sort by

134 publications mentioning mmu-mir-23a (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-23a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 398
In pSNL -induced chronic neuropathic pain, spinal miR-23a expression was significantly reduced, which increased the expression of spinal CXCR4, and subsequently the expression of TXNIP and NLRP3 inflammasome including NLRP3, ASC, Caspase-1, and IL-1β The present study is for the first time to identify a novel role of miR-23a as a regulator of neuropathic pain by directly targeting CXCR4 at spinal level. [score:11]
Then, we intrathecally post -injected mice with the increase of TXNIP induced by knockdown of miR-23a; the result showed that miR-23a inhibition -induced increase of TXNIP expression was markedly reduced by CXCR4 knockdown with siRNA, suggesting that miR-23a regulates TXNIP expression via CXCR4 at the protein level (Fig.   5c, d). [score:10]
In pSNL -induced chronic neuropathic pain, spinal miR-23a expression was significantly reduced, which increased the expression of spinal CXCR4, and subsequently the expression of TXNIP and NLRP3 inflammasome including NLRP3, ASC, Caspase-1, and IL-1β CXCR4 has been identified as an inflammatory-related regulatory factor in mammals. [score:8]
Additionally, spinal CXCR4 expression was increased by 37.6 or 39.4%, respectively, after miR-23a knockdown with miR-23a inhibitor (Fig.   2h) or LV-miR-23a (expressing two molecules of miR-23a antisense, a “miRNA-loss-of-function” strategy) (Fig.   2i) in naïve mice. [score:8]
Data are presented as mean ± SEM; n = 3 per group Based on the fact that miR-23a/CXCR4 regulates neuropathic pain by directly targeting TXNIP and TXNIP regulates the expression of NLRP3 inflammasome in neuropathic pain, we supposed to investigate whether miR-23a or CXCR4 could regulate NLRP3 inflammasome via TXNIP. [score:7]
Contrarily, knockdown of miR-23a with LV-miR-23a or overexpression of CXCR4 by Lenti-CXCR4 increased the expression of spinal NLRP3, ASC, P-Caspase-1, C-Caspase-1, and IL-1β, which were reversed by knockdown of TXNIP with siRNA in naïve mice (Fig.   6d, e). [score:7]
Data are presented as mean ± SEM; n = 5 per groupTo determine the role of CXCR4 in miR-23a -mediated modulation of neuropathic pain at the behavioral level, we inhibited CXCR4 with AMD3100 in the presence of miR-23a inhibition with miR-23a inhibitor (Fig.   3e) or LV-miR-23a (Fig.   3f), followed by behavioral tests. [score:7]
Data are presented as mean ± SEM; n = 3 per groupBased on the fact that miR-23a/CXCR4 regulates neuropathic pain by directly targeting TXNIP and TXNIP regulates the expression of NLRP3 inflammasome in neuropathic pain, we supposed to investigate whether miR-23a or CXCR4 could regulate NLRP3 inflammasome via TXNIP. [score:7]
In contrast, TXNIP expression was significantly enhanced in the spinal cord of naïve mice with miR-23a inhibition by intrathecal injection of miR-23a inhibitor or LV-miR-23a, whereas no changes were observed by intrathecal injection of scrambled or empty vector (Fig.   5c, d). [score:7]
Data are presented as mean ± SEM; n = 5 per group To determine the role of CXCR4 in miR-23a -mediated modulation of neuropathic pain at the behavioral level, we inhibited CXCR4 with AMD3100 in the presence of miR-23a inhibition with miR-23a inhibitor (Fig.   3e) or LV-miR-23a (Fig.   3f), followed by behavioral tests. [score:7]
As shown in Fig.   6c, overexpression of miR-23a significantly reduced the increase of NLRP3 inflammasome evidenced by downregulation of NLRP3, ASC, P-Caspase-1, C-Caspase-1, and IL-1β after pSNL. [score:6]
Data are presented as mean ± SEM; n = 5 per group The 3′-untranslated region (3′-UTR) sequence of miR-23a targeting CXCR4 was synthesized [wild-type(wt)-Cx, 5′-P-TCGAAATACTTTTTTTTGTTTGTTTGTTTCAT GTGAATGAGTGTCTAGGCAGGACCTGT-3′, and 5′-P-GGCCACAGGTCCTGCCTA GACACTCATTCACATGAAACAAACAAACAAAAAA AAGTATT-3′; mutation type (mut)-Cx, 5′-P-TCGAAATACTTTTTTTTGTTTGTTTGTTTCAGGAAAATGAGTGT CTAGGCAGGACCTGT-3′, and 5′-P-GGCCACAGGTCCTGCCTAGACACTCATTTT CCTGAAACAAACAAACAAAAAAAAGTATT-3′]. [score:6]
In particular, inhibition of TXNIP reversed pain behavior elicited by pSNL, miR-23a knockdown, or CXCR4 overexpression. [score:6]
Our findings demonstrate that downregulation of miR-23a increases spinal CXCR4 expression and subsequently induces neuropathic pain through modulating the TXNIP/NLRP3 inflammasome axis. [score:6]
Moreover, miR-23a was found not only decreased in the blood of patients with multiple sclerosis [10] or acute ischemic stroke [11], but also rapidly downregulated in the injured cortex following traumatic brain injury [12], suggesting a potential modulatory function of miR-23a in CNS diseases. [score:6]
In contrast, knockdown of miR-23a by intrathecal injection of miR-23a inhibitor or lentivirus induced pain-like behavior, which was reduced by CXCR4 inhibition. [score:6]
Furthermore, we determined whether CXCR4 knockdown could inhibit the increase of TXNIP induced by miR-23a overexpression. [score:6]
Intrathecal injection of miRNA mimics (miR-23a mimics) or lentivirus (Lenti-miR-23a) upregulated the expression of spinal miR-23a. [score:6]
And combining to treat the mice with CXCL12 further aggravated the pain sensitivity induced by knockdown of miR-23a with inhibitor, evidenced by the enhanced thermal hyperalgesia and mechanical allodynia (Fig.   3g), suggesting the down-modulation of miR-23a inducing overexpression of CXCR4 is functional and contributes to pain production. [score:6]
To further determine the role of TXNIP in miR-23a/CXCR4 -mediated pain process at the behavioral level, we post -treated the animals with siRNA to knockdown TXNIP in the presence of miR-23a inhibition or CXCR4 overexpression with respective intrathecal injection of LV-miR-23a or Lenti-CXCR4 and then observed the behavioral response. [score:6]
Knocking down of TXNIP markedly alleviated the hypersensitivity to thermal and mechanical stimulus induced by miR-23a inhibition (Fig.   5e) or CXCR4 overexpression (Fig.   5f) in naïve mice. [score:6]
Together, these results suggest that spinal miR-23a regulates neuropathic pain by targeting CXCR4 expression at the spinal level. [score:6]
In contrast, in naïve mice, downregulation of miR-23a via intrathecal injection of miR-23a inhibitor or LV-miR-23a, but not scrambled miRNAs or vector, for 3 consecutive days, produced pain-like behavior (Fig.   3c, d). [score:6]
