sort by

164 publications mentioning hsa-mir-144 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-144. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 266
Other miRNAs from this paper: mmu-mir-144, mmu-mir-143, hsa-mir-143
The decrease in E [2] levels before term leads to down-regulation of c-fos gene expression, which in turn results in the down-regulation of miR-144 and COX2 expression, and miR-144 directly and indirectly targets c-fos and COX2, all of which reduce the secretion of PGE2 throughout most of pregnancy (Fig. 7). [score:15]
With the increased expression of c-fos, the expression of COX2 is also upregulated, but miR-144 partially inhibits COX2 expression, thus slightly reducing the PGE2 secretion. [score:12]
After the transduction of the c-fos overexpression plasmid and the COX2 target protector, the protein levels of COX2 increased (Fig. 5H), as did PEG2 synthesis (Fig. 5I), thus indicating that miR-144 can partly inhibit COX2 via the up-regulation of c-fos. [score:10]
In the present study, the overexpression analysis of miR-144 mimics in cultured human WISH cells indicated that miR-144 downregulates the expression of c-fos and COX2 and that c-fos interference inhibits the synthesis of PGE2 in the amnion during pregnancy and labor. [score:10]
To test this hypothesis, we transfected WHIS cells with either miR-144 mimics/COX2 target protector/c-fos target protector or miR-144 mimics/COX2 target protector/c-fos target protector negative control (NC). [score:9]
From these collective findings, we conclude that the increase in miR-144 and COX2 that occurs during late gestation in response to LPS treatment is attributable to the rise of c-fos expression but that the decrease in miR-144 and COX2 that occurs before late gestation is attributable to the down-regulation of c-fos expression. [score:8]
This increase up-regulates the expression of the c-fos gene, which leads to the increased expression of miR-144 and COX2. [score:8]
miR-144 directly and indirectly targets c-fos and COX2, and inhibits the synthesis of PGE2. [score:7]
As shown above, because c-fos can increase the expression of COX2, we hypothesized that miR-144 might indirectly regulate COX2 expression via c-fos. [score:7]
c-fos to promote the expression of miR-144 and COX2, but with the increase of COX2, miR-144 partially inhibited the COX2 expression, thereby reducing slightly the secretion of PGE2, implying that miR-144 reduces PGE2 secretion by section to avoid preterm delivery. [score:7]
To assess whether miR-144 directly targets c-fos and COX2, we transfected HeLa cells separately with miR-144 mimics and a luciferase reporter plasmid containing a portion of the c-fos 3′UTR or COX2 3′UTR, which resulted in significant down-regulation of the luciferase activity of both the c-fos 3′UTR and COX2 3′UTR. [score:7]
Together, these data indicate that during pregnancy, the expression of c-fos is lower and that miR-144 directly or indirectly targets both c-fos and COX2, ultimately decreasing the PGE2 levels. [score:7]
After the transduction of miR-144 and c-fos target protector, the protein levels of COX2 increased (Fig. 5G), thus implying that miR-144 can indirectly target COX2 via c-fos. [score:6]
These findings suggest that up-regulation of the expression of miR-144, c-fos and COX2 in anmion may play a role preterm labor. [score:6]
Because c-fos regulates the transcription of miR-144 and COX2 and because, we hypothesize that with the increase in c-fos and COX2 that occurs in labor, miR-144 might partially inhibit COX2 expression. [score:6]
To investigate whether c-fos regulates miR-144 and COX2 expression in the amnion, a pcDNA3.1 expression plasmid was used for the c-fos transfection of WISH cells to augment c-fos expression at both the mRNA and protein levels (Fig. 3A,B); this transfection led to an increase in the mRNA and protein levels of miR-144 and COX2 (Fig. 3C–E). [score:6]
c-fos upregulates miR-144 and COX2 expression in WISH cells. [score:6]
miR-144 inhibited COX2 mRNA expression (D), reduced c-fos and COX2 protein levels (E), and decreased PGE2 levels (F). [score:5]
For the miRNA target protector studies, the cells were transfected with 1000 nM c-fos miScript Target Protector (QIAGEN) and 20 nM miR-144 mimic using Lipofectamine RNAiMAX Reagent (Invitrogen). [score:5]
miR-144, c-fos and COX2 are up-regulated in pregnant and near term mice. [score:4]
Transfecting the WISH cells with miR-144 mimics significantly decreased the protein level of c-fos and the mRNA and protein levels of COX2 as well as the concentration of PGE2 in the cell supernatants; in contrast, transfecting the WISH cells with miR-144 inhibitors significantly increased the protein level of c-fos and the mRNA and protein levels of COX2 but did not significantly regulate the mRNA level of c-fos (Fig. 5C–F). [score:4]
miR-144, c-fos, and COX2 are up-regulated in a mouse mo del of preterm labor. [score:4]
Further tests indicated that miR-144 indirectly targets COX2 via c-fos. [score:4]
In a previous deep sequencing analysis of Large White sows placentas before and at the onset of labor, we found that miR-144, c-fos and COX2 were significantly up-regulated near term 18. [score:4]
miR-144, c-fos and COX2 are up-regulated in a mouse mo dels of preterm labor. [score:4]
The results of the cotransfection experiments indicate that miR-144 directly targets the c-fos 3′UTR and the COX2 3′UTR. [score:4]
c-fos up-regulates miR-144 and COX2 in WISH cells. [score:4]
The up-regulation of c-fos was associated with a significant increase in miR-144(C) and COX2 mRNA (D) and protein (E) levels. [score:4]
In summary, c-fos is a key E [2] target gene in amnion that promotes the synthesis of PGE2, and it is associated with COX2 and miR-144. [score:3]
To assess the effects of E [2] on the expression of miR-144, c-fos and COX2 in the amnion, WISH cells were treated with 10 nM E [2], and mice were administered an amniotic sac injection of E [2]. [score:3]
Together, these results indicated that the expression patterns of miR-144, c-fos and COX2 during pregnancy are similar in pigs and mice. [score:3]
To determine whether the changes in the expression of miR-144, c-fos and COX2 were associated with preterm labor, preterm labor was induced by injecting LPS into the amniotic sacs of 15.5 dpc mice 19. [score:3]
How to cite this article: Li, H. et al. miR-144 and targets, c-fos and cyclooxygenase-2 (COX2), modulate synthesis of PGE2 in the amnion during pregnancy and labor. [score:3]
LPS treatment promoted miR-144 expression in the amnion (Fig. 2A) and increased the mRNA and protein levels of c-fos and COX2 (Fig. 2B–D). [score:3]
E [2] injection, which led to a moderate increase in the expression of miR-144, c-fos and COX2 in both the amnion and WISH cells (Fig. 6). [score:3]
miR-144 targets c-fos and COX2. [score:3]
LPS treatment increased the expression of miR-144 (A) c-fos, and COX2 at the mRNA (B,C) and protein (D) levels. [score:3]
Collectively, these findings suggest that E [2] promotes the expression of miR-144, c-fos and COX2 and that miR-144 and COX2 are probably mediated, in part, via the induction of c-fos by E [2]. [score:3]
COX2 protein levels increased in cells transfected with miR-144 and the c-fos target protector. [score:3]
Additionally, we investigated whether miR-144 inhibits endogenous c-fos and COX2 expression in human WISH cells. [score:3]
For the miRNA mimic studies, the cells were transfected with 20 nM scrambled control mimic, the miR-144 mimic or the miR-144 inhibitor (Ribobio, Guangzhou, China) using Lipofectamine RNAiMAX Reagent (Invitrogen). [score:3]
To confirm whether the expression pattern of miR-144, c-fos and COX2 is conserved in mice, qRT-PCR analysis of mouse amniotic tissue at 15.5 and 18.5 dpc was performed, and the results showed that miR-144 (Fig. 1A) as well as c-fos and COX2 (Fig. 1B,C) were increased. [score:3]
To further examine whether c-fos regulates miR-144, the miR-144 promoter region was isolated from a luciferase reporter construct, referred to as pGL3-promoter-2225, containing a 2.2-kb region upstream of the precursor miR-144. [score:2]
miR-144, c-fos, COX2 and PGE2 are coordinately regulated during pregnancy and near term in the mouse amnion. [score:2]
E [2] regulates miR-144, c-fos and COX2 in WISH cells and amnion of pregnant mice. [score:2]
In contrast, the siRNA -mediated knockdown of c-fos in WISH cells decreased the mRNA and protein levels of miR-144 and COX2 (Fig. 3F–J). [score:2]
E [2] regulates miR-144, c-fos and COX2 in WISH cells and amnion of pregnant miceE [2] promotes an inflammatory response in the uterus and antagonizes the anti-inflammatory actions of P [4]/PR 4 23. [score:2]
For the analysis of the 3′UTR mutations, four nucleotides in the putative miR-144 binding site were mutated (c-fos 3′UTR CCATGTACTGT-5′ to 3′-CCATGTAAGTG-5′ and COX2 3′UTR 3′-CATTTAATGGTACTGTA-5′ to 3′-CATTTAATGGTACGAGC-5′). [score:2]
E [2] regulates miR-144, c-fos and COX2 in the amnion of pregnant mice and in WISH cells. [score:2]
Recently, Liu et al. have demonstrated the functional significance of miR-144 and the regulation feedback loop of c-fos in the migration and invasion of hepatoma cells 33. [score:2]
These results clearly demonstrate that c-fos regulates the transcription of miR-144 and COX2 by binding the potential sites in its promoter. [score:2]
The miR-144 promoter reporter plasmids with specific single mutations in the miR-144 binding site of the AP-1 transcription factor AP-1 binding site were generated by using fusion PCR. [score:2]
Transcriptional regulation of miR-144. [score:2]
Schematic diagram of the regulation of E [2] during pregnancy and labor via the miR-144/c-fos/COX2/PGE2 axis. [score:2]
We also synthesized primers targeting the miR-144 promoter sequence that did not contain the c-fos binding site (Nbs). [score:2]
As mentioned above, the 3′UTR of c-fos and COX2 was found to contain putative binding sites for miR-144. [score:1]
org) was used to identify the putative miR-144 binding sites in the 3′UTRs of mouse and human c-fos and COX2. [score:1]
E [2] treatment increased miR-144 (A) c-fos, and COX2 mRNA (B,C) and protein (D) levels. [score:1]
Three putative AP-1 binding sites were identified in the region 1-kb upstream of the miR-144 precursor. [score:1]
These results indicated that the promoter activity that triggers miR-144 transcription resides in the region -360 bp upstream of the precursor miR-144. [score:1]
This repression was reversed when the putative miR-144 binding sites were mutated (Fig. 5A,B). [score:1]
To construct the pGL3-promoter-2225, promoter-1075, promoter-757, promoter-360 and promoter-191 luciferase reporter plasmids, each region of the miR-144 promoter was amplified from human genomic DNA and cloned into the pGL3-basic plasmid (Promega). [score:1]
The luciferase activity in cells cotransfected with miR-144 relative to luciferase activity in cells transfected with the NC are plotted. [score:1]
E [2] treatment increased miR-144 (E) c-fos, and COX2 mRNA (F,G) and protein (H) levels. [score:1]
Synthetic complementary oligonucleotides containing the AP-1 -binding site of the miR-144 promoter were 3′-biotinylated and annealed. [score:1]
Similarly, the association between c-fos and miR-144 has not previously been reported. [score:1]
Further, the expression relationship among miR-144, c-fos and COX2 after E [2] addition at different time points could be investigated in the subsequent experiment. [score:1]
The effect of miR-144 on c-fos and COX2 was abolished when the putative miR-144 binding sites were mutated. [score:1]
We hypothesize that miR-144 reduces PGE2 secretion by section to avoid the onset of premature delivery. [score:1]
We examined the DNA probes corresponding to the AP-1 binding sites 1, 2 and 3, which contained the putative AP-1 binding sequences and the regions flanking them on both sides in the human miR-144 promoter. [score:1]
[1 to 20 of 70 sentences]
2
[+] score: 262
These data impelled us to hypothesize that mir-144 expression is also down-regulated in lung cancer, and it has an inhibitory function on proliferation and metastasis of lung cancer cells. [score:8]
0074175.g003 Figure 3. A. Over -expression of mir-144 in A549 cells, mean±SD, n = 3. B. Growth curves of A549 cells with or without mir-144 over -expression, mean±SD, n = 3. C. Western-blots of A549 cells with or without mir-144 over -expression. [score:7]
Ectopic ZFX expression rescues growth inhibitory effect of ectopic miR-144 expression in A549 cells. [score:7]
Finally, we found that ZFX expression is highly adjustable upon presence of mir-144 and ectopic expression of ZFX dramatically dampens mir-144 action of tumor inhibition. [score:7]
E. The different effects of mir-144 on ZFX 3′-UTR and its mutant, mean±SD, n = 5. Mir-144 can efficiently inhibit the luciferase expression by binding to ZFX 3′-UTR, but has no effect on the luciferase expression when the binding sites were mutated on ZFX 3′-UTR. [score:7]
F. Quantification of results, mean±SD, n = 3. A. Western-blots of ZFX, cytochrome-c, caspase-3 and GAPDH in A549 cells with only mir-144 over -expression, or mir-144 over -expression combined with ZFX over -expression. [score:7]
0074175.g006 Figure 6 A. Western-blots of ZFX, cytochrome-c, caspase-3 and GAPDH in A549 cells with only mir-144 over -expression, or mir-144 over -expression combined with ZFX over -expression. [score:7]
A. Over -expression of mir-144 in A549 cells, mean±SD, n = 3. B. Growth curves of A549 cells with or without mir-144 over -expression, mean±SD, n = 3. C. Western-blots of A549 cells with or without mir-144 over -expression. [score:7]
Although we should not rule out the involvement of other target genes for mir-144 action in the current scenario, our results, to a lesser extent, at least provide a proof of principle showing that translational approaches may be useful for future development of novel therapeutic strategies for NSCLC. [score:6]
Interestingly, a recent paper reported a down-regulated mir-144 expression in whole blood of patients with lung adenocarcinoma [26]. [score:6]
As expected, we found that ZFX knockdown strongly induces NSCLC apoptosis (as manifested by enhanced apoptotic protein markers and flowcytometry) and suppresses tumor cell growth (Figure 5B-F), which is similar to the biological effects we observed for mir-144 over -expression shown in previous figures. [score:6]
This hypothesis was further confirmed with another two key observations 1) Mir-144 exerts direct regulatory roles on ZFX expression and 2) ZFX protein expression (ELISA) seems to be associated with tumorigenesis. [score:6]
We found Mir-144 can efficiently inhibit the luciferase expression by binding to ZFX 3′-UTR, but has no effect on the luciferase expression when the binding sites were mutated on ZFX 3′-UTR (Figure 4E). [score:6]
Several research groups have reported down-regulation of mir-144 in different types of cancers including osteosarcoma and mesothelioma that implied mir-144 as a potential tumor suppressor [13], [14]. [score:6]
Moreover, we also found that ZFX protein expression is also associated with malignant phenotype of NSCLC and knockdown of ZFX protein results in a similar effect as of ectopic mir-144 expression. [score:6]
revealed that ZFX over -expression partially but significantly dampens mir-144 action as demonstrated by decreased cell apoptosis (Figure 6A,6C-6F) and increased tumor cell growth (Figure 6B) compared to the tumor cells with only mir-144 hyper -expression, which clearly suggests that ZFX-depression is required for mir-144 mediated A549 NSCLC cell apoptosis and growth inhibition. [score:6]
In line with this notion, ectopic expression of mir-144 results in a dramatic inhibition of tumor cell growth and an induction of tumor apoptosis. [score:5]
ZFX protein, a down-stream target of mir-144, is expressed higher in human lung cancer cell lines than in the bronchial epithelial cell line. [score:5]
showed mir-144 expression in mir-144 hyperexpressed A549 cell is over 7 fold higher than the vector control (Figure 3A). [score:5]
Ectopic miR-144 expression inhibits growth of A549 cells and promotes apoptosis of the cells. [score:5]
Interestingly, we found that mir-144 hyperexpression results in significant inhibition of tumor cell growth (Figure 3B) and enhancement of apoptosis as manifested by elevated apoptotic protein markers (cytochrome-c and caspase 3) and flow cytometry results (Figure 3C-F). [score:5]
Expression levels of mir-144 or mir-451 in tumor tissues were normalized to the expression of above microRNAs in the corresponding normal tissues from the same patient. [score:5]
A few reports showed that ZFX serves as a target for mir-144 and exerts regulatory effects on tumor growth [31], [32]. [score:4]
F: Quantification of results, mean±SD, n = 3. The results showed in Figure 1– 3 strongly suggested that mir-144 may play an important inhibitory role in lung cancer development. [score:4]
Two recent papers from Courtney's group showed that knockdown DCAMKL-1 can increase microRNA-144 which in turn contributes to inhibition of colorectal cancer and pancreatic cancer [16], [17]. [score:4]
F: Quantification of results, mean±SD, n = 3. The results showed in Figure 1– 3 strongly suggested that mir-144 may play an important inhibitory role in lung cancer development. [score:4]
As the next step, it seems to be intriguing to find out the underlying mechanism for mir-144 mediated tumor inhibition. [score:3]
From human NSCLC tumor tissue samples and cell culture samples, we found that the expression of mir-144 is associated with malignant phenotype of NSCLC. [score:3]
Further investigations showed that ectopic mir-144 expression dramatically inhibits NSCLC tumor cell growth and induces apoptosis as manifested by elevated apoptotic protein markers and flowcytometry change. [score:3]
Micro -RNA expression kits for mir451 (001105), mir144 (002676) and RUN48 (001006) were purchased from Applied Biosystems. [score:3]
As shown in Figure 1A and 1B, we found a significant down-regulation for both mir-144 (>70% decrease, p<0.001) and mir-451(>60% decrease, p<0.001) in non-small-cell lung cancer tissues (n = 26) as compared to the peri-tumoral normal tissues (n = 26), which is in line with previous data showing that mir-144 and mir-451 share the same DNA locus, coordinately transcribed and plays similar roles in various pathophysiological scenarios [13], [24], [35], [36]. [score:3]
Consistently, we also found that mir-144 is significantly down-regulated in NSCLC cell lines A549 (>45% decrease, p<0.001), CRL-5875(>60% decrease, p<0.001), HTB-183 (>50% decrease, p<0.001) as compared to normal bronchial epithelial cell lines (16HBE14o- cells) (Figure 2). [score:3]
F: Quantification of results, mean±SD, n = 3. To further determine whether ZFX is required for mir-144 action in NSCLC scenario, we simultaneously over-expressed mir-144 and ZFX protein in A549 cell line. [score:3]
A and B. The relative expression levels of mir-144 and mir-451 in normal (n = 26) and tumor tissues (n = 26). [score:3]
ZFX is required for the suppressive function of mir-144 on NSCLC growth. [score:3]
To test this hypothesis, we successfully engineered mir-144 hyperexpression in A549 lung cancer cells. [score:3]
Data showed that mir-144 robustly induces apoptosis and inhibits growth of NSCLC cells. [score:3]
First, we collected data from bed side, which shows a strongly association between malignant phenotype of NSCLC and mir-144 expression. [score:3]
Briefly, pMIR-REPORT-Luciferase-ZFX-3′-UTR or its mutant (3 µg) was co -transfected with pMIR-REPORT β-gal control (1 µg) into A549 cells (10 [6]) with or without mir-144 over -expression using 15 µl of Lipofectmin 2000 (Invitrogen). [score:3]
Expression levels of mir-144 in A549, CRL-5875, HTB-183 and 16HBE14o- cells, mean±SD, n = 5.. [score:3]
0074175.g002 Figure 2 Next, we sought to determine whether mir-144 plays a direct regulatory role on tumor growth. [score:3]
In terms of NSCLC, it seems that the anti-tumor activity of mir-144 is at least partially through turning down ZFX protein expression at a post-transcription level. [score:3]
0074175.g004 Figure 4 The effect of ectopic miR-144 expression on ZFX protein level in A549 cells. [score:3]
D and E. The representative pictures of results of A549 cells without and with mir-144 over -expression, respectively. [score:3]
In Figure 4D we showed the scheme of the luciferase assay using pMIR-REPORT System to evaluate the direct inhibition of mir-144 on ZFX protein expression. [score:3]
F: Quantification of results, mean±SD, n = 3. As the next step, it seems to be intriguing to find out the underlying mechanism for mir-144 mediated tumor inhibition. [score:3]
We over-expressed mir-144 by transfecting the cells with pre-mir-144 plasmid using lipofectamine 2000. [score:3]
