sort by

122 publications mentioning mmu-mir-18a (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-18a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 231
analysis revealed that PTEN expression was repressed by transfection with miR-18a mimics or si-TP53TG1#1, while PTEN expression was facilitated following miR-18a downregulation or TP53TG1 upregulation (Fig.   5a, b). [score:11]
In our study, the data showed that miR-18a expression was markedly upregulated and miR-18a expression was inversely correlated with TP53TG1 expression in NSCLC tissues. [score:10]
Additionally, qRT-PCR assay displayed that TP53TG1 and PTEN mRNA levels were upregulated, while miR-18a expression was downregulated in tumors derived from lenti-TP53TG1 -transfected A549/DDP cells with or without cisplatin treatment (Fig.   6c). [score:8]
Moreover, miR-18a -induced decrease of luciferase activity of PTEN-WT vector was remarkably reversed by TP53TG1 upregulation, while anti-miR-18a-triggered increase of luciferase activity of PTEN-WT vector was evidently counteracted following TP53TG1 downregulation (Fig.   5c, d). [score:7]
Furthermore, TP53TG1 overexpression resulted in a decrease of miR-18a expression and an increase of PTEN expression in resected tumors derived from A549/DDP cells with or without cisplatin treatment. [score:7]
Our study revealed that miR-18a negatively regulated PTEN expression in A549 cells and PTEN level was significantly downregulated in NSCLC tissues. [score:7]
TP53TG1 suppressed miR-18a expression in NSCLC cells by direct interaction. [score:6]
A previous document has verified that the tumor suppressor phosphatase and tensin homolog (PTEN) was a direct target of miR-18a [16]. [score:6]
These data displayed that TP53TG1 -induced apoptosis was greatly lowered in A549/DDP cells after up-regulation of miR-18a (Fig.   4e), while si-TP53TG1-elicited reduction on apoptosis was significantly reverted following the regaining of miR-18a expression in A549 cells (Fig.   4f). [score:6]
All these data indicated that TP53TG1 sensitized NSCLC cells to cisplatin by enhancing apoptosis via suppressing miR-18a expression. [score:5]
Whereas, no evident effects was observed in the luciferase activity of TP53TG1-MUT following miR-18a upregulation or knockdown (Fig.   3c, d). [score:5]
These results discovered that TP53TG1 -mediated increase of cisplatin sensitivity and apoptosis was abated following the restoration of miR-18a expression in A549/DDP cells, while si-TP53TG1 -induced decrease of cisplatin sensitivity and apoptosis was antagonized after transfection miR-181a inhibitor in A549 cells. [score:5]
Fig.  3TP53TG1 inhibited miR-18a expression in NSCLC cells. [score:5]
TP53TG1 suppressed miR-18a expression in A549 cells. [score:5]
Moreover, miR-18a expression was inversely correlated with TP53TG1 expression in NSCLC tumor tissues (Fig.   3j). [score:5]
Moreover, TP53TG1 -mediated enhancement effect on cisplatin sensitivity was abated following the restoration of miR-18a expression in A549/DDP cells, while si-TP53TG1 -induced decrease of cisplatin sensitivity and apoptosis was counteracted by miR-18a inhibitor in A549 cells. [score:5]
MTT assay revealed that TP53TG1 -induced decrease of IC50 of cisplatin was strikingly recovered by miR-18a overexpression in A549/DDP cells (Fig.   4c), while si-TP53TG1-triggered increase of IC50 of cisplatin was remarkably abrogated by miR-18a downregulation (Fig.   4d). [score:5]
Taken together, these results indicated that TP53TG1 could inhibit miR-18a expression in NSCLC cells. [score:5]
Furthermore, TP53TG1 promoted PTEN expression via inhibiting miR-18a. [score:5]
Subsequent luciferase reporter experiments, RNA pull-down analysis, RIP and qRT-PCR assay confirmed that TP53TG1 suppressed the expression of miR-18a via direct interaction. [score:5]
qRT-PCR assay of miR-18a expression (e) and PTEN expression pattern (f) in HBE, A549 and A549/DDP cells. [score:4]
It was reported that PTEN was a direct target of miR-18a in multiple cancers, such as luminal breast cancer [16]. [score:4]
As shown in Fig.   3g, qRT-PCR assay displayed that miR-18a level was markedly repressed after TP53TG1 was upregulated, while miR-18a expression was remarkably promoted following TP53TG1 depletion compared with their counterparts respectively. [score:4]
These data demonstrated that miR-18a expression was significantly increased (Fig.   3h) in NSCLC tumor tissues compared with normal tissues, and miR-18a expression in DDP-resistant group was about threefold than that in control group (Fig.   3i). [score:4]
Interestingly, qRT-PCR results also revealed that miR-18a expression was significantly increased in A549 cells compared with HBE cells, and it was markedly upregulated in A549/DDP cells when compared to A549 cells (Fig.   1e). [score:4]
Fig.  4TP53TG1 -induced cisplatin sensitivity of NSCLC cells was decreased following miR-18a upregulation. [score:4]
Additionally, a recent document demonstrated that miR-18a level was significantly associated with therapeutic response, and miR-18a downregulation sensitized NSCLC cells to radiation treatment [20]. [score:4]
Fig.  5TP53TG1 regulated PTEN expression through miR-18a in NSCLC cells. [score:4]
TP53TG1 regulated PTEN expression in NSCLC cells by acting as a molecular sponge of miR-18a. [score:4]
g qRT-PCR assay of miR-18a expression in A549 cells transfected with si-TP53TG1#1 or pcDNA-TP53TG1 for 48 h. h qRT-PCR assay of miR-18a expression in 40 pairs of NSCLC samples. [score:3]
j The correlation between TP53TG1 and miR-18a expression was detected in NSCLC samples. [score:3]
qRT-PCR analysis was used to detect the expression of TP53TG1, miR-18a and PTEN mRNA in NSCLC tissues and cells. [score:3]
A mutation in the miR-18a -binding site sequence of TP53TG1-WT was created using a Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA, USA) to generate TP53TG1 mutant-type reporter vector (TP53TG1-MUT). [score:3]
a PTEN expression was assessed by western blot in A549 cells transfected with miR-18a mimics or anti-miR-18a. [score:3]
qRT-PCR analysis presented that TP53TG1 -induced reduction of miR-18a expression was markedly restored by cotransfection with miR-18a mimics in A549/DDP cells (Fig.   4a), while si-TP53TG1#1-triggered promotion of miR-18a level was significantly reversed by cotransfection with anti-miR-18a in A549 cells (Fig.   4b), in comparison to their counterparts. [score:3]
In a word, these findings demonstrated that TP53TG1 contributed to PTEN expression via modulating miR-18a in NSCLC cells. [score:3]
All miRNA mimics (miR-18a mimics, miR-NC), miRNA inhibitors (anti-miR-NC, anti-miR-18a), and si -RNAs (si-NC, si-TP53TG1#1 and si-TP53TG1#2) were designed and synthesized by Sigma-Aldrich (St. [score:3]
TP53TG1 -mediated cisplatin sensitivity was abated following the restoration of miR-18a expression in NSCLC cells. [score:3]
Furthermore, the enhancement effect of TP53TG1 on cisplatin sensitivity might be mediated by miR-18a/PTEN axis in NSCLC cell line, indicating a potential target for improving NSCLC chemotherapy. [score:3]
Firstly, the effect of miR-181a and TP53TG1 on PTEN expression was explored in A549 cells by transfecting with miR-18a mimics, anti-miR-18a, si-TP53TG1#1 or pcDNA-TP53TG1. [score:3]
Then, we further measured the expression of miR-18a, and the interaction between TP53TG1 and miR-18a expression in NSCLC samples. [score:3]
qRT-PCR reactions were performed to detect TP53TG1, miR-18a and PTEN mRNA expression using SuperScript Platinum SYBR™ Green One-Step qRT-PCR Kit (Invitrogrn) on an 7900HT Fast Real-Time PCR System (Applied Biosystems). [score:3]
All these results made us draw a conclusion that TP53TG1 enhanced the sensitivity of cisplatin in NSCLC via regulation of miR-18a/PTEN pathway. [score:2]
Non-small cell lung cancer (NSCLC) Cisplatin Drug sensitivity Tumor protein 53 target gene 1 (TP53TG1) MiR-18a PTEN Non-small cell lung cancer (NSCLC), a heterogeneous class of tumors, represents approximately 85% of all new lung cancer diagnoses [1]. [score:2]
Data showed that the luciferase activity of TP53TG1-WT was significantly suppressed by transfection with miR-18a mimics (Fig.   3c), while it was obviously promoted when introducing with anti-miR-18a (Fig.   3d) compared with corresponding counterparts. [score:2]
Thus, we further observed whether TP53TG1 regulated miR-18a/PTEN axis in NSCLC cells. [score:2]
All these results implied that TP53TG1 regulated miR-18a/PTEN axis in NSCLC cells. [score:2]
i qRT-PCR assay of miR-18a expression in DDP-sensitive NSCLC tissues and DDP-resistant NSCLC samples. [score:2]
A549/DDP cells were transfected with pcDNA-TP53TG1 alone or together with miR-18a mimics, followed by qRT-PCR assay of miR-18a expression (a), MTT analysis of IC50 of cisplatin (c) and flow cytometry analysis of apoptotic rate (e). [score:2]
These data showed that luciferase activity of PTEN-WT vector was significantly inhibited by introduction with miR-18a mimics, while it was substantially promoted after miR-18a depletion compared with homologous control (Fig.   5c, d). [score:2]
c, d The luciferase activity was detected in A549 cells transfected with TP53TG1-WT or TP53TG1-MUT and miR-con, miR-18a mimics, anti-miR-con or anti-miR-18a. [score:1]
TP53TG1 increased the sensitivity of NSCLC cells to cisplatin by modulating miR-18a/PTEN axis, elucidating a novel approach to boost the effectiveness of chemotherapy for NSCLC. [score:1]
A549 cells were introduced with si-TP53TG1#1 alone or together with anti-miR-18a, followed by measurement of miR-18a expression by qRT-PCR (b), determination of IC50 of cisplatin by MTT (d), detection of apoptotic rate by flow cytometry (f). [score:1]
In total, these findings suggested that TP53TG1 increased the sensitivity of NSCLC cells to cisplatin through repressing miR-18a. [score:1]
a Sequence alignment of miR-18a with the putative binding sites within the wild-type regions of TP53TG1. [score:1]
To verify the direct binding between miR-18a and TP53TG1, dual-luciferase reporter assay, and were performed in A549 cells. [score:1]
was performed by transfecting PTEN-WT vector into A549 cells together with miR-18 mimics or miR-18a mimics + pcDNA-TP53TG1 (c), and anti-miR-18a or anti-miR-18a + si-TP53TG1#1 (d). [score:1]
The data presented that TP53TG1 harbored seven conserved cognate sites of miR-18a, predicting that TP53TG1 might serve as a ceRNA of miR-18a. [score:1]
Then, A549 cells were cotransfected with TP53TG1-WT or TP53TG1-MUT and miR-18a mimics or anti-miR-18a. [score:1]
Thus, we further explored whether the enhancement effect of TP53TG1 on cisplatin sensitivity was mediated by miR-18a in NSCLC cell line. [score:1]
c qRT-PCR analysis of TP53TG1, miR-18a and PTEN mRNA levels in excised tumor tissues. [score:1]
RNA pull-down results displayed that miR-18a enrichment in Bio-TP53TG1-probe group was significantly higher than negative control group (Fig.   3e). [score:1]
Furthermore, TP53TG1 -induced sensitivity of cisplatin to NSCLC cells might be mediated by miR-18a/PTEN axis. [score:1]
To further explore whether the enhancement effect of TP53TG1 on cisplatin sensitivity of NSCLC was mediated by miR-18a, A549/DDP cells were transfected with pcDNA-TP53TG1 alone or together with miR-18a mimics, and A549 cells were transfected with si-TP53TG1#1 alone or together with anti-miR-18a. [score:1]
The sequences of TP53TG1 containing the putative binding sites of miR-18a and the 3′-UTR of PTEN containing the intact miR-18a recognition sequence, were amplified by PCR and cloned into pGL3 vector (Promega, Madison, WI, USA) to generate TP53TG1 wild-type reporter vector (TP53TG1-WT) and PTEN wild-type reporter vector (PTEN-WT), respectively. [score:1]
MiR-18a, a member of the oncogenic miR-17-92 cluster, has been found to be involved in a variety of human cancers, including NSCLC. [score:1]
Interestingly, the data stated that there existed complementary sequences between miR-18a and TP53TG1 (Fig.   3a). [score:1]
[1 to 20 of 67 sentences]
2
[+] score: 200
Other miRNAs from this paper: mmu-mir-17
Figure 6miR-18a suppresses liver metastasis of colon cancer triggered by direct targeting of Irf2 expressed in Kupffer cells(A) Schematic diagram of the putative binding sites of miR-18a in the wide type (WT) IRF2 3′ untranslated regions (UTR). [score:10]
miR-18a suppresses liver metastasis of colon cancer triggered by direct targeting of Irf2 expressed in Kupffer cells. [score:8]
The RAW264.7 cells transfected with OGNVs/miR-18a have significantly down-regulated IRF2 mRNA expression (Figure 6B) as well as IRF2 protein expression (Figure 6C, 6D). [score:8]
Our previous study published showed that miR-18a suppresses colon tumor growth by targeting β-catenin expressed in the colon tumor cells. [score:7]
miR-18a suppresses liver metastasis of colon cancer triggered by directly targeting IRF2. [score:6]
Collectively, miR-18a treatment promoted induction of M1 macrophages (F4/80 [+]IFNγ [+] and F4/80 [+]IL-12 [+]) with upregulated co-stimulatory factors such as CD80, and iNOS while inhibiting M2 macrophages (F4/80 [+]TGFβ [+], F4/80 [+]IL-10 [+]) in the liver of metastatic colon tumor bearing mice. [score:6]
Therefore, genes targeted by miR-18a in KCs are unlikely the same ones if miR-18a is overexpressed in other types of cells such as hepatocytes. [score:5]
The molecular mechanisms involved in miR-18a -induced M1 macrophages were further studied and we found that miR-18a -mediated induction of macrophage IFNγ is required for inhibition of liver metastasis of colon cancer and that macrophage IRF2 is targeted by miR-18a. [score:5]
The three public miRNA databases (TargetScan, Pictar, and MicroRNA) all predicted that Irf2 might be a target for miR-18a; the 3′-UTR of Irf2 contains a highly conserved binding site from position 1668 to 1682 for miR-18a (Figure 6A). [score:5]
We attempted to predict the potential target genes of miR-18a through applying a bioinformatics analysis method (TargetScan). [score:5]
Therefore, increasing IRF-1/IRF-2 ratios by targeted delivery of miR-18a to IRF2 overexpressed macrophages is expected to induce IFNγ. [score:5]
miR-18a mediated inhibition of the growth of liver metastasis of colon tumor cells is IFNγ dependent. [score:3]
To further clarify the role of NK, NKT and T cells on the inhibition of tumor metastasis caused by miR-18a, NOG mice which are deficient for NK, NKT, and T cells were challenged with CT26 tumor cells using the identical protocol described for induction of liver metastasis of colon cancer in a wild-type BALB/c mouse mo del (Figure 2). [score:3]
