sort by

562 publications mentioning hsa-mir-122 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-122. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 377
The above results showed that over -expression of miR-194-5p or miR-122 negatively regulated the expression of SOX3, which affects the transcription and expression of the target gene TDGF-1 and then inhibits the biological behavior of GSCs. [score:12]
Abnormal expression of miR-122 in primary tumors appears to play important roles in the development of colorectal liver metastasis [29], and miR-122 can remarkbly inhibit the growth of hepatocellular carcinoma through down-regulation of the target gene MEF2D [30]. [score:11]
Down-regulation of the expression of miR-194-5p or miR-122 reversed the inhibitory effects of SOX2OT knockdown on SOX3 expression, which indicated that SOX2OT acts as a miR-194-5p or miR-122 sponge, and thus influences the biological behaviors of GSCs. [score:11]
We confirmed that TDGF-1 is a downstream target of SOX3, as shown in Fig. 4. To further detect whether miR-194-5p and miR-122 reduced TDGF-1 expression by down -regulating SOX3 expression, we detected TDGF-1 protein expression via western blotting. [score:10]
As shown in Fig.   8a and b, SOX2OT inhibition, miR-194-5p over -expression, miR-122 over -expression and SOX2OT inhibition combined with over -expression of both miR-194-5p and miR-122 produced smaller tumors compared with the control group. [score:10]
Decreasing the expression of SOX2OT or increasing the expression of miR-194-5p or miR-122 inhibited SOX3 expression. [score:9]
Moreover, silencing SOX2OT increased the expression of miR-194-5p and miR-122, and knockdown of SOX2OT inhibited the proliferation, migration and invasion of GSCs, and promoted apoptosis by up -regulating the expression of miR-194-5p and miR-122. [score:9]
MiR-194-5p and miR-122 were down-regulated in human glioma tissues and GSCs, and miR-194-5p and miR-122 respectively exerted tumor-suppressive functions by inhibiting the proliferation, migration and invasion of GSCs, while promoting GSCs apoptosis. [score:8]
The above results suggested that miR-194-5p and miR-122 reduced SOX3 expression by targeting its 3′-UTR and mediated the tumor-suppressive effect of SOX2OT knockdown. [score:8]
Finally, the in vivo study demonstrated that SOX2OT knockdown, miR-194-5p over -expression, miR-122 over -expression and the combination of the above significantly inhibited GSCs tumor volume and prolonged survival time. [score:8]
Our study revealed that SOX2OT can down-regulate the expression of SOX3 by regulating miR-194-5p and miR-122. [score:7]
Over -expression of miR-194-5p and miR-122 decreased the mRNA and protein expression of SOX3 by targeting its 3’UTR. [score:7]
These results suggested that over -expression of miR-194-5p and miR-122 can inhibit malignant biological behaviors of GSCs by directly down -regulating SOX3. [score:7]
Further studies showed that over -expression of miR-194-5p or miR-122 decreased the expression of TDGF-1; inhibited the proliferation, migration and invasion and promote apoptosis of GSCs. [score:7]
Further, we explore whether SOX2OT can regulate the expression of SOX3 by regulating the expression of miR-194-5p and miR-122, and affect the biological behavior of GSCs. [score:7]
The results indicated that the combination of SOX2OT knockdown, miR-194-5p over -expression and miR-122 over -expression has potential clinical value. [score:6]
Over -expression of miR-194-5p or miR-122 inhibited GSCs proliferation, migration and invasion, and promoted GSCs apoptosis; Knockdown of miR-194-5p or miR-122 produced the opposite effect. [score:6]
TDGF-1 acted as an oncogene by activating the JAK/STAT signaling pathway, and miR-194-5p and miR-122 reduced TDGF-1 expression by down -regulating SOX3 expression in GSCs. [score:6]
Based on the above results, we confirmed that miR-194-5p and miR-122 mediate the tumor-suppressive effects of SOX2OT knockdown in GSCs, and knockdown of miR-194-5p or miR-122 respectively reversed the effects induced by SOX2OT knockdown in GSCs. [score:6]
Over -expression of miR-194-5p and miR-122 decreased the expression of SOX3 by directly binding to the 3′UTR of SOX3. [score:6]
Knockdown of SOX2OT combined with over -expression of miR-194-5p and miR-122 suppressed tumor growth and induced the longest survival time in nude mice. [score:6]
Moreover, in this study, we found that over -expression of miR-194-5p or miR-122 inhibited proliferation, migration and invasion of GSCs, and promoted GSCs apoptosis. [score:5]
Moreover, over -expression of SOX3 reversed the effect of over -expression of miR-194-5p or miR-122 in GSCs. [score:5]
h Real-time PCR and (i) Weatern blot assay were used to detect the SOX3 expression after miR-122 over -expression or knockdown. [score:5]
The sequence of SOX2OT was amplified by PCR and cloned into pmirGLO Dual-luciferase miRNA Target Expression Vectors along with its mutant sequence of mir-194-5p (or mir-122) binding sites (GenePharama, Shanghai, China). [score:5]
Additionally, SOX2OT inhibition combined with over -expression of both miR-194-5p and miR-122 resulted in the smallest tumor size among all the groups. [score:5]
Knockdown of SOX2OT decreased SOX3 expression by up -regulating miR-194-5p and miR-122. [score:5]
These results revealed that miR-194-5p and miR-122 inhibited TDGF-1 expression by reducing SOX3. [score:5]
Transfect pGCMV/EGFP/miR-194-5p plasmid and pGCMV/EGFP/miR-122 plasmid in sh-SOX2OT stable expressing cells to generate sh-SOX2OT + miR-194-5p + miR-122 stable expressing cell lines. [score:5]
This study further confirmed that the expression of miR-194-5p and miR-122 was decreased in glioma tissues and GSCs, and the expression decreased as the pathological grade increased. [score:5]
Compared with the SOX2OT knockdown group, miR-194-5p over -expression or miR-122 over -expression groups, the group with the three treatments combined exhibited the lowest tumor volume and the longest survival time in nude mice. [score:5]
The 3′-UTR sequence of SOX3 and its mutant sequence of mir-194-5p (or mir-122) binding sites were cloned into pmirGLO Dual-luciferase miRNA Target Expression Vectors (GenePharama, Shanghai, China). [score:5]
k The apoptotic percentages of GSC-U87 and GSC-U251 cells were detected after miR-122 over -expression or inhibition. [score:5]
In addition, over -expression of SOX3 reversed the inhibitory effects of miR-194-5p and miR-122 in GSCs. [score:5]
MiR-122 is under-expressed in glioma tissues and glioma cell lines, and the expression level of miR-122 is correlated with patient survival. [score:5]
Over -expression of miR-194-5p and miR-122 inhibited the proliferation, migration and invasion of GSCs and promoted GSCs apoptosis. [score:5]
Moreover, miR-122 over -expression can suppress the proliferation, migration and invasion of glioma cells [31]. [score:5]
Moreover, miR-122 was decreased in gastric cancer tissues and cells, and miR-122 over -expression inhibited the proliferation, migration and invasion of gastric cancer cells [52]. [score:5]
To determine whether the tumor-suppressive effects of SOX2OT knockdown were mediated by miR-194-5p or miR-122, the stable sh-SOX2OT cells were transfected with miR-194-5p or miR-122 agomir and antagomir. [score:4]
These results suggested that miR-194-5p and miR-122 suppressed the malignant behaviors of GSCs by down -regulating SOX3. [score:4]
Fig. 5The SOX3 expression regulated by SOX2OT, miR-194-5p and miR-122. [score:4]
MiR-194-5p and miR-122 mediated the tumor-suppressive effects of SOX2OT knockdown on GSCs. [score:4]
Fig. 3MiR-194-5p and miR-122 mediated the tumor-suppressive effects of SOX2OT knockdown on GSCs. [score:4]
To determine whether SOX2OT -mediated regulation of miR-122 expression could affect the behaviors of GSCs, cells were divided into five groups: control, sh-NC + agomir-122-NC, sh-SOX2OT + agomir-122, sh-NC + antagomir-122-NC and sh-SOX2OT + antagomir-122 groups. [score:4]
h The expression of miR-122 with SOX2OT knockdown in GSC-U87 and GSC-U251 cells. [score:4]
Knockdown of SOX2OT significantly increased the expression of miR-194-5p and miR-122 in GSCs. [score:4]
In contrast, miR-194-5p and miR-122 were downregulated in glioma tissues and cell lines. [score:4]
In this paper, we studies the endogenous expression of SOX2OT, miR-194-5p, miR-122, SOX3 and TDGF-1 in GSCs, and their effects on the biological behavior of GSCs. [score:3]
j Real-time PCR and (k)Weatern blot assay were used to detect the SOX3 expression regulated by SOX2OT and miR-122. [score:3]
Further, SOX2OT targeted miR-194-5p and miR-122 in a sequence-specific manner. [score:3]
SOX3 mediated the tumor-suppressive effects of miR-194-5p and miR-122 in GSCs. [score:3]
Silencing SOX2OT increased the expression of miR-194-5p and miR-122. [score:3]
i Weatern blot assay were used to detect the TDGF-1 expression regulated by miR-122 and SOX3. [score:3]
Combined with the effect of miR-122 on GSCs in this study, we suggest that miR-122 may act as a tumor suppressor in gastric cancer, liver cancer and glioma. [score:3]
org), a dual-luciferase reporter assay demonstrated that miR-194-5p and miR-122 could directly targeting the SOX3 3′-UTR. [score:3]
After infection, the stable expressing cells of miR-194-5p and miR-122 were picked. [score:3]
MiR-194-5p and miR-122 exerted tumor-suppressive functions in GSC-GBM. [score:3]
Fig. 2MiR-194-5p and miR-122 exerted tumor-suppressive functions in GSCs. [score:3]
The expression of miR-122 in HA cells, glioblastoma cell lines(U87 and U251) and glioblastoma stem cells (GSC-U87, GSC-U251). [score:3]
Moreover, miR-122 act as a tumor suppressor gene in breast cancer [28]. [score:3]
To uncover whether SOX3 could reverse the tumor-suppressive effects of miR-194-5p and miR-122 in GSCs, cells were cotransfected with miR-194-5p or miR-122 and SOX3, and cell proliferation, migration, invasion and apoptosis were assessed. [score:3]
g The expression of miR-122 in normal brain tissues(NBTs) and glioma tissues of different grades. [score:3]
The mRNA and protein expression of SOX3 after cells cotransfection of miR-194-5p or miR-122 with SOX3 were shown in 1: Figure S5. [score:3]
TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA) was used for the reverse transcription of miR-194-5p and miR-122, and the expression of miR-194-5p and miR-122 were detected with TaqMan Universal Master Mix II. [score:3]
Fig. 6SOX3 mediated tumor-suppressive effects of miR-194-5p and miR-122. [score:3]
MiR-194-5p and miR-122 functioned as tumor suppressors in GSCs. [score:3]
SOX3 mediated tumor-suppressive effects of miR-194-5p and miR-122. [score:3]
These results demonstrated that miR-194-5p and miR-122 exerted the tumor-suppressive role in GSCs. [score:3]
These results suggested that miR-194-5p and miR-122 act as tumor suppressor in GSCs. [score:3]
This study is the first to demonstrate that the SOX2OT-miR-194-5p/miR-122-SOX3-TDGF-1 pathway forms a positive feedback loop and regulates the biological behaviors of GSCs, and these findings might provide a novel strategy for glioma treatment. [score:2]
This study demonstrated that the SOX2OT-miR-194-5p/miR-122-SOX3-TDGF-1 pathway forms a positive feedback loop, which plays an important role in regulating the biological behaviors of GSCs. [score:2]
MiR-122 is decreased in HBV-related hepatocellular carcinoma, and its expression is negatively correlated with tumor size, lymph node metastasis, TNM stage, histological type, and cell differentiation [53]. [score:2]
The SOX2OT-miR-194-5p/miR-122-SOX3-TDGF-1 feedback loop plays an important role in regulating GSCs biological behaviors. [score:2]
l The predicted miR-122 binding sites in the 3’UTR region of SOX3 (SOX3–3’UTR-Wt) and the designed mutant sequence (SOX3–3’UTR-Mut) are indicated. [score:1]
SOX2OT miR-194-5p miR-122 SOX3 TDGF-1 Glioma Glioma is the most common primary malignant tumor of the brain, and the median survival time is less than 12 months [1, 2]. [score:1]
The effects of mir-194-5p and miR-122 in GSC-GBM were similar as it in GSC-U87 and GSC-U251 cells (Additional file 1: Figure S3). [score:1]
We found that SOX2OT might harbor a binding site for miR-194-5p and miR-122 using a bioinformatics database (DIANA-LncBase). [score:1]
Similar results were observed with miR-122 (Fig. 3d–f). [score:1]
In addition, similar results were also observed with miR-122 (Fig. 5h-l). [score:1]
i The predicted miR-122 binding sites in the SOX2OT sequence (SOX2OT-Wt) and the designed mutant sequence of miR-122 binding site (SOX2OT-Mut) are indicated. [score:1]
An in vivo tumor mo del was used to further determine the functions of SOX2OT, miR-194-5p and miR-122. [score:1]
MiR-194-5p agomir, miR-194-5p antagomir, miR-122 agomir, miR-122 antagomir and their respective negative control were synthesized (GenePharama, Shanghai, China). [score:1]
To determine whether SOX3 is involved in the of miR-122 effect on the behaviors of GSCs, cells were divided into five groups: control, agomir-122-NC + SOX3(+)NC, agomir-122 + SOX3(+)NC, agomir-122-NC + SOX3(+) and agomir-122 + SOX3(+) groups. [score:1]
The mice were divided into five groups: control, sh-SOX2OT, miR-194-5p, miR-122 and sh-SOX2OT + miR-194-5p + miR-122 groups. [score:1]
As shown in Fig. 8c, the survival analysis indicated that mice in the sh-SOX2OT, miR-194-5p, miR-122 and sh-SOX2OT + miR-194-5p + miR-122 groups exhibited longer survival time than the control mice, and mice in the sh-SOX2OT + miR-194-5p + miR-122 group had the longest survival time. [score:1]
The pGCMV/EGFP/miR-194-5p plasmid and pGCMV/EGFP/miR-122 plasmid were transfected into cells respectively. [score:1]
A kind of graphene-P-gp loaded with miR-122-InP@ZnS quantum dots nanocomposites induced drug-resistant liver tumor cells apoptosis [54]. [score:1]
Similar results were also observed when detecting the effect of miR-122 on the proliferation, migration, invasion and apoptosis of GSCs (Fig. 2g–l). [score:1]
[1 to 20 of 88 sentences]
2
[+] score: 366
This may serve as a positive feedback mechanism in which the IGF1 induced downregulation of miR-122 is further enhanced because of the accompanying upregulation of IGF1R. [score:7]
To determine whether repression of miR-122 reporter in HepG2 is due to an actual transfer of miRNA between the co-cultured cells or due to an induction of miR-122 expression in HepG2 by Huh7 cells, GFP expressing HepG2 cells were co-cultured with DsRed expressing Huh7 cells for 48 h before they were sorted to GFP and dsRed positive cell pools (Figure 1D and Supplementary Figure S1). [score:7]
The decrease in senescent cell number was also there after anti-miR-122 expression in Huh7 indicating that the inhibition of miR-122 expression by HepG2 could lead to reduced senescence of Huh7 cells (Figure 6I and J). [score:7]
HepG2 cells stably expressing DsRed were incubated with exosomes isolated either from HepG2, Huh7, anti-miR-122 or let-7a expressing Huh7, or from Huh7 exogenously expressing miR-122. [score:7]
n = 4. (B) Number of PCNA positive DsRed expressing HepG2 cells in co-culture either with HepG2 cells (control, not expressing DsRed) or with Huh7 cells (untreated or expressing anti-miR-122 or anti-let-7a oligos). [score:7]
HepG2 CM was also effective in downregulating pre-miR-122 expression in Huh7 cells (Figure 3H). [score:6]
Huh7 cells incubated with HepG2 CM show downregulated expression of miR-122. [score:6]
Huh7 cells in the presence of HepG2 CM demonstrate reduced miR-122 expression along with an increased growth rate (Figure 2A) To identify the nature of the factor responsible for downregulation of miR-122 in Huh7 cells, the status of different intracellular signals in Huh7 cells incubated with HepG2 CM was checked. [score:6]
There is a concomitant downregulation of miR-122 expression in Huh7 cells mediated by HepG2 secreted Insulin-like Growth Factor 1 (IGF1). [score:6]
Real-time analysis confirmed reduced expression of several of these LETFs accompanied by reduced miR-122 expression in Huh7 cells treated with HepG2 CM (Figure 3I). [score:5]
This is consistent with the notion that IGF1 inhibits miR-122 expression in Huh7 cells. [score:5]
Treatment of cells with exosomes isolated from miR-122 expressing HepG2 cells also reduced [3]H incorporation in target HepG2 cells, signifying a reduced proliferation of the treated cells (Figure 2E). [score:5]
IGF1R is a known target of miR-122 (28) and hence this increase may possibly be a consequence of the decreased miR-122 expression in Huh7 cells (Figure 5L). [score:5]
These experiments demonstrate the tumour suppressive and anti-invasive activity of the transferred miR-122 on target HepG2 cells. [score:5]
We wanted to examine this crosstalk between cells and to that purpose developed a co-culture system involving hepatic cells having differential expression of the tumour suppressor miR-122. [score:5]
Huh7 cells were transfected with miR-122 expressing pmiR-122 plasmid that drives pre-miR-122 expression from a U6 promoter. [score:5]
Reciprocal inhibition of miR-122 expression in neighbouring cells by the human HCC cell HepG2. [score:5]
Previously, it was reported that miR-122 expression in HepG2 cells decreased Cyclin G1 expression and was accompanied by an increase in p53 protein (29). [score:5]
Huh7 is a hepatoma cell that exhibits constitutive expression of miR-122 which is associated with low Cyclin G1 expression level in hepatic cells (29, 38, 39). [score:5]
Additionally, miR-122 -mediated downregulation of IGF1 release by hepatic cells may serve as another potential therapeutic avenue. [score:4]
The unbalanced expression of miR-122 during the initial steps of liver cancer development may be compensated by exosomal transfer of miR-122 from normal to cancer cells. [score:4]
Therefore, as compared to nIgG, α-IGF1 blocked CM showed increased miR-122 activity, suggesting that IGF1 present in HepG2 CM causes inhibition of miR-122 expression leading to decreased miR-122 activity in Huh7 cells. [score:4]
Low miR-122 level in hepatic tumours correlates with reduced expression of these liver-specific transcription factors, suggesting a regulatory role for these proteins on hepatic miR-122 level (19, 25, 40). [score:4]
miR-122 transfer from Huh7 to HepG2 can change the expression of various miR-122 regulated genes in the recipient HepG2. [score:4]
Thus, we may hypothesize that IGF1 secreted by HCC cells serves to downregulate miR-122 in the surrounding normal cells and causes tumour progression. [score:4]
Antibody inhibition experiments coupled with siRNA mediated knockdown of IGF1R in Huh7 cell and IGF1 in HepG2 cells proved the primary involvement of this factor in reduction of miR-122 in Huh7 cells and also in mouse primary hepatocytes. [score:4]
The transferred miRNA was used in gene repression and could change the expression of various miR-122 regulated physiological genes in the recipient cells. [score:4]
Similarly, depletion of IGF1R in Huh7 cells made them immune to HepG2 CM mediated downregulation of miR-122 activity and level in Huh7 cells (Figure 5I and K). [score:4]
Consequent real-time quantification of various miR-122 target mRNAs (32) such as CAT1 (Solute Carrier Family 7 Member 1/Cationic Amino Acid Transporter 1), Aldolase (Aldolase A), GTF2B (General Transcription Facor IIB) and GYS1 (Glycogen Synthase 1) revealed a decrease in their expression in HepG2 cells co-cultured with Huh7 cells as compared to control (Figure 1I). [score:4]
Li Z. Y. Xi Y. Zhu W. N. Zeng C. Zhang Z. Q. Guo Z. C. Hao D. L. Liu G. Feng L. Chen H. Z. Positive regulation of hepatic miR-122 expression by HNF4alphaJ. [score:4]
Huh7 cells (control or IGF1R depleted), expressing miR-122 RL reporter, were incubated with CM from normal or IGF1 depleted HepG2 for 72 h to determine the specificity of IGF1 to decrease miR-122 activity in Huh7 cells. [score:3]
Fold repression was estimated by dividing the normalized RL levels in RL-con and RL-per-miR-122 expressing cells. [score:3]
HepG2 cells secrete factors that activate AKT/mTOR and ERK signalling pathways in the neighbouring Huh7 cells, concomitant with a corresponding decrease in miR-122 expression. [score:3]
When Huh7 cells were transfected with plasmids expressing pre-miR-122 under a U6 promoter (31), there was no change in the miR-122 level in control and HepG2 co-cultured Huh7 cells (Figure 3E). [score:3]
The effect of Huh7 on HepG2 growth is mediated via transfer of miR-122 as inhibition of miR-122 in Huh7 resulted in impaired growth retardation of neighbouring HepG2 cells (Supplementary Figure S5A). [score:3]
HepG2 cells overcome the restorative effect exerted by the transferred miR-122 by secreting IGF1 which in turn inhibits miR-122 biogenesis in neighbouring cells. [score:3]
Cyclin G1 is a target of miR-122. [score:3]
Thus, IGF1 released by HepG2 cells enabled the cells to become more invasive in nature through a layer of cells expressing miR-122. [score:3]
IGF1 secreted by HepG2 inhibits miR-122 biogenesis in co-cultured Huh7 cells, and this in turn may be the reason behind the increased growth rate of Huh7 observed in HepG2 co-cultured cell populations. [score:3]
In the presence of Rapamycin, the HepG2 CM induced decreased miR-122 activity in Huh7 was also found to be reversed thereby indicating that the decreased expression of miR-122 in Huh7 cells in the presence of HepG2 is mediated by the Rapamycin sensitive AKT/mTOR signalling pathway (Figure 4C). [score:3]
This may have been because of the reduced transfection efficiency of Huh7 cells which resulted in incomplete inhibition of transferable miR-122 via exosomes. [score:3]
Mean fold repression was estimated by dividing the normalized RL levels in RL-con and RL-per-miR-122 expressing cells with changing Huh7 to HepG2 cell number ratios. [score:3]
As expected, co-culture of DsRed HepG2 with HepG2 overexpressing miR-122 leads to a reduced number of DsRed cells invading through the matrigel (Figure 6A and Supplementary Figure S8). [score:3]
Anti-miR-122 treatment could not fully block the Huh7 exosomes’ effect on HepG2 colony size, possibly due to incomplete inhibition of miR-122 in transfected Huh7 cells (Figure 2C). [score:3]
CM from siIGF1 transfected HepG2, in contrast to siControl transfected HepG2, was unable to reduce neither miR-122 activity or level in target Huh7 cells (Figure 5I and J). [score:3]
Interestingly, IGF1 expression in HepG2 cells is decreased upon treatment with miR-122 containing Huh7 exosomes. [score:3]
Downregulation of miR-122 is a characteristic feature of human HCC and this is accompanied with the deregulation of mTOR signalling which plays a pivotal role in the pathogenesis of HCC (42–44). [score:3]
HepG2 cells were incubated with exosomes from HepG2, Huh7, anti-miR-122 or anti-let-7a transfected Huh7, and HepG2 cells expressing miR-122, for 7 days with changes after every 48 h. The cells were then reseeded at 1 × 10 [3] cells/cm [2]. [score:3]
Figure 6. HepG2 cells overcome the tumour suppressive effect of miR-122 containing exosomes by secreting IGF1. [score:3]
HepG2 cells have highly reduced levels of miR-122 whereas Huh7 cells express this hepatic miRNA in high amounts (28, 29). [score:3]
To exogenously express miR-122, cells were transfected with pmiR122 plasmid. [score:3]
Thus the factor secreted by HepG2 cells, which induces a decrease in miR-122 expression in Huh7 cells, is likely non-exosomal. [score:3]
How does HepG2 reduce pre-miR-122 expression in Huh7 cells? [score:3]
Confirming the importance of miR-122 in this effect, exosomes from Huh7 cells inhibited for miR-122 did not reduce [3]H incorporation in HepG2 cells (Figure 2F). [score:3]
Despite its hepatic origin, HepG2 has highly reduced levels of miR-122 whereas Huh7 expresses this miRNA in high amounts (28, 29). [score:3]
Figure 5. IGF1 secreted by HepG2 reduces activity and expression of miR-122 in Huh7 cells. [score:3]
The reduced level of intracellular miR-122 is also translated into reduced levels of exosomal miR-122 released from anti-miR-122 oligonucleotide (both 2’- O-methyl and LNA modified) transfected cells (Supplementary figure S11G and H). [score:3]
This was done to verify whether the decrease of miR-122 in Huh7 cells by HepG2 was because of a decreased expression of LETFs. [score:3]
miR-122 overexpression in HepG2 cells decreased its’ growth rate along with an impairment in its invasion capability (29). [score:3]
It has a miR-122 binding site in its 3’UTR and was shown by Bai et al. to be a target of miR-122. [score:3]
When IGF1-antibody blocked HepG2 CM was added, there was no inhibitory effect associated with HepG2 CM on miR-122 activity in Huh7 cells; rather an increase in miRNA activity was observed (Figure 5I). [score:3]
Figure 3. HepG2 cells secrete factors to reduce expression of miR-122 in hepatic cells. [score:3]
In this context, there seems to be a reciprocal relationship between miR-122 and IGF1 expression (Supplementary Figure S12). [score:3]
Lin C. J. Gong H. Y. Tseng H. C. Wang W. L. Wu J. L. miR-122 targets an anti-apoptotic gene, Bcl-w, in human hepatocellular carcinoma cell linesBiochem. [score:3]
The notion that exosomal export of miRNA plays the key role in transfer of miR-122 from Huh7 to HepG2 cells was further confirmed when treatment of Huh7 cells with siRNAs against nSMNase II resulted in inhibition of miR-122 activity transfer from Huh7 cells to co-cultured HepG2 cells (Figure 1M). [score:3]
HepG2 cells overcome tumour suppressing effect of exosomal miR-122 by secreting IGF1. [score:3]
HepG2 cells expressing miR-122 was used as a positive control. [score:3]
The secretion of miR-122 containing exosomes from Huh7 was found to be inhibited with increasing concentrations of GW4869, which also lowers the tetraspanin CD63 (34, 35) and ALIX, two mammalian exosomal marker proteins (Figure 1K). [score:3]
In hepatic cells, expression of miR-122 is controlled primarily by four liver enriched transcription factors (LETFs) (25, 36, 40). [score:3]
Huh7 exogeneously expressing pre-miR-122 leads to a lesser number of DsRed HepG2 cells invading through matrigel than control (Figure 6B and Supplementary Figure S9A). [score:3]
GFP positive HepG2 cells were co-cultured with DsRed and miR-122 expressing Huh7 cells and after 48 h, cells were FACS sorted and were used for further analysis. [score:3]
Can HepG2 cells circumvent the growth inhibitory effect exerted by the transferred miR-122 by secreting IGF1? [score:3]
HepG2 secreted IGF1 reduces miR-122 expression and activity in neighbouring cells. [score:3]
miR-122 and Igf1r were found to be reciprocally regulated in primary human HCCs (28). [score:2]
These results indicate direct transfer of mature miR-122 to HepG2 cells grown in a co-culture with Huh7 cells. [score:2]
Knockdown of Insulin Like Growth Factor 1 Receptor in Huh7 cells by siRNAs resulted in a reversal of the decrease in both miR-122 activity and level upon incubation with HepG2 CM. [score:2]
Also Huh7 cells transfected with anti-miR-122 oligos have higher levels of miR-122 targets compared to control (Supplementary Figure S11E and F). [score:2]
Bai S. Nasser M. W. Wang B. Hsu S. H. Datta J. Kutay H. Yadav A. Nuovo G. Kumar P. Ghoshal K. MicroRNA-122 inhibits tumorigenic properties of hepatocellular carcinoma cells and sensitizes these cells to sorafenibJ. [score:2]
RNA was isolated from the control and co-cultured sets and real-time qPCR was performed to detect miR-122 level change. [score:1]
Cells were lysed after 24 h. For all other experiments with growth factors, indicated concentrations of the factors were added to Huh7 CM which had been depleted for miR-122 containing exosomes by centrifuging at 100,000 x g for 90 min. [score:1]
For incubation times greater than 24 h, media was replaced with fresh CM after every 24 h. For the isolation of miR-122, anti-miR-122 and anti-let7a carrying exosomes, 1 × 10 [6] cells were transfected and 24 h after transfection, the cells were reseeded onto a 60 cm [2] plate. [score:1]
Similar decrease of miR-122 was also noted in mouse primary hepatocytes incubated with IGF 1 in culture (Figure 5G). [score:1]
This tells us that the observed decrease in miR-122 activity is because of a reduced miR-122 level in Huh7 cells co-cultured with HepG2. [score:1]
Figure 1. Huh7 cells can transfer miR-122 to neighbouring HepG2 cells in co-culture. [score:1]
To detect fold repression in Huh7, 10 [6] Huh7 cells in a 10 cm [2] well were transfected with 100 ng of RL-Con and RL-perf-miR-122. [score:1]
We documented increased repression of miR-122 reporter in HepG2 cells co-cultured with Huh7 cells where the extent of repression was determined by HepG2 to Huh7 cell ratio in the co-culture (Figure 1A–C). [score:1]
Real-time quantification further revealed a similar change in the precursor form of miR-122 (pre-miR-122) in HepG2 exposed Huh7 cells, suggesting a reduced production of miR-122 (Figure 3D). [score:1]
Cellular miR-122 levels were quantified by RT-PCR. [score:1]
HepG2 cells transfected with a plasmid encoding RL reporter with one perfect miR-122 binding site were co-cultured with Huh7 cells or, as a control, with non -transfected HepG2 cells. [score:1]
Real-time quantification of miR-122 was then done to detect the level of miR-122 in both control and co-cultured samples in presence or absence of GW4869. [score:1]
2’-OMe-anti-miR-122 transfected Huh7 cells showed reduced levels (∼50%) of intracellular miR-122. [score:1]
Hence, we hypothesized that co-culture of Huh7 with HepG2 cells would lead to reduced invasion of HepG2 due to transfer of miR-122 from Huh7. [score:1]
miR-122 is known to repress genes involved in metastasis, invasion (ADAM10, ADAM17) and apoptosis (Bcl-w) (26, 28, 49). [score:1]
However, the effect was reversed if the Huh7 used in co-culture was pre -transfected with anti-miR-122 oligonucleotides to block miR-122 activity, but not in the case of anti-let-7a oligonucleotides (Figure 2B and Supplementary Figure S6A). [score:1]
Relative fold repression was determined by setting the repression level of control as 1. (C, D) Effect of IGF1 on miR-122 activity (C) and Level (D) in Huh7 cells. [score:1]
miR-122 and let-7a mimic and anti-let-7a and anti-miR-122 were purchased from Ambion and was used at 100 pmoles to transfect cells per well of a six-well plate. [score:1]
Exosomal transfer of miR-122 to human HepG2 cells leads to decreased growth and increased senescence. [score:1]
Total RNA was extracted from the cells and qPCR was done to determine the miR-122 level. [score:1]
Intercellular transfer of miR-122 between human hepatic cells. [score:1]
Girard M. Jacquemin E. Munnich A. Lyonnet S. Henrion-Caude A. miR-122, a paradigm for the role of microRNAs in the liverJ. [score:1]
Relative quantification of the miR-122 levels in the sorted HepG2 cells that otherwise have low levels of mature miR-122 indicated a 9-fold increase of mature miR-122 level upon co-culture with Huh7 cells while the let-7a miRNA level in sorted HepG2 cells remained unchanged (Figure 1D and E). [score:1]
This reciprocal effect exerted by HepG2 on miR-122 producing neighbouring cells may a indicate a strategy that hepatic cancer cells adopt to modulate their microenvironment to their benefit and proliferation. [score:1]
Co-culture with HepG2 also leads to a reciprocal decrease in miR-122 level in Huh7 cells. [score:1]
miR-122 levels are detected in the bottom panel. [score:1]
Xu J. Wu C. Che X. Wang L. Yu D. Zhang T. Huang L. Li H. Tan W. Wang C. Circulating microRNAs, miR-21, miR-122, and miR-223, in patients with hepatocellular carcinoma or chronic hepatitisMol. [score:1]
Jopling C. Liver-specific microRNA-122: Biogenesis and functionRNA Biol. [score:1]
Huh7 cells in turn exert a restorative effect on HepG2 by transferring miR-122 to HepG2. [score:1]
However, anti-miR-122 oligonucleotides transfected HepG2 cells treated with Huh7 exosomes resulted in complete reversal of the reduction in invasive potential observed in the case of anti-let-7a transfected HepG2 cells (Figure 6C and Supplementary Figure S9B). [score:1]
This reduction was comparable to that obtained with LNA-anti-miR-122 oligonucleotides. [score:1]
It may be argued that the remaining residual exosomal miR-122 has an effect on the recipient HepG2 cells and thus cause only partial reversal of the reduction in colony formation and invasion as shown in Figures 2C and 6B. [score:1]
Exosomes, isolated from the ≥100 KDa cutoff fraction of Huh7 CM when added to HepG2 cells, were able to transfer miR-122 to the recipient cells. [score:1]
As a control Huh7 cells transfected with LNA [TM] modified -anti-miR-122 and LNA [TM] -modified anti-miR-128 (control) oligonucleotides were similarly analysed. [score:1]
No effect of the drug on the ability of HepG2 secreted factor to reduce miR-122 level in Huh7 cells was noticed (Figure 5A). [score:1]
Also, Figure 2C describes an experiment where HepG2 cells are incubated with exosomes from Huh7 for 7 days with changes after every 48 h. It may be hypothesized that the residual exosomal miR-122 in Huh7 transfected with anti-miR-122 are transferred to HepG2 during the longer incubation time involved and restore miR-122 level to an extent sufficient to observe the effect. [score:1]
Northern analysis confirmed the transfer of mature miR-122 to HepG2 cells when incubated either with Huh7 CM or with its ≥100 KDa cutoff fraction. [score:1]
However, anti-miR-122 treatment does not totally reduce miR-122 in exosomes. [score:1]
Quantitative PCR indicated that there was a decrease in the miR-122 level in HepG2 co-cultured, as opposed to the control Huh7 cells (Figure 3C). [score:1]
These results are consistent with exosomes being the probable vehicle for intercellular miR-122 delivery. [score:1]
However, incubation with exosomes isolated from Huh7 cells transfected with anti-miR-122 oligonucleotides had little effect on the senescence status of treated HepG2 cells (Figure 2G and Supplementary Figure S6B). [score:1]
This decrease in transcription appears to be specific for the miR-122 promoter and does not depend on miR-122 identity. [score:1]
Further decrease in miR-122 levels may not have been possible because of the low transfection efficiency of Huh7 cells which was determined to be ∼20% (Supplementary figure S11C). [score:1]
Addition of exosomes from Huh7 transfected with anti-miR-122 oligonucleotides only partially reversed the effect of Huh7 exosomes. [score:1]
Real-time quantification in HepG2 CM treated Huh7 cells confirmed a decreased level of cellular miR-122 (Figure 3G). [score:1]
We wanted to see if miR-122 from Huh7 cells could be transferred to HepG2 cells in a co-culture mo del. [score:1]
We found that the decrease in miR-122 level starts from 5 ng/ml of IGF1. [score:1]
These results suggest transfer of mature form of miR-122 from Huh7 to HepG2 cells, possibly via exosomal vesicles (Figure 1J and Supplementary Figure S2). [score:1]
It would be interesting to speculate that the exosomal delivery of miR-122 containing exosomes between hepatic cells in liver tissue may serve as a mechanism for maintaining homeostasis of tissue miRNA. [score:1]
The pellet was resuspended in 200 μl of 1X Passive Lysis Buffer, half of which was used for western analysis and the remaining half was used for miR-122 analysis by real-time quantification. [score:1]
Hence, in an effort to induce miR-122 ‘loss of function’, anti-miR-122 and anti-let7 oligonucleotides were introduced in HepG2 cells which were then treated with Huh7 exosomes. [score:1]
Incubation of reporter transfected HepG2 cells with CM from Huh7 cells for 24 h also resulted in an increase in fold repression of miR-122 reporter in HepG2 cells (Figure 1J). [score:1]
Incubation of HepG2 CM with αIGF1 antibody removed the anti-miR-122 activity. [score:1]
Figure 2. HepG2 cells receiving miR-122 from the donor Huh7 cells exhibit a decreased growth rate, increased senescence and increased sensitivity to apoptosis inducing agent. [score:1]
Therefore, it may be concluded that HepG2 cells exert a reciprocal effect on the miR-122 level in co-cultured Huh7 cells primarily by reducing the production of pre-miR-122. [score:1]
Quantification revealed a corresponding decrease in miR-122 level and activity upon IGF1 treatment of Huh7 cells (Figure 5C, D and E). [score:1]
CHIP-PCR analysis using antibodies against RNA polymerase II, HNF1α, HNF3β and HNF4α (36, 41) revealed reduced binding of the miR-122 promoter element by these transcription factors in Huh7 cells treated with HepG2 CM (Figure 3J). [score:1]
Therefore, transfer of miR-122 from Huh7 to HepG2 cells results in decreased proliferation of HepG2 cells accompanied by increased senescence. [score:1]
We attempted to determine the doxorubicin sensitivity of HepG2 cells when conditioned with miR-122 containing exosomes from Huh7 cells. [score:1]
Pre-miR-122 and mRNA levels of various Hepatic Nuclear Factors like HNF1α, HNF3β, HNF4α and CEBPα were quantified in Huh7 cells treated with IGF1 (Figure 5H). [score:1]
Confirming the importance of exosomal delivery in intercellular miR-122 transfer, the increase in miR-122 activity in HepG2 cells upon co-culture with Huh7 was prevented in the presence of GW4869 (Figure 1L). [score:1]
Huh7 cells transfected with miR-122 reporter showed a decreased repression even when they were incubated with CM from confluent HepG2 cells (Figure 3F). [score:1]
Therefore, it is evident that factor(s) present in HepG2 CM are able to cause reduction in the levels of miR-122 and pre-miR-122 in Huh7 cells by reducing LETF activity and their binding to miR-122 promoter. [score:1]
Thus treatment of HepG2 with miR-122 containing exosomes from Huh7 cells leads to increased apoptosis when challenged with doxorubicin (Figure 2H). [score:1]
This was reversed in cells treated with exosomes isolated from Huh7 cells transfected with anti-miR-122 but not with anti-let-7a oligonucleotides. [score:1]
For intercellular transfer of miR-122 in hepatic cells, intercellular contacts are not required. [score:1]
Does HepG2 reduce miR-122 in neighbouring Huh7 cells to increase their proliferation? [score:1]
Anti-miR-122 treatment but not the anti-let-7a treatment resulted in reversal in the reduction in colony size of HepG2 cells in the presence of Huh7 exosomes (Figure 2D). [score:1]
In the presence of IGF1, Huh7 cells showed decreased pre-miR-122 and lower levels of the HNFs. [score:1]
In this study, we have documented exosome mediated transfer of miR-122 between co-cultured human hepatoma cells. [score:1]
To determine the efficacy of the anti-miR-122 transfection in Huh7 cells, Huh7 cells transfected with anti-miR-122 oligonucleotides were analysed for cellular miR-122 levels (Supplementary Figure S11A and B). [score:1]
This decrease was only partially reversed when exosomes isolated from anti-miR-122 oligonucleotide transfected Huh7 cells were added to HepG2 cells. [score:1]
The miR-122 level of the cells was detected by RT-PCR. [score:1]
Here we show the exosome mediated transfer of miR-122 from Huh7 to HepG2 cells. [score:1]
[1 to 20 of 152 sentences]
3
[+] score: 360
Other miRNAs from this paper: hsa-mir-145
Differentiated cell-specific miR-122 is highly expressed in hPHs, and predicted to target a hepatic progenitor stem cell associated gene, Pkm2, that is commonly enriched in hESCs and HCCsBecause mRNAs commonly up-regulated in hESCs and HCCs embody GO functional descriptions associated with self-renewal and proliferation, we sought to determine whether a differentiated cell-specific miR-122 facilitates the suppression of these traits in hESCs and HCCs by targeting mRNAs commonly up-regulated in these two classes of cells. [score:15]
Because mRNAs commonly up-regulated in hESCs and HCCs embody GO functional descriptions associated with self-renewal and proliferation, we sought to determine whether a differentiated cell-specific miR-122 facilitates the suppression of these traits in hESCs and HCCs by targeting mRNAs commonly up-regulated in these two classes of cells. [score:11]
hPH-specific miR-122 suppresses the translation of Pkm2 To determine whether miR-122 is capable of attenuates the expression of Pkm2 in vitro, we first validated the opposing expression patterns of Pkm2 and miR-122 in hESCs, HCCs and hPHs, using quantitative real time PCR (RT-qPCR). [score:9]
Given the high enrichment of Pkm2 in rapidly self-renewing hESCs and proliferating HCCs, and the role of miR-122 as a direct suppressor of this gene, we asked whether the loss of self-renewal during the hepatocyte differentiation process may be accompanied by a decreased Pkm2 expression, and a corresponding increased expression of miR-122. [score:8]
These data indicate that miR-122 directly binds to the two predicted target sites in the 3′UTR of Pkm2 and suppresses translation. [score:8]
Our findings suggest that one possible mechanism by which hESC self-renewal and HCC proliferation are modulated is through the regulatory activity of a differentiated cell-specific miR-122, which directly suppresses the translation of a gene, Pkm2, that is commonly enriched in hESCs and HCCs, and plays a role as a facilitator of these traits. [score:7]
Although several studies have knocked-down miR-122 expression in the mouse liver using ‘antagomirs,’ Pkm2 up-regulation was not reported [19], [47]. [score:7]
Future challenge will be to further elucidate the involvement of miR-122 as a regulator of hESC self-renewal and HCC proliferation through direct translational suppression of genes in addition to Pkm2, as well as the role of various other differentiated cell-specific miRNAs that have yet to be explored. [score:7]
Through a series of global gene expression analysis, we show that miR-122 expression is either lost or severely attenuated in hESCs and HCCs, while an opposing expression pattern is observed for Pkm2. [score:7]
The ability of miR-122 to inhibit cell cycle progression in liver cancer cells raises the possibility that this miRNAs may also regulate hESC cell self-renewal during hepatocyte differentiation, by suppressing a common network of genes that promote hESC self-renewal as well as HCC proliferation. [score:6]
The present work has provided evidence to suggest the involvement of a differentiated cell-specific miR-122 as a modulator of hESC self-renewal and HCC proliferation through a direct translational suppression of a gene, Pkm2, that is commonly enriched in these classes of cells. [score:6]
To examine the effect of knocking-down Pkm2 and over -expressing miR-122 on hESC pluripotency, we assayed the expression patterns for hESC markers (Pou5f1, Nanog, Sox2) (Figure 5F), mature hepatocyte markers (Alb, α1At, Tf) (Figure 4G), and early differentiation markers following the transfection procedure (Sox17, Brach, Gsc, Cxcr4, Foxa2, Mixl1) (Figure 4H). [score:5]
A failure to elevate the expression of miR-122 is observed in hepatocellular carcinoma cells, and its effect on cellular proliferation suggests that miR-122 embodies a function that is reminiscent of a tumor suppressor. [score:5]
In contrast, the high level of miR-122 expression in hPHs likely attenuates the endogenous Pkm2 expression. [score:5]
Pkm2 facilitates the promotion of hESC self-renewal and HCC proliferationTo determine whether Pkm2 facilitates the promotion of hESC self-renewal and HCC proliferation, we performed a series of in vitro loss-of-function analysis by silencing the expression of Pkm2 or over -expressing miR-122 in these cells. [score:5]
To determine whether miR-122 is capable of attenuates the expression of Pkm2 in vitro, we first validated the opposing expression patterns of Pkm2 and miR-122 in hESCs, HCCs and hPHs, using quantitative real time PCR (RT-qPCR). [score:5]
In the preceding sections, we have shown that attenuating the expression of miR-122 in hESCs and HCCs allows for a constitutive expression of Pkm2, which in turn, facilitates the promotion of self-renewal and proliferation in these cells. [score:5]
Among this list of genes that are predicted to be targeted by miR-122, we selected miR-122: Pkm2 pair for an in-depth analysis, because the embryonic isoform of pyruvate kinase (Pkm2) is reported in the literature to be highly expressed in actively proliferating hepatic progenitor stem cells (hepatoblasts), as well as many cancer cells [31]– [34]. [score:5]
These findings suggest a role for miR-122 as a potential modulator of hESC self-renewal during the hepatocyte differentiation process by suppressing the translation of Pkm2. [score:5]
To do this, we performed global miRNA expression profiles on hESCs, HCCs and hPHs to determine whether miR-122 is highly expressed in hPHs, but attenuated in hESCs and HCCs. [score:5]
To determine whether Pkm2 facilitates the promotion of hESC self-renewal and HCC proliferation, we performed a series of in vitro loss-of-function analysis by silencing the expression of Pkm2 or over -expressing miR-122 in these cells. [score:5]
These results indicate that miR-122 expression is pervasively attenuated in self-renewing hESCs and proliferating liver cancer cells, and espouses an opposing expression pattern to Pkm2. [score:5]
Protein immunoblot assay validated the direct translational suppression of Pkm2 by miR-122 (Figure 3G). [score:5]
hPH-specific miR-122 suppresses the translation of Pkm2. [score:5]
Differentiated cell-specific miR-122 is highly expressed in hPHs, and predicted to target a hepatic progenitor stem cell associated gene, Pkm2, that is commonly enriched in hESCs and HCCs. [score:5]
We, therefore, speculated that Pkm2 may facilitate the promotion of hESC self-renewal and HCC proliferation, and that miR-122 may play a role as a modulator of these traits in differentiated hepatocytes by suppressing the translation of Pkm2. [score:5]
To ascertain the endogenous translational suppression of Pkm2 by miR-122, we performed a series of loss-of-function analyses by ectopically transfecting HepG2 and Hep3B cells with siPkm2, precursor miR-122 molecules, or mock precursor miR molecules. [score:5]
As stem cells moved further along the differentiation pathway, Pkm2 expression continued to decrease with a corresponding increase in miR-122 expression. [score:5]
miR-122 hybridizes to the 3′UTR of Pkm2 and induces endogenous translation suppression. [score:5]
These results suggest that an absence of miR-122 expression in hESCs and HCCs may permit an increased expression of Pkm2. [score:5]
Here, we show that miR-122 is highly enriched in differentiated human primary hepatocytes (hPHs), and functions as a modulator of hESCs self-renewal and HCC proliferation by suppressing the translation of a metabolic protein, PKM2. [score:5]
The ramifications of these findings are significant in reference to this study, as they suggest that in differentiated normal hepatocytes, miR-122 may function as a critical tumor suppressor by negatively regulating the level of Pkm2 transcripts in the cell, thereby minimizing the likelihood that PKM2 may interact with pTyr. [score:4]
These findings suggest that over -expressing miR-122 or knocking-down Pkm2 in hESCs and HCCs modulates self-renewal and proliferation. [score:4]
For example, studies have shown that Igf1r is a direct target of miR-122, and may function as a mediator of HCC proliferation [48] (Figure S5). [score:4]
Of relevance to this study are recent reports demonstrating the role of miR-122 as a potential tumor suppressor, because of its ability to regulate cell cycle progression and metastasis in liver cancer cells [21]– [27]. [score:4]
To do this, a portion of the 3′UTR of Pkm2 containing either of the two predicted miR-122 target sequences, and two derivative sequences with three-mismatch mutations, were cloned into separate luciferase reporter vectors (Figure 3D). [score:4]
However, while knocking-down Pkm2 did not affect the ESC pluripotency associated genes that were observed, keeping the differentiated cell-specific miR-122 attenuated in hESCs appears essential in order to prevent the destabilization of a ESC marker genes, Sox2, and also, to inhibit the induction of an early differentiation gene, Gsc. [score:4]
Suppression of the luciferase activity was not observed when precursor miR-122 was co -transfected into HepG2 cells with luciferase constructs that contained the three-base mismatch mutation. [score:4]
These findings suggest that miR-122 expression in hESCs, HCCs and hPHs may be associated with the methylation status and RNAPII binding activity at the promoter region of this gene (Figure 9). [score:3]
Given the multifaceted role of miR-122 in the liver [16]– [27], it is likely that this miRNA suppresses genes other than Pkm2 to modulate hESC self-renewal and HCC proliferation. [score:3]
A significant increase in Sox2 expression was observed in hESCs that were transfected with precursor miR-122 molecules. [score:3]
An opposite expression pattern was observed for miR-122 in these cell types (Figure 3B). [score:3]
For this reason, examining the relevance of miR-122 in stem and cancer cells of human origin helps elucidate the important tumor suppressor potential of this miRNA during the differentiation process of hESCs into quiescent hepatocytes. [score:3]
Consistent with the observations in HCCs, we found that miR-122 expression was significantly attenuated in human liver tumor tissues (Figure 3C). [score:3]
An examination of the 3′UTR of Pkm2 using Target Scan and miRNAMap 2.0 revealed two potential binding sites for miR-122 (Figure 2E). [score:3]
Likewise, during the differentiation process of hESCs into hepatocytes, a reciprocal expression pattern is observed between miR-122 and Pkm2, suggesting a possible role for this miRNA as a modulator of self-renewal during hepatic lineage specification. [score:3]
The coordinated interplay between miR-122 and Pkm2 suggests a novel and elegant mechanism for controlling the expression of a gene that may be beneficial for stem cells, but becomes undesirable as stem cells transition into a differentiated quiescent hepatic cell fate. [score:3]
These findings suggest a possible role for miR-122 as a modulator of self-renewal during hepatic lineage specification, and that a failure to properly attenuate the expression of this miRNA is observed in proliferating HCCs. [score:3]
As expected, hFHs mirrored the Pkm2 and miR-122 expression patterns that were observed in hESCs and HCCs. [score:3]
In hESCs and HCCs, hyper-methylation of the genomic region up-stream of miR-122 inhibits transcription. [score:3]
Reduction of endogenous Pkm2 expression by miR-122 modulates cellular proliferation. [score:3]
Pkm2 and miR-122 expression patterns are inversely correlated during hepatic differentiation of hESCs. [score:3]
Overall, these observations show that a reciprocal expression exists between Pkm2 and miR-122 during hepatic lineage specification of hESCs. [score:3]
0027740.g005 Figure 5 Pkm2 and miR-122 expression patterns are inversely correlated during hepatic differentiation of hESCs. [score:3]
An inverse expression pattern is observed between Pkm2 and miR-122 during hepatocyte differentiation of hESCs. [score:3]
0027740.g004 Figure 4Reduction of endogenous Pkm2 expression by miR-122 modulates cellular proliferation. [score:3]
of IGF1R in HepG2 and Hep3B overexpressing miR-122. [score:3]
RT-qPCR of early hepatic lineage markers revealed a significant increase in GSC expression when hESCs were transfected with precursor miR-122 molecules (4H). [score:3]
Our findings suggest that hyper-methylation of the genomic region up-stream of miR-122 may interfere with the binding of RNAPII, which in turn, inhibits a proper initiation of miR-122 transcription (Figure 9). [score:3]
In this list, we observed that miR-122 is predicted to target three genes (Ndrg3, Npepps, Pkm2). [score:3]
By initiating the expression of miR-122, the differentiating cells of a hepatic lineage have evolved an effective method for reducing the cell of a transcript that they have outgrown, in order to pave a path to ushering in a new phenotype for which self-renewal is undesired. [score:3]
The luciferase reporter was constructed by cloning into pMiR-REPORT vector (Ambion) the target PKM2 sequences of miR-122 downstream of the firefly luciferase gene and verified by sequencing. [score:3]
Figure S3 Reduction of endogenous Pkm2 expression by miR-122 modulates cellular proliferation. [score:3]
The large boxed region shows that the target sequence of miR-122 in the 3′UTR of Pkm2 is conserved among a large number of species. [score:3]
Both loss of Pkm2 and gain of miR-122 function in hESCs and HCCs lead to a severe deficiency in self-renewal and proliferation, and during the differentiation process of hESCs into hepatocytes, a reciprocal expression pattern is observed between miR-122 and Pkm2. [score:3]
An inverse expression pattern is observed between Pkm2 and miR-122 during hepatocyte differentiation of hESCsDuring the lineage specification process of hESCs into hepatocytes, the narrowing of the pluripotent potential is accompanied by a gradual loss of self-renewal. [score:3]
Figure S5 Overexpression of miR-122 is inversely correlated with IGF1R in HepG2 and Hep3B. [score:3]
In contrast, hESCs that were transfected with precursor miR-122 molecules revealed an increased expression of one of the stem cell markers (Sox2), as well as one of the early differentiation markers (Gsc). [score:3]
We then performed a series of tests using a luciferase reporter vector to evaluate whether miR-122 hybridizes to the in silico predicted sites in the 3′UTR of Pkm2 and inhibit translation (Figure 2E). [score:3]
Consistent with the luciferase reporter assays, over -expression of miR-122 in HepG2 and Hep3B cells significantly reduced the level of Pkm2 transcripts relative to the mock miR transfections (Figure 3H), indicating that miR-122 hybridizes to the 3′UTR of Pkm2 and induces transcript destabilization. [score:2]
To evaluate this, we utilized a three-step in vitro differentiation method for directing the specification of a large fraction of hESCs into hepatocyte-like cells [35]– [37], and examined the expression patterns of Pkm2 and miR-122 at 5 day intervals during the differentiation timeline. [score:2]
In this study, we have examined the role of a differentiated cell-specific miR-122 as a regulator of a common network of genes that promote the facilitation of stem cell self-renewal as well as hepatocellular carcinoma cell (HCC) proliferation. [score:2]
A mo del for miR-122 regulation of Pkm2. [score:2]
We found that in HCCs that were treated with 5-aza-dC, a significant increase in miR-122 expression was observed compared to the control (Figures 8C and 8D). [score:2]
0027740.g009 Figure 9A mo del for miR-122 regulation of Pkm2. [score:2]
Methylation analysis of the genomic region upstream of miR-122 using ChIP-chip and bisulfite treatment. [score:1]
In the liver, miR-122 has been described as a critical facilitator of various homeostatic functions, notably, fatty acid and cholesterol metabolism, as well as hepatitis C viral replication [16]– [20]. [score:1]
We found that HepG2 cells that were transfected with either of the two wild-type luciferase constructs resulted in a significant reduction of the luciferase activity in the presence of precursor miR-122 relative to the control (Figures 3E and 3F). [score:1]
Additional conservation information and the genomic locations of miR-122 and the 3′UTR of Pkm2 are shown in Figures S1 and S2. [score:1]
Hence, the combined results of ChIP-chip, bisulfite sequencing, and 5′RACE analyses suggest that in hPHs, RNAPII binds to the hypo-methylated promoter of miR-122 and initiates transcription. [score:1]
Both depleting hESCs and HCCs of Pkm2, or gain of miR-122 function, leads to a notable deficiency in self-renewal and proliferation. [score:1]
Figure S2 Genomic location and conservation of miR-122 and Pkm2. [score:1]
Quantification of the Hoechst stained nuclei from randomly chosen regions of the cultures validated the proliferation deficiency in the siPkm2 and miR-122 transfected HCCs, relative to the control (Figures S3A and S3B). [score:1]
Hence, in addition to the many homeostatic functions that have been ascribed to miR-122 in the liver, this miRNA may also function as an early defense mechanism against a possible neoplastic transformation. [score:1]
miR-122 is conserved in a large fraction of vertebrates. [score:1]
The ChIP data revealed that the upstream region of miR-122 in hPHs was covered with RNAPII, while in hESCs and Hep3B cells, the same region was hyper-methylated (Figure 6A). [score:1]
To confirm whether the promoter of miR-122 is located in this region, 5′RACE was performed to determine the transcription start site (TSS). [score:1]
To determine whether these regions contain a putative promoter sequence for miR-122, two programs, Promoter 2.0 [40] and BDGP [41], designed to identify possible promoter sequences in the genome were utilized. [score:1]
0027740.g008 Figure 8(A) The sequence shows the promoter region of pri-miR-122 as determined by 5′RACE. [score:1]
To do this, we examined the 20 kb genomic region up-stream of miR-122, where the putative promoter sequence of this miRNA is likely to be found, for methylation status and binding activity of RNA Polymerase II (RNAPII) in hESCs, HCCs and hPHs. [score:1]
Each of these vectors was then co -transfected into HepG2 cells with precursor miR-122 molecules or mock precursor miR molecules. [score:1]
Figure S1 Genomic location and conservation of miR-122 and Pkm2. [score:1]
In addition, the morphology of a larger fraction of hESC colonies in the miR-122 transfected condition appeared differentiated/unhealthy (Figure 4D and 4E). [score:1]
50,000 HepG2 and Hep3B cells were grown on 24-well plates, and transfected with 20 pmol of precursor miR-122 molecules or mock precursor miRNA molecules (Ambion) using Lipofectamine 2000 (Invitrogen) 24 hours after initial plating of the cells. [score:1]
5′RACE promoter analysis of pri-miR-122. [score:1]
By using this approach, we identified seven miRNAs, including miR-122, that are exclusively enriched in hPHs (Figure 2A). [score:1]
It remains to be seen whether silencing miR-122 in terminally differentiated hepatocytes may give rise to tumorigenesis. [score:1]
The reporter plasmids were co -transfected with 20 pmol of precursor miR-122 molecules or mock precursor miRNA molecules (Ambion) into 50,000 HepG2 cells in 24-well plates using Lipofectamine 2000 (Invitrogen). [score:1]
In order to verify these findings in vitro, we treated the HepG2 and Hep3B cells with a demethylating reagent, 5-Aza-2′Deoxycytidine (5-aza-dC), and performed RT-qPCR 72 hours following the treatment to measure the level of miR-122 expression. [score:1]
Bisulfite sequencing analysis of the predicted promoter region of miR-122 in hESCs, HCCs and hPHs. [score:1]
hESCs that were transfected with miRNA-122 molecules showed more colonies with morphologically differentiated regions (shown by red arrows). [score:1]
The up-stream genomic region of miR-122 is occupied by RNAPII in hPHs but hyper-methylated in hESCs and HCCs. [score:1]
The miR-122 promoter array was custom designed by tiling 20 kb region upstream from the mature miR-122 DNA sequence with 50-mer probes on 386K array platforms. [score:1]
An examination of the genomic region up-steam of miR-122 uncovered hyper-methylation in hESCs and HCCs, while the same region is de-methylated and occupied by a transcription initiating protein, RNA polymerase II (RNAPII), in hPHs. [score:1]
An examination of the genomic region up-steam of miR-122 uncovered hyper-methylation in hESCs and HCCs, while the same region is de-methylated and occupied by a transcription initiating protein, RNA polymerase II (RNAPII) in hPHs. [score:1]
Because established cell lines cannot fully recapitulate clinical malignancy, we also examined the enrichment pattern of miR-122 in primary liver tissues from three patients. [score:1]
By using this approach, we show that the TSS is located within the predicted promoter region of miR-122. [score:1]
Hoechst stained images of HepG2 and Hep3B cells at 24 and 36 hours post-transfection showed a notable difference in the amount of nuclei between the control, and both the siPkm2 and precursor miR-122 transfected conditions (Figures 4B and 4C). [score:1]
The horizontal bar on the top of the figure indicates the genomic positions on chromosome 18, and the location of the mature miR-122 sequence in the genome is boxed in yellow. [score:1]
In hPHs, an absence of methylation allows the binding of RNAPII and initiation of miR-122 transcription. [score:1]
The predicted promoter sequence of miR-122 (Figure S4) is indicated above the horizontal bar with the genomic positions. [score:1]
[1 to 20 of 111 sentences]
4
[+] score: 336
While miR122 restoration induced AKT2 and AKT3 significant down-regulation in HCC cells, treatment with TGF-β-R1 kinase inhibitor rescued only AKT2 expression. [score:8]
A total of 2432 genes that were differentially expressed (1215 genes were up-regulated and 1217 down-regulated) in BCLC9-miR122 compared to BCLC9 cells with a FDR < 0,05 (p < 0,05), were used for the analysis using Ingenuity [®] Pathways Analysis [™] (IPA) (http://www. [score:8]