These results suggest that the downregulation of spinal miR-23a after pSNL injury, which subsequently reduces its inhibitory effect on CXCR4, may be required for the maintenance of neuropathic pain. [score:6]
Moreover, miR-23a overexpression or CXCR4 knockdown inhibited the increase of TXNIP and NLRP3 inflammasome in pSNL mice. [score:6]
h, i Spinal CXCR4 protein expression was increased by intrathecal injection of miR-23a inhibitor (miR-23a Ih) (h) or LV-miR-23a (LV-23a) (i) in naïve mice. [score:5]
To construct expression vectors, oligos were synthesized in specific sequences listed as follows: miR-23a overexpression primer 23W (5′-AGCTCGAGAGACCCAGCCTGGT CAAGAT-3′ and 5′-GTACGCGTTCATGATAGGCTTCTCTGTTA-3′), CXCR4 overexpression primer C4W (5′-AGCTCGAGATGGAACCGATCAGTGTGA-3′ and 5′- GTACGCGTGTGTTAGCTGGAGTGAAAAC-3′), and miR-23a knockdown primer LV-23 (5′-PCGCGGGAAATCCCAACCAATGTGATGCTAGGAAATCCCAACCAAT GTGAT-3′ and 5′-P-CGCCTTTAGGGTTGGTTACACTACGATCCTTTAGGGTTGGT TACACTA-3′) and then amplified in PCR. [score:5]
miR-23a, by directly targeting CXCR4, regulates neuropathic pain via TXNIP/NLRP3 inflammasome axis in spinal glial cells. [score:5]
Here, miR-23a was predicted to bind to CXCR4 mRNA; however, it is still unknown whether miR-23a regulated neuropathic pain via directly targeting CXCR4. [score:5]
We found that the pSNL -induced spinal TXNIP expression was decreased by 35.8 and 39.2% with miR-23a overexpression by intrathecal injection of miR-23a mimic and Lenti-miR-23a, respectively, but not affected by scrambled control or lentivirus vector (Fig.   5a, b). [score:5]
Data are presented as mean ± SEM; ** p < 0.01 versus Scr group; n = 5. (PPTX 2670 kb) 3′-UTR 3′-untranslated region ASC Apoptosis -associated speck-like molecule containing CARD domain CCI Chronic constriction injury CNS Central nervous system CXCL12 Chemokine C-X-C motif ligand 12 CXCR4 Chemokine CXC receptor 4 DRG Dorsal root ganglion FISH Fluorescence in situ hybridization IF Immunofluorescence Ih Inhibitor IL-1β Interleukin 1β IP miR-23a MicroRNA-23a-3p NLRP3 NOD-like receptor protein 3 pSNL Partial sciatic nerve ligation PWL Paw withdrawal latency PWT Paw withdrawal threshold Scr Scrambled TXNIP Thioredoxin-interacting protein We thank Jamie Bono (Rutgers, The State University of New Jersey, USA) for proofreading the paper. [score:5]
c, d TXNIP protein expression increased by intrathecal injections of miR-23a Ih (c) or LV-miR-23a (d) in naïve mice was inhibited by intrathecal injection of CXCR4 pool siRNA. [score:5]
Notably, considering the contribution of activation of CXCR4 by CXCL12 to nociceptive pain process [5], and CXCL2 as a regulating target of miRNA-23a [58], we intrathecally injected CXCL2 into the mice having pain-like behavior induced by the knockdown of LV-miR-23a. [score:5]
Further, miR-23a knockdown increased expression of spinal NLRP3, ASC, P-Caspase-1, C-Caspase-1, and IL-1β, which were reduced by CXCR4 knockdown with intrathecal injection of siRNA (Fig.   6f). [score:5]
Identification of miR-23a targets was performed by transfecting CHK-wt-CXCR4 or CHK-mut-CXCR4 plasmids (50 ng) and miR-23a mimics (80 ng) or inhibitor (50 ng) into HEK293T cells using Lipofectamine 2000 (11668-027, Invitrogen) in a 24-well plate. [score:5]
In fact, miR-23a has been demonstrated to be involved in the pathological process of various diseases, such as adipose metabolism [59], diabetes [60], cancer formation [6], Harada Miuji syndrome [8], inflammation [7], cognitive impairment [9], Alzheimer’s disease [61], and stroke [62]. [score:5]
The in vitro and in vivo findings suggest that miR-23a, through directly binding to CXCR4-3′UTR, regulates the expression of spinal CXCR4 following pSNL -induced neuropathic pain. [score:5]
Therefore, the present study aimed to determine the functional and regulatory role of miR-23a in pain processing in the CNS and its interplay with CXCR4 and TXNIP at spinal level, which may provide potential therapeutic targets for peripheral injury -induced neuropathic pain. [score:4]
d LV-miR-23a -induced expression of NLRP3 inflammasome was reversed by knockdown of TXNIP with siRNA in naïve mice. [score:4]
Therefore, we wanted to know whether miR-23a regulated CXCR4 expression at the post-transcriptional level in the neuropathic pain. [score:4]
Notably, upregulation of miR-23a relieves peripheral nerve injury -induced neuropathic pain. [score:4]
Fig. 7 The schematic of miR-23a targeting CXCR4 regulates neuropathic pain via TXNIP/NLRP3 inflammasome in spinal glial cells of mice. [score:4]
Spinal miR-23a regulates CXCR4 expression in pSNL -induced neuropathic pain. [score:4]
Additionally, miR-23a knockdown or CXCR4 overexpression in naïve mice could increase the thioredoxin-interacting protein (TXNIP), which was associated with induction of NOD-like receptor protein 3 (NLRP3) inflammasome. [score:4]
As a result, this study elucidated a novel mechanism of miR-23a in the induction and maintenance of neuropathic pain via regulating CXCR4, which expands our knowledge on the functional role of miR-23a in the aforementioned CNS diseases. [score:4]
g Intrathecal injection of CXCL12 further increased the thermal and mechanical sensitivity induced by miR-23a knockdown, with miR-23a inhibitor, in naïve mice. [score:4]
Furthermore, knockdown of miR-23a induced pain-like behavior, accompanied by an increase in CXCR4 expression. [score:4]
f NLRP3 inflammasome upregulated by injection of LV-miR-23a was reversed by injection of CXCR4 siRNA in naïve mice. [score:4]
In contrast, miR-23a inhibitor increased the luciferase activity by 30% in CHK-wt-CXCR4 but not in CHK-mut-CXCR4 (Fig.   2d). [score:3]
Data are presented as mean ± SEM; n = 5 per group TXNIP siRNAs (681si, 5′-CCAGCCAACUCAAGAGGCAAAGAAAUU-3′, and 5′-U UUCUUUGCCUCUUGAGUUGGCUGGUU-3′; 1271si, 5′-GCCUCAGAGUGCAGA AGAUUUUU-3′, and 5′-AAAUCUUCUGCACUCUGAGGCUU-3′), miR-23a mimics (5′-UAAUGCCCCUAAAAAUCCUUAU-3′ and 5′-AUAAGGAUUUUUAGGGGCAU UA-3′), miR-23a inhibitor (Ih) (5′-AUAAGGAUUUUUAGGGGCAUUA-3′), CXCR4 smart pool siRNAs (94si and 5′-GAACCGAUCAGUGUGAGUA-3′, 192si and 5′-AAACGUC CAUUUCAAUAGG-3′, 420si and 5′-GUGUAAGGCUGUCCAUAUC-3′, 703si and 5′-GUGU UUCAAUUCCAGCAUA-3′) [25] and scrambled (Scr) siRNA (5′-UUCUCCGAACG UGUCAC GUdTdT-3′ and 5′-ACGUGACACGUUCGGAGAAdTdT-3′) were designed and validated in vitro and in vivo. [score:3]