We identified miR-18a as a previously unrecognized inhibitor for liver metastasis through the induction of M1 macrophage. [score:3]
On day 14 after tumor cell inoculation, OGNVs/miR-18a treatment showed no evidence of inhibiting tumor growth in IFNγ KO mice. [score:3]
It was reported that miR-18a could act as a tumor suppressor. [score:3]
We further demonstrate that miR-18a delivered by GNVs inhibits the growth of colon tumors that have metastasized to the liver by polarizing KCs to M1 cells (F4/80 [+]IFNγ [+]IL-12 [+]). [score:3]
In contrast, the data generated from nude mice (Figure 5F) which have both NK and NKT cell activity suggest that NK and NKT cells play a critical role in the inhibition of tumor metastasis caused by miR-18a. [score:3]
This finding led us to choose miR-18a as an example to test whether a grapefruit-derived nanovector (GNV) based delivery system can be used for targeted delivery of therapeutic miRNA to liver macrophages and treat liver metastasis. [score:3]
Evidence for the effect of miR-18a on induction of F4/80 [+]IL-12 [+] was not obtained in IFNγ KO mice although the expression of TGFβ was still repressed by miR-18a (Figure 5C). [score:3]
miR-18a -mediated inhibition of the growth of liver metastasis of colon tumor cells is IFNγ dependent. [score:3]
miR-18a encapsulated in OGNVs inhibits liver metastasis of colon cancer and induces Kupffer cell polarization into M1. [score:3]
To determine whether miR-18a could target Irf2 in macrophage cells, we transfected the mouse mature miR-18a mimic into BALB/c-derived macrophage-like RAW264.7 cells. [score:3]
It has been reported that over expression of miR-18a in hepatocytes may contribute to the pathogenicity of liver cancer [45]. [score:3]
We found Irf2, a theoretical target gene of miR-18a with the specific binding site in the 3′-UTR sequence. [score:3]
The inhibition of liver metastatic tumor growth in CT26 tumor bearing mice treated with OGNV-miR18a was also demonstrated. [score:3]
We first searched miRNA databases for potential miR-18a targets that may possibly contribute to IFNγ induction. [score:3]
The exploitation of the liver macrophages to mediate the immune therapeutic effects of miRNA, such as miR-18a delivered by GNVs, can circumvent limitations of miRNA targeted delivery. [score:3]
Collectively, these results suggest that F4/80 [+]IL-12 [+] cells induced by OGNV-miR-18a plays a crucial role in the inhibition of liver metastasis of colon cancer. [score:3]
Consistent with flow cytometry results, OGNV-miR18a treatment dramatically increased the level of genes encoding IFNγ, IL-12, CD80, inducible nitric oxide synthase (iNOS), and decreased TGFβ expressed in F4/80 KCs isolated from metastatic liver (Figure 2D). [score:3]
This role of IL-12 was also supported in NOG mice injected with CT26 colon tumor cells by the fact that miR-18a delivered by GNVs does not inhibit the growth of colon tumors that have metastasized to the liver. [score:3]
In combination with data generated from macrophage depletion, IFNγ KO mice and NOG and nude mice, these data suggest that miR-18a delivered by OGNVs initially induces expression of IFNγ in macrophages, which is required for induction of macrophage IL-12. [score:3]
Moreover, overexpression of anti-sense (AS) miR-18a caused induction of luciferase and no inductive effect of AS-miR-18a on the activity of the reporter when a mutant 3′UTR of Irf2 was detected. [score:3]
As expected, multi-administration of OGNVs-miR-18a did not lead to inhibition of tumor metastasis in the NOG mice (Figure 5D) although F4/80 [+]IFNγ [+], F4/80 [+]IL-12 [+] and F4/80 [+]MHCII [+] cells (Figure 5E) were still induced. [score:3]
The data presented in this study suggest that liver macrophages are preferentially targeted by GNV, and miR-18a delivered by GNVs to promote liver anti-tumor M1 macrophages induction. [score:3]
Overexpression of miR-18a decreased the luciferase activity of the reporter with 3′UTR of Irf2 by about 60% in RAW264.7 cells (Figure 6H). [score:3]
Consistent with in vivo results, neutralizing IL-12 in the supernatants of miR-18a pre -transfected IL-12 [+] RAW264.7 macrophage-like cells (Supplementary Figure S5) co-cultured with primary spleen NKT cells led to a significant reduction of IFNγ expressed in the NKT cells (Supplementary Figure S5). [score:3]
These results demonstrate that Irf2 is a target of miR-18a in macrophages. [score:3]
However, mutation that disrupted the binding site for miR-18a entirely restored luciferase activity. [score:2]
To identify whether the anti-tumor activity of miR-18a was directly mediated by liver macrophages, mice were repeatedly treated with clodronate liposome as described in Figure 4A to deplete macrophages before an intra-splenic injection of CT26 cells. [score:2]
To ascertain the direct effect of miR-18a on Irf2, a mutant construct that would disrupt the predicted miR-18a binding site was generated from pEZX-MT01- Irf2 containing a 1,234 bp length 3′UTR of Irf2 mRNA (Gene Accession: NM_008391.4). [score:2]
In this study, our main finding is highlighted in a novel regulatory mechanism of M1 macrophage functioning along the IFN-γ/ Irf2 axis mediated by miR-18a (Supplementary Figure S7). [score:2]
Figure 3Induction of IFNγ [+]NK and IFNγ [+]NKT by OGNVs-miR-18aFrequency of IFNγ [+] cells in liver CD3 [+]Dx5 [+] (NKT) cells, CD3 [−]Dx5 [+] (NK) cells, and CD3 [+]Dx5 [−] (T) cells from CT26 liver metastasis mice treated with OGNVs-Ctrl, OGNVs-miR-18a with/without IL-12 siRNA knockdown assessed by flow cytometry (Left); Right, quantification of FACS analyzed results; each symbol represents an individual mouse. [score:2]
To determine whether the effect of miR-18a against liver metastasis of colon cancer results from induction of KC IFNγ, CT26 colon carcinoma cells were intra-splenic injected into IFNγ knock out (KO) mice. [score:2]
Alternatively, it is possible that as a result of miR-18a -mediated down regulation of levels of IRF2, the level of IRF1 is increased. [score:2]
Frequency of IFNγ [+] cells in liver CD3 [+]Dx5 [+] (NKT) cells, CD3 [−]Dx5 [+] (NK) cells, and CD3 [+]Dx5 [−] (T) cells from CT26 liver metastasis mice treated with OGNVs-Ctrl, OGNVs-miR-18a with/without IL-12 siRNA knockdown assessed by flow cytometry (Left); Right, quantification of FACS analyzed results; each symbol represents an individual mouse. [score:2]
Our real-time PCR data showed that the level of miR-18a in hepatocytes was not increased following an intravenous administration of OGNVs/miR-18a. [score:1]
The effects of miR-18a on the polarization of M1 versus M2 macrophages have not been reported. [score:1]
FISH (fluorescence in situ hybridization)To visualize biotin conjugated miR-18a in the liver, tissue sections were deparaffinized and rehydrated. [score:1]
MiR-18a, an important member of miR-17–92 family, has been shown various effects on different tumors. [score:1]
Induction of IFNγ [+]NK and IFNγ [+]NKT by OGNVs-miR-18a. [score:1]
Given the profound anti-colon tumor metastasis effect of miR-18a delivered by OGNVs, how miR-18a induces the expression of IFNγ in macrophages required further investigated. [score:1]
miR-18a treatment led to increasing percentages of F4/80 [+]IFNγ [+], F4/80 [+]IL-12 [+], F4/80 [+]CD80 [+], and decreasing percentages of F4/80 [+] transforming growth factor beta (TGFβ) [+], F4/80 [+]CD206 [+] and F4/80 [+] IL-10 [+] detected in the liver metastatic tumor bearing mice (Figure 2B). [score:1]
Liver KCs (Figure 1A–1D) but not hepatocytes (Figure 1E) take up OGNVs carrying miR-18a after a tail vein injection. [score:1]
We found that liver macrophages are polarized to M1 macrophages after miR-18a is delivered by OGNVs. [score:1]
This increase is specific since the percentages of F4/80 [+]CD86 [+] cells present in the liver of tumor bearing mice treated with OGNVs/Ctrl alone were no different from those treated with OGNVs-miR18a (Figure 2B). [score:1]
Depletion of macrophages restricted the response of miR-18a against liver metastasis. [score:1]
Mice treated with OGNVs/control (Ctrl)-miRNA alone and OGNVs/miR18a were similar in liver size and weight (Figure 5A). [score:1]
The miR-18a seed matches in the IRF2 3′UTR are mutated at the positions as indicated. [score:1]
The role of miR-18a in macrophage polarization is unknown but immunomodulation of dendritic cell function of miR-18a has been described [42, 43]. [score:1]
On day 14 after an intra-splenic injection of CT26 colon tumor cells, the number and size of tumor nodules in the liver of mice treated with vehicle were significantly increased in comparison with mice treated with OGNV-miR18a (Figure 2E). [score:1]
To visualize biotin conjugated miR-18a in the liver, tissue sections were deparaffinized and rehydrated. [score:1]
Subsequently, macrophage IL-12 amplifies the miR-18a -mediated anti-tumor activity by activation of liver NK and NKT cells in an IFNγ dependent manner. [score:1]
These in vitro results were further confirmed in the liver KCs isolated from liver metastasis in CT26 mice administrated OGNVs/miR-18a (Figure 6G). [score:1]
The effects of miR-18a on induction on IFNγ [+]IL-12 [+]KCs (Figure 5G) and IFNγ [+]NK [+] cells (Figure 5H) has no impact in T cell deficient nude mice. [score:1]
miR-18a mediated induction of M1 IFNγ [+] is required for production of IL-12. [score:1]
Collectively, these results indicate that KC IFNγ is an upstream cytokine of IL12 for miR-18a mediated induction of M1 macrophages. [score:1]
This conclusion is also supported by the fact that there were fewer liver tumor foci, the liver weighed less in OGNV-miR18a treated mice (Figure 2F) and these mice had a significantly prolonged survival (Figure 2G). [score:1]
To further demonstrate the role of macrophage-derived IL-12 induction of IFNγ [+]NK and IFNγ [+]NKT, mice treated with OGNVs co-encapsulating miR-18a and IL-12 siRNA but not encapsulating IL-12 siRNA alone resulted in significant reduction of liver IFNγ [+] NK and IFNγ [+]NKT, but had no effect on IFNγ [+]CD3 [+]DX5 [−] T cells (Figure 3). [score:1]
This could be due to OGNVs/miR-18a primarily being taken up by KCs. [score:1]
Therefore, we set out to determine whether miR-18a delivered by OGNVs has a biological effect on liver metastasis of colon cancer as an example. [score:1]
We also found IFNγ induction by OGNVs/miR-18a following reduction of Irf2 (Figure 6C). [score:1]
KC IFNγ is required for miR-18a -mediated induction of IL-12. [score:1]
miR-18a encapsulated in OGNVs (OGNVs-miR-18a) induces M1 Kupffer cells. [score:1]
In this study, using miR-18a as an example, we found that optimized GNVs (OGNVs) are capable of encapsulating miR-18a and the ability was significantly increased by short pre-exposure of the GNVs mixed with miR-18a buffered with an optimized concentration of Na [+] with exposure to ultraviolet (UV) light. [score:1]
These results provide new insights into the molecular mechanisms of miR-18a -mediated macrophage polarization and shed light on new therapies for cancers through a miR-18a -mediated induction of M1 macrophages. [score:1]
Depletion of macrophages (Figure 4B, 4C) abolished the anti-tumor activity of miR-18a, and the miR-18a -mediated anti-tumor activity was restored by adoptive transfer of macrophage-like RAW264.7 cells (Figure 4D). [score:1]
The data generated from FACS analysis indicated that at day 2 after OGNV-miR-18a treatment, both IFNγ [+] NKT (CD3 [+]DX5 [+]) and IFNγ [+]NK (CD3 [−]DX5 [+]) but not T(CD3 [+]DX5 [−]) cells were significantly induced; whereas, on day 14 induction of IFNγ [+] CD3 [+]T cells was dominant (Figure 2H). [score:1]
OGNV-miR18a treatment, as described in Figure 2A, led to an increase in the percentages of F4/80 [+] major histocompatibility complex (MHC)II [+], F4/80 [+]IL-12 [+] (M1), F4/80 [+]interferon gamma (IFNγ) [+] and F4/80 [+]CD80 [+] cells (Figure 2B). [score:1]
[1 to 20 of 79 sentences]
3
[+] score: 126
In contrast, collagen 1A1 and 3A1 transcription was not affected by either miR-18a and miR-19b overexpression or inhibition in neonatal rat cardiomyocytes and cardiac fibroblasts (NRCFs), indicating that collagen expression in cardiac fibroblasts is unrelated to these miRNAs (Fig. 6B). [score:7]
For the overexpression or inhibition of miR-18a and miR-19b, NRCMs and NRCFs were transfected with 80 nm miRIDIAN hairpin inhibitor (antagomiR) miR-18a (#IH-300487-06) or miR-19b (#IH-300489-05), or with miRIDIAN mimic miR-18a (#C-300487-05), or miR-19b (#C-300489-03) (Dharmacon, Colorado, CO, USA). [score:7]
In line with reduced expression levels in failing hearts of old mice, decreased miR-18a, miR-19a, and miR-19b expression was associated with severe heart failure at old age (Fig. 3A), while miRNA expression in old patients with a preserved function was not different from young ICM patients (Fig. 3A). [score:7]
Together, these data suggest that regulation of CTGF and TSP-1 is the result of the shared expression of miR-18a, miR-19a, and miR19b, enabling modest changes in miRNA expression to control transcriptional repression. [score:6]
The pro-oncogenic activity of miR-17–92 partially involves the regulation of the ECM proteins CTGF and thrombospondin-1 (TSP-1) by the cluster members miR-18 and miR-19, through sequence-specific targeting within the 3′-untranslated region (3′-UTR) of these gene transcripts (Supporting information Fig. S1) (Dews et al., 2006). [score:6]
Thus, in concordance with CTGF and TSP-1 regulation by miR-18a and miR-19b in cardiomyocytes, these data strongly imply that miR-18a and miR-19b contribute to the induction of collagen synthesis in aged cardiomyocytes via the regulation of the pro-fibrotic CTGF and TSP-1. Fig. 6MiR-18a and miR-19b regulate collagen 1A1 and 3A1 expression in cardiomyocytes in vitro. [score:6]
Thus, in concordance with CTGF and TSP-1 regulation by miR-18a and miR-19b in cardiomyocytes, these data strongly imply that miR-18a and miR-19b contribute to the induction of collagen synthesis in aged cardiomyocytes via the regulation of the pro-fibrotic CTGF and TSP-1. Fig. 6MiR-18a and miR-19b regulate collagen 1A1 and 3A1 expression in cardiomyocytes in vitro. [score:6]
In conclusion, our study is the first to show that miRNA expression of the miR-17–92 cluster changes with cardiac aging and associates decreased miR-18a, miR-19a, and miR-19b expression with age-related remo deling in the heart. [score:5]
