sort by

166 publications mentioning hsa-mir-191 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-191. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 356
Recently, Dong et al. reported that high miR-191 expression was associated with CRC tumor invasion by directly targeting tissue inhibitor of metalloprotease 3 (TIMP3), a pro-apoptotic gene in various cancers and diseases [25]. [score:10]
C/EBPβ was identified as a target of miR-191 and ectopic expression of C/EBPβ impaired the effect of miR-191 overexpression on CRC by activating expression of downstream genes, including p15, p16 and p57 (Figure 7). [score:9]
Anticancer reagents, such as 5-Fu and etoposide, inhibited the expression of miR-191 and sustained up-regulation of miR1-191 reduced cell susceptibility to 5-Fu. [score:8]
The present study provides evidence indicating that inhibition of miR-191 suppresses the proliferation of colorectal cells and tumorigenicity in vivo, and that miR-191-down-regulated cells are more sensitive to 5-Fu -induced cell apoptosis. [score:8]
Mechanistically, we found that miR-191 functioned as an ‘oncomiR’ by directly targeting the tumor suppressor C/EBPβ and that there was a negative correlation between miR-191 and C/EBPβ expression. [score:8]
Overexpression of miR-191 inhibited the cleavage of caspase-3, and suppression of miR-191 overtly induced the cleavage of caspase-3 (Figure 4F). [score:7]
In the present report, we showed that up-regulation of miR-191 was a frequent event in colon cancers and that this up-regulation increased cell viability and promoted cell proliferation and tumorigenicity of HCT116 cells. [score:7]
Di Leva et al. reported that cell cycle regulatory proteins such as CDK6 and CCND2 were established as targets of miR-191 in thyroid carcinoma and aggressive breast cancer and showed that miR-191 -mediated down-regulation of CDK6 led to reduced cell proliferation [16, 20]. [score:7]
To explore the molecular mechanism responsible for the function of miR-191 in CRC, we used three publicly available databases (TargetScan, picTar and miRanda) to search for predicted direct target genes of miR-191. [score:6]
Notably, there were three colon cancer tissues displayed a 3-fold down-regulation of miR-191 expression. [score:6]
Conversely, inhibition of miR-191 resulted in the up-regulation of the levels of C/EBPβ (Figure 5D, 5E and Supplementary Figure 1B and Figure 2B). [score:6]
On the other hand, miR-191 suppresses the level of C/EBPβ, a tumor suppressor gene functions as a transcriptional activator of p15, p16 and p57, which are the key regulators of cell cycle and cell survival. [score:6]
Xi et al. reported that miR-191 was up-regulated in tumors with a p53 deletion [22]; therefore, it is possible that inhibition of miR-191 renders the cells more susceptible to p53 -dependent stress responses. [score:6]
These results were partially consistent with the previous reports which showed that miR-191 inhibition induced cell apoptosis by upregulation of pro-apoptotic TIMP3. [score:6]
miR-191 down-regulates the expression of C/EBPβ. [score:6]
miR-191 expression values were expressed as ratios with U6 snRNA (×10). [score:5]
Notably, the levels of p16, p15 and p57, which are important cell cycle inhibitors, were decreased when miR-191 was overexpressed. [score:5]
Louis, MO, USA) Has-miR-191-5p mimic, has-miR-191-5p inhibitor and the corresponding mimic/inhibitor control oligo were purchased from Guangzhou RiboBio Co. [score:5]
miR-191 was expressed in all six cell lines, and HCT116 displayed a higher expression level of miR-191 (Figure 1B). [score:5]
We showed that miR-191 expression was significantly up-regulated in colon cancer tissues compared to adjacent non-cancerous lung tissues. [score:5]
Quantitative PCR analysis showed that the expression of miR-191 increased by 3.6-fold and decreased by 12.8-fold following miR-191 mimic or inhibitor transfection, respectively. [score:5]
Previous work has demonstrated that miR-191 was deregulated in a wide range of human cancers, including breast cancer [16], hepaotocellular carcinoma [17], thyroid follicular tumors [18] and acute myeloid leukemia [19]; and this deregulation may be associated with clinical stage, patient survival and disease prognosis. [score:5]
To determine the correlation between miR-191expression and the C/EBPβ level, we analyzed the mRNA and protein levels of C/EBPβ in the same set of specimens shown in Figure 1A, and the results showed that the miR-191 level was inversely correlated with C/EBPβ expression (Figure 5F–5H). [score:5]
Ectopic expression of C/EBPβ diminished the role of miR-191 on cell viability (Figure 6C), and LAP2 transfection induced the expression of p16, p15 and p57. [score:5]
These results further indicated that C/EBPβ is a direct target of miR-191. [score:4]
Previous reports have shown that miR-191 is deregulated in various cancers and diseases and depending on the tissue and context conditions, miR-191 may exhibit specific functions [16– 20]. [score:4]
However, considering technology and the number of patients limitations in our study, cancer or disease specific mouse mo dels, such as tissue-specific transgenic or knockout mice, would be extremely helpful to verify miR-191 therapeutic potential. [score:4]
We considered that the tumor promoting role of miR-191 in CRC was primarily due to the suppression of cell cycle inhibitors. [score:4]
Our results demonstrated that miR-191 was up-regulated in the majority of examined tumor tissues, with 10 of 16 (62.5%) tumor tissues displaying a more than 38% increase, which suggested a probable ‘oncomiR’ role of miR-191 in colorectal cancer. [score:4]
The introduction of miR-191 inhibitor led to a significant decrease in cell viability when compared with the inhibitor control (Figure 4D). [score:4]
These data suggested that C/EBPβ is a direct target of miR-191 in CRC. [score:4]
To elucidate the effect of miR-191 on cell cycle regulation, HCT116 cells transfected with miR-191 mimic or inhibitor were subjected to flow cytometry. [score:4]
Figure 7 In colorectal cancer cells, various anticancer drugs regulate the expression of miR-191. [score:4]
In colorectal cancer cells, various anticancer drugs regulate the expression of miR-191. [score:4]
miR-191 inhibition effectively suppressed tumor growth in nude mice, as determined by the retarded tumor growth rate, reduced tumor volume and decreased tumor weight compared with the negative control (Figure 2D, 2E, 2F). [score:4]
We found that miR-191 induced the expression of CDK4, a key regulator in the G1-to-S cell cycle transition; however, the changes in the cyclin D1 and cyclin E levels were not significant. [score:4]
miR-191 is upregulated in colon cancers. [score:4]
miR-191 is up-regulated in colon cancers. [score:4]
The wild-type (WT) or mutant 3′ UTR, in which the seed region was mutated to abolish miR-191 binding, was cloned into the psiCheck-2 plasmid (Figure 5B), and a dual-luciferase reporter system was employed to verify whether C/EBPBβ is a direct target of miR-191. [score:4]
Due to the regulation of C/EBPβ and downstream signaling by miR-191, the specific inhibition of miR-191 or when in combination with 5-Fu may be useful for the treatment of human colorectal cancer. [score:4]
It has been reported that miR-191 is a regulator of cell fate that inhibits cell apoptosis in colorectal carcinoma and hepatocellular carcinoma and miR-191 can be induced by various stimuli such as hypoxia and serum starvation [17, 20, 25]. [score:4]
miR-191 directly targets the 3′ UTR of C/EBPβ. [score:4]
Several reports indicated that miR-191 is up-regulated in human colorectal cancers by using high throughput sequencing [22– 24]. [score:4]
Compared with the inhibitor control, inhibition of miR-191 clearly increased the apoptotic rates of HCT116 cells treated with 5-Fu (Figure 4G). [score:4]
Interestingly, we found that the level of miR-191 was down-regulated by etoposide, a commonly used anticancer agent and an inducer of DNA double-strand breaks and cell apoptosis. [score:4]
Our data showed that the level of CDK4, the key regulator of cell cycle progression, was altered when miR-191 was up- or down- regulated. [score:3]
Ectopic overexpression of miR-191 promoted cell proliferation in HCT116 cells and tumorigenicity in vivo in a nude mouse mo del. [score:3]
In the current study, we examined the expression of miR-191 in different human colorectal cancer cell lines and tissues. [score:3]
Sustained miR-191 overexpression was associated with increased viability, cell proliferation and tumorigenicity in vivo, and we further revealed that miR-191 promoted cell resistance to chemotherapeutic agents such as 5-Fu. [score:3]
Furthermore, miR-191 mimic transfected cells displayed more DNA synthesis, while miR-191 inhibition delayed the G1-to-S cell cycle transition. [score:3]
On one hand, miR-191 induces the expression of CDK4 to increase cell growth. [score:3]
Therefore, identification of the effects of miR-191 and its targets in CRC may lead to new perspectives for gene therapy clinical trials. [score:3]
Several studies have provided strong evidence that miR-191 is overexpressed in human CRC [22– 24]. [score:3]
Our further study showed that miR-191 was involved in the 5-Fu -induced cell apoptotic pathway and that miR-191 overexpression increased cell resistance to 5-Fu -induced cell apoptosis. [score:3]
In addition, C/EBPβ overexpression partially abolished the effects of miR-191 in CRC cells. [score:3]
Here, miR-191 expression was further analyzed in 16 paired colon and adjacent non-tumor colon tissues by way of real-time PCR. [score:3]
On the contrary, miR-191 inhibition by sponge-miR-191 decreased cell viability in HCT116, R KO, HT29 and SW480 cells (Figure 2B, Supplementary Figure 1A and Figure 2A). [score:3]
miR-191 functions as an estrogen inducible oncomiR in breast cancer, and mediate enhanced cell proliferation and migration by targeting SATB1 [20]. [score:3]
Seven candidate targets of miR-191 (unpublished and we are doing further research) were screened. [score:3]
In contrast, miR-191 inhibition by sponge-miR-191 led to a decrease in the level of CDK4 and an increase in the levels of p15, p16, p27 and p57 (Figure 3F, 3G). [score:3]
HCT116 cells were transfected with the miR-191 mimic/mimic control (D) or miR-191 inhibitor/inhibitor control (E) for 48 hours and total mRNA and protein were extracted and analyzed by RT-PCR and western blotting analysis, respectively. [score:3]
On the contrary, the miR-191 inhibitor restrained the G1-to-S cell cycle transition. [score:3]
The results indicated that the mRNA and protein levels of C/EBPβ were impaired under conditions of miR-191 overexpression. [score:3]
In addition, miR-191 reduced growth and cell migration by targeting CDK6 in thyroid follicular tumor [18]. [score:3]
Furthermore, the expression of miR-191 was negatively related to the level of C/EBPβ in 16-paired tumor and non-tumor patient samples. [score:3]
To assess the role of miR-191 in the growth of CRC, stable miR-191 -expressing cell lines were prepared using lenti-virus -mediated gene transfer, wherein the plemiR-191 and sponge-miR-191 were used as mediators for gain- and loss- of -function studies, respectively. [score:3]
In hepatocellular carcinoma, miR-191 was identified as an oncogene and its inhibition led to decreased cell proliferation and induced apoptosis in vitro and in vivo [17]. [score:3]
Our study demonstrated a higher expression of miR-191 in colon cancer patients, which is consistent with previous reports [22]. [score:3]
In addition, HCT116 cells transfected with the miR-191 -mimic or miR-191 -inhibitor were subjected to flow cytometry analysis. [score:3]
Our study revealed that endogenous miR-191 was regulated by 5-Fu in a dose -dependent manner, which is consistent with results of a previous study [36]. [score:2]
In this study, we demonstrated that miR-191 could directly bind to the 3′UTR region of C/EBPβ and decrease its mRNA and protein levels, which suggests a novel signaling mechanism wherein miR-191 functions as an ‘onco-miR’. [score:2]
In contrast, the Bcl-2 level was higher in cells transfected with the miR-191 -mimic and lower in cells transfected with the miR-191 -inhibitor when compared with the corresponding control group (Figure 4E). [score:2]
The mRNA level of Bax decreased in cells transfected with the miR-191 -mimic and increased by 50% in cells transfected with the miR-191 -inhibitor when compared with the control group. [score:2]
Considering the high mutation rate of p53 in human CRC, it would be intresteing to see whether introduction of miR-191 into CRC cells can modulate p53 activity and uncover the mechanism of miR-191 action. [score:2]
Collectively, this evidence strongly suggests that C/EBPβ is regulated by miR-191 in human colorectal cancer, although the signal transduction is still not well understood. [score:2]
miR-191 causes a number of genes to respond and adapt. [score:1]
Interestingly, although the changes of cell viability were similar when HCT116 cells were treated with different drugs, the alteration of the level of miR-191 was the most apparent in cells treated with 5-Fu (Figure 4A, 4B). [score:1]
HCT116 cells transfected with plemiR-191 or pSicoR-sponge-miR-191 (100 μL) were seeded at a density of 2 × 10 [3] cells/well in 96-well plates. [score:1]
miR-191 level was normalized to the U6 level, and the C/EBPβ level was normalized to the GAPDH level. [score:1]
In contrast, Di Leva G et al. reported that activation of the miR-191/425 cluster reduced proliferation and impaired tumorigenesis in breast cancer cells [21]. [score:1]
miR-191 promotes cell resistance to 5-Fu. [score:1]
PlemiR-191 or pSicoR-sponges-miR-191 transfected HCT116 cells and the corresponding control cells (5 × 106) were suspended in 200 μl PBS and then injected subcutaneously into either the flank or forelimb armpits of the same female, 5−6-week-old BALB/c athymic nude mouse (HFKBio, Peking, China). [score:1]
The plemiR-191/plemiR-control or sponge-miR-191/sponge-control stable cell lines derived from HCT116 cells were subcutaneously injected into either the flank or forelimb armpits of nude mice. [score:1]
The levels of miR-191 in the stable cell lines were determined by quantitative PCR, and our results demonstrated the effectiveness of this transfection (Figure 2A). [score:1]
The induction of the pro-apoptotic pathway by 5-Fu is crucial for its anticancer role, so we hypothesized that miR-191 might be involved in the 5-Fu induced cell apoptotic pathway. [score:1]
miR-191 promotes cell viability and proliferation. [score:1]
Figure 1Stem-loop RT-PCR analysis of the miR-191 level in tissues and cell lines. [score:1]
Interestingly, miR-191 exerts diverse and often conflict biological effects, which are always cell-type and context specific. [score:1]
However, the molecular mechanism by which miR-191 functions in CRC remains largely unknown. [score:1]
miR-191 induces the G1-to-S cell-cycle transition. [score:1]
An miR-191 sponge(sponge-miR-191) was constructed using the methods described by Margaret S Ebert [48]. [score:1]
The sponge sequence, encoding ten repeats of reverse complementary sequence of mature miR-191 was synthesized by Sunny Biotechnology Co. [score:1]
Our results suggest a crucial role of miR-191 in tumorigenesis of CRC and provide a therapeutic approach for CRC treatment. [score:1]
miR-191 promotes the tumorigenic features of colorectal cancer cells. [score:1]
Schematic mo del of miR-191 -mediated promotion of tumorigencity of colorectal cancer cells. [score:1]
To examine the effect of miR-191 upon proliferation, the cells were seeded in 6-well plates (500 cells/well) for 14 days. [score:1]
We further demonstrated that 5-Fu decreased the endogenous miR-191 level in a dose -dependent manner (Figure 4C). [score:1]
Taken together, miR-191 decreased the sensitivity of HCT116 cells to 5-Fu. [score:1]
As a result, miR-191 induces the cell cycle progression and tumor cell resistance to various stimuli. [score:1]
The involvement of miR-191 in the 5-Fu -induced cell apoptotic pathway in HCT116 cells. [score:1]
miR-191 has conserved binding sites in the 3′UTRs of C/EBPβ of different species (Figure 5A). [score:1]
First, we determined the miR-191 level to verify the effectiveness of the transfection. [score:1]
C/EBPβ is involved in miR-191 induced cell growth advantage. [score:1]
Effects of miR-191 on the cell cycle distribution of HCT116 cells. [score:1]
HCT116 cells were transfected with miR-191 mimic or inhibitor for 24 hours and then treated with 25 μg/ml 5-Fu for another 24 hours, and the cell viability was measured by CCK8. [score:1]
HCT116 cells were treated with the indicated concentration of 5-Fu for 48 hours, total mRNA was isolated, and the miR-191 level was analyzed by RT-PCR (* P < 0.05 versus DMSO treated cells). [score:1]
Figure 2 (A) Confirmation of the level of miR-191 in stably transfected HCT116 cell lines by RT-PCR; cells transfected with the empty vector were used as a negative control. [score:1]
So, we determined the mRNA levels of CDK6 in HCT116 cells transfected with plemiR-191 or sponge-miR-191 and found that miR-191 also decreased the level of CDK6 in HCT116 cells (Supplementary Figure 3A). [score:1]
Here, we conclude that miR-191 is an anti-apoptotic gene in a colorectal carcinoma, in 5-Fu -induced cell apoptotic mo del. [score:1]
Stem-loop RT-PCR analysis of the miR-191 level in tissues and cell lines. [score:1]
The apoptotic rate of cells transfected with miR-191 -mimic was approximately 5.45%, which was significantly lower than of cells transfected with mimic-control oligo, which showed 10.1% apoptotic rates when exposed to 5-Fu. [score:1]
Figure 5 (A) The predicted binding sites of miR-191 in the 3′ UTRs of C/EBPβ of different species. [score:1]
[1 to 20 of 112 sentences]
2
[+] score: 345
Other miRNAs from this paper: hsa-mir-34a
The extensive miR-191 mediated regulation of gene expression through seed matches in the CDS may represent an isolated case, but it raises the intriguing possibility that other miRNAs may significantly regulate gene expression through pairing to target sites in the CDS. [score:9]
In multiple cases, miR-191 influences tumor progression by regulating proliferation; miR-191 promotes proliferation in hepatocellular carcinoma, and in gastric carcinoma by targeting NDST1, but inhibits proliferation in thyroid carcinoma by targeting CDK6 [18, 20]. [score:8]
The direct targeting of both proliferation enhancing and inhibiting genes is consistent with observations of miR-191 functioning as a tumor suppressor in certain cell types or genetic backgrounds and an oncogene in other contexts. [score:8]
To further confirm these genes as direct targets and examine the effect of miR-191 on the expression of these genes in primary human fibroblasts, we examined the effect of miR-191 transient overexpression in primary fibroblasts and HeLa cells on transcript and protein levels. [score:8]
GO-term enrichment analysis of these targets identified multiple genes involved in proliferation and cell cycle regulation, and we experimentally confirmed multiple proto-oncogenes as direct targets of miR-191. [score:7]
In addition, our results suggest that miR-191 mediates gene expression of a large fraction of its target genes by targeting RISC to the CDS. [score:7]
For instance, miRNA target pairing has been generally thought to occur through pairing to the 3’ UTR of the target transcript, and prediction algorithms frequently restrict predictions to the 3’ UTR [33], but in this work we show that miR-191 may utilize extensive pairing to the CDS of the target transcript (Fig 4). [score:7]
