sort by

126 publications mentioning hsa-mir-184 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-184. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 457
Other miRNAs from this paper: mmu-mir-184
The data showed that the up-regulation of miR-184 led to the obviously down-regulated expression of TNFAIP2 and reduced the expression of miR-184 resulted in the significant up-regulation of TNFAIP2 (Figure  3C-D). [score:14]
The present study demonstrated that miR-184 was markedly down-regulated in human glioma cells and tissues, TNFAIP2 was up-regulated in human glioma cells and tissues, and TNFAIP2 expression was inversely correlated with miR-184 expression. [score:11]
The up-regulated expression of miR-184 in U87 and U251 cells led to the obvious down-regulation of TNFAIP2 mRNA and protein expressions. [score:11]
Also, miR-184 targeted TNFAIP2 in vitro and in vivo, but it was neither elaborated upon nor proven whether the high expression of TNFAIP2 led to the process of invasion and proliferation in gliomas or whether miR-184 suppressed the survival and invasion of gliomas by down -regulating the expression of TNFAIP2. [score:10]
Also, the overexpression of miR-184 led to the down-regulation of TNFAIP2, and miR-184 regulated the expression of TNFAIP2 by binding to the 3′-UTR of TNFAIP2 mRNA. [score:9]
Up-regulation of miR-184 directly regulated the low expression of TNFAIP2 in human glioma cells. [score:8]
The results confirmed that both TNFAIP2 mRNA and protein expressions were substantially down-regulated by the high expression of miR-184 in gliomas. [score:8]
Up-regulation of miR-184 suppressed glioma cell proliferation in vitro and in vivo, induced apoptosis, and inhibited the cell cycle. [score:8]
Up-regulation of miR-184 suppressed glioma cell proliferation in vitro and in vivo, induced apoptosis, and inhibited the cell cycleAs shown in Figure  5C, the CCK-8 assay was performed to detect the effects of miR-184 on U87 and U25 cells growth in vitro. [score:7]
The up-regulation of miR-184 inhibited glioma cell proliferation and invasion and induced apoptosis. [score:6]
miR-184 could regulate TNFAIP2 expression and affected its translation in glioma. [score:6]
Emdad L, Janjic A, Alzubi MA, Hu B, Santhekadur PK, Menezes ME, et al. Suppression of miR-184 in malignant gliomas upregulates SND1 and promotes tumor aggressiveness. [score:6]
To examine whether miR-184 regulated TNFAIP2 expression in gliomas, U87 and U251 cells were infected with miR-184 mimic, inhibitor, negative control miRNA. [score:6]
For glioma, miR-184 exhibited a progression -associated down-regulation miRNA; Overexpression of miR-184 in A172 and T98G glioma cells significantly decreased cell viability and proliferation [17]. [score:6]
The results showed that miR-184 may regulate the expression of TNFAIP2 by binding to the 3′-UTR of TNFAIP2 mRNA and affecting its translation in gliomas. [score:6]
The miR-184 expression level was significantly increased after transfection with miR-184 mimic, while its expression was decreased after transfection with inhibitors, as compared to their corresponding negative control (miR-NC and anti-NC). [score:6]
Reducing the expression of miR-184 resulted in the significant up-regulation of TNFAIP2 mRNA and protein. [score:6]
Therefore, both TNFAIP2 mRNA and protein expressions were down-regulated by ectopic miR-184 in glioma cells. [score:6]
The overexpression of miR-184 inhibited the wound closure speed of U87 and U251 cells compared with the Negative group or inhibitor group. [score:6]
A. To keep a high transfection efficiency, qRT-PCR was used to detect the expression of miR-184 in U87 and U251 cells 48 h after transfection with miR-184 mimic, inhibitors, and the negative control miRNA. [score:5]
Recently, researchers have shown that miR-184 functions as a potential oncogene in human hepatocellular carcinoma by suppressing Sox7 expression [13]. [score:5]
In vitro, the proliferation of glioma cells was found to be significantly inhibited by the forced expression of miR-184. [score:5]
The miR-184 expression levels were determined in 49 glioma tissues and 5 glioma cell-lines by qRT-PCR analysis, which displayed a remarkable down-regulation of miR-184 in gliomas compared to 6 non-tumor brain tissues. [score:5]
A. shows that miR-184 overexpression induced apoptosis in U87 and U251 cells and down-regulated of miR-184 reduced apoptosis compared with Negative group. [score:5]
Foley et al. found that miR-184 ectopic overexpression in neuroblastoma cell-lines had pro-apoptotic and anti-proliferation functions through inhibiting AKT2, which was one downstream gene of the PI3K/AKT pathway [28]. [score:5]
Figure 3 The expression of miR-184 in U87 and U251 cells after transfection modulated the expression of TNFAIP2. [score:5]
Thus, miR-184 inhibited the progression of gliomas and may serve as a novel therapeutic target for the treatment of gliomas. [score:5]
B. shows that miR-184 expression in 5 glioma cell-lines was down-regulated compared to 6 normal brain tissues (N1, N2, N3, N4, N5, N6). [score:5]
These results suggested that low expression of miR-184 might be associated with the malignant glioma process and might act as a tumor suppressor in gliomas. [score:5]
Biological information software (Targetscan, miRwalk, miRanda) have predicted that TNFAIP2 was one of the miR-184 target genes (Figure  3B) and have characterized TNFAIP2 as a direct target of miR-184 by a dual-luciferase reporter assay in lung cancer cells [22]. [score:5]
Also, miR-184 down-regulation might be linked to glioma development. [score:5]
miR-184 could also inhibit glioma progression and might serve as a novel therapeutic target in glioma. [score:5]
B. shows the bioinformatic analysis using Targetscan, miRwalk, and miRanda, which predicted that miR-184 targeted TNFAIP2. [score:5]
The results of this experiment implied that miR-184 might be a suppressor gene and conformed that miR-184 could target TNFAIP2 in gliomas. [score:5]
Figure 1 miR-184 was down-regulated in human glioma tissues and glioma cell-lines. [score:4]
However, miR-184 functions both as oncogene and tumor suppressor in the development and progression of numerous cancers. [score:4]
D. depicts the results of the qRT-PCR analysis, which showed that miR-184 inhibited the mRNA expression of TNFAIP2 in U87 and U251 cells compared with their corresponding negative control. [score:4]
Up-regulation of miR-184 reduced the invasion and migration of U87 and U251 cells. [score:4]
TNFAIP2, which can be induced by treatment of TNF-α that with miR-184 can directly target TNFAIP2 in carcinoma (NPC) tissues, and is closely related to invasion and metastasis and poor survival in NPC patients [21]. [score:4]
Previous studies have shown that miR-184 was down-regulated in glioma cell-lines and tissues and decreased with the increasing degree of malignancy [17, 18], but too few cases were studied. [score:4]
Biological information software also predicted that miR-184 could directly target TNFAIP2 mRNA sequences at the region from 1870 to 1876. [score:4]
Wound healing and Matrigel invasion assays were performed to conclude that the overexpression of miR-184 markedly suppressed the invasiveness of U87 and U251 cells in comparison with the negative control group. [score:4]
In additional, Yuan et al. reported that miR-184 was significantly upregulated in human glioma cells. [score:4]
Even though previous studies have confirmed that miR-184 was down-regulated in gliomas and decreased with the increasing degree of malignancy, the number of cases used was too limited. [score:4]
C. shows the left panel, in which the Western blot analysis showed that miR-184 inhibited the expression of TNFAIP2 compared with the Mock group or the negative control miRNA group. [score:4]
Studies have shown that miR-184 was down-regulated in glioma and TNFα -induced protein 2 (TNFAIP2) was closely related to tumorigenesis. [score:4]
In vivo, the xenografted tumor size in the miR-184 overexpressing group were smaller than the miR-NC group. [score:3]
Figure  3A shows that the expressions of miR-184 in U87 and U251 cells after transfection were detected by qRT-PCR. [score:3]
The expression and function of TNFAIP2 have not been studied in gliomas; the relationship between TNFAIP2 and miR-184 also has not been studied. [score:3]
The collective data provided sufficient indication that miR-184 might serve as a tumor suppressor gene in gliomas. [score:3]
In vivo, U87 cells transduced with either lentiviral over-expressed miR-184 or control lentivirus were injected into nude mice subcutaneously and intracranial respectively. [score:3]
U87 and U251 cells were transfected with miR-184 mimic, miR-184 inhibitor, and their corresponding negative control (miR-NC and anti-NC) by Lipofectamine2000 (Invitrogen Inc. [score:3]
Cells (2 × 10 [3] per well) were seeded in a 96-well plate and incubated for 24 h. Then, the cells were transfected with miR-184 mimic, miR-184 inhibitor, or the negative control miRNA (Negative)at a final concentration of 50 nmol/L. [score:3]
It is reasonable to hypothesize that miR-184 inhibited the proliferation of glioma cells by increasing the percentage of early apoptotic cells, and it was suggested that miR-184 might be a novel specific biomarker for gliomas. [score:3]
The overexpression of miR-184 might play an onco-miRNA role in the anti-apoptotic and proliferation processes. [score:3]
Previous experimental studies have demonstrated that miR-184 acted as a modulator in the malignant progression of gliomas [17] and was expressed lower in glioma cells and tissues [18]. [score:3]
To achieve stable transfectant overexpression of miR-184 and negative control oligonucleotide, pLenti-miR-184-GFP and pLenti-NC-GFP (Genechem Co. [score:3]
Cells transfected with miR-184 mimic, inhibitor, or negative control miRNA were collected and resuspended in 400 μl of 1× binding buffer containing 5 μl 7-AAD (7-amino-actinomycin D) and 5 μl PI at room temperature in the dark for 10–15 min. [score:3]
TNFAIP2 expression and its correlation with miR-184 in gliomas have not been previously reported. [score:3]
In concordance with the previous results, Tivnan et al. have demonstrated that miR-184 mediated inhibition tumor growth and prolonged the survival time in an orthotopic murine mo del of neuroblastomas [16]. [score:3]
The expression level of miR-184 was low in 49 cases of glioma and 5 glioma cell-lines. [score:3]
Quantitative reverse transcriptase PCR (qRT-PCR) results demonstrated that miR-184 expression in 49 glioma tissues was markedly lower than in 8 noncancerous brain tissues and decreased with the increasing degree of malignancy in gliomas (low-grade vs high-grade, P < 0.01, Figure  1A, Table  1). [score:3]
To select stably expressed cells, U87 cells were transfected with pLenti-miR-184-GFP or pLenti-NC-GFP. [score:3]
The stable expression of U87 cells of miR-184 or miR-NC were established through a lentivirus infection method and inoculated into nude mice in intracranial and subcutaneous, respectively. [score:3]
Biological information software have predicted that miR-184 could target TNFα -induced protein 2 (TNFAIP2), Which was further validated by Western blot and qRT-PCR in glioma cells. [score:3]
Protein and mRNA expression of TNFAIP2 were inversely correlated with miR-184 in glioma. [score:3]
These findings suggested that miR-184 inhibited the migration and invasion of U87 and U251 cells in vitro. [score:3]
The sequences were as follows: miR-184 mimic, 5′-UGGACGGAGAACUGAUAAGGGUCCUUAUCAGUUCUCCGUCCAUU-3′; the negative control (miR-NC), 5′-UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT-3′; miR-184 inhibitor, 5′-ACCCUUAUCAGUUCUCCGUCCA-3′; and the negative control (anti-NC), 5′-CAGUACUUUUGUGUAGUACAA-3′. [score:3]
In human gliomas, TNFAIP2 was one of the specific targets of miR-184. [score:3]
The present study increased the glioma cases to further confirm the expression and function of miR-184 in gliomas. [score:3]
The immunohistochemical staining results also showed that the glioma xenografts of the U87-miR-184 group expressed less TNFAIP2 than the tumors in the U87 -negative group (Figure  4F). [score:3]
The average expression rate of Ki-67 is only 33% in U87 -miR-184 group, 75% in U87 negative group (p < 0.01) (Figure  4F). [score:3]
Real-time reverse-transcription PCR detected expression of miR-184 and TNFAIP2. [score:3]
The miR-184 binding site single nucleotide polymorphisms [SNP (rs8126 T > C)] in the 3′-UTR of TNFAIP2 modulated TNFAIP2 expression and contributed to susceptibility to squamous cell carcinoma of the head and neck (SCCHN) [22]. [score:3]
miRNA-184 is an oncogene in human hepatocellular carcinoma but acts as a tumor suppressor in tongue squamous cell carcinoma. [score:3]
F. shows that miR-184 reduced TNFAIP2 and ki-67 expression in an in vivo mice mo del. [score:3]
Meanwhile, miR-184 expression was also examined in glioma cell-lines (U87, U251, U373, A72, SHG44). [score:3]
The tumor size of the xenografts further confirmed that the U87 miR-184 overexpression group showed slower tumor growth than the U87 negative control group in vivo. [score:3]
Figure 6 miR-184 overexpression induced apoptosis and increased the cell population in the G0/G1 phase. [score:3]
The plasma expression levels of miR-184 were also associated with the presence of primary tumors and might be used as a novel cancer marker in tongue squamous cell carcinoma [14]. [score:3]
However, the high expression of miR-184 reportedly causes a decrease in cell numbers and increases apoptosis in neuroblastoma cell-lines [15]. [score:3]
All the experiments showed that miR-184 was a suppressor gene in the malignant procession and carcinogenesis of gliomas and may be used to develop a miRNA -based therapeutic strategy against glioma. [score:3]
Therefore, the expressions of miR-184 and TNFAIP2 were negatively correlated in gliomas. [score:3]
In vivo, the growth curve of tumor xenografts showed that high expression level of miR-184 obviously slowed tumor growth. [score:3]
The effects of miR-184 on malignant progression are debated because it can act as a tumor promoter or suppressor in some solid tumors [14, 13, 26]. [score:3]
It showed that miR-184 expression in 49 gliomas was markedly lower than in 8 non-cancerous brain tissues and decreased with the increasing degree of malignancy in gliomas (low grade vs high grade). [score:3]
These collective results suggested that TNFAIP2 is a genuine target of miR-184 in gliomas. [score:3]
Figure 4 miR-184 reduced glioma growth and TNFAIP2 expression in vivo in the mice mo del. [score:3]
A. shows the qRT-PCR analysis results of miR-184 expression in glioma tissues and normal brain tissues (NBT). [score:3]
To confirm the results of the present study, the number of glioma cases was increased to detect the expression of miR-184. [score:3]
A previous study showed that miR-184 directly targeted the 3′-UTR of TNFAIP2 using a dual-luciferase reporter assay in lung, head, and neck cancer cell-lines. [score:3]
miR-184 had a significant suppressive effect on glioma proliferation, migration, and invasion. [score:3]
Besides, a study by Emdad et al. confirmed that miR-184 is down-regulated in human malignant glioma cells and tumor tissue as compared with their non-neoplastic counterpart [18]. [score:3]
B. Transwell assay shows the invasion of U87 and U251 cells transfected with miR-184 mimics or inhibitor. [score:2]
The data demonstrated that the growth curve was significantly inhibited in the miR-184 mimic -transfected cells compared to the negative control groups, and there was a significant difference between the control (miR-NC)group and miR-184 group (Table  3). [score:2]
Contrarily, wound closure speed was improved by transfection with miR-184 inhibitor compared with Negative and miR-184 groups (Figure  5A). [score:2]
The IHC results of the nude mice intracerebral transplantation tumors also showed that U87 cells transfected with miR-184 had reduced ki-67 expression compared to the control group. [score:2]
As shown in our experiments, tumors were efficiently suppressed in miR-184 group compared to negative group (Figure  4A). [score:2]
Expression of miR-184 was significantly lower in glioma tissues and cell-lines compared to normal brain tissues. [score:2]
As demonstrated in Figure  1B, the expression of miR-184 was significantly reduced in 5 glioma cell-lines compared to 6 non-tumor brain tissues. [score:2]
A. Wound healing assay shows that the migration of U87 and U251 cells transfected with miR-184 mimics or inhibitor. [score:2]
In accordance with the results of the wound healing assay, the Transwell matrix penetration assay showed that the overexpression of miR-184 markedly suppressed the invasiveness of U87 and U251 cells compared to Negative and anti-miR-184 groups (Figure  5B). [score:2]
As in other reports, the results of the present study indicated that miR-184 could regulate TNFAIP2 in glioma cells. [score:2]
U87 and U251 cells were transfected with miR-184 mimic, inhibitor, or negative control miRNA, and their invasion abilities were assayed. [score:2]
Concordantly, U87 and U251 cells transfected with miR-184 mimic had a higher apoptosis rate, triggering an accumulation of cells at the G0/G1 phase and decreased cells in S-phase. [score:1]
Whether miR-184 inhibits glioma survival by blocking the PI3K/AKT2 pathway needs further investigation. [score:1]
U87-miR-184 and U87-miR-NC cells were established and inoculated into nude mice (4 to 5 weeks old) in intracranial (1 × 10 [5]) and subcutaneous (1 × 10 [6]) fashions, respectively (n = 6 /group). [score:1]
Representative intracranial H&E stainings of xenograft tumors in nude mice showed that miR-184 reduced glioma growth, as shown in Figure  4E. [score:1]
Figure 5 Up-miR-184 reduced the invasiveness and growth of glioma cells. [score:1]
B. - D. show that miR-184 reduced glioma growth in the subcutaneous glioma nude mice mo del. [score:1]
This study aimed to determine the functions of miR-184 in glioma and the mechanisms of miRNA-184-TNFAIP2 mediated glioma progression. [score:1]
In vitro, proliferation and invasion abilities were also decreased in U87 and U251 cells after transfection with miR-184 mimic. [score:1]
A. shows the T2-weighted MRI imaging of subcutaneous tumor growth at days 25 and 35 in U87-miR-184 and U87-Negative nude mice (red arrows indicate tumors). [score:1]
This study confirmed that miR-184 was lower in glioma cell-lines and in 49 glioma specimens than in normal brain tissues. [score:1]
The role of miR-184 in growth was next explored in vivo. [score:1]
miR-184 is particularly enriched in the brain and testes in humans and is located in region 25.1 on the q-arm of chromosome 15. [score:1]
The functions and exact mechanisms of miR-184 in glioma are poorly uderstood. [score:1]
The miR-184 expression level was measured using All-in-One™miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD, USA) according to the instructions. [score:1]
miR-184 performed an important function in glioma invasion. [score:1]
miR-184 effects on glioma cell apoptosis and cell cycle were assessed by flow cytometer. [score:1]
E. shows the representative H&E staining, which revealed that miR-184 reduced glioma growth in the encephalic glioma nude mice mo del. [score:1]
In gastric cancer and SCCHN, miR-184 bonded to the 3′-UTR of TNFAIP2, and the miR-184 binding site single nucleotide polymorphisms in TNFAIP2 contributed to tumor susceptibility [22, 30]. [score:1]
The present study identified that miR-184 induced the apoptosis of U87 and U251 cells, increased the cell population in the G0/G1 phase, and reduced the percentage of cells in the S phase. [score:1]
Cell proliferation was dramatically decreased in U251 and U87 cells after transfection with miR-184. [score:1]
The results indicated that the proportion of apoptosis cells transfected with miR-184 was significantly higher than in the anti-miR-184 group and the negative group (Figure  6A). [score:1]
The wound healing assay showed that miR-184 expression reduced the wound closure speed of U87 and U251 cells compared with negative control oligonucleotide (Negative) and anti-miR-184 groups. [score:1]
To illustrate the mechanisms how miR-184 modulates glioma cell growth, flow cytometry was applied to detect the effects of miR-184 on cell apoptosis and the cell cycle. [score:1]
The left panel shows representative pictures of up-miR-184, which increased the apoptosis of U87 and U251 cells. [score:1]
miR-184 TNFAIP2 Proliferation Invasion Glioma Gliomas are the most common and lethal primary brain tumors in adults. [score:1]
[1 to 20 of 129 sentences]
2
[+] score: 393
Exogenous hsa-miR-184 expression was remarkably up-regulated in cells transfected with hsa-miR-184 mimic (Figure 3A), and endogenous hsa-miR-184 expression was down-regulated in cells transfected with hsa-miR-184 inhibitor (Figure 3B). [score:13]
C-F. Proliferative rates of ARPE-19 cells transfected with NC mimic (C), hsa-miR-184 mimic (C), NC inhibitor (E), and hsa-miR-184 inhibitor (E), and migration of ARPE-19 cells transfected with NC mimic (D), hsa-miR-184 mimic (D), NC inhibitor (F), and hsa-miR-184 inhibitor (F). [score:9]
Q-PCR results indicated that knocking down of dre-miR-184 will suppress the expression of RPE markers, while overexpression of dre-miR-184 can promote RPE development (Figures 4C-4D). [score:9]
Ectopic hsa-miR-184 overexpression elevated both mRNA and protein expressions of the RPE markers (Figures 3C, 3E-3F), while hsa-miR-184 insufficiency suppressed their expressions (Figures 3D, 3E, and 3G). [score:9]
Human and zebrafish miRNA mimics and inhibitors, including NC mimic, NC inhibitor, hsa-miR-184 mimic, hsa-miR-184 inhibitor, dre-miR-184 mimic, and dre-miR-184 inhibitor, were purchased from GenePharma Co. [score:9]
C-F. Four differentially expressed miRNAs with fold change of over 2 among all time points, including the up-regulated hsa-miR-184 (C), hsa-miR-449a (D), hsa-miR-449b-5p (E), and the down-regulated hsa-miR-302d-3p (F), were selected for validation of the microarray results in hiPSC-RPE at 0, 30, 60, and 90 dpd. [score:9]
AKT2 is a direct target of hsa-miR-184 in RPE cellsPrevious study suggested that hsa-miR-184 suppressed AKT2 expression in neuroblastoma [24]. [score:8]
Both proliferation and migration were inhibited by hsa-miR-184 overexpression at all time points post transfection (Figures 6C-6D), and cell proliferative and migratory rates were increased in cells with endogenous hsa-miR-184 down-regulated (Figures 6E-6F). [score:8]
Altogether, our findings supported that hsa-miR-184 directly targets AKT2 3′-UTR and suppresses AKT2 expression in RPE. [score:8]
Figure 7Hsa-miR-184 is down-regulated in dysfunctional RPE, and AKT2 is up-regulated in AMD A. Relative RNA expressions of hsa-miR-184, AKT2, RPE65, RLBP1, BEST1, and LRAT in the macular RPE of an aged donor compared to a young donor. [score:8]
G-H. Relative mRNA expressions of MITF, RPE65, RLBP1, LRAT, BEST1, KRT18, and CTNNB1 in hiPSC-RPE at 30 dpd transfected with hsa-miR-184 mimic plus empty expression vector compared to hsa-miR-184 mimic plus AcFlag-AKT2 (G), and in cells transfected with hsa-miR-184 inhibitor plus scramble siRNA compared hsa-miR-184 inhibitor plus AKT2-siRNA (H). [score:7]
