sort by

154 publications mentioning hsa-mir-127 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-127. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 380
Other miRNAs from this paper: mmu-mir-127, mmu-mir-433, hsa-mir-433
0065256.g005 Figure 5(A-C) qPCR analysis of c-Jun (A), miR-127 (B), and MMP13 (C) mRNA expression in MHCC97H cells treated with TGFβR inhibitor (SB 431542, 10 µM), NFκB inhibitor (BAY-11-7082, 5 µM, ERK inhibitor (PD 98059, 50 µM), p38 inhibitor (SB 203580, 10 µM) and JNK inhibitor (SP 600125, 50 µM),) in the absence (−) or presence of TGFβ (+) (5 ng/ml). [score:13]
The miR-127 was downregulated in four out of five HCC (Fig. 6A), and the downregulation of miR-127 correlated negatively with the upregulation of MMP13 mRNA and protein (Fig. 6B). [score:10]
In addition, MMP13 mRNA showed similar changes as its protein upon inhibition or overexpression of miR-127 (not shown), which was in agreement with the inference that a miRNA also represses its target gene mRNA [16]. [score:7]
Overexpression of miR-127 inhibits MMP13 3′UTR activity and gene expression. [score:7]
MHCC97H cells were transfected with either an empty vector pTarget (-) or a miR-127 expression vector in pTarget (+) (2 µg). [score:7]
MHCC97H cells were transfected with pTarget or pTarget-miR127 (2 µg), a negative (neg) control or miR-127 inhibitor (anti-miR-127) (20 nM). [score:7]
Overall, the results demonstrate that TGFβ represses miR-127 expression and activates MMP13 expression through c-Jun mediated ERK and JNK pathways, and NFkB signaling is not involved in such regulation. [score:6]
Overall, our studies establish a novel feedback regulatory network between miR-127 and the TGFβ signaling, whereby miR-127 constrains TGFβ activation of HCC cell migration via inhibition of MMP13 function, and TGFβ represses miR-127 expression via activation of c-Jun. [score:6]
Mo del of negative-feedback regulation of miR-127 expression by TGFβ/c-Jun that controls MMP13 expression and stability in HCC. [score:6]
It is noteworthy that miR-127 expression is downregulated in a subset of HCC specimens we analyzed. [score:6]
Two algorithms, TargetScan and miRanda, were used to predict miR-127 target genes that are involved in regulating cell migration/invasion. [score:6]
On the other hand, PPP1R9B (protein phosphatase 1, regulatory subunit 9B) was also a predicted target of miR-127, but its 3′UTR reporter activity was not altered by miR-127 expression (Fig. 2B, middle). [score:6]
Indeed, transient transfection assays showed that overexpression of c-Jun, but not c-Fos, dose -dependently inhibited miR-127 promoter activity (Fig. 4B), and the inhibition of c-Jun was further enhanced by TGFβ (Fig. 4C, left). [score:6]
MHCC97H cells were transfected with pTarget or pTarget-miR127 (2 µg), and seeded onto pre-coated inserts with BME solution and incubated for 16 hr. [score:5]
In addition, overexpression of p53 (Fig. 4F, left) induced miR-127 expression in MHCC97H cells and the effect of p53 was blocked by c-Jun (Fig. 4F, right). [score:5]
A recent report showed that upregulation of miR-127-3p was associated with KRAS mutation in colorectal cancer [11]. [score:5]
The miR-127 expression plasmid pTarget-miR-127 was generated as described [3]. [score:5]
The activation of c-Jun serves a dual function, which involves induction of MMP13 gene expression but repression of miR-127 gene transcription by inhibiting miR-127 promoter activity. [score:5]
Overexpression of miR-127 inhibits HCC cell migration and tumor growth. [score:5]
Next, we established control and miR-127 overexpressing cells that also express a constitutive luciferase reporter (see M&M section), which are designated as 97HLuc-Sico (control) and 97HLuc-miR-127 (Fig. 1D, left). [score:5]
MHCC97H and Hepa-1 cells were transfected with pTarget or pTarget-miR-127 (2 µg), in the absence or presence of TGFβ (5 ng/ml). [score:5]
TGFβ Enhances AP1 -mediated Suppression of miR-127 Expression. [score:5]
Second, we elucidated the underlying molecular basis by identifying MMP13, a gene downstream of the TGFβ signaling that is important in tumor invasion and metastasis, as a target for miR-127 inhibition. [score:5]
Consistent with these results, inhibition of endogenous miR-127 expression by a specific anti-miR-127 increased MMP13 3′UTR activity (Fig. 2C). [score:5]
Consistently, the repression of miR-127 by TGFβ was relieved by TGFβR, ERK, and JNK inhibitors, but not by an NFkB inhibitor (Fig. 5B). [score:5]
Briefly, MHCC97H cells (1×10 [6], 6-cm plate) were cultured overnight and transfected with pTarget or pTarget-miR-127 the next day using Lipofactamine 2000 (Invitrogen). [score:5]
Overexpression of miR-127 inhibits MMP13 and TGFβ -mediated induction of HCC cell migration. [score:5]
MHCC97H cells were transfected with MMP13 siRNA (siMMP13) (20 nM) in the absence or presence of pTarget or pTarget-miR-127 (2 µg). [score:5]
Hela cells were co -transfected with the control pTarget (0), pTarget-miR-127, and MMP13 (left), PPP1R9B (middle), or MMP13 mutant (mut) 3′UTRs (right). [score:5]
However, miRNA expression profiling in early stage invasive squamous cell carcinomas (ISCC) revealed a significant correlation between the increased expression of miR-127 and lymph mode metastasis [6]. [score:5]
In contrast, knockdown of endogenous miR-127 using a specific miR-127 inhibitor (anti-miR-127) facilitated MHCC97H cell migration (Fig. 1B, right two). [score:4]
miR-127 is downregulated in a subset of HCC specimens. [score:4]
The results further support MMP13 as a target of miR-127, and also establish the functionality of miR-127 and MMP13 in the development of HCC. [score:4]
The effect of miR-127 is through direct inhibition of TGFβ -mediated activation of matrix metallopeptidase 13 (MMP13, also known as collagenase-3). [score:4]
We further show that the activation of TGFβ signature in a subset of HCC is at least in part attributed to the downregulation of miR-127. [score:4]
miR-127 is Downregulated in a Subset of HCC Specimens. [score:4]
Therefore, HepG2 cells were used to examine the effect of transient p53 knockdown on miR-127 expression. [score:4]
Interestingly, TGFβ inhibits miR-127 transcription through activation of c-Jun via extracellular signal-regulated kinases (ERK) and the c-Jun amino-terminal kinases (JNK) pathways, which counteracts the stimulation of miR-127 by p53. [score:4]
In addition, miR-127 was part of the miRNA signature that was upregulated in acute myeloid leukaemia (AML) [7] and in nodal diffuse large B-cell lymphomas [8]. [score:4]
Fifth, we demonstrated that miR-127 is downregulated in a subset of HCC specimens that have active MMP13. [score:4]
Importantly, the TGFβ signature only occurred in a subset of HCC displaying invasive phenotype [29], [30] and the downregulation of miR-127 correlated with the activation of MMP13/TGFβ signaling. [score:4]
Overexpression of p53 induced miR-127 promoter transactivation, which was antagonized by c-Jun (Fig. 4D), suggesting a direct activation of miR-127 transcription by p53. [score:4]
Although downregulation of miR-127 was observed in rat liver during hepatocarcinogenesis [10], the functional role of miR-127 in HCC has remained elusive until now. [score:4]
Overall, the results demonstrate that MMP13 is a direct target gene of miR-127. [score:4]
Treatment of MHCC97H cells with a recombinant human MMP13 protein markedly increased HCC cell migration, which was significantly attenuated by miR-127 overexpression (Fig. 3A). [score:3]
miR-127 Inhibits HCC Cell Migration and Invasion. [score:3]
The major focus is to determine the inhibitory effect of miR-127 in HCC cell migration and/or invasion, thus a higher invasive cell line, i. e. MHCC97H, was chosen to be the most appropriate cell mo del for our study. [score:3]
Interestingly, miR-127 repression by TGFβ was also blunted by the p38 MAPKs inhibitor, suggesting an alternate mechanism not involving c-Jun. [score:3]
As expected, TGFβ treatment induced MHCC97H migration and its effect was markedly blunted by co -expression of miR-127 (Fig. 3D). [score:3]
The microRNA-127 (miR-127) is located within the imprinted Dlk1/Gtl2 region expressed from the maternal chromosome [1]. [score:3]
On the other hand, overexpression of miR-127 did not affect TGFβ activation of c-Jun (not shown). [score:3]
The results provide evidence for miR-127 inhibition of TGFβ -mediated HCC migration. [score:3]
TGFβ represses miR-127 expression by enhancing c-Jun activity. [score:3]
On the other hand, overexpression of miR-127 decreases MMP13 protein levels by binding to its 3′UTR and causing MMP13 degradation, thus diminishing TGFβ -mediated HCC migration. [score:3]
The first report suggesting that miR-127 is a putative tumor suppressor was based on observations that miR-127 levels were induced by the chromatin-modifying drug 5′-aza-2′-deoxycytidine (Aza) in a panel of human cancer cell lines including T24, HCT116, Hela, NCCIT, and Ramos cells [5]. [score:3]
0065256.g004 Figure 4(A) qPCR analysis of MMP13 (left), c-Jun (middle), and miR-127 (right) expression in MHCC97H cells treated with TGFβ. [score:3]
When the miR-127 seed region in the MMP13 3′UTR was mutated, the suppression of MMP13 3′UTR activity by miR-127 was relieved (Fig. 2B, right). [score:3]
0065256.g006 Figure 6(A-B) qPCR analysis of miR-127 expression (A) and MMP13 mRNA (B, left), and Western blot (WB) analysis of MMP13 protein (B, right) in 5 pairs of surrounding controls and HCC specimens. [score:3]
Interestingly, TGFβ induced c-Jun mRNA (Fig. 4A, middle) but inhibited miR-127 levels (Fig. 4A, right) in a dose -dependent fashion. [score:3]
First, we defined a role of miR-127 in inhibiting HCC migration. [score:3]
miR-127 Decreases MMP13 3′UTR Reporter Activity and Protein Expression. [score:3]
Hela cells were co -transfected with miR-127 promoter (pro) luciferase (luc) reporter, and c-Jun or c-Fos expression plasmids. [score:3]
Fourth, we showed that ERK and JNK pathways are involved in TGFβ-induction of c-Jun to activate the expression of MMP13 and repress miR-127. [score:3]
pTarget in MMP13 group; [§]p<0.01, miR-127 vs. [score:3]
Our results demonstrate for the first time that miR-127 serves as a potential tumor suppressor in HCC by antagonizing TGFβ -mediated HCC cell migration. [score:3]
This has limited our ability to test the in vivo effect of miR-127 in the inhibition of HCC metastasis. [score:3]
pTarget in control group; [‡]p<0.01, miR-127 vs. [score:3]
Generation of miR-127 Expressing Cells. [score:3]
pTarget control; [¥]p<0.01, anti-miR-127 vs. [score:3]
Future studies will be focused on using miR-127 knockout mouse mo del to further examine the function of miR-127 in HCC development and the use of this miR as a potential agent to diminish the amplified TGFβ signaling and modulate the invasiveness of HCC cells. [score:3]
We show that overexpression of miR-127 represses HCC migration, invasion, and tumor growth. [score:3]
qPCR confirmed that miR-127 was ∼2-fold increased in 97HLuc-miR-127 cells, which was consistent with the published literature that used the same miR-127 expression system [12]. [score:3]
Nonetheless, our present studies establish for the first time a role of miR-127 in inhibiting HCC invasion in vitro and HCC growth in vivo. [score:3]
Because activation of TGFβ initiates multiple signaling pathways [25], [26], we sought to determine the specific pathways that are involved in the inhibition of miR-127 by c-Jun downstream of the TGFβ signaling. [score:3]
The human, mouse and rat MMP13 3′UTR shared the same seed region for miR-127 (Fig. 2A), thus MMP13 was predicated to be a target of miR-127. [score:3]
The results suggest that miR-127 is likely to function as an inhibitor of HCC. [score:3]
TGFβ Represses miR-127 Expression Through c-Jun Mediated ERK and JNK Pathways. [score:3]
This observation suggests that TGFβ can feedback repress miR-127 expression through both c-Jun -dependent and independent mechanisms. [score:3]
In spite of relatively low efficiency of anti-miR-127, the abundance of MMP13 protein in whole cell lysate was increased by anti-miR-127 and reduced by miR-127 overexpression (Fig. 2D). [score:3]
Third, we identified c-Jun as a transcriptional repressor and p53 an activator of miR-127 expression. [score:3]
Transient transfection assays showed that the MMP13 3′UTR reporter activity was decreased in a dose -dependent fashion by ectopic expression of miR-127 (Fig. 2B, left). [score:2]
Ectopic expression of miR-127 in 97HLuc-miR-127 cells decreased tumor growth compared with the 97HLuc-Sico cells by day 9 (Fig. 1D, right). [score:2]
We analyzed miR-127 expression in five HCC specimens (T) and compared it with matched normal surrounding livers (N) [27]. [score:2]
Overall, the results suggest that miR-127 directly counteracts the effect of MMP13 on HCC cell migration. [score:2]
The invasive potential of MHCC97H cells was similarly diminished by miR-127 expression as determined by a Transwell cell invasion assay (Fig. 1C). [score:2]
It should be noted that other unidentified miR-127 targets may also be involved in miR-127 regulation of HCC cell migration and invasion, which is currently under investigation. [score:2]
Hela cells were co -transfected with miR-127 promoter reporter, c-Jun (100 ng) and/or p53 plasmids (100 ng). [score:1]
In human breast cancer [9] and in a rat mo del of liver carcinogenesis induced by a methyl -deficient diet [10], the levels of miR-127 were decreased. [score:1]
We therefore determined the interaction between miR-127 and TGFβ in controlling HCC cell migration. [score:1]
The results suggest that TGFβ is likely to repress miR-127 through c-Jun. [score:1]
miR-127 Represses HCC Cell Migration Induced by MMP13. [score:1]
c-Jun also antagonizes p53 activation of the miR-127 promoter and gene transcription. [score:1]
The 97HLuc-Sico and 97HLuc-miR-127 cells were used in Xenograft mouse mo del. [score:1]
Both flanks of each mouse were injected with 0.5×10 [6] 97HLuc-Sico or 97HLuc-miR-127 cells mixed with Matrigel (Invitrogen) in a total volume of 100 µl. [score:1]
MiR-127 is clustered with miR-433 and both miRNA primary transcripts are controlled by nuclear receptor signaling involving small heterodimer partner (SHP) and estrogen related receptor gamma (ERRγ) [2]– [4]. [score:1]
Overexpression of miR-127 decreased the migration rate of MHCC97H by about 40% as examined by a wound healing assay (Fig. 1A), as well as by an alternate Transwell cell migration assay (Fig. 1B, left two). [score:1]
The levels of miR-127 were significantly reduced in HepG2 cells transfected with p53-siRNA (Fig. 4E, left and middle). [score:1]
Thus far, the in vivo physiological function of miR-127 has not been studied and remains largely unknown. [score:1]
In particular, conflicting information is available regarding the potential role of miR-127 in human cancers. [score:1]
TGFβ enhances c-Jun -mediated repression of miR-127 via ERK and JNK pathways. [score:1]
Control 97HLuc-Sico or 97HLuc-miR-127 cells were grafted subcutaneously in the dorsa of athymic mice, and tumor growth was monitored using the Xenogen bioluminescent imaging system by day 9. The number represents tumor images detected (photons/s/cm [2]/steridian). [score:1]
We next examined the effects of miR-127 and MMP13 on HCC cell migration. [score:1]
It would be interesting to determine in future studies whether miR-127 may play a role in TGFβ -mediated Smad activity. [score:1]
Overall, the results suggest that p53 activation of miR-127 is a common but not a cell type specific phenomenon. [score:1]
Ad-cre virus (100 PFU) was then used to infect 97HLuc-SicoGFP or 97HLuc-miR-127GFP cells, which removed the GFP marker and generated 97HLuc-Sico and 97HLuc-miR-127 cells, respectively. [score:1]
Both 97HLuc-Sico and 97HLuc-miR-127 cells were implanted subcutaneously in nude mice and tumor growth was monitored using the Xenogen bioluminescent imaging system [14]. [score:1]
On the other hand, p38 protein kinases, another downstream mediator of the mitogen-activated protein kinase pathways [35], is not involved in TGFβ activation of c-Jun, but is involved in TGFβ repression of miR-127. [score:1]
Despite these existing literature reports pointing to a role for miR-127 in various cancers, no detailed functional and mechanistic studies have been done. [score:1]
The levels of miR-127 were not affected by MMP13 (Fig. 3C). [score:1]
0065256.g002 Figure 2(A) Sequence alignment between miR-127 and the 3′UTR of MMP13 in human, mouse, and rat. [score:1]
Hela cells were co -transfected with miR-127 or AP1 promoter reporter along with c-Jun/c-Fos plasmid (100 ng) in the absence or presence of TGFβ (5 ng/ml). [score:1]
miR-127 attenuates TGFβ -mediated induction of HCC cell migration. [score:1]
[1 to 20 of 112 sentences]
2
[+] score: 324
Additionally, upregulation of miR-127 could significantly suppress growth, reduce colony formation, enhance apoptosis, and inhibit migration and invasion of BC cells, at least partially by targeting BCL-6. Thus, miR-127 could be a potential prognostic biomarker and therapeutic target for BC. [score:12]
In addition, upregulation of miR-127 could inhibit growth, reduce colony formation, and enhance apoptosis of BC cells by targeting BCL-6. The microRNA-127 (miR-127) is located within the imprinted Dlk1/Gtl2 region expressed from the maternal chromosome. [score:10]
It was observed that upregulation of miR-127 could significantly inhibit the expression of BCL-6 protein in MCF-7 and SK-BR-3 cells (Figure 5(c)). [score:8]
Zhao and his colleagues also found that Tudor-SN promoted metastasis and proliferation of breast cancer cells via downregulating the miR-127 expression [22], although miR-127 could regulate breast cell proliferation and senescence [15]. [score:7]
These data suggested that downregulation of miR-127 was inversely correlated with upregulation of BCL-6 in BC tissues. [score:7]
To testify the validation of BCL-6 as a direct target of miR-127, we performed miRNA target luciferase reporter assay using a pLUC target reporter plasmid containing BCL-6/3′-UTR (Genecoepia, Rockville, MD) (pLUC/BCL-6/3′-UTR-wt). [score:7]
To explore how miR-127 contributes to the malignant phenotypes of BC cells, we searched for the potential regulatory targets of miR-127 using prediction tools, including miRanda, PicTar, and TargetScan. [score:6]
Further researches suggested that upregulation of miR-127 could enhance apoptosis of BC cells, which might be associated with activation of caspase-3. These data indicated that miR-127 functions as a tumor suppressor in BC. [score:6]
Upregulation of miR-127 Significantly Inhibits Migration and Invasion of BC Cells. [score:6]
Guo and his colleagues showed that the ectopic expression of miR-433 and miR-127 in gastric cancer cell lines inhibits cell proliferation, cell cycle progression, cell migration, and invasion by directly interacting with the mRNA encoding oncogenic factors KRas and MAPK4, respectively [19]. [score:6]
These data showed that upregulation of miR-127 could inhibit growth and reduced the capacity of colony formation in BC cells by enhancing caspase-3 -dependent apoptosis. [score:6]
Upregulation of miR-127 Inhibits Growth, Reduces Colony Formation, and Enhances Apoptosis of BC Cells. [score:6]
Although hundreds of different targets were predicted, those genes involved in the pathogenesis of human cancers may be the relevant targets with respect to the biological functions of miR-127. [score:5]
The median value of miR-127 in all BC tissues was 0.86 and was used as a cutoff value, and all patients were divided into two groups high-miR-127 expression group (≥0.86; n = 44) and low-miR-127 expression group (<0.86; n = 66). [score:5]
Also, restoration of miR-127 significantly inhibits growth, induces apoptosis, and reduces migration and invasion of BC cells by targeting pro-oncogene (BCL-6). [score:5]
By analysis of the global expression profile of miRNAs in primary breast cancer and normal adjacent tumor tissues (NATs), Yan et al. showed that seven miRNAs (miR-497, miR-31, miR-355, miR-320, mir-140, miR-127, and miR-30a-3p) were downregulated more than twofold in BC tissue compared with normal adjacent tissues [14]. [score:5]
Results from MTT assays indicated that upregulation of miR-127 could significantly inhibit growth of BC cells (Figure 3(b)). [score:5]
miR-127 and miR-433 are transcribed from independent promoters in overlapping genomic regions, and expression of these two miRNAs is induced by estrogen related receptor gamma (ERRc) and inhibited by small heterodimer partner (SHP), a unique orphan nuclear receptor and transcriptional repressor [16, 17]. [score:5]
Kaplan-Meier analyses were performed to analyze the correlation between miR-127 expression and disease-free survival (DFS) and overall survival (OS) of BC patients. [score:5]
By next generation sequencing analysis of miRNAs, Jiang et al. reported that miR-127-3p inhibits glioblastoma proliferation and activates TGF- β signaling by targeting SKI (v-ski sarcoma viral oncogene homolog (avian)) [20]. [score:5]
More importantly, the relative expression level of BCL-6 protein in BC tissues was observed to be inversely correlated with the expression level of miR-127. [score:5]
Expression of miR-127 in BC Tissues Was Inversely Associated with BCL-6 Expression. [score:5]