Using both miR-191 dependent RISC association and repression of gene expression to identify putative miR-191 targets resulted in the highest frequency of seed sites in the most highly ranked targets (Fig 3E). [score:7]
Several of the previously identified miR-191 targets, such as NDST1, SATB1, and EGR1 are more strongly associated with inhibition of proliferation, where as CSDA, CCND2, CDK6 are known to promote proliferation, in addition to the targets identified in this study, CDK9, NOTCH2, and RPKS6KA3 [18, 21, 46]. [score:7]
By constructing a genome wide miR-191 target set, we were able identify and confirm the regulators of proliferation CDK9, NOTCH2, and RPS6KA3 as direct targets of miR-191. [score:7]
Because we had found the primary phenotypic effect of miR-191 overexpression to be inhibition of proliferation, we selected multiple proto-oncogenes and regulators of proliferation to further investigate as miR-191 targets. [score:6]
This collection of experimentally validated proliferation associated miR-191 targets raises the intriguing possibility that miR-191 may regulate proliferation by targeting a network of genes connected to proliferative pathways, rather than exerting its effects through modulation of one or two genes. [score:6]
CDK6 was one of our putative targets and had previously been identified as a direct target of miR-191 by multiple groups [19, 21, 40]. [score:6]
RIP-seq enrichment and gene expression repression data were combined to rank miR-191 targets. [score:5]
This inhibitory effect of miR-191 was comparable to miR-34a, a well known tumor suppressor [32]. [score:5]
To experimentally identify the targets of miR-191 we used two approaches: (1) Profiling miRNA dependent RISC-transcript association, and (2) profiling miRNA dependent repression of gene expression (Fig 2). [score:5]
We experimentally identified the targets of miR-191 by conducting extensive profiling of RNA induced silencing complex (RISC) associated transcripts in combination with gene expression profiling. [score:5]
As may be expected given the function of miR-191 as a regulator of proliferation, it is unsurprising that miR-191 expression is frequently altered in tumors, and may be up or down regulated depending on cancer type [40]. [score:5]
In addition to the novel miR-191 targets we identified in this study, miR-191 has been previously shown to target the proliferation associated genes NDST1 in the human gastric carcinoma cell line MGC803, and CDK6, SATB1, CCND2, CSDA, and EGR1 in the human embryonic kidney cell line used in this study HEK293 [18, 21, 46]. [score:5]
For A-D, n = 3. E combines gene expression RNA-seq data, n = 3, with RIP-seq data, n = 3. As an additional means to assess the quality of our miR-191 target profiles, we quantified miR-191 seed match frequency in miR-191 dependent RISC associated mRNAs. [score:5]
Although miR-191 regulation of CDK9, NOTCH2, and RPS6KA3 expression was modest, moderate repression of multiple key regulators of proliferation may have large phenotypic effects in concert. [score:5]
For A-D, n = 3. E combines gene expression RNA-seq data, n = 3, with RIP-seq data, n = 3. As an additional means to assess the quality of our miR-191 target profiles, we quantified miR-191 seed match frequency in miR-191 dependent RISC associated mRNAs. [score:5]
The luciferase reporter assays confirmed 7 of the 8 putative targets as direct targets of miR-191, and deletions of the miR-191 seed matches showed that the miR-191 mediated repression was dependent on the miR-191 seed matches in the 3’ UTRs (Fig 5B). [score:5]
The blot showing reduced expression of miR-191 targets was stripped and re-probed with different primary antibodies for the appropriate proteins. [score:5]
In conjunction with media replacement, cells were transiently transfected with miR-191 miRCURY Locked Nucleic Acid (LNA) miRNA Inhibitor or Negative Control Inhibitor obtained from Exiqon (10 nM final concentration). [score:5]
To confirm direct miR-191 targeting and regulation of the transcripts produced from this group of genes, we cloned ~0.5–1 kb sections of their 3’ UTRs into luciferase reporter constructs. [score:5]
Error bars denote ± SD, n = 6. P-values were estimated by Student’s one tailed t-test comparing cell numbers following miR-191 inhibitor transfection to cell numbers following the Control inhibitor transfection at each time point. [score:5]
In addition, transient miR-191 overexpression significantly reduced the number of cells expressing the proliferation marker Ki67 compared to multiple controls (Fig 1B) [30, 31]. [score:4]
Despite the clear link between miR-191, proliferation, and tumorigenesis, the regulation of proliferation by miR-191 has not been explored in primary cells, and genome wide target identification for miR-191 has not been performed with current biochemical techniques. [score:4]
To rule out indirect effects from flooding the cells and the RNA silencing machinery with large amounts of mature miRNA duplexes, we transiently inhibited miR-191 in fibroblasts induced into quiescence by serum removal. [score:4]
miR-191 directly targets multiple proto-oncogenes. [score:4]
miR-191 Directly Targets Multiple Proto-Oncogenes. [score:4]
miR-191 directly targets the 3’ UTRs of multiple proto-oncogenes. [score:4]
In this study, we show that miR-191 regulates proliferation in primary human fibroblasts and show by experimental analysis that it targets a number of proto-oncogenes. [score:4]
Transient overexpression of miR-191 also significantly decreased the rate of fibroblast progression through the cell cycle (S2 Fig). [score:3]
0126535.g002 Fig 2To assess the effectiveness of our profiling of miR-191 targets, we first examined the levels of repression for mRNAs that associated with RISC in a miR-191 dependent manner. [score:3]
Genome wide profiling of miR-191 targets. [score:3]
0126535.g002 Fig 2 To assess the effectiveness of our profiling of miR-191 targets, we first examined the levels of repression for mRNAs that associated with RISC in a miR-191 dependent manner. [score:3]
n = 3. (B) There is a high frequency of sequences pairing only to the seed region of miR-191 in the 3’ UTRs of the miR-191 target set. [score:3]
Bars indicate the mean, and error bars denote ± SD, n = 3. P-values were estimated by Student’s one tailed t-test comparing miR-191 normalized to Control siRNA luciferase activity with intact 3’ UTRs to luciferase activity with miR-191 target site deleted 3’ UTRs. [score:3]
0126535.g003 Fig 3 (A) Transcript levels of mRNAs enriched in the RIP-seq following miR-191 transfection were decreased in the RNA-seq expression profiles. [score:3]
Due to a large fraction of miR-191 7-mer seed matches being located in the CDS of protein coding genes, we hypothesized that miR-191 may mediate extensive RISC occupancy of the CDS, but exert a stronger influence on gene expression through 3’ UTR pairing (Fig 4A). [score:3]
miR-191 dependent RISC association correlated well with repression of expression (Fig A in S4 Fig), and mRNAs that associated with RISC in a miR-191 dependent manner were significantly more repressed than all mRNAs profiled (Fig 3A). [score:3]
In addition, transcript levels of mRNAs that associated with RISC in a miR-191 dependent manner were significantly more repressed than all mRNAs profiled that contained a miR-191 7-mer seed match in their 3’ UTR, indicating that the RIP more successfully identifies mRNAs repressed by miR-191 transient overexpression than using presence of the seed match as the lone criteria (Fig 3A). [score:3]
In addition, enrichment of sequences pairing to miR-191 in the most highly ranked targets was specific to sequences matching the seed area of miR-191, and not subsequences pairing to other areas of the miRNA (Fig B in S4 Fig). [score:3]
P-values were estimated by Student’s one tailed t-test comparing miR-191 normalized to Control siRNA luciferase activity with intact 3’ UTRs to normalized luciferase activity with miR-191 target site deleted 3’ UTRs. [score:3]
Inhibition of miR-191 in quiescent fibroblasts significantly increased the rate of cell growth (Fig 1D). [score:3]
Error bars indicate ± SD, n = 3. (D) Inhibition of miR-191 increases cell growth in fibroblasts serum starved into quiescence. [score:3]
Diagram of miR-191 pairing to putative targets. [score:3]
Average cell number relative to 0 hours post transfection of an LNA targeting miR-191 or a LNA negative control is shown for each time point indicated. [score:3]
Genome Wide Profiling of miR-191 Targets. [score:3]
Purple bars: 3’ UTRs with the putative miR-191 target site deleted. [score:3]
Conversely, mRNAs with the greatest miR-191 dependent RISC association had the highest frequency of miR-191 seed sites in their 3’ UTRs (Fig 3C), and mRNAs with the greatest miR-191 dependent repression of gene expression had the highest frequency of miR-191 seed sites in their 3’ UTRs (Fig 3D). [score:3]
S7 Fig Luciferase reporter assays showed miR-191 directly targets the 3’ UTRs of the genes indicated on the X-axis. [score:3]
miR-191 has predominantly been shown to act as an oncogene, promoting tumorigenesis in gastric, colorectal, breast, thyroid, and hepatocellular carcinoma, but has also been shown to inhibit tumorigenesis in thyroid carcinoma and breast cancer [16, 19, 20, 40]. [score:3]
Experimentally identified targets of miR-191. [score:3]
Transient miR-191 overexpression in fibroblasts significantly repressed the transcript levels of AGO2, BCL2, CDK6, CDK9, NOTCH2, and RPS6KA3, but not PRMT or SLC7A1 (p = 0.11 and p = 0.08, respectively) (Fig 5C). [score:3]
Bars are the frequency denoted on the Y-axis of a 6-mer in the 3’ UTRs of the experimentally identified miR-191 target set relative to all mRNAs profiled. [score:3]
Proliferation related targets have been identified for miR-191, such as CDK6 and SATB1 [21]. [score:3]
mRNAs with miR-191 Seed Matches in Their Coding Sequence Display Greater RISC Association and Repression of Gene Expression than mRNAs with Seed Matches in Their 3’ UTR. [score:3]
Taken together, these results suggest that miR-191 may mediate extensive RISC occupancy of the CDS, and exert a greater effect on gene expression through pairing to the CDS than the 3’ UTR. [score:3]
0126535.g005 Fig 5(A) Enriched Gene Ontology terms for the experimentally identified set of miR-191 targets. [score:3]
To avoid denominator inflation in subsequent ratio calculations, all FPKMs less than 1 were set to 1. Repression of gene expression for each gene was calculated as the ratio of the FPKM in the miR-191 transfection to the FPKM in the control transfection: Repression = FPKM for the control  FPKM for miR-191 RNA-seq RISC immunoprecipitations (RIP) enrichments for each gene were calculated as follows: RIP FPKMs were first normalized to gene expression FPKMs, and then enrichment was calculated as the ratio of the normalized miR-191 transfection to the normalized control transfection: Enrichment =  FPKM for the miR-191 transfection RIP FPKM for the miR-191 transfection gene expression FPKM for the control transfection RIP FPKM for the control transfection gene expression Each gene was ranked as a putative target by calculating a target score. [score:3]
Transient miR-191 overexpression in conjunction with M phase trapping confirmed the miR-191 dependent reduction in the rate of progression through the cell cycle (Fig 1C). [score:3]
In our experimentally identified set of miR-191 targets, there was strong enrichment for genes associated with cell proliferation, cell division, the MAPK signaling pathway, and cancer pathways (Fig 5A). [score:3]
Purple bars: 3’ UTRs with the putative miR-191 target site entirely deleted. [score:3]
To examine the effect of miRNA concentration on miR-191 mediated repression, we conducted luciferase reporter assays with decreasing concentrations of miRNA transfected for this subset of the confirmed miR-191 targets, and observed similar miRNA mediated repression at lower concentrations (S7 Fig). [score:2]
Taken as a whole, the cell type, cancer, and cancer subtype specific effects of miR-191 on proliferation suggest miR-191 regulates proliferation in a manner dependent upon cell type and genetic context. [score:2]
Transient miR-191 overexpression significantly reduced cell growth compared to control (Fig 1A). [score:2]
We assayed the effect of transient miR-191 overexpression on protein levels in fibroblasts and HeLa cells for a subset of the genes, and confirmed miR-191 repression of CDK9, NOTCH2, and RPS6KA3, but AGO2 only showed repression in HeLa cells (Fig 5D, S6 Fig, and data not shown). [score:2]
However, we also showed extensive miR-191 dependent regulation of transcript levels for mRNAs with a miR-191 seed match in the CDS, and the mRNAs with a seed match in their CDS showed a significantly stronger response than those with a 3’ UTR seed match. [score:2]
miR-191 transfection in HeLa cells decreased protein expression of CDK9, NOTCH2, RPS6KA3, and AGO2 compared to Control siRNA transfection. [score:2]
Increases in miR-191 dependent RISC association with a given transcript as measured by RIP enrichment were used to identify direct targets of miR-191. [score:2]
To explore the role of miR-191 in primary human cell proliferation, we transiently overexpressed miR-191 by transfecting the mature duplex form of miR-191 into proliferating primary fibroblasts and assayed cell growth. [score:2]
Surprisingly, miR-191 dependent repression of gene expression was significantly greater when a seed match was located in the CDS compared to the 3’ UTR (Fig 4C and Fig C in S5 Fig). [score:2]
Cells were grown 24 hours, and then transiently transfected with miR-191, Control siRNA, or Control siRNA 2 duplexes (100 nM final concentration). [score:1]
Entire 3' UTRs or at minimum 0.5 kb up- and down-stream of the predicted miR-191 binding site (S1 Fig) were cloned from human genomic DNA and inserted into the psi-CHECK2 plasmid (Promega) using XhoI and NotI restriction sites downstream from the Renilla luciferase gene. [score:1]
P-values were estimated by Student’s one tailed t-test comparing normalized transcript levels following miR-191 transfection to normalized transcript levels following Control siRNA transfection. [score:1]
Left panel: All mRNAs profiled with a 7-mer miR-191 seed match. [score:1]
S5 Fig (A) RIP-ChIP enriched mRNAs have a higher proportion of miR-191 seed matches in the CDS than all mRNAs profiled. [score:1]
Solid lines are all mRNAs profiled with a miR-191 seed match, and dashed lines are the mRNAs 1.5 fold enriched or repressed with a seed match. [score:1]
The line is the frequency indicated on the Y-axis of miR-191 7-mer seed matches in the 3’ UTRs of the group relative to the frequency of miR-191 seed matches in all mRNAs profiled. [score:1]
24 hours after plating, miR-191 or Control siRNA duplexes were transfected at a 100 nM concentration (Lipofectamine, Invitrogen). [score:1]
We demonstrated that miR-191 represses proliferation and cell cycle progression in primary human fibroblasts. [score:1]
In support of this hypothesis, we observed an increase in the proportion of miR-191 seed matches in the CDS of our experimentally identified miR-191 mRNA target set compared to all mRNAs profiled (61% compared to 42%) (Fig 4A and Fig A in S5 Fig). [score:1]
Varying concentrations of miR-191 were used, and final concentrations of miR-191 are indicated on the X-axis. [score:1]
mRNAs that contain a miR-191 miRNA 7-mer seed match were significantly more repressed than all mRNAs profiled (p = 4.65e-24). [score:1]
miR-191 has been shown to play a role in multiple cancer types, including gastric, colorectal, breast, thyroid, and hepatocellular carcinoma [16– 20]. [score:1]
Total RNA from fibroblasts transfected with miR-191 or Control siRNA duplexes was extracted with TRIzol reagent (Invitrogen) and reverse transcribed with the High-Capacity cDNA Reverse Transcription Kit from ABI that uses random hexamers. [score:1]
miR-191 transfection slows progression through the cell cycle. [score:1]
The line is the frequency indicated on the Y-axis of miR-191 7-mer seed matches in the 3’ UTRs of the group relative to the frequency of seed matches in all mRNAs profiled. [score:1]
Each plasmid was co -transfected at 50 ng/well with either miR-191 or Control siRNA at a 100 nM in triplicate (Lipofectamine, Invitrogen). [score:1]
Right panel: mRNAs 1.5 fold enriched in the RIP-seq with a 7-mer miR-191 seed match. [score:1]
miR-191 represses proliferation. [score:1]
mRNAs that were both RISC associated and contained a miR-191 7-mer seed match showed the greatest amount of repression (Fig 3A). [score:1]
miR-191 Represses Primary Human Cell Proliferation. [score:1]
Greater RISC association and repression of mRNAs with a miR-191 seed match in the CDS than in the 3’ UTR. [score:1]
0126535.g001 Fig 1 (A) miR-191 transfection reduces the rate of cell growth. [score:1]
Solid lines are all mRNAs profiled with a miR-191 seed match, and dashed lines are the mRNAs 1.5 fold repressed or enriched with a seed match. [score:1]
The Y-axis denotes relative luciferase units from miR-191 transfected HEK293 cells normalized to Control siRNA transfected cells. [score:1]
Right panel: mRNAs 1.5 fold enriched in the RIP-ChIP with a 7-mer miR-191 seed match. [score:1]
0126535.g004 Fig 4 (A) RIP-seq enriched mRNAs have a higher proportion of miR-191 seed matches in the CDS than all mRNAs profiled. [score:1]
Average cell number relative to 0 hr following miR-191 or control siRNA transfection is shown for each time point indicated. [score:1]
For mRNAs with the greatest miR-191 dependent RISC association, there were no consistently significant differences in RISC association between mRNAs with seed matches in the 3’ UTR, CDS, or 5’ UTR (Fig 4B and Fig B in S5 Fig). [score:1]
We observed a large fraction of miR-191 seed matches in the CDS, and extensive miR-191 dependent RISC occupancy of the CDS. [score:1]
The line is the frequency indicated on the Y-axis of the miR-191 7-mer seed match in the 3’ UTRs of the group relative to the frequency of the seed match in all mRNAs profiled. [score:1]
miR-191 guide: 5’-CAACGGAAUCCCAAAAGCAGCUG-3’ and anti-guide: 5’GCUGCGCUUGGAUUUCGUCCCC-3’; Control RNA 1 guide: 5’-CUGGAGUUGUCCCAAUUCCUU-3’ and anti-guide: 5’-AGAAUUGGGACAACUCCAGUU-3’; and Control RNA 2 guide: 5’-AAUUCUCCGAACGUGUCACGUUA-3’ and anti-guide: 5’-ACGUGACACGUUCGGAGAAUUCA-3’. [score:1]
Microarray data confirms greater RISC association and repression of mRNAs with a miR-191 seed match in the CDS than in the 3’ UTR. [score:1]
Cells were grown 24 hours, and then transiently transfected with miR-191 or Control siRNA duplexes. [score:1]
mRNAs that contained a 7-mer miR-191 seed match in their 3’ UTR displayed significantly higher levels of miR-191 dependent RISC association than all mRNAs profiled (Fig 3B). [score:1]
The frequency of 6-mer sequences pairing to each 6-mer sub-sequence of miR-191 is plotted. [score:1]
The duality of miR-191 is illustrated in breast cancer: miR-191 impairs or promotes breast cancer tumorigenesis depending on ER-alpha receptor status [19, 46]. [score:1]
A miR-191 dependent repression of protein level was shown for NDST1 in MGC803s, CDK6 and SATB1 in human epidermal keratinocytes, and CCND2, CSDA, and EGR1 in the human breast cancer cell line MDA-MB-231 [18, 21, 46]. [score:1]
For each plasmid produced this way, a mutant plasmid was subsequently produced via deletion of the 22 bp sequence corresponding to the full length of miR-191 at the putative binding site (QuikChange Lightning Mutagenesis Kit, Agilent). [score:1]
mRNAs enriched in the RIP were significantly more repressed than mRNAs with a miR-191 7-mer seed match (p = 2.54e-12). [score:1]
[1 to 20 of 115 sentences]
3
[+] score: 331
