sort by

384 publications mentioning hsa-mir-133a-1 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-133a-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 218
A comparison of TargetScan targets with this refined list identified 27 miR-133a-3p targets when considering both major isomiRS and 4 miR-133a-5p targets, with no targets in common. [score:11]
When all TargetScan-predicted targets were considered, there was substantial concordance across species with 514 (78%) of human miR-133a-3p targets and 259 (78%) of human miR-133a-5p targets shared by mouse. [score:8]
Only 26 (6%) of the total 402 TGGTCCC human miR-133a-3p isomiR targets overlapped with the predicted targets for the abundant human miR-133a-5p, and similarly, 30 (6%) of the total 502 TTGGTCC isomiR targets overlapped with those predicted for human miR-133-5p. [score:7]
When the TargetScan and RISC-seq data were compared, there were 168 miR-133a-3p targets when considering both major isomiRs, and 75 miR-133a-5p targets, only 6 of which were common. [score:6]
Predicted gene targets of murine miR-133a were matched against mRNAs that in which expression levels were altered by at least 1.5 fold in microarray data from miR-133a knockout mice [21]. [score:6]
We then cross-referenced all the predicted murine targets to a set of mRNAs identified by Liu and colleagues [21] that showed altered expression levels in miR-133a knockout mice. [score:6]
We hypothesized that increases in miR-133a-5p associated with the 79T > C MIR133A2 variant could result in selective down-regulation of a distinctive set of target mRNAs. [score:6]
To assess the potential impact of the 79T > C MIR133A2 variant, we searched for differences in miR-133a-3p and miR-133a-5p predicted mRNA targets using the respective human and murine seed regions and a set of genes known to be differentially regulated in miR-133a knockout mice [21]. [score:5]
Overall, only 44 (7%) of the total 657 human miR-133a-3p predicted targets from both abundant isomiRs overlapped with the targets predicted for miR-133a-5p (Figure 2C). [score:5]
Gene targets for human and murine miR133a were predicted using TargetScan Custom (v5.2) [33] with the “seeds” (nt 2–8) of the most abundant miR-133a-3p and miR-133a-5p isomiRs that were identified via deep sequencing used as inputs. [score:5]
To compare murine miR-133a-3p and miR-133a-5p targets, we used the two predominant 3p and single predominant 5p murine isomiR seed regions to search for predicted mRNA binding sites in TargetScan. [score:5]
In the Ingenuity Knowledge Base, the TargetScan-predicted human miR-133a-3p and 5p target mRNAs are associated with a range of cardiac and extra-cardiac biological functions (Figure 3). [score:5]
Significant associations were found in the Ingenuity Knowledge Base between predicted human target mRNAs of miR-133a-3p and miR-133a-5p and a range of cardiac and extra-cardiac biological functions and/or disease states. [score:5]
This produced a list of 61 predicted targets for miR-133a-3p and 35 predicted targets for miR-133a-5p, only 4 of which were in common (Figure 2D). [score:5]
On Northern blotting the 79T allele showed strong expression of miR-133a-3p with weak expression of miR-133a-5p. [score:5]
Similar to the human data, only a minority of murine miR-133a-3p targets (31 [5%]) overlapped with 5p targets (Figure 2D). [score:5]
Matkovich and colleagues reduced their list of 1640 targets to 209 by analyzing transgenic mice that overexpress miR-133a [16]. [score:5]
With the 79T > C MIR133A2 variant, no changes in miR-133a-3p target gene expression would be expected. [score:5]
It is notable that at least 25% of the lowest-abundance miR-133a-5p targets include mRNAs involved in regulation of transcription, signaling and membrane transport. [score:4]
Verified mRNA targets of miR-1 and miR-133 include those encoding proteins that are involved in cardiac development, ion channel function, hypertrophy, and fibrosis [11- 16]. [score:4]
We also compared our TargetScan outputs to a list of 1640 miR-133a targets identified by Matkovich and colleagues in mouse heart using RISC-seq [16]. [score:4]
To explore what these cardiac genes might be, we used the seed sequences of the two most abundant human miR-133a-3p isomiRs and the single abundant miR-133a-5p isomiR identified by deep sequencing to look for predicted human mRNA binding sites in TargetScan. [score:3]
Bioinformatics analyses indicate that the major miR-133a-3p and 5p isomiRs have numerous predicted target mRNAs, only a few of which are in common. [score:3]
To test these predictions, we prepared two constructs that replicated the 79T and 79C genotypes of mature miR-133a, transfected these into the HeLa cell line that does not detectably express endogenous miR-133a and performed Northern blotting. [score:3]
In contrast, the relative increase in miR-133a-5p could have a relatively greater impact and give rise to selective repression of the 5p suite of targets. [score:3]
In human and murine atrial tissues, miR-133 was the most highly expressed miRNA, comprising approximately 20% of all miRNA sequences. [score:3]
Click here for file TargetScan outputs for human miR-133a-3p and miR-133a-5p (from Figure 2C) that were used as inputs for Ingenuity Pathway Analysis. [score:3]
org, MirTarget2, PicTar, PITA, RNA22, RNAhybrid) were unable to be utilized because human and/or murine miR-133a-5p sequences were unable to be inputted and/or analyzed. [score:3]
The TargetScan outputs for human miR-133a-3p and miR-133a-5p were imported into Ingenuity Pathway Analysis software (Ingenuity® Systems, http://www. [score:3]
Figure 3 Functional analysis of human miR-133a-3p and miR-133a-5p targets. [score:3]
These results showed that only a minority of predicted miR-133a targets were shared, and that most were unique to either 3p or 5p forms. [score:3]
These findings collectively suggest that miR-133a isomiRs have distinctive target spectra. [score:3]
Multiple miR-133a isomiRs with potential different mRNA target profiles are present in the atrium in humans and mice. [score:3]
The 79T allele had strong expression of miR-133a-3p with low amounts of miR-133a-5p. [score:3]
Altered expression of miR-133 itself has been observed in cardiac tissues from patients with AF [18, 19], and conditions that predispose to AF, such as atrial dilation, ventricular hypertrophy, and myocardial ischemia [12, 31]. [score:3]
For example, our group has recently demonstrated that the two most abundant miR-133a isomiRs in murine atrial HL-1 cells have different targeting properties [8]. [score:3]
For the two abundant human miR-133a-3p isomiRs, the seed sequences TGGTCCC and TTGGTCC had 402 and 502 predicted targets, respectively, of which 247 were in common. [score:3]
The 79T > C MIR133A2 variant is positioned directly adjacent to the Drosha cleavage site in the stem-loop structure at the 3 [′] end of miR-133a-3p (Figure 1C). [score:2]
Further studies are required to determine whether changes in miR-133a-5p directly alter levels of these critical molecules and have biologically-significant functional effects. [score:2]
Consequently, the 79T > C variant lies within the duplex and would directly prevent base-pairing and weaken thermostability at this site, favoring incorporation of miR-133a-5p into RISC. [score:2]
MiR-133a mRNA target profiles. [score:2]
The 79T > C variant (red) is located at the 3′end of miR-133a-3p directly adjacent to the Drosha cleavage site. [score:2]
Our data suggest that the MIR133A2 variant increases the relative abundance of miR-133a-5p. [score:1]
A number of isomiRs with variations at 5 [′] and 3 [′] ends were identified for both miR-133a-3p and miR-133a-5p, with 2 predominant miR-133a-3p isomiRs and one predominant miR-133a-5p isomiR. [score:1]
There were two predominant isomiRs processed from the miR-133a 3p arm in both the human and murine atria (Figures 2A and 2B). [score:1]
Second, we report a novel MIR133A2 variant that alters strand abundance during miRNA processing and results in accumulation of miR-133a-5p. [score:1]
Altered levels of miR-1 and miR-133 have been observed in atrial tissue samples from patients with AF in several studies [17- 19]. [score:1]
In the normal human atrium, almost all the miR-133a is comprised of miR-133a-3p with negligible amounts of miR-133a-5p. [score:1]
To determine the diversity and abundance of miR-133a-3p and 5p processed species that are normally present in the atrium, small RNA libraries were prepared from human and murine heart tissue samples and were subjected to deep sequencing. [score:1]
Together, the abundance of these tags represented >99% of all tags derived from the miR-133a hairpin. [score:1]
This variant lies within the duplex at the 3 [′] end of the mature strand, miR-133a-3p, and is predicted to prevent base-pairing and weaken thermostability at this site, favoring incorporation of the passenger strand, miR-133a-5p, into RISC. [score:1]
of small RNA libraries prepared from normal human and murine atria confirmed that nearly all the mature miR-133a was comprised of miR-133a-3p and that levels of miR-133a-5p were very low. [score:1]
DNA oligonucleotide probes (5 [′]- tacagctggttgaaggggaccaaa -3 [′], 5 [′]- gatttggttccattttaccagct -3 [′], 5 [′]- tgtgctgccgaagcaagcac -3 [′]) complementary to mature miR-133a (miR-133a-3p), passenger miR-133a (miR-133a-5p) and U6 sequences, respectively, were end-labeled with [32]P using T4 Polynucleotide Kinase (New England Biolabs, Ipswich, MA, USA) and purified by Microspin G-25 columns (GE Healthcare) according to manufacturer’s instructions. [score:1]
We identified a human 79T > C MIR133A2 variant that alters miRNA processing and results in accumulation of the miR-133a-5p strand that is usually degraded. [score:1]
In contrast, the 79C allele had no effect on miR-133a-3p but there was a significant increase (mean 3.6-fold) in miR-133a-5p levels. [score:1]
In the absence of sequence data for human miR-133a-5p in miRBase, this location was initially deduced from 3p dominant processed sequence listed for mouse. [score:1]
MirBase-annotated miR-133a-3p and 5p sequences are shown in black with ‘seed’ regions (nt 2–8) underlined. [score:1]
Here we find that both (mature) miR-133a-3p and (passenger) miR-133a-5p are present in the atrium in humans and mice, with miR-133a-5p normally representing <1% of all miR-133a species. [score:1]
If the conventional murine miR-133a-5p sequence as annotated by miRBase (v18) represented the predominant isomiR in the normal human heart, then the nt corresponding to position 79 would lie just outside the base-paired region of the processed miRNA duplex. [score:1]
Less than 1% of all sequences that mapped to the miR-133a hairpin aligned to the 5p arm. [score:1]
of human and murine atrial tissue was performed and revealed an unexpected diversity of miR-133a isomiRs, with nearly all the miR-133a tags comprised of the 2 major miR-133a-3p isomiRs and <1% comprised of miR-133a-5p species. [score:1]
To assess the potential effects of this variant, we first needed to catalogue the abundance and diversity of miR-133a isomiRs in the normal heart. [score:1]
The sequences for the miR-133a high-abundance isomiRs were identical in the two species. [score:1]
We re-sequenced the MIR1-1, MIR1-2, MIR133A1, MIR133A2, and MIR133B genes, that encode the cardiac-enriched miRNAs, miR-1 and miR-133, in 120 individuals with familial atrial fibrillation and identified 10 variants, including a novel 79T > C MIR133A2 substitution. [score:1]
MiR-1 and miR-133 sequence variants. [score:1]
The main effect of the 79T > C MIR133A2 variant is to alter the relative ratio of miR-133a-3p and 5p strands. [score:1]
The muscle-enriched miRNAs, miR-1 and miR-133, are amongst the most abundant of the miRNAs present in the normal heart [9, 10]. [score:1]
Analysis of sequencing tags that map to a miR-133a locus showed an extensive range of 5 [′] and 3 [′] isomiRs for miR-133a-3p and miR-133a-5p in both human and mouse (Additional file 3: Table S3 and Additional file 4: Table S4). [score:1]
Although multiple 5 [′] and 3 [′] isomiRs are present, there are only 2 major miR-133a-3p isomiRs and one major miR-133a-5p isomiR. [score:1]
Two genes, MIR1-1 and MIR1-2, encode miR-1-1 and miR-1-2, while three genes, MIR133A1, MIR133A2, and MIR133B, encode miR-133a-1, miR-133a-2, and miR-133b, respectively. [score:1]
Click here for file Sequences and abundance of different 5 [′] and 3 [′] murine miR-133a isomiRs identified by sequencing of murine atria. [score:1]
Click here for file Sequences and abundance of different 5 [′] and 3 [′] human miR-133a isomiRs identified by sequencing of human atria. [score:1]
There was a single predominant miR-133a-5p isomiR in human atrium, which started one nt upstream from the murine miRBase entry. [score:1]
In this study, we hypothesized that genetic variation could alter the functional effects of miR-1 and miR-133 and contribute to AF pathogenesis. [score:1]
We have identified a missense MIR133A2 variant that alters miR-133a duplex processing and strand abundance with accumulation of miR-133a-5p in HeLa cells. [score:1]
There was also only one major murine miR-133a-5p isomiR that had an identical 5 [′] sequence to the major human miR-133a-5p isomiR. [score:1]
79T > C MIR133A2 variant increases levels of miR-133a-5p. [score:1]
MiR-133a-1 and miR-133a-2 have identical mature sequences, with miR-133b differing only by a single nt at the 3 [′] end. [score:1]
The 5 loci encoding miR-1 and miR-133 precursor transcripts were re-sequenced in 120 probands with a family history of AF. [score:1]
However, our deep sequencing data clearly show that the −1 isomiR is the most abundant miR-133a-5p species in the human atrium. [score:1]
Figure 2 Abundance of miR-133a 5 [′ ] isomiRs in atrial tissue. [score:1]
Note that there is no miRBase annotation for human miR-133a-5p. [score:1]
Despite the importance of miR-133a in atrial biology, miR-133a genetic variants are not a common cause of familial AF. [score:1]
Parameters that achieved statistical significance (P < 0.05) are shown for miR-133a-3p (left) and miR-133a-5p (right), with the relative proportions determined on the basis of the negative logarithm of the P values. [score:1]
The scaled miR-133a values were then normalized to the scaled U6 values to adjust for any loading bias. [score:1]
[1 to 20 of 85 sentences]
2
[+] score: 212
Wu ZS Wang CQ Xiang R Liu X Ye S Yang XQ Loss of miR-133a expression associated with poor survival of breast cancer and restoration of miR-133a expression inhibited breast cancer cell growth and invasionBMC Cancer. [score:7]
Relatively lower level of miR-133a expression was also perceived in cases of high EGFR protein expression (2.2843 ± 1.3288) while higher level was detected in those with low EGFR protein expression (1.0006 ± 1.2706, P = 0.001, Figure  3B). [score:7]
Furthermore, the expression of miR-133a suggested the deterioration of the disease to certain degree in spite of inferior statistical significance (P = 0.083), since the miR-133a expression in advanced stages (III and IV, 1.8304 ± 1.3063) was lower than that in early stages (I and II, 2.2480 ± 1.3434). [score:7]
MiR-133a serves as a tumor-suppressive miRNA in human NSCLC, and its downregulation suggests deterioration in NSCLC patients. [score:6]
What makes our current study potent and novel is that we examined the miR-133a expression in relatively larger sample sizes, 125 cases of NSCLC tissues, and their paired non-cancerous lung tissues, which minimized individual difference, and ran a full-panel analysis between the expression levels of miR-133a and clinicopathological parameters in NSCLC. [score:5]
The expression of miR-133a was reported to be downregulated in various malignancies when cancerous tissue was compared with normal adjacent tissue, including bladder cancer, head and neck squamous cell carcinoma, and colorectal cancer [19- 21]. [score:5]
Meanwhile, Spearman correlation test was employed for further analysis, which revealed the consistent relationship between miR-133a expression and the following clinicopathological parameters: lymphatic metastasis (r = −0.182, P = 0.042), tumor size (r = −0.253, P = 0.04), and EGFR protein expression (r = −0.612, P < 0.001). [score:5]
Putative miR-133a binding sites of EGFR have also been identified by computational algorithms from several online miRNA-target gene prediction softwares, including Targetscan (www. [score:5]
Therefore, in this study, we targeted the correlation between miR-133a expression and clinicopathological significance in NSCLC patients. [score:5]
The high miR-133a expression group showed a survival time of 20.012 ± 3.132 months in contrast to 17.296 ± 3.424 months in low miR-133a expression group. [score:5]
In consideration of literatures and the current study [25, 32], it strongly suggests the potential tumor-suppressive role of miR-133a and the possibility to be regarded as a promising diagnostic biomarker as well as a target of treatment in NSCLC. [score:5]
Moriya et al. [32] stated that miR-133a regulates ARPC5 and GSTP1 to perform a tumor-suppressive function. [score:4]
They were obviously correlated negatively, which strongly backed the perspective of Wang et al. [25], who assumed that several oncogenic receptors in NSCLC cells might be direct targets of miR-133a, including EGFR. [score:4]
To begin with, miR-133a was significantly downregulated in NSCLC tissues with larger tumor diameter (P = 0.017), which unveiled that miR-133a might correlate with the growth of tumor in NSCLC positively. [score:4]
The downregulation of miR-133a indicates deterioration in NSCLC patients. [score:4]
Nevertheless, other clinicopathological features which proved to be independent of miR-133a expression were as follows: age, gender, differentiation grades, pathological types, smoke, vascular infiltration, metastasis, EGFR amplification, or EGFR mutation status. [score:4]
MiR-133a expression was negatively correlated to lymphatic metastasis (r = −0.182, P = 0.042), tumor size (r = −0.253, P = 0.04), clinical TNM stages (r = −0.154, P = 0.087), and EGFR protein expression (r = −0.612, P < 0.001). [score:4]
Also, the aberrant expression of miR-133a emerged among breast cancer, renal cell carcinoma, and prostate cancer [22- 24]. [score:3]
Nevertheless, to date, there are very few studies attempting to expound the relationship between the expression of miR-133a and the clinicopathological parameters in NSCLC, except the research by Wang et al. [25], in which only Kaplan-Meier survival rate was taken into account. [score:3]
It was actually supported by the study of Wang et al. [25], in which they claimed that miR-133a can inhibit cell invasiveness. [score:3]
We used the formula 2 [−Δcq] when determining the expression of miR-133a while Wang et al. did not specify the calculating method of gene expression in their article [25]. [score:3]
According the their report, the underexpression of miR-133a was significantly associated with poor overall survival with a P value of 0.0409, which later inferred that miR-133a could be a prognostic indicator when combined with the results of multivariable Cox regression analyses. [score:3]
Meanwhile, the relationship between miR-133a expression and several clinicopathological parameters and patient survival was analyzed. [score:3]
We also adopted one-way analysis of variance (ANOVA) test to identify the relationship between the expression level of miR-133a and pathological grading and histological classification. [score:3]
Figure 3Correlations between the expression of miR-133a and some clinicopathological parameters in lung cancer. [score:3]
Figure 1The expression of miR-133a in lung cancer and non-cancerous lung tissues. [score:3]
Moriya et al. [32] and Wang et al. [25] also reported the suppressive role of miR-133a in NSCLC. [score:3]
In the perspective of clinical significance, Wang et al. [25] concluded that miR-133a expression levels indicate the clinical outcome in NSCLC and could serve as a suitable prognostic factor merely based on the multivariable Cox regression analysis. [score:3]
We found the role of miR-133a as a tumor suppressor in NSCLC. [score:3]
We applied reverse transcription (RT) and qPCR kits based on precedents in order to examine the expression of miR-133a as reported previously [30]. [score:3]
The current research along with other related studies firmly suggest that miR-133a serves as a tumor-suppressive miRNA, which plays a crucial part in the oncogenesis and progression of human NSCLC. [score:3]
The expression of miR-133a was determined with the formula 2 [−Δcq] [31]. [score:3]
No statistical significance of survival emerged in patients with low or high miR-133a expression (P = 0.325). [score:3]
It would be hard for us to neglect the distinct correlation between the miR-133a level and the expression of EGFR protein (r = −0.612, P < 0.001) as assessed by Spearman’s correlation. [score:3]
Among the 57 patients followed up, 27 had relatively low miR-133a level (lower than the median level of 1.60) while 30 possessed relatively high level of miR-133a expression. [score:3]
It remains a long way to go when it comes to the molecular mechanism of miR-133a and its target genes in NSCLC. [score:3]
qRT-PCR was employed to detect the expression of miR-133a in lung cancer tissue and adjacent non-cancerous lung tissue. [score:3]
It is worth mentioning that there existed a distinct difference of 2.716 months in the survival between the two groups even though no statistical significance of miR-133a expression was shown in survival of NSCLC (P = 0.325, Figure  5). [score:3]
Figure 5Kaplan-Meier curve for survival in miR-133a expression. [score:3]
The area under curve (AUC) of low expression of miR-133a to diagnose NSCLC was 0.760 (95% CI: 0.702 ~ 0.819, P < 0.001). [score:3]
Sequences of targeted miRNAs and reference miRNAs used were as follows: miR-133a (Applied Biosystems Cat. [score:3]
However, although statistically significant, the correlation between tumor size and miR-133a expression was quite weak. [score:3]
However, in our study, there emerged no statistical significance of miR-133a expression in the survival of NSCLC. [score:3]
As for the association between miR-133a level and EGFR status, we first detected EGFR expression by IHC. [score:3]
Correlations between the miR-133a expression and clinicopathological parameters in NSCLC. [score:3]
The molecular mechanisms between miR-133a and the tumorigenesis of NSCLC may be concerned with other targets. [score:3]
Then, we came to the relationship between the miR-133a expression and lymphatic metastasis. [score:3]
The relative expression level of miR-133a was significantly lower than that in the non-cancerous lung tissues. [score:3]
A larger cohort is needed to further determine the relationships between miR-133a expression and tumor size as well as lymphatic metastasis. [score:3]
Decreased expression of miR-133a in NSCLC. [score:3]
MiR-133a NSCLC Downregulate Clinical significance Lung cancer is the major cause of cancer mortality worldwide with an approximation of 80% non-small cell lung cancer (NSCLC) [1- 3]. [score:3]
The relative level of miR-133a expression in patients with tumor greater than 3 cm (1.7385 ± 1.3581) was significantly lower when compared to that in those with tumor less than or equal to 3 cm (2.3058 ± 1.2512, P = 0.017, Figure  3A). [score:2]
There were only two publications concerning the role of miR-133a in NSCLC, which concentrated more on its regulating mechanism than the clinical significance [25, 32]. [score:2]
The expression of miR-133a in advanced stages (III and IV, 1.8304 ± 1.3063) was relatively decreased when compared with that in early stages (I and II, 2.2480 ± 1.3434, P = 0.083). [score:2]
Figure 2ROC curve of miR-133a for lung cancer. [score:1]
Thus, it is rational that a trend of resorting to miR-133a as a therapeutic strategy has become increasingly popular. [score:1]
The area under curve (AUC) of miR-133a was 0.760 (95% CI: 0.702 ~ 0.819, P < 0.001, Figure  2), and the optimal cut-off value was 1.690. [score:1]
The relative level of miR-133a in NSCLC tissues was 2.0108 ± 1.3334, which was significantly lower than that in the adjacent non-cancerous lung tissues (3.6430 ± 2.2625, P = 0.019, Figure  1 and Table  1). [score:1]
Our team intends to undergo further in vitro and in vivo studies to illuminate the role and mechanism of miR-133a in the malignant phenotype of NSCLC cell lines. [score:1]
The above results of the study reveal a remarkable significance between miR-133a and tumor growth, metastasis, and progression of NSCLC. [score:1]
Moreover, the ROC analysis results demonstrated that miR-133a had a moderate diagnostic value for NSCLC with the AUC of 0.760. [score:1]
To our knowledge, this study was the first one to illuminate the relationship between miR-133a and clinicopathological parameters in NSCLC. [score:1]
Furthermore, a decreasing trend of miR-133a could be found in the clinical TNM stages. [score:1]
The relative level of miR-133a was 2.0108 ± 1.3334 in NSCLC tissues, significantly lower than that of the adjacent non-cancerous lung tissues (3.6430 ± 2.2625, P = 0.019). [score:1]
The expression of miR-133a in 125 cases of NSCLC and their paired adjacent non-cancerous tissues was evaluated by quantitative reverse transcription polymerase chain reaction (qRT-PCR). [score:1]
Figure 4ROC curves of miR-133a for clinicopathological factors of lung cancer. [score:1]
The area under curve (AUC) of miR-133a was 0.760 (95% CI: 0.702 ~ 0.819, P < 0.001). [score:1]
Our main focus in the current study lied in the correlation between miR-133a and clinicopathological parameters in NSCLC. [score:1]
Unfortunately, the impact was suboptimal [28], thus making us curious about the potential of miR-133a as therapeutic strategy. [score:1]
Despite present studies which suggested miR-133a as a promising biomarker for several cancers, there still exist no articles concerning the validated clinical significance of miR-133a in non-small cell lung cancer (NSCLC). [score:1]
This combination was adopted in the current study for the evaluation of miR-133a expression. [score:1]
A higher level of miR-133a, 2.2662 ± 1.3316, was shown in patients with lymphatic metastasis while a lower level, 1.8035 ± 1.3079, was observed in those without lymphatic metastasis. [score:1]
[1 to 20 of 72 sentences]
3
[+] score: 145
miR-133a/b was upregulated in response to 5α-DHT treatment and mirR-206 expression was downregulated in response to to testosterone treatment ([*] P < 0.05) (A). [score:9]
miR-1, miR-133a and miR-133b expression is upregulated with aging in men. [score:6]
An ordinary Two-Way ANOVA revealed an overall effect of both gender and age on miR-133a and miR-133b expression (B,C) ([**] P < 0.01) and a significant interaction for miR-1 expression ([**] P < 0.01). [score:5]
An overall effect of LHRH-agonist treatment was observed for miR-133a and miR-133b expression (P < 0.05), but not in miR-1 or miR-206 expression (P > 0.05). [score:5]
An ordinary Two-Way ANOVA revealed a markedly effect of both gender and age on miR-133a and miR-133b expression (P < 0.01), where both factors are associated with an overall higher expression of both mature miRNA transcripts. [score:5]
miR-133a and miR-133b are down-regulated in castrated mice. [score:4]
In contrast to our results from the current study, their microarray data pointed toward a downregulation of miR-133a/b in elderly men. [score:4]
5α-dihydrotestosterone regulates miR-133a, miR-133b, and miR-206 expression in human primary myocytes. [score:4]
Importantly, we also show that physical activity overrides the regulatory effect of testosterone on miR-133a/b expression. [score:4]
Interestingly, one validated target of miR-133a/b is the insulin-like growth factor-1 receptor (IGF-1R) in skeletal muscle (Huang et al., 2011), making miR-133a/b a likely regulator of growth factor signaling through the AKT signaling pathway (Schiaffino and Mammucari, 2011). [score:4]
When using Bonferroni multiple comparison post-hoc test it was demonstrated that miR-1 (A), miR-133a (B), and miR-133b (C) expression levels were higher in elderly compared to younger men ([*] P = 0.02, [*] P = 0.03, [***] P = 0.008, respectively) There was no effect of age or gender on mir-206 expression (D) (P > 0.05). [score:4]
Our collective data from three independent mo dels, indicate that testosterone up-regulates miR-133a, and 133b. [score:4]
Androgenic control of miR-133a/b expression therefore seems to be a separate regulatory mechanism that may play a role during certain physiological conditions, such as physical inactivity. [score:4]
Thus, it is possible that the regulation of mir-133a/b expression by testosterone occurs through a post-transcriptional processing of the pri- and/or pre-miRNA transcripts. [score:4]
miR-133a and miR-133b are down-regulated in testosterone blocked participants. [score:4]
Therefore, it is likely that the decline in physical activity is the main determining factor involved in the age -dependent up-regulation of miR-1 and miR-133a/b. [score:4]
Surprisingly, a bonferroni multiple comparison test revealed reduced miR-133a/b expression (miR-133a, P = 0.02. miR-133b, P = 0.03. ) [score:3]
Consistent with our findings in the LHRH-agonist treated men with low circulating testosterone, castrated mice had a lower expression of mir-133a (P < 0.05) and mir-133b (P < 0.001) (Figure 4A). [score:3]
An unpaired t-test demonstrated a significant lower expression of mir-133a ([*] P < 0.05) and mir-133b ([***] P < 0.001) in the skeletal muscle of castrated mice. [score:3]
The observed effects of testosterone and age as inducers of miR-133a and miR-133b expression are seemingly in opposition. [score:3]
Bonferroni multiple comparison post-hoc tests revealed a significant lower expression of mir-133a (B) ([*] P = 0.02) and mir-133b (C) ([*] P = 0.03), but not mir-1 (A) or miR-206 (D) in testosterone blocked patients at rest before training. [score:3]
In addition, miR-133a (F) and miR-133b (G) expression were negatively correlated with testosterone levels in men (n = 18) (P < 0.05, R [2] = 0.33 and P < 0.05, R [2] = 0.26). [score:3]
Drummond found that 18 miRNAs, including miR-133a and miR-133b, were differentially expressed. [score:3]
Specific requirements of MRFs for the expression of muscle specific microRNAs, miR-1, miR-206 and miR-133. [score:3]
Furthermore, circulating testosterone levels in men was negatively correlated with miR-133a and miR 133b expression (Figures 2F,G) (P < 0.05, r [2] = 0.33 and P < 0.05, r [2] = 0.26). [score:3]
Gender and age affects miR-133a and miR-133b expression. [score:3]
Regardless of pre-exercise intervention level, training equalized the expression of miR-133a and miR-133b between healthy and LHR -treated participants to a lower level. [score:3]
MicroRNA-1 and microRNA-133a expression are decreased during skeletal muscle hypertrophy. [score:3]
Our findings suggest that an age -dependent decline in testosterone and increase of miR-133a/b expression are independent events. [score:3]
Partly in line with our previous results (Nielsen et al., 2010), a Two-Way ANOVA (RM) demonstrated a main effect of training in terms of decreased expression in all four myomiRs (miR-1, P < 0.0001. miR-133a, P < 0.01. miR-133b, P < 0.0001, miR-206 P < 0.05). [score:3]
