sort by

168 publications mentioning mmu-mir-20a (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-20a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 383
The EMAP-II -induced up-regulation of LC3-II/I, and down-regulation of P62/SQSTM1, was blocked by miR-20a overexpression; while miR-20a had a negative effect on ATG7 and ATG5 protein expression. [score:11]
The protein expression level of LC3-II/I significantly up-regulated and the protein expression level of P62/SQSTM1 significantly down-regulated in miR-20a (−) group when compared to control and miR-20a (−) NC groups. [score:10]
These results indicated that miR-20a overexpression reversed the effect of EMAP-II up -regulating the expression of LC3-II/I and down -regulating the expression of p62/SQSTM1, and miR-20a might be involved in the regulating of EMAP-II inducing autophagy. [score:10]
These findings suggest that low miR-20a expression contributes to up-regulation of autophagy-related protein expression, activates autophagy, and inhibits the proliferation of glioma cells. [score:10]
Compared with EMAP-II + miR-20a (+) NC group, EMAP-II + miR-20a (+) significantly down-regulated LC3-II/I protein expression and up-regulated P62/SQSTM1 protein expression (P < 0.05), whereas EMAP-II + miR-20a (−) group showed no significant differences. [score:10]
As shown in Figures 4A–H, the protein expression level of LC3-II/I significantly down-regulated and the protein expression level of P62/SQSTM1 significantly up-regulated in miR-20a (+) group compared with control and miR-20a (+) NC groups (P < 0.05). [score:10]
Therefore, EMAP-II may up-regulate expression of ATG5 and ATG7 via down-regulation of miR-20a, inducing autophagy in glioma cells. [score:9]
EMAP-II and miR-20a Inhibitor Inhibited Tumor Growth In VivoThe growth -inhibitory effect of EMAP-II and miR-20a inhibitor on U-87 and U-251 cells was further tested in xenografted mice. [score:9]
above demonstrated that EMAP-II up-regulates expression of ATG7 and ATG5 through miR-20a inhibition. [score:8]
This suggests that EMAP-II up-regulation of ATG7 and ATG5 by down-regulation of miR-20a leads to autophagy. [score:7]
MiR-20a and miR-106b negatively regulate autophagy induced by leucine deprivation via suppression of ULK1 expression in C2C12 myoblasts. [score:6]
MiR-20a targets the ATG ULK1 post-transcriptionally and regulates autophagy of C2C12 cells (Wu et al., 2012), suggesting control by regulating expression of the autophagy-related protein. [score:6]
In summary, this is the first study proposing that low-dose EMAP-II treatment induces autophagy of U-87 and U-251 glioma cells leading to inhibition of cell viability, migration and invasion via the down-regulation of miR-20a. [score:6]
In addition, miR-20a overexpression significantly down-regulated ATG7 and ATG5 protein levels. [score:6]
Whether EMAP-II induces autophagy through down-regulation of miR-20a expression, and thus affects the viability of glioma cells, is not known. [score:6]
MiR-20a expression significantly increased in glioma stem cells, which enhanced invasiveness (Wang et al., 2015); the degree of malignancy in brainstem gliomas was often higher in children than in adults, which correlated with up-regulation of miR-20a in pediatric brainstem gliomas (Wang et al., 2012). [score:6]
Research showed that miR-20a overexpression inhibits transformation from LC3-I to LC3-II, thereby negatively regulating autophagy in liver cancer cells (Chen et al., 2015). [score:6]
The results of this study showed that EMAP-II treatment of U-87 and U-251 cells led to a significant decrease in miR-20a expression and a significant increase in ATG7 and ATG5 expression. [score:5]
When the tumors grew to about 80 mm [3], the tumor-bearing mice were divided into four groups: (1) Control group, treated with 0.9% sodium chloride; (2) EMAP-II group, treated with 80 ng/kg EMAP-II; (3) miR-20a (−) group, treated with miR-20a (−) stable expressing cells; and (4) EMAP-II + miR-20a (−) group, treated with miR-20a (−) stable expressing cells and 80 ng/kg EMAP-II. [score:5]
Figure 8EMAP-II and miR-20a inhibitor inhibited tumor growth in vivo. [score:5]
Therefore, EMAP-II can inhibit miR-20a expression and induce autophagy of U-87 and U-251 glioma cells by an unknown mechanism. [score:5]
However, neither miR-20a overexpression nor silencing affected mRNA expression. [score:5]
In this study, miR-20a overexpression prevented the EMAP-II -induced increase of LC3-II/I and decreases of P62/SQSTM1 expression. [score:5]
Figure 7 EMAP-II alone and EMAP-II combined with miR-20a inhibitor inhibited the proliferation, migration and invasion of U-87 and U-251 Cells. [score:5]
Our study found that the expression level of miR-20a was significantly decreased in U-87 and U-251 glioma cells after EMAP-II treatment, suggesting EMAP-II inhibited the viability, migration, and invasion of glioma cells by decreasing miR-20a via an unknown mechanism. [score:5]
MicroRNA-20a (MiR-20a), a miR-17-92 family member located on chromosome 13, is highly expressed in glioma tissues; overexpression of miR-20a promotes proliferation of U-251 glioma cells, suggesting a tumor-promoting effect (Yao et al., 2012). [score:5]
In order to study the effect of miR-20a on EMAP-II inducing autophagy of U-87 and U-251 glioma cells, the experiments were divided into 10 groups (n = 8): (1) Control group; (2) EMAP–II group; (3) miR-20a (+) NC group, transfected with negative control of miR-20a overexpression; (4) miR-20a (+) group, transfected with miR-20a overexpression; (5) miR-20a (−) NC group, transfected with negative control of miR-20a silencing; (6) miR-20a (−) group, transfected with miR-20a silencing; (7) EMAP-II + miR-20a (+) NC group; (8) EMAP-II + miR-20a (+) group; (9) EMAP-II + miR-20a (−) NC group; and (10) EMAP-II + miR-20a (−) group. [score:5]
For example, miR-20a overexpression significantly inhibited the proliferation and invasive capacity of thyroid cancer cells (Xiong et al., 2014), while it is a cancer-promoter in cervical cells (Kang et al., 2012). [score:5]
EMAP-II and miR-20a Inhibitor Inhibited Tumor Growth In Vivo. [score:5]
MiR-20a is upregulated in anaplastic thyroid cancer and targets LIMK1. [score:5]
Similar to the above results, EMAP-II and miR-20a (−) groups inhibited the migration and invasion of cells, and the combination of EMAP-II and miR-20a (−) group displayed maximum inhibitory effect on the migration and invasion of cells (P < 0.05, Figures 7C–H). [score:5]
The growth -inhibitory effect of EMAP-II and miR-20a inhibitor on U-87 and U-251 cells was further tested in xenografted mice. [score:5]
Oncogenic miR-20a and miR-106a enhance the invasiveness of human glioma stem cells by directly targeting TIMP-2. Oncogene 34, 1407– 1419. [score:4]
Upregulation of miR-20a and miR-106b is involved in the acquisition of malignancy of pediatric brainstem gliomas. [score:4]
To verify that ATG7 or ATG5 3′-UTR is a direct target of miR-20a, we cloned the reporter plasmid containing the wild 3′-UTR of ATG7 and ATG5 (atg7/ATG5-3UTR-Wt) and mutant 3′-UTR of ATG7 and ATG5 (atg7/ATG5-3UTR-mut). [score:4]
To further verify the regulation effect of miR-20a on ATG7 and ATG5 expression, the experiments were divided into five groups: (1) Control group; (2) miR-20a (+) NC group; (3) miR-20a (+) group; (4) miR-20a (−) NC group; and (5) miR-20a (−) group. [score:4]
These results showed that miR-20a directly targeted the 3′-UTR of ATG7 and ATG5. [score:4]
Figure 6 ATG7 and ATG5 are the direct targets of miR-20a. [score:4]
This study aims to verify whether low-dose (0.05 nM) EMAP-II treatment induces autophagy in U-87 and U-251 glioma cells by regulation of the expression of miR-20a, and explores the molecular mechanisms associated with EMAP-II -induced glioma cell autophagy. [score:4]
To further confirm whether miR-20a is involved in EMAP-II -induced autophagy, western blot and immunofluorescence assays were used to test the protein expression of LC3 and P62/SQSTM1 in U-87 and U-251 cells, which were transfected with a mimic or inhibitor of miR-20a. [score:4]
Putative binding site between the 3′UTR of ATG7 (ATG5) mRNA and the seed region of miR-20a were predicted by TargetScan Human Release 6.2. [score:3]
showed that both EMAP-II and the miR-20a inhibitor effectively reduced cell viability, migration and invasion, and the combination brought synergistic or enhanced effects. [score:3]
Real-Time PCR analysis was performed to test the expression levels of miR-20a, ATG7 and ATG5 by means of a 7500 Fast Real-Time PCR System. [score:3]
Cells were seeded on six-well plates cultured overnight, then transfected with miR-20a mimic, miR-20a inhibitor, or their respective negative control (GenePharma, Shanghai, China) using lipofectamine 2000 reagent (Life Technologies Corporation) according to the manufacturer’s instructions. [score:3]
The expression levels of miR-20a decreased significantly after EMAP-II treatment. [score:3]
The expression levels of miR-20a in U-87 and U-251 cells after treating with EMAP-II were detected by quantitative real-time PCR. [score:3]
MiR-20a Directly Targeted the 3′-UTR of ATG7 and ATG5. [score:3]
MiR-20a Negatively Regulated ATG7 and ATG5 Protein Expression Levels in U-87 and U-251 Cells. [score:3]
Furthermore, combination of EMAP-II with a miR-20a inhibitor significantly reduces the proliferation, migration and invasion of glioma cells, prevents tumor growth in vivo, and exerts a synergistic effect against glioma. [score:3]
Using the bioinformatics Software TargetScan Human Release 6.2, putative binding sites for miR-20a were predicted on ATG7 and ATG5. [score:3]
After infection, the stable expressing cells of miR-20a-silencing [miR-20a (−)] were picked. [score:3]
EMAP-II and miR-20a inhibition significantly reduced the viability, migration and invasion of U-87 and U-251 cells in a synergistic manner. [score:3]
U-87 and U-251 cells were transfected with miR-20a mimics and its inhibitors, and then the mRNA and protein levels of ATG7 and ATG5 in U-87 and U-251 cells were detected by using western blot and quantitative real-time PCR, respectively. [score:3]
These data showed that nude mice were treated by EMAP-II combined with miR-20a inhibitor produced the smallest tumors and had the highest survival rate. [score:3]
Expression of hsa-miR-20a in human glioma tissues and its effect on the proliferation of human glioma cells in vitro. [score:3]
However, protein expression levels of ATG7 and ATG5 in miR-20a (−) group increased in comparison with those of control group and miR-20a (−) NC group (P < 0.05). [score:3]
The Effects of miR-20a on the Protein Expression of LC3 and P62/SQSTM1 in U-87 and U-251 Cells. [score:3]
The functional role of EMAP-II and miR-20a inhibitor alone or in combination on cell viability, migration and invasion of U-87 and U-251 cells was determined. [score:3]
EMAP-II and the miR-20a inhibitor contributed to reduced tumor size and prolonged survival of the mice, highlighting the synergistic effect against glioma. [score:3]
The expression change of P62/SQSTM1 was reversed to LC3, which was decreased in EMAP-II, miR-20a (−) and EMAP-II + miR-20a (−) groups, while increased in miR-20a (+) group and there was no significant difference between EMAP-II + miR-20a (+) group and respective control groups. [score:3]
Figure 3 Effects of EMAP-II on the expression of microRNA-20a (miR-20a) in U-87 and U-251 glioma Cells. [score:3]
This study finds that EMAP-II and miR-20a inhibition have an antitumor effect toward glioma cells. [score:3]
As shown in Figures 6A,B, by using TargetScan Human Release 6.2 Software [1], 3′-UTR of ATG7 and ATG5 was predicted as a putative binding site matching with the seed region of miR-20a. [score:3]
Therefore, EMAP-II combined with a miR-20a inhibitor shows promise as a new treatment for glioma. [score:3]
The Single or Combined Application of EMAP-II and miR-20a Inhibitors on the Viability, Migration and Invasion of U-87 and U-251 Cells. [score:3]
To study the effect of EMAP-II and miR-20a inhibitor alone and in combination on cell proliferation, migration, and invasion, U-87 and U-251 cells were divided into six groups (n = 8): (1) Control group; (2) EMAP-II group; (3) miR-20a (−) NC group; (4) miR-20a (−) group; (5) NS + miR-20a (−) NC group, treatment with 0.9% sodium chloride after negative control of miR-20a silencing transfection; and (6) EMAP-II + miR-20a (−) group. [score:3]
Figure 4 The effects of miR-20a on protein expression levels of LC3 and P62/SQSTM1 in EMAP-II treated U-87 and U-251 glioma cells. [score:3]
A subsequent study analyzed the effect of EMAP-II and the miR-20a inhibitor on tumor size and survival time in a nude mouse mo del of subcutaneous xenograft. [score:3]
The combination of EMAP-II and miR-20a (−) displayed greater inhibitory effect than either EMAP-II or miR-20a (−) alone (P < 0.05). [score:3]
The Effects of Low-Dose EMAP-II on the miR-20a Expression Levels in U-87 and U-251 Cells. [score:3]
Furthermore, nude mice carrying silencing-expressed miR-20a combined with EMAP-II treatment had the smallest tumors and highest survival. [score:3]
The cells were harvested after 48 h. After the cell clones of miR-20a overexpression or silencing were established, EMAP-II was administrated for 0.5 h. Cell viability was analyzed by MTT (Solarbio Company, Beijing, China) assay. [score:2]
The protein expression levels of ATG7 and ATG5 in miR-20a (+) group were significantly decreased compared with those of control group and miR-20a (+) NC group (P < 0.05). [score:2]
miR-20a promotes migration and invasion by regulating TNKS2 in human cervical cancer cells. [score:2]
Compared with EMAP-II group, the expression of LC3 decreased in EMAP-II + miR-20a (+) group and there was no significant difference in EMAP-II + miR-20a (−) group. [score:2]
As shown in Figures 3A,B, compared with control group, EMAP-II significantly reduced the expression levels of miR-20a normalized to U6 at 0.5 h and 1 h and the decline was most obvious at 0.5 h (P < 0.05); meanwhile, there was no significant difference among EMAP-II 3 h, 6 h groups and control group (P > 0.05). [score:2]
However, whether EMAP-II induced autophagy of U-87 and U-251 cells via regulation of miR-20a is not clear. [score:2]
This suggests that miR-20a post-transcriptionally regulates ATG7 and ATG5. [score:2]
The mechanism of action is associated with negative regulation of the autophagy-related proteins ATG7 and ATG5 by miR-20a. [score:2]
For quantification of miR-20a expression, reverse transcription and real-time PCR amplification were carried out using Taqman MicroRNA Reverse Transcription Kit and Taqman Universal Master Mix II with the TaqMan MicroRNA Assay of miR-20a and U6 (Applied Biosystems, Foster, CA, USA), respectively. [score:2]
As shown in Figures 8A–F, tumor volumes of xenografts were significantly suppressed in EMAP-II, miR-20a (−) and EMAP-II + miR-20a (−) groups as compared to control group (P < 0.01), and the tumor volumes was most significantly decreased in EMAP-II + miR-20a (−) group (P < 0.01). [score:2]
Compared with EMAP-II group, the expression of P62/SQSTM1 increased in EMAP-II + miR-20a (+) group and there was no significant difference in EMAP-II + miR-20a (−) group. [score:2]
As shown in Figure 4I, the LC3 expression significantly increased in EMAP-II, miR-20a (−) and EMAP-II + miR-20a (−) groups, while decreased in miR-20a (+) group and there was no significant change in EMAP-II + miR-20a (+) group when compared to respective control group. [score:2]
MiR-20a acts as a tumor promoter or suppressor, depending on the cell type. [score:2]
miR-20a (−) NC; [▴▴] P < 0.01 vs. [score:1]
miR-20a (−) NC group; [Δ] P < 0.05 vs. [score:1]
Survival curve analysis showed that, survival time of nude mice was longer in EMAP-II, miR-20a (−) and EMAP-II + miR-20a (−) groups than that in control group, and was significantly longest in EMAP-II + miR-20a (−) group (Figures 8G,H). [score:1]
The miR-20a silencing was ligated into the pLenti6.3/V5eDEST vector (GenePharma, Shanghai, China) and then pLenti6.3/V5eDEST-miR-20a-scilecing vector was generated. [score:1]
ATG5wt + miR-20a (+) NC group, [##] P < 0.01 vs. [score:1]
miR-20a (−) NC group. [score:1]
Furthermore, miR-20a is also considered as an autophagy-related gene (ATG) and it may participate in regulating leucine deprivation -induced autophagy by changing intracellular levels of key autophagy-related proteins in C2C12 myoblasts (Wu et al., 2012). [score:1]
Whereas, miR-20a (−) group showed the opposite effect. [score:1]
This indicates that miR-20a may serve as a cancer-promoting gene and affect the biological activity of glioma cells. [score:1]
ATG7 wt + miR-20a (+) group. [score:1]
NS + miR-20a (−) NC group; [Δ] P < 0.05 vs. [score:1]
As shown in Figures 5A,B,G,H, there were no obvious differences of ATG7 mRNA and ATG5 mRNA levels between miR-20a (+) and miR-20a (+) NC groups, miR-20a (−) and miR-20a (−) NC groups (P > 0.05). [score:1]
miR-20a (+) NC group; [▴] P < 0.05 vs. [score:1]
It has been reported that miR-20a can affecte autophagy in C2C12 cells (Wu et al., 2012). [score:1]
EMAP-II + miR-20a (+) NC group. [score:1]
miR-20a (−) group. [score:1]
There was no significant difference among EMAP-II, EMAP-II + miR-20a (+) NC and EMAP-II + miR-20a (−) NC groups. [score:1]
The tumor-promoting effect of miR-20a has been reported in glioma cells and tissues (Yao et al., 2012). [score:1]
After that, cells were co -transfected with the wild-type or mutated ATG7 (ATG5)-3′UTR reporter plasmid (GenePharma, Shanghai, China), and transfected with miR-20a mimic or miR-20a mimic NC. [score:1]
Lentivirus encoding miR-20a silencing was generated using pLenti6.3/V5eDEST Gateway Vect—or Kit (Life Technologies Corporation, Carlsbad, CA, USA). [score:1]
As shown in Figures 5C–F, 5C–F,I–L, there were no obvious differences among control, miR-20a (+) NC and miR-20a (−) NC groups. [score:1]
[1 to 20 of 105 sentences]
2
[+] score: 230
The miR-20a-5p expression levels in SJSA-1 cells compared with G-292 cells (summarized in Table a) were analyzed by miR-seq and qRT-PCR analyses in plot b. The expression level of KIF26B is higher in SJSA-1 cells than in G-292 cells, as summarized in Table c. Western blot and qRT-PCR analyses are shown in plots d and e, respectively To examine the effects of miR-20a-5p on the expression of its targets in OS, we measured the RNA and protein levels of putative miR-20a-5p target genes, which were chosen by TargetScan (http://www. [score:10]
miR-20a-5p expression has been shown to correlate with the development and progression of diverse cancer types [26– 36]; for example, miR-20a-5p can be downregulated by glioblastoma hypoxia [31], which often promotes radioresistance and chemoresistance in cancer cells. [score:7]
In conclusion, this study is the first to illustrate that miR-20a-5p can regulate OS multi-drug resistance through its direct target gene KIF26B by targeting it in a classical 3′-UTR binding fashion. [score:7]
The current study is the first to demonstrate that KIF26B mRNA and protein expression is upregulated in OS cells because of hypermethylation of its upstream regulator miR-20a. [score:7]
Chemically modified mimic oligonucleotides (agomir) were synthesized to upregulate miR-20a-5p expression in vivo. [score:6]
To profile miRNA expression in the G-292 and SJSA-1 OS cell lines, we performed RNA-seq -based miR-omic analysis and referred to the relevant literature, and miR-20a-5p was selected as one of the studied target genes. [score:5]
The siRNA sequences used to produce KIF26B interference in this study were as follows: si-KIF26B: 5′-CGGACAGCCUCUCCUAUUAdTdT-3′ 3′-dTdTGCCUGUCGGAGAGGAUAAU-5′ hsa-miR-20a-5p antagomir: 5′-CUACCUGCACUAUAAGCACUUUA-3′ mimic: sense 5′-UAAAGUGCUUAUAGUGCAGGUAG-3′ antisense 5′-CUACCUGCACUAUAAGCACUUUA-3′ A full-length human KIF26B 3′-untranslated region (UTR, 520 bp) and wild-type (WT) and mutant (Mut) target sequences for miR-20a-5p were cloned on either side of the 3′-region of the luciferase coding sequence in the pmiR-RB-REPORT™ vector to construct the pmiR-RB-REPORT™-KIF26B vector. [score:5]
Western blot results showed that KIF26B expression was suppressed by transfection of the miR-20a-5p mimic in SJSA-1 cells (~28 %) and enhanced in antagomir -transfected G-292 cells (~3.15-fold) (Fig.   3a–e) relative to the negative control. [score:5]
The results showed that transfection with the miR-20a-5p mimic reduced the KIF26B level to 36 % of that found in the NC and that KIF26B siRNA inhibited KIF26B protein expression to approximately 40 % of the NC control (Fig.   4a). [score:5]
The siRNA sequences used to produce KIF26B interference in this study were as follows: si-KIF26B: 5′-CGGACAGCCUCUCCUAUUAdTdT-3′ 3′-dTdTGCCUGUCGGAGAGGAUAAU-5′ hsa-miR-20a-5p antagomir: 5′-CUACCUGCACUAUAAGCACUUUA-3′ mimic: sense 5′-UAAAGUGCUUAUAGUGCAGGUAG-3′ antisense 5′-CUACCUGCACUAUAAGCACUUUA-3′ A full-length human KIF26B 3′-untranslated region (UTR, 520 bp) and wild-type (WT) and mutant (Mut) target sequences for miR-20a-5p were cloned on either side of the 3′-region of the luciferase coding sequence in the pmiR-RB-REPORT™ vector to construct the pmiR-RB-REPORT™-KIF26B vector. [score:5]
We provide experimental evidence that miR-20a-5p repression of the direct target kinesin family member 26B (KIF26B), a member of the kinesin family that can attach to and move along microtubules to transport cellular cargoes, improved the chemosensitivity of OS cells to multiple drugs, including doxorubicin (Dox), etoposide (Etop), methotrexate (MTX), cisplatin (CDDP) and carboplatin (Carb). [score:4]
Expression of the DNA methylation-regulated miR-20a gene positively correlates with the multi-chemoresistance of OS cells. [score:4]
c, d The effects of the forced expression of miR-20a-5p or knockdown of KIF26B on the cell cycle distribution of SJSA-1 cells shown by FACS analysis in plot and in the original To further explore the mechanism underlying OS chemoresistance, we detected the activities of the following seventeen signaling pathways using Qiagen pathway reporter systems in both SJSA-1 and G-292 cells: oxidative stress, DNA damage, NF-κB, hypoxia, ER stress, heavy metal stress, heat shock, glucocorticoid, JNK, xenobiotic, Wnt, Notch, TGF-β, cell cycle/pRb-E2F, Myc/Max, and MAPK/ERK (Fig.   6a). [score:4]
The results showed that miR-20a-5p directly targeted kinesin family member 26B (KIF26B) in OS cells. [score:4]
a, b The effects of forced expression of miR-20a-5p and knockdown of KIF26B on the apoptosis of SJSA-1 cells shown by FACS analysis in table and in the original. [score:4]
MiR-20a-5p specifically suppresses KIF26B expression in OS cells. [score:4]
Overexpression of KIF26B modulates multi-drug resistance effects similar to miR-20a-5p knockdown in OS cells. [score:4]
Fig.  3KIF26B is a direct target of miR-20a-5p in OS cells. [score:4]