The effect of ectopic miR-144 expression on ZFX protein level in A549 cells. [score:3]
0074175.g001 Figure 1 A and B. The relative expression levels of mir-144 and mir-451 in normal (n = 26) and tumor tissues (n = 26). [score:3]
C. Western-blots of ZFX and GAPDH in A549 cells with or without mir-144 over -expression. [score:3]
D. The scheme of the luciferase assay using pMIR-REPORT System to evaluate the direct inhibition of mir-144 on ZFX protein expression. [score:3]
C. The relative expression levels of mir-144 in low-grade (IA-IIB) (n = 14) and high-grade (IIIA-IV) lung adenocarcinoma (n = 12). [score:3]
However there are several papers discerning the important function of mir-451, another microRNA sharing the same locus with mir-144, in the tumorigenesis and development of lung cancer [20]– [23]. [score:2]
Expression levels of miR-144 are lower in human lung cancer cell lines when compared to the normal human bronchial epithelial cells. [score:2]
More specifically, a recent study revealed an inverse correlation between mir-144 level and gastric cancer development [15]. [score:2]
The function of mir-144 in tumorigenesis and cancer development seems to be complicated and highly tissue-specific [19]. [score:2]
Even so, there is a relative lack of data on roles of mir-144 in tumor biology and there has been no report showing the involvement of mir-144 in NSCLC development. [score:2]
By comprehensively searching related data, we found ZFX (Zinc Finger Protein, X-linked) may be a potential effector molecule for mir-144 action in context of NSCLC growth and development. [score:2]
Mir-144 over -expression. [score:2]
In light of the data from real NSCLC samples, we further explored the role of mir-144 in NSCLC development. [score:2]
We also found ZFX protein level was lower in mir-144 over-expressed A549 cells when compared to vector control transduced cells (Figure 4C). [score:2]
Specifically, it seems that mir-144 is negatively associated with malignant phenotype of lung cancers (Figure 1, 2). [score:1]
However, there is still lack of data on the role of ZFX on lung cancer behavior and mir-144-ZFX pathway has never been reported in context of NSCLC. [score:1]
As for colorectal cancer, another group reported an elevated level of mir-144 in human feces and cancer tissue [18]. [score:1]
The pre-mir-144 or its corresponding vector plasmid was transfected into A549 cells with lipofectamine 2000 (Invitrogen). [score:1]
Levels of mir-144 and mir-451 are decreased in NSCLC tumor tissues comparing to peri-tumor normal tissues. [score:1]
Recently, there is a growing research interest on the role of microRNA-144 in tumorigenesis and cancer treatment. [score:1]
In addition, a significant decrease of mir-144 level (Figure 1C) is also observed in high-grade cancer (IIIA-IV) comparing to that in low-grade cancer (IA-IIB). [score:1]
Levels of mir-144 and mir-451 are decreased NSCLC tumor tissues comparing to peri-tumor normal tissues. [score:1]
To date, to the best of our knowledge, there has been no report showing a direct involvement of mir-144-ZFX axis in NSCLC development, which warrants further investigation of this pathway in NSCLC behavior. [score:1]
Moreover, the results also suggested that the Zinc finger X-chromosomal protein, or ZFX, seems to be a downstream effector molecule for mir-144 action. [score:1]
To date, to the best of our knowledge, there has been no report paper specifically addressed the role of mir-144 in lung cancer. [score:1]
Combined with the data shown in Figure 4 and Figure 5, it seems that ZFX as a downstream effector gene, may be involved in mir-144 mediated NSCLC tumor development regulation,which sheds light on further investigation of this novel pathway in NSCLC management. [score:1]
Given that clustered miRNA are usually coordinately transcribed, we hypothesize that mir-144 level is also lower in lung cancer [24], [25]. [score:1]
A report from Fu et al claimed that mir-144 promotes cell proliferation, migration and invasion in nasopharyngeal carcinoma through repression of PTEN. [score:1]
To construct pre-mir-144, a DNA fragment containing the 86-bp hsa-miR-144 precursor (plus 100 bp upstream and 100 bp downstream) was amplified from genomic DNA of 16HBE14o- cells and cloned into pcDNA(+)3.1(Invitrogen) which is modified for puromycin resistance. [score:1]
[1 to 20 of 76 sentences]
3
[+] score: 244
We hypothesize that miR-144 inhibits GC metastasis, and that some of this inhibition is mediated by targeting MET expression. [score:9]
For that reason, we hypothesized that miR-144 inhibits GC tumorigenesis by targeting MET expression. [score:7]
By inducing ectopic expression of miR-144, we discovered MET is a novel target of miR-144 regulation. [score:6]
Zhang J, Qin X, Sun Q, Guo H, Wu X, Xie F, et al. Transcriptional control of PAX4-regulated miR-144/451 modulates metastasis by suppressing ADAMs expression. [score:6]
As shown, cell lines with “downregulated” miR-144 levels have higher amounts of MET as compared to cell lines with “upregulated” miR-144 levels (Figure  4A). [score:6]
Putative miR-144 binding sites in MET mRNA 3′ untranslated region were predicted by the Target Scan program (http://www. [score:5]
The reverse experiment, blocking miR-144 expression, was conducted in the AGS cell line, which has a relatively high endogenous level of miR-144 expression. [score:5]
miR-144 overexpression can reduce MET expression at both mRNA and protein levels, and correspondingly, luciferase reporter assays revealed that miR-144 can directly interact with the MET 3′UTR. [score:5]
Overexpression of MET abolished miR-144 -induced inhibition of cell migration and proliferation. [score:5]
miR-144 inhibits cancer cell metastasis by targeting the A disintegrin and metalloproteinase (ADAM) protein family member ADAMTS5. [score:5]
The following PCR conditions were used: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 31 s. The amount of target (MET/miR-144), normalised to the endogenous housekeeping gene GAPDH/U6snRNA and relative to a reference sample, is given by the following equation: amount of target =2-△△CT. [score:5]
Through the ectopic expression of miR-144 in SNU-5 cells, we determined ADAM12, VCAN and MET are putative miR-144 targets. [score:5]
We hypothesized that reintroduction of miR-144 expression would suppress cancer cell migration. [score:5]
Furthermore, miR-144 inhibits GC tumorigenesis by targeting MET, and subsequently, the PI3K/Akt pathway. [score:5]
Because miR-144 inhibits MET expression, we hypothesized that miR-144 could ultimately decrease Akt phosphorylation and activation through decreased MET signaling. [score:5]
Inhibition of miR-144 expression resulted in increased AGS cell migration. [score:5]
Suitably, introduction of miR-144 expression inhibited cell migration in SNU-5 (Figure  2B). [score:5]
Mutation of the miRNA binding site abolished miR-144 -mediated inhibition of luciferase activity (Figure  3G). [score:4]
Figure 3Expression of MET was regulated by miR-144. [score:4]
As shown in Figure  3B, only MET protein levels were downregulated by miR-144. [score:4]
We determined that changes in cell proliferation and migration through miR-144 could be exerted through the regulation of MET expression. [score:4]
Analysis of miRNA and gene expression profiles in the miRNA-gene-network identified miR-144 as a regulator of major oncogenic pathways, such as proliferation and migration. [score:4]
Accordingly, we examined Akt phosphorylation levels after miR-144 overexpression and observed a significant decrease of Akt phosphorylation (Figure  4C). [score:3]
In 93 cases of primary GC, diminished miR-144 expression was associated with poor prognosis [19]. [score:3]
Unsurprisingly, inhibition of miR-144 increased AGS cell migration (Figure  2C). [score:3]
This finding implicates miR-144 as a potential tumor suppressor in GC. [score:3]
To determine whether MET is the critical mediator of miR-144’s effect on cellular migration and proliferation, we constructed two MET expression vector. [score:3]
As shown in Figure  3A, miR-144 expression dramatically affected the mRNA levels of ADAM12, VCAN and MET. [score:3]
Furthermore, we found that MET expression inversely correlates to miR-144 levels in a small but well-documented GC cohort. [score:3]
Using nonparametric tests, we determined a significant inverse correlation between MET mRNA and miR-144 expression in the GC metastatic samples (Figure  4B). [score:3]
microRNA miR-144 MET Gastric cancer Metastases Globally, gastric cancer (GC) is one of the most prevalent types of malignant disease. [score:3]
Position 1430–1436 of MET 3′ UTR has a conserved binding site for miR-144 targeting. [score:3]
The reverse experiment, accomplished by blocking endogenous miR-144 production with a miR-144 inhibitor in AGS cells, resulted in increased luciferase signal (Figure  3F). [score:3]
We then evaluated MET expression levels in a cohort of 52 GC patients and found that miR-144 levels are inversely correlated to MET expression. [score:3]
Co-transfection of LUC-MET 3′UTR and miR-144 mimics in SNU-5 cells resulted in a decreased luciferase signal (compared to miR-NC), confirming that binding of miR-144 to the 3′UTR of MET has a direct inhibitory effect (Figure  3E). [score:3]
Correspondingly, earlier studies have documented miR-144 -based inhibition of tumor cell migration and invasion in epithelial squamous cell carcinoma. [score:3]
GC patients with peritoneal metastases had lower miR-144 expression levels than patients without metastases. [score:3]
As shown in Figure  2A, we selected AGS, characterized with upregulated miR-144, and SNU-5, characterized with downregulated miR-144, for further study. [score:3]
miR-144 was identified as a potential tumor suppressor in GC and has been associated with the mechanisms of GC metastasis. [score:3]
These results indicate that MET is a critical target for the anti-migration effect of miR-144 in human GC cells. [score:3]
We studied the effect of miR-144 expression in the SNU-5 cell line, as it is characterized by low expression of miR-144. [score:3]
In GC cell lines, reintroduction of miR-144 expression results in repression of ZFX, which moderately increases cancer cell susceptibility to 5-fluorouracil chemotherapy. [score:3]
MiR-144 mimics, miR-144 inhibitor (anti–miR-144), and MET siRNA (siRNA-MET) were synthesized by Genepharma, Shanghai, China. [score:3]
Our findings suggest that miR-144 regulates Akt phosphorylation through MET regulation in GC. [score:3]
SNU-5 cells and AGS cells were transfected with miR-144 mimics/inhibitors and pGL3 luciferase reporter constructs harboring the MET 3′UTR. [score:3]
The MiRcute miRNA qPCR detection kit (TIANGEN, Beijing, China) was used to quantitate the expression levels of miR-144 according to the provided protocol. [score:3]
ADAM12, VCAN and MET protein expression levels were also detected through western blot in cancer cells transfected with miR-144 mimics. [score:3]
In this study, we found that miR-144 significantly attenuated Akt phosphorylation, and that Akt phosphorylation was completely restored with overexpression of MET. [score:3]
miR-144 affects MET expression. [score:3]
We also thought they showed that may be due to the presence of miR-144 that was continuously repressing translation in one case but not the other. [score:3]
To our knowledge, this is the first time miR-144 has been shown to target MET in GC cells. [score:3]
In the cancer coexpression network, miR-144 is connected to 6 protein-coding genes that are involved in tumor growth and metastasis (Figure  1C). [score:3]
Ectopic expression of miR-144 in SNU-5 cells results in profound phenotypic changes, such as decreased migration. [score:3]
Compared to SNU-5, AGS cells have a relatively higher level of endogenous miR-144 expression. [score:2]
Regulatory role of miR-144 in gastric cancer metastasis. [score:2]
This finding was confirmed on both mRNA and protein levels, and reporter gene luciferase assays verified direct binding of miR-144 to the regulatory binding site in the 3′UTR of MET. [score:2]
These data suggest that the 1430–1436 position of the MET 3′UTR is critical for miR-144 -mediated gene regulation. [score:2]
Therefore, further studies exploring the anticancer role of miR-144 may contribute to the development of new therapeutic strategies for GC. [score:2]
We decided to investigate whether miR-144 -induced MET downregulation had an effect on tumor cell migration and proliferation. [score:2]
Therefore, miR-144 may regulate other genes in GC cells. [score:2]
The final concentration of miR-144 mimics, anti–miR-144 or siRNA-MET in the transfection system was 100 nM. [score:1]
In conclusion, our study identified a basis for the decreased level of miR-144 seen in GC metastatic tissues. [score:1]
In contrast, the protein level of MET and phosphorylated-AKT increased in AGS cells treated with anti-miR-144 (Figure  4I), and blocking of miR-144 also promoted the migration and proliferation of AGS cells (Figure  4J and K). [score:1]
Using bioinformatic -based analysis, we identified a single miRNA binding site for miR-144 in the 3′ UTR of MET mRNA (Figure  3D). [score:1]
Our results correspond with the results of earlier studies on the role of miR-144 in cancer proliferation, migration, and invasion [22, 23]. [score:1]
We transfected miR-144 and siRNA for MET (siRNA-MET) in SNU-5 cells. [score:1]
We then performed western blot analysis 48 h after transfection of MET-ORF/MET-full long into miR-144 mimics -treated SNU-5 cells (Figure  4F). [score:1]
We used Quick Change mutagenesis to mutate the miR-144 putative binding site (Stratagene, Santa Clara, CA, USA). [score:1]
A mutated luciferase reporter at the miR-144 binding site was also constructed (Figure  3D). [score:1]
However, we also found the ADAM12 and VCAN protein levels are not decreased by exogenous introduction of miR-144. [score:1]
To test if miR-144 directly binds the 3′-UTR of MET mRNA, we performed luciferase reporter assays in SNU-5 cells. [score:1]
Figure 4MET modulation accounts for the antimetastatic effect of miR-144. [score:1]
Interestingly, miR-144 influenced hepatocyte growth factor (HGF) signaling. [score:1]
In fact, endogenous miR-144 was found associated with endogenous MET in anti-MET but not anti-IgG immunoprecipitates from cells (Figure  3C). [score:1]
for miR-144 performed on anti-MET antibody from lysates of cells. [score:1]
These results illustrated that miR-144 plays an important role in migration but not in invasion of GC cells. [score:1]
To investigate the mechanism behind miR-144 -dependent decreased migration of GC, we identified the putative targets for miR-144 as predicted by miRNA-gene-network. [score:1]
In this study, we characterized the targets and defined the mechanism of action of miR-144 in GC. [score:1]
MET mediates the miR-144 -induced resistance to migration. [score:1]
Furthermore, miR-144 is associated with the mechanisms of metastasis. [score:1]
In our study, we observed a close association between miR-144 loss and metastases in GC (Figure  1A and C). [score:1]
miR-144 repression leads to increased levels of MET, which may explain the metastasis phenotype of miR-144 -depleted cells. [score:1]
Prediction of miR-144 binding site. [score:1]
[1 to 20 of 83 sentences]
4
[+] score: 228
In cells transfected with the miR-144 mimic, Zeb1 expression was down-regulated (Fig. 3F) at the protein level, whereas its target E-cadherin 12 was up-regulated and Vimentin was down-regulated (Fig. 3F). [score:14]
Consistent with this, transfection of miR-144 into the cells caused down-regulation of Zeb1 and Vimentin and up-regulation of E-Cadherin, whereas ectopic expression of Zeb1 partially reversed these effects (Fig. 4F). [score:9]
We analysed the expression of miR-144 in human lung cancer cell lines by quantitative RT-PCR and found that the expression of this miRNA was low in the lung cancer cell lines 95D, H1975, EPLC, and A549, whereas 16HBE cells had a relatively high expression level of miR-144 (Fig. 2A). [score:7]
To evaluate whether down-regulation of Zeb1 was involved in the miR-144 -induced suppression of cell migration, A549 and 95D cells were transfected with a Zeb1-specific siRNA (siZeb1) that caused down-regulation of Zeb1 at the mRNA (Fig. 4A) and protein (Fig. 4B) levels. [score:7]
We expanded this observation and reported that miR-144 was down-regulated in 45/51 (88.2%) HPR NSCLCs, whereas in CR patients miR-144 was suppressed in 34/54 (63%) tumour samples (p = 0.016). [score:6]
In contrast, transfection of anti-miR-144 into the cells resulted in up-regulation of the Zeb1 protein (Fig. 3G), suggesting that Zeb1 could be a target gene of miR-144. [score:6]
MiR-144 directly targets Zeb1 by interacting with its 3′-untranslated regions (UTRs)Next, we investigated the targets of miR-144. [score:6]
The down-regulation of miR-144 in tumor samples was more frequently seen in HPR than CR NSCLCs (p = 0.016), indicating the association between air pollution and low miR-144 expression (Table 1). [score:6]
MiR-144 could also bind Zeb2 at positions 1003-1023 in its 3′-UTR (Fig. 3A), but in NSCLC cells overexpression or knockdown of miR-144 had no effect on the expression of Zeb2 at the mRNA and protein levels (Fig. 3B, F, G). [score:6]
The immunohistochemistry (Fig. 4I) and Western blot (Fig. 4J) assays showed that both Zeb1 and Vimentin were down-regulated and E-Cadherin was up-regulated in tumours harvested from mice inoculated with the miR-144-A549-luciferase cells. [score:6]
uk/enright-srv/microcosm/htdocs/targets/v5/), four genes (Zeb1, Zeb2, Rgs17, and Rock1) were predicted to be targeted by miR-144. [score:5]
In contrast, suppression of miR-144 by using an miRNA inhibitor enhanced cell migration in both of the lung cancer cell lines (Fig. 2E, F). [score:5]
Hence, our results indicated that miR-144 is an important tumour suppressor that is inactivated during malignant transformation, and the miR-144-Zeb1 signal pathway could represent a rational therapeutic target. [score:5]
Inhibition of Zeb1 mediates the tumour suppressor functions of miR-144. [score:5]
MiR-144 directly targets Zeb1 by interacting with its 3′-untranslated regions (UTRs). [score:5]
Zeb1 inhibition recapitulates the tumour suppressing effect of miR-144. [score:5]
However, the expression of Zeb2 was not affected by miR-144 overexpression or silencing (Fig. 3B, F, G). [score:5]
We showed that Zeb1, a transcriptional repressor 42 that inhibits E-cadherin and promotes EMT and metastasis 12 43, is a target of miR-144. [score:5]
Moreover, the transcription factors Snail and Slug which play important roles in the epithelial mesenchymal transition (EMT) through transcriptional activation of Zeb1 13 14, were not affected by miR-144 overexpression or silencing (Fig. 3F, G), confirming the results that Zeb1 has no effect on the expression of Snail and Slug 15. [score:5]
MiR-144 inhibits cancer progression in vivoTo test the in vivo tumour suppressing effect of miR-144, either the miR-control or miR-144 was stably transfected into A549-luciferase cells, which were then injected into the tail veins of SCID Beige mice. [score:5]
However, treatment of 16HBE cells with the carcinogens BaP, BPDE, BzP, DBA and NNK for up to 15 days did not result in the down-regulation of miR-144, suggesting that other carcinogens may be responsible for the down-regulation of this miRNA; therefore, investigations are warranted to uncover the carcinogen(s). [score:5]
MiR-144 inhibits NSCLC cell growth and induces apoptosis by down -regulating ZFX 40, and re-establishing miR-144 in gastric cancer restores the chemosensitivity 41. [score:4]
MiR-3195, miR-3656 and miR-144-3p (hereafter, miR-144) were the 3 most significantly down-regulated miRNAs (Fig. 1 and Table 2). [score:4]
In NSCLCs, miR-200b and miR-200c, which are able to bind Zeb2 at positions 1015-1036 of its 3′-UTR, were up-regulated 48 49, and may therefore antagonize the effects of miR-144 on Zeb2. [score:4]
To test whether air pollutants could down-regulate miR-144, several PAH compounds including benzo(a)pyrene (BaP), benzo(a)pyrene diol epoxide (BPDE), dibenzo[a, h]anthracene (DBA), and benzo[g, h, i]perylene (BzP) as well as the tobacco-specific carcinogen nicotine-derived nitrosamine ketone (NNK) were used to treat normal human bronchial epithelial 16HBE cells 11 for 2 (Fig. S1A) or 15 (Fig. S1B) days. [score:4]
Identification of down-regulated miR-144 in HPR and CR NSCLCs. [score:4]
Down-regulation of miR-144 is frequently seen in NSCLCs from HPR. [score:4]
Here, we performed miRNA microarrays to screen for abnormal miRNAs in air pollution-related lung cancer, using samples from a unique HPR and found that miR-144 and its family member miR-451 37 were significantly down-regulated in the patients. [score:4]