a, b Increased spinal TXNIP protein expression in pSNL mice was reversed by intrathecal injection of miR-23a mimics (a) or Lenti-miR-23a (b). [score:3]
pSNL -induced neuropathic pain significantly reduced mRNA expression of miR-23a. [score:3]
The results showed that antagonizing CXCR4 alleviated miR-23a inhibition -induced thermal hyperalgesia and mechanical allodynia in naïve mice (Fig.   3f), indicating that CXCR4 acts as the downstream effector of miR-23a -mediated modulation of pain behavior. [score:3]
qRT-PCR results showed that no significant alteration of miR-23a expression was found in the sham group. [score:3]
Overexpression of miR-23a by intrathecal injection of miR-23a mimics or lentivirus reduced spinal CXCR4 and prevented pSNL -induced neuropathic pain. [score:3]
Consequently, we found that miR-23a was a potential small RNA in the prevention and inhibition of thermal hyperalgesia and mechanical allodynia induced by injury. [score:3]
e, f Blocking CXCR4 with AMD3100 significantly reversed thermal hyperalgesia and mechanical allodynia induced by miR-23a inhibitor (e) or LV-miR-23a (f) in naïve mice. [score:3]
c Time course of spinal miR-23a expression in pSNL -induced chronic neuropathic pain mice. [score:3]
Here, we provided the evidence that pSNL -induced neuropathic pain altered miR-23a expression in the spinal cord. [score:3]
Overexpression of spinal miR-23a not just reversed the increase of CXCR4 induced by pSNL, but also alleviated the pain hypersensitivity to thermal and mechanical stimuli. [score:3]
c, d Daily intrathecal injections of c miR-23a inhibitor or d LV-miR-23a for 2.5 or 3 consecutive days, respectively, produced thermal hyperalgesia and mechanical allodynia in naïve mice. [score:3]
MicroRNA-23a-3p (miR-23a) is highly conserved across species, and it modulates various disease processes, such as cancer [6], inflammation [7], Harada Miuji syndrome [8], and cognitive impairment [9]. [score:3]
f, g The increased spinal CXCR4 protein expression in pSNL mice was reversed by intrathecal injection of miR-23a mimics (f) or Lenti-miR-23a (g). [score:3]
d In vitro validation of miR-23a targeting CXCR4. [score:3]
miR-23a target construction. [score:3]
As we have shown that miR-23a regulates CXCR4 and that CXCR4 interacts with TXNIP in neuropathic pain, it is possible that miR-23a may regulate TXNIP via CXCR4 in neuropathic pain. [score:3]
Black arrow indicates miR-23 inhibitor or Src injection. [score:3]
miR-23a was chosen as an experimental target. [score:3]
Direct interaction of TXNIP and CXCR4 is regulated by miR-23a in neuropathic pain process. [score:3]
A mutation was generated in the CXCR4-3′-UTR mRNA sequence in the complementary site for the seed region of miR-23a as indicated (CHK-mut-CXCR4). [score:2]
MicroRNA-23a-3p (miR-23a) directly bounds to 3′ UTR of CXCR4 mRNA. [score:2]
However, compared with the sham group, miR-23a expression was significantly decreased from 1 to 7 days after pSNL surgery in pSNL group, but it slightly recovered on day 21 (Fig.   2c). [score:2]
Fig. 3Spinal miR-23a regulates pain behavior via CXCR4. [score:2]
Therefore, we determined whether intrathecal injection of CXCL12 strengthened the pain-like behavior induced by miR-23a knockdown. [score:2]
Interestingly, miR-23a is demonstrated to mediate the post-transcriptional regulation of CXCL12 in human bone marrow stromal cells [58]. [score:2]
The results exhibited that pain sensitivity behavior is further exaggerated by CXCL12, suggesting either miR-23a alone or synergistic with CXCL12 participated in the regulation and generation of pain behavior following peripheral nerve injury. [score:2]
However, to the best of our knowledge, a functional regulatory role of miR-23a in pain-related CNS disorders has not been reported. [score:2]
For miR-23a knockdown construct, pLVTHM vector was digested with ClaI and MluI and then ligated to annealed double-strand oligos LV-23 using T4 ligase. [score:2]
Spinal miR-23a regulates neuropathic pain via CXCR4. [score:2]
Furthermore, we investigated the regulatory role of miR-23a in CXCR4 expression in vivo. [score:2]
We further found that TXNIP/NLRP3 inflammasome axis is a direct downstream effector of miR-23a/CXCR4 pathway in spinal glial cells. [score:2]
Among them, miR-23a predictably regulates CXCR4 by binding to 202–208 region of 3′UTR in CXCR4 mRNA (Fig.   2b). [score:2]
miR-23a/CXCR4 regulates neuropathic pain by modulation of NLRP3 inflammasome via TXNIP. [score:2]
Our results demonstrate the functional regulation of neuropathic pain by miR-23a via CXCR4/TXNIP/NLRP3 inflammasome. [score:2]
Intrathecal injections of miR-23a mimics or Lenti-miR-23a were performed from day 7 after pSNL. [score:1]
Content of inflammasome was examined at 48 h after 3-day injections of LV-miR-23a or at 24 h after 3-day injections of TXNIP siRNA or Scr (starting after the injections LV-miR-23a or vector). [score:1]
Functionally, miR-23a has a predictive binding capacity to the 3′UTR of CXCR4 mRNA and was decreased significantly in the spinal cord of mice with pSNL -induced neuropathic pain. [score:1]
Therefore, we speculated that the decease of miR-23a may affect GlyRα3 expression and p38 pathways, which would be further investigated in the future. [score:1]
[#] p < 0.05, [##] p < 0.01, and [###] p < 0.001 versus LV-miR-23a + Scr group. [score:1]
Collectively, these results suggest that miR-23a/CXCR4 modulates neuropathic pain via the TXNIP/NLRP3 inflammasome axis (Fig.   7). [score:1]
[##] p < 0.01 versus miR-23a Ih or LV-miR-23a group. [score:1]
Epigenetic interventions against miR-23a, CXCR4, or TXNIP may potentially serve as novel therapeutic avenues in treating peripheral nerve injury -induced nociceptive hypersensitivity. [score:1]
Spinal cord was harvested 24 h after intrathecal injection of continuous 2-day miR-23a mimics in naïve mice or pSNL mice with 7-day surgery or 72 h after intrathecal injection of continuous 2-day Lenti-miR-23a in naïve mice or pSNL mice with 7-day surgery. [score:1]
The results showed that intrathecal injection of miR-23a mimics or Lenti-miR-23a, but not control scrambled miRNAs or Lenti-vector, for 2 or 3 consecutive days, significantly reversed pSNL -induced thermal hyperalgesia and mechanical allodynia (Fig.   3a, b). [score:1]
e Daily intrathecal injections of TXNIP siRNA for 3 consecutive days reversed pain-like behavior induced by LV-miR-23a. [score:1]