In the current study, we found that the expression of miR-1, miR-133a, and miR-133b was higher in the skeletal muscle of elderly compared to younger men and that miR-133a/b was higher expressed in women compared to men. [score:3]
miR-1, miR-133a, miR-133b, and miR-206 belong to a group of muscle specific miRNAs (myomiRs) crucial for the regulation of skeletal muscle development and function (Chen et al., 2006; van Rooij et al., 2008). [score:3]
However, our subsequent studies demonstrated that testosterone positively regulated miR-133a/b. [score:2]
We thus show a physiological role of testosterone in the regulation of miR-133a and miR-133b in human and murine skeletal muscle. [score:2]
Insulin-like growth factor-1 receptor is regulated by microRNA-133 during skeletal myogenesis. [score:2]
Interestingly, the women had a markedly increase in miR-133a and miR-133b expression compared to men. [score:2]
Thus, we conducted subsequent experiments addressing the potential role that circulating testosterone and/or aerobic fitness might play in regulating skeletal muscle miR-133a/b in men. [score:2]
We found an increased expression of miR-1 (P = 0.02), miR-133a (P = 0.03) and miR-133b (P = 0.008) in elderly men compared to younger men (Figures 1A–C). [score:2]
Consistent with the in vivo experiments suggesting a role for testosterone in regulating miR-133a/b, 5α-DHT incubation in culture increased miR-133a and miR-133b (P < 0.05) (Figure 5A). [score:2]
miR-133a/b was inversely correlated with an age -dependent decrease of testosterone in men. [score:1]
ARE motifs near the miR-1/miR-133a loci, have not yet been identified. [score:1]
miR-1, miR-133a, and miR-133b (A–C) were inversely correlated with maximal oxygen uptake in women and men (n = 36) (P < 0.05, 0.01 and 0.001, R [2] = 0.11, 0.24, and 0.33). [score:1]
A Two-Way ANOVA (RM) (miR-1, [****] P < 0.0001. miR-133a, [**] P < 0.01. miR-133b, [***] P < 0.001, miR-206 [*] P < 0.05). [score:1]
To address a potential involvement of miR-1, miR-133a, and miR-133b in the age-related decline in muscle function for both genders, we used a bonferroni multiple comparison post-hoc test. [score:1]
Furthermore, it has been shown that miR-133a and miR-206 are lower in skeletal muscle of people with type 2 diabetes (Gallagher et al., 2010). [score:1]
In line with our previous findings (Nielsen et al., 2010) aerobic fitness in all subjects was negatively correlated with miR-1 and miR-133a and miR-133b (Figures 2A–C) (P < 0.05, 0.01 and 0.001, r [2] = 0.11, 0.24, and 0.33, respectively). [score:1]
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
However, in addition to miR-133a/b, miR-1 was induced in the elderly group. [score:1]
[1 to 20 of 48 sentences]
4
[+] score: 134
Of extreme relevance, WB analysis showed that the combination of miRNA499 plus miRNA133 upregulated the protein expression of both Cx43 and cTnT (Fig. 6B). [score:6]
Gene and protein expression analysis showed that miRNA499 and miRNA133 are able to induce the differentiation of AMSC into cells expressing typical cardiac markers such as Nkx2.5, GATA4, cTnT, Cx43, Ryr2, and Cav1.2. [score:5]
At the 14 days time point, WB showed that miRNA1 alone had no effect on both Cx43 and cTnT, miRNA133 increased only the expression of cTnT, while miRNA499 was able to markedly increase the expression of both Cx43 and cTnT (Fig. 3A). [score:5]
The coexpression of miRNA499 and miRNA133 further increased the expression of the atrial marker Mlc. [score:5]
Expression of cardiac cytoskeletal protein (α-sarcomeric actinin) and of other important proteins involved in cardiac excitation/contraction (EC)-coupling (Cav1.2, SERCA2a, and RyR2) was analyzed by ICC on EB coexpressing miRNA499 and miRNA133, selected from the same batch of EB showing caffeine-responsiveness. [score:5]
ICC further confirmed that miRNA499 and miRNA133 coexpression was able to induce the expression of cardiac-specific proteins like cTnT, Cx43, Serca2a, and Cav1.2 (Fig. 6C) even in the absence of DMSO. [score:5]
When miRNA499 and miRNA133 were coexpressed, we documented a significant increase in both GATA4 and Nkx2.5 expression compared with all other conditions tested (Fig. 2A, 2B). [score:4]
However, the coexpression of miRNA499 and miRNA133 resulted in a significantly higher expression of both cardiac markers compared with the other conditions tested (Fig. 7A). [score:4]
Recently, it has been suggested that certain miRNA are powerful regulators of cardiac differentiation processes [32], and it has been shown that miRNA1, miRNA133, and miRNA499 are highly expressed in muscle cells [32]. [score:4]
Most importantly, by simultaneously over -expressing miRNA499 and miRNA133 the number of P19 cells expressing cTnI was 30-fold greater compared with the standard differentiation protocol. [score:4]
Real-time PCR analysis showed that also in P19 cells not exposed to DMSO, treatment with miRNA499 and miRNA133 upregulated GATA4 (+4.9-fold, p < . [score:4]
However, when we coexpressed miRNA499 together with miRNA133 the results were significantly and strikingly superior compared with the over -expression of miRNA499 alone. [score:4]
The Combination of miRNA499 and miRNA133 Increases the Expression of Cardiac-Specific Genes. [score:3]
ICC experiments confirmed that Cx43 and cTnT were convincingly turned on upon over -expression of miRNA449 alone and even more so in combination with miRNA133 (Fig. 3B). [score:3]
In particular, untreated EB showed responses compatible with Ca [2+] -dependent electrical activity, typical of immature CMC, while Na [+] -dependent excitability was recorded in EB over -expressing miRNA499 and miRNA133. [score:3]
CMC derived from P19 cells over -expressing miRNA499 and miRNA133 develop EC-coupling properties typical of mature CMC. [score:3]
miRNA133 increased the expression of Nkx2.5 (+1.3-fold vs. [score:3]
Coexpression of miRNA499 and miRNA133 sharply increased the proportion of caffeine-responsive cells. [score:3]
Importantly for translational purposes, we have also shown that the same combination miRNA499 and miRNA133 is a powerful inducer of cardiac differentiation for human MSC. [score:3]
WB (Fig. 7B) and ICC (Fig. 7C,D) analysis confirmed that AMSC treated with miRNA499 and miRNA133 differentiated in cells expressing Cx43 and cTnT (Fig. 7B, 7C) but also Cav1.2 and Ryr2 (Fig. 7D). [score:3]
Coexpression of miRNA499 and miRNA133 induced a 3.5-fold increase in the number of responsive cells with respect to cells exposed to DMSO (p < . [score:3]
WB and ICC analysis confirmed that cardiac proteins are indeed expressed at higher levels when P19 cells are cotransfected with miRNA499 plus miRNA133. [score:3]
Cardiac-Specific Proteins Are Highly Expressed in P19 Cells Treated with miRNA499 and miRNA133. [score:3]
As already observed in P19 cells, the combination of miRNA499 with miRNA133 triggered the over -expression of both the nuclear transcription factor GATA4 (+13-fold, p < . [score:3]
In addition, the expression of genes encoding for cardiac-specific transcription factors, such as GATA4 and Nkx2.5, and cardiac-specific proteins, such as Cx43 and cTnT, was enhanced in cells treated with miRNA499 plus miRNA133. [score:3]
It is currently unknown whether the concomitant over -expression of miRNA1, miRNA133, and miRNA499 or if the combination of two of these miRNA would result in a synergistic action, further increasing the efficiency of cardiac differentiation. [score:3]
After 14 days, Cx43 was significantly over-expressed in cells treated with miRNA133 or miRNA499 and cTnT was significantly higher in the miRNA499 group compared with naïve cells (Fig. 7A). [score:2]
At day 14, the over -expression of miRNA1 or miRNA133 alone or their combination did not increase the number of beating clusters compared with DMSO treatment (Fig. 1A). [score:2]
It has been shown that miRNA1 and miRNA133 are important regulators of embryonic stem cell (ESC) differentiation into CMC. [score:2]
naïve, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1; †, p < . [score:1]
To strengthen our observation, we aimed to test whether treatment with miRNA499 plus miRNA133 in the absence of DMSO exposure was sufficient to trigger cardiac differentiation. [score:1]
The treatment of EB with both pre-miRNA499 and pre-miRNA133 resulted in the strongest activation of the cTnI promoter (Fig. 1B). [score:1]
001), 4.1-fold versus miRNA133 alone (p < . [score:1]
Figure 7Amniotic mesenchymal stromal cells (AMSC) differentiation using miRNA499 and miRNA133 precursors. [score:1]
Figure 5MEA and twitch recordings of embryoid bodies treated with pre-miRNA499 together with pre-miRNA133. [score:1]
001), and miRNA133 (+2.7-fold; p < . [score:1]
It was impossible to document the same results using different combination of miRNAs, confirming that only the couple miRNA499/miRNA133 triggers the differentiation of MSC toward a cardiac-like phenotype. [score:1]
naïve, scramble miRNA, miRNA133, miRNA1 + 499 and p < . [score:1]
DMSO, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1, and p < . [score:1]
These data strongly suggest a synergistic effect of miRNA499 and miRNA133. [score:1]
In particular, miRNA133 seems more crucial in controlling cell proliferation by repressing serum response factor and cyclin D2 [17, 24]. [score:1]
In summary, we demonstrated that miRNA499 and miRNA133 act in a synergic manner inducing P19 differentiation into CMC even in the absence of DMSO. [score:1]
Therefore, the effect of miRNA499 and miRNA133 synergism on cardiogenic differentiation was further tested based on the notion that mature excitation-contraction coupling relies on the presence of Ryrs-operated intracellular Ca [2+] stores. [score:1]
Finally, functional analysis showed that the percentage of responsive EB grown without DMSO but transfected with pre-miRNA499 and pre-miRNA133 did not significantly differ from the percentage of EB grown in the presence of 0.5% DMSO (Fig. 6D). [score:1]
After 14 days, quantification of late cardiac-specific genes confirmed the synergistic effect exerted by miRNA499 and miRNA133 (Fig. 2C, 2D). [score:1]
DMSO and miRNA133; *, p < . [score:1]
DMSO, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1; †, p < . [score:1]
The Synergic Effect of miRNA499 and miRNA133 on AMSC. [score:1]
To verify whether miRNA499 and miRNA133 exert their effects also on other cell types, we tested our protocol on AMSC. [score:1]
DMSO, miRNA1 and miRNA133; ‡, p < . [score:1]
In particular, it has been clearly shown that miRNA133 and miRNA1 promote myoblast proliferation and differentiation, respectively, and that miRNA499 enhances the differentiation of cardiac progenitor cells into CMC [17– 20]. [score:1]
Although miRNA1 and miRNA133 are cotranscribed, the function of miRNA133 is different from miRNA1. [score:1]
naïve, scramble miRNA, miRNA1, miRNA133, and miRNA1 + 499; #, p < . [score:1]
After 4 days, the EB were transferred to plastic culture dishes in the presence of differentiation medium, and transfected with precursor molecules (pre-miRNA) for miRNA499 (PM11352, 10 nM), miRNA1 (PM10617, 10 nM), and miRNA133 (PM10413, 5 nM) in different combinations or with scrambled miRNA used as a negative CTRL (AM17110, 5 nM) (Supporting Information Table S1). [score:1]
Our results clearly showed that miRNA499 is a powerful activator of cardiac differentiation, particularly in comparison with miRNA1 and miRNA133. [score:1]
naïve, scramble miRNA, miRNA1, miRNA133, miRNA1 + 499 and p < . [score:1]
Furthermore, the spontaneous mechanical activity response of miRNA499 and miRNA133 transfected cells to modulators of Ca [2+] handling effectors (CaV, RyRs, and IP3R) is consistent with that expected for cardiac but not skeletal muscle. [score:1]
miRNA precursors were diluted in Opti-MEM I medium at the following concentration: miRNA1 and miRNA499 precursors 10 nM, miRNA133 precursor and scrambled miRNA 5 nM. [score:1]
In order to confirm the synergic action of miRNA499 with miRNA133, we tested this combination also in AMSC. [score:1]
The synergistic effect exerted by the combination of miRNA133 and miRNA499 was confirmed by activation of the cTnI cardiac-specific promoter (Fig. 1B). [score:1]
[1 to 20 of 60 sentences]
5
[+] score: 109
We found that the expression of muscle miRNAs, including miR-1a, miR-133a and miR-206, was up-regulated in the skeletal muscle of mdx mice. [score:6]
miR-133 also inhibits the translation of polypyrimidine tract -binding protein (nPTB), which controls differential transcript splicing during skeletal-muscle differentiation [20]. [score:5]
Because the MCK promoter also directed miR-133a-1 overexpression in the heart, albeit at lower level, we determined whether heart development was affected in the transgenic mice. [score:5]
However, transgenic overexpression of miR-133a-1 in skeletal muscle did not result in a noticeable change in skeletal muscle development and morphogenesis. [score:4]
We have previously reported that the expression of muscle-specific miR-1 and miR-133 is induced during skeletal muscle differentiation and miR-1 and miR-133 play central regulatory roles in myoblast proliferation and differentiation in vitro. [score:4]
Transgenic overexpression of miR-133a-1 in the skeletal muscle. [score:3]
Genomic DNA from mouse chromosome 18 encoding the miR-133a-1 gene was inserted into an expression vector (Figure 2A). [score:3]
Total RNAs were isolated from indicated tissues, and the overexpression of miR-133a-1 was clearly detected in the skeletal muscle, and to a much less extent, the cardiac muscle, but not in the liver of transgenic mice (Figure 2C, D). [score:3]
Furthermore, miR-1 and miR-133 are also important regulators of cardiomyocyte differentiation and heart development [22- 24]. [score:3]
The overexpression of miR-133a-1 in germline-transmitted stable transgenic mice was confirmed by Northern blot analyses. [score:3]
We found that the expression miR-133a, together with that of miR-206 and miR-1a, was induced in the skeletal muscle of mdx mice. [score:3]
We also generated transgenic mice to overexpress miR-133a in skeletal muscle. [score:3]
We found that the expression levels of miR-1, miR-133 and miR-206 were higher in the skeletal muscle of one month-old mdx mice (Figure 1A). [score:3]
However, in the current study, we did not observe any overt muscle defect in mice expressing the MCK-miR-133a-1 transgene. [score:3]
A subset of miRNAs, miR-1, miR-133, miR-206 and miR-208, are either specifically or highly expressed in cardiac and skeletal muscle and are called myomiRs [6, 7, 13]. [score:3]
Among them, miR-133 was shown to promote the proliferation of myoblasts and inhibits their differentiation in cultured skeletal muscle myoblasts. [score:3]
Additionally, embryonic stem (ES) cell differentiation towards cardiomyocytes is promoted by miR-1 and inhibited by miR-133 [22]. [score:3]
Together, these data suggest that miR-133a is dispensable for the normal development and function of skeletal muscle. [score:2]
Surprisingly, skeletal muscle development and function appear to be unaffected in miR-133a transgenic mice. [score:2]
Analysis of mice that lost either miR-133a-1 or miR-133a-2 revealed that both miRNAs are dispensable for development or viability under normal physiological conditions. [score:2]
Recently, miR-133 genes (miR-133a-1 and miR-133a-2) were knocked out from the mouse genome. [score:2]
Our study therefore suggests that miR-133a is dispensable for skeletal muscle development. [score:2]
Paradoxically, miR-1 and miR-133 exert opposing effects to skeletal-muscle development despite originating from the same miRNA polycistronic transcript. [score:2]
Normal skeletal muscle development in miR-133 transgenic mice. [score:2]
In this study, we demonstrate that miR-133a is dispensable for the normal development and function of skeletal muscle. [score:2]
Additional analyses indicated that skeletal muscle development and function were not altered in miR-133a-1 transgenic mice. [score:2]
Figure 3 Normal cardiac and skeletal muscle development in miR-133a transgenic mice. [score:2]
Our results indicate that miR-133a is dispensable for the normal development and function of skeletal muscle. [score:2]
In order to further analyze muscle development, skeletal muscle from the diaphragms of six month old miR-133a-1 transgenic mice was collected and examined by tissue histology (n = 4). [score:2]
miR-133 enhances myocyte proliferation, at least in part, by reducing protein levels of SRF, a crucial regulator for muscle differentiation [18, 19]. [score:2]
As shown in Figure 4, hematoxylin and eosin (H&E) staining of diaphragms indicated that the tissue thickness, muscle cell size and numbers were comparable between miR-133a-1 transgenic mice and the control wild type mice. [score:1]
Figure 5 Histology of skeletal muscle from wild type and miR-133a transgenic mice. [score:1]
Similarly, we examined the skeletal muscle of the extensor digitorum longus (EDL) from six month old of both miR-133a-1 transgenic and wild type control mice (n = 4). [score:1]
Briefly, 20 μg of total RNAs isolated from skeletal muscle of 1 month old mdx and the control mice (Figure 1), or from the heart, skeletal muscle and liver tissues of miR-133a-1 transgenic and the control mice (Figure 2), were used and miRNA oligonucleotides with corresponding miRNAs (miR-1a, miR-133a and miR-206) sequences were used as probes. [score:1]
In order to further investigate the function of miR-133 in vivo, we took a gain-of-function approach and generated transgenic mice to overexpress miR-133a-1 in skeletal muscle. [score:1]
There was not difference in skeletal muscle formation or body fat deposit between miR-133a-1 transgenic mice and their littermate controls (Figure 3C, D). [score:1]
The MCK-miR-133a-1 transgenic construct was injected into fertilized mouse eggs and multiple transgenic founder lines were obtained, as verified by PCR genotyping (Figure 2B). [score:1]
H&E staining suggested that there was no difference in skeletal muscle morphology between miR-133a-1 transgenic mice and their control littermates (Figure 5A). [score:1]
Hematoxylin and eosin (H&E) staining for skeletal muscle tissue sections of diaphragm from 6 month old wild type (Wt) and miR-133a transgenic mice (MCK-miR-133). [score:1]
We used the well-characterized muscle creatine kinase (MCK) promoter to drive miR-133a-1 expression in skeletal muscle (and to a less extend, cardiac muscle). [score:1]
Our results are consistent with a recent report in which miR-133 loss-of-function mice did not induce overt defects in skeletal muscle [24]. [score:1]
Among them, miR-1, miR-133, miR-206, miR-208 and miR-499 have been described as muscle specific miRNAs, or myomiRs [6, 13]. [score:1]
All miR-133a-1 transgenic mice were viable and fertile without overt abnormality (Figure 3A, B). [score:1]
In this study, we attempted to determine the function of miR-133 in skeletal muscle. [score:1]
Interestingly, miR-1 and miR-133 also produce opposing effects on apoptosis [21]. [score:1]
The miR-133a-1 transgenic construct was injected into the pronuclei of C57/Bl6 X C3H hybrid embryos and implanted into pseudo-pregnant recipient females by the University of North Carolina Animal Mo dels Core. [score:1]
However, our results showed that there was no difference in the gross morphology of the adult hearts of miR-133a-1 transgenic mice and wild type controls (Figure 3E, F). [score:1]
Figure 2 Generation of miR-133a transgenic mice. [score:1]
We employed a gain-of-function approach and generated transgenic mice to overexpress miR-133a-1 in skeletal muscle, using the well-characterized muscle creatine kinase (MCK) promoter. [score:1]
The body weight and size between wild type and miR-133a-1 transgenic adult mice (ages from 2 to 12 months) were indistinguishable (n = 40, data not shown). [score:1]
Figure 4 Histology of skeletal muscle from diaphragm of wild type and miR-133a transgenic mice. [score:1]
Surprisingly, we found that miR-133a-1 transgenic mice appear to be normal. [score:1]
In order to generate miR-133a-1 transgenic mice, a genomic fragment encoding the precursor and franking sequences of the miR-133a-1 gene, which is located on mouse chromosome 18, was amplified by PCR using mouse genomic DNA as a template. [score:1]
[1 to 20 of 53 sentences]
6
[+] score: 108
The four downregulated miRNAs miR-133a, miR-133b, miR-331-3p, and miR-204 had 1,836 potential target genes, 222 of which were significantly upregulated in our prior mRNA microarray study (Additional file 4: Table S4) [9], consistent with the proposed regulatory action of the miRNAs. [score:10]
Predicted targets for miR-133a, miR-133b, miR-331-3p, and miR-204 were retrieved from the miRNA–mRNA target databases TargetScan, Pictar, and MirTarget2 with the R package RmiR. [score:9]
Bioinformatic analysis predicted 222 genes (see Additional file 4: Table S4) with upregulated expression in AAA based on a prior microarray study [9] were targets of miR-133a, miR-133b, miR-331, or miR-204. [score:8]
A list of predicted target genes for miR-133a/miR-133b, miR-204, and miR-331-3p that were also upregulated in our prior microarray study. [score:6]
We searched the literature for information on miR-133b, miR-133a, miR-204, miR-331-3p, and miR-30c-2*, the five miRNAs with confirmed downregulated expression between AAA and control abdominal aorta. [score:6]
Green molecules are the four down regulated miRNAs (miR-133a/miR-133b, miR-204, and miR-331-3p), yellow molecules are experimentally verified target genes of the four miRNAs, and grey molecules are predicted targets of the four miRNAs. [score:6]
miR-133a regulates the expression of a gene called nuclear factor of activated T cells, calcineurin -dependent-4 (NFATc4/NFAT3), which is a ubiquitously expressed member of the NFAT transcription factor family and is involved in cell proliferation. [score:6]
Since IPA combines the targets of mature miRNAs with similar sequences (2–3 nucleotide difference) to miRNA families, experimentally validated targets of miR-133a/miR-133b, miR-211/204, and miR-331-3p were retrieved. [score:5]
KLF15 is also a target of miR-133a/miR-133b [23], and its expression is reduced in both mouse aneurysm mo dels and human AAA [9, 55]. [score:5]
The three upregulated miRNAs were miR-181a* (MIMAT0000270), miR-146a (MIMAT0000449), and miR-21 (MIMA0000076), while five miRNAs, miR-133b (MIMAT0000770), miR-133a (MIMA000427), miR-331-3p (MIMAT0000760), miR-30c-2* (MIMAT0004550), and miR-204 (MIMA0000265), were significantly down regulated (Figure 1). [score:5]
Targets were predicted for qRT-PCR validated miRNAs (miR-133a, miR-133b, miR-331-3p, and miR-204), which were all down regulated in AAA. [score:4]
There was a redundancy between the predicted targets of miR-133a and miR-133b due to the similarity in their sequences; however, the two base pair difference had an impact on the calculated minimum free energies, suggesting that they may have different affinities for individual target silencing [19]. [score:3]
Bioinformatic analysis indicated that miR-133a, miR-133b, miR-331-3p, and miR-204 target apoptotic genes, which may play a role in the loss of vascular smooth muscle cells in AAA. [score:3]
CD28, CD86, and ICOS, which are important co-stimulatory molecules, were predicted to be targets of miR-204, miR-133a/miR-133b, and miR-331-3p, respectively [40]. [score:3]
Figure 3 A network of miRNAs miR-133a, miR-133b, miR-331-3p, miR-204, and their target genes. [score:3]
In the combined qRT-PCR analysis including all the 36 AAA tissue samples and seven controls, the differences in expression levels of the five miRNAs, miR-133b, miR-133a, miR-331-3p, miR-30c-2*, and miR-204, between AAA and control groups were highly significant (Figure 2). [score:3]
Two tumor necrosis factor receptors, TNFRSF10B and TNFRSF8, were predicted targets of miR-133a/miR-133b and miR-204, respectively. [score:3]
Four genes (CSRNP1, SLC7AB, PLK3, and FURIN) were predicted targets of miR-133a/miR-133b and miR-331-3p. [score:3]
NFATC4 mediates the effect of miR-133a in increasing cell proliferation in cardiomyocyte hypertrophy in vivo[24], but its expression is decreased in AAA [9]. [score:3]
Eight genes (DNM2, DNAJB1, TGFBR1, TGOLN2, BCL11A, EDEM1, SFXN2, YTHDF3) were predicted targets of miR-204 and miR-133a/miR-133b. [score:3]
Ingenuity Systems® Pathway Analysis tool was used to generate a network from 45 experimentally verified interactions of the four biologically active, validated, down regulated miRNAs (miR-133a, miR-133b, miR-331-3p, and miR-204) (Figure 5). [score:2]
Of the validated miRNAs in the current study only miR-133a and miR-133b differed in expression also in thoracic aortic dissections compared to controls [29]. [score:2]
This conclusion is supported by other studies in which mice treated with antagomirs for miR-133a showed cardiomyocyte hypertrophy [25], but knockout mice lacking miR-133a displayed dilated cardiomyopathy with increased apoptosis [22, 25]. [score:2]
For example, in cell culture experiments, miR-133a/miR-133b down regulation is associated with a switch in vascular smooth muscle cells to a proliferative phenotype [27]. [score:2]
The functions of miR-133b, miR-133a, and miR-204 have been thoroughly examined in a cardiovascular context [22- 28], but nothing was known about their role in AAA. [score:1]
Eight miRNAs (miR-133a, miR-133b, miR-146 a, miR-181a*, miR-204, miR-21, miR-30c-2*, miR-331-3p) which showed significant differences in their levels with an adjusted p < 0.05 in the microarray experiment were selected for qRT-PCR validation. [score:1]
Ingenuity Pathway Analysis® tool was used to generate the network from experimentally observed miRNA–mRNA interactions of miR-133a/miR-133b, miR-204, and miR-331-3p. [score:1]
[1 to 20 of 27 sentences]
7
[+] score: 108
org/), has revealed, interestingly, that the miR-1 targets; FOXP1 and HDAC4 have putative target sites for miR-133a or miR-133b, whereas miR-133b target; BCL2L2 also has putative miR-1 or miR-206 target sites. [score:9]
Common targets of miR-1 or miR-206 and miR-133a or miR-133b are 538 genes, which is 21.5% of miR-1 or miR-206 targets and 30.6% of miR-133a or miR-133b targets (Additional Table 1). [score:7]
Putative miR-1 or miR-206 targets exist in 2498 genes, and putative miR-133a or miR-133b targets are found in 1756 genes. [score:5]
A total of 3716 genes were identified by the TargetScan program as predicted targets of miR-1, miR-133a, miR-133b and miR-206. [score:5]
Figure 5A total of 3716 genes were identified by the TargetScan program as predicted targets of miR-1, miR-133a, miR-133b and miR-206. [score:5]
To identify the biological processes or pathways potentially regulated by the miR-1/miR-133a and miR-206/miR-133b clusters, we performed GENECODIS analysis [81, 82] with our predicted target list. [score:4]
As mentioned above, although the sequence of each seed region is different, some targets, such as MET, TAGLN2, PNP and LASP1, are commonly regulated by the miR-1/miR-133a and/or miR-206/miR-133b clusters. [score:4]
Recently, studies from our group and others have shown that downregulation of the miR-1/miR-133a and miR-206/ miR-133b clusters are frequent events in various types of cancer. [score:4]
Except for one report about multiple myeloma [37], studies on miR-1, miR-133a, miR-133b and miR-206 have found them all to be downregulated in many types of cancer (Table 1). [score:4]
We and other researchers have reported that the expression levels of miR-1 and miR-133a are significantly reduced in and correlated with maxillary sinus squamous cell carcinoma (SCC), renal cell carcinoma (RCC) and rhabdomyosarcoma (RMS) [38- 40]. [score:3]
Cell migration and invasion activities are also inhibited by miR-133a in ESCC [69], PCa [58], BC [59] and RCC [39]. [score:3]
Workflow for the bioinformatic analysis of target genes of miR-1, miR-133a, miR-133b and miR-206. [score:3]
Validated targets of miR-133a are actin-related protein 2/3 complex, subunit 5 (ARPC5) in lung SCC [67]; caveolin 1 (CAV1) in HNSCC [74]; fascin homolog 1 (FSCN1) in BC [75] and ESCC [69]; glutathione S-transferase pi 1 (GSTP1) in HNSCC [76] and BC [77]; LASP1 in BC [72]; pyruvate kinase, muscle (PKM2) in tongue SCC [78]; PNP in maxillary sinus SCC [38] and PCa [58]; and TAGLN2 in maxillary sinus SCC [38] and BC [59]. [score:3]
Altered expression of miR-1, miR-133a, miR-133b and miR-206 in cancers. [score:3]
These targets potentially contribute to specific functional readouts of miR-1, miR-133a, miR-133b and miR-206. [score:3]
Ectopic miR-133a has been shown to inhibit cancer cell growth in lung SCC [67], maxillary sinus SCC [38], tongue SCC [68], esophageal squamous cell carcinoma (ESCC) [69], PCa [58], BC [59], RCC [39] and RMS [40], and miR-133a was found to induce apoptosis in maxillary sinus SCC [38], tongue SCC [68], BC [59], and RCC cells [39], whereas miR-133a induced G2 arrest in RCC cells [39]. [score:3]
Aberrant expression of miR-1, miR-133a, miR-133b and miR-206 in cancers. [score:3]
Validated oncogene targets of miR-1, miR-133 and miR-206 in cancers. [score:3]
The predicted target genes of miR-1 are the same as those of miR-206, and those of miR-133a are the same as those of miR-133b, due to the identical sequences of their seed regions. [score:3]
miR-133b, a homologue of miR-133a, also inhibited tumor growth in tongue SCC [68], ESCC [69], and CRC cells [70]. [score:3]
Several cancers, including PCa, pancreatic cancer, lung cancer, AML, RCC, CRC, BC and thyroid cancer, are among the statistically enriched categories (Additional Table 2), and it is worth mentioning that miR-1, miR-133a, miR-133b and miR-206 are differentially expressed in these types of human malignancies. [score:3]
The total number of genes targeted by miR-1 or miR-206 and miR-133a or miR-133b is 3716. [score:3]
This bioinformatic analysis indicates that the miR-1/miR-133a and miR-206/miR-133b clusters might supplement each other to regulate several cancer pathways, such as cell growth, cell apoptosis, cell cycle, invasion and angiogenesis (Additional Figure 1). [score:2]
Computational analysis of miR-1-, miR-133a-, miR-133b- and miR-206-regulated molecular networks. [score:2]
Conducting qPCR, western blotting, and reporter assays and using bioinformatic prediction programs, recent research has identified several targets of miR-1, miR-133a, miR-133b and miR-206 (Table 2). [score:2]
miR-1-, miR-133a-, miR-133b- and miR-206-regulated molecular networks in cancers. [score:2]
As miR-1, miR-133a, miR-133b and miR-206 are mostly downregulated in cancers, gain-of-function experiments are a feasible way to evaluate the functional significance of these miRNAs in various cancers. [score:2]
Circulating miR-1, miR-133a, miR-133b and miR-206 as potential diagnostic markers. [score:1]
Genes of the miR-1/miR-133a and miR-206/miR-133b clusters. [score:1]
Figure 4The structures of precursor miR-133a-1, miR-133a-2 and miR-133b as constructed by the Mfold program [92] (http://mfold. [score:1]
miR-1-1/miR-133a-2, miR-1-2/miR-133a-1, and miR-206/miR-133b form clusters in three different chromosomal regions in the human genome – 20q13.33, 18q11.2, and 6p12.2, respectively. [score:1]