In this study, we demonstrated that the expression level of miR-20a-5p varies in OS cells with different levels of chemosensitivity, suggesting that miR-20a-5p might participate in the regulation of OS chemoresistance. [score:4]
e (*p < 0.05; **p < 0.01)Additionally, the miR-20a-5p mimic mediated KIF26B downregulation in SJSA-1 cells and increased the percentage of apoptotic cells from 1.29 to 5.01 %. [score:4]
The RT-PCR validation also confirmed that miR-20a-5p was significantly more highly expressed in the G-292 than the SJSA-1 cell line (by more than eightfold), suggesting that this miR might be involved in regulating the multi-drug resistance of OS cells. [score:4]
In conclusion, the KIF26B gene was shown to be a novel direct target of miR-20a-5p in OS cells and might contribute to miR-20a-5p -mediated multi-drug resistance in OS cells. [score:4]
e (*p < 0.05; **p < 0.01) Additionally, the miR-20a-5p mimic mediated KIF26B downregulation in SJSA-1 cells and increased the percentage of apoptotic cells from 1.29 to 5.01 %. [score:4]
In this study, we report that miR-20a-5p was downregulated in a multi-drug-resistant (MDR) human OS cell line (SJSA-1) and describe the mechanism of OS chemoresistance mediated by miR-20a-5p. [score:4]
The methylation ratio of the miR-20a gene in SJSA-1 cells in most CpG islands is much higher than the ratio in G-292 cells, as high as approximately 10-fold on average (51.53:5.67, Fig.   1c, d), indicating that miR-20a methylation is negatively correlated with miR-20a-5p expression (Fig.   2a, b). [score:3]
We found that miR-20a-5p was more highly expressed in G-292 cells than in SJSA-1 cells. [score:3]
The association data include protein, DNA and genetic interactions and pathways; gene and protein expression data; phenotypic screens and shared protein domains Further confirmation of the role of miR-20a-5p in OS cell resistance to Dox was obtained by immuno-histological analysis of KIF26B and Ki67 in tumor sections of Dox -treated versus PBS -treated mice. [score:3]
One of miR-20a-5p’s targets, kinesin family member 26B (KIF26B), was found to mediate the miR-20a-5p -induced reduction in OS chemoresistance by modulating the activities of the MAPK/ERK and cAMP/PKA signaling pathways. [score:3]
Because of its repressive effect on KIF26B and other downstream effects on two signaling pathways, decreasing miR-20a-5p expression promotes OS multi-drug resistance (at least for Dox, Etop and Carb, which were studied in this report) both in vitro and in vivo. [score:3]
To the best of our knowledge, this study provides the first evidence of the potential utility of miR-20a-5p as an important target for developing novel OS chemotherapeutics. [score:3]
d Methylation percentage at each CpG site in the SJSA-1 and G-292 cells Fig.  2Different expression patterns of miR-20a-5p/KIF26B in SJSA-1 and G-292 cells. [score:3]
Forced expression of miR-20a-5p counteracted OS cell chemoresistance in both cell culture and tumor xenografts in nude mice. [score:3]
Among these genes, the expression of kinesin family member 26B (KIF26B), which has a binding site for miR-20a-5p in the 3′-UTR of its mRNA, was opposite to that of miR-20a-5p at both the RNA (Fig.   2c, d) and protein levels (Fig.   2e) in G-292 and SJSA-1 cells. [score:3]
Moreover, we bioinformatically identified key links that connect miR-20a-5p to two signaling pathways via its target gene KIF26B, through which a chemoresistant phenotype is produced in OS cells. [score:3]
These results indicated that miR-20a-5p compromised the tumor -inhibition capability of Dox. [score:3]
Our data suggested that the miR-20a-5p level might serve as a potential biomarker of chemotherapy-resistant OS and that miR-20a-5p overexpression might aid in overcoming OS drug resistance. [score:3]
The levels of miR-20a-5p and KIF26B mRNA expression were determined by quantitative real-time PCR. [score:3]
f Layout of the luciferase reporter plasmid and the sequence of the WT and Mut UTR region of the KIF26B gene targeted by miR-20a-5p. [score:3]
The association data include protein, DNA and genetic interactions and pathways; gene and protein expression data; phenotypic screens and shared protein domainsFurther confirmation of the role of miR-20a-5p in OS cell resistance to Dox was obtained by immuno-histological analysis of KIF26B and Ki67 in tumor sections of Dox -treated versus PBS -treated mice. [score:3]
All of these observations suggest that KIF26B acts as a downstream target of miR-20a-5p and mediates chemoresistance against Dox, Etop, MTX, CDDP and Carb in OS cells. [score:3]
Fig.  4Effects of forced alteration of miR-20a-5p or KIF26B expression on chemoresistance in SJSA-1 and G-292 cells. [score:3]
Therefore, miR-20a-5p is capable of inhibiting in vivo tumor growth. [score:3]
This result indicated that low levels of miR-20a-5p promoted OS cell survival probably by increasing KIF26B expression. [score:3]
In conclusion, both the DNA methylation and gene expression levels of miR-20a-5p are tightly correlated with multi-drug resistance in OS cells. [score:3]
Expression of the miR-20a gene was negatively controlled by DNA methylation. [score:3]
To explore how miR-20a-5p affects chemoresistance regulation in OS, a luciferase reporter assay was performed to identify potential target genes of miR-20a-5p. [score:3]
KIF26B expression decreases in miR-20a-5p agomiR -injected SJSA-1 tumor xenografts and increases in antagomir -injected G-292 tumor xenografts in nude mice. [score:3]
Fig.  6Signaling pathways regulated by miR-20a-5p and KIF26B. [score:2]
Our findings suggest that miR-20a-5p may function as a potential biological molecule for preventing chemoresistance of OS, which may lead to additional new diagnostic and therapeutic approaches for OS and provide new insights into the posttranscriptional regulation of KIF26B. [score:2]
Furthermore, to assess whether miR-20a-5p directly alters the expression of KIF26B in the above OS cell lines, we measured KIF26B levels in OS cell lines that were transfected with either a miR-20a-5p mimic (SJSA-1) or an antagomir (G-292). [score:2]
Error bars represent the s. e. m. **p < 0.01 by Student’s t-testTo confirm KIF26B as a real miR-20a-5p target, the WT or Mut 3′-UTR region (520 bp) of KIF26B was inserted downstream of the luciferase gene in the pmiR-RB-REPORT™ vector (Guangzhou RiboBio, China) to create the pmiR-RB-REPORT™-UTR WT and Mut, respectively (Fig.   3f), and assayed in SJSA-1 and G-292 cell lines to determine the functional status of miR-20a-5p in OS cells. [score:2]
c Relative activities of the 6 pathways regulated by miR-20a-5p in OS cells. [score:2]
To further demonstrate that miR-20a-5p modulates multi-drug resistance by repressing KIF26B expression in OS cells, we compared drug-triggered cell death in SJSA-1 cells transfected with miR-20a-5p mimic or KIF26B siRNA. [score:2]
Furthermore, FACS analysis of the cell cycle in SJSA-1 cells showed that the percentage of S stage cells significantly decreased after miR-20a-5p mimic transfection or KIF26B knockdown (Fig. 5c, d). [score:2]
Error bars represent the s. e. m. **p < 0.01 by Student’s t-test To confirm KIF26B as a real miR-20a-5p target, the WT or Mut 3′-UTR region (520 bp) of KIF26B was inserted downstream of the luciferase gene in the pmiR-RB-REPORT™ vector (Guangzhou RiboBio, China) to create the pmiR-RB-REPORT™-UTR WT and Mut, respectively (Fig.   3f), and assayed in SJSA-1 and G-292 cell lines to determine the functional status of miR-20a-5p in OS cells. [score:2]
Expression levels of miR-20a-5p (a, b) and KIF26B mRNA (d, e) and protein (c) in miR-20a-5p mimic (5PM) -transfected SJSA-1 cells and miR-20a-5p antagomir (5PA) -transfected G-292 cells compared with the negative control (NC) as determined by qRT-PCR and Western blot analyses. [score:2]
More importantly, we found that miR-20a-5p/KIF26B promoted multi-drug resistance in OS cells by regulating MAPK/ERK and cAMP/PKA signaling pathway activities. [score:2]
In this investigation, we tested the impact of differential expression of miR-20a-5p on cell death in OS cells triggered by commonly used therapeutics. [score:1]
Furthermore, of these six pathways, MAPK/ERK, ATF2/ATF3/ATF4, and cAMP/PKA signaling pathway activity increased in miR-20a-5p mimic -transfected SJSA-1 cells and decreased in antagomir -transfected G-292 cells (Fig.   6b, c). [score:1]
g– i, The relative luciferase activity (fold change) of the reporter with WT or Mut KIF26B-UTR or with no UTR (Vec) was determined in the miR-20a-5p mimic (in SJSA-1)- or antagomir (in G292)- or Mock -transfected cells. [score:1]
MiR-20a-5p and KIF26B regulate the activities of chemoresistance -associated signaling pathways in multi-drug resistant OS cells. [score:1]
To investigate the epigenetic regulation of miR-20a-5p expression, the methylation status of the miR-20a promoter region was assessed in both the SJSA-1 and G-292 cell lines using the bisulfite sequencing PCR (BSP) assay. [score:1]
In the SJSA-1 tumor mice that received intratumoral injection of miR-20a-5p agomir, the mock tumor xenograft was lighter than the Ago-5P tumor xenograft. [score:1]
The sequences of primers and probes used for the qRT-PCR analysis were as follows: hKIF26B F: 5′-GCTGCGTGTTCTGTTTCGG-3′ hKIF26B R: 5′-TTCCTTGCGTTCGTTTATGAG-3′ hKIF26B probe: 5′-CY5-TCGGAAAGGATGATTCCATGCAGAAC-3′ hACTB F: 5′-GCCCATCTACGAGGGGTATG-3′ hACTB R: 5′-GAGGTAGTCAGTCAGGTCCCG-3′ hACTB probe: 5′-HEX-CCCCCATGCCATCCTGCGTC-3′ To detect and quantify the expression of miR-20-5p, RNA was reverse-transcribed using a Primer Set (RiboBio) and quantified using SYBR Green -based real-time PCR analysis in a FTC-3000P instrument (Funglyn Biotech Inc. [score:1]
Osteosarcoma miR-20a-5p KIF26B Multi-drug resistance Osteosarcoma (OS) is the most common primary bone malignancy in children and adolescents, up to 20–25 % of diagnosed patients present with metastasis, primarily to the lung [1]. [score:1]
Furthermore, the tumor weight of the miR-20a-5p agomir/Dox injected SJSA-1 mice was smaller than that in the miR-20aa-5p agomir/Mock counterparts, and the reverse observation was found in that of Dox -treated group of G-292 cells with and without miR-20a-5p agomir transfection (Fig.   7b–f). [score:1]
c Relative methylation levels (fold) of miR-20a in SJSA-1 and G-292 cells. [score:1]
Fig.  5Effects of forced alteration of miR-20a-5p or KIF26B levels on the cell survival of SJSA-1 cells. [score:1]
G-292-generated tumors on the left side of the backs of the nude mice were injected with 2 nM miR-20a-5p antagomir, while the right side of their backs was injected with 2 nM Mock. [score:1]
The Ct values of miR-20-5p were normalized to the Ct values of U6 RNA before quantification using the 2 [−ΔΔ]Ct method. [score:1]
The sequences of primers and probes used for the qRT-PCR analysis were as follows: hKIF26B F: 5′-GCTGCGTGTTCTGTTTCGG-3′ hKIF26B R: 5′-TTCCTTGCGTTCGTTTATGAG-3′ hKIF26B probe: 5′-CY5-TCGGAAAGGATGATTCCATGCAGAAC-3′ hACTB F: 5′-GCCCATCTACGAGGGGTATG-3′ hACTB R: 5′-GAGGTAGTCAGTCAGGTCCCG-3′ hACTB probe: 5′-HEX-CCCCCATGCCATCCTGCGTC-3′ To detect and quantify the expression of miR-20-5p, RNA was reverse-transcribed using a Primer Set (RiboBio) and quantified using SYBR Green -based real-time PCR analysis in a FTC-3000P instrument (Funglyn Biotech Inc. [score:1]
b Cell survival rate after administering IC [50] doses of drugs to SJSA-1 cells transfected with miR-20a-5p mimic (3PM) or KIF26B siRNA relative to the negative control (NC). [score:1]
Intratumoral injection of the miR-20a-5p agomir/antagomir indeed led to the expected changes in KIF26B levels in tumor sections (Fig.   7g), which confirmed that miR-20a-5p has a profound negative effect on both the growth and chemoresistance of the OS cell-derived tumor xenografts in nude mice. [score:1]
Ten days after cell injection, all of the SJSA-1-derived tumors were intratumorally injected with 2 nM miR-20a-5p agomir (Ago) every 2 days, whereas G-292-derived tumors were injected with 2 nM miR-20a-5p/Mock antagomir (Anta)/PBS. [score:1]
Fig.  7The effect of miR-20a-5p on both the in vivo growth and Dox chemoresistance of SJSA-1- and G-292-derived xenografts in nude mice. [score:1]
The boxes indicate the pathways that failed to respond in an expected manner Intratumoral injection of miR-20a-5p agomir/antagomir or the scramble sequence control (Mock) or PBS into SJSA-1/G-292-derived tumors was initiated on the tenth day and repeated four times once every 2 days. [score:1]
In summary, we demonstrated that a miR-20a-5p-centered axis dictates OS multi-chemoresistance. [score:1]
After transfection with either miR-20a-5p or miR-Ctrl for 48 h, the cells were collected and fixed in 70 % cold ethanol for 24 h at 4 °C. [score:1]
From the tenth day after cell injection, all six SJSA-1-generated tumors on the left side of the backs of the nude mice were intratumorally injected with 2 nM miR-20a-5p agomir, while the right side of their backs was injected with 2 nM Mock. [score:1]
However, knowledge of the contribution of miR-20a-5p to OS chemoresistance is still limited. [score:1]
[1 to 20 of 80 sentences]
3
[+] score: 219
Other miRNAs from this paper: mmu-mir-106a, mmu-mir-106b, mmu-mir-26a-1, mmu-mir-17, mmu-mir-26a-2
The results obtained following the stable and transient expression of miR-20a indicate the important role of LRF down-regulation/p19ARF up-regulation, but also suggest that other targets are involved. [score:11]
For this reason, the expression of E2F1 after miR-20a transient over -expression in MEF or stable expression in wild type and LRF -null MEF was determined. [score:7]
0002542.g004 Figure 4 analysis showing the expression of LRF and E2F1 in wt (a) and LRF -null MEF (b) retrovirally infected with PIG/miR-20a; c: analysis showing the expression of E2F1 in MEF transfected with d-20a; d: analysis showing the expression of E2F1 and p19ARF in wt MEF transfected with si-LRF, si-E2F1, si-EGFP and miR-20a; e: percentage of SA-ß-gal positive cells in wt MEF transfected with si-LRF, si-E2F1, si-EGFP and miR-20a. [score:7]
These data and data from transient trasfection experiments, showing that miR-20a over -expression induces a greater percentage of senescent cells than si-LRF (Figure 2e), indicate that although LRF is target of miR-20a, the modulation of other targets contributes to the senescent effect. [score:7]
analysis showing the expression of LRF and E2F1 in wt (a) and LRF -null MEF (b) retrovirally infected with PIG/miR-20a; c: analysis showing the expression of E2F1 in MEF transfected with d-20a; d: analysis showing the expression of E2F1 and p19ARF in wt MEF transfected with si-LRF, si-E2F1, si-EGFP and miR-20a; e: percentage of SA-ß-gal positive cells in wt MEF transfected with si-LRF, si-E2F1, si-EGFP and miR-20a. [score:7]
p19ARF was more strongly up-regulated by si-LRF than by miR-20a at both the mRNA (Figure 2a) and protein (Figure 2b,c) levels in agreement with the degree of LRF inhibition. [score:6]
On the other hand miR-20a was able to induce a more profound E2F1 down-regulation than si-LRF both in wt and in LRF -null cells (Figure 4a,b), possibly by direct binding of this microRNA to the 3′UTR of E2F1 mRNA. [score:5]
To reinforce the finding that miR-20a induced senescence, LRF positive and null-LRF MEF were infected with a retrovirus expressing miR-20a (PIG/miR-20a) in order to achieve a stable expression. [score:5]
miRNA -expressing plasmids (p-miRs) were investigated for their ability to inhibit fluorescence and it was found that p-miR-20a (Figure 1d), p-miR-17 (Figure 1e) and p-miR-106b (Figure 1f) all inhibit in a dose dependent manner. [score:5]
h i: Effects of over -expression/depletion of miR-20a on LRF expression. [score:5]
We asked whether another key senescence inducer, the tumor suppressor p16, might be induced by miR-20a over -expression. [score:5]
As reported in Figure 1b, MEF express the precursor of miR-20a, miR-17 and miR-106b, while they do not express the precursor of miR-106a. [score:5]
miR-20a over -expression affects the expression of p16INK4a and E2F1. [score:5]
miR-20a regulates LRF expression in MEF. [score:4]
The underlying mechanism of action appears to be the E2F1 down-regulation by two members of the cluster, miR-17 and miR-20a. [score:4]
p-miR-20a/p- zbtb7a 3′UTR interaction reduced the fluorescence, while p-miR-20a/p- zbtb7a 3′UTR [m] interaction rescues the inhibition (Figure 1g) indicating that miR-20a binds directly zbtb7a 3′UTR. [score:4]
In this respect, it is of note that E2F1 and c-Myc are linked by a positive feedback loop [45], [46], so that miR-20a -induced E2F1 down-regulation might decrease c-Myc level. [score:4]
This hypothesis is supported by the finding that E2F1 knock-down by si-E2F1 per se is not enough to induce senescence (Figure 4e) and by the significant increase of senescence in LRF -null MEF over -expressing miR-20a concomitant with E2F1 reduction (Figure 3e). [score:4]
These data strongly suggest that miR-20a induced premature senescence is due to the cooperation of LRF and E2F1 down-regulation. [score:4]
We observed that, as opposed to miR-20a, si-LRF causes only p19ARF (Figure 2c) and not p16 (Figure 5a) up-regulation. [score:4]
A plausible hypothesis is that miR-20a directly or indirectly affects a negative regulator of p16. [score:4]
The depletion of the endogenous miR-20a with d-20a slightly enhanced the expression of E2F1 thus confirming that E2F1 is potentially under miR-20a control (Figure 4c). [score:3]
analysis showing the expression of p16 after miR-20a transfection in wt MEF (a,b) and in LRF -null MEF (c). [score:3]
This assumption is based on the finding that miR-20a is a more powerful senescence inducer than si-LRF, although it is a milder inhibitor of LRF/inducer of p19ARF (Figure 2c) and that in LRF -null MEF additional senescence is induced (figure 3e). [score:3]
We confirmed that, when miR-20a is over-expressed either by transient transfection (Figure 4a) or stable infection (Figure 4b), E2F1 is invariably decreased. [score:3]
E2F1, which plays a crucial role in senescence, is a known target of miR-20a. [score:3]
0002542.g005 Figure 5 analysis showing the expression of p16 after miR-20a transfection in wt MEF (a,b) and in LRF -null MEF (c). [score:3]
The relative expression of p- zbtb7a 3′UTR was obtained by the ratio of the mean fluorescence value of HEK293T cells transfected with p-miR-20a, p-miR-17 or p-miR-106b and the mean fluorescence value of HEK293T cells transfected with p-miR-26a control plasmid. [score:3]
The combined modulation of these different proteins is likely to be at the basis of the senescence pathways elicited by miR-20a-over -expression. [score:3]
In this way, the expression plasmids nick-named p-miR-20a, p-miR-17, p-miR-106b and p-miR-26a were obtained. [score:3]
The results show that PIG/miR-20a markedly inhibits cell proliferation (Figure 3d), and it increases the percentage of SA-β-gal positive cells two fold over control (Figure 3e). [score:3]
We observed that miR-20a over -expression, by transfection of 80 nM mature miR-20a, reduces LRF protein by 40% (Figure 1h). [score:3]
The transient over -expression of miR-20a shows that 48 hours post transfection the level of LRF mRNA was almost unchanged, while it was reduced following a si -RNA specific for LRF, si-LRF, (Figure 2a). [score:3]
24 hours later, 140 ng of p- zbtb7a 3′UTR were cotransfected with 75–300 ng of p-miR-17, p-miR-20a, p-miR-106 (specific miRNAs) or p-miR-26a not predicted by any algorithm to target the 3′UTR of LRF. [score:3]
The relative expression was obtained by the ratio of the mean fluorescence values of HEK293T cells cotransfected with p-miR-20a and either p- zbtb7a 3′UTR or p- zbtb7a 3′UTR [m] normalized to that of HEK293T cells transfected with pEGFPC1. [score:3]
Looking for other possible miR-20a targets, we focused our attention on E2F1, already known to be under miR-17 family control [20], [21], [23]. [score:3]
miR-20a over -expression decreases cell proliferation and induces senescence. [score:3]
We also over-expressed miR-20a in MEF and found that LRF protein was consistently decreased (Figure 1h), while the mRNA level was unchanged (Figure 2a). [score:3]
miR-20a over -expression induces p19ARF. [score:3]
Conversely, inhibition of endogenous miR-20a by transfection with 80 nM antisense 2′-O-methyl-oligoribonucleotide (decoy, d-20a) increases LRF protein level by 55% (Figure 1i). [score:3]
The PCR products of ∼500 bp length are pri-miRNAs of the miR-17 family; c: analysis of mature miR-20a expression in MEF. [score:3]
miR-20a regulates p16. [score:2]
miR-20a regulates LRF protein at the post-transcriptional level. [score:2]
miR-20a regulates E2F1. [score:2]
Interestingly, we observed that the transient and stable miR-20a over-espression direct MEF toward senescence (Figure 3b,e), more similar to stress rather than to culture induced senescence, as it is accomplished within few days from transfection. [score:2]
The mutated version of this plasmid (p- zbtb7a 3′UTR [m]) was generated by utilizing the p- zbtb7a 3′UTR as template and modifying the miR-20a seed binding site using the QuikChange II XL Site-Directed Mutagenesis Kit. [score:2]
Using a hybrid reporter assay, we were able to demonstrate that miR-17 family members, in particular miR-20a, interact directly with zbtb7a 3′UTR (Figure 1d,e,f,g). [score:1]
Genomic fragments of about 500 bp which contained human pri-miR-17, pri-miR-20a, pri-miR-106a, pri-miR-106b or pri-miR-26a sequences were obtained by PCR. [score:1]
Viceversa the depletion of the endogenous miR-20a by the antisense d-20a increased LRF protein level (Figure 1i). [score:1]
Furthermore, p16 is induced by miR-20a in both wt (Figure 5a) and LRF -null MEF (Figure 5c). [score:1]
The finding that miR-20a is able to induce premature senescence is, in our opinion, interesting as it may have potential clinical relevance as anti-tumorigenic drug. [score:1]
It can be noted that si-LRF was less efficient than miR-20a despite the stronger induction of p19ARF. [score:1]
For retrovirus -mediated gene transfer, Phoenix E cells (3×10 [6]) were plated in a 100 mm poly-D-Lysine coated dish and, 16 hours later, were transfected with retroviral plasmid (PIG/miR-20a) using Lipofectamine 2000. [score:1]
We found that only miR-20a and not si-LRF is able to increase p16 protein levels (Figure 5 a,b). [score:1]
Exponentially growing MEF at passage 2 were transfected with miR-20a, d-20a, siRNA-LRF, a siRNA specific for LRF (5′-CAUAAAGAAGAGUGGGAAG-3′) or si-E2F1 (Dharmacon). [score:1]
Annealing temperatures were: 54.9°C for pri-miR-17, 54.2°C for pri-miR-20a, 57.6°C for pri-miR-106b, and 57°C for pri-miR-26a. [score:1]
20 µg of total RNA was analyzed with miR-20a probe or valine tRNA control probe; d, e, f: Interaction between 3′UTR of mmu- zbtb7a mRNA and miR-17 family. [score:1]
0002542.g003 Figure 3 Detection of cell proliferation (a), SA-ß-gal positive (b) and binucleated (c) cells in wt MEF transfected with miR-20a. [score:1]