Furthermore, mutations in potential interaction sites 1 and 2 of Zeb1 (Fig. 3C) abrogated miR-144 -induced suppression of Zeb1-luciferase in the 293T (Fig. 3D) and A549 cells (Fig. 3E). [score:4]
Down-regulation of miR-144 is associated with colorectal cancer progression via activation of the mTOR signalling pathway 39. [score:4]
Whereas transfection of miR-144 suppressed the migration of cancer cells, co-transfection of Zeb1 attenuated this effect (Fig. 4E). [score:3]
To verify the results of the miRNA microarrays, we tested the expression of miR-3195, miR-3656, miR-144, miR-1915, and miR-451a in additional NSCLCs from HPR and CR. [score:3]
The differences between groups were estimated using an independent two-tailed Student’s t-test (normal distribution data) or Wilcoxon rank sum test (non-normal distribution data), and the association between miR-144 expression and the Zeb1 level was analysed by Pearson correlation analysis. [score:3]
We found that the expression of miR-144 was much lower in tumour samples than paired adjacent normal lung tissues in 45/51 (88.2%) and 34/54 (63%) NSCLCs from HPR and CR (Fig. 1F), respectively. [score:3]
We showed that treatment of the cells with these compounds at concentrations of 0.25 and 0.5 μM for up to 15 days did not perturb the expression of miR-144. [score:3]
MiR-144 directly targets Zeb1. [score:3]
To test the in vivo tumour suppressing effect of miR-144, either the miR-control or miR-144 was stably transfected into A549-luciferase cells, which were then injected into the tail veins of SCID Beige mice. [score:3]
A549-luciferase cells (1 × 10 [6]) stably expressing miR-144 or the miR-control were injected into the lateral tail veins of the mice (6 per group). [score:3]
Using Pearson correlation analysis, we evaluated the potential correlation between miR-144 and Zeb1 expression and found that miR-144 was inversely associated with Zeb1 expression (Fig. 3I). [score:3]
To further determine whether miR-144 affected endogenous Zeb1 expression, A549 and 95D cells were transfected with a miR-control or miR-144 mimic. [score:3]
Notably, the expression of miR-144 was decreased by at least 4-fold in 68/105 (64.8%) NSCLCs compared to matched adjacent normal lung samples (Fig. 1D, E). [score:2]
MiR-144 expression was frequently decreased in cancer tissues (E). [score:2]
MiR-144 suppresses cell migration in vitro. [score:2]
MiR-144 can modulate TRAIL -induced apoptosis by targeting caspase-3 38. [score:2]
How to cite this article: Pan, H. -L. et al. Down–regulation of microRNA-144 in air pollution-related lung cancer. [score:2]
MiR-144 interacts with Zeb1 via two sites in Zeb1’s 3′-UTR, and mutations in these sites abrogate miR-144’s repression of Zeb1 functions (Fig. 3), a result in agreement with previous reports 44 45. [score:2]
To determine whether miR-144 was a putative tumour suppressor, an miR-144 mimic was transfected into A549 and 95D cells by using Lipofectamine or into A549-luciferase cells by using lentivirus -mediated cell transfection (Fig. 2B), and cell migration assays were performed. [score:2]
By transwell and wound healing assays, we found that miR-144 dramatically suppressed the migration abilities of the cells (Fig. 2C, D). [score:2]
Two point mutations (underlined) predicted to abolish miRNA-mRNA binding were introduced into the miR-144 recognition region. [score:2]
MiR-144 inhibits cancer progression in vivo. [score:2]
Pre-miR-144 DNA sequences were amplified from human genomic DNA, subcloned into the EcoR I and BamH I sites downstream of the CMV promoter in the pCDH vector (kindly provided by Dr. [score:1]
MiR-144 expression was determined by qRT-PCR 48 h after transfection and was calculated as the fold change relative to the miR-control. [score:1]
Conversely, co-transfection of the miR-144 mimic did not perturb Zeb2, Rgs17 or Rock1 reporter activity (Fig. 3B). [score:1]
The cells transfected with the miR-144 mimic in serum-free medium were seeded (2 × 10 [4] cells) into the inserts (the upper chamber). [score:1]
Effects of miR-144 on NSCLC cell migrations. [score:1]
The cells were transfected with 0.5 μg of pGL3-luciferase vector and 50 nM of the miR-144 mimic or miR-control together with a Renilla plasmid using Lipofectamine 2000 (Invitrogen) according to the manufacturer′s instructions. [score:1]
The miR-144 mimic (5′-UACAGUAUAGAUGAUGUACU-3′), miR-control (5′-UUCUCCGAACGUGUCACGUTT-3′), anti-miR-144 (5′-AGUACAUCAUCUAUACUGUA), anti-miR-control (CAGUACUUUUGUGUAGUACAA), si Zeb1 (5′-UGAUCAGCCUCAAUCUGCATT-3′) and si-control (UUCUCCGAACGUGUCACGUTT) were synthesized by GenePharma (Shanghai, China). [score:1]
Predicted duplex formation between Zeb1-3′-UTR, Zeb2-3′-UTR, Rock1-3′UTR, Rgs17-3′UTR and miR-144. [score:1]
The body weights of the mice harboring miR-control-A549-luciferase cells decreased rapidly, whereas the body weights of mice bearing miR-144-A549-luciferase cells decreased gradually (Fig. 4H), reflecting the tumour burden and progression. [score:1]
Infectious virus particles were harvested 48 hours after co-transfection of pCDH-miR-144 or pCDH with the lentivirus packing vector (psPAX2 and pMD2G) into HEK293FT cells. [score:1]
Next, we investigated the targets of miR-144. [score:1]
Therefore, isolation of other carcinogens and the assessment of the effects of these compounds on the expression of miR-144 warrant further investigation. [score:1]
The miR-144 binding site-containing 3′ UTR fragment of Zeb1 was amplified and cloned into the modified pGL3-luciferase vector. [score:1]
Zeb1 and Rock1 had 2 potential interacting sites, while Zeb2 and Rgs1 had 1 potential interacting site with miR-144 (Fig. 3A). [score:1]
[1 to 20 of 64 sentences]
5
[+] score: 179
Overexpression of miR-144inhibited proliferation and invasion of uveal melanoma cells (A) qRT–PCR analysis of miR-144 expression in MUM-2B cells which was transfected miR-144 mimics, inhibitors, scramble or control. [score:9]
Moreover, c-Met was identified as the potential targets of miR-144, and miR-144 might suppress tumor growth and invasion by repressing the expression of c-Met. [score:7]
c-Met is a critical downstream target of miR-144 (A) Targetscan analysis using available algorithms indicated that c-Met is a theoretical target gene of miR-144. [score:7]
When miR-144 inhibitor and si-c-Met were cotransfected into MUM-2B cells, miR-144 inhibitor enhanced the si-c-Met -induced inhibition of proliferation and invasion in uveal melanoma cells (Fig 4B and 4C). [score:7]
In our study, the expression of miR-144 was downregulated in human uveal melanoma cells and tissues. [score:6]
In the present study, for the first time, miR-144 was demonstrated to inhibit the proliferation and invasion of uveal melanoma cells by regulating the expression of c-Met. [score:6]
These results suggest that miR-144 might act as a tumor suppressor gene whose down-regulation contributes to the progression and metastasis of uveal melanoma. [score:6]
Sureban et al. also showed that knockdown of doublecort in and CaM kinase-like-1 (DCAMKL-1) increased miR-144 expression, which in turn inhibited epithelial-mesenchymal transition (EMT) of pancreatic cancer[43]. [score:6]
Target prediction and in vitro functional studies showed that c-Met was a direct target of miR-144. [score:6]
Restoration of miR-144 inhibits c-Met -mediated uveal melanoma cell proliferation and invasion (A) The protein expression of c-Met was detected using western blotting analysis. [score:5]
Our findings suggest that miR-144 may function as a novel tumor suppressor gene in uveal melanoma and can be a potential therapy target for uveal melanoma. [score:5]
0124428.g003 Fig 3 (A) Targetscan analysis using available algorithms indicated that c-Met is a theoretical target gene of miR-144. [score:5]
0124428.g002 Fig 2 (A) qRT–PCR analysis of miR-144 expression in MUM-2B cells which was transfected miR-144 mimics, inhibitors, scramble or control. [score:5]
These results demonstrate that miR-144 may act as a tumor suppressor in uveal melanoma by targeting c-Met. [score:5]
Ectopic expression of miR-144 could inhibit uveal melanoma cell proliferation and invasion in vitro. [score:5]
Ectopic expression of miR-144 inhibited uveal melanoma cell proliferation and invasion. [score:5]
The expression of miR-144 was increased in MUM-2B cells transfected with miR-144 mimics, and decreased in cells transfected with miR-144 inhibitor (Fig 2A). [score:5]
Downregulation of miR-144 was found in various cancers, such as hepatocellular carcinoma, lung cancer, and osteosarcoma[39– 41]. [score:4]
The ability of miR-144 to regulate the expression of the c-Met was also verified by western blotting (Fig 3D). [score:4]
These findings suggest that miR-144 has an important role in inhibiting the development and progression of uveal melanoma. [score:4]
In conclusion, the present study demonstrated that miR-144 was downregulated in uveal melanoma tissues and cell lines. [score:4]
In our study, miR-144 was down-regulated in uveal melanoma cells and tissues. [score:4]
In the present study, miR-144 was downregulated in human uveal melanoma cells and tissues. [score:4]
Luciferase reporter gene assays demonstrated that miR-144 reduced luciferase activity of the c-Met wild-type reporter gene but not the mutant type, suggesting that miR-144 directly targeted the c-Met3’UTR (Fig 3B). [score:3]
0124428.g001 Fig 1 The level of miR-144 expression was normalized to U6. [score:3]
Restoration of miR-144 inhibited c-Met -mediated uveal melanoma cell proliferation and invasion. [score:3]
Therefore, miR-144 may serve as a potential therapeutic target in uveal melanoma patients. [score:3]
c-Met is a critical downstream target of miR-144. [score:3]
The mRNA level of c-Met was decreased after transfection miR-144 mimics and increased after transfection miR-144 inhibitor (Fig 3C). [score:3]
Specifically, miR-144 inhibited cell proliferation and invasion. [score:3]
The level of miR-144 expression was normalized to U6. [score:3]
The miR-144 inhibitors, mimics and their controls were synthesised from GenePharma (Shanghai, China). [score:3]
Akiyoshi et al. proved that miR-144 expression was inversely correlated with gastric cancer [42]. [score:3]
Meanwhile, miR-144 inhibitor promoted the MUM-2B cells proliferation (Fig 2B). [score:3]
Analysis using available algorithms suggested that c-Met was a potential target gene of miR-144 (Fig 3A). [score:3]
Meanwhile, miR-144 inhibitor increased the proliferation of the MUM-2B cells. [score:3]
Restoration of miR-144 inhibits c-Met -mediated uveal melanoma cell proliferation and invasion. [score:3]
qRT–PCR analysis showed that the expression of miR-144 was decreased in uveal melanoma cell lines (MUM-2B, C918, MUM-2C and OCM-1A) compared with D78, human melanocyte cell line(Fig 1A). [score:2]
−ΔCT [CT] represents the difference of CT values between internal control and miR-144. [score:1]
However, the role of miR-144 in uveal melanoma remains unclear. [score:1]
Zhang et al. showed that miR-144 promoted proliferation, migration, and invasion of nasopharyngeal carcinoma through repressing phosphatase and tensin homolog (PTEN)[44]. [score:1]
There is increasing reports on the role of miR-144 in carcinogenesis[37]. [score:1]
Further investigation revealed that c-Met was a potential target of miR-144. [score:1]
In addition, when miR-144 mimic and pCDNA-c-Met was cotransfected into MUM-2B cells, miR-144 mimic repressed the pCDNA-c-Met -induced proliferation and invasion in uveal melanoma cells (Fig 5B and 5C). [score:1]
Importantly, miR-144 mimic rescued the c-Met -induced cell invasion and proliferation. [score:1]
Moreover, introduction of miR-144 can reduceduveal melanoma cell proliferation and invasion. [score:1]
Thus the function of miR-144 in carcinogenesis seems to be complicated and highly tissue-specific. [score:1]
The invasiveness of cells was decreased in cells transfected with miR-144 mimics compared with the scramble group and control group cells and increased in cells transfected with miR-144 inhibitor compared with the scramble group and control group (Fig 2C). [score:1]
MiR-144 was originally identified as an erythroid-specific miRNA, which was required for subsequent urvival and maturation of the erythroid lineage[38]. [score:1]
[1 to 20 of 49 sentences]
6
[+] score: 168
We also identified miR-144 as a tumor-suppressive microRNA that directly targeted E2F8 to inhibit proliferation of PTC cells in vitro and in vivo. [score:8]
Moreover, miR-144 was wi dely downregulated in PTC, where its expression correlated inversely with E2F8 expression. [score:8]
Moreover, miR-144 appears to be a tumor suppressor through direct inhibition of E2F8. [score:6]
E2F8 or miR-144 expression profiles in PTC tissues were obtained from The Cancer Genome Atlas (TCGA) datasets, and the correlation of E2F8 expression with clinicopathological features was analyzed in a cohort PTC patients. [score:5]
MiR-144 downregulated the expression of E2F8, and resulted in G1-phase arrest in PTC cells. [score:5]
We found that enforced overexpression of E2F8(oe-E2F8) by transfection of a cDNA that lacked the miR-144 -binding site in the 3’-UTR partially abrogated miR-144 -mediated suppression of proliferation in TPC-1 cells (Fig.   6g). [score:5]
g Effect of enforced overexpression of E2F8 could partially reverse the miR-144 -mediated inhibition of proliferation in TPC-1 cells. [score:5]
This result was strongly supported by the rescue experiments in which enforced overexpression of E2F8 could partially reverse cell proliferation inhibition and alleviate G1-phase arrest by miR-144. [score:5]
As expected, data demonstrated that miR-144 inhibited luciferase activity by around 46% in BCPAP cells and 55% in TPC-1 cells when the reporter plasmid carried the wild-type(WT)-E2F8 3’-UTR, but no significant inhibition was observed at the reporter plasmid carried a mutant(Mut)-E2F8 3’-UTR (Fig.   5c). [score:5]
MiR-144 is downregulated in PTC tissues and inversely correlates with E2F8 expression. [score:5]
a and b Transfection of miR-144 mimic inhibited cells proliferation, while transfection of miR-144 inhibitor promoted cells proliferation in BCPAP and TPC-1 cells. [score:5]
miR-144 mimic, control mimic, control inhibitor, miR-144 inhibitor and siRNAs against E2F8 were synthesized by Genechem. [score:5]
was used to determine E2F8 was a direct target of miR-144. [score:4]
In all mice, the proliferation of tumor cells stably overexpressing miR-144 was dramatically suppressed compared to that with miR-NC. [score:4]
We further demonstrate that E2F8 is a direct functional target of miR-144, which controls PTC cell proliferation both in vitro and in vivo. [score:4]
Our results reveal that miR-144 targets E2F8 by directly binding to the predicted site in 3’-UTR of E2F8 mRNA. [score:4]
Fig. 5E2F8 is a direct target of miR-144. [score:4]
As shown in Fig.   5d and e, results of qRT-PCR and western blot demonstrated that miR-144 inhibited expression of E2F8 compared with negative control group. [score:4]
Next, we performed luciferase reporter assays to determine whether miR-144 regulates E2F8 expression through binding to the predicted site in 3’-UTR of E2F8 mRNA. [score:3]
Our results suggest that the miR-144/E2F8/CCND1 axis might function as a key pathway regulating tumor cell proliferation during PTC development. [score:3]
As shown in Fig.   8b, miR-144 expression was found to be significantly decreased along with more advanced T stage in PTC tissues. [score:3]
Then, miR-144 was proved to be a specific miRNA targeting E2F8 which has not been previously identified. [score:3]
b Predicted miR-144 target sequences in E2F8 3’-UTR. [score:3]
a TCGA dataset showed that miR-144 was significantly downregulated in PTC tissues compared with adjacent normal tissues. [score:3]
Among candidate miRNAs, miR-144 was identified by all the three programs as targeting E2F8 with highest predictive score (Fig.   5a). [score:3]
a Venn diagram showing miR-144 targets E2F8 by three prediction software packages. [score:3]
To confirm the growth -inhibitory effect of miR-144 on PTC cells in vivo, the subcutaneous growth of tumors derived from TPC-1 cells transfected with miR-144 or miR-NC was assessed. [score:3]
We then examined the effect of miR-144 on the mRNA and protein expression of E2F8 in BCPAP and TPC-1 cells, respectively. [score:3]
As shown in Fig.   5b, 91–98 of E2F8 3’-UTR was a predicted target of miR-144. [score:3]
For overexpressing miR-144, recombinant lentiviruses containing miR-144 precursor or negative control sequences were purchased from Genechem. [score:3]
E2F8 is specifically targeted by miR-144. [score:3]
Our results demonstrate a new miR-144/E2F8/CCND1 regulatory axis controlling PTC development, which may offer a potential prognostic and therapeutic strategy. [score:3]
Our data indicated that miR-144 suppressed PTC cell proliferation at least in part through decreasing the posttranscriptional level of E2F8 (Fig.   8d). [score:3]
We found that miR-144 inhibited PTC cells proliferation by decreasing E2F8 posttranscriptionally. [score:3]
In TCGA dataset, miR-144 was found to be significantly downregulated in PTC tissues compared with paired adjacent normal tissues (Fig.   8a). [score:3]
In a bioinformatics search for potential miRNAs targeting E2F8, we identified miR-144 as the most promising one. [score:3]
MiR-144 inhibits tumor growth in vivo. [score:2]
MiR-144 inhibits proliferation and induces G1 phase arrest in PTC cells. [score:2]
As shown in Fig.   6h and i, flow-cytometry analysis also showed that oe-E2F8 partially alleviated miR-144 -mediated G1-phase arrest. [score:1]
e IHC analysis showed that E2F8 and CCND1 protein levels were both greatly decreased in miR-144 transfected tumors. [score:1]
E2F8 miR-144 Papillary thyroid cancer (PTC) TCGA Proliferation Cell cycle Thyroid cancer is the most common malignancy of endocrine system, and its incidence has increased rapidly worldwide in the past few decades [1]. [score:1]
Level of E2F8 protein after miR-NC or miR-144 transfected into PTC cells. [score:1]
miR-144 mimic: 5’-UACAGUAUAGAUGAUGUACU-3’. [score:1]
These vectors (WT-E2F8 3’-UTR or Mut-E2F8 3’-UTR were together with miR-144 mimic or miR-NC) were transiently transfected into BCPAP and TPC-1 cells using Lipofectamine 2000 reagent (Invitrogen). [score:1]
d A hypothetical mo del of the miR-144/E2F8/CCND1 axis controlling PTC cell proliferation. [score:1]
c Relative luciferase activity of reporter plasmids carrying wild-type or mutant E2F8 3’-UTR in BCPAP and TPC-1 cells co -transfected with miR-NC or miR-144 mimic. [score:1]
Our results suggest that the miR-144/E2F8/CCND1 axis might represent a potential therapeutic strategy for treatment of human PTC. [score:1]
Then, 64 collected paired tissues were used to investigate the association between miR-144 expression and T stage. [score:1]
b Tumors harvested from miR-NC group and miR-144 group. [score:1]
IHC analysis showed that levels of E2F8 and CCND1 protein were greatly decreased in miR-144 transfected tumors (Fig.   7e). [score:1]
The levels of E2F8 mRNA exhibited an inverse correlation with the levels of miRNA-144 in 64 PTC tissues. [score:1]
Level of E2F8 mRNA after miR-NC or miR-144 transfected into PTC cells. [score:1]
Six nucleotides (red) were mutated to prevent binding to miR-144. [score:1]
c Pearson correlation scatter plot of fold change in miR-144 levels and E2F8 mRNA levels in PTC tissues (n = 64). [score:1]
The mutant variant of E2F8 3’-UTR was generated based on WT-E2F8 3’-UTR by mutating six nucleotides that potentially bind to miR-144 and named as Mut-E2F8 3’-UTR. [score:1]
b qRT-PCR analysis showed that miR-144 was significantly decreased along with more advanced T stage in PTC tissues. [score:1]
h and i Flow-cytometry analysis showed that enforced oe-E2F8 treatment could significantly alleviate miR-144 -mediated G1-phase arrest of TPC-1 cells. [score:1]
[1 to 20 of 57 sentences]
7
[+] score: 167
In-silico Prediction of Target miRNAs against Human Nrf2 and Experimental Validation of Nrf2 Downregulation by Forced Expression of miR144, miR153, miR27a and miR142-5pNrf2, an essential transcription factor for regulating both basal and inducible expression of diverse cytoprotective genes [26], [27] has been recently demonstrated to be regulated by miR144 and miR28 in non-neuronal mo dels [22], [23]. [score:12]
Individual overexpression of miR144, miR153, miR27a and miR142-5p directly target Nrf2 3′ UTR and downregulate expression of Nrf2 transcript. [score:11]
Overexpression of miR144, miR153, miR27a and miR142-5p downregulates Nrf2 protein expression in SH-SY5Y cells. [score:8]
In-silico Prediction of Target miRNAs against Human Nrf2 and Experimental Validation of Nrf2 Downregulation by Forced Expression of miR144, miR153, miR27a and miR142-5p. [score:8]