Hsa-miR-184 is down-regulated in dysfunctional RPE, and AKT2 is up-regulated in AMD. [score:7]
Agreed with the microarray data, hsa-miR-184, hsa-miR-449a and hsa-miR-449b-5p were consistently up-regulated along with the differentiation, while hsa-miR-302d-3p was down-regulated (Figures 1C-1F). [score:7]
In the present study, we confirm that AKT2 is a direct target for miR-184 in ARPE-19 cells, and miR-184 promotes RPE differentiation via suppression of AKT2. [score:6]
Figure 4Dre-miR-184 promotes retinal development in vivo A-B. Relative expression of dre-miR-184 in zebrafish injected with dre-miR-184 inhibitor compared to NC inhibitor (A), and in embryos injected with dre-miR-184 mimic compared with NC mimic (B). [score:6]
MiR-184 -based supplementary therapeutics and mTOR pathway inhibitor, like rapamycin, can inhibit RPE dedifferentiation in dry AMD and may become prospective options for treating retinal degenerative diseases. [score:6]
Q-PCR analysis revealed that overexpression of exogenous hsa-miR-184 down-regulates the AKT2 mRNA level in 30 dpd hiPSC-RPE (Figure 5C). [score:6]
Hsa-miR-184 targets the AKT2/mTOR pathway, and inhibits cell proliferation and migration. [score:5]
The mutated miR-184 antagonizes miR-205 to maintain the expression of the inositol polyphosphate phosphatase-like 1 (INPPL1) gene, which generates the disease phenotype [19]. [score:5]
We further aimed to tell whether the effect of hsa-miR-184 on AKT2 expression is a direct effect of hsa-miR-184 targeting AKT2 3′-UTR using luciferase reporter assay. [score:5]
Overexpression of miR-184 promotes RPE differentiation, while miR-184 insufficiency could suppress RPE differentiation. [score:5]
Taken together, our results suggested that hsa-miR-184 suppresses the AKT2/mTOR signaling pathway, and inhibits cell proliferation and migration. [score:5]
Embryos at 1- to 2-cell stage (0 dpf) were grouped and injected with 1 nl solution containing 4 μM the abovementioned NC mimic, NC inhibitor, dre-miR-184 mimic, or dre-miR-184 -inhibitor, respectively. [score:5]
As shown in Figure 6A, western blot analysis revealed decreased phosphorylation of AKT2 [Ser474], mTOR [Ser2448], and p70S6K [Thr389] in 30 dpd hiPSC-RPE overexpressing hsa-miR-184, suggesting that hsa-miR-184 could inhibit the AKT2/mTOR pathway. [score:5]
A-B. Relative expression of dre-miR-184 in zebrafish injected with dre-miR-184 inhibitor compared to NC inhibitor (A), and in embryos injected with dre-miR-184 mimic compared with NC mimic (B). [score:5]
Figure 5Hsa-miR-184 targets the AKT2/mTOR pathway, and inhibits cell proliferation and migration A. Schematic construction of reporter containing a fragment of the wild type and mutant AKT2 3′-TUR. [score:5]
Previous study suggested that hsa-miR-184 suppressed AKT2 expression in neuroblastoma [24]. [score:5]
A-B. Relative miRNA expression of hsa-miR-184 in hiPSC-RPE at 30 dpd transfected with hsa-miR-184 mimic compared to NC mimic (A), and in cells transfected with hsa-miR-184 inhibitor compared to NC inhibitor (B). [score:5]
Since hsa-miR-184 could inhibit mTOR, we, therefore, assumed that hsa-miR-184 expression will be reduced in dysfunctional RPE. [score:5]
C-D. Relative mRNA expressions of RPE65, RLBP1, MERTK, BEST1, and TJP1 in hiPSC-RPE at 30 dpd transfected with hsa-miR-184 mimic compared to NC mimic (C), and in cells transfected with hsa-miR-184 inhibitor compared to NC inhibitor (D). [score:5]
As above mentioned, hsa-miR-184 expression was consistently increased along with RPE differentiation (Figure 1C), we then respectively transfected hsa-miR-184 mimic and inhibitor into hiPSC-RPE at 30 dpd to see its role on cell differentiation. [score:5]
Hsa-miR-184 suppresses the AKT2/mTOR pathway, and inhibits cell proliferation and migration. [score:5]
Figure 3 A-B. Relative miRNA expression of hsa-miR-184 in hiPSC-RPE at 30 dpd transfected with hsa-miR-184 mimic compared to NC mimic (A), and in cells transfected with hsa-miR-184 inhibitor compared to NC inhibitor (B). [score:5]
Embryos at 1- to 2-cell stage were individually injected with dre-miR-184 mimic or inhibitor to modulate its exogenous or endogenous dre-miR-184 expression (Figures 4A-4B). [score:5]
E-G. Relative protein expressions of MERTK, LRAT, ZO-1, Keratin 18, RLBP1, and β-catenin in hiPSC-RPE at 30 dpd transfected with hsa-miR-184 mimic compared to NC mimic (E-F), and in cells transfected with hsa-miR-184 inhibitor compared to NC inhibitor (E, G). [score:5]
AKT2 expression was found consistently decreased along with the differentiation from hiPSC to RPE as demonstrated in Figure 5D, which was inversely correlated to the expression pattern of hsa-miR-184 (Figure 2C). [score:5]
C-D. Relative mRNA expressions of pax6a, rpe65c, rlbp1b, lrat, mertka, best1, krt18, cdh2, tjp1b, and ctnnb1 in zebrafish injected with dre-miR-184 inhibitor compared to NC inhibitor (C), and in embryos injected with dre-miR-184 mimic compared with NC mimic (D). [score:5]
Our results were consistent with the previous report that hsa-miR-184 expression was inhibited in the RPE of donors with AMD [19], and further implied that hsa-miR-184 may play a role in keeping regular function of RPE. [score:5]
We have also reasoned that miR-184 suppresses the AKT2/mTOR signaling pathway, promotes RPE differentiation, and inhibits RPE proliferation and migration. [score:5]
As indicated above, hsa-miR-184 would promote RPE differentiation, and AKT2 was a direct target of hsa-miR-184. [score:4]
Antisense hsa-miR-184 oligonucleotides are used as hsa-miR-184 inhibitor, which binds directly to the single strand mature hsa-miR-184 to block its activity [26]. [score:4]
Our findings suggested that dre-miR-184 functions in maintaining the regular function of zebrafish RPE, and its insufficiency would suppress RPE development. [score:4]
Hsa-miR-184 was constantly up-regulated along with the differentiation from hiPSC to RPE. [score:4]
Mature miR-184, containing 22 nucleotides, shows tissue and developmental stage specific expression patterns [17, 18]. [score:4]
Consistent to mRNA findings, immunofluorescence revealed decreased reactivity of retinoid isomerohydrolase (encoded by rpe65c; NP_000320), a marker of RPE cells, in the RPE layer of zebrafish injected with dre-miR-184 inhibitor (Figures 4E-4H) compared to embryos injected with NC inhibitor (Figures 4I-4L). [score:4]
As expected, hsa-miR-184 level was found remarkably down-regulated in the aged donor with RPE dysfunction (Figure 7A). [score:4]
Dre-miR-184 insufficiency suppresses RPE development in vivo. [score:4]
This finding implies that in order to sustain RPE function and survival, miR-184 may also modulate the expressions of regulatory factors, like other miRNAs and long non-coding RNAs. [score:4]
A total of 78 miRNAs are initially sorted out, among which miR-184 is the most up-regulated signature along with the differentiation, and its crucial role in RPE differentiation is further confirmed in both cellular and zebrafish mo dels. [score:4]
AKT2 is a direct target of hsa-miR-184 in RPE cells. [score:4]
Reduction in miR-184 expression will decrease level of EZR-bounded LAMP-1 and interrupt RPE phagocytosis [19]. [score:3]
Since cellular proliferation and migration can follow the dedifferentiation of postmitotic tissues, including RPE, and activation of mTOR pathway have been reported to enhance cell proliferation and migration [16, 27– 30], we next determined whether hsa-miR-184 would inhibit proliferation and migration of ARPE-19 cells. [score:3]
Hsa-miR-184 is decreased in dysfunctional RPE, and AKT2 is increased in AMDActivation of mTOR signaling pathway is reported to cause RPE dedifferentiation and retinal degenerative diseases, namely AMD [1]. [score:3]
Previous study has revealed that miR-184 expression is decreased in RPE of AMD donors [19]; however, its role in AMD pathogenesis, especially in RPE dedifferentiation, is still largely unknown. [score:3]
via suppression of AKT2We next tested whether AKT2 could affect the promotive effect of hsa-miR-184 on RPE differentiation. [score:3]
Hsa-miR-184 mimic comprises chemically synthesized oligonucleotides identical to the sequence of endogenous hsa-miR-184, which will be loaded into the RNA -induced silencing complex (RISC) and silence target genes like endogenous hsa-miR-184 [25]. [score:3]
Collectively, our data implied that hsa-miR-184 promotes RPE differentiation via suppression of AKT2. [score:3]
Ezrin (EZR) gene is the only reported target of miR-184 involved in RPE functions. [score:3]
Herein, consistent to previous findings, we show that miR-184 expression is remarkably reduced in the macular RPE of a donor with RPE dysfunction, indicating its role in maintaining regular functions of RPE cells. [score:3]
Initial assessments were carried out to see whether AKT2 expression levels are inversely related to hsa-miR-184 levels. [score:3]
We also demonstrate that miR-184 blocks the AKT2/mTOR signaling pathway and suppresses cell proliferation and migration. [score:3]
Taken together, our study concludes that miR-184 promotes RPE differentiation via inhibiting the AKT2/mTOR signaling pathway, and miR-184 insufficiency plays an important role in the pathogenesis of dry AMD. [score:3]
RNA isolation, RT-PCR, and real-time PCR were carried out to determine the expression levels of dre-miR-184 and several RPE markers. [score:3]
C. mRNA expression of AKT2 were analyzed in 30 dpd hiPSC-RPE transfected with NC mimic or hsa-miR-184 mimic, respectively. [score:3]
Hsa-miR-184 promotes RPE differentiation via suppression of AKT2. [score:3]
Cellular mo del also proves that the expression level of miR-184 associates with RPE differentiation. [score:3]
We showed that AKT2 overexpression abrogated the hsa-miR-184 mediated RPE differentiation (Figure 5F). [score:3]
AKT2 has been proved as a target for miR-184 in neuroblastoma cell line [24], while their interaction in RPE cells remains inclusive. [score:3]
Dre-miR-184 insufficiency suppresses RPE development in vivoWe next used zebrafish mo del to investigate the role of dre-miR-184 on RPE development. [score:3]
RAC-beta serine/threonine-protein kinase (AKT2; NM_001626) was found as a target for hsa-miR-184 (Figure 2G) [24]. [score:3]
We then focused on studying whether AKT2 is a potential target of hsa-miR-184 in RPE cells. [score:3]
By contrast, the dre-miR-184 mimic injection group showed robust expression of retinoid isomerohydrolase in the RPE layer (Figures 4M-4P), similar to the NC mimic injection group (Figures 4Q-4T). [score:3]
To confirm that AKT2 was inhibited by hsa-miR-184 in RPE, we next measured the expression of AKT2 in 30 dpd hiPSC-RPE transfected with hsa-miR-184 mimic. [score:3]
Further, silencing of AKT2 rescued the inhibition on RPE differentiation induced by hsa-miR-184 insufficiency (Figure 5F). [score:3]
Dre-miR-184 promotes retinal development in vivo. [score:2]
To test our hypothesis, we compared the expression of hsa-miR-184 between the macular RPE of a 70-year-old male and a 30-year-old female donor. [score:2]
B. Schematic of the hsa-miR-184 regulatory network. [score:2]
The impact of miR-184 on promoting RPE development is further confirmed in zebrafish mo del. [score:2]
Other than retinopathy, miR-184 seed region mutations are reported to cause EDICT syndrome, presenting familial keratoconus with cataract [35, 36]. [score:2]
Since hsa-miR-184 was reported to present a decreased expression pattern in AMD patients, we next tested and compared the macular and extramacular AKT2 mRNA levels in RPE-choroid from normal individuals and AMD patients. [score:2]
A. Relative RNA expressions of hsa-miR-184, AKT2, RPE65, RLBP1, BEST1, and LRAT in the macular RPE of an aged donor compared to a young donor. [score:2]
A fragment from the 3′-UTR of the AKT2 gene bearing its binding region with has-miR-184 were synthesized and cloned into the firefly pMIR-GLO™ luciferase vector (pMIR, Invitrogen) using SacI and XhoI restriction sites to construct the recombinant plasmid AKT2 [WT] and AKT2 [MU]. [score:1]
Hsa-miR-184 is decreased in dysfunctional RPE, and AKT2 is increased in AMD. [score:1]
The role of miR-184 in AMD pathogenesis, especially in RPE dedifferentiation, is still largely unknown. [score:1]
Reduction in RPE markers is observed in embryos with miR-184 silenced. [score:1]
In addition, abnormal methylation status of MIR-184 has also been found correlated with Rett syndrome, presented with autism spectrum disorders and involving irregular synaptic plasticity [18]. [score:1]
However, introduction of 3 single nucleotides located in the core binding region of AKT2 completely abolished the ability of hsa-miR-184 mimic to decrease luciferase activity (Figure 5B). [score:1]
A. of p-AKT2, AKT2, p-mTOR, mTOR, p-p70S6K, p70S6K in 30 dpd hiPSC-RPE transfected with NC mimic/hsa-miR-184 mimic. [score:1]
Hsa-miR-184 promotes RPE differentiation. [score:1]
We therefore hypothesized that hsa-miR-184 might promote RPE differentiation via blocking the AKT2/mTOR signaling pathway (Figure 6B). [score:1]
Our findings suggested that hsa-miR-184 promotes the differentiation of hiPSC-RPE. [score:1]
Hsa-miR-184 promotes cell differentiation. [score:1]
Further analysis suggested that, opposite to the decreased hsa-miR-184 level, AKT2 mRNA was elevated in the macular RPE of the above mentioned aged donor with RPE dysfunction (Figure 7B). [score:1]
Thus, deep investigations into the regulatory network and epigenetic regulation of miR-184 in maintaining RPE function may become part of our future work. [score:1]
In this study, we aim to analyze the effect of miR-184 in RPE differentiation. [score:1]
We next tested whether AKT2 could affect the promotive effect of hsa-miR-184 on RPE differentiation. [score:1]
Figure 6 A. of p-AKT2, AKT2, p-mTOR, mTOR, p-p70S6K, p70S6K in 30 dpd hiPSC-RPE transfected with NC mimic/hsa-miR-184 mimic. [score:1]
Further work is still warranted to better elucidate the role of miR-184 in AMD pathogenesis. [score:1]
A fragment from the 3′-UTR of the AKT2 gene bearing its binding region with hsa-miR-184 was cloned into the firefly pMIR-GLO™ luciferase vector (pMIR, Invitrogen) to construct the recombinant plasmid AKT2 [WT] (Figure 5A). [score:1]
[1 to 20 of 99 sentences]
3
[+] score: 381
Ectopic expression of miR-184 promotes the proliferation and tumorigenicity of HCC cells by targeting the 3′-UTR of SOX7 mRNA and suppressing its expression. [score:9]
The results showed that the mRNA of Cyclin D1, MYC, LEF1, and TCF were significantly upregulated by ectopic miR-184, whereas they were downregulated by inhibition of miR-184 (Figure 4D). [score:9]
The anchorage-independent growth assay revealed that Hep3B-miR-184 -inhibitor and Huh7-miR-184 -inhibitor cells produced fewer and smaller colonies than the negative control cells, indicating the inhibitory function of the miR-184 inhibitor on HCC tumorigenicity (Figure 3D). [score:8]
By contrast, the expression of c-Myc and Cyclin D1 were downregulated, and Rb phosphorylation was decreased, in cells transfected with the miR-184 inhibitor (Figure 4E). [score:8]
The result showed that Cyclin D1, MYC, and LEF1 were upregulated in HCC tissues and the expression levels were positively correlated with the expression of miR-184 (Figure S3). [score:8]
Our present study suggested that miR-184 promotes cell proliferation, tumorigenicity and cell cycle progression in HCC cells by targeting SOX7 mRNA and suppressing its expression. [score:7]
To explore the molecular mechanism of miR-184 function in HCC cells, we used publicly available algorithms (TargetScan, Pictar and miRANDA, which are public compilation of databases and web portals and servers used for microRNAs and their targets) to predict the target(s) of miR-184 in humans. [score:7]
These results suggested that silencing SOX7 expression in miR-184-repressed cells could reverse the inhibitory effect of the miR-184 inhibitor on HCC cell proliferation. [score:7]
Moreover, we presented data indicating that SOX7 is a direct target of, and is downregulated by, miR-184. [score:7]
B. The expression levels of SOX7 protein in THLE3 cells, Hep3B and Hep3B transfected with miR-184 inhibitor cells, Huh7 and Huh7 transfected with miR-184 inhibitor cells. [score:7]
They found miR-184 might play a role in proliferation of HCC cells by regulating INPPL1 expression and act as anti-apoptotic factor in HCC development by inhibiting the activities of caspases 3/7 [35]. [score:7]
Moreover, the expression of c-Myc and Cyclin D1 proteins were upregulated, and phosphorylated Rb was increased in miR-184 overexpressing cells compared with the negative control cells (Figure 4E). [score:7]
The miR-184 mimic, miR-184 inhibitor (miR-184 inhibitor is a LNA/OMe modified antisense oligonucleotide designed specifically to bind to and inhibit endogenous miR-184 molecule) and negative control were purchased from RiboBio. [score:7]
Our study revealed that miR-184 is upregulated in HCC and promotes HCC cell proliferation in vitro and suggested an oncogenic role of miR-184 in HCC and identify a possible target for HCC diagnosis and therapy. [score:6]
Figure S5 HCC proliferation is markedly promoted by miR-184 inhibition and SOX7 upregulation. [score:6]
B. The expression levels of SOX7 protein in HCC cells overexpressing miR-184 or transfected with miR-184 inhibitor, compared with control cells, by western blotting 48 hours after transfection; α-Tubulin served as the loading control. [score:6]
As predicted, western blotting revealed that SOX7 expression decreased in HepG3 and Huh7 cells, compared with normal cells THLE3, and further decreased in HepG3 and Huh7 cells overexpressing miR-184 and increased in cells transfected with the miR-184 inhibitor (Figure 4B, Figure S2B). [score:6]
The results reveal that miR-184 is overexpressed in HCC and overexpression of miR-184 promotes cell proliferation and tumorigenesis in human HCC cells. [score:5]
A. Real-time PCR analysis of miR-184 expression in Hep3B and Huh7 cells transfected with miR-184 inhibitor. [score:5]
A. Schematic representation of the mature miR-184 sequence, miR-184 target site in the 3′-UTR of SOX7 mRNA and a 3′-UTR mutant of SOX7 mRNA containing three altered nucleotides in the putative target site (SOX7-3′UTR-mut). [score:5]
The average miR-184 expression was normalized using U6 expression. [score:5]
By contrast, a SOX7 3′-UTR -luciferase reporter with a mutant miR-184 binding site seed sequence was not inhibited by ectopic expression of miR-184 (Figure 4C). [score:5]
A. The expression levels of SOX7 in miR-184 -inhibitor transfected HCC cells that overexpressing SOX7, as measured by western blotting; α-Tubulin served as the loading control. [score:5]
These data confirmed that miR-184 promotes HCC cell proliferation and tumorigenicity by repressing endogenous SOX7 expression, and that SOX7 suppression is essential for miR-184 -mediated HCC cell proliferation. [score:5]
B. The correlation between miR-184 expression and Cyclin D1, MYC or LEF1 expression in HCC tissues. [score:5]
A. Real-time PCR analysis of miR-184 expression in Hep3B and Huh7 cells stably overexpressing miR-184. [score:5]
The negative regulation of SOX7 by miR-184 leads to upregulation of c-Myc, CyclinD1 and Rb phosphorylation (Figure 6). [score:5]
Consistently, the growth rate of miR-184 -inhibited cells was further inhibited by SOX7 overexpresion (Figure S5). [score:5]
Among the putative targets of miR-184 in the publicly available algorithms, SOX7 is reported to have a tumor-suppressive function in tumors [19]– [24]. [score:5]
0088796.g002 Figure 2 A. Real-time PCR analysis of miR-184 expression in Hep3B and Huh7 cells stably overexpressing miR-184. [score:5]
0088796.g003 Figure 3 A. Real-time PCR analysis of miR-184 expression in Hep3B and Huh7 cells transfected with miR-184 inhibitor. [score:5]
B. The growth rates in miR-184 -inhibited and SOX7 -overexpressing cells, as indicated by the MTT assay. [score:4]
We further found that ectopic expression of miR-184 in HCC cells led to the promotion of cell proliferation, tumorigenicity and cell cycle regulation. [score:4]
SOX7 is a Direct Target of miR-184 in HCC Cells. [score:4]
One comprehensive microRNA profiling of prostate cancer showed that miR-184 was upregulated in high grade tumors [30]. [score:4]
Collectively, our results suggested that SOX7 is a direct target of miR-184. [score:4]
The results suggested that upregulation of miR-184 promoted the proliferation and tumorigenicity of HCC cells in vitro. [score:4]
Upregulation of miR-184 represses SOX7 and promotes cell proliferation in HCC. [score:4]
In the present study, we found that miR-184 is upregulated in HCC cell lines and tissues. [score:4]
Furthermore, we identified SOX7 mRNA as a direct and functional target of miR-184. [score:4]
To examine whether miR-184 mediated-SOX7 downregulation was effected via the 3′-UTR of SOX7, the SOX7-3′-UTR fragment, containing miR-184 binding site, was subcloned into a pGL3 luciferase reporter vector. [score:4]
Mature miR-184 was also found to be upregulated in squamous cell carcinoma of the tongue. [score:4]
In this study, we showed that miR-184 is upregulated in HCC cell lines and tissues. [score:4]
These results suggested that downregulation of miR-184 could reduce the proliferation and tumorigenicity of HCC cells. [score:4]
MiR-184 inhibits neuroblastoma cell survival and promotes apoptosis by targeting AKT2 [33]. [score:4]
0088796.g006 Figure 6 Upregulation of miR-184 represses SOX7 and promotes cell proliferation in HCC. [score:4]
The results of the luciferase reporter assay showed that ectopic expression of miR-184 decreased, and suppression of miR-184 increased, the luciferase activity of the SOX7 3′-UTR-luciferase reporter. [score:4]
The results showed that suppression of miR-184 significantly decreased the growth rate of Hep3B, Huh7 and THLE3, when transfected with the miR-184 inhibitor, compared with that of NC transfected cells (Figure 3, B and C, and Figure S2A). [score:4]
MiR-184 directly targets the 3′-UTR of SOX7 mRNA. [score:3]
To further test whether endogenous miR-184 helps to sustain the proliferative property of HCC cells, loss-of-function studies using a miR-184 inhibitor were performed (Figure 3A). [score:3]
Other studies showed that miR-184 has a tumor-suppressive role in cancers. [score:3]
By analyzing a published micro-array -based high-throughput assessment (NCBI/GEO/GSE31384), miR-184 was identified to be significantly upregulated in HCC tissues compared with that in matched noncancerous hepatic tissues. [score:3]
Expression of miR-184 is elevated in HCC. [score:3]
Ectopic Expression of miR-184 Enhances Proliferation of HCC Cells. [score:3]
Comparative analysis also revealed that miR-184 was significantly upregulated in eight pairs of cancerous tissues compared with the adjacent noncancerous hepatic tissues (Figure 1B, Figure S1). [score:3]
Inhibition of miR-184 in tongue SCC cells reduced cell proliferation and induced apoptosis [31]. [score:3]