miR-1-1/miR-133a-2 is in an intron of the C20orf166 gene, miR-1-2/miR-133a-1 is in an intron of the MIB1 gene, and miR-206/133b is in an intergenic region (Figure 2). [score:1]
The structures of precursor miR-133a-1, miR-133a-2 and miR-133b as constructed by the Mfold program [92] (http://mfold. [score:1]
miR-133a-1 and miR-133a-2 possess identical mature sequences. [score:1]
Alignment of miR-133a-1, miR-133a-2 and miR-133b. [score:1]
Functional significance of miR-1, miR-133a, miR-133b and miR-206 in cancers. [score:1]
These high-throughput analyses have found miR-1, miR-133a, miR-133b and miR-206 to be altered in various types of cancers. [score:1]
miR-133b differs from miR-133a by a single nucleotide at the 3' end [26] (Figure 4). [score:1]
These facts suggest that miR-1/miR-133a and miR-206/miR-133b clusters might coordinately affect downstream pathways. [score:1]
[1 to 20 of 39 sentences]
8
[+] score: 108
We observed that approximately 1/10 of the recently identified 578 miRNAs are highly expressed in the mouse heart; SRF overexpression in the mouse heart resulted in altered expression of a number of miRNAs, including the down-regulation of mir-1 and mir-133a, and up-regulation of mir-21, which are usually dysregulated in cardiac hypertrophy and congestive heart failure [3, 13- 16]. [score:14]
In conclusion, our current study demonstrates that cardiac-specific overexpression of SRF leads to altered expression of cardiac miRNAs, especially the down-regulation of miR-1 and miR-133a, and up-regulation of miR-21, the dysregulation of which is known to contribute to cardiac hypertrophy. [score:12]
Real-time RT-PCR analysis revealed that mildly reduced SRF resulted in the down-regulation of miR-21 expression, but up-regulation of both miR-1 and miR-133a (Figure 5A). [score:9]
As shown in Figure 6, when pri-mir-1-1 and pri-mir-1-2 transcripts were down-regulated, so was miR-1 mature form; when pri-mir-133a1 and pri-mir-133a2 transcripts were down-regulated, the same was true for miR-133a mature form. [score:7]
Reducing cardiac SRF level using the antisense-SRF transgenic approach led to the expression of miR-1, miR-133a and miR-21 in the opposite direction to that of SRF overexpression. [score:6]
The up-regulation of miR-21, and the down-regulation of miR-1 and miR-133a were observed in SRF-Tg compared to wild-type (WT) mouse heart (P < 0.01**, n = 3). [score:6]
Our findings demonstrate for the first time that it is possible to regulate at the same time the expression of three miRNAs, miR-1, miR-133a and miR-21, through targeting the components of SRF -mediated signaling pathway. [score:6]
Interestingly, the down-regulation of miR-21, but up-regulation of miR-1 and mir-133a were observed in Anti-SRF-Tg compared to wild-type mouse heart (p < 0.01**, n = 3). [score:6]
When the mouse cardiac SRF level was reduced using the antisense-SRF transgenic approach, we observed an increase in expression of miR-1 and miR-133a miRNA, and a decrease in expression of miR-21. [score:5]
miR-1 ranks number 1 in expression, miR-133a ranks number 7 in expression. [score:5]
Our data revealed that the down-regulation of miR-1 correlates closely with that of miR-133a in the SRF-Tg at various time points from 7 days to 6 months of age (Figure 7B). [score:4]
Mir-1 and mir-133a are down-regulated in cardiac hypertrophy and cardiac failure, suggesting that they may play a role in the underlying pathogenesis [14, 43]. [score:4]
The down-regulation of miR-1 correlates closely with that of miR-133a in SRF-Tg at various time points from 7 days to 6 months of age (p < 0.05, n = 3 for all time points, except n = 6 for miR-21 at 6 months). [score:4]
The expression levels of miR-1, miR-133a and miR-21 were observed to be in the opposite direction with reduced cardiac SRF level in the Anti-SRF-Tg mouse. [score:4]
These findings suggest that SRF may regulate these two miRNAs at the level of polycistronic transcription, rather than at each individual miRNA (pri-mir-1 or pri-mir-133a) transcription, thereby keeping the expression of both miRNAs closely correlated. [score:4]
Another important miRNA, mir-133a, was ranked number seven in terms of level of expression. [score:3]
In addition, serum response factor (SRF), an important transcription factor, participates in the regulation of several cardiac enriched miRNAs, including mir-1 and mir-133a [4, 6]. [score:2]
Similarly, the mature miR-133a is derived from both mir-133a1 gene (on chromosome 18) and mir-133a2 gene (on chromosome 2). [score:1]
It is plausible that increasing mir-1 and mir-133a level at a specific time point may have potentially beneficial effects against the pathological conditions. [score:1]
The mouse pri-mir-1-1 and pri-mir-133a-2 are transcribed into a polycistronic transcript that is 10 kb in length, and the pri-mir-1-2 and pri-mir-133a-1 are transcribed into another polycistronic transcript that is 6 kb in length [42]. [score:1]
Both miR-1 and miR-133a are produced from the same polycistronic transcripts, which are encoded by two separate genes in the mouse and the human genomes [42]. [score:1]
Both guide strand and passenger strand (*) of mir-133a are decreased in SRF-Tg vs. [score:1]
Matkovich et al reported that an increase of mir-133a level in the postnatal heart has beneficial effects against cardiac fibrosis after transverse aortic constriction [44]. [score:1]
Generally, the pri-miRNA transcript contains one miRNA (e. g pri-mir-21), but it can also contain more than one miRNAs (e. g. mir-1 and mir-133a). [score:1]
[1 to 20 of 24 sentences]
9
[+] score: 106
Other miRNAs from this paper: hsa-mir-223, hsa-mir-133a-2, hsa-mir-146a, hsa-mir-382, hsa-mir-133b
To further predict what genes are targeted and regulated by miR-133a in monocytes in bone metabolism, we used two miRNA target gene predicting databases (miRDB and TargetScan) [50]– [55]. [score:8]
In bone, particularly, miR-133 and 133a have been found to regulate osteoblastogenesis by targeting and regulating Runx2 expression [6], [48]. [score:7]
A recent study also demonstrated that miR-133a was upregulated in osteoblast-like periodontal ligament stem cells treated with ibandronate, a nitrogen-containing bisphosphonate that inhibits bone resorption and is wi dely used to treat osteoporosis [49]. [score:6]
In addition, we performed Pearson correlation analyses between the expression levels of miR-133a and the three potential target genes in the 20 postmenopausal women. [score:5]
Correlation of expression levels (2 [−ΔΔCT]) of miR-133a with those of three potential target genes and the ratio of expression levels of each gene in the high and low BMD groups, as measured by qRT-PCR. [score:5]
Therefore, we will test the current and potential novel target gene expression and correlation with miR-133a in a bigger population at both mRNA and protein levels in the future. [score:5]
Our bioinformatic sequence analyses and reference searching identified three potential target genes of miR-133a related to the inhibition of osteoclastogenesis, which are CXCL11, CXCR3, and SLC39A1 (Table 2). [score:5]
However, only the upregulation of miR-133a in monocytes in the low vs. [score:4]
This result is consistently correlated with the downregulation of miR-133a in the high vs. [score:4]
We found significant upregulation of miR-133a in the low BMD group in both the array and the qRT-PCR analyses. [score:4]
Third, there may be other unknown target genes of miR-133a in circulating monocytes that affect osteoclastogenesis. [score:3]
Putative binding sites of miR-133a in predicted target genes in humans. [score:3]
We did not find significant correlations of miR-133a and selected potential target genes. [score:3]
According to this criterion, 156 qualified miRNAs (Table S1) were subject to the statistical analyses and two miRNAs, miR-133a and miR-382, showed significant upregulation in the low BMD group compared with the high BMD group (Figure 1). [score:3]
In addition, we detected miR-133a expression levels in circulating B cells from the same 20 high or low BMD postmenopausal women. [score:3]
We further performed qRT-PCR to validate the differential expression of miR-133a and miR-382. [score:3]
Further bioinformatic analysis of miR-133a identified its potential target genes that may be important in osteoclastogenesis. [score:3]
However, the significant qRT-PCR P value confirmed the differential expression of miR-133a in the array analyses. [score:3]
However, miR-133a was not differentially expressed in B cells between the high and the low BMD groups (P=0.49). [score:3]
However, our study for the first time showed the association of miR-133a expression levels in circulating monocytes, the osteoclast precursors, with postmenopausal osteoporosis. [score:3]
In addition, we performed correlation analysis of the expression levels of miR-133a and each gene. [score:3]
Many studies demonstrated that miR-133 and 133a are important in the development of muscle, such as skeletal muscle [39]– [43], and heart/cardiovascular muscle [44]– [47]. [score:2]
Our study suggested that miR-133a is a potential miRNA biomarker and/or regulatory element in circulating monocytes for postmenopausal osteoporosis. [score:2]
MiR-133a was upregulated (P=0.007) in the low compared with the high BMD groups in the array analyses, which was also validated by qRT-PCR (P=0.044). [score:2]
We found the significance of miR-133a in human circulating monocytes associated with postmenopausal osteoporosis. [score:1]
Therefore, miR-133a is most likely to be a monocyte specific biomarker underlying postmenopausal osteoporosis. [score:1]
Moreover, we are also planning to validate the miR-133a biomarker in a larger independent population. [score:1]
0034641.g002 Figure 2Expression levels (2 [−ΔΔCT]) of miR-133a and miR-382 measured by qRT-PCR analysis in circulating monocytes in the low and high BMD groups (*: P<0.05). [score:1]
All three genes did demonstrate negative correlation with miR-133a, although they were not significant (P>0.05) (Table 3). [score:1]
We did find negative correlations between miR-133a and all the three genes though not significant. [score:1]
In humans, there are two types of miR-133 miRNA isoforms, miR-133a and miR-133b, with one base difference (g-a) in the last nucleotide at the 3′ end (miRBase: http://www. [score:1]
The ABI miRNA array used in this study includes both miR-133a and miR-133b probes. [score:1]
Specifically, miR-133a displayed a fold change of 6.48 between the low and high BMD groups as mean ± SD (4.21±2.15 vs. [score:1]
Human mature miR-133a is encoded by two genes: MIR133A1 for miR-133a1 at 18q11.2 (194,036,59–194,077,46 bp) and MIR133A2 for miR-133a2 at 20q13.33 (611,601,19–611,642,20 bp). [score:1]
Our results suggest that miR-133a in circulating monocytes is a potential biomarker for postmenopausal osteoporosis. [score:1]
Both genes encode different pre-mature miRNAs but generate the same mature miR-133a sequence. [score:1]
Expression levels (2 [−ΔΔCT]) of miR-133a and miR-382 measured by qRT-PCR analysis in circulating monocytes in the low and high BMD groups (*: P<0.05). [score:1]
All three genes did show negative correlation with miR-133a, though not significant (Table 3). [score:1]
[1 to 20 of 38 sentences]
10
[+] score: 101
Other miRNAs from this paper: hsa-mir-133a-2
In conclusion, the present study has demonstrated that miR-133a is downregulated in epithelial ovarian cancer and that decreased miR-133a expression is associated with advanced clinical stage, poor histological differentiation and lymph node metastasis. [score:6]
Studies are likely to remain far from unveiling all miR-133a targets, and the roles of some of the potential targets in EOC carcinogenesis and progression are poorly understood. [score:5]
Similarly, among the 70 ovarian cancer samples analyzed, the relative expression of miR-133a was also significantly downregulated compared with the 26 normal ovarian tissues, as shown in Fig. 1B. [score:5]
Data were expressed as the expression level of miR-133a relative to that of the internal control U6, using the 2 [−ΔΔCt] method (22). [score:5]
miR-133a is downregulated in OVCAR-3 cells and primary EOC tumor samples. [score:4]
The present study has demonstrated for the first time that miR-133a is downregulated in the OVCAR-3 ovarian cancer cell line and primary tumor samples. [score:4]
Following transfection with miR-133a mimics or NC in OVCAR-3, a significant downregulation of invasion into Matrigel was observed in miR-133a -transfected OVCAR-3 cells (Fig. 3). [score:4]
Decreased miR-133a expression is associated with clinicopathological features. [score:3]
Aberrant miR-133a expression was previously reported in human malignancies, including bladder cancer (5), head and neck cancer (14), rhabdomyosarcoma (15), esophageal cancer (16), colon cancer (17), tongue cancer (18) and renal cell carcinoma (19), using high-throughput technology, including miRNA oligonucleotide arrays and quantitative polymerase chain reaction (qPCR). [score:3]
In order to determine whether miR-133a functions as a tumor suppressor in EOC, cell viability and apoptosis were analyzed in the present study. [score:3]
For example, ectopic miR-133a has been reported to suppress cell growth in lung cancer (26), maxillary sinus squamous cell carcinoma (27), tongue cancer (18), esophageal cancer (16), prostate cancer (28), bladder cancer (29) and renal cell carcinoma (19). [score:3]
Previous studies have illustrated that miR-133a plays a suppressive role in tumors. [score:3]
These findings suggest that miR-133a may be a useful target for therapeutic intervention and a biomarker for the prediction of EOC progression and prognosis. [score:3]
Furthermore, Wu et al revealed that loss of expression of miR-133a was markedly associated with tumor lymph node metastasis, advanced clinical stages and shortened relapse-free survival in patients with breast cancer (30). [score:3]
miR-133a may also inhibit cell migration and invasion activities in esophageal cancer (16), prostate cancer (28), bladder cancer (29) and renal cell carcinoma (19). [score:3]
Furthermore, the expression levels of miR-133a were markedly associated with clinical and pathological features, including tumor stage and grade, and lymph node metastasis. [score:3]
Collectively, these results indicate that miR-133a suppresses EOC growth in vitro. [score:3]
These findings suggest that miR-133a may be a useful biomarker for the prediction of ovarian cancer progression and a potential promising target for gene therapy. [score:3]
Therefore, future research is required to identify the targetome and the exhaustive roles of miR-133a in ovarian cancer, based on this assumption. [score:3]
Among the miRNAs, miR-133a is regarded as one of the major tumor suppressor miRNAs. [score:3]
Additionally, cell apoptosis in OVCAR-3 cells increased following restoration of miR-133a expression (Fig. 2B). [score:3]
Collectively, these results suggest that miR-133a may be of vital importance in tumor initiation and in the development and progression of malignancy. [score:2]
As shown in Fig. 1A, miR-133a expression significantly decreased in OVCAR-3 cells compared with OSE(tsT) cells. [score:2]
Several targets of miR-133a have recently been identified, including fascin homologue 1 (31), transgelin 2 (19, 27), purine nucleoside phosphorylase (27), actin-related protein 2/3 complex subunit 5 (26), glutathione S-transferase π 1 (26), caveolin-1 (14), LASP1 (32) and pyruvate kinase M2 isoform (18), using qPCR, western blotting, reporter assays and bioinformatic prediction programs. [score:2]
Table I shows that the relative expressions of miR-133a were significantly lower in advanced stage and grade 3 tumor samples compared with early stage and grade 1 and 2 tumor samples. [score:2]
miR-133a transfection. [score:1]
Furthermore, the number of migrated cells transfected with miR-133a mimics was significantly lower than with the NC, as shown in Fig. 4. These observations confirm the function of miR-133a in the invasion and metastasis of OVCAR-3 cells. [score:1]
The cells were cultured using complete medium without antibiotics, and Lipofectamine 2000 and miR-133a mimics were diluted with serum-free medium. [score:1]
miR-133a mimics were obtained from Shanghai GenePharma Co. [score:1]
In addition, miR-133a plays a critical role in the cell viability, apoptosis, invasion and migration of ovarian cancer OVCAR-3 cells. [score:1]
OVCAR-3 cells were transfected with NC or miR-133a mimics and grown to confluence. [score:1]
OVCAR-3 cells were transfected with NC or miR-133a mimics for 48 h and transferred onto the top of Matrigel-coated invasion chambers in serum-free DMEM (1×10 [5] cells per transwell). [score:1]
Additionally, the effects of miR-133a on OVCAR-3 cell proliferation, apoptosis, invasion and migration were analyzed. [score:1]
Additionally, miR-133a was found to induce apoptosis in maxillary sinus squamous cell carcinoma (27), tongue cancer (18), bladder cancer (29) and renal cell carcinoma (19). [score:1]
miR-133a reduces cell viability and promotes cell apoptosis. [score:1]
OVCAR-3 cells were transfected with NC or miR-133a mimics for 48 h. Next, cell culture medium was replaced with serum-free DMEM. [score:1]
It was revealed that transfection of miR-133a mimics significantly reduced cell viability in OVCAR-3 cells (Fig. 2A). [score:1]
The transfection of miR-133a mimics into cells was carried out using Lipofectamine 2000 (Invitrogen Life Technologies, Carlsbad, CA, USA). [score:1]
miR-133a affects cell invasion and migration in vitro. [score:1]
In addition, miR-133a was found to reduce OVCAR-3 cell viability, promote cell apoptosis and affect cell invasion and migration. [score:1]
These included synthetic small duplex sequences of miR-133a -RNA able to be bioprocessed into mature miR-133a in the cells. [score:1]
Thus, the present study was performed to investigate the expression of miR-133a in EOC tissues and the human EOC OVCAR-3 cell line by qPCR. [score:1]
However, it remains unknown whether miR-133a has a functional role in EOC. [score:1]
[1 to 20 of 43 sentences]
11
[+] score: 100
The average expression levels of miR-133a, miR-133b and miR-208b in osteosarcoma tissues were significantly down-regulated, while the average miR-645 expression was significantly up-regulated ([**], p≤0.01). [score:11]
Evidence shows that BCL-xL and MCL-1 are targets of miR-133a, and over -expression of miR-133a inhibits cell proliferation and promotes cell apoptosis of osteosarcoma cell lines through decreasing BCL-xL and MCL-1 expression [30]. [score:9]
Decreased expression of miR-1 and miR-133a are found in bladder cancer, and over -expression of miR-1 or miR-133a inhibits bladder cancer cell proliferation, migration and invasion, and increases apoptosis [20]. [score:7]
showed that compared with normal bones, miR-133a and miR-133b expression were significantly down-regulated in paraffin-embedded osteosarcomas (p≤0.01), being consistent with results in frozen osteosarcoma samples. [score:5]
It indicates that miR-133a mimic may promote apoptosis of U2-OS cells through suppressing MCl-1 expression in our study. [score:5]
The average relative expression level of miR-133b in paraffin-embedded normal bones was 19.29, whereas the average relative expression level of miR-133a in paraffin-embedded normal bones was only 0.07. [score:5]
The top down-regulated miRNAs (miR-1, miR-30a, miR-133a, miR-133b, miR-208b and miR-378c) and up-regulated miRNAs (miR-338-5p, miR-663b, miR-645 and miR-3663-5p) are listed in Table 2 and 3. To confirm the results of miRNA microarray assay, SYBR Green qRT-PCR was performed using the RNAs from five human osteosarcoma and three normal muscle samples in miRNA microarray assay as templates. [score:5]
The decreased expression of miR-133a and miR-133b in paraffin-embedded osteosarcoma was consistent with those in frozen osteosarcoma samples ([**], p≤0.01), whereas the increased expression of miR-645 was not obviously observed (p≥0.05). [score:5]
We found that miR-133a, miR-133b and miR-208b expressions significantly decreased in osteosarcomas (p≤0.01) while miR-645 expression significantly increased (p≤0.01) (Figure 2). [score:5]
We observed that miR-133a mimic is more difficult to transfect into MG-63 cells than U2-OS cells, and the relative expression of miR-133a in MG-63 cells after miR-133a mimic transfection is lower than those in U2-OS cells (Figure S2 in File S1). [score:3]
results also showed that transfection of miR-133a mimic decreased the expression of MCL-1 but not BCL2L2 in U2-OS cells (Figure S5 in File S1). [score:3]
Confirmation of miR-133a, miR-133b and miR-645 expression in paraffin-embedded human osteosarcoma samples (P-OS) using SYBR Green qRT-PCR. [score:3]
A study also identifies that miR-1/miR-133a and miR-206/miR-133b clusters are down-regulated in several osteosarcoma cell lines compared with normal bones, which is consistent with our findings [17]. [score:3]
Therefore, the amount of miR-133a in MG-63 cells may not be enough to decrease MCL-1 expression and induce apoptosis. [score:3]
In this study, the expression levels of miR-133a and miR-133b were confirmed to be reduced significantly in both frozen and paraffin-embedded osteosarcoma samples. [score:3]
Among the 43 differentially expressed miRNAs, a part of miRNAs such as miR-1, miR-26a, miR-30a, miR-30b miR-133a, miR-133b and miR-224, are found to play a key role in cancers, whereas some miRNAs are not reported [20]– [26]. [score:3]
Although miR-133a and miR-133b locate on the different chromosomal regions of human genomes, they share several target genes such as BCL2L2, IGF1R MCL-1 and MET, since they are only distinguished by a single nucleotide at the 3′-end. [score:3]
We also found that the expression level of miR-133b in paraffin-embedded normal bones was higher than those of miR-133a (Figure 3). [score:3]
In addition, no correlation between the histological subtypes of osteosarcoma and the expression of miR-133a or miR-133b was found in our study. [score:3]
MiR-133a mimic decreased the expression of MCL-1 in U2-OS cells. [score:2]
As described above, compared with miR-133a, miR-133b is a more promising candidate to develop novel targets of osteosarcoma therapy. [score:2]
However, results showed that the miR-133a mimic did not significantly decrease cell proliferation and migration of OS cells as miR-133b (Figure S3 in File S1). [score:1]
Effect of miR-133a mimic on apoptosis of OS cells. [score:1]
For further validation of our microarray results, eighteen paraffin-embedded human osteosarcoma samples and two normal bones obtained from patients P-OS-4 and P-OS-10 were employed to evaluate the expression level of miR-133a, miR-133b and miR-645 by qRT-PCR. [score:1]
MiR-133b is a member of miR-133 family and known as a muscle-specific miRNA, mediating myoblasts proliferation and differentiation [7]. [score:1]
U2-OS or MG-63 cells were transfected with miR-133a mimic or miRNA mimic negative control (NC) at a final concentration of 50 nM. [score:1]
Effect of miR-133a mimic on OS cell proliferation and migration. [score:1]
Relative expression of miR-133a in osteosarcoma cells U2-OS and MG-63 was then evaluated by SYBR Green qRT-PCR as described in (n = 3; [**], p≤0.01). [score:1]
Osteosarcoma cell lines U2-OS (A) and MG-63 (B) were transfected with miR-133a mimic or miRNA mimic negative control (NC) at a final concentration of 50 nM. [score:1]
We also performed pilot studies using miR-133a mimic in osteosarcoma cell lines U2-OS and MG-63. [score:1]
[1 to 20 of 30 sentences]
12
[+] score: 96
Other miRNAs from this paper: hsa-mir-133a-2, hsa-mir-146a, hsa-mir-133b, hsa-mir-146b
Since the high glucose effects on PTB protein levels and insulin biosynthesis rates were counteracted by the miR-133a inhibitor, and since the miR-133a precursor mimicked the effects of high glucose, it is likely that miR-133a binds to and inhibits the translation of PTB in human islet cells, and that high-glucose decreases insulin production, at least in part, by inducing miR-133a. [score:7]
However, PTB protein levels were decreased by 30–40% in islets incubated in the presence of high glucose or sodium palmitate (Figure 3) consistent with the observation that miR-133a inhibits PTB translation by binding to the 3′-UTR of PTB [31], [32], and in line with the generally accepted notion thats often decrease translation without affecting stability and levels [38], [39]. [score:7]
MicroRNA-133a is abundantly expressed in muscle tissue, and insulin -mediated down-regulation of miR-133a levels in human skeletal muscle is attenuated in Type 2 diabetes [45]. [score:6]
To clarify if the inhibitory effects of these islet stressors were associated with differential expression of specifics, we analyzed miR-133a, miR-124a and miR-146 levels by semi-quantitative real-time RT-PCR and normalized the results per let7c levels. [score:5]
For example, miR-146 -mediated control of cytokine-receptor-signaling events may regulate beta-cell sensitivity to inflammatory factors, and miR-133a targeting of UCP-2 may control mitochondrial output of ROS. [score:4]
Prolonged high-glucose exposure down-regulates PTB levels and insulin biosynthesis rates in human islets by increasing miR-133a levels. [score:4]
Assuming that miR-133a also targets UCP-2 in islet cells, high glucose -induced increase in miR-133a may result in lower UCP-2 activity and higher ROS production, contributing to glucotoxicity. [score:3]
Effects of miR-133a precursor and miR-133 inhibitor on human islet insulin biosynthesis. [score:3]
0010843.g005 Figure 5In A, human islet cells were dispersed by trypsin treatment and lipofected with control RNA, miR-133a precursor or miR-133a inhibitor using Dharmafect I. Two days after the lipofection cells were cultured for another 24 hours in either 5.6 or 20 mM glucose. [score:3]
Effects of high glucose, miR-133a precursor or miR-133a inhibitor on human islet PTB protein levels (A) and insulin biosynthesis rates (B). [score:3]
The resulting islet cell suspensions were placed in non-attachment plates and transfected with the pre-designed miR-133a precursor (Ambion; AM17100), a small, double-stranded and chemically modified RNA molecule designed to mimic the effects of miR-133a, the pre-designed miR-133a inhibitor (Ambion; AM17000), a single stranded and chemically modified RNA-molecule designed to nullify miR-133a activity, or with the negative control miR oligonucleotide (Ambion). [score:3]
The miR-133a inhibitor tended to increase PTB protein levels, both at low and high glucose, but this effect did not reach statistical significance (Figure 5A). [score:3]
The miR-133a inhibitor prevented the high glucose -induced decrease in PTB and insulin biosynthesis, and the miR-133a precursor decreased PTB levels and insulin biosynthesis similarly to high glucose. [score:3]
The impact of the high glucose -induced increase in miR-133a on insulin biosynthesis rates was not dramatic, but this mechanism may act in synergy with other high glucose -induced suppressive mechanisms leading to beta-cell failure and aggravation of Type 2 diabetes. [score:3]
The pathophysiological consequences of such changes in miR-133a levels are unknown, but it has been suggested that uncoupling protein (UCP)-2 is a miR-133a target, and that high miR-133a levels result in a decrease in UCP-2 [47]. [score:3]
The high glucose -induced decrease in insulin biosynthesis was abolished by transfection with the miR-133a inhibitor (Table 2 and Figure 5B). [score:3]
Synthetic miR-133a precursor and inhibitor were delivered to dispersed islet cells by lipofection, and PTB was analyzed by immunoblotting following culture at low or high glucose. [score:3]
To establish that the high glucose -induced increase in miR-133a mediated the decrease in PTB protein levels, we introduced the miR-133a precursor and the miR-133a inhibitor into dispersed islet cells by lipofection. [score:3]
In A, human islet cells were dispersed by trypsin treatment and lipofected with control RNA, miR-133a precursor or miR-133a inhibitor using Dharmafect I. Two days after the lipofection cells were cultured for another 24 hours in either 5.6 or 20 mM glucose. [score:3]
Two of theses, miR-124a and miR-133a, have recently been shown to target PTB in neuronal and muscle cells, respectively [31], [32]. [score:3]
Effects of miR-133a precursor and miR-133a inhibitor on islet PTB protein levels and insulin biosynthesis rates. [score:3]
Indeed, miR-133a -induced inhibition of nPTB translation has previously been demonstrated in neuronal cells [31], and it is known that PTB contains similar miR-133a binding sites as those characterized in nPTB [31]. [score:3]
RNA was then isolated for real-time RT-PCR analysis of miR-133a, miR-124a, miR-146, insulin and PTB contents. [score:1]
This effect was mimicked by the miR-133a precursor (Figure 5A). [score:1]
In addition, miR-133a contents are increased in cardiomyocytes taken from human diabetic patients [46]. [score:1]
We observed that a 24h exposure to 20 mM glucose resulted in a doubling of miR-133a levels (Figure 1A). [score:1]
Culture in high glucose resulted in increased islet contents of miR-133a and reduced contents of miR-146. [score:1]
Here we report that a high glucose concentration increased miR-133a levels and decreased PTB protein levels, paralleled by lowered insulin biosynthesis rates. [score:1]
Using the same experimental setup, insulin biosynthesis rates, but not total protein biosynthesis rates, were decrease in human islet cells transfected with the miR-133a precursor, both at low and high glucose concentrations (Table 2 and Figure 5B). [score:1]
The polypyrimidine tract binding protein (PTB) is required for stabilization of insulin and the PTB 3′-UTR contains binding sites for the microRNA molecules miR-133a, miR-124a and miR-146. [score:1]
Further studies on the consequences of miR-133a -mediated reduction on UCP-2 levels in human islet cells are warranted. [score:1]
We report here that miR-133a is induced by high glucose in human islet cells leading to lower PTB levels. [score:1]
Typical thresh-hold cycle numbers for miR-133a, miR-124a and miR-146 were 28–30, 32–34 and 25–27, respectively, indicating a relatively high abundance for miR-146, an intermediary abundance for miR-133a and a low abundance for miR-124a. [score:1]
Also the islet miR-133a response to sodium palmitate was highly inconsistent from one donor to another. [score:1]
A 24h exposure to cytokines did not affect miR-133a levels (Figure 1A). [score:1]
Effects of high glucose, palmitate or cytokines on human islet miR-133a, miR-124a and miR-146 levels. [score:1]
There was also a trend to higher miR-133a levels in response to sodium palmitate (Figure 1A), both at 5.6 and 20 mM glucose, but due to considerable inter donor variation, this effect did not reach statistical significance. [score:1]
[1 to 20 of 37 sentences]
13
[+] score: 95
In our findings, the downregulation of miRs-133a and b started at 24 h and peaked at 2–3 days post the surgery, whereas miR-1 peaked already at 24 h. Thus, we suggest that the early expression of is necessary to contrast the caspase protein translation in all injured hearts (due to miR-133 downregulation). [score:11]