Here, we first detected the expression of miR-127 in 15 pairs of BC tissues and corresponding noncancerous tissues and showed that the relative expression level of miR-127 in BC tissues was significantly lower than that in corresponding noncancerous tissues. [score:5]
Additionally, we generated mutant BCL-6/3′-UTR reporter construct by site-directed mutagenesis in the putative target site of miR-127 in the wild-type BCL-6/3′-UTR (pLUC/BCL-6/3′-UTR-mut) using Stratagene QuikChange Site-Directed Mutagenesis Kit (Stratagene, Hei delberg, Germany). [score:5]
The expression of miRNA was defined based on the threshold cycle (Ct), and relative expression levels of miR-127 were calculated as 2 [−[(Ct of miR-127)−(Ct of U6)]] after normalization with reference to expression of U6 small nuclear RNA. [score:5]
A total of 15 BC tissues were analyzed for the expression levels of BCL-6 and for miR-127 expression. [score:5]
Results showed that the relative level of miR-127 expression in BC tissues was significantly downregulated, compared with that in corresponding noncancerous tissues (P < 0.001; Figures 1(a)- 1(b)). [score:5]
MTT and colony formation assays indicated that upregulation of miR-127 could significantly inhibit growth and reduce colony formation capacity of BC cells. [score:5]
Next, we analyzed the effect of miR-127 on the expression of BCL-6 by Western blotting to detect the expression of BCL-6 protein in MCF-7/miR-127 or SK-BR-3/miR-127 and their respective control cells. [score:5]
BCL-6 Was a Direct Target of miR-127. [score:4]
These data suggest that BCL-6 might be a direct target of miR-127. [score:4]
In concordance with the luciferase reporter results, endogenous BCL-6 protein levels were found to be downregulated by miR-127 in BC cells. [score:4]
Therefore, silencing of BCL-6 could mimic the effects of miR-127 upregulation on malignant phenotypes of BC cells. [score:4]
Yang and his colleagues firstly elucidated a feedback regulation between miR-127 and the TGF β/c-Jun cascade in HCC migration via MMP13 that involves a cross talk between the oncogene c-Jun and tumor suppressor p53 [21]. [score:4]
Thus, upregulation of miR-127 could reduce the capacity of migration and invasion in BC cells. [score:4]
These data indicated that downregulation of miR-127 might play a critical role in BC progression. [score:4]
Previously, Saito and his colleagues also reported specific activation of microRNA-127 with downregulation of the proto-oncogene BCL-6 by chromatin-modifying drugs in human cancer cells [18]. [score:4]
Taken together, downregulation of miR-127 was significantly correlated with higher lymph node metastasis, advanced clinical stage, and poor overall survival of BC patients. [score:4]
In the present study, we showed that miR-127 was significantly downregulated in BC tissues in comparison with corresponding noncancerous tissues. [score:4]
These data clearly suggested that BCL-6 might be a direct and functional target of miR-127 in BC cells. [score:4]
By integrating bioinformatics analysis, BCL-6 was identified as a direct functional downstream target of miR-127. [score:4]
3.1. miR-127 Was Significantly Downregulated in BC Tissues. [score:4]
At the same time, silencing of BCL-6 could mimic the effects of miR-127 upregulation on malignant phenotypes of BC cells. [score:4]
To determine the status of miR-127 expression in BC, a qRT-PCR assay was performed to determine the expression of miR-127 in 15 pairs of BC and corresponding noncancerous tissue samples. [score:4]
miR-127 has been reported to function as a tumor suppressor in a variety of human cancers, including BC. [score:3]
Results from survival analyses suggested that the expression of miR-127 was correlated to OS but not to DFS of BC patients. [score:3]
Correlation of miR-127 Expression with Prognosis of BC Patients. [score:3]
Furthermore, multivariate regression analysis indicated that status of miR-127 expression (RR, 2.023; 95% CI, 1.437–2.855; P = 0.009) was an independent predictor for the prediction of OS, as well as lymph node metastasis (RR, 2.097; 95% CI, 1.005–2.506; P = 0.012) and clinical stage (RR, 1.676; 95% CI, 1.278–3.121; P = 0.006). [score:3]
qRT-PCR was used to detect the expression of miR-127 in MCF-7/miR-127 and MCF-7/miR-NC, respectively. [score:3]
Also, low-miR-127 expression was observed to be significantly correlated with higher incidence of lymph node metastasis and advanced clinical stage of BC patients. [score:3]
Univariate and multivariate analyses indicated that status of miR-127 expression, along with lymph node metastasis and clinical stage, might be an independent prognostic factor for BC patients. [score:3]
The clinicopathological and prognostic significance of miR-127 expression in BC is still unclear and needs to be further elucidated. [score:3]
Second, further studies are needed to identify other undefined miR-127 targets, which may also affect cellular phenotypes at other levels. [score:3]
To analyze the effects of miR-127 expression on malignant phenotypes of BC cells, pGCMV/miR-127 vector or control vector (pGCMV/miR-NC) was stably transfected into BC cells (MCF-7 and SK-BR-3), which was named MCF-7/miR-127 (or MCF-7/miR-NC) and SK-BR-3/miR-127 (or SK-BR-3/miR-NC), respectively. [score:3]
For ectopic expression of miR-127, the pGCMV/miR-127 or pGCMV/miR-NC vectors were purchased from GenePharm (Shanghai, China). [score:3]
To further analyze the clinicopathological significance of miR-127 in BC, the expression of miR-127 was determined in another 110 cases of BC tissues. [score:3]
However, there were no significant correlations between miR-127 expression and other clinicopathological factors of patients, such as age, tumor size, histological type, differentiation grade, ER, PR, and HER-2 status (P = 0.749, 0.500, 0.795, 0.352, 0.936, 0.340, and 0.640, resp. [score:3]
Next, we explored the effects of miR-127 expression on migration and invasion of BC cells. [score:3]
Correlation of miR-127 Expression with Clinicopathologic Factors of BC Patients. [score:3]
The first study indicating that miR-127 might be a putative tumor suppressor was based on findings that miR-127 levels could be induced by the chromatin-modifying drug 5′-aza-2′-deoxycytidine in a panel of human tumor cell lines including T24, HCT116, Hela, NCCIT, and Ramos cells [18]. [score:3]
Here, we show that low-miR-127 expression may be an independent poor prognostic factor for BC patients. [score:3]
By statistical analyses, low-miR-127 expression was found to be significantly correlated with higher incidence of lymph node metastasis and advanced clinical stage (P = 0.029 and 0.004, resp. [score:3]
Univariate and multivariate analyses of factors related to prognosis of BC patients were shown in Table 2. Multivariate regression analysis indicated that status of miR-127 expression (relative risk (RR), 1.798; 95% confidence interval (CI), 1.333–2.552; P = 0.038) was significantly correlated with OS of BC patients, along with HER-2 status (P = 0.028), lymph node metastasis (P = 0.007), and clinical stage (P = 0.025). [score:3]
First, as the number of patients in this study is small, a larger case population is needed to confirm the prognostic value of miR-127 expression in BC. [score:3]
By statistical analysis, the expression of miR-127 was observed to be significantly correlated with advanced clinical stage and higher incidence of lymph node metastasis. [score:3]
The expression of cleaved caspase-3 and PARP proteins was significantly increased in MCF-7/miR-127 or SK-BR-3/miR-127 cells in comparison with control cells (Figure 3(e)). [score:3]
Compared with that in control cells, the relative level of miR-127 expression in MCF-7/miR-127 and SK-BR-3/miR-127 cells was significantly increased by about 423.8% and 508.4%, respectively (P < 0.01; Figure 3(a)). [score:2]
To further determine the roles of miR-127 in BC development, we analyzed the effects of miR-127 on malignant phenotypes of BC cells. [score:2]
To obtain further direct evidence that BCL-6 is a target of miR-127, we investigated the binding site of miR-127 in the 3′-UTR sequence of BCL-6 mRNA. [score:2]
Also, Chen and his colleagues reported that miR-127 could regulate proliferation and senescence of breast cancer cells [15]. [score:2]
The cDNA was synthesized from 5 ng of total RNA by using the TaqMan miRNA reverse transcription kit (Applied Biosystems, Foster City, CA), and the expression levels of miR-127 were quantified by using miRNA-specific TaqMan MiRNA Assay Kit (Applied Biosystems). [score:2]
In this study, we performed qRT-PCR assay to detect expression of miR-127 and analyze its associations with clinicopathological factors and prognosis of BC patients. [score:2]
However, the clinicopathological and prognostic values of miR-127 in BC and its effects on migration and invasion of BC cells need to be further elucidated. [score:1]
The chi-squared test was used to investigate the significance of miR-127 expression as being correlated with clinicopathologic factors in BC. [score:1]
48 h after pGCMV/miR-127 or pGCMV/miR-NC were cotransfected with pLUC/BCL-6/3′-UTR-wt or pLUC/BCL-6/3′-UTR-mut into human HEK293T cells, the luciferase activity was determined. [score:1]
We constructed a luciferase reporter (pLUC/BCL-6/3′-UTR-wt) in which the nucleotides of the BCL-6-3′-UTR complementary to miR-127 (nt 3057–3080) were inserted into the pLUC vector, and we also generated a mutant reporter (pLUC/BCL-6/3′-UTR-mut), in which the first six nucleotides in the miR-127 seed region complementary sites were mutated (Figure 5(a)). [score:1]
A statistically significant inverse correlation was observed between BCL-6 and miR-127 (r = −0.334; P = 0.038, Pearson's correlation; Figure 7(b)). [score:1]
Here, the focus is on miR-127. [score:1]
By analysis of luciferase activity, miR-127 can bind with 3′-UTR sequence of BCL-6 mRNA. [score:1]
The capacity of colony formation in MCF-7/miR-127 and SK-BR-3/miR-127 cells was significantly reduced, in comparison with that in the control cells (P < 0.05; Figure 3(c)). [score:1]
It was observed that the 5-year OS of high-miR-127 group (57.4%) was significantly higher than that of low-miR-127 group (44.8%; P = 0.0016) (Figure 2(b)). [score:1]
In addition, the effects of miR-127 on phenotypes of BC cells were determined. [score:1]
Furthermore, the apoptotic rate of MCF-7/miR-127 or SK-BR-3/miR-127 cells was significantly increased by about 14.5% and 16.6%, respectively (Figure 3(d)). [score:1]
Next, we investigated whether BCL-6 protein expression was inversely correlated with levels of miR-127 in BC tissues. [score:1]
Additionally, the OS of patients with low miR-127 was significantly lower than that of those patients with high miR-127, and multivariate analysis indicated that status of miR-127 was an independent factor for predicting the survival of BC patients. [score:1]
However, there was no significant difference between the 5-year DFS of high-miR-127 group and that of low-miR-127 group (61.4% versus 59.3%; P = 0.165) (Figure 2(a)). [score:1]
[1 to 20 of 86 sentences]
3
[+] score: 298
miR-127 is up-regulated in senescent fibroblasts, and its over -expression inhibits proliferation and induces senescence-like phenotypes, including increased SA-β-gal -positive staining and up-regulation of p53 and p21 expression. [score:13]
Similar to the results of transient expression of miR-127, p53 and p21 were up-regulated, and cyclin D1 was down-regulated in WI-38 cells stably expressing miR-127. [score:11]
In rat liver cells, down-regulation of miR-127 promotes cell proliferation, while up-regulation of miR-127 inhibits proliferation [16]. [score:9]
In breast cancer tissues, we found that miR-127 was down-regulated, whereas its target,BCL6, was up-regulated. [score:9]
Furthermore, over -expression of miR-127 has markedly down-regulated BCL6 expression in both WI-38 and IMR-90 cells (Figure 3B). [score:8]
In primary breast tumors,miR-127 expression is lower, and BCL6 expression is higher than in adjacent normal tissues, suggesting that miR-127 may function as a novel tumor suppressor and that its alteration may contribute to breast cancer development. [score:8]
We found that miR-127 was down-regulated in 9 of 10 breast cancer tissues and conversely, that BCL6 expression was up-regulated in breast tumors compared with their corresponding tumor-adjacent tissues (Figure 6). [score:8]
This suggests that miR-127 is involved in the DNA damage response by indirectly targeting p53 through the down-regulation of BCL6. [score:7]
Moreover, we showed that over -expression of miR-127 or depletion of BCL6 expression inhibited breast cancer cell growth. [score:7]
We first confirmed that the level of miR-127 expressionwas up-regulated by the infection with lentiviral miR-127 and were comparable to that in senescent WI-38 (Figure 2A). [score:6]
miR-127 significantly inhibited growth in both the MCF7 and MDA-MB-231 cell lines and was associated with down-regulation of BCL6, cyclin D1 and dephosphorylation of pRb at ser780 (Figure 5C, D). [score:6]
Because miR-127 is significantly up-regulated in senescent cells, we first examined BCL6 expression in young and senescent fibroblasts by Western blot analysis. [score:6]
This suggests that up-regulation of miR-127 in senescent cells can activate p53 by translational repression of BCL6. [score:6]
We found that, in inverse correlation with miR-127 expression, BCL6 was significantly down-regulatedin senescent WI-38 and IMR-90 fibroblasts (Figure 3A). [score:6]
The results showed that miR-127 expression was up-regulated in senescent WI-38 cells and IMR-90 cells (Figure 1A). [score:6]
To ensure that the observed effects of the miR-127 duplex mimic were not associated with supraphysiologic levels of miR-127 expression, we repeated these experiments using a lentiviral expression system. [score:5]
Together, these results suggest that miR-127 inhibits cell proliferation by targeting BCL6 in breast cancer cells. [score:5]
Here, we show that miR-127 induces senescence in human fibroblasts and inhibits the proliferation of breast cancer cells by targeting the oncogene BCL6. [score:5]
Furthermore, we attempted to determine whether overexpression of BCL6 could rescue the senescence phenotype in WI-38 cells induced by overexpression of miR-127. [score:5]
We observed that induced miR-127 expression caused a remarkable inhibition of cell proliferation (Figure 1B) and increased senescence-like phenotypes with positive staining of senescence -associated-β-galactosidase (SA-β-gal) (Figure 1C) in both WI-38 and IMR-90 cells. [score:5]
Interestingly, we observed that miR-127 and its target, BCL-6,are inversely correlated and that their expression profiles are opposite in breast tumors and matched adjacent tissues. [score:5]
miR-127 and miR-433 are transcribed from independent promoters in overlapping genomic regions,and expression of these two miRNAs is induced by estrogen related receptor gamma (ERRγ) and inhibited by small heterodimer partner (SHP), a unique orphan nuclear receptor and transcriptional repressor [11]– [13]. [score:5]
In this report, we identified miR-127 as a novel regulator of cellular senescence that targets BCL6. [score:4]
miR-127-3p is one of the miRNAs that was up-regulated in senescent WI-38 and IMR-90 cells [9]. [score:4]
Our data suggest that miR-127 regulates cellular senescence through the p53/p21 pathway by targeting BCL6. [score:4]
miR-127 and its Target BCL6 Regulate the Proliferation of Breast Cancer Cells. [score:4]
BCL6 is a direct target of miR-127. [score:4]
miR-127 is up-regulated in senescent human fibroblasts and mediates cellular senescence. [score:4]
miR-127 is expressed at its highest level during the late stage of fetal lung development and may thus play an important role in this process [15]. [score:4]
In addition, miR-127 has been shown to regulate BCL6 -mediated expression of CDKN1A (p21). [score:4]
Our results also showed that BCL6 is a direct target of miR-127 in normal human fibroblasts. [score:4]
Together, these results suggest that BCL6 is a direct target of miR-127 in the context of senescence in human fibroblasts. [score:4]
miR-127 is up-regulated in replicative senescent cellsand in response to DNA damage induced by the DNA damage agent etoposide in WI-38 cells (data not shown). [score:4]
We therefore examined the expression of miR-127 in breast cancer cells. [score:3]
Together, these observations suggest that miR-127 functions as a novel tumor suppressor that coordinates with oncogene BCL6 to contribute to the pathologies of aging and cancer. [score:3]
Using microarray, we previously reported that miR-127 is differentially expressed in young replicating versus senescent WI-38 cells [9]. [score:3]
As expected, miR-127 overexpression induced cell cycle arrest at G [0]/G [1] phase (Figure 1E). [score:3]
It has been reported that miR-127 is significantly reduced in gastric cancer tissues and osteosarcoma cell lines [27] and that BCL6 is overexpressed in invasive breast cancers [28], [29]. [score:3]
Additionally, we found an inverse correlation of expression between BCL6 and miR-127 in primary breast tumors versus adjacent normal tissues. [score:3]
We then analyzed the expression of miR-127 in human breast cancer tissues and adjacent normal tissues. [score:3]
Overexpression of miR-127 repressed the luciferase activity of the reporter containing the wild-type full-length 3′-UTR, but not the mutant full-length 3′-UTR (Figure 3D). [score:3]
We found miR-127 -induced cell growth repression can be rescued by the ectopically expression of BCL6 in these two cell lines. [score:3]
miR-127 Overexpression Induces Cellular Senescence in Human Fibroblasts. [score:3]
0080266.g001 Figure 1(A) Relative levels of miR-127 expression analyzed by stem-loop qRT-PCR in different PDLs of WI-38 and IMR-90 cells. [score:3]
This indicates that over -expression of miR-127 induces cellular senescence. [score:3]
In addition, we found an opposing effect of miR-127 and its target,BCL6, on breast cancer cell proliferation. [score:3]
Stable expression miR-127 affects senescence phenotypes in WI-38 fibroblasts. [score:3]
To confirm that BCL6 is a direct target of miR-127 in human fibroblasts, we then performed luciferase reporter assays. [score:3]
Our results showed that miR-127 -induced senescence -associated phenotypes were rescued by the ectopically expressed BCL6 in WI-38 cells (Figure 4F,G). [score:3]
0080266.g005 Figure 5(A) qRT-PCR analysis of miR-127 expression in WI-38, IMR-90, MCF7, and MDA-MB-231. [score:3]
Expression levels of miR-127 and BCL6 in normal breast tissues and primary breast tumors. [score:3]
BCL6 have been reported to be a potential target of miR-127 [14]. [score:3]
A pre-miR-127 lentiviral construct (lenti-miR-127) that stably expressesthe miR-127 precursor in its native context was used to study the effect of miR-127 on cellular senescence in WI-38 fibroblasts. [score:3]
Reverse Correlation between miR-127 and BCL6 Expression in Primary Breast Tumors Versus Matched Adjacent Tissues. [score:3]
This indicates that the depletion of BCL6 resulted in a similar senescence phenotype to miR-127 over -expression. [score:3]
BCL6 is a Target of miR-127. [score:3]
Cells that were stably expressing miR-127 exhibited a reduced life span (Figure 2B), enlarged senescence morphology, and SA-β-gal positive staining (Figure 2C) compared with cells infected with the YFP lentivirus. [score:2]
The mutant BCL6 3′UTR segment, with point substitutions in the miR-127 complementary sites, was generated by site-directed mutagenesis. [score:2]
We constructed luciferase reporters using the pGL3 vector that contained the wild-type full-length 3′-UTR ofBCL6 (Figure 3C, P1) orthe mutant full-length 3′-UTR of BCL6 (Figure 3C, P2), in which the miR-127 binding site was mutated by site-directed mutagenesis. [score:2]
To investigate how miR-127 participates in the regulation of cellular senescence, we sought to identify miR-127 target genes in normal human fibroblasts. [score:2]
The results showed that miR-127 has a much lower expression level in breast cancer MCF7 and MDA-MB-231 cell lines compared with normal human fibroblasts (Figure 5A). [score:2]
These results indicate that miR-127 indeed regulates cellular senescence in normal human fibroblasts. [score:2]
Our data suggest that miR-127 is a novel senescence -associated (SA)-miRNA that regulates cellular senescence. [score:2]
These observations suggest important roles for miR-127 in cell proliferation, differentiation, and development. [score:2]
miR-127-3p and miR-127-5p are two mature miRNAs that are processed from the same precursor miRNA; hereafter, miR-127-3p will be referred to as miR-127. [score:1]
To further confirm the microarray data, we performed real-time RT-PCR analysis on miR-127 in young proliferating and senescent WI-38 cells and IMR-90 cells. [score:1]
Figure S1 MCF7(A) and MDA-MB-231 (B) cells were first transfected with miR-127 duplex. [score:1]
We then analyzed the cell cycle of MCF7 cells transfected by miR-127 mimics. [score:1]
qRT-PCR analysis of miR-127 and Western blot analysis of BCL6 in matched sets of normal tissues and primary tumors of breast. [score:1]
miR-127 is located in chromosome region 14q32.2 and belongs to a cluster that includes miR-431, miR-433, miR-127, miR-432, and miR-136 [10]. [score:1]
The hsa-miR-127 mimic and negative controls were obtained from GenePharma (Shanghai, China). [score:1]
These findings suggest that miR-127 is a novel SA-miRNA. [score:1]
