a, miR-143, and miR-499 in hE/F/A-VCM were confirmed by qPCR (Figure 1B). [score:1]
[1 to 20 of 87 sentences]
6
[+] score: 147
org/), has revealed, interestingly, that the miR-1 targets; FOXP1 and HDAC4 have putative target sites for miR-133a or miR-133b, whereas miR-133b target; BCL2L2 also has putative miR-1 or miR-206 target sites. [score:9]
Common targets of miR-1 or miR-206 and miR-133a or miR-133b are 538 genes, which is 21.5% of miR-1 or miR-206 targets and 30.6% of miR-133a or miR-133b targets (Additional Table 1). [score:7]
Ectopic expression of miR-1 reportedly inhibits cell growth in HCC [41], RMS [40, 52], lung cancer [43], maxillary sinus SCC [38], head and neck squamous cell carcinoma (HNSCC) [53], laryngeal SCC [54], thyroid cancer [55- 57], prostate cancer (PCa) [58], BC [59], RCC [39] and CRC [42]. [score:5]
For example, the tumor suppressive function of miR-1 is partially accounted for by its repression of the oncogenic target met proto-oncogene (MET) in lung cancer [43], HCC [41], papillary thyroid cancer [57] and RMS [52]. [score:5]
A total of 3716 genes were identified by the TargetScan program as predicted targets of miR-1, miR-133a, miR-133b and miR-206. [score:5]
Putative miR-1 or miR-206 targets exist in 2498 genes, and putative miR-133a or miR-133b targets are found in 1756 genes. [score:5]
In RMS, low expression levels of miR-206 in tumor tissues were shown to be correlated with poor prognosis for overall survival (n=159), but no difference was found in the expression levels of miR-1 [46]. [score:5]
Figure 5A total of 3716 genes were identified by the TargetScan program as predicted targets of miR-1, miR-133a, miR-133b and miR-206. [score:5]
Recently, studies from our group and others have shown that downregulation of the miR-1/miR-133a and miR-206/ miR-133b clusters are frequent events in various types of cancer. [score:4]
As mentioned above, although the sequence of each seed region is different, some targets, such as MET, TAGLN2, PNP and LASP1, are commonly regulated by the miR-1/miR-133a and/or miR-206/miR-133b clusters. [score:4]
MCL1 is also indirectly suppressed by miR-1 in lung cancer [43]. [score:4]
To identify the biological processes or pathways potentially regulated by the miR-1/miR-133a and miR-206/miR-133b clusters, we performed GENECODIS analysis [81, 82] with our predicted target list. [score:4]
Except for one report about multiple myeloma [37], studies on miR-1, miR-133a, miR-133b and miR-206 have found them all to be downregulated in many types of cancer (Table 1). [score:4]
To our knowledge, other validated oncogenic targets of miR-1 are forkhead box P1 (FOXP1) and histone deacetylase 4 (HDAC4) in lung cancer [43] and HCC [41]; LIM and SH3 protein 1 (LASP1) in BC [72]; pim-1 oncogene (PIM1) in lung cancer [43]; cyclin D2 (CCND2), chemokine (C-X-C motif) receptor 4 (CXCR4) and chemokine (C-X-C motif) ligand 12 (CXCL12) in thyroid cancer [56]; purine nucleoside phosphorylase (PNP) in maxillary sinus SCC [38] and PCa [58]; transgelin 2 (TAGLN2) in maxillary sinus SCC [38]; HNSCC [53], BC [59] RCC [39], and prothymosin alpha (PTMA) in nasopharyngeal carcinoma [60]; fibronectin 1 (FN1) in laryngeal SCC [54]; and splicing factor arginine/serine-rich 9 (SRSF9) in BC [73]. [score:3]
In vivo, a tumor suppressive function for miR-1 was shown in lung cancer and RMS in xenotransplanted mice [43, 52]. [score:3]
Workflow for the bioinformatic analysis of target genes of miR-1, miR-133a, miR-133b and miR-206. [score:3]
In lung cancer cells, miR-1 suppression might be caused by hypoacetylation of nucleosomal histones and not DNA methylation [43]. [score:3]
Several cancers, including PCa, pancreatic cancer, lung cancer, AML, RCC, CRC, BC and thyroid cancer, are among the statistically enriched categories (Additional Table 2), and it is worth mentioning that miR-1, miR-133a, miR-133b and miR-206 are differentially expressed in these types of human malignancies. [score:3]
We and other researchers have reported that the expression levels of miR-1 and miR-133a are significantly reduced in and correlated with maxillary sinus squamous cell carcinoma (SCC), renal cell carcinoma (RCC) and rhabdomyosarcoma (RMS) [38- 40]. [score:3]
Altered expression of miR-1, miR-133a, miR-133b and miR-206 in cancers. [score:3]
Low serum expression levels of miR-1 were found to be associated with poor prognosis in NSCLC [49]. [score:3]
Validated oncogene targets of miR-1, miR-133 and miR-206 in cancers. [score:3]
Aberrant expression of miR-1, miR-133a, miR-133b and miR-206 in cancers. [score:3]
miR-206 is similar to miR-1 in terms of expression and function, but its sequence differs from the miR-1 sequence by four nucleotides [26] (Figure 3). [score:3]
miR-1 overexpression has also been reported to induce apoptosis through enhanced activation of caspases 3 and 7 and cleavage of their substrate, PARP-1, in lung cancer cells [43]. [score:3]
The predicted target genes of miR-1 are the same as those of miR-206, and those of miR-133a are the same as those of miR-133b, due to the identical sequences of their seed regions. [score:3]
These targets potentially contribute to specific functional readouts of miR-1, miR-133a, miR-133b and miR-206. [score:3]
In acute myeloid leukemia (AML) cell lines, overexpression of miR-1 promotes cell proliferation, suggesting that miR-1 might act as an oncogene in hematologic malignancy [61]. [score:3]
miR-1 has been found to inhibit cancer cell migration and invasion in lung cancer [43], thyroid cancer [56], HNSCC [53], laryngeal SCC [54], BC [59], RCC [39], PCa [58], RMS [52] and CRC cells [42]. [score:3]
Our group also revealed that miR-1 overexpression induces apoptosis in maxillary sinus SCC [38], HNSCC [53], BC [59] and RCC cells [39] by fluorescence-activated cell sorting (FACS) analysis. [score:3]
The total number of genes targeted by miR-1 or miR-206 and miR-133a or miR-133b is 3716. [score:3]
As miR-1, miR-133a, miR-133b and miR-206 are mostly downregulated in cancers, gain-of-function experiments are a feasible way to evaluate the functional significance of these miRNAs in various cancers. [score:2]
This bioinformatic analysis indicates that the miR-1/miR-133a and miR-206/miR-133b clusters might supplement each other to regulate several cancer pathways, such as cell growth, cell apoptosis, cell cycle, invasion and angiogenesis (Additional Figure 1). [score:2]
Computational analysis of miR-1-, miR-133a-, miR-133b- and miR-206-regulated molecular networks. [score:2]
Conducting qPCR, western blotting, and reporter assays and using bioinformatic prediction programs, recent research has identified several targets of miR-1, miR-133a, miR-133b and miR-206 (Table 2). [score:2]
miR-1-, miR-133a-, miR-133b- and miR-206-regulated molecular networks in cancers. [score:2]
As for cell cycle distribution, miR-1 was found to induce G0/G1 arrest in lung cancer [43], HNSCC [53], RCC [39] and RMS cells [40, 52] and G2 arrest in HCC cells [41]. [score:1]
These high-throughput analyses have found miR-1, miR-133a, miR-133b and miR-206 to be altered in various types of cancers. [score:1]
DNA methylation -mediated miR-1 silencing was suggested in hepatocellular carcinoma (HCC) after treatment with 5-aza-cytidine [41], and methylation of an miR-1-1 promoter CpG island has been found frequently in primary colorectal cancer (CRC) and colorectal adenoma [42]. [score:1]
The structures of precursor miR-1-1, miR-1-2 and miR-206 as constructed by the Mfold program [92] (http://mfold. [score:1]
miR-1-1/miR-133a-2 is in an intron of the C20orf166 gene, miR-1-2/miR-133a-1 is in an intron of the MIB1 gene, and miR-206/133b is in an intergenic region (Figure 2). [score:1]
These facts suggest that miR-1/miR-133a and miR-206/miR-133b clusters might coordinately affect downstream pathways. [score:1]
miR-1 may serve as a predictor for overall survival in non-small cell lung cancer (NSCLC). [score:1]
With regard to miR-206, a homologue of miR-1, the articles of its functional role are reported in RMS, breast cancer, endometrial endometorioid carcinoma (EEC) and lung cancer. [score:1]
Gene structure of the human miR-1/133a and miR-206/133b clusters. [score:1]
In a study of gastric cancer (GC), a combination of five serum miRNAs (miR-1, miR-20a, miR-27a, miR-34 and miR-423) was a better indicator for cancer detection than conventional markers, such as CEA and CA19-9 (sensitivity of 0.8 and specificity of 0.81) [51]. [score:1]
Circulating miR-1, miR-133a, miR-133b and miR-206 as potential diagnostic markers. [score:1]
Genes of the miR-1/miR-133a and miR-206/miR-133b clusters. [score:1]
Functional significance of miR-1, miR-133a, miR-133b and miR-206 in cancers. [score:1]
Figure 3The structures of precursor miR-1-1, miR-1-2 and miR-206 as constructed by the Mfold program [92] (http://mfold. [score:1]
It is interesting to note that the commonalities and differences in miR-1 function depend on the type of malignant cells. [score:1]
Alignment of miR-1-1, miR-1-2 and miR-206. [score:1]
miR-1-1/miR-133a-2, miR-1-2/miR-133a-1, and miR-206/miR-133b form clusters in three different chromosomal regions in the human genome – 20q13.33, 18q11.2, and 6p12.2, respectively. [score:1]
[1 to 20 of 53 sentences]
7
[+] score: 133
We observed that approximately 1/10 of the recently identified 578 miRNAs are highly expressed in the mouse heart; SRF overexpression in the mouse heart resulted in altered expression of a number of miRNAs, including the down-regulation of mir-1 and mir-133a, and up-regulation of mir-21, which are usually dysregulated in cardiac hypertrophy and congestive heart failure [3, 13- 16]. [score:14]
In conclusion, our current study demonstrates that cardiac-specific overexpression of SRF leads to altered expression of cardiac miRNAs, especially the down-regulation of miR-1 and miR-133a, and up-regulation of miR-21, the dysregulation of which is known to contribute to cardiac hypertrophy. [score:12]
The pri-mir-1-1 is expressed at 6-fold higher than pri-mir-1-2. Therefore, the contribution of pri-mir-1-1 to the mature miR-1 pool may be greater than that of pri-mir-1-2. Given the fact that targeted mutation of mir-1-2 gene resulted in embryonic myocardial dysfunction and half of the mutant mice suffered early death due to ventricular septal defect (VSD) [4], one might speculate that a targeted mutation of mir-1-1 gene would also cause equally (or more) severe consequences. [score:9]
Real-time RT-PCR analysis revealed that mildly reduced SRF resulted in the down-regulation of miR-21 expression, but up-regulation of both miR-1 and miR-133a (Figure 5A). [score:9]
As shown in Figure 6, when pri-mir-1-1 and pri-mir-1-2 transcripts were down-regulated, so was miR-1 mature form; when pri-mir-133a1 and pri-mir-133a2 transcripts were down-regulated, the same was true for miR-133a mature form. [score:7]
Our findings demonstrate for the first time that it is possible to regulate at the same time the expression of three miRNAs, miR-1, miR-133a and miR-21, through targeting the components of SRF -mediated signaling pathway. [score:6]
The up-regulation of miR-21, and the down-regulation of miR-1 and miR-133a were observed in SRF-Tg compared to wild-type (WT) mouse heart (P < 0.01**, n = 3). [score:6]
Reducing cardiac SRF level using the antisense-SRF transgenic approach led to the expression of miR-1, miR-133a and miR-21 in the opposite direction to that of SRF overexpression. [score:6]
Interestingly, the down-regulation of miR-21, but up-regulation of miR-1 and mir-133a were observed in Anti-SRF-Tg compared to wild-type mouse heart (p < 0.01**, n = 3). [score:6]
When the mouse cardiac SRF level was reduced using the antisense-SRF transgenic approach, we observed an increase in expression of miR-1 and miR-133a miRNA, and a decrease in expression of miR-21. [score:5]
The miR-1 was ranked number one in the level of expression among all the microRNAs detected, and it alone accounted for 7% of all the microRNA expression signals, and 9% of the 50 cardiac-enriched microRNA signals. [score:5]
miR-1 ranks number 1 in expression, miR-133a ranks number 7 in expression. [score:5]
The down-regulation of miR-1 correlates closely with that of miR-133a in SRF-Tg at various time points from 7 days to 6 months of age (p < 0.05, n = 3 for all time points, except n = 6 for miR-21 at 6 months). [score:4]
Mir-1 and mir-133a are down-regulated in cardiac hypertrophy and cardiac failure, suggesting that they may play a role in the underlying pathogenesis [14, 43]. [score:4]
SRF is known to regulate mir-1, which regulates certain critical cardiac regulatory proteins that control the balance between differentiation and proliferation during cardiogenesis [4]. [score:4]
These findings suggest that SRF may regulate these two miRNAs at the level of polycistronic transcription, rather than at each individual miRNA (pri-mir-1 or pri-mir-133a) transcription, thereby keeping the expression of both miRNAs closely correlated. [score:4]
Our data revealed that the down-regulation of miR-1 correlates closely with that of miR-133a in the SRF-Tg at various time points from 7 days to 6 months of age (Figure 7B). [score:4]
The expression levels of miR-1, miR-133a and miR-21 were observed to be in the opposite direction with reduced cardiac SRF level in the Anti-SRF-Tg mouse. [score:4]
The miR-1 is the most abundant miRNA that is expressed in the heart. [score:3]
Since mir-1-1 and mir-1-2 genes are located on two different chromosomes, their expression is divergent. [score:3]
In addition, serum response factor (SRF), an important transcription factor, participates in the regulation of several cardiac enriched miRNAs, including mir-1 and mir-133a [4, 6]. [score:2]
Generally, the pri-miRNA transcript contains one miRNA (e. g pri-mir-21), but it can also contain more than one miRNAs (e. g. mir-1 and mir-133a). [score:1]
pri-mir-1-2 forward: 5'-accacaagcagaagtggcatt-3', pri-mir-1-2 reverse: 5'-tggaagtcatcctcctggaaa-3'. [score:1]
As shown in Figure 2D, pri-mir-1-1 level was 6-fold higher than that of pri-mir-1-2 (n = 3, p < 0.05). [score:1]
The mouse pri-mir-1-1 and pri-mir-133a-2 are transcribed into a polycistronic transcript that is 10 kb in length, and the pri-mir-1-2 and pri-mir-133a-1 are transcribed into another polycistronic transcript that is 6 kb in length [42]. [score:1]
The length of three representative primary transcripts: pri-mir-21 is over 3 kb, "pri-mir-1-1 and pri-mir-133a2" is 10 kb, and "pri-mir-1-2 and pri-mir-133a1" is 6 kb. [score:1]
Both miR-1 and miR-133a are produced from the same polycistronic transcripts, which are encoded by two separate genes in the mouse and the human genomes [42]. [score:1]
Both pri-mir-1-1 and pri-mir-1-2 are processed into mature miR-1, but pri-mir-1-1 transcript level is 6-fold higher than that of pri-mir-1-2 (n = 3, p < 0.05*). [score:1]
Our present study revealed that miR-1 accounted for 7% of all the 578 miRNAs detected by the microarray. [score:1]
For examples, the mature miR-1 is processed from pri-mir-1-1 and pri-mir-1-2 transcripts that are transcribed from two genes, mir-1-1 (on chromosome 2) and mir-1-2 (on chromosome 18), respectively. [score:1]
Two CArG-like elements have been found in the promoter of mir-1-1 and mir-1-2 genes [4]. [score:1]
It is plausible that increasing mir-1 and mir-133a level at a specific time point may have potentially beneficial effects against the pathological conditions. [score:1]
[1 to 20 of 32 sentences]
8
[+] score: 128
Upstream inhibitors like miR-1 besides downstream inhibitors like miR-25 thus show interesting properties for anti-cancer treatments in Wnt -dependent cancers and further support current findings that upstream components of the Wnt pathway are also valid and rational targets for cancer-therapies, even in cells with downstream mutations [15], [54], [55]. [score:8]
Lentiviral expression of miR-1 inhibits expression of the Wnt reporter, axin2/Conductin-LacZ in primary mouse mammary epithelial organoid cultures. [score:7]
As shown in Fig. 5, while pLV control vector (as followed by DsRED expression) did not influence the expression of β-gal reporter (green) (Fig. 5A-A″″), expression of miR-1 within the organoids strongly repressed reporter activity (Fig. 5B-B″″) (see quantification in Fig. 5C). [score:7]
0026257.g005 Figure 5Lentiviral expression of miR-1 inhibits expression of the Wnt reporter, axin2/Conductin-LacZ in primary mouse mammary epithelial organoid cultures. [score:7]
Epistasis experiments revealed that miR-1 and miR-613 target the pathway upstream of Axin or active β-catenin, and that miR-25 acts downstream, at the level of β-cat, likely by targeting β-cat's coding sequence. [score:5]
Hsa-miR-1 expressing cells displayed markedly reduced viability at day 4. While control-virus infected HT29 cells exhibited normal proliferation and colony-formation efficiency at day 7, Pre-miR-1 expressing HT29 cells did not show any obvious signs of proliferation (Fig. 4A–C). [score:5]
Importantly, overexpression of miR-25 and miR-1 inhibited proliferation/viability of human colon cancer cells that are known to be dependent on sustained β-cat signaling for their survival [22], [24]. [score:5]
miR-1 inhibits expression of a Wnt-responsive reporter (conductin-lacZ) in primary mammary organoids. [score:5]
Furthermore, expression of miR-1 in primary mammary epithelial organoids derived from a Wnt-reporter mouse (conductin-lacZ) significantly reduced the expression of the β-gal reporter. [score:5]
These data strongly suggest that ectopic expression of miR-1 may be sufficient in inhibiting the Wnt-responsive reporter in an in vivo context. [score:5]
Finally, the very strong anti-proliferative effect of hsa-miR-1 in Wnt/β-catenin dependent human cancer cells (HT29) but not in HEK293 cells, combined with its strong inhibitory effect on an in vivo Wnt-reporter in primary mammary epithelial organoids (Fig. 5), and its lack of known oncogenic properties, highlight its potential as a novel miRNA -based candidate for the development of anti-cancer therapies. [score:4]
Elevated reporter activity by simultaneous siRNA mediated knockdown of Axin1 and Axin2 could be strongly inhibited by transfection of Pre-miR-25 (P<0.05; unpaired t-test), while miR-1 and miR-613 showed no significant influences (P>0.05). [score:4]
The organoids transduced with control lentiviral vector (A″) shows significantly higher expression of Axin2-β-gal compared to organoids expressing miR-1 (B″). [score:4]
That said, it is important to note that cMET has been previously suggested to be a direct target of miR-1 [49], [50], [51]. [score:4]
Hsa-miR-1 and -613 seem to be not closely/directly related but share identical seed sequences and act upstream of Axin and probably downstream of GSK3 (as judged by their inhibitory effect on LiCl mediated activation of the reporter). [score:4]
Secondary validation and functional testing of 3 candidate miRs, namely miR-1, miR-25 and miR-613 confirmed their inhibitory effect on the activity of the Wnt pathway. [score:3]
Control and miR-1 expression vectors (pLV-miR-1 from Biosettia Inc. [score:3]
Taken together, these data suggest that miR-25 represses the Wnt pathway downstream of GSK3β, Axin1/2 and stabilized β-catenin, while miR-1 and miR-613 act upstream of Axin1/2 and stabilized β-catenin but probably downstream of LiCl -mediated inhibition of GSK3β. [score:3]
0026257.g004 Figure 4 (A) HT29 colon cancer cells expressing pLV-Hsa-Pre-miR-1 or control vectors at day 4 of puromycin selection. [score:3]
We introduced a miR-1 expression construct into mammary epithelial organoids derived from the conductin-lacZ in vivo reporter mouse using lentiviral transduction (pLV-miR-1 from Biosettia Inc. [score:3]
While miR-1 and miR-613 could slightly reduce Wnt3a-CM mediated induction of β-catenin protein levels in HEK293 cells, miR-25 and miR-613 expression resulted in a moderate (∼20%) reduction in LiCl induced total β-catenin protein level, (Fig. 3B). [score:3]
To understand at which step these miRs (miR-1,-25,-613) modulate the linear cascade of the Wnt pathway, and to identify their potential target genes, a series of epistasis experiments were conducted in HEK293 cells using the Wnt reporter and different pathway activators (Fig. 3 A, B). [score:3]
HT29 cells stably expressing intronic miR-1 in the 5′-UTR of rPURO, a red fluorescent puromycin-N-acetyl-transferase, were generated. [score:3]
, USA) and investigated whether expression of miR-1 could influence the expression of the β-gal reporter compared to pLV-empty vector control. [score:2]
Moreover, alignment of miRs that could regulate the Wnt reporter made intra- and inter -family related functional consensus sequences apparent (i. e. the seed of miR-1 and miR-613 or within the miR-302 and -515 families (Fig. S8)). [score:2]
In vivo context analysis of the regulation of axin2/Conductin-lacZ reporter by miR-1. Results. [score:2]
MiR-613 showed the strongest inhibition in the primary validation assay (Fig. S1) and shares the same seed sequence as the miR-1/206 superfamily (5′-GGAAUGU-3′) but shows no additional overall conservation (Fig., S4). [score:2]
0026257.g003 Figure 3 (A) Epistasis experiments with synthetic human Pre-miR-1, Pre-miR-25 and Pre-miR-613. [score:1]
Secondary validation of miR-1, miR-25 and miR-613. [score:1]
HEK293 cells that stably express hsa-miR-1, while showed an initial reduction in cell proliferation at day 4 of selection compared to control, did not display any major proliferation defect by day 7. These results may suggest that the compromised viability in HT29 cells, as compared to HEK293 cells, can be due to a specific Wnt-dependence of HT29 colon cancer cells for their survival (Fig. 4D). [score:1]
Characterization of miR-1 overexpression in HT29 and HEK293 cells. [score:1]
Renilla gene activity with an inserted β-catenin CDS in the 3′UTR indicated a significant miR-25 -dependent reduction while control siRNAs, miR-1 or miR-613 had no effect (Fig. 3E). [score:1]
We also investigated the potential function of the candidate Wnt -inhibitor miR-1 in the Wnt -dependent HT29 cancer cell line, because miR-1 was identified as one of the strongest repressors of Wnt-3a -induced activation of the STF reporter (Fig. 4). [score:1]
Pre-mir-1 may function most upstream, followed by miR-613 and then miR-25, which seems to influence the most downstream activity at the level of β-catenin. [score:1]
In fact in most cases, miR-1 transduced organoid colonies exhibited almost no immuno-reactivity towards β-gal under identical exposure conditions. [score:1]
This could indicate that some miRs or miR-families may repress the Wnt pathway components/activity mainly with the seed sequence (miR-1/613 -family), while others may require the coordinated action of the seed and co-seed (miR-25/92 -family). [score:1]
Phylogenetic analysis support the miR-base classification that miR-1 belongs to the miR-1/206 family including hsa-miR-206 and the Drosophila dme-miR-1, an indication of the high evolutionary conservation of this family (shown in Supplementary, Fig. S2A by alignments and phylogenetic quartette puzzling trees); hsa-miR-25 belongs to the evolutionary conserved miR-25/92 family [39] including Drosophila miR-92a+b/310/311/312/313, shown in Fig. S2B, and shares only the seed sequence with other miRs like miR-4325 or miR-367. [score:1]
Lenti-pLV-miR-1 and -pLV-control transduced cells were selected with puromycin for up to 7 days. [score:1]
pLV-miR-1 and pLV-miR-control lentivirus were obtained from Biosettia (San Diego, USA). [score:1]
3 out of 38 candidate miRs (miR-1, miR-25, miR-613) were further characterized in Wnt-responsive cultured cells and all were validated for their Wnt -inhibitory properties identified in the initial screen. [score:1]
Figure S4 Screening results and alignment of studied miRs (miR-1/206 and miR-25/92 family) and miRs with a similar seed sequence. [score:1]
50–100-fold) could only be reduced by miR-1 and miR-613 that can block a more upstream part of the pathway and are thus more efficient (Fig. 3D). [score:1]
Hsa-Pre-mir-1 had a lesser ability to reduce total β-catenin protein levels under conditions of high pathway activation with LiCl. [score:1]
HPLC grade human synthetic Pre-miR™ precursor miRNAs that are strand-selection optimized/approved and chemically modified siRNA-like precursor miRs (Pre-miR-1™ #AM17100; Pre-miR-25™ #AM17100; Pre-miR-613™ #AM17100) were purchased from Ambion. [score:1]
[1 to 20 of 44 sentences]
9
[+] score: 121
Other miRNAs from this paper: hsa-mir-122, hsa-mir-1-1
miR-122 and miR-1 downregulate G6PD expression in liver cancer cells individually and in combination. [score:6]
It is noteworthy that both miR-1 and miR-122 comparably suppressed luciferase activity and G6PD levels indicating both can target G6PD equally well (Fig.   4, Supplement Fig.   3). [score:5]
To address whether both could contribute equally to the upregulation of G6PD expression in liver cancer, we compared miR-1 and miR-122 levels in the context of G6PD mRNA levels using density distribution plots (Fig.   4). [score:5]
Figure 6G6PD expression and activity are suppressed by miR-122 and miR-1 in HepG2 cells. [score:5]
Previous studies have shown that miR-1 levels are reduced in several malignancies, and it directly regulates G6PD expression by binding to the G6PD 3′-UTR at a single site 33, 34. [score:5]
Since G6PD activity is essential for cell proliferation, we speculated ectopic miR-1 and miR-122 expression would inhibit HepG2 cell proliferation. [score:5]
In healthy liver however, miR-122 is the most abundant miRNA, and its downregulation is much more pronounced than miR-1 in liver cancer (Supplement Fig.   2). [score:4]
Nasser MW Down-regulation of micro -RNA-1 (miR-1) in lung cancer. [score:4]
Interestingly, G6PD was validated as a miR-1 target 33, 34, indicating that complex networks of miRNA interactions may regulate G6PD. [score:4]
gov/), its mRNA levels increase in conjunction with rise tumor grade, and its levels also negatively correlate with the expression of miR-122 and miR-1, a previously reported regulator of G6PD 33, 34. [score:4]
Notably, the suppression of G6PD activity in miR-1 and miR-122 mimic co -transfected cells was comparable to G6PD knocked down cells. [score:4]
To the best of our knowledge, these data demonstrate for the first time that miR-122 regulates G6PD levels in HCC cells, and that loss of expression of miR-1 and miR-122 in primary HCCs may contribute to the increased G6PD activity thereby promoting tumor growth. [score:4]
Exogenous miR-122 and miR-1 mimics resulted in reduced G6PD expression and activity in transfected HCC cells. [score:3]
miR-1 and miR-122 inhibit G6PD activity and cell survival in HepG2 cells. [score:3]
No such relationship was identified for miR-1. Nevertheless, our results showed that miR-1 and miR-122 are both capable of suppressing G6PD luciferase reporter activity independently or in combination (Fig.   5a). [score:3]
Next we sought to determine whether modulation of G6PD expression by miR-1 or miR-122 is reflected in its enzyme activity. [score:3]
Collectively, these data implicate anti-tumorigenic efficacy of miR-1 and miR-122 at least, in part, mediated through targeting G6PD, associated with poor patient prognosis (Fig.   1). [score:3]
We were one of the first to report that miR-1 is suppressed in the lung [46] and hepatocellular cancer [47], and its therapeutic potential in these malignancies. [score:3]
Interestingly, miR-1, miR-122 combination seemed to have an additive effect on luciferase activity suppression. [score:3]
Cells were then transfected with 40 nM each of scrambled miRNA mimic control (NC -mimic), miR-1 mimic, miR-122 mimic or their combination (20 nM of each), non -targeting siRNA control (70 nM), or siG6PD (70 nM) using RNAiMAX following the manufacturer’s protocol (Thermo Fischer Scientific, Waltham, MA). [score:3]
Importantly, this activity was reduced in HepG2 cells transfected with miR-1 or miR-122 mimic, which was more pronounced in cells expressing both miRNAs (Fig.   6a). [score:3]
psiCHECK2 vectors (50 ng) harboring miR-122 target 3′-UTRs were co -transfected with either miR-122, miR-1, or scrambled (NC) RNA mimics (50 nM) using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA) into H293-T cells. [score:3]
As reported earlier 33, 34, we also found that miR-1 targets G6PD by interacting with a cognate site in its 3′-UTR (Supplement Fig.   3c,d). [score:3]
Indeed, growth of these cells were suppressed upon transfecting miR-1, miR-122 and their combination relative to the scrambled miRNA (Fig.   6d). [score:3]
In contrast, the correlation of G6PD and miR-1 expression was less pronounced (Fig.   2c) (R-squared = 0.01891, P-value = 0.003279, regression coefficient = −0.1249872). [score:3]
Inverse expression of miR-1 and G6PD in patient tissues further supports its contribution to the overall elevated G6PD levels in HCC. [score:3]
Both miR-1 and miR-122 were found to be suppressed in tumor when compared benign liver tissues (Supplement Fig.   2). [score:2]
Interestingly, levels of miR-1 and miR-122 negatively correlate with each other (overall p-value = 1.22 × 10 [−7], coefficient = −0.212) in human liver cancer (Fig.   4), indicating a possible reciprocal regulation. [score:2]
While the role of miR-122 depletion in HCC is much more significant due to its abundance in benign liver and its dramatic decrease in HCC, a combined reduction of both miR-122 and miR-1 are likely to contribute to the deregulation of glucose metabolism in HCC, resulting in rapid tumor progression. [score:2]
Notably, miR-1 and miR-122 together exhibited slightly more suppression in G6PD protein levels compared to its mRNA levels. [score:2]
These data also show a negative correlation between miR-1 and miR-122 indicating their reciprocal regulation. [score:2]
Scatterplot and linear regression of miR-122 and miR-1 levels in liver cancer patients. [score:1]
However, our data show for the first time that levels of miR-122 are almost 10,000 fold higher than miR-1 levels in benign liver tissues in HCC patients (Supplement Fig.   2). [score:1]
HepG2 cells transfected with scrambled miRNA (NC), miR-1, miR-122, combo (miR-1 and miR-122), G6PD siRNA (siG6PD) or negative control siRNA (NC) for 48 hours. [score:1]
These data tend to support the possibility that miR-1 and miR-122 in combination could be more effective anti-HCC therapy. [score:1]
Briefly, HepG2 cells were transfected using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA) with either miR-1 (40 nM), miR-122 (40 nM), or combo (20 nM of each). [score:1]
Density plots were used to visualize the distribution of miR-1 (top panel) and miR-122 (right panel) levels in the context of G6PD mRNA levels. [score:1]
Previous studies have shown a notable relationship between miR-1 and G6PD 33, 34. [score:1]
Furthermore, G6PD mRNA levels were more closely associated with miR-122 than with miR-1 (Fig.   4). [score:1]
The density plots of miR-1 and miR-122 showed that higher levels of G6PD were associated with lower levels of miR-122. [score:1]
Wild-type and mutated G6PD 3′-UTR harboring miR-122 and miR-1 binding sites was cloned into the 3′-UTR of Renilla Luciferase cDNA in psiCHECK2 (Promega, Madison, WI) dual luciferase reporter. [score:1]
Other similar studies have reported that level of the muscle specific miR-1 in the liver is relatively low [45]. [score:1]
This relationship was further corroborated by the decrease in G6PD activity after miR-1 and miR-122 co-transfection in HepG2 cells (Fig.   6). [score:1]
H293-T cells were transfected with control RNA (NC), miR-122, miR-1, or combination of both, along with psi-CHECK2 vector harboring human G6PD 3′-UTR and Firefly luciferase (an internal control). [score:1]