The miR-133 expression is regulated by extracellular signal-regulated kinase 1/2 activation and is inversely correlated with vascular growth [23], since it is strongly related to FGF-receptor expression [24]. [score:7]
a Expression of miR-1; b expression of miR-133a; c expression of miR-133b. [score:7]
miR-133a instead acts directly on blocking the expression of the receptor of FGF and on the expression of the PP2AC that promotes the activity of ERK. [score:6]
At 7 days after amputation (dpa), the level of miR-133 expression in the ventricle of the heart was lower than control individuals and suggested that miR-133 is an endogenous inhibitor of EC proliferation [25]. [score:5]
Most of these genes were demonstrated to be, directly or indirectly, a target of miR-1 and miR-133a and miR-133b (ref. [score:5]
Liu N MicroRNA-133a regulates cardiomyocyte proliferation and suppresses smooth muscle gene expression in the heartGenes Dev. [score:5]
Particularly, miR-1, miR-133a and miR-133b have been detected in 1 dpa in different data sets of down-regulated transcripts. [score:4]
miR-133a has significantly downregulated at 24 hpa in both portions (EPCs, 0.329 ± 0.056; RC, 0.388 ± 0.152; P < 0,001) vs control (EPCs, 1 ± 0.377; RC 0.880 ± 0.219). [score:4]
Moreover, miR-133a is probably a key miR that can activate the epicardium because it showed a more significant downregulation already at 1 dpa. [score:4]
However, in the reference panorama, information is still lacking about the timing of the downregulation of the miRs, about the possible involvement of miRs-1 and of the isoforms miR-133a and -133b in the heart differentiation and regeneration. [score:4]
In zebrafish, transgenic-inducing elevation of miR-133 levels after injury provoked an inhibition of myocardial regeneration, while the knockout of miR-133 showed increased CM proliferation [30]. [score:4]
Xu C The muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, and caspase-9 in cardiomyocytesJ. [score:3]
In zebrafish, miR-133 antagonism that occurred during FGF-receptor inhibition has accelerated the regeneration of appendage or heart damage through increased proliferation within the regeneration blastema [25]. [score:3]
Regarding miR-133a (Fig.   1b), the qPCR data show that at 24 hpa there is a decrease (but not statistically significant, 0.707 ± 0.065), while the values of expression on days 2, 3 and 7 are similar to those of the miR-1 (0.519 ± 0.079, 0.255 ± 0.016, 0.560 ± 0.145, respectively) (Fig.   2). [score:3]
For example, among the target genes of miR-133, the genes for fibroblast growth factor receptor 1 (FGFR1) and protein phosphatase-2A-catalytic subunit (PP2AC, including Ppp2ca and Ppp2cb) seem to be promising to understand the possible induction. [score:3]
Tbx18, a target of miR-133a, is specific for epicardium and it would be a key transcription factor to induce the mesenchymal transient cells to differentiate into the precursors of CM 24, 29. [score:3]
Hearts were harvested from 24 h to 30 dpa, and analysed for miRs (miR-1 and miR-133a/miR-133b) by qPCR to know how their expression levels vary at different stages of regeneration. [score:3]
miR-1 is the most conserved miRNA during evolution [16], whereas a gene duplication probably has formed the miR-133 gene, which in fact is positioned in the same genetic locus of the miR-1 [31] and, in mammals, it regulates transcription of myoD [19]. [score:2]
Feng Y A feedback circuit between miR-133 and the ERK1/2 pathway involving an exquisite mechanism for regulating myoblast proliferation and differentiationCell Death Dis. [score:2]
Previous studies indicated that during myogenesis, the signalling pathway of MyoD are regulated by both miR-133a and miR-133b [24]. [score:2]
Fig. 7 A proposed schematic mo del of miR-1 and miR-133 actions in blocking the FGF -dependent transduction pathway in the cells involved in cardiac regeneration: CMs, fibroblast, EPCs and endocardial cells. [score:1]
Particularly, miR-133 has two isoforms, miR-133a and miR-133b, and their activity seems to be similar at the moment [23]. [score:1]
There are two members in the miR-133 family: miR-133a and miR-133b. [score:1]
miR-1/miR-133 are mainly implicated in post lesion in mammals as well as in zebrafish 14, 17, 22, 23. [score:1]
Recently, an involvement of miRs has been shown by the array analysis at 7 days post operation dpa [25], and in particular of miR-133 [31]. [score:1]
[1 to 20 of 26 sentences]
14
[+] score: 89
Other miRNAs from this paper: hsa-mir-1-2, hsa-mir-133a-2, hsa-mir-206, hsa-mir-1-1, hsa-mir-133b
Detection of miRNA-133a target protein in vitro and in vivoThere was no change in the mRNA expression of genes that contained myomir target sites (data not shown); thus, miR-133a may only target protein translation rather than mRNA cleavage. [score:11]
Several groups have used microarray data to examine the expression changes when a single miRNA changes, and we used the mean absolute expression approach described recently by Arora and Simpson [49] and also the tissue-centric approach described by Sood et al. [50] to determine whether we could detect shifts in the average expression of mRNA targets of the muscle-specific miRNAs (miR-1, miR-133a/b and miR-206, collectively known as 'myomirs') in human skeletal muscle. [score:9]
There was no change in the mRNA expression of genes that contained myomir target sites (data not shown); thus, miR-133a may only target protein translation rather than mRNA cleavage. [score:9]
Over -expression of miR-1 [55] or miR-206 [86] in mouse myoblasts accelerates differentiation into myotubes whereas over -expression of miR-133 promotes proliferation [55]. [score:5]
CDC42 and PTBP1 were selected for study because they ranked highly as targets of miR-133/miR-206 in the TargetScan database and both proteins are relevant for muscle cell differentiation and metabolism [57, 58]. [score:5]
We found that expression of miR-133a was associated with fasting glucose and 2 hour glucose tolerance data (R [2 ]= 0.37, P < 0.001), with higher fasting glucose levels associated with lower miR-133a expression (Figure 2d). [score:5]
Regulation of miRNA production, post-transcriptionally, is proving to be potentially important for determining stem cell differentiation [93, 94] while the protein or signaling factors that inhibit miR-133a production in T2D remain to be determined, this process clearly has the potential to alter muscle differentiation [28]. [score:4]
However, evidence of distinct binding proteins that modulate processing of pri-miRNA to mature miRNA [92] has emerged and we clearly demonstrate that expression of miR-1 and miR-133a are not co-regulated in vivo in human skeletal muscle. [score:4]
Thus, we found that altered miR-133a expression modestly related to important clinical parameters. [score:3]
Detection of miRNA-133a target protein in vitro and in vivo. [score:3]
ANOVA indicated that miR-133a (F = 11.8, P < 0.0001) was significantly different between the three groups, miR-206 expression more modestly altered (F = 4.5, P = 0.02) and miR-1 and miR-133b were unchanged (Figure 2c). [score:3]
In addition, miR-133a expression was significantly associated with HbA1c, an indicator of long-term glucose homeostasis (R [2 ]= 0.29, P < 0.01) and also correlated with HOMA1 (R [2 ]= 0.15, P = 0.04). [score:3]
A clear stepwise reduction in mature miR-133a expression was observed across the three clinical groups. [score:3]
In vivo the expression of these miRNAs can vary as miR-1 and miR-133a decrease 50% in response to muscle hypertrophy in mice following 7 days of loading [87]. [score:3]
Skeletal muscle miR-133a expression was reduced by five-fold in T2D (P < 0.001). [score:3]
Expression of miR-133a is positively correlated with fasting glucose, R [2 ]= 0.41 (P < 0.001, n = 30). [score:3]
The steady state level of pre-miR-133 was very low in human skeletal muscle compared with the signal from the mature miR-133a/b expression transcript (Figure S3 in Additional file 1). [score:2]
miR-133a (P < 0.001) and miR-206 (P = 0.04) were significantly reduced in T2D patients when compared with expression levels in healthy controls. [score:2]
Interestingly, reduction in miR-133a using an antagomir (Figure S4A in Additional file 1) had an indirect effect on the other myomirs, such that miR-133b (expected due to sequence similarity) and miR-206 (unexpected) were substantially reduced. [score:2]
An oligonucleotide was synthesized to probe for miR-133a/b (5'-AGCUGGUUGAAGGGGACCAAA-3'). [score:1]
To determine if pri-miRNA transcript abundance differs across the presumed polycistronic mir-1/mir-133a pri-miRNA, we utilized qPCR. [score:1]
Northern analysis was used to document differences in precursor miR-133 and mature miR-133 abundance. [score:1]
This confirms that along with the much lower (>100 times) amplification efficiency [45], miR-133 pre-miRNA cannot contribute to the TaqMan signal. [score:1]
This suggests that either processing of the pri-miR-133a or stability of mature miR-133a is altered in T2D. [score:1]
The Northern probe detects both miR-133a and miR-133b due to sequence similarity. [score:1]
Most studied are miR-133, miR-206 and miR-1, which are all induced during differentiation of myoblasts into myotubes [28]. [score:1]
[1 to 20 of 26 sentences]
15
[+] score: 83
Mg [2+] Potentiates miR-133a Expression and Prevents Its Pi-Induced DecreaseRegarding the time course of miR-133a regulation for the various conditions, HAVSMC cultured with 3 mM Pi led to a progressive decrease of miR-133a expression, whereas the addition of Mg [2+] resulted in an upregulation of miR-133a (Figure 3(b)). [score:9]
The downregulation of miR-133a is consistent with findings in [11] in which miR-133/135 were downregulated during osteogenic differentiation. [score:7]
The past and present findings are summarized in Figure 6, where the multiple modes of action of Mg [2+] in Pi -induced VC are depicted: from its entry into the cell through TRPM7, its modulation of Ca/P crystal composition and structure, its modifications of calcification inhibitors, enhancement of cell viability, suppression of osteogenic differentiation, inhibition of Wnt/ β-catenin pathway, and finally its active influence on osteogenesis (Runx2, Osx, and Smad1) through specific miR modulation (miR-30b, miR-133a, and miR-143). [score:7]
Regarding the time course of miR-133a regulation for the various conditions, HAVSMC cultured with 3 mM Pi led to a progressive decrease of miR-133a expression, whereas the addition of Mg [2+] resulted in an upregulation of miR-133a (Figure 3(b)). [score:7]
It reveals three main findings: (i) our screening showed a downregulation of key miRs such as miR-30b, miR-133a, and miR-143 during Pi -induced calcification of HAVSMC; (ii) osteogenesis and VC markers related to these miRs, such as Smad1 and Osterix, were found to be modulated accordingly; and (iii) Mg [2+] had a protective effect by interfering with the Pi -induced VC process as the modulations of the affected miRs and their related targets were partially abrogated or even improved. [score:6]
We are now able to assert that Mg [2+] is effective relatively early during Pi -induced VC by cancelling osteogenic gene expression through miR-30b/miR-133a/miR-143 expression reinforcement, resulting in a retention of the SMC phenotype. [score:5]
Inhibition and overexpression of Runx2 protein as well as other calcification markers were shown using ectopic miR-133a and anti-miR-133a, respectively. [score:5]
Thus, our data expand Liao et al. observations on miR-133a downregulation during VC to a human vascular mo del. [score:4]
The implication of miR-133a in a mineralization process was first described during BMP-2 induced osteoblastogenesis [11], where it was found to be downregulated. [score:4]
Conversely, upregulation of miR-133a was found when Mg [2+] was added to the calcifying condition. [score:4]
The expression of Runx2 mRNA is regulated by several miRs: miR-30b, miR-133a, and miR-204 (Table 1). [score:4]
Lately, miR-133a was shown to be downregulated in primary murine vascular SMC calcified by the addition of 10 mM β-glycerol phosphate [31]. [score:4]
In summary, we found that Pi, the most prominent natural inducer of VC, was able to decrease the expression of miR-30b/miR-133a/miR-143. [score:3]
Mg [2+] Potentiates miR-133a Expression and Prevents Its Pi-Induced Decrease. [score:3]
Similar results were found at day 7. After 10 days of induced calcification, miR-133a expression levels were lowered in conditions containing Pi. [score:3]
Considering the previous studies, we decided to assess Runx2 and Smad1 mRNA expression to see the potential consequences of a miR-30b and miR-133a Pi -induced decrease. [score:3]
Thus, the addition of Mg [2+] 2 mM only partially reverses the decrease of miR-133a. [score:1]
Our data suggest that Mg [2+] is able to antagonize the Pi -induced decrease of 3 miRs (miR-30b, miR-133a, and miR-143) involved in mineralization processes or SMC phenotypic switch. [score:1]
It is of note that, despite the use of ectopic anti-miR-133a, Runx2 mRNA levels remained unaffected. [score:1]
Our results confirmed the implication of miR-30b in calcification and brought miR-133a as well as miR-143 from phenotypic switch and vascular remo deling into the field of VC. [score:1]
A sequence analysis indicated the presence of a putative miR-133a binding site located in the 3′ UTR of Runx2 mRNA. [score:1]
[1 to 20 of 21 sentences]
16
[+] score: 80
Ssc-miR-103 and ssc-miR-107 expression was slightly lower in premolars (Dpm) than in other types of teeth, ssc-miR-133a and ssc-miR-133b expression was much higher in Dpm than in other types of teeth, and ssc-miR-127 expression gradually increased from the incisor (Di) to the molar (Dm) In order to detect the oral developmental specificity of the five selected miRNAs, we further extracted kidney, liver and submandibular gland to contrast the five miRNAs expression (Fig.   5). [score:10]
Ssc-miR-103 and ssc-miR-107 expression was slightly lower in premolars (Dpm) than in other types of teeth, ssc-miR-133a and ssc-miR-133b expression was much higher in Dpm than in other types of teeth, and ssc-miR-127 expression gradually increased from the incisor (Di) to the molar (Dm)In order to detect the oral developmental specificity of the five selected miRNAs, we further extracted kidney, liver and submandibular gland to contrast the five miRNAs expression (Fig.   5). [score:10]
For example, hsa-miR-133a, hsa-miR-200b, hsa-miR-206, and hsa-miR-218 were considered as tooth tissue-specific miRNAs [4]; eight differentially expressed miRNAs were expressed during morphogenesis and seven were expressed in the incisor cervical loop containing the stem cell niche [1]; the three most highly expressed microRNAs in dental epithelium were identified as mmu-miR-24, mmu-miR-200c, and mmu-miR-205, while mmu-miR-199a-3p and mmu-miR-705 were found in dental mesenchyme [2]; and miR-200 was suggested to play an important role in the formation of incisor cervical loop during stem cell–fueled incisor growth [5]. [score:8]
We also found that expression levels of ssc-miR-103 and ssc-miR-107 were slightly lower in Dpm than in other types of teeth, ssc-miR-133 a and ssc-miR-133b expression levels were much higher in Dpm than in other types of teeth, and ssc-miR-127 expression increased in Di, Dc, Dpm, and Dm, in that order. [score:7]
In our study, they were also broadly expressed in all types of teeth at nearly every stage, but the complete lack of expression of ssc-miR-103 and ssc-miR-107 in Dpm during E40 and E50 is worthy of attention, as this could indicate that they exist in bidirectional antagonism with ssc-miR-133a and ssc-miR-133b during premolar morphogenesis in large animal species. [score:6]
Of the five differentially expressed miRNAs that we identified, miR-133 (miR-133a and miR-133b), which is specifically expressed in muscles, is classified as a myomiRNA and is necessary for proper skeletal and cardiac muscle development and function [18]. [score:6]
Combined with the results of our current study, which showed that these two isomiRs are distinctly expressed in Dpm during E60 (late bell stage), we have reason to believe that ssc-miR-133a and ssc-miR-133b may be differentially expressed miRNAs in multiple pathways involved in bicuspid teeth morphogenesis. [score:5]
Both ssc-miR-133a (Fig.   6G1–I4) and ssc-miR-133b (Additional file 6D1–F4) were strongly expressed in the epithelium and mesenchyme of Dpm, in contrast with the other three potentially differentially expressed miRNAs. [score:5]
At E50, miR-133a expression in all four types of teeth stayed nearly the same, but with a lower signal in the incisor (H1–H4). [score:3]
In another study, mmu-miR-133a and mmu-miR-133b were found to be highly expressed at E13.5 in the mouse molar [3]. [score:3]
Expression levels of five miRNAs (ssc-miR-103, ssc-miR-107, ssc-miR-127, ssc-miR-133a, and ssc-miR-133b) were detected by real-time RT-PCR and microarray chip. [score:3]
The present study indicated that these five miRNAs, including ssc-miR-103 and ssc-miR-107, ssc-miR-133a and ssc-miR-133b, and ssc-miR-127, may play key regulatory roles in different types of teeth during different stages and thus may play critical roles in tooth morphogenesis during early development in miniature pigs. [score:3]
We then predicted that the miR-103, and miR-107, miR-133a, and miR-133b isomiRs would be differentially expressed miRNAs. [score:3]
Microarray, real-time RT-PCR, and in situ hybridization experiments revealed that ssc-miR-103 and ssc-miR-107, ssc-miR-133a and ssc-miR-133b, and ssc-miR-127 may play more important roles in Di and Dc, Dpm, and Dm, respectively, during different developmental stages. [score:2]
We also suggested in a previous study that ssc-miR-133 may play key roles in miniature pigs’s tooth development [7]. [score:2]
MiR-133 is one of tissue-specific miRNAs in tooth germ [4], and in Michon’s miRTooth1.0 Database (http://bite-it. [score:1]
For ssc-miR-133a and ssc-miR-133b, we chose the second deciduous premolar to contrast with the three kinds of tissues. [score:1]
This suggests that ssc-miR-133a and ssc-miR-133b may play more important roles in the early morphogenesis of premolar. [score:1]
By clustering analysis, we predicted 11 unique miRNA sequences that belong to mir-103 and mir-107, mir-133a and mir-133b, and mir-127 isomiR families. [score:1]
[1 to 20 of 19 sentences]
17
[+] score: 74
Other miRNAs from this paper: hsa-mir-1-2, hsa-mir-133a-2, hsa-mir-206, hsa-mir-1-1, hsa-mir-133b
Cell culture experiments have shown that miR-1 and miR-206 promote muscle cell differentiation, whereas miR-133 promotes cell proliferation by down-regulation of different target genes [10, 11]. [score:6]
These data are consistent with previous findings that miR-1 and miR-133 are expressed in very small amounts in the developing heart and skeletal muscle of embryonic day 13.5 (E13.5) and E16.5 in mice and their expression increases in neonatal heart and skeletal muscle [10]. [score:5]
Although miR-1, miR-133 and miR-206 are related in terms of expression, they have different targets, biological functions and transcriptional activation [4, 10, 14- 17]. [score:5]
miR-1 and miR-133 are highly expressed both in skeletal and cardiac muscles, whereas miR-206 is specifically expressed only in skeletal muscle [10, 11]. [score:5]
Although miR-1, miR-133a, miR-133b and miR-206 genes have similar expression patterns, they have different targets and biological functions [4, 10]. [score:5]
Restoration of decreased MyoD levels promotes muscle cell differentiation in vitro and increases miR-1, miR-133a, miR-133b and miR-206 gene expression in human foetal myoblastsForced expression of MyoD in non-muscle cells in culture can induce myogenic differentiation, whereas MyoD -null primary myoblasts exhibited reduced differentiation [26, 27]. [score:5]
miR-1, miR-133a, miR-133b and miR-206 are expressed in muscle tissue and induced during muscle cell differentiation, a process that directs myoblasts to differentiate into mature myotubes, which are organized into myofibers. [score:4]
Although miR-1, miR-133a, miR-133b and miR-206 have been extensively studied, there is no information about their expression during the development of human skeletal muscle. [score:4]
Although miR-1, miR-133a, miR-133b and miR-206 are well-studied in muscle, there is no information about their expression and function during human development. [score:4]
Experiments on adult mouse C2C12 and mouse embryonic fibroblasts showed that MyoD binds to regions upstream of miR-1, miR-133a and miR-206 and regulates their expression [12, 14]. [score:4]
There is currently no existing evidence about the expression of miR-1, miR-133a, miR-133b and miR-206 genes during the stages of human muscle development. [score:4]
Ectopic MyoD expression caused an induction of muscle cell differentiation in vitro, accompanied by an increase in the levels of miR-1, miR-133a, miR-133b and miR-206. [score:3]
miR-1, miR-133a, miR-133b and miR-206 levels were low in undifferentiated myoblasts, signifying that they are not highly expressed during the stages before differentiation (Figure 2). [score:3]
miR-1, miR-133a, miR-133b and miR-206 were found to be expressed during muscle cell differentiation both in adult primary human myoblasts and adult mouse cell lines [10- 12]. [score:3]
Restoration of decreased MyoD levels promotes muscle cell differentiation in vitro and increases miR-1, miR-133a, miR-133b and miR-206 gene expression in human foetal myoblasts. [score:3]
miR-1, miR-133a, miR-133b and miR-206 levels are proportional to the stage of muscle development. [score:2]
presented in this study show that miR-1, miR-133a, miR-133b and miR-206 are induced during human muscle cell differentiation and their levels are increased proportionally to the stage of muscle foetal development. [score:2]
We examined the levels of miR-1, miR-133a, miR-133b and miR-206 during the development of human foetus. [score:2]
It can be therefore assumed that miR-1, miR-133a, miR-133b and miR-206 levels correlate with the induced in vitro differentiation of myoblasts to myotubes. [score:1]
These results suggest a mechanism by which MyoD induces in vitro muscle cell differentiation in human foetal cells, accompanied by the induction of miR-1, miR-133a, miR-133b and miR-206 levels in vitro. [score:1]
Of these, the most extensively studied are miR-1, miR-133 and miR-206. [score:1]
The purpose of this study was to investigate the expression of miR-1, miR-133a, miR-133b and miR-206 at different stages of the human developing muscle and during differentiation in myoblast cell lines. [score:1]
In human and mouse, these miRNAs are encoded by three loci, each of which produces a bicistronic transcript, containing one miRNA from the miR-1/206 family and one from the miR-133 family (miR-133a, miR-133b) [10]. [score:1]
[1 to 20 of 23 sentences]
18
[+] score: 69
Details are listed in Supplementary Table 1. Details regarding the selective expression of these miRNAs are given in Supplementary Table 1. Among the group of miRNAs with statistically significant P [adj] < 0.05 and more than 2-fold (log2 value of > 1 or < −1) expression differences, miR-375 was detected in rectal cancer only with a mean expression of 2002 read counts, a log2 fold change of -1.76 and a P [adj] = 1.35E-09, while hsa-miR-133a-3p was detected in colon cancer only with mean expression of 620 read counts, a log2 fold change of -1.25 and a P [adj] = 1.58E-02. [score:9]
Details are listed in Supplementary Table 1. Details regarding the selective expression of these miRNAs are given in Supplementary Table 1. Among the group of miRNAs with statistically significant P [adj] < 0.05 and more than 2-fold (log2 value of > 1 or < −1) expression differences, miR-375 was detected in rectal cancer only with a mean expression of 2002 read counts, a log2 fold change of -1.76 and a P [adj] = 1.35E-09, while hsa-miR-133a-3p was detected in colon cancer only with mean expression of 620 read counts, a log2 fold change of -1.25 and a P [adj] = 1.58E-02. [score:9]
The specificity of hsa-miR-375 downregulation in rectal cancer is clearly visible (P [adj] = 1.35E-09 in rectal cancer but P [adj] = 3.82E-01 in colon cancer) similar to the specific downregulation hsa-miR-133a-3p in colon cancer (P [adj] = 1.58E-02 in colon and P [adj] = 9.05E-01 in rectal cancer). [score:7]
Upregulation of hsa-miR-18a-5p and hsa-miR-21-3p or downregulation of hsa-miR-133a-3p in adenoma and cancer tissues seemed to serve as an index for early screening of colorectal cancer [17]. [score:7]
Ectopic expression of hsa-miR-133a significantly suppressed colorectal cancer cell growth in vitro and in vivo and functions as a tumor suppressor. [score:7]
Cell-cycle analysis revealed that hsa-miR-133a induced a G0/G1-phase arrest, concomitant with the upregulation of the key G1-phase regulator p21, increased p53 protein and induced p21 transcription [42]. [score:5]
Reciprocally, Illumina expression analysis followed by ROC analysis point out an important role for hsa-miR-133a-3p for colon cancer. [score:3]
Hsa-miR-133a was shown to be significantly downregulated in primary colorectal cancer specimens compared with matched adjacent normal tissue [42]. [score:3]
Our current work on freshly isolated tissue further underlines the importance of hsa-miR-133a in CRC, and suggests that decreased hsa-miR-133a expression may serve as a biomarker for colon cancer presence. [score:3]
Previous reports have already detected a role for hsa-miR-133a in CRC: For example, a Turkish group reported that decreased expression of hsa-miR-133a correlated with poor prognosis in CRC patients [40, 41]. [score:3]
The pooled result showed that decreased expression of hsa-miR-133a predicted poor overall survival (OS) in solid cancer patients (HR = 1.73). [score:3]
Our data suggest that dysregulation of hsa-miR-375 and hsa-miR-133a is limited to rectal or colon cancer, respectively, and underline their potential to serve as a marker. [score:2]
Due to a good tissue quality in this study, we were able to determine the selective dysregulation of certain miRNAs in colon cancer (hsa-miR-133a-3p), rectal cancer (hsa-miR-375), or both (hsa-miR-21-5p, -215-5p and -378a). [score:2]
These data are in accordance with our current results, however, it has to be emphasized that because of the limited overall amount of data used in this preliminary meta-analysis, additional studies are required to verify the poor prognosis of decreased hsa-miR-133a in solid tumors [43]. [score:1]
Hsa-miR-133a-3p, in contrast, had the highest sensitivity for detecting colon cancer, with an AUC above 0.89 (95% CI confidence interval: 0.75–1.0). [score:1]
An additional Box plot analysis is shown underneath the heatmaps of hsa-miR-133a-3p in colon cancer vs. [score:1]
Hsa-miR-133a-3p, in contrast, had the highest sensitivity for detecting colon cancer, with an AUC above 0.88 (95% CI 0.75–1.0) (C). [score:1]
Several studies have been published reporting the relationship between CRC and hsa-miR-133a and thus, a meta-analysis has already been performed in regard to the predictive value of hsa-miR-133a in digestive systems neoplasms. [score:1]
Thus, our findings are in accordance with previous results but suggest a specific role of hsa-miR-133a-3p for colon cancer (vs. [score:1]
[1 to 20 of 19 sentences]
19
[+] score: 69
Furthermore, miRNA-1 and miRNA-133 genes are direct transcriptional targets of muscle differentiation regulators including serum response factor, MyoD or Mef2, suggesting a common set of regulatory elements that control cardiac and skeletal muscle development [41, 42]. [score:7]
Interestingly, in a rabbit mo del of diabetes, miRNA-133 was shown to be up-regulated in the heart in association with increased expression of serum response factor, which is known to be a transactivator of miRNA-133 [89]. [score:6]
Liu N. Bezprozvannaya S. Williams A. H. Qi X. Richardson J. A. Bassel-Duby R. Olson E. N. microRNA-133a regulates cardiomyocyte proliferation and suppresses smooth muscle gene expression in the heart Genes Dev. [score:6]
Muscle-specific miRNAs, miRNA-1 and miRNA-133 in addition to their role in cardiac development have been shown to be significantly up-regulated in ischaemic injury in the heart in both rodents and humans [75, 80, 81]. [score:5]
On the contrary, miRNA-133a mutant mice exhibit excessive cardiomyocyte proliferation, attributed, in part, due to elevated expression of SRF and cyclin D2, which are targets for repression by miRNA-133a [43]. [score:5]
A recent study has shown that hyperglycemia augmented expression of miRNA-1 and miRNA-133 in human cardiac progenitor cells associated with suppressed KCNE1 and KCNQ1 and significant reduction in the functional I [Ks] current [91]. [score:5]
McCarthy J. J. Esser K. A. MicroRNA-1 and microRNA-133a expression are decreased during skeletal muscle hypertrophy J. Appl. [score:3]
Xiao J. Luo X. Lin H. Zhang Y. Lu Y. Wang N. Zhang Y. Yang B. Wang Z. MicroRNA miR-133 represses HERG K [+] channel expression contributing to QT prolongation in diabetic hearts J. Biol. [score:3]
The expression of miRNA-1 and miRNA-133a is cardiac and skeletal-muscle specific. [score:3]
Furthermore, addition of miRNA-1 and miRNA-133 antagomirs diminished the inhibitory effect of high glucose on KCNE1 and KCNQ1 and restored the potassium current I [Ks] [92]. [score:3]
In another study, Duisters et al. (2009) [79] has demonstrated that miRNA-133 and miRNA-30, both consistently down regulated in several mo dels of pathological hypertrophy and heart failure, regulate connective tissue growth factor (CTGF), a key molecule involved in fibrosis. [score:3]
Over -expression of miRNA-133a driven by the βMHC promoter in embryonic cardiomyocytes inhibits cardiomyocyte proliferation and causes embryonic lethality characterized by a thinner ventricular wall [43]. [score:3]
These studies indicate that miRNAs, miRNA-208, miRNA-23a, miRNA-24, miRNA-125, miRNA-21, miRNA-129, miRNA-195, miRNA-199, and miRNA-212 are frequently increased in response to cardiac hypertrophy, whereas, miRNA-29, miRNA-1, miRNA-30, miRNA-133, and miRNA-150 expression are often found to be decreased. [score:3]
Recent analysis identified miRNAs expressed in undifferentiated mouse embryonic stem cells and differentiating cardiomyocytes and found increased level of miRNA-1, miRNA-18, miRNA-20, miRNA-23b, miRNA-24, miRNA-26a, miRNA-30c, miRNA-133, miRNA-143, miRNA-182, miRNA-183, miRNA-200a/b, miRNA-292-3p, miRNA-293, miRNA-295 and miRNA-335 in mice [14, 45]. [score:3]
miRNA-133a negatively regulates cardiomyocyte proliferation during heart development. [score:3]
Duisters R. F. Tijsen A. J. Schroen B. Leenders J. J. Lentink V. van der Made I. Herias V. van Leeuwen R. E. Schellings M. W. Barenbrug P. miR-133 and miR-30 regulate connective tissue growth factor: Implications for a role of microRNAs in myocardial matrix remo deling Circ. [score:2]
Yin V. P. Lepilina A. Smith A. Poss K. D. Regulation of zebrafish heart regeneration by miR-133 Dev. [score:2]