0080266.g006 Figure 6 qRT-PCR analysis of miR-127 and Western blot analysis of BCL6 in matched sets of normal tissues and primary tumors of breast. [score:1]
The histogram displays the percentage changes of G [0]/G [1] and G [2]/M when WI-38 cells transfected with miR-127 mimics and negative control. [score:1]
The histogram displays the percentage changes of G [0]/G [1] and G [2]/M when MCF7 cells transfected with miR-127 mimics and negative control. [score:1]
As is shown in Figure 3D, miR-127 significantly reduced the luciferase activity of the reporter containing the wild-type binding sitebut not the mutant binding site of miR-127. [score:1]
The WI-38 and IMR-90 cellswere stained for SA-β-gal activity 7 days after transfection with 50 nM miR-127 mimic or negative control. [score:1]
To investigate the involvement of miR-127 in cellular senescence in human fibroblasts, we induced miR-127 expression by transfecting a miR-127 duplex mimic into the young proliferating human fibroblast cell lines WI-38 and IMR-90. [score:1]
In addition, we constructed luciferase reporters containing the wild-type (Figure 3C, P3) or mutant (Figure 3C, P4) binding site of miR-127 within the BCL6 3′-UTR. [score:1]
This indicates that miR-127 mediates cellular senescence by activating the p53/p21 pathway in human fibroblasts. [score:1]
Little is known about the role of miR-127 in cellular senescence. [score:1]
BCL6 is potentially involved in miR-127 -mediated cellular senescence. [score:1]
[1 to 20 of 82 sentences]
4
[+] score: 217
Alteration of those miRNAs expression may in turn affect the expression of the imprinted genes, as evidenced by the down-regulation of Rtl1 by miR-127 in this study. [score:8]
Thus, the expression of human miR-127 was ∼20 times higher than human miR-433, the expression of rat miR-127 was ∼47 times higher than rat miR-433, and the expression of dog miR-127 was ∼40 times higher than dog miR-433. [score:7]
Down-Regulation of the Imprinted Gene Rtl1 by Overexpression of miR-127. [score:6]
This data suggests that miR-127 may function as a siRNA to down-regulate its host gene expression. [score:6]
Potential PCR amplification from genomic DNA contamination was eliminated by treating the total RNA with DNase I. As shown in Figures 6a–c, primary transcripts of the human (a), rat (b), or dog (c) miR-433 and miR-127 were easily detected in cells that over-expressed the recombinant expression vector, respectively. [score:5]
0007829.g005 Figure 5(a) The miR-433/127 loci expression plasmid of human, rat, or dog was expressed in mouse Hepa-1 cells (different species), and the binding of ERRγ to the endogenous promoter of miR-433 and of miR-127 of each species was detected using specific ERRγ antibodies. [score:5]
0007829.g006 Figure 6(Panels a–c) Semi-quantitative RT-PCR analysis of pri-miR-433 and pri-miR-127 expression transcribed from the human (a), rat (b), and dog (c) miR-433/127 loci expression plasmid. [score:5]
The recombinant human, rat, or dog miR-433/127 loci expression vector (designated pMIR-REPORT-NoMp-human, rat or dog) was then transfected into Hepa-1 cells and the expression of miR-433 and miR-127 primary transcripts was examined using semi-quantitative RT-PCR. [score:5]
Because miR-127 is located in an imprinted region encoding Rtl1, we determined if changes in miR-127 expression would affect the expression of Rtl1. [score:5]
Artificial Expression of miR-433 and miR-127 In Vitro in CellsOur previous studies showed that the mouse miR-433 and miR-127 genes overlapped and the expression of mouse miR-433 and miR-127 was controlled by independent promoters [3], [4]. [score:5]
0007829.g007 Figure 7 The expression vector of miR-127 was transfected in human Hela and mouse Hepa-1 cells and the expression of Rtl1 was determined by a modified strand-specific q-PCR. [score:5]
Similarly, the rat miR-433 and miR-127 was ∼210 fold and ∼10000 fold ovexpressed (Figure 6f) and the dog miR-433 and miR-127 was ∼4 fold and ∼160 fold ovexpressed (Figure 6g), respectively. [score:5]
The expression vector of miR-127 was transfected in human Hela and mouse Hepa-1 cells and the expression of Rtl1 was determined by a modified strand-specific q-PCR. [score:5]
We overexpressed miR-127 in human Hela and mouse Hepa-1 cells using an expression vector of miR-127 and the level of Rtl1 was assessed using a strand specific q-PCR analysis. [score:5]
For instance, if mutations occurred in the region between pre-miR-433 and pre-miR-127, it would be likely to affect both the processing of mature miR-433 and the regulation of miR-127 expression. [score:5]
We next determined expression levels of the mature miR-433 and miR-127 in Hepa-1 cells after recombinant vector over -expression. [score:5]
Interestingly, ectopic expression of miR-127 resulted in a significant reduction in Rtl1 expression in both cells (Figure 7). [score:5]
Based on this information, we made a direct comparison between the expression level of miR-433 and miR-127. [score:4]
Compared with non-vector transfected cells, the human miR-433 was ∼100 fold over-expressed whereas the human miR-127 was ∼2000 fold over-expressed (Figure 6e). [score:4]
The imprinted expression of miR-127 has been shown to undergo DNA methylation regulation in mouse embryos [26] and cancer cells [27]. [score:4]
Our studies provide evidence for a conserved gene structure and ERR/SHP dependent regulation of miR-433 and miR-127 gene expression in mammals. [score:4]
We recently have shown that gene expression of miR-433 and miR-127 in mice was regulated via a nuclear receptor ERRγ/SHP dependent mechanism [4]. [score:4]
Based on the identification of the same binding motifs, we predicted that a common regulatory mechanism of miR-433 and miR-127 expression may exist among different mammalian species. [score:4]
Artificial Expression of miR-433 and miR-127 In Vitro in Cells. [score:3]
Due to high expression of primary transcript of miR-433 and mIR-127, different PCR cycles were used (see Figure 6). [score:3]
This would allow us to determine if the transcriptional expression of miR-433 or miR-127 could be driven by its own promoter from the endogenous miR-433/127 loci. [score:3]
The mouse cell line Hepa1 and human cell line Hela were transfected with miR-127 expression vector. [score:3]
On the other hand, we observed a common transcriptional mechanism governing the expression of miR-433 and miR-127 in mammals, which involved ERR family members and orphan receptor SHP. [score:3]
As expected, ERRγ dose -dependently activated promoters of miR-433 and miR-127 of human (Figure 4a), rat (Figure 4b), and dog (Figure 4c), which was repressed by co -expression of SHP. [score:3]
Transcriptional expression of miR-433 and miR-127 from the miR-433/127 loci in human, rat, and dog. [score:3]
In addition, the expression level of pri-miR-433 was markedly lower than that of pri-miR-127 (Figure 6d) in all three species, suggesting pri-miR-433 and pri-miR-127 were transcribed differentially from an independent transcription unit. [score:3]
These differential expression results provided further evidence that miR-433 and miR-127 produced from the miR-433-127 loci were transcribed from two separate promoters in human, rat, and dog. [score:3]
Our previous studies showed that the mouse miR-433 and miR-127 genes overlapped and the expression of mouse miR-433 and miR-127 was controlled by independent promoters [3], [4]. [score:3]
In order to avoid the effect of endogenous miR-127 and miR-433 primary transcripts in Hela cells, we overexpressed the pMIR-Report human433/127 loci, pMIR-Report rat433/127 loci, and pMIR-Report dog433/127 loci in Hepa1 cells. [score:3]
The expression level of primary transcript of miR-433 and miR-127 was determined by semi-quantitative PCR using primers listed in Supplementary Material Table S3. [score:2]
We recently have reported that the full length primary transcripts of mouse miR-433 and miR-127 overlapped in a 5′–3′ unidirectional way [3]. [score:2]
We elucidated a common regulatory mechanism governing miR-433 and miR-127 promoter activities, which was dependent on nuclear receptor estrogen related receptor gamma (ERRγ, NR3B3) and small heterodimer partner (SHP, NR0B2) [4]. [score:2]
In this study, we used pMIR-Report-human 433/127, pMIR-Report-rat433/127, pMIR-Report-dog433/127 plasmids as the standard template to determine the PCR efficiency, then compared the expression level of miR-433 and miR-127 primary transcripts. [score:2]
The conservation of the transcriptional regulation of miR-433 and miR-127 further supports the notion that the miR-433/127 loci in mammals might be evolved from an ancient common origin. [score:2]
Primers used to determine the expression of primary transcripts of miR-433 and of miR-127 are located surrounding the precursors of miR-433 and of miR-127. [score:2]
In conclusion, our studies for the first time provide evidence for a conserved structure and transcriptional regulation of the clustered miR-433 and miR-127 genes in mammals, including humans. [score:2]
However, the question remains to be determined whether molecular details of miR-433 and miR-127 regulation by ERR/SHP are restricted to mouse or whether they apply to other species. [score:2]
Common Regulation of miR-433 and miR-127 Promoter Activity among Mammalian Species. [score:2]
Our published results showed that miR-433 and miR-127 genes are overlapped in a 5′–3′ unidirectional way in mouse [3] and these two non-coding genes have an antisense transcript, RTL1 [19]. [score:2]
Based on their overlapping gene structure and transcriptional initiation and termination sites, we subsequently cloned promoters of miR-433 and miR-127. [score:1]
ERRγ was co-immunoprecipitated on the ERRE containing the endogenous promoter regions of miR-433 and miR-127 in the liver of human and rat, and dog spleen, respectively (Figure 5b). [score:1]
Although the miR-433/127 loci were located on different chromosomes (Chr) in those species (human, Chr 14; Chimpanzee, Chr14; Horse, Chr 24; Dog, Chr 8; Monkey, Chr 7; Rat, Chr 6; Cow, Chr 21; mouse, Chr 12), multiple sequence alignment (MSA) of the precursors, pre-miR-433 and pre-miR-127, showed that the sequence similarity of pre-miR-433 hairpins was ∼95% (Figure 1a) and of pre-miR-127 was 100% (Figure 1b) among those species. [score:1]
To determine if miR-433 and miR-127 in human, rat, and dog can be independently and differentially transcribed using each miRNA's own promoter, we cloned a large (∼4.5 kb) human, rat, or dog genomic DNA fragment containing miR-433 and miR-127 and their promoter regions into pMIR-REPORT vector (Figure S2). [score:1]
Figure S1 Transient transfection assays to determine ERRα and ERRβ regulation of miR-433 and miR-127 promoter (pro. ) [score:1]
Transient transfection assays to determine ERRγ and SHP regulation of miR-433 and miR-127 promoter (pro. ) [score:1]
MatInspector of Genomatix Software Suite was used to predict the transcription factor binding sites in the promoter regions of miR-433 and miR-127 in different species, which was completely using Default parameters (http://www. [score:1]
0007829.g004 Figure 4Transient transfection assays to determine ERRγ and SHP regulation of miR-433 and miR-127 promoter (pro. ) [score:1]
The mature sequences of miR-433 and miR-127 were identical among the eight species. [score:1]
The response elements of the miR-433 and miR-127 genes from eight different species are illustrated. [score:1]
As shown in Figure 5, ERRγ was found to Co-IP on both the miR-433 and miR-127 promoters of human, rat, or dog. [score:1]
This resulted in the cloning of the gene cluster encoding mouse miR-433 and miR-127, which provided the first report for an overlapping code usage of the paired miR-433/127 gene [3]. [score:1]
The promoters of pri-miR-433 and pri-miR-127 were cloned into a pGL3-basic vector, respectively. [score:1]
ERRa, but not ERRβ, showed strong activation of miR-433 and miR-127 promoters of human, rat, and dog (Figure S1). [score:1]
The distance between miR-433 and miR-127 showed a striking similarity: 986 bp in human, chimpanzee, horse, dog, and monkey, 989 bp in rat, 988 bp in cow, and 1007 bp in mouse. [score:1]
The promoter of pri-miR-433 and of pri-miR-127 from each species was cloned into a pGL3-basic vector, respectively. [score:1]
Our results presented in this study provide evidence that the miR-433 and miR-127 overlapping genes have a higher rate of conservation in mammalian species. [score:1]
The genomic region between the two pre-miRNAs is predicted to function as the promoter of miR-127 based on our published mouse data [4]. [score:1]
BLASTN search of genome sequences of different species was completed online and a 5 kb genomic sequence surrounding the miR-433 and miR-127 precursors in each species was extracted manually. [score:1]
ChIP analysis of ERRγ Co-immunoprecipitation (Co-IP) on the miR-433 and miR-127 promoter region containing putative ERRE in human, rat, and dog. [score:1]
The precursor sequences of miR-433 and miR-127 were downloaded from the Sanger Institute (http://microrna. [score:1]
MSA of miR-433 and miR-127 gene promoters in eight mammalian species. [score:1]
Using mouse miR-433 and miR-127 precursor hairpin structure sequences as a query, we searched the genome databases of seven other species, including human, chimpanzee, horse, dog, monkey, rat, and cow. [score:1]
The promoters of miR-433 and miR-127 from human, rat and dog were cloned into a pGL3 basic vector, respectively. [score:1]
Although the miR-433/127 gene loci was located on different chromosomes in different species, the distance between miR-433 and miR-127 is very similar, which is ∼1 kb. [score:1]
The 4.5 kb genomic sequences centered miR-433 and miR-127 were extracted. [score:1]
Representative common TF binding motifs (1°∼4°) are shown, and their positions appear to be conserved in the promoter region of miR-433 and of miR-127 among different species. [score:1]
Predicted ERRE sites on the miR-433 and miR-127 gene promoters. [score:1]
Promoter analysis of miR-433 and miR-127 luciferase reporters of human, rat and dog. [score:1]
Why is the miR-433 and miR-127 overlapping gene structure in mammalian species so conserved? [score:1]
0007829.g003 Figure 3 The response elements of the miR-433 and miR-127 genes from eight different species are illustrated. [score:1]
Conserved Transcription Factor Binding Motifs in the Upstream Region of miR-433 and of miR-127 among Mammalian Species. [score:1]
Finally, the long DNA fragments containing human, rat or dog miR-433 and miR-127 loci were inserted into Asc I and Pac I sites of pMIR-REPORT-NoMp. [score:1]
We used MatInspector of Genomatix Software Suite to identify transcription factor binding motifs and position preference in the upstream promoter regions of miR-433 and of miR-127 in eight mammalian species. [score:1]
We found that miR-433 and miR-127 had almost identical PCR amplification efficiency (Supplementary Material Table S4). [score:1]
Conserved response elements in the promoters of miR-433 and miR-127 of eight mammalian species. [score:1]
Semi-Quantitative RT-PCR for miR-433 and miR-127 Primary Transcripts. [score:1]
Based on the above gene structure analysis and sequence prediction referenced from our published mouse data [3], [4], we hypothesized that the genomic location of promoters of miR-433 and miR-127 was similar in other mammalian species as in mouse. [score:1]
In the present study, we analyzed genes encoding miR-433 and miR-127 and determined the promoter transactivation of miR-433 and miR-127 from other mammalian species, including humans. [score:1]
To further confirm this result, the direct association of ERRγ with miR-433 and miR-127 promoters of each species in vivo was assessed using ChIP assays. [score:1]
The lowest evolutionary distance between cow and other species is 0.10114 and the sequence homology is low, based on the sequence alignment of the miR-127 promoter region (Figure 2b). [score:1]
miR-127 pro. [score:1]
The sequence similarity in either the miR-433 promoter region (Figure 2a) or the genomic region between pre-miR-433 and pre-miR-127 (Figure 2b) was low among the eight species. [score:1]
We cloned the promoters of miR-433 and miR-127 into pGL3 luciferase reporters using genomic DNAs isolated from liver specimens of human, rat and dog. [score:1]
The conservation of pre-miR-433 and pre-miR-127 hairpin sequences as well as the distance between them among different mammalian species raised the possibility that miR-433 and miR-127 might be evolved from the same DNA origin during evolution. [score:1]
Multiple sequence alignment (MSA) of miR-433 and miR-127 precursor hairpin sequences in eight mammalian species. [score:1]
Despite lower sequence similarity, analysis of miR-433 and miR-127 promoters of those species predicted common nuclear receptor binding sites, including ERRE (Figure 3 and Table 1). [score:1]
Unique potential binding motifs were also identified in the promoter region of miR-433 and of miR-127 in each species. [score:1]
[1 to 20 of 92 sentences]
5
[+] score: 167
Quantitative RT-PCR results showed that the expression of miR-433 and miR-127 was consistently increased in two situations (Figure 1e): for the 5-Aza-CdR treatment, the expression of miRNA was up-regulated in HGC-27 (5-Aza-CdR 0.6μmol/L; 3.74-fold for miR-433 and 3.02-fold for miR-127) and MGC-803 (5-Aza-CdR 1.5 μmol/L; 2.07-fold for miR-433 and 2.25-fold for miR-127) compared with DMSO control group; for the 5-Aza-CdR and TSA combination treatment, the expression of miR-433 is much higher in HGC-27 (5-Aza-CdR 0.6 μmol/L; 1.98-fold for miR-433 and 1.33-fold for miR-127) and MGC-803 (5-Aza-CdR 1.5 μmol/L; 1.43-fold for miR-433 and 1.45-fold for miR-127) compared with TSA control group. [score:8]
In an attempt to reveal the underlining mechanisms regulating both miR-433 and miR-127 expression in GC cells, the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (5-Aza-CdR) and histone-deacetylase inhibitor trichostatin A (TSA) were used to detect whether the miR-433~miR-127 locus was epigenetically modified in GC. [score:8]
The silenced expression of miR-433 and miR-127 in HGC-27 and MGC-803 cells was restored by the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (5-Aza-CdR) and histone-deacetylase inhibitor trichostatin A (TSA) treatment, suggesting the epigenetic regulation of this miRNA cluster in GC cells. [score:8]
These results suggested that the miR-433~miR-127 cluster function as tumor suppressor miRNAs in GC and provided potential therapy strategy for GC patients by targeting miRNA expression. [score:7]
In conclusion, expression and functional studies suggest that both miR-433 and miR-127 have tumor suppressive function in GC via targeting MAPK4 and KRAS respectively. [score:7]
Over-Expression of miR-433 and miR-127 in GC Cells Inhibits Cell Migration and Invasion. [score:5]
The examination of miR-433 and miR-127 expression in four GC cell lines (HGC-27, MGC-803, MKN-45 and SGC-7901) also indicated the down-regulation when compared to non-tumor tissues (Figure 1d). [score:5]
The tumor suppressor roles of miR-433 and miR-127 in GC cells were mediated by inhibition of KRAS and MAPK4, respectively. [score:5]
Furthermore, the restored miR-433 and miR-127 expression upon miRNA mimics transfection inhibited cell proliferation, cell cycle and migration in HGC-27 cell. [score:5]
In agreement with the reduced expression of target proteins, decreased cell proliferation (Figure 4e), accompanied by decreased cell invasion (Figure 4f) were also observed in HGC-27 cells transfected with miR-127 mimic following treatment of pcDNA-MAPK4 construct. [score:5]
In the present study, we showed that the restored expression of miR-433 and miR-127 in GC cell line HGC-27 resulted in reduced cell proliferation and inhibition of cell cycle progression. [score:5]
Here, we analyzed the expression level of miR-433 and miR-127 in 86 paired GC tissues and adjacent normal tissues, and demonstrated that miR-433 and miR-127 were both down-regulated in GC tissues compared with normal control, as well as in GC cell lines HGC-27, MGC-803, MKN-45 and SGC-7901. [score:5]
MiR-127 Suppresses the Expression of MAPK4 in GC Cells. [score:4]
MiR-433 and miR-127 Were Down-Regulated in GC Patients and GC Cell Lines. [score:4]
The introduction of miR-433 and miR-127 inhibited HGC-27 cell migration in wound healing assays, and suppressed cell invasion in transwell analysis, further confirming their association with the degree of GC malignance. [score:4]
In addition, restored expression of miR-433 and miR-127 dramatically inhibited the normally strong invasive capacity of HGC-27 cells as indicated in the transwell invasion assay (Figure 3d). [score:4]
Thus, we conclude that the repression of cell growth by miR-127 is typically the consequence of decreased MAPK4 expression in GC. [score:3]
A recent report has indicated the decreased expression of miR-127 in hepatocellular carcinoma [9]. [score:3]
To further study the relationship between miR-433/miR-127 expression and clinicopathological factors, the level of miR-433/miR-127 in GC tissues (including fully clinical information) were statistically analyzed (non-parametric test). [score:3]
These two miRNA genes are expressed from distinct primary miRNAs (pri-miR-433 and pri-miR-127) encoded by the miR-433-127 locus [8]. [score:3]
The restored expression of miR-433 and miR-127 in HGC-27 and MGC-803 cells upon 5-Aza-CdR treatment indicated the hyper-DNA methylation on miR-433 and miR-127 locus in GC. [score:3]