This is also reflected at the G6PD protein and RNA levels in liver cancer cells transfected with miR-1 or miR-122 mimics (Fig.   5b,c). [score:1]
[1 to 20 of 45 sentences]
10
[+] score: 121
Other miRNAs from this paper: hsa-mir-21, hsa-mir-141, hsa-mir-143, hsa-mir-1-1
Thus, we posit that miR-1 expression is predominantly stromal, and that its expression may be suppressed in the tumor microenvironment. [score:7]
In summary, we have demonstrated for the first time predominant stromal expression of miR-1 and miR-143 in prostate tissue, predominant epithelial expression of miR-141, and both stromal and epithelial expression of miR-21. [score:7]
These results show a generally tissue-restricted expression pattern for miR-1 and miR-141, and a broader and higher level expression pattern for miR-143 and miR-21, across multiple tissue types. [score:5]
These data indicate a predominantly stromal expression pattern for miR-1 and miR-143, and a predominantly epithelial expression pattern for miR-141. [score:5]
The levels of miR-1 and miR-143 are commonly diminished in PCa, and ectopic expression of either miR-1 or miR-143 inhibits the growth and survival of PCa cells 9– 13. [score:5]
Interestingly, miR-1 levels were nearly associated with disease recurrence in multivariate analyses (p = 0.055), suggesting that stromal miRNA expression may be informative for PCa prognoses. [score:5]
However, our results found miR-1 expression to be predominantly stromal in microdissected tissues. [score:3]
Distinctly, miR-1 expression was extremely low or absent (0–1 RPM) from fat and fibroblast samples. [score:3]
The most significant miR-1 levels appear to be in human muscle, which is consistent with early studies of miR-1 expression and function in mice 32, 33. [score:3]
In summary, these data suggest that miR-1 may not be a cell-autonomous tumor suppressor in PCa. [score:3]
Figure 3Cell and tissue type specific expression of miR-1, miR-143, miR-141, and miR-21. [score:3]
Compartmentalized expression of miR-1, miR-141, and miR-143 in normal human prostate. [score:3]
Alternatively, different cell types with altered miR-1 expression may populate the tumor microenvironment. [score:3]
These results suggest that loss of miR-1 and gain of miR-21 expression are highly associated with PCa aggressiveness and Gleason Score. [score:3]
Figure 2Compartmentalized expression of miR-1, miR-141, and miR-143 in normal human prostate tissue. [score:3]
Strikingly, the expression of miR-1 and miR-143 were found to be almost exclusively stromal, with very few copies detected in the epithelium. [score:3]
Indeed, miR-1 expression was extremely low, or absent, in fibroblast and fat samples from the SRA. [score:3]
Four miRNAs have been frequently reported to have aberrant expression in PCa: miR-1, miR-21, miR-141, and miR-143. [score:3]
Interestingly, miR-1 expression was found in tissues microdissected by xMD, and not by LCM. [score:3]
The expression of miR-21 (hsa-miR-21-5p) and miR-141 (hsa-miR-141-3p) are frequently reported to be elevated in human PCa, while the levels of miR-1 (hsa-miR-1-p3) and miR-143 (hsa-miR-143-3p) are frequently found to be decreased [8]. [score:3]
Reduced miR-1 was also closely related to disease recurrence in multivariate analyses, but without significance (Table  1B, p = 0.055). [score:3]
Expression of miR-1, miR-21, miR-141, and miR-143 in normal human cells and tissues. [score:3]
miR-1 has also been termed a tumor suppressor in prostate and other cancers 28– 31. [score:3]
We found a strong positive correlation between miR-1 expression and stromal MYH11 (Fig.   6C), with a Pearson’s r value of 0.43 (p < 2.2 × 10 [−16]). [score:3]
In contrast to miR-1 and miR-143, miR-141 expression was predominantly epithelial in human tissues and cell cultures. [score:3]
Altered stromal miR-1 expression may affect tumor associated stromal cell phenotype, neighboring tumor cell phenotype, or the tumor microenvironment. [score:3]
This result was supported by a clear association of miR-1 with stromal gene markers in the TCGA, and with little to no expression detected in epithelial cell lines. [score:3]
N1), and the dichotomized expression (using optimal thresholds) of miR-1, miR-141, and miR-21 were significantly associated with biochemical recurrence (Table  1A). [score:3]
Thus, miR-1 and miR-143 have been considered cell-autonomous tumor suppressors of PCa. [score:2]
An average of 395 copies of miR-1 were detected in prostate stroma, while less than 10 copies could be detected in epithelium (Fig.   2C). [score:1]
The RT-ddPCR results show that these JHU samples have similar trends of elevated miR-21 and miR-141 in PCa, and reduced miR-1 and miR-143 (Fig.   1B). [score:1]
Like miR-143, the levels of miR-1 were selectively decreased in the tumor -associated stroma of microdissected tissues. [score:1]
Remarkably, we were not able to detect miR-1 in any of these cell extracts. [score:1]
Reduced miR-1 and elevated miR-21 are associated with biochemical recurrence. [score:1]
TaqMan MicroRNA RT (Applied Biosystems, Life Technologies) was used to generate cDNA for hsa-miR-21-5p, hsa-miR-143-3p, hsa-miR-141-5p, hsa-miR-1-5p, cel-miR-39, and RNU6B from 10 ng of RNA. [score:1]
The levels of miR-1 were low (average <10 [3] RPM) in most tissues, with the highest levels found in skeletal muscle and heart (Fig.   3A). [score:1]
Surprisingly, miR-1 could not be detected in the stroma or epithelium of these samples (Fig.   2D). [score:1]
Significant differences could only be found for miR-1 and miR-143 in tumor -associated stroma in this small sample set. [score:1]
Figure 4Reduced miR-1 and miR-143 levels in PCa -associated tumor stroma. [score:1]
The specific and significant loss of miR-1 and miR-143 in tumor -associated stroma indicates a potential role for these miRNAs in the tumor microenvironment. [score:1]
However, only miR-1 and miR-21 showed an association with biochemical recurrence as continuous variables, and only miR-21 showed an association on top of and beyond Gleason grade and stage in multivariate analysis. [score:1]
miR-21 and miR-141 levels are elevated in human PCa, and miR-1 and miR-143 levels are reduced. [score:1]
miR-1 was detectable at low copy number (7–29 copies) in these six stromal cultures (Fig.   5C). [score:1]
Levels of miR-1 and miR-143 are significantly reduced in tumor -associated stroma. [score:1]
Only miR-1 and miR-21 showed an association with biochemical recurrence as continuous variables. [score:1]
Low miR-1 copy numbers could also be detected in these LNCaP (32 copies) and HFF (4 copies) cell extracts. [score:1]
The levels of miR-1 were not significantly different between benign and malignant tissue in this dataset. [score:1]
However, the levels of miR-1 were not significantly different between normal and cancerous epithelium. [score:1]
[1 to 20 of 48 sentences]
11
[+] score: 98
In our findings, the downregulation of miRs-133a and b started at 24 h and peaked at 2–3 days post the surgery, whereas miR-1 peaked already at 24 h. Thus, we suggest that the early expression of is necessary to contrast the caspase protein translation in all injured hearts (due to miR-133 downregulation). [score:11]
The immunohistochemistry has been focused on three markers linked with the investigated miRs: (1), as a marker of recovery activities as well as the block of apoptosis and controlled by miRs expression; (2) Wilms tumour 1 (WT1), as a specific marker for development/regeneration activity of the epicardium 26, 27 and in the epithelial–mesenchymal transition (EMT) [28]; (3) or component of cardiac troponin T, as a marker of differentiated myocardial cells because its expression is essential for sarcomere assembly and directly mediated by miR-1 upregulation [29]. [score:8]
a Expression of miR-1; b expression of miR-133a; c expression of miR-133b. [score:7]
In fact, the expression of miRNA-1, 133a and 133b during regenerative phenomenon showed a downregulation around the first 48 h post the surgery, suggesting that the transition from epicardial and other tissue has already started. [score:6]
miR-1 is not expressed by ERK1,2 activity because of the expression of cardiac embryonal genes and relative proteins such as GATA4. [score:5]
Most of these genes were demonstrated to be, directly or indirectly, a target of miR-1 and miR-133a and miR-133b (ref. [score:5]
When the genes of differentiation are expressed, such as MyoD, miR-1 start to be highly transcripted and act as a repressor of GATA4 translation and other embryonic key proteins. [score:5]
Although different patterns of miR expression are found by transcriptome analyses during regeneration, miR-1 and miRs-133a/b seem to be commonly expressed in mammals as well as in zebrafish [53]. [score:5]
In the rationale, we have suspected that during regeneration, the downregulation of miRs-133a, 133b and miR-1 could occur before 7 days after the resection and that could be differently regulated by the cell-type (i. e., epicardium and CM). [score:5]
However, miR-1 is a direct repressor of and its upregulation was demonstrated during the regeneration of zebrafish heart [5]. [score:5]
In particular, miR-1 and miR-133b have undergone a significant downregulation at 1 dpa. [score:4]
The translation of vegf and raldh2 are directly repressed by miR-1 (refs. [score:4]
Particularly, miR-1, miR-133a and miR-133b have been detected in 1 dpa in different data sets of down-regulated transcripts. [score:4]
In the myocardium formation, Tbx can activate the transcription factors and morphogens such as MyoD (maintained by miR-1 expression) and Myf5 [50]. [score:3]
From 7 dpa, the miR-1 expression has been slowly returned to the control values (data not shown). [score:3]
Xu C The muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, and caspase-9 in cardiomyocytesJ. [score:3]
Hearts were harvested from 24 h to 30 dpa, and analysed for miRs (miR-1 and miR-133a/miR-133b) by qPCR to know how their expression levels vary at different stages of regeneration. [score:3]
Regarding miR-133a (Fig.   1b), the qPCR data show that at 24 hpa there is a decrease (but not statistically significant, 0.707 ± 0.065), while the values of expression on days 2, 3 and 7 are similar to those of the miR-1 (0.519 ± 0.079, 0.255 ± 0.016, 0.560 ± 0.145, respectively) (Fig.   2). [score:3]
The results indicated that miR-1 has been strongly downregulated in the RC already at 24 hpa (0.060 ± 0.021, P < 0.001) as compared to control and EPCs. [score:3]
miR-1 is the most conserved miRNA during evolution [16], whereas a gene duplication probably has formed the miR-133 gene, which in fact is positioned in the same genetic locus of the miR-1 [31] and, in mammals, it regulates transcription of myoD [19]. [score:2]
Fig. 7 A proposed schematic mo del of miR-1 and miR-133 actions in blocking the FGF -dependent transduction pathway in the cells involved in cardiac regeneration: CMs, fibroblast, EPCs and endocardial cells. [score:1]
It is probable that the block of myogenic or hyperplastic role of miR-1 is crucial in activating the regeneration process. [score:1]
miR-1 at 1 dpa has evidenced a value of 0.566 ± 0.008 and 0.526 ± 0.004 on the second day. [score:1]
miR-1/miR-133 are mainly implicated in post lesion in mammals as well as in zebrafish 14, 17, 22, 23. [score:1]
[1 to 20 of 24 sentences]
12
[+] score: 93
miR-1 was shown to bind to the 3'UTR of the histone deacetylase 4 (HDAC4), an inhibitor of muscle differentiation, and suppresses its expression during growth and differentiation conditions [10, 21, 22]. [score:7]
Connexin 43 (Cx43), a gap junction channel required in embryonic skeletal muscle, which is also down-regulated during late embryogenesis and early post-natal life was found to be an experimentally verified target of miR-206 and miR-1 during myogenesis [15]. [score:6]
Cell culture experiments have shown that miR-1 and miR-206 promote muscle cell differentiation, whereas miR-133 promotes cell proliferation by down-regulation of different target genes [10, 11]. [score:6]
miR-1 and miR-133 are highly expressed both in skeletal and cardiac muscles, whereas miR-206 is specifically expressed only in skeletal muscle [10, 11]. [score:5]
Although miR-1, miR-133a, miR-133b and miR-206 genes have similar expression patterns, they have different targets and biological functions [4, 10]. [score:5]
Although miR-1, miR-133 and miR-206 are related in terms of expression, they have different targets, biological functions and transcriptional activation [4, 10, 14- 17]. [score:5]
Restoration of decreased MyoD levels promotes muscle cell differentiation in vitro and increases miR-1, miR-133a, miR-133b and miR-206 gene expression in human foetal myoblastsForced expression of MyoD in non-muscle cells in culture can induce myogenic differentiation, whereas MyoD -null primary myoblasts exhibited reduced differentiation [26, 27]. [score:5]
These data are consistent with previous findings that miR-1 and miR-133 are expressed in very small amounts in the developing heart and skeletal muscle of embryonic day 13.5 (E13.5) and E16.5 in mice and their expression increases in neonatal heart and skeletal muscle [10]. [score:5]
Although miR-1, miR-133a, miR-133b and miR-206 have been extensively studied, there is no information about their expression during the development of human skeletal muscle. [score:4]
miR-1, miR-133a, miR-133b and miR-206 are expressed in muscle tissue and induced during muscle cell differentiation, a process that directs myoblasts to differentiate into mature myotubes, which are organized into myofibers. [score:4]
There is currently no existing evidence about the expression of miR-1, miR-133a, miR-133b and miR-206 genes during the stages of human muscle development. [score:4]
Experiments on adult mouse C2C12 and mouse embryonic fibroblasts showed that MyoD binds to regions upstream of miR-1, miR-133a and miR-206 and regulates their expression [12, 14]. [score:4]
Western blot analysis showed increased levels of HDAC4 (A), a verified target of miR-1, and Connexin 43 (B), a verified target of miR-206 and miR-1 in foetal muscle cells, compared to newborn cells. [score:4]
Although miR-1, miR-133a, miR-133b and miR-206 are well-studied in muscle, there is no information about their expression and function during human development. [score:4]
miR-1, miR-133a, miR-133b and miR-206 were found to be expressed during muscle cell differentiation both in adult primary human myoblasts and adult mouse cell lines [10- 12]. [score:3]
Restoration of decreased MyoD levels promotes muscle cell differentiation in vitro and increases miR-1, miR-133a, miR-133b and miR-206 gene expression in human foetal myoblasts. [score:3]
miR-1, miR-133a, miR-133b and miR-206 levels were low in undifferentiated myoblasts, signifying that they are not highly expressed during the stages before differentiation (Figure 2). [score:3]
Ectopic MyoD expression caused an induction of muscle cell differentiation in vitro, accompanied by an increase in the levels of miR-1, miR-133a, miR-133b and miR-206. [score:3]
presented in this study show that miR-1, miR-133a, miR-133b and miR-206 are induced during human muscle cell differentiation and their levels are increased proportionally to the stage of muscle foetal development. [score:2]
We examined the levels of miR-1, miR-133a, miR-133b and miR-206 during the development of human foetus. [score:2]
miR-1, miR-133a, miR-133b and miR-206 levels are proportional to the stage of muscle development. [score:2]
It can be therefore assumed that miR-1, miR-133a, miR-133b and miR-206 levels correlate with the induced in vitro differentiation of myoblasts to myotubes. [score:1]
These results are analogous to the elevated miR-1 and miR-206 levels observed in the newborn muscle cell line in part 3.2 (Figure 2). [score:1]
Of these, the most extensively studied are miR-1, miR-133 and miR-206. [score:1]
In human and mouse, these miRNAs are encoded by three loci, each of which produces a bicistronic transcript, containing one miRNA from the miR-1/206 family and one from the miR-133 family (miR-133a, miR-133b) [10]. [score:1]
These results suggest a mechanism by which MyoD induces in vitro muscle cell differentiation in human foetal cells, accompanied by the induction of miR-1, miR-133a, miR-133b and miR-206 levels in vitro. [score:1]
Among the four miRNAs, miR-1 and miR-206 were found to promote muscle cell differentiation [10, 11]. [score:1]
The purpose of this study was to investigate the expression of miR-1, miR-133a, miR-133b and miR-206 at different stages of the human developing muscle and during differentiation in myoblast cell lines. [score:1]
[1 to 20 of 28 sentences]
13
[+] score: 89
The seed mutation of Timp3 miR binding site 1 (pmiR-GLO-Timp3-S1-MUT), but not site 2 (pmiR-GLO-Timp3-S2-MUT), could rescue expression of the reporter gene luciferase, suggesting that site 2 is not involved in the regulation of this gene by miR-1. Limana et al. [26] previously reported that the site 2, but not site 1, was targeted by miR-206, which has identical 5′ seed to miR-1, whilst site 1 did not respond to miR-206 over expression. [score:9]
Figure S5 Conservation of (A) Timp3 miR-1/206 targeting seed, (B) Rbm24 miR-125b-5p targeting seed, (C) Tgfbr2 miR-204 targeting seed, (D) Csnk2a2 miR-208b targeting seed. [score:9]
It is noteworthy that miR-1, miR-133, miR-30, miR-208a, miR-208b, mir-499, miR-23a, miR-9 and miR-199a have previously been shown to be functionally involved in cardiovascular diseases such as heart failure and hypertrophy [40], [41], [42], [43], [44], and have been proposed as therapeutic- or disease-related drug targets [45], [46]. [score:7]
Interestingly, Timp3 has two predicted binding sites for the miR-1/206 family and despite miR-1 and miR-206 (an already known regulator of Timp3) having identical seed sequences, miR-206 specifically targets the second site [26], while miR-1 specifically targets the first site (Figure 6). [score:6]
In particular, miR-1 and miR-133, which are abundant microRNAs in the heart, are implicated in cardiovascular development and myocardial lineage differentiation, as they tightly control expression of muscle genes and repress ”unwanted” gene transcription through a network of target transcription factors [36], [37], [38], [39]. [score:6]
We demonstrate that miR-1 can directly regulate Timp3 expression at the post-transcriptional level. [score:5]
Expression profiles of miR-1/Timp3 and miR-125b-5p/Rbm24 were also anti-correlated with microRNA expression in the dog (Figure S2) and cynomolgus monkey (Figure S3). [score:5]
A subset of microRNAs (miR-1, miR-125b-5p, miR-204 and miR-208b) was selected for further cross-species analysis and their expression level relative to heart apex is shown in Figure 4. MiR-1 was highly expressed in all rat, dog and cynomolgus monkey heart structures except valves. [score:5]
Human Timp3 was down-regulated by miR-1 over expression in HeLa cells by Lim and colleagues [2], but the authors did not further investigate whether the effect was directly mediated by miR-1 at the post-transcriptional level. [score:5]
In particular, several microRNAs that are preferentially expressed in different types of muscles (e. g. miR-1, miR-133, and the myomiRs miR-208, miR-208b and miR-499) play a pivotal role in maintenance of cardiac function [17], [18], and the ablation of microRNAs-RISC machinery can have dramatic effects on cardiac development [19], [20], [21]. [score:4]
We selected 4 genes (Timp3, Rbm24, Tgfbr2 and Csnk2a2), respectively targeted by miR-1, miR-125b, miR-204 and miR-208b, for further analysis. [score:3]
MiR-1, miR-204 and miR-125b were detected in rat cardiac tissue by in situ hybridization (ISH), and the staining patterns observed were consistent with the relative expression observed by microRNA sequencing and qPCR. [score:3]
PLoS Genet 7. 39 Zhao Y, Ransom JF, Li A, Vedantham V, von Drehle M, et al (2007) Dysregulation of cardiogenesis, cardiac conduction, and cell cycle in mice lacking miRNA-1–2. [score:2]
We have also identified novel microRNA -mediated post-transcriptional mRNA regulatory interactions with potentially important roles in cardiac/muscle physiopathology including miR-1/Timp3, miR-125b/Rbm24, miR-204/Tgfbr2 and miR-208b/Csnk2a2. [score:2]
In summary, we have demonstrated that four genes (Timp3, Rbm24, Tgfbr2 and Csnk2a2) important for cardiac/muscular physiology are post-transcriptionally regulated by miR-1, miR-125b-5p, miR-204 and miR-208b and exhibit conserved cardiac tissue miR-mRNA interactions across species. [score:2]
0052442.g006 Figure 6 Timp3 and miR-1 (A), Rbm24 and miR-125b-5p (B), Tgfbr2 and miR-204 (C), Csnk2a2 and miR-208b (D). [score:1]
Interestingly, we demonstrated that only one of two predicted miR-1 binding sites within Timp3 was active. [score:1]
Timp3 and miR-1 (A), Rbm24 and miR-125b-5p (B), Tgfbr2 and miR-204 (C), Csnk2a2 and miR-208b (D). [score:1]
Distribution of miR-1, miR-125b-5p, miR-204 and miR-208b in cardiac structures across species. [score:1]
Furthermore, ventricular microRNAs (miR-1, miR-133, miR-208b and miR-499) have been found to be increased in the plasma of patients with myocardial infarction, and might represent a useful alternative to the classical cardiac troponin (cTnI) biomarker [57], [58], [59], [60], [61]. [score:1]
While signals for miR-1 and miR-125b-5p were strong, miR-204 was at the limit of detection, consistent with its relatively low abundance as determined by microRNA sequencing (Table S8). [score:1]
The ISH signal for miR-1 was more intense in the myocardium than in the valves (Figure 5G, H and I), and staining for miR-204 and 125b-5p was more intense in the valves than in the rest of the heart (Figure 5A to F), ISH of the liver-enriched miR-122 was performed and used as a negative control (Figure 5J, K and L). [score:1]
An assessment of the degree of conservation for structure-specific distribution of microRNAs in Wistar rat, Beagle dog and cynomolgus monkey (see for relative enrichment analysis), revealed high enrichment of nine microRNAs cardiac valves (miR-let7c, mIR-125b, miR-127, mir-199a-3p, miR204, miR-320, miR-99b, miR-328 and miR-744) (Figure 3A) and seven microRNAs in the myocardium (miR-1, mir-133a, miR-133b, miR-208b, miR-30e, miR-499-5p, miR-30e*) (Figure 3A). [score:1]
Here we focused on the characterization of four microRNAs, including myocardial specific miR-1 and miR-208b and valve enriched mir-204 and miR-125b-5p, based on their distinct heart-structure-specific distribution patterns and known roles in cardiac physiology, disease and pathological remo deling. [score:1]
Localization of miR-204, miR-125b-5p, miR-1 and miR-122 in rat heart by in situ hybridization. [score:1]
Staining for miR-1 was intense and uniform in the cardiomyocytes of the ventricle, while no signal could be detected in the cardiac valves (Figure 5G, H and I and Table S2). [score:1]
Conserved microRNA signatures were identified in valves (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744) and in ventricular-specific regions of the myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*) of Wistar rat, Beagle dog and cynomolgus monkey. [score:1]
0052442.g007 Figure 7 (A–D) Real-Time RT-PCR of Timp3, Rbm24, Tgfbr2 and Csnk2a2 in HPASM cells transfected with mimics for miR-1, miR-125b-5p, miR-204, miR-499 and miR-208b or with a mimic microRNA negative control. [score:1]
0052442.g005 Figure 5Localization of miR-204, miR-125b-5p, miR-1 and miR-122 in rat heart by in situ hybridization. [score:1]
Figure S6 Distribution of miR-1, miR-125b-5p, miR-204 and miR-208b in the cardiac structures in 1 human donor. [score:1]
miR-1 in valves (G–H) and ventricle (I). [score:1]
[1 to 20 of 31 sentences]
14
[+] score: 86
It is also noteworthy that the most abundant EBOV miRNAs in EBOV-infected samples regulate target genes in vitro; for instance, miR-1-5p experimentally downregulated importin-α5 in HEK293T cells [14], while miR-T3-3p inhibited the expression of HDAC5 and RIPK (genes not originally predicted for this miRNA by TargetScan) [12]. [score:13]
Inspection of the data revealed miRNA expression trends that could be grouped into: (1) miRNAs that increased steadily during disease (miR-1-3p, miR-2-3p, and miR-VP-3p); (2) miRNAs that remained low until day 4, then increased on day 7 (miR-1-5p, miR-T1-3p, miR-T3-3p, miR-T3/T4-5p, and miR-T4-3p); and (3) one miRNA that was highest on day 4/peak viremia (miR-T2-3p). [score:5]
They confirmed that these miRNAs were produced in mammalian cell lines by transfecting the pre-miRNA sequence into these cells, and further demonstrated in vitro that one of the miRNAs (miR-1-5p) suppresses the expression of importin-α5, a nuclear transport protein that interacts with EBOV and may influence viral virulence in vivo. [score:5]
Genes targeted by miR-1-3p are involved in clathrin -mediated endocytosis, while those regulated by miR-1-5p participate in c-MET signaling. [score:4]
miRNA Overrepresented pathway P-value miR-1-3p Cargo recognition for clathrin -mediated endocytosis 1.12E-05 Clathrin -mediated endocytosis 7.06E-05 Disease 1.02E-04 miR-1-5p MET activates RAS signaling 2.57E-08 Signaling pathways regulating pluripotency of stem cells 7.96E-07 Hippo signaling pathway 3.81E-06 Signaling by MET 7.12E-06 Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met) 1.12E-05 miR-T3-3p Antagonism of Activin by Follistatin 1.61E-03 We performed a BLAT search in the UCSC Ebola Genome Browser (with default reference sequence Ebola virus/H. [score:4]
miRNA Overrepresented pathway P-value miR-1-3p Cargo recognition for clathrin -mediated endocytosis 1.12E-05 Clathrin -mediated endocytosis 7.06E-05 Disease 1.02E-04 miR-1-5p MET activates RAS signaling 2.57E-08 Signaling pathways regulating pluripotency of stem cells 7.96E-07 Hippo signaling pathway 3.81E-06 Signaling by MET 7.12E-06 Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met) 1.12E-05 miR-T3-3p Antagonism of Activin by Follistatin 1.61E-03 In this work, we demonstrated that putative EBOV-encoded miRNAs are detectable in circulation in different infection mo dels (mouse, rhesus macaque, cynomolgus macaque, and human) of various EBOV variants (EBOV/Mayinga-MA, EBOV/Kikwit, and EBOV/Makona). [score:4]
miR-1-3p putatively governs clathrin -mediated endocytosis, which is an entry mechanism used by EBOV 29, 30. miR-1-5p target genes, meanwhile, may control c-Met signaling. [score:3]
Enriched pathways from human target gene lists predict that miR-1-3p, miR-1-5p, and miR-T3-3p exert control over different processes in EBOV pathogenesis. [score:3]
In the mouse mo del, miR-1-5p was the most abundant on all days, representing an average of 31.0% of the total over the disease course, followed by miR-T3-3p and miR-1-3p at 22.4% and 15.4%, respectively. [score:3]
We then used ToppFun [21] with default parameters (hypergeometric distribution with Bonferroni correction, P-value < 0.05) on predicted human target genes for the three most abundant miRNAs (miR-1-5p, miR-1-3p, and miR-T3-3p) to perform gene set functional enrichment. [score:3]
The top three miRNAs with the most predicted gene targets were miR-1-5p, miR-T2-3p, and miR-VP-3p. [score:3]
As expected, primers designed to miR-1-3p (Liang) and miR-1-5p (Liang), which only aligned to SUDV variants, showed no target amplification (data not shown). [score:2]
In contrast to the EBOV/Kikwit cohort, one technical replicate in one NHP showed presymptomatic amplification of the most-abundant miR-1-5p at day 3 without direct detection of EBOV (miRNA Cq = 34.79, NTC Cq not detected after 45 cycles). [score:2]
Similar to the NHP findings, the miRNAs at the highest levels were miR-1-5p and miR-T3-3p, followed by miR-1-3p, miR-T4-3p, and miR-T3/T4-5p. [score:1]
Similar to the NHP groups, miR-1-5p, miR-1-3p, and miR-T3-3p were also present at the highest levels in this cohort, albeit with more balanced proportions of these top miRNAs relative to the total miRNA amount. [score:1]
In the human cohort, a similar pattern of miRNA abundances emerged, with miR-1-5p garnering an average of 73.4% over all days, and trailed by miR-T3-3p (6.6%), miR-1-3p (6.5%), and miR-T3/T4-3p (5.4%). [score:1]
Similar to the NHP and mouse groups, miR-1-5p, miR-T3-3p, and miR-1-3p presented at the highest concentrations. [score:1]
In all EBOV infection mo dels, miR-1-5p was the most abundant miRNA, comprising ~70% of the EBOV miRNAs detected in two macaque species and in humans. [score:1]
Circulating virus peaked and then declined after day 6 with viral miRNAs following two trends: (1) mirroring viral load (miR-1-3p, miR-1-5p, miR-2-3p, miR-T1-5p) and (2) increasing over time independent of viral load (miR-T1-3p, miR-T2-3p, miR-T3-3p, miR-T3/T4-5p, miR-T4-3p, miR-VP-3p). [score:1]
All putative miRNAs were detected in these samples, with miR-1-5p and miR-1-3p being most abundant, followed by miR-T3-3p, miR-T1-5p, miR-T4-3p, and miR-T3/T4-3p. [score:1]
EBOV miRNAs amplified in cell culture supernatants, with the most abundant miRNAs being miR-1-5p, miR-1-3p, and miR-T3-3p. [score:1]
The concentration of the most-abundant miR-1-5p was only 54-fold lower than circulating virus in the EBOV/Makona cohort despite the G-to-A substitution in the 20 [th] nucleotide of the EBOV/Makona sequence; it was ~257-fold lower than virus in the EBOV/Kikwit group. [score:1]
EBOV miRNA miRNA concentration by day post-exposure (fM) Day 0 (EBOV load ND) Day 1 (4.17E-05 pM) Day 2 (0.04 pM) Day 3 (3.99 pM) Day 4 (20.20 pM) Day 7 (0.22 pM) miR-1-3p ND ND ND 8.82 ± 6.92 20.94 ± 14.68 51.32 ± 37.27 miR-1-5p ND ND 1.08 ± 0.99 8.52 ± 1.51 25.11 ± 2.55 129.37 ± 6.68 miR-2-3p ND ND ND 2.40 ± 1.23 5.00 ± 1.11 12.41 ± 2.36 miR-T1-3p ND ND ND 0.74 ± 0.16 1.78 ± 0.41 18.44 ± 1.83 miR-T1-5p ND ND ND ND 14. [score:1]
A BLAT search of EBOV-miR-1-3p (Liang) and EBOV-miR-1-5p (Liang) did not produce a significant alignment, and NCBI BLAST results showed that these sequences were only found in SUDV. [score:1]
While still the main miRNA present in mouse EVD, miR-1-5p abundance was proportionally lower and closer to the next most-abundant miRNAs miR-T3-3p and miR-1-3p. [score:1]
In this cohort, miR-1-5p and miR-1-3p yielded the highest concentrations, followed by miR-T1-5p and miR-T3-3p. [score:1]
miR-1-5p was also the most represented miRNA in the cynomolgus macaque EBOV/Makona infection at an average of 67.7% of the total over all days, followed by miR-T3-3p (11.2%), miR-T4-3p (6.9%), miR-T3/T4-5p (6.7%), and miR-1-3p (4.2%). [score:1]
miR-1-3p and miR-1-5p, which were among the top miRNAs detected, lie in the intergenic region between VP30 and VP24. [score:1]
miR-1-5p was detected in the most samples (7 patients), followed by miR-T3/T4-5p and miR-T1-3p (5 patients). [score:1]
Similarly, miR-T3-3p was present at a concentration 26 times higher than virus in sample G14, miR-T3/T4-5p was 5-fold higher in sample G8, and miR-1-3p was 1.8-fold higher in sample G4. [score:1]
Similarly, miR-1-5p was most abundant in the EBOV/Makona group, followed by miR-T3-3p, miR-T4-3p, miR-T3/T4-5p, and miR-1-3p (Table  2 and Supplementary Fig.   S1b). [score:1]
Analysis of the distributions of viral miRNAs in the four species revealed that miR-1-5p was the predominant EBOV miRNA in all infection mo dels, followed by miR-T3-3p and miR-1-3p. [score:1]
In the mouse samples, average viral load was 5.22 ± 0.27 pM, with miR-1-5p concentrations ~400-fold lower over the course of infection. [score:1]
We found that miR-T1-3p shares the same seed sequence as the endogenous mouse miRNA mmu-miR-470, while miR-1-5p shares the same seed region as hsa-miR-155-5p [14], indicating that these may function as host miRNA analogs. [score:1]