B. The expression of miR-184 was examined in eight paired cancerous tissues (T) and their adjacent noncancerous hepatic tissues (ANT), showed in a boxplot. [score:3]
Inhibition of miR-184 reduces the proliferation of HCC cells. [score:3]
SOX7 Suppression is Critical for miR-184 -induced Cell Proliferation in HCC. [score:3]
Figure S3 The expression of miR-184, and Wnt/β-catenin signaling related genes in HCC tissues. [score:3]
A. The expression levels of SOX7 in miR-184 -inhibitor transfected HCC cells that were transfected with SOX7-siRNA#1, as measured by western blotting; α-Tubulin served as the loading control. [score:3]
Figure S1 The expression of miR-184 was examined in eight paired cancerous tissues (T) and their adjacent noncancerous hepatic tissues (ANT). [score:3]
Collectively, we believe that miR-184 plays an essential role in the progression of HCC and might represent a therapeutic target for HCC. [score:3]
Collectively, our results showed that miR-184 was overexpressed in HCC cell lines and tissues. [score:3]
Figure S4 A. The expression levels of SOX7 in miR-184 -inhibitor transfected HCC cells that were transfected with SOX7-siRNA#2, as measured by western blotting; α-Tubulin served as the loading control. [score:3]
The results indicated that SOX7 was one of the potential targets of miR-184 (Figure 4A). [score:3]
0088796.g005 Figure 5 A. The expression levels of SOX7 in miR-184 -inhibitor transfected HCC cells that were transfected with SOX7-siRNA#1, as measured by western blotting; α-Tubulin served as the loading control. [score:3]
Inhibition of miR-184 Reduces Proliferation of HCC Cells. [score:3]
Nevertheless, the expression level of miR-184 in HCC and its clinical relevance, require further study. [score:3]
To determine the effect of miR-184 on HCC progression, Hep3B and Huh7 cells stably overexpressing miR-184 were established for further study (Figure 2A). [score:3]
pMSCV-miR-184, the miR-184 expression plasmid, was generated by cloning the genomic pre-miR-184 gene with 300-bp on each flanking side into the retroviral transfer plasmid pMSCV-puro (Clontech Laboratories Inc. [score:3]
E. Flow cytometry analysis of indicated HCC cells transfected with miR-184 -inhibitor or NC. [score:3]
In addition, SOX7 suppression is essential for miR-184 -induced cell proliferation in HCC. [score:3]
An MTT assay showed that ectopic expression of miR-184 significantly increased the growth rate of Hep3B and Huh7 cells (Figure 2B). [score:2]
MiR-184 Expression is Elevated in HCC. [score:2]
Thus, miR-184 plays essential role during the regulation of SOX7 in HCC cells in vitro. [score:2]
A. Real-time PCR analysis of miR-184 expression in hepatocellular carcinoma cell lines (Hep3B, BEL-7402, MHCC97H, HCCC-9810, MHCC97L, Huh7, QGY-7703 and HepG2), compared with normal liver epithelial THLE3 cells and two noncancerous hepatic tissues (ANT1 and ANT2). [score:2]
MiR-184 promotes HCC proliferation by inhibiting SOX7. [score:2]
B. The proliferation ability of HCC cells transfected with an miR-184 inhibitor or negative control (NC), analyzed by the MTT assay. [score:2]
Xu et al. found that the TNFAIP2 miR-184 binding site variant rs8126 T>C genotype was significantly associated with risk of gastric cancer development [32]. [score:2]
Further study is required to identify the biological function of miR-184 and its clinical relevance in HCC development. [score:2]
Additionally, an anchorage-independent growth assay revealed that Hep3B and Huh7 cells stably expressing miR-184 showed more and larger-sized colonies than control cells (Figure 2D). [score:2]
Colony formation assays showed a similar result: overexpression of miR-184 enhanced the proliferation of HCC cells (Figure 2C). [score:2]
The MTT and the colony formation assays both indicated that silencing SOX7 in miR-184 inhibitor transfected cells increased the proliferation of cells (Figure 5, B and C, Figure S4, B and C). [score:2]
0088796.g001 Figure 1 A. Real-time PCR analysis of miR-184 expression in hepatocellular carcinoma cell lines (Hep3B, BEL-7402, MHCC97H, HCCC-9810, MHCC97L, Huh7, QGY-7703 and HepG2), compared with normal liver epithelial THLE3 cells and two noncancerous hepatic tissues (ANT1 and ANT2). [score:2]
Real-time PCR analysis showed that miR-184 expression was markedly increased in all eight HCC cell lines (Hep3B, BEL-7402, MHCC97H, HCCC-9810, MHCC97L, Huh7, QGY-7703 and HepG2), compared with that in the normal liver epithelial cells THLE3 and the other two noncancerous hepatic tissues (Figure 1A). [score:2]
Recently, Gao et al. reported that miR-184 functions as an oncogenic regulator in HCC. [score:2]
In summary, our findings demonstrate, for the first time, that miR-184 plays an important role in HCC development and progression. [score:2]
D. The tumorigenicity of HCC cells transfected with miR-184 inhibitor or NC, as determined by an anchorage-independent growth ability assay. [score:2]
In addition, flow cytometry showed a significant increase in the percentage of cells in G1/G0 phase and a decrease in the percentage of cells in S phase in cells transfected with the miR-184 inhibitor compared with NC transfected cells (Figure 3E). [score:2]
The proliferative function of miR-184 in HCC might be through SOX7 -mediated signaling pathway regulation, such as Wnt/β-catenin pathway. [score:2]
Ectopic miR-184 promotes the proliferation of HCC cells. [score:1]
We demonstrated that miR-184 might have an important role in the SOX7 -mediated signal pathway during HCC progression. [score:1]
However, the biological function and mechanism of miR-184 in HCC has not been completely elucidated. [score:1]
Some studies have suggested miR-184 as a potential onco-miR. [score:1]
Taken together, these studies indicate a possible role of miR-184 in modulating tumor progression. [score:1]
A. The proliferative capacity of THLE3 cells and THLE3 cells transfected with miR-184 inhibitor, compared with HCC cells, Hep3B and Huh7, analyzed by the MTT assay. [score:1]
pMSCV-miR-184 was then cotransfected with the pIK packaging plasmid into 293FT cells, using the standard calcium phosphate transfection method [25]. [score:1]
C. Luciferase assay of pGL3-SOX7-3′UTR or pGL3-SOX7-3′UTR-mut reporter cotransfected with different amounts (10, 50 nM) of miR-184 mimic in indicated cells, or different amounts (50, 100 nM) of miR-184 inhibitor, compared with negative control (NC). [score:1]
A. Real-time PCR analysis of miR-184, Cyclin D1, MYC and LEF1 in HCC tissues. [score:1]
Another study demonstrated that miR-184 dramatically reduces tumor growth and increases overall survival in an orthotopic murine mo del of neuroblastoma [34]. [score:1]
[1 to 20 of 101 sentences]
4
[+] score: 275
Altogether, we propose that, by targeting K15 and FIH1, miR-184 regulates the transition from proliferation to early differentiation, while mis -expression or mutation in miR-184 results in impaired homeostasis. [score:7]
We confirmed that miR-184 is expressed in the epidermis of wild-type and not miR-184 -deficient epidermis (Figures S2E–S2F), miR-184 is expressed by primary human and mouse keratinocytes (KCs) and repressed by anti-miR antagonist (Figure S2G) and is expressed in heart, epidermal, and corneal cells but not in fibroblasts (Figure S2H). [score:7]
To unravel miR-184 pathways in the skin, we used three algorithms (TargetScan, miRanda, MicroCosm) that identify potential target genes for miRNAs based on complementary sequences of given miRNA to the 3′-untranslated region (3′UTR) of mRNAs. [score:7]
Here, we report that the miR-184 knockout mouse mo del displayed increased p63 expression in line with epidermal hyperplasia, while forced expression of miR-184 by stem/progenitor cells enhanced the Notch pathway and induced epidermal hypoplasia. [score:6]
Figure 5FIH1 and K15 Are Direct Targets of miR-184 that Maintain Epidermal Stemness In Vitro(A) HEK293 cells were co -transfected with the indicated concentration (nM) of pre-miR-184 (PM184), disease-causing pre-miR-184 [C57U] mutant (C57U) or pre-miR-203 (PM203), or control oligonucleotides together with luciferase plasmids containing the 3′UTR of the indicated genes downstream to the luciferase encoding sequence. [score:6]
At P60, miR-184 was expressed at low levels in the SC niche (limbus, white arrow), highly induced in early committed basal layer peripheral and central corneal epithelium (red arrow) but not by terminally differentiated (K12 -expressing) corneal supra-basal cells (green arrow) (Figure 1C). [score:5]
At E18.5 and P8 (B), most epidermal basal cells expressed low levels of miR-184 (white arrow), while miR-184 was highly expressed in the spinous layer (red arrow) but not in terminally differentiated cells (green arrow). [score:5]
These studies link miR-205 with oncogenic properties and its inhibitor, miR-184, as a tumor suppressor. [score:5]
This suggests that miR-184 does not directly inhibit p63, and we conclude that the observed repression of p63 by miR-184 (Figures 2, 3, and 4) was indirect, potentially a consequence of Notch activation. [score:5]
FIH1 has already been reported to be a direct target of miR-184 in glioma (Yuan et al., 2014) and to negatively regulate Notch activity (Peng et al., 2012), but its role in the epidermis is not clear. [score:5]
By targeting K15 and FIH1, miR-184 induces the Notch pathway and thereby represses epidermal stemness, inhibits proliferation, and induces the differentiation program. [score:5]
miR-184 was low expressed in the SC niche (epidermal basal layer, bulge, and limbus) but mainly expressed by cells that migrated out of the niche (epidermal spinous layer, corneal basal layer, ORS, and matrix of the hair follicle). [score:5]
Likewise, miR-184 was not expressed in the hair-follicle SC niche (bulge) but was detected in early committed outer root sheath cells (ORS) and matrix cells and not expressed by terminally differentiated hair shaft cells (Figure 1B, see also Figures 5B and 5C). [score:5]
In situ hybridization of miR-184 coupled to K15 immunostaining illustrated that miR-184 and K15 are reciprocally expressed in the epidermis and hair follicle (Figures 5B and 5C), with only scarce co -expression in the same cells. [score:5]
It was shown that miR-184 interferes with miR-205 repression of the phosphatidylinositol 3-kinase inhibitor, SHIP2 (Yu et al., 2008, Yu et al., 2010), and inhibits cell migration (Yu et al., 2010). [score:5]
In line with the expression pattern of miR-184 in vivo, differentiation was correlated with an elevation in the levels of expression of miR-184 (Figure 4D). [score:5]
The expression pattern of K15 is clearly reciprocal to miR-184, strongly suggesting that, as soon as cells depart from the niche, the levels of miR-184 are elevated and, in turn, miR-184 directly represses K15. [score:4]
Notably, PM184 inhibited the luciferase activity when co -transfected with Luc-K15 plasmid, while point mutation in the 3′UTR plasmid (Luc-K15-mut, Figure S5B), which disrupted the miR-184-predicted binding site, completely abolished the effect of PM184 (Figure 5A). [score:4]
The importance of miR-184 was underscored by the discovery that point mutations in miR-184 gene led to corneal/lens blinding disease. [score:4]
Indeed, point mutations in miR-184 are linked with autosomal-dominant blinding eye diseases (Farzadfard et al., 2016, Hughes et al., 2011, Lechner et al., 2013, Iliff et al., 2012). [score:4]
Interestingly, the C57U mutation that is located to the seed sequence itself (Hughes et al., 2011) resulted in loss-of-function most likely due to reduced complementary to bona fide miR-184 target genes such as FIH1 and K15 (Figure 5A), and failure to induce the Notch pathway and differentiation (Figures 4E and 6D). [score:4]
Interestingly, transfection with pre-miR that mimics the disease-causing miR-184 (C57U) had no significant effect on differentiation (Figure 4E), suggesting a loss-of-function mechanism. [score:3]
Figure 1 Expression Profile of miR-184 in the Murine Skin and Cornea In situ hybridization was performed on whole embryos (A) or tissue sections (B and C) of wild-type mice on the indicated embryonic day (see also Figures 5B and 5C). [score:3]
The disease-causing miR-184 [C57U] mutant failed to repress K15 and FIH1 and to induce Notch activation, suggesting a loss-of-function mechanism. [score:3]
Altogether, miR-184 displays a common expression pattern in the differentiation program of the epidermis, hair follicle, and corneal epithelium; it is low or absent in the SC compartment, high in early committed cells, and absent in terminal differentiated cells. [score:3]
To test this hypothesis further, a transgenic mouse strain allowing tetracycline-inducible expression of miR-184 under the promoter of K14 has been produced (Figures S4A and S4B). [score:3]
Although miR-184 is expressed by hair-follicle cells, no change was found in hair-follicle morphology and cell proliferation. [score:3]
The compartmentalized expression of miR-184 is similar in the different but closely related epithelial tissues that were studied, namely, epidermis, hair follicle, and cornea. [score:3]
Likewise, miR-184 acts as a tumor suppressor in glioma (Malzkorn et al., 2010) and neuroblastoma (Foley et al., 2010). [score:3]
Interestingly, disease-causing C57U-miR-184 mimic did not significantly affect luciferase activity when co -transfected with Luc-K15 or Luc-FIH1 plasmids (Figure 5A). [score:3]
However, it is likely that other, yet unknown, miR-184-target genes are involved in this process. [score:3]
We found that miR-184 is expressed at the highest levels in the corneal and lens epithelia, high in the hair follicle, and moderately in the epidermis. [score:3]
Identification of miR-184 Target Genes in the Epidermis. [score:3]
The expression of miR-184 in early committed spinous cells, together with its impact on proliferation and the Notch pathway, suggests that miR-184 may serve as a molecular switch to epidermal differentiation. [score:3]
Finally, to test whether Notch activation is necessary for miR-184 -induced differentiation, transfected KCs were treated with a γ-secretase inhibitor (DAPT) that prevents Notch cleavage and thus the production of active NICD. [score:3]
Compartmentalized Expression Pattern of miR-184. [score:3]
The present study shows that miR-184 represses basal layer cell proliferation, inhibits p63, and activates Notch in mouse mo dels. [score:3]
In the hair follicle (B, right image), miR-184 was not detected in the bulge SC niche (white arrow), expressed by early committed inner root sheet (red arrow), and matrix cells but not in terminally differentiated hair cells (green arrow). [score:3]
In agreement, the levels of K15 significantly decreased upon miR-184 forced expression and increased upon miR-184 ablation (Figures 5D and 5E). [score:3]
Since miR-184 is low or not expressed by basal cells (Figure 1B), the effect on the basal layer may involve a non-cell-autonomous mechanism. [score:3]
Modulation of miR-184 Expression in Mice Results in Abnormal Epidermal Proliferation. [score:3]
To further explore the specificity of miR-184 expression in epidermal cells we performed in situ hybridization and real-time PCR analysis. [score:3]
Genotyping, quantitative real-time PCR, and in situ hybridization analyses confirmed that miR-184 is not expressed by KO mice (Figures S2C, S2E, and S2F). [score:3]
Therefore, it would be interesting to examine the role for the miR-184/Notch axis in other tissues where miR-184 is highly expressed and plays an important role, such as the cornea and lens (Hughes et al., 2011, Shalom-Feuerstein et al., 2012) and pancreatic β cells (Tattikota et al., 2014). [score:3]
The repression of proliferation and activation of Notch by miR-184 suggests that it may play a role as a tumor suppressor in the epidermis (Nicolas et al., 2003). [score:3]
At murine embryonic day 11.5 (E11.5), miR-184 was highly expressed in the developing lens (Figure 1A, arrowhead) while from E14.5–18.5 to postnatal stages, a significant signal was detected in the developing epidermis and hair follicles (Figures 1A and 1B). [score:3]
Thus, the elevation in miR-184 and NICD in the spinous layer is well correlated with the observed inhibition of proliferation by miR-184. [score:3]
Future studies will be needed to define the effect of miR-184 mutation on FIH1, K15, and on cell proliferation and differentiation in corneal/lens development, homeostasis, and pathology. [score:3]
These mice were crossed with a ubiquitously expressed Cre transgene (ROSA26-Cre) to generate miR-184-heterozygous (HT) mice (Figures S2A–S2B). [score:3]
In line with a previous report (Peng et al., 2012), miR-184 efficiently inhibited luciferase activity when co -transfected with Luc-FIH1. [score:3]
Figure 3 Forced Overexpression of miR-184 Attenuated Proliferation and Induced Epidermal Hypoplasia(A–D) Paraffin sections of the head of newborn mice of the indicated genotypes were used for histology staining with H&E (A) or for immunofluorescent staining of the indicated proteins (A and D). [score:3]
Altogether, these data suggest that miR-184 inhibits SC/progenitor clonogenic potential and induces differentiation in human KCs. [score:3]
Our data support a mo del by which miR-184 regulates Notch activity through repression of K15 and FIH1 (mo del in Figure 7). [score:2]
Modulation of miR-184 Expression in Mice in Abnormal Epidermal ProliferationTo investigate the importance of miR-184 in vivo, a miR-184 knockout (KO) mouse mo del carrying a conditional loss-of-function allele was generated. [score:2]
The changes in proliferation and thickening of the spinous layer raised the possibility that the switch from the basal layer to the spinous layer, which is known to be controlled by p63 (Senoo et al., 2007) and Notch (Nguyen et al., 2006, Rangarajan et al., 2001), is interrupted in miR-184 knockout skin. [score:2]
Taken together, these results suggest that miR-184 directly represses both K15 and FIH1 in the epidermis in vivo. [score:2]
The data presented here suggest that miR-184 regulates the balance between epidermal proliferation and differentiation through the repression of K15 and FIH1. [score:2]
We showed that by directly repressing cytokeratin 15 (K15) and FIH1, miR-184 induces Notch activation and epidermal differentiation. [score:2]
In line, miR-184 is involved in regulating pancreatic β cell growth and function according to the demand for insulin (Tattikota et al., 2014). [score:2]
There was no impact on hair growth in miR-184 mutants, suggesting that miR-184/Notch is not involved in the regulation of matrix cell proliferation. [score:2]
Interestingly, four different point mutations in miR-184 were linked with lens/corneal dystrophy and blindness (Farzadfard et al., 2016, Hughes et al., 2011, Lechner et al., 2013, Iliff et al., 2012). [score:2]
Figure 7 A Working Mo del miR-184 regulates the balance between basal layer cell proliferation and Notch -dependent differentiation in the epidermis. [score:2]
Altogether, we conclude that miR-184, through direct repression of K15 and FIH1, induces an exit from epidermal stemness/proliferation and accelerates Notch -dependent differentiation (Figure 7). [score:2]
In order to examine further the regulation of Notch by miR-184, we performed staining of NICD on wild-type mice (Figures 6A and 6B). [score:2]
As shown in Figures 6E and 6F, miR-184-repression of K15 and FIH1 was not reversed by DAPT treatment, indicating that this effect is upstream to Notch and most likely a direct effect. [score:2]
miR-184 was shown to be involved in various biological processes, including germline development in the fly (Iovino et al., 2009), neural fate (Liu et al., 2010, Nomura et al., 2008), cell proliferation, and migration (Yu et al., 2008, Yu et al., 2010). [score:2]
Conditional loxP-miR-184 mice were crossed with ROSA26-Cre transgene to generate miR-184- HT. [score:1]
Although no phenotype has been found yet in the hair follicle of miR-184- KO and transgenic mice, miR-184 and NICD were both detected in matrix cells that are highly proliferative, suggesting that miR184/NICD may have a cell-context -dependent effect on cell proliferation. [score:1]
Administration of the tetracycline analog doxycycline (Dox) from E12 efficiently induced miR-184 only in double-transgenic animals (K14-rtTA;miR-184 [Tg], referred to hereafter as Tg) (Figure S4C). [score:1]
We next explored the impact of the miR-184/Notch axis on differentiation. [score:1]
Figure 2 miR-184-Deficient Mice Displayed Increased Proliferation and Epidermal Hyperplasia(A–C and E) Paraffin sections of the head of newborn mice of the indicated genotypes were used for histology staining with H&E (A) or for immunofluorescent staining of the indicated proteins (A and E). [score:1]
In line, the oncogenic miR-205 (Cai et al., 2013) is counteracted by competition with miR-184 (Yu et al., 2008). [score:1]
In line, miR-184 reduced clonogenicity and accelerated differentiation of human epidermal cells. [score:1]
miR-184- KO mice displayed corneal stromal thinning, which is in line with keratoconus found in these patients (to be described elsewhere). [score:1]
The involvement of miR-184 in SC regulation and differentiation was further tested by a calcium stratification/differentiation assay. [score:1]
Furthermore, similar to the effect of miR-184 on the long-term proliferation of KCs (Figures 4A and 4B), repression of K15 or FIH1 resulted in significant reduction in KC clonogenicity (Figures 5G and 5H). [score:1]
Altogether, these observations suggest that miR-184 induces the commitment to differentiation of basal epidermal cells. [score:1]
This is in accordance with the role of miR-205 in SC maintenance (Wang et al., 2013) and with our data that miR-184 represses stemness. [score:1]
All epidermal layers were present in the miR-184 -null mice; however, the spinous K10 -positive cell layer was significantly thicker (∼30% increase) (Figures 2E and 2F). [score:1]
We thus tested the possibility that miR-184 can directly bind to the 3′UTR of these three genes by the luciferase assay (Figure S5B). [score:1]
It is thus conceivable that some of the functions of miR-184 that are described in the current study are mediated by interference with miR-205. [score:1]
To confirm the effect of miR-184 on Notch transcriptional activity, we used Hes1-dGFP reporter plasmid that contains a destabilized GFP under the promoter of Hes1. [score:1]
In contrast, miR-184 -induced repression of basal layer genes (p63, K14) and enhancement in spinous layer genes (K10, Hes1, Hey2) was attenuated in the presence of DAPT, suggesting that miR-184 acts upstream to Notch and its effect on differentiation depends on Notch activation. [score:1]
The miR-184- KO mouse mo del (C57BL/6N) was generated by Phenomin-iCS, Strasbourg. [score:1]
In line with a previous report (Blanpain et al., 2006) and similar to miR-184 (Figures 1B, 5B, and 5C), Notch activity was high in the spinous layer cells, which are post-mitotic, and in matrix cells, which are highly proliferative cells. [score:1]