In conclusion our data demonstrate that in MEF at early passages miR-20a is able to induce cellular senescence. [score:1]
Each bar represents the mean±SE of three independent experiments; g,: Transfection of p-miR-20a with either p- zbtb7a 3′UTR or p- zbtb7a 3′UTR [m] in HEK293T. [score:1]
Mature miR-20a was quantified using the miScript System according to the manifacturer's instruction. [score:1]
miR-20a significantly enhanced SA-β-gal positive (Figure 3b) and binucleated (Figure 3c) cells over control level. [score:1]
Interestingly, PIG/miR-20a is still able to cause a statistically significant increase in SA-β-gal positive cells in LRF -null cells (Figure 3e). [score:1]
The results clearly indicate that miR-20a decreases E2F1 protein level in both cases (Figure 4 a,b). [score:1]
Moreover, transient miR-20a transfection in LRF -null MEF demonstrates that miR-20a is able to induce p16 also in the absence of LRF (Figure 5c). [score:1]
Detection of cell proliferation (a), SA-ß-gal positive (b) and binucleated (c) cells in wt MEF transfected with miR-20a. [score:1]
miR-20a induces senescence in MEF. [score:1]
The oligonucleotide used as probe was the complementary sequence of the mature miR-20a (miRNA Registry): (5′-CTACCTGCACTATAAGCACTTTA-3′). [score:1]
The sequence was then subcloned into MSCV-PIG [9] using BglII and XhoI (PIG/miR-20a). [score:1]
Ultrahyb Oligo solution (Ambion); Nylon membrane Hybond-C extra, ECL detection kit (Amersham Biosciences); pEGFP-C1 plasmid (Clontech); mature miR-20a, si-EGFP, si-LRF (Dharmacon); antisense 2′-O-methyl-oligoribonucleotide against miR-20a (d-20a) (LGTM, IFC, Pisa); Gene Silencer® (Gene Therapy Systems); lipofectamine 2000, Trizol® Reagent DNAseI amplification grade, SuperScript II reverse transcriptase, Taq DNA polymerase, Dulbecco's Modified Eagle Medium-High Glucose (D-MEM-HG), fetal bovine serum (FBS) (Invitrogen); anti-LRF (BIDMC, Boston, USA); anti-E2F1 (sc-193) anti-p16 (sc-1661), anti-p21 (sc-397) (Santa Cruz Biotechnology, Inc. [score:1]
Here, we report a novel activity exerted by miR-20a in mouse embryonic fibroblasts (MEF). [score:1]
These results clearly demonstrate that in MEF LRF is under miR-20a control. [score:1]
Since we decided to focus on miR-20a throughout the experiments, the presence of the mature form in MEF cells was first ascertained by (Figure 1c). [score:1]
We also found that miR-20a increases another important senescence player, p16 [42], in both wild type (Figure 5a,b) and LRF -null MEF (Figure 5c). [score:1]
We then tested whether mouse zbtb7a 3′UTR interacts with miR-20a, miR-17 and miR-106b, using an. [score:1]
Furthermore, when endogenous miR-20a is depleted by decoy, E2F1 protein level is slightly increased confirming that E2F1 is under miR-20a control in MEF (Figure 4c). [score:1]
Detection of proliferation (d) and SA-ß-gal positive (e) cells in wt and LRF -null MEF retrovirally infected with PIG/miR-20a. [score:1]
HEK293T cells were co -transfected with p- zbtb7a 3′UTR and increasing concentrations of p-miR-20a, p-miR-17 p-miR-106b or p-miR-26a control plasmid. [score:1]
Total RNA was extracted from MEF transfected with miR-20a, si-LRF or si-EGFP. [score:1]
Effects of miR-20a on LRF-p19ARF pathway. [score:1]
p-miR-20a was tested against p- zbtb7a 3′UTR wild type or mutated at the two binding sites specific for miR-17 family. [score:1]
MEF transfected with miR-20a proliferated less than those transfected with control miRNA (Figure 3a). [score:1]
The miR-20a -induced senescence in MEF is not an exception to this rule. [score:1]
[1 to 20 of 83 sentences]
4
[+] score: 182
Adenovirus -mediated p300 expression significantly increased levels of all cluster members including miR-20a (1.95-fold ±0.03, p<0.0001, Figures 4C and D), while expression of an unrelated miRNA, miR-199, was unchanged (Figure 4D), confirming that p300 gain can positively regulate expression of this anti-angiogenic microRNA cluster. [score:8]
The decline in expression of these microRNAs was associated with increased expression of VEGFA, a validated miR-20a target. [score:7]
In fact, miR-20a overexpression significantly repressed most of the angiogenic genes that were differentially upregulated in p300tg hearts (Figure 5F; compare Figure 2A). [score:6]
To determine whether miR-20a could similarly repress p300 -dependent transcription in vivo, we transduced neonatal (d 1–3) p300tg mice with lentivirus encoding mature miR-20a or a scrambled sequence (ct-miR), and at 3 months of age, quantitated expression of 84 genes previously shown to be selectively upregulated by p300 in vivo [13]. [score:6]
We show that p300 is a novel target for a microRNA, miR-20a, that has been previously implicated in the negative regulation of angiogenesis through its ability to target VEGF and HIF-1 [26], [27]. [score:6]
Relative expression of most members of the 17∼92 cluster was similar in all 4 cardiac chambers and in other organs, however, significant downregulation of miR-17-3p and miR-20a occurred between 1 and 8 months of age in both wt and tg mice. [score:6]
Angiogenic genes identified as p300-regulated in the myocardial expression profile from Figure 2A were assayed by QPCR in CPCs expressing miR-20a or ct-miR. [score:5]
Grey = expression below detection threshold G. MiR-20a directly targets EP300 3′UTR. [score:5]
In addition, miR-20a was demonstrated to directly repress p300 expression through a consensus binding site in the p300 3′UTR. [score:4]
Two members of the miR-17∼92 cluster, miR-17-3P and miR-20a, were upregulated in p300tg relative to WT myocardium in both young (1 month) and adult (9 month) mice (Figure 3A). [score:4]
One member of this cluster, miR-20a, specifically targets p300 and negatively regulates the p300 -dependent angiogenic transcription program, and angiogenic differentiation of cardiac progenitor cells. [score:4]
MiR-92, another member of the cluster, has been shown to regulate myocardial angiogenesis through targets distinct from those of miR20a, including integrin subunit alpha5 [14]. [score:4]
On the other hand, unbalanced upregulation of miR-20a in this system could lead to excessive attenuation of angiogenic transcription, and could in theory account for eventual failure of compensatory blood vessel growth [12], [13], [38]. [score:4]
A. Relative upregulation of miR-17-3p and miR-20a in p300 transgenic mice. [score:4]
p300 also induces miR-20a, which provides feedback inhibition of p300, reversing both the angiogenic and hypertrophic programs and providing counter-regulatory control of the hypertrophic stress response. [score:4]
These experiments confirm that p300 is a direct target of miR-20a, likely affecting the stability of p300 mRNA, and that angiogenic transcription downstream of p300 is also repressed by miR-20a. [score:4]
Confirming this finding, both miR-17-3p and miR-20a were upregulated in neonatal rat ventricular myocytes following adenoviral transduction of p300. [score:4]
miR-20a Represses the Angiogenic Gene Expression Program in CPCs. [score:3]
Transduction of miR-20a, but not a control miR, repressed expression of a luciferase construct containing the p300 3′UTR miR17-5p/miR-20a binding site (Figure 5G, left); mutagenesis of this site eliminated miR-20a repression (Figure 5G, right). [score:3]
Note relatively higher expression of 3′ members of the cluster, miR-20a, miR-19b, and miR-92. [score:3]
D. miR-20a reverses myocardial p300 -induced gene expression profile. [score:3]
A. Low expression of miR-20a levels in cardiac progenitor cells. [score:3]
5-day old wt pups were transduced with the indicated lentiviruses and miR20a expression was detected by qPCR in left ventricular myocardial lysates at2 weeks. [score:3]
In addition, miR-20a has been recently reported to reduce apoptosis following hypoxia-reoxygenation of cardiomyocytes [36], and overexpression of the miR-17∼92 cluster modestly improved cardiac function in a mouse mo del of myocardial infarction [37], suggesting that members of this cluster may have more general protective effects during oxidative or biomechanical stress. [score:3]
E. Overexpression of miR-20a slows proliferation of cardiac progenitor cells (CPCs). [score:3]
These CPCs have high angiogenic differentiation potential and express endogenous miR-20a at very low levels relative to cardiomyocytes (Figure 5A). [score:3]
Luciferase vectors containing either full-length mouse p300 (NM_177821.6) 3′ UTR or a control 3′ sequence were transfected into 293T cells stably overexpressing miR-20a or a scrambled control microRNA using Lipofectamine 2000 (Invitrogen). [score:3]
Lentiviral-transduced cardiomyocytes expressing a control sequence (A, ct-miR) or miR-20a (B and C) together with EGFP (green) were visualized with anti-GATA-4 (magenta) and pan-alpha-actinin (red) antibodies and nuclear DNA was stained with DAPI (blue). [score:3]
CPC clones stably expressing GFP and miR-20a or a scrambled sequence (ct-miR) were plated and maintained at 40–60% confluency by serial passage. [score:3]
Neither vector inhibited a control sequence lacking the miR-20a binding site. [score:3]
Lentiviral overexpression of miR-20a, but not a scrambled sequence [16] increased miR-20a levels by more than 600-fold (Figure 5B) from a negligible endogenous level; this was sufficient to reduce endogenous CPC p300 mRNA levels by more than 40% (Figure 5C) and VegfA protein levels by ∼50% (Figure 5D), associated with a significant reduction in CPC proliferation (Figure 5E). [score:3]
MiR-20a recipients had significantly reduced myocardial p300 protein (Figures 7B and C), together with significant reversal of the myocardial p300 gene expression signature (Figure 7D and Table 3) relative to control miR-transduced hearts. [score:3]
0079133.g006 Figure 6Lentiviral-transduced cardiomyocytes expressing a control sequence (A, ct-miR) or miR-20a (B and C) together with EGFP (green) were visualized with anti-GATA-4 (magenta) and pan-alpha-actinin (red) antibodies and nuclear DNA was stained with DAPI (blue). [score:3]
Since sarcomeric actinins are not predicted targets of miR-20a, this could be due to loss of p300 and previously demonstrated p300 -dependent actinin transcription [28]. [score:3]
B. Successful expression of miR20a in CPCs following lentiviral transduction. [score:3]
Notably, we find that miR-20a prevents the expression of angiogenic genes not only in the intact myocardium, but also in c-kit+ cardiac progenitor cells [40]. [score:3]
0079133.g005 Figure 5 A. Low expression of miR-20a levels in cardiac progenitor cells. [score:3]
MiR-20a targets p300 and p300-regulated angiogenic genes. [score:3]
MiR-20a binding sites predicted by TargetScan. [score:2]
F. Mir-20a overexpression represses p300 -induced angiogenic genes in CPCs. [score:2]
To determine whether miR-20a could provide a counter-regulatory signal during p300 -induced angiogenic transcription, we transduced miR-20a into previously described clonal murine c-kit+ cardiac progenitor cells (CPCs) [24]. [score:2]
B. Time dependent inverse regulation of VegfA and miR-20a. [score:2]
p300 drives an angiogenic transcription program during hypertrophy that is fine-tuned in part through direct repression of p300 by miR-20a. [score:2]
The miR-20a binding site in the p300 3′UTR was mutated using a site-directed mutagenesis kit (Stratagene). [score:2]
Note that cells expressing the miR-20a-EGFP lentivirus (B and C, arrows) have greatly reduced staining for actinin, compared with adjacent non-transduced cells (B and C, asterixes), or cells taking up the scrambled sequence (compare EGFP+ cells in A). [score:2]
p300 protein was quantitated in the same lysates in (A) by Western blot 3 months after transduction with miR-20a. [score:1]
Newborn (5 day) p300tg pups (BS line [13]) received 8×10 [8] viral particles of miR-20a or control sequence (ct-miR) [16] via external jugular vein injection using a previously described method [17], with minor modifications [18]. [score:1]
In vivo Transduction of miR-20a. [score:1]
C. miR-20a reduces endogenous p300 transcript levels in CPCs. [score:1]
C. Gain of p300 induces miR-20a. [score:1]
A mo del of the miR20-p300 feedback loop during hypertrophy. [score:1]
Lentiviral transduction of miR-20a, but not a control sequence, sharply reduced the number of visible sarcomeres containing alpha-actinin in cardiac myocytes (Figure 6). [score:1]
These data further support functional repression of p300 by miR-20a. [score:1]
We have previously demonstrated long-lasting effects of microRNA transduction using this method [18]; consistent with this, miR-20a levels were significantly elevated for at least 2 weeks following injection (Figure 7A) following miR-20a but not ct-miR transduction. [score:1]
CPCs were transduced with miR-20a or scrambled control lentivirus [16]. [score:1]
In brief, 5-days old p300tg pups were placed on a transilluminator and the external jugular vein was injected with 10 µl of 8×10 [8] viral particles encoding miR-20a or ct-miR. [score:1]
We asked whether the sarcomeric organization of neonatal rat cardiomyocytes could be impacted by increased levels of miR-20a. [score:1]
Lentiviral vectors encoding miR-20a or a control sequence within a common miR-30 backbone have been previously described [16]. [score:1]
B. Reduced p300 in miR-20a-transduced hearts. [score:1]
A. Sustained in vivo transduction of miR20a. [score:1]
Shown are locations and sequences of canonical MEF2 and GATA binding sites upstream of miR-20a. [score:1]
In vivo Transduction of miR-20aNewborn (5 day) p300tg pups (BS line [13]) received 8×10 [8] viral particles of miR-20a or control sequence (ct-miR) [16] via external jugular vein injection using a previously described method [17], with minor modifications [18]. [score:1]
p300 -induced genes repressed by miR-20a transduction in vivo. [score:1]
See for miR-20a binding site sequence and mutant sequence. [score:1]
Similar negative feedback loops have been described for miR20a, E2F and Myc [30], [31], [32], [33]. [score:1]
[1 to 20 of 65 sentences]
5
[+] score: 164
Other miRNAs from this paper: mmu-mir-34a, mmu-mir-20b
In conclusion, this study demonstrated that miR-20a-5p can regulate OS multi-drug resistance through its direct target gene SDC2 by targeting its 3′-UTR. [score:7]
We showed here that miR-20a-5p represses the OS multi-chemoresistance via its down-regulation of the SDC2 gene, a newly identified target of miR-20a-5p. [score:6]
The results showed that a dozen of miRNAs were differentially expressed in the SJSA-1 and the G-292 cells and miR-20a-5p was selected as one of the studied target miRNAs. [score:5]
We predicted Homo sapiens syndecan 2 (SDC2) as one of the target genes of miR-20a-5p via several websites, which was further validated by detecting their expression of both mRNA and protein level in both the miR-20a-5p -mimic transfected G-292 and miR-20a-5p-antagomiR transfected SJSA-1 cells. [score:5]
The sequences used in this study are as follows: si-SDC2: 5′-GAAACCACGACGCTGAATA-3′ hsa-miR-20a-5p antagomiR: 5′-CUACCUGCACUAUAAGCACUUUA-3′ mimic: sense 5′-UAAAGUGCUUAUAGUGCAGGUAG-3′ antisense 5′-CUACCUGCACUAUAAGCACUUUA-3′ Two partial sequences of the human SDC2 3′-untranslated region (276 bp, 1–276 and 533 bp, 1729–2261) with the miR-20a-5p targeting motif were cloned at the downstream of the firefly luciferase gene in pmiR-RB-REPORT™ to construct pmiR-RB-REPORT™-luc-SDC2-WT1 and pmiR-RB-REPORT™-luc-SDC2-WT2, respectively. [score:5]
We thus predicted the target genes of miR-20a-5p based on the following websites: TargetScan (http://www. [score:5]
The sequences used in this study are as follows: si-SDC2: 5′-GAAACCACGACGCTGAATA-3′ hsa-miR-20a-5p antagomiR: 5′-CUACCUGCACUAUAAGCACUUUA-3′ mimic: sense 5′-UAAAGUGCUUAUAGUGCAGGUAG-3′ antisense 5′-CUACCUGCACUAUAAGCACUUUA-3′ Two partial sequences of the human SDC2 3′-untranslated region (276 bp, 1–276 and 533 bp, 1729–2261) with the miR-20a-5p targeting motif were cloned at the downstream of the firefly luciferase gene in pmiR-RB-REPORT™ to construct pmiR-RB-REPORT™-luc-SDC2-WT1 and pmiR-RB-REPORT™-luc-SDC2-WT2, respectively. [score:5]
For example, miR-20a-5p can be downregulated by glioblastoma hypoxia [31], which often promotes radioresistance and chemoresistance in cancer cells. [score:4]
The SDC2 gene is a direct target of miR-20a-5p in OS cells. [score:4]
Getting together, SDC2 is indeed, a direct target of miR-20a-5p and may execute the miR-20a-5p’s repressing effect on the OS drug resistance. [score:4]
The results showed that miR-20a-5p directly targeted Homo sapiens syndecan 2 (SDC2) in OS cells. [score:4]
In this study, we demonstrated that the expression level of miR-20a-5p was elevated in the chemosensitive OS cell line, suggesting that miR-20a-5p might participate in the regulation of OS chemoresistance. [score:4]
Among them, the SDC2 gene is one of the most significantly differentiated genes that negatively correlate with the expression of miR-20a-5p. [score:3]
MiR-20a-5p expression has been shown to correlate with the development and progression of diverse cancer types [26– 32]. [score:3]
To explore how miR-20a-5p affects chemoresistance regulation in OS, a luciferase reporter assay was performed to identify potential target genes of miR-20a-5p. [score:3]
The key players in the miR-20a-5p/SDC2 axis may be a potential diagnostic biomarker and therapeutic target for OS patients. [score:3]
By contrast, the injection of miR-20a-5p’s antagomiR into G-292 increased SDC2 expression in Dox- or PBS -treated mice (Fig.   6). [score:3]
The SDC2 expression negatively correlates with the miR-20a-5p’s repressing effect on OS drug resistance. [score:3]
Afterwards, we increased the level of SDC2 by transfection of miR-20a-5p antagomiR or overexpression of SDC2 in G-292 cells. [score:3]
c MiR-20a-5p antagomiR (5PA) or overexpression construct -transfected G-292 cells showed higher invasion capacity then the NC -transfected. [score:3]
The level of miR-20a-5p in G-292 was 8.27-fold higher than that in SJSA-1, indicating a higher expression of miR-20a-5p in the sensitive OS cells [25]. [score:3]
The transfection of miR-20a-5p mimic in SJSA-1 cells increased its expression to about 39-fold, whereas the transfection of miR-20a-5p antagomiR in G-292 cells significantly decreased its level to 19% [25]. [score:3]
Forced expression of miR-20a-5p counteracted OS chemoresistance in both cell culture and tumor xenografts in nude mice. [score:3]
Fig.  2SDC2 is a target of miR-20a-5p in OS cells. [score:3]
Our data suggested that the miR-20a-5p level might serve as a potential biomarker of chemotherapy-resistant OS and that miR-20a-5p overexpression might aid in overcoming OS drug resistance. [score:3]
As one of miR-20a-5p’s targets, SDC2 was found to mediate the miR-20a-5p -induced repression of OS chemoresistance. [score:3]
The intratumoral injection of miR-20a-5p’s agomiR into SJSA-1 decreased SDC2 expression. [score:3]
This result indicated that low levels of miR-20a-5p promoted OS cell survival probably by increasing SDC2 expression. [score:3]
The constructs pmiR-RB-REPORT™-SDC2 UTR WT and pmiR-RB-REPORT™ enhancer control were transfected into G-292 and SJSA-1 cells respectively, to determine whether the differentially expressed miR-20a-5p in OS cells of distinct chemoresistance is indeed functional. [score:3]
To further conclude whether the SDC2 is a target of miR-20a-5p, the wild type 3′-UTR region of SDC2 was inserted downstream of the luciferase gene in the pmiR-RB-REPORT™-control vector to create pmiR-RB-REPORT™-SDC2 UTR WT1 and pmiR-RB-REPORT™-SDC2 UTR WT2 (Fig.   2e). [score:3]
Because of its repressive effect on SDC2, decreasing miR-20a-5p expression promotes OS multi-drug resistance (at least for Dox, Etop and Carb, which were studied in this report) both in vitro and in vivo. [score:3]
d The sequences in the UTR region of the SDC2 gene targeted by miR-20a-5p (shaded part). [score:3]
To check whether SDC2 is one of the authentic targets of miR-20a-5p, we determined the SDC2 level in the miR-20a-5p mimic transfected SJSA-1 and the antagomiR transfected G-292 cells versus the NC (scramble sequence control) transfected. [score:3]
Here the expression of miR-20a-5p by miR-omic analysis was 10.50-fold higher in G-292 cells compared with SJSA-1 cells [25]. [score:2]
In addition, miR-20, Rest and Wnt signaling is suggested to be involved in a regulatory circuit that can modulate the neural differentiation of neural progenitor cells [16]. [score:2]
b The IC [50]-dosed drug -induced cell death of G-292 cells transfected with the miR-20a-5p antagomiR (5PA) or the GFP-tagged overexpression construct versus the corresponding negative control (NC) assayed 72 h post-treatment. [score:2]
Our findings suggest that miR-20a-5p may function as a potential candidate for preventing chemoresistance of OS, which may lead to additional new diagnostic and therapeutic approaches for OS and provide new insights into the posttranscriptional regulation of SDC2. [score:2]
The current study is the first to demonstrate that SDC2 promotes the chemoresistance of OS cells via its upstream regulator miR-20a-5p. [score:2]
To further demonstrate that miR-20a-5p modulates multi-drug resistance by repressing SDC2 expression in OS cells, we compared drug-triggered cell death in SJSA-1 cells transfected with miR-20a-5p mimic or SDC2 siRNA. [score:2]
MiR-20a-5p suppresses both growth and Dox drug resistance of the G-292 and SJSA-1-derived tumor xenografts in nude mice. [score:2]
Osteosarcoma Chemoresistance miR-20a-5p SDC2 MiRNAs are a class of small non-coding regulatory RNA molecules that have been shown to be involved in a wide range of biological processes [1]. [score:2]
In this investigation, we tested the impact of differential expression of miR-20a-5p on cell death in OS cells triggered by commonly used therapeutics. [score:1]
Fig.  5Effects of forced alteration of both miR-20a-5p and SDC2 levels on apoptosis in G-292 cells as determined by FACS analysis. [score:1]
In summary, we demonstrated that a miR-20a-5p-centered axis dictates OS multi-chemoresistance. [score:1]
As one of the well-studied miRNAs, miR-20a, a member of the miR-17-92 cluster, has been shown to function as an oncomir in many human cancers, including lung cancer [13], hepatocellular carcinoma [14], and gastric cancer [15]. [score:1]
Based on the CCK8 experiments, we performed an RNA-seq -based miR-omic analysis of osteosarcoma (OS) cells (a multi-chemosensitive OS cell line G-292 and a multi-chemoresistant OS cell line SJSA-1) to detect the levels of miR-20a-5p. [score:1]
As expected, miR-20a-5p antagomiR transfection increased the mRNA level of SDC2 by 2.59-folds (Fig.   2b) and the protein level by 3.78-folds in G-292 cells (Fig.   2c). [score:1]
Error bars represent the s. e. m. *P value < 0.05, **P value < 0.01 by Student’s t test Sequence analysis revealed that 3′-UTR region of SDC2 contains two potential binding motifs for miR-20a-5p (termed sit1 and sit2, respectively) (Fig.   2d). [score:1]