[#] p < 0.05, [##] p < 0.01 versus LV-miR-23a + Scr group. [score:1]
These data suggest that TXNIP acts as one of the downstream effectors of miR-23a/CXCR4 -mediated modulation of neuropathic pain. [score:1]
Inflammasome complex expressions were measured at 7 days after pSNL surgery or at 48 h after 3-day injections of Lenti-miR-23a or Lenti-vector, beginning on day 7 after pSNL. [score:1]
[#] p < 0.05, [##] p < 0.01, and [###] p < 0.001 versus pSNL+Lenti-miR-23a group. [score:1]
[&] p < 0.05 versus miR-23a Ih + CXCL12. [score:1]
However, motor function was not affected by the manipulation with miR-23a (data not shown). [score:1]
These findings suggest that spinal miR-23a is involved in the process of neuropathic pain. [score:1]
To experimentally validate the in silico prediction, we constructed luciferase reporter vectors containing CXCR4-3′UTR region recognized by miR-23a. [score:1]
Then, we evaluated the temporal expression pattern of miR-23a in the spinal cord. [score:1]
The transfection efficiency of Lenti-miR-23a in the mouse spinal cord was validated by qRT-PCR. [score:1]
CXCR4 was measured at 24 h after 2-day miR-23a inhibitor injections or at 48 h after 3-day LV-miR-23a injections. [score:1]
Co-transfection of miR-23a mimics with the wild-type reporter CHK-wt-CXCR4 decreased luciferase activity by 41% compared with the mutation-type reporter CHK-mut-CXCR4. [score:1]
b The informatics analysis of miR-23a binding the 3′UTR in CXCR4 mRNA. [score:1]
e The validation of transfection efficiency of miR-23 mimics or Lenti-miR-23a in the mouse spinal cord by qRT-PCR. [score:1]
miRNA-23a CXCR4 TXNIP NLRP3 inflammasome Sciatic nerve injury Spinal glia cell Chemokine CXC receptor 4 (CXCR4) belongs to the family of G protein-coupled receptors. [score:1]
Expression of inflammasome was measured at 48 h after 3-day injections of LV-miR-23a or at 6 h after injection of CXCR4 siRNA or Scr (beginning after injections of LV-miR-23a or Vector). [score:1]
a, b Daily intrathecal injections of miR-23a mimics (a) or Lenti-miR-23a (b) for 2 or 3 consecutive days, respectively, reversed pSNL -induced thermal hyperalgesia and mechanical allodynia. [score:1]
Intrathecal injection of CXCR4 pool siRNA was performed at 24 h after miR-23a Ih injections for 2 consecutive days or 48 h after LV-miR-23a injections for 3 consecutive days. [score:1]
Spinal miR-23a was increased respectively by 91 or 95% after intrathecal injection of miR-23a mimics or Lenti-miR-23a for 2 continuous days in naïve mice, and decreased miR-23a was reversed by the intrathecal injection of miR-23a mimics or Lenti-miR-23a for 2 continuous days in pSNL mice with 7-day surgery (Fig.   2e). [score:1]
Furthermore, we found that the pSNL -induced CXCR4 protein was decreased by 20.1% after miR-23a mimic injection (Fig.   2f) and by 22.8% after Lenti-miR-23a injection (Fig.   2g), respectively, but not by scrambled miRNA or lentivirus vector control. [score:1]
c Increased NLRP3 inflammasome were reversed by intrathecal injection of Lenti-miR-23a in pSNL mice. [score:1]
[1 to 20 of 116 sentences]
2
[+] score: 326
Other miRNAs from this paper: mmu-mir-23b, mmu-mir-125b-2, mmu-mir-125b-1
The exogenous overexpression of miR-23a in the PC-3 cells resulted in a marked decrease in PAK6 expression (79%), whereas miR-23a inhibitor oligonucleotides induced a pronounced increase in PAK6 expression (40%). [score:9]
The extent of PAK6 up-regulation inversely correlated with degree of miR-23a down-regulation (R [2] = 0.69, P < 0.05) (Figure 4E), suggesting that the inhibitory effects of miR-23a on PAK6 were clinically relevant in prostate cancer. [score:9]
To understand the mechanism by which miR-23a suppressed the migration and invasion of prostate cancer cells, we used target prediction programs (PicTar, TargetScan and miRanda) to predict the targets of miR-23a. [score:9]
These data suggested that miR-23a inhibited PAK6 expression at the post-transcriptional level by directly targeting the 3′-UTR of PAK6 mRNA. [score:8]
Additional analyses revealed that miR-23a directly targeted the p21-activated kinase 6 (PAK6) gene to suppress the phosphorylation of LIM kinase 1 (LIMK1), resulting in cytoskeletal reorganization, and ultimately, the inhibition of prostate cancer cell invasion and metastasis. [score:8]
Figure 3Overexpression of miR-23a suppressed prostate cancer metastasis in vivo (A) PC-3 cells stably expressing either empty vectors or miR-23a and a luciferase reporter were injected into the prostates of nude mice. [score:7]
The median expression level of all 123 prostate cancer samples was chosen as the cut-off point for separating tumors with low miR-23a expression from those with high expression. [score:7]
In this study, the exogenous expression of miR-23a in the PC-3 and DU145 cells suppressed the dissolution of actin stress fibers and the formation of actin fibers at the cell peripheries; its target gene PAK6 counteracted the cytoskeletal changes. [score:7]
Furthermore, western blotting analysis demonstrated that PAK6 expression in prostate orthotopic tumors was down-regulated significantly in the miR-23a -expression group compared with the control group (Figure 3E). [score:7]
The pre-miR-23a and pre-miR-23a-sponge -inhibitor sequences were synthesized and cloned into pGLV-H1-GFP-Puro (GenePharma, Shanghai, China) to generate the pGLV-H1-GFP-Puro-miR-23a and pGLV-H1-GFP-Puro-miR-23a-inhibit expression vectors, respectively. [score:7]
Previous studies showed that miR-23a is up-regulated in many types of cancer and is an important oncogene that promotes proliferation, migration and invasion and suppresses apoptosis. [score:6]
There was also one study from our research group reported that miR-23a is down-regulated in non-small cell lung cancer and suppresses the migration [29]. [score:6]
MiR-23a suppressed prostate cancer migration and invasion by directly targeting PAK6. [score:5]
Overexpression of miR-23a suppressed invasion and migration of prostate cancer cells in vitro. [score:5]
Figure 2MiR-23a overexpression decreased prostate cancer cell invasion and migration in vitro (A) Real-time PCR analysis of miR-23a expression in PC-3, DU145, C4-2 and C4-2B cells infected with miR-control-lentivirus or with miR-23a-lentivirus. [score:5]