BCLC9-AKT3 KD cells upregulate FOXO3A gene expression similarly as BCLC9-miR122 cells, but FOXO1 expression do not follow the same trend (Supplementary Figure S6C). [score:8]
AKT3 silenced cells reproduce the expression of FOXM1 and FOXO3A obtained in BCLC9-miR122 cells, but not for FOXO1 which expression was clearly down-regulated in BCLC9-AKT3 KD cells. [score:8]
Since TGF-β can also activate PI3K through phosphorylation of its effector AKT [29], we wanted to know if rescue in malignant behavior in BCLC9-miR122 cells due to TGF-β-R1 inhibition, were supported by AKT up-regulated expression and/or activation. [score:8]
Furthermore, we analyzed MYC expression during TGF-β-R1 inhibition and we found a significant increase in MYC protein load in BCLC9-miR122 cells (Figure 4D) and a significant decrease in p21 and p15 expression (Supplementary Figure S4C), confirming that TGF-β-R1 signalling pathways exert a cytostatic role in BCLC9-miR122 cells. [score:7]
Since miR122 down-regulation occurs frequently in HCC, upregulation of AKT3 kinase is almost an unavoidable event in this neoplasm. [score:7]
Accordingly, restoring miR122 expression in HCC cells with CSC phenotype will depict the mechanisms involved in the tumor suppressor impact of miR122 and it will provide valuable information about potential therapeutic targets for refractory/recurrent HCC. [score:7]
We found a significant down-regulation of FOXM1 gene expression in BCLC9-miR122 cells compared to parental BCLC9 cells, thus providing more evidences towards cell differentiation induced by miR122 expression. [score:7]
Only two of the genes tested- MYC and KLF4-were significantly down-regulated in BCLC9-miR122 cells, while CD133 and EpCAM genes were up-regulated (Figure 1C). [score:7]
miR122 increases adherence of cell spheroids and down-regulates pluripotency markers in vitroBCLC9 cell line was established from a well-differentiated human HCC [12] and they show a stem cell phenotype characterized by gene and protein expression of a pool of pluripotency markers: OCT4, NANOG, SOX2, KLF4, CD133, EpCAM, KRT19 genes, and overexpression of MYC which is not due to MYC gene amplification (Supplementary Figure S1A–S1C). [score:6]
AKT1, AKT2 and AKT3 expression are down-regulated in BCLC9-AKT3 KD cells as observed in BCLC9-miR122 cells (Supplementary Figure S6D). [score:6]
In BCLC9 cells, MYC is undoubtedly linked to all pathways regulated by miR122 and MYC expression recovery marks the shift in TGF-β activity, from tumor suppressor to oncogene. [score:6]
After treatment, miR122 transfected cells increased MYC protein load, down-regulated p21 and p15 expression and recovered cell proliferation rate. [score:6]
So, our results support the fact of BCLC9-miR122 cells being in a quiescent state because we are able to reverse this state by inhibiting TGF-β-R1 activation and we are able to demonstrate a down-regulation of IGF1R activity, one of the prevalent growth-promoting genes in malignant cells. [score:6]
miR122 and AKT3 expression was checked by means of real-time PCR using specificTaqMan expression assays (Applied Biosystems, Life Technologies) to detect mature miR122 and AKT3 expression. [score:6]
We found a significant down-regulation in all AKT gene expression and in AKT2 and AKT3 protein load in miR122 transfected cells (Supplementary Figure S5). [score:6]
We analyzed the potential role of TGF-β pathway in BCLC9-miR122 cells, because the mechanism of TGF-β growth arrest is related to the inhibition of MYC expression [15] and the induction of both p21 and p15 genes [16]. [score:5]
So, we generated a stable BCLC9 cell line expressing miR122 by plasmid transfection and confirmed its expression by real-time PCR (Figure 1A). [score:5]
Since BCLC9 cells do not express miR122, they are the perfect setting to analyze the effects of restoring miR122 expression in CSC-like human HCC cells. [score:5]
Several studies forcing expression of miR122 in HCC cell lines, describe miR122 as a liver tumor suppressor [8] and hepatocyte cell differentiation factor [9]. [score:5]
To discard any contribution of TGF-β pathway in BCLC9-miR122 cells, we treated transfected and parental cells with an inhibitor of TGF-β type 1 receptor phosphorylation: TGF-β-R1 kinase inhibitor II (II, 2-(3-(6-Methylpyridin-2-yl)-1H-pyrazol-4-yl)-1,5-naphthyridine). [score:5]
TGF-β-R1 inhibition decreases the percentage of phospho-p38 while further increases phospho-ERK1/2 levels These results confirm that treatment with TGF-β-R1 inhibitor reverts BCLC9-miR122 dormancy towards a proliferative condition due to a significant reduction in p38 activation (Supplementary Figure S4A). [score:5]
CCNG1 increased expression is justified by the fact that cyclin G1 is a miR122 target gene. [score:5]
Since AKT3 is a miR122 target, its expression remained almost silenced in miR122 transfected cells whatever treatment we applied. [score:5]
On the other hand, CD133 and EpCAM are significantly up-regulated in BCLC9-miR122 cells. [score:4]
Differences between the effects achieved by silencing AKT3 (in a setting of miR122 absence) and miR122 reestablishment, define the key facts in tumor cell dormancy: increase in functional p38 and cell cycle progression inhibitors p21 and p15, modulation of IGF1/IGF1R signaling pathway which, in turn, regulates AKT2 activation and subsequent FOXO activity. [score:4]
Since miR122 is key in hepatocyte differentiation [9], the reported miR122 down-regulation in a high percentage of HCCs, is justified. [score:4]
This result indirectly confirms IGF1R as a miR122 target gene [30]. [score:4]
The role of AKT3 in HCC is not known, so silencing AKT3 isoform in BCLC9 cells determined the effects of miR122 due to AKT3 down-regulation. [score:4]
We also confirmed the induction of two TGF-β target genes different from those directly involved in cell cycle progression: TGF-β Induced (TGFBI) and TGF-β Receptor 3 (TGFBR3) in BCLC9-miR122 cells (Supplementary Figure S3D). [score:4]
Up to 70% of hepatocellular carcinomas (HCC) show miR122 down-regulation [6] and the same applies for HCC-derived cell lines [7]. [score:4]
Since CDKNs are direct targets of TGF-β pathway, our results ratify its cytostatic role in BCLC9-miR122 but not in BCLC9-AKT3 KD cells. [score:4]
miR122 expression increases along with liver development. [score:4]
miR122 increases adherence of cell spheroids and down-regulates pluripotency markers in vitro. [score:4]
We observed FOXO1 and FOXO3A gene up-regulation in BCLC9-miR122 cells in array platform and real-time PCR (Figure 5A). [score:4]
Thus, miR122 might act as a differentiation factor in BCLC9 cells since it down-regulates two out of the four master pluripotency genes: OCT4, SOX2, KLF4, and MYC [13]. [score:4]
miR122 regulates AKT expression and activation. [score:4]
This, indirectly confirms IGF1R as a gene target of miR122. [score:4]
miR122 modulates FOX gene family expression. [score:3]
TGF-β-R1 inhibition in BCLC9-miR122 cells induced the recovery of AKT2 to the levels observed in parental BCLC9 cells, but AKT3 levels remained nearly undetectable in BCLC9-miR122 (Figure 6C). [score:3]
Our study demonstrates that restitution of miR122 expression, in addition of functioning in stem/progenitor liver cells on a normal basis, is able to reduce tumor growth by inducing tumor cell dormancy in a human HCC cell line with a consistent stem-like profile. [score:3]
Here we demonstrate TGF-β cytostatic role in BCLC9-miR122 cells by inhibiting TGF-β-R1 kinase activation. [score:3]
AKT3 protein is almost knocked-down in BCLC9-miR122 cells compared to the high amounts of this kinase in parental cells, this ratifies AKT3 as a miR122 target [28] (Figure 6A). [score:3]
Thus, restoration of miR122 induces a dormant state that can be reverted by TGF-β-R1 pathway inhibition. [score:3]
miR122 transfection in BCLC9 cells is able to reduce significantly the expression of KLF4 and MYC genes, both associated to cell pluripotency. [score:3]
To determine if BCLC9-miR122 tumors are going into a dormant state and the potential role of TGFβ pathway in this condition, expression of ERK1/2, and p38 and their phosphorylated forms in parental BCLC9 and BCLC9-miR122 cells were analyzed in vitro. [score:3]
FOXM1 down-regulation was confirmed in BCLC9-miR122 compared to parental cells (Figure 5A). [score:3]
So, miR122 transfected BCLC9 cells enter in a dormant state and treatment with TGF-β-R1 kinase inhibitor reverts those ratios, thus confirming the exit of dormancy and resuming the high proliferative phenotype in BCLC9-miR122 cells. [score:3]
Although AKT3 absence partially reproduces the effects induced by miR122 expression in BCLC9 cells, it is not enough to fully reduce tumor size. [score:3]
BCLC9-miR122 reveal a significant decrease in cyclins A2, E1, and G1 and a higher expression of p21, p15 and p16. [score:3]
We reestablished miR122 expression in a distinctive human HCC cell line - the BCLC9 cell line. [score:3]
So, miR122 expression is rendering BCLC9 cells to a more “well-behaved” phenotype. [score:3]
TGF-β-R1 kinase inhibition in BCLC9-miR122. [score:3]
Not surprisingly, results of array analysis comparing BCLC9-miR122 and BCLC9 cells, revealed an increase in expression of genes involved in cell cycle arrest, and a decrease in DNA replication and cancer pathway -associated genes. [score:3]
Percentage of phosphorylated AKT2 over total AKT2 protein load, showed that BCLC9-miR122 cells, with or without TGF-β-R1 inhibitor treatment, do not phosphorylate AKT2, although this treatment induces an increase in AKT2 isoform (Figure 6D). [score:3]
IHC confirmed that AKT3 is highly expressed in BCLC9 tumors, it is reduced in BCLC9-miR122 tumors and completely absent in mouse healthy liver (Figure 6B). [score:3]
Neither SMAD2 nor SMAD3 expression and activation, change depending on the presence of miR122 in vitro (Figure 3A, 3B) or in vivo (Figure 3C). [score:3]
BCLC9-miR122 cells show increased expression of p38 compared to parental cells and the same happens when we determine the ratio of activated forms, phosphoERK1/2:phospho-p38. [score:2]
miR122 is one of the most abundant miRNAs in the adult healthy liver but absent in fetal liver and this is suggestive that miR122 is crucial in organ development. [score:2]
AKT3 knocked-down cells (BCLC9-AKT3 KD) show an adherent phenotype comparable to that of BCLC9-miR122 cells (Supplementary Figure S6B) and a lower cell proliferation ratio in vitro (Figure 7A). [score:2]
BCLC9-miR122 cells treated with 1 μM of TGF-β-R1 inhibitor for 48 hours significantly increases cell proliferation rate when compared to untreated cells (Figure 3D). [score:2]
BCLC9-miR122 cells show a significant increase in FOXO3A expression confirmed by an increase in protein load compared to parental cells and a reduced percentage of inactivated FOXO3A. [score:2]
Reestablishing miR122 expression should be considered as a potential therapeutic strategy since it would work concurrently reducing tumor aggressiveness and decreasing HCC recurrence by favouring stem-like tumor cell differentiation. [score:2]
This agrees with a decrease in expression of CCNA2, CCND1 and CCNE1 in BCLC9-AKT3 KD cells compared to parental and BCLC9-miR122 cells. [score:2]
Figure 7Effects of AKT3 knock-down(A) Cell growth kinetics of parental BCLC9, BCLC9-miR122 and AKT3 silenced BCLC9 cells at different time points (t = 0, 24, 48, 96 and 144 hours). [score:2]
Studies performed by Wang and collaborators have shown a potential reciprocal regulation of MYC and miR122 in HCC [45]. [score:2]
Moreover, SMAD4 pathway is listed as an activated pathway in IPA analysis (Supplementary Figure S3C) in BCLC9-miR122 cells. [score:1]
To analyze AKT3-KD cells tumorigenic potential, we reproduced exactly the same protocol previously done in BCLC9-miR122 xenografts. [score:1]
miR122 delays cell proliferation and cell cycle progression. [score:1]
miR122 triggers dormancy program. [score:1]
Moreover, BCLC9-miR122 transfected cells only phosphorylate AKT2 kinase under insulin but not IGF1 treatment. [score:1]
Staining pattern in BCLC9-miR122 tumors is comparable to that of mouse healthy liver, used as a reference of quiescent liver. [score:1]
Figure 1(A) Mature miR122 levels in parental and miR122 -transfected BCLC9 cells determined by real-time PCR and related to healthy liver. [score:1]
miR122 do not activate canonical TGFβ pathway. [score:1]
Thus, our results demonstrate that miR122 is the unique responsible for rendering BCLC9-miR122 insensitive to IGF1 (Figure 7D). [score:1]
We treated parental and miR122 transfected cells with IGF1, one of the main triggers of AKT activation. [score:1]
Ratios of phospho-ERK1&2/phospho-p38 are shown for both BCLC9-miR122 against parental cells and for BCLC9-AKT3 KD against parental cells. [score:1]
Since no other human HCC cell line offers this profile, there is no possibility to verify our results in other liver cell line although effects of miR122 on differentiation of non-transformed progenitor cells are well reported. [score:1]
We performed in three independent batches of both parental BCLC9 cells and BCLC9-miR122 cells grown in vitro. [score:1]
Total RNA was extracted from three independent BCLC9 and BCLC9-miR122 cell batches. [score:1]
miR122 promotes hepatobiliary segregation and the acquisition and maintenance of a hepato-specific phenotype [8, 31]. [score:1]
Mature miR122 was positively localized in hepatocytes of all tumors from BCLC9-miR122 cells (Supplementary Figure S3B). [score:1]
Besides the well-known role of miR122 in favoring hepatitis C virus replication in hepatocytes [4], its function in the normal adult liver is related to cholesterol and lipid homeostasis [5]. [score:1]
BCLC9-miR122 cells were obtained by electroporation of pCMV6-GFP-MIR122 plasmid (MI0000442, OriGene Technologies. [score:1]
Treatment with neomycin once a week keeps selective pressure on miR122 -positive cells and puromycin treatment on AKT3 silenced cells. [score:1]
These results ruled out the possibility that BCLC9-miR122 tumors developed from BCLC9-miR122-negativized cells. [score:1]
Since TGF-β pathway seems to be activated in miR122 transfected cells, we analyzed SMAD2 and SMAD3 status to confirm a potential shift of TGF-β towards a cytostatic role. [score:1]
Parental BCLC9 and BCLC9-miR122 subconfluent cell cultures are analyzed using Hoechst 33342 (Molecular Probes, Invitrogen) in unfixed cells. [score:1]
Since, FOXM1 has been associated to human epithelial progenitor cell expansion [19] and malignancy [20], the results support the activity of miR122 in CSC differentiation. [score:1]
We analyzed BCLC9 and BCLC9-miR122 cell cycle by flow cytometry in physiologic conditions, this allowed us to know the percentage of cells alive in each phase. [score:1]
Figure 2(A) Flow Cytometry cell cycle analysis in unfixed BCLC9 parental cells (top) and BCLC9-miR122 cells (bottom) in physiologic conditions using Hoechst 33342 and PI as non-vital DNA dye. [score:1]
miR122 reduces cell proliferation and tumor progression in vivoWe performed in three independent batches of both parental BCLC9 cells and BCLC9-miR122 cells grown in vitro. [score:1]
miR122 restores liver cell homeostasis in CSC. [score:1]
We analyzed the presence of pluripotency cell markers to pinpoint miR122 role in cell differentiation. [score:1]
Analysis revealed a high percentage of BCLC9 and BCLC9-miR122 cells in Sub G [0]/G [1] and G [0]/G [1] phases (Figure 2A). [score:1]
We also confirmed a significant decrease in MYC protein load in BCLC9-miR122 cells (Figure 1D). [score:1]
Xenograft tumors derived from BCLC9-miR122 cells are significantly smaller than those generated by parental BCLC9 cells. [score:1]
Quiescence program was well-defined in BCLC9-miR122 cells, but BCLC9-AKT3 KD cells were not able to activate p38 MAPK in order to keep the low p-ERK1/2:p-p38 ratio that defines dormancy, thus BCLC9-AKT3 KD tumors were bigger than BCLC9-miR122 tumors but smaller than those from BCLC9 cells. [score:1]
In agreement with this, we demonstrated that BCLC9-miR122 cells show a lower cell proliferation rate both in vitro and in in vivo setting. [score:1]
BCLC9-miR122 and BCLC9-AKT3 KD culture medium is supplemented with neomycin (G418 disodium salt, Sigma-Aldrich, Germany; at a final concentration of 500 μgr/mL) and puromycin (Sigma-Aldrich, Germany; at a final concentration of 10 μgr/mL) respectively, once a week to keep selective pressure. [score:1]
AKT2 isoform was phosphorylated after IGF1 treatment in parental BCLC9 cells but not in BCLC9-miR122 cells. [score:1]
To check miR122 effects on cell proliferation in vivo, we injected 1·10 [6] of parental BCLC9 or BCLC9-miR122 cells in SCID mice. [score:1]
We observed that, differently from BCLC9-miR122 cells, phospho-ERK1/2:phospho-p38 ratio in BCLC9-AKT3 KD cells was comparable to that in parental BCLC9, clearly favouring phospho-ERK1/2 over phospho-p38 (Figure 7E and Supplementary Figure S6E). [score:1]
miR122 changes CSC profile and cell adherence capability. [score:1]
AKT3 silencing partially reproduces miR122 effects on CSC cells. [score:1]
On the contrary, BCLC9-miR122 tumors show widespread cytoplasmic positivity for p38 and phospho-p38 is clearly localized in the cell nuclei, indicating active p38 protein. [score:1]
To revise the responsiveness of BCLC9-miR122 to IGF1, we used insulin for AKT activation and we found a significant AKT2 phosphorylation in both BCLC9 and BCLC9-miR122 cells (Figure 6F). [score:1]
For instance, miR122 accounts for 72% of all miRs in the liver and it is undetectable in all other tissues analyzed [3]. [score:1]
BCLC9-miR122 tumors show cytoplasmic positive ERK1/2 staining, but no phospho-ERK1/2 (Supplementary Figure S4B). [score:1]
First group mice were injected with 1·10 [6] parental BCLC9 cells, the second group with 1·10 [6] BCLC9-miR122 cells and the third group of mice with 1·10 [6] BCLC9-AKT3 KD cells. [score:1]
All mice from both groups developed tumors, although tumors originated from BCLC9-miR122 cells were significantly smaller than those generated by parental cells (Figure 2D). [score:1]
BCLC9-miR122 cells show adherent phenotype (Figure 1B) different from that of parental cells. [score:1]
BCLC9-AKT3 KD cells originated tumors which size is halfway between those obtained from parental BCLC9 and BCLC9-miR122 cells (Figure 7F). [score:1]
miR122 reduces cell proliferation and tumor progression in vivo. [score:1]
[1 to 20 of 115 sentences]
5
[+] score: 334
Furthermore, the core protein -expressing transgenic mice and miR-122 knockout mice both are characterized by hepatic inflammation and fibrosis, followed by the development of hepatocellular carcinoma with age, further supporting the role of the core protein in liver diseases through its ability to promote miR-122 destabilization by inhibiting GLD-2. Studies have suggested that let-7i-5p and miR-29a-3p act as tumor suppressors because of their ability to repress oncogenes [39, 40]. [score:9]
In addition, it was found that miR-122 downregulates its target genes that may be involved in tumorigenesis and metastasis, thus acting as a tumor suppressor [12– 15]. [score:8]
Because GLD-2 silencing lowered miR-122 levels, we assessed whether the HCV core protein expression downregulates GLD-2, but we did not observe a reduction in GLD-2 expression (S6A Fig). [score:8]
We report in this study that the HCV core protein inhibits GLD-2’s terminal mononucleotidyl transferase activity, resulting in the downregulation of miR-122 isomers bearing non-templated 3′-end single-nucleotide additions and thereby the dysregulation of miR-122 function. [score:7]
Decreased miR-122 expression resulting from core protein expression during the course of chronic HCV infection may in part explain the oncogenic phenotype previously observed in cell culture and transgenic mice expressing the core protein [38]. [score:7]
These miR-122 suppressing effect would also contribute in promoting liver diseases and cancer development. [score:6]
To identify the viral proteins involved in this regulation of miR-122 expression, we monitored miR-122 levels in Huh7-derived cell lines that individually express the HCV core protein, NS5B, and NS proteins (NS3 to NS5B from an HCV genotype 1b subgenomic replicon, which constitutively replicates in the R-1 cell line; Fig 1C, top). [score:6]
These results together suggest that the inhibition of GLD-2-catalyzed 3′ non-templated nucleotide addition by the core protein is responsible for the downregulation of miR-122 following HCV infection. [score:6]
Downregulation of miR-122 expression by HCV core protein. [score:6]
In an additional experiment using various GFP-tagged core proteins (Fig 6C, top panel), we found that the full-length core protein GFP-C(1–191) and its truncation mutants GFP-C(76–191) and GFP-C(99–191), which localized in the cytoplasm due to the presence of the C-terminal region spanning amino acids 174–191, downregulate miR-122 expression. [score:6]
However, when GLD-2 expression was substantially silenced with higher concentrations of siRNA, this inhibitory effect of core protein was diminished, suggesting that miR-122 level regulation by core protein is a GLD-2 -dependent event. [score:6]
The downregulating effect of the HCV core protein was also observed both in R-1 cells (Fig 1I) and in mouse primary hepatocytes (Fig 1J), which express the same mature form miR-122 as in human hepatocytes. [score:6]
In contrast, other truncation mutants [GFP-C(1–75), GFP-C(1–121), and GFP-C(1–173)], which translocated to the nucleus, failed to decrease miR-122 levels (Fig 6C and 6D), indicating that GLD-2 inhibition -mediated miR-122 expression regulation by the core protein is a cytoplasmic process. [score:6]
We demonstrated that the HCV core protein inhibits GLD-2 and thereby promotes miR-122 destabilization, which leads to the downregulation of HCV RNA abundance. [score:6]
Notably, the expression of miR-122 precursors (primary and precursor forms of miR-122) was not altered by the core protein (Fig 1E), demonstrating that miR-122 transcription and biogenesis were not affected by core protein expression. [score:5]
Loss of miR-122 expression in liver cancer correlates with suppression of the hepatic phenotype and gain of metastatic properties. [score:5]
As expected, this rescuing effect and target gene-suppressing activity disappeared when the miR-122 -binding site in the dual reporter was mutated. [score:5]
First, using a psiCHEK-2_CULT1(WT) dual-luciferase reporter vector that contains the CULT1 3′-UTR, a known target of miR-122 [23], we demonstrated that the reporter activity, which was suppressed by miR-122 duplex transfection, could be rescued by the HCV core protein both in Huh7 and R-1 cells (Fig 2A). [score:5]
Non-templated nucleotide addition to the 3′ end of miR-122 is suppressed in liver tissue from patients with HCV and in Huh7 cells expressing HCV core protein or infected with HCV. [score:5]
We observed a significant decrease in the expression of the mature form of miR-122 when the HCV core protein was expressed (30 ± 11.5% decrease; Fig 1C and 1D), whereas its levels were not influenced by NS proteins. [score:5]
These dual luciferase reporters contain the 3′-UTR fragment of cut-like homeobox 1 (i. e., CULT1), a transcriptional repressor of genes specifying terminal differentiation in hepatocytes, carrying either the miR-122 target sequence or its mismatched target sequence (Fig 2A) [23]. [score:5]
1005714.g002 Fig 2(A) Schematic representation of a reporter plasmid carrying a miR-122 target site [psiCHEK-2_CULT1(WT)] or a miR-122 mismatched target [psiCHEK-2_CULT1(MT)] at its 3′-UTR (top). [score:5]
Among diverse miRNA [578 (for HCV-2) to 775 (for HCV-3) species identified by aligning the reads to 1,080 prototype miRNAs in the miRNA database] expressed in human liver tissues, miR-122 was the most abundantly expressed miRNA. [score:5]
Interaction of the HCV core protein with GLD-2 in the cytoplasm is required for miR-122 expression regulation. [score:4]
Downregulation of miR-122 by HCV is attributed to the core protein. [score:4]
As observed in GLD-2 knock-downed cells, the 23-nt miR-122 isomers as well as the two other major isomers (21-nt and 22-nt species) concurrently decreased both in Huh7 cells transiently expressing the core protein and in HCV-infected cells (S2A and S2B Fig), suggesting that the miR-122 level reduction does not occur in a step-by-step manner in the order of decreasing length of isomers. [score:4]
Because miR-122 abundance was specifically regulated by GLD-2 silencing and the miR-122 isomers’ 3′ end was found to carry four different single ribonucleotides, we assessed the possibility that GLD-2 adds ribonucleotides other than adenylate to the 3′ end of miR-122 and sought to test whether GLD-2 catalytic activity is inhibited by the HCV core protein. [score:4]
In Huh7 cells transiently expressing the HCV core protein, decreased miR-122 levels were also observed, as assessed by real-time quantitative RT-PCR (53 ± 1.6% of an empty vector -transfected control) and northern blot analysis (35% decrease compared with miR-122 levels in the 6-μg empty plasmid -transfected control) (Fig 1F), whereas miR-221 levels were not altered upon core protein expression (Fig 1G). [score:4]
Interaction of the HCV core protein with GLD-2 in the cytoplasm is required for the downregulation of miR-122. [score:4]
In this study, we examined the mechanism by which the cellular abundance of miR-122 is downregulated by HCV. [score:4]
HCV core protein inhibits GLD-2, which specifically regulates the cellular abundance of miR-122. [score:4]
With many unanswered questions, our results propose a novel feedback regulatory mechanism for controlling HCV RNA abundance by the viral capsid protein, which is capable of modulating miR-122 activity and stability through the inhibition of GLD-2. All relevant data are within the paper and its files. [score:4]
In summary, our results provide a novel mechanism by which the HCV core protein controls viral replication levels through the downregulation of miR-122. [score:4]
These results demonstrate that miR-122 isomers modified by GLD-2 -mediated 3′ non-templated addition display increased miRNA activity and stability, implying that GLD-2 inhibition by the HCV core protein promotes miR-122 destabilization to dysregulate its functions in the liver and in the HCV life cycle. [score:4]
Our results demonstrate a novel role of the HCV core protein in regulating viral replication and translation through GLD-2 -mediated miR-122 stability control. [score:4]
Furthermore, when the core protein was expressed in GLD-2 knock-downed cells, miR-122 levels decreased further (Fig 4E, see the cells treated with 1 or 5 nM siGLD-2). [score:4]
In particular, the non-templated addition of adenylate residues, which is the major modification event of miR-122, was substantially inhibited by HCV. [score:3]
Via miRNA isomer profile analysis for the top 50 most abundantly expressed miRNAs in liver biopsies, we discovered that these 50 miRNAs, including miR-122, are modified via a non-templated or templated 3′ addition of any of four ribonucleotide residues. [score:3]
We demonstrated that the HCV core protein plays a role in reprogramming the cellular profile of miR-122 isomers by inhibiting GLD-2, a non-canonical cytoplasmic poly(A) polymerase, to promote miR-122 destabilization. [score:3]
As expected, we observed that miR-122 added exogenously could rescue the inhibitory effects of core protein in R-1 cells. [score:3]
Suppressing miR-122 levels in addition to sequestering of miR-122 by the HCV genome as reported recently [45] might be viral strategies to control viral titers. [score:3]
The beneficial effect of miR-122 in HCV replication and translation can be repressed by the accumulation of the core protein, which determines the degree to which the host supports viral replication and thus plays a role in establishing persistent infection. [score:3]
Analysis of miR-122 expression in HeLa cells. [score:3]
Sequestration of miR-122 with miravirsen, an antisense oligonucleotide targeting miR-122, resulted in a prolonged and dose -dependent decrease in HCV RNA titers in a clinical study [9]. [score:3]
Profile of miR-122 isomers in Huh7 and Huh7 expressing HCV core protein or infected with HCV. [score:3]
Using the miR-122-5p that was most efficiently adenylated by GLD-2, we revealed that the HCV core protein inhibits GLD-2’s 3′-end monoadenylation activity, whereas severe acute respiratory syndrome coronavirus (SARS-CoV) capsid protein had little effect on GLD-2 activity (Fig 5D). [score:3]
Silencing of GLD-2 expression with increasing doses of siRNA (Fig 4B), which was not associated with a substantial cell viability decrease (Fig 4C), decreased the cellular abundance of three major miR-122 isomers (21-, 22-, and 23-nt isomers) (Fig 4D), resulting in an overall 49% decrease in their miRNA levels and consequent decreases in HCV subgenomic RNA and viral protein (NS3 and NS5B) levels (Fig 4B and 4D). [score:3]
miR-122 binds to two closely spaced target sites in the 5′-UTR of the HCV genome to promote viral RNA stability and accumulation by diverse mechanisms [4– 8]. [score:3]
Inhibition of GLD-2 by the HCV core protein affects multiple miRNAs in addition to miR-122 by decreasing the proportion of mono-adenylated isomers. [score:3]
If consistent with the in vitro findings for GLD-2, the inhibition of GLD-2 by the HCV core protein would lower the proportion of miR-122 isomers bearing any single non-templated nucleotides at their 3′ ends. [score:3]
are expressed as a percentage of the miR-122 level in the normal liver specimen N-1. (B) Relative miR-122 level in Huh7 cells infected with HCV (MOI of ~0.25) at 2 days post infection. [score:3]
miR-122 is involved in the cholesterol synthesis pathway, and the plasma cholesterol level decreases upon the inhibition of miR-122 using an antisense oligonucleotide [10]. [score:3]
After 48 h, cells were harvested to assess expression levels of miR-122 (* P = 0.0025; F) and miR-221 (G), and cell viability (H). [score:3]
In HeLa cells, which express an undetectable amount of miR-122 (S7 Fig), all of the 23-nt miR-122 isomers (pre-annealed imperfect duplex miRNAs modified with a single nucleotide addition added to their 3′ ends) significantly increased the reporter-suppressing activity compared with the findings using the 21-nt isomer in a reporter assay with the psiCHEK-2_CULT1(WT) plasmid (Fig 7A). [score:3]
Similar results were also observed both in Huh7 cells transiently expressing core protein and in HCV-infected Huh7 cells (Fig 3D), in which only 3′-end mono-adenylated or uridylated species were detected probably due to ~100-fold lower miR-122 levels in Huh7 cells (Fig 1A and S4 Table). [score:3]
Dysregulation of miR-122 function by the HCV core protein. [score:2]
However, little is known regarding how the cellular abundance of miR-122 is regulated by HCV. [score:2]
HCV RNA abundance is regulated by miR-122 binding to the HCV 5′-UTR [4, 5, 26]. [score:2]
The tumor suppressor activity of miR-122 is well characterized in cells and miR-122 knockout mice [12– 15]. [score:2]
S5 Fig Terminal transferase assays were performed with eight different miRNAs (A) randomly selected from the top 50 most abundantly expressed miRNAs in human liver, along with miR-122-5p. [score:2]
This result suggests that miR-122 level regulation was not mediated through Ago2-core protein interactions. [score:2]
In addition to its proviral function for HCV, miR-122 regulates hepatic function and cholesterol and fatty-acid metabolisms [10, 11]. [score:2]
Cellular abundance of miR-122 is specifically regulated by GLD-2.. [score:2]
However, uridylation of miR-122 enhanced its stability and miRNA activity, highlighting the importance of the fine regulation of miRNA 3′-end modification for executing the optimal functions of individual miRNAs. [score:2]
Second, how does HCV regulate pre-miR-122 processing in its loop region? [score:2]
1005714.g007 Fig 7(A) A reporter assay was performed 48 h after the transfection of duplex forms of the indicated miR-122 isomers or scrambled siRNA (Ctrl) and the reporter plasmid psiCHECK-2_CULT1(WT) harboring a miR-122 target. [score:2]
Similarly, these miR-122 isomers were more effective in enhancing HCV IRES -mediated translation compared with the shorter forms of miR-122, the 21- and 22-nt isomers (Fig 7B). [score:2]
We silenced each of a series of known terminal nucleotidyl transferases using specific small interfering RNAs (siRNAs) and found that miR-122 abundance is specifically regulated by GLD-2, a non-canonical cytoplasmic poly(A) polymerase [29] [also known as terminal uridylyl transferase 2 (TUTase-2)] (Fig 4A). [score:2]
Thus, our results imply that the HCV core protein may contribute to liver cancer development by decreasing miR-122 levels. [score:2]
Dysregulation of miR-122 function by the core protein. [score:2]
We performed a series of experiments to evaluate the impact of miR-122 downregulation. [score:2]
These results also indicate that the RNA -binding activity of the core protein is not involved in this regulation because GFP-C(76–191) and GFP-C(99–191), lacking the known RNA -binding domain (amino acids 1–75) [34], did also reduce miR-122 levels. [score:2]
Notably, among these miRNAs, only miR-122 displayed >50% decreases regarding the proportions of all isomers modified by single nucleotide additions. [score:1]
In only six miRNAs carrying either a single non-templated adenylate residue (miR-122-5p, miR-92a-3p, miR-26a-5p, miR-186-5p, miR-30b-5p, and miR-29a-3p) or a single uridylate residue (miR-122-5p, let-7a-5p, and let-7g-5p have a 3′-end single uridylate residue that is either derived from their precursor forms or added in a non-template -dependent manner; let-7f-5p miR-26a-5p and miR-151a-5p have a non-templated uridylate residue), we observed decreases in their proportions in liver biopsies from patients with HCV. [score:1]
Hepatitis C virus (HCV) uses microRNA-122 (miR-122) as a proviral host factor to increase viral genome abundance, but HCV infection results in diminished miR-122 levels by unknown mechanisms. [score:1]
S2 Fig of miR-122 isomers in Huh7 cells and primary hepatocytes. [score:1]
GFP-C(151–191), in which 52 amino acids was further deleted from GFP-C(99–191) and thus lacks the most of the domain 2 of HCV core protein known to be required for its lipid droplet association [35], failed to decrease miR-122 level (Fig 6E). [score:1]
The miR-122 level was determined by real-time at 48 h post-siRNA transfection (20 nM). [score:1]
The ability of GLD-2 to use UTP and ATP as a substrate was also observed in the 24-nt isomers in which the U-tailed 23-nt isomer (it can be derived by the non-templated addition or aberrant processing of pre-miR-122) was further extended by the addition of a single uridylate or adenylate residue. [score:1]
GLD-2 monoadenlyation activity on miR-122 was also previously demonstrated with an immunoprecipitated mouse GLD-2 [19, 31] and a recombinant GDL-2 fused to the C-terminal end of GST [19]. [score:1]
In the hepatocellular carcinoma cell line Huh7, which is wi dely used in HCV studies because of its capability to support HCV replication, the miR-122 level was found to be approximately 100-fold lower than that in the normal liver N-1 (1.25% of miR-122 levels in N-1). [score:1]
Similarly, in a cellular context, helper protein might also govern GLD-2 specificity toward miR-122. [score:1]
miRNAs on the x-axis (starting from miR-122-5p) are in the order of their abundance in liver biopsies. [score:1]
As size markers, 5′- [32]P-labeled miR-122 isomers were used. [score:1]
Presented at the top is the pri-miR-122 sequence showing processing sites (blue arrows) for the 22-nt prototype miR-122 and an aberrant 3′-terminal processing site (black arrow) for the 23-nt isomer bearing a template-derived 3′ GU-tail. [score:1]
Finally, it should be stated that there was a substantial decrease in the proportion of the single U-tailed abundantly present 23-nt miR-122 isomer (aberrantly processed or terminally modified one), suggesting that pre-miR-122 processing in its single-stranded loop region might also be influenced by HCV infection (30%–33% of 22-nt canonical miR-122 in normal liver versus 14%–18% in patient liver biopsies). [score:1]
In these miR-122 species, the non-templated addition of uridylate residues was repeatedly observed. [score:1]
Notably, in patient liver specimens, all of the miR-122 isomers with a non-templated nucleotide added to the 3′-end of 22-nt prototype miR-122 exhibited a similar decrease in their proportions (Fig 3B). [score:1]
The miR-122 level decreased gradually during the course of HCV infection as early as day 1 post-infection (S1B Fig). [score:1]
Given that miR-122 is a specific template of GLD-2, one important question is whether the non-templated addition of all four different nucleotides to miR-122 is catalyzed by GLD-2 alone. [score:1]
Importantly, we found that GLD-2 was capable of adding any of the four ribonucleotides to the miR-122 3′ end with almost similar efficiency (Fig 5C). [score:1]
In this cell line, HCV infection elicited a 70 ± 1.5% decrease in miR-122 levels at 2 days post infection (Fig 1B) when ~30–40% of cells were infected as determined by immunostaining of core protein (S1A Fig). [score:1]
We intended to test the possibility that HCV infection affects this miRNA modification process to alter the profile of miR-122 isomers. [score:1]
1005714.g003 Fig 3 (A) Analysis of miR-122 isomers identified by the deep sequencing of small RNA libraries from human liver biopsies. [score:1]
The results together demonstrate that regardless of the types of 23- and 24-nt miR-122 isomers bearing a single nucleotide or dinucleotide, their relative proportions were decreased in liver tissues from patients with HCV. [score:1]
We detected various miR-122 species in the range of 16 to 25 nucleotide (nt) in length (S3 Table). [score:1]
Owing to the high abundance of miR-122 in the liver, the analysis of our small RNA sequencing datasets enabled us to identify previously uncovered 24-nt miR-122 species that carry a dinucleotide (AA and AU; all represent non-templated nucleotides that always start with A) or a 25-nt species bearing a triple nucleotide sequence (U UU; underlined sequences represent non-templated nucleotides). [score:1]
Interference of miR-122 function using an antisense oligonucleotide decreased cholesterol levels in plasma [11]. [score:1]
The 23-nt isomer, including five different species, had either a templated nucleotide [i. e., the 3′-end U residue derived from precursor miR122 (pre-miR-122); Fig 3B, top shows the partial primary miR-122 (pri-miR-122) secondary structure and sequence] or a non-templated nucleotide (i. e., isomers bearing a dinucleotide of 3′-G A, 3′-G G, and 3′-G C in the 23-nt isomer in which the penultimate G is derived from a template or a 3′- AU dinucleotide; underlined sequences represent non-templated additions) at their 3′ ends. [score:1]
Indeed, the read frequency of all of the abovementioned miR-122 species was substantially decreased in liver biopsies from patients with HCV (S3 Table). [score:1]
This result was unexpected because GLD-2 was originally identified as a non-canonical cytoplasmic poly(A) polymerase that acts on certain mRNAs [29, 30] but was consistent with previous studies illustrating GLD-2 -mediated miR-122 3′ adenylation [19, 31]. [score:1]
Having found that HCV infection interferes with miR-122 3′-end tailing in liver tissues, we investigated whether the HCV core protein inhibits this modification. [score:1]
Having found that HCV infection decreases the proportion of miR-122 isomers with a mononucleotide tail (see Fig 3B), we asked whether HCV infection also reprograms the isomer profiles of other liver-resident miRNAs. [score:1]
S7 Fig (A) Total RNA isolated from HeLa and Huh7 cells was analyzed by northern blotting for miR-122. [score:1]
Alteration of miR-122 isomer profile by HCV infection. [score:1]
In addition, a decreased miR-122 level was detected in sera from patients with HCV [21, 22]. [score:1]
In addition to the 3′-end mono-adenylated isomer, we could also detect miR-122 isomers carrying a 3′-mono-G or -C tail in the liver biopsies, but these isomers represented <0.2% of the total read counts of all miR-122 species (S3 Table). [score:1]
Interestingly, the proportion of individual miR-122 isomers was substantially altered in patient liver biopsies. [score:1]
1005714.g004 Fig 4(A) mir-122 level in Huh7 cells silenced for indicated terminal nucleotidyl transferases using siRNA. [score:1]
3′-End nucleotide addition to miR-122 promotes its activity and stability. [score:1]
Complete list of all miR-122 sequences obtained by deep sequencing of small RNA libraries from human liver biopsies. [score:1]
Because miR-122 isomers of 21, 22, and 23 nt in length are three prominent species, which were detectable by northern blot analysis of total RNA from Huh7 cells and primary hepatocytes (S2A and S2C Fig), and other individual isomers comprised <2% of the total read counts of all forms of miR-122 species (with a read frequency of >50 reads per million) in biopsies, we focused on these three isomers for further sequence analysis. [score:1]
1005714.g001 Fig 1(A) quantification of miR-122 levels normalized to U6 snRNA in liver biopsies from patients with HCV (HCV-1 to HCV-3) and healthy controls (N-1 and N-2) and in Huh7 cells. [score:1]
Analysis of small RNA sequencing datasets for each species of the 24-nt miR-122 isomers (four different species of 24-nt isomer harboring an AA, AU, U U, and U A dinucleotide; underlined sequences represent non-templated nucleotides) also revealed that their relative ratios decreased by >2-fold in HCV-infected liver tissues, although the total read counts of the 24-nt long miR-122 isomers was relatively low (approximately 1% of total reads; S3 Table). [score:1]
Initially, we tested the adenylation activity of the purified recombinant GLD-2 with an N-terminal histidine tag and found that wild-type GLD-2, but not its inactive form GLD-2(D215A), monoadenylates miR-122-5p (Fig 5B). [score:1]
Northern blot analysis of miR-122 isomers in Huh7 cells and primary hepatocytes. [score:1]
Interestingly, the GST-fused GLD-2 used in the latter study displayed a weak preference for ATP over UTP on miR-122. [score:1]
Plotted in (D) are the relative levels of miR-122 (mean ± SD) estimated from three independent experiments. [score:1]
MicroRNA-122 (miR-122) is the most abundant miRNA in the liver [2, 3]. [score:1]
Probe sequences were as follows: 5′-ACAAACACCATTGTCACACTCCA-3′ (miR-122-5p), 5′-GAAACCCAGCAGACAATGTAGC-3′ (miR-221), and 5′-CCTGCTTAGCTTCCGAGATCA-3′ (5S rRNA). [score:1]
Analysis of the activity and stability of miR-122 isomers. [score:1]
miR-122 transfection into R-1 cells increased HCV subgenomic RNA titer (Fig 2C), confirming the previous findings. [score:1]
Translin, a DNA -binding protein, was reported to bind to miR-122 and increase its stability [32]. [score:1]
Huh7 or R-1 cells treated with miR-122 duplexes were transfected with each indicated reporter plasmid together with pcDNA3.1 (Ctrl) or pcDNA3.1-Flag-core (Core). [score:1]
Previous studies illustrated that miR-122 levels are decreased in HCV-infected cells [21]. [score:1]
[1 to 20 of 125 sentences]
6
[+] score: 323
To examine whether miR-122 inhibits PACT expression at the protein level, we also performed western blot analysis of LX-2 cells transfected with miR-122 or miR-C. A significant down-regulation of PACT expression in the LX-2 cells expressing miR-122 was observed at the protein level (Fig 4B). [score:12]
To validate whether miR-122 inhibits PACT mRNA expression, we performed real-time PCR analysis of LX-2 cells transfected with miR-122 or miR-C. We confirmed the significant down-regulation of PACT mRNA expression in the LX-2 cells transfected with miR-122 (Fig 4A). [score:10]
These data suggest that the inhibition of inflammatory cytokine production together with the knockdown of PACT in HSCs inhibits the migration of monocytes and monocyte-derived cells, supporting the notion that miR-122 inhibits cytokine production in HSCs and the recruitment of immune cells to the liver at least in part, due to the suppression of PACT. [score:10]
In particular, PCR array analysis showed that miR-122 downregulated PACT mRNA expression (0.56-fold; Fig 3A), and TargetScanHuman revealed that PACT mRNA is a putative target of miR-122. [score:10]
These results also supported the previous observation that IFN could modulate the expression of liver-specific miR-122 [56], which may be due to the fact that IFN treatment can inhibit miR-122 expression and induce PACT expression. [score:9]
To confirm that miR-122 directly regulates PACT expression, we examined whether its overexpression inhibited the activity of a luciferase reporter construct containing PACT 3´-UTR (wild) or PACT 3´-UTR (mutant) (Fig 4C). [score:9]
In general, miRNAs inhibit gene expression; therefore, we focused on genes downregulated by miR-122. [score:8]
Furthermore, we observed that the down-regulation of PACT by miR-122 and the pharmacological inhibition of PKR activity suppressed cytokine production in HSCs, suggesting the importance of PKR signaling. [score:8]
It is known that LPS treatment upregulates PACT expression [41], but we did not observe any differences in miR-122 expression between HSCs treated with or without LPS (1.1 or 1.0-fold, respectively). [score:8]
MiR-122 -deficient mice show increased hepatic inflammation through the up-regulation of MCP-1 in hepatocytes, directly by the targeting of this transcript and indirectly as in a response to underlying hepatocyte injury [19]. [score:7]
These data suggest that the inhibition of inflammatory cytokine production together with miR-122 in HSCs inhibits the migration of monocytes and monocyte-derived cells, supporting the concept that miR-122 prevents hepatic inflammation by inhibiting cytokine production and the recruitment of immune cells to the liver. [score:7]
In the present study, we described at least four important findings, demonstrating that miR-122 can affect HSCs and that it is involved in immune response in the liver, including the following: 1) miR-122 negatively regulates the production of IL-6, MCP-1 and IL-1β after LPS stimulation in HSCs (Fig 2); 2) miR-122 directly targets the PKR activator, PACT (Fig 4); 3) PKR signaling can also play a role in cytokine production in HSCs, at least in part through NF-κB (Figs 6 and 7); and 4) Conditioned media from miR-122 -transfected LX-2 cells can suppress the migration of human monocyte-derived THP1 cells, suggesting that this miR affects the migration of monocytes and monocyte-derived cells in the liver (Fig 2). [score:7]
We also postulated that indirect inhibition of the activation of NF-κB by miR-122 might result in inhibition of cytokine production, as this transcription factor plays a role in LPS -induced inflammatory cytokine production [7, 24]. [score:6]
Therefore, the down-regulation of miR-122 in hepatocytes may also increase cytokine production in these cells and contribute to the progression of liver disease. [score:6]
There have been several reports of the association of the down-regulation of hepatic miR-122 with human liver diseases. [score:6]
Down-regulation of miR-122 in the liver has been reported in certain patients with advanced liver disease and in animal mo dels of hepatic fibrosis. [score:6]
In conclusion, our study demonstrated that miR-122 downregulates cytokine production in HSCs and inhibits monocyte chemotaxis. [score:6]
MiR-122 directly downregulates PACT expression. [score:6]
Further studies may be needed to examine whether overexpression of miR-122 can also inhibit inflammatory cytokine production in monocytes. [score:5]
In rats, miR-122 is constitutively expressed in HSCs, and its expression level is decreased in activating HSCs, suggesting its importance in hepatic fibrosis [20]. [score:5]
A total of 3 x 10 [5] LX-2 cells were co -transfected with either 0.1 μg PACT 3´-UTR (wild) or PACT 3´-UTR (mutant) reporter clones for miRNA target validation (Origene, Rockville, MD) and 10 ng phRluc-TK vector (Promega, Madison, WI), which is a transfection efficiency internal control plasmid expressing Renilla reniformis luciferase, and 50 nM miR-122. [score:5]
In the present study, we observed that the overexpression of miR-122 could inhibit the production of inflammatory cytokines and migration of monocytes. [score:5]
Out of 84 TLR-signaling pathway -associated genes, 19 genes (22.6%) were downregulated by 1.17-fold or greater in miR-122 -transfected LX-2 cells compared with miR-C -transfected LX-2 cells in the presence of LPS-stimulation (Fig 3A; n = 3, P < 0.05), and 17 genes (20.3%) were upregulated by 1.17-fold or greater in miR-122 -transfected LX-2 cells compared with miR-C -transfected LX-2 cells in the presence of LPS-stimulation (Fig 3B; n = 3, P < 0.05). [score:5]
We examined the functional role of the miR-122 -mediated inhibition of inflammatory cytokine expression. [score:5]
The targeting of miR-122 may shed new light on therapeutic options to prevent the progression of liver diseases. [score:5]
The present study showed that miR-122 inhibits the production of proinflammatory cytokines by targeting PACT in human HSCs. [score:5]
MiR-122 directly inhibits PACT expression in LX-2 cells. [score:5]
We expected that miR-122 might inhibit PACT expression and the interaction between PACT and PKR. [score:5]
Gene expression was normalized to five internal controls (β-2-microglobulin, hypoxanthine phosphoribosyltransferase 1, ribosomal protein large P0, GAPDH and β-actin) to determine the fold-changes in gene expression between the test sample (miR-122 -transfected-LX-2) and the control sample (miR-C -transfected-LX-2) by the 2 [-ddCt] methods. [score:5]
0144295.g004 Fig 4(A) MiR-122 inhibits PACT mRNA expression. [score:4]
IL-6, MCP-1 and IL-1β mRNA expression levels in the LX-2 cells transfected with miR-122 were significantly inhibited, compared with those in the LX-2 cells transfected with miR-C (Fig 2A). [score:4]
Our study also revealed that miR-122 in HSCs might be an important regulator of hepatic inflammation and could have therapeutic potential for preventing the progression of liver diseases. [score:4]
MiR-122 inhibits cytokine production in LX-2 cells and suppresses the migration of THP-1 cells. [score:4]
Further study concerning the regulation of miR-122 may also be important for the increased understanding of chronic liver disease. [score:4]
Taken together, these data demonstrate that PACT is a direct target of miR-122. [score:4]
Conditioned media from miR-122 -transfected LX-2 cells suppress human monocyte-derived THP-1 cell migration. [score:3]
In the present study, miR-122 inhibited TLR4 signaling after LPS stimulation in HSCs, indicating that it may play an important role in preventing liver inflammation caused by bacterial translocation. [score:3]
A reduction in hepatic miR-122 expression has been observed in patients with NASH and chronic hepatitis B infection [44, 45]. [score:3]
We also co-expressed miR-122 and PKR induced by IFN-α in LX-2 cells, in the presence of LPS stimulation, and observed that NF-κB nuclear localization was partly rescued (Fig 7B). [score:3]
0144295.g003 Fig 3(A) Downregulated genes in miR-122 -transfected LX-2 cells compared with miR-C -transfected LX-2 cells. [score:3]
We next examined whether miR-122 could inhibit the production of inflammatory cytokines induced by LPS in HSCs. [score:3]
The inhibition of several proinflammatory cytokines, such as IL-1β, MCP-1, IL-8 and IL-6, was observed in the LX-2 cells transfected with miR-122 (Fig 3A). [score:3]
RNAs were isolated from LX-2 cells transfected with miR-122 or miR-C, and PCR array analysis was performed to assess the expression of TLR and its related genes. [score:3]
We and others [25] have identified PACT as one of the target genes of miR-122. [score:3]
In the present study, we showed another mechanism of MCP-1 inhibition by miR-122, suggesting the importance of HSCs in hepatic inflammation. [score:3]
Taken together, miR-122 could prevent hepatic inflammation by inhibiting LPS -induced cytokine production and the recruitment of immune cells to the liver. [score:3]
We also observed that miR-122 inhibited the phosphorylation of IκBα (Fig 7C). [score:3]
We observed that IFN treatment in miR-122 overexpressed LX-2 cells treated with LPS rescue NF-κB nuclear translocation (Fig 7B). [score:3]
Similarly, miR-122 expression levels in LX-2 cells are ~20% of those in Huh7 cells [20]. [score:3]
Previous reports have shown that transcription factors, such as CCAAT/enhancer -binding protein α (C/EBPα) and hepatocyte nuclear factor 4α (HNF4α), promote miR-122 expression in hepatocytes [49] and HSCs [20]. [score:3]
In humans, changes in the level of miR-122 in HSCs during the progression of chronic liver disease and the influence of this miR on hepatic inflammation in these cells have not been well assessed. [score:3]
We observed that miR-122 inhibited the migration of PMA-stimulated THP-1 cells more weakly than PMA-unstimulated THP-1 cells (~3-fold vs. [score:3]
To further advance mechanistic insights into the role of miR-122 in innate immunity, including its effects on cytokines and the TLR signaling pathway, we assessed the gene expression profile of LX-2 cells. [score:3]
Song et al. [50] have shown that peroxisome proliferator-activated receptor γ (PPARγ) promotes miR-122 transcription and that hepatitis B virus X protein inhibits PPARγ binding. [score:3]
Previous study has shown that miR-122 expression levels in primary HSCs are ~25% of those in primary hepatocytes [20]. [score:3]
MiR-122 modulates the expression of genes related to TLR and its associated signaling pathway in LX-2 cells. [score:2]
Because MCP-1 functions as a chemoattractant cytokine for monocytes, macrophages and Kupffer cells [28], which seem to contribute to inflammation in the liver [29], we focused on cell migration of the human monocyte-derived cell line THP-1. We performed in vitro migration assays to determine whether conditioned media from miR-122 -transfected LX-2 cells could suppress the migration of THP-1 cells. [score:2]
We confirmed that 8-nt seed matches seem to result in the regulation of a given message by miR-122 (Fig 4C). [score:2]
MiR-122 inhibits cytokine production in LX-2 cells. [score:2]
MiR-122 reduced the luciferase activity of PACT 3´-UTR (wild) (Fig 4D) but not the PACT 3´-UTR (mutant) (Fig 4E), suggesting that the mutation in the seed sequence prevented the binding of miR-122 to 3´-UTR (Fig 4C). [score:2]
However, the mechanism of the regulation of miR-122 is still not well understood. [score:2]
Further, real-time PCR assay showed no miR-122 expression in THP-1 cells under our experimental conditions. [score:2]
We performed a pathway-specific PCR array to identify miR-122 target genes in miR-122 -transfected LX-2 cells compared with miR-C -transfected LX-2 cells (Fig 3A and 3B). [score:2]
Yet, the role of miR-122 in HSCs on hepatic inflammation is not well known. [score:1]
0144295.g007 Fig 7 (A) LX-2 cells were transfected with miR-C, miR-122, si-C or si-PACT. [score:1]
However, Momen-Heravi et al. [55] have recently shown that exosomes mediated communication between hepatocytes and monocytes/macrophages, and that hepatocyte-derived miR-122 could reprogram monocytes, inducing sensitization to LPS. [score:1]
HSCs may not be the major source of liver inflammation, and they produce miR-122 at low levels. [score:1]
In this study, we examined the sublocalization of NF-κB in LX-2 cells transfected with miR-122 or si-PACT after LPS stimulation (Fig 7A). [score:1]
It has been reported that miR-122 is associated with lipid metabolism, stress response and hepatitis C virus (HCV) replication [18]. [score:1]
It was reported that miR-122 levels go down with fibrosis and also in activated HSCs [44– 46]. [score:1]
A total of 5 x 10 [5] THP-1 cells were placed in the upper chamber, and conditioned medium from LPS-stimulated LX-2 cells transfected with miR-C or miR-122 was added to the lower chamber. [score:1]
The white rectangle in hsa-miR-122-5p indicates the seed sequence. [score:1]
LX-2 cells were transfected with miR-122 or control miR-C. After incubation in DMEM with 1% FCS for 24 hours, the cells were treated with 100 ng/mL LPS for 24 hours. [score:1]
If there is no interaction between miR-122 and 3´-UTR of the PACT mRNA, luciferase activity remains high. [score:1]
Moreover, we observed a reduction in the phosphorylation status of PKR in miR-122 -transfected LX-2 (Fig 4F). [score:1]
Hsa-miR-122-5p mimic (miR-122) and control miR (miR-C) were purchased from Life Technologies (Tokyo, Japan). [score:1]
NF-κB nuclear translocation decreases in LX-2 cells transfected with miR-122 or si-PACT. [score:1]
Transfections were performed with 50 nM miR-122, 50 nM miR-C, 20 nM si-PACT, or 20 nM si-C using Effectene Transfection Reagents (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. [score:1]
In addition, because exosomes, nano-sized membranous vesicles, have been reported in association with the transfer of miRs between hepatic cells [48], it is possible that miR-122 derived from hepatocytes affects the functioning of HSCs. [score:1]
IL-1β in conditioned medium from the untransfected, miR-C -transfected or miR-122 -transfected LX-2 cells was undetectable, 4.55 pg/mL or undetectable, respectively. [score:1]
In chronic hepatitis C patients with advanced fibrosis, hepatic miR-122 is also decreased [46, 47]. [score:1]
The migration of THP-1 cells was markedly decreased (~68%) when conditioned media from LX-2 cells transfected with miR-122 was used (Fig 2C). [score:1]
MiR-122 represents approximately 70% of the total miRs in the liver [16, 17]. [score:1]
The amount of miR-122 mimic used in the present study seems high, but it was similar to previous reports [20, 53, 54]. [score:1]
When the miR-122/RNA -induced silencing complex (RISC) binds to 3´-UTR of PACT mRNA, firefly luciferase activity is reduced. [score:1]
Then, the cells were transfected with miR-122, miR-C, si-PACT or si-C. Thirty-six hours post-transfection, the cells were treated with 100 ng/mL LPS or 1 x 10 [5] U/mL IFN-α. [score:1]
The modulation of IL-6 and MCP-1 by miR-122 in conditioned medium was also verified by. [score:1]
The number of migrated THP-1 cells was 31,700/well, 28,000/well or 19,800/well when conditioned medium from LX-2 cells transfected with mock, miR-C or miR-122, respectively, was used. [score:1]
LX-2 cells were transfected with mock, 50 nM control miRNA (miR-C) or 50 nM miR-122. [score:1]
These findings suggest that miR-122 can affect cytokine production, at least in part, through NF-κB. [score:1]
[1 to 20 of 90 sentences]
7
[+] score: 277
Other miRNAs from this paper: hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-103b-1, hsa-mir-103b-2
These results show that miR-122 directly inhibits c-Met translation by targeting the 3′UTR region. [score:8]
Overall, our findings provide an insight into (1) the inhibitory role of Gα [12] in miR-122 targeting c-Met, and (2) the crosstalk between GPCR and c-Met in HCC, implying that intervention of the Gα [12] pathway may be of help to improve c-Met -targeted therapy. [score:7]
To verify the effect of siRNA knockdown of Gα [12] on miR-122 expression, we examined the effects of four different siRNAs on the basal Gα [12] expression in HepG2 cells (Figure 1D). [score:6]
Hence, Gα [12] overexpression in HCC makes a positive feed-forward loop in activating signaling such as ERK1/2, STAT3, Akt, and mTOR through up-regulation of c-Met as a consequence of decrease of miR-122 in the tumor tissue. [score:6]
These results provide evidence that Gα [12] decreases miR-122 levels by inhibiting HNF4α activity, which may contribute to c-Met up-regulation. [score:6]
Our data indicates that Gα [12] overexpressed in liver cancer mostly greatly dysregulates the expression of miR-122. [score:6]
c-Met overexpression by activated Gα [12] and the effects of LPA and S1P on miR-122 and c-Met expression. [score:5]
Because miR-122 is the most greatly and significantly suppressed by activated Gα [12] among those down-regulated in the microarray analysis, this study investigated the effect of miR-122 dysregulation on cancer cell malignancy using cell and animal mo dels, and human HCC samples. [score:5]
Based on the targeting efficacy on miR-122 expression, siGα [12]#1 was selected in the subsequent experiments. [score:5]
c-Met overexpression by activated Gα [12] and the effects of LPA and S1P on miR-122 and c-Met expressionHaving identified the link between miR-122 and c-Met downstream of Gα [12], we next confirmed the effect of Gα [12] modulations on c-Met. [score:5]
Because miRNAs have overlapping targets, other targets of miR-122 including cyclin G1 and ADAM17 may additionally be involved in HCC pathogenesis [25, 33]. [score:5]
using Microcosm program enabled us to select the targets putatively regulated by miR-122. [score:4]