However, knowledge of the contribution of miR-20a-5p to OS chemoresistance is still limited. [score:1]
We further tested the level of miR-20a-5p in G-292 and SJSA-1 OS cell lines by qRT-PCR. [score:1]
Error bars represent the s. e. m. *P value < 0.05, **P value < 0.01 by Student’s t test Sequence analysis revealed that 3′-UTR region of SDC2 contains two potential binding motifs for miR-20a-5p (termed sit1 and sit2, respectively) (Fig.   2d). [score:1]
We found that SDC2 negatively correlates with the level of miR-20a-5p. [score:1]
Fig.  6 The SDC2 level in the miR-20a-5p agomiR -injected SJSA-1 and the miR-20a-5p antagomiR -injected G-292 tumor xenograft versus the NC -injected tumor xenografts determined by immunohistochemical staining. [score:1]
The transfection of miR-20a-5p -mimic into SJSA-1 cells significantly brought down the luciferase activity of pmiR-RB-REPORT™-SDC2-UTR WT constructs, whereas the control cells showed almost the same activity upon the transfection of miR-20a-5p -mimic (Fig.   2f). [score:1]
It was also found that miR-20a induces cell radio-resistance by activating the PTEN/PI3K/Akt signaling pathway in hepatocellular carcinoma [17]. [score:1]
Our results suggest that miR-20a-5p and SDC2 contribute to OS chemoresistance. [score:1]
The level of SDC2 mRNA (a, b) and protein (c) in the miR-20a-5p mimic (5PM) -transfected SJSA-1 cell and the miR-20a-5p antagomiR (5PA) -transfected G-292 cell versus the corresponding negative control (NC) determined by western analyses or qRT-PCR. [score:1]
The results showed that transfection with the miR-20a-5p mimic reduced the SDC2 level to 31% of that found in the NC transfected cells. [score:1]
We found that the miR-20a-5p level was higher in G-292 cells than in SJSA-1 cells. [score:1]
The transfection of miR-20a-5p mimic or si-SDC2 in SJSA-1 cells decreased the chemoresistance to some extent against the following five drugs: Dox, Etop, MTX, CDDP, Carb, except the mimic to MTX and CDDP (Fig.   3b). [score:1]
The results further confirmed that miR-20a-5p has a profound negative effect on both the growth and chemoresistance of OS cell-derived tumor xenografts in nude mice. [score:1]
a The SDC2 protein level (western blot analysis) in the miR-20a-5p mimic or siRNA -transfected versus the NC -transfected SJSA-1 cells. [score:1]
The relative level (fold) of the SDC2 gene is also summarized in table (a), by miR-seq and qRT-PCR analyses in plot (b), analyzed by western analysis (c) The miR-20a-5p level was significantly higher in G-292 cells than SJSA-1 cells. [score:1]
All of these observations suggest that SDC2 gene does contribute a great deal to the miR-20a-5p’s repressing effect on the OS drug resistance. [score:1]
Fig.  3The effects of a forced reversal of the miR-20a-5p mimic (5PM) or si-SDC2 level on the chemoresistance of SJSA-1 cells. [score:1]
Similarly, the invasion capacity was elevated with the transfection of either miR-20a-5p antagomiR or GFP-SDC2 in G-292 cells (Fig.   4c). [score:1]
This is also in accordance with the sequence analysis that miR-20a-5p has seven base pairings for sit1 UTR whereas six base pairings for sit2 UTR (Fig.   2d). [score:1]
e– g The relative luciferase activity (fold) of the reporter with wild-type (WT1 and WT2) SDC2-UTR or with no UTR (Vec) was determined in the miR-20a-5p mimic (in SJSA-1), antagomiR (in G-292) or corresponding mock -transfected OS cells. [score:1]
[1 to 20 of 68 sentences]
6
[+] score: 141
Other miRNAs from this paper: mmu-mir-18a, mmu-mir-17, mmu-mir-19a, mmu-mir-19b-1
We found that uPAR induces miR-17-5p and miR-20a expression by upregulating the transcription factor c-myc, whereas miR-17-5p/20a inhibit breast cancer apoptosis by suppressing DR4 and DR5. [score:10]
Our data demonstrated that uPAR upregulated miR-17 and miR-20a expression via c-myc, and uPAR reduced cell apoptosis by increasing miR-17-5p/ 20a expression, which caused inhibition of TRAIL -induced apoptosis. [score:10]
To further determine whether miR-17-5p/20a inhibits apoptosis and cell growth by suppressing DR4 and DR5, miR-17-5p -expressing or miR-20a -expressing cells were co -transfected with DR4 and DR5 siRNA. [score:9]
However, in our mo del system, downregulation of uPAR increased TRAIL -induced apoptosis through induction of the expression of miR-17-5p and miR-20a and inhibition of DR4 and DR5. [score:8]
Inhibition of miR-17-5p and miR-20a expression suppresses tumor growth in nude mice. [score:7]
Because a previous study demonstrates that c-myc binds to the miR-17-cluster locus and enhances miR-17 and miR-20a expression [27], we speculated that uPAR might induce miR-17-5p/20a expression via c-myc. [score:5]
Mimics and inhibitors of miR-17-5p or miR-20a, cholesterol-conjugated miR-17-5p and miR-20a inhibitors, c-myc, uPAR, and DR5-specific small interfering RNA (siRNA) were chemically synthesized by RiboBio Co. [score:5]
This outcome might occur because the uPAR depletion -induced decrease (approximately 50%, see Figure 5B) of miR-17-5p and miR-20a preferentially reduces DR4/5 translation efficiency, because transfection of miR-17-5p/20a inhibitor caused more evident changes in protein levels of DR4/5 than in their mRNA levels (Figure 2D and 2E). [score:5]
Figure 4 (A–C) MDA MB 231 cells were co -transfected with DR4/DR5 siRNA and miR-17-5p or miR-20a inhibitor or a randomized oligonucleotide as an inhibitor control, and MCF-7 cells were co -transfected with DR4/DR5 siRNA and miR-17-5p or miR-20a mimic or a randomized oligonucleotide as a mimic control. [score:5]
Figure 3 (A–D) MDA MB 231 cells were transfected with miR-17-5p or miR-20a inhibitor or a randomized oligonucleotide as an inhibitor control, and MCF-7 cells were transfected with miR-17-5p or miR-20a mimic or a randomized oligonucleotide as a mimic control. [score:5]
Conversely, transfection of their mimics in MCF-7 cells, which express relatively low levels of miR-17-5p and miR-20a, suppressed apoptosis (without TRAIL) and TRAIL -induced cell apoptosis (all P < 0.01) (Figure 3B and Supplementary Figure 2B). [score:5]
Inhibition of miR-17-5p and miR-20a levels by antagomir-17-5p and antagomir-20a delivery induces apoptosis and suppresses breast tumor growth in nude mice. [score:5]
Transfection of MDA MB 231 cells, which express relatively high levels of miR-17-5p and miR-20a, with miR-17-5p or miR-20a inhibitors significantly induced apoptosis (without TRAIL) and increased TRAIL -induced cell apoptosis compared with controls (both P < 0.01) (Figure 3A and Supplementary Figure 2A). [score:4]
Depletion of miR-20a and miR-17-5p (Figure 6E) and upregulation of DR4/DR5 mRNA and protein levels (Figure 6F and 6G) in tumors were verified by real-time PCR and Western blotting, respectively. [score:4]
In this study, we found that uPAR knockdown increased the pro-apoptotic DR4 and DR5 protein levels in the MDA MB 231 TNBC cell line and confirmed that DR4 and DR5 are suppressed by miR-17-5p and miR-20a, which is similar to the results of Krishnamoorty et al. [34] showing that uPAR -depleted glioma cells have higher levels of DR4 and DR5. [score:4]
Cholesterol-conjugated miR-17-5p and miR-20a inhibitor (10 nmol/mouse) or cholesterylated randomized oligonucleotide were intratumor- delivered five times every 3 days. [score:3]
Antagomir-17-5p and antagomir-20a are synthesized cholesterylated stable miR-17-5p and miR-20a inhibitors that have two oxygen methylation modifications and a sulfur -modified phosphate. [score:3]
Additionally, increased cleaved caspase 3 was also observed in antagomir-17-5p/20a -treated tumors (Figure 6G) Figure 6 (A and B) MDA MB 231 cells were treated with cholesterol-conjugated miR-17-5p and miR-20a inhibitors or a cholesterylated randomized oligonucleotide as a control. [score:3]
Similarly, miR-17-5p and miR-20a inhibitors or mimics could not cause a change in activated caspase 8 and caspase 3 levels in DR4 and DR5 siRNA -treated cells (Figure 4C). [score:3]
Treatment with miR-17-5p or miR-20a inhibitor abruptly increased the protein levels of activated caspase 8 and caspase 3, whereas treatment with miR-17-5p or miR-20a mimics decreased the levels of caspase 8 and caspase 3 (Figure 3C). [score:3]
The DR4 and DR5 3′untranslated region (UTR), which contains miR-17-5p or miR-20a binding sites, was amplified by PCR. [score:3]
This report is the first showing that uPAR induces miR-17 and miR-20a expression. [score:3]
Overexpression of c-myc in MCF-7 cells resulted in an increase in miR-17-5p by 7.0-fold and miR-20a levels by 6.9-fold (Figure 5F). [score:3]
The miR-17 and miR-20a miRNAs are usually expressed as miR-17/20a because they share an identical sequence in both humans and mice [35, 36]. [score:3]
Inhibition of TRAIL -induced apoptosis by miR-17-5p/miR-20a in breast cancer cells. [score:3]
Additionally, increased cleaved caspase 3 was also observed in antagomir-17-5p/20a -treated tumors (Figure 6G) Figure 6 (A and B) MDA MB 231 cells were treated with cholesterol-conjugated miR-17-5p and miR-20a inhibitors or a cholesterylated randomized oligonucleotide as a control. [score:3]
The effects of miR-17-5p and miR-20a inhibitors or mimics on cell apoptosis (Figure 4A and Supplementary Figure 1) and cell growth (Figure 4B) were largely attenuated by DR4 and DR5 depletion. [score:3]
CCK-8 assays revealed that treatment with miR-17-5p or miR-20a inhibitor resulted in decreased cell growth, whereas an miR-17-5p or miR-20a mimic caused an increase in cell growth (all P < 0.05) (Figure 3D). [score:2]
The PCR products were cloned into the pGL3 vector, and the recombinant plasmids (DR4-UTR-wt and DR5-UTR-wt) were mutated in the seed sequences of miR-17-5p or miR-20a by site-directed mutagenesis. [score:2]
Mutations in the seed region of the miR-17-5p (up) or miR-20a (lower) binding sites in the DR4 (nucleotides 1630-1647) or DR5 UTR (nucleotides 1892-1909) are marked in the box. [score:2]
As seen in Figure 2A, perfect matches of the seed sequence are shown by vertical lines between the DR4 3′-UTR (nucleotides 1630–1647) or DR5 3′-UTR (nucleotides 1892–1909) and miR-17-5p or miR-20a. [score:1]
The miR-17-92 cluster includes six miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) that are located within an 800-bp region of human chromosome 13. [score:1]
Figure 5 (A) uPAR, miR-20a, and miR-17-5p levels in MDA MB 231, MCF-7, SK-BR3, BT-4T4, and ZR-751 cells were detected by real-time PCR. [score:1]
The 293T cells were co -transfected with DR4-UTR-wt (DR5-UTR-wt) or DR4-UTR-mu (DR5-UTR-mu), pRL-TK plasmid, and miR-17-5p/miR-20a or a randomized oligonucleotide as a control. [score:1]
At 48 hours after transfection, miR-17-5p or miR-20a levels were detected by real-time PCR. [score:1]
miR-17-5p or miR-20a levels were detected by real-time PCR, and c-myc protein levels were determined by Western blotting at 48 hours after transfection. [score:1]
We focused on miR-17-5p and miR-20a in this study because they belong to the same miRNA cluster (miR-17-92 cluster), which has strong oncogenic potential [23, 24, 25]. [score:1]
The miR-17-5p and miR-20a miRNAs were selected from the top 40 miRNAs according to context score percentiles, because they belong to the miR-17-92 cluster that is involved in cell proliferation and apoptosis [23, 24, 25] and they bind to both DR4 and DR5. [score:1]
[1 to 20 of 38 sentences]
7
[+] score: 129
xlsx”): Column 1: predicted target gene list used for GSEA; Column 2: subset list of predicted target genes present on microaarray; Column 3: leading edge subset of genes that were found to be either up or downregulated by comparing −H−D vs +H+D (normalized p value indicated on the top of the column); Column 4: leading edge subset gene list that were found to be either up or downregulated by comparing −H−D vs +H+D (normalized p value indicated on the top of the column); Column 5: intersection between leading edge gene lists in columns 3 and 4. Lists of leading edge common targets for miR-17 and miR-20 (intersection of the four gene lists in columns 3 and 4 on sheets miR-17 and miR-20), miR-19a and miR19b (intersection of the four gene lists in columns 3 and 4 on sheets miR-19a and miR-19b) as well as for miR-451 (intersection of gene lists in columns 3 and 4 in sheet miR-451) that have been used to generate the histograms presented in Figure 3B, C and D are given in sheet named «Gene list profile». [score:13]
This analysis (Figure 3A) revealed that genes belonging to the predicted targets lists of miR-17, miR-20a, miR-19a and miR19b but not to those of miR-18a or miR-92a were significantly over-represented among genes up-regulated in response to HMBA and Dox (resulting in down regulation of miR-17-92 cluster). [score:7]
Clones NN10#17-92a and #17-92b expressing inducible exogenous miR-17-92 and clone NN10#17-20 expressing inducible exogenous miR-17 and miR-20a were derived from NN10#5 cells after transfection with expression vector pcDNA4/TO (Invitrogen, Cergy Pontoise, France) carrying the corresponding miRNA coding regions followed by zeocin selection. [score:7]
We further demonstrated that loss of proliferation induced by Fli-1 knockdown can be at least partially rescued by exogenous whole miR-17-92 cluster re -expression or by miR-17 and miR-20a only re -expression. [score:6]
We also compared mean expression levels of genes in the leading edge subsets of common miR-17/miR-20a, common miR-19a/miR-19b and miR-451 targets identified in response to HMBA in the other two conditions (+Dox only or +HMBA only) which are associated with intermediate pri-miR-17-92 expression levels (Figure 1). [score:6]
In summary, these analyses indicated that miR-17-92 cluster in 745A#44 cells is mainly involved in the down-regulation of predicted targets of miR-17/miR-20a and miR-19a/miR-19b rather than miR-18a or miR-92a. [score:6]
As expected from authentic target genes, variations in the levels of miR-17/miR-20a and of miR-19a/miR-19b targets were inversely correlated with the variations of pri-miR-17-92a levels (compare Figure 3B with pri-miR-17-92a and miRNAs profiles in Figure 1A). [score:5]
In contrast, in cells harboring functional P53 such as normal erythroid progenitors (B), increased Myc activity mediated by deregulated expression of miR17 and miR20a induces oncogenic stress thus explaining their anti-proliferative effect. [score:4]
In fully transformed cells with no functional P53 such as established erythroleukemic cells lines (A) increased Myc activity induced by deregulated expression of miR17 and miR20a cannot induce oncogenic stress thus explaining their pro-proliferative effect. [score:4]
Due to this property of HBP1, our finding that miR17 and miR20a downregulate HBP1 strongly suggests that these two miRNA contribute to increase Myc activity. [score:4]
Fli-1 directly activates miR-17-92 promoter and contributes to miR-17 and miR-20a expression in NN10#5 cells. [score:4]
We decided to focus first on miR-17 and miR-20a which are the most significantly downregulated miRNA of the cluster after Dox treatment. [score:4]
Moreover, miR-20a has been shown to targets E2F1 and prevents apoptosis of the PC3 prostate cancer cell line [46] whose tumorigenicity has been independently shown to be dependent on Ets2 transcription factor [56] while another prostate cell line is also characterized by Ets2 over expression and Hbp1 down regulation [41]. [score:4]
We used a miR-17 and miR-20a anti-miRs mixture since both miRNA share a common seed sequence and have essentially identical targets. [score:3]
Having established miR-17 and miR-20a functionality in NN10#5 cells proliferation downstream of Fli-1, we tried to identify miR-17/20a targets able to explain this effect. [score:3]
Using the same approach, we derived #17-20a cells allowing Dox-inducible expression of miR-17 and miR-20a only instead of the whole miR-17-92 cluster. [score:3]
In contrast, miR-17 and miR-20a anti-miRs transfection completely suppressed the proliferation rescue of #17-92a cells in the presence of Dox, thus confirming that exogenous miR-17-92 cluster contribution is strictly dependent on miR-17 and miR-20a function. [score:3]
Surprisingly, Western blots analyses revealed that none of several miR-17/miR-20a targets already identified in other cell contexts (including p21, PTEN, E2F1 or TXNIP) displayed the expected increased level in response to Dox treatment (Figure 7A). [score:3]
A: Parental NN10#5 cells and their derivative clones #17-92a, #17-92b or #17-20 harboring inducible exogenous whole miR-17-92 miRNA cluster or miR-17-20a sub-cluster were cultured for two days in the presence or absence of Dox and the relative levels of pri-miR-17-92, miR-17 and miR-20a levels were determined by qRT-PCR as in Figure 4. are expressed as +Dox/-Dox ratios (means and standard deviations from 3 independent experiments). [score:3]
In addition, miR-17 and miR-20a are two closely related miRNA which share a common seed sequence and have several well described targets. [score:3]
Identification of HBP1 as a miR-17/miR-20a target in NN10#5 and 745A#44 cells. [score:3]
Our experimental results support the functional implication of miR-17 and miR-20a in erythroleukemic cells proliferation downstream of Fli-1 based on the rescue of proliferation loss induced by Fli-1 knock down following the restoration of these two miRNA to their initial levels. [score:2]
Interestingly, when compared to parental NN10#5 cells, #17-20a cells displayed the same proliferation rescue in Dox as did #17-92 a and #17-92b cells (Figure 6A), thus indicating that combined miR-17 and miR-20a re -expression is sufficient to reproduce the effect of the whole miR-17-92 cluster. [score:2]
Moreover, we showed that restoration to their initial levels of only two members of this cluster, miR-17 and miR-20a, is sufficient to partially rescue the loss of proliferation induced by Fli-1 knock-down in erythroleukemic cells harboring activated fli-1 locus. [score:2]
miR-17 and miR-20a are sufficient for partial rescue of Fli-1 knock-down induced cell proliferation arrest. [score:2]
miR-17-92 functional implication in NN10#5 cells proliferation control downstream of fli-1. Restoration of initial levels of miR-17 and miR-20a following Dox -induced Fli-1 knockdown in NN10#5 cells. [score:2]
We thus identified clones #17-92a and #17-92b that maintained stable levels of mature miR-17 and miR-20a in the presence or absence of Dox (Figure 5A) while still displaying Dox-inducible Fli-1 knock down (Figure 5B). [score:2]
Like in #17-92a and #17-92b, miR-17 and miR-20a levels remained roughly unaffected by Dox treatment in #17-20 cells (Figure 5A) while Fli-1 remained strongly down regulated (Figure 5B). [score:2]
We also derived following the same strategy a single clone from 745#44 cells that maintains stable levels of pri-miR-17-92 and miR-20a after Fli-1 knockdown (Figure S1). [score:2]
miR-17 and miR-20a contribute to Hbp1 regulation in NN10#5 and 7451#44 cells. [score:2]
From these results, we conclude that HBP1 can be considered as an authentic miR-17 and miR-20a target in both NN10#5 and 745A#44 cells. [score:2]
However, unlike in NN10#5, restoration of pri-miR-17-92 and miR-20a levels in 745#44 cells did not rescue cell proliferation decrease induced by Fli-1 loss thus suggesting different parallel contributions of Fli-1 between the two cell lines. [score:1]
Moreover, transfection of miR-17 and miR-20a anti-miRs confirmed that this rescue is not due to clone effect and further supports our conclusion. [score:1]
Identification of miR-17/miR-20a and miR-19a/miR-19b signatures in the transcriptome of 745A#44 cells displaying decreased levels of miR-17-92 cluster. [score:1]
Figure S1 Restoration of pri-miR-17-92 and miR-20a levels in 745#44 cells does not rescue the decrease of cell proliferation induced by Fli-1 loss. [score:1]
A: of qRT-PCR showing the rescue of both pri-miR-17-92 and miR-20a levels in the presence of Dox in 745#44G3 cells. [score:1]
pcDNA4/17-92 and pcDNA4/17-20 were obtained by cloning PCR-amplified genomic DNA corresponding to the whole mouse miR-17-92 cluster or to the miR-17 and miR-20a coding segments downstream to the Dox-inducible CMV promoter in pcDNA4/TO plasmid (Invitrogen, Cergy Pontoise, France). [score:1]
This miR-17-92 cluster comprises six miRNAs that can be grouped into four sub-families based on their seed sequence (miR-17 and miR-20a, miR-18a, miR-19a and b and miR-92a) [19]. [score:1]
Equal number of 745#44 and 745#44G3 cells were then seeded in the presence or absence of Dox, numbered every next three days whereas both pri-miR-17-92 and miR-20a levels were quantified at day 2 by qRT-PCR as in Figure 1A. [score:1]
Given the very high similarity between miR-17 and miR-20a or miR-19a and miR-19b, this retrospective analysis was performed on the intersection of the leading edge subset of miR-17 and miR-20a or miR-19a and miR-19b, respectively. [score:1]
B: Equal numbers of NN10#5 or #17-92a cells were transfected with control, anti-miR-92a or a mixture of anti-miR-17 and anti-miR-20a and cultured in the presence or absence of Dox. [score:1]
Dox treatment of NN10#5 led to a strong reduction of Fli-1 levels associated with a 60% decrease of pri-miR-17-92 transcript level and a 40% decrease of mature miR-17 and miR-20a levels (Figure 4A). [score:1]
[1 to 20 of 42 sentences]
8
[+] score: 95
Simulations of transcriptional networks were carried out using the Gillespie exact stochastic simulation algorithm, programmed and analysed using R based on a microRNA feed-forward mo del [8] to simulate CD69 protein expression in resting T cells (unfilled histogram), in a scenario where activation increases Cd69 mRNA but the expression of miR-17 and miR-20a remained the same as in resting T cells (activated without microRNA FFL, filled red histogram), and in a scenario where activation increases both Cd69 mRNA and miR-17 and miR-20a expression (activated with microRNA FFL, filled grey histogram). [score:7]
Hence, activation signals of increasing strength induce a proportional upregulation of the microRNAs miR-17 and miR-20a and the target mRNA Cd69. [score:6]
The coordinated regulation of miR-17, miR-20a and Cd69 in response to TCR signaling provides a potential mechanism for restricting cell-to-cell variability of microRNA target gene expression. [score:6]
Interestingly, this graded increase in Cd69 mRNA was accompanied by a proportional upregulation of miR-17 and miR-20a expression (Fig. 5A). [score:6]
B) Perceived signal strength varies among individual DP thymocytes and determines the expression of Cd69, miR-17 and miR-20a (microRNA expression is normalised to snoRNA-135 and snoRNA-202). [score:5]
miR-17 and miR-20a form an incoherent positive feedforward loop with the target mRNA Cd69 miRNA expression responds to T-cell activation signals [34, 35, 39– 45]. [score:5]