Similarly, MAPK4 was selected as the potential target of miR-127 for further assess (Figure 4a). [score:3]
Increased miR-433 and miR-127 Inhibits Cell Proliferation and Cell Cycle Progression of GC Cells. [score:3]
Taken together, these results indicated that miR-433 and miR-127 can efficiently inhibited tumor cell proliferation and cell cycle in vitro. [score:3]
These data suggest that alterations of miR-433 and miR-127 expression might be involved in gastric cancer progression. [score:3]
In these genes, the v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) harboring miR-433 binding site and the mitogen-activated protein kinase 4 (MAPK4) harboring miR-127 binding site were regarded as potential target genes for miR-433 and miR-127 respectively. [score:3]
Enforced expression of miR-433 and miR-127 led to significant decrease in cell proliferation in HGC-27 cells (Figure 2b). [score:3]
The remarkable reduction of miR-433 and miR-127 expression in GC patients promotes us to explore the possible biological significance of these miRNAs in tumorigenesis. [score:3]
Our experiments also documented the lower expression of miR-433 and miR-127 was associated with higher grade and later stage tumors. [score:3]
Expression levels of miR-433 and miR-127 were much lower in tumor than in non-tumor tissues (Figure 1a,b). [score:3]
The lower level expression of miR-127 was associated with pM stage (p = 0.009, metastasis vs. [score:3]
As expected, both reporter assays and immunoblotting analysis showed the repression of miR-127 on MAPK4 3′UTRs, suggesting the direct inhibition of MAPK4 by miR-127 in GC cells (Figure 4b,c). [score:3]
These results were consistent with the above findings that the expression of miR-433 and miR-127 were much lower in GC patients with more malignant degree. [score:3]
Since miR-127 and miR-433 are commonly regulated by nuclear receptor signaling [28, 29], and our study showed that both miR-127 and miR-433 have similar function in GC cell growth and invasion, the clustered miR-127 and miR-433 may work in combination to reinforce their function. [score:2]
These results indicated that the dysregulation of miR-433 and miR-127 in GC may be restricted to the hypermethylation of CpG-rich regions in their genomic locus. [score:2]
In this study, we analyzed the expression of miR-443 and miR-127 in 86 GC patients and found that both of the two miRNAs were much lower in GC tissues compared with adjacent controls. [score:2]
HGC-27 cells in 6-well plates were first transfected with miR-127 mimic or scramble (30 nM). [score:1]
MiR-433 and miR-127 are derived from an overlapping gene locus highly conserved among different mammalian species. [score:1]
However, the potential roles of miR-433 and miR-127 in GC have largely undefined. [score:1]
Although miR-433 and miR-127 has been reported closely related to colorectal cancer, breast cancer, lung adenocarcinoma, esophageal squamous cell carcinoma, their function in gastric cancer remains to be determined. [score:1]
To study the relevance of miR-433/miR-127 level and GC cell growth, miRNA mimics or scramble were used to transfect into HGC-27 cells. [score:1]
Therefore, the introduction of miR-433 and miR-127 into HGC-27 cells resulted in a significant reduction of cell migration during the closing of an artificial wound created over a confluent monolayer (Figure 3b,c). [score:1]
Next, we adapted a “rescue” strategy in order to examine the functional relevance of the miR-127/MAPK4 interaction in GC cells. [score:1]
Quantitative RT-PCR analysis showed that the miRNA mimic treatment led to more than 100-fold increase of miR-433 and miR-127 level in HGC-27 cells (Figure 3a). [score:1]
no metastssis), and lower level of miR-127 was associated with pTNM stage (p = 0.009, stage II vs. [score:1]
To evaluate the expression of miR-433 and miR-127, quantitative RT-PCR analysis was performed in 86 pairs of clinic GC tissue and matched adjacent normal tissue samples. [score:1]
The level of MAPK4 was reduced when miR-127 mimic were transfected after 24 h treatment of pcDNA-MAPK4 (Figure 4d). [score:1]
A previous study has indicated the association of miR-127 with methylation in GC [13]. [score:1]
After 24 h in culture, these H cells were then co -transfected with either miR-127 mimic (30 nM) and 2.0 μg pCDNA-MAPK4 or pCDNA empty vector. [score:1]
On the other hand, metastasis is the major cause of morbidity and mortality from GC patients, therefore we subsequently detect the affects of miR-433 and miR-127 on cell migration and invasion. [score:1]
Given that miR-433 and miR-127 display close association with metastasis and malignant degree of tumor, we proposed that these two miRNAs may play an extremely important role in GC migration and invasion. [score:1]
However, the alone treatment of TSA and the combinational treatment of 5-Aza-CdR and TSA didn’t affect the level of miR-433 and miR-127 in both cell lines. [score:1]
Our results suggested that miR-127 could affect tumor migration and invasion through MAPK4 in highly differentiated GC. [score:1]
These results allow us to speculate that the silencing of miR-433 and miR-127 may provide a survival advantage to GC cells. [score:1]
To further investigate the mechanism of miR-433 and miR-127 in GC, we predicted miRNA targets by various computer-aided algorithms. [score:1]
The intracellular level of miR-433 and miR-127 was about 40-fold and 60-fold higher in HGC-27 cells treated with miRNA mimics than scramble, respectively (Figure 2a). [score:1]
Accordingly, the percentage of S phase cells was also reduced by ~17% and ~16% in HGC-27 cells treated with miR-433 mimic and miR-127 mimic respectively (Figure 2c). [score:1]
[1 to 20 of 57 sentences]
6
[+] score: 165
Other miRNAs from this paper: mmu-mir-127
It has been reported that BCL6 (B-cell CLL/lymphoma 6) is an miR-127 target in cancer cells 13, 23, 31 whose expression is upregulated during myogenic differentiation in C2C12 cells, [32] suggesting that miR-127 might promote myogenic differentiation by targeting BCL6. [score:10]
However, our data did not support this possibility, as evidenced by the observations that BCL6 mRNA levels were not reduced in miR-127-OE muscle (Figure 4a) and expression of the BCL6 gene was upregulated during C2C12 cell differentiation (Figure 4b), an expression pattern similar to that of miR-127 (Figure 1b). [score:8]
Mechanistically, we further provide evidence that miR-127 enhances SC differentiation by directly targeting the gene encoding S1PR3, a G-protein-coupled receptor for the bioactive sphingolipid S1P (sphingosine-1-phosphate), which is an important regulator of skeletal muscle function. [score:5]
Interestingly, miR-127 was significantly upregulated in response to the induction of myogenic differentiation in both the C2C12 mouse myoblast cell line (Figure 1b and Supplementary Figure S1) and primary mouse myoblasts (Figure 1c) as reported very recently, [27] indicating a functional role of miR-127 in regulating myogenic cell differentiation. [score:5]
These findings suggest that miR-127 may be a potential therapeutic target in the treatment of human muscular diseases. [score:5]
11, 33 S1PR3, which contains a putative miR-127 binding site in its 3′-untranslated region (3′-UTR) (Figure 4c), was ranked 75 out of more than 10 000 targets of miR-127 predicted by the analysis tool, miRWalk. [score:5]
11, 33 S1PR3, which contains a putative miR-127 binding site in its 3′-untranslated region (3′-UTR) (Figure 4c), was ranked 75 out of more than 10 000 targets of miR-127 predicted by the analysis tool, miRWalk. [score:5]
[33] To confirm directly the functional correlation between miR-127 and S1PR3, we overexpressed S1PR3 in C2C12 cells stably OE miR-127 (Figure 6a). [score:4]
Consistent with this, both mRNA (Figure 4f) and protein (Figure 4g) levels of S1PR3 were also lower in the skeletal muscle of miR-127 TG mice than WT mice, indicating that miR-127 directly targets SIPR3 both in vitro and in vivo. [score:4]
[33] Interestingly, we found that the expression pattern of endogenous S1PR3 during muscle regeneration (Figure 4h) was opposite that of miR-127 (Figure 4i), suggesting that miR-127 regulates myogenic differentiation by modulating S1PR3 function. [score:4]
These results indicate that miR-127 directly targets S1PR3. [score:4]
Collectively, these results demonstrate that miR-127 functionally regulates myogenic differentiation by targeting S1PR3. [score:4]
We then further predicted functional targets of miR-127 using computational and bioinformatics -based approaches. [score:3]
miR-127 was overexpressed ~4.5-fold in the skeletal muscle of mdx;miR-127 mice (Figure 7a). [score:3]
Overexpression of miR-127 in the TG mice was driven by the β-actin promoter (pCAGGS). [score:3]
To experimentally validate that S1PR3 is a target of miR-127, we generated luciferase reporter constructs carrying the 3′-UTR sequence of WT S1PR3 (WT-UTR) and a mutant form (mut-3′-UTR) harboring substitutions in the miR-127 binding sites in the 3′-UTR. [score:3]
29, 30 Although miR-127 expression in the skeletal muscle was increased 2.5-fold in the F line (Figure 2a) and 14-fold in the C line (Figure 2b), we did not observe significant difference in bodyweight (Figure 2c), muscle mass (Figure 2d) or fiber size (Figures 2e and f) between either line miR-127 TG mice and wild-type (WT) mice at the indicated ages. [score:3]
Among the predicted miR-127 targets, S1PR3 (sphingosine-1-phosphate receptor 3) seemed particularly interesting because of its previously reported roles in muscle differentiation and regeneration. [score:3]
Taken together, our data indicate that miR-127 overexpression significantly reduces the dystrophic muscle pathology in mdx mice by improving sarcolemmal integrity, despite the absence of obvious alterations in the cross-sectional area of myofibers in mdx;miR-127 mice (Figure 7h). [score:3]
miR-127 augments myogenic differentiation by targeting S1PR3. [score:3]
As shown in Figure 1a and consistent with published data, 26, 27 we found that miR-127 is predominantly expressed in the skeletal muscle and the brain. [score:3]
Similar effects were also observed for MHC immunoreactivity (Figure 6e), fusion index (Figure 6f) and levels of MHC mRNA (Figure 6g), demonstrating that S1PR3 overexpression abolishes the miR-127 -mediated enhancement of muscle cell differentiation. [score:3]
Taken together, these findings show that miR-127 overexpression morphologically and functionally improves the dystrophic phenotype of mdx mice. [score:3]
To further establish a functional link between miR-127 and S1PR3, we first examined the expression of endogenous S1PR3 in miR-127 OE C2C12 cells and in thr skeletal muscle of miR-127 TG mice. [score:3]
[33] In this report, we identified S1PR3 as a functional target of miR-127. [score:3]
As expected, miR-127 expression was higher in primary myoblasts isolated from miR-127 TG mice than in those from WT mice (Figure 3f). [score:3]
Very recently, Li et al. [27] described a dynamic expression of miRNA-127-3p in proliferating and differentiating C2C12 cells as we reported here. [score:3]
To overexpress S1PR3, miR-127-stable cell or control cells were transfected with 1.6 ng pcDNA 3.0-S1PR3 plasmids per 12-plate well by using the FuGene HD transfection reagent (Roche, Basel, Switzerland). [score:3]
Overexpression of S1PR3 significantly blocked miR-127 -mediated myogenic differentiation. [score:3]
For this purpose, we generated two miR-127 TG mice lines (C line and F line), in which miR-127 overexpression was driven by the β-actin promoter. [score:3]
Notably, overexpression of miR-127 also considerably improved the muscular dystrophy phenotype in mdx mice by enhancing SC differentiation. [score:3]
Moreover, miR-127 overexpression significantly ameliorates muscular dystrophy symptoms in mdx mice. [score:3]
The expression of miR-127 was ~25-fold higher in miR-127 OE cells compared with that in NC cells (Figure 1d). [score:2]
To investigate directly the impact of miR-127 on myogenic cell differentiation, we established C2C12 cell lines stably overexpressing (OE) miR-127 or the empty vector as a negative control (NC). [score:2]
The expression levels of mature miRNAs miR-127-3p were determined using the miRNA-specific TaqMan microRNA Assay Kit (Applied Biosystems, CA, USA), U6 was used as a normalizer. [score:2]
C2C12 cell lines stably OE miR-127 were established by infection with lentivirus containing H1-miR-127-CMV-puromycin (Genechem, Shanghai, China). [score:1]
miR-127 transgenic mice in a C57BL/6 background were generated by the Mo del Animal Research Center of Nanjing University. [score:1]
These results indicate that miR-127 significantly potentiates myogenic cell differentiation in vitro. [score:1]
To this end, we generated mdx mice OE miR-127 (mdx;miR-127) and used them to assess the ability of miR-127 to alleviate symptoms of muscular dystrophy. [score:1]
Next, we assessed the functional role of miR-127 in mediating skeletal muscle regeneration. [score:1]
MyoG [+] cells were less numerous among C2C12 cells OE both miR-127 and S1PR3 (Figures 6b and c), and the level of MyoG mRNA in these cells was lower than that in cells stably OE only miR-127 (Figure 6d). [score:1]
As shown in Figure 4d, co-transfection of miR-127 mimics decreased the luciferase activity of WT-UTR, but not that of mut-3′-UTR. [score:1]
Immunostaining for the early myogenic differentiation marker myogenin (MyoG) revealed significantly increased the number of differentiating cells in miR-127 OE cultures than in NC cultures following induction of differentiation (Figures 1e and f). [score:1]
miR-127 attenuates the dystrophic phenotype of mdx miceGiven that miR-127 accelerates muscle regeneration in mice, we reasoned that miR-127 might reduce the muscular dystrophy phenotype in mdx mice. [score:1]
miR-127-3p probes were labeled with γ- [32]P-ATP using T4 DNA kinase (Fermentas, Thermo Scientific, Waltham, MA, USA). [score:1]
Cells plated in 24-well plates were co -transfected with pGL3-S1PR3-3′-UTR and miR-127 mimics (triplicates for each transfection). [score:1]
The control pGL-3 construct was insensitive to miR-127. [score:1]
The functional role of miR-127 in promoting myogenic cell differentiation was further validated using primary myoblasts isolated from hindlimb skeletal muscles of miR-127 TG and WT mice. [score:1]
Notably, the running time of mdx;miR-127 mice was remarkably longer than that of mdx mice (Figure 7i). [score:1]
miR-127 attenuates the dystrophic phenotype of mdx mice. [score:1]
The ability of miR-127 to enhance C2C12 cell differentiation in vitro prompted us to investigate its functional role in regulating skeletal muscle development and regeneration in vivo. [score:1]
Taken together, these findings reveal a significant role of miR-127 in promoting myogenic differentiation, both in vitro and in vivo. [score:1]
Consistent with the MyoG staining results, levels of MyoG mRNA (Figure 1g) and protein (Figure 1h) were also significantly increased in miR-127 OE cells relative to NC cells. [score:1]
To this end, we injured tibialis anterior (TA) muscles from miR-127 TG and WT mice using cardiotoxin (CTX) as described previously. [score:1]
[16] To assess directly the functional role of miR-127 in regulating SC differentiation during regeneration, we measured the size of regenerating myofibers 7.5 days postinjury. [score:1]
The ability of miR-127 to stimulate C2C12 cell differentiation is further supported by the observed increase in myosin heavy chain (MHC) immunoreactivity (Figure 1i) and fusion index (Figure 1j), and higher levels of MHC mRNA (Figure 1k) and protein (Figure 1l) in miR-127 OE cells. [score:1]
Given that miR-127 accelerates muscle regeneration in mice, we reasoned that miR-127 might reduce the muscular dystrophy phenotype in mdx mice. [score:1]
mdx;miR-127 mice were generated by breeding miR-127 transgenic male mice with homozygous mdx/mdx female mice. [score:1]
Interestingly, levels of serum CK were significantly lower in mdx;miR-127 mice than in mdx mice (Figure 7c). [score:1]
miR-127 enhances C2C12 cell differentiation. [score:1]
EDL muscles from mdx;miR-127 mice exhibited a greater peak twitch force (Figure 7j) and a 1.5-fold increase in the peak tetanic force (Figure 7k) than those from mdx mice. [score:1]
[39] Therefore, modulating the levels of the metabolite, S1P, or manipulating its receptor, S1PR3, by miR-127 would represent a potential therapeutic strategy for muscular dystrophy. [score:1]
Collectively, this morphological and molecular evidence revealed that myogenic differentiation was significantly accelerated in miR-127 TG mice undergoing muscle regeneration. [score:1]
miR-127 accelerates skeletal muscle regeneration by promoting SC differentiation. [score:1]
In the context of CTX -induced muscle regeneration, miR-127 transgenic mice exhibited a phenotype similar to that observed in S1PR3 -null mice. [score:1]
As a consequence, S1PR3 mRNA levels were significantly reduced in the skeletal muscle of mdx;miR-127 mice relative to those in mdx mice (Figure 7b). [score:1]
We found that S1PR3 mRNA levels were decreased in miR-127 OE cells (Figure 4e). [score:1]
Additionally, we found no significant difference in Pax7 -positive (Pax7 [+]) SC numbers between WT and miR-127 TG mice (Figures 2g and h). [score:1]
The gender- and age-matched littermates of the miR-127 TG and WT mice were used for all phenotypic analysis throughout the study. [score:1]
Next, we investigated the molecular mechanism underlying the function of miR-127 in promoting myogenic cell differentiation by identifying its targets. [score:1]
Using transgenic mouse mo dels in this study, we further demonstrate that miR-127 accelerates skeletal muscle regeneration in mice. [score:1]
[1 to 20 of 71 sentences]
7
[+] score: 151
This study also shows that miR-127-5p is down regulated in the OA patients, and miR-127-5p targets the 3′UTR of OPN mRNA to down-regulate the expression of OPN. [score:9]
In conclusion, this study identified that miR-127-5p targets the 3′UTR of OPN mRNA to down-regulate the expression of OPN. [score:8]
miR-127-5p mimics transfection significantly promoted expression of miR-127-5p compared the controls (Fig. 2A), while miR-127-5p inhibitor inhibited expression of miR-127-5p (Fig. 2B). [score:8]
Summarily, OA patients have alterations in expression of miRNAs and OPN, and miR-127-5p may inhibit expression of OPN. [score:7]
Taken together, miR-127-5p inhibits expression of OPN, and OPN mRNA is a downstream target of miR-127-5p. [score:7]
As far as we known, this is the first study show miR-127-5p directly targets OPN to regulate expression of OPN in OA. [score:7]
Collectively, miR-127-5p inhibits proliferation of chondrocytes by targeting expression of OPN. [score:7]
More importantly, we have shown miR-127-5p regulates proliferation of chondrocytes through targeting expression of OPN. [score:6]
We tested the hypothesis that miR-127-5p directly influences OPN expression by transfecting a miR-127-5p mimics or inhibitor into the chondrocytes and then detecting protein abundance of OPN. [score:6]
Besides miRNA 181a, miR-220b, miR-513a-3p, miR-181b, miR-181c, miR-181d, miR-548n and miR-127-5p, are also predicted to target and regulate the expression of OPN. [score:6]
In OA, the down-expressed miR-127-5p allows the expression of OPN, which mediates the establishment and development of OA. [score:6]
We co -transfected the miR-127-5p inhibitor and wild-type 3′-UTR reporter vector into chondrocytes, which demonstrated the luciferase activity was significantly increased in the presence of the miR-127-5p inhibitor (Fig. 2G). [score:5]
miR-127-5p inhibits OPN expression. [score:5]
Notably, spearman’s correlation analysis shown that there was a significant negative correlation between expression of miR-127-5p and mRNA expression of OPN (r = −0.723, P = 0.001) (Fig. 1D). [score:5]
To further confirm that OPN is a functional target of miR-127-5p, we rescued the expression of OPN by the transfecting the pcDNA3.1-OPN in chondrocytes, which increased protein abundance of OPN in chondrocytes (Fig. 3B). [score:5]
To directly test the hypothesis that OPN is a downstream target of miR-127-5p, OPN wild-type/mutant 3′-UTRs containing the putative miR-127-5p binding sites were cloned into the psi-CHECK2 reporter vector downstream of the Photinus pyralis/Renila reniformis dual luciferase reporter gene (Fig. 2E). [score:4]
OA patients have higher expression of miR-220b, miR-513a-3p and miR-548n, but lower expression of miR-181a, miR-181b, miR-181c, miR-181d and miR-127-5p, compared to non-OA patients (Fig. 1A). [score:4]
miR-127-5p targets the 3′UTR of β-F1-ATPase mRNA (β-mRNA), which is a catalytic subunit of mitochondrial H(+)-ATP synthase and functions in the provision of metabolic energy by oxidative phosphorylation 41. [score:3]
miR-127-5p inhibits proliferation of chondrocytes though OPN. [score:3]
Mi-C: miR-127-5p mimics control; I-C: miR-127-5p inhibitor control. [score:3]
As OPN increased in the pathogenesis of OA 32, we focused on the down-expressed miRNA, including miR-181a, miR-181b, miR-181c, miR-181d and miR-127-5p. [score:3]
miR-127-5p mimics significantly reduced proliferation of chondrocytes, while miR-127-5p inhibitor promoted proliferation of chondrocytes (Fig. 3E,F). [score:3]
