sort by

294 publications mentioning mmu-mir-200a (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-200a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 310
To determine whether down-regulation of the miR-200 family plays a role in arsenic -induced cell malignant transformation, we first transiently re-expressed miR-200b or -200c in arsenic-transformed cells and found that re -expression of miR-200b or -200c alone or together restored E-cadherin expression and the epithelial-like cellular morphology, and reduced the formation of colonies in soft agar. [score:10]
To determine whether miR-200 suppresses metastasis by targeting ZEB1, the ZEB1 expressing cDNA lacking the 3′UTR was engineered into the MDA-MB-231 LM2 cells that stably expressed miR-200b. [score:9]
Importantly, it was found when C2 was stably expressed the other cluster (C1) also showed a significant increase in expression levels; however, C1 overexpression did not increase the expression levels of C2 miR-200 members. [score:9]
Through down -regulating ZEB1 and ZEB2 expression, the miR-200 family can effectively up-regulate cellular E-cadherin level and maintain a cell in a more epithelial-like state. [score:7]
Using specific miR-200 inhibitors, this group found that the miR-200 inhibitors increased cell migration of Madin-Darby canine kidney epithelial cells, suggesting that the miR-200 family inhibits cell migration. [score:7]
Of these nine targets, three were confirmed as direct targets of miR-200: cofilin 2 (Cfl2), low-density lipoprotein receptor-related protein 1 (Lrp1) and Sec23a, a key component of COPII vesicles. [score:6]
Furthermore, these and others have shown that the miR-200 family is a strong inhibitor of EMT, and that EMT resulting from the loss of the miR-200 family depends on ZEB1 and/or ZEB2 up-regulation. [score:6]
Completing these studies will lead to the discovery of more miR-200 targets and ultimately the development of novel and targeted therapeutic options for the treatment of cancer. [score:6]
By applying the Ago-HITS-CLIP technology for transcriptome-wide identification of direct miRNA targets in living cells, Bracken et al recently identified a good number of miR-200a and miR-200b targets [67]. [score:6]
YAP1, yes -associated protein 1, was confirmed to be a direct target of miR-200a and by targeting this protein miR-200a allows cells to avoid anoikis. [score:6]
For example, it was found that forced expression of miR-200a in meningioma cells [39], or expression of miR-429 in SW260 colorectal carcinoma cells [40], reduced xenograft tumor growth when injected into the flanks of SCID or nude mice, respectively. [score:5]
Therefore, it was concluded that the miR-200 family elicits this inhibitory effect on cell migration by targeting both ZEB1/2. [score:5]
These studies suggest that even though the miR-200 reduces the number of cancer cells in the bloodstream, probably by strongly inhibiting the early metastatic steps, those cancer cells that have high expression levels of miR-200s and do manage to get through the extravasation step are more capable of colonizing a distant organ. [score:5]
Recent studies have shown that the miR-200 family can inhibit angiogenesis because the family targets multiple key players in this process. [score:5]
These data suggests that the miR-200 family targets pathways involved in inhibiting metastatic colonization. [score:5]
Additionally, miR-200a and miR-200b have also been shown to directly target the pro-angiogenic ligands interleukin 8 (IL-8) and chemokine (C-X-C motif) ligand 1 (CXCL1) to regulate angiogenesis in ovarian cancer [50]. [score:5]
Recent studies suggest that the miR-200 family is pivotal in regulating EMT by targeting ZEB1 and ZEB2 via direct interactions with their 3′UTRs [61– 63]. [score:5]
It was determined that the promoter regions of the miR-200 family were indeed highly methylated upon treatment with the carcinogen, and demethylation induced by DNA methyltransferase inhibitors or demethylation chemicals increased the expression of the miR-200 family. [score:5]
The expression levels of the miR-200 family members was determined by qPCR in MCF-7 cells that were either sensitive or resistant (LY2) to endocrine treatment, and showed that the expression of miR-200b, -200a, and -200c was significantly decreased in the endocrine-resistant cell lines. [score:5]
In contrast, injection of the modified C2 or C1+C2 4TO7 cells (cell lines that both express high levels of all five miR-200 members) formed more lung metastases than the parental or C1 alone overexpressing 4TO7 cells [72]. [score:5]
Xu and colleagues were able to show that miR-200 family expression was significantly correlated with the status (benign, non-recurrent or recurrent primary, or metastatic) of a melanoma tumor, therefore expanding the potential role of the miR-200 family as a prognostic marker in this disease [91]. [score:5]
It has been shown that stably expressing both miR-200 cluster members reduced the ability of cancer cells to enter the blood stream, and that E-cadherin overexpression can also decrease the number of cells in the blood stream [72]. [score:5]
Not only has the miR-200 family been shown to inhibit cellular malignant transformation, but studies have also shown that they are capable of suppressing tumor growth. [score:5]
Another study looked at the effects of miR-200 on targets that regulate the reorganization of the actin cytoskeleton to promote invasiveness [56]. [score:4]
In addition, in meningiomas it was found that miR-200a directly targeted β-catenin to increase apoptotic cell death [76]. [score:4]
A summary of the validated direct targets of the miR-200 family. [score:4]
Therefore, downregulation of miR-200 family levels in tumor cells can help the cell survive within the bloodstream by reducing apoptosis. [score:4]
Studies have shown that the miR-200 family plays a role in reducing chemoresistance by targeting these genes known to play a direct role in developing this resistance. [score:4]
This work showed for the first time a global regulatory network directly regulated by miR-200 family, which provided a novel mechanistic insight for miR-200 family maintaining the key features of the epithelial phenotype and preventing cell migration. [score:4]
The expression of the miR-200 family can be regulated through interactions with, and modifications of their promoters. [score:4]
Studies on the miR-200 family have enhanced our knowledge of the crucial roles that they may play in cancer development and progression through targeting a variety of important proteins. [score:4]
Together, these studies suggest that loss of miR-200 expression may play an important role in the early stage of carcinogenesis. [score:3]
Recent research done in our laboratory has been the first to show an important role of the miR-200 family in inhibiting and preventing cell malignant transformation by a carcinogen exposure [35]. [score:3]
However, ours and other recent studies also suggest that the miR-200 family can inhibit cell migration independent of its effect on ZEB1/ZEB2. [score:3]
However, in contrast to these studies, Yu et al. found that expression of miR-200a made breast cancer cells more resistant to anoikis [79]. [score:3]
A miRNA microarray analysis showed that the expression levels of miR-200 family were drastically reduced in arsenic-transformed cells. [score:3]
However, ZEB1 and ZEB2 can also bind to the E-box sites close to the transcription start site of each of the miR-200 clusters inhibiting their transcription, resulting in a negative feedback loop [64, 65]. [score:3]
In striking contrast to the strong inhibitory effect of miR-200 family has on the early metastatic steps, studies have shown that miR-200 may promote metastatic colonization [72, 81]. [score:3]
The miR-200 family is highly conserved among vertebrate species and highly expressed within epithelial cells. [score:3]
A recent paper by Manavalan et al. has also shown a link between the miR-200 family and targeted therapy resistance in breast cancer cells [109]. [score:3]
Together, these findings suggest that loss of miR-200 expression plays a causal role in arsenic -induced cell malignant transformation and tumorigenesis. [score:3]
Early studies on the miR-200 family have shown that the miR-200 family can suppress cell migration. [score:3]
Moreover, profiling a group of mouse breast cancer cell lines (67NR, 168FARN, 4TO7, and 4T1) with different metastatic capabilities (67NR cells are unable to intravasate; 168FARN cells cannot extravasate efficiently; 4TO7 cells do not colonize distant organs well; and 4T1 cells are capable of completing all steps of metastasis) revealed that the most metastatic cells (4T1) had the highest level of miR-200 family expression. [score:3]
This again suggested that other targets of the miR-200 family are more important in colonization efficacy of a cancer cell. [score:3]
Since some of the data on the role of miR-200 family in cancer is controversial and cellular context dependent, it is important for future studies to tease apart which miR-200 family members act as a tumor suppressor and which may promote cancer progression. [score:3]
Through microarray and mass spectrometry analysis nine potential miR-200 targets were identified. [score:3]
Some representative miR-200 targets involved in each step of the metastatic cascade are shown. [score:3]
The identified miR-200 targets are critically involved in Rho-ROCK signaling, invadopodia formation, matrix metalloproteinase activity, and focal adhesions. [score:3]
Functional analysis in vitro and in vivo revealed that miR-200 increased metastatic colonization by targeting Sec23a. [score:3]
Further functional validation of the identified miR-200 targets revealed that they constitute subnetworks that play crucial roles in enabling cancer cells to migrate and invade. [score:3]
Figure 3 Some representative miR-200 targets involved in each step of the metastatic cascade are shown. [score:3]
These two studies described above both looked at epigenetic silencing as a possible mechanism for the carcinogen -induced miR-200 expression loss seen in the HBECs. [score:3]
Therefore, the miR-200 family also plays a role in sensitivity to the specific targeted therapies available for breast cancer. [score:3]
Recent studies suggest that modifications to the promoter regions of each of the miR-200 clusters can cause the loss of the expression of the miR-200 family in cancer. [score:3]
When bound, ZEB1 and ZEB2 can inhibit the transcription of the entire miR-200 family, while Sp1 and p53 binding has been shown to lead to activation of transcription of the miR-200b/200a/429 [32, 33] and the miR-200c/141 [33, 34] clusters, respectively. [score:3]
Furthermore, the miR-200 family has also been shown to target the VEGF receptors. [score:3]
Recent research has suggested that the miR-200 family plays an important role in inhibiting cell malignant transformation and preventing tumor initiation. [score:3]
Using a miRNA microarray, Kovalchuk and colleagues found that the levels of miR-200a and miR-200c were significantly lower in MCF-7 breast cancer cells that were resistant to doxorubicin compared to the parental cells, suggesting that decreased expression of these miRNAs may contribute to doxorubicin resistance in breast cancer [104]. [score:2]
In contrast, Park et al. reported that miR-200a was expressed at lower levels in the saliva of 38 patients with oral squamous cell carcinoma (OSCC) compared to 38 healthy controls [89]. [score:2]
Gregory et al. first reported the inhibitory effect of miR-200 on cell migration using a transwell migration assay [61]. [score:2]
Our recent studies have also implicated the miR-200 family in the ZEB1-independent regulation of cell migration and metastasis. [score:2]
Comparing the expression levels of the miR-200 family members in gastric cancer cell lines, Valladares-Ayerbes and colleagues found that miR-200c levels were much significantly higher in cancer cells compared to normal cells [90]. [score:2]
Similarly, Park et al. found that expressing miR-200a/c in the highly metastatic MDA-MB-231 breast cancer cells significantly decreased their motility in a transwell migration assay [62]. [score:2]
Taken together, these data suggest that the miR-200 family plays crucial roles in the metastatic cascade by down -regulating important players involved in angiogenesis. [score:2]
Effect of the miR-200 family on tumor cell intravasation. [score:1]
Although current studies on the miR-200 family have shown promising results, more work is needed to further understand the role this family plays in cancer. [score:1]
The potential role of miR-200 family in cancer therapy. [score:1]
MiR-200b, -200c, and -429 (Functional Group I) all share the same seed sequence and miR-200a and -141 (Functional Group II) both share the same seed sequence, with the two functional groups only differing in the seed sequence by one nucleotide (AA UACUG for miR-200b/200c/429 and AA CACUG for miR-200a/141). [score:1]
Effect of the miR-200 family on epithelial-to-mesenchymal transition and tumor cell migration. [score:1]
Figure 1The miR-200 family consists of two clusters: Cluster I (miR-200b, - 200a, and - 429 is located on chromosome 1) and Cluster II (miR-200c and - 141 is located on chromosome 12). [score:1]
Studies showed potential in the use of members of the miR-200 family for cancer diagnosis. [score:1]
Indeed, Pecot et al. recently reported that higher miR-200 levels in ovarian, lung, renal and basal-like breast adenocarcinomas are associated with improved clinical outcome. [score:1]
Effect of the miR-200 family on tumor cell survival in circulation. [score:1]
Therefore, arsenic or tobacco carcinogens may induce cell transformation by increasing the methylation of the promoter regions of, and subsequently leading to silencing of, the miR-200 family. [score:1]
This is probably partly due to the difficulty in measuring intravasated cells in the blood stream, and that the miR-200 family has a strong suppressive effect on the earlier steps of the metastatic cascade. [score:1]
However, there has been little research done with respect to the mechanism by which miR-200 family reduces cancer cell intravasation. [score:1]
Alternatively, the miR-200 family members can also be divided into two functional groups based upon the similarities of their seed sequences (Figure 2). [score:1]
Moreover, most of the research done on individual miR-200 family members focuses on miR-200b or -200c, therefore more work is needed on miR-200a, -141 and -429 and their individual role in cancer. [score:1]
The miR-200 family as potential diagnostic and prognostic tools. [score:1]
These studies suggest that body fluid miR-200 family levels may have different diagnostic values for different types of cancers. [score:1]
Effect of the miR-200 family on tumor cell extravasation and metastatic colonization. [score:1]
MiR-200 family members have been shown to regulate apoptosis and anoikis, and therefore may have an effect on tumor cell survival in circulation. [score:1]
However, higher levels of miR-141 are significantly associated with worse clinical outcome of luminal subtypes breast cancer [50], suggesting that miR-200 may exhibit differential functions among different breast cancer subtypes. [score:1]
Thus, ZEB1 and ZEB2 can keep a cell in a mesenchymal phenotype by repressing the transcription of both E-cadherin and the miR-200 family. [score:1]
Developing new and robust mo dels for the study of intravasation and extravasation steps of metastasis are also needed to advance our knowledge on the miR-200′s role in these critical processes. [score:1]
Alternatively, the promoter regions of the miR-200 family can be bound by the transcription factors zinc finger e-box bind homeobox 1 (ZEB1) and 2 (ZEB2 also known as SIP1), specificity protein 1 (Sp1), and p53. [score:1]
Given the contradictory results observed, the role of individual members of the miR-200 family in anoikis still needs to be further studied. [score:1]
Therefore more work is needed to determine the role of the miR-200 family in this early step of metastasis. [score:1]
Though much of the research on the miR-200 family in cancer drug resistance has focused mostly on miR-200b and -200c, it is possible that the other members of the miR-200 family may also play similar roles in the process due to their similar seed sequences. [score:1]
Zhang and colleagues also studied the role of miR-200 in anoikis in breast cancer [78]. [score:1]
The miRNA-200 (miR-200) family consists of five members, which form two clusters located in two different genomic regions. [score:1]
The miRNA-200 family. [score:1]
The miR-200 family is among the most wi dely studied miRNAs in cancer, this review will focus specifically on the role of the miR-200 family in cancer initiation, metastasis, diagnosis and treatment. [score:1]
Figure 2The miR-200 family members can also be separated into two functional groups based upon their seed sequences. [score:1]
Therefore, the interplay between the miR-200 family and ZEB1/ZEB2 plays an important role in driving the cell in to and out of EMT. [score:1]
The miR-200 family two clusters are located on two different chromosomes. [score:1]
The miR-200 family in cell transformation and tumorigenesis. [score:1]
Effect of the miR-200 family on tumor growth, angiogenesis, and nearby tissue invasion. [score:1]
To study the role of miR-200 in the last step of the metastatic cascade, Korpal and colleagues profiled the levels of the miR-200 family in primary and metastatic samples and found that the miR-200 family was higher in metastatic secondary tumors [72]. [score:1]
Of these 17 miRNAs, four of them were from the miR-200 family (miR-200b, -200a, -200c, and -141), and this group concluded that miR-200b was the best miRNA for determining CTC -positive MBC patients. [score:1]
Moreover, it was also found that the poorly metastatic 4TO7 cells can take up miR-200 from 4T1 EVs and become metastatic in a miR-200–dependent manner [82]. [score:1]
The miR-200 family in cancer metastasis. [score:1]
Current research on the miR-200 family has shown that the family can affect each step of the metastatic cascade. [score:1]
Together, these findings suggest that miR-200 levels may have the potential to serve as indicators of cancer prognosis. [score:1]
The miR-200 family members can also be separated into two functional groups based upon their seed sequences. [score:1]
The miR-200 family consists of two clusters: Cluster I (miR-200b, - 200a, and - 429 is located on chromosome 1) and Cluster II (miR-200c and - 141 is located on chromosome 12). [score:1]
Future work on the miR-200 family can help with better understanding the mechanism by which miR-200s affect cancer initiation, metastasis, and relapse. [score:1]
The sequences of the mature miRNA-200 family members. [score:1]
To further determine the underlying mechanism behind miR-200 promotion of metastatic colonization, Korpal and colleagues used a tail vein injection mo del with the modified 4TO7 cells described above. [score:1]
The role of the miR-200 family in apoptosis has already been discussed above in the survival in circulation section; therefore this section will focus primarily on the effect of miR-200s on chemoresistance. [score:1]
Since much work has focused on the effect of whole clusters/groups on metastasis, more work is also needed to be done on individual members of the miR-200 family to elucidate their role in each step of the metastatic cascade. [score:1]
Furthermore, a high level of circulating miR-141 was found to be associated with high-risk (Gleason score ≥ 8) tumors [92], while a lower level of cluster I of the miR-200 family was correlated with relapse [93] in prostate cancer. [score:1]
However, more research is needed to discern the function of each cluster as a whole and to elucidate the effect of each individual member of the miR-200 family on the metastatic cascade. [score:1]
[1 to 20 of 113 sentences]
2
[+] score: 271
Other miRNAs from this paper: mmu-mir-141, mmu-mir-146a, mmu-mir-200b, mmu-mir-200c, mmu-mir-429
In contrast, transfection of miR-200a/200b inhibitors respectively increased HG -induced endothelial ICAM-1 mRNA expression to 1.25- and 1.32-fold, VCAM-1 mRNA expression to 1.28- and 1.35-fold, and E-selectin mRNA expression to 1.15-fold and 1.20-fold, of the negative control expression levels (Figure 3F). [score:11]
As shown in Figure 3E, transfection of miR-200a/200b mimics respectively inhibited HG -induced endothelial ICAM-1 mRNA expression to 83 and 81%, VCAM-1 mRNA expression to 86 and 87%, and E-selectin mRNA expression to 74 and 70%, of the negative control expression levels. [score:11]
miR-200a/200b mimics inhibit HG -induced endothelial OGT expression, protein O-GlcNAcylation, and inflammatory phenotypesTo examine the potential regulation of OGT expression by the miR-200 family, transfection assays with 200a/200b mimics or inhibitors were performed to determine whether miR-200a/200b mimics modulates OGT gene expression. [score:11]
This suggests that miR-200a/200b mimics may play a therapeutic role by decreasing diabetes -induced endothelial inflammation through the downregulation of both OGT and ICAM-1. The potential mechanisms of miR-200a/200b in regulating HG -induced endothelial OGT expression, protein O-GlcNAcylation, and inflammation is illustrated in Figure 6. Figure 5miR-200a/200b mimic decreased endothelial OGT and ICAM-1 expression in type 2 db/db diabetic mice. [score:9]
This suggests that miR-200a/200b mimics may play a therapeutic role by decreasing diabetes -induced endothelial inflammation through the downregulation of both OGT and ICAM-1. The potential mechanisms of miR-200a/200b in regulating HG -induced endothelial OGT expression, protein O-GlcNAcylation, and inflammation is illustrated in Figure 6. Figure 5miR-200a/200b mimic decreased endothelial OGT and ICAM-1 expression in type 2 db/db diabetic mice. [score:9]
To determine whether HG -induced downregulation of miR-200 members also modulates ZEB-1 gene expression, we examined the effects of HG on ZEB-1 expression. [score:8]
Although we did not examine the repressive effect of miR-141 on ICAM-1 expression, we found that ICAM-1 gene and protein expression and monocyte adhesion were significantly downregulated by the miR-200a mimic. [score:8]
The present study demonstrates that HG induces OGT expression, protein O-GlcNAcylation levels, and endothelial inflammation in the HAECs by downregulating miR-200a/200b expression. [score:8]
To examine the potential regulation of OGT expression by the miR-200 family, transfection assays with 200a/200b mimics or inhibitors were performed to determine whether miR-200a/200b mimics modulates OGT gene expression. [score:7]
Based on OGT siRNA data, the ability of miR-200a/200b mimics to downregulate OGT expression and O-GlcNAcylation levels may act as a possible mechanism to attenuate hyperglycemia -induced endothelial inflammation by regulating nuclear factor-kB activity (James et al., 2002; Yang et al., 2008; Allison et al., 2012). [score:7]
Interestingly, the miR-200 family members were not predicted to bind to the mouse ICAM-1 3′-UTR; however, our results show that miR-200a/200b mimics significantly attenuated endothelial ICAM-1 expression, suggesting that ICAM-1 expression was indirectly regulated by miR-200a/200b mimics in the db/db diabetic mice. [score:7]
The transcriptional inhibitor ZEB-1 is a well-known target of the miR-200 family members through a reciprocal repression mechanism to promote epithelial-mesenchymal transition and cancer invasion (Burk et al., 2008). [score:5]
miR-200a/200b mimics inhibit HG -induced endothelial OGT expression, protein O-GlcNAcylation, and inflammatory phenotypes. [score:5]
While we did not investigate the role of miR-141 and miR-200c/429 in regulating OGT expression, it is possible that all members of the miR-200 family can regulate OGT expression, as they have the same seed sequence as either miR-200a or miR-200b. [score:5]
Moreover, miR-200a/200b mimics significantly decreased the ZEB-1 gene expression levels to 83 and 80%, respectively, of the expression in the negative control group after 24 h HG-stimulation in the HAECs (Figure 2E). [score:5]
In contrast, transfection of miR-200a/200b inhibitors in the HG-stimulated HAECs caused a significant increase in OGT gene expression level, by 1.20- and 1.23-fold, respectively, of that in the negative control (Figure 3B). [score:5]
The miR-200 family is now known to play an inhibitory role in cancer progression because of the strong suppressive effects of its members on cell transformation, migration, proliferation, invasion, and metastasis (Humphries and Yang, 2015). [score:5]
To determine whether reduced OGT and protein O-GlcNAcylation expression are associated with reduced endothelial inflammation in the miR-200a/200b mimics -transfected HG-stimulated HAECs, we measured ICAM-1, VCAM-1, and E-selectin gene expression levels, ICAM-1 expression, and THP-1 monocyte adhesion. [score:5]
Although HG caused a significant decrease in the miR-200a and miR-200b expression levels, the osmotic control LG did not modulate the expression levels of miR-200a and miR-200b (Figure 2C). [score:5]
miR-200a mimic, miR-200b mimic, miR-200a inhibitor, miR-200b inhibitor, and negative control (NC) were transfected into the HAECs as previously described (Wang et al., 2014; Lo et al., 2017). [score:5]
Transfection of miR-200a/200b mimics also significantly downregulated OGT protein expression (Figure 3C) and was associated with decreased protein O-GlcNAcylation in the HG-stimulated HAECs as compared with the negative control group (Figure 3D). [score:5]
Given that miR-200a and miR-141 have the same seed sequence, miR-200a may also regulate ICAM-1 expression in the HG-stimulated HAECs. [score:4]
Belgardt et al. reported that β-cell specific overexpression of miR-200 family induced β-cell apoptosis and type 2 diabetes, whereas miR-200 family knock-out reduced β-cell apoptosis and improved type 2 diabetes symptoms (Belgardt et al., 2015). [score:4]
These results indicate that miR-200a/200b mimics possess anti-inflammatory properties in HG -induced endothelial inflammation, possibly because of their ability to modulate protein O-GlcNAcylation levels via OGT downregulation. [score:4]
However, this study confirmed that the miR-200 family is dysregulated in HG-stimulated HAECs, and both in vitro and in vivo experiments revealed that miR-200a/200b have therapeutic potential in treating diabetic vascular disease. [score:4]
Figure 2OGT is a direct target of miR-200a and miR-200b. [score:4]
OGT is a direct target of miR-200a and miR-200b. [score:4]
As shown in Figures 5A,B, the immunoreactivities of OGT and ICAM-1 in the aortic endothelial layers were substantially downregulated in the miR-200a/200b mimic -treated db/db mice than in the negative control -treated db/db mice. [score:4]
Magenta and colleagues reported that miR-200 family members were increased in H [2]O [2]-stimulated human umbilical endothelial cells, which play a critical role in ROS -mediated senescence and apoptosis by downregulating the zinc-finger E-box binding homeobox 1 (ZEB-1) (Magenta et al., 2011). [score:4]
In this study, miR-200a/200b mimics regulated OGT gene and protein expression and protein O-GlcNAcylation. [score:4]
Both cellular and animal experiments revealed miR-200a/200b as a potential therapeutic target for treating vascular complications in diabetes. [score:3]
miR-200a/200b mimics decreased endothelial OGT and ICAM-1 expression in type 2 diabetic mice. [score:3]
ICAM-1 expression was also significantly decreased by transfection with miR-200a/200b mimics in the HG-stimulated HAECs (Figure 3G) and was associated with decreased adhesion of the THP-1 cells to the HAECs, to 33 and 34%, respectively, of the adhesion levels in the negative control group (Figure 3H). [score:3]
These findings suggest that the miR-200 family has cytoprotective roles, consistent with its role as a tumor suppressor. [score:3]
Similarly, HG stimulation for 24 h caused a significant decrease in the miR-200a, miR-141, miR-200b, miR-200c, and miR-429 expression levels to 27, 18, 39, 71, and 39%, respectively, of the levels in the unstimulated control. [score:3]
non-diabetic samples), suggesting that the miR-200 family has various roles in inflammation -associated diseases, including diabetes. [score:3]
A segment of the OGT 3′-untranslated region (UTR) that includes both miR-200a and miR-200b binding sites was constructed into the pmirGLO vector (Promega, Madison, WI, USA). [score:3]
Interestingly, transfection of miR-200a mimics in the HG-stimulated HAECs caused a non-significant decrease in OGA expression, to 95% (p = 0.089) of that in the negative control. [score:3]
As shown in Figure 2B, real-time PCR analyses showed that HG stimulation for 12 h resulted in a significant decrease in miR-200a, miR-141, miR-200b, miR-200c, and miR-429 expression levels to 53, 38, 11, 42, and 33%, respectively, of the levels in the unstimulated control. [score:3]
As shown in Figure 3A, transfection of miR-200a/200b mimics in HG-stimulated HAECs caused a significant decrease in the OGT gene expression level to 83 and 82%, respectively, of that in the negative control (Figure 3A). [score:3]
These results confirm that ZEB-1 is a target of miR-200a/200b. [score:3]
Furthermore, downregulation of miR-200 family members in the HG-stimulated HAECs can modulate the expression levels of ZEB-1. To investigate whether miR-200a/200b can interact with the 3′-UTR of OGT mRNA, we performed a luciferase reporter assay. [score:3]
Real-time PCR data revealed that the most highly expressed miRs among functional groups 1 and 2 were miR-200a and miR-200b, respectively. [score:3]
To examine the effect of miR-200a/200b mimics on the expression of endothelial OGT and ICAM-1 in db/db type 2 diabetic mice, we performed of the aortic tissues. [score:3]
Similarly, 24 h HG stimulation decreased miR-200a, miR-141, miR-200b, miR-200c, and miR-429 expression levels to 27, 18, 39, 71, and 39% of the control level, respectively N = 5. ** p < 0.01 and *** p < 0.001 compared with control. [score:2]
In the endothelial layers, quantification of immunoreactivity signals showed that OGT expression was decreased significantly—to 0.37- and 0.43-fold in the db/db (miR-200a mimic) and db/db (miR-200b mimic) groups compared with that in the db/db (negative control) group. [score:2]
As shown in Figure 2F, cotransfection of pmirGLO-OGT-3′-UTR and either the miR-200a or miR-200b mimic resulted in a decrease in the luciferase signal to 83 and 74%, respectively, of that in the negative control, confirming direct binding of miR-200a/200b to the 3′-UTR of OGT mRNA. [score:2]
The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. [score:2]
The microRNA-200 family regulates pancreatic beta cell survival in type 2 diabetes. [score:2]
ICAM-1 expression in the endothelial layers was also decreased significantly—to 0.34- and 0.33-fold in the db/db (miR-200a mimic) and db/db (miR-200b mimic) groups compared with that in the db/db (negative control) group (Figure 5C). [score:2]
All members of the miR-200 family were showed homology with the 3′-UTR of human OGT mRNA in their seed sequences (Figure 2A), indicating potential regulation of OGT by miR-200 members. [score:2]
There is conflicting evidence regarding the regulatory role of miR-200 family members in diabetes. [score:2]
Aldose reductase regulates miR-200a-3p/141-3p to coordinate Keap1-Nrf2, Tgfbeta1/2, and Zeb1/2 signaling in renal mesangial cells and the renal cortex of diabetic mice. [score:2]
This suggests that either miR-200b can bind the miR-200a binding site of the ICAM-1 3′-UTR through G:U wobble binding, or ICAM-1 was indirectly repressed by miR-200b. [score:2]
Figure 6Proposed role of miR-200a/200b in regulating HG -induced endothelial protein O-GlcNAcylation and inflammation via OGT. [score:2]
Immunoreactivity signals observed in the endothelial layers of the db/m (vehicle), db/db (negative control), db/db (miR-200a mimic), and db/db (miR-200b mimic) groups were quantified as previously described (Federici et al., 2002). [score:1]
Particularly, members of the miR-200 family are highly sensitive to ROS. [score:1]
A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells. [score:1]
Fourteen-week-old db/db mice were injected with 100 μL miR-200a mimic, miR-200b mimic, or NC (13 μg per week, three times) by tail-vein injection using equal volume mixtures of Lipofectamine™ 2000 and miR-200a mimic, miR-200b mimic, or NC. [score:1]
The five known miR-200 members are located on two chromosomes (chromosome 12: miR-141 and miR-200c; chromosome 1, miR-200a, miR-200b, and miR-429) and are highly conserved in higher vertebrates (Gheldof et al., 2012). [score:1]
Alternatively, G:U wobble pairing may explain the binding of miR-200b (seed sequence: 3′-GUCA UAA-5′) to the miR-200a binding site on OGT 3′-UTR (5′-CAGU GUU-3′), as Doench et al. reported that thermodynamically favorable G:U pairing in the seed region can retain significant gene repressive effects (Doench and Sharp, 2004). [score:1]
602003; miR-200a: Cat No. [score:1]
MicroRNA-200 is induced by thioredoxin-interacting protein and regulates Zeb1 protein signaling and beta cell apoptosis. [score:1]
However, the miRanda-mirSVR database identified all five miR-200 family members as potential binding partners of the mouse Ogt 3′-UTR. [score:1]
Based on manual sequence alignment, both human OGT and mouse Ogt 3′-UTRs share an identical nucleotide sequence (5′-AGUAUU-3′) that is complementary to the seed sequence of miR-200 functional group 2, suggesting that human OGT 3′-UTR also binds to miR-200b/200c/429, similar to mouse Ogt. [score:1]
In addition, a luciferase reporter assay confirmed that miR-200a/200b mimics directly interact with the 3′-UTR of OGT mRNA. [score:1]
In this study, web -based bioinformatics analysis using miRanda-mirSVR and miRDB database revealed that the members of the miR-200 functional group 1, but not of group 2, may bind to the 3′-UTR of human OGT mRNA. [score:1]
In contrast, the miR-200 family has also been reported to have protective effects. [score:1]
Transfection of miR-200a and miR-200b mimics. [score:1]
However, reports of miR-200 family members in diabetes -associated studies are conflicting. [score:1]
The microRNA-200 family: still much to discover. [score:1]
Therefore, miR-200a and miR-200b were selected for further analysis. [score:1]
The miR-200 family has been reported to have a detrimental effect. [score:1]
Although ROS is involved in modulating the miR-200 family and protein O-GlcNAcylation, the interplay between these factors is not clear. [score:1]
Similar to the effects of the miR-200a/200b mimics, OGT siRNA transfection caused a significant decrease in ICAM-1, VCAM-1, and E-selectin mRNA levels—to 58, 71, and 67%, respectively, of that in the scrambled negative control (Figure 4D). [score:1]
These findings support that the miR-200a::OGT and miR-200b::OGT interactions are functional. [score:1]
Wei et al. reported that tail-vein injection of anti-miR-200a in streptozotocin -induced diabetic mice exacerbated cortical and glomerular fibrosis and increased urinary albumin excretion (Wei et al., 2014). [score:1]
The sequence is listed in Supplemental Data 2. HAECs were cotransfected with 1 μg of constructed plasmids and 100 nM of miR-200a mimic, miR-200b mimic, or NC using Lipofectamine™ 2000 (Invitrogen). [score:1]
Nanoparticle -mediated miR200-b delivery for the treatment of diabetic retinopathy. [score:1]
Some studies showed that miR-200 family members have harmful effects on diabetes progression (Filios et al., 2014; Belgardt et al., 2015), diabetes -induced inflammation (Reddy et al., 2012), and diabetes -induced endothelial dysfunction (Zhang et al., 2016), while others showed that members of the miR-200 family have protective effects because of their anti-inflammatory (McArthur et al., 2011) and anti-fibrotic properties (Wei et al., 2014). [score:1]
[1 to 20 of 80 sentences]
3
[+] score: 247
Other miRNAs from this paper: mmu-mir-141, mmu-mir-200b, mmu-mir-200c, mmu-mir-429
The DMPCs were co -transfected microRNA inhibitor negative control or combination of miR-200a/200b/429 inhibitors with pEGFP- RSAD2 plasmid and then grouped as NC Inhibitor, miR-200s Inhibitors + RSAD-DMPC, miR-200s Inhibitors-DMPC, DMPC, and MPC, respectively. [score:11]
On the basis of previous data, In general, the predicted miR-200 family target genes were downregulated in DMPCs because miR-200 family expression was upregulated in DMPCs. [score:11]
The DMPCs were transfected with microRNA inhibitor negative control or combination of miR-200a/200b/429 inhibitors and then grouped as NC inhibitor, miR-200a/200b/429 inhibitors-DMPC, DMPC, and MPC, respectively. [score:9]
Because miR-200a/200b/429 were up-regulated in DMPCs, we examined the down-regulated genes in DMPCs to predict the target genes using the microRNA and miRDB databases. [score:9]
Relative to miR-200 family inhibition cells (miR-200s inhibitors DMPC group; 65.2 ± 8.9%), a decrease cells in G0/G1 phase of the cell cycle was observed following miR-200 family inhibition combining with overexpression of RSAD2 in DMPC (RSAD2-DMPC group; 58.4 ± 1.7%, P < 0.05) (Fig. 6a). [score:9]
Then, we further predicted the miR-200 family target genes by comparing the upregulated miRNAs and the downregulated mRNAs on two web sites: http://www. [score:9]
Up-regulation of miR-200 family inhibits the RSAD2 protein expression, the process of which significantly promotes podocyte differentiation (right). [score:8]
Down-regulation of miR-200 family fail to inhibit the RSAD2 protein expression in undifferentiated podocytes (left). [score:8]
To produce the point mutations (psiCHECK-MT- RSAD2) of the miR-200a/200b/429 targeting sites, the mutant fragments of RSAD2 3′-UTR (miR-200a/200b/429 targeting sites mutated to TGACAGG) were generated using the site-directed Gene Mutagenesis Kit (Beyotime, Haimen, Jiangsu, PR China). [score:7]
Moreover, The expressions of podocyte-specific markers, Nephrin, CD2AP and WT1 significantly down-regulated in miR-200a/200b/429 inhibitors-DMPC group (148.3 ± 18.1% of Nephrin, P < 0.001; 139.8 ± 18.6% of CD2AP, P < 0.001; 119.2 ± 12.5% of WT1, P < 0.001, Fig. 3c,d) compared with the DMPC group (256.0 ± 15.8% of Nephrin, P < 0.001; 226.8 ± 25.3% of CD2AP, P < 0.001; 180.2 ± 9.9% of WT1, P < 0.001, Fig. 3c,d). [score:7]
The miR-200 family directly regulates RSAD2 expression by targeting the 3′-UTR of RSAD2. [score:7]
In this study, we found that miR-200a, miR-200b and miR-429 were upregulated in DMPCs, whereas the expression of miR-200c and miR-141 were not affected (Fig. 1). [score:6]
More intriguingly, miR-200 family directly inhibited the RASD2 expression, which can reverse miR-200a/200b/429 -mediated promotion of cell differentiation (Fig. 8). [score:6]
Furthermore, the blockade of miR-200 family by RNA interference inhibited the expression of RASD2 and arrested cellular differentiation. [score:5]
Notably, the three miR-200a/200b/429 are all located on chromosome 4, which indicates a potential key role of the three members on chromosome 4 in podocyte differentiation, but not the other two members (miR-200c and miR-141) on chromosome 6. Thus, a negative control or miR-200a, miR-200b and miR-429 inhibitors were all co -transfected together into DMPCs for 48 h. We found that restraint of miR-200 family significantly inhibited podocyte differentiation (Figs 2 and 3). [score:5]