In general, these miRs (miR144, miR153, miR27a, miR142-5p) when individually present can regulate numerous targets/pathways and the effect of particularly targeting Nrf2 may vary from moderate to high depending on the cellular/stressor setting. [score:6]
Nrf2, an essential transcription factor for regulating both basal and inducible expression of diverse cytoprotective genes [26], [27] has been recently demonstrated to be regulated by miR144 and miR28 in non-neuronal mo dels [22], [23]. [score:5]
Altogether, our results strongly suggest that miR144/153/27a/142-5p could suppress Nrf2 gene expression through 3′ UTR binding and down-modulating Nrf2 mRNA in SH-SY5Y neuronal cells. [score:5]
miR144, miR153, miR27a and miR142-5p abrogates the interaction and binding of corresponding miRs to human Nrf2 3′ UTR, thus indicating Nrf2 as a direct regulatory target of these miRs. [score:5]
Nrf2 transactivation and ARE -driven NQO1 gene expression were reduced by overexpression of different miRs, miR144, miR153, miR27a and miR142-5p. [score:5]
To validate whether the computationally predicted miRNAs could target Nrf2 in neuronal system, we chose human neuroblastoma SH-SY5Y, a neuronal-like subline of SK-N-SH cells and overexpressed with each of these miRs (miR144, miR153, miR27a and miR142-5p) individually. [score:5]
In each case, mutation of miR144 (or) miR153 (or) miR27a (or) miR142-5p binding sites on Nrf2 3′ UTR failed to downregulate the luciferase activity as opposed to those observed in WT type reporter construct (Fig. 5B –5E; compare lane 3 vs lane 4). [score:5]
Overexpression of miR144, miR153, miR27a and miR142-5p reduces GCLC and GSR expression affecting GSH/GSSG ratio and cellular ROS levels. [score:5]
In-silico based identification of Nrf2 dependent molecular pathway and complex network of disease processes that could be regulated at the intersection of miR144, miR153, miR27a and miR142-5p. [score:4]
Mutating miR144, miR153, miR27a and miR142-5p binding sites in Nrf2 3′ UTR confirms Nrf2 as a direct target of miR144/153/27a/142-5p. [score:4]
Nevertheless, our findings demonstrate that in neuronal SH-SY5Y cells, miR144/153/27a/142-5p induced Nrf2 downregulation affects the nucleo-cytoplasmic concentration of Nrf2 which is reflected in its inefficient transactivating ability. [score:4]
To further confirm that Nrf2 3′ UTR regulation by miR144, miR153, miR27a, miR142-5p indeed impact the expression of Nrf2 mRNA, we determined the levels of Nrf2 message in SH-SY5Y cells transfected with and without the aforementioned miRs using quantitative real time PCR for Nrf2. [score:4]
Nrf2 is a Direct Target of miR144, miR153, miR27a and miR142-5p. [score:4]
Ectopic Expression of miR144/153/27a/142-5p Deregulates GSH and ROS Levels. [score:4]
miR153, miR27a, miR142-5p and miR144 in regulating Nrf2 expression in SH-SY5Y neuronal cells. [score:4]
0051111.g007 Figure 7 In-silico based identification of Nrf2 dependent molecular pathway and complex network of disease processes that could be regulated at the intersection of miR144, miR153, miR27a and miR142-5p. [score:4]
Results were analyzed and expressed as natural logarithm (ln) of relative quantity of miR144 and miR142-5p, normalized to U6 snRNA from a calibrator sample (scramble control miR) [42], [43]. [score:3]
It is to be noted that DIANA-mirPath analysis populated NFE2L2 as the principal gene at the intersection of miR144, miR153, miR27a, miR142-5p with a highest –ln(p-value) of 20.79 that is mapped to involve in Prion disease by KEGG pathway (Fig. 7B). [score:3]
The results of Fig. S5 and S6 suggests that in a given cellular context, when these candidate miRs: miR144, miR153, miR27a and miR142-5p co-exist even at low levels, each would bind to Nrf2 via multiple, distinct binding sites and may perhaps increase the robustness and likelihood of targeting Nrf2 and its associated functions. [score:3]
The results show that individual overexpression of miR144, miR153, miR142-5p effected a ∼42% repression and a maximal repression by about ∼68% was shown by miR27a (Fig. 2A). [score:3]
While all the other target genes which are at the intersection of 4 miRs are represented by independent colored lines (miR144-brown; miR153-red; miR27a-black; miR142-5p-purple). [score:3]
As one to many miR:target relationships are likely, we next analyzed the possible strong candidates including Nrf2 that could be mapped at the intersecting points of miR144, miR153, miR27a and miR142-5p using “mirDIP (microRNA: Data Integration Portal)”. [score:3]
Overall, this data suggests that Nrf2 is translationally repressed by miR144, miR153, miR27a, miR142-5p in a specific manner. [score:3]
Construction of miR-disease Network (MDN) with Respect to miR144/miR153/miR27a/miR142-5p. [score:3]
Thus, future studies should assess the relative timing and involvement of various closely linked events such as translation repression, mRNA deadenylation and decay in miR144/miR153/miR27a/miR142-5p induced silencing of Nrf2. [score:3]
Thus our study is the first to demonstrate that Nrf2 protein could be subjected to translation repression by miR144/miR153/miR27a/miR142-5p in a Keap1 independent manner in neuronal cellular system. [score:3]
Figure S5 Effect of 10 nM each of combination of miR144, miR153, miR27a and miR142-5p on Nrf2 protein expression. [score:3]
Thus, to test whether the forced expression of selected individual miRNA candidates (miR144, miR153, miR27a and miR142-5p) have any repressing effect on Nrf2 3′ UTR, we used a reporter construct that was cloned with 428 bp of human Nrf2 3′ UTR downstream of luciferase gene. [score:3]
This suggests that Nrf2 regulation by miR144/153/27a/142-5p appears to be a tightly controlled event with the likelihood of circumventing any redundancies involving Keap1. [score:2]
The critical role for Nrf2 in regulating ARE/GSH pathway suggests that any impairment in Nrf2 levels induced by miR144/153/27a/142-5p may impose damaging effects on GSH homeostasis. [score:2]
Thus, in view of preserving redox potential that is key to a normal cellular physiology, our results suggest that Nrf2 dependent redox homeostasis could be controlled in this neuronal system by regulation of levels of the following miRs: miR144/miR153/miR27a/miR142-5p. [score:2]
miR144/miR153/miR27a/miR142-5p Mediated Repression of Nrf2 is Keap1-independent. [score:1]
Based on these criteria, we narrowed down to a list of 4 different miRs (hsa-miR27a, hsa-miR153, hsa-miR142-5p including the already reported hsa-miR144) (Fig. 1A). [score:1]
It has been previously demonstrated that human Nrf2 3′ UTR possess 2 potential miR144 binding sites at 265–271 and 370–377 [22]. [score:1]
The schematic representation of binding sites and the individual mutants for miR144 (site-1 & site-2), miR153, miR27a and miR142-5p in the human Nrf2 3′ UTR was shown in Fig. 5A and the successful incorporation of mutagenized bases was confirmed by sequencing of the individual mutant constructs. [score:1]
So far, there are only few studies in non-neuronal mo dels that has validated Nrf2 silencing by miR144 [22], miR28 [23] and miR34a [24]. [score:1]
Figure S6 Integration analysis of multiple miRNAs (miR144/miR153/miR27a/miR142-5p) to various human pathways by DIANA mirPath. [score:1]
Endogenous level of miR144 and miR142-5p in SH-SY-5Y cells were observed to be negligible. [score:1]
SH-SY5Y cells were transfected with either 40 nM of scramble miRNA or combination of miRs (10 nM each of miR144, miR153, miR27a, miR142-5p) for 48 h. (A) Nrf2 immunoblotting was performed in whole cell protein lysates with anti-GAPDH serving as loading control. [score:1]
miRNA precursors for hsa-miR144, hsa-miR153, hsa-miR27a, hsa-miR142-5p, hsa-miR21, scramble control miR, siPort™ Amine NeoFX and mirVana miRNA isolation kit were purchased from Ambion (Austin, TX). [score:1]
miR144, miR153, miR27a and miR142-5p Represses Nrf2 3′ UTR and Endogenous Nrf2 mRNA. [score:1]
We focused on miR144 (site 2) in the current study as Sangokoya et al. (2010) [22] previously demonstrated that miR144 binding site 2 (position 370–377) is only involved in miR144 mediated repression of Nrf2 in erythrocytes. [score:1]
Totally 28 genes were computed to be at the intersection of 4 different miRs (hsa-miR144/hsa-miR153/hsa-miR27a/hsa-miR142-5p). [score:1]
Transfection of miR144 and miR142-5p duplex increased the endogenous level of these miRs by log (2) 3.4 fold and 5.2 fold respectively (Fig. S1A; S1D). [score:1]
[1 to 20 of 48 sentences]
8
[+] score: 140
To show that Sweet-P specifically targets miR144 -binding site in the 3′UTR of hGRβ, we measured protein expression by immunohistochemistry of two known miR144 targets that have been shown to be suppressed, PTEN [35] and the mammalian target of rapamycin (mTOR) [40]. [score:9]
Zhang et al. showed that miR144 downregulated PTEN expression [35], a tumor suppressor gene that regulates many cellular functions including cell proliferation. [score:9]
As shown by the mutation in the 3′UTR of human GRβ reporter, and plasmid overexpression, miR144 is a positive regulator of human GRβ expression and not GRα. [score:7]
Mutational analysis of the miR144 binding site resulted in a decrease of 77% (UMUC-3) and 81% (T24) in the reporter expression, indicating that miR144 may enhance human GRβ expression. [score:6]
Guo et al. showed that miR144 inhibits bladder cancer proliferation by targeting the enhancer the zeste homolog 2 (EZH2), a downstream regulator of the Wnt/β-catenin pathway that mediates growth [34]. [score:6]
We found three potential miRNA target sites in the 3′ UTR of human GRβ and show that miR144 positively affected human GRβ expression. [score:5]
During migration, dexamethasone suppression of miR144 may have a larger impact on GRβ expression. [score:5]
Blocking the miR144 binding site in the 3′UTR of human GRβ by Sweet-P inhibits expression and cell migration. [score:5]
Dexamethasone decreased miR144 and migration of the T24 cells, which indicates that suppression of miR144 levels may also reduce GRβ expression. [score:5]
Iwaya et al. showed that miR144 downregulated mTOR, a regulator of cellular growth and metabolism, and the loss of miR144 leads to the progression of colorectal cancer [40]. [score:5]
Additionally, we show that blocking the binding site of miR144 in the 3′ UTR of human GRβ inhibited expression, and, as a result, decreased migration of bladder cancer cells. [score:5]
To inhibit the binding of miR144 to the 3′UTR of GRβ, we developed a peptide nucleic acid (PNA) conjugated with a cell-penetrating peptide (CPP) (Sweet-P) targeting the site (Figure 7A). [score:5]
The overexpression of miR144 resulted in a significant (p < 0.05) increase in human GRβ expression (3.8 fold), while not changing GRα (Figure 5F). [score:5]
There are a plethora of targets for miRNAs, and the specific blockade of miR144 binding to the 3′UTR of GRβ by Sweet-P resulted in decreased GRβ mRNA expression and 3′UTR GRβ-luc reporter assay. [score:4]
In this study, we show that dexamethasone treatment inhibited miR144, which we have shown is a positive regulator of GRβ and is increased during migration. [score:4]
To show that miR144 specifically regulates human GRβ, we overexpressed a plasmid containing the precursor of human miR144 in pCMV-MIR or empty vector. [score:4]
Dex treatment decreased expression of miR144, miR181a, and miR181c in the T24 cells, but not in the UMUC-3 cells (Figure 6B). [score:3]
Higher-grade bladder tumors have been shown to express elevated miR144 [34], which has also been shown to promote cell proliferation in nasopharyngeal carcinoma [35]. [score:3]
The Sweet-P sequence targeted the miR144 binding site in the 3′ UTR of human GRβ (Supplementary Figure 2). [score:3]
However, insulin did not increase miR144 expression with an acute two-hour treatment, which suggests that insulin may enhance GRβ levels by a different mechanism. [score:3]
Two drugs for the treatment of type II diabetes, rosiglitazone and pioglitazone, have been shown to induce bladder cancer [56, 57], but their effect on miR144 or GRβ expression is unknown. [score:3]
Drug targeting the miR144 enhancement of GRβ. [score:3]
The effect of Sweet-P was specific for the 3′UTR of human GRβ, as mTOR and PTEN, which are known to be suppressed by miR144, were not lower but PTEN was significantly higher. [score:3]
Insulin did not significantly change expression of miR33a, miR144, miR181a, miR181b, miR181c, or miR181d in the T24 cells. [score:3]
A plasmid containing the human miR144 in the pCMV-MIR vector was transfected in the T24 cells to show how miR144 overexpression affected the expression of GRβ and GRα as measured by Real-time PCR (F). [score:3]
A peptide nucleic acid (PNA) conjugated to a cell penetrating peptide (CPP) targeting the miR144 binding site in the 3′UTR of the human GRβ (Sweet-P) was designed using PANAGENE website (http://www. [score:3]
Most likely the increase of miR144 during T24 migration and its enhancement of GRβ expression are mediated in a non-insulin dependent manner. [score:3]
The inhibition of miR144 may be a potential mechanism that migration was reduced by dexamethasone in the T24 cells. [score:3]
The human 3′UTR of GRβ is regulated by miR144. [score:2]
Next, we wanted to determine if miR33a, miR144, miR181a, miR181b, miR181c, or miR181d changed during a scratch assay and if this affected the human GRβ or GRα expression. [score:2]
The miR144 containing pCMV-MIR vector resulted in a 184-fold increase in miR144 expression compared to the empty vector (p = 0.002). [score:2]
The 3′ UTR of GRβ is enhanced by miR144 during human bladder cancer migration. [score:1]
Three miRNAs were predicted to bind the 3′UTR of human GRβ (miR33a, miR181-a/b/c/d, and miR144). [score:1]
Interestingly, miR33a, miR144, miR181a, miR181b, miR181c, and miR181d were all increased in the T24 cells. [score:1]
However, the effects of miR144 on migration were not tested. [score:1]
The cloning vector pCMV-MIR containing the miR144 sequence was purchased from Origene. [score:1]
A peptide nucleic acid (PNA) conjugated to a cell penetrating peptide (CPP) (Sweet-P) was designed to bind to the miR144 binding site in the 3′UTR of human GRβ mRNA (A). [score:1]
The T24 and UMUC-3 bladder cancer cells were transfected with the 3′UTR GRβ-Luc expression construct with mutation in the miRNA binding site for miR181, miR144, or miR33a and was measured by a luciferase assay, and normalized to renilla (B). [score:1]
Figure 7A peptide nucleic acid (PNA) conjugated to a cell penetrating peptide (CPP) (Sweet-P) was designed to bind to the miR144 binding site in the 3′UTR of human GRβ mRNA (A). [score:1]
Blocking the interaction of miR144 with the 3′ UTR of GRβ by Sweet-P slowed bladder cancer migration. [score:1]
[1 to 20 of 40 sentences]
9
[+] score: 112
The results of upregulated expression of hsa-miR-144 should represent the guide mark for further genetical and functional studies on mechanisms of miR expression and activity, involved in the development of urinary tract anomalies. [score:9]
Certain GO biological processes enriched in the cluster (kidney development, urogenital system development, tube development, embryonic organ development) suggest that deregulated expression of hsa-miR-144 might contribute to impaired development of kidney and urinary tract. [score:9]
Analysis of the coexpression clusters of CoMeTa predicted hsa-miR-144 targets from the Co-Operational Level (COOL) analysis, and GO analysis of these clusters [14], revealed that a cluster of 511 putative targets was enriched with describes biological processes relevant for CAKUT pathology (Fig.   3). [score:7]
Although this highly conserved miR shows age dependent upregulation, this should not bias the results of our study in which hsa-miR-144 was upregulated in ureter samples of children with CAKUT compared to adult controls. [score:6]
In Fig.   1b, four miRs finally selected for experimental validation (hsa-miR-144, hsa-miR-101, hsa-miR-183 and hsa-miR-375) were in the opposite direction from the origin compared to CAKUT samples in Fig.   1a suggesting that these miRs might be responsible for the downregulation in the CAKUT gene expression data. [score:6]
The number of CoMeTa predicted target genes of hsa-miR-144 associated with each category is shown in parentheses A combination of unsupervised CIA (using correspondence analysis) and supervised CIA (using BGA) was employed to simultaneously analyze mRNA expression levels from microarray and information in the 3′UTRs of the same genes. [score:5]
The two gene clusters with high reciprocal expression relationships, containing 1024 and 511 genes, resulted from the COOL performed on hsa-miR-144 predicted targets. [score:5]
Of the selected biological processes, cell–cell signaling process contained the largest number of hsa-miR-144 predicted targets (50 target genes). [score:5]
Fig.  3CoMeTa predicted hsa-miR-144 target genes contributing to biological processes involved in the development of CAKUT. [score:4]
However, miR-144 was found to be the sole miR that was consistently upregulated in the aging human and nonhuman primate cerebellum and in nonhuman primate cortex [44]. [score:4]
Therefore, hsa-miR-144 might be upregulated by specific CNV genotype. [score:4]
Although in this study we could not investigate the expression of hsa-miR-144 in human tissue during development, but after birth, certain developmental factors which represent crucial controllers of developmental stages could have prolonged activity in later stages after birth in CAKUT etiology. [score:4]
The neural factors were described to be important in urinary tract development [26], thus we have selected the transmission of nerve impulse and neuron differentiation as important processes controlled through hsa-miR-144 targeting of the notable number of genes (34 and 33 respectively). [score:4]
As for the developmental processes, there were four GO terms describing the potential of direct participation of hsa-miR-144 in CAKUT. [score:3]
10.1186/s12967-016-0955-0 Statistically significant GO terms from Gene Ontology analysis performed on a cluster of 511 hsa-miR-144 target genes. [score:3]
Predicted miRs were experimentally validated to be expressed in ureter tissue: hsa-miR-144, hsa-miR-375, hsa-miR-183 and hsa-miR-200a. [score:3]
The number of CoMeTa predicted target genes of hsa-miR-144 associated with each category is shown in parentheses The genetic cause of most CAKUT cases remains unknown. [score:3]
Fig.  2Difference in relative expression of hsa-miR-144, hsa-miR-183, hsa-miR-200a, and hsa-miR-375 between CAKUT patients (n = 36) and controls (n = 9). [score:3]
Seven GO terms were selected and presented as a pie chart showing the number of predicted target genes of hsa-miR-144 (Fig.   3). [score:3]
The inverse correlation pattern was described between hsa-miR-144 expression and genome-wide methylation status in cancer [38]. [score:3]
miRs from the same community that have higher average ranking were chosen for experimental validation (italics) The present study showed a statistically significant 5.7 fold increase of hsa-miR-144 expression in human ureter tissue from CAKUT patients (n = 36) compared to control ureter tissue (n = 9) (p < 0.01) (Fig.   2; Table  2). [score:2]
The 5.7 fold increase of hsa-miR-144 expression in human tissue from CAKUT patients compared to controls (p = 0.005) was observed. [score:2]
miRs from the same community that have higher average ranking were chosen for experimental validation (italics)The present study showed a statistically significant 5.7 fold increase of hsa-miR-144 expression in human ureter tissue from CAKUT patients (n = 36) compared to control ureter tissue (n = 9) (p < 0.01) (Fig.   2; Table  2). [score:2]
We received a notably reduced list containing 7 miRs (hsa-miR-144, hsa-miR-101, hsa-miR-375, hsa-miR-200a, hsa-miR-183, hsa-miR-495, hsa-miR-222) with a potential role in CAKUT development. [score:2]
The hsa-miR-144, first time identified in CAKUT, could be connected with biological processes crucial for normal development of kidney and urinary tract. [score:2]
Therefore, by the observation of the plots, miRs hsa-miR-144, hsa-miR-101, hsa-miR-183 and hsa-miR-375 are potentially associated with CAKUT according to their position To systematically identify miRs specifically associated with CAKUT, a supervised analysis was conducted by combining CIA and BGA. [score:1]
This was the first ex vivo human study that investigated the expression of miRs: hsa-miR-144, hsa-miR-200a, hsa-miR-375 and hsa-miR-183 in human CAKUT. [score:1]
The hsa-miR-144 gene is located in a polymorphic region (17q11.2) rich with CNVs, according to the database of genomic variants [33]. [score:1]