Ectopic overexpression of miR-23a in prostate cancer cells resulted in inhibiting invasion and metastasis abilities both in vitro and in vivo. [score:5]
A miR-23a mimic and miR-23a inhibitor (anti-miR-23a, chemically modified antisense oligonucleotides designed to specifically target mature miR-23a) were synthesized by GenePharma (Shanghai, China). [score:5]
The results indicated that miR-23a may suppress gene expression through the miR-23a binding sequence in the 3′-UTR of PAK6. [score:5]
The c-Myc -mediated suppression of miR-23a/b enhances mitochondrial glutaminase expression and glutamine metabolism in prostate cancer. [score:5]
Representative bioluminescence images of the mice in the control (left) or miR-23a -expression (right) groups on day 56 indicated that miR-23a overexpression decreased the number of metastatic lesions (Figure 3A). [score:5]
Overall, 62/123 prostate cancer samples exhibited low miR-23a expression, whereas 61/123 showed high expression (Table 1). [score:5]
Overexpression of miR-23a suppressed prostate cancer metastasis in vivo. [score:5]
These results indicated that miR-23a expression in prostate cancer cells significantly suppressed metastasis in vivo. [score:5]
MiR-23a inhibited prostate cancer metastasis in vivoTo assess the effects of miR-23a on tumor metastasis in vivo, we generated PC-3 cells that stably expressed luciferase (PC-3-Luc) to enable the live imaging of cancer metastasis using bioluminescent imaging technology. [score:5]
PAK6 was a direct regulated target of miR-23a. [score:5]
PAK6 is a direct target of miR-23a. [score:4]
The overexpression of miR-23a suppressed the migration of the PC-3, DU145, C2-4 and C4-2B cells as evidenced by the transwell migration assays (Figure 2B). [score:4]
To determine whether PAK6 was a direct target of miR-23a, a human PAK6 3′-UTR fragment containing a wild-type or a mutant miR-23a binding sequence was cloned downstream of the firefly luciferase reporter gene (Figure 4C). [score:4]
Down-regulated miR-23a was consistent with the study analyzing microRNA profiling of prostate cancer [22]. [score:4]
MiR-23a, which was one of the other 7 miRNAs, is down-regulated significantly. [score:4]
To examine whether the biological effects of down -regulating miR-23a correlated with PAK6 protein levels in clinical prostate cancer tissues, PAK6 protein levels in 20 paired prostate cancer and adjacent non-tumor tissues were examined by, and miR-23a expression was determined by real-time PCR (Supplementary Figure 1A, 1B; the same samples as in Figure 1C). [score:4]
MiR-23a expression levels in the PC-3, DU145, C2-4 and C4-2B cells infected with miR-control-lentivirus or with miR-23a-lentivirus were confirmed by real-time PCR (Figure 2A). [score:3]
To assess the effects of miR-23a on tumor metastasis in vivo, we generated PC-3 cells that stably expressed luciferase (PC-3-Luc) to enable the live imaging of cancer metastasis using bioluminescent imaging technology. [score:3]
Low miR-23a expression was associated with aggressive and poor prognostic prostate cancer phenotype. [score:3]
The results showed that, all five metastatic prostate cancer cell lines (PC-3, DU145, LNCaP, C2-4 and C4-2B) had lower miR-23a expression than the normal prostate cell line RWPE-1 (Figure 1B). [score:3]
The Kaplan-Meier analysis revealed that low miR-23a expression in prostate cancer was associated with decreased survival time (P < 0.05, Table 2, Figure 1E). [score:3]
293T cells grown in a 48-well plate were cotransfected with 200 ng of pcDNA3.0 or 200 ng of pc3-miR-23a, 10 ng of firefly luciferase reporter containing the wild-type or mutant 3′-UTR of the target gene, and 2 ng of pRL-TK (Promega, Madison, WI). [score:3]
The correlation analysis revealed that low miR-23a expression in prostate cancer was associated with a more aggressive tumor phenotype (P < 0.05, Table 1, Figure 1D). [score:3]
Ectopic expression of miR-23a impaired cytoskeletal events. [score:3]
Potential therapeutic approach by targeting miR-23 is suggested. [score:3]
We also showed that miR-23a suppressed the migration and invasion of prostate cancer in vitro and tumor metastasis in vivo. [score:3]
In this study, we found that the relationship between PAK6 overexpression and miR-23a levels in prostate cancer tissues was negatively correlated. [score:3]
Decreased miR-23a expression was frequently detected in prostate cancer cells and human prostatic cancer tissues. [score:3]
Subsequently, our results showed that miR-23a bound the complementary sites in the 3′-UTR of PAK6 and markedly decreased PAK6 protein expression. [score:3]
PC-3 cells stably expressing either empty vector or miR-23a and a luciferase reporter were generated by retroviral transduction. [score:3]
Representative bioluminescence images from either control mice (left) or miR-23a -expressing mice (right) were obtained on day 56. [score:3]
712) 0.000 Distant metastasis (M1 vs M0) 33/90 7.908 (3.529–17.719) 0.000 Overexpression of miR-23a suppressed invasion and migration of prostate cancer cells in vitroTo study the potential biological function of miR-23a in prostate cancer cells, we performed transwell migration assays and matrigel invasion assays. [score:3]
To determine whether PAK6 was involved in the miR-23a -mediated inhibition of migration and invasion in prostate cancer cells, we transfected PC-3 cells with siRNA-PAK6 (siPAK6). [score:3]
Correlation of miR-23a expression in tissues with clinicopathological variables of patients in 123 cases of prostate cancer. [score:3]
Mechanism by which miR-23a suppresses migration and invasion of prostate cancer cells. [score:3]
Upon examination by laser confocal microscopy, we found that the dissolution of actin stress fibers and the formation of actin fibers at the cell peripheries were suppressed in the miR-23a-PC-3 cells and miR-23a-DU145 cells; similar results were observed in the PC-3 and DU145 cells transfected with siPAK6 (Figure 5A). [score:3]
The expression of miR-23a in a cohort of 123 prostate cancer tissues was examined by real-time PCR. [score:3]
In the present study, we also found the function of miR-23a as a tumor suppressor in prostate cancer. [score:3]
In addition, mean miR-23a expression was significantly lower in the primary prostate cancer samples than that in the matched non-tumor tissues (P < 0.01) (Figure 1C and Supplementary Figure 1C). [score:3]