Clinical outcomes of HCC patients in association with weak or strong Gα [12] expression, miR-122 dysregulation, and c-Met induction. [score:4]
These results support the conclusion that Gα [12] overexpression causes miR-122 dysregulation, promoting c-Met induction, which may deteriorate the prognosis, recurrence-free and overall survival rates of HCC patients. [score:4]
In particular, HNF4α is abundantly expressed in the liver, and directly binds to the promoter region of the MIR122 gene [35]. [score:4]
Figure 7Clinical outcomes of HCC patients in association with weak or strong Gα [12] expression, miR-122 dysregulation, and c-Met induction A. Association between Gα [12] and miR-122 repression in patients with HCC. [score:4]
Nevertheless, the upstream regulator of miR-122 and the basis underlying miR-122 dysregulation in HCC had been elusive. [score:3]
As a continuing effort to find the basis of miR-122 dysregulation by Gα [12], we assessed the enhancing or silencing effect of Gα [12] on HNF4α; transfection with Gα [12]QL diminished HNF4α level, whereas siRNA knockdown of Gα [12] accumulated it (Figure 4B). [score:3]
The miR-122 inhibitor and negative control were purchased from Dharmacon (Lafayette, CO). [score:3]
We found a putative miR-122 binding site within the 3′-untranslated region (3′UTR) of c-Met mRNA using RNA 22 program (Figure 2B). [score:3]
The chi-square test showed a significant association between Gα [12] and miR-122 expression (Figure 7A), whereas the Pearson or Spearman analysis failed to do so (Supplementary Figure 1). [score:3]
In addition, miR-122 is frequently under-expressed in human HCC [25]. [score:3]
Inhibition of c-Met by miR-122. [score:3]
miR-122 mimic transfection notable decreased c-Met protein levels in three different cell lines, whereas miR-122 inhibitor increased them (Figure 2D). [score:3]
The samples were divided into two groups according to the results of qRT-PCR assays for miR-122; miR-122 down-regulation (≤10%) was found in 37% of HCC samples (22 of 45). [score:3]
Figure 3c-Met induction by Gα [12] and the effects of LPA and S1P on miR-122 expression A. The effect of Gα [12]QL transfection on c-Met levels. [score:3]
Among the putative, but yet unidentified, targets of miR-122, c-Met was the most enriched interacting molecule of the pathway in cancer (Figure 2A). [score:3]
Gα [12] inactivation of HNF4α necessary for the basal expression of MIR122. [score:3]
Our findings also reveal the role of Gα [12] pathway in the activity of hepatocyte nuclear factor 4α (HNF4α) required for the expression of MIR122. [score:3]
Association of Gα [12]/miR-122/c-Met changes with HCC patient survivalTo further explore the relationship between Gα [12] and miR-122 (or c-Met), we examined the expression of miR-122 and c-Met in tissues from 59 human primary HCC and matched non-tumorous (NT) tissues. [score:3]
Since Gα [12] activates JNK1 [36], miR-122 repression by Gα [12] may be associated with JNK1 -dependent inhibition of HNF4α. [score:3]
Having identified the most evident decrease of miR-122 by the activated form of Gα [12], we searched for the target of miR-122 as a protein possibly implicated in the aggressiveness of HCC. [score:3]
D. The effect of miR-122 modulations on c-Met expression. [score:3]
c-Met induction by Gα [12] and the effects of LPA and S1P on miR-122 expression. [score:3]
Consistently, miR-122 mimic diminished luciferase expression from pEZX-c-Met-3′UTR luciferase construct comprising the c-Met 3′UTR region (Figure 2E). [score:3]
The potential targets of miR-122 were extracted from Microcosm program (http://www. [score:3]
In the present study, activated Gα [12] decreased the levels of primary and precursor forms of miR-122, supporting the role of Gα [12] in inhibiting MIR122 transcription. [score:3]
The cells were co -transfected with control or c-Met 3′UTR luciferase vector and miR-122 mimic (or inhibitor) or its relative control using FuGENE [®] HD Reagent (Roche, Indianapolis, IN). [score:3]
Inhibition of cancer cell aggressiveness by miR-122. [score:3]
D. Kaplan-Meier survival curves for 9 HCC patients with respect to Gα [12] and miR-122 expression (upper). [score:3]
The results that Gα [12]QL transfection initiated capillary tube formation (i. e., a late stage of angiogenesis) and this effect was antagonized by miR-122 mimic transfection support the notion that miR-122 acts as a suppressor of liver tumor progression in severity. [score:3]
Figure 5The effect of miR-122 overexpression on tumor cell survival, proliferation, colony formation, and tube formation in Gα [12]QL-Huh7 cells A. The effect of miR-122 mimic transfection on signaling pathways downstream from c-Met. [score:3]
To further explore the relationship between Gα [12] and miR-122 (or c-Met), we examined the expression of miR-122 and c-Met in tissues from 59 human primary HCC and matched non-tumorous (NT) tissues. [score:3]
Our data showing an increase in HNF4α ubiquitination by Gα [12] supports the idea that JNK1 activated by Gα [12] may decrease miR-122 through the inhibitory phosphorylation and ubiquitination of HNF4α [23]. [score:3]
Our findings support the reciprocal link between miR-122 and c-Met expression downstream from increase of Gα [12], extending basic scientific information to clinical arena. [score:3]
Here, we report c-Met as a new target of miR-122. [score:3]
Figure 2 A. An integrative network of putative or validated targets of miR-122. [score:3]
Figure 1The survival rates of HCC patients in association with Gα [12] intensity and miR-122 repression by activated mutant of Gα [12] A. Kaplan-Meier analysis of overall survival in patients with HCC according to weak or strong Gα [12] expression. [score:3]
Transfection with miR-122 inhibitor enhanced the 3′UTR reporter activity. [score:3]
Moreover, the loss of miR-122 alters hepatic phenotype, assisting gain of metastatic properties, which strengthens the concept that miR-122 may be an intrinsic tumor suppressor gene in the liver [24- 26]. [score:3]
The expression of miR-122 relies on liver-enriched transcription factors in the developing liver or cell lines [16]. [score:3]
An important finding of our study is the ability of Gα [12] to negatively control HNF4α, a transcription factor required for the constitutive MIR122 gene expression [35]. [score:3]
Predicted (or validated) targets of miR-122 were subjected to KEGG enriched pathway analysis (pathway in cancer) using the DAVID 6.7 (http://david. [score:3]
Immunoblottings for c-Met were done on the lysates of Gα [12]QL- or WT-Huh7, HepG2, or SK-Hep1 cells transfected with miR-122 mimic, miR-122 inhibitor or the respective negative control. [score:3]
Activated Gα [12] decreased both the primary and the precursor forms of miR-122 transcript levels (Figure 4A, left and right), suggesting that activated Gα [12] inhibits MIR122 gene transcription. [score:3]
The effect of miR-122 overexpression on tumor cell survival, proliferation, colony formation, and tube formation in Gα [12]QL-Huh7 cells. [score:3]
A. An integrative network of putative or validated targets of miR-122. [score:3]
Our results shown here demonstrate for the first time that Gα [12] overexpressed in the tumor decreases miR-122, accounting for cancer aggressiveness and poor prognosis of the patients with HCC. [score:3]
c-Met inhibition by miR-122. [score:3]
In particular, miR-122 is a predominant liver-enriched miRNA, which may act as a tumor suppressor [12]. [score:3]
D. The effect of Gα [12] knockdown on miR-122 levels. [score:2]
HNF4α, a transcription factor belonging to the HNF family members, may regulate the MIR122 gene [16]. [score:2]
E. A schematic diagram illustrating the proposed mechanism by which Gα [12] dysregulation of miR-122 contributes to poor prognosis in patients with HCC. [score:2]
siRNA knockdown of Gα [12] diminished the ability of LPA or S1P to induce c-Met (Figure 3G), supporting the concept that Gα [12] transduces GPCR signals for decrease of miR-122 presumably in tumor microenvironments. [score:2]
Moreover, these changes correlated with TNM stages, suggestive of the role of miR-122 and c-Met dysregulation in the tumor stage progression. [score:2]
All of these results indicate that increased levels of Gα [12] causes the induction of c-Met by deregulating miR-122. [score:2]
In Gα [12]QL-Huh7 or SK-Hep1, siRNA knockdown of Gα [12] promoted increase of miR-122. [score:2]
A novel finding of this study is the identification of c-Met as a new target of miR-122, as evidenced by the outcomes of in vitro functional assays using a construct comprising c-Met 3′UTR and bioinformatic analysis. [score:2]
Dysregulation of miR-122 by Gα [12]. [score:2]
Having identified the link between miR-122 and c-Met downstream of Gα [12], we next confirmed the effect of Gα [12] modulations on c-Met. [score:1]
We found that treatment of HepG2 cells with LPA (12 h) moderately reduced miR-122 levels (Figure 3F). [score:1]
Association of Gα [12]/miR-122/c-Met changes with HCC patient survival. [score:1]
C. The effect of miR-122 mimic on c-Met induction by Gα [12]QL. [score:1]
To further link Gα [12] and miR-122 physiologically, we examined their levels in a panel of human HCC cell lines. [score:1]
E. The effect of miR-122 modulations on pEZX-c-Met-3′UTR luciferase activity. [score:1]
A. The effect of miR-122 mimic transfection on signaling pathways downstream from c-Met. [score:1]
Luciferase activities were measured on HEK293 cells transfected with miR-122 mimic, miR-122 inhibitor or the respective negative control in combination with pEZX-control or pEZX-c-Met-3′UTR. [score:1]
In patients with HCC, Gα [12] levels correlated with either decrease of miR-122 or c-Met induction in the HCC samples. [score:1]
In addition, transfection with miR-122 mimic diminished the induction of c-Met by Gα [12]QL (Figure 3C). [score:1]
To further understand the mechanism of Gα [12] oncogenic activity, we assessed the role of Gα [12]-miR-122 pathway in tumor cell death. [score:1]
Repression of HNF4α -mediated miR-122 transcription by Gα [12]. [score:1]
Moreover, HCC patients with high Gα [12] and low miR-122 had the poorest prognosis (i. e., the lowest overall survival and highest probability of tumor recurrence), whereas those with low Gα [12] and high miR-122 had the best outcomes (Figure 7D, upper). [score:1]
Consistently, miR-122 contents were lower in the mesenchymal cell lines (Figure 3D, right). [score:1]
Transfection with miR-122 mimic unchanged c-Met mRNA level (Figure 2C). [score:1]
S1P treatment also significantly decreased miR-122 level (Figure 3F). [score:1]
miR-122 levels in the liver amount to 135,000 copies per normal human hepatocyte [21], representing 72% of all miRNAs. [score:1]
miR-122 is necessary for the control of lipid and glucose metabolism, and other physiological activities in the liver [22, 23]. [score:1]
C. The effect of Gα [12]QL on miR-122 level. [score:1]
Consistently, stable transfection with Gα [12]QL promoted Huh7 cell proliferation under anchorage-independent condition, and this effect was attenuated by miR-122 mimic transfection (Figure 5E). [score:1]
C. The relative levels of miR-122 or c-Met in the patients with HCC in different TNM stages. [score:1]
C. The effect of miR-122 mimic transfection on the cell apoptosis caused by serum deprivation. [score:1]
Since miR-122 is the most abundant in the liver, the repression of miR-122 by Gα [12] would greatly alter cell biology in association with c-Met -mediated aggressiveness (e. g., anti-apoptosis, proliferation, and angiogenesis). [score:1]
A. Association between Gα [12] and miR-122 repression in patients with HCC. [score:1]
A clear difference was found in capillary tube formation after miR-122 mimic transfection (Figure 5F). [score:1]
Similarly, miR-122 was depressed in a subset of HCC harboring c-Met signature [26]. [score:1]
WT- or Gα [12]QL-Huh7 cells were transfected with control mimic or miR-122 mimic. [score:1]
Pri-miR-122 had been identified as a non-coding RNA, hcr [21]. [score:1]
WT- or Gα [12]QL-Huh7 cells were transfected with control mimic or miR-122 mimic for 48 h. B. The effect of miR-122 mimic on the proteins related with apoptosis or survival. [score:1]
Gα [12]QL transfection promoted phosphorylation of ERK, STAT3, Akt, and mTOR in Huh7 cells, whereas transfection with miR-122 mimic abrogated this effect (Figure 5A). [score:1]
To clarify the role of miR-122 in regulating c-Met, in vitro functional assays were done after enhancing or silencing the miRNA. [score:1]
The survival rates of HCC patients in association with Gα [12] intensity and miR-122 repression by activated mutant of Gα [12]. [score:1]
Tumor samples were divided into four groups according to mean fold changes (T/N) of Gα [12] or miR-122. [score:1]
C. The effect of miR-122 mimic treatment on c-Met transcript level. [score:1]
HepG2 cells were transfected with control siRNA or Gα [12] siRNA for 48 h and were continuously treated with either LPA or S1P as described in panel F. Gα [12] inactivation of HNF4α necessary for the basal expression of MIR122To precisely define the underlying basis of miR-122 repression by Gα [12] signaling, the levels of miR-122 primary transcript and of its precursor form were measured in Gα [12]QL-Huh7 cells. [score:1]
Of the miRNAs normally enriched in hepatocytes, activated Gα [12] most greatly and significantly decreased miR-122 levels. [score:1]
Consistently, miR-122 levels were significantly decreased in the samples except siRNA #2 (siGα [12] #2). [score:1]
miR-122 mimic and its negative control were synthesized by GenePharma (Shanghai, China). [score:1]
Transfection of the cells with miR-122 mimic diminished the ability of Gα [12]QL to increase procaspase 3 and B-cell lymphoma 2 (Bcl-2) levels, but enhanced poly[ADP-ribose]polymerase 1 (PARP1) cleavage (Figure 5B), supporting the induction of cell death. [score:1]
The result also supports the role of Gα [12] as an independent prognostic factor for tumor recurrence particularly in combination with low miR-122. [score:1]
In our finding, activated Gα [12] most substantially and significantly repressed miR-122: either stable or transient transfection with Gα [12]QL reduced the levels of mature form of miR-122 in Huh7 or HepG2 cells (Figure 1C). [score:1]
HepG2 cells were co -transfected with either pCDNA3 or Gα [12]QL and either control mimic or miR-122 mimic. [score:1]
B. Prediction of miR-122 binding to the 3′UTR of human c-Met mRNA. [score:1]
[1 to 20 of 112 sentences]
8
[+] score: 275
Other miRNAs from this paper: mmu-mir-122
Our findings demonstrate that miR-122 normally downregulates PEG10 protein expression and this regulation is lost in HCC (Fig.   5), suggesting that the combination of downregulation of miR-122 and upregulation of PEG10 protein can be serve as early biomarkers for identifying an HCC subpopulation that is at high risk for poor outcome. [score:13]
In HCC patient tissue, there was no strong relationship between miR-122 and PEG10 levels in normal and tumor tissue, suggesting that other factors regulate PEG10 expression in HCC patients miR-122 suppressed PEG10 expression at translation level but not the mRNA level in cell lines and mouse mo del via direct binding to the 3′-UTR of PEG10 transcript. [score:11]
In some cases, PEG10 mRNA was downregulated whereas the protein expression was upregulated relative to normal adjacent tissue, which is consistent with miR-122 -mediated translational repression of PEG10; however, there was still no correlation between PEG10 and miR-122 levels in HCC patients. [score:11]
In this study, we identified PEG10 as a potential miR-122 target by an in silico approach and suppresses it’s expression via miR-122 direct binding to the 3′-UTR of the PEG10 transcript. [score:8]
miR-122 downregulated the expression of PEG10 protein through binding to 3′-untranslated region (UTR) of the PEG10 transcript. [score:8]
These results indicate that miR-122 downregulated the PEG10 expression in liver was at the translational but not transcriptional level. [score:8]
These results indicate that miR-122 downregulates the PEG10 expression via direct binding to site 2310 in the 3′-UTR of PEG10. [score:7]
c Overexpression of miR-122 upon HepG2 cells transfection with miR-122S and miR-122AS, as determined by qRT-PCR We further to confirm miR-122 mediates the expression of PEG10 protein in vivo, the total RNA and whole cell lysate were extracted from liver tissue of the and then quantified the relative expression of PEG10 mRNA and protein by qRT-PCR and western blotting, respectively. [score:7]
miR-122 is downregulated while PEG10 is upregulated in HCC patients. [score:7]
miR-122 has many mRNA targets, including cyclin G1, Bcl2- like protein 2, CCAAT- displacement protein, and paternally expressed gene 10 (PEG10), all of which are overexpressed in HCC patients [12]. [score:7]
c Overexpression of miR-122 upon HepG2 cells transfection with miR-122S and miR-122AS, as determined by qRT-PCRWe further to confirm miR-122 mediates the expression of PEG10 protein in vivo, the total RNA and whole cell lysate were extracted from liver tissue of the and then quantified the relative expression of PEG10 mRNA and protein by qRT-PCR and western blotting, respectively. [score:7]
miR-122 downregulates PEG10 protein expression. [score:6]
A qRT-PCR analysis of 12 HCC tumors reveal that miR-122 expression levels were downregulated relative to adjacent non-cancerous tissue (Fig.   4a). [score:6]
miR-122 suppresses PEG10 expression via direct binding to the 3′-UTR of the PEG10 transcript. [score:6]
Previous studies shown that PEG10 highly expressed in hepatoma cell lines and miR-122 downregulated in HCC tissue [4, 7, 39, 40]. [score:6]
miR-122 expression was found to be downregulated in HCC tissue, suggesting that miR-122 is associated with hepatocarcinogenesis and can serve as a biomarker for liver cancer [8– 15]. [score:6]
The miR-122 positive control targeting sequence, 5′-CTA GCA CAA ACA CCA TTG TCA CAC TCC AGA ATT CAC AAA CAC CAT TGT CAC ACT CCA C-3′, was also cloned into NheI/ XhoI sites downstream of the luciferase gene in the pmiR-GLO plasmid to obtain pmiR-GLO-miR122 PTS (positive targeted sequence). [score:5]
We also showed with a luciferase reporter assay that miR-122 directly bound to the 3′-UTR of the PEG10 transcript (2006–2872 bp) and further suppress the translation of PEG10. [score:5]
Fig.  2PEG10 is upregulated by miR-122 deficiency in miR-122 knockout (KO) mice. [score:5]
In our study, we did not observe significant correlation between the downregulation of miR-122 and relative change of endogenous PEG10 protein levels in HCC (Fig.   4b); only 8 of 12 (67 %) HCC patients had higher PEG10 protein expression in tumor as compared to normal adjacent tissue (Fig.   4b). [score:5]
Several studies have found an association between downregulation of miR-122, a liver-specific miRNA, and upregulation of paternally expressed gene 10 (PEG10) in HCC; however, the correlation between low miR-122 and high PEG10 levels still remains to be defined and require more investigations to evaluate their performance as an effective prognostic biomarker for HCC. [score:5]
Liver-specific transcription factors regulate miR-122, which in turn targets cut-like homeobox 1 during liver development [35]. [score:5]
In cell cultures, binding of miR-122 to sites 2310 and 2403 in the 3′-UTR of the PEG10 transcript suppressed PEG10 protein expression. [score:5]
In contrast, the protein level of PEG10 was upregulated in miR-122 knockout as compared to wild-type mice (Fig.   2c). [score:4]
miR-122 is specifically expressed in the liver, where it accounts for 70 % of the total miRNA population [4, 5] and regulates lipid metabolism to maintain normal liver function [6, 7]. [score:4]
Further studies are needed in order to determine whether other factors besides miR-122 regulate PEG10 expression in HCC. [score:4]
These suggesting that factors other than miR-122 are also involved in regulation of PEG10 expression in HCC. [score:4]
Indeed, mice with targeted deletion of the miR-122 gene exhibited a variety of phenotypes associated with human liver disease, providing a useful mo del for investigating the effects of miR-122 dysregulation in HCC patients [7]. [score:4]
An in silico approach was used to isolate PEG10, a potential miR-122 target implicated in HCC development. [score:4]
In order to clarify the regulatory interaction between miR-122 and PEG10, the expression levels of these two factors were examined in normal and tumor tissue from HCC patients. [score:4]
Fig.  5 Regulation of PEG10 expression by miR-122 in different mo del systems. [score:4]
We found that miR-122 was expressed at low levels in normal tissue adjacent to tumors in all patient samples, while PEG10 levels varied between specimens. [score:3]
These findings imply that expression of miR-122 and PEG10 is inversely related in HCC. [score:3]
In this study, we performed a luciferase reporter assay to determine whether PEG10 expression is directly mediated by miR-122. [score:3]
To investigate the relationship between miR-122 and PEG10, pre-miR-122 was overexpressed in 293T and HepG2 cells and determined the mRNA and protein expression levels of PEG10 by qRT-PCR and western blotting, respectively. [score:3]
The mRNA level of PEG10 was unaltered upon miR-122 or miR-122AS overexpression in 293T cells (Fig.   1a). [score:3]
The forward 47-bp fragments included a 29-bp upstream flanking sequence, 7- or 8-bp miR-122 seed, and an 11-bp downstream flanking sequence in the 3′-UTR of putative miR-122 targeted genes (Fig.   3c). [score:3]
The 293T and HepG2 cells were transfected with the specified concentration of miR-122 (pSM-miR-122S) or anti-sense miR-122 (pSM-miR-122AS), then cultured for 72 h, with PEG10 expression analyzed by western blotting. [score:3]
a miR-122 expression levels in HCC. [score:3]
Briefly, 293T cells were co -transfected with miR-122 (pSM-miR-122S), antisense miR-122 (pSM-miR-122AS), or target reporter plasmid. [score:3]
a PEG10 mRNA expression levels were determined by qRT-PCR in the liver of wild-type (WT) and miR-122 KO mice and normalized to that of GAPDH. [score:3]
These results suggest that miR-122 has a tumor suppressor function in hepatocarcinogenesis. [score:3]
Sense (pSM-miR-122S) and antisense (pSM-miR-122AS) miR-122 expression vectors were provided by Dr. [score:3]
The protein level of PEG10 was only significantly decreased when miR-122 overexpressed but not miR-122AS in both 293T and HepG2 cells (Fig.   1b, c). [score:3]
miR-122 is downregulated in human HCC and has been considered as part of the miRNA signature for HCC. [score:3]
d Identification of the miR-122 target sequence in the 3′-UTR of PEG10 transcript. [score:3]
b miR-122 expression in the liver of WT and miR-122 KO, as determined by qRT-PCR. [score:3]
b Identification of the miR-122 target region in the 3′-UTR of PEG10 transcript. [score:3]
Figure  2a shows that there is no obvious correlation in mRNA expression level of PEG10 between miR-122 -deficient and wild-type mice. [score:3]
This decrease was abrogated by introducing a 6-bp mutation in the miR-122 binding site. [score:2]
The results of our study demonstrated a negative regulatory relationship between miR-122 and PEG10 in two different cell lines. [score:2]
Direct interaction of miR-122 with 3′-UTR of PEG10. [score:2]
miR-122 knockout mice. [score:2]
The oligonucleotides containing the putative miR-122 binding site(s) were designed and subcloned by ligating annealed oligonucleotides into the NheI/ XhoI-digested pmiR-GLO vector in the forward direction (Fig.   3c); the resultant constructs pmiR-GLO-PEG10 TS, pmiR-GLO-PEG10 MTS, and pmiR-GLO 122 PST were transiently transfected into 293T cells. [score:2]
Fig.  1PEG10 is regulated by miR-122 at the post-transcriptional level in 293T and HepG2 cells. [score:2]
Recent studies suggest a role for PEG10 in HCC progression [19, 25– 27]; thus, overexpression of PEG10 is considered as a potential biomarker for HCC [28, 29], although the relationship between miR-122 and PEG10 remains not well understood. [score:2]
293T cells were co -transfected with either miR-122S or empty vector along with pmiR-GLO-PEG10-3′-UTR TS, pmiR-GLO-PEG10-3′-UTR MTS, or pmiR-GLO-miR122 PTS constructs To clarify the interaction between miR-122 and PEG10 3′-UTR, sequences corresponding to miR-122 seed binding sites (Fig.   3c) were constructed [35]. [score:1]
The analysis results indicate that there are nine putative miR-122 binding sites located in the 3′-UTR of PEG10 transcript, i. e., 64, 102, 564, 934, 1310, 1735, 2310, 2403 and 3420 (Fig.   3a). [score:1]
293T cells were co -transfected with either miR-122S or empty vector along with pmiR-GLO-PEG10-3′-UTR TS, pmiR-GLO-PEG10-3′-UTR MTS, or pmiR-GLO-miR122 PTS constructsTo clarify the interaction between miR-122 and PEG10 3′-UTR, sequences corresponding to miR-122 seed binding sites (Fig.   3c) were constructed [35]. [score:1]
Chimeric mice were produced by crossing with wild-type C57BL/6 mice for germline transmission of the miR-122 allele. [score:1]
Total RNA was extracted from 12 paired cancerous and adjacent normal tissues from HCC patients and miR-122 level was quantified by qRT-PCR. [score:1]
An expanded view of the seed region of miR-122 in the PEG10-3′-UTR is shown. [score:1]
The effect of miR-122 on PEG10 mRNA levels was examined by quantifying the mRNA levels of PEG10 as well as miR-122S and miR-122AS in cells transiently transfected with pSM-miR-122S or pSM-miR-122AS constructs (Fig.   1). [score:1]
293T cells were co -transfected with miR-122S and the negative control (Vector) along with pmiR-GLO-PEG10-3′-UTR F1, pmiR-GLO-PEG10-3′-UTR F2, pmiR-GLO-PEG10-3′-UTR F3, pmiR-GLO-PEG10-3′-UTR F4, pmiR-GLO-PEG10-3′-UTR F5, or pmiR-GLO-miR122 PTS; luciferase activity was determined at 48 h post-transfection. [score:1]
However, it is still not clear how miR-122 contributes to liver tumor progression. [score:1]
These results are consistent with the study which transient transfected pre-miR122 into HepG2 cells caused a decrease in PEG10 protein level without altering the mRNA level [38]. [score:1]
c Schematic illustration of putative miR-122 binding site in the 3′-UTR of PEG10 transcript. [score:1]
Homozygous miR-122 [−/−] mice were obtained by crossing heterozygous offspring [7]. [score:1]
Nine putative miR-122 binding sites were identified by bioinformatic analysis (top) at positions 64, 102, 564, 934, 1310, 1735, 2310, 2403 and 3420. [score:1]
In mice, PEG10 protein level was increased by miR-122 deficiency. [score:1]
miR122 PEG10 HCC Hepatocellular carcinoma (HCC) is the fifth most common cancer around the world and is the cause of nearly 745,000 deaths worldwide each year [1]. [score:1]
In and HCC patients, the deficiency of miR-122 was associated with HCC progression. [score:1]
[1 to 20 of 72 sentences]
9
[+] score: 253
miR-122 expression value>0.39 was designed as the high expression group, while miR-122 expression value<-0.58 was designed as the low expression group. [score:9]
To further investigate whether miR-122 targets TGFβ1 in humans, but TGFβR1 in mice, we analysed four more liver cell lines When two human liver cell lines, SMMC-7721 and LM9, were transfected with the miR-122 overexpression plasmid, both transcriptional and translational expression levels of TGFβ1 were decrease by over 50% and the levels of TGFβR1 remains unchanged. [score:7]
When miR-122 was overexpressed in NIT-1 cells, which is a pancreatic β-cell line established from a transgenic non-obesity diabetes (NOD/Lt) mouse, the expression level of TGFβR1 was decreased by 40% and the expression level of TGFβ1 was unchanged. [score:7]
It is highly possible that the imbalance of TGFβ1 due to the dysregulation of miR-122 makes a direct contribution to the development of these diseases. [score:6]
In addition to cancer, the downregulation of miR-122 has been reported in many types of liver disease 35. [score:6]
Thus, miR-122 directly targets a noncanonical site in TGFβ1 5′UTR in humans, but it targets TGFβR1 in mice. [score:6]
Consistent with this, when Huh7 cells were treated with the miR-122 sponge expression construct, there was a twofold increase in TGFβ1 expression (Fig. 1a; Supplementary Fig. 1c). [score:5]
The overexpression of miR-122 in these two cell types resulted in a decrease of the TGFβ1 level by 80% and 70%, respectively, and no change in the expression level of TGFβR1 (Fig. 1c). [score:5]
Similarly, the ratio of the p-Smad2 to Smad2 level was inhibited when miR-122 was overexpressed in NIT-1 cells, and the decreased ratio was reversed by TGFβR1 (Fig. 1g). [score:5]
HepG2 cells were transfected with the miR-122 overexpression plasmid (transient expression). [score:5]
These tissue miRNAs are highly expressed, such as miR-122 outnumbering any single mRNA target by as much as 500-fold 50. [score:5]
Furthermore, in the most recent common ancestor of humans and the chimpanzee, a second mutation (A–>G, blue in Fig. 3e) occurred, and this mutation further destroyed the binding affinity of miR-122 and the target sites. [score:5]
Quantification of the expression levels of miR-122, TGFβ1 and TGFβR1 in these tissue samples revealed an eightfold decrease in miR-122 expression and an eightfold increase in the TGFβR1 level in tumour samples (Fig. 6a,b). [score:5]
In this study, we demonstrate that miR-122 targets different components in the TGFβ pathway, namely, TGFβ1 in humans and TGFβR1 in mice, thus providing the first evidence for species -dependent miRNA targeting within a pathway. [score:5]
Mice were subcutaneously implanted with HepG2 cells stably expressing NC, miR-122 or both miR-122 and TGFβ1 (122-TGFβ1), or with Hepa1-6 cells stably expressing NC or miR-122 sponge (122sp) in each group. [score:5]
The selection was carried out for 3–5 weeks, and the stable cell lines of HepG2 were referred to as HepG2-NC, HepG2-122 (overexpressing miR-122) and HepG2-122-TGF (overexpressing miR-122 as well as TGF-β1), respectively. [score:5]
Consistent with the results of our cell studies, the expression of TGFβR1 was not associated with overall survival (Supplementary Fig. 6b, representative data of miR-122, TGF-β1 and TGF-βR1 expression shown in Supplementary Fig. 6c–e). [score:5]
This mutation abolishes a pairing between miR-122 and the target site. [score:4]
However, western blot assay demonstrated that miR-122 inhibits the expression level of TGFβR1 in rat or pig cell lines(Fig. 3c). [score:4]
Subsequent mutation experiments, in which three nucleotides most affecting the stability of the predicted RNA secondary structure was mutated one by one, identified the exact targeting sequence, which may pair to the 3′ region of miR-122, rather than to its seed sequence (Fig. 2g). [score:4]
The ago protein immunoprecipitation (AGO-IP) assay showed that the miR-122 expression level increased 60-fold, while the expression of TGFβ1 decreased to 54% (Fig. 1a; Supplementary Fig. 1b) 23. [score:4]
On the other hand, in the most recent ancestor of mouse and rat, a G–> A mutation (green in Fig. 3e) created a pairing site for miR-122, which in principle enhances the binding specificity of miR-122 and the target site. [score:4]
miR-122 inhibits TGFβ1 in human cells, but TGFβR1 in mouse cells. [score:3]
A conserved mechanism of miR-122 switching targets. [score:3]
Evolutionary analysis of miR-122 targeting TGFβ1/TGFβR1 in vertebrates. [score:3]
miR-122 targets human TGFβ1 5′UTR in a non-‘seed-region' base-pairing manner. [score:3]
Similarly, the overexpression of miR-122 in HepG2 or SMMC-7721 resulted in the increase of E-cadherin as well as the decrease of vimentin, regardless of treating Huh7 or MCF cells (Fig. 4c–e). [score:3]
We then switched our attention to coding sequences (CDS), in which a group of candidate miR-122 target sites were identified (Supplementary Table 2). [score:3]
miR-122 targets TGFβ1 5′UTR in humans. [score:3]
However, the silencing of miR-122 in Hepa1-6 cells resulted in no change of TGFβ1, but a twofold increase in TGFβ receptor 1 (TGFβR1) expression (Fig. 1a; Supplementary Fig. 1d). [score:3]
miR-122 inhibits TGFβ1 in humans but TGFβR1 in mice. [score:3]
miR-122 was overexpressed in HepG2 cells to generate a stable cell line, which is referred to as HepG2-122. [score:3]
Supplementary Figures 1-18, Supplementary Tables 1-7 Supplementary Figures 1-18, Supplementary Tables 1-7 (a) Western blot analysis of TGFβ1 and TGFβR1 in HepG2, Huh7 or Hepa1-6 cells when treated with an miR-122 expression plasmid (122), miR-122 sponge (122sp) or scramble sequence as an negative control (NC), respectively. [score:3]
Within these cohorts, a low expression of miR-122 was associated with poor survival (Fig. 6d). [score:3]
miR-122 significantly silenced the reporter containing the rhesus monkey TGFβ1 5′UTR, which contained a target sequence exactly the same as that found in humans (Fig. 3b; Supplementary Table 1). [score:3]
First, we experimentally determined whether miR-122 targets TGFβ1/TGFβR1 in the rhesus monkey, pig or rat. [score:3]
Together, these data demonstrate that miR-122 inhibits TGFβ1 in humans, but TGFβR1 in mice. [score:3]
How to cite this article: Yin, S. et al. Differential TGFβ pathway targeting by miR-122 in humans and mice affects liver cancer metastasis. [score:3]
Second, we examined the respective expression levels of miRNA-122, TGFβ1 and TGFβR1 in human and mouse hepatocellular carcinoma samples. [score:3]
miR-122 significantly inhibited the reporter containing the TGFβ1 5′UTR of the manetee, in which 1C is changed into 1T (Fig. 2g). [score:3]
Surprisingly, no miR-122 target site was identified in either the TGFβ1 or TGFβR1 UTRs in pigs or rats (Fig. 3a; Supplementary Fig. 3a–c). [score:3]
Differential targeting of TGFβ1/TGFβR1 is the underlying reason for the distinct impact of miR-122 on EMT in human or mouse cells. [score:3]
The reporter containing the 3′UTR of mouse TGFβR1 was decreased to 60% by miR-122 treatment, whereas the reporter containing the 3′UTR of human TGFβ1 or TGFβR1 was unchanged, indicating that there is no target site in their 3′UTRs (Fig. 2b,c). [score:3]
The conversion of 21C to 21T, accompanied by the insertion of either one or a small number of bases between the 11th and 12th bases, resulted in a total loss of the inhibition by miR-122, such as those found in the mouse, rat, dog and pig (Fig. 3b; Supplementary Fig. 3b,d). [score:3]
Consistent with the data in Hepa1-6 cells, the overexpression of miR-122 in two mouse liver cell lines, H22 and NCTC1469, resulted in the decrease of TGFβR1 in both protein and mRNA levels, but no change of TGFβ1 (Supplementary Fig. 1e,f). [score:3]
Since the sequence of miR-122 is identical in vertebrates, we performed an analysis of the degree of conservation of miR-122 target sites in TGFβ1/TGFβR1 in different species. [score:3]
HepG2 has a low level of miR-122 expression, whereas both Huh7 and Hepa1-6 have a high level (Supplementary Fig. 1a). [score:3]
Quantitative analysis of miR-122 expression showed that it decreased ∼40% in the cancer samples (Supplementary Fig. 6f). [score:3]
In case of targeting CAT-1, miR-122 was used as a positive control while let-7a as a negative control 34. [score:3]
That is, HepG2 or SMMC-7721 cells were treated with TGFβ1 antibody, miR-122 overexpression or both, and then their supernatants were treated to Huh7 or MCF cells, respectively. [score:3]
The overexpression of TGFβ1 in HepG2-122 reversed the effect of miR-122 on both local invasion and distant metastasis. [score:3]
The gain of the miR-122 target site occurs in the common ancestor of the manatee and humans as well as other primates (black arrow), while the loss of this site in the pig, dog, rat or mouse due to the insertion of a few of bases between the 11th and 12th bases (red arrow). [score:3]
proved that a miR-122 target site exists in the TGFβR1 CDSs of pigs or rats, but not humans or monkeys. [score:3]
We found that miR-122 expressing tumours were well encapsulated and non-invasive (Fig. 5c). [score:3]
By comparative genomic analysis of the miR-122 target sites across representative species in the animal phylogenetic tree, we traced the evolutionary trajectory. [score:3]
In contrast, the expression of TGFβR1 remained unchanged in response to miR-122 or its sponge in human liver cancer cells (Fig. 1a). [score:3]
No homologous sequence was identified in the TGFβ1 5′UTR of the more distantly related vertebrates, such as the birds or fish, indicating that the gain of the miR-122 target site occurs in the common ancestor of the Afrotheria and Primate. [score:3]
Switch of miR-122 targeting from TGFβR1 to TGFβ1 generates different metastatic effects in human xenografts or mouse allografts. [score:3]
The luciferase assay further excluded VEGF as a target of miR-122 (Supplementary Fig. 4d). [score:2]
Therefore, this is a good demonstration of the evolutionary scenario in which the TGFβR1 CDS regulated by miR-122 in the mouse evolved to the TGFβ1 5′UTR in humans. [score:2]
We first examined the effect of decreased miR-122 on the development of liver cancer using human xenografts or mouse allografts. [score:2]
For the predicted miR-122 target site in each species, the luciferase assay was performed. [score:2]
It was reported that miR-122 repression coincides with the acquisition of a liver invasive phenotype 14 15. [score:1]
Given that miR-122 is a liver-specific molecule, the TGFβR1 increase was constrained to liver cancer cells. [score:1]
Distinct metastatic traits by miR-122 loss in humans or mice. [score:1]
To further confirm the effect of miR-122 on EMT was mediated through TGFβ1, HepG2 and HepG2-122 culture supernatants were treated with a TGFβ1 neutralizing antibody (TGFβ1-Ab) and TGFβ1, respectively. [score:1]
These in vitro data showed that miR-122 -mediated TGFβ1/TGFβR1 activity generated distinct metastasis-relevant traits in human or mouse cells. [score:1]
Species-specific effect of miR-122 on liver cancer metastasis. [score:1]
Loss of miR-122 resulted in the different metastatic effects in humans or mice liver cancers in vivo. [score:1]
miR-122 levels are reduced in clinical samples of HCC 14 15. [score:1]
Taken together, these results demonstrated that miR-122 repression resulted in different patterns of pathological liver function in humans and mice in vivo, including tumour weight as well as angiogenesis and metastasis. [score:1]
Unexpectedly, the reporter containing the sixth fragment was resistant to the silence of miR-122. [score:1]
Furthermore, the similar results were found in another human liver cancer cells, SMMC-7721, when transfected with miR-122 or miR-122 together with TGFβ1 (Fig. 1f). [score:1]
Quantitative analysis showed that miR-122 levels were decreased >10-fold in human tumour samples relative to normal adjacent samples (Fig. 6a). [score:1]
Here our results clearly prove that a loss of miR-122 exerts markedly different effects on metastatic liver cancer in humans and mice. [score:1]
They used the anti-miRNA-122 agent miravirsen to treat HCV and reported no dose-limiting adverse events for <1 month. [score:1]
To further confirm that a miR-122 -mediated repression affected EMT in human cells, we demonstrated three more experiments. [score:1]
Only the reporter containing the 5′UTR of human TGFβ1 was decreased to 75% by miR-122 (Fig. 2d,e). [score:1]
We found that the reporters containing the fourth fragment or seventh fragment were silenced by miR-122 (Fig. 2f). [score:1]
We first assessed the effect of miR-122 on the endogenous levels of TGFβ1 in three liver cell lines. [score:1]
The change of TGFβ1 or TGFβR1 mRNAs demonstrated the similar pattern to their protein one in these non-liver cell lines (Fig. 1d), indicating the mechanism of mRNA degradation by miR-122. [score:1]
We thus hypothesized that the loss of miR-122 in liver cancers would generate distinct pathological effects in humans and mice, mainly with regard to tumour metastasis-relevant traits. [score:1]
We next studied whether the repressive effect of miR-122 is specific to TGFβ isoforms or passes on the downstream signalling components. [score:1]
[1 to 20 of 83 sentences]
10
[+] score: 232
To validate whether target mRNA can trigger biogenesis of cognate mature miRNA from their precursors, pre-miR-122 and reporter target mRNAs were co-expressed in HEK293 cells that do not express the liver-specific miR-122. [score:9]
The effect of target mRNA was specific, as let-7a target mRNA increased let-7a repressive activity without affecting miR-122 activity in co -expressing cells (Supplementary Fig. 3f). [score:7]
To test this, a doxycycline-inducible system was developed to express pre-miR-122 in HEK293 cells already expressing target mRNA. [score:7]
An increase in mature miR-122 content was observed in the presence of target mRNAs along with a decrease in the pre-miR-122 level in cells transiently expressing pre-miR-122 along with target mRNA bearing a single-bulged (RL-1 × bulge-miR-122) or three-bulged (RL-3 × bulge-miR-122) miR-122 -binding sites in their 3′-UTRs (Fig. 2a–c). [score:7]
In the in vitro pre-miRNA-processing assays with target mRNAs W5′ and W3′, we observed lower target -driven miR-122 biogenesis for W3′ and W5′ target RNA (Supplementary Fig. 5a). [score:6]
To downregulate CAT-1 along with other miR-122 target genes we introduced excess pre-miR-122 before starvation. [score:6]
This minimized any ambiguity arising from transcriptional regulation of miR-122 expression in the cell and provided a relatively clean system to study the effect of target mRNA on miRNA levels. [score:6]
Under this condition, on relief of starvation, the target -driven miR-122 biogenesis was not observed compared with the control where a nonspecific pre-miRNA was pre-expressed, confirming the role of elevated miR-122 targets in promoting faster miR-122 maturation (Supplementary Fig. 2c). [score:6]
Transcriptional upregulation of miR-122 did not contribute to the increased mature miR-122 level, as inhibition of RNA Polymerase II by α-Amanitin could not prevent this increase (Supplementary Fig. 1c). [score:6]
The decay kinetics of mature miR-122 was similar in cells expressing RL-con and RL-3 × bulge-miR-122, suggesting that the presence of target mRNA does not have a stabilizing effect on miR-122 (Fig. 4b). [score:5]
The mature miR-122 content of miRISC was independent of the presence of target mRNA, arguing against the stabilizing action of target mRNA (Fig. 4c). [score:5]
To test the effect of target mRNA concentration on the observed miRNA increase, we introduced increasing amounts of synthetic target mRNAs and observed a correlative increase in mature miR-122 levels coupled with a simultaneous reduction in pre-miR122 levels (Fig. 3b). [score:5]
It has been shown that the 5′-half of siRNA is essential for target RNA recognition, whereas the 3′-half contributes to the stability of the association 2. It was observed that the 5′-seed sequence is crucial for target recognition as a seed sequence mutant RL-3 × bulge-miR-122 (W5′) is not repressible by miR-122 (Supplementary Fig. 3d). [score:5]
Introduction of the ferritin IRE in the 5′-UTR of RL-3 × bulge-miR-122 is therefore expected to regulate mRNA translation depending on cellular iron availability (Fig. 3c). [score:4]
In the human hepatoma cell line Huh7, expression of cationic amino acid transporter-1 (CAT-1) is regulated by miR-122 (refs 23, 24). [score:4]
Immunoprecipitated FH-AGO2 isolated from HEK293 cells stably expressing the protein was subjected to loading assay with 10 nM pre-miR-122 and 25 ng μl [−1] of respective target mRNAs. [score:4]
FH-AGO2 affinity purified on agarose beads from FH-AGO2-stable HEK293 cells was incubated with 10 nM synthetic 5′-phosphorylated pre-miR-122 or pre-let-7a, and 500 ng in vitro-transcribed target mRNA in a 20-μl reaction in assay buffer [20 mM Tris-HCl pH 7.5, 200 mM KCl, 2 mM MgCl [2], 5% glycerol, 1 mM DTT, 40 U RNase inhibitor (Fermentas)] for 1 h at 37 °C followed by washing of the beads three times with IP buffer. [score:4]
However, as CAT-1 is one of the numerous miR-122 target mRNAs that surge in starved cells and is responsible for miR-122 increase in re-fed cells, siRNA -mediated knockdown of CAT-1 could only partially reduce the miR-122 level in re-fed cells (Supplementary Fig. 2b). [score:4]
Therefore, the concentration of free miRNA binding sites either placed in cis (RL-3 × bulge-miR-122) or in trans (RL-1 × bulge-miR-122) regulate target -dependent miRNA biogenesis. [score:4]
To verify whether target mRNA induces higher miRNA biogenesis by faster pre-miRNA processing, we performed an in vitro RISC-loading assay with immunoisolated AGO2, synthetic pre-miR-122 and in vitro transcribed m [7]G-capped and poly(A)-tailed target mRNAs. [score:4]
Therefore, if stress -induced upregulation of these mRNAs is prevented, the increase in mature miR-122 levels on stress relief should not occur. [score:4]
We have provided evidence of target -driven miRNA biogenesis using Huh7 hepatoma cells in which, on stress reversal, increased levels of CAT-1 mRNA induced miR-122 production (Fig. 1). [score:3]
However, heat denaturation of rAGO2 impaired the target -driven increase, confirming the importance of AGO2 association of DICER1 in the observed increase in miR-122 biogenesis (Fig. 6a). [score:3]
We hypothesized that CAT-1 along with all other stress -induced elevated miR-122 target mRNAs trigger miR-122 biogenesis on re-feeding of starved Huh7 cells. [score:3]
Apart from miR-122, levels of other endogenous miRNAs such as let-7a, miR-16 and miR-21 did not change significantly in the presence of the miR-122 targets (Supplementary Fig. 3a). [score:3]
Relative quantification of mature miR-122 level increase in the presence of target RL-3 × bulge-miR-122 mRNA and in the presence of mRNAs with weak 5′- region (W5′) or weak 3′-region (W3′). [score:3]
The supernatant was removed and on-bead was subsequently performed to quantify the amount of miR-122 retained with AGO2 post interaction with target mRNA. [score:3]
Reduced translation using DFMO as a Fe [2+] chelator resulted in higher mRNA levels and higher miR-122 formation (Fig. 3e). [score:3]
Further quantification of miR-122 association with affinity-purified AGOs revealed an elevated association of mature miR-122 with all the three Argonautes tested, in a target -dependent manner (Supplementary Fig. 3e). [score:3]
The increased accumulation of mature/5p strand within AGO2 in the presence of miR-122 targets was accompanied by a corresponding decrease in AGO2-bound passenger/3p strand, indicative of successful RISC activation (Fig. 5b) 31. [score:3]
The presence of target mRNA enhanced the pre-miRNA processing activity, leading to higher accumulation of mature miR-122 with AGO2 (Fig. 5a). [score:3]
In HEK293 cells, 1 μg target mRNA encoding plasmids were transfected in six-well format with 5 pmol pre-miR-122 (Life Technologies) or 500 ng pre-miR-122 encoding plasmid. [score:3]
Interestingly, the 3′-half also binds target mRNA (Supplementary Fig. 3c) and the 3′-sequence mutant RL-3 × bulge-miR-122 (W3′) was less efficiently repressed than the wild-type mRNA (Supplementary Fig. 3d). [score:3]
HEK293 cells expressing pre-miR-122 were transfected with increasing amounts of in vitro-transcribed mRNA (RL-con or RL-3 × bulge-miR-122) and mature miR-122 and pre-miR-122 levels were quantified 6 h post transfection. [score:3]
Cycloheximide -mediated reduced translation led to higher reporter mRNA levels and a corresponding increase in mature miR-122 (Supplementary Fig. 4c). [score:3]
Labelled miR-122 (1.5 pmol; 100 fmol radiolabelled and 1.4 pmol 5′-end labelled with cold ATP) was mixed with 500 fmol of target mRNA and precipitated with 0.1 vol sodium acetate (pH 5.2) and 2.5 vol ice-cold ethanol for 1 h at −80 °C. [score:3]
In vitro RISC loading assayFH-AGO2 affinity purified on agarose beads from FH-AGO2-stable HEK293 cells was incubated with 10 nM synthetic 5′-phosphorylated pre-miR-122 or pre-let-7a, and 500 ng in vitro-transcribed target mRNA in a 20-μl reaction in assay buffer [20 mM Tris-HCl pH 7.5, 200 mM KCl, 2 mM MgCl [2], 5% glycerol, 1 mM DTT, 40 U RNase inhibitor (Fermentas)] for 1 h at 37 °C followed by washing of the beads three times with IP buffer. [score:3]
In the experiment using GFP target reporters, HEK293 cells were transfected in a 24-well format with 250 ng pmiR-122, 100 ng firefly luciferase, 500 ng of GFP-con or GFP-3 × bulge-miR-122 along with 10 ng of luciferase reporter RL-con or RL-3 × bulge-miR-122, or RL-3 × bulge-let-7a (additional control). [score:3]
Expression of RL-1 × bulge-miR-122 induced similar or slightly higher mature miR-122 levels in comparison with RL-3 × bulge-miR-122, despite having a single miR-122 -binding site. [score:3]
Target mRNA -dependent increase of mature miR-122 in human cells. [score:3]
Values plotted are means from at least three biological replicates for c and d, and two biological replicates for e. Error bars represent s. d. (a) Amount of mature miR-122 formed per unit of target mRNA in HEK293 cells transfected with pmiR-122 and respective reporter plasmids. [score:3]
Furthermore, the in vivo repressive activity of miR-122 was enhanced in the presence of its target GFP-3 × bulge-miR-122 compared with green fluorescent protein (GFP) control. [score:2]
Quantification of absolute copy numbers of miR-122 and CAT-1 mRNA per cell further confirmed the reciprocal regulation of these two molecules during starvation and re-feeding (Fig. 1d). [score:2]
In vitro pre-miRNA processing assay with rDICER1 and rAGO2 (native or heat-denatured) to quantify miR-122 biogenesis in the presence of target mRNA. [score:2]
Affinity-purified miRISC-122 were assayed for target RNA cleavage using a 36 nt RNA 5′- AAAUUCAAACACCAUUGUCACACUCCACCAGAUUAA -3′ bearing the sequence complementary to mature miR-122. [score:2]
It was observed that the amount of mature miR-122 formed was higher in the presence of the let-7a target mRNA compared with that of RL-con (Fig. 6e). [score:2]
FH-AGO2 immunoprecipitated from HEK293 cells transiently expressing NHA-DICER1 was subjected to in vitro pre-miRNA processing assay with pre-miR-122 and RL-3 × bulge-miR-122 as described earlier, followed by immunoprecipitation of AGO2 and DICER1 with antibodies specific to endogenous proteins. [score:2]
However, the increase in mature miR-122 on re-feeding the starved cells was reduced on small interfering RNA (siRNA) -mediated knockdown of DICER1, suggesting a requirement of DICER1 in this process (Fig. 1g). [score:2]
In assays using rDICER1 and rAGO2, target -dependent biogenesis of miR-122 was observed. [score:2]
Values were calculated by normalizing the amount of mature miR-122 against the amount of respective target mRNA level and plotted. [score:1]
RNA was isolated from the reaction and mature miR-122 formed quantified by real-time PCR. [score:1]
Cells were harvested after 14 and 24 h, and mature and pre-miR-122 levels quantified. [score:1]
FH-AGO2 was eluted from anti-FLAG beads with 3 × FLAG Peptide (Sigma) and isolated miRISC was incubated with RL-3 × bulge-miR-122 at 37 °C with 10 nM pre-miR-122 for 60 min. [score:1]
There was a significant increase in the de novo-synthesized mature miR-122 with time when RL-3 × bulge-miR-122 was present. [score:1]
Cells were transfected with 1 μM synthetic pre-miR-122. [score:1]
After 48 h, cells were again transfected with RL-con or RL-3 × bulge-miR-122 plasmids. [score:1]
Interestingly, the effect was specific for miR-122 alone, as levels of other miRNAs such as let-7a, miR-16, miR-21, miR-24 and miR-125b were unaffected, arguing against the possibility of a global increase in miRNA levels on stress relief (Fig. 1c,e). [score:1]
Total RNA was extracted and 8 μg RNA was used for northern blotting of mature miR-122, let-7a and miR-16. [score:1]
Reversal of amino acid-starvation -induced stress increases miR-122 biogenesis in Huh7 cells. [score:1]
In vitro with equivalent amounts of affinity-purified AGO2 demonstrated increased miRISC activity in the presence of RL-3 × bulge-miR-122 (Fig. 2e). [score:1]
Hence, it is probable that CAT-1 can trigger increased miR-122 biogenesis in an attempt to restore cellular homeostasis on reversal of stress induced by amino-acid starvation. [score:1]
Positions of the miR-122 -binding sites are indicated. [score:1]
For detection, γ [32]P -labelled 22-nt miRCURY complementary LNA probes for miR-122 and let-7a (Exiqon) or complementary DNA probe for miR-16, U6 snRNA were used. [score:1]
The 3′-UTR of human CAT-1 mRNA harbours four miR-122 -binding sites. [score:1]
FH-AGO2 was eluted from anti-FLAG beads with 3 × FLAG Peptide (Sigma) and isolated miRISC was incubated with RL-con or RL-3 × bulge-let-7a at 37 °C with 10 nM pre-miR-122 for 30 min. [score:1]
Amino acid stress reversal induces miR-122 biogenesis. [score:1]
Consistent with higher miR-122 level, CAT-1 mRNA also showed higher association with AGO2 in re-fed cells (Supplementary Fig. 1b). [score:1]
Synthetic pre-miR-122 was used as a size marker to determine the position of the pre-miR-122 in the northern blotting. [score:1]
To determine copy number of miR-122, we generated a standard curve using PAGE-purified synthetic miR-122. [score:1]
The synthetic miR-122 RNA probe was 5′-end labelled with γ [32]P ATP using T4 Polynucleotide kinase (Ferementas) according to the manufacturer's protocol. [score:1]
This was followed by RNA isolation after 24, 48 and 72 h, and mature miR-122 levels quantified to plot the decay rate of mature miR-122. [score:1]
The amount of mature miR-122 formed was normalized to the amount of AGO2 immunoprecipitated for quantification. [score:1]
Polysomal enrichment of IRE-RL-3 × bulge-miR-122 was estimated by normalizing polysomal mRNA content by total mRNA level. [score:1]
This was accompanied by a concomitant decrease in pre-miR-122 levels, indicating a higher rate of mature miR-122 biogenesis from pre-miR-122 in presence of RL-3 × bulge-miR-122 (Fig. 4a). [score:1]
No Ct was obtained in a control where synthetic miR-122 was not added. [score:1]
As DICER1 processes pre-miRNA to the mature form, we suspected a role of DICER1 in the miR-122 surge, but did not detect any increase in DICER1 protein level on stress reversal (Supplementary Fig. 2a). [score:1]
Immunopurified AGO2 (let-7a miRISC) incubated with 25 ng ml [−1] RL-con or RL-3 × bulge-let-7a in the presence of pre-miR-122 (10 nM) at 37 °C for 30 min followed by RNA isolation and quantification of mature miR-122 formed by qRT-PCR. [score:1]
Relative change of mature and pre-miR-122 in the presence of different amounts of RL-3 × bulge-miR-122 was plotted (right panel). [score:1]
Pre-miR-122 detected by northern blotting with 15 μg total RNA. [score:1]
An increase in DICER1 activity could potentially contribute to the observed increase in mature miR-122. [score:1]
However, the amount of mature miR-122 formed per unit of mRNA was higher for the mRNA with three miRNA -binding sites than with only a single binding site (Fig. 3a). [score:1]
The elevated miR-122 was functionally active, as it was AGO2 associated. [score:1]
In Huh7 cells, low CAT-1 protein level is maintained by high miR-122 activity. [score:1]
In experiment described in the right panel, HEK293 cells co -transfected with plasmid encoding pre-miR-122 (pmiR-122) and RL reporters were used. [score:1]
However, on re-feeding the cells with amino acids, within 2 h CAT-1 mRNA was restored to a lower level accompanied by an increase in mature miR-122 level (Fig. 1b,c,e). [score:1]
Total RNA was extracted and northern blotted for mature miR-122, for all the experiments. [score:1]
For GFP-3 × bulge-let-7a reporter, exactly the same transfections were performed with an exception of the GFP-3 × bulge-miR-122 reporter. [score:1]
rDICER1 could process the pre-miR-122 in vitro but rAGO2 alone failed to process pre-miR-122, eliminating the possibility of enhanced miRNA maturation by increased AGO2 slicer activity 33 (Supplementary Fig. 5b,c). [score:1]
Tet-ON HEK293 cells were induced for specific time points with doxycycline to synthesize pre-miR-122 from a plasmid with Tet-response element. [score:1]
The increase in miR-122 was accompanied by a sharp decrease in pre-miR-122, suggesting increased processing of pre-miR-122 to generate mature miR-122 on stress reversal (Fig. 1f). [score:1]
For preparation of plasmid DNA template, RL-con, RL-1 × bulge-miR-122, RL-3 × bulge-miR-122, RL-3 × bulge-miR-122 (W5′), RL-3 × bulge-miR-122 (W3′) and RL-CatA were digested for 4 h at 37 °C with DraI (New England Biolabs) and RL-3 × bulge-let-7a was digested with HpaI (New England Biolabs); the rest of the protocol was as per the manufacturer's instructions. [score:1]
In the left panel, changes in relative level of mature miR-122 has been plotted for experiments done with RL-con or RL-3 × bulge-miR-122. [score:1]
The rise in miR-122 level is expected, as it would help the cells to restore CAT-1 levels back to normal. [score:1]
[1 to 20 of 93 sentences]
11
[+] score: 221
We discovered that of these five miRNAs, miR-122 and miR-192 were upregulated at least 1.5-fold in both HES1 and HES2 cells, while miR-135b and miR-33a were upregulated only in HES2 cells, and miR-224 was upregulated only in HES1 cells. [score:10]
Our interpretation of this observation is that since we profiled gene expression in 14d-differentiated cells stably expressing miR-122, most of the detected changes in gene expression were a result of an indirect rather than direct effect of miR-122. [score:9]
It is noteworthy that only one predicted target of miR-122 (NPEPPS) was significantly downregulated in wt versus mutant miR-122 -expressing cells, albeit relatively mildly (1.2-fold). [score:8]
Additionally, overexpression of miR-122 may have affected global processing of miRNAs (DICER1 is a predicted target of miR-122 according to TargetScan 4.0) and interfered with the ESC differentiation, as it has been previously shown that global loss of small RNAs in Dicer [−/−] mES cells results in a block in ES cell differentiation [62]. [score:7]
According to the data of Laurent et al., miR-122, miR-10a and miR-24 were upregulated in hESC differentiated towards extraembryonic endoderm, while miR-375's expression was unchanged [20]. [score:6]
These miRNAs were differentially-expressed upon NaB -induced differentiation and represent ES miRNAs (hsa-miR-302a*, hsa-miR-302d, hsa-miR-517b), endodermal miRNAs (hsa-miR-122, hsa-miR-375) and miRNAs that were upregulated in both lines (hsa-miR-10a, hsa-miR-24). [score:6]
The expression of endoderm-specific miRNAs–miR-375 [43], and miR-122, [31] was upregulated in response to NaB, though to a higher extent in the HES2 cell line. [score:6]
Stable overexpression of endoderm-specific miR-122 in hESC resulted in increased expression of a few endodermal markers in spontaneously-differentiating hESC, but had no clear effect on directing differentiation towards an endodermal fate; rather, it delayed the general differentiation of hESC. [score:6]
Construction of a lentiviral vector expressing enhanced yellow fluorescent protein (EYFP) reporter fused to the 3′UTR of miR-122 target gene CAT1 [31] was performed as follows: First, the human PGK promoter-EGFP cassette from pRLLSIN18. [score:5]
Effect of miR-122 overexpression on gene expression in hESC. [score:5]
We looked for enrichment in specific pathways among the significantly differentially-expressed genes when comparing wt versus mutant miR-122 -expressing cells (using the Panther classification system http://www. [score:5]
For analysis of gene expression in RNA from differentiated hESC expressing miR-122, average results of three (mutant miRNA) or two (wt miRNA) independent experiments were used. [score:5]
We confirmed the functionality of the cloned miR-122 by its ability to repress the expression of an EYFP reporter gene fused to the 3′UTR of a known miR-122 target gene, CAT-1 [31]. [score:5]
Upon treatment with NaB, induction of the endodermal miR-122 and miR-375 was observed in parallel to induction of hepatic gene expression, while ESC-specific miRNA expression was reduced. [score:5]
Table S3 Effect of miR-122 overexpression on gene expression in differentiated hESC (0.11 MB DOC) Click here for additional data file. [score:5]
Table S2 Affymetrix gene expression of hESC overexpressing miR-122 (6.72 MB XLS) Click here for additional data file. [score:5]
QRT-PCR results of gene expression in 14d-differentiated HES2 cells expressing mutant (mut) or wt miR-122. [score:5]
Effect of miR-122 overexpression on miRNA expression in hESC. [score:5]
Strikingly, among the genes that were upregulated in the presence of wt miR-122 were HHEX, an early marker of embryonic liver [53], which play a fundamental role in liver development [54] (Table S3 and Fig. 7A), and CXCR4, a marker for definitive endoderm [55]. [score:5]
0003726.g007 Figure 7 QRT-PCR results of gene expression in 14d-differentiated HES2 cells expressing mutant (mut) or wt miR-122. [score:5]