Therefore, by the observation of the plots, miRs hsa-miR-144, hsa-miR-101, hsa-miR-183 and hsa-miR-375 are potentially associated with CAKUT according to their positionTo systematically identify miRs specifically associated with CAKUT, a supervised analysis was conducted by combining CIA and BGA. [score:1]
The chosen mature forms for validation were: hsa-miR-144-3p, hsa-miR-200a-3p, hsa-miR-375-3p and hsa-miR-183-5p. [score:1]
Assigning the CAKUT related biological functions to hsa-miR-144. [score:1]
Further functional analysis must follow to reveal the impact of hsa-miR-144 on CAKUT occurrence. [score:1]
From the GO we selected 7 biological processes that could contribute to CAKUT, which genes are potentially influenced by hsa-miR-144. [score:1]
According to the CIA average ranking, we have chosen the better ranked miRs from communities 4 and 1 (hsa-miR-144 and hsa-miR-183 respectively) for experimental validation in this study (Table  1). [score:1]
[1 to 20 of 34 sentences]
10
[+] score: 97
In this analysis, again hsa-miR-144* and hsa-miR-20b showed the strongest downregulation in diseases with AUC values of 0.771 (95% CI of 0.721–0.821) and 0.760 (95% CI of 0.71–0.811), respectively, while hsa-miR-194* was the most upregulated miRNA with an AUC value of 0.687. [score:9]
Of all miRNAs, seven (hsa-miR-380*, hsa-miR-106b, hsa-miR-17, hsa-miR-144*, hsa-miR-558, hsa-miR-548d-3p, and hsa-miR-222) were significantly downregulated (adjusted two-tailed t-test P <0.05) in at least 13 of 19 disease conditions, representing the most non-specific miRNAs. [score:6]
The same holds for hsa-miR-144*, which was a key miRNA in our analysis and downregulated in almost all tested disease conditions. [score:6]
In the abovementioned studies, hsa-miR-144* has been described to be upregulated in diseases. [score:6]
In summary, we were able to successfully validate that hsa-miR-144* was significantly downregulated in various diseases in a total of 319 samples over three approaches with consistent fold-changes of 3.8, 3.4, and 3.5, respectively. [score:6]
In our recent study on Alzheimer’s disease, hsa-miR-144-5p was the most significantly downregulated miRNA in whole blood [28]. [score:6]
According to the Human MIRNA & Diseases Database (HMDD, [37, 38]) several studies revealed hsa-miR-144* (in the current V20 miRBase: hsa-miR-144-5p) as disease -associated. [score:5]
For the breast cancer samples against controls we likewise did not detect any statistically significant difference (P =0.42), providing evidence that hsa-miR-155* is in contrast to hsa-miR-144*, and is not a general disease marker but only significant in a restricted subset of diseases. [score:5]
In contrast, Liu et al. showed that hsa-miR-144* is overexpressed in peripheral blood mononuclear cells of active tuberculosis patients [40] and Redova et al. showed that it is also upregulated in serum of patients with renal cell carcinoma compared to healthy controls [41]. [score:5]
The miRNAs hsa-miR-144* and hsa-miR-20b were the most downregulated with an AUC of 0.751 (95% CI: 0.703–0.799), followed by miR-17 and miR-20a. [score:4]
Among the most significant miRNAs in the ANOVA was also hsa-miR-144*, being significant in 14 different diseases and representing the most generally dysregulated miRNA with a significance value of 1.88 × 10 [−33]. [score:4]
For miR-144*, we measured ΔΔCT values of −1.93 in center 1. Thus, hsa-miR-144* was downregulated 3.8-fold in diseases (P =1.9 × 10 [−5]). [score:4]
The strong downregulation of hsa-miR-144* and the less variable pattern of hsa-miR-155* has been validated in a cohort of 319 samples in three different centers. [score:4]
In center 2, we calculated ΔΔCT values of −1.75; thus, concordantly hsa-miR-144* was significantly less expressed in diseases (P = 0.0096) with a fold-change of 3.4. [score:3]
To validate our microarray results for two important disease miRNAs, hsa-miR-144* (non-specific) and hsa-miR-155* (specific), qRT-PCR was performed in two participating centers. [score:3]
Analogously to hsa-miR-144* as a general disease marker, we also validated the miRNA hsa-miR-155* as example of a rather specific miRNA. [score:3]
hsa-miR-144* was further identified as a new fecal -based marker for colon cancer [42] and as significantly upregulated in primary medulloblastoma samples compared to neural stem cells [43]. [score:3]
We discovered miRNAs that seem to be generally associated with diseases, most importantly miR-144*. [score:3]
of microarray data To validate our microarray results for two important disease miRNAs, hsa-miR-144* (non-specific) and hsa-miR-155* (specific), qRT-PCR was performed in two participating centers. [score:3]
This holds especially for hsa-miR-144*, which was mostly expressed in CD15 cells compared to the other cell types according to the results of our previous study. [score:2]
As for the first two validation approaches, hsa-miR-144* was significantly less (P =0.04) expressed with a fold-change of 3.5 in breast cancer samples compared to controls. [score:2]
Our study presents miRNAs that are dysregulated in almost all patients, such as miR-144*, which was also validated using qRT-PCR. [score:2]
Our classifier outperformed the maximal AUC of the best single biomarker, i. e., hsa-miR-144* and hsa-miR-20a (AUC 0.751, respectively), by 16%. [score:1]
For the comparison of cancer versus controls the highest AUC was as high as 0.94, representing a 16.9% improvement over the best single miRNA for this comparison (hsa-miR-144*). [score:1]
Among those, we found substantially decreased levels of hsa-miR-144* and hsa-miR-20b with AUC of 0.751 (95% CI: 0.703–0.799), respectively. [score:1]
[1 to 20 of 25 sentences]
11
[+] score: 80
We can speculate that high expression of miR-101 observed in the lung samples could contribute to the sustained activation of Erk1/2 (phosphoErk1/2) observed in COPD patients [22] due to lack of dephosphorylation by MKP-1. Regarding miR-144, this miRNA has been found to be elevated in cancer [23]- [25], and was recently identified to be among the top three miRNAs up-regulated in the lung of COPD patients [7]. [score:6]
Taken together, our results indicate that up-regulation of miR-101 and/or miR144 could contribute to the suppression of CFTR observed in COPD patients. [score:6]
The expression of three miRNAs predicted to target CFTR (miR-101, miR-144, and miR-145) was determined. [score:5]
Expression of miR-144 and miR-101 Suppresses CFTR Protein in HBE Cells. [score:5]
Expression of miR-101 and miR-144 decreases expression of CFTR protein. [score:5]
We also determined the role of miR-101 and miR-144 in regulating CFTR expression. [score:4]
Since cadmium is a contaminant of cigarette smoke, it is possible that cadmium present in cigarette smoke was responsible for the up-regulation of miR-101 and miR-144. [score:4]
On the other hand, the fact that both miR-101 and miR-144 target the same region suggests that this 3′UTR region is highly regulated by miRNAs. [score:4]
In order to confirm that miR-101 and miR-144 directly target CFTR, the CFTR 3′UTR was subcloned into the reporter psiCHECK-2 vector. [score:4]
Cigarette Smoke and Cadmium Induce Up-regulation of miR-101 and miR-144. [score:4]
Mature miR-101 and miR-144 could be detected six hours post-transfection and were still highly expressed 48 hours after transfection (Fig. 2B and data not shown). [score:3]
MiR-101 and miR-144 Target CFTR 3′UTR. [score:3]
Similarly, overexpression of miR-144 resulted in ≈30 and 50% decrease in reporter activity when cells were transfected with 30 and 60 nM of pre-miR-144, respectively (Fig. 4). [score:3]
The expression of mature miR-101 and miR-144 was confirmed by quantitative RT-PCR. [score:3]
Since miR-101 and miR-144 are predicted to target the CFTR gene, we evaluated the effect of these miRNAs on the expression of CFTR protein. [score:3]
MiR-101 and miR-144 target the same region of CFTR 3′UTR and share the same seed sequence indicating that these two miRNAs do not act synergistically or additionally. [score:3]
Effect of the air pollutants cigarette smoke and cadmium on expression of miR-101, miR-144, and miR-145. [score:3]
MiR-144 targets 3′UTR of CFTR. [score:2]
Gillen et al. recently reported that CFTR can be regulated by several miRNAs including miRNA-144 but did not observe any effect of miR-101 on CFTR [10]. [score:2]
HEK-293 cells were transfected with 50 ng of psiCHECK-CFTR or psiCHECK empty vector and either scrambled pre-miR, pre-miR-101, or pre-miR-144. [score:1]
Cells were transfected with 50 ng of psiCHECK containing WT or Mut CFTR 3′UTR and either 30 or 60 nM of pre-miR-144. [score:1]
Total RNA was isolated and expression of mature miR-101, miR-144, and miR-145 was measured by quantitative RT-PCR. [score:1]
HBE cells were transfected with 30 nM of pre-miR-101 or pre-miR-144 using Lipofectamine 2000. [score:1]
Both pollutants increased miR-101 and miR-144 but had no effect on miR-145. [score:1]
Exposure of HBE cells to cigarette smoke resulted in ≈80- and 4-fold increases of miR-101 and miR-144, respectively, while cadmium induced miR-101 and miR-144 by ≈40 and 6 fold (Fig. 1). [score:1]
0050837.g004 Figure 4 Cells were transfected with 50 ng of psiCHECK containing WT or Mut CFTR 3′UTR and either 30 or 60 nM of pre-miR-144. [score:1]
0050837.g002 Figure 2 HBE cells were transfected with 30 nM of pre-miR-101 or pre-miR-144 using Lipofectamine 2000. [score:1]
[1 to 20 of 27 sentences]
12
[+] score: 61
Chronic exposure of these cells to 75 mM ethanol for five days resulted in a significant up-regulation of the expression of miR-7 and miR-144 and down-regulation of miR-203 and miR-15B with no significant change in the expression of miR-152 or miR-153 (Table 1). [score:11]
Chronic ethanol exposure resulted in a significant up-regulation of the expression of miR-7 and miR-144 and down-regulation of miR-203 and miR-15B. [score:9]
The expression of miR-144 was down-regulated to the extent that it could not be detected and the expression of miR-153 was unchanged. [score:8]
Specifically, miR-203, miR-144, miR-15B and miR-153 are all predicted to target the α1 isoform of the GABA [A] receptor, miR-7 and miR-153 are known to act co-operatively to regulate the expression of α-synuclein and miR-203, miR-144, miR-152, miR-7 and miR-15B are predicted to target isoforms of the 14-3-3 family. [score:8]
Here we measured the expression of six miRNAs—miR-7, miR-153, miR-152, miR-15B, miR-203 and miR-144—which are predicted to target key genes involved in chronic alcoholism and other neurodegenerative disease. [score:5]
We measured the expression of six miRNAs—miR-7, miR-153, miR-152, miR-15B, miR-203 and miR-144—which are predicted to target key genes involved in chronic alcoholism and other neurodegenerative diseases. [score:5]
We selected six miRNAs—miR-7, miR-152, miR-153, miR-144, miR-203 and miR-15B—which are predicted to target key genes involved in chronic alcoholism including GABA [A] receptors [18], α-synuclein [19], regulators of G protein signaling [20], and the 14-3-3 family of molecular chaperones [21]. [score:4]
SH SY5Y cells expressed all of the miRNAs except for miR-144. [score:3]
MiR-7, miR-152, miR-153 and miR-15B were expressed in the 1321 N1 cell line whereas miR-144 and miR-203 were below the threshold for reliable detection. [score:3]
The expression of miR-152, miR-144, miR-15B and miR-153 did not change following either chronic-intermittent ethanol exposure or its removal (Table 2). [score:3]
HEK293T cells expressed all six miRNAs under investigation although miR-144 and miR-203 were found at much lower levels than the other four miRNAs. [score:1]
We measured the changes in expression of six miRNAs (miR-7, miR-153, miR-152, miR-144, miR-203 and miR-15B) in HEK293T cells, SH SY5Y neuroblastoma and 1321 N1 cells following ethanol treatment. [score:1]
[1 to 20 of 12 sentences]
13
[+] score: 60
While miR-424* was up-regulated in response to radiation in both gravity conditions, miR-27a and miR-144 were respectively up-regulated and down-regulated, in 2Gy-PBL incubated in MMG. [score:10]
A) Down-regulated miRNAs (miR-144, miR-598, miR-181a-2*) and mRNAs (ATM, STAT5A); B) Up-regulated miRNAs (miR-34a, miR-424*, miR-27a) and mRNAs (BAX, TNFRSF10B). [score:7]
Luciferase reporter vectors containing the 3′-UTR of miR-27a, miR-144 and miR-424* target genes ATM, FANCF, STAT5A, TNFRSF10B, BAX, were generated following PCR amplification from human cDNA and cloned into the pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, Madison, WI), immediately downstream from the stop codon of the luciferase gene. [score:7]
0031293.g009 Figure 9Transient transfection analysis for luciferase expression in A549 cells co -transfected with pre-miRNA precursors (pre-miRNAs) miR-27a, miR-144, miR-424*, or pre-miRNA precursor-Negative Control (pre-control), and reporter constructs containing the 3′UTR of the indicated target genes or synthetic sequence including the perfect miR-27a, miR-144 and miR-424* binding site (sensors). [score:5]
Transient transfection analysis for luciferase expression in A549 cells co -transfected with pre-miRNA precursors (pre-miRNAs) miR-27a, miR-144, miR-424*, or pre-miRNA precursor-Negative Control (pre-control), and reporter constructs containing the 3′UTR of the indicated target genes or synthetic sequence including the perfect miR-27a, miR-144 and miR-424* binding site (sensors). [score:5]
MiR-27a, miR-144, miR-598, together with ATM and STAT5A transcripts, were down-regulated in 2Gy MMG samples. [score:4]
A549 cells were plated in 24-well plates (14×10 [5] cells/well) and 24 h later co -transfected with 50 ng of the pmirGLO dual-luciferase constructs, containing the indicated 3′UTRs of target genes, and with 32 nM pre-miR™ miRNA Precursor Molecules-Negative Control or pre-miR™ miRNA Precursor hsa-miR-27a (PM10939), hsa-miR-424*(PM12641), and hsa-miR-144 (PM11051) (all from Ambion, Austin, TX), using Lipofectamine2000 (Invitrogen Life Technologies). [score:3]
From our results the extrinsic pathway of apoptosis appeared more targeted in MMG than in 1 g. Indeed, miR-7, miR-7-1*, miR-144 and miR-650, which were anti-correlated to pro-apoptotic TNFRSF10B, were exclusively radio-responsive in MMG. [score:3]
Eight miRNAs (let-7i*, miR-7, miR-7-1*, miR-27a, miR-144, miR-200a, miR-598, miR-650), were differentially expressed only when PBL were incubated in MMG. [score:3]
Instead, the interaction between miR-144 and miR-27a with their putative target genes involved in apoptosis (respectively TNFRSF10B and STAT5A), diminished the luciferase activity, but not significantly. [score:3]
To validate some of the predicted miRNA-mRNA anti-correlations identified in 2Gy-PBL incubated in 1 g and MMG, we selected three miRNAs (miR-27a, miR-424*, miR-144) and at least 2 of their potential targets, for functional testing in vitro with the luciferase reporter assay. [score:2]
Moreover, let-7i*, miR-7, miR-7-1*, miR-27a, miR-144, miR-200a, miR-598, miR-650 are deregulated by the combined action of radiation and MMG. [score:2]
Notably, pro-apoptotic BAX was anti-correlated to four miRNAs (miR-144, miR-200a, miR-598,miR-650) deregulated in only 2Gy MMG PBL. [score:2]
Except for miR-371-5p and miR-886-3p, which were differently altered in 1 g at 24 h after irradiation (Table 1), miR-99b, let-7i*, miR-144, miR-200a, miR-27a, miR-598, miR-650, miR-7, miR-7-1* were activated by the combined exposure to IR and MMG (Figure 4B). [score:1]
As positive controls were used miR-27a-sensor, miR-144-sensor, and mR-424*-sensor constructs, containing the perfect binding site for each miRNA. [score:1]
Pre-miR-424* reduced significantly the luciferase activity of both FANCF and STAT5A 3′UTR containing vectors, whereas pre-miR-144 reduced significantly that from constructs containing the BAX 3′UTR (Figure 9). [score:1]
MiR-27a-sensor, miR-144-sensor and miR-424*-sensor, were obtained by annealing, purifying and cloning short oligonucleotides containing the perfect miRNA binding site into the SacI and XbaI sites of the pmirGLO vector. [score:1]
[1 to 20 of 17 sentences]
14
[+] score: 50
The identification of multiple elements within the miR-144/451 cluster is not surprising, as miR-144 and miR-451 are both highly expressed and upregulated by GATA1 during erythrocyte development [8]. [score:7]
Upregulation of miR-4732-3p, as well as its physical proximity to the miR-144/451 locus suggests its similar regulation and functional role during erythroid development. [score:6]
Similar to miR-451a and miR-144-3p [8], both miR-144-5p and miR-4732-3p were also upregulated during erythropoiesis (Fig.   3b). [score:4]
MiR-451a and miR-144-3p are both GATA-1-responsive microRNAs upregulated during erythroid differentiation and play important roles in the anti-stress capacity of erythrocytes [7, 8, 31– 34]. [score:4]
Within the miR-144/451 locus previously implicated in erythroid development, we observed unique co -expression of several primate-specific noncoding RNAs, including a lncRNA, and miR-4732-5p/-3p. [score:4]
b Expression of miR-144-5p, miR-4732-3p, and miR-4732-5p, during CD34+ erythroid differentiation using progenitors from three different individuals. [score:3]
We focused on the co-expressed microRNAs and the long RNA within the miR-144/451 locus for several reasons (Fig.   3a). [score:3]
In the second pattern, we observed co -expression a long RNA spanning only the 5’ portion of the miR-4732 pre-microRNA, proximal to the miR-144/451 region; this lncRNA was confirmed via RT-PCR (Additional file 1: Figure S4). [score:3]
Fig. 3Genomic locations and expression dynamics of noncoding RNAs in the miR-144/451 locus. [score:3]
Notably, several groups have observed mild anemic phenotypes with deletion of the abbreviated miR-144/451 locus in mice, yet these studies did not take into account potential regulatory factors flanking this site [31, 58]. [score:2]
Additionally, both miR-451 and miR-144 reside in a locus that is regulated by GATA-1, are highly induced during erythroid differentiation, and are critical to erythropoiesis [8]. [score:2]
Additionally, proximal microRNAs miR-451a and miR-144-3p are significantly induced during erythroid differentiation [8]. [score:1]
We have previously shown that higher levels of miR-144 and miR-451 reflect the hemolytic phenotype and malaria resistance of sickle erythrocytes, respectively [6, 7]. [score:1]
Joint analysis of erythrocyte long and short RNA transcriptomes reveals novel elements within the miR-144/451 locus. [score:1]
Conservation of miR-451a, miR-144-3p, and miR-144-5p in the listed species. [score:1]
In contrast, miR-451a, miR-144-3p, and miR-144-5p are all highly conserved among primate and non-primate species (Additional file 1: Figure S6). [score:1]
Interestingly, when the sequencing reads were mapped to the miR-144/451 locus, we found several RNA reads mapped to distinct elements 5’ of pre-miR-144. [score:1]
Together, the significant miRDeep score (1.9), predicted pre-microRNA structure, and proximity to the miR-144/451 locus underscores the authenticity and potential functional relevance of miR-4732-3p. [score:1]
We found that miR-4732-3p is an abundant erythrocyte microRNA within the erythroid-enriched miR-144/451 locus. [score:1]
a Location, sequence read length, relative read number, and vertebrate conservation of noncoding RNAs within the chromosome 17 miR-144/451 locus according to UCSC genome browser (hg38). [score:1]
[1 to 20 of 20 sentences]
15
[+] score: 41
miR-125a-3p inhibits autophagy through targeting UV radiation resistance -associated gene (UVRAG), miR-33 targets ATG5/LAMP1, miR-144-3p targets autophagy-related gene 4a (ATG4a), miR-23a-5p inhibits the TLR2/MyD88/NF-κB leading to reduced autophagy and miR-33 also plays an inhibitory role via targeting some unknown factors. [score:15]
Liu et al. (2011) showed that the expression of several miRNAs was significantly altered in patients with active TB, with miR-144 [∗] being mainly expressed in T cells. [score:5]
Guo et al. (2017) revealed that M. bovis BCG infection of macrophages leads to increased expression of miR-144-3p, which induces autophagy-related gene 4a (ATG4a) to inhibit autophagy. [score:5]
MicroRNA-144-3p inhibits autophagy activation and enhances Bacillus Calmette-Guerin infection by targeting ATG4a in RAW264.7 macrophage cells. [score:4]
miR-125a-3p, miR-33, miR-144-3p, miR-23a-5p, and miR-142-3p are potential inhibitors of autophagy in Mycobacterium tuberculosis (Mtb) infection. [score:3]
Functional analysis showed that miR-144 [∗] inhibits the secretion of two important cytokines, INF-γ and TNF-α, and also reduces T cell proliferation. [score:3]
Modulation of T cell cytokine production by miR-144 [∗] with elevated expression in patients with pulmonary tuberculosis. [score:3]