Vo N. K. Dalton R. P. Liu N. Olson E. N. Goodman R. H. Affinity purification of microRNA-133a with the cardiac transcription factor, Hand2 Proc. [score:1]
Interestingly, muscle specific miRNA, miRNA-1 showed a moderate negative correlation with fractional shortening, whereas miR-133a was positively related to the thickness of the intraventricular septal wall [54]. [score:1]
The authors further show that miRNA-133 represses ERG (ether-a-go-go-related gene) leading to depressed I [Kr], slow repolarization and QT prolongation associated with arrhythmias in diabetic hearts. [score:1]
He B. Xiao J. Ren A. J. Zhang Y. F. Zhang H. Chen M. Xie B. Gao X. G. Wang Y. W. Role of miR-1 and miR-133a in myocardial ischemic postconditioning J. Biomed. [score:1]
[1 to 20 of 21 sentences]
20
[+] score: 55
Figure 4TINCR expression was inhibited by miR-137/ miR-133a(A) miR-137, miR-133a, and miR-137/ miR-133a cotransfection could suppress the luciferase activity in pmirGLO-TINCR transfected HUH7 cells. [score:7]
These data suggest that TINCR is a direct target of miR-137/ miR-133a, which is suppressed by miR-137/ miR-133a. [score:6]
TINCR expression was inhibited by miR-137 and miR-133a. [score:5]
Although miR-137/ miR-133a cotransfection seemed to show more power than miR-133a in suppressing the expression of TINCR, it displayed less activity than miR-137. [score:5]
TINCR expression was inhibited by miR-137/ miR-133a. [score:5]
Therefore, we could not conclude that miR-137 and miR-133a have synergistic roles in inhibiting TINCR expression in HCC. [score:5]
Moreover, the expression of TINCR protein was inhibited significantly in HUH7 cells by miR-137 and miR-133a, with the TINCR protein level decreased to 58.96 ± 2.52% and 35.03 ± 8.85% (Figure 4C,D, P=0.001 and 0.017), respectively. [score:5]
To investigate whether miR-137 and miR-133a could synergistically inhibit TINCR expression in HCC, the HUH7 cells were cotransfected with miR-137 and miR-133a, and subjected to luciferase assay and TINCR expression detection. [score:4]
We found that miR-137 and miR-133a co-transfection significantly decreased the luciferase activity (40.59 ± 6.37%), TINCR mRNA expression (53.06 ± 10.84%) and TINCR protein level (47.55± 5.08%) in HUH7 cells (Figure 4, P<0.05). [score:3]
showed that miR-137 and miR-133a could significantly reduce the TINCR mRNA expression level by 56.74 ± 4.92% and 50.13 ± 8.64% in HUH7 cells (Figure 4B, P=0.003 and 0.002), respectively. [score:3]
We next detected whether miR-137 and miR-133a could decrease TINCR mRNA expression levels in HCC cells. [score:3]
The luciferase assays demonstrated that miR-137 and miR-133a, rather than miR-126, miR-22, and miR-372 could significantly suppress the luciferase activity in pmirGLO-TINCR (3′-UTR) and miRNAs cotransfected cells (Figure 4). [score:2]
Data showed that miR-137 and miR-133a transfection led to 45.14 ± 7.31% and 35.87 ± 3.24% decrease in luciferase activity in HUH7 cells, respectively (Figure 4A, P=0.002 and 0.006). [score:1]
Based on these data and the previous reports about the candidate miRNAs’ function, six cancer-related or tumor-suppressing miRNAs were chosen for further investigation, including miR-198, miR-126, miR-133a, miR-137, miR-22, and miR-372 [18– 23]. [score:1]
[1 to 20 of 14 sentences]
21
[+] score: 48
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-221, hsa-mir-23b, hsa-mir-27b, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-2, hsa-mir-143, hsa-mir-200c, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-30e, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-10b-1, dre-mir-181b-1, dre-mir-181b-2, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-204-1, dre-mir-181a-1, dre-mir-221, dre-mir-222a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7e, dre-mir-7a-3, dre-mir-10b-2, dre-mir-20a, dre-mir-21-1, dre-mir-21-2, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-26b, dre-mir-27a, dre-mir-27b, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-30e-2, dre-mir-101b, dre-mir-103, dre-mir-128-1, dre-mir-128-2, dre-mir-132-1, dre-mir-132-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-148, dre-mir-181c, dre-mir-200a, dre-mir-200c, dre-mir-203b, dre-mir-204-2, dre-mir-338-1, dre-mir-338-2, dre-mir-454b, hsa-mir-181d, dre-mir-212, dre-mir-181a-2, hsa-mir-551a, hsa-mir-551b, dre-mir-31, dre-mir-722, dre-mir-724, dre-mir-725, dre-mir-735, dre-mir-740, hsa-mir-103b-1, hsa-mir-103b-2, dre-mir-2184, hsa-mir-203b, dre-mir-7146, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, dre-mir-204-3, dre-mir-24b, dre-mir-7133, dre-mir-128-3, dre-mir-7132, dre-mir-338-3
Three of the 107 genes are previously identified targets of the downregulated miRNAs, including mmp14, a known target of miR-133 [64], mmp9 (targeted by miR-204 and miR-338) and timp2 (targeted by miR-24 and miR-204). [score:12]
Conversely, miR-204 was downregulated in zebrafish and bichir, miR-133a was downregulated in bichir, and miR-2184, miR-338 and miR-24 were downregulated in axolotl. [score:10]
S24 Table Zebrafish Ensembl gene identifiers for 107 genes upregulated in three mo dels with predicted miRNA binding sites for miR-2184, miR-204, miR-338, miR-133a and miR-24 and members of the network of commonly up- and downregulated genes with functional interactions to 11 blastema -associated genes. [score:7]
We performed similar analyses to capture potential target genes for the 5 commonly downregulated miRNAs (miR-2184, miR-204, miR-338, miR-133a and miR-24). [score:6]
S23 Table Zebrafish Ensembl gene identifiers for 205 genes upregulated in three mo dels with predicted miRNA binding sites for miR-2184, miR-204, miR-338, miR-133a and miR-24 in all three mo dels. [score:4]
Within this subset of differentially regulated zebrafish miRNAs, we identified 10 miRNAs: miR-21, miR-181c, miR-181b, miR-31, miR-7b, miR-2184, miR-24, miR-133a, miR-338 and miR-204, that showed conserved expression changes with both bichir and axolotl regenerating samples (Table 1). [score:4]
Recently, zebrafish appendage regeneration studies have revealed two differentially regulated miRNAs, miR-133 [27] and miR-203 [28], as essential regulators of caudal fin regeneration. [score:3]
26 +2.14 miR-132 +1.83 (1.71e-3) +0.52 miR-2184 -2.63 (2.54e-5) -2.25 -2.50 miR-222a +1.54 (1.13e-2) +3.24 miR-24 -1.36 (1.9e-2) -1.41 -0.73 miR-454b +1.14 (4.93e-2) +0.14 miR-133a -1.72 (2.67e-3) -4.25 -5.07 miR-101b -2.52 (3.44e-5) -3.43 miR-338 -2.23 (1.90e-4) -2.90 -1.57 miR-26b -1.91 (1.84e-3) -3. 67 miR-204 -2.60 (4.76e-5) -0.57 -2.36 miR-203b -1.77 (3.45e3 -0.21 miR-10b -1.36 (2.90e-2) -1.78 miR-725 -1.29 (3.23e-2) -1.62 Zebrafish + Axolotl Zebrafish SymbolZebrafish log [2] Fold-change (p-value)Axolotl log [2] Fold-change SymbolZebrafish log [2] Fold-change (p-value) miR-27a +1.57 (7.96e-3) +2.15 miR-27b +1.38 (2.44e-2) miR-29b -2.05 (1.28e-2) -0.97 miR-143 +1.31 (2.89e-2) miR-30e +1.18 (4.80e-2) miR-200c -1.85 (1.72e-3) miR-200a -1.74 (3.66e-3) miR-23a -1.35 (2.05e-2) 10. [score:1]
26 +2.14 miR-132 +1.83 (1.71e-3) +0.52 miR-2184 -2.63 (2.54e-5) -2.25 -2.50 miR-222a +1.54 (1.13e-2) +3.24 miR-24 -1.36 (1.9e-2) -1.41 -0.73 miR-454b +1.14 (4.93e-2) +0.14 miR-133a -1.72 (2.67e-3) -4.25 -5.07 miR-101b -2.52 (3.44e-5) -3.43 miR-338 -2.23 (1.90e-4) -2.90 -1.57 miR-26b -1.91 (1.84e-3) -3. 67 miR-204 -2.60 (4.76e-5) -0.57 -2.36 miR-203b -1.77 (3.45e3 -0.21 miR-10b -1.36 (2.90e-2) -1.78 miR-725 -1.29 (3.23e-2) -1.62 Zebrafish + Axolotl Zebrafish SymbolZebrafish log [2] Fold-change (p-value)Axolotl log [2] Fold-change SymbolZebrafish log [2] Fold-change (p-value) miR-27a +1.57 (7.96e-3) +2.15 miR-27b +1.38 (2.44e-2) miR-29b -2.05 (1.28e-2) -0.97 miR-143 +1.31 (2.89e-2) miR-30e +1.18 (4.80e-2) miR-200c -1.85 (1.72e-3) miR-200a -1.74 (3.66e-3) miR-23a -1.35 (2.05e-2) 10. [score:1]
[1 to 20 of 9 sentences]
22
[+] score: 42
In the case of miR-133a and -133b, immortalized myotube transfection anti-miRs resulted in the upregulation of six of ten randomly selected target genes, supported by our transcriptome data. [score:6]
Transcriptome-supported target genes of miR-1/206 (C) and miR-133a/b (D) were downregulated during normal myogenic differentiation but not when it was accompanied by the transfection with corresponding anti-miRs. [score:6]
Myogenic microRNAs miR-1, miR-133a/b and miR-206 (also called MyomiRs, as suggested by [6]) regulate myogenic differentiation and proliferation of myogenic cells by targeting important regulators of myogenesis [7, 8] (for review see [6, 9]). [score:5]
MiR-1 and miR-133a are expressed in both skeletal and cardiac muscles [7, 10], while miR-133b and miR-206 are expressed solely in skeletal muscles [10]. [score:5]
We have then randomly selected 12 and 10 genes predicted to be targeted by miR-1/206 and miR-133a/b respectively and supported by our transcriptome data and tested their expression using qRT-PCR in the cells transfected with corresponding anti-miRs. [score:5]
In addition, miR-133a/b might target genes involved in intracellular transport, cell cycle regulation, DNA damage response, protein phosphorylation and ubiquitination (Figure  5, Additional file 9). [score:4]
These novel qRT-PCR validated targets of miR-133a and -133b include ASAP2 (ArfGAP with SH3 domain, ankyrin repeat and PH domain 2), ARFGAP1 (ADP-ribosylation factor GTPase activating protein 1), ATP1A2 (ATPase, Na+/K+ transporting, alpha 2 polypeptide), C7orf51 (chromosome 7 open reading frame 51), RBM15B (RNA binding motif protein 15B) and TMCC2 (transmembrane and coiled-coil domain family 2) (Figures  4B). [score:3]
Here we confirm that miR-133a/b might target genes involved in these biological functions. [score:3]
Human immortalized myoblasts were differentiated in vitro and then transfected separately with anti-miRs targeting miR-1, miR-133a, miR-133b and miR-206. [score:3]
miR-133a and miR-133b. [score:1]
[27]↑ C2C12 diff [28] ↑ pMyo diff [33]  26 miR-133a↑↑↑enriched in sk. [score:1]
[1 to 20 of 11 sentences]
23
[+] score: 40
Previous reports have demonstrated that β-adrenergic stimulation suppresses microRNA-133 (miR-133) expression in a myocyte enhancer factor 2 (Mef2c) -dependent manner, which results in direct de-repression of PRDM16 expression in brown adipose tissue (BAT) [42– 45]. [score:8]
β-adrenergic stimulation after cold exposure is reported to suppress myocyte enhancer factor 2 (Mef2) expression, which results in remarkable downregulation of microRNA-133 (miR-133) in BAT [42, 44]. [score:8]
The downregulation of mir-133 directly de-repression of PRDM16 expression [43, 45]. [score:7]
EPO upregulates PRDM16 via β-adrenergic receptor/Mef2c/ miR-133 cascade of interscapular brown adipose tissue (iBAT) in high-fat diet induced obese mice. [score:4]
These data suggest that EPO upregulates PRDM16 through EpoR/STAT3 and β-adrenergic receptor/Mef2/miR-133 signaling pathway, which results in the enlargement of iBAT mass. [score:4]
4427975), the expression of microRNA-133a (miR-133a) levels in iBAT were analyzed. [score:3]
Furthermore, the expression of both Mef2c mRNA and miR-133a was significantly decreased in EPO -treated mice under a high-fat diet (Fig 8C and 8D). [score:3]
Effect of erythropoietin (EPO) on the β-adrenergic receptor/Mef2/miR-133 pathway in interscapular BAT. [score:1]
The level of miR-133a was markedly decreased by EPO under both normal chow and high-fat diet conditions (Fig 8D). [score:1]
In summary, we found that: 1) EPO facilitates energy expenditure by increasing classical BAT mass; 2) EPO stimulates EpoR/STAT3 and β-adrenergic receptor/Mef2c/miR-133 pathways, resulting in enhancement of PRDM16 of classical BAT; 3) EPO promoted secretion of classical BAT’s derived-FGF21; and 4) EPO ameliorated obesity and glucose homeostasis in high-fat diet -induced obese mice. [score:1]
[1 to 20 of 10 sentences]
24
[+] score: 38
Since miR-133 has been recently implicated in the regulation of brown adipose differentiation by directly targeting PRDM16, a master transcription factor for brown adipogenesis [53], and there are common Myf5 positive progenitor cells for brown fat and skeletal muscle during embryonic development, miR-133 likely participates in regulating the adipogenic/myogenic fate determination in such progenitor cells [54]. [score:7]
Interestingly, although miR-133 is also upregulated during C2C12 differentiation and muscle regeneration, it promotes myoblast proliferation by inhibiting serum responding factor (SRF) [26]. [score:6]
In contrast, miR-133 inhibits myogenic differentiation and sustains myoblast proliferation by inhibiting SRF, as mentioned above. [score:5]
Interestingly, HuR, an RNA binding protein that stabilizes the mRNAs of several myogenic factors during muscle differentiation, is a target of miR-133. [score:3]
Since SRF is directly involved in the regulation of miR-1/miR-133a transcription [26, 28, 42], miR-133 and SRF form a negative feedback circuit that balances myoblast proliferation and differentiation. [score:3]
Interestingly, miR-133a targets the 3′ UTR of dynamin 2 to repress its protein level. [score:3]
While both the miR-1/miR-206 family and miR-133 family of miRNAs become enriched in myocytes during differentiation, likely via MyoD- and/or myogenin -dependent transcriptional regulation, their effects and mode of action on myogenesis are different. [score:2]
Therefore, there is a delicate and complex regulatory circuit between linc-MD1, miR-133, and HuR, which is critical for appropriate muscle differentiation. [score:2]
Linc-MD1 is required for appropriate muscle differentiation, at least in part because it regulates the levels of Myocyte Enhancer Factor 2C (MEF2C) and Mastermind-like protein 1 (MAML1), via the mechanism of sponging endogenous miR-133 and miR-135 in cytoplasm [165]. [score:2]
Studies using mice lacking both miR-133a-1 and miR-133a-2 (miR-133 d KO) reveal an important role of miR-133a in muscle pathophysiology [101]. [score:1]
Therefore, the central nuclear myopathy observed in miR-133a d KO mice is at least partially due to the elevated protein level of dynamin 2 [101]. [score:1]
Many MyomiRs and muscle-enriched miRNAs, such as miR-1, miR-133, and miR-206, are all increased in the serum of DMD patients and/or in muscle tissues of mdx mice [89– 96]. [score:1]
The miR-1/206 family is transcribed from three different chromosomal loci in the form of bicistronic transcripts with miRNAs in the miR-133 family (miR-133a-1, miR-133a-2, and miR-133b) [28, 33, 36]. [score:1]
In fact, miR-133 was recently found to control the brown adipose fate determination of satellite cells [55]. [score:1]
[1 to 20 of 14 sentences]
25
[+] score: 38
Interestingly, with the nanoantagomiR-133a treatment, a sustained downregulation of miR-133a was obtained from day 1, the earliest time point assessed, which demonstrated accelerated downregulation of miR-133a levels in comparison to untreated cells in osteogenic culture (Fig. 3a). [score:7]
miR-133a expression continuously increased in the standard (no osteogenic supplements) culture group, whereas the osteogenic culture group showed a peak at day 3 but reduced levels at the later timepoints of days 7 and 14. [score:3]
The pattern of miR-133a expression during osteogenesis has not been previously assessed in hMSCs. [score:3]
Taken together, this study has produced an innovative alternative to existing bone graft treatments and represents a promising new concept in tissue engineering through the inhibition of miR-133a in hMSCs for the first time using hydroxyapatite based delivery on porous collagen -based scaffolds. [score:3]
They bind to and inhibit miR-133a (black arrow and X symbol), diminishing the silencing of Runx2 (faded red brake symbol), which results in higher availability of functional levels of Runx2. [score:3]
Changes in ALP activity induced by manipulation of miRNA levels have been assessed with inhibition of miR-133a resulting in a two-fold increase in ALP activity over untreated cells 33. [score:3]
How to cite this article: Castaño, I. M. et al. Next generation bone tissue engineering: non-viral miR-133a inhibition using collagen-nanohydroxyapatite scaffolds rapidly enhances osteogenesis. [score:3]
Hence, we sought to elucidate miR-133a expression levels in hMSCs over the course of 14 days comparing standard and osteogenic culture (Fig. 2). [score:3]
This pointed to a link between suppression of miR-133a and progression of in vitro osteogenesis, in accordance with previous reports for C2C12 mouse myoblasts and primary mouse vascular smooth muscle cells 23 25. [score:3]
qRT-PCR analysis of miR-133a role in hMSC osteogenesis. [score:1]
Complementary to this, treatment with nanoantagomiR-16 as a negative control was introduced to control for specific manipulation of miR-133a levels. [score:1]
In summary, this data highlighted the role of miR-133a in hMSC osteogenic differentiation and the potent ability of the nHA particles to act as non-viral delivery vectors for specific manipulation of intracellular miRNA levels. [score:1]
These 3D platforms significantly decreased the amount of miR-133a available intracellularly in hMSCs to 0.49 ± 0.14 fold after 3 days (Fig. 5a), an effect which was able to trigger a 2.74 ± 1.97 fold change increase in Runx2 mRNA at the same timepoint (Fig. 5b). [score:1]
Briefly, a phosphate solution (12 mM), containing 0.017% (V/V) Darvan 821A dispersant reagent (RT Vandervilt), was added to an equal volume of calcium chloride solution (20 mM) and filtered through a 0.2 μm filter 20. nHA particles (150 μl) were added to a scrambled (scr) or hsa-miR-133a miRIDIAN antagomiR solution (Dharmacon) prepared at a final 20 nM concentration per well, following the method developed in-house 19. [score:1]
qRT-PCR was used to determine levels of miR-133a, Runx2, and OCN after transient transfection using the nanomiR method. [score:1]
Comparison of miR-133a intracellular levels between cells cultured in standard growth medium versus osteogenic media over the course of 14 days demonstrated a natural decrease in miR-133a at later timepoints in osteogenic culture. [score:1]
[1 to 20 of 16 sentences]
26
[+] score: 36
As overexpression of LASP1 is frequent in human cancer and associated with tumor aggressiveness, numerous studies investigated the regulation of LASP1 expression and identified several microRNAs (miRNAs), that target the 3′ untranslated region (UTR) of LASP1 [72, 86]: In CRC cell lines, LASP1 was identified as a direct target of miR-133a and downregulation of miR-133a was observed in 85% of primary tumors and in 100% of liver metastases [86, 87]. [score:14]
Ectopic miR-133a expression impaired cell proliferation and migration, and sufficiently suppressed tumor growth and metastasis in liver and lung in vivo [86], indicating that miR-133a can act as tumor suppressor. [score:7]
Notably miR-133a expression not only reduces the expression of LASP1 but also of key cellular molecules like Rho GDI 1, Rab GDI-β and proteins involved in the MAPK pathway, hence inhibiting phosphorylation of ERK and MEK [86]. [score:7]
In contrast, the subgroup of CRC patients with higher, but still downregulated miR-133a expression developed more often distant metastases, presented advanced Dukes and TNM staging and showed poor survival [88]. [score:6]
In bladder carcinoma, luciferase reporter assays showed reduced luminescence intensity with miR-1, miR-133a, and miR-288 transfectants, suggesting cognate target sites in the 3′UTR of LASP1 for these miRNAs [72]. [score:2]
[1 to 20 of 5 sentences]
27
[+] score: 36
In addition to miR-320a, we found a group miRNAs which are differentially expressed in CAD patients, among which miRNAs, miR-21, miR-30a, miR-126, and miR-133a were reported to be up-regulated and miR-208a and miR-320a to be downregulated in infarcted myocardium 35, 36. [score:9]
Interestingly, the expression miR-1 and miR-133a, miRNAs regulated by SRF 21, were significantly decreased by miR-320a transfection in vivo and in vitro (Fig. 4F and G). [score:4]
Interestingly, recent studies have shown that SRF regulates the expression of miR-1 and miR-133a, miRNAs important for cardiac and skeletal muscles 46, 47. [score:4]
Indeed, the expression of miR-1 and miR-133a were regulated by miR-320a. [score:4]
We speculate miR-1 and miR-133a are indirect targets of miR-320a downstream of SRF. [score:4]
MiR-1, miR-133a and other targets of SRF may contribute to the development of atherosclerosis and CAD. [score:4]
Seven miRNAs (miR-21, miR-30a, miR-126, miR-133a, miR-195, miR-208a and miR-320a) were confirmed to be differentially expressed between CAD and control samples (Fig. 1B). [score:3]
We detected the expressions of miR-1 and miR-133a by real-time PCR in aorta of miR-320a treated mice and endothelium cells treated with miR-320a. [score:3]
Our data reveal links among SP1, miR-320a, SRF and miR-1/miR-133a in endothelial dysfunction in atherosclerosis. [score:1]
[1 to 20 of 9 sentences]
28
[+] score: 35
Among 154 coexpressed miRNAs, five mature miRNAs (dme-miR-1008-5p, dme-miR-133-3p, dme-miR-137-3p, dme-miR-13b-3p, dme-miR-932-5p) were differentially expressed between PD and control groups (p<0.05) (Table 2 and S5 Table). [score:5]
As four of the dysregulated miRNAs in PD flies including dme-miR-133-3p, dme-miR-137-3p, dme-miR-13b-3p and dme-miR-932-5p were brain enriched, we predicted targets of them and then submit to DAVID for Gene Ontology analysis (Fig 6 and S7 Table). [score:4]
Among the dysregulated miRNAs, miR-13b, miR-133 and miR-137 were highly conserved from Drosophila to H. sapiens and their expression was validated by qRT-PCR. [score:4]
Our study using high throughput sequencing of miRNAs identified miR-13b, miR-133, miR-137, miR-932 and miR-1008 consistently upregulated in early stage PD flies. [score:4]
We found that five miRNAs (dme-miR-133-3p, dme-miR-137-3p, dme-miR-13b-3p, dme-miR-932-5p, dme-miR-1008-5p) were upregulated in PD flies. [score:4]
0137432.g005 Fig 5 qRT-PCR were performed to validate the expression of dme-miR-13b-3p, dme-miR-133-3p and dme-miR-137-3p in control and PD flies. [score:3]
qRT-PCR were performed to validate the expression of dme-miR-13b-3p, dme-miR-133-3p and dme-miR-137-3p in control and PD flies. [score:3]
Lgr3 (Relaxin receptor) and AR2 (Galanin receptor) were predicted to be targeted by miR133-3p and miR-13b-3p respectively. [score:3]
Using high throughput small RNA sequenceing technology, we measured miRNA expression profiles of early stage PD flies and identified five dysregulated mature miRNAs (miR-13b, dme-miR-133, dme-miR-137, miR-932 and miR-1008). [score:2]
Among them, miR-13b, miR-133, miR-137 are brain enriched and highly conserved from Drosophila to Homo sapiens. [score:1]
MiR-133a and miR-133b are human orthologs of dme-miR-133 and enriched in human brain. [score:1]
Among them, dme-miR-133-3p, dme-miR-137-3p and dme-miR-13b-3p (the mature sequence both for dme-mir-13b-1 and dme-mir-13b-2) were highly conserved from flies to humans and enriched in nervous system. [score:1]
[1 to 20 of 12 sentences]
29
[+] score: 35
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-205, hsa-mir-214, hsa-mir-221, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-2, hsa-mir-184, hsa-mir-193a, hsa-mir-1-1, hsa-mir-29c, hsa-mir-133b, dre-mir-205, dre-mir-214, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-mir-1-2, dre-mir-1-1, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-107a, dre-mir-122, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-184-1, dre-mir-193a-1, dre-mir-193a-2, dre-mir-202, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-202, hsa-mir-499a, dre-mir-184-2, dre-mir-499, dre-mir-724, dre-mir-725, dre-mir-107b, dre-mir-2189, hsa-mir-499b, dre-mir-29b3
This network visualization shows that (1) all modules contain at least 2 genes that are predicted targets of a deregulated miRNA identified in this study, except the module “Apoptosis and NAFLD”; (2) dre-miR-2189, the only DE miRNA that was downregulated, targets many genes in modules that are predominantly upregulated such as Cell cycle (4 target mRNAs), Apoptosis and Autophagy (19 targets), Epigenetics and Apoptosis/Autophagy (2 targets) and Receptors (4 targets); (3) certain miRNAs have only 1 target gene in the selected modules, including dre-miR-184 (“Oxidative phosphorylation”), dre-miR-430a and dre-miR-430b (“Apoptosis and Autophagy”); (4) while other miRNAs have common target genes in the same modules, i. e., dre-miR-725/dre-miR-724/dre-miR-193a, dre-miR-202, dre-miR-205 and dre-miR-133a that have several common target genes in modules “Oxidative phosphorylation and NAFLD”, “Apoptosis/Autophagy”, “NAFLD” and “Cell cycle”. [score:26]
Renaud L. Harris L. G. Mani S. K. Kasiganesan H. Chou J. C. Baicu C. F. Van Laer A. Akerman A. W. Stroud R. E. Jones J. A. HDACs regulate miR-133a expression in pressure overload -induced cardiac fibrosisCirc. [score:4]
Dre-miR-430a and dre-miR-133a have more targets in common than with any other miR-430 family members. [score:3]
Chen J. -F. Man del E. M. Thomson J. M. Wu Q. Callis T. E. Hammond S. M. Conlon F. L. Wang D. -Z. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiationNat. [score:1]
For the species Danio rerio, miRNAs are labeled “dre-miRNAs”, i. e., dre-miR-133a. [score:1]
[1 to 20 of 5 sentences]
30
[+] score: 32
Full transcriptome analysis of microRNAs dysregulated in FSHD myoblasts and serum from FSHD patients revealed a significant increase in expression of the muscle myomiRs (miR-1, miR-133a/b, miR-206) along with significant dysregulation of several other microRNAs [63, 64] (Table 1). [score:5]
MyomiRs (a term coined by combining myo/muscle and miR/microRNA) was used to originally describe three microRNAs (miR-1, miR-133a/b, and miR-206) that showed enriched expression in heart and skeletal muscles; but has since expanded from its original definition to include several additional microRNAs that are strongly expressed in muscle lineages [31, 32]. [score:5]
Another recent study of serum obtained from DMD boys demonstrated that in addition to the three myomiRs (miR-1, miR-133a/b, and miR-206) being increased in expression, two other muscle-enriched microRNAs, miR-208b and miR-499 were also increased in expression [37] (Table 1). [score:5]
MicroRNA expression profiling of the serum from the dystrophic CXMDJ canine dystrophin -deficient mo del also showed a dysregulation of miR-1, miR-133a, and miR-206 [36]. [score:4]
Compound deletions of miR-1-1/miR-133a-2 and miR-1-2/miR-133a-1, which in mammals are clustered and transcribed at the same genomic locus, revealed a role for these microRNAs as a regulator of smooth muscle gene transcription via suppression of the SRF cofactor myocardin [44]. [score:4]
Follow-up studies in muscles of dystrophin -deficient mdx mice demonstrated that many microRNAs that regulate nNOS signaling, with a particular dysregulation of miR-1, miR-133a/b, and miR-206 (also referred to as “myomiRs”), were significantly altered by the loss of a functional dystrophin protein [29, 30]. [score:3]
MicroRNA-133a mutant mice develop centronuclear myopathy (CNM)-like symptoms due to miR-133a's direct regulation of the dynamin2 (DNM2) transcript [103]. [score:3]
These microRNAs (miR-1, miR-133a/b, and miR-206) were first given the classification as “dystromiRs” as potential diagnostic markers due to their dysregulation in dystrophin -deficient mdx mouse and human DMD patient skeletal muscles [17]. [score:2]
Similar global deletion of both copies of miR-133a (miR-133a-1 and miR-133a-2) revealed an essential role for miR-133a in postnatal cardiac function, normal cardiomyocyte proliferation, and activation of SRF -dependent smooth muscle gene transcription [43]. [score:1]
[1 to 20 of 9 sentences]
31
[+] score: 32
Interestingly, whereas these 4 miRNAs are dramatically up-regulated during myoblasts differentiation [24], they do not have the same expression profile during human muscle development: miR-1 progressively increased during development, miR-133a/miR-133b were highly expressed from 16 weeks of development until birth and miR-206 was expressed at a similar level at all development stages studied (Fig. 1). [score:14]
This suggests that the D4Z4 contraction does not impact myomiR expression, unlike in Duchenne Muscular Dystrophy (DMD) where miR-1, miR-133a, and miR-206 were highly abundant in the serum of DMD patients but down-regulated in muscle [29, 30]. [score:6]
At first view our results could seem to be in contradiction with previous results showing that miR-133a is up-regulated in FSHD2 myoblasts derived from an adult quadriceps [31]. [score:4]
Our results therefore seem to suggest a different function for miR-133 during human muscle development, as opposed to previous studies in animal mo dels, reinforcing the concept of species-specific miRNA signatures during skeletal muscle development. [score:3]
Since we analyzed whole human biopsies isolated after myotube formation, a high expression of miR-133 was not expected. [score:3]
The best-studied myomiRs are the miR-1/miR-206 and miR-133a/miR133-b families. [score:1]
In muscle cell cultures, miR-1 and miR-206 promote muscle cell differentiation, whereas miR-133 promotes myoblast proliferation [25]. [score:1]
[1 to 20 of 7 sentences]
32
[+] score: 31
Sybr Green technology was used to validate: miR-122, which was specifically expressed on present microarrays compared to our previous study [11] and it showed the highest up-regulation; miR-21 and miR-126, which are in addition to muscle-specific miR-1 and miR-133 the most common miRNAs involved in heart diseases; miR-125a/b, which are according to TAM tool involved in myocardial remo delling after MI. [score:7]
Statistical analysis revealed that miR-1, miR-133a/b and miR-98 expression based on qPCR results is in accordance to microarray results, that are down-regulated in infracted compared to corresponding remote myocardium, but statistical significance is dependent of RG used (Table  5). [score:5]
revealed that miR-1, miR-133a/b and miR-98 expression based on qPCR results is in accordance to microarray results, that are down-regulated in infracted compared to corresponding remote myocardium, but statistical significance is dependent of RG used (Table  5). [score:5]
Using; the miR-1 and miR-133 were used to compare present study to our-previous research [33] and confirmed up-regulation of miR-1 in remote myocardium. [score:4]
TaqMan based approach was used to validate miR-98, which was one of the few miRNAs overlapping target prediction and is according to TAM tool involved in hypertrophy; and miR-1 and miR-133a/b, muscle-specific miRNAs. [score:3]
In contrast, expression of miR-1 and miR-133a/b is always in statistical significant correlation to each other not dependent of RG used (data not shown). [score:3]
Free-energy of binding and flanking regions (RNA22, RNAfold) was calculated for 10 up-regulated miRNAs from microarray analysis (miR-122, miR-320a/b/c/d, miR-574-3p/-5p, miR-199a, miR-140, and miR-483), and nine miRNAs deregulated from microarray analysis were used for validation with qPCR (miR -21, miR-122, miR-126, miR-1, miR-133, miR-125a/b, and miR-98). [score:3]
MicroRNAs, miR-1, miR-133a, miR-133b, and miR-98 were tested relatively to RNU6B, RNU48 and miR-26b. [score:1]
[1 to 20 of 8 sentences]