Overexpression of miR-18a and miR-19b, using miRNA mimics, resulted in significant repression of CTGF and TSP-1 mRNA and protein expression in cardiomyocytes (Fig. 5F and G; Supporting information Fig. S3A). [score:5]
In cardiac fibroblasts, overexpression of miR-18a and miR-19b also decreased CTGF and TSP-1 transcription; however, inhibition of these miRNAs was not sufficient to increase CTGF and TSP-1. This may be attributed to the fact that a fibroblast produces large amounts of CTGF and TSP-1 while it contains relatively low amounts of miR-18a and miR-19b. [score:5]
Indeed, overexpression of miR18a and miR-19b in cardiomyocytes repressed collagen 1A1 and 3A1 mRNA levels, while inhibition of these miRNAs using antagomirs significantly enhanced collagen transcription (Fig. 6A). [score:5]
Here, miRNA mimics of miR-18a and miR-19b blunted the expression of CTGF and TSP-1, and vice versa, inhibition of these miRNAs enhanced CTGF and TSP-1 levels. [score:5]
Our in vitro results support a role for miR-18a, miR-19a, and miR-19b in regulating CTGF and TSP-1 expression in the aged cardiomyocyte. [score:4]
At 104 weeks of age, HF-prone mice had significantly reduced expression levels of miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1 as compared to 12-week littermates (Fig. 2C and Supporting information Table S1), coinciding with the observed increased presence of their targets TSP-1 and CTGF. [score:4]
These results imply that the age-related regulation of CTGF and TSP-1 expression by miR-18a and miR-19b in the heart is uniquely restricted to the cardiomyocyte to control its surrounding ECM. [score:4]
Importantly, the abundant expression of miR-18a and miR-19b in cardiomyocytes coincides with low levels of CTGF and TSP-1, whereas in cardiac fibroblasts, relatively low levels of miR-18a and miR-19b were associated with high CTGF and TSP-1 transcription (Fig. 5E). [score:3]
This, together with miR-18 and miR-19 targeting CTGF and TSP-1 and the fact that ECM proteins are crucial for healthy cardiac aging, has led us to hypothesize that these miRNAs play a role in age-related cardiac remo deling. [score:3]
These findings confirm the expression profiles in aged HF-prone mice and again suggest that miR-18a, miR-19a, and miR-19b could transcriptionally repress CTGF and TSP-1 levels in cardiomyocyte aging and HF at old age. [score:3]
MiR-18a and miR-19b are abundantly expressed in the adult mouse heart and are predominantly localized in the perinuclear area of cardiomyocytes (Fig. 5A–C). [score:3]
CTGF and TSP-1 have been identified as target genes of the miR-17–92 cluster (Dews et al., 2006), more specifically of the cluster members miR-18a and miR-19a/b (Suarez et al., 2008; Ohgawara et al., 2009). [score:3]
The miR-18/19 – CTGF/TSP-1 axis is regulated in aged cardiomyocytes in vitroTo gain further insight into the role of the miR-17–92 cluster in aging of cardiomyocytes, neonatal rat cardiomyocytes (NRCMs) were aged in vitro, and miRNA levels were determined. [score:2]
The miR-18/19 – CTGF/TSP-1 axis is regulated in aged cardiomyocytes in vitro. [score:2]
Next, we performed a series of functional studies to determine the role of miR-18a and miR-19b in the regulation of CTGF and TSP-1 and collagen production in cardiomyocytes and cardiac fibroblasts. [score:2]
Cardiomyocyte CTGF and TSP-1 and collagen production are regulated by miR-18/19. [score:2]
The miR-18/19 – CTGF/TSP-1 axis is regulated in human age -associated heart failure. [score:2]
These results show that regulation of CTGF and TSP-1 by miR-18a and miR-19b is uniquely restricted to the cardiomyocyte. [score:2]
Therefore, we investigated whether age-related changes in miR-18a, miR-19a, and miR-19b expression regulate CTGF, TSP-1, and collagen levels in rodent mo dels of aging -associated heart failure and in the human failing heart. [score:2]
The three miR-17–92 cluster members miR-18a, miR-19a, and miR-19b specifically target the ECM proteins CTGF and TSP-1. To investigate the role of these genes in human HF, we studied their expression profiles in cardiac biopsies of idiopathic cardiomyopathy (ICM) patients at old age with a moderately decreased or preserved systolic function (ejection fraction (EF) between 40 and 55%) (Paulus et al., 2007) and severely impaired cardiac function (EF < 30%) and compared them to young ICM subjects. [score:2]
Fig. S3 CTGF and TSP-1 transcripts are regulated by miR-18a and miR-19b in cardiomyocytes. [score:2]
This was corroborated by the finding that miR-18a and miR-19b expression was higher in cardiomyocytes compared to cardiac fibroblasts (Fig. 5D). [score:2]
From the six members of the miR-17–92 cluster, miR-18a, miR-19a, and miR-19b were among the most strongly repressed miRNAs in aged cardiomyocytes and hearts of old failure-prone mice. [score:1]
CTGF, TSP-1, miR-18a, miR-19a, and miR-19b levels in aged HF-resistant (12 weeks, n = 8; 52 weeks, n = 8; and 104 weeks, n = 9) and HF-prone mice (12 weeks, n = 6; 52 weeks, n = 11; and 104 weeks, n = 9). [score:1]
Importantly, miR-18a, miR-19a, and miR-19b were among the most strongly repressed miRNAs. [score:1]
Vice versa, blunting of miR-18a and miR-19b using antagomirs was sufficient to increase CTGF and TSP-1 transcript and protein levels in cardiomyocytes (Fig. 5F, G; Supporting information Fig. S3A). [score:1]
Cardiac fibroblasts demonstrated decreased CTGF and TSP-1 transcript levels upon introduction of miR-18a and miR-19b; however, this did not result in reduced protein levels (Fig. 5H, I). [score:1]
This cluster encodes six miRNAs (miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1) that are located within an 800-base pair region of human chromosome 13. [score:1]
Double DIG-labeled locked nucleic acid (LNA) hybridization probes complementary to mouse mature miR-18a (5DIGN/CTATCTGCACTAGATGCACCTTA/3DIG_N) (#38462-15), miR-19b (5DIGN/TCAGTTTTGCATGGATTTGCACA/3DIG_N) (#38092-15), and a scrambled probe (5DIGN/GTGTAACACGTCTATACGCCCA/3DIG_N) (#99004-15) were purchased from Exiqon (Vedbaek, Denmark). [score:1]
RT-PCR analysis for the induction collagen 1A1 (COL1A1) and collagen 3A1 (COL3A1) in cultured neonatal rat cardiomyocytes and cardiac fibroblasts after manipulation with miR-18a and miR-19b mimics and antagomirs. [score:1]
RT-PCR analysis of miR-18a, miR-19a, miR-19b, CTGF, and TSP-1 transcript levels in myocardial biopsies from idiopathic cardiomyopathy (ICM) patients at older age with normal (n = 5) and severely impaired (n = 9) cardiac function. [score:1]
[1 to 20 of 39 sentences]
4
[+] score: 113
Other miRNAs from this paper: mmu-mir-20a, mmu-mir-17
This anti-metastatic pharmacological activity of Rd mechanistically in part implicates downregulated expression of TGFβ1 and derepression of miR-18a-regulated Smad2 expression in 4T1 cells. [score:9]
These results not only confirmed that Smad2 is a direct target of miR-18a in 4T1 cells, but also indicated miR-18a -mediated suppression of Smad2 expression is abrogated by Rd treatment. [score:8]
Given that TGF-β/Smad signaling is implicated in breast cancer metastasis 31 and miR-18a has been demonstrated to directly regulate Smad2 in neuroblastoma cells 28, we hypothesized that miR-18a -mediated regulation of Smad2 expression is involved in the suppressive effect of Rd treatment on breast cancer metastasis. [score:8]
Moreover, Smad2 is validated as a direct target of miR-18a and Rd treatment specifically abrogates miR-18a -mediated suppression of Smad2 in 4T1 cells. [score:6]
To clarify the possibility that cell cycle arrest might contribute to downregulated expression of miR-18a in Rd -treated 4T1 cells, the cell cycle distribution was analyzed in 4T1 cells treated with vehicle or Rd at 10, 50, 100 and 150 μM, respectively. [score:6]
Rd treatment results in increased expression of Smad2, decreased expression of miR-18a and increased activity of the luciferase reporter of Smad2 3′-UTR containing intact miR-18a seed region. [score:5]
Rd reduced the expression of miR-18a and increased the expression of Smad2 in cultured 4T1 cells and in 4T1 cell-derived tumors in mice. [score:5]
Given that significant reduction of miR-18a expression was observed in 4T1 cells treated by Rd at 50 μM (Fig. 7), it is possible that decreased expression miR-18a in Rd -treated 4T1 cells was independent of the influence of Rd on cell cycle distribution. [score:5]
How to cite this article: Wang, P. et al. Ginsenoside Rd attenuates breast cancer metastasis implicating derepressing microRNA-18a-regulated Smad2 expression. [score:4]
Together with the impact of Rd treatment on the expression of TGFβ signaling molecules, the anti-metastatic activity of Rd could implicate at least two mechanistic arms including derepressing miR-18a -mediated Smad2 regulation and lowering the expression of TGFβ1, with the latter remains to be further investigated for the involved mechanisms in the future studies. [score:4]
Our results verify the direct interaction of miR-18a and Smad2, indicating that Smad2 is a gene target of miR-18a in 4T1 mouse mammary carcinoma cells. [score:4]
Rd derepressed miR-18a -mediated downregulation of Smad2 in 4T1 cells. [score:4]
As aforementioned, miR-18a plays oncogenic roles in various types of cancer and Smad2 has been identified as a direct target of miR-18a in human neuroblastoma. [score:4]
As shown in Fig. 7A, Rd treatment dose -dependently caused significant decrease in the expression of miR-18a in cultured 4T1 cells. [score:3]
In addition, miR-18a expression in response to Rd treatment was analyzed. [score:3]
However, when Rd was delivered at higher doses, changes in cell cycle distribution might exert additionally impact on the expression of miR-18a in 4T1 cells. [score:3]
Rd treatment decreased miR-18a expression in cultured 4T1 cells and 4T1 cell-derived tumors. [score:3]
However, this miR-18a -mediated suppression of Smad2 3′-UTR luciferase reporter activity was not observed when the seed region of miR-18a was mutated. [score:3]
Typical kinetic updates were recorded at 1 h intervals for the duration of 48 h. To assess the impact of miR-18a expression on 4T1 cell migration, 4T1 cells were seeded in Essen ImageLock 96-well plates at the number of 2 × 10 [4] cells per well. [score:3]
Rd treatment also leads to decreased expression of miR-18a and increased mRNA and protein levels of Smad2 in both cultured 4T1 cells and 4T1 cell-derived tumors. [score:3]
These results indicated that Rd-treatment leads to decreased miR-18a expression both in vitro and in vivo. [score:3]
Rd treatment abrogated miR-18a -mediated suppression of Smad2 in 4T1 cells. [score:3]
To elucidate whether miR-18a was involved in Rd -mediated attenuation of breast cancer metastasis, the impact of miR-18a expression on 4T1 cell metastatic potential was first examined. [score:3]
*Compared to that from negative control mimic -transfected cells, p < 0.05. miR-18a expression in the absence or presence of Rd treatment was analyzed using real-time PCR in cultured 4T1 cells (A) and 4T1 cell-derived tumors (B). [score:2]
Next, miR-18a -mediated regulation of Smad2 was verified in 4T1 cells. [score:2]
Cells were transfected with 100 ng of reporter plasmid pmirGLO-Smad2 wt 3′-UTR or pmirGLO-Smad2 mut 3′UTR and 20 nM mmu-miR-18a mimic or negative control mimic in the presence or absence of 50 μM Rd. [score:1]
A fragment of 3′-UTR of Smad2 in the length of 303 bp containing the putative miR-18a binding site was amplified by PCR from genomic DNA, and then subcloned at the SacI and XhoI sites into pmirGLO vector (Promega, USA) immediately downstream to the luciferase gene sequence. [score:1]
Cells were transfected with negative control mimic or miR-18a mimic at concentration of 50 nM for 24 h. The monolayer of confluent cells was then scratched using the Essen WoundMaker to generate wound approximately 600 μm wide. [score:1]
miR-18a promoted 4T1 cell migration and invasion. [score:1]
A mutant construct containing 3′-UTR of Smad2 with deletion of miR-18a seed region was also synthesized through overlap extension PCR (OE-PCR) 42. [score:1]
Cells were then transfected with negative control mimic or miR-18a mimic at concentration of 50 nM for 24 h. The monolayer of confluent cells was then scratched using the Essen WoundMaker to generate wound approximately 600 μm wide and 50 μl of serum-free RPMI 1640-diluted matrigel was coated on the wound. [score:1]
Cells were then transfected with negative control mimic or miR-18a mimic at concentration of 50 nM for 24 h. The monolayer of confluent cells was then scratched using the Essen WoundMaker to generate wound approximately 600 μm wide. [score:1]
[1 to 20 of 32 sentences]
5
[+] score: 80
Other miRNAs from this paper: mmu-mir-18b
These results suggest that YKS reduces miR-18 expression and increases GR protein expression by downregulating the inhibitory effects of GR translation in the PVN of the hypothalamus after stress exposure. [score:12]
To obtain definitive evidence that this downregulation of miR-18 reduced inhibition of GR protein translation, we analyzed GR protein expression levels in the PVN of the hypothalamus. [score:10]
In conclusion, our findings suggest that YKS downregulates miR-18 expression and normalizes HPA axis activity by recovering GR protein expression in the hypothalamus of stress-exposed mice. [score:8]
In our stress mo del, miR-124a expression was unchanged in the hypothalamus and hippocampus, whereas miR-18 expression was only downregulated in the hypothalamus of stress-exposed mice with YKS pretreatment. [score:8]
In the present study, we provide the first evidence that YKS downregulates miR-18 expression in the hypothalamus after stress exposure and ultimately normalizes GR protein levels in the PVN, thus affecting HPA axis activity. [score:6]
Therefore, miR-18 expression may crucially control GR protein expression in the hypothalamus after stress exposure (Figures 3 and 4). [score:5]
In the brain, miR-18 and/or miR-124a posttranscriptionally regulate GR protein expression [22, 40, 41]. [score:4]
These findings indicate that YKS regulates miR-18 expression in the hypothalamus but has no effect on GR mRNA or miR-124a after stress exposure. [score:4]
The comparative CT method (ΔΔCt) was used to quantify the relative expression levels of miR-18 and 124a according to the manufacturer's instructions. [score:3]
We found that YKS pretreatment reduced miR-18 expression in the hypothalamus (Figure 3(a)). [score:3]
