sort by

143 publications mentioning hsa-mir-194-1 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-194-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 404
The above results showed that over -expression of miR-194-5p or miR-122 negatively regulated the expression of SOX3, which affects the transcription and expression of the target gene TDGF-1 and then inhibits the biological behavior of GSCs. [score:12]
Down-regulation of the expression of miR-194-5p or miR-122 reversed the inhibitory effects of SOX2OT knockdown on SOX3 expression, which indicated that SOX2OT acts as a miR-194-5p or miR-122 sponge, and thus influences the biological behaviors of GSCs. [score:11]
As shown in Fig.   8a and b, SOX2OT inhibition, miR-194-5p over -expression, miR-122 over -expression and SOX2OT inhibition combined with over -expression of both miR-194-5p and miR-122 produced smaller tumors compared with the control group. [score:10]
We confirmed that TDGF-1 is a downstream target of SOX3, as shown in Fig. 4. To further detect whether miR-194-5p and miR-122 reduced TDGF-1 expression by down -regulating SOX3 expression, we detected TDGF-1 protein expression via western blotting. [score:10]
Decreasing the expression of SOX2OT or increasing the expression of miR-194-5p or miR-122 inhibited SOX3 expression. [score:9]
Moreover, silencing SOX2OT increased the expression of miR-194-5p and miR-122, and knockdown of SOX2OT inhibited the proliferation, migration and invasion of GSCs, and promoted apoptosis by up -regulating the expression of miR-194-5p and miR-122. [score:9]
Finally, the in vivo study demonstrated that SOX2OT knockdown, miR-194-5p over -expression, miR-122 over -expression and the combination of the above significantly inhibited GSCs tumor volume and prolonged survival time. [score:8]
These results indicated that SOX2OT knockdown inhibited SOX3 expression by increasing miR-194-5p expression. [score:8]
The above results suggested that miR-194-5p and miR-122 reduced SOX3 expression by targeting its 3′-UTR and mediated the tumor-suppressive effect of SOX2OT knockdown. [score:8]
MiR-194-5p and miR-122 were down-regulated in human glioma tissues and GSCs, and miR-194-5p and miR-122 respectively exerted tumor-suppressive functions by inhibiting the proliferation, migration and invasion of GSCs, while promoting GSCs apoptosis. [score:8]
The results showed that the luciferase activities in the SOX2OT-Wt + Agomir-194-5p group were inhibited (Fig. 2c), suggesting that SOX2OT targeted miR-194-5p and regulated its expression. [score:8]
The expression level of miR-194-5p is markedly decreased in gallbladder cancer cells, and over -expression of miR-194-5p markedly promoted cells into S-phase and cell apoptosis, which suggested that miR-194-5p acts as a tumor suppressor gene in gallbladder carcinoma tissue [27]. [score:7]
Further, we explore whether SOX2OT can regulate the expression of SOX3 by regulating the expression of miR-194-5p and miR-122, and affect the biological behavior of GSCs. [score:7]
Further studies showed that over -expression of miR-194-5p or miR-122 decreased the expression of TDGF-1; inhibited the proliferation, migration and invasion and promote apoptosis of GSCs. [score:7]
Over -expression of miR-194-5p and miR-122 decreased the mRNA and protein expression of SOX3 by targeting its 3’UTR. [score:7]
Over -expression of miR-194-5p increased the expression of E-cadherin and inhibited the migration and invasion of colorectal cancer cells [51]. [score:7]
Our study revealed that SOX2OT can down-regulate the expression of SOX3 by regulating miR-194-5p and miR-122. [score:7]
These results suggested that over -expression of miR-194-5p and miR-122 can inhibit malignant biological behaviors of GSCs by directly down -regulating SOX3. [score:7]
The results indicated that the combination of SOX2OT knockdown, miR-194-5p over -expression and miR-122 over -expression has potential clinical value. [score:6]
Over -expression of miR-194-5p and miR-122 decreased the expression of SOX3 by directly binding to the 3′UTR of SOX3. [score:6]
TDGF-1 acted as an oncogene by activating the JAK/STAT signaling pathway, and miR-194-5p and miR-122 reduced TDGF-1 expression by down -regulating SOX3 expression in GSCs. [score:6]
Based on the above results, we confirmed that miR-194-5p and miR-122 mediate the tumor-suppressive effects of SOX2OT knockdown in GSCs, and knockdown of miR-194-5p or miR-122 respectively reversed the effects induced by SOX2OT knockdown in GSCs. [score:6]
Over -expression of miR-194-5p or miR-122 inhibited GSCs proliferation, migration and invasion, and promoted GSCs apoptosis; Knockdown of miR-194-5p or miR-122 produced the opposite effect. [score:6]
Knockdown of SOX2OT combined with over -expression of miR-194-5p and miR-122 suppressed tumor growth and induced the longest survival time in nude mice. [score:6]
Based on information obtained from a bioinformatic database (TargetScan), SOX3 might be a target of miR-194-5p. [score:5]
This study further confirmed that the expression of miR-194-5p and miR-122 was decreased in glioma tissues and GSCs, and the expression decreased as the pathological grade increased. [score:5]
In addition, over -expression of SOX3 reversed the inhibitory effects of miR-194-5p and miR-122 in GSCs. [score:5]
The sequence of SOX2OT was amplified by PCR and cloned into pmirGLO Dual-luciferase miRNA Target Expression Vectors along with its mutant sequence of mir-194-5p (or mir-122) binding sites (GenePharama, Shanghai, China). [score:5]
Knockdown of SOX2OT decreased SOX3 expression by up -regulating miR-194-5p and miR-122. [score:5]
These results revealed that miR-194-5p and miR-122 inhibited TDGF-1 expression by reducing SOX3. [score:5]
Additionally, SOX2OT inhibition combined with over -expression of both miR-194-5p and miR-122 resulted in the smallest tumor size among all the groups. [score:5]
Over -expression of miR-194-5p and miR-122 inhibited the proliferation, migration and invasion of GSCs and promoted GSCs apoptosis. [score:5]
The 3′-UTR sequence of SOX3 and its mutant sequence of mir-194-5p (or mir-122) binding sites were cloned into pmirGLO Dual-luciferase miRNA Target Expression Vectors (GenePharama, Shanghai, China). [score:5]
c Real-time PCR and (d) Weatern blot assay were used to detect the SOX3 expression after miR-194-5p over -expression or knockdown. [score:5]
Moreover, over -expression of SOX3 reversed the effect of over -expression of miR-194-5p or miR-122 in GSCs. [score:5]
Enhanced expression of miR-194-5p by exogenous miR-194-5p expression re-sensitized cells to differentiation and apoptosis [49]. [score:5]
Moreover, in this study, we found that over -expression of miR-194-5p or miR-122 inhibited proliferation, migration and invasion of GSCs, and promoted GSCs apoptosis. [score:5]
Compared with the SOX2OT knockdown group, miR-194-5p over -expression or miR-122 over -expression groups, the group with the three treatments combined exhibited the lowest tumor volume and the longest survival time in nude mice. [score:5]
Transfect pGCMV/EGFP/miR-194-5p plasmid and pGCMV/EGFP/miR-122 plasmid in sh-SOX2OT stable expressing cells to generate sh-SOX2OT + miR-194-5p + miR-122 stable expressing cell lines. [score:5]
e The apoptotic percentages of GSC-U87 and GSC-U251 cells were detected after miR-194-5p over -expression or inhibition. [score:5]
In contrast, miR-194-5p and miR-122 were downregulated in glioma tissues and cell lines. [score:4]
Fig. 5The SOX3 expression regulated by SOX2OT, miR-194-5p and miR-122. [score:4]
To determine whether SOX2OT -mediated regulation of miR-194-5p expression could affect the behaviors of GSCs, cells were divided into five groups: control, sh-NC + agomir-194-5p-NC, sh-SOX2OT + agomir-194-5p, sh-NC + antagomir-194-5p-NC and sh-SOX2OT + antagomir-194-5p groups. [score:4]
These results suggested that miR-194-5p and miR-122 suppressed the malignant behaviors of GSCs by down -regulating SOX3. [score:4]
The results confirmed our prediction that SOX3 is a direct target of miR-194-5p. [score:4]
b The expression of miR-194-5p after SOX2OT knockdown in GSC-U87 and GSC-U251 cells. [score:4]
Our results also showed that the mRNA and protein expression levels of SOX3 that should be reduced by SOX2OT knockdown were restored by antagomir-miR-194-5p (Fig. 5e, f). [score:4]
To determine whether the tumor-suppressive effects of SOX2OT knockdown were mediated by miR-194-5p or miR-122, the stable sh-SOX2OT cells were transfected with miR-194-5p or miR-122 agomir and antagomir. [score:4]
Knockdown of SOX2OT significantly increased the expression of miR-194-5p and miR-122 in GSCs. [score:4]
MiR-194-5p and miR-122 mediated the tumor-suppressive effects of SOX2OT knockdown on GSCs. [score:4]
In this paper, we studies the endogenous expression of SOX2OT, miR-194-5p, miR-122, SOX3 and TDGF-1 in GSCs, and their effects on the biological behavior of GSCs. [score:3]
The above studies demonstrated that miR-194-5p acts as tumor suppressor gene in gliomas, acute myeloid leukemia, hepatocellular carcinoma and colorectal cancer. [score:3]
SOX3 mediated the tumor-suppressive effects of miR-194-5p and miR-122 in GSCs. [score:3]
To uncover whether SOX3 could reverse the tumor-suppressive effects of miR-194-5p and miR-122 in GSCs, cells were cotransfected with miR-194-5p or miR-122 and SOX3, and cell proliferation, migration, invasion and apoptosis were assessed. [score:3]
MiR-194-5p and miR-122 exerted tumor-suppressive functions in GSC-GBM. [score:3]
After infection, the stable expressing cells of miR-194-5p and miR-122 were picked. [score:3]
Silencing SOX2OT increased the expression of miR-194-5p and miR-122. [score:3]
MiR-194-5p and miR-122 functioned as tumor suppressors in GSCs. [score:3]
Antagomir-122-NC group To investigate the miR-194-5p effect on GSCs, we next detected cell proliferation, migration, invasion and apoptosis of GSCs after miR-194-5p over -expression or inhibition. [score:3]
h Weatern blot assay were used to detect the TDGF-1 expression regulated by miR-194-5p and SOX3. [score:3]
Moreover, transfection with antagomir-miR-194-5p rescued the inhibitory effect of sh-SOX2OT on cell proliferation, migration and invasion, and rescued the increased apoptosis induced in the sh-SOX2OT group (Fig.   3a–c). [score:3]
Further, SOX2OT targeted miR-194-5p and miR-122 in a sequence-specific manner. [score:3]
SOX3 mediated tumor-suppressive effects of miR-194-5p and miR-122. [score:3]
Antagomir-122-NC group To investigate the miR-194-5p effect on GSCs, we next detected cell proliferation, migration, invasion and apoptosis of GSCs after miR-194-5p over -expression or inhibition. [score:3]
org), a dual-luciferase reporter assay demonstrated that miR-194-5p and miR-122 could directly targeting the SOX3 3′-UTR. [score:3]
The expression of miR-194-5p in human astrocytes (HA), glioblastoma cell lines (U87 and U251) and glioblastoma stem cells (GSC-U87, GSC-U251). [score:3]
The mRNA and protein expression of SOX3 after cells cotransfection of miR-194-5p or miR-122 with SOX3 were shown in 1: Figure S5. [score:3]
a The expression of miR-194-5p in normal brain tissues (NBTs) and glioma tissues of different grades. [score:3]
e Real-time PCR and (f) Weatern blot assay were used to detect the SOX3 expression regulated by SOX2OT and miR-194-5p. [score:3]
Fig. 6SOX3 mediated tumor-suppressive effects of miR-194-5p and miR-122. [score:3]
These results demonstrated that miR-194-5p and miR-122 exerted the tumor-suppressive role in GSCs. [score:3]
TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA) was used for the reverse transcription of miR-194-5p and miR-122, and the expression of miR-194-5p and miR-122 were detected with TaqMan Universal Master Mix II. [score:3]
These results suggested that miR-194-5p and miR-122 act as tumor suppressor in GSCs. [score:3]
The SOX2OT-miR-194-5p/miR-122-SOX3-TDGF-1 feedback loop plays an important role in regulating GSCs biological behaviors. [score:2]
As shown in Fig.   2a, miR-194-5p were significantly decreased in glioma tissues of different grades, compared with normal brain tissues (NBTs), and the expression was negatively correlated with tumor grade. [score:2]
This study demonstrated that the SOX2OT-miR-194-5p/miR-122-SOX3-TDGF-1 pathway forms a positive feedback loop, which plays an important role in regulating the biological behaviors of GSCs. [score:2]
This study is the first to demonstrate that the SOX2OT-miR-194-5p/miR-122-SOX3-TDGF-1 pathway forms a positive feedback loop and regulates the biological behaviors of GSCs, and these findings might provide a novel strategy for glioma treatment. [score:2]
The expression level of miR-194-5p was increased in the sh-SOX2OT group compared with the sh-NC group (Fig. 2b). [score:2]
Dell'Aversana C, Giorgio C, D'Amato L, Lania G, Matarese F, Saeed S, Di Costanzo A, Belsito Petrizzi V, Ingenito C, Martens JH, et al. miR-194-5p/BCLAF1 deregulation in AML tumorigenesis. [score:2]
However, the relationship between miR-194-5p and glioma is still unclear. [score:1]
An in vivo tumor mo del was used to further determine the functions of SOX2OT, miR-194-5p and miR-122. [score:1]
c The predicted miR-194-5p binding site in the SOX2OT sequence (SOX2OT-Wt) and the designed mutant sequence of miR-194-5p binding site (SOX2OT-Mut) are indicated. [score:1]
According to the bioinformatics database (Starbase v2.0), we proposed that SOX2OT might harbor miR-194-5p binding sites. [score:1]
As shown in Fig. 8c, the survival analysis indicated that mice in the sh-SOX2OT, miR-194-5p, miR-122 and sh-SOX2OT + miR-194-5p + miR-122 groups exhibited longer survival time than the control mice, and mice in the sh-SOX2OT + miR-194-5p + miR-122 group had the longest survival time. [score:1]
MiR-194-5p agomir, miR-194-5p antagomir, miR-122 agomir, miR-122 antagomir and their respective negative control were synthesized (GenePharama, Shanghai, China). [score:1]
The mice were divided into five groups: control, sh-SOX2OT, miR-194-5p, miR-122 and sh-SOX2OT + miR-194-5p + miR-122 groups. [score:1]
Recently, the role of miR-194-5p in tumors has attracted an increasing amount of attention. [score:1]
In addition, the expression of miR-194-5p in GBMs and GSCs was decreased compared with that in HA cells, and reduced in GSC-U87 and GSC-U251 cells compared with U87 and U251 cells, respectively. [score:1]
The effects of mir-194-5p and miR-122 in GSC-GBM were similar as it in GSC-U87 and GSC-U251 cells (Additional file 1: Figure S3). [score:1]
g The predicted miR-194-5p binding sites in the 3’UTR region of SOX3 (SOX3–3’UTR-Wt) and the designed mutant sequence (SOX3–3’UTR-Mut) are indicated. [score:1]
Scale bars represent 40 μm The expression levels of miR-194-5p in human glioma tissues, GBM cells and GSCs were measured by qRT-PCR. [score:1]
To determine whether SOX3 is involved in the miR-194-5p effect on the behaviors of GSCs, cells were divided into five groups: control, agomir-194-5p-NC + SOX3(+)NC, agomir-194-5p + SOX3(+)NC, agomir-194-5p-NC + SOX3(+) and agomir-194-5p + SOX3(+) groups. [score:1]
We found that SOX2OT might harbor a binding site for miR-194-5p and miR-122 using a bioinformatics database (DIANA-LncBase). [score:1]
SOX2OT miR-194-5p miR-122 SOX3 TDGF-1 Glioma Glioma is the most common primary malignant tumor of the brain, and the median survival time is less than 12 months [1, 2]. [score:1]
The pGCMV/EGFP/miR-194-5p plasmid and pGCMV/EGFP/miR-122 plasmid were transfected into cells respectively. [score:1]
MiR-194-5p is decreased in side population cells in human primary hepatocellular carcinoma, and regulated the proliferation, clone formation, anti-apoptosis, self-renewal and invasion abilities of side population cells [50]. [score:1]
[1 to 20 of 96 sentences]
2
[+] score: 331
Treatment with trastuzumab can activate miR-194 expression, downregulate cytoskeletal protein talin2 expression and inhibit cell migration/invasion in HER2 -overexpressing breast cancer cells. [score:12]
miR-194 was upregulated and downregulated talin2, inhibited cell migration and invasion, which may contribute to the anti-tumor activity of trastuzumab on HER2 -overexpressing breast cancer cells. [score:11]
Increased expression of miR-194 significantly inhibits migration and invasion of breast cancer cells that overexpress HER2. [score:7]
miR-194 directly targets the talin2 gene and downregulates talin2 protein. [score:7]
Trastuzumab upregulates miR-194 expression in vitro and in vivo. [score:6]
miR-194 targets the talin2 gene and downregulates talin2 protein levels. [score:6]
While inhibition of cell migration by miR-194 has been demonstrated in other systems, this is the first report to show that miR-194 can inhibit breast cancer cell migration (Fig. 2) and that miR-194 and migration can be regulated by trastuzumab. [score:6]
Our data suggest that miR-194 -induced inhibition of motility is mediated by downregulation of cytoskeletal proteins. [score:6]
We next asked whether miR-194 targeted the expression of proteins which regulate migration and invasion of breast cancer cells (Fig. 2). [score:6]
miR-194 inhibitor stimulates cell migration and blocks trastuzumab -inhibited cell migration. [score:5]
Taken together, these data indicate that miR-194 can significantly inhibit cell migration/invasion in vitro, and tumor growth in vivo in breast cancer cells that overexpress HER2. [score:5]
Forced expression of miR-194 inhibits cell migration and decreases levels of talin2, a cytoskeletal protein. [score:5]
Inhibition of these other cytoskeletal and migration-related proteins may contribute to miR-194 -induced inhibition of cell migration/invasion as well. [score:5]
In agreement with the luciferase reporter results, transient overexpression of miR-194 significantly decreased talin2 protein expression (Fig. 3C). [score:5]
Additionally, miR-194 was not induced by trastuzumab treatment in either the MDA-MB-231 breast cancer cell line that expresses low levels of HER2 and is insensitive to trastuzumab or the KPL4 breast cancer cell line that expresses high levels of HER2 and is insensitive to trastuzumab (Fig. S2). [score:5]
Activation of tumor suppressor p53 can induce miR-194 and its clustered miR-192 and miR-215 expression [55], [57]. [score:5]
However, trastuzumab treatment was no longer able to inhibit cell migration in the presence of miR-194 antagomir or inhibitor (Fig. 5C), indicating miR-194 induction was required for trastuzumab to slow cell migration in breast cancer cells. [score:5]
SKBr3 cells were transiently transfected with a miR-194 inhibitor or its negative control (miR inhibitor CTRL) for 48 hrs. [score:5]
Our study has identified another miRNA (miR-194) and new target (talin 2, motility) in HER2 -overexpressing breast cancer cells. [score:5]
Using the TargetScan and miRanda programs, we identified talin2 that encodes a cytoskeletal protein as one of many genes targeted by miR-194. [score:5]
miR-194 has been shown by others to target migration-related proteins including N-cadherin, Rac1, heparin -binding epidermal growth factor–like growth factor, type 1 insulin-like growth factor receptor, protein tyrosine phosphatase-non receptor type 12, integrin-alpha 9, suppressor of cytokine signaling 2, and BMI1 polycomb ring finger oncogene [54], [56], [58]. [score:5]
In endometrial cancer cells, miR-194 has been reported to inhibit self-renewal factor BMI-1, reduce cell invasion and inhibit epithelial-mesenchymal transition (EMT) [58]. [score:5]
Two stable clones that express miR-194 and two control clones that express the backbone vector (pEGPF-C1) were established in BT474 cells using previously reported methods [46]. [score:5]
Increased miR-194 expression inhibits breast cancer cell migration and invasion. [score:5]
Additionally, stable overexpression of miR-194 inhibited the ability of BT474 cells to migrate by 40% and to invade by 55% (Fig. 2G & 2H). [score:5]
We have demonstrated for the first time that miR-194 inhibits talin2 protein expression and binds to the talin2 3′-UTR (Fig. 3). [score:5]
These data indicate that talin2 is a direct target of miR-194 in breast cancer cells. [score:4]
From the data presented above, trastuzumab treatment increases miR-194 (Tables 1 & 2 and Fig. 1) and miR-194 negatively regulates cell migration (Fig. 2) and talin2 expression (Fig. 3). [score:4]
The sequence of this miR-194 construct was verified by direct sequencing and QRT-PCR after transient expression. [score:4]
miR-194 precursor and its miRNA negative controls, miR-194 inhibitor and its negative inhibitor, and TaqMan assay for miR-194 were purchased from Applied Biosystems Incorporated (ABI, Foster City, CA). [score:4]
In addition to regulating talin2, we have also observed that miR-194 expression reduces profilin2, another cytoskeletal protein (data not shown). [score:4]
Knockdown of miR-194 promotes cancer cell migration and reverses trastuzumab inhibition of cell migration. [score:4]
Two control clones #17 and #19 that contain empty vector and two miR-194 -expressing clones #22 and #23 were established and subjected for QRT-PCR analysis. [score:3]
The control clone #17 and the miR-194 -expressing clone #22 were chosen to study migration. [score:3]
Figure S2 Effects of trastuzumab on miR-194 expression in the MDA-MB-231 cells with low-HER2 level and the KPL4 cells with high-HER2 level. [score:3]
Generation of Trastuzumab-resistant Cells and Stable Clones that Express miR-194 in BT474 and SKBr3 cells. [score:3]
Total RNA was extracted and subjected to QRT-PCR analysis for miR-194 expression. [score:3]
Trastuzumab treatment upreguates miR-194 in HER2 overexpressing breast cancer cells. [score:3]
Stable expression of miR-194 in subclones of BT474 cells was confirmed with QRT-PCR and shown in Figure 2A. [score:3]
The control clone #17 and the miR-194 -expressing clone #22 were chosen to study invasion. [score:3]
Prediction of miR-194 binding sites was performed using TargetScan software (http://www. [score:3]
Trastuzumab specifically induces miR-194 expression in trastuzumab-sensitive breast cancer cells. [score:3]