Increasing expression of CD69 protein correlated with increasing Cd69 mRNA levels, and with incremental expression of miR-17 and miR-20a (Fig. 5B). [score:5]
This result is consistent with our experimental data where the mean and CV of activation -induced CD69 expression were significantly elevated in Dicer -deficient thymocytes: in the absence of a functional microRNA biogenesis pathway, the activation -driven increase in Cd69 mRNA was not balanced by increased miR-17 and miR-20a expression. [score:5]
Our data show that the expression of these microRNAs is induced together with Cd69 mRNA in response to TCR signals, and that the expression of CD69 protein, Cd69 mRNA and miR-17/miR20a is proportional in thymocytes. [score:5]
The mo del predicts that thymocyte activation with co-regulation of Cd69 mRNA and miR-17/miR-20a reduces the mean (887 versus 1300) and the CV (10.2 versus 14.6) of CD69 expression compared to the regulation of Cd69 mRNA alone (P<10 [–4]). [score:4]
In contrast, induction of Cd69 mRNA without upregulation of miR-17/miR-20a results in a higher mean (1300) and increased CV (14.6%, activated without microRNA FFL, filled red histogram in Fig. 5D, P<10 [–4]). [score:4]
Mechanistically, T cell receptor signaling induces both Cd69 and miR-17 and miR-20a, two microRNAs that target Cd69. [score:3]
Next, we asked how miR-17 and miR-20a expression was related to the range of responses by individual cells to a uniform extracellular signal. [score:3]
miR-17 and miR-20a form an incoherent positive feedforward loop with the target mRNA Cd69. [score:3]
At a fixed extracellular signal of 1u/ml H57, the fold-change in miR-17 and miR-20 relative to CD69 negative DP and normalised to snoRNA-135 was proportional to the expression of CD69 (n = 3, mean ± SD). [score:3]
A) The strength of activation signals (0.1, 1, 10 μg/ml H57) determines the expression of Cd69, miR-17 and miR-20a (normalised to snRNA-135 and -202, n = 2–3, mean ± SE). [score:3]
Since the miR-17-92 cluster encodes microRNAs that target the Cd69 3'UTR, including miR-17 and miR-20a (Fig. 3), we investigated how the expression of miR-17 and miR-20a was affected by the activation of DP thymocytes. [score:3]
This mo del predicts that thymocyte activation results in mean CD69 expression of 887 with a CV of 10.2% when Cd69 mRNA and miR-17/miR-20a are induced together (activated with microRNA FFL, filled grey histogram in Fig. 5D). [score:3]
miR-17 and miR-20 form an incoherent positive feedback loop with the target mRNA Cd69. [score:3]
1005020.g005 Fig 5miR-17 and miR-20 form an incoherent positive feedback loop with the target mRNA Cd69. [score:3]
To implement a more specific mo del of CD69 regulation we estimated the mRNA copy numbers for Cd69 and the microRNA copy numbers for miR-17 and miR-20a in resting and activated T cells (see legend Fig. 5D). [score:2]
These findings suggest that miR-17, miR-20a and Cd69 are co-regulated. [score:2]
A different mechanism applies to the regulation of CD69 by miR-17 and miR-20a, two microRNAs of the miR-17-92 cluster. [score:2]
This was confirmed by mo deling the experimentally estimated copy numbers of Cd69 mRNA and miR-17 and miR-20a in resting and activated T cells. [score:1]
DP thymocytes contain ∼6–12 copies of miR-17 and miR-20a per cell, and our quantitative PCR data show that this number increases by 5–10-fold in response to TCR signaling. [score:1]
As detailed in the legend to S4 Fig., the number of Cd69 mRNA copies was estimated as 0 in resting and 6 in activated cells, miR-17 and miR-20 were estimated as 6–12 copies per cell the resting state and 30–60 copies per cell after activation. [score:1]
Based on reported cloning frequencies (89884 miR-181a-1/2 per 10 [6] microRNAs in DP, 1465 miR-17 per 10 [6] microRNAs in DP thymocytes, and 1050 miR-20a per 10 [6] microRNAs in DP [64]. [score:1]
[1 to 20 of 27 sentences]
9
[+] score: 86
b miRNA RT-qPCR analysis showing the complete regulation of Hsa-miR-93, Hsa-miR-20a, Hsa-miR-125b and Hsa-miR-27b and, significant increase in the expression of Hsa-miR-1260 and Hsa-miR-1224-3p in metastatic tumors as compared to the non-metastatic xenograft To validate the altered expression levels observed with whole genome miRNA array, we examined the expression levels of select miRNAs including hsa-miR-1260, hsa-miR-1224-3p (showing significant upregulation; see Fig.   2), hsa-miR-93, hsa-miR-20a, hsa-miR-125b, hsa-miR-27b (showing significant downregulation; see Fig.   3a), using individual miRNA QPCR analysis. [score:13]
b miRNA RT-qPCR analysis showing the complete regulation of Hsa-miR-93, Hsa-miR-20a, Hsa-miR-125b and Hsa-miR-27b and, significant increase in the expression of Hsa-miR-1260 and Hsa-miR-1224-3p in metastatic tumors as compared to the non-metastatic xenograftTo validate the altered expression levels observed with whole genome miRNA array, we examined the expression levels of select miRNAs including hsa-miR-1260, hsa-miR-1224-3p (showing significant upregulation; see Fig.   2), hsa-miR-93, hsa-miR-20a, hsa-miR-125b, hsa-miR-27b (showing significant downregulation; see Fig.   3a), using individual miRNA QPCR analysis. [score:13]
In order to validate the miRNA expression obtained from whole genome profiling, expression of selected metastamiRs, including hsa-miR-1224-3p, hsa-miR-1260 (both significantly upregulated), hsa-miR-125b, hsa-miR-27b, hsa-miR-93,and hsa-miR-20a (all significantly downregulated) were confirmed using QPCR. [score:11]
To define the effect of characterized metastamiRs on the putative target proteins, we adopted two approaches: (i) inhibited hsa-miR-1224-3p or hsa-miR-1260 (both significantly upregulated) and (ii) functionally mimicked hsa-miR-125b, hsa-miR-27b, hsa-miR-93 or hsa-miR-20a (all significantly downregulated) and examined for the miRNA -dependent modulations in protein targets. [score:11]
First, MSDACs transiently transfected with mimics for hsa-miR-125b, hsa-miR-27b, hsa-miR-93 or hsa-miR-20a (those exhibited complete suppression in aggressive disease) and examined for the regulation of their corresponding target proteins (Fig.   6a). [score:8]
Thus, we validated our microarray results with RT-qPCR for upregulation (Hsa-miR-1260; Hsa-miR-1224-3p) and downregulation (Hsa-miR-20a, Hsa-miR-27b, Hsa-miR-125b, Hsa-miR-93) profiles (see Fig.   3b). [score:7]
miRNA mimic (hsa-miR-125b, hsa-miR-27b, hsa-miR-93, hsa-miR-20a) and inhibitor (hsa-miR-1224-3p, hsa-miR-1260) approach for select miRNAs revealed the direct influence of the altered metastamiRs in the regulation of identified protein targets. [score:7]
Transient transfection of MSDACs with hsa-miR-125b-, hsa-miR-27b-, hsa-miR-93- or hsa-miR-20a- mimics (MISSION® microRNA Mimics, Sigma-Aldrich) as well as hsa-miR-1224-3p- and hsa-miR-1260 -inhibitors (MISSION® Synthetic miRNA Inhibitors, Sigma-Aldrich) were carried out by using either TurboFectin 8.0 reagent (Origene) or Neon electroporation transfection system (Life Technologies). [score:5]
On the other hand, MSDACs transfected with hsa-miR-20a exhibited significant (P < 0.001) inhibition of ASK1, MMP2, MMP3/10, PTPN3 and VEGF (Fig.  6b iii). [score:3]
We did not see any consistent inhibition of CREB and STAT3 at least with the mimic for hsa-miR-20a. [score:3]
b Histograms of mean cell–Alexa Fluor intensity obtained from Columbus automated batch analysis showing alterations in the expression (i) GRB10, MMP2, p38, STAT3, TNFα and VEGF in cells with hsa-miR-125b mimic, (ii) EGFR FOSB, kRAS, p38, PTPN3 and VEGF in hsa-miR-27b mimic transfected cells, (iii) ASK1, CREB, MMP2, MMP3/10, PTPN3, STAT3and VEGF in MSDACs with hsa-miR-20a mimic and, (iv) MMP2, MMP3/10, PTPN3 and STAT3 with hsa-miR-93 mimic in MSDACs. [score:3]
Compared to the non-metastatic xenograft, we observed a complete (P < 0.001) decrease in the expression of hsa-miR-93, hsa-miR-20a, hsa-miR-125b, and hsa-miR-27b (Fig.   3b). [score:2]
[1 to 20 of 12 sentences]
10
[+] score: 84
miR-20a and miR-17 directly bind to the 3′ untranslated region (UTR) of FBXO31 and inhibit FBXO31 mRNA and protein expression in human GC cells. [score:8]
Human miR-20a mimics, miR-17 mimics, control mimics, miR-20a inhibitors, miR-17 inhibitors and control inhibitors were synthesized from RiBoBio (Guangzhou, China). [score:7]
Our results indicated that miR-17 and miR-20a mimics inhibited, whereas miR-17 and miR-20a inhibitor increased, the expression of FBXO31. [score:7]
The overexpression of miR-17 and miR-20a contributed to the down-regulation of FBXO31 in GC tissues partly. [score:6]
miR-20a and 17 were up-regulated in GC samples and FBXO31 expression was negatively associated with miR-20a and 17 in primary GC tissues. [score:6]
We used different databases, such as TargetScan, pictar and miRanda to predict the miRNA targeting FBXO31 and found that miR-20a and 17 were partly complementary to two conserved site within the 3' UTR of FBXO31. [score:5]
Therefore,we transfected the mimics or inhibitor of miR-20a or miR-17 into GC cells BGC-823 and HGC-27 and used qRT-PCR and western blot to detect the expression of FBXO31. [score:5]
However, miR-20a and 17 mimics or inhibitor have no effect on the protein expression level of another F-box protein FBXL11 (Fig. S2). [score:5]
We used qRT-PCR to determine miR-20a and 17 expression in 56 paired GC and the corresponding non-cancerous normal mucosa tissues. [score:3]
Correlation analyses between FBXO31 and miR-20a (17) expression in GC samples were made using linear regression. [score:3]
FBXO31 expression is negatively associated with miR-20a and miR-17 in primary GC tissues. [score:3]
Clinically,we found that the expression of miR-17 and miR-20a in tumor tissue was significantly higher than that in surrounding normal mucosa. [score:3]
We found that miR-20a or miR-17 mimics decreased, whereas miR-20a or miR-17 inhibitor increased, the mRNA and protein level of FBXO31, respectively (Fig. 3 A-F). [score:3]
showed that the expression of miR-20a and 17 in tumor tissue was significantly higher than that in surrounding normal mucosa. [score:3]
Two miR-20a and miR-17 complementary sequences GCACTTT in the 3' UTR were mutated singly or together to remove complementarity by use of a QuikChange site-directed mutagenesis kit with pMIR-FBXO31/wt as the template. [score:2]
To further determine whether FBXO31 was a direct target of miR-20a and miR-17,we constructed a vector containing the 3'UTR of FBXO31 and luciferase reporter vector pMIR-REPORT (pMIR-FBX) and investigated the effect of miR-20a and miR-17 on the luciferase activity of pMIR-FBX. [score:2]
26/52 samples showed the inverse trend of decreased FBXO31 and increased miR-20a expression in tumor tissues compared with non-cancerous tissue. [score:2]
In all, 37/56 (66.1%) and 38/56 (67.9%)of the clinical GC specimens showed increased expression of miR-20a and miR-17,respectively, as compared with surrounding normal mucosa (Fig. 4A and 4B). [score:2]
Therefore, we detected whether FBXO31 were regulated by miR-17 and miR-20a. [score:2]
We found miR-20a and 17 significantly reduced the luciferase activity of pMIR-FBX (Fig. 3G). [score:1]
Therefore, the second region of the 3' UTR of FBXO31 is important in binding with the miR-20a and miR-17. [score:1]
Figure 3 (A) miR-20a and miR-17 were analyzed with qRT-PCR in BGC-823 and HGC-27 cells transfected with miR-20a, miR-17 mimics or control mimics. [score:1]
Statisticalanalysis showed that FBXO31 were highly correlated with miR-20a and miR-17 levels in GC samples (P<0.0001) (Fig. 4E and 4F). [score:1]
Because two sites within the 3'UTR of FBXO31 was found to be complementary to miR-20a and 17, we constructed three mutant, pMIR-FBX/mut1 (Site1 was mutated), pMIR-FBX/mut2 (Site2 was mutated) and pMIR-FBX/mut1,2 (Both site1 and 2 were mutated). [score:1]
Figure 4 (A and B) qRT-PCR analysis of miR-20a (A) and miR-17 (B) level in 56 paired human GC and adjacent normal gastric mucosa tissues. [score:1]
The 217bp 3' -UTR sequence of human FBXO31 gene containing miR-20a and miR-17 binding sites was amplified and inserted into the SpeI/HindIII sites of the pMIR-REPORT luciferase vector (named as pMIR-FBXO31/wt). [score:1]
[1 to 20 of 26 sentences]
11
[+] score: 57
Significant expression of these 10 miRNA targets was detected at 8 and 24 h after CLP, and 6 targets (miR-16, miR-17, miR-20a, miR-20b, miR-26b, miR-106a) showed remarkable upregulation of up to 50- and even 100-fold at 24 h (Fig. 4B). [score:10]
The exosomes showed marked expression of 6 (miR-16, miR-17, miR-20a, miR-20b, miR-26a, and miR-26b) of the 10 miRNA targets at 8 h after CLP; the expression of the remaining 4 miRNA targets (miR-106a, miR-106b, miR-195, and miR-451) increased; however, the increase was not significant (Fig. 5B). [score:9]
The miRNA targets that were significantly up-regulated in the CLP experiment, as shown by the microarray experiments, are shown in Table 1. The expressions of 2 (miR-16 and miR-17), 6 (miR-20a, miR-16, miR-17, miR-451, miR-106a, and miR-106b), and 7 miRNAs (miR-26b, miR-20b, miR-17, miR-20a, miR-106a, miR-26a, and miR-195) increased significantly in the whole blood of mice at 4, 8, and 24 h after CLP, respectively. [score:8]
In this study, the mice with CLP experienced bacterial infection first and then septicemia, therefore, the results clearly showed that 8 miRNA targets (miR-16, miR-17, miR-20a, miR-26a, miR-26b, miR-106a, miR-106b, and miR-451) were up-regulated in both the CLP alone group and the E. coli infection group. [score:6]
miR-17, miR-20a, and miR-106a all specifically bind to the same seed sequence within the 3′-untranslated region (UTR) of signal-regulatory protein α (SIRPα), an essential signaling molecule that modulates leukocyte -mediated inflammatory responses and are inversely correlated with SIRPα expression in various cells [42]. [score:6]
In this study, we demonstrated that experimental sepsis induced by CLP caused time -dependent upregulation of the circulating miRNAs miR-16, miR-17, miR-20a, miR-20b, miR-26a, miR-26b, miR-106a, miR-106b, miR-195, and miR-451. [score:4]
These results show that 8 miRNAs (miR-16, miR-17, miR-20a, miR-26a, miR-26b, miR-106a, miR-106b, and miR-451) were up-regulated after both CLP and subcutaneous injection of E. coli. [score:4]
By targeting Ask1 mRNA, miR-20 effectively controls the production of inflammatory cytokines by fibroblast-like synoviocytes in response to stimulation by a TLR4 ligand LPS [41]. [score:3]
Both in vitro and in vivo assays demonstrate that miR-17, miR-20a, and miR-106a regulate macrophage infiltration, phagocytosis, and proinflammatory cytokine secretion by targeting SIRPα [42]. [score:3]
miR-17 and miR-20a belong to a group of commonly overexpressed miRNAs, the miR-17∼92 cluster, which is located on mouse chromosome 14 (13 in humans) and comprises 7 mature miRNAs (miR-17-5p and, miR-18a, miR-19a and b, miR-20a, and miR-92a). [score:3]
Among these miRNAs, the levels of miR-195 and miR-451 detected in the Ago2 immunoprecipitates were more than 20-fold that in the controls and the levels of miR-16, miR-20a, miR-26a, and miR-106b were more than 10-fold that in the control. [score:1]
[1 to 20 of 11 sentences]
12
[+] score: 55
As miRNAs play their roles by regulating target genes, we identified target genes of miR-20a both in human and mice by bioinformatic methods. [score:6]
Furthermore, in cutaneous squamous cell carcinoma, researchers also found that miR-20a could inhibit A431 and SCL-1 proliferation and metastasis, and LIMK1 was a direct target gene of miR-20a [33]. [score:6]
In anaplastic thyroid cancer, miR-20a could inhibit cellular proliferation and cell invasion via decreasing LIMK1 protein expression [32]. [score:5]
Relative expression levels of target genes of miR-20a. [score:5]
miR-20a might be a key inhibitor in this process via targeting Limk1 to lower cell motility. [score:5]
This result suggested that miR-20a could directly target Limk1. [score:4]
Figure 4 (A-F) represents relative expression level of miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1, respectively. [score:3]
In this study, we found that in infertile male subjects, sperm motility was lower in relative higher GEN dose group (Group3) while the relative expression levels of seminal plasma miR-19b-1, miR-20a and miR-92a-1 were higher in corresponding groups. [score:3]
After treatment with GEN, we found that the relative expression levels of miR-17 and miR-20a were significantly increased at the dose of 5 mg/kg/day (Figure 4, P < 0.05, P < 0.01, respectively). [score:3]
We found that miR-20a was the only miRNA of miR-17-92 cluster differentially expressed both in human and mice samples. [score:3]
miR-20a was the only miRNA that differentially expressed in human and mice samples. [score:3]
It is interesting that the relative expression levels of miR-19b-1, miR-20a and miR-92a-1 were higher in Group 3 compared to Group 1 (Figure 2, P < 0.05). [score:2]
The result of 3’ UTR luciferase assay showed that Limk1 was targeted by miR-20a. [score:2]
This cluster includes miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1 [13, 14]. [score:1]
Cells were transfected with 50 nM miR-20a mimics, negative control (NC), 500 ng pGL3-Limk1-miR-20a-WT and pGL3-Limk1-miR-20a-Mut on 24-well plates respectively. [score:1]
Figure 2 (A-F) represents miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1, respectively. [score:1]
of miR-20a. [score:1]
These findings suggested that miR-20a might be one of the key miRNAs that is involved in abnormal spermatogenesis induced by GEN. [score:1]
[1 to 20 of 18 sentences]
13
[+] score: 51
The key reasons are as follows: Bim and Stat3 genes harbor miR-20a binding sites, and c-Kit and Socs3 genes harbor miR-19 binding sites, which are conserved across different phyla (ie, human, monkey, mouse, and rat) (Figures 8A, B and S7A, B); Bim is identified as direct targets of miR-17, 43, 44 miR-20a, [44] and miR-92a; [44] Stat3 is identified as direct targets of miR-17 45, 46 and miR-20a; 45, 46 Socs3 is identified as a direct target of miR-19a; [47] and Bim, Stat3, c-Kit, and Socs3 have been demonstrated to be implicated in the process of spermatogenesis. [score:10]
Zhang M Liu Q Mi S Both miR-17-5p and miR-20a alleviate suppressive potential of myeloid-derived suppressor cells by modulating STAT3 expression. [score:7]
He Z Jiang J Kokkinaki M MiRNA-20 and mirna-106a regulate spermatogonial stem cell renewal at the post-transcriptional level via targeting STAT3 and Ccnd1. [score:4]
293T and GC-1 cells were seeded in 96-well plate (1 × 10 [5] cells/well) and incubated for 24 h. The pLuc-Bim-3’-UTR-wt or pLuc-Stat3-3’-UTR-wt was cotransfected into 293T or GC-1 cells with miR-20a mimics, mimics control, or miR-20a mimics plus miR-20a inhibitor using Lipofectamine 2000 (Invitrogen, California, USA), respectively. [score:3]
C–F, Both Bim (C, D) and Stat3 (E, F) are target genes of miR-20a. [score:3]
In contrast, transient transfection of wild-type Bim-luc reporter or Stat3-luc reporter with miR-20a mimics plus inhibitor into 293T or GC-1 cells could fully reverse the miR-20a -induced decrease in luciferase activity (Figure 8C–F). [score:3]
16– 19 The in situ hybridization analysis on adult testes revealed that the miR-17 is highly expressed in early stages of germ cells and greatly decreased as germ cells mature, and miR-20a is mainly detected in the spermatogonia and preleptotene spermatocytes. [score:3]
The miR-17-92 cluster and its 6 different mature microRNAs, including miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92a, play important roles in embryo development, immune system, kidney and heart development, adipose differentiation, aging, and tumorigenicity. [score:3]
48– 54 FIGURE 8 Identification of Bim and Stat3 as target genes of miR-20a. [score:3]
48– 54 FIGURE 8 Identification of Bim and Stat3 as target genes of miR-20a. [score:3]
[15] miR-20 is preferentially expressed in mouse spermatogonial stem cells (SSCs) and essential for self-renewal of SSCs. [score:3]
The miR-17-92 gene cluster encodes 6 miRNAs of 4 miRNA families: the miR-17 family including miR-17-5p and miR-20a, the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and the miR-92 family. [score:1]
The 3’-UTRs of Bim and Stat3 mRNA contain complementary site for the seed region of miR-20a (Figure 8A and B), and the 3’-UTRs of c-Kit and Socs3 mRNA contain complementary site for the seed region of miR-19 (data not shown). [score:1]
Currently, increasing evidence indicates that some members of miR-17-92 cluster may be critical players in spermatogenesis, including miR-17, miR-18a, and miR-20a. [score:1]
The luciferase reporter gene vectors (ie, pLuc-Bim-3’-UTR-wt and pLuc-Stat3-3’-UTR-wt) containing the putative miR-20a binding site at the 3’-UTR of Bim or Stat3 mRNA were obtained from Kangbio (Shenzhen, China). [score:1]
[4] The miR-17-92 gene cluster encodes 6 miRNAs of 4 miRNA families: the miR-17 family including miR-17 and miR-20a, the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and the miR-92 family. [score:1]
A, B, Sequence alignment of 3’-UTR of human (Hsa), mouse (Mmu), rhesus (Mml), and rat (Rno) Bim (A) and Stat3 (B) highlighting miR-20a binding site. [score:1]
[1 to 20 of 17 sentences]
14
[+] score: 48
According to Matsubara et al. [80], inhibition of miR-17-5p and miR-20a with antisense oligonucleotides (ONs) can induce apoptosis selectively in lung cancer cells overexpressing miR-17-92, suggesting the possibility of targeting an ‘oncomiR addiction’ to expression of these miRNAs in a subset of lung cancers. [score:9]
Resveratrol and Pterostilbene decrease the levels of endogenous as well as exogenously expressed miR-17, miR-20a and miR-106b thereby upregulating their target PTEN [122] and eventually leading to reduced tumor growth in vivo. [score:8]
As p21 and STAT 3 are direct targets of miR-17-5p and miR-20a, downregulation of miR-17-5p and miR-20a induces myeloid differentiation and growth arrest in AML cells in vitro and in vivo [112]. [score:7]
HIF-1α (Hypoxia Inducible Factor 1 Alpha Subunit) downregulates the expressions of miR-17-5p and miR-20a through a mechanism that is dependent of c-Myc but independent of its transcription partner HIF-1ß. [score:6]
Supporting in vitro and tissue level high expression of miR-17-5p, a clinical study proves serum levels of miR-17 along with miR-19a, miR-20a and miR-223 were significantly upregulated in CRC patients compared to controls [104]. [score:5]
qPCR -based miRNA expression profiling revealed that miR-17-5p, miR-18a-5p and miR-20a-5p exhibit enhanced expression in tissue samples derived from triple -negative as compared to luminal A breast tumors, which are less aggressive and have much better prognosis as well as lower recurrence rate [64]. [score:4]
miR-17-5p and miR-20a in turn negatively regulate E2F1 expression [28]. [score:4]
MiR-17 along with miR-106a/b and miR-20a/b targets GABBR1(gamma-amino-butyric acid type B receptor 1) thus promoting colorectal cancer cell proliferation and invasion [99]. [score:3]