In order to overexpress miR-122 or a control, which is mutated in 3 nucleotides within the seed sequence, we used a lentiviral transduction -based method, which was shown to enable stable and efficient transgene expression in hESC [25], [34]. [score:5]
We analyzed the global gene expression of differentiated cells expressing either wt or mutant miR-122 using Affymetrix microarrays (Table S2, GEO accession GSE13460 [36]) and qRT-PCR. [score:5]
miR-122 is highly-expressed in the developing and in the adult liver (Fig. 2 and [31]) and regulates metabolic functions in the adult liver such as lipid metabolism [51] and cholesterol biosynthesis [52]. [score:4]
Downregulation of members of the integrin signaling pathway by miR-122 may lead, therefore, to de-repression of Nanog, and consequently, to activation of hESC markers including POU5F1 and SOX2 [61], as was observed in our cells. [score:4]
For generation of mutated miR-122 -expressing vector, three mutations in the seed sequence (at positions 2, 4 and 6) were introduced by PCR. [score:4]
Overall, overexpression of miR-122 alone in hESC was unable to modify the mRNA profile of the cells towards an endodermal or a hepatic pattern, but rather delayed the differentiation when compared to mutant miRNA -expressing cells. [score:4]
Stable overexpression of miR-122 in hESC was unable to direct spontaneous differentiation towards a clear endodermal fate, but rather, delayed general differentiation of these cells. [score:4]
Table S3 lists the 50 most differentially-expressed probes between cells transduced with wt versus mutant miR-122. [score:3]
Therefore, we sought to determine whether overexpression of miR-122 may modify the mRNA profile of HES2 cells towards a ”liver-like” pattern. [score:3]
Following transfection to HEK-293 cells, wt miR-122 repressed the EYFP levels to 25% of the expression level in the presence of mutant miR-122 or empty vector (Fig. 5B). [score:3]
miR-122 remained highly-expressed during the differentiation process (Fig. 6A). [score:3]
Transduction efficiency of both lentiviral vectors (encoding wt and mutant miR-122) into HES2 cells was at least 80%, as judged by the expression of the red fluorescent reporter protein (Fig. 5C). [score:3]
We further analyzed the effect of over -expression of the endoderm-specific miR-122 on spontaneous differentiation of hESC. [score:3]
B. HEK-293 cells were co -transfected with a lentiviral plasmid encoding EYFP fused to the 3′UTR of hsa-miR-122 target gene CAT-1 (EYFP-CAT-1) and lentiviral plasmids encoding wt hsa-miR-122, mutant (mut) hsa-miR-122 or empty vector (ev). [score:3]
A. Schematic representation of the lentiviral vector expressing the wt and mutant hsa-miR-122. [score:3]
0003726.g006 Figure 6 QRT-PCR results of miRNA expression levels in undifferentiated (undiff) untransduced (un-trans) HES2 cells, and in cells transduced with wt or mutant (mut) miR-122 vector either undifferentiated, or spontaneously differentiated for 14d. [score:3]
Recombinant virions of miR-122 -expressing vectors were produced and concentrated as previously described [34]. [score:3]
Overexpression of hsa-miR-122 in hESC. [score:3]
As demonstrated above, NaB treatment induced the expression of liver-specific miR-122 in parallel to several hepatic genes, mainly in HES2 cells. [score:3]
C. FACS histogram showing transduction efficiency of HES2 cells with lentiviral vector expressing hsa-miR-122 (wt or mutant) and a RFP reporter. [score:3]
D. QRT-PCR results of hsa-miR-122 expression levels in undifferentiated untransduced HES2 cells, or cells transduced with lentiviral vector encoding wt or mutant (mut) hsa-miR-122. [score:3]
Further, the most likely scenario is that miR-122 may require additional miRNAs or proteins in order to allow for differentiation, In summary, miRNA expression profiling in hESC revealed three novel undiscovered miRNAs, which will be uploaded to the miRbase and given formal names. [score:3]
The effect of miR-122 overexpression on hESC differentiation. [score:3]
For construction of a lentiviral vector expressing miR-122, the human H1 promoter (position -220 to +1) was amplified by PCR and subcloned into pBS as described [35]. [score:3]
Further, the most likely scenario is that miR-122 may require additional miRNAs or proteins in order to allow for differentiation, In summary, miRNA expression profiling in hESC revealed three novel undiscovered miRNAs, which will be uploaded to the miRbase and given formal names. [score:3]
0003726.g005 Figure 5 A. Schematic representation of the lentiviral vector expressing the wt and mutant hsa-miR-122. [score:3]
QRT-PCR results of miRNA expression levels in undifferentiated (undiff) untransduced (un-trans) HES2 cells, and in cells transduced with wt or mutant (mut) miR-122 vector either undifferentiated, or spontaneously differentiated for 14d. [score:3]
Furthermore, induction of several liver-enriched miRNAs, including miR-122 and miR-192, was observed in parallel to induction of endodermal gene expression. [score:3]
Then, the effect of lentiviral -based overexpression of liver-specific miR-122 on hESC differentiation was analyzed, using genomewide gene microarrays. [score:3]
The sequence of mature wt miR-122 and mutant miR-122 carrying 3 mutations in the seed sequence (underlined) are shown below. [score:2]
QRT-PCR analysis revealed that miR-122 was highly expressed in transduced HES2 cells compared to untransduced cells (Fig. 5D). [score:2]
miR-122. [score:1]
We inserted the genomic sequence encoding human hsa-miR-122 into a reporter-containing lentiviral vector, under the constitutive polymerase III promoter H1 (Fig. 5A). [score:1]
In order to evaluate the effect of miR-122 expression on differentiation of hESC, we transferred the transduced HES2 cells from feeder cells to fibronectin and allowed the cells to differentiate spontaneously in the basic medium without bFGF supplementation for fourteen days. [score:1]
[1 to 20 of 54 sentences]
12
[+] score: 216
Other miRNAs from this paper: mmu-mir-122
Huh7 hepatocellular carcinoma cells resemble normal hepatocytes in that they express significant amounts of the liver-specific miR122 [27], and have previously been used as an in vitro mo del for adenovirus infection of liver cells to demonstrate the capacity of miR122 target sites to down-regulate E1A expression [22], [23]. [score:10]
As expected, a strong miR122 target element -dependent suppression of reporter gene expression was observed in Huh7 cells, whereas no evidence for miR122 expression in A549, HCT116, or Hep-2 cells could be detected (Figure S1). [score:9]
Thus, placing these toxic or immunomodulatory genes under a dual miR122 control by targeting their mRNAs directly as well as indirectly (via miR122-regulated replication) would provide a synergistic and powerful strategy for excluding their expression in hepatocytes. [score:8]
Although even a strong systemic antagomir -mediated miR122 inhibition used as an experimental HCV therapy did not show any obvious adverse effects on the liver [42], the prominent role of miR122 in hepatocytes might raise concerns of disrupting normal gene regulation in hepatocytes due to a “sponge effect” of expression of multiple miR122 target sites. [score:8]
Reflecting its role as a tumour suppressor [45], [46], the loss of miR122 expression is common in HCC [47], [48], and the Huh7 cells used in this study are exceptional among HCC-derived cell lines in resembling normal hepatocytes by expressing miR122 [27]. [score:7]
In order to bring the replication of this modified Ad5/3 virus effectively under the control of miR122 -mediated E1A regulation, it was necessary to combine the liver-specific, miR122 -mediated inhibition with a mutation that non-specifically decreased E1A translation in all cell types. [score:7]
The success in using miR122 targets for suppressing E1A expression, suggests that similar strategies might also be useful for preventing potentially harmful replication of other therapeutic or vaccine viruses. [score:7]
Using a chimeric Ad5/3 adenovirus containing three miR122 target elements in the E1A 3′UTR, we have previously reported that despite potent suppression of E1A mRNA and protein expression, viral replication was only modestly attenuated in the liver-derived Huh7 cells [22]. [score:7]
Nevertheless, it is interesting to note that despite this limited capacity to replicate in murine cells, our current findings together with the data by Cawood et al. clearly show that the elevated markers of liver damage in mice are a genuine consequence of adenoviral gene expression in hepatocytes rather than due to less direct hepatotoxicity caused by the viral particles, and can thus be counteracted by miR122 -based targeting. [score:6]
In this study we show that targeting of E1A to cell type-specific downregulation by miR122 is sufficient to potently attenuate adenovirus replication in the human liver. [score:6]
In this study we show in normal human liver tissue strong suppression of otherwise unmodified adenovirus 5 carrying six copies of miR122 target elements in E1A 3′ UTR. [score:5]
Of note, when considering intrahepatic tumours, the value of miR122 -based targeting is not limited to metastatic disease, but could also be exploited in virotherapy of primary hepatocellular carcinoma (HCC). [score:5]
By inserting miR122 target elements in the 3′UTR of E1A gene we could strongly reduce E1A expression in cells of hepatic origin. [score:5]
Equally important, miRNA122 is one the most tissue-specific miRNA and apart from minimal expression in some cells of the thymus and brain, it is not expressed outside of the liver [38], [39], [40], [41]. [score:5]
In both cases the suppressive effect of the miR122 target elements on replication and cytopathicity of Ad5T122 in Huh7 cells was almost completely abolished (Figure S2). [score:5]
To generate a miRNA -targeted version of wild-type adenovirus 5 (Ad5 in Fig. 1), we inserted six copies of target elements with perfect sequence complementarity for the liver-specific microRNA miR122 in the 3′UTR of the E1A gene (Ad5T122 in Fig. 1). [score:5]
On the other hand, similar to our earlier study, Leja et al. reported that combining miR122 -mediated E1A mRNA suppression with other inhibitory measures was required to potently suppress adenovirus replication in cultured hepatic cells [25]. [score:5]
Moreover, miR122-control could also be further employed in liver detargeting of oncolytic adenoviruses by placing additional target sequences in other positions in the viral genome. [score:5]
Indeed, miR122 is very highly expressed in normal hepatocytes where it has been estimated to constitute over 70% of all miRNAs expressed [27], [38]. [score:5]
The potent suppression of the current Ad5T122 virus in the normal human liver tissue may be contributed by the higher number of miR122 targets compared to the Ad5/3-derived virus that we have studied earlier [22] (six vs. [score:4]
Specifically, they combined miR122 -mediated downregulation of E1A with deletion of the E1B gene and a tissue-specific promoter showing low activity in the liver to drive E1A transcription. [score:4]
Thus, we concluded that miR122 in normal human liver tissue could exert a powerful negative regulation on the target site-containing virus. [score:4]
This chimeric mRNA was strongly downregulated by miR122, as evidenced by reduced luciferase activity in Huh7 cells and in primary hepatocyte cultures, as well as in the livers of infected mice. [score:4]
This confirmed that inclusion of the miR122 target sites had not compromised the replicative potential of Ad5T122 in the tumour tissue, as we had already observed in cancer cell lines (Figure 2). [score:3]
Finally, it is also important to note that Huh7 cells express only 8% of the miR122 levels observed in primary human hepatocytes [27]. [score:3]
We also examined the effect of miR122 inhibition by a transfected antagomir designed against miR122. [score:3]
To confirm that the attenuation of Ad5T122 in Huh7 cells was indeed specifically due to silencing by miR122 we generated stable cell lines in which the critical miRNA machinery component Argonaute 2 (Ago2) had been targeted for silencing with lentivirally transduced anti-Ago2 shRNAs. [score:3]
In summary, the current study provides a definitive proof of concept and preclinical validation for the use of miR122 target elements for reducing the risk of liver toxicity of therapeutic adenoviruses. [score:3]
pShuttle 6×122 was made as described [22], except inserting six copies of miR122 target elements instead of three. [score:3]
To improve the safety of oncolytic adenoviruses we have introduced a miRNA -based approach for engineering adenoviruses that are suppressed in their replication by the liver-specific miR122 [22]. [score:3]
These results provide a definitive validation for introducing miR122 targets into oncolytic adenovirus constructs as a safeguard of the liver. [score:3]
Our data show that in normal human liver tissue miR122 target elements alone are sufficient to profoundly attenuate Ad5. [score:3]
Based on these data we conclude that the miR122 sites could strongly suppress replication of Ad5T122 in normal human liver tissue without compromising its replication in colorectal cancer liver metastasis tissue. [score:3]
Subsequently Cawood et al. reported the use of a serotype 5 virus in which E1A had been replaced with an E1A-luciferase fusion gene containing four miR122 target elements in its 3′UTR. [score:3]
By itself this uniform decrease of E1A protein production did not have a noticeable effect on Ad5/3 replication in a panel of non-hepatic cancer cell lines, but together with the miR122 -mediated E1A control led to a potent suppression of replication and cytopathicity in Huh7 cells [22]. [score:3]
Moreover, the failure of Ad5T122 to replicate and spread in the liver cells provides another layer of protection against deregulating normal miR122-regulated processes in the liver. [score:3]
However, Leja et al. also used six miR122 targets in their related study design discussed above. [score:3]
The indicated cells lines were co -transfected with an unmodified Firefly luciferase vector (pSIRNALUC-3′MluI) or its derivative containing a miR122 target element in the 3′ UTR (pSIRNALUC-3′1×T122) together with a vector for Renilla luciferase (pcDNA-Renilla). [score:3]
Because of the non-hepatic origin of the latter cell lines they were not expected to express miR122. [score:3]
Figure S2Suppression of Ad5T122 replication in Huh7 cells is miR122-specific. [score:3]
They also showed that serum markers of liver damage as well as viral genome copy numbers in the livers of mice infected with wild-type Ad5 containing four miR122 targets were lower than mice infected with an unmodified virus [23], [24]. [score:3]
B. Effect of miR122 inhibition by a synthetic antagomir oligonucleotide on Ad5T122 replication in Huh7 cells. [score:3]
The number of miR122 target elements is determined by the copy number of E1A mRNAs in the infected cells, which becomes very low in liver cells due to miR122 -guided destruction. [score:3]
To examine the potential of the miR122 -mediated suppression in controlling Ad5T122 replication in human liver we turned into an experimental system based on ex vivo culturing of precision-cut human liver tissue slices [28], [29]. [score:3]
In Ad5T122, six copies of miR122 target elements were introduced in the 3′UTR of E1A gene. [score:3]
Figure S1 Functional quantitation of miR122 expression in different cell lines. [score:3]
Combining such transductional liver-detargeting with the post-transcriptional, miR122 -based approach validated in this study would be straight-forward, and could further minimize the potential damage to hepatocytes by oncolytic adenoviruses, especially when treating tumours outside of the liver. [score:3]
miR122 Inhibitor Assay. [score:2]
To confirm this, we quantified the functional miR122 expression in these cell lines using a previously validated dual luciferase assay [22]. [score:2]
Cawood et al. suggested that four miR122 target sites as compared to the three copies used in our previous study allowed a better control of viral replication. [score:2]
By contrast, cell death caused by Ad5T122 was strongly reduced in Huh7 cells, indicating that replication of Ad5T122 could be attenuated by miR122. [score:1]
Immunohistochemistry of the infected tissues does not provide a quantitative measure of viral replication, and low levels of E1A do not exclude replication of the miR122 -targeted virus. [score:1]
[1 to 20 of 52 sentences]
13
[+] score: 215
The experiments, based on miR-122 over -expression or knockdown confirmed that miR-122 could directly bind with HPV16 E6 mRNA and significantly decrease the expression of E6 mRNA. [score:7]
As SOCS1 acted as the inhibitor of type I IFN, the results indicated that miR-122 affected the expression of type I IFN signal pathway by inhibiting SOCS1. [score:7]
Up -expression and down -expression of miR-122 verified that miR-122 could only directly bind with HPV16 E6 mRNA and decrease its level greatly. [score:6]
The results showed that miR-122 down-regulated HPV16 E6 mRNA expression obviously, while it reduced E6*I and E7 mRNAs less but still significantly (Figure 2C). [score:6]
Direct inhibition of miR-122 on HPV16 E6 mRNA expression in SiHa cells. [score:6]
These data further indicated that miR-122 directly inhibited the expression of HPV16 E6, but not HPV16 E7. [score:6]
The mature sequence of miR-122 (miR-122 mimic) was obtained from miR-Base database: 5′-UGGAGUGUGACAAUGGUGUUUG-3′; the sequence of miR-122 inhibitor (AMO-122) was the exact antisense copy of the mature miR-122 sequence: 5′-CAAACACCAUUGUCACACUCCA-3′; the mutant miR-122 mimics, miR-122-E6-mu and miR-122-SOCS1-mu, were designed by RNAhybrid software to eliminate the combination between miR-122 and target (HPV16 E6 and SOCS1 nt359-nt375) mRNAs, respectively. [score:5]
Also, the study showed that the constitutive expression of miR-122 in several human cervical carcinoma cell lines were different and some cervical cells have higher miR-122 expression. [score:5]
According to the percentage of mCherry -positive cells and mCherry fluorescence intensity, the mCherry-E6 expression were significantly inhibited by miR-122, while it rarely affected by miR-122-E6-mu or miR-mock (Figure 4B–D). [score:5]
In this study, the constitutive expression of miR-122 were detected in different cell lines derived from human cervical cancer, which demonstrated the differential expression levels of miR-122 in those cells. [score:5]
The inhibition of E6*I and E7 mRNAs expression by miR-122 indicated that other potential factors might be involved in miR-122 anti-HPV process. [score:5]
Our previous study showed that SOCS1 effectively regulated type I IFN signal pathway and miR-122 could regulate the SOCS1 protein expression in Huh7 cells [7]. [score:5]
This significant inhibition of E7 and E6*I mRNAs suggested that miR-122 might also induce some other cellular antiviral signal pathways to influence HPV’s mRNAs expression. [score:5]
In conclusion, this study showed that miR-122 inhibited HPV through both binding to E6 mRNA directly and promoting type I IFN signaling pathway indirectly in cervical carcinoma cell lines and might be a potentially viable therapeutic option for HPV infection. [score:5]
Compared with miR-mock transfected cells, SOCS1-EGFP expression was inhibited obviously by miR-122, but not miR-122-SOCS1-mu (Figure 8B). [score:4]
MiR-122 plasmid and AMO-122 nucleotides were separately transfected into SiHa cells to up-regulate and block miR-122 effects, respectively. [score:4]
The results showed that, compared with Huh7 cells, CaSki cells had the highest miR-122 expression, and HeLa cells hardly expressed miR-122. [score:4]
The confirmation of miR-122 direct inhibition on HPV16 E6 mRNAs. [score:4]
In our previous study, miR-122 presented the anti-viral effects in Borna disease virus (BDV) persistently infected cells and hepatoma cell lines by up -regulating type I IFNs production [7], [8]. [score:4]
The inhibition of miR-122 on HPV16 E7 and E6*I mRNA suggested that some other pathways might play essential roles involving in the miR-122 anti-HPV effects. [score:3]
2. MiR-122 directly inhibits HPV16 E6 oncogene. [score:3]
This was because HeLa cells expressed little endogenous miR-122, which made the antiviral effects of miR-122 more obvious shown in the fluorescent images by transfecting exogenous miR-122 plasmid. [score:3]
Furthermore, to confirm the response to IFN-I pathway after blocking SOCS1 by miR-122, the expression of STAT1 was detected by western blotting after separately transfected miR-122 mimic and miR-122-SOCS1-mu into SiHa cells. [score:3]
Therefore, we could conclude that the inhibition of HPV16 mRNAs by miR-122 was also attributed to the induction of type I IFN. [score:3]
To confirm the binding effects of miR-122 on SOCS1 mRNA in HeLa cells, pSOCS1-EGFP expressing plasmid was co -transfected with miR-mock, miR-122 mimic or miR-122-SOCS1-mu (Figure 8A), separately. [score:3]
Western blotting results showed the same change of SOCS1-EGFP expression as above (Figure 8E), which indicated that miR-122-SOCS1-mu did eliminate the binding effects of miR-122 on SOCS1 mRNA. [score:3]
The main cell line used in this study was SiHa, because it carries HPV16, the major infection type, and has middle level miR-122 constitutive expression (Figure 1). [score:3]
Inhibition effects of miR-122 on SOCS1 mRNA. [score:3]
Constitutive expression of miR-122 in cervical epithelial carcinoma cells. [score:3]
0108410.g007 Figure 7(A–B) Inhibition of SOCS1 by transfecting miR-122 in SiHa cells, detected by RT-qPCR and western blotting at 24 h, 48 h and 72 h separately. [score:3]
The prediction implied that miR-122 could possibly target HPV16 E6 and E7 mRNAs, but not E6*I or E6*II mRNAs. [score:3]
As expected, the expression of OAS-1 and MxA’s mRNAs increased after miR-122 mimic transfection, and the significant increase exhibited at 48 h post-transfection (Figure 6A). [score:3]
To figure it out, miR-122 plasmid and AMO-122 nucleotides were transfected into SiHa cells to detect the expression of type I IFN, E6*I, E7 and E6 mRNAs at 24 h, 48 h and 72 h post-transfection, respectively. [score:3]
Loss function of miR-122 decreased the expression of OAS-1 and MxA’s mRNAs (Figure 6C). [score:3]
0108410.g001 Figure 1 The constitutive expression of miR-122 were separately detected in several cell lines by RT-qPCR. [score:3]
Furthermore, at 48 h post-transfection of miR-122, there was a negative correlation between the expression of IFN-α/β and HPV16 mRNAs. [score:3]
But it is still unclear whether cervical carcinoma cells, including HPV -positive and HPV -negative cells, express miR-122 and more importantly, whether miR-122 functions as anti-HPV in cervical cells. [score:3]
We previously demonstrated that over -expression of miR-122 induced the production of type I IFN in BDV persistent infected OL cells [8]. [score:3]
At 48 h post-transfection, the expression of miR-122, E6*I, E7 and E6 mRNAs were detected by RT-qPCR. [score:3]
The previous study also indicated that nt359-nt375 of SOCS1 might be the target of miR-122 in Huh7 cells [7]. [score:3]
1. Detection of constitutive expression of miR-122 in cervical carcinoma cells. [score:3]
The constitutive expression of miR-122 in C33A, HeLa, SiHa and CaSki cells were detected by RT-qPCR, respectively. [score:3]
The constitutive expression of miR-122 were separately detected in several cell lines by RT-qPCR. [score:3]
The miR-122 expression in Huh7 cells, human hepatoma carcinoma cells, were employed as control. [score:3]
These results indicated that miR-122 could directly bind with E6 mRNA. [score:2]
Through prediction, the combination of miR-122 and SOCS1 was identified, which inspired us that miR-122 might induce IFN-I pathway by blocking the negative regulator of it. [score:2]
MiR-122 expression in SiHa cells was mediate, nearly one fifth of that in Huh7 cells (Figure 1). [score:2]
MiR-122 plasmid was then transfected into HeLa cells with pmCherry-E6 and pmCherry-E7 plasmids to verify its inhibition effects. [score:2]
4. MiR-122 increases type I IFN expression through blocking SOCS1. [score:2]
According to predicted mfe, the combining ability of miR-122 to HPV16 E6 mRNA is better than to E7 mRNA (Figure 2B). [score:1]
The phosphorylation levels of STAT1 protein increased clearly enough to reflect the same tendency after treated SiHa cells with miR-122 mimic (Figure 6B). [score:1]
As we co -treated HeLa cells with miR-122 and HPV16 E6 plasmids, the HPV18 oncogenes in HeLa cells did not influence our conclusion that miR-122 could act as anti-HPV reagent and might serve as a therapeutic option in human cervical cancer. [score:1]
In this study, miR-122 plasmid and AMO-122 nucleotide were separately transfected into SiHa cells, and the expression of SOCS1 was evaluated at 24 h, 48 h and 72 h post-transfection. [score:1]
Moreover, the nt359-nt375 site of SOCS1 was identified as the binding sites of miR-122. [score:1]
The IFN- increased 2.3-fold and IFN-β increased 2.5-fold by miR-122 (Figure 5A and 5B), while decreased 57.2% and 61.3% by AMO-122, respectively (Figure 5F and 5G). [score:1]
The results showed that both mRNA and protein levels of SOCS1 decreased, especially at 48 h post-transfection of miR-122 (Figure 7A and 7B). [score:1]
0108410.g005 Figure 5(A–E) The expression of IFN-α, IFN-β, E6*I, E7 and E6 mRNAs in SiHa cells after transfected with miR-122 or miR-NC plasmid for 24 h, 48 h and 72 h, evaluated by RT-qPCR. [score:1]
The verification of miR-122 and HPV16 E6 mRNA binding effects by mutating miR-122 sequence. [score:1]
In our study, the antiviral capability of miR-122 on HPV 16 was verified. [score:1]
To confirm the binding effects of miR-122 on HPV16 E6 mRNA, pmCherry-E6 plasmid was co -transfected with miR-mock, miR-122 mimic or miR-122-E6-mu (Figure 4A) into HeLa cells, separately. [score:1]
After transfected miR-122 into SiHa cells, type I IFN and associated ISGs increased significantly, indicating that miR-122 might also anti-HPV by inducing IFN-I pathway. [score:1]
The verification of miR-122 binding site in SOCS1. [score:1]
Accordingly, type I IFN became our first hypothesis of miR-122 antiviral pathway. [score:1]
Previous studies reported that miR-122, a liver-specific miRNA, assisted hepatitis C virus (HCV) replication by binding to its 5′UTR, resulting in stabilizing HCV genome [6]. [score:1]
0108410.g004 Figure 4(A) The nucleotide sequence miR-122-E6-mu. [score:1]
The sequences of miR-122-E6-mu and miR-122-SOCS1-mu were as follows: 5′-ACCUGACACUGUUACCACAAAC-3′, 5′-UCCUCACACACAAACCACAUUG-3′. [score:1]
As shown, the phosphorylation level of STAT1 increased obviously by miR-122 mimic, instead of miR-mock or miR-122-SOCS1-mu (Figure 8F). [score:1]
0108410.g006 Figure 6(A) The expression of OAS-1 and MxA mRNAs in SiHa cells after transfected with miR-122 or miR-NC for 24 h, 48 h and 72 h, evaluated by RT-qPCR. [score:1]
0108410.g008 Figure 8(A) The nucleotide sequence of miR-122-SOCS1-mu. [score:1]
Further results showed that miR-122 could pair with SOCS1, resulting in the induction of IFN-Is production, followed by down-stream response in signaling pathway. [score:1]
0108410.g003 Figure 3(A–C) Fluorescent images of HeLa cells co -transfected with miR-122 plasmid and pmCherry-C1, pmCherry-E6 or pmCherry-E7, respectively. [score:1]
After blocking miR-122, the HPV16 E6 mRNA increased about 3.9-fold, while E6*I and E7 only increased about 2.3-fold and 2.1-fold (Figure 2D), respectively. [score:1]
Effects of miR-122 on type I IFN, HPV16 E6*I, E7 and E6 mRNAs. [score:1]
The pDC-316-EGFP-U6-miR-122 (miR-122) and pDC-316-EGFP-U6-miR-NC (miR-NC) plasmids were synthesized by Genscript (USA) as previously described [8]. [score:1]
To verify the type I IFN signal pathway has been promoted by miR-122 in cervical carcinoma cells, IFN stimulated genes and the activity of STAT proteins were detected respectively. [score:1]
Yet, the interaction between miR-122 and HPV has not been studied before. [score:1]
Complementary bindings of miR-122 to HPV16 E6 and E7 mRNAs were predicted. [score:1]
Furthermore, based on the prediction, we found that miR-122 could complementally bind to HPV16 E6 and E7 mRNAs rather than HPV16 E6*I mRNA. [score:1]
MiR-122-SOCS1-mu had the similar effect on SOCS1-EGFP as miR-mock (Figure 8C and 8D). [score:1]
Promotion of type I IFN signal pathway by miR-122. [score:1]
0108410.g002 Figure 2(A) The predicted binding sites of miR-122 to HPV16 E6 and E7 transcripts. [score:1]
[1 to 20 of 81 sentences]
14
[+] score: 200
The over expression of insulin-like growth factor 1 receptor (Igf1R) in the development of tumors stimulates cell growth, survival and proliferation and regulates the initiation of cancer cell metastasis; the level of Igf1R is negatively associated with the level of miR-122 expression, implying that the overexpression of miR-122 can inhibit tumor cell growth and proliferation by suppressing Igf1R expression 34. [score:15]
In summary, we found that miR-122 expression significantly decreased in CC tissues, and the overexpression of miR-122 played a pivotal role in inhibiting proliferation, stimulating apoptosis and suppressing invasion of CC cells. [score:9]
Bcl-W activity can inhibit cancer cell apoptosis, and the overexpression of miR-122 can inhibit the expression of Bcl-W and CCNG1 to induce cell apoptosis and cell cycle arrest 40. [score:9]
As a tumor suppressor, miR-122 can inhibit intrahepatic invasion and migration of CC cells by suppressing angiogenesis through regulating the disintegrin and metalloprotease 17 activity 43. [score:8]
In our study, we found that the overexpression of miR-122 played pivotal roles in inhibiting proliferation, stimulating apoptosis and suppressing invasion of QBC939 and RBE cells. [score:7]
Our study confirmed that the expression of miR-122 was significantly lower in CC tissues than that in normal bile duct tissues, indicating that the decreased expression of miR-122 might be closely related to the development of CC. [score:6]
A previous study demonstrated that the abnormal expression of miR-122 was responsible for hepatocarcinogenesis; the loss of miR-122 led to the down-regulation of tumor cell apoptosis 37. [score:6]
MiR-122 expression in tumor cells is suppressed in the early phase of CC, resulting in severe metastasis of tumor cells, and the restoration of its expression may help to control tumor progression of CC patients 38. [score:6]
Furthermore, the expression level of miR-122 in QBC939 was significantly lower than those of the first two cell lines (both P < 0.05), while there was no significant difference in the expression levels of miR-122 between HCCC-9810 and RBE (P > 0.05) (Fig. 1B). [score:5]
As shown in Fig. 1A, qRT-PCR results indicated that the expression of miR-122 was significantly lower in CC tissues than that in the normal bile duct tissues, and the relative expression levels (2 [−ΔΔCt]) were (0.442 ± 0.051) and (0.990 ± 0.121), respectively (t = 14.10, P < 0.001). [score:5]
The associations between miR-122 expression and the clinicopathological features of the CC patients were presented in Table 1. The results showed that there was no significant association between miR-122 expression and gender, age, tumor size or differentiation (all P > 0.05). [score:5]
The imbalance between miR-122 and CCNG1 may help to inhibit the tumor cell proliferation of CC through triggering p53 tumor suppressor gene 36. [score:5]
Based on previous study results, miR-122 down-regulation was identified to be associated with hepatic cell invasion, intrahepatic metastasis and reduction of tumor cell sensitivity to drug agent resulting in tumor aggressiveness 42. [score:4]
As a vital apoptosis regulator, and the mechanism of miR-122 in CC cells involves suppressing Bcl-W mRNA and the protein level, consequently leading to large reduction of cell motility 39. [score:4]
Therefore, we suggested that regulating the level of miR-122 could be used in controlling the progression of CC, which was consistent with the previous study findings revealing that the modulation of miR-122 level may be one of the targets for the prognosis prediction and the design of effective therapies for CC patients 26. [score:4]
How to cite this article: Liu, N. et al. The Roles of MicroRNA-122 Overexpression in Inhibiting Proliferation and Invasion and Stimulating Apoptosis of Human Cholangiocarcinoma Cells. [score:4]
The role of miR-122 in inhibiting CC cell proliferation. [score:3]
Association of the relative expression of microRNA-122 (miR-122) and clinicopathological features in cholangiocarcinoma (CC) patients. [score:3]
Quantitative real-time polymerase chain reaction (qRT-PCR) detected the relative expression of microRNA-122 (miR-122) in cholangiocarcinoma (CC) tissues and cell lines. [score:3]
However, the expression of miR-122 was found significantly associated with lymph node metastasis and distant metastasis (both P < 0.05). [score:3]
Association of miR-122 expression with the clinicopathological features of CC patients. [score:3]
MiR-122 deficiency in CC patients may contribute to the dysregulation of mitochondrial functions related with liver function, so its loss of expression may lead to increased morbidity and mortality and may predict poor prognosis of CC patients 25. [score:3]
Furthermore, miR-122 participates in the tumor cell survival, proliferation, differentiation and migration as a tumor suppressor 27. [score:3]
Finally, our study suggested that miR-122 could be a promising biomarker and target used for the diagnosis and treatment of CC. [score:3]
Thus, down-regulated miR-122 is potential to be an independent predictor of the development and progression of CC characterized by the loss of anti-apoptotic effect 41. [score:3]
Quantitative real-time polymerase chain reaction (qRT-PCR) testing microRNA-122 (miR-122) expression level after transfection in different groups. [score:3]
However, the expression levels of miR-122 in QBC939 and RBE cells of the NC group, the Mock group and the Blank group were significantly higher than that of anti-miR-122 group (all P < 0.05). [score:3]
In addition, we identified that the expression level of miR-122 in QBC939 was significantly lower than those of HCCC-9810 and RBE cells, while there was no significant difference between HCCC-9810 and RBE. [score:3]
MiR-122 also functions as a key modulator of cyclin G1 expression and there is also a negative association between the levels of miR-122 and cyclin G1 (CCNG1) 35. [score:3]
The role of miR-122 in suppressing CC cell invasion. [score:3]
The miR-122 expression of different cell lines was measured through qRT-PCR, the result showed that the expression level of miR-122 in QBC93 cells was lower than that in HCCC-9810 and RBE cells, indicating that the QBC93 cell line was suitable for the following experiment. [score:3]
The sequences of transfected miR-122 mimics, miR-122 inhibitors and miR-122-NC (designed and synthesized by Shanghai GenePharma Co. [score:3]
Our study also confirmed that the decreased expression of miR-122 was also associated with lymph node metastasis and distant metastasis. [score:3]
Expression of miR-122 in CC tissues and cell lines. [score:3]
After the transfection with miR-122 mimics, the miR-122 expression levels in QBC939 and RBE cells of the NC group, the Mock group and the Blank group were significantly lower than that of miR-122 mimic group (all P < 0.05). [score:3]
The relative expressions of miR-122 in HCCC-9810, RBE and QBC939 were (1.582 ± 0.088), (1.534 ± 0.047), and (0.968 ± 0.012), respectively. [score:3]
Our study also found that the role of miR-122 in antitumor activity is manifested in suppressing tumor cell invasion. [score:3]
Similarly, it was also previously reported that serum miR-122 level was an important indicator in the diagnosis of liver injury and could be used as a biomarker and therapeutic target for diagnosis and treatment of CC- 30. [score:3]
Detailed grouping information were as follows: the miR-122 mimic group was transfected with miR-122 mimics; the anti-miR-122 group was transfected with miR-122 inhibitors; the negative control (NC) group was transfected with miR-122-NC; the Mock group was transfected with reagent by using Lipofectin [TM] 2000; no transfection was performed on the Blank group. [score:3]
As the most abundant miRNA in the liver, miR-122 is well known for its biologic function in maintaining liver homeostasis, as well as its role in regulating cell growth, differentiation, apoptosis and metabolism in the carcinogenesis in the liver, which is detrimental to normal liver function 32 33. [score:2]
3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromid (MTT) assay detected the role of microRNA-122 (miR-122) in inhibiting QBC939 cell proliferation. [score:2]
However, compared to the NC group, Mock group and Blank group, QBC939 and RBE cell proliferations were both significantly inhibited in the miR-122 mimic group at the time points of 48 h and 72 h after the transfection (P < 0.05), while the cell proliferation was remarkably promoted in the anti-miR-122 group (Tables 3- 4 and Fig. 5). [score:2]
MiR-122 serves as functional miRNA involved in regulating lipid metabolism, cell differentiation, hepatic metabolism and hepatitis C virus replication 22. [score:2]
3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromid (MTT) assay detected the role of microRNA-122 (miR-122) in inhibiting RBE cell proliferation. [score:2]
The design of the experiment constituted a knockout mouse mo del mo deling the loss of miRNA in hepatocytes, and finally liver disruptions including steatosis, inflammation and hepatocyte apoptosis were identified, suggesting that miRNAs played a key role in the liver function and that miR-122 may be associated with hepatocarcinogenesis by influencing hepatocyte survival and tumor progression 23 24. [score:2]
MiR-122 expression level after transfection. [score:2]
The number of QBC939 cells migrating into Matrigel in the miR-122 mimic group (33.47 ± 3.292) was significantly smaller than that in the NC group (64.87 ± 4.42), the Mock group (67.87 ± 3.502) and the Blank group (65.53 ± 3.796) (all P < 0.05). [score:1]
The transfection efficiency of microRNA-122 (miR-122) observation in cholangiocarcinoma under fluorescence microscope. [score:1]
The relative expression level of miR-122 was calculated using 2 [−ΔΔCt] method. [score:1]
In contrast, the number of migrating cells in the miR-122 mimic group was significantly greater than that in the NC group (43.96 ± 2.567), the Mock group (45.76 ± 3.011) and the Blank group (43.42 ± 2.201), while the number in the anti-miR-122 group was significantly smaller than the latter three groups (all P < 0.05) (Fig. 9). [score:1]
Similarly, the rate of RBE cell apoptosis in the miR-122 mimics group and the anti-miR-122 group was (27.76 ± 0.31) % and (6.71 ± 0.10) %, respectively, which were significantly different from those in the NC group, the Mock group and the Blank group (all P < 0.05). [score:1]
Decreased level of miR-122 was detected in the CC patients, leading to the increased level of CCNG1, which is associated with accumulation of tumor cells via affecting cell cycle (http://wenku. [score:1]
However, the number of invasive QBC939 cells into Matrigel in anti-miR-122 group was (101.02 ± 5.92), significantly greater than those in the NC group, the Mock group and the Blank group (all P < 0.05). [score:1]
, Lowell, MA, USA); NCode [TM] miRNA First-Strand complementary DNA synthesis Kit (Invitrogen, Carlsbad, USA); Fast SYBR [®] Green Master Mix (Roche Diagnostics GmbH, Mannheim, Germany); Transwell chamber (Corning Costar, Tewksbury, MA, USA) and miR-122 mimic and negative control (NC) (Shanghai GenePharma Co. [score:1]
On the other side, the numbers of RBE cells migrating into Matrigel in the miR-122 mimic group and the anti-miR-122 group were (21.19 ± 3.292) and (71.21 ± 3.091), respectively. [score:1]
No significant difference in miR-122 level was found among the NC group, the Mock group and the Bland group (all P > 0.05) (Fig. 4 and Table 2). [score:1]
Transfection efficiency of miR-122 in CC QBC939 and RBE cell lines. [score:1]
The role of miR-122 in stimulating CC cell apoptosis. [score:1]
Previous evidence have shown that compared with adjacent benign liver, miR-122 appears to be down regulated in deficient liver, suggesting the potential of miR-122 as a novel biomarker for liver injury 28. [score:1]
The amplification curve of target gene miR-122 was in accordance with the smooth curve with four characteristic stages (baseline period, exponential phase, exponential phase, platform stage). [score:1]
Besides, in the miR-122 mimic group, the rate of QBC939 cell apoptosis was (21.63 ± 0.60) %, and in the anti-miR-122 group, the rate of QBC939 cell apoptosis was (4.11 ± 0.25) %, suggesting that rates of apoptosis in the NC group, the Mock group and the Blank group were significantly different from those in the miR-122 and the anti-miR-122 group (all P < 0.05). [score:1]
[1 to 20 of 61 sentences]
15
[+] score: 188
In previous knockdown studies, it has been shown that the inhibition of miR-122 expression leads to reduced cholesterol biosynthesis and an overall 25–30% reduction in TC levels without any signs of toxicity, suggesting it as a potential therapeutic target for hypercholesterolemia 19 39. [score:8]
However, their findings of up-regulated miR-122 cannot be compared directly with our data as there were no healthy controls included in their study design and the analysis was focused only on comparing miR-122 expression levels between patients of two different HCV genotypes. [score:6]
It has previously been reported that miR-122 levels are down-regulated in liver tissues infected with HCV genotype 1 and 2 33. [score:4]
We found that pre-treatment levels of hepatic miR-122 were significantly down-regulated in the SVR group in comparison with NR+RR (P = 0.01) and NR only (P = 0.002) groups (Fig. 4a). [score:4]
Similarly, in another recent report by Oliveria et al. 36 in which the authors used FFPE samples from HCV genotype 3 liver tissues, hepatic miR-122 levels were found to be up-regulated. [score:4]
The findings of Zhang et al. corroborate our data as they also noted significant up-regulation of serum miR-122 in CHC patients versus controls and significant positive correlations with ALT and AST levels. [score:4]
Hepatic miR-122 levels are down-regulated in CHC patients. [score:4]
Serum miR-122 levels are up-regulated in CHC patients. [score:4]
Up-regulation of serum miR-122 levels in the SVR group in comparison with those in the NR group has also been reported previously in HCV genotype 1-, 2- and 4-infected Taiwanese and Egyptian patients, respectively 26 44. [score:4]
The authors also observed a significant up-regulation of serum miR-122 and a significant correlation with elevated ALT and inflammatory scores. [score:4]
For the ∆Cq values to reflect actual/direct expression instead of the opposite, a modification of the Livak method was used where the Cq values of normalizers were subtracted from that of miR-122, instead of subtracting the Cq of miR-122 from the Cq of normalization controls. [score:4]
This is in agreement with the above reported down- and up-regulation of miR-122 levels in matched liver tissues and serum samples of CHC patients, respectively. [score:4]
This ratio of down-regulation of hepatic miR-122 was more profound and significant in CHC patients with higher ALT levels, increased necroinflammation, and fibrosis compared with those with comparatively lower ALT levels and with little, or moderate, liver damage. [score:3]
Moreover, both groups of CHC patients also showed a significant difference in the expression levels of miR-122 between each other (P = 9.03 × 10 [−7]), indicating that miR-122 expression is a more sensitive indicator of HCV infection than the routinely measured ALT levels (Fig. 1a). [score:3]
The expression levels of hepatic miR-122 were significantly correlated with the following clinicopathological features in chronic hepatitis C patients: (a) Necroinflammatory scores. [score:3]
In contrast, we observed a significant up-regulation of hepatic miR-122 levels in NR patients compared with those who achieved SVR status. [score:3]
A similar trend of up-regulation with was observed when the serum miR-122 levels of the normal ALT (P = 5.21 × 10 [−8]) and elevated ALT (P = 1.62 × 10 [−15]) CHC patient groups were compared with those of controls (Fig. 1b). [score:3]
A Spearman non-parametric rank test was used to determine the correlations, computed as the correlation coefficient r, between the expression levels of hepatic and serum miR-122 and the clinicopathological parameters. [score:3]
Although, it was beyond the scope of this study, it would be interesting to perform IL-28B genotyping on CHC genotype 3 patients, in parallel with miR-122 expression profiling. [score:3]
Based on the miR-122 release mo del, serum miR-122 levels are expected to rise with an increase in severity of disease and a decrease in hepatic miR-122 levels. [score:3]
The expression levels of serum miR-122 were significantly correlated with the following clinicopathological features in chronic hepatitis C patients: (a) Necroinflammatory scores. [score:3]
Relative expression levels of microRNA-122. [score:3]
How to cite this article: Butt, A. M. et al. Parallel expression profiling of hepatic and serum microRNA-122 associated with clinical features and treatment responses in chronic hepatitis C patients. [score:3]
Although correlations between lipid profile parameters and serum miR-122 levels have been recently reported in non-alcoholic fatty liver disease (NAFLD) and hyperlipidaemia 40, to our knowledge this is the first study to report a significant correlation between TC and serum miR-122 levels in CHC patients. [score:3]
This indicates that a decrease in hepatic miR-122 levels is potentially correlated with an increase of disease severity in CHC patients. [score:3]
We also found down-regulation of hepatic miR-122 levels in liver tissues of CHC patients infected with HCV genotype 3 as compared with those of healthy controls. [score:3]
In contrast to hepatic miR-122, serum miR-122 levels were found to be significantly up-regulated in CHC patients compared with those of controls (P = 1.52 × 10 [−14]). [score:3]
The differences in expression levels of hepatic (a) and serum (b) miR-122 were computed between SVR and NR groups. [score:3]
It was found that miR-122 levels were significantly down-regulated in CHC liver tissues compared with controls (P = 2.15 × 10 [−9]) (Fig. 1a). [score:3]
Interestingly, pre-treatment serum miR-122 levels were found to be significantly up-regulated in SVR compared with those in NR+RR and NR only group of patients, which was also further validated via logistic regression analysis showing that serum miR-122 levels remained independently associated with ETR in the SVR group of patients. [score:3]
Expression levels of hepatic and serum miR-122 in sustained virological responder (SVR) and non-responder (NR) groups. [score:3]
Boxes represent range, median and quartiles of the normalized miR-122 expression (∆Cq) levels. [score:3]
Serum miR-122 levels seem to be a sensitive predictor of disease progression and may possess more potential than the routinely performed biochemical tests for monitoring HCV -associated liver damage. [score:3]
Interestingly, in our data it was also observed that the majority of the clinicopathological features that were directly correlated with hepatic miR-122 levels were inversely correlated with serum miR-122 levels, with few exceptions. [score:2]
The expression levels of hepatic (a) and serum (b) miR-122 in chronic hepatitis C patients with normal and elevated alanine transaminase (ALT) levels were compared with those of healthy controls. [score:2]
In addition to the association of miR-122 with HCV, it is also known that miR-122 regulates several genes from different metabolic pathways, including cholesterol biosynthesis. [score:2]
For instance, pre-treatment expression of hepatic miR-122 has been reported to be decreased in NR compared with SVR patients of HCV genotypes 1 and 2 43. [score:2]
However, serum miR-122 levels showed a significant direct correlation with TC levels. [score:2]
Even though they were taken from non HCV-HCC patients, there is no information given on whether they were also negative for any other etiology, as hepatic miR-122 levels also tend to deregulate in case of HBV and non-viral HCC. [score:2]
The differences in deregulated levels of both hepatic and serum miR-122 levels between CHC patients and controls may be attributed to HCV infection. [score:2]
Furthermore, age and gender adjusted univariate and multivariate regression analyses were performed to determine the potential of miR-122 levels, and the clinical features of CHC patients, as predictors of ETR. [score:1]
Overall, this indicates that serum miR-122 has the potential to serve as a biomarker in case of CHC patients. [score:1]
In the case of lipid function parameters, a weakly positive significant correlation was noted between serum miR-122 and total cholesterol (TC) levels (r = 0.215, P = 0.017, 95% CI: 0.039 to 0.378) (Fig. 3c–j). [score:1]
In case of SVR and NR only groups, an increase in predictive potential of serum miR-122 was noted with an AUC of 0.840 (95% CI: 0.755–0.905; P < 0.0001; cut-off value: −8.18; sensitivity: specificity ratios: 72.7: 89.9%) (Fig. 5d). [score:1]
In univariate analysis, both hepatic and serum miR-122 levels, platelet count, PT, ALT, AST, alkaline phosphatase (ALP), TP, Alb, high-density lipoprotein (HDL) and low density lipoprotein (LDL) were identified as predictors of ETR. [score:1]
Although the exact mechanism of the decrease in miR-122 is not yet known in the case of liver damage, it has previously been proposed that miR-122, which is synthesized in hepatocytes, releases into the blood stream as a consequence of liver injury and/or a persistent inflammatory state 34. [score:1]
In agreement with our data, the ability of serum miR-122 to discriminate between normal and elevated ALT levels in genotype 1 CHC patients has also been reported previously 28. [score:1]
As the majority of CHC patients have stable and slightly elevated alanine transaminase (ALT) levels, we next determined whether miR-122 levels have any relationship with ALT levels. [score:1]
However, before suggesting miR-122 as a potential biomarker, we were interested to determine the level of sensitivity and specificity miR-122 offers compared with other biochemical factors, such as ALT, in CHC patients that also show deregulation after HCV infection. [score:1]
An initial study found that mouse serum miRNA-122 levels elevate in response to drug induced liver injury and this was proposed as a potential biomarker of liver damage 37. [score:1]
The diagnostic and prognostic potential of serum miRNA-122 in CHC patients. [score:1]
In summary, the results of the present study suggest that circulating levels of liver specific miR-122 reflect changes in hepatic miR-122 concentrations due to HCV infections. [score:1]
In agreement with logistic regression analysis, serum miR-122 ROC curve analysis between SVR: NR+RR and SVR: NR only groups also revealed its prognostic potential to discriminate between these groups. [score:1]
In contrast to this, ALT showed no significant prognostic value in case of SVR versus NR+RR (P > 0.05) (Fig. 5c) and SVR versus NR only (P > 0.05) (Fig. 5d) group of patients, indicating overall superiority of serum miR-122 levels in differentiating responders from non-responders. [score:1]
Therefore, we performed correlation analyses on hepatic and serum miR-122 levels and lipid related features. [score:1]
In contrast to hepatic miR-122 levels, serum miR-122 levels showed no significant correlation with fibrosis scores (r = −0.03, P > 0.05). [score:1]
In contrast to our and previously reported decreased hepatic miR-122 levels, no significant differences were observed in hepatic miR-122 levels between CHC patients and controls by Bostjancic et al. 35. [score:1]
Univariate and multivariate logistic regression analyses were performed to determine the association between hepatic and serum miR-122 levels, clinicopathological features, and with ETR. [score:1]
For instance, hepatic miR-122 levels were significantly correlated with fibrosis scores, whereas no correlation was observed between fibrosis and serum miR-122 levels. [score:1]
The lack of correlation between serum miR-122 and fibrosis has also been reported previously in genotype 1 CHC patients 31 which is in agreement to our data. [score:1]
At the cut-off value of −10.32, miR-122 had sensitivity and specificity ratio of 87.0% and 96.7% respectively. [score:1]
Hepatic miR-122 levels were significantly correlated with the necroinflammation grading (r = −0.493, P = 6.79 × 10 [−9], 95% CI: −0.616 to −0.346) and fibrosis staging (r = −0.215, P = 0.015, 95% CI: −0.378 to −0.0398) scores (Fig. 2a,b). [score:1]
However, unlike our study, neither of these studies analysed hepatic miR-122 levels in relation to ETR in matched liver tissues, so it is not known what correlation hepatic miR-122 might have with ETR in these studies. [score:1]
For instance, Wang et al. 29 did not observe any correlation of serum miR-122 with any of the clinical parameters including ALT and histopathology findings of HCV genotype 1 CHC patients 29. [score:1]
This indicates a potentially low significance of serum miR-122 as a fibrosis specific biomarker in CHC patients. [score:1]
Correlation analysis of hepatic miR-122. [score:1]
To evaluate the potential of hepatic miRNA-122 levels to indicate ongoing CHC -associated liver damage and disease severity, we correlated miR-122 levels with the histopathology index (HAI) and liver function parameters. [score:1]
Conversely, Estrabaud et al. 25 observed no correlation between pre-treatment decreased levels of hepatic miR-122 and ETR. [score:1]
A significant inverse correlation was noted in our study of miR-122 levels between matched tissue and serum samples of CHC patients, which favoured this hypothesis. [score:1]
The significant correlation of ETR with hepatic miR-122 levels indicates that it could serve as a predictive marker of ETR in CHC patients. [score:1]
Among the analysed biochemical parameters, hepatic miR-122 levels showed significant correlations with prothrombin time (PT) (r = −0.282, P = 0.002, 95% CI: −0.438 to −0.111), international normalized ratio (INR) (r = −0.272, P = 0.001, 95% CI: −0.438 to −0.112), ALT (r = −0.559, P = 1.8 × 10 [−11], 95% CI: −0.670 to −0.424), aspartate transaminase (AST) (r = −0.518, P = 1.204 × 10 [−9], 95% CI: −0.637 to −0.374), AST/ALT ratio (r = 0.372, P = 2.3 × 10 [−5], 95% CI: 0.208 to 0.515), total proteins (TP) (r = −0.185, P = 0.040, 95% CI: −0.351 to −0.00840), and gamma-glutamyl transferase (γ-GT) (r = −0.256, P = 5.0 × 10 [−3], 95% CI: −0.416 to −0.0812) (Fig. 2c–i). [score:1]
It was observed that serum miR-122 had a robust potential to discriminate CHC patients (including both normal and elevated ALT patients) from healthy controls with an area under the curve (AUC) of 0.954 (95% CI: 0.907–0.981; P < 0.0001). [score:1]
It is interesting to note that in a previous study no correlation between any lipid profile parameters and serum miR-122 levels in genotype 1 CHC patients was found 26. [score:1]
A significant inverse correlation (r = −0.395, P = 3.6 × 10 [−5]) was observed between the levels of hepatic and serum miR-122 in CHC patients. [score:1]
Shortly after that Bihrer et al. 31 expression profiled serum miRNA-122 in CHC patients (genotypes 1 and 2) and investigated their correlation with various clinical parameters. [score:1]
However, there was no significant difference of either hepatic and serum miR-122 levels between SVR and RR only groups (P > 0.05). [score:1]
Hepatic miR-122 levels correlate with necroinflammation, fibrosis, and clinicopathological features of CHC patients. [score:1]
Pre-treatment hepatic and serum miR-122 levels correlate with ETR in CHC patients. [score:1]
Interestingly, serum miR-122 also maintained its ability to differentiate between CHC patients with normal ALT levels and healthy controls. [score:1]
Serum miR-122 levels correlate with necroinflammation and clinicopathological features but not with fibrosis in CHC patients. [score:1]
Serum miR-122 levels were found to be positively correlated with necroinflammation grading scores (r = 0.407, P = 3.0 × 10 [−6], 95% CI: 0.248 to 0.545) (Fig. 3a). [score:1]
The amplification cycling conditions were: 95 °C for 15 min, followed by 40 cycles of 94 °C for 15 s, 55 °C for 30 s and 70 °C for 30 s. The relative expression levels, of hepatic and serum miR-122 were calculated using a 2 [∆∆Cq] method where, ∆∆Cq = ∆Cq (Cq [RNU6B] − Cq [miR-122]) [CHC] − ∆Cq (Cq [RNU6B] − Cq [miR-122]) [Controls] and ∆∆Cq = ∆Cq (Cq [cel-miR-39] − Cq [miR-122]) [CHC] − ∆Cq (Cq [cel-miR-39] − Cq [miR-122]) [Controls], respectively. [score:1]
Hence, at this stage, it is not clear whether observed differences in hepatic miR-122 levels were due to some actual biological aspect or the influence of the choice of samples selection and preservation approaches. [score:1]
As the focus was to elucidate a non-invasive diagnostic biomarker potential of miR-122, ROC curves were constructed for serum miR-122, which was found to be superior to ALT in discriminating CHC patients from healthy controls. [score:1]
The findings of a correlation analysis between hepatic miR-122 and clinicopathological features also favours the above described miR-122 release mo del, as hepatic miR-122 levels were found to be significantly associated with liver function parameters and histopathological scores in our study cohort. [score:1]
Hepatic and serum miR-122 levels correlate with each other in CHC patients. [score:1]
RNU6B and cel-miR-39 were used as normalization controls for miR-122 levels in tissue and serum samples respectively. [score:1]
Due to the significance of miR-122 in HCV infections, the association between hepatic miR-122 expression and ETR has been evaluated in some recent reports. [score:1]
Correlation analysis of serum miR-122. [score:1]
To determine whether pre-treatment levels of hepatic and serum miR-122 correlate with, and potentially serve as a predictive marker of, ETR to PEG-INF/RBV therapy in CHC patients, CHC patients were divided into responder (SVR) (n = 70) and non-responder (NR+RR) (n = 53) groups according to their ETR status (Table 1). [score:1]
In the case of liver function parameters, serum miR-122 levels were significantly positively correlated with PT (r = 0.325, P = 2.0 × 10 [−4], 95% CI: 0.157 to 0.475), INR (r = 0.323, P = 3.0 × 10 [−4], 95% CI: 0.157 to 0.477), ALT (r = 0.684, P = 2.70 × 10 [−18], 95% CI: 0.577 to 0.768), AST (r = 0.661, P = 1.56 × 10 [−16], 95% CI: 0.547 to 0.751), albumin (Alb) (r = 0.185, P = 0.043, 95% CI: 0.006 to 0.352), γ-GT (r = 0.351, P = 7.8 × 10 [−5], 95% CI: 0.184 to 0.499) and significantly negatively correlated with the AST/ALT ratio (r = −0.408, P = 3.0 × 10 [−6], 95% CI: −0.545 to −0.248). [score:1]
Overall, we propose that elevated pre-treatment serum miR-122 levels have the potential to predict ETR in genotype 3 CHC patients. [score:1]
Furthermore, ROC curve analysis for the prognostic significance of serum miR-122 in the SVR and NR+RR groups showed that miR-122 had an AUC of 0.796 (95% CI: 0.714–0.863; P < 0.0001; cut-off value: −7.79; sensitivity: specificity ratios: 69.8: 80.0%) (Fig. 5c). [score:1]
However, under multivariate analysis, only serum miR-122 and ALP remained independently associated with ETR (Table 2). [score:1]
Interestingly, serum miR-122 maintained its differentiating potential between CHC patients with normal ALT levels and healthy controls with an AUC of 0.877 (95% CI: 0.779–0.942; P < 0.001; cut-off value: −10.32; sensitivity: specificity ratio: 67.4: 96.7%) (Fig. 5b). [score:1]
First, we quantified the levels of miR-122 in matched tissue and serum samples of the same patients. [score:1]
No significant correlation was observed between hepatic miR-122 and lipid profile parameters. [score:1]
[1 to 20 of 97 sentences]
16
[+] score: 172
Because it has been reported that several nonhepatic cell lines allowed HCV replication due to miR-122 expression (HEK293T cells [15, 16] and Hec1B cells [16]), we delivered miR-122 into Vero cells, which allowed Human kidney-derived HEK293 cells also supported HCV replication when miR-122 was expressed, but another human kidney-derived cell line, 786-O, did not support HCV replication even when miR-122 was expressed. [score:7]
Download Figure S3, TIF file, 0.1 MB Figure S4  Effect of expression of SEC14L2 on (A) Expression levels of SEC14L2 in Vero/miR122+SRBI+ApoE cells, Vero/miR122+SRBI+ApoE+LV-SEC14L2 cells, and Huh-7.5.1 cells. [score:5]
Because the cell clones obtained expressed miR-122 at different levels, we selected the Vero cell clone that had the highest miR-122 expression level and designated it Vero/miR122. [score:5]