33
[+] score: 30
MEG3 directly bound to and activated miR-133a-3p, thereby inhibiting the expression of SLC39A1 (a direct target of miR-133a-3p), which was regarded as a positive regulator of osteogenic differentiation. [score:10]
Overexpression of MEG3 inhibited osteogenic differentiation of BMSCs, which was markedly reversed by miR-133a-3p knockdown. [score:6]
As indicated, lncRNA linc- MD1 “sponges” miR-133 and miR-135, antagonizing the miRNA -mediated translation suppression Another example of involvement of lncRNA in AS is sno- lncRNA, a class of nuclear-enriched intron-derived lncRNAs transcribed from a critical region of chromosome 15 (15q11-q13). [score:5]
As indicated, lncRNA linc- MD1 “sponges” miR-133 and miR-135, antagonizing the miRNA -mediated translation suppression Another example of involvement of lncRNA in AS is sno- lncRNA, a class of nuclear-enriched intron-derived lncRNAs transcribed from a critical region of chromosome 15 (15q11-q13). [score:5]
Linc- MD1 “sponges” miR-133 and miR-135 to regulate the mRNA translation of mastermind-like-1 (MAML1) and myocyte-specific enhancer factor 2C (MEF2C), respectively (Fig.   2f). [score:4]
[1 to 20 of 5 sentences]
34
[+] score: 30
In particular, a muscle-specific lncRNA, linc-MD1, sponges miR-133 to regulate the expression of MAML1 and MEF2C, transcription factors that activate muscle-specific gene expression. [score:6]
Conversely, overexpression of miR-133 and miR-30c repressed the production of collagens, which was accompanied with a decrease in CTGF expression levels. [score:5]
For instance, it has been reported that miR-1 and miR-133, two most commonly expressed miRNAs in striated muscle, target several ion channel and gap-junction associated genes, such as HCN2, HCN4, KCNJ2, ERG and GJA1 (Cx43) [42]. [score:5]
Both miR-133 and miR-30 were found consistently down-regulated in several mo dels of heart failure and pathological hypertrophy. [score:4]
Duisters R. F. Tijsen A. J. Schroen B. Leenders J. J. Lentink V. van der Made I. Herias V. van Leeuwen R. E. Schellings M. W. Barenbrug P. miR-133 and miR-30 regulate connective tissue growth factor: Implications for a role of microRNAs in myocardial matrix remo deling Circ. [score:2]
Duisters et al. showed that miR-133 and miR-30 were involved in myocardial matrix remo deling through regulating CTGF [33]. [score:2]
However, it was reported in a separated study that a combination of miR-1, miR-133, miR-208, and miR-499 was able to directly induce the cellular reprogramming of fibroblasts into cardiomyocyte-like cells in vitro [18]. [score:2]
It was found that HuR, which is under the repressive control of miR-133, is derepressed due to the sponging activity of linc-MD1 on miR-133. [score:1]
Furthermore, it has been reported that several circulating miRNAs, such as miR-133, miR-1291, miR-663b, miR-328, and miR-134, exhibit clinical impact on human myocardial infarction [47, 48]. [score:1]
Peng L. Chun-guang Q. Bei-fang L. Xue-zhi D. Zi-hao W. Yun-fu L. Yan-ping D. Yang-gui L. Wei-guo L. Tian-yong H. Clinical impact ofcirculating miR-133, miR-1291 and miR-663b in plasma of patients with acute myocardial infarction Diagn. [score:1]
They treated human fibroblasts with four transcriptional factors, GATA-4, Hand2, Tbx5 and Myocardin [20], together with two miRNAs, miR-1 and miR-133. [score:1]
[1 to 20 of 11 sentences]
35
[+] score: 29
they are “Roles of the canonical myomiRs miR-1, -133 and -206 in cell development and disease” [6], “microRNA-133: expression, function and therapeutic potential in muscle diseases and cancer” [7] and “microRNA-1/133a and microRNA-206/133b clusters:Dysregulation and functional roles in human cancers” [5], respectively. [score:9]
miR-133 was downregulated in radioresistant lung cancer cells, but restoring the miR-133b can resensitizes radioresistant lung cancer cells through the inhibition of PKM2 -mediated glycolysis that interfere the sensitivity mechamism. [score:6]
Moreover, the response rate of esophageal squamous cell carcinoma (ESCC) patients to paclitaxel -based chemotherapy was significantly higher in combined miR-133a/b downregulation group [74], miR-133b contributes to arsenic -induced apoptosis in glioma cells [34] and the joint utilization of miR-133b and cetuxima can enhance suppression effect on the growth and invasion of colorectal cancer cells by modulating EGFR [52]. [score:6]
The protein level of EGFR, phosphorylated ERK and AKT, MMP-2 was significantly lowered in PC cell lines after transfection of miR-133a/b, which indicate miR-133a/b suppress EGFR in PC cells whereby inactivating the downstream signals, MMP-2, as an effector of EGFR pathway and mediating cell migration and invasion [49], similar mechanisms may occur in NSCLC [51]and in bladder cancer [50]. [score:3]
In addition, another original intention for this review is that there has been individual review for each myomiRs but miR-133b, these independent reviews about miR-133 [7]/a [10], miR-1 [11– 13], miR-206 [14, 15] and miR-133b which we review in here is so particularly important for us to understand the jointly or independently role of myomiRs acting in human disease. [score:3]
miR-133b and miR-206, two isomers of miR-1 and miR-133a form different clusters located in on chromosomes 6p12.2, 20q13.33 and 18q11.2, respectively. [score:1]
MicroRNA families miR-1 and miR-133, and single miR-206 are collectively known as the muscle-specific miRNAs (“myomiRs”) because of they are highly conserved in the musculatures across species [8]. [score:1]
[1 to 20 of 7 sentences]
36
[+] score: 28
miRNAs miR-133a, miR-138, and miR-491, which specifically inhibited reporter activity, also directly inhibit telomerase activity in cells a few hours after treatment. [score:6]
Finally, miR-133a/b belongs to the group of miRNAs most consistently downregulated in the wide variety of solid tumors [78]– [80]. [score:4]
Our report confirms this finding and demonstrates that at least five additional miRNAs (let-7g*, miR-133a, miR-342-5p, miR-491-5p, and miR-541-3p) directly regulate hTERT. [score:3]
The luciferase activity of the WT reporter construct was significantly inhibited in cells transfected with precursors of let-7g*, miR-133a, miR-138, miR-342, miR-491, and miR-541 relative to cells transfected with the negative control. [score:3]
miR-133a, miR-138, miR-188, miR-342, miR-491, and miR-541 were co -transfected into HeLa cells with a reporter plasmid containing the appropriate 3′UTR and their ability to inhibit reporter activity was analyzed as described for the hTERT 3′UTR. [score:3]
The MSI1 reporter activities were also inhibited by all the miRNAs except miR-133a which has no predicted binding site in the MSI1 3′UTR. [score:3]
The inhibitory effect observed for miR-133a, miR-342, miR-491 and miR-541, was completely or almost completely eliminated when the luciferase assays employed the hTERT 3′UTR constructs with mutated binding sites. [score:2]
The second group contained three miRNAs that are conserved among Bilateria or vertebrates (let-7g*, miR-133a and miR-138) (MIX2). [score:1]
Additional miRNAs for further analysis were selected based on their broad conservation across most bilaterian metazoans (miR-9-5p, miR-133a) or because they have previously been shown to interact with the hTERT 3′UTR (miR-138-5p, let-7g*) [31], [32]. [score:1]
The mixtures of miRNAs as well as scrambled control (SC) were always at a concentration of 60 nM; MIX1 (miR-491, miR-541, and miR-342), MIX2 (let-7g*, miR-133a, and, miR-138), MIX3 (MIX1+MIX2). [score:1]
Further, the transfection of four of these six miRNAs (let-7g*, miR-133a, miR-138, miR-491) also decreased telomerase activity. [score:1]
[1 to 20 of 11 sentences]
37
[+] score: 28
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
A few notable exceptions are miR-499, an miRNA abundantly expressed in the heart (Figure 2A), which is represented by only one read (Table 2), and the miR-133 family, which is preferentially and abundantly expressed in the heart (Figure 2), and represented by only 7 reads (Table 1). [score:5]
The expression patterns of miR-1 and miR-133 largely overlapped in many tissues examined in this study (Figure 2). [score:3]
These two miRNA genes – miR-1 and miR-133 – exist as a cluster and thus are always expressed together in mouse [42]. [score:3]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
Like miR-1, miR-133 is a muscle-specific miRNA (Figure 2) because of its abundant expression in many other muscular tissues such as heart and skeletal muscle [45, 46]. [score:3]
Similarly, we found all members of the miR-15, miR-16, miR-18 and miR-133 families in our sequences, suggesting that all members belonging to these miRNA families are expressed in these three (heart, liver and thymus) tissues. [score:3]
Additionally, miR-1 and miR-133 in the heart, miR-181a and miR-142-3p in the thymus, miR-194 in the liver, and miR-143 in the stomach showed the highest levels of expression. [score:3]
For instance, miR-133 is represented only by 4 clones (two reads each for 133a and 133b) in our sequences, which indicates a 100-fold lower expression level compared with that of miR-1 family, if cloning frequency taken as a measure of expression. [score:2]
The discrepancies between the cloning frequency and small RNA blot results for miRNA-1 and miR-133 could not be attributed to the RNA source because the same RNA samples were used for both experiments (cloning and small RNA blot analysis). [score:1]
We also used approximately a similar amount (activity) of [32]P -labelled probe for detection of miR-1 and miR-133. [score:1]
However, our small RNA blot analysis indicated a different picture as miR-133 was detected as abundantly as miR-1 in the heart (Figure 2). [score:1]
[1 to 20 of 11 sentences]
38
[+] score: 27
MiR-1 and miR-133a have been frequently found to be co -downregulated in several types of cancer. [score:4]
In addition, the targets of miR-1 or miR-133a in prostate adenocarcinoma could be further queried (Figure 3). [score:3]
[40] In addition, expression level of both miR-1 and miR-133a altered in uveal melanoma. [score:3]
From our system, we could find out that co -expression of miR-1 and miR-133a is meaningful. [score:3]
The targets of miR-1 and miR-133a are enriched in cancer-related GO biological processes such as mitotic cell cycle (P=1.13E-08), cell division (P=2.54E-08) and mitotic nuclear division (P=9.74E-08). [score:3]
[39] MiR-133b, which is from the miR-133 family (miR-133a and miR-133b), potentially regulates pathways related to pheochromocytoma–paraganglioma. [score:2]
Of all the pairs formed by miR-1 in prostate adenocarcinoma, miR-133a and miR-1 share the highest functional similarity score that means their functions are closely linked. [score:1]
[41] Accordingly, the synergism between miR-1 and miR-133a revealed by CancerNet is consistent with previous studies. [score:1]
Second, we would like to further detect all the miRNAs that are functionally synergistic with miR-1 or miR-133a in a certain cancer type such as prostate adenocarcinoma. [score:1]
From the result page, we could find that miR-1 and miR-133a are functionally synergistic in five cancer types: sarcoma; stomach adenocarcinoma; pheochromocytoma–paraganglioma; prostate adenocarcinoma; and uveal melanoma. [score:1]
[46] Together with miR-1 and miR-133a, these miRNAs form a functionally synergistic clique in prostate cancer and jointly function in tumorigenesis. [score:1]
For example, the common partners that are synergistic with miR-1 and miR-133a in prostate adenocarcinoma can be visualized by using ‘My miRNA-miRNA Network' module (Figure 4). [score:1]
Among them, it has been revealed that both miR-1 and miR-133a are related to sarcoma, [30] stomach adenocarcinoma 37, 38 and prostate adenocarcinoma. [score:1]
First, we are curious about in which cancer types this miRNA pair exists, so miR-1 and miR-133a were queried simultaneously in CancerNet (Figure 1). [score:1]
32, 35, 36 Therefore, there must be a functional link between miR-1 and miR-133a. [score:1]
[1 to 20 of 15 sentences]
39
[+] score: 27
Chiyomaru T. Enokida H. Tatarano S. Kawahara K. Uchida Y. Nishiyama K. Fujimura L. Kikkawa N. Seki N. Nakagawa M. miR-145 and miR-133a function as tumour suppressors and directly regulate fscn1 expression in bladder cancer Br. [score:7]
Yoshino H. Chiyomaru T. Enokida H. Kawakami K. Tatarano S. Nishiyama K. Nohata N. Seki N. Nakagawa M. The tumour-suppressive function of miR-1 and miR-133a targeting tagln2 in bladder cancer Br. [score:5]
On the other hand, miR-133b [46, 47, 48] and miR-133a [39, 46, 49, 50, 51, 52], shown by us to be strongly affected by HO-1 [30], are also downregulated in bladder cancer. [score:4]
Furthermore, HO-1 is a potent regulator of miRNAs [30], inhibiting among others miR-133a, miR-133b, and miR-1 [30]. [score:4]
Uchida Y. Chiyomaru T. Enokida H. Kawakami K. Tatarano S. Kawahara K. Nishiyama K. Seki N. Nakagawa M. miR-133a induces apoptosis through direct regulation of GSTP1 in bladder cancer cell lines Urol. [score:3]
However, our analysis does not show the changes in the expression of miR-133a. [score:3]
No changes were observed in the case of miR-133a (Figure 3). [score:1]
[1 to 20 of 7 sentences]
40
[+] score: 27
Specifically, the expression of miR-133a, associated with cardiomyogenic differentiation [50], was strongly up-regulated, together with the expression of miR-210 and mir-34a, involved in stem cell survival [51] and negative growth control [52], respectively. [score:8]
In particular, 20 microRNAs were up-regulated >2-fold (among which miR-133a, miR-34a, and miR-210) and 10 were down-regulated (such as miR-155). [score:7]
In this light Epic -treated CStC expressing miR-133, more closely resemble cardiovascular precursors than control CStC, in which miR-133 expression is very low. [score:5]
On the other hand, EpiC -treated cells also up-regulated some markers associated with differentiating cardiomyocyte precursors (i. e. Nkx2.5, Gata4, α–sarcomeric actin, α–myosin heavy chain, miR-133a) and exhibited functional, although not yet operational, properties typical of differentiating cardiomyocytes, suggesting that EpiC treatment may induce cardiomyogenic differentiation at least in a fraction of the CStC population. [score:4]
Interestingly, a recent paper by Anversa and co-workers shows that microRNA typically associated to adult cardiomyocytes (such as miR-1, mir-499 and mir-133) are expressed in cardiovascular precursors, but at lower levels than in adult cardiomyocytes [49]. [score:3]
[1 to 20 of 5 sentences]
41
[+] score: 26
Ectopic expression of miR-133 inhibited cell proliferation, migration and invasion in these cells by targeting EGFR. [score:7]
Moreover, expression of miR-133a was significantly down-regulated in breast cancer cell lines and tissues [34]. [score:6]
MiR-133 has long been recognized as a muscle-specific miRNA which may regulate myoblast differentiation and participate in many myogenic diseases. [score:4]
Recently, miR-133a and miR-133b were shown to be weakly expressed in two hormone-insensitive prostate cancer cell lines, PC3 and DU145 [33]. [score:3]
Overexpression of miR-133a in tumor cells arrested the cell cycle by drastically decreasing the G2/S phase and retarded the newly synthesized DNA. [score:3]
A dual luciferase assay showed that miR-133a bound to the wild-type 3′-UTR of EGFR but not a mutated 3′-UTR, thereby down -regulating the protein expression level. [score:3]
[1 to 20 of 6 sentences]
42
[+] score: 25
Indeed, the marked down-regulation of miR-378a-3p, miR-1 and miR-133a, and the concomitant up-regulation of IGF1R observed in RMS tumours could explain why cancer cells are prohibited from undergoing terminal differentiation despite their commitment to a myogenic pathway. [score:7]
In agreement with the deep-sequencing findings, Q-PCR results confirmed the down-regulation of miR-133a, miR-378a-3p and miR-378a-5p, as well as the over -expression of miR-483-3p and miR-503-5p in the RMS tumour tissues (see Additional file 2: Figure S1A) and cells (see Additional file 2: Figure S1B). [score:6]
Re-activation of skeletal muscle development in RMS seems to be linked to the IGF1R inhibition, as demonstrated by miR-1 and miR-133a [51, 58]. [score:4]
Notably, many relevant myo-miRNAs, such as miR-1, miR-133a and miR-29, were markedly down-regulated in tumour samples in comparison to NSM, as already shown in previous studies carried out by microarray or Q-PCR technologies [21, 37]. [score:4]
MiR-133a, miR-378a-3p, miR-378a-5p, miR-483-3p and miR-503-5p were selected as candidates to validate miRNA expression levels in Q-PCR using the eight deep-sequencing-analysed RMSs, seven additional tumour samples (3 ARMSs and 4 ERMSs) along with four different RMS cell lines (RH4 and RH30 ARMS cell lines; and RD and RD18 ERMS cell lines). [score:3]
An increasing number of miRNAs, such as miR-1, miR-133a, miR-200c, miR-206, miR-214 and miR-9*, have been identified to have a role in RMS [11, 20– 24], as recently summarized by Novak et al. [12]. [score:1]
[1 to 20 of 6 sentences]
43
[+] score: 24
Other miRNAs from this paper: hsa-mir-1-2, hsa-mir-133a-2, hsa-mir-1-1, hsa-mir-133b
We show that a single transfection with miR-1 and miR-133a along with induced expression of GATA4, TBX5, MEF2C, MYOCD, and NKX2-5 activates expression of TNNT2, upregulates a cohort of cardiac-specific genes, and allows generation of intracellular Ca [2+] transients. [score:8]
They argued that miR-1 and miR-133 can directly activate MEF2C expression and thus make its addition dispensable. [score:4]
We determined that a single delivery of miR-1 and miR-133a at the beginning of the process, followed by continuous (2 weeks) induced expression of “GTMMN” significantly enhanced the cardio-inducing effect of the 5 cardiac TF as evidenced by the number of TNNT2 [+] cells detected: 3.8 ± 0.8% versus 0.21 ± 0.04% in “GTMMN” cultures without added microRNAs (p < 0.0001) (Fig. 2A). [score:3]
Based on these findings, in all subsequent experiments we induced cell transdifferentiation using an initial delivery of miR-1 and miR-133a followed by continuous induced expression of “GTMMN”. [score:3]
A single delivery of miR-1 and miR-133a at the beginning of the process was sufficient to induce significant expression of TNNT2. [score:3]
To this end, we tested the capacity of miR-1 and miR-133a to induce HDF transdifferentiation when delivered alone or in combination with “GTMMN”. [score:1]
Finally, Nam et al. performed a large-scale screen determining that GATA4, TBX5, HAND2, and MYOCD along with microRNAs miR-1 and miR-133 were the most effective at inducing transdifferentiation of neonatal or adult human foreskin fibroblasts into iCML cells 12. [score:1]
MicroRNAs were purchased from Thermo Scientific: hsa-miR-1 (MIMAT0000416, C-300585-05-0005), and hsa-miR-133a (MIMAT0000427, C-300600-05-0005). [score:1]
[1 to 20 of 8 sentences]
44
[+] score: 24
Other miRNAs from this paper: hsa-mir-133a-2, hsa-mir-133b
MicroRNA-133 (miRNA-133), an important member in miRNA family, is specifically expressed in adult cardiac and skeletal muscle tissues [6], and its expression has been shown to be down-regulated during cardiac hypertrophy. [score:8]
E) In the presence of perfectly complementary target short RNA (say miRNA-133), reporter-STV-QDs complex is replaced by target RNA eventually. [score:5]
Besides, recent studies indicate that miRNA-133a acts as a tumor suppressor [7], [8], [9], [10]. [score:3]
Good linearity demonstrates the possibility of using this method to accurately detect the decreased expression of miRNA-133 in cardiac hypertrophy and skeletal myoblast proliferation, and even other types of miRNA. [score:3]
In addition, multiple lines of evidence suggest that miRNA-133 acts as a key player in proliferation and differentiation of skeletal myoblasts [5], [6]. [score:1]
In the presence of perfectly complementary synthesized miRNA-133, 4-base “toe-hold” region (purple box) would firstly be hybridized to initiate migration, and reporter-STV-QDs complexes would be totally displaced so that light dots on motifs would disappear in the end [26]. [score:1]
In this study, we performed a quantitative exploration of the relationship between miRNA-133 concentration and the percentage of probe-STV-QDs complex displacement. [score:1]
However, thus far, no details have been reported about the efficiency of single strand-displacement as described by Zhang Z et al. In this study, we demonstrate a linear relationship between miRNA-133 concentration and the percentage of streptavidin and quantum dots binding complex (STV-QDs) displacement in both symmetrical and asymmetrical origami motif. [score:1]
Second, given fixed origami structure concentration, we observed a strong linear relationship between the miRNA-133 concentration and %STV-QDs bound. [score:1]
[1 to 20 of 9 sentences]
45
[+] score: 23
Using 15 down-regulated miRNAs (let-7 g, miR-101, miR-133a, miR-150, miR-15a, miR-16, miR-29b, miR-29c, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, miR-34b and miR-342), known to be associated with cancer, we found 16.5% and 11.0% of our PLS-predicted miRNA-targets, on average, were also predicted as targets for the corresponding miRNAs by TargetScan5.1 and miRanda, respectively (Table 2). [score:10]
We found that ten of the down-regulated miRNAs (miR101, miR26a, miR26b, miR30a, miR30b, miR30d, miR30e, miR34b, miR-let7 g and miRN140) were grouped together in a functional network (Figure 3A) and nine of the down-regulated miRNAs (miR-130a, miR-133a, miR-142, miR-150, miR15a, miR-16, miR-29b, miR-30c and miR-99a) were grouped together in a second network (Figure 3B). [score:7]
With the aid of IPA pathway designer, we found that 27 of the 31 down-regulated miRNAs were linked to one or more mRNA networks and 20 of them (let-7 g, miR-101, miR-126, miR-133a, miR-142-5p, miR-150, miR-15a, miR-26b, miR-28, miR-29b, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, miR-34b, miR-99a, mmu-miR-151, mmu-miR-342 and rno-miR-151) were involved in all of the top 4 networks. [score:4]
C. A sub-network depicting miRNA:mRNA interactions predicted from other cancer -associated miRNAs: let-7 g, miR-101, miR-133a, miR-15a, miR-16, miR-29b and miR-29c. [score:1]
Networks were also developed for the seven miRNAs (let-7 g, miR-101, miR-133a, miR-15a, miR-16, miR-29b and miR-29c) closely related to cancer and their associated mRNAs (Figure 2C). [score:1]
[1 to 20 of 5 sentences]
46
[+] score: 22
Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42]. [score:8]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
Bladder cancer-specific expression of TRAIL genes was achieved by employing MREs of miR-1, miR-133 and miR-218. [score:3]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
Application of MREs of miR-1, miR-133 and miR-218 restrained exogenous gene expression within bladder cancer cells. [score:3]
Ad-TRAIL-MRE-1-133-218 contained MREs of miR-1, miR-133 and miR-218 that were inserted immediately following TRAIL gene. [score:1]
AACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACC AAGCACAAACAAACACC AAGCACAA-3′), which contained two copies of miR-1 MREs, two copies of miR-133 MREs and two copies of miR-218 MREs. [score:1]
[1 to 20 of 7 sentences]
47
[+] score: 22
Particularly, T3 treatment was found to be effective in countering the injury-related downregulation of miR-29c, miR-30c, and miR-133a resulting in the reduction of profibrogenic matrix metalloproteinase (MMP)-2 and CTGF expressions (Nicolini et al., 2015). [score:6]
In other works, the downregulation of miRNAs was also observed in cardiac disease mo dels including reductions in miR-133, miR-590, miR-30, miR155, miR-22, miR-29, and miR101 (van Rooij et al., 2008; Duisters et al., 2009; Shan et al., 2009; Pan et al., 2012; Kishore et al., 2013; Hong et al., 2016). [score:6]
Downregulation of miR-133 and miR-590 contributes to nicotine -induced atrial remo delling in canines. [score:4]
Examples include a noted reduction in HSC-produced collagens in response to the overexpression of miR-133a (Roderburg et al., 2013). [score:3]
miR-133 and miR-30 regulate connective tissue growth factor: implications for a role of microRNAs in myocardial matrix remo deling. [score:2]
miR-133a mediates TGF-beta -dependent derepression of collagen synthesis in hepatic stellate cells during liver fibrosis. [score:1]
[1 to 20 of 6 sentences]
48
[+] score: 22
This causes increased expression of miR-133 target genes such as cx43 (Yin et al., 2012; Banerji et al., 2016). [score:5]
Although rescue using Tg(hsp70:miR-133sp [pd48]) supports our mo del that cx43 is functionally activated downstream of Esco2 and Smc3, because miR-133 has multiple targets (Yin et al., 2008), we cannot rule out the possibility that a different target gene is responsible for the rescue. [score:5]
In this line, heat shock induces expression of the miR-133 target sequence fused to EGFP and therefore sequesters the miR-133. [score:5]
Knocking down miR-133 (which targets cx43 for degradation) via the ‘sponge’ transgene (three miR-133 binding sites) results in the increase of cx43 levels (Yin et al., 2012). [score:4]
Regulation of zebrafish heart regeneration by miR-133. [score:2]
Fgf -dependent depletion of microRNA-133 promotes appendage regeneration in zebrafish. [score:1]
[1 to 20 of 6 sentences]
49
[+] score: 21
MiR-133a, tumor suppressor miRNA downregulated in several types of cancer including HNSCC, was also downregulated in our set of HPV -positive tumors [50– 52]. [score:9]
The most upregulated miRNAs in HPV -positive tonsillar tumors were miR-125b-2-3p and miR-147b while the most downregulated were miR-133a-3p and miR-575. [score:7]
Lan D Zhang X He R Tang R Li P He Q MiR-133a is downregulated in non-small cell lung cancer: a study of clinical significanceEur J Med Res. [score:3]
MiR-133a has been shown to be involved in inhibition of cell proliferation, migration and invasion in HNSCC cell lines [53, 54]. [score:2]
[1 to 20 of 4 sentences]
50
[+] score: 20
Developmental stage of O. felineus miRNAs AdultNoEggs & Adult+Eggs & Metacercaria let-7, miR-1, miR-2(a,b,c,d,e), miR-36, miR-71(a,b), miR-124, miR-125, miR-133, miR-190 AdultNoEggs & Adult+Eggs bantam, miR-281(miR-46 family) AdultNoEggs & Metacercaria miR-7 Metacercaria miR-10Candidate sequences for novel miRNAs (S4 Table) were selected from reads without matches to miRBase sequences after mapping them to the C. sinensis genome and processing the genomic fragments encompassing the resultant hits through the secondary structure filter (see ). [score:2]
Developmental stage of O. felineus miRNAs AdultNoEggs & Adult+Eggs & Metacercaria let-7, miR-1, miR-2(a,b,c,d,e), miR-36, miR-71(a,b), miR-124, miR-125, miR-133, miR-190 AdultNoEggs & Adult+Eggs bantam, miR-281(miR-46 family) AdultNoEggs & Metacercaria miR-7 Metacercaria miR-10 Candidate sequences for novel miRNAs (S4 Table) were selected from reads without matches to miRBase sequences after mapping them to the C. sinensis genome and processing the genomic fragments encompassing the resultant hits through the secondary structure filter (see ). [score:2]
It should be mentioned that miR-133 were not annotated for S. mansoni in previous reports [36, 37, 71]. [score:1]
We found that miR-133 is located near a gene encoding one of several Mind bomb proteins in all five genomes. [score:1]
Genes around miR-1 and miR-133 in the flatworms genomes. [score:1]
In previous papers, the combination of the miR-1/miR-133 miRNA genes was described also as a miRNA cluster for many animal species (see data in miRBase) [74] including flatworms [45]. [score:1]
Hence, we referred to the regions as “cluster-like regions miR-1/miR-133”. [score:1]
Upon analysis by Jin et al. [45], the genomic regions with matches for miR-1 and miR-133 were designated as orthologous miRNA gene clusters in three flatworms, namely the cestodes E. granulosus, E. multilocularis and H. microstoma. [score:1]
The alignments of some miRNAs (two miR-71/ miR-2 clusters, miR-1, miR-133, and miR-190) with sequences of these miRNAs orthologs (obtained from S. mediterranea, G. salaris, S. mansoni, S. japonicum, E. granulosus, E. multilocularis, H. microstoma and T. solium genomes) were performed using the program CLUSTALW [68]; miRNA sequences of T. solium, namely miR-1, miR-2b, miR-2c, miR-71, miR-133, miR-190, were obtained by homology search of these miRNAs in T. solium genome (http://www. [score:1]
Hence, due to the distance between the sites corresponding to the miRNAs in flatworms, as well as the capability to predict protein-coding genes in between these sites, we suggest referring to these regions as “cluster-like regions miR-1/miR-133”, which form a putative synteny group. [score:1]
The ortholog search for the miRNAs of the three opisthorchiids yielded 19 conserved miRNAs belonging to 13 families (bantam, let-7, miR-1, miR-2, mir-7, miR-10, miR-36, miR-46, miR-71, miR-124, miR-125, miR-133, and miR-190) (Fig 2A, Table 1, S3 Table). [score:1]
Cluster-like regions miR-1/miR-133. [score:1]
The UNAFold secondary structure prediction for the precursors of the conserved miRNAs showed no canonical structure for the putative S. mansoni pre-miR-133, which could possibly explain the delay in sma-miR-133 annotation (S6 Table). [score:1]
We then explored the genomic context beyond the cluster-like regions miR-1/miR-133 in the five flatworm species using information from the C. sinensis database (http://fluke. [score:1]
miR-1, miR-133 and putative miR-1, miR-133. [score:1]
Gene prediction in region between miR-1 and miR-133. [score:1]
miRNA Genomes C. sinensis S. mansoni S. japonicum bantam + + + let-7 + + + miR-1 + + − miR-2a + + + miR-2b + + + miR-2c + + + miR-2d + + + miR-2e + + + miR-7 + + + miR-10 + + + miR-36a + + + miR-36b + − − miR-281 + + + miR-71a + + + miR-71b + + + miR-124 + + + miR-125 − + + miR-133 + + + miR-190 + + + Mapped miRNA is designated by plus; unmapped—by minus. [score:1]
Genomic organization scheme of cluster-like regions miR-1/miR-133 in five flatworms. [score:1]
[1 to 20 of 18 sentences]
51
[+] score: 20
miRNA Tissue type Mode of action Reference miR-491-5p Cervical cancerUnknown, inhibits hTERT Zhao et al., 2015 miR-1182 Gastric cancerBinds the ORF of hTERT mRNA, preventing translation Zhang et al., 2015 miR-1207-5p Gastric cancerRepresses hTERT in normal tissues Chen et al., 2014 miR-1266 Gastric cancerRepresses hTERT in normal tissues Chen et al., 2014 miR-138 Anaplastic thyroid carcinoma (ATC)Interaction with 3′UTR of hTERT to reduce protein expression Mitomo et al., 2008 let-7g Pulmonary fibrosisInteraction with 3′UTR of hTERT to reduce expression Singh et al., 2010 miR-133a Jurkat cellsInteraction with 3′UTR of hTERT to reduce expression Hrdličková et al., 2014 miR-342 Jurkat cellsInteraction with the 3′UTR of hTERT to reduce expression Hrdličková et al., 2014 miR-541 Jurkat cellsInteraction with the 3′UTR of hTERT to reduce expression Hrdličková et al., 2014 Non-coding RNAs can also target transcription factors involved in the control of hTERT. [score:17]
Other microRNAs that directly regulate TERT include let-7g, miR-133a, - 342, and - 541 (Hrdličková et al., 2014). [score:3]