Flow cytometry analysis showed that transfection with PM184 mimic resulted in a significant increase in GFP -positive cells, while the miR-184 mutant (C57U) miRNA mimic had an insignificant effect, and the AM184 antagonist had an opposite effect (Figure 6D). [score:1]
miR-184 Induced Differentiation through Activation of Notch Signals. [score:1]
Altogether, these data suggest that by repressing K15/FIH1, miR-184 induces a differentiation program through Notch activation. [score:1]
In agreement, ablation of miR-184 resulted in a reduction in the percentage of epidermal cells in G1 and an increase in cells found to be in S and G2/M phase (Figures 2D, S3A, and S3B). [score:1]
The present study suggests that FIH1 is required to repress Notch activity and maintain proliferative potential, while miR-184, by repressing FIH1, induces the Notch pathway and commitment to differentiation. [score:1]
By generating loss-of-function and gain-of-function mouse mo dels, we found that miR-184 controls the balance between epidermal cell proliferation and differentiation. [score:1]
The repression of FIH1 or K15 could contribute to miR-184-observed functions; however, the role of K15 and FIH1 in the KC proliferation and differentiation is unknown. [score:1]
KRT14-rtTA (genetic background FVB) was purchased from (008099, The Jackson Laboratory, Bar Harbor, USA) and crossed with previously described TRE-miR-184 [Tg] (referred to hereafter as miR-184 [Tg], genetic background C57BL/6J) (Tattikota et al., 2014). [score:1]
miR-184 is a remarkably evolutionary conserved miRNA, which was shown to be essential for the commitment of embryonic stem cells into corneal-epithelial cells (Shalom-Feuerstein et al., 2012). [score:1]
In line, an increased number of proliferating Ki67 -positive cells was observed in miR-184 -null epidermis, indicating that miR-184 represses cell proliferation (Figures 2A and 2C). [score:1]
However, miR-184-related function in vivo remained unclear. [score:1]
Among other genes, p63, K15, and FIH1 were very interesting candidates that contained a predicted binding site(s) for miR-184 (Figure S5A). [score:1]
Finally, as the available FIH1 antibodies could not faithfully detect FIH1 protein by staining on tissue sections, we performed western blot analysis, which confirmed that miR-184 significantly repressed FIH1 in vivo (Figure 5E). [score:1]
Here, we report that the level of miR-184 is significantly elevated in committed cells of the epidermis, hair follicle, and corneal epithelium. [score:1]
Indeed, miR-184 -deficient mice developed a significantly larger numbers of tumors in a two-stage chemical carcinogenesis mo del (S. N. et al., unpublished data). [score:1]
p63 and K15 were linked with stemness in the skin and cornea (Ito et al., 2005, Peng et al., 2012, Senoo et al., 2007), and p63 was modulated by miR-184 (Figures 2 and 3). [score:1]
miR-184 Modulates Colony Formation Capacity and Accelerates Differentiation of Human Keratinocytes. [score:1]
Figure 6 miR-184 Activates the Notch Pathway to Induce KC Differentiation (A and B) Paraffin sections of wild-type mice at the indicated postnatal day were stained for NICD. [score:1]
However, it was proposed that miR-184 plays a role as an oncogenic miRNA in head and neck squamous cell carcinoma and in tongue cancer (Wong et al., 2009), suggesting a context -dependent role for miR-184 in cancer. [score:1]
Altogether, these data indicate that miR-184 tilts the balance between Notch and p63 in the epidermis, represses epidermal cell proliferation, and may be involved in early steps of epidermal commitment to differentiation. [score:1]
miR-184 is a highly evolutionary conserved microRNA (miRNA) from fly to human. [score:1]
Figure 4 miR-184 Repressed the Clonogenic Potential and Accelerated Epidermal Differentiation (A and B) Primary human foreskin KCs were transfected with pre-miR-184 -mimic (PM184) or anti-miR antagonist (AM184) or appropriate controls (Ctl-PM and Ctl-AM, respectively) and then subjected to the clonogenicity test. [score:1]
To test the potential effect of miR-184 on long-term proliferation of stem/progenitor cells in human cells, foreskin KCs were transfected with pre-miR-184 mimic (PM184), anti-miR-184 antagonist (AM184), or control oligonucleotides (Ctl-PM and Ctl-AM, respectively). [score:1]
Since no phenotypic difference was found between other genotyped littermates (WT, K14-rtTA, or miR-184 [Tg]), K14-rtTA was used as a control in the next experiments. [score:1]
In line, miR-184 repressed clonogenic potential and accelerated differentiation of human epidermal cells in vitro. [score:1]
• The levels of miR-184 are enhanced upon exit from the stem cell niche • miR-184 represses epidermal proliferation and stemness • miR-184 represses K15 and FIH1, both of which prevent epidermal differentiation • mutated miR-184 failed to repress K15 and FIH1 and failed to induce differentiation microRNA miR-184 miRNA-184 K15 FIH1 notch stem cells epidermis hair follicle cornea The skin and cornea serve as a barrier that is protecting our body against exterior insults. [score:1]
KCs that were transfected with PM184 mimic showed increased levels of NICD while AM184 antagonist had an opposite effect and uncleaved Notch remained unchanged (Figure 6C), suggesting that miR-184 controls Notch at the level of activation. [score:1]
[1 to 20 of 112 sentences]
5
[+] score: 213
Other miRNAs from this paper: hsa-mir-206
To understand the molecular mechanism of CCDC19-modulated suppression of cell growth in NSCLC, we observed that C-Myc, a key initial factor which suppresses p15 and p21 expression and stimulates CCND1 expression which promotes G1 to S transition [21], was a direct target of miR-184. [score:12]
In our study, miR-184 was found to suppress cell proliferation by inhibiting oncogenic cell cycle factors C-Myc and CCND1, and inducing the expression of cell cycle suppressors p15 and p21 in NSCLC, similar to the role of CCDC19. [score:9]
We provided evidence that CCDC19 suppresses cell growth by inactivating CCDC19 -mediated suppression of growth involving the direct interaction of miR-184 with C-Myc, and transcription suppression of miR-184 by CCDC19-inactivated PI3K/AKT/C-Jun pathway (Fig. S5). [score:8]
In this study, we used qPCR to examine differential miRNA expression and discovered that miR-184 and miR-206 were significantly up-regulated in CCDC19 -overexpressing A549 and SPCA1 lung cancer cells compared to their respective controls. [score:7]
Interestingly, similar to CCDC19 -mediated cell cycle pathway, miR-184 mimics suppressed the expression of C-Myc and CCND1 while inducing p21 and p15 expression (Fig. 6C). [score:7]
Figure S3 The expression of miR-184 was suppressed by its specific inhibitor in A549 and SPCA1 cells. [score:7]
To confirm that miR-184 is directly regulated by C-Jun, we first used siRNA [23] to suppress the expression of C-Jun in lung cancer A549 and SPCA1 cell lines as confirmed by (Fig. 7A). [score:7]
Further, we found that C-Jun (AP1), an oncogenic transcription factor regulated by CCDC19, directly bound to the promoter of miR-184 and suppressed its expression in NSCLC. [score:7]
Transfection of miR-184 mimics down-regulated the protein expression of C-Myc in lung cancer cell lines A549 and SPCA1. [score:6]
On the contrary, miR-184 is found to be down-regulated in renal carcinoma [13] and acts as a candidate tumour suppressor in neuroblastoma [14]. [score:6]
Our results demonstrated that miR-184 direct targeting of C-Myc was responsible for the CCDC19 -mediated suppression of cell growth through the PI3K/AKT/C-Jun pathway. [score:6]
Compared with their respective controls, miR-184 mimics suppressed cell growth (Fig. 6A), while its inhibitor with respective suppression efficiency of 78.14% and 72.38% for miR-184 (Fig. S3) in A549 and SPCA1 cells (Fig. 6B) induced cell proliferation bys. [score:6]
The promoter region of human miR-184 (−1500 to 100 bp) was predicted to contain AP-1 (C-Jun) binding sites (Fig. S2), which suggested that C-Jun directly regulated the expression of miR-184. [score:5]
In this study, we present evidence that CCDC19 as a potential tumour suppressor, activates the expression of miR-184. [score:5]
Subsequently, miR-184 was found to be involved in suppressing cell survival and growth by targeting AKT2 in neuroblastoma cells [14]. [score:5]
Table S2 Sequences of miR-184 mimics and negative control, miR-184 inhibitor and inhibitor negative control. [score:5]
C-Myc was predicted to be a directly regulated target of miR-184 by miRwalk software and RNAhybrid (Fig. S1). [score:5]
Expression of miR-184 and miR-206 was markedly induced in CCDC19 -overexpressing A549 cells (Fig. 5A). [score:5]
Subsequently, we transfected miR-184 inhibitor into these two cells and observed elevated expression of C-Myc (Fig. 6D). [score:5]
In a previous report, miR-206, but not miR-184, was been found to act as a tumour suppressor to inhibit cell growth, invasion and metastasis in lung cancer [35]. [score:5]
Fig. 7PI3K/AKT signalling modulates C-Jun -mediated direct suppression of miR-184 in NSCLC. [score:4]
miR-184 directly targeted oncogenic transcription factor C-Myc. [score:4]
Fig. 5CCDC19 positively regulates the expression of miR-184 in NSCLC. [score:4]
Taken together, these results strongly supported that C-Myc is a direct target of miR-184. [score:4]
C-Jun directly negatively modulates the expression of miR-184. [score:4]
Figure S4 miR-184 did not regulate the expression of CCDC19 in NSCLC. [score:4]
We observed an inverse change in miR-184 and miR-206 after knocking down ectopic CCDC19 expression in A549 and SPCA1 NSCLC cells (Fig. 5C and D). [score:4]
CCDC19 positively modulates the expression of miR-184 and miR-206. [score:3]
These results demonstrated that CCDC19 stimulated the expression of miR-184 through PI3K/AKT/C-Jun pathway. [score:3]
We further performed a luciferase reporter assay to determine whether miR-184 could directly target the C-Myc coding region (CDS) in 293FT cells. [score:3]
miR-184 mimics and its inhibitor was designed and synthesized by Guangzhou RiboBio (RiboBio Inc). [score:3]
To examine the effect of miR-184 on cell proliferation, miR-184 mimics and its inhibitor were respectively transfected into lung cancer cell lines according to the manufacturer's instructions. [score:3]
The expression of miR-184 was markedly increased by qPCR analysis in both cell lines (Fig. 7B). [score:3]
miR-184 suppresses cell proliferation by modulating cell cycle transition signals. [score:3]
However, miR-184 did not modulate the expression of endogenous CCDC19, which suggested it as a downstream factor modulated by CCDC19 in NSCLC cells (Fig. S4). [score:3]
The activity of mt vectors was unaffected (Fig. 6E, lanes 5 and 6; P = 0.36) by miR-184 mimics or inhibitor, consistent with our previous findings. [score:3]
Further, the three reporters with mutations in the putative C-Jun binding sites of the miR-184 promoter (MT1, MT2 and MT1+2; Fig. S2) were prepared using GeneTailor Site-Directed Mutagenesis System (Invitrogen). [score:3]
The sequences of miR-184 mimics or its inhibitor and their respective controls are shown in Table S2. [score:3]
Site-directed mutagenesis of the miR-184 binding sites in the C-Myc CDS was performed with GeneTailor Site-Directed Mutagenesis System (Invitrogen, Carlsbad, CA, USA) [named mutant (mt)]. [score:3]
Transient transfection with miR-184 mimics and its inhibitor. [score:3]
Dysregulation of miR-184 was reported to be a potential oncomir promoting cell proliferation and blocking cell apoptosis in tongue and hepatocellular carcinoma [11, 12]. [score:2]
miR-184 mimics induced a significant decrease of luciferase activity of wt vector C-Myc CDS (Fig. 6E, lanes 1 and 2; P < 0.001) or an obvious increase of luciferase activity by transfecting miR-184 inhibitor (Fig. 6E, lanes 3 and 4; P < 0.001) compared with miR controls. [score:2]
For reporter assays, wt or mt vector and the control vector psiCHECK-2 vector were cotransfected into 293FT cells with miR-184 mimics or inhibitor. [score:2]
However, the role of miR-184 is still to be determined in other tumours. [score:1]
Recently, miR-184 has been implicated in the pathogenesis of several types of tumour and plays dual roles in different tumours. [score:1]
miR-184 is evolutionarily conserved at the nucleotide level from flies to humans [9]. [score:1]
Figure S2 C-Jun binding sites and its mutant sites in miR-184 promoter. [score:1]
Table S3 Sequences of miR-184 and U6. [score:1]
Using the C-Jun binding site mutants, we found that luciferase activity of miR-184 promoter was significantly increased in 293FT cells (Fig. 7D). [score:1]
To investigate the molecular basis of miR-184 cell cycle regulation in lung cancer, we analysed the modulated targets of miR-184 by miRwalk assay and RNAhybrid. [score:1]
qPCR analysis indicated that C-Jun could bind more DNA in Site1 and Site2 of the miR-184 promoter region in pcDNA3.1-C-Jun -transfected A549 cells than that in control pcDNA3.1 -transfected A549 cells. [score:1]
The fold change of miR-184 was more than twofold in each of these experiments. [score:1]
Subsequently we used chromatin immunoprecipitation combined with qPCR analysis to confirm that C-Jun could bind to the putative miR-184 promoter (Fig. 7C). [score:1]
The miR-184 promoter sequence was constructed into pGL3 Luciferase Reporter Vector (Promega). [score:1]
Further, we investigated the molecular basis of miR-184 cell proliferation inhibition in lung cancer. [score:1]
[1 to 20 of 55 sentences]
6
[+] score: 135
Among three selected targets for mosquito-specific miRNAs that were inserted into the 3’NCR of DEN4 genome, the presence of a target for the highly expressed miRNAs in mosquito cells Aag2 or C [7]10 (mir-184 and mir-275) reduced DEN4 replication to a greater extent than the inclusion of a target for the less expressed mir-1 miRNA (Figs 2 and S1) [37]. [score:11]
Therefore, to explore if targeting of an ORF region of DEN4 by mosquito-specific miRNAs can result in specific viral attenuation in mosquitoes, targets for mosquito-expressed mir-184 and mir-275 as well as three targets for human neuron-specific mir-124 miRNA were introduced in the DEN4 genome between sequences encoding the two C-terminal stem-anchor domains of DEN4 E protein (D4-E virus; Fig 1). [score:9]
Even though a combined expression of mir-184 and mir-275 targets in the 3’NCR was sufficient to greatly restrict the D4-275-184 virus replication in mosquito cells and abolish infectivity in adult mosquitoes, an escape mutant lacking both authentic target sequences can theoretically emerge as a result of error prone flavivirus replication under miRNA -mediated selective pressure. [score:7]
Thus, replication of D4-275-184 containing targets for mir-275 and mir-184 in the 3’NCR was not detected in either Aag2 or C6/36 cells, whereas D4-E containing the same targets in the duplicated E-NS1 region replicated to titers of 2.5 and 5.5 log [10] pfu/ml in these cells, respectively. [score:5]
1004852.g001 Fig 1 Positions of miRNA targets for brain-expressed mir-124 and mosquito-specific mir-1, mir-184, or mir-275 in the ORF and 3’NCR of DEN4 genome are indicated by blue and red boxes, respectively. [score:5]
In contrast, the D4-275-184 virus was unable to infect the midgut and thus failed to disseminate in both mosquito species indicating that a combined expression of mir-184 and mir-275 targets in D4-275-184 was sufficient to completely block DEN4 replication in the principal mosquito vectors (Fig 4C and 4D, p<0.001; Fisher’s exact test). [score:5]
Target sequences for mosquito specific mir-1 (5’-CTCCATACTTCTTTACATTCCA-3’), mir-184 (5’-GCCCTTATCAGTTCTCCGTCCA-3’) and mir-275 (5’-GCGCTACTTCAGGTACCTGA-3’) or human brain-specific mir-124 (5’-GGCATTCACCGCGTGCCTTA-3’) were introduced into the 3’NCR of DEN4 genome between nts 10,277 and 10,278 (position 1, Fig 1) or 10,474 and 10,475 (position 2, Fig 1); these sites of target insertion are located 15 or 212 nts downstream of the TAA stop codon in the 3’NCR, respectively. [score:5]
To minimize the probability of such events, we generated a virus (D4-E-NCR1; Fig 1) expressing mir-184 and mir-275 target sequences in both the ORF and 3’NCR of DEN4 genome. [score:5]
Based on this data, three mosquito-specific miRNAs (mir-184, mir-275 and mir-1) were selected for DEN4 genome targeting because they satisfy the following criteria: 1) they are highly expressed in different mosquito organs and mosquito-derived cell lines, and also remain abundant during flaviviruses infection [37]; 2) these miRNAs are evolutionarily conserved among insect species including mosquitoes, but they are different from their miRNA analogs in mammals. [score:5]
Positions of miRNA targets for brain-expressed mir-124 and mosquito-specific mir-1, mir-184, or mir-275 in the ORF and 3’NCR of DEN4 genome are indicated by blue and red boxes, respectively. [score:5]
In addition, combined expression of mir-275 and mir-184 targets in the 3’NCR was sufficient to completely block the D4-275-184 virus infectivity for A. aegypti and A. albopictus (Fig 4), whereas D4-E was detected in 5.6% (1/24) of A. aegypti mosquitoes (Fig 6). [score:5]
Both D4-E and D4-E-NCR1 viruses contained miRNA targets for mosquito-specific mir-184 and mir-275 and three copies of target sequences for vertebrate brain-specific mir-124 in the duplicated E/NS1 region (Fig 1). [score:5]
Synonymous mutations introduced into mir-184 and mir-275 target sequences of D4-E* are highlighted in bold letters. [score:4]
of a single copy of miRNA target for either mir-184 or mir-275 miRNA resulted in a significant reduction of the DEN4 titer in mosquito bodies (Fig 4A and 4B; p≤0.002 one-tailed Student's t-test) in both mosquito species as well as viral infectivity and ability of virus to develop a disseminated infection in A. aegypti (Fig 4C; p<0.05 one-tailed Fisher’s exact test). [score:3]
1004852.g004 Fig 4Effect of combined mir-184 and mir-275 co -targeting of DEN4 genome in the 3’NCR on virus fitness in A. aegypti and A. albopictus. [score:3]
S1 FigRelative expression of mir-184 (A), mir-275 (B), mir-1 (C) in cell cultures, adult A. aegypti mosquitos, and new-born mouse brains. [score:3]
1004852.g006 Fig 6Effect of mir-184 and mir-275 co -targeting of DEN4 genome in the ORF and 3’NCR on virus fitness in A. aegypti mosquitoes. [score:3]
Two additional constructs were developed based on D4-275s that contained additional target sequence for either mir-184 or mir-275 at nt position 212 of DEN4 3’NCR (Fig 1). [score:3]
Effect of combined mir-184 and mir-275 co -targeting of DEN4 genome in the 3’NCR on virus fitness in A. aegypti and A. albopictus. [score:3]
This likely reflects that insertions of heterologous sequences (mir-275 and mir-184 targets) in the ORF can result in partial attenuation of DEN4 replication in the brain of mice. [score:3]
Mir-184 and mir-275 target sequences are indicated as red and green boxes, respectively. [score:3]
In contrast, the replication of viruses D4-184s and D4-275s carrying a target for mir-184 or mir-275 was significantly impaired (p<0.001; 2-way ANOVA). [score:3]
Relative expression of mir-184 (A), mir-275 (B), mir-1 (C) in cell cultures, adult A. aegypti mosquitos, and new-born mouse brains. [score:3]
Specifically, the introduced sequence was inserted between nts 2451 and 2452 of DEN4 genome and contained five tandem targets for mir-124, mir-184 and mir-275 that were followed by a duplicated DEN4 E/NS1 region (nts from 2130 to 2451 of DEN4 genome) encoding 98 amino acids from the C-terminal end of the DEN4 E protein and 7 amino acids from the N-terminal end of the NS1 protein (Fig 1). [score:3]
Effect of mir-184 and mir-275 co -targeting of DEN4 genome in the ORF and 3’NCR on virus fitness in A. aegypti mosquitoes. [score:3]
The modified parental and mir-184- or mir-275 -targeted DEN4 viruses (designated D4, D4-184, and D4-275; Fig 1) were re-generated by cDNA transfection into Vero cells (S2 Table). [score:3]
Combined targeting for mir-184 and mir-275 miRNAs in the 3’NCR greatly reduced the DEN4 replication in mosquito cells and Aedes mosquitoes. [score:3]
Effect of combined mir-184 and mir-275 co -targeting of DEN4 genome in the 3’NCR on virus replication in mosquito and Vero cells. [score:3]
To investigate if miRNA targeting of DEN4 genome results in selective restriction of DEN4 replication in mosquitoes, a single copy of mir-184, mir-275, or mir-1 target sequence was introduced into the genome of DEN4 strain 814669 [40] (abbreviated D4s) between nucleotides (nts) 10277 and 10278 (15 nts downstream of the TAA stop codon preceding the 3’NCR). [score:3]
Two additional viruses (D4-275-184 and D4-275x2) were developed based on the D4-275 genome and contained a second target sequence for either mir-184 or mir-275 at nt position 212 of the 3’NCR (Fig 1). [score:3]
As a control, we generated a D4-E* virus, in which mir-184 and mir-275 target sequences of D4-E were synonymously mutated in the third base position of each codon. [score:3]
In both cell lines, these viruses exhibited a 1000-fold or higher reduction in virus titer at 3 days post-infection (dpi) compared to the D4s virus, correlating with mir-184 and mir-275 expression levels in Aag2 and C [7]10 cell lines (S1 Fig) [37]. [score:2]
For each line 14 μg of total RNA was used in northern blot analysis and then hybridized with biotinylated probes complementary to mir-184 (A), mir-275 (B), and mir-1 (C). [score:1]
The biotinylated probes complementary to mir-184 (5’Biotin-GCCCTTATCAGTTCTCCGTCCA-Biotin3’), mir-275 (5’Biotin-GCGCTACTTCAGGTACCTGA-Biotin3’), and mir-1 (5’Biotin-CTCCATACTTCTTTACATTCCA-Biotin3’) were synthesized by Bioresearch Technologies and used at 2–10 ng/mL. [score:1]
Ribo-oligonucleotides for artificial mir-184 (5’UGGACGGAGAACUGAUAAGGGC), mir-275 (5’UCAGGUACCUGAAGUAGCGC), and mir-1 (5’UGGAAUGUAAAGAAGUAUGGAG3’) were synthesized by Integrated DNA Technologies, and were used in northern blot as positive controls and molecular weight standards. [score:1]
[1 to 20 of 35 sentences]
7
[+] score: 135
Other miRNAs from this paper: hsa-mir-96, hsa-mir-205
In accordance with other reports [24, 35], our miRNA expression data indicated miR-184 as the most abundantly expressed miRNAs in postmortem human cornea samples obtained from donors with no history of ocular diseases. [score:7]
It has also been previously reported that the expression of miR-184 in the cornea was downregulated in the reepithelializing cells of wounded corneal epithelium. [score:6]
Furthermore, taking into account the potential inhibitory effect of miR-184 on miR-205, we also examined the relative expression of miR-184 versus miR-205 in normal human cornea samples. [score:5]
miR-184 seems to play its biological role through the competitive inhibition of the binding of miR-205 to its mRNA target that encodes inositol polyphosphate-like 1 (INPPL1) and integrin, beta 4 (ITGB4) [14]. [score:5]
In summary, our findings recommend more elaborative genetic and functional studies to elucidate the expression/role of miR184 in the normal versus diseased cornea. [score:5]