The miR-127-5p mimics, inhibitors and their negative controls (NC) were purchased from Promega (USA). [score:3]
OPN: osteopontin; PI3K: phosphatidylinositide 3-kinases; Mi-C: miR-127-5p mimics control; I-C: miR-127-5p inhibitor control. [score:3]
How to cite this article: Tu, M. et al. MicroRNA-127-5p regulates osteopontin expression and osteopontin -mediated proliferation of human chondrocytes. [score:3]
Furthermore, although miR-127-5p mimics significantly inhibited the activation of phosphatidylinositide 3-kinase (PI3K)-Akt pathway, pcDNA3.1-OPN rescued the activation of PI3K-Akt pathway (Fig. 3I). [score:3]
Chondrocytes were transfected with psiCHECK-2-OPN-wt, psiCHECK-2-OPN-mut, miR-127-5p mimics, miR-127-5p inhibitor or its control using Lipofectamine 2000 reagent. [score:3]
Notably, miR-127-5p is an important regulator of MMP-13 in human chondrocytes and contributes to the development of OA 42. [score:3]
Similarly, spearman’s correlation analysis shown that there was a significant negative correlation between expression of miR-127-5p and protein abundance of OPN (r = −0.69, P < 0.05) (Fig. 1E). [score:3]
In total, eight potential regulatory miRNAs, including miR-220b, miR-513a-3p, miR-181a, miR-181b, miR-181c, miR-181d, miR-548n and miR-127-5p, were identified by the five algorithms. [score:2]
Thus, it is fruitful to use miR-127-5p to manipulate the establishment and development of OA. [score:2]
miR-127-5p mimics significantly reduced protein abundance of OPN in the chondrocytes (Fig. 2C), while miR-127-5p inhibitor increased protein abundance of OPN (Fig. 2D), compared to the controls. [score:2]
Thus, this study mainly focused on the miR-127-5p. [score:1]
Although miR-127-5p mimics significantly decreased proliferation of chondrocytes, pcDNA3.1-OPN rescued proliferation of chondrocytes (Fig. 3G,H). [score:1]
The 3′-UTR sequence of OPN (TCC CTG TAA ACT AAA AGC TTC AG) containing the putative miR-127-5p binding site were synthesized by Invitrogen (USA). [score:1]
Chondrocytes co -transfected with the wild-type 3′-UTR reporter vector and the miR-127-5p mimics showed a significant reduction in luciferase activity, whereas the luciferase activity in the cells transfected with the mutant-type 3′-UTR vector was unaffected by the miR-127-5p mimics (Fig. 2F). [score:1]
[1 to 20 of 36 sentences]
8
[+] score: 106
Other miRNAs from this paper: hsa-mir-101-1, hsa-mir-101-2
Our results implicate NEFA -induced miR-127-5p expression in suppressing muscle β-F1-ATPase translation in obesity, despite an increase in β-F1-ATPase mRNA expression in the obese subjects. [score:9]
miR-127-5p targets the 3'UTR of human beta-F1-ATPase mRNA and inhibits its translation. [score:7]
More specifically, miR-101-3p and miR-127-5p target the β-F1-ATPase mRNA and inhibit translation without affecting mRNA content. [score:7]
Treatment with the inhibitor did not alter either miR-127-5p expression (F [(3,20)] = 0.09398; P = 0.9625) or ATP5B mRNA expression (F [(3,20)] = 0.08332; P = 9683) (Fig 5C). [score:7]
There was also a significant effect of miR-127-5p inhibition on β-F1-ATPase translation efficiency (F [(3,20)] = 4.941; P = 0.01; Fig 5E). [score:5]
These findings illustrate a gene-environment interaction that may be a key mechanism sustaining the increased miR-127-5p expression and subsequently decreased β-F1-ATPase translation in obesity. [score:5]
Exposure to a miR-127-5p inhibitor dose dependently increased β-F1-ATPase protein expression (Fig 5D). [score:5]
To determine the role of miR-127-5p in controlling β-F1-ATPase translation, primary myotubes from an obese individual were exposed to graded concentrations of a miR-127-5p inhibitor. [score:5]
S4 Fig(A) Both miR-101-3p (left) and miR-127-5p (right) can regulate β-F1-ATPase protein translation (microrna. [score:4]
There was a significant 1.50±0.01 fold increase in miR-127-5p expression (t [(11)] = 3.551; P<0.01) in skeletal muscle of obese individuals compared to lean controls (Fig 5A), but no difference in miR-101-3p expression (t [(11)] = 1.273; P = 0.1160). [score:4]
0160057.g005 Fig 5(A) Expression of miR-127-5p (left) and miR-101-3p (right) were quantified in lean (n = 6) and obese (n = 6) subjects. [score:3]
The 1kB region adjacent to the TSS of miR-127-5p contains four CpG islands, which may be responsible for sustaining expression of the miRNA. [score:3]
The expression of miR-127-5p in exosomes significantly correlated with skeletal muscle miR-127-5p content (r = 0.9184; P<0.001). [score:3]
Furthermore, we found that exosomes extracted from the media of the primary myotube cultures also expressed miR-127-5p (S7E Fig), further supporting a link between exosomal miR-127-5p and muscle miRNA. [score:3]
The expression of miR-127-5p negatively correlated with (r = -0.6744; P<0.01). [score:3]
0160057.g006 Fig 6The 1kB region adjacent to the TSS of miR-127-5p contains four CpG islands, which may be responsible for sustaining expression of the miRNA. [score:3]
S5 Fig A schematic diagram of the CpG islands of the 1 kb region for The 1kB region adjacent to the TSS of miR-127-5p contains four CpG islands, which may be responsible for sustaining expression of the miRNA. [score:3]
Inhibition of miR-127-5p experiments and exosome isolation. [score:3]
To expand upon potential clinical applicability of these findings, exosomes extracted from patient sera collected at the time of the muscle biopsies were analyzed to determine whether miR-127-5p is present in exosomes and the degree of correlation with skeletal muscle miR-127-5p expression. [score:3]
Alexa Fluor-488 conjugated locked nucleic acid (LNA) oligos were used to inhibit miR-127-5p in primary myotubes from an obese subject. [score:3]
S8 FigGenetic and epigenetic factors unmask transcription of miR-127-5p, which can then bind to the 3’ UTR of the ATP5B mRNA and block ribosomal translation machinery from accessing the transcript. [score:3]
Hypomethylation of the miR-127-5p control region emerged as an epigenetic mechanism contributing to the chronicity of reduced muscle β-F1-ATPase translation in obesity. [score:3]
Details of the experiments for the inhibition of miR-127-5p, as well as the procedures used for the isolation of exosomes in serum are provided in the S1 Appendix. [score:3]
Both miR-101-3p and miR-127-5p have been reported to regulate β-F1-ATPase translation [19, 23], and were investigated in the present study as putative intermediates (S4A Fig). [score:2]
Upon further analysis of miR-127-5p expression in the exosomes, we found a significant 2.547±0.4609 fold increase (t [(11)] = 2.934; P<0.01) in obese subjects compared to lean controls (Fig 6C). [score:2]
As an extension of the present study, the quantification of miR-127-5p in plasma exosomes provides a viable marker of β-F1-ATPase metabolism. [score:1]
Analysis of the small RNAs present in the exosomes revealed the presence of miR-127-5p (S7C Fig). [score:1]
Analysis of the miR-127-5p promoter region. [score:1]
In primary myotubes exposed to NEFA from lean and obese subjects, there was significantly increased expression of miR-127-5p with Obese NEFA treatment when compared to VEH and the two Lean NEFA treatments (F [(3,20)] = 4.919; P = 0.0102), but no difference in Lean NEFA or Lean NEFA [(P)] treatments when compared to VEH (Fig 5B). [score:1]
miR-127-5p. [score:1]
[1 to 20 of 30 sentences]
9
[+] score: 76
Ssc-miR-103 and ssc-miR-107 expression was slightly lower in premolars (Dpm) than in other types of teeth, ssc-miR-133a and ssc-miR-133b expression was much higher in Dpm than in other types of teeth, and ssc-miR-127 expression gradually increased from the incisor (Di) to the molar (Dm)In order to detect the oral developmental specificity of the five selected miRNAs, we further extracted kidney, liver and submandibular gland to contrast the five miRNAs expression (Fig.   5). [score:10]
Ssc-miR-103 and ssc-miR-107 expression was slightly lower in premolars (Dpm) than in other types of teeth, ssc-miR-133a and ssc-miR-133b expression was much higher in Dpm than in other types of teeth, and ssc-miR-127 expression gradually increased from the incisor (Di) to the molar (Dm) In order to detect the oral developmental specificity of the five selected miRNAs, we further extracted kidney, liver and submandibular gland to contrast the five miRNAs expression (Fig.   5). [score:10]
At E50, miR-127 expression in all four types of teeth stayed almost the same, but expression in the premolar was not observed and the expression level was lower and more restricted in the inner enamel epithelium of the molar (E1–E4). [score:7]
We also found that expression levels of ssc-miR-103 and ssc-miR-107 were slightly lower in Dpm than in other types of teeth, ssc-miR-133 a and ssc-miR-133b expression levels were much higher in Dpm than in other types of teeth, and ssc-miR-127 expression increased in Di, Dc, Dpm, and Dm, in that order. [score:7]
At E60, mir-127 expression in the incisor, canine, and premolar increased, while expression decreased in the molar. [score:5]
d Seed sequences and duplexes (boxes) of five isomiR families including 11 miRNAs had high-signal (signal ≥500) miRNA transcripts based on cluster analyses of miRNA expression patterns, thus identifying them as key microRNAs After performing six pairwise comparisons among the subgroups, we added another candidate miRNA, miR-127, which was significantly differentially expressed among Di, Dc, and Dpm (Fig.   3b– c). [score:5]
d Seed sequences and duplexes (boxes) of five isomiR families including 11 miRNAs had high-signal (signal ≥500) miRNA transcripts based on cluster analyses of miRNA expression patterns, thus identifying them as key microRNAsAfter performing six pairwise comparisons among the subgroups, we added another candidate miRNA, miR-127, which was significantly differentially expressed among Di, Dc, and Dpm (Fig.   3b– c). [score:5]
b, c Pairwise comparisons based on cluster analyses revealed anther eight differentially expressed miRNAs between the first deciduous incisor (Di) and the second deciduous premolar (Dpm) (p < 0.01), and one (ssc-miR-127) between the deciduous canine (Dc) and Dpm (p < 0.05) during the three developmental stages. [score:4]
The present study indicated that these five miRNAs, including ssc-miR-103 and ssc-miR-107, ssc-miR-133a and ssc-miR-133b, and ssc-miR-127, may play key regulatory roles in different types of teeth during different stages and thus may play critical roles in tooth morphogenesis during early development in miniature pigs. [score:3]
In combination with our other results, this implies that ssc-miR-127, ssc-miR-103, and ssc-miR-107 may play a regulatory role in the morphogenesis of all kinds of teeth during different developmental stages. [score:3]
Expression levels of five miRNAs (ssc-miR-103, ssc-miR-107, ssc-miR-127, ssc-miR-133a, and ssc-miR-133b) were detected by real-time RT-PCR and microarray chip. [score:3]
Di, first deciduous incisor; Dc, deciduous canine; Dpm, second deciduous premolar; Dm, deciduous molar; E40, embryonic day 40; E50, embryonic day 50; E60, embryonic day 60 Ssc-mir-127 in situ expression reflected the microarray and real-time RT-PCR results (Fig.   6D1–F4). [score:3]
Di, first deciduous incisor; Dc, deciduous canine; Dpm, second deciduous premolar; Dm, deciduous molar; E40, embryonic day 40; E50, embryonic day 50; E60, embryonic day 60Ssc-mir-127 in situ expression reflected the microarray and real-time RT-PCR results (Fig.   6D1–F4). [score:3]
MiR-127 is an important regulator of MMP-13 in human chondrocytes and may contribute to the development of osteoarthritis [21]. [score:2]
For ssc-miR-127, deciduous molar were chose as the reference, the expression level is fairly higher in deciduous molar and submandibular gland compared to that in kidney and liver. [score:2]
Microarray, real-time RT-PCR, and in situ hybridization experiments revealed that ssc-miR-103 and ssc-miR-107, ssc-miR-133a and ssc-miR-133b, and ssc-miR-127 may play more important roles in Di and Dc, Dpm, and Dm, respectively, during different developmental stages. [score:2]
By clustering analysis, we predicted 11 unique miRNA sequences that belong to mir-103 and mir-107, mir-133a and mir-133b, and mir-127 isomiR families. [score:1]
The location of mir-127 was restricted in the inner enamel epithelium of the incisor, canine, and premolar (F1–F4). [score:1]
[1 to 20 of 18 sentences]
10
[+] score: 70
miR-21 was also reported to be up-regulated in squamous cell carcinoma [55] while miR-127, miR-322 and miR-146b are up-regulated during fetal lung development [56], [57]. [score:8]
Lastly, miR-127 was hypothesized to be involved in alveolar septation by inhibiting mRNA translation of specific targets [38]. [score:7]
Five miRNAs, miR-127, miR-21, miR-146b, miR-183, miR-184 were similarly up-regulated in c-Raf transgenic lung and human lung cancer therefore demonstrating clinical relevance of this particular disease mo del. [score:6]
The Affymetrix platform detected only the up-regulation of miR-127 in both female and male c-Raf transgenic mice (log [2] Ratio = 2.57 for females and 1.73 for males), and of miR-433 only in female c-Raf (log [2] Ratio = 2.10). [score:4]
Here miR-127 was highly up-regulated in male, but did not reach statistical significance (borderline at p<0.06; Table 1). [score:4]
Five miRNAs, miR-127, miR-21, miR-146b, miR-183, miR-184 were similarly up-regulated in c-Raf transgenic mouse lung and human lung cancer thus further validating this mo del as relevant for human lung cancer (Figure 7). [score:4]
Hence, much to our surprise, the two platforms correlated at best in identifying miR-127 as up-regulated in male, but not female, transgenic animals (Figure 1C). [score:4]
Differential miRNA expression was examined by quantitative real time PCR (qRT-PCR) of the eight regulated miRNAs (miR-21, miR-96, miR-127, miR-146b, miR-183, miR-184 and miR-322, miR-433). [score:4]
Shown is the expression of miR-21, miR-146b, miR-127, miR-433, miR-96, miR-183, miR-184 and miR-322 in WT and transgenic male and female mice. [score:3]
Specifically, with the Agilent platform a significant regulation of miR-21, miR-96, miR-127, miR-146b, miR-183, miR-184 and miR-322 was observed whereas for the Affymetrix platform significant regulation of miR-127 and miR-433 could only be evidenced. [score:3]
The qPCR results confirmed the significant over -expression of miR-127 and miR-433 in male and female c-Raf mice as identified by the. [score:3]
0078870.g005 Figure 5The 3′UTR sequence alignment of VLC, SLC10A3, MAPK4, GATA3, ANKRD27, IRS1, CRISPLD2 and ARL2 between Mus musculus and Homo sapiens species may possibly suggest conservation of seed sequences targeted by miR-21 (panel A), miR-146b (panel B), miR-127 (panel C), miR-433 (panel D), miR-96 (panel E), miR-183 (panel F), miR-184 (panel G) and miR-322 (panel H), respectively. [score:3]
miR-322, miR-127, and miR-433 are regulated similarly in organ and tumor development. [score:3]
0078870.g002 Figure 2 Shown is the expression of miR-21, miR-146b, miR-127, miR-433, miR-96, miR-183, miR-184 and miR-322 in WT and transgenic male and female mice. [score:3]
The 3′UTR sequence alignment of VLC, SLC10A3, MAPK4, GATA3, ANKRD27, IRS1, CRISPLD2 and ARL2 between Mus musculus and Homo sapiens species may possibly suggest conservation of seed sequences targeted by miR-21 (panel A), miR-146b (panel B), miR-127 (panel C), miR-433 (panel D), miR-96 (panel E), miR-183 (panel F), miR-184 (panel G) and miR-322 (panel H), respectively. [score:3]
Furthermore, miR-433 and miR-127 are within the same locus, and they are co-transcribed and co-regulated by estrogen-related receptors gamma [58]. [score:2]
The dendogram is suggestive for miR127 to be regulated in common when both platforms are compared while a third group of miRNAs is regulated in common amongst male transgenic mice as detected by the Agilent platform. [score:2]
Evidence has also been obtained to suggest a conserved gene structure and transcriptional regulation of miR-433 and miR-127 in mammals and that the miR-433/127 loci may have evolved from a common gene of origin. [score:2]
Prefabricated TaqMan MicroRNA Assays (containing microRNA-specific forward and reverse PCR primers and microRNA-specific Taqman MGB probe) were used to determine expression of miR-21 (ABI P/N 000397), miR-146b-5p (ABI P/N001097), miR-127 (ABI P/N000452), miR-433-3p (ABI P/N001028), miR-322 (ABI P/N001076), miR-184-3p (ABI P/N000485), miR-183 (ABI P/N002269), miR-96 (ABI P/N000186), miR-15a-5p (ABI P/N000389), miR-34a-5p (ABI P/N000426), miR-146a-5p (ABI P/N000468) and miR-182-5p (ABI P/N002599). [score:1]
Similarly, it is not clear why Affymetrix fails to see variations in all but two miRs (-127 and -433), since for example the probe for miR-184 has similar parameters to those for miR-127 and miR-433. [score:1]
[1 to 20 of 20 sentences]
11
[+] score: 56
Colorectal cancer pathway with interaction between significant up-regulated miRNAs, let-7f-5p, miR-455-3p, miR-98, miR-155-5p, and down-regulated miRNAs, miR-1, miR-127-5p, miR-142-5p, miR-202-5p after radiation and SN38 treatments and their target genes. [score:9]
In case of miR-127-5p and miR-142-5p the most notable down-regulation was found in HCT116 [p53+/+] and HCT116 [p53+/−] cells after the treatment, whereas miR-127-5p and miR-142-5p were up-regulated in HCT116 [p53−/−] cells after the radiation treatment. [score:7]
Moreover, from EBarrays, we found miRNAs, such as let-7f-5p, miR-455-3p, miR-98, miR-155-5p, up-regulated to the highest degree and miRNAs, miR-1, miR-127-5p, miR-142-5p, miR-202-5p were down-regulated most, after the radiation and SN38 treatment. [score:7]
Heatmap of four most significant up-regulated miRNA, let-7f-5p, miR-455-3p, miR-98 and miR-155-5p, as well as four most down-regulated miRNA, miR-1, miR-127-5p, miR-142-5p and miR-202-5p after radiation and SN38 treatments, and different pathways by clustering from pathway union. [score:7]
We also found in KM12C and KM12L4a cells with p53 mutation, let-7f-5p, miR-455-3p, miR-98, miR-155-5p and miRNAs were up-regulated, whereas miR-1, miR-127-5p, miR-142-5p and miR-202-5p remained undetected after the radiation and SN38 treatment. [score:5]
The results showed that let-7f-5p, miR-455-3p, miR-98 and miR-155-5p were up-regulated in KM12C (Supplementary Figure S1) and KM12L4a (Supplementary Figure S2) cell lines after radiation and SN38 treatment, whereas miR-1, miR-127-5p, miR-142-5p and miR-202-5p were undetected in KM12C and KM12L4a cell lines after radiation and SN38 treatment. [score:4]
In summary, after radiation and SN38 treatment, we found that most significant up- or down-regulation and interactions of 8 miRNAs (let-7f-5p, miR-455-3p, miR-98, miR-155-5p, miR-1, miR-127-5p, miR-142-5p, miR-202-5p), 7 cytokines (IL-1β, IL-4, IL-6, IL-10, IFN- γ, VEGF, TNF- α) and 2 chemokines (IL-8, MIP-1-α) were dependent on p53 status in colon cancer cells. [score:4]
In miR-127-5p and miR-142-5p the highest degree of down-regulation was found in HCT116 [p53+/+] and HCT116 [p53+/−] cells after the radiation treatment. [score:4]
To validate our results found in HCT116 cells, we further examined the expression of miRNAs, let-7f-5p, miR-455-3p, miR-98, miR-155-5p, miR-1, miR-127-5p, miR-142-5p and miR-202-5p in KM12C and KM12L4a human colon cancer cell lines. [score:3]
The expression level of miR-127-5p is used for determining the likelihood of CRC recurrence [46]. [score:3]
miR-1: An interaction site of miR-1 is reported in IL-10 by DIANA-microT, while TargetScan, PicTar, RNA22, miRanda, and DIANA-microT recognize multiple probable interactions between VEGF and has-miR-1. miR-127-5p: RNA 22 predicts multiple site interaction between miR-127-5p and IL-1beta. [score:3]
[1 to 20 of 11 sentences]
12
[+] score: 48
Four binding sites of hsa-miR-127-3p including SNP-56, −2236, −2611 and −3496 were identified in the 3′ untranslated region of PIK3R1 mRNA, suggesting that single SNPs located at miRNA -binding sites are likely to affect the expression of their targets and might contribute to the pathogenesis of bladder cancer. [score:7]
Thirty eight target genes regulated by miR-127 were identified via five predicted software instruments including TargetScan, PicTar, PITA, miRanda and RNA22. [score:6]
Moreover, a predicted target of miR-127, proto-oncogene BCL6, was down-regulated after treatment with chromatin-modifying drugs [14]. [score:6]
Therefore, we tried to describe miR-127 and its target gene PIK3R1 and their mechanism of action in bladder cancer. [score:3]
Target prediction of miR-127. [score:3]
Our data demonstrate a significant association between miR-127 and its target gene of PIK3R1 via analysis of the CLIP-Seq data, RNA secondary structure and free energy. [score:3]
Figure 3 Venn diagram of 38 target genes of miR-127. [score:3]
Among the remaining five miRNAs, miR-127 is usually differentially expressed as part of a miRNA cluster between normal cells and cancer cells [14]. [score:3]
MiR-127, one of the remaining five miRNAs, is usually differentially expressed as part of a miRNA cluster between normal cells and cancer cells [14]. [score:3]
Given that miR-127 is highly embedded in a CpG island and numerous recent studies have revealed the role of miR-127 in human cancers [14, 26], we tried to focus on the study of target prediction of miR-127. [score:3]
The results indicate that miR-127 plays an important role in regulating PIK3R1 that is involved in both the cancer and bladder cancer pathways. [score:2]