qRT-PCR data showing that miR-191 overexpression (Pre191) leads to targeted downregulation of HuR at the transcript level while its inhibition (Anti191) leads to the opposite. [score:10]
Since we also see that HuR downregulates TGFβ2 in hypoxia and that miR-191 mediated induction of TGFβ2 is reduced on HuR overexpression, thus, miR-191 targeting of HuR may be another mechanism to maintain high TGFβ2 levels under hypoxia. [score:8]
Interestingly, we saw increase in the levels of TGFβ2, SMAD3 (SMAD family member 3), BMP4 (bone morphogenetic protein 4), JUN, FOS, PTGS2 (prostaglandin-endoperoxide Synthase 2), CTGF (connective tissue growth factor), & VEGFA transcripts in response to miR-191 overexpression and their downregulation on miR-191 inhibition under hypoxia in the three cell lines (Figure 4c–e). [score:8]
Using qRT-PCR, luciferase reporter activity assays & western blotting, we validated that overexpression of miR-191 suppresses the expression of HuR in hypoxic microenvironment while its inhibition led to the opposite (Figure 5e–h, Supplementary data 4b). [score:8]
We show that miR-191 directly targets HuR under hypoxia and mediates its downregulation. [score:7]
qRT-PCR data showing expression level of genes belonging to TGFβ-pathway in response to miR-191 overexpression/inhibition in hypoxic microenvironment in a panel of breast cancer cell lines- MCF7 (c), T47D (d), MM231 (e). [score:7]
Targeted downregulation of HuR plays an important role in miR-191 mediated TGFβ2 induction in hypoxic microenvironment. [score:6]
FACS analysis shows reduction in cells in G0/G1 phase while increase in cells in G2/M phase on miR-191 overexpression (h) while inhibition of miR-191 shows opposite (i). [score:5]
miR-191 induced migration is SMAD3 dependent as reduction in migration was observed on miR-191 overexpression along with the inhibition of SMAD3. [score:5]
We show that miR-191 overexpressing cells show increased cellular proliferation, migration and therapy resistance as compared to the control cells under hypoxia and vice versa is seen when miR-191 is downregulated in hypoxic cells. [score:5]
Bar graph represents relative luciferase activity of p3TP-Lux reporter plasmid on overexpression/inhibition of miR-191 under hypoxic (a) and normoxic conditions (b). [score:5]
Our previous work also shows cellular migration as part of functional domain of miR-191 that is partly mediated by downregulation of metastatic regulator SATB1 in hormone positive breast cancer 26. [score:5]
Levels of miR-191 were modulated (overexpressed-Pre191 or inhibited-Anti191) in hypoxic microenvironment in a panel of breast cancer cell lines (MCF7, T47D & MM231) and various cellular effects were studied. [score:5]
Overall, we found that miR-191 overexpression promoted cell proliferation, migration, invasion (modest but statistically significant) and resistance to chemotherapeutic drug (doxorubicin) or radiation mediated death while miR-191 downregulation using anti-miR-191 oligos showed the opposite effect as compared to the control in all the three cell lines tested (Figure 3a–f). [score:5]
In agreement with the results in 2D culture conditions, spheroids generated with miR-191 overexpressed cells were found to be more proliferative while miR-191 inhibitor treated cells showed less proliferation (Figure 8a). [score:5]
Effect of HIF overexpression (HIF-1α or HIF-2α) or inhibition (shHIF1α or shHIF2α) in normoxic (c) or hypoxic (d) conditions on the levels of miR-191 in a panel of breast cancer cell lines (MCF7, T47D, & MM231). [score:5]
Interestingly, overexpression of miR-191 resulted in increased levels of TGFβ2 protein while its inhibition led to the opposite (Figure 5a, Supplementary data 4a, c). [score:5]
The results show that the decrease in migration by inhibition of miR-191 was reduced when TGFβ2 was coexpressed. [score:5]
TGFβ2: A direct miR-191 target in hypoxic microenvironment. [score:4]
This suggests that miR-191 mediated downregulation of HuR is important to bring about full TGFβ2 induction. [score:4]
miR-191 mediated downregulation of HuR in hypoxia leads to induction of TGFβ2. [score:4]
These studies suggest that miR-191 mediated doxorubicin resistance and increased migration in breast cancer cells may involve HuR downregulation as well. [score:4]
It was found that miR-191 mediated HuR downregulation was mainly through the HuR B1 while HuR B2 seemed largely unresponsive. [score:4]
Altogether, this confirmed that miR-191 directly targets HuR by binding to its 3′UTR at position 4027–4033. [score:4]
qRT-PCR data showing regulation of TGFβ2 levels in MCF7 cells in response to overexpression of miR-191 or HuR or both. [score:4]
Since TGFβ2 showed maximal induction and is also an upstream molecule in the TGFβ pathway we sought to see if it is a direct target of miR-191. [score:4]
Thus, while hypoxia is known to induce HuR levels, simultaneously through miR-191 induction it brings about its downregulation. [score:4]
Since our results from 3D spheroids suggest that miR-191 is a major regulator of TGFβ2 levels, thus, targeting miR-191 in tumors may have an added advantage during cancer treatment. [score:4]
In contrast, inhibiting miR-191 under hypoxia showed higher cells in G0/G1 phase and fewer G2/M phase cells as compared to the control suggesting that miR-191 inhibition under hypoxia causes cell cycle arrest (Figure 3h, i). [score:4]
To further confirm HuR as a direct target of miR-191, the two miR-191 binding sites (HuR B1 and HuR B2) in HuR 3′UTR were individually or together cloned (HuR B1&2) and 3′UTR luciferase activity was scored (Supplementary data 5a, b). [score:4]
Downregulation of miR-191 levels in the spheroids was confirmed by qRT-PCR (Supplementary data 7b). [score:4]
Concomitantly there was increase in cells in G2/M phase on miR-191 overexpression. [score:3]
TGFβ2 & HuR: bonafide targets of miR-191 in hypoxic microenvironment. [score:3]
Here, we show that severe hypoxic microenvironment (0.2% pO [2]) often seen in solid tumors strongly induce miR-191 expression through dynamic binding of HIF-1α and HIF-2α to the HREs present upstream of miR-191. [score:3]
Since HuR, an RNA binding protein, is known to be associated with breast cancer, and its 3′UTR bears two miR-191 binding sites as well, we checked to see if miR-191 mediated regulation of HuR indirectly affects TGFβ2 levels 44 62. [score:3]
The MCF7 cells with differential level of miR-191 were exposed to hypoxic microenvironment and analyzed for expression of HuR protein by western blotting. [score:3]
Interestingly, overexpression of both the HIFs led to strong induction in miR-191 levels while considerable reduction in miR-191 levels was observed with the silencing of the HIFs using specific shRNAs under normoxia (Figure 1c). [score:3]
Substantial increase in luciferase activity was observed when miR-191 mimic was cotransfected along with the reporter plasmid in hypoxic microenvironment while inhibition of miR-191 led to strong reduction in luciferase activity in the three breast cancer cell lines (Figure 4a). [score:3]
Graph showing luciferase activity of TGFβ2-wild type (d) or mutated 3′UTR (e) in response to overexpression of miR-191 or HuR or both in MCF7 cells. [score:3]
The association of miR-191 with TGFβ-signaling has been suggested before by Elyakim's group in hepatocellular carcinoma based on gene expression profiling results 58. [score:3]
The cells were transfected with miR-191 mimic or inhibitor with respective controls and exposed to hypoxia for 24 hrs. [score:3]
Graph showing 3′UTR luciferase activity of TGFβ2-3′UTR luciferase constructs bearing wild type (c) or mutated (d) miR-191 binding site, in response to differential expression of miR-191 in hypoxic microenvironment. [score:3]
Interestingly, considerably higher number of colonies were observed when cells with increased level of miR-191 were exposed to hypoxia and allowed to grow on semi-solid media while miR-191 inhibition showed the opposite (Figure 3g). [score:3]
The MCF7 cells with differential level of miR-191 were exposed to hypoxic microenvironment and analyzed for expression of TGFβ2 protein by western blotting. [score:3]
Further, a recent study in hepatocellular carcinoma suggested a link between miR-191 and TGFβ pathway based on gene expression data. [score:3]
We found that miR-191 mediated induction of TGFβ2 was partially reduced in presence of HuR overexpression. [score:3]
Since HIFs are master regulators of hypoxia response, we thus sought to study their involvement in miR-191 regulation 31. [score:3]
The HuR B1 site was mutated for further confirmation and as expected, miR-191 overexpression led to decrease in luciferase activity with wild type HuR B1 construct while no effect was observed when the mutated HuR B1 was used (Supplementary data 5c). [score:3]
Interestingly, the luciferase assay results were in agreement with the qRT-PCR data showing that miR-191 directly targets TGFβ2 (Figure 5c). [score:3]
Similarly, while anti-miR-191 led to decrease in migration, forced expression of TGFβ2 along with anti-miR-191 oligos led to restoration of migration (Figure 7c, d, Supplementary data 3g, h). [score:3]
show that miR-191 mediated induction of TGFβ2 was partially reduced in presence of HuR overexpression. [score:3]
The MCF7 cells with differential level of miR-191 were exposed to hypoxic microenvironment (pO [2]-0.2%, 24 hrs) and analyzed for the expression of TGFβ2 protein by western blotting and immunofluorescence using an antibody specific for TGFβ2. [score:3]
A proposed mo del detailing hypoxic regulation of miR-191 along with its functional impact on HIF & TGFβ-pathways and further implication in regulation of migration of hypoxic breast cancer. [score:3]
The relative luciferase activity of the reporter constructs containing TGFβ2 –mut-3′UTR was found to be unaltered by the presence of either of miR-191 mimic or inhibitor (Figure 5d) in contrast to the wild type TGFβ2-3′UTR reporter construct. [score:3]
Significant induction in the level of transcripts was observed (at day 5/day 1) in the multicellular spheroids generated from cells with transient overexpression of miR-191. [score:3]
Next, to identify if HIFs are involved in the direct regulation of miR-191, we looked for the presence of potential HREs in the region upstream of the precursor miR-191 sequence. [score:3]
Transcriptional regulation of miR-191 in hypoxic microenvironment. [score:2]
For wound healing assay, the cells were transfected with miR-191 mimic/inhibitor/controls and 24 hrs post transfection scratches were made in the plate using 10 ul sterile tip (any cellular debris was removed by washing with PBS). [score:2]
The results were further validated by mutating (four point mutations) the miR-191 binding sites in TGFβ2 3′UTR. [score:2]
A considerable induction in the level of TGFβ2 was also observed (at day 5/day 1) in the multicellular spheroids generated with cells treated with miR-191 -mimic compared to that of treated with miR-191 inhibitor validating our results obtained using 2D culture (Figure 8b). [score:2]
Enhanced luciferase activity was observed on HIF/hypoxia stimulation suggesting a direct role of these HREs in hypoxia/HIF induced miR-191 levels. [score:2]
Similar to TGFβ2, miR-191 mediated regulation of HuR was not seen under normoxia suggesting this effect to be hypoxia-specific (Supplementary data 4e–g). [score:2]
Transcriptional regulation of miR-191 is HIF dependent. [score:2]
This lays scope for further studies using animal mo dels for development of a detailed protocol for using anti-miR-191 therapy for breast cancer treatment. [score:2]
Notably, miR-191 overexpressing cells showed reduction in cells in G0/G1 phase as compared to respective controls. [score:2]
A strong induction in TGFβ2 levels by direct miR-191 binding to its 3′UTR under hypoxia seems intriguing considering the fact that conventionally miRNAs are known as post transcriptional gene silencers 59. [score:2]
We thus searched for this core sequence (ACGTG) in the region upto 7 kb upstream of precursor miR-191 and identified 6 potential regulatory sites (HI-H6) (Figure 2a). [score:2]
To further gain insight into association of miR-191 and TGFβ-pathway in the promotion of breast cancer migration, we examined whether the silencing/restoration of TGFβ2 affects miR-191 induced cell migration. [score:1]
Hypoxia inducible miR-191 promotes breast tumor aggressiveness. [score:1]
We generated 3D tumor spheroids for MCF7 and T47D cell lines transfected with miR-191 mimics or inhibitors and studied their growth characteristics. [score:1]
HIF silencing under hypoxia using specific shRNAs led to a drastic decrease in miR-191 levels suggesting that hypoxia mediated induction of miR-191 is HIF dependent (Figure 1d). [score:1]
For effect of miR-191 on the HRE constructs (EPO-HRE, H2-HRE, H3-HRE and control vector pGL3-TK-Luc) were cotransfected with HIF1α/shHIF1α or their respective controls. [score:1]
Cells were transfected with differential level of miR-191 (pre191/anti-191 and their respective controls) and exposed to hypoxic microenvironment. [score:1]
This was accompanied by reduction in cell proliferation in anti-miR-191 treated cells suggesting anti-miR-191 therapy to be promising for breast cancer treatment (Figure 8d). [score:1]
Excitingly, we found the existence of an miR-191-HuR-TGFβ2 axis. [score:1]
Since we wanted to identify miR-191 specific effects with respect to hypoxia, thus all experiments have been carried out under hypoxia and comparisons have been made between cells transfected with control oligos versus pre/anti-miR-191(Supplementary data 3a, b). [score:1]
Enhanced cell migration was observed when miR-191 mimic was used alone or along with siCtrl, however the effect was abolished when miR-191 mimic was used along with siSMAD3 (Figure 7e, Supplementary data 3i). [score:1]
We found that severe hypoxic microenvironment (pO [2]-0.2%) has a maximum inducing effect on mature miR-191 levels as opposed to moderate hypoxia (1%) (Figure 1a). [score:1]
We recently found that the stress prevalent in tumor microenvironment has an inducing effect on mature miR-191 levels 26. [score:1]
The predicted miR-191 binding site in the 3′UTR of HuR (positions: 4027–4033 and 4071–4077) and TGFβ2 (position: 5756–5784) was amplified and cloned in pMIR-REPORT™ vector to generate wild type 3′UTR-luciferase constructs. [score:1]
qRT-PCR data showing TGFβ2 transcript level in the 3D tumor spheroids generated from cells with differential miR-191 levels. [score:1]
Since our studies establish miR-191 as an oncogenic miRNA in breast cancer, we wanted to see the effect of anti-miR-191 treatment on the 3D tumors. [score:1]
Cells were transiently transfected with miR-191 mimics (pre-191) or antisense (anti-miR-191) or respective control oligos (Ctrl and NCtrl) and exposed to hypoxic microenvironment (0.2% oxygen) for 24 hours. [score:1]
Effect of miR-191 and TGFβ2 on migration under hypoxia. [score:1]
The sequences of primers used for cloning and site-directed mutagenesis are mentioned in Supplementary data 1. For promoter analysis, miR-191 promoter fragments predicted to encompass hypoxia response elements (HREs) were amplified. [score:1]
This may also involve its competition/cooperation with other miRNAs including miR-191 interacting with TGFβ2 transcript. [score:1]
miR-191 induces TGFβ-signaling under hypoxia. [score:1]
The cloned 3′UTR region of TGFβ2 encompassing the binding sites of miR-191 and HuR is highlighted. [score:1]
miR-191 promotes TGFβ-signaling in hypoxic microenvironment. [score:1]
TGFβ2 is a critical mediator of miR-191 induced breast cancer migration. [score:1]
Since miR-191 and HuR both were showing contrasting effects on TGFβ2 levels and were found to have binding sites in proximity, we checked whether HuR binding affects miR-191-TGFβ2 transcript interaction. [score:1]
The region was considered for determining the combined effect of both miR-191 and HuR in the regulation of TGFβ2. [score:1]
We transiently modulated the level of HIFs (HIF-1α & HIF-2α) and scored for the effect on miR-191 levels. [score:1]
MCF7 spheroids were generated and anti-miR191/NCtrl treatment was given to the spheroids. [score:1]
Effects of anti-miR-191 treatment in breast cancer cell 3D tumor spheroids. [score:1]
To experimentally determine this we sought for the effect of miR-191 on TGFβ2 level in the presence of HuR in hypoxic MCF7 cells using qRT-PCR (Figure 6c). [score:1]
In this study, we focused on the signaling activity of miR-191 under hypoxia and its effects on cell migration, which represents an essential component of the cancer metastasis cascade. [score:1]
We thus checked whether hypoxia inducible miR-191 acts as a mediator of the same. [score:1]
Under normoxic conditions no change in luciferase activity was observed suggesting that miR-191 mediated induction of TGFβ signaling is hypoxia specific (Figure 4b). [score:1]
Our studies suggest that miR-191 may be a candidate for crosstalk between the two pathways leading to increased hypoxia induced breast cancer cell migration. [score:1]
Notably, under normoxia, miR-191 was unable to modulate TGFβ2 levels suggesting hypoxia specificity of this effect (Supplementary data 4e–g). [score:1]
Thus, results obtained from all the three cell lines suggest that miR-191 mediated breast cancer migration under hypoxia is TGFβ2 dependent. [score:1]
Picture Diagram showing six potential hypoxia response elements (HRE) upstream of pre-miR-191 sequence. [score:1]
TGFβ2 is a critical mediator of miR-191 induced breast cancer migration under hypoxia. [score:1]
To study effect of anti-miR-191 treatment on MCF7 3D tumor spheroids, first, the spheroids were generated in the manner described above. [score:1]
The results from the three cell lines show that miR-191 mediated increase in migration is abolished with the TGFβ2 silencing. [score:1]
Cells with differential miR-191 levels were exposed to hypoxia for 24 hrs and stained with JC-1. The ratio of red (JC-1 aggregates) to green (monomers) fluorescence intensity was determined for each sample as a representative of ΔΨm. [score:1]
A time dependent induction in mature miR-191 levels (4–7 fold induction) in response to hypoxic stress was seen, suggesting it to be chronic in nature (Figure 1b). [score:1]
Cell cycle analysis was performed with serum starvation synchronized MCF7 cells followed by differential modulation of miR-191 levels and exposure to hypoxic microenvironment. [score:1]
To show endogenous HIF1α binding to miR-191 promoter in hypoxia, cells were exposed to normoxic or hypoxic microenvironment for 24 hrs. [score:1]
Overall, miR-191 seems to be orchestrating the responses to hypoxia (summarized in Figure 7f). [score:1]
To begin with, we first determined the effect of miR-191 on TGFβ-signaling by using a 3TP-Lux reporter plasmid (possessing TGFβ-responsive elements) 36. [score:1]
These results strongly demonstrated that in response to hypoxia, HIFs are recruited to the HRE sites in miR-191 promoter to induce miR-191 transcript levels. [score:1]
Anti-miR-191 therapy brings about reduction in MCF7 3D tumor spheroids volume. [score:1]
Although recent studies by ours and Croce's group had implicated miR-191 as an onco-miR in breast cancer, its functional role in the hypoxic microenvironment has not been explored yet 26 28. [score:1]
We next wanted to study the mechanism behind miR-191 induction under hypoxia. [score:1]
Thus, to determine whether miR-191:TGFβ2 induced breast cancer migration is SMAD3 dependent, we silenced SMAD3 by using SMAD3-specific siRNA and analyzed the effect on miR-191 induced breast cancer migration. [score:1]
However, no change was observed in the JC-1 aggregates/monomers in the cells with differential miR-191 levels suggesting that mitochondrial functioning remains unaffected due to miR-191 levels under hypoxia (Figure 3j). [score:1]