The miR-194 target site is also highly conserved among multiple species including humans, chimpanzees, mice, rats, rabbits, hedgehogs, dogs, cats, horses and elephants (Fig. 3A). [score:3]
Stimulation of SKBr3 cells with EGF for 16 hrs had no effect on miR-194 expression (data not shown). [score:3]
In this study, we have found for the first time that miR-194 is induced in HER2 -overexpressing breast cancer cells by trastuzumab treatment. [score:3]
Transient overexpression of miR-194 significantly decreased the ability of SKBr3 cells to migrate (Fig. 2C). [score:3]
Depletion of miR-194 stimulates breast cancer cell migration and abolishes trastuzumab -inhibited cell migration. [score:3]
0041170.g005 Figure 5(A) Effect of miR-194 inhibitor on cell migration in SKBr3 cells. [score:3]
No significant change in cell cycle distribution or apoptosis was observed in subclones of BT474 with stable overexpression of miR194 (data not shown). [score:3]
BT474 xenografts in nude mice were established with the control clone #17 and the miR-194 -expressing clone #22 as described in Methods. [score:3]
miR-194 suppresses invasion and migration of liver mesenchymal-like cancer cells [54]. [score:3]
miR-194 Expression Construct. [score:3]
Briefly, BT474 wild-type cells or stable transfectants expressing miR-194 were injected subcutaneously into two mammary fat pads of 4-week-old BALB/c athymic Nu/Nu mice (obtained from the in-house animal facility at the Department of Experimental Radiation Oncology, the University of Texas MD Anderson Cancer Center). [score:3]
QuikChange® II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) was used to generate a deletion mutation in the miR-194 seed region according to the manufacturer's instructions. [score:3]
SKBr3 cells were transiently transfected with a miR-194 inhibitor or its negative control (miR inhibitor CTRL) for 48 hrs before measurement of migration overnight. [score:3]
As shown in Figure 1E, miR-194 expression increased only in trastuzumab-sensitive SKBr3 and BT474 parental cells but not in trastuzumab-resistant cells. [score:3]
The putative miR-194 target site in the 3′-UTR of talin2 gene shows a close match to nucleotides 2 to 18 of miR-194 (Fig. 3A). [score:3]
Two approaches were used to study the function of miR-194 in breast cancer cells: transient and stable expression of miR-194 in BT474 or SKBr3 breast cancer cells. [score:3]
Low miR-194 expression has been associated with large tumor size and advanced stage in gastric cancer [56]. [score:3]
High levels of miR-194 are expressed in the intestines and liver [50], [51]. [score:3]
Validation of miR-194 transient expression was performed with QRT-PCR and shown in Figure 2F. [score:3]
miR-194 expression is elevated in normal colon tissues and low in colon cancers [55]. [score:3]
Similar results were observed in BT474 cells, where inhibition of miR-194 by a miR-194 antagomir stimulated BT474 cell migration (Fig. 5C). [score:3]
When miRNA changes were compared in SKBr3 and BT474 breast cancer cells, miR-194 upregulation was the only change shared by both cell lines. [score:3]
As shown in Figure 2I, miR-194 expressing BT474 tumors grew significantly less rapidly than did tumors containing breast cancer cells with an empty vector. [score:3]
Hepatocyte nuclear factor (HNF) can induce miR-194 expression during intestinal epithelial cell differentiation [52], [53]. [score:3]
To determine whether a decrease in miR-194 would increase motility, SKBr3 cells were transiently transfected with a specific miR-194 inhibitor or antagomir. [score:3]
Briefly, BT474 stable cells that either express empty vector or miR-194 were seeded and cultured in triplicate in 96-well cell culture plates for different intervals. [score:3]
SKBr3 cells were transiently transfected with a miR-194 inhibitor or its negative control (miR inhibitor CTRL) for 16 hrs, treated with trastuzumab (Tras) or control hIgG (10 µg/ml) for 36 hrs, and motility was then measured for overnight in Transwell assays. [score:2]
Transient overexpression of miR-194 also decreased the ability of SKBr3 cells to detach from and invade through the matrigel matrix as illustrated in the cell invasion assay (Fig. 2E). [score:2]
The regulatory role of miR-194 was first studied in normal and malignant cells of the gastrointestinal tract. [score:2]
An assay with a miR-194-specific sensor reporter also indicated that trastuzumab increased miR-194 expression (data not shown). [score:2]
Consistent with above results in cell culture, QRT-PCR analysis of BT474 xenograft tumor samples also showed that treatment with trastuzumab induced miR-194 expression by 3.1 fold compared to control hIgG (Fig. 1D). [score:2]
As shown in Figure 2B, stable overexpression of miR-194 in two BT474 stable clones (#22 and #23) produced moderate inhibition of cell growth as measured with a crystal violet viability assay. [score:2]
Compared with the negative control miRNA, miR-194 expression reduced SKBr3 cell migration by 56% (Fig. 2D). [score:2]
Briefly, cells were seeded in 6-well plates, cotransfected with miR-194 precursor or its negative control and a wild-type or mutated talin2 3′-UTR reporter construct as described above. [score:1]
The effect of miR-194 on HER2 -overexpressing breast cancer cells was further evaluated in a BT474 xenograft mo del. [score:1]
Thus, miR-194 is specifically induced by trastuzumab treatment and may associate with trastuzumab response. [score:1]
miR-194 Northern blotting was performed as described previously [44]. [score:1]
BT474 cells were stably transfected with an empty pEGFP-C1 vector or pEGFP-miR-194 vector under the selection of G418. [score:1]
MDA-MB-361 cells were transiently transfected with a miR Control or miR-194 precursor for 36 hrs. [score:1]
However, miR-194 did not bind directly to the profilin2 3′-UTR in a luciferase reporter assay. [score:1]
Collectively, above results confirm that trastuzumab induces miR-194 in cell culture and in vivo. [score:1]
To determine whether miR-194 acts directly on talin2 3′-UTR, we conducted luciferase reporter assays, cotransfecting miR-194 and luciferase reporter constructs containing wild type (underlined letter in Figure 3A) or mutant (deletion of underlined letter in Figure 3A) talin2 3′-UTR. [score:1]
0041170.g003 Figure 3(A) Alignment of miR-194 with talin2 (TLN2) 3′-UTRs. [score:1]
Northern blotting further confirmed that trastuzumab treatment increased miR-194 level by 2.1 fold in BT474 cells (Fig. 1C). [score:1]
QRT-PCR analysis confirmed that trastuzumab treatment increased miR-194 by 1.64 fold in SKBr3 cells (Fig. 1A) and by 1.95 fold in BT474 cells (Fig. 1A). [score:1]
Total RNA was prepared and analyzed by QRT-PCR in triplicate for miR-194 levels. [score:1]
Two control clones #17 and #19 that contain empty vector and two miR-194 -expressing clones #22 and #23 were chosen to measure viability of crystal violet-stained cells on day 1, day 3 and day 5. (C) Effect of miR-194 precursor on cell migration in SKBr3 cells. [score:1]
Trastuzumab upreguates miR-194 in cell culture and in xenografts. [score:1]
In contrast, miR-194 did not alter activity of the mutant talin2 luciferase reporter that contained the deletion of miR-194 binding site (Fig. 3B), indicating miR-194 specifically act on wild-type talin2 3′-UTR. [score:1]
BT474 cells were stably transfected with empty pEGFP-C1 vector or pEGFP-miR194 construct under the selection of G418. [score:1]
Briefly, control -treated or miR-194 (or trastuzumab) -treated BT474 or SKBr3 cells were introduced into the upper compartment, incubated for 24 hrs, fixed and stained after removing non-invading cells as described above for the. [score:1]
The effects of transient and stable expression of miR-194 on cell viability, cell cycle, apoptosis and cell migration/invasion were evaluated. [score:1]
Consequently, miR-194 was selected for further study. [score:1]
The ability of the miR-194 antagomir to silence miR-194 was confirmed by QRT-PCR as shown in Figure 5B. [score:1]
The hybridization with a DNA oligonucleotide probe complementary to the mature miR-194 sequence end-labeled with [γ- [32]P] ATP was performed at 42°C in 7% SDS/0.2 M Na [2]PO [4] (pH 7.0) overnight. [score:1]
We next explored the biological function of miR-194 in breast cancer. [score:1]
Total RNA was prepared and analyzed by QRT-PCR to detect miR-194. [score:1]
As shown in Table 1, trastuzumab treatment in SKBr3 cells increased 23 human miRNAs including miR-194 and miR-629, but decreased 33 human miRNAs in SKBr3 cells. [score:1]
The seed sequences of miR-194 are underlined. [score:1]
Briefly, cells were transfected with miR-194 precursors for 3 days, and then harvested for total lysate preparation. [score:1]
As shown in Figure 5A, transfection of SKBr3 cells with a miR-194 antagomir increased cancer cell migration by more than 55%. [score:1]
As shown in Table 2, trastuzumab increased 40 human miRNAs including miR-194, decreased 18 human miRNAs in BT474 cells. [score:1]
BT474 or SKBr3 cells were seeded on 6-well culture plates and transfected with a negative control sequence or miR-194 using the DF4 reagent (Dharmacon). [score:1]
Complementary sequences of miR-194 and mammalian talin2 3′-UTRs are marked in Bold. [score:1]
Total RNA was prepared and analyzed by Northern blotting to detect miR-194. [score:1]
SKBr3 cells were transiently transfected with a miR-194 precursor or a control miRNA (miR CTRL) for 48 hrs. [score:1]
[1 to 20 of 108 sentences]
3
[+] score: 293
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-127, hsa-mir-150, hsa-mir-194-2
Overexpression of miR-194 downregulated the expression of N-cadherin and IGF-IR protein, suggesting that miR-194 functions as tumor suppressor probably by downregulating N-cadherin and IGF-IR in osteosarcoma. [score:13]
Therefore, upregulated miR-194 was very effective in inhibiting tumor growth and metastasis indicating that miR-194 functions as a tumor suppressor gene and as a potential therapeutic target. [score:10]
Our results indicate that miR-194 interacted with N-cadherin and IGF-IR and negatively regulated their expression at the translational level, which also indicated that miR-194 may suppress tumor growth and metastasis in osteosarcoma cells by down -regulating N-cadherin and IGF-IR. [score:9]
The mutations of p53 tumor suppressor gene, which directly regulates the expression of miR-194, were found in 20–60% of sporadic OS (31). [score:8]
miR-194 functions as a tumor suppressor gene by downregulating targets such as SSH2, HBEGF, IGF1R, CDH2 (N-cadherin) and TLN2 (23– 27). [score:8]
Patients were divided into two groups according to their expression levels of miR-194, using its median as a cut-off: high miR-194 expression group (n=41) and low miR-194 expression group (n=66). [score:7]
In addition, miR-194 specifically downregulated the expression of IGF1R and CDH2. [score:6]
Expression of IGF1R and N-cadherin proteins were both inversely correlated with miR-194 expression and regulated the migration and invasion of osteosarcoma cells. [score:6]
We report for the first time that overexpression of miR-194 inhibited growth and metastasis of osteosarcoma. [score:5]
By using TargetScan 5.1 and PicTar, we predicted putative genes of miR-194, and obtained several putative targets correlating with tumor growth or metastasis, such as QKI, KIAA1239, EPHA5, NACC2, MCTS1 and SAMD4A. [score:5]
Overexpression of miR-194 in gastrointestinal cancer cells suppresses cell migration, invasion and metastasis (24). [score:5]
We examined the potential targets of miR-194 by searching the PicTar miRanda and TargetScan databases. [score:5]
These findings suggest that expression of the IGF1R and N-cadherin proteins were inversely correlated with miR-194 expression in osteosarcoma. [score:5]
The FFPE tissues were also divided: high miR-194 expression group (n=21) and low miR-194 expression group (n=78). [score:5]
In endometrial cancer cells, miR-194 has been reported to inhibit self-renewal factor BMI-1, reduce cell invasion and inhibit epithelial-mesenchymal transition (EMT) (30). [score:5]
We showed that overexpressed miR-194 significantly suppressed proliferation, migration and invasion of SOSP-9607 and U2-OS cells in vitro. [score:5]
Orthotopic tumors in the OE group expressed higher miR-194 levels compared with other groups (Fig. 6G) indicating that exogenous miR-194 significantly inhibited the tumor growth and metastasis in vivo. [score:4]
High levels of IGF1R were seen in 47 of 66 (71.2%) cases with downregulated miR-194 (p<0.001) (Table IV). [score:4]
Downregulation of miR-194 may be associated with tumor aggressiveness and tumor metastasis of osteosarcoma, suggesting that miR-194 may be an independent prognostic marker for osteosarcoma. [score:4]
These results revealed that downregulation of miR-194 was associated with poor prognosis of OS. [score:4]
After transfection and selection of cells, the experiments with SOSP-9607 cells and U2-OS cells were divided into four groups including a blank group (untransfected cells), a control group (cells transfected with the control lentivirus), an OE group (overexpression of miRNA-194) and a KD group (knocked down miRNA-194). [score:4]
Briefly, 4 groups SOSP-9607 cells (overexpression of miRNA-194, for knocking down miRNA-194, miRNA control and untransfected cells) suspension of 100,000 cells in 100 μl were injected into the proximal tibia of each anesthetized nude mouse (n=10 animals per group). [score:4]
Downregulation of miR-194 confers poor prognosis in patients with osteosarcoma. [score:4]
In colon cancer tissue, miR-194 was downregulated relative to normal mucosa (28). [score:4]
Downregulation of miR-194 is associated with advanced clinicopathological features of osteosarcoma. [score:4]
Patients with high miR-194 expression survived significantly longer compared with low miR-194 expression based on the log rank test (Fig. 7C; p=0.0007). [score:4]
It is crucial to identify additional target genes that mediate the miR-194 -induced regulation of tumor metastasis. [score:4]
Predicting and identifying the miR-194 -targeting genes provides an experimental basis for further research on regulatory mechanism of miR-194. [score:4]
High levels of N-cadherin were present in 42 of 66 (63.6%) cases with downregulated miR-194 (p<0.05). [score:4]
High levels of N-cadherin were present in 51 of 78 (65.4%) cases with downregulated miR-194 (p<0.01). [score:4]
These results indicated that miR-194 recombinant lentiviruses could regulate miR-194 expression effectively in both SOSP-9607 and U2-OS cells. [score:4]
Recombinant lentiviruses containing overexpression of miRNA-194, for knocking down miRNA-194 and miRNA control were purchased from Shanghai Genechem Co. [score:4]
High levels of IGF1R were seen in 62 of 78 (79.5%) cases with downregulated miR-194 (p<0.001). [score:4]
No significant difference was observed between the expression of miR-194 and the patient gender (p=0.749). [score:3]
showed that miR-194 inhibits the clonogenicity of osteosarcoma in vitro (P<0.001). [score:3]
miR-194 inhibits tumor growth and metastasis of osteosarcoma in vivo. [score:3]
Hepatocyte nuclear factor (HNF) also induces miR-194 expression during intestinal epithelial cell differentiation (23). [score:3]
miR-194 inhibits migration and invasion of osteosarcoma in vitro. [score:3]
The precusor sequence of miR-194 was used for overexpression as follows: AUGGUGUUAUCAAGUGUAACAGCAACUCCAUGUGG ACUGUGUACCAAUUUCCAGUGGAGAUGCUGUUACU UUUGAUGGUUACCAA. [score:3]
In the final multivariate Cox regression mo del, low levels of miR-194 expression in osteosarcoma (p=0.001, relative risk = 0.390) and distant metastasis (p=0.001, relative risk =2.386) were associated with a poor prognosis in terms of overall survival, independent of other clinical covariates (Table III). [score:3]
We have performed the largest study to date that assessed the expression levels of miR-194 in osteosarcoma by real-time PCR. [score:3]
miR-194 is specifically expressed in the human gastrointestinal tract and is induced during intestinal epithelial cell differentiation (23). [score:3]
The results indicate that miR-194 may target CDH2 and IGF1R. [score:3]
miR-194 expression levels in the orthotopic tumors were tested using real-time RT-PCR, and the number of pulmonary metastatic tumor nodules was counted under a low-power dissecting stereomicroscope. [score:3]
The median of miR-194 expression levels in all 99 paraformalin-fixed, paraffin-embedded (FFPE) tissues with osteosarcoma was 5.74. [score:3]
Expression of miR-194 in osteosarcoma and corresponding non-cancerous tissues. [score:3]
Our mouse mo del showed that miR-194 also significantly inhibited orthotopic tumor growth and lung metastasis in vivo. [score:3]
As shown in Table I, we found statistically significant relationships between miR-194 expression and age (p=0.0015), clinical stage (p=0.019), distant metastasis (p=0.0251) and patient mortality (p=0.0065). [score:3]
However, no significant difference of miR-194 expression was found in 107 cancerous and adjacent non-cancerous tissue pairs. [score:3]
As shown in Table II, we found statistically significant relationships between miR-194 expression and age (p=0.037), tumor size (p=0.041), clinical stage (p=0.039), distant metastasis (p=0.044) and patient mortality (p=0.013). [score:3]
miR-194 inhibits proliferation of osteosarcoma in vitro. [score:3]
We observed that decreased expression of miR-194 was correlated with cancer progression and poor prognosis in osteosarcoma patients, independent of other clinicopathologic factors. [score:3]
It could be informative to confirm the putative target genes and further investigate the underlying molecular mechanisms of miR-194 as a tumor suppressor gene in osteosarcoma. [score:3]
CDH2 and IGF1R are potential targets of miR-194. [score:3]
The reports suggested that miR-194 may function as a tumor suppressor in OS. [score:3]
These data demonstrated that miR-194 could inhibit the proliferation in both SOSP-9607 and U2-OS cells. [score:3]
The median miR-194 expression level in 107 patients with osteosarcoma was 3.647. [score:3]
Low expression of miR-194 has been associated with large tumor size and advanced stage in gastric cancer (29). [score:3]
miR-194 gene therapy may prove to be a promising therapy for tumorsuppression in osteosarcoma. [score:3]
No significant difference was observed between the expression of miR-194 and the patient gender (p=0.4038) and tumor size (p=0.6264). [score:3]
Tissue specificity might be one of the reasons which was associated with the differences in miR-194 expression, as observed in cancer miRNA signatures across different organs (42). [score:3]
The regulatory role of miR-194 was first studied in normal and malignant cells of the gastrointestinal tract (24). [score:2]
The reverse complementary sequence of miR-194 was used for the knock-down as follows: TC CACATGGAGTTGCTGTTACA. [score:2]
The miR-194-up cells significantly repressed the luciferase activity of the vector with the wild-type CDH2 3′-UTR, whereas mutation of the seed sequence abolished this repression (Fig. 8E and F). [score:2]
The results showed that miR-194 expression was significantly lower in F5M2 cells compared with F4 cells (Fig. 1A; p<0.001). [score:2]
We carried out in vitro and in vivo experiments to evaluate the effects of miR-194 and its possible direct targets, IGF1R and CDH2, in tumor growth and metastasis of SOSP-9607 and U2-OS cells. [score:2]
miR-194 expression was decreased in 59 of 107 (55.14%) tumor samples compared with their non-malignant counterparts by real-time PCR (Fig. 7A). [score:2]
To validate IGF1R and N-cadherin as target genes of miR-194 in osteosarcoma cells, luciferase assay was performed as previously described (33). [score:2]
Finally, miR-194 may prove to be a promising gene therapeutic agent. [score:1]
Of the 41 osteosarcoma cases with elevated miR-194, 25 (61.0%) showed low levels of N-cadherin. [score:1]
miR-194 expression levels in four groups were measured using microscopy and stem-loop real-time RT-PCR. [score:1]
To identify whether miR-194 was an independent prognostic covariate for osteosarcoma, we performed a multivariate Cox proportional hazards analysis. [score:1]
Therefore, it is of great significance to further study the function and mechanism of miR-194 in osteosarcoma. [score:1]
The results suggested that miR-194 might play a vital role in the metastatic processes. [score:1]
Similar results were obtained in U2-OS cell lines (Fig. 5A and B), which strongly indicated that miR-194 had an important role in reducing the migration and invasion of osteosarcoma in vitro. [score:1]
Of the 21 osteosarcoma cases with elevated miR-194, 16 (76.2%) showed low levels of N-cadherin. [score:1]
miR-194 induces apoptosis. [score:1]
Other putative miR-194 target genes that are potentially associated with the growth and metastasis of osteosarcoma cells should be investigated. [score:1]
We identified a conserved domain within the 3′-UTR of CDH2 (N-cadherin) and IGF1R with a potential miR-194 binding site (Fig. 8A). [score:1]
These results revealed that loss of miR-194 was associated with some clinicopathological features of OS. [score:1]
Of the 41 osteosarcoma cases with elevated miR-194, 29 (70.7%) had low levels of IGF1R. [score:1]
In conclusion, the results demonstrate that miR-194 affected the growth and metastasis of osteosarcoma cells both in vitro and in vivo. [score:1]
Effect of miR-194 on clone formation in SOSP-9607 and U2-OS cells. [score:1]
These results showed that miR-194 could induce apoptosis in both SOSP-9607 and U2-OS cells. [score:1]
In the present study, we evaluated the expression of miR-194 using quantitative real-time PCR. [score:1]
Of the 21 osteosarcoma cases with elevated miR-194, 15 (71.4%) had low levels of IGF1R. [score:1]
However, the effects of miR-194 in osteosarcoma have not been completely elucidated. [score:1]
The results showed that miR-194 had no effect on CDH2 and IGF1R mRNA levels (Fig. 8C and D). [score:1]
[1 to 20 of 88 sentences]
4
[+] score: 287
Other miRNAs from this paper: hsa-mir-99a, hsa-mir-194-2