Ectopic expression of human SEC14L2 increased intracellular HCV core Ag levels in Vero/miR122+SRBI+ApoE cells after HCV RNA transfection (Fig.  S4B), suggesting that human SEC14L2 expression could enhance To establish a novel HCV cell culture system using non-cancer-derived cells, we tested the susceptibility to HCV infection and replication in several vaccine producer cell lines: CHO cells (derived from Chinese hamster ovary), MDCK cells (derived from canine kidney), MRC-5 cells (derived from healthy human lung tissue), and Vero cells (derived from monkey kidney). [score:5]
The expression of miR-122 was also lacking in 786-O cells, and the ectopic expression of miR-122 (786-O/miR122) did not allow HCV replication after HCV RNA transfection (Fig.  S1B and S1C). [score:5]
In the experiments with HCVpp, HCVpp infection was completely recovered by both hCLDN1 and vCLDN1 expression in HEK293/miR122 cells and partially recovered by both hCD81 and vCD81 expression in Huh7-25 cells (Fig.  3A). [score:5]
Ectopic expression of human SEC14L2 increased intracellular HCV core Ag levels in Vero/miR122+SRBI+ApoE cells after HCV RNA transfection (Fig.  S4B), suggesting that human SEC14L2 expression could enhance To establish a novel HCV cell culture system using Vero cells, we assessed several host factors for their contribution to each step of the HCV life cycle and identified three important molecules: miR-122, SRBI, and ApoE. [score:5]
Chang J, Nicolas E, Marks D, Sander C, Lerro A, Buendia MA, Xu C, Mason WS, Moloshok T, Bort R, Zaret KS, Taylor JM 2004 miR-122, a mammalian liver-specific microRNA, is processed from hcr mRNA and may downregulate the high affinity cationic amino acid transporter CAT-1. RNA Biol 1: 106– 113. doi: 10.4161/rna. [score:4]
To assess the function of ApoE originally expressed in Vero cells, we cloned Vero- and human-derived ApoE (vApoE and hApoE, respectively) and compared the effects of these molecules on infectious virus production by introducing them into HEK293/miR122 cells because ApoE expression in these cells was negligible. [score:4]
The expression of miR-122 enhances the replication efficiency, SRBI is essential for infection, and ApoE is indispensable for the production of infectious HCV. [score:3]
Fukuhara T, Kambara H, Shiokawa M, Ono C, Katoh H, Morita E, Okuzaki D, Maehara Y, Koike K, Matsuura Y 2012 Expression of microRNA miR-122 facilitates an efficient replication in nonhepatic cells upon infection with hepatitis C virus. [score:3]
Therefore, in the case of Vero cells, the level of expression of these factors (miR-122, SRBI, and ApoE) is important for HCV susceptibility and restricts the host and organ tropisms. [score:3]
Furthermore, additional hCLDN expression in Vero/miR122+LV-hSRBI cells enhanced HCVpp infection but did not increase the number of HCV -positive cells after HCVcc infection (Fig.  3C and D and Fig.  S2B). [score:3]
Overexpression of hCD81 or hOCLN in Vero/miR122 did not enhance HCVpp or HCVcc infection (Fig.  3C and D and Fig.  S2B). [score:3]
The ectopic expression of miR-122 enabled HCV replication after HCV RNA transfection (HEK293/miR122 [Fig.  S1B and S1D]). [score:3]
These results indicated that the established Vero cell line expressing miR-122, SRBI, and ApoE together could support the entire life cycle of HCV. [score:3]
We identified miR-122 as an essential factor for We obtained Vero/miR122 cells that highly expressed miR-122 via transduction with miR-122, and we observed HCV replication in these cells, although the level was still lower than that in Huh-7.5.1 cells. [score:3]
FIG 1  HCV replication in Vero cells expressing miR-122. [score:3]
After single-cell cloning, we obtained a Vero cell clone that expressed miR-122, hSRBI, and hApoE (Vero/miR122+SRBI+ApoE). [score:3]
Because the CLDN1 expression level was slightly lower in the Vero cells than in the Huh-7.5.1 cells (Fig.  2C), we also investigated the effect of hCLDN1 expression in Vero/miR122 cells (Vero/miR122+LV-hCLDN1) on HCVpp and HCVcc infection. [score:3]
Thus, miR-122 expression does not always lead to HCV replication in every cell line, and the existence of other factors involved in HCV replication is likely. [score:3]
HEK293 cells also do not express miR-122. [score:3]
Although hCLDN1 expression significantly enhanced HCVpp infection (Fig.  3C), it did not enable HCVcc infection in Vero/miR122 cells (Fig. 3D). [score:3]
FIG 5  Coexpression of miR-122, SRBI, and ApoE enabled HCV infection, replication, and virus production in Vero cells. [score:3]
The miR-122 expression level in these cell lines became higher than that in Huh-7.5.1 cells after lentiviral transduction (Fig.  1B). [score:3]
The level of expression of miR-122 in Huh-7.5.1 cells is indicated by the dashed line. [score:3]
The expression levels of these molecules in Vero/miR122+SRBI+ApoE cells were higher (miR122 and SRBI) or similar (ApoE) to the levels in Huh-7.5.1 cells (Fig.  5A and B). [score:3]
Finally, we created a Vero cell line that expressed the essential factors miR-122, SRBI, and ApoE; the entire HCV life cycle, including infection, replication, and infectious virus production, was completed in these cells. [score:3]
However, Vero cells that expressed miR-122 still did not allow HCV infection. [score:3]
FIG 2  (A) HCVcc infection into Vero cells expressing miR-122 and four HCV receptors. [score:3]
The dashed lines indicate the miR-122 expression level in Huh-7.5.1 cells. [score:3]
The expression of microRNA 122 (miR-122), an essential factor for HCV replication, is notably low in Vero cells. [score:3]
Huh-7.5.1, Vero, and Vero/miR122+SRBI+ApoE cells were lysed, and protein expression was confirmed by Western blotting. [score:3]
Then, we tested the effect of SEC14L2 on The gene expression level of SEC14L2 in Vero/miR122+SRBI+ApoE cells was more than 10-fold higher than that in Huh-7.5.1 cells (see Fig.  S4A in the supplemental material). [score:3]
The expression level of miR-122 in Vero/miR122 cells was approximately 10-fold higher than that in Huh-7.5.1 cells (Fig.  1C). [score:3]
The expression of either hSRBI or vSRBI did not enhance the susceptibility to HCVpp infection in Vero/miR122 cells. [score:3]
For example, HEK293T cells are human kidney-derived cells, and the ectopic expression of microRNA 122 (miR-122) and Claudin-1 (CLDN1) enabled HCV replication after HCV infection of HEK293T cells (16). [score:3]
The expression levels of ApoE in HEK293/miR122+hApoE and HEK293/miR122+vApoE cells were comparable to that in Huh-7.5.1 cells (Fig.  4D). [score:3]
To establish a Vero cell line that supported the entire HCV life cycle, miR-122, hSRBI, and hApoE were expressed in Vero cells via lentiviral transduction. [score:3]
A slight, time -dependent increase in the HCV core Ag was observed in miR-122-transduced Vero cells, indicating that Vero cells expressing miR-122 supported HCV replication at a low level after HCV RNA transfection (Vero+LV-miR122 [LV stands for lentivirus] in Fig.  1A). [score:3]
The expression level of hApoE in Vero/miR122+hApoE cells was higher than in Huh-7.5.1 cells (Fig.  4G). [score:3]
Then, we established a Vero cell clone that expressed hApoE in addition to miR-122 (Vero/miR122+hApoE). [score:3]
The mRNA expression level of apolipoprotein E (ApoE) was low in parental Vero and Vero/miR122 cells compared with Huh-7.5.1 cells (Fig.  4C). [score:2]
Because the miR-122 expression level in these cells was quite low compared to the levels in Huh-7.5.1 cells (Fig.  1B), we introduced miR-122 into these cells via lentiviral transduction. [score:2]
After HCV RNA transfection, intracellular HCV core Ag levels in HEK293/miR122 and HEK293/miR122+hApoE cells were similar and slightly lower than in HEK293/miR122+vApoE cells (Fig.  4E). [score:1]
We introduced Vero- or Huh-7.5.1-derived SRBI (vSRBI or hSRBI, respectively) into Vero/miR122 cells via lentiviral transduction. [score:1]
Download Figure S2, TIF file, 0.2 MB Figure S3  HCVcc infection of Vero cells, Vero/miR122+SRBI+ApoE cells, and Huh-7.5.1 cells. [score:1]
After HCV RNA transfection, the HCV core Ag level in Vero/miR122 cells increased in a time -dependent manner and was 70 times higher than that in Vero+LV-miR122 cells but still 17.7-fold lower than that in Huh-7.5.1 cells at 3 days after transfection (Fig.  1D). [score:1]
Then, we tested the susceptibility for HCV replication in these cells in which miR-122 had been introduced. [score:1]
Although Vero/miR122 cells supported HCV replication after HCV RNA transfection (Fig.  4A), no infectivity was detected in the cell culture medium (Fig.  4B). [score:1]
The liver-specific miR-122 is an important host factor for HCV replication. [score:1]
However, infectivity could be detected only in the medium of HEK293/miR122+hApoE cells (Fig.  4F). [score:1]
After HCVcc infection, HCV -positive cells were observed in Vero/miR122+SRBI+ApoE cells; however, the susceptibility of Vero/miR122+SRBI+ApoE cells to infection did not reach that of Huh-7.5.1 cells (Fig.  5C; see Fig.  S3 in the supplemental material). [score:1]
In conclusion, we demonstrated that miR-122, SRBI, and ApoE were necessary and sufficient for the completion of the entire HCV life cycle in nonhuman, nonhepatic Vero cells. [score:1]
Vero cells, Vero/miR122 cells, and Vero/miR122+LV-4Receptors cells were infected with HCVcc, HCV -positive cells were visualized with anti-NS5A antibody (green), and nuclei were visualized with DAPI (blue). [score:1]
HCV NS5A -positive Vero cells were detected via immunostaining at 3 days after HCV RNA transfection (Fig.  1E), indicating that Vero/miR122 cells supported efficient HCV replication after HCV RNA transfection. [score:1]
Infectivity was detected in the medium of Vero/miR122+hApoE cells, although the titer was lower (by approximately 4 log units) than in Huh-7.5.1 cells (Fig.  4I). [score:1]
Four HCV receptor-transduced bulk Vero cells, designated Vero/miR122+LV-4Receptors, became susceptible to infection with HCVcc (Fig.  2A) and HCV pseudotype virus (HCVpp) (Fig.  2B). [score:1]
Similar results were also observed in both hCLDN1- and vCLDN1-transduced HEK293/miR122 cells (Fig.  3B, middle panels) and in both hSRBI- and vSRBI-transduced Vero/miR122 cells (Fig.  3B, bottom panels). [score:1]
After HCV RNA transfection, the intracellular HCV core Ag level in Vero/miR122+hApoE cells was slightly higher than that in Vero/miR122 cells (Fig.  4H). [score:1]
After HCV RNA transfection, the intracellular HCV core Ag levels increased in a time -dependent manner in Vero/miR122+SRBI+ApoE cells (Fig.  5D), similar to that in Vero/miR122 cells (Fig.  1B). [score:1]
To establish a Vero cell line that supported more efficient HCV replication, we performed single-cell cloning of miR-122-transduced bulk Vero cells (Vero+LV-miR122). [score:1]
Though Vero/miR122 cells supported HCV replication, HCV -positive cells were not observed after HCVcc infection (Fig.  2A). [score:1]
We introduced Vero- or Huh-7.5.1-derived CLDN1 (vCLDN1 or hCLDN1, respectively) into HEK293/miR122 cells via lentiviral transduction. [score:1]
Furthermore, infectivity could be detected in the medium of Vero/miR122+SRBI+ApoE cells, although the infectivity titer in the medium of Vero/miR122+SRBI+ApoE cells was still lower than that in Huh-7.5.1 cells (Fig.  5E). [score:1]
Then, we introduced four human HCV receptors, CD81, occludin (OCLN), CLDN1, and scavenger receptor class B type I (SRBI), into Vero/miR122 cells via lentiviral transduction. [score:1]
Therefore, we supplemented Vero cells with miR-122 and found that HCV replication was enhanced. [score:1]
Furthermore, the sequence of mature miR-122 is conserved across species from fish to mammals (33). [score:1]
[1 to 20 of 68 sentences]
17
[+] score: 171
To determine whether miR-122 inhibited apoptosis in the corneal keratocytes through CPEB1 downregulation, we treated the corneal keratocyte cell line with inflammatory cytokines and transfected a CPEB1 overexpression plasmid carrying either a wild-type (CPEB1-WT) or miR-122 -binding site-mutated (CPEB1-Mu) 3′-UTR. [score:8]
Although our results showed that miR-122 inhibited apoptosis in corneal stromal cells and significantly decreased the risk of corneal transplantation rejection by reducing the expression of its target CPEB1, whether miR-122 exerts its function only through CPEB1 and the pathways by which CPEB1 regulates corneal stromal cell apoptosis remain unknown. [score:8]
miR-122 overexpression significantly downregulated CPEB1 mRNA (Figure 2d) and protein (Figure 2e) expression compared with the control group. [score:7]
Our results revealed that the inhibition of miR-122 expression or increased CPEB1 expression in a corneal keratocyte cell line significantly increased apoptosis induced by inflammatory cytokines. [score:7]
To further confirm that miR-122 regulates CPEB1 expression, we performed real-time PCR and western blotting to compare CPEB1 expression in the corneal autograft and allograft groups. [score:6]
To validate CPEB1 as a target of miR-122, CPEB1 3′-untranslated regions (UTRs) with or without mutations in the miR-122 -binding site were inserted into the pmiR-RB-REPORT dual-luciferase reporter plasmid. [score:6]
We also confirmed that miR-122 suppressed corneal keratocyte apoptosis through downregulation of CPEB1. [score:6]
Our dual-luciferase reporter assay showed that miR-122 overexpression significantly downregulated the fluorescence of the reporter plasmid containing the wild-type CPEB1 3′-UTR but not the CPEB1 3′-UTR with mutations in the miR-122 -binding sites (Figure 2a). [score:6]
CPEB1, an important mediator of cell ageing and apoptosis, [18–20] was identified as the target gene of both miR-122 and miR-1a, two miRNAs that were downregulated in the allograft group. [score:6]
These results indicate that miR-122 inhibited apoptosis in corneal keratocytes through the downregulation of CPEB1. [score:6]
Our current study revealed that miR-122 expression was significantly downregulated during rejection after keratoplasty. [score:6]
Inhibition of miR-122 expression increased CPEB1 expression (Figure 4a) and promoted cytokine -induced apoptosis in the corneal keratocytes (Figure 4b) compared with the control group. [score:6]
miR-122 was highly expressed in the corneal stromal layer and was not expressed in immune cells. [score:5]
Our results revealed high expression of miRNA-122 in the corneal stromal cells but no expression in immune cells (Figure 3). [score:5]
To examine the effects of miR-122 on apoptosis in corneal keratocytes, we suppressed miR-122 expression using antagomir-122 and treated the cells with inflammatory cytokines. [score:5]
Further investigations demonstrated that miR-122 blocked apoptosis in corneal keratocytes and thus reduced the risk of immune rejection after keratoplasty through the downregulation of its target, cytoplasmic polyadenylation element -binding protein-1 (CPEB1). [score:4]
However, the downregulation of miR-122 may only be correlated with such rejection. [score:4]
Furthermore, local overexpression of miR-122 in the eye, which was accompanied by decreased expression of CPEB1, significantly increased the survival of the mouse grafts compared with the control group. [score:4]
miR-122 blocks apoptosis in a mouse corneal keratocyte cell line through the downregulation of CPEB1. [score:4]
To confirm the involvement of miR-122 in postoperative rejection in different cell types, we examined miR-122 expression in a variety of immune cells and three layers of mouse corneal tissue (the epithelial, stromal and endothelial layers). [score:3]
CPEB1 was a target of miR-122. [score:3]
40, 41 Total RNA was extracted using TRIzol lysis buffer (Invitrogen Life Technologies, Grand Island, NY, USA) from the following tissues and cells: (1) mouse corneal cells of the epithelial, stromal and endothelial layers; (2) corneas at 14 days after corneal transplantation with or without miR-122 overexpression (agomir-122, 20  μM; Guangzhou RiboBio Co. [score:3]
We also overexpressed miR-122 in the TKE2 mouse corneal epithelial cell line and measured CPEB1 expression using real-time PCR and western blotting. [score:3]
Increased miR-122 expression significantly reduces the risk of corneal transplantation rejection. [score:3]
Using miRNA expression profile analysis, this study showed that miR-122 is an important miRNA that was negatively correlated with corneal transplantation rejection. [score:3]
In addition, miR-122 exhibited the largest expression difference among all eight miRNAs identified. [score:3]
Similar results were obtained after miR-122 overexpression (Figure 5b). [score:3]
CPEB1 has been reported to be a target gene of miR-122 in skin fibroblasts. [score:3]
To investigate whether increased miR-122 expression can reduce corneal cell apoptosis and thus decrease the risk of corneal transplantation rejection, we established a mouse PKP mo del and treated mice with either the agomir negative control or agomir-122 (to increase the expression of miR-122). [score:3]
TKE2 (mouse corneal epithelial progenitor cell line) cells were transiently transfected with constructs containing wild-type or miR-122 -binding site-mutated 3′-UTR together with or without miR-122 overexpression using Lipofectamine LTX transfection reagent (Invitrogen, Grand Island, NY, USA). [score:3]
The significance of differences in CPEB1 and miR-122 expression, luciferase activity and apoptosis rate was determined by Student’s t-test. [score:3]
Expression of miR-122 is enriched in corneal stromal cells. [score:3]
Alternatively, miR-122 may directly regulate corneal transplantation rejection. [score:3]
miR-122 has important regulatory roles in physiological functions of the liver, including the growth cycle and lipid metabolism of hepatocytes. [score:2]
miR-122 is considered a liver-specific miRNA; [28–32] its expression level accounts for >70% of all miRNAs in the liver. [score:2]
[39] As CPEB1 has important roles in cell ageing and apoptosis, [18–20] we investigated whether miR-122 regulates corneal stromal cell apoptosis through the reduction of CPEB1 expression. [score:2]
Site-directed mutagenesis of the miR-122 -binding site was performed using the QuickChange kit (Stratagene, Santa Clara, CA, USA) according to the manufacturer’s instructions. [score:2]
Mouse full-length CPEB1 cDNA with a wild-type or miR-122 -binding site-mutated 3′-UTR was cloned into the pZSGreen lentiviral vector. [score:1]
U6 and GAPDH were used as the internal controls for miR-122 and CPEB1 detection, respectively. [score:1]
Alternatively, cells were transfected with a plasmid carrying CPEB1 cDNA with wild-type or miR-122 -binding site-mutated 3′-UTR. [score:1]
Nevertheless, our results indicate that miR-122 is closely associated with corneal transplantation rejection and may have important roles in this process. [score:1]
The microarray result for miR-122 (Figure 1d) was further validated by real-time PCR. [score:1]
Therefore, we next focused on corneal keratocytes to study the functions and mechanisms of miR-122 in corneal transplantation rejection. [score:1]
To elucidate the mechanism underlying the role of miR-122 in corneal transplantation rejection, we evaluated the expression of miR-122 in three types of corneal cells and four types of immune cells with or without stimulation. [score:1]
Therefore, miR-122 and CPEB1 were chosen for further study. [score:1]
miR-122 is an important miRNA associated with corneal transplantation rejection. [score:1]
To investigate the mechanism of miR-122 in corneal transplantation rejection, we first performed bioinformatics analyses and cross-predictions to identify CPEB1 as a miR-122 target in corneal cells. [score:1]
Therefore, the subsequent study focused on the effects of miR-122 on the biology of corneal keratocytes. [score:1]
The role of miR-122 in corneal cells has not been reported. [score:1]
[1 to 20 of 49 sentences]
18
[+] score: 170
The seed target nucleotides and the so-called supplementary binding region are separated by the SL I in target site 1, and by some intervening nucleotides conserved not to pair to miR-122 in target site 2. Due to the conserved proximity of both target sites in the HCV 5′ UTR, the two miR-122/Ago2 complexes bind cooperatively to these sites (Thibault et al., 2015; Nieder-Röhrmann et al., 2017). [score:9]
microRNA-122 target sites in the hepatitis C virus RNA NS5B coding region and 3′ untranslated region: function in replication and influence of RNA secondary structure. [score:5]
Cooperative enhancement of translation by two adjacent microRNA-122/Argonaute 2 complexes binding to the 5 untranslated region of Hepatitis C Virus RNA. [score:5]
Continuous pairing of miR-122 to its target sites appears to be counter selected by evolution (Fricke et al., 2015), likely to avoid cleavage of fully hybridized target HCV RNA genomes by the slicer activity of the Ago2 protein (Schirle et al., 2014). [score:5]
The seed region of miR-122 (nucleotides 2–7 or 2–8) binds to the target sequence (A)CACUCC, and the miR-122 supplementary region binds to a variable number of target nucleotides. [score:5]
While the mechanisms of translation stimulation by the miR-122/Ago2 complexes binding to the 5′ UTR are not yet clear, changes in RNA template stability were shown not to be the primary cause for the effect of miR-122 on HCV translation (Henke et al., 2008; Bradrick et al., 2013; Huys et al., 2013; Roberts et al., 2014; Nieder-Röhrmann et al., 2017). [score:5]
Ago2 crosslink-immunoprecipitation (CLIP) experiments have shown that Ago2 binds mainly to the HCV 5′ UTR miR-122 target sites but also to the NS5B and 3′ UTR target sites (Luna et al., 2015). [score:5]
Single-stranded miR-122 guide strand can induce a conformational change in HCV 5′ UTR structure by displacing this inhibitory hybridization in vitro (Diaz-Toledano et al., 2009), whereas the displacement of this inhibitory interaction by invading miR-122 appears to be of minor importance in vivo (Goergen and Niepmann, 2012). [score:5]
However, it should be mentioned here that a sequence at the base of SL VI in the core coding region can hybridize to a sequence overlapping with both 5′ UTR miR-122 binding sites and was reported to inhibit HCV translation (Wang et al., 2000; Kim et al., 2003) (Figure 2A). [score:5]
Contradictory results have been published about possible roles of the NS5B and 3′ UTR miR-122 binding sites in regulation of translation and replication (Henke et al., 2008; Nasheri et al., 2011; Gerresheim et al., 2017). [score:4]
Requirements for human Dicer and TRBP in microRNA-122 regulation of HCV translation and RNA abundance. [score:4]
miR-122, a mammalian liver-specific microRNA, is processed from hcr mRNA and may downregulate the high affinity cationic amino acid transporter CAT-1. RNA Biol. [score:4]
Regulation of hepatitis C virus translation and infectious virus production by the microRNA miR-122. [score:4]
miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. [score:4]
Regulation of hepatitis C virus genome replication by Xrn1 and MicroRNA-122 binding to individual sites in the 5′ untranslated region. [score:3]
The P body protein LSm1 contributes to stimulation of hepatitis C virus translation, but not replication, by microRNA-122. [score:3]
miR-122 stimulates hepatitis C virus RNA synthesis by altering the balance of viral RNAs engaged in replication versus translation. [score:3]
microRNA-122 stimulates translation of hepatitis C virus RNA. [score:3]
miR-122 (Nasheri et al., 2011) as well as miR-122/Ago2 complexes (Gerresheim et al., 2017) bind to these sites, while binding strength depends on local RNA structure, which may change depending on local RNA function, e. g., during translation (Gerresheim et al., 2017). [score:3]
3) and the miR-122 target site in the 3′ UTR (S3) with solid boxes (Fricke et al., 2015). [score:3]
Differential stimulation of hepatitis C virus RNA translation by microRNA-122 in different cell cycle phases. [score:3]
It has been speculated that miR-122 affects the switch from translation to replication, the displacement of the plus strand RNA from its minus strand template following replication, the modulation of binding of RNA binding proteins and the recruitment of the HCV RNA to replication complexes (Sarnow and Sagan, 2016). [score:3]
A downstream function during HCV translation stimulation by miR-122 may involve the P body protein LSm1 (Roberts et al., 2014). [score:3]
Later, it was shown that one such effector function of miR-122 is the stimulation of HCV translation (Henke et al., 2008), confirmed by several other studies (Bung et al., 2010; Jangra et al., 2010b; Roberts et al., 2011, 2014; Wilson et al., 2011; Fehr et al., 2012; Goergen and Niepmann, 2012; Zhang et al., 2012; Bradrick et al., 2013; Conrad et al., 2013; Huys et al., 2013; Nieder-Röhrmann et al., 2017). [score:3]
Modulation of hepatitis C virus RNA accumulation and translation by DDX6 and miR-122 are mediated by separate mechanisms. [score:3]
In vivo, Argonaute (Ago) protein, a key component of microRNA–protein (miRISC) complexes (Schirle et al., 2014), confers binding of the two miR-122 molecules to these target sites (Roberts et al., 2011; Wilson et al., 2011; Shimakami et al., 2012a; Conrad et al., 2013). [score:3]
Stimulatory (green) and inhibitory (red) long-range RNA -RNA interactions (LRIs) and binding sites for the liver-specific microRNA-122 (miR-122) (blue boxes) are shown. [score:3]
Stimulation of hepatitis C virus RNA translation by microRNA-122 occurs under different conditions in vivo and in vitro. [score:3]
By binding miR-122, the replicating HCV RNA sequesters miR-122 from its natural cellular mRNA targets (Luna et al., 2015), thereby possibly interfering with the fine-tuning of cellular metabolism (Krützfeldt et al., 2005; Esau et al., 2006) and the differentiation status of the hepatocytes (McGivern and Lemon, 2011). [score:3]
There are five to six target sites for miR-122 in the HCV RNA genome (Figure 1), depending on genotype (Fricke et al., 2015). [score:3]
Then, binding of miR-122/Ago2 to the first binding site (S1) is stronger than to the second site S2, probably due to the fact that the target nucleotides in the HCV RNA opposite to the so-called seed sequence of the miRNA (nucleotides 2–8) are seven nucleotides in site S1 and only six nucleotides in site S2 (Figure 2A). [score:3]
Approaching this point, a function of miR-122 in replication was proposed that could stimulate HCV RNA synthesis by altering the balance of viral RNAs engaged in replication versus translation (Masaki et al., 2015). [score:3]
Hepatitis C virus genetics affects miR-122 requirements and response to miR-122 inhibitors. [score:3]
miR-122 activates hepatitis C virus translation by a specialized mechanism requiring particular RNA components. [score:3]
On the other hand, an decrease in cellular miR-122 concentration lead to the emergence of a mutation in the HCV sequence that slightly increased the affinity of miR-122 binding, indicating a certain need for miR-122 in efficient HCV replication (Israelow et al., 2014). [score:2]
Regulation of hepatitis C virus by microRNA-122. [score:2]
The liver-specific miR-122 (Chang et al., 2004; Jopling, 2012) initially was found to positively regulate overall HCV replication (Jopling et al., 2005). [score:2]
MicroRNA-122 dependent binding of Ago2 protein to hepatitis C virus RNA is associated with enhanced RNA stability and translation stimulation. [score:2]
Consistent with these ideas, Xrn1 knockdown does not rescue replication of a viral mutant defective in miR-122 binding to the 5′ UTR (Li et al., 2013b), again indicating that miR-122 may also have additional functions in the HCV life cycle. [score:2]
Competing and noncompeting activities of miR-122 and the 5′ exonuclease Xrn1 in regulation of hepatitis C virus replication. [score:2]
The effector functions of miR-122 binding to the 5′ UTR appear to be complex and are still controversially discussed. [score:1]
Viral determinants of miR-122-independent hepatitis C virus replication. [score:1]
Liver-specific microRNA-122: biogenesis and function. [score:1]
In contrast, later during HCV replication when the membranous web replication complexes have been established, HCV RNA can only be attacked by Xrn1 but not by the exosome, while miR-122 protects against this degradation (Li et al., 2013b). [score:1]
The second downstream effector function of the two miR-122/Ago2 complexes binding to the HCV 5′ UTR is to protect the 5′ end of the genomic RNA against degradation by 5′–3′-exonucleases (Machlin et al., 2011; Shimakami et al., 2012a, b; Li et al., 2013b; Sedano and Sarnow, 2014). [score:1]
However, all above studies focused on the 5′ UTR miR-122 binding sites. [score:1]
Moreover, functional circularization of the HCV genome by binding to the ribosomal 40S subunit may also be supported by the oligomerization of Argonaute (Ago) protein which associates with miR-122 at the 5′ end and the 3′ end of the HCV RNA (see below); it can be assumed that Ago protein routinely associates with ribosomes since it was initially purified from ribosomes (Zou et al., 1998). [score:1]
miR-122 and the Hepatitis C RNA genome: more than just stability. [score:1]
Also the potential roles of miR-122 in the HCV life cycle have been discussed in detail (Jopling, 2008, 2012; Niepmann, 2009a; Li et al., 2013a, 2015; Wilson and Huys, 2013; Sagan et al., 2015; Sarnow and Sagan, 2016). [score:1]
Position -dependent function for a tandem microRNA miR-122 -binding site located in the hepatitis C virus RNA genome. [score:1]
Stabilization of hepatitis C virus RNA by an Ago2-miR-122 complex. [score:1]
Bridging the SL I and spanning into the region between SLs I and II, two binding sites for the liver-specific miR-122 are located. [score:1]
miR-122 promotion of the hepatitis C virus life cycle: sound in the silence. [score:1]
miR-122 is required for efficient overall HCV genome replication, but low-level HCV replication can occur independently of miR-122 (Thibault et al., 2013). [score:1]
In addition, cooperative aggregation of miR-122/Ago complexes may also be hypothesized to contribute to the RNA end-to-end communication (not illustrated in the figure). [score:1]
The Liver-Specific microRNA-122. [score:1]
miR-122 does not modulate the elongation phase of hepatitis C virus RNA synthesis in isolated replicase complexes. [score:1]
The miR-122 binding sites are shown as blue boxes, with the first non-conserved site 5B. [score:1]
Moreover, it has been shown that revertants in the 5′ UTR miR-122 binding sites that do not support miR-122 binding can be stable (Hopcraft et al., 2016), even suggesting a miR-122-independent role of the primary sequence of the respective HCV 5′ UTR region in the HCV life cycle. [score:1]
Hepatitis C virus subverts liver-specific miR-122 to protect the viral genome from exoribonuclease Xrn2. [score:1]
Competing roles of microRNA-122 recognition elements in hepatitis C virus RNA. [score:1]
In vitro, two miR-122 molecules can bind independently of each other to these sites, to the second binding site (S2) with higher affinity than to the first binding site (S1) (Mortimer and Doudna, 2013). [score:1]
Hepatitis C virus RNA functionally sequesters miR-122. [score:1]
The possibly multiple functions of miR-122 in HCV overall replication are discussed below. [score:1]
The third effector function of the miR-122/Ago complexes binding to the HCV 5′ UTR is assumed in RNA replication. [score:1]
According to effects of miR-122 not explained by the functions actually analyzed, one study proposed a function in replication (Jangra et al., 2010b). [score:1]
Other putative functions of miR-122 in the HCV replication cycle have not yet been resolved. [score:1]
Unconventional miR-122 binding stabilizes the HCV genome by forming a trimolecular RNA structure. [score:1]
The first studies described a strong effect of miR-122 on overall HCV replication (Jopling et al., 2005). [score:1]
[1 to 20 of 69 sentences]
19
[+] score: 163
Other miRNAs from this paper: hsa-mir-1-2, hsa-mir-1-1
This small (21–23 nt) non-coding RNA regulates gene expression post-transcriptionally by mediating Argonaute binding at the target RNA sites complementary to the miR-122 seed sequence, causing decay of target message [19]. [score:8]
Figure 5miR-1 and miR-122 reppress G6PD expression by direct targeting. [score:6]
miR-122 and miR-1 downregulate G6PD expression in liver cancer cells individually and in combination. [score:6]
Studies have shown that miR-122 maintains liver homeostasis by regulating triglyceride and cholesterol metabolism 20, 21, mitochondrial function [22], expression of genes modulated by circadian rhythm [23], polyploidy [24], and tumor suppression 16, 17, 25– 30. [score:6]
Several groups including ours demonstrated that miR-122, a highly conserved liver-specific miRNA expressed in vertebrates [15], is a novel tumor suppressor in HCC 16– 18. [score:5]
Figure 6G6PD expression and activity are suppressed by miR-122 and miR-1 in HepG2 cells. [score:5]
It is noteworthy that both miR-1 and miR-122 comparably suppressed luciferase activity and G6PD levels indicating both can target G6PD equally well (Fig.   4, Supplement Fig.   3). [score:5]
In the present study we established G6PD as a functional miR-122 target, and G6PD could be potential therapeutic target for HCC. [score:5]
To address whether both could contribute equally to the upregulation of G6PD expression in liver cancer, we compared miR-1 and miR-122 levels in the context of G6PD mRNA levels using density distribution plots (Fig.   4). [score:5]
A query of the miRNA target prediction database TargetScan [36] and Ago-CLIP data performed in human benign liver and liver tumors (GSE97061) [30], revealed that G6PD harbors three miR-122 binding sites in the 3′UTR (Fig.   2a). [score:5]
Since G6PD activity is essential for cell proliferation, we speculated ectopic miR-1 and miR-122 expression would inhibit HepG2 cell proliferation. [score:5]
gov/), its mRNA levels increase in conjunction with rise tumor grade, and its levels also negatively correlate with the expression of miR-122 and miR-1, a previously reported regulator of G6PD 33, 34. [score:4]
In healthy liver however, miR-122 is the most abundant miRNA, and its downregulation is much more pronounced than miR-1 in liver cancer (Supplement Fig.   2). [score:4]
Notably, the suppression of G6PD activity in miR-1 and miR-122 mimic co -transfected cells was comparable to G6PD knocked down cells. [score:4]
To the best of our knowledge, these data demonstrate for the first time that miR-122 regulates G6PD levels in HCC cells, and that loss of expression of miR-1 and miR-122 in primary HCCs may contribute to the increased G6PD activity thereby promoting tumor growth. [score:4]
Down regulation of miR-122 expression associated with or hypermethylation of upstream promoter region is predictive of poor overall survival in human liver cancer patients 18, 29, 37, 42. [score:4]
In this same dataset, we found a profound inverse correlation of miR-122 with G6PD levels in liver cancer (Fig.   2b,c), suggesting that miR-122 may play a regulatory role of PPP flux through G6PD suppression. [score:4]
Collectively, these data implicate anti-tumorigenic efficacy of miR-1 and miR-122 at least, in part, mediated through targeting G6PD, associated with poor patient prognosis (Fig.   1). [score:3]
Interestingly, miR-1, miR-122 combination seemed to have an additive effect on luciferase activity suppression. [score:3]
Figure 2G6PD is a novel target of miR-122. [score:3]
Our study shows that G6PD is a critical miR-122 target that is likely to modulate glucose metabolism in liver cancer. [score:3]
No such relationship was identified for miR-1. Nevertheless, our results showed that miR-1 and miR-122 are both capable of suppressing G6PD luciferase reporter activity independently or in combination (Fig.   5a). [score:3]
Figure 3Validation of G6PD as a novel miR-122 target. [score:3]
psiCHECK2 vectors (50 ng) harboring miR-122 target 3′-UTRs were co -transfected with either miR-122, miR-1, or scrambled (NC) RNA mimics (50 nM) using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA) into H293-T cells. [score:3]
Importantly, this activity was reduced in HepG2 cells transfected with miR-1 or miR-122 mimic, which was more pronounced in cells expressing both miRNAs (Fig.   6a). [score:3]
Exogenous miR-122 and miR-1 mimics resulted in reduced G6PD expression and activity in transfected HCC cells. [score:3]
Complete recovery of this activity in cells co -transfected with luciferase reporter plasmid harboring the G6PD 3′-UTR with mutated miR-122 binding sites confirmed that G6PD 3′-UTR is required for miR-122 mediated suppression (Fig.   3a). [score:3]
Next we sought to determine whether modulation of G6PD expression by miR-1 or miR-122 is reflected in its enzyme activity. [score:3]
Cells were then transfected with 40 nM each of scrambled miRNA mimic control (NC -mimic), miR-1 mimic, miR-122 mimic or their combination (20 nM of each), non -targeting siRNA control (70 nM), or siG6PD (70 nM) using RNAiMAX following the manufacturer’s protocol (Thermo Fischer Scientific, Waltham, MA). [score:3]
G6PD is a novel conserved miR-122 target. [score:3]
Indeed, growth of these cells were suppressed upon transfecting miR-1, miR-122 and their combination relative to the scrambled miRNA (Fig.   6d). [score:3]
miR-1 and miR-122 inhibit G6PD activity and cell survival in HepG2 cells. [score:3]
These data also show a negative correlation between miR-1 and miR-122 indicating their reciprocal regulation. [score:2]
Mutation (point or deletion) of individual sites showed that miR-122 cognate sites #2 and #3 are functional (Supplement Fig.   3a,b). [score:2]
While the role of miR-122 depletion in HCC is much more significant due to its abundance in benign liver and its dramatic decrease in HCC, a combined reduction of both miR-122 and miR-1 are likely to contribute to the deregulation of glucose metabolism in HCC, resulting in rapid tumor progression. [score:2]
Interestingly, levels of miR-1 and miR-122 negatively correlate with each other (overall p-value = 1.22 × 10 [−7], coefficient = −0.212) in human liver cancer (Fig.   4), indicating a possible reciprocal regulation. [score:2]
Furthermore, G6PD mRNA levels was significantly reduced in HCC cells transfected with miR-122 mimics (Fig.   3b) whereas knocking down miR-122 by transfecting an antimiR-122 oligo resulted in increased G6PD mRNA levels (Fig.   3c). [score:2]
Luna, J. M. et al. Argonaute CLIP Defines a Deregulated miR-122-Bound Transcriptome that Correlates with Patient Survival in Human Liver Cancer. [score:2]
Both miR-1 and miR-122 were found to be suppressed in tumor when compared benign liver tissues (Supplement Fig.   2). [score:2]
Notably, miR-1 and miR-122 together exhibited slightly more suppression in G6PD protein levels compared to its mRNA levels. [score:2]
These data tend to support the possibility that miR-1 and miR-122 in combination could be more effective anti-HCC therapy. [score:1]
This is also reflected at the G6PD protein and RNA levels in liver cancer cells transfected with miR-1 or miR-122 mimics (Fig.   5b,c). [score:1]
We find that the G6PD 3′-UTR harbors three miR-122 sites, and two are validated as functional sites (Fig.   3; Supplement Fig.   3). [score:1]
Scatterplot and linear regression of miR-122 and miR-1 levels in liver cancer patients. [score:1]
Density plots were used to visualize the distribution of miR-1 (top panel) and miR-122 (right panel) levels in the context of G6PD mRNA levels. [score:1]
While the role of miR-122 in lipid metabolism has been studied 16, 17, 20, 31, our understanding of its potential role in glucose metabolism remains unclear [32]. [score:1]
HepG2 cells transfected with scrambled miRNA (NC), miR-1, miR-122, combo (miR-1 and miR-122), G6PD siRNA (siG6PD) or negative control siRNA (NC) for 48 hours. [score:1]
The density plots of miR-1 and miR-122 showed that higher levels of G6PD were associated with lower levels of miR-122. [score:1]
However, our data show for the first time that levels of miR-122 are almost 10,000 fold higher than miR-1 levels in benign liver tissues in HCC patients (Supplement Fig.   2). [score:1]
Briefly, HepG2 cells were transfected using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA) with either miR-1 (40 nM), miR-122 (40 nM), or combo (20 nM of each). [score:1]
This relationship was further corroborated by the decrease in G6PD activity after miR-1 and miR-122 co-transfection in HepG2 cells (Fig.   6). [score:1]
H293-T cells were transfected with control RNA (NC), miR-122, miR-1, or combination of both, along with psi-CHECK2 vector harboring human G6PD 3′-UTR and Firefly luciferase (an internal control). [score:1]
This conclusion reflects results from other studies that showed that the loss of miR-122 is associated with an altered metabolic profile in the liver 20, 43, 44. [score:1]
Furthermore, G6PD mRNA levels were more closely associated with miR-122 than with miR-1 (Fig.   4). [score:1]
G6PD mRNA and miR-122 levels in liver cancer patient data downloaded from TCGA were found to negatively correlate (Fig.   2b) (R-squared = 0.1772, P-value = 5.874367 × 10 [−19], regression coefficient = −0.4696232). [score:1]
Figure 4miR-1 and miR-122 levels are negatively correlated in human liver cancer. [score:1]
Wild-type and mutated G6PD 3′-UTR harboring miR-122 and miR-1 binding sites was cloned into the 3′-UTR of Renilla Luciferase cDNA in psiCHECK2 (Promega, Madison, WI) dual luciferase reporter. [score:1]
[1 to 20 of 57 sentences]
20
[+] score: 155
Our study showed that re -expression of miR-122 suppressed PKM2 in HCC cell lines; therefore, under -expression of miR-122 may contribute to preferential expression of PKM2 in human HCC. [score:9]
Interestingly, in a genome-wide expression profiling in 96 pairs of HCC and NT liver tissues which analyzed the coordinate expression of mRNAs and miRNAs, miR-122 under -expression in HCC was found to be significantly associated with the genes involved in mitochondrial functions, fatty-acid metabolism, and amino-acid metabolism [25]. [score:7]
To assess whether PKM2 expression was affected by miR-122, we transiently transfected miR-122 precursors into HCC cell lines and found that miR-122 suppressed the protein expression of PKM2 but not PKL, the predominant form in normal livers (Fig. 4C). [score:7]
MiR-122 targeted PKM2 and suppressed PKM2 expression. [score:6]
0115036.g005 Figure 5(A) miR-122 expression in MHCC-97L cells stably expressing miR-122 precursors. [score:5]
Re -expression of miR-122 suppressed HCC growth through modulating aerobic glycolysis. [score:5]
We generated MHCC-97L and SMMC-7721 cells that stably expressed miR-122 (Fig. 5A) and found that miR-122 profoundly reduced the PKM2 expression (S5 Fig. ) lactate accumulation (Fig. 5B) and glucose uptake rate (Fig. 5C–E) in MHCC-97L cells. [score:5]
S5 Fig PKM2 mRNA expression in MHCC-97L and SMMC-7721 cells that stably expressed EV or miR-122. [score:5]
We found that miR-122 interacted with the 3UTR of PKM2 and suppressed PKM2 expression in human HCCs. [score:5]
On the other hand, in normal liver, miR-122 is highly expressed and suppresses PKM2, making PKL the most abundant PK isoform. [score:5]
Conversely, inhibition of miR-122 in HCC cell line with high expression of miR-122, PLC/PRF/5, by LNA enhanced glucose uptake rate (Fig. 5F). [score:5]
Importantly, linear regression mo del showed that miR-122 expression inversely correlated with PKM2 expression in our cohort of HCC and NT liver tissues (Fig. 4D). [score:5]
In this study, miR-122 was shown to suppress stem cell-renewal and HCC proliferation through down -regulating PKM2 [28]. [score:4]
Although Liu et al. started from the angle of miR-122 and discovered PKM2 as its target while our current study started from the angle of different PK isoforms and discovered miR-122 as the regulator of PKM2, two studies converged to an important conclusion. [score:4]
MiR-122 expression was normalized to U6 expression and to empty vector (EV) control. [score:4]
Moreover, we found that miR-122 was significantly under-expressed in human HCC tissues as compared to NT livers and was further under-expressed in venous metastases (VM) (Fig. 4F). [score:4]
Establishment of PKM2 knockdown and miR-122 over -expressing HCC cells. [score:4]
Intriguingly, we showed that PKM2 expression was regulated by the most abundant microRNA in the liver, miR-122. [score:4]
In another study which compared the gene expression profiles of human embryonic stem cells (hESCs), human primary hepatocytes (hPHs), and HCCs, miR-122 was found to be significantly under-expressed in hESCs and hPHs [28]. [score:4]
Interestingly, miR-122 precursors did not affect the phosphorylation of PKM2 at Tyrosine 105, indicating that miR-122 only regulated the expression but not the activity of PKM2 (S4 Fig. ). [score:4]
Re -expression of miR-122 in HCC cell lines also decreased glucose uptake and lactate accumulation. [score:3]
Consistent with other reports, miR-122 was one of the most abundantly expressed miRNAs in the human liver (Fig. 4E). [score:3]
Importantly, expression levels of PKM2 and miR-122 inversely correlated in human HCCs and non-tumorous liver tissues. [score:3]
Protein lysates were from SMMC-7721 cells that expressed miR-122 and miR-122 control precursors were probed with phosphoPKM2 (Tyrosine 105), PKM2, and β actin antibodies. [score:3]
More importantly, re -expression of miR-122 in MHCC-97L significantly impeded tumor growth and attenuated lung metastasis (Fig. 5G–H). [score:3]
By in silico analysis with the algorithm Target Scan 5.2, we studied the 3UTR of PKM2 and found that miR-122 could potentially interact with the 3UTR of PKM2. [score:3]
However, as HCC cells expressed high level of PKM2 but not PKM1 (Fig. 1A), the functional effects driven by miR-122 should mainly be contributed by PKM2. [score:3]
To generate HCC cells that stably express –NTC and –shPKM2 or –EV and -miR-122 precursor sequences, pL KO/pMIRNA1 plasmids and viral packaging plasmids (System Biosciences) were transfected into 293FT packaging cells. [score:3]
In addition to miR-122 we reported in our current study, a number of miRNAs have been shown to regulate genes involved in the glucose metabolism, thereby fine-tuning cancer metabolism. [score:2]
Our current study has unequivocally revealed the precise mechanisms by which miR-122 regulated the PK isoform switching in HCC, the clinical relevance of PKM2, and the clinical association of PKM2 and miR-122. [score:2]
Many of these miRNAs, like miR-122, have been reported to be deregulated in various cancer tissues (please see review for details [23], indicating the importance of miRNAs in cancer metabolism. [score:2]
To further interrogate the roles of miR-122 in human HCC, we looked into our previous miRNA array study which compared the expression of>667 microRNA species in tumor and NT specimens in 20 HCC patients. [score:2]
Luciferase reporter assay showed that miR-122 suppressed the WT 3UTR and effect was reduced in the Mut 3UTR of PKM2 (Fig. 4B). [score:2]
Taken together, Liu et al. ’s and our current studies contain complementary information supporting the important metabolic roles of miR-122/PKM2 in HCC development. [score:2]
S4 Fig MiR-122 reduced expression but not the activity of PKM2. [score:2]
MiR-122 is the most dominant miRNA in normal hepatocytes and it is important for the maintenance of normal liver functions. [score:1]
We also cloned the sensor sequence which was completely complementary to miR-122 as a positive control. [score:1]
As we have shown earlier in this study that PKM2 promoted the Warburg effect in HCC, we studied the metabolic roles of miR-122 in HCC cell lines. [score:1]
0115036.g004 Figure 4(A) Seed sequence of miR-122 in the 3UTR of PKM2 was underlined. [score:1]
A day after these constructs were transiently transfected into BEL-7402 cells by Lipofectamine 2000 (Life Technologies, Grand Island, NY), 5 pmol of miR-122 precursors (Life Technologies) were transfected by X-tremeGENE DNA transfection reagent (Roche). [score:1]
Sensor sequences, perfectly complementary to the miR-122, were included as positive control. [score:1]
pMIRNA1 plasmid carrying miR-122 precursor sequences was purchased from System Biosciences (Mountain View, CA). [score:1]
Mouse with germline deletion of miR-122 developed steatohepatitis, fibrosis, and HCC [27]. [score:1]
MiR-122 is the most abundant miRNA in NT liver. [score:1]
MiR-122 was shown to regulate a network of genes that are responsible for lipid metabolism [24], mitochondrial metabolism [25], and differentiation [26]. [score:1]
The abundance of miR-122 in the human liver implies that miR-122 might play an important role in human liver. [score:1]
Although the relationship of miR-122 and PKM2 has been briefly revealed [28], the defined roles of miR-122 in HCC metabolism especially in the aspect of glucose metabolism have not been clearly elucidated. [score:1]
To validate the interaction between miR-122 and PKM2, we cloned the wild-type (WT) and mutant (Mut) 3UTRs of PKM2 into the pmirGLO luciferase reporter vector (Fig. 4A). [score:1]
LNA Ctrl (control) and LNA miR-122 were purchased from Exiqon and were transfected by X-tremeGEME DNA transfection reagent in PLC/PRF/5 cells based upon manufacturer’s protocol. [score:1]
Our results have revealed that the miR-122 -mediated switch of PK isoforms drove HCC metabolic reprogramming. [score:1]
While our data echo Liu et al. ’s in vitro findings, we additionally demonstrated that PKM2 and miR-122 were critical to HCC growth in vivo using both subcutaneous and orthotopic implantation mo dels. [score:1]
[1 to 20 of 51 sentences]
21
[+] score: 147
org, TargetScan and MirTarBase databases Overexpression of putative mir-122 downstream targets: G6PC3, ALDOA, and CSIt is generally accepted that miRNAs exert their function partly by down -regulating the expression of their target genes. [score:12]
The glycometabolism-related genes G6PC3, ALDOA, and CS are putative targets of mir-122To elucidate the downstream mechanism of down-regulated mir-122 expression, we sought to identify mir-122 targets. [score:10]
We further confirmed that mir-122 overexpression suppresses the expression of a luciferase reporter gene containing the putative wild-type but not the mutated mir-122 target sequence from CS 3'UTR in human 293T cells (Figure 5D). [score:9]
They also found that mir-122 is up-regulated in cancer-secreted enclosed vesicles and transfers to normal cells to suppress CS expression and glucose utilization in these cells [22]. [score:8]
To elucidate the downstream mechanism of down-regulated mir-122 expression, we sought to identify mir-122 targets. [score:8]
In addition, Cecchi et al. have demonstrated that HIF-1a (hypoxia -induced factor 1-a), a target of mir-122 expressed in response to hypoxia, was up-regulated in mechanical asphyxia compared with craniocerebral injury, natural death and other causes of death [25, 26]. [score:7]
Importantly, significant correlations with postmortem interval, environmental temperature and age were not observed for mir-122 expression (Figure 3B and Figure 3C), further indicating that mir-122 down-regulation is likely caused by hypoxia shock in mechanical asphyxia death. [score:6]
ALDOA is a glycolytic enzyme that can up-regulated by inhibiting mir-122 in the liver [21, 30]. [score:6]
Overexpression of putative mir-122 downstream targets: G6PC3, ALDOA, and CS. [score:5]
We observed significantly increased G6PC3, ALDOA and CS expression accompanied by reductions in mir-122 expression in mechanical asphyxia specimens, indicating an elevated glucose demand under acute hypoxia conditions. [score:5]
We also reported reversed expression patterns of three predicted mir-122 target genes, G6PC3, ALDOA and CS, which encode metabolic enzymes, in the corresponding human specimens. [score:5]
We also observed reversed expression patterns of the three predicted miR-122 targets, G6PC3, ALDOA and CS, which encode glycometabolic enzymes, in the corresponding specimens. [score:5]
RT-qPCR validation of mir-122 expression in 48 human brain specimens, 36 heart specimens and 18 rats and analyses the relationships between the Ct values of mir-122 expression and postmortem of death, environmental temperature and age. [score:5]
All of these studies demonstrate that mir-122 is down-regulated in hypoxia and can stimulate intracellular glucose by up -regulating G6PC3 and ALDOA regardless of whether it is stimulated by glycolysis or by gluconeogenic factors. [score:5]
Our data suggest that mir-122 and its putative downstream target genes, G6PC3, ALDOA and CS, could serve as biomarkers for mechanical asphyxia and shed light on the pathogenesis of hypoxia in diseases. [score:5]
Further analysis of the RT-qPCR data from the 84 samples found that mir-122 was the most consistently down-regulated miRNA in response to mechanical asphyxia in both types of tissues comparing with the other two death causes. [score:4]
Finally, Miranda et al. have demonstrated that mir-122 is down-regulated intracellularly with the excessive glucose spared from glycolysis going towards storage in breast cancer cells. [score:4]
Our data coordinate with prevails studies indicating that mir-122 regulates the expression of the mRNAs and proteins related to G6PC3 [20], ALDOA [21] and CS [22] in cell cultures. [score:4]
Figure 3 A. mir-122 down-regulation in both brain and cardiac tissues of human and rat from mechanical asphyxia cases compared with specimens from other cases. [score:3]
We ultimately selected mir-122, which was expressed at a significantly low level in the both brain and heart specimens from mechanical asphyxia cases. [score:3]
A. mir-122 down-regulation in both brain and cardiac tissues of human and rat from mechanical asphyxia cases compared with specimens from other cases. [score:3]
D. Dual luciferase reporter analysis of mir-122 and a reporter gene with predicted mir-122 target sequences (wildtype and mutant) in the CS 3'UTR in 293T cells. [score:3]
The glycometabolism-related genes G6PC3, ALDOA, and CS are putative targets of mir-122. [score:3]
Venny analyses of mir-122 targets predicted by the microrna. [score:3]
Venny analyses [16] revealed 25 genes that might be regulated by mir-122 (Figure 4). [score:2]
Our findings indicate that an acute metabolic response to hypoxia occurs in human bodies in cases of mechanical asphyxia and is likely regulated by mir-122. [score:2]
Specifically, mir-122 expression was significantly reduced in the brains and cardiac tissues of mechanical asphyxia cases compared with the specimens from craniocerebral injury and hemorrhagic shock cases. [score:2]
Consistently, mir-122 and protein level analyses from the three cause-of-death mo dels in rats (n = 6) revealed the same trend (Figure 3A and Figure 5C). [score:1]
in the brain specimens and sixteen miRNAs (mir-192, mir-148a, mir-122, etc. ) [score:1]
G6PC3, ALDOA and CS exhibited inverse correlations with mir-122 in specimens from the indicated causes of death and Dual luciferase reporter analysis of CS in 293T cells. [score:1]
Our findings thus indicate that mir-122 reduction might be the response to hypoxia in mechanical asphyxia. [score:1]
Furthermore, G6PC3 is a gluconeogenic enzyme that can be stimulated by mir-122 reduction to contribute to gluconeogenesis [20, 31]. [score:1]
HEK293T cells were infected with c-GFP and mir-122 or mir-122M for 24 h. The cells were then seeded into 24-well plates and co -transfected with 0.5 μg of the respective pGL3-3'UTR construct and 0.05 μg of the pGL-TK vector (Promega). [score:1]
Furthermore, eight miRNAs (mir-31, mir-122, mir-219-2-3p, etc. ) [score:1]
We hypothesized that there are reverse correlations between mir-122 and G6PC3, ALDOA and CS mRNA levels. [score:1]
Kyoungsub et al. found that mir-122 decreased and activated glycolytic metabolism with low ATP synthesis in hepatocellular carcinoma cancer stem cells in a hypoxia microenvironment [27]. [score:1]
RT-qPCR validation of microarray results and the robust reduction of mir-122 in mechanical asphyxia specimens. [score:1]
[1 to 20 of 37 sentences]
22
[+] score: 141
Overexpression of miR-122 promotes Hep-Dif through a miR-122/HNF4α -positive feedback loop [49, 50], and mechanistic studies using inhibitors of PI3K/PKB significantly suppressed the expression of miR-122 levels [51]. [score:9]
Recent studies have uncovered profound roles for a family of microRNAs (miRNAs) controlling gene expression in almost every biological process including development, aging, and cell death, but also in the control of diverse aspects of hepatic function and dysfunction, and these have emphasized the role of the most abundant miRNA in human liver, miR-122, a key factor and therapeutic target in liver disease [43– 45]. [score:8]
Interestingly, when cells were treated with Wnt5a + WRT, the PI3K inhibitor completely blocked the impact of Wnt5a on miR-122 expression indicating that PI3K acts as a target of Wnt5a in the regulation of miR-122 in the ML141 -induced Hep-Dif of hADSCs (Fig.   8b). [score:8]
By inhibiting miR-122 with the selective inhibitor NSC5476, blockade of the expression of HNF4α, albumin, and E-cadherin was seen, thus indicating that no more reversibility of the action of ML141 can then occur. [score:7]
Mechanistic studies using inhibitors of PI3K, PKB, and mammalian target of rapamycin (mTOR) in primary cultured rat hepatocytes resulted in significant suppression of the insulin -mediated elevation of miR-122 levels. [score:7]
miR-122 was reported to be a direct target of the LETFs-HNF4 which controls the Hep-Dif [48], and its overexpression promotes Hep-Dif through a miR-122/HNF4α -positive feedback loop [49, 50]. [score:6]
Concerning its role in Hep-Dif, miR-122 was reported to be a direct target of the liver-enriched transcription factor (LETFs) hepatocyte nuclear factor (HNF)4, which controls Hep-Dif [48], and its overexpression promotes Hep-Dif through a miR-122/HNF4α -positive feedback loop [49, 50]. [score:6]
miR-122 is considered a key factor and therapeutic target in liver disease [43– 45] where loss of its expression has been associated with hepatocellular carcinoma [46] and its presence is essential as a host factor for hepatitis C virus replication [47]. [score:6]
In addition, by inhibiting miR-122, secreted albumin and exosome release were completely inhibited in the ML141 -induced Hep-Dif. [score:5]
The histone deacetylase inhibitor Trichostatin A (TSA) was shown to be a nonspecific inhibitor of Cdc42 activity but a key factor for MSC differentiation into hepatocytes via the induction of microRNA-122 (miR-122) [23, 24]. [score:5]
Inhibition of PI3K and miR-122 abolished completely the effects of ML141 indicating that inhibition of Cdc42 promotes the Hep-Dif through a Wnt5a/PI3K/miR-122/HNF4α/albumin/E-cadherin -positive action. [score:5]
As expected, the expression of miR-122 increased significantly during the Hep-Dif, reaching approximately a 44-fold increase relative to the expression of miR-122 at D28 versus 21-fold at D0 (young-hADSCs versus aged-hADSCs, respectively). [score:5]
However, Wnt5a significantly induced the expression of miR-122 in contrast to WRT which completely abolished the effect of ML141 on miR-122 expression (Fig.   8b). [score:5]
The miR-122 inhibitor completely abolished the effects of ML141 on the expression of miR-122/ALB/HNF4α/E-cadherin, particularly when cells were treated with ML141(D−2/14); moderate effects of NSC5476 were seen in the case of ML141(D14/28) (Fig.   8a). [score:5]
Hepatocyte differentiation is controlled by a liver-enriched transcription factor (LETFs) network, where miR-122—a direct target of LETF hepatocyte nuclear factor (HNF)—is the most common miRNA in the adult liver and a crucial factor in hepatocyte differentiation [43, 45, 48]. [score:4]
Conversely, by inhibiting miR122 with NSC5476, the effects of Cdc42 knockdown in aged cells were significantly abolished (Fig.   9) in favor of a mechanism of action involving the miR122 axis as shown with ML141. [score:4]
Cells were treated with or without the miR-122 selective inhibitor (NSC5476 (NSC)) for 24 h before adding ML141 and maintained throughout the ML141 incubation. [score:3]
In addition, by using a PI3K inhibitor in combination with Wnt5a, our data show that Wnt5a is required for the activation of PI3K, thus inducing miR122 in hADSC-derived Hep -Dif. [score:3]
Concomitantly, siCdc42 significantly increased the secretion of albumin, the release of exosomes, and the mRNA expression of miR122/HNF4/E-cadherin. [score:3]
The role of miR-122 in liver function and diseases has also been reported. [score:3]
ML141 -induced Hep-Dif showed an improvement in mesenchymal-epithelial transition, a switch from Wtn-3a/β-catenin to Wnt5a signaling, involvement of PI3K/PKB but not the MAPK (ERK/JNK/p38) pathway, induction of miR-122 expression, reinforcing the exosomes release and the production of albumin, and epigenetic changes. [score:3]