YKS Reduces miR-18 Expression in the Hypothalamus after Stress Exposure. [score:3]
In the present study, we demonstrate that YKS affects hypothalamic miR-18 expression levels in stress-exposed mice and investigate GR protein expression level in the paraventricular nucleus (PVN) of the hypothalamus in YKS-pretreated and stress-exposed mice. [score:3]
YKS pretreatment only reduced miR-18 expression in the hypothalamus (Figures 3(a) and 3(b)). [score:3]
Next, we determined if YKS is involved in the posttranscriptional regulation of GR protein levels by evaluating the effect of YKS on miR-18 and 124a expression in the hippocampus and the hypothalamus following stress exposure. [score:2]
Interestingly, miR-18 and/or miR-124a are candidate negative regulators of GRs in the brain [22]. [score:2]
Elucidating the functional roles of the YKS-miR-18-GR protein -regulating pathway in the PVN of the hypothalamus is a primary goal of future research. [score:2]
The finding of miR-18 reduction in the hypothalamus is in good agreement with a previous report [40]. [score:1]
Quantification of miR-18 and 124a. [score:1]
[1 to 20 of 18 sentences]
6
[+] score: 63
Fig. 5. Atm expression is upregulated in Dgcr8 and Dicer c KOs and a target of germline-expressed miR-18, as well as miR-183 and miR-16. [score:10]
The target sites of two other miRNAs, miR-183 and miR-16, clustered in the same region of the Atm 3′UTR as the miR-18 target sites; moreover, the miR-183 and miR-16 target sites were predicted as the second and third strongest sites, respectively, within Atm (Fig.  5C). [score:7]
Taken together, these results indicate that miR-18, miR-183, and miR-16 target sites in Atm are functional and effective at eliciting downregulation in response to very low levels of miRNA. [score:6]
Many miRNAs are predicted to target the Atm 3′UTR, but only three are also expressed in spermatocytes and show depletion in Dgcr8 and Dicer c KOs: miR-18, miR-183 and miR-16. [score:5]
Therefore, miR-18, miR-183 and miR-16 are the strongest candidates for miRNA -mediated regulation of Atm expression in mammalian spermatogenesis. [score:4]
To investigate the efficacy of miR-18 target sites in the Atm 3′UTR, we designed a luciferase reporter construct containing 431 nucleotides of the endogenous Atm 3′UTR sequence encompassing the two predicted miR-18 target sites. [score:3]
It is worth noting that the miR-18 target sites are located close to each other, an arrangement previously observed to mediate synergistic enhancements to repression by miRNAs (Grimson et al., 2007; Saetrom et al., 2007). [score:3]
miR-18, a member of Oncomir-1, targets heat shock transcription factor 2 in spermatogenesis. [score:3]
We measured reporter activity in a cell line that does not express miR-18 by co-transfecting the reporter plasmids with either an siRNA corresponding to miR-18 or a control siRNA corresponding to a miRNA that does not target Atm. [score:3]
Like the miR-18 target sites, the single site for miR-183 (Fig.  5F) and combined miR-16 sites (Fig.  5H) were able to mediate an ∼2-fold repression of the reporter construct at high-to-moderate concentrations (25-nM–1-nM) of miR-183 and miR-16 mimetic. [score:3]
We also identified alterations in many small RNAs, including miR-18, miR-183 and miR-16, among whose targets is the mRNA encoding ATM. [score:3]
Strikingly, the miRNA predicted to mediate the strongest repression of Atm was miR-18, a miRNA known to exhibit meiosis-preferential expression (Björk et al., 2010). [score:3]
Fold regulation mediated by miR-18 was calculated by generating reporter constructs containing mutations disrupting both predicted target sites (purple bars) and normalizing luciferase activity to this construct. [score:3]
Reporter constructs were transfected into A549 cells along with varying levels of siRNA duplexes corresponding to miR-18 (using RNA oligonucleotides: 5′-UAAGGUGCAUCUAGUGCA-GAU-3′ and 5′-CUGCACUAGAUGCACCUUAAU-3′), miR-183 (5′-UA-UGGCACUGGUAGAAUUCACU-3′ and 5′-UGAAUUCUACCAGUG-CCAGAUA-3′), miR-16 (5′-UAGCAGCACGUAAAUAUUGGCG-3′ and 5′-CCAAUAUUUACGUGCUGUUAUU-3′), or, as a control, miR-124 (Lim et al., 2005). [score:1]
Importantly, miR-18 is not one of the most abundant miRNAs in the murine male germ line (compare supplementary material Fig.  S2J with supplementary material Fig.  S2K,L). [score:1]
Concentrations of miR-18 at which target sites contribute synergistically to repression are indicated with an asterisk and bracket above red and orange-striped bars; synergism was inferred when the observed repression of the Atm 3′UTR (red bar) significantly (P<0.01) exceeded that expected based on measurements of each site individually (orange-striped bar) (5 nM, P=0.0022; 1 nM, P=0.0029; 0.2 nM, P=0.0006; Bonferroni-corrected Wilcoxon-rank sum test). [score:1]
Sites were mutated as follows: the miR-18 site (GCACCUUA) was mutated to GCAggaUA for both miR-18 sites; the miR-183 site (GUGCCAUA) was mutated to GUGaCgUA, the miR-16 sites (GCUGCU) were mutated to either GCcGaU, GaUGgU, GCcGaU (corresponding to the order of the sites within the reporter construct). [score:1]
Luciferase reporter constructs containing a portion of the Atm 3′UTR (red bars) were transfected into A549 cells together with different concentrations (x-axis) of a miR-18 mimetic siRNA duplex (D) or miR-124, as a control (E). [score:1]
Our results underscore the significance of specific miRNAs in ensuring the fi delity of gametogenesis, and point to miR-18, miR-183 and miR-16 as miRNAs playing an important role in male fertility. [score:1]
Using this approach, we did not observe evidence of synergism at high concentrations (25 nM) of the miR-18 mimetic; at lower concentrations (5, 1 and 0.2 nM), however, we observed increasingly strong evidence for synergistic interactions between the sites (Fig.  5D). [score:1]
[1 to 20 of 20 sentences]
7
[+] score: 54
Here we suggest that up-regulation of Nr1h2 might be due to a down-regulation of miR-18a-5p (and potentially its isomiRs) and it may be part of a common mechanism for changing the expression of steroidogenic-pathway transcripts such as Star and Cyp19a1 (or estrogen sulfotransferase) that are involved in the decrease of estradiol levels (Fig.   7). [score:9]
However, our data revealed that exposure to a mixture of EDCs resulted in the deregulation of specific miRNAs and isomiRs with 3′ end variants, some of them of differentially expressed canonical miRNAs (as shown for miR-18a-5p) (Fig.   6) which, consequently, share mRNA targets. [score:6]
When we searched in the sncRNA-Seq data for any member of this miR-17 family that was differentially expressed in testes after exposure to the mixture of EDCs, we only identified two down-regulated miRNAs: miR-18a-5p and miR-20b-5p. [score:6]
miR-18a-5p was associated with the reduction of intratesticular estradiol levels in testes of mice exposed to EDCs mixtureGiving that the exposure to a mixture of EDCs induced a decrease in estradiol levels, we correlated the differentially expressed miRNAs with deregulated transcripts of the steroidogenic pathway. [score:4]
Another important miRNA that was down-regulated by EDCs-mixture was miR-18a-5p, which is also associated with Sertoli cells; its absence results in the deterioration of spermatogenesis [61]. [score:4]
Interestingly, two isomiR variants of miR-18a-5p and one isomiR variant of miR-15b-5p, miR-20b-5p, miR-3085-3p, and miR-1981-5p were down-regulated due to the addition of an adenine at its 3′ end, similarly to the corresponding canonical miRNAs (Fig.   6A,B). [score:4]
Figure 7Down-regulation of miR-18a-5p in mice exposed to EDCs mixture is associated with estradiol decrease in testes via Nr1h2. [score:4]
We found that in the mouse, targeting of Nr1h2 by miR-18a-5p was already validated using immunoprecipitation experiments with Ago2 in C1C12 cells [31]. [score:3]
We used bioinformatics tools and found that in mouse testes, Nr1h2 could be a target of miR-18a-5p (Fig.   7A). [score:3]
As the processing of pre-mir-18a stem-loop may be selective and independent of the cluster by the action of RNA -binding proteins 63, 64, we speculate that exposure to the mixture of EDCs could alter the expression of some RNA -binding proteins, affecting the processing of specific miRNAs. [score:3]
However, we observed that miR-18a-5p was the only deregulated miRNA from this cluster (see Supplementary Fig.   S2). [score:2]
On the other hand, changes observed in miR-18a-5p and miR-15b-5p were higher with RT-qPCR than with NGS, but the tendency was similar to that observed with sncRNA-Seq (Fig.   5). [score:1]
Despite not having determined, in this work, the participation of nuclear receptors that are known to interact with the EDCs used such as ER, RXR/PPAR and AhR, we found that the decrease of miR-18a is negatively correlated to the Nr1h2 levels detected in exposed mice. [score:1]
By RT-qPCR, we found that Nr1h2 levels were two-fold higher in testes of mice exposed to EDCs mixture, which were negatively correlated with miR-18a-5p (Fig.   7A,B), suggesting a mechanism of estradiol downturn by various pathways and associated with loss of miR-18a-5p induced by the exposure to the EDCs mixture (Fig.   7C). [score:1]
miR-18a-5p was associated with the reduction of intratesticular estradiol levels in testes of mice exposed to EDCs mixture. [score:1]
Michlewski G Guil S Caceres JF Stimulation of pri-miR-18a processing by hnRNP A1Adv. [score:1]
To support our prediction, we searched in the DIANA-TarBase v7.0, that contains hundreds of thousands of high-quality manually curated and experimentally validated miRNA:gene interactions [30] for miR-18a. [score:1]
[1 to 20 of 17 sentences]
8
[+] score: 44
Based on the experiments using specific miR inhibitors, the mechanisms of the effects of miR-18a-5p, miR-19a-3p, and miR-19b-3p on the up-regulation of activated STAT3 might be the suppression of genes for regulatory proteins of STAT3 such as protein inhibitor of activated STAT3 (PIAS3) and suppressor of cytokine signaling 1 and 3 (SOCS1, SOCS3) [29– 32]. [score:13]
Interestingly, miRNA inhibitors targeted to miR-18a-5p, miR-19a-3p, and miR-19b-3p down-regulated the expression of BCL2, BCL2L1, BIRC5, and MMP9, target genes of STAT3, which implied the positive feedback loop of STAT3/miR-17-92 clusters (Fig. 7B-E). [score:12]
In particular, inhibition of miR-18a-5p, miR-19a-3p, and miR-19b-3p resulted in differential up-regulation of mRNA expressioin of PIAS3, SOCS1, and SOCS3, coding genes for regulatory proteins of STAT3 such as (Supplemental Fig. 6–8). [score:9]
In order to figure out feedback effects of miR-17-92 clusters on STAT3 activation, we evaluated the expression of target genes of STAT3 which demonstrated higher expression in Y79 cells than other retinal constituent cells: BCL2, BCL2L1, BIRC5, and MMP9 according to the treatment with specific miRNA inhibitors to components of miR-17-92 clusters: miR-18a-5p, miR-19a-3p, and miR-19b-3p. [score:7]
Interestingly, the inhibition of miR-18a-5p, miR-19-3p, and miR-19b-3p induced the decrease in the proportion of pSTAT3 -positive retinoblastoma cells. [score:3]
[1 to 20 of 5 sentences]
9
[+] score: 39
MiR-18a targets the protein inhibitor of activated STAT-3 (PIAS-3), an inhibitor of STAT-3 signaling (Brock et al., 2011), and TNF-α induced protein 3 (TNFAIP-3), as the NF-κ B pathway inhibitor (Trenkmann et al., 2013), and ataxia telangiectasia mutated (ATM) kinase, as the primary sensor and transducer of DNA damage signal (Song et al., 2011). [score:8]
miRNA Number of targets in miRNA-gene bigraph network P-value miR-20a 9 8.16E-09 miR-17 10 1.30E-07 miR-34a 9 2.78E-07 miR-155 14 2.16E-07 miR-18a 5 4.04E-06 miR-22 5 6.18E-06 miR-26a 6 9.29E-06 miR-101 5 3.30E-05 miR-106b 5 3.30E-05 miR-125b 8 8.37E-05 It is well known that AD is a complex disease and devastating neurodegenerative disorder without effective disease-modifying or preventive therapies. [score:7]
In addition, microRNAs, including miR-20a, miR-17, miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b might regulate the expression of genes (nodes) in the sub-network, thereby disrupting the fine-tuning of genetic networks in SAMP8 mice. [score:4]
The top 10 miRNAs with P ≤ 8.37 e [5] were listed in Table 3. They are miR-20a, miR-17, miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b, indicating that these ten miRNAs could regulate the expression of nodes (genes) in the sub-network of SAMP8 mice and might be one cause inducing SAMP8 mice to exhibit significant nodes (or genes) and to display a distinct genetic sub-network in the brain. [score:4]
miR-18a impairs DNA damage response through downregulation of ataxia telangiectasia mutated (ATM) kinase. [score:4]
Furthermore, the gene expression of CDKN2A and MCM3AP were changed, and miRNAs, including miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b are important in SAMP8 mice in the present study. [score:3]
miRNA Number of targets in miRNA-gene bigraph network P-value miR-20a 9 8.16E-09 miR-17 10 1.30E-07 miR-34a 9 2.78E-07 miR-155 14 2.16E-07 miR-18a 5 4.04E-06 miR-22 5 6.18E-06 miR-26a 6 9.29E-06 miR-101 5 3.30E-05 miR-106b 5 3.30E-05 miR-125b 8 8.37E-05 Differentially expressed mRNA in the hippocampus and cerebral cortex of SAMP8 and SAMR1 mice at 2, 6, and 12 months were investigated using cDNA microarray (Cheng et al., 2007b). [score:3]
MiR-18a is involved in the up-regulation of both the constitutive and TNF-α induced secretion of MMP-1 and inflammatory cytokines and chemokines (Trenkmann et al., 2013). [score:3]
Based on the miRNA-gene bipartite graph network in the brain of SAMP8 mice, we identified the top 10 miRNAs with P ≥ 8.37E-05, including miR-20a, miR-17, miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b (Table 3). [score:1]
Tumor necrosis factor alpha -induced microRNA-18a activates rheumatoid arthritis synovial fibroblasts through a feedback loop in NF-kappaB signaling. [score:1]
In these miRNAs, we first indicated that miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b were important in SAMP8 mice. [score:1]
[1 to 20 of 11 sentences]
10
[+] score: 33
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Heart-specific miRNAs or miRNAs abundantly expressed in the heart, B) Liver-specific miRNAs or miRNAs abundantly expressed in the liver, C) miRNAs showing strong expression in the thymus, D) Expression analysis of miR-18a and miR-20a, the miRNAs located in the miR-17-92 cluster, and E). [score:9]