As shown above, overexpression of miR-200 family inhibited RSAD2 in HEK293 cells. [score:5]
Over -expression of RSAD2 combining with restraint of miR-200 family revealed inhibition of cell differentiation and proliferation. [score:5]
Consequently, we studied the effect of miR-200 family inhibition on the rearrangement of cytoskeleton and expression of biomarkers, which would reveal the effect of miR-200 family on podocyte differentiation. [score:5]
Indeed, comparative analysis of F-actin distribution revealed that the process extension was prominently inhibited in miR-200a/200b/429 inhibitors-DMPC (Fig. 3a). [score:5]
If this also holds true for podocytes, one might predict that restraint of miR-200 family expression combining with higher expression of RSAD2 may restrict podocyte differentiation. [score:5]
To confirm the biological function of miR-200 family in podocyte differentiation, we examined cell cycle distribution after a simultaneous inhibition of the expression of miR-200a, miR-200b and miR-429. [score:5]
All together, these results suggested that miR-200 family directly regulated the expression ofRSAD2 by interacting with its 3′-UTR. [score:5]
Besides, Nestin, the intermediate filaments -associated protein, was significantly down-regulated in miR-200a/200b/429 inhibitors-DMPC group (147.6 ± 9.3%) compared with the DMPC group (246.4 ± 21.1%, P < 0.001, Fig. 3c,d). [score:5]
Nephrin (green) and F-actin staining (red) of podocytes transfected with a microRNA inhibitor negative control or combination of miR-200a/200b/429 inhibitors were detected at 48 h. DAPI staining was used to detect nuclei and is merged with Nephrin and F-actin in their respective panels. [score:5]
In the present study, we demonstrated that miR-200a, miR-200b and miR-429 are significantly up-regulated during the podocyte differentiation. [score:4]
Upregulation of miR-200a, miR-200b and miR-429 during the differentiation of podocytes. [score:4]
Compared with DMPC group (76.3 ± 0.5%), a significant decrease of cells in the G0/G1 phase of cell cycle was observed following miR-200a, miR-200b and miR-429 co -inhibition (miR-200a/200b/429 inhibitors-DMPC group; 63.3 ± 4.5%, P < 0.001)(Fig. 2a). [score:4]
These data indicated that miR-200a/200b/429 negatively regulated RSAD2 expression by binding to the 3′-UTR of the RSAD2 gene. [score:4]
Semiquantification of F-actin expression showed that, compared with the DPMC group (166.7 ± 13.6%), the mean relative fluorescent intensity in each cell of the miR-200a/200b/429 inhibitors-DPMC group is significantly decreased (118.7 ± 11.6%, P < 0.001, Fig. 3b). [score:4]
showed that miR-200a (P < 0.01), miR-200b (P < 0.05) and miR-429 (P < 0.05) significantly down-regulated the luciferase activity of RSAD2 construct (Fig. 5a), whereas luciferase activity was not generated from the mutant construct (Fig. 5b). [score:4]
Our further assay by restraint of miR-200 family expression combining with higher expression of RSAD2 in podocytes showed a restriction of podocyte differentiation (Fig. 6), which further confirmed the pivotal role of miR-200s/RSAD2 signaling in podocyte differentiation. [score:4]
RSAD2 is a predicted target gene of miR-200 family. [score:3]
Over -expression of RSAD2 combining with restraint of miR-200 family revealed promotion of cell dedifferentiation and proliferation. [score:3]
Restraint of miR-200 family revealed inhibition of cell differentiation and apoptosis. [score:3]
Since restraint of miR-200 family inhibited podocyte differentiation, we further explored the effect of restraint of miR-200 family on podocyte apoptosis. [score:3]
We then looked for miR-200 family putative targets. [score:3]
Total RNA isolation and qPCR for detecting miR-200a, miR-200b, miR-429 and RSAD2 mRNA expression were carried out by the following procedures. [score:3]
Both of the web sites showed the same sequences of RSAD2 targeting by miR-200 family (Fig. 4a). [score:3]
The results showed that miR-200 family modulated cell differentiation through the inhibition of RSAD2. [score:3]
To investigate the expression level of miR-200 family during the differentiation of podocytes, a recent study in our laboratory has identified the miRNAs and mRNA expression levels in undifferentiated and differentiated podocytes using miRNA and mRNA microarray 16. [score:3]
The miRNA microarray showed that miR-200a, miR-200b and miR-429 expressions were significantly increased in differentiated podocytes (Fig. 1a). [score:3]
Hence, these findings indicate that miR-200 family may potentially promote podocyte differentiation through repression of RSAD2 expression. [score:3]
RSAD2 was a predicted target gene of miR-200 family. [score:3]
Several genes have been reported to be the targets of the miR-200 family, including ZEB1 29, ZEB2 30, Foxf2 31 and SIP1 32. [score:3]
MiR-200 family restraint reveals a significant inhibition in podocyte differentiation. [score:2]
Together, functional assays in podocytes demonstrated that miR-200 family inhibited RSAD2 to promote podocyte differentiation. [score:2]
Further real-time quantitative PCR (qPCR) assay showed that miR-200a (1996 ± 470, P < 0.01), miR-200b (543 ± 92, P < 0.01) and miR-429 (463 ± 74, P < 0.01) expressions were significantly increased in differentiated podocytes (Fig. 1b). [score:2]
The 1083 bp fragment of the RSAD2 3′-UTR containing the miR-200a/200b/429 targeting sequence (CAGTGTT) was cloned into the psiCHECKTM-2 dual Luciferase reporter plasmid (Promega, Madison, WI, USA) at the 3′ end of the coding sequence of R. reniformis luciferase to produce psiCHECK-WT- RSAD2 using PCR (primer Forward: 5′ ACCTCTGCC CTAACCTCACC CTC 3′; Reverse: 5′ GTTACCATACATTAGAGCGATGC 3′). [score:2]
Notably, the three members are all located on chromosome 4, which indicated a potential key role of the three members of miR-200 family in podocyte differentiation. [score:1]
Proposed mechanism of miR-200 family modulating RSAD2 protein and their roles in podocyte differentiation. [score:1]
We then constructed a vector containing the mutated 3′-UTR of the RSAD2 gene, and confirmed that the RSAD2 gene was regulated by miR-200a/200b/429 subfamily using a dual luciferase reporter assay (Fig. 5). [score:1]
In the present study, we show a relationship between miR-200 family and RSAD2 in podocyte differentiation. [score:1]
Restraint of miR-200 family affects cell cycle and apoptosis. [score:1]
Though the members of the miR-200 family (the miR-200b/200c/429 group and the miR-200a/141 group) share the similarities of their seed sequences 25, the biological function of miR-200a/200b/429 subfamily in our study may undergo a chromosome -dependent molecular mechanism. [score:1]
Restraint of miR-200 family affects differentiation marker and reveals rearrangement of cytoskeleton. [score:1]
How to cite this article: Li, Z. et al. miR-200 family promotes podocyte differentiation through repression of RSAD2. [score:1]
The miR-200a, miR-200b and miR-429 mimics and vectors containing the 3′-UTR of RSAD2 were transiently transfected into HEK293 cells. [score:1]
Since report has revealed the critical role of mir-200 family in cell proliferation 33, These results indicated that the novel role of the miR-200s/RSAD2 signaling in podocyte proliferation. [score:1]
[1 to 20 of 58 sentences]
4
[+] score: 243
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-200c
The relevant regulatory mechanisms may be indirect because some of them are up-regulated on miR-200 overexpression, and even down-regulated genes lack miR-200 binding sites on their 3′-UTRs, with the exception of Tgfb2 [30]. [score:11]
Yellow: genes up-regulated by miR-200 overexpression; blue: genes down-regulated by miR-200 overexpression. [score:11]
miR-200 down-regulates Bmp4 through GATA4 and GATA6To identify the mediators of miR-200’s suppressive effect on Bmp4 expression, we first searched for putative transcriptional regulators that act on the Bmp4 promoter. [score:9]
ZEB1, a transcription suppressor of miR-200, enhanced Bmp4 expression in a low metastatic lung cancer cell line (393P), but miR-200 suppressed Bmp4 expression in 344SQ (Fig.   1c) and 531LN2 (Additional file 1: Figure S4), which was confirmed by (Fig.   1d). [score:9]
Transcriptional profiling revealed that expression of several cytokines/chemokines and their receptors is up- or down-regulated by miR-200 overexpression (Fig.   1a). [score:8]
miR-200 down-regulated BMP4 via direct targeting of the GATA4 and GATA6 transcription factors that stimulate Bmp4 transcription. [score:7]
Of interest, Jag2-KD suppressed Bmp4 mRNA expression (Fig.   6g), which may be mediated by enhancing the expression of miR-200 family members, especially, miR-200b/200a/429 (Fig.   6h). [score:7]
In addition, miR-200b repressed Gata4 and Gata6 mRNA expression in 344SQ cells (Fig.   2d), and ectopic GATA4 or GATA6 expression in 344SQ_miR-200 cells reinstated the Bmp4 mRNA level suppressed by miR-200 (Fig.   2e). [score:7]
Recently, we published our findings that the miR-200/ZEB1 negative-feedback loop regulates CD8 [+] tumor-infiltrating lymphocytes by directly targeting PD-L1 expression [29], which strongly supports the idea that modulation of the immune system is a prerequisite to cancer metastasis. [score:7]
Mean + SD, n = 3; p, two-tailed Student’s t-test In the present study, we showed that miR-200 suppresses BMP4 indirectly through the GATA4 and GATA6 transcription factors and that BMP4 knockdown inhibits cancer cell growth, migration, invasion, and metastasis. [score:7]
On the basis of these data, we propose that miR-200 down-regulates Bmp4 through direct targeting of its transcription factors, GATA4 and GATA6. [score:7]
To identify the mediators of miR-200’s suppressive effect on Bmp4 expression, we first searched for putative transcriptional regulators that act on the Bmp4 promoter. [score:6]
Indirect regulation by miR-200 could be achieved through targeting of transcription factors such as ZEB1 [8], ETS1 [31], and GATA4/6, as proposed herein, which would vastly expand miR-200’s regulatory network. [score:6]
Bmp4 is down-regulated in miR-200 -overexpressing cells. [score:6]
The effect of miR-200 on BMP4 expression may not be mediated via direct 3′ -untranslated region (UTR) binding because there is no putative miR-200 binding site on Bmp4’s 3′ -UTR (http://www. [score:6]
Moreover, a recent finding suggests that direct targeting of MYH10 itself by miR-200a inhibits cell migration and tumor growth in meningiomas [34]. [score:6]
Up-regulation of BMP4 in metastatic-prone, mesenchymal lung cancer cells was first observed in our previous study, which aimed to identify the target genes of miR-200 systematically through a proteomic analysis coupled with stable isotope labeling by amino acids in cell culture (SILAC) and mass spectrometry [31]. [score:6]
org), and less chromosomal DNA of the Bmp4 promoter region was immunoprecipitated by an RNA polymerase II (Pol-II) antibody from 344SQ_miR-200 cells than from 344SQ_vec control cells (Fig.   1e), which clearly suggests transcriptional regulation of Bmp4 mRNA expression by miR-200 via indirect mechanisms. [score:5]
Among hundreds of genes down-regulated by miR-200, we focused on bone morphogenetic protein 4 (BMP4), a member of the transforming growth factor β (TGF-β) superfamily, which is involved not only in early embryonic development but also in cellular growth, differentiation, and tumorigenesis [9]. [score:5]
Ectopic expression of a miR-200 cluster (miR-200b/200a/429) in a highly metastatic murine lung adenocarcinoma cell line (344SQ) blocks EMT and metastasis and induces global gene expression changes [6]. [score:5]
miR-200b and 200c suppressed Gata4 3′ -UTR activity, and miR-200a inhibited Gata6 3′ -UTR activity as reported previously [13], which were restored by mutating the miR-200 binding sites on their 3′-UTRs (Fig.   2b and 2c). [score:5]
miR-200 down-regulates Bmp4 through GATA4 and GATA6. [score:4]
j Diagram of a regulatory loop involving BMP4, JAG2, and miR-200 To clarify the roles of BMP4 in lung tumorigenesis and metastasis, we analyzed the expression levels of Bmp4 mRNA and miR-200 family members in 13 KP cell lines (Fig.   1b and Additional file 1: Figure S1). [score:4]
ZEB1 and miR-200 form a double -negative feedback loop [7, 8] that plays a key role in determining the metastatic fate of epithelial cancers through the regulation of downstream target genes and microRNAs (miRNAs). [score:4]
BMP4 up-regulated JAG2, an upstream factor of miR-200; therefore,. [score:4]
We have clearly demonstrated here that BMP4 is indirectly suppressed by miR-200 and that BMP4 promotes tumor cell migration/invasion and metastasis. [score:4]
Previously, we reported that GATA factors are down-regulated by miR-200 [12, 13]. [score:4]
Based on these findings, we concluded that BMP4 is one of the key downstream factors that mediate miR-200’s effects on lung tumorigenesis and metastasis and is a candidate target for directed cancer therapy. [score:4]
In addition, Bmp4-KD increased miR-200b/200a/429 expression (Fig.   6i) by removing the negative regulator of miR-200, JAG2. [score:4]
MicroRNA-200 (miR-200) suppresses the epithelial-mesenchymal transition of various cancer cells, including lung adenocarcinoma cells. [score:3]
Expression of BMP4 is inversely correlated with that of miR-200. [score:3]
Mesenchymal-like cells exhibited higher Bmp4 mRNA expression than did epithelial-like cells, and Bmp4 tended to correlate negatively with miR-200 members. [score:3]
To clarify the roles of BMP4 in lung tumorigenesis and metastasis, we analyzed the expression levels of Bmp4 mRNA and miR-200 family members in 13 KP cell lines (Fig.   1b and Additional file 1: Figure S1). [score:3]
We found that bone morphogenetic protein 4 (BMP4) was decreased in miR-200 -overexpressing cells and epithelial-like lung cancer cells. [score:3]
To identify genes downstream of miR-200, we performed microarray -based transcriptional profiling in KP cells overexpressing a miR-200 cluster, miR-200b/200a/429 [6]. [score:3]
Promoter and 3′-untranslated region (UTR) luciferase reporter assays were performed to discover the mechanism of regulation of BMP4 by miR-200. [score:3]
j Diagram of a regulatory loop involving BMP4, JAG2, and miR-200 In this study, we investigated the function of BMP4, a TGF-β superfamily member, which is down-regulated by miR-200 in murine lung adenocarcinoma cell lines. [score:3]
Phase contrast microscope images of 3-D acini were taken 12 days after cell seeding We previously reported that JAG2, a Notch ligand, promotes lung adenocarcinoma metastasis by suppressing miR-200, which is mediated by GATA3 [12]. [score:3]
Similar to ectopic expression of miR-200, depletion of BMP4 also induced abnormal shape and multiple-lumen formation of 3-D acini (Fig.   4), which could be caused by misorientation of mitotic spindles [17, 18]. [score:3]
Fig. 2GATA4 and GATA6, transcription factors of BMP4, are miR-200 target genes. [score:3]
JAG2, miR-200, and BMP4 form a regulatory loop. [score:2]
BMP4 functions as a pro-tumorigenic factor in a murine lung cancer mo del, and its transcription is regulated by miR-200 and GATA4/6. [score:2]
Fig. 6JAG2, miR-200, and BMP4 form a regulatory loop. [score:2]
In addition, we integrated BMP4 into the JAG/Notch signaling pathway and proposed a regulatory loop consisting of JAG2, GATA3, miR-200, and BMP4 (Fig.   6h), suggesting that BMP4 interconnects with various cell signaling partners to induce tumorigenesis and metastasis in lung adenocarcinomas. [score:2]
From the tumors of these KRAS/p53-mutant mice (KP mice), we also established several murine lung cancer cell lines (KP cells) that exhibit various levels of metastatic potential mainly regulated by ZEB1 and microRNA-200 (miR-200) [6]. [score:2]
It is also noteworthy that miR-200 can regulate a variety of immune-related genes, including cytokines (e. g., Il11, Ifna1, Csf1, Tgfb2, Il7), chemokines (e. g., Cxcl12, Ccl6, Cxcl7), and their receptors (e. g., Tlr12, Lepr, Tlr1) (Fig.   1a). [score:2]
Collectively, we propose a regulatory loop comprising JAG2, GATA3, miR-200, GATA4/6, and BMP4 (Fig.   6j). [score:2]
Similarly, 344SQ_miR-200 cells formed irregular acini with multiple lumens (Fig.   4c), suggesting that the miR-200/BMP4 pathway regulates normal acinus formation in Matrigel 3-D culture. [score:2]
In summary, BMP4 functions as a pro-tumorigenic factor in a murine lung cancer mo del and is regulated by miR-200 and GATA4/6. [score:2]
Mean + SD, n = 3; p, two-tailed Student’s t-test Bmp4 knockdown suppresses migration, invasion, tumorigenesis, and metastasis of lung cancer cellsNext, to investigate the biological role of Bmp4 repression by miR-200, we depleted BMP4 in 344SQ cells (Fig.   3a) and H157 human lung cancer cells (Additional file 1: Figure S5A) by stable transfection of shRNAs. [score:2]
Similar negative correlations between Bmp4 and miR-200 members were also observed in human lung adenocarcinomas and breast invasive carcinomas (Additional file 1: Figure S2 and S3). [score:1]
Interestingly, Gata4 and Gata6 have conserved miR-200 binding sites on their 3′-UTRs: Gata4 has a miR-200b/200c/429 site and Gata6 has a miR-200a/141 site (http://www. [score:1]
Negative correlation between BMP4 and miR-200 family members in human lung adenocarcinomas. [score:1]
Negative correlation between Bmp4 and miR-200 family members in murine lung adenocarcinoma cells. [score:1]
3′-UTR reporters (500 ng) and pGL3-control (50 ng, Promega) were co -transfected into 344SQ cells seeded on 24-well plates (1x10 [5] cells/well) in the presence or absence of Pre-miR™ miR-200 precursors (5 nM, Ambion). [score:1]
i qRT-PCR of miR-200 family members in 344SQ-NTC and Bmp4-KD (#2 and #3) cells. [score:1]
BMP4 miR-200 Lung cancer Metastasis Lung cancer is the leading cause of cancer-related death in both men and women worldwide [1]. [score:1]
To test for direct interaction between miR-200 and these 3′-UTRs, we made Gata4 and Gata6 3′ -UTR reporter constructs and performed luciferase assays after co-transfection with miR-200 mimics. [score:1]
Blue: DAPI, red: β-catenin, green: ZO-1. c Matrigel 3-D culture of 344SQ_vec and miR-200 cells. [score:1]
Negative correlation between BMP4 and miR-200 family members in human breast invasive carcinomas. [score:1]
h qRT-PCR of miR-200 family members (200a, 200b, 200c, 141, and 429) in 344SQ- Jag2-KD and 344SQ-NTC. [score:1]
344SQ cells were co -transfected with control (con) or miR-200 mimics and 3′-UTR reporter constructs. [score:1]
[1 to 20 of 62 sentences]
5
[+] score: 237
miR-200 family members directly target Zeb1/Zeb2 and enhance E-cadherin expression, resulting in the suppression of murine mammary tumor cell migration [33, 36]. [score:8]
Furthermore, Grb2 expression was upregulated during EB formation, unlike miR-200a expression (Figure 2D). [score:8]
In this paper, we report that miR-200a was highly expressed in ES cells and gradually decreased in expression during embryoid body (EB) formation and that miR-200a suppressed endoderm and mesoderm lineage commitment. [score:7]
0068990.g004 Figure 4 (A) Brightfield images and AP staining of wild-type ES cells, miR-200a -expressing ES cells and exogenous Grb2 -expressing ES cells plus expressing miR-200a. [score:7]
Consistently, miR-200a -overexpressing ES cells displayed much lower Afp, Gata4 and alpha-Sma expression levels and higher Tuj1 and Nestin expression levels. [score:7]
Our findings showed that, in response to Grb2 knockdown or miR-200a overexpression, Gata4 and Afp expression was decreased. [score:6]
In contrast, Zeb1 suppresses the expression of miR-200 family members, forming a regulatory feedback loop [37]. [score:6]
The delivery of miR-200a mimics significantly suppressed Grb2 3’ UTR reporter luciferase activity more than 25% over the empty vector, and a mutation in the miR-200a binding site blocked this suppression (Figure 2B). [score:6]
A recent study demonstrated that miR-200a overexpression prevents the transformation of normal mammary cells and decreases cell migration by targeting the class III histone deacetylase silent information regulator 1 (Sirt1) [38]. [score:6]
Additionally, we found that miR-200a increased expression of the self-renewal -associated gene Oct4 and maintained the expression of Nanog (Figure 1C). [score:5]
Grb2 had been suggested to be a putative target for miR-200a according to the miRDB, miRanda, TargetScan, PicTar and miRWalk algorithms, as well as a recent study [47]. [score:5]
In our study, we found that miR-200a acted as an inhibitor of endoderm and mesoderm formation by repressing the expression of genes involved in mesoderm and endoderm formation. [score:5]
However, the function of miR-200a in the initiation of vertebrate embryo development has not been reported (A list of miR-200 family members targets in stem cells and development is shown in Table 1). [score:5]
These findings indicated that miR-200a specifically bound the predicted translation repressor site on Grb2 and repressed the expression of Grb2 in ES cells. [score:5]
Overexpression of miR-200a in ES cells suppressed differentiation into endoderm and mesoderm. [score:5]
We further identified Grb2 as a direct regulatory target of miR-200a. [score:5]
Under these conditions, in which miR-200a expression was rapidly induced, the Grb2 protein expression levels significantly decreased. [score:5]
miR-200a overexpression decreases Smad-3 activity and the matrix protein, including Collagen I, Collagen IV and Fibronectin, blocks the TGF-beta dependent epithelial-mesenchymal transition (EMT) process, and rescues early and advanced kidney disease in mouse mo dels [40]. [score:5]
Only the miR-200a -overexpressing ES cell colonies showed strong staining; the majority of the control and Grb2/miR-200a -overexpressing ES cell colonies showed faint or no staining under the same conditions. [score:5]
Taken together, these results suggest that miR-200a might control cell fate decisions affecting the early endoderm and mesoderm layers in a manner that is partly dependent on Erk signaling, by regulating Grb2 expression levels. [score:4]
These findings revealed that miR-200a directly targeted Grb2, thereby mediating Erk signaling. [score:4]
Our data showed that Grb2 knockdown or miR-200a overexpression likely mediated FGF signaling that stimulated layer formation. [score:4]
Knockdown of Grb2 overlaps phenotypically with the enforced expression of miR-200a. [score:4]
miR-200a also targets p38alpha and regulates the oxidative stress response, affecting tumorigenesis and chemosensitivity [39]. [score:4]
Taking these findings together, we postulate that Erk signaling and miR-200a maintain a balance in specific cell fate decisions such that Erk signaling regulates differentiation into the mesoderm and endoderm lineages and miR-200a suppresses differentiation into these lineages. [score:4]
0068990.g001 Figure 1 (A) The expression of miR-200a, miR-200b and miR-429 in ES cell diferentiation. [score:3]
This finding suggested that the overexpression of Grb2 partially reversed the changes in morphology and losses of endoderm and mesoderm formation that were induced by miR-200a. [score:3]
The miR-200 family consists of five members (miR-200a, -200b, -200c, -141 and -429) that are expressed as two separate polycistronic pri-miRNA transcripts. [score:3]
miR-200a targets Grb2 at the protein level. [score:3]
We found that miR-200a expression was markedly decreased during EB formation (Figure 1A). [score:3]
A 3’ UTR segment of wild-type Grb2 mRNA, which contained the putative target sites of miR-200a, was amplified and cloned into the SacI and XbaI sites downstream of the luciferase reporter gene in pGL3. [score:3]
To determine whether miR-200 family is responsive to ES cell differentiation, we analyzed miR-200 mumbers (miR-200a, miR-200b and miR-429) expression during ES cell spontaneous differentiation by quantitative real-time PCR. [score:3]
We found that miR-200a decelerated the process of ES cell differentiation, especially into the endoderm and mesoderm layers, as determined by the expression of marker genes. [score:3]
In mRNA level, miR-200a reduced the expression of Brachyury (T), alpha-Sma, Snail, Afp, Gata4 and Apoa1. [score:3]
To examine the role of miR-200a in the early differentiation processes of ES cells, we overexpressed miR-200a and performed differentiation experiments by withdrawing LIF 3 days. [score:3]
In contrast, expression levels of the ectodermal specific markers Tuj1, Pax6 and Nestin were increased in miR-200a treatment comparing to control (Figure 1E). [score:3]
Our findings demonstrated that miR-200a maintained ES cell pluripotency and suppressed differentiation capacity of endoderm and mesoderm. [score:3]
To further address the mechanisms underlying the effects of miR-200a, we predicted that Grb2 was a target of miR-200a repression and confirmed this by using a partial-length Grb2 3’ UTR reporter. [score:3]
An analysis of colony formation showed that ES cells that overexpressed miR-200a appeared to retain the classic compact morphology and well-defined borders of undifferentiated ES cell colonies. [score:3]
A pGL3-Grb2-3’UTR-Mutant vector, which carried a mutation in the complementary site for the seed region of miR-200a, was generated from the pGL3-Grb2-3’UTR-WT vector by mutation PCR. [score:3]
Our findings suggest that miR-200a mediates Grb2 expression, thereby blocking Erk activation, which leads to the arrest of endoderm and mesoderm lineage differentiation and promotes ectoderm lineage commitment. [score:3]
Grb2 as a novel and important target gene for miR-200a. [score:3]
miR-200a mimics and inhibitors (including the Negative control) were purchased from Ribo. [score:3]
Interestingly, during EB formation, lower levels of the primitive endoderm markers Afp, Gata4, Apoa1 and the mesoderm markers T, alpha-Sma and Snail were observed in response to miR-200a overexpression, as well as opposite effects on the ectoderm markers Tuj1, Pax6 and Nestin. [score:3]
Our results showed that the extraneous addition of miR-200a significantly repressed Erk activation, due to the loss of Grb2 expression. [score:3]
Immunostaining demonstrated that miR-200a-ES cell differentiation expressed low levels of alpha-Sma and Afp proteins (Figure 1D). [score:3]
In EB, knockdown of Grb2 with a specific shRNA had an identical effect to treatment with miR-200a. [score:2]
To confirm the post-translational repression of miR-200a, Grb2 3’ UTR reporter luciferase assays were performed. [score:2]
miR-200 family menbers in stem cells and development. [score:2]
Previous studies show that miR-200 family members are emerging as important regulators of cell proliferation, differentiation and metastasis [29– 31]. [score:2]
It was not clear whether miR-200a exerted its effects by negatively regulating multiple genes that are involved in ES cell identity. [score:2]
However, the colonies that overexpressed both Grb2 and miR-200a were flat and displayed abundant cytoplasmic prolongations when compared to the empty-vector control ES cells (Figure 4A). [score:2]
Finally, a rescue assay showed that exogenous Grb2 could reverse the miR-200a -induced endoderm and mesoderm suppression. [score:2]
Similarly, the extracellular signal-regulated kinase (Erk) signaling, when activated with assistance from Grb2, also rescued miR-200a -induced effects. [score:2]
In contrast, ectoderm genes were enhanced in response to miR-200a. [score:1]
The miR-200a-Grb2-Erk axis is therefore indispensable to layer formation in embryogenesis. [score:1]
The predicted interaction between the Grb2 3’ UTR and miR-200a is illustrated in Figure 2A. [score:1]
miR-200a is involved in endoderm and mesoderm formation in a Grb2 -dependent manner. [score:1]
The cells were subsequently transfected with a miR-200a vector, followed by the immediate induction of spontaneous differentiation. [score:1]
Furthermore, Grb2 supplementation rescued miR-200a -induced Erk inactivation and losses in endoderm and mesoderm differentiation after 10 days of EB formation. [score:1]
This finding suggested that Erk activation is controlled by miR-200a via the repression of Grb2 and that the main defect in miR-200a -induced endoderm and mesoderm formation was due to decreased Erk activation in response to reduced Grb2 levels. [score:1]
Neutralization of Grb2 rescues aberrant miR-200a -induced endoderm and mesoderm repression. [score:1]
Grb2 can rescue cells from the effects of miR-200a. [score:1]
Our data suggested that the effects of miR-200a might depend on the repression of Grb2. [score:1]
At 48 h post-transfection, Western blotting analysis showed that miR-200a reduced the level of endogenous Grb2 protein, whereas the Grb2 protein level was rescued from endogenous miR-200a by the sponge 200a treatment of ES cells (Figure 2C Figure S1A). [score:1]
Figure S1(A) Quantifications of Grb2 in miR-200a and Sponge 200a treated ES cells in Figure 2C. [score:1]
The miR-200a sequence was obtained from the mirbase website and cloned into the AgeI and EcoRI sites of the pL KO. [score:1]
To construct a miR-200a sponge vector, the following oligoribonucleotides for the miR-200a sponge were designed and synthesized: miR-200a sponges forward oligo, CCGGTACATCGTTACTCTCAGTGTTACCGACATCGTTACTCTCAGTGTTAGCGACATCGTTACTCTCAGTGTTAG; reverse oligo, AATTCTAACACTGAGAGTAACGATGTCGCTAACACTGAGAGTAACGATGTCGGTAACACTGAGAGTAACGATGTA. [score:1]
We observed that miR-200a promoted retention of the ES cell-like morphology and had high alkaline phosphatase activity at the epiblast-like stem cell stage. [score:1]
In miR-200a -treated cells, both the Grb2 protein and the Erk phosphorylation levels were low. [score:1]
In previous studies, miR-200 family members were shown to promote the mesenchymal-epithelial transition (MET) and to activate the differentiation of pancreatic, colorectal and breast cancer cells into epithelial cells [33– 35]. [score:1]
0068990.g002 Figure 2 (A) Outline of the interaction of miR-200a with the Grb2 3’ UTR. [score:1]
The addition of miR-200a or Sponge 200a to ES cells further validated the potent and specific miR-200a-Grb2 connection at the protein level. [score:1]
To study the effects of miR-200a on spontaneous differentiation, we analyzed marker genes for the three layers. [score:1]
We supposed that miR-200a would be involved in the formation of the endoderm and other layers. [score:1]
Effects of miR-200a in ES cells and ES cell differentiation. [score:1]
To investigate whether the Grb2-miR-200a interaction is needed for the spontaneous differentiation of ES cells in vitro, ES cells were infected with a lentiviral vector that overexpressed Grb2 without the 3’ UTR. [score:1]
[1 to 20 of 77 sentences]
6
[+] score: 202
The miR-200 target gene Zeb2 is down-regulated and E-cadherin is up-regulated in 4T1 cells. [score:9]
Over -expression of miR-200 in 4TO7 cells down-regulates Zeb2 expression, resulting in increased E-cadherin. [score:8]
The low expression of Zeb2 protein in 4T1 cells relative to 168FARN and 4TO7 cells is consistent with inhibition of Zeb2 translation by miR-200. [score:7]
Expression of miR-200, which promotes a mesenchymal to epithelial cell transition (MET) by inhibiting Zeb2 expression, unexpectedly enhances macroscopic metastases in mouse breast cancer cell lines. [score:7]
As a consequence of miR-200 expression, 4T1 cells have reduced Zeb2 expression and high E-cadherin expression compared to 4TO7 cells. [score:6]
The most prominent change in miRNA expression by microarray analysis between the three cell lines not able to colonize distant sites (67NR, 168FARN and 4TO7 cells) and 4T1 cells was up-regulation of several members of the miR-200 family in 4T1 cells (Figure 1A, Table S1). [score:6]
Protein expression of Zeb2 protein negatively correlates and E-cadherin positively correlates with miR-200 expression. [score:5]
The effect of exogenous miR-200 expression on E-cadherin expression and cell morphology of 4TO7 cells was also analyzed by fluorescence microscopy (Figure 4). [score:5]
To determine whether a gene was also a predicted target of miR-200b and c, the presence of miR-200 family binding sites was analyzed using TargetScan 5.0 (www. [score:5]
miR-200 over -expression in 4TO7 cells reduces Zeb2 and Snai1 and increases E-cadherin expression. [score:5]
Neither miR-200a nor miR-141 expression was detected in any of the cell lines, which is surprising since they would be expected to be co-expressed on the same primary transcript with the other clustered miRNAs. [score:5]
The TargetScan5.0 algorithm identified the zinc finger E-box binding homeobox 2 (Zeb2/SIP1/ZFXH1B) gene as the highest likelihood target gene of the miR-200 family with 6 potential miR-429/miR-200b/miR-200c binding sites and an additional 3 potential miR-141/miR-200a binding sites in its 3′UTR. [score:5]
The cells incapable of colonization had very low to undetectable expression of all miR-200 family members, while 4T1 cells expressed miR-429, miR-200b and miR-200c. [score:5]
This miRNA -mediated silencing of Zeb2 was the result of the directed targeting of the Zeb2 3′UTR by the miR-200 family, as previously reported [30]– [37]. [score:4]
This up-regulation of miR-200 family members was particularly pronounced in serous and endometroid histotypes. [score:4]
To test the direct targeting of Zeb2 by miR-200, the complete Zeb2 3′-UTR was cloned downstream of a Renilla luciferase reporter gene. [score:4]
Patients with ovarian tumors with high miR-200a expression had an approximately 50% decrease in median survival time compared to those lacking significant miR-200a expression (27.5 months vs. [score:4]
The miR-200 family is up-regulated in 4T1 cells. [score:4]
To determine whether miR-200 regulates Zeb2 and E-cadherin expression in these breast cancer cell lines, we transfected 4TO7 cells with mimics of miR-200b or miR-200c alone or in combination. [score:4]
4TO7 cells over -expressing miR-200 or knocked down for Zeb2 morphologically resembled 4T1 cells. [score:4]
Croce and colleagues found that the miR-200 family (miR-200a, miR-200b, miR-200c and miR-141) were upregulated in human ovarian cancers compared to normal ovarian tissue [51]. [score:3]
No significant signal was detected for miR-200a and 141 (N. D.  = not detected), averaged signal for all samples below 500), but the remaining miR-200 family members were highly expressed in 4T1 cells relative to the less metastatic 67NR, 168FARN, and 4TO7 cells. [score:3]
These findings are surprising since the miR-200 family was previously shown to promote epithelial characteristics by inhibiting the transcriptional repressor Zeb2 and thereby enhancing E-cadherin expression. [score:3]
Figure S1 The Zeb1 3′-UTR is a target of the miR-200 family of miRNAs. [score:3]
The lack of miR-200a and miR-141 expression was confirmed by quantitative RT-PCR analysis (data not shown). [score:3]
Moreover, over -expressing miR-200 in 4TO7 cells enabled them to metastasize to lung and liver. [score:3]
Although highly homologous, the miR-200 family members (miR-141, miR-429, miR-200a, miR-200b and miR-200c) can be divided into two functional groups based on their seed sequences, nucleotides 2 to 7 of the miRNA, which play an important role in target recognition. [score:3]
Based on the EMT hypothesis of cancer metastasis, it is expected that miR-200 expression would lead to a decrease in metastasis. [score:3]
Altering miR-200 or Zeb2 expression did not significantly change the number or size of colonies (Figure 6A, data not shown). [score:3]
Moreover, over -expression of the miR-200 family significantly correlated with decreased survival. [score:3]
Surprisingly, our results with this series of isogenic mouse mammary tumor cells showed the opposite effect - expression of miR-200 family members either endogenously in 4T1 cells or by retroviral transduction in 4TO7 cells enhanced both in vitro motility and in vivo metastases. [score:3]
We cannot rule out that some of the 4T1 or miR-200 -expressing 4TO7 cells transiently became E-cadherin- and more mesenchymal in vivo under the influence of local stromal factors. [score:3]
4T1 cells and miR-200 -expressing 4TO7 cells did not differ from parental 4TO7 cells in proliferative rate in vitro or growth in soft agar, but they both established primary tumors more rapidly and were capable of colonizing distant tissues. [score:3]
miR-200 expression does not alter colony formation or cell proliferation, but enhances cell motility in vitro. [score:3]
0007181.g001 Figure 1 (A) miRNA microarray analysis of miR-200 family expression in 4 isogenic mouse breast cancer cell lines. [score:3]
The members of the miR-200 family of miRNAs (miR-200b, miR-200c and miR-429) were highly expressed in 4T1 cells but undetectable in 4TO7 cells. [score:3]
Higher expression of the miR-200 family in the cell line capable of forming distant metastases was unexpected since the miR-200 family has been linked to epithelial differentiation [30]– [36] that is normally associated with decreased metastatic potential. [score:3]
Exogenous miR-200 expression enhances the epithelial morphology of 4TO7 cells. [score:3]
4TO7 cells treated with either of the miR-200 mimics adopted an epithelial-like morphology and expressed high levels of E-cadherin, similar to the highly metastatic 4T1 cells. [score:3]
miR-200 expression in 4TO7 cells confers in vivo metastatic potential. [score:3]
These studies also showed that miR-200 expression enforces an epithelial phenotype in tumor cells, as we confirmed here in these mouse breast cancer cells. [score:3]
However, the 4T1 and miR-200 -expressing 4TO7 cells retained some vimentin expression, suggesting that they may have some characteristics of both epithelial and mesenchymal cells. [score:3]
Although there was a delay in detecting 4TO7 primary tumors relative to 4T1 or miR-200 -expressing 4TO7 tumors, once tumors became palpable, mathematical mo deling did not show any significant change in their doubling times (data not shown). [score:3]
Over -expression of miR-200 in 4TO7 cells converts fibroblastic cells to an epithelial morphology. [score:3]
In fact, the more epithelial 4T1 and miR-200 -expressing 4TO7 cells were better able to traverse an artificial basement membrane in vitro than their more mesenchymal relatives. [score:3]
In addition, they are encoded from 2 gene clusters in mice - miR-200c and miR-141 on chromosome 6 and miR-200b, miR-200a and miR-429 on chromosome 4. In agreement with recent papers [30]– [37], we found that the miR-200 family members target the transcriptional repressor Zeb2. [score:3]
Unlike Zeb2, Snai1 is not a predicted target of the miR-200 family. [score:3]
MiR-200 family member expression distinguishes highly metastatic 4T1 cells from 67NR, 168FARN, and 4TO7 cells. [score:2]
4T1 cells that form macroscopic metastases had elevated expression of miR-200 family miRNAs compared to related cells that invade distant tissues, but are unable to colonize. [score:2]
Although this paper is the first to show the direct enhancement of metastasis by the miR-200 family, changes in miR-200 family levels have been associated with enhanced tumorigenesis. [score:2]
In addition, members of the miR-200 family of miRNAs, miR-141 and miR-200b, were found to be over-expressed in malignant cholangiocarcinoma cells compared to non-malignant cells [55]. [score:2]