Aging Cdc42 ML141 Adipose derived mesenchymal stem cells Hepatocyte differentiation Exosomes release miR122 Wnt MAPK PI3K Aging is a process that results from an increased failure in a system normally designed for growth and reproduction [1], and is a major risk factor for most chronic diseases. [score:3]
The results of this study indicate that the inhibition of Cdc42 promotes the hepatic differentiation of hADSCs through a Wnt5a/PI3K/miR-122/HNF4α/albumin/E-cadherin -positive action (Fig.   11). [score:3]
a RNAs were collected at D0/14/28 and mRNA levels of hepatocyte nuclear factor (HNF)4α/albumin (ALB)/E-cadherin/miR-122 genes were determined by RT-qPCR: the results are expressed as fold variation relative to D0 (or young at D0) after normalization to GAPDH. [score:3]
b Effects of H-89, SP, PD, WRT, Wnt5a, and NSC on the expression of miR-122 mRNA on the ML(−2/14) treated group. [score:3]
Interestingly, PI3K/PKB signaling has been demonstrated to positively regulate miR-122 [51]. [score:2]
In hADSCs, ML141 induced the hepatocyte differentiation by a mechanism involving the Wnt5a/PI3K/miR-122 signaling pathway, and regulated positively the hepatic specific genes and function, importantly the exosome release. [score:2]
Cdc42 mRNA and Cdc42-GTP protein levels as well as key factors were assessed during hepatocyte differentiation of Cdc42-knockdown cells from D<0 to D28: secreted albumin protein, released exosomes, miR122 mRNA, hepatocyte nuclear factor (HNF)4 mRNA, and E-cadherin mRNA. [score:2]
Among the signaling pathways that control miR-122, PI3K/PKB has been demonstrated to positively regulate miR-122 [51]. [score:2]
The PI3K/Wnt5a/miR-122 signaling pathways play important major roles in the regulatory effects on hepatic differentiation of hADSCs and are involved in cell fate determination. [score:2]
SP600125, PD98059, H-89, and DKK1 did not show any blockade to the action of ML141 nor any additive effects, indicating no requirement for their pathways in this cell mo del to regulate miR-122 (Fig.   8b). [score:2]
Involvement of miR-122 and impact on the exosome release. [score:1]
First, the expression of miR-122, HNF4α, albumin, and E-cadherin mRNAs was evaluated during the differentiation (Fig.   8a). [score:1]
Our findings also describe a mechanism of action in ML141 -induced Hep-Dif of hADSCs involving MAPK, PI3k, Wnt/β-catenin, and miR-122 pathways. [score:1]
Third, the mechanism of action of Cdc42 involved miR-122 in ML141 -treated cells. [score:1]
Our results reveal that miR-122 increased significantly during Hep-Dif, especially in the young group, and this is in accordance with previously reported studies on the positive implication of miR-122 in hepatic differentiation [24, 50]. [score:1]
Mechanistic insights of the Wnt(s)/MAPK/PI3K/miR-122 pathways were studied. [score:1]
Third, the impact of miR-122 inhibition by NSC5476 was evaluated on the cell functionality (Fig.   8c). [score:1]
[1 to 20 of 38 sentences]
23
[+] score: 120
Here we demonstrated that the increased expression of AUF1, which suppresses the expression of Dicer1, contributes to the down-regulated miR-122 in HCC. [score:10]
In summary, this study demonstrated that AU-rich element binding protein AUF1, which was found upregulated in the cancerous tissues of HCC patients, suppresses the maturation of miR-122 by interacting with the 3′UTR and coding region of DICER1 mRNA, leading to the reduced expression of Dicer1. [score:8]
Our results suggest that the up-regulated expression of AUF1 and insufficient Dicer1 might be crucial for the dysregulated biogenesis of miRNAs including miR-122 in HCC. [score:7]
Since the present study found that the increased expression of AUF1 reduced the abundance of miR-122 by blocking its maturation, apoptosis was further examined when AUF1 was overexpressed or inhibited by siRNA. [score:7]
Our data suggest that AUF1 suppresses the maturation of miR-122 through inhibiting Dicer1 expression by interacting with the 3′UTR and ORF of DICER1 mRNA. [score:7]
Given the importance of miR-122 in liver diseases, the present study aims to determine the molecular basis underlying the reduced expression of miR-122 in HCC. [score:5]
Inhibited expression of AUF1 by siRNA promoted HCC cell death, which could be the result of the elevated level of miR-122. [score:5]
The putative mechanism for the regulatory effect of AUF1 on miRNA expression through AUF1-Dicer1 interaction is summarized schematically in Figure 8. Given the large abundance and active biological role of miR-122 in liver, the change of miR-122 level might be a remarkable molecular event for liver cells. [score:4]
Consistent with the previous findings [29], miR-122 was also found down-regulated in HCC tissues in this study (Figure 1B). [score:4]
It has been demonstrated that the abundance of miR-122 is usually down-regulated in liver cancer [29], while the underlying mechanism is not understood. [score:4]
Our data indicate that Dicer1 expression can be regulated by AUF1, we further studied if AUF1 influences the maturation of miR-122, the most abundant miRNA in the liver. [score:4]
So far, it remains unknown why the biogenesis of miR-122 is down-regulated in HCC. [score:4]
In contrast, the abundance of pre-miR-122 was increased dramatically in the cells overexpressing AUF1 and decreased in the cells transfected with siRNA of AUF1 (Figure 3B, 3D). [score:3]
Based on above data that AUF1 can modulate the expression of miR-122 by targeting DICER1 mRNA, we further evaluated whether other miRNAs could be affected by AUF1 in hepatoma cells. [score:3]
In consistent with the previous data [24], miR-122 was significantly down-regulated in cancer tissues of HCC patients, compared to the matched non-cancerous liver tissues. [score:3]
Importantly, this study shows that AUF1 suppresses the biogenesis of miR-122 at the step from pre-miRNA to miRNA, possibly by promoting the degradation of DICER1 mRNA. [score:3]
We began this study by determining the expression of AUF1, Dicer1, and miR-122 in both HCC liver tissues and HCC cell lines. [score:3]
These data suggest that AUF1, Dicer1, and miR-122 are present in HCC with altered expression profile. [score:3]
As shown in Figure 3, the abundance of miR-122 was reduced significantly in both PLC/PRF/5 and Huh7 cells overexpressing AUF1, while miR-122 level was increased markedly in both cell lines transfected with siRNA of AUF1 (Figure 3A, 3C). [score:3]
Figure 8 In a previous study, we found that miR-122 promotes apoptosis and inhibits the viability of HCC cells [32]. [score:3]
n = 4. [**] P < 0.01. miR-122 has been demonstrated as tumor suppressor [31]. [score:3]
Just as its impact on miR-122, AUF1 knockdown resulted in the decreased levels of miR-1, miR-21, and miR-375. [score:2]
miR-122 also directly interacts with the genomic RNA of HCV and promotes viral replication [25– 27]. [score:2]
Schematic diagram of the putative mechanism of AUF1 regulating miR-122 maturation. [score:2]
It is noteworthy that miR-122, miR-1, miR-21, miR-125b, and miR-375 are so called onco-miRs, which play various roles in tumor development such as carcinogenesis, malignant transformation, and metastasis [40, 41]. [score:2]
AUF1 regulates the maturation of miR-122. [score:2]
Increasing evidence has shown that miR-122 plays a central role in the development, differentiation, homeostasis, and functions of the liver [24]. [score:2]
miR-122 is considered as tumor suppressor gene, because decreased miR-122 abundance is frequently found in HCC and it is often related with the invasion, metastasis, and poor prognosis of HCC [28– 30]. [score:2]
Figure 6Huh7 cells were transfected with siAUF1 and siDicer1 for 36–48 h. (A– E) The levels of oncogenic miRNAs (miR-1, miR-21, miR-125b, miR-375) and miR-122 were determined by qRT-PCR. [score:1]
We began this study by measuring the expression of AUF1, Dicer1, and miR-122 in both HCC cell lines and the tissues from HCC patients. [score:1]
In contrast, the loss of other miRNAs may not be so influential as that of miR-122 due to their relative less abundance in either HCC or heathy liver cells. [score:1]
PLC/PRF/5 and Huh7 cells were transfected with pEGFP-AUF1 or siAUF1, or co -transfected with both pEGFP-AUF1 and siAUF1 for 48 h. The levels of miR-122 (A, C) and pre-miR-122 (B, D) were determined by qRT-PCR. [score:1]
Collectively, these data suggest that the maturation from pre-miR-122 to miR-122, a step mainly processed by Dicer1, is somehow blocked by AUF1. [score:1]
PLC/PRF/5 and Huh7 cells were transfected with pEGFP-AUF1 or siAUF1 for 48 h, and the levels of miR-122 and pre-miR-122 were determined by qRT-PCR. [score:1]
miR-122 is the most abundant hepatic miRNA that constitutes 70% of miRNAs in the adult liver [24]. [score:1]
Huh7 cells were transfected with siAUF1 and siDicer1 for 36–48 h. (A– E) The levels of oncogenic miRNAs (miR-1, miR-21, miR-125b, miR-375) and miR-122 were determined by qRT-PCR. [score:1]
Figure 3PLC/PRF/5 and Huh7 cells were transfected with pEGFP-AUF1 or siAUF1, or co -transfected with both pEGFP-AUF1 and siAUF1 for 48 h. The levels of miR-122 (A, C) and pre-miR-122 (B, D) were determined by qRT-PCR. [score:1]
Our previous study showed that miR-122 promotes the apoptosis of HCC cells [32]. [score:1]
[1 to 20 of 38 sentences]
24
[+] score: 117
Other miRNAs from this paper: hsa-let-7e, hsa-mir-16-1, hsa-mir-16-2, hsa-mir-200a
Yet, expression of miR-200a is significantly enriched in hepatocytes and its similar expression profile to miR-122 in this study suggests that changes in its expression in the circulation are due to its release from hepatocytes 24– 28. [score:7]
We next analysed whether the expression of miR-122 and miR-200a were differentially regulated in individuals who died from liver-related diseases. [score:6]
Previous studies have reported that expression of both miR-122 and miR-200a are dysregulated in the circulation during liver disease [18]. [score:6]
However, miR-122 is also down-regulated in HCC and has been associated with disease progression and anti-apoptotic pathways in HCC cells 35– 39. [score:6]
The cellular function of miR-122 is more difficult to ascertain, as this miRNA is associated with a wide array of potential cellular targets during liver disease (reviewed in ref. [score:5]
The greater expression of miR-122, the most highly expressed miRNA in hepatocytes [19], is not surprising as this miRNA has been found to be elevated in HIV/HCV co-infected individuals previously 20, 21. [score:5]
For miR-200a and let-7e if cel-miR-39 and miR-122 was detected < 30 cycles in a sample but miR-200a or let-7e was not detected the sample was designated as having a Ct of 35 (the lower limit of detection) to signify extremely low expression or no expression of that particular miRNA. [score:5]
The data presented here, coupled with both miRNAs previous associations with liver disease in the literature, suggests that circulating miR-122 and miR-200a are promising predictive biomarkers for liver disease in the ART -treated HIV-1-infected populations. [score:5]
In conclusion circulating levels of miR-122 and miR-200a were clearly greater at baseline in the HIV-1-infected individuals, who suffered from some degree of liver disease whilst on continuous virally suppressive ART. [score:5]
Secondly, the release of miR-122 and miR-200a into the circulation may be indicative of a specific cellular pathway, i. e. apoptosis, which is disrupted during liver disease, and further analysis of these miRNA may provide new avenues for therapeutics targeting this disrupted pathway. [score:5]
However, miR-122 is almost exclusively expressed in hepatocytes and its dysregulation in the circulation is almost certainly due to its release from these cells [19]. [score:4]
Additionally, we observed greater pre-ART levels of circulating miR-122 and miR-200a, compared to matched controls, in HIV-1 positive individuals who died from liver-related diseases whilst undergoing suppressive ART. [score:4]
Overall, the data presented here show that both miR-122 and miR-200a are promising biomarkers, whose increase may precede the development of severe liver disease in the ART -treated HIV-1-infected population. [score:4]
Importantly out study is the first to associate elevated levels of miR-122 and miR-200a, at baseline, with the development of fatal liver disease in the future. [score:4]
Furthermore, in the PPPs of these liver cases and controls, the expression of miR-122 was significantly greater (p < 0.01, fold change = 3.3) and miR-200a showed a clear trend towards significance (p = 0.079, fold change = 4.5) in the liver cases compared to their matched controls, while, as expected, let-7e, which showed no association with liver disease in serum, showed no difference in the PPPs. [score:4]
Relative expression (normalised to miR-16) of (a) miR-122, (b) miR-200a and c) Let-7e were log10 normalised and plotted for the Liver Cases (n = 13) and their matched controls (n = 25). [score:3]
Mir-200a may not be as specific to the liver, but it’s parallel expression with miR-122 indicate that it is also originating from the liver. [score:3]
MiR-122 and miR-200a were greater in the serum of individuals who develop fatal liver disease. [score:3]
MiR-122 and miR-200a were greater in PEG-precipitated particles of individuals who develop fatal liver disease. [score:3]
The data presented above clearly shows that miR-122 and miR-200a are greater in the circulation during liver disease. [score:3]
MiR-122 is almost exclusively expressed in the liver, whereas AST and ALT can originate from a number of cellular sources, including skeletal muscle [47]. [score:2]
The correlations of miR-122 and miR-200a with IL-6 are interesting, as IL-6 is a marker of systemic inflammation, and it’s increase is associated with an increased risk of the development of SNAEs 16, 17. [score:2]
While the contribution of EV-free, AGO -associated miRNAs cannot be ruled out, this observation, along with the observation that there was no difference in size or number of particles between liver cases and controls, suggests that the observed increase in miR-122 and miR-200a is due to a release of these miRNAs in PPPs. [score:1]
MiR-122 and miR-200a represent a potential improvement on the current liver biomarkers AST and ALT. [score:1]
One interesting observation was that the differences between levels of miR-122 and miR-200a in liver cases and controls were much greater when serum was precipitated using ExoQuick reagent. [score:1]
Figure 4Levels of PPP -associated miR-122, miR-200a and let-7e in liver cases and controls. [score:1]
Only miR-122 significantly correlated with ALT (r = 0.65, p = 0.001) (Fig.   5a) while miR-200a was on the cusp of significance (r = 0.43, p = 0.05) (Fig.   5b). [score:1]
Matching PCR results and ALT levels were available for 22/38 individuals for miR-122, 21/38 for miR-200a and 19/38 for Let-7e, while matching AST results were available for 17/38 individuals for miR-122, 15/38 for miR-200a and 17/38 for let-7e. [score:1]
Both miR-122 and miR-200a showed modest, but statistically significant positive correlations with AST (r = 0.37 & p < 0.0001 and r = 0.29 & p = 0.0003 respectively) and ALT (r = 0.42 & p < 0.0001 and r = 0.33 and p < 0.0001 respectively). [score:1]
Relative expression (normalised to cel-miR-39 and PPP number) of miR-122 and miR-200a, measured in the PPPs of the Liver cases and controls and controls from the SMART and ESPRIT studies, (a) ALT and (b) AST were log normalised and plotted. [score:1]
Serum levels of miR-122 and miR-200a were greater in ART -treated HIV/HCV co-infected individuals and correlate with AST and ALT levels. [score:1]
Figure 3Serum levels of miR-122, miR-200a and let-7e in liver cases and controls. [score:1]
Additionally, miR-122 has been found, associated with HCV RNA, in the exosomes of HCV mono-infected individuals 22, 23. [score:1]
However, what is not clear from these cellular studies is if the elevated levels of miR-122 and miR-200a, seen in our study, are contributing to the increase in IL-6, or are merely a down-stream result of its increase. [score:1]
XY pairs were available for 22 individuals in the miR-122 vs ALT analysis, 21 for miR-200a vs ALT, 17 in the miR-122 vs AST analysis, 15 for miR-200a vs AST. [score:1]
It is clear that future studies will have to fully characterise the location of circulating miR-122 and miR-200a in the context of HIV related liver disease. [score:1]
Correlation of miR-122 and miR-200a with IL-6. Discussion. [score:1]
However, the data presented above indicates a great deal of potential for miR-122 and miR-200a. [score:1]
Overall, the cellular data suggest that miR-122 and miR-200a may play a role in hepatocyte survival. [score:1]
In order to determine whether miR-122 and miR-200a were present in the circulation packaged in EVs, we precipitated the serum using the PEG -based ExoQuick reagent. [score:1]
PPP -associated miR-122 and miR-200a correlate with levels of AST and ALT. [score:1]
Yet, future studies may benefit from further exploring the clinical utility of miR-122 and miR-200a when extracted from both serum and PEG precipitated serum – with and without the use of technologies such as the NanoSight– as these methodologies may be more easily adopted in resource limited settings. [score:1]
However, further work is clearly required on the exact purpose and mechanism of the release of miR-122 and miR-200a into the circulation. [score:1]
Matching xy pairs were available for 30 individuals in the miR-122 analysis and 31 individuals in the miR-200a and let-7e analyses. [score:1]
A 2 and 1.22 fold difference between means for miR-122 and miR-200a, respectively, were observed (Fig.   3a and b). [score:1]
[1 to 20 of 45 sentences]
25
[+] score: 95
Figure 1 also supports a previous observation that the miR-122 expression increases during directed differentiation of hESCs toward HLCs (Kim et al., 2011). [score:4]
miR-122, a mammalian liver-specific microRNA, is processed from hcr mRNA and may downregulate the high affinity cationic amino acid transporter CAT-1. RNA Biol. [score:4]
Correlation between intracellular ATP activity (expressed as percentage of vehicle control) and number of copies of miR-122 per million cells in the media of (A) hiPSC-derived HLCs and (B) undifferentiated hiPSCs, treated with acetaminophen and diclofenac over 24 h using paired mean values obtained from experimental results summarised in Figure 4. r denotes Pearson’s correlation coefficient, CI denotes the confidence interval of r. However, in contrast to the varying intracellular ATP profile seen in the hiPSCs incubated with acetaminophen and diclofenac (Figs. 5A and 5B), the miR-122 level in the media did not display any increasing trend throughout the range of concentrations of the hepatotoxicants (Figs. 5C and 5D). [score:3]
This study also demonstrates for the first time that HLCs differentiated from hiPSCs exhibit a similar trend of increase in miR-122 expression to hESC-derived HLCs, although only one hiPSC line was examined in this study. [score:3]
We hypothesized that the hepatocyte-enriched expression of miR-122 could be used to detect selectively drug -induced perturbation of the HLCs in non-homogeneous cell cultures. [score:3]
The use of miR-122 as an in vitro biomarker in HLCs was explored using ChiPSC-18-derived HLCs, which were characterized with immunocytochemical analysis and confirmed to express the hepatic markers hepatocyte nuclear factor 4 alpha (HNF4α), alpha-1-antitrypsin and cytokeratin-18 (Figs. 4A–D), and did not express the pluripotency marker Oct3/4 (data not shown). [score:3]
For this study, we first confirmed that the in vitro hepatic mo dels examined express high levels of miR-122, in contrast to the non-hepatic mo dels (Fig. 1). [score:3]
We found that the mean intracellular miR-122 level normalized to the amount of total RNA used for qRT-PCR is the highest in human primary hepatocytes with a 9- to 41-fold lower expression in hPSC-derived HLCs, and 2500-fold lower in HepG2 (Fig. 1). [score:3]
MiR-122 Expression Increases during Directed Differentiation of hESCs and hiPSCs Toward HLCs. [score:3]
In parallel experiments, we also used the undifferentiated hiPSCs (ChiPSC-18) (Figs. 4E and 4F) from which the HLCs were derived from, as a surrogate for poorly differentiated cells present in HLC cultures that do not possess a hepatic phenotype and express a very low level of intracellular miR-122 relative to hepatic cells, to examine the hepatic specificity of miR-122 as an in vitro marker of toxicity. [score:3]
Correlation between intracellular ATP activity (expressed as percentage of vehicle control) and number of copies of miR-122 per million cells in the media of (A) hiPSC-derived HLCs and (B) undifferentiated hiPSCs, treated with acetaminophen and diclofenac over 24 h using paired mean values obtained from experimental results summarised in Figure 4. r denotes Pearson’s correlation coefficient, CI denotes the confidence interval of r. However, in contrast to the varying intracellular ATP profile seen in the hiPSCs incubated with acetaminophen and diclofenac (Figs. 5A and 5B), the miR-122 level in the media did not display any increasing trend throughout the range of concentrations of the hepatotoxicants (Figs. 5C and 5D). [score:3]
The total number of copies of miR-122 expressed by an equivalent number of hiPSCs was also at least 78-fold less than that expressed by the HLCs, and therefore the potential contributory effect of miR-122 from the non-hepatocyte cells in HLC cultures toward the total number of copies of miR-122 measured in the media was negligible. [score:3]
We propose that miR-122 is one such hepatocyte-enriched marker that can be applied in hepatic mo dels that incorporate hepatocytes or HLCs that express high levels of miR-122. [score:3]
MicroRNA-122 has been shown to be a liver-enriched and -abundant miR, which could be useful as a bridging biomarker of drug -induced hepatotoxicity to translate findings from in vitro experiments to in vivo experiments and the clinical setting. [score:3]
For the human primary hepatocyte samples, both the total copies of miR-122 in the cellular and media components were determined separately, and the percentage of miR-122 in the media was expressed as a percentage of the combined total of intracellular and extracellular miR-122 copies in the well, analogous to the LDH cytotoxicity assay. [score:2]
One major advantage of using miR-122 as an in vitro biomarker is the potential to translate such in vitro findings to in vivo animal mo dels and human samples using the same assay, as miR-122 in the plasma has been shown to be an appropriate marker of acetaminophen -induced liver injury in a mouse mo del and in humans (Antoine et al., 2013; Harrill et al., 2012; Starkey Lewis et al., 2011; Wang et al., 2009). [score:2]
Human primary hepatocytes also expressed significantly more miR-122 compared with undifferentiated hPSCs (3900- to 78 000-fold lower) and the pancreatic cancer cell line Suit2 (17 000-fold lower), which was included as part of the comparison as a negative control for non-hepatic cells of the endodermal lineage. [score:2]
The number of copies of miR-122 estimated in the media was normalized to the number of cells estimated to be present in the HLC and hiPSC cultures to allow for a direct comparison of absolute quantities of miR-122 in the media. [score:2]
Using miR-122 as a marker for drug -induced toxicity in the same experiments, a trend toward an increase in the number of copies of miR-122 in the media of HLCs was noted with acetaminophen and diclofenac, with a mean 4-fold and 6-fold increase from baseline, respectively, at the highest concentrations used in these experiments (Figs. 5C and 5D). [score:1]
There was also a similarly high positive correlation between the mean percentage of total LDH activity and the mean number of copies of miR-122 in the media (Pearson’s correlation coefficient, r = 0.945, P < 0.0001, 95% CI 0.810–0.985) (Supplementary Fig. 3B). [score:1]
The Level of miR-122 in the Media Reflects Hepatocyte-Specific Drug-Induced Toxicity in hiPSC-Derived HLCs. [score:1]
For comparison of the intracellular miR-122 level between mo dels, the mean and the standard error of the mean of each mo del were determined. [score:1]
Defining the effects of other hepatotoxicants that induce DILI through other mechanisms such as cholestasis and steatosis on the dynamics of miR-122 release may help in unravelling this uncertainty. [score:1]
This suggests that using the mo del of human primary hepatocytes, miR-122 is equivalent to LDH when used as an in vitro biomarker of drug -induced toxicity. [score:1]
Data are presented as the mean total number of copies of intracellular miR-122 per µg of total RNA ± SEM for human primary hepatocytes, hPH (n = 6 different donors), HLCs differentiated from HUES7 and Shef-3 hESC lines (n = 3 separate differentiation experiments each), HLCs differentiated from ChiPSC-18 hiPSC line (n = 3 separate differentiation experiments), HepG2 (n = 3 biological replicates from one experiment), Suit2 (n = 3 biological replicates from one experiment) and undifferentiated human pluripotent stem cell (hPSC) lines (n = 3 independent experiments each). [score:1]
The lower intracellular miR-122 levels in the various mo dels in comparison to freshly isolated human primary hepatocytes suggest that the quantity of intracellular miR-122 broadly reflects the mo dels’ degree of hepatic phenotype. [score:1]
It is also unclear if drug -induced toxicity per se or individual drugs have any effect on the synthesis or degradation of mature miR-122, although data shown in Supplementary Figures 1 and 2 suggest that the hepatotoxicants examined in this study at least, have no effect on the steady state level or the total number of copies of miR-122 in the human primary hepatocyte cultures. [score:1]
Although the application of miR-122 for detecting drug -induced toxicity is shown in this study, the basis for the increase of miR-122 in the media during drug -induced toxicity is still unclear. [score:1]
FIG. 6. Correlation of intracellular ATP activity with miR-122 level in the media. [score:1]
Intracellular miR-122 Levels Reflect the Physiological Relevance of Human Hepatic Mo dels. [score:1]
We found that the level of miR-122 increased in the media with increasing concentrations of acetaminophen and diclofenac, which paralleled the extracellular release of intracellular LDH. [score:1]
Although we have shown the utility of miR-122 in the human primary hepatocyte and HLC mo dels, validation experiments of its predicted utility in complex coculture hepatic mo dels still need to be conducted. [score:1]
The amplification efficiency of cel-lin-4 cDNA was confirmed in independent experiments to be comparable to that of miR-122 cDNA, with similar standard curves constructed. [score:1]
Future challenges include defining the mechanism(s) by which miR-122 is released into the media and understanding the effect of drugs on miR-122 biogenesis and stability. [score:1]
We then explored the use of miR-122 in complex human hepatic mo dels which may not be homogeneous such as cultures of HLCs, where the differentiation efficiency can be variable and not 100% predictable (Baxter et al., 2010; Kia et al., 2013). [score:1]
FIG. 1. Quantitative comparison of intracellular miR-122 between human hepatic mo dels. [score:1]
Analysis utilizing the paired values of both biomarkers from the experiments using hiPSCs described above, also showed no correlation between the levels of miR-122 in the media and the change in intracellular ATP levels in the hiPSCs (Pearson’s correlation coefficient, r = 0.041, P = 0.901, 95% CI −0.546 to 0.601). [score:1]
It has a wide dynamic range and the denominator of the total number of copies of miR-122 in both the cellular lysates and the media component remained fairly constant throughout the various validation experiments (Supplementary Figs. 1 and 2). [score:1]
A feedback loop between the liver-enriched transcription factor network and miR-122 controls hepatocyte differentiation. [score:1]
Bridging in vitro and in vivo studies can now be performed to further define the mechanism(s) of miR-122 release, which will enhance the mechanism -based utility of miR-122 both as a quantitative and qualitative marker of liver injury. [score:1]
In those experiments, the endpoint of change in intracellular ATP level was confirmed to correlate significantly with the percentage of total LDH activity in the media, percentage of total miR-122 in the media and the number of copies of miR-122 per million cells in the media (data to be published elsewhere). [score:1]
For each donor batch of hepatocytes, parallel experiments were performed in duplicates to compare the sensitivity of LDH and miR-122 as biomarkers. [score:1]
In other words, miR-122 can be used to bridge results in in vitro experiments to clinical findings, and conversely used to link findings from clinical studies to inform on the relevance of in vitro mo dels being developed for the study of DILI, which the current conventional in vitro markers such as LDH and ATP could not provide. [score:1]
More importantly, at the toxic concentrations of acetaminophen and diclofenac, where a reduction of intracellular ATP level and an increase in miR-122 in the media of treated HLCs was detected (Figs. 5A–D), the corresponding miR-122 level in the media of hiPSCs treated with the same concentrations remained unchanged. [score:1]
In summary, this report demonstrates that miR-122 detection in cell culture media can be used as an in vitro marker of drug -induced cytotoxicity in homogeneous cultures of hepatic cells, and also can be applied as a hepatocyte-enriched marker of toxicity in heterogeneous cultures of hepatic cells. [score:1]
Therefore, miR-122 can also be potentially exploited as a biomarker of physiological relevance of current and emerging in vitro hepatic mo dels for mechanistic studies of DILI, by correlating their intracellular level of miR-122 to the biochemical and functional phenotype. [score:1]
However, increased cellular -mediated release of miR-122 in microparticles, exosomes, or protein complexes as a response to toxic chemical exposure cannot be excluded (Salminen et al., 2011). [score:1]
However, our finding of a high correlation between the increases in LDH and miR-122 in the media of human primary hepatocytes treated with hepatotoxicants suggests that miR-122 may be passively released from necrotic cells (Figs. 2 and 3), which is in keeping with the finding that miR-122 predominantly is increased in the protein-rich fraction rather than the exosome-rich fraction in the plasma/serum samples of a mouse mo del of acetaminophen -induced liver injury (Bala et al., 2012). [score:1]
Percentage of total LDH and miR-122 in the media of human primary hepatocytes at 24 h post-treatment with (A) acetaminophen and (B) diclofenac. [score:1]
The number of copies of miR-122 in each PCR reaction was quantified using the absolute quantification method with a standard curve of cel-lin-4 cDNA used as a surrogate for miR-122 cDNA, due to its similar nucleotide length and to avoid contamination of PCR reactions with synthetic miR-122. [score:1]
Using the experimental values obtained from the dose-response experiments of hepatocytes treated with various concentrations of acetaminophen and diclofenac, we found a high positive correlation between the mean percentage of total miR-122 and the mean number of copies of miR-122 in the media (Pearson’s correlation coefficient, r = 0.967, P < 0.0001, 95% CI 0.882–0.991) (Supplementary Fig. 3A). [score:1]
Nevertheless, the data presented here establish the potential of miR-122 as a useful in vitro marker of drug -induced toxicity. [score:1]
Real-Time Quantitative RT-PCR (qRT-PCR) Analysis of miR-122. [score:1]
The Relative Level of miR-122 Detected in the Media Correlates with the Extracellular Release of LDH in Drug-Induced Toxicity of Human Primary Hepatocytes. [score:1]
The total number of copies of miR-122 in each sample was then extrapolated from this figure. [score:1]
Overall, the results in Figure 1 confirm that miR-122 is highly enriched in human primary hepatocytes and provide a quantitative comparison of intracellular miR-122 among the most relevant human hepatic in vitro mo dels currently used. [score:1]
However, there was no significant difference between the mean intracellular miR-122 levels among the HLCs derived from the 2 hESC lines and ChiPSC-18, or between the low levels of mean intracellular miR-122 detected in the undifferentiated pluripotent stem cell lines. [score:1]
In HLCs differentiated from their respective hESC lines, the mean fold increase of miR-122 from basal levels in their originating undifferentiated hESC lines was similar (420- and 430-fold change, respectively), whereas in the HLCs differentiated from the hiPSC line (ChiPSC-18), the mean increase in miR-122 level was higher at 3500-fold (Fig. 1). [score:1]
By plotting the paired values of each biomarker obtained from the experiments using various concentrations of acetaminophen and diclofenac in a scatter graph, we confirmed that there was a high positive correlation between the levels of LDH and miR-122 in the media (Pearson’s correlation coefficient, r = 0.993, P < 0.0001, 95% CI 0.974–0.998) (Fig. 2C). [score:1]
MiR-122 levels in each sample were determined using the TaqMan gene expression assay (Applied Biosystems) according to the manufacturer’s protocol. [score:1]
Thus, the source of increased level of miR-122 in a heterogeneous culture such as HLCs treated with toxic concentrations of hepatotoxicants was likely to be from hepatic cells with a high level of intracellular miR-122—in this case well-differentiated HLCs. [score:1]
[1 to 20 of 61 sentences]
26
[+] score: 92
As shown in Figure 5D, 5E, 5F, 5G, forced miR-122 expression could inhibit the expression of IGF-1R at mRNA and protein levels both in BGC823 and CTC141, while down-regulation of miR-122 with miR-122 inhibitor could enhance the expression of IGF-1R in SGC7901 and GES. [score:14]
Indeed, enhanced miR-122 expression with miR-122 mimics could inhibit the expression of MALAT1 in BGC823, while miR-122 inhibitor could enhance the expression of MALAT1 in SGC7901 (Figure 5B, 5C). [score:11]
Our unpublished data indicated that the expression IGF-1R, a target of miR-122 was positively correlated with the expression of MALAT1 in gastric cancer cell lines. [score:7]
Further studies indicated that the process of miR-122 down-regulated MALAT1 expression might involve IGF-1R. [score:6]
Indeed, miR-122 could inhibit the expression of MALAT1. [score:5]
Our unpublished data have indicated that the expression of miR-122 was negatively correlated with that of MALAT1 in gastric cells, while IGF-1R, a target of miR-122, was positively correlated with the MALAT1 level (Unpublished data). [score:5]
In all, the current study indicated that MALAT1 up-regulation might be a valuable biomarker for the distant metastasis in gastric cancer patients, and miR-122-IGF-1R signaling might be involved in the MALAT1 dysregulation in gastric cancer. [score:5]
These preliminary data suggested that the miR-122-IGF-1R axis could regulate the expression of MALAT1 in GC cells. [score:4]
The miR-122-IGF-1R signaling might participate in the dysregulated MALAT1 expression in gastric cancer. [score:4]
The plasma miR-122 was down-regulated in distant metastasis gastric cancer [24]. [score:4]
We previously reported that miR-122 was significantly down-regulated in GC/DM plasma. [score:4]
And our unpublished data also indicated that miR-122, as well as IGF-1R knockdown could significantly inhibit cell proliferation, migration and invasion in gastric cancer cells. [score:4]
The miR-122-IGF-1R signaling correlated with the deregulated MALAT1 expression in gastric cancer cells. [score:4]
We then investigated whether miR-122 could inhibit the expression of MALAT1 in gastric cancer cells. [score:3]
The miR-122 mimic and inhibitor, siRNAs against MALAT1 and IGF-1R were designed and synthesized by Ribobio (Ribobio, Guangzhou, China). [score:3]
So our preliminary data combined with several recent studies suggested that the miR-122-IGF-1R axis might participate in the MALAT1 dysregulation in gastric cancer. [score:2]
So we test whether miR-122 could regulate the MALAT1 level in gastric cancer cells. [score:2]
The miR-122-IGF-1R signaling correlated with the dysregulation of MALAT1 in gastric cancer cell. [score:2]
Figure 5(A) Plasma levels of MALAT1 and miR-122 is negatively correlated in the validation set. [score:1]
The presented data indicated that plasma level of MALAT1 was negatively correlated with miR-122. [score:1]
As shown in Figure 5A, the plasma levels of MALAT1 was negatively correlated with that of miR-122 in the validation set (r= −0.5576, P < 0.01). [score:1]
[1 to 20 of 21 sentences]
27
[+] score: 90
The liver-expressed miR-122 binds to two closely spaced miR-122 target sites in the 5' non-coding region (NCR) of the HCV genome, resulting in up-regulation of viral RNA levels [143]. [score:8]
Hence, more sensitive methods, such as qPCR or ELISA, might be better suited to estimate antimiR effects on single direct targets, as shown in Figure 3E for two direct miR-122 target mRNAs in the mouse liver. [score:7]
Furthermore, transcriptional profiling and histopathology of liver biopsies demonstrated de-repression of target mRNAs with canonical miR-122 seed sites, down-regulation of interferon-regulated genes and improvement of HCV -induced liver pathology [107]. [score:7]
The tumor-suppressive effects of miR-122 have been linked to several direct miR-122 targets implicated in HCC tumorigenesis, such as cyclin G1, RHOA and the metalloprotease ADAM17. [score:6]
Furthermore, systemic delivery of antagomir-122 by three intravenous (i. v. ) injections of 80 mg/kg led to efficient inhibition of the liver-expressed miR-122 with concomitant de-repression of liver mRNAs with miR-122 seed match sites and a 40% decrease in serum cholesterol levels in the treated mice [104]. [score:5]
Notably, inhibition of miR-122 by antimiR oligonucleotides leads to rapid loss of HCV RNA in cultured liver cells, which makes miR-122 an attractive therapeutic target for antiviral intervention [143, 146]. [score:5]
Besides its role in modulating cholesterol homeostasis and promoting HCV RNA abundance, miR-122 has also been suggested to be important for maintaining liver cell identity and reported to be down-regulated in HCC [148- 150]. [score:4]
Interestingly, other studies have reported that miR-122 expression is either maintained or increased in HCV -associated HCC [150, 153]. [score:3]
Therapeutic targeting of microRNA-122 for treatment of hepatitis C virus infection. [score:3]
Effective targeting of miR-122 by LNA/2'- O-Me and 2'-F/MOE modified antimiRs (Figure 2B), respectively, has also been reported [77, 94]. [score:3]
The landscape plots resulting from this type of analysis (Figure 3F) show the significance profiles of all sequence motifs of a given length across the sorted gene list, as shown in Figure 3F for two different LNA -modified antimiR oligonucleotides targeting miR-122. [score:3]
Using single i. p. injections of the LNA-antimiR at doses ranging from 1 to 200 mg/kg we observed a dose -dependent lowering of serum cholesterol in mice with a median effective dose of 10 mg/kg, whereas treatment of high fat diet-fed mice with 5 mg/kg LNA-antimiR twice weekly for six weeks led to sustained lowering of serum cholesterol by 30% and de-repression of predicted target mRNAs with canonical miR-122 seed match sites [90]. [score:3]
As expected, pharmacological inhibition of miR-122 in HCV patients resulted in decreased levels of serum cholesterol, apoA and apoB. [score:3]
Loss of miR-122 expression in HCC was shown to be associated with poor prognosis, acquisition of an invasive phenotype and with intrahepatic metastasis [150- 152]. [score:3]
Consistent with these observations, we found that inhibition of miR-122 function in cultured Huh-7 cells by different LNA/DNA mixmers was affinity dependent and identified a LNA -modified antimiR with a high T [m ]of 80°C, which mediated efficient de-repression of a miR-122 luciferase reporter upon co-transfection of the antimiR-122 into Huh-7 cells at 5 nM concentration [90]. [score:3]
Moreover, Varnholt et al. [153] observed strong up-regulation of miR-122 in an extended sample set of HCV -induced dysplastic nodules and HCCs, which implies that the role of miR-122 in HCV-derived HCCs is different compared to that in HCCs of non-HCV etiologies. [score:3]
Several studies have reported on pharmacological inhibition of miR-122 in mice using antimiR oligonucleotides [77, 90, 96, 100, 104, 106]. [score:3]
A systemically delivered 8-mer antimiR-122 (three i. v. doses of 5 or 20 mg/kg) was shown to sequester miR-122 in the mouse liver, leading to concomitant de-repression of predicted miR-122 target mRNAs with canonical 3' UTR seed match sites and dose -dependent lowering of serum cholesterol, which is consistent with previous reports in rodents and non-human primates [90, 103, 104, 106]. [score:3]
While further studies are needed to establish the potential risks associated with long-term therapeutic silencing of miR-122, it is important to note that short-term inhibition of miR-122 in rodents and non-human primates was shown to be reversible [90, 96], and furthermore, that the duration of treatment of HCV-infected patients with an antimiR-122 is expected to be limited. [score:3]
The data from stepwise mutational analyses suggest a mo del for an oligomeric miR-122-HCV complex in which one miR-122 molecule binds to the 5' terminus of the HCV RNA with 3' overhanging nucleotides masking the 5' terminal sequences of the HCV genome. [score:2]
Moreover, systemic administration of PBS-formulated LNA-antimiR to African green monkeys at doses ranging from 1 to 10 mg/kg with three i. v. infusions over five days resulted in accumulation of the LNA-antimiR compound in the liver and concomitant, dose -dependent sequestration of mature miR-122 in a shifted LNA-antimiR:miR-122 heteroduplex in Northern blots. [score:1]
We have described potent and specific miR-122 silencing in vivo using a high-affinity 15 nucleotide LNA/DNA mixmer PS oligonucleotide complementary to the 5' end of miR-122 [90]. [score:1]
More recently, we assessed the potential of miR-122 antagonism as a new anti-HCV therapy in chimpanzees with chronic HCV infection [107]. [score:1]
The highlighted words in the plots correspond to canonical miR-122 seed match sites and to perfect match binding sites for the 8-mer antimiR-122. [score:1]
Furthermore, the fact that both miR-122 seed sites are conserved in all HCV genotypes suggests that the antiviral effect of antimiR-122 will be genotype-independent, which was recently confirmed [154]. [score:1]
In this study, systemic delivery of unconjugated, saline-formulated antimiR-122 resulted in efficient sequestration of miR-122 leading to a dose -dependent and long-lasting decrease of serum cholesterol levels in mice and African green monkeys without any evidence for acute or subchronic toxicities in the study animals [90]. [score:1]
This unusual interaction was first described by Peter Sarnow in 2005 [143], and was subsequently confirmed by several reports [144- 146], implying that miR-122 is an essential host factor for HCV RNA accumulation in infected liver cells. [score:1]
These findings suggest that miR-122 protects the 5' terminal viral sequences from nucleolytic degradation or from inducing innate immune responses to the RNA terminus [147]. [score:1]
The Northern blot was probed for miR-122 and U6. [score:1]
We have previously shown that potent miR-122 antagonism can be achieved in rodents and non-human primates using a high-affinity 15-mer LNA -modified antimiR-122. [score:1]
[1 to 20 of 30 sentences]
28
[+] score: 85
Moreover, compound C reversed the suppression of miR-122 expression by 2-OA (Figure S3), indicating 2-OA inhibit miR-122 expression through activated AMPK. [score:9]
Active AMPK also induces ISGs, and suppresses miR-122 expression, thereby inhibiting HCV infection. [score:7]
To examine that the inhibitory of miR-122 expression directly links the antiviral activity of 2-OA, we have performed additional experiments. [score:6]
To determine the causal relationship between AMPK activation and the induction of ISGs and downregulation of miR-122 by 2-OA, we performed the siRNA knockdown experiments. [score:5]
Figure S3 2-OA inhibits miR-122 expression in HCV-infected hepatocytes through activated AMPK. [score:5]
2-OA Induces ISGs and Inhibits the Expression of miR-122 through Activated AMPK. [score:5]
Importantly, activated AMPK by 2-OA inhibited the expression of miR-122 in virus-infected hepatocytes. [score:5]
2-OA induces ISGs and inhibits the expression of miR-122 through activated AMPK. [score:5]
Knockdown of AMPK expression by its siRNA also attenuated the repression of miR-122 by 2-OA (Figure 5F). [score:4]
Moreover, knock down of AMPK reversed both the induction of ISGs and suppression of miR-122 by 2-OA. [score:4]
These data indicated that activated AMPK is responsible for both the induction of ISGs and inhibition of miR-122 by 2-OA. [score:3]
Activated AMPK is responsible for both the induction of ISGs and inhibition of miR-122 by 2-OA. [score:3]
MiR-122 is a highly abundant, liver-expressed microRNA that binds to two sites near the 5′ end of HCV genome, resulting in up -regulating of viral RNA levels. [score:3]
The expression of miR-122 was normalized with GAPDH. [score:3]
As showed in Figure 5G, miR-122 overexpression reversed the antiviral effect of 2-OA. [score:3]
All the data suggested that the antiviral activity of 2-OA is partially through inhibition of miR-122 by activated AMPK. [score:3]
MiR-122 overexpression reversed the antiviral effect of 2-OA. [score:2]
The authors demonstrated an increase in phosphorylated AMPK in the livers of mice with miR-122 knockdown, but failed to clarify the relationship between miRNA-122 and AMPK activity. [score:2]
MiR-122 was overexpressed in HCV-infected cells and the cells were treated by 2-OA. [score:2]
MiR-122 was overexpressed in HCV-infected cells and the cells were treated by 100 µM 2-OA for 48 hours. [score:2]
It is logical to test whether the antiviral activity of 2-OA is associated with miR-122. [score:1]
As shown in Figure 5C, HCV-infected hepatocytes with 2-OA treatment had much lower level of miR-122 than untreated control cells. [score:1]
In the liver, miR-122 is associated with more than 200 cellular genes, including those involved in lipid metabolism [24]. [score:1]
MiRNA-122 has been demonstrated to be important for regulating liver lipid metabolism [27], [28]. [score:1]
[1 to 20 of 24 sentences]
29
[+] score: 84
Other miRNAs from this paper: hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-187, hsa-mir-181a-1, hsa-mir-221, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-152, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-193a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-148b, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-454, ssa-mir-10a-1, ssa-mir-10a-2, ssa-mir-10b-1, ssa-mir-10b-2, ssa-mir-10b-3, ssa-mir-10b-4, ssa-mir-10d-1, ssa-mir-10d-2, ssa-mir-122-1, ssa-mir-122-2, ssa-mir-125b-1, ssa-mir-125b-2, ssa-mir-125b-3, ssa-mir-146a-1, ssa-mir-146a-2, ssa-mir-146a-3, ssa-mir-148a, ssa-mir-148b, ssa-mir-152, ssa-mir-16a-1, ssa-mir-16a-2, ssa-mir-181a-1, ssa-mir-181a-2, ssa-mir-181a-3, ssa-mir-181a-4, ssa-mir-181a-5, ssa-mir-181b, ssa-mir-181c, ssa-mir-192a-1, ssa-mir-192a-2, ssa-mir-192b, ssa-mir-193, ssa-mir-21a-1, ssa-mir-21a-2, ssa-mir-21b, ssa-mir-221, ssa-mir-23a-3, ssa-mir-23a-4, ssa-mir-23a-1, ssa-mir-23a-2, ssa-mir-25-1, ssa-mir-25-2, ssa-mir-25-3, ssa-mir-26a-1, ssa-mir-26a-2, ssa-mir-26a-3, ssa-mir-26a-4, ssa-mir-26a-5, ssa-mir-26a-6, ssa-mir-26b, ssa-mir-26d, ssa-mir-30a-3, ssa-mir-30a-4, ssa-mir-30a-1, ssa-mir-30a-2, ssa-mir-30b, ssa-mir-30c-1, ssa-mir-30c-2, ssa-mir-30d-1, ssa-mir-30d-2, ssa-mir-30e-1, ssa-mir-30e-2, ssa-mir-30e-3, ssa-mir-454, ssa-mir-462a, ssa-mir-92a-1, ssa-mir-92a-2, ssa-mir-92a-3, ssa-mir-92a-4, ssa-mir-92b
In mammals, MIR122 is involved in maintaining an adult-liver phenotype by suppressing the expression of non-liver genes [76], and it is well recognized as a tumor suppressor, since loss of its function leads to hepatocarcinogenesis [77]. [score:7]
From day 2 of the exposure period to day 28, all but one of the examined miRNAs followed two distinct trends: one group of miRNAs was up-regulated (MiR10b-5p, MiR21a-3p, MiR23a-3p, MiR125b-1-3p, MiR221-3p), while the other group was down-regulated (MiR92b-3p, MiR122-5p, MiR122-2-3p, MiR152-5p). [score:7]
Several up-regulated (MiR21a-3p, MiR125b-1-3p, MiR23a-3p, MiR10b-5p, MiR221-3p) and down-regulated (MiR92b-3p, MiR152-5p, MiR122-2-3p or MiR122-5p) miRNAs shown in Fig 4A have been implicated in cirrhosis and hepatocellular carcinoma in humans [31]. [score:7]
It has been suggested that downregulation of MIR122 expression may be involved in mediating intrahepatic bile duct injury or liver fibrosis [75]. [score:6]
We focused on 6 aberrantly expressed miRNAs found in our study (MiR122, MiR92a(b), MiR146a, MiR148a, MiR221) for which contributions to a disease state of liver in humans have been proven. [score:5]
In contrast to MiR122 expression profile, MiR21 and MiR221 were upregulated after exposure to MC-LR (Fig 6). [score:5]
The down-regulated miRNAs included MiR92b-3p and MiR122-5p, which both showed at least 4-fold decrease (Fig 3). [score:4]
Particularly, MiR122 is one of the most important liver-specific miRNAs [75], which in our study was consistently downregulated after exposure to MC-LR (Fig 6). [score:4]
First, since salmonids (salmon and whitefish) have undergone an additional whole genome duplication compared to many other animal species [49], the isomiR pattern may be a result of different expression bias of mir122 gene paralogues; two S. salar sequences putatively expressed from two mir122 loci are presented in Fig 8A. [score:4]
Most likely, the G/A difference which occurs in the region outside the seed of the mature MiR122-5p sequence suggests rather the–GA- isomiRs represent expression products from two homozygous mir122 genetic loci carrying either nucleotide. [score:3]
However, MIR122, MIR21, and MIR221, collectively, have been reported to be aberrantly expressed after MC-LR exposure in the mice and human liver cells, both in vivo and in vitro [80, 81]. [score:3]
Thus, we focused on the MiR122 isomiR profiles from the 5p arm which exhibited an aberrant expression profile in the studied liver samples. [score:3]
In further analysis, we were particularly interested whether expression profiles of miRNA variants of liver specific MiR122 can be distinguished between the groups of MC-LR challenged and healthy fish (S6 Table); we selected these miRNA loci because they produce a considerable number of isomiRs that we can use to interpret the correlation patterns. [score:3]
Similarly dubious seems that the -GA- isomiRs have resulted from co -expression of two allelic variants from one heterozygous mir122 locus. [score:3]
Interestingly, the consistent expression pattern of the miRNAs (MiR122↓, MiR21↑, MiR221↑) found in our study is in compliance with the previous reports. [score:3]
In our initial study, we showed that 5 out of 8 miRNAs, MiRlet7c, MiR16a, MiR21a, MiR34a and MiR122, were deregulated in the liver of whitefish (Coregonus lavaretus) after short-term (2 d) exposure to MC-LR [35]. [score:2]
These findings provide evidence that subsets of miRNA genes, including mir10, mir122, and mir92, are commonly deregulated in vertebrate liver tissue and can potentially underlie initiation and progression of destructive processes in liver cells. [score:2]
Even though the correlation patterns of either MiR122-5p or MiR122-2-3p isomiRs argue for the importance of the findings, the biological implications of the isomiR categories and pathways regulated is not currently understood. [score:2]
Sequence differences and correlation patterns between multiple MiR122 isomiRs detected in whitefish. [score:1]
As seen in Fig 8B, the hierarchical analysis revealed that the isomiR cluster comprises two subgroups: one subgroup contained 38 isomiRs, which shared the same 15 and 16 nt (-GA-) as the canonical miRNA and formed clusters based mainly on the isomiR 3' length; the second group contained isomiRs of different 3' lengths, but sharing double G at nucleotide position 15 and 16 of the archetype MiR122-5p. [score:1]
The data suggest that the isomiRs detected in the current study are products of two mir122 loci, mir122-1 and mir122-2. (B) (C) Hierarchical clustering (HCL) analyses (1-Pearson correlation) on the isomiRs 122-5p and 122-2-3p, respectively. [score:1]
With respect to 3p length variants, of a total 148 distinct miRNAs filtered for the analysis, 9 miRNAs differed significantly between groups (FDR < 0.05), and another four differed with respect to non-templated A additions (MiR125b-5p and MiR122-5p), non-templated C additions (MiR30d-5p), and non-templated U additions (MiRlet7b-5p). [score:1]
0158899.g008 Fig 8(A) Nucleotide differences, marked with capital letters, within pre-miR122 sequences from whitefish and Atlantic salmon. [score:1]
Fig 8 shows that 43 isomiR variants of the MiR122-5p (Fig 8B) and four isomiRs of the MiR122-2-3p (Fig 8C) distinguish control from the MC-LR treated samples. [score:1]
If the liver metabolic networks are evolutionarily conserved between species and connected by specific miRNAs (such as MiR21, MiR122, or MiR221), our results suggest severe consequences for the liver cell maintenance and may provide molecular background explaining how MC-LR affects biological systems on a larger scale. [score:1]
The set of filtered miRNA variants of liver specific MiR122. [score:1]
Liver specific MiR122-5p and MiR122-2-3p isomiR profiles correlate with MC-LR treatment. [score:1]
Among the latter, MiR122-5p had the most isomiRs (43 isomiRs) followed by MiR26a-5p (35 isomiRs) and MiRlet7a-5p (31 isomiRs). [score:1]
The most abundant miRNA families were MiR10 (19.91%), MiR181 (19.36%), MiRlet7 (9.24%), MiR30 (8.61%), MiR25 (7.81%), and MiR122 (6.54%), followed by MiR26 (4.78%), MiR21 (4.76%) and MiR192 (4.21%) (Fig 2C). [score:1]
[1 to 20 of 29 sentences]
30
[+] score: 84
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Izzotti et al. (2009a, b) have monitored the expression of 484 miRNAs in the lungs of mice exposed to cigarette smoking, the most remarkably downregulated miRNAs belonged to several miRNA families, such as let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223. [score:6]
In HCC, miR-122 is downregulated in approximately 70% of cases, suggesting a tumor suppressor function for this miRNA (Bai et al., 2009; Fornari et al., 2009; Ma et al., 2010; Callegari et al., 2013). [score:6]
MicroRNA-122 suppresses cell proliferation and induces cell apoptosis in hepatocellular carcinoma by directly targeting Wnt/β-catenin pathway. [score:5]
Bcl-w is a direct target of miR-122 that functions as an endogenous apoptosis regulator in these HCC-derived cell lines (Lin et al., 2008). [score:5]
Loss of miR-122 expression in liver cancer correlates with suppression of the hepatic phenotype and gain of metastatic properties. [score:5]
miR-122 inhibits viral replication and cell proliferation in hepatitis B virus-related hepatocellular carcinoma and targets NDRG3. [score:5]
In HCC has been reported up -expression of miR-21, miR-221, miR-22, miR-15, miR-517a, and down -expression of miR-122, miR-29 family, miR-26a, miR-124, let-7 family members, and miR-199a/b-3p (Szabo et al., 2012). [score:5]
The high expression of miR-122 in the liver appears to correlate with a central role in various functions of normal and diseased livers (Lewis and Jopling, 2010; Negrini et al., 2011). [score:5]
The role of miR-122 in liver cancer has been demonstrated directly by the generation of miR-122 knockout mice (Hsu et al., 2012; Tsai et al., 2012) These mice were characterized by hepatic inflammation, fibrosis, and development of spontaneous tumors similar to HCC, demonstrating the tumor-suppressor function of this miRNA and its important role in liver metabolism and differentiation of hepatocytes (Jensen et al., 2003; Gramantieri et al., 2007; Lin et al., 2008; Bai et al., 2009; Fornari et al., 2009; Tsai et al., 2009; Callegari et al., 2013). [score:4]
Downregulation of miR-122 in the rodent and human hepatocellular carcinomas. [score:4]
Rather surprisingly, given the high intracellular levels and numerous targets of miR-122, inactivation of the miRNA does not have any apparent adverse effects on liver physiology. [score:3]
However, reduced miR-122 expression does show an association with hepatocellular carcinoma, and further work will be necessary. [score:3]
In addition, loss of miR-122 expression in patients with liver cancer is correlated with the presence of metastasis and a shorter time to recurrence (Coulouarn et al., 2009; Fornari et al., 2009; Tsai et al., 2009). [score:3]
MicroRNA-122, a tumor suppressor microRNA that regulates intrahepatic metastasis of hepatocellular carcinoma. [score:3]
Expression of miR-122 mediated by adenoviral vector induces apoptosis and cell cycle arrest of cancer cells. [score:3]
miR-122 targets an anti-apoptotic gene, Bcl-w, in human hepatocellular carcinoma cell lines. [score:3]
Expression of microRNAs, miR-21, miR-31, miR-122, miR-145, miR-146a, miR-200c, miR-221, miR-222, and miR-223 in patients with hepatocellular carcinoma or intrahepatic cholangiocarcinoma and its prognostic significance. [score:3]
Regulation and biological function of the liver-specific miR-122. [score:2]
MicroRNA-122 inhibits tumorigenic properties of hepatocellular carcinoma cells and sensitizes these cells to sorafenib. [score:2]
Circulating microRNAs, miR-21, miR-122, and miR-223, in patients with hepatocellular carcinoma or chronic hepatitis. [score:1]
miR-122 is under the transcriptional control of HNF1A, HNF3A and HNF3B and loss of miR-122 results in an increase of cell migration and invasion. [score:1]
miR-122 found up to 70% of total miRNA in the liver, modulates cyclin G1, thus influences p53 protein stability and transcriptional activity and reduces invasion capability of HCC-derived cell lines (Fornari et al., 2009). [score:1]
Wang et al. (2009a) found increase serum concentration of hepatocyte-specific miRNAs including miR-122 and miR-192 within 1 h after acetaminophen exposure. [score:1]
Essential metabolic, anti-inflammatory, and anti-tumorigenic functions of miR-122 in liver. [score:1]
Potential microRNAs that could serve as possible markers of HCC by exposure to aflatoxins are miR-27a, miR-27b, miR-122, miR-148, miR-155, miR-192, miR-214, miR-221, miR-429, and miR-500. [score:1]
From a clinical point of view, miR-122 can be used as a diagnostic and prognostic marker for HCC progression (Coulouarn et al., 2009). [score:1]
ProliferationKutay et al., 2006; Pogribny et al., 2007; Shah et al., 2007; Jiang et al., 2008; Ji et al., 2009a; Li et al., 2009c; Pineau et al., 2010 miR-122/a Stimulation of HCC proliferation. [score:1]
MicroRNA-122 antagonism against hepatitis C virus genotypes 1-6 and reduced efficacy by host RNA insertion or mutations in the HCV 5′ UTR. [score:1]
[1 to 20 of 28 sentences]
31
[+] score: 81
, we reasoned that in Mir122a [-/- ]livers, elevated expression of Klf6, a miR-122 target gene [32], is a simple response to the loss of miR-122a; nonetheless, elevated expression of Klf6 is likely to be the sum of a cascade of events involving the loss of miR-122a and the down regulation of 5 other DNmiRs (miR-17-5, -31, 19a, 93-5p and 144-3p). [score:8]
To date we have detected the expression of 79 experimentally-verified miR-122 targets, which represents only 8.9% (79/886) of the differentially expressed genes (DEGs) [32] in Mir122a [-/- ]livers. [score:7]
In addition, a group of 9 miRNAs was found to share miR-122 target genes, indicating synergy between miRNAs and target genes by way of multiplicity and cooperativity. [score:5]
It is worth mentioning that CTCF, an insulator-and chromatin loop -associated protein as well as an epigenetic regulator, is a direct target of miR-122 [33]. [score:5]
The V-shaped nodes correspond to the miRNAs, while the rectangle-shaped nodes are the target genes, the nodes marked by the blue border represent the co-miR-122 targets, and the octagonal nodes represent the transcription factors (TF). [score:5]
A group of 9 miRNAs was found to share miR-122 target genes, indicating synergy between miRNAs and target genes by way of multiplicity and cooperativity. [score:5]
The fact that many target genes of miR-122 are common to both mouse and human it is highly likely that EZH2, MYCBP, RBBP5, SIN3A, SIN3B, SIRT1, SRF and SUZ12 are mouse miR-122a target genes. [score:5]
This result suggests that miR-122 can potentially modulate the expression of 46 miRNAs via its target transcription factors. [score:5]