Our data indicates that miR-184 is the most abundantly expressed miRNA in the cornea with a mean of 45,039 reads per million sequencing reads and it is also highly expressed in the trabecular meshwork (30,565 reads per million sequencing reads). [score:5]
This spatial-specific expression further highlights the potential role of miR-184 in regulating cellular-specific functions in the eye. [score:4]
In contrast, the expression of miR-184 in the lens was more significantly detected in the germinative layer of epithelial cells and was more uniformly distributed at an earlier developmental stage [24]. [score:4]
This restricted expression pattern in the lens and cornea suggests a unique role of miR-184 in these particular ocular structures and may be specifically related to the regulation of proliferation versus differentiation of cornea and lens epithelia. [score:4]
These observations suggest that the expression of miR-184 is independent of the proliferative stage of corneal epithelia but may be delineating their differentiated phenotype. [score:3]
The expression levels of miR-184 and miR-205 were examined in all 10 ocular samples. [score:3]
These expression data support the recent publication by Teng et al. 2015 [36] reporting abundance of miR-184 in postmortem human cornea samples. [score:3]
Our microRNA sequencing data in postmortem unaffected human ocular samples with Illumina MiSeq identifies the expression of more than 340 mature miRNAs, including both miR-184 and its competitor miR-205 (Figure 3). [score:3]
This can be further confirmed by examining the relative expression of miR-184 and miR-205 in KC-affected cornea samples. [score:3]
However, similar to the miR-184 data, miR-205 has a negligible expression in both the ciliary body and the retina. [score:3]
Our findings together with that by Teng and colleagues [37] are the first to report the abundant expression of miR-184 in normal human cornea. [score:3]
The expression of miR-184 is almost 15-fold and 8-fold higher than that of miR-205 in the human cornea and the trabecular meshwork samples, respectively. [score:3]
The most abundantly expressed miRNA in the cornea and lens is miR-184 [22, 24]. [score:3]
However, increased corneal epithelial proliferation had no effect on the expression of miR-184. [score:3]
However, the expression of miR-184 is low in the ciliary body (59 reads per million sequencing reads) and retina (29 reads per million sequencing reads). [score:3]
Comparing the expression of miR-184 and miR-205 in control versus KC cornea samples as well as corneas of other ocular abnormalities will reveal the contribution of miR-184 and miR-205 to KC and/or other ocular defects. [score:3]
miR-184 is most abundantly expressed in the cornea and lens epithelia. [score:3]
INPPL1 and ITGB4 are suggested to regulate corneal healing, a role that seems consistent with the pathogenesis of KC and its association with mutations in MIR184 [14]. [score:3]
The potential role of miR-184 as a competitive inhibitor of miR-205 was further confirmed by Hughes and colleagues [14]. [score:3]
Despite the available data regarding the distinct expression pattern and level of miR-184 in ocular tissues, little is known about the biological function of this miRNA in these two tissues. [score:3]
In the cornea, the expression of miR-184 is cell type-specific. [score:3]
Individuals with c. 57C>T mutation in MIR184 display different corneal abnormalities including congenital cataract with keratoconus or corneal thinning but no keratoconus. [score:2]
In a similar context, various reports have subsequently highlighted an association between point mutations within the seed region of MIR184 and KC with/without other ocular abnormalities including cataract and myopia (Table 3) [14, 25, 40– 42]. [score:2]
In 2013, Lechner and colleagues [25] identified 2 heterozygous substitution mutations in the seed region of MIR184 (+3A>G and +8C>A) in 2 patients with isolated KC. [score:2]
Similarly, another group [26] identified a c. 57C>T mutation in MIR184 affecting members of the same family. [score:2]
Our data regarding the abundant expression of miR-184 as compared to miR-205 in normal human cornea samples further highlight the potential role of miR-184 in the cornea. [score:2]
To further explore the role of MIR184 sequence variants in KC, we screened a group of KC patients from Saudi Arabia for mutations in the seed region of MIR184. [score:2]
Only one of these studies reported mutation in the seed region of MIR184 affecting patients with KC which was not associated with cataract [25]. [score:2]
Our report represents a follow-up study on the association between MIR184 mutations and KC. [score:2]
No point mutations, small insertions, or small deletions were identified in the precursor region of miR-184 in any of the 134 KC patients. [score:2]
These functional findings further suggest MIR184 mutation as a potential candidate for various ocular defects especially those related to the cornea and lens. [score:2]
More recently other studies reported similar mutations in MIR184. [score:2]
Taken together, the lack of sequence variants within the seed region of MIR184 in our group of KC patients from Saudi Arabia is still consistent with the rarity of the occurrence of this mutation in patients with KC only. [score:2]
In that study, a substitution mutation within MIR184 was present in 2 sporadic KC cases. [score:2]
Likewise, substitution mutation within the seed region of MIR184 has also been mapped in patients with endothelial dystrophy, iris hypoplasia, congenital cataract, and stromal thinning, not associated with keratoconus (EDICT syndrome) [38, 43] as well as familial KC with cataract [14]. [score:2]
Accordingly, it was reported that miR-184 prevents knockdown of INPPL1 and ITGB4 by miR-205 and rescued their levels in cell culture [14, 39]. [score:2]
The genomic region containing MIR184 was sequenced using PCR -based Sanger sequencing. [score:1]
The genomic region covering the has-mir-184 precursor was successfully amplified with PCR with one unique product at a size of 255 bp. [score:1]
The sequencing data was examined in reference to the sequence of has-mir-184 using Sequencher software (Gene Codes Corporation, Ann Arbor, MI) (Figure 2). [score:1]
Among the various reported KC -associated candidate genes are VSX1 (visual system homeobox 1), MIR184 (microRNA 184), and DOCK9 (dedicator of cytokinesis 9) in addition to other candidate single nucleotide polymorphisms (SNPs) in other genetic loci [11– 14]. [score:1]
However, MIR184 may be an attractive genetic candidate in implication with the cooccurrence of KC with other corneal abnormalities such as cataract. [score:1]
Based on our findings and in accordance with previous reports, variants within MIR184 seem to play a limited role in the susceptibility for KC alone. [score:1]
The absence of sequence variants in patients with KC only suggests that MIR184 may have a more pronounced role as a candidate gene for other corneal/lens abnormalities with or without KC. [score:1]
However, absence of MIR184 sequence variant in this population of KC patients without any other concomitant ocular abnormalities is consistent with previously published reports. [score:1]
Hughes et al. 2011 [14] have reported a heterozygous C-to-T transition (r. 57c>T) within the MIR184 seed region in a Northern Irish family in which 18 individuals from 3 generations were affected with KC associated with cataract. [score:1]
[1 to 20 of 50 sentences]
8
[+] score: 93
Other miRNAs from this paper: hsa-mir-21, hsa-mir-145, hsa-mir-451a, hsa-mir-451b
Our previous studies successfully identified numerous aberrant expressions of miRNAs in RCC by massively parallel sequencing technology, and revealed that miR-184 was significantly downregulated in RCC (10); then, researchers observed that the expression of miR-184 was downregulated in RCC tissues (15). [score:11]
Furthermore, miR-184 is upregulated in human HCC cell lines and tissues, and it post-transcriptionally regulates SOX7 expression and promotes cell proliferation in HCC (14). [score:7]
miR-184 inhibits neuroblastoma cell survival and promotes apoptosis by targeting AKT2 (12). [score:5]
The inhibition rates of migration were 45.58% for 786-o cells (P<0.05) and 28.44% for ACHN cells (P<0.05), indicating that miR-184 mimic inhibited the migration of renal cancer cells. [score:5]
Previous studies have demonstrated that miR-184 was downregulated in RCC, which may have potential significance in the occurrence and development of RCC (15). [score:5]
One comprehensive miRNA profiling of prostate cancer revealed that miR-184 was upregulated in high-grade tumors (27). [score:4]
In conclusion, our results revealed that miR-184 dramatically suppressed cell proliferation and migration and induced cell apoptosis in renal cancer cell lines and plays an significant role in RCC. [score:3]
Other scholars demonstrated that miR-184 has a tumor suppressive role in cancers. [score:3]
miR-184 mimic suppresses renal cancer cell proliferation. [score:3]
Further research is still needed to explore the roles and target genes of miR-184. [score:3]
The miR-184 expression level was determined using the ΔΔCt method. [score:3]
Transfection efficiency and miR-184 expression changes were confirmed by fluorescence microscopy and reverse transcription-quantitative polymerase chain reaction (RT-qPCR). [score:3]
In addition, our data suggest that miR-184 may be a promising therapeutic target for renal cancer treatment in the future. [score:3]
Moreover, further research should be conducted to determine the roles and target genes of miR-184 in renal cell carcinoma. [score:3]
Inhibition of miR-184 in tongue squamous cell carcinoma cells reduced cell proliferation and induced apoptosis (11). [score:3]
miR-184 mimic inhibits renal cancer cell migration. [score:3]
As shown in Fig. 2A and B, cell migration was significantly inhibited in the groups transfected with miR-184 compared with those in the negative control. [score:2]
The results provide new insight into the roles and possible mechanisms of miR-184 in the occurrence and development of RCC. [score:2]
It has been reported that miR-184 is wi dely dysregulated in various human cancers, including tongue squamous cell carcinoma (11), neuroblastoma (12), nasopharyngeal carcinoma (13) and hepatocellular carcinoma (HCC) (14), indicating that miR-184 may play a significant role in oncogenesis. [score:2]
The OD values revealed that proliferation of 786-o cells was decreased by 2.3% (P>0.05), 10.75% (P<0.05) and 13.72% (P<0.05), while proliferation of ACHN cells was decreased by 2.4% (P>0.05), 11.57% (P<0.05) and 16.67% (P<0.05) at 24, 48 and 72 h after transfection, respectively, suggesting that miR-184 mimic inhibited the growth of 786-o and ACHN compared with the negative control (Fig. 3). [score:2]
The miR-184 mimic or negative control was chemically synthesized by Shanghai GenePharma Co. [score:1]
786-o and ACHN cells were seeded into 96-well culture plates at a cell density of 6,000 cells/well in growth medium and transfected with 10 pmol miR-184 mimic or negative control. [score:1]
The aim of our study was to examine the effects of miR-184 on proliferation, migration and apoptosis in two RCC cell lines and to lay the foundation for the further study of the pathogenesis of renal cell carcinoma. [score:1]
ACHN and 786-o cells of 60–80% confluence were transfected with miR-184 mimic or negative control using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instructions. [score:1]
In the present study, the functions of miR-184 on cell migration, proliferation and apoptosis were analyzed by transfecting miR-184 mimic and negative control into renal cancer 786-o and ACHN cells. [score:1]
miR-184 mimic induces renal cancer cell apoptosis. [score:1]
786-o and ACHN were cultured at 37°C and 5% CO [2] in six-well plates and transfected with miR-184 mimic or negative control at a confluence of approximately 60%. [score:1]
786-o and ACHN cells were transfected with miR-184 mimic and negative control for 48 h. Flow cytometry analysis demonstrated that the apoptosis rates of 786-o cells transfected with miR-184 mimic and control were 6.2% versus 2.2% (P<0.05) while the apoptosis rates of ACHN cells were 5.2% versus 1.5% (P<0.05). [score:1]
However, knowledge on the mechanism of action of miR-184 in RCC is limited. [score:1]
Based on the above, the results appear contradictory in that miR-184 was characterized as an oncogene in certain cancers and a tumor suppressor in others. [score:1]
Approximately 500,000 cells (786-o and ACHN) were seeded in each six-well dish and transfected with miR-184 mimic (100 pmol) or negative control (100 pmol) 24 h later using Lipofectamine 2000. [score:1]
However, the biological role of miR-184 in RCC is not fully elucidated, and several methods have been used to study their function. [score:1]
Taken together, these studies indicate a possible role of miR-184 in modulating tumor progression. [score:1]
Among these miRNAs, miR-184 is one of the most frequently studied in cancer biology. [score:1]
These data demonstrated that miR-184 mimic promoted renal cancer cell apoptosis (Fig. 4). [score:1]
The sequences were as follows: miR-184 mimic sense strand 5′-TGGACGGAGAACTGATAA GGGT-3′, and antisense strand 5′-CCTTATCAGTTCTCCGTC CATT-3′; miR-184 negative control sense strand 5′-TTCTCC GAACGTGTCACGTTT-3′, and antisense strand 5′-ACGTGA CACGTTCGGAGAATT-3′. [score:1]
miR-184 has been reported extensively in human cancers, suggesting that it may function as an oncogene in a variety of tumors. [score:1]
The reaction of miR-184 was performed in a Lightcycler 480 real-time PCR system (Roche Diagnostics GmbH, Mannheim, Germany) using a miScript SYBR-Green PCR kit (Qiagen) according to the instructions and using U6 as an endogenous control. [score:1]
[1 to 20 of 38 sentences]
9
[+] score: 88
MiR-184 also targets the Wnt receptor frizzled-7 and negatively regulates the Wnt pathway; down-regulation of miR-184 is associated with aberrant activation of the Wnt pathway in ischemia -induced neovascularization of the murine retina [67]. [score:7]
Differential expression of RNAseq data identified 12 miR with changes in relative expression during follicular trachoma, of which 9 were confirmed as differentially expressed by qPCR (miR-155, miR-150, miR-142, miR-181b, miR-181a, miR-342, miR-132, miR-4728 and miR-184). [score:7]
MiR-155 was up-regulated (OR = 2.533 ((95 % CI = 1.291–4.971); P = 0.0069) and miR-184 was down-regulated (OR = 0.416 ((95 % CI = 0.300–0.578); P = 1.61*10 [−7]) as the severity of clinical inflammation increased. [score:7]
MiR-184 is strongly down-regulated during acute corneal injury and expression is restored in the re-epithelialized cornea upon healing [63]. [score:5]
MiR-184 and miR-4728 were down-regulated in TF independently of Ct infection. [score:4]
MiR-184 and miR-4728 were down-regulated during follicular trachoma in the absence of Ct. [score:4]
Prolonged down-regulation of miR-184 may also contribute to epithelial thinning, which is observed in trachoma, potentially predisposing individuals more to subsequent bacterial infections. [score:4]
We found that miR-184 and miR-4728-3p were down-regulated in follicular trachoma irrespective of Ct infection. [score:4]
MiR-155 and miR-184 expression had a direct relationship with the degree of clinical inflammation. [score:4]
Altogether, these data suggest that a down-regulation of miR-184 in follicular trachoma once Ct has been cleared reflects a prolonged wound healing process and activation of the Wnt pathway, possibly contributing to pathology. [score:4]
Future work should focus on the expression of miR-184 and activity of the Wnt pathway in a longitudinal set of clinical samples to determine the contribution of this pathway to the development of trachomatous pathology. [score:4]
MiR-184 was the only miR differentially expressed in uninfected cases of follicular trachoma versus uninfected healthy controls and was highly associated with papillary hypertrophy score after adjustment for Ct load. [score:3]
In follicular trachoma, expression of miR-155 and miR-184 is correlated with the severity of inflammation. [score:3]
We previously found that miR-184 was highly abundant (5/502) in a pool of normal healthy adults and adults with scarring trachoma [15], suggesting tissue specific expression does not vary with age. [score:3]
In the cornea miR-184 is expressed in basal and supra-basal epithelial cells [63], under which the stromal thinning occurs. [score:3]
MiR-184 was the only miR that was significantly differentially expressed between uninfected normal healthy controls (n = 77) and Ct negative TF cases (TF Ct- (n = 34), P [adj] = 0.00165, FC = 0.315, data not shown). [score:3]
Delivery of miR-184 was able to inhibit induction of the Wnt pathway, conferring miR-184 with significant therapeutic potential. [score:3]
Expression of miR-155 and miR-184 for 163 clinical samples plotted against clinical trachoma papillary hypertrophy score. [score:3]
Significant differences in miR-184 expression level were found between P0 and P1 (P [adj] = 5.5  [x] 10 [−5]) and between P0 and P2/3 (P [adj] = 4.2  [x] 10 [−5]). [score:3]
MiR-155 and miR-184 alone had a strong and direct association with papillary inflammatory score after adjustment for these factors. [score:2]
MiR-184 expression decreased with papillary inflammation score (Fig.   3). [score:2]
A single base substitution in the seed region of miR-184 is associated with severe keratoconus (thinning of the cornea) [64– 66]. [score:1]
MiR-155 and miR-184 were inversely correlated with pathological inflammation, which is known to be a major risk factor for scarring trachoma. [score:1]
After adjusting for the relationship between miR and Ct infectious load, we found that miR-155 and miR-184 were independently associated with inflammation. [score:1]
MiR-184 is known to be enriched in the corneal epithelium [63] and it is the fourth most abundant miR in control individuals (F0P0C0). [score:1]
MiR-155 (OR = 2.533 (95 % CI = 1.291–4.971), P = 0.007) and miR-184 (OR = 0.416 (95 % CI = 0.300–0.578), P = 1.61  [x] 10 [−7]) were significantly associated with papillary inflammation (Additional file 7). [score:1]
This hypothesis perhaps also explains the lack of miR response in our infected epithelial cell mo del and suggests that inflammatory cell stimuli are required for a miR response in the epithelium in vivo, as might be the case for miR-184. [score:1]
[1 to 20 of 27 sentences]
10
[+] score: 88
The inverse correlation between miR-184 expression and disease recurrence would suggest to us that miR-184 is probably tumour suppressive in the context of GCTs, which is supported by its expression patterns seen in other tumour types [34– 36]. [score:9]
Contrastingly, our study has demonstrated that early FIGO-staged adult-GCT tumours expressing low tumour miR-184 expression at disease presentation were significantly more likely to recur when compared to tumours with high expression. [score:8]
Patients with a low tumour miR-184 expression had a significantly shorter median time to disease recurrence when compared to those with high tumour expression. [score:6]
miR-184 is highly conserved across animal kingdoms and its expression has been shown to be critical in regulating early developmental processes in Drosophila melanogaster, particularly in female germline development as well as oogenesis [29]. [score:6]
In addition, the expression of miR-184 was predictive of tumour recurrence in adult-GCTs, specifically for patients diagnosed with stage I and II and stage I only disease (p < 0.001 and p < 0.05, respectively). [score:5]
Further, miR-184 has been linked to regulation of the PI3K/AKT/mTOR pathway [44], via multiple confirmed gene targets, which is a key signalling pathway in the development of GCTs [45, 46]. [score:5]
Cheng Z, Wang HZ, Li XT, Wu ZW, Han Y, Li YY, Chen GL, Xie XS, Huang YL, Du ZW et al: MicroRNA-184 inhibits cell proliferation and invasion, and specifically targets TNFAIP2 in Glioma. [score:4]
We found a significant difference in recurrence-free survival between tumours with low expression of miR-184 when compared to those with high expression for both ‘stage I and II’ and ‘stage I only’ patients (p < 0.05) (Fig. 4). [score:4]
miR-184 has also been shown to be expressed in normal proliferating granulosa cells of the developing follicle in bovine animals [30]. [score:3]
Normalised expression values of a. hsa-miR-138-5p, b. hsa-miR-184, c. hsa-miR-204-5p, d. hsa-miR-29c-3p, e. hsa-miR-328-3p, and f. hsa-miR-501-3p in healthy normal granulosa cells (circle), juvenile-GCT (square) and adult-GCT (triangle) assessed using RT-qPCR. [score:3]
Tarbase v7.0 [38] listed LAMC1 as an experimentally confirmed and in silico predicted target of miR-184. [score:3]
Interestingly, this particular tumour also had the highest level of miR-184 expression of all the juvenile-GCT tumours included in this study (Fig. 2b), which further supports that it was an adult-GCT that might have been misdiagnosed based on standard pathology diagnostics. [score:3]
During follicular development, miR-184 regulates steroidogenesis and follicle maturation, two important biological functions of normal granulosa cells [30]. [score:3]
We would propose that loss of miR-184 in the tumours may in part lead to earlier recurrence due to the loss of inhibition of migration and invasion promoting genes [47]. [score:3]
Gui YT et al: microRNA-184 functions as tumor suppressor in renal cell carcinoma. [score:3]
Therefore the abundant expression of miR-184 in the adult-GCT tumours is consistent with its known cellular origin and suggest that miR-184 is likely to have a role in normal granulosa cell biology which, we believe, becomes perturbed in GCTs. [score:3]
Kaplan-Meier estimates of recurrence-free survival for a. stage I and II and b. stage I only adult-GCT patients according miR-184 expression. [score:3]
miR-184 in human cancer appears to be context -dependent with roles as an oncogene and a tumour suppressor gene [31– 36]. [score:3]
30th quantiles was used as the expression cut-off for miR-184. [score:3]
In prostate cancer, for example, miR-184 is differentially expressed in cancer cells of higher-grade tumours with a more aggressive clinical behaviour when compared with lower-grade tumours [37]. [score:2]
The array data identified hsa-miR-184 to be 56 times more abundant in adult-GCTs than juvenile-GCTs, a difference later validated by RT-qPCR. [score:1]
However, as we were limited by the study sample size, validation of this finding in a larger sample series is warranted in order to confirm and fully elucidate the predictive power of miR-184 as a recurrence marker. [score:1]
The reduction of miR-184 in earlier recurring tumours may also be biologically relevant. [score:1]
Low miR-184 abundance was correlated with tumour recurrence in early stage adult-GCT patients as a candidate predictive biomarker. [score:1]
Interestingly, among the differentially regulated miRNAs, miR-184 was shown to be 56 folds more highly abundant in adult-GCTs when compared to juvenile-GCTs (Table 1). [score:1]