[1 to 20 of 2 sentences]
52
[+] score: 20
ceRNAs are important regulators in cell cycle control and tumor suppression (e. g. PTEN-P1 blocking miR-19b and miR-20a from binding to PTEN tumor suppressor [17]– [19]), modulating self-regulation in hepatocellular carcinoma (HCC) (HULC lncRNA acts as ceRNA of the protein coding gene PRKACB that induces activation of CREB which in turn is involved in upregulation of HULC [20]) as well as in developmental stages (e. g. linc-MD1 blocking miR-133 from binding to transcription factors involved in myogenic differentiation [21] and H19 blocking the miRNA let-7 to affect muscle differentiation in vitro [22]). [score:11]
lncRNA acting as ceRNA Competing protein coding gene Shared miRNA ceRNA score Reference HULC (Highly Upregulated in Liver Cancer) PRKACB miR-372 0.026 (p-value = 0.001) [20] lincRNA MD1 MAML1 miR-133 0.022 (p-value = 0.02) [21] H19 Targets of hsa-let-7 Let-7 - [22] Linc-RoR (Regulator of Reprogramming) SOX2 and NANOG miR-145 0.038 (p-value = 0.008) [36] PTCSC3 Targets of miR-574-5p in thyroid cancer cell line miR-574-5p - [37] Users can browse for ceRNA candidates for a protein coding gene (by gene symbol, gene id or refseq accession) and/or lncRNA gene (by gene name, ensemble gene id or ensemble transcript id) and/or miRNA name. [score:9]
[1 to 20 of 2 sentences]
53
[+] score: 20
Irrespective of wild type or mutated or null p53, after radiation treatment, miR-302a and miR-302c up-regulated, and miR-518f down-regulated in colon cancer cells, whereas after SN38 treatment up-regulated miRNAs were miR-133a, miR-155, miR-204, miR-22, miR-512-3p, miR-517a, miR-517c and miR-708 in the all colon cancer cell lines. [score:10]
Irrespective of p53 status, after radiation miR-302a and miR-302c up-regulated, and miR-518f down-regulated in the all cell lines, whereas after SN38 treatment up-regulated miRNAs were miR-133a, miR-155-3p, miR-204, miR-22, miR-512-3p, miR-517a, miR-517c and miR-708 in the all cell lines (Figure 3, Table 1a). [score:10]
[1 to 20 of 2 sentences]
54
[+] score: 20
Nine of these microRNAs have elevated expression in the tail base, including miR-1, miR-133a, miR-133b, and miR-206, which have been shown to play key roles in regulating skeletal muscle differentiation and function [37, 44– 48]. [score:4]
Eleven microRNAs were differentially expressed between the regenerating tail tip and base during maximum outgrowth (25 days post autotomy), including miR-133a, miR-133b, and miR-206, which have been reported to regulate regeneration and stem cell proliferation in other mo del systems. [score:4]
For example, the small RNA miR-133 is downregulated during heart regeneration and in the tip of the regenerating tail in zebrafish [49]. [score:4]
Highly expressed microRNAs in the skeletal muscle include the muscle specific microRNAs, or myomiRs, miR-1 and miR-133a [37, 38], along with miR-26, miR-125b, and miR-27 all of which are involved in myogenesis and skeletal muscle repair (Table  2) [39– 42]. [score:3]
As shown in Fig.   3 miR-1a, miR-1b, miR-133a and miR-206 show increased expression in the proximal portion of the regenerating tail, while miR-184 and miR-2188 display an opposite pattern. [score:3]
In zebrafish, the miR-133 precursor family regulates regeneration in the tail fin [21], the heart [49], and spinal cord [22]. [score:2]
[1 to 20 of 6 sentences]
55
[+] score: 20
It is noteworthy that miR-1, miR-133, miR-30, miR-208a, miR-208b, mir-499, miR-23a, miR-9 and miR-199a have previously been shown to be functionally involved in cardiovascular diseases such as heart failure and hypertrophy [40], [41], [42], [43], [44], and have been proposed as therapeutic- or disease-related drug targets [45], [46]. [score:7]
In particular, miR-1 and miR-133, which are abundant microRNAs in the heart, are implicated in cardiovascular development and myocardial lineage differentiation, as they tightly control expression of muscle genes and repress ”unwanted” gene transcription through a network of target transcription factors [36], [37], [38], [39]. [score:6]
In particular, several microRNAs that are preferentially expressed in different types of muscles (e. g. miR-1, miR-133, and the myomiRs miR-208, miR-208b and miR-499) play a pivotal role in maintenance of cardiac function [17], [18], and the ablation of microRNAs-RISC machinery can have dramatic effects on cardiac development [19], [20], [21]. [score:4]
An assessment of the degree of conservation for structure-specific distribution of microRNAs in Wistar rat, Beagle dog and cynomolgus monkey (see for relative enrichment analysis), revealed high enrichment of nine microRNAs cardiac valves (miR-let7c, mIR-125b, miR-127, mir-199a-3p, miR204, miR-320, miR-99b, miR-328 and miR-744) (Figure 3A) and seven microRNAs in the myocardium (miR-1, mir-133a, miR-133b, miR-208b, miR-30e, miR-499-5p, miR-30e*) (Figure 3A). [score:1]
Conserved microRNA signatures were identified in valves (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744) and in ventricular-specific regions of the myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*) of Wistar rat, Beagle dog and cynomolgus monkey. [score:1]
Furthermore, ventricular microRNAs (miR-1, miR-133, miR-208b and miR-499) have been found to be increased in the plasma of patients with myocardial infarction, and might represent a useful alternative to the classical cardiac troponin (cTnI) biomarker [57], [58], [59], [60], [61]. [score:1]
[1 to 20 of 6 sentences]
56
[+] score: 19
While another group has reported that miR-133a is highly expressed in the sheep heart [17], they did not, as has been done in the present study, specify expression of the different isoforms. [score:5]
Four myocardial-enriched miRNAs, miR-1, miR-133, miR-499 and miR-208, were confirmed to be highly expressed in ovine heart tissue. [score:3]
For the first time we report that not only are the four cardiac-enriched miR-1, miR-133, miR-499 and miR-208 highly expressed in sheep LV, but also provide information on their isomiRs. [score:3]
In this study, NGS detected high counts of oar-miR-133, while array yielded high expression of hsa-/mmu-/rno-miR-133a-3p, which is one nt longer at the 5′ end compared to oar-miR-133. [score:2]
Oar-miR-133 was the main form in sheep heart, while hsa-/mmu-/rno-miR-133a-3p and-5p and hsa-/mmu-/rno-miR-133b were detected at much lower counts. [score:1]
Oar-miR-133 is currently the only cardiac specific miRNA listed in miRBase 21. [score:1]
Of these, oar-miRNA-133 is the only one presently recorded in miRBase (v21). [score:1]
MiR-1, miR-133, miR-499 and miR-208 are highly enriched myocardial miRNAs 27, 28 and are highly conserved across multiple species including human [29], mouse [30] rat [31] and porcine [32]. [score:1]
Cardiac-enriched miR-1-3p, miR-133a-3p, miR-133b-3p, miR-208b-3p and miR-499-3p were screened. [score:1]
The most abundant cardiac-specific miRNA-133 in the sheep heart was oar-miR-133 which has one nt different from hsa-/mmu-/rno-miR-133a-3p (previously hsa-miRNA-133). [score:1]
[1 to 20 of 10 sentences]
57
[+] score: 19
The three related miRNAs, miR-133a-1, miR-133a-2, and miR-133b, are co-transcribed with miR-1-2 and miR-1-1. Accumulated data from several groups has identified several genes as downstream targets of miR-133, such as NFATc4, calcineurin, Rac, and Cdc42, among others. [score:3]
MicroRNA-1 and microRNA-133a expression are decreased during skeletal muscle hypertrophy. [score:3]
The four miRNAs found repeatedly were miR-1, miR-133a, miR-208b, and miR-499, and these were selected for further processing. [score:1]
Actually, miRNAs abundant in the myocardium, known as myomiRs, such as miR-1, miR-133, miR-208a/b, and miR-499a, were reported many times as being strongly increased in the serum or plasma of patients with AMI (36). [score:1]
miR-133 was initially identified by microarray analysis as a muscle-specific miRNA (108). [score:1]
Three frequently found miRNAs were chosen for subgroup analysis: miR-1, miR-133, and miR-499. [score:1]
Later, in July 2016, Yuan et al. concentrated on miR-133a in a study enrolling a total of 332 individuals of which 222 presented chest pain symptoms suggestive of AMI (52). [score:1]
This study also provided some clues about prognostic information from miR-133a. [score:1]
Furthermore, it has brought to the forefront a specific set of miRNAs, namely, miR-1; miR-133; miR-208a/b, and miR-499a. [score:1]
Referring to the aforementioned multiple studies on miRNAs as AMI biomarker, a set of candidates has emerged: the four muscle-specific miRNAs, the myomiRs miR-1, miR-133, miR-208a/b, and miR-499a. [score:1]
Actually, this trans-differentiation has been achieved by Jayawardena et al. in 2015 using the exact same set of miRNAs that stood out in the above-mentioned studies on miRNAs as AMI biomarkers, namely miR-1, miR-133a, miR-208a, and miR-499a (104). [score:1]
The pooled sensitivity and specificity for miRNA-1 resulting from 9 studies were 0.70 and 0.81, for miR-133 resulting from 5 studies were 0.82 and 0.87 and for miR-499 resulting from 10 studies were 0.80 and 0.89. [score:1]
For each miRNA, the obtained values were as listed: (i) miR-1: 0.63 and 0.76 (ii) miR-133a: 0.89 and 0.87 (iii) miR-208b: 0.78 and 0.88, and (iv) miR-499: 0.88 and 0.87. [score:1]
However, among the miRNAs set, miR-133a and miR-499 look especially suitable for use as diagnostic biomarkers of AMI. [score:1]
Briefly, miR-133 is thought to be involved in cardiomyocyte proliferations. [score:1]
[1 to 20 of 15 sentences]
58
[+] score: 19
This pattern included the two created target sites for ssc-miR-34a and ssc-miR-34c, both predicted by TargetScan and PACMIT in SLA-1 (Figure 3 A); the disrupted target site for ssc-miR-148a in HSPA1A predicted by PACMIT and TargetSpy (Figure 3 B); the ssc-miR-133b (TargetScan and PACMIT), ssc-miR-133a-3p (TargetScan) and ssc-miR-323 (TargetSpy) created target sites in RNF5 (Figure 3 C); and the disrupted site for ssc-miR-2320 predicted by TargetSpy in SLA-1 (Figure 3D). [score:19]
[1 to 20 of 1 sentences]
59
[+] score: 19
miR-133 and miR-208 converge around structures pertaining to myocardial tissue albeit with opposite effects on cardiac hypertrophy, as miR-133 yields both anti-fibrotic and anti-hypertrophic effects [14], whereas overexpression of miR-208 is pro-hypertrophic [15]. [score:3]
The other miR that showed a significantly elevated gradient, miR-133, is thought to be protective and anti-fibrotic in smooth muscle [14] and is elevated in patients with coronary atherosclerosis [22]. [score:1]
Based on these data circulating levels miR-92a and miR-133 could serve as surrogate markers for early coronary atherosclerosis. [score:1]
A significant inverse correlation between percent change in CBF and transcoronary gradient of miR-133 (r [2] = 0.11, p = 0.03; Figure 2) indicated that the gradient reduced with improving endothelial function. [score:1]
While Fichtlscherer et al. initially showed significant reductions in most absolute and relative endothelial-related miR levels (miR-17, miR-92a, and miR-126) with increases in myocardial and inflammatory-related miRs (miR-133, miR-145, and miR-155) in patients with stable CHD [22], De Rosa et al. showed little to no change in miR levels with stable CAD, but marked increases and decreases in some miR levels with ACS [23]. [score:1]
Transcoronary gradient of miR-133 versus the percent change in microcirculatory blood flow showing an inverse correlation (r [2] = 0.11, p = 0.03). [score:1]
Multivariate analysis (Spearman's correlation) revealed a few moderate correlations between certain miRs aortic (Table 3), coronary sinus (Table 4), and transcoronary gradients and surrogate markers for CHD found in serum blood draws such as hemoglobin, leukocytes, platelets, total cholesterol, LDL-cholesterol, triglycerides, hs-CRP, and vitamin B12 (miR-21 (p = 0.02), miR-92a (p = 0.02), miR-126 (p = 0.02), miR-133 (p = 0.03), and miR-155 (p = 0.003); (Table 5). [score:1]
Thus, it is likely that the positive transcoronary gradient of endothelial and anti-fibrotic miRs (miR-92a and miR-133), which may potentially become negative during ACS [23], could reflect a protective retention during ACS. [score:1]
Mean aortic miR levels were significantly reduced, after normalization using the delta-CP method, in miR-92a (p = 0.02), miR-126 (p = 0.03), miR-133 (p = 0.03), and miR-155 (p = 0.003). [score:1]
It may be speculated that in patients with myocardial injury and continual low-grade ischemia, there is a compensatory anti-fibrotic and myocardial protective process ongoing as the overabundance of miR-133 spills into the coronary circulation; alternatively miR-133 may serve a signal to the anti-ischemic process [40] secondary to the impaired tissue perfusion. [score:1]
In summary, we report significantly elevated transcoronary gradients of miR-92a and miR-133 in patients without early coronary atherosclerosis and demonstrated coronary microvascular endothelial dysfunction. [score:1]
On the other hand, in patients with active acute coronary syndromes (ACS) miR-133a and miR-208a (myocardial miRs), miR-126 and miR-92a (endothelial), and miR-155 (inflammatory cell) levels were all found to be increased in aortic blood samples (miR-133a, miR-208a also increased in coronary sinus samples), with increased transcoronary gradient of miR-133 and trends toward negative gradients of miR-92a and miR-126 [23]. [score:1]
Similar to our results, a study in patients with ACS has found a positive transcoronary gradient of miR-133 [18]. [score:1]
In particular, an absolute and relative decrease in endothelial-related miRs (miR-17, miR-92a, miR-126), smooth muscle miR (miR-145), and inflammatory cell -mediated miR (miR-155) with a converse increase in miR-133a and miR-208a (myocardial -associated miRs) was observed in patients with stable CHD [22]. [score:1]
0109650.g002 Figure 2Transcoronary gradient of miR-133 versus the percent change in microcirculatory blood flow showing an inverse correlation (r [2] = 0.11, p = 0.03). [score:1]
A recent study uncovered an association between a series of miRs specific to the myocardium (miR-133a, miR-208a), the vasculature (miR-17, miR-92a, miR-126), inflammatory cells (miR-145), smooth muscle and (miR-155) and the presence of stable CHD [22]. [score:1]
Our current study, furthermore, demonstrates a correlation between transcoronary gradient of miR-133 and the percent change in CBF with implications for myocardial ischemia dynamics. [score:1]
[1 to 20 of 17 sentences]
60
[+] score: 19
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
In another study, four miRNAs (miR-1, miR-27a, miR-133a, and miR-206) were differentially expressed during skeletal muscle development of Nile tilapia (Yan et al. 2012a). [score:4]
Huang et al. (2011) have reported a negative feedback circuit in which insulin-like growth factor 1 (IGF-1) promotes miR-133 expression, which, in turn, represses IGF-1 receptor (IGF-1R) affecting skeletal myogenesis. [score:3]
Similarly, by comparing skeletal muscle of different stages (larvae, 1-, and 2-year old) of common carp (Cyprinus carpio), Yan et al. (2012) reported an increase in miR-1, miR-21, miR-133a-3p, and miR-206 expression with age. [score:3]
Given that miR-133 has regulatory role in skeletal muscle proliferation (Chen et al. 2006), the repression of miR-133 during heart regeneration may indicate reprogramming. [score:2]
In gain- and loss-of-function experiments, Yin et al. (2008) showed that the regulated depletion of miR-133 resulted in effective fin regeneration. [score:2]
Further evaluation of miR-133 in this study indicated that miR-133 had several targets, among them mps1 and cx43, which are essential for the regeneration process. [score:1]
Soares et al. (2009) let-7i, miR-15b, miR-17a-3p, miR-21, miR-92b, miR-128, miR-133, miR-146a,b, miR-150, miR-194a, miR-204, miR-210-3p, miR-301a, miR-429, miR-730, miR-733, miR-738, Zebrafish Microarray, northern blot, qRT-PCR, ISH Yin, Lepilina, et al. (2012) Muscle miR-1, miR-21, miR-133a,b,c, miR-203b Zebrafish NGS, qRT–PCR ? [score:1]
This has been shown in 5′-isomiRs of miR-101 (Llorens et al. 2013) and miR-133a (Humphreys et al. 2012). [score:1]
In zebrafish embryos, miR-1 and miR-133 were implicated in shaping sarcomeric actin organization (Mishima et al. 2009). [score:1]
Xia et al. (2011) miR-1, miR-101a, miR-130b,c, miR-133a, miR-221, and miR-499 Zebrafish NGS, qRT–PCR ? [score:1]
[1 to 20 of 10 sentences]
61
[+] score: 18
Down-regulation of miR-133a is associated with increased bronchial smooth muscle contraction in patients with asthma [41]. [score:4]
qRT-PCR confirmed similar fold differences in expression to microarray results for the two miRNAs, miR-34c and miR-133a tested (Additional file 1: Figure S3). [score:3]
Class comparison identified five miRNAs (miR-34c, miR-34b, miR-149, miR-133a and miR-133b) that were significantly differentially expressed between mild and moderate emphysema (p < 0.01, Additional file 1: Figure S2 & Table  2). [score:3]
Other candidate emphysema severity miRNAs identified in this study – miR-34b, miR-133a/b and miR-149 – have been previously implicated in the pathogenesis of lung diseases. [score:3]
Five miRNAs (miR-34c, miR-34b, miR-149, miR-133a and miR-133b) were significantly down-regulated in lung from patients with moderate compared to mild emphysema as defined by gas transfer (p < 0.01). [score:3]
In this cohort, expression of three of these miRNAs (miR-149, miR-133a and miR-133b) correlated with functional measurement of emphysema severity (KCO, Figure  1). [score:1]
MiRNAs associated with asthma include miR-21, miR-126, miR-133a, miR-148a/b and miR-152[11]. [score:1]
[1 to 20 of 7 sentences]
62
[+] score: 18
It has been reported that miR-326 and miR-133a reduce adriamycin resistance of human hepatoma HepG2 cells through downregulating ABCC1 expression [18]; miR-1291 could modulate cellular drug disposition through direct targeting ABCC1 in PANC-1 cells [19]. [score:9]
miR-133a and miR-326 have also been reported to induce drug accumulation by suppressing MRP1 expression in HepG2 cells [18]. [score:5]
We analyzed breast cancer dataset from TCGA and found that the levels of miR-326, miR-133a and miR-1291 were all very low, previously reported miRNAs targeting MRP1 in other cancers [18, 19] and their expression levels showed no markedly significant difference in tumors compared to their normal adjacent tissues in breast cancer (Supplementary Figure S1). [score:4]
[1 to 20 of 3 sentences]
63
[+] score: 18
Specifically, miRNA-seq analysis identified 5 up-regulated cardiac specific miRNAs (miR-29a, miR-29b, miR-133, miR-193 and miR-223) previously identified for being regulators of cardiac development and homeostasis (Fig.   2). [score:6]
Targetscan software [50] predicted about 51 common targets for miR-29a, miR-29b, miR-133, miR-193 and miR-223 (Fig.   2C, middle panel). [score:5]
Table  2, miR-29a, miR-29b, miR-133, miR-193 and miR-223 were selected among the 10 most up-regulated miRNAs associated to the aging heart 43, 47– 49. [score:4]
Venn diagrams depicting the distribution of miR-133, miR-193, miR-29a/b, miR-223 predicted targets (middle panel). [score:3]
[1 to 20 of 4 sentences]
64
[+] score: 18
Given the requisite role of miR-1 and miR-133 in cell survival and development, it is convincing to believe that the redundant transcription complexes directing miR-1 and miR-133a expression are elegantly developed to ensure cells to survive under evolutionary pressure. [score:5]
MiR-1 and miR-133 are muscle-enriched microRNAs, and they have been demonstrated as critical factors involved in both cardiac and skeletal muscle development and diseases [20- 25]. [score:4]
Given the importance of miR-1 and miR-133 in various cardiomyopathy developments, such as cardiac hypertrophy, understanding the precise control of SRF -mediated microRNA gene regulation in the heart will provide an additional perspective for the treatment of SRF dysfunction -mediated cardiomyopathy. [score:3]
Given that individual microRNAs regulate potentially dozens of genes, functions of miR-1 and miR-133 in cardiac muscle and skeletal muscle can be quite distinct [23, 26, 27]. [score:2]
Both miR-1 and miR-133 also participate in cardiomyopathy development including cardiac hypertrophy [25, 28], cardiac fibrosis [29, 30], and arrhythmia [30, 31]. [score:2]
While the deficiency of miR-133a leads to cardiomyocyte proliferation and VSD. [score:1]
For skeletal muscle, miR-1 facilitates myogenesis, and miR-133 promotes myoblast proliferation [20]. [score:1]
[1 to 20 of 7 sentences]
65
[+] score: 18
In hypertrophic adult rat VCMs, down-regulation of miR-1/miR-133 levels promotes automaticity via up-regulation of HCN2/HCN4, but this defect can be reversed by forced expression of miR-1/miR-133 [10], [11]. [score:9]
This observation was consistent with the upregulation of NKX2.5 seen in EBs differentiated from LV-miR-1-transduced, but not LV-miR-133-transduced or WT, H7 hESCs that Srivastava and colleagues reported [8]. [score:4]
Indeed, miR-133 has been implicated in early cardiac differentiation of murine and human ESCs by repressing the non-mesoderm lineages, rather than by directly promoting cardiogenesis per se [8]. [score:2]
The profiles of miR-1, let-7a, let-7b, miR-26b, miR-30b, miR-125a, miR-126, miR-133a, miR-143, and miR-499 in hE/F/A-VCM were confirmed by qPCR (Figure 1B). [score:1]
Consistently, miR-133 exerts no effects on Ca [2+]-handling and contractile proteins when cardiovascular progenitors of later stages were transduced. [score:1]
Interestingly, miR-133a has two sequences located within the same introns where miR1-1 and -1-2 are found [45]. [score:1]
[1 to 20 of 6 sentences]
66
[+] score: 18
The expressions of 17 of the dysregulated miRNAs (miR-145*, -145, -214, -4770, -378*, -99a, -193b, -100, -125b, -3195, -30e*, -9, -125a-5p, let-7b, miR-24-1*, -1979, and -768-3p) were significantly lower in both colon and rectal cancers compared with normal tissues, but of the remaining 5, miR-133a and miR-140-3p were found significantly downregulated (P<0.05) only in rectal cancers, and miR-27b*, miR-30a, and miR-29b-2* were significantly downregulated only in colon cancers (P<0.05; Figure 1). [score:9]
For example, downregulation of miRNAs, such as miR-145, -195, -383 and miR-378, was found in CRC relative to their expressions in normal mucosa, whereas, some upregulated miRNAs, like miR-96, -135b, miR-493 and miR-133a, have also been found associated with CRC [19], [20]. [score:9]
[1 to 20 of 2 sentences]
67
[+] score: 17
In conclusion, our results confirm that miR-124-3p, miR-133a-3p, miR-133b, miR-138-5p, miR-150-5p, miR-378a-3p and miR-422a expression levels were downregulated in CRC and that miR-138-5p and miR-422a were found to potentially interact with hTERT. [score:6]
The results revealed that the expression level in CRC tissues of miR-124-3p, miR-133a-3p, miR-133b, miR-138-5p, miR-150-5p, miR-378a-3p and miR-422a (P<0.0001 for all) were statistically significantly downregulated when compared with the corresponding normal tissues. [score:5]
Our results suggested that hTERT protein showed a significant negative correlation with the expression levels of miR-138-5p (r=−0.362, P=0.001) and miR422a (−0.306, P=0.005), while the correlation between hTERT and other miRNAs (miR-124-3p, miR-133a-3p, miR-133b, miR-150-5p and miR-378a-3p) revealed no significant negative correlation (Table IV). [score:3]
The expression levels of the 7 miRNAs (miR-124-3p, miR-133a-3p, miR-133b, miR-138-5p, miR-150-5p and miR-378a-3p, miR-422a) were found to be significantly decreased in 84 pairs of the CRC tissues when compared with their matched corresponding normal tissues using RT-qPCR. [score:2]
Eight miRNAs with the potential to interact with hTERT were predicted: miR-29c-3p, miR-124-3p, miR-133a-3p, miR-133b, miR-138-5p, miR-150-5p, miR-378a-3p and miR-422a, respectively. [score:1]
[1 to 20 of 5 sentences]
68
[+] score: 17
Although miR-133a was downregulated in serum-derived exosomes of CL -treated mice, miR-133a expression was neither significantly altered in brown adipocyte-derived exosomes nor in any of the mouse mo dels analysed (Fig. 2b,c). [score:6]
Although miR-92a and miR-133a expression levels showed considerable inter-individual variation in cohort 1, their expression was not different between males and females and was not related to any other parameter such as age, or BMI. [score:5]
Human serum miR-92a and miR-133a expression levels were not normally distributed in cohort 1 according to Shapiro–Wilk test (P=0.000 and P=0.001, respectively). [score:3]
Such correlation was absent for miR-133a (Supplementary Fig. 3b). [score:1]
478511, Life Technologies) was used to quantify miR-133a located on chromosome 18: 19405659-19405746 [−] with the sequence 3′- UUUGGUCCCCUUCAACCAGCUG -5′. [score:1]
For the analysis of human exosomal miRNAs, we focused on miR-92a and miR-133a, whereas miR-34c* was not detectable in human serum exosomes. [score:1]
[1 to 20 of 6 sentences]
69
[+] score: 17
miR-29 is the best characterized direct regulator of extracelluar matrix protein synthesis [29], while miR-30 and miR-133a target connective tissue growth factor (CTGF) [30]. [score:3]
The remaining 14 (miR-18a-5p, miR-146a-5p, miR-30d-5p, miR-17-5p, miR-200a-3p, miR-19b-3p, miR-21-5p, miR-193-5p, miR-10b-5p, miR-15a-5p, miR-192-5p, miR-296-5p, miR-29a-3p, and miR-133a-3p) were upregulated in HCM patients with T [1] < 470 ms compared with those with T [1] ≥ 470 ms, and 11 (except miR-192-5p, miR-296-5p and miR-133a-3p) were significantly inversely correlated with postcontrast T [1] values. [score:3]
Among 14 miRNAs identified in our study, the roles of miR-21, miR-29a, miR-30d and miR-133a in myocardial fibrosis are well established. [score:1]
Interestingly, miR-29a-3p and miR-133a-3p, known to be involved in myocardial fibrosis, were not significantly different among 3 groups (Fig.   1). [score:1]
miR-29a-3p and miR-133a-3p were also significantly increased in patients with diffuse fibrosis (Fig.   2). [score:1]
T [1] ≥ 470 ms Table 3Correlations between circulating miRNAs measured by miRNA array and T [1] times miRNA r P value miR-18a-5p −0.521 0.082 miR-146a-5p −0.658 0.020 miR-30d-5p −0.599 0.040 miR-17-5p −0.458 0.134 miR-200a-3p −0.436 0.157 miR-19b-3p −0.434 0.159 miR-21-5p −0.443 0.150 miR-193a-5p −0.553 0.062 miR-10b-5p −0.548 0.065 miR-15a-5p −0.475 0.119 miR-192-5p −0.512 0.089 miR-296-5p −0.557 0.060 miR-96-5p −0.579 0.049 miR-373-3p −0.517 0.085 Spearman correlation coefficients were computed to assess the correlations between postcontrast T1 times and miRNAs We validated the expression of the above 14 miRNAs plus miR-29a-3p and miR-133a-3p in all 55 HCM patients by. [score:1]
We then validated the above 14 miRNAs plus miR-29a-3p and miR-133a-3p (known to be involved in fibrosis) using in 55 HCM patients. [score:1]
T [1] ≥ 470 ms Table 3Correlations between circulating miRNAs measured by miRNA array and T [1] times miRNA r P value miR-18a-5p −0.521 0.082 miR-146a-5p −0.658 0.020 miR-30d-5p −0.599 0.040 miR-17-5p −0.458 0.134 miR-200a-3p −0.436 0.157 miR-19b-3p −0.434 0.159 miR-21-5p −0.443 0.150 miR-193a-5p −0.553 0.062 miR-10b-5p −0.548 0.065 miR-15a-5p −0.475 0.119 miR-192-5p −0.512 0.089 miR-296-5p −0.557 0.060 miR-96-5p −0.579 0.049 miR-373-3p −0.517 0.085 Spearman correlation coefficients were computed to assess the correlations between postcontrast T1 times and miRNAs Validation of by real-time PCRWe validated the expression of the above 14 miRNAs plus miR-29a-3p and miR-133a-3p in all 55 HCM patients by. [score:1]
Individual ROCs of 14 miRNAs including miR-29a-3p and miR-133-3p showed moderate predictive values for the presence of diffuse myocardial fibrosis (AUC ranges from 0.663 to 0.742, Table  4). [score:1]
We included miR-29a-3p and miR-133a-3p for further validation since their roles in myocardial fibrosis are well established. [score:1]
11 miRNAs were significantly and inversely correlated with postcontrast T [1] times, but the inverse correlations with T [1] times were not significant for miR-192-5p (r = 0.246, p = 0.071), miR-296-5p (r = 0.239, p = 0.079) and miR-133a-3p (r = −0.208, P = 0.127) (Fig.   3). [score:1]
miR-21 and miR-29a are fibroblast-enriched, while miR-133a is cardiomyocyte-enriched. [score:1]
Several miRNAs, particularly, miR-21, miR-29, miR-30, and miR-133, have been implicated in the control of myocardial fibrosis [15, 16]. [score:1]
[1 to 20 of 13 sentences]
70
[+] score: 17
Pahl et al. examined the miRNA expression pattern in human AAA tissues and revealed that miR-133a, miR-133b and miR-331-3p were significantly downregulated in AAAs [24]. [score:6]
Dysregulated expression of miR-133a and miR-133b has been found in some types of cancer [44]. [score:4]
However, the biological effects of changed expressions of miR-133a/b and miR-331-3p in vascular tissues are currently unclear. [score:3]
Moreover, miR-133a has been shown to have critical roles in modulating cardiac development and maintaining skeletal muscle homeostasis [45, 46]. [score:2]
Similar to miR-133, miR-331-3p is also involved in regulating growth of certain cancer cells [47]. [score:2]
[1 to 20 of 5 sentences]
71
[+] score: 17
The role of as a suppressor of cardiomyocyte proliferation is supported by both double -knockout (miR-133a-1/miR-133a-2) mouse studies showing that is essential for regulating cardiomyocyte proliferation and normal heart development [17], and zebrafish studies, where was significantly reduced in regenerative/proliferative cardiac tissue [7]. [score:6]
A comparison of in regenerated versus un-injured zebrafish myocardium identified miR-133 as being specifically down-regulated during the period of cardiomyocyte proliferation and regeneration [7]. [score:4]
There are three genomic loci producing miR-133 with only-1 and-2 being expressed in the heart [15]. [score:3]
miR-133 is one of the most abundant cardiac miRNA [16] and is essential for normal cardiogenesis in mice, through regulation of serum response factor (SRF) [GenBank: NM_020493] dependent transcription [17]. [score:2]
miR-133a. [score:1]
Microarray miR-133 miR-590 miR-199a Cardiomyocyte Proliferation From late gestation, the majority of human cardiomyocytes cease proliferating due to either an absence of karyokinesis and/or cytokinesis [1– 3]. [score:1]
[1 to 20 of 6 sentences]
72
[+] score: 17
The PP2A regulatory subunit B56α is another target of miR-1 and miR-133, and the inhibition of PP2A’s function via miR-1 overexpression induces hyperphosphorylation and activation of RyR2, which subsequently promotes Ca [2+] release from the SR, leading to abnormal Ca [2+] cycling, and increased cardiac arrhythmogenesis [67, 68]. [score:8]
Shan H. Zhang Y. Cai B. Chen X. Fan Y. Yang L. Chen X. Liang H. Zhang Y. Song X. Upregulation of microRNA-1 and microRNA-133 contributes to arsenic -induced cardiac electrical remo deling Int. [score:4]
Kuwabara Y. Ono K. Horie T. Nishi H. Nagao K. Kinoshita M. Watanabe S. Baba O. Kojima Y. Shizuta S. Increased microRNA-1 and microRNA-133a levels in serum of patients with cardiovascular disease indicate myocardial damage Circ. [score:3]