Expression of some members of the miR-200 family of miRNAs (miR-429, miR-200b, and miR-200c) was increased more than 100-fold in 4T1 cells compared to 4TO7 cells. [score:2]
In particular, it would be worthwhile to examine whether the miR-200 family might have a role in regulating the metastasis of different human breast cancer subtypes. [score:2]
To evaluate the effect of miR-200 and Zeb2 on tumor formation and metastasis, we next engineered retroviruses encoding the miR-141-200c cluster mature miRNAs or control virus expressing firefly luciferase shRNA or Zeb2 shRNA within the miR-30 stem. [score:1]
The 2 groups differ by a single seed nucleotide - miR-200b, miR-429 and miR-200c share the 5′-AAUACU-3′seed sequence and miR-200a and miR-141 have the 5′-AACACU-3′ seed. [score:1]
miR-200 enhances 4TO7 cells migration through a basement membrane, but does not affect cell proliferation. [score:1]
[1 to 20 of 56 sentences]
7
[+] score: 187
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-214, hsa-mir-200b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, hsa-mir-200c, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-200a, hsa-mir-130b, hsa-mir-376a-1, mmu-mir-376a, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, hsa-mir-429, mmu-mir-429, hsa-mir-450a-1, mmu-mir-450a-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-130b, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, hsa-mir-450a-2, dre-let-7j, hsa-mir-376a-2, mmu-mir-450a-2, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Some of the miR-9 and miR-200-class targets upregulated in the mutant OE (Qk, Foxf2) are mesenchymally-expressed rather than OE-expressed, while other targets were actually downregulated in the absence of Dlx5 (Akap6, Elmod1, Snap25) (Table 1C). [score:15]
We found eight miRs differentially expressed, six down-regulated (miR-9, miR-141, miR-200a, miR-200b, miR-429 and miR-376a) and two up-regulated (miR-450a-5p and miR130b*) in the Dlx5 [−/−] OE (Fig.  1a). [score:9]
To determine whether the forced expression of DLX5 may result in an upregulation of miR-9 and miR-200-class RNAs, SH-SY5Y cells were transfected with myc-tagged wild-type DLX5 or Q178P mutant DLX5 expression vectors, and the relative abundance of miR-9 and miR-200 was quantified by Real-Time qPCR. [score:8]
Thus, Dlx5 is likely to regulate the expression of miR-9.3 directly, and the expression of miR-200a/ b/ miR-429 indirectly. [score:8]
In summary, since miR-9 and miR-200-class are down-modulated in the absence of Dlx5, while Foxg1 protein level is up-regulated, and since the 3′ UTR of the Foxg1 mRNA is a predicted target of these miRs, we can infer that the Dlx5-miR-Foxg1 regulation is most likely a direct one. [score:8]
Two possible explanations: either changes in the abundance of miR-9 and miR-200-class cause changes in the abundance of target RNAs that are too modest to pass the imposed cut-off value, or these miRs preferentially affect translation and not stability of the target mRNAs. [score:7]
For chromatin immunoprecipitation (ChIP) we used the human SHSY-5Y neuroblastoma cells, which express low endogenous levels of Dlx5, miR-9 and miR-200, transfected with 5 μg of DLX5-myc-tag expression vector (from Open-Biosystem) or with the same vector in which the Q178P mutation (Shamseldin et al., 2012) was introduced (BioFab, Rome, sequence verified). [score:6]
A significant enrichment of miR-9 and miR-200-class target sequences was detected in the 3′ UTR of genes up-regulated in the Dlx5 [−/−] OE (Table 1A, B). [score:6]
myc-tagged version of either the WT or the Q178P mutant DLX5 were expressed in the SH-SY5Y human neuroblastoma cells, which express DLX5, miR-9 and miR-200 endogenously. [score:5]
We also show that Dlx5 promotes expression of miR-9 and miR-200 class, thereby tends to repress Foxg1 protein translation. [score:5]
•Dlx5 controls the expressions of miR9 and miR-200, which target the Foxg1 mRNA • miR-9 and -200 are needed for olfactory neurons differentiation and axon extension • miR-9 and -200 are required for the genesis and position of GnRH neurons. [score:5]
2.9To downmodulate endogenously expressed miR-9 and miR-200 we used the commercially available Ambion anti-miR inhibitors (Life Technologies). [score:5]
To downmodulate endogenously expressed miR-9 and miR-200 we used the commercially available Ambion anti-miR inhibitors (Life Technologies). [score:5]
On the contrary, DLX5 overexpression did not induce changes in miR-200 expression, either in SH-SY5Y (Fig.  2d) or in GN11 (neuroendocrine) or in U2OS (osteosarcoma) cells (data not shown). [score:5]
Next we intersected the predicted miR-9 and miR-200-class targets with the coding mRNAs found to be differentially expressed in the Dlx5 [−/−] OE compared to the WT (Garaffo et al., 2013). [score:4]
Alternatively the expression of miR-200a/ b/ miR-429 could require additional transcription (co)factors not present in these cells. [score:3]
To overexpress miR-9 and miR-200 exogenously we used commercially available Ambion pre-miR precursors (Life Technologies). [score:3]
miR-200a, miR-200b, miR-141 and miR-429 share the same seed sequence and likely target the same mRNAs; for this reason they are grouped in a single miR class (named miR-200-class). [score:3]
The 3′ UTR of tetrapod and zebrafish Foxg1 mRNAs hosts miR-9 and miR-200 target sequences. [score:3]
To functionally demonstrate a role of miR-9 and miR-200-class for olfactory development, and the involvement of Foxg1 in this regulation in vivo, the zebrafish mo del was again used. [score:3]
3.7To determine whether miR-9 and miR-200-class play a role in GnRH neuronal differentiation and migration, we used the GnRH3:GFP transgenic zebrafish strain, in which the GFP reporter is expressed under the transcriptional control of a fragment of the z- GnRH3 promoter. [score:3]
Searching for functionally relevant targets of miR-9 and miR-200 clsss in the OE. [score:3]
Here we show that mouse and fish foxg1 mRNA is a target of miR-9 and miR-200 class, both of which are down-modulated in the Dlx5 null embryonic OE. [score:3]
We also show that miR-9 and miR-200-class target (amongst others) the foxg1 mRNA, through which they likely exert their functions. [score:3]
Instead, we could easily monitor the number and position of early GFP -expressing neurons, and noted that upon depletion of miR-200 class they appear reduced in number but normally clustered. [score:3]
To determine whether miR-9 and miR-200-class play a role in GnRH neuronal differentiation and migration, we used the GnRH3:GFP transgenic zebrafish strain, in which the GFP reporter is expressed under the transcriptional control of a fragment of the z- GnRH3 promoter. [score:3]
The results presented here indicate that loss of Dlx5 causes a down-modulation of miR-9 and of miR-200-class, which results in the over -expression of the Foxg1 protein. [score:3]
3.6To functionally demonstrate a role of miR-9 and miR-200-class for olfactory development, and the involvement of Foxg1 in this regulation in vivo, the zebrafish mo del was again used. [score:3]
In the same cells, the expression of pre -miR-200 led to a 3.9-fold decrease in Foxg1 proteins level (Fig.  3c). [score:3]
The most abundant miRs expressed in the developing mouse OE are: the miR-200-class (- 200a, - 200b, - 200c, - 141 and - 429), miR-199, miR-152, miR-214, miR-205, miR-183, miR-182 and miR-96 (Choi et al., 2008). [score:3]
Examining olfactory development more thoroughly we now can implicate the miR-9 and miR-200-class networks in a more complex phenotype reminiscent of the Kallmann syndrome (see below). [score:2]
Another indication comes from a study in zebrafish, showing a role of miR-200-class for olfactory development (Choi et al., 2008). [score:2]
To determine whether miR-9 and miR-200-class may modulate Foxg1 protein level, the effect of introduction of pre-miR-9 or depletion of endogenous miR-9 on Foxg1 protein level was assayed by Western blot analysis in SH-SY5Y cells, which express DLX5, miR-9, miR-200-class and Foxg1 endogenously. [score:2]
Thus, both miR-9 and miR-200 negatively regulate Foxg1 protein level. [score:2]
Genomic regulation of miR-9 and miR-200 by Dlx5. [score:2]
miR-9 and miR-200-class regulate Foxg1. [score:2]
In this work we define the role of miR-9 and miR-200-class in the development of the olfactory system, with functions ranging from ORN differentiation to axon guidance, glomerulus formation and GnRH neuron migration. [score:2]
We predicted one Dlx5 binding site near the miR-9.2 locus, located about 1.5 kb downstream, three sites near the miR-9.3 locus, located about 4, 5 and 6 kb downstream, and two sites near the miR-200a–200b-429 locus, located about 5 kb upstream (Fig.  2a). [score:1]
Starting from profile data obtained from a mouse mo del of Kallmann syndrome, we functionally examined this pathway in zebrafish showing that miR-9 and miR-200-class are required for normal differentiation of the ORNs, for the extension and connectivity of the olfactory axons, and for the migration of the GnRH neurons from the nasal primordium to the forebrain. [score:1]
It has also been shown that miR-200 represses neural induction of human embryonic stem cells, via modulation of Pax6 and Zeb transcription factors (Du et al., 2013). [score:1]
Since miR-200a, miR-200b, miR-141 and miR-429 share very similar seed sequences (Suppl. [score:1]
miR200a and miR200b could not be tested by in situ hybridization due to high sequence conservation between all members of the miR-200-class. [score:1]
To complement the previous (static) data with live images of the migrating GnRH3 neurons, we carried out few time-lapse video recordings on untreated (4) and z- miR-200-class MO injected (4) embryos at earlier ages (36–52 hpf), in order to observe the first appearance of these neurons. [score:1]
We depleted the miR-200 class in fish zygotes, by injecting a mix of anti -miR-200 MO previously described and found to efficiently down-modulate several miR of the class-200 and to affect ORN differentiation (Choi et al., 2008). [score:1]
We previously verified that the depletion of miR-9 and miR-200-class in zebrafish embryos leads to higher level of z-foxg1 mRNA (no Ab efficiently recognizes the z-foxg1 protein). [score:1]
The 3′ UTR of the mammalian and fish Foxg1 mRNA contains seed sequences for miR-9 and miR-200 (Suppl. [score:1]
The abundance of z-hoxa-7a and z-hoxa-10b mRNAs did not greatly change, indicating that the differentiation delay observed upon depletion of miR-200-class is specific. [score:1]
Thus, our results provide the first evidence of the participation of miR-9 and miR-200-class in these early events. [score:1]
z-foxg1 mRNA level increased by three-folds when either miR-9 or miR-200-class were depleted (Figs.  5e and 6f). [score:1]
In control embryos, we counted an average of 13 (+/− 2) GnRH3::GFP + neurons/embryo at 72 hpf, while in miR-9 and miR-200 MO injected embryos the average number was, respectively, 5 (+/− 1) and 6 (+/− 1) (Suppl. [score:1]
3.4The 3′ UTR of the mammalian and fish Foxg1 mRNA contains seed sequences for miR-9 and miR-200 (Suppl. [score:1]
Depletion of miR-9 and miR-200-class in zebrafish results in altered GnRH neuron genesis and position. [score:1]
Previous results in which zebrafish embryos were injected with anti- miR-200 class MOs found a delayed ORN differentiation, but axonal organization and GnRH neuron migration was not assessed (Choi et al., 2008). [score:1]
com/request/, while the anti- z-miR-200 MO mix was as previously published (Choi et al., 2008). [score:1]
Similarly, the depletion of miR-200-class (N = 23) resulted in a reduced number of GFP + neurons in 22% of GFP + embryos with the phenotype “reduced number” and 50% of the cases showing the phenotype “scattered position” (Fig.  7). [score:1]
We used the same MOs indicated above to deplete miR-9 and miR-200 class in GnRH3::GFP zygotes, and examined the effect on the number and position of the GFP + neurons associated to the terminal nerves, between 36 and 72 hpf. [score:1]
In Danio rerio (zebrafish) the miR-200-class is required for the proliferation, differentiation and survival of ORNs (Choi et al., 2008). [score:1]
Upon injection of the anti-miR-200 MO mix, only about 24% of examined embryos turned out CFP + (vs. [score:1]
To test whether the DLX5 protein physically occupies the Dlx5 sites near the miR-9.3 and miR-200a/ b/ miR-429 loci, Chromatin Immuno-Precipitation (ChIP) analysis on these sites was performed. [score:1]
The miR-200a, - 200b and - 429 loci are closely located on chromosome 4, while miR-141 and -200c are closely located on chromosome 6. miR-376a is clustered with 16 other miRs on chromosome 12. [score:1]
Using reporter zebrafish strains to visualize the embryonic olfactory axons (Miyasaka et al., 2005; Sato et al., 2005; Yoshida et al., 2002) or the GnRH + neurons (Abraham et al., 2008, 2009, 2010), we show that miR-9 and miR-200-class play a role in ORN differentiation and axonal organization. [score:1]
miR-9 and miR-200 mediate the Dlx5-Foxg1 cascade. [score:1]
Depletion of miR-9 and miR-200-class in zebrafish results in delayed ORN differentiation. [score:1]
We injected anti- miR-9 and anti- miR200 (or control) MOs in WT zygotes, then at 48 hpf we extracted total -RNA from these and carried out Real-Time qPCR analyses. [score:1]
[1 to 20 of 64 sentences]
8
[+] score: 177
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-191, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-let-7d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, mmu-mir-429, mmu-mir-449a, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, mmu-mir-449c, mmu-mir-449b, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-124b
These results argue that lfng and zfhx1 can be efficiently downregulated by the miR-200 family alone, whereas foxg1 and neuroD, although likely genuine targets, may require the combined action of several miRNA species in addition to miR-200 action, in order to be efficiently downregulated. [score:9]
Our data show that expression patterns of genes expressed throughout the brain and in areas devoid of miR-200 family expression were comparable between wild-type and triple MO morphants, indicating that widespread neural defects were absent in the morphant fish (Figure 7D). [score:7]
Intriguingly, miR-200 family members are coordinately expressed from different loci, yet members express different 5′ seed heptamers, changes in which are thought to alter the binding specificity to target mRNA (Doench and Sharp, 2004; Lewis et al., 2005). [score:7]
Knocking down the expression of mature miR-200 family members led to impairment of mature olfactory marker expression and expansion of the early marker, foxg1, in the olfactory primordium. [score:6]
Expression of the miR-200 family can be detected in olfactory placodes as early as E9.5, which is the first identifiable stage of olfactory development, with continued expression within the MOE anlage in the posterodorsal aspect of the olfactory pit at E11.5 (Figure 2B). [score:6]
In addition, in situ hybridization analyses (Figure 7C) show that a mixture of all three morpholinos (Triple MO mix: miR-141 MO, miR-200b MO, and miR-429 MO) was sufficient to simultaneously inhibit the expression of all five mature zebrafish miR-200 family members to threshold levels of detection. [score:5]
We conclude that foxg1, zfhx1, and lfng are likely to be genuine targets for miR-200 family members in both mouse and zebrafish olfactory systems, while neuroD might only be a target in the fish. [score:5]
Antisense morpholino experiments in zebrafish reveal that the inhibition of expression of a single miRNA family, miR-200, largely phenocopies the defect in terminal olfactory differentiation resulting from lack of Dicer function in mouse olfactory progenitor cells. [score:5]
Exogenous miR-200 duplex RNA was able to reduce expression of the lfng and zfhx1 reporters, while miR-200 duplexes did not affect GFP expression levels for the foxg1 and neuroD reporters (Figure 8B). [score:5]
Finally, 8 of 24 miRNA probes, including miR-200a and miR-200b, as well as miR-96, miR-141, miR-182, miR-183, miR-191, and miR-429, revealed robust expression in the MOE and VNO neuroepithelium, with weaker expression in the adjacent respiratory epithelium (Figure 2A, right column, and Table S3). [score:5]
Embryos injected with either miR-141/miR-200a or miR-200b/miR-429 pairs of antisense morpholinos showed lack of expression of the corresponding miR-200 members with a given 5′ seed but did not display any change in OMP expression relative to wild-type controls (data not shown). [score:5]
Moreover, increased foxg1 expression observed in the zebrafish morpholino experiments and in the mouse conditional Dicer microarray experiments (Table S3) also suggests that foxg1 may be a genuine miR-200 family target. [score:5]
As predicted from sequence analyses and thermal stability calculations, miR-141 MO specifically inhibited miR-200a and miR-141, miR-200b MO specifically inhibited miR-200b and miR-200c, and miR-429 MO specifically inhibited miR-429 (Figure S4B). [score:5]
In situ hybridization analyses using LNA antisense probes to detect mature miRNAs indicated that 4 ng per embryo per miR-200 family member was the minimal dose required to knock down miRNA expression to threshold levels of detection (data not shown). [score:4]
Taken together, these results indicate that in the absence of miR-200 family expression during olfactory placodal development, zebrafish olfactory progenitors are unable to undergo normal terminal differentiation and, instead, undergo apoptosis. [score:4]
We conclude that mature zebrafish miR-200 family members can be specifically and efficiently knocked down in various combinations in the developing olfactory system using antisense morpholinos without confounding “off-target” effects. [score:4]
Due to the molecular and cellular similarity of mouse and zebrafish olfactory development processes and the high degree of conservation between the miR-200 miRNAs in the respective organisms, we reasoned that physiologically meaningful targets were likely to be conserved between the zebrafish and mouse genomes. [score:4]
Preliminary data suggest that lunatic fringe (lfng) and zinc-finger homeobox 1 (zfhx1), two key factors associated with Notch and BMP pathways, respectively, as well as foxg1, a transcription factor required for normal olfactory development, may be relevant miR-200 targets. [score:4]
However, miR-141 and -200a express different 5′ seed heptamers from miR- 200b, -200c, and -429 and are thus likely to form two functional subgroups within the miR-200 family (Figure 2C; Doench and Sharp, 2004; Lewis et al., 2005). [score:3]
A subset, including the miR-200 family, shows high olfactory enrichment and expression patterns consistent with a role during olfactory neurogenesis. [score:3]
In the adult, the expression pattern of all miR-200 family members is restricted to the immature and mature neuronal cell layers of the MOE and is excluded from the basal and sustentacular cell layers (Figure 2B). [score:3]
The strong, specific, and coordinated expression of miR-200 members in the MOE anlage and in the mature and immature MOE is consistent with a potential role of this miRNA family during MOE neurogenesis. [score:3]
In order to further validate the physiological requirement for miR-200's action on these targets, we generated GFP reporters containing the full-length 3′ UTRs for zebrafish neuroD, foxg1, zfhx1, and lfng (Giraldez et al., 2006). [score:3]
As shown in Figure 3C, miR-200a is wi dely expressed throughout the developing MOE neuroepithelium in embryonic day 13.5 (E13.5) wild-type mice. [score:3]
Notch and TGFβ Signaling Pathways and Foxg1 Are Candidate Targets of the miR-200 Family. [score:3]
In addition, other predicted miR-200 family targets may also contribute to the olfactory phenotypes observed in morphant fish and the Foxg1-Cre;Dicer [loxP/loxP] mutant mice. [score:3]
In addition, our preliminary microarray and GFP-sensor experiments suggest that foxg1 itself, as well as lunatic fringe (lfng) and zinc-finger homeobox 1 (zfhx1), two key factors associated with Notch and BMP pathways, respectively, may be genuine miR-200 targets. [score:3]
From the over 100 distinct miRNAs identified in olfactory tissues, the most abundant miRNAs isolated from our study include species that are wi dely expressed in many neural tissues (miR-124a and let-7 variants), as well as a highly restricted family of miRNAs (miR-200). [score:3]
Recently, independent reports have demonstrated that the miR-200 family is highly expressed in skin epidermal cells (Yi et al., 2006). [score:3]
By contrast, we identified 12 miRNAs corresponding to 9 families (miR-199, miR-140, miR-152, miR-214, miR-205, miR-200, miR-183, miR-182, miR-96) that displayed highly enriched expression in the olfactory system (Figure 1A). [score:3]
To gain further insights into the role of the miR-200 family in mediating olfactory differentiation, we used a bioinformatic approach to predict and validate potential miR-200 targets. [score:3]
Thus, the regulatory step involving the miR-200 family, and shown here to be essential for olfactory neurogenesis, may be employed by other systems of epithelial origin to ensure the proper mediation of critical signaling cascades during development. [score:3]
Accordingly, we decided to focus our efforts on potential functions mediated by the miR-200 family, which is among the most highly and most specifically miRNA subset expressed in the developing olfactory system. [score:3]
All individual members of the miR-200 family display similar expression patterns. [score:3]
We designed three morpholino antisense oligonucleotides predicted to each target the mature sequence of one or a few members of the miR-200 family (Figure S4A). [score:3]
Morpholinos targeting the miR-200 family were generated as described in. [score:3]
Moreover, as shown in the mouse, miR-200 family members display early expression in zebrafish (Wienholds et al., 2005) and appear highly enriched in olfactory tissues by the time olfactory placodes arise at 26 hpf (Figure 7A). [score:3]
In marked contrast, miR-200a expression is undetectable in the MOE of E13.5 Foxg1-Cre [+/−]; Dicer [loxP/loxP] mutants, despite the fact that the main olfactory epithelium is still present at this stage, as revealed by Foxg1 staining in adjacent sections (Figure 3C). [score:3]
The function of miR-200 during olfactory development is likely to be conserved throughout evolution, as judged from the absolute conservation of miR-200 orthologs between mouse and zebrafish with respect to the relative genomic clustering position, the conserved seed region sequences, the conserved size of the family, and the conserved arm of the hairpin that generates the mature miRNA (Figure S3). [score:2]
The morpholino knockdown experiments show that miR-200 family members are likely to act redundantly, even though they display different 5′ seed regions. [score:2]
The intriguing specificity and intensity of expression of the miR-200 family members in the MOE prompted us to pursue an in-depth investigation of their distribution during embryonic development and in the adult. [score:2]
These results indicate that the functional loss of the miR-200 family precludes normal differentiation of olfactory progenitor cells into mature olfactory neurons and thus phenocopies an important aspect of the Dicer knockout phenotype observed both in mice and zebrafish. [score:2]
The miR-200 family is therefore among the first neuronal miRNA families in vertebrates with a loss-of-function phenotype. [score:1]
We used the MicroCosm system that interfaces the miRanda prediction software with miRBase, the accepted database of miRNA classification, to confirm that mouse orthologs of zebrafish neuroD, foxg1, zfhx1, and lfng have conserved miR-200 seeds in their 3′UTRs (Griffiths-Jones et al., 2006) (Figure 8A). [score:1]
In mouse, the miR-200 family is composed of five family members (miR-141, -200a, -200b, -200c, -429) clustered into two loci of chromosomes 4 and 6 (Figure 2C). [score:1]
These results suggest that the loss of miR-200 family function disrupts terminal differentiation of olfactory progenitor cells, thus phenocopying an important aspect of the defects observed in mouse Foxg1-Cre; Dicer [loxP/loxP] mutant MOE. [score:1]
We subsequently performed immunohistochemical identification of proliferating and apoptotic cells in order to determine whether miR-200 morphant olfactory phenotypes are accompanied by increased cellular apoptosis, as observed in Dicer null mouse olfactory placodes. [score:1]
In order to test the specificity of each morpholino (MO) sequence, we systematically injected one-cell zebrafish embryos with either miR-141 MO, miR-200b MO, or miR-429 MO and performed in situ hybridization against all five miRNAs of the miR-200 family. [score:1]
To evaluate the contribution of specific miRNAs, we focused on the miR-200 family, which is highly and specifically expressed in the developing olfactory system. [score:1]
By contrast, miR-200 morphant olfactory epithelia presented significantly increased numbers of apoptotic cells relative to wild-type controls (mean ± SEM, WT 12.55 ± 1.46, n = 11; mutant 30.67 ± 2.59, n = 12, p < 0.01, Student's t test) (Figure 7F), as detected by TUNEL staining. [score:1]
One of these families, miR-200 family comprising miR-200a, miR-200b, miR-200c, miR-429, and miR-141, also highly detected by microarray, was among the most frequently cloned species in all olfactory tissues examined (Table S2). [score:1]
How does the miR-200 family mediate its control of olfactory neurogenesis? [score:1]
miR-200 Family Members Are Required for the Proper Differentiation of Olfactory Progenitor Cells. [score:1]
We next wished to determine whether the distinct 5′ seeds contributed differentially to the physiological function of the miRNA-200 family. [score:1]
Loss of function of the miR-200 family phenocopies the terminal differentiation defect observed in absence of all miRNA activity in olfactory progenitors. [score:1]
Finally, we eliminated the function of all miR-200 family members by injecting embryos simultaneously with the Triple MO mix. [score:1]
[1 to 20 of 56 sentences]
9
[+] score: 171
In green are the gene targets of miR200/182 members that are down-regulated in brain tissue acutely infected with HSV-1. In grey are putative targets of miR200/182 members whose expression was determined to be unchanged. [score:10]
Amongst these genes, 2260 were also predicted targets of miR-200/182, from which 200 were downregulated and 54 upregulated more than 2-fold in mouse brain following infection. [score:9]
Both miR-200a and miR-183 were approximately 78-fold upregulated (p-value<0.05) while miR-141 was 23-fold upregulated (p-value<0.001) (Fig 4B). [score:7]
Using the target prediction software TargetScan in conjunction with gene expression profiling, we found that miR-200/182 may in fact modulate the biosynthesis of heparan sulfate proteoglycans (HSPGs). [score:7]
In particular, several miR-200/182 members were downregulated in rabies virus infection [67] and West Nile virus infection [16] of mice while upregulated in HCMV [15, 68] and influenza infection of cell culture [69– 70]. [score:7]
All 4 of these miRNAs were also upregulated in the right cortex of the infected brain but at a lower fold change than for the left cortex (~18-fold for miR-141, ~15-fold for miR-200a, ~49-fold for miR-183 and ~5-fold for miR-155), correlating with the relatively lower number of cells stained for HSV-1. We found that hsv1-miR-H1 expression was also lower in cells extracted from the right versus the left cortex (Fig C in S1 File), however, the viral transcript copy numbers were not determined quantitatively. [score:6]
The 7 canonical pathways that were significantly enriched (p-value<0.05) in the group of genes that were downregulated in HSVE and also predicted targets of miR-200/182 are shown in Fig 6A. [score:6]
miR-200/182 expression was upregulated during HSVE. [score:6]
Several miR-200/182 members are able to downregulate the expression of Sdc2, a core protein of HSPGs that is important for attachment of numerous viruses, including HSV-1, for entry into the host cell. [score:6]
A number of downregulated genes targeted by miR-200/182 (including the sulfotransferases HS3ST1, HS3ST3A1, HS6ST2 and SDC2) are involved in heparan sulfate proteoglycan (HSPG) biosynthesis (Fig 6C). [score:6]
One heparan sulfate proteoglycan, Sdc2, was predicted by TargetScan to be targeted at multiple conserved sites by at least 5 different members of the miR-200/182 miRNA group; miR-141, miR-200b/c, miR-182, miR-96 and miR-183. [score:5]
Induction of miR-200/182 expression visualized by in situ hybridization in brain tissueWe used ISH to visualize the expression of a subset of induced miRNAs (miR-141, miR-183, miR-200a and miR-155) within the brain of infected mice. [score:5]
We performed qRT-PCR to validate the upregulation of 5 miRNAs identified as deregulated by NGS and TLDA miR-141, miR-200a, miR-183, miR-26a, miR-146a, miR-132, miR-34a. [score:5]
TargetScan version 6.2 (June 2012) was used to curate a list of predicted mouse specific miRNA target genes for miR-200/182 members [34]. [score:5]
The induction of miR-200/182 miRNAs in HSV-1 infected brains may therefore play a role as a host mechanism to mitigate virus entry and spread by downregulating SDC2. [score:4]
0169081.g005 Fig 5Detection of miR-200/182 upregulation in HSVE brain tissues by in situ hybridization. [score:4]
Upregulation of miR-200/182 members and miR-155 was detected in HSV-1 infected cortex region. [score:4]
Detection of miR-200/182 upregulation in HSVE brain tissues by in situ hybridization. [score:4]
miR-200/182 and several others were upregulated in HSVE brain samples. [score:4]
Given the upregulation of miR-200/182 members during acute HSV-1 infection, we employed a bioinformatics approach to explore their functionality within the context of HSV-1 -induced encephalitis. [score:4]
We also observed the upregulation of 7 miRNAs belonging to the related and often co-transcribed miRNA-200 family (miR-200a,b,c/miR-141/miR-429) and miRNA-182 cluster (miR-182/miR-183), henceforth collectively referred to as miR-200/182. [score:4]
miR-200/182 members may regulate expression of heparan sulfate proteoglycan, syndecan-2 (Sdc2). [score:4]
In addition the miR-429, a member of the miRNA-200 family, was upregulated 2-fold showing a similar trend of induction. [score:4]
There are, however, reports listing the deregulation of miR-200/182 members in a number of other viral disease mo dels. [score:4]
Overall, our data suggests that miR-200/182 induction may result in downregulation of Sdc2 in an in vivo mouse mo del of HSVE. [score:4]
We used ISH to visualize the expression of a subset of induced miRNAs (miR-141, miR-183, miR-200a and miR-155) within the brain of infected mice. [score:3]
miR-200/182 expression was induction in HSV-1 positive areas of the brain. [score:3]
The expression of the miR-200 family has been shown to be particularly enriched in epithelial and endothelial tissues [43, 45]. [score:3]
Using in situ hybridization (ISH), we found that miR-141, miR-200a and miR-183 expression was induced in cells that appeared to include not just myeloid cells but also other resident brain cells such as neurons and endothelial cells. [score:3]
Induction of miR-200/182 expression visualized by in situ hybridization in brain tissue. [score:3]
Based on the staining patterns of miR-200/182 as determined by ISH, it appeared that members of these miRNA families could also be expressed and induced in neurons. [score:3]
In situ hybridization for miR-141, miR-200a and miR-183 further showed that the increased expression was not limited to cells with a glial or lymphocyte phenotype but also included neurons and likely other resident cell-types of the central nervous system (CNS) such as microglia, astrocytes and endothelial cells. [score:3]
Furthermore, we identified the co-ordinate dysregulation of miR-200/182 family members during acute encephalitis. [score:2]
These miRNAs were induced in areas of the tissue heavily infected by HSV-1. In addition, a potential role for miR-200/182 members is the regulation of HSPG synthesis. [score:2]
The induction of multiple members of the highly related, and often co-transcribed, miRNA-200 family and miRNA-182 cluster was our most striking finding. [score:1]
Interestingly, 6 members of the related and often co-transcribed miRNA-200 family (miR-200a,b,c/miR-141/miR-429) and miRNA-182 cluster (miR-182/miR-183), henceforth referred to collectively as miR-200/182, were amongst the highest induced in HSV-1 infected brain. [score:1]
Hypothalamus region coinsides with miR-141 and miR-182 staining while pons region coinsides with staining for miR-200a. [score:1]
In addition miR-141 is expressed in normal human astrocytes and the role for this miRNA in these cells, and other members of miR-200 family and miR-182 cluster, has not yet been investigated [65]. [score:1]
Total RNA was extracted from these samples and real-time PCR was used to profile for 3 select miR-200/182 members (miR-141, miR-200a and miR-183) as well as miR-155. [score:1]
Increased staining in the HSV-1 versus mock-infected brain was clearly evident for miR-141, miR-183, miR-200a and miR-155 throughout the tissue (Fig D in S1 File). [score:1]
Previous studies have shown the miR-200 family to be induced by oxidative stress and play a role in apoptosis and so we hypothesized that the significant induction of these miRNAs we saw in our mo del of HSV-1 induced encephalitis may be related to tissue damage during infection [43]. [score:1]
was added to the slides and hybridized overnight at either 56°C for miR-141, 52°C for miR-200a, 58°C for miR-183, 49°C for miR-155, 60°C for U6 or 57°C for Scrambled probes. [score:1]
MiR-141, miR-200a, miR-183 and miR-155 along with U6 (positive control) and a scrambled probe (negative control) within the brain sections were detected by in situ hybridization as previously described [33]. [score:1]
Bioinformatic analysis of miR-200/182 function identifies a potential role in heparan sulfate proteoglycan (HSPG) biosynthesis. [score:1]
Increased staining was also observed for miR-200a within the heavily HSV-1 infected pons region. [score:1]
In situ hybridizationMiR-141, miR-200a, miR-183 and miR-155 along with U6 (positive control) and a scrambled probe (negative control) within the brain sections were detected by in situ hybridization as previously described [33]. [score:1]
[1 to 20 of 46 sentences]
10
[+] score: 158
At 15 dpe in both, control and miR-200 -gof conditions the percentage of GFP + cells expressing calretinin was approximately 2% suggesting that the calretinin expressing neuroblasts at 4 and 7 dpe after miR-200 -gof electroporation either downregulated calretinin or died at later stages. [score:8]
Altogether these results show that knockdown of miR-200 family microRNAs interferes with terminal neuronal differentiation while their premature expression induces in a subset of postnatally generated precursors defined aspects of neuronal maturation: cell-cycle exit and premature expression of a mature neuron marker. [score:6]
miR-200 induces calretinin expression through Zeb2 inhibition. [score:5]
The miR-200 -gof and a GFP- expression vectors were co-electroporated into the SVZ and Zeb2 expression was analyzed in the RMS at 4 dpe. [score:5]
Only in the miR-200 over -expression condition GFP + cells expressing calretinin are detected. [score:5]
miR-200 sponge partially rescues the inhibitory activity of the miR-200 expression vector. [score:5]
Moreover, transgenic co -expression of Zeb2 rescued the miR-200 mediated induction in calretinin expression (Fig. 4d). [score:5]
These did not express significant levels of either GluR2 or DCX (Fig. 2b), thus likely representing glia and GluR2 negative neurons 28. qRT-PCR analyses to detect miR-200b and miR-141 as representative members of each of the two miR-200 clusters showed strongest expression in the mature GABAergic (GFP-low) population (Fig. 2c), in agreement with the deep-sequencing data (Fig. 1). [score:5]
For b-e the qPCR values shown in the histograms result from 2 (b, d) or 3 (c, e) qPCR experiments (4 wells per condition in each experiment) (f) Electroporation of an expression construct driving GFP with regulatory sequences of the human miR-429/miR-200a/miR-200b cluster leads to GFP-labeled cells in the OB. [score:4]
To generate the vector expressing gfp under the control of the human miR-200b/miR-200a/miR-429 regulatory sequence we subcloned gfp from pCX-GFP into the pGL3-1574/ + 120 vector obtained from addgene. [score:4]
The quantity of NeuN negative cells in the OB after miR-200 knockdown increases by only 5%, while premature expression of the family induces calretinin in less than 10% of all transfected cells. [score:4]
microRNA expression in the OB neurogenic system: the miR-200 family. [score:3]
In mice, three members (miR-429, miR-200a, miR-200b) reside in one intergenic cluster on chromosome 4. These showed particularly high expression levels (Fig. 1c). [score:3]
Taken together, the above results demonstrate that miR-200 microRNAs expression increases with maturation in the postnatal neuronal lineage that generates OB interneurons. [score:3]
Such a role for Zeb2 in the differentiation process would account for the appearance of calretinin positive cells in the RMS in the context of miR-200 overexpression. [score:3]
All miR-200 family members are exclusively expressed in the OB but not in the stem cell or migratory compartments. [score:3]
How to cite this article: Beclin, C. et al. miR-200 family controls late steps of postnatal forebrain neurogenesis via Zeb2 inhibition. [score:3]
First, we analyzed the consequences of miR-200 inhibition on neuronal differentiation in the OB using the miR-200-sponge. [score:3]
Our finding that the miR-200 promoter fragment that we used to drive GFP expression is only active in a small fraction of the transfected neurons supports this potential lack of competence. [score:3]
We conclude that regulation of Zeb2 by miR-200 family microRNAs regulates neuronal maturation during postnatal neurogenesis. [score:3]
Together with their synchronized expression this suggested a redundant or cooperative function of the miR-200 family members in the OB. [score:3]
We asked if premature expression of miR-200 family microRNAs interfered with Zeb2 levels in neuronal precursors. [score:3]
As miR-200 expression occurs during late stages of OB neurogenesis, we analyzed the electroporated cells at 15 dpe, a time point of advanced maturation. [score:3]
The miR-200 expression vector (miR-200 -gof) was generated by PCR amplification of both miR-200 clusters from CD1 mouse genomic DNA and sub-cloning of amplified fragments into pCX-MCS2. [score:3]
Altogether, these data strongly indicated that the miR-200 induced increase in neuronal differentiation in the RMS was mediated by inhibition of Zeb2. [score:3]
GFP -expressing cells showed significantly less Zeb2 immunoreactivity when miR-200 -gof was present (Fig. 4b,c). [score:3]
Therefore we aimed at refining miR-200 family expression in the system combining transgenic and sorting approaches. [score:3]