Our study revealed miR-181 and miR-142-3p with relatively high expression in thymus (Figure 2C), and miR18a and miR-20a appeared to be weakly expressed in thymus (Figure 2D). [score:5]
Some miRNAs, including miR-208, miR-101, miR-18a, miR-20 and miR-142-3p, showed a weaker expression than other miRNAs tested by small RNA blot analyses (Figures 2 and 3). [score:3]
miR-18a and miR-20a are located within the miR-17-92 cluster, which contains miRNAs known as "oncomiRs" because of their overexpression in many types of cancer cells [58, 59]. [score:3]
Similarly, we found all members of the miR-15, miR-16, miR-18 and miR-133 families in our sequences, suggesting that all members belonging to these miRNA families are expressed in these three (heart, liver and thymus) tissues. [score:3]
Although miR-18a and miR-20a are likely derived from the same primary-transcript, the expression levels of these mature miRNAs are not similar (Figure 2D). [score:3]
Surprisingly, the expression pattern of miR-20a's differed from that of miR18a in different tissues. [score:3]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
The miR-17-92 cluster (polycistronic miRNA gene) encodes six miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) located in the third intron of a ~7-kb primary transcript known as C13orf25 [61]. [score:1]
[1 to 20 of 9 sentences]
11
[+] score: 30
has-mir-18a is upregulated [73, 74], and its targets BDNF [75], TH [76] and NCSTN [72] are downregulated in AD. [score:9]
A similar result was observed when we used the targets of hsa-let-7b, hsa-mir-18a, hsa-mir-21, hsa-mir-30b and hsa-mir-101 that have the most common targets from both the AD and BARHL1-ESR1 networks (Table S13) for ToppFun analysis. [score:5]
hsa-mir-18a also targets ESR1, and BARHL1 is its putative target (Table S13). [score:5]
Since hsa-mir-18a targets all five genes, it may regulate the neuronal death and cognitive impairment associated with AD. [score:4]
3.11. hsa-mir-18a May Regulate the BARHL1-AD Network and Alzheimer’s Disease Patho-Physiology. [score:4]
For the 44 miRNAs having targets from both the AD and BARHL1 pathways (Table S13), we observed that only hsa-mir-18a meets these criteria. [score:3]
[1 to 20 of 6 sentences]
12
[+] score: 29
Other miRNAs from this paper: mmu-mir-19b-2, mmu-mir-19b-1
The inverse correlation observed between miR-18a and miR-19b levels with antithrombin mRNA, one potential target of these miRNAs, suggests that certain miRNAs may be involved in the regulation of selected hepatic haemostatic proteins during development by targeting mRNA coding for these proteins and be in part responsible of the observed decay in neonates [12]. [score:7]
We point out that miR-18a and miR-19b are also expressed in human liver where their expression pattern during development is similar to that observed in our study [16]. [score:6]
We were particularly interested to deepen in two miRNAs: miR-18a and miR-19b which are overexpressed 5.4 and 8.2-fold and both have antithrombin as a potential target. [score:5]
Expression of antithrombin and miRNAs miR-18a and miR-19b during post-natal development in mouse. [score:4]
We next move to NIH3T3 cells that do express antithrombin and we performed transfection assays with oligonucleotide precursors and inhibitors (pre-miRs and antagomiRs from Applied Biosystems, Madrid, Spain) of miR-18a and miR-19b to evaluate their effect in the expression of antithrombin. [score:4]
Finally, we sacrificed 3 mice from different litters, from neonate stage (day +1) to adult stage (day +50) each two days, to perform the quantification of antithrombin mRNA levels and miRNAs miR-18a and miR-19b levels, during post-natal development. [score:2]
Interestingly, when quantifying miR-18a, miR-19b, and antithrombin mRNA during the 19 days after birth, we found an inverse and significant correlation (miR-19b: R = 0.81; p = 0.03; miR-18a: R = 0.91; p<0.001) (Figure 3). [score:1]
[1 to 20 of 7 sentences]
13
[+] score: 26
The microRNA expression levels of miR-18a-5p and miR-466f were down-regulated in the aged thymus, while the microRNA expression levels of miR342-3p, miR-6931-5p, miR-125a-5p and miR-320-5p were up-regulated in the aged thymus. [score:11]
Results are shown in Figure 2. In those 12 miRNAs, there were 6 miRNAs with statistically different expression, among which two (miR-18a-5p, miR-466f) were down-regulated (< -2.0 folds) in aged TECs which were consistent the result with ones in the microarray (Fig. 2 top panels), and four (miR-342-3p, miR-6931-5p, miR-125a-5p, miR320-5p) were up-regulated (> 2.0-fold), confirmed the trend in the microarray data (Fig. 2 middle and bottom panels). [score:9]
Figure 2. The microRNA expression levels of miR-18a-5p, miR-466f, miR342-3p, miR-6931-5p, miR-125a-5p and miR-320-5p were consistent with the miRNA microarray results. [score:3]
The microRNA expression levels of miR-18a-5p, miR-466f, miR342-3p, miR-6931-5p, miR-125a-5p and miR-320-5p were consistent with the miRNA microarray results. [score:3]
[1 to 20 of 4 sentences]
14
[+] score: 25
Other miRNAs from this paper: mmu-mir-134, mmu-mir-182, mmu-mir-34b, mmu-mir-210
Our pathway analysis revealed that miR-18a targeted the pten gene (phosphatase and tensin homolog) in the p53 signaling pathway, miR-210 targeted the tcf7l2 gene (transcription factor 7-like 2) in the Wnt signaling pathway, and the bcl2 gene (B-cell CLL/lymphoma 2) in the apoptosis signaling pathway (FDR = 1.2 × 10 [−2]). [score:5]
Our results revealed a potential role of miR-18a in regulating the p53 signaling pathway and abnormal expression of miR-210 in AKI might influence the Wnt and apoptosis signaling pathways. [score:4]
Furthermore, six miRNAs (miR-18a, -34b, -134, -182, -210, and -214) were examined for a similar association between temporal expression and phenotype as was observed for global miRNAs (Figs. 2B and 2C). [score:3]
The expression of five miRNAs, including miR-18a, -134, -182, -210, and -214, increased at 24 h after IRI. [score:3]
qRT-PCR was used to assess the temporal expression changes of six miRNAs including miR-18a, -34b, -134, -182, -210, and -214. [score:3]
1729/fig-3 Figure 3(A) Temporal expression changes of six miRNAs, including miR-18a, -34b, -134, -182, -210, and -214 (n = 8). [score:3]
Renal pathology-related mRNAs targeted by miR-18a, -134, -182, -210, or -214. [score:3]
Until now, there was no experimental evidence linking miR-18a, -134, and -214 to AKI. [score:1]
[1 to 20 of 8 sentences]
15
[+] score: 24
To normalize the detection method of miR-1253 expression in NSCLC, two other miRNAs, namely, miR-99a and MiR-18a-5p, were assessed, and a similar approach demonstrated that expression miR-99a was significantly down-regulated and miR-18a-5p was obviously up-regulated in tumor tissue samples compared with the controls (Supplementary Figure S1a-b) 21, 22. [score:10]
To normalize the detection method of miR-1253 expression in NSCLC, two other miRNAs, namely, miR-99a and MiR-18a-5p, were assessed, and a similar approach demonstrated that expression miR-99a was significantly down-regulated and miR-18a-5p was obviously up-regulated in tumor tissue samples compared with the controls (Supplementary Figure S1a-b) 21, 22. a miR-1253 level was measured by qRT-PCR in 70 NSCLC and pair-matched lung tissue samples, and normalized against endogenous U6 RNA. [score:8]
The expression of miR-1253 was normalized to miR-99a and miR-18a-5p. [score:3]
Liang C MicroRNA-18a-5p functions as an oncogene by directly targeting IRF2 in lung cancerCell Death Dis. [score:3]
[1 to 20 of 4 sentences]
16
[+] score: 22
All members of miR-17-92 cluster, except miR-18, are also known to downregulate expression of the tumor suppressor PTEN [52]. [score:8]
It is suggested that SMAD2/4 is regulated by miR-18 in neuroblastoma cells [66] and that SMAD4 is targeted by miR-19a/b in thyroid follicular cells [68]. [score:4]
One possible relevant difference between these two clusters is that miR-17-92, but not miR-106b-25, expresses members of the miR-19 and miR-18 families. [score:3]
Furthermore, the antiangiogenic proteins TSP11 and CTGF are both negatively regulated by miR-18 and miR-19 [58]. [score:2]
The six miRNAs can be grouped into four miRNA families based on their seed-sequence: the miR-17 family (miR-17 and miR-20a), the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and miR-92 family (miR-92a-1) [31, 34, 39]. [score:1]
It is tempting to speculate that loss of miR-19a, miR-19b, and miR-18 is significantly responsible for the phenotype caused by deletion of miR-17-92. [score:1]
In addition, it has been demonstrated that miR-18 and miR-19 repress the antiangiogenic factors TSP-1 and CTGF [51]. [score:1]
Both the evolutionary sequence analysis and the seed-sequence -based grouping partition these miRNAs into four families: the miR-106 family (miR-17, miR-20a/b, miR-106a/b, and miR-93), the miR-18 family (miR-18a/b), the miR-19 family (miR-19a/b-1/2), and the miR-92 family (miR-25, miR-92a-1/2, and miR-363). [score:1]
The primary transcript encodes six mature miRNAs: miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1 (Figure 2, Table 1). [score:1]
[1 to 20 of 9 sentences]
17
[+] score: 20
From these, BCL2 was validated as a direct target of the miR-17 and miR-18a, and BCL2 knockdown resulted in strong induction of apoptosis in BCR-ABL -positive, but not BCR-ABL -negative ALL cells. [score:5]
We further confirmed this by a complementary approach using lentiviral overexpression of antagomirs against miR-17, miR-18 and miR-20a in the human BCR-ABL -positive BV173 cell line. [score:3]
The polycistronic microRNA cluster miR-17∼92 encodes miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1. [13] Notably, miR-17∼92 -deficient mice suffer significant developmental cardiac defects and lung hypoplasia though interrogation of haematopoiesis identified isolated defects in B-lineage development. [score:3]
21, 26 miRNA expression was increased between 5- and 16-fold upon transduction (miR-17 5.2-fold, miR-18a 2.1-fold, miR-19a 9-fold, miR-19b 10.6-fold, and miR-20a 15.8-fold). [score:3]
Together, these data demonstrate direct and functional miRNA binding of miR-17∼19b members namely miR-17/miR-20a and miR-18a to human BCL2 mRNA. [score:2]
In human BCL2, we identified 13 binding sites for miR-17∼19b miRNAs (five sites for miR-17, six sites for miR-18a and two sites for miR-20a) located within the CDS and 3′UTR (Supplementary Figure 3B). [score:1]
[19] It is interesting to note that while this effect, in MYC -driven lymphoma at least, is primarily mediated by miR-19 family members (miR-19a/b), we have identified principally a miR-17 family- (miR-17, miR-20a/b, miR-106a/b and miR-93) and miR-18 family(miR-18a/b) -driven effect in BCR-ABL -positive ALL on BCL2, indicating differences in pro- and anti-apoptotic functions of miR-17∼92 between the various cellular contexts. [score:1]
Notably, six binding sites for miR-17∼19b miRNAs (three sites for miR-18a, two sites for miR-17 and one site for miR-20a) are located within the 5′UTR and CDS of murine Bcl2 (Supplementary Figure 3A). [score:1]
As shown in Figure 4a, miR-17∼19b significantly repressed luciferase activity for the wildtype but not for mutated miR-17 and miR-18a -binding sites in the murine Bcl2 5′UTR. [score:1]
[1 to 20 of 9 sentences]
18
[+] score: 19
Specifically, two miRNAs (miR-18a-5p and miR-574-3p) were upregulated in the Mn [2+] -induced NPA mo del, while let-7e-5p was downregulated and miR-205-5p was upregulated in the chlorpromazine -induced NPA mo del. [score:10]
In the lupus-like disease produced by Mn [2+] -induced NPA, miR-18a-5p and miR-574-3p exhibited increased expression. [score:5]
The remaining six deregulated miRNAs: let-7e-5p, miR-18a-5p, miR-23b-3p, miR-205-5p, miR-207, and miR-574-3p, which are specific to each of our murine lupus-like mo dels, highlight some differences between them, but also show roles on inflammation and immune disease. [score:4]
[1 to 20 of 3 sentences]
19
[+] score: 18
This analysis (Figure 3A) revealed that genes belonging to the predicted targets lists of miR-17, miR-20a, miR-19a and miR19b but not to those of miR-18a or miR-92a were significantly over-represented among genes up-regulated in response to HMBA and Dox (resulting in down regulation of miR-17-92 cluster). [score:7]
In summary, these analyses indicated that miR-17-92 cluster in 745A#44 cells is mainly involved in the down-regulation of predicted targets of miR-17/miR-20a and miR-19a/miR-19b rather than miR-18a or miR-92a. [score:6]
Except for miR-18, the oncogenic contributions of miR-17/20a, miR-19a/b and miR-92 have all been demonstrated and several functional targets identified, including E2F1, PTEN and BIM1 [26]. [score:3]
Figure S4 Comparison of miR-17, miR18, miR-19a, miR19b and miR92 levels between NN10#5, 745A#44 and K16 erythroleukemic cells. [score:1]
This miR-17-92 cluster comprises six miRNAs that can be grouped into four sub-families based on their seed sequence (miR-17 and miR-20a, miR-18a, miR-19a and b and miR-92a) [19]. [score:1]
[1 to 20 of 5 sentences]
20
[+] score: 16
Evidence of the concerted interplay of miRNAs regulated by CpG-ODN and their potential target mRNAs was observed (Fig. 4) for 2 miRNAs upregulated (hsa-miR-302b and hsa-miR-374b) and for 13 miRNAs downregulated in CpG-ODN -treated mice (hsa-miR-135a, hsa-miR-136, hsa-miR-340, hsa-miR-445-5p, hsa-miR-424, hsa-miR-96, hsa-miR-142-3p, hsa-miR-140-5p, hsa-miR-542-3p, hsa-miR-18a, hsa-miR-18b, hsa-miR-101, and hsa-miR-99a). [score:10]
Comparison of hsa-miR-18a, hsa-miR-18b, hsa-miR-140-5p, hsa-miR-101, hsa-miR-556-3p, hsa-miR-424, hsa-miR-136, hsa-miR-340, hsa-miR-302b expression obtained by miRNA expression profile and qRT-PCR on tumors collected from human IGROV-1 ovarian tumor-bearing mice treated daily i. p. with CpG-ODN or saline (control group). [score:5]
Of the 9 miRNAs, hsa-miR-18a and hsa-miR-18b were selected based on their reported role in the pathogenesis of ovarian cancer [25]; [26], and hsa-miR-101 and hsa-miR-302b for their described involvement in DNA repair processes and sensitivity to chemotherapy [20]; the remaining 5 miRNAs were randomly selected. [score:1]
[1 to 20 of 3 sentences]
21
[+] score: 15
Seven conserved DE miRs are upregulated during pneumonia and are expressed at moderate to high levels in lung neutrophils (average normalized mean expression above 5): mmu-miR-1224-5p, mmu-miR-188-5p, mmu-miR-139-5p, mmu-miR-15b-5p, mmu-miR-721, mmu-miR-18a-5p, and mmu-miR-130b-3p. [score:8]