Conversely, as BCL-2 inhibits apoptosis and Cyclin D1 promotes progression through the cell cycle, their reduced expression in cells treated with miR-194 vector also confirm the association between miR-194 expression and apoptosis. [score:7]
miR-194 suppresses metastasis of non-small cell lung cancer through regulating expression of BMP1 and p27 [kip1]. [score:6]
Moreover, miR-194 was found to reduce in primary tumor samples with metastasis and enforcing miR-194 suppressed motility and invasiveness of lung cancer cells in vitro and in vivo through downregulation of two key functional factors, BMP1 and p27 [kip1]. [score:6]
A recent study reported that miR-194 was decreased and associated with tumor size and tumor differentiation in colorectal cancer, overexpression of miR-194 suppresses tumor growth by regulating the MAP4K4/c-Jun/MDM2 signaling pathway. [score:6]
In osteosarcoma, overexpression of miR-194 inhibits tumor growth and metastatic potential via the regulation of CDH2 and IGF1R [27]. [score:6]
29 patients had tumors that expressed high levels of miR-194, while 35 patients had tumors that expressed low levels of miR-194. [score:5]
Furthermore, a Together, our findings suggest that miR-194 acts as a tumor-inhibiting factor in NSCLC, and could be a target for NSCLC, even patients with chemotherapy tolerance. [score:5]
As we expected, overexpression of miR-194 are more prone to apoptosis when treated with a DDP and require a significantly reduced half maximal inhibitory concentration of the chemotherapeutic agent. [score:5]
As Bax is a protein necessary for the initiation of apoptosis, its increased expression in cells treated with the miR- 194 vector confirms the association between miR-194 expression and apoptosis. [score:5]
Figure 1(A) Relative expression of miR-194 expression in NSCLC tissue (n = 64) and in paired adjacent non-cancerous tissues (n = 64). [score:5]
We therefore reintroduced FOXA1 expression in NSCLC cells that overexpressed miR-194 and determined its effect on apoptosis and metastatic capacity. [score:5]
Overall, these findings suggest that increased expression of miR-194 improves the sensitivity of NSCLC cells to the chemotherapeutic agent DPP, whereby cells that express higher levels of miR-194 not only have higher rates of apoptosis but also require a significantly smaller amount of the drug to produce the same effect. [score:5]
Additionally, miR-194 may play an indirect role in the prevention of HCC, it has been shown to regulate the hepatitis C virus binding target CD81, thereby preventing entry of the virus into hepatocytes [33]. [score:5]
In all, our data supports the notion that miR-194 acts as a tumor suppressor and might be a novel potential therapeutic target for NSCLC. [score:5]
Patients with tumors that expressed high levels of miR-194 had significantly longer overall survival than patients who had tumors that expressed low levels of miR-194 (p = 0.0002) (Figure 1C). [score:5]
In my present study, overexpression of miR-194 inhibited cell proliferation, migration, and invasion in vitro and in vivo. [score:5]
Overexpression of miR-194 suppresses NSCLC cell proliferation. [score:5]
Yet another study examining miR-194's role in preventing the progression of gastric cancer suggested that it was miR-194's regulation of the protein RBX1 that was responsible for its inhibitory effect. [score:4]
In endometrial cancer, miR-194 was also found to have a protective effect, increasing levels of E-cadherin and reducing levels of vimentin, thus inhibiting cellular invasion via its regulation of the protein BMI-1 [21]. [score:4]
miR-194 was significantly downregulated and correlated with poor prognosis. [score:4]
FOXA1 is a direct target of miR-194. [score:4]
Both H1299-miR-194 and A549-miR-194 cells overexpressing FOXA1 expressed greater levels of the anti-apoptotic proteins BCL-2 and Cyclin D1 and recued levels of the pro-apoptotic protein Bax compared to control (Figure 6C). [score:4]
MiR-194 expression was normalized to U6 expression. [score:4]
These findings suggest that FOXA1 is responsible for the tumorigenic effects in NSCLC cells, and reduction of FOXA1 via miR-194 inhibits those effects. [score:3]
Next, we examined the half maximal inhibitory concentration of DPP for A549/DPP cells transfected with the miR-194 vector. [score:3]
FOXA1 is one such protein, TargetScan demonstrated a putative binding site to miR-194 in the 3′ UTR region of FOXA1 (FOXA1-WT) (Figure 5A). [score:3]
Overall survival was examined in patients with NSCLC's expressing varying amounts of miR-194. [score:3]
Relative miR-194 expression in NSCLC tissue and its clinical significance. [score:3]
Overxpression of FOXA1 inhibits the pro-apoptotic, anti-invasive, and anti-migratory capacities attributed to miR-194. [score:3]
miR-194 inhibits NSCLC migration and invasion both in vitro and in vivo. [score:3]
Increased expression of miR-194 in the cells transfected with the miR-194 vector was confirmed by qRT-PCR in both cell lines (p < 0.01) (Figure 2A). [score:3]
We first examined miR-194 expression in cisplatin-resistant NSCLC cells (A549/DPP). [score:3]
We also provide experimental evidence that miR-194 regulated cellular function via directly interacting with the FOXA1 mRNA at the 3′-UTR. [score:3]
In summary, we showed that low levels of miR-194 are associated with worse prognosis of NSCLC and could inhibit cell proliferation and invasion in vitro and in vivo. [score:3]
Another study showed that miR-194, via its actions on the protein FOXM1, inhibits gastric carcinoma cell migration, invasion, and epithelial to mesenchymal transition [11]. [score:3]
We then examined miR-194 expression in A549/DPP cells transfected with the miR-194 vector versus the control vector. [score:3]
Because miR-194 expression is associated with both decreased tumor growth and metastatic capacity, a search for a potential binding protein was performed. [score:3]
Pathologically, miR-194 may play a role in the development of osteoporosis [15, 16] and osseous developmental abnormalities [17]. [score:3]
Figure 6(A) Overexpression of FOXA1 reduces the rate of apoptosis in both H1299 and A549 cells treated with the miR-194 vector. [score:3]
miR-194 inhibits NSCLC cell proliferation both in vitro and in vivo. [score:3]
Overexpression of miR-194 in A549/DPP cells significantly increases their sensitivity to DPP. [score:3]
Overexpression of FOXA1 also restored both the migratory and invasive capacities of NSCLC cells transfected with miR-194. [score:3]
Both H1299 and A549 cells that were transfected with the miR-194 vector expressed greater levels of Bax and lower levels of BCL-2 and CyclinD1 than H1299 and A549 cells transfected with the control vector respectively (Figure 3C). [score:3]
Overall, these results indicated that not only does decreased expression of miR-194 distinguish benign tissue from malignant NSCLC but also that the magnitude of the decrease in expression in tumor tissue can characterize the aggressiveness of the tumor. [score:3]
MiR-194, commonly repressed in colorectal cancer, suppresses tumor growth by regulating the MAP4K4/c-Jun/MDM2 signaling pathway. [score:3]
Figure 7(A) Relative miR-194 expression in A549 parent cells and A549/DPP cells. [score:3]
Expression of miR-194 was also examined in NSCLC tissues of varying stage. [score:3]
These data consisted with previous results that miR-194 inhibits the capacity of NSCLC cells to metastasis [30]. [score:3]
Finally, expression levels of miR-194 were determined in six NSCLC cell lines, with the benign human bronchial epithelial cell line (16HBE) serving as a control. [score:3]
In higher stage lesions (stage III–IV), miR-194 expression was significantly lower than in lower stage lesions (stage I–II) (p = 0.0004) (Figure 1B). [score:3]
In gastric cancer, overexpression of miR-194 was associated with decreased tumor size and less advanced tumor stage, though was not associated with cell proliferation [19]. [score:3]
In colorectal carcinoma, miR-194 inhibits cell viability and invasion via its actions on the AKT2 pathway. [score:3]
Expression of FOXA1 could partially restore the pro-apoptotic and anti-invasion function of miR-194. [score:3]
Figure 5(A) TargetScan predicts a putative binding site for miR-194 in the 3′-UTR of FOXA1. [score:3]
Quantitative real-time PCR and were then used to determine expression levels of native FOXA1 in cells transfected with the miR-194 vector. [score:3]
A full length of human FOXA1 3′-UTR with a wide type and mutant target sequence for miR-194 were cloned into downstream of the of Renilla psi-CHECK2 (Promega, Madison, WI, USA) according to our previous publications. [score:3]
miR-194 inhibits the migratory, invasive, and metastatic capacities of NSCLC cells. [score:3]
Finally, we wished to assess the sensitivity of NSCLC cells to chemotherapy based on their expression level of miR-194. [score:3]
These findings suggested that miR-194 reduces cellular proliferation in NSCLC tissue both by increasing apoptosis as well as by inhibiting cellular mitosis. [score:3]
The roles of miR-194 in this study were consistent with other studies, which showed significant growth inhibition in several cancer cell types [34– 37]. [score:3]
Expression of miR-194 in NSCLC tumor tissue was significantly lower than in the paired non-tumor tissue (p < 0.01) (Figure 1A). [score:3]
These cells expressed significantly greater levels of miR-194 than the control (p < 0.01) (Figure 7B), thus confirming the efficacy of the vector in the cisplatin-resistant line. [score:3]
Clinicopathological variables of NSCLC patients were shown in Table 1. Interestingly, low miR-194 expression was significantly correlated with Lymph node metastasis and TNM stage (P < 0.05). [score:3]
Subsequently, cells transfected with the miR-194 vector also had reduced expression of FOXA1 (Figure 5D). [score:3]
Expression levels of miR-194 were determined in 64 pairs of NSCLC tissue and paired adjacent non-tumor tissue. [score:3]
In oral squamous cell carcinoma, miR-194 appears to medicate PI3K-Akt-FOXO3a signaling pathway via its negative regulation of AGK [8]. [score:2]
Our findings suggest that miR-194 could play an important role in the development of cisplatin resistance in NSCLC, consisted with the results miR-194 was reduced in A549/DDP. [score:2]
Both H1299-miR-194 (p < 0.01) and A549-miR-194 (p < 0.01) cells that were induced to overexpress FOXA1 demonstrated reduced rates of apoptosis compared to the control (Figure 6A). [score:2]
Expression levels of miR-194 were significantly less in all of the NSCLC cell lines compared to the control (p < 0.01) (Figure 1D), especially, NCI-H1299 and A549 cells showed lowest miR-194 levels. [score:2]
MiR-194 is a vertebrate specific microRNA with a known role in mitochondrial energy production [4], inhibition of inflammation [5], chondrogenesis [6] and neuronal differentiation [7]. [score:2]
Both H1299-miR-194 (p < 0.01) and A549-miR-194 (p < 0.01) cells that were induced to overexpress FOXA1 exhibited significantly increased capacities to both migrate and invade compared to the control (Figure 6B). [score:2]
In this study, we have demonstrated a mechanism that miR-194 was decreased in clinical NSCLC tissues compared to adjacent normal lung tissues and that miR-194 played a critical role in NSCLC progression by regulating cell proliferation and invasion via negatively regulate FOXA1. [score:2]
miR-194 regulates the sensitivity of NSCLC cells to DDP in vitro. [score:2]
Another study had similar findings regarding the role of miR-194 in colorectal carcinoma, though it suggested that miR-194 regulated the MAP4K4/c-Jun/MDM2 signaling pathway [29]. [score:2]
A549 cells that were transfected with the miR-194 vector and implanted into nude mice grew into both significantly smaller (p < 0.01) (Figure 2E) and lighter (p < 0.01) (Figure 2F) tumors than A549 cells that were transfected with the empty control vector and implanted into nude mice. [score:1]
Figure 2(A) Overxpression of miR-194 in H1299 and A549 cells transfected with the miR-194 vector with respect to cells transfected with the control vector was confirmed by qRT-PCR. [score:1]
We therefore examined effect of miR-194 on cell proliferation. [score:1]
An overexpression of miR-194 vector was created according to our previous publications [9] with following primer 5′-AAAGGATCCCAGGAGTTGTAAA TCCGAGCCG-3′ and the reverse primer 5′-AAAGAATTC TTCATAGGTCAGAGCCCTGTGCA-3′. [score:1]
Given that NSCLC cells treated with the miR-194 vector exhibited reduced migratory and invasive capacity in vitro, we therefore examined the metastatic capacity of these cells in vivo. [score:1]
miR-194 arrests the cell cycle and induces apoptosis in NSCLC cells. [score:1]
Figure 3(A) Rates of apoptosis in H1299 and A549 cells transfected with the miR-194 vector versus the empty vector control. [score:1]
Again, both H1299 and A549 cells that were transfected with the miR-194 vector exhibited significantly lower rates of colony formation than H1299 and A549 cells transfected with the control vector respectively (p < 0.01). [score:1]
To produce experimental metastasis, A549 cells (1 × 10 [6]) infected with lentiviral constructs carrying either the miR-194 vector or the control vector were harvested and injected into the 6-week-old nude mice. [score:1]
With the knowledge that lower level of miR-194 is associated with more aggressive NSCLC behavior, we then attempted to determine what factors contribute to the increase in aggressiveness of these tumors. [score:1]
Transfection of the H1299 and A549 NSCLC cell lines with either a miR-194 vector or an empty control vector was performed. [score:1]
Figure 4(A–B) of H1299 and A549 NSCLC cells transfected with the control vector or the miR-194 vector. [score:1]
Conversely, cells co -transfected with the miR-194 vector and the FOXA1-MUT protein had similar levels of luciferase activity as cells co -transfected with the control vector and the FOXA1-MUT protein (Figure 5B). [score:1]
The reduction in cell proliferation seen in NSCLC cells treated with miR-194 was then further examined by looking at its effect on apoptosis and the cell cycle. [score:1]
Further, Pearson correlation analysis demonstrated an inverse relationship between FOXA1 mRNA levels and miR-194 levels (p < 0.001) (Figure 5F). [score:1]
The lentiviruses of miR-194 were generated by co-transfecting HEK293T with pPACKH1 Lentivector Packaging KIT (SBI) according to our previous publications [9]. [score:1]
In this study, we first determined the miR-194 expression in NSCLC tissues and their corresponding adjacent normal tissues, then investigated the functional role of miR-194 in tumourigenesis, metastasis, and apoptosis induction in NSCLC cells. [score:1]
Furthermore, we investigated the potential associations between miR-194 expression and patients’ clinicopathological variables. [score:1]
Mice that had been implanted with A549 cells treated with the miR-194 vector had a significantly lower number of pulmonary metastases than mice that had been implanted with A549 cells treated with the control vector (p < 0.01). [score:1]
When miR-194 levels are low, as in NSCLC tissue, FOXA1 levels remain elevated. [score:1]
A significantly lower percent of both H1299 and A549 cells transfected with the miR-194 vector were in S phase than H1299 and A549 cells transfected with the control vector respectively (p < 0.01) (Figure 3B). [score:1]
Having confirmed that miR-194 acts to reduce FOXA1 levels in NSCLC cells, we then wished to determine whether this action of miR-194 is responsible for its tumorigenic effects. [score:1]
Cells co -transfected with the miR-194 vector and the FOXA1-WT protein had significantly lower levels of luciferase activity than cells co -transfected with the control vector and the FOXA1-WT protein (p < 0.01) (Figure 5B). [score:1]
The luciferase reporter gene vector with wild type FOXA1 (FOXA1-WT) or mutate FOXA1 (FOXA1-MUT) co -transfected with miR-194 in HEK293T cells. [score:1]
Both H1299 (p < 0.01) and A549 (p < 0.01) cells that were transfected with the miR-194 vector had significantly lower levels of FOXA1 mRNA than H1299 and A549 cells transfected with the control vector respectively (Figure 5C). [score:1]
And our data also showed that miR-194 was decreased in NSCLC tissues and associated with poor prognosis. [score:1]
Our data showed that miR-194 was significantly decreased in stage III–IV. [score:1]
Patients with endometrial cancers that produced higher levels of miR-194 also had a better prognosis [22]. [score:1]
[1 to 20 of 102 sentences]
5
[+] score: 241
Effect of miR-194 inhibition on protein expression of the oxidative phosphorylation complexes expression in L6 cells. [score:7]
In summary, our data indicate that miR-194 is down-regulated early in the development of insulin resistance and that this regulation is maintained through the progression towards type 2 diabetes. [score:6]
When miR-194 was down-regulated in vitro, western blot analysis showed an increased phosphorylation of AKT and GSK3β in response to insulin, and an increase in expression of proteins controlling mitochondrial oxidative phosphorylation. [score:6]
When studying the effects of miR-194 inhibition in L6 myocytes, we found that down-regulation of miR-194 resulted in an increased glucose uptake into the muscle cells and incorporation into glycogen both basally and in response to insulin. [score:6]
Our functional experiments in vitro have provided strong evidence of the effects of miR-194 down-regulation on glucose metabolism; additional studies examining the effects of miR-194 inhibition in vivo are now warranted to confirm our data. [score:6]
A computational prediction of miR-194 target genes has suggested several targets linked to T2DM signaling pathways (ATM, AKT2, KCNJ11, MAPK1, SOCS2), insulin signaling (AKT2, ATM, CRK, FOXO1, GRB10, INPP5K, MAPK1, PRKAR1A) and AMPK signaling (ADRAP1A, AKT2, ATM, CHRNAS, MAPK1, PPAT, PPP2R2C, PRKAR1A). [score:5]
Our combined experimental and clinical approach allowed us to identify changes of miR-194 expression across multiple species and metabolic tissues (skeletal muscle, adipose tissue) at different stages of the disease progression suggesting that miR-194 may be involved in the initial cellular responses to hyperglycemia and be part of the early cellular events related to the pathogenesis of type 2 diabetes. [score:5]
Phosphorylation of AKT (Ser473) and GSK3β (Ser9), relative to total expression, in response to insulin were increased by 43±9% and 71±4% respectively (p<0.05) in L6 cells transfected with the miR-194 inhibitor (Fig 4). [score:5]
We firstly assessed basal and insulin-stimulated glucose uptake in the L6 muscle cell line after inhibiting miR-194 expression. [score:5]
Interestingly, miR-194 was a unique miRNA that appeared regulated across different stages of the disease progression, from the early stages of insulin resistance to the development of T2DM. [score:5]
The expression levels of miR-194 were validated by qPCR, demonstrating a 50% reduction in expression in the skeletal muscle of individuals with pre-diabetes and diabetes (Fig 1A) and a 25% decrease in the skeletal muscle of insulin resistant rats (Fig 1B). [score:5]
Effect of miR-194 inhibition on AKT and GSK3β expression in L6 cells. [score:5]
Down-regulation of miR-194 identified by microarray was indeed validated by qPCR, showing good correlation between microarray and qPCR, and discarding the possibility of a false positive which can be high with microarray studies. [score:4]
Interestingly, a unique microRNA was regulated across both species: indeed, miR-194 expression was significantly reduced by 25 to 50% in both mo dels. [score:4]
Down-regulation of miR-194 in vitro activates the insulin signaling pathway and oxidative phosphorylation. [score:4]
To investigate the functional effect of down-regulation of miR-194 expression in the development of T2DM, we performed in vitro functional assays. [score:4]
miR-194 down-regulation promotes multiple aspects of glucose metabolism in skeletal muscle. [score:4]
We identified miR-194 as being commonly down-regulated in humans and rats. [score:4]
We have also shown an increased glycolysis in response to the down-regulation of miR-194, as indicated by an elevated lactate production in transfected cells. [score:4]
We investigated the functional role of miR-194 in skeletal muscle cells and showed that miR-194 down-regulation is associated with: 1) increased basal and insulin-stimulated glucose uptake, 2) increased glycolysis and incorporation into glycogen, 3) increased AKT and GSK3β phosphorylation in response to insulin stimulation, 4) increased glucose oxidation capacity, and 5) increased basal protein expression of mitochondrial oxidative phosphorylation complexes in skeletal muscle. [score:4]
Down-regulation of miR-194 in vitro promotes glucose metabolism. [score:4]
Among these, only one miRNA was similarly regulated: miR-194 expression was significantly reduced by 25 to 50% in both the rat mo del and in human with pre-diabetes and established diabetes. [score:4]
Indeed, we identified miR-194 as being down-regulated in skeletal muscle of insulin resistant rats from HF fed dams, high fat fed mice, and humans with pre-diabetes and T2DM. [score:4]
Although we have not examined the mechanism by which miR-194 is down-regulated in skeletal muscle in the current study, it could involve selective packaging into exosomes. [score:4]
Among these, one miR was similarly regulated; indeed, miR-194 expression was significantly reduced in both mo dels. [score:4]
Thus, miR-194 could be down-regulated in patients with early features of diabetes as an adaptive response to facilitate glucose metabolism in the face of insulin resistance. [score:4]
Expression of the phosphorylated and total forms of AKT (A) and GSK3β (B) were measured by Western blot in L6 cells 48 hours after transfection with a miR-194 inhibitor. [score:3]
When stimulated with insulin, lactate production increased by 18±7% in control cells while there was no further increase in cells transfected with the miR-194 inhibitor (p<0.05, Fig 3C). [score:3]