1 macrophages Kim et al., 2015 miR-17-5p ULK-1 Mouse RAW264.7 macrophages Duan et al., 2015 miR-144-3p ATG4a Mouse RAW264.7 macrophages Guo et al., 2017 miR-20a ATG7andATG16L1 Mouse RAW264.7 macrophages Guo et al., 2016 miR-23a-5p TLR2/MyD88/NF-κB Mouse RAW264.7 and BMDMs Gu et al., 2017 miR-26a KLF 4 Mouse RAW264.7 macrophages Sahu et al., 2017 miR-17-5p Mcl-1/STAT3 Mouse RAW264.7 macrophages Kumar et al., 2016 With respect to TB, miR-146a and miR-155 are the most vastly studied miRNAs influencing the host–pathogen interaction. [score:1]
Sputum and serum microRNA-144 levels in patients with tuberculosis before and after treatment. [score:1]
1 macrophages Kim et al., 2015 miR-17-5p ULK-1 Mouse RAW264.7 macrophages Duan et al., 2015 miR-144-3p ATG4a Mouse RAW264.7 macrophages Guo et al., 2017 miR-20a ATG7andATG16L1 Mouse RAW264.7 macrophages Guo et al., 2016 miR-23a-5p TLR2/MyD88/NF-κB Mouse RAW264.7 and BMDMs Gu et al., 2017 miR-26a KLF 4 Mouse RAW264.7 macrophages Sahu et al., 2017 miR-17-5p Mcl-1/STAT3 Mouse RAW264.7 macrophages Kumar et al., 2016With respect to TB, miR-146a and miR-155 are the most vastly studied miRNAs influencing the host–pathogen interaction. [score:1]
[1 to 20 of 10 sentences]
16
[+] score: 40
Therefore, we measured the expression of GRP78 mRNA, rno-miR-144, rno-miR-376a, and rno-miR-451 using real-time RT-PCR to examine their expression patterns in the context of LHR downregulation (Fig. 1). [score:6]
In a similar manner, rno-miR-144 and rno-miR-376a expression peaked 12 h after the hCG treatment, and rno-miR-451 expression peaked 24 h after the hCG treatment. [score:5]
We believe that the discrepancy regarding in the expression of miR-144 and 451 between in the in vivo and in vitro experiments (Fig. 1 and 2) can be explained by the presence of blood cells in the in vivo study which express both rno-miR-144 and rno-miR-451 [22], [23]. [score:5]
uk/) revealed that rno-miR-144, rno-miR-376a, and rno-miR-451 can bind to the 3′-UTR of GRP78 mRNA (from bp 2439–2459) and negatively regulate GRP78 expression. [score:4]
Time course of rat GRP78 mRNA, rno-miR-144, rno-miR-376a, and rno-miR-451 expression in rat ovaries induced by PMSG and hCG. [score:3]
The array data along with the bioinformatic analysis provided by MicroCosm Targets, which indicated that several miRNAs bind to the GRP78 mRNA 3′-UTR, led us to focus on rno-miR-144, rno-miR-376a, and rno-miR-451. [score:3]
From these, we narrowed the focus to rno-miR-376a based on the results of the in vitro experiments (Fig. 2) since rno-miR-144 and rno-miR-451 was not induced expression by hCG treatment. [score:3]
In contrast, rno-miR-144 and rno-miR-451 expression decreased significantly after the hCG treatment. [score:3]
Rat GRP78 mRNA, rno-miR-144, rno-miR-376a, and rno-miR-451 expression in primary rat granulosa cells induced by FSH and hCG. [score:3]
Next, we investigated the effects of rno-miR-144, rno-miR-376a, and rno-miR-451 on GRP78 mRNA expression in granulosa cells isolated from DES -treated immature rats (Fig. 2). [score:1]
Total RNA was isolated, and GRP78 mRNA (A), rno-miR-144 (B), rno-miR-376a (C), and rno-miR-451 (D) expression levels were measured using real-time RT-PCR as described in the. [score:1]
Rat GRP78 mRNA (A), rno-miR-144 (B), rno-miR-376a (C), and rno-miR-451 (D) expression levels were measured using real-time RT-PCR as described in the. [score:1]
The amount of rat GRP78 mRNA, rno-miR-144, rno-miR-376a, and rno-miR-451 in the hCG 0 h group was set at 1. Data were normalized to 18S rRNA (for GRP78 mRNA) and 4.5S RNA(H) (for rno-miR-144, rno-miR-376a, and rno-miR451) levels in each sample and represent the mean ±SE of three independent experiments. [score:1]
The amounts of GRP78 mRNA, rno-miR-144, rno-miR-376a, and rno-miR-451 in the hCG 0 h group were set at 1. Data were normalized for 18S rRNA (for GRP78 mRNA) and 4.5S RNA(H) (for rno-miR-144, rno-miR-376a, and rno-miR-451) levels in each sample and represent the mean ±SE of 3 independent experiments. [score:1]
[1 to 20 of 14 sentences]
17
[+] score: 39
Hsa-miR-424 had the highest degree of regulation in the MiRNA-Gene-Network; 37 target genes were down-regulated in the mRNA expression profiles, followed by hsa-miR-144 with 23 target genes and hsa-miR-302a, hsa-miR-181b and hsa-520d-3p, both had 20 target genes in the network. [score:13]
7 miRNAs (hsa-miR-144,hsa-miR-133a,hsa-miR-365, hsa-miR-424,hsa-miR-500, hsa-miR-661,hsa-miR-892b) had different gene expression levels between active TB and healthy controls; 4 of them (hsa-miR-144,hsa-miR-365 and hsa-miR-133a, hsa-miR-424) were up-regulated and 3 of them (hsa-miR-500, hsa-miR-661,hsa-miR-892b) were down-regulated in active TB patients. [score:9]
Interestingly, 5 of the miRNAs (hsa-miR-365, hsa-miR-223 and hsa-miR-144, hsa-miR-451, hsa-miR-424) were highly expressed in PBMCs and their expression in 3 groups was confirmed by qPCR. [score:5]
We analyzed the expression of 7 miRNAs (hsa-miR-223, hsa-miR-365 hsa-miR-424, and hsa-miR-451, hsa-miR-144, hsa-miR-500 and hsa-miR-21*) selected from the microarray data by qPCR. [score:3]
This difference between active and non-active TB groups was mainly due to the induced expression of hsa-miR-365, hsa-miR-223 and hsa-miR-302a, hsa-miR-486-5p, hsa-miR-144 and hsa-miR-451, hsa-miR-21* and hsa-miR-424 in active TB patients. [score:3]
The expression profiles of the active TB and LTBI groups were statistically different for miRNAs from group 1: hsa-miR-144 (P<0.05), hsa-miR-424 (P<0.01), hsa-miR-451(P<0.05), hsa-miR-223 (P<0.05), and hsa-miR-365 (P<0.05). [score:3]
Among these miRNAs, hsa-miR-223, hsa-miR-424, and hsa-miR-451 and hsa-miR-144 were highly expressed in PBMCs compared to other miRNAs. [score:2]
MiR-451, with its cluster miR144, is required for erythroid differentiation and homeostasis [34]. [score:1]
[1 to 20 of 8 sentences]
18
[+] score: 38
miR-142-3p and miR-144* showed a trend of upregulation in the diseased group, whereas let-7c was slightly downregulated in DCM dogs. [score:9]
For miR-142-3p and miR-144*, we found a trend for upregulation in DCM diseased dogs both in the microarrays and the results, although interindividual variation was very high. [score:6]
miR-144 was also upregulated in the microarray analysis. [score:4]
With p-values > 0.05 for all tested target assays, revealed no statistically significant difference between diseased and healthy dogs (mmu-miR-142-3p: p = 0.771; mmu-miR-144*: p = 0.421; cfa-let-7c: p = 0.634; cfa-miR-21: p = 0.940; cfa-miR-92a: p = 0.873). [score:4]
The upregulation of miR-144 might be a stress response of affected myocytes and an attempt to protect the cells against this stimulus. [score:4]
miR-144 is known to be expressed in a cluster with miR-451. [score:3]
For further analysis, we selected five miRNAs which have been earlier mentioned in literature as being involved in cardiovascular pathology and which also showed a trend for differential expression in the microarray (miR-142-3p, miR-144*, miR-21, let-7c and miR-92a). [score:3]
miR-142-3p and miR-144* were up regulated about two-fold in the DCM group compared to the control group, while let-7c appears to be slightly down regulated. [score:2]
The miR-144/451 promoter is activated by GATA-4, a critical transcription factor in the heart. [score:1]
miR-142-3p showed a 2.18-fold change (p: 0.0042), miR-144* a 2.20-fold change (p: 0.0016), miR-21 a 1.67-fold change (p: 0.0089) and let-7c was negatively 1.53-fold changed (p: 0.0340). [score:1]
miR-144 and miR-144* are the two strands of the double stranded precursor miRNA (mir-144). [score:1]
[1 to 20 of 11 sentences]
19
[+] score: 33
As was seen with the regulation of ABCA1, miR-144-5p is transcribed following LXR activation and suppresses ABCG1 mRNA expression in vitro [54]. [score:6]
FXR also increases miR-144-5p expression to mediate ABCA1 suppression and cholesterol efflux [54]; perhaps miR-33b and miR-144-5p work together to mediate FXR -induced ABCA1 repression. [score:5]
Indeed, multiple groups have shown that miR-33-5p and miR-144-5p have an additive effect on suppression of ABCA1 [54, 60, 62], while cotransfection of miR-33-5p and miR-758 further reduced ABCA1 expression in vitro [48]. [score:5]
Milenkovic et al. [72] found that in vivo supplementation with nine different polyphenols modulated the expression of some combination of miRNAs, including miR-10b, miR-30, miR-144, miR-197, and miR-370, all of which are regulators of cholesterol metabolism [5, 27, 42, 63, 73]. [score:4]
Though they have not been studied in tandem, it also appears that LXR and FXR may be components of a feedback loop that helps maintain cholesterol balance by regulating ABCA1 expression via miR-144-5p. [score:4]
In vivo, ABCA1 suppression in macrophages by miR-19b [53] and miR-144-3p [5], and in liver by miR-144-5p [54], reduced HDL cholesterol and RCT. [score:3]
LXR activation also increases miR-144-5p, which suppresses ABCA1 and cholesterol efflux to ApoA1 [60]. [score:3]
Ramirez C. M. Rotllan N. Vlassov A. V. Davalos A. Li M. Goedeke L. Aranda J. F. Cirera-Salinas D. Araldi E. Salerno A. G. Control of cholesterol metabolism and plasma HDL levels by miRNA-144 Circ. [score:1]
This suggests a potential for utilizing miR-144-3p as a marker for AMI, though it is unclear whether elevated miR-144-3p is a risk for AMI or if miR-144-3p is elevated because the individuals have had an AMI. [score:1]
De Aguiar Vallim T. Q. Tarling E. J. Kim T. Civelek M. Baldán Á. Esau C. Edwards P. A. MicroRNA-144 regulates hepatic ABCA1 and plasma HDL following activation of the nuclear receptor FXR Circ. [score:1]
[1 to 20 of 10 sentences]
20
[+] score: 32
Zebrafish embryos sequentially injected with GFP- cdh53’UTR mRNA and miR-142a-3p duplex showed suppression of GFP expression, while miR-144 duplex had no effect on the GFP expression (Figure 6B). [score:7]
During zebrafish embryo development, miR-1 is known to express ubiquitously where as miR-144 and miR-142a-3p show strong expression in blood cells [35]. [score:6]
Zebrafish meunier mutant has diminished miR-144/451 expression with retarded erythrocyte maturation, showed partial rescue of mutant phenotype solely by miRNA overexpression [22]. [score:5]
The erythroid specific miR-144 has been shown to negatively regulate embryonic α -hemoglobin (α -E1), by targeting the 3′-UTR of Kruppel-like factor D (klfd) gene physiologically [23]. [score:4]
Previous studies of these miRNAs have implicated miR-1 in regulating muscle gene expression and miR-144 in zebrafish embryonic α-globin synthesis [23], [36]. [score:4]
However, to the best of our knowledge distinct functional roles of miR-144, miR-1 and miR-142a-3p in vascular development are yet to be explored. [score:2]
Of the eight-selected miRNA tested using zebrafish as a mo del system, we observed specific non-overlapping phenotypes affecting vascular development for three miRNAs, namely miR-1, miR-144 and miR-142a-3p (Figure 2). [score:2]
Microinjection of duplex miR-144 (20 µM) resulted in a reduction/absence of blood flow in trunk intersegmental vessel (Se) at 2 dpf in approximately 68% of injected animals (n = 63/92). [score:1]
H,I,J - Zebrafish embryos injected with miR-144 display reduced or absence of blood in intersegmental vessels. [score:1]
[1 to 20 of 9 sentences]
21
[+] score: 30
Seven miRNAs showed significant differences in expression in samples from FMF patients compared to healthy controls: four miRNAs were upregulated (miR-144-3p, miR-21−5p, miR−4454, and miR-451a), and three were downregulated (miR-107, let−7d−5p, and miR-148b-3p). [score:8]
Seven were found to be significantly deregulated in the patients with FMF: compared to control samples, three were significantly downregulated (miR-107, let−7d−5p, and miR-148b-3p), and four were significantly upregulated (miR-144-3p, miR-21−5p, miR−4454 and miR-451a), all with P values of <0.01 (Table 2, Fig 1, and S1 Fig). [score:7]
We found that miR-107, let−7d−5p, and miR-148b-3p were downregulated in patients with FMF, and miR-144-3p, miR-21−5p, miR−4454, and miR-451a were upregulated. [score:7]
In FMF patient samples, three miRNAs were downregulated compared to healthy control samples (miR-107, let−7d−5p, and miR-148b-3p), and four miRNAs were upregulated (miR-144-3p, miR-21−5p, miR−4454 and miR-451a). [score:6]
S2 Fig Two differentially expressed microRNAs—let-7d and miR-144 were analyzed by qPCR, and the results compared to NanoString results, revealing a correlation of 0.93 between the modalities. [score:2]
[1 to 20 of 5 sentences]
22
[+] score: 23
Wang et al. also found increased miR-144* expression in TB patients (only in comparison to TSTneg) [13] whereas no differential miR-144 expression was found by others [14]. [score:5]
This study identified 30 differentially regulated miRNAs but decided to focus on increased miR-144 expression in TB patients [16]. [score:4]
miR-144* was mentioned as a candidate regulator or IFN-γ expression before. [score:4]
Kleinsteuber et al. analyzed miR-144* expression in CD4 [+] T cells but since it was not detectable in a subgroup of donors, miR-144* was excluded from further analyses [18]. [score:3]
However, contrary findings with regard to miR-144* expression have been published. [score:3]
In addition, a global miRNA array -based approach detected decreased miR-144 expression of CD4 [+] T cells in TB patients as compared to LTBI but these results of pooled sample analyses were not verified by quantitative PCR [17]. [score:2]
Since miR-144* was described as an important T-cell factor in TB, different results may be due to confounding effects of cellular heterogeneity in peripheral blood [12]. [score:1]
Taken together, as for miR-223, a role for miR-144 and miR-29 in host immunity against TB is likely but the applicability of miR-29 as a biomarker has not been proven. [score:1]
[1 to 20 of 8 sentences]
23
[+] score: 21
Four miRNAs (miR-144, miR-217, miR-424 and miR-214) were also reported to be down-regulated in HCC, and the supplement of their target gene E2F3a partially reversed the tumor suppressive effects of these miRNAs in HCC cells [50– 52]. [score:8]
The expression levels of miR-144, miR-141 and miR-214 were negatively correlated with E2F3 level, and overexpression of those miRNAs was found to inhibit proliferation of HCC cells [50, 68, 83]. [score:7]
Studies demonstrated the biological functions of miR-144, miR-141 and miR-217, with the ability to suppress migration and invasion of HCC cells by downregulating E2F3 [50, 51, 68]. [score:6]
[1 to 20 of 3 sentences]
24
[+] score: 21
The three most up-regulated miRNAs were bta-miR-17-5p (+35.88 fold increase), bta-miR-146a (+34.36 fold increase), and bta-miR-144 (+28.78 fold increase) (Table  2). [score:4]
Of the miRNAs that were significantly up- or down-regulated, five were shared between acutely and persistently infected cattle (bta-miR-17-5p, bta-miR-144, bta-miR-497, bta-miR-22-5p, and bta-miR-1281). [score:4]
The up-regulated miRNA species included bta-miR-17-5p, bta-miR-146a, bta-miR-144, bta-miR-34a, bta-miR-369-3p, bta-miR-497, and bta-miR-22-5p (Table  2 and Fig.   2a). [score:4]
In contrast, the ViTa algorithm found that more of these miRNAs could potentially target the genome, adding bta-miR-205, bta-miR-26b, bta-let-7 g, bta-miR-34a, bta-miR-144, bta-miR-181b, and bta-miR-147 to the list. [score:3]
Of the differentially regulated miRNAs, 16 (bta-miR-23b-5p, let-7 g, bta-miR-22-5p, bta-miR-1224, bta-miR-144, bta-miR-497, bta-miR-455-3p, bta-miR-154a, bta-miR-369-3p, bta-miR-26b, bta-miR-34a, bta-miR-205, bta-miR-181b, bta-miR-146a, bta-miR-17-5p, and bta-miR-31) have previously been described to play a role in cellular proliferation or apoptosis (Fig.   6b, orange circle). [score:2]
As shown in the top portion of Table  3: bta-miR-22-5p, bta-miR-147, bta-miR-1224, bta-miR-144, bta-miR-497, bta-miR-154a, bta-miR-17-5p, bta-miR-205, and bta-miR-31, with fold changes of 2.17, 5.28, 5.69, 23.78, 24.62, 24.05, 40.84, 41.22, and 43.37, respectively. [score:1]
Eleven of the miRNAs are encoded in intergenic regions, including: bta-miR-1281, bta-miR-150, bta-miR-181b, bta-miR-497, bta-miR-144, bta-miR-34a, bta-miR-154a, bta-miR-146b, bta-miR-17-5p, bta-miR-205, and bta-miR-31. [score:1]
The remaining 8 miRNAs (bta-miR-497, bta-miR-144, bta-miR-181b, bta-miR-22-5p, bta-miR-23b-5p, bta-miR-17-5p, bta-miR-154a, and bta-miR-369-3p) detected in this study were found to be clustered. [score:1]
The only chromosomes in the Bos taurus genome that were associated with more than one of the identified miRNAs were: chromosome #8 with bta-miR-23b-5p, bta-miR-31, and bta-miR-455-3p; chromosome #16 with bta-miR-34a, bta-miR-181b, and bta-miR-205; chromosome #19 with bta-miR-22-5p, bta-miR-144, and bta-miR-497; and finally chromosome #21 with bta-miR-154a and bta-miR-369-3p. [score:1]
[1 to 20 of 9 sentences]
25
[+] score: 20
The miRNAs expressed at the highest levels coincided with those reported by previous studies, and were similar to those expressed by NBC in our study, though several divergences emerged between CLL and NBC, such as the previously reported overexpression of miR-150-5p, miR-29a-3p, miR-155-5p, or miR-101-3p, underexpression of miR-181a-5p, or miR-181b-5p [14– 19], and others not firmly established yet, including the highly divergent miR-451a, miR-28-5p, miR-144-5p, miR-486-5p, or miR-486-3p, within the overexpressed, and miR-126-3p, miR-365a-3p, miR-199a-3p, or miR-582-5p, within the underexpressed. [score:13]
However, 41 miRNAs were differentially expressed between CLL and NBC according to the Student t test (cut-off 2-fold, p<0.05), being 29 overexpressed in CLL, including miR-150-5p, miR-29a-3p, miR-29b-3p, let-7a-5p, miR-26a-5p, miR-451a, miR-155-5p, miR-101-3p, miR-28-5p, miR-144-5p, miR-486-5p, or miR-486-3p, and 12 underexpressed, including miR-181a-5p, miR-222-3p, miR-126-3p, miR-365a-3p, miR-181b-5p, miR-199a-3p, or miR-582-5p (Table 1). [score:7]
[1 to 20 of 2 sentences]
26
[+] score: 19
Wu X. Cui C. L. Chen W. L. Fu Z. Y. Cui X. Y. Gong X. miR-144 suppresses the growth and metastasis of laryngeal squamous cell carcinoma by targeting IRS1Am. [score:5]
In rats, CR reduces miR-144 expression in cerebromicrovascular endothelial cells, avoiding the reduction of NRF2, a regulator of cellular resistance to oxidants [163]. [score:4]
Interestingly, some microRNAs that are differentially expressed by CR, have been described as regulators of nutrient sensing pathways (let-7, miR-34, miR-425, miR-16, miR-155, miR-144, miR-451). [score:4]
Xiang C. Cui S. P. Ke Y. MiR-144 inhibits cell proliferation of renal cell carcinoma by targeting MTORJ. [score:4]
It is important to highlight the role of miR-144 as a regulator of these pathways. [score:2]
[1 to 20 of 5 sentences]
27
[+] score: 19
Cq values of the target TLDA card B miRNAs hsa-miR-923, hsa-miR-144* and hsa-miR-21* were further normalised to each selected EC reference gene and relative expression was determined using the 2 [-ΔCq] method, where ΔCq = (Cq [miR] – Cq [endogenous control gene]). [score:5]
The mean fold changes of hsa-miR-923, hsa-miR-144* and hsa-miR-21* expression in nine primary MB specimens in comparison to the mean expression of these miRNAs in CD133+ NSCs and CD133- NPCs. [score:5]
The uniformity of expression of these candidate EC genes was subsequently investigated across all samples, with the relative quantities of miRNAs, hsa-miR-144*, hsa-miR-21* and hsa-miR-923 assessed using five different normalisers, to determine the impact of EC reference gene selection on relative expression of individual miRNAs of interest. [score:3]
In primary MB specimens, the over -expression of three TLDA card B miRNAs, hsa-miR-144*, hsa-miR-21* and hsa-miR-923, was previously described [47]. [score:3]
With the use of suitable EC reference genes, including hsa-miR-425*, RNU24, hsa-miR-877 and EC reference pair, RNU24/hsa-miR-425*, over -expression of all three miRNAs (hsa-miR-21*, hsa-miR-144* and hsa-miR-923) was identified, as previously reported [47]. [score:3]
[1 to 20 of 5 sentences]
28
[+] score: 19
Each graph represents a correlation between miR-142-5p and a separate CpG site that was analyzed by pyrosequencing To gain further insight into the biological meaning of the dysregulation of miR-142-5p, miR-142-3p, miR-21-5p, miR-144-3p, and miR-451a in the autism brain samples, we performed gene ontology analysis on the targets of these microRNAs, using the DIANA-lab software [23]. [score:4]
Of these microRNAs we studied, real-time PCR analysis detected significant upregulation of five microRNAs (Fig.   1), including miR-142-5p (p = 0.0003), miR-142-3p (p = 0.003), miR-21 (p = 0.022), miR-451a (p = 0.007), and miR-144-3p (p = 0.0001). [score:4]
Fig. 1miR-451a, miR-142-5p, miR-142-3p, miR-144-3p, and miR-21-5p are overexpressed in the autism brain samples. [score:3]
We determined that miR-142-5p, miR-142-3p, miR-451a, miR-144-3p, and miR-21-5p are overexpressed in the asd brain. [score:3]