EBOV miRNA miRNA concentration by day post-exposure (fM) Day −7 (EBOV load ND) Day 0 (ND) Day 3 (ND) Day 6 (51.71 pM) Day 7 (287.17 pM) Day 8 (295.55 pM) miR-1-3p ND ND ND 58.37 ± 20.57 557.04 ± 111.82 245.68 ± 48.88 miR-1-5p ND ND ND 216.36 ± 15.75 1424.69 ± 108.41 1151.34 ± 72.38 miR-2-3p ND ND ND 1.74 ± 1.32 8.02 ± 1.68 5.20 ± 3.76 miR-T1-3p ND ND ND 2.13 ± 0.52 12.04 ± 1.11 9.94 ± 0.55 miR-T1-5p ND ND ND 4.64 ± 1.06 31.27 ± 1.44 87. [score:1]
In our human samples, EBOV/Makona viral loads were much lower and ranged from 2.1 × 10 [−5] to 7.64 pM (mean 1.06 pM), with average miRNA levels from the most abundant viral miRNA, miR-1-5p, at 99.43 fM (~11-fold lower). [score:1]
The relative abundances of the miRNAs in this cohort mirrored the NHP groups, with miR-1-5p dominating the viral miRNA landscape. [score:1]
In rhesus macaques, miR-1-5p dominated the total EBOV miRNA content at 69.1% over all days, followed by miR-1-3p at 21.3% and miR-T3-3p at 2.7%. [score:1]
EBOV miRNA miRNA concentration by patient sample designator (fM)G1(0.031 pM)G2(0.367 pM)G3(0.336 pM)G4(0.012 pM)G5(7.64 pM)G6(7.50 pM)G8(3.47E-05 pM)G9(1.61E-04 pM)G14(1.04E-04 pM) miR-1-3p 2.67 ±  4.62* 21.74 ±  23.92 15.87 ± 10.68 21.78 ± 10.63 miR-1-5p 0.48 ± 0.11 110.09 ± 1.86 4.17 ± 0.87 361.67 ± 48.69 217.95 ± 5.70 1.39 ±  0.95 0.21 ±  0.26 miR-2-3p 0. 86 ± 0.74 1.38 ± 0.58 1.84 ± 0.25 miR-T1-3p 4.62 ± 1.02 0.38 ± 0.17 1.36 ± 0.45 9.42 ± 1.41 5.03 ± 2.31 miR-T1-5p 0.58 ± 0.99 4.55 ± 1.39 6.47 ± 0.56 miR-T2-3p 0.83 ± 0.87 2.80 ± 0.67 2.48 ± 1.26 miR-T3-3p 9.89 ± 4.67 36.29 ± 8.78 14. [score:1]
Similarly, miR-1-5p was not initially found in the UCSC reference but closer inspection of the pre-miR-1 annotation revealed that miR-1-5p spanned genome position 9892–9913, with a G to A substitution at position 9911 of the EBOV/Makona variant (20 [th] nucleotide of the miRNA sequence); no mismatches were present in the genomes of other EBOV variants. [score:1]
However, miR-1-5p was detected in sample G9 (viral load = 0.161 fM) and miR-T3-3p amplified in one technical replicate of sample G14 (viral load = 0.104 fM, 18 days after symptom onset). [score:1]
miR-1-3p, miR-1-5p, and miR-T3-3p were the most abundant in all variants tested. [score:1]
miR-1-5p was the most abundant miRNA (mean concentration 99.43 ± 142.16 fM), followed by miR-T3-3p (mean 15.76 ± 14.48 fM), miR-1-3p (mean 15.51 ± 9.00 fM) and miR-T3/T4-5p (mean 10.28 ± 11.14 fM). [score:1]
miRNA concentrations on day 7 rivaled those of viral load, with miR-1-5p only ~1.65 times lower than corresponding EBOV titer. [score:1]
However, miR-1-5p, miR-T3-3p, miR-T3/T4-5p, and miR-T4-3p were detectable in three different mice as early as day 2 post-exposure, when animals were asymptomatic for EVD. [score:1]
[1 to 20 of 45 sentences]
15
[+] score: 81
Recently, Duan and colleagues showed that miR-1 was downregulated in 93.7% of chordoma tissues and its expression was inversely correlated with c-Met expression, indicating that suppressed miR-1 expression in chordoma may in part be a driver for tumor growth, and that miR-1 has the potential to serve as a prognostic biomarker and therapeutic target for chordoma patients [46]. [score:14]
Interestingly, miR-1/206 expression levels were inversely correlated with c-Met, demonstrating that miR-1/206 suppressed c-Met expression in rhabdomyosarcoma and could function as a potent tumor suppressor in c-Met-over -expressing tumors [49]. [score:11]
Another study conducted by Reid et al. showed that miR-1 can have a tumor-suppressor function in colorectal cancer by directly downregulating c-Met oncogene both at the RNA and protein levels and that reexpression of miR-1 leads to c-Met -driven reduction of cell proliferation and motility, identifying miR-1 downmodulation as one of the events that could enhance colorectal cancer progression [48]. [score:9]
They showed that concomitant downregulation of miR-1 and up-regulation of MACC1 leads to a c-Met induction and promotes cancer metastatis in colon cancer cells [49] (Figure 2). [score:7]
Novello and colleagues demonstrated that the ectopic expression of miR-1 in the U2-OS osteosarcoma cell lines, significantly reduced cell proliferation and cell invasiveness correlated with c-Met down-regulation. [score:6]
Migliore C. Martin V. Leoni V. P. Restivo A. Atzori L. Petrelli A. Isella C. Zorcolo L. Sarotto I. Casula G. MiR-1 downregulation cooperates with MACC1 in promoting C-MET overexpression in human colon cancer Clin. [score:5]
They performed a miR profiling in osteosarcoma clinical samples and showed that the expression of miR-1 together with miR-133b may control cell proliferation and cell cycle through c-Met protein expression modulation [47]. [score:5]
Nasser M. W. Datta J. Nuovo G. Kutay H. Motiwala T. Majumder S. Wang B. Suster S. Jacob S. T. Ghoshal K. Down-regulation of micro -RNA-1 (miR-1) in lung cancer. [score:4]
Nasser and colleagues have published the first evidence of the direct binding between miR-1 and the 3' UTR of c-Met, reporting that exogenous miR-1 significantly reduced its expression, thereby reducing cell migration and motility of A549 cells in a c-Met -mediated manner [44]. [score:4]
Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin -induced apoptosis by miR-1 J. Biol. [score:3]
Novello C. Pazzaglia L. Cingolani C. Conti A. Quattrini I. Manara M. C. Tognon M. Picci P. Benassi M. S. miRNA expression profile in human osteosarcoma: Role of miR-1 and miR-133b in proliferation and cell cycle control Int. [score:3]
Migliore’s group observed that miR-1 and miR-206 are highly expressed in skeletal muscle and investigated their role in the development of rhabdomyosarcoma. [score:2]
Several papers showed the direct interaction between miR-1 and c-Met. [score:2]
A significantly lower level of miR-1 compared to the higher level of c-Met expression was observed in aggressive PTC, in chordoma tissues and human primary lung cancer tissues and cell lines [44, 45, 46]. [score:2]
Additionally, Migliore and colleagues identified a feedback loop between miR-1 and c-Met, resulting in their mutual regulation. [score:2]
Reid J. F. Sokolova V. Zoni E. Lampis A. Pizzamiglio S. Bertan C. Zanutto S. Perrone F. Camerini T. Gallino G. miRNA profiling in colorectal cancer highlights miR-1 involvement in MET -dependent proliferation Mol. [score:1]
2.5. miR-1. 2.6. [score:1]
[1 to 20 of 17 sentences]
16
[+] score: 78
Hereby, we have randomly selected 32 genes targeted by 6 different microRNAs including miR-1, -206, -133a, -133b, -128 and -30 and tested their expression using pRT-PCR in the cells where corresponding microRNA was ectopically overexpressed or inhibited. [score:9]
To illustrate the impact of miRNA repression on the expression of their target genes, we have chosen to inhibit the expression of four well-characterized myogenic microRNAs miR-1, -133a, -133b and -206 in human immortalized myoblasts using LNA (Locked Nucleic Acids) antisense microRNAs (anti-miRs). [score:7]
Functional analysis of predicted miR-1 target genes supported by transcriptome data indicated that these microRNAs might also target genes involved in the regulation of apoptosis, DNA damage response, cell motility and protein modification, cell signaling and kinase activity [33]. [score:6]
Transcriptome-supported target genes of miR-1/206 (C) and miR-133a/b (D) were downregulated during normal myogenic differentiation but not when it was accompanied by the transfection with corresponding anti-miRs. [score:6]
The full list of supported target genes of MR-miRs with and without assigned functions can be found in the Additional file 7. It has been previously demonstrated that miR-1 and -206 target genes linked to the regulation of chromatin modifications [8], transcription [20, 49] and cell cycle [50]. [score:6]
Repressing miR-1/206 resulted in the upregulation of six of its targets: AP3D1 (adaptor-related proteins complex 3, delta 1 subunit), COL3A1 (collagen, type III, alpha 1), HDAC1 (histone deacetylase 1), PDCD4 (programmed cell death 4), PRKAB2 (protein kinase, AMP-activated beta 2 non-catalytic subunit) and ZNF365 (zinc finger protein 365). [score:6]
Myogenic microRNAs miR-1, miR-133a/b and miR-206 (also called MyomiRs, as suggested by [6]) regulate myogenic differentiation and proliferation of myogenic cells by targeting important regulators of myogenesis [7, 8] (for review see [6, 9]). [score:5]
We have then randomly selected 12 and 10 genes predicted to be targeted by miR-1/206 and miR-133a/b respectively and supported by our transcriptome data and tested their expression using qRT-PCR in the cells transfected with corresponding anti-miRs. [score:5]
MiR-1 and miR-133a are expressed in both skeletal and cardiac muscles [7, 10], while miR-133b and miR-206 are expressed solely in skeletal muscles [10]. [score:5]
Our own functional analysis of predicted target genes of miR-1 and -206 supported by transcriptome analysis confirmed that might target genes involved in in these biological processes. [score:5]
These target genes were considered as novel “qRT-PCR validated” target genes of miR-1 and -206 (Figures  4A). [score:4]
It has been previously demonstrated that miR-1 and -206 target genes linked to the regulation of chromatin modifications [8], transcription [20, 49] and cell cycle [50]. [score:4]
Human immortalized myoblasts were differentiated in vitro and then transfected separately with anti-miRs targeting miR-1, miR-133a, miR-133b and miR-206. [score:3]
In addition, miRNA-1 and -206 might target genes implicated in cytoskeleton organization, ubiquitination and nucleotide biosynthesis (Figure  5, Additional file 9). [score:3]
The full list of supported target genes of MR-miRs with and without assigned functions can be found in the Additional file 7. MicroRNAs, particularly miR-1, -206 and -133a/b, play crucial roles in myogenesis [6]. [score:3]
miR-1 and miR-206. [score:1]
[1 to 20 of 16 sentences]
17
[+] score: 77
Other miRNAs from this paper: hsa-mir-1-1
In conclusion, RSV is an agent with potent suppressing effect on canonical Wnt signal and exerts strong regulation over SRF expression and subsequent miR-1 expression in iPSCs. [score:8]
In that study, the authors demonstrated that 100 ng Wnt3A completely suppressed CM differentiation in miR-1 overexpressing iPSCs [30], suggesting that miR-1 mediates CM differentiation via antagonizing the suppressor role of Wnt3A. [score:7]
In the current study, we also found that RSV exerted strong regulation over SRF expression and subsequent miR-1 expression. [score:6]
Inhibiting SRF directly led to decreased miR-1 expression in the heart of mice [20]. [score:6]
In combination with our data, it is possible that RSV's suppressive effect over canonical Wnt is partially through increasing miR-1 expression, which antagonizes Wnt3A. [score:5]
RSV treatment could enhance SRF expression at both mRNA and protein levels and further increase miR-1 expression. [score:5]
MiR-1, a SRF dependent miRNA, is highly expressed in cardiomyocytes and their precursors and regulates cardiomyogenesis [18– 20]. [score:4]
Knockdown of endogenous SRF partly abrogated RSV's effect in enhancing miR-1 expression (Figure 4(g)). [score:4]
In this study, we explored the effect of RSV in CM differentiation of human iPSCs and firstly reported that RSV could enhance the differentiation through inhibiting canonical Wnt signal pathway and enhancing SRF-miR-1 axis. [score:3]
Since RSV has general inhibiting effect on canonical Wnt pathway, we could not exclude the possibility that, besides the linear RSV-SRF-miR-1-Wnt3A pathway, RSV may exert differentiation inducing effect through other Wnt proteins or even non-Wnt pathways. [score:3]
qRT-PCR analysis also revealed that 50  μM RSV administration enhanced miR-1 expression (Figure 4(d)). [score:3]
To explore whether SRF-miR-1 axis is involved in RSV enhanced CM differentiation, transcription and protein levels of SRF in EBs treated with 50  μM RSV were detected on day 4. RSV remarkably promoted SRF expression at both mRNA and protein levels (Figures 4(a), 4(b), and 4(c)). [score:3]
Secondly, one recent study found that miR-1 mediates CM differentiation via antagonizing the suppressor role of Wnt3A [30]. [score:3]
To quantify miR-1 expression in iPSCs treated with RSV, total RNAs were extracted using the mirVana PARIS Kit (Ambion, USA). [score:3]
Through regulating SRF-miR-1 axis, RSV increased the ratio beating EBs of human iPSCs. [score:2]
MiR-1 plays an important part in CM commitment from human cardiovascular progenitors via suppressing both WNT and FGF signaling pathways [30]. [score:2]
To quantify the expression of miR-1, TaqMan MicroRNA Assay Kit (Applied Biosystems) was used. [score:2]
To knock down endogenous miR-1, iPSCs were transfected with 200 nM anti-miR-1 (sequence: ACAUACUUCUUUAUAUGCCCAU, Ambion, Life Technology) using Lipofectamine 2000 reagent (Invitrogen). [score:2]
The ratios of beating EBs formed by iPSCs with miR-1 or SRF knockdown alone or with knockdown of miR-1 and SRF in combination on day 24 were calculated. [score:1]
In fact, miR-1 is a SRF dependent microRNA [18– 20]. [score:1]
SRF-miR-1 Axis Is Also Involved In the CMs Differentiation Enhanced by RSV. [score:1]
These results indicate that the SRF-miR-1 axis also involved the CMs differentiation enhanced by RSV. [score:1]
Blocking either SRF or miR-1 substantially weakened the effect of RSV in CMs differentiation, while blocking both showed stronger weakening effect. [score:1]
In fact, our preliminary work showed that SRF-miR-1 might exert function through non-Wnt pathways. [score:1]
[1 to 20 of 24 sentences]
18
[+] score: 76
By introducing tissue-specific miR-1 and miR-124 miRNAs into HeLa cells, Lim et al. showed that (1) miRNAs are able to downregulate messenger levels as monitored by microarray experiments and (2) that these artificially downregulated mRNAs are usually underexpressed in the tissue where the miRNA is expressed. [score:11]
For genes containing miR-1 or miR-124 targets, we expected that targeted isoforms would be downregulated in tissues where cognate microRNAs are known to be expressed. [score:10]
Figure 4 shows the average relative EST -based expression levels of targeted and nontargeted isoforms in cardiovascular tissues for miR-1 and brain tissues for miR-124, compared to their relative expression in other tissues. [score:8]
If certain miRNAs such as miR-1 and miR-124 are able to repress messenger levels, we expect a specific downregulation of targeted isoforms in tissues where such miRNAs are expressed. [score:8]
Only when tissues known to express miR-1 and miR-124 were singled out did a tendency emerge for specific downregulation of isoforms containing targets for these miRNAs. [score:8]
While the level of targeted isoforms is usually higher than that of nontargeted isoforms in tissues taken as a whole, it is reduced in the tissue class where the cognate miRNA is expressed, with a one-way T test p-value of 0.03 for miR-1/cardiovascular, and 0.06 for miR-124/brain. [score:7]
Figure 5 shows levels of repression of targeted versus nontargeted isoforms in each class, for genes containing miR-1 and miR-124 targets. [score:7]
MiR-1 is preferentially expressed in heart and skeletal muscle, and miR-124 is preferentially expressed in brain [15, 16]. [score:5]
Relative EST-Based Expression of Isoforms Containing or Not Containing a Target for miR-1 or miR-124. [score:5]
For miR-1–targeted isoforms, a stronger repression is observed in cardiovascular and musculoskeletal tissues, which agrees well with experimental data [15], even though repression in musculoskeletal tissue was not statistically significant (p = 0.09). [score:3]
For the analysis of miR-1 and miR-124 targets (Figure 5), tissue class “nervous” was replaced by lower-level class “brain. [score:3]
We describe an application of this strategy to miR-1 and miR-124, the miRNAs first reported to cause tissue-specific transcript repression [5]. [score:1]
[1 to 20 of 12 sentences]
19
[+] score: 75
Other miRNAs from this paper: hsa-mir-1-1, rno-mir-1
Our study provides support to this finding and also demonstrates that, in an in vivo mo del of hepatocarcinogenesis, miR-1 expression is down-regulated in KRT-19 [+] nodules expressing high levels of NRF2-target genes [26]. [score:10]
F. qRT-PCR and WB analysis of G6PD expression in RH cells transfected with pre-miR-1. In agreement with recent findings proposing that NRF2 indirectly induces G6PD expression by down -regulating miR-1 [33], microarray analysis performed in microdissected preneoplastic KRT-19 [+] nodules showed an inverse correlation between miR-1 and its target gene, G6PD, (Supplementary Figure S8A). [score:9]
Remarkably, the translational value of the present results can be inferred by the observation that, similar to rat pre- and neoplastic lesions, in human HCCs high G6PD expression is associated with miR-1 down-regulation and correlates with tumor grading, metastatic status and poor prognosis. [score:8]
NRF2 regulates antioxidant genes, thus protecting cells from excessive ROS damage and, as recently shown, sustained activation of NRF2 signaling in cancer cells attenuated miR-1 expression, leading to enhanced expression of PPP genes [38]. [score:6]
Accordingly, in NRF2-silenced RH cells, we observed an increased expression of miR-1, paralleled by G6PD down-regulation (Figure 6B). [score:6]
Having shown induction of G6PD and miR-1 down-regulation in both preneoplastic and neoplastic rat hepatocytes, we wished to determine whether these results could be of translational value for human HCC. [score:6]
Our data also show that NRF2 silencing decreased G6PD expression and concomitantly increased miR-1, while transfection with miR-1 mimic abolished G6PD expression. [score:5]
Since it was not possible to collect a significant number of human early dysplastic lesions and in consideration of the finding that miR-1 and G6PD expression were dysregulated all throughout the rat carcinogenic process, we determined miR-1 expression and G6PD mRNA levels in a cohort of 59 patients subjected to liver resection for HCC (study population characteristics are described in Supplementary Table S1A). [score:4]
E. qRT-PCR analysis of miR-1 expression in KRT-19 [+] nodules. [score:3]
Similarly to what observed in rats, qRT-PCR analysis showed a significant down-regulation of miR-1 levels (Supplementary Figure S8B) (P <0.05) in 78% of HCCs, when compared to matched non-cancerous liver cirrhotic (LC) tissues. [score:3]
F. qRT-PCR and WB analysis of G6PD expression in RH cells transfected with pre-miR-1. A. Top. [score:3]
NRF2 modulates G6PD and miR-1 expression. [score:3]
Moreover, inhibition of miR-1 following induction of the transcription factor NRF2 and accumulation of glycolytic intermediates increase PPP activity [13, 14]. [score:3]
In agreement with the decreased miR-1 levels, we observed a concomitant increase of G6PD expression in the same human HCCs compared to LC (P <0.05) (Figure 7A). [score:2]
Conversely, RH cells transfected with pre-miR-1 showed a significant decrease of G6PD mRNA and protein levels (Figure 6F). [score:1]
RH cells were transiently transfected with 200 pmol of miR-1 mimic (Ambion, Austin, TX) or 200 pmol of siRNAs (control siRNA or NRF2 siRNA, Ambion) using Lipofectamine 2000 (Invitrogen, Paisley, UK). [score:1]
B. qRT-PCR analysis of NRF2, G6PD and miR-1 RNA levels in RH cells upon NRF2 silencing. [score:1]
miR-1 is involved in NRF2 induced activation of the PPP pathway. [score:1]
[1 to 20 of 18 sentences]
20
[+] score: 75
miR-1, miR-133a and miR-133b expression is upregulated with aging in men. [score:6]
miR-1 has a specific set off predicted mRNA targets and the regulatory net-effect will thus differ from the effect of testosterone -mediated miRNA regulation. [score:5]
An overall effect of LHRH-agonist treatment was observed for miR-133a and miR-133b expression (P < 0.05), but not in miR-1 or miR-206 expression (P > 0.05). [score:5]
Where no effect of age and/or gender on miR-1 and miR-206 expression was detected (P > 0.05), a significant interaction on miR-1 expression was identified with a Two-Way ANOVA test (P < 0.05). [score:5]
An ordinary Two-Way ANOVA revealed an overall effect of both gender and age on miR-133a and miR-133b expression (B,C) ([**] P < 0.01) and a significant interaction for miR-1 expression ([**] P < 0.01). [score:5]
When using Bonferroni multiple comparison post-hoc test it was demonstrated that miR-1 (A), miR-133a (B), and miR-133b (C) expression levels were higher in elderly compared to younger men ([*] P = 0.02, [*] P = 0.03, [***] P = 0.008, respectively) There was no effect of age or gender on mir-206 expression (D) (P > 0.05). [score:4]
Therefore, it is likely that the decline in physical activity is the main determining factor involved in the age -dependent up-regulation of miR-1 and miR-133a/b. [score:4]
miR-1 and miR-206 expression were not altered by LHRH-agonist treatment before the training period (P > 0.05) (Figures 3A,D). [score:3]
The expression of mir-1 and mir-206 were identical in skeletal muscle in both castrated and sham operated mice (P > 0.05). [score:3]
miR-1, miR-133a, miR-133b, and miR-206 belong to a group of muscle specific miRNAs (myomiRs) crucial for the regulation of skeletal muscle development and function (Chen et al., 2006; van Rooij et al., 2008). [score:3]
miR-1 (E) and miR-206 (H) expression were not correlated with testosterone in men. [score:3]
Bonferroni multiple comparison post-hoc tests revealed a significant lower expression of mir-133a (B) ([*] P = 0.02) and mir-133b (C) ([*] P = 0.03), but not mir-1 (A) or miR-206 (D) in testosterone blocked patients at rest before training. [score:3]
The expression of mir-1 and mir-206 were not significantly different between castrated and sham operated mice (A). [score:3]
Specific requirements of MRFs for the expression of muscle specific microRNAs, miR-1, miR-206 and miR-133. [score:3]
Partly in line with our previous results (Nielsen et al., 2010), a Two-Way ANOVA (RM) demonstrated a main effect of training in terms of decreased expression in all four myomiRs (miR-1, P < 0.0001. miR-133a, P < 0.01. miR-133b, P < 0.0001, miR-206 P < 0.05). [score:3]
In the current study, we found that the expression of miR-1, miR-133a, and miR-133b was higher in the skeletal muscle of elderly compared to younger men and that miR-133a/b was higher expressed in women compared to men. [score:3]
MicroRNA-1 and microRNA-133a expression are decreased during skeletal muscle hypertrophy. [score:3]
Dysregulation of cardiogenesis, cardiac conduction, and cell cycle in mice lacking miRNA-1-2. Cell 129, 303– 317 10.1016/j. [score:2]
We found an increased expression of miR-1 (P = 0.02), miR-133a (P = 0.03) and miR-133b (P = 0.008) in elderly men compared to younger men (Figures 1A–C). [score:2]
However, in addition to miR-133a/b, miR-1 was induced in the elderly group. [score:1]
ARE motifs near the miR-1/miR-133a loci, have not yet been identified. [score:1]
To address a potential involvement of miR-1, miR-133a, and miR-133b in the age-related decline in muscle function for both genders, we used a bonferroni multiple comparison post-hoc test. [score:1]
In line with our previous findings (Nielsen et al., 2010) aerobic fitness in all subjects was negatively correlated with miR-1 and miR-133a and miR-133b (Figures 2A–C) (P < 0.05, 0.01 and 0.001, r [2] = 0.11, 0.24, and 0.33, respectively). [score:1]
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
A Two-Way ANOVA (RM) (miR-1, [****] P < 0.0001. miR-133a, [**] P < 0.01. miR-133b, [***] P < 0.001, miR-206 [*] P < 0.05). [score:1]
miR-1, miR-133a, and miR-133b (A–C) were inversely correlated with maximal oxygen uptake in women and men (n = 36) (P < 0.05, 0.01 and 0.001, R [2] = 0.11, 0.24, and 0.33). [score:1]
[1 to 20 of 26 sentences]
21
[+] score: 74
Future studies targeted on in vivo restoration of Pim-1 either by upregulation of Pim-1 or by knocking-down miR-1 will provide a platform for the development of gender specific treatment to combat the disease. [score:10]
Literature search and online target prediction tools (Target Scan and Pictar Scan) revealed miR-1 and miR-208a as possible inhibitors of Pim-1 expression [15, 17, 32]. [score:9]
We also demonstrate that early downregulation of pro-survival protein Pim-1 plays a major role in accelerating the progression of cardiomyopathy in female diabetics through upregulation of miR-1 and 208a. [score:7]
This was associated with significant downregulation of pro-survival Pim-1 and upregulation of pro-apoptotic Caspase-3, microRNA-1 and microRNA-208a. [score:7]
In vitro restoration of Pim-1 levels either through direct overexpression of Pim-1 or inhibition of miR-1 and 208a reverted this “ female disadvantage” in the diabetic cardiomyocytes. [score:6]
However, the miR expression study on human hearts did not reveal any significant difference between male and female diabetics although there was a trend for increased expression of miR-1 in female diabetics. [score:5]
MiR-1 has been well demonstrated as the direct regulator of Pim-1 in the heart independent of Akt [17] and our earlier study showed marked improvement in the survival of male diabetic cardiomyocytes following knockdown of miR-1 [15]. [score:4]
Our results newly show marked upregulation of miR-1 in the female diabetic heart. [score:4]
In support of this notion, inhibition of both miR-1 and -208a improved the survival of female diabetic cardiomyocytes. [score:3]
F-G Bar graphs showing the expression level of miR-1 (F) and miR-208 (G) in study groups (n = 5 at each time point). [score:3]
C-D. Bar graphs showing the expression level of miR-1 (C) and miR-208a (D) in diabetic and non-diabetic human heart. [score:3]
Here, we confirmed that female diabetic hearts more abundantly express miR-1 (Figure  3F) and miR-208a (Figure  3G) at 4 weeks after STZ -induced diabetes, with further increases during evolution of cardiomyopathy (P < 0.01 vs. [score:3]
Transfection with Pim-1 (Figure  5A-C) or anti-miR-1/208a (Figure  5D-E) rescued Pim-1 expression in both the male and female diabetic cardiomyocytes (Figure  5B and Figure  5D, P < 0.05 vs. [score:3]
Additional in vivo studies are necessary to understand the role of miR-1 and miR-208a in accelerating the development of cardiomyopathy in female diabetic hearts. [score:2]
To this aim, cardiomyocytes isolated from diabetic and non-diabetic mice at 12 weeks after STZ -induced diabetes were transfected with either hPim-1 plasmid or anti-miR-1/208a. [score:1]
Akt was decreased (Figure  4B) and miR-1 (Figure  4C) and miR-208 (Figure  4D) was increased in both the diabetic groups with no significant difference between genders, although there was a trend for increased levels of miR-1 in female diabetics (Figure  4C). [score:1]
In addition to miR-1, we also found early activation of miR-208a in the female diabetic mice, which might also account for increased LV dilation early in the female diabetic heart [42]. [score:1]
D representative blots and bar graphs showing the levels of Pim-1 in the isolated and cultured cardiomyocytes treated with either anti-miR-1/208a or scrambled sequence. [score:1]
Freshly isolated cardiomyocytes from diabetic and non-diabetic murine hearts of both genders were transfected either with human Pim-1 plasmid (8 μg/1×10 [6] cells) [15], or anti-miR-1/208 (50 nM, Life Technologies) using commercially available Lipofectamine 2000 (Life Technologies) according to the manufacturer’s instructions. [score:1]
[1 to 20 of 19 sentences]
22
[+] score: 72
Other miRNAs from this paper: mmu-mir-1a-1, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-1b
IL11 is a predicted gene target of miR-1 [22] and miR-1 transfection of Hela cells down-regulates IL11, IL11Rα and STAT3 mRNA [29]. [score:6]
MiR-1 down-regulated IL11 gene expression and its’ signaling components, IL11Rα and gp130 in G3-derived AN3CA endometrial epithelial cells. [score:5]
Loss of miR-1 expression in primary type I human endometrial cancer [21] correlates with elevated IL11 expression [13, 14]. [score:5]
Restoration of miR-1 by synthetic miR-1 mimic transfection significantly down-regulated IL11, IL11Rα and gp130 in AN3CA cells, but not HEC1A cells. [score:4]
MiR-1 expression was detectable in most benign endometrial tissue samples, however expression in G1-3 endometrial tumour tissues was undetectable (n = 10/group) (Figure 1A). [score:4]
IL11 is a predicted target of miR-1 [22]. [score:3]
MiR-1 mimic significantly reduced HEC1A (p < 0.05) and AN3CA cell viability (p < 0.01) (Figure 1D), and significantly down-regulated IL11 mRNA and its’ signaling components, IL11Rα and gp130 in AN3CA cells (p < 0.05), but not HEC1A cells (Figure 1E). [score:3]
This finding suggests that miR-1 may regulate proliferation in endometrial cancer cells at least in part via IL11, however, the direct binding of miR-1 with the 3′UTR of IL11 was not established. [score:3]
Gene expression was normalised against 18 s. Table 2 IL11 F 5′-GTTTACAGCTCTTGATGTCTC-3′ R 5′-GAGTCTTTAACAACAGCAGG-3′ IL11Rα F 5′-GTCCCCTGCAGGATGAGATA-3′ R 5′-AGGCCAAGGCAAGAGAAGAT-3′ p130 F 5′-CATAGTCGTGCCTGTGTGCT-3′ R 5′-GCCGTCCGAGTACATTTGAT-3′ HEC1A or AN3CA cells were transfected according to manufacturers instructions using Lipofectamine [®] RNAiMAX and miR-1 mimic (100 nM; Life Technologies) for 72 h. A scrambled microRNA sequence (scr) (Life Technologies) was used as a control. [score:3]
MicroRNA (miR-1) has previously been demsontrated to act as a tumour suppressor in endometrial tumours [21]. [score:3]
MiR-1 was overexpressed by transfecting HEC1A and AN3CA cells with miR-1 mimic. [score:3]
MiR-1 expression and regulation of IL11 in human endometrial cancer and cell lines. [score:3]
Quantitative real-time RT-PCR was performed to determine miR-1 expression in whole tissue from G1-3 endometrial tumours versus benign endometrium. [score:3]
Gene expression was normalised against 18 s. Table 2 IL11 F 5′-GTTTACAGCTCTTGATGTCTC-3′ R 5′-GAGTCTTTAACAACAGCAGG-3′ IL11Rα F 5′-GTCCCCTGCAGGATGAGATA-3′ R 5′-AGGCCAAGGCAAGAGAAGAT-3′ p130 F 5′-CATAGTCGTGCCTGTGTGCT-3′ R 5′-GCCGTCCGAGTACATTTGAT-3′ HEC1A or AN3CA cells were transfected according to manufacturers instructions using Lipofectamine [®] RNAiMAX and miR-1 mimic (100 nM; Life Technologies) for 72 h. A scrambled microRNA sequence (scr) (Life Technologies) was used as a control. [score:3]
MiR-1 is absent in human endometrial cancer and cell lines and miR-1 mimic down regulates IL11 in AN3CA cells. [score:2]
Figure 1(A) MiR-1 expression was quantified in G1, 2, or 3 human endometrial cancer tissue, or benign (B) endometrium by real-time RT-PCR normalized to snU6 (n = 10/group) and in (B) normal proliferative phase endometrial epithelial cells (n = 4), or human endometrial cancer cell lines; Ishikawa, HEC-1A, RL95 and AN3CA derived from grade 1, 2, or 3 human endometrial cancers respectively, normalized to 18 s (n = 3 passages/cell line). [score:2]
We hypothesized that miR-1 regulates IL11 in endometrial tumours and that IL11 promotes high grade endometrial tumour growth. [score:2]
MiR-1 has approximately 1000 predicted targets in different cell types [22, 29], with only phosphodiesterase 7A (PDE7A) experimentally confirmed in endometrial cancer cells [21]. [score:2]
MiR-1 expression levels were normalised against control snU6 probes. [score:2]
Similarly, we found loss of miR-1 expression in a panel of human endometrial epithelial cell lines compared to normal proliferative phase endometrial epithelial cells. [score:2]
In AN3CA cells, miR-1 mimic significantly reduced cell proliferation versus scr control after 72 h (p < 0.01) (Figure 1F). [score:1]
Addition of IL11 to miR-1 mimic transfected cells restored AN3CA cell proliferation to control levels (Figure 1F). [score:1]