For instance, miR-194 expression was found increased in C2C12 cells treated with palmitate, and restored with oleate [52]. [score:3]
miR-194 expression was validated by qPCR in human (A) and rat samples (B) (n = 4–6 per group). [score:3]
To determine the optimal concentration, experiments using varying miR-194 inhibitor concentrations (5–100 nM) were performed. [score:3]
miR-194 expression in the skeletal muscle of human participants and rat offspring and correlations with HOMA-IR. [score:3]
Indeed, our study revealed augmented levels of insulin-stimulated phosphorylation of AKT and GSK3β by miR-194 inhibition. [score:3]
Expression of the oxidative phosphorylation (OXPHOS) complexes I to V of the electron transport chain was measured by western blot in L6 cells 48 hours after transfection with a miR-194 inhibitor. [score:3]
Effect of miR-194 inhibition on glucose homeostasis in L6 cells. [score:3]
Transfection of miR-194 inhibitor. [score:3]
Of note, we also found a decreased miR-194 expression in the adipose tissue from our human cohort (-21% in patients with pre-diabetes, -38% in patients with T2DM, data not shown). [score:3]
Fully differentiated L6 cells were transfected with either a miR-194 inhibitor or a negative control (Applied Biosystems, #MH10004 and #4464076) using Lipofectamine RNAiMAX (Invitrogen) following the manufacturers’ recommended protocol. [score:3]
MiR-194 could be down-regulated in patients with early features of diabetes as an adaptive response to facilitate tissue glucose uptake and metabolism in the face of insulin resistance. [score:3]
Correlation between miR-194 expression and HOMA-IR in human (C) and rat (D) was assessed using Pearson’s or Spearman’s correlation test as appropriate. [score:3]
Although there was no effect of miR-194 inhibition on the basal glucose oxidation rate, we found an increased glucose oxidation when the cells were treated with the mitochondrial uncoupler FCCP (Fig 3D). [score:3]
The microarray data from humans and rats provided a basis for the a priori hypothesis that miR-194 would be differentially expressed between the various mo dels when assessed by qPCR. [score:3]
In line with our oxidative phenotype, L6 muscle cells transfected with a miR-194 inhibitor had higher protein expression of several complexes of the mitochondrial oxidative phosphorylation (OXPHOS) chain, a proxy measure for mitochondrial volume. [score:3]
A negative correlation between miR-194 expression and the HOMA-IR also indicated an inverse association of this miR with insulin resistance. [score:3]
There was no effect on phosphorylation of these proteins by miR-194 inhibition under basal conditions. [score:3]
Moreover, we identified a negative correlation between homeostatic mo del assessment index of insulin resistance (HOMA-IR, reported in Table 1) and miR-194 expression levels (r = -0.69, p = 0.01 in humans, r = -0.65, p = 0.04 in rats, Fig 1C and 1D), indicating an association of miR-194 with insulin resistance. [score:3]
Measuring circulating miR-194 in the blood at different stages of the disease progression could inform on the potential of miR-194 as an early biomarker of diabetes, long before the onset of the disease. [score:3]
A role for miR-194 in type 2 diabetes has not yet been described in the literature; however, Zhang J. et al. showed a decreased hepatic expression of miR-194 in the adult offspring of high fat fed dams [29]. [score:3]
0155108.g005 Fig 5Expression of the oxidative phosphorylation (OXPHOS) complexes I to V of the electron transport chain was measured by western blot in L6 cells 48 hours after transfection with a miR-194 inhibitor. [score:3]
0155108.g004 Fig 4Expression of the phosphorylated and total forms of AKT (A) and GSK3β (B) were measured by Western blot in L6 cells 48 hours after transfection with a miR-194 inhibitor. [score:3]
Interestingly, the absence of further increase of lactate production when transfected cells are treated with insulin may indicate that the glycolytic rate within miR-194 inhibited cells is already operating at maximal capacity. [score:3]
Conversely, we observed that decreased expression of miR-194 for a short term (48 hours in vitro) is able to increase muscle mitochondrial oxidative capacity potential through increased mitochondrial OXPHOS. [score:3]
Differentiated L6 cells were transfected with either a miR negative control or miR-194 inhibitor. [score:3]
Taken together, our data suggest that the decrease in miR-194 expression observed in insulin resistant muscle is an adaptive response to facilitate tissue glucose uptake and metabolism in the face of insulin resistance. [score:3]
rates were unaffected by miR-194 inhibition under basal conditions, but in the presence of the mitochondrial uncoupler FCCP, cells had an increased oxidative capacity. [score:3]
A concentration of 100 nM proved optimal, giving robust and consistent efficacy inducing a 35 fold decrease in miR-194 expression in the cells (qPCR, data not shown). [score:3]
Considering glucose oxidation was assayed under basal conditions, it might be interesting to determine whether miR-194 inhibition can increase glucose oxidation under simulated nutrient excess. [score:2]
Basal or insulin-stimulated glucose uptake (A), glycogen synthesis (B) and lactate production (C) were assayed in L6 cells 48 hours after transfection with a miR-194 inhibitor. [score:2]
Under basal conditions, we found lactate production was significantly increased following miR-194 inhibition compared to control (9±4%, p<0.05, Fig 3C). [score:2]
Compared to control, miR-194 inhibition increased glycogen synthesis by 34±3% under basal conditions and 23±13% with insulin stimulation (p<0.05 for both, Fig 3B). [score:2]
MiR-194 expression in the skeletal muscle of mice fed a high fat diet. [score:2]
To further confirm down-regulation of miR-194 in the insulin resistant state, we measured its expression in skeletal muscle from mice fed a HFD for 8 weeks, a well characterized mouse mo del of insulin resistance [18]. [score:2]
To address the possible mechanisms by which miR-194 regulates glucose metabolism, we examined components of signaling pathways contributing to glucose metabolism. [score:2]
0155108.g003 Fig 3Basal or insulin-stimulated glucose uptake (A), glycogen synthesis (B) and lactate production (C) were assayed in L6 cells 48 hours after transfection with a miR-194 inhibitor. [score:2]
Inhibition of miR-194 induced a 53±8% increase in basal glucose uptake and a 40±20% increase in insulin-stimulated glucose uptake into the muscle cells compared to the transfection control (p<0.05 for both, Fig 3A). [score:2]
Knockdown of miR-194 in L6 skeletal muscle cells induced an increase in basal and insulin-stimulated glucose uptake and glycogen synthesis. [score:2]
Complexes I (NADH dehydrogenase, NDUFB8), II (succinate dehydrogenase, SDHB), IV (cytochrome c oxidase, MTCO1), and V (ATP synthase, ATP5A) were increased by between 30 to 85% (p<0.05) when miR-194 was inhibited compared to control (Fig 5). [score:2]
The results of this study reveal an important role of miR-194 in influencing glucose metabolism in association with the progression from insulin resistance to type 2 diabetes. [score:1]
Thus, reduced miR-194 may elevate glucose uptake and its incorporation into glycogen by activating AKT and inactivating GSK3 through phosphorylation. [score:1]
These data suggest a reduction in miR-194 may allow greater oxidation of substrate, specifically glucose, under periods of increased substrate supply or under metabolic stress where greater ATP turnover is required. [score:1]
Moreover, we measured miR-194 expression in the skeletal muscle of high fat fed mice with established insulin resistance [18] and also showed a 37% decrease in the skeletal muscle of these animals. [score:1]
Furthermore, in vitro experiments showed miR-194 is involved in glucose uptake, glycolytic breakdown and its incorporation into glycogen, as well as mitochondrial oxidative capacity through mechanisms involving modulation of AKT, GSK3 and oxidative phosphorylation complexes. [score:1]
We have shown miR-194 is involved in multiple aspects of skeletal muscle glucose metabolism from uptake, through to glycolysis, glycogenesis and glucose oxidation, potentially via mechanisms involving AKT, GSK3 and oxidative phosphorylation. [score:1]
A greater mitochondrial volume provides a likely explanation for the increase in oxidative capacity we observed in miR-194 silenced cells. [score:1]
[1 to 20 of 74 sentences]
6
[+] score: 208
The down-regulation of miR-194 increases its direct targeting of gene Sox5, and results in enhanced chondrogenic differentiation of hASCs, what is more, we found that MiR-194 was up-regulated and Sox5 was down-regulated in osteoarthritis. [score:13]
Consistent with the prominent role of Sox5 in the regulation of chondrogenesis, our results demonstrated that over -expression of miR-194 via pre-miR-194 precursor resulted in inhibition of hASCs chondrogenic differentiation, whereas inhibition of miR-194 enhanced chondrogenic differentiation. [score:8]
We demonstrated that miR-194 targets and suppresses the expression of SRY-related high mobility group-Box gene 5 (Sox5). [score:7]
0031861.g005 Figure 5 (A) Primary chondrocyte was treated by IL-1βfor 24 h, DMSO was added as control group, qRT-PCR showed that miR-194 was up-regulated, The relative gene expression alteration was demonstrated by percentage increase and (B)Western-blotting Assay showed that Sox5 was down-regulated compared with control group. [score:7]
This study revealed that miR-194 repressed Sox5 expression via its binding with imperfect complementation to the Sox5 mRNA 3′-UTR through translational inhibition. [score:7]
Previous reports have shown that miR-194 is highly up-regulated with great tissue specificity during intestinal epithelial differentiation, and that the expression pattern is controlled by HNF-1a [28]. [score:6]
It has also been reported that miR-194 is down-regulated in hepatic stellate cells during liver fibrogenesis, and that over -expression of miR-194 causes decreased stellate cell activation [29]. [score:6]
In this study, our findings indicated that miR-194 suppresses the chondrogenic differentiation of ASCs by directly targeting Sox5, a key transcriptional factor for chondrogenesis at the post-transcriptional level. [score:6]
Compared to the negative control group, hASCs transfected with pre-miR-194 demonstrated a significant decrease in the mRNA expression levels of chondrogenesis markers, whereas inhibition of endogenous miR-194 expression in hASCs by transfection of anti-miR-194, under the same induction conditions as above, resulted in enhanced chondrogenic differentiation as demonstrated by the significant increase in chondrogenesis markers at the mRNA level (Fig. 4). [score:6]
We found that miR-194 was up-regulated in the osteoarthritis group while Sox5 was down-regulated compared with control group (Fig. 5). [score:6]
To demonstrate whether miR-194 acts as an inhibitor of Sox5 protein expression, we transfected hASCs with pre-miR-194, anti-miR-194, and their negative control for 24 h, respectively, and then exposed the transfected cells to the chondrogenic differentiation medium that primarily consisted of TGF-β3. [score:5]
We performed miR microarray to detect the expression profile of miRs at three different stages during chondrogenic differentiation, including induction at 7 d, 14 d, and 21 d. We found that the expression of miR-194 significantly decreased during chondrogenic differentiation. [score:5]
The luciferase reporter analysis demonstrated that exogenous pre-miR-194 and anti-miR194 regulated the activity of luciferase when the miR-194 miRs regulatory element (MRE) from Sox5 3′-UTR was fused to luciferase, and that suppression was exhibited in a dose -dependent manner. [score:5]
We demonstrated the predicted target proteins for miR-194 using bioinformatic approaches, we found that one of the target proteins was Sox-5. Because Sox5 plays an essential role in chondrogenesis, we focused on the relationships among miR-194, Sox5, and chondrogenesis. [score:5]
Besides Sox5, there are many additional proteins that seem to be regulated by MiR-194 using TargetScan, among which we found that Sox6 is also a target for MiR-194. [score:5]
Dong et al suggested that miR-194 inhibits epithelial to mesenchymal transition (EMT) of endometrial cancer cells by targeting oncogene BMI-1 [31]. [score:5]
Subsequently, we predicted the target genes of miR-194 using Pictar and Targetscan [23], [24] (Fig. 1A). [score:5]
We observed that Sox5 was clearly the potential target gene regulated by miR-194. [score:4]
MiR-194 inhibits Sox5 expression during chondrogenic differentiation. [score:4]
Furthermore, down-regulation of miR-194 potentially exhibits a positive effect on chondrogenic differentiation. [score:4]
The hASCs prepared for miR-194 expression analysis were directly induced to chondrogenic differentiation. [score:4]
Consistent with the mechanisms of miRs regulation, both in gain- or loss-of function of miR-194 experiments, we found Sox5 differentially expressed at the protein level but not at the mRNA level. [score:4]
These results suggest that miR-194 potentially regulates Sox5 expression by binding the MREs within the Sox5 3′-UTR, and prompted us to investigate whether miR-194 affects chondrogenesis via targeting of Sox5. [score:4]
These data indicate that miR-194 can suppress expression of transcripts containing a miR-194 -binding site according to our luciferase reporter assay analysis. [score:4]
Because of the principal role played by Sox5 in the process of MDSC differentiation into chondrocytes, we hypothesized that Sox5 may be inhibited by miR-194, which prevents ASCs from differentiating into chondrocytes. [score:3]
These results revealed that modulation of miR-194 affected the expression of genes related to chondrocytes after induction for 7 d and 14 d. However, the difference decreased at day14 (data not shown). [score:3]
The relative expression level of miR-194 in untreated hASCs (0 d) was acted as control. [score:3]
The results implied that MiR-194 and Sox5 were deregulated during osteoarthritis, and they are likely to be target for osteoarthritis therapy. [score:3]
These results indicated that miR-194 potentially represses the protein expression whereas the mRNA level remains undisturbed. [score:3]
The results confirmed that expression levels of miR-194 gradually decreased during ASC chondrogenesis (Fig. 1B). [score:3]
Following induction, the decrease in expression of miR-194 allows for the positive effect on chondrogenesis of Sox5, thereby facilitating chondrogenic differentiation. [score:3]
Differential expression of miR-194. [score:3]
Sox5 is a target of miR-194. [score:3]
Differential Expression of miR-194 during hASCs chondrogenic differentiation. [score:3]
What is more important, we found that MiR-194 was elevated in IL-1β induced osteoarthritis, and it is accompanied by decreased expression of Sox5. [score:2]
To determine if miR-194 targets Sox5, we applied the luciferase reporter gene assay using the pMIRREPORT Luciferase reporter. [score:2]
Sox9 is reported to be an early determinant during chondrogenesis, however, it is not predicted to be one of MiR-194's targets, so the results implied that MiR-194 might play important role during late chondrogenesis. [score:2]
We further asked whether the expression of miR-194 is in accordance with Sox5 in osteoarthritis, we treated primary chondrocyte with IL-1βfor 24 h and the total RNA and protein was collected for qRT-PCR and Western-blotting Assay. [score:2]
Using miR microarray analysis, we demonstrated that miR-194 gradually decreased during chondrogenesis of ASCs, the differential expression pattern was confirmed by qRT-PCR assay. [score:2]
MiR-194 inhibits early chondrogenic differentiation. [score:2]
miR-194 regulates chondrogenic differentiation of hASCs. [score:2]
Thus, we performed the qRT-PCR assay to validate the expression pattern of miR-194. [score:2]
MiR-194 represses the expression of Sox5 at protein level during chondrogenic differentiation. [score:2]
Sox5 is a target of MiR-194. [score:2]
We further explored whether miR-194 exhibited an effect on chondrogenic differentiation: we transfected pre-miR-194, anti-miR-194, and their negative control into hASCs, we used 15 pmol in all experiments. [score:1]
The Sox5 3′-UTR contains one putative miR-194 binding site which is bound with imperfect complementation. [score:1]
The sense and anti-sense strands of the oligonucleotides of the Sox5-3′-UTR containing the miR-194 binding site were synthesized, annealed, and then subcloned into the pMIR-REPORT vector. [score:1]
0031861.g001 Figure 1 (A) Bioinformatics study shows that miR-194 sequence is partially complementary to the 3′-UTR of Sox5 mRNA. [score:1]
Meng et al found that miR-194 is a hepatocyte-specific marker in the liver and plays a role in EMT and HCC metastasis [30]. [score:1]
The Sox5-3′-UTR-miR194 or control plasmid was transfected into the HEK293 stable cell line using Lipofectamine 2000 (Invitrogen, Eugene, OR, USA). [score:1]
MiR-194 is thought to regulate cell differentiation in the gastrointestinal tract. [score:1]
Next, we further analysed the functional relevance of miR-194, Pre-miR-194 and anti-miR-194 were designed as described previously [22]. [score:1]
Our results suggest that miR-194 is a key mediator during chondrogenic differentiation via elimination of the effect of transcription factor Sox5. [score:1]
For gain- or loss-of-function analysis, hASCs were transfected with pre-miR-194, anti-miR-194, or their negative controls before chondrogenic differentiation and after transfection and incubation for 24 h. High density micromass regions were used for chondrogenic differentiation culture. [score:1]
We further demonstrated that differentiation of ASCs can be controlled by miR-194 through gain- or loss-of-function experiments. [score:1]
0031861.g002 Figure 2 (A) Different doses of pre-miR-194 were co -transfected with the specific pMIR-REPORT construct into HEK293 cells. [score:1]
We co -transfected the Sox5-3′-UTR-miR194 reporter plasmid into HEK293 cells with pre-miR-194 or its control pre-miR, and we found that luciferase activity was significantly decreased in the HEK293 cells transfected with pre-miR-194, and that the effect was dose -dependent (Fig. 2A). [score:1]
This result again proved our hypothesis that MiR-194 regulates chondrogenesis. [score:1]
miR-194 is in accordance with Sox5 in osteoarthritis. [score:1]
In this study, we found that miR-194 levels gradually decreased during chondrogenic differentiation of ASCs. [score:1]
In conclusion, our study demonstrates that miR-194 is decreased during chondrogenic differentiation of hASCs. [score:1]
To our knowledge, this is the first study to demonstrate the critical role of miR-194 in hASC chondrogenesis and osteoarthritis, and it may provide novel insight toward potential cell manipulation improvements during cartilage regeneration. [score:1]
We also found that miR-194 and Sox5 play a role in osteoarthritis. [score:1]
Computational algorithms predicted that miR-194 binds to Sox5 3′-UTR with imperfect complementation, suggesting that it potentially does not degrade Sox5 mRNA. [score:1]
0031861.g004 Figure 4 (A) hASCs were transfected with pre-miR-194 or their control respectively. [score:1]
We transfected the pre-miR-194, anti-miR-194, or their negative controls into hASCs in 6-well plates (10 [5] cell per well) with 5 ul siPORT NeoFX transfection agent (Ambion, Austin, TX,USA) following the manufacturer's instructions. [score:1]
0031861.g003 Figure 3 (A) hASCs were transfected with pre-miR-194, anti-miR-194 or their control respectively. [score:1]
[1 to 20 of 67 sentences]
7
[+] score: 196
Further, ectopic expression of miR-194 also augmented E-cadherin expression and lowered AKT2 expression by targeting 3′UTR of AKT2. [score:9]
Maximal suppression of SPRY2 in clone 7522 resulted in a more than twofold upregulation of miR-194-5p, -4423 and -3925 and downregulation of miR-21 and −491 (corresponding to at least ±1.0  log fold change) (Supplementary Table 1). [score:9]
SPRY2 and miR-194 -dependent suppression of AKT2 and other repressors of E-cadherin may account for upregulation of E-cadherin and inhibition of cancer cell migration and invasion. [score:8]
[19] We, therefore, extended our studies to assess E-cadherin repressors such as SNAIL1 and SNAIL2 that are not the direct targets of miR-194 as predicted by miR databases (picTar, miRanda and TargetScan). [score:6]
Further, SPRY2 downregulation had no significant effect on miR-194-3p expression levels in cancer cells (Supplementary Figure S2). [score:6]
The miR-194 -dependent downregulation of AKT2 and SNAILs may account for increased expression of E-cadherin in these studies. [score:6]
In the present study, increased miR-194 expression in SPRY2 -downregulated cells may indicate increased cancer cell differentiation. [score:6]
Collectively, above results demonstrate that SPRY2 suppression by two different methods significantly upregulated miR-194-5p contents of colon cancer cells. [score:6]
In miR-194 -transfected cells, downregulation of E-cadherin repressors other than AKT2 may represent an indirect regulation of E-cadherin repressors by miR-194 without any involvement of 3′UTR of these genes. [score:6]
[35] SPRY2 -dependent regulation of E-cadherin is the end-organ effect of reduction of both direct and indirect targets of miR-194. [score:6]
demonstrate that miR-194 also affects targets, other than AKT2, by direct or indirect mechanisms involved in E-cadherin induction. [score:5]
To further confirm that SPRY2 suppression affects miR-194-5p expression levels, HCT116 and SW480 cells were transiently transfected with SPRY2 siRNA. [score:5]
Collectively, data indicate that miR-194 may inhibit EMT by increasing expression and membrane localization of E-cadherin and partial association of E-cadherin with AKT2. [score:5]