Considering its involvement in various types of human cancer, the expression of miR-184 as a tumour biomarker has been extensively investigated. [score:1]
[1 to 20 of 26 sentences]
11
[+] score: 70
In our miRNA inhibition assays, CHIKV replication was inhibited in AAG-2 and BHK-21 cells at 48 and 24 h. p. i but not at 72 h. p. i. This corresponds with a previous study, where upregulation of miR-184 was observed in S. frugiperda cells after baculovirus infection at 24 h. p. i. but downregulated by 72 h. p. i. and could potentially explain the lack of CHIKV inhibition in our study at 72 h. p. i. [31]. [score:12]
In comparison with uninfected saliva, aae-mir-184 was highly expressed but downregulated in CHIKV infected Ae. [score:6]
High expression of miR-184 has been reported in other insects as well [18, 45] where miR-184 is ubiquitously expressed in varying levels at all stages of Drosophila development [31]. [score:6]
MicroRNA inhibitors were designed based on the sequences of the following select microRNAs, aae-mir-12, aae-mir-125, aae-mir184, aar-mir-375, aae-mir-2490 and a control inhibitor with random sequence, Scramble, that was designed based on a previous study [30]. [score:5]
As the RNAi pathway is an important defense pathway against viral infections in several mosquito species [47– 50] differential expression of aae-miR-184 post-infection in mosquitoes could modulate AGO 2 levels thereby regulating viral replication at the initial site of infection. [score:4]
albopictus saliva whereas aae-mir-125 (2.2-fold), aae-mir-263a (3.4-fold), aae-mir-184 (1.3-fold) and aae-mir-100 (2.0-fold) were all upregulated in comparison with uninfected Ae. [score:4]
Out of the 5 miRNAs inhibited, all demonstrated lower CHIKV titers in AAG-2 cells however, only miR-184, miR-375 and miR-2490, demonstrated decreased CHIKV titers in both mosquito (AAG-2) and mammalian (BHK-21) cells. [score:3]
In the present study, CHIKV replication was inhibited at 24 and 48 h. p. i. in C6/36 cells suggesting a potentially more complex role of miR-184 in the RISC. [score:3]
C6/36 cells: No significant differences were observed in titers for any miRNA inhibitor with the exception of MIR-184. [score:3]
Mosquito (AAG-2 and C6/36) and mammalian (BHK-21) cells were transfected with miRNA inhibitors, a) MIR-12, b) MIR-125, c) MIR-184, d) MIR-375 and e) MIR-2940, and then infected with CHIKV at 72 hours post-transfection. [score:3]
0003386.g002 Figure 2 Mosquito (AAG-2 and C6/36) and mammalian (BHK-21) cells were transfected with miRNA inhibitors, a) MIR-12, b) MIR-125, c) MIR-184, d) MIR-375 and e) MIR-2940, and then infected with CHIKV at 72 hours post-transfection. [score:3]
All miRNA inhibitors (MIR-12, MIR-125, MIR-184, MIR375 and MIR-2490) were synthesized by Integrated DNA Technologies [©]. [score:3]
The miR-184 was highly expressed in both species. [score:3]
At 24 h. p. i., MIR-184 inhibited cells showed a significantly lower CHIKV titer of 7.16 ± 0.12 log [10]PFU/mL in comparison to 7.5 ± 1.2 log [10]PFU/mL (p<0.05). [score:3]
Significant inhibition of CHIKV replication in both AAG-2 and BHK-21 cells also indicates the important role of miR-184 in arboviral infections in both mosquito and mammalian host. [score:3]
MicroRNA-184 has also been shown to increase in response to interleukin-22 (IL-22), a proinflammatory cytokine associated with inflammatory skin disorders, thereby reducing expression of Argonaute-2 (AGO 2) protein in human keratinocytes [46]. [score:2]
aegypti saliva and these include aae-mir-8, aae-mir-2940, aae-mir-263a, aae-mir-bantam, aae-mir-125, aae-mir-184, aae-mir-281and aae-mir-100 all of which have been identified in Aedes spp. [score:1]
At 48 h. p. i., CHIKV titers were significantly lower (p < 0.05) in cells transfected with MIR-184 (Fig. 2C) and MIR-375 (Fig. 2D). [score:1]
albopictus saliva were from aae-mir-125 (4333), aae-mir-263a (4293), aae-mir-8 (2609), aae-mir-184 (2332) and aae-mir-100 (2255) (Table 3). [score:1]
aegypti saliva were aae-mir-281 (56394), aae-mir-2940 (25307), aae-mir-8 (47613), aae-mir-184 (10105) aae-mir-bantam (9969), aae-mir-263a (9084) and aae-mir125 (5863) (Table 1). [score:1]
[1 to 20 of 20 sentences]
12
[+] score: 59
Other miRNAs from this paper: hsa-mir-205
It is possible that miR-205, which was also upregulated in K+Y -treated LECs (Supplementary Table  S1), is involved in this regulation because miR-184 inhibits the binding of miR-205 to its target mRNA and prevents the knockdown effect by miR-205, thereby rescuing the production of target mRNAs [50]. [score:12]
It is also possible that miR-184 inhibits the translation of CTCF, considering that CTCF expression was not significantly different between the two conditions, at least at the transcription level (Supplementary Fig.   S7). [score:7]
Knockdown of miR-184 leads to decreased expression of PAX6 and KRT3 in human embryonic stem cell-derived CECs [32], which indicates that miR-184 regulates the expression of PAX6 in CECs. [score:7]
Interestingly, a promoter of microRNA, p1@MIR184, was significantly upregulated in K+Y -treated LECs (adjusted P = 8.77 × 10 [−30]; Fig.   3a and Supplementary Table  S1). [score:4]
These observations suggest that miR-184 plays a crucial role in the transcriptional network of CECs and K+Y -treated LECs, given that microRNAs regulate gene expression post-transcriptionally [35]. [score:4]
Here, we determined that miR-184 and CEC-specific p3 and p9@PAX6 were significantly upregulated in LECs cultured with KGF and Y-27632. [score:4]
It has been reported that the 3′-UTR of PAX6 does not have predictable binding sites for miR-184, which suggests that miR-184 regulates PAX6 indirectly [32]. [score:3]
The promoter of CEC-specific miR-184 was also highly expressed in LECs cultured with K+Y. [score:3]
It has been reported that miR-184 is essential for corneal epithelial differentiation [32] and is the most abundant miRNA expressed in the mouse and human cornea 33, 34. [score:3]
The expression of PAX6 might be rescued by miR-184 through this mechanism. [score:3]
The FANTOM5 atlas also demonstrated that miR-184 is expressed exclusively in ocular tissues (Supplementary Table  S3). [score:3]
Further studies are needed to elucidate the underlying mechanism of gene regulation by miR-184. [score:2]
A point mutation in miR-184 causes corneal endothelial dystrophy, iris hypoplasia, congenital cataract, and stromal thinning (EDICT) syndrome, which exhibits a phenotype similar to that of anterior segment dysgenesis disorders caused by PAX6 deficiency [49]. [score:2]
These observations suggest that these CEC-specific PAX6 promoters are positively regulated by miR-184. [score:2]
[1 to 20 of 14 sentences]
13
[+] score: 40
To assess whether miRNA with expression divergence on the human lineage might be associated with human cognitive functions, we investigated the expression of genes targeted by five miRNA showing human-specific expression, according to multiple methodologies: miR-184, miR-487a, miR-383, miR-34c-5p and miR-299-3p (Figure 2). [score:7]
Potential influence of miRNA divergence on neuronal functions was further confirmed by preferential expression of the corresponding miR-299-3p and miR-184 in cortical neurons, as well as verification of the predicted miRNA-target relationship in two human neuroblastoma cell lines. [score:5]
This effect was significant for combined targets of the five miRNA, as well as for targets of miR-184 and miR-383 analyzed individually. [score:5]
Furthermore, miR-184 targets were significantly enriched in “long-term potentiation” pathway – one of the few pathways directly connected to learning and memory formation [34], [35]. [score:4]
Similarly, based on the DIANA-mirPath algorithm [33], targets of miR-184, miR-487a and miR-299-3p were significantly enriched in KEGG pathways that are related to neural functions (Table S10). [score:3]
To further test association of miR-184 and miR-299-3p with neuronal functions, we determined their expression patterns in the human and macaque prefrontal cortex by in situ hybridization with specific LNA-probes (Table S11). [score:3]
Based on the DIANA-mirPath algorithm, targets of miR-184, miR-487a and miR-299-3p were significantly enriched in KEGG pathways that are related to neural functions (Table S10). [score:3]
Requiring significant support by at least two out of three methodologies (sequencing, microarrays and Q-PCR), expression changes in five miRNA (miR-184, miR-299-3p, miR-487a, miR-383 and miR-34c-5p) could be assigned to the human evolutionary lineage and two (miR-375 and miR-154*) to the chimpanzee evolutionary lineage (Figure 2). [score:3]
Recent studies have also shown that miR-184 is involved in regulation of neural stem cell proliferation and differentiation [36]. [score:2]
We chose three types of miRNA differences: (1) consistent by both methodologies: miR-383 and miR-34c-5p; (2) significant according to sequencing, but unconfirmed in the microarray experiment: miR-143 and miR-499; (3) significant according to sequencing, but not detected or masked on the microarrays: miR-184 and miR-299-3p. [score:1]
1002327.g004 Figure 4 In situ staining of miR-184 and miR-299-3p in prefrontal cortex. [score:1]
In situ staining of miR-184 and miR-299-3p in prefrontal cortex. [score:1]
We designed two LNA-probes complementary to miR-184 and miR-299-3p respectively (Table S11). [score:1]
On the DNA sequence level, these miRNA tend to be conserved: miR-184 mature miRNA sequence is evolutionarily conserved from insects to humans, with only one nucleotide different at 3′end of mature sequence, while miR-383 and miR-34c-5p are classified as broadly conserved and miR-299-3p - as conserved among animal species [25], [31]. [score:1]
[1 to 20 of 14 sentences]
14
[+] score: 37
The same study also suggested that miR-184 down-regulates NCOR2 (nuclear receptor co-repressor 2) by targeting its 3 prime untranslated region and preventing NCOR2 protein translation. [score:10]
Up-regulated miRNAs (cfa-let-7, cfa-miR-200, cfa-miR-125, cfa-miR-34, cfa-miR-23, cfa-miR-146 clusters, cfa-miR-184 and cfa-miR-214) in adult canine testis treated with DMSO, RA or CYP26B1 inhibitor. [score:6]
Interestingly, in the present study cfa-miR-184 has been significantly up-regulated in response to direct and indirect increase of RA level in canine testis. [score:6]
MiRNA families such as miR-200 (cfa-miR-200a, cfa-miR-200b and cfa-miR-200c), Mirlet-7 (cfa-let-7a, cfa-let-7b, cfa-let-7c, cfa-let-7g and cfa-let-7f), miR-125 (cfa-miR-125a and cfa-miR-125b), miR-146 (cfa-miR-146a and cfa-miR-146b), miR-34 (cfa-miR-34a, cfa-miR-34b and cfa-miR-34c), miR-23 (cfa-miR-23a and cfa-miR-23b), cfa-miR-184, cfa-miR-214 and cfa-miR-141 were significantly up-regulated with testicular RA intervention via administration of CYP26B1 inhibitor and all-trans-RA (Figure 5). [score:6]
Mir-21, mir-34c and mir-221/222 control self-renewal of undifferentiated spermatogonia [19], Mirc1, Mirc3 and Mirlet7 regulate spermatogonial differentiation [9], [20], mir-15a and mir-184 mediate differentiation of spermatocytes [18], [19], miR-18, miR-34b, miR-34c, miR-184, miR-383, miR-449 and miR-469 mediate meiotic division of spermatocytes to spermatids [21], [23]– [25] and miR-469, miR-34c regulate differentiation of spermatid to form spermatozoa [24], [25]. [score:3]
Therefore, it is suggested that cfa-miR-184 is an RA -dependent regulator for canine spermatogenesis. [score:2]
An earlier study [22], demonstrated that miR-184 level was steadily increased during post-natal testicular development in mice. [score:2]
MiR-184 has been shown to be highly expressed in murine testis. [score:2]
[1 to 20 of 8 sentences]
15
[+] score: 37
Five miRNAs, miR-127, miR-21, miR-146b, miR-183, miR-184 were similarly up-regulated in c-Raf transgenic lung and human lung cancer therefore demonstrating clinical relevance of this particular disease mo del. [score:6]
Five miRNAs, miR-127, miR-21, miR-146b, miR-183, miR-184 were similarly up-regulated in c-Raf transgenic mouse lung and human lung cancer thus further validating this mo del as relevant for human lung cancer (Figure 7). [score:4]
Differential miRNA expression was examined by quantitative real time PCR (qRT-PCR) of the eight regulated miRNAs (miR-21, miR-96, miR-127, miR-146b, miR-183, miR-184 and miR-322, miR-433). [score:4]
With the Agilent platform significant up-regulation of, miR-21, miR-184 and miR-146b (borderline significant in male, Table 1) in male and female transgenic animals was observed, although at different levels in the two sexes. [score:4]
Shown is the expression of miR-21, miR-146b, miR-127, miR-433, miR-96, miR-183, miR-184 and miR-322 in WT and transgenic male and female mice. [score:3]
0078870.g005 Figure 5The 3′UTR sequence alignment of VLC, SLC10A3, MAPK4, GATA3, ANKRD27, IRS1, CRISPLD2 and ARL2 between Mus musculus and Homo sapiens species may possibly suggest conservation of seed sequences targeted by miR-21 (panel A), miR-146b (panel B), miR-127 (panel C), miR-433 (panel D), miR-96 (panel E), miR-183 (panel F), miR-184 (panel G) and miR-322 (panel H), respectively. [score:3]
0078870.g002 Figure 2 Shown is the expression of miR-21, miR-146b, miR-127, miR-433, miR-96, miR-183, miR-184 and miR-322 in WT and transgenic male and female mice. [score:3]
Specifically, with the Agilent platform a significant regulation of miR-21, miR-96, miR-127, miR-146b, miR-183, miR-184 and miR-322 was observed whereas for the Affymetrix platform significant regulation of miR-127 and miR-433 could only be evidenced. [score:3]
The 3′UTR sequence alignment of VLC, SLC10A3, MAPK4, GATA3, ANKRD27, IRS1, CRISPLD2 and ARL2 between Mus musculus and Homo sapiens species may possibly suggest conservation of seed sequences targeted by miR-21 (panel A), miR-146b (panel B), miR-127 (panel C), miR-433 (panel D), miR-96 (panel E), miR-183 (panel F), miR-184 (panel G) and miR-322 (panel H), respectively. [score:3]
3) 55.6 AACCCATGGAATTCAGTTCTCA −26.0 59.5 −20 54.0 mmu-miR-146b UGAGAACUGAAUUCCAUAGGCU 40 AGCCTATGGAATTCAGTT(C) (−21.5) 41.5 AGCCTATGGAATTCAGTTCTCA −26.2 47.4 −20.2 39.2 mmu-miR-182 UUUGGCAAUGGUAGAACUCACACCG 48 CGGTGTGAGTTCTAC(C) (−19.9) 62.9 CGGTGTGAGTTCTACCATTGCCAAA −31.9 62.9 −17 58.8 mmu-miR-183 UAUGGCACUGGUAGAAUUCACU 40 AGTGAATTCTACCAGTGC(C) (−23.2) 44.7 AGTGAATTCTACCAGTGCCATA −26.3 46.3 −20.3 40.0 mmu-miR-184 UGGACGGAGAACUGAUAAGGGU 50 ACCCTTATCAGTTCTCCGTCC(A) (−31.9) 57.0 ACCCTTATCAGTTCTCCGTCCA −31.9 57.0 −30.3 56.2 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA 40 TCCAAAACATGAATTGCTGCTG −23.1 37.7 TCCAAAACATGAATTGCTGCTG −23.1 37.7 mmu-miR-433 AUCAUGAUGGGCUCCUCGGUGU 54 ACACCGAGGAGCC(C) (−20. [score:1]
Prefabricated TaqMan MicroRNA Assays (containing microRNA-specific forward and reverse PCR primers and microRNA-specific Taqman MGB probe) were used to determine expression of miR-21 (ABI P/N 000397), miR-146b-5p (ABI P/N001097), miR-127 (ABI P/N000452), miR-433-3p (ABI P/N001028), miR-322 (ABI P/N001076), miR-184-3p (ABI P/N000485), miR-183 (ABI P/N002269), miR-96 (ABI P/N000186), miR-15a-5p (ABI P/N000389), miR-34a-5p (ABI P/N000426), miR-146a-5p (ABI P/N000468) and miR-182-5p (ABI P/N002599). [score:1]
Similarly, it is not clear why Affymetrix fails to see variations in all but two miRs (-127 and -433), since for example the probe for miR-184 has similar parameters to those for miR-127 and miR-433. [score:1]
Only the Agilent data for miR-184 and miR-146b, as well as for miR-21 (here female mice), were confirmed by the qPCR. [score:1]
[1 to 20 of 13 sentences]
16
[+] score: 30
We also found other evidence supports that ectopic expression of miRNA-184 leads to neuroblastoma cell growth arrest and apoptosis, miRNA-184 expression is repressed in human neuroblastoma tissues, and low levels of miRNA-184 expression in human neuroblastoma tissues correlate with poor patient survival [57]. [score:7]
As low levels of miR-184 in human neuroblastoma tissues also correlates with poor patient survival, the data suggest that miR-184 is likely to positively regulate ALDH4A1 expression in tumours. [score:4]
Based on this evidence, the miRNA-184 target sites in 5' UTRs or coding region may make significant contribution to miR-184 mediated regulation. [score:4]
The expression levels of miR-184 is preprocessed by dividing 10 and has a good gain ratio, classifying the HCV+ and HCV- samples very well. [score:3]
Mature miR-184 of over -expression can act as an oncogene in the antiapoptotic and proliferative processes of tongue Squamous Cell Carcinoma [43]. [score:3]
As found by this work, the strongest positively regulated relationship is between miR-184 and ALDH4A1 mRNA. [score:2]
In Drosophila, a luciferase reporter assay has shown that miR-184 can target some mRNAs in the protein coding region [56]. [score:2]
We found that the seed region of miR-184 is complementary to the coding region or to the 5' UTR of ALDH4A1 with just one mismatched pair. [score:1]
GFRA2 QKI MAP2 FRMPD4 BNC2 CAMK2D miR-493-3p - -0.68 - 0.12 - - miR-184 - - - -0.05 - - miR-129 - -0.71 - - - 0.01 miR-214 - - -0.15 - -0.01 0.03 miR-557 0.18 - -0.01 - - - miR-765 0.21 -0.44 -0.02 -0.04 -0.10 - miR-17-3p 0.26 - - - -0.13 -0.13 miR-34a - - -0.05 - - - (Figure 8). [score:1]
An positive realtionship between the ALDH4A1 mRNA and miR-184. [score:1]
• In the module of miR-184 and miR-214, a mRNA ALDH4A1 of miR-184 was believed to contribute to HBV- or HCV- induced liver [34]. [score:1]
The seed region of miR-184 matches the positions from 705 to 711 of ALDH4A1 's coding region or with the positions from 257 to 263 at ALDH4A1 5' UTR. [score:1]
[1 to 20 of 12 sentences]
17
[+] score: 30
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-205, hsa-mir-214, hsa-mir-221, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-193a, hsa-mir-1-1, hsa-mir-29c, hsa-mir-133b, dre-mir-205, dre-mir-214, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-mir-1-2, dre-mir-1-1, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-107a, dre-mir-122, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-184-1, dre-mir-193a-1, dre-mir-193a-2, dre-mir-202, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-202, hsa-mir-499a, dre-mir-184-2, dre-mir-499, dre-mir-724, dre-mir-725, dre-mir-107b, dre-mir-2189, hsa-mir-499b, dre-mir-29b3
This network visualization shows that (1) all modules contain at least 2 genes that are predicted targets of a deregulated miRNA identified in this study, except the module “Apoptosis and NAFLD”; (2) dre-miR-2189, the only DE miRNA that was downregulated, targets many genes in modules that are predominantly upregulated such as Cell cycle (4 target mRNAs), Apoptosis and Autophagy (19 targets), Epigenetics and Apoptosis/Autophagy (2 targets) and Receptors (4 targets); (3) certain miRNAs have only 1 target gene in the selected modules, including dre-miR-184 (“Oxidative phosphorylation”), dre-miR-430a and dre-miR-430b (“Apoptosis and Autophagy”); (4) while other miRNAs have common target genes in the same modules, i. e., dre-miR-725/dre-miR-724/dre-miR-193a, dre-miR-202, dre-miR-205 and dre-miR-133a that have several common target genes in modules “Oxidative phosphorylation and NAFLD”, “Apoptosis/Autophagy”, “NAFLD” and “Cell cycle”. [score:26]
Here we showed that dre-miR-724 and -725 teamed up with dre-miR-193a, -202, -205 and -133a to regulate apoptosis, autophagy, NAFLD, oxidative phosphorylation and cell cycle modules whereas other miRNAs only had one target in a single module (dre-miR-184, -430a, -430b). [score:4]
[1 to 20 of 2 sentences]
18
[+] score: 29
This deviant DNA methylation causes damping of miRNA tumour suppressors such as let-7, miR-101, and miR-202 that target MYCN; miR-9 that targets tyrosine kinase (Trk) C, RE-1 silencing transcription factor (REST), DNA -binding protein inhibitor (ID2), and Matrix metalloproteinase-14 (MMP-14); miR-34a that targets E2F transcription factor 3 (E2F3), B-cell lymphoma 2 (Bcl-2) and MYCN; miR-340 that targets SRY (sex determining region Y)-box 2 (SOX2); miR-184 that targets v-akt murine thymoma viral oncogene homolog 2 (Akt2); and miR-335 that targets Mitogen-Activated Protein Kinase 1 (MAPK1), leucine-rich repeat 1 (LRG1), and Ser/Thr Rho kinase 1 (ROCK1) [101] (Figure 1). [score:17]
Another study indicated that when miR-184 was overexpressed using pre-miR-184, it inhibited the mRNA of Akt2, thus affecting the phosphatidylinositol 3-kinase (PI3K) pro-survival pathway and reducing tumour growth [253]. [score:5]
Foley N. H. Bray I. M. Tivnan A. Bryan K. Murphy D. M. Buckley P. G. Ryan J. O’Meara A. O’Sullivan M. Stallings R. L. MicroRNA-184 inhibits neuroblastoma cell survival through targeting the serine/threonine kinase AKT2Mol. [score:4]
Tivnan A. Foley N. H. Tracey L. Davidoff A. M. Stallings R. L. MicroRNA-184 -mediated inhibition of tumour growth in an orthotopic murine mo del of neuroblastomaAnticancer Res. [score:2]
In this regard, miR-134 and miR-184 have both been associated with neural progenitor maintenance and proliferation [66]. [score:1]
[1 to 20 of 5 sentences]
19
[+] score: 24
revealed that the expression of human miR-184, miR-1225-5p and miR-30c-2-3p was up-regulated in human spermatogonia compared to pachytene spermatocytes, whereas miR-126-3p, let-7a-5p and miR-125b-5p were down-regulated in human spermatogonia compared with pachytene spermatocytes (Fig. 6A), which was completely consistent with our miRNA microarray data. [score:7]
Using different miRNA software programs, including TargetScan, miRbase, and miRDB 5, we predicted the targeting genes of human miR-1225-5p, miR-184, miR-30c-2-3p, let-7a-5p, miR-125b-5p and miR-126-3p. [score:5]
Specifically, E2F transcription factor 1 (E2F1) was a potential binding target for human miR-184 (Fig. 7A), while Ets variant 1 (ETV1) was a target of miR-1225-5p (Fig. 7B). [score:5]
We also identified E2F1 as a target for miR-184 using various kinds of softwares. [score:3]
In line with these observations, we found a higher expression of miR-184 in human spermatogonia compared to pachytene spermatocytes, suggesting miR-184 may be involved in the self-renewal of human SSCs. [score:2]
Previous studies have reported that miR-184 plays an important role in the balance between proliferation and differentiation of adult neural stem/progenitor cell and in Drosophila female germline development 38 39. [score:2]
[1 to 20 of 6 sentences]
20
[+] score: 24
Liu Z Candidate tumour suppressor CCDC19 regulates miR-184 direct targeting of C-Myc thereby suppressing cell growth in non-small cell lung cancersJ. [score:9]
In addition, miR-184 acts as a tumor suppressor in nasopharyngeal carcinoma, lung cancer, and neuroblastoma by targeting c-Myc, BCL-2, and AKT2 38– 40. [score:5]
Dysregulation of miR-184 promotes cell proliferation in hepatocellular carcinoma by targeting INPPL1 and SOX7 36, 37. [score:4]
Foley NH MicroRNA-184 inhibits neuroblastoma cell survival through targeting the serine/threonine kinase AKT2Mol. [score:4]
Gao B Gao K Li L Huang Z Lin L miR-184 functions as an oncogenic regulator in hepatocellular carcinoma (HCC)Biomed. [score:2]
[1 to 20 of 5 sentences]
21
[+] score: 24