Another question concerns the observation that only a small fraction of neuronal precursors shows altered differentiation after interference with miR-200 expression. [score:3]
First, we constructed an in vivo expression vector that generates a single transcript containing the two genomic regions harboring the miR-200 family clusters under the control of the chicken β-actin promoter (miR-200 -gof, Fig. 3a). [score:3]
The limited effects might be due to the fact that only a subfraction of the transfected cells are responsive to either inhibition or increase of miR-200 microRNAs. [score:3]
Indeed, the five members of the miR-200 -family were exclusively expressed in the OB and densely clustered in the heat map representation (Fig. 1b,c). [score:3]
Moreover, both, Zeb2 loss-of-function and miR-200 gain-of-function led to a comparable phenotype, the premature expression of the late neuronal subtype marker calretinin. [score:3]
This demonstrates that miR-200b and miR-141, and therefore likely the entire miR-200 family, are present in the postnatal neurogenic lineages and that their expression level increases with maturation. [score:3]
However, 4 days after miR-200 -gof electroporation 4.79% ± 1.15%, (Fig. 3g) of the GFP positive cells in the RMS expressed calretinin and this percentage increased to 8.96%; ± 1.82% at 7 dpe (Fig. 3f,g). [score:3]
Simultaneous expression of the miR-200-sponge was able to partially restore luciferase activity (Fig. 3b), altogether demonstrating that both vectors were functional. [score:3]
Knockdown of miR-200 significantly increased the percentage of electroporated cells in the OB that were negative for NeuN, a marker for mature neurons (control: 1.99% ± 0,43%; miR-200-sponge: 7.32% ± 1.76%; Fig. 3c,d). [score:2]
Mir-200 family target Zeb2 in the OB neurogenic system. [score:2]
Next, we aimed at analyzing the regulatory mechanism that underlies the differentiation-inducing function of miR-200 family microRNAs in the system. [score:2]
In cancer cells the interaction between miR-200 and Zeb proteins is a key regulatory event in the control of epithelial-mesenchymal transition (EMT) and has been extensively implicated in the metastasis of different cancer types. [score:2]
Another family of microRNAs that is tightly regulated during postnatal OB neurogenesis is the miR-200 family, that has been implicated in neurogenesis in cultured cells 25 and sensory neurons 26. [score:2]
miR-200 family microRNAs regulate neuronal differentiation. [score:2]
First, repression of Zeb2 by miR-200 microRNAs has a direct impact on differentiation of at least a subfraction of neuronal progenitors. [score:2]
Differences between groups of cells were analyzed pairwise with a t-test (control vs miR-200 calretinin positive P < 2.2e-16; control vs miR-200 calretinin negative P < 2.2e-16); n = number of cells used for analysis; an = number of animals from which analyzed cells were issued. [score:1]
Co-transfection of HeLa cells with miR-200 -gof and the resulting plasmid strongly repressed luciferase activity. [score:1]
Finally, we introduced the human sequence upstream of the miR-200b/miR-200a/miR-429 cluster 29 upstream of a GFP-cassette. [score:1]
The miR-200 family contains two different seed sequences (differing in only one nucleotide) and both sequences are present in the two genomic loci. [score:1]
We then used in vivo brain electroporation to introduce the miR-200-sponge or miR-200 -gof constructs into the OB neurogenic system. [score:1]
In vivo functional analysis of miR-200 microRNAs. [score:1]
The sponge construct was designed according to 58 with 4 repetitions of 2 oligonucleotides (5′-GACACATCGTTACTCTCAGTGTTAGACACGGCATTACTCTCAGTATTA and 5′-GACTTCATCATTACTCCCAGTATTAGACCCATCTTTACTCTCAGTGTTA) partially complementary to any member of the miR-200 family were placed behind a destabilized GFP gene in pCX-d2-GFP plasmid. [score:1]
Differences between groups were analyzed pairwise with the Man and Whitney test (control (n = 5 animals) vs miR-200 (n = 5 animals) P = 0.008816, miR-200 (n = 5 animals) vs miR-200 + Zeb2 (n = 7 animals) P = 0.04236). [score:1]
The best-characterized targets of the miR-200 family, albeit in cancer backgrounds, are the zinc finger proteins Zeb1 and Zeb2 30. [score:1]
We focused our functional analysis on the miR-200 family. [score:1]
It would also explain the lack of differentiation, as measured by decreased NeuN staining, when miR-200 is inhibited. [score:1]
Second, we investigated if expression of the miR-200 members at early stages of OB neurogenesis was sufficient to induce premature neuronal differentiation. [score:1]
To this end we electroporated miR-200 -gof into the lateral ventricular wall and analyzed their progeny. [score:1]
The 3′UTR of the zinc finger/homeodomain transcription factor Zeb2, a well-characterized miR-200 target 30, was cloned downstream the firefly luciferase gene in the pmiRGlo vector (Promega). [score:1]
Second, we designed a miR-200-sponge that contained four repeats capable to bind each of the miR-200 family members (Fig. 3a). [score:1]
We thus investigated whether premature expression of miR-200 can induce premature exit of cell-cycle. [score:1]
[1 to 20 of 58 sentences]
11
[+] score: 142
It is unclear whether miR-200a directly regulates the expression of claudin-3 and Par-6b by binding to their mRNAs; however, the regulation of cell polarity genes as well as E-cadherin is important for mammary epithelial differentiation during pregnancy and lactation. [score:6]
Real-time PCR analysis showed that the expression of cell polarity-related genes, claudin-3 and Par-6b, as well as E-cadherin mRNA expression, was decreased in miR-200a knockdown cells (Fig. 5C). [score:6]
During mammary epithelial differentiation, lactogenic hormone -induced miR-200a maintains E-cadherin expression and enhances milk protein gene expression. [score:5]
More importantly, miR-200a expression was stimulated by lactogenic hormones, and miR-200a could control cell polarity and maintain epithelial phenotype by increasing E-cadherin, which has been implicated in controlling gene expression for milk production. [score:5]
We observed increased miR-141 as well as miR-200a expression during mammary epithelial cell differentiation; the expression was stimulated by lactogenic hormone (data not shown). [score:5]
In this study, miR-200a knockdown reduced the number of colonies containing cavities and miR-200a-knocked down cells expressed a low level of claudin-3 and Par-6b mRNA compared to control cells. [score:4]
Effect of miR-200a knockdown on ß-casein, E-cadherin, vimentin, ZEB1 and Snail1 mRNA expression. [score:4]
Moreover, it is likely that E-cadherin maintenance occurs is due to the down-regulation of ZEB1 and ZEB2 by miR-200a. [score:4]
In the present study, to better understand the importance of miR-200a during mammary gland development, we confirmed the expression profile of miR-200a in both mouse mammary gland tissues and in mammary epithelial cells in vitro. [score:4]
Effect of miR-200a knockdown on E-cadherin protein expression. [score:4]
We did not confirm the exact target gene in this cell differentiation process, but ZEB1 is most likely because anti-miR-200a decreased ZEB1 protein level in mammary epithelial cells. [score:3]
0065127.g001 Figure 1 Mice brain, heart, lung, liver, spleen, kidney, and mammary glands were collected on day 7 of lactation (n = 3 animals), and expression of miR-23b and miR-200a were analyzed by real-time PCR. [score:3]
Mice brain, heart, lung, liver, spleen, kidney, and mammary glands were collected on day 7 of lactation (n = 3 animals), and expression of miR-23b and miR-200a were analyzed by real-time PCR. [score:3]
These observations suggest that decreasing c-myc level might be required for expression of miR-200a by lactogenic hormone. [score:3]
Changes in miR-200a, ß-casein, E-cadherin and vimentin mRNA expression during mammary epithelial cell differentiation. [score:3]
Many studies have highlighted the importance of miR-200a in tumor progression and metastasis and suggested that miR-200a plays a crucial role in maintaining epithelial cell phenotype by targeting transcriptional repressors of E-cadherin [11]– [13]. [score:3]
The results showed high expression of miR-200a in the lung, kidney, and mammary glands, which are organs composed of epithelial cells. [score:3]
To confirm the tissue expression of miR-200a and miR-23b (as a control) in mice, we conducted real-time PCR analysis using cDNAs from brain, heart, lung, liver, spleen, kidney, and mammary glands (Fig. 1). [score:3]
Tissue expression of miR-200a in mice. [score:3]
A positive correlation was observed for the expression of miR-200a. [score:3]
To mimic in vivo states, EpH4 cells were induced to undergo lactogenic differentiation by DIP treatment for 72 h. Increased expression levels of miR-200a, but not miR-23b, was observed after 48 h and 72 h DIP treatment (Fig. 2C). [score:3]
Real-time PCR analyses showed that miR-200a expression gradually increased from mid-pregnancy (P14) to lactation (Fig. 2A). [score:3]
Twenty-four hours after transfection, cells were treated with or without DIP for 72 h. After DIP treatment, expression of miR-200a (A), ß-casein (B), E-cadherin (C), vimentin (D), ZEB1 (E) and Snail1 (F) mRNA were analyzed by real-time PCR. [score:3]
miR-200a and miR-141 are thought to interact with the same target sites based on similarities in their seed sequences. [score:3]
Changes in miR-200a expression during mammary epithelial cell differentiation. [score:3]
In conclusion, we showed that lactogenic hormone stimulated miR-200a expression during mammary epithelial differentiation and that miR-200a controlled E-cadherin and other cell polarity genes to maintain the epithelial cell phenotype. [score:3]
Several target genes of miR-200a have been identified by comparing normal and cancer epithelial cells, such as ZEB1, ZEB2, SIRT1, and KEAP1 [11]– [13], [21]. [score:3]
Transfection of anti-miR-200a inhibitors (Invitrogen) was performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. [score:3]
Previously, Galio et al reported that miR-200 is expressed in luminal cells of mammary gland during the second half of pregnancy in sheep [10]. [score:3]
Similar to miR-101a, increased miR-200a expression was observed in differentiated epithelial cells. [score:3]
Expression of miR-200a in mice tissues. [score:3]
However, these proteins were randomly distributed in the miR-200a knockdown colonies that did not form cavities (Fig. 5D). [score:2]
Effect of miR-200a knockdown on 3D cavity formation. [score:2]
Cavity formation was reduced when miR-200a was knocked down (Fig. 5B). [score:2]
We also demonstrated the role of miR-200a in epithelial cell differentiation and cell polarity through miR-200a-knockdown experiments. [score:2]
Effect of miR-200a knockdown on EpH4 cell differentiation. [score:2]
As shown in Fig. 3B, the expression of ß-casein mRNA after DIP treatment was decreased in transfection with anti-miR-200a compared to transfection with the anti-sense RNA control. [score:2]
To define the involvement of miR-200a in mammary gland development, mammary glands were collected from non-pregnant mice, mice at days 7 and 14 of pregnancy, and mice at days 1 and 7 of lactation. [score:2]
At 24 h after transfection, we began DIP treatment for 72 h; at this time point, we confirmed the knockdown of miR-200a by real-time PCR (Fig. 3A). [score:2]
Knockdown of miR-200a resulted in a significant (p<0.05) reduction in the cavity formation (48%). [score:2]
Similar to ß-casein, the miR-200a knockdown decreased E-cadherin mRNA levels under the DIP treatment (Fig. 3C). [score:2]
The miR-200 family consists of 5 members localized on 2 genomic clusters, miR-200a/b, miR-429 and miR-200c, miR-141 on chromosomes 1 and 12 in humans and on chromosomes 4 and 6 in mice [22]. [score:1]
Western blot analysis showed that ß-catenin (different marker of epithelial cell) as well as E-cadherin protein levels in DIP treatment were decreased by transfection with anti-miR-200a (Fig. 4A). [score:1]
Further studies should be conducted to examine how lactogenic hormone controls miRNAs transcription and whether there is a functional difference between miR-141 and miR-200a. [score:1]
0065127.g003 Figure 3 EpH4 cells were transfected with anti-miR-200a or control antisense. [score:1]
EpH4 cells were transfected with anti-miR-200a or control antisense. [score:1]
In contrast to these epithelial markers, ZEB1 protein (EMT marker) level was increased by the transfection with anti-miR-200a (Fig. 4A and Fig. 5D). [score:1]
E-cadherin, ß-catenin and ZO-1 reduction led us to examine whether miR-200a is involved in cell polarity. [score:1]
In the present study, we provide evidence suggesting that one miRNA, miR-200a, plays an important role in mammary gland epithelial cell differentiation during pregnancy and lactation. [score:1]
The miR-200 family has been implicated in the epithelial-to-mesenchymal transition (EMT) that occurs during tumor invasion and metastasis [11], [25], [26]. [score:1]
Before performing the DIP treatment, we transfected oligoribonucleotide anti-sense miR-200a into EpH4 cells. [score:1]
Furthermore, results of the immunofluorescence analyses also showed that the E-cadherin signal decreased in anti-miR-200a -treated cells. [score:1]
showed that ß-catenin (different marker of epithelial cell) as well as E-cadherin protein levels in DIP treatment were decreased by transfection with anti-miR-200a (Fig. 4A). [score:1]
[1 to 20 of 53 sentences]
12
[+] score: 133
Following the knockdown of DCLK1, miR-200 miRNAs were upregulated and resulted in inhibition of its downstream targets (EMT-transcription and angiogenic factors). [score:9]
In this report, following the knockdown of DCLK1 using nanoparticle-encapsulated siRNA (NPsiDCLK1) in tumor xenografted mice, we observed a significant increase in: (A) miR-143/145 cluster, which resulted in downregulation of key pluripotency markers (OCT4, SOX2, KLF4 and NANOG); (B) let- 7a, which resulted in decreased pluripotency factor LIN28B; and (C) miR-200a, b and c, which resulted in downregulation of EMT and angiogenic factors. [score:8]
siRNA -mediated knockdown of DCLK1 in BxPC-3 cells results in decreased expression of miR-200a, miR-200b and miR-200c (A), decreased expression of ZEB1 and ZEB2 (B), and decreased expression of VEGFR1 and VEGFR2 (C). [score:8]
Following the knockdown of DCLK1, a significant downregulation of ZEB1, ZEB2, SNAIL and SLUG was observed following increased expression of pri-miR-200a in AsPC-1 cancer cells [11]. [score:7]
Furthermore, it was found that overexpression of miR-200 family significantly inhibits the NOTCH pathway in pancreatic cancer cells, which suggests the NOTCH pathway may be one of the miR-200 targets [60]. [score:7]
Nevertheless, in this study, inhibition of DCLK1 results in inhibition of pluripotency markers and induction of miR-200 (EMT inhibitor) and thereby drives the cancer cells towards a differentiated state with reduced invasive properties. [score:7]
Following the knockdown of DCLK1, there was a significant downregulation of miR-200a, miR-200b and miR-200c (Figure 5B) mediated luciferase activity. [score:5]
Figure S4 NPsiRNA -mediated knockdown of DCLK1 downregulates EMT transcription factors ZEB1, ZEB2 and angiogenic factors VEGFR1 and VEGFR2 via miR-200 in BxPC-3 cells. [score:5]
It has been demonstrated that miR-200 inhibits lung adenocarcinoma invasion and metastasis by targeting VEGFR1. [score:5]
Similar to miR-200a, we observed a significant upregulation of miR-200b (1.5-fold) (Figure 5A) and miR-200c (2-fold) (Figure 5A) following the knockdown of DCLK1. [score:5]
These data taken together indicate that knockdown of DCLK1 inhibits EMT and invasion by regulating miR-200 in human pancreatic tumor xenografts and cancer cells. [score:5]
DCLK1 regulates EMT in human pancreatic cancer cells via a miR-200a dependent mechanism [11] and is also a regulator of let- 7a in pancreatic and colorectal cancer cells, which supports the concept that these miRNAs are relevant and novel targets in several solid tumor cancers [10, 11, 27, 30, 41]. [score:5]
Here, we found DCLK1 regulating miR-200 and its downstream targets. [score:4]
DCLK1 negatively regulates miR-200 and inhibits EMT and invasion. [score:4]
We also observed a subsequent reduction of miR-200 downstream targets ZEB1 and ZEB2 (Figure 5C), SNAIL and SLUG (Figure 5D) following the knockdown of DCLK1 in pancreatic tumor xenografts. [score:4]
A, siRNA -mediated knockdown of DCLK1 results in increased expression of pri-miR-200a, pri-miR-200b and pri-miR-200c by real-time RT-PCR. [score:4]
These data indicate that DCLK1 regulates miR-200 and its downstream targets in PDAC. [score:4]
0073940.g005 Figure 5DCLK1 negatively regulates miR-200 and inhibits EMT and invasion. [score:4]
Earlier reports [11, 28, 41] and the data presented above indicate that DCLK1 negatively regulates tumor suppressor miRNAs like let- 7a, miR-144 and miR-200a. [score:4]
The let- 7 and miR-200 families are well-known regulators of key differentiation programs during development. [score:3]
These data indicate that VEGFR1 and VEGFR2 are downstream targets of miR-200. [score:3]
Recently, a number of reports have identified the microRNA (miRNA) miR-200 family as fundamental markers and regulators of EMT [10– 12]. [score:2]
A putative binding site for miR-200 was observed in the 3’ UTR of VEGFR1, and it was demonstrated that miR-200 negatively regulates VEGFR1 [48]. [score:2]
DCLK1 regulates miR-200 family genes and EMT in pancreatic cancer. [score:2]
The studies presented clearly implicate DCLK1 in the regulation of miR-143/145, miR-200, EMT, pluripotency, angiogenesis, NOTCH1, and cancer stemness. [score:2]
Next, we wanted to investigate whether DCLK1 regulates the downstream targets of miR-200. [score:2]
Loss of let- 7 in cancer results in progression and dedifferentiation, and the miR-200 family has been shown to be a key regulator of EMT. [score:2]
Recent studies have demonstrated that miR-200a, b and c (miR-200) are known to regulate EMT and angiogenesis [48]. [score:2]
B, Following the knockdown of DCLK1, a decrease in miR-200a, miR-200b and miR-200c dependent luciferase activity was observed in AsPC-1 cells. [score:2]
AsPC-1 cells were transfected separately with plasmids encoding the luciferase gene under the regulation of miRNA binding sites (three plasmids each containing binding sites for miR-200a, b or c) at its 3’ UTR. [score:2]
These data taken together indicate that DCLK1 regulates VEGFR1 and VEGFR2 via miR-200 in PDAC. [score:2]
Similarly in AsPC-1 tumor xenografts, a 2-fold induction of pri-miR-200 a (p < 0.01) (Figure 5A) was observed. [score:1]
Based on previous studies and computational analysis of the 3’ UTR of VEGFR1 and VEGFR2, we observed a putative binding site for miR-200 (miR-200a, b and c) [48, 49]. [score:1]
Moreover, alteration of the miR-200 family has been found to be associated with the NOTCH signaling pathway in pancreatic CSCs. [score:1]
[1 to 20 of 34 sentences]
13
[+] score: 126
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-200c
Genes associated with angiogenesis were also enriched, with increased expression of 5/6 anti-angiogenic gene decreased expression of 11/15 pro-angiogenic genes (Supplementary Fig.   5B), suggesting that miR-200 -targeted genes may play a role in the inhibition of angiogenesis. [score:9]
Secondly, the miR-200 knockdown we achieved was sufficient to increase expression of ZEB1 and ZEB2, which are direct targets of miR-200c. [score:7]
Using mutational profiling and analysis of miRNA and mRNA expression, we confirmed that our mo del cell lines match miR-200 and EMT gene expression profiles representative of EACs (specifically, endometrioid and serous histologic subtypes) and UCSs. [score:6]
In UCS cell lines, we also observed increased expression of ZEB1 and ZEB2, transcription factors upstream in the EMT pathway that are targeted by miR-200 for degradation (Fig.   1C). [score:5]
Specifically, ectopic miR-200 expression was shown to decrease metastasis, inhibit angiogenesis, and induce normal vascularization. [score:5]
Figure 4Differential expression of EMT/MET-related genes in EAC-miR-200 depleted and UCS-miR-200 overexpressed cells. [score:5]
In summary, our mo del cell lines are representative of EAC and UCS, based on both mutational landscape and miR-200/EMT expression features. [score:4]
Firstly, we used miR-200b and miR-200c inhibitors to ensure knockdown of both miR-200 gene clusters. [score:4]
Whole transcriptome sequencing confirms MET changes in miR-200 overexpressed UCS cells and suggests a role for miR-200 in the regulation of angiogenesis. [score:4]
We did not observe changes in cellular morphology after miR-200 depletion in either of the EAC cell lines after 40 days of growth (Supplementary Fig.   1), suggesting that the increase in ZEB1/2 expression alone is not sufficient to drive EAC cells to undergo EMT. [score:3]
Finally, we show that miR-200 overexpression in UCS cells leads to decreased tumor growth and aggressiveness both in vitro and in vivo. [score:3]
While miR-200 overexpression in JHUCS-1 cells resulted in MET functional changes (increased cell adhesion and decreased cell migration and invasion), we did not observe the same changes in SNU-685 cells (decreased cell adhesion, no significant change in cell migration or invasion). [score:3]
miR-200 overexpression can induce MET 22, 23, 31; however, miR-200 -driven MET in UCS has not been previously reported. [score:3]
A recent study exploring the clinical outcomes related to miR-200 expression found that miR-200 plays an important role in metastasis and angiogenesis [32]. [score:3]
Four days after seeding, proliferation was decreased by ~37% and ~67% in miR-200 overexpressing SNU-685 and JHUCS-1 cells, respectively. [score:3]
pathologic) are ultimately determined by a complex interplay between pro-angiogenic and anti-angiogenic factors, it appears that miR-200 is associated with inhibition of angiogenesis. [score:3]
Figure 3Effects of ectopic miR-200 overexpression in UCS cell lines. [score:3]
Given that EMT is a reversible process, we sought to explore whether miR-200 overexpression in UCS cells would cause MET. [score:3]
Ectopic expression of miR-200 has been shown to increase sensitivity of ovarian, breast and endometrial cancer cells to chemotherapeutic agents 48– 51 and enhance radiosensitivity in lung cancer [52]. [score:3]
This may be one mechanism by which increased miR-200 expression in UCS cells leads to decreased tumor growth and metastasis. [score:3]
Taken together, our data suggest that the only consistent EMT-like changes achievable in EAC cells, either by constitutive miR-200 depletion or exogenous TGF-β treatment, are increases in ZEB1 and ZEB2 expression. [score:3]
In conclusion, although miR-200 depletion and increase in ZEB1/2 expression resulted in a modest decrease in cellular adhesion, there was no evidence of molecular or functional complete EMT. [score:3]
We demonstrate that xenografted UCS tumors with miR-200 overexpression show striking changes in morphologic and immunohistochemical phenotype, becoming more epithelial and less mesenchymal-like. [score:3]
Our data show that, despite miR-200 depletion and subsequent increases in ZEB1/2 expression in EACs, there is no evidence of complete EMT induction. [score:3]
After selecting our cell lines, we sought to examine whether their miR-200 expression and EMT signature profiles were consistent with their named histologic subtypes. [score:3]
We hypothesized that miR-200 overexpression in UCS cells would result in a less aggressive, epithelial-like phenotype. [score:3]
miR-200 -depleted EACs exhibit increased ZEB1 and ZEB2 expression without significant changes in other EMT markers. [score:3]
Fold-change in migration or invasion was calculated by comparing miR-200 knockdown or miR-200 expressing cells to their negative controls. [score:2]
Changes in miR-200, mRNA and protein expression were assayed 15 days after the treatment. [score:2]
We examined the gene expression of miR-200 and several well-established EMT markers (ZEB1, ZEB2, E-cadherin, N-cadherin and vimentin) using TaqMan® Real-Time PCR Assays (Fig.   1B–D). [score:2]
Proliferation for either miR-200 knockdown or miR-200 expressing cells was calculated relative to negative controls. [score:2]
Taken together, our in vitro and in vivo data strongly support the conclusion that JHUCS-1 cells readily undergo miR-200 driven MET, leading to decreased tumor aggressiveness. [score:1]
Although UCSs are hypothesized to evolve from EACs 4, 18, 19, 30, the role of miR-200 -driven EMT in the oncogenesis of UCSs has not been previously studied. [score:1]
Our results suggest that while UCSs do not appear to develop from EACs by miR-200 -dependent EMT, UCS cell lines readily undergo miR-200 -induced MET resulting in decreased tumor growth and aggressiveness. [score:1]
Lack of functional changes in miR-200 -depleted EACs further confirms the absence of complete EMT. [score:1]
Altogether, our results lead us to conclude that UCSs are unlikely to develop from EACs via EMT in a miR-200 -dependent and exclusive manner. [score:1]
Figure 2Effects of consecutive transient miR-200 depletion in EAC cell lines. [score:1]
Here, we test the hypothesis that UCSs arise from a carcinomatous origin via miR-200 -driven EMT. [score:1]
We tested the hypothesis that UCSs evolve from EACs by EMT in a miR-200 -dependent manner. [score:1]
To investigate whether EACs undergo a miR-200 -driven EMT resulting in a UCS phenotype, we depleted miR-200b/c in Ishikawa and MFE-280 cells using single-stranded RNAs that inhibit endogenous microRNAs. [score:1]
Failure to induce miR-200 -dependent EMT in EAC cell lines due to transient and/or insufficient miR-200 depletion is unlikely for several reasons. [score:1]
There is also abundant evidence linking miR-200 to treatment sensitivity [47]. [score:1]
We show that while EAC cell lines are resistant to full EMT, UCSs readily undergo miR-200 -induced MET. [score:1]
Additionally, EMT is a reversible process, and mesenchymal-epithelial transition (MET) has been shown to decrease tumor aggressiveness 22, 23. miR-200 has been identified as a key element in the EMT pathway 24– 26. [score:1]
To explore whether EACs are able to undergo complete EMT by mechanisms other than miR-200 depletion, we treated Ishikawa, HEC-251 and MFE-280 cells with TGF-β, a well-defined and potent inducer of a full EMT response (Supplementary Fig.   2). [score:1]
To test the hypothesis that UCSs develop from a carcinomatous phenotype in a miR-200 -dependent manner, we selected endometrial adenocarcinoma (EAC) cell lines based on histologic and genetic profiles (Fig.   1A). [score:1]
[1 to 20 of 46 sentences]
14
[+] score: 112
miR-155-5p showed clearly downregulated expression at the same time as miR-200a-3p showed upregulated expression in all three-murine lupus-like mo dels tested (Figure 3(a)). [score:11]
3.4. miR-155-5p Downregulation and miR-200a-3p Upregulation Seen through miRNA Expression Profiling Were Confirmed by qRT-PCR. [score:9]
In contrast, miR-200a-3p upregulation suppresses gene inhibitors for EED and EZH2 (KIF20A and HSD17B11 for EED and CDK6 for EZH2) and allows these two transcription factors to positively affect the transcription of interferons IFNA1 and IFNA2. [score:8]
Overexpression of miR-200a-3p also contributes positively by inhibiting the TLR4 signaling pathway through MYD88, acting directly on MAPK1 and JUN and interfering with the action of specific inhibitors for transcription factors such as EED and EZH2 involved in the production of interferons IFNA1 and IFNA2. [score:8]
A closer look into the signaling pathway showed that the overall effect of miR-155-5p downregulation and miR-200a-3p upregulation is an increased transcription of interferons (Figure 4). [score:7]
Interestingly, miR-155-5p and miR-200a-3p, which were statistically validated, play pivotal immune roles and may participate in the development of the lupus-like disease mo dels in BALB/c mice by increasing the production of anti-NPA antibodies, which are responsible for inducing the murine disease. [score:6]
The signaling network summarizing our current and previous results was developed using Cytoscape v3.4.0 [18] to assess interactions between the mRNA results found in TLR4 signaling pathways [7] and the known targets for miR-155-5p, miR-200a-3p, miR-21a-5p, and miR-146b-5p, trying to find the role of those miRNAs on the development of murine lupus-like disease. [score:6]
The downregulation of miR-155-5p and the upregulation of miR-200-3p in the mouse mo dels were detected in the PCR array and with the TaqMan probes, with significant differences compared to the healthy mice. [score:6]
All these effects of miR-200a-3p on the TLR4 signaling pathway are positive for interferon production, as its upregulation provokes a partial inhibition of the MYD88-dependant signaling branch and diminishes its possible genetic products (e. g., TNF-α, IL-6, IL-12A/B, and IL-1B) and helps to activate transcription factors relevant for the interferon-producing TICAM -dependent signaling branch (Figure 4). [score:6]
Interestingly, six of these miRNAs showed similar behavior in the three conditions tested, three of them were downregulated (miR-142a-3p, miR-146b-5p, and miR-155-5p) and three were overregulated (miR-21a-5p, miR-125a-5, and miR-200a-3p). [score:5]
Two deregulated miRNAs, miR-155-5p and miR-200a-3p, were found to contribute to the development of a murine lupus-like disease triggered by NPA, a recently described molecular association of phospholipids, different from the classical lipid bilayer, and induced by some specific inductors. [score:5]
Th17 cell differentiation has been linked to inflammatory processes [37]; in this way, miR-200a-3p overexpression would contribute to the inflammatory response, which leads to the production of IgG antibodies and the observed murine lupus-like disease in our mo dels. [score:5]
Six of them were down- (miR-142a-3p, miR-146b-5p, and miR-155-5p) or upregulated (miR-21a-5p, miR-125a-5p, and miR-200a-3p) in the three lupus-like murine mo dels while the other six were affected in two or only one of them (Figure 2(b)). [score:4]
Interestingly, miR-200a-3p has a direct inhibitory action on MAPK1 and JUN. [score:4]
Using the database of the Cancer miRNA Regulatory Network [19] and Cytoscape v3.4.0 [18], a signaling network was developed to find relationships among miR-155-5p, miR-200a-3p, miR-21a-5p, and miR-146b-5p and their own targets, which allowed us to highlight only miR-155-5p and miR-200a-3p of the original four miRNAs selected. [score:4]
SMAD2, GATA3, and FOXO3 could also be the miR-200a-3p targets in SLE and our lupus-like mo dels. [score:3]
miR-200a-3p is overexpressed in SLE [35]. [score:3]
The PCR amplification was run as described by the TaqMan Universal PCR Master Mix manual (Applied Biosystems) for the following differentially expressed miRNAs, as determined by PCR array analysis: miR-21a-5p, miR-125a-5p, miR-142-3p/5p, miR-146b/5p, miR-155-5p, and miR-200a-3p. [score:3]
Nevertheless, the expression of miR-155-5p and miR-200-3p, together with the anti-NPA antibodies, should be evaluated in other mouse mo dels of lupus and in SLE patients, to validate their possible role as biomarkers of this disease. [score:3]
Taking into account these findings and the presence of anti-NPA antibodies both in murine lupus-like and in human patients, we propose that the miRNAs miR-155-5p and miR-200a-3p and the anti-NPA antibodies may play an important role in the development of human LES. [score:2]
Only miR-155-5p and miR-200a-3p were statistically validated (p < 0.001) in the three lupus-like mo dels, while miR-21a-5p was validated (p < 0.05) only in those triggered by chlorpromazine- or promazine -induced NPA. [score:1]
Both miR-155-5p and miR-200a-3p cooperate to favor the signaling branch from TLR4 through TICAM1 and TICAM2 (TRAM) instead of that involving MYD88. [score:1]
Based on this knowledge, we propose miR-155-5p and miR-200a-3p, together with the anti-NPA antibodies, as key players in the murine lupus-like mo dels and possible biomarkers of the human SLE. [score:1]
Interestingly, miR-155-5p and miR-200a-3p stand out because of their strong influence on TLR4 signaling, mostly on transcription factors that, in turn, trigger interferon production. [score:1]
[1 to 20 of 24 sentences]
15
[+] score: 110
Other miRNAs from this paper: mmu-mir-141, mmu-mir-200b, mmu-mir-200c, mmu-mir-429
In total, 744 patients were available for analyses of expression of miR-200 s. Most miR-200 s were downregulated in late-stage primary tumors, but all miR-200 s were downregulated in the primary tumors with metastasis (Fig.   3c). [score:9]
Apart from the miR-200-ZEB1/2-E-cadherin axis, miR-200 s inhibit Wnt through CTNNB1, NOTCH through JAG1, and SNAIL through SNAI2, and other direct targets, FN1, MSN, NTRK2, LEPR, and ARHGAP19, all of which are necessary for tumor metastasis [15– 17]. [score:6]
All experiments were repeated three times To determine if miR-200 is expressed in human breast cancers, the breast invasive carcinoma (n = 1100) expression dataset (RNAseqV2, UNC) from NCI The Cancer Genome Atlas (TCGA) was examined. [score:5]
In cancer cells, miR-200 s induce epithelial differentiation by suppressing ZEB1/2 and subsequently increasing E-cadherin expression [11, 12]. [score:5]
All experiments were repeated three times To determine if miR-200 is expressed in human breast cancers, the breast invasive carcinoma (n = 1100) expression dataset (RNAseqV2, UNC) from NCI The Cancer Genome Atlas (TCGA) was examined. [score:5]
Members of the human and mouse miR-200 family (miR-200 s), including two clusters (cluster 1: miR-200b, 200a, and 429, on chromosome 1, and cluster 2: miR-200c and miR-141, on chromosome 12), inhibit the epithelial-mesenchymal transition (EMT) [11, 12] but promote the mesenchymal-epithelial transition (MET) [13, 14], thereby regulating tumor metastasis by a reversible EMT-MET transition. [score:4]
Our analysis of TCGA database identified downregulation of miR-200 s in primary breast cancer cells in patients with distant metastases. [score:4]
To avoid the potential effect of FOXP3 [+] TILs, we selected the CD25 [low] tumors, indicative of few FOXP3 [+] TILs, to assess the association between expression of FOXP3 and miR-200 s in the TCGA breast cancers (Additional file 1: Figure S2C). [score:3]
These data indicate that miR-200c and miR-141 at miR-200 cluster 2 are downstream targets of FOXP3. [score:3]
According to our previous ChIP-sequencing data [30], the binding signals of FOXP3 are close (-3.4 kb) to the locus at non-regulated miR-200 cluster 1 (miR-200a/b/429) but distal (-20 kb) to the locus at FOXP3-regulated miR-200 cluster 2 (miR-200c/141) in FOXP3/GFP-Tet-off MCF-7 cells (Additional file 1: Figure S3A-B). [score:3]
Association of expression levels of miR-200 s with ER/PR/HER2 status in breast cancer cells. [score:3]
In murine cancers and human xenograft mo dels, miR-200 -expressing tumor cells and extracellular vesicles from these tumor cells promote breast cancer metastasis and confer the capacity for these cells to colonize distant tissues in an miR-200 -dependent manner [20]. [score:3]
In further studies, isolation of circulating CTCs and exosomes from mice or patients with breast cancer and comparison of expression levels of miR-200 s between CTCs and exosomes will address this hypothesis. [score:3]
In total, 542 samples were available for analyses of expression of both miR-200 s and FOXP3. [score:3]
Functional studies have found conflicting results on the role of miR-200 s in suppressing or promoting metastasis in different cellular contexts [11– 14]. [score:3]
Associations between expression of FOXP3 and miR-200 s in TCGA breast cancer samples. [score:3]
c Quantification of miR-200 s (by qPCR) as a percentage of RUN6B expression in T47D (left), BT474 (middle), and MDA-MB-468 (right) cells at 48 h after transfection. [score:3]
ZEB1 and ZEB2 both bind to the two miR-200 clusters, causing inhibition of the transcription of all miR-200 s; Sp1 binds the miR-200b/a/429 cluster [44, 54] and p53 binds the miR-200c/141 cluster [44, 55], leading to activation of transcription of miR200s. [score:3]
Decreased levels of miR-200 s in tumor cells have been implicated in the invasion and metastasis of breast cancer [11, 12, 18], but, in preclinical mo dels, restoration of miR-200c reduced metastases [19], suggesting that the miR-200 s function as tumor suppressors. [score:3]
In breast cancer cells, however, expression of miR-200 s was not related to ER/PR/HER2 status (Additional file 1: Figure S5A-C). [score:3]
However, the effect of KAT2B knockdown on the miR-200 cluster 1 miRNAs was not observed in FOXP3/GFP-Tet-off MCF7 cells (Additional file 1: Figure S4). [score:2]
In the present work, we explored the relevance of FOXP3 -mediated transcriptional regulation of miR-200 s in breast cancer cells in mice and humans. [score:2]
During tumor progression in the Foxp3 [sf/+] female mice, there were increased levels of plasma miR-200c and miR-141 at miR-200 cluster 2 (Fig.   3d, the time points of breast tumor development are indicated by vertical arrows) but not at miR-200 cluster 1 (Additional file 1: Figure S6). [score:2]
To validate our observation in breast cancer cells, we used heterozygous Foxp3 [sf/+] breast cancer mice to analyze the regulation of mouse miR-200 s during tumor progression. [score:2]
These data suggest the presence of a FOXP3-KAT2B-miR200c/141 axis in breast cancer cells and a differential mechanism of transcriptional regulation between the two miR-200 clusters. [score:2]
Likewise, high levels of all miR-200 s were validated in FOXP3 [high] tumors relative to those in FOXP3 [low] tumors (Additional file 1: Figure S2C). [score:1]
However, in peripheral blood cells, no significant changes in the miR-200 s levels were evident (Figs.   5d and Additional file 1: Figure S9). [score:1]
[d]Normal healthy women without family history of breast cancer Two independent cohorts of human subjects were divided for assessment and validation of the miR-200 family as potential biomarkers. [score:1]
Potential binding signals of FOXP3 in the promoter regions of the miR-200 family and KAT2B gene. [score:1]
As shown, miRs-200c and miR-141 at miR-200 cluster 2 (2.0-fold to 3.2-fold miR-200c induction; 1.8-fold to 2.6-fold miR-141 induction), but not miRs-200b, 200a, and 429 at miR-200 cluster 1, were induced after FOXP3 induction (Fig.   1b). [score:1]
Thus, circulating miR-200 s are promising biomarkers for breast cancer metastasis. [score:1]
c Concentrations of cluster 1 and cluster 2 miR-200 s in human breast cancer samples at various tumor stages (tumor-node-metastasis (TNM) staging classifies cancers based on T1-T4, N, and M), as determined from data for 271 patients listed in the NCI The Cancer Genome Atlas (TCGA). [score:1]
High levels of all miR-200 s were present in FOXP3 [high] tumors relative to those in FOXP3 [low] tumors (Additional file 1: Figure S2A). [score:1]
The transcriptional activity of miR-200b/a/429 on miR-200 cluster 1 after FOXP3 induction and KAT2B silencing in breast cancer cells. [score:1]
b Relative quantification (by quantitative (q)PCR) of miR-200 clusters 1 and 2 in FOXP3/GFP-Tet-off MCF7 cells without Dox at 0, 24, and 48 h. The concentrations of miR-200 s at 0 h were used as a reference. [score:1]