Bar graph showing relative luciferase activity of HuR-3′UTR luciferase construct in response to miR-191 level modulation. [score:1]
Diagram showing miR-191 binding site (HuR B1, wild type as well as mutated) in the 3′UTR of HuR that were subsequently cloned and scored for luciferase activity. [score:1]
It will be certainly interesting to see if miR-191 levels also correlate with the hypoxic quotient and markers in breast tumor patient samples. [score:1]
Diagram showing wild type/mutated miR-191 binding site in TGFβ2-3′UTR. [score:1]
Taken together, these findings suggest that hypoxia induced miR-191 increases breast cancer cell migration through TGFβ2 induction in a SMAD3 -dependent manner (Summarized in Figure 7f). [score:1]
It confirmed that miR-191 binds to the 3′UTR of TGFβ2 (at position 5756–5784) and brings about its induction in hypoxia. [score:1]
miR-191 is hypoxia inducible in a HIF dependent manner. [score:1]
Cells grown on coverslips were then transfected with differential level of miR-191 (pre191/anti-191 and their respective controls) oligos and 24 hrs post –transfection cells were exposed to hypoxic microenvironment (pO [2]-0.2% for 24 hrs). [score:1]
We first determined the effect of miR-191 on TGFβ2 protein level. [score:1]
Overall, these results suggest existence of an association between miR-191 and TGFβ-signaling in the hypoxic microenvironment. [score:1]
MCF7 cells were arrested in G0/G1 phase by serum starvation and these arrested cells were washed with 20% serum and then transfected with miR-191 oligos [sense/antisense or controls (ctrls)] and exposed to hypoxic microenvironment in complete media. [score:1]
miR-191 promotes breast cancer aggressiveness. [score:1]
Notably, a single dose of anti-miR-191 treatment brought about a drastic reduction in spheroid volume accompanied by a decrease in cell proliferation. [score:1]
Stem loop qRT-PCR data showing time dependent induction of miR-191 levels in response to 0.2% hypoxia treatment in MCF7, T47D, & MM231 cells. [score:1]
Stem loop qRT-PCR data showing relative level of miR-191 in breast cancer cell lines (MCF7, T47D, & MM231) exposed to different pO [2] (0.2%, 0.5%, 1% & 21%) for 48 hrs. [score:1]
Since miR-191 affects the cells in apoptotic peak (G0/G1) we sought to know whether it is due to its effects on mitochondrial functioning. [score:1]
Notably, the increase in migration (~2 fold) seen with miR-191 mimic alone was abolished when miR-191 mimic was used along with esiTGFβ2 (Figure 7a, b, Supplementary data 3f, h). [score:1]
In summary, our study unravels the hypoxia/HIF/miR-191/TGFβ pathway that plays an important role in breast cancer biology. [score:1]
The sequences of primers used for cloning and site-directed mutagenesis are mentioned in Supplementary data 1. For promoter analysis, miR-191 promoter fragments predicted to encompass hypoxia response elements (HREs) were amplified. [score:1]
Thus, miR-191 induction under hypoxia is mediated by recruitment of HIF to the HRE sites present in its promoter. [score:1]
Altogether, these results suggested that hypoxia mediated strong induction in miR-191 levels is HIF -dependent. [score:1]
To show HIF specific regulation of miR-191, CHIP assay was performed on MCF7 cells transfected with HA-tagged-HIF 1α/HIF 2α/parent vector and exposed to hypoxia for 24 hrs. [score:1]
[1 to 20 of 140 sentences]
4
[+] score: 138
Colamaio M. Borbone E. Russo L. Bianco M. Federico A. Califano D. Chiappetta G. Pallante P. Troncone G. Battista S. miR-191 down-regulation plays a role in thyroid follicular tumors through CDK6 targetingJ. [score:6]
Examination of miR-191 and miR-425 expression in four GC cell lines (HGC-27, MGC-803, MKN-45 and SGC-7901) indicated an obvious upregulation of miR-191/425 in HGC-27, MGC-803, and SGC-7901 cell lines when compared to adjacent non-tumor tissues and five normal gastric tissues from healthy people (Figure 1d). [score:5]
miR-191 was hypomethylated and overexpressed in liver cancer, and the inhibition of miR-191 decreased cell proliferation and tumor growth of hepatocellular carcinoma cells [22]. [score:5]
In this study, we demonstrated that reduced expression of miR-191 in the GC cell line HGC-27 resulted in impaired cell proliferation and inhibition of cell cycle progression. [score:5]
Inhibition of miR-191 and miR-1425 in GC Cells Inhibits Cell Migration and Invasion. [score:5]
In addition, reduced expression of miR-191 and miR-425 dramatically inhibited the normally strong invasive capacity of HGC-27 cells as indicated by transwell invasion assays (Figure 5c). [score:4]
These results, particularly the finding that high levels of miRNAs correlate with disease progression, indicate the misregulation of miR-191 and miR-425 in GC patients, which makes the use of miR-191 and miR-425 as novel biomarkers in GC patients a possibility. [score:4]
Our study revealed two upregulated miRNAs, miR-191 and miR-425, in GC patients. [score:4]
Inhibition of miR-191 and miR-425 both slowed HGC-27 cell migration in wound healing assays and suppressed cell invasion in transwell analysis, further confirming their association with the degree of GC malignance. [score:4]
Another study dealing with GC samples has demonstrated that miR-191 was upregulated in gastric carcinoma; however, the functional and mechanistic significance of miR-191 in gastric carcinogenesis was undefined. [score:4]
The remarkable increase in miR-191 and miR-425 expression in GC patients incited us to explore the possible biological significance of these miRNAs in tumorigenesis. [score:3]
The miR-191/425 Cluster Is Highly Expressed in Gastric Cancer (GC). [score:3]
Treatment with miRNA inhibitors reduced intracellular levels of miR-191 and miR-425 in HGC-27 cells by 4-and 3-fold over scramble control, respectively (Figure 4a). [score:3]
Because the basal level of miR-191 in non-tumor serum is relatively low, even a small increase in its expression could enable a sensitive enough signal for detection. [score:3]
This difference was significant (Figure 2a), suggesting a lower background in non-tumor serum for miR-191/425 expression relative to miR-16 and miR-21. [score:3]
Elyakim E. Sitbon E. Faerman A. Tabak S. Montia E. Belanis L. Dov A. Marcusson E. G. Bennett C. F. Chajut A. hsa-miR-191 is a candidate oncogene target for hepatocellular carcinoma therapyCancer Res. [score:3]
The expression of miR-191 and miR-425 was much higher in tumor than in non-tumor tissues (Figure 1a,b). [score:3]
Taken together, these results indicate that inhibition of miR-191 and miR-425 can efficiently reduce tumor cell proliferation and cell cycle in vitro, suggesting oncogenic roles in modulating tumorigenicity of GC cells. [score:3]
To determine the differential expression of miR-191 and miR-425, we used quantitative RT-PCR (qPCR) to analyze their relative levels in total RNA extracted from 75 clinical GC tissue samples with adjacent normal tissue samples from the same patient. [score:3]
The relative expression values for miR-191 in blood above this cutoff point were found in 50.0% of stage I–II GC patients, in 71.4% of stage III GC patients and in 75.0% of stage IV GC patients. [score:3]
Accordingly, the percentage of S phase cells was reduced by ~11% and ~8% in HGC-27 cells treated with miR-191 and miR-425 inhibitor, respectively (Figure 4c). [score:3]
These findings suggest that elevated blood miR-191 could be detected in early stages of GC and therefore facilitate early disease detection. [score:3]
Reduced expression of miR-191 and miR-425 led to significant decreases in cell proliferation in HGC-27 cells (Figure 4b). [score:3]
Inhibition of endogenous miR-191 and miR-425 in HGC-27 cells resulted in a significant reduction of cell migration during the closing of artificial wounds created over confluent monolayers (Figure 5a,b). [score:3]
miR-191 also displayed tumor-type specific roles in tumorigenesis, as miR-191 represses MDM4 and CDK6 expression in ovarian and thyroid follicular cancer, thereby delaying cancer progression and tumor-related death [25, 26]. [score:3]
Inhibition of miR-191 and miR-425 Repressed Cell Proliferation and Cell Cycle Progression of GC Cells. [score:3]
To further study the correlation between miRNA expression and clinicopathological factors, the levels of miR-191/425 in GC tissues (including fully clinical information) were statistically analyzed (non-parametric test). [score:3]
The activation of miR-191 and miR-425 (the miR-191/425 cluster) expression by their host gene DALRD3 and estrogen receptor a (ERa) was shown to modulate the tumorigenicity of breast cancer cells [24]. [score:3]
To assess the relevance of miR-191/425 levels on GC cell growth, miRNA inhibitors or scramble controls were used to transfect HGC-27 cells. [score:3]
The level of miR-191 was significantly higher in GC patients with late stage disease (p < 0.01, stage IV vs. [score:3]
To determine the level of circulating miR-191/425 level in GC patient serum, we performed qPCR analysis and compared miR-191/425 expression in GC patient serum with normal human serum (a control group consisting of pooled RNA from 58 healthy donor serum samples). [score:2]
To test our hypothesis, cell migration and invasion assays were performed in HGC-27 cells transfected with miR-191/425 inhibitors or scramble controls. [score:2]
In the normal serum, the mean Cq of both miR-191 (Cq = 33) and miR-425 (Cq = 35) was higher than the mean Cq of both miR-16 (Cq = 26) and miR-21 (Cq = 28) (Figure 2a). [score:1]
Di Leva G. Piovan C. Gasparini P. Ngankeu A. Taccioli C. Briskin D. Cheung D. G. Bolon B. Anderlucci L. Alder H. Estrogen mediated-activation of miR-191/425 cluster modulates tumorigenicity of breast cancer cells depending on estrogen receptor statusPLoS Genet. [score:1]
Furthermore, as metastasis is the major cause of morbidity and mortality from GC patients, we subsequently analyzed the affects of miR-191 and miR-425 levels on cell migration and invasion. [score:1]
The level of miR-191 in GC tissues with metastasis was higher than that in the non-metastatic group (p < 0.01). [score:1]
However, the precise role for the miR-191/425 cluster and their clinic significance in human GC are not well understood. [score:1]
miR-191 is associated with several human solid tumors including colon, lung, pancreas, prostate, and stomach cancer, as well as acute lymphocytic leukemia (ALL) -associated hematopoietic malignancies [22– 24]. [score:1]
These results are consistent with the above findings that the miR-191 and miR-425 can promote tumor cell growth as well as their progression towards more malignant degree. [score:1]
In contrast, when using miR-16 as an endogenous control, the relative level of miR-191 in GC serum was significantly higher than those in the controls (p < 0.01) (Figure 2b). [score:1]
Based on our results that miR-191 or miR-425 are statistically associated with metastasis and the degree of tumor malignancy, we proposed that these two miRNAs might play an extremely important role in GC cell migration and invasion. [score:1]
More importantly, increased levels of serum miR-191 can distinguish, with significant specificity and sensitivity, patients with GC from healthy controls. [score:1]
The difference between miR-191 levels in the patient and healthy groups varied depending on whether U6 snRNA (p = 0.036) or miR-16 (p = 0.007) was used as a reference gene in our experiments. [score:1]
The average %CVs for miR-191 intra-run and inter-run (6 runs total for 75 paired samples) were 1.51% ± 0.44% and 2.95% ± 0.87%, respectively. [score:1]
Furthermore, serum miR-191 levels were also associated with lymph node metastasis and TNM staging, thus increasing its diagnostic importance. [score:1]
To ascertain whether the miR-191 and miR-425 signatures differ between GC and non-tumor serum, qRT-PCR was performed using 57 GC patients and 58 healthy donor blood samples. [score:1]
Our results may provide new insight into the role of the miR-191/425 cluster in human GC tumorigenesis and may suggest serum miRNA levels to be novel clinical biomarkers in GC patients. [score:1]
In the present study, we focused on the tumorigenic role of the miR-191/425 cluster in human GC cells as well as their potential use for the diagnosis of GC. [score:1]
The miRBase Accession Numbers for miR-191 (MIMAT0000440) and miR-425 (MIMAT0003393). [score:1]
Furthermore, the low basal levels of serum miR-191 and miR-425 might hint that miR-191/425 could serve as more sensitive biomarkers in GC detection. [score:1]
Levels of serum miR-191 can be a potential marker for discriminating GC patients from healthy controls, with ROC curve areas of 0.849 (95% CI: 0.78–0.92) (Figure 3). [score:1]
First, we detected the raw Cq data for miR-191 and miR-425 in the control serum. [score:1]
These results indicate that increased levels of serum miR-191 in GC samples correlate with pTNM stage (p = 0.013, stage II vs. [score:1]
With this cutoff value for miR-191, the sensitivity and specificity were 70.2% and 99.9%, respectively. [score:1]
Here, we also used different reference genes (U6 snRNA and miR-16) in miR-191 data analysis. [score:1]
A similar oncogenic phenotype was also observed in HGC-27 cells with miR-425, another component originating from the same gene cluster as miR-191. [score:1]
According to the ROC curve, the relative blood level of miR-191 is 3.34, which is the optimal cutoff value for differentiating GC patients and controls (Youden’s index). [score:1]
When U6 snRNA was used as an endogenous control for data normalization, no miRNA levels were significantly different between the two groups (p = 0.23, miR-191; p = 0.07, miR-425) (Figure 2b). [score:1]
These results allow us to speculate that silencing of miR-191 may provide a survival advantage to GC cells. [score:1]
The average coefficients of variation (%CV) for miR-191 intra-run and inter-run (3 runs total for 115 serum samples) were 1.96% ± 0.89% and 1.28% ± 0.60%, respectively. [score:1]
[1 to 20 of 60 sentences]
5
[+] score: 123
S2 TableSelected putative targets of miR-191 in vertebrate genomes predicted using the TargetScan Release 6.2 algorithm and ranked by their probability of conserved targeting (P [CT]). [score:7]
Selected putative targets of miR-191 in vertebrate genomes predicted using the TargetScan Release 6.2 algorithm and ranked by their probability of conserved targeting (P [CT]). [score:7]
Similar findings have not been reported for the human orthologues, although expression of miR-191 in colonic mucosal tissue of inflammatory bowel disease patients [84] and its higher levels in peripheral blood of Crohn’s disease patients relative to healthy individuals [85] suggests a potential immunological involvement. [score:7]
Putative targets of hsa-miR-191 and hsa-miR-425 were predicted with the TargetScanHuman Release 6.2 algorithm, which predicts target mRNAs in vertebrate genomes (http://www. [score:7]
In addition, miR-191 and miR-425 expression was upregulated by IL-2 stimulation of human natural killer (NK) cells [86]. [score:6]
Furthermore, the implication of the human miR-191 cluster in various physiological processes [95– 99] and in a number of pathologies and human neoplasias [87– 88, 90– 94, 100] indicate a wide and diverse expression pattern, target repertoire, and regulatory roles in diverse processes in multiple organs and tissues. [score:6]
Validated targets for miR-191 in humans include genes encoding transcription factors, chromatin remo delers, and regulators of the cell cycle [101] and for miR-425 genes encoding a tumor suppressor [87] and the atrial natriuretic peptide involved in salt intake response [96]. [score:6]
We thus wanted to find out whether the expression of miR-462 and miR-731 (in fish cells) and miR-191 and miR-425 (in human cells) will be induced in response to stimulation with the TLR3 agonist and general IFN stimulator poly I:C. Furthermore, we were interested to know if the rainbow trout mir-462 promoter containing IFN-relevant motifs will be able to drive the expression of a reporter gene following poly I:C simulation of cells. [score:5]
A recent report further demonstrated involvement of miR-425 in inflammation -induced cancer, which together with miR-191 and other miRNAs, has been shown to be upregulated in IL-1β -treated human gastric adenocarcinoma cell line AGS [87]. [score:4]
In addition, miR-191 and miR-425 were not among the many inducible miRNAs found in a virus replicon-bearing human hepatoma cell line, nor were they upregulated by the addition of ribavirin and/or IFN-β to these cells [89]. [score:4]
We report here that miR-462 and miR-731 in teleost fishes are orthologous, respectively, to miR-191 and miR-425 present in other vertebrates, but differ in the regulation of their expression and detailed genomic position. [score:4]
S4 Fig (A-C) Immune stimulation by poly I:C does not induce upregulation of miR-191 in HeLa cells. [score:4]
As expected, we were not able to induce miR-191 nor miR-425 in the human HeLa cells with poly I:C despite the high up-regulation of the IFN-stimulated gene ISG-12. [score:4]
In conclusion, our study showed that the IFN-regulated miR-462 and miR-731 in teleost fishes are orthologues, respectively, of the ancestral vertebrate miR-191 and miR-425 present in a wide range of non-teleost vertebrates from primitive cartilaginous fish to humans but that the teleost variant has evolved differently with respect to its regulation and presumably also functional roles. [score:3]
Reduced cell proliferation and migration following inhibition of miR-191 and miR-425 in a gastric cancer cell line further supported their involvement in oncogenesis and cell cycle control [88]. [score:3]
The regulation of the intragenic miR-191 cluster in humans thus appears to be different, possibly controlled by proinflammatory signaling molecules like IL-1β [87], estrogen response elements [90– 91], other regulatory elements [92– 93], and by epigenetic mechanisms [94]. [score:3]
Stimulation of HeLa cells with poly I:C induced the expression of the IFN -induced gene ISG12 but not miR-191 and miR-425 (S4 Fig). [score:3]
We did not perform further analysis of the promoter activity of the upstream region of the miR-191 cluster locus since this region in mammalian genomes does not contain IFN-related elements and has no similarity to that found upstream of the teleost miR-462 cluster locus; and poly I:C stimulation of HeLa cells accordingly did not result in the induction of miR-191 and miR-425 expression. [score:3]
Human embryo kidney cells (HEK293T) were used as negative control cells because an innate cellular response in these cells cannot be induced by poly I:C. Accordingly, these neither regulated ISG12 nor miR-191/miR-425 (data not shown). [score:2]
Human miR-191 cluster regulation is not steered by a poly I:C activated promoter. [score:2]
The presence of IFN-relevant promoter elements upstream of the mir-462 locus in fish genomes and the non-association of these with the miR-191 locus in the human genome indicate potential regulation of miR-462 and miR-731, but not of miR-191 and miR-425, by IFNs. [score:2]
Precursor and mature sequences of miR-191 and miR-462 cluster miRNAs were retrieved from miRBase Release 20 (http://www. [score:1]
However, the recently discovered presence of the miR-191 cluster in the cartilaginous fish C. milii or elephant shark, which has been claimed to have the slowest evolving genome of all known vertebrates [76], suggested that the miR-191 cluster has existed in the common ancestor of cartilaginous fishes and bony vertebrates. [score:1]