Furthermore, mean miR-23a expression was significantly lower in the ten metastatic prostate cancer samples than that in the primary prostate cancer samples (P < 0.01) (Figure 1D). [score:3]
The expression vector for miR-23a (pc3-miR-23a) was generated by cloning genomic fragments encompassing the miR-23a precursor and its 5′- and 3′-flanking sequences into pcDNA3.0 (Invitrogen Life Technologies, Carlsbad, CA). [score:3]
Figure 5 (A) Ectopic expression of miR-23a or of si-PAK6 disrupted stress fiber network. [score:3]
These data indicated that PAK6 was involved in the miR-23a -mediated inhibition of migration and invasion in prostate cancer cells. [score:3]
revealed that the phosphorylation of LIMK1 and cofilin was markedly reduced in the miR-23a-PC-3 and miR-23a-DU145 cells, whereas the total expression of LIMK1 and cofilin did not significantly change (Figure 5B). [score:3]
There were fewer metastatic lesions in the miR-23a -expression group than in the control group (Figure 3C, 3D). [score:3]
The transwell migration assays and matrigel invasion assays demonstrated that PAK6 overexpression reversed the miR-23a -mediated inhibition of migration and invasion in PC-3, DU145, C2-4 and C4-2B cells (Figure 4F). [score:3]
The effects of miR-23a on the endogenous expression of PAK6 were further examined by (Figure 4D). [score:3]
PAK6 was identified as a potential target of miR-23a. [score:3]
Here, we demonstrated that miR-23a expression was specifically diminished in prostate cancer cell lines and human prostate cancer tissues. [score:3]
An additional multivariate Cox regression analysis indicated that low miR-23a expression was an independent prognostic factor for poor survival in patients with prostate cancer (P = 0.002, Table 2). [score:3]
Low miR-23a expression was associated with a more aggressive tumor phenotype and was an independent predictor of reduced survival time in patients with prostate cancer. [score:3]
Our findings also suggest treatment targeting miR-23 have potential benefit for patients with prostate cancer. [score:3]
The PC-3-Luc cells engineered to stably express miR-23a or vector controls were then injected into the prostates of immunodeficient mice. [score:3]
Virus particles were harvested 48 h after the pGLV-H1-GFP-Puro-miR-23a, pGLV-H1-GFP-Puro -inhibitor and pGLV4-EF1a-EGFP-luciferase were transfected along with the packaging plasmids, PG-P1-VSVG, PG-P2-REV and PG-P3-RRE, into 293T cells using Lipofectamine 2000 (Invitrogen Life Technologies, Carlsbad, CA). [score:3]
MiR-23a overexpression reduced the activity of a luciferase reporter gene fused to the wild-type PAK6 3′-UTR (43% reduction, P < 0.05). [score:2]
MiR-23a inhibited prostate cancer metastasis in vivo. [score:2]
MiR-23a overexpression decreased prostate cancer cell invasion and migration in vitro. [score:2]
Together, these data suggested that LIMK1-cofilin signaling played an important role in the regulation of prostate cancer cell migration by miR-23a. [score:2]
MiR-23a overexpression did not elicit the degradation of PAK6 mRNA (Figure 4B). [score:2]
The matrigel invasion assays demonstrated that miR-23a overexpression dramatically reduced the invasiveness of the PC-3, DU145, C2-4 and C4-2B cells (Figure 2C). [score:2]
In conclusion, we found that miR-23a-PAK6-LIMK1 regulatory pathway may contribute to prostate cancer metastasis. [score:2]
The expression of MiR-23a in prostate cancer cell lines and tissues and its prognostic values in patients. [score:2]
Cofilin, which is a substrate of LIMK1, plays an important role in promoting actin polymerization and defining the direction of cell motility [25, 26], we investigated whether LIMK1 and cofilin were involved in the inhibition of migration by miR-23a-PAK6. [score:2]
Our findings suggested that miR-23a may be cancer type-specific, and play a role in the regulation of prostate cancer metastasis and invasion. [score:2]
Figure 4 (A) Schematic of predicted miR-23a binding sequence in PAK6 3′-UTR. [score:1]
The PAK6 coding sequence was cloned into pc3-gab to generate ahe complementary site for the seed region of miR-23a was generated using the fusion PCR method. [score:1]
The 3′-UTR of PAK6 mRNA contained a complementary sequence for the seed region of miR-23a (Figure 4A). [score:1]
Then, PC-3 and DU145 cells were infected with a miR-control-lentivirus or a miR-23a-lentivirus. [score:1]
A human PAK6 3′-UTR fragment containing wild-type or mutant miR-23a binding sequence was cloned downstream of luciferase reporter gene. [score:1]
Conversely, when we performed luciferase assays using a plasmid harboring a mutant version of the PAK6 mRNA 3′-UTR (the miR-23a binding sites were inactivated by site-directed mutagenesis), the luciferase activity of the mutant reporter was unaffected by the simultaneous infection with miR-23a (Figure 4C). [score:1]
PAK6 rescued effects of miR-23a on migration and invasion in prostate cancer cells. [score:1]
PAK6 3′-UTR was mutated in complementary site for seed region of miR-23a as indicated. [score:1]
Control and pSuper-miR-23a -transfected PC-3 cells and DU145 cells were seeded on fibronectin-pretreated chamber slides. [score:1]
The final concentration of miR-23a mimic in the transfection system was 50 nM, and the final concentration of anti-miR-23a in the transfection system was 200 nM. [score:1]
MiR-23a was also reported to be able to regulate the metabolism of tumor cells [30]. [score:1]
MiR-23a-PAK6-LIMK1 was showed to be a novel regulatory pathway that contributed to prostate cancer metastasis. [score:1]
5 vs 68.5) 57/66 0.976 (0.635–1.501) 0.913 PSA level (> 10 vs ≤ 10) 50/64 1.782 (1.159–2.741) 0.009 Gleason (> 7 vs ≤ 7) 32/91 4.941 (3.096–7.885) 0.000 Distant metastasis (M1 vs M0) 12/111 15.724 (7.829–31.580) 0.000 Pathologic stage (> T2 vs T1) 33/90 2.242 (1.428–3.520) 0.000 multivariate analysis miR-23a (low vs high) 62/61 1.776 (1.116–2.829) 0.015 Pathologic stage (> T2 vs T1) 33/90 1.724 (1.009–2.946) 0.046 Gleason (> 7 vs ≤ 7) 32/91 4.026 (2.415–6. [score:1]
[1 to 20 of 92 sentences]
3
[+] score: 269
The Runx2 overexpression -mediated downregulation of Mgat3 expression and bisecting structures in N-glycans was weakened in the presence of the miR-23a inhibitor, while transfection of the miR-23a mimic diminished the Runx2 siRNA -mediated increase in the levels of Mgat3 expression and bisecting structures. [score:12]