MiR-1 was significantly up regulated in both cell types treated with mimic versus scrambled (scr) control (Figure 1C). [score:1]
MiR-1 is reported to act as a tumour supressor, since restoration of mature miR-1 impairs endometrial cancer cell migration and invasion [21]. [score:1]
Regardless, miR-1 mimic significantly reduced cell viability in both HEC1A and AN3CA cells, in line with findings in other endometrial epithelial cell lines, including G1-derived HEC1B and G2-derived HEC265 [21]. [score:1]
Similarly, miR-1 was detected in primary human proliferative phase endometrial epithelial cells, but was undetectable in human endometial epithelial carcinoma cell lines (n = 3–4/group) (Figure 1B). [score:1]
In AN3CA cells, miR-1 mimic reduced cell proliferation and addition of IL11 to miR-1 mimic transfected cells restored AN3CA proliferation to control levels. [score:1]
Micro -RNA (miR-1) mimic transfection. [score:1]
HEC1A or AN3CA cells transfected with miR-1 mimic or scr control were seeded at a density of 10,000 cells per well in 96-well flat-bottom microplates (Costar, USA) 72 h after transfection. [score:1]
[1 to 20 of 29 sentences]
23
[+] score: 70
Cardiomyocyte-specific tamoxifen-inducible inactivation of the SRF gene (SRF [H KO]) results in downregulation of NCX1 mRNA and primary miR-1 expression, but the translation of both NCX1 and AnxA5 is upregulated due to the downregulation of mature miR-1. Ultimately, the upregulation of NCX1 and AnxA5 restricts intracellular Ca [2+] extrusion during heart failure. [score:17]
The serum-response factor (SRF) regulates the transcription of NCX1 and miR-1. Tritsch et al. reported that the SRF/miR-1 axis regulates the expression of NCX1 and annexin A5 (AnxA5), a Ca [2+] -binding protein that interacts with NCX1, and that miR-1 is directly suppressed by both NCX1 and AnxA5 [65]. [score:8]
The PP2A regulatory subunit B56α is another target of miR-1 and miR-133, and the inhibition of PP2A’s function via miR-1 overexpression induces hyperphosphorylation and activation of RyR2, which subsequently promotes Ca [2+] release from the SR, leading to abnormal Ca [2+] cycling, and increased cardiac arrhythmogenesis [67, 68]. [score:8]
Terentyev D. Belevych A. E. Terentyeva R. Martin M. M. Malana G. E. Kuhn D. E. Ab dellatif M. Feldman D. S. Elton T. S. Gyorke S. miR-1 overexpression enhances Ca [2+] release and promotes cardiac arrhythmogenesis by targeting PP2A regulatory subunit b56alpha and causing camkii -dependent hyperphosphorylation of RyR2 Circ. [score:6]
Both the overexpression and suppression of miR-1 have strong effects on Ca [2+] flux in cardiomyocytes. [score:5]
Shan H. Zhang Y. Cai B. Chen X. Fan Y. Yang L. Chen X. Liang H. Zhang Y. Song X. Upregulation of microRNA-1 and microRNA-133 contributes to arsenic -induced cardiac electrical remo deling Int. [score:4]
Ali et al. suggested that miR-1 had an indispensable role in cardiac contractility, in which tamoxifen -induced cardiac-specific Dicer knockout mice demonstrated a significant decrease of miR-1 expression among the examined cardiac-specific miRNAs [66]. [score:4]
Ali R. Huang Y. Maher S. E. Kim R. W. Giordano F. J. Tellides G. Geirsson A. miR-1 mediated suppression of sorcin regulates myocardial contractility through modulation of Ca [2+] signaling J. Mol. [score:4]
In the I/R-injured heart, cardiac-enriched miR-1 exacerbates cardiac injury and apoptosis, whereas oligonucleotides modified to act against miR-1 (e. g., LNA-antimiR-1 or loss-of-function miR-1) attenuate I/R injury by restoring protein kinase C ε (PKCε) and heat shock protein 60 (HSP60), which are targeted by miR-1 [64]. [score:3]
Kuwabara Y. Ono K. Horie T. Nishi H. Nagao K. Kinoshita M. Watanabe S. Baba O. Kojima Y. Shizuta S. Increased microRNA-1 and microRNA-133a levels in serum of patients with cardiovascular disease indicate myocardial damage Circ. [score:3]
Wystub K. Besser J. Bachmann A. Boettger T. Braun T. miR-1/133a clusters cooperatively specify the cardiomyogenic lineage by adjustment of myocardin levels during embryonic heart development PLoS Genet. [score:2]
Tritsch E. Mallat Y. Lefebvre F. Diguet N. Escoubet B. Blanc J. De Windt L. J. Catalucci D. Vandecasteele G. Li Z. An SRF/miR-1 axis regulates NCX1 and annexin A5 protein levels in the normal and failing heart Cardiovasc. [score:2]
3.2.2. miR-1. 3.2.3. miR-145. [score:1]
During the I/R injury, plasma levels of miR-1, miR-133a, miR-499-5p, and cardiac-specific miR-208b rapidly increase in both rodent mo dels and in human patients presenting with ST-elevation myocardial infarction (STEMI). [score:1]
Decreases in miR-1 are correlated with increases in Sorcin, which resides on RyR2 and is a modulator of both calcium signaling and EC-coupling. [score:1]
In addition, circulating miR-1, miR-133a, miR-328, miR-499, and miR-208b levels also increase in patients who present with acute myocardial infarction [82, 83]. [score:1]
[1 to 20 of 16 sentences]
24
[+] score: 63
RT-qPCR was performed on 5 differentially expressed miRNAs (3 upregulated: miR-466, miR-574-3p, miR-3613-3p; and 2 downregulated: miR-1, miR-26a-5p) to confirm the microarray data. [score:9]
The miRNAs hsa-miR-1 and hsa-miR-26a-5p were predicted by 5 target prediction databases; hsa-miR-574-3p was predicted from 4 target prediction databases, and hsa-miR-466 and hsa-miR-3613-3P were predicted from 2 target prediction databases (Table 3). [score:7]
Finally, we selected 5 miRNAs for further analysis: 3 were upregulated in the AF group relative to the NSR (hsa-miR-466, hsa-miR-574-3p, and hsa-miR-3613-3p), and 2 were downregulated (hsa-miR-1 and hsa-miR-26a-5p). [score:7]
However, Girmatsion et al. [27] reported that miR-1 was downregulated in human LAA tissue from AF patients (relative to patients without AF who also underwent mitral valve repair or bypass grafting), which is consistent with our finding that miR-1 was downregulated in human LAA tissues in MS patients with AF. [score:7]
According to the RT-qPCR data, hsa-miR-466, hsa-miR-574-3p, and hsa-miR-3613-3p were upregulated in the LAAs of the AF group relative to the NSR, while hsa-miR-1 and hsa-miR-26a-5p were downregulated. [score:7]
To determine the probable biological function of the differentially expressed miRNAs, we predicted the putative targets and pathways of 5 validated miRNAs (hsa-miR-1, hsa-miR-26a-5p, hsa-miR-466, hsa-miR-574-3p, and hsa-miR-3613-3p) using the miRFocus database. [score:5]
Spearman’s correlation analysis showed a positive correlation between the level of expression of miR-466 and LA size, and a negative correlation between the level of expression of miR-1 and miR-26a-5p with LA size. [score:5]
Another study indicated that miR-1 levels are greatly reduced in human AF, possibly contributing to upregulation of Kir2.1 subunits, leading to increased cardiac inward-rectifier potassium current I K1 [27]. [score:4]
Studies have shown that miRNAs may be involved directly or indirectly in AF by modulating atrial electrical remo deling (miR-1, miR-26, miR-328) [10, 27, 28] or structural remo deling (miR-30, miR-133, mir-590) [7, 30]. [score:3]
Our study found that the expression levels of three validated miRNAs (miR-1, miR-26a-5p, miR-466) correlated with LA size, while those of two others (miR-574-3p, miR-3613-3p) did not. [score:3]
One study showed that miR-1 overexpression slowed conduction and depolarized the cytoplasmic membrane by post-transcriptionally repressing KCNJ2 (potassium inwardly-rectifying channel, subfamily J, member 2; which encodes the K [+] channel subunit Kir2.1) and GJA1 (gap junction protein, alpha 1, 43 kDa; which encodes connexin 43), and this likely accounts at least in part for its arrhythmogenic potential [31]. [score:3]
Moreover, there was a significantly negative correlation between the levels of expression of miR-1 and miR-26a-5p in LAAs and LA size (r = –0.81; P = 0.002 and r = –0.86; P < 0.001, respectively). [score:3]
[1 to 20 of 12 sentences]
25
[+] score: 63
At the 14 days time point, WB showed that miRNA1 alone had no effect on both Cx43 and cTnT, miRNA133 increased only the expression of cTnT, while miRNA499 was able to markedly increase the expression of both Cx43 and cTnT (Fig. 3A). [score:5]
Consistently, the over -expression of miRNA1 in EB derived from human ESC can increase the expression of myosin heavy chain [33]. [score:5]
Recently, it has been suggested that certain miRNA are powerful regulators of cardiac differentiation processes [32], and it has been shown that miRNA1, miRNA133, and miRNA499 are highly expressed in muscle cells [32]. [score:4]
Moreover, miRNA1 is upregulated upon induction of cardiac differentiation in mouse and human ESC and in adult cardiac-derived progenitors [18, 19, 33]. [score:4]
The over -expression of miRNA1 alone or in association with miRNA499 failed to increase the expression level of the cardiac-specific differentiation markers considered. [score:4]
On the contrary, the coexpression of miRNA1 with miRNA499 did not increase the expression of the two cardiac-specific proteins compared with miRNA499 alone (Fig. 3A). [score:4]
It is currently unknown whether the concomitant over -expression of miRNA1, miRNA133, and miRNA499 or if the combination of two of these miRNA would result in a synergistic action, further increasing the efficiency of cardiac differentiation. [score:3]
01) (Fig. 2B), but had no effect on GATA4 (Fig. 2A), while miRNA1 triggered the expression of neither GATA4 nor Nkx2.5 (Fig. 2A, 2B). [score:3]
For example, loss- and gain-of-function studies documented that miRNA1 modulates cardiogenesis and muscle gene expression in Drosophila [20]. [score:3]
It has been shown that miRNA1 and miRNA133 are important regulators of embryonic stem cell (ESC) differentiation into CMC. [score:2]
Accordingly, we tested this hypothesis by over -expressing different combinations of miRNA1, 133, and 499 in P19 cells, which are considered an ideal mo del to study cardiac differentiation in vitro. [score:2]
At day 14, the over -expression of miRNA1 or miRNA133 alone or their combination did not increase the number of beating clusters compared with DMSO treatment (Fig. 1A). [score:2]
By simultaneously over -expressing miRNA499 and miRNA1, the number of beating EB significantly increased compared with: DMSO (+2.8-fold; p < . [score:2]
DMSO, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1; †, p < . [score:1]
After 4 days, the EB were transferred to plastic culture dishes in the presence of differentiation medium, and transfected with precursor molecules (pre-miRNA) for miRNA499 (PM11352, 10 nM), miRNA1 (PM10617, 10 nM), and miRNA133 (PM10413, 5 nM) in different combinations or with scrambled miRNA used as a negative CTRL (AM17110, 5 nM) (Supporting Information Table S1). [score:1]
Our results clearly showed that miRNA499 is a powerful activator of cardiac differentiation, particularly in comparison with miRNA1 and miRNA133. [score:1]
In particular, it has been clearly shown that miRNA133 and miRNA1 promote myoblast proliferation and differentiation, respectively, and that miRNA499 enhances the differentiation of cardiac progenitor cells into CMC [17– 20]. [score:1]
DMSO, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1, and p < . [score:1]
DMSO, scramble miRNA, miRNA1, and miRNA499 + 1). [score:1]
naïve, scramble miRNA, miRNA1, miRNA133, miRNA1 + 499 and p < . [score:1]
naïve, scramble miRNA, miRNA133, miRNA1 + 499 and p < . [score:1]
miRNA1 + 499; *, p < . [score:1]
naïve, scramble miRNA, miRNA1, miRNA133, and miRNA1 + 499; #, p < . [score:1]
Likewise, miRNA1 triggers the differentiation of cardiac progenitor cells [18]. [score:1]
DMSO, scramble miRNA, miRNA1, and miRNA499 + 1; #, p < . [score:1]
miRNA1 + 133, §, p < . [score:1]
miRNA1 and p < . [score:1]
001), miRNA1 (+2.5-fold; p < . [score:1]
Although miRNA1 and miRNA133 are cotranscribed, the function of miRNA133 is different from miRNA1. [score:1]
naïve, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1; †, p < . [score:1]
miRNA1; §, p < . [score:1]
miRNA precursors were diluted in Opti-MEM I medium at the following concentration: miRNA1 and miRNA499 precursors 10 nM, miRNA133 precursor and scrambled miRNA 5 nM. [score:1]
DMSO, miRNA1 and miRNA133; ‡, p < . [score:1]
[1 to 20 of 33 sentences]
26
[+] score: 60
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
In prostate gland cells, miR-1 is a candidate tumor suppressor and is frequently downregulated in various types of cancer (Hudson et al., 2012). [score:6]
MiR-1 downregulation cooperates with MACC1 in promoting MET overexpression in human colon cancer. [score:5]
Tumour suppressors miR-1 and miR-133a target the oncogenic function of purine nucleoside phosphorylase (PNP) in prostate cancer. [score:5]
MiR-1 is tumor suppressor in thyroid carcinogenesis targeting CCND2, CXCR4, and SDF-1alpha. [score:4]
This conclusion notwithstanding, there is a provocative association between top KEGG pathways in the brains of mice exposed to MAM and in human cancers, with suspicion falling heavily on a prominent role for at least one miRNA, namely miR-1. However, miRNAs are but one of at least three known mechanisms of epigenetic regulation, and there is no information on the possibility that MAM modulates brain gene expression via cytosine methylation or histone modification. [score:4]
The most significant scoring sub-network of these MAM-differentially expressed genes (p < 10 [-46]) contained hubs for F-actin, NF-κB, cofilin, calcium/calmodulin -dependent protein kinase II (CaMKII), glycogen synthase, the AMPA receptor, BDNF, and miR-1. There is a large literature on miR-1, much of which is focused on cardiac muscle function (Mishima et al., 2007). [score:3]
The most significant molecular networks derived from 362 MAM-triggered, differentially expressed genes revealed hubs involving NF-κB (nuclear factor of kappa light polypeptide gene enhancer in B-cells), calcium -binding proteins (i. e., calcineurin, calmodulin), brain-derived neurotrophic factor (BDNF), glutamate receptors N-methyl- d-aspartate (NMDA), and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA), cyclic AMP response element -binding factor (CREB), and miR-1 (Kisby et al., 2011a). [score:3]
MiR-1 also has an oncosuppressive role in breast, lung, thyroid, liver, renal, and colorectal cancer (Datta et al., 2008; Beltran et al., 2011; Leone et al., 2011; Kawakami et al., 2012; Kojima et al., 2012; Migliore et al., 2012), and, in the latter, this activity is silenced by miR-1 methylation (Suzuki et al., 2011). [score:3]
In support, miR-1 is altered in the colon of AOM -treated rats (Davidson et al., 2009) and was a prominent hub among the 362 genes that were differentially expressed in the brain of Mgmt [−/−] mice after systemic administration of MAM (Kisby et al., 2011a). [score:3]
In this rodent mo del, the expression of 27 miRNAs is significantly (>6-fold) increased (e. g., miR-1, miR-34a, 132, 223, and 224), while that of 19 miRNAs is reduced (<0.49-fold; e. g., miR-192, 194, 215, and 375) in the colon tumors (Davidson et al., 2009). [score:3]
Differential expression of microRNA-1 in dorsal root ganglion neurons. [score:3]
Available evidence suggests that miR-1 alters the cellular organization of F-actin, thereby inhibiting filopodia formation, cell motility, and tumor invasion. [score:3]
MiR-1 is present in nerve cells, at least in the peripheral nervous system (Bastian et al., 2011), and blood miR-1 expression has been used to distinguish normal subjects from patients with PD (Margis et al., 2011). [score:3]
The right-hand column shows the biological processes or signaling pathways potentially regulated by the miR-1/miR-133a cluster in human cancers examined by *Nohata et al. (2012). [score:2]
microRNA-1/133a and microRNA-206/133b clusters: dysregulation and functional roles in human cancers. [score:2]
Top MAM -associated KEGG pathways in mouse brain Genes Phenotype miR-1/miR- 133A-regulated in human cancers* Pathways in cancer 13 CC Yes Wnt signaling 10 AD, CC Yes Insulin signaling 9 AD, ALS Purine metabolism 9 Prostate cancer 8 CC MAPK signaling 7 AD, CC Yes Melanogenesis 6 PD? [score:2]
Most of these pathways have been implicated in AD and/or colon cancer (Kisby et al., 2011a) and, in a separate recent study, some (pathways in cancer, Wnt signaling, MAPK signaling, and calcium-pathway signaling) have been predicted to be regulated by miR-1/miR-133A (Table 2). [score:2]
The functional significance of miR-1 and miR-133a in renal cell carcinoma. [score:1]
Methylation mediated silencing of microRNA-1 gene and its role in hepatocellular carcinogenesis. [score:1]
Identification of miR-1 as a micro RNA that supports late-stage differentiation of growth cartilage cells. [score:1]
miR-1-2 gets to the heart of the matter. [score:1]
[1 to 20 of 21 sentences]
27
[+] score: 58
Other miRNAs from this paper: hsa-mir-1-1
BPEI was not studied further because it did not lead to a downregulation of target mRNA neither in SGBS preadipocytes nor in SGBS and primary adipocytes upon miR-1 mimic overexpression. [score:8]
Taken together, our results show that lipid -based si/miRNA transfection of adherent SGBS preadipocytes and adipocytes is highly efficient as demonstrated by the cytoplasmic localization of the fluorescent -labelled control siRNA and the downregulation of a specific target twf-1 in response to miR-1 overexpression. [score:8]
To asses the effect of miR-1 over -expression on its target mRNA, cells were transfected either using a non -targeting siRNA or a miR-1 mimic at a final concentration of 20 nM. [score:7]
Preadipocytes transfected with a non -targeting control siRNA or a miR-1 mimic (20 nM final concentration) were washed with PBS and harvested in a lysis buffer consisting of 10 mM Tris-HCl, 150 mM NaCl, 2 mM EDTA, 1% (v/v) Triton X-100, 10% (v/v) glycerol, 1 mM DTT and cOmplete Protease Inhibitor Cocktail from Roche. [score:5]
These results were reflected also on protein level as Western blotting analysis revealed a clear twf-1 protein knockdown in response to the Lipofectamine 2000 delivered miR-1 overexpression (Figure 4 B and C). [score:4]
0098023.g004 Figure 4 SGBS preadipocytes were transfected with nontargeting (NT) siRNA and a miR-1 mimic with Lipofectamine 2000 (LF2000), ScreenFect A (SFA) or BPEI 1.2 k as delivery agents. [score:3]
of the miR-1 mimic using ScreenFect A reduced twf-1 mRNA expression by approximately 20%. [score:3]
This result also confirmed that twf-1 is a target for miR-1 in adipocytes and provided us with an easily detectable positive control for further studies. [score:3]
Effect of miR-1 overexpression on protein level was assessed 48 hours post transfection. [score:3]
SGBS preadipocytes were transfected with nontargeting (NT) siRNA and a miR-1 mimic with Lipofectamine 2000 (LF2000), ScreenFect A (SFA) or BPEI 1.2 k as delivery agents. [score:3]
SGBS adipocytes (D) and primary human adipocytes (E) were transfected with NT siRNA and miR-1 mimic with LF2000, SFA or BPEI 1.2 k. The levels of miR-1 target twinfilin-1 (twf-1) mRNA were determined with real-time qPCR 48 hours post-transfection. [score:3]
We therefore performed a gene knockdown experiment where we tested the effect of increased cytoplasmic miR-1 abundance on the level of twf-1. After transfection with the miR-1 mimic (20 nM), the cells were incubated for 48 hours followed by total RNA extraction and reverse transcription reactions. [score:2]
miR-1 has been suggested to bind to the 3′-UTR of twinfilin-1 (twf-1) transcript and induce its mRNA degradation in human and mouse cells [17], [18]. [score:1]
Alexa Fluor 488 labelled, Alexa Fluor 647 labelled and the non -labelled control siRNAs as well as the miR-1 mimic were products of QIAGEN (Hilden, Germany). [score:1]
To test the applicability of the twf-1 gene knockdown assay in mature adipocytes we used the three delivery agents to transfect SGBS adipocytes and also ex vivo differentiated primary human adipocytes with the miR-1 mimic. [score:1]
miR-1, **p<0.0018 LF2000 vs. [score:1]
miR-1, ***p<0.0005 LF2000 vs. [score:1]
miR-1, ***p<0.0006 SFA siRNA NT vs. [score:1]
[1 to 20 of 18 sentences]
28
[+] score: 56
In cardiac and skeletal muscles, myogenic transcription factors MyoD, MEF2, and SRF drive the expression of miR1/206/133 clusters directly through upstream or intronic cis-regulatory elements [17]. [score:5]
The extent of growth inhibition exerted by miR-214mi was comparable to that by the mimic of miR-1, which is known to suppress RMS cell growth [41]. [score:5]
Indeed, dysregulation of microRNAs in RMS is a wide spread phenomenon for many specific microRNAs [26], and re -expression of miR-1/133a, miR-206, and miR-29 in RMS cells have been shown to induce myogenic differentiation and block xenograft tumorigenesis [22, 27]. [score:4]
6C, 6D), albeit miR-1 exhibited more potent activity in suppressing the anchorage-independent colony formation than miR-214. [score:3]
Pre-miR-1 for:TTGCGGCCGCAA GCTTGGGACACATACTTCTT Pre-miR-1 rev: GGTTTAAACC GCCTGAAATACATACTTCT Pre-miR-214 for: TTGCGGCCGCAA GGCCTGGCTGGACAGAGTT Pre-miR-214 rev: GGTTTAAACC AGGCTGGGTTGTCATGTGACT  FL-for: CTATGAAAATTTCAAAACAGT  FL-rev: GAATATAAGAATTATGACTAAGCC  S1-for: CTTCCACAGCACAAACAC  S1-rev: AACAAACCAAACAGCAAT  S2-for: GTTTAGTCTTTCACCATCC  S2-rev: GAAGCAGAACGCACCATT  S3-for: ATATCAGTACTTGAGGATTCAACCGT  S3-rev: ATTATGACTAAGCCAAGAA MicroRNA mimics and inhibitors were purchased from Dharmacon, Inc. [score:3]
So, despite both miR-1 and miR-214 are able to induce RD cells to undergo myogenic differentiation (Fig. 3D, 3E) and suppress their tumorigenic activities (Fig. 4A-4E), only miR-214 reached these outcomes through blocking N-ras. [score:3]
Moreover, the average sizes of miR-1 and miR-214 -expressing colonies were much smaller than that of the vector cells (Fig. 4A). [score:3]
For these purposes, we generated stable RD cells expressing pre-miR-214 or pre-miR-1 from the constitutive P2GM vector. [score:3]
On histological sections, xenograft tumors expressing pre-miR-1 or pre-miR-214 showed decreased staining for Ki67 but increased staining for MHC (Fig. 4F), suggesting a benign growth relative to the vector-bearing tumors. [score:3]
Stem-loop RT-PCR confirmed the ectopic expression of miR-1 and miR-214 in their respective tumors (Fig. 4G). [score:3]
After plating approximately 500 stably transfected cells in a 60 mm petri dish and culturing for 14 days, we observed about 68 colonies of RD cells carrying the P2GM vector, and below 40 colonies of RD cells expressing either miR-1 or miR-214 (Fig. 4A and 4B). [score:3]
Some of these microRNAs that exhibit specific patterns of muscle expression are dubbed “myomiRs”; these include members of the bicistronic miR-1/133a and miR206/133b families [20], and a group of microRNAs, namely miR-208, miR-208b, and miR-499, that are embedded in genes encoding the myosin heavy chain [21]. [score:3]
Pre-miR-1 for:TTGCGGCCGCAA GCTTGGGACACATACTTCTT Pre-miR-1 rev: GGTTTAAACC GCCTGAAATACATACTTCT Pre-miR-214 for: TTGCGGCCGCAA GGCCTGGCTGGACAGAGTT Pre-miR-214 rev: GGTTTAAACC AGGCTGGGTTGTCATGTGACT  FL-for: CTATGAAAATTTCAAAACAGT  FL-rev: GAATATAAGAATTATGACTAAGCC  S1-for: CTTCCACAGCACAAACAC  S1-rev: AACAAACCAAACAGCAAT  S2-for: GTTTAGTCTTTCACCATCC  S2-rev: GAAGCAGAACGCACCATT  S3-for: ATATCAGTACTTGAGGATTCAACCGT  S3-rev: ATTATGACTAAGCCAAGAA MicroRNA mimics and inhibitors were purchased from Dharmacon, Inc. [score:3]
Compared to the vector-bearing control RD cells, those that expressed pre-miR-1 or pre-miR-214 grew much slower (Fig. 4C, and 4D), and reached to smaller terminal sizes (Fig. 4E). [score:2]
When assayed for anchorage-independent growth in top agar plates, stable RD cells expressing pre-miR-1 or pre-miR-214 also formed fewer foci than the P2GM RD cells (Supplementary sFig. [score:2]
Human genomic DNA fragments containing pre-miR-1 or pre-miR-214 sequences were amplified by PCR and inserted at the NotI and PmeI site in the MSCV-P2Gm vector. [score:1]
Figure 2 (A) RT-PCR detection of miR-1, miR-133a, and miR-214 in RD and Rh30 cells, as well as in normal skeletal muscles (SKM). [score:1]
In the presence of 10% FBS, RD cells did not undergo apoptosis and neither miR-1 nor miR-214 were able to induce such (Fig. 3C). [score:1]
Figure 6 (A) IHC staining of N-ras in xenograft tumors derived from RD stable cells carrying P2GM, P2GM-miR-1, and P2GM-miR-214 constructs. [score:1]
Several studies reported decreased levels of miR-1, miR-206, and miR-133a in primary RMS tumor samples and cell lines [27, 41]. [score:1]
The levels of muscle specific miR-1 and miR-133a also decreased in RD and Rh30 cells in accordance with the oncogenic transformation, although the level of miR-206 did not show significant change (Fig. 2A). [score:1]
For generating the stable cell lines, P2GM, P2GM-miR-1(P-1) or P2GM-miR-214(P-214) plasmids were transfected into RD cells using Lipofectamie according to the manufacturer's procedure (Invitrogen). [score:1]
Figure 4 (A) 500 stable RD cells carrying constitutive P2Gm vector, P2Gm-miR-1, or P2Gm-miR-214 were cultured in 60 mm petri dishes in the presence of 10 μg/ml puromycin for 14 days. [score:1]
[1 to 20 of 23 sentences]
29
[+] score: 55
Our data identified miR-19b as a critical miRNA which was significantly upregulated and could synergize with miR-1 to control the expression of GJA1 protein in the development of VMC. [score:7]
These consistent data obtained from HL-1 cells and hiPSCs-CMs strengthened the notion that miR-19b could cooperate with miR-1 to down-regulate the GJA1 expression. [score:6]
Our previous study has found that miR-1 could suppress the GJA1 expression in VMC in the same way as miR-19b did [14]. [score:5]
Yang B. Lin H. Xiao J. Lu Y. Luo X. Li B. Zhang Y. Xu C. Bai Y. Wang H. Chen G. Wang Z. The muscle-specific microRNA miR-1 regulates cardiac arrhythmogenic potential by targeting GJA1 and KCNJ2 Nat. [score:4]
2.7. miR-19b Cooperated with miR-1 to Regulate the GJA1 Expression. [score:4]
A previous study showed that miR-1 regulated cardiac arrhythmogenic potential by targeting GJA1 and KCNJ2 [10]. [score:4]
Yang B et al. showed that miR-1 regulates cardiac arrhythmogenic potential by targeting GJA1 and KCNJ2 [10]. [score:4]
Our previous study also demonstrated that miR-1 was able to decrease the expression of GJA1 in VMC [14]. [score:3]
MiR-1 shared a similar expression tendency with miR-19b during the progression of VMC (Figure 5B). [score:3]
And miR-19b could cooperate with miR-1 to diminish the GJA1 expression in a dose -dependent manner. [score:3]
The present study found that miR-19b could cooperate with miR-1 to diminish the GJA1 expression in a dose -dependent manner. [score:3]
Xu H. F. Ding Y. J. Shen Y. W. Xue A. M. Xu H. M. Luo C. L. Li B. X. Liu Y. L. Zhao Z. Q. MicroRNA-1 represses Cx43 expression in viral myocarditis Mol. [score:2]
Our previous study also found that miR-1 was involved in VMC via post-transcriptional repression of GJA1 [14], and miR-21 regulated the progression of VMC to dilated cardiomyopathy (DCM) [28]. [score:2]
Our previous work also showed that GJA1 could be post-transcriptionally regulated by miR-1 in VMC [14]. [score:2]
Therefore, we assumed that miR-19b could interact with miR-1 in VMC. [score:1]
Figure S1: Transfection efficiency of miR-19b and miR-1 in iPSCs-CMs and HL-1 cells. [score:1]
Analysis of the 3’-UTR of GJA1 mRNA revealed that the two binding sites of miR-1 were adjacent to that of miR-19b (Figure 5A). [score:1]
[1 to 20 of 17 sentences]
30
[+] score: 55
Colorectal cancer pathway with interaction between significant up-regulated miRNAs, let-7f-5p, miR-455-3p, miR-98, miR-155-5p, and down-regulated miRNAs, miR-1, miR-127-5p, miR-142-5p, miR-202-5p after radiation and SN38 treatments and their target genes. [score:9]
Moreover, from EBarrays, we found miRNAs, such as let-7f-5p, miR-455-3p, miR-98, miR-155-5p, up-regulated to the highest degree and miRNAs, miR-1, miR-127-5p, miR-142-5p, miR-202-5p were down-regulated most, after the radiation and SN38 treatment. [score:7]
Heatmap of four most significant up-regulated miRNA, let-7f-5p, miR-455-3p, miR-98 and miR-155-5p, as well as four most down-regulated miRNA, miR-1, miR-127-5p, miR-142-5p and miR-202-5p after radiation and SN38 treatments, and different pathways by clustering from pathway union. [score:7]
miR-1 was down-regulated after radiation and SN38 treatment in HCT116 [p53+/+] and HCT116 [p53−/−] cells most significantly (undetected) but after SN38 treatment in HCT116 [p53+/−] cells it was marginally up-regulated. [score:7]
We also found in KM12C and KM12L4a cells with p53 mutation, let-7f-5p, miR-455-3p, miR-98, miR-155-5p and miRNAs were up-regulated, whereas miR-1, miR-127-5p, miR-142-5p and miR-202-5p remained undetected after the radiation and SN38 treatment. [score:5]
In summary, after radiation and SN38 treatment, we found that most significant up- or down-regulation and interactions of 8 miRNAs (let-7f-5p, miR-455-3p, miR-98, miR-155-5p, miR-1, miR-127-5p, miR-142-5p, miR-202-5p), 7 cytokines (IL-1β, IL-4, IL-6, IL-10, IFN- γ, VEGF, TNF- α) and 2 chemokines (IL-8, MIP-1-α) were dependent on p53 status in colon cancer cells. [score:4]
The results showed that let-7f-5p, miR-455-3p, miR-98 and miR-155-5p were up-regulated in KM12C (Supplementary Figure S1) and KM12L4a (Supplementary Figure S2) cell lines after radiation and SN38 treatment, whereas miR-1, miR-127-5p, miR-142-5p and miR-202-5p were undetected in KM12C and KM12L4a cell lines after radiation and SN38 treatment. [score:4]
mir-1 was down-regulated after the radiation and SN38 treatment in HCT116 [p53+/−] and HCT116 [p53−/−] cells. [score:4]
miR-1: An interaction site of miR-1 is reported in IL-10 by DIANA-microT, while TargetScan, PicTar, RNA22, miRanda, and DIANA-microT recognize multiple probable interactions between VEGF and has-miR-1. miR-127-5p: RNA 22 predicts multiple site interaction between miR-127-5p and IL-1beta. [score:3]
To validate our results found in HCT116 cells, we further examined the expression of miRNAs, let-7f-5p, miR-455-3p, miR-98, miR-155-5p, miR-1, miR-127-5p, miR-142-5p and miR-202-5p in KM12C and KM12L4a human colon cancer cell lines. [score:3]
Deregulation of miR-1 is also reported earlier in CRC [45]. [score:2]
[1 to 20 of 11 sentences]
31
[+] score: 54
Profiling of human DMD patient myoblasts confirmed the dysregulation of miR-1, but also found a significant dysregulation in the expression of miR-29a both of which regulate a Dystrophin-nNOS-Hdac2 pathway [33]. [score:6]
For example, phosphorodiamidate morpholino oligonucleotide (PMO) -mediated dystrophin restoration therapy in mdx mice was able to correct the dysregulation of the myomiRs (miR-1, -133a/b, -206) to normal wild type levels in mouse serum indicating the dynamic nature of microRNA expression in neuromuscular disease [34]. [score:6]
Full transcriptome analysis of microRNAs dysregulated in FSHD myoblasts and serum from FSHD patients revealed a significant increase in expression of the muscle myomiRs (miR-1, miR-133a/b, miR-206) along with significant dysregulation of several other microRNAs [63, 64] (Table 1). [score:5]
MyomiRs (a term coined by combining myo/muscle and miR/microRNA) was used to originally describe three microRNAs (miR-1, miR-133a/b, and miR-206) that showed enriched expression in heart and skeletal muscles; but has since expanded from its original definition to include several additional microRNAs that are strongly expressed in muscle lineages [31, 32]. [score:5]
Another recent study of serum obtained from DMD boys demonstrated that in addition to the three myomiRs (miR-1, miR-133a/b, and miR-206) being increased in expression, two other muscle-enriched microRNAs, miR-208b and miR-499 were also increased in expression [37] (Table 1). [score:5]