Furthermore, mir-191 and mir-425 sequences from selected vertebrates (Homo sapiens, human; Rattus norvegicus, rat; Bos taurus, cow; Mus musculus, mouse; Mono delphis domestica, opossum; Xenopus tropicalis, Western clawed frog) were aligned with mir-462 and mir-731 sequences, respectively, from Danio rerio (zebrafish) in the CLC main Workbench (CLC, Denmark) using default settings. [score:1]
Although the functional impact of the miR-191 cluster miRNAs remains unclear in the above-mentioned studies, the results indicate this miRNA cluster’s potential role in inflammatory responses. [score:1]
We therefore performed phylogenetic analysis based on the mature sequences of the miR-191 and miR-462 cluster miRNAs retrieved from miRBase to elucidate their evolutionary history in vertebrates. [score:1]
Higher vertebrate sequences were from Xenopus tropicalis (Western clawed frog), Anolis carolinensis (Carolina anole, lizard), Homo sapiens (human), Macaca mulatta (macaque), Pan troglodytes (chimpanzee), Pongo pygmaeus (orangutan), Gorilla gorilla, Cricetulus griseus (Chinese hamster), Bos taurus (cow), Equus caballus (horse), Ovis aries (sheep), Canis familiaris (dog), Ornithorhynchus anatinus (platypus), Mono delphis domestica (opossum), Sus scrofa (pig), Rattus norvegicus (rat), Mus musculus (mouse), and Taeniopygia guttata (zebra finch) (exceptions: miRBase Release 20 does not have a record of mir/miR-191 from T. guttata and of mir/miR-425 from G. gorilla, E. caballus, and O. aries). [score:1]
0132434.g003 Fig 3Diagram of the genomic location of the (A) miR-462 cluster in zebrafish and (B) the miR-191 cluster in humans. [score:1]
S2 FigAlignment of dre-mir-462/731 with higher vertebrate mir-191/425 stem loops (referring to Fig 3). [score:1]
0132434.g005 Fig 5 of (A) miR-191 and miR-462 and (B) miR-425 and miR-731. [score:1]
Teleost miR-462 and miR-731 have evolved from the ancestral miR-191 and miR-425, respectively. [score:1]
Diagram of the genomic location of the (A) miR-462 cluster in zebrafish and (B) the miR-191 cluster in humans. [score:1]
Alignment of dre-mir-462/731 with higher vertebrate mir-191/425 stem loops (referring to Fig 3). [score:1]
The larger genetic distance (Fig 5) that separates the teleost fish miR-462 cluster from the orthologous miR-191 cluster of other vertebrates indicates that teleost miRNA sequences in relative terms have undergone more accelerated changes. [score:1]
In contrast to the miR-462 cluster in teleost genomes, the human miR-191 cluster does not appear to be involved in IFN -mediated immunological functions but may play a role in non-IFN associated inflammatory responses and cell proliferation. [score:1]
Elephant shark mir/miR-191 and mir/miR-425 sequences were accessed from NCBI Nucleotide database (http://www. [score:1]
Unrooted neighbor-joining (NJ) bootstrapped distance trees (1000 replicates) confirmed that the teleost miR-462 and miR-731 clustered together with the non-teleost miR-191 and miR-425, respectively. [score:1]
All available teleost fish genomes have the miR-462 and miR-731 loci positioned in an intergenic region between the DALRD3 and IMPDH2 loci whereas humans and some other mammals have the homologous miR-191 cluster within DALRD3 [51]. [score:1]
On the other hand, miR-191 and miR-425 of diverse higher vertebrates all clustered together and were thus almost identical. [score:1]
Gene synteny and sequence homology analyses showed that the teleost miR-462 and miR-731 are orthologues of miR-191 and miR-425, respectively, found in mammals as well as in the more primitive cartilaginous fish, elephant shark. [score:1]
Furthermore, by aligning the fish and the human DALRD3 sequences, we found that the miR-191 cluster sequences were absent in the fish DALRD3 locus (data not shown). [score:1]
Alignment of miR-191 and miR-425 with miR-462 and miR-731, respectively, showed high homology especially in the antisense strand and a full conservation in the seed area (Fig 3C). [score:1]
The intergenic position of the miR-191 cluster in the genome of the primitive cartilaginous fish, C. milii [76], suggests that a translocation of the miR-191 locus into the DALDR3 intron has occurred during vertebrate evolution in the primate lineage including human, macaque, and marmoset. [score:1]
Together with their consistent position relative to the DALRD3 locus as well as the association of the two miRNAs comprising the given miRNA cluster in all genomes analyzed, this further supports the genetic relation of the miR-462 and miR-191 clusters. [score:1]
These elements themselves are rather conserved among vertebrates [66– 68, 80– 81], but are not associated with the miR-191 cluster in mammals. [score:1]
In humans, the miR-191 cluster has been previously shown to be involved in cell cycle control and carcinogenesis, which appears unrelated to the involvement of their rainbow trout homologues in the response to VHSV infection and IFN stimulation. [score:1]
Based on the high homology of the seed regions in the non-teleost miR-191 and teleost miR-462 clusters (Fig 3C), conserved clustering pattern, related genomic location as well as lack of genomic co-existence, we hypothesized these miRNA clusters to represent evolutionary orthologues. [score:1]
The miR-462 and miR-731 in teleost fish are orthologues of miR-191 and miR-425, respectively, in higher vertebrates. [score:1]
Based on teleosts belonging to an evolutionary early vertebrate lineage, we initially thought that the miR-462 cluster represented an ancestral form of the mammalian miR-191 cluster. [score:1]
Interestingly, while comparing several mammalian genomes from the Ensembl database, we noted that whereas the human, macaque, and marmoset miR-191 cluster is present intragenically in an intron of DALRD3 (Fig 3A and 3B), this is not the case for all mammalian genomes. [score:1]
Synteny analysis between teleost fish and human genomes showed two intragenic/intronic miRNAs, miR-191 and miR-425, within the region flanked by DALRD3 and IMPDH2 instead of the intergenic miR-462 and miR-731 present in teleost fish genomes analyzed (http://www. [score:1]
of (A) miR-191 and miR-462 and (B) miR-425 and miR-731. [score:1]
[1 to 20 of 52 sentences]
6
[+] score: 76
In addition, miR-191 was downregulated in retinoblastoma compared to human fetal retinae and multiple miR-191 targets were deregulated in retinoblastomas. [score:6]
In order to find protein coding genes that are potentially regulated by miR-191, we downloaded the list of genes predicted to be targeted by miR-191 from several public databases (TargetScan: 34 genes; PicTar: 27 genes; MSKCC miRanda: 2,204 genes; Sanger microcosm: 2,208) and publications (Zhang et al. : 2 genes; Elyakim et al. : 39 genes) and merged into a non-redundant set (2,249 genes). [score:6]
0042739.g004 Figure 4 A) Boxplot of the Log [2] expression for hsa-mir-191 probeset in 6 fetal retina and 16 primary human retinoblastomas showing significantly lower expression. [score:5]
We performed pair-wise correlation of the expression of miR-191 and that of its predicted targets. [score:5]
Table S8 Target genes associated with mir-191 expression in retinoblastoma tumors. [score:5]
However, miR-191 expression levels did not significantly correlate with expression of MDM4 mRNA (r = 0.48; p = 0.097;) (Figure 4D). [score:5]
A) Boxplot of the Log [2] expression for hsa-mir-191 probeset in 6 fetal retina and 16 primary human retinoblastomas showing significantly lower expression. [score:5]
The miR-191 array data were validated by real time-RT-PCR (Figure 4B) and 19 target genes showed an inverse correlation between miR-191 levels and gene expression levels in our cohort (Figure 4C and Table S8). [score:5]
The transcriptome analysis showed that all of the transcripts expressed in the 3 retinoblastoma samples that were used to generate the orthotopic xenografts had the A/A allele of MDM4 SNP34091 which is the allele that is believed to be less sensitive to regulation by miR-191. [score:4]
We also explored the role of miR-191 in regulating MDM4 mRNA and protein expression in retinoblastoma. [score:4]
We found that miR-191 was significantly downregulated in retinoblastoma compared to human fetal retinae (p = 0.04) (Figure 4A). [score:3]
Moreover, miR-191 was significantly downregulated in retinoblastoma compared to human fetal retinae. [score:3]
The SNP34091-A allele is not efficiently recognized by miR-191 and this in turn leads to increased MDM4 protein expression and increased risk of high-grade carcinoma [9]. [score:3]
Specifically, we propose that miR-191 expression levels, SNP34091 genotype and the relative abundance of MDM4-S and MDM4-A contribute to the steady state levels of MDM4 protein and the activity of the p53 pathway in retinoblastoma. [score:3]
In a more recent study, Wynendaele and colleagues identified a SNP C>A in the 3′ UTR of MDM4 (SNP34091) that creates a putative target site for miR-191 [9]. [score:3]
We analyzed the expression of miR-191, using the Agilent microRNA chip array in our human orthotopic xenografts, retinoblastoma cell lines, human fetal retinae and primary tumors. [score:3]
Mir-191 Target Gene Analysis. [score:2]
It has been previously shown that MDM4 SNP34091 C allele creates a binding site for miR-191 and leads to reduced mRNA and protein levels [9]. [score:1]
We found that the majority of primary retinoblastomas in our cohort (38/44) had at least one allele that is insensitive to miR-191. [score:1]
Additional samples with the C/A or C/C genotype would be required to provide statistically significant data on the relationship between miR-191 levels and MDM4 mRNA in retinoblastoma. [score:1]
Analysis of the miR-191 binding site SNP in retinoblastoma. [score:1]
Analysis of miR-191 in retinoblastoma. [score:1]
To explore the possible role of miR-191 in retinoblastoma further, we genotyped SNP34091 in the tumor and normal DNA of each of samples in our cohort of 44 samples (Table S5). [score:1]
[1 to 20 of 23 sentences]
7
[+] score: 39
In proliferating keratinocytes (Figure  5A), we confirmed the down-regulation of the 3 tested miRNAs (miR-191-5p, miR-200b-3p and miR-331-3p) at 3 h whereas no modulation was detected at 1 or 24 h. In differentiated keratinocytes (Figure  5B), we also observed a significant response at 3 h for two of the 3 tested miRNAs: as observed after TLDA analysis (Figure  4B), let-7b-5p and miR-196b-5p were up-regulated 3 hours after irradiation. [score:7]
As miR-191-5p is down-regulated whereas the level of its precursor remains constant, those results suggest that the global modulation of the miRNAs expression that we detected after irradiation (see Figure  3) is the result of multiple and complementary levels of regulation within the miRNA biogenesis pathway. [score:7]
List of the predicted targets for the microRNAs miR-191-5p, miR200b-3p and miR-331-3p and list of the targets in common between these 3 miRNAs. [score:5]
Click here for file List of the predicted targets for the microRNAs miR-191-5p, miR200b-3p and miR-331-3p and list of the targets in common between these 3 miRNAs. [score:5]
Some of the miRNAs repressed by IR in proliferating keratinocytes could be involved in this growth arrest: it is the case of miR-17-5p and miR-191-5p that are over-expressed in cancer cells where they contribute to activate cell proliferation [32, 33]. [score:3]
Venn diagram showing the predicted targets in common between the 3 miRNAs miR-191-5p, miR200b-3p and miR-331-3p. [score:3]
To go further into these mechanisms, we searched for putative gene targets of miR-191-5p, miR-200b-3p and miR-331-3p. [score:3]
Click here for file Venn diagram showing the predicted targets in common between the 3 miRNAs miR-191-5p, miR200b-3p and miR-331-3p. [score:3]
A. Proliferating keratinocytes were transfected with pre-miRNA for miR-191-5p or miR-200b-3p or miR-331-3p (pre-miR-specific) or with a Pre-miR negative control. [score:1]
Because of their higher level of repression in irradiated proliferating cells, miR-191-5p, miR-200b-3p and miR-331-3p were selected for further analysis. [score:1]
The day after, cells were transfected during 6 h with 50pM pre-miR-191-5p, 50pM pre-miR-331-3p or 500fM pre-miR-200b-3p, individually or pooled, in tetraplicate using HiPerfect Transfection Reagent (301705, Qiagen). [score:1]
[1 to 20 of 11 sentences]
8
[+] score: 38
Other miRNAs from this paper: hsa-mir-30a
Target prediction by the miRanda algorithm identified 731 targets for miR-30a-5p and 570 targets for miR-191. [score:7]
MiR-191 expression is up-regulated in pancreatic [14], colon, lung and prostate [7] cancers. [score:5]
For example, in a study by Peltier et al [18] that carefully evaluated several candidate miRNAs for stability of expression across five types of cancer and normal tissues by RT-PCR, miR-191 was so stably expressed that it was proposed as a gene to be used for normalization. [score:3]
Quantitative RT-PCR for confirming over -expression of miR-30a in A-30a and B-30a, and of miR-191 in A-191 and B-191 cell lines, respectively. [score:3]
No mRNA targets of miR-191 have been experimentally verified. [score:3]
0009219.g001 Figure 1Quantitative RT-PCR for confirming over -expression of miR-30a in A-30a and B-30a, and of miR-191 in A-191 and B-191 cell lines, respectively. [score:3]
MiR-191 expression is also altered in lungs exposed to cigarette smoke [15]. [score:2]
Cell migration of A-30a and B-30a is increased compared to controls; no effect of overexpression of miR-191 is seen. [score:2]
There was no significant difference in the migration distance between cell lines overexpressing miR-191 when compared to the corresponding control cell lines (Figure 3A). [score:2]
A. Cell migration of A-30a and B-30a is increased compared to controls; no effect of overexpression of miR-191 is seen. [score:2]
Compared to controls, miR-191 was overexpressed ∼2 fold and ∼7 fold in A549 (A-191) and BEAS-2B (B-191) respectively (Figure 1). [score:2]
Only a single mature form of miR-191 is known to exist. [score:1]
The specific miRNAs selected were miR-191 and - 30a-5p. [score:1]
MiR-191 is located on human chromosome 3p21.31 and is generated from an intronic transcriptional unit that can produce two miRNAs: miR-191 and -425 [5]. [score:1]
This argues against a role for miR-191 in carcinogenesis. [score:1]
[1 to 20 of 15 sentences]
9
[+] score: 37
Other miRNAs from this paper: mmu-mir-191
It is hypothesized that aromatase inhibition through Letrozole treatment reduces oestrogen -mediated binding of the ER to the ERE and therefore reduces miR-191 expression. [score:5]
Assessment of the role of miR-191 in aromatase inhibitor -induced reduction of GBM cell proliferation. [score:3]
Oestrogen is synthesised, catalysed by aromatase, and subsequently binds to the estrogen receptor (ER) alpha/beta subunits which dynamically interact with the estrogen responsive elements (ERE) in the promoter region of miR-191 [39], increasing expression and driving proliferation, migration and chemoresistance in several cancer types [54, 66– 68]. [score:3]
GBM cells (MZ-304) were treated with Letrozole (0.1 μM) and qPCR was carried out to assess the effect of aromatase inhibition on the oestrogen response microRNA, miR-191. [score:3]
As miR-191 is an estrogen-responsive microRNA [39], and its expression has been correlated to the aggressive mesenchymal subtype of GBM [40], it was of interest to evaluate if the treatment with Letrozole (0.1 μM) (Figure 2) alters miR-191 expression in glioma cells. [score:3]
Notably, Letrozole treatment resulted in a 34.46% ± 4.99 reduction in miR-191 expression relative to vehicle -treated controls (A), n = 3, mean ± SEM * p < 0.05). [score:3]
The microRNA-191 (miR-191) has been implicated in several cancer types [35– 38] showing an active role in cell proliferation, migration, chemoresistance and ultimately disease progression. [score:3]
The results showed that Letrozole treatment results in a 34.46% ± 4.99 reduction in miR-191 expression relative to vehicle -treated controls (Figure 6A * p < 0.05). [score:3]
Therefore, qPCR was carried out to assess the effect of aromatase inhibition on levels of miR-191. [score:3]
Figure 6GBM cells (MZ-304) were treated with Letrozole (0.1 μM) and qPCR was carried out to assess the effect of aromatase inhibition on the oestrogen response microRNA, miR-191. [score:3]
In an attempt to understand the mechanism through which Letrozole elicits its anti-tumor effect in GBM cells, the authors evaluated the expression levels of the estrogen-responsive microRNA-191 (miR-191) post-Letrozole treatments. [score:1]
It was found that transient transfection of miR-191 Let -treated MZ-304 cells led to a restoration of ‘normal’ cell proliferation rates, similar to those noted in untreated and DMSO+premiRneg -treated MZ-304 cells (*** p < 0.001, n = 3, mean ± SEM, Two way ANOVA). [score:1]
As shown in Figure 6B, transient transfection of synthetic miR-191 into MZ-304, whose growth rate had been significant reduced by Letrozole treatment, led to a restoration of cell proliferation rates back to basal levels of untreated cells. [score:1]
It was of interest, therefore, to assess if the reduction of GBM cell proliferation after Letrozole-treatment could be reversed by reintroduction of miR-191. [score:1]
After 40 hours, MZ-304 ± Letrozole cells were transiently reverse transfected with control negative (premiR-neg) or synthetic precursor miR-191 (premiR-191) and returned to assess subsequent growth. [score:1]
[1 to 20 of 15 sentences]
10
[+] score: 35
Thus, pred-MIR191 lies 219bp upstream of and antisense to SLAIN1 (SLAIN motif family, member 1), a gene strongly expressed in human embryonic stem cells and down-regulated during differentiation, but expressed in the brain [45]. [score:8]
Both pred-MIR191 and pred-MIR222 are associated with host genes suggesting that, potentially, their expression could be co-regulated. [score:4]
Furthermore the presence of a predicted binding site for pred-MIR191 in the 3′-UTR of SLAIN1 also raises the possibility that this miRNA can regulate the translation of its host gene, a mechanism that has been proposed for miR-186 in dog [62] and for miR-763 in human, mouse and rat [63]. [score:4]
The results showed that both pred-MIR191 and its host gene SLAIN1 were up-regulated after 8 days RA (Fig. 9; NT2-8D/NT2-undiff: pred-MIR191 - 2.3-fold, p0.04 and SLAIN1- 5.9-fold, p0.1). [score:4]
This, in turn, raised an interesting possibility that the region between SLAIN1 and pred-MIR191, which contains both a putative promoter and a CpG island, may be responsible for co-regulation of these genes through a bi-directional promoter mechanism [61]. [score:3]
The remaining 10 miRNAs, including 5 known (miRNAs 24, 92a, 135a, 214, and 494) and 5 predicted (pred-MIR112, pred-MIR166, pred-MIR189, pred-MIR191, and pred-MIR222) continued to be expressed in fully differentiated NT2-N neurons and/or NT2-A astrocytes (Fig. 5A). [score:3]
In addition we also tested the expression of the predicted miRNAs, pred-MIR191 and pred-MIR222, and the associated host genes, SLAIN1 and FOXP2, and demonstrated that they followed the same kinetics. [score:3]
Finally, we confirmed the existence of two predicted miRNAs; pred-MIR191 and pred-MIR222 associated with SLAIN1 and FOXP2, respectively, and provided some evidence of their potential co-regulation. [score:2]
The predicted miRNAs, pred-MIR191 and pred-MIR222, were submitted to miRBase (http://www. [score:1]
Pred-MIR191 was determined to be 18 nt, omitting 4 nt at the 5′ end and pred-MIR222 was 21 nt, missing 1 nt at the 3′ end. [score:1]
The PCR amplified bands, observed for both pred-MIR191 and pred-MIR222, were cut from the gel and the sequences were then validated by cloning and sequencing of the amplicons. [score:1]
The mature sequences of these miRNAs were determined to be: pred-MIR191; 5′-AGCAGGTGCGGGGCGGCG-3′ and pred-MIR222; 5′-CAGTGCAAGTGTAGATGCCGA-3′. [score:1]