We identified a network containing seven upregulated conserved miRs (mmu-miR-1224-5p, mmu-miR-188-5p, mmu-miR-139-5p, mmu-miR-15b-5p, mmu-miR-721, mmu-miR-18a-5p and mmu-miR-130b-3p) and another network consisting of downregulated miRs belonging to 3 highly conserved miR families (let-7, mir-30 and mir-34). [score:7]
[1 to 20 of 2 sentences]
22
[+] score: 14
Of the 6 differentially regulated miRNA predicted to target NR3C1, two (miR-18a and miR-142-3p) have previously been shown to target NR3C1 directly [59– 63]. [score:7]
Interestingly, 5 of the 29 differentially expressed miRNAs identified in our study (let-7d-3p, miR-18a-5p, -21a-5p, -155-5p and -223-3p) have previously been implicated in inflammatory diseases [6, 14, 15, 18, 33, 41– 45]. [score:5]
Six of the miRNAs assessed (mmu-miR-18a-5p, -21a-5p, -155-5p, 188-5p, -223-3p and -449a-5p) were significantly increased following OVA sensitization and challenge (Fig 1D). [score:1]
Tumor necrosis factor alpha -induced microRNA-18a activates rheumatoid arthritis synovial fibroblasts through a feedback loop in NF-kappaB signaling. [score:1]
[1 to 20 of 4 sentences]
23
[+] score: 13
Also, miR-125a-5p/-351, miR-200c/-429, miR-106b/-17, miR-363/-92b, miR-181b/-181d, miR-19a/-19b, let-7d/-7f, miR-18a/-18b, miR-128/-27b and miR-106a/-291a-3p pairs exhibited significant synergy and their association to aging and/or cardiovascular diseases is supported in many cases by a disease database and previous studies. [score:5]
2013.125 24212931 42. van Almen GC Verhesen W van Leeuwen RE van de Vrie M Eurlings C Schellings MW MicroRNA-18 and microRNA-19 regulate CTGF and TSP-1 expression in age-related heart failureAging Cell. [score:4]
Another previous study showed that the members of miR-17-92 cluster, including miR-18a, − 19a, and -19b, were differentially expressed in failure-prone heart of aged mice as well as in cardiac biopsies of idiopathic cardiomyopathy patients at old age with severely impaired cardiac function [42]. [score:3]
We corroborate to this observation since the miR-19a/-19b and miR-18a/-18b pairs scored high in terms of synergy (2 [nd] and 7 [th] rank respectively) despite not participating in the consensus modules. [score:1]
[1 to 20 of 4 sentences]
24
[+] score: 13
miR-92a-3p inhibition also reduced TNF-α production by ∼50%, suggesting its involvement in regulating TLR7 -mediated immune induction, while miR-18a-5p and miR-17-5p inhibition only had a modest effect on RNA sensing (Figure 1A). [score:6]
In accord with the concept of a sequence -dependent and miRNA-independent activity of select 2′OMe AMOs on ssRNA sensing, transfection of 2′OMe NC1 AMO resulted in a dose -dependent inhibition of IFN-α production (indicative of TLR7 recruitment (21, 28)) to immunostimulatory ssRNA in human PBMCs, while the miR-18a-5p 2′OMe AMO did not (Figure 1C). [score:3]
To investigate the specific impact of miR-19 inhibition, relative to that of other members of the same cluster of miRNAs (miR-17-5p, miR-18a-5p and miR-92a-3p), we measured the inhibition of TLR7 signalling in primary mouse BMMs treated with specific 2′OMe AMOs. [score:1]
In this work, we originally set out to study the role of the individual members of the miR-17∼92 cluster of miRNAs (miR-17/20a, miR-19a/b, miR-18a and miR-92a) on TLR7 -driven NF-κB signalling in mouse primary macrophages. [score:1]
miR-17∼92 [flox/ flox] mice (Jax mice stock 8458 – on a mixed C57BL/6 and 129S4 background) harbouring loxP sites on each side of the miR-17∼92 cluster (Mir17, Mir18, Mir19a, Mir20a, Mir19b-1, Mir92–1) (23), were bred to LysMCre mice (kind gift from Dr. [score:1]
In light of previous reports that 2′OMe RNAs can act as TLR7 antagonists (10, 11), we reasoned that certain 2′OMe AMO sequences could be more potent than others—thereby explaining the divergent activity of miR-18a-5p and NC1 AMOs. [score:1]
[1 to 20 of 6 sentences]
25
[+] score: 12
Other miRNAs from this paper: mmu-mir-155, mmu-mir-17
Whereas stimulated WT CD8 T cells showed continued upregulation of miR18a, dicer [C KO] CD8 T cells did not exhibit significant accumulation of miR18a between days 1.5–2.5 after activation (S1F Fig). [score:4]
Encoded within the miR17-92 cluster, we have previously shown that miR18a is strongly upregulated in CD8 T cells upon stimulation [8]. [score:4]
ΔΔCt method was used and miR18a expression is shown as fold increase over naïve samples. [score:3]
For the detection of Dicer function, RT-PCR analysis of miR18a was used. [score:1]
[1 to 20 of 4 sentences]
26
[+] score: 12
Dclk1 was the target of mmu-miR-15a-5p, Slit2 was the target of mmu-miR-322-5p, Ctgf and Notch2 were targets of mmu-miR-18a-5p, and Mgp was the target of mmu-miR-155-5p. [score:9]
In addition, we corroborated the expression in Sca-1 [+]CD31 [−] cells of differentiation promoting-miRNAs mmu-miR-322-5p, mmu-miR-505-5p, mmu-miR-18a-5p, and mmu-miR-139-5p. [score:3]
[1 to 20 of 2 sentences]
27
[+] score: 12
Hsa-miR-18a-5p (homologous to mmu-miR-18a-5p) enhances cell apoptosis in human keratinocytes in vitro [62] and stimulates the protein expression of the vascular smooth muscle cell differentiation markers Acta2 and Tagln [63] and mmu-miR-224-5p negatively regulates mouse adipocyte differentiation [64]. [score:4]
a Box-plots of miRNA expression levels of mmu-miR-18a-5p, mmu-miR-31-5p, mmu-miR-130b-3p, mmu-miR-199a-5p, mmu-miR-200c-3p, mmu-miR-224-5p in mouse quadriceps muscle at 2 days, 2 weeks, 4 weeks and 12 weeks after birth. [score:3]
A similar array has been previously conducted in a mouse mo del of muscle regeneration [73] and several miRNAs, including mmu-miR-18a-5p, mmu-miR-136-5p, mmu-miR-31-5p and mmu-miR-199a-5p, were similarly regulated as observed in our study. [score:2]
This suggests that mmu-miR-18a-5p and mmu-miR-224-5p may play roles in the early stages of the skeletal muscle tissue development, including vascular and adipocyte differentiation. [score:2]
The top-ranked miRNAs for clusters A were mmu-miR-18a-5p, mmu–miR-31–5p, mmu-miR-130b–5p, mmu-miR-199a–5p, mmu-miR-200c–5p and mmu-miR-224–5p. [score:1]
[1 to 20 of 5 sentences]
28
[+] score: 12
Several down-regulated (i. e. miR-1, miR-7, miR-34a, miR-122, miR-125b, miR-200) or up-regulated (i. e. miR-17, miR-18, miR-19, miR-155, miR-93, miR-221/222) miRNAs have been identified as tumor suppressor or oncomirs, respectively, by targeting and regulating genes involved in cell proliferation, apoptosis, angiogenesis and metastasis [13]. [score:12]
[1 to 20 of 1 sentences]
29
[+] score: 12
Bjork JK Sandqvist A Elsing AN miR-18, a member of Oncomir-1, targets heat shock transcription factor 2 in spermatogenesis. [score:3]
[19] miR-18 displays a cell-type-specific expression, with highest intensity in the spermatocytes. [score:3]
The miR-17-92 cluster and its 6 different mature microRNAs, including miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92a, play important roles in embryo development, immune system, kidney and heart development, adipose differentiation, aging, and tumorigenicity. [score:3]
The miR-17-92 gene cluster encodes 6 miRNAs of 4 miRNA families: the miR-17 family including miR-17-5p and miR-20a, the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and the miR-92 family. [score:1]
Currently, increasing evidence indicates that some members of miR-17-92 cluster may be critical players in spermatogenesis, including miR-17, miR-18a, and miR-20a. [score:1]
[4] The miR-17-92 gene cluster encodes 6 miRNAs of 4 miRNA families: the miR-17 family including miR-17 and miR-20a, the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and the miR-92 family. [score:1]
[1 to 20 of 6 sentences]
30
[+] score: 12
The following synthetic miRNA mimics were used in this study: Mimic Transfection Control with Dy547 (cel-mir-67 conjugated with Dy547), Dharmacon CP-004500-01-10 miRIDIAN microRNA Mimic Negative Control #1 (cel-mir-67), Dharmacon CN-001000-01-10 miRIDIAN Mimic hsa-miR-17, Dharmacon C-300485-05-0005 miRIDIAN Mimic hsa-miR-18a, Dharmacon C-300487-05-0005 miRIDIAN Mimic hsa-miR-19a, Dharmacon C-300488-03-0005 miRIDIAN Mimic hsa-miR-20a, Dharmacon C-300491-03-0005 miRIDIAN Mimic hsa-miR-19b, Dharmacon C-300489-03-0005 hsa-miR-92a, custom synthesized by Shanghai GenePharma miRIDIAN Mimic hsa-miR-155, Dharmacon C-300647-05-0010 Generation of miR-17~92 -expressing lentivirus was previously described (Hong et al., 2010). [score:3]
Importantly, transient transfection of cel-mir-67 did not alter the expression level and size of endogenous miRNAs, including miR-17, miR-18a, miR-19b, miR-92a, and miR-16 (Figure 2B). [score:3]
For example, the probe mixture for the miR-17 subfamily contains probes for miR-17, miR-20a, miR-106a, miR-20b, miR-106b, and miR-93, the probe mixture for the miR-18 subfamily contains probes for miR-18a and miR-18b, the probe mixture for the miR-19 subfamily contains probes for miR-19a and miR-19b, and the probe mixture for the miR-92 subfamily contains probes for miR-92, miR-363, and miR-25. [score:1]
The following synthetic miRNA mimics were used in this study: Mimic Transfection Control with Dy547 (cel-mir-67 conjugated with Dy547), Dharmacon CP-004500-01-10 miRIDIAN microRNA Mimic Negative Control #1 (cel-mir-67), Dharmacon CN-001000-01-10 miRIDIAN Mimic hsa-miR-17, Dharmacon C-300485-05-0005 miRIDIAN Mimic hsa-miR-18a, Dharmacon C-300487-05-0005 miRIDIAN Mimic hsa-miR-19a, Dharmacon C-300488-03-0005 miRIDIAN Mimic hsa-miR-20a, Dharmacon C-300491-03-0005 miRIDIAN Mimic hsa-miR-19b, Dharmacon C-300489-03-0005 hsa-miR-92a, custom synthesized by Shanghai GenePharma miRIDIAN Mimic hsa-miR-155, Dharmacon C-300647-05-0010 Transfection of miR-17~92-expresing plasmid was previously described (Xiao et al., 2008). [score:1]
Since cel-mir-67 is a C. elegans miRNA that has no homolog in mammalian species, we decided to perform the same experiments using microRNA-17~92 (miR-17~92), a miRNA cluster encoding six mature miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b, and miR-92). [score:1]
Endogenous miR-18a in Replicate 1 was not detectable and was excluded from quantification. [score:1]
HeLa cells were transfected with 100 nM unconjugated cel-mir-67 and analyzed by to detect cel-mir-67 (A) and endogenous miR-17, miR-18a, miR-19b, miR-92a, and miR-16 (B). [score:1]
The multifunctional RNA -binding protein hnRNP A1 is required for processing of miR-18a. [score:1]
[1 to 20 of 8 sentences]
31
[+] score: 11
In HepG2 cells, miR-192, miR-204, miR-18, miR-19 and miR-211 could down-regulate HOTTIP expression (all P<0.05). [score:6]
All miRNA mimics (miR-138, miR-18, miR-192, miR-215, miR-19, miR-204 and miR-211), miRNA inhibitors(miR-192 and miR-204) and small interfering RNA (siRNA) duplexes (siHOTTIP-1 and siHOTTIP-2) were products of Genepharma (Shanghai, China). [score:3]
20 nmol/L mimics of miR-138, miR-18, miR-192, miR-215, miR-19, miR-204, and miR-211, two HOTTIP siRNAs (siHOTTIP-1 and siHOTTIP-2)or NC RNA were transfected into SMMC7721,HepG2 and Hep3B HCC cells. [score:1]
* MicroRNAs Seed position Conservation Primates Mammals Other Vertebrates miR-138 chr7:27245289 89% 30% 0% miR-18 chr7:27238346 89% 30% 0% miR-192/215 chr7:27241747 89% 91% 77% miR-19 chr7:27245115 100% 0% 0% miR-204/211 chr7:27245995 89% 43% 0%*Data from miRcode (http://www. [score:1]
[1 to 20 of 4 sentences]
32
[+] score: 11
Silencing PRDM14 reduced the expression of miRNAs upregulated in breast cancer tissues (e. g. miR-106a, miR-149, miR-18a, miR-221, miR-222, miR-224, miR-23a, miR-24, miR-27a/b, and miR-493) and increased expression of those that were downregulated (e. g. miR-15a, miR-150, miR-183, and miR-203). [score:11]
[1 to 20 of 1 sentences]
33
[+] score: 11
However, only miR-17 and miR-20a were shown to directly target TGF-β receptor II and miR-18a was reported to target the TGF-β down-stream signaling proteins Smad2 and Smad4 (for review see [4]). [score:6]
One limitation of the present study, however, is that the deletion of miR-92a moderately affected the expression of miR-20a and miR-19b in heart and muscle tissue, and miR-18a was moderately but significantly reduced in skeletal tissue. [score:3]
MiR-92a [−/−] mice showed a moderate, but significant decrease in miR-19a, miR-19b, and miR-20a in the heart, whereas only miR-19b and miR-20a were significantly decreased in muscle and miR-18a was significantly reduced in skeletal tissue (Figure 1C, Figure S1A/B). [score:1]
Moreover, in skeletal tissue only miR-18a was slightly reduced in miR-92a [−/−] mice. [score:1]
[1 to 20 of 4 sentences]
34
[+] score: 10
Upon activation, both miR-17~92 miRNAs and their target mRNAs are up-regulated (Fig 3C and 3D), but the fold increase of the latter outpaces the former, thereby increasing the ratios between conserved binding sites and miRNA molecules to 2.8 (miR-92 family) and 8.7 (miR-18 family) in 25.5h activated B cells (Fig 3E). [score:6]
Our calculation showed that each naïve B cell expresses 900–1,800 molecules of miR-17, miR-19, and miR-92 subfamily miRNAs, and 80 molecules of miR-18 subfamily miRNAs (Fig 3B and 3C and S7 Table). [score:1]
They fall into four miRNA subfamilies (miR-17, miR-18, miR-19, and miR-92 subfamilies), with members in each subfamily sharing the same seed sequence. [score:1]
The ratios between conserved miR-17~92 binding sites and miRNA molecules range from 0.5 (miR-92 subfamily) to 4.6 (miR-18 subfamily) in naïve B cells (Fig 3E). [score:1]
Indicated amounts of synthetic miR-17, miR-18a, miR-19b and miR-92 were added to naïve and activated T KO B cells before RNA extraction. [score:1]
[1 to 20 of 5 sentences]
35
[+] score: 10
There is positive correlation between the EpCAM and mir-17-92 cluster over -expression in cancers [45]and mir-18a targets ATM, thereby downregulating its expression to aid tumorigenesis [46]. [score:10]
[1 to 20 of 1 sentences]
36
[+] score: 10
While miR-18 is expressed in multiple tissues, miR-124 is particularly enriched in the brain [21] and has been shown to inhibit Nr3c1 expression in cultured cells and in vivo [22]. [score:7]
The 3′ untranslated region of the Nr3c1 gene contains multiple microRNAs’ seed regions, including miR-124 and miR-18 [20]. [score:3]
[1 to 20 of 2 sentences]
37
[+] score: 10
Similar BMI and CYCLIN D1 expression was observed in the C666-1 cells stably expressing miR-96 and miR-18 and the vector control. [score:5]
C666-1 cells stably overexpressing miRNA were generated by lentiviral transfection with a vector expressing miR-96 or miR-18 and a miR -negative control vector according to the manufacturer’s protocol (Lenti-miR™ microRNA precursor clones, SBI System Biosciences, Palo Alto, CA, USA). [score:5]