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
Within 6 hrs of the presence of E. coli, the expression of 6 miRNAs in MAC-T cells was significantly altered (P < 0.05), three were down regulated (bta-miR-193a-3p, miR-30c and miR-30b-5p) while three were up-regulated (bta-miR-365-3p, miR-184 and miR-24-3p) (Table  3). [score:7]
Similarly, only 3 genes each out of 88 target genes for miR-184 were enriched (P > 0.05) in two pathways, Chronic myeloid leukemia and Prostate cancer and were ignored. [score:3]
Furthermore, the differential expression pattern of five miRNAs (bta-miR184, miR-24-3p, miR-148, miR-486 and bta-let-7a-5p) were unique to E. coli while four (bta-miR-2339, miR-499, miR-23a and miR-99b) were unique to S. aureus. [score:3]
Most of the detected top expressed miRNAs are conserved in human, mouse, and bovine, and belong to several miRNA families, vis, miR-31, miR-26a, miR-27a-3p/27b, let-7a-5p/7f/7i, miR-21-5p, miR-22-3p, miR-184, miR-186, miR-191, miR-205 and miR221/222. [score:3]
The top five highly expressed miRNAs were bta-miR-21-5p, miR-27b, miR-22-3p, miR-184 and let-7f, accounting for 16.02%, 15.18%, 8.37%, 5.45% and 5.01% of total known miRNA reads, respectively. [score:3]
Five differentially expressed miRNAs (bta-miR-184, miR-24-3p, miR-148, miR-486 and let-7a-5p) were unique to E. coli while four (bta-miR-2339, miR-499, miR-23a and miR-99b) were unique to S. aureus. [score:3]
A total of 231 known bovine miRNAs were identified with more than 10 counts per million in at least one of 13 libraries and 5 miRNAs including bta-miR-21-5p, miR-27b, miR-22-3p, miR-184 and let-7f represented more than 50% of the abundance. [score:1]
Interestingly, our study shows that a different set of five miRNAs (miR-184, miR-24-3p, miR-148, miR-486 and let-7a-5p) were unique to E. coli bacteria while another set of four (miR-2339, miR-499, miR-23a and miR-99b) were unique to S. aureus bacteria. [score:1]
[1 to 20 of 8 sentences]
22
[+] score: 18
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The highest upregulated miRNA (miR-184) at the GP-early OP transition shows a strong conserved 8mer binding site to BCL2-like 1 (Bcl2l1), a gene highly expressed in astrocytes [36]. [score:6]
The highest upregulated miRNA at this transition, miR-184, shows a high likelihood of binding to Bcl2l1, a gene which has been shown to be co-expressed with GFAP in various samples of astrocyte tissue [36]. [score:6]
On the other hand, the top upregulated miRNAs at the OP3-OL transition included miRNAs (miR-181a, miR-181b, miR-125b, and miR-184) that are associated with decreased proliferation in maturing CNS cells and decreased malignancy in glioma stem cells [49], [50], [51], [52], [53], [54], [55]. [score:4]
Therefore, it is possible that transfection of miR-184 and/or miR-1183 analogs to GPs may help reduce astrocyte differentiation and promote the production of oligodendrocyte cultures with increased purity. [score:1]
The key miRNAs discussed in this manuscript were validated by conducting real-time qRT-PCR for samples from the appropriate stages, including the following: miR-199a and miR-145 at the OP1, OP2, OP3, and OL stages; miR-214 at the OP1 and OP2 stages; miR-184 and miR-1183 at the GP and OP1 stages (Table 1 ). [score:1]
[1 to 20 of 5 sentences]
23
[+] score: 18
Invasion was similarly inhibited by miR-184, but not by the other Suppressive miRNAs (Figure 4C). [score:5]
The few publications concerning miR-184 in cancer showed contradictory effects, either suppressive [39] or oncogenic [40]. [score:3]
Three miRNAs were within expression range (miR-34a, miR-185 and miR-204, Figure 2C) and two which were silenced (miR-31 and miR-184, Figure 2B) in the HAG cells. [score:3]
Tube formation activity was substantially inhibited by miR-34a and miR-185, and more mildly by miR-31 and miR-184, but not by miR-204, as compared to control (Figure 5, A–F). [score:2]
Most current studies on miR-184 and miR-204 focus on their roles in development and morphogenesis, which could be predicted computationally (Supplementary Table S1). [score:2]
Remarkably, a substantial and consistent inhibition in net proliferation was conferred by miR-31, miR-34a, miR-184 and miR-185 as compared to the control cell (Figure 4B). [score:2]
In contrast, very little is known about miR-184, miR-185 and miR-204 in cancer. [score:1]
[1 to 20 of 7 sentences]
24
[+] score: 17
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-221, hsa-mir-361, hsa-mir-33b
Up to date, the limited information relative to the postranscriptional regulation of SND1 identifies SND1 transcript as a target of miR-184 in malignant gliomas and breast cancer [21, 57] and miR-361-5p in colorectal and gastric cancer [58] and links miRNAs suppression with SND1 upregulation and cancer development and progression. [score:10]
Participation of SND1 in molecular networks involving NF-κB signalling activation and miR-221 induction [23], miR-184 expression and JAK/STAT3 inhibition [21], TGFβ1/Smad signalling pathway [15], Wnt/β-catenin activation [17] as well as the interaction of SND1 with partner proteins like metadherin-1 [24] and monoglyceride lipase [16], have been described to strictly modulate prosurvival and proliferative genes and proteins expression in cancer cells. [score:7]
[1 to 20 of 2 sentences]
25
[+] score: 15
For example, AKT2 28, target of hsa-miR-184, participating in Pten signaling pathway, activates a series of downstream targets, which are involved in the regulation of key cellular functions including cell growth and survival, glucose metabolism and protein translation. [score:8]
Additionally, hsa-miR-365, hsa-miR-1238, hsa-miR-184 are all down-regulated in [ER−|PR−]HER2−, and up-regulated in [ER−|PR−]HER2+. [score:7]
[1 to 20 of 2 sentences]
26
[+] score: 14
miR-184, which is differentially expressed in the regenerating tail tip, regulates proliferation and differentiation of neural stem cells [51]. [score:4]
In addition to regulating neural stem cell proliferation and differentiation, miR-184 targets the RNA -induced silencing complex (RISC) member argonaute2 [51, 58, 59]. [score:4]
As shown in Fig.   3 miR-1a, miR-1b, miR-133a and miR-206 show increased expression in the proximal portion of the regenerating tail, while miR-184 and miR-2188 display an opposite pattern. [score:3]
The small RNA miR-184, which is differentially expressed in the tip of anole regenerating tail, has also been identified in zebrafish tail fin regeneration [20]. [score:3]
[1 to 20 of 4 sentences]
27
[+] score: 14
miR-184, miR-524-5p, miR-629, and miR-766 were upregulated, while miR-124, miR-222, miR-32, miR-744, and miR-765 were downregulated [28]. [score:7]
miR184 was markedly upregulated in GH-secreting pituitary adenomas and was correlated with tumor diameter [28]. [score:4]
Contrary to that, another study reported that ectopic overexpression of miR-184 resulted in increased apoptosis [83]. [score:3]
[1 to 20 of 3 sentences]
28
[+] score: 14
MiR-184 may participate in the terminal differentiation of corneal epithelia and antagonize with miR-205, which down-regulates SH2-containing inositol phosphatase-2 in regulating epithelial cell proliferation [17]. [score:5]
Among them, miR-184 was up-regulated in CC epithelia, similar to reported finding. [score:4]
Among them, miR-184, as previously reported [16], was the most significantly up-regulated microRNA in CC epithelia (4.9 folds, P = 0.00005, unpaired Student's t test). [score:4]
In mouse cornea, miR-184 is highly enriched in basal corneal epithelium but absent in the superficial cells of cornea, whole limbal and conjunctival epithelia [16]. [score:1]
[1 to 20 of 4 sentences]
29
[+] score: 12
Different colors represent different experimental groups as indicated and the numbers 1, 2, 4, 5, 7 and 26 show the differentially expressed miRNAs that were significantly changed during infection with DENV-3 and ADETo further confirm our sequencing data, six significantly differentially expressed miRNAs, including hsa-miR-184, hsa-let-7e-5p, hsa-miR-132-3p, hsa-miR-155-5p, and hsa-miR-1246, were chosen for RT-qPCR analysis. [score:5]
Different colors represent different experimental groups as indicated and the numbers 1, 2, 4, 5, 7 and 26 show the differentially expressed miRNAs that were significantly changed during infection with DENV-3 and ADE To further confirm our sequencing data, six significantly differentially expressed miRNAs, including hsa-miR-184, hsa-let-7e-5p, hsa-miR-132-3p, hsa-miR-155-5p, and hsa-miR-1246, were chosen for RT-qPCR analysis. [score:5]
The levels of hsa-miR-184 is the comparison of PBMC infected with DENV to PBMC infected with DENV-ADE. [score:1]
d. Quantitative real-time PCR verify of hsa-miR-184 among III-8, III-24 and ADE-24. [score:1]
[1 to 20 of 4 sentences]
30
[+] score: 12
Other miRNAs from this paper: hsa-mir-204, hsa-mir-1469, hsa-mir-4279
In contrast to the above results, the mRNA levels of miR204, miR184, TGFβR2, TGFβR3, and BMP4, which have been previously shown to be downregulated by TGFβ2 in HLE cells (Dawes et al., 2007; Wang et al., 2013), were expectedly downregulated by the TGFβ2 treatment (Fig.   4). [score:7]
There were no apparent differences in the mRNA levels of miR204, miR184, and TGFβR2 in the cells on the unmodified or AGE‐modified BME, possibly because these mRNA levels were already highly downregulated by TGFβ2. [score:4]
The mRNA levels of BMP4, miR184, and TGFβR3 were all slightly but statistically insignificantly reduced in the cells grown on the AGE‐modified capsule than in the cells grown on the unmodified capsule. [score:1]
[1 to 20 of 3 sentences]
31
[+] score: 12
Disease Origin References of iPSC lines Phenotype of iPSC-derived neurons miRNAs of interest Fragile X syndrome Loss of function of FMRP (FMR1 gene) Urbach et al. (2010), Sheridan et al. (2011) Hyper-excitability of glutamatergic synapses DICER and AGO-1 complexes Rett’s syndrome Loss of function of MeCP2 transcriptional repressor Marchetto et al. (2010), Kim et al. (2011c), Cheung et al. (2012) Decreased soma size, neurite atrophy, decreased efficiency of glutamatergic synapses miR-132, miR-184, miR-483-5p, miR-212 Schizophrenia Multifactorial Urbach et al. (2010); Brennand et al. (2011), Paulsen Bda et al. (2012), Robicsek et al. (2013) Diminished neuronal connectivity miR-17-5p, miR-34a, miR-107, miR-122, miR-132, miR-134, miR-137 Down’s syndrome Additional copy of chromosome 21 Briggs et al. (2013), Weick et al. (2013) Reduced synaptic activity, increased sensitivity to oxidative stress miR-99a, miR-125b, miR-155, miR-802, Ret 7c Micro -RNAs, as fine regulators of protein translation, influence directly the level of gene expression. [score:9]
Disruption of MeCP2 gene in mice leads to the dysregulation of a set of miRNA potentially of influence in neurogenesis including miR-132, miR-184, miR-483-5p, and miR-212 (Nomura et al., 2008; Im et al., 2010; Urdinguio et al., 2010; Han et al., 2013). [score:2]
MeCP2 -dependent repression of an imprinted miR-184 released by depolarization. [score:1]
[1 to 20 of 3 sentences]
32
[+] score: 12
However, a tumor suppressor function was suggested by a recent study showing that ectopic expression of miR-184 suppresses Akt signaling pathway, which is associated with a marked increase in keratinocyte apoptosis and cell death [78]. [score:7]
Wong et al. suggested that miR-184 acts as a oncogenic microRNA by inhibiting apoptosis and inducing proliferation in HNOC [25]. [score:3]
The knowledge on miR-184 and its role on tumorigenesis are still elusive. [score:1]
These include miR-21, miR-184, miR-133a/133b, miR-137, and miR-193a. [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 11
Finally, the downregulation of mir-184 was reported in marginal zone lymphoma [34]. [score:4]
Conversely, 15 miRNAs resulted downregulated in activated B cells: mir-483, mir-95, mir-326, mir-135a, mir-184, mir-185, mir-516-3p, mir-30b, mir-203, mir-216, mir-150, mir-182*, mir-141 and mir-211 (Table 3). [score:4]
Our study identified 8 new differentially expressed miRNAs: mir-323, mir-138, mir-9*, mir-211, mir-149, mir-373, mir-135a and mir-184; that have not been reported in literature so far. [score:3]
[1 to 20 of 3 sentences]
34
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
Thus, it is possible that the down-regulation of miRNAs (rno-miR-770, rno-miR-466c, rno-miR-31, rno-miR-183, rno-miR-96, rno-miR-132, rno-miR-182, rno-miR-384-3p and rno-miR-184) observed in this study could be associated with promoted thecal hyperandrogenesis [37, 38]. [score:4]
MiRNAs found to be primarily down-regulated in DHT -treated rats includes rno-miR-770, rno-miR-466c, rno-miR-21, rno-miR-31, rno-miR-182, rno-miR-183, rno-miR-96, rno-miR-132, rno-miR-182, rno-miR-384-3p and rno-miR-184. [score:4]
Among the fourteen miRNAs mapped to the ingenuity databases, twelve (rno-let-7d, rno-miR-132, rno-miR-182, rno-miR-183, rno-miR-184, rno-miR-21, rno-miR-221, rno-miR-24, rno-miR-25, rno-miR-26b, rno-miR-31 and rno-miR-96) had 171 experimentally validated targets. [score:3]
[1 to 20 of 3 sentences]
35
[+] score: 11
As shown in Additional file 2: Table S2, 6 optimized miRNA-AKT interactions (miR-149-AKT1, miR-302d-AKT1, miR-184-AKT2, miR-708-AKT2, miR-122-AKT3 and miR-124-AKT3) had lower MFEs than the median values [-33.35(kcal/mol)] of all MFEs, thus, miR-149 and miR-302d were identified as candidate miRNAs targeting AKT1, miR-184 and miR-708 were identified as candidate miRNAs targeting AKT2, and miR-122 and miR-124 were identified as candidate miRNAs targeting AKT3. [score:7]
Nodes with yellow rings refer to the validated targets of hsa-miR-149, hsa-miR-302d, hsa-miR-184, hsa-miR-708, hsa-miR-122 and hsa-miR-124. [score:3]
Six optimized miRNA-AKT interactions (miR-149-AKT1, miR-302d-AKT1, miR-184-AKT2, miR-708-AKT2, miR-122-AKT3 and miR-124-AKT3) were obtained by combining the miRNA target prediction and MFE calculation. [score:1]
[1 to 20 of 3 sentences]
36
[+] score: 11
miRNAExpression change [a] miRbase accession numberExpression change [b] miR-132-5p Down MIMAT0004594 DownLi et al., 2013 miR-125b-1-3p Down MIMAT0004592 DownLi et al., 2013; Mar-Aguilar et al., 2013a miR-34c-5p Down MIMAT0000686 DownYang et al., 2013 miR-382-3p Down MIMAT0022697 DownLi et al., 2013; Mar-Aguilar et al., 2013b miR-485-5p Down MIMAT0002175 DownAnaya-Ruiz et al., 2013 miR-323b-3p Down MIMAT0015050 NA NA miR-598-3p Down MIMAT0003266 NA NA miR-224-5p Up MIMAT0000281 UpHuang et al., 2012 miR-1246 Up MIMAT0005898 UpPigati et al., 2010 miR-184 Up MIMAT0000454 NA NA a Expression change in this study. [score:7]
Additionally, miR-598 and miR-184 were also reported to be down-regulated in esophageal cancer (Zhao et al., 2013) and prostate cancer (Walter et al., 2013), respectively. [score:4]
[1 to 20 of 2 sentences]
37
[+] score: 10
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, dme-mir-1, dme-mir-8, dme-mir-11, hsa-mir-34a, hsa-mir-210, dme-mir-184, dme-mir-275, dme-mir-92a, dme-mir-276a, dme-mir-277, dme-mir-33, dme-mir-281-1, dme-mir-281-2, dme-mir-34, dme-mir-276b, dme-mir-210, dme-mir-92b, dme-bantam, dme-mir-309, dme-mir-317, hsa-mir-1-2, hsa-mir-190a, hsa-mir-1-1, hsa-mir-34b, hsa-mir-34c, aga-bantam, aga-mir-1, aga-mir-184, aga-mir-210, aga-mir-275, aga-mir-276, aga-mir-277, aga-mir-281, aga-mir-317, aga-mir-8, aga-mir-92a, aga-mir-92b, hsa-mir-92b, hsa-mir-33b, hsa-mir-190b, dme-mir-190, dme-mir-957, dme-mir-970, dme-mir-980, dme-mir-981, dme-mir-927, dme-mir-989, dme-mir-252, dme-mir-1000, aga-mir-1174, aga-mir-1175, aga-mir-34, aga-mir-989, aga-mir-11, aga-mir-981, aga-mir-1889, aga-mir-1890, aga-mir-1891, aga-mir-190, aga-mir-927, aga-mir-970, aga-mir-957, aga-mir-1000, aga-mir-309, cqu-mir-1174, cqu-mir-281-1, cqu-mir-1, cqu-mir-275, cqu-mir-957, cqu-mir-277, cqu-mir-252-1, cqu-mir-970, cqu-mir-317-1, cqu-mir-981, cqu-mir-989, cqu-mir-1175, cqu-mir-276-1, cqu-mir-276-2, cqu-mir-276-3, cqu-mir-210, cqu-mir-92, cqu-mir-190-2, cqu-mir-190-1, cqu-mir-1000, cqu-mir-11, cqu-mir-8, cqu-bantam, cqu-mir-1891, cqu-mir-184, cqu-mir-1890, cqu-mir-980, cqu-mir-33, cqu-mir-2951, cqu-mir-2941-1, cqu-mir-2941-2, cqu-mir-2952, cqu-mir-1889, cqu-mir-309, cqu-mir-252-2, cqu-mir-281-2, cqu-mir-317-2, aga-mir-2944a-1, aga-mir-2944a-2, aga-mir-2944b, aga-mir-2945, aga-mir-33, aga-mir-980
The most highly expressed miRNA in both mosquito species was miR-184, a miRNA conserved from insects to vertebrates. [score:3]
miR-184 was the most highly expressed miRNA in both species, represented by 1,487,481 reads in the Ae. [score:3]
albopictus C710 cells, these two species shared five out of the top ten most frequently occurring miRNAs: miR-184, miR-317, miR-277, miR-275, and miR-8 (Tables 1, 2). [score:1]
To date, miR-184 has been identified in over 39 organisms, but has no defined role in insects. [score:1]
In fact, miR-184 dominated the Ae. [score:1]
Five miRNAs, miR-184, miR-275, miR-277, miR-276, and miR-92, were sequenced >500 times and were readily detectable in total RNA isolated from C7/10 cells (Figure 3A). [score:1]
[1 to 20 of 6 sentences]
38
[+] score: 10
The analysis revealed ezrin, a protein required for the formation of microvilli and membrane ruffles in epithelial cells, as the protein with the highest increase in expression following miR184 inhibition. [score:5]
Quantitative proteomics with iTRAQ labeling, multi-dimensional chromatography and tandem mass spectrometry was used to identify proteins regulated by miR184 in RPE cells transfected with a miR184 inhibitor. [score:4]
Murad et al. studied the role of miR184 in human RPE cells and its relevance to AMD [54]. [score:1]
[1 to 20 of 3 sentences]
39
[+] score: 10
[175] Silencing of miR-184 during insulin resistance promotes expression of Argonaute2, which in turn, facilitates the function of miR-375 to decrease the expression of growth suppressors and promote compensatory β-cell proliferation to meet metabolic demands. [score:7]
[174] Another example is miR-184, which targets Argonaute2, a component of the miRNA -induced silencing complex, to prevent murine β-cell expansion. [score:3]
[1 to 20 of 2 sentences]
40
[+] score: 9
On the TS miRNA side, downregulation of miR-184 has been found to promote human malignant glioma by regulating its target SND1, a multifunctional nuclease that is overexpressed in multiple cancers [34]. [score:9]
[1 to 20 of 1 sentences]
41
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
LRRK2 is downregulated by miR-205, and pathogenic mutations in the LRRK2 disrupts the critical signaling mechanism of let-7 and miRNA-184, which causes the deregulation of transcription factor E2F1/DP and cell survival is hampered (Gehrke et al., 2010; Cho et al., 2014). [score:6]
Several studies demonstrated that miRNA-148a, miRNA-17-5p, miRNA-137, miRNA-181c, miRNA-101, miRNA-184, miRNA-15a, miRNA-185, and miRNA-210 are few of those miRNAs that are expressed in AD (Lukiw, 2007; Cogswell et al., 2008; Hébert et al., 2008; Geekiyanage and Chan, 2011; Wang et al., 2011). [score:3]
[1 to 20 of 2 sentences]
42
[+] score: 9
In order to confirm the small RNA sequencing results, and to determine the expression patterns of these miRNAs in different developmental stages, we chose three conserved miRNAs: miR-184, −989 and miR-1000 represented in our sequencing data for further northern blot analysis. [score:4]
The expression patterns of four conserved miRNAs are shown in Figure  3. The patterns of miR-184, −2943 and miR-1000 are similar to the patterns found in Ae. [score:3]
Probe sequences were as follow, aan-miR-184: CCCTTATCAGTTCTCCGTCCA; aan-miR-989: GTACCACTACGTCACATCACA; aan-miR-998: GAGCTGAATCTCATG GTGCTA; aan-miR-2943: TTTGCCTGCAAGTGCCTACTTAA; aan-miR-1000: ACTG CTGTGTCAGGCAATAT. [score:1]
miR-184 and miR-1000 are present in An. [score:1]
[1 to 20 of 4 sentences]
43
[+] score: 9
Besides demonstrating that lipid phosphatase SH2-domain-containing inositol 5-phosphatase 2 (SHIP2) is a target of miR-205 in epithelial cells, they observed that the corneal epithelial-specific miR-184 interferes with miR-205 to suppress SHIP2 levels [71] (Figure 1c (ii)). [score:5]
Since aggressive squamous cell carcinoma (SCC) cells exhibited elevated levels of miR-205, they speculated that blockage of miR-205 activity with an antagonist or via ectopic expression of miR-184 could establish a therapeutic approach for treating aggressive SCCs. [score:3]
Yu J. Ryan D. G. Getsios S. Oliveira-Fernandes M. Fatima A. Lavker R. M. MicroRNA-184 antagonizes microRNA-205 to maintain SHIP2 levels in epithelia Proc. [score:1]
[1 to 20 of 3 sentences]
44
[+] score: 9
To validate the accuracy of our heatmap results, we performed qPCR to confirm the expression levels of the top up-regulated miRNAs (such as miR365a-3p, miR-2277-3p, and miR-184-3p) and down-regulated miRNAs (such as miR-21-5p, miR-136-3p, and miR-127-3p) (Fig.   1g). [score:9]
[1 to 20 of 1 sentences]
45
[+] score: 8
Ectopic expression of miR-184 restrains SOX7 protein, resulting in upregulation of c-Myc and Cyclin D1 expression and the phosphorylation of Rb to promote cell proliferation, tumorigenicity, and cell cycle progression [18]. [score:8]
[1 to 20 of 1 sentences]
46
[+] score: 8
SNP ID small RNA ID Type Chr P-value eQTL P-value GWAS GWAS phenotype rs8033963 hsa-miR-184 mature-miRNA 15 1.98E-06 1.01E-02 BMI rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 4.93E-02 BMI rs2440129 hsa-miR-195-3p mature-miRNA 17 2.44E-05 3.58E-02 BMI rs2053005 SNORD18A snoRNA 15 6.83E-09 4.57E-02 BMI rs16868443 hsa-miR-653 mature-miRNA 7 1.38E-04 3.70E-02 WHR(adjBMI) rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 7.89E-04 LDL rs2986039 hsa-miR-1307-3p mature-miRNA 10 6.31E-06 1.84E-02 HDL rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 1.14E-03 TCWhile on the whole, none of the cis-SNPs were genome-wide significant in the GWAS data, they were significantly enriched for nominally significant (p<0.05) SNPs in the BMI GWAS results ([65], binomial p = 0.007), indicating either their pleiotropic effect, or metabolic trait regulation through small RNA expression levels. [score:4]
SNP ID small RNA ID Type Chr P-value eQTL P-value GWAS GWAS phenotype rs8033963 hsa-miR-184 mature-miRNA 15 1.98E-06 1.01E-02 BMI rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 4.93E-02 BMI rs2440129 hsa-miR-195-3p mature-miRNA 17 2.44E-05 3.58E-02 BMI rs2053005 SNORD18A snoRNA 15 6.83E-09 4.57E-02 BMI rs16868443 hsa-miR-653 mature-miRNA 7 1.38E-04 3.70E-02 WHR(adjBMI) rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 7.89E-04 LDL rs2986039 hsa-miR-1307-3p mature-miRNA 10 6.31E-06 1.84E-02 HDL rs6658641 hsa-miR-197-3p mature-miRNA 1 1.57E-04 1.14E-03 TC While on the whole, none of the cis-SNPs were genome-wide significant in the GWAS data, they were significantly enriched for nominally significant (p<0.05) SNPs in the BMI GWAS results ([65], binomial p = 0.007), indicating either their pleiotropic effect, or metabolic trait regulation through small RNA expression levels. [score:4]
[1 to 20 of 2 sentences]
47
[+] score: 8
Wong et al. showed that miR-184 was overexpressed in tongue squamous cell carcinoma (TSCC), and the reduction of miR-184 inhibited cell proliferation and induced apoptosis through c-Myc downregulation [14]. [score:8]