Interestingly, in the hearts of DM1 and DM2 patients the pri-miR-1 stem loop expression level increases in overall expression; however, the mature miR-1 sequence is overall reduced in comparison with unaffected patient hearts [80]. [score:5]
Compound deletions of miR-1-1/miR-133a-2 and miR-1-2/miR-133a-1, which in mammals are clustered and transcribed at the same genomic locus, revealed a role for these microRNAs as a regulator of smooth muscle gene transcription via suppression of the SRF cofactor myocardin [44]. [score:4]
MicroRNA expression profiling of the serum from the dystrophic CXMDJ canine dystrophin -deficient mo del also showed a dysregulation of miR-1, miR-133a, and miR-206 [36]. [score:4]
Follow-up studies in muscles of dystrophin -deficient mdx mice demonstrated that many microRNAs that regulate nNOS signaling, with a particular dysregulation of miR-1, miR-133a/b, and miR-206 (also referred to as “myomiRs”), were significantly altered by the loss of a functional dystrophin protein [29, 30]. [score:3]
Global loss of both copies of miR-1 (miR-1-1 and miR-1-2) in mice revealed an essential function for miR-1 in postnatal cardiac conduction function, sarcomere formation, and activation of smooth muscle gene expression [41, 42]. [score:3]
The authors of the study showing decreased levels of miR-1 in DM1 and DM2 patient hearts (despite increased levels of pri-miR-1) demonstrate that miR-1 biogenesis is significantly altered due to the muscleblind protein (MBNL1) sequestration in the nucleus and dysregulation of microRNA interacting RNA -binding factors [80]. [score:2]
Conversely, mature miR-1 is significantly increased in expression levels in DM1 patient primary myoblast cell lines when compared to unaffected control patient myoblast [76] (Table 1). [score:2]
These microRNAs (miR-1, miR-133a/b, and miR-206) were first given the classification as “dystromiRs” as potential diagnostic markers due to their dysregulation in dystrophin -deficient mdx mouse and human DMD patient skeletal muscles [17]. [score:2]
Additionally, a naturally-occurring SNP mutation in the 3'UTR of the Myostatin (GDF8) gene generated a novel miR-1/206 binding site resulting in both a dramatic decrease in myostatin protein and a consequential increase in muscle size [104]. [score:2]
[1 to 20 of 14 sentences]
32
[+] score: 54
Furthermore, miRNA-1 and miRNA-133 genes are direct transcriptional targets of muscle differentiation regulators including serum response factor, MyoD or Mef2, suggesting a common set of regulatory elements that control cardiac and skeletal muscle development [41, 42]. [score:7]
Muscle-specific miRNAs, miRNA-1 and miRNA-133 in addition to their role in cardiac development have been shown to be significantly up-regulated in ischaemic injury in the heart in both rodents and humans [75, 80, 81]. [score:5]
A recent study has shown that hyperglycemia augmented expression of miRNA-1 and miRNA-133 in human cardiac progenitor cells associated with suppressed KCNE1 and KCNQ1 and significant reduction in the functional I [Ks] current [91]. [score:5]
Zhao et al. (2007) [31] showed that miRNA biogenesis in the mouse heart is essential for cardiogenesis and that targeted deletion of muscle-specific miRNA, miRNA-1-2, revealed numerous functions in the heart, including regulation of cardiac growth and differentiation, electrical conduction, and cell-cycle control through modulation of transcription factors like Irx4, Hrt2, Hand1 and Gata6. [score:4]
Jayawardena et al. (2012) [107] demonstrated that miRNA-1 is sufficient to induce reprogramming of fibroblast into cardiomyocytes, however, the efficiency was significantly enhanced by adding miRNAs-133, -208 and -499 and JAK inhibitor I. Importantly, administration of these miRNAs into ischemic mouse myocardium resulted in evidence of direct conversion of cardiac fibroblasts to cardiomyocytes in situ [107]. [score:4]
Yang B. Lin H. Xiao J. Lu Y. Luo X. Li B. Zhang Y. Xu C. Bai Y. Wang H. The muscle-specific microRNA miR-1 regulates cardiac arrhythmogenic potential by targeting GJA1 and KCNJ2 Nat. [score:4]
The expression of miRNA-1 and miRNA-133a is cardiac and skeletal-muscle specific. [score:3]
These studies indicate that miRNAs, miRNA-208, miRNA-23a, miRNA-24, miRNA-125, miRNA-21, miRNA-129, miRNA-195, miRNA-199, and miRNA-212 are frequently increased in response to cardiac hypertrophy, whereas, miRNA-29, miRNA-1, miRNA-30, miRNA-133, and miRNA-150 expression are often found to be decreased. [score:3]
Ikeda S. He A. Kong S. W. Lu J. Bejar R. Bodyak N. Lee K. H. Ma Q. Kang P. M. Golub T. R. MicroRNA-1 negatively regulates expression of the hypertrophy -associated calmodulin and Mef2a genes Mol. [score:3]
Over -expression of miRNA-1, in normal or infarcted rat hearts, slowed conduction and depolarized the cytoplasmic membrane by post-transcriptionally repressing KCNJ2 (which encodes the K [+] channel subunit Kir2.1) and GJA1 (which encodes connexin 43), and therefore exacerbates arrhythmogenesis [75]. [score:3]
Recent analysis identified miRNAs expressed in undifferentiated mouse embryonic stem cells and differentiating cardiomyocytes and found increased level of miRNA-1, miRNA-18, miRNA-20, miRNA-23b, miRNA-24, miRNA-26a, miRNA-30c, miRNA-133, miRNA-143, miRNA-182, miRNA-183, miRNA-200a/b, miRNA-292-3p, miRNA-293, miRNA-295 and miRNA-335 in mice [14, 45]. [score:3]
Furthermore, addition of miRNA-1 and miRNA-133 antagomirs diminished the inhibitory effect of high glucose on KCNE1 and KCNQ1 and restored the potassium current I [Ks] [92]. [score:3]
McCarthy J. J. Esser K. A. MicroRNA-1 and microRNA-133a expression are decreased during skeletal muscle hypertrophy J. Appl. [score:3]
Li Y. Yang C. M. Xi Y. Wu G. Shelat H. Gao S. Cheng J. Geng Y. J. MicroRNA-1/133 targeted dysfunction of potassium channels KCNE1 and KCNQ1 in human cardiac progenitor cells with simulated hyperglycemia Int. [score:2]
He B. Xiao J. Ren A. J. Zhang Y. F. Zhang H. Chen M. Xie B. Gao X. G. Wang Y. W. Role of miR-1 and miR-133a in myocardial ischemic postconditioning J. Biomed. [score:1]
Interestingly, muscle specific miRNA, miRNA-1 showed a moderate negative correlation with fractional shortening, whereas miR-133a was positively related to the thickness of the intraventricular septal wall [54]. [score:1]
[1 to 20 of 16 sentences]
33
[+] score: 46
miRNA Protein target(s) Regulatory Action Clinical Implications miR-1 LXRα*Directly suppresses LXR in vitro May promote an increase in cellular cholesterol[38] miR-9 ACAT1* Directly suppresses ACAT1 and esterification of cholesterol in macrophages Overexpression may promote macrophage cholesterol efflux and reduce foam cell formation[47] miR-10b ABCA1* ABCG1* Directly represses ABCA1 and ABCG1 expression and decreases macrophage cholesterol efflux Can be suppressed by dietary anthocyanins, leading to increased macrophage cholesterol efflux and lesion regression[63] miR-19b ABCA1* Directly suppresses ABCA1 and decreases cholesterol efflux to ApoA1; increases atherosclerotic lesion area and severity Inhibition may increase macrophage ABCA1, promoting cholesterol efflux and lesion regression[53] miR-26 ABCA1* ARL7 Activated by LXR to suppress both proteins, decreasing macrophage cholesterol efflux Inhibition may increase macrophage ABCA1, promoting cholesterol efflux and lesion regression[58] miR-27a/b ABCA1* ABCG1 ACAT1* CD36 LPL* Directly suppresses ABCA1, indirectly suppresses ABCG1, and reduces cholesterol efflux. [score:32]
This particular study examined only downstream genes involved in regulation of lipogenesis, but as LXR is a known regulator of cholesterol-related genes, miR-1 and miR-206 may also be involved in regulation of cholesterol homeostasis through their ability to suppress LXRα and, subsequently, downstream target genes involved in cholesterol synthesis, transport, and uptake (Figure 1a). [score:8]
Zhong D. Huang G. Zhang Y. Zeng Y. Xu Z. Zhao Y. He X. He F. MicroRNA-1 and microRNA-206 suppress LXRα -induced lipogenesis in hepatocytes Cell. [score:3]
MiR-1 and miR-206 were also recently shown to suppress LXRα in vitro [38]. [score:3]
[1 to 20 of 4 sentences]
34
[+] score: 46
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Thus, miRNA families (e. g., miR-1 and miR-122) that are specifically or highly expressed in any one of the 3 tissues, or miRNAs that are expressed ubiquitously (e. g., let-7 and miR-26) in all 3 tissues, show a far greater frequency than other miRNAs. [score:5]
These two miRNA genes – miR-1 and miR-133 – exist as a cluster and thus are always expressed together in mouse [42]. [score:3]
In agreement with this observation, miR-1 is the most abundantly expressed miRNA in the heart but not in the liver or thymus (Figure 3), two other tissues used for miRNA library generation. [score:3]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
The expression patterns of miR-1 and miR-133 largely overlapped in many tissues examined in this study (Figure 2). [score:3]
Thus, the high abundance of miR-1 as indicated by the number of sequence reads is associated with its high expression in the heart. [score:3]
Our small RNA blot analysis indicated that miR-1 was highly expressed in the heart but moderately in the stomach, testes, bladder and spleen (Figure 2). [score:3]
For instance, the miR-1 family has the highest frequency (411 times) in our sequences (Table 2) and the highest level of expression in the heart, but was barely detected in thymus and liver (Figure 2). [score:3]
Like miR-1, miR-133 is a muscle-specific miRNA (Figure 2) because of its abundant expression in many other muscular tissues such as heart and skeletal muscle [45, 46]. [score:3]
miR-1 is one of the highly conserved miRNAs and found to be abundantly and specifically expressed in the heart and other muscular tissues [41, 42]. [score:3]
Additionally, miR-1 and miR-133 in the heart, miR-181a and miR-142-3p in the thymus, miR-194 in the liver, and miR-143 in the stomach showed the highest levels of expression. [score:3]
For instance, miR-133 is represented only by 4 clones (two reads each for 133a and 133b) in our sequences, which indicates a 100-fold lower expression level compared with that of miR-1 family, if cloning frequency taken as a measure of expression. [score:2]
The miR-1 family is represented by three members (miR-1a, miR-1b and miR-1c) in diverse animals (miRBase). [score:1]
miR-1 was barely detected in the liver, with only trace amounts in the thymus (Figure 2). [score:1]
Therefore the total miR-1 count in our sequences could be derived largely from heart tissue. [score:1]
Our sequence analysis in this study indicated that miR-1 family (miR-1a, miR-1b and miR-1c) has the highest abundance (411 sequence reads). [score:1]
The discrepancies between the cloning frequency and small RNA blot results for miRNA-1 and miR-133 could not be attributed to the RNA source because the same RNA samples were used for both experiments (cloning and small RNA blot analysis). [score:1]
The high level of miR-1 in the pig heart is in agreement with previous reports [43, 44]. [score:1]
However, our small RNA blot analysis indicated a different picture as miR-133 was detected as abundantly as miR-1 in the heart (Figure 2). [score:1]
We cannot ascertain whether the miR-1 family is also represented by three members in pig because of the lack of complete genome information, but is possible because we found miR-1a, miR-1b and miR-1c homologs in our library (Table 2). [score:1]
We also used approximately a similar amount (activity) of [32]P -labelled probe for detection of miR-1 and miR-133. [score:1]
[1 to 20 of 21 sentences]
35
[+] score: 45
Interestingly, whereas these 4 miRNAs are dramatically up-regulated during myoblasts differentiation [24], they do not have the same expression profile during human muscle development: miR-1 progressively increased during development, miR-133a/miR-133b were highly expressed from 16 weeks of development until birth and miR-206 was expressed at a similar level at all development stages studied (Fig. 1). [score:14]
The different expression patterns of miR-206 and miR-1 observed during human fetal muscle development suggests a more complex regulation of their expression. [score:7]
During the regulation of skeletal muscle development, miR-1 and miR-206 share similar functions, such as their seed sequences, target genes, and muscle-specific expression patterns. [score:7]
This suggests that the D4Z4 contraction does not impact myomiR expression, unlike in Duchenne Muscular Dystrophy (DMD) where miR-1, miR-133a, and miR-206 were highly abundant in the serum of DMD patients but down-regulated in muscle [29, 30]. [score:6]
However, during the regulation of myogenesis, miR-1 has more regulatory functions when compared with miR-206 since it has more target genes that are able to influence differentiation [27]. [score:4]
Moreover, it has been demonstrated that MyoD and myogenin bind to regions upstream of miR-1 and miR-206, inducing their expression [28]. [score:3]
In contrast, miR-1, miR-299–5p, miR-381, miR-193b* and let-7a seem to be more associated with the third phase of muscle development, the volumetric growth and maturation of the muscle fibers (Stg3, Fig. 3B). [score:2]
In muscle cell cultures, miR-1 and miR-206 promote muscle cell differentiation, whereas miR-133 promotes myoblast proliferation [25]. [score:1]
The best-studied myomiRs are the miR-1/miR-206 and miR-133a/miR133-b families. [score:1]
[1 to 20 of 9 sentences]
36
[+] score: 43
Among three selected targets for mosquito-specific miRNAs that were inserted into the 3’NCR of DEN4 genome, the presence of a target for the highly expressed miRNAs in mosquito cells Aag2 or C [7]10 (mir-184 and mir-275) reduced DEN4 replication to a greater extent than the inclusion of a target for the less expressed mir-1 miRNA (Figs 2 and S1) [37]. [score:11]
Based on this data, three mosquito-specific miRNAs (mir-184, mir-275 and mir-1) were selected for DEN4 genome targeting because they satisfy the following criteria: 1) they are highly expressed in different mosquito organs and mosquito-derived cell lines, and also remain abundant during flaviviruses infection [37]; 2) these miRNAs are evolutionarily conserved among insect species including mosquitoes, but they are different from their miRNA analogs in mammals. [score:5]
Positions of miRNA targets for brain-expressed mir-124 and mosquito-specific mir-1, mir-184, or mir-275 in the ORF and 3’NCR of DEN4 genome are indicated by blue and red boxes, respectively. [score:5]
Target sequences for mosquito specific mir-1 (5’-CTCCATACTTCTTTACATTCCA-3’), mir-184 (5’-GCCCTTATCAGTTCTCCGTCCA-3’) and mir-275 (5’-GCGCTACTTCAGGTACCTGA-3’) or human brain-specific mir-124 (5’-GGCATTCACCGCGTGCCTTA-3’) were introduced into the 3’NCR of DEN4 genome between nts 10,277 and 10,278 (position 1, Fig 1) or 10,474 and 10,475 (position 2, Fig 1); these sites of target insertion are located 15 or 212 nts downstream of the TAA stop codon in the 3’NCR, respectively. [score:5]
1004852.g001 Fig 1 Positions of miRNA targets for brain-expressed mir-124 and mosquito-specific mir-1, mir-184, or mir-275 in the ORF and 3’NCR of DEN4 genome are indicated by blue and red boxes, respectively. [score:5]
S1 FigRelative expression of mir-184 (A), mir-275 (B), mir-1 (C) in cell cultures, adult A. aegypti mosquitos, and new-born mouse brains. [score:3]
To investigate if miRNA targeting of DEN4 genome results in selective restriction of DEN4 replication in mosquitoes, a single copy of mir-184, mir-275, or mir-1 target sequence was introduced into the genome of DEN4 strain 814669 [40] (abbreviated D4s) between nucleotides (nts) 10277 and 10278 (15 nts downstream of the TAA stop codon preceding the 3’NCR). [score:3]
Relative expression of mir-184 (A), mir-275 (B), mir-1 (C) in cell cultures, adult A. aegypti mosquitos, and new-born mouse brains. [score:3]
Ribo-oligonucleotides for artificial mir-184 (5’UGGACGGAGAACUGAUAAGGGC), mir-275 (5’UCAGGUACCUGAAGUAGCGC), and mir-1 (5’UGGAAUGUAAAGAAGUAUGGAG3’) were synthesized by Integrated DNA Technologies, and were used in northern blot as positive controls and molecular weight standards. [score:1]
For each line 14 μg of total RNA was used in northern blot analysis and then hybridized with biotinylated probes complementary to mir-184 (A), mir-275 (B), and mir-1 (C). [score:1]
The biotinylated probes complementary to mir-184 (5’Biotin-GCCCTTATCAGTTCTCCGTCCA-Biotin3’), mir-275 (5’Biotin-GCGCTACTTCAGGTACCTGA-Biotin3’), and mir-1 (5’Biotin-CTCCATACTTCTTTACATTCCA-Biotin3’) were synthesized by Bioresearch Technologies and used at 2–10 ng/mL. [score:1]
[1 to 20 of 11 sentences]
37
[+] score: 43
In order to validate PCR-array results, we evaluated the expression of some target genes belonging to the most differentially expressed miRNAs (VEGF-A, PKCε, MMP9 and NOD2 as targets of miR-205-3p, miR-1, miR-133b and miR-122-5p, respectively). [score:7]
Similarly, Xu et al. showed that overexpression of miR-1 in HT-29 and Caco2 cells suppressed aerobic glycolysis by targeting Smad3, a critical protein for HIF-1α signaling, causing a reduction in proliferation [116]. [score:7]
MiR-1 is abundantly expressed in cardiac and skeletal muscle tissue [112] and its expression is down-regulated in several solid cancers: testes, colon, lung, ovary, lymphoma and prostate [113]. [score:7]
Nevertheless, PKCε was validated as a target of miR-1 in cardiac ischemia (in mouse mo del) [55], therefore, it is plausible that miR-1 could be targeting different mRNAs in colorectal cancer. [score:5]
In HT-29 and HTC-116 colorectal cancer cells, miR-1 acts as a tumor suppressor, reducing proliferation and migration by targeting the c- MET oncogene (Hepatocyte growth factor receptor) [114], a member of the MAPK pathway [115]. [score:5]
Furthermore, transfection with miR-1 in cardiomyocytes induces apoptosis by targeting the anti-apoptotic protein Bcl-2 [117]. [score:3]
Interestingly, only one miRNA (miR-1) was deregulated to both radiation doses (0.6 and 12 Gy), indicating that most of miRNAs levels studied are IR dose -dependent (Figure 5C). [score:2]
When compared to the control group, five differentially expressed miRNAs (adjusted P < 0.05) were identified in cells IR with 0.6 Gy, of which three were augmented (miR-205-3p, miR-1 and miR-133b) and two diminished (miR-122-5p and miR-134-5p) (Figure 5A and Table 1). [score:2]
Figure 6mRNAs targeted by: (A) MiR-205-3p (VEGFA), (B) miR-1 (PKCε), (C) miR-133b (MMP9) and (D) miR-1225p (NOD2), were evaluated by RTqPCR in DLD-1 cells, 48 h after irradiation with 0 (Control), 0.6 and 12 Gy. [score:1]
Interestingly, miR-1 was the only miRNA that significantly increased at both 0.6 and 12 Gy IR doses. [score:1]
On the other hand, only 4 miRNAs were differentially incremented (miR-512-5p, miR-218-5p, miR-449a and miR-1) with no differentially decreased miRNAs in cells exposed to 12 Gy (Figure 5B and Table 2). [score:1]
All this data suggests that, in DLD-1 cells, miR-1 may be inducing apoptosis in response to low and high-dose radiation. [score:1]
mRNAs targeted by: (A) MiR-205-3p (VEGFA), (B) miR-1 (PKCε), (C) miR-133b (MMP9) and (D) miR-1225p (NOD2), were evaluated by RTqPCR in DLD-1 cells, 48 h after irradiation with 0 (Control), 0.6 and 12 Gy. [score:1]
[1 to 20 of 13 sentences]
38
[+] score: 39
A large body of evidence has demonstrated that miR-1 is also involved in cardiac hypertrophy, a leading cause of HF, and overexpression of miR-1 inhibits hypertrophic growth of cardiomyocytes [39]. [score:5]
Red, green and yellow nodes represent proteins that are encoded by gene targeted by miR-1, miR-21 and both of them, respectively. [score:3]
In addition, co-transfection of miR-1 and miR-21 also significantly reduced isoproterenol -induced gene expression of ANP, BNP and β-MHC (Figure 4D–F), but obvious synergy was only displayed on BNP, a heart failure biomarker [28]. [score:3]
0063342.g006 Figure 6Red, green and yellow nodes represent proteins that are encoded by gene targeted by miR-1, miR-21 and both of them, respectively. [score:3]
For example, miRNAs miR-1 and miR-21 co-regulate only a small number of genes (TSS = 0.067); however, they jointly participate in more than 30 GO terms in biological processes. [score:2]
Fibrosis-related network of functional protein association that is regulated by miR-1 and miR-21. [score:2]
Besides significant antiapoptotic and antihypertrophic effects, co-transfection of miR-1 and miR-21 also drastically alleviated oxidative stress caused by H [2]O [2] but remarkably exacerbated myocardial fibrosis. [score:1]
A very high synergy score value of 2.153 was calculated for the miRNA pair miR-1:miR-21, when only HF -associated target genes were incorporated into computation. [score:1]
A. Heatmap of recovery rate of cell viability at different transfection concentration ratios of miR-1 and miR-21. [score:1]
CMs and CFs were transfected with miR-1, miR-21, negative control (NC) siRNAs, or miR-1 and miR-21 together using X-treme GENE siRNA transfection reagent (Roche, Switzerland). [score:1]
This result was consistent with the significantly promoted fibrosis through miR-1 and miR-21 co-transfection (Figure 4G). [score:1]
There are increasing lines of evidence suggesting that miR-1 might play vital roles in MI, providing the functional links between miR-1 and MI [36]– [38]. [score:1]
This may explain broad synergistic actions afforded by miR-1 and miR-21 (Figure 4). [score:1]
Consistently, gene ontology (GO) analysis revealed that miR-1 and miR-21 were simultaneously implicated in more than 30 GO processes. [score:1]
from our in vivo experiments validated that co-transfection of miR-1 and miR-21 significantly ameliorated H [2]O [2] -induced myocardial apoptosis and oxidative stress (Figure 4A–C). [score:1]
The miR-1:miR-21 miRNA pair was assigned with the highest synergy score among the 4851 random miRNA-miRNA combinations for MI, implying potent synergy (Table S9). [score:1]
Intensive functional protein association can explain this better (PIS [miR-1:miR-21] = 1.542). [score:1]
However, co-transfection of miR-1 and miR-21 elicited a remarkable anti-apoptosis effect, strongly suggesting a potent synergy (p<0.01). [score:1]
With fibrosis-related genes being retrieved from the Gene Prospector online tool [14], a high synergy score of miR-1 and miR-21 was obtained which strongly indicates a potential synergistic action of these two miRNAs in cardiac fibrosis (Figure 6). [score:1]
Apart from the miRNA pair miR-1 and miR-21, more miRNA pairs showed synergistic anti-apoptosis against H [2]O [2] -induced myocardial cell injury when co -transfected at 40 nM. [score:1]
Figure S9 Validation of miR-1 (A) and miR-21 (B) transfection in neonatal rat ventricular cardiomyocytes and cardiac fibroblasts. [score:1]
We found that despite that transfection of miR-1 alone failed to affect the collagen content in angiotensin II -treated fibroblasts, significant synergy was still detected when miR-21 was co -transfected with miR-1 (Figure 4G). [score:1]
Transfection concentrations were 50 nM for miR-1, miR-21 and NC siRNAs. [score:1]
Experimental results of synergistic actions of miR-1 and miR-21. [score:1]
For example, miR-1 and miR-21 are located at human chromosome 20 and 17, respectively. [score:1]
TSS [miR-1:miR-21] = 0.169; PIS [miR-:miR-21] = 1.029; synergy score [miR-1:miR-21] = 2.021. [score:1]
Notably, miR-1 was found to act synergistically with miR-21 on cell apoptosis as synergy score confidently predicted. [score:1]
[1 to 20 of 27 sentences]
39
[+] score: 38
Since NRF2 is found to be upregulated in both colorectal and hepatocellular carcinoma and miR-1 is inhibited then this forms the hypothesis that NRF2 could be linked to high c-MET expression in these diseases. [score:10]
As expected both miRNA are downregulated in a range of cancers, for example miR-1 is downregulated in hepatocellular carcinoma and colorectal cancer [77, 78], while miR-206 is downregulated in gastric and breast cancer [79, 80]. [score:10]
Mir-1 and its paralog miR-206 are tumor suppressor miRs which are indirectly regulated by NRF2 via HDAC4. [score:5]
Interestingly, the miR-1 target endothelin-1 (ET-1) is a growth promoting peptide that plays an oncogenic role in hepatocellular carcinoma by significantly increasing its ability to proliferate [77]. [score:3]
Furthermore, Singh et al identified two miRNA (miR-1 and miR-206) that are indirectly regulated by NRF2 [21]. [score:3]
This is supported by in vivo studies where overexpression of either miR-1 or miR-206 reduced lung cancer growth in nude mice [76]. [score:3]
miR-1 also targets the tyrosine kinase receptor c-MET, c-MET encodes a hepatocyte growth factor (HGF) receptor which when bound activates various oncogenic pathways including PI3K, RAS and CDC42 thereby promoting survival, proliferation and mobility [81]. [score:3]
miR-1 and miR-206. [score:1]
[1 to 20 of 8 sentences]
40
[+] score: 37
Lim et al. identified 96 genes that were significantly down-regulated (p-value < 0.001) at both 12 and 24 hours with miR-1 over -expression and 174 genes with miR-124 over -expression. [score:8]
Ensembl accession numbers of genes down-regulated in human HeLa cells with miR-1 over -expression. [score:6]
Both miR-1 and miR-124 are known for their tissue specificity in mammals, where the former is preferentially expressed in heart and skeletal muscle, while the latter is preferentially expressed in brain. [score:5]
MobyDick analysis on the human 3' UTR sequences alone would not have been able to identify the target site of miR-1, which is derived from only the mouse sequence set (Figure 5A), where the signal for the target site may be stronger than in human. [score:5]
Click here for file Accession numbers of miR-1 over -expression. [score:3]
Accession numbers of miR-1 over -expression. [score:3]
The motif cluster with the most significant p-value predicted by CompMoby was the target site of miR-1 (Figures 5A, 5B) and miR-124 (Figures 5A, 5C). [score:3]
Lim et al. generated the datasets by independently over -expressing miR-1 or miR-124 in human HeLa cells and then profiling the mRNA on whole genome microarrays. [score:3]
Also shown is the match between the predicted motif cluster to the miR-1 seed region. [score:1]
[1 to 20 of 9 sentences]
41
[+] score: 36
The miR-1 has target genes for Notch3 which is upregulated in PH in human as well as in rat mo del may indicate a functional correlation [26]. [score:6]
Among the downregulated miRNAs; miR-1, miR-29c, and miR-34b showed more declined expression in the female subjects, compared to the male counterpart. [score:5]
A. Expression of miR-1, miR-26a and miR-29c B. Expression of miR-34b, miR-451 and miR-1246. [score:5]
0064396.g003 Figure 3 A. Expression of miR-1, miR-26a and miR-29c B. Expression of miR-34b, miR-451 and miR-1246. [score:5]
Our study reveals that in human subjects with moderate to severe PH are associated with significant downregulation of plasma levels of circulatory miR-1, miR-26a and miR-29c. [score:4]
MiR-1, miR-26a, miR-29c, miR-34b, miR-451 and miR-1246 are downregulated in PH subjects. [score:4]
The expression of miR-34b and miR-1 showed strongest declined pattern among the PH subjects. [score:3]
The expression of miR-1 showed 0.27±0.06-fold in moderate PH and elicited a sharp decline to 0.13±0.05-fold (p<0.05) in severe PH subjects, compared to the control subjects (Fig. 3 B). [score:2]
Alternatively, the significant decrease of miR-1, miR-26a and miR-29c level in PH has potential diagnostic significance. [score:1]
We also have included few cardiac specific miRNAs (e. g. miR-1, 133b and 208b) as to test whether they are circulating in PH subjects. [score:1]
[1 to 20 of 10 sentences]
42
[+] score: 35
For miR-1, SVMicrO is still among the better performing algorithms; instead of TargetScan, MirTarget and Pictar emerge to have competitive performance with SVMicrO. [score:5]
To further demonstrate the ability of site-SVM to reveal insights about miRNA binding, we apply the site-SVM to predict the binding sites of miR-1 in 75 validated positive targets obtained in miRecords. [score:3]
388 genes for miR-124 and 56 genes for miR-1 were determined in the end to be highly expressed at a stringent FDR level of 0.01. [score:3]
Particularly, we treated the 388 and 56 highly expressed genes as the true targets of miR-124 and miR-1, respectively and investigated the ROC performance of different algorithms (Figure 7). [score:3]
For the 75 miR-1 targets, a total of 155 sites (or 2.07 sites/UTR) are predicted by site-SVM. [score:3]
To investigate the performance of SVMicrO on targets independent of the training data, we carried out the genome-wide target prediction for human miR-1, miR-16, miR-30a, miR-124, miR-155 and let-7b. [score:3]
Figure 3 reveals two regions in miR-1 sequences that are likely to be responsible for binding to its target. [score:3]
Figure 9 ROC curves for the predictions of miR-1 tested on IP pull-downs. [score:1]
Figure 6 depicts the CFC (Cumulative Fold Change) for the top ranked 300 predictions of miR-124 and miR-1. Intuitively, CFC rewards higher confidence prediction with a drop and penalizes false prediction with a raise in the fold change. [score:1]
Figure 3 Binding sequence logo of miR-1 predicted by Site-SVM. [score:1]
The first region corresponds to the 6-mer seed from nt 2-6, and 100% probabilities in this region suggests miR-1 has perfect 6-mer pairing with every sites. [score:1]
The 22 nucleotides of miR-1 sequence are plotted from 5' to 3'. [score:1]
A close look into the secondary structure of binding at each predicted sites reveals that there is an average of 7 bulges and mismatches in this region of the site; the largest number of bulges and mismatches is 25 and the smallest is 0, indicating that miR-1 binds perfectly with some sites in this region. [score:1]
We therefore further validated the prediction of miR-124 and miR-1 on the IP pull-down data[31]. [score:1]
Same tests were also carried out for miR-1 (Figure 9 and 10). [score:1]
Based on the binding matrix, the empirical probability of binding can be obtained for each of the nucleotides in miR-1 sequence and a binding sequence logo is generated by the TarLogo program in the SVMicrO suite and plotted in Figure 3 to depict these binding probabilities. [score:1]
A binding matrix is constructed based on the predicted sites with the ij-th element being 1 if the j-th nucleotide of miR-1 is paired to the i-th site, and 0, otherwise. [score:1]
Figure 10 Number of true positives among top ranked predictions of miR-1. The improved performance of SVMicrO can be attributed to the following three factors. [score:1]
Figure 10 Number of true positives among top ranked predictions of miR-1. The 21 optimal site features are resulted from the sequential forward search feature selection applied to the site training data (Table 2). [score:1]
[1 to 20 of 19 sentences]
43
[+] score: 35
Among the miRNAs with age-limited expression, the majority of them were expressed in adults only, with miR-1 being the most highly expressed in the peripheral blood of all adults. [score:7]
When examined in the validation set, miR-1 exhibited similar expression pattern, showing nonexpression in both the preterm infants and children but detectable expression in the adults (Fig. 2B). [score:7]
Six (miR-1, miR-486, miR-26a, miR-24, miR-26b, and miR-142-3p) of seven top 5% differentially expressed miRNAs in the classes with age-limited or age-related expression were confirmed in a validation set using qPCR. [score:5]