[1 to 20 of 2 sentences]
38
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-217, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-23a, mmu-mir-34a, mmu-mir-98, mmu-mir-322, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-18b, hsa-mir-503, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, hsa-mir-744, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Osteocyte marker Stemness inhibitor high in 2w−, low in 2w+ miR-18a, 322, 125b-5p, 182, 872, 130a, 191, 28, 425, 196a, 93 Osteocyte negative marker Stemness marker high only in 2w+ Snord85 Osteocyte marker Stemness inhibitor high only in 2w− miR-101a, 16, 23b, 23a, 9, 24, 467c, 140, 10b, 467e, 29a, 27b, 150, 199a-5p, 199b, 218, 17, 126-3p, 99a, 10a, 30e, 19b, 126-5p, 196b, 25, 96, 186, 106b, 31, 22, 140, 30a, 374, 34c, 27a, 880. let-7i, 7g, 7f, 7a, 7b, 7c, 7d Osteocyte negative marker Stemness marker Possible functions of miRNAs were shown in right. [score:5]
Among this group, miR-18 has been reported to control ctgf/ccn2 gene expression in chondrocytic cells [64]. [score:3]
hnRNPA1 directly associates with miR-18a stem-loop as well as pri-miR-17/18a/19a, and then export pri-miR-17/18a/19a in the exportin-independent manner [42]. [score:2]
[1 to 20 of 3 sentences]
39
[+] score: 10
Most of the 15 guide strands were upregulated in the aging heart, where 11 guide strands were expressed in the same direction, but four guide strands (miR-18a-5p, miR-18b-5p, miR-20b-5p, and miR-363-5p) were increased in some old mice while decreased in other old mice (Figure 3(a)). [score:7]
The SRF gene is a target of miR-18a and miR-18b. [score:3]
[1 to 20 of 2 sentences]
40
[+] score: 9
Interestingly, p53 appears to inhibit the expression of hnRNP A1 through its target miRNA-15/16, suggesting that p53/p73/p63 could function as a negative regulator of the processing of the oncogenic miRNA-18a. [score:8]
Further, hnRNP A1, an RNA binding protein, has been shown to interact with conserved loops of pre-miR-18a and thereby promotes its cleavage mediated by the Drosha complex [86]. [score:1]
[1 to 20 of 2 sentences]
41
[+] score: 9
However, there was no further increase in miR-18 levels in tumors with Xpcl1 integrations, so this likely represents expression from the miR-17∼92 paralog. [score:3]
Thus, the increased miR-18 levels noted in tumors (Figure 1B), may be due to expression from paralogous miR-17∼92 cluster. [score:3]
We observed increased expression of miR-18 in lymphomas, compared to normal thymic tissue. [score:2]
Mir-18, in contrast, is also encoded by the paralogous miR-17∼92 cluster. [score:1]
[1 to 20 of 4 sentences]
42
[+] score: 9
qPCR -based miRNA expression profiling revealed that miR-17-5p, miR-18a-5p and miR-20a-5p exhibit enhanced expression in tissue samples derived from triple -negative as compared to luminal A breast tumors, which are less aggressive and have much better prognosis as well as lower recurrence rate [64]. [score:4]
In marked contrast, antisense oligonucleotides against miR-18a, miR-19a or miR-92-1 led to no or slight inhibition of cell growth, indicating that single miRNAs of the miR-17-92 cluster have distinct roles on cancer formation and progression. [score:3]
Members of a specific cluster can also be processed in a context -dependent manner, as explained by Cáceres JF et al., where miR-18a stability is changed by hnRNP A1 (Heterogeneous Nuclear Ribonucleoprotein A1) in comparison to the other cluster members [4]. [score:1]
The miR-17-92 cluster transcript comprises six miRNAs - miR-17-5p, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1 - and is highly conserved among vertebrates [19, 20]. [score:1]
[1 to 20 of 4 sentences]
43
[+] score: 9
Indeed, by cloning the identified miR-18a binding region in Malat1 into a luciferase reporter vector, we found that transfection of precursor oligos of miR-181a (pre-181a) but not a negative control or an irrelevant miR-193a downregulated the reporter activity (Figure 6b); moreover, mutating the predicted binding site (Figure 6a, Mutant) abolished this targeting effect (Figure 6b), suggesting that indeed miR-181a directly targeted Malat1 through the above-identified site. [score:9]
[1 to 20 of 1 sentences]
44
[+] score: 9
Other miRNAs from this paper: mmu-mir-155, mmu-mir-222
Yang Q Bidirectional regulation of angiogenesis and miR-18a expression by PNS in the mouse mo del of tumor complicated by myocardial ischemiaBMC Complement Altern Med. [score:5]
Wang P Ginsenoside Rd attenuates breast cancer metastasis implicating derepressing microRNA-18a-regulated Smad2 expressionSci Rep. [score:4]
[1 to 20 of 2 sentences]
45
[+] score: 9
Inhibition of miR-17 and miR-20a in cells overexpressing the miR-17-92 cluster can induce apoptosis, while inhibition of miR-18a and miR-19a did not have the same effect and inhibition of miR-92-1 resulted in only a modest reduction of cell growth [25]. [score:9]
[1 to 20 of 1 sentences]
46
[+] score: 9
To address this issue, we first screened the miRNAs whose expressions are modulated in 4T1 cells by miRNA microarray analysis using both total cellular miRNA and exosomal miRNA after treatment with 100 μM of EGCG for 24 h. In brief, a set of miRNAs including let-7, miR-16, miR-18b, miR-20a, miR-25, miR-92, miR-93, miR-221, and miR-320 were up-regulated, and dozens of miRNAs including miR-10a, miR-18a, miR-19a, miR-26b, miR-29b, miR-34b, miR-98, miR-129, miR-181d were down-regulated in both total cellular and exosomal fraction by EGCG treatment (data not shown). [score:9]
[1 to 20 of 1 sentences]
47
[+] score: 9
Nine of these miRNAs that were known to be oncomirs or oncosuppressors according to data in the literature were selected for validation using: mmu-mir-29b, mmu-mir-21, mmu-10b, mmu-mir-451a, mmu-mir-17, mmu-mir-18a, mmu-mir-145, mmu-mir-31, and mmu-let-7g (further in the text without species identity) (Table S5). [score:3]
The reaction was performed with initial preheating at 95°C for 2 min followed by 40 cycles of denaturing at 94°C for 15 s, annealing at 58°C for miR-21, miR-29b-1, let7-g, miR-10b, miR-451a, miR-17, and miR-18a, or 62°C for miR-145a and miR-31 for 30 s, and elongation at 70°C for 30 s. The expression of tumour-derived miRNAs was rated relatively to U6 and rpl30 and the concentration of serum-derived miRNAs was normalised to serum volume. [score:3]
The analysis of miRNA profiles showed that the altered pool of miRNAs contained a considerable number of ascertained tumour -associated miRNAs, both oncogenic and tumour-suppressing, such as miRNAs from the let-7 family, mir-107, mir-155, mir-15, mir-16, mir-21, mir-10b, mir-145, mir-451a, mir-29b1, mir-17, mir-18a, and others. [score:3]
[1 to 20 of 3 sentences]
48
[+] score: 9
Foxp3 repression of SATB1 is achieved by inducing miRNA (miR-155, miR-21, miR-7, miR-34a, and miR-18a) binding to the Satb1 3′ untranslated region, indirectly suppressing SATB1. [score:6]
Four other miRNA, miR-7, miR-18a, miR-34a, and miR-155, have been shown to contribute to the stabilization of Treg suppressor function (47, 55, 56). [score:3]
[1 to 20 of 2 sentences]
49
[+] score: 8
Interestingly, downregulation of HDAC9 by si-HDAC9 in P-PDLSCs restored the expression of pri-miR-17-92a as well as the mature miR17-92a, though, miR-18 was not affected, suggesting that HDAC9 inhibited miR17-92a (Fig.   3a, b). [score:8]
[1 to 20 of 1 sentences]
50
[+] score: 8
All the members of the cluster were cloned from purified P6 SCs [14], in situ hybridization with LNA (Locked Nucleic Acid) on adult testes showed miR-17 and miR-20a expression in SCs [12], and ulterior analysis of the small RNA transcriptome of SCs purified from mice at postnatal day 6 revealed high levels of expression for miR-19a and miR-19b, intermediated levels for miR-17 and miR-20a and low levels for miR-18a and miR-92a [16]. [score:5]
The miR-17-92 cluster, also known as Mirc1, is a polycistronic miRNA gene encoding six members (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) which are highly conserved in vertebrates and expressed in practically all tissues analyzed during embryonic and postnatal stages [5– 7]. [score:3]
[1 to 20 of 2 sentences]
51
[+] score: 8
Some of these miRNAs (e. g. miR-18a, miR-20a, miR-93) are upregulated in a high proportion of non-CBF-AML, and are associated with distinct AML subtypes (Additional file 1: Figure S3). [score:4]
The expression of miR-17, miR-18a, miR-20a, miR-93, and miR-181 in was evaluated from published gene expression datasets [24, 25]. [score:3]
Specifically, 52 non-CBF-AML and 31 CBF-AML were analyzed for miR-17, 31 non-CBF-AML and 18 CBF-AML were analyzed for miR-18a, 53 non-CBF-AML and 34 CBF-AML were analyzed for miR-20a, 34 non-CBF-AML and 18 CBF-AML were analyzed for miR-93 and miR-181. [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 8
Figure 4 (A-F) represents relative expression level of miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1, respectively. [score:3]
But the relative expression levels of miR-18a, miR-19a, miR-19b-1, and miR-92a-1 did not show significantly changed after treatment with GEN (Figure 4). [score:3]
This cluster includes miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1 [13, 14]. [score:1]
Figure 2 (A-F) represents miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1, respectively. [score:1]
[1 to 20 of 4 sentences]
53
[+] score: 7
In Dicer c KO mutants, miR-18, -19, and- 92a were downregulated, whereas miR-17 and -20a were upregulated. [score:7]
[1 to 20 of 1 sentences]
54
[+] score: 7
This finding was further demonstrated by reverse transcription-quantitative PCR (RT-qPCR) analysis of tumour-suppressive miR-193a (Fig. 2b), miR-18a (Fig. 2c) and oncogenic miR-21 (Fig. 2d), as an example. [score:3]
Expression of miR-193a (b), miR-18a (c) and miR-21 (d) in the exosomes and exosome donor tissues, including primary colon cancer and liver metastasis of colon cancer, were assessed by qPCR. [score:3]
Our results indicate that the level of miR-18a and miR-193a in the exosomes from either primary colon tumour tissue or metastatic liver of colon tumour is higher than in their donor tumour tissues. [score:1]
[1 to 20 of 3 sentences]
55
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The luminal subtypes of breast cancer appear to have elevated expression of miR-190b, while basal-like tumors have higher levels of miR-18a/b, miR-9 and the miR-17-92 family and lower levels of miR-29 and miR-190b [55]. [score:3]
The higher levels of miR-18a/b, miR-9 and miR-17-92 in the MaSC/basal population suggest that a subset of triple negative cancers may harbor an expression signature that more closely resembles that of the stem cell population. [score:3]
[1 to 20 of 2 sentences]
56
[+] score: 6
microRNA-18a upregulates autophagy and ataxia telangiectasia mutated gene expression in HCT116 colon cancer cells [40]. [score:6]
[1 to 20 of 1 sentences]
57
[+] score: 6
In contrast, miR-18a, miR-19a, miR-19b and miR-20a expression levels were significantly lower in PMBL than in DLBCL. [score:3]
In the wild-type cell lines studied, we found that, as in human samples, miR-92a expression was significantly higher in Karpas than in SU-DHL-5 (Karpas 9.09 (Q1-Q3, 9-9.25); SU-DHL-5 3.3 (Q1-Q3, 3.16-3.31); P =< 0.002) and miR-18a significantly lower (Karpas 0.57 (Q1-Q3, 0.56-0.62); SU-DHL-5 1.17 (Q1-Q3, 0.98-1.37); P =< 0.02). [score:3]
[1 to 20 of 2 sentences]
58
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-9-2, mmu-mir-141, mmu-mir-145a, mmu-mir-155, mmu-mir-10b, mmu-mir-24-1, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10b, hsa-mir-34a, hsa-mir-205, hsa-mir-221, mmu-mir-290a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-31, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-322, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-29b-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-373, hsa-mir-20b, hsa-mir-520c, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-290b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The overexpression of certain oncogenic miRNAs (miR-21, miR-27a, miR-155, miR-9, miR-10b, miR-373/miR-520c, miR-206, miR-18a/b, miR-221/222) and the loss of several tumor suppressor miRNAs (miR-205/200, miR-125a, miR-125b, miR-126, miR-17-5p, miR-145, miR-200c, let-7, miR-20b, miR-34a, miR-31, miR-30) lead to loss of regulation of vital cellular functions that are involved in breast cancer pathogenesis [127, 128]. [score:6]
[1 to 20 of 1 sentences]
59
[+] score: 6
These results show that miR-17 and miR-18 levels were reduced by PMIS-miR-17-18 and this is consistent with other studies demonstrating miR degradation by inhibitors. [score:3]
6 demonstrated 95% knockdown of miR-17 and 86% knockdown of miR-18a by RT-PCR (Figure 10a). [score:3]
[1 to 20 of 2 sentences]
60
[+] score: 6
Seventeen miRNAs were found which had 2-folds or greater differences in levels in VemR A375 melanoma cells as compared with parental A375 cells by microarray (Figure 1B and Supplementary Table S1), with 7 down-regulated miRNAs including miR-7 (40.3-fold), miR-18a-5p (5.2-fold), miR-19a-3p (3.6-fold), miR-20b-5p (3.4-fold), miR-17-5p (3.2-fold), miR-20a-5p (3.1-fold), and miR-19b-3p (2.8-fold) and 10 up-regulated miRNAs including miR-514a-3p (116-fold), miR-129-1-3p (87-fold), miR-509-3p (83-fold), miR-629-3p (22-fold), miR-937-5p (4.6-fold), miR-3960 (4.3-fold), miR-1915-3p (3.2-fold), miR-6090 (3.1-fold), miR-4281 (2.6-fold) and miR-4634 (2-fold). [score:6]
[1 to 20 of 1 sentences]
61
[+] score: 6
A previous study found that miR-18a, miR-126, let-7e, miR-155, and miR-224 were down-regulated while miR-498, miR-187, miR-874, miR-143, and miR-886-3p were up-regulated in asthmatic patients compared to controls [27]. [score:6]
[1 to 20 of 1 sentences]
62
[+] score: 6
Furthermore, miR-18a directly targets HSF2 (heat shock factor 2), a transcription factor that controls the expression of many genes required for successful spermatogenesis[42]. [score:6]
[1 to 20 of 1 sentences]
63
[+] score: 6