These findings provide new insights into the role of miRNAs in the pathway of cancer and give us a hypothesis that miR-127 might play a similar role in regulation and control of PIK3R1. [score:2]
Hence, we tried to study the functional mechanism of miR-127 in bladder cancer. [score:1]
Of note, nine miRNAs such as hsa-miR-199a*, hsa-miR-143, hsa-miR-127, hsa-miR-30-3p, hsa-miR-221, hsa-miR-21, hsa-miR-101, hsa-miR-129 and hsa-miR-133a were listed (Table  2). [score:1]
Binding sits of hsa-miR-127-3p. [score:1]
We also identify the binding site of miR-127 and PIK3R1 in chromosome 5:67595672-67595693[+] (GRCh37/hg19) via CLIP-Seq datasets in the deepView genome browser (Figure  2). [score:1]
[1 to 20 of 16 sentences]
13
[+] score: 47
Radiation up-regulated miRNA expression levels included let-7g, miR-16, miR-20a, miR-21 and miR-29c, while miR-18a, miR-125a, miR-127, miR-148b, miR-189 and miR-503 were down-regulated. [score:9]
Likewise, we also found that the inhibition of miRNA-127 reduced clonogenic survival (and proliferation; data not shown), suggesting that the anti-endothelial radiation effects are associated with down-regulated miR-127 levels. [score:6]
Another explanation would be that the downregulation of miRNA-127 after radiation is not functionally in line but rather part of a negative feedback mechanism. [score:4]
miR-127 also was found to be down-regulated in irradiated cells. [score:4]
Perhaps the executed signaling pathways are dependent on the expression levels of other parameters suggesting a functional 'switch' role of miRNA-127. [score:3]
Figure 6 Clonogenic survival of HDMEC after transfection with miR-127 precursor or inhibitor. [score:3]
miR-127 overexpression had a strong negative effect on clonogenic survival in 2 Gy treated cells (P < 0.05) (Fig. 6, right panel). [score:3]
In contrast, and similarly to the findings for miRNA-127, miR-148b inhibition might favor survival under radiation conditions. [score:3]
The overexpression of miR-125a or miR-127 showed no marked effects on clonogenicity per se. [score:3]
Conversely, over-expressed miR-127 enhanced radiation sensitivity in clonogenic assays. [score:2]
While in particular miR-189 and miR-125a have a protective effect on endothelial cells, miR-127 and let-7g enhance their sensitivity to irradiation. [score:1]
The following pre- and anti-miRs were used: hsa-let-7g, hsa-miR-125a, hsa-miR-127, hsa-miR-148b, hsa-miR-189, hsa-miR-20a, pre-miR negative control #1, and anti-miR negative control #1 (all purchased from Ambion). [score:1]
While miR-125a and miR-189 had a radioprotective effect, miR-127 and let-7g enhanced radiosensitivity in human endothelial cells. [score:1]
s Out of the microRNA list from the microarrays we selected six miRNAs (let-7g, miR-125a, miR-127, miR-148b, miR-189, and miR-20a) for further functional analysis. [score:1]
Six microRNAs (miRs) were chosen for subsequent functional analyses (let-7g, miR-125a, miR-127, miR-148b, miR-189, and miR-20a). [score:1]
Out of the microRNA list from the microarrays we selected six miRNAs (let-7g, miR-125a, miR-127, miR-148b, miR-189, and miR-20a) for further functional analysis. [score:1]
One might speculate that miR-127 is involved in such or similar pro-survival mechanisms [13, 23]. [score:1]
[1 to 20 of 17 sentences]
14
[+] score: 45
miR-127 acts as a tumor suppressor by downregulating BCL6. [score:6]
Downregulation of miR-125 (p = 0.05), miR-127 (p = 0.001), miR-145 (p = 0.005), miR-192 (p = 0.015), miR-194 (p = 0.003), miR-199-5 (p = 0.008), miR-215 (p < 0.001), and miR-429 (p = 0.03) in the normal liver tissue was significantly associated with poor survival, suggesting oncosuppressive effects of these miRNAs. [score:6]
In the host tissue of the liver metastases, we identified several miRNAs with significant correlations between expression and survival: downregulation of miR-125 (p = 0.05), miR-127 (p = 0.001), miR-145 (p = 0.005), miR-192 (p = 0.015), miR-194 (0.003), miR-199-5 (p = 0.008), miR-215 (p < 0.001), and miR-429 (p = 0.03) was associated significantly with poor survival (Table 4). [score:6]
miR-127 showed a 10-fold upregulation in the stroma compartment of the lung metastases compared to the tumor compartment (p < 0.0001) and a 5-fold upregulation compared to the normal lung tissue (p = 0.01). [score:5]
miR-127 was 60-fold upregulated in the stroma tissue compared to the tumor tissue of the liver metastases (p < 0.0001) but showed no significant upregulation compared to the normal liver tissue. [score:5]
miR-127 has been shown to exert tumor suppressive functions in gastric cancers by interacting directly with the mRNA-encoding oncogenic factors KRAS and MAPK4 [30]. [score:4]
miR-125 and miR-199-5 showed a 2-fold; miR-19 and miR-127 showed a 4-fold; miR-215 showed a 100-fold; miR-194 showed a 150-fold; and miR-192 showed a 300-fold upregulation in the normal liver tissue compared to the normal lung tissue. [score:3]
Only three miRNAs, miR-127, miR-192, and miR-215, showed a significant expression difference (>2-fold) between all three compartments in both liver and lung metastases (Tables S1 and S2). [score:3]
Guo L. -H. Li H. Wang F. Yu J. He J. -S. The Tumor Suppressor Roles of miR-433 and miR-127 in Gastric Cancer Int. [score:3]
miR-194 showed a 1.5-fold; miR-125, miR-127, and miR-192 showed a 2.5-fold; miR-19 and miR-215 a 3-fold; miR-145, miR-199-3, and miR-429 a 5-fold; miR-21 a 7-fold; and miR-199-5 a 12.5-fold downregulation in the liver metastases compared to the lung metastases. [score:3]
The final selection of miRNAs for further analysis consisted of 11 miRNAs: miR-19b, miR-21, miR-125b, miR-127-3p, miR-145, miR-192, miR-194, miR-199a-3p, miR-199a-5p, miR-215, and miR-429. [score:1]
[1 to 20 of 11 sentences]
15
[+] score: 42
Before the onset of lupus, male and female NZB/W [F1] mice have comparable levels of lupus -associated miRNAsIn our previous study where we utilized only female NZB/W [F1] mice, we reported that a set of miRNAs including the miR-96-182-183 cluster, miR-155, miR-31, miR-127, and miR-379 were upregulated only in the splenocytes from diseased 36–40-wk-old (8–9 months) female NZB/W [F1] mice, but not in the splenocytes from the pre-diseased 16–18-wk-old (3–4 months) NZB/W [F1] mice when compared to those in the control NZW mice [34]. [score:7]
In our previous study where we utilized only female NZB/W [F1] mice, we reported that a set of miRNAs including the miR-96-182-183 cluster, miR-155, miR-31, miR-127, and miR-379 were upregulated only in the splenocytes from diseased 36–40-wk-old (8–9 months) female NZB/W [F1] mice, but not in the splenocytes from the pre-diseased 16–18-wk-old (3–4 months) NZB/W [F1] mice when compared to those in the control NZW mice [34]. [score:7]
We initially analyzed the expression of lupus -associated miRNAs including the miR-96-182-183 cluster, miR-155, miR-31, miR-127, miR-379, and miR-148a in splenocytes from male and female NZB/W [F1] mice at 17–18 wks old, an age before the onset of disease in NZB/W [F1] mice. [score:5]
Of the eight lupus -associated miRNAs analyzed in this study, only miR-127 and miR-379 displayed sexual differential expression before the onset of lupus in NZB/W [F1] (Figure  1). [score:3]
However, these two estrogen-lymphoma mice displayed large variations in expression of other miRNAs such as miR-127, miR-327, and miR-31 (Additional file 1: Figure S2). [score:3]
We recently reported that female NZB/W [F1] mice had increased expression of lupus -associated miRNAs such as the miR-182-96-183 cluster, miR-31, miR-155, miR-127, and miR-379 only at an age when lupus is manifested [34]. [score:3]
At 23 wks of age, the expression levels of miR-182, miR-183, miR-127, and miR-31 were significantly increased in female NZB/W [F1] mice when compared to age-matched male NZB/W [F1] mice (Figure  2A). [score:2]
There is also limited knowledge with regard to the immune regulatory function of miR-127 and miR-379. [score:2]
The sex differences in the expression of lupus -associated miRNAs, including the miR-182-96-183 cluster, miR-155, miR-31, miR-148a, miR-127, and miR-379, were markedly evident after the onset of lupus, especially at 30 wks of age when female NZB/W [F1] mice manifested moderate to severe lupus when compared to their male counterparts. [score:2]
Impressively, we found that after the onset of lupus, the expressions of lupus -associated miRNAs (miR-182-96-183, miR-31, miR-127, miR-379, and miR-148a, miR-155) were significantly increased in female NZB/W [F1] mice when compared to those in age-matched male mice. [score:2]
So far, there is limited knowledge about Dlk1-Gtl2 imprinted miRNA clusters such as miR-127 and miR-379 with regard to their function, especially their immune regulatory function. [score:2]
There was a trend (albeit not significant) of increase of miR-31 and miR-127 expressions in 32-wk-old estrogen -treated mice when compared to 32-wk-old placebo -treated control mice. [score:2]
Impressively, our previous microarray data indicated that in addition to miR-127 and miR-379, several other miRNAs from the Dlk1-Gtl2 region, including miR-433, miR-300, and miR-382, were also increased in MRL-lpr and B6-lpr mice [34]. [score:1]
miR-127 and miR-379 are encoded by a large miRNA cluster embedded in the mouse maternal imprinted region Dlk1-Gtl2 and human homologues DLK1-DIO3. [score:1]
[1 to 20 of 14 sentences]
16
[+] score: 36
Moreover, Philippidou et al. also observed that both mir-127-3p and mir-376c are down-regulated in a metastatic cell line relative to their expression in the primary tumor from the same patient [5], again in agreement with our current observations. [score:6]
To verify that the treatment indeed led to epigenetic modifications in the vicinity of the regulatory region of the 14q32-cluster, chromatin immunoprecipitation (ChIP) using an anti-acetylated Histone 3 antibody was performed, showing that the addition of epigenetic modifiers increased the extent of histone acetylation in two different loci within the IG-DMR region and in another regulatory region located approximately 700 bp upstream of the mir-127 locus [10] (Figure  2D), suggesting that re -expression of these miRNAs is a result of a true epigenetic alteration in the cells. [score:5]
The miRNAs with significant differences between treatment and control are bolded Mir-127 was previously shown to target BCL-6 in a bladder cancer mo del [10], so we first generated melanoma cell lines that ectopically express mir-127 in a stable manner. [score:5]
Four of these miRNAs (namely mir-127-3p, mir-136, mir-376a and mir-376c) were shown to be down-regulated but not completely silenced in nevi and melanomas. [score:4]
Four of these five miRNAs (mir-127-3p, mir-136, mir-376a and mir-376c) were found to be down-regulated but not entirely silenced in nevi and melanoma (Additional file 2). [score:4]
Additionally, mir-127 from this cluster was shown to have tumor suppressor function in a bladder cancer mo del [10]. [score:3]
Re -expression of mir-127 was assessed using the same treatment conditions. [score:3]
In our experimental system, mir-127 over -expression did not lead to a significant decrease in BCL-6 levels in melanoma cell lines, nor did it lead to a significant change in melanoma cell line proliferation or migration in vitro (results not shown). [score:3]
One can postulate that specific miRNAs within this large cluster have their own individual 'switches', and indeed such a switch has been suggested for mir-127 [10], also shown to be up regulated in our work in response to epigenetic modifiers. [score:2]
Interestingly, out of all 65 chromosome-14-miRNAs assessed in four melanoma cell lines, only five miRNAs were shown to be induced in any of the cell lines: mir-127-3p, mir-137, mir-376a (also designated mir-376a-3p), mir-376c and mir-485-3p. [score:1]
[1 to 20 of 10 sentences]
17
[+] score: 31
miR-127 and miR-379, which were greatly upregulated in splenocytes from lpr mice, were moderately increased in diseased NZB/W mice. [score:6]
As shown in the figure 5, the expression levels of selected lupus -associated miRNAs including miR-96, miR-31, miR-127, miR-146a and miR-155 were significantly upregulated in freshly-isolated splenocytes from 3-4-month old MRL-lpr mice when compared to 1-month old MRL-lpr mice. [score:5]
However, the upregulation of miR-127 and miR-379 in 9-month old NZB/W is not significant when compared to 9-month old NZW mice (Fig. 4B). [score:3]
Overall, our data revealed that the expression changes in lupus -associated miRNAs such as miR-182-96-183, miR-31, miR-127, miR-379, miR-155, and miR-150 that were observed in splenocytes were also evident in purified splenic B and T cells. [score:3]
However, LPS activation did not induce miR-96, miR-31 and miR-127 expression changes in splenocytes. [score:3]
0014302.g005 Figure 5The expression levels of selected lupus -associated miRNAs (miR-96, miR-31, miR-127, miR-146a, and miR-155) in freshly-isolated (MRL-lpr-1 month), 24 hrs of LPS activated (MRL-lpr-1 month-LPS) splenocytes from 1-month old MRL-lpr mice, and freshly isolated splenocytes from 3-4 month old MRL-lpr mice (MRL-lpr-3-4 months) were analyzed by Real-time RT-PCR. [score:3]
The expression levels of selected lupus -associated miRNAs (miR-96, miR-31, miR-127, miR-146a, and miR-155) in freshly-isolated (MRL-lpr-1 month), 24 hrs of LPS activated (MRL-lpr-1 month-LPS) splenocytes from 1-month old MRL-lpr mice, and freshly isolated splenocytes from 3-4 month old MRL-lpr mice (MRL-lpr-3-4 months) were analyzed by Real-time RT-PCR. [score:3]
miR-127 and miR-379 were also significantly upregulated in 9-month old NZB/W mice when compared to 3-4-month old NZB/W. [score:3]
Consistent with the data observed in whole splenocytes, the expression of miR-182-96-183, miR-31, miR-127 and miR-379 was also significantly increased in purified splenic B cells and T cells from MRL-lpr mice when compared to MRL mice (Fig. 2B). [score:2]
[1 to 20 of 9 sentences]
18
[+] score: 28
The use of inhibitors of methylation and histone deacetylation in these cancer cells causes over expression of miR-127 and related down regulation of the target BCL6 (NM_138931), a bona fide proto-oncogene [29], [30]. [score:8]
For example, miR-127 has been shown to be expressed, together with other members of its cluster, in normal tissues [29], but to be down regulated or silenced in cancer cell lines and primary tumours; the expression is correlated with the methylation and the acetylation status of its promoter. [score:6]
The expression of miR-127 by LNA-FISH was seen in all samples with a t(15;17) translocation and in the sample with a t(8;21) translocation. [score:3]
Validation of pattern of expression of miR-127 and miR-154 in AML by locked nucleic acid fluorescent in situ hybridisation (LNA-FISH). [score:3]
It is possible that the specific expression of miR-127 and the other members of the cluster, in a subtype of leukaemia carrying the t(15;17) translocation, is due to a change in the methylation and acetylation status of the 14q32 region. [score:3]
We further developed this methodology to visualise the spatial localisation of two mature miRNAs, miR-127 and miR-154, in primary AML suspension cells and thus we confirmed their high expression in APMLs as measured by real-time PCR. [score:1]
The A and B panels show the detection of miR-127 and miR-154, respectively. [score:1]
The probe sequences were (5′-3′): miR-154, CGAAGGCAACACGGATAACCTA; miR-127, AGCCAAGCTCAGACGGATCCGA; U6, CACGAATTTGCGTGTCATCCTT. [score:1]
Locked nucleic acid (LNA) -modified probes were obtained for two miRNAs (miR-127 and miR-154) and positive (U6) and negative controls (miRCURY-LNA detection probe, Exiqon). [score:1]
The set includes miR-127, miR-154, miR-154*, miR-299, miR-323, miR-368, and miR-370. [score:1]
[1 to 20 of 10 sentences]
19
[+] score: 25
Of a number of upregulated miRNAs, miRNA-376a, miR-127, miR-34a, miR-300, miR-342-3p were downregulated following metformin treatment in MCD-fed mice. [score:7]
Notably, miR-122, miR-194, miRNA-101b, and miRNA-705 were upregulated and miRNA-376a, miRNA-127, miRNA-34a, miRNA-300 and miRNA-342-3p were downregulated in the liver tissue of MCD-fed mice treated with or without metformin (Table IB and Fig. 6). [score:7]
The five downregulated miRNAs i. e., miRNA-376a, miRNA-127, miRNA-34a, miRNA-300 and miRNA-342-3p, were identical to five of the 71 upregulated miRNAs in control and MCD-fed mice. [score:7]
In addition, the downregulation of miR-127 facilitates hepatocyte regeneration after partial hepatectomy (17). [score:4]
[1 to 20 of 4 sentences]
20
[+] score: 22
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26b, hsa-mir-27a, hsa-mir-31, hsa-mir-33a, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-147a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-212, hsa-mir-221, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-142, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-134, hsa-mir-200c, hsa-mir-106b, hsa-mir-361, hsa-mir-148b, hsa-mir-20b, hsa-mir-410, hsa-mir-202, hsa-mir-503, hsa-mir-33b, hsa-mir-643, hsa-mir-659, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-221, bta-mir-26b, bta-mir-27a, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-127, bta-mir-142, bta-mir-20b, bta-let-7d, bta-mir-132, bta-mir-148b, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-361, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, hsa-mir-708, hsa-mir-147b, hsa-mir-877, hsa-mir-940, hsa-mir-548j, hsa-mir-302e, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-100, bta-mir-106b, bta-mir-130a, bta-mir-134, bta-mir-147, bta-mir-152, bta-mir-153-1, bta-mir-153-2, bta-mir-182, bta-mir-24-1, bta-mir-199a-2, bta-mir-202, bta-mir-212, bta-mir-224, bta-mir-33a, bta-mir-33b, bta-mir-410, bta-mir-708, bta-mir-877, bta-mir-940, bta-mir-29b-1, bta-mir-148c, bta-mir-503, bta-mir-148d
Relative expression of candidate circulatory miRNAs in blood plasma of hypersitimulated heifers across different days during estrous (a- f) Expression of miR-221, miR-103, let-7g, miR-134, miR-147 and miR-127-3p was determined by RT-qPCR and each miRNA expression level was normalized using global normalization method. [score:7]
As shown in Fig.   4 expression analysis of candidate miRNAs (miR-221, miR-103, let-7 g, miR-134, miR-147 and miR-127-3p) using qRT-PCR revealed the presence of temporal changes in the pattern of expression depending on the time during the estrous cycle as shown in Fig.   4. While four of the candidates namely. [score:5]
For instance, miR-221, miR-103, miR-134 and miR-127-3p show significantly higher expression at day 7 of estrous cycle compared to day 0 or day 3. In contrast, miR-147 has significantly lower expression at day 7 of estrous. [score:4]
miR-221, miR-103, miR-134 and miR-127-3p showed a significant increase in abundance at day 7 of the estrous cycle compared to days 0 and 3, miR-147 showed a decreasing pattern from day 0 to day 7. No significant difference in the expression of let-7 g miRNA has been observed between the days during estrous cycle. [score:2]
Mir-103 and miR-127-3p were not detected in the Ago2 protein fraction of both treatment groups. [score:1]
Data are presented as raw Ct value and Ct value of more than 35 was considered as undetected Here we have tried to detect candidate miRNAs, which were enriched (miR-221, miR-103 & let-7 g) or suppressed (miR-134, miR-147 & miR-127-3p) in blood plasma samples of hyperstimulated animals compared to the unstimulated ones. [score:1]
Candidates including miR-182 from follicular fluid (Fig.   4) and miR-221, miR-103 and miR-127-3p from blood plasma (Fig.   5) were found to be detected only in exosomal fraction and completely undetected in the Ago2 fraction. [score:1]
As shown in Fig.   7, all candidate miRNAs, except miR-103 and miR-127-3p, were detected in both exosomal and Ago2 fraction of blood plasma of both hyperstimulated and unstimulated heifers. [score:1]
[1 to 20 of 8 sentences]
21
[+] score: 21
In order to further understand the role of aberrant miRNAs in physiological functions and biologic processes in arsenite -induced neoplastic transformation cells, 11 downregulated miRNAs (miR-197-3p, miR-192-5p, miR-127-3p, miR-139-5p, miR-490-3p, miR-196b-5p, miR-125a-3p, miR-298, miR-542-3p, miR-15b-5p, and miR-33b-5p) and six upregulated miRNAs (miR-200b-3p, miR-106b-5p, miR-574-5p, miR-320d, miR-200c-3p, and miR-141-3p) (Table S2) were selected, and their target genes were predicted with the TargetMiner, miRDB, and TarBase databases. [score:11]
Among the 191 dysregulated miRNAs, seventeen miRNAs (downregulation miRNAs: miR-197-3p, miR-192-5p, miR-127-3p, miR-139-5p, miR-490-3p, miR-196b-5p, miR-125a-3p, miR-298, miR-542-3p, miR-15b-5p, miR-33b-5p; upregulation miRNAs: miR-200b-3p, miR-106b-5p, miR-574-5p, miR-320d, miR-200c-3p, miR-141-3p, Table S2) were selected for bioinformatics analysis. [score:8]
On the contrary, miRNAs like miR-197-3p, miR-127-3p, and miR-490-3p regulate few genes and are on the edge of the network, suggesting these miRNAs were less important in arsenite-transformed cells. [score:2]
[1 to 20 of 3 sentences]
22
[+] score: 19
For example, over expression of miR-127, a Dlk1-Dio3 mat NAFLD candidate, in pancreas islet cells suppresses insulin secretion and causes glucose intolerance [51]; additionally, miR-342 and miR-379 are upregulated in white adipose tissue of obese mice [52]. [score:8]