[1 to 20 of 12 sentences]
11
[+] score: 34
After normalization to 1 in the control group (U937/GFP), the relative expressions of selected downregulated miRNAs (miR-27a-3p, miR-424-5p, and miR-496-5p) in the test group are shown in A; the relative expressions of upregulated miRNAs (miR-296-5p, miR-377-5p, and miR-3680-5p), and unchanged miR-191-5p in the test group are shown in B. Figure 3 qPCR validation of miRNA expression levels in samples from the latent tuberculosis infection (LTBI) group versus the healthy control group. [score:13]
After normalization to 1 in the control group (U937/GFP), the relative expressions of selected downregulated miRNAs (miR-27a-3p, miR-424-5p, and miR-496-5p) in the test group are shown in A; the relative expressions of upregulated miRNAs (miR-296-5p, miR-377-5p, and miR-3680-5p), and unchanged miR-191-5p in the test group are shown in B. Figure 3 qPCR validation of miRNA expression levels in samples from the latent tuberculosis infection (LTBI) group versus the healthy control group. [score:13]
In parallel, the levels of upregulated miR-296-5p, miR-377-5p, miR-3680-5p, and unchanged miR-191-5p were similar to the chip results as well (Figure 2B). [score:4]
The expression level of seven miRNAs (miR-424-5p, miR-493-5p, miR-296-5p, miR-27b-3p, miR-377-5p, miR-3680-5p, miR-191-5p) were validated by qRT-PCR. [score:3]
The miR-424-5p (previous ID: miR-424), miR-493-5p (previous ID: miR-493*), and miR-296-5p were reported as potential to discriminate between latent TB and healthy by the previous study [12], the other four miRNAs (miR-27b-3p, miR-377-5p, miR-3680-5p, miR-191-5p) were randomly selected. [score:1]
[1 to 20 of 5 sentences]
12
[+] score: 27
Thus miR-98, miR-323-3p, miR-330-3p, miR-376a, miR-494, miR-598 were down-regulated by UVA and UVB, while miR-191, miR-376c and miR-501-5p were up-regulated by both. [score:7]
Of the 3 up-regulated miRNAs after UVA- and UVB-irradiation (miR-191, mir-376c, miR-501) miR-191 and miR-376c shared the same regulatory element GLYCA-nTRE (gcaggtgaggacttca), which belongs to thyroid regulatory elements (TREs ), whereas miR-376c and miR-501-5p shared GATA-1-undefined-site-13 (cccacccac). [score:6]
Interestingly, of these ten commonly regulated microRNAs miR-98, miR-191, miR-323-3p, miR-330-3p, miR-494, and miR-598 were reported to be also deregulated after ionizing radiation [29], [30], [31] and miR-376a was shown to be a regulator of apoptosis in response to arsenic trioxide treatment [32]. [score:4]
In detail we confirmed the up-regulation of miR-23b (UVA), miR-361-5p (UVB), miR-191 (UVA and UVB) and miR-376c (UVA and UVB). [score:4]
As input the up-regulated miRNA-set consists of miR-191, miR-376c and miR-501-5p. [score:4]
Thyroid hormone receptor T3R is the only identified regulatory factor for GLYCA-nTRE (gcaggtgaggacttca) (shared by miR-191 and miR-376c, see above) [35]. [score:2]
[1 to 20 of 6 sentences]
13
[+] score: 22
'hsa-miR-191’ is identified as the primary miRNA that targets on the 'CEBPB’ mRNAs, through which the expressions of a number of important genes are indirectly co-regulated. [score:7]
Multiple post-transcriptional regulations can also be found in Figure  3. For example, 'hsa-miR-191’ is identified to suppress gene 'REPS1’ (RALBP1 associated Eps domain containing 1) in Figure  3(A), and 'hsa-miR-28-5p’ to suppress gene 'CIT’ (rho-interacting, serine/threonine kinase 21) in Figure  3(B). [score:6]
Both 'ISG20’ and 'ABCG1’ are also the target genes co-regulated by 'hsa-miR-191’ and 'CEBPB’. [score:4]
This module contains the co-regulation motifs 'CEBPB’-'hsa-miR-191’-'CCL5’ and 'CEBPB’-'hsa-miR-191’-'ALB’/'ISG20’. [score:2]
It also contains some two-node regulatory motifs, e. g., 'ETS2’-'ETS2’, 'NFKB2’-'hsa-miR-1227’, 'IRF5’-'CCL5’ and 'hsa-miR-191’-'REPS1’. [score:2]
The first motif cluster in (D) contains the motifs 'CEBPB’-'hsa-miR-191’-'CCL5’/'TRIM28’/'ISG20’/'ABCG1’ etc. [score:1]
[1 to 20 of 6 sentences]
14
[+] score: 21
Interestingly, few of the differentially expressed miRNAs were highly expressed, such as hsa-miR-191-5p, which was abundant in both pre- and post-feed milk (total reads = 1,140,649) and was upregulated post-feeding (p = 0.002). [score:8]
The top 3 included the known hsa-miR-191-5p (total reads 1,140,649) and hsa-miR-30e-3p (total reads 91,722) miRNAs and the novel_mir_39 (total reads 789), which were the most significantly upregulated post-feeding compared to the other differentially expressed known and novel miRNAs (Tables S7 and S8). [score:5]
In particular, hsa-miR-191-5p is upregulated in breast cancer [37, 38], and has been suggested as a prognostic marker for breast cancer progression [39]. [score:4]
Mar-Aguilar F. Luna-Aguirre C. M. Moreno-Rocha J. C. Araiza-Chavez J. Trevino V. Rodriguez-Padilla C. Resendez-Perez D. Differential expression of miR-21, miR-125b and miR-191 in breast cancer tissue Asia Pac. [score:3]
hsa-miR-191-5p and hsa-miR-30e-3p are known to be involved in cell proliferation and different types of cancer [36]. [score:1]
[1 to 20 of 5 sentences]
15
[+] score: 20
A. Expression of miR-21 and miR-23a, B. Expression of miR-30b and miR-130a, C. Expression of miR-133b and miR-191, D. Expression of miR-204 and miR-208b. [score:9]
The expression of miR-130a, miR-133b and miR-191 were increased significantly in all PH subjects and, showed further pronounced in severe PH subjects. [score:3]
It is of note that the expression of miR-133b, miR-191 and miR-204 were not significant in severe PH subjects, compared to their moderate counterparts. [score:2]
Likewise, in the moderate PH group, the expression of miR-191 was 2.88±0.71-fold and was further increased to 5.83±1.66-fold (p<0.05) in severe PH subjects, compared to the controls (Fig. 4A). [score:2]
Mi-130a, mir-133b, miR-191, miR-204 and miR-208b are highly elevated in PH subjects. [score:1]
We choose the following miRNAs for validation: MiR-21, miR-23a, miR-26a, miR-29, miR-34b, miR-191, miR-451 and miR-1246 were derived from the miRNA array analysis (Figure 2). [score:1]
From this study, we present evidence that a set of increased plasma miRNA level that include miR-21, miR-130a, miR-133b, miR-191, miR-204 and miR-208b, can be used as biomarker for assessment of PH. [score:1]
We choose the following miRNAs for validation:MiR-21, miR-23a, miR-26a, miR-29, miR-34b, miR-191, miR-451 and miR-1246 were derived from the miRNA array analysis (Figure 2). [score:1]
[1 to 20 of 8 sentences]
16
[+] score: 18
More relevant microRNAs detected were miR-181d and miR-191, implicated in circadian transcription factor regulation in mouse liver, suggesting the importance of the cyclic expression of these microRNAs for the cyclic regulation of the expression of clock genes like CLOCK and BMAL1 in the liver [116]. [score:7]
miR-191 has been linked to several cancers and other diseases like T2DM, Crohn’s disease, pulmonary hypertension, and Alzheimer’s disease [117]. [score:7]
Nagpal N. Kulshreshtha R. miR-191: An emerging player in disease biology Front. [score:3]
Additionally, circulating miR-191 levels are increased in patients with coronary artery calcification [118] but are not modified in patients with T2DM [119]. [score:1]
[1 to 20 of 4 sentences]
17
[+] score: 17
The strongest reduction of the miR-191 level was observed in the case of AGO2 suppression and of pre-miR-191 in the case of PACT suppression. [score:5]
For miRNA overexpression, the cells were grown to 90% confluence, transfected with plasmid constructs (1 µg/ml) expressing miRNA precursors (pri-miR-182 (Open Biosystems), pri-miR-191, pri-miR-137 or pri-miR-206 (System Biosciences)), and harvested 24 hours after transfection. [score:5]
Moreover, 48 h after the second transfection, the HeLa cells were transfected with plasmid constructs encoding miRNA precursors, pre-miR-191 (System Biosciences) and pre-miR-182 (Open Biosystems), as described above for miRNA overexpression. [score:3]
To rule out the possibility that the effect of Dicer protein partner depletion on miRNA levels is somehow affected by the high stability of endogenous miRNAs, we used the system for miRNA overexpression and analyzed exogenous miR-182 and miR-191. [score:3]
Two independent experiments, for miR-182 and miR-191, showed that the levels of these miRNAs were substantially decreased upon the depletion of Dicer protein partners, and the levels of pre-miRNAs also declined (Figure 3B, Figure 3F). [score:1]
[1 to 20 of 5 sentences]
18
[+] score: 17
Additionally, 3 miRNAs (miR-103, miR-191 and miR-423-5p) with stable expression in human testis tissue were included to serve as reference miRNAs in the expression analysis. [score:5]
miR-126 was downregulated by a factor of 40 (P < 0.00001), miR-126-5p by a factor of 20.7, miR-191 by a factor of 20 (P = 0.001) in SCO samples relative to normal testicular tissue. [score:4]
We found that miR-204, miR-99b-3p, miR-191, miR-509-3-5p, miR-99b, miR-10b, miR-126, miR-126-5p, miR-103 are downregulated in samples from men with SCO pathology pattern. [score:4]
L’expression de miR-34c-5p est réduite d’un facteur 346 (P < 0.00001), celle de miR-10b d’un facteur 18 (P < 0.00001), celle de miR-191 d’un facteur 20 (P = 0.001) et celle de miR-126 d’un facteur 40 (P < 0.00001) dans les tissus des hommes SCO comparés à ceux des hommes à spermatogenèse normale. [score:3]
No hsa-miR-10b-3p ACAGAUUCGAUUCUAGGGGAAU 204514 hsa-miR-10b UACCCUGUAGAACCGAAUUUGUG 204753 hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG 204373 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC 204407 hsa-miR-99b-3p CAAGCUCGUGUCUGUGGGUCCG 204064 hsa-miR-99b CACCCGUAGAACCGACCUUGCG 204367 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC 204446 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA 204339 hsa-miR-126-5p CAUUAUUACUUUUGGUACGCG 204584 hsa-miR-126 UCGUACCGUGAGUAAUAAUGCG 204227 hsa-miR-202-5p UUCCUAUGCAUAUACUUCUUUG 204730 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA 204101 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU 204507 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA 204539 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA 204480 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG 204077 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG 204458 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG 204503 hsa-miR-514 AUUGACACUUCUGUGAGUAGA 204645 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA 204063 hsa-miR-191 CAACGGAAUCCCAAAAGCAGCUG 204306 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU 204593 First strand of cDNA was synthesized using a Universal cDNA Synthesis Kit II (Exiqon, Cat. [score:1]
[1 to 20 of 5 sentences]
19
[+] score: 16
miR-125b, miR-126, miR-10b, miR-10a and miR-191 were underexpressed in cancer samples, whereas miR-26b, miR-607 and miR-135b were overexpressed. [score:5]
In fact, miR-125b, miR-126, miR-10b, miR-10a and miR-191 were underexpressed whereas miR-26b, miR-607 and miR-135b were overexpressed in cancer samples examined, in comparison with the gynecomastia samples. [score:5]
Other miRNAs similarly altered after the enrichment, such as miR-191, miR-454, miR-10a, miR-374a, miR-10b, miR-218, miR-140-3p and miR-126, were downregulated in cancer. [score:4]
To confirm the results of microarray analysis, we performed quantitative real-time PCR analysis on a limited number of samples (19 cancer samples, five gynecomastia samples) using probes corresponding to miR-125b, miR-126, miR-10b, miR-10a, miR-191, miR-26b, miR-607 and miR-135b (Figure 2). [score:1]
analysisTo confirm the results of microarray analysis, we performed quantitative real-time PCR analysis on a limited number of samples (19 cancer samples, five gynecomastia samples) using probes corresponding to miR-125b, miR-126, miR-10b, miR-10a, miR-191, miR-26b, miR-607 and miR-135b (Figure 2). [score:1]
[1 to 20 of 5 sentences]
20
[+] score: 15
The data are plotted as the FC of expression relative to miR-191 expression. [score:5]
miR-191 has been recognized as stably and consistently expressed among esophageal tissues [15] and is more consistent than other reference RNAs in miRNA qRT-PCR experiments such as 5S rRNA, U6 snRNA, or total RNA [16]. [score:3]
The data is expressed as the log10 FC relative to miR-191. [score:3]
The FC of expression relative to miR-191 is shown using box-and-whisker plots. [score:3]
miR-191 was used as a reference gene. [score:1]
[1 to 20 of 5 sentences]
21
[+] score: 13
It has been reported that miR-221/222, miR-24, miR-191 and microRNA-146b-5p modulate erythropoiesis through targeting c-kit, Alk4, Riok3 and Mxi1, and PDGFRA, Klfd, respectively [25– 28]. [score:3]
Recombinant overexpression plasmids for miR-150 and miR-191, including pSUPER-miR-150 and pSUPER-miR-191, were obtained from OligoEngine. [score:3]
Then, 30 ng/well recombinant reporter plasmid (psi-EPB41 3′ UTR, psi-mutated EPB41 3′ UTR or psi-MYB 3′ UTR) and recombinant pSUPER-miRNA plasmid expressing miR-150 or miR-191 were co -transfected into each well by using the Attractene transfection reagent (QIAGEN, USA) in triplicate. [score:3]
Cells were transfected with empty luciferase reporter plasmid, or cotransfected with by EPB41 3′ UTR, mutated EPB41 3′ UTR (mut EPB41 3′ UTR) or MYB 3′ UTR recombinant luciferase reporter plasmid and miR-191 or miR-150 recombinant overexpression plasmid. [score:3]
miR-191 was also used as a negative miRNA control of miR-150 and was shown to have no effect on 4.1 R, as the cotransfection of psiCHECK2–4.1R 3′ UTR and pSUPER-miR-191 did not influence the luciferase activities (Figure 6B). [score:1]
[1 to 20 of 5 sentences]
22
[+] score: 13
Notably, miR-191 and miR-484, two of the nucleolar miRNAs revealed in this study, have been suggested as internal references for miRNA profiling [49]– [51], possibly because of their high abundance. [score:1]
Figure S4 Nucleolars miR-484 and miR-191 are sensitive to exogenous nucleic acids. [score:1]
Figure S5 Nucleolars miR-484 and miR-191 rapidly respond to influenza A virus infection. [score:1]
Nucleolar location of mature miR-191, miR-193b, miR-484 and miR-574-3p in HeLa cells. [score:1]
The HeLa cells were mock -transfected (A, upper panels) or transfected with 1 µg/ml pCDNA-GFP plasmid (A, lower panels) for 72 hrs, or transfected with a single stranded short DNA oligo for 20 hrs, 48 hrs and 72 hrs (B), and fixed and processed for ISH with an miR-484 or miR-191 probe. [score:1]
It is possible that the distribution of other nucleolar miRNAs also respond in the same manner, as another nucleolar miRNA, miR-191, also re-distributed following transfection (Figure S4B). [score:1]
The ISH probes used for nucleolar miRNAs were: hsa-miR-191 with a sequence 5′DigN-cag ctg ctt ttg gga ttc cgt tg-3′; hsa-miR-193b with a sequence 5′DigN-agc ggg act ttg agg gcc agt t-3′; hsa-miR-484 with a sequence 5′DigN-atc ggg agg gga ctg agc ctg a-3′; and hsa-miR-574-3p with a sequence 5′DigN-tgt ggg tgt gtg cat gag cgt g-3′. [score:1]
Four nucleolar miRNAs; miR191, miR-484, miR-574-3p and miR-193b, were tested in our ISH experiments, and all four miRNAs exhibit strong nucleolar localisation (Figure 2A). [score:1]
However, we observed subtle differences in the distribution of the ISH signals from miR191 and that of U3 snoRNA, another known GC component (Figure 2B), which suggest that nucleolar miRNAs and snoRNAs may occupy distinct sub-regions of the GC. [score:1]
Three out of the 11 nucleolar miRNAs identified in our study, including miR-191 and miR-484, are also on their list (Table S1). [score:1]
Four nucleolar microRNAs; miR-191, miR-193, miR-484, miR-574-3p, are examined for their nucleolar location. [score:1]
Remarkably, we observed dynamic changes in nucleolar miRNAs, such as miR-484 and miR-191, upon viral infection. [score:1]
Influenza A mo del cell lines A549 - a human lung cancer cell (A) and MDCK- a dog kidney cells (B, C) are infected with influenza A/WSN for different times, fixed and processed for ISH analysis with miR-191 and miR-484 probes. [score:1]
[1 to 20 of 13 sentences]
23
[+] score: 13
The increased expression of hsa-miR-191 stimulates proliferation in hepatocellular carcinoma cell lines and its therapeutic targeting suppresses tumor masses in vivo [42]. [score:7]
Among these potentially novel ER-related miRNAs, four miRNAs (hsa-miR-26a, hsa-miR-92b, hsa-miR-191, hsa-miR-492) appear to show consistently higher expression across all the ER -positive cell lines (fold change ≥ 1.5), and as yet only hsa-miR-26a has been implicated in breast carcinogenesis whereas hsa-miR-26a and hsa-miR-92b have also been implicated in brain tumors [39, 40]. [score:3]
Another group of 17 miRNAs (hsa-miR-575, hsa-miR-155, hsa-miR-26b, hsa-miR-200a, hsa-miR-200b, hsa-miR-141, hsa-miR-200c, hsa-miR-190b, hsa-miR-492, hsa-miR-640, hsa-miR-196a, hsa-miR-29c, hsa-miR-93, hsa-miR-193a-3p, hsa-miR-191, hsa-miR-26a, hsa-miR-182) showed significantly higher expression in the major cluster compared with the other miRNAs (fold change ≥ 1.5) (Figure 2, bottom red box). [score:2]
The other two miRNAs (hsa-miR-191, hsa-miR-492) have been linked to hepatic cancer. [score:1]
[1 to 20 of 4 sentences]
24
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
When globally analyzed the relapse-related miRNAs-miR-7, miR-100, miR-216 and let-7i—were up-regulated, and miR-486, miR-191, miR-150, miR-487 and miR-342 were down-regulated in early relapse ALL patients [76]. [score:7]
Along these lines, AML patients with worse overall and event-free survival were known to have higher expression of miR-191 and miR-199a [127]. [score:3]
The B and T lineages of ALL can be distinguished based on relative expression of miR-148, miR-151, miR-424, miRNA-425-5p, miRNA-191, miRNA-146b, miRNA-128, miRNA-629, and miRNA-126. [score:3]
[1 to 20 of 3 sentences]
25
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Izzotti et al. (2009a, b) have monitored the expression of 484 miRNAs in the lungs of mice exposed to cigarette smoking, the most remarkably downregulated miRNAs belonged to several miRNA families, such as let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223. [score:6]
Bisphenol A (Avissar-Whiting et al., 2010), dioxin (Elyakim et al., 2010), and diethylstilbestrol (DES) (Hsu et al., 2009) desregulate expression of miR-146a, miR-191, and miR-9-3, respectively. [score:4]
hsa-miR-191 is a candidate oncogene target for hepatocellular carcinoma therapy. [score:3]
[1 to 20 of 3 sentences]
26
[+] score: 12
Other miRNAs from this paper: mmu-mir-191
LOXL2 transduction compared to the EV control downregulated genes known to be involved in TGF-β1 and TNF-α signaling and apoptosis (Fig.   5a- i); these include reactome signaling by TGF-β1 receptor complex, Biocarta TNF-α receptor 1 pathway, reactome activation genes by ATF4, negative regulation of cell proliferation, regulation of angiogenesis regulation of apoptosis, reactome mitogen-activated protein (MAP) kinase nuclear events mediated by MAP kinases, regulation of IkB kinase NF-ĸB cascade, and signaling by miR-191. [score:7]
Gene set enrichment analysis data shown are reactome signaling by transforming growth factor -β1 (TGF-β1) receptor complex (a), Biocarta TNF-α receptor 1 pathway (b), reactome activation genes by ATF4 (c), reactome mitogen-activated protein kinase (MAPK) targets nuclear events mediated by MAPK (d), negative regulation of cell proliferation (e), regulation of angiogenesis (f), regulation of apoptosis (g), regulation of IkB kinase NF-ĸB cascade (h), and signaling by MiR-191 i compared to control (EV). [score:5]
[1 to 20 of 2 sentences]
27
[+] score: 12