The genes and miRNAs expected to be enriched in iPSCs/ESCs, from the literature [18, 21, 38– 42], include transcription factors involved in maintaining “stemness” (FOXD3, GATA6, NANOG, NR6A1, POU5F1, SOX2, UTF1, TFCP2L1, and ZFP42), signaling molecules involved in pluripotency and self-renewal (CRABP2, EDNRB, FGF4, FGF5, GABRB3, GAL, GRB7, IFITM1, IL6ST, KIT, LEFTY1, LEFTY2, LIFR, NODAL, NOG, NUMB, PTEN, SFRP2, and TDGF1), cytokines and growth factors (FGF4, FGF5, LEFTY1, LEFTY2, NODAL, and TDGF1), other ESC-specific genes (BRIX1, CD9, DIAPH2, DNMT3B, IFITM2, IGF2BP2, LIN28A, PODXL, REST, SEMA3A, TERT, ESRG, and GJA1), and miRNAs (miR-302a, miR-302c, miR-371a, miR-302b, miR-302d, miR-372, miR-373, miR-92a-1, miR-92a-2, miR-92b, miR-17, miR-20a, and miR-18a) that were highly enriched in genes and miRNAs that were expressed (NRC ≥ 20) in our reprogrammed iPSCs and the majority of them showed significant upregulation (FC ≥ 2.0, FDR ≤ 0.05) during iPSC reprogramming (Figure 4(c)). [score:6]
[1 to 20 of 1 sentences]
64
[+] score: 6
Other miRNAs from this paper: mmu-mir-199a-1, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-18b
Recent association studies between miRNA markers and lung cancer development have demonstrated that the miRNAs miR-18, miR-199, and miR-519c can suppress HIF-1α expression for the purpose of assessing cancer prognosis [39– 41]. [score:6]
[1 to 20 of 1 sentences]
65
[+] score: 6
The mir-17 family is the one most enriched (p = 3.24 E-4; Table S6) and comprises mir-17, mir-18a, mir-19a, mir-20a, mir-19b-1 and mir-92-1. This family is expressed as polycistronic units, revealing a common regulatory mechanism [62], that is confirmed by the similarity of their expression profiles (Figure 4 D). [score:6]
[1 to 20 of 1 sentences]
66
[+] score: 5
Leivonen reported that five ERα -regulating miRNAs (e. g. miR-18a, miR-18b, miR-193b, miR-302c, and miR-206) directly targeted ERα in the 3′UTR [29]. [score:5]
[1 to 20 of 1 sentences]
67
[+] score: 5
Sprague-Dawley rats treated with 2-AAF for 12 or 24 weeks exhibited disrupted regulation of the miR-34a-p53 feed-back loop and substantial deregulation of expression of miR-18, miR-21, miR-182, and miR-200 family miRNAs [11]. [score:5]
[1 to 20 of 1 sentences]
68
[+] score: 5
By combining transcriptome profiling, in situ hybridization and bioinformatics the authors zoomed in on six miRNAs (miR-15a, miR-18a, miR-30b, miR-99a, miR-182, and miR-199a) showing different spatio-temporal expression in new born mouse cochlea and vestibule. [score:3]
Interestingly two of these miRNAs (miR-15a-1 and miR-18a) were also shown to be important in zebrafish inner ear development. [score:2]
[1 to 20 of 2 sentences]
69
[+] score: 5
The miR-18a* microRNA functions as a potential tumor suppressor by targeting on K-Ras. [score:5]
[1 to 20 of 1 sentences]
70
[+] score: 5
Based on the partial residual expression of the miR-17 and miR-92 families (Figure 7B, 7C), and the generally very low expression of the miR-18 family (Figure 7D, note y axis units), we hypothesized that loss of the miR-19 family was responsible for the defective invasion of 17KPC cell lines. [score:5]
[1 to 20 of 1 sentences]
71
[+] score: 4
Impressively, we found that although several members of the miR-17-92 cluster (miR-17, miR-18a, miR-19a, miR-20a), miR-146a, and miR-101a were not changed in purified splenic B cells, they were significantly upregulated in splenic T cells (Fig. 3). [score:4]
[1 to 20 of 1 sentences]
72
[+] score: 4
Of note, one of these miRNAs (miR-18a-5p) (as well as miR-223-3p, whose expression in addition differed between the two mouse strains) is among three miRNAs that were recently identified as being commonly regulated in the response to IAV infection in all four species screened, i. e., humans, pig, chicken, and mouse (63). [score:4]
[1 to 20 of 1 sentences]
73
[+] score: 4
However, miR-215 [31], miR-375 [32], miR-141, and miR-200c [33], miR-200a [34], miR-429 [35], miR-625 [36], and miR-18a [37] have already been shown to be inversely correlated with the EMT, and they were found downregulated in this subtype. [score:4]
[1 to 20 of 1 sentences]
74
[+] score: 4
Only two of these miRNAs derived from the same primary miRNA gene transcript (mir-17 and mir-18a), showing similar extent of up-regulation in schizophrenia in both cases. [score:4]
[1 to 20 of 1 sentences]
75
[+] score: 4
Interestingly, a group of miRNAs, including miR-221/222, miR-206, miR-18a, and miR-22, have been reported to be involved in the regulation of ERα at either the transcriptional or post-transcriptional level [10, 11], thereby presenting attractive targets for therapeutic intervention in ERα -negative breast cancer. [score:4]
[1 to 20 of 1 sentences]
76
[+] score: 4
The miR-17-92 (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a) cluster was previously described to be regulated by cell cycle via E2F3 binding and by a negative feedback loop through miR-17 that targets E2F2 (ref. [score:4]
[1 to 20 of 1 sentences]
77
[+] score: 4
In addition, the miR-17-19 cluster, which comprises seven miRNAs (miR-17-5p, miR-17-3p, miR-18, miR-19a, miR-20, miR-19b, and miR-92-1) and promotes cell proliferation in various cancers, has been demonstrated to be significantly upregulated at the clonal expansion stage of adipocyte differentiation. [score:4]
[1 to 20 of 1 sentences]
78
[+] score: 4
Our findings show similarities to the regulation of the processing of the human miR-18a since we have also demonstrated that the closed secondary structure is a key determinant to the relative efficient processing of mmu-miR132; however, relaxing the loop with introducing mutations had an adverse effect on miR-132 processing in vitro. [score:3]
hnRNPA1 was the first protein identified to promote the processing of an individual miRNA among the co-transcribed miR-17-92 miRNA cluster by binding to a conserved sequence motif in the loop of miR-18a and generated a more relaxed structure necessary for efficient processing 46. [score:1]
[1 to 20 of 2 sentences]
79
[+] score: 4
The following miRNAs were categorized as oncomiRs for DLBCL: miR-10b [44], miR-155 [9, 19, 29, 44], let-7b [31, 42], miR-18a [1, 14, 41, 44], and miR-130a [44, 46]. [score:1]
This key circulating miRNA signature consists of ten miRNAs (let-7c, let-7b, miR-15a, miR-18a, miR-27a, miR-155, miR-24, miR-130a, miR-10b, and miR-497), which were responsible for DLBCL initiation and was present prior to the formation of visible tumor. [score:1]
Five out of the ten miRNAs (let-7c, miR-15a, miR-18a, miR-24, and miR-130a) showed an increased amount of circulating miRNA with age for both Smurf2 [T/T] and wild-type mice (Fig 4). [score:1]
Since miRNAs can have different aliases, the 10 miRNAs (Fig 1) are identified as the following for the rest of this manuscript: let-7 = let-7b, let-7a-5p = let-7c, miR-10 = miR-10b, miR-130 = miR-130a, miR-155 = miR-155, miR-27 = miR27a, miR-24-3p = miR-24, miR-17 = miR-18a, miR-15 = miR-15a, and miR-16-5p = miR-497. [score:1]
[1 to 20 of 4 sentences]
80
[+] score: 4
However, we didn’t find predicted target site of miR-18a/19a/19b/92a on E2F1. [score:3]
The miR-17-92 cluster is conserved among vertebrates, comprising six miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1 [8]. [score:1]
[1 to 20 of 2 sentences]
81
[+] score: 3
MP1, MP2, MP3, MP4, MP5, MP6 and MP7 had a common core comprised of mmu-miR-1-3p, mmu-miR-145-5p, mmu-miR-18a-5p, mmu-miR-199a-5p, mmu-miR-200b-3p, mmu-miR-223-3p, mmu-miR-291a-3p, mmu-miR-34a-5p and their target mRNAs. [score:3]
[1 to 20 of 1 sentences]
82
[+] score: 3
MiR-18a promotes the proliferation, migration and invasion of glioma cells, whereas miR-146a and miR-449a inhibit glioma growth by inducing cellular apoptosis [20– 22]. [score:3]
[1 to 20 of 1 sentences]
83
[+] score: 3
miR-17 and miR-20a belong to a group of commonly overexpressed miRNAs, the miR-17∼92 cluster, which is located on mouse chromosome 14 (13 in humans) and comprises 7 mature miRNAs (miR-17-5p and, miR-18a, miR-19a and b, miR-20a, and miR-92a). [score:3]
[1 to 20 of 1 sentences]
84
[+] score: 3
Calvano Filho CMC Calvano-Mendes DC Carvalho KC Maciel GA Ricci MD Torres AP Triple -negative and luminal A breast tumors: differential expression of miR-18a-5p, miR-17-5p, and miR-20a-5pTumour Biol. [score:3]
[1 to 20 of 1 sentences]
85
[+] score: 3
Real-time PCR analyses showed a significant decrease of miR-17, miR-18a, miR-20a and miR-92a in bone tissues, reduction of all family members in bone marrow and reduced expression of miR-17, miR-18a, miR-19a, miR-20a and miR-92a could be observed in BMMSCs (Fig. 4A-C). [score:3]
[1 to 20 of 1 sentences]
86
[+] score: 3
In splenocytes from the MRL-lpr mice (the samples in our previous study), the expression levels of miR-18a-5p, miR-31-5p, miR-96-5p, miR-127-3p, miR-182-5p, miR-183-5p, and miR-379-5p were significantly higher, while those of miR-101a-3p and miR150-5p were significantly lower in the C group than in the N group. [score:3]
[1 to 20 of 1 sentences]
87
[+] score: 3
34, 35 The miR-17/92 cluster (Figure 3c) includes miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1. Therefore, we set out to precisely quantify the expression levels of those eight miRNAs (miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, miR-92a-1 and miR-106a/b), all of which belong to the miR-17 family or the miR-17/92 cluster, using real-time quantitative RT-PCR with U6 snRNA as an internal control probe. [score:3]
[1 to 20 of 1 sentences]
88
[+] score: 3
No differences in miRNA expression were found in kidneys of ischemic heart failure mice compared to control animals (S6 Table) and only small differences were observed between expression levels of miR-18a-5p, miR-30e-5p, miR-199a-3p and miR-223-3p in the LV of mice with ischemic heart failure compared to controls (S7 Table), however not reaching significance after Bonferroni correction for multiple testing. [score:3]
[1 to 20 of 1 sentences]
89
[+] score: 3
Murakami et al. [48] showed a correlation between miR-222, miR-106a, miR-92, miR-17-5p, miR-20 and miR-18 and the degree of differentiation suggesting an involvement of specific miRNAs in the progression of the disease. [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
E [2] decreased miR-146a, miR 125a, miR-125b, let-7e, miR-126, miR-145, and miR-143 and increased miR-223, miR-451, miR-486, miR-148a, miR-18a, and miR-708 expression in mouse splenic lymphocytes [199]. [score:3]
[1 to 20 of 1 sentences]
91
[+] score: 3
Overexpression of miR-17~92 cluster (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) induces lymphoma [29]. [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
The resultant 37 miRNAs with adjusted p values < 0.1 were subjected to Dunnett's test using non-target cells as control, and we then identified six miRNAs (mmu-miR-18a, -25, -29b, -140, -337, and -1839) with adjusted p values < 0.05 (Figure 2C). [score:3]
[1 to 20 of 1 sentences]
93
[+] score: 3
Several miRNAs from the MYCN -induced miR-17–92 cluster (miR-17-5p, miR-18-5p, miR-20a-5p and miR-92a-3p) were significantly upregulated in LSL- MYCN;Dbh-iCre tumors compared with normal adrenals from wild-type mice (Supplementary Figure 8b). [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-33a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-191, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-10a, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-let-7a-3, gga-mir-155, gga-mir-18a, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-mir-126, gga-let-7a-2, gga-mir-27b, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, hsa-mir-33b, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-675, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, hsa-mir-675, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-664a, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, gga-mir-10a, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, mmu-mir-126b, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
According to previous experimental studies, DICER1 was found targeted by nine miRNAs: hsa-let-7a, - 7b, - 7c, and -7d, hsa-mir-18a, -103, -107, -374a, and -519a [52]– [55]. [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 3
Several miRNAs, such as miR-101 [6], miR-122 [7], [8], [9] miR-373 [10], miR-221/222 [11], [12], [13], miR-195 [14], miR-30d [15], miR-125b [16], miR-18a [17], miR-139 [18], miR-223 [19] and miR-29 [20], have already been reported to regulate HCC tumor progression and metastasis by regulating key genes such as Mcl-1, ADAM17, YAP, DDIT4, Cyclin D1, CDK6, E2F3, Galphai2, LIN28B, estrogen receptor-α, Rho-kinase 2, Stathmin 1 and Bcl-2 and so on. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-18a, hsa-mir-21, hsa-mir-27a, hsa-mir-96, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30b, mmu-mir-99a, mmu-mir-124-3, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-27a, mmu-mir-96, mmu-mir-135b, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-200a, hsa-mir-135b, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-15a-1, dre-mir-15a-2, dre-mir-18a, dre-mir-21-1, dre-mir-21-2, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30b, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-135c-1, dre-mir-135c-2, dre-mir-200a, dre-mir-200b, dre-let-7j, dre-mir-135b, dre-mir-181a-2, dre-mir-135a, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
mir-15a, mir-18a, mir-30b, mir-99a and mir-199a were found in different and distinct regions of the mouse P0 cochlea and vestibule, including hair and supporting cells, the spiral ganglia and other cell types. [score:1]
These findings were followed by a report that miR-15a-1 is found in neuromasts and throughout the inner ear and miR-18a is mainly in the utricular macula and nearby cells at 48 h post-fertilization (hpf) (Friedman et al, 2009). [score:1]
[1 to 20 of 2 sentences]
97
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
In the miR-17-92 cluster, ssc-miR-17 and ssc- miR-18 had higher expression in mpiPSCs compared with the pEFs. [score:2]
[1 to 20 of 1 sentences]
98
[+] score: 2
Protein levels and function of p53 have been shown to be regulated by miRNAs including miR-125 [43], miR-18 [23], and miR-504 [28]. [score:2]
[1 to 20 of 1 sentences]
99
[+] score: 2
LncRNA CASC2 have been demonstrated as playing crucial regulatory roles in a few of cancers, and functioned as endogenous RNA by sponging miRNAs, such as miR-18a [26], miR-367 [27], miR-21 [28], etc. [score:2]
[1 to 20 of 1 sentences]
100
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
For example let-7, miR-18a and miR-143 are strongly linked to KRAS knockdown and activation of the epidermal growth factor receptor-mitogen activated protein kinase (EGFR-MAPK) pathway, whereas miR-21 and miR-126 are associated with augmentation or inactivation of the phosphatidylinositol-3-kinase pathway (Aslam et al., 2012). [score:2]
[1 to 20 of 1 sentences]