Based on our previous finding that let-7c inhibits the metastatic ability of mouse HCC cells via targeting Mgat4a [11], we focused in this study on Mgat3, which was negatively correlated with miR-23a expression in mouse HCC cells (Fig.   1b,c) and has been regarded as a metastases suppressor, as the predicted target of miR-23a. [score:11]
To confirm that Mgat3 is a target of miR-23a, we showed the direct binding of miR-23a to the Mgat3 3′-UTR in luciferase reporter assays (Fig.   2a,b) and verified miR-23a could suppress Mgat3 expression both in transcriptional and translational level by transfection experiments (Fig.   2c,d). [score:9]
miR-23a overexpression suppressed the levels of bisecting structures in N-glycans, and conversely, miR-23a downregulation increased the levels of these bisecting structures (Fig.   2e,f). [score:8]
In contrast, miR-23a downregulation with the miR-23a inhibitor significantly increased Mgat3 expression (Fig.   2c,d). [score:8]
In contrast, Berchem G et al. found that in hypoxic tumor-derived microvesicles, miR-23a operates as an immunosuppressive factor, because it directly targets CD107a expression in NK cells [22]. [score:8]
Gao et al. revealed that c-Myc transcriptionally represses miR-23a and miR-23b, which function as tumor suppressors, resulting in greater expression of their target protein, mitochondrial glutaminase, in human P-493 B lymphoma cells and PC3 prostate cancer cells [21]. [score:7]
Mgat3 was identified as a potential candidate; it is an important suppressor of metastasis in several types of tumors, and its mRNA and protein expression levels were negatively correlated with miR-23a expression in Hca-P and Hepa1–6 cells (Fig.   1c). [score:7]
As shown in Fig.   5a, overexpression of Runx2 increased miR-23a expression, while suppression of Runx2 decreased miR-23a levels. [score:7]
In terms of the regulation of miR-23a expression, we showed that Runx2 enhances miR-23a expression via transcriptional activation of the miR-23a promoter in mouse HCC cells. [score:6]
Taken together, these results show that Runx2 might suppress Mgat3 expression and bisecting structures in N-glycans by transcriptionally activating miR-23a. [score:5]
To ascertain the potential mechanism by which miR-23a affects tumor metastasis, we searched for potential target genes of miR-23a using two publicly available databases, TargetScan [19] and miRanda [30]. [score:5]
Runx2 mRNA and protein expression levels were positively correlated with miR-23a expression levels in Hca-P and Hepa1–6 cells (Figs  1b and 4a). [score:5]
Furthermore, transfection experiments were carried out to verify that Runx2 suppressed the Mgat3 expression as well as the bisecting structures in N-glycans by promoting the transcriptional activity of miR-23a (Fig.   5). [score:5]
Our miRNA microarray analyses showed that miR-23a expression levels were significantly higher in Hca-P cells (with lymphatic metastatic potential) than in Hepa1–6 cells (with no lymphatic metastatic potential) [27], while the relative expressions of miR-23a were higher than several tumor malignancy related miRNAs 9, 10, 16, 20, 21, 28, 29 in the two mouse HCC cell lines (Fig.   1a). [score:5]
Figure 5Runx2 regulates Mgat3 expression via miR-23a. [score:4]
miR-23a has been implicated in several physiological and pathological processes, including osteoblast differentiation, cardiac hypertrophy, and muscular atrophy, and it has been reported as both an oncogene and tumor suppressor in tumorigenesis and development [20]. [score:4]
Mgat3 is a direct target of miR-23a. [score:4]
Furthermore, we evaluated Mgat3 expression (Fig.   5a,b) and N-glycan structures (Fig.   5c,d) on the cell surface after Runx2 or miR-23a knockdown or overexpression. [score:4]
Moreover, miR-23a overexpression significantly decreased Mgat3 expression at both the mRNA and protein levels compared with the controls in both mouse HCC cell lines. [score:4]
As shown in Fig.   4c, Runx2 significantly increased relative firefly luciferase activity compared with the control, whereas the mutant promoter reporter had no such effect, indicating that Runx2 upregulates miR-23a transcription by directly binding to the miR-23a promoter. [score:4]
Overall, these results strongly support the direct suppression of Mgat3 by miR-23a, which is likely to contribute to promoting metastasis. [score:4]
miR-23a is upregulated in metastatic mouse HCC cell lines. [score:4]
The controversial role of miR-23a in different kinds of cancer might be a result of differential regulation of miR-23a expression in a tissue- and time -dependent manner. [score:4]
Hernandez-Torres F et al. found that Srf is critical for miR-23a~27a~24-2 cluster expression, whereas other muscle-enriched transcription factors provide regulatory cues at both the transcriptional and post-transcriptional levels in cardiac and skeletal muscles [25]. [score:4]
miR-23a has been implicated in several physiological and pathological processes, including osteoblast differentiation, cardiac hypertrophy, and muscular atrophy, and it has been reported as both an oncogene and tumor suppressor gene in tumorigenesis and development [23]. [score:4]
The direct upregulation of the miR-23a~27a~24-2 cluster by Runx2 in mouse HCC cells was verified by luciferase reporter assays and ChIP (Fig.   4b–d). [score:4]
Figure 2Mgat3 is a direct target of miR-23a. [score:4]
In summary, our findings identify Runx2 as a transcriptional activator of miR-23a and demonstrate that as an oncogene, miR-23a may promote lymphatic metastasis by targeting Mgat3, which regulates the branching pattern of N-glycans on the mouse hepatoma cell surface (Fig.   6). [score:4]
Moreover, Runx2 rescue 24 h after Runx2 siRNA transfection restored miR-23a expression, suggesting that Runx2 positively regulates miR-23a as a transcriptional activator (Fig.   5b). [score:4]
The mean weight of the inguinal lymph nodes (location of potential metastasis) was significantly increased in the miR-23a mimic -transfected group but was lighter in the miR-23a inhibitor -transfected group than in the control group (Fig.   3b). [score:3]
In mouse HCC cells, high expression levels of the transcription factor Runx2 activate the transcription of the miR-23a∼27a∼24-2 cluster by binding to its promoter (around −277 bp to −157 bp). [score:3]
Targeting the interaction between miR-23a and Mgat3 would be a potential therapeutic approach to blocking cancer cell metastasis. [score:3]