CTCF [33] is a miR-122 target gene found in the human HCC cell line, while Hif1a [34] is a recently confirmed miR-122a target in mouse hepatocytes. [score:5]
Ten of the 40 curated TFs, potentially regulating 46 miRNAs, are verified as miR-122 target genes. [score:4]
We identified 9 DEmiRs that can simultaneously regulate 39 miR-122 targets (Table S4.1, S4.2). [score:4]
MicroRNA-122 (miR-122) is a highly abundant, developmental-regulated, liver-specific miRNA. [score:3]
Moreover, we demonstrate that loss of imprinting at the chromosome 12qF1 region is associated with miRNA overexpression in human hepatocellular carcinoma and stem cells, suggesting initiation of precancerous changes in young mice deficient in miR-122. [score:3]
The expression ratio between the mir-122 [-/- ]and WT (KO/WT) is shown. [score:3]
Although the target relationship of miR-122 with EZH2, MYCBP, RBBP5, SIN3A, SIN3B, SIRT1, SRF and SUZ12 has not been studied in mouse liver but it has been identified in starBase with human samples. [score:3]
The octagonal nodes represent the transcription factors (TF) and the V-shaped nodes correspond to the miRNAs, while the nodes marked by the blue border represent the miR-122 targets. [score:3]
Remarkably, we demonstrate that loss of imprinting at 12qF1 is associated with miRNA overexpression in human HCC and stem cells, suggesting initiation of precancerous changes in young mice deficient in miR-122. [score:3]
A systematic, genome-wide investigation of the miRNA -mediated regulatory networks will provide important insights into the molecular mechanisms by which miR-122 modulates liver transcriptome and disease. [score:2]
How miR-122 influences epigenetic regulation of DEGs is not clear. [score:2]
Since miR-122 represents ~70% of the liver miRNAs, the imbalance of the miRNA homeostasis in Mir122a [-/- ]liver can give rise to liver damage. [score:1]
[1 to 20 of 20 sentences]
32
[+] score: 78
Because these transcripts do not contain hsa-miR-122 -binding sites, it is assumed that hsa-miR-122 regulates the expression of HMGCR by the down-regulation of an inhibitor for these genes. [score:9]
However, a comparison of the replication capacities of the double -binding-site mutant and an IRES mutant with a quantitatively equivalent defect in translation suggested that the decrement in translation associated with the loss of hsa-miR-122 binding was insufficient to explain the profound defect in virus production by the double mutant. [score:5]
Currently, anti-HCV treatment based on miR-122 inhibition by antisense oligonucleotide anti-miR-122 (miravirsen or SPC3649) is the first miRNA -targeting treatment in human clinical trials to treat previously untreated CHC patients infected with. [score:5]
According to Jangra et al. (12), translation of RNA was reduced over 50% by mutations in either S1 or S2, and was partially rescued by the transfection of the complementary hsa-miR-122 mutant (12, 13). [score:4]
On the contrary, for HIV-1 and HBV there is no miRNA -targeted therapy, and hsa-miR-122 does show limited identities to HIV-1 and HBV (Table 1). [score:3]
They determined that over -expression of hsa-miR-122 enhanced viral RNA accumulation without affecting genes in the mevalonate pathway, such as the 3-hydroxy-3-methylglutaryl-coenzyme reductase (HMGCR) gene. [score:3]
Hsa-miR-122 expression is inversely correlated with both functional and histopathological liver damage and is believed to stimulate replication through interaction with two adjacent sites downstream of stem loop I (SLI) within the 5'UTR. [score:3]
Currently, hsa-miR-122 is the major therapeutic miRNA against but it does not target other two viruses. [score:3]
Therefore, miR-122, by itself, is not a critical molecular target for therapy. [score:3]
A study that investigated 185 seropositive patients’ sera for and correlated hsa-miR-122 expression and load in liver samples found that hepatic miR-122 expression was not correlated with the viral load (32). [score:3]
We also carried out genome/miRNA alignment to determine the degree of identity of hsa-miR-122 and discovered that even though this miRNA does share a significant (∼88%) identity to, it does not appear to follow the basic rules in relation to having the minimum 19 bp required for functional miRNA expression in vivo and in vitro (9, 21), since it has 17 miRNAs. [score:3]
However, inhibition of hsa-miR-122 decreased both RNA and HMGCR RNA abundance with little effect on the rates of and HMGCR RNA synthesis, and loss of RNA could not be restored by isoprenoid intermediate metabolites. [score:3]
Hence, through our computational analysis, we propose the utility of hsa-miR-3065-3p in TI patients as a potential therapeutic agent infected with/HIV-1/HBV It is worth mentioning that hsa-miR-122 has been the subject of intensive investigations around the globe, and it has been fairly well established that this miRNA appears to play a crucial role in upregulating intracellular replication in hepatic cells (12, 13, 21, 22, 24). [score:2]
An intense interest in the development of a miRNA -based therapy for infection and hsa-miR-122 has received considerable attention. [score:2]
The hsa-miR-122 was named miravirsen by California based Santaris Pharma, which initiated the trials in 2009. hsa-miRs: −99 and −548 identity with, HIV-1, and HBVThe other two miRNAs, hsa-miR- 99 and hsa-miR-548, did show, respectively, 79 and 68% identity with, but their identity with the other two viruses (HIV-1 and HBV) was only significant with other branches of hsa-miRs (Table 1), which may not be important in regulating the viral replications of any of the three viruses. [score:2]
Hsa-miR-122 is a liver-specific miRNA that positively regulates RNA abundance and appears to be essential for the production of infectious. [score:2]
and hsa-miR-122An intense interest in the development of a miRNA -based therapy for infection and hsa-miR-122 has received considerable attention. [score:2]
HCV and hsa-miR-122. [score:1]
We analyzed the identity of hsa-miR-3065-3p through computational analysis and came to the conclusion that it is perhaps a better miRNA than hsa-miR-122 as a therapeutic agent for infection alone or for treatment of TI patients suffering from, HIV-1, and HBV. [score:1]
However, neither of the two miRNAs (i. e. hsa-miR-3065-3p and hsa-miR-122) exhibited 100% identity with. [score:1]
Hence, hsa-miR-122 acts at an additional step in the virus life cycle by producing infectious particles. [score:1]
Furthermore, hsa-miR-122 shares a much lesser identity to HIV-1 and HBV (53 and 71%, respectively), which potentially makes it less effective as a therapeutic treatment agent against TI patients (14– 16). [score:1]
Interestingly, hsa-miR-122 exhibited imperfect homologies in the seed sequences for all three viruses, even for (23). [score:1]
In 2009, miR-122 -based molecular therapy was the first to utilize miRNA in clinical trials involving humans; in 2012, this therapy entered Phase 3 of its clinical trial (21, 24). [score:1]
Viral RNA with base substitutions in both S1 and S2 failed to produce infectious viruses in transfected liver cells, while the virus production was rescued to near-wild-type levels in cells supplemented with a complementary hsa-miR-122 mutant. [score:1]
Miravirsen was designed to recognize and interfere with hsa-miR-122, a liver-specific miRNA that requires for replication. [score:1]
Hsa-miR-122 shows an imperfect identity at seed residue position #4 and hsa-miR-3065-3p shows an imperfect identity at seed residue position #7 in the seed sequence (2–8 bps) to the genome (Table 1). [score:1]
A genetic approach has demonstrated that the ability of hsa-miR-122 to enhance yields of the infectious virus is dependent upon two hsa-miR-122 -binding sites near the 5’ end of the genome, S1 and S2 (12, 21– 24). [score:1]
A comparison of mutants with substitutions in only one site revealed S1 to be dominant, but the S1 mutant did not produce high virus yields in liver cells supplemented with wild-type hsa-miR-122. [score:1]
Interestingly, hsa-miR-122 is only 17 bp long, it has a non-homologous bp match at seed residue position #4 to, and to be a potential candidate for gene -based therapy, the first four bps of the seed sequence should be identical (23, 24), which they are not (Table 1). [score:1]
hsa-miR-122 identity with, HIV-1, and HBV. [score:1]
In addition, hsa-miR-99, hsa-miR-548, and hsa-miR-122 also showed mutual identity with these three viral genomes, albeit at a lower degree (∼52–88%). [score:1]
Their findings suggest that miR-122 modulates viral RNA abundance independently of its effect on isoprenoid metabolism. [score:1]
However, hsa-miR-122 exhibited imperfect homologies in the seed sequences for all three viruses, even for (Table 1). [score:1]
The ‘mature’ and ‘stem-loop’ sequences for hsa-miR-122 and hsa-miR-3065 were obtained from the ‘miRBase’ database (http://www. [score:1]
The hsa-miR-122 was named miravirsen by California based Santaris Pharma, which initiated the trials in 2009. [score:1]
The main focus of this study is hsa-miR-3065-3p and not hsa-miR-122, hsa-miR-99, or has-miR-548. [score:1]
We also make an argument that current proposed therapy with hsa-miR-122 may not be the optimal choice for patients since it lacks essential gene alignment and may be harmful for the patients. [score:1]
[1 to 20 of 38 sentences]
33
[+] score: 77
Other miRNAs from this paper: rno-mir-122
Based on the previous evidence linking epigenetics with stroke occurrence, and in order to reinforce the involvement of miR-122 in this pathological condition, we presently tested the hypothesis that a derangement of brain miR-122 expression level could be an early marker of cerebrovascular disease in our animal mo del. [score:5]
In fact, miR-122 was shown to be downregulated both in animal mo dels of ischemic stroke, including the MCAO rat mo del [7, 8], and in peripheral blood cells of patients suffering from ischemic stroke [7, 10, 11]. [score:4]
The same stimuli were applied to cell dishes in the presence of exogenous mimic miR-122 overexpression. [score:3]
The correlation between miR-122 levels and protein expression levels was conducted by using the Pearson correlation test. [score:3]
In the latter mo del, intravenous administration of exogenous miR-122 led to inhibition of proteins involved in inflammation such as intercellular adhesion molecule 1 (ICAM-1) and, most importantly, to reduced brain injury and neurological deficits [9]. [score:3]
In order to assess the brain miR-122 expression level in SHRSP and SHRSR under both JD and RD, tissue total RNA was obtained using TRIzol reagent (Life Technologies, Carlsbad, CA, USA), subjected to DNAse I treatment (Qiagen, Venlo, Netherlands) and subsequently purified using miRNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. [score:3]
Results were expressed as relative levels of miR-122 under the different experimental conditions. [score:3]
In particular, we showed that the overexpression of miR-122 was able to rescue the cell death induced by both excess NaCl and hydrogen peroxide in a line of brain endothelial cells. [score:3]
In particular, the brain miR-122 expression level was significantly increased in the SHRSR, whereas it was significantly decreased in the SHRSP. [score:3]
Correlation Analysis between miR-122 and Protein Expression Levels in the Two Strains. [score:3]
In order to support the in vivo findings and the hypothesis that miR-122 may be involved in cerebrovascular disease pathogenesis, we tested in vitro the ability of miR-122 to maintain cell survival upon two different stress stimuli. [score:3]
In vitro, the overexpression of miR-122 revealed a significant protective effect on survival in cerebral endothelial cells exposed either to excess NaCl or to hydrogen peroxide. [score:3]
At the end of 4 weeks of dietary treatment, miR-122 expression level was significantly increased in the brains of JD- versus RD-fed SHRSR, whereas it was significantly decreased in the brains of JD- versus RD-fed SHRSP (Figure 1(a)), thus reproducing previous findings in other animal mo dels and in humans [7– 11]. [score:3]
The results of the correlation analysis between miR-122 and protein expression levels are shown in Figure 4 (SHRSP strain) and in Figure 5 (SHRSR strain). [score:3]
Brain Expression of MicroRNA-122 in SHRSP and SHRSR. [score:2]
Interestingly, we detected a differential modulation of brain miR-122 expression level after 4 weeks of high-salt dietary regimen, before stroke occurrence, in the SHRSP as compared to the SHRSR strain. [score:2]
Consistently with our current evidence, the miRNA-122 has been involved in the regulation of inflammation and of cell proliferation through the interference with the NF-kB and toll-like receptor signaling pathways [10]. [score:2]
Herein, the involvement of miR-122 on the regulation of several genes and pathways associated with ischemic stroke, including leukocytes activation and thrombus formation, was demonstrated [10]. [score:2]
As a limitation of our current study, we did not test the impact of exogenous miR-122 administration on the stroke phenotype occurrence of JD-fed SHRSP. [score:1]
In fact, substantial changes in markers of oxidative stress, inflammation, endothelial dysfunction, apoptosis, and necrosis could be detected along with the miR-122 decrease in the brains of SHRSP. [score:1]
On the other hand, levels of miR-122 in the SHRSR positively correlated with CD31 and p-eNOS levels, whereas they negatively correlated with the levels of NF-kB, caspase 3, and vWF (Figure 5). [score:1]
Notably, a decrease of miR-122 level was also detected in blood cells of acute ischemic stroke patients [7, 10, 11]. [score:1]
For the latter purpose, a specific miR-122 mimic (miRvana miRNA mimic, Thermo Fisher, Waltham, USA) was incubated in OPTIMEM (Thermo Fisher) reduced serum medium with a nucleic acid transferring agent (lipofectamine RNAiMAX reagent, Invitrogen, Carlsbad USA) in a final volume of 2 ml/well each for 20 min, following the manufacturer's instructions. [score:1]
In the latter strain, the miR-122 decrease was associated with the early signs of cerebrovascular damage. [score:1]
On the other hand, higher levels of miR-122, as those found in the brains of SHRSR, appear to be protective and, in fact, they were able to preserve cell survival from stress stimuli in vitro. [score:1]
The efficiency of miR-122 mimic transfection was validated by RT-PCR. [score:1]
Levels of miR-122 increased in cells transfected with mimic miR-122 (5.32 ± 0.05 fold changes versus nontransfected cells at 24 hrs; 5.84 ± 0.032 fold changes versus nontransfected cells at 72 hrs). [score:1]
Impact of miRNA122 on Cell Viability, Apoptosis, and Necrosis in MECs. [score:1]
Notably, vWF and ICAM-1 were previously reported to be modulated in association with miR-122 changes in animal mo dels of ischemic stroke [9]. [score:1]
Importantly, to further support our hypothesis, we presently provide a clear cut in vitro demonstration of the significant protective effect of exogenous administration of miR-122 on cell survival upon exposure to stress stimuli. [score:1]
Among others, the microRNA-122 (miR-122) level was significantly reduced in the blood of ischemic rats [8] and in both blood and brain tissues of the middle cerebral artery occlusion (MCAO) rat mo del [9]. [score:1]
Our findings support the use of microRNAs, such as miR-122, as useful biomarkers for stroke prevention and diagnosis. [score:1]
The transfection with mimic miR-122 of MECs exposed to either NaCl or H [2]O [2] rescued the cell viability and reduced apoptosis and necrosis in a significant manner. [score:1]
It has been previously associated with miR-122 levels in other experimental mo dels of stroke [9]. [score:1]
For this purpose, the brain miR-122 level was assessed at the end of one month of JD feeding in SHRSP, before the stroke phenotype occurrence. [score:1]
In Vitro Effects of Mimic miRNA-122 on Rat Brain Microvascular Endothelial Cells Viability. [score:1]
Interestingly, based on our findings, miR-122 may be a contributor to stroke resistance in the SHRSR strain. [score:1]
The overall findings of our investigation suggest that miR-122 plays a contributory role in the pathogenesis of cerebrovascular disease, therefore supporting previous evidence [6, 9]. [score:1]
By performing this statistical test, we were able to obtain a significant linear inverse relationship between miR-122 level and levels of Gp91phox, Nf-kB, vWF, ICAM1, CD31, c-Jun, and caspase 3 in the SHRSP (Figure 4). [score:1]
In summary, the different modulation of miR-122 level, associated with the early signs of cerebrovascular damage, was detected in the brains of SHRSP after four weeks of the stroke permissive diet, before the occurrence of cerebrovascular events. [score:1]
At the end of each stress exposure, performed both in the absence or in the presence of exogenous mimic miR-122, we assessed the effect of miR-122 on cell viability, apoptosis, and necrosis by fluorescent-activated cell sorting (FACS) (Accuri C6 flow cytometer, BD Biosciences, San Jose, CA, USA), following previously reported procedures (16). [score:1]
In addition, the exogenous administration of miR-122 to MCAO rats reduced the brain infarct size and the neurological deficits with improvement of stroke outcomes [9]. [score:1]
[1 to 20 of 42 sentences]
34
[+] score: 72
We propose that an increase in the expression of cytokine IL-6 stimulates the expression of ferritin and hepcidin, decreasing serum iron levels, which is a stimulus to increase the expression of miR-122. [score:7]
The liver specific miR-122 directly targets HFE and HJV, contributing to the regulation of systemic iron homeostasis by decreasing hepcidin mRNA expression (Chen et al., 2008; Mitchell et al., 2008). [score:7]
CCL2 is upregulated by decreased miR-122 expression in iron-overload -induced hepatic inflammation. [score:6]
Iron overload induces a significantly reduced expression of miR-122, which also increases HFE and HJV expression (Castoldi et al., 2011). [score:5]
Also, miR-155 regulated the expression of CEBPβ and PPARγ in adipocytes (Liu et al., 2011; Chen et al., 2013) and miR-122 participate regulating the levels of cholesterol, fatty acids synthesis, and in the cell differentiation (Kim et al., 2011). [score:5]
Human hemochromatosis protein (HFE) and HJV are directly targeted by miR-122, thus decreasing hepcidin gene (HAMP) transcription (Castoldi et al., 2011). [score:4]
Li et al. (2017) and Tang et al. (2017) have demonstrated that iron overload in mice induces the down-regulation of miR-122. [score:4]
Other mechanism that may be involved in the up-regulate of miR-122 in obese subjects involves NF-κB activity. [score:4]
We only observed an inverse association between serum iron levels and the expression of serum miR-122, considering the total population (controls and obese; rho Spearman = -0.54, p = 0.02). [score:3]
Wang C. et al. (2011) studied miRNAs in seminal plasma and observed an increase of miR-122 expression in asthenozoospermic patients, a term for reduced sperm motility. [score:3]
Based in the previous information, we hypothesize that men with obesity show an increase in the relative expression of microRNAs associated with inflammation (miR-155 and miR-21) and iron homeostasis (miR-122 and miR-200b) at a systemic and spermatic level. [score:3]
Donkin et al. (2016) did not find changes in expression profiles of miR-122 at the spermatic level, by contrast, our data demonstrated that miR-122 in spermatozoa was elevated among obese patients. [score:3]
MiR-122 inhibition increases the amount of mRNA transcribed by genes that control systemic iron levels, such as HFE, HJV, bone morphogenetic protein receptor type 1A (Bmpr1a), and HAMP (Castoldi and Muckenthaler, 2012). [score:2]
In sperm, miR-155 (rho Spearman = 0.84; p = 0.002) and miR-21 (rho Spearman = 0.71; p = 0.03) with serum IL-6. Also, we observed an inverse association between serum iron levels and the expression of miR-122, considering the total population (controls and obese subjects; rho Spearman = -0.54; p = 0.02) Iron content in PBMCs in controls was 0.46 (0.14–0.89) μg/10 [5] cells compared to 0.57 (0.16–1.06) μg/10 [5] cells in obese subjects (p = NS). [score:2]
FIGURE 4Relative expression of miR-155, miR-21, miR-122 and miR-200b in the spermatozoa samples of obese subjects compared with the normal weight controls. [score:2]
We did not find any significant correlation between miR-122 and iron in sperm or seminal plasma. [score:1]
The liver-specific microRNA miR-122 controls systemic iron homeostasis in mice. [score:1]
Also, in patients with iron overload disorders, it was observed that miR-122 was decreased. [score:1]
Elevated circulating microRNA-122 is associated with obesity and insulin resistance in young adults. [score:1]
In contrast, Abu-Halima et al. (2013) found that miR-122 was down regulated in sperm from asthenozoospermic and oligoasthenospermic infertile men, compared to normozoospermic controls. [score:1]
In this study, the increase of miR-122 was related to the obesity and not to differences in the seminal pattern between cases and control subjects. [score:1]
These results coincide with previous studies that demonstrate that circulating miR-122 is elevated in obese patients and exhibit a tendency to increase with the degree of obesity (Ortega et al., 2013; Wang et al., 2015). [score:1]
MiR-122 is highly abundant in liver tissue and is a hepato-specific miRNA (Wrighting and Andrews, 2006). [score:1]
In plasma, miR-122 levels were increased in Ob group (p = 0.029; Figure 3A); however, miR-200b did not show a significant difference (p = 0.059; Figure 3B) between obese and control subjects. [score:1]
The hepatocyte-specific HNF4α/miR-122 pathway contributes to iron overload -mediated hepatic inflammation. [score:1]
In the promoter region of miR-122 was identified a NF-κB binding site, and has been demonstrated that RELA (NF-κB p65 subunit), is an activator of NF-κB, which increased promoter activity of miR-122 (Rivkin et al., 2016). [score:1]
Then, in the current study, we evaluated changes in microRNAs expression related to inflammation (miR-21 and miR155) and iron homeostasis (miR-122 and miR-200b) in peripheral blood mononuclear cells (PBMC), plasma, and spermatozoa of obese and healthy subjects. [score:1]
[1 to 20 of 27 sentences]
35
[+] score: 70
Other miRNAs from this paper: hsa-mir-22, hsa-mir-140, hsa-mir-185
Then, hygromycin was added to select hygromycin resistant cells, which potentially have impaired miR122 function as a result of gene disruption (which itself results in impaired suppression of hygromycin resistance gene expression). [score:5]
0024359.g002 Figure 2 A, Overexpression of miR122, miR140, and miR185 precursors suppressed activity of the corresponding reporters. [score:5]
Using selected Huh7-pBSII-Hygro-miR122 cells and parental Huh7-pBSII-Hygro cells, titration of the hygromycin concentration required for total cell killing was performed to determine the clone showing the widest differences in hygromycin concentration (i. e., the clone in which expression of the hygromycin resistance gene was most effectively suppressed by miR122). [score:5]
A, Overexpression of miR122, miR140, and miR185 precursors suppressed activity of the corresponding reporters. [score:5]
B, CatA-Luc plasmids, which contain endogenous miR122 target sites derived from the CAT1 gene in its 3′-UTR, were transfected, with or without miR122 precursor- and siRACK1 -expressing plasmids, into Huh7 cells. [score:5]
Levels of endogenous mature miR122, miR22, miR140-5p,-3p, and miR185, which are expressed at relatively high levels in liver cells [16], were comparable in control and RACK1-knockdown cells (Fig. 3A and Figure S1). [score:4]
Binding of miR122 reduces the expression of this hygromycin resistance gene in this construct. [score:3]
To determine the effect of miR-122 on natural gene targets, a reporter plasmid (CatA-Luc) with natural 3′-UTR sequences of the CATT1 (cationic amino-acid transporter (CAT-1)) gene containing three predicted miR-122 binding sites was used. [score:3]
To express miR122, a construct carrying a CMV promoter -driven miR122 precursor was used in conjunction with puromycin selection. [score:3]
0024359.g001 Figure 1 A, Reporter and miR122 precursor -expressing constructs. [score:3]
However, if miR122 function is impaired by the disruption of genes that are important for miRNA signaling, hygromycin resistance gene expression increases. [score:3]
Additionally, to enhance the effects of miR122, we co -transfected a miR122 precursor -expressing plasmid (Fig. 1A) with the reporter construct and selected monoclonal cells containing both constructs to minimize the effects of their random integration. [score:3]
The selected clones were then infected with MIR122-puro lentiviruses, which express a miR122 precursor and a puromycin resistance gene, and selected on puromycin. [score:3]
Transient knockdown of RACK1 reduced the function of three miRNAs: miR122, miR140, and miR185 (Fig. 2A). [score:2]
C, Levels of mature miR122 and miR185 in Ago2-containing complexes were reduced in RACK1-knockdown cells. [score:2]
Control Huh7 cells and RACK1-knockdown cells were transfected with miR122 reporter plasmids with or without synthetic corresponding miR122 oligonucleotides and non-corresponding miR185 oligonucleotides (to verify specificity). [score:2]
Control and Ago2-knockdown cells were transfected with miR122 or miR185 reporter plasmids with corresponding synthetic mature miRNA oligonucleotides. [score:2]
Control and Ago2-knockdown (Ago2 KD) cells were transfected with miR122 or miR185 reporter plasmids with corresponding synthetic mature miRNA oligonucleotides. [score:2]
A construct containing an SV40 promoter -driven hygromycin resistance gene with two tandem miR122-responsive elements (miR122 RE) in its 3′-UTR was used to assess miRNA function. [score:1]
We infected ∼106 Huh7-pBS-Hygro-miR122 cells and obtained ∼104 blasticidin-resistant clones. [score:1]
To identify genes involved in miRNA pathways especially in liver cells, we constructed a reporter carrying a hygromycin resistance gene with two miR122-responsive elements in its 3′-UTR (Fig. 1A). [score:1]
Next, the gene cassette (containing an SV40 promoter, the hygromycin resistance gene, the miR122 responsive elements and polyA sequences) was excised using BamHI and SalI, and was inserted into pBlueScript II at the same restriction sites. [score:1]
Synthetic oligonucleotides containing two tandem miR122-responsive elements were annealed and inserted in the 3′-UTR of this plasmid's hygromycin resistance gene (at the PmeI site). [score:1]
For example, the maturation of miRNAs used in our study, i. e., miR122, miR140, and miR185, is KSRP-independent [29]. [score:1]
To examine these effects using a natural 3′-UTR containing miR122 binding sites, we used a CatA-Luc reporter that carried the 3′-UTR of the CAT1 (cationic amino acid transporter 1) gene and a luciferase gene [22]. [score:1]
We chose miR122 because it is the most abundant and tissue-specific miRNA in the liver [16]. [score:1]
The CAT1 3′-UTR contains three predicted miR122 binding sites [22]. [score:1]
We infected ∼10 [6] Huh7-pBS-Hygro-miR122 cells established from Huh7 cells and obtained ∼10 [4] clones with random gene disruptions (confirmed by resistance to blasticidin) (Fig. 1B). [score:1]
[1 to 20 of 28 sentences]
36
[+] score: 66
Other miRNAs from this paper: hsa-let-7a-1, hsa-mir-224
Figure 3 compares the expression patterns of 261 coexpressed genes (the pink line represents the average value of their expression) with hsa-miR-122 among 17 human normal tissues, indicating that remarkable peaks appear in liver for all the coexpressed genes. [score:9]
The additional file provides the expression profile of hsa-miR-122 and its 261 co-expressed genes among 17 human normal tissues (Figure S1 and S2), and full list of TSSs, the number of co-expressed gene groups, and putative TFs of human miRNAs (Table S1-S3). [score:7]
The expression image (see Figure S1 in additional file) also reveals the similar trends between hsa-miR-122 and its coexpressed genes. [score:5]
In addition to the high expression level in liver, two obvious peaks of brain and thymus appear in the log [10] transformed expression profile of hsa-miR-122. [score:5]
261 annotated genes coexpressed with miR-122 were identified according to their expression levels with Pearson's correlation coefficient (PCC) more than 0.8. [score:5]
The knockout of HNF1A, FOXA1, and FOXA2 by RNAi assay reduces the expression of miR-122, suggesting that these transcription factors may bind to miR-122 promoter and transcriptionally regulate miR-122 [38]. [score:4]
Unlike hsa-miR-122, miR-224 is upregulated in HCC through epigenetic mechanisms and controls several crucial cellular processes [40]. [score:4]
The occurrence of putative transcription factors of miR-122 is listed in Table 1. Among TF candidates regulating hsa-miR-122, the TF binding motif of HNF-4alpha can be found in 191 coexpressed gene promoters. [score:4]
In 2011, Li et al. reported that HNF-4alpha is a key regulator positively controlling the expression of miR-122 in liver [37], proving our computational finding. [score:4]
It is implied that transcription factor NR1B2 may bind to miR-122 promoter and regulate its expression. [score:4]
Figure S2 illustrates an example of hsa-miR-122 expression patterns with and without log [10] transformation. [score:3]
The members of hsa-miR-122 coexpression group also reflect the variation. [score:3]
Then, the promoter sequences (1 kb upstream from TSS) of hsa-miR-122 gene and 261 coexpressed genes were collected to identify coTFBSs using Match. [score:3]
Because of the explicit promoter and biological importance, hsa-miR-122 was selected as the case study to investigate which TFs may regulate its gene expression. [score:2]
Moreover, other liver-enriched transcription factors including HNF-1alpha, HNF-3alpha, HNF-3beta, and HNF-6 showed a strong positive correlation with miR-122. [score:1]
Case Study: hsa-miR-122. [score:1]
Furthermore, the liver-specific hsa-miR-122 was also selected as the case study to demonstrate the usage of this filtering approach and its practicability. [score:1]
Importantly, HNF-1alpha, HNF-3alpha, and HNF-3beta were identified in our list of TF candidates, and a HNF-6 binding site was determined (−2720 from miR-122 TSS) if the 3 kb promoter sequence of miR-122 was used. [score:1]
[1 to 20 of 18 sentences]
37
[+] score: 61
Systemic administration of LNA- or PNA -based miR-122 antagonists in mice lead to upregulation of a large set of genes in liver, as revealed by genome-wide expression profiling, and FUT8 proved to be among the upregulated genes in the liver after systemic administration of a LNA-antagomir-122, both after acute administration and chronic treatment (3 weeks) of mice [15]. [score:9]
The levels of miR-122 and miR-34a inhibition on FUT8 expression are comparable to that obtained for ALDOA, which is a validated target of miR-122 and which has been wi dely used to demonstrate the effects of the systemic administration of miR-122 antagonists in the liver [15]. [score:7]
The direct effects of miRNAs on FUT8 expression were determined after transfection of miR-122 and miR-34a mimics in the hepatocarcinoma cell lines. [score:4]
miR-122 has been also reported to be specifically and consistently downregulated in most spontaneous liver tumours and in almost all hepatocarcinoma cell lines [13]. [score:4]
This study demonstrated that ectopic expression of both miR-122 and miR-34a was able to significantly decrease FUT8 levels and also to affect core fucosylation of secreted proteins, suggesting that a miRNA -mediated mechanism could also play a role in the dysregulation of core fucosylation observed in liver tumors. [score:4]
miR-122 is the most abundant miRNA in adult hepatocytes, accounting for about 70% of total miRNA content, while it is expressed at low levels during liver development [14]. [score:4]
However, while miR-122 showed a prolonged effect also at 48 hours, miR-34a induced only a transient inhibition, which was completely reversed at 48 hours. [score:3]
Figure 2 reports the effects of miR-122 and miR-34a mimics on mRNA and proteins expression for FUT8 and ALDOA at 24 and 48 hours post-transfection. [score:3]
However, co-transfection of miR-122 and miR-34a mimics decreased luciferase activity for both target genes, indicating that the miRNAs were able to interact specifically with the 3′UTRs. [score:3]
Here, we report the effects of transient transfection of miR-122 and miR-34a mimics on expression levels of FUT8 mRNA and protein and on core fucosylation of secreted glycoproteins in human and rodents hepatocarcinoma cell lines. [score:3]
Since ALDOA 3′UTR also contains the sites for potential recognition by both miRNAs and it has been already experimentally validated to be a target for miR-122, we decided to use the human enzyme as a positive control for our experimental protocols. [score:3]
Among them, miR-122 and miR-34a, were further chosen for an experimental validation, since their dysregulation during hepatocarcinogenesis is well known. [score:2]
0076540.g001 Figure 1 For each experiment, HeLa cells were seeded in 96 plates (six replicates for each condition) and they were then co -transfected with either miR-122 or miR-34a mimics and with empty pMiR-Report, with pMiR-Report containing downstream FUT8 3′UTR (pMiR-Report/FUT8) or ALDOA 3′UTR (pMiR-Report/ALDOA). [score:1]
The tools used for analysis predicted the presence of a 8 mer site matching the seed region of miR-34a and a 7 mer-1A seed region for miR-122 in the human, mouse and rat 3′UTRs. [score:1]
For this purpose, we cloned the complete human 3′UTRs downstream of a luciferase reporter gene and we then analyzed luciferase activity after co-transfection of the pMir-Report constructs with miR-122 and miR-34a mimics in HeLa cells. [score:1]
To further confirm the effects of the two miRNAs on FUT8 also in other experimental mo dels, we analyzed the effects of miR-122 and miR-34a transfection on mouse Hepa1C1C7 and rat HTC hepatocarcinoma cell lines. [score:1]
For each experiment, HeLa cells were seeded in 96 plates (six replicates for each condition) and they were then co -transfected with either miR-122 or miR-34a mimics and with empty pMiR-Report, with pMiR-Report containing downstream FUT8 3′UTR (pMiR-Report/FUT8) or ALDOA 3′UTR (pMiR-Report/ALDOA). [score:1]
Western blot analyses revealed that both miR-122 and miR-34a are able to induce also a decrease in Fut8 protein levels (Figure 3B and 3D), confirming the data already observed for human HepG2 cells. [score:1]
Mimics miR-122 and miR-34a were both able to decrease FUT8 and ALDOA protein levels. [score:1]
The effects of miR-122 observed for ALDOA 3′UTR were comparable to those already reported using a similar reporter system [15]. [score:1]
0076540.g002 Figure 2 Cells were transfected with either the AllStar siRNA negative control, miR-122 mimic or miR-34a mimic in 12 well plates. [score:1]
This finding is in agreement with the previous reported data which indicated that the systemic administration of antagonists of miR-122 was able to affect also mRNA levels in the mouse liver for both Fut8 and AldoA [14]. [score:1]
Mimic miR-122 was able to induce a decrease of mRNA levels for both genes, which was maximal at 24 hour post-transfection (Figure 2A). [score:1]
Cells were transfected with either the AllStar siRNA negative control, miR-122 mimic or miR-34a mimic in 12 well plates. [score:1]
[1 to 20 of 24 sentences]
38
[+] score: 60
As HCV RNA replication and expression levels of intracellular core and NS5A protein were not influenced by apolipoprotein expression (see Figs 2C and 3A), we concluded that exchangeable apolipoproteins other than ApoE sustain particle assembly and/ or secretion with lower efficiency in 293T/miR-122 cells. [score:5]
To allow a quantitative comparison between expressed apolipoproteins we created C-terminally HA-tagged variants of all related exchangeable apolipoproteins (A1, A2, A4, A5, C1, C2, C3, C4, and E) as well as of ApoD (an unrelated exchangeable apolipoprotein) and introduced these into 293T/miR-122 cells via lentiviral gene transfer. [score:3]
A: Depicted are reciprocal dilutions of secreted HA-tagged apolipoproteins that reach an OD of 2-fold over background (293T/miR-122 cells expressing an empty vector). [score:3]
In contrast, production of intracellular infectious particles was comparable between ApoE and ApoC3 expressing 293T/miR-122 cells and ca. [score:3]
As expected, 293T/miR-122 cells expressing ApoA2 or ApoC3 released ca. [score:3]
Accumulation of luciferase activity was comparable in all cell lines and was similar to Huh-7.5 cells, indicating that HCV replication was not modulated by expression of any HA-tagged apolipoprotein in 293T/miR-122 cells. [score:3]
Ectopic expression of various exchangeable apolipoproteins in 293T/miR-122 cells restores production of infectious HCV particles. [score:3]
293T/miR-122 cells [15] were transduced with lentiviruses as described previously [47] to ectopically express apolipoprotein constructs. [score:3]
Specific infectivity of particles produced in 293T/miR-122 in the presence of ApoC1, C2 and C3 was similar to values observed from ApoE -expressing cells. [score:3]
Therefore, we utilized human non-liver-derived 293T/miR122 cells, which robustly replicate HCV RNA but do not permit production of infectious progeny unless ApoE is ectopically expressed [14, 15]. [score:3]
0134529.g002 Fig 2 A: Depicted are reciprocal dilutions of secreted HA-tagged apolipoproteins that reach an OD of 2-fold over background (293T/miR-122 cells expressing an empty vector). [score:3]
Importantly, all ApoE-related apolipoproteins rescued production of infectious HCV progeny in 293T/miR-122 cells, even though efficiency of luciferase transduction was reduced compared to cells expressing ApoE. [score:2]
100-fold lower levels of infectious HCV compared to ApoE expressing 293T/miR-122 cells (Fig 3C and Fig 4A). [score:2]
We transduced 293T/miR-122 cells with this construct and excluded a significant impact of this mutation on its secretion by HA-specific ELISA (Fig 6A). [score:2]
While they determined the importance of these helices by using deletion mutants of ApoE and ApoC1 in Huh7 double -knockout cells, we impaired helix formation by insertion of proline residues in ApoC1 and determined particle production in 293T/miR-122 cells. [score:2]
Of note, Fukuhara et al. observed comparable virus production and specific infectivity between ApoA1, A2, C1, C2, C3, and E in Huh-7 double knock-out cells, whereas we observed significant differences between apolipoproteins to restore virus production in 293T/miR-122 cells. [score:2]
Consequently, the ratio between extracellular and intracellular infectious HCV particles was significantly reduced in 293T/miR-122 cells expressing ApoA2 or ApoC3 compared to ApoE (Fig 4B). [score:2]
Analogous to our previous assays, we created stable 293T/miR-122-derivatives expressing these ApoC1 variants. [score:2]
Given that all ApoE-related apolipoproteins at least partially restored particle production from 293T/miR-122 cells, we hypothesized that these proteins should share a common determinant for their function in HCV morphogenesis. [score:1]
Notably, the unrelated exchangeable apolipoprotein D did not enable detectable production of infectious particles in 293T/miR-122 cells, even though viral RNA replication was not influenced (Fig 2C and 2D). [score:1]
Different ratio between extracellular and intracellular infectious virus production in HCV transfected Huh-7.5 and 293T/miR-122 cells. [score:1]
ApoE-related exchangeable apolipoproteins can partially restore particle production in 293T/miR-122 cells. [score:1]
The genotype 2A/2A chimera Jc1 [48], the Renilla luciferase reporter virus JcR2A[49], the pLenti plasmid harboring the miR-122 gene [50], and the human ApoE construct with a C-terminal HA-tag [51] have been described previously. [score:1]
In this study, we demonstrate that all ApoE-related exchangeable apolipoproteins of the ApoA and ApoC families complement the lack of ApoE in 293T/miR-122 cells during HCV production. [score:1]
10-fold lower in case of 293T/miR-122 ApoA2 cells (Fig 4A). [score:1]
Huh-7.5 [46] and 293T/miR-122 derivatives were maintained in Dulbecco’s Modified Eagle Medium (Invitrogen) containing 10% fetal calf serum (PAA Laboratories GmbH), 2 mM L-glutamine (Invitrogen), 1 mM non-essential amino acids (Invitrogen), and 100 μg/ml penicillin/ streptomycin (Invitrogen). [score:1]
As expected, ApoE secretion was only observed in the cell culture fluid of Huh-7.5 cells and of 293T/miR-122 cells that had been transduced with ApoE-HA, but not in 293T/miR-122 cells that were transduced with the empty vector or with vectors encoding any of the other HA-tagged exchangeable apolipoproteins. [score:1]
Reciprocal dilutions of secreted HA-tagged apolipoproteins that reach an OD of 2-fold over background (293T/miR-122 expressing the empty vector) were calculated based on these data. [score:1]
As published previously, transduction of luciferase activity and thus presence of infectious HCV particles in the inoculum could be observed in cell culture fluids from Huh-7.5 cells and 293T/miR-122/ApoE cells, while no luciferase activity was transduced from the supernatant of 293T/miR-122 cells (Fig 2D and [15]). [score:1]
[1 to 20 of 29 sentences]
39
[+] score: 59
These data suggest that the therapeutic targeting of miR-122 and upregulation of HO-1 may represent a new strategy for anti-HCV intervention and cytoprotection. [score:6]
miR-122 inhibition increased the expression of several genes that control systemic iron levels, such as hemochromatosis (Hfe), hemojuvelin (Hjv), bone morphogenetic protein receptor type 1A (Bmpr1a) and Hamp. [score:5]
Conversely, miR-122 overexpression increases the expression of HMGCS1, DHCR7 and SQLE [22]. [score:5]
Importantly, all these genes are not direct targets of miR-122. [score:4]
miR-122 inhibition by antisense oligonucleotides (ASO) in mice resulted in increased hepatic fatty-acid oxidation and a reduced cholesterol synthesis [23]. [score:3]
miR-122 is highly expressed in the liver, and it is estimated to account for approximately 70% of all liver miRNA [22, 60]. [score:3]
Due to the lack of toxicity, miR-122 has become a strong candidate as a therapeutic target in the treatment of hypercholesterolemia in humans. [score:3]
Very interestingly, miR-122 inhibition also decreased Bach1 and increased heme oxygenase-1 (HO-1), which is an antioxidant defense and key cytoprotective enzyme repressed by Bach1 [67]. [score:3]
It is important to take into account that many miR-122 validated targets are involved in glucose homeostasis and the Krebs cycle, including aldolase A (ALDOA) and citrate synthase (CS) [22, 23]. [score:3]
In addition, miR-122 inhibition reduced total plasma cholesterol by 25–35%, and this was reflected by changes in both the LDL and HDL fractions [23]. [score:3]
Similar effects were observed in African green monkeys treated with miR-122 antagomirs wherein inhibition caused a dose -dependent decrease in plasma cholesterol without any signs of toxicity [11]. [score:3]
miR-122 inhibition caused a significant decrease of genes involved in cholesterol synthesis including 3-hydroxy-3-methylglutaryl-CoA synthase 1 (HMGCS1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR), 7-dehydrocholesterol reductase (DHCR7), and squalene epoxidase (SQLE) [22]. [score:3]
In addition to regulate lipid and glucose metabolism, miR-122 also plays an important role in regulating iron homeostasis [63]. [score:3]
This lack of a mechanistic understanding of the effects of miR-122 on cholesterol homeostasis, and the possibilities of other adverse consequences as the decline levels of HDL, both in mice and in nonhuman primates [11, 23, 62], and hepatocellular carcinoma, has also dampened the enthusiasm for the development of miR-122 antisense technologies as a therapeutic approach for long-term management of cholesterol disorders. [score:2]
A role for miR-122 in lipid metabolism was revealed in knockdown studies [11, 23]. [score:2]
Several miRNAs have been described to regulate lipid metabolism, including miR-122, miR-33, miR-758, and miR-106b [11– 14] (Table 1). [score:2]
Therefore, the mechanism by which miR-122 regulates lipid metabolism remains undetermined. [score:2]
miR-122 is highly conserved from human to frogs, suggesting an important role for this miRNA that has been under selective pressure throughout evolution [61]. [score:1]
miR-122 binds two positions in the 5′UTR of the HCV genome, and this binding is essential to viral accumulation and propagation infected hepatocytes [64– 66]. [score:1]
Recently, miR-122 was found to be required for the propagation of hepatitis C virus (HCV). [score:1]
In a recent study in nonhuman primates, silencing of miR-122 resulted in a sustained reductions in HVC viremia and improvement in liver pathology, with no evidence of viral resistance [66]. [score:1]
[1 to 20 of 21 sentences]
40
[+] score: 59
Inhibition of miR-122 also boosts HO-1 mRNA expression and reduces HCV RNA expression, highlighting its potential as a therapeutic target [17]. [score:9]
Further, miR-130a was found to downregulate miR-122 but upregulate proteins that coordinate the host innate immune response, including type I IFN (IFNα/IFNβ), ISG15, USP18, and MxA. [score:7]
Notably, silencing miR-122, which is strongly expressed upon HCV infection and is predictive of the response to IFN therapy [14, 19], also suppresses SOCS3 expression by methylation of its promoter, and thereby boosts STAT3 activation [40] to enhance the response to IFN therapy. [score:7]
Some studies showed that miR-122 is strongly expressed in malignant liver nodules, and may promote tumorigenesis by inhibiting tumour suppressors in hepatocellular carcinoma related to HCV infection [21]. [score:7]
An inverse correlation between miR-122 and biochemical evidences of hepatocyte damage, including alanine aminotransferase, aspartate aminotransferase, and fibrosis, but not viral load, has also been noted in patients with chronic hepatitis C [18], with miR-122 expression consistently downregulated at advanced stages of fibrosis. [score:6]
Corollary, other studies indicated that miR-122 is downregulated in hepatocellular carcinoma unrelated to HCV [22]. [score:4]
The miRNA miR-122 is specifically expressed in the liver, and accounts for approximately 70% of total liver miRNA [14]. [score:3]
Human Dicer and TRBP proteins involve in the biogenesis pathway of miR-122 mature, but they are not needed for the mechanism of HCV RNA accumulation and HCV translation provided by mature duplex miR-122 [16]. [score:3]
Accordingly, miR-122 mimics may be more beneficial than miR-122 inhibitors in early infection [20], as low miR-122 levels at the beginning of infection may facilitate HCV entry into hepatocytes. [score:3]
It is essential for miR-122 modulation of HCV translation and RNA accumulation, that pre-miR-122 must be processed by Dicer and TRBP and strand selection of mature duplex miR-122 [16]. [score:3]
miR-122 binds to the 5′-UTR of and stabilizes the HCV RNA genome, and thereby stimulates virus replication [14, 15]. [score:1]
Collectively, these studies imply that miR-122 plays essential and complex roles not only in HCV infection, but also in hepatocellular carcinoma regardless of HCV status [21]. [score:1]
Both miR-122 inhibitors and mimics have advantages in HCV infection, which still needs to have further careful studies to evaluate. [score:1]
Various relationships between miR-122 and hepatocellular carcinoma have also been noted. [score:1]
Strikingly, miR-122 was also shown to impede HCV entry into hepatocytes by binding the 3′-UTR of OCLN mRNA. [score:1]
On the other hand, pre-miR-122 or unprocessed single-stranded miR-122 cannot bind to the HCV 5′-UTR, and cannot modulate HCV RNA accumulation. [score:1]
Decreased levels of miR-122 were also predictive of poor response to therapy with IFN [19]. [score:1]
[1 to 20 of 17 sentences]
41
[+] score: 59
In addition, effective inhibition of the liver-expressed miR-122 was achieved in mice by three intravenous (i. v. ) doses of 80 mg/kg antagomir-122, which resulted in derepression of direct miR-122 targets in the liver and lowering of serum cholesterol by 40% (Krützfeldt et al, 2005). [score:8]
Interestingly, inhibition of miR-122 function in cultured liver cells results in marked suppression of HCV RNA accumulation, implying that miR-122 could be a potential target for treatment of HCV infection (Jopling et al, 2005). [score:7]
AntimiR -mediated inhibition of miR-122 in mice results in derepression of predicted target mRNAs in the liver and lowering of plasma cholesterol by 30–40%, suggesting that miR-122 could be a potential target for cholesterol lowering (reviewed in: Rottiers & Näär, 2012). [score:7]
Furthermore, inhibition of miR-122 has been shown to lower both LDL cholesterol and HDL cholesterol levels mice and non-human primates (Elmén et al, 2008b), which implies that miR-122 is not a good therapeutic target for reducing increased levels of LDL cholesterol in hypercholesterolemia. [score:5]
miR-122 is a highly abundant, liver-expressed miRNA that is completely conserved from zebrafish to man and implicated in the regulation of hepatic cholesterol, lipid and iron metabolism and in maintaining liver cell identity (Lagos-Quintana et al, 2002; Krützfeldt et al, 2005; Wienholds et al, 2005; Esau et al, 2006; Elmén et al, 2008a, b; Castoldi et al, 2011; Jopling, 2012). [score:4]
Therapeutic inhibition of miR-122 for the treatment of HCV infection. [score:3]
Krützfeldt et al (2005) were the first to report on miR-122 antagonism in mice using intravenously injected antagomirs (three doses of 80 mg/kg antagomir-122), whereas Esau et al (2006) used an intraperitoneally delivered, 2′ MOE -modified for inhibition of miR-122 in high-fat-diet-fed mice by treating the animals for 4 weeks with 2 weekly doses ranging from 12.5 to 75 mg/kg/dose. [score:3]
However, two recent studies reported that chronic loss of miR-122 function in Mir122 germline knockout and liver-specific knockout mice, respectively, resulted in increased incidence of steatohepatitis and hepatocellular carcinoma with age (Hsu et al, 2012; Tsai et al, 2012). [score:3]
Hence, additional studies are required to assess the potential risks associated with long-term inhibition of miR-122. [score:3]
Apart from its role in modulating cholesterol metabolism, miR-122 was shown to function as an important host factor for hepatitis C virus (HCV) propagation by an unusual mechanism, in which two miR-122 molecules interact with the 5′ untranslated region (UTR) of the HCV genome by binding to two miR-122 seed sites in association with Ago2 (Jopling et al, 2005; Machlin et al, 2011; Shimakami et al, 2012a). [score:3]
Importantly, short-term pharmacological inhibition of miR-122 was shown to be reversible and well tolerated in mice and non-human primates without any acute or subchronic toxicities (Elmén et al, 2008a, b). [score:3]
In a third miR-122 inhibition study, treatment of high-fat-diet-fed mice with a 15-mer LNA -modified (miravirsen) twice weekly at 5 mg/kg/dose for 6 weeks resulted in long-lasting decrease in serum cholesterol (Elmén et al, 2008b). [score:3]
No viral resistance -associated mutations were detected in the miR-122 seed sites of HCV 5′ UTR in any of the patients. [score:2]
Furthermore, no escape mutations were detected in the two miR-122 binding sites of the HCV 5′ UTR, implying that miravirsen has a high barrier to HCV resistance (Lanford et al, 2010). [score:2]
By forming a ternary miR-122-HCV RNA complex, miR-122 protects the HCV 5′ UTR from nucleolytic degradation and thereby promotes viral RNA stability and propagation (Jopling et al, 2005; Machlin et al, 2011; Shimakami et al, 2012b; Mortimer & Doudna, 2013). [score:1]
Furthermore, both miR-122 binding sites are conserved in all six HCV genotypes (Li et al, 2011; Shimakami et al, 2012b), which implies that an -based HCV therapy would be genotype independent. [score:1]
Furthermore, systemic administration of this to African green monkeys at doses ranging from 1 to 10 mg/kg with three i. v. infusions over 5 days resulted in sequestration of mature miR-122 and dose -dependent and long-lasting decrease of circulating cholesterol levels, which gradually returned to baseline levels over a 3-month period after treatment (Elmén et al, 2008b). [score:1]
[1 to 20 of 17 sentences]
42
[+] score: 58
In contrast to miR-122-5p, miR-21-5p expression showed significant upregulated expression in severely diseased aortic valves. [score:10]
The majority of down-regulated miRNAs showed highly correlated expression (Pearson correlation coefficient ≥70%), with the most suppressed, miR-122-5p, at the core of the miRNA network. [score:8]
Of note, miR-122-5p deletion in mice leads to hepatic fibrosis 19, while overexpression leads to suppression of stellate cell proliferation and reduced collagen production 20, and, conversely, stellate cell activation leads to downregulation of miR-122-5p 21. [score:8]
In addition to its involvement in lipid metabolism, a recent study has also shown that miR-122-5p directly targets TGF-β and is downregulated in the myocardium of AS patients with more extensive myocardial fibrosis 17. [score:7]
miR-122-5p expression was almost completely suppressed in severely diseased aortic valves. [score:7]
It is, however, worth noting that increasing the levels of a particular miR, which would be required if miR-122-5p were pursued as a therapeutic target in AS, is generally viewed as more challenging than suppressing that miR. [score:5]
miR-122-5p is also involved in lipid metabolism, and this is a possible reason for the differential expression in CAVD. [score:3]
miR-122-5p tends to inhibit fatty acid oxidation, and promotes fatty acid and triglyceride biosynthesis 15. [score:3]
The finding of a role of miR-122-5p in CAVD was unexpected, as miR-122-5p is primarily expressed in the liver, with most attention focusing on its role in hepatitis C infection. [score:3]
miR-122-5p has the distinction of being the first miR to be manipulated in human clinical trials, where an antagomiR, miravirsen, has shown promising early results 14. [score:1]
At the time there was no obvious association between this pathway and underlying mechanisms of CAVD, but our current observation may suggest that miR-122-5p provides this link. [score:1]
A trial of anti-miR-122 in chimpanzees (designed primarily to assess the effect on hepatitis C virus) showed a 25 to 54% reduction in low-density lipoprotein, and a 23 to 42% reduction in apolipoprotein apo-B 16. [score:1]
Comparing the AS to control groups, we confirmed differences in levels of miR-122-5p (Mann-Whitney p < 0.0001), miR-21-5p (p < 0.0001), miR-625-5p (p = 0.017), miR-221-3p (p < 0.0001) and miR-30e-5p (p = 0.012). [score:1]
[1 to 20 of 13 sentences]
43
[+] score: 55
Other miRNAs from this paper: mmu-mir-122
Tsai et al. [23, 25] applied a miRNA-target interaction database to predict miR-122 target genes in mice and humans (S2 and S3 Tables). [score:5]
The results show upregulated profiles from 2, 6, and 11 months of mir-122 knockout mice liver data (Fig 4C–4E). [score:5]
Interestingly, P-BTK and BTK were upregulated in mir-122 knockout mice livers as early as 2 months of age. [score:5]
In this study, using the KEGG and ExPASy databases, we determined that 20 genes from the set of miR-122 target genes directly encode enzymes listed in the Recon2-hepatocyte mo del. [score:4]
Clearly our results favor the notion that miR-122 plays a major dominant role in regulating these target genes in normal liver. [score:4]
We examined the expression pattern of DDC in mir-122 knockout mice livers to explore the role of DDC. [score:4]
Genes regulated by miR-122 and their regulated reactions in Recon2-hepatocyte mo del. [score:3]
miR122 target genes of human. [score:3]
Four of them, DDC, PKM, ENTPD4, and ALDOA, are miR-122 target genes. [score:3]
Mouse studies have revealed that microRNA-122 (miR-122), which accounts for 70% of the total miRNAs in the liver, plays a pivotal role in liver and has been implicated as a regulator of fatty acid metabolism. [score:2]
In addition, we also examined the role of BTK in the mir-122 knockout mice livers. [score:2]
Since miR-122 knockout mice have increased levels of DDC (Fig 4C–4E), we then set up to determine the association between DDC and liver cancer. [score:2]
Reduced miR-122 levels are associated with hepatocellular carcinoma (HCC), and miR-122 plays a crucial positive role in the regulating hepatitis C virus replication [22]. [score:2]
Most of the miRNAs in Mir122a [–/–]are expressed at low (RPM<10) to moderate (RPM 10–100) levels compared to high level of miR-122-5p in normal mouse liver (RPM 21378.2). [score:2]
Mice liver tissues were harvested from C57BL/6 wildtype and mir-122 knockout mice at 2, 6 and 11 months of age. [score:2]
MicroRNA-122 (miR-122) plays an important role in the regulation of liver metabolism, but its intrinsic physiological functions require further clarification. [score:2]
It consists of 2163 metabolites and 3047 reactions in eight compartments and was used to predict the metabolic capability under a particular condition and to infer the metabolic reprogramming of hepatocytes under miR-122 dysregulation. [score:2]
Since miR-122 is a highly abundant liver-specific miRNAs, an imbalance of the miRNA homeostasis in Mir122a [–/–]liver is anticipated. [score:1]
However, how miR-122 affects the metabolic network of hepatocytes is unclear. [score:1]
However, the intrinsic physiological roles of miR-122 remain largely undetermined. [score:1]
[1 to 20 of 20 sentences]
44
[+] score: 53
The top five differentially upregulated miRNAs in HCC (Table  5) were: miR-142 (1 million-fold), miR-7704 (257-fold), miR-101 (147-fold), miR-23a (124-fold), and miR-22 (85-fold); whereas, the top five downregulated were: miR-122 (513-fold), Let-7g (358-fold), miR-378c (187-fold), miR-185 (68-fold), and miR-451a (58-fold). [score:7]
The top five differentially upregulated miRNAs in LGDN (Table  2) were: miR-141 (625-fold), miR-101 (208-fold), miR-22 (111-fold), miR-16 (61-fold), and miR-486 (35-fold); whereas, the top five downregulated were: miR-451a (513-fold), miR-378c (104-fold), miR-361 (95-fold), miR-122 (81-fold), and miR-30c (78-fold). [score:7]
miR-101, miR-22, and circR-0015774 were the top upregulated sncRNAs, whereas miR-122, piR-952, and circR-0035409 were the most frequently downregulated. [score:7]
Five miRNAs were upregulated (miR-130b, miR-182, miR10b, miR320a, and miR769) ranging from a 2.9 to 30-fold induction in the NanoString miRNA assay, whereas six miRNAs were downregulated (miR122, miR451a, miR200a, miR139, miR148a, and miR375) ranging from −2.2 to −6 fold (Table  6). [score:6]
In our analysis, miR-122 was downregulated across all disease stages in both sequenced data and clinical samples (Fig.   1H). [score:6]
miR-122 appears to act as a tumor suppressor and its downregulation in our study may be pertinent to an ordered progression from normal liver to HCC phenotype. [score:6]
The top five downregulated were: miR-122 (312-fold), Let-7g (204-fold), miR-103a (83-fold), miR-532 (79-fold), and miR-451a (62-fold). [score:4]
Accordingly, miR-122 is downregulated in more than 70% of cancers, suggesting a crucial role in oncologic transformation. [score:4]
Interestingly, miR-122 affects all of these pathways while also targeting CUTL1 transcriptional repression 35, 36, leading to apoptosis and cell cycle arrest. [score:3]
In summary, miR-101, miR-22, miR-122, circR-0015774, circR-0035409, MT-TS1, MT-TP, sno115-31, and snoRD37 may serve as biomarkers for liver pathogenesis, since they were differentially expressed. [score:3]
[1 to 20 of 10 sentences]
45
[+] score: 52
Downregulation of miR-122 expression in hepatocellular carcinoma (HCC) is associated with a poor prognosis [37– 39], and liver tumorigenesis is facilitated in mice lacking miR-122 [40, 41]. [score:6]
miR-122 binds to two closely spaced target sites in the highly conserved 5′-untranslated region of the HCV genome, thereby forming an oligomeric miR-122-HCV complex that protects the HCV genome from nucleolytic degradation or from host innate immune responses [35]. [score:5]
These preclinical results led to the development of miravirsen, a LNA -modified DNA phosphorothioate antisense oligonucleotide against miR-122, as the first miRNA -targeting drug for clinical use [29]. [score:4]
However, caution should be used since miR-122 is generally known as a tumor-suppressive miRNA. [score:3]
Lanford et al. demonstrated that LNA -based anti-miR-122 oligonucleotides led to the long-lasting suppression of HCV viremia and improvement of HCV -induced liver pathology in chimpanzees [33]. [score:3]
b, Miravirsen, a modified oligonucleotide complementary to miR-122 sequences, binds and sequesters mature miR-122, resulting in the functional inhibition of miR-122. [score:3]