associated disease or trait miRNA target gene putative risk allele functional association test for allele-specific effects on miRNA targeting association test population refs small cell lung cancer SCLC miR-191, miR-887-3p MDM4 rs4245739 A>C (C creates a new binding site) in vitro: reporter gene assay in SCLCH446 cells (with miR mimics, or negative controls). [score:6]
MDM4 | miR-191 or miR-877-3pMdm2-like p53 -binding protein (MDM4) is an oncoprotein that negatively regulates the p53 tumour suppressor protein [70]. [score:4]
MDM4 | miR-191 or miR-877-3p. [score:1]
Numerous studies have shown that introduction of this C minor SNP creates a new binding site for miR-191 [42– 46] and/or miR-887-3p [42, 43, 47], and this leads to a decreased level of MDM4 protein. [score:1]
[1 to 20 of 4 sentences]
28
[+] score: 12
We found miR-191-5p, shown previously to regulate IL-6 [44], to be downregulated and this could increase the levels of IL-6, which is consistent with our experimental findings. [score:5]
miR-191-5p, which binds IL-6 [44], is downregulated. [score:4]
In response to OxS, the expression levels of miR-21-5p, miR-1195, miR-181a-5p, and miR-191-5p (as shown in Fig.   8) were changed significantly and this could result in the observed increased levels of STAT3. [score:3]
[1 to 20 of 3 sentences]
29
[+] score: 11
The most representative ones were miR-212, miR-026a, miR-150, miR-152, miR-191, and miR-192, which were upregulated in pituitary adenomas, while miR-024-1 and miR-098 were downregulated in tumor samples. [score:7]
Study of Cheng et al. suggested that the upregulated miR-150, miR-152, miR-191, and miR-192 may also be involved in apoptosis [84]. [score:4]
[1 to 20 of 2 sentences]
30
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-30a, hsa-mir-32, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-30d, hsa-mir-196a-2, hsa-let-7g, hsa-let-7i, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-149, hsa-mir-200c, hsa-mir-425, hsa-mir-505, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-625, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-3146, hsa-mir-548v, hsa-mir-3174, hsa-mir-548w, hsa-mir-3192, hsa-mir-548x, hsa-mir-3605, hsa-mir-3662, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-664b, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
The principal finding was of greatly increased expression of members of the let-7 family of miRNAs, and increased expression (above a GFOLD threshold of 2.0) of several other miRNAs including hsa-miR-196a, hsa-miR-30a/d, hsa-miR-191 and hsa-miR-200c following silencing of L1 expression. [score:7]
In addition to the let-7 family members, large changes were also seen in the expression of miR-196a, miR-30d, miR-103, miR-425, miR-191 and miR-200c (Figure 2D). [score:3]
[1 to 20 of 2 sentences]
31
[+] score: 9
Of these potentially differentially expressed miRNAs, three (miR-191, miR-150 and miR-30d) were not supported after TMM testing, and only miR-320a and miR-140 were differentially expressed using upper quantile normalisation as well (Table 2). [score:5]
Interrogation of the miRNA results using RPKM adjustment alone would have yielded six differentially expressed miRNAs (miR-320a, miR-140, miR-30d, miR-22, miR-191, and miR-150). [score:3]
The next most frequently observed miRNAs were miR-191 (13% of control and 11% of breast cancer) and then miR-484 (3% and 4%). [score:1]
[1 to 20 of 3 sentences]
32
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
MiR-378 promotes osteoblast differentiation by targeting polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7 or GalNT7) [70], and miR-191 regulates erythroid differentiation in mammals by up -regulating erythroid-enriched genes Riok3 and Mxi1[71]. [score:5]
Notably, some miRNAs among the top 10 identified here have been reported to be related to immunity (miR-320, miR-181a, miR-30a-3p, let-7a, let-7f and let-7c) and development (miR-193a-3p, miR-378 and miR-191). [score:2]
Further comparison revealed that miR-191 and let-7a, which potentially play a vital role in immunity, were found in both that study and in the top 10 miRNAs of our study. [score:1]
The top 10 miRNAs were ssc-miR-193a-3p, ssc-miR-423-5p, ssc-miR-320, ssc-miR-181a, ssc-miR-30a-3p, ssc-miR-378, ssc-miR-191, ssc-let-7a, ssc-let-7f and ssc-let-7c. [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 9
Furthermore, inhibition of miR-191 expression attenuated the epithelial-mesenchymal transition and decreased cellular migratory capacity as well as neoplastic properties in arsenite-transformed cells [21]. [score:5]
Althought the expression level of some miRNAs (e. g., miR-21 and miR-191) have been reported to regulate the neoplastic transformation induced by arsenite [18, 21], their changes were less than 2-fold in our present study. [score:4]
[1 to 20 of 2 sentences]
34
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Targets of the most remarkably down-regulated miRNAs (let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223) regulate proliferation, gene expression, stress response, apoptosis, and angiogenesis. [score:9]
[1 to 20 of 1 sentences]
35
[+] score: 9
On the other hand, these 19 miRNAs (hsa-miR106a, hsa-miR-125a, hsa-miR-140, hsa-miR-146a, hsa-miR-146b, hsa-miR-155, hsa-miR-16, hsa-miR-17, hsa-miR186, hsa-miR-191, hsa-miR-197, hsa-miR-200b, hsa-miR-200c, hsa-miR-339, hsa-miR-374, hsa-miR-422, hsa-miR-422, hsa-miR-454, hsa-miR-484 and hsa-miR-590) were up-expressed in VP and ART (block1-group2) and down-expressed in EC and HIV- (block2-group2). [score:5]
Hsa-miR-221 and hsa-miR-155 were the most highly expressed miRNAs (fold-change 0.9) and hsa-miR-191 and hsa-miR-200c were the ones with the lowest expression levels (fold change -0.3) compared to HIV-. [score:4]
[1 to 20 of 2 sentences]
36
[+] score: 8
A comprehensive list of potential miRNA targets for AML therapy is summarized in Table 2. Table 2 miRNA target genes or pathways References miR-141 PI3K/Akt/mTOR[113] miR-125a ErbB pathway[10] miR-125b Mcl-1[11, 12] miR-22-3p, let-7e-5p PLK1[114] miR-34a PD-L1[80] miR-638 CDK2[34] miR-181a, b and c PRKCD, CTDSPL and CAMKK1[6, 36, 96, 97] miR-191-5p, miR-142-3p PPP2R2A[19, 115] miR-181b MDR[36] miR-21, miR-196b HOX[98] miR-29a/b/c Dnmts[19, 22] Both single miRNAs and panel of miRNAs have potential prognostic value complementing information gained from cytogenetics, gene mutations, and altered gene expression. [score:8]
[1 to 20 of 1 sentences]
37
[+] score: 8
SOX4 knockdown (Figure  5A) using shRNA led to significant upregulation of miR-31 in TE8 and FLO1 cells, while miR-191 and miR-423-5p, used as controls, did not show any significant change (Figure  5B and C). [score:5]
miR-31, miR-191, miR-423-5p expression was normalized to RNU6. [score:3]
[1 to 20 of 2 sentences]
38
[+] score: 8
The results showed that the expression levels of miR-92a-3p and miR-191-3p were 385 and 4.6 fold higher than the expression level of miR-26b-5p (Figure  2C). [score:5]
These relative abundance ratios were close to the ratios from the sequencing data using the Illumina kit (441 fold for miR-92a-3p versus miR-26b-5p, and 10.7 fold for miR-191-3p versus miR-26b-5p). [score:1]
To validate the RNA sequencing data, we performed a qPCR analysis of miR-92a-3p, miR-191-3p, miR26b-5p, and β-actin. [score:1]
To validate the sequencing data, we selected three miRNAs with different read counts for qPCR quantification; namely, miR-92a-3p, which had a high read count, and miR-191-3p and miR-26b-5p, which had relatively low counts. [score:1]
[1 to 20 of 4 sentences]
39
[+] score: 8
We also found only low and unchanged expression of the microRNAs, ssc-miR-155-5p, ssc-miR-181b and ssc-miR-191, even though they have previously implicated in CRC development in humans [31– 33]. [score:4]
Ten differentially expressed miRNAs were validated by qRT-PCR: ssc-let-7e, ssc-miR-98, ssc-miR-126-3p, ssc-miR-146a-5p, ssc-miR-146b, ssc-miR-155-5p, ssc-miR-181b, ssc-miR-183, ssc-miR-191 and ssc-miR-196a. [score:3]
Differences in ssc-miR-155-5p, ssc-miR-181b and ssc-miR-191 levels fell below statistical significance, but were still consistent with data from small RNA sequencing (Figure 2). [score:1]
[1 to 20 of 3 sentences]
40
[+] score: 7
Relative miRNA expression was quantified by determining the point at which the fluorescence accumulation entered the exponential phase (Ct), and the Ct ratio of the target was normalized to small nuclear RNA U6B (RNU6B) or miR-191. [score:5]
For the six colon tumors shown, data bars indicate mean ± SD, n = 3. An inverse relationship between miR-206 and KLF4 in human primary colon cancersBased on a prior report [25], human primary colon cancers were first screened for a suitable endogenous control (data not shown); miR-191 was selected for subsequent qRT-PCR analyses. [score:1]
For the six colon tumors shown, data bars indicate mean ± SD, n = 3. Based on a prior report [25], human primary colon cancers were first screened for a suitable endogenous control (data not shown); miR-191 was selected for subsequent qRT-PCR analyses. [score:1]
[1 to 20 of 3 sentences]
41
[+] score: 7
In addition, 10 other miRNAs (miR-378-1/-2-3p, miR-127-3p, miR-191-5p, miR-486-2-5p, miR-143-3p, miR-10a-5p, miR-148a-3p, miR-99a-5p, miR-30e-5p, and miR-199a-1/-2-5p) (Fig. 2) in the set of the top 10 most highly expressed unique miRNAs over the five muscle development stages are related to various cell proliferation, myogenesis, and apoptosis responses. [score:4]
Moreover, miR-191 could promote cell proliferation and suppress apoptosis in MGC803 cells (Shi et al., 2011). [score:3]
[1 to 20 of 2 sentences]
42
[+] score: 7
Similarly, miRNAs that were up-regulated in other cancers such as miR-126 in colon cancer [30], miR-23a and miR-125b in HCC [33, 34], miR-191 and miR-199a in myeloid leukemia [35], miR-200b [36], miR-10b and miR-26b in breast cancer [37, 38], and miR-98 [28] in head and neck squamous cell carcinoma were also up-regulated in rabbit VX2 tumors. [score:7]
[1 to 20 of 1 sentences]
43
[+] score: 7
In basal conditions (day 0), up-regulated miRNAs were: miR-1225-3p, miR-1305, miR-1238, miR-425, miR-191* and miR-34a, while miR-378 was the only down-regulated miR. [score:7]
[1 to 20 of 1 sentences]
44
[+] score: 7
We also observed significant inhibition of immunostimulatory ssRNA sensing by select LNA/DNA phosphorothioate AMOs from Classes 3 and 4. Although miRNA -based mechanisms could be at play for LNA/DNA AMOs targeting abundant miRNAs (such as miR-191-5p, miR-16-5p, miR-29a-3p or miR-100-5p), such effects can be ruled out for other AMOs of Class 3 targeting poorly abundant miR-224-5p, miR-331-3p, miR-134-5p or miR-31-5p. [score:7]
[1 to 20 of 1 sentences]
45
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
There were eight microRNAs (bta-miR-27b, bta-miR-191, bta-miR-30d, bta-miR-451, bta-miR-25, bta-miR-140, bta-miR-24-3p, and bta-miR-122), that were upregulated in older animals in the present study, and upregulated in fetal muscle tissue of the study. [score:7]
[1 to 20 of 1 sentences]
46
[+] score: 7
Besides the identification of differential expression of miRNAs, our initial studies identified three reference endogenous miRNAs (miR-103, miR-191, and miR-423-3p). [score:3]
M values and stability factors for GeNorm and NormFinder identify miR-423-3p, miR-191, and miR-103 as endogenous reference miRNAs for mouse experiments. [score:1]
Three reference miRNAs, in addition to the spiked in UniSp2 were used for normalization in the validation experiments (ΔCq = NF − Cq [miRNA]) were NF is the normalization factor and NF = (Cq [miR-103] + Cq [miR-191] + Cq [miR-423-3p] + Cq [UniSp2])/4. [score:1]
Additionally, GeNorm and NormFinder algorithms were run and identified miR-103, miR-191, and miR-423-3p as appropriate reference miRNAs 11. [score:1]
Through pilot large-scale comprehensive profiling studies, we identified three reference miRNAs, miR-109, miR-191, and miR-423-3p with GeNorm and Normfinder that were invariant in the mouse samples and were used as reference miRNAs for those studies. [score:1]
[1 to 20 of 5 sentences]
47
[+] score: 7
The comparison between control- and MPA -treated cells revealed that 16 miRNAs were significantly modulated by more than two-fold (P < 0.05, Figure 1A), nine miRNAs were upregulated (miR-191*, miR-17*, miR- 470*, miR-451, miR-702, miR-434-3p, miR-493, miR-23a* and miR-485*) and seven were downregulated (miR-378*, miR-376a, miR-224, miR-190b, miR-16, miR-410 and miR-197) (Figure 1B). [score:7]
[1 to 20 of 1 sentences]
48
[+] score: 7
The expression pattern of 12 specific upregulated miRNAs (miR-17-3p, miR-21, miR-106a, miR-146, miR-155, miR-191, miR-192, miR-203, miR-205, miR-210, miR-212, miR-214) in tumor samples was similar in the tumor plasma-derived exosomes and distinct from the control samples, indicating exosomal miRNAs could be relevant as a screening method for this tumor (122). [score:6]
Recently, a report identified the exosomal miRNAs in bile from cholangiocarcinoma patients and a potential diagnostic panel that includes miR-486-3p, miR-16, miR-1274b, miR-484 and miR-191 as predictive markers (125). [score:1]
[1 to 20 of 2 sentences]
49
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-199a-2, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-141, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-149, hsa-mir-150, hsa-mir-320a, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-379, hsa-mir-423, hsa-mir-451a, hsa-mir-486-1, hsa-mir-496, hsa-mir-520a, hsa-mir-525, hsa-mir-518b, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-27a, bta-mir-320a-2, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-31, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, hsa-mir-1249, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-141, bta-mir-152, bta-mir-16a, bta-mir-24-1, bta-mir-199a-2, bta-mir-223, bta-mir-26a-1, bta-mir-379, bta-mir-451, bta-mir-486, bta-mir-496, bta-mir-92a-1, bta-mir-92b, bta-mir-1249, bta-mir-320b, bta-mir-320a-1, hsa-mir-320e, hsa-mir-23c, hsa-mir-451b, bta-mir-149, hsa-mir-486-2
Out of the most abundant miRNAs in bovine plasma, miR-486 and miR-92a are reportedly expressed primarily in erythrocytes, and miR-191 is expressed primarily in platelets [31, 35]. [score:5]
b Expression level of the 20 most abundant miRNAs in bovine plasma (calculated as 2 [^(40-Ct)]) Comparing the 20 most abundant miRNAs in each of the PCR array and sequencing datasets, only 6 miRNAs (miR-486, miR-22-3p, miR-191, miR-92a, miR-140 and miR-451) were common. [score:1]
b Expression level of the 20 most abundant miRNAs in bovine plasma (calculated as 2 [^(40-Ct)])Comparing the 20 most abundant miRNAs in each of the PCR array and sequencing datasets, only 6 miRNAs (miR-486, miR-22-3p, miR-191, miR-92a, miR-140 and miR-451) were common. [score:1]
[1 to 20 of 3 sentences]
50
[+] score: 6
Increased in Bissels et al. and this studyIncreased in Liao et al. and this studyIncreased in Cattaneo et al. and this study Commonly increased in three studies miR-484 miR-16 nil miR-142-3p miR-425-5p miR-27a miR-142-5p miR-191 Decreased in Bissels et al. and this study Decreased in Liao et al. and this study Decreased in Cattaneo et al. and this study Decreased in Bissels et al. and Cattaneo et al. miR-146a miR-127 miR-126-5p miR-29b-3p miR-146b-5p miR-100 miR-99a miR-10a miR-125b miR-125a-5p These data together suggest a signature of miRNA expression associated with differentiation status and maturation within the myeloid lineage. [score:3]
Increased in Bissels et al. and this studyIncreased in Liao et al. and this studyIncreased in Cattaneo et al. and this study Commonly increased in three studies miR-484 miR-16 nil miR-142-3p miR-425-5p miR-27a miR-142-5p miR-191 Decreased in Bissels et al. and this study Decreased in Liao et al. and this study Decreased in Cattaneo et al. and this study Decreased in Bissels et al. and Cattaneo et al. miR-146a miR-127 miR-126-5p miR-29b-3p miR-146b-5p miR-100 miR-99a miR-10a miR-125b miR-125a-5p These data together suggest a signature of miRNA expression associated with differentiation status and maturation within the myeloid lineage. [score:3]
[1 to 20 of 2 sentences]
51
[+] score: 6
Another study determined that 5-FU and oxaliplatin (L-OHP) down-regulated the expression of miR-197, miR-191, miR-92a, miR-93, miR-222 and miR-826 in HCT-8 and HCT-116 colon cancer cells [96]. [score:6]
[1 to 20 of 1 sentences]
52
[+] score: 6
In mice with AFL, miR-199-3p, miR-214, miR-93, miR-146a, miR-191, and let-7b are downregulated and miR-129, miR-490, miR-21, miR-503, miR-183, and miR-185 are upregulated compared with healthy mice [103]. [score:6]
[1 to 20 of 1 sentences]
53
[+] score: 6
Genome-wide miR profiling has also shown that several miRs, including miR-138, miR-181a, miR-181b, miR-191 and miR-130b, target the 3′UTRs of p63 and regulate p63 expression [55]. [score:6]
[1 to 20 of 1 sentences]
54
[+] score: 6
In this cohort, a combination of miR-191 and miR-484 provided the best normalization approach for target miRNA expression. [score:5]
Additional studies, on breast and other cancers, have suggested alternative EC candidates such as U6, RNU44, RNU48, miR-142-3p, miR-484, miR-191 and miR-425 [3], [11]- [18]. [score:1]
[1 to 20 of 2 sentences]
55
[+] score: 6
Based on real-time polymerase chain reaction (PCR), the analysis of miRNA arrays using pooled RNA samples from five gastric cancer patients indicates that the expression of miRNA-107, miRNA-21, miRNA-196a, miRNA-26b, miRNA-9, miRNA-142-3p, miRNA-30b, miRNA-150, miRNA-191, and miRNA-17 was found to be upregulated [14]. [score:6]
[1 to 20 of 1 sentences]
56
[+] score: 6
Interestingly, miR-146b-5p, miR-223, miR-150, miR-16, and miR-191 among the down regulated miRNAs were found to be plentifully expressed in B and T-lymphocyte, confirming a positive disease status (Houzet et al., 2008). [score:6]
[1 to 20 of 1 sentences]
57
[+] score: 6
The results are consistent with findings by Vickers and colleagues, indicating that miR-877 is abundantly expressed in normal individuals while miR-191 is up-regulated in familial hypercholesterolemia (FH) human subjects. [score:6]
[1 to 20 of 1 sentences]
58
[+] score: 6
miR-191 expression was used as a reference. [score:3]
Differences in expression were determined using the 2−ΔΔCt method [44], using the housekeeping gene RPLP0 and miR-191 for normalization. [score:3]
[1 to 20 of 2 sentences]
59
[+] score: 6
CO;2-U 9819568 8. Zhang L. Flygare J. Wong P. Lim B. Lodish H. F. miR-191 regulates mouse erythroblast enucleation by down -regulating Riok3 and Mxi1 Genes Dev. [score:3]
During the late stage of erythroid differentiation, the inhibition of RIO kinase 3 (Riok3) and Mix1 (a c-Myc antagonist [7]) by miR-191 is relaxed in order to allow for enucleation [8]. [score:3]
[1 to 20 of 2 sentences]
60
[+] score: 5
The differential expression of six abundantly expressed miRNAs (miR-34c, miR-92a, miR-181a-5p, miR-191, miR-10a-5p, and let-7f-5p) was verified by qRT-PCR analysis of the 35 normal-pregnancy deciduas and 25 menstrual endometria (Fig 1). [score:5]
[1 to 20 of 1 sentences]
61
[+] score: 5
Alterations in miRNA expression have been observed in CRC, and several dysregulated miRNAs, including miR-625-3p [8], miR-99-5b [9], miR-361-5p [10], miR-17-5p [11], miR-137 [12], miR-95 [13], miR-23a [14, 15], miR-155 [16], miR-150 [17], miR-191[18], miR-339-5p [19], miR-429 [20], miR-345 [21], miR-22 [22], miR-638 [23] and miR-138 [24], have been shown to regulate CRC cell growth, apoptosis and metastasis. [score:5]
[1 to 20 of 1 sentences]
62
[+] score: 5
Variant expression followed two main patterns as seen in other studies [40] those miRNAs with a strong predominant isomiR, such as bta-miR-191 and bta-miR-103; and those miRNAs where there is no predominant isomiR, such as bta-miR-486 and bta-miR-320a. [score:3]
In order of decreasing abundance, the top five were miR-486, miR-423-5p, miR-92a, miR-22-3p and miR-191. [score:1]