Fig. 3Gene ontology analysis of predicted targets of miR-142-5p, miR-142-3p, miR-21-5p, miR-144-3p, and miR-451a. [score:3]
No CpGs were dysregulated in the genetic regions encoding miR-21, miR-144, or miR-451 [6]. [score:2]
[1 to 20 of 6 sentences]
29
[+] score: 19
All of the miRNAs that were confirmed downregulated in clinical samples compared to bone are known to act as tumor suppressors in other types of cancers, that is miR-1, miR-126/miR-126*, miR-133b, miR-144, miR-195, miR-223 and miR-497 [38], [39], [40], [41], [42], [43]. [score:5]
Among these, miR-126/miR-126*, miR-142-3p, miR-150, miR-223, miR-486-5p and members of the miR-1/miR-133a, miR-144/miR-451, miR-195/miR-497 and miR-206/miR-133b clusters were found to be downregulated in osteosarcoma cell lines. [score:4]
The highly downregulated miRNAs presented in Table 1 were miR-126/miR-126*, miR-142-3p, miR-150, miR-223, miR-363, miR-486-5p and members of the miR-1/miR-133a, miR-206/miR-133b, miR-451/miR-144 and miR-497/miR-195 clusters. [score:4]
A set of miRNAs, miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-142-3p, miR-133b, miR-144, miR-195, miR-223, miR-451 and miR-497 was identified with an intermediate expression level in osteosarcoma clinical samples compared to osteoblasts and bone, which may reflect the differentiation level of osteosarcoma relative to the undifferentiated osteoblast and fully differentiated normal bone. [score:2]
As predicted, the 13 miRNAs miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-133b, miR-142-3p, miR-144, miR-195, miR-223, miR-451 and miR-497 showed opposite regulation when the osteosarcoma clinical samples were compared against bone or osteoblasts. [score:1]
These 13 miRNAs include all the above seven miRNAs (omitting miR-31*) previously described in osteoblasts [8] as well as miR-1, miR-18a, miR-18b, miR-19b, miR-133b and miR-144. [score:1]
miR-144 was undetected in all osteoblasts, and miR-1 and miR-451 was undetected in two and three of the osteoblast samples, respectively. [score:1]
The level of change was significant for nine of these miRNAs; miR-1, miR-9, miR-18a, miR-18b, miR-126, miR-133b, miR-144, miR-195 and miR-223. [score:1]
[1 to 20 of 8 sentences]
30
[+] score: 17
Down-regulation of miR-144-3p, miR-181b-5p, miR-320a, miR-320c, miR-320d and miR-451a separated melanoma from normal skin; and down-regulation of miR-203, miR-205, miR-211 (and its homologue, miR-204), miR-23b, miR-26a and miR-26 distinguished melanoma from nevus. [score:7]
Using DIANA mirPath software [36], gene targets were interrogated for miR-144-3p, miR-181b-5p, miR-320a, miR-320c, miR-320d and miR-451a down-regulated in PCM vs. [score:6]
miR-144-3p, miR-181b-5p, miR-320a, miR-320c, miR-320d and miR-451a were down-regulated in PCM vs. [score:4]
[1 to 20 of 3 sentences]
31
[+] score: 17
miR-144 and −101 downregulate ATXN1 expression, miR-25 does not affect ATXN1 levels Overexpression of miRNA duplexes and miRNA inhibitors followed by western blotting. [score:10]
Human cerebellum and cortex, SCA1 patients and healthy controls[50] miR-144 slightly downregulated in SCA1 cerebellum but strongly induced in the cortex qRT-PCR, TaqMan miRNA assays (Applied Biosystems) for miR-144 and miR-101. [score:3]
A highly conserved miR-144 was found to be related to the aging process but regulated differently between species. [score:2]
The level of miR-144 that was predicted to bind to the ATXN1 3′-UTR was elevated in the cortex. [score:1]
Another key example of the potential involvement of miRNAs, especially miR-144, in brain aging and SCA1 pathogenesis has been provided by a genome-wide microarray analysis [50]. [score:1]
[1 to 20 of 5 sentences]
32
[+] score: 15
We analyzed the expression of various tumor suppressor miRNAs (miR-144, miR-145, and miR-200a, b, c) that are regulated by DCLK1. [score:6]
Tumor suppressor miRNAs miR-144 C. miR-145 D. and miR-200a, b, c E. were significantly (p < 0.0001, except for miR-200c) downregulated in HCC tumors compared with adjacent normal tissue. [score:5]
We observed significant downregulation of miR-144 (Figure 3C and 3F), miR-145 (Figure 3D and 3F), and miR-200a, b, c (Figure 3E and 3F) in HCC tumors compared with adjacent normal tissue. [score:3]
The crossing threshold value was noted for pri-let-7a, pri-miR-144, pri-miR-143, pri-miR-145, and pri-miR-200a miRNAs, and normalized with U6 pri-miRNA. [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 15
Analyzing the expression profile, we found miR-144 down-regulated in cancer, but up-regulated in Parkinson disease and idiopathic Myelofibrosis. [score:11]
Predicted targets of miR-144 are SRF, a transcription factor activated by PDGFa, and FOS that is thought to have an important role in signal transduction, cell proliferation and differentiation [33]– [35]. [score:3]
We found miR-144 to be highly enriched in the PDGFa pathway. [score:1]
[1 to 20 of 3 sentences]
34
[+] score: 15
Further analysis demonstrated that hsa-miR-144-5p expression was highly correlated with hsa-miR-4732-5p and hsa-miR-451a expression, and low hsa-miR-144-3p and hsa-miR-144-5p expression was shown to be the independent risk factors for the onset of esophageal carcinoma. [score:7]
For example, in a cohort of 102 patients who were pathologically diagnosed with esophageal carcinoma, hsa-miR-451a, hsa-miR-144-3p and hsa-miR-144-5p expression in tumor tissues were significantly lower than those in adjacent non-tumor tissues (P < 0.05) [17], which were detected by stem-loop reverse transcription-quantitative polymerase chain reaction and bioinformatics tools. [score:3]
Pearson correlation analysis demonstrated that the expression levels of individual miR-144/451 cluster members were correlated with each other, except for hsa-miR-144-3p and hsa-miR-4732-3p. [score:3]
Kyoto Encyclopedia of Genes and Genomes pathway analysis indicated that miR-144/451 cluster could regulate the cell cycle, which validates it to be a promising biomarker for early detection of esophageal carcinoma [17]. [score:2]
[1 to 20 of 4 sentences]
35
[+] score: 15
Using a co-culture assay with glioma and endothelial cells, Cai et al. (2015) revealed that the knockdown of TUG1 could reduce tight junction protein expression in endothelial cells by down -regulating heat shock transcription factor 2 (HSF2), the target of miR-144, increasing BTB permeability of chemotherapeutic agents. [score:6]
Meanwhile, the results from Liu’s group indicated that the lncRNA TUG1, which is highly expressed in vascular endothelial cells from glioma tissues, could influence BTB permeability via binding to miR-144, further reducing the expression of tight junction proteins in endothelial cells, such as ZO-1, occludin, and claudin-5 (Cai et al., 2015). [score:5]
The long noncoding RNA TUG1 regulates blood-tumor barrier permeability by targeting miR-144. [score:4]
[1 to 20 of 3 sentences]
36
[+] score: 14
Thus, age -associated miR-144 may contribute to declining brain function in both normal and disease states via the downregulation of longevity/protective factors (Figure 1; Persengiev et al., 2011). [score:6]
Genome-wide analysis of miRNA expression reveals a potential role for miR-144 in brain aging and spinocerebellar ataxia pathogenesis. [score:3]
Importantly, the ATXN1 protein (encoded by the gene mutated in SCA1) is a known target of miR-144. [score:3]
For instance, miR-144 is a strong positive correlate of aged brains in humans, chimpanzees, and rhesus macaques (Persengiev et al., 2011). [score:1]
miR-144 is also enriched in post-mortem tissue from SCA1 and AD patients. [score:1]
[1 to 20 of 5 sentences]
37
[+] score: 13
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-215, hsa-mir-140, hsa-mir-193b
A more recent study reported that miR-144/451 inhibits breast cancer and head and neck squamous cell carcinoma (HNSCC) metastasis by targeting ADAMTS5 and ADAM10, and the overexpression of these two proteins being significantly associated with lymph node metastasis and pathological grade [28]. [score:7]
Zhang J Qin X Sun Q Guo H Wu X Xie F Xu Q Yan M Liu J Han Z Chen W Transcriptional control of PAX4-regulated miR-144/451 modulates metastasis by suppressing ADAMs expressionOncogene. [score:6]
[1 to 20 of 2 sentences]
38
[+] score: 12
CFTR is a predicted target of miR-101 and miR-144, and this group further demonstrated that cadmium upregulates the expression of miR-101 and miR-144 (Hassan et al., 2012), suggesting that cadmium, through miRNA induction, may be involved in the pathogenesis of cystic fibrosis. [score:8]
MiR-101 and miR-144 regulate the expression of the CFTR chloride channel in the lung. [score:4]
[1 to 20 of 2 sentences]
39
[+] score: 12
Crtc3 was reduced by miR-144 and miR-21 over -expression, whereas Crtc1 levels where only reduced by miR-21 (Fig. S1a). [score:3]
A less stringent i n silico analysis with only two different target prediction tools identified miR-144 and miR-17 (homo sapiens only) binding sites in the 3′-UTRs of Crtc1 and Crtc3 (Table S1). [score:3]
Additionally, the levels of miR-17, miR-144 and miR-21 significantly correlated with total cell counts in bronchoalveolar lavage (BAL), indicating an increased expression of the miRNAs upon increasing inflammation (Fig. 3b). [score:3]
Ambion [®] Pre-miR Precursors (for miR-17 and miR-144), miRvana miRNA mimics (for miR-21) (Ambion, Austin, USA) or antimiRs (miR-17 and -144) (Ambion, Austin, USA) were transfected in duplicates to a final miRNA concentration of 20 nM per well in a murine lung epithelial cell line (MLE-12) or a human bronchial epithelial cell line (16-HBE14o [−]) 64. [score:1]
To our knowledge the involvement of miR-144 has not been proposed in allergic airway inflammation so far. [score:1]
In total, the 3′UTR of Creb1 contains eight predicted binding sites for miR-17 (three sites), miR-144 (one site), miR-22 (two sites), and miR-181a (two sites) (Fig. 1b). [score:1]
[1 to 20 of 6 sentences]
40
[+] score: 12
A recent study showed that miR-144 directly targeted Smad4 to inhibit the osteogenic differentiation of MSCs [58]. [score:6]
Taken together, the lower expression of exosomal miR-31, miR-221 and miR-144 from the late stage of differentiation may contribute to the induction of osteogenic differentiation, whereas the lower osteogenic differentiation of cells treated by exosomes from expansion or early osteogenic differentiation may partly be due to the delivery of higher exosomal miR-31, miR-221 and miR-144. [score:3]
Furthermore, in the present study, two other negative regulators of osteogenesis, miR-221 and miR-144, were also decreased in exosomes from the late stage of osteogenic differentiation. [score:2]
However, when comparing Exo_D21 with Exo_D3, three microRNAs (miR-31-3p, miR-144-3p and miR-29c-3p) were reduced more than two-fold and two microRNAs (miR-154-5p and miR-10b-5p) were increased more than two-fold. [score:1]
[1 to 20 of 4 sentences]
41
[+] score: 12
Transcriptional control of PAX4-regulated miR-144/451 modulates metastasis by suppressing ADAMs expression. [score:6]
MicroRNA-144 is regulated by activator protein-1 (AP-1) and decreases expression of Alzheimer disease-related a disintegrin and metalloprotease 10 (ADAM10). [score:5]
Additionally, miR-144/451 which has been shown to be induced by A-beta peptide in SH-SY5Y cells decreased ADAM10 protein amount (Cheng et al., 2013). [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 11
We used a combination of two microRNA prediction methods, TargetScan and PicTar, to search for all predicted gene targets of the 5 most highly upregulated (let-7s, miR-21, miR-23b, miR-27a and miR-30a) and downregulated (miR-29b, miR-32, miR-144, miR-197 and miR-212) microRNAs [13]. [score:11]
[1 to 20 of 1 sentences]
43
[+] score: 11
The expression patterns of three other miRNA (miR-451, miR-144, and miR-142) predicted to be expressed in erythroid cells were also examined (Figure 2C). [score:5]
C. Relative expression patterns of the GATA-1 regulated miRNA, miR-451 and miR-144, and hematopoietic tissue-specific microRNA, miR-142. [score:4]
The miR-144 and miR-451 genes are known erythroid miRNA that are regulated by the GATA-1 transcription factor [18, 19]. [score:2]
[1 to 20 of 3 sentences]
44
[+] score: 11
The luciferase assays showed that miR-27b, miR-101, or miR-128 rather than miR-144 or miR-186 (Figure 3A and 3B) displayed more effectively inhibited luciferase activity with an inhibitory rate of more than 30% in pmiR-VEGF-C and miRNAs co -transfected cells, indicating that miR-27b, miR-101, and miR-128 were candidate miRNAs for VEGF-C. Specifically, miR-27b, miR-101, or miR-128 transfection decreased luciferase expression by 41.65 ± 4.60%, 30.36 ± 15.99%, and 51.20 ± 7.3%, respectively in MKN-45 cells (Figure 3C, p = 0.0020, p = 0.0179, or p = 0.0037). [score:6]
Dual-luciferase reporter gene assay showed that miR-27b, miR-101, or miR-128(decreased 38.68% ± 10.86%, 30.36% ± 10.29%, 47.76% ± 13.61%, p = 0.0115, p = 0.0156, or p = 0.0111) respectively, but not miR-144 or miR-186 displayed strong inhibitory effect on the luciferases expression in MKN-45 cells. [score:4]
Five tumor-suppressing miRNAs including miR-27b, miR-101, miR-128, miR-144, and miR-186, which have potential binding sites in the 3′-UTR of VEGF-C (Figure 3A and Supplementary Figure S1A), were selected for further investigation. [score:1]
[1 to 20 of 3 sentences]
45
[+] score: 11
The eight miRNAs selected included the most upregulated miRNAs (miR-512-3p, miR-377-5p, miR-433-3p and miR-1323) and most downregulated miRNAs (miR-33a-5p, miR-551b-3p, miR-3613-5p and miR-144-3p) in OS. [score:7]
Among these, miR-512-3p, miR-377-5p, miR-433-3p and miR-1323 were the greatest upregulated miRNAs, whereas miR-33a-5p, miR-551b-3p, miR-3613-5p and miR-144-3p were the most decreased miRNAs in OS. [score:4]
[1 to 20 of 2 sentences]
46
[+] score: 11
First, miR-101 is located in the genomic loci with a high frequency of allelic losses in several types of cancers, and the down-regulation of miR-101 has been found in a variety of human malignancies including ESCC [26, 45– 61] Second, in our previous study, we found that COX-2 has an important effect on the proliferation and metastasis of ESCC [20– 23, 33, 62– 63]; in our preliminary experiment, among four putative miRNAs (miR-101, miR-143, miR-26a and miR-144) that could bind to the 3 ‘-UTR of COX-2 predicted by at least five databases (as shown above), only miR-101 could inhibit both the proliferation and metastasis of ESCC. [score:6]
Previously, we searched seven databases (Targetscan, Pictar, MiRanda, MiRwalk, Dianamt, Ebi and Microrna) and found four putative miRNAs that could bind to the 3 ‘- untranslated region (UTR) of COX-2 (according to at least five databases), which are miR-101, miR-144, miR-26a and miR-143. [score:5]
[1 to 20 of 2 sentences]
47
[+] score: 10
Numerous studies have shown that miR-99b, miR-100, miR-199a-3p, miR-451, miR-144 and miR-101 can directly or indirectly mediate mTOR expression [18- 23], and reduction of these miRNAs was connected with the elevated levels of mTOR in prostate cancer and endometrial carcinoma [18, 24]. [score:5]
To identify whether miRNAs were involved in radiation induced mTOR aberrant expression and activation, several miRNAs which targeted mTOR kinase including miR-101, miR-144, miR-100, miR-451, miR-199a and miR-99b were tested before and after radiation treatment. [score:5]
[1 to 20 of 2 sentences]
48
[+] score: 9
The met proto-oncogene (MET), which is often amplified in human cancers and functions as an important regulator of cell growth and tumor invasion, has been identified as a direct target of miR-144 [55]. [score:5]
The down-regulation of miR-451a, miR-144, miR-195, miR-218, miR-145, miR-30a, miR-126 and miR-139 has been found in both the training and validation set. [score:4]
[1 to 20 of 2 sentences]
49
[+] score: 9
miR-144 downregulation increases bladder cancer cell proliferation by targeting EZH2 and regulating Wnt signaling. [score:7]
In addition, several other miRNAs, including miR-26a (Wong and Tellam, 2008), miR-98 (Alajez et al., 2010), miR-124 (Zheng et al., 2012), miR-144 (Guo et al., 2013), miR-214 (Derfoul et al., 2011), and let-7 (Kong et al., 2012) are also reported to negatively regulate EZH2 (Figure 2). [score:2]
[1 to 20 of 2 sentences]
50
[+] score: 9
Interestingly, the data identified miR-144 to be the sole miRNA that was consistently upregulated in the aging chimp and human cerebellum and cortex [13]. [score:4]
Interestingly, PDCD4 3′ UTR also contains a conserved response element for miR-144 suggesting that the aging-specific miR-144 might play a role in the inhibition of apoptosis by repressing the activity of PDCD4. [score:3]
The selective increase of miR-144 levels suggests that miR-144 is likely to play a coordinating role in the posttranscriptional regulation of a group of genes that are subjected to strong miRNA control in the aging brain. [score:2]
[1 to 20 of 3 sentences]
51
[+] score: 9
MiR-144*, miR-30d-3p, miR-452, miR-340, miR-202, miR-500, miR-626, miR-330-3p and miR-302c* expression was determined by RT-qPCR in RAFLS (n = 3) and SScHDF (n = 3) stimulated with Poly (I:C) (10 µg/mL) or IFN-γ (0.1 or 5 ng/mL) for 72 h. were normalized to U6snRNA and expressed as fold change compared with samples from RAFLS or SScHDF incubated with medium. [score:4]
uk/enright-srv/microcosm/htdocs/targets/v5) identified several miRNAs candidates: miR-144*, miR-452, miR-340, miR-202, miR-500, miR-626, miR-330-3p, miR-302c* and miR-30 family members (miR-30a, d and e which share the same seed sequence). [score:3]
To evaluate the possible involvement of these miRNAs in BAFF regulation, we first performed RT-qPCR analysis to quantify their expression in RAFLS and SScHDF treated with Poly(I:C) or IFN-γ for 6 h, 48 h and 72 h. This analysis revealed that miR-144*, miR-30d-3p, miR-340, miR-626, miR-330-3p and miR-302c* could not be detected in RAFLS and SScHDF (figure 1S). [score:2]
[1 to 20 of 3 sentences]
52
[+] score: 8
Recently, super ovulation in mice has been shown to downregulate the expression of miRNAs such as miR-122, miR-144, and miR-211, which are involved in the regulation of neuronal migration and differentiation, linking ART -mediated epigenetic susceptibility to neurodevelopmental disorders [136]. [score:8]
[1 to 20 of 1 sentences]
53
[+] score: 8
Other miRNAs from this paper: hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-30a, hsa-mir-32, hsa-mir-33a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-147a, hsa-mir-34a, hsa-mir-187, hsa-mir-204, hsa-mir-205, hsa-mir-200b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-138-2, hsa-mir-142, hsa-mir-125b-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-190a, hsa-mir-200c, hsa-mir-155, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-365b, hsa-mir-328, gga-mir-33-1, gga-mir-125b-2, gga-mir-155, gga-mir-17, gga-mir-148a, gga-mir-138-1, gga-mir-187, gga-mir-32, gga-mir-30d, gga-mir-30b, gga-mir-30a, gga-mir-30c-2, gga-mir-190a, gga-mir-204-2, gga-mir-138-2, gga-let-7d, gga-let-7f, gga-mir-146a, gga-mir-205b, gga-mir-200a, gga-mir-200b, gga-mir-34a, gga-mir-30e, gga-mir-30c-1, gga-mir-205a, gga-mir-204-1, gga-mir-23b, gga-mir-142, hsa-mir-449a, hsa-mir-489, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-33b, hsa-mir-449b, gga-mir-146b, gga-mir-147, gga-mir-489, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-144, gga-mir-460a, hsa-mir-147b, hsa-mir-190b, gga-mir-22, gga-mir-460b, gga-mir-1662, gga-mir-1684a, gga-mir-449c, gga-mir-146c, gga-mir-449b, gga-mir-2954, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, gga-mir-365b, gga-mir-33-2, gga-mir-125b-1, gga-mir-190b, gga-mir-449d, gga-mir-205c
Likewise, from the miRNA-mRNA association, the under expressed genes LZTFL1, JAZF1, THBS2 and RPS14 were associated with microRNAs (miR-146b-5p, miR-1684a-3p, miR-460b-3p, miR-30e-5p, miR-33-5p, miR-148a-5p, miR-32-5p, miR-155 and miR-144-3p) that were down-regulated in pulmonary arteries (Figure 4). [score:6]
We also identified five other microRNAs including miR-489-3p, miR-1662, miR-460b-5p, miR-144-3p and miR-30e-5p, which were involved in the regulation of HIF1α in these data. [score:2]
[1 to 20 of 2 sentences]
54
[+] score: 8
Statistical analysis was made on Ct values normalized with a housekeeping gene; one-way ANOVA followed by Tukey’s HSD post hoc tests Three of the most down-regulated miRNAs in the metastatic group, revealed in tumour samples in our microarray analysis (cfa-miR-144, cfa-miR-32 and cfa-miR-374a), and hsa-miR-1246, known for its deregulation in plasma from human breast cancer patients [28], were chosen for the evaluation in plasma samples. [score:3]
Relative expression of cfa-miR-144, cfa-miR-32 cfa-miR-374a and hsa-miR-1246 in plasma samples from dogs with non-metastatic and metastatic tumours. [score:3]