Levels of miR-200 s in the FOXP3/GFP-Tet-off MCF-7 cell lines were assessed by use of qPCR at 24 and 48 hours after FOXP3 induction. [score:1]
All experiments were repeated three times To determine the levels of miR-200 s in circulation during tumor progression, plasma was collected monthly from Foxp3 [sf/+] female mice after 1 year of age. [score:1]
As circulating miR-200 s reflect the CTC status of patients with breast cancer [21], they may be released from CTCs through exosomes rather than from blood cells or primary tumor cells. [score:1]
Further, high levels of circulating miR-200 s in breast cancer patients are associated with increased numbers of circulating tumor cells (CTCs) [21], which are a predictor of metastasis up to 2 years prior to clinical diagnosis [22] and of shorter brain-metastasis-free survival [23]. [score:1]
[d]Normal healthy women without family history of breast cancer Two independent cohorts of human subjects were divided for assessment and validation of the miR-200 family as potential biomarkers. [score:1]
However, the cellular origin, mechanism of release, and function of circulating miR-200 s during tumor progression and metastasis remain elusive. [score:1]
Participants (259), including patients with breast cancer or benign breast tumors, members of breast cancer families, and healthy controls, were assessed for tumor and circulating levels of the miR-200 family. [score:1]
There were, however, no significant differences in the amounts of miR-200b, miR-200a, or miR-429 in MCF7 cells, cell culture medium, or exosomes (Additional file 1: Figure S8A–C). [score:1]
b Levels of cluster 1 and cluster 2 miR-200 s (measured by quantitative (q)PCR) as percentages of snoRNA202 expression in microdissected breast epithelial cells and tumor cells. [score:1]
Conversely, some studies suggest that, in cancer cells, miR-200 s promote tumor metastasis through promotion of tumor colonization at metastatic sites [13, 14]. [score:1]
All experiments were repeated three times To determine the levels of miR-200 s in circulation during tumor progression, plasma was collected monthly from Foxp3 [sf/+] female mice after 1 year of age. [score:1]
In patients with breast cancer, increased levels of circulating miR-200 s may be a predictor of CTCs [21], metastasis up to 2 years prior to clinical diagnosis [22], and poor survival [23]. [score:1]
Fig. 3Changes in miR-200 s in tumor cells and plasma during breast cancer progression. [score:1]
[1 to 20 of 48 sentences]
16
[+] score: 109
In order to confirm that miR-200 family miRNAs and miR-182/96/183 family miRNAs are involved in ULM and/or ULM-related gene expression, we compiled a list of potential targets of these miRNAs in various ULM mRNAs using three computational target prediction programs: TargetScan (www. [score:9]
Effect of inhibition or overexpression of the miR-200 family and the miR-182 family miRNAs on OGD -induced cell death in SHSY5Y cells. [score:5]
The results strongly suggest that theses predicted target sites are real and SUMO and other ULM mRNAs are indeed targeted and controlled by the miR-200 family and the miR-182 family miRNAs. [score:5]
They found that miR-320, miR-378, miR-211, miR-200a,b and miR-184 were significantly down-regulated during both stages of hibernation compared with non-hibernating animals, whereas miR-486, miR-451, miR-144 and miR-142 were significantly overexpressed in late torpor phase [22]. [score:5]
We found quite a few potential target sites for miR-200 and miR-141, and some for miR-182/183/96 in SUMO-related genes and other ULMs as shown in Table 2. miRNA::mRNA target prediction is based on assumptions of certain values for temperature, salt and other conditions and the results are all too often dependent on the algorithm employed by each tool. [score:5]
html) We have established that the miR-200 family and the miR-182 family miRNAs target SUMO and other ULMs, and that inactivation of these miRNAs increases both global SUMOylation and global conjugation of other ULMs resembling the changes in posttranslational modifications that have been noted in ground squirrels during hibernation torpor. [score:5]
We have established that the miR-200 family and the miR-182 family miRNAs target SUMO and other ULMs, and that inactivation of these miRNAs increases both global SUMOylation and global conjugation of other ULMs resembling the changes in posttranslational modifications that have been noted in ground squirrels during hibernation torpor. [score:5]
In order to examine whether some (if not all) of these predicted target sites are really recognized by either miR-200 family or miR-182/183/96 family miRNAs, we made firefly luciferase reporter constructs containing individual predicted target sequences for the miRNAs of interest. [score:5]
We could confirm that miR-200, miR-182, miR-183, miR-141, miR-96, miR-122 and miR-429 were indeed down regulated, and miR-34 and miR-206 were upregulated during hibernation torpor (Fig. 2B). [score:5]
We also show in SHSY5Y cells that inhibition of miR-200 family and/or miR-182 family miRNA activity makes cells more tolerant to oxygen/glucose deprivation (OGD), perhaps via an increase in post-translational modification of cellular proteins by various ULM species. [score:5]
These results had only a limited overlap with our findings that was restricted to miR-200a,b, which were among the miRNAs we found to be down-regulated during hibernation. [score:4]
The roles of miR-200 family and miR-182 family miRNAs, which we found to be down-regulated during hibernation torpor, have been examined in various areas of research, especially cancer, but the studies have generally been correlational. [score:4]
Interestingly, SHSY5Y cells became more tolerant to OGD -induced cell death when activities of miR-200 family and/or miR-182 family miRNAs were inhibited (Fig. 6B), and more sensitive when mimics of these miRNAs were transfected (Fig. 6B). [score:3]
We transfected SHSY5Y cells with inhibitors or mimics for several miR-200 family and the miR-182 family miRNAs (miR-200c, miR-141, miR-182, miR-183 and miR-96) in duplicate plates, incubated them for 2 days, and subjected one plate of cells to OGD, and the other plate of cells to normal culture conditiions as a control. [score:3]
Effect of miRNA inhibitors and mimics for miR-200 family and miR-182 family members on ULM conjugation levels in SHSY5Y cells. [score:3]
Cells transfected with miRNA inhibitors, especially miR-200 family (miR-200c and miR-141) showed much far less cell death (Fig. 6B), but cells transfected with miRNA mimics, especially from the miR-182 family, caused more cell death (Fig. 6B). [score:3]
miR-200 family and miR-182 family members of miRNAs indeed target various ULM and/or ULM related genes. [score:3]
Effects of inhibitors and mimics for miR-200 family and miR-182 family miRNAs on OGD -induced cell death in SHSY5Y. [score:3]
The DNA sequences of target sites for miR-200 family and/or miR-182 family miRNAs in each gene are shown in the supplemental materials (Table S2). [score:3]
Identification of potential targets of miR-200 family and miR-183/96/182 family miRNAs in ULMs and/or ULM-related genes. [score:3]
Roh's group [37] reported that miR-200 family and miR-182 family miRNAs increased at 3 hrs after an ischemic preconditioning (15 min transient focal cerebral ischemia) in mice and that overexpressing these miRNAs made mouse neuroblast cells (Neuro-2a) more resistant to OGD (16 h). [score:3]
25Gravgaard KH, Lyng MB, Laenkholm AV, Sokilde R, Nielsen BS, et al. (2012) The miRNA-200 family and miRNA-9 exhibit differential expression in primary versus corresponding metastatic tissue in breast cancer. [score:3]
The clear increase in expression of miR-200 and miR-182 family miRNAs at the 3 hour timepoint may have reflected the sublethal ischemic stress that induces ischemic tolerance, but at the times that OGD tolerance was tested, these miRNA levels may well have been depressed. [score:3]
These results suggest that inhibiting miR-200 family and miR-182 family miRNAs does protect SHSY5Y cells from OGD -induced cell death. [score:3]
Of these families, miR-200 had the greatest number of differentially regulated members (n = 48) and the largest magnitude difference between means of the LH and ACR states (Δ = −3.04). [score:2]
We also report that two miRNA families, miR-200 family (miR-200a/miR-200b/miR-200c/miR-141/miR-429) and miR-182 family (miR-182/miR-183/miR-96), which were consistently lower in the brain samples from torpor phase ground squirrels compared to active animals, are involved in expression of various ULM proteins and their global protein conjugation. [score:2]
In particular, two miRNA families, the miR-200 family (miR-200a, b, c, miR-496, and miR-141) and the miR-182 family (miR-182, miR-183 and miR-96) were consistently down regulated during torpor phase. [score:2]
MiR-182, miR-96, miR-200, miR-183 and miR-141 were among the most highly regulated miRNAs with a 13∼20-fold decrease during the torpor phase of the hibernation cycle. [score:2]
From the results of our microRNA array study of ground squirrel brain (comparing active and torpor phase), we found that most miRNAs were unchanged or increased during torpor phase, but certain miRNAs such as miR-200 family (miR-200a, -200b, -200c, -141, -429) and miR-182 family (miR-182, -183, -96) miRNAs were consistently decreased (Fig. 2A and Table S1). [score:1]
We wondered whether the tolerance to in vitro “ischemia” by OGD in cultured cells (e. g. SHSY5Y) would change if miR-200 family and/or miR-182 family miRNA activity levels were reduced or increased. [score:1]
Close relationships of miR-200 family miRNAs with cancer cell invasion or cancer metastasis have been reported repeatedly [23]- [26]. [score:1]
[1 to 20 of 31 sentences]
17
[+] score: 102
2016.00140/full#supplementary-material Figure S1 miR-200 inhibitors up-regulate PTEN expression. [score:8]
Taken together, the miR-200 family, especially miR-200c, directly targets the 3′UTR of PTEN and inhibits its protein expression. [score:8]
To identify the binding site of miR-200 that plays the most important role in miR-200-regulated PTEN protein expression, we generated three different site-directed mutations on PTEN 3′UTR. [score:6]
To explore the potential roles of miR-200 family members in translational regulation of PTEN expression, we co -transfected a luciferase reporter construct containing PTEN 3′UTR together with different miR-200 family members. [score:6]
We provided evidence showing that upregulation of miR-200 family by ER stress exhibited protective roles via PTEN suppression in early phase of AD. [score:6]
In order to understand the role of miR-200 family in AD development, we employed the TargetScan (version 6.2, 2012) database to predict potential miR-200 target genes. [score:6]
On the other hand, transfection of miR-200 inhibitors to HCT116 colon cancer cells that have high endogenous levels of miR-200 resulted in increased expression of PTEN (Figure S1). [score:5]
Overexpression of miR-200 family inhibitors dramatically enhanced luciferase reading (Figure 1C). [score:5]
The mimic or inhibitors of miR-200 family and siPTEN/control siRNAs were synthesized by Life Technologies with sequences shown in Table 1. Table 1 Sequences of synthesized miR mimics/inhibitors or siRNA. [score:5]
The mimic or inhibitors of miR-200 family and siPTEN/control siRNAs were synthesized by Life Technologies with sequences shown in Table 1. Table 1 Sequences of synthesized miR mimics/inhibitors or siRNA. [score:5]
Among them, microRNA-200 family showed a dynamic expression profile during AD development in the APPswe/PSΔE9 transgenic mice. [score:4]
Among the three sites, site II seems to have the most important role in the regulation of PTEN expression by miR-200 family. [score:4]
Among them, miR-200a/b/c, miR-141, and miR-429 in the miR-200 family were significantly upregulated in early age AD in mice. [score:4]
In this study, we identified PTEN as a target of miR-200 family in neuronal cells. [score:3]
HCT-116 cells were transfected with different combinations of miR-200 inhibitors as indicated. [score:3]
As predicted by Targetscan (version 6.2, 2012), three miR-200 family bind sites (Site I and Site III for miR-141/200a, Site II for miR-200b/c/429) are highlighted. [score:3]
Identification of PTEN as a target of miR-200 family. [score:3]
Database prediction indicated that PTEN has three miR-200 family binding sites in its 3′UTR and may be one of the potential targets of miR-200 family (Figure 1A). [score:3]
Among miR-200 family, miR-200c is the major microRNA that targets PTEN. [score:3]
Members of the miRNA-200 family regulate olfactory neurogenesis. [score:2]
Among the five miR-200 family members, miR-200c plays the most important regulatory role and was used to represent miR-200 family in the following parts of the study (Figures 1D–F). [score:2]
Critical role of the miR-200 family in regulating differentiation and proliferation of neurons. [score:2]
In nerve system, miR-200 family is enriched in olfactory and has been implicated in neuronal proliferation and differentiation (Choi et al., 2008; Pandey et al., 2015). [score:1]
MiR-200 family can be divided into two groups according to the seed sequences (group I: miR-141 and miR-200a; group II: miR-200b, miR-200c, and miR-429). [score:1]
For luciferase activity assay, we introduced mutations on each miR-200 family miR binding site by overlap PCR. [score:1]
Name of miRs/siRNAs Sequence miR-200a 5′-UAACACUGUCUGGUAACGAUGU miR-200b 5′-UAAUACUGCCUGGUAAUGAUGA miR-200c 5′-UAAUACUGCCGGGUAAUGAUGGA miR-141 5′-UAACACUGUCUGGUAAAGAUGG miR-429 5′-UAAUACUGUCUGGUAAUGCCGU miR-NC 5′-UAACGUGUCACGUCUCCGACUA Anti-miR-200c 5′-UAACACUUGCCGGGUAAUGGUGUA Anti-miR-NC 5′-UCUUGCCGGGCCCGAUCCAACGA siCont 5′-UUCUCCGAACGUGUCACGU siPTEN 5′-AACCCACCACAGCUAGAACUU 2.3 kb PTEN 3′UTR was amplified by PCR from a human cDNA library. [score:1]
pMIR-Reporter constructs containing either wild type or mutant fragments of PTEN 3′UTR were co -transfected into 293T cells with miR-200 family miRs (miR-141/200a, miR-200b/c/429, or miR-200c). [score:1]
A series of truncations containing different miR-200 family binding sites were also amplified and cloned into the pMIR-REPORT vector. [score:1]
[1 to 20 of 28 sentences]
18
[+] score: 98
These EMT-type cells also showed decreased expression of miR-200 or let-7, and reversal of EMT by forcing expression of miR-200 significantly inhibited clonogenic and prostasphere-forming ability, which was consistent with the inhibition of Notch1 and Lin28B expression. [score:11]
These results suggest that miR-200b and miR-200c but not miR-200a inhibited self-renewal of PC3 PDGF-D cells by controlling target gene expressions of miR-200b and miR-200c. [score:7]
Reversal of EMT by re -expression of miR-200 inhibited prostasphere-forming ability of EMT-type cells and reduced the expression of Notch1 and Lin28B. [score:7]
Interestingly, recent studies have also shown that miR-200 family not only could regulate the processes of EMT by targeting E-box binding protein ZEB1 and ZEB2 [15] but was also associated with stem-like cell signatures by regulating the expression of Bmi1 [16], [17]. [score:7]
Moreover, knock-down of Lin28B markedly increased let-7 expression, suggesting that miR-200 and let-7 could act as a target for the prevention of tumor recurrence and metastasis in PCa. [score:6]
Down-regulation of Notch1 by miR-200 was partially responsible for the inhibition of colonogenic and prostasphere-forming ability of PC3 PDGF-D cells. [score:6]
Moreover, re -expression of miR-200b or miR-200c dramatically reduced the activity of 3′UTR of Notch1 luciferase in PC3 PDGF-D cells, while re -expression of miR-200a with one base of seed sequence different from miR-200b and miR-200c had no effects on the activity of 3′UTR of Notch1 luciferase (Fig. 5B). [score:5]
Thus, we assessed the expression of the putative targets of miR-200b and miR-200c such as Notch1, Bmi1 and lin28B in PC3 PDGF-D cells transfected with miR-200 family because miR-200b and miR-200c have three or one putative binding sites in the 3′UTR of Lin28B, Bmi1 mRNA (Fig. S3) and Notch1 mRNA. [score:5]
Moreover, miR-200 and let-7 played a critical role in linking EMT phenotype with stem cell signatures by regulating the expression of Lin28B and Notch1. [score:4]
These results suggest that miR-200 mediated down-regulation of Notch1 was partially responsible for self-renewal capacity and colonogenic growth of EMT-like cells having stem cell features. [score:4]
Interestingly, recent studies have shown that some natural agents could up-regulate miR-200 and reverse the EMT phenotype [44], [45]. [score:4]
The miR-200, especially miR-200b and miR-200c were identified to be mechanically linked with EMT phenotype and stem cell signatures in these cells via regulation of Notch1 and/or Lin28B expression. [score:4]
In our previous studies, we found significant down-regulation of miR-200 family in PC3 PDGF-D cells with EMT phenotype [28], which was consistent with our miRNA microarray data (Table S3). [score:4]
Two evolutionary conserved families, miR-200 and let-7 have been shown to regulate the differentiation processes during the development. [score:3]
To reveal whether expressions of miR-200 family are associated with stem cell signatures, PC3 PDGF-D cells were transfected with miR-200a, miR-200b and miR-200c. [score:3]
In this study, we found that PCa cells with EMT phenotype displayed stem-like cell features characterized by increased expression of Sox2, Nanog, Oct4, Lin28B and/or Notch1, consistent with enhanced clonogenic and sphere (prostasphere)-forming ability and tumorigenecity in mice, which was associated with decreased expression of miR-200 and/or let-7 family. [score:3]
MiR-200 repressed the self-renewal capacity by regulating Notch1 and Lin28B expression. [score:3]
In order to investigate whether miR-200 family could contribute to the generation of cancer stem-like cell characteristics in ARCaP [M] and PC3 PDGF-D cells by regulating the expression of Nanog, Oct4 and Sox2, Lin28B and other stem cell -associated makers, we have searched targets of miR-200 family in www. [score:2]
Therefore, we analyzed the expression of Lin28B, Notch1 and Bmi1, and performed the sphere-forming assay using ARCaP [M] and PC3 PDGF-D cells transfected with miR-200. [score:2]
Single cell suspensions of PC3 Neo, PC3 PDGF-D, ARCaP [E], ARCaP [M] and PC3 PDGF-D cells transfected with Sox2, Nanog, Oct4, Lin28B or control siRNA as well as miR-200 and let-7, were plated on ultra low adherent wells of 6-well plate (Corning, Lowell, MA) at 1000 or 2000 cells/well in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen). [score:1]
Table S3 The levels of miR-200 and let-7 family in PC3 Neo and PC3 PDGF-D cells. [score:1]
0012445.g004 Figure 4PC3 PDGF-D cells were transfected with pre-miR-200. [score:1]
Cells were transfected with 100 nmol/L of Sox2, Nanog, Oct4, Lin28B siRNA or control siRNA (Santa Cruz) as well as 20 nmol/L of miR-200 or let-7 (Ambion, Austin, TX) using DharmaFECT3 siRNA transfection reagent (DHARMACON, Lafayette, CO). [score:1]
Taken together, PC3 PDGF-D cells with EMT signatures showed stem-like cell characteristics through over -expression of Nanog, Oct4 and Sox2, Lin28B and activation of polycomb repressor complex 2. The miR-200 family plays a critical role in mediating EMT phenotype induced by various factors including PDGF-D [28], [40], [41]. [score:1]
3 days after transfection, cells were split and transfected repeatedly with pre-miR-200 every 3–4 days for 14 days. [score:1]
PC3 Neo and PC3 PDGF-D cells were seeded at a density of 6×10 [3] cells per well in 96-well plate and incubated for 24 h. The cells were co -transfected with Notch1 3′UTR luciferase plasmid (Switch Gear Genomics, Menlo Park, CA) and pre-miR-200 using DharmaFECT duo transfection reagent (DHARMACON, Lafayette, CO). [score:1]
PC3 PDGF-D cells were transfected with pre-miR-200. [score:1]
[1 to 20 of 27 sentences]
19
[+] score: 92
Other miRNAs from this paper: mmu-mir-141, mmu-mir-200b, mmu-mir-200c, mmu-mir-429
We found that Notch-1 could be one of the target genes of miR-200 family (miR-200b, miR-200c) because over -expression of these miRNAs significantly inhibited Notch-1 expression in prostate cancer [31] and pancreatic cancer (unpublished data). [score:9]
Moreover, novel strategies for the re -expression of miR-200 and its consequence could be tested in this animal mo del, which would help in the rational drug design in addition to Notch and NF-κB targeted drugs for the treatment of human PDAC for improving the overall survival of patients diagnosed with this devastating disease. [score:7]
Most interestingly, recent studies have shown that the miR-200 family regulates EMT by targeting ZEB expression. [score:6]
We have reported earlier that miR-200a, miR-200b, and miR-200c are down-regulated in gemcitabine-resistant pancreatic cancer cells, which have high expression of Notch pathway and contributed to the acquisition of EMT phenotype [33], [34]. [score:6]
Based on our results, we conclude that one possible mechanism by which the tumors developed in the compound KCI transgenic mice with activated K-ras and Ink4a/Arf deficiency is in part due to the loss of miR-200 family, which leads to the activation of Jagged/Notch and NF-κB signaling pathway, resulting in the up-regulation of NF-κB target genes, such as MMP-9, c-myc, survivin, Bcl-2, cyclin D1, and COX-2 as summarized in the cartoon diagram (Fig. 7) and contributes to tumor aggressiveness. [score:6]
C, The expression of miR-200 family was down-regulated in the tumors of the KCI mice as assessed by real-time RT-PCR. [score:6]
Furthermore, we have shown that miR-200 family regulates the expression of ZEB1, slug, E-cadherin, and vimentin, and thus suggested the re -expression of miR-200 could be useful for the reversal of EMT phenotype to mesenchymal-to-epithelial transition (MET), which has been partly documented in our recent publication [34]. [score:6]
Consistent with this notion, we found loss of miR-200a, miR-200b, and miR-200c expression in the tumors of KCI mice, suggesting that activated Notch pathway could also be due to the loss of expression of miR-200 family. [score:5]
Moreover, we found down-regulation of miR-200 family, which could also play important roles in tumor development and progression of PDAC in the compound transgenic mice. [score:5]
Our previous studies have shown that miR-200a, miR-200b, and miR-200c were down-regulated in gemcitabine-resistant pancreatic cancer cells, consistent with the observed EMT phenotype [32], [33]. [score:4]
Recently many studies have shown that the miR-200 family regulates EMT by targeting zinc-finger E-box binding homeobox 1 (ZEB1) and ZEB2. [score:4]
The miRNA-200 family was down-regulated in KCI mice. [score:4]
Moreover, we found alterations in the expression of miR-200 family, which could also play important roles in tumor development and progression of PDAC in the compound transgenic mice with activated K-ras and Ink4a/Arf deficiency. [score:4]
As expected, the expression of miR-200a, miR-200b and miR-200c was significantly decreased in the tumors of KCI mice (Fig. 3C). [score:3]
Recently, it has been reported that miR-200 family members target Notch pathway components, such as Jagged-1 [35], [36]. [score:3]
To address whether miR-200 family is involved in the tumors of KCI mice which showed high expression of Notch (Notch-2 and 4) signaling pathway, we investigated the expression of miR-200 family. [score:3]
One important miRNA is miR-200 family, which is involved in the regulation of EMT, stem cells and the regulation of Notch pathway [35], [36]. [score:3]
The miR-200 family have been found to regulate Notch signaling pathway [31]. [score:2]
Our results suggest that the activation of Notch and NF-κB together with the loss of miR-200 family is mechanistically linked with the development and progression of PDAC in the compound K-ras [G12D] and Ink4a/Arf deficient transgenic mice. [score:2]
In order to examine whether miR-200 family regulate Notch pathway, we transfected miR-200b precursor into Rink-1 cells. [score:2]
Since we found low expression of miR-200 family in the tumors of KCI mice, we assessed the EMT markers to investigate whether the tumors in the KCI mice underwent EMT or not. [score:1]
The miR-200 family has five members: miR-200a, miR-200b, miR-200c, miR-141 and miR-429. [score:1]
[1 to 20 of 22 sentences]
20
[+] score: 91
Other miRNAs from this paper: mmu-mir-141, mmu-mir-200b, mmu-mir-192, mmu-mir-200c, mmu-mir-429
Conversely, there are several reports that miR-200 family members and miR-192 can be down-regulated by TGF-beta, and this promotes EMT in cancer and other cell lines via subsequent up-regulation of targets ZEB1 and ZEB2 to repress E-cadherin [1]– [4]. [score:9]
Thus, TGF-beta -induced increase in the expression of microRNAs (miR-192 and miR-200 family members) might coordinately down-regulate E-box repressors Zeb1 and Zeb2 to inhibit EMT and fibrosis of kidneys. [score:8]
Previous studies showed that inhibition of EMT by miR-200 family members was mediated by their inhibition of the expression of the E-cadherin repressors ZEB1 and ZEB2 through binding to the 3′-UTR region of ZEB1 and ZEB2 mRNAs [1]– [3]. [score:7]
Several reports have shown that members of the miR-200 family (miR-200a,b,c, miR-141 and miR-429) inhibit EMT through direct targeting of ZEB1 and ZEB2, which encode transcriptional repressors of E-cadherin in kidney tubular cells [1], breast cancer cells [2], and mammary epithelial cells [3]. [score:6]
We also observed that Zeb1 and Zeb2 was a target of miR-200 family members that tended to be up-regulated by TGF-beta in kidney tubular cell lines. [score:6]
All miR-200 family precursors tested were capable of inhibiting the reduction of E-cadherin and up-regulation of N-cadherin affected by TGF-beta in HK-2 cells (Fig. 1b, c). [score:6]
We suggest that members of the miR-200 family, and miR-200b specifically, might constitute novel therapeutic targets in various kidney diseases. [score:5]
Finally, an alternative therapeutic approach in kidney disease may be to identify compounds that increase the expression levels of members of the miR-200 family of microRNAs. [score:5]
Conversely, the down-regulation of ZEB1 and ZEB2 by TGF-beta via miR-200 family and miR-192 can affect upstream E-box regions [14]. [score:4]
This study indicates that miR-200 family is up-regulated after ureter obstruction, miR-200b being strongly induced, and that miR-200b ameliorates tubulointerstitial fibrosis in obstructed kidneys. [score:4]
In order to confirm that miR-200 family members target ZEB1 and ZEB2 3′-UTRs, we co -transfected either ZEB1-3′UTR-luciferase or ZEB2-3′UTR-luciferase reporter vectors with miR-200 family precursors in HK-2 cells. [score:3]
miR-200 family members target the transcriptional repressors ZEB1 and ZEB2. [score:3]
showed that expression of all members of the miR-200 family tested were increased in a time -dependent manner after ureter obstruction (Fig. 1d); the induction of miR-200b was most pronounced. [score:3]
Given their ability to inhibit EMT, we investigated whether injection of miR-200 miRNA family precursors - chemically modified double strand of RNA which form RNA -induced silencing complex (RISC) like complex and can be processed by endonuclease Dicer into mature miR-200 family in cells - could ameliorate tubulointerstitial fibrosis by inhibition of EMT of tubular epithelial cells in UUO mo del mice. [score:3]
In this report, we show that members of the miR-200 family of miRNAs are induced after ureter obstruction and that miR-200b ameliorates tubulointerstitial fibrosis in obstructed kidneys via inhibition of EMT of tubular cells. [score:3]
Several articles have shown that the miR-200 family targets ZEB1 and ZEB2 [1]– [4]. [score:3]
Recent reports have indicated that a double -negative feedback loop between ZEB1, ZEB2 and miRNA-200 family members regulates EMT in kidney tubular cells [4]. [score:2]
In western blotting, each band has been quantitated and subjected to densitometry to determine if statistically significant difference exists between groups d, Changes in miR-200 family levels in UUO mo del mice kidneys, as measured by TaqMan qRT-PCR and normalized to U6 expression. [score:1]
miR-200 family members can ameliorate EMT and tubulointerstitial fibrosis in UUO mo del mouse kidneys. [score:1]
We suggest that the therapeutic role of miR-200 family members be investigated in other mo dels of kidney disease, particularly in the context of these factors. [score:1]
b, c, in HK-2 cells treated with TGF-beta and transfected with control miR or miR-200 members precursors individually. [score:1]
Since the most efficient in vitro inhibition of TGF-beta was mediated by the miR200-b miRNA (Fig. 1b and Fig. 1c) we next evaluated its effect in vivo by injecting miR-200b precursor via the abdominal vein prior to occlusion of the left ureter. [score:1]
0013614.g003 Figure 3Normalized activity of luciferase reporter with the ZEB1 or ZEB2 3′UTR in HK-2 cells in the presence of co -transfected negative control pre-miR or miR-200 family individually. [score:1]
To assess the effect of miR-200 family precursor on reporter activity, 50 pM of synthetic precursor miRNAs (pre-miRs) (Ambion) were co -transfected. [score:1]
The luciferase activity of both reporters was significantly reduced in the presence of all miR-200 family members tested (Fig. 3). [score:1]
b. Changes in miR-200 family levels in Balbc mice kidneys 12, 24, 48 hours after intravenously administration of miR-200b precursor, as measured by TaqMan qRT-PCR and normalized to U6 expression. [score:1]
These results indicate that members of the miR-200 family of miRNAs are induced after ureter obstruction and that miR-200b ameliorates tubulointerstitial fibrosis in obstructed kidneys. [score:1]
Normalized activity of luciferase reporter with the ZEB1 or ZEB2 3′UTR in HK-2 cells in the presence of co -transfected negative control pre-miR or miR-200 family individually. [score:1]
[1 to 20 of 28 sentences]
21
[+] score: 77
They found that miR-200 family inhibitors down-regulated pro-SP-C and SP-B expression. [score:8]
Of note, we did not observe upregulation of the primary direct targets of the miR-200 family in the transcriptome analysis of miR-200b [−/−] lungs. [score:7]
Others have shown that miR-200 is down-regulated in a mouse mo del of fibrotic lung disease and human patients with idiopathic pulmonary fibrosis (IPF) [21]. [score:6]
Although miR-200a and miR-429 were expressed lower in miR-200b [−/−] lungs, their expression was not undetectable like miR-200b. [score:5]
Knocking down miR-200b in our mice resulted in down-regulation of mature miR-200a and miR-429. [score:5]
Based on our studies, we cannot exclude that downregulation of miR-200a and miR-429 contributed to the observed lung phenotype in miR-200b deficient mice. [score:4]
Therefore, changes in proteins of the direct gene targets of the miR-200 family might not be reflected in the transcriptome of miR-200b [−/−] lungs. [score:4]
miR-200a and miR-429 were significantly downregulated, but no changes were observed in abundance of miR-200c and miR-141 ** P < 0.01, Student’s t-test, Data represent mean ± SEM of at least four independent experiments. [score:4]
However, it is unclear at this point what the influence of downregulation of miR-200a and miR-429 on the lung phenotype of miR-200b deficient mice is. [score:4]
Benlhabib H Guo W Pierce BM Men delson CR The miR-200 Family and Its Targets Regulate Type II Cell Differentiation in Human Fetal LungJ. [score:4]
Members of the miR-200 family are down-regulated in the lungs of patients with IPF and a mouse mo del of lung fibrosis [21]. [score:4]
MiR-200b belongs to the miR-200 family (miR-141, miR-429, miR-200a, miR-200b and miR-200c) and regulates epithelial-to-mesenchymal transition (EMT) in cancer and organ fibrosis 17– 20. [score:2]
Using human fetal lung cultures, Benlhabib, et al. showed previously that miR-200 family members regulate epithelial type II cell differentiation and function [33]. [score:2]
We showed that mature microRNAs transcribed in the same cluster - miR-200a and miR-429 - were still expressed, albeit lower compared to miR-200b [+/+] lungs (Fig.   1f, Supplementary Fig. 5). [score:2]
Du, J. T. et al. MicroRNA-200 family members are weakly expressed in the neurosensory epithelia of the developing zebrafish (Danio rerio) inner ear. [score:2]
miR-200b [−/−] lungs have dysfunctional surfactant and denser parenchyma with more fibroblast- like cellsSome of the lung function abnormalities in miR-200 [−/−] could result directly from changes in surfactant function or distal airway branching. [score:2]
Some of the lung function abnormalities in miR-200 [−/−] could result directly from changes in surfactant function or distal airway branching. [score:2]
Mature microRNAs transcribed in the same cluster–miR-200a and miR-429–were still expressed, albeit lower compared to miR-200b [+/+] lungs (wt). [score:2]
We also observed lower miR-200a and miR-429 in kidney tissues of miR-200b [−/−] mice (Supplementary Fig. 6). [score:1]
mRNA-Seq whole transcriptome analysis demonstrated that mRNAs of epithelial cell differentiation and surfactant genes are most affected in miR-200b [−/−] lungsIn order to evaluate the effect on downstream targets and associated pathways owing to loss of miR-200b on the lung tissue transcriptome, we performed Next Generation Sequencing (NGS) on total RNA samples from lungs of three 8-week-old miR-200b [−/−] mice and three miR-200 [+/+] (wt) mice. [score:1]
Although miR-200c has the exact same seed sequence as miR-200b, the abundance of this microRNA along with miR141 was not changed in lungs and kidneys of 8-week old miR-200b [−/−] mice suggesting the absence of any compensatory effects of these two miR-200 family members in miR-200b deficient mice. [score:1]
Therefore, we assessed the biophysical function of surfactant from miR-200b [−/−] and miR-200 [+/+] lungs using capillary surfactometry. [score:1]
In order to evaluate the effect on downstream targets and associated pathways owing to loss of miR-200b on the lung tissue transcriptome, we performed Next Generation Sequencing (NGS) on total RNA samples from lungs of three 8-week-old miR-200b [−/−] mice and three miR-200 [+/+] (wt) mice. [score:1]
We then scanned three complete sections per lung of three miR-200b [+/+] and three miR-200 [−/−] lungs using an Axio Scan. [score:1]
These two miR-200 family members share the same transcript with miR-200b. [score:1]
We observed lower percentages of airspace in miR-200 [−/−] lungs (Fig.   3d). [score:1]
[1 to 20 of 26 sentences]
22
[+] score: 77
NP-siRNA -mediated knockdown of DCAMKL-1 resulted in upregulation of pri-miR-200a (Figure 5A) and downregulation of ZEB1 and ZEB2 with upregulation of E-cadherin (Figure 5B) in the HCT116 tumor xenografts. [score:11]
In this report, we have demonstrated that (a) DCAMKL-1 siRNA encapsulated in PLGA nanoparticles (siDCAMKL-1 NPs) exhibit significant knockdown of DCAMKL-1 mRNA in HCT116 cells; (b) siDCAMKL-1 NPs are similarly potent or more than free liposomal encapsulated siDCAMKL-1 in the ability to down-regulate tumorigenesis, pro-proliferative and oncogenic factors such as c-Myc, in tumor xenografts; (c) siDCAMKL-1 NPs are similarly effective in increasing tumor suppressor miRNA let-7a; (d) siDCAMKL-1 NPs are effective in increasing miR-144 and downregulating Notch-1 and (e) siDCAMKL-1 NPs may serve as a useful vehicle for the delivery of anti-cancer therapy via its effects on EMT through its interaction with miR-200a. [score:10]
Moreover, an upregulation of EMT inhibitor miR-200a and downregulation of the EMT -associated transcription factors ZEB1, ZEB2, Snail and Slug were observed in vivo. [score:9]
Taken together, these data strongly suggest that Notch-1 is a downstream target of miR-144 miRNA and that DCAMKL-1 regulates posttranscriptional control of Notch-1. siRNA -mediated knockdown of DCAMKL-1 inhibits Epithelial-to-Mesenchymal Transition via a miR-200a dependent mechanismEpithelial-to-Mesenchymal Transition (EMT) is a phenotypic conversion in fibrotic diseases and neoplasia [33, 34]. [score:9]
The novel putative intestinal and pancreatic stem cell marker DCAMKL-1 [5- 7], a microtubule -associated kinase is upregulated in colorectal and pancreatic cancers and plays a functional role in tumorigenesis through regulation of the tumor suppressor microRNAs (let-7a, miR-200a and miR-144) and their downstream targets such as c-Myc, KRAS, ZEB1, ZEB2 and Notch-1 [8, 9]. [score:9]
Furthermore, recent reports suggest that the downregulation of several miRNAs (miR-200a, miR-200b, miR-200c, miR-141, and miR-429) is an essential feature of EMT [37]. [score:4]
Furthermore, induction of pri-miR-200a resulted in downregulation of ZEB1, ZEB2, Snail and Slug in colorectal tumor xenografts. [score:4]
These data taken together suggest that knockdown of DCAMKL-1 may inhibit EMT via a miR-200a -dependent mechanism in human colorectal cancer [8]. [score:4]
Here we report that NP-siDCAMKL-1 upregulates miR-200a, let-7a and miR-144 in the colorectal cancer tumor xenograft mo del. [score:4]
siRNA -mediated knockdown of DCAMKL-1 inhibits Epithelial-to-Mesenchymal Transition via a miR-200a dependent mechanism. [score:4]
These data suggest that Notch-1 inhibition alone was insufficient to induce endogenous miR-200a at the dose tested. [score:3]
We subjected the HCT116 tumor xenografts to miR-200a miRNA expression analysis by real-time RT-PCR. [score:3]
We did not observe any difference in expression of pri-miR-200a miRNA following treatment with DAPT compared to control or NP-siSCR treated tumors (Figure 5A). [score:2]
The crossing threshold value assessed by real-time PCR was noted for pri-let-7a, pri-miR-144, and pri-miR-200a miRNAs and normalized with U6 pri-miRNA. [score:1]
[1 to 20 of 14 sentences]
23
[+] score: 72
Taken together with our later observations that targeting of the liver-specific miR-122-5p or poorly abundant miR-195-5p, miR-25-3p, miR-200a/b/c-3p, miR182-5p and the mutant miR-224-5p mut2 by 2′OMe AMOs (but not their LNA/DNA AMO counterparts) also resulted in significant inhibition of immunostimulatory ssRNA sensing, our work establishes sequence -dependent and miRNA-independent off-target inhibitory activity of 2′OMe AMOs on the immune sensing of pathogenic RNA by human and mouse phagocytes. [score:9]
Mutation or deletion of part of this motif resulted in the loss of inhibitory activity for miR-200a-3p, miR-122-5p and NC1 2′OMe AMO variants, while introduction of this motif to the poorly inhibitory miR-224-5p AMO significantly increased the inhibitory activity of the AMO on TLR7. [score:8]
The sequence-specific and miRNA-independent significant inhibition of immunostimulatory ssRNA sensing by 2′OMe AMOs targeting miR-195-5p, miR-25-3p, miR-122-5p, miR-200a/b/c-3p and miR182-5p (Figure 2B) was supported by the lack of inhibitory activity with LNA/DNA AMOs (Figure 2C), and the low abundance of these miRNAs (less than 100-fold the level of the most abundant miRNA in BMMs) (Figure 2A). [score:7]