The miR-17-92 cluster transcript comprises six miRNAs - miR-17-5p, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1 - and is highly conserved among vertebrates [19, 20]. [score:1]
A study in multiple myeloma (MM) patients showed that high levels of miR-17-5p, miR-20a and miR-92-1 of miR-17-92 cluster are associated with shorter progression-free survival, suggesting poor prognosis [109]. [score:1]
[1 to 20 of 10 sentences]
15
[+] score: 36
Among all the miRNAs examined, significantly upregulated expression of miR-21, miR-26a, and downregulated expression of miR-20 was observed in aortas in NR1 -treated ApoE [−/−] mice compared to that from the vehicle -treated ApoE [−/−] mice (Table 3 ), suggesting that NR1 may exert the anti-atherosclerotic effects in part through modulating the expression of regulatory miRNAs in atherosclerosis. [score:13]
It is worth noting that NR1 treatment significantly decreased the expression of miR-21a, miR-26a, miR-126a and increased the expression of miR-20a in the aortas, suggesting that the anti-atherosclerotic effects of NR1 could be mediated in part through modulating the expression of miRNAs implicated in monocyte differentiation, oxidative stress, fibrosis as well as angiogenesis. [score:7]
Furthermore, significantly increased aortic expression of miR-26a, miR-21, miR-126a, miR-132, miR-146 and miR-155 and decreased expression of miR-20a and miR-92a were observed in the vehicle -treated ApoE [−/−] mice. [score:5]
While NR1 treatment led to a significant reduction in the expression of miR-21, miR-26a, miR-126 and increased expression of miR-20a. [score:5]
Significantly increased aortic expression of miR-146a, miR-26a, miR-21a, miR-155, miR-126a and miR-132, decreased expression of miR-20a and miR-92a was observed in vehicle -treated ApoE [−/−] mice. [score:5]
miR-155 is pro-differentiative [26] and miR-20a has been revealed to be anti-differentiative [27]. [score:1]
[1 to 20 of 6 sentences]
16
[+] score: 36
miRNA Number of targets in miRNA-gene bigraph network P-value miR-20a 9 8.16E-09 miR-17 10 1.30E-07 miR-34a 9 2.78E-07 miR-155 14 2.16E-07 miR-18a 5 4.04E-06 miR-22 5 6.18E-06 miR-26a 6 9.29E-06 miR-101 5 3.30E-05 miR-106b 5 3.30E-05 miR-125b 8 8.37E-05 It is well known that AD is a complex disease and devastating neurodegenerative disorder without effective disease-modifying or preventive therapies. [score:7]
Moreover, the miR-17 and miR-20a bindings sites located in or near the APP 3'UTR variants T117C, A454G and A833C, and the A454G variant increased miR-20a binding (Delay et al., 2011), and miR-17 and miR-20a were down-regulated in age-related and senescence-related cellular processes (Hackl et al., 2010). [score:4]
The top 10 miRNAs with P ≤ 8.37 e [5] were listed in Table 3. They are miR-20a, miR-17, miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b, indicating that these ten miRNAs could regulate the expression of nodes (genes) in the sub-network of SAMP8 mice and might be one cause inducing SAMP8 mice to exhibit significant nodes (or genes) and to display a distinct genetic sub-network in the brain. [score:4]
miR-17, miR-19b, miR-20a, and miR-106a are down-regulated in human aging. [score:4]
In addition, microRNAs, including miR-20a, miR-17, miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b might regulate the expression of genes (nodes) in the sub-network, thereby disrupting the fine-tuning of genetic networks in SAMP8 mice. [score:4]
APP expression was regulated by miR-20a (Hebert et al., 2009; Fan et al., 2010; Delay et al., 2011), miR-17 (miR-17-5p) (Delay et al., 2011), miR-106b (Hebert et al., 2009), and miR-101 (Vilardo et al., 2010; Long and Lahiri, 2011). [score:4]
miRNA Number of targets in miRNA-gene bigraph network P-value miR-20a 9 8.16E-09 miR-17 10 1.30E-07 miR-34a 9 2.78E-07 miR-155 14 2.16E-07 miR-18a 5 4.04E-06 miR-22 5 6.18E-06 miR-26a 6 9.29E-06 miR-101 5 3.30E-05 miR-106b 5 3.30E-05 miR-125b 8 8.37E-05 Differentially expressed mRNA in the hippocampus and cerebral cortex of SAMP8 and SAMR1 mice at 2, 6, and 12 months were investigated using cDNA microarray (Cheng et al., 2007b). [score:3]
miR-20a promotes proliferation and invasion by targeting APP in human ovarian cancer cells. [score:3]
In addition, a tight correlation between miR-20a/miR-106b and APP was found during brain development and in differentiating neurons (Hebert et al., 2009). [score:2]
Based on the miRNA-gene bipartite graph network in the brain of SAMP8 mice, we identified the top 10 miRNAs with P ≥ 8.37E-05, including miR-20a, miR-17, miR-34a, miR-155, miR-18a, miR-22, miR-26a, miR-101, miR-106b, and miR-125b (Table 3). [score:1]
[1 to 20 of 10 sentences]
17
[+] score: 35
However, the presence of miR-20a, −25 and -30b, all predicted to inhibit expression of genes involved in brown fat development, may prevent the development of a “classical” brown fat phenotype in human BAT. [score:7]
In this present study, miR-20a was the only miRNA predicted to target MYF5 and PPARγ (a previously experimentally observed target [38]), two important factors directing cell fate towards a brown fat phenotype [11]. [score:6]
Finally, PPARγ is known to be targeted by miR-20a [29] and myogenic factor 5 (MYF5) is predicted to be targeted by miR-20a. [score:5]
Furthermore, miR-20a was the miRNA targeting the second most numbers of genes (n = 149) involved in growth and development, highlighting its potential importance in these pathways. [score:4]
These 10 miRNAs and their predicted regulatory network are presented in Fig.   5. Bone morphogenetic protein 2 (BMP2) and BMP7 are predicted to be targeted by miR-20a,-140 and miR-25, −30b, respectively. [score:4]
In contrast, miR-20a is also predicted to target BMP2 and BMPR2, a growth factor and receptor increased in white fat differentiation [39]. [score:3]
Of these 25 miRNAs, miR-20a was predicted to target MYF5 and PPARγ, two important genes involved in brown adipogenesis, as well as BMP2 and BMPR2, genes involved in white adipogenesis. [score:3]
The identification of BAT-enriched miRNAs, conserved in both mouse and human BAT, such as miR-20a, may be a common factor controlling BAT development. [score:2]
These findings suggest that miR-20a may have the capacity to control cell fate toward a brown or white fat phenotype. [score:1]
[1 to 20 of 9 sentences]
18
[+] score: 32
A number of dysregulated microRNAs in this mo del were already described in the pathogenesis of liver disease and showed concordant level of expression with respect to that already described in literature (miR-155, miR-20a, miR-182, miR-200a, miR-200c, miR-27a, miR-31, miR-99b) or discordant expression level (miR-193b, miR-93, miR-125a-5p). [score:8]
Some miRNAs were overexpressed in tumors (miR-155, miR-193b, miR-27a, miR-31, miR-99b, miR-484, miR-574-3p, miR-125a-5p, miR-182), whereas others displayed down-regulation (miR-20a, miR-200c, miR-93, miR-340-5p, miR-720) or a comparable level of expression (miR-200a) with respect to non tumor tissues. [score:8]
MiR-20a down-regulation was described in human HCC, where Mcl-1 (myeloid cell leukemia sequence 1), an anti-apoptotic member of Bcl-2 family, was identified as miR-20a target [49]. [score:6]
MiR-20a, miR-200c, miR-27a, miR-99b displayed a global, more or less marked, down-regulation during the treatment. [score:4]
MiR-20a was down-regulated in liver tissues and in tumors from HF mice. [score:3]
In accordance, a miR-20a predicted target site is located on Mus musculus Mcl-1 3′UTR (microRNA. [score:3]
[1 to 20 of 6 sentences]
19
[+] score: 30
Another explanation is that the expression of miRNA-20a may be down-regulated in the necrotic hepatocytes. [score:6]
Temporal abundance analysis of host serum miRNAs in two murine mo dels during S. japonicum infectionTwo mouse strains, C57BL/6 and BALB/c, were employed as schistosomiasis japonica disease mo dels to detect in serum, four host circulating miRNAs, miR-122, miR-21, miR-20a and miR-34a, all of which have been suggested to be correlated with different types of liver disease progression [30– 33]. [score:5]
Two mouse strains, C57BL/6 and BALB/c, were employed as schistosomiasis japonica disease mo dels to detect in serum, four host circulating miRNAs, miR-122, miR-21, miR-20a and miR-34a, all of which have been suggested to be correlated with different types of liver disease progression [30– 33]. [score:5]
There was a tendency, albeit not statistically significantly, for relatively high expression of miRNA-20a in the serum of infected BALB/c mice at 7 weeks p. i. and thereafter. [score:3]
These data indicate that other tissues, such as the spleen and/or intestine, which also retain schistosome eggs, may contribute to the serum levels of miR-20a and miR-34a, both are multi-tissue expressed miRNAs [45, 46]. [score:3]
Thus, the low efficiency of reverse transcription of other miRNA-20a isomiRs might have impaired the sensitivity of detecting this miRNA to some degree. [score:1]
In C57BL/6 mice, the serum concentrations of miR-122, miR-20a and miR-34a did not change at any time point post infection, but the level of serum miR-21 was increased at 6 (1-Way ANOVA, P<0.01) (Fig 1A). [score:1]
In contrast, apart from miR-20a, the serum levels of the three other host miRNAs were significantly elevated in BALB/c mice by 6 (miR-122) or 7 (miR-21 and miR-34a) weeks p. i. and thereafter (Fig 1B and S3 Fig). [score:1]
The serum miR-20a and miR-34a levels showed a significant but weaker correlation with the serum AST and ALT levels than those of miR-122 and miR-21 in BALB/c mice. [score:1]
M, Ultra low range DNA ladder; lane 1, ath-miR-159a; lane 2, mmu-miR-122; lane 3, mmu-miR-21; lane 4, mmu-miR-20a; lane 5, mmu-miR-34a; lane 6, ath-miR-159a; lane 7, sja-miR-277; lane 8, sja-miR-3479-3p. [score:1]
S1 Fig M, Ultra low range DNA ladder; lane 1, ath-miR-159a; lane 2, mmu-miR-122; lane 3, mmu-miR-21; lane 4, mmu-miR-20a; lane 5, mmu-miR-34a; lane 6, ath-miR-159a; lane 7, sja-miR-277; lane 8, sja-miR-3479-3p. [score:1]
With miR-122 and miR-34a, there was a significant difference between the two mouse strains at 4–11 weeks p. i., while for miR-21 and miR-20a, significant difference was only observed at 7 weeks p. i. (Fig 1C). [score:1]
This may have been due to the existence of multiple relatively high expressed miRNA-20a isomiRs and the design of the RT-primer against this miRNA, since we only designed one RT-primer against one form of miRNA-20a isomiRs. [score:1]
[1 to 20 of 13 sentences]
20
[+] score: 27
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Heart-specific miRNAs or miRNAs abundantly expressed in the heart, B) Liver-specific miRNAs or miRNAs abundantly expressed in the liver, C) miRNAs showing strong expression in the thymus, D) Expression analysis of miR-18a and miR-20a, the miRNAs located in the miR-17-92 cluster, and E). [score:9]
Our study revealed miR-181 and miR-142-3p with relatively high expression in thymus (Figure 2C), and miR18a and miR-20a appeared to be weakly expressed in thymus (Figure 2D). [score:5]
Some miRNAs, including miR-208, miR-101, miR-18a, miR-20 and miR-142-3p, showed a weaker expression than other miRNAs tested by small RNA blot analyses (Figures 2 and 3). [score:3]
Although miR-18a and miR-20a are likely derived from the same primary-transcript, the expression levels of these mature miRNAs are not similar (Figure 2D). [score:3]
Surprisingly, the expression pattern of miR-20a's differed from that of miR18a in different tissues. [score:3]
miR-18a and miR-20a are located within the miR-17-92 cluster, which contains miRNAs known as "oncomiRs" because of their overexpression in many types of cancer cells [58, 59]. [score:3]
The miR-17-92 cluster (polycistronic miRNA gene) encodes six miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) located in the third intron of a ~7-kb primary transcript known as C13orf25 [61]. [score:1]
[1 to 20 of 7 sentences]
21
[+] score: 25
We found that the expression of miR-20a, miR-21, miR-28 and miR-290, all involved in MEF senescence, were deregulated in coincidence with p21 down regulation and increase of cell proliferation. [score:5]
The proliferation data showed that miR-20a and miR-290 did not affect cell proliferation as expected, the down regulated miR-28 and miR-34 significantly reduced the proliferation of immortalized MEF with similar efficiency, while miR-21 did not inhibit cell proliferation (Fig. 3C). [score:4]
The analysis showed that while miR-20a and miR-290 were down regulated till p6 (Fig 3A) miR-21 and miR-28 were up regulated. [score:3]
Conversely miR-290 and miR-20a involved in culture and stress induced senescence of primary MEF were not able to inhibit proliferation of immortal MEF in keeping with the idea that miRNAs behave differently in different cellular context [33]. [score:3]
The miRNA signatures changed markedly after p6: while miR-20a and miR-290 remain down regulated, although to a lesser extent, miR-21 and miR-28 switched from up to down regulation (Fig. 3A). [score:3]
In addition we tested miR-20a and miR-290 whose expression was not affected by the immortalization. [score:3]
MiR-20a, miR-21, miR-28, miR-34, miR-290 and miR-NC (negative control) (GenePharma Shanghai, China) MEF were isolated from 13.5d mouse embryos, expanded and then replated every three days (6T3 protocol). [score:1]
The following oligonucleotides were used: p19ARF, forward (F) (5'-CATGGGTCGCAGGTTCTTG-3') and reverse (R) (5'-GCTCGCTGTCCTGG GTCTC-3'); p16, F (5'-CGACGGGCATAGCTTCAG-3') and R (5'-GCTCTGCTCTTGGGATTGG-3'); p21, F (5'-TCCACAGCGATATCCAGACA-3') and R (5'-GGACATCACCAGGATTGGAC-3'); p53, F (5'-ATGCCCATGCTACAGAGGAG-3') and R (5'-AGACTGGCCCTTCTTGGTCT-3'); GAPDH, F (5'-GCCTTCCGTGTTCCTACCC-3'), R (5'-TGCCTGCTTCACCACCTTC-3'); miR-20a, F (5'-TAAAGTGCTTATAGTGCAGGTAG-3'); miR-21, F (5'-TAGCTTATCAGACTGATGTTGA-3'), miR-28, F (5'-AAGGAGCTCACAGTCTATTGAG-3'); miR-34a, F (5'-TGGCAGTGT CTTAGCTGGTTGT-3'); miR-290, F (5'-gctaatcttctctgtatcgttccaa-3'); U6, F (5'-CGCAAGGATGACACGCAAATTC-3'). [score:1]
Figure 3 (A) Quantification of miR-20a, miR-21, miR-28, miR-290 and miR-34a per passage normalized to that of MEF at passage 0. Dashed lines indicate the transition from passage 5 to 6. (B) phase distribution (%) of MEF from p1 to p5. [score:1]
Mature miR-20a, miR-21, miR-28, miR-34a and miR-290 were quantified using the miScript System: 1μg of total RNA was retrotranscribed with miScript Reverse Transcription Kit (Qiagen) and qRT-PCR was carried out using miScript SYBR Green PCR Kit (Qiagen). [score:1]
[1 to 20 of 10 sentences]
22
[+] score: 25
Using the software ‘TARGETSCAN’, “PICTAR” and ‘MIRANDA’, we found that miR-17 and miR-20a have the same seed sequences and two predicted target sites in the same region of the 3′UTR of mouse E2F1 (Fig.   4C). [score:5]
These results suggest that the effect of miR-17-92 on cell cycle control is dependent on miR-17 and miR-20a which directly target E2F1 in PMCs. [score:4]
This result indicates that E2F1 is a direct target of miR-17 and miR-20a in PMCs. [score:4]
In addition, miR-17 and miR-20a could directly target the 3′UTR of E2F1 in PMCs and imped G1/S transition of PMCs. [score:4]
After increase, miR-17 and miR-20a may negatively target E2F1, and thereby prevent the cells from excessive proliferation. [score:3]
The inhibition of miR-17 and miR-20a in cells transfected with miR-17-92 mimics decreased the proportion of cells in G0/G1 phase (Fig.   5C) while increasing the percent of cells in S phase (Fig.   5D). [score:3]
To investigate whether this effect was dependent on miR-17 and miR-20a, the same cells were co -transfected with miRNA inhibitors against miR-17 and miR-20a respectively. [score:1]
The miR-17-92 cluster is conserved among vertebrates, comprising six miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1 [8]. [score:1]
[1 to 20 of 8 sentences]
23
[+] score: 23
miRNAs predominantly affect protein expression, so we initially used a stable isotope labelling in cell culture (SILAC) -based approach to identify miR-17∼19b- and miR-20a-regulated proteins. [score:4]
We further confirmed this by a complementary approach using lentiviral overexpression of antagomirs against miR-17, miR-18 and miR-20a in the human BCR-ABL -positive BV173 cell line. [score:3]
21, 26 miRNA expression was increased between 5- and 16-fold upon transduction (miR-17 5.2-fold, miR-18a 2.1-fold, miR-19a 9-fold, miR-19b 10.6-fold, and miR-20a 15.8-fold). [score:3]
miR-20a overexpression showed similar, but weaker, effects to miR-17∼19b in preliminary experiments (data not shown). [score:3]
The polycistronic microRNA cluster miR-17∼92 encodes miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1. [13] Notably, miR-17∼92 -deficient mice suffer significant developmental cardiac defects and lung hypoplasia though interrogation of haematopoiesis identified isolated defects in B-lineage development. [score:3]
Together, these data demonstrate direct and functional miRNA binding of miR-17∼19b members namely miR-17/miR-20a and miR-18a to human BCL2 mRNA. [score:2]
In human BCL2, we identified 13 binding sites for miR-17∼19b miRNAs (five sites for miR-17, six sites for miR-18a and two sites for miR-20a) located within the CDS and 3′UTR (Supplementary Figure 3B). [score:1]
[19] It is interesting to note that while this effect, in MYC -driven lymphoma at least, is primarily mediated by miR-19 family members (miR-19a/b), we have identified principally a miR-17 family- (miR-17, miR-20a/b, miR-106a/b and miR-93) and miR-18 family(miR-18a/b) -driven effect in BCR-ABL -positive ALL on BCL2, indicating differences in pro- and anti-apoptotic functions of miR-17∼92 between the various cellular contexts. [score:1]
Notably, six binding sites for miR-17∼19b miRNAs (three sites for miR-18a, two sites for miR-17 and one site for miR-20a) are located within the 5′UTR and CDS of murine Bcl2 (Supplementary Figure 3A). [score:1]
TonB cells metabolically labelled with heavy, medium, or light isotope lysine and arginine versions were lentivirally transduced with miR-17∼19b, miR-20a, or a control vector (SIEW). [score:1]
Protein abundance was only slightly affected in miR-20a cells and thus, respective proteins were not further analysed. [score:1]
[1 to 20 of 11 sentences]
24
[+] score: 22
The well expressed miR-21, miR-155 and miR-146a clustered together as consistently upregulated, while the abundant microRNAs of the miR17~92 clusters (miR-19b, miR-20a and miR-92) showed a clear trend towards decreased expression in differentiated cells, as did miR-26a (Figure 2A). [score:8]
In contrast to the clear upregulation observed for miR-155, the expression of the miR-17~92 cluster (especially miR-17-3p and miR-20a) tended to decrease along differentiation. [score:6]
In addition, 7 microRNAs of the 17~92 and paralog 106b~25 clusters (namely miR-19a, miR-19b, miR-20a, miR-25, miR-92, miR-93 and miR-106b) were identified among the 53 most expressed microRNAs (groups A and B, see Table 1). [score:3]
Interestingly, the expression level of miR-20a was significantly increased in the central memory subset, in contrast to more differentiated subsets. [score:3]
Expression levels of miR-17-3p, miR-17-5p, miR-19b, miR-20a and miR-92 were therefore determined by single specific qPCR in differentiated CD8 [+ ]T cell subsets, and compared to the levels found in naïve cells. [score:2]
[1 to 20 of 5 sentences]
25
[+] score: 21
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
In contrast, ICI 182,780 increased the expression of miR-20a and miR-21 in MSMC and LSMC, and miR-26a in MSMC, while inhibiting the expression of miR-26a in LSMC [210]. [score:7]
After 6 and 12 wks of E [2] exposure, 15 miRNAs were down-regulated, e. g., miR-22, miR-99a, miR-106a, miR-127, miR-499, and 19 miRNAs were-up-regulated, e. g., miR-17-5p, miR-20a, miR-21, miR-129-3p, miR-106a, miR-22, and miR-127. [score:7]
Genes targeted by three of the altered miRNAs were examined: miR-20a regulates E2F1, miR-106a regulates RBI, and miR-127 regulates BCL6. [score:6]
Western blot of mammary gland lysates after 12 wks of E [2] showed that levels of RBI and E2F1 were decreased and BCL6 protein was increased, data that are in agreement with the increase miR-20a and miR-106a and the decrease in miR-127 detected [198]. [score:1]
[1 to 20 of 4 sentences]
26
[+] score: 20
Other miRNAs from this paper: mmu-mir-141, mmu-mir-21a, mmu-mir-21b, mmu-mir-21c
Regulation of miR expression patterns in both Myc-CaP/AS and Myc-CaP/CR by panobinostat single treatment resulted in down-regulation of miR-20a and miR-21 compared to vehicle treated mice. [score:6]
Whereas PSA allows for surveillance of AR transcriptional activity, microRNAs including miR-20a and miR-21 would allow the monitoring of multiple pathways within PCa patients being treated with novel targeted therapies. [score:3]
Using QRT-PCR, we determined the expression levels of a documented miR associated with AR/hypoxia signaling, miR-21 [21] and the c-Myc/hypoxia associated miR-20a [22]. [score:3]
The microRNA target sequences are miR21 (UAGCUUAUCAGACUGAUGUUGA) which produces a product of 44 base pairs and miR20a (UAAAGUGCUUAUAGUGCAGGUAG) which produces a product of 47 base pairs. [score:3]
Of specific interest to us was the response of two documented microRNAs to exhibit oncogenic activity in PCa and whose expression is mediated by these signaling pathways, miR-20a [51] and miR-21 [52]. [score:3]
Also, data from clinical samples indicated that patients with a Gleason score ≥7 had significant increase of miR-20a expression compared to patients with Gleason score ≤6 [51]. [score:2]
[1 to 20 of 6 sentences]
27
[+] score: 20
In contrast, expression of miR-19a and miR-20a was downregulated in mouse NS cell differentiation. [score:6]
In contrast, antiapoptotic miR-20a was mainly downregulated throughout neural differentiation. [score:4]
In fact, transfection of hematopoietic progenitors with miR-20a increased the proliferation of monocytes and blocked differentiation, whereas inhibition of miR-20a caused a decrease in proliferation and more rapid differentiation and maturation. [score:3]
Expression of specific proapoptotic (miR-16, let-7a and miR-34a) and antiapoptotic miRNAs (miR-20a and miR-19a) were analyzed by quantitative Real Time-PCR from 10 ng of total RNA using specific Taqman primers and GAPDH for normalization. [score:2]
However, additional studies are required to determine the specific role of both miR-20a and miR-19a during cell differentiation, and also evaluate if their expression is restricted to a specific cell type. [score:1]
Recently, additional functions have been assigned to this cluster, particularly to miR-20a and miR-19a. [score:1]
miR-19a and miR-20a are members of the miR-17-92 cluster [61], which consists of seven mature miRNAs, previously linked to tumorigenesis. [score:1]