In order to confirm SPRY2's role on miR-194 -induced regulation of E-cadherin, we assessed E-cadherin induction during SPRY2 downregulation alone or in combination with miR-194 transfection (Figure 2d). [score:5]
Hypermethylation of this cluster promoter and epigenetic downregulation of miR-194 has been suggested in multiple myeloma. [score:4]
MiR-194 mimics significantly increased E-cadherin expression in HCT116 (4.1-fold, P<0.05) and SW480 cells (5.3-fold, P<0.05), whereas miR-194 inhibitor reduced E-cadherin levels in HT29 cells (>70%, P<0.05) as compared with control transfections (Figure 2c). [score:4]
AKT2 is a direct target of miR-194. [score:4]
A complete reversal of E-cadherin induction indicates that miR-194 is a major downstream effector of SPRY2 -dependent upregulation of E-cadherin (Figure 2e). [score:4]
To test whether AKT2 is a direct target gene of miR-194, we used a dual luciferase reporter, which has a conserved sequence of mRNA that is complimentary to the seed sequence of miR-194. [score:4]
[25] Suppression of SPRY2 may positively regulate various transcription factors that bind to promoter for increased miR-194 transcription. [score:4]
We identified that knockdown of SPRY2 expression increases miR-194-5p contents in colon cancer cells. [score:4]
A significant downregulation of SNAILs was also observed in miR-194 mimic -transfected HCT116 cells (Supplementary Figure S7). [score:4]
To further confirm miR-194's role on AKT2's induced upregulation of E-cadherin, we assessed E-cadherin induction with siAKT2 or miR-194 transfection or in combination (Figure 3f). [score:4]
Other intracellular factors may also regulate miR-194 expression in CRC. [score:4]
As discussed above, SPRY2 downregulation significantly increased miR-194-5p levels, altered cancer cell morphology and decreased cell migration and invasion. [score:4]
For example, methylation of miR-194-2 and -192 cluster promoter regulates miR-194 expression in cancer cells. [score:4]
We further validated our results by confocal microscopy and demonstrated a significant upregulation and redistribution of E-cadherin in miR-194 -transfected HCT116 (Figure 4a) and SW480 (Figure 4b) cells. [score:4]
Suppression of SPRY2 also decreased AKT2 expression though to a lesser extent when compared with miR-194 effects (>40%, P<0.05) (Figure 3b). [score:4]
[26] Hepatocyte nuclear factor has been reported to induce miR-194 expression during intestinal epithelial cell differentiation. [score:3]
[24] An increased miR-194 expression in differentiating Caco-2 colon cancer cells has been reported. [score:3]
MiR-194-5p levels were significantly upregulated (threefold, P<0.05) in HCT116 and SW480 cells (Figure 2a). [score:3]
22, 23 Reduced miR-194 expression was noted in CRC. [score:3]
Inverse correlation of miR-194-5p with SPRY2 expression. [score:3]
Several genes of interest were predicted by the search programs of miRanda and TargetScan, and the effect of miR-194 on Talin2, SOX5, Musashi, AKT2, Rac1, HBEGF and IGF-1 R was tested by quantitative real-time (RT–PCR) and western blotting (Supplementary Figure S6). [score:3]
The role of miR-194 has been analyzed in normal and malignant cells of the gastrointestinal tract as high levels of miR-194 are expressed in the intestine and liver. [score:3]
Therefore, in subsequent experiments HCT116 and SW480 cells were used for miR-194 mimic transfection, whereas HT29 cells were used for miR-194 inhibitor experiments. [score:3]
Thus regulation of miR-194 by SPRY2 and suppression of AKT2 and other EMT markers by miR-194 could be considered as a potential anticancer therapeutic strategy. [score:3]
In this study, we provided the experimental evidence that SPRY2 regulates miR-194. [score:2]
The results demonstrate that miR-194 may negatively regulate AKT2 posttranscriptionally in HCT116 and SW480 cells. [score:2]
Furthermore, combination of siAKT2 and miR-194 accentuated E-cadherin expression when compared with siAKT2 or miR-194 responses alone (Figure 3f). [score:2]
Further, miR-194 transfection also induced E-cadherin expression to a greater extent as compared with siAKT2 response only. [score:2]
In summary, studies demonstrate a significant role of miR-194 in negative regulation of EMT in CRC. [score:2]
Cancer cells were transfected with miR-control or miR-194 mimics, and transfection was confirmed by increased miR-194 levels as assessed by RT–PCR (Supplementary Figure S9). [score:1]
Cells were co -transfected with miR-194 plasmid or empty vector and AKT2 wild-type 3′UTR or AKT2 mutant 3′UTR. [score:1]
Mir-194 -dependent regulation of AKT2 has been recently demonstrated. [score:1]
MiR-194 is transcriptionally regulated in intestinal epithelial cells. [score:1]
In miR-194 -transfected cells, the immunoreactive E-cadherin appears in small vesicles that have a tendency to concentrate in the cell periphery in the area of plasma membrane. [score:1]
Mir-194 precursor is processed into miR-194-5p and miR-194-3p. [score:1]
Conversely, the luciferase activity of the mutant reporter was not affected in response to miR-194 plasmid treatment (Figure 3c). [score:1]
Mir-194-5p is the major mature form of miR-194. [score:1]
Briefly, cells were seeded in six-well plates, co -transfected with miR-194 precursor vector (p-CMV-miR-194) or empty vector control (Origene, Rockville, MD, USA) and a wild-type AKT2 3′UTR reporter construct (pmiR-GLO-AKT2-3′UTR) or pmir-GLO-AKT2-3′UTR mutant or empty vector with the firefly luciferase reporter and the control vector Renilla luciferase, pRL-TK (Promega, Madison, WI, USA) using lipofectamine 2000 following the manufacturer's protocol. [score:1]
[20] However, miR-194 transfection moderately increased the association of AKT2 with E-cadherin on the cell membrane, but no nuclear translocation of AKT2 was noted. [score:1]
[15] We focused our investigation on miR-194, because this is mainly expressed in the gastrointestinal tract. [score:1]
The highest efficiencies of miR-194 transfection were achieved at 96 h posttransfection at 100 n m final concentration (data not shown). [score:1]
We then investigated endogenous contents of miR-194-5p in three different colon cancer cell lines that express different levels of SPRY2. [score:1]
HCT116 and SW480 cancer cells have significantly lower contents of miR-194-5p than HT29 cells (Supplementary Figure S3). [score:1]
MiR-194 negatively regulates EMT and colon cancer cell migration and invasion. [score:1]
[1 to 20 of 57 sentences]
8
[+] score: 181
As shown in Figure 2e, miR-194 downregulated TRAF6 protein expression, while miR-194 inhibitor upregulated TRAF6 (Figure 2f). [score:11]
Meanwhile, miR-194 inhibitor upregulated TRAF6 expression and promoted TNF-α expression. [score:10]
Our study demonstrates that PA activates the TLR4 signal pathway, upregulates a key molecule TRAF6 and cytokines TNF-α and TGF-β, and also downregulates miR-194 expression in THP-1 monocytic cells. [score:9]
In our study, miR-194 downregulated by PA and rescuing miR-194 decreased TNF-α expression through targeting TRAF6. [score:8]
These results suggest that after PA stimulation, downregulated miR-194 results in TRAF6 (a key molecule in the TLR4 pathway) overexpression and further mediates downstream cytokine expression. [score:8]
Our results showed that miR-194 attenuated PA -induced cytokine TNF-α release through suppressing a key molecule TRAF6 in the TLR4 pathway, and both miR-194 and TRAF6 are thus potential targets in the developing therapy strategy for PA-related disease. [score:7]
Palmitic AcidSuppresses miR-194 Expression Which Targets TRAF6. [score:7]
Figure 2PA induces miR-194 downregulation and miR-194 directly targets TRAF6 in THP-1cells. [score:7]
Recent studies found that miR-194 was downregulated in fibrosis, and more importantly, rescuing miR-194 decreased stellate cell activation through targeting rac1 [31]. [score:6]
According to Figure 2d, miR-194 suppressed luciferase expression which evaluated by PA, meanwhile miR-194 inhibitor enhanced luciferase expression compared with control. [score:6]
Venugopal S. K. Jiang J. Kim T. H. Li Y. Wang S. S. Torok N. J. Zern M. A. Liver fibrosis causes downregulation of miRNA-150 and miRNA-194 in hepatic stellate cells, and their overexpression causes decreased stellate cell activation Am. [score:6]
MiR-194 decreased TNF-α expression through targeting TRAF6 but had no effect on TGF-β expression. [score:6]
We also found that TRAF6 was a target gene for miR-194 which attenuates PA -induced TRAF6 upregulation and cytokine TNF-α release. [score:6]
Taken together, based on the PA-activated TLR4 pathway, we found miR-194 inhibited the TLR4 pathway through targeting a key signal molecule TRAF6. [score:5]
We transfected miR-194 mimic and its control into THP-1 cells for 24 h followed by PA stimulation, detecting TNF-α and TGF-β levels through ELISA after 8 h. As shown in Figure 3a,c, PA induced TNF-α and TGF-β release, while miR-194 mimic suppressed the cytokine expression. [score:5]
MiR-194 directly target TRAF6, which could influence downstream cytokine expression such as TNF-α and TGF-β [19]. [score:5]
In order to investigate miRs which could regulate the TLR4 pathway, we detected some miR expression and found miR-194 downregulation after PA stimulation in THP-1 cells (Figure 2b). [score:5]
Both miR-194 and TRAF6 are therefore potential targets that can contribute to the therapy strategy of PA-related diseases. [score:5]
In order to further verify the miR-194 target TRAF6, we transfected miR-194 or miR-194 inhibitor into THP-1 and detected the TRAF6 protein level. [score:5]
Meanwhile, we also found miR-194 inhibitor enhanced TNF-α expression compared with the negative control but had no obvious effects on TGF-β release (Figure 3b,d). [score:4]
Gene Sequence of Primer (5′ to 3′) GAPDH Forward, ACTTCAACAGCGACACCCACTC Reverse, TCTCTCTTCCTCTTGTGCTCTTGC TLR4 Forward, GGTGATTGTTGTGGTGTCCCA Reverse, AGTGTTCCTGCTGAGAAGGCG TRAF6 Forward, GCTTTCCAGCGACCCACA Reverse, CCCTCCGAAGGCTACCCAT TNF-α Forward, CCCTCAGCAAGGACAGCAGA Reverse, AGCCGTGGGTCAGTATGTGAGA TGF-β Forward, GCAAGTGGACATCAACGGG Reverse, CGCACGCAGCAGTTCTTCT miR-194 Forward, GCCCGCTGTAACAGCAACTCCAT Reverse, GTGCAGGGTCCGAGGT THP-1 cells were cultured in a 12-well culture plate at a density of 2×10 [5] cells per well for 24 h, the cells were then transfected with 20 nM miR-194 mimic, miR-194 inhibitor and negative controls (GenaPharma, Shanghai, China) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions for 48 h. After stimulation with 250 μM Palmitic acid, cells were lysed in 1%Nonidet P-40 lysis buffer (50 mM HEPES, pH 7.4, 150 mM NaCl, 2 mM EDTA, 1%Nonidet P-40, and protease inhibitors). [score:4]
The results reveal that PA -induced TLR4 activating can be negatively regulated by miR-194 which targets TRAF6, a crucial molecular in the TLR4 pathway. [score:4]
All of these results indicated that miR-194 directly target TRAF6. [score:4]
Then miR-194 mimic or inhibitor and their control respectively co -transfected with the plasmid pGL3-CM-TRAF6 into THP-1 cells. [score:3]
Taken together, our results indicate that miR-194 attenuates TLR4 signaling pathway via targeting TRAF6 during PA stimulation in THP-1 cells. [score:3]
The THP-1 cells were co -transfected with the miR-194 mimics/inhibitor (or their controls) and constructed pGL3-CM vectors using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. [score:3]
org/) analysis we found TRAF6 is one of the prediction targets of miR-194 (Figure 2a). [score:3]
At the same time, there was no significant difference between the normal group and miR-194 inhibitor group in our results. [score:3]
Therefore, miR-194 can be developed as a potential target for intervention of inflammation response caused by free fatty acids. [score:3]
Targets of miR-194 were predicted through software based on seed sequence complementarity. [score:3]
Most studies about miR-194 focus on tumor suppression. [score:3]
During our experiment, we found miR-194 inhibitor transfection has negative effects on cell growth. [score:3]
3.3. miR-194 Inhibit the TLR4-Related Cytokine Production. [score:3]
Constructed luciferase reporter plasmid and miR-194 mimics were co -transfected into THP-1cells for 24 h and then exposed to 250 μM PA for 8 h. All of these whole-cell extracts were prepared for luciferase assay; (e, f) THP-1 cells were transfected with miR-194 mimics or its control for 24 h and followed 250 μM PA stimulation for 8 h. miR-194 inhibitor and its control were transfected into THP-1 for 32 h. All the above whole-cell extracts were collected for Western blot analysis. [score:2]
It suggests that the regulation of miR-194 in TLR4 is limited and interactions of the intracellular signaling pathways are complex. [score:2]
We used the luciferase report system to identify the direct relationship between miR-194 and TRAF6. [score:2]
As a TLR4 common downstream cytokine, TNF-α was decreased by miR-194. [score:1]
THP-1 cells were transfected with miR-194 mimics, inhibitor, their control for 24 h and followed 250 μM PA exposure for 8 h. Supernatants were collected to measure TNF-α and TGF-β by ELISA. [score:1]
[1 to 20 of 38 sentences]
9
[+] score: 118
These results indicated that inhibition of miR-194 and -515 during IL-1β and TNF-α stimulation can indeed rescue the downregulated expression of CHSYs, which indicated a vital role of miR-194 and -515 in the IL-1β and TNF-α modulated CHSYs expression. [score:10]
With the addition of miR-194 and -515 inhibitors, protein expression of CHSYs upregulated significantly, while mRNA level remain unchanged (Figure 6B–6C). [score:8]
Figure 6Real-time PCR and Western blot analysis showing the expression level of CHSY-1, -2 and -3 under TGF-β (A), IL-1β (B), TNF-α (C) treatment combined with miR-194, -515 or control miRNA mimic overexpression (A) or inhibition (B-C). [score:7]
Taken together, we found that IDD upregulated and IL-1β/TNF-α stimulated miR-194 and -515 could affect the protein translation of CHSY-1, -2 and -3 through direct binding to their 3′UTR. [score:7]
Using qPCR, we found that miR-194 and miR-515 were highly upregulated after cytokine stimulation (Figure 5C), indicating miR-194 and -515 may take vital roles in IL-1β and TNF-α modulated CHSYs expression. [score:6]
Now that we know miR-194 and -515 could affect CHSYs expression directly, however, their roles in IL-1β and TNF-α modulated CHSYs expression is not known. [score:6]
We found that miR-194 and -515 can indeed reduce the upregulated CHSYs expression at protein level, while showed no significance in mRNA level (Figure 6A). [score:6]
By directly overexpressing miRNA mimics, we found that the mRNA level of CHSYs did not change significantly except for miR-194 overexpression group (Figure 5D). [score:6]
However, the western results showed significant downregulation in both miR-194 and -515 overexpression groups, which is consistent with that of IL-1β and TNF-α treatment (Figure 5D). [score:6]
The blue squares represent miR-194 targeted sites, while red square represents miR-515 targeted sites. [score:5]
The right panel shows the relative protein level of CHSYs, the quantification of gray scale were shown under the blot, n = 3. (A) Immunofluorescence images of CS in NP cells treated with 10 ng/ml TGF-β and miR-194 or miR-515 or scramble miRNA mimic control for 72 h. (B) Immunofluorescence images of CS in NP cells treated with 20 ng/ml IL-1β and miR-194 or miR-515 inhibitors or scramble control inhibitor for 72 h. The quantifications of relative intensity were shown in the right panel. [score:5]
To our expect, miR-194 and -515 treatment significantly halted the upregulation of mean cellular CS concentration stimulated by TGF-β (Figure 7C), while their inhibition increased the mean cellular CS concentration compared with IL-1β and TNF-α treatment (Figure 7D–7E). [score:5]
Figure 7(A) Immunofluorescence images of CS in NP cells treated with 10 ng/ml TGF-β and miR-194 or miR-515 or scramble miRNA mimic control for 72 h. (B) Immunofluorescence images of CS in NP cells treated with 20 ng/ml IL-1β and miR-194 or miR-515 inhibitors or scramble control inhibitor for 72 h. The quantifications of relative intensity were shown in the right panel. [score:5]
Through mechanism study, we showed that IL-1β and TNF-α stimulated microRNA-194, -515 expression can significantly reduce CHSY expression and thus lower CS biosynthesis. [score:5]
MiR-194 and miR-515 is essential for inflammatory cytokine regulated CHSY expressions. [score:4]
IL-1β and TNF-α stimulated miR-194 and -515 target CHSYs in human NP cells. [score:3]
Next, we use miRNA antisense inhibitors to eliminate the function of endogenous miR-194 and -515 to test their roles in IL-1β and TNF-α stimulation. [score:3]
On the other hand, inhibition of miR-194 and -515 significantly rescued the diminished CS Immunofluorescence caused by IL-1β and TNF-α stimulation (Figure 7B, Supplementary Figure 1C). [score:3]
Till now, we found that miR-194 and -515 can indeed affect the CS content synthesized by NP cells, and the mechanism of which is related to IL-1β and TNF-α modulated CHSYs expression. [score:3]
The right panel shows the relative protein level of CHSYs, the quantification of gray scale were shown under the blot, n = 3. (E) A list of target sites of miR-194 and -515 in CHSYs mRNA. [score:3]
However, in our study, we proved that miR-194 and -515 is the key mediator between inflammatory cytokines and CS synthesis which demonstrated a new regulatory circuitry in IDD pathogenesis, and also gave evidence that microRNAs are also important regulators in intervertebral disc degeneration. [score:3]
Here we first confirmed the regulation ability of miR-194 and -515 in TGF-β stimulated NP cells. [score:2]
MiR-194 and -515 are responsible for IL-1β and TNF-α modulated CHSYs expression in degenerated NP. [score:2]
Effects of miR-194, -515 on inflammatory cytokines modulated chondroitin sulfate content in human NP cells. [score:1]
As expected, results showed that miR-194 and -515 significantly decreased the luciferase activities of CHSY-1, -2 and -3 (Figure 5F), while no significant changes were observed using mutant reporters (Figure 5G). [score:1]
The right panel shows the relative protein level of CHSYs, the quantification of gray scale were shown under the blot, n = 3. Next we examined whether CS content is affected by miR-194 and -515. [score:1]
We found that miR-194 decreases the protein level of CHSY-1, -2, -3, but not the mRNA level. [score:1]
The right panel shows the relative protein level of CHSYs, the quantification of gray scale were shown under the blot, n = 3. Next we examined whether CS content is affected by miR-194 and -515. [score:1]
[1 to 20 of 28 sentences]
10
[+] score: 74
Other miRNAs from this paper: hsa-mir-194-2
Western blot analysis showed that ectopic expression of miR-194 in Hep-2 and KB-3-1 cells obviously downregulated the protein levels of Wee1 as well as the known targets XIAP and p27 [3, 6] (Fig.   2a). [score:8]
All three algorithms predicted Wee1 as a target gene of miR-194, which is a protein kinase to regulate cell cycle through inhibiting CDK1 by phosphorylation on its two different residues Thr14 and Tyr15 [5]. [score:6]
i Kaplan–Meier analysis of overall survival and disease-free survival curves for LSCC patients with high and low expression of miR-194. [score:5]
We used three computational algorithms, including miRanda, PITA, and TargetScan in combination to identify the novel potential targets of miR-194. [score:5]
In addition, ectopic expression of Wee1 partially reverses the suppressive effects of miR-194 on LSCC cells (Additional file 1: Figure S4a–g). [score:5]
The predicted interaction between miR-194 and the target sites within the 3’-untranslated regions (3’UTR) of Wee1 was shown in Fig.   2b. [score:5]
The data in the subcutaneous tumor mo del in nude mice revealed that overexpression of miR-194 significantly inhibited the growth of Hep-2 and KB-3-1 xenografts by the numbers of Ki67 [+] proliferating cells and CD31 [+] microvessels (Additional file 1: Figure S3a–d). [score:5]
Fig. 1Downregulation of miR-194 in LSCC is correlated with T stages, lymph node metastasis, clinical stages, recurrence, and poor prognosis. [score:4]
Functional assays showed that enforced expression of miR-194 inhibits the growth, migration, invasion, and drug resistance of Hep-2 and KB-3-1 cells in vitro (Additional file 1: Figure S2a–g). [score:4]
As one of frequently deregulated miRs in cancer, the expression and role of miR-194 in LSCC are still unknown [3, 4]. [score:4]
a RT-qPCR analysis of the relative miR-194 expression in 44 pairs of LSCC tissues and adjacent normal tissues with Student’s t test. [score:3]
Kaplan–Meier analysis indicated that high miR-194 expression predicts a favorable outcome for LSCC patients (Fig.   1i). [score:3]
The relative miR-194 expression in three groups of LSCC tissues classified by differentiation (d) and primary location (e) were analyzed with Kruskal–Wallis test. [score:3]
As illustrated in Fig.   2c, ectopic expression of miR-194 significantly decreased the luciferase activity of wild type 3’UTR, but not mutant 3’UTR in Hep-2 and KB-3-1 cells, suggesting that the putative miRNA binding sites of Wee1 are responsible for this miRNA-mRNA interaction (Additional file 1: Figure S1b). [score:3]
The relative miR-194 expression in two groups of LSCC tissues classified by age (b), T stage (c), lymph node metastasis (f) and clinical stage (g) were analyzed with Mann-Whitney U test. [score:3]
h ROC curve analysis of the discrimination between LSCC tissues and adjacent normal tissues by miR-194. [score:1]
In the current study, we found that the expression level of miR-194 is significantly lower not only in two LSCC cell lines Hep-2 and KB-3-1 compared with normal human bronchial epithelial cell line 16HBE but also in clinical LSCC tissues compared with adjacent normal tissues and correlated with T stage, lymph node metastasis, and clinical stage, but not with age, tumor grades, and tumor primary locations (Fig.   1b–g, 1: Figure S1a and Table S1). [score:1]