In addition, truncation of miR-200a-3p 2′OMe AMO to a shorter form (miR-200a-3p short) directly impacting on the 5′ end of the inhibitory motif, also resulted in decreased inhibitory activity of miR-200a-3p in both human and mouse (Figure 4F). [score:6]
While a single base change in miR-200a-3p mut1 did not significantly affect the inhibitory activity of this 2′OMe AMO, the addition of another two changes significantly compromised the inhibitory effect of the miR-200a-3p mut2 2′OMe AMO in primary BMMs (Figure 4E), thereby underlining a critical role of this motif. [score:5]
Importantly, although miR-200a-3p and miR-200b-3p had similar inhibitory activities, miR-200c-3p was a less potent inhibitor (Figure 2B). [score:5]
Relying on the variations between the miR-200a-3p and miR-200b-3p AMOs, we defined a central core UUACCA sequence changed to UUACCC in miR-200c-3p, which is potentially directly involved in the inhibitory activity of these 2′OMe AMOs on TLR7 sensing (Figure 4C). [score:4]
To validate the TLR7 -inhibitory function of this motif in the miR-200 2′OMe AMOs, we synthesized two AMO variants of the miR-200a-3p 2′OMe AMO, with one (miR-200a-3p mut1) and three (miR-200a-3p mut2) base changes in the most conserved residues of the enriched motif (Figure 4C and D). [score:3]
We noted that miR-200a-3p, miR-200b-3p and miR-200c-3p 2′OMe AMOs had a strong inhibitory effect on immunostimulatory ssRNA sensing in primary BMMs. [score:3]
Critically, this core sequence overlapped with a significantly enriched motif found in all the inhibitory sequences of Class 2 AMOs previously identified, in 5′-3′ orientation (for miR-200a/b-3p, and miR-25-3p) or 3′-5′ orientation (for AMO-NC1, miR-182-5p, miR-122-5p and miR-195-5p) (Figure 4C and Supplementary Table S2). [score:3]
Noteworthy, we found that miR-200a-3p and NC1 2′OMe AMO variants conjugated with a 3′ cholesterol group (commonly used for in vivo administration and referred to as antagomiRs (4)) were also strong inhibitors of TLR7/8, with marginally less activity than native sequences (Supplementary Figure S2B). [score:3]
These results were confirmed in dose-response studies in primary BMMs, demonstrating that the miR-200a-3p 2′OMe AMO was significantly more inhibitory than the miR-200c-3p AMO (Figure 4A). [score:3]
While the native miR-200c-3p 2′OMe AMO was significantly less inhibitory than miR-200a-3p 2′OMe AMO, activity of its mutated variant miR-200c-3p mut (restoring the core UUACCA sequence) did not significantly differ from that of miR-200a-3p in either human PBMCs or mouse BMMs (Figure 4F). [score:3]
Our analyses of truncated variants of miR-122-5p and miR-200a-3p 2′OMe AMOs also show that disruption of the context of the inhibitory motif can significantly reduce its activity (Figure 4). [score:3]
While comparing the effects of miR-200 AMO variants, we noted that miR-200c-3p had a lesser capacity to inhibit TNF-α production, compared to miR-200a-3p and miR-200b-3p. [score:2]
Unpaired t-tests comparing miR-200a-3p+B-406AS-1 and indicated conditions are shown. [score:1]
Ordinary one-way ANOVA with Dunnett's multiple comparison tests to miR-200a-3p+B-406AS-1 (E) or NC1+B-406AS-1 (H and I) are shown. [score:1]
To define further the impact of this motif in the modulation of TLR7/8 sensing, we generated a set of AMO mutants and truncated variants (Figure 4D) based on miR-200a/c-3p, miR-122-5p and NC1 2′OMe AMOs. [score:1]
Unpaired t-tests comparing miR-200a-3p+B-406AS-1 (F) or RD+B-406AS-1 (G) and indicated conditions are shown (ns, not significant). [score:1]
Similar results were found with immunostimulatory ssRNA sensing in human PBMCs on TLR8, where the miR-200c-3p AMO was also significantly less potent than the miR-200a-3p AMO at reducing TNF-α production (Figure 4B). [score:1]
[1 to 20 of 20 sentences]
24
[+] score: 70
Other miRNAs from this paper: mmu-mir-200b, hsa-mir-200b, hsa-mir-200c, mmu-mir-200c, hsa-mir-200a
It is of note that further down-regulation of Zeb1 in Zeb1 null MEF cells had little effects on miR-200 expression (Figure  4B), possibly due to [1] the level of Zeb1 protein in het MEF cells is low enough to relieve the repression on miR-200 family, further decrease in Zeb1 expression in null cells will not increase in miR-200 expression accordingly or/and [2] it is also possible that Zeb1 might down-regulate other unknown factor(s) that positively regulates expression of miR-200 family at the same time and thereby makes the regulation network more complex. [score:17]
Our results suggest that E2F-Rb1 binds constitutively to the Ets1 promoter and limits the level of expression, but a second major impact of Rb1 on Ets1 expression is mediated through Rb1 repression of Zeb1 [40] and in turn induction of miR-200, which targets Ets1. [score:7]
Knockdown of Zeb1 in the T KO MEFs using shRNA lenvirirus, as described previously [17], eliminated much of the induction of Ets1 (Figure  4D), suggesting that induction of Zeb1 and repression of miR-200 as Rb1 family members are mutated is contributing significantly to the upregulation of Ets1. [score:5]
Because miR-200 has been shown to target Ets1 [19], we wondered if Zeb1 might also affect expression of Ets1. [score:5]
We link the effect of Zeb1 to its regulation of miR-200, which in turn target Ets1. [score:4]
Such findings raised the possibility that Zeb1 might feedback to induce Ets1 via its repression of miR-200, and that Rb1 might also influence Ets1 expression via its regulation of Zeb1. [score:4]
Rrm2, ribonucleotide reductase, Ntf3, neurotrophin 3. Zeb1 is a target of the miR-200 family, but in a negative loop Zeb1 feeds back to repress transcription of miR-200 family members [20, 21]. [score:3]
We link Rb1 repression of Zeb1 to induction of miR-200 family members, which in turn target Ets1 mRNA. [score:3]
miR-200 also represses Zeb1, but in a double negative loop Zeb1 binds the promoters of miR-200 family members and represses their expression [20, 21]. [score:3]
These results suggest that Rb1-E2F binds the Ets1 promoter to limit its level of expression, but it is induction of Zeb1 and in turn repression of miR-200 when the Rb1 family activity is lost that is responsible for most of the induction of Ets1. [score:3]
Taken together, our results provide evidence of an amplification loop consisting of Ets1 and Zeb1, which is mediated by miR-200 and regulated by Rb1. [score:2]
Figure 8 Mo del depicting an Ets1-Zeb1 amplification loop that is dependent upon miR-200 and regulated by Rb1. [score:2]
These results imply that CtBP -dependent transcription repression of miR-200 family members by Zeb1 is important for regulation of Ets1 and for thymocyte differentiation. [score:2]
We propose that Ets1 and Zeb1 form an amplification loop that is dependent upon Zeb1 repression of miR-200 and regulated by the Rb1 family (Figure  8). [score:2]
These findings suggest that Ets1 and Zeb1 comprise an amplification loop that is dependent upon miR-200 and regulated by Rb1. [score:2]
As we demonstrated previously [16], mutation of Rb1 family members led to induction of Zeb1 and this induction of Zeb1 was accompanied by repression of miR-200 (Figure  4C) and, as shown above, Ets1 (Figure  1). [score:2]
Zeb1 repression of the miR-200 family is linked to induction of Ets1. [score:1]
Ets1 Zeb1 miR-200 Thymocyte differentiation Lung adenocarcinoma c-Ets1 was identified as a proto-oncogene based on v-ets in the genome of the avian leukemia retrovirus E26, and is the founding member of the Ets family of transcription factors [1]. [score:1]
Recent studies have found that Ets is repressed by miR-200 family members [19]. [score:1]
Taken together, these results suggest an amplification loop between Ets1 and Zeb1, where Ets1 increases transcription of Zeb1, and Zeb1 in turn represses miR-200 to further elevate Ets1. [score:1]
[1 to 20 of 20 sentences]
25
[+] score: 67
of databases predicting interaction Names of databases Dcx mmu-miR-200a 6 DIANAmT, miRanda, miRDB, miRWalk, PITA, Targetscan mmu-miR-200b 6 DIANAmT, miRanda, miRWalk, PITA, Targetscan, PICTAR 4 mmu-miR-466a-3p 4 miRanda, miRWalk, PITA, Targetscan mmu-miR-466d-3p 4 miRanda, miRWalk, PITA, Targetscan Pafah1b1 mmu-miR-200a 4 DIANAmT, miRanda, PITA, Targetscan mmu-miR-200b 5. [score:11]
In NSCs from diabetic pregnancy, the significant increase in protein expression of Dcx and Pafah1b1 correlates well with the reduced expression of miRNAs (mmu-miR-200a, mmu-miR-200b, mmu-miR-466a-3p and mmu-miR-466d-3p) (Figs. 2B and 3C) which have been predicted to target Dcx and Pafah1b1 suggesting possible role for miRNA in regulating gene expression. [score:10]
We report novel role of miRNAs mmu-miR-200a, mmu-miR-200b, mmu-miR-466a-3p and mmu-miR-466d-3p in regulating neurogenesis and gliogenesis in vitro by targeting and upregulating Gfap, Map2 and Ng2 proteins either through direct target or through an indirect regulation which needs detailed evaluation. [score:10]
In NSCs, hyperglycemia increased the expression of Dcx (Doublecortin) and Pafah1b1 (Platelet activating factor acetyl hydrolase, isoform 1b, subunit 1) proteins concomitant with decreased expression of four microRNAs (mmu-miR-200a, mmu-miR-200b, mmu-miR-466a-3p and mmu-miR-466 d-3p) predicted to target these genes. [score:7]
Confocal images showing the expression of Gfap positive cells (A–E), Ng2 positive cells (F–J) and Map2 positive cells (K–O) (red) in differentiated cells following knockdown of miRNAs mmu-miR-200a or mmu-miR-200b or mmu-miR-466a-3p or mmu-miR-466d-3p in NSCs. [score:4]
Further, we confirmed that Dcx and Pafah1b1 were targets of miRNAs mmu-miR-200a, mmu-miR-200b, and mmu-miR-466a-3p and mmu-miR-466d-3p by using knockdown approach. [score:4]
miR-200 family has been reported to regulate olfactory neurogenesis in mouse and zebrafish mo dels [47] and the expression of few members of miR-466 family have been shown in mouse ocular tissue [48]. [score:4]
Knockdown of miRNAs, mmu-miR-200a, or mmu-miR-200b, or mmu-miR-466a-3p or mmu-miR-466d-3p resulted in increased expression of Dcx (1.78±0.57-folds, p<0.05; 1.42±0.34-folds, p<0.05; 2.12±0.40-folds, p<0.05; 2.98±1.05-folds, p<0.05 respectively) (Fig. 4B) and Pafah1b1 (1.93±0.43-folds, p<0.05; 1.69±0.57-folds, p<0.05; 1.64±0.45-folds, p<0.05; 1.68±0.34-folds, p<0.01 respectively) (Fig. 4C) proteins in NSCs. [score:4]
5′flourescently labelled miRCURY LNA ™ miRNA inhibitors mmu-miR-200b, mmu-miR-466d-3p, and non labeled miRCURY LNA ™ mmu-miR-200a, mmu-miR-466a-3p and were purchased from Exiqon (Vedbaek, Denmark) (Table S3 in Tables S1). [score:3]
This study is the first to report the expression of miRNAs mmu-miR-200a, mmu-miR-200b, mmu-miR-466a-3p and mmu-miR-466 d-3p in NSCs obtained from mouse embryonic forebrain. [score:3]
The expression levels of miRNA mmu-miR-200a (0.009±0.009 vs 1.06±0.45-folds, p<0.05), mmu-miR-200b (0.021±0.02 vs 1.04±0.37-folds, p<0.05), mmu-miR-466a-3p (0.054±0.01 vs1.01±0.21-folds, p<0.05) and mmu-miR-466d-3p (0.028±0.02 vs 1.01±0.21-folds, p<0.01) were significantly decreased in NSCs from diabetic pregnancy when compared to the control (Fig. 3C). [score:2]
miRNAs, mmu-miR-200a, mmu-miR-200b, mmu-miR-466a-3p and mmu-miR-466d-3p were knocked down individually in NSCs in culture. [score:2]
There was significantly increased astrogenesis as indicated by increased Gfap positive cells following knockdown of miRNAs, mmu-miR-200a (120.52±6.54%, p<0.01) or mmu-miR-200b (115±2.24%, p<0.01) or mmu-miR-466a-3p (126.53±18.87%, p<0.05) compared to scrambled (Scr) transfected cells (Fig. 5 A–E, i). [score:1]
We performed in situ hybridization of two representative miRNAs (mmu-miR-200b and mmu-miR-466d-3p) selected from each family of miRNA that are investigated in this study (mmu-miR-200 and mmu-miR-466 family) in unbiased manner to detect whether these miRNAs were expressed by NSCs. [score:1]
Knockdown of only mmu-miR-200a (135.25±19.34%, p<0.05) or mmu-miR-466a-3p (121.54±17.29%, p<0.05) significantly increased the number of Map2 positive cells compared to scrambled transfected cells (Fig. 5K–O, iii), signifying increased neurogenesis. [score:1]
[1 to 20 of 15 sentences]
26
[+] score: 66
miR-200 family knockdown by a single miR inhibitor plasmidBecause one miR inhibitor can potentially inhibit different members of the same miR family, we asked if a PMIS construct containing two inhibitors targeting an miR family could inhibit the complete miR family. [score:14]
To inhibit the miR-200 family, PMIS-miR-200b-200a was constructed and contains a U6 promoter followed by an miR-200b inhibitor, a second U6 promoter followed by miR-200a inhibitor (Figure 1c). [score:7]
This construct allows for the expression of multiple miR inhibitors from one plasmid to inhibit the entire miR-200 family (Figure 4g). [score:7]
Ndrg3 (N-myc downstream regulated gene 3), Bckdk (branched-chain α-ketoacid dehydrongenase kinase) and Cd320 (Cd320 antigen, putative VLDL receptor), which are also known targets of miR-122, [46] were analyzed for their expression in WT, PMIS-miR-17-18-19-92 and PMIS-miR-200a mice. [score:6]
[41] To test if the PMIS-miR-200 inhibits miR-200 function in vitro and promotes EMT, a stable MDCK cell line was made that expresses PMIS-miR-200a-200b. [score:5]
Overexpression of miR-200 promotes a mesenchymal-to-epithelial transition in MDCK-Pez cells and conversely inhibition of miR-200 causes EMT in MDCK cells. [score:5]
24, 29 Bim expression, a proapoptotic gene involved in B-cell development and a known target of miR-17, [38] was elevated in cells transfected with PMIS-miR-17 compared with cells with empty vector and PMIS-miR-200a (Figure 2c). [score:5]
miR-200 family knockdown by a single miR inhibitor plasmid. [score:4]
39, 40 PMIS for miR-200b, -200c or -429 inhibited the miR-200b/200c/429 subfamily efficiently but not the miR-200a/141 subfamily (Figures 4d–f). [score:3]
PMIS constructs for miR-200a or -141 (PMIS-miR-200a or PMIS-miR-141) inhibited the miR-200a/141 subfamily but not the miR-200b/200c/429 subfamily (Figures 4b and c). [score:3]
Immunofluorescence of the epithelial marker E-cadherin confirmed that MDCK cells underwent EMT after expression of PMIS-miR-200a-200b (data not shown). [score:3]
The miR-200 family has two subfamilies, miR-200a-3p/141-3p and miR-200b-3p/200c-3p/429-3p (Figure 4a). [score:1]
Mice and embryos from WT, PMIS-miR-17-18, PMIS-miR-19-92 and PMIS-miR-200a were genotyped from DNA extraction of tail biopsies. [score:1]
The following oligos were also used: miR-200a rf, 5′-TCGAATGACCACATCGTTACCAGACAGTGTTACTCGAGCTGC-3′ and miR-200a rr, 5′-GGCCGCAGCTCGAGTAACACTGTCTGGTAACGATGTGGTCAT-3′ miR-200b rf, 5′-TCGAATGACCTCATCATTACCAGGCAGTATTACTCGAGCTGC-3′ and miR-200b rr, 5′-GGCCGCAGCTCGAGTAATACTGCCTGGTAATGATGAGGTCAT-3′ miR-200c rf, 5′-TCGAATGACCTCCATCATTACCCGGCAGTATTACTCGAGCTGC-3′ and miR-200c rr, 5′-GGCCGCAGCTCGAGTAATACTGCCGGGTAATGATGGAGGTCAT-3′ miR-141 rf, 5′-TCGAATGACCCCATCTTTACCAGACAGTGTTACTCGAGCTGC-3′ and miR-141 rr, 5′-GGCCGCAGCTCGAGTAACACTGTCTGGTAAAGATGGGGTCAT-3′ miR-429 rf, 5′-TCGAATGACCACGGCATTACCAGACAGTATTACTCGAGCTGC-3′ and miR-429 rr, 5′-GGCCGCAGCTCGAGTAATACTGTCTGGTAATGCCGTGGTCAT-3′. [score:1]
[48] The PMIS-miR-17-18, PMIS-miR-19-92 and PMIS-miR-200a mice do not develop cancer or die due to liver toxicity or toxicity problems. [score:1]
[1 to 20 of 15 sentences]
27
[+] score: 59
Cluster analysis of over-expressed miRNAs (Figure S1A) and under-expressed miRNAs (Figure S1B) indicated that some deregulated miRNAs might play their roles in groups, such as up-regulated miR-10b and miR-21 and down-regulated miR-200a* and miR-148b*. [score:12]
The proven targets of seven validated, deregulated miRNAs are listed in Table 4. Among these targets, we detected the targets of miR-200a* (the most down-regulated miRNA) in both SP cells. [score:11]
In contrast to the miR-200a* expression, both targets ZEB1 and ZEB2 were expressed at much higher levels in SP-HCCs than in SP-NLCs by sQRT-PCR (Figure S2). [score:7]
In this study, the targets of miR-200a*, ZEB1 and ZEB2 were both expressed at much higher levels in SP-HCCs than in SP-NLCs. [score:5]
The ZEB-miR-200 feedback loop has been demonstrated to link EMT activation and the maintenance of stemness by suppressing stemness-inhibiting miRNAs and acting as a promoter of mobile, migrating CSCs [59]. [score:5]
Among these targets, the miR-200a* target genes ZEB1 and ZEB2 [32], [33] were analyzed in both SP-HCCs and SP-NLCs by sQRT-PCR. [score:5]
Two important miRNAs that were down-regulated in SP-HCCs, miR-200a* and miR-148b*, have been described in HCC tissues [26] and ovarian cancers [47]. [score:4]
These data indicate that the greatly down-regulated miR-200a* may promote malignant transformation of SP-NLCs and force SP-HCCs to become more metastatic. [score:4]
Figure S2 The target analysis of miR-200a*. [score:3]
Mol Biol Cell 33 Bendoraite A Knouf EC Garg KS Parkin RK Kroh EM 2010 Regulation of miR-200 family microRNAs and ZEB transcription factors in ovarian cancer: evidence supporting a mesothelial-to-epithelial transition. [score:2]
Recent findings have associated miR-200a* with stem cell maintenance and suggest a connection between the epithelial-to-mesenchymal transition (EMT) and stem cell formation. [score:1]
[1 to 20 of 11 sentences]
28
[+] score: 58
It has been suggested that different cell lines regulate miR-200 expression through distinct epigenetic mechanisms [27]. [score:4]
Downregulation of miR-200 family members might underlie kidney cyst formation in Dicer mutant kidneys. [score:4]
Members of the miR-200 family were highly expressed in the kidney, lung, small intestine, and exocrine glands (Figure 2(a)). [score:3]
Members of the miR-200 family are commonly expressed in tubular tissues, and it is impossible to classify these tissues using only the miR-200 family. [score:3]
The miR-200 family consists of five members (miR-200a, miR-200b, miR-200c, miR-141, and miR-429), which are clustered and expressed as the miR-200b-200a-429 cluster at chromosomal location 1p36 and the miR-200c-141 cluster at chromosomal location 12p13. [score:3]
In human tissues, the results of the miRNA array analysis showed that miR-200a, miR-200b, and miR-200c (miR-200 family) were highly expressed in the kidney, lung, salivary gland, trachea, colon, prostate, liver, and pancreas (Figure 1). [score:3]
As expected, members of the miR-200 family were highly expressed in exocrine glands and epithelial cells. [score:3]
The expression of miR-200a, miR-200b, miR-200c, miR-192, miR-194, and miR-449a was validated with real-time RT-PCR in rat tissues in order to discriminate the kidney from other tissues with a tubular structure. [score:3]
Members of the miR-200 family were highly expressed in the proximal tubule. [score:3]
Members of the miR-200 family were expressed at high levels in each tissue with a tubular structure (Figures 3(a)– 3(c)). [score:3]
To examine the miR-200 family in the kidney, miRNA array analysis was performed to compare expression in the proximal tubule and mesangial cells. [score:3]
The lacrimal gland and salivary gland are formed from the ectoderm, and the expression ratio of miR-200a/b and miR-200c might depend on the germ layer. [score:3]
Our results showed that miR-200 family members were expressed at high levels in various tissues with a tubular structure: the kidney (proximal tubule and collecting duct), lung, pancreas (duct cells), small intestine (intestinal villus), bile duct, and exocrine glands (duct cells). [score:3]
Members of the miR-200 family are highly expressed in the kidney and lung. [score:3]
On the other hand, urinary miR-200a increased after day 3 of administration (Figure 5(c)). [score:1]
Furthermore, the levels of miR-200a/b/c were higher in the proximal tubule than in the glomerulus. [score:1]
In our results, urinary miR-200a also increased, and the sensitivity was similar to that of urinary albumin excretion. [score:1]
We assessed whether the plasma concentrations of miR-200a, miR-200b, and miR-200c could be used as a biomarker for acute kidney injury (Figure 4). [score:1]
Plasma miR-200a was not detected (data not shown). [score:1]
We assessed whether the urinary concentrations of miR-200a and miR-200c could be used as a biomarker for renal tubular dysfunction (Figure 5). [score:1]
A significant increase in plasma miR-200a/b/c, miR-192, and miR-194 levels was observed in the AKI mo del. [score:1]
These results suggest that the miR-200 family is closely associated with tubular structure. [score:1]
The concentrations of miR-200a/b/c were estimated based on the analytical curve for synthetic miRNA. [score:1]
Although morphological changes were not observed and miR-200a was not detected in plasma, macrophage infiltration was induced [23]. [score:1]
In the future, we will assess the potential of the urinary miR-200 family as biomarkers of the renal tubular dysfunction in humans. [score:1]
Patel et al. have reported that miR-200 family members play important roles in renal tubule maturation by repressing Pkd1 in the kidney [25]. [score:1]
We assessed whether the miR-200 family could be used as a biomarker for kidney injury. [score:1]
Consistently, the plasma concentrations of the miR-200 family members and miR-192 and miR-194 increased significantly. [score:1]
[1 to 20 of 28 sentences]
29
[+] score: 55
Several down-regulated (i. e. miR-1, miR-7, miR-34a, miR-122, miR-125b, miR-200) or up-regulated (i. e. miR-17, miR-18, miR-19, miR-155, miR-93, miR-221/222) miRNAs have been identified as tumor suppressor or oncomirs, respectively, by targeting and regulating genes involved in cell proliferation, apoptosis, angiogenesis and metastasis [13]. [score:12]
A number of dysregulated microRNAs in this mo del were already described in the pathogenesis of liver disease and showed concordant level of expression with respect to that already described in literature (miR-155, miR-20a, miR-182, miR-200a, miR-200c, miR-27a, miR-31, miR-99b) or discordant expression level (miR-193b, miR-93, miR-125a-5p). [score:8]
Some miRNAs were overexpressed in tumors (miR-155, miR-193b, miR-27a, miR-31, miR-99b, miR-484, miR-574-3p, miR-125a-5p, miR-182), whereas others displayed down-regulation (miR-20a, miR-200c, miR-93, miR-340-5p, miR-720) or a comparable level of expression (miR-200a) with respect to non tumor tissues. [score:8]
MiR-200a was found to be up-regulated in NAFLD [51], significantly down-regulated in human HCC samples and, along with miR-200 family members, has been described as a marker able to distinguish between cirrhotic and cancer tissues [52, 53]. [score:7]
It is known that miR-200 family plays a role as tumor suppressor by inhibiting epithelial-to-mesenchymal transition (EMT) and repressing cancer stem cells; in addition, its deregulation has been described in several tumor types, including hepatocarcinoma [50]. [score:6]
MiR-200a and c, members of the miR-200 family, showed different behavior: after expression level’s decrease (6 months), miR-200a increased during the progression of hepatic damage (12 months), whereas miR-200c revealed a trend of down-regulation during HF diet treatment and in tumors. [score:6]
MiR-200a revealed a modulation, being down-regulated after 6 months and over-expressed after 12 months of HF diet. [score:5]
Dhayat SA Mardin WA Kohler G Bahde R Vowinkel T Wolters H The microRNA-200 family-A potential diagnostic marker in hepatocellular carcinoma?J Surg Oncol. [score:1]
Feng X Wang Z Fillmore R Xi Y MiR-200, a new star miRNA in human cancerCancer Lett. [score:1]
In addition, miRNAs have been described to be modulated even in steatosis/NASH (i. e. miR-155, miR-370, miR-34a, miR-200a/b, miR-99a/b), fibrosis (i. e. miR-200a/b, miR-221/222, miR-34a, miR-16, miR-99b), cirrhosis (i. e. miR-34a, miR-21, miR-31, miR-181b), and HCC (i. e. miR-16, miR-33, miR-21, miR-31, miR-181a/b, miR-99a, miR-200a/b) [15]. [score:1]
[1 to 20 of 10 sentences]
30
[+] score: 53
As depicted in Fig 8, miR-1, miR-29a, miR-106b and miR-200a was selectively inhibited by H [2]0 [2] treated Pitx2 -overexpressing cells but up-regulated in H [2]0 [2] treated Pitx2 silenced cells at both time points (12h and 24h). [score:8]
HL-1 atrial cardiomyocytes transfected with miR-29 and miR-200 (Fig 8) significantly down-regulate Cacna1c, Hnc4 and Ryr2 expression, while Camk2a was significantly decreased with miR-200 but not miR-29 (Fig 8). [score:6]
We provide herein evidences that miR-29 and miR-200 over -expression also contributes to ion channel expression remo deling. [score:5]
Observe that miR-29 and miR-200 over -expression leads to significant decreased of Cacna1c, Hcn4, Ryr2 and Camk2a (except for miR-29a) expression. [score:5]
miR-29 over -expression in HL1 atrial cardiomyocyte deregulate Cacna1c, Hnc4 and Ryr2, influencing therefore both the calcium handling and pacemaker activity, whereas miR-200 regulated Cacna1c, Ryr2 and Camk2a, in addition to Scn5a as previously reported [64], impacting therefore also in calcium handling. [score:5]
qPCR of left atrial chambers demonstrated that miR-1, miR-26b, miR-29a, miR-30e, miR-106b, miR-133 and miR-200 are up-regulated in HTD rats as compared to controls (Fig 1), demonstrating a similar microRNA expression profile as in atrial-specific Pitx2 deficient mice [14, 16]. [score:5]
HL-1 cells (6 × 10 [5] cells per well) were transfected with plasmids containing expression constructs for Pitx2, Wnt8a (Addgene), Wnt11a (Addgene, Cambridge, MA, USA), premiR-29a, pre-miR-200 (Exiqon) or siRNA-Pitx2c, siRNA-Zfhx3, siRNA-Enpep, siRNA-Sod2 (Sigma, Aldrich, Munich, Germany) as previously described [14, 34]. [score:3]
Thus these data demonstrate that miR-29 and miR-200 impaired expression also contributes to develop pro-arrhythmogenic substrates. [score:3]
miR-29a and miR-200 expression in HL-1 atrial cardiomyocytes transfected cells. [score:3]
Whereas it is wi dely documented that redox signaling can compromise ion channel functioning and calcium homeostasis in cardiomyocytes [67], in our system we observed no influence of H [2]O [2] administration on the regulatory impact of Pitx2 in distinct ion channels such as Scn5a, Kcnj2 and Cacna1c as well as multiple Pitx2-regulated microRNAs such as miR-1, miR-26, miR-29 and miR-200, in which redox impairment impact is less documented [68]. [score:3]
We have previously demonstrated that Pitx2 modulates expression of miR-29 and miR-200, among other microRNAs [16] and furthermore we have demonstrated in this study that modulation of distinct ion channel is greatly influenced by H [2]0 [2] administration while microRNA signature is mostly dependent on Pitx2c but not H [2]0 [2] administration. [score:3]
Several lines of evidence have already reported the key regulatory role of miR-1 [60– 62], miR-26 [63], miR-106b [64], miR-133 [65– 66] and miR-200 [64] in arrhythmogenesis. [score:2]
Modulation of miR-29 and miR-200 alters cardiac action potential determinants. [score:1]
Importantly, miR-29 and miR-200 are not significantly impaired in SHR atrial chambers, suggesting that Wnt-microRNA might be a pivotal candidate establishing fundamental differences between HTD and HTN in atrial arrhythmogenesis susceptibility. [score:1]
[1 to 20 of 14 sentences]
31
[+] score: 47
Korpal M Lee ES Hu G Kang Y The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2J Biol Chem. [score:6]
In fact, the miR-200 microRNAs have been established as master regulators of the EMT program in both physiological and pathological conditions 19, 21, 27, 31. miR-200b was recently shown to suppress invasiveness and to modulate the cytoskeletal and adhesive machinery by targeting Kindlin-2 in oesophageal squamous cell carcinoma cells [32]. [score:6]
Expression levels of N-Cadherin, Fibronectin and Vimentin were significantly downregulated (p < 0.05) in the tumours derived from the miR-200b-overexressing MDA-MB-231 (miR200) cells compared to the tumours from the control (Scram) counterparts (Fig.   6F–H, respectively). [score:5]
Overexpression of miR-200b slowed the growth of primary tumours; at the 5-week time point when all the primary tumours were removed, the average volume of the tumours derived from the miR-200 -overexpressing MDA-MB-231 cells (miR200b) was more than 3-fold less (p < 0.01) than those derived from the control (Scram) cells (Fig.   6A). [score:5]
Gregory PA The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat Cell Biol. [score:4]
Park SM Gaur AB Lengyel E Peter ME The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2Genes Dev. [score:3]
Mutation of the seed sequence of miR-200b in the 3′-UTR of K2 (K2 3′UTR with scrambled miR-200 seed sequence) abrogated the effect of the exogenous miR-200b (Fig.   5H); the levels of luciferase activity did not show any significant difference when compared to the control cells or those treated with the non -targeting microRNA (Fig.   5H). [score:3]
These cells remained either untreated (Ctrl) or transfected with either a non -targeting micro -RNA (NT-miR) or the miR-200b mimics (miR200). [score:3]
qt-RT-PCR analyses of total RNA from the primary tumours showed that Kindlin-2 mRNA levels were significantly lower in the tumours derived from the miR-200b -expressing MDA-MB-231 (miR200) cells (Fig.   6E) compared to those derived from the control (Scram) counterparts. [score:2]
Sossey-Alaoui K Bialkowska K Plow EF The miR200 family of microRNAs regulates WAVE3 -dependent cancer cell invasionJ Biol Chem. [score:2]
We used the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA), as per the manufacturer’s instructions, to generate the K2 3′-UTR variants, where seed sequences that are recognized by miR200 microRNA were deleted. [score:2]
Burk U A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cellsEMBO Rep. [score:1]
Kindlin-2 was also reported to promote BC invasion through epigenetic silencing of members of the miR-200 gene family [33]. [score:1]
In contrast, transfection of the 231-wild-type K2-3′UTR cells with miR-200b mimics (miR200) resulted in ~60% reduction (p < 0.05) in luciferase activity (Fig.   5G). [score:1]
Spaderna S Brabletz T Opitz OG The miR-200 family: central player for gain and loss of the epithelial phenotypeGastroenterology. [score:1]
Korpal M Kang Y The emerging role of miR-200 family of microRNAs in epithelial-mesenchymal transition and cancer metastasisRNA Biol. [score:1]
The miR-200 family is no stranger to EMT. [score:1]
[1 to 20 of 17 sentences]
32
[+] score: 47
Representative miRNAs that were downregulated after treatment with 1 μM RA for 24 h. (E, F, and G) MiR-200a, miR-200b, and miR-200c relative expression levels after transfection with the expression vector PCDH-miR-200b or PCDH-miR-200c for 48 h. (H) qPCR revealed enhanced Oct4 and Nanog expression levels after transfection with the expression vectors PCDH-miR200a, PCDH-miR200b, or PCDH-miR200c for 48 h (without RA). [score:12]
We chose members of the miR-200 family, miR-200a, miR-200b, and miR-200c because these are abundantly expressed in mESCs and demonstrated that upregulation of miR-200b or miR-200c increased the expression of two key embryonic stemness genes Oct4 and Nanog, thereby promoting pluripotency [65]. [score:8]
In this mo del, RA treatment inhibited miR-200 family expression. [score:5]
A previous study detected that miR-200a could increase Oct4 expression slightly in ES-E14TG2a cells and had no effect on Nanog [66]. [score:3]
We found that Oct4 and Nanog were significantly increased after the overexpression of miR-200b/c and miR-200a had no effect on Oct4 and Nanog (Fig 4H). [score:3]
The pri-miRNA miR-200a, miR-200b and miR-200c were amplified from the J1 genome and were inserted into the multiple cloning site (MCS) of the expression vector pCDH-CMV-MCS-EF1-copGFP (System Biosciences, CA, USA). [score:3]
We constructed expression vectors for miR-200a,miR-200b, and miR-200c (Fig 4E, 4F and 4G). [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
The miR-200 family is considered essential for tumor development by regulating epithelial transition [63]. [score:2]
The microRNA-200 family regulates epithelial to mesenchymal transition. [score:2]
Thus, we did not conduct further research on miR-200a. [score:1]
Let-7 and miR-200 microRNAs. [score:1]
In our research, both Oct4 and Nanog were not significantly effected by miR-200a in J1 cells (Fig 4H), which may be attributed to different cell types. [score:1]
[1 to 20 of 13 sentences]
33
[+] score: 46
While some downregulated miRNAs were observed, we focused on the significantly upregulated miR-200 family members (miR-141, -200a, -200b, -200c, and -429) and the miR-183 family members (miR-96, -182, and -183), which had higher expression levels in 10-month-old Tg2576 mice (fold-change > 2.0, unpaired Student’s t-test; p < 0.05; Fig 1A). [score:9]
The above-mentioned network consisted of differentially expressed genes in 10-month-old Tg2576 mouse cortex presenting highly expression of miR-200 family (Fig 1C). [score:5]
The marked upregulation of members of the miR-200 family was confined to the phase of increasing Aβ deposition, and disappeared in the plateau phase (17-month-old mice). [score:4]
In this study, we showed that miR-200 family members were upregulated in the cortices of 10-month-old Tg2576 mice, which might bring about compensative effects in relation to Aβ -induced toxicity. [score:4]
The miRNAs that were upregulated were members of the miR-200 and miR-183 families. [score:4]
Growing evidence indicates that the miR-200 family is involved in cancer cell migration via the targeting of ZEB1 and ZEB2 [45– 48]. [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
Intriguingly, miR-8 in flies (homologous to miR-200 in mammals) has been revealed to target FOG2, which binds to a subunit of PI3K and activates insulin signaling [51]. [score:3]
The members of the miR-200 family and related differentially expressed mRNA network are implicated in insulin signaling in the cortex of 10-month-old Tg2576 mice. [score:3]
Although neurological reports for the miRNA-200 family are few, one neurological study has shown that members of the miR-200 family contribute to olfactory neurogenesis [49], and a microarray study showed that miR-200c is differentially expressed in AD brains [50]. [score:3]
The miR-200 family was upregulated in the cortices of 10-month-old Tg2576 mice as compared with age-matched WT mice in the microarray analysis. [score:3]
In this study, we investigated the function of the miR-200 family, the upregulation of which may represent an innate defense response rather than being the result of Aβ -induced toxicity. [score:2]
[1 to 20 of 12 sentences]
34
[+] score: 42
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-32, mmu-mir-1a-1, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-144, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-200b, mmu-mir-206, hsa-mir-208a, mmu-mir-122, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-214, hsa-mir-200b, mmu-mir-299a, mmu-mir-302a, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-144, hsa-mir-134, hsa-mir-206, mmu-mir-208a, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-328, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-214, mmu-mir-135a-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, hsa-mir-361, mmu-mir-361, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-377, mmu-mir-377, hsa-mir-328, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-20b, hsa-mir-429, mmu-mir-429, hsa-mir-483, hsa-mir-486-1, hsa-mir-181d, mmu-mir-483, mmu-mir-486a, mmu-mir-367, mmu-mir-20b, hsa-mir-568, hsa-mir-656, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-744, mmu-mir-181d, mmu-mir-568, hsa-mir-892a, hsa-mir-892b, mmu-mir-208b, hsa-mir-744, hsa-mir-208b, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-1307, eca-mir-208a, eca-mir-208b, eca-mir-200a, eca-mir-200b, eca-mir-302a, eca-mir-302b, eca-mir-302c, eca-mir-302d, eca-mir-367, eca-mir-429, eca-mir-328, eca-mir-214, eca-mir-200c, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-mir-133a, eca-mir-144, eca-mir-25, eca-mir-135a, eca-mir-568, eca-mir-133b, eca-mir-206-2, eca-mir-1-2, eca-let-7f, eca-mir-24-2, eca-mir-134, eca-mir-299, eca-mir-377, eca-mir-656, eca-mir-181a, eca-mir-181b, eca-mir-32, eca-mir-486, eca-mir-181a-2, eca-mir-20b, eca-mir-361, mmu-mir-486b, mmu-mir-299b, hsa-mir-892c, hsa-mir-486-2, eca-mir-9021, eca-mir-1307, eca-mir-744, eca-mir-483, eca-mir-1379, eca-mir-7177b, eca-mir-8908j
Normalized expression levels of the most up- (a) and down-regulated (b) miRNA in Pony compared to Warmblood serum as well as eca-miR-200a (c) that is downregulated by HMGA2 We next selected a total of 177 target-genes of eca-miR-122 using TargetScan [28] and performed gene set enrichment analysis with GeneCodis [29] to assess their biological role. [score:12]
Normalized expression levels of the most up- (a) and down-regulated (b) miRNA in Pony compared to Warmblood serum as well as eca-miR-200a (c) that is downregulated by HMGA2 We next selected a total of 177 target-genes of eca-miR-122 using TargetScan [28] and performed gene set enrichment analysis with GeneCodis [29] to assess their biological role. [score:12]
For instance, we showed an increased expression of circulating serum miR-122 and miR-200 in ponies together with the predicted miRNA target genes that are required in the control of energy metabolism. [score:5]
Therefore, we can speculate that impaired HMGA2 has decreased capability to inhibit the miR-200 expression in ponies. [score:5]
A total of 50 miRNAs in serum proved to be potential biomarkers to differentiate specific breed types, of which miR-122, miR-200, miR-483 were over-expressed and miR-328 was under-expressed in ponies compared to Warmbloods. [score:4]
Both miR-200a and miR-200b were significantly upregulated in pony serum in our study with log2FC >3.5 (Fig.   7c, Additional file 3: Table S2). [score:4]
[1 to 20 of 6 sentences]
35
[+] score: 41
As illustrated in Figure 2, TGF-β1 up-regulates miR-21, miR192, miR-377, miR-382, and miR-491-5p, but down-regulates miR-29 and miR-200 families during renal fibrosis (Kantharidis et al., 2011; Kriegel et al., 2012; Lan and Chung, 2012; Chung et al., 2013a, b). [score:7]
The miR-200 family regulates TGF-beta1 -induced renal tubular epithelial to mesenchymal transition through Smad pathway by targeting ZEB1 and ZEB2 expression. [score:6]
The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2. [score:6]
The miR-29 and miR-200 are TGF-β1 -dependent anti-fibrotic miRNAs that are extensively suppressed in the diseased kidneys (Qin et al., 2011). [score:5]
Moreover, recent studies also revealed that overexpression of miR-29, miR-200 or inhibition of miR-21 and miR-192 can effectively decelerate the progression of renal fibrosis (Oba et al., 2010; Chung et al., 2010a; Qin et al., 2011; Zhong et al., 2011, 2013; Chen et al., 2014) (Figure 3). [score:5]
Downregulation of miR-200a and miR-141 are detected in the fibrotic kidneys of obstructive and diabetic nephropathies (Wang et al., 2011; Xiong et al., 2012). [score:4]
miR-200a Prevents renal fibrogenesis through repression of TGF-beta2 expression. [score:3]
As miR-200 has a major role in maintaining the epithelial differentiation, delivery of miR-200b significantly reduces renal fibrotic response by suppressing the transcriptional repressors of E-cadherin ZEB1 and ZEB2 (Korpal et al., 2008; Oba et al., 2010). [score:3]
The miR-200 family contains miR-200a, miR-200b, miR-200c, miR-429, and miR-141 (Howe et al., 2012). [score:1]
The miR-200 and miR-221/222 microRNA families: opposing effects on epithelial identity. [score:1]
[1 to 20 of 10 sentences]
36
[+] score: 35