Evidence suggests that miR-1 is a highly conserved miRNA with common muscle-specific expression during embryonic and fetal development as well as during adulthood in flies, zebrafish, chicken, mice, and humans (Chen et al., 2006; Ibanez-Ventoso et al., 2006; Chang & Men dell, 2007; Liang et al., 2007; Koutsoulidou et al., 2011). [score:4]
Of those, miR-1 was highly expressed in all adults (Fig. 2A). [score:3]
Taken together, these findings imply that adult muscle tissue might regularly release a certain level of miR-1 into the blood for baseline function, and elevated expression of miR-1 might serve as a biomarker for muscle cell injury, such as acute myocardial infarction. [score:3]
First, hsa-miR-1 was expressed in adulthood only and was not associated with aging (Fig. 4A). [score:3]
Nevertheless, the expression of miR-1 is increased in the bloodstream of patients with myocardial infarction (Cheng et al., 2010). [score:3]
[1 to 20 of 8 sentences]
44
[+] score: 34
Regeneration-miRNAs were up-regulated (miR-31, miR-34c, miR-206, miR-335, miR-449, and miR-494), while degenerative-miRNAs (miR-1, miR-29c, and miR-135a) were down-regulated in mdx mice and in DMD patients’ muscles. [score:7]
Recently, a new regulatory pathway, the mechanistic target of rapamycin (mTOR) signaling was seen to regulate miR-1 expression and was also found responsible for MyoD stability [30– 36]. [score:7]
They found specific deregulated miRNAs: miR-1 and -335 are up-regulated, whereas miR-29b, -29c and -33 are down-regulated compared to control muscles [67, 68]. [score:7]
Muscle specific myomiR miR-1 and miR-133 and the ubiquitous miR-29c and miR-30c are down-regulated in mdx mice. [score:4]
miR-1 controls Glucose-6-phosphate dehydrogenase (G6PD), a relevant enzyme involved in the response to oxidative stress while miR-29 controls fibrotic process since it targets the structural component of extracellular matrix, collagen (Col1a1) and elastin (Eln). [score:3]
An up-to-date list of the identified targets of miR-1, miR-133 and miR-206, together with a plethora of specific muscular pathways they are involved in, is reported in a recent review [40] and some of these will be also discussed in the next paragraph to highlight how these important families of miRNAs contribute to determine typical deficiencies occurring in a pathological muscular context. [score:3]
It is possible to functionally define miR-133 as enhancer of myoblast proliferation while miR-1 and miR-206 as enhancers of skeletal muscle differentiation [37– 40]. [score:1]
In particular the activation of both human and murine miR-1 and miR-29 is tightly linked to HDAC2 release from their respective promoters. [score:1]
miR-1, miR-133a/b and miR-206 are largely studied and defined muscle-specific miRNAs (myomiRs). [score:1]
[1 to 20 of 9 sentences]
45
[+] score: 33
Having demonstrated that miR-1 is able to target PAX7, as already reported for miR-206 [65], which is consistently upregulated in YY1 over -expressing myoblasts, the authors depicted an anti-myogenic network in which YY1 plays a central role in repressing miR-1/miR-206 (Figure 4). [score:8]
Indeed, (i) miR-1 and miR-133 target IGF receptor 1, thus avoiding aberrant muscle hypertrophy [71, 72]; (ii) miR-214, which is repressed by EZH2 in proliferating myoblasts, is able to favor myogenesis by downregulating the anti-myogenic N-RAS oncogene [73, 74]. [score:6]
Although no direct epigenetic regulation of the expression of miR-1 and miR-206 clusters has been highlighted in RMS, a recent study provided several evidences linking these miRNAs to the epigenetic machinery in normal myoblasts [63]. [score:5]
In this work, YY1 was shown to regulate the expression of miR-1 and miR-206 clusters in murine myoblasts in vitro and in vivo. [score:4]
Furthermore, the same authors uncovered a feedback loop between miR-1 and YY1 demonstrating that miR-1 directly targets the 3′UTR of YY1 mRNA. [score:4]
This network is flexible and bi-univocal due to the feedback control of miR-1 on YY1 expression [63]. [score:3]
” To this group belong three miRNA clusters, miR-1-1/miR-133a-2, miR-1-2/miR133a-1 and miR-206/miR-133b, encoded by three bicistronic miRNA genes on separate chromosomes (reviewed in [62]). [score:1]
In particular, the authors found YY1 binding sites in previously identified muscle-specific enhancers [64] located (i) upstream of miR-1-2 (E1) and (ii) in an intron between miR-1-2 and miR-133a-1 (E2), and (iii) between miR-1-1 and miR-133a-2 gene loci (E3). [score:1]
Additional links with epigenetic networks in myoblasts have been shown for both miR-1 and miR-206 clusters. [score:1]
[1 to 20 of 9 sentences]
46
[+] score: 32
Although target genes of miR-1 by miTarget were less enriched in downregulated genes, miTarget showed more robust target prediction of three miRNAs and the seed match showed a high number of false positives. [score:12]
In the analysis, we observed terms associated significantly with the target genes (27 for miR-1, 26 for miR-124a, and 23 for miR-373) [see Additional file 2] included in the GO gene-association database (goa_human and Affymetrix HG_U95AV2 Human known genes) among the top 50 target genes. [score:5]
Through microarray experiments, Lim et al. [40] reported genes downregulated by miR-1, miR-124a, and miR-373, respectively. [score:4]
We have shown the results for miR-1, miR-124a, and miR-373 and these are consistent with the general idea that miRNA targets are diverse in function [23]. [score:3]
In miR-124a and miR-373, excluding miR-1, miTarget was more significant than the seed match. [score:3]
This predicted significant functions of human miRNA miR-1, miR-124a, and miR-373 by GO analysis. [score:1]
For miR-1 and miR-124a, the most significant GO annotations were GO:0050517 (inositol hexakisphosphate kinase activity, adjusted P = 0.055) and GO:0046914 (transition metal ion binding, adjusted P = 0.0396) in the molecular function category, respectively. [score:1]
The genes were used for GO analysis for miR-1 (Supplementary Table 2-1), miR-124a (Supplementary Table 2-2), and miR-373(Supplementary Table 2-3). [score:1]
Supplementary Table 3. This table lists statistically significant GO terms in the prediction results for miR-1 (Supplementary Table 3-1), miR-124a (Supplementary Table 3-2), and miR-373 (Supplementary Table 3-3). [score:1]
We predicted significant functions for human miR-1, miR-124a, and miR-373 using Gene Ontology (GO) analysis and revealed the importance of pairing at positions 4, 5, and 6 in the 5' region of a miRNA from a feature selection experiment. [score:1]
[1 to 20 of 10 sentences]
47
[+] score: 31
Northern blot analyses further confirmed a significantly increased expression of miR-206, whereas the expression of miR-1 modestly increased in the muscle muscle of mdx mice (Figure 1B, C). [score:5]
We have previously reported that the expression of muscle-specific miR-1 and miR-133 is induced during skeletal muscle differentiation and miR-1 and miR-133 play central regulatory roles in myoblast proliferation and differentiation in vitro. [score:4]
This mutation creates a binding site for miR-1 and miR-206, leading to the translational repression of myostatin, which phenocopies the "muscle doubling" that results from the loss of myostatin in mice, cattle, and humans [29, 30]. [score:4]
Furthermore, miR-1 and miR-133 are also important regulators of cardiomyocyte differentiation and heart development [22- 24]. [score:3]
We found that the expression levels of miR-1, miR-133 and miR-206 were higher in the skeletal muscle of one month-old mdx mice (Figure 1A). [score:3]
A subset of miRNAs, miR-1, miR-133, miR-206 and miR-208, are either specifically or highly expressed in cardiac and skeletal muscle and are called myomiRs [6, 7, 13]. [score:3]
Additionally, embryonic stem (ES) cell differentiation towards cardiomyocytes is promoted by miR-1 and inhibited by miR-133 [22]. [score:3]
Paradoxically, miR-1 and miR-133 exert opposing effects to skeletal-muscle development despite originating from the same miRNA polycistronic transcript. [score:2]
Furthermore, miR-1 and miR-206 also participate the regulation of skeletal muscle satellite cell proliferation and differentiation [8]. [score:2]
Among them, miR-1, miR-133, miR-206, miR-208 and miR-499 have been described as muscle specific miRNAs, or myomiRs [6, 13]. [score:1]
Interestingly, miR-1 and miR-133 also produce opposing effects on apoptosis [21]. [score:1]
[1 to 20 of 11 sentences]
48
[+] score: 31
In addition, over -expression of miR-1 and miR-133b inhibits osteosarcoma cell proliferation and invasion through cell cycle arrest and decreasing MET expression [18]. [score:7]
Decreased expression of miR-1 and miR-133a are found in bladder cancer, and over -expression of miR-1 or miR-133a inhibits bladder cancer cell proliferation, migration and invasion, and increases apoptosis [20]. [score:7]
The top down-regulated miRNAs (miR-1, miR-30a, miR-133a, miR-133b, miR-208b and miR-378c) and up-regulated miRNAs (miR-338-5p, miR-663b, miR-645 and miR-3663-5p) are listed in Table 2 and 3. To confirm the results of miRNA microarray assay, SYBR Green qRT-PCR was performed using the RNAs from five human osteosarcoma and three normal muscle samples in miRNA microarray assay as templates. [score:5]
Among the 43 differentially expressed miRNAs, a part of miRNAs such as miR-1, miR-26a, miR-30a, miR-30b miR-133a, miR-133b and miR-224, are found to play a key role in cancers, whereas some miRNAs are not reported [20]– [26]. [score:3]
A study also identifies that miR-1/miR-133a and miR-206/miR-133b clusters are down-regulated in several osteosarcoma cell lines compared with normal bones, which is consistent with our findings [17]. [score:3]
Similar results are also reported in Novello's study, which demonstrates the decreased miR-1 and miR-133b expression in osteosarcoma cell lines and clinical samples [18]. [score:3]
Novello et al. found that 12 miRNAs including miR-1, miR-133b and miR-378 were differentially expressed in high-grade and low-grade OS [18]. [score:3]
[1 to 20 of 7 sentences]
49
[+] score: 31
Sybr Green technology was used to validate: miR-122, which was specifically expressed on present microarrays compared to our previous study [11] and it showed the highest up-regulation; miR-21 and miR-126, which are in addition to muscle-specific miR-1 and miR-133 the most common miRNAs involved in heart diseases; miR-125a/b, which are according to TAM tool involved in myocardial remo delling after MI. [score:7]
Statistical analysis revealed that miR-1, miR-133a/b and miR-98 expression based on qPCR results is in accordance to microarray results, that are down-regulated in infracted compared to corresponding remote myocardium, but statistical significance is dependent of RG used (Table  5). [score:5]
revealed that miR-1, miR-133a/b and miR-98 expression based on qPCR results is in accordance to microarray results, that are down-regulated in infracted compared to corresponding remote myocardium, but statistical significance is dependent of RG used (Table  5). [score:5]
Using; the miR-1 and miR-133 were used to compare present study to our-previous research [33] and confirmed up-regulation of miR-1 in remote myocardium. [score:4]
In contrast, expression of miR-1 and miR-133a/b is always in statistical significant correlation to each other not dependent of RG used (data not shown). [score:3]
Free-energy of binding and flanking regions (RNA22, RNAfold) was calculated for 10 up-regulated miRNAs from microarray analysis (miR-122, miR-320a/b/c/d, miR-574-3p/-5p, miR-199a, miR-140, and miR-483), and nine miRNAs deregulated from microarray analysis were used for validation with qPCR (miR -21, miR-122, miR-126, miR-1, miR-133, miR-125a/b, and miR-98). [score:3]
TaqMan based approach was used to validate miR-98, which was one of the few miRNAs overlapping target prediction and is according to TAM tool involved in hypertrophy; and miR-1 and miR-133a/b, muscle-specific miRNAs. [score:3]
MicroRNAs, miR-1, miR-133a, miR-133b, and miR-98 were tested relatively to RNU6B, RNU48 and miR-26b. [score:1]
[1 to 20 of 8 sentences]
50
[+] score: 31
In the pre-miR-206 downregulated genes, the regression mo del showed that miR-1 and miRNA-206 have the highest coefficient that explains 25% of the downregulated genes. [score:7]
For example, in [26] LNCaP cell lines were treated with pre-miRNA (pre-miR-1, pre-miR206, and pre-miR27b) and downregulated genes were identified using differential gene expression analysis. [score:6]
88 genes were identified to be down regulated after pre-miR-1 treatment, 83 were downregulated after pre-miR-206 treatment, and 51 were down regulated after pre-miR-27b treatment. [score:6]
To demonstrate the applicability and effectiveness of using Lasso regression mo deling to identify miRNAs whose targets are enriched in gene lists, we used affymetrix gene expression data from LNCaP cell lines treated with pre-miR-1, pre-miR-27b and pre-miR-206 that was retrieved from [26] under the access number GSE31620. [score:5]
In the pre-miR-1 downregulated genes, the regression mo del ranked miRNA-1 first with the highest coefficient value. [score:4]
For example, miRNA-1 showed to be a tumor suppressor miRNA that act as prognostic biomarker [26]. [score:3]
[1 to 20 of 6 sentences]
51
[+] score: 30
miR-1, a muscle-specific microRNA, promotes cell apoptosis by targeting Bcl-2 (Tang et al., 2009), and could target heat shock protein 70 (HSP70) in the development of muscle atrophy (Kukreti et al., 2013). [score:6]
Besides the miR-1 and miR133a that we found highly expressed in all the stages (McCarthy & Esser, 2007), miR-26a also showed abundant expression (Huang, Sherman & Lempicki, 2008; Huang et al., 2008). [score:5]
miR-27b showed increasing expression levels during development, and miR-1 showed the opposite trend. [score:4]
Hence, miR-1 could be a potential modulator in regulating porcine postnatal skeletal muscle development. [score:3]
Previous study performed by Qin et al. indicated that most of the highly expressed miRNAs in porcine skeletal muscle such as miR-1 and miR-133 will be more functional. [score:3]
Therefore, miR-27b promotes myogenesis and proliferation, whereas miR-1 inhibits these processes and induces apoptosis. [score:3]
Particularly, miR-1 showed significantly increasing expression level in 180d and 7y stages (Fig. 5A and Table S7). [score:3]
Of these miRNAs, six (miR-133a-1/-2-3p, let-7a-1/-2-5p, miR-27b-3p, miR-26a-5p, miR-1-3p, and let-7f-1/-2-5p) were shared by all five stages and were closely related to myogenesis, cell growth, myocyte proliferation, and cell apoptosis. [score:1]
By using both C2C12 myotubes and dex -induced muscular atrophy mouse mo dels, Kukreti et al. (2013) indicated that miR-1 is a muscle-specific microRNA and has a role in promoting muscle atrophy. [score:1]
On the other hand, McCarthy & Esser (2007) also revealed that miR-1 decreased during mouse skeletal muscle hypertrophy. [score:1]
[1 to 20 of 10 sentences]
52
[+] score: 30
they are “Roles of the canonical myomiRs miR-1, -133 and -206 in cell development and disease” [6], “microRNA-133: expression, function and therapeutic potential in muscle diseases and cancer” [7] and “microRNA-1/133a and microRNA-206/133b clusters:Dysregulation and functional roles in human cancers” [5], respectively. [score:9]
High expression of miR-185 and low expression of miR-133b were correlated with poor survival and metastasis in colorectal cancer [84], which suggest the potential prognostic values of these miRNAs for predicting clinical outcome after surgery, miR-1 and mir-133b have been significantly downregulated in recurrent PCa specimens and can serve as novel biomarkers for prediction of PCa progression [85]. [score:8]
In addition, miR-133b can mediate cancer metastasis via regulating the tumor microenvironment, previous study [66] have found a marked up-regulation of miR-1 and miR-133b in interleukin-6 (IL6)-(human prostate fibroblasts) HPFs and (cancer associated fibroblasts) CAFs, miR-133b not only is able per se to promote fibroblast activation by inducing phenotypic changes but can be secreted by activated fibroblasts and may intake further by prostate carcinoma cells, by which mesenchymal phenotype would be established, and then CAFs induce EMT in tumor cells. [score:5]
In addition, another original intention for this review is that there has been individual review for each myomiRs but miR-133b, these independent reviews about miR-133 [7]/a [10], miR-1 [11– 13], miR-206 [14, 15] and miR-133b which we review in here is so particularly important for us to understand the jointly or independently role of myomiRs acting in human disease. [score:3]
miR-133b belong to canonical muscle-specific microRNAs (myomiR) families(miR-1, −133 and -206s) and was initially considered muscle specific in that it was highly enriched in heart and skeletal muscle and played a critical regulator for muscle development and remo deling [5, 6]. [score:2]
miR-133b and miR-206, two isomers of miR-1 and miR-133a form different clusters located in on chromosomes 6p12.2, 20q13.33 and 18q11.2, respectively. [score:1]
However, discussions from these excellent reviews are mainly centered on the role of miR-133b in homologous cluster (miR-1, -133 and -206s) and sometimes its unique physiological functions are harder to distinguish and to be highlighted extremely well. [score:1]
MicroRNA families miR-1 and miR-133, and single miR-206 are collectively known as the muscle-specific miRNAs (“myomiRs”) because of they are highly conserved in the musculatures across species [8]. [score:1]
[1 to 20 of 8 sentences]
53
[+] score: 30
miR-1/206 inhibits the expression of histone deacetylase 4 (HDAC4), which suppresses the MEF2c transcriptional activity to induce muscle gene expression. [score:9]
Thus, this forms a positive feedforward loop in which MEF2c induces miR-1 expression, causing inhibition of the MEF2c repressor HDAC4, leading to enhancement of MEF2 activity [26]. [score:5]
Others and we have found that the miR-1/206 family, comprised of miR-1-1, miR-1-2, and miR-206, is capable of promoting myogenesis, in part by inhibiting Pax3/7 in embryonic muscle precursors and satellite cells [33– 35]. [score:3]
Since SRF is directly involved in the regulation of miR-1/miR-133a transcription [26, 28, 42], miR-133 and SRF form a negative feedback circuit that balances myoblast proliferation and differentiation. [score:3]
It has been reported that miR-1 and miR-206 levels are repressed in RMS [106], likely resulting in the inhibition of terminal differentiation of myogenic progenitor cells. [score:3]
miR-1-1 and miR-1-2 are expressed in both skeletal and cardiac muscles, while miR-206 is specific for skeletal muscle [28, 30, 33, 36]. [score:3]
While both the miR-1/miR-206 family and miR-133 family of miRNAs become enriched in myocytes during differentiation, likely via MyoD- and/or myogenin -dependent transcriptional regulation, their effects and mode of action on myogenesis are different. [score:2]
The miR-1/206 family is transcribed from three different chromosomal loci in the form of bicistronic transcripts with miRNAs in the miR-133 family (miR-133a-1, miR-133a-2, and miR-133b) [28, 33, 36]. [score:1]
Many MyomiRs and muscle-enriched miRNAs, such as miR-1, miR-133, and miR-206, are all increased in the serum of DMD patients and/or in muscle tissues of mdx mice [89– 96]. [score:1]
[1 to 20 of 9 sentences]
54
[+] score: 30
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-214, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, hsa-mir-1-1, hsa-mir-128-2, hsa-mir-29c, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-148b, hsa-mir-133b, hsa-mir-424, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-128-1, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-503, hsa-mir-411, hsa-mir-378d-2, hsa-mir-208b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-17, ssc-mir-221, ssc-mir-133a-1, ssc-mir-1, ssc-mir-503, ssc-mir-181a-1, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-29a, ssc-mir-199a-2, ssc-mir-128-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-486-1, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-23b, ssc-mir-148b, ssc-mir-208b, ssc-mir-424, ssc-mir-127, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-411, ssc-mir-133a-2, ssc-mir-126, ssc-mir-199a-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-378j, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, hsa-mir-486-2, ssc-mir-378b
Notably, in addition to porcine myomiRs (miR-1, -206, -133 a-3p/a-5p/b), three other miRNAs (miR-128, -208b and -378) reported to be related to muscle development in other mammals were also included in up-regulation Cluster 2, suggesting their roles in the regulation of porcine embryonic myogenesis at 35 to 77 dpc. [score:6]
Journal of Cell Science 120: 3045-3052 74 Yan D, Dong XD, Chen XY, Wang LH, Lu CJ et al. (2009) MicroRNA-1/206 Targets c-Met and Inhibits Rhabdomyosarcoma Development. [score:5]
STEM clustering results suggested that ssc-miR-378 functioned as a new candidate miRNA for porcine myogenesis because of its expression profile similar to ssc-miR-1 and -133a-3p (Figure 5A). [score:3]
It’s worth noting that many miRNAs are expressed in a tissue-specific or stage-specific manner [10], and the best-characterized muscle-specific miRNAs (myomiRs [11]) are miR-1, miR-206 and miR-133 families which specifically expressed in cardiac and skeletal muscles. [score:3]
Stem-loop quantitative RT-PCR was then performed on 9 random miRNAs with different expression levels (miR-1, -206, -133a-3p, -133a-5p, -133b, -378, -214, -744 and let-7f) to validate the sequencing data (Figure 6). [score:3]
The predominance of miR-1 is consistent with its well established function during skeletal muscle development [21] and reported role during porcine myogenesis [22]. [score:2]
Ssc-miR-1 was the most abundant miRNA in ten libraries, consistent with the well-established function of miR-1 during skeletal muscle development [21]. [score:2]
In addition, we both focused on the changes in abundance of myomiRs (miR-1, -206 and -133) during swine skeletal muscle development. [score:2]
Figure 2 showed that the number of DE miRNAs during myofiber formation was the least but still accounted for almost 50% of total DE miRNAs, from which all of porcine myomiRs (ssc-miR-1, -206, -133 a-3p/a-5p/b) were identified. [score:1]
Intriguingly, 11 of the 25 common miRNAs were reported to function as muscle-related miRNAs including the well-known myomiRs (miR-1, -206 and -133 family). [score:1]
In addition to the best-studied myomiRs (miR-1, -206 and miR-133 families), 11 other DE muscle-related miRNAs (miR-378 [24], miR-148a [27], miR-26a [28, 29], miR-27a/b [30, 31], miR-23a [32, 33], miR-125b [34], miR-24 [35], miR-128 [36], miR-199a [37] and miR-424 [38]) with high abundance (average RPM >1,000) and another 14 (miR-181a/b/c/d-5p [26], miR-499-5p [11], miR-503 [38], miR-486 [39], miR-214 [40], miR-29a/b/c [41– 43], miR-221/222 [44] and miR-208 [11] with low abundance (average RPM <1,000) were detected in myogenesis of pig. [score:1]
The most abundant miRNA was ssc-miR-1, which presented by more than 2,100,000 RPM in ten libraries. [score:1]
[1 to 20 of 12 sentences]
55
[+] score: 29
MiR-1 and miR-133a have been frequently found to be co -downregulated in several types of cancer. [score:4]
From our system, we could find out that co -expression of miR-1 and miR-133a is meaningful. [score:3]
In addition, the targets of miR-1 or miR-133a in prostate adenocarcinoma could be further queried (Figure 3). [score:3]
[40] In addition, expression level of both miR-1 and miR-133a altered in uveal melanoma. [score:3]
The targets of miR-1 and miR-133a are enriched in cancer-related GO biological processes such as mitotic cell cycle (P=1.13E-08), cell division (P=2.54E-08) and mitotic nuclear division (P=9.74E-08). [score:3]
For miR-1, most miRNA–target interactions are experimentally validated (12/16). [score:3]
32, 35, 36 Therefore, there must be a functional link between miR-1 and miR-133a. [score:1]
From the result page, we could find that miR-1 and miR-133a are functionally synergistic in five cancer types: sarcoma; stomach adenocarcinoma; pheochromocytoma–paraganglioma; prostate adenocarcinoma; and uveal melanoma. [score:1]
Of all the pairs formed by miR-1 in prostate adenocarcinoma, miR-133a and miR-1 share the highest functional similarity score that means their functions are closely linked. [score:1]
[46] Together with miR-1 and miR-133a, these miRNAs form a functionally synergistic clique in prostate cancer and jointly function in tumorigenesis. [score:1]
Among them, it has been revealed that both miR-1 and miR-133a are related to sarcoma, [30] stomach adenocarcinoma 37, 38 and prostate adenocarcinoma. [score:1]
First, we are curious about in which cancer types this miRNA pair exists, so miR-1 and miR-133a were queried simultaneously in CancerNet (Figure 1). [score:1]
For example, the common partners that are synergistic with miR-1 and miR-133a in prostate adenocarcinoma can be visualized by using ‘My miRNA-miRNA Network' module (Figure 4). [score:1]
Here we only show the results of miR-1 (Figure 2). [score:1]
[41] Accordingly, the synergism between miR-1 and miR-133a revealed by CancerNet is consistent with previous studies. [score:1]
Second, we would like to further detect all the miRNAs that are functionally synergistic with miR-1 or miR-133a in a certain cancer type such as prostate adenocarcinoma. [score:1]
[1 to 20 of 16 sentences]
56
[+] score: 28
In the present study, we showed that the expression of several miRNAs is altered during the development of PC and that licofelone reverses the altered expression of the majority of these miRNAs with up-regulation of miR-21, miR-222, Let-7, miR-125, miR-142 and down-regulation of miR-1, miR-122 and miR-148. [score:12]
Licofelone dramatically down-regulated the majority of miRNAs overexpressed in association with pancreatic tumor progression and upregulated miR1, miR122 and miR158 by many fold including those that regulate inflammation and CSCs. [score:10]
Researchers also have found that miR-1 is down-regulated in several types of cancers [45– 48] and that it acts as a tumor suppressor. [score:6]
[1 to 20 of 3 sentences]
57
[+] score: 28
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-210, hsa-mir-215, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-302a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-369, hsa-mir-371a, hsa-mir-340, hsa-mir-335, hsa-mir-133b, hsa-mir-146b, hsa-mir-519e, hsa-mir-519c, hsa-mir-519b, hsa-mir-519d, hsa-mir-519a-1, hsa-mir-519a-2, hsa-mir-499a, hsa-mir-504, hsa-mir-421, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-190b, hsa-mir-301b, hsa-mir-302e, hsa-mir-302f, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-371b, hsa-mir-499b
Several classes of mRNAs encoding SR proteins are known to be targeted by miRNAs; miR7, miR-10a, miR10b are known to target SRSF1, miR-193a-3p regulates SRSF2 and miR-1 targets SRSF9 in several cell types [63] and the genes encoding hnRNPA1 and hnRNPA0 are known to be targets of miR-124, miR-137 and miR-340 in colon cancer cells [64]. [score:10]
Shan Z. X. Lin Q. X. Fu Y. H. Deng C. Y. Zhou Z. L. Zhu J. N. Liu X. -Y. Zhang Y. -Y. Li Y. Lin S. -G. Upregulated expression of miR-1/miR-206 in a rat mo del of myocardial infarction Biochem. [score:6]
MicroRNAs are known to regulate the chaperone network in several conditions including cerebral ischemia; miR-320 has been demonstrated to regulate HSP20 transcripts during cardiac injury [66] and miR-1 is known to target HSP72 mRNAs in cardiac ischemia [67]. [score:5]
MicroRNA miR-1 has also been documented to directly target IGF1 transcripts in cardiac and skeletal muscle [72], as have miR-320 and miR-206 in a rat mo del of myocardial infarction [73]. [score:4]
Xu C. Lu Y. Pan Z. Chu W. Luo X. Lin H. Xiao J. Shan H. Wang Z. Yang B. The muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, HSP70 and caspase-9 in cardiomyocytes J. Cell Sci. [score:3]
[1 to 20 of 5 sentences]
58
[+] score: 27
Briefly, miR-1 is thought to function as a regulator of differentiation and proliferation during cardiogenesis as well as a regulator of cardiomyocyte growth in the adult heart. [score:3]
MicroRNA-1 and microRNA-133a expression are decreased during skeletal muscle hypertrophy. [score:3]
The three related miRNAs, miR-133a-1, miR-133a-2, and miR-133b, are co-transcribed with miR-1-2 and miR-1-1. Accumulated data from several groups has identified several genes as downstream targets of miR-133, such as NFATc4, calcineurin, Rac, and Cdc42, among others. [score:3]
Accumulated data from several groups has identified several genes as downstream targets of miR-1-1 and miR-1-2, such as MEF2a, calmodulin, GATA4, insulin-like growth factor-1 and twinfillin, among others. [score:3]
Zhao et al. found that targeted deletion of miR-1 in mice led to the in utero death of 50% of embryos, and many of the remaining mice died of heart defects within a few months of birth (107). [score:3]
The four miRNAs found repeatedly were miR-1, miR-133a, miR-208b, and miR-499, and these were selected for further processing. [score:1]
The pooled sensitivity and specificity for miRNA-1 resulting from 9 studies were 0.70 and 0.81, for miR-133 resulting from 5 studies were 0.82 and 0.87 and for miR-499 resulting from 10 studies were 0.80 and 0.89. [score:1]
Actually, miRNAs abundant in the myocardium, known as myomiRs, such as miR-1, miR-133, miR-208a/b, and miR-499a, were reported many times as being strongly increased in the serum or plasma of patients with AMI (36). [score:1]
Three frequently found miRNAs were chosen for subgroup analysis: miR-1, miR-133, and miR-499. [score:1]
miR-1 was first discovered in 2002 in a screen for muscle-specific miRNAs in mouse. [score:1]
The miR-1 results were disappointing due to low values of sensitivity and specificity. [score:1]
Nonetheless, the level of miR-1 was dropped to normal on discharge following medication. [score:1]
Furthermore, it has brought to the forefront a specific set of miRNAs, namely, miR-1; miR-133; miR-208a/b, and miR-499a. [score:1]
For each miRNA, the obtained values were as listed: (i) miR-1: 0.63 and 0.76 (ii) miR-133a: 0.89 and 0.87 (iii) miR-208b: 0.78 and 0.88, and (iv) miR-499: 0.88 and 0.87. [score:1]
Actually, this trans-differentiation has been achieved by Jayawardena et al. in 2015 using the exact same set of miRNAs that stood out in the above-mentioned studies on miRNAs as AMI biomarkers, namely miR-1, miR-133a, miR-208a, and miR-499a (104). [score:1]
Increased circulating miR-1 was not associated with age, gender, blood pressure, or diabetes mellitus. [score:1]
Referring to the aforementioned multiple studies on miRNAs as AMI biomarker, a set of candidates has emerged: the four muscle-specific miRNAs, the myomiRs miR-1, miR-133, miR-208a/b, and miR-499a. [score:1]
[1 to 20 of 17 sentences]
59
[+] score: 27
Several groups have used microarray data to examine the expression changes when a single miRNA changes, and we used the mean absolute expression approach described recently by Arora and Simpson [49] and also the tissue-centric approach described by Sood et al. [50] to determine whether we could detect shifts in the average expression of mRNA targets of the muscle-specific miRNAs (miR-1, miR-133a/b and miR-206, collectively known as 'myomirs') in human skeletal muscle. [score:9]
Over -expression of miR-1 [55] or miR-206 [86] in mouse myoblasts accelerates differentiation into myotubes whereas over -expression of miR-133 promotes proliferation [55]. [score:5]
However, evidence of distinct binding proteins that modulate processing of pri-miRNA to mature miRNA [92] has emerged and we clearly demonstrate that expression of miR-1 and miR-133a are not co-regulated in vivo in human skeletal muscle. [score:4]