One of the most extensively studied miRNAs is miR-122, an abundant liver-specific miRNA that plays a critical role in liver function, such as fatty acid and cholesterol metabolism, and in the pathophysiology of liver diseases, such as hepatitis C viral (HCV) replication [11, 31– 33]. [score:3]
Figure 1 Miravirsen inhibits miR-122. [score:3]
Miravirsen, an LNA -modified DNA phosphorothioate oligonucleotide complementary to miR-122, is thought to hybridize to the 5′ region of mature miR-122, resulting in sequestration and inhibition of miR-122 [29]. [score:3]
Inhibition of miR-122 with locked-nucleic-acid (LNA) -based anti-miR-122 oligonucleotides complementary to miR-122, caused a long-lasting decrease in total plasma cholesterol in mice [31] and in monkeys [34]. [score:3]
Miravirsen also binds to the stem-loop structure of pri- and pre-miR-122 and inhibits the maturation of miR-122. [score:3]
Recently, it was reported that Miravirsen also binds to the stem-loop structure of pri- and pre- miR-122 and inhibits both Dicer- and Drosha- mediated processing of miR-122 precursors [30] (Figure 1). [score:3]
It was developed to target HCV since the stability and propagation of HCV is dependent on a functional interaction between the HCV genome and miR-122 [35]. [score:3]
a, Mir-122 binds two target sites in the HCV 5′ non-coding region and promotes HCV propagation. [score:2]
Patients who received miravirsen showed a dose -dependent reduction in HCV levels, without major adverse events and with no escape mutations in the miR-122 binding sites of the HCV genome [29]. [score:2]
The miR-122 binding sites are conserved across all HCV genotypes and subtypes [36]. [score:1]
In addition to the current success of anti-miR122 therapy against chronic hepatitis C and the ongoing studies of miR-34 mimics against liver cancers in human clinical trials, the results of preclinical studies will likely lead to human clinical trials in the near future. [score:1]
Anti-miR-122 therapy against chronic hepatitis C. miR-34 mimics as a therapeutic against primary and metastatic liver cancer. [score:1]
[1 to 20 of 18 sentences]
46
[+] score: 50
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-32, mmu-mir-1a-1, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-144, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-200b, mmu-mir-206, hsa-mir-208a, mmu-mir-122, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-214, hsa-mir-200b, mmu-mir-299a, mmu-mir-302a, hsa-mir-1-2, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-144, hsa-mir-134, hsa-mir-206, mmu-mir-200a, mmu-mir-208a, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-328, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-214, mmu-mir-135a-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, hsa-mir-361, mmu-mir-361, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-377, mmu-mir-377, hsa-mir-328, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-20b, hsa-mir-429, mmu-mir-429, hsa-mir-483, hsa-mir-486-1, hsa-mir-181d, mmu-mir-483, mmu-mir-486a, mmu-mir-367, mmu-mir-20b, hsa-mir-568, hsa-mir-656, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-744, mmu-mir-181d, mmu-mir-568, hsa-mir-892a, hsa-mir-892b, mmu-mir-208b, hsa-mir-744, hsa-mir-208b, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-1307, eca-mir-208a, eca-mir-208b, eca-mir-200a, eca-mir-200b, eca-mir-302a, eca-mir-302b, eca-mir-302c, eca-mir-302d, eca-mir-367, eca-mir-429, eca-mir-328, eca-mir-214, eca-mir-200c, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-mir-133a, eca-mir-144, eca-mir-25, eca-mir-135a, eca-mir-568, eca-mir-133b, eca-mir-206-2, eca-mir-1-2, eca-let-7f, eca-mir-24-2, eca-mir-134, eca-mir-299, eca-mir-377, eca-mir-656, eca-mir-181a, eca-mir-181b, eca-mir-32, eca-mir-486, eca-mir-181a-2, eca-mir-20b, eca-mir-361, mmu-mir-486b, mmu-mir-299b, hsa-mir-892c, hsa-mir-486-2, eca-mir-9021, eca-mir-1307, eca-mir-744, eca-mir-483, eca-mir-1379, eca-mir-7177b, eca-mir-8908j
Normalized expression levels of the most up- (a) and down-regulated (b) miRNA in Pony compared to Warmblood serum as well as eca-miR-200a (c) that is downregulated by HMGA2 We next selected a total of 177 target-genes of eca-miR-122 using TargetScan [28] and performed gene set enrichment analysis with GeneCodis [29] to assess their biological role. [score:12]
Normalized expression levels of the most up- (a) and down-regulated (b) miRNA in Pony compared to Warmblood serum as well as eca-miR-200a (c) that is downregulated by HMGA2 We next selected a total of 177 target-genes of eca-miR-122 using TargetScan [28] and performed gene set enrichment analysis with GeneCodis [29] to assess their biological role. [score:12]
The most significant up- (eca-miR-122) and down-regulated (eca-miR-328) miRNAs in ponies related to Warmblood are shown on Fig.   7a-b. Fig. 7Significantly differentially expressed miRNA in the serum of ponies. [score:6]
The human miR-122 is involved in glucose and lipid metabolism [45, 46] and it has been proposed as a therapeutic target for metabolic diseases [46]. [score:5]
For instance, we showed an increased expression of circulating serum miR-122 and miR-200 in ponies together with the predicted miRNA target genes that are required in the control of energy metabolism. [score:5]
A total of 50 miRNAs in serum proved to be potential biomarkers to differentiate specific breed types, of which miR-122, miR-200, miR-483 were over-expressed and miR-328 was under-expressed in ponies compared to Warmbloods. [score:4]
The most significantly DEmiR was eca-miR-122, which was highly up-regulated in ponies compared to Warmbloods (Fig.   7a). [score:3]
Ponies are known to be among breeds more prone to develop equine metabolic syndrome (EMS) [47] and therefore miR-122 may be of particular interest for unravelling the molecular mechanism of this disease. [score:3]
[1 to 20 of 8 sentences]
47
[+] score: 49
In fact, both HFE and HJV are directly targeted by miR-122, suggesting that miR-122 could be targeted for therapeutic intervention for diseases of iron metabolism [44]. [score:8]
The liver specific miR-122 directly targets HFE and HJV to contribute to the regulation of systemic iron homeostasis by decreasing hepcidin mRNA expression. [score:7]
Inhibition of miR-122 by locked nucleic acid (LNA) modification is associated with an increased expression of hemochromatosis gene (HFE), hemojuvelin (HJV or HFE2), bone morphogenetic protein receptor type 1a (BMPR1A), and hepcidin (HAMP) mRNA, all of which contribute to a reduction in both plasma and liver iron, in addition to mildly impairing hematopoiesis [44]. [score:5]
miRNA Target mRNA Reference(s) miR-Let-7d DMT (∆IRE), BACH1Andolfo et al. (2010) [42], Hou et al. (2012) [43] miR-122 HFE, HJVCastoldi et al. (2009) [44] miR-196 BACH1Hou et al. (2010) [45] miR-200b FTHShpyleva et al. (2009) [46] miR-210 ISCU, TFRChan et al. (2009) [47], Yoshioka et al. (2012) [48] miR-214 LactoferrinLiao et al. (2010) [49] miR-320 TFRSchaar et al. (2009) [50] miR-485-3p FPNSangokoya et al. (2013) [51] miR-584 Lactoferrin ReceptorLiao et al. (2010) [52] Whereas hepcidin is considered to be the primary means of regulating systemic iron homeostasis, a family of cytosolic RNA binding proteins known as Iron Regulatory Proteins (IRP) is considered to be the global regulators of cellular iron homeostasis. [score:4]
While it is tempting to postulate that miR-122 may be yet another interesting link between iron and copper metabolism, it is important to note that miR-122 comprises ~70% of all hepatic miRNA expression, and is therefore likely to have numerous regulatory roles and capacities [31, 65]. [score:4]
Elevated serum levels of miR-122 are detectable as much as two weeks earlier than traditional hepatitis -associated serum markers and therefore may represent a potential non-invasive biomarker for early detection of liver disease [64]. [score:3]
Inhibition of miR-122 in mice and non-human primates contributes to reduced plasma cholesterol levels, decreased hepatic fatty acid synthesis, and repressed cholesterol synthesis [31, 32]. [score:3]
Siaj R. Sauer V. Stoppeler S. Gerss J. Spiegel H. U. Kohler G. Zibert A. Schmidt H. H. Longitudinal analysis of serum miR-122 in a rat mo del of Wilson’s disease Hepatol. [score:3]
Systemic iron homeostasis is also likely influenced by miRNA expression via the liver-specific miR-122 [44]. [score:3]
Intriguingly, miR-122 also correlates with copper accumulation and the onset of fulminant hepatitis in a rodent mo del of Wilson’s disease [64]. [score:3]
Esau C. Davis S. Murray S. F. Yu X. X. Pandey S. K. Pear M. Watts L. Booten S. L. Graham M. McKay R. MiR-122 regulation of lipid metabolism revealed by in vivo antisense targeting Cell Metab. [score:3]
For instance, the liver-specific miR-122 has been implicated in the maintenance of hepatocyte development, but also impacts hepatic cholesterol and lipid metabolism [31]. [score:2]
Castoldi M. Vujic Spasic M. Altamura S. Elmen J. Lindow M. Kiss J. Stolte J. Sparla R. D’Alessandro L. A. Klingmuller U. The liver-specific microRNA miR-122 controls systemic iron homeostasis in mice J. Clin. [score:1]
[1 to 20 of 13 sentences]
48
[+] score: 48
The human IFNβ was reported to induce the expression of cellular miRNAs miR-196, miR-296, miR-351, miR-431, and miR-448, which displayed seed-sequence complementarity with HCV RNA genome and downregulated virus replication; conversely, the IFNβ was shown to downregulate the HCV cofactor miR-122, thereby causing a reduction in HCV replication [209]. [score:9]
Employing a similar microarray -based approach, Triboulet et al. [181] showed that, while 11 cellular miRNAs (including miR-122, miR-297, miR-370, and miR-373) were upregulated, just two cellular miRNAs, miR-17-5p and miR-20a were downregulated upon HIV-1 infection in the Jurkat cells. [score:7]
Further, the hepatitis B virus (HBV) RNA harbors six miR-122 -binding sites that act as sponges of miR-122; the ensuing sequestration and downregulation of miR-122 was proposed to steer them away from their inhibitory action on cellular proteins that aid HBV replication [171, 172]. [score:6]
Interestingly, miR-122 was recently shown to primarily enhance the viral RNA synthesis by competing with the poly(rC) -binding protein (PCBP2), thus steering the viral genome away from translation [168]; this, albeit indirectly, reinforces the canonical role of miRNAs as translational repressors. [score:6]
Li C. Wang Y. Wang S. Wu B. Hao J. Fan H. Ju Y. Ding Y. Chen L. Chu X. Hepatitis B virus mRNA -mediated miR-122 inhibition upregulates PTTG1 -binding protein, which promotes hepatocellular carcinoma tumor growth and cell invasionJ. [score:6]
The recognition of miR-122 as an essential cofactor for HCV replication has resulted in the development, and clinical trial, of an miR-122 -targeting antimiR. [score:4]
A striking example, and a first report involving an RNA virus, was the demonstration that the liver-specific miR-122 binds directly to the 5′-UTR of the hepatitis C virus (HCV) RNA without affecting the viral mRNA stability or translation. [score:4]
Li Y. Masaki T. Yamane D. McGivern D. R. Lemon S. M. Competing and noncompeting activities of miR-122 and the 5′ exonuclease Xrn1 in regulation of hepatitis C virus replicationProc. [score:2]
Shimakami T. Yamane D. Jangra R. K. Kempf B. J. Spaniel C. Barton D. J. Lemon S. M. Stabilization of hepatitis C virus RNA by an Ago2-miR-122 complexProc. [score:1]
Subsequently, miR-122, in concert with AGO2, was shown to protect the bound HCV RNA from host mRNA decay machinery [166, 167]. [score:1]
Interestingly, both miR-122 and miR-17 has been shown to act as “miRNA sponges”, thus altering the host transcriptome [169, 170]. [score:1]
Interestingly, the virus replication was reduced when the miR-122 binding to HCV RNA was blocked, thus indicating that miR-122 promoted HCV replication [165]. [score:1]
[1 to 20 of 12 sentences]
49
[+] score: 47
The expression of mir-296-5p (p = 0.002), mir-122 (p<0.001), mir-448 (p<0.001) and mir-128 (p<0.001) was significantly down-regulated in patients with chronic hepatitis C compared to normal non-infected patients (Fig. 2C). [score:5]
Mir-122 is highly expressed in the liver; its over -expression stimulates HCV replication, in vitro [18]. [score:4]
None of mir-23a, mir-99a and mir-122 was differentially expressed between SVRs and NRs (Fig. 3A). [score:3]
Mir-122 showed a trend of down-regulation in NRs. [score:3]
Moreover, the expression of mir-23a, mir-99a and mir-122 were not correlated in serum and liver samples (Table 3). [score:3]
In a previous work, we showed that mir-122 expression was decreased in patients with IFNL3 CT/TT genotypes and that this association was stronger than the one between mir-122 and the response to the treatment [23]. [score:3]
In agreement, in the current cohort, when RRs were added to the group of NRs, the difference of mir-122 expression between SVRs and NRs plus RRs was statistically significant (p = 0.02). [score:3]
2C- The expression of mir-122, mir-196b, mir-296-5p, mir-448, mir-431 and mir-128 was analyzed by RT q-PCR in the total group of patients (n = 111). [score:3]
The aim was to study the expression of 6 miRNAs (mir-122, mir-196b, mir-296-5p, mir-448, mir-431 and mir-218) and 30 mRNAs (S1 Table). [score:3]
Interestingly, mir-122 was expressed in the serum and strongly correlates with Alanine amino transferase (Fig. 3B), confirming our previous results [23]. [score:3]
The use of anti mir-122 (SPC3649, miravirsen) inhibits viral replication both in animal mo del and in HCV infected patients [19– 21]. [score:3]
A reduction of mir-122 expression has been reported, at baseline, in patients with primary non-response as compared to patients with early virological response [22]. [score:2]
The level of expression of mir-23a and mir-99a were low compared to mir-122 (Fig. 3A). [score:2]
In the serum, the level of expression of mir-23a and mir-99a were low compared to the one of mir-122 (Fig. 3A). [score:2]
The expression of mir-23a, mir-99a, mir-181a*, mir-217 and mir-122 was investigated, in 68 serum samples available (NR = 26, RR = 10, RR = 32) (Fig. 3). [score:1]
0121395.g003 Fig 33A- Mir-23a, mir-99a, mir-181a*, mir-217 and mir-122 were detected by RT-q-PCR in 68 serums (NR = 26, RR = 10, RR = 32). [score:1]
3A- Mir-23a, mir-99a, mir-181a*, mir-217 and mir-122 were detected by RT-q-PCR in 68 serums (NR = 26, RR = 10, RR = 32). [score:1]
3B- Correlation between mir-122 and alanine amino transferase, in the serum. [score:1]
Interestingly, only serum mir-122 and alanine amino transferase were strongly correlated (Fig. 3B), as we previously described [23]. [score:1]
[1 to 20 of 19 sentences]
50
[+] score: 43
The four upregulated miRNAs, i. e., miR-122, miR-194, miRNA-101b and miRNA-705, in mice treated with or without metformin were consistent with four of the 60 downregulated miRNAs from the control group and MCD-fed mice. [score:7]
By contrast, miRNA-122 and miRNA-194 were significantly upregulated by metformin out of the nine miRNAs that were downregulated in the NASH liver of MCD-fed mice. [score:7]
Notably, miR-122, miR-194, miRNA-101b, and miRNA-705 were upregulated and miRNA-376a, miRNA-127, miRNA-34a, miRNA-300 and miRNA-342-3p were downregulated in the liver tissue of MCD-fed mice treated with or without metformin (Table IB and Fig. 6). [score:7]
Similar to miRNA-122, downregulation of miRNA-194 enhances the expression of frizzled-6 (FZD6) and promotes tumorigenesis in the adult liver (26). [score:6]
Additionally, it has been described that miRNA-122 is downregulated in NASH and may alter lipid metabolism in the liver (13). [score:4]
Taken together, it is suggested that one of the downstream targets of the metformin -induced pathway is miRNA-122 and/or miRNA-194. [score:3]
Hu et al (14) recently reported that miRNA-122 is a liver-specific miRNA and acts as a suppressor of cell proliferation and carcinogenesis in hepatocytes (19). [score:3]
However, the target gene of miRNA-122 involved in lipid metabolism remains elusive (25). [score:3]
Currently, several target genes of miRNA-122 have been shown to be involved in hepatocarcinogenesis, such as a distintegrin and metalloproteinase family 10 (ADAM10), serum response factor (SRF) (21), insulin-like growth factor 1 receptor (Igf1R) (22), cyclin G1 (23) and Wnt1 (24). [score:3]
[1 to 20 of 9 sentences]
51
[+] score: 42
Other miRNAs from this paper: hsa-mir-21
miR-122 is one of the most qualified human disease miRNA biomarkers, but its translation to clinical utility has been limited by a lack of a rapid and precise assay, and the challenges of the workflow of PCR. [score:4]
Here, we elected to use an aldehyde -modified cytosine to interrogate a guanidine residue on the target miR-122 (Table 1). [score:3]
The sequence of the probe (1) was designed to allow anti-parallel hybridization with the mature miR-122 target (2); sequences are shown in Table 1. The probe contained 3 thymidine bases modified with propionic acid side chains to increase its negative charge. [score:3]
Sequences of capture probe (1) and miR-122 target (2). [score:3]
These data show that the Ct values of miR-122 with a single base mismatch did not differ significantly from the perfect match target, indicating that conventional RT-qPCR does not have the specificity of the Simoa assay described here. [score:2]
S3 Fig shows AEB values of the off-target miRNA compared to the calibrator for miR-122; the AEB values for miR-39 were at background. [score:2]
For comparison, we also examined the specificity of the PCR assay for miR-122 by comparing the Ct values of the target miRNA and the single base mismatched molecule across the concentration range (S4 Fig). [score:2]
Fig 4A shows AEB values for miR-122 in the serum of patients with liver injury and healthy controls. [score:1]
At low concentrations of miR-122, the ratio of enzyme labels to beads was <1, so that the distribution of enzymes on the beads followed a Poisson distribution,[12] and single miR-122 molecules were labeled. [score:1]
Ct values were determined for miR-122 and miR-39 in separate PCR reactions. [score:1]
[15] miR-122 is a known biomarker of drug -induced liver toxicity that is more sensitive and specific than conventional markers of liver toxicity. [score:1]
The calibration curve was also used to determine the concentration of miR-122 in each sample following the protocol reported in the miRNeasy Serum/Plasma Handbook. [score:1]
The mature sequence of miR-122 is 22 bases long. [score:1]
To calibrate the concentration of miR-122 and as a control to determine the efficiency of recovery and reverse transcription of miRNA, 3.5 μL of cel-miR-39-3p (1.6 × 10 [8] copies/μL) was added to each sample, in addition to 100 μL chloroform. [score:1]
We applied this method to detect miR-122, a biomarker of liver toxicity, in serum. [score:1]
Preparation of samples spiked with known concentrations of a synthetic calibrator for miR-122. [score:1]
A specific 18-mer abasic PNA probe that was complementary to miR-122 was synthesized with the cytosine base at the 9 [th] position from the C-terminus of the PNA probe replaced with a secondary amine group to yield a “blank” position in the capture sequence. [score:1]
These enzyme-labeled miR-122 molecules were detected by loading the beads into arrays of ~239,000 microwells in the presence of a fluorogenic substrate of β-galactosidase (RGP). [score:1]
Determination of concentration of miR-122 using quantitative real time PCR. [score:1]
Correlation of concentration of synthetic miR-122 spiked into serum determined using Simoa and PCR. [score:1]
Ct values determined using PCR as a function of [miR-122]. [score:1]
A synthetic calibrator for miR-122 (A, S2 Table) at different concentrations were added to each aliquot to yield 6 control samples (Control samples 1 to 6 containing: 10 nM, 10 nM, 1 nM, 1 nM, 100 pM, and 10 pM, respectively). [score:1]
Determination of concentration of miR-122 using Simoa. [score:1]
The AEB values for miR-122 in healthy individuals, however, were similar and slightly above background (dotted line in Fig 4A), an observation that could be caused by differences in the matrix of the samples and calibrator solutions, rather than the presence of miR-122. [score:1]
If miR-122 was present in the sample then it hybridized to the complementary capture probe on the beads (I, Fig 1). [score:1]
[17] From the resulting AEB values of calibrators of known concentration, the concentrations of miR-122 in samples of unknown concentration were determined from interpolation using linear curve fitting in Microsoft Excel. [score:1]
Concentrations of miR-122 in samples using PCR. [score:1]
Fig 3 shows AEB values for buffered solutions into which known concentrations of a synthetic calibrator for miR-122 were spiked ranging from 0 to 1500 pM. [score:1]
Bland-Altman plot for concentrations of miR-122 in serum samples of patients determined using Simoa and PCR. [score:1]
Second, a molecule that differed in sequence from miR-122 by a single base at the complement to the labeling position was tested. [score:1]
[1 to 20 of 30 sentences]
52
[+] score: 42
0037395.g003 Figure 3(A) Serum miR-122 expression levels; (B) Serum miR-192 expression levels; (C) Serum miR-193 expression levels; (D) Biochemical parameter: serum ALT levels; (E) Biochemical parameter: serum AST levels. [score:7]
0037395.g004 Figure 4(A) Serum miR-122 expression levels; (B) Serum miR-192 expression levels; (C) Serum miR-193 expression levels; (D) Biochemical parameter: serum ALT levels; (E) Biochemical parameter: serum AST levels; The absolute concentrations of target miRNAs were calculated by referring to calibration curves developed with corresponding synthetic miRNA oligonucleotides. [score:7]
Among them, circulating miR-122 had been reported as liver-specifically conserved across species [24], [35], [36] and has been applied to diagnosis of various liver diseases in clinical studies, including hepatocellular carcinoma (HCC) [38], [39], [40], hepatitis B virus (HBV) infection [24], [39], cirrhosis [38] and alcohol- and chemical-related hepatic diseases [24], [27]. [score:5]
Unfortunately, this approach has its own disadvantages; circulating miR-122 could not serve as a biomarker to distinguish these different liver diseases. [score:3]
Once an elevated circulating miR-122 level has been detected, a physician cannot make a judgment about what the specific liver disease(s) is/are using this information alone. [score:3]
By individual TaqMan qRT-PCR analysis of dysregulated serum miRNAs uncovered by serum TLDA and dysregulated liver tissue miRNAs uncovered by microarray hybridization in primary screening, 6 serum miRNAs, including miR-122, miR-192, miR-193, miR-200a, miR-21 and miR-29c, exhibited a high correlation with primary screening results. [score:3]
Beside, among the three serum miRNAs as potential diagnostic biomarker for DILI explored in rat mo dels in present study, miR-122 and miR-192 was also validated in plasma of mice mo dels by Wang et al. [27]. [score:1]
Besides, unlike ALT and AST, miR-122 has no association with muscle disorders [24]. [score:1]
In the dose -dependent analysis of the serum miRNAs miR-122, miR-192 and miR-193, miR-122 showed extremely high sensitivity in both 2 DILI mo del groups (fold change >50.0), while serum biochemical parameters (e. g., ALT and AST) displayed only mild sensitivity (fold change <20.0) in the high-dose group. [score:1]
Patients with circulating miR-122 elevation might be infected by HBV and/or present HCC and/or be stimulated by alcohol abuse rather than drug overdosing. [score:1]
The panel of aberrantly expressed serum miRNAs (miR-122, miR-192 and miR-193) all exhibited time- and dose -dependent characteristics. [score:1]
Our results demonstrate that a new panel of serum miRNAs (miR-122, miR-192 and miR-193) could have the potential to serve as sensitive, specific and noninvasive biomarkers for the diagnosis of DILI. [score:1]
The concentration of serum miR-122 peaked at 12 h after administration (fold change >100.0), while serum biochemical parameters showed a limited change (fold change <3.0). [score:1]
The liver-specific miR-122, for example, is over 1,000 times more abundant in 0.1 g liver tissue than in 0.1 mL serum (Figure S3). [score:1]
Among this set of serum miRNAs, miR-122, miR-192 and miR-193 presented a significant change in both DILI mo del groups within the threshold of a fold change >10 and P-value<0.05 (Table 1). [score:1]
Previously, plasma miR-122 and miR-192 had been reported increased linearly from 1 to 3 hours and displayed dose -dependent manner after APAP overdosing in mice. [score:1]
All 3 serum miRNAs demonstrated better sensitivity than serum biochemical parameters in the middle- and low-dose group, but serum miR-122 was much more sensitive than biochemical parameters (Figure 4A, 4B, 4C, 4D and 4E). [score:1]
In summary, serum miR-122, miR-192 and miR-193 constitute a new panel for compound- and herb -induced liver injury diagnosis. [score:1]
Given that circulating miR-122 was previously reported as a DILI biomarker, the results from the strategies in this study indicate that there is a set of serum miRNAs highly related to DILI. [score:1]
In the time -dependent analysis of the serum miRNAs miR-122, miR-192 and miR-193, all of these serum miRNAs exhibited an ascending trend 3 h after administration in both DILI mo del groups (fold change >2.0); while serum biochemical parameters (e. g., ALT and AST) remained at baseline levels (fold change <1.5). [score:1]
[1 to 20 of 20 sentences]
53
[+] score: 42
Two mouse strains, C57BL/6 and BALB/c, were employed as schistosomiasis japonica disease mo dels to detect in serum, four host circulating miRNAs, miR-122, miR-21, miR-20a and miR-34a, all of which have been suggested to be correlated with different types of liver disease progression [30– 33]. [score:5]
Temporal abundance analysis of host serum miRNAs in two murine mo dels during S. japonicum infectionTwo mouse strains, C57BL/6 and BALB/c, were employed as schistosomiasis japonica disease mo dels to detect in serum, four host circulating miRNAs, miR-122, miR-21, miR-20a and miR-34a, all of which have been suggested to be correlated with different types of liver disease progression [30– 33]. [score:5]
These observations led us to hypothesise that the up-regulation of serum miR-122, miR-21 and miR-34a levels in BALB/c mice during infection may be mainly due to the massive release of these miRNAs from necrotic hepatocytes. [score:4]
There are consistent observations that miR-122 serum levels are elevated in a number of liver diseases with different etiologies, suggesting that this miRNA may act as a clear biomarker of general liver injury [11, 42]. [score:3]
The advantage of using two mouse strains in this study was the capacity to observe the considerably different dysregulation of circulating host miRNAs, miR-122, miR-21 and miR-34a, in the sera of C57BL/6 and BALB/c mice during S. japonicum infection. [score:2]
M, Ultra low range DNA ladder; lane 1, ath-miR-159a; lane 2, mmu-miR-122; lane 3, mmu-miR-21; lane 4, mmu-miR-20a; lane 5, mmu-miR-34a; lane 6, ath-miR-159a; lane 7, sja-miR-277; lane 8, sja-miR-3479-3p. [score:1]
There were no significant differences in hepatic egg burden between the two mouse strains at any time-point (2-Way ANOVA, P>0.05) (Fig 2A), indicating that differences in hepatic egg burden did not cause the differential serum levels of miR-122, miR-21 and miR-34a observed in the two mouse strains during S. japonicum infection. [score:1]
In BALB/c mice, the elevated serum miR-122 and miR-21 levels showed a much stronger correlation with hepatocellular enzymes than with the level of hepatic necrosis. [score:1]
In addition, the abundance of serum miR-34a showed the strongest association with the degree of liver fibrosis in BALB/c mice during schistosomiasis progression, followed by miR-122 and miR-21 (Fig 4E). [score:1]
With miR-122 and miR-34a, there was a significant difference between the two mouse strains at 4–11 weeks p. i., while for miR-21 and miR-20a, significant difference was only observed at 7 weeks p. i. (Fig 1C). [score:1]
Here, significant correlations between the levels of serum miRNAs (miR-122 and miR-21) and liver enzymes indicate that the passive release from injured tissues may represent a key mechanism for the observed increased levels of these miRNAs. [score:1]
Furthermore, plasma miR-122 has been shown to have a better performance than ALTs in the detection of liver injury [43, 44]. [score:1]
This can be explained by the fact that hepatic necrosis peaked at 6 weeks p. i. in this strain and dramatically decreased thereafter, while the serum levels of miR-122 and miR-21 reached a plateau after 7 weeks p. i., due to accumulation of these miRNAs, which are extremely stable in body fluids [9, 47]. [score:1]
In contrast, apart from miR-20a, the serum levels of the three other host miRNAs were significantly elevated in BALB/c mice by 6 (miR-122) or 7 (miR-21 and miR-34a) weeks p. i. and thereafter (Fig 1B and S3 Fig). [score:1]
For example, the level of liver-specific miR-122 was elevated in the serum of BALB/c mice after S. japonicum infection [24], while it did not change in the serum of C57BL/6 mice between 4–12 weeks post- S. mansoni infection [18]. [score:1]
Similar results were observed by He et al., who found that the levels of miR-122 and miR-34a were significantly elevated in the serum of BALB/c mice at 72 days post- S. japonicum infection [24]. [score:1]
In C57BL/6 mice, the serum concentrations of miR-122, miR-20a and miR-34a did not change at any time point post infection, but the level of serum miR-21 was increased at 6 (1-Way ANOVA, P<0.01) (Fig 1A). [score:1]
Three host circulating miRNAs, miR-122, miR-21 and miR-34a, may, as a panel, serve as indicative biomarkers for hepatopathology progressions. [score:1]
S1 Fig M, Ultra low range DNA ladder; lane 1, ath-miR-159a; lane 2, mmu-miR-122; lane 3, mmu-miR-21; lane 4, mmu-miR-20a; lane 5, mmu-miR-34a; lane 6, ath-miR-159a; lane 7, sja-miR-277; lane 8, sja-miR-3479-3p. [score:1]
This may explain why the significant alteration in miR-122 serum levels could be sensitively detected in BALB/c mice as early as 6 weeks p. i., at the same time when hepatic necrosis is evident. [score:1]
However, miR-21, miR-122 and miR-223 were also shown elevated in the serum of patients with HCC (hepatic cellular carcinoma) and chronic hepatitis and these miRNAs were suggested as novel biomarkers for liver injury but not specifically for HCC [32], thereby providing support that the elevation of serum miRNA-223 level might also be caused by liver necrosis due to S. japonicum infection. [score:1]
MiR-122 is the predominant liver-specific miRNA, constituting about 70% of the total miRNA population in normal liver tissue [41]. [score:1]
Meanwhile, the degree of hepatic granuloma and fibrosis also stabilized after 7 weeks p. i. in BALB/c mice, which resulted in significant positive correlations between the serum miR-122 and miR-21 levels and hepatic fibrosis severity. [score:1]
The serum miR-20a and miR-34a levels showed a significant but weaker correlation with the serum AST and ALT levels than those of miR-122 and miR-21 in BALB/c mice. [score:1]
The inconsistent levels of the host circulating miRNAs, miR-122, miR-21 and miR-34a in serum were confirmed in the two murine mo dels during infection, which limits their potential value as individual diagnostic biomarkers for schistosomiasis. [score:1]
Thus, as summarized in Table 1, the differential levels of miR-122, miR-21 and miR-34a in host sera are mainly the result of hepatopathology caused by the different types of immune response induced in C57BL/6 and BALB/c mice after S. japonicum infection, especially following the onset of egg deposition. [score:1]
In summary, inconsistent serum levels of host miR-122, miR-21 and miR-34a in different murine mo dels during infection may impair their value as diagnostic biomarkers for schistosomiasis. [score:1]
Among these four miRNAs, the serum concentration of miR-122 showed the strongest association with the serum levels of liver injury-related enzymes and the severity of hepatic necrosis in BALB/c mice during S. japonicum infection, and this was followed by miR-21 (Fig 4B–4D). [score:1]
[1 to 20 of 28 sentences]
54
[+] score: 41
As in one study, human liver specific miRNA expression vector for miR-122 was constructed, and the tissue specific expression of miR-122 using this vector in HepG2 cells down-regulated the gene expression of HBV [119]. [score:10]
Thus, it further highlighted the potential of targeting miR-122 with antagomirs for inhibition of metabolic disease development. [score:8]
After three days of daily 80 mg/kg antagomirs to normal mice, levels of mRNAs of hundreds of genes containing miR-122 targeting sequence in their 3’ UTRs were increased by a factor of at least 1.4, and a down-regulation of nearly as many mRNAs occurred possibly through the suppression of a transcriptional repressor. [score:8]
The effective inhibition of miR-122 in this study also resulted in a reduction in cholesterol levels and a decrease in hepatic fatty acid and cholesterol synthesis rates, both in normal mice and in diet -induced obese mice, with a significant improvement in liver steatosis of diet -induced obese mice [67, 73]. [score:3]
Unexpectedly, it not only inhibited miR-122, but also led to the degradation of the corresponding miR-122 in the liver and other tissues except central nervous system (CNS), but not the other species of miRNAs in those tissues. [score:3]
miR-122 is the highly expressed dominant miRNA in the liver, and is implicated in fatty acid and cholesterol metabolism as well as hepatitis C viral replication [59, 79]. [score:3]
The striking example for the latter was from the investigation of hepatitis C virus (HCV) infection, which revealed a smart strategy of this virus to utilize host liver-specific miR-122 targeting the 5’UTR of the viral genome as a positive regulator of viral replication, putatively via conformational change of 5’UTR [59]. [score:2]
In another study, Esau et al. achieved the same results by delivering intraperitoneally 2′-MOE AMO to silence the miR-122 in mice. [score:1]
Krutzfeldt and coworkers showed for the first time the long-lasting and non-toxic silencing generated by intravenously injected ‘antagomirs’ (2′-OMe) complementary to miR-122 in mice [81]. [score:1]
In several pioneer studies, the efficiency and significance of various AMOs have been examined and validated by the mo del that ablates the liver-enriched miR-122 in living mice upon administering the specially developed AMOs [67, 73, 81, 82]. [score:1]
An in vivo study exhibits LNA as efficient antigomirs, systemically administered 16-nt, unconjugated LNA-antimiR oligonucleotides complementary to the 5′ end of miR-122 led to specific, dose -dependent silencing of miR-122 and showed no hepatotoxicity in mice [82]. [score:1]
[1 to 20 of 11 sentences]
55
[+] score: 38
The results of recent studies show a significant down-regulation of miR-122, a liver-specific miRNA 81, 82, which is important for normal lipid metabolism, and the marked up-regulation of miR-34a, a critical regulator of apoptosis 83, in the livers of mice fed with ethanol (Fig.  3). [score:8]
Ethanol increases miR-34a and decreases miR-122 in the liver, resulting in altered target gene expressions, and consequently, increased cell proliferation while maintaining overall apoptosis resistance. [score:5]
Among these, the over -expression of miR-21, miR-34a, miR-155, miR-320 and the under -expression of miR-122, miR-181a, miR-199a, miR-200a were reported by more than one publication. [score:5]
Both miR-122 and miR-34a were aberrantly expressed in both alcoholic steatohepatitis and non-alcoholic fatty liver disease 52, 84, 87. [score:5]
miRNA Chromosome location Dysregulation References miR-122 18q21.3 Decreased/Increased 52, 103 miR-125b 11q24.1 Decreased 103 miR-126 9q34.3 Decreased 98 miR-155 21q21.3 Increased 31, 99 miR-181a 1q32.1 Decreased 52, 100 miR-199a 1q24.3 Decreased 99, 100 miR-200a 1p36.33 Decreased 100, 103 miR-21 17q23.2 Increased 52, 102 miR-217 2p16.1 Increased 91 miR-320 8p21.3 Increased 100, 103 miR-34a 1p36.22 Increased 52, 103 miR-375 2q35 Increased 101 miR-486 8p11.21 Increased 100 let-7b 22q13 Decreased 52 miRNA is a known regulator of Kupffer cell response to. [score:3]
In normal liver, miR-34a and miR-122 cooperatively repress gene expression to balance cell survival and proliferation. [score:3]
miR-34a is anti-apoptotic, while miR-122, the liver specific miRNA, is the critical regulator of cell cycle. [score:2]
It is also known that ethanol regulates miRNA (miR-122 and miR-34a) in the liver that contributes to hepatocytes/HSC survival. [score:2]
Several recent reports have shown that miRNAs miR-122 and miR-34a are two of the most frequently dysregulated miRNAs in steatohepatitis 84, 85. [score:2]
Serum/plasma miR-122 has been correlated with ALT increases in the liver damage caused by alcohol, and was predominantly associated with the exosome-rich fraction 86. [score:1]
These miRNAs are described in Table 2. Three of the more notable ones are miR-122, miR-34a and miR-21. [score:1]
One of the miRNA's responsible for maintaining intestinal permeability is the miR-122, which as was mentioned before is negatively affected by ethanol exposure. [score:1]
[1 to 20 of 12 sentences]
56
[+] score: 38
Taken together with our later observations that targeting of the liver-specific miR-122-5p or poorly abundant miR-195-5p, miR-25-3p, miR-200a/b/c-3p, miR182-5p and the mutant miR-224-5p mut2 by 2′OMe AMOs (but not their LNA/DNA AMO counterparts) also resulted in significant inhibition of immunostimulatory ssRNA sensing, our work establishes sequence -dependent and miRNA-independent off-target inhibitory activity of 2′OMe AMOs on the immune sensing of pathogenic RNA by human and mouse phagocytes. [score:9]
Mutation or deletion of part of this motif resulted in the loss of inhibitory activity for miR-200a-3p, miR-122-5p and NC1 2′OMe AMO variants, while introduction of this motif to the poorly inhibitory miR-224-5p AMO significantly increased the inhibitory activity of the AMO on TLR7. [score:8]
The sequence-specific and miRNA-independent significant inhibition of immunostimulatory ssRNA sensing by 2′OMe AMOs targeting miR-195-5p, miR-25-3p, miR-122-5p, miR-200a/b/c-3p and miR182-5p (Figure 2B) was supported by the lack of inhibitory activity with LNA/DNA AMOs (Figure 2C), and the low abundance of these miRNAs (less than 100-fold the level of the most abundant miRNA in BMMs) (Figure 2A). [score:7]
Critically, this core sequence overlapped with a significantly enriched motif found in all the inhibitory sequences of Class 2 AMOs previously identified, in 5′-3′ orientation (for miR-200a/b-3p, and miR-25-3p) or 3′-5′ orientation (for AMO-NC1, miR-182-5p, miR-122-5p and miR-195-5p) (Figure 4C and Supplementary Table S2). [score:3]
Our analyses of truncated variants of miR-122-5p and miR-200a-3p 2′OMe AMOs also show that disruption of the context of the inhibitory motif can significantly reduce its activity (Figure 4). [score:3]
We speculate that this relates to the position of the motif at the 5′-end of the sequence, which precludes formation of secondary structures necessary for inhibitory activity; similar to what is seen with miR-122-5p short. [score:3]
This is illustrated with the example of the anti-miR-122-5p miRNA, miravirsen, a 15-nucleotide LNA/DNA phosphorothioate AMO with demonstrated therapeutic effect against hepatitis C virus in recent human clinical trials (34). [score:1]
Critically, we found this motif in miR-182-5p and miR-122-5p AMOs, when read in 3′-5′ orientation. [score:1]
Similar results were found for a 15mer variant of miR-122–5p (Figure 4G). [score:1]
To define further the impact of this motif in the modulation of TLR7/8 sensing, we generated a set of AMO mutants and truncated variants (Figure 4D) based on miR-200a/c-3p, miR-122-5p and NC1 2′OMe AMOs. [score:1]
The miR-122-5p AMO (reported as ‘15mer 2′OMe 5′inZEN, 3′ZEN’) was previously found to have similar miR-122–5p inhibitory activity in reported assays, compared to its full-length counterpart (7). [score:1]
[1 to 20 of 11 sentences]
57
[+] score: 37
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-205, hsa-mir-214, hsa-mir-221, hsa-mir-1-2, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-184, hsa-mir-193a, hsa-mir-1-1, hsa-mir-29c, hsa-mir-133b, dre-mir-205, dre-mir-214, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-mir-1-2, dre-mir-1-1, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-107a, dre-mir-122, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-184-1, dre-mir-193a-1, dre-mir-193a-2, dre-mir-202, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-202, hsa-mir-499a, dre-mir-184-2, dre-mir-499, dre-mir-724, dre-mir-725, dre-mir-107b, dre-mir-2189, hsa-mir-499b, dre-mir-29b3
In the murine mo del, overexpression of miR-122 has been shown to perturb hepatic cell differentiation and induce biliary hyperplasia [141], and the authors suggested that monitoring or controlling the expression level of miR-122 might help during programmed in vitro differentiation of stem cells toward hepatocytes for regenerative therapy of liver disease. [score:7]
Of interest because it is expressed specifically in the liver [138, 139, 140], controls hepatocyte differentiation [141] and gastrointestinal development [140], we found that dre-miR-122 was significantly upregulated after BPA exposure in the adult male liver. [score:7]
Interestingly, several VTGs are targets of miRNAs for silencing [119]: VTG-3 is targeted by miR-122, the most abundant miRNA in the liver, as well as miR-107, VTG-7 by miR-107, VTG-2 by miR-214 and VTG-6 by miR-23a, highlighting the importance that miRNAs have on vitellogenesis, oocyte maturation and reproduction. [score:5]
In gankyrin transgenic zebrafish, dre-miR-122 upregulation was associated with dysregulated metabolism and apoptosis in the liver [145]. [score:5]
MiR-122 has also been characterized as a tumor suppressor miRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, and its mode of action has been associated with the regulation of the disintegrin and metalloprotease 17 (ADAM17) [147]. [score:4]
Additionally, inhibition of miR-122 in mice led to a reduced fatty-acid synthesis rate, substantial reduction of liver steatosis and accumulation of triglycerides [146], implicating miR-122 as a key regulator of cholesterol and fatty-acid metabolism in the adult liver. [score:4]
Esau C. Davis S. Murray S. F. Yu X. X. Pandey S. K. Pear M. Watts L. Booten S. L. Graham M. McKay R. Mir-122 regulation of lipid metabolism revealed by in vivo antisense targetingCell Metab. [score:3]
Recently, the circulating miRNA signature associated with NAFLD progression has been examined, and miR-122 was the only deregulated miRNA allowing distinction between simple steatosis (SS) and non-alcoholic steatohepatitis (NASH) [157]. [score:2]
[1 to 20 of 8 sentences]
58
[+] score: 37
It is wi dely reported that miRNAs translate across species; for example, we have reported that miR-122-5p reports liver injury in cell mo dels, zebrafish, rodents and humans. [score:3]
Biomarker sensitivity - ROC curve analysis supports the potential for miR-122-5p to predict the development of ALI. [score:2]
For patient stratification at first presentation to hospital miR-122-5p is the lead miRNA candidate for clinical development, possibly in combination with miR-483-3p. [score:2]
The most abundant miRNA species in the liver 20, miR-122-5p, was the highest increased circulating miRNA but other species were elevated to comparable degrees (miR-885-5p, miR-151-3p) or were ranked higher by random forest analysis in terms of ability to report injury (miR-382-5p). [score:1]
ROC analysis revealed that miR-122-5p was superior to ALT activity with regard to predicting APAP-TOX in early APAP patients. [score:1]
In the 67 APAP-early patients, miR-122-5p identified subsequent liver injury when normalized by any of the 6 endogenous miRNA normalizers described above (miR-122-5p area under ROC curve normalized by miR-1913, 0.97 (95% CI 0.92–1.01); miR-671, 0.96 (0.92–1.01); miR-1287, 0.95 (0.90–1.00); let7-d, 0.94 (0.89–1.00); miR-1260, 0.93 (0.88–1.00); miR-324, 0.93 (0.87–1.00) miR-122-5p ROC-AUC significantly larger than all other miRNAs – P < 0.05). [score:1]
miR-885-5p remained elevated longer than miR-122-5p (Fig. 6B). [score:1]
In addition to miR-122-5p, the miRNA species miR-22, miR-29b, miR-29c, miR-130a and miR-193 were increased in both mice and humans. [score:1]
In situ hybridization for miR-122-5p and miR-885-5p was performed on liver explants removed following acetaminophen overdose. [score:1]
Figure (A) Pearson correlation plot of circulating miR-885-5p and miR-122-5p across APAP-TOX and APAP-no TOX patients. [score:1]
The largest fold increase miRNAs (miR-122-5p and miR-885-5p) were highly correlated across patients in the training set (Fig. 3A). [score:1]
At first presentation, miR-122-5p was also superior to other miRNAs with regard to prediction of subsequent liver injury. [score:1]
Images from hematoxylin and eosin (H&E) and in situ hybridization for miR-122-5p and miR-885-5p are presented. [score:1]
When normalized by any of the stable miRNAs, miR-122-5p was superior to ALT. [score:1]
miR-122-5p, miR-885-5p, miR-151-3p and miR-382-5p reported acute liver injury due to causes other than acetaminophen, which is consistent with them being liver specific and demonstrates that this panel has utility in the diagnosis of acute liver injury due to multiple causes. [score:1]
These data suggest release of miR-122 and miR-885 from the same cells attached to the same carrier protein. [score:1]
However, there was no difference in miR-122-5p, miR-885-5p, miR-151a-3p or miR-382-5p (Table 1). [score:1]
The largest fold change miRNAs (miR-122-5p, miR-885-5p and miR-151-3p) and the best discriminating miRNA (miR-382-5p) were taken forward and tested for specificity. [score:1]
Interestingly, combining miR-122-5p with miR-483-3p resulted in an increase in predictive accuracy (as judged by the largest area under the ROC curve). [score:1]
miR-122-5p and miR-885-5p are released from human hepatocytes bound to the carrier protein Ago2. [score:1]
For the first time we demonstrate that human miR-122-5p circulates bound to the protein Ago2 and this fraction increases with liver injury. [score:1]
Comparative biomarker profiles for miR-122-5p, miR-885-5p, miR-151-3p and miR-382-5p are summarized in supplementary Table 5. Although miR-122-5p had the highest fold increase in APAP-TOX patients, it was ranked 11th place in the miRNA panel, suggesting that other microRNA species may have greater clinical utility. [score:1]
The 3 largest fold increase miRNAs (miR-122-5p, miR-885-5p and miR-151a-3p) and the miRNA with the lowest prediction error from the classifier mo del (miR-382-5p) were taken forward and tested for specificity and sensitivity. [score:1]
By contrast with vehicle treated controls (N = 7), acetaminophen toxicity in mice resulted in increased miR-122-5p and miR-151a-3p, and decreased miR-382-5p, in line with our human data (Fig. 5E–H). [score:1]
Figure (B– D) represent the relative Ago2 fraction for miR-122-5p, miR-885-5p and miR-151a-5p respectively in APAP-TOX (N = 6) and APAP-no TOX (N = 6) patients. [score:1]
Figure (E– H) present miR-122-5p, miR-885-5p, miR-151a-3p and miR-382-5p in control mice, APAP overdose mice and cisplatin -induced acute kidney injury (AKI) mice. [score:1]
miR-122-5p very accurately predicted liver injury at first presentation to hospital, especially when combined with the largest decrease miRNA. [score:1]
Figure (A– D) present circulating miR-122-5p, miR-885-5p, miR-151a-3p and miR-382-5p in APAP-no TOX patients and patients with acute liver injury (ALI) induced by APAP overdose or another aetiology (non-APAP). [score:1]
Cisplatin had no effect on miR-122-5p, miR-885-5p, miR-151a-3p or miR-382-5p (Fig. 5E–H). [score:1]
After antibody -mediated pull down of Ago2 (corrected by IgG control), acetaminophen toxicity induced a significant increase in the amount of miR-122-5p and miR-885-5p specifically bound to Ago2 (Fig. 3B,C), consistent with both miRNAs being released bound to this protein. [score:1]
The temporal profiles of the individual miRNAs were different; miR-122-5p concentration was elevated but decreased earlier than ALT (Fig. 6A). [score:1]
The largest median (IQR) increased circulating miRNAs were miR-122-5p 68 (11–277), miR-885-5p 57 (17–372) and miR-151a-3p 57 (16–360) (Fig. 2B). [score:1]
In rats, in addition to miR-122-5p, the increase of miR-22, miR-193 and miR-194 was in accordance with our human data 23. [score:1]
[1 to 20 of 33 sentences]
59
[+] score: 37
Furthermore, a relationship between miR-122 and expression of cholesterol and lipid metabolism genes was found; e. g., expression of pparβ /δ and smarcd1/baf60a, were highly sensitive to miR-122 dependent regulation [117]. [score:6]
Taken together, miR-122 -dependent regulation of noc expression may be an important link between miRNAs, hepatic lipid metabolism, and the circadian clock. [score:4]
Interestingly, NOC has also been identified as a direct target of miR-122 [110]. [score:4]
For example, Gatfield et al. [117] identified miR-122 as a candidate for regulating circadian gene expression in the liver. [score:4]
Knockdown of miR-122 in liver results in an increase in the amplitude of noc rhythms, with increased expression at night [110]. [score:4]
For example, miR-122, an abundant miRNA in hepatocytes [125, 126], might be a unique biomarker of liver disease, as increased levels of circulating miR-122 are present in conditions of viral, drug, and alcohol -induced liver toxicity [124]. [score:3]
Gatfield D. le Martelot G. Vejnar C. E. Gerlach D. Schaad O. Fleury-Olela F. Ruskeepaa A. L. Oresic M. Esau C. C. Zdobnov E. M. Integration of microRNA miR-122 in hepatic circadian gene expression Genes Dev. [score:3]
Zhou et al. [12] found that chronic alcohol feeding decreased the expression of miR-122 in liver during the early part of the light/inactive phase of the day (ZT2.5), suggesting that increased circulating levels of miR-122 [124] may indeed be correlated to release from alcohol-damaged hepatocytes [12]. [score:3]
They found that precursor and primary transcripts of miR-122 display circadian rhythmicity with expression peaking in the early morning. [score:3]
However, in liver of REV-ERB α knockout mice, they observed that miR-122 transcripts were constitutively elevated and non-cycling, indicating that REV-ERBα may drive transcription of miR-122. [score:2]
Hsu S. H. Wang B. Kota J. Yu J. Costinean S. Kutay H. Yu L. Bai S. la Perle K. Chivukula R. R. Essential metabolic, anti-inflammatory, and anti-tumorigenic functions of miR-122 in liver J. Clin. [score:1]
[1 to 20 of 11 sentences]
60
[+] score: 36
However, over -expression of miR-18a, miR-122, and miR-423-5p did not suppress the expression level of TNRC6B and suppression of miR-221 did not induce over -expression of TNRC6B. [score:11]
To clarify the biological links between miRNAs and TNRC6B, we examined the expression pattern of TNRC6B in Huh7 cells by real-time qPCR when expression levels of miR-18a, miR-18b miR-122, miR-221, miR-423-5p, and miR-22 were either over-expressed or suppressed. [score:9]
14.0 and showed that the expression of miR-221, miR-18a, miR-18b, and miR-423-5p in poorly differentiated HCC were significantly higher than in well differentiated HCC, and 8 miRNAs (miR-455-3p, miR-1914*, miR-100, miR-215, miR-122*, let-7b, miR-22 and miR-99a) in poorly differentiated HCC were expressed significantly lower than in well differentiated HCC. [score:5]
The expression of miR-221, miR-18a, miR-18b, and miR-423-5p in poorly differentiated HCC were significantly higher than in well differentiated HCC, and 8 miRNAs (miR-455-3p, miR-1914*, miR-100, miR-215, miR-122*, let-7b, miR-22 and miR-99a) in poorly differentiated HCC had significantly lower expression levels than in well differentiated HCC (p < 0.05) (Table  2). [score:5]
Recently the expression level of miR-122 was associated with not only hepatocarcinogenesis but liver homeostasis and essential liver metabolism [14, 15]. [score:3]
Homo sapiens trinucleotide repeat containing 6B (TNRC6B) was a common hypothetical target gene in miR-221, miR-18a, miR-18b, miR-423-5p, miR-455-3p, miR-1914*, miR-215, miR-122*, let-7b, and miR-22 using miRanda algorithm. [score:3]
[1 to 20 of 6 sentences]
61
[+] score: 35
In addition, 10 miRNAs; miR-720, miR-891a, miR-522, miR-518c, miR-3665, miR-3620, miR-382, miR-452, miR-122 and miR-147 were found down-regulated in the patient group, indicating tumor suppressor properties. [score:6]
Remaining in the same context, both initial and meta-analyses showed that miR-720, miR-891a, miR-3665, miR-3620, miR-382, miR-452, and miR-122 were down-regulated in the patient group and therefore indicating that they might possess tumor-suppressive activities. [score:6]
In addition, miR-122, has been well-documented to act as tumor-suppressor gene for hepatocellular carcinoma [63, 64] and breast cancer [65]. [score:3]
Regarding brain tumors, under expression of miRNA-122 has been demonstrated in glioma specimens and glioma cell lines and has been inversely correlated with patients’ survival following surgery [66]. [score:3]
Following meta-analysis, miR-122, miR-3162 and miR-642a were found to be significantly different between RE and CR samples in the log [2], ratio transformed expression values. [score:3]
The miR-122 tumor suppressor property was confirmed by meta-analysis (Table  1). [score:3]
Following meta-analysis, only miR-122* was found differentially expressed between males and females. [score:3]
Especially, miR-122 expression appeared to follow a descending trend from MB to ATRT to GE. [score:3]
Finally, ten miRNAs were found overexpressed in the control group when compared to the patients group (relapsed or in Complete Remission (CR)); miR-720 (I), miR-891a (J), miR-522 (K), miR-518c (L), miR-3665 (M), miR-891a (N), miR-382 (O), miR-452 (P), miR-122 (Q), miR-147 (R). [score:2]
Wang G, Zhao Y, Zheng Y: miR-122/Wnt/beta-catenin regulatory circuitry sustains glioma progression. [score:2]
Additionally, accounting for the natural values, miR-122 was found to be significantly different between control and RE samples as well as RE and CR samples. [score:1]
[1 to 20 of 11 sentences]
62
[+] score: 35
Eight miRNAs (miR-101, miR-107, miR-122, miR-29, miR-365, miR-375, miR-378, and miR-802), whose expression was found to be downregulated in c-Myc and/or AKT/Ras liver tumors, were selected and their tumor suppressor activity was assessed in c-Myc and AKT/Ras mice. [score:8]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
In summary, the present results indicate that miR-107, miR-122, miR-29, miR-365, and miR-802 possess weak to moderate tumor suppressive properties, as none of them is able to completely prevent oncogene driven liver tumor development in mice. [score:4]
Weak to moderate tumor suppressor potential of miR-107, miR-122, miR-29, miR-365, and miR-802 in c-Myc and AKT/Ras driven liver tumor development. [score:4]
Overexpression of miR-122 delayed c-Myc induced hepatocarcinogenesis, as two of nine c-Myc/miR-122 injected mice developed high tumor burden 8 weeks post injection (Supplementary Figure 5A and 5B). [score:3]
The tumor suppressor activity of miR-122 against AKT/Ras induced liver tumor was even more pronounced, as all of the AKT/Ras/miR-122 injected mice appeared to be healthy 8 weeks post injection. [score:3]
Among the 8 miRNAs, 4 miRNA (miR-101, miR-29, miR-107 and miR-122) had available human miRNA array data. [score:1]
Macroscopically, livers from AKT/Ras/miR-122 injected mice were pale, but no tumor nodules were detected. [score:1]
Histologically, AKT/Ras/miR-122 livers showed the presence of clusters of lipid-rich preneoplastic hepatocytes occupying most of the liver parenchyma, whereas no frankly malignant lesions were identified (Supplementary Figure 5C and 5D). [score:1]
[1 to 20 of 10 sentences]
63
[+] score: 34
With the exception of gga-miR-122-5p, which was significantly downregulated, all miRNAs were strongly up-regulated in response to food deprivation. [score:7]
When miR-122-5p is downregulated the hepatic synthesis rate of fatty acids and cholesterol decrease [52], [53], which is in agreement with the finding that this miRNA is downregulated in response to feed deprivation in the liver (Figure 6). [score:7]
This apparent paradox may be explained by a higher constitutive expression in the R+ line of gga-miR-122-5p by other tissues, with subsequent release in plasma. [score:3]
Interestingly, a significant difference between R+ and R− lines (p = 0.03) was observed for gga-miR-122-5p in the feed deprived condition alone and not in the re-fed one (p = 0.82), with gga-miR-122-5p more expressed in the R− line. [score:3]
For example, the three members of the let-7 family (let-7a, let-7f, let-7k) are broadly expressed across tissues [36] and tissue enrichment has been found for miR-499-5p and −3p in heart [37], miR-122-5p in liver [38], miR-202-5p in testis [39] and gga-miR-107-3p in brain tissues [40] (Table 2). [score:3]
Furthermore, it has been reported that a choline- and folate -deficient diet causing nonalcoholic fatty liver disease (NAFLD) determined a different extent of modulation of some miRNAs, including miR-122, in both liver and plasma of divergent strains of mice [59]. [score:3]
This hypothesis is supported by the different plasmatic contents found in the R+ and R− lines of three highly conserved miRNAs with a key regulatory role in energetic metabolism (gga-miR-204, gga-miR-let-7f-5p and gga-miR-122-5p) (Table 2). [score:2]
Conversely, high significance values were found for all miRNAs (gga-miR-122-5p, gga-miR-2188-3p and gga-let-7f-5p) previously identified as differentially abundant between R+ and R- animals (Line). [score:1]
The miRNAs were selected among those found differentially abundant in the Condition comparison (gga-miR-204, gga-miR-2188-5p and gga-miR-365-3p), in the Line comparison (gga-miR-2188-3p, and gga-miR-122-5p) or in both (gga-let-7f-5p). [score:1]
Remarkably, gga-miR-122-5p was confirmed to be significantly more abundant in the R+ animals than in the R− ones despite the high variability observed in the two feeding conditions. [score:1]
Finally, an interesting example is provided by gga-miR-122-5p. [score:1]
However, in plasma, the level of gga-miR-122-5p decreases after feed deprivation only in the R− line. [score:1]
These miRNAs were found to be present in plasma at very different levels of abundance, from an average of 397 normalized counts (gga-miR-122-5p) to an average of 2.1 million normalized counts (gga-miR-2188-5p). [score:1]
[1 to 20 of 13 sentences]
64
[+] score: 34
Emerging evidence demonstrates that miRNAs are critical regulators of lipid synthesis and FAO [81] resulting in defective cell metabolism and carcinogenesis [82] directly targeting key enzymes or transcription factors as oncogenes and tumor suppressors [81] as shown in Table  1. Table 1 miRNAs involved in cancer metabolic plasticity MiRNAs Target Reference miR-122 Cholesterol biosynthesis 88– 90 miR-370 Fatty acid oxidation, CPT1A [91] miR-378/378* Lipid metabolism, CrAT 92, 93 miR-335 Lipid metabolism and adipogenesis [94] miR-205 Lipid metabolism [95] miR-143 Adipocyte differentiation [96] miR-27 Adipolysis [97] miR-33a/b Cholesterol efflux and β-oxidation 98– 100 miR-185 Lipogenesis and cholesterogenesis [101] miR-342 Lipogenesis and cholesterogenesis [101] miR-124 CPT1A [27] miR-129 CACT 27, 102 MiR-122 was the first miRNA identified as tissue-specific, and it is the most abundant in liver involved in lipid metabolic reprogramming [83]. [score:9]
Mir-33a/b and miR-122 target AMPK (activated by metabolic stress) and ACC1/2 respectively, whereas miR-205 targets the acyl-CoA synthetase, indirectly regulating the components of carnitine system. [score:7]
Particularly, the human hepatic cell line HepG2 transfection with miR-370 upregulates the expression of miR-122. [score:6]
Esau C miR-122 regulation of lipid metabolism revealed by in vivo antisense targetingCell Metab. [score:4]
Iliopoulos D Drosatos K Hiyama Y Goldberg IJ Zannis VI MicroRNA-370 controls the expression of microRNA-122 and Cpt1alpha and affects lipid metabolismJ. [score:3]
MiR-122 inhibition leads to decreased plasma cholesterol and triglyceride levels associated with altered lipids biosynthesis and increased FAO. [score:2]
Furthermore, miR-122 silencing in high-fat-fed mice reduced hepatic steatosis, with a decrease in cholesterol synthesis and stimulation of FAO [85]. [score:1]
Recently, Iliopoulos et al. identified a new miRNA, miR-370, that has effects on lipid metabolism similar to miR-122. [score:1]
Several genes involved in fatty a