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-205, mmu-mir-200c, mmu-mir-429
We then assessed whether overexpression of Etv5 could increase expression levels of any miRNA-200 family members. [score:5]
Expectedly, all the miRNA-200 family members were found to be expressed with higher expression levels in OSKME combination when compared that with OSKM during the first seven days of reprogramming (Fig.   3b). [score:4]
Gregory PA The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat. [score:4]
Interestingly, there are five sites in 3′ UTR of Zeb1 potentially targeted by cluster A of miRNA-200 family members (miR-200b,-200c, and -429) and three sites by cluster B of miRNA-200 family members (miR-200a and -141) (Fig.   3a). [score:3]
However, Etv5 KD in OSKM combination only led to the decreased expression levels of miR-200a, miR-200b, and miR-429 (Fig.   3b). [score:3]
In parallel, Etv5 knockdown can promote specification of epiblast and its derivative mesoendoderm and ectoderm In this study, we demonstrated that Etv5 could promote MET at the early stage of reprogramming through Tet2-miR200- Zeb1 regulation axis, which further increased the final efficiency of iPSCs induction (Fig.   3e). [score:3]
Three sites (green) are supposed to be targeted by cluster B of miR-200 family (miR-200a, and -141). [score:3]
Five sites (orange) are supposed to be targeted by cluster A of miR-200 family (miR-200b,-200c and -429). [score:3]
Wang G Critical regulation of miR-200/ZEB2 pathway in Oct4/Sox2 -induced mesenchymal-to-epithelial transition and induced pluripotent stem cell generationProc. [score:2]
b RT-qPCR analysis of miR-200 family members during the early stage of reprogramming (Day 0–7). [score:1]
Data are shown as mean ± SD (n = 3), OSKM + EV was set as the control, * P < 0.05, ** P < 0.01, *** P < 0.001. c The diagram of genomic structure of miR-200 family on chromosome 4 and chromosome 6. The red regions represent miRNA clusters and green regions represent conserved noncoding sequence (CNS) across mammals. [score:1]
a Predicted binding sites of miR-200 family located in 3′ UTR of Zeb1. [score:1]
This speculation is consistent with the observation that Oct4/ Sox2 can induce MET by miR-200- Zeb2 pathway [14]. [score:1]
We first analyzed the complementation of 3′ UTR of Zeb1 mRNA and miRNA-200 family members. [score:1]
[1 to 20 of 14 sentences]
37
[+] score: 34
Amongst these, oxidative stress -induced upregulation of the miR-200 family caused senescence [103]. [score:4]
We observed the upregulation of eight miRNAs that make up a related miR-200 family (miR-200a, 200b, 200c, miR-141, miR-429) and a miR-183/96/182 cluster. [score:4]
It was shown the entire miR-200/182 cluster is upregulated in acute herpes simplex virus 1 encephalitis [80]. [score:4]
Overall, much remains to be discovered about the miR-200 family’s roles in various diseases and conditions, including cancer and cancer treatment -associated CNS toxicity. [score:3]
We noted a commonality between all three groups (PR+BC, PR+BC/CRIZ, and PR+BC/TOP): miR 200 family (miR-200a, miR-200b, miR-200c, miR-141, and miR-429), miR-183/96/182 cluster, miR-30d-5p, and miR-191-5p were up-regulated, as compared to intact controls. [score:3]
Both tumor growth and chemotherapy treatment led to the upregulation of the miR-200 family, as compared to intact animals. [score:3]
A recent study analyzed and compared the miRNA profiles of gastric adenocarcinomas and brain metastatic carcinomas and identified the upregulation of, among others, the miR-200 family members miR-141-3p and miR-200b-3p in the brain metastatic samples [84]. [score:3]
Therefore, deregulation of the miR-200 family could be involved in brain metastasis via the Zeb/miR-200 family feedback loop. [score:2]
The miR-200 family was associated with brain metastases [84], and miR-30d-5p was implicated in medulloblastoma development [102]. [score:2]
Chemo and tumor brain -induced miRNA changes involved several miRNA families, such as the miR-200 family and miR-183/96/182 cluster, which were deregulated in PR+BC tumor-bearing and chemotherapy -treated animals. [score:2]
The miR-200 family is important for the proper balance between neuronal proliferation and differentiation during development [81]. [score:2]
Green arrow - miR-200 family; blue arrow - miR-183/96/182 cluster; red arrow - other common miRNAs. [score:1]
These miRNAs are often co-transcribed and referred to as the miR-200/182 cluster. [score:1]
[1 to 20 of 13 sentences]
38
[+] score: 33
The top 15 differentially expressed microRNAs based on fold change (p<0.05) are presented in Table 1. The most differentially expressed miRNA was mmu-miR-429, a member of the miR-200 family, and 4 of the 5 miR-200f members (miR-141, miR-200b, miR-200c and miR-429) were in the top 15 differentially expressed miRNAs (shaded in Table 1). [score:7]
5-aza-2′-deoxycytidine treatment significantly increased the expression of both miR-200c (4.6-fold) and miR-200b (4.7-fold) suggesting that the expression of both miR-200 clusters are regulated, at least in part, by methylation. [score:6]
Quantitative RT-PCR was used to validate the differential expression of the miR-200 family and as shown in Table 2, all 5 members of the miR-200f (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) were expressed at significantly higher levels in the PMT samples compared to the RST samples. [score:4]
Expression of the miR-200 clusters appears to be regulated by modifications to the promoter regions of each cluster. [score:4]
Inhibition of angiogenesis by miR-200c is consistent with a study by Pecot et al [92] that showed miR-200 family members could regulate tumor angiogenesis in basal-like breast cancer. [score:4]
This family of microRNAs is expressed as two clusters on distinct chromosomes with the miR-200c/miR-141 cluster located on chromosome 12 in humans and chromosome 6 in mice and the miR-200b/miR-200a/miR-429 cluster located on chromosome 1 in humans and chromosome 4 in mice [15]. [score:3]
Expression (mean ± SEM) of miR-200a, miR-200b, miR-200c, miR-141 and miR-429 in RJ345 cells, RJ423 cells containing the empty vector control (RJ423EV) or RJ423 cells containing miR-200c (RJ423200c) as determined by Taqman RT-PCR. [score:3]
One family of microRNAs that has garnered considerable attention in cancer biology is the miRNA-200 family (miR-200f) which consists of 5 members, miR-141, miR-200a, miR-200b, miR-200c and miR-429. [score:1]
miR-200a and miR-141 share the same seed sequence (AACACUG) that is different from the seed sequence of miR-200b, miR-200c and miR-429 by one nucleotide [16]. [score:1]
[1 to 20 of 9 sentences]
39
[+] score: 32
Our small RNA library sequencing data (Figure 1A) show that the miR-200 family is highly expressed in cultured normal human mammary epithelial cells (HMEC) derived from three different individuals, whereas the isogenic human mammary fibroblast cells (FB) lack miR-200 family expression (Figure 1A). [score:5]
Regulation of the miR-200 family expression in normal and cancer cells is not fully understood. [score:4]
It is apparent from the small RNA library sequencing data (Figure 1A) that the most highly expressed members of the miR-200 family in HMEC are miR-200c and miR-141. [score:3]
The microRNA-200 family participates in the maintenance of an epithelial phenotype and loss of its expression can result in epithelial to mesenchymal transition (EMT). [score:3]
Furthermore, the loss of expression of miR-200 family members is linked to an aggressive cancer phenotype. [score:3]
The CpG island is unmethylated in human miR-200/miR-141 expressing epithelial cells and in miR-200c/miR-141 positive tumor cells. [score:3]
A. miR-200 family expression according to massive parallel sequencing of small RNA libraries from a set of three isogenic pairs of human mammary epithelial cells (HMEC) and fibroblasts (FB). [score:3]
miR-200 family expression according to massive parallel sequencing of small RNA libraries from a set of three isogenic pairs of human mammary epithelial cells (HMEC) and fibroblasts (FB). [score:3]
miR-200c and miR-141 are members of the miR-200 family and are important regulators of the epithelial to mesenchymal transition (EMT) [5], [9], [10], [11]. [score:2]
HMEC samples are shown in green, isogenic FB samples are shown in red, and two miR-200 -negative breast cancer cell lines are in blue. [score:1]
One cluster resides on human chromosome 1 and encodes miR-200b, miR-200a, and miR-429, while the other cluster is located on human chromosome 12, and encodes miR-200c and miR-141. [score:1]
The miR-200 family is comprised of five miRNAs that are encoded within two clusters. [score:1]
[1 to 20 of 12 sentences]
40
[+] score: 30
miR-375 was expressed at an average of 4 × 10 [4] copies/ng of RNA (Fig. 1 F), whereas miR-200a and miR-200c were expressed about 10-fold higher (Fig. 1, G and H). [score:5]
Uhlmann S., Zhang J. D., Schwäger A., Mannsperger H., Riazalhosseini Y., Burmester S., Ward A., Korf U., Wiemann S., Sahin O. (2010) miR-200bc/429 cluster targets PLCγ1 and differentially regulates proliferation and EGF -driven invasion than miR-200a/141 in breast cancer. [score:4]
To further examine expression patterns throughout lactation, miR-375 and two representative members of the miR-200 family, miR-200a and miR-200c, were absolutely quantified in milk from pups ranging in age from day 1–14 of lactation. [score:3]
Several studies analyzing miRNAs in milk emphasize enrichments in “immune-related” miRNAs such as miR-146b, miR-27b, and the miR-200 family (14, 17, 18, 22), which were also among the more highly expressed miRNAs in murine milk. [score:3]
E–H, results are represented as mean ± S. E. miR-375, designated as the main focus of this study because of its identity as a single-locus miRNA, and miR-200, selected as a secondary example of a milk miRNA, revealed intermediate expression in milk derived from the stomachs of WT mice (Fig. 1 E). [score:3]
E–H, results are represented as mean ± S. E. miR-375, designated as the main focus of this study because of its identity as a single-locus miRNA, and miR-200, selected as a secondary example of a milk miRNA, revealed intermediate expression in milk derived from the stomachs of WT mice (Fig. 1 E). [score:3]
Belgardt B. F., Ahmed K., Spranger M., Latreille M., Denzler R., Kondratiuk N., von Meyenn F., Villena F. N., Herrmanns K., Bosco D., Kerr-Conte J., Pattou F., Rulicke T., Stoffel M. (2015) The microRNA-200 family regulates pancreatic β cell survival in type 2 diabetes. [score:2]
For absolute quantification of miRNAs, synthetic miRNAs comprising the mature miRNA sequence (Sigma) were serially diluted in water and used as input for RT-qPCR reactions, generating standard curves against which to compare experimental cycle threshold (Ct) values (mmu-miR-375-3p, 5′-UUUGUUCGUUCGGCUCGCGUGA-3′; mmu-miR-200a-3p, 5′-UAACACUGUCUGGUAACGAUGU-3′; mmu-miR-200c-3p, 5′-UAAUACUGCCGGGUAAUGAUGGA-3′; mmu-let-7f-5p, 5′-UGAGGUAGUAGAUUGUAUAGUU-3′; mmu-miR-194-5p, 5′-UGUAACAGCAACUCCAUGUGGA-3′; mmu-miR-122-5p, 5′-UGGAGUGUGACAAUGGUGUUUG-3′; mmu-miR-33-5p, 5′-GUGCAUUGUAGUUGCAUUGCA-3′; and mmu-miR-16-5p, 5′-UAGCAGCACGUAAAUAUUGGCG-3′). [score:1]
miR-200c, a prototypical epithelial miRNA, is a member of the miR-200 family composed of two chromosomal clusters: miR-200a/200b/429 and miR-200c/141 (28). [score:1]
Because of infertility of the global miR-200 KO mouse (35), we focused on the miR-141/200c KO mo del. [score:1]
miR-200c is a member of a miRNA family composed of five members that are divided into two genomic clusters, miR-141/200c and miR-200a/b/429. [score:1]
Although high sequence similarity between miR-200 family members (28) led to less reliable quantification of miR-200c, analysis of this second miRNA nevertheless provided additional insights into the behavior of milk miRNAs in general. [score:1]
F–H, copy number per nanogram of RNA of miR-375 (F), miR-200a (G), and miR-200c (H) in WT milk throughout lactation (n = 4–6). [score:1]
Determination of a qPCR detection limit was not instructive in this case because of cross-detection of other miR-200 family members, although the lack of change between 200c KO pups receiving WT milk versus 200c KO milk suggests a negligible uptake. [score:1]
[1 to 20 of 14 sentences]
41
[+] score: 30
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-200c
We previously showed that GRHL2 upregulates the expression of miR-200 family genes and other epithelial-specific genes, e. g., p63, K14, E-Cad, and β-catenin, while it suppressed mesenchymal regulators, e. g., fibronectin (FN), N-Cad, ZEB1, and ZEB2 [7]. [score:9]
Generally, GRHL2 regulates epithelial phenotype through direct transcriptional control of its target genes, e. g., E-Cad, p63, hTERT, miR-200 family genes, and EDC genes 4, 5, 7. The current study revealed an alternative pathway, in which GRHL2 determines epithelial phenotype through activation of the MAP kinase signaling, which then suppresses Smad -dependent TGF-β signaling molecules. [score:7]
This pathway is distinct from the transcriptional regulation of the target genes, e. g., E-cadherin, hTERT, p63, and miR-200 family genes, by direct GRHL2 binding at the promoter regions Mechanistic scheme is drawn to depict the functional interaction between GRHL2 and TGF-β signaling through Erk and JNK MAP kinase signaling. [score:5]
This pathway is distinct from the transcriptional regulation of the target genes, e. g., E-cadherin, hTERT, p63, and miR-200 family genes, by direct GRHL2 binding at the promoter regions SCC4, SCC9, FaDu, and SCC15 cell lines were purchased from the ATCC (Manassas, VA) and were cultured in DMEM/Ham’s F-12 (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS) and 0.4 µg/ml hydrocortisone. [score:5]
In addition, GRHL2 is a critical determinant of the epithelial phenotype through transcriptional regulation of the relevant effector molecules, e. g., miR-200 family genes and ZEB1, which also determine cellular plasticity 7– 9. GRHL2 has been shown to suppress epithelial–mesenchyme transition (EMT) induced by TGF-β in human mammary epithelial cells [9], while the mechanisms underlying the functional interaction between GRHL2 and TGF-β are not known. [score:4]
[1 to 20 of 5 sentences]
42
[+] score: 29
miR-200 members regulate global gene expression through RNA silencing and direct or indirect post-transcriptional targeting, thereby modulating many biological processes, including cell cycle control, proliferation, apoptosis, and invasion [1, 2, 4– 8, 23, 24]. [score:8]
The microRNA-200 (miR-200) family consists of five members in two clusters, miR-200c/141 and miR-200b/a/429, which likely target different, but sometimes overlapping genes, thereby regulating many biological processes as oncomiRs or tumor suppressors [1, 2]. [score:6]
Despite advances in our understanding of BC-related miR-200 members, their precise roles in breast cancer cell (BCC) metastasis are largely unknown, in part because each miR-200 has several putative targets with disparate functions. [score:3]
The underlying mechanisms by which miR-200 overexpression promotes metastasis require further study, and genes that serve as intermediaries in miR-200 -associated metastasis are yet be identified. [score:3]
Individual miR-200 family member target genes appear to be cancer type- and context -dependent [3]. [score:3]
In many cancers, miR-200 member expression status serves as a surrogate marker for metastasis, response to drug treatments, and patient outcomes [4– 9]. [score:3]
Korpal M, et al. reported high miR-200 family levels in lung-pleural metastases with reduced BC patient survival and poor prognosis [7]. [score:1]
Del Vecchio G et al. reported that miR-200a could increases the c-Jun amount through a microRNA -mediated stabilization of its mRNA [31]. [score:1]
This is consistent with our xenograft results, and supports the potential role of the miR-200 family in promoting metastasis. [score:1]
[1 to 20 of 9 sentences]
43
[+] score: 28
Other miRNAs from this paper: mmu-mir-17, mmu-mir-378a, mmu-mir-378b, mmu-mir-378c, mmu-mir-378d
In silico analysis of miRNAs overexpressed in neonates revealed that mir-200a might target these sialyltransferases. [score:5]
Using target predicting algorithms, we found that miR-200a may target St3gal3 and St3gal4 (Table 1) and thus it was a valuable candidate to explain the lower sialylation of antithrombin in neonate mice. [score:5]
These experiments suggest that miR-200a may be in part implicated in the regulation of St3gal3 and, in a lesser degree, in the regulation of St3gal4, as predicted by in silico studies (Table 1). [score:3]
MiRNA assay kits for miR-200a (Applied Biosystems, Madrid, Spain) were used to validate expression levels in mouse hepatocytes during post-natal development (neonates day+1, n=14; adults day+50, n=5). [score:3]
Interestingly, the analysis of the subtractive miRNA array revealed that miR-200a is over-expressed in neonates in comparison with adults in both chips. [score:3]
n fact, in silico searching identified miR-200a as an excellent regulator of St3gal3 and St3gal4. [score:2]
The next step to demonstrate the potential regulation of St3gal3 and St3gal4 by miR-200a was to perform transfection studies of primary hepatocytes from adult mouse with miR-200a. [score:2]
Regulation of St3gal3 and St3gal4 by miR-200a. [score:2]
Cells were pre-cultured for 24 h in complete medium without antibiotics and transfected at 40-60% confluence with 100 nmol/L of precursor molecules for miR-17-3p, miR-200a, and negative scrambled control (Applied Biosystems, Madrid, Spain) by using siPORT™ NeoFX™ transfection agent (Applied Biosystems, Madrid, Spain). [score:1]
The final proof indicating the control of these sialyltransferases by miR-200a was obtained by transfecting this miRNA in adult primary hepatocytes. [score:1]
Figure 4 Levels of selected sialyltransferases mRNA and of miR-200a in neonate and adult liver. [score:1]
[1 to 20 of 11 sentences]
44
[+] score: 28
According to prior work, the miR-200 family is induced by NO donors and contributes to Zeb2 downregulation during mESC mesendodermal differentiation [28]. [score:4]
Western blot analysis showed that the inhibition of miR-200b, the most NO-sensitive miR-200 family member, rescued Zeb1 levels both in DM and in NO conditions (Supplementary Fig.   3d). [score:3]
Of note, miR-200c and miR-141, belonging to the miR-200 family cluster 2 and mapping to mouse chromosome 6 (Supplementary Fig.   1c, left lower cartoon), were not significantly upregulated by NO compared to controls (Supplementary Fig.   1c, middle lower graph). [score:3]
Kim Y Lineage-specific expression of miR-200 family in human embryonic stem cells during in vitro differentiationInt. [score:3]
Furthermore, p53 positively regulates the miR-200 family transcription 34, 35 and NO is among the signaling molecules regulating p53 [35]. [score:3]
Brabletz S Brabletz T The ZEB/miR-200 feedback loop--a motor of cellular plasticity in development and cancer?EMBO Rep. [score:2]
Moreover, ChIP experiments revealed a feedback loop regulation between Zeb1 and miR-200 family in mESC (Supplementary Fig.   3e). [score:2]
To establish whether the NO -mediated Zeb1 down-modulation was regulated by induction of miR-200 family, we analyzed Zeb1 protein levels in mESC transfected with scramble or anti-miR-200b oligonucleotides. [score:2]
In this condition, chromatin immunoprecipitation (ChIP) showed p53 bound to the miR-200 cluster 1 promoter region (Supplementary Fig.   1f). [score:1]
To assess NO responsiveness at the molecular level, we evaluated the expression of the miR-200 family members. [score:1]
This evidence suggests the presence of a molecular circuitry involving mir-200, Zeb factors, Hdacs and pluripotency genes contributing to keep mESC undifferentiated [30]. [score:1]
Specifically, we observed an enrichment of Zeb1 binding on miR-200 family cluster 1 promoter in mESC kept in GS, suggesting active repression of the miR-200 family in self-renewal condition. [score:1]
Conversely, in cells released from GS in the presence of NO, miR-200 family member induction was robust and significant for all cluster components (Supplementary Fig.   1c, right graphs). [score:1]
In SM, miR-200b, miR-200a, and miR-429 were induced after LIF withdrawal (DM), an effect enhanced in NO (Supplementary Fig.   1c, middle upper graph) [28]. [score:1]
[1 to 20 of 14 sentences]
45
[+] score: 27
For example, miR200 targets snai2, zeb1 and zeb2 mRNA [57– 59] whereas miR203 targets snai1 and zeb2 mRNA [59], and miR34 targets snai1 mRNA [60]. [score:7]
The miR200 expression can also be induced by p63 and p73 proteins, while miR34 is only induced by p73 but is down-regulated by p63 [65– 67]. [score:6]
The different isoforms of AKT seem to have opposing roles in the regulation of microRNAs: AKT1 inhibits miR34 and activates miR200 while AKT2 inhibits miR200 and activates miR34 [81]. [score:6]
To make our mo delling more insightful, we reduced the complexity by lumping variables into modules corresponding to signalling pathways: the TGF-β pathway (TGFb_pthw consisting of TGFbeta, SMAD), Notch pathway (Notch_pthw, includes activated Notch intracellular domain (NICD), the WNT pathway (WNT_pthw consisting of DKK1, CTNNB1), the p53 pathway (p53, consisting of p53), the p63-p73 proteins (p63_73 consisting of p63 and p73), the miRNA (miR34, miR200, miR203), the EMT regulators (EMT_reg including Twist1, Zeb1, Zeb2, Snai1, Snai2, Cdh2, Vim), E-cadherin (Ecadh with Cdh1), growth factors (GF), the ERK pathway (ERK_pthw: ERK), p21 is included in the CellCycleArrest phenotype, AKT1 module and AKT2 module. [score:2]
miR200 ZEB2 (SNAI1 | (SNAI2 & TWIST1) | NICD) & ! [score:1]
Cell migration depends on pathways involving AKT, ERK, Vimentin, miR200 and p63 but also on the acquisition of EMT and invasive abilities such as producing MMPs to dissolve the laminae propria enabling migration to distant sites. [score:1]
AKT1 Apoptosis (p53 | p63 | p73 | miR200 | miR34) & ! [score:1]
AKT1 GF !CDH1 & (GF | CDH2) miR200 (p63 | p53 | p73) & ! [score:1]
miR200 & ! [score:1]
miR203 CellCycleArrest (miR203 | miR200 | miR34 | ZEB2 | p21) & ! [score:1]
[1 to 20 of 10 sentences]
46
[+] score: 27
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-203, mmu-mir-205, mmu-mir-200c
Upregulation of CDH1 in OSC-19 RICs may be directly caused by KLF4 [36], since they did not show downregulation of SNAI, ZEB families or up-regulation of miR-200 family. [score:11]
It has been reported that the EMT-inducing transcription factors, which suppress the CDH1 expression, are negatively regulated by the miRNAs (miR-200 family, miR-203, and miR-205, etc. ) [score:6]
The HOC313 RICs showed increased levels of miR-200 family members (miR-200a, -200b, -200c, -141, and -429), miR-203, and miR-205 (Fig 3G), which could down-regulate the SNAI and ZEB families [15– 17]. [score:4]
In accordance with this observation, significant up-regulation of miR-200 family, (miR-200a, -200b, -200c, -141, and -429), miR-203, and miR205 was detected in the RICs from HOC313 cells. [score:4]
The OSC-19 RICs showed increased levels of miR-203 and miR-205, although the miR-200 family members were not altered (Fig 4I). [score:1]
This result is consistent with the previous study showing that OCT3/4 and SOX2 induce the miR-200 family during iPS generation [35]. [score:1]
[1 to 20 of 6 sentences]
47
[+] score: 27
The expression level of these 4 miRNAs was significantly different between F0 and F3 and spearman correlation analysis also showed that the expressions of these miRNAs were strongly and positively correlated with fibrosis grade (n = 105, r = 0.498(miR-199a), 0.607(miR-199a*), 0.639(miR-200a), 0.618(miR-200b), p-values<0.0001) (Figure 3). [score:5]
In LX-2 cells treated with TGFβ, the expression levels of miR-199a and miR-199a* were significantly higher than in untreated cells; the expression levels of miR-200a and miR-200b were significantly lower than in untreated cells. [score:5]
Recent reports showed that the miR-200 family regulated EMT by targeting EMT accelerator ZEB1 and SIP1 [24]. [score:4]
From our observations, overexpression of miR-200a and miR-200b can be connected to the progression of liver fibrosis. [score:3]
We identified that 4 highly expressed miRNAs (miR-199a, miR-199a*, miR-200a, and miR-200b) that were significantly associated with the progression of liver fibrosis both human and mouse. [score:3]
Furthermore, overexpression of miR-199a, miR-199a*, miR-200a and miR-200b in LX-2 cells resulted significant induction of above fibrosis-related genes compared with control miRNA (Figure 4B). [score:2]
The 4 human miRNAs (miR-199a, miR-199a*, miR-200a, and miR-200b) with the largest difference in fold change between the F1 and F3 groups were chosen to validate the microarray results using stem-loop based real-time qPCR. [score:1]
The miR-199 and miR-200 families have are circumstantially related to liver fibrosis. [score:1]
The sequences of mmu-miR-199a-5p, mmu-miR-199b, mmu-miR-199b, mmu-miR-200a, and mmu-miR-200b in mouse miRNA corresponded to the sequences of hsa-miR-199a, hsa-miR-199a*, hsa-miR-199a, hsa-miR-200a, and hsa-miR-200b in human miRNA, respectively (Table S3). [score:1]
validation of the 4 miRNAs (miR-199a, miR-199a*, miR-200a, and miR-200b). [score:1]
0016081.g003 Figure 3 validation of the 4 miRNAs (miR-199a, miR-199a*, miR-200a, and miR-200b). [score:1]
[1 to 20 of 11 sentences]
48
[+] score: 26
The miR-200a-3p was involved in the regulation of neuronal differentiation and proliferation and miR-542-3p up-regulated in blood after ischemic stroke, intracerebral hemorrhage, and kainate seizures [78, 79]. [score:5]
The miR-200a-3p and miR-1306-3p had the most significantly changed fold (fold-changes of 11.62 and 11.51, respectively), but the miR-1306-3p has a low expression in A53T and WT mice (TPM = 2.10 and 0.18, respectively). [score:3]
More importantly the miR-200a-3p and -144-5p were showed the different expression in PD mice for the first time. [score:3]
The expression of miR-144-5p, miR-200a-3p and miR-542-5p showed an increased tendency accompanied with high H&Y scales of PD patients (Figure 4D-4F). [score:3]
The relative expression of miR-200a-3p C., miR-144-5p D. and miR-542-3p E. in CSF from PD and health controls by qRT-PCR. [score:3]
Correspondingly, the gender, age and smoking did not significantly contribute to the expression difference of miR-200a-3p (p = 0.69, 0.34 and 0.03), miR-144-5p (p = 0.47, 0.19 and 0.83) and miR-542-3p (p = 0.56, 0.65 and 0.65, Supplementary Figure 4). [score:3]
The miR-200a-3p D., miR-144-5p E. and miR-542-3p F. were increased in CSF form PD and changed with H&Y scale. [score:1]
Among them, we confirmed that miR-200a-3p, -144-5p and -542-3p had significantly higher concentration in the CSF from PD patients. [score:1]
At the cut-off values of 0.35 for miR-144-5p, 0.05 for miR-200a-3p, and 0.40 for miR-542-3p, the sensitivity and specificity for these markers were 65.91% and 75.56%, 73.17% and 75.61%, 84.09% and 91.11%, respectively (Figure 4A-4C). [score:1]
The ROC results and ordinal regression analysis further suggested the miR-200a-3p, miR-144-5p and miR-542-3p may be potential biomarkers for PD prediction. [score:1]
As a result, the candidate miRNAs were significant increased following the PD severity with the coefficient: 12.51 (95% CI: 7.51-17.51) in miR-200a-3p, 1.33 (95% CI: 0.74-1.92) in miR-144-5p, 4.64 (95% CI: 3.05-6.52) in miR-542-3p respectively (Table 3). [score:1]
The ROC analyses and ordinal logistic regression mo del further supported the miR-200a-3p, -144-5p and -542-3p might be served as biomarkers for PD diagnosis at the early stage. [score:1]
[1 to 20 of 12 sentences]
49
[+] score: 26
We found that five miRNAs were significantly upregulated (miR-429, miR-200a, miR-200b, miR-200c and miR-10b) and one of them was significantly downregulated (miR-29b) in aggressive clone compared to non-aggressive one. [score:6]
Five of these miRNAs were upregulated (miR-429, miR-200a, miR-200b, miR-200c and miR-10b) and one of them was downregulated (miR29-b) in the aggressive S2B11 clone compared to S2D10 (Figure 6A). [score:6]
This upregulation may be a key event in the aggressive clones of heterogeneous DCIS lesions, and the specific roles of the miR-200 family in our aggressive clones and their contribution to disease progression will be the focus in our future studies. [score:6]
We have observed that four members of miR-200 family were upregulated in our aggressive clones. [score:4]
MiR-200 family regulates epithelial-to-mesenchymal transition (EMT) and mesenchymal-to-epithelial transition (MET) through the inhibition of ZEB1 and ZEB2 [26]. [score:3]
MiR-200 family is an example to such miRNAs. [score:1]
[1 to 20 of 6 sentences]
50
[+] score: 26
miR-204 and miR-488 (A) were down-regulated in Pkd1 [-/- ]kidneys whereas miR10a, miR-30a, miR-96, miR-126-5p, miR-182, miR-200a and miR-429 (B) were up-regulated in Pkd1 [-/- ]kidneys. [score:7]
For example, down-regulation of miR-200a at E17.5 was correlated with up-regulation of Pitx2 in the Pkd1 [-/- ]mutants (Additional file 21). [score:7]
Expression of 9 miRNAs (miR-204, miR-488, miR10a, miR-30a, miR-96, miR-126-5p, miR-182, miR-200a and miR-429), predicted to target significantly regulated genes at E14.5 was assayed using miRNA-qPCR. [score:5]
Expression of 9 miRNAs (miR-10a, miR-126-5p, miR-200a, miR-204, miR-429, miR-488, miR-96, miR-182 and miR-30a-5p), predicted to target significantly regulated genes at E17.5 was evaluated using miRNA-qPCR assays. [score:3]
We tested this hypothesis by determining the differential expression of 9 miRNAs (mmu-miR-10a, mmu-miR-30a-5p, mmu-miR-96, mmu-miR-126-5p, mmu-miR-182, mmu-miR-200a, mmu-miR-204, mmu-miR-429, and mmu-miR-488) between WT and Pkd1 [-/- ]genotypes at E14.5 and E17.5 (Figures 7 and 8). [score:3]
miR-200a did not show significant variation between the WT and Pkd1 [-/- ]kidneys at E17.5 (Figure 8). [score:1]
[1 to 20 of 6 sentences]
51
[+] score: 25
To validate the up- and downregulated miRNAs identified in the Solexa sequencing, 6 upregulated (mmu-miR-146a-5p, mmu-miR-341-3p, mmu-miR-879-5p, mmu-miR-3470a, mmu-miR-3473a and mmu-miR-3473b) and six downregulated miRNAs (mmu-miR-96-5p, mmu-miR-141-3p, mmu-miR-182-5p, mmu-miR-200a-3p, mmu-miR-200b-3p and mmu-miR-200b-5p), as well as two novel miRNAs (novel-mir-2 and novel-mir-20), were selected. [score:10]
[30] The miR-200 family is a cluster of miRNAs closely linked to the epithelial–mesenchymal transition (EMT) and is believed to have an essential role in tumour suppression by inhibiting EMT, the initiating step of metastasis. [score:5]
The most significantly up- and downregulated miRNAs in scrapie-infected mice were mmu-miR-3473e (9.48 log2) and mmu-miR-141-5p (−7.33 log2) in the 139A group, mmu-miR-3473e (13.18 log2) and mmu-miR-200a-5p (−7.08 log2) in the ME7 group, and mmu-miR-3473e (14.15 log2) and mmu-miR-183-3p (−10.15 log2) in the S15 group. [score:4]
Recent studies have shown that the miR-200 family is also significantly reduced during clinical disease in the scrapie agent RML (RML, mouse prion strain from Rocky Mountain Laboratory)-infected mouse neural synapses. [score:3]
We have also found that five members of the miR-200 family are markedly decreased in the brains of scrapie-infected mice, including mmu-miR-200a-3p, mmu-miR-200a-5p, mmu-miR-200b-3p, mmu-miR-200b-5p and mmu-miR-200c-3p. [score:1]
[31] A number of experimental studies show that changes in miR-200 family levels have been associated with enhanced tumorigenesis and are significantly correlated with decreased survival caused by lung cancer and other cancers. [score:1]
[31] The role of the miR-200 family in TSEs is not very clear. [score:1]
[1 to 20 of 7 sentences]
52
[+] score: 25
PJ up-regulates genes involved in cell adhesion such as E-cadherin, intercellular adhesion molecule 1 (ICAM1) and myristoylated alanine-rich protein kinase C (MARCKS) and down-regulates genes involved in cell migration such as type I collagen, tenascin C and chimerin 1. In addition, anti-invasive microRNAs such as miR-335 (predicted targets include COL1A1, TNC, SOX4), miR-205 (predicted targets include CHN1, PRKCE), miR-200 (predicted targets include ZEB1, ZEB2), and miR-126 (predicted targets include SLC45A3), are up-regulated, whereas pro-invasive microRNA such as miR-21 (predicted targets include MARCKS, PDCD4, TPM1) and miR-373 (predicted targets include CD44), are down-regulated. [score:25]
[1 to 20 of 1 sentences]
53
[+] score: 25
To obtain insight into the normal expression of miRNAs at the cellular level, we performed in situ hybridization of miRNAs in EHBDs from mice at 7 days of life and found that miR-200a was expressed largely in cholangiocytes of the duct epithelium and peribiliary glands, and the remaining 5 miRNAs were expressed in cholangiocytes and subepithelial stromal cells (Figure  5). [score:7]
Expression of miR-365, miR-195, miR-30c and miR-200a were significantly downregulated in RRV infected cholangiocytes. [score:6]
After 24 hours of RRV infection (100 multiplicity of infection [MOI]), the expression levels were downregulated by 1.30 to 1.53-fold for miR-365, miR-195, miR-30c and miR-200a (Figure  6) below levels of the vehicle control. [score:6]
Most of these miRNAs have been implicated in mechanisms of hepatocellular carcinoma (miR-193b, [13] -195, [14- 16] -200a/b [15, 17- 19]), hepatitis C virus infection of hepatocytes (miR-193b [20] and −320 [21]), and nonalcoholic fatty liver disease and steatohepatitis (miR-200a/b, [22, 23] Table  2). [score:3]
The remaining miR-200a, -320 and -133a/b were linked to organ and tissue development via Ereg (miR-320), Ctgf, Col8a (miR-133a/b) and Runx1 (miR-200a and -30b/c). [score:2]
05mmu-miR-365−4.620.015−4.450.034mmu-miR-133a−3.650.015−2.670.032mmu-miR-200b−3.960.015−2.840.046mmu-miR-133b−4.410.009−4.350.032mmu-miR-200a−5.560.009−3.110.034 mmu-miR-195 −4.93 0.014 −8.71 0.05 * Minus sign implies fold change below controls. [score:1]
[1 to 20 of 6 sentences]
54
[+] score: 24
In epithelial cells, miR-200 family microRNAs and E-cadherin maintain higher level expression by repressing ZEB1, ZEB2 and TGFβ; on the other hand, in mesenchymal cells and tumors, the up-regulation of ZEB factors is triggered by TGFβ and suppresses the transcription of miR-141/200c by binding to their putative common promoter region. [score:8]
In our primary dataset, ZEB1 and ZEB2 were both up-regulated in six out of our eight ccRCC samples and, their expression levels were highly anti-correlated with the miR-200 family in both tumor and normal samples. [score:6]
Recently, several other groups have reported a role for the miR-200 family in the Epithelial-Mesenchymal-transition (EMT) and in cancer cell migration, the latter by directly targeting the transcription factors ZEB1 and ZEB2, which regulate E-Cadherin, a mediator of cell-cell adhesion [84, 85]. [score:5]
We also noted that in our data, the anti-correlation between VEGFA and the miR-200 family was strongest in normal kidney tissue, suggesting that loss of this regulation may be an important factor providing a permissive environment for HIF transcriptional signaling. [score:2]
We also found strong anti-correlation between VEGFA and the miR-200 family of microRNA: miR-200a*, 200b, 200c and miR-141. [score:1]
Five miR-200 family members contain very similar seed sequences - AAUACU for miR-200b/200c/429 and AACACU for miR-200a*/141 [84]. [score:1]
Another example is the miR-200 family which includes two microRNA clusters, one on Chromosome 1p36.3 (miR-200a*/200b/429) and another on Chromosome 12p13 (miR-200c/141). [score:1]
[1 to 20 of 7 sentences]
55
[+] score: 24
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Luminal-restricted miRNAs included miR-10a (targets KLF4 and PIK3CA) [41, 42], miR-200a/b (targets EMT (epithelial mesenchymal transition) genes) [43], miR-148a (targets Bim) [44] and miR-375 (targets PDK1) [45]. [score:9]
Gregory PA Bert AG Paterson EL Barry SC Tsykin A Farshid G The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat Cell Biol. [score:4]
In human mammary epithelial cell lines, the expression of the miR-200 family was recently found to be subject to epigenetic regulation, whereby DNA methylation and histone modifications were altered during the transition between stem-like and nonstem states [67]. [score:4]
More specifically, the expression of some miRNAs has been linked to histopathological features such as HER2/ neu or ER/PR status (miR-30), metastasis (miR-126 and miR-335) and the EMT (miR-205 and miR-200 family) [43, 76– 79]. [score:3]
Bracken CP Gregory PA Kolesnikoff N Bert AG Wang J Shannon MF A double -negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transitionCancer Res. [score:2]
In the context of miRNAs that potentially control these pathways, we identified several luminal-restricted miRNAs, including miR-10a, miR-200a/b, miR-203, miR-148a. [score:1]
Lim YY Wright JA Attema JL Gregory PA Bert AG Smith E Epigenetic modulation of the miR-200 family is associated with transition to a breast cancer stem-cell-like stateJ Cell Sci. [score:1]
[1 to 20 of 7 sentences]
56
[+] score: 24
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-200c
Given that miR-200 inhibits TGF-β1 -induced E-cadherin downregulation [14], we examined miR-200 role in G9a knockdown HCC cells. [score:7]
Furthermore, miR200a overexpression inhibited TGF-β1 -induced E-cadherin repression in G9a knockdown cells and in control cells. [score:6]
Huh7 cells that stably express miR200a were established by transduction with lentiviral vectors (pLV-miRNA) expressing miR200a (Biosettia Inc. [score:5]
miR200a and 200b expression levels showed no significant changes after G9a knockdown (Supplementary Figure 4A). [score:4]
Collectively, these results imply that G9a minimally affects TGF-β1 -induced EMT in HCC cells and that other regulatory mechanisms that involve miR200 might be more important in EMT induction. [score:2]
[1 to 20 of 5 sentences]
57
[+] score: 24
The highly conserved miR-200 family is composed of five members, miR-200a, miR-200b, miR-200c, miR-141 and miR-429, which are similar in sequence and are clustered and expressed as two separate polycistronic pri-miR transcripts: the miR-200b/a/429 cluster on chromosome 4 and the miR-200c/141 cluster on chromosome 6. The miR-200 family has been reported to be strongly expressed in lung, kidney and thymus tissues [13]. [score:5]
The miR-200 family has also been shown to be involved in the epithelial-to-mesenchymal transition in humans, thereby enhancing cancer cell colonization in distant tissues by targeting zeb1, and in the regulation of olfactory neurogenesis and osmotic stress in zebrafish [16, 17]. [score:4]
MiR-200, down-regulated in the livers of db/db mice, also contribute to IL-6 -induced insulin resistance [21]. [score:3]
Hasuwa et al revealed the requirement of miR-200 family and their target zeb1 in hypothalamo-pituitary-ovarian axis to support female ovulation [13]. [score:3]
In hypothalamus, miR-200a inhibition of ob/ob mice reduced body weight and improved whole-body insulin sensitivity [22]. [score:3]
Our data suggest either that the role of the miR-200 family in the regulation of body weight homeostasis is not evolutionarily conserved or that mice are not completely analogous to flies. [score:2]
miR-8, the homolog of miR-200 in Drosophila, has been reported to positively regulate body size [18]. [score:2]