[1 to 20 of 1 sentences]
48
[+] score: 8
Lechner J Mutational analysis of MIR184 in sporadic keratoconus and myopiaInvest. [score:2]
Hughes AE Mutation altering the miR-184 seed region causes familial keratoconus with cataractAm. [score:2]
Only a small number of gene mutations were confirmed to be pathogenic, such as VSX1, TGFBI, and mir184 7, 12– 14. [score:2]
Exome sequencing detects a nonsense variant in TUBA3DTo reveal the underlying genetic defect in this family, we initially screened three reported candidate genes (VSX1, TGFBI, and mir184) using Sanger sequencing. [score:1]
To reveal the underlying genetic defect in this family, we initially screened three reported candidate genes (VSX1, TGFBI, and mir184) using Sanger sequencing. [score:1]
[1 to 20 of 5 sentences]
49
[+] score: 8
Other miRNAs from this paper: mmu-mir-184
Interestingly, a recent study has shown that MYCN contributes to tumorigenesis, in part, by repressing miR-184, and increasing AKT2 expression, a direct target of miR-184 [22], and thereby indicating that AKT2 is a downstream target of N-myc. [score:8]
[1 to 20 of 1 sentences]
50
[+] score: 8
Other miRNAs from this paper: hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137
miR-184 functions as a direct target of Mbd1 to inhibit neuronal differentiation from adult neural stem cells in the SGZ [204] by post-transcriptional repression of Numb-like, a regulator of neuronal differentiation during development. [score:8]
[1 to 20 of 1 sentences]
51
[+] score: 8
In an ischemia -induced mo del of retinal neovascularization, seven miRNAs (miR-106a, miR-146, miR-181, miR-199a, miR-214, miR-424, and miR-451) were upregulated, and three miRNAs (miR-31, miR-150, and miR-184) were downregulated. [score:7]
Interestingly, intraocular injection of pre-miR-31, pre-miR-150, or pre-miR-184 reduced ischemia induced retinal or laser induced CNV [54]. [score:1]
[1 to 20 of 2 sentences]
52
[+] score: 7
The up-regulated miRNAs include let-7a and miR-99a and the down-regulated include miR-196a, miR-470, miR-21*, miR-208a, miR-683, miR-184, miR-693-3p, miR-202-3p, miR-429, miR-878-3p and miR-327. [score:7]
[1 to 20 of 1 sentences]
53
[+] score: 7
Although our analysis does not extend to include fully functioning islets, we did detect increased expression of miR-127-3p and miR-495 at day 8 and day 11. miR-184 was also detected at high levels at day 11 relative to the day 1– day 8 samples, but we also observed high expression in the starting hESC population, suggesting that although it may have a role in development it is not islet-specific. [score:6]
A recent study by Bolmeson et al., of miRNA enriched in pancreatic islet samples versus liver and skeletal muscle identified miR-127-3p, miR-184, miR-195 and miR-495 [28]. [score:1]
[1 to 20 of 2 sentences]
54
[+] score: 7
In 2014, Murad et al. [52] reported that miR-184 was significantly downregulated in primary RPE cells isolated from AMD donors, and its downregulation resulted in impaired autophagy and dysfunction of the RPE. [score:7]
[1 to 20 of 1 sentences]
55
[+] score: 7
miR-31, miR-150 and miR-184 have shown to be downregulated in oxygen -induced retinopathy mice mo dels [20]; miR-23~24~27 cluster was upregulated in laser induced CNV mice mo dels [21]. [score:7]
[1 to 20 of 1 sentences]
56
[+] score: 7
Schaefer et al. [8] validated that ten microRNAs (hsa-miR-16, hsa-miR-31, hsa-miR-125b, hsa-miR-145, hsa-miR-149, hsa-miR-181b, hsa-miR-184, hsa-miR-205, hsa-miR-221, hsa-miR-222) were downregulated and five miRNAs (hsa-miR-96, hsa-miR-182, hsa-miR-182, hsa-miR-183, hsa-375) were upregulated in prostate cancer. [score:7]
[1 to 20 of 1 sentences]
57
[+] score: 7
The top 5 upregulated miRNAs were miR-431-5p, miR-3169, miR-371a-3p, miR-1537 and miR-593-3p, and the top 5 downregulated miRNAs were miR-30a-5p, miR-193a-3p, miR-204-5p, miR-184 and miR-29b-3p (Figure 1B). [score:7]
[1 to 20 of 1 sentences]
58
[+] score: 7
In cSCC most of the altered miRNAs are downregulated (miR-125b, miR-34a, miR-214, miR-124, miR-361, miR-193b, miR-365a, miR-20a, miR-199a) [19– 25] whereas only a small number of miRNAs have been found to be upregulated and act as onco-miRNAs, being involved in angiogenesis, colony formation, migration and invasion, and metastatic spread (miR-365, miR-9, miR-184, miR-21, miR-31, miR-135b, miR-205, let-7a) [25– 34]. [score:7]
[1 to 20 of 1 sentences]
59
[+] score: 6
Our data adds support for an islet-enriched expression pattern of six miRNAs previously highlighted by microarray studies (miR-184, miR-183-5p, miR-7-5p, miR-127-3p, miR-375, and miR-493-5p) [17], [20]. [score:3]
For miR-184, miR-182-5p and miR-127-3p, there is published evidence for a role in insulin biosynthesis and secretion, though for miR-184 and miR-127-3p this is restricted to a correlation between islet expression levels and glucose-stimulated insulin secretion [17], [18]. [score:3]
[1 to 20 of 2 sentences]
60
[+] score: 6
Other miRNAs from this paper: dme-mir-2a-1, dme-mir-2a-2, dme-mir-14, mmu-mir-184, dme-mir-184
Experiments using miR-14 and miR-184 gave similar results (Additional file 5, Figure S5). [score:1]
Mutating miRNA nt 2 in miR-2a and miR-184 influenced the order of preference for nt 1 in flies (Figures 4B and 4C). [score:1]
Hence additional features in the miRNA/miRNA* duplex must influence the order of preference for miRNA nt 1. Mutating the overhanging nucleotide in miR-184* did not alter the efficiency of loading miR-184 (Additional file 7, Figure S7), excluding a role for base pairing between nt 1 and the 3′ overhang of the miRNA*. [score:1]
Strikingly, the order of preference for nt 1 was not the same across the three tested miRNA: miR-2a preferred U > A > C (Figure 3), miR-14 preferred U ~ C > A and miR-184 preferred U ~ A > C (Additional file 6, Figure S6). [score:1]
Changing the 5′-nt of miR-2a (C) or miR-184 (D) into 5′-guanidine (5′-G) decreases miRNA loading (relatively to a 5′-A). [score:1]
The Ago2 loading machinery has a moderate effect on miR-184 loading preferences, while it strongly affects miR-184* loading preferences. [score:1]
[1 to 20 of 6 sentences]
61
[+] score: 6
Other miRNAs from this paper: hsa-mir-17, hsa-mir-221
Emdad L. Janjic A. Alzubi M. A. Hu B. Santhekadur P. K. Menezes M. E. Shen X. N. Das S. K. Sarkar D. Fisher P. B. Suppression of miR-184 in malignant gliomas upregulates SND1 and promotes tumor aggressiveness Neuro Oncol. [score:6]
[1 to 20 of 1 sentences]
62
[+] score: 6
The direction of miR-184 and miR-127-3p expression did not correlate between CSF and SER data. [score:4]
The overlap of CSF and SER expressed miRNAs for AD compared to neurologically normal control subject analysis consists of two miRNAs, miR-184 and miR-127-3p. [score:2]
[1 to 20 of 2 sentences]
63
[+] score: 6
High levels of expression across all tissues were detected only for miR-8, whereas nine miRNAs (miR-1, miR-2, let-7, miR-34, miR-125, miR-184, miR-277, miR-306, and miR-957) had moderate to high levels of expression in at least two tissues (Figure 2). [score:5]
Previous RNA sequencing studies of whole mosquitoes identified miR-10, miR-184, miR-263, miR-281, and miR-306 as the most abundant miRNAs in adult females (Biryukova et al. 2014; Castellano et al. 2015). [score:1]
[1 to 20 of 2 sentences]
64
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7e, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-192, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-214, hsa-mir-215, hsa-mir-222, hsa-mir-223, hsa-mir-1-2, hsa-mir-15b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-149, hsa-mir-186, hsa-mir-200c, hsa-mir-1-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-339, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-624, hsa-mir-650, hsa-mir-651, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-449b, hsa-mir-1185-2, hsa-mir-1283-1, hsa-mir-1185-1, hsa-mir-708, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1283-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
In addition the FOXO1, BAD, CDKN1A, CDKN1B genes, which encode proteins repressed by AKT were found down-regulated, as well as the AKT inhibitors miR-125b, miR-149, miR-184, miR-708, PPP2CA, PPP2R1A, PPP2R1B and PPP2R5E (S3 Fig). [score:6]
[1 to 20 of 1 sentences]
65
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Several miRNAs, such as miR-96, miR-124a, miR-181a, miR-181b, miR-182, miR-183, miR-184, and miR-204 are expressed in eye of zebrafish embryo (Cavodeassi et al. 2005). [score:3]
Soares et al. (2009) let-7b, miR-9, miR-30a, miR-92b,miR-96 miR-124, miR-181a,b, miR-182, miR-183, miR-184, and mir-204 Zebrafish ISH ? [score:1]
Ason et al. (2006) miR-7, miR-9, miR-34b, miR-96, miR-124a, miR-125b, miR-132, miR-181b, miR-182, miR-183, miR-184, and miR-204, miR-215, miR-216, miR-217 Zebrafish Microarray, ISH ? [score:1]
miR-30a, miR-184, and mir-204 were localized in lens. [score:1]
[1 to 20 of 4 sentences]
66
[+] score: 6
For example, NFATc2 in CD4 T cells was shown to be regulated by miR-184 and miR-568 was shown to inhibit the activation of T cells by targeting NFAT5 [15, 16]. [score:6]
[1 to 20 of 1 sentences]
67
[+] score: 5
Although no studies have investigated regulation of miR-184 activity, analysis of the promoter region upstream of miR-184 using rVISTA (Loots and Ovcharenko, 2004) reveals putative E2F and MYC-MAX binding sites (Supplementary Fig. 2a), so it is tempting to speculate that either E2F, or E2F -mediated induction of c-MYC expression, could result in increased miR-184 levels, which in turns represses miR-205 expression. [score:4]
A possible candidate for this repression is another miRNA, miR-184, which has been shown to antagonize miR-205 in corneal epithelial keratinocytes (Yu et al., 2008). [score:1]
[1 to 20 of 2 sentences]
68
[+] score: 5
Other microRNAs with a different expression pattern in wild-type versus mutant flies were miR-133, miR-124, miR-184, miR-210, miR-276b, and miR-31a, microRNAs that could target clock genes such as Clk, Per, Dbt, Tws, and Slo as predicted by in silico analyses [120]. [score:5]
[1 to 20 of 1 sentences]
69
[+] score: 5
Other oral tissue-enriched miRNAs that we identified included miR-24, which has been reported as up-regulated in oral squamous cell carcinoma [26], and miR-184, which was shown to be associated with anti-apoptotic and proliferative processes in tongue carcinoma [27]. [score:4]
Wong TS Mature miR-184 as potential oncogenic microRNA of squamous cell carcinoma of tongueClin. [score:1]
[1 to 20 of 2 sentences]
70
[+] score: 5
Phylogenetic analysis, target gene prediction and pathway analysis showed that, among the 13 conserved miRNAs (miR-1, miR-100, miR-10a, miR-124, miR-125, miR-184, miR-33, miR-34, miR-7, miR-9, miR-92a, miR-92b and miR-let7), several highly conserved miRNAs (miR-1, miR-7 and miR-34) targeted the same or similar genes leading to the same pathways in shrimp, fruit fly and human (Figure 3b). [score:5]
[1 to 20 of 1 sentences]
71
[+] score: 5
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2, hsa-mir-542
In addition, microRNAs such as microRNA-542-3p, microRNA-184, and microRNA-199a-5p could target FZD7 and suppress cell proliferation [24– 26]. [score:5]
[1 to 20 of 1 sentences]
72
[+] score: 4
A comparison of the inhibitory effects of miRNAs on these cell lines and A375 is given in figure 4. miRNAs yielded very similar effects in all cell lines, with a notable exception for miR-184 and miR-203 in SK-MEL-28. [score:3]
We chose the top scoring miRNA constructs from the second-round, confirmation screen: mir-497, mir-96, mir-141, and mir-184 (figure 1d). [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 4
For example, miR-204 is primarily expressed in insulinomas and co-localizes mainly with insulin [43]; miR-127-3p and miR-184 are positively correlated with insulin biosynthesis and negatively correlated with glucose-stimulated insulin secretion (GSIS) [44]; miR-148 controls the insulin content in β-cells through regulation of the insulin repressor SOX6 [45] and miR-29 contributes to pancreatic β-cell dysfunction in prediabetic NOD Mice [46], and affects the release of insulin from β-cells by silencing of monocarboxylate transporter (MCT1) [47]. [score:4]
[1 to 20 of 1 sentences]
74
[+] score: 4
In our previous study [17], we found that miR-204-5p, miR-30a-5p, miR-204-3p, and miR-184 were significantly downregulated in PCO samples. [score:4]
[1 to 20 of 1 sentences]
75
[+] score: 4
miR-184 whose expression was restricted to the germ cells from spermatogonia to round spermatids is involved in the post-transcriptional regulation of mRNAs of nuclear co-repressor 2 (ncor2) in mammalian spermatogenesis [15]. [score:4]
[1 to 20 of 1 sentences]
76
[+] score: 4
The same group had previously discovered a pro-apoptotic effect of miR-184 both in vitro and in vivo, through the direct targeting of AKT2, a serine/threonine kinase active downstream of the PI3K pathway. [score:4]
[1 to 20 of 1 sentences]
77
[+] score: 4
Of these deregulated miRNAs, hsa-miR-21, hsa-miR-20a, hsa-miR-184, hsa-miR-26a, hsa-miR-125b, hsa-miR-29a, hsa-miR-29c and so on share the similar expression patterns with our results. [score:4]
[1 to 20 of 1 sentences]
78
[+] score: 4
controls as well as miR-155-5p, miR-184 and miR-708-5p in IgA-GN vs. [score:1]
Four miRNAs (miR-132-3p, miR-146-5p, miR-184, miR-708-5p) demonstrated high persistence throughout different normalization methods (at least 3 out of 5 normalization methods with similar significant results). [score:1]
IgA-GN, whereas miR-132-3p and miR-184 demonstrated highest persistency throughout different normalization methods. [score:1]
Four miRNAs (miR-132-3p, miR-146-5p, miR-184, miR-708-5p) demonstrated high consistency throughout different normalization methods. [score:1]
[1 to 20 of 4 sentences]
79
[+] score: 4
Our miRNA profile (84) Chromosomal localization Fold change Reference DOWNREGULATED hsa-miR-206 6p12.2 −7.53(29) hsa-miR-219-2-3p 9q33.3 −6.64(52) hsa-miR-383 8p22 −6.56(12, 55, 56) hsa-miR-138 16q13.3/3p21.32 −5.16(12, 14) hsa-miR-323-3p 14q32.2 −4.96(12, 52) hsa-miR-122 18q21.31 −4.82 hsa-miR-105 Xq28 −4.66 hsa-miR-129-5p 11p11.2/7q32.1 −4.56(23) hsa-miR-935 19q13.43 −4.53(52) hsa-miR-329 14q32.2 −4.48 hsa-miR-129-3p 11p11.2/7q32.1 −4.43 hsa-miR-650 22q11.21 −4.19 hsa-miR-184 15q24.3 −4.14 hsa-miR-370 14q32.2 −3.99(12) hsa-miR-433 14q32.2 −3.96(29) hsa-miR-138-2* 16q13. [score:4]
[1 to 20 of 1 sentences]
80
[+] score: 4
Yang et al. [81] used immunohistochemical methods to study breast tumor subtypes and found that there is expression differences on hsa-miR-365, hsa-miR-1238 and hsa-miR-184. [score:3]
The only one unverified by database was the 46th ranked hsa-mir-184. [score:1]
[1 to 20 of 2 sentences]
81
[+] score: 4
In contrast, 11 miRNAs (miR-9-5p, miR-184, miR-328-3p, miR-363-3p, miR-372-3p, miR-518d-3p, miR-518f-3p miR-523-3p, miR-618, miR-625-5p, and miR-628-5p) were significantly up-regulated in human oocytes (with respect to FF) (Figure 3B and Supplementary Table S1). [score:4]
[1 to 20 of 1 sentences]
82
[+] score: 4
Other miRNAs from this paper: hsa-mir-26b, hsa-mir-128-1, hsa-mir-128-2
Furthermore, N-Myc has been reported to regulate a microRNA, miR-184, that in turn targets the 3′UTR of AKT2 mRNA (155), suggesting that N-myc and PI3K/Akt signaling may form a positive feedback loop. [score:4]
[1 to 20 of 1 sentences]
83
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-25, hsa-mir-33a, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-141, mmu-mir-155, mmu-mir-10b, mmu-mir-129-1, mmu-mir-181a-2, mmu-mir-183, mmu-mir-184, hsa-mir-192, mmu-mir-200b, hsa-mir-129-1, mmu-mir-122, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-183, hsa-mir-210, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-217, hsa-mir-223, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-129-2, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-96, mmu-mir-34a, mmu-mir-129-2, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-10a, mmu-mir-25, mmu-mir-210, mmu-mir-181a-1, mmu-mir-216a, mmu-mir-223, mmu-mir-33, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, mmu-mir-217, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-375, mmu-mir-375, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-33b, mmu-mir-216b, hsa-mir-216b, mmu-mir-1b, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-129b, mmu-mir-216c, bbe-let-7a-1, bbe-let-7a-2, bbe-mir-10a, bbe-mir-10b, bbe-mir-10c, bbe-mir-125a, bbe-mir-125b, bbe-mir-129a, bbe-mir-129b, bbe-mir-133, bbe-mir-1, bbe-mir-183, bbe-mir-184, bbe-mir-200a, bbe-mir-200b, bbe-mir-210, bbe-mir-216, bbe-mir-217, bbe-mir-22, bbe-mir-252a, bbe-mir-252b, bbe-mir-278, bbe-mir-281, bbe-mir-33-1, bbe-mir-33-2, bbe-mir-34a, bbe-mir-34b, bbe-mir-34c, bbe-mir-34d, bbe-mir-34f, bbe-mir-375, bbe-mir-7, bbe-mir-71, bbe-mir-9, bbe-mir-96, bbe-mir-34g, bbe-mir-34h, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
For instance, miR-183, miR-184 and miR-96 dominate the population of expressed miRNAs in sensory organs in vertebrates [33], and these were also detected in amphioxus. [score:3]
However, by tracing the phylogenetic histories of miRNAs in Oikopleura dioica, Ciona intestinalis, and B. belcheri (Gray), we found that several phylogenetically conserved miRNAs were either lost or no longer recognizable in Oikopleura dioica (for example, miR-33, miR-34, miR-125, miR-133, miR-184, and miR-210), and we did not detect any miRNAs present in both chordates and vertebrates. [score:1]
[1 to 20 of 2 sentences]
84
[+] score: 3
They also included miR-184, whose mutation causes EDICT syndrome, which entails corneal endothelial dystrophy, iris hypoplasia, congenital cataract, and stromal thinning (Iliff et al., 2012) (Table 1 and Fig. S2c). [score:2]
217526672,+ ITGBL1 Integrin subunit beta like 1 p3@ITGBL1 LMX1B LIM homeobox transcription factor 1 beta p2@LMX1B MIR184 MicroRNA 184 p1@MIR184 MSMP Microseminoprotein, prostate associated p1@MSMP, p3@MSMP PITX2 Paired like homeodomain 2 p1@PITX2, p2@PITX2, p3@PITX2, p8@PITX2 POU6F2 POU class 6 homeobox 2 p3@POU6F2, p@chr7:39018373.. [score:1]
[1 to 20 of 2 sentences]
85
[+] score: 3
Especially for the placenta, except miR-136, miR-184 and miR-381, 40 out of 43 (93.02%) placenta-specific miRNAs were clustered miRNAs, suggesting that these clustered miRNAs have similar expression patterns and play related or particular functions in this tissue. [score:3]
[1 to 20 of 1 sentences]
86
[+] score: 3
Six of these miRNAs, i. e., miR-184, miR-371-5p, miR-412, miR-219-5p, pred-MIR145 and pred-MIR207 were expressed only during the RA time-course (Fig. 5B). [score:3]
[1 to 20 of 1 sentences]
87
[+] score: 3
A great variability in the number of target genes per miRNA was observed, ranging from six for gga-miR-184-3p to 276 for hsa-let-7a-3p. [score:3]
[1 to 20 of 1 sentences]
88
[+] score: 3
The miRnomes of echinococcus species showed expression of conserved miR profiles mir-36, mir-67, mir-92, mir-184, mir-281, miR-307, mir-1992, and miR-3479 which were previously thought to be lost in Echinococcus (Fromm et al., 2013; Jin et al., 2013; Cucher et al., 2015; Macchiaroli et al., 2015; Kamenetzky et al., 2016). [score:3]
[1 to 20 of 1 sentences]
89
[+] score: 3
Indirect regulatory effects on PD -associated proteins have also been reported for miR-133b, miR-433, miR-184* and let-7 [11, 12, 13]. [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 3
We confirmed the expression changes (> 2-fold) of mir-184 and mir-1250 in brain and of mir-1281, mir-551b, mir-3185, mir-3162-5p and mir-1228 in heart in mechanical asphyxia cases (Figure 2A and 2C). [score:3]
[1 to 20 of 1 sentences]
91
[+] score: 3
Other miRNAs from this paper: hsa-mir-148a, hsa-mir-152, hsa-mir-148b, hsa-mir-675
e and f HA-VSMCs were transfected with pcDNA3.1 empty vetor, pcDNA-H19 overexpression plasmid, si-con, si-H19#1 or si-H19#2, followed by the detection of H19 e and miR-184 f levels at 48 h after transfection. [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
In our previous study on unfractionated plasma samples, we have found significant overexpression of 5 circulating miRNAs (hsa-miR-483-5p, hsa-miR-100, hsa-miR-181b, hsa-miR-184, hsa-miR-210) in ACC relative to ACA [10]. [score:3]
[1 to 20 of 1 sentences]
93
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Similarly, Jin et al. (2014a) demonstrated a differential expression of nine miRNAs (bta-miR-184, miR-24-3p, miR-148, miR-486, and let-7a-5p, miR-2339, miR-499, miR-23a, and miR-99b) upon challenge of MACT-cells (bovine mammary epithelia cell line) with heat inactivated E. coli and S. aureus bacteria. [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
Interestingly, 5 of these (miR-184, miR-210, miR-31, miR-335, and miR-92) were deemed to be “retina specific” in expression, according to the tissue survey conducted by Xu et al. [37]. [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 3
Other miRNAs from this paper: hsa-mir-21, hsa-mir-138-2, hsa-mir-138-1, hsa-mir-195
In TSCC, miR-184 is overexpressed and acts as an “oncogene” [9], miR-138 plays an important role in cell migration and invasion [10] and miR-21 indicates poor prognosis in TSCC patients [11]. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
We also performed analogous experiments in Drosophila S2R+ cells with two predicted targets of miR-184 (PCK and CG13088), and revealed that both of these MREs are functional in this cell type (Supplementary Fig. 1). [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
yes white college students[67] colorectal cancer miR-337, miR-582, miR-200a-5p, miR-184, miR-212 CD86 rs17281995 G>C (for miR-337, miR-582, and miR-200a-5p, C impairs binding efficiency; for miR-184 and miR-212, C increases binding efficiency) in silico: miRNA target prediction program. [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
As demonstrated in Fig. 6A, rno-miR-184, rno-miR-484 and rno-miR-138-1-3p were the most significantly dysregulated miRNAs in GHS rats, and the results were comparable with our microarray data. [score:2]
control rats (Table 1 and Table S2); of these rno-miR-184, rno-miR-21-3p and rno-miR-672-5p had the largest positive fold changes, while rno-miR-484, rno-miR-138-1-3p and rno-miR-201-3p had the largest negative fold changes. [score:1]
[1 to 20 of 2 sentences]
99
[+] score: 3
In this sense, they are important post-transcriptional gene regulators and play an important role in response to cellular stress [37] as well as pathogenesis of cancer development and progression [38] with miR-17 and miR-184 being promising candidates for tumor progression [39]. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
In a subsequent study, the expression of 380 miRNAs using TaqMan low density arrays was evaluated in the plasma of patients with primary osteoarthritis and controls and 12 miRNAs (hsa-miR-16, hsa-miR-20b, hsa-miR-29c, hsa-miR-30b, hsa-miR-93, hsa-miR-126, hsa-miR-146a, hsa-miR-184, hsa-miR-186, hsa-miR-195, hsa-miR-345, and hsa-miR-885) were identified being over-expressed in OA patients [28]. [score:3]
[1 to 20 of 1 sentences]