22_13473 was 99% conserved in all species and was found to be reverse complementary to the bta-miR-191 gene. [score:1]
[1 to 20 of 3 sentences]
63
[+] score: 5
For example, TCF7L2, NRAS, VEGF and HOXC8 are the target genes of miR-191 which are involved in colon, lung, pancreatic and prostate cancer respectively. [score:3]
It has been observed that miR-32, miR-29b-2, miR-21, miR-20a, miR-191, miR-17-5p, miR-106a, miR-155 and miR-24-2 all have significant dysregulation in lung, colon and pancreatic cancer cell line. [score:2]
[1 to 20 of 2 sentences]
64
[+] score: 5
Different studies reported low expression of let-7b and miR-9 in patients with favourable cytogenetic translocations [76] while high expression of miR-191 and miR-199a adversely affected overall survival of newly diagnosed AML patients with predominantly intermediate- and poor-risk cytogenetic [77]. [score:5]
[1 to 20 of 1 sentences]
65
[+] score: 5
After filtering and aligning using with MirBase, 148 mature miRNAs were identified in the gastric antrum tissue, totaling 3,181 quality reads; 63.5% (2,021) of the reads were concentrated in the eight most highly expressed miRNAs (hsa-mir-145, hsa-mir-29a, hsa-mir-29c, hsa-mir-21, hsa-mir-451a, hsa-mir-192, hsa-mir-191 and hsa-mir-148a). [score:3]
Detailed descriptions of these miRNAs are shown in Table 1 and Figure 2. When these results were compared with the cardia’s miRnome [11], it was observed that the miRNAs listed here are among the 15 most highly expressed miRNAs in the cardia, with the exception of hsa-mir-191. [score:2]
[1 to 20 of 2 sentences]
66
[+] score: 5
Finally, the qPCR data were normalized to the average of three invariantly expressed miRNAs, let-7a, miR-191-5p and miR-103a-3p. [score:3]
Among these, miR-191-5p and miR-103a-3p were selected on the basis of their performance as invariant miRNAs in the neurological array and custom array, respectively, while let-7a has been wi dely reported as an invariant miRNA in blood. [score:1]
In the third strategy, miR-125b-5p, miR-126-5p, miR-140-5p and miR-191-5p were chosen for the data normalization of the neurological array, whereas miR-103a-3p, miR-21-5p, miR-23a-3p, and miR-25-3p were chosen for the custom array. [score:1]
[1 to 20 of 3 sentences]
67
[+] score: 5
As shown in Figure 1A, and detailed in Supplementary Table S1, we observed that several of these highly expressed miRNAs were either more highly RISC associated (e. g., miR-197-3p, miR-191-5p, miR-92a-3p and miR-92b-3p) or significantly less RISC associated (e. g., miR-22-3p, miR-27b-3p and miR-101-3p) than the average miRNA. [score:3]
We note, however, that RISC association does not perfectly predict functionality in this assay, e. g. miR-191-5p appears to be a less effective inhibitor than miR-197-3p yet is found in RISC at levels that are ∼4-fold higher (Figure 3A). [score:2]
[1 to 20 of 2 sentences]
68
[+] score: 5
The majority of miRNAs (76%) showed high expression level (10 AC 100), 13 miRNAs (16%) had AC lower than 10, whereas 6 miRNAs-MIR34B, MIR34C, MIR191, MIR223, MIR1248, and MIR1905C-showed very high expression levels (AC≥100) in stallion sperm (Table S7). [score:5]
[1 to 20 of 1 sentences]
69
[+] score: 5
Other miRNAs from this paper: hsa-let-7b, hsa-mir-15a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-100, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-1-2, hsa-mir-15b, hsa-mir-30b, hsa-mir-122, hsa-mir-132, hsa-mir-141, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-195, hsa-mir-200c, hsa-mir-1-1, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-371a, hsa-mir-372, hsa-mir-373, hsa-mir-375, hsa-mir-151a, hsa-mir-429, hsa-mir-449a, hsa-mir-483, hsa-mir-193b, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-449b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320b-2, hsa-mir-891a, hsa-mir-935, hsa-mir-1233-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-1275, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1973, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-1233-2, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Among the ten most expressed miRNAs, three directly control spermatogenesis because they are involved in the regulation of the E2F-pRB pathway during male meiosis (hsa-miR-34b-3p), in cell cycle progression (hsa-miR-132-3p) and in sperm differentiation (hsa-miR-191-5p). [score:5]
[1 to 20 of 1 sentences]
70
[+] score: 4
Patel et al. [77] described miR-223, miR-191, miR-16, miR-203, and miR-24 as the five most abundantly expressed miRNAs; they have also been reported in other studies [74, 78, 79]. [score:3]
Moreover, Salazar et al. [100] concluded that miR-9, miR-191 and miR-134 can serve as novel non-invasive biomarkers in head and neck squamous cell carcinoma (HNSCC) (n = 122), providing a good discriminatory power with AUC values of 0.85 (p < 0.0001), 0.74 (p < 0.001) and 0.98 (p < 0.0001), respectively. [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 4
miRNA(s) Source Donor cell Recipient cell Target gene Reference miRNA-210 Cell culture BEC Fibroblast ATG7Fujita et al., 2015 miRNA-191,miRNA-126, miR125a Cell culture EC MacrophagesSerban et al., 2016 miR-204 Mouse lung MSC Lung immune cells and immune cells STAT3 pathwayLee et al., 2012 miR-146a, miR-155 Cell culture DC Immune cellAlexander et al., 2015 BEC, bronchial epithelial cell; EC, endothelial cell; MSC, mesenchymal stem cell; DC, dendritic cell. [score:3]
They also demonstrated that cigarette smoke induced the endothelial cell release of microparticles with special miRNAs, such as miR-191, miR-126 and miR125a, via aSMase. [score:1]
[1 to 20 of 2 sentences]
72
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Two miRNAs, miR-191 and miR-372, were expressed specifically in spent media after embryo culture. [score:3]
Interestingly, miRNAs were related to some bad condition: miR-191 was more highly concentrated in media from aneuploid embryos, and miR-191, miR-372, and miR-645 were more highly concentrated in media from failed in vitro fertilization cycles without pregnancy (Figure 4). [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 4
Among others, such as hsa-miR-191, hsa-miR-200b, hsa-miR-320 and several members of let-7 family we found that hsa-miR-342-3p was regulated at a late stage of disease in both, Scrapie-infected mice and BSE-infected macaques. [score:4]
[1 to 20 of 1 sentences]
74
[+] score: 4
There were however seven microRNAs (miR-335-3p, miR-128, miR-224-5p, miR-28-5p, miR-191-5p, miR-423-3p, and miR-181a-5p) with a statistically significant upregulation in the controls. [score:4]
[1 to 20 of 1 sentences]
75
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-33a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-10a, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-let-7a-3, gga-mir-155, gga-mir-18a, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-mir-126, gga-let-7a-2, gga-mir-27b, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, hsa-mir-33b, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-675, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, hsa-mir-675, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-664a, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, gga-mir-10a, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, mmu-mir-126b, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
Previous studies revealed that five miRNA genes as well as their host genes (hsa-mir-10a/ HOXB4, hsa-mir-126/ EGFL7, hsa-mir-152/ COPZ2, hsa-mir-191/ DALRD3, and hsa-mir-342/ EVL) were found to be epigenetically downregulated, either by histone modification and/or CpG island hypermethylation in the promoter region in cancer cells [27], [86]– [89] (Table 2 ). [score:4]
[1 to 20 of 1 sentences]
76
[+] score: 4
Three miRNAs (miR-16, miR-92a, and miR-191) were selected by the geNorm algorithm because their expression levels in all of our intestine-derived exosomes samples were stable (Fig. 3). [score:3]
Since pairwise variations in all combination patterns were less than 0.15 (the cut-off value 25), we selected the recommended minimal number of references, 3 miRNAs (miR-16, miR-92a, and miR-191) as a set of stable reference miRNAs (Fig. 3C). [score:1]
[1 to 20 of 2 sentences]
77
[+] score: 4
We normalized to miR-191 in serum as it was expressed in all participant serum, did not change with age and was the least variable normalization miRNA in all individuals. [score:3]
Data was normalized to miR-191. [score:1]
[1 to 20 of 2 sentences]
78
[+] score: 4
Significant abundance and co -expression of miR-191 and miR-425 were demonstrated in various cancer cell lines [36]. [score:3]
miR-425 resides at 3p21, next to miR-191 precursors embedded in the 1st intron of DALRD3 gene. [score:1]
[1 to 20 of 2 sentences]
79
[+] score: 4
Other miRNAs from this paper: hsa-mir-31, hsa-mir-93, hsa-mir-198, hsa-mir-181a-2
Then, qRT-PCR was performed in order to assay EMSY and miR-31 expression levels as well as the expression of the control miRNAs, miR-191, and miR-93. [score:4]
[1 to 20 of 1 sentences]
80
[+] score: 4
miRNA profiling of 80 type 2 diabetic patients compared with age and gender matched controls showed overexpression of miR-28-3p and underexpression of 12 miRNAs (miR-223, miR-320, miR-486, miR-150, miR-24, miR-21, miR-29b, miR-20b, miR-15a, miR-126, miR-191, and miR-197). [score:4]
[1 to 20 of 1 sentences]
81
[+] score: 4
Seven out of these 10 miRNAs (miR-486-5p, miR-92a-3p, miR-451a, miR-16-5p, miR-142-5p, miR-191-5p and miR-25-3p) have been found to be highly expressed in various blood cell types [24]. [score:3]
Based on the total number of sequencing reads the miRNAs miR-486-5p, miR-92a-3p, miR-22-3p, miR-451a, miR-423-5p, miR-16-5p, miR-142-5p, miR-191-5p, miR-10b-5p and miR-25-3p were the most abundant miRNAs in the serum of HC subjects. [score:1]
[1 to 20 of 2 sentences]
82
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7e, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-192, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-214, hsa-mir-215, hsa-mir-222, hsa-mir-223, hsa-mir-1-2, hsa-mir-15b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-149, hsa-mir-184, hsa-mir-186, hsa-mir-200c, hsa-mir-1-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-339, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-624, hsa-mir-650, hsa-mir-651, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-449b, hsa-mir-1185-2, hsa-mir-1283-1, hsa-mir-1185-1, hsa-mir-708, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1283-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Overall, the top five up-regulated miRNAs were miR-624, miR-339-5p, miR-191 and miR-651. [score:4]
[1 to 20 of 1 sentences]
83
[+] score: 4
a Meta-analysis algorithm of the most significant pathways targeted by miR-222-3p, miR-16-5p, miR-484, miR-17-5p, miR-106a-5p, miR-365b-5p, miR-196b-5p, miR-19b-3p, miR-197-3p, miR-193b-3p, miR-518d-5p and miR-191-5p. [score:3]
As shown in Fig.   8a and resumed in Fig.   8b, miR-222-3p, miR-16-5p, miR-484, miR-17-5p, miR-106a-5p, miR-365b-5p, miR-196b-5p, miR-19b-3p, miR-197-3p, and miR-193b-3p significantly correlated with at least 2 of the following pathways: pathway in cancer, adherens junction, p53 signaling pathway, cell cycle and ECM receptor interaction; whereas, miR-518d-5p and miR-191-5p did not. [score:1]
[1 to 20 of 2 sentences]
84
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
Most of the detected top expressed miRNAs are conserved in human, mouse, and bovine, and belong to several miRNA families, vis, miR-31, miR-26a, miR-27a-3p/27b, let-7a-5p/7f/7i, miR-21-5p, miR-22-3p, miR-184, miR-186, miR-191, miR-205 and miR221/222. [score:3]
48164101:+ bta-miR-191′-5pbta-mir-191′bta-miR-1915.540gaacgaaauccaagcgcagcug220gcugcuuuugggauuccguugcc2322:51543481.. [score:1]
[1 to 20 of 2 sentences]
85
[+] score: 4
Zhang et al. identified increased expression of miR-191-3p, -455-3p, and -1281 in the whole blood of AAA patients compared to controls, while a separate study showed decreased expression of miR-126, -124a, -146a, -155, -223, -29b, -15a, and -15b in AAA [164, 165]. [score:4]
[1 to 20 of 1 sentences]
86
[+] score: 4
Top 10 up-regulated miRNAs with maximum score and high fold change were: miR-317-5p, miR-373, miR-1268, miR-191*, miR-150, miR-1275, miR-188-5p, miR-1238, miR-134 and miR-296-5p. [score:4]
[1 to 20 of 1 sentences]
87
[+] score: 3
Other miRNAs from this paper: bta-mir-191
Similarly, miR-191 was found to be highly expressed in the culture media of chromosomally abnormal aneuploid embryos in comparison to euploid embryos (Rosenbluth et al., 2014). [score:3]
[1 to 20 of 1 sentences]
88
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-100, hsa-mir-106a, hsa-mir-107, hsa-mir-192, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-139, hsa-mir-10b, hsa-mir-34a, hsa-mir-182, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-221, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-134, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-154, hsa-mir-320a, hsa-mir-155, hsa-mir-128-2, hsa-mir-200a, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-302c, hsa-mir-367, hsa-mir-370, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-379, hsa-mir-328, hsa-mir-151a, hsa-mir-135b, hsa-mir-335, hsa-mir-133b, hsa-mir-449a, hsa-mir-451a, hsa-mir-410, hsa-mir-486-1, hsa-mir-146b, hsa-mir-520f, hsa-mir-518d, hsa-mir-517c, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-584, hsa-mir-602, hsa-mir-629, hsa-mir-638, hsa-mir-449b, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-298, hsa-mir-1246, hsa-mir-1908, hsa-mir-718, hsa-mir-2861, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-4728, hsa-mir-4734, hsa-mir-378j, hsa-mir-6165, hsa-mir-486-2
Bellavia et al. (2017) GATA1, FOXP3, SHIP1, ID1, E2F1, CEBP-a and -b, Myc, and MEF2C, specifically, nucleophosmin 1 (NPM1), FLT3, CXCR4, MMP9, IGF-IR, Let-7a, MiR-9, MiR-99b, MiR-150, MiR-155, MiR-191, MiR-223, MiR-146a, and MiR-150The acute myelogenous leukemia (AML) cell lines HEL, HL-60, Molm-14, and U937 The blood plasma of AML patients Igf-1r knockout (R [−]) mouse embryonic fibroblasts and R [−] cells expressing human insulin-like growth factor (IGF)-IR cDNA (termed R [+]) qRT-PCR analysis, Flow cytometry assay, and Western blotting Profiling the mRNA content of these microvesicles indicated the presence of transcripts relevant to AML prognosis (FLT3-ITD, NPM1), treatment (FLT3-ITD, IGF-IR, CXCR4), and niche function (IGF-IR, CXCR4, MMP9). [score:2]
Cazzoli et al. (2013) MiR-17-3p, MiR-21, MiR-106a, MiR-146, MiR-155, MiR-191, MiR-192, MiR-203, MiR-205, MiR-210, MiR-212, and MiR-214 Plasma samples from patients with lung adenocarcinoma and a control group without known lung cancer or other active cancer Microarray analysis The considerable difference in total exosome and miRNA levels between lung cancer patients and controls, and the similarity between the circulating exosomal miRNA and the tumor-derived miRNA patterns, suggest that circulating exosomal miRNA might be useful as a screening test for lung adenocarcinoma. [score:1]
[1 to 20 of 2 sentences]
89
[+] score: 3
Other miRNAs from this paper: hsa-mir-148a, hsa-mir-10a, hsa-mir-34a, hsa-mir-148b
First, mRNA from the C allele but not the majority A allele of rs4245739 (a SNP in the 3′ UTR of MDM4) has been demonstrated to be decreased by miR-191, and hence the A allele is associated with high-grade carcinomas and higher expression of MDM4 [32]. [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 3
Alveolar macrophages possessed the highest number of highly expressed miRNAs than the other cell types and included miR-92, miR-223, miR-191, miR-30a-5p, miR-320, miR-342, miR-146b and miR-142-3p. [score:3]
[1 to 20 of 1 sentences]
91
[+] score: 3
Shorter read lengths of miR-22-3p, let-7i-5p and miR-191-5p accumulate in VACV-infected cells. [score:1]
It is not possible to infer trimming of polyadenylated miRNAs, however we examined unmodified miRNA sequences for evidence of trimming for ten miRNAs that exhibited either minimal reduction (fold change less than 20%: miR-16-5p and miR-21-5p), intermediate levels of reduction (fold change 40–65%: miR-22-3p and miR-191-5p) or extensive reduction (fold change greater than 70%: let-7b-5p, let-7i-5p, miR-27b-30, miR-29a-3p, miR-31-5p and miR-143-3p) at 6 hpi. [score:1]
Overall, a statistically significant increase in the proportion of shorter reads in VACV-infected cells was detected for six of the ten miRNAs, spanning all three classes (miR-21-5p, miR-22-3p, miR-191-5p, let-7b-5p, let-7i-5p and miR-143-3p) (Fig 7 and S4 Fig). [score:1]
[1 to 20 of 3 sentences]
92
[+] score: 3
Conversely, HIF-1 promotes the expression of several hypoxamiRs including miR-210 [97], miR-146a [98], miR-145 [99], miR-382 [100], miR-191 [101], miR-363 [102], miR-421 [103] in tumor cells, miR-204 in neuronal cells [104], miR-30a and miR-21 in cardiomyocytes [105, 106], miR-687 in embryonic kidney cells [107], miR-155 in intestinal epithelial cells [108], and miR-429 [109] and miR-19a [110] in endothelial cells. [score:3]
[1 to 20 of 1 sentences]
93
[+] score: 3
miR-155 levels in B-cells strongly correlate with response to therapy [22] and levels of miR-223 and miR-191 vary with the extent of platelet inhibition by thienopyridines and aspirin [23]. [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
Cq values were adjusted by IPC and normalized using hsa-miR-191, hsa-miR-16 and hsa-let-7a as indigenous reference miRNA genes, in accordance with the ΔΔCq method. [score:1]
Human miR-191, miR-16 and let-7a were used as reference miRNA genes [42] for normalization. [score:1]
Included in the panels were three Inter-Plate Calibrators (IPC) and three candidate miRNA reference genes (hsa-miR-191, hsa-miR-16 and hsa-let-7a) [42]. [score:1]
[1 to 20 of 3 sentences]
95
[+] score: 3
qRT-PCR expression data were normalized to selected reference genes (ACTB, RN7SL, RNU6, SNORD48, hsa-let-7a and hsa-miR-191) in qbasePLUS. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
Interestingly, the top three most highly-represented miRNAs identified in LIM1863-derived EVs - miR-192-5p, miR-10a-5p, and miR-191-5p - have been reported previously in tissue and serum of CRC patients as potential diagnostic biomarkers. [score:1]
For example, miR-192 has been observed in tissue [41] and serum/plasma [42] from CRC patients, miR-191 in tissue [41], [43] and serum/plasma [44], and miR-10a in tissue [45] and serum/plasma [42] from CRC patients. [score:1]
Of these, miR-192-5p, miR-10a-5p and miR-191-5p are the most highly represented our dataset along with members of the let-7 and miR-8 families. [score:1]
[1 to 20 of 3 sentences]
97
[+] score: 3
Other miRNAs from this paper: hsa-mir-21
mRNA and miR expression levels were normalized to the endogenous controls GAPDH and miR-191, respectively. [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
Differential expression of miR-21, miR-125b and miR-191 in breast cancer tissue. [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
2 miRNAs of hsa-miR-191 and hsa-miR-16 were identified as miRNA normalizers, since they displayed no statistically significant difference among groups, had the smallest variation across all 86 samples (CV = 1.2 and 1.8%), and had relatively high expression values. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
In the study of Wang et al. [25], they employed RNU48 as the endogenous control while we adopted a combination of miR-191 and miR-103 as the endogenous control in our research. [score:1]
4427975-000458): UUGGUCCCCUUCAACCAGCUGU; miR-191 (Applied Biosystems Cat. [score:1]
Previously, we discovered that the aggregation of miR-191 and miR-103 was the most stable housekeeping miRNA by using NormFinder and geNorm. [score:1]
[1 to 20 of 3 sentences]