Light gray bars, miR-200b; dark gray bars, miR-200a; black bars, miR-429. [score:1]
Previous studies showed the critical functions of miR-200 family in female reproduction [14, 15]. [score:1]
[1 to 20 of 9 sentences]
58
[+] score: 22
Other miRNAs from this paper: mmu-mir-301a, hsa-mir-200a, hsa-mir-301a
Several reports have already shown that i) miR-200a directly regulates A2, a receptor for the oncogene Eph, and decreases cancer cell migration via downstream activation of AMPKα [43], and ii) miR-301a appears to directly down-regulate AMPKα1 in osteosarcoma cells [44]. [score:7]
These findings support our results indicating that telmisartan inhibited cancer proliferation and tumor growth via AMPK activation, which was likely enhanced by the down-regulation of miR-200a and miR-301a. [score:6]
Among these microRNAs, miR-200a and miR-301a were significantly down-regulated in OE19 cells treated with telmisartan. [score:4]
miR-200a-3p overexpression did not attenuate p-AMPKα regardless of telmisartan treatment (Supplementary Figure 6). [score:3]
After 24 h, OE19 cells were transfected with miR-200a-3p mimic, miR-301a-30 mimic, or negative control miRNA at a final concentration of 10 nM using Lipofectamine RNAiMAX (Invitrogen, Grand Island, NY, USA). [score:1]
miR-200a-3p mimics, miR-301a-3p mimics, and negative control miRNA were obtained from Thermo Scientific (Waltham, MA, USA). [score:1]
[1 to 20 of 6 sentences]
59
[+] score: 22
Other miRNAs from this paper: mmu-mir-141, mmu-mir-200b, mmu-mir-205, mmu-mir-200c, mmu-mir-429
These include the expression of six microRNAs of the microRNA 200 family, microRNA-200a, -200b, -200c, -141, -429, and -205, which were all downregulated (see the left blue bar-containing thermometers in Figure 2(b)). [score:6]
We found that expressions of various EMT process-related microRNAs, such as microRNA-200a, -200b, -200c, -429, -141, and -205 were suppressed in skin after shikonin treatment. [score:5]
Previous studies have shown that expression of microRNA-200 family members and microRNA-205 in particular is necessary for the maintenance of the epithelial phenotype [18, 19], that is, the reverse of EMT activity; thus, we further validated the RNA transcript and microRNA array expression results. [score:5]
The expression levels of EMT process-related mRNAs (Zeb1 and Zeb2) and microRNAs (microRNA-200a, -200b, -200c, -141, -429, and -205) were quantitatively determined by real-time PCR (RT-PCR). [score:3]
Interestingly, the suppression of the expression of some microRNAs (i. e., microRNA-200a, -200b, and -205) was not statistically significant as conventionally measured by “fold change. [score:3]
[1 to 20 of 5 sentences]
60
[+] score: 22
Other miRNAs from this paper: mmu-mir-141, mmu-mir-200b, mmu-mir-34a, mmu-mir-200c, mmu-mir-429
Previously, we examined miRNA expression in the livers of db/db mice and found that the expression of the miR-200 family members miR-200a, miR-200b and miR-200c was reduced in response to hepatic insulin resistance [23]. [score:5]
Researchers demonstrated that the miR-200 family influences cancer development and progression by targeting various important signaling factors. [score:4]
To identify the potential role of the miR-200 family in lipid metabolism, relative expression patterns were analyzed in the steatotic livers of HFD-fed mice and NAFLD patients. [score:3]
The miR-200 family, including miR-200a, miR-200b, miR-200c, miR-141 and miR-429, has been reported to be dysregulated in several types of cancers including gastric cancer, breast cancer and bladder cancer [20– 22]. [score:2]
To further assess the requirement of miR-200 in sitagliptin's effect, miR-200b and miR-200c were knocked down in the Hep1-6 cells pre -treated with a mixture of oleic acid/palmitic acid and treated with sitagliptin. [score:2]
The aim of this study was to explore the potential role of the miR-200 family in the regulation of hepatic lipid metabolism. [score:2]
In a previous study, we demonstrated that the reduction of miR-200a, miR-200b and miR-200c in hepatocytes contributed to IL -induced insulin resistance [23]. [score:1]
As shown in Figure 1D, the levels of miR-200b and miR-200c, but not the levels of other members of the miR-200 family including miR-200a, miR-141 and miR-429, were obviously reduced in the livers of HFD-fed mice. [score:1]
However, the role of the miR-200 family in hepatic lipid metabolism remains unknown. [score:1]
The miR-200 family has been extensively studied in different tumors [29– 31]. [score:1]
[1 to 20 of 10 sentences]
61
[+] score: 22
HMGA2 has also been shown to function as an activator of Snail1 and Slug (Snail2) expression (inhibitors of E-cadherin/miR-200 expression), suggesting that p53/TA-p73/p63, by suppressing the expression of both Snail and Slug, it could induce the expression of E–cadherin and miR-200. [score:13]
Together, p53/TA-p73/p63, by increasing the expression of miR-145, let-7, and miR-200, it could decrease the expression of metastasis promoting factors, and stem cell factors. [score:5]
p53, TA-p73/p63, and ΔNp63 regulate the processing of the tumor suppressor miRNAs, let-7, miR-200, miR-143, and miR-107. [score:4]
[1 to 20 of 3 sentences]
62
[+] score: 21
Other miRNAs from this paper: mmu-mir-200b, hsa-mir-200b, hsa-mir-200c, mmu-mir-200c, hsa-mir-200a
When Grhl2 was over-expressed, expression levels of the miR-200 family were up-regulated. [score:8]
4T1-control cells recovered from primary tumors were mainly comprised of epithelial cells, and expressed E-cadherin, Grhl2 and miR-200, while 4T1-control cells recovered from lungs were characterized by mesenchymal morphology and did not express E-cadherin, Grhl2 and miR-200 (Figure 4F, 4G, 4H, 4I). [score:3]
Our data suggest that Grhl2 could be the transcription factor that drives the expression of miR-200 in breast cancer cells. [score:3]
Members of the miR-200 family are epithelial specific microRNAs and play a critical role in EMT by targeting Zeb1 and Zeb2 [21], [22]. [score:3]
In contrast, 4T1-Wnt7A2 cells recovered from either primary tumors or lungs had a spindle or round-like mesenchymal morphology and did not express E-cadherin, Grhl2 and miR-200 (Figure 4F, 4G, 4H, 4I). [score:3]
4T1-Wnt7A1 cells recovered from either primary tumors or lungs were characterized by a cobble-stone like epithelial morphology and expressed high levels of E-cadherin, Grhl2 and miR-200 (Figure 4F, 4G, 4H, 4I). [score:1]
[1 to 20 of 6 sentences]
63
[+] score: 21
The miR-200 family was significantly upregulated during T2AECs differentiation in fetal lung; miR-200 induction was inversely correlated with expression of known targets, transcription factors ZEB1/2, and TGF-β2. [score:8]
miR-200 antagonists inhibited thyroid transcription factor (TTF)-1 and surfactant proteins and upregulated TGF-β2 and ZEB1 expression in T2AECs [44]. [score:8]
Benlhabib H Guo W Pierce BM Men delson CR The miR-200 family and its targets regulate type II cell differentiation in human fetal lungJ. [score:4]
Koutsaki M Spandidos DA Zaravinos A Epithelial-mesenchymal transition -associated miRNAs in ovarian carcinoma, with highlight on the miR-200 family: prognostic value and prospective role in ovarian cancer therapeuticsCancer Lett. [score:1]
[1 to 20 of 4 sentences]
64
[+] score: 21
Because ZEB factors induce EMT by suppressing the expression of epithelial marker genes, including E-cadherin [9, 10], the overexpression of miR-200 s decreases expression of ZEB factors and induces epithelial differentiation. [score:9]
We also examined the levels of miR-200c, one of the miR-200 family microRNAs that are expressed in the cells, preserve epithelial phenotypes and function as EMT suppressors. [score:5]
A recent publication showed that the miR-200 family members inhibit TGF-β -induced EMT in a rat alveolar epithelial cell line [11]. [score:3]
The miR-200 family targets the ZEB factors (ZEB1 and ZEB2) that function as transcriptional repressors. [score:3]
The microRNA-200 (miR-200) family can reverse EMT and induce an epithelial phenotype in cancer cells [3- 8]. [score:1]
[1 to 20 of 5 sentences]
65
[+] score: 20
We observed a significant reduction in the expression of miR21, miR34a, miR200c, miR203 and miR19a, whereas miR200a, miR200b and miR205 displayed increased expression in HuΔNp63α -expressing 940 cells (Fig. 2I). [score:7]
Importantly, the reduction of miR21, miR19a and miR203, and the increased expression of miR200a, miR200b and miR205 are compatible with a possible reduction in the metastatic potential of 940 cells upon ectopic expression of huΔNp63α, and may explain the indirect regulation of EMT-mediating transcription factors described above. [score:7]
In the present study we show that the experimental deregulation of p63 levels promoted altered expression of various miRNA previously involved in EMT and tumor metastasis, including miR-21, miR-34a, miR-200a, miR-200b, miR-203, miR19a and miR205. [score:4]
Of note, several of these miRNAs have been identified in ChIP-seq experiments and display binding sites for p53 (miR-21, miR34a), p63 (miR-200a, miR-200b) or both (miR-205) [20, 60]. [score:1]
These include miR21, miR200 family, miR34 family, miR130a, miR203, miR19a and miR205. [score:1]
[1 to 20 of 5 sentences]
66
[+] score: 20
In MDA-MB-231 cells expressing the OVOLs, we used to assess expression of miR-200 family members (miR-200a, miR-200b, miR-200c, miR-141, miR-429, miR205, miR-203), relative to controls miR-U6 and miR16. [score:5]
Comparing these observations to the MDA-MB-231 mo del, we found no general correlation between the expression of OVOL and the members of miR-200 -family across cell types, suggesting that regulation of miRNA-200s is cell-type specific. [score:4]
Specifically, ZEB1 can induce EMT by repressing epithelial proteins and by downregulating its own miR-200 repressors. [score:4]
It has been proposed that EMT is regulated by reciprocal feedback loops between ZEB1/ZEB2 TFs and members of the MicroRNA miR-200 family [6, 7]. [score:2]
This suggests that, in addition to the previously described mechanism, the OVOL -mediated MET may involve regulation of the miR-200 family. [score:2]
The double-transduced cells showed greater than 2-fold increases in miR-200a, miR-200c, and miR-429 (Figure 6E), while only modest changes were seen in the single-transduced cells. [score:1]
Given evidence of reciprocal feedback loops between ZEB1/2 and miR-200 family members in EMT-MET transformations [7, 26], we explored the contribution of miR-200s as potential inducers of epithelial differentiation in the breast and prostate cancer mo dels. [score:1]
It has been suggested that ZEB1 mediates EMT-MET plasticity through a feedback loop including the microRNA-200 family [26]. [score:1]
[1 to 20 of 8 sentences]
67
[+] score: 20
MACC1 acted as a target gene for miRNAs, and it has been reported that the expression of MACC1 was down-regulated by miR-143 inhibited the cell migration and invasion in colorectal cancer (Zhang et al., 2012) and MACC1 was down-regulated by miR-200a inhibited the hepatocellular carcinoma cell proliferation and migration (Feng et al., 2015). [score:15]
miR-200a suppresses cell growth and migration by targeting MACC1 and predicts prognosis in hepatocellular carcinoma. [score:5]
[1 to 20 of 2 sentences]
68
[+] score: 20
For example, Tnfsf10, a critical pro-apoptotic gene whose expression was upregulated by 1.9-fold in the LW of C57 mice, is predicted to be regulated by two anti-apoptotic miRNAs, miR-145 and miR-107, which were downregulated at 9 m. Also, Birc5, an anti-apoptotic gene downregulated in both strains during aging, is predicted to be regulated by miR-200a, a known pro-apoptotic miRNA that was upregulated at 9 m in the LW of C57 mice. [score:17]
Birc5 is predicted to be regulated by miR-27b, miR-125b-3p, miR-150, miR-200a, miR-146a, miR-709, miR-705, and miR-762. [score:2]
miR-107 and miR-200a were found in all three cell types in the SV. [score:1]
[1 to 20 of 3 sentences]
69
[+] score: 20
In oral cancer, the expression of OIP5 may not be regulated at the post-transcription level as the miR-143/145, miR-200 and let-7 family microRNAs were reported to be downregulated in oral cancer 9, 11, 14. [score:7]
However, OIP5 was targeted by stemness regulatory miR-143/145, EMT associated miR-200 family and oral cancer-specific tumor suppressor let-7 family. [score:6]
Interestingly, we also found many MREs for stemness regulatory miRNAs miR-143/145 family, EMT regulatory miRNA miR-200a/miR-200b/miR-141, TP53 induced miR-34a, let-7, and several other oral cancer specific tumor suppressive miRNAs in OIP5 mRNA 3′-UTR (Supplementary Table  S7). [score:5]
One such important function of miR-200 family is regulation of epithelial to mesenchymal transition and miR-143/145 is to maintain the stemness 9, 14. [score:2]
[1 to 20 of 4 sentences]
70
[+] score: 20
The results revealed that PQ could inhibit the expression of miR-200a-3p and miR-21, but up-regulated the levels of miR-141-3p and miR-153 in damaged lung tissues; EPCs injection significantly attenuated the PQ induced-up-regulation of miR-141-3p (approximate to 60%), while EPCs had no significant effect on the expression of miR-200a-3p, miR-21 and miR-153 (Fig.   3a). [score:13]
PQ also caused the dysregulated expression of some miRNAs including miR-200a-3p, miR-21, miR-141-3p and miR-153, and only the level of miR-141-3p was influenced by EPCs. [score:4]
a The expressions of miR-200a-3p, miR-21, miR-141-3p and miR-153 in lung tissues were determined using qRT-PCR. [score:3]
[1 to 20 of 3 sentences]
71
[+] score: 19
Other miRNAs from this paper: mmu-mir-101a, mmu-mir-199a-1, mmu-mir-96, mmu-mir-199a-2
The heat scale at the right of the panel represents a linear scale, with magenta, black and turquoise representing high, average and low expression, respectively; Expression profiles of miR-96-5p (b), miR-101a-3p (c), miR-199a-5p (d) and miR-200a-3p (e) over 24 h in mesencephalon examined by a microarray or qRT-PCR. [score:5]
These oscillations of miRNAs such as miR-96-5p, miR-199a-5p and miR-200a-3p are unique in mature miRNA processing; other miRNAs such as miR-101a-3p exhibit no significant diurnal changes in expression (Supplementary Fig. 8). [score:3]
Significant rhythmicity of the expression patterns of miR-96-5p and miR-199a-5p miR-200a-3p was revealed (P=0.0082, 0.026 and 0.023, respectively) but not of miR-101a-3p (P=0.053). [score:3]
Among the candidates with diurnal oscillations, our computational analysis of candidate miRNA prediction using established programmes revealed three miRNAs-miR-96-5p, miR-199a-5p and miR-200a-3p-as possible candidates, with oscillations that target the 3′-UTR of human, mouse and rat EAAC1. [score:3]
The transfection of miR-96-5p or miR-101a-3p into HEK293 cells decreased EAAC1 protein compared with control miRNA (Steel’s test; P<0.05), whereas miR-199a-5p and miR-200a-3p had no effects on protein expression (Fig. 4a,b). [score:2]
In contrast, miR-199a-5p and miR-200a-3p had no effect on the luciferase activity, which is also consistent with the western blotting results (Fig. 4a,d, Supplementary Fig. 9b). [score:1]
Using qRT–PCR, we confirmed that miR-96-5p, miR-199a-5p and miR-200a-3p oscillate in a diurnal manner as shown by the microarray data (Cosinor; P=0.0082, 0.026 and 0.023, respectively) but that miR-101a-3p does not (Cosinor; P=0.053). [score:1]
MiR-199a-5p and miR-200a-3p had especially large amplitudes, with more than threefold changes and peaks at ZT5 and ZT14, respectively (Fig. 3d,e). [score:1]
[1 to 20 of 8 sentences]
72
[+] score: 19
Some of the results are in accordance with previous studies, such as the up-regulation of mmu-miR-221 and mmu-miR222 cluster and the down-regulation of the mmu-miR-200 family, as well as of mmu-miR-204, mmu-miR-30a*, mmu-miR-193, mmu-miR-378 and mmu-miR-30e*. [score:7]
On the contrary, the following miRNAs were down-regulated in WAT after HFD feeding: mmu-miR-141, mmu-miR-200a, mmu-miR-200b, mmu-miR-200c, mmu-miR-122, mmu-miR-204, mmu-miR-133b, mmu-miR-1, mmu-miR-30a*, mmu-miR-130a, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-203, mmu-miR-378 and mmu-miR-30e*. [score:4]
Mmu-miR-200b and mmu-miR-200c(members of the mmu-miR-200 family), mmu-miR-203 and mmu-miR-192 target Zeb1 and Zeb2 that regulate epithelial to mesenchymal transition [41] and have recently been implicated in adipogenesis and obesity [42]. [score:4]
The down-regulation of mmu-miR-200b and mmu-miR-200c after HFD -induced obesity, is in accordance with a previous study which showed that the mmu-miR-200 family promotes adipogenesis [43]. [score:4]
[1 to 20 of 4 sentences]
73
[+] score: 19
Although the majority of the differentially expressed miRNAs originated from different miRNA clusters, mmu-miR-429-3p and mmu-miR-200a-5p belonged to the same cluster (MID < 5 kb) on chromosome 4 and were both up-regulated in myopic retina, while mmu-miR-145-5p and mmu-miR-143-3p localized within the same cluster (MID < 5 kb) on chromosome 18 and were both down-regulated in myopic retina (Table 1) [68]. [score:9]
For example, miR-200a, miR-429 and miR-141 were shown to play important roles in neurogenesis, epithelial-to-mesenchymal transition and Notch signaling [73, 75– 84], miR-214 was found to be overexpressed in fetal sclera versus adult sclera and shown to play important role in brain and retina development and function [36, 85– 89], miR-18b, miR-21, miR-101a, miR-200a and miR-429 were found to be involved in stem cell function and differentiation [90– 100], miR-1306 negatively regulated Alzheimer’s disease gene ADAM10 [101]. [score:7]
Several miRNAs exhibited more than 10-fold change in expression in the myopic retina (Table 1), including mmu-miR-1947-5p (FC = 31.5, p = 1.47 × 10 [−04]), mmu-miR-200a-5p (FC = 18.8, p = 9.46 × 10 [−05]), mmu-miR-141-5p (FC = 13.9, p = 4.75 × 10 [−06]), mmu-miR-465b-5p (FC = 12.8, p = 5.93 × 10 [−04]), mmu-miR-214-5p (FC = 12.6, p = 8.27 × 10 [−03]), mmu-miR-1936 (FC = 12.3, p = 9.56 × 10 [−06]), mmu-miR-466f-5p (FC = 11.5, p = 3.85 × 10 [−03]), mmu-miR-669o-5p (FC = 10.9, p = 2.18 × 10 [−03]), mmu-miR-18b-5p (FC = 10.1, p = 1.79 × 10 [−03]), and mmu-miR-145-5p (FC = -10.5, p = 8.87 × 10 [−09]). [score:3]
[1 to 20 of 3 sentences]
74
[+] score: 19
In this study, we provide strong evidence that KLF8 promotes the expression of EGFR by both directly activating the gene promoter and by repressing its inhibitory microRNA141, a member of the microRNA-200 family to release its translation. [score:8]
miR141 belongs to the microRNA-200 family that is known to inhibit EMT and metastasis [35] by inhibiting the EMT-inducing ZEB1 and SIP1 [28, 36]. [score:5]
In breast cancer, for example, the microRNA-200 family members have been shown to inhibit EMT and invasion in breast cancer [28]. [score:3]
miR141 belongs to the miR-200 family and this family of microRNAs plays a crucial role in inhibiting EMT, invasion and metastasis [30, 31]. [score:3]
[1 to 20 of 4 sentences]
75
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
Out of these 25 miRNAs, 18 miRNAs were differentially expressed in a consistent manner between the 2 groups (Figure 4A, highlighted); 8 miRNAs were downregulated in both groups (miR-16, miR-200, miR-205, miR-3064, miR-379, miR-431, miR-485 and miR-491) and 10 miRNAs were upregulated in both groups (miR-194, miR-1894, miR-211, miR-3072, miR- 3077, miR-4436, miR-5128, miR-669a, miR-669c and miR-6967). [score:9]
MiRNAs (miR-199 and miR-200) were significantly upregulated in cbs [+/–] in comparison with the control ([*] p < 0.05, [**] p < 0.01). [score:4]
However, miR-199 (p value = 0.01) and miR-200 (p value = 0.004) in contrary to the microarray results were significantly upregulated in cbs [+/–] in comparison with the control cbs [+/+] (p value < 0.05). [score:4]
Hcy also induces alteration of miRNAs related to tight junctions signaling such as miR-128, miR-132, miR-133, miR-195, miR-3473, miR-19, miR-200, miR-205, miR-214, miR-217, miR-23, miR-26, miR-29, miR-30, miR-31 AND miR-690. [score:1]
[1 to 20 of 4 sentences]
76
[+] score: 17
Korpal M Lee ES Hu G Kang Y The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2J Biol Chem. [score:6]
The miRNA profiles of the MVs revealed that EPO-MVs changed 212 miRNAs (fold-change ≥ 1.5), including miR-299, miR-499, miR-302, and miRNA-200, and that 70.28 % of these changes involved upregulation. [score:4]
Our findings also demonstrate that miR-299, miR-499, miR-302, and miRNA-200 were upregulated in EPO-MVs (Fig.   8c). [score:4]
In vitro studies have demonstrated that members of the miRNA-200 family inhibit the E-cadherin transcriptional repressors ZEB1 and ZEB2, which are implicated in EMT [45]. [score:3]
[1 to 20 of 4 sentences]
77
[+] score: 17
Downregulated miR-200 in aged LCs may upregulate its target, Gfi1, which could then arrest LCs commitment. [score:9]
Our miRNA array data showed that the expression level of miR-200 that potentially targets Langerin, was downregualted in aged LCs. [score:5]
Gfi1 is a potential target of miR-200. [score:3]
[1 to 20 of 3 sentences]
78
[+] score: 17
Other miRNAs from this paper: rno-mir-200a
Figure 7 (A) Expression of vimentin and N-cadherin in K3, K3-F4, and K3-B6 cells was detected by immunofluorescence analysis (×200); (B) Expression of vimentin, N-cadherin, and E-cadherin in K3, K3-F4, K3-B6 cells was detected by; (C) Expression of miRNA-200a, snail, slug, and ZEB1 in K3, K3-F4, and K3-B6 cells was detected. [score:7]
In addition, the expression level of the accepted EMT inhibitor miR-200a was lower in K3-F4 and K3-B6. [score:5]
Moreover, the expression levels of miR-200a, an accepted EMT inhibitor, were lower in K3-F4 and K3-B6 cells than in K3 cells (Figure 7C). [score:5]
[1 to 20 of 3 sentences]
79
[+] score: 17
The only common dysregulated miRNA in all mo dels studied, miR-200a, was downregulated in the DAPC -associated pathologies and upregulated in the two other pathologies. [score:8]
In contrast, the upregulation of miR-149 and miR-193b, and the downregulation of miR-122 and miR-200a were not confirmed in DMD patients (not shown). [score:7]
The miR-200a was the only commonly dysregulated in Mybpc3-related HCM with the other 4 pathologies. [score:2]
[1 to 20 of 3 sentences]
80
[+] score: 16
Significant downregulation of miR-200a, miR-96, miR-183, and miR-203 expression was found in the nasopharyngeal carcinoma cancer stem-like cells. [score:6]
Significant downregulation of miR-200a and miR-203 expression was also detected in NPC CSCs (Additional file 1: Figure S1B). [score:6]
Several downregulated miRNAs including miR-200a and miR-203 were previously reported to modulate CSC properties in NPC cells [19, 20]. [score:4]
[1 to 20 of 3 sentences]
81
[+] score: 16
Therefore, the circuits shown in Figure 12 uncovers that the regulatory combinations of MEIS1 and mir-200/mir-29/mir-150 miRNAs play roles in the early stage in the lung development, while their abnormal expressions may result in the tumour progression. [score:5]
Specifically, miR-200 miRNAs are involved in cancer metastasis[62]; mir-150 functions in hematopoiesis, and regulates genes whose downstream products encourage differentiating stem cells towards becoming megakaryocytes rather than erythrocytes [63]; mir-29 miRNAs activates p53, the tumour suppressor [64]. [score:4]
The miR-200 family is believed to play an essential role in the tumour suppression. [score:3]
We have noticed that miRNAs are from mir-200 family (mir-200a, mir-200b and mir-429), mir-29 family (mir-29a and mir-29c) and mir-150 family, they are all related to lung cancer[60, 61]. [score:1]
MiRNA overlap (Figure 5(c))We have found that there are five miRNAs participated in both the early and late stages: mmu-mir-200a, mmu-mir-200b, mmu-mir-135b, mmu-mir-494 and mmu-mir-503. [score:1]
We have also noted that mmu-mir-200a play some roles in the early stage by cooperating with MEIS1, while play other roles in the late stage by cooperating with BRCA1 together. [score:1]
We have found that there are five miRNAs participated in both the early and late stages: mmu-mir-200a, mmu-mir-200b, mmu-mir-135b, mmu-mir-494 and mmu-mir-503. [score:1]
[1 to 20 of 7 sentences]
82
[+] score: 16
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-mir-34a, mmu-mir-200c
In particular, our work is consistent with the findings that p53 upregulates miR-200 which in turns downregulates Zeb1 and Zeb2 and reduces EMT in liver cancer cells [43]. [score:7]
In mammary epithelial cells and HCC cell lines, p53 regulates EMT by up -regulating the expression of miR-200, thereby repressing Zeb1 and Zeb2 [42], [43]. [score:5]
In our study, we did find a decreased expression of miR-200 family members when p53 was silenced (Figure S6 in File S1), further supporting the idea that p53 may influence EMT through regulating miR-200 family. [score:4]
[1 to 20 of 3 sentences]
83
[+] score: 15
Of these, miR-200 family members, including miR-200a-3p and miR-200b-3p, were significantly downregulated whereas all others were upregulated (Fig. 1A and Table 1). [score:7]
Our previous study using microarray analysis revealed downregulation of tight junction -associated molecules 3 months after Müller cell disruption 25 42, we found significant downregulation of miR-200a-3p and miR-200b-3p 3 months after Müller cell disruption in this study. [score:7]
These included miR-133a-3p, miR-133b-3p, miR-146b-3p, miR-200a-3p, miR-200b-3p, miR-215-5p, miR-223-3p, miR-1936 and miR-202-3p (Fig. 1A and Table 1). [score:1]
[1 to 20 of 3 sentences]
84
[+] score: 15
For instance, the mir-200 family of micrornas is down-regulated during TGF-β induced EMT in NMUMG cells; while over -expression of these micrornas inhibites EMT [21]. [score:8]
For example, the mir-200 family of mirnas is specifically down-regulated by TGF-β during EMT in normal mouse mammary gland (NMUMG) cells, whereas up-regulation of mir-200s in epithelial phase NMUMG cells completely abrogates TGF-β pathway signaling and thus TGF-β mediated stimulation of EMT [19]– [22]. [score:7]
[1 to 20 of 2 sentences]
85
[+] score: 15
Other miRNAs from this paper: mmu-mir-141, mmu-mir-200b, mmu-mir-200c, mmu-mir-429
By targeting ZEB1 and ZEB2, several members of the miR-200 family (miR-141, miR-200a, miR-200b, miR-200c and miR-429) are considered the main suppressors of EMT. [score:4]
We confirmed significant downregulation of miR-141, miR-200a, miR-200b, miR-200c and miR-429 in ALK-TKI-resistant cells as determined by qRT-PCR (Figure 2B). [score:4]
The expressions of such miR-200 family members were all markedly suppressed in ALK-TKI-resistant compared with parental H2228 cells (data are not shown). [score:4]
We have previously reported that TGF-β1 -induced EMT changes in NSCLC cells with drug insensitivity were associated with low expression of the miR-200 family and the alteration of EMT-related factors such as ZEB1 and ZEB2 [19, 37]. [score:3]
[1 to 20 of 4 sentences]
86
[+] score: 15
Concomitant with the large induction of epithelial -associated genes and repression of mesenchymal regulators, MET -associated miRNAs miR-205-5p and the miR-200 family (miR-200a-3p, miR-200b-3p, miR-200c-3p, miR-141-3p and miR-429-3p) [23- 26] were markedly upregulated (at least four-fold) in the Thy1- to SSEA1+ transition (Figure 2; Additional file 3). [score:5]
Another TGFβ pathway miRNA, miR-203-3p, was not upregulated until the Thy1- to SSEA1+ transition, along with the miR-200 family [35]. [score:4]
miRNAs associated with the MET (miR-200a, b, c-3p, miR-141-3p, miR-429-3p, miR-205-5p) [23- 26] were not differentially expressed between the piPSC lines and the stem cell lines, with the exception of miR-200c-3p. [score:3]
The miR-200 family did not significantly decline in the newly reprogrammed Oct4-GFP+ line; however, many of these miRNAs were expressed at lower levels in the iPSC line with higher passages and in the mES cell line, suggesting that, with additional passages, iPSCs more closely resemble mES cells. [score:3]
[1 to 20 of 4 sentences]
87
[+] score: 14
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-200c
Patel V. et al. have shown that in Ksp/cre; Dicer [F/F] mice the suppression of the miRNA200 family stimulates Pkd1 expression and consequently the development of cysts [10]. [score:6]
com) the suppression of miRNA200 family in Dicer c KO mice [10] could determine GSK3β cytosolic accumulation and therefore β-catenin inhibition. [score:5]
Since GSK3β mRNA has multiple target sites for several members of the miRNA200 family (www. [score:3]
[1 to 20 of 3 sentences]
88
[+] score: 14
These included miR-8 family overexpressed in FCx and comprising of miRNAs from two chromosomal clusters, miR-429, miR-200a, miR-200a*, miR-200b, and miR-200b* from chromosome 4, and miR-141 and miR-200c from chromosome 6. Also, a chromosome 6 cluster with miR-182, miR-96, and miR-183 and a chromosome 11 cluster with miR-212 and miR-312 were expressed on a higher level in FCx. [score:5]
For example, in the ceramide pathway (Figure 5), miR132 and miR-212 were predicted to regulate Ras, Pi3k, Pp2a, and Tnfr1, miR-200a to regulate Nsmaf, Pp2a, and Map2k4, and miR-200b, miR-200c, and miR-429 to regulate Ras, Pp2a, Map3k1, and Jun. [score:4]
The Chipster tool was used to visualize the miR-8 family members located on chromosome 4 (miR-429, miR-200a, miR-200a*, miR-200b and miR200b*). [score:1]
As an example, Figure 3 shows visualization of miR-8 family (miR-429, miR-200a, miR-200a*, miR-200b and miR200b*) located on chromosome 4. 10.1371/journal. [score:1]
0021495.g003 Figure 3The Chipster tool was used to visualize the miR-8 family members located on chromosome 4 (miR-429, miR-200a, miR-200a*, miR-200b and miR200b*). [score:1]
The lower half zooms in on the reads detected for miRNA-200a and miR-200a*. [score:1]
As an example, Figure 3 shows visualization of miR-8 family (miR-429, miR-200a, miR-200a*, miR-200b and miR200b*) located on chromosome 4. 10.1371/journal. [score:1]
[1 to 20 of 7 sentences]
89
[+] score: 14
These changes in the expression levels of full length and shorter isoforms may be sustained, at least in part, by deregulation of 17 miRNAs, with particular reference to miR-200a-3p and miR-375 that exhibited very high levels of downregulation in all samples in the exploratory cohort (Figs. 5 and 6). [score:7]
Finally, 17 miRNAs to target TP53 transcripts were deregulated highlighting the levels of miR-200a-3p and miR-375 downregulation of (Fig.   5; Additional file  8: Table S6). [score:7]
[1 to 20 of 2 sentences]
90
[+] score: 14
In the context of CNS, it has been shown that mir-200a, mir-200b, and mir-429 are up-regulated in the hypothalamus of ob/ob and db/db mice (Crépin et al., 2014). [score:4]
Recently, it has been shown that mir-200a, mir-200b, and mir-429 are up-regulated in the hypothalamus of ob/ob and db/db mice (Crépin et al., 2014). [score:4]
Interestingly, two extreme conditions of nutritional stress, i. e., caloric restriction and high fat diet -induced obesity, modified the hypothalamic pattern of expression of a set of miRNAs including let7a, mir-9 [*], mir-30e, mir-132, mir-145, mir-200a, and mir-218 (Sangiao-Alvarellos et al., 2014). [score:3]
The over -expression of miR-200a in the hypothalamus of ob/ob mice is linked to leptin and insulin signaling impairment. [score:3]
[1 to 20 of 4 sentences]
91
[+] score: 14
We observed the uncoupling of HMGCR mRNA (up-regulated) and protein (unchanged) in the liver of leptin -treated chicks, which coincided with significantly increased expression of gga-miR-200a gga-miR-200b and gga-miR-429 that were predicted to target the chicken HMGCR gene. [score:8]
Among the nine miRNAs predicted to target HMGCR, the expression of gga-miR-200a, gga-miR-200b and gga-miR-429 was significantly increased (P < 0.05). [score:5]
It is noteworthy that gga-miR-99a and gga-miR-100 belong to the miRNA gene family of miR-99, while the remaining three miRNAs, gga-miR-200a, gga-miR-200b and gga-miR-429, belong to the miRNA gene family of miR-8, located in the same miRNA cluster. [score:1]
[1 to 20 of 3 sentences]
92
[+] score: 13
Another highly-enriched beta cell miRNA is miR-200a, demonstrated to be upregulated in islets of the db/db diabetic mouse mo del and shown to contribute in regulating pancreatic beta cell survival in T2D (Belgardt et al., 2015). [score:5]
Expression of miR-200a, miR-130a and miR-152 in INS-1 832/13 cells (A–C) or in EndoC-βH1 cells (D–F) at different confluences. [score:3]
For miR-200a, miR-130a and miR-152, the expression levels were found not to be influenced by cellular confluence (Fig. S2). [score:3]
We also investigated the influence of confluence on the expression levels of miR-200a, miR-130a, miR-152, miR-132 and miR-212. [score:1]
The following primers from TaqMan [®] Gene Expression and TaqMan [®] miRNA Assays were used for qPCR: Cav1/CAV1 (Rn00755834_m1/Hs00971716_m1), Aifm1/AIFM1 (Rn00442540_m1/ Hs00377585_m1), miR-375 (TM_ 000564), miR-200a (TM_000502), miR-130a (TM_00454), miR-152 (TM_000475), miR-132 (TM_000457) and miR-212 (TM_002551) were used for qPCR. [score:1]
[1 to 20 of 5 sentences]
93
[+] score: 13
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-27b, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-182, mmu-mir-199a-1, mmu-mir-122, mmu-mir-143, mmu-mir-298, mmu-let-7d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-27a, mmu-mir-31, mmu-mir-98, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-181b-1, mmu-mir-379, mmu-mir-181b-2, mmu-mir-449a, mmu-mir-451a, mmu-mir-466a, mmu-mir-486a, mmu-mir-671, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-491, mmu-mir-700, mmu-mir-500, mmu-mir-18b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-669e, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-669a-10, mmu-mir-669a-11, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-486b, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-145b, mmu-let-7j, mmu-mir-451b, mmu-let-7k, mmu-mir-126b, mmu-mir-466c-3
We also observed downregulated (>1.5-fold) expression of two other miRs: miR-200a and miR-491 in TCDD-exposed fetal thymocytes. [score:6]
Also miR-200a has been shown to regulate apoptosis [83], whereas miR-491 has been shown to induce apoptosis by targeting Bcl-xL gene [40]. [score:4]
miR-200a has been reported to play a crucial role in apoptosis [39], whereas miR-491 has been shown to influence apoptosis by targeting BCL-xL gene in colorectal cancer cells [40]. [score:3]
[1 to 20 of 3 sentences]
94
[+] score: 13
Eades G. Yang M. Yao Y. Zhang Y. Zhou Q. miR-200a Regulates Nrf2 activation by targeting Keap1 mRNA in breast cancer cellsJ. [score:4]
Li Y. VandenBoom T. G. Kong D. Wang Z. Ali S. Philip P. A. Sarkar F. H. Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cellsCancer Res. [score:4]
In detail, DIM up-regulated miR-200 and the let-7 family, which were increased in gemcitabine-resistant pancreatic cancer cells, leading to the reversal of the cells to an epithelial phenotype [177]. [score:4]
For example, miR-200-a and miR-141 were found to bind to the 3’-UTR of the Keap1 transcript leading to reduced Keap1 protein levels and an enhanced transcriptional activity of Nrf2 [188, 189, 190, 191]. [score:1]
[1 to 20 of 4 sentences]
95
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-138-2, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
miR-200 negatively regulates the expression of Sox2 and E2F3, a pluripotency factor and a cell cycle regulator, respectively (Johnson and Walker, 1999; Peng et al., 2012). [score:5]
The lack of Sox2 and E2F3 regulation by miR-200 results in reduced cell cycle exit and neuronal differentiation of ventral midbrain/hindbrain (vMH) NPs while, overexpression of miR-200 in primary vMH NPs results in the opposite effect (Peng et al., 2012) indicating that these interactions control the proliferative state of vMH NPs (Figure 2). [score:4]
Interestingly, both TFs Sox2 and E2F3 activate miR-200 transcription which establish a negative feedback loop between miR-200 and its target genes that guaranty NPs cell cycle exit and differentiation in the midbrain/hindbrain region (MHR) (Peng et al., 2012). [score:3]
A unilateral negative feedback loop between miR-200 microRNAs and Sox2/E2F3 controls neural progenitor cell-cycle exit and differentiation. [score:1]
[1 to 20 of 4 sentences]
96
[+] score: 13
Members of the miR-200 family are known to suppress the Zeb2 transcription factor, and its inhibition promotes MET [53]. [score:5]
Among the miRNAs upregulated in rat PSCs, we also identified miR-205 and members of the miR-200 family (miR-200a, miR-200b, miR-200c, miR-141 and miR-429), which promote mesenchymal to epithelial transition (MET) in mouse cells, a key step in fibroblast reprogramming [47]. [score:4]
A number of miRNAs that were found to be upregulated in rat PSCs, such as the miR-290-295 cluster and the miR-200 family miRNAs, are involved in pluripotency induction and maintenance in mice 21, 47. [score:4]
[1 to 20 of 3 sentences]
97
[+] score: 12
Enforced expression of the miR-200 family was sufficient to prevent TGF-beta induced EMT, while inhibition of the miR-200 family was sufficient to induce EMT in cells [30]. [score:5]
All five members of the miR-200 family were markedly down-regulated in cells that had undergone EMT in response to transforming growth factor (TGF)-beta [30]. [score:4]
The cluster includes miR-200 family members miR-200a, miR-141 and miR-429. [score:1]
It is therefore tempting to speculate that the miR-200 family may act to prevent premature loss of E-cadherin and induction of EMT during lactation. [score:1]
This cluster included the seed-identical miRNAs miR-141 and miR-200a, and miR-429, which is situated in the same genomic cluster as miR-200a. [score:1]
[1 to 20 of 5 sentences]
98
[+] score: 12
In NPC, down-expressed miR-29c could upregulate mRNA expression of extracellular matrix genes [17], and ZEB2 and CTNNB1 low -expression induced by miR-200a inhibits the growth, migration and invasion of NPC cells [18]. [score:12]
[1 to 20 of 1 sentences]
99
[+] score: 12
In PyMT mice, miR-200a and miR-148a can regulate their expression, and thus changes in the expression of these miRNAs will probably also drive changes in the expression of both PPAR genes. [score:8]
For example, miR-182, miR-141, miR-18b, miR-200a, miR-17 and, especially, miR-421 appear recurrently along PyMT cancer progression regulating genes involved in ABC transporters (DNAH8, ABCC5, ABCA8A, ABCB4, and ABCA8B), which are significant in cancer research due to their impact in treatment resistance [47]. [score:2]
MiRNAs persistently regulating these genes in our mo del are miR-143, miR-27b, miR-141, miR-200a, and miR-148a (Fig.   6b). [score:2]
[1 to 20 of 3 sentences]
100
[+] score: 12
Among the differentially expressed miRNAs in lungs, most were correlated with immune system regulation, including miR-223 (regulation of the immune response), miR-1224 (regulation of tumor necrosis factor), miR-150 (differentiating stem cells towards megakaryocytes and control of B and T cell differentiation), miR-200a (regulation of immune response). [score:7]
miR-200a, miR-34c and miR-34b-3p were identified as regulators of the immune response and part of the p53 tumor suppressor network, respectively [49]. [score:4]
MiR-122, miR-451 and miR-494 were detected in liver, miR-494, miR-691 and miR-143 in spleen, and miR-223, miR-200a and miR-322 in lung. [score:1]
[1 to 20 of 3 sentences]