ANOVA indicated that miR-133a (F = 11.8, P < 0.0001) was significantly different between the three groups, miR-206 expression more modestly altered (F = 4.5, P = 0.02) and miR-1 and miR-133b were unchanged (Figure 2c). [score:3]
In vivo the expression of these miRNAs can vary as miR-1 and miR-133a decrease 50% in response to muscle hypertrophy in mice following 7 days of loading [87]. [score:3]
Subsequently, we checked miR-206, which associated more modestly with these clinical parameters, and miR-1, which did not associate with any of these clinical parameters. [score:1]
Most studied are miR-133, miR-206 and miR-1, which are all induced during differentiation of myoblasts into myotubes [28]. [score:1]
To determine if pri-miRNA transcript abundance differs across the presumed polycistronic mir-1/mir-133a pri-miRNA, we utilized qPCR. [score:1]
[1 to 20 of 8 sentences]
60
[+] score: 26
Among these: 3 miRNAs (i. e. miR-26a-5p, miR-143-3p, and miR-4454) were expressed in both RAA and LAA; 6 miRNAs (i. e. miR-30c-5p, miR-125b-5p, miR-133b, miR- 145-5p, miR-451a, and miR-4484) were expressed in only RAA; and 3 miRNAs (i. e. miR-1, miR-23b-3p, and miR-494) were expressed in only LAA. [score:7]
For example, miR-208 and miR-499 are cardiac-specific miRNAs exclusively expressed in cardiac tissues, while miR-1 and miR-133 are muscle-specific miRNAs preferentially expressed in cardiac and skeletal muscle [37, 38]. [score:5]
Girmatsion et al. [32] indicated that miR-1 levels are greatly reduced in human AF, possibly contributing to up-regulation of Kir2.1 subunits, leading to increased cardiac inward-rectifier potassium current (I [K1]) [. ] [score:4]
To determine the probable biological function of the AF -associated miRNAs, we predicted the putative targets and pathways of 10 validated miRNAs (i. e. miR-1, miR-23b-3p, miR-26a-5p, miR-30c-5p, miR-125b-5p, miR-133b, miR-143-3p, miR-145-5p, miR-4454, and miR-4484) using the miRFocus database. [score:3]
Yang et al. [31] reported that miR-1 overexpression slowed conduction and depolarized the cytoplasmic membrane by post-transcriptionally repressing KCNJ2 (potassium inwardly-rectifying channel, subfamily J, member 2; which encodes the K [+] channel subunit Kir2.1) and GJA1 (gap junction protein, alpha 1, 43 kDa; which encodes connexin 43), and this likely accounts at least in part for its arrhythmogenic potential. [score:3]
Studies have shown that miRNAs may be involved directly or indirectly in AF by modulating atrial electrical remo deling (i. e. miR-1, miR-26, and miR-328) or structural remo deling (i. e. miR-30, miR-133, and mir-590). [score:3]
According to the qRT-PCR data, miR-26a-5p, miR-143-3p, miR-4454 were AF -associated miRNAs found in both RAA and LAA tissues, while miR-30c-5p, miR-125b-5p, miR-133b, miR-145-5p, miR-4484 were AF -associated miRNAs found in only RAA tissues and miR-1, miR-23b-3p were found only in LAA tissues (Figure  5). [score:1]
[1 to 20 of 7 sentences]
61
[+] score: 25
Mir-1 is known to have high expression levels in mammalian heart and muscle cells while mir-124 contributes to the cells of the nervous system [24]. [score:3]
Second, we have cloned the 1000 bp 5' flanking region of mir-1 and used it to construct an expression plasmid with green fluorescent protein as the reporter (data not shown). [score:3]
In both cases, we chose mir-1-1 as the representative of mir-1 -family and mir-124a-1 for the representative of mir-124 -family for human and mouse. [score:1]
Figure 4The frequency diagrams of the motif GANNNNGA occurrences in sequences 1000 bp upstream of mir-1 (panel a) and mir-124 (panel b) family members in C. elegans, C. briggsae, human and mouse. [score:1]
The multiple sequence alignment of the mir-1 family upstream sequences of C. elegans, C. briggsae, human and mouse. [score:1]
The abundance and conservation of this motif in the upstream of two old and important miRNAs, mir-1 and mir-124 suggest a connection to miRNAs with global specialized function. [score:1]
Both human and mouse, have three miRNAs belonging to the mir-1 -family: mir-1-1, mir-1-2 and mir-206. [score:1]
We draw the frequency diagrams of the motif GANNNNGA in the 1000 bp upstream sequences of mir-1 and mir-124 orthologs in these four species (Figure 4), and made the global alignments of mir-1 and mir-124 upstream sequences (Additional files 1 and 2). [score:1]
The 1000 bp upstream sequence of human hsa-mir-1-1 includes 21 occurrences of the motif which is more than twice as many occurrences as the corresponding sequences of hsa-mir-1-2 and hsa-mir-206 which contain 10 and 6 occurrences, respectively. [score:1]
We found these motifs also from the mir-1 and mir-124 1000 bp upstream sequences in C. elegans and C. briggsae, thus strengthening the connection of these miRNAs with a muscle specific function in these two worms. [score:1]
In addition, this motif was observed to be most abundant in the upstream sequences of two important miRNAs, mir-1 and mir-124. [score:1]
Consistent with this result, the transfection of mir-1 duplexes to HeLa cells produced a heart and skeletal muscle profile. [score:1]
When comparing these results, we found that the motif GANNNNGA is especially abundant in the 1000 bp upstream sequences of miRNAs mir-1, mir-124 and mir-228 in both worms. [score:1]
In summary, the mir-1-1 1000 bp upstream sequences of human and mouse contain nearly as many occurrences of the motif GANNNNGA (21 and 20) as the corresponding sequences of mir-1 of C. elegans and C. briggsae (23 and 26). [score:1]
We also found the frequency distribution of the motif in the upstream sequences from human and mouse orthologs of mir-1 and mir-124 to approximately follow its corresponding distributions in the two worms, thus confirming the conserved nature of the motif. [score:1]
Click here for file The multiple sequence alignment of the mir-1 family upstream sequences of C. elegans, C. briggsae, human and mouse. [score:1]
To determine whether the motif GANNNGA is conserved in the upstream sequences of mir-1, mir-124 and mir-228 orthologs in other species, we located all its occurrences from 1000 bp upstream sequences of all miRNAs that, according to miRBase [17], belong to mir-1 or mir-124 family in human and mouse genomes. [score:1]
The 1000 bp upstream sequences of human and mouse miRNAs that belong to mir-1 and mir-124 families were downloaded from UCSC Genome Browser [40], and the multiple sequence alignments for the mir-1 and mir-124 families upstream sequences were made with ClustalW [37]. [score:1]
Prior to and independent from the current study, there has been keen interest in mir-1 and mir-124, two miRNAs with the most abundant GANNNNGA motifs. [score:1]
This motif was also found to be especially abundant in the upstream sequences of two old and biologically important miRNAs, mir-1 and mir-124, thus suggesting a connection between the number of motif instances in the upstream sequence close to a miRNA start site and a globally conserved function of the miRNA. [score:1]
For mouse, the numbers are 20 for mmu-mir-1-1, 6 for mmu-mir-1-2, and 6 for mmu-mir-206. [score:1]
[1 to 20 of 21 sentences]
62
[+] score: 25
miR-1 overexpression also results in maturation of calcium handling in hESC-CMs, increasing calcium transient amplitude and upstroke velocity, which is accompanied by increased expression of junctin (Jnct), triadin (Trdn) and ryanodine (RyR2) mRNA. [score:5]
Post-differentiation, miR-1 overexpression in hESC-CMs did not change the expression of cardiac contractile proteins, including α-MHC and β-MHC, MLC2V, α-actinin and troponin T [77]. [score:5]
When overexpressed during pre-cardiac differentiation, miR-1 induces expression of cardiac marker genes in both mouse and human ESCs [78] and EBs [76, 77]. [score:5]
However, miR-1 overexpression did promote electrophysiological maturation with a decrease in action potential duration and a more hyperpolarized resting membrane potential. [score:3]
Moreover, miR-1, miR-144 and miR-499 are the most differentially expressed miRNAs between hESCs, hESC-CMs, human fetal CMs and human adult CMs [77]. [score:3]
Although several clusters of miRNA are important for cardiac development and maturation, only miR-1, miR-133 and miR-499 are significantly induced during cardiac differentiation in hESCs [75- 78]. [score:2]
Therefore, while both miR-1 and miR-499 appear to be potent inducers of cardiomyogenic differentiation of stem cells, miR-499 promotes ventricular specificity after initiation of cardiac differentiation while miR-1 induces a more mature ventricular CM phenotype than miR-499 [77]. [score:1]
miR-1 is the most abundant miRNA in the mammalian heart. [score:1]
[1 to 20 of 8 sentences]
63
[+] score: 24
The authors found that miR-1 was able to directly bind to 3′-untranslated regions (3′-UTRs) of UCA1 and effectively inhibit its expression. [score:8]
Wang et al. found that miR-1 plays tumor suppressive roles via downregulation of the lncRNA urothelial cancer associated 1 (UCA1) in bladder cancer. [score:6]
Wang T. Yuan J. Feng N. Li Y. Lin Z. Jiang Z. Gui Y. Hsa-miR-1 downregulates long non-coding RNA urothelial cancer associated 1 in bladder cancer Tumour Biol. [score:4]
For example, miR-1 inhibits cardiac hypertrophy both in vitro and in vivo by modulating signaling molecules of heart growth such as calmodulin [7]. [score:3]
Both increased cell apoptosis and decreased cell motility were observed when urinary cancer cell lines were transfected with miR-1 mimic or UCA1 shRNA [35]. [score:1]
This study suggests that the miR-1/UCA1 axis may have potential to be developed as a therapeutic option for this cancer. [score:1]
For example, miR-1, miR-133, miR-208a/b, miR-499, and miR-328 have all been shown to modulate the cardiac damage following an acute MI [78, 79, 80]. [score:1]
[1 to 20 of 7 sentences]
64
[+] score: 24
The miR-1 can directly target and inhibit insulin-like growth factor 1 (IGF-I) and Akt -mediated signaling while miR-133 can enhance muscle cell proliferation (Kovanda et al., 2014) indicating putative regulatory roles for these miRNAs in muscle growth/ anabolic responses. [score:7]
Reduced miR-1 expression has been reported following a bout of resistance exercise in human skeletal muscle (Drummond et al., 2008) but aerobic exercise increases miR-1 expression (Nielsen et al., 2010; Russell et al., 2013). [score:5]
Despite being the most highly expressed of the miRNAs analyzed, there were no post-exercise changes in miR-1 and miR-133a expression. [score:5]
It is tempting to speculate that endurance exercise subsequent to resistance exercise counteracted any attenuation of miR-1 expression shown previously following resistance exercise with protein ingestion (Drummond et al., 2008). [score:3]
The array contained 13 common miRNAs previously shown in the literature to be regulated following resistance or endurance exercise, and amino acid ingestion in human skeletal muscle including hsa-miR-1, hsa-miR-9-3p, hsa-miR-16-5p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-miR-31-5p, hsa-miR-133a-3p, hsa-miR-133b, hsa-miR-181a-5p, hsa-miR-378a-5p, has-miR-451a, hsa-miR-486-5p, and hsa-miR-494-3p. [score:2]
There were no changes post-exercise or between groups for miR-1, -16, -31, -133a, and -451a (Table 1). [score:1]
In vitro gain- and loss-of-function studies investigating potential cause-effect between miR-1 expression and IGF-I signal transduction are required to determine any role in the specificity of training adaptation in human skeletal muscle. [score:1]
[1 to 20 of 7 sentences]
65
[+] score: 24
We speculate miR-1 and miR-133a are indirect targets of miR-320a downstream of SRF. [score:4]
Indeed, the expression of miR-1 and miR-133a were regulated by miR-320a. [score:4]
MiR-1, miR-133a and other targets of SRF may contribute to the development of atherosclerosis and CAD. [score:4]
Interestingly, the expression miR-1 and miR-133a, miRNAs regulated by SRF 21, were significantly decreased by miR-320a transfection in vivo and in vitro (Fig. 4F and G). [score:4]
Interestingly, recent studies have shown that SRF regulates the expression of miR-1 and miR-133a, miRNAs important for cardiac and skeletal muscles 46, 47. [score:4]
We detected the expressions of miR-1 and miR-133a by real-time PCR in aorta of miR-320a treated mice and endothelium cells treated with miR-320a. [score:3]
Our data reveal links among SP1, miR-320a, SRF and miR-1/miR-133a in endothelial dysfunction in atherosclerosis. [score:1]
[1 to 20 of 7 sentences]
66
[+] score: 24
Other miRNAs from this paper: hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-1-1, hsa-mir-133b
We show that a single transfection with miR-1 and miR-133a along with induced expression of GATA4, TBX5, MEF2C, MYOCD, and NKX2-5 activates expression of TNNT2, upregulates a cohort of cardiac-specific genes, and allows generation of intracellular Ca [2+] transients. [score:8]
They argued that miR-1 and miR-133 can directly activate MEF2C expression and thus make its addition dispensable. [score:4]
We determined that a single delivery of miR-1 and miR-133a at the beginning of the process, followed by continuous (2 weeks) induced expression of “GTMMN” significantly enhanced the cardio-inducing effect of the 5 cardiac TF as evidenced by the number of TNNT2 [+] cells detected: 3.8 ± 0.8% versus 0.21 ± 0.04% in “GTMMN” cultures without added microRNAs (p < 0.0001) (Fig. 2A). [score:3]
Based on these findings, in all subsequent experiments we induced cell transdifferentiation using an initial delivery of miR-1 and miR-133a followed by continuous induced expression of “GTMMN”. [score:3]
A single delivery of miR-1 and miR-133a at the beginning of the process was sufficient to induce significant expression of TNNT2. [score:3]
MicroRNAs were purchased from Thermo Scientific: hsa-miR-1 (MIMAT0000416, C-300585-05-0005), and hsa-miR-133a (MIMAT0000427, C-300600-05-0005). [score:1]
To this end, we tested the capacity of miR-1 and miR-133a to induce HDF transdifferentiation when delivered alone or in combination with “GTMMN”. [score:1]
Finally, Nam et al. performed a large-scale screen determining that GATA4, TBX5, HAND2, and MYOCD along with microRNAs miR-1 and miR-133 were the most effective at inducing transdifferentiation of neonatal or adult human foreskin fibroblasts into iCML cells 12. [score:1]
[1 to 20 of 8 sentences]
67
[+] score: 23
Furthermore, in miR-1-2 mutants, the observed abnormality in the propagation of cardiac electrical activity, despite normal anatomy and function, was correlated with the upregulation of the direct target Irx5, a transcription factor, resulting in ventricular repolarization abnormalities and a predisposition to arrhythmias. [score:7]
While it is likely that mice lacking both miR-1-1 and miR-1-2 will have increasingly severe abnormalities, the range of defects upon the deletion of miR-1-2 highlighted the ability of miRNAs to regulate multiple diverse targets in vivo [63]. [score:4]
The subtle dysregulation of numerous developmental genes may contribute to the embryonic defects observed in miR-1-2 mutants. [score:3]
Clop et al. [41] demonstrated that the myostatin (GDF8) gene of Texel sheep is characterized by a G to A transition in the 3' UTR that creates a target site for mir-1 and mir-206, which are highly expressed in the skeletal muscle. [score:3]
For instance, miR-1-2 appears to be involved in the regulation of diverse cardiac and skeletal muscle functions, including cellular proliferation, differentiation, cardiomyocyte hypertrophy, cardiac conduction and arrhythmias [63]. [score:2]
Remarkably, the persistence in these mice of the other identical copy of miR-1-2 (that is, miR-1-1) did not compensate for the loss of miR-1-2, at least for many aspects of its function. [score:1]
miR-1, together with another heart-specific miRNA (miR-133a), is known to be transcribed by a duplicated bicistronic genetic locus (miR-1-1/miR133a-2 and miR-1-2/miR133a-1) sharing identical sequences of the mature miRNAs. [score:1]
Jiang et al. added one more piece to the puzzle represented by the miR-1/miR-133a cluster. [score:1]
Mice lacking miR-1-2 present a spectrum of abnormalities, ranging from ventricular septal defects and early lethality to cardiac rhythm disturbances. [score:1]
[1 to 20 of 9 sentences]
68
[+] score: 23
Only two miRNAs (hsa-miR-1 and hsa-miR-133b) were shared by both TRU- and non-TRU-type adenocarcinoma; two others—hsa-miR-494 and ebv-miR-BART19—were upregulated by > 5-fold whereas hsa-miR-551b was downregulated by > 5-fold in the non-TRU type relative to the TRU type, confirming that they are histologically and molecularly dissimilar. [score:7]
In addition to the three miRNAs that were differentially expressed between TRU-type and non-TRU-type adenocarcinomas, we found two miRNAs—miR-1 and miR-133b—that were downregulated in both subtypes. [score:6]
One study showed that miR-1 inhibits the tumorigenic properties of lung cancer cells by targeting Slug, a transcriptional repressor of E-cadherin and an inducer of epithelial-to-mesenchymal transition [23]. [score:5]
MiR-1 has been reported as a tumor suppressor in various cancers including NSCLC. [score:2]
Only two miRNAs (hsa-miR-1 and hsa-miR-133b) were down regulated in both adenocarcinoma subtypes relative to normal tissue. [score:2]
MiR-1 was also suggested to play an important role in the pathogenesis of NSCLC by regulating PIK3CA catalytic subunit alpha via the PI3K/Akt pathway [24]. [score:1]
[1 to 20 of 6 sentences]
69
[+] score: 23
As shown in Figure 6B, the CREB transcriptional targets AREG, Cyclin A and miR-130b showed an upregulated profile, whereas miR-1 appeared downregulated in Ccdc6 [−ex2/−ex2] mice with respect to the Ccdc6 [wt/wt] mice. [score:9]
Accordingly, in hyperplastic thyroids of Ccdc6 [−ex2/−ex2] mice, the expression analysis of CREB1 target genes revealed the upregulation of CREB1 associated to increased levels of AREG and Cyclin A, or decreased levels of miR-1, confirming the modulation of these gene by an enhanced CREB1 activity. [score:8]
In order to investigate whether the increase in the phosphorylation status may reflect the transcriptional ability of the thyroid cells, we have analysed the levels of some CREB1 target genes, such as AREG, Cyclin A, miR-130b (positively regulated by CREB1) and miR-1 (negatively regulated by CREB1) in hyperplastic thyroids of Ccdc6 [−ex2/−ex2] mice and controls. [score:3]
B. AREG, CCNA2, miR-1 and miR-130b genes expression by qRT-PCR from Ccdc6 [wt/wt] and Ccdc6 [−ex2/−ex2] thyroids. [score:3]
[1 to 20 of 4 sentences]
70
[+] score: 23
Other miRNAs from this paper: mmu-mir-1a-1, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-1b
After an exhaustive search for alterations that could be responsible for the observed reduction in IgfI mRNA, we found that miR-1 -a microRNA predicted to target IgfI- was significantly upregulated in a variety of tissues from Zmpste24 [−/−]mice. [score:6]
In addition, the observed upregulation of miR-1 likely contributes to the exacerbated suppression of liver IGF-1 synthesis, even in the presence of high circulating GH levels. [score:6]
After performing a series of specific luciferase assays, usually employed for microRNAs target validation, we could confirm that the 3'-UTR of Igf1 contains a functional binding site for miR-1, thereby demonstrating that miR-1 is a bona fide microRNA targeting Igf1 regulator [27, 29]. [score:5]
Since these experimental findings suggested a causal relationship between nuclear envelope defects and miR-1 upregulation, we decided to characterize in more detail the putative relevance of miR-1 as a specific microRNA involved in Igf1 control. [score:2]
Accordingly, it is tempting to speculate that the characteristic nuclear lamina abnormalities present in both HGPS and Zmpste24 [−/−] cells induce -by a yet unknown mechanism- an upregulation of miR-1, which in turn leads to a reduction in Igf1 mRNA cellular content and finally, to a decrease in circulating IGF-1 (Figure 1). [score:2]
In addition, miR-1 over-activation represses Igf1 synthesis, reinforcing the already reduced Igf1 transcription and compromising the circulating levels of Igf1. [score:1]
However, and although GH is able to stimulate the IgfI mRNA transcription in progeroid cells, the increased levels of miR-1 may contribute to block IGF-1 protein synthesis. [score:1]
[1 to 20 of 7 sentences]
71
[+] score: 23
Overexpression of miR-1 in infarcted myocardium can promote arrhythmogenesis, whereas arrhythmia could be alleviated through deleting endogenous miR-1. miR-208a, a cardiac-specific miRNA encoded by the intron of the myosin heavy chain gene Myh6, has also been demonstrated to play an important role in arrhythmogenesis [43], especially in the process of atrial depolarization, by regulating the expression of Connexin-40 (GJA5). [score:6]
miR-1 is tissue-specifically expressed in the heart and skeletal muscle, and genetic deletion of both miR-1-1 and miR-1-2 indicated that miR-1 is required for cardiomorphogenesis and the expression of many cardiac contractile proteins [7, 8]. [score:5]
For instance, it has been reported that miR-1 and miR-133, two most commonly expressed miRNAs in striated muscle, target several ion channel and gap-junction associated genes, such as HCN2, HCN4, KCNJ2, ERG and GJA1 (Cx43) [42]. [score:5]
Yang B. Lin H. Xiao J. Lu Y. Luo X. Li B. Zhang Y. Xu C. Bai Y. Wang H. The muscle-specific microRNA miR-1 regulates cardiac arrhythmogenic potential by targeting GJA1 and KCNJ2 Nat. [score:4]
However, it was reported in a separated study that a combination of miR-1, miR-133, miR-208, and miR-499 was able to directly induce the cellular reprogramming of fibroblasts into cardiomyocyte-like cells in vitro [18]. [score:2]
They treated human fibroblasts with four transcriptional factors, GATA-4, Hand2, Tbx5 and Myocardin [20], together with two miRNAs, miR-1 and miR-133. [score:1]
[1 to 20 of 6 sentences]
72
[+] score: 22
Other miRNAs from this paper: mmu-mir-1a-1, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-1b
Western blot analysis showed that while SAR405838 effectively and dose -dependently induces upregulation of p53, MDM2 and p21 proteins in the parental SJSA-1 and all the sublines obtained from in vivo SAR405838 treatment, it fails to induce robust upregulation of p53, p21 and MDM2 in both the MIR1 and MIR2 sublines obtained from in vitro SAR405838 treatment (Fig 5C). [score:7]
Since the activity of MDM2 inhibitors is known to depend upon wild-type p53, we analyzed p53 mutation by sequencing exons 2–11 in each of the three in vitro resistant sublines, (CMIR, MIR1 and MIR2) and found that they all harbor p53 mutation(s) in the DNA binding domain (S1A Table). [score:5]
The "hot spot" R273C mutation identified in both the MIR1 and MIR2 sublines and the C277F mutation identified in the CMIR subline are common DNA contact mutations [41]. [score:4]
While both the MIR1 and MIR2 sublines contain a single R273C p53 heterozygous mutation, the CMIR subline contains two heterozygous p53 mutations, L130R and C277F. [score:3]
Our data show that treatment of the SJSA-1 cells in vitro with either a fixed concentration of SAR405838 or with stepwise increments of concentration of SAR405838 yields highly resistant subline lines (CMIR, MIR1 and MIR2), which are 100-times less sensitive to the drug than the parental SJSA-1 cell line based upon IC [50] values. [score:1]
This yielded two sublines (MIR1 and MIR2). [score:1]
B, Protocol to establish the MIR1 and MIR2 cell lines by treating the SJSA-1 cells with stepwise increments of concentration of SAR405838. [score:1]
[1 to 20 of 7 sentences]
73
[+] score: 22
Other miRNAs from this paper: mmu-mir-1a-1, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-1b
WNV infection of or SFV-sfRNA replication in mosquito cells upregulated the levels of GATA4 mRNA so did the ectopic expression of pre-KUN-miR-1 alone from a plasmid DNA or from SFV replicon. [score:6]
Importantly, knock-down of GATA4 led to a reduction in WNV replication analogous to that observed with a KUN-miR-1 inhibitor. [score:4]
KUN-miR-1 was demonstrated as important for the WNV lifecycle in mosquitoes, as a specific inhibitor of this miRNA greatly reduced virus replication in mosquito cells. [score:3]
WNV sfRNA was deemed the likely source of KUN-miR-1 as expression of this RNA species from a heterologous Semliki Forest virus (SFV, an unrelated alphavirus) replicon was sufficient to lead to production of the functional KUN-miR-1 miRNA. [score:3]
In addition, a host mRNA target for KUN-miR-1 in mosquito cells was determined to be zinc-finger transcription factor GATA4. [score:3]
In addition, infection with FL-IRAdCS3 mutant WNV resulted in detection of diminished amounts of KUN-miR-1, although it also coincided with diminished viral RNA replication. [score:1]
The observation that sfRNA is a Dicer substrate corresponds with the production of KUN-miR-1 from the 3'UTR/sfRNA that was shown to be mediated by insect Dcr-1 [62]. [score:1]
Recently we identified the first flavivirus-derived miRNA, KUN-miR-1, in WNV-infected mosquito cells [62]. [score:1]
[1 to 20 of 8 sentences]
74
[+] score: 22
Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42]. [score:8]
Application of MREs of miR-1, miR-133 and miR-218 restrained exogenous gene expression within bladder cancer cells. [score:3]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
Bladder cancer-specific expression of TRAIL genes was achieved by employing MREs of miR-1, miR-133 and miR-218. [score:3]
AACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACC AAGCACAAACAAACACC AAGCACAA-3′), which contained two copies of miR-1 MREs, two copies of miR-133 MREs and two copies of miR-218 MREs. [score:1]
Ad-TRAIL-MRE-1-133-218 contained MREs of miR-1, miR-133 and miR-218 that were inserted immediately following TRAIL gene. [score:1]
[1 to 20 of 7 sentences]
75
[+] score: 22
RNA quantity and quality were assessed with NanoDrop ND 1000 spectrophotometer (NanoDrop Tech) and LabChip GX (Perkin Elmer) respectively before loading the samples on a HumanHT-12 v4.0 (mir-1 overexpression, non -targeting control) or HumanHT-12 v3.0 (all residual samples) Expression BeadChip (Illumina) in 4–6 biological replicates. [score:7]
82% of the validated targets for miR-1 [25] expressed in MCF 10A were down regulated, confirming the accuracy of the experimental strategy. [score:6]
But while down regulation of genes carrying canonical seed (CS) 2–8 target sites was the most prominent feature in the miR-1 control experiment (Figure S1 in File S1, middle panel), CS matches were only the third most enriched word for miR-4728-3p. [score:4]
In lieu of applying routine target prediction algorithms, we then performed a motif search on microarray data from six biological replicates 32 hours after transfection of miR-4728-3p and controls including miR-1. We identified over-represented stretches of consecutive bases (“words”) in the 3' untranslated regions (UTRs) of genes from ranked gene lists and calculated the statistical significance of their enrichment using SylArray [22]. [score:3]
This observation is analogous to the CS site of miR-1 in the control experiment (Fig. S1 in File S1). [score:1]
Additionally, we transfected MCF 10A in a control experiment with a mimic of human miR-1, a well-characterized gene involved in the differentiation of smooth and skeletal muscles, normally not expressed in breast cell lines. [score:1]
[1 to 20 of 6 sentences]
76
[+] score: 22
The possibility of functional compensation among myogenesis miRNAs, to some extent, can explain why knockdown or knockout of miR-1 do not result in obvious defects. [score:3]
The expression level of miR-1 or myogenin was normalized to that of dTuD-Ctrl. [score:3]
Similar to miR-1, knockout of miR-206 shows no obvious defect in muscle development [31]. [score:3]
Inhibitory effect of dTuD-miR-1 in mice. [score:3]
It has been reported that even knockout of miR-1 in mice shows no apparent phenotypic consequences in skeletal muscle [30]. [score:2]
In our study, knockdown of miR-1 in mice did not lead to any defect. [score:2]
To test the effect of dTuD in vivo, dTuD against miR-1 (dTuD-miR-1) and scramble control (dTuD-Ctrl) were administrated to mice by intraperitoneal injection every two weeks, in total three injections (Fig 6A). [score:1]
0143864.g006 Fig 6(A) Schematic representation of dTuD-miR-1 intraperitoneal administration into mice. [score:1]
Body weight changes of mice injected with dTuD-miR-1 and dTuD-Ctrl from 2 to 8 weeks of age. [score:1]
miR-1 and -206 are well-established myogenesis and play critical roles in muscle differentiation [24, 29]. [score:1]
We observed that both miR-1 (63%, p < 0.001) and myogenin protein (34%, p < 0.01) were significantly reduced in gastrocnemius muscles two weeks after the last injection (Fig 6B and 6C). [score:1]
There were no significant (p > 0.05) changes in body weight that received the dTuD-miR-1 (S4 Fig). [score:1]
[1 to 20 of 12 sentences]
77
[+] score: 21
Among the down-regulated miRNAs, miR-133a and miR-1, as well as miR-30a-3p and miR-30a-5p, have a common chromosomal locus on chromosome 6 and chromosome 18 respectively and also display highly correlated expression levels. [score:6]
In addition, miR-1 over -expression has been shown to cause expression of differentiated muscle cell mRNA [43]. [score:5]
Similarly, miR-1, miR-551b, miR-137, miR-30a-3p and miR-30a-5p were all expressed at lower levels in embryonic stem cells relative to differentiated cells. [score:3]
Tumor specimens showed highly significant and large fold change differential expression of the levels of 39 miRNAs including miR-135b, miR-96, miR-182, miR-183, miR-1, and miR-133a, relative to normal colon tissue. [score:3]
The decreased levels of miR-1 and miR-133a in dMMR tumors relative to pMMR tumors may also explain why sporadic CC with dMMR show poor differentiation. [score:1]
miR-1, miR-133a, miR-328 and miR-9 are further decreased in dMMR tumors relative to pMMR tumors. [score:1]
This is further supported by the observed decreases in miR-1 and miR-133a, which are involved in maintaining the differentiation status of muscle cells [42]. [score:1]
Figures Array data was validated by by qRT-PCR for 10 miRNAs (mir-1, miR-10b, miR-135b, miR-147, miR-31, miR-33, miR-503, miR-552, miR-592, miR-622). [score:1]
[1 to 20 of 8 sentences]
78
[+] score: 21
In a mouse mo del, the regulation of this pathway has also been found to be mediated by miR-1, which is downregulated in many cancers and inhibits cancer cells growth and proliferation, and promotes apoptosis [128]. [score:7]
Circulating miR-1, miR-208a and miR-133a are overexpressed in the following 2 h after an acute myocardial infarction [106], and circulating miR-423-5p is upregulated in heart failure [107, 108]. [score:6]
The role of miR-1 in aging has been revealed in a progeria mouse mo del, where it has been found that miR-1 is upregulated in liver irrespective of GH levels [129]. [score:4]
Han C. Shen J. K. Hornicek F. J. Kan Q. Duan Z. Regulation of microRNA-1 (miR-1) expression in human cancerBiochim. [score:4]
[1 to 20 of 4 sentences]
79
[+] score: 21
Moreover, miR-1, -206 and -29 usually target G1/S-specific cyclin-D2 (CCND2), a cell-cycle protein found to be upregulated in several malignancies, and repress its translation [78, 79]. [score:8]
Li L. Sarver A. L. Alamgir S. Subramanian S. Downregulation of microRNAs miR-1, -206 and -29 stabilizes PAX3 and CCND2 expression in rhabdomyosarcomaLab. [score:6]
miR-1 and mir-206 are further miRNAs that are downregulated in both embryonal and alveolar rhabdomyosarcoma [78]. [score:4]
Consequently, miR-29, miR-1 and miR-206 have potential tumour-suppressive functions; therefore, their mimics may be used in the treatment of rhabdomyosarcoma. [score:3]