Furthermore, analysis of proteins extracted from Hep-2 and KB-3-1 subcutaneous tumors in mice exhibited that the protein levels of Wee1 in miR-194-transduced tumors were remarkably lower than those in vector control (Fig.   2d). [score:1]
The miR-194 levels could be a significant parameter to distinguish LSCC and adjacent normal tissues with an area under the ROC curve (AUC) of 0.676 (sensitivity = 63.64%, specificity = 72.72%; P = 0.004) (Fig.   1h). [score:1]
Our study provides new sights into the role of miR-194/Wee1 axis in LSCC and suggests a novel miR-194/Wee1 -based clinical application for LSCC patients. [score:1]
The clinical results indicate that miR-194 can be the potential diagnostic and prognostic biomarkers for LSCC. [score:1]
We then performed luciferase assay to examine whether there is a direct interaction between miR-194 and Wee1. [score:1]
b A schematic diagram of the reporter constructs showed the wild type (Wt) and mutant (Mut) sequences of the miR-194 binding sites within human Wee1 3’-UTR. [score:1]
[1 to 20 of 23 sentences]
11
[+] score: 72
Moreover, miR-194 has been shown to suppress metastasis in non-small lung cancer through suppression of TGFβ activity via suppression of bone morphogenetic protein 1 (BMP1) as well as suppression of cyclin -dependent kinase inhibitor 1B (CDKN1B), which controls the cell cycle [33]. [score:11]
Furthermore, we found a significant upregulation of miR-19, miR-192, miR-194, and miR-215 in the tumor compartment of the lung metastases and a significant downregulation of the same miRNAs in the liver metastases. [score:7]
These contradictory results could be explained by the 1000-fold and 300-fold downregulation of miR-192, miR-194, and miR-215 in the host tissue of the lung compared to the liver, thus resulting in a relative upregulation in the tumor and stroma compartment. [score:6]
In the host tissue of the liver metastases, we identified several miRNAs with significant correlations between expression and survival: downregulation of miR-125 (p = 0.05), miR-127 (p = 0.001), miR-145 (p = 0.005), miR-192 (p = 0.015), miR-194 (0.003), miR-199-5 (p = 0.008), miR-215 (p < 0.001), and miR-429 (p = 0.03) was associated significantly with poor survival (Table 4). [score:6]
Downregulation of miR-125 (p = 0.05), miR-127 (p = 0.001), miR-145 (p = 0.005), miR-192 (p = 0.015), miR-194 (p = 0.003), miR-199-5 (p = 0.008), miR-215 (p < 0.001), and miR-429 (p = 0.03) in the normal liver tissue was significantly associated with poor survival, suggesting oncosuppressive effects of these miRNAs. [score:6]
miR-194 showed a 2-fold upregulation in the tumor compartment of the liver metastases compared to the stroma compartment and a 3-fold upregulation compared to the normal liver tissue (p < 0.0001). [score:5]
In the lung metastases, miR-194 showed an almost 4-fold upregulation in the tumor compartment compared to the stroma compartment (p < 0.0001) and a more than 700-fold upregulation compared to normal lung tissue (p < 0.0001). [score:5]
Our results show a downregulation of miR-192, miR-194, and miR-215 in the tumor and the tumor -associated stromal compartment of the liver metastases. [score:4]
Sundaram P. Hultine S. Smith L. M. Dews M. Fox J. L. Biyashev D. Schelter J. M. Huang Q. Cleary M. A. Volpert O. V. p53-Responsive miR-194 Inhibits Thrombospondin-1 and Promotes Angiogenesis in Colon Cancers Cancer Res. [score:3]
Noteworthy, miR-215, miR-194, and miR-192 showed a more than 100-fold upregulation in the normal liver tissue compared to the normal lung tissue. [score:3]
miR-194 is expressed in the liver parenchyma and can prevent metastasis [32]. [score:3]
miR-194 showed a 1.5-fold; miR-125, miR-127, and miR-192 showed a 2.5-fold; miR-19 and miR-215 a 3-fold; miR-145, miR-199-3, and miR-429 a 5-fold; miR-21 a 7-fold; and miR-199-5 a 12.5-fold downregulation in the liver metastases compared to the lung metastases. [score:3]
miR-125 and miR-199-5 showed a 2-fold; miR-19 and miR-127 showed a 4-fold; miR-215 showed a 100-fold; miR-194 showed a 150-fold; and miR-192 showed a 300-fold upregulation in the normal liver tissue compared to the normal lung tissue. [score:3]
Especially miR-192, miR-194, and miR-215 were downregulated up to 350 times in the lung metastases compared to the liver metastases. [score:3]
The miRNAs miR-192 and miR-194 are collocated on the miR-192/miR-194-2 cluster on chromosome 11 (11q13.1). [score:1]
miR-194 and miR-215 are situated in the miR-215/miR-194-1 cluster on chromosome 1 (1q41). [score:1]
miR-192, -194 and -215 are located in the miR-215/miR-194-1 cluster on chromosome 1 (1q41) and the miR-192/miR-194-2 cluster on chromosome 11 (11q13.1). [score:1]
The final selection of miRNAs for further analysis consisted of 11 miRNAs: miR-19b, miR-21, miR-125b, miR-127-3p, miR-145, miR-192, miR-194, miR-199a-3p, miR-199a-5p, miR-215, and miR-429. [score:1]
[1 to 20 of 18 sentences]
12
[+] score: 68
The qRT-PCR analysis indicated that 2 miRNAs (miR-21 and miR-133b) were deregulated in both EAC and GC, and 6 miRNAs (up-regulated: miR-194, miR-31, miR-192, and miR-200a; down-regulated: miR-203 and miR-205) in EAC, as compared to BE but not in GC, indicating their potential unique role in EAC. [score:7]
We showed the up-regulation of miR-194, miR-192, miR-21, miR-31, and miR-200a (Figure 2, Table 3) and the down-regulation of miR-133b, miR-203, and miR-205 in EAC as compared to BE (Figure 3, Table 3). [score:6]
Our results indicating up-regulation of miR-21, miR-192, and miR-194 are consistent with previous reports on the miRNA expression profile in EAC [12], [25]. [score:6]
While miR-194, miR-192, and miR-200a were significantly up-regulated in EAC, they also displayed an interesting pattern with disease progression. [score:6]
We found that 2 miRNAs (miR-192, and miR-194) were up-regulated and 3 miRNAs (miR-205, miR-203, and miR-31) were down-regulated in BE as compared to NS (Figures 2 and 3). [score:6]
Our validation confirmed the up-regulation of miR-194, miR-192, miR-21, and miR-200a, and the down-regulation of miR-203, miR-205, miR-133b, and miR-31 in EAC as compared to NS. [score:6]
Our data showed that miR-194, miR-192, miR-21, and miR-31 were up-regulated in BE adjacent to HGD lesions relative to isolated BE samples. [score:4]
Of note, the overexpression levels of miR-194, miR-200a and miR-192 were significantly higher in EAC stage I than in advanced stages (P [ANOVA] ≤0.0009, P [II&III] ≤0.003, and P [I&III] ≤0.006), suggesting that these miRNAs may be involved in tumor development rather than tumor progression (Figure 7). [score:4]
We found that miR-192, miR-194, miR-31, and miR-21 were significantly up-regulated in BE tissues adjacent to HGD, relative to the isolated BE samples (P<0.05) (Figure 8, Table 5). [score:4]
Four miRNAs (miR-194, miR-192, miR-31, and miR-200a) were up-regulated in EAC but not in GC (Table 4, Figure 5). [score:4]
Interestingly, the overexpression levels of miR-194, miR-200a, and miR-192 were significantly higher in early EAC stages, suggesting that these miRNAs may be involved in EAC tumor development rather than progression. [score:4]
The log10 values of fold expression of the 8 miRNAs (miR-192, miR-200a, miR-194, miR-21, miR-203, miR-205, miR-31, and miR-133b) were used for hierarchical clustering. [score:3]
In addition, our data showed that miR-192, miR-194, miR-21, and miR-31 were significantly dysregulated in BE adjacent to HGD relative to isolated BE tissue samples, showing levels similar to those observed in HGD and EAC. [score:2]
0064463.g007 Figure 7 The expression levels of the 4 miRNAs (miR-203, miR-194, miR-192, and miR-200a) were evaluated in EAC tissue samples of stages I, II and III by means of qRT-PCR. [score:1]
0064463.g005 Figure 5The expression levels of the 6 miRNAs (miR-194, miR-192, miR-203, miR-205, miR-200a, and miR-31) were measured by means of qRT-PCR in 13 BE, 34 EAC, 45 NG, and 33 GC tissue samples. [score:1]
0064463.g002 Figure 2 The expression of 4 miRNAs (miR-192, miR-194, miR-21, and miR-200a) was evaluated using qRT-PCR in 46 NS, 13 BE, 17 HGD, and 34 EAC tissues. [score:1]
The expression of 4 miRNAs (miR-192, miR-194, miR-21, and miR-200a) was evaluated using qRT-PCR in 46 NS, 13 BE, 17 HGD, and 34 EAC tissues. [score:1]
The expression levels of the 4 miRNAs (miR-203, miR-194, miR-192, and miR-200a) were evaluated in EAC tissue samples of stages I, II and III by means of qRT-PCR. [score:1]
miR-194, miR-192, miR-200a, miR-21, miR-203, miR-205, miR-133b, and miR-31 were selected for validation using 46 normal squamous (NS), 23 Barrett’s esophagus (BE), 17 Barrett’s high grade dysplasia (HGD), 34 EAC, 33 gastric adenocarcinoma (GC), and 45 normal gastric (NG) tissues. [score:1]
[1 to 20 of 19 sentences]
13
[+] score: 62
The authors concluded that miR-194 increased K [IR]1.1 channel activity by enhancing the surface expression of the channel as a result of miR-194 decreasing ITSN1-WNK -induced endocytosis of K [IR]1.1, as demonstrated by co -expression of ITSN1 and miR-194; which reversed the effect of miR-194 on K [IR]1.1 surface expression (Figure 2A). [score:7]
In order to determine if miR-194 increased expression of K [IR]1.1 at the membrane by modulation of ITSN1, they used biotin-labeling to determine the surface expression of K [IR]1.1. [score:5]
Therefore, they hypothesized if K [+] diet altered expression of ITSN1 through miR-194, then, a high K [+] diet should reduce expression of ITSN1. [score:5]
MiR-194 reduced expression of ITSN1-3′UTR but had no effect on the expression of 3′UTR-free ITSN1. [score:4]
MicroRNA-194 (miR-194) regulates ROMK channel activity by targeting intersectin 1. Am. [score:4]
Upper Panel: MiR-194 inhibits Intersectin 1, which mitigates the inhibition of K [IR]1.1 by intersectin 1 and increases K [IR]1.1. [score:4]
Immunoblot results demonstrated that pre-miR-194 enhanced K [IR]1.1 surface expression compared to the control nucleotide and that ITSN1 prevented any increase in K [IR]1.1 surface expression. [score:4]
Co -expression (into HEK293T cells) of miR-194 and ITSN1-3′UTR, but not mutant ITSN1-3′UTR resulted in altered luciferase activity providing evidence that miR-194 regulated ITSN1. [score:4]
miR-802 and K [IR]1.1. miR-194 and K [IR]1.1. miR-205 suppresses K [IR]4.1 (KCNJ10) in corneal epithelial cells. [score:3]
To verify that the effect of miR-194 on ITSN1 expression was due to ITSN1-3′UTR, the authors used a flag-tagged ITSN1-3′UTR and 3′UTR-free ITSN1 immunoblot approach with HEK293T cells. [score:3]
Therefore, K [IR]1.1 expressing HEK293T cells were transfected with pre-miR-194, pre-miR-194 + ITSN1 or a control oligonucleotide. [score:3]
Based on those results, they examined whether miR-194 regulated the expression of ITSN1 by using a wild-type ITSN1-3′UTR, mutant ITSN1-3′UTR, and a luciferase assay approach. [score:3]
Therefore, they predicted that miR-194 should alter K [IR]1.1 channel activity by regulating ITSN1. [score:2]
By using perforated whole cell patch experiments of HEK293T cells, the authors reported that co-transfection of K [IR]1.1 and pre-miR-194 increased the K [+] current compared with control cells only expressing K [IR]1.1. [score:2]
Wang and colleagues (Lin et al., 2014) demonstrated the up regulation of miR-194 in the mouse kidney of animals fed a high K [+] diet as determined by Northern blot. [score:2]
MiR-802 and miR-194 increase K [IR]1.1 (KCNJ1) abundance in the kidney by indirect pathways. [score:2]
As with miR-802, Wang and coworkers (Lin et al., 2014) used a similar high K [+] diet experimental approach to investigate the role of miR-194 in the regulation of K [IR]1.1 by targeting intersectin 1 (ITSN1). [score:2]
The authors then, identified, through database analysis, that the 3′UTR of ITSN1 contained a putative binding site for miR-194. [score:1]
Next, they demonstrated, by qRT-PCR, that miR-194 was increased in the CCDs of mice that were fed a high K [+] diet. [score:1]
These data demonstrated that miR194 modulated ITSN1 via the 3′UTR. [score:1]
[1 to 20 of 20 sentences]
14
[+] score: 35
Notably, miR-122, miR-194, miRNA-101b, and miRNA-705 were upregulated and miRNA-376a, miRNA-127, miRNA-34a, miRNA-300 and miRNA-342-3p were downregulated in the liver tissue of MCD-fed mice treated with or without metformin (Table IB and Fig. 6). [score:7]
The four upregulated miRNAs, i. e., miR-122, miR-194, miRNA-101b and miRNA-705, in mice treated with or without metformin were consistent with four of the 60 downregulated miRNAs from the control group and MCD-fed mice. [score:7]
By contrast, miRNA-122 and miRNA-194 were significantly upregulated by metformin out of the nine miRNAs that were downregulated in the NASH liver of MCD-fed mice. [score:7]
Similar to miRNA-122, downregulation of miRNA-194 enhances the expression of frizzled-6 (FZD6) and promotes tumorigenesis in the adult liver (26). [score:6]
In various types of cancer, such as gastric (28), endometrial cancer (29, 30), renal cell carcinoma (31) and colorectal cancer (32) miRNA-194 inhibits tumor invasion and metastasis. [score:3]
Taken together, it is suggested that one of the downstream targets of the metformin -induced pathway is miRNA-122 and/or miRNA-194. [score:3]
miRNA-194 is also considered to be a marker of hepatic epithelial cells and inhibits the metastasis of liver cancer cells (27). [score:2]
[1 to 20 of 7 sentences]
15
[+] score: 29
miR-192, miR-194, and miR-215 have been reported to be highly expressed in kidney tissue and play critical roles in kidney development and differentiation [7]. [score:4]
The expression of urinary EV miR-192, miR-194, and miR-215 was increased in T2DM patients with microalbuminuria. [score:3]
We found that exposure to high glucose significantly enhanced EV miR-192 (t = 7.129, P = 0.019), miR-194 (t = 4.008, P = 0.016), and miR-215 (t = 4.806, P = 0.04) expression levels in HK-2 cells (Figure 5). [score:3]
Furthermore, Saal and Harvey confirmed this expression pattern in rat kidneys and found that miR-192 and miR-194 are enriched in rat kidney cortex tissue relative to medulla tissue [27]. [score:3]
Recently, miR-192 and miR-194 were confirmed to be highly expressed in human proximal tubule and mesangial cells and to play key roles in acute kidney injury (AKI) [28]. [score:3]
As shown in Table 2, miR-192 levels were higher than the levels of miR-194 (Z = 7.913, P < 0.001) and miR-215 (Z = 8.405, P < 0.001) in urinary EVs. [score:1]
ROC analysis revealed that miR-192 had an area under the curve (AUC) of 0.802 (95% confidence interval, 0.696–0.907, P < 0.001), which was better than miR-194 with an AUC of 0.703 (95% confidence interval, 0.581–0.826, P = 0.04) and miR-215 with an AUC of 0.757 (95% confidence interval, 0.545–0.869, P < 0.001) in discriminating the normoalbuminuric group from the microalbuminuric group (Figure 3). [score:1]
miR-192, miR-194, and miR-215 are particularly abundant in the kidneys relative to other organs [7]. [score:1]
Indeed, miR-192 and miR-194 are highly enriched in proximal tubule and mesangial cells [28], and miR-192 and miR-215 have been shown to play roles in mesangial cell hypertrophy and fibrogenesis [9, 42]. [score:1]
Levels of miR-192 (Z = 3.777, P < 0.001), miR-194 (Z = 2.210, P = 0.027), and miR-215 (Z = 3.046, P = 0.002) in patients with diabetes with microalbuminuria were higher than those with normoalbuminuria. [score:1]
No correlation was found with miR-194 (r = 0.164, P = 0.211) and miR-215 (r = 0.250, P = 0.054). [score:1]
In EVs from hMCs, no significant differences were found between miR-192 and either miR-194 (t = 1.333, P = 0.212) or miR-215 (t = 1.146, P = 0.278) (Figure 6). [score:1]
TGF- β1 levels were significantly correlated with miR-192 (r = 0.356, P = 0.005) and miR-215 (r = 0.332, P = 0.010), and no significant correlation was detected between TGF- β1 levels and miR-194 (r = 0.190, P = 0.146) (Figure 4). [score:1]
In addition, in EVs from HK-2 cells from both the NG and the HG groups, the miR-192 levels were significantly higher than those of miR-194 (t = 3.001, P = 0.03) and miR-215 (t = 2.668, P = 0.043). [score:1]
In our study, these miRNAs were also detected in urinary EVs, and the relative abundance of miR-192 was significantly higher than those of miR-194 (Z = 7.913, P < 0.001) and miR-215 (Z = 8.405, P < 0.001), which suggests that miR-192 plays a more important role in the DN process, specifically in renal cell communication. [score:1]
miR-215 and miR-194-1 are located on the same chromosome, as are miR-192 and miR-194-2. miR-192 and miR-215 share the same seed sequence, and miR-194-1 and miR-194-2 possess the same mature sequence [8]. [score:1]
However, in another study, miR-192 and miR-194 were found to be decreased in the mesangial cells of diabetic mice [10]. [score:1]
There was no significant difference between miR-194 and miR-215 (Z = 0.452, P = 0.651). [score:1]
[1 to 20 of 18 sentences]
16
[+] score: 28
Of the differentially expressed miRNAs, miR-185, miR-150, miR-194, and miR-363 were downregulated in individuals with 22q11DS as compared to TD controls and miR-208, miR-190, and miR-1 were upregulated. [score:8]
Down-regulation of miR-194 was observed in both the prefrontal cortex and hippocampus in the 22q11DS mouse mo del, suggests a potential role in the development of the central nervous system [29]. [score:5]
Specifically, six miRNAs (miR-185, miR-15b-3p, miR-363, miR-324-5p, miR-361-5p, and miR-194) were dysregulated in individuals with 22q11DS when examining left hippocampal volume (Figure 5 ), and also with right hippocampal volume (Figure 6 ), while the expression level of two miRNAs (miR-361-5p, and miR-194) significantly decreased with increased whole brain volume (Figure 7 ). [score:4]
In addition, our data showed that miR-194 was significantly up-regulated by 2.13 fold in individuals with 22q11DS who had thyroid dysfunction (p = 0.037), and by 2.02-fold in individuals with 22q11DS who had CHD (p = 0.012), compared to unaffected subjects. [score:3]
miR-194 is also highly enriched in kidney, differentially expressed in renal carcinoma and can affect cell migration [59]. [score:3]
A number of miRNAs including miR-194, miR-361, miR-150 and miR-185 were found to be dysregulated in 22q11DS. [score:2]
More importantly, we observed a statistically significant difference in its expression levels within the 22q11 group between subjects with CHD compared to those without, particularly in relation to the recent findings of miR-194 involvement in acute myocardial infarction in individuals experiencing heart failure [60]. [score:2]
In particular, highly significant lower expression levels were observed for miR-194, miR-361 and miR-185 in individuals with 22q11DS across all of our phenotypic neuronal measures. [score:1]
[1 to 20 of 8 sentences]
17
[+] score: 25
It was shown that miR-192, miR-194 and miR-215 are highly expressed in normal colon tissue while their expression is dramatically decreased in colon cancer. [score:5]
Consistently, in distal parts of the intestine we determined diminished expression of miR-194 and miR-215, respectively pointing to a higher proliferative activity in the distal parts. [score:3]
In our microarray experiments, miR-194 and miR-215 showed the same expression pattern along the entire intestine, underlining the fact that both may derive from one transcript. [score:3]
In another recent study, Hino et al. [30] published that human miR-194 expression is induced by the transcription factor HNF-1α promoting intestinal epithelial differentiation. [score:3]
Cluster I (Figure 3E) shown in the hierarchically clustered heatmap harbored only miR-194 and miR-215, which were highly expressed in the proximal parts of the small intestine (duodenum and proximal jejunum). [score:3]
Consequently, increased expression of miR-194 and miR-215 in duodenum and proximal jejunum are probably involved in promoting epithelial differentiation in order to replace cells that differ e. g. in transport functions. [score:3]
They identified two genomic clusters in the human genome either encoding miR-194-1 and miR-215 on chromosome 1 or encoding miR-194-2 and miR-192 on chromosome 11 [30]. [score:1]
Interestingly, miR-194 and miR-215 were both duplicated and located on chromosomes X and 10 and clustered within a 353 bp chromosomal region. [score:1]
We have identified several genomic clusters one of those including the porcine miRNAs miR-194 and miR-215. [score:1]
In contrast to human, both porcine clusters are 100% identical encoding only miR-194 and miR-215. [score:1]
A) ssc-miR-215, B) MDM238, C) MDM392, D) ssc-miR-30a, E) ssc-miR-194, F) ssc-miR-374b, G) ssc-miR-155, H) ssc-miR-4331. [score:1]
[1 to 20 of 11 sentences]
18
[+] score: 24
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
Out of these 25 miRNAs, 18 miRNAs were differentially expressed in a consistent manner between the 2 groups (Figure 4A, highlighted); 8 miRNAs were downregulated in both groups (miR-16, miR-200, miR-205, miR-3064, miR-379, miR-431, miR-485 and miR-491) and 10 miRNAs were upregulated in both groups (miR-194, miR-1894, miR-211, miR-3072, miR- 3077, miR-4436, miR-5128, miR-669a, miR-669c and miR-6967). [score:9]
A triple comparison was also done that included cbs [–/–], cbs [+/–] and STZ retinas, which revealed 6 miRNAs (miR-194, miR-16, miR-212, miR-30c, miR-5128 and miR-669c) that were commonly changed among cbs [–/–], cbs [+/–] and diabetes; 2 of these miRNAs were consistently changed among the three groups (miR-194 was upregulated and miR-16 was downregulated). [score:7]
In the microarray data, 12 miRNAs were consistent in their change either with HHcy or diabetes; of which 4 miRNAs were downregulated in both groups (miR-16, miR-1983, miR-412 and miR-487) and 8 miRNAs (miR-194, miR-188, miR-1896, miR-467e, miR-504, miR-5110, miR-669k and miR-696) were upregulated in both groups. [score:7]
Among those miRNAs, 2 miRNAs (miR-16-5p and miR-194) were consistently changing among the three different groups. [score:1]
[1 to 20 of 4 sentences]
19
[+] score: 22