Specifically, miR-20a was shown to control monocyte differentiation [62]. [score:1]
Our results, showing that miR-20a decreases during mouse NS cell differentiation, are in agreement with this previous report. [score:1]
[1 to 20 of 9 sentences]
28
[+] score: 19
While we did not observe de-repression of let-7a, miR-20a, or miR-17-5p in ICMs lacking Sin3a, it is possible that other members of these miRNA families, different miRNAs altogether, or traditional protein repressors of Myc or E2f1 are instead misexpressed in these mutant cells, causing loss of Myc/E2F target expression and abortion of the cell cycle. [score:7]
Our analysis of miRNAs in Sin3a -null ICMs revealed no induction of miR17-5p nor increased expression of miR-20a or miR-290 family miRNAs, thereby demonstrating that the apoptosis and repression of Myc/E2F targets we observe in Sin3a null ICMs are not due to misregulation of these miRNAs. [score:6]
Artificially high levels of c-Myc expression were shown in human B cells to induce the miR-20 family of miRNAs as part of a feedback loop, resulting in a block in the translation of E2F1 transcripts (Zhang and Pugh, 2011). [score:5]
Similarly, human E2f1 is repressed by the miR-20 miRNA family (O'Donnell et al., 2005), whose members are either nearly or completely undetectable in and the ICM (Tang et al., 2006a, this study). [score:1]
[1 to 20 of 4 sentences]
29
[+] score: 19
Notably, 23 circulating miRNAs (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were significantly downregulated in DIO mice but upregulated in DIO + LFD mice. [score:7]
As shown in the Venn diagram in Fig.   7, notably, 23 of the 28 upregulated miRNAs in DIO + LFD mice (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were downregulated in the DIO mice. [score:7]
In addition, the miR-17-19 cluster, which comprises seven miRNAs (miR-17-5p, miR-17-3p, miR-18, miR-19a, miR-20, miR-19b, and miR-92-1) and promotes cell proliferation in various cancers, has been demonstrated to be significantly upregulated at the clonal expansion stage of adipocyte differentiation. [score:4]
Some of the circulating miRNAs identified in this study have also been reported in the adipose tissue of DIO mice or implicated in adipogenic processes [11– 13], including Let-7, miR-103, miR-15, the miR-17-92 cluster (miR-17, miR-20a, and miR-92a), miR-21, miR-221, and miR-30b. [score:1]
[1 to 20 of 4 sentences]
30
[+] score: 19
To validate the up- and downregulated miRNAs identified in the Solexa sequencing, 6 upregulated (mmu-miR-146a-5p, mmu-miR-341-3p, mmu-miR-879-5p, mmu-miR-3470a, mmu-miR-3473a and mmu-miR-3473b) and six downregulated miRNAs (mmu-miR-96-5p, mmu-miR-141-3p, mmu-miR-182-5p, mmu-miR-200a-3p, mmu-miR-200b-3p and mmu-miR-200b-5p), as well as two novel miRNAs (novel-mir-2 and novel-mir-20), were selected. [score:10]
Among them, two novel miRNAs, novel-mir-2 and novel-mir-20 were commonly found to be downregulated in all three infected groups. [score:4]
The downregulated log2-folds of novel-mir-2 in the 139A, ME7 and S15 groups were 2.72, 2.68 and 4.06, while those of novel-mir-20 were 6.84, 6.78 and 6.28, respectively. [score:4]
Specifically, two novel miRNAs (novel-mmu-miR-2 and novel-mmu-miR-20) are commonly changed in all three animal mo dels. [score:1]
[1 to 20 of 4 sentences]
31
[+] score: 19
In TM4 cells exposed to NP, Ppara was down-regulated at both 3 and 24 h. We thus surmised that miRNAs regulated by Ppara may include miR-378, miR-125a-3p, and miRNA-148a at 3 h, and miR-20a, miR-203, and miR-101a at 24 h. Figure 3 Network analysis of miRNAs the expression of which in TM4 cells was altered by NP (A) 3 h. (B) 24 h. Network analysis was performed using an algorithm supported by IPA. [score:7]
In TM4 cells exposed to NP, Ppara was down-regulated at both 3 and 24 h. We thus surmised that miRNAs regulated by Ppara may include miR-378, miR-125a-3p, and miRNA-148a at 3 h, and miR-20a, miR-203, and miR-101a at 24 h. Figure 3 Network analysis of miRNAs the expression of which in TM4 cells was altered by NP (A) 3 h. (B) 24 h. Network analysis was performed using an algorithm supported by IPA. [score:7]
Network analysis of deregulated miRNAs suggested that Ppara may regulate the expression of certain miRNAs, including miR-378, miR-125a-3p miR-20a, miR-203, and miR-101a, after exposure to NP. [score:5]
[1 to 20 of 3 sentences]
32
[+] score: 19
Of these OncomiRs, the expression levels of miR-21, miR-155, miR-221/222, miR-17, miR-19a/19b, and miR-20a/20b were higher in OCI-Ly10 cells, whereas the expression levels of miR-21, miR-155, miR-125a-5p/125b, miR-146a/146b-5p, and miR-17 were higher in SUDHL-4 and DB cells (Figure 1C). [score:5]
The expression levels of miR-21, miR-155, miR-221/222, miR-125a-5p/125b, miR-146a/146b-5p, miR-17, miR-19a/19b, and miR-20a/20b were significantly higher in the OCI-Ly10, SUDHL-4, and DB cells than in the IM-9 cells. [score:3]
Based on the mechanisms of miRNA functions, we selected those that are highly expressed in DLBCL, including miR-21, miR-155, miR-221/222, miR-125a-5p/125b, and miR-146a/146b-5p, as well as the miR-17-92 family members miR-17, miR-19a/19b, and miR-20a/20b; subsequently, we generated tandem sequences of 10 copies of the antisense sequences to these miRNA seed sequences and synthesized an interfering long non-coding RNA (i-lncRNA). [score:3]
Overexpression of miR-17~92 cluster (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) induces lymphoma [29]. [score:3]
A tandem sequence containing 10 copies of complementary sequences to the seed sequences of highly expressed OncomiRs (miR-21, miR-155, miR-221/222, miR-125a-5p/125b, miR-146a/146b-5p, miR-17, miR-19a/19b, miR-20a/20b) in DLBCL (Table 1) was generated and used as the encoding sequence for i-lncRNA. [score:3]
The i-lncRNA-involved OncomiRs were not always decreased, miR-21 was decreased, miR-221 was increased, and the expression of miR-155, miR-17, miR-19a and miR-20a was not changed, compared with the control group. [score:2]
[1 to 20 of 6 sentences]
33
[+] score: 19
In contrast to no effect of p100 on expression of miR-17/miR-20, the results from using p100 knockdown and constitutive expression revealed that p100 was crucial for miR-302d expression. [score:8]
However, our results indicated that p100 deletion failed to affect expression of miR-17/miR-20 although p100 exhibited an inhibitory effect on cyclin d1 mRNA 3′-UTR activity. [score:5]
The expression of these miRNAs were therefore determined in both p100+/+ and p100−/− cells, and the expression of miR-302a, miR-302b and miR-302d was found to be significantly decreased in p100−/− cells, whereas there was no observable difference on miR-17, miR-19a, miR-20a and miR-106b between p100+/+ and p100−/− cells (Figure 4E). [score:5]
The potential miRNA of miR-17/miR-20a cluster has been reported to inversely correlate to Cyclin D1 abundance in human breast cell lines [41]. [score:1]
[1 to 20 of 4 sentences]
34
[+] score: 19
We previously suggested that of the miRs analyzed, nine (miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194) stand out as being differentially expressed in C57BL/6 mice undergoing IRI compared to the expression observed in mice undergoing a sham procedure [14]. [score:4]
Panel C, Shown is a three-dimensional plot of the first three PCs obtained by performing PCA on all expression data obtained for kidneys from C57BL/6 mice following IRI (blue line) or sham surgery (red lines) in which we eliminated miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194 from the analysis. [score:3]
Our previous work showed that in C57BL/6 mice, expression of miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194 is significantly different between IRI and sham control groups at all times analyzed [14]. [score:3]
Shown is a three-dimensional plot of the first three PCs obtained by performing PCA on expression data for miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194 obtained for kidneys from C57BL/6 mice following IRI (blue line) or sham surgery (red lines) (Movie S3). [score:3]
Shown is a three-dimensional plot of the first three PCs obtained by performing PCA on expression data for miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194 obtained for kidneys from C57BL/6 mice following IRI (blue line) or sham surgery (red lines). [score:3]
Movie showing the rotation of a three-dimensional plot of the first three PCs obtained by performing PCA on all expression data obtained for kidneys from C57BL/6 mice following IRI (blue line) or sham surgery (red lines) in which we eliminated miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194 from the analysis. [score:3]
[1 to 20 of 6 sentences]
35
[+] score: 18
In terms of same “seed” sequence shared by miR-17 and miR-20a,1,220 conserved target genes for both miR-17 and miR-20a are predicted by TargetScan tool, in which quite a few genes are involved in cellular apoptosis regulation including caspase 7, caspase 2, BCL2-like 11, et al. Ingenuity Pathway Analysis (IPA) on the 1,220 predicted target genes revealed a cell death network (Supplemental Figure S5) and a cellular apoptosis pathway (Supplemental Figure S6). [score:8]
The target gene prediction of hsa-miR-17 and hsa-miR-20 was performed using TargetScan Human 6.2 version (released June 2012) (http://www. [score:5]
Consistent with the observation, transfection of MCF-7 cells with anti-miR-17 or anti-miR-20a decreased p53 expression (Fig. 1E). [score:3]
E, Western blot showing decreased p53 in anti-miR-17 and anti-miR-20a- transduced MCF-7 cells. [score:1]
In order to corroborate the effects of miR-17/20 on apoptosis, anti-miR-17 and anti-miR-20a were applied to block the function of endogenous miR-17 and miR-20a. [score:1]
[1 to 20 of 5 sentences]
36
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
We have recently shown that HDI downregulated the expression of AID and Blimp-1 by upregulating miR-155, miR-181b, and miR-361, which silence Aicda mRNA, and miR-23b, miR-30a, and miR-125b, which silence Prdm1 mRNA, but not miR-19a/b, miR-20a, and miR-25, which are not known to regulate Aicda, Prdm1, or Xbp1 (16). [score:10]
The selectivity of HDI -mediated silencing of AICDA/Aicda and PRDM1/Prdm1 was emphasized by unchanged expression of HoxC4 and Irf4 (important inducers/modulators of AICDA/Aicda), Rev1 and Ung (central elements for CSR/SHM), and Bcl6, Bach2, or Pax5 (repressors of PRDM1/Prdm1 expression), as well as unchanged expression of miR-19a/b, miR-20a, and miR-25, which are not known to regulate AICDA/Aicda or PRDM1/Prdm1. [score:8]
[1 to 20 of 2 sentences]
37
[+] score: 16
[179] In addition, some non-BMP-regulated miRNAs also have regulatory roles in BMP signaling: miR-141 and -200a remarkably modulate the BMP-2 -induced pre-osteoblast differentiation through the translational repression of Dlx5; [180] miR-542-3p targets BMP7 and represses BMP7 -induced osteoblast differentiation and survival; [181] miR-20a promotes osteogenic differentiation through upregulation of BMP/Runx2 signaling by targeting PPARγ, Bambi, and Crim1; [182] miR-140 targets a mild inhibitor of BMP Dnpep, and loss of miR-140 in mice causes growth defects of endochondral bones and craniofacial deformities. [score:16]
[1 to 20 of 1 sentences]
38
[+] score: 16
However, only miR-17 and miR-20a were shown to directly target TGF-β receptor II and miR-18a was reported to target the TGF-β down-stream signaling proteins Smad2 and Smad4 (for review see [4]). [score:6]
Moreover, the expression of the closely related family members miR-17 (which only differs from miR-20a by 2 nucleotides) and miR-19a (which only differs from miR-19b by one nucleotide) was not significantly changed, and might compensate for the reduction in miR-20a and miR-19b expression, respectively. [score:5]
One limitation of the present study, however, is that the deletion of miR-92a moderately affected the expression of miR-20a and miR-19b in heart and muscle tissue, and miR-18a was moderately but significantly reduced in skeletal tissue. [score:3]
However, the reduction of miR-19b and miR-20a in muscle tissue of miR-92a [−/−] mice was less than 50%. [score:1]
MiR-92a [−/−] mice showed a moderate, but significant decrease in miR-19a, miR-19b, and miR-20a in the heart, whereas only miR-19b and miR-20a were significantly decreased in muscle and miR-18a was significantly reduced in skeletal tissue (Figure 1C, Figure S1A/B). [score:1]
[1 to 20 of 5 sentences]
39
[+] score: 16
The miR-17 family (mmu-miR-17, mmu-miR-20a and mmu-miR-93) was highly expressed within the ovaries and down-regulated with age exclusively in df/df mice. [score:6]
Both miR-17 and miR-20a also directly target TGFBRII [46], a gene well-known to be directly involved in the regulation of primordial follicle activation and ovarian aging [7]. [score:6]
Specifically, miR-20a overexpression is associated with increased proliferation and invasion in ovarian cancer cells [47], and cell division, motility and differentiation were among the enriched GO terms for miRNAs regulated with age in df/df mice, further suggesting this. [score:4]
[1 to 20 of 3 sentences]
40
[+] score: 16
HEK 293T cells were seeded onto 24-well plates for 12 h. Afterwards, 0.2 μg of firefly luciferase reporter plasmid; 0.2 μg of β-galactosidase expression vector (Ambion); 0.2 μg of expression vector pcDNA3.1 -overexpressing miR-17-92 cluster; empty vector pcDNA3.1; or 10-, 20-, 50-nM miR-17, miR-20a, miR-19a, and miR-19b mimics were transfected into the cells. [score:7]
org) bioinformatics tools, we found that among those miRNAs in miR-17-92 cluster, miR-19a/b may target CNTFR and miR-17, miR-20a, and miR-19a/b may target glycoprotein 130 (GP130), respectively (Fig.   2a, b). [score:5]
In addition, miR-17 and miR-20a are reported to target JAK2 and STAT3 [26, 27]. [score:3]
b Sequence alignment of mature miR-19a, miR-19b, miR-17, and miR-20a revealed their seed sequences that were reverse complementary to the seed-matched sequence within the 3′ UTR of mouse CNTFR or GP130, respectively. [score:1]
[1 to 20 of 4 sentences]
41
[+] score: 15
Indeed, overexpression of miR-17 and miR-20a inhibited senescence in primary human fibroblasts by blunting the activation of p21 [WAF1], while inhibition of miR-17 caused senescence in anaplastic thyroid cancer cells (Takakura et al., 2008; Hong et al., 2010). [score:7]
At 104 weeks of age, HF-prone mice had significantly reduced expression levels of miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1 as compared to 12-week littermates (Fig. 2C and Supporting information Table S1), coinciding with the observed increased presence of their targets TSP-1 and CTGF. [score:4]
Aging of HF-resistant mice, on the other hand, was accompanied by significantly enhanced expression of these miRNAs, except for miR-17 and miR-20a (Supporting information Table S1). [score:3]
This cluster encodes six miRNAs (miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1) that are located within an 800-base pair region of human chromosome 13. [score:1]
[1 to 20 of 4 sentences]
42
[+] score: 14
EMAP-II upregulated ATG7 and ATG5 to enhance U87 and U251 glioma cell autophagy via miR20a down-regulation (Chen et al., 2016 ). [score:7]
We found that EMAP-II induced upregulation of autophagy-related protein 5 (ATG5) and autophagy-related protein 7 (ATG7) to promote autophagy that killed glioma cells by down -regulating miR-20a(12). [score:5]
Low-dose endothelial-monocyte-activating polypeptide-II induced autophagy by down -regulating miR-20a in U-87 and U-251 glioma cells. [score:2]
[1 to 20 of 3 sentences]
43
[+] score: 13
MiR-143 has been shown to inhibit ERK5 mRNA translation 2-fold through a site in its 3′ UTR, miR-20a inhibits translation of the E2F1 mRNA approximately 4-fold, and miR-375 inhibits translation of Myotrophin mRNA 2-fold. [score:13]
[1 to 20 of 1 sentences]
44
[+] score: 13
miR-17 and miR-20a inhibitors and mimics were used as positive controls, since these two miRNAs were previously shown to target HIF-1α. [score:5]
Independent transfection of HeLa cells with anti miR-17/-20a/-335/-93 exhibited an increase in the relative luciferase activity, whereas introduction of miR-17/-20a/-335/-93 mimics resulted in a reduction in luciferase activity suggesting that, apart from miR-17 and miR-20a, miR-335 and miR-93 are also direct regulators of Hif-1α (Fig 2B). [score:3]
Among these miRNAs, miR-17 and miR-20a have been reported to directly regulate HIF-1α in lung cancer cells [16]. [score:3]
Furthermore, interaction between miR-20a and Hif-1α was not found to be significant in our study. [score:1]
miR-93 was observed to share the same binding site as miR-17 and miR-20a while miR-335 had two binding sites. [score:1]
[1 to 20 of 5 sentences]
45
[+] score: 13
Figure 4 A. Histograms of individual miRNA QPCR analysis showing circulating levels of randomly selected miRNAs (miR-20a, miR-27b, miR-1224-3p, miR-1260, and miR-93) in the serum of animals with non-metastatic primary disease or with high-risk metastatic disease. [score:5]
Compared with the non-metastatic favorable disease animals, we observed marginal variations in the expression of miR-20a, miR-27b, miR-93, miR-1260, and miR-1224 (Figure 4A). [score:4]
For the present study, we used QPCR to confirm expression of selected miRNAs, including hsa-miR-1224-3p, hsa-miR-1260, hsa-miR-27b, hsa-miR-93, and hsa-miR-20a. [score:3]
B. Correlation analysis of the serum-circulating profiles of miR-20a, miR-27b, miR-1224-3p, miR-1260, and miR-93 observed using the miRnome approach. [score:1]
[1 to 20 of 4 sentences]
46
[+] score: 13
The miRNAs are clustered into five groups: (1: turquoise) The most highly expressed miRNAs in all samples, which are primarily made up of the mGliomiRs and the shared miRNAs; (2, gray) a cluster of miRNAs not expressed in vivo, but with very high expression levels in the cultured MG; (3: black) a “cluster” with miR-21 alone, which is moderately expressed in vivo but increased substantially in vitro; (4: pink) a cluster with miRNAs expressed at low levels in the FAC-sorted MG and which decline further in vitro (including miR-146a, miR-20a+b) and lastly (5: purple) a cluster of miRNAs that are moderately expressed in freshly isolated samples and also decline in vitro (including miR-148a, miR-106/miR-17, and miR-191). [score:13]
[1 to 20 of 1 sentences]
47
[+] score: 12
As expected, the CDK4/6 inhibitor significantly decreased the expression of miRNAs in these clusters, including miR-20a, -20b, -93*, and -106a in proneural GSCs (G44 and G559; Figure 5B). [score:5]
In contrast, miR-20a, -20b, -93, -106a, -19a, -130b, and -10b are up-regulated in GBM compared to the normal brain tissue. [score:3]
As predicted, the members of the miR-17˜92 cluster (miR-20a, -20b, -93, -106a, -130b, and -10b) and paralog clusters were over-expressed in seven of eight PN GSC lines (G44, 448, 464, 559, 578, 816 and 827; Figure 2C). [score:3]
Interestingly, miR-20a and -19a belong to the miR-17˜92 family, while miR-20b and -106a belong to the miR-106a˜363 family, a paralog of the miR-17˜92 cluster [20]. [score:1]
[1 to 20 of 4 sentences]
48
[+] score: 12
The study of these miRNAs could be a good basis for the identification and analysis of potential immuno-modulatory effectors in immuno -mediated diseases like multiple sclerosis, where a down-regulation of miR-17 and miR-20a associated with T-cell activation was demonstrated [80], or like inflammatory myopathies. [score:6]
The mir-17 family is the one most enriched (p = 3.24 E-4; Table S6) and comprises mir-17, mir-18a, mir-19a, mir-20a, mir-19b-1 and mir-92-1. This family is expressed as polycistronic units, revealing a common regulatory mechanism [62], that is confirmed by the similarity of their expression profiles (Figure 4 D). [score:6]
[1 to 20 of 2 sentences]
49
[+] score: 11
However, treatment with siADAM8-1 led to reduced levels of only eight miRNAs (miR-181a-2, miR-29c, miR-29c*, miR-98, miR-520c-3p, miR-93, miR-130b, and miR-720), whereas three miRNAs showed increased expression, including miR-30d, miR-20a and miR-106*b (Fig.   1d), suggesting these miRNAs may not be regulated specifically by ADAM8 or may have differential regulation via splice variants. [score:5]
For example, miR-18b, miR-20a, and miR-30d have been reported to be highly expressed in the serum of relapsing TNBC patients [88]. [score:3]
Calvano Filho CMC Calvano-Mendes DC Carvalho KC Maciel GA Ricci MD Torres AP Triple -negative and luminal A breast tumors: differential expression of miR-18a-5p, miR-17-5p, and miR-20a-5pTumour Biol. [score:3]
[1 to 20 of 3 sentences]
50
[+] score: 11
However, miR-124 is likely to be the major regulator of Ezh2 expression in differentiating neurons, because it is the most abundant miRNA in the brain (12) and is also highly up-regulated in differentiating P19 cells (20 times for miR-124 versus 2 times for miR-20 and miR-26a) (62). [score:7]
Of these, only miR-20a, miR-26a, and miR-124 are known to be up-regulated in differentiating P19 cells (62), which predicts possible synergistic effects of these three miRNAs on Ezh2 abundance. [score:4]
[1 to 20 of 2 sentences]
51
[+] score: 11
Since mmu_circRNA_40806 is a potential sponge for mmu-miR-20a-3p, we therefore speculate that mmu_circRNA_40806 might competitively bind with mmu-miR-20a-3p and relieve the inhibitory effects on the associated target genes including Hcfc2, Aak1, Capn2, and Tnfsf13b in the network (Figure 7). [score:5]
The five highest-ranking miRNA candidates that are binding targets of each circRNA were identified as: 1) For mmu_circRNA_40001:mmu-miR-466f, mmu-miR-466i-5p, mmu-miR-669n, mmu-miR-1187, and mmu-miR-466c-5p; 2) For mmu_circRNA_013120: mmu-miR-6541, mmu-miR-669c-3p, mmu-miR-466f-5p, mmu-miR-669m-5p, and mmu-miR-466j; and 3) For mmu_circRNA_40806: mmu-miR-7038-3p, mmu-miR-20a-3p, mmu-miR-145a-3p, mmu-miR-346-3p, and mmu-miR-149-5p. [score:3]
For example, among the observed circRNA/miRNA interactions, the potential miRNA targets of mmu_circRNA_40806 include miR-149-5p, mmu-miR-346-3p, and mmu-miR-20a-3p. [score:3]
[1 to 20 of 3 sentences]
52
[+] score: 11
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
From the top twenty miRNAs showing highest expression in A2B5+ GalC− cells, miR-130a, miR-16, miR-17, and miR-20a were also in the top twenty expressed miRNAs from our GPs. [score:5]
Similarly, miR-17, miR-20a, miR-21, miR-16, miR-103, and miR-107 identified in A2B5-GalC+ cells showed overlapping expression with our OPs. [score:3]
Additionally, miR-17 and miR-20a were predicted to target membrane associated guanylate kinase, WW and PDZ domain containing 3 (MagI-3), a junctional protein found in astrocytes [40]. [score:3]
[1 to 20 of 3 sentences]
53
[+] score: 10
Other miRNAs from this paper: hsa-mir-20a
In Ras transformed NIH 3 T3 cells it controls cebpb expression [38] in gastric cancer cells its expression is associated with metastasis [39] and inversely associated with the expression of miR20a [40]. [score:7]