[1 to 20 of 4 sentences]
80
[+] score: 21
Other miRNAs from this paper: mmu-mir-1a-1, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-1b
With a “GMTEMMZ plus one” strategy, our single-cell qPCR assay of reprogrammed human iCM disclosed that an additional reprogramming factor helps GMTEMMZ to activate specific cardiac gene(s) (S3 Fig); more importantly, the expression profile of those 46 genes could estimate the overall quality of reprogramming in individual iCMs and revealed that additional HAND2 or microRNA-1 could facilitate the early progress of iCM reprogramming, indicated by a decreased subpopulation of fibroblast-like iCMs with decreased expression of fibroblast genes and enhanced activation of cardiac genes. [score:4]
S3 FigViolin plots of single cell qPCR showed the expression of the 46 identified genes in the populations of iCMs reprogrammed by 7 factors (7Fs) GMTEMMZ plus one extra factor, including HAND2, RXRG, SMYD1, TBX20, and microRNA-1. H9CMs, H9Fs, 4-week, and 12-week GMTEMMZ-reprogrammed iCMs were included as control groups. [score:3]
MicroRNA-1 significantly increased the activation of RYR2, CASQ2, MYH6, MYH7, TNNI1, and LMOD2, but decreased the expression of MYL9 and MYOZ2. [score:2]
We found that microRNA-1 had no significant influence on the efficiency of αMHC-mCherry [+] and cTnT [+] iCMs reprogrammed by GMTEMMZ (S2B Fig and Fig 4D). [score:1]
Most importantly, the fibroblast-like population was significantly decreased in those 4-week iCMs reprogrammed by GMTEMMZ plus HAND2 or microRNA-1 (Fig 5B), while RXRG, SMYD1 and TBX20 had no significant influence on the overall quality of reprogrammed iCMs and the CM-like subpopulation was significantly increased in 12W-7Fs-iCMs. [score:1]
HAND2 and microRNA-1 facilitated the early progress of human iCM reprogramming. [score:1]
C) Representative FACS plots showing the effect of microRNA-1 (miR1) on the induction of αMHC-mCherry [+] (upper panel) or cTnT [+] (lower panel) iCMs reprogrammed by 7Fs. [score:1]
Importantly, our study reveals that introducing additional HAND2 or microRNA-1 together with GMTEMMZ could facilitate the early progress of iCM reprogramming with improved activation of cardiac genes and silence of fibroblast genes. [score:1]
A) A t-SNE embedding was utilized to visualize the overall reprogramming degree in individual iCMs reprogrammed by 7Fs plus one extra factor, including microRNA-1 (n = 39), HAND2 (n = 61), RXRG (n = 18), SMYD1 (n = 74), and TBX20 (n = 74). [score:1]
0183000.g005 Fig 5A) A t-SNE embedding was utilized to visualize the overall reprogramming degree in individual iCMs reprogrammed by 7Fs plus one extra factor, including microRNA-1 (n = 39), HAND2 (n = 61), RXRG (n = 18), SMYD1 (n = 74), and TBX20 (n = 74). [score:1]
Additional HAND2 or microRNA-1 could facilitate the progress of human iCM-reprogramming by GMTEMMZ 7 factors (7Fs). [score:1]
C-D) The effect of adding one extra transcription factor (C) or microRNA-1 (D) on the induction of αMHC-mCherry [+] (upper panel, n = 6) or cardiac troponin T (cTnT [+], lower panel, n = 4) iCMs reprogrammed by 7Fs. [score:1]
Our study demonstrated that additional HAND2 and microRNA-1 could help GMTEMMZ to facilitate the early progress of iCM-reprogramming in human cells. [score:1]
B) The quantification of three subpopulations in panel A showed that additional HAND2 or microRNA-1 significantly decreased the subpopulation of fibroblast-like reprogrammed iCMs, while the CM-like subpopulation was significantly enhanced only in 12W-7Fs-iCMs. [score:1]
The effect of adding one extra transcription factor or microRNA-1 on human iCM-reprogramming. [score:1]
[1 to 20 of 15 sentences]
81
[+] score: 21
The re-introduction of wild type Pten, strongly reduced the expression of the overexpressed miRs 132, 150, 155, 223 but increased the expression of the previously downregulated miRs-375, mir-377 and miR-1 (see Fig.   5e). [score:10]
The downregulated or lost miRs in our study, such as miR-1 and its cluster partner miR-133, are tumour suppressor miRs, previously identified as consistently downregulated in primary prostate tumours [39]. [score:9]
Hudson RS MicroRNA-1 is a candidate tumor suppressor and prognostic marker in human prostate cancerNucleic Acids Res. [score:2]
[1 to 20 of 3 sentences]
82
[+] score: 20
In contrast, analysis of miRNA levels in mdx TA muscle sections harvested at the same time as the serum samples showed upregulation of miR-1 expression immediately after exercise, but downregulation at later time points (Figure 3C). [score:9]
Similarly, post hoc analysis demonstrated a significant increase in miR-1 abundance immediately after exercise and a significant increase in miR-133a abundance 7 days after exercise. [score:1]
In the present study, we observed that miR-1 was the most strongly induced miRNA immediately after exercise in both serum and muscle (Figure 2). [score:1]
Importantly, miR-1 exhibited a similar increase in abundance 5 days after exercise as observed in the downhill exercise experiment (Figure 2), possibly coupled to the regenerative phase. [score:1]
Notably, miR-1, miR-133 and miR-206 are among the most abundant miRNA species in myocytes (compromising more than 25% of all miRNAs) (26) and are involved in the control of muscle homeostasis by coordinating both myoblast proliferation and differentiation (27, 28). [score:1]
Despite slightly differing patterns of release, after 9 days the absolute levels of myomiRs in the media were similar for miR-206 (0.4 million copies/ml) and miR-133a (0.2 million copies/ml) and somewhat lower for miR-1 (0.04 million copies/ml). [score:1]
Furthermore, the exercised and unexercised group behaved significantly different for miR-1 and miR-133a (P-value of group factor P <  0.05). [score:1]
As with the primary human myoblasts, cellular and secreted levels of myomiRs in C2C12 cells were likewise strongly correlated (Pearson coefficients: 0.9291 (miR-1), 0.8878 (miR-133a), 0.8937 (miR-206); all P <  0.0001,, Table S7) whereas the non-myomiR controls were not correlated (miR-31 and let7-a) or had weak correlation coefficients (miR-16). [score:1]
Previously, similar observations were made for miR-1 in human skeletal muscle after various types of exercise both immediately following the ex ercise as well as up to 10 days later (depending on the mode of exercise and the training status of the individual) (59–61). [score:1]
Interestingly, it has been shown that administration of exogenous miR-1, miR-133, and miR-206 oligonucleotides in rats accelerates muscle regeneration (62). [score:1]
Most importantly, miR-1, miR-133a and miR-206 dynamics followed a similar pattern in both mouse strains (P-value of interaction factor P > 0.05 for all myomiRs, i. e. not significant). [score:1]
Notably, cellular miRNA and secreted ex-miRNA levels were positively correlated for all myomiRs (Pearson coefficients: 0.7809 (miR-1), 0.7515 (miR-133a), 0.8219 (miR-206); all P <  0.01,, Table S7). [score:1]
[1 to 20 of 12 sentences]
83
[+] score: 19
Dai et al. [27] confirmed the mechanism in which miR-1 and miR-206 positively regulate bovine skeletal muscle satellite cell myogenic differentiation via the downregulation of PAX7 and HDAC4. [score:5]
MiR-1 and miR-206 were also found to inhibit PAX3 [28] and NOTCH3 [29] allowing differentiation to proceed. [score:3]
A few high-throughput studies have confirmed some of the identified miRNAs (miR-1, miR-128, miR-133a, miR-133b, miR-206, miR-222, and miR-503) as common for skeletal muscle development in mouse, human, pig, common carp [11], and cattle [25]. [score:2]
Cell culture experiments have shown that miR-1 and miR-206 promote muscle cell differentiation, whereas miR-133 enhances cell proliferation. [score:1]
On the basis of a functional analysis, we assigned 9 miRNA as molecules responsible for differentiation progression (miR-1, -128a, -133a, -133b, -139, -206, -222, -486, and -503). [score:1]
Among them, 9 miRNA were classified as involved in myoblast differentiation (miR-1, -128, -133a, -133b, -139, -206, -222, -486, and -503). [score:1]
According to the aforementioned database, a majority of the analyzed molecules were engaged in the myogenesis process (miR-1, -29b, -128, -133a, -133b, -139, -206, -222, -449a, -486, and -503). [score:1]
Among them were muscle-specific myomiRs miR-1, -133a, -206, and miR-486 and non-myomiRs such as miR-9-5p, -128, -139, -145, -503, and -660. [score:1]
The combined action of miR-133 and myomiRs (miR-1 and -206) induces MYOD1, PAX7, and myogenin causing myoblast differentiation [33]. [score:1]
Among them, the well-known muscle-specific miRNAs miR-1, -133a, -133b, and -206; also called myomiRs [11]. [score:1]
It is plausible that in HER/LIM cells, the differentiation progression is accelerated via similar mechanisms involving miR-1, miR-133, miR-206, and myogenin, resulting possibly in enhanced myotube formation observed in the primary cultures of the skeletal muscle with a HER/LIM origin (Fig. 1). [score:1]
Moreover, some of identified molecules were also annotated as taking part in myoblast proliferation (miR-1, -128, -133a, -133b, -139, and -206); myocyte function (miR-31, -133a, -145, and -222); myoblast fusion (miR-206, -222, and -486); and satellite cell activation (miR-1 and -206) (Fig.   3). [score:1]
[1 to 20 of 12 sentences]
84
[+] score: 19
Yoshino H. Enokida H. Chiyomaru T. Tatarano S. Hidaka H. Yamasaki T. Gotannda T. Tachiwada T. Nohata N. Yamane T. Tumor suppressive microRNA-1 mediated novel apoptosis pathways through direct inhibition of splicing factor serine/arginine-rich 9 (SRSF9/SRp30c) in bladder cancer Biochem. [score:6]
Yoshino H. Chiyomaru T. Enokida H. Kawakami K. Tatarano S. Nishiyama K. Nohata N. Seki N. Nakagawa M. The tumour-suppressive function of miR-1 and miR-133a targeting tagln2 in bladder cancer Br. [score:5]
Furthermore, HO-1 is a potent regulator of miRNAs [30], inhibiting among others miR-133a, miR-133b, and miR-1 [30]. [score:4]
Wang T. Yuan J. Feng N. Li Y. Lin Z. Jiang Z. Gui Y. Hsa-miR-1 downregulates long non-coding rna urothelial cancer associated 1 in bladder cancer Tumour Biol. [score:4]
[1 to 20 of 4 sentences]
85
[+] score: 19
Developmental stage of O. felineus miRNAs AdultNoEggs & Adult+Eggs & Metacercaria let-7, miR-1, miR-2(a,b,c,d,e), miR-36, miR-71(a,b), miR-124, miR-125, miR-133, miR-190 AdultNoEggs & Adult+Eggs bantam, miR-281(miR-46 family) AdultNoEggs & Metacercaria miR-7 Metacercaria miR-10Candidate sequences for novel miRNAs (S4 Table) were selected from reads without matches to miRBase sequences after mapping them to the C. sinensis genome and processing the genomic fragments encompassing the resultant hits through the secondary structure filter (see ). [score:2]
Developmental stage of O. felineus miRNAs AdultNoEggs & Adult+Eggs & Metacercaria let-7, miR-1, miR-2(a,b,c,d,e), miR-36, miR-71(a,b), miR-124, miR-125, miR-133, miR-190 AdultNoEggs & Adult+Eggs bantam, miR-281(miR-46 family) AdultNoEggs & Metacercaria miR-7 Metacercaria miR-10 Candidate sequences for novel miRNAs (S4 Table) were selected from reads without matches to miRBase sequences after mapping them to the C. sinensis genome and processing the genomic fragments encompassing the resultant hits through the secondary structure filter (see ). [score:2]
Upon analysis by Jin et al. [45], the genomic regions with matches for miR-1 and miR-133 were designated as orthologous miRNA gene clusters in three flatworms, namely the cestodes E. granulosus, E. multilocularis and H. microstoma. [score:1]
We then explored the genomic context beyond the cluster-like regions miR-1/miR-133 in the five flatworm species using information from the C. sinensis database (http://fluke. [score:1]
Cluster-like regions miR-1/miR-133. [score:1]
miR-1, miR-133 and putative miR-1, miR-133. [score:1]
Genomic organization scheme of cluster-like regions miR-1/miR-133 in five flatworms. [score:1]
The ortholog search for the miRNAs of the three opisthorchiids yielded 19 conserved miRNAs belonging to 13 families (bantam, let-7, miR-1, miR-2, mir-7, miR-10, miR-36, miR-46, miR-71, miR-124, miR-125, miR-133, and miR-190) (Fig 2A, Table 1, S3 Table). [score:1]
The alignments of some miRNAs (two miR-71/ miR-2 clusters, miR-1, miR-133, and miR-190) with sequences of these miRNAs orthologs (obtained from S. mediterranea, G. salaris, S. mansoni, S. japonicum, E. granulosus, E. multilocularis, H. microstoma and T. solium genomes) were performed using the program CLUSTALW [68]; miRNA sequences of T. solium, namely miR-1, miR-2b, miR-2c, miR-71, miR-133, miR-190, were obtained by homology search of these miRNAs in T. solium genome (http://www. [score:1]
Gene prediction in region between miR-1 and miR-133. [score:1]
Genes around miR-1 and miR-133 in the flatworms genomes. [score:1]
Hence, due to the distance between the sites corresponding to the miRNAs in flatworms, as well as the capability to predict protein-coding genes in between these sites, we suggest referring to these regions as “cluster-like regions miR-1/miR-133”, which form a putative synteny group. [score:1]
Hence, we referred to the regions as “cluster-like regions miR-1/miR-133”. [score:1]
miRNA Genomes C. sinensis S. mansoni S. japonicum bantam + + + let-7 + + + miR-1 + + − miR-2a + + + miR-2b + + + miR-2c + + + miR-2d + + + miR-2e + + + miR-7 + + + miR-10 + + + miR-36a + + + miR-36b + − − miR-281 + + + miR-71a + + + miR-71b + + + miR-124 + + + miR-125 − + + miR-133 + + + miR-190 + + + Mapped miRNA is designated by plus; unmapped—by minus. [score:1]
This could be due to the incompleteness of either genome assembly (miR-125 was not found in C. sinensis genome) or indeed by the species specificity of miRNA genes (we did not find the opisthorchid miR-1 in S. japonicum genome, we also did not locate opisthorchid miR-36b in either schistosome genome). [score:1]
In previous papers, the combination of the miR-1/miR-133 miRNA genes was described also as a miRNA cluster for many animal species (see data in miRBase) [74] including flatworms [45]. [score:1]
We also found that miR-1 mapped near a gene encoding another Mind bomb protein in the genomes of S. mansoni, E. granulosus and E. multilocularis (S7 Table). [score:1]
[1 to 20 of 17 sentences]
86
[+] score: 19
All of the miRNAs that were confirmed downregulated in clinical samples compared to bone are known to act as tumor suppressors in other types of cancers, that is miR-1, miR-126/miR-126*, miR-133b, miR-144, miR-195, miR-223 and miR-497 [38], [39], [40], [41], [42], [43]. [score:5]
The highly downregulated miRNAs presented in Table 1 were miR-126/miR-126*, miR-142-3p, miR-150, miR-223, miR-363, miR-486-5p and members of the miR-1/miR-133a, miR-206/miR-133b, miR-451/miR-144 and miR-497/miR-195 clusters. [score:4]
Among these, miR-126/miR-126*, miR-142-3p, miR-150, miR-223, miR-486-5p and members of the miR-1/miR-133a, miR-144/miR-451, miR-195/miR-497 and miR-206/miR-133b clusters were found to be downregulated in osteosarcoma cell lines. [score:4]
A set of miRNAs, miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-142-3p, miR-133b, miR-144, miR-195, miR-223, miR-451 and miR-497 was identified with an intermediate expression level in osteosarcoma clinical samples compared to osteoblasts and bone, which may reflect the differentiation level of osteosarcoma relative to the undifferentiated osteoblast and fully differentiated normal bone. [score:2]
As predicted, the 13 miRNAs miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-133b, miR-142-3p, miR-144, miR-195, miR-223, miR-451 and miR-497 showed opposite regulation when the osteosarcoma clinical samples were compared against bone or osteoblasts. [score:1]
miR-144 was undetected in all osteoblasts, and miR-1 and miR-451 was undetected in two and three of the osteoblast samples, respectively. [score:1]
The level of change was significant for nine of these miRNAs; miR-1, miR-9, miR-18a, miR-18b, miR-126, miR-133b, miR-144, miR-195 and miR-223. [score:1]
These 13 miRNAs include all the above seven miRNAs (omitting miR-31*) previously described in osteoblasts [8] as well as miR-1, miR-18a, miR-18b, miR-19b, miR-133b and miR-144. [score:1]
[1 to 20 of 8 sentences]
87
[+] score: 19
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
In rat thyroid cells, many miRNAs such as miR-1, miR-28a, and miR-296-3p are differentially expressed and possibly they target transcripts that are important in thyroid cell proliferation (Leone et al. 2011). [score:5]
In another study, four miRNAs (miR-1, miR-27a, miR-133a, and miR-206) were differentially expressed during skeletal muscle development of Nile tilapia (Yan et al. 2012a). [score:4]
Similarly, by comparing skeletal muscle of different stages (larvae, 1-, and 2-year old) of common carp (Cyprinus carpio), Yan et al. (2012) reported an increase in miR-1, miR-21, miR-133a-3p, and miR-206 expression with age. [score:3]
In their mo del, MRFs activate miR-1/miR-206 in the committed myoblasts, and these miRNAs target residual pax3 during the progenitor-to-myoblast transition, and they control transitional timing by repressing pax3. [score:3]
Xia et al. (2011) miR-1, miR-101a, miR-130b,c, miR-133a, miR-221, and miR-499 Zebrafish NGS, qRT–PCR ? [score:1]
In zebrafish embryos, miR-1 and miR-133 were implicated in shaping sarcomeric actin organization (Mishima et al. 2009). [score:1]
For instance, a single-nucleotide polymorphism (SNP) at the 3′-UTR of mystotin gene in Texel sheep allows binding by miR-1 and miR-206, which in effect creates muscular hypertrophy (Clop et al. 2006). [score:1]
Soares et al. (2009) let-7i, miR-15b, miR-17a-3p, miR-21, miR-92b, miR-128, miR-133, miR-146a,b, miR-150, miR-194a, miR-204, miR-210-3p, miR-301a, miR-429, miR-730, miR-733, miR-738, Zebrafish Microarray, northern blot, qRT-PCR, ISH Yin, Lepilina, et al. (2012) Muscle miR-1, miR-21, miR-133a,b,c, miR-203b Zebrafish NGS, qRT–PCR ? [score:1]
[1 to 20 of 8 sentences]
88
[+] score: 18
Other miRNAs from this paper: hsa-mir-1-1, hsa-mir-29c
We found that miR-1 expression was also down-regulated in normal prostate and uterus tumors in MCC data. [score:6]
In MCC data, miR-1 was found to be differentially expressed between normal and tumoral colon samples as was also observed in [34]. [score:3]
Furthermore, some of the targets predicted by TaLasso for miR-1 were related to the cancers in MCC data: for instance, MCM7, related to prostate cancer progression [35] and TAGLN2, a colorectal cancer biomarker [35]. [score:3]
However, GenMiR++ predicted two of those miR-1 targets in the top 500 interactions. [score:3]
for Multi Class Cancer (MCC) data A large amount of experimentally-validated interactions within the top 500 predicted by TaLasso corresponded to miR-1. This did not occur to the top 500 interactions of GenMiR++ and Pearson Correlation. [score:1]
A large amount of experimentally-validated interactions within the top 500 predicted by TaLasso corresponded to miR-1. This did not occur to the top 500 interactions of GenMiR++ and Pearson Correlation. [score:1]
Although miR-1 is muscle specific, we found relationships between miR-1 and cancer. [score:1]
[1 to 20 of 7 sentences]
89
[+] score: 18
We first tested the feasibility by examining the 2 kb-upstream sequence of the miR-1 cluster at chromosome 18 in the muscle-specific expression group because a number of myogenic factors are known to bind to the upstream sequences of muscle-specific miRNAs [20]. [score:3]
The pseudocolor scale is the same as that in Figure 3. Group I (r = 0.937) that contains miR-1 and miR-133a/b showed highest expression in different parts of the heart and skeletal muscle as well as in vena cava, and in, unexpectedly, thyroid. [score:3]
However, it was not previously appreciated that much lower expression of miR-1 and miR-133a/b was seen in some non-heart, non-skeletal muscle tissues. [score:3]
These are "hollow" organs composed of smooth muscle-containing wall, such as the gastrointestinal system, suggesting that expression of miR-1 and miR-133a/b might mark some features shared by different muscle types (i. e., skeletal, cardiac, and smooth). [score:3]
The pseudocolor scale is the same as that in Figure 3. Group I (r = 0.937) that contains miR-1 and miR-133a/b showed highest expression in different parts of the heart and skeletal muscle as well as in vena cava, and in, unexpectedly, thyroid. [score:3]
Click here for file The "regulogram" of the genomic sequence close to the hsa-miR-1-2 locus where MyoD binding site was identified. [score:1]
The "regulogram" from GenomeTraFac showed the genomic sequence close to the hsa-miR-1-2 locus where MyoD binding site was identified. [score:1]
The "regulogram" of the genomic sequence close to the hsa-miR-1-2 locus where MyoD binding site was identified. [score:1]
[1 to 20 of 8 sentences]
90
[+] score: 18
Interestingly, ft, a transcriptional target of Yki in the Hippo pathway, which is deregulated in lgl mutant tissue (Grifoni et al., 2015; Grzeschik et al., 2010b; Khan et al., 2013), was upregulated in lgl mutant tissue, and is a predicted target for miR-1, suggesting that post-transcriptional regulation of Hippo pathway genes might also be controlled by Lgl. [score:10]
MiR-1 downregulation cooperates with MACC1 in promoting MET overexpression in human colon cancer. [score:5]
Of these, a core set of 10 miRNAs was found to be consistently dysregulated across all time points: let-7, miR-210, miR-9a, miR-275, miR-1, miR-993, miR-100, miR-1004, miR-980 and miR-317 (Fig.  2E). [score:2]
Of the ten Drosophila miRNAs identified, let-7, miR-210, miR-1, miR-100, and miR-9a have homologues in humans as evidenced in miRBase (Griffiths-Jones et al., 2006). [score:1]
[1 to 20 of 4 sentences]
91
[+] score: 18
During zebrafish embryo development, miR-1 is known to express ubiquitously where as miR-144 and miR-142a-3p show strong expression in blood cells [35]. [score:6]
Previous studies of these miRNAs have implicated miR-1 in regulating muscle gene expression and miR-144 in zebrafish embryonic α-globin synthesis [23], [36]. [score:4]
However, to the best of our knowledge distinct functional roles of miR-144, miR-1 and miR-142a-3p in vascular development are yet to be explored. [score:2]
Of these, three miRNAs, miR -144, miR-1 and miR-142a-3p revealed specific non-overlapping phenotypes affecting vascular development. [score:2]
Of the eight-selected miRNA tested using zebrafish as a mo del system, we observed specific non-overlapping phenotypes affecting vascular development for three miRNAs, namely miR-1, miR-144 and miR-142a-3p (Figure 2). [score:2]
K,L,M - Zebrafish embryos injected with miR-1 display accumulation of blood cells in LDA/YSL. [score:1]
Microinjection of duplex miR-1 (10 µM) in zebrafish embryos showed accumulation of blood cells in lateral dorsal aorta (LDA) and yolk syncitial layer (YSL) with disrupted blood flow at 2 dpf in approximately 60% of injected animals (n = 56/93). [score:1]
[1 to 20 of 7 sentences]
92
[+] score: 18
Given the requisite role of miR-1 and miR-133 in cell survival and development, it is convincing to believe that the redundant transcription complexes directing miR-1 and miR-133a expression are elegantly developed to ensure cells to survive under evolutionary pressure. [score:5]
MiR-1 and miR-133 are muscle-enriched microRNAs, and they have been demonstrated as critical factors involved in both cardiac and skeletal muscle development and diseases [20- 25]. [score:4]
Given the importance of miR-1 and miR-133 in various cardiomyopathy developments, such as cardiac hypertrophy, understanding the precise control of SRF -mediated microRNA gene regulation in the heart will provide an additional perspective for the treatment of SRF dysfunction -mediated cardiomyopathy. [score:3]
Both miR-1 and miR-133 also participate in cardiomyopathy development including cardiac hypertrophy [25, 28], cardiac fibrosis [29, 30], and arrhythmia [30, 31]. [score:2]
Given that individual microRNAs regulate potentially dozens of genes, functions of miR-1 and miR-133 in cardiac muscle and skeletal muscle can be quite distinct [23, 26, 27]. [score:2]
For skeletal muscle, miR-1 facilitates myogenesis, and miR-133 promotes myoblast proliferation [20]. [score:1]
Mice with miR-1-2 deletion develop ventricular septal defect (VSD), cardiomyocyte hyperplasia, and abnormal electrophysiology [27]. [score:1]
[1 to 20 of 7 sentences]
93
[+] score: 18
In mice, over -expression of miR-1 inhibits muscle proliferation [39]. [score:5]
miR-1 also regulates the development of cardiac hypertrophy [40]. [score:3]
In the heart, miR-1 targets the transcription factor Hand2, which accelerates the expansion of the cardiac muscle [37]. [score:3]
Previous studies have reported that in skeletal muscle, miR-1 is modulated by serum response factors (SRFs), such as MyoD and Mef2, which are muscle differentiation regulators [37]. [score:2]
For example, fru-miR-1 was abundant in skeletal muscle and the heart, as it is in many animals. [score:1]
The next-generation sequencing results of fru-miR-145-5p, fru-miR-1-3p, fru-miR-204-5p, fru-miR-9-3p and fru-miR-122-5p correlated well with those of q-PCR. [score:1]
For example, fru-miR-1-3p was muscle specific, fru-miR-196a-5p was skeletal muscle specific, fru-miR-499-5p was heart and slow muscle specific, fru-miR-204-5p was eye specific, fru-miR-9-3p was brain and eye specific, fru-miR-192-5p was intestine and liver specific, fru-miR-122-5p was liver specific, and fru-miR-202-5p was ovary specific. [score:1]
miR-1 plays a role in repressing embryonic stem cell differentiation into non-muscle cells in mice and humans [38]. [score:1]
In addition, arrhythmogenesis in infarcted rat hearts can be treated by injection with an antisense strand of miR-1 [41]. [score:1]
[1 to 20 of 9 sentences]
94
[+] score: 18
Expression levels of miR-1 are significantly downregulated in (A) human colorectal adenocarcinoma (conventional (n = 18), mucinous (n = 20) and chronic UC (n = 13) -associated CRC) tumor areas compared to matched R [0] margins and (B) colon carcinoma-like Caco-2 [D299G] cells compared to enterocyte-like Caco-2 [WT], as determined by qPCR. [score:4]
S1 FigExpression levels of miR-1 are significantly downregulated in (A) human colorectal adenocarcinoma (conventional (n = 18), mucinous (n = 20) and chronic UC (n = 13) -associated CRC) tumor areas compared to matched R [0] margins and (B) colon carcinoma-like Caco-2 [D299G] cells compared to enterocyte-like Caco-2 [WT], as determined by qPCR. [score:4]
In contrast, miR-1, miR-10a and miR-133a were downregulated in human CRC tumour tissues, regardless of the histological subtype (S1A, S2A and S3A Figs). [score:4]
Expression levels of miR-1 in human CRC patient samples and Caco-2 subclones. [score:3]
S4 FigExpression levels of (A) miR-205, (B) miR-373, (C) miR-1, (D) miR-10a and (E) miR-133a in different human colonic adenocarcinoma cell lines (LS 174T, HT-29, HCT 116 and SW480), in comparison to naïve (untransfected) Caco-2, Caco-2 [WT] and Caco-2 [D299G] cells, as determined by qPCR (n ≥ 2 samples/cell line). [score:3]
[1 to 20 of 5 sentences]
95
[+] score: 17
By the end of the year 2010, miR-199a-3p and miR-210 were found to suppress HBsAg expression by directly targeting the HBV S protein coding region and pre-S1 region, respectively [37]; miR125a-5p was then shown to interfere with the viral translation, down -regulating the expression of the surface antigen [38], while miR-1 increases HBV transcription by upregulating farnesoid X receptor α (FXRA), a nuclear receptors binding to the HBV core promoter and regulating HBV transcription and replication. [score:17]
[1 to 20 of 1 sentences]
96
[+] score: 17
TRAF6 and TAOK3 are inhibited by mir-373, GYK and APPBP2 are inhibited by mir-200a, TRAF6, TAOK3 and ZNF302 are inhibited by mir-141, CBX2 is inhibited by mir-1, APBB1 is inhibited by mir-148b, POLR3D is inhibited by mir-374b, NAE1 is inhibited by mir-503, and GTF2I is inhibited by mir-98. [score:17]
[1 to 20 of 1 sentences]
97
[+] score: 17
For instance, miR-10a interacts with the 5′UTR of mRNAs encoding ribosomal proteins to enhance their translation 35. miR-346 targets the 5′UTR of the receptor-interacting protein 140 (RIP140) mRNA to upregulate its expression 36. miR-1 has been also reported to represses translation in the cytoplasm, but positively enhances mitochondrial translation recently 37. [score:14]
Additionally, disruption of the miR-16 family through serum -induced cell cycle re-entry depends on both the seed and the 3′-end region sequences 40. miR-1 stimulates the translation of the mitochondrial genes ND1 and COX1 through its seed and 3′ profile sequences in an AGO2 -dependent and GW182-independent manner, respectively 37. [score:3]
[1 to 20 of 2 sentences]
98
[+] score: 17
miR-1, miR-133a, and miR-30c-2* were found to be downregulated in TAA when compared with control specimens (p < 0.05), whereas for downregulation of miR-30c-2* in AAA compared to control there were no changes in the expression of miR-1, -133a, and -29a in AAA (Figure 1). [score:7]
In opposition, miR-1, -29a, and -133a were found to be downregulated in TAA patients only. [score:4]
In contrast to TAA, expression of miR-1, -29a, and -133a were unaltered in AAA specimens. [score:3]
The real-time PCR assay was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems) for miRNAs (miR-1, miR-21, miR-29a, miR-30c-2*, miR-124a, miR-126, miR-133a miR-145, miR-146a, miR-155, miR-204, miR-221, miR-222 miR-331-3p, and miR-486-5p); and RNU44, internal control to analyze specific miRNA expression following the 2−ΔΔ Ct method. [score:2]
Ai J. Zhang R. Li Y. Pu J. Lu Y. Jiao J. Li K. Yu B. Li Z. Wang R. Circulating microRNA-1 as a potential novel biomarker for acute myocardial infarctionBiochem. [score:1]
[1 to 20 of 5 sentences]
99
[+] score: 17
Similar to miRNA-1, the co-expressed miRNA-133 has also been shown to be necessary for atrioventricular canal development in zebrafish [13]. [score:4]
Overexpression of miRNA-1 in Drosophila led to embryonic lethality because of an insufficient number of cardioblasts [15]. [score:3]
This expression profile was not observed for a group of well-known cardiac or muscle specific miRNAs (miR-1, miR-133a, miR-133b, miR-208a, miR-208b, miR-499-5p and miR-499-3p). [score:3]
Expression profile of (A) miRNA-940; (B) miR-1; (C) miR-133a; (D) miR-133b; (E) miR-499-3p; (F) miR-499-5p; (G) miR-208a; (H) miR-208b in different part of human hearts. [score:3]
For example, studies showed that knock-out miRNA-1-2 in mice resulted in fatal septal abnormalities together with thickened ventricular walls caused by persistent proliferation [14]. [score:2]
Furthermore, compared to well-known cardiac or muscle specific miRNAs (miR-1, miR-133a, miR-133b, miR-208a, miR-208b, miR-499-5p and miR-499-3p), miRNA-940 was the only one which is most highly expressed in the normal human right ventricular out-flow tract comparing to other chambers within the heart (Fig. 3). [score:2]
[1 to 20 of 6 sentences]
100
[+] score: 17
We have recently observed that miR-1 is downregulated in CRC with respect to matched normal tissues and we have demonstrated that this miRNA can downregulate MET expression in vitro CRC mo dels. [score:9]
In addition, re -expression of miR-1 in CRC cell lines leads to MET -driven reduction in cell proliferation and motility, thus suggesting that miR-1 can be a possible candidate for clinical trials of MET inhibitors in the treatment of metastatic CRC [70]. [score:5]
Several miRNAs have been identified which target MET oncogene, including miR-34a, miR-199, miR-206, and miR-1 that could be challenged in therapies for silencing MET. [score:3]
[1 to 20 of 3 sentences]