The other seven (miR-127, -136, -376c, -379, -409-3p, -411, and -495) were upregulated in both FLS W and FLS ob/ob mice relative to control mice; however, expression of these seven was higher in the FLS W mice than in FLS ob/ob mice. [score:6]
Furthermore, among these eight miRNAs, seven (miR-127, -136, -376c, -379, -409-3p, -411, and -495) were each upregulated in both FLS W and FLS ob/ob liver and mapped to the same maternally imprinted gene cluster delineated by the delta-like homolog 1 gene and the type III iodothyronine deiodinase gene (Dlk1-Dio3 mat) [30]. [score:4]
In the present study, we identified a novel set of NAFLD candidate miRNAs—miR-127, -136, -376c, -379, -409-3p, -411, and -495—that all mapped to the same miRNA cluster in the human Dlk1-Dio3 mat region. [score:1]
[1 to 20 of 4 sentences]
23
[+] score: 18
Two miRNA (miR-195-5p and miR-16-5p) strongly upregulated GBA1 expression, while three miRNA (miR-127-5p, miR-19a-5p, and miR-1262) downregulated SCARB2, an important membrane receptor involved in Gba availability. [score:9]
One of them, miR-127-5p, downregulated Gba activity and also its levels, since it was also able to downregulate SCARB2 expression. [score:9]
[1 to 20 of 2 sentences]
24
[+] score: 16
Other miRNAs from this paper: hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-502
SETD8 has been also identified as a direct target of miR-127-3p, a miRNA that acts as a tumor suppressor in osteosarcoma (OS) tissues and cell lines and whose down-regulation in cancer may contribute to OS progression and metastasis. [score:9]
MiR-127-3p has been suggested to act mainly via the suppression of SETD8 expression. [score:4]
SETD8 overexpression can reverse the potential influence of miR-127-3p on the migration and invasion of OS cells [62]. [score:3]
[1 to 20 of 3 sentences]
25
[+] score: 16
In this study, we found that, in addition to lowered levels of miR-122, expression of miR-223, miR-34a, and miR-127 was also down-regulated. [score:6]
miR-223 is noteworthy because it is frequently suppressed in human HCC [52], and miR-34a, miR-127 and miR-200b are down-regulated in the rat liver during experimental hepatocarcinogenesis [36]. [score:6]
Tryndyak V. P. Ross S. A. Beland F. A. Pogribny I. P. Down-regulation of the microRNAs miR-34a, miR-127, and miR-200b in rat liver during hepatocarcinogenesis induced by a methyl -deficient diet Mol. [score:4]
[1 to 20 of 3 sentences]
26
[+] score: 16
Among the genes upregulated in the cancer cells was miR-127, which was embedded within a CpG island and was upregulated in association with DNA demethylation, acetylation of histone H3 and trimethylation of histone H3 lysine 4 (H3K4me3), which are marks of active transcription. [score:7]
Experimental evidence confirmed that the proto-oncogene BCL6 is a target of miR-127, suggesting miR-127 acts as a tumor suppressor (Saito et al., 2006). [score:5]
Specific activation of microRNA-127 with downregulation of the proto-oncogene BCL6 by chromatin-modifying drugs in human cancer cells. [score:4]
[1 to 20 of 3 sentences]
27
[+] score: 16
More specifically, experimentally has been shown, the suppression of RAS oncogene by let-7 [40]; the suppression of BCL-2 by miR-15a and miR-1 [51]; the regulation of transcription factor E2F1 activity by miR-17-5p and miR-20 [52]; the downregulation of the KIT oncogene by miR-221 and miR-222 [53], the inhibition of the expression of tumour-supressor LATS2 and the influence on p53 pathway by miR-372 and miR-373 [54], and finally, the downregulation of the proto-oncogene BCL6 by miR-127 [55]. [score:16]
[1 to 20 of 1 sentences]
28
[+] score: 14
Imprinted gene expression profiles in the Dlk1-Dio3 region were determined, including those of paternally expressed genes, Dlk1, Rtl1 and Dio3, and maternally expressed genes, Meg3, Meg8 and antisense Rtl1 (encoding miR433 and miR127). [score:7]
PCR was carried out using primers for the paternally expressed genes, Dlk1, Rtl1, and Dio3, and the maternally expressed genes, Meg3, Meg8, and antisense Rtl1 encoding miR433 and miR127. [score:4]
In the Dlk1-Dio3 region, the maternally expressed genes can produce non-coding RNAs, including mir-431, mir-433, mir-127, mir-432 and mir-136. [score:3]
[1 to 20 of 3 sentences]
29
[+] score: 14
Saito and colleagues showed that silencing of miR-127 in several cancers was due to promoter hypermethylation [118] and treatment of a bladder cancer cell line with DNMT inhibitor 5-Aza-2’-deoxycytidine could strongly up-regulate the miR-127 level and down-regulate BCL-6 expression, which was shown to be directly targeted miR-127 [118]. [score:14]
[1 to 20 of 1 sentences]
30
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
After 6 and 12 wks of E [2] exposure, 15 miRNAs were down-regulated, e. g., miR-22, miR-99a, miR-106a, miR-127, miR-499, and 19 miRNAs were-up-regulated, e. g., miR-17-5p, miR-20a, miR-21, miR-129-3p, miR-106a, miR-22, and miR-127. [score:7]
Genes targeted by three of the altered miRNAs were examined: miR-20a regulates E2F1, miR-106a regulates RBI, and miR-127 regulates BCL6. [score:6]
Western blot of mammary gland lysates after 12 wks of E [2] showed that levels of RBI and E2F1 were decreased and BCL6 protein was increased, data that are in agreement with the increase miR-20a and miR-106a and the decrease in miR-127 detected [198]. [score:1]
[1 to 20 of 3 sentences]
31
[+] score: 13
In our analysis of primary human glioblastoma tissue samples and brain tissues, miR-31 was not detectable, miR-143 was down-regulated in only half of the glioblastoma samples analyzed, and miR-127 exhibited only modest down-regulation in glioblastomas (Table S4). [score:7]
One study done with brain developed an insect baculovirus -based vector expressing HSV-TK under the regulation of three miRNAs (miR-31, miR-127, and miR-143) reported to be under-expressed in glioblastoma cell lines [31]. [score:6]
[1 to 20 of 2 sentences]
32
[+] score: 13
5 miRs from the 18 targets that were predicted by both HuMiTar and PicTar, i. e. miR-19a, miR-127, miR-141, miR-182, and miR183. [score:3]
The experiment shows that miR-127 does not affect the expression levels of Septin7, which may suggest that this is a false positive prediction. [score:3]
The test considers three sets of miRs: 5 miRs from the 18 targets that were predicted by both HuMiTar and PicTar, i. e. miR-19a, miR-127, miR-141, miR-182, and miR183. [score:3]
The test considers three sets of miRs: 5 miRs from the 18 targets that were predicted by both HuMiTar and PicTar, i. e. miR-19a, miR-127, miR-141, miR-182, and miR183. [score:3]
The Septin7 expression levels were measured (left to right) for (1) control sample, (2) miR-127, (3) miR-182, (4) miR-412, (5) miR-19a, (6) miR-453, (7) miR-448, (8) miR-450, (9) miR-183, (10) miR-141, (11) miR-202, (12) miR-148, (13) miR-106b, (14) miR-134, (15) miR-106, (16) miR-144, (17) miR-151, (18) miR-384, (19) miR-101, (20) miR-142, (21) miR-129 and (22) miR-126. [score:1]
[1 to 20 of 5 sentences]
33
[+] score: 13
Inhibition of methylation and histone deacetylation in these cancer cells causes over expression of miR-127 and related down regulation of the target BCL6, a bona fide protooncogene [36]. [score:8]
For instance, miR-127 has been shown to be down regulated or silenced in cancer cells, whose expression is correlated with the methylation and acetylation status of its promoter. [score:4]
The set includes miR-127, miR-154, miR-154*, miR-299, miR-323, miR-368, and miR-370. [score:1]
[1 to 20 of 3 sentences]
34
[+] score: 12
MiR-485 has been implicated in synaptic formation and maintenance and has been reported to be dysregulated in Alzheimer’s disease and Huntington’s disease [32], miR-124 is known as a neurodevelopmental regulator [33], miR-219 required for neural precursor differentiation in zebrafish [34] and promotes myelination in rats [35], miR-127 regulates cell proliferation and senescence by targeting BCL6 [36] while miR-136, miR-873 and miR-410 have all been studied in the context of glioma growth, invasiveness and apoptosis 37– 39. [score:11]
miRNAlog [2]FoldChange P-value Corrected P-value hsa-mir-577 −3,28 1,46E-10 3,87E-08 hsa-mir-182-5p −2,70 6,50E-15 3,44E-12 hsa-mir-485-5p −2,12 8,79E-05 8,45E-03 hsa-mir-124-3p −1,83 1,05E-05 1,85E-03 hsa-mir-218-5p −1,68 1,54E-04 1,16E-02 hsa-mir-183-5p −1,62 3,14E-04 2,08E-02 hsa-mir-873-5p −1,58 9,80E-04 3,25E-02 hsa-mir-133a −1,53 6,05E-04 2,29E-02 hsa-mir-487b −1,45 1,56E-03 4,59E-02 hsa-mir-219-5p −1,44 9,55E-04 3,25E-02 hsa-mir-409-3p −1,34 1,12E-03 3,48E-02 hsa-mir-889 −1,23 5,71E-04 2,29E-02 hsa-mir-136-3p −1,15 1,75E-03 4,87E-02 hsa-mir-410 −1,12 4,02E-04 2,29E-02 hsa-mir-127-3p −0,95 5,61E-04 2,29E-02 hsa-mir-148a-3p 1,23 4,99E-04 2,29E-02 hsa-mir-155-5p 1,82 9,56E-05 8,45E-03 hsa-mir-221-3p 2,10 4,82E-04 2,29E-02For each differently expressed miRNA we report the standard name according to MirBase database, the log [2] fold-change, the P-value and the corresponding corrected P-value as calculated by DESeq. [score:1]
[1 to 20 of 2 sentences]
35
[+] score: 11
In addition, activation of miR-127 by epigenetic treatment induced downregulation of its target oncogene BCL6 (Saito et al., 2006). [score:6]
Specific activation of microRNA-127 with downregulation of the proto-oncogene BCL6 by chromatin-modifying drugs in human cancer cells. [score:4]
In particular, miR-127, which is embedded in a CpG island, is remarkably induced by a decrease in DNA methylation levels and an increase in active histone marks around the promoter region of the miR-127 gene. [score:1]
[1 to 20 of 3 sentences]
36
[+] score: 11
Previous experiments in bladder cancer cells showed that a combination of epigenetic modifiers, including inhibitors of histone deacetylation such as sodium-4-phenylbutyrate (4-PBA) and inhibitors of such as 5-Azacytidine (5-AzadC), restored expression of miR-127 at the 14q32 locus [25]. [score:7]
COmbined Bisuifite Restriction Analysis (COBRA) for CpG regions upstream of miR-127, -411, -431 and -432 in OS and normal bone tissue samples. [score:1]
Sequences 200 nucleotides upstream to the transcription start site of miR-654, miR-431, miR-127, miR-432, miR-411, miR-544, miR-369-3p, miR-382 and miR-134 were then amplified using qPCR from DNA present in the immune complexes. [score:1]
We tested at the CpG regions upstream of selected 14q32 miRNA transcripts (miR-127, -411, -431 and -432) [11]. [score:1]
The presence of bisulfite converted PCR products that were insensitive to digestion suggested no change or relative hypomethylation in upstream regions of miR-127 and -411 in OS patients and corresponding age matched normal bone tissues (Figure 1). [score:1]
[1 to 20 of 5 sentences]
37
[+] score: 10
Several of the most highly expressed miRNAs in human islets (including miR-375, miR-7-5p, miR-148a-3p, miR-26a-5p and miR-127-3p) have been previously described in rodent or human islets [7], [17]– [20]. [score:3]
For miR-184, miR-182-5p and miR-127-3p, there is published evidence for a role in insulin biosynthesis and secretion, though for miR-184 and miR-127-3p this is restricted to a correlation between islet expression levels and glucose-stimulated insulin secretion [17], [18]. [score:3]
Our data adds support for an islet-enriched expression pattern of six miRNAs previously highlighted by microarray studies (miR-184, miR-183-5p, miR-7-5p, miR-127-3p, miR-375, and miR-493-5p) [17], [20]. [score:3]
For example, mir-182 and mir-183 (both amongst the most islet-specific transcripts) originate from the same cluster on chromosome 7q32.2, whilst mir-136 and mir-127 map together on chromosome 14q32.2. [score:1]
[1 to 20 of 4 sentences]
38
[+] score: 10
Our data in the present study are consistent with the above findings showing the upregulation of miR-517, miR-92a, miR-127, and miR-181a in Exo [Hypoxic]. [score:4]
The prognostic and biological significance of miR-127 expression in breast cancer was reported by Wang et al. [26]. [score:3]
Among these, 15 miRNAs (miR-143, miR-146a, miR-181a, miR-204, miR-222, miR-27a, miR-335, miR-433, miR-491, miR-502, miR-521, miR-92a, miR-127, miR-135b and miR-451) target 211 mRNAs when the confidence limit was set as “Experimentally Observed” only. [score:3]
[1 to 20 of 3 sentences]
39
[+] score: 10
In the results of the splenocytes from the MRL/lpr mice, ASC treatment did not change the miR expression significantly, but cyclophosphamide treatment decreased the expression of miR-31-5p, miR-96-5p, miR-127-3p, miR-182-5p, miR-183-5p, and miR-379-5p significantly compared with the saline-treatment. [score:4]
In splenocytes from the MRL-lpr mice (the samples in our previous study), the expression levels of miR-18a-5p, miR-31-5p, miR-96-5p, miR-127-3p, miR-182-5p, miR-183-5p, and miR-379-5p were significantly higher, while those of miR-101a-3p and miR150-5p were significantly lower in the C group than in the N group. [score:3]
The expression levels of miR-31-5p, miR-96-5p, miR-127-3p, miR-182-5p, miR-183-5p, and miR-379-5p 5p in the Y group were significantly lower than in the C group (Supplementary Fig. 3). [score:3]
[1 to 20 of 3 sentences]
40
[+] score: 9
Specific activation of microRNA-127 with downregulation of the proto-oncogene BCL6 by chromatin-modifying drugs in human cancer cells. [score:4]
In particular, DNA hypermethylation and induction of active histone marks in the promoter region of miR-127 resulted in decreased and increased expression of miR-127, respectively (Saito et al., 2006). [score:3]
miR127, miR-342, and miR-512-5p, are regulated epigenetically (Saito et al., 2013). [score:2]
[1 to 20 of 3 sentences]
41
[+] score: 9
For example, miR-127, which is down-regulated in prostate, colon and bladder tumors relative to matched normal tissues, is up-regulated in cell lines derived from these tumor types following inhibition of DNA demethylation and histone deacetylase [40]. [score:9]
[1 to 20 of 1 sentences]
42
[+] score: 9
Of these, 31 miRs (88.6%, 31/35) were downregulated in the EOC lines compared with the IOSE lines, including the tumor suppressor miRs, let-7d [10], and miR-127 [20]. [score:5]
MiR-21, miR-29a, miR-92, miR-93, and miR-126 were significantly overexpressed in the serum of ovarian cancer patients compared to controls, while miR-99b, miR-127, and miR-155 were significantly underexpressed. [score:4]
[1 to 20 of 2 sentences]
43
[+] score: 9
This study identified 68 up-regulated and 2 down-regulated miRNAs between the ISCCs and normal epithelial tissues, with miR-199s, miR-9, miR-199a*, miR-199a, miR-199b, miR-145, miR-133a, miR-133b, miR-214 and miR-127 being among the miRNAs most overexpressed. [score:9]
[1 to 20 of 1 sentences]
44
[+] score: 9
To validate the accuracy of our heatmap results, we performed qPCR to confirm the expression levels of the top up-regulated miRNAs (such as miR365a-3p, miR-2277-3p, and miR-184-3p) and down-regulated miRNAs (such as miR-21-5p, miR-136-3p, and miR-127-3p) (Fig.   1g). [score:9]
[1 to 20 of 1 sentences]
45
[+] score: 8
Other miRNAs from this paper: hsa-mir-365a, hsa-mir-365b, hsa-mir-558
Previously, we were able to demonstrate that miR-127-5p and miR-558, which are regulated by IL-1β in chondrocytes and downregulated in OA cartilage, are able to regulate MMP-13 and cyclooxygenase-2 (COX-2) expression, respectively 15, 16. [score:8]
[1 to 20 of 1 sentences]
46
[+] score: 8
In colorectal cancer, the presence of the KRAS mutation was associated with upregulation of miR-127-3p, miR-92a, and miR-486-3p and downregulation of miR-378, which constituted a miRNA signature capable of predicting colorectal cancers resistant to EGFR antagonists [54]. [score:8]
[1 to 20 of 1 sentences]
47
[+] score: 8
Other miRNAs from this paper: hsa-mir-154, hsa-mir-376c, hsa-mir-494, hsa-mir-495, hsa-mir-496
Based on the qRT-PCR results, the hESCs with higher MEG3 and MEG8 expression were classified as MEG3-ON hESCs, in which several miRNAs from this locus, miR-127-3p, miR-154, miR-376c, miR-494, miR-495, and miR-496, were also abundantly expressed (Figure  1B). [score:5]
The UPL probe system (Roche) was used to detect the expression of miRNAs, including miR-127-3p, miR-376c, miR-494, miR-495, miR-496, and miR-154. [score:3]
[1 to 20 of 2 sentences]
48
[+] score: 8
Among these miRNAs, miR-127, embedded in a CpG island and lacks expression in cancer cells, had significantly elevated expression after the treatment, which was accompanied by the downregulation of proto-oncogene BCL6. [score:8]
[1 to 20 of 1 sentences]
49
[+] score: 8
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
Furthermore, treatment with methylating agents or histone deacetylases inhibitor drugs leads to activation of tumor suppressor miRNAs like miR-127 which targets proto-oncogene BCL6 in human bladder cancer cells [8]. [score:7]
miRNA signature associated with event-free and overall survival in DLBCL was reported to include: miR-21, miR-127, miR-34a, miR-195, and miR-let7g [51]. [score:1]
[1 to 20 of 2 sentences]
50
[+] score: 8
For the detection of differentially expressed microRNAs we analyzed 240 target miRNAs with four different normalization methods: Recommendation of (i) geNormPlus (geometric mean of miR-26b-5p and miR-195-5p (Pool A) as well as of miR-720, miR-1274a, miR-1260a and miR-30a-5p (Pool B)), (ii) NormFinder (geometric mean of miR-28-5p, miR-127-3p and miR-181a-5p (Pool A) as well as miR-10b-3p, miR-181a-2-3p and miR-720 (Pool B)), (iii) global mean normalization method, (iv) two most stable snoRNAs (geometric mean of RNU44 and RNU48 (Pool A) as well as RNU48 and snRNU6 (Pool B)) or (v) geometric mean of all three snoRNAs provided by the manufacturer. [score:5]
In order to provide a set of reference miRNAs one could suggest the intersection of the best 15 reference genes from both algorithms geNormPlus and NormFinder (miR-10b-3p, miR-1260a, miR-127-3p, miR-1274a, miR-181a-5p, miR-181a-2-3p, miR-195-5p, miR-26b-5p, miR-28-5p, miR-30a-3p, miR-30a-5p, miR-30d-5p, miR-361-5p, miR-720, miR-92a-3p). [score:1]
Relative expression levels were calculated using the following normalization methods: geNormPlus (miR-26b, miR-195-5p) NormFinder (miR-28-5p, miR-127-3p, miR-181a-5p), global Mean, best two snRNAs (RNU44, RNU48) and all 3 snRNAs (RNU44, RNU48, snRNU6). [score:1]
In contrast, NormFinder identified miR-28-5p, miR-127-3p and miR-181a-5p for Pool A as well as miR-10b-3p, miR-181a-2-3p and miR-720 for Pool B as the most stable miRNAs (Fig. 2). [score:1]
[1 to 20 of 4 sentences]
51
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7e, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-192, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-214, hsa-mir-215, hsa-mir-222, hsa-mir-223, hsa-mir-1-2, hsa-mir-15b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-149, hsa-mir-184, hsa-mir-186, hsa-mir-200c, hsa-mir-1-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-339, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-624, hsa-mir-650, hsa-mir-651, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-449b, hsa-mir-1185-2, hsa-mir-1283-1, hsa-mir-1185-1, hsa-mir-708, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1283-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Strongly down-regulated tumor suppressing miRNAs included miR-1, miR-34c, let-7a, let-7b, miR-127, with a percentile rank of inhibition of 96.2, 84.2, 69.1, 61.6, 59.3, respectively. [score:8]
[1 to 20 of 1 sentences]
52
[+] score: 8
From the 20 most differentially regulated microRNAs (10 most up-regulated and 10 most down-regulated, see Table 2) 7 are shared with female breast cancer (miR-21, miR-127, miR-122a, miR-135b, miR-140, miR-497, miR-145). [score:8]
[1 to 20 of 1 sentences]
53
[+] score: 7
Increased in Bissels et al. and this studyIncreased in Liao et al. and this studyIncreased in Cattaneo et al. and this study Commonly increased in three studies miR-484 miR-16 nil miR-142-3p miR-425-5p miR-27a miR-142-5p miR-191 Decreased in Bissels et al. and this study Decreased in Liao et al. and this study Decreased in Cattaneo et al. and this study Decreased in Bissels et al. and Cattaneo et al. miR-146a miR-127 miR-126-5p miR-29b-3p miR-146b-5p miR-100 miR-99a miR-10a miR-125b miR-125a-5p These data together suggest a signature of miRNA expression associated with differentiation status and maturation within the myeloid lineage. [score:3]
Increased in Bissels et al. and this studyIncreased in Liao et al. and this studyIncreased in Cattaneo et al. and this study Commonly increased in three studies miR-484 miR-16 nil miR-142-3p miR-425-5p miR-27a miR-142-5p miR-191 Decreased in Bissels et al. and this study Decreased in Liao et al. and this study Decreased in Cattaneo et al. and this study Decreased in Bissels et al. and Cattaneo et al. miR-146a miR-127 miR-126-5p miR-29b-3p miR-146b-5p miR-100 miR-99a miR-10a miR-125b miR-125a-5p These data together suggest a signature of miRNA expression associated with differentiation status and maturation within the myeloid lineage. [score:3]
In addition to these miRNAs that have been previously reported, we have also identified some miRNAs that have not been studied in the context of myeloid differentiation, such as miR-127 and miR-484. [score:1]
[1 to 20 of 3 sentences]
54
[+] score: 7
The analysis of randomly-chosen miRNAs from clusters 1 and 2 (miR-654-3p, mir-369-3p, miR-495, miR-370-5p, miR-127-5p and miR-376c-3p) in tumor cell lines confirmed their downregulation (Figure 1d). [score:4]