Our results showed that IRAK1 (P = 1.04 × 10 [−7]), the targets of miR-146a, MAPKBP1 (P = 10.44 × 10 [−7]) and CASP6 (P = 0.001), targets of miR-106b, were down-regulated, whereas MAP2K6 (P = 5.30 × 10 [−5]), target of miR-194-5p, was up-regulated in epilepsy patients compared with normal controls. [score:12]
For miR-15a-5p and miR-194-5p, no previous literatures have reported their dysregulation in epilepsy or other neurological diseases. [score:4]
The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis revealed many predicted target genes that were involved in inflammation and neuronal apoptosis, including IRAK1 19 of miR-146a-5p, CASP6 20 and MAPKBP1 21 of miR-106b-5p, MAP2K6 22 of miR-194-5p, etc. [score:3]
We got 361, 48, 8, 19, 87 and 26 intersected targets for let-7d-5p, miR-106b-5p, miR130a-3p, miR-146a-5p, miR-15a-5p and miR-194-5p, respectively (Supplementary Table S3). [score:3]
[1 to 20 of 4 sentences]
20
[+] score: 22
Consistent with these findings, miR-192 transfection in S KOV3ip1 and HeyA8 cells resulted in a significant downregulation of several important angiogenic factors including IL6, IL8 and FGF2 levels (75, 80 and 50% decrease, respectively; Supplementary Fig. 1e), while only a minimal downregulation of these factors was observed following miR-194 treatment (Supplementary Fig. 1f). [score:7]
To study the roles of miR-192 and miR-194 in tumour angiogenesis, we first examined the expression levels of these miRNAs in endothelial cells isolated from human normal ovaries or HGSCs. [score:3]
No statistically significant differences in miR-192 or miR-194 expression were observed between normal versus tumoral endothelial cells (Supplementary Fig. 1a). [score:3]
The cells were incubated with conditioned media collected from stable S KOV3ip1 control miRNA or miR-192 expressing cells or from ovarian or renal cancer cells treated control miRNA, miR-192, miR-194 or miR-215 mimics. [score:3]
As miR-192 expression has been previously reported to be associated with VEGF levels 19, we assessed both miR-192 and miR-194 levels in tumours treated with B20. [score:3]
High tumoral miR-192 and miR-194 correlated with prolonged overall survival (OS; both P<0.05). [score:1]
RF-24, human endothelial cells, were then exposed to conditioned media obtained from control miRNA, miR-192 or miR-194 -treated S KOV3ip1 cells (48 h post transfection). [score:1]
For the miRNA-Seq data sets, the following MIMAT numbers were analysed: MIMAT0000259 (hsa-miR-182-5p), MIMAT0000222 (hsa-miR-192-5p), MIMAT0002868 (hsa-miR-522-3p), MIMAT0018937 (hsa-miR-378g), MIMAT0003326 (hsa-miR-663a), MIMAT0000258 (hsa-miR-181c-5p), MIMAT0000318 (hsa-miR-200b-3p), MIMAT0000095 (hsa-miR-96-5p), MIMAT0014999 (hsa-miR-378b), MIMAT0005870 (hsa-miR-1206), MIMAT0000266 (hsa-miR-205-5p), MIMAT0000460 (hsa-miR-194-5p) and MIMAT0000440 (hsa-miR-191-5p). [score:1]
[1 to 20 of 8 sentences]
21
[+] score: 22
Transfection with miR-152 efficiently down-regulated TFRC at both mRNA and protein levels (Figure 4D and 4E), while transfection with either miR-194 or miR-320 did not (data not shown). [score:4]
There were no differences in the expression of miR-194 between normal and HCC samples (Supplementary Figure 2). [score:3]
The results of in silico screening analysis demonstrated that several miRNAs, including miR-152, miR-194, and miR-320, could target the 3′-UTR of TFRC mRNA. [score:3]
In contrast, the expression of miR-194 in PLC/PRF/5, Hep3B, and HepG2 cells was substantially greater than in SK-HEP1 cells and there was no major difference in the level of miR-320 among cell lines (Supplementary Figure 1). [score:3]
The expression levels of TFRC, miR-152, and miR-194 in human HCC tissue samples and normal liver samples were extracted from the TCGA database. [score:3]
Gene expression data for TFRC, miR-152, and miR-194, and clinical and tumor pathological data were extracted as. [score:3]
To confirm further the involvement of miR-152 in the regulation of TFRC at the post-transcriptional level, HepG2 cells were transfected with miR-152, miR-194, miR-320 microRNA mimics, or scrambled RNA oligonucleotide. [score:2]
HepG2 cells were seeded in 100 mm dishes at a density of 1 × 10 [6] cells/dish, and transfected with 20 nM of either miR-152, miR-194, or miR-320 microRNA mimics (Life Technologies), in three independent replicates, using Lipofectamin™ 2000 transfection reagent (Life Technologies) according to the manufacturer's instructions. [score:1]
[1 to 20 of 8 sentences]
22
[+] score: 20
Additionally, 9 miRNAs (hsa-miR-484, hsa-miR-499-5p, hsa-miR-126*, hsa-miR-491-5p, hsa-miR-1303, hsa-miR-539, hsa-miR-25*, hsa-let-7e*, and hsa-miR-194*) were upregulated in 10 diseases while not downregulated in any other, as the balloon plot (Figure  3) of all miRNAs significant in at least 8 of 19 diseases (>40%) shows. [score:11]
In this analysis, again hsa-miR-144* and hsa-miR-20b showed the strongest downregulation in diseases with AUC values of 0.771 (95% CI of 0.721–0.821) and 0.760 (95% CI of 0.71–0.811), respectively, while hsa-miR-194* was the most upregulated miRNA with an AUC value of 0.687. [score:9]
[1 to 20 of 2 sentences]
23
[+] score: 18
Although we observed upregulation of miR-143 and miR-145 in squamous mucosa from individuals with ulcerative oesophagitis, we did not observe altered expression of other miRNAs, miR-21, miR-194 and miR-215, which have previously been shown to be increased in Barrett’s oesophagus mucosa. [score:6]
miR-203 and miR-205 are expressed at higher levels in squamous mucosa, and miR-143, miR-145, miR-194 and miR-215 are expressed at higher levels in Barrett’s oesophagus. [score:5]
Previous work from our laboratory which compared normal squamous oesophageal mucosa with Barrett’s oesophagus showed increased expression of miR-21, miR-143, miR-145, miR-194 and miR-215, and decreased expression of miR-203 and miR-205 in Barrett’s oesophagus. [score:4]
There were no significant differences between the 2 groups of squamous mucosae for the expression of miR-21, miR-194, miR-203 and miR-215. [score:3]
[1 to 20 of 4 sentences]
24
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
We also found miR-194 abundantly expressed in the liver, and its level of expression was comparable with that of miR-122 (Figure 2B). [score:5]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
Additionally, miR-1 and miR-133 in the heart, miR-181a and miR-142-3p in the thymus, miR-194 in the liver, and miR-143 in the stomach showed the highest levels of expression. [score:3]
miR-194 has been implicated in intestinal epithelial cell differentiation and maturation [54], and our finding of miR-194 expression in stomach of the pig is consistent with this previous report [54]. [score:3]
The liver -associated expression of miR-194 in the mouse has been reported recently [53]. [score:3]
We also detected a trace amount of miR-194 in pig stomach (Figure 2B). [score:1]
[1 to 20 of 6 sentences]
25
[+] score: 17
Smith et al. [11] demonstrated that miR-143, miR-145, and miR-205 expression levels appear to be elevated in oesophageal squamous mucosa of individuals with ulcerative oesophagitis, while Bus et al. [12] reported that miR-143, miR-145, miR-192, and miR-194 were upregulated in esophageal epithelial cells upon acidic bile salt stimulation. [score:6]
Specifically, Wijnhoven et al. [10] have shown that miR-203 and miR-205 are high in normal squamous epithelium and low in columnar epithelia, while miR-21, miR-143, miR-145, miR-194, and miR-215 are significantly upregulated in columnar tissues compared with normal squamous epithelium. [score:3]
In this study, we hypothesised that miR-143, miR-145, miR-192, miR-194, miR-203, and miR-205 expression might be altered in tongue coating in response to chronic gastroesophageal reflux. [score:3]
To assess differential expression of miRNAs in exfoliated cells of the tongue coating between GERD (n = 24) and Ctrls (n = 24), 6 candidate miRNAs (miR-143, miR-145, miR-192, miR-194, miR-203, and miR-205) were selected. [score:3]
We evaluated the expression levels of miR-143, miR-145, miR-192, miR-194, miR-203, and miR-205 in exfoliated cells of the tongue coating in patients with GERD and Ctrls across a discovery cohort of 48 specimens. [score:1]
Subsequent research found that miR-143, miR-145, miR-192, and miR-194 were also significantly increased in esophageal epithelial cells (Het-1A) upon acidic bile salt stimulation [12]. [score:1]
[1 to 20 of 6 sentences]
26
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-210, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-16c, gga-mir-214, sma-let-7, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infectionBetween weeks 6 and 12, female parasites continue to produce ∼300 eggs per day [51], resulting in an increase in the number of granulomas in the liver and the development of fibrosis [45]. [score:4]
As shown in Fig. 2, the levels of miR-192, miR-194 and miR-122 in serum do not change between 4–12 weeks post infection, whereas five of the miRNAs that are up-regulated in the liver are also significantly elevated in serum at 12 weeks post infection (p<0.05), ranging from 2.6 fold (miR-21) to 4.7 fold (miR-214) (Table S2). [score:4]
However, according to our analysis, although miR-192, miR-122 and miR-194 were down-regulated in the liver during infection, their levels in serum did not change significantly (Fig. 1– 2). [score:4]
Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infection. [score:3]
Consistent with the array results, there was an increase in miR-199-5p, miR-199-3p, miR-214, miR-21, miR-210, and a reduction of miR-192, miR-194, miR-365, miR-122 and miR-151 in the liver tissue of S. mansoni infected mice as compared to naïve mice; miR-9 and miR-744 did not display differential expression and were not analysed further (Table 1). [score:2]
[1 to 20 of 5 sentences]
27
[+] score: 14
Analysis of cellular miRNAs identified that administration of FGF2, FGF4 or INF-β significantly regulated the expression of several miRNAs (Fig. 7a) including the liver-enriched miR-194 31. miR-194 expression is regulated by hepatocyte nuclear factor 1α (HNF1-α 45) and its down-regulation may have an effect on cellular mobility 46. [score:10]
Microarray analysis identified a panel of miRNAs, which are either highly expressed in the heart (miR-1, miR-133a and miR-16) or in the liver (miR-122, miR-192 and miR-194) or invariant (miR-21; Supplementary Figure 1a). [score:3]
Total RNA from heart or liver were reverse transcribed according to the miQPCR and TaqMan protocols and the expression of 7 miRNAs (miR-1, miR-133b, miR-16, miR-122, miR-194 and miR-21) and a small nuclear RNA (RNU6) was measured by qPCR with respectively SYBR-Green (top panel) or TaqMan probes (lower panel). [score:1]
[1 to 20 of 3 sentences]
28
[+] score: 13
On the other hand, miR-192 and miR-194 were highly expressed in the kidney and small intestine, and miR-449a was highly expressed in the lung (Figures 3(d) and 3(e)). [score:5]
The expression of miR-200a, miR-200b, miR-200c, miR-192, miR-194, and miR-449a was validated with real-time RT-PCR in rat tissues in order to discriminate the kidney from other tissues with a tubular structure. [score:3]
miR-192 and miR-194 were highly expressed in the kidney and in the small intestine. [score:3]
A significant increase in plasma miR-200a/b/c, miR-192, and miR-194 levels was observed in the AKI mo del. [score:1]
Consistently, the plasma concentrations of the miR-200 family members and miR-192 and miR-194 increased significantly. [score:1]
[1 to 20 of 5 sentences]
29
[+] score: 12
The minor allele at rs116971887 is predicted to abrogate the miR-194 target site, thereby potentially increasing SALL1 expression levels. [score:5]
SALL1 is critical for normal development and function of the kidney [Abedin et al., 2011; Nishinakamura and Takasato 2005], where miR-194 expression is highly enriched [Senanayake et al., 2012]. [score:4]
The minor allele at rs116971887 disrupts a highly conserved predicted miR-194 target site within the gene SALL1, and is in strong LD (1000G EUR, r [2] = 0.92) with a reported index SNP for plasma C-reactive protein (CRP) levels (Table 1; Supp. [score:3]
[1 to 20 of 3 sentences]
30
[+] score: 12
Other miRNAs from this paper: hsa-mir-140, hsa-mir-146a, hsa-mir-194-2, hsa-mir-146b, hsa-mir-193b
Similar to the effect of increased levels of miR-146b on SOX5 expression, down-regulation of SOX5 has previously been demonstrated in human adipose-derived stem cells as a result of miR-194 overexpression. [score:8]
Like miR-146b, miR-194 was also found to be down-regulated during chondrogenesis 33. [score:4]
[1 to 20 of 2 sentences]
31
[+] score: 12
Other miRNAs from this paper: hsa-mir-155, hsa-mir-194-2
To elucidate the biological significance of the inhibition of P1-HNF4α protein expression by its 5′ UTR, we determined the effect of the 5′ UTR on HNF4α -mediated activation of the promoter of miR-194, a known HNF4α-target gene [37] (Fig.   1D). [score:7]
HEK293 cells in 96-well plate were co -transfected with miR-194 reporter vector, pRL-CMV vector, as well as 1, 3, and 10 ng HNF4α1 expression vectors. [score:3]
Meanwhile, equal amounts of pcDNA3-HNF4A1-5′ UTR (with UTR) only activate the miR-194 by 1.6, 5.2, and 16.8 fold, accordingly (Fig.   1D). [score:1]
At 10 μM, PDS specifically decreased P1-HNF4A-5′ UTR reporter activity by 45% (Fig.   4E), and decreased the ability of HNF4A1-5′UTR to activate the miR-194 reporter by 30% (Fig.   4F). [score:1]
[1 to 20 of 4 sentences]
32
[+] score: 11
Our recent data revealed that miR-30e is a downstream target of beta-catenin during intestinal crypt cell differentiation [15]; Hino et al. showed that miR-194 expression was induced by HNF-1alpha during intestinal epithelial cell differentiation [16], suggesting active roles for miRNAs during intestinal development. [score:6]
No statistically significant regulations were found for miR-143 or miR-194. [score:2]
Cell Mol Life Sci DOI: 10.1007/s00018-010-0366-y 16 Hino K Fukao T Watanabe M 2007 Regulatory interaction of HNF1-alpha to microRNA-194 gene during intestinal epithelial cell differentiation. [score:2]
Takada et al. [27] showed high abundance of miR-143 and miR-194 in mouse small intestine and Hino et al. [16], [28] further showed induction of miR-194 by HNF-1 during differentiation of intestinal epithelial Caco-2 cells. [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 11
Deregulated miRNAs might show abnormal isomiR expression profiles in tumor cells, such as miR-194-5p (upregulated) and miR-24-3p (downregulated) (Figure 2). [score:10]
For example, miR-103a-3p was not detected any modified isomiRs even though 10 isomiRs were obtained, while three isomiRs with 3′ additions were found in miR-194-5p (Figure 2). [score:1]
[1 to 20 of 2 sentences]
34
[+] score: 10
Of the 137 studied miRNAs with more than 50 targets found in the mRNA expression profiles, 67% (92) showed negative mean Pearson correlation coefficients with their targets, 18% (24, including miR-125b, miR-29a, and miR-194) and 7% (9, including let-7i, and miR-138) showed significantly stronger negative and positive, respectively, mean correlations with their targets than with all mRNAs (P < 0.05) [see Additional file 3]. [score:9]
Among the 120 individual miRNAs studied, miR-194, miR-193 and miR-29a showed the lowest RR values (0.414, 0.423 and 0.435). [score:1]
[1 to 20 of 2 sentences]
35
[+] score: 10
Six miRNAs were overexpressed (hsa-miR-193a-3p, hsa-miR-29b-1-5p, hsa-miR-505-5p, hsa-miR-194-5p, hsa-miR-99b-3p, and hsa-miR-200b-3p) and 14 (hsa-miR-3663-3p, hsa-miR-513a-5p, hsa-miR-146b-5p, hsa-miR-1972, hsa-miR-718, hsa-miR-3138, hsa-miR-21-5p, hsa-miR-630, hsa-miR-575, hsa-miR-301a-3p, hsa-miR-636, hsa-miR-34a-3p, hsa-miR-21-3p, and hsa-miR-516a-5p) were downregulated in aortic tissue from AS patients (Table 2). [score:6]
Six overexpressed miRNAs (hsa-miR-193a-3p, hsa-miR-29b-1-5p, hsa-miR-505-5p, hsa-miR-194-5p, hsa-miR-99b-3p, and hsa-miR-200b-3p) and 14 downregulated miRNAs (hsa-miR-3663-3p, hsa-miR-513a-5p, hsa-miR-146b-5p, hsa-miR-1972, hsa-miR-718, hsa-miR-3138, hsa-miR-21-5p, hsa-miR-630, hsa-miR-575, hsa-miR-301a-3p, hsa-miR-636, hsa-miR-34a-3p, hsa-miR-21-3p, and hsa-miR-516a-5p) were identified in patients with AS, relative to normal controls, and their general characteristics and functional annotations were analyzed using bioinformatic tools. [score:4]
[1 to 20 of 2 sentences]
36
[+] score: 10
Furthermore, the elevated levels of miR-122, miR-194 and miR-125b could be related to immunity and inhibition of HBV [29– 31]. [score:3]
0177928.g004 Fig 4 The figure presents serum levels, based on normalized sequencing reads, of significantly altered miRNAs in APAP, HBV, LC, T2DM an HC for miR-122-5p, miR-192-5p, miR-483-5p and miR-194-5p (A) and miR-221-5pp, miR-222-3p, miR-375 and miR-885-5p (B). [score:1]
Interestingly, the signature revealed a simultaneous increase of the 5p and 3p forms for miR-122, miR-125b, miR-194, miR-455 and miR-99a, which has been previously observed in the case of miR-455 in HBV-infected children [28]. [score:1]
Among these the liver -associated miRNAs miR-122-5p, miR-192-5p, miR-483-5p and miR-194-5p were strongly elevated in the serum of APAP patients (Fig 4A). [score:1]
0177928.g005 Fig 5 The figure presents the isomiR composition, based on normalized mean sequencing reads, in APAP, HBV, LC, T2DM an HC for miR-122-5p (A), miR-194-5p (B), miR-885-5p (C) and miR-221-3p (D). [score:1]
The figure presents the isomiR composition, based on normalized mean sequencing reads, in APAP, HBV, LC, T2DM an HC for miR-122-5p (A), miR-194-5p (B), miR-885-5p (C) and miR-221-3p (D). [score:1]
A similar isomiR distribution is presented for miR-194-5p and miR-885-5p in Fig 5B and 5C. [score:1]
The figure presents serum levels, based on normalized sequencing reads, of significantly altered miRNAs in APAP, HBV, LC, T2DM an HC for miR-122-5p, miR-192-5p, miR-483-5p and miR-194-5p (A) and miR-221-5pp, miR-222-3p, miR-375 and miR-885-5p (B). [score:1]
[1 to 20 of 8 sentences]
37
[+] score: 9
A previous study of an adult liver reported high expression of miR-122 and miR-194, and moderate expression of miR-148 and miR-192 [17], which is similar to our study (Fig. 5), indicating that these liver-specific miRNAs are important for the two developmental stages of the liver. [score:6]
However, the other three liver-specific miRNAs (miR-148, miR192 and miR-194) exhibited moderate expression levels (Fig. 5). [score:3]
[1 to 20 of 2 sentences]
38
[+] score: 8
Using microarrays, we previously showed that 6 of 52 miRNAs were differentially expressed more than two fold in docetaxel-resistant SPC-A1/DTX cells compared with parental SPC-A1 cells, including three upregulated miRNAs (miR-192, miR-424 and miR-98) and three downregulated miRNAs (miR-200b, miR-194 and miR-212) [16]. [score:8]
[1 to 20 of 1 sentences]
39
[+] score: 8
miR-192, miR-194, miR-215, miR-200c and miR-141 are downregulated and their common target ACVR2B is strongly expressed in renal childhood neoplasms. [score:8]
[1 to 20 of 1 sentences]
40
[+] score: 8
The group II shown in Figure 5 included two subgroups with similar expression patterns, in that miRNAs in the first subgroup (miR-192 and miR-194, r = 0.988) had rather focused expression in the gastrointestinal organs as well as in kidney. [score:5]
A neighboring group of miRNAs (miR-192, miR-194, and miR-215) shared similar expression patterns but particularly in the gastrointestinal organs (r = 0.912, Figure 2). [score:3]
[1 to 20 of 2 sentences]
41
[+] score: 8
Presently, EMT is suppressed in EC through the action of four miRNAs: miR-194, miR-101, miR-23a, and miR-124. [score:3]
In EC cell lines, BMI-1 can be linked to enhanced invasiveness, and miR-194 levels in highly invasive EC in vitro are inversely correlated with BMI-1 expression (153). [score:3]
miR-194 transfection decreases cell invasion in the HEC50B cell line while simultaneously inducing a loss of the EC cell line’s mesenchymal phenotype (153). [score:1]
miR-194 has been linked to B lymphoma mouse Moloney leukemia virus insertion region 1 (BMI-1), a protein associated with self-renewal and malignant transformation. [score:1]
[1 to 20 of 4 sentences]
42
[+] score: 8
Overexpressed miR-125b [16] could function as an oncogene, whereas downregulated miRNAs, including miR-194 [17], miR-130b [18], miR-106b [19] and miR-34 [20], could work as tumor suppressors in aggressive ECs. [score:8]
[1 to 20 of 1 sentences]
43
[+] score: 8
Also, miR-194 inhibits the EMT phenotype in gastric cancer cells by targeting FOXM1 [57]. [score:5]
A. TXNIP/miR-124a/FoxA2/IAPP; B. miR-204/MEIS2-FOXC1/PAX6/ITGβ1; C. resveratrol/miRNA-520h/PP2A/C/Akt/NF-κB/FOXC2; D. Gα12/AP-1/miR-135b/FOXO1-Gα12/miR-194/MDM2/FOXO1; E. miR-22-miR-486/PTEN/PI3K/AKT/FOXO1; F. TGF-β/FOXO1/miR-21/AKT/NF-KB/Snail; G. AR/PI3K/AKT/FOXO3/AP-1/miR-21/PTEN; H. miR-34a-146b-132-21-217/Sirt/FOXO1. [score:1]
Figure 2 A. TXNIP/miR-124a/FoxA2/IAPP; B. miR-204/MEIS2-FOXC1/PAX6/ITGβ1; C. resveratrol/miRNA-520h/PP2A/C/Akt/NF-κB/FOXC2; D. Gα12/AP-1/miR-135b/FOXO1-Gα12/miR-194/MDM2/FOXO1; E. miR-22-miR-486/PTEN/PI3K/AKT/FOXO1; F. TGF-β/FOXO1/miR-21/AKT/NF-KB/Snail; G. AR/PI3K/AKT/FOXO3/AP-1/miR-21/PTEN; H. miR-34a-146b-132-21-217/Sirt/FOXO1. [score:1]
In addition, Gα [12]QL represses miR-194 cluster gene products (194/192/215), which contributes to MDM2 -mediated FOXO1 repression (Figure 2D) [77]. [score:1]
[1 to 20 of 4 sentences]
44
[+] score: 8
At the same time, since CCND1 has been shown to be a hypothetical gene target for miR-449b and miR-194, whereas VEGFA for miR-361-5p, we have analyzed also the expression levels of CCND1 (Hs00765553_m1) and VEGFA (Hs00900055_m1) mRNAs in MDA-MB-231 cells subjected to the same conditions, in order to confirm the coherence of our results (Supplementary Figure 5). [score:5]
Moreover, about 4.5% of miRNAs, including miR-148a, miR-154, miR-194, miR-361-5p and miR-449b, was specifically expressed only in treated MDA-MB-231 cells undergone to STS (Supplementary Figure 3). [score:3]
[1 to 20 of 2 sentences]
45
[+] score: 8
Other miRNAs from this paper: hsa-mir-194-2, dre-mir-194a, dre-mir-194b