In addition, circulating miR-1, miR-133a, miR-328, miR-499, and miR-208b levels also increase in patients who present with acute myocardial infarction [82, 83]. [score:1]
During the I/R injury, plasma levels of miR-1, miR-133a, miR-499-5p, and cardiac-specific miR-208b rapidly increase in both rodent mo dels and in human patients presenting with ST-elevation myocardial infarction (STEMI). [score:1]
[1 to 20 of 5 sentences]
73
[+] score: 17
miR-133a/miR-133b have a dual role being essential for myogenesis and suppressing osteogenesis through targeting of runt-related transcription factor 2 (RUNX2), and are downregulated in BMP2 -induced osteogenesis of premyoblast mesenchymal cells [44]. [score:8]
Among these, miR-126/miR-126*, miR-142-3p, miR-150, miR-223, miR-486-5p and members of the miR-1/miR-133a, miR-144/miR-451, miR-195/miR-497 and miR-206/miR-133b clusters were found to be downregulated in osteosarcoma cell lines. [score:4]
The highly downregulated miRNAs presented in Table 1 were miR-126/miR-126*, miR-142-3p, miR-150, miR-223, miR-363, miR-486-5p and members of the miR-1/miR-133a, miR-206/miR-133b, miR-451/miR-144 and miR-497/miR-195 clusters. [score:4]
RUNX2 does not seem to be reduced at the mRNA level by miR-133 in our study, which may be explained by the high amplification frequency (68%) of RUNX2 observed in our cell lines, as previously reported [46]. [score:1]
[1 to 20 of 4 sentences]
74
[+] score: 17
Wang DS, Zhang HQ, Zhang B et al (2016) miR-133 inhibits pituitary tumor cell migration and invasion via down -regulating FOXC1 expression. [score:6]
Wang et al. reported that downregulated miR-133 promoted the expression of FOXC1 and promoted migration, invasion, and epithelial-to-mesenchymal transition in PAs [21]. [score:6]
Therefore, we present the bold assumption that decreased miR-133 in PA facilitates FOXC1 expression and results in the high expression of CCND1, which in turn promote G [1]–S phase transition in PAs. [score:5]
[1 to 20 of 3 sentences]
75
[+] score: 17
The present findings revealed that miRNA-21 and miRNA-208 are highly expressed in patients with AF, though there were no significant differences between AF and SR patients regarding miRNA-133 and miRNA-590 expressions. [score:5]
Nat Med 212: 358- 367; 16 Shan H, Zhang Y, Lu Y, Zhang Y, Pan Z et al. (2009) Downregulation of miR-133 and miR-590 contributes to nicotine induced atrial remo deling in canines. [score:4]
One study revealed that down-regulation of miRNA-133 promotes AF through a mechanism favoring atrial structural remo deling [16]. [score:4]
They concluded that the pro-fibrotic response to nicotine in the canine atrium is critically dependent upon down-regulation of the anti-fibrotic miRNA-133 and miRNA-590. [score:4]
[1 to 20 of 4 sentences]
76
[+] score: 17
Calin et al. reported that one of the most upregulated miRNAs is miR-106a, which is consistently reported in six studies, and the five most downregulated miRNAs are miR-30a-3p, miR-139, miR-145, miR-125a, and miR-133a, which are consistently reported and differentially expressed in four studies; these miRNAs may actually be of clinical use as diagnostic/prognostic biomarkers or therapeutic targets [3]. [score:11]
Twelve miRNAs were upexpressed, while 84 miRNAs (has-miR-137, hsa-miR-133a, hsa-miR-143, hsa-miR-363, hsa-miR-4770, hsa-miR-490-5p, hsa-miR-133b, and so on) were deexpressed in tumors compared with those in normal tissues (adjusted P = 0.05) (Figure  1). [score:4]
Preliminary results showed that the level of miR874-3p, miR-422a, miR-490-3p, miR-374b, miR-133a, let-7 g, miR-378, miR-9*, and miR-378i were all deregulated in the CRC tissues compared with the neighboring noncancerous colorectal tissues (all P < 0.05) (Figure  2). [score:1]
After a series of selection processes independently with enter method and conditional forward method in conditional logistic regression, we found nine statistically significant miRNAs in enter method, namely, miR574-3p, miR422a, miR490-3p, miR-374b, miR-133a, let7g, miR-378*, miR-9* and miR-378i. [score:1]
[1 to 20 of 4 sentences]
77
[+] score: 16
Other miRNAs from this paper: hsa-mir-133a-2, hsa-mir-206
Indeed, we demonstrated that DNMT3B depletion was able to significantly up-regulate the expression of miR-133a and miR-206, two well-established myomiRs essential in promoting muscle cell differentiation (Figure 5E). [score:6]
Compared to mocked control cells, si-DNMT3B samples showed of a marked expression of MYOD1, followed by Myogenin and myomiR (miR-133a and miR-206) up-regulation. [score:5]
D. Expression of myogenic miRNAs, miR-133a and miR-206, by Q-PCR experiments in RD cells transfected with DNMT3B or NC siRNAs for 72 h. Expression of each miRNA was normalized to U6 levels and plotted as fold change relative to si-NC samples. [score:5]
[1 to 20 of 3 sentences]
78
[+] score: 16
Regarding the other microRNAs found altered in this study, we confirmed that miR-133a is down-regulated in the myocardium of patients with AS 37 38. [score:4]
Relative expression of miR-133a and miR-19b in myocardium [Panel (a)] and serum [Panel (b)] from patients with aortic stenosis (AS) and control subjects. [score:3]
The expression of miR-133a and miR-19b is decreased in myocardium and serum from aortic stenosis patients. [score:3]
From the 7 microRNAs assessed, miR-133a, miR-21 and miR-19b were detected both in myocardial and serum samples from AS patients and control subjects, whereas the expression of miR-29b, miR-1, miR-208a and miR-499-5p was under the limit of detection in serum samples from AS patients and control subjects. [score:3]
The expression of miR-133a and miR-19b was reduced in the myocardial and serum samples from AS patients compared to control subjects (Fig. 1). [score:2]
No associations were found between myocardial and serum levels of miR-133a. [score:1]
[1 to 20 of 6 sentences]
79
[+] score: 16
Based on the TargetScan, miRanda, and Diana microT computational algorithms, we determined that miR-1, miR-133a, and miR-206 might target a combined site in the G6PD 3′-UTR gene sequence. [score:5]
Levels of these miR-1 targets in miRNPs are also shown following miR-133a/206 transfection. [score:3]
However, neither miR-133a nor miR-206 expression differed in HR-HPV+ cervical cancer cells compared to control cells (Figure 4A). [score:2]
RIP-Chip revealed that G6PD mRNA was recruited to the miRNPs to the greatest degree following transfection with miR-1. (A-a) Enrichment in AGO-miRNPs after miR-1 transfection, n = 3161; (A-b) Enrichment in AGO-miRNPs after miR-133a transfection, n = 3336; (A-c) Enrichment in AGO-miRNPs after miR-206 transfection, n = 5958. [score:1]
Co-immunoprecipitation (co-IP) revealed that transfected miR-1, miR-133a, and miR-206 were specifically incorporated into miRNPs in both Hela (Figure 1A) and Siha cells (Figure 1B). [score:1]
By contrast, G6PD mRNA was not enriched in miRNPs following transfection with either miR-133a or miR-206 (Figure 2A–2B and Figure 2A–2C). [score:1]
After 24 hours, cells were transfected with 25 nM “Pre-miRNA” (Ambion) for has-miR-1, has-miR-133a, has-miR-206, or Negative Control (NC, Ambion, Austin, TX, sense sequence AGUACUGCUUACGAUACGG) using RNAiMAX (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions [13]. [score:1]
Among the many miRNAs identified, miR-1, miR-133a, and miR-206, each of which were predicted by all three software programs, were chosen for further validation. [score:1]
Figure 2RIP-Chip revealed that G6PD mRNA was recruited to the miRNPs to the greatest degree following transfection with miR-1. (A-a) Enrichment in AGO-miRNPs after miR-1 transfection, n = 3161; (A-b) Enrichment in AGO-miRNPs after miR-133a transfection, n = 3336; (A-c) Enrichment in AGO-miRNPs after miR-206 transfection, n = 5958. [score:1]
[1 to 20 of 9 sentences]
80
[+] score: 16
miR-1, miR-133a, and miR-30c-2* were found to be downregulated in TAA when compared with control specimens (p < 0.05), whereas for downregulation of miR-30c-2* in AAA compared to control there were no changes in the expression of miR-1, -133a, and -29a in AAA (Figure 1). [score:7]
Decreases in miR-133a expression level, as we confirmed here, likely play a role in matrix degradation and remo deling as MMP-2 and -9 were shown to be targets of miR-29a in vitro [18]. [score:5]
Duisters R. F. Tijsen A. J. Schroen B. Leenders J. J. Lentink V. van der Made I. Herias V. van Leeuwen R. E. Schellings M. W. Barenbrug P. MiR-133 and miR-30 regulate connective tissue growth factor implications for a role of microRNAs in myocardial matrix remo delingCirc. [score:2]
The real-time PCR assay was performed using the 7500 Fast Real-Time PCR System (Applied Biosystems) for miRNAs (miR-1, miR-21, miR-29a, miR-30c-2*, miR-124a, miR-126, miR-133a miR-145, miR-146a, miR-155, miR-204, miR-221, miR-222 miR-331-3p, and miR-486-5p); and RNU44, internal control to analyze specific miRNA expression following the 2−ΔΔ Ct method. [score:2]
[1 to 20 of 4 sentences]
81
[+] score: 16
Several genes involved in cardiomyocyte cell cycle control, such as Cyclin D1, Cyclin D2 and Cyclin B1, were found to be significantly upregulated in miR-133a deficient hearts as well as several smooth muscle genes, such as smooth muscle-Actin, Transgelins, Calponin I and the myogenic transcription factor SRF. [score:4]
In a further attempt to dissect the effects of miR-133a on cardiomyocyte proliferation, Liu et al. [68] overexpressed miR-133a under the control of the cardiac β- myosin heavy chain promoter. [score:3]
While miR-133a-1 and miR-133a-2 seemed to have redundant functions and did not cause obvious cardiac abnormalities when deleted individually, targeted deletion of both miRNAs resulted in cardiac malformations and embryonic or postnatal lethality. [score:3]
miR-133a double knockout mice displayed two distinct lethal phenotypes: (1) either large ventricular sept defects (VSDs), dilated right ventricles, and atria leading to death shortly after birth; or (2) survival into adulthood, no VSDs but dilated cardiomyopathy (DCM), cardiac fibrosis and heart failure. [score:2]
Surprisingly, miR-133a deficiency did not lead to hypertrophic cardiomyopathy, as one would have been expected from previous studies, in which miR-133a-antagomir treatment induced cardiac hypertrophy in mice [67]. [score:1]
miR-1, together with another heart-specific miRNA (miR-133a), is known to be transcribed by a duplicated bicistronic genetic locus (miR-1-1/miR133a-2 and miR-1-2/miR133a-1) sharing identical sequences of the mature miRNAs. [score:1]
They extensively characterized genetically engineered mice deficient for either miR-133a-1, or miR-133a-2, or both as well as mice overexpressing miR-133a [66]. [score:1]
Jiang et al. added one more piece to the puzzle represented by the miR-1/miR-133a cluster. [score:1]
[1 to 20 of 8 sentences]
82
[+] score: 16
miR-133a is muscle specific and is proposed as a novel therapeutic target in cardiovascular disease [273]. [score:5]
In contrast, depleting or blocking of miR-133a by its antagonist resulted in upregulation of these proteins [279]. [score:4]
To assess its role in survival of MSCs, miR-133a was made to express in these cells. [score:3]
Duisters RF, Tijsen AJ, Schroen B, Leenders JJ, Lentink V, van der Made I, et al. miR-133 and miR-30 regulate connective tissue growth factor: implications for a role of microRNAs in myocardial matrix remo deling. [score:2]
Patients suffering from MI have been shown to have lower levels of miR-133a [274, 275]. [score:1]
miR-133a is known to play an important role in terminating embryonic cardiomyocyte proliferation [276], attenuating fibrosis [277] and promoting cardiac remo delling [278]. [score:1]
[1 to 20 of 6 sentences]
83
[+] score: 16
For example, miR-133a is a muscle-enriched miRNA that inhibits proliferation of progenitor cells and promotes myogenesis by targeting SRF (McCarthy & Esser, 2007). [score:5]
Besides the miR-1 and miR133a that we found highly expressed in all the stages (McCarthy & Esser, 2007), miR-26a also showed abundant expression (Huang, Sherman & Lempicki, 2008; Huang et al., 2008). [score:5]
Previous study performed by Qin et al. indicated that most of the highly expressed miRNAs in porcine skeletal muscle such as miR-1 and miR-133 will be more functional. [score:3]
Of these miRNAs, six (miR-133a-1/-2-3p, let-7a-1/-2-5p, miR-27b-3p, miR-26a-5p, miR-1-3p, and let-7f-1/-2-5p) were shared by all five stages and were closely related to myogenesis, cell growth, myocyte proliferation, and cell apoptosis. [score:1]
1504/fig-3 Figure 3Furthermore, nine representative DE miRNAs (miR-133a-5p, miR-181a-1-3p, miR-499-5p, miR-320-3p, miR-24-1-3p, miR-214-3p, let-7g-5p, miR-23a-3p, and miR-10b-3p) were chosen for validation by the stem–loop real time (RT)-PCR -based method using three independent samples. [score:1]
1504/fig-3 Figure 3 Furthermore, nine representative DE miRNAs (miR-133a-5p, miR-181a-1-3p, miR-499-5p, miR-320-3p, miR-24-1-3p, miR-214-3p, let-7g-5p, miR-23a-3p, and miR-10b-3p) were chosen for validation by the stem–loop real time (RT)-PCR -based method using three independent samples. [score:1]
[1 to 20 of 6 sentences]
84
[+] score: 16
For bladder cancer, Takahiro et al. demonstrated that KRT7 mRNA was significantly down-regulated by transfection of miR-30-3p, miR-133a and miR-199a in the bladder cancer cell line (KK47), suggesting that these three miRNAs may have a tumor suppressive role via the mechanism underlying transcriptional repression of KRT7 [9]. [score:6]
Only four miRNAs, including miR-21, miR-101-3p, miR-221-3p and miR-133 were in the miRNA-target genes network. [score:3]
Only four miRNAs, including oncomiR miR-21, miR-101-3p, miR-221-3p and miR-133 were found in the miRNA-target genes network in this study. [score:3]
Figure  1 shows that target genes of four miRNAs such as hsa-miR-221, hsa-miR-30-3p, hsa-miR-133a and hsa-miR-21 were enriched in three pathways. [score:3]
Of note, nine miRNAs such as hsa-miR-199a*, hsa-miR-143, hsa-miR-127, hsa-miR-30-3p, hsa-miR-221, hsa-miR-21, hsa-miR-101, hsa-miR-129 and hsa-miR-133a were listed (Table  2). [score:1]
[1 to 20 of 5 sentences]
85
[+] score: 16
While miR-133a downregulation in HNOC has been reported by Wong et al. [25], downregulation of miR-133b has been consistently observed by both Wong and Kozaki studies [25, 27]. [score:7]
In a followup study, Wong et al. further demonstrated the tumor-suppresser functions of miR-133a/133b that inhibit proliferation and induce apoptosis in HNOC cell lines [26]. [score:5]
In addition to their apparent tumor-suppresser function, miR133a/133b have also been associated with various functional roles in cardiomyocytes [79– 81], osteoblasts [82], and neurons [83]. [score:3]
These include miR-21, miR-184, miR-133a/133b, miR-137, and miR-193a. [score:1]
[1 to 20 of 4 sentences]
86
[+] score: 15
The same group later revealed that IL-13 is capable of reducing the miR-133a expression in BSMCs and that the miR-133a downregulation causes an upregulation of RhoA, presumably resulting in an augmentation of the contraction [93]. [score:9]
Another study showed that expression of RhoA in bronchial smooth muscle cells (BSMCs), a new target for asthma therapy, is negatively regulated by miR-133a [92]. [score:6]
[1 to 20 of 2 sentences]
87
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Tumour suppressors miR-1 and miR-133a target the oncogenic function of purine nucleoside phosphorylase (PNP) in prostate cancer. [score:5]
miR-145, miR-133a and miR-133b: tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. [score:5]
Most of these pathways have been implicated in AD and/or colon cancer (Kisby et al., 2011a) and, in a separate recent study, some (pathways in cancer, Wnt signaling, MAPK signaling, and calcium-pathway signaling) have been predicted to be regulated by miR-1/miR-133A (Table 2). [score:2]
The right-hand column shows the biological processes or signaling pathways potentially regulated by the miR-1/miR-133a cluster in human cancers examined by *Nohata et al. (2012). [score:2]
The functional significance of miR-1 and miR-133a in renal cell carcinoma. [score:1]
[1 to 20 of 5 sentences]
88
[+] score: 15
Other miRNAs from this paper: hsa-mir-133a-2, hsa-mir-145, hsa-mir-133b
Transfection of miR-133-sense into T24 cells caused Bcl-w (Figures  6e and ) and Akt1 (Figures  6g and h) protein expression to be significantly down-regulated (P < 0.05 for both; Figures  6e and f). [score:6]
Chiyomaru et al. [31] reported that miR-145 and miR-133a could influence the biological behavior of bladder cancer cells by also regulating the expression of FSCN1. [score:4]
Computer -based programs were used to predict potential miR-133 targets. [score:3]
We therefore speculated that miR-133b, whose nucleotide sequences are similar to those of miR-133a, may also play an important regulatory role in bladder cancer. [score:2]
[1 to 20 of 4 sentences]
89
[+] score: 15
RhoA over -expression correlated with down-regulation of miR-133a in human bronchial smooth muscle cells (hBSM) treated with IL-13 and in bronchial tissue from sensitised BALB/c mice repeatedly challenged with ovalbumin [97]. [score:6]
This data suggests that IL-13, one of the major up-regulated cytokines in asthmatic airways, may play a role in AHR induction in part through repression of miR-133a and inducing increased expression of RhoA [97]. [score:6]
1[120] miR-133a Bronchial smooth muscle cells Human RhoA[97] miR-146a Lung alveolar epithelial cells Human IL-1β IL-8, RANTES[67] miR-218 Primary bronchial epithelial cells Human CSE MAFG[87] miR148a,b, Human miR-152 Primary bronchial epithelial cells HLA-G[24] # Let-7c miR-34c miR-222 Whole lung Rat CSE ND[86] miR-26b, 27a, miR-31*, 96, Primary bronchial epithelial cells Human DEP ND[88] miR-135b,274a, miR-338-5p, 494, miR-513a-5p, b, c, miR-923 Let-7a, b, f, Whole lung Mouse CSE ND[85] miR-26a, 30b, c, miR-34b, 99b, 122a, miR-124a, 125a, b, 140, miR-192, 431 CSE; cigarette smoke extract, ND; not determined, DEP; diesel exhaust particulate, # 3 of 24 down-regulated miR's validated by qRT-PCR The discovery of miRNA is considered one of the major breakthroughs of the last decade. [score:3]
[1 to 20 of 3 sentences]
90
[+] score: 15
Our previous work showed a significant upregulation of miR-133a in circulating monocytes in the low vs. [score:4]
We previously found that in vivo miR-133a in circulating monocytes is upregulated in postmenopausal women with low BMD compared to postmenopausal women with high BMD, thus identifying miR-133a a potential biomarker associated with postmenopausal osteoporosis [23]. [score:3]
To find out if there is any relationship between the two significant miRNA markers that we identified in our current and previous studies, we also performed Pearson correlation analysis between the expression levels of miR-422a and miR-133a. [score:3]
As we previously reported, two miRNAs- miR-133a and miR-382- showed a statistically significant difference in array analysis between the low and high BMD groups [23]. [score:1]
Previously, we have identified a potential biomarker miR-133a in circulating monocytes for postmenopausal osteoporosis. [score:1]
Particularly, miR-133a displayed a fold change of 6.48 between the low and high BMD groups as mean ± SD (4.21±2.15 vs. [score:1]
However, only miR-133a was validated by qRT-PCR (2.21±2.08 vs. [score:1]
the high BMD postmenopausal women by both array and qRT-PCR analyses and identified miR-133a as a potential biomarker for postmenopausal osteoporosis. [score:1]
[1 to 20 of 8 sentences]
91
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-18a, hsa-mir-21, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-30a, mmu-mir-99a, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-138-2, hsa-mir-192, mmu-mir-204, mmu-mir-122, hsa-mir-204, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-138-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-103-1, mmu-mir-103-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-26a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-26a-2, hsa-mir-376c, hsa-mir-381, mmu-mir-381, mmu-mir-133a-2, rno-let-7a-1, rno-let-7a-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-18a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-26a, rno-mir-30a, rno-mir-99a, rno-mir-103-2, rno-mir-103-1, rno-mir-122, rno-mir-126a, rno-mir-133a, rno-mir-138-2, rno-mir-138-1, rno-mir-192, rno-mir-204, mmu-mir-411, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-193b, rno-mir-1, mmu-mir-376c, rno-mir-376c, rno-mir-381, hsa-mir-574, hsa-mir-652, hsa-mir-411, bta-mir-26a-2, bta-mir-103-1, bta-mir-16b, bta-mir-18a, bta-mir-21, bta-mir-99a, bta-mir-126, mmu-mir-652, bta-mir-138-2, bta-mir-192, bta-mir-23a, bta-mir-30a, bta-let-7a-1, bta-mir-122, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-204, mmu-mir-193b, mmu-mir-574, rno-mir-411, rno-mir-652, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-1-2, bta-mir-1-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-138-1, bta-mir-193b, bta-mir-26a-1, bta-mir-381, bta-mir-411a, bta-mir-451, bta-mir-9-1, bta-mir-9-2, bta-mir-376c, bta-mir-1388, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-451b, bta-mir-574, bta-mir-652, mmu-mir-21b, mmu-mir-21c, mmu-mir-451b, bta-mir-411b, bta-mir-411c, mmu-mir-126b, rno-mir-193b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The expression analysis of selected miRNAs using qRT-PCR also showed that miR-26a and -99a were highly expressed in all tissues, while miR-122 and miR-133a were predominantly expressed in liver and muscle, respectively. [score:7]
Comparison of miRNA expression profiles among tissues revealed that very few miRNAs expression was tissue specific (e. g., miR-9, -124 in brain, miR-122 in liver, miR-1, miR-133a and -206 in muscle). [score:5]
Our comparison of miRNA expression across 11 tissues from bovine revealed a few tissue specific miRNAs: miR-9, -124 in brain, miR-122 in liver, miR-1, miR-133a and -206 in muscle, which had been previously reported in mouse and human [13, 27]. [score:3]
[1 to 20 of 3 sentences]
92
[+] score: 15
Several miRNAs modulate osteogenic differentiation: miR-125b negatively regulates osteoblastic differentiation through targeting VDR, ErbB2, and Osterix [28, 29]; miR-133 (targeting RUNX2) and miR-135 (recognizing SMAD5) inhibit differentiation of mouse osteoprogenitors [30]; miR-26a and miR-29b facilitate osteogenic differentiation of human adipose tissue-derived stem cells (hADSCs), and positively modulate mouse osteoblast differentiation [31, 32]. [score:8]
In contrast, Li and coworkers reported that miR-135b (and also miR-133a/b) were downregulated during mouse osteoblast differentiation after 16 hours [30]. [score:4]
In USSC, miR-133a and miR-133b as well as miR-135b are only weakly expressed even in native cells and virtually unchanged during osteogenic differentiation (see Additional file 1). [score:3]
[1 to 20 of 3 sentences]
93
[+] score: 14
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-34a, hsa-mir-182, hsa-mir-210, hsa-mir-215, hsa-mir-221, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-133a-2, hsa-mir-141, hsa-mir-144, hsa-mir-127, hsa-mir-1-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-375, hsa-mir-133b, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-486-1, hsa-mir-802, bta-mir-26a-2, bta-let-7f-2, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-221, bta-mir-34b, bta-mir-127, bta-mir-15b, bta-mir-20b, bta-mir-215, bta-mir-210, bta-let-7f-1, bta-mir-122, bta-mir-34c, bta-mir-34a, bta-mir-1-2, bta-mir-1-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-141, bta-mir-144, bta-mir-16a, bta-mir-182, bta-mir-26a-1, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-486, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2376, bta-mir-2285c, bta-mir-1388, bta-mir-3431, hsa-mir-451b, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-6119, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-6529a, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, hsa-mir-486-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-6529b, bta-mir-133c, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm, hsa-mir-6529
In recent years, the value of circulating miRNAs as diagnostic biomarkers has been shown in relation to cancer (e. g. miR-21, miR-20, miR-221 [10, 11]), cardiovascular disease (miR-1, miR-133a [12]), liver disease (miR-122 [13]) and diabetes (miR-375 and miR-34 [14]), among many other human pathologies and physiological processes including pregnancy [15]. [score:5]
Accordingly, the three miRNAs (Fig.   5a) were expressed predominantly in liver (miR-122, 88-fold higher than in any other tissue), muscle/heart (miR-133, 254-fold higher) and intestine (miR-215, 150-fold higher). [score:3]
Among miRNAs enriched in plasma were several known to be expressed exclusively or predominantly in specific tissues in humans including miR-122 (liver), miR-133a (muscle), miR-127 (adrenal gland), miR-141 (adrenal gland and reproductive system) and miR-182 (thymus) [37, 38]. [score:3]
We first profiled three miRNAs, miR-122, miR-133a and miR-215, known to be tissue-specific in humans [37, 38]. [score:1]
We then sought to validate the results for these eight miRNAs (miR-122, miR-215, miR-133a, miR-144, miR-451, and miR-6119-5p, miR-26a and let-7f) using samples from an independent group of animals (four Holstein-Friesian cross cows, aged between 24 and 48 months, in late pregnancy or post-partum) and we confirmed differences in plasma and cell levels of seven miRNAs (Additional file  2); levels of miR-133a were very low (Ct 34–37) in the original group of animals and were undetectable in this second group. [score:1]
Among miRNAs found to be enriched in plasma, we confirmed miR-122 (liver), miR-133a (muscle) and miR-215 (intestine) to be tissue-enriched, as reported for other species. [score:1]
[1 to 20 of 6 sentences]
94
[+] score: 14
We suspect the failure of normal miR-499 down-regulation in our transgenic mice disrupted the normal response to cardiac pressure stress; similar theories have recently been put forward for cardiac transgenic mice expressing miR-133a [53]. [score:6]
We transfected increasing amounts of miR-499 into 293T cells in culture and found dose -dependent inhibition of the Sox6 UTR-luciferase construct, however another cardiac microRNA, miR-133, had no effect regardless of the dose (Fig. 4A ). [score:3]
Several microRNAs, including miR-1, miR-133, miR-206 and miR-208 [17]– [29], are found in cardiac and/or skeletal muscle, and each has a potentially distinct regulatory function. [score:2]
Sox6 3′UTR -mediated repression increased as amounts of miR-499 was increased; this was not observed with miR-133 or when the UTR orientation was reversed, n = 3–4 transfections per condition, *P<0.05. [score:1]
miR-499 was among the top cardiac-enriched microRNAs (Fig. 1A, Table S1), along with the well-studied microRNAs, miR-1 and miR-133. [score:1]
miR-499 is distinct from miR-1 and miR-133 in that it is encoded in only one genomic locus. [score:1]
[1 to 20 of 6 sentences]
95
[+] score: 14
In fact, extracellular GTP up-regulated the miR-133a and miR133b expression. [score:6]
miR-133a and miR-133b were significantly up-regulated after 24 h of 500 μM GTP stimulation of myoblasts (GTP-undiff) compared to control (CTR-undiff). [score:3]
The graphs show the relative expression of miR-133a, miR-133b, miR-1, and miR-206 both in myoblasts (CTR-undiff), in cells differentiated for 24 h in DM (CTR-diff) and in 500 μM GTP-stimulated myoblasts and differentiating cells (GTP-undiff and GTP-diff, respectively). [score:3]
These phases influence and in turn are influenced both by myogenic regulator factors as Myogenin and by myo-microRNA, specifically miR-1, miR133a/b, and miR-206 (Drummond et al., 2011; Di Filippo et al., 2017). [score:2]
[1 to 20 of 4 sentences]
96
[+] score: 14
Circulating miR-1, miR-208a and miR-133a are overexpressed in the following 2 h after an acute myocardial infarction [106], and circulating miR-423-5p is upregulated in heart failure [107, 108]. [score:6]
Apart from SIRT1, miR-133 also inhibits AMPK expression. [score:5]
Thus, miR-133 targets this pathway at two different points [99]. [score:3]
[1 to 20 of 3 sentences]
97
[+] score: 14
BMP treatment regulates multiple miRNA expression during osteoblastogenesis, and a number of those miRNAs feedback to regulate BMP signaling: [176–179] miR-133 targets Runx2 and Smad5 to inhibit BMP -induced osteogenesis; [176] miR-30 family members negatively regulate BMP-2 -induced osteoblast differentiation by targeting Smad1 and Runx2; 177, 178 miR-322 targets Tob and enhances BMP response. [score:14]
[1 to 20 of 1 sentences]
98
[+] score: 14
Shan et al. reported a decreased miR-133 and miR-590 expression in smoking individuals with atrial fibrosis and showed that an ectopic over -expression of miR-133 and miR-590 resulted in a post-transcriptional suppression of TGF-β 1 and TGF-β RII in cultured canine atrial fibroblasts (Shan et al., 2009). [score:7]
Downregulation of miR-133 and miR-590 contributes to nicotine -induced atrial remo delling in canines. [score:4]
Mizuno et al. studied serum miRNA expression in the X-linked muscular dystrophy in Japan dog mo del (CXMD [J]) and found, as in humans, increased miR-1, miR-133a, and miR-206 levels (Cacchiarelli et al., 2010, 2011; Mizuno et al., 2011). [score:3]
[1 to 20 of 3 sentences]
99
[+] score: 14
The miR-1 can directly target and inhibit insulin-like growth factor 1 (IGF-I) and Akt -mediated signaling while miR-133 can enhance muscle cell proliferation (Kovanda et al., 2014) indicating putative regulatory roles for these miRNAs in muscle growth/ anabolic responses. [score:7]
Despite being the most highly expressed of the miRNAs analyzed, there were no post-exercise changes in miR-1 and miR-133a expression. [score:5]
The array contained 13 common miRNAs previously shown in the literature to be regulated following resistance or endurance exercise, and amino acid ingestion in human skeletal muscle including hsa-miR-1, hsa-miR-9-3p, hsa-miR-16-5p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-miR-31-5p, hsa-miR-133a-3p, hsa-miR-133b, hsa-miR-181a-5p, hsa-miR-378a-5p, has-miR-451a, hsa-miR-486-5p, and hsa-miR-494-3p. [score:2]
[1 to 20 of 3 sentences]
100
[+] score: 14
In contrast, miR-1, miR-10a and miR-133a were downregulated in human CRC tumour tissues, regardless of the histological subtype (S1A, S2A and S3A Figs). [score:4]
S3 FigExpression levels of miR-133a are significantly downregulated in (A) human colorectal adenocarcinoma (conventional (n = 18) and mucinous (n = 20), but not in chronic UC (n = 13) -associated CRC) tumor areas compared to matched R [0] margins, and (B) colon carcinoma-like Caco-2 [D299G] cells compared to enterocyte-like Caco-2 [WT], as determined by qPCR. [score:4]
Expression levels of miR-133a in human CRC patient samples and Caco-2 subclones. [score:3]
S4 FigExpression levels of (A) miR-205, (B) miR-373, (C) miR-1, (D) miR-10a and (E) miR-133a in different human colonic adenocarcinoma cell lines (LS 174T, HT-29, HCT 116 and SW480), in comparison to naïve (untransfected) Caco-2, Caco-2 [WT] and Caco-2 [D299G] cells, as determined by qPCR (n ≥ 2 samples/cell line). [score:3]
[1 to 20 of 4 sentences]