Cahill and colleagues have shown that human derived BRAFT1799A- and RET/PTC-bearing thyroid tumor cells, KAT10 and TPC-1 respectively, express lower levels of 14q32-encoded miRNAs miR-323-3p, miR-370-5p, miR-127-3p, miR-299 and miR-154 [22, 23]. [score:3]
[1 to 20 of 2 sentences]
55
[+] score: 7
Other miRNAs from this paper: hsa-let-7d, hsa-mir-155
However, certain miRNAs, including let-7d and mir-127 are underexpressed in cancer and may function as tumor suppressors by inhibiting oncogenes and/or genes controlling cell differentiation or apoptosis (9). [score:7]
[1 to 20 of 1 sentences]
56
[+] score: 7
In a comparison between the pig breeds, 49 dpc showed the most significant differences in G1 (up-regulated), in which miR-378, miR-30a, miR-148a, and miR-127 showed drastic changes. [score:4]
Allen S Ito M Murray A Ferguson-Smith A A trans-homologue interaction between miR-127 and Rtl1: roles in mouse muscle developmentGenet. [score:2]
Figure  3 shows that in G1 (up), we clearly found that 49 dpc showed the most significant differences between breeds; in this group, miR-378, miR-148a and miR-127 showed drastic changes. [score:1]
[1 to 20 of 3 sentences]
57
[+] score: 7
Although our analysis does not extend to include fully functioning islets, we did detect increased expression of miR-127-3p and miR-495 at day 8 and day 11. miR-184 was also detected at high levels at day 11 relative to the day 1– day 8 samples, but we also observed high expression in the starting hESC population, suggesting that although it may have a role in development it is not islet-specific. [score:6]
A recent study by Bolmeson et al., of miRNA enriched in pancreatic islet samples versus liver and skeletal muscle identified miR-127-3p, miR-184, miR-195 and miR-495 [28]. [score:1]
[1 to 20 of 2 sentences]
58
[+] score: 7
For example, miR-143 and miR-145 are downregulated in colon cancer [27], miR-127 is down regulated or silenced in T24 cell (Bladder transitional carcinoma cell); on the otherhand miR-99 is overexpressed/amplified in pancreatic cancer. [score:7]
[1 to 20 of 1 sentences]
59
[+] score: 7
The importance of angiogenic regulatory pathways was also highlighted by the abnormal upregulated expression of miR-127, miR-21, and miR-16 in placentas of deceased cloned sheep with respect to controls [55]. [score:7]
[1 to 20 of 1 sentences]
60
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-9-2, mmu-mir-141, mmu-mir-145a, mmu-mir-155, mmu-mir-10b, mmu-mir-24-1, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10b, hsa-mir-34a, hsa-mir-205, hsa-mir-221, mmu-mir-290a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-31, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-322, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-29b-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-373, hsa-mir-20b, hsa-mir-520c, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-290b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
For example, miR-127, which is downregulated in human cancer cells, has been reported to be located within a CpG island and highly up-regulated by DNA demethylation and histone acetylation [109]. [score:7]
[1 to 20 of 1 sentences]
61
[+] score: 7
The direction of miR-184 and miR-127-3p expression did not correlate between CSF and SER data. [score:4]
The overlap of CSF and SER expressed miRNAs for AD compared to neurologically normal control subject analysis consists of two miRNAs, miR-184 and miR-127-3p. [score:2]
Interestingly, miR-127-3p, 443, 431-3p, 136-3p and 10a-5p were differentially expressed for both AD compared to Control subjects and PD patients compared with Control subjects, in the CSF. [score:1]
[1 to 20 of 3 sentences]
62
[+] score: 7
Specific activation of microRNA-127 with downregulation of the proto-oncogene BCL6 by chromatin-modifying drugs in human cancer cells. [score:4]
Saito et al. reported that the expression of mir-127, which is embedded in a CpG island, was induced by treatment with the chromatin-modifying drugs 5-aza-2’-deoxycytidine and 4-phenylbutyric acid in a bladder cancer cell line. [score:3]
[1 to 20 of 2 sentences]
63
[+] score: 7
Other miRNAs from this paper: hsa-mir-21, hsa-mir-145, hsa-mir-155, hsa-mir-372, hsa-mir-661
Initial clinical results using epigenetic drugs, such as 4-phenylbutyric acid (PBA) and 5-Aza-2’-deoxycytidine (5-Aza-CdR) exhibit the capability to up-regulate miR-127, which in turn down-regulates Bcl6. [score:7]
[1 to 20 of 1 sentences]
64
[+] score: 7
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34b, hsa-mir-34c, hsa-mir-512-1, hsa-mir-512-2
In addition, activation of miR-127 by epigenetic treatment induced down-regulation of its target oncogene BCL6 [4, 5]. [score:6]
In particular, miR-127, which is embedded in a CpG island, is remarkably induced by a decrease in DNA methylation levels and an increase in active histone marks around the promoter region of the miR-127 gene. [score:1]
[1 to 20 of 2 sentences]
65
[+] score: 7
A recent study showed that miR-127, which was embedded in a CpG island, was expressed in normal fibroblast but silenced or down-regulated in cancer cells. [score:6]
The silencing of the miRNA promoter region of miR-127 was mediated by CpG island hypermethylation, which could be reversed by simultaneous treatment with the chromatin-modifying drugs 5-aza-2'-deoxycytidine and 4-phenylbutyric acid [31]. [score:1]
[1 to 20 of 2 sentences]
66
[+] score: 7
Among miRNA analyzed, miR-23b, miR-30d, miR-132, miR-140-3p, miR-145, miR-150, miR-204 were up-regulated in OA chondrocytes whereas miR-22, miR-25, miR-26, miR-30c, miR-92b, miR-127, miR-194, miR-197, miR-296-5p, miR-342-3p, miR-488 were down-regulated in OA chondrocytes (Figure  1B). [score:7]
[1 to 20 of 1 sentences]
67
[+] score: 6
Also, miR-127 was shown to regulate Bcl6 [53]. [score:2]
Three microRNAs in this region, miR-431, miR-127, and miR-136, were shown previously to regulate Peg11 through a siRNA-like mechanism [52]. [score:2]
This conclusion is based on the observation that our cDNA begins at the end of miR-431 precursor and ends at the beginning of miR-127 precursor. [score:1]
org/microrna/) Meg3mmu-miR-770 # Bmp1, Bmp15, Capn3, Casq2, Fosb, Lmna, Mb, Obscn, Peg10, Ppp1ca, Sspn, Tmod1, Trp53 Unidentified mmu-miR-673 Camk2a, Camk2b, Camk2d, Camk2g, Dnmt1, Mtpn, Myh6, Ndn, Pax3, Rbl1, Sln, Tnnt1, Wnt1 Unidentifiedmmu-miR-493 # Cacng5, Camk2g, Cdkn1c, Ctcf, Dag1, Fhl1, Fos, Hras1, Jun, Mib2, Mtap, Peg10, Shh, Tmod1 Unidentifiedmmu-miR-337 # Capza2, Des, Dmd, Dnmt3a, Myh8, Mypn, Nfatc1, Plagl2, Pvalb, Sgcb, Snta1, Tpm3, Trp53 Unidentified mmu-miR-540 Akt3, Bmp2, Bmp7, Capzb, Emd, Itga7, Itgb1, Msc, Myog, Nkx2-5, Pten, Rhoa, Sln, Tlx1, Vim Unidentifiedmmu-miR-665 # Casq2, Igf2, Junb, Ldb3, Peg10, Magel2, Nnat, Pax3, Ryr1, Sntb2, Tln1, Tpm2, Trp53, TtnAnti-Peg11 $ mmu-miR-431 # d Camk2b, Casq1, Dtna, E2f1, Fgf4, Gata3, Igf1, Kit, Max, Peg10, Plagl2, Ppp3r1, Sgcd, Tcf21Anti-Peg11 $ mmu-miR-433 # Bmpr1b, Capza1, Creb1, Ctcf, E2f3, Gata6, Isl1, Jak2, Myh9, Peg10, Plagl2, Ppp3r1, Sntg1Anti-Peg11 $ mmu-miR-127 # d e Auts2, Bcl6, Camk2d, Cdc42, Creb5, E2f3, Igf2, Myo1c, Otx1, Plagl2, Pitx2. [score:1]
[1 to 20 of 4 sentences]
68
[+] score: 6
hsa-miR-182, hsa-miR-183 and hsa-miR-224 are upregulated and hsa-miR-1, hsa-miR-101, hsa-miR-143, hsa-miR-145, hsa-miR-127 and hsa-miR-29c are downregulated in bladder urothelial carcinoma compared to matched histologically normal urothelium [27]. [score:6]
[1 to 20 of 1 sentences]
69
[+] score: 6
Respiratory syncytial virus altered expression of host miRNAs (let-7f, miR-198, -24, -26b, -337-3p, -520a-5p and -595) in vitro eventually affecting the anti-viral host response [14] whereas Epstein-Barr virus encoded nuclear antigen 1 (EBNA1) transcriptionally activated expression of miR-127 which affected B-cell regulators [15]. [score:6]
[1 to 20 of 1 sentences]
70
[+] score: 6
In this study, five miRNAs (miR-29a, miR-29b, miR-126*, miR-127-3p, miR324-3p) were found upregulated and four (miR-188-5p, miR-25, miR-320a, miR-346) downregulated in both quiescent and active UC compared to healthy controls (Fasseu et al., 2010). [score:6]
[1 to 20 of 1 sentences]
71
[+] score: 6
By analysis of the genome-wide expression profiling of miRNAs, Yan and his colleagues showed that seven miRNAs of hsa-miR-497, hsa-miR-31, hsa-miR-355, hsa-miR-320, rno-mir-140, hsa-miR-127 and hsa-miR-30a-3p were significantly downregulated in BC [20]. [score:6]
[1 to 20 of 1 sentences]
72
[+] score: 6
To test this, we randomly selected five additional mIRs located in these two clusters: miR-127, miR-136, miR-154, miR-337, and miR-379 to examine their expression in our CLL patients. [score:3]
Expression levels of five miRNAs in treated and untreated CLL patients for b miR-127, c miR-136, d miR-154, e miR-337, and f miR-379. [score:3]
[1 to 20 of 2 sentences]
73
[+] score: 6
miR-ID Increased Fold-Changes miR-ID Decreased Fold-Changes miR-29b 8.5 miR-17 15.7 miR-29a 7.7 miR-92a 13.6 miR-29c 7.3 miR-18a 12.0 miR-1224 6.6 miR-192 7.2 miR-133b 2.0 miR-127 2.4 miR-200c 1.7 miR-154 1.9 miR-200a 1.4 miR-21 1.7 miR-205 1.3 miR-680 1.3 miR-208a 1.2 miR-377 1.2 miR-669b 1.2 miR-153 1.1 Figure 3Fucoidan increases the expression of miR-29b. [score:3]
miR-ID Increased Fold-Changes miR-ID Decreased Fold-Changes miR-29b 8.5 miR-17 15.7 miR-29a 7.7 miR-92a 13.6 miR-29c 7.3 miR-18a 12.0 miR-1224 6.6 miR-192 7.2 miR-133b 2.0 miR-127 2.4 miR-200c 1.7 miR-154 1.9 miR-200a 1.4 miR-21 1.7 miR-205 1.3 miR-680 1.3 miR-208a 1.2 miR-377 1.2 miR-669b 1.2 miR-153 1.1 Figure 3Fucoidan increases the expression of miR-29b. [score:3]
[1 to 20 of 2 sentences]
74
[+] score: 5
The most significantly downregulated group of miRNAs in cells with BRAF mutation comprised miR-127, -130a, and -144; with RET/PTC1 rearrangement miR-154*, -181a, -302b and -302c [40, 41]. [score:5]
[1 to 20 of 1 sentences]
75
[+] score: 5
The profiling of miRNA expression showed that most of them are down-regulated in tumors compared to normal tissues [31], like let-7 in lung cancers [32] and miR-127 in human bladder cancers [33]. [score:5]
[1 to 20 of 1 sentences]
76
[+] score: 5
While expression of miR-136, miR-376a and miR-377 did not significantly change during treatment, expression of miR-376c and miR-127-3p was significantly increased by Aza treatment and was further elevated by the combined treatment with Aza and PBA. [score:5]
[1 to 20 of 1 sentences]
77
[+] score: 5
In human gastric cancer, multiple miRNAs with aberrant expression have been identified, for example, miR-21, miR-22, miR-23, miR-127, miR-148, miR-202 and miR-433, which played oncogenic or suppressive role [20]– [25]. [score:5]
[1 to 20 of 1 sentences]
78
[+] score: 5
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-150, hsa-mir-194-1, hsa-mir-194-2
Some of these miRNA expression profiles showed downregulation in tumors compared with normal tissue (14), like miR-127 in human bladder cancers (15) and microRNA-34a in OS (16). [score:5]
[1 to 20 of 1 sentences]
79
[+] score: 5
hsa-miR-127 was found to be encoded in RTL1, and to target two differentially expressed genes, XBP1 and BCL6. [score:5]
[1 to 20 of 1 sentences]
80
[+] score: 4
Tryndyak V. P. Ross S. A. Beland F. A. Pogribny I. P. Down-regulation of the microRNAs miR-34a, miR-127, and miR-200b in rat liver during hepatocarcinogenesis induced by a methyl -deficient dietMol. [score:4]
[1 to 20 of 1 sentences]
81
[+] score: 4
According to the study conducted by Mo and colleagues, human ESCs with low MEG3 expression level (designated as MEG3-OFF) also showed significantly low expressions of DLK1-DIO3 locus-derived noncoding RNAs, including MEG8, miR-127, miR-376, miR-494, miR-495, miR-496, and miR-154, compared to its counterpart MEG3-ON [68]. [score:4]
[1 to 20 of 1 sentences]
82
[+] score: 4
He, Q. -Q. et al. MicroRNA-127 targeting of mitoNEET inhibits neurite outgrowth, induces cell apoptosis and contributes to physiological dysfunction after spinal cord transection. [score:4]
[1 to 20 of 1 sentences]
83
[+] score: 4
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-34b, hsa-mir-34c, hsa-mir-328
In fact, previous reports showed that miR-127, miR-124a, and miR-34 were down-regulated by epigenetic events such as DNA methylation [41, 42]. [score:4]
[1 to 20 of 1 sentences]
84
[+] score: 4
In addition, we also detected other miRNAs that are known to exhibit differential expression during the hair growth cycle, such as oar-miR-125, oar-miR-127, oar-miR-200, and oar-miR-29 [35], and thus confirmed their involvement in hair development. [score:4]
[1 to 20 of 1 sentences]
85
[+] score: 4
In addition, 10 other miRNAs (miR-378-1/-2-3p, miR-127-3p, miR-191-5p, miR-486-2-5p, miR-143-3p, miR-10a-5p, miR-148a-3p, miR-99a-5p, miR-30e-5p, and miR-199a-1/-2-5p) (Fig. 2) in the set of the top 10 most highly expressed unique miRNAs over the five muscle development stages are related to various cell proliferation, myogenesis, and apoptosis responses. [score:4]
[1 to 20 of 1 sentences]
86
[+] score: 4
14 hsa-miR-127-5p 1708.96 hsa-miR-139-5p 1096.97 hsa-miR-146b-5p 1662.59 hsa-miR-23b-3p 1281.21 hsa-miR-193b-3p 1275.18 hsa-miR-320b 1148.60 hsa-miR-146a-5p 1135.37 hsa-miR-210 1055.20 hsa-miR-708-3p 1027.45 hsa-miR-769-5p 1004.10 hsa-miR-378d 1000.99 To determine if adjacent fascia exhibits a disease-like molecular phenotype, we compared the adjacent fascia biopsies with patient matched diseased Dupuytren’s fascia. [score:4]
[1 to 20 of 1 sentences]
87
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-214, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-206, hsa-mir-1-1, hsa-mir-128-2, hsa-mir-29c, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-148b, hsa-mir-133b, hsa-mir-424, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-128-1, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-503, hsa-mir-411, hsa-mir-378d-2, hsa-mir-208b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-17, ssc-mir-221, ssc-mir-133a-1, ssc-mir-1, ssc-mir-503, ssc-mir-181a-1, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-29a, ssc-mir-199a-2, ssc-mir-128-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-486-1, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-23b, ssc-mir-148b, ssc-mir-208b, ssc-mir-424, ssc-mir-127, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-411, ssc-mir-133a-2, ssc-mir-126, ssc-mir-199a-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-378j, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, hsa-mir-486-2, ssc-mir-378b
MiR-127, which is located within a CpG island with little research on myogenesis, showed similar expression pattern to ssc-miR-206, up regulated at 35 to 77 dpc and down regulated at 77 dpc to 180 dpn (Figure 5B), providing the possibility for further investigation concerning the function of ssc-miR-127 during muscle development. [score:4]
[1 to 20 of 1 sentences]
88
[+] score: 4
Other miRNAs from this paper: hsa-mir-155
Other studies have assessed that hsa-miR-127 up-regulation in EBV positive BL confirming different pathogenetic mechanisms between EBV -positive and EBV -negative BL [45]. [score:4]
[1 to 20 of 1 sentences]
89
[+] score: 4
Especially, the association between miRNA and extracellular matrix of chondrocyte has also been investigated: that microRNA-145 contributes to impaired extracellular matrix in OA cartilage 31, that microRNA-125b regulates the expression of ADAMTS-4 in human OA chondrocytes 20, and that microRNA-127-5p is an important regulator of MMP13 in human chondrocytes and may contribute to the development of OA 32. [score:4]
[1 to 20 of 1 sentences]
90
[+] score: 4
For example, miR-204 is primarily expressed in insulinomas and co-localizes mainly with insulin [43]; miR-127-3p and miR-184 are positively correlated with insulin biosynthesis and negatively correlated with glucose-stimulated insulin secretion (GSIS) [44]; miR-148 controls the insulin content in β-cells through regulation of the insulin repressor SOX6 [45] and miR-29 contributes to pancreatic β-cell dysfunction in prediabetic NOD Mice [46], and affects the release of insulin from β-cells by silencing of monocarboxylate transporter (MCT1) [47]. [score:4]
[1 to 20 of 1 sentences]
91
[+] score: 4
In this context, we observed a preferential down-regulation in region 14q32.31 including miRNA miR-127, miR-370, miR-299, miR-154, miR-154*, miR-323, miR-134, miR-368 and miR-337. [score:4]
[1 to 20 of 1 sentences]
92
[+] score: 4
The rest of co-expressed clusters were listed for regions at 6q13 (including mir-30a and mir-30c-2), Xp11.23 (including mir-362, mir-500, mir-501, mir-502 and mir-532), 14q32.2 (including mir-134, mir-379 and mir-382), 14q32.31 (including mir-127, mir-432 and mir-770), 9q22.32 (including let-7d, mir-23b and mir-27b) and 7q22.1 (including mir-93 and mir-106b) (Table 3). [score:3]
Loss of regions including 14q32.2 (location of mir-127, mir-432 and mir-770) and 14q32.31 (mir-134, mir-379, and mir-382) were reported in previous studies of renal cancer and osteosarcoma [16], [44]. [score:1]
[1 to 20 of 2 sentences]
93
[+] score: 4
Other miRNAs from this paper: mmu-mir-127
Jiang H MicroRNA-127-3p promotes glioblastoma cell migration and invasion by targeting the tumor-suppressor gene SEPT7Oncol. [score:4]
[1 to 20 of 1 sentences]
94
[+] score: 4
We ectopically expressed four miRNAs representing different clusters and/or miRNA-families: miR-770 located in the intron of MEG3, miR-136 from the miR-127~136 cluster, and miR-379 and miR-410 as the first and last miRNAs from the megacluster (Supplementary Fig.   7a). [score:3]
Among the ncRNAs are several lncRNAs, a box C/D snoRNA cluster, and 54 miRNAs, including the miR-127~136 cluster (7 miRNA-members), the miR-379~410 megacluster (42 miRNAs), and intronic miR-770. [score:1]
[1 to 20 of 2 sentences]
95
[+] score: 4
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-221, hsa-mir-200b, hsa-mir-151a, hsa-mir-151b
Tryndyak V. P. Ross S. A. Beland F. A. Pogribny I. P. Down-regulation of the microRNAs miR-34a, miR-127, and miR-200b in rat liver during hepatocarcinogenesis induced by a methyl -deficient diet Mol. [score:4]
[1 to 20 of 1 sentences]
96
[+] score: 4
Specifically, from among the miRNAs that are differentially expressed in estrogen -depleted mice, miR-127 and miR-136 negatively regulate bone mass [112], whereas miR-30b-5p may be a suitable serum biomarker for osteoporosis and osteopenia in postmenopausal women [93]. [score:4]
[1 to 20 of 1 sentences]
97
[+] score: 4
Other miRNAs from this paper: mmu-mir-127, hsa-mir-494, mmu-mir-494
Eight out of the ten analyzed 14q32 miRNAs were expressed by A549 cells at baseline conditions (namely miR-127,-379, -382, -409-3p, -412, -431, -494-3p and -543; Supplementary Figure 3B). [score:3]
We therefore analyzed a subset (n = 10) of those miRNAs (miR-127, -300, 370, -379, -382, -409-3p, -412, -431, -494-3p and -543) in a series of 57 NSCLC patients. [score:1]
[1 to 20 of 2 sentences]
98
[+] score: 4
Other miRNAs from this paper: hsa-mir-140
MicroRNA-127-3p promotes glioblastoma cell migration and invasion by targeting the tumor-suppressor gene SEPT7. [score:4]
[1 to 20 of 1 sentences]
99
[+] score: 4
These findings strongly suggest that aberrantly expressed miRNAs, such as miR-29ab, miR-183, and miR-127-3P, play significant roles in regulating the CD133+/CD326+ subpopulation of cells (Lin et al. 2012). [score:4]
[1 to 20 of 1 sentences]
100
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-127, mmu-mir-132, mmu-mir-133a-1, mmu-mir-136, mmu-mir-144, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-10b, mmu-mir-185, mmu-mir-190a, mmu-mir-193a, mmu-mir-203, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-10b, hsa-mir-34a, hsa-mir-203a, hsa-mir-215, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-144, hsa-mir-152, hsa-mir-136, hsa-mir-146a, hsa-mir-185, hsa-mir-190a, hsa-mir-193a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-337, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-29b-2, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, hsa-mir-337, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-215, mmu-mir-411, mmu-mir-434, hsa-mir-486-1, hsa-mir-146b, hsa-mir-193b, mmu-mir-486a, mmu-mir-540, hsa-mir-92b, hsa-mir-411, hsa-mir-378d-2, mmu-mir-146b, mmu-mir-193b, mmu-mir-92b, mmu-mir-872, mmu-mir-1b, mmu-mir-3071, mmu-mir-486b, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, hsa-mir-203b, mmu-mir-3544, hsa-mir-378j, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-let-7k, hsa-mir-486-2
MiR-127 was identified as a cardiac valve-enriched miRNA [34]; however, there were no previous reports on its role in skeletal muscle development. [score:2]
miRNA Fold Change P-value mmu-miR-337-5p −5.2 0.0149 mmu-miR-3544-3p −5.1 0.0147 mmu-miR-540-5p −4.9 0.0200mmu-miR-337-3p [a] −3.0 0.0324mmu-miR-3544-5p [a] −3.0 0.0308 mmu-miR-434-3p −2.1 0.0001 mmu-miR-3071-5p −2.0 0.0004mmu-miR-136-3p [a] −2.0 0.0004mmu-miR-3071-3p [a] −1.6 0.0000 mmu-miR-136-5p −1.6 0.0000 mmu-miR-143-5p −1.2 0.0004 mmu-miR-190a-5p −1.0 0.0139 mmu-miR-872-3p −0.9 0.0152 mmu-miR-193a-3p −0.9 0.0164 mmu-miR-144-3p −0.8 0.0298 mmu-miR-127-3p −0.7 0. 0002mmu-miR-434-5p [a] −0.6 0.0082 mmu-miR-148a-3p −0.6 0.0130 mmu-miR-411-5p −0.6 0.0091 a miRNA* (passenger) strand processed from opposite arm of the mature miRNA. [score:1]
Of the eight miRNAs located in the imprinted Dlk1-Dio3 region, four miRNAs, miR-127, -136, -434, and -3071, are located within anti-Rtl1, which contains seven miRNAs (Fig. S3, based on miRbase). [score:1]
[1 to 20 of 3 sentences]