This is demonstrated in 5-dpf menadione -treated mlt heterozygotes that express an activated form of human KRAS in the intestinal epithelium and are homozygous for an axin1 loss-of-function mutation that activates the canonical Wnt signaling pathway [Tg (miR194:eGFP-KRAS [G12V]); axin [tm213/tm213] ; myh11 [mlt] [/+]; hereafter referred to as ‘KRAS-axin’ fish]. [score:4]
Expression of mutant human KRAS fused to GFP (GFP-KRAS [G12V]) in the intestinal epithelium was driven by the miR194 promoter described by Seiler et al. (2012). [score:3]
The transgenic lines used have been previously described [Tg(miR194-mCherry); Tg(miR194-Lifeact-GFP ); Tg(sm22alpha-GFP)] (Seiler et al., 2012). [score:1]
[1 to 20 of 3 sentences]
46
[+] score: 8
The expression of Bmi1 is regulated by miRNAs, such as miR-128, miR-200b/c, miR-141, miR-15, miR-16, miR-203, miR-183, miR-194, and miR-218 [24, 67, 121, 122, 123, 124, 125]. [score:4]
Dong P. Kaneuchi M. Watari H. Hamada J. Sudo S. Ju J. Sakuragi N. MicroRNA-194 inhibits epithelial to mesenchymal transition of endometrial cancer cells by targeting oncogene BMI-1 Mol. [score:4]
[1 to 20 of 2 sentences]
47
[+] score: 8
Dysregulation of 7 of these miRNAs coincides with our results (upregulation of hsa-let-7i-5p, hsa-miR-21-5p and hsa-miR-146a-5p; downregulation of hsa-miR-192-5p, hsa-miR-194-5p and hsa-miR-200b-3p). [score:8]
[1 to 20 of 1 sentences]
48
[+] score: 7
It has also been reported that the inhibition of c-myb and rac-1 expression caused by miR-150 and miR-194 was able to inhibit HSC activation [23]. [score:7]
[1 to 20 of 1 sentences]
49
[+] score: 7
The expression of tissue specific miRNAs is often regulated at the transcription level by tissue specific transcription factors (for examples, miR-122a by HNF4, miR-192 and miR-194 by HNF1 [8], [9]. [score:4]
Similarly, genes encoding for miR-192 and miR-194 are clustered on chromosome 1, and could explain their coordinated increase in expression (Table 2). [score:3]
[1 to 20 of 2 sentences]
50
[+] score: 7
In those 12 miRNAs, 4 were upregulated (miR-194, -449b, -425, and –3153), and 8 were downregulated. [score:7]
[1 to 20 of 1 sentences]
51
[+] score: 7
Among miRNA analyzed, miR-23b, miR-30d, miR-132, miR-140-3p, miR-145, miR-150, miR-204 were up-regulated in OA chondrocytes whereas miR-22, miR-25, miR-26, miR-30c, miR-92b, miR-127, miR-194, miR-197, miR-296-5p, miR-342-3p, miR-488 were down-regulated in OA chondrocytes (Figure  1B). [score:7]
[1 to 20 of 1 sentences]
52
[+] score: 7
Prior studies using borderline tissue from colorectal liver metastases have validated the liver invasion front-specific down-regulation of miR-19b, miR-194, let-7b and miR-1275, and the tumor invasion front-specific down-regulation of miR-143, miR-145, let-7b and miR-638 [24]. [score:7]
[1 to 20 of 1 sentences]
53
[+] score: 6
Hepatology 17 Venugopal SK Jiang J Kim TH Li Y Wang SS 2010 Liver fibrosis causes downregulation of miRNA-150 and miRNA-194 in hepatic stellate cells, and their overexpression causes decreased stellate cell activation. [score:6]
[1 to 20 of 1 sentences]
54
[+] score: 6
Six of them, namely, rno-miR-107-5p, rno-miR-383-5p, rno-miR-24-1-5p, rno-mir-191b, rno-miR-196b-5p, and rno-miR-3552, were upregulated, while only rno-mir-194-1 was downregulated in the MCAO group compared with the sham group. [score:6]
[1 to 20 of 1 sentences]
55
[+] score: 6
Other miRNAs from this paper: hsa-mir-194-2
In addition, it has been reported that HNF1α inhibits Wnt and NF-κB signalling during hepatocarcinogenesis and HCC metastasis by transcriptionally regulating the expression of miR-194 [11, 12]. [score:6]
[1 to 20 of 1 sentences]
56
[+] score: 6
We have shown that in tumor samples compared to normal samples, the majority of miRNAs (miR-216, miR-217, miR-100, miR-345, miR-141, miR-483-3p, miR-26b, miR-150, Let-7b, Let-195 and miR-96) were downregulated, and few were upregulated (miR-146b, miR-205, miR-31, miR-192, miR-194 21, miR-379, miR-431, miR-541, and miR-199b). [score:6]
[1 to 20 of 1 sentences]
57
[+] score: 6
The expression of miR-23a, miR-181c, miR-192, miR-194, miR-208, miR-337-5p, miR-338-3p, miR-502-5p, miR-542-3p, miR-628-5p, and miR-672 is upregulated in the oral mucosa of heavy smokers with lung cancer versus patients without cancer and light smokers [66]. [score:6]
[1 to 20 of 1 sentences]
58
[+] score: 6
In the up-regulated miRNAs, we found the five miRNAs have both 5p-arm and 3p-arm expression significantly increased (miR-146b, miR-200a, miR-141 miR-192 and miR-194). [score:6]
[1 to 20 of 1 sentences]
59
[+] score: 6
The dsyregulation of miRNAs in HCC have been reported using miRNA expression profiling studies with several miRNAs reported as enhancers (miR-30d, miR-151, miR-210) or suppressors (miR-122, let-7g, miR-29b, miR-193b, miR-194, miR-139 and miR-124) of the metastatic process [8]. [score:6]
[1 to 20 of 1 sentences]
60
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-210, hsa-mir-215, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-302a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-369, hsa-mir-371a, hsa-mir-340, hsa-mir-335, hsa-mir-133b, hsa-mir-146b, hsa-mir-519e, hsa-mir-519c, hsa-mir-519b, hsa-mir-519d, hsa-mir-519a-1, hsa-mir-519a-2, hsa-mir-499a, hsa-mir-504, hsa-mir-421, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-190b, hsa-mir-301b, hsa-mir-302e, hsa-mir-302f, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-371b, hsa-mir-499b
The action of p53 is also essential for induction of the related miRNAs miR-192, miR-194 and miR-215, which are up-regulated by genotoxic stress and are capable of inducing cell cycle arrest by causing increased expression of multiple transcripts involved in S phase and G1 and G2 checkpoints in human colon cancer samples [21] and human osteosarcoma cells [22]. [score:6]
[1 to 20 of 1 sentences]
61
[+] score: 6
For example, Pichiorri et al. [83] identified that in multiple myeloma, three miRNAs (miR-192, miR-194 and miR-215) are transcriptionally activated by p53 to suppress Mdm2 expression via directly binding to its mRNA, thereby protecting p53 from degradation. [score:6]
[1 to 20 of 1 sentences]
62
[+] score: 6
The abundance of seven liver-expressed miRNAs (Let-7b, Let-7c, Let-7d, miR-122, miR-16, miR-192 and miR-194) and of RNU6 was analyzed by using SYBR Green and the crossing threshold value (C [t ][22]) determined for each condition (Figure 7). [score:3]
Comparison of changes in relative expression for 7 selected miRNAs (Let-7b, Let-7c, Let-7d, miR-122, miR-16, miR-192 and miR-194) and RNU6 in total RNA extracted from frozen liver. [score:3]
[1 to 20 of 2 sentences]
63
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-138-2, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
Mdm2 is negatively regulated by several miRNAs including miR-192 (Pichiorri et al., 2010), miR-194 (Pichiorri et al., 2010), miR-215 (Pichiorri et al., 2010), miR-221 (Kim et al., 2010), and miR-17 (Li and Yang, 2012) in different cellular contexts; however, whether these or other miRNAs regulate Mdm2 expression during the CNS development must be determined. [score:6]
[1 to 20 of 1 sentences]
64
[+] score: 6
BCL6 modulates the B cell response inducing tolerance to DNA damage -induced apoptosis by suppressing TP53 in GC B cells, [48]; while P53 controls the cell cycle at two distinctive checkpoints (G1/S and G2/M) by the regulation of miR-107, miR-145, miR-34, and of the miRNA clusters miR-15a/miR-16 and miR-192/miR-194/miR-215, able to target many cell cycle-related genes [49]. [score:6]
[1 to 20 of 1 sentences]
65
[+] score: 6
MiR-21 25, miR-17-92 26 and miR-196a 27 are up-regulated and function as oncogenes, whereas let-7 28, miR-194 29 and miR-126 30 suppress carcinogenesis. [score:6]
[1 to 20 of 1 sentences]
66
[+] score: 6
Among the miRNAs with high abundance (more than 100,000 counts), 12 miRNAs (mfi-miR-192, mfi-miR-26, mfi-miR-143, mfi-miR-148a, mfi-miR-205a, mfi-miR-22-3p, mfi-miR-181a-5p, mfi-miR-182-5p, mfi-miR-194, mfi-miR-200a, mfi-miR-92a, and mfi-let-7f) were most highly expressed in M. fissipes metamorphosis. [score:3]
The expression levels of mfi-miR-192, mfi-miR-26, mfi-miR-143, mfi-miR-148a, mfi-miR-205a, mfi-miR-22-3p, mfi-miR-181a-5p, mfi-miR-182-5p, mfi-miR-194, mfi-miR-200a, mfi-miR-92a, and mfi-let-7f were highest in this study, implying their potential significant functions in M. fissipes metamorphosis. [score:3]
[1 to 20 of 2 sentences]
67
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
miR-194 is a marker of hepatic epithelial cells and suppresses metastasis of liver cancer cells in mice. [score:3]
Enhanced MMP2 and MMP9Gramantieri et al., 2007; Meng et al., 2007; Li et al., 2008; Garofalo et al., 2009; Ji et al., 2009a; Pogribny et al., 2009; Wang et al., 2010; Song et al., 2013 miR-182 MetastasisWang et al., 2008, 2012b; Wong et al., 2008, 2010 miR-183 Onset and progression, ApoptosisWang et al., 2008; Wong et al., 2008, 2010; Liang et al., 2013 miR-185 MetastasisBudhu et al., 2008; Wong et al., 2008, 2010; Huang et al., 2009; Zhi et al., 2013 miR-192 Inhibition of DNA excision repairXie et al., 2011 miR-194 MetastasisBudhu et al., 2008; Huang et al., 2009; Meng et al., 2010; Xu et al., 2013 miR-195 Proliferation, colony formation. [score:3]
[1 to 20 of 2 sentences]
68
[+] score: 6
They further found that miR-194-5p is a candidate diagnostic biomarker for MDS and that low miR-194-5p expression could be associated with poor overall survival for MDS patients [15]. [score:3]
They found a significant upregulation of miR-194-5p and miR-320a in MDS patients compared with controls. [score:3]
[1 to 20 of 2 sentences]
69
[+] score: 5
Kim et al. [64] found that p53 up-regulated miR-200 and miR-192 family members and described the role of p53 in regulating epithelial-mesenchymal transition (EMT) in HCC through the induction of specific effector microRNAs including miR-141, miR-192, miR-194, miR-200b, miR-200c, and miR-215. [score:5]
[1 to 20 of 1 sentences]
70
[+] score: 5
Expression levels of fru-miR-196a-5p, fru-miR-206-3p, fru-miR-194-5p, fru-miR-192-5p, and fru-miR-10b-5p in slow muscle were 1305-, 529-, 93-, 85-, and 77-fold higher, respectively, compared with cardiac muscle, while expression levels of fru-miR-187-3p, fru-miR-30e-3p, fru-miR-140-3p, fru-miR-218a-5p, and fru-miR-140-5p were 16-, 16-, 10-, 8-, and 6-fold higher, respectively, in cardiac muscle compared with slow muscle. [score:3]
In contrast, fru-miR-126b-5p, fru-miR-194-5p, fru-miR-499-5p, fru-miR-30e-5p, and fru-miR-30c-5p exhibited 121-, 21-, 13-, 11-, and 4-fold higher levels of expression, respectively, in slow muscle compared with fast muscle (Table  1). [score:2]
[1 to 20 of 2 sentences]
71
[+] score: 5
Other miRNAs from this paper: hsa-mir-142, hsa-mir-155, hsa-mir-194-2, hsa-mir-200a
Indeed, miRNA-142-3p might target SOCS4, 5, 6 mRNA while miRNA-194-5p might target SOCS2, 3, 4, 5 and 7 mRNA. [score:5]
[1 to 20 of 1 sentences]
72
[+] score: 5
Functional validation in CRC cell lines has confirmed that miR-194, miR-200b, miR-203 and miR-429, which share target genes and pathways, have abilities to suppress the stem/serrated/mesenchymal subtype [77]. [score:5]
[1 to 20 of 1 sentences]
73
[+] score: 5
For example, the common target ACVR2B of five miRNAs (miRNA-192, miRNA-194, miRNA-215, miRNA-200c and miRNA-141) is strongly expressed in renal childhood neoplasms [57]. [score:5]
[1 to 20 of 1 sentences]
74
[+] score: 5
A proposed network of dysregulated miRNA/mRNA pairs in NEC suggested interaction at bacterial receptor TLR4 (miR-31, miR-451, miR-203, miR-4793-3p), mediated via key transcription factors NFKB2 (miR-203), AP-1 /FOSL1 (miR-194-3p), FOXA1 (miR-21-3p, miR-431 and miR-1290) and HIF1A (miR-31), and extended downstream to pathways of angiogenesis, arginine metabolism, cell adhesion and chemotaxis, extracellular matrix remo deling, hypoxia/oxidative stress, inflammation and muscle contraction. [score:2]
If proven effective at multiple hierarchies of the inflammatory cascade, specific miRNAs such as miR-31, miR-203 or miR-194-3p, could be developed for treatment to dampen the exaggerated immunologic response that contributes to the pathophysiology of NEC. [score:1]
Levels of 15 miRNAs: miR-223, miR-1290, miR-4725-3p, miR-4793-3p, miR-410, miR-187, miR-375, miR-203, miR-200b-5p, miR-194-3p, miR-200a, miR-215, miR-31, miR-192-3p and miR-141 were significantly different between NEC and SIP tissues (0.12–59.05 fold; Table 2). [score:1]
Interestingly, we identified miRNAs that could exhibit multiple interacting points at the upstream receptor and transcription factors as well as downstream effector genes e. g., miR-31 (TLR4, HIF1A, HBEGF), miR-194-3p (AP-1 /FOSL1, MMP9, TIMP1), miR-203 (TLR4, NFKB2, HBEGF, IL8, TNF, PTGS2), miR-1290 (FOXA1, THBS1) and miR-200b-5p (SOD2, FLT1). [score:1]
[1 to 20 of 4 sentences]
75
[+] score: 5
MicroRNA-194 modulates glucose metabolism and its skeletal muscle expression is reduced in diabetes. [score:2]
Knockdown of miRNA-194 in L6 muscle cells improved insulin sensitivity, an effect that coincided with improvements in mitochondrial function (Latouche et al., 2016). [score:2]
Furthermore, miRNA-194, determined by miRNA microarray analysis, was found to be reduced in T2DM patients as well as in insulin resistant rats (Latouche et al., 2016). [score:1]
[1 to 20 of 3 sentences]
76
[+] score: 5
Lin et al. found robust and significant downregulation of 8 miRNAs in the hypertonic dialysate group (miR-31, miR-93, miR-100, miR-152, miR-497, miR-192, miR-194, and miR-200b) and increased expression of miR-122 was observed in the hypertonic dialysate group compared with the saline and control groups [26]. [score:5]
[1 to 20 of 1 sentences]
77
[+] score: 5
Based on gene knockdown experiment, Jung et al. 47 summarized that Gα12gep oncogene inhibits FOXO1 in HCC is caused by miR-135b and miR-194 dysregulation. [score:5]
[1 to 20 of 1 sentences]
78
[+] score: 4
miR-194 and miR-200a-3p have been shown to suppress invasion and metastasis in HCC [24– 26]. [score:3]
Notably, six miRNAs (miR-489, miR-194–3p, miR-200a-3p, miR-30e-3p, miR-192, and miR-574–3p) were identically decreased in both our microarrays and The Cancer Genome Atlas (TCGA) dataset (Supplementary Table 1, Figure 1B). [score:1]
[1 to 20 of 2 sentences]
79
[+] score: 4
Hepatocyte -associated miRNAs, such as miR-122, miR-145, miR-192, and miR-194, were also upregulated (Figure 3B). [score:4]
[1 to 20 of 1 sentences]
80
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-217, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-328, hsa-mir-335, hsa-mir-133b, hsa-mir-409, hsa-mir-484, hsa-mir-485, hsa-mir-486-1, hsa-mir-490, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-506, hsa-mir-509-1, hsa-mir-532, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-33b, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-1224, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-802, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-4262, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-486-2, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
A comprehensive analysis of microRNA levels in the frontal cortex of patients with alcoholism showed that 35 microRNAs were upregulated including let 7 family members, miR-34c, miR-146a, miR-194, miR-203, and miR-369. [score:4]
[1 to 20 of 1 sentences]
81
[+] score: 4
Upregulation of miR-194 contributes to tumor growth and progression in pancreatic ductal adenocarcinoma. [score:4]
[1 to 20 of 1 sentences]
82
[+] score: 4
Four other miRNAs (hsa-miR-342-5p, hsa-miR-194, hsa-miR-150, hsa-miR-132) were deregulated in the same and two miRNAs (hsa-miR-22*, hsa-miR-30e*) were deregulated in the opposite direction in whole blood and in one other cell subset. [score:4]
[1 to 20 of 1 sentences]
83
[+] score: 4
Interestingly, BMP2 signaling upregulated miRNAs: miR-194, miR-186, miR-99a, miR-92a and also miR-31, and miR-181a (51). [score:4]
[1 to 20 of 1 sentences]
84
[+] score: 4
Some miRNAs have been identified to regulate the expression of FoxM1, including miR-149, miR-134, miR-370, miR-494, miR-194, and miR-24-1 [37– 43]. [score:4]
[1 to 20 of 1 sentences]
85
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The prospect that a similar function may extend to other miRNAs is suggested by the conservation of several miRNAs (e. g. miR-25, miR-34a/b/c, miR-135a/b, miR-194, and miR-200a) that are capable of directly targeting the Wnt/β-catenin, a signaling pathway that has been wi dely implicated in the control of oncogenic hallmarks such as cell proliferation, metastasis, angiogenesis, telomerase activity, and apoptosis (reviewed by [49]). [score:4]
[1 to 20 of 1 sentences]
86
[+] score: 4
Thus, miR-192, miR-194 and miR-215 are regarded as an amplifier to p53 and p53 -dependent mediators of cell cycle arrest. [score:1]
The miR-34 story set the precedence and a number of papers have now been published showing that other miRNAs interfere the p53 pathway, in a p53-independent manner (miR-34), partial p53 -dependent manner (miR-192, miR-194, miR-215, and miR-21) or a p53 -dependent manner (miR-29). [score:1]
Furthermore, miRNAs is implicated in every aspect of cellular outcome of p53 activation: apoptosis (miR-34 and miR-29), cell cycle arrest (miR-192, miR-194, and miR-215), and senescence (miR-34). [score:1]
In a recent paper published by Dobbelstein and colleagues [26] p53 was shown to induce, together with miR-34a, three additional miRNAs: miR-192, miR-194, and miR-215. [score:1]
[1 to 20 of 4 sentences]
87
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Increased miR-124, miR-128-1, miR-194, miR-219–5p, miR-220a and miR-320 expression are associated with increased risk in AML, however the role of microRNAs in the development of AML is unclear [101]. [score:4]
[1 to 20 of 1 sentences]
88
[+] score: 4
miR-192 and miR-194, also grouped here, are expressed relatively specifically in endoderm-derived tissues, such as the liver, lungs and the gastrointestinal tract [13], [25], [26]. [score:3]
The first pattern was of liver-specific miRNAs, represented in Figure 4A by miR-122, miR-192 and miR-194. [score:1]
[1 to 20 of 2 sentences]
89
[+] score: 4
In endometrial cancer, oncogenes such as p53 gain-of-function mutations [21], KLF17 [79], EZH2, MCL-1 and FOS [8] promote EMT -associated invasiveness and enhance CSC properties including self-renewal capacity and chemoresistance, whereas miR-101, miR-106b, miR-130b and miR-194 [7, 8, 22, 80] serve as EMT suppressors and attenuate CSC features. [score:4]
[1 to 20 of 1 sentences]
90
[+] score: 4
Although we found that mimics of miR-125b-5p, miR-194-5p miR-21-5p and miR-122-5p restored GSH levels significantly (Fig. 1d), inhibitors of only miR-125b-5p and miR-122-5p led to significant reduction in GSH levels (Fig. 1e). [score:3]
We found seven miRNAs fulfilling these two criteria: miR-194-5p, miR-125b-5p, miR-21-5p, let-7a-5p, miR-122-5p, miR-30c-5p and miR-193a-3p (Fig. 1c). [score:1]
[1 to 20 of 2 sentences]
91
[+] score: 4
For example, miR-215, miR-200c, miR-192, miR-194 and miR-141 were downregulated in Kidney Neoplasms [92]. [score:4]
[1 to 20 of 1 sentences]
92
[+] score: 4
Other miRNAs from this paper: hsa-mir-194-2
CCR-12-3363 23719264 Zhu X, Li D, Yu F, Jia C, Xie J, Ma Y, et al. MiR-194 inhibits the proliferation, invasion, migration, and enhances the chemosensitivity of non-small cell lung cancer cells by targeting forkhead box A1 protein. [score:4]
[1 to 20 of 1 sentences]
93
[+] score: 4
Other miRNAs from this paper: hsa-mir-203a, hsa-mir-200c, hsa-mir-194-2, hsa-mir-203b
Recent studies indicate that miRNAs regulate EMT or MET pathways by targeting epithelial or mesenchymal cell marker genes that include miR-194, miR-203, and miR-200c [22], [26]. [score:4]
[1 to 20 of 1 sentences]
94
[+] score: 3
Three probesets aligned to regions that contain structural variants among CC founder strains (miR-148b, miR-192, and miR-194), but the observed patterns of expression were not correlated with the strain distribution of structural variants. [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 3
Krutzfeldt et al. were the first to demonstrate the effectiveness of antagomiRs in silencing their target miRNA (miR-16, miR-122, miR-192 and miR-194) in liver, lung, kidney, heart, intestine, fat, skin, bone marrow, muscle, ovaries and adrenals [198]. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
For instance, higher expression of microRNAs miR-192 and miR-194 in colon cancer cell-lines, and of miR-708 and miR-886-3p in renal cancer cell-lines (table S2) was also observed by Sokilde, et al [23]. [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
miRNA nameIL10 [−/−] mice mo del Intestinal Inflammation Inflammation mmu-miR-29b-3p x mmu-miR-122-5p x x x mmu-miR-148a-3p x mmu-miR-150-5p x x mmu-miR-192-5p x mmu-miR-194-5p x mmu-miR-146a-5p x mmu-miR-375-3p x x x mmu-miR-199a-3p x We showed that our nine-miRNA signature could discriminate between the different forms of colitis and arthritis, as well as between non-colitic mice with and without a genetic predisposition to develop the disease (WT mice versus non-colitic IL10 [−/−] mice). [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
In the setting of EC, MIR152 [15], MIR194 [16], MIR34b [17], MIR204 [18], MIR145 [19] and MIR129-2 [20] have been reported to be tumor suppressor genes, and MIR125b [21] has been reported to be an oncogene (oncomir). [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
MiRNAs with expression profiles closest to the mean were miR-103, miR-185, miR-532-3p, miR-194, miR-126, miR-155, let-7e, miR-345, miR-425 and miR-15b as illustrated in Table 3. The first 9 miRNAs on this list were excluded from further EC analysis on the basis of their documented roles in breast cancer (Table 3). [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
Shiotani et al. reported that the expression of oncogenic microRNAs (miR-17/92 and the miR-106b-93-25 cluster, miR-21, miR-194, and miR-196) is significantly higher in the intestinal than nonintestinal metaplasia. [score:3]
[1 to 20 of 1 sentences]