The lymph node metastasis rate was significantly lower in the Hca-P/miR-23a inhibitor group than in the other groups (chi-square test; *p = 0.0455; p < 0.05), as shown in the histogram. [score:3]
In contrast, transfection with the miR-23a inhibitor had the opposite effects (see Supplementary Fig.   S3). [score:3]
This work provides insight into the molecular mechanisms by which miR-23a promotes metastasis and reveals an inverse correlation between miR-23a expression and bisecting N-glycan structure levels. [score:3]
To identify the potential binding site, we inserted a wild-type or mutant 3′UTR sequence (571 bp, at 2180~2751 bp) immediately downstream of the luciferase reporter gene (Fig.   2a) and co-expressed the resulting plasmids with either miR-23a mimic or scrambled miRNA in Hepa1–6 cells. [score:3]
Considering the oncogenic role of miR-23a, the promotion of miR-23a expression by Runx2 plays a carcinogenic role in mouse HCC cells, as it does in several cancer types, including ovarian, breast, liver and prostate cancer 37– 40. [score:3]
Figure 1Constitutive expression of miR-23a and Mgat3 in mouse HCC cell lines. [score:3]
Hassan M Q et al. showed that the miR-23a~27a~24-2 cluster is directly and negatively regulated by Runx2 in osteoblast differentiation [26]. [score:3]
Hca-P cells (5 × 10 [6]) that had been transiently transfected with the miR-23a mimic, miR-23a inhibitor or scrambled miRNA were inoculated subcutaneously into the left footpad of each mouse. [score:3]
After predicting transcription factors that may bind to the miR-23a promoter region by online bioinformatics analysis 31, 32, we focused on Runx2, which showed positive correlation with metastasis 35, 36 in HCC and found a positive correlation between Runx2 expression and miR-23a~27a~24-2 cluster levels in these two mouse HCC cell lines (Figs  1b and 4a). [score:3]
miR-23a is positively and direct regulated by Runx2. [score:3]
Further studies demonstrated that miR-23a overexpression decreased bisecting N-glycan structures on the cell surface (Fig.   2e,f) and promoted cell migration and invasion in vitro and lymphatic metastasis in vivo (Fig.   3). [score:3]
Then, increased miR-23a levels restrain the expression of the glycosyltransferase Mgat3, which catalyzes the branch formation of bisecting β1,4-GlcNAc. [score:3]
Coincidentally, Frampton et al. identified miR-23a promotes tumor progression via acting as cooperative repressors of a network of tumor suppressor genes in pancreatic ductal adenocarcinoma (PDAC) cells [23]. [score:3]
Both cell lines were transfected with 100 nM miR-23a mimic, miR-23a inhibitor, scrambled miRNA or Runx2 siRNA using riboFECT™ CP transfection reagent (Ribo-bio, China) according to the manufacturer’s instructions. [score:3]
We performed a miRNA microarray analysis to analyze the miRNA profiles in these two cell lines [12], and found that miR-23a levels were significantly higher in Hca-P cells than in Hepa1–6 cells, which suggested the correlation between miR-23a expression and lymphatic metastasis in mouse HCC cells. [score:3]
In the present study, we determined that affecting the branch formation of N-glycan chains by targeting Mgat3 might be one of the mechanisms by which miR-23a increases the metastatic ability of mouse HCC. [score:3]
miR-23a mimic, miR-23a inhibitor (antisense oligonucleotide) and scrambled miRNA oligonucleotide pairs were purchased from Ribo-bio (Guangzhou, China). [score:3]
In continuing to explore the regulatory mechanism of miR-23a biosynthesis, we searched for potential transcription factors that may bind the −0.801-kb fragment of the mouse miR-23a promoter by using two publicly available databases, TRANSFAC [31] and TESS [32]. [score:2]
As shown in Fig.   2b, miR-23a significantly suppressed relative Renilla luciferase activity compared with scrambled miRNA, whereas luciferase activity did not decrease in the presence of the mutant 3′UTR reporter, indicating that functionality depends on an intact seed sequence. [score:2]
Bioinformatics analysis predicted that miR-23a may regulate several glycosyltransferase-encoding genes, such as B3galt2, B3gnt1, Gxylt1, Gcnt4, B3gat2 and Mgat3 [19]. [score:2]
miR-23a is the first member of the miR-23a~27a~24-2 cluster, which is well conserved among various species [20], but the transcriptional regulation of this intergenic miRNA cluster is elusive. [score:2]
A mutation was generated in the Mgat3 3′UTR sequence at the complementary site for the seed region of miR-23a (red). [score:2]
Bioinformatics analysis revealed that miR-23a may regulate several glycosyltransferase-encoding genes, such as B3galt2, B3gnt1, Gxylt1, Gcnt4, B3gat2 and Mgat3 19, 30. [score:2]
The Hca-P/miR-23a mimic group showed a significant increase in mean lymph node weight compared with the control group, while the Hca-P/miR-23a inhibitor group showed a decrease. [score:2]
The transcriptional regulation of the intergenic miR-23a~27a~24-2 cluster is elusive, although its promoter region (from −603 to +36 bp) has been uncovered, it lacks the common promoter elements, such as TATA box or the TFIIB recognition element [24], only Srf and Runx2 were found to be its transcriptional factors respectively in cardiac muscles and osteoblast 25, 26. [score:2]
Observation of lymph node HE-stained sections revealed aberrant swollen oval-like morphology, follicular diffuse fusion or diffuse invasion of lymphoma cells in the three groups, while the lymph node metastasis rate was significantly lower in the Hca-P/miR-23a inhibitor group than in the other groups (3/6 compared to 6/6). [score:2]
A mutation was generated in the miR-23a promoter at the complementary site for the E-BOX of Runx2 (red). [score:2]
In this study, we focused on the tissue-specific transcriptional regulation of miR-23a, in particular with regard to HCC. [score:2]
miR-23a is the first member of the miR-23a~27a~24-2 cluster, which is well conserved among various species [20]. [score:1]
To further determine the role of Mgat3 in the miR-23a -mediated promotion of metastasis, we analyzed N-linked glycosylation on the cell membrane of miR-23a -transfected mouse HCC cells using flow cytometry (FCM) analysis by labeling specific N-glycans with fluorescein isothiocyanate lectins (FITC-PHA-E and FITC-PHA-L). [score:1]
Figure 6 Mo del for the