P-values vary from 0.6 in cfa-miR-144, 0.89 in cfa-miR-32, to 0.27 in cfa-miR-374a in contrast to <1e [−07] in tumour samples and fold change 4.74, 3.54 and 3.24, respectively. [score:1]
However, validation of cfa-miR-144, cfa-miR-32 and cfa-miR-374a levels in blood samples did not follow changes observed in the non-metastatic and metastatic tumours. [score:1]
[1 to 20 of 4 sentences]
55
[+] score: 8
For example, miR-144/451 inhibits cancer metastasis by targeting ADAMTS5 and ADAM10 in human epithelial cancers [36]; miR-122-5p reduces trastuzumab resistance by regulating ADAM10 in breast cancer [37]; miR-140-5p can repress tumor progression by targeting ADAM10 in human tongue and hypopharyngeal squamous cancer cells [38, 39]. [score:8]
[1 to 20 of 1 sentences]
56
[+] score: 7
Among the fifteen miRNAs in the top group, two miRNAs were highly likely to be upregulated, i. e., hsa-miR-24and hsa-miR-885-5p, whereas thirteen miRNAs were highly likely to be downregulated, i. e., hsa-miR-26b, hsa-let-7b, hsa-miR-185, hsa-miR-142-3p, hsa-miR-29b, hsa-miR-483-5p, hsa-miR-144*, hsa-miR-145*, hsa-miR-629*, hsa-miR-222*, hsa-miR-497, hsa-miR-675 and hsa-miR-106b*, in the eutopic endometrium of patients with endometriosis compared with the controls (Table 2). [score:6]
319hsa-miR-144*0.140.08557.828.90.490.2960.686.650.30.34−3.31−2.8910hsa-miR-145*1.040.877.4612.372.391.875.388.90.430.34−2.3−2.9411hsa-miR-629*1.531.35287.8815.11.91.3169.05100. [score:1]
[1 to 20 of 2 sentences]
57
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-19a, hsa-mir-21, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-199a-1, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-205, hsa-mir-214, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-128-1, hsa-mir-141, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-146a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-29c, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-133b, hsa-mir-429, hsa-mir-487a, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-526b, hsa-mir-514a-1, hsa-mir-514a-2, hsa-mir-514a-3, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-656, hsa-mir-542, hsa-mir-378d-2, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-1275, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-2114, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-514b, hsa-mir-378c, hsa-mir-4303, hsa-mir-4309, hsa-mir-4307, hsa-mir-4278, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Another miRNA gene, miR-144, was downregulated and had reported increased bladder cancer cell proliferation by targeting EZH2 and regulating Wnt signaling [40]. [score:7]
[1 to 20 of 1 sentences]
58
[+] score: 7
Specifically, five miRNAs (miR-26b, miR-26a, miR-212, miR-107, and miR-103) were upregulated and twelve miRNAs (miR-125b, miR-141, miR-144, miR-164, miR-145, miR-143, miR-15b, miR-16, miR-186, let-7b, let-7a3, and miR-128) were downregulated. [score:7]
[1 to 20 of 1 sentences]
59
[+] score: 7
However, only a small number of microRNAs, including miR-28, miR-93, miR-144, miR-153, miR-27a, miR-132, and miR142-5p, have been confirmed experimentally to directly bind to the 3′UTR of Nrf2 and consequently downregulate gene expression [104– 108]. [score:7]
[1 to 20 of 1 sentences]
60
[+] score: 7
According to these criteria, we found that 6 miRNAs (miR-144-5p, -15a-5p, -181c-5p, -194-5p, -889-3p and novel-mir-96) were down-regulated and 4 (let-7d-5p, miR-106b-5p, -130a-3p, and -146a-5p) were up-regulated in epilepsy patients compared to controls (Supplementary Table S1). [score:6]
The detection rates of miR-889-3p were less than 75%; no significant difference was observed in the levels of miR-144-5p, and -181c-5p between epilepsy patients and controls (P > 0.05). [score:1]
[1 to 20 of 2 sentences]
61
[+] score: 7
In ATL cells, upregulated miRNAs include miR-144-5p, 183, 451, and 509-3p, while downregulated miRNAs include let-7b, 7c, 7e, miR-17, 26a, 31-3p, 31-5p, 95, 99a, 99b, 125a-5p, 125b, 146b-5p, 148b, 151-3p, 151-5p, 181a, 181c, 215, 222, 328, 423-5p, 571, and 874. [score:7]
[1 to 20 of 1 sentences]
62
[+] score: 7
Using human iPSC-derived RPE cells under Paraquat stress, Garcia et al. showed upregulation of miR-146a and miR-29a, downregulation of miR-144, miR-200a and miR-21, whereas a biphasic response was seen on miR-27b [45]. [score:7]
[1 to 20 of 1 sentences]
63
[+] score: 7
CSE skin identified only two downregulated miRNAs, miR-30* and miR-144, whereas no miRNA was found to be upregulated in AK. [score:7]
[1 to 20 of 1 sentences]
64
[+] score: 6
For instance, weak expression of miR-150 and miR-222 coupled with abundant expression of miR-451, miR-144 and miR-146b has been described in human erythrocytes from EPO -induced CD34 [+] cells and adult bone marrow [25, 28– 29]. [score:5]
Deficiency or attenuation of miR-144 and miR-451 has been shown to impair late erythroid maturation, which then leads to splenomegaly, erythroid hyperplasia and mild anemia [22– 24]. [score:1]
[1 to 20 of 2 sentences]
65
[+] score: 6
Finally, mir-144 is expressed in the hippocampus of rats and is known to be influenced by both valproate and the mood stabilizer lithium [38]; mir-144 is found to be only differentially expressed in individuals categorized as “disorganized” SCZ. [score:5]
For instance, the miRNA family 34 were only significant in the undifferentiated subtype and mir-144 was only associated with the disorganized subtype (Supplementary Table 4). [score:1]
[1 to 20 of 2 sentences]
66
[+] score: 6
The expression of the miR-144/451 cluster is regulated by GATA-4, a critical transcription factor in the heart, and the miR-144/451 cluster protects against I/R -induced cardiomyocyte apoptosis [77]. [score:4]
Zhang X. Wang X. Zhu H. Zhu C. Wang Y. Pu W. T. Jegga A. G. Fan G. C. Synergistic effects of the GATA-4 -mediated miR-144/451 cluster in protection against simulated ischemia/reperfusion -induced cardiomyocyte death J. Mol. [score:1]
3.2.7. miRNAs Related to Cardiomyocyte Cell Death: miR-15, miR-21, and miR-144/451 Cluster. [score:1]
[1 to 20 of 3 sentences]
67
[+] score: 6
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-32, mmu-mir-1a-1, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-144, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-200b, mmu-mir-206, hsa-mir-208a, mmu-mir-122, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-214, hsa-mir-200b, mmu-mir-299a, mmu-mir-302a, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-134, hsa-mir-206, mmu-mir-200a, mmu-mir-208a, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-328, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-214, mmu-mir-135a-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, hsa-mir-361, mmu-mir-361, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-377, mmu-mir-377, hsa-mir-328, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-20b, hsa-mir-429, mmu-mir-429, hsa-mir-483, hsa-mir-486-1, hsa-mir-181d, mmu-mir-483, mmu-mir-486a, mmu-mir-367, mmu-mir-20b, hsa-mir-568, hsa-mir-656, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-744, mmu-mir-181d, mmu-mir-568, hsa-mir-892a, hsa-mir-892b, mmu-mir-208b, hsa-mir-744, hsa-mir-208b, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-1307, eca-mir-208a, eca-mir-208b, eca-mir-200a, eca-mir-200b, eca-mir-302a, eca-mir-302b, eca-mir-302c, eca-mir-302d, eca-mir-367, eca-mir-429, eca-mir-328, eca-mir-214, eca-mir-200c, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-mir-133a, eca-mir-144, eca-mir-25, eca-mir-135a, eca-mir-568, eca-mir-133b, eca-mir-206-2, eca-mir-1-2, eca-let-7f, eca-mir-24-2, eca-mir-134, eca-mir-299, eca-mir-377, eca-mir-656, eca-mir-181a, eca-mir-181b, eca-mir-32, eca-mir-486, eca-mir-181a-2, eca-mir-20b, eca-mir-361, mmu-mir-486b, mmu-mir-299b, hsa-mir-892c, hsa-mir-486-2, eca-mir-9021, eca-mir-1307, eca-mir-744, eca-mir-483, eca-mir-1379, eca-mir-7177b, eca-mir-8908j
More precisely, we identified five miRNAs expressed at the level > 10 cpm solely in PSSM GM muscle: eca-miR-144, eca-miR-20b, ecaub_novel-miR-472, ecaub_novel-miR-568, and ecaub_novel-miR-892. [score:3]
The miR-144 was also expressed at >10 cpm level in bone and eca-miR-20b in bone and liver (Additional file 3: Table S2). [score:3]
[1 to 20 of 2 sentences]
68
[+] score: 6
Other miRNAs from this paper: hsa-mir-675
Knockdown of TUG1 increases blood-tumor barrier (BTB) permeability via binding to miR-144 and reducing tight junction protein expression in endothelial cells through targeting HSF2. [score:6]
[1 to 20 of 1 sentences]
69
[+] score: 6
Herein, 29 miRNAs out of our 32 differentially dysregulated miRNAs were overexpressed, while three (miR-144-3p, 150-5p, 96-5p) were down-expressed. [score:6]
[1 to 20 of 1 sentences]
70
[+] score: 6
Tumour-suppressive microRNA-144–5p directly targets CCNE1/2 as potential prognostic markers in bladder cancer. [score:6]
[1 to 20 of 1 sentences]
71
[+] score: 6
In fact, bioinformatic analysis indicated BCL11A as a potential target of miR-144 which, together with miR-451, specifically regulate erythropoiesis [9], [56]. [score:4]
Erythropoiesis was reported to be promoted by miR-451 and miR-144 [9], [10] and negatively regulated by miR-150 [11], miR-221, miR-222 [12] and miR-223 [13]. [score:2]
[1 to 20 of 2 sentences]
72
[+] score: 5
An in silico search for putative binding sites of differentially abundant miRNAs was performed using TargetScan 6.0 [26]; note that non-conserved miRNAs (ENSGALT00000042483-3p, ENSGALT00000043002-3p, ENSGALT00000043002-5p, gga-miR-1736-3p) and those with borderline differential abundance (adjusted P-values of 0.0498; ccr-miR-133a-5p, mmu-miR-144-5p, gga-miR-20a, aca-miR-499-3p) were not included in the functional analysis. [score:3]
This set includes five mature miRNAs (hsa-let-7a-3p, ccr-miR-133a-5p, mmu-miR-144-5p, aca-miR-21-3p and hsa-miR-30c-2-3p), which are present in miRBase as Gallus gallus mature miRNAs with a different 3′ editing (Table 2). [score:1]
c Difference with mmu-miR-144-5p: missing U in 3′. [score:1]
[1 to 20 of 3 sentences]
73
[+] score: 5
Ectopic overexpression of control miR-144 (10 µM) did not result in any observable phenotype in zebrafish embryos at 2 dpf. [score:3]
A sequence unrelated miRNA (miR-144) was used as control. [score:1]
Non -injected control (NIC), control mimic (miR-144) and miR-125b mimic. [score:1]
[1 to 20 of 3 sentences]
74
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
Genome-wide analysis of miRNA expression reveals a potential role for miR-144 in brain aging and spinocerebellar ataxia pathogenesis. [score:3]
Similarly, it has been demonstrated that miRNA-144 can possibly bind to the 3UTR of programmed cell death protein 4 (PDCD4), which shows that miRNA-144 might be crucial in apoptotic mechanisms during AD development (Persengiev et al., 2011). [score:2]
[1 to 20 of 2 sentences]
75
[+] score: 5
In the down-regulated group, there are seven miRNA pairs (miR-139, miR-29c, miR-145, miR-378, miR-30a, miR-143 and miR-144) with both the 5p-arm and 3p-arm identified as significantly dys-regulated miRNAs. [score:5]
[1 to 20 of 1 sentences]
76
[+] score: 5
Down-regulation of miR-144 after Mycobacterium tuberculosis infection promotes inflammatory factor secretion from macrophages through the Tpl2/ERK pathway. [score:4]
However, the following miRNAs are known to be involved in the MΦ response to mycobacterial infection: miR-144 (40), miR-132 (32), miR-26a (32), miR-155 (41), miR-146a (41), miR-145 (41), miR-222 (41), miR-27a (41), miR-27b (41), and miR-125b (42). [score:1]
[1 to 20 of 2 sentences]
77
[+] score: 5
Other miRNAs from this paper: hsa-mir-215, hsa-mir-132, hsa-mir-200c
Notably, a number of miRs, including miR-132 (24), miR-144 (25) and miR-200c (26), participate in the regulation of ZEB2 activity in various tissues; however, the potential regulatory effect of miR-215 on ZEB2 expression in NSCLC has not been confirmed. [score:5]
[1 to 20 of 1 sentences]
78
[+] score: 5
The miR-451/miR-144 cluster has been found to play a crucial role in erythropoiesis and the miRNA hsa-miR-150 is involved in myelopoiesis, megakaryopoiesis, B- and T-cell development, and NK cell development [34]– [36]. [score:3]
In detail, we found five miRNAs deregulated after exhaustive exercise in elite endurance athletes, namely hsa-miR-144*, hsa-miR-150, hsa-miR-320b, hsa-miR-3656, and hsa-miR-494. [score:2]
[1 to 20 of 2 sentences]
79
[+] score: 5
Forced overexpression of miR-144 remarkably reduces cell proliferation, increases apoptosis, and suppresses migration and invasion of HCC cells [89]. [score:5]
[1 to 20 of 1 sentences]
80
[+] score: 5
11 miRs from the 34 extra targets on Septin7, which were found only by HuMiTar although these miRs are included in PicTar's database, i. e. miR-148, miR-106b, miR-134, miR-106, miR-144, miR-151, miR-384, miR-101, miR-142, miR-129, and miR-126. [score:3]
Analysis of 39 miRs that were predicted exclusively by HuMiTar shows that 11 of them (miR-101, miR-126, miR-129, miR-134, miR-144, miR-151, miR-202, miR-384, miR-412, miR-450, miR-453) are included in the Western blot on Figure 3. Among them, nine are true positives, miR-453 is a borderline case, and miR-412 is a false positive. [score:1]
The Septin7 expression levels were measured (left to right) for (1) control sample, (2) miR-127, (3) miR-182, (4) miR-412, (5) miR-19a, (6) miR-453, (7) miR-448, (8) miR-450, (9) miR-183, (10) miR-141, (11) miR-202, (12) miR-148, (13) miR-106b, (14) miR-134, (15) miR-106, (16) miR-144, (17) miR-151, (18) miR-384, (19) miR-101, (20) miR-142, (21) miR-129 and (22) miR-126. [score:1]
[1 to 20 of 3 sentences]
81
[+] score: 5
Recently, we reported that the transcription factor RUNX1 is a suppressor of erythroid TAL1 target genes such as KLF1 and the microRNA miR-144/451 [15, 17]. [score:5]
[1 to 20 of 1 sentences]
82
[+] score: 5
A new association is reported about the miRNA bicluster composed of sf-hsa-miR-451-DICER1, sf-hsa-miR-144, sf-hsa-miR-486: our biclustering showed an over -expression of this bicluster in a sub-class of IDC/her2 positive patients. [score:3]
Instead in [33] it is reported that miR-144 and miR-451 clustered together but were abundant in normal breast and reduced in IDC. [score:1]
Interestingly SAMBA algorithm also reported the association among miR-451-DICER1, miR-144 and miR-486. [score:1]
[1 to 20 of 3 sentences]
83
[+] score: 5
Increased expression of ZFX negatively correlates with microRNA-144 expression and may contribute to bone marrow metastasis in gastric cancer [13]. [score:5]
[1 to 20 of 1 sentences]
84
[+] score: 5
Recently, a study demonstrated miR-143/145 and miR-144/451 cluster members were significantly downregulated in liposarcoma compared to adipocytes indicating their potential role as tumor suppressors (Gits et al., 2014). [score:5]
[1 to 20 of 1 sentences]
85
[+] score: 5
The miRNAs which can potentially target PTGS2 are miR-199a*, miR-26a, miR-26b, miR-144, and miR-101, and it is noteworthy that miR-199a-5p and miR-199a-3p are also among the significantly down-regulated miRNAs in the reflected amnion of term in labor cases compared to the placental amnion. [score:5]
[1 to 20 of 1 sentences]
86
[+] score: 5
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Thus miR-144* was substantially more expressed than miR-144 in both metastatic and non-metastatic libraries; similarly miR-126* was more expressed than miR-126, but only in the non-metastatic library. [score:5]
[1 to 20 of 1 sentences]
87
[+] score: 5
Sweet-P inhibits miR144 binding to the 3′UTR of human GRβ, resulting in reduced expression. [score:5]
[1 to 20 of 1 sentences]
88
[+] score: 5
miRNA expression profiling is challenging as mature miRNAs are; i) short single stranded RNAs (22–24 nts); ii) their CG content varies between 33% of hsa-miR-144 and 89% of hsa-miR-4665-3p resulting in a wide range of Tms; iii) miRNAs only represent a small fraction of the cellular RNA; iv) miRNA target sequence is contained in its precursors (i. e. pri- and pre-miRNAs); and v) miRNAs are redundant and exist in families where individual members can differ by just a single nucleotide 27. [score:5]
[1 to 20 of 1 sentences]
89
[+] score: 4
Other miRNAs from this paper: hsa-mir-140
In the literature, there is also support for the association of lncRNAs with small RNAs; for example, lnc-TUG1 is known to regulate blood–tumour barrier permeability by targeting miR-144. [score:4]
[1 to 20 of 1 sentences]
90
[+] score: 4
In endometrioid tumors, miR-21, miR-182, and miR-205 are considerably overexpressed while miR-144, miR-222, and miR-302a have reduced expression compared to normal. [score:4]
[1 to 20 of 1 sentences]
91
[+] score: 4
Nevertheless, the individual study reported by Xie et al. [98], where the data for meta-analysis is derived from, showed that miR-10b*, miR-144, and miR-451 in WS, and miR-10b*, miR-144, miR-21, and miR-451 in CFS were significantly up-regulated in patients with ESCC, with sensitivities of 89.7%, 92.3%, 84.6%, 79.5%, 43.6%, 89.7%, and 51.3%, and specificities of 57.9%, 47.4%, 57.9%, 57.9%, 89.5%, 47.4%, and 84.2%, respectively, therefore demonstrating that saliva miRNAs possess discriminatory power for detection of ESCC. [score:4]
[1 to 20 of 1 sentences]
92
[+] score: 4
Among them, hsa-mir-374a and hsa-mir-144 are two extreme cases, at which the miRBase-annotated minor arms individually have about 17 or 28 times as high expression levels as the miRBase-annotated major arms have. [score:3]
For the pre-miRNAs originally annotated to encode miRNAs at both arms, the major arms of hsa-mir-374a, hsa-mir-500a, hsa-mir-625 and hsa-mir-136 are their 5p arms; while, the major arms of hsa-mir-664, hsa-mir-144, hsa-mir-493 and hsa-mir-376a-1 are their 3p arms. [score:1]
[1 to 20 of 2 sentences]
93
[+] score: 4
Moreover, the miR-143/miR-145 cluster (gene region 5q32) is downregulated along with the miR-144/451 (gene region 17q11.2) cluster in liposarcoma, in contrast to benign adipocytic tumours [38]. [score:4]
[1 to 20 of 1 sentences]
94
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, hsa-mir-676, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The miRNA families that change expression in both mouse and human were: let-7, miR-7, miR-15, miR-101, miR-140, miR-152 (all validated by qPCR, P < 0.05), as well as miR-17, miR-34, miR-135, miR-144, miR-146, miR-301, miR-339, miR-368 (qPCR not performed). [score:3]
39E-0218mmu-miR-138-5pmir-1380.2612.849.05E-053.20E-0340mmu-miR-140-3pmir-1400.197.891.23E-031.94E-0246mmu-miR-144-3pmir-1440.256.882.38E-033.30E-0268mmu-miR-145-5pmir-1450.177.038.25E-037.73E-0248mmu-miR-146b-5pmir-1460.167.502.60E-033.38E-0225mmu-miR-152-3pmir-1480.196.472.22E-045.65E-0331mmu-miR-149-5pmir-1490.227.694.26E-048.75E-0314mmu-miR-16-5pmir-150.2910.942.74E-051. [score:1]
[1 to 20 of 2 sentences]
95
[+] score: 4
Several miRNAs were identified as deeply involved in the erythroid phenotype, including miR-15a, miR-16-1, miR-126, miR-144, miR-451 and miR-210 are believed to regulate several functions of erythroid cells such as maturation and proliferation of early erythroid cells, expression of fetal γ-globin genes and enucleation [5]. [score:4]
[1 to 20 of 1 sentences]
96
[+] score: 4
We found that compared to medium, moDCs stimulated with B0213 showed significantly increased expression of hsa-miR-132-3p, hsa-miR-144-3p, hsa-miR-147a, hsa-miR-155-5p, hsa-miR-503-3p, and hsa-miR-99b-5p and a decreased expression hsa-miR-222-3p (Fig.   3c). [score:4]
[1 to 20 of 1 sentences]
97
[+] score: 4
miR-144-3p and miR-17-5p can respectively recognize 19 and 17 miR-122a targets. [score:3]
These 9 DNmiRs are miR-144-3p, 17-5p, 93-5p, 322-5p, 19a-3p, 31-5p, 145a-5p, 335-5p and 345-5p (Tables S4.1 and S4.2). [score:1]
[1 to 20 of 2 sentences]
98
[+] score: 4
Genome-wide analysis of miRNA expression reveals a potential role for miR-144 in brain aging and spinocerebellar ataxia pathogenesis. [score:3]
More recently, it has been shown that, miR-144 and miR-101 play a central role in modulating the levels of ATXN1 (Persengiev et al., 2011). [score:1]
[1 to 20 of 2 sentences]
99
[+] score: 4
In addition, hsa-miR-144 has been associated with regulation of the insulin receptor substrate 1 (IRS1) that controls the metabolic state of the cell [58] and of the MITF gene, which encodes the microphthalmia -associated transcription factor [59]. [score:2]
1:109593703) identified in the binding site of hsa-miR-144 in Patients 11, 13, 22, and 24 (Table 6). [score:1]
It is possible that the two deletions in the binding site of hsa-miR-144 affect the hsa-miR-450b-5p binding site, which is only 2 nucleotides downstream. [score:1]
[1 to 20 of 3 sentences]
100
[+] score: 4
Among the individual miRNAs represented on the microarray, six of the apoptosis -associated miRNAs, including let-7a, let-7c, miR-10a, miR-26, miR-142 and miR-144, were significantly up-regulated by anisomycin. [score:4]
[1 to 20 of 1 sentences]