Li X, Zhang Z, Yu M, Li L, Du G, Xiao W, Yang H. Involvement of miR-20a in promoting gastric cancer progression by targeting early growth response 2 (EGR2). [score:3]
[1 to 20 of 2 sentences]
54
[+] score: 10
Target analysis of miRNA expression revealed that Curcumin down-regulates the expression of pro-oncogenic miR-17-5p, miR-20a, miR-21, and miR-27a in human colo-rectal carcinoma cell lines. [score:10]
[1 to 20 of 1 sentences]
55
[+] score: 10
Upregulated mmu-miR-20 family could be useful in chromatin remo deling and subsequent gene expression. [score:6]
mmu-miR-20 and mmu-miR-106 have to regulate IL10 expression and macrophage inflammatory response [28, 29]. [score:4]
[1 to 20 of 2 sentences]
56
[+] score: 10
Among the miRNAs examined, we found that let-7b, miR-20a, and miR-181a were reliably expressed in the Dgcr8 [flox/ flox] TTFs, but expression of all three miRNAs was reduced to negligible levels in the Dgcr8 [Δ/Δ] TTFs (Figure 1B), which is consistent with the previous report (Kim et al., 2012). [score:5]
The qPCR analysis confirmed that Dgcr8 [Δ/Δ] NSCs did not express mature miRNAs such as miR-20a, miR-181a, let-7b, and miR-9/9 [∗], which are abundantly expressed in Dgcr8 [flox/ flox] NSCs (Figure 2D). [score:5]
[1 to 20 of 2 sentences]
57
[+] score: 10
miRNAs that were downregulated during granulopoiesis, including miR-17, miR-19a and miR-20a, were amongst those previously shown to be upregulated in leukemia [48]. [score:7]
Several members of the polycistronic miR-17-92 cluster and the homologous miR-106a-92 cluster (miR-17, miR-19a, miR-20a, miR-92a and miR-106a) were expressed at the highest levels in promyelocytes (Figure 3B). [score:3]
[1 to 20 of 2 sentences]
58
[+] score: 10
Although we were also studying miRNA expression in a condition where there is CD4 [+]CD8 [+] cell loss, in TEC we observed an upregulation of miR-20b and a suggestive increase in miR-20a expression, suggesting that intrathymic regulation of miR-20b is cell type specific. [score:9]
The systemic stress induced by dexamethasone intraperitoneal injection, a synthetic GC causes a significant loss of the CD4 [+]CD8 [+] thymocytes within 24 h and a reduction in miR-17-92 cluster (miR-17, miR-20a, miR-20b, and miR-106a) in whole thymus samples (52). [score:1]
[1 to 20 of 2 sentences]
59
[+] score: 9
miR-17, miR-20a, and miR-92 also illustrated the importance of collaboration in the regulation of Isl1 and Tbx1 during cardiac development [69]. [score:3]
miR-17 and miR-20a have been identified to target TGFBRII [66, 67]. [score:3]
The six miRNAs can be grouped into four miRNA families based on their seed-sequence: the miR-17 family (miR-17 and miR-20a), the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and miR-92 family (miR-92a-1) [31, 34, 39]. [score:1]
The primary transcript encodes six mature miRNAs: miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1 (Figure 2, Table 1). [score:1]
Both the evolutionary sequence analysis and the seed-sequence -based grouping partition these miRNAs into four families: the miR-106 family (miR-17, miR-20a/b, miR-106a/b, and miR-93), the miR-18 family (miR-18a/b), the miR-19 family (miR-19a/b-1/2), and the miR-92 family (miR-25, miR-92a-1/2, and miR-363). [score:1]
[1 to 20 of 5 sentences]
60
[+] score: 9
To address this issue, we first screened the miRNAs whose expressions are modulated in 4T1 cells by miRNA microarray analysis using both total cellular miRNA and exosomal miRNA after treatment with 100 μM of EGCG for 24 h. In brief, a set of miRNAs including let-7, miR-16, miR-18b, miR-20a, miR-25, miR-92, miR-93, miR-221, and miR-320 were up-regulated, and dozens of miRNAs including miR-10a, miR-18a, miR-19a, miR-26b, miR-29b, miR-34b, miR-98, miR-129, miR-181d were down-regulated in both total cellular and exosomal fraction by EGCG treatment (data not shown). [score:9]
[1 to 20 of 1 sentences]
61
[+] score: 9
The down-regulated miRNAs miR-9, miR-30 and miR-20 were all strongly predicted to affect target genes involved in axonal guidance. [score:6]
Axon guidance was among the most significant pathways to be affected by the predicted target genes and was the top prediction for miR-9, miR-30 and miR-20. [score:3]
[1 to 20 of 2 sentences]
62
[+] score: 9
Inhibition of miR-17 and miR-20a in cells overexpressing the miR-17-92 cluster can induce apoptosis, while inhibition of miR-18a and miR-19a did not have the same effect and inhibition of miR-92-1 resulted in only a modest reduction of cell growth [25]. [score:9]
[1 to 20 of 1 sentences]
63
[+] score: 9
The top-ranking biological networks associated with (A) miR-124, (B) miR-19, (C) miR-29 and (D) miR-20/17/106/93 predicted target genes are depicted. [score:3]
0044060.g004 Figure 4The top-ranking biological networks associated with (A) miR-124, (B) miR-19, (C) miR-29 and (D) miR-20/17/106/93 predicted target genes are depicted. [score:3]
The highest-ranking IPA networks associated with miR-124, miR-19, miR-29 and miR-20/17/106/93 predicted targets are depicted in Figure 4 and Figure S1. [score:3]
[1 to 20 of 3 sentences]
64
[+] score: 9
For example, miR-22, miR-142-3p and miR-142-5p were upregulated in CD11c [+] CD11b [+] B220 [−] cDCs and downregulated in pDCs relative to progenitor expression levels, while miR-20a, miR-17-5p and miR-130a showed the reverse pattern. [score:9]
[1 to 20 of 1 sentences]
65
[+] score: 9
Similarly, sequences from 461 through 474, from 1133 through 1154, and from 1138 through 1154 in the 3′ UTR region of CDKN1A are targets for miR-17 and miR-20a. [score:3]
This set of miRNAs was deliberately chosen based on the screening data showing that there were no definite differences in the positivity of immunostaining of pSTAT3 [Ser727] and pSTAT3 [Tyr705] after the treatment with miR inhibitors to miR-17-5p, miR-20a-5p, and miR-92a-3p (Supplemental Fig. 5). [score:3]
org demonstrated that sequences from 998 through 1020 in the 3′ UTR region of CCND1 are targets for miR-17 and miR-20a, those from 1770 through 1784 are those for miR-19a, and those from 1777 through 1782 are those for miR-19b. [score:3]
[1 to 20 of 3 sentences]
66
[+] score: 8
Stem cell lineage commitment into osteoblasts is likewise governed by diverse miRNAs, either in terms of inhibition or enhancement of osteogenesis, by miR-204/211 suppressing Runx2 or by miR-20a activating BMP signaling for example [23, 24]. [score:5]
Real-time PCR analyses showed a significant decrease of miR-17, miR-18a, miR-20a and miR-92a in bone tissues, reduction of all family members in bone marrow and reduced expression of miR-17, miR-18a, miR-19a, miR-20a and miR-92a could be observed in BMMSCs (Fig. 4A-C). [score:3]
[1 to 20 of 2 sentences]
67
[+] score: 8
In this study, Yang et al. have reported that vorinostat upregulates the transcription of MICA/B by promoting MICA -associated histone acetylation and by suppressing the MICA/B -targeting miRNAs, such as miR-20a, miR-93, and miR-106b. [score:8]
[1 to 20 of 1 sentences]
68
[+] score: 8
Less marked expression increase (included between 1.5 and 1.7 fold) of miR-20a, 200c, 93, 99b, 484, 574-3p and 720 was also detected, with final global iso- expression in HF with respect to LF-HC tissues. [score:5]
Slighter expression changes were detected in miR-20a, 200a and 720. [score:3]
[1 to 20 of 2 sentences]
69
[+] score: 8
Some of these miRNAs (e. g. miR-18a, miR-20a, miR-93) are upregulated in a high proportion of non-CBF-AML, and are associated with distinct AML subtypes (Additional file 1: Figure S3). [score:4]
The expression of miR-17, miR-18a, miR-20a, miR-93, and miR-181 in was evaluated from published gene expression datasets [24, 25]. [score:3]
Specifically, 52 non-CBF-AML and 31 CBF-AML were analyzed for miR-17, 31 non-CBF-AML and 18 CBF-AML were analyzed for miR-18a, 53 non-CBF-AML and 34 CBF-AML were analyzed for miR-20a, 34 non-CBF-AML and 18 CBF-AML were analyzed for miR-93 and miR-181. [score:1]
[1 to 20 of 3 sentences]
70
[+] score: 8
All the members of the cluster were cloned from purified P6 SCs [14], in situ hybridization with LNA (Locked Nucleic Acid) on adult testes showed miR-17 and miR-20a expression in SCs [12], and ulterior analysis of the small RNA transcriptome of SCs purified from mice at postnatal day 6 revealed high levels of expression for miR-19a and miR-19b, intermediated levels for miR-17 and miR-20a and low levels for miR-18a and miR-92a [16]. [score:5]
The miR-17-92 cluster, also known as Mirc1, is a polycistronic miRNA gene encoding six members (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) which are highly conserved in vertebrates and expressed in practically all tissues analyzed during embryonic and postnatal stages [5– 7]. [score:3]
[1 to 20 of 2 sentences]
71
[+] score: 7
Conversely, overexpression of miR-20a significantly inhibited proliferation, migration and invasion of the JEG-3 cell line, and inhibited the growth of JEG-3 tumour xenografts in nude mice 39. [score:7]
[1 to 20 of 1 sentences]
72
[+] score: 7
In summary, our results underline the relevance of microRNAs during kidney development and will encourage further functional studies examining single microRNAs and their target mRNA interactions – such as miR-20 and its targets PKD1 and PKD2 [3, 6, 30, 31] - as regulators of renal organogenesis. [score:7]
[1 to 20 of 1 sentences]
73
[+] score: 7
The enrichment of these miRNAs in TFS 1.1000 genes suggests that testosterone may down regulate these miRNAs, which would, in turn, lead to the observed up regulation (de-repression) of the TFS 1.1000 genes with mir-20A and mir-202 sites. [score:3]
Two other miRNAs whose binding sites were enriched in the genes of TFS group 1.1000, namely mir-20A and mir-202, are induced in testicular tubules following suppression of FSH and androgen [54], which leads to a block in spermiation. [score:3]
Class TFS group Motif name miRNA name I 9.1001 MEF2A - 9.2002 FOXO, LEF1, STAT5B, POU1F1, NFAT, TLX-2, GATA-1, STAT5a, MAZ, IRF-7, TAF, FOXF2, JUN, FOXA1, FOXJ1, ZHX2 MIR-23B, MIR-144, MIR-142 6.0110 MEF2A - 15.2112 TGIF - IIa 8.0002 E2F, TCF3, ETS-2, PAX4 - IIb 4.0010 MEF2A - 4.0020 HOXA4, GCM1, RFX1, GATA3 MIR-24 13.2022 TAF - IIc 12.0022 TCF8, FOXO, TAF MIR-524 IIIa 1.1000 STAT5B, STAT5A, PGR, LEF1, TCF3, FOXF2, E4F1 MIR-124A, MIR-17-5P, MIR-20A, MIR-106A, MIR-106B, MIR-20B, MIR-519D", MIR-182, MIR-200B, MIR-200C, MIR-429, MIR-202, MIR-199A, MIR-519E, MIR-9 IIIb 2.0100 MYCN, OLF1, MYOD1 - 2.0200 - MIR-493 - 11.1101 LEF1 -Motifs and miRNAs within each TFS group are listed in order of decreasing enrichment p-value, based on data provided in Additional file 3, Table S3B. [score:1]
[1 to 20 of 3 sentences]
74
[+] score: 7
The p49/STRAP (SRFBP1) gene is a target of miR-106a, miR-106b, miR-17, miR-20a, miR-20b, and miR-93. [score:3]
LIM-kinase 1 (LIMK1) is a target of miR-20a and other miRNAs including miR-106a, miR-106b, miR-17, miR-20a, miR-20b, and miR-93 [72]. [score:3]
As shown in Figure 4, after six hours of high glucose (400 mg/dL) and low glucose (30 mg/dL) treatment, the miR-17, miR-20a, and miR-92a-1 from miR-17-92 cluster were decreased in response to high glucose but increased in response to low glucose. [score:1]
[1 to 20 of 3 sentences]
75
[+] score: 7
The following synthetic miRNA mimics were used in this study: Mimic Transfection Control with Dy547 (cel-mir-67 conjugated with Dy547), Dharmacon CP-004500-01-10 miRIDIAN microRNA Mimic Negative Control #1 (cel-mir-67), Dharmacon CN-001000-01-10 miRIDIAN Mimic hsa-miR-17, Dharmacon C-300485-05-0005 miRIDIAN Mimic hsa-miR-18a, Dharmacon C-300487-05-0005 miRIDIAN Mimic hsa-miR-19a, Dharmacon C-300488-03-0005 miRIDIAN Mimic hsa-miR-20a, Dharmacon C-300491-03-0005 miRIDIAN Mimic hsa-miR-19b, Dharmacon C-300489-03-0005 hsa-miR-92a, custom synthesized by Shanghai GenePharma miRIDIAN Mimic hsa-miR-155, Dharmacon C-300647-05-0010 Generation of miR-17~92 -expressing lentivirus was previously described (Hong et al., 2010). [score:3]
The following synthetic miRNA mimics were used in this study: Mimic Transfection Control with Dy547 (cel-mir-67 conjugated with Dy547), Dharmacon CP-004500-01-10 miRIDIAN microRNA Mimic Negative Control #1 (cel-mir-67), Dharmacon CN-001000-01-10 miRIDIAN Mimic hsa-miR-17, Dharmacon C-300485-05-0005 miRIDIAN Mimic hsa-miR-18a, Dharmacon C-300487-05-0005 miRIDIAN Mimic hsa-miR-19a, Dharmacon C-300488-03-0005 miRIDIAN Mimic hsa-miR-20a, Dharmacon C-300491-03-0005 miRIDIAN Mimic hsa-miR-19b, Dharmacon C-300489-03-0005 hsa-miR-92a, custom synthesized by Shanghai GenePharma miRIDIAN Mimic hsa-miR-155, Dharmacon C-300647-05-0010 Transfection of miR-17~92-expresing plasmid was previously described (Xiao et al., 2008). [score:1]
miR-17 and miR-20a belong to the miR-17 family, while miR-19a and miR-19b belong to the miR-19 family. [score:1]
For example, the probe mixture for the miR-17 subfamily contains probes for miR-17, miR-20a, miR-106a, miR-20b, miR-106b, and miR-93, the probe mixture for the miR-18 subfamily contains probes for miR-18a and miR-18b, the probe mixture for the miR-19 subfamily contains probes for miR-19a and miR-19b, and the probe mixture for the miR-92 subfamily contains probes for miR-92, miR-363, and miR-25. [score:1]
Since cel-mir-67 is a C. elegans miRNA that has no homolog in mammalian species, we decided to perform the same experiments using microRNA-17~92 (miR-17~92), a miRNA cluster encoding six mature miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b, and miR-92). [score:1]
[1 to 20 of 5 sentences]
76
[+] score: 7
Hua et al. [29] showed that VEGF is predicted to be targeted by multiple miRNAs, including miR-15b, miR-16, miR-20a and miR-20b, and transfection of these miRNAs into CNE cells (a human nasopharyngeal carcinoma cell line) can inhibit VEGF expression [29]. [score:7]
[1 to 20 of 1 sentences]
77
[+] score: 6
Seventeen miRNAs were found which had 2-folds or greater differences in levels in VemR A375 melanoma cells as compared with parental A375 cells by microarray (Figure 1B and Supplementary Table S1), with 7 down-regulated miRNAs including miR-7 (40.3-fold), miR-18a-5p (5.2-fold), miR-19a-3p (3.6-fold), miR-20b-5p (3.4-fold), miR-17-5p (3.2-fold), miR-20a-5p (3.1-fold), and miR-19b-3p (2.8-fold) and 10 up-regulated miRNAs including miR-514a-3p (116-fold), miR-129-1-3p (87-fold), miR-509-3p (83-fold), miR-629-3p (22-fold), miR-937-5p (4.6-fold), miR-3960 (4.3-fold), miR-1915-3p (3.2-fold), miR-6090 (3.1-fold), miR-4281 (2.6-fold) and miR-4634 (2-fold). [score:6]
[1 to 20 of 1 sentences]
78
[+] score: 6
Since loss of miR-17 group miRNAs (miR-17 and miR-20a) causes skeletal defects in mice [20], we tested whether miR-17 can suppress gene expression via the predicted target sequence of Tgfbr2 by luciferase reporter assay. [score:6]
[1 to 20 of 1 sentences]
79
[+] score: 6
In contrast, miR-18a, miR-19a, miR-19b and miR-20a expression levels were significantly lower in PMBL than in DLBCL. [score:3]
The only discrepancy was observed for miR-20a expression which was higher in Karpas versus SU-DHL-5 (Karpas 17.14 (Q1-Q3, 1.9-22); SU-DHL-5 5.9 (Q1-Q3, 5.52-6.29) P =< 0.02), but it was significantly lower in PMBL versus DLBCL patients (Supplementary figure 3). [score:3]
[1 to 20 of 2 sentences]
80
[+] score: 6
Among the microRNAs, miR-182 in the Udown group together with 8 microRNAs in the Uup group (miR-96, miR-30a, miR-20a, miR-93, miR-384-5p, miR-106b, miR-17, and miR-181a) targeted Ppp3r1. [score:3]
miR-182 in the Udown group together with miR-96, miR-30a, miR-20a, miR-93, miR-106b, miR-17, miR-384-5p, and miR-181a in the Uup group targeted Caln (Fig 6). [score:3]
[1 to 20 of 2 sentences]
81
[+] score: 6
Interestingly, many moRNA-deriving, cancer -associated hairpins are also expressed in oocytes such as mir-17-92 cluster, miR-20, miR-21, miR-15a/16 and miR-103 [50] whereas miR-421 from mir-374b-421 cluster has been reported to be up-regulated in ovarian teratomas [60]. [score:6]
[1 to 20 of 1 sentences]
82
[+] score: 6
Up-regulation of circulating miR-20a is correlated with hepatitis C virus -mediated liver disease progression. [score:6]
[1 to 20 of 1 sentences]
83
[+] score: 6
MiR-17-5p, miR-20a, miR-93, miR-106b, miR-373, and miR-520 all target MICA or MICB, two ligands of the NKG2D receptor, and regulate their expression in several human cancer cell lines [29]. [score:6]
[1 to 20 of 1 sentences]
84
[+] score: 6
The genes and miRNAs expected to be enriched in iPSCs/ESCs, from the literature [18, 21, 38– 42], include transcription factors involved in maintaining “stemness” (FOXD3, GATA6, NANOG, NR6A1, POU5F1, SOX2, UTF1, TFCP2L1, and ZFP42), signaling molecules involved in pluripotency and self-renewal (CRABP2, EDNRB, FGF4, FGF5, GABRB3, GAL, GRB7, IFITM1, IL6ST, KIT, LEFTY1, LEFTY2, LIFR, NODAL, NOG, NUMB, PTEN, SFRP2, and TDGF1), cytokines and growth factors (FGF4, FGF5, LEFTY1, LEFTY2, NODAL, and TDGF1), other ESC-specific genes (BRIX1, CD9, DIAPH2, DNMT3B, IFITM2, IGF2BP2, LIN28A, PODXL, REST, SEMA3A, TERT, ESRG, and GJA1), and miRNAs (miR-302a, miR-302c, miR-371a, miR-302b, miR-302d, miR-372, miR-373, miR-92a-1, miR-92a-2, miR-92b, miR-17, miR-20a, and miR-18a) that were highly enriched in genes and miRNAs that were expressed (NRC ≥ 20) in our reprogrammed iPSCs and the majority of them showed significant upregulation (FC ≥ 2.0, FDR ≤ 0.05) during iPSC reprogramming (Figure 4(c)). [score:6]
[1 to 20 of 1 sentences]
85
[+] score: 6
The miR-20a family and miR-101, which target APP, are down-regulated in AD patients 46 47. [score:6]
[1 to 20 of 1 sentences]
86
[+] score: 6
In absence of irradiation, here we show no difference in expression levels of three miRNAs belonging to miR-17∼92 cluster (miR-17, miR-19a, miR-20a; Figure 7), although at P2/3 GCPs are actively proliferating. [score:3]
One of the miRNAs of interest is miR19a-5p, belonging to one of the best-known miRNA clusters, the miR-17∼92, which encodes six miRNAs (i. e., miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1) [24]. [score:1]
Bonferroni post-hoc tests, for unirradiated conditions, did not show any significant difference between WT and mutant cells in miR-17 and miR-19a, while a mild significance is observable in miR-20a (P < 0.01). [score:1]
Second, we analyzed 3 members of the 17∼92 cluster, i. e., miR-17, miR-19a, miR-20a, involved in cell survival and viability. [score:1]
[1 to 20 of 4 sentences]
87
[+] score: 5
Other highly-expressed miRNAs include those of the miR-17∼92 cluster (miR-17, miR-20a, miR-19b, miR-92a) (Table 1 ). [score:3]
Also, our studies showed that miR-17 and miR-20a were found to be significantly more highly-expressed in hypertrophic chondrocytes compared to both precursor and differentiated chondrocytes (Tables 3 and 4 ). [score:2]
[1 to 20 of 2 sentences]
88
[+] score: 5
Hypoxia -induced microRNA-20a expression increases ERK phosphorylation and angiogenic gene expression in endometriotic stromal cells. [score:5]
[1 to 20 of 1 sentences]
89
[+] score: 5
Among the p53-miRs that target the components of the miRNA processing complexes, miR-15/16/195, miR-103, miR-107, let-7, miR-124, miR-181, miR-148a/b, miR-30a/c, miR-27, miR-17, and miR-20 appear to target more than five components of the miRNA-processing pathway [Table 4, Table S3], suggesting the conserved nature of p53-miRs. [score:5]
[1 to 20 of 1 sentences]
90
[+] score: 5
hsa-miR-93 and hsa-miR-20a have been found to be overexpressed in a multiple cancer types, induce cell proliferation and deletion of these miRNA clusters, in mice, are lethal, and cause lung and lymphoid cell developmental defects [39]. [score:4]
hsa-miR-mit-3 has two matches with hsa-miR-93 and hsa-miR-20a. [score:1]
[1 to 20 of 2 sentences]
91
[+] score: 5
This includes miRNA families miR-30 (miR-30a, miR-30d, miR-30e, miR-30b, miR-30c, miR-30e*), miR-24 (miR-24, miR-24-2*), miR-26 (miR-26a, miR-26b), miR-29 (miR-29a, miR-29c), miR-34 (miR-34b-3p, miR-34c*) in Cluster 1 which has high expression in the adulthood stage, and miR-20 (miR-20a, miR-20b) in cluster 5 which has high expression in the early stages of lung organogenesis. [score:5]
[1 to 20 of 1 sentences]
92
[+] score: 5
Fang W Microrna-20a-5p contributes to hepatic glycogen synthesis through targeting p63 to regulate p53 and pten expressionJ. [score:5]
[1 to 20 of 1 sentences]
93
[+] score: 5
Other miRNAs from this paper: hsa-mir-20a
It has been observed that pks E. coli induces the expression of microRNA-20a-5p, which is responsible for p53 post-translational modification (accumulation of small ubiquitin-like modifier (SUMO)-conjugated p53), which in turn leads to cellular senescence [17, 82]. [score:5]
[1 to 20 of 1 sentences]
94
[+] score: 5
In addition, none of the miRNAs predicted to regulate Irf9, Oas1a or IfitM1 mRNAs (i. e. miR-20, −23, −106a) exhibited noticeable downregulation in Dicer [d/d] splenocytes. [score:5]
[1 to 20 of 1 sentences]
95
[+] score: 5
Jung et al (17) determined that there is an interaction between the hepatitis B virus (HBV) and the miR-17–92 polycistron via c-Myc, and that miR-20a and miR-92a-1 induce post-transcriptional suppression of HBV. [score:3]
MicroRNA-19b (miR-19b) is part of the miR-17–92 cluster, which encodes miR-17, miR-18a, miR-19a, miR-19b, miR-20a and miR-92a-1. The miR-17–92 cluster is required to induce cardiomyocyte proliferation in postnatal and adult hearts (4). [score:1]
A previous study has observed specific changes in miRNA abundance and activity in a broad range of human aging mo dels and suggested the use of miR-17, miR-19b, miR-20a and miR-106 as novel biomarkers of cellular aging (6). [score:1]
[1 to 20 of 3 sentences]
96
[+] score: 5
In addition, miR-20a, which is part of the mir-17–92 cluster, is overexpressed in prostate cancer, and its inhibition induces cell death and apoptosis in PC3 cells (5). [score:5]
[1 to 20 of 1 sentences]
97
[+] score: 5
Moreover, we recently demonstrated that oncogenic miRNAs, such as miRNA-20a and miRNA-106a, were critical targets for inhibiting malignant phenotypes of CSCs [3, 39]. [score:5]
[1 to 20 of 1 sentences]
98
[+] score: 5
Other miRNAs from this paper: hsa-mir-20a, mmu-mir-182, hsa-mir-148a, hsa-mir-182, mmu-mir-148a
Chen and team validated the finding that QKI suppresses GBM by stabilizing microRNA-20a (miR-20a), which targets TGF-β receptor 2 (TGFβR2) [28]. [score:5]
[1 to 20 of 1 sentences]
99
[+] score: 4
For example, a microRNA identified as a regulator of p53 expression could be considered a senescence marker but there are reports that p53 can be regulated by microRNA-20 (miR-20) [13], miR-106a [14], miR-22 [15], miR-33 [16] and miR-29 [17]. [score:4]
[1 to 20 of 1 sentences]
100
[+] score: 4
Impressively, we found that although several members of the miR-17-92 cluster (miR-17, miR-18a, miR-19a, miR-20a), miR-146a, and miR-101a were not changed in purified splenic B cells, they were significantly upregulated in splenic T cells (Fig. 3). [score:4]
[1 to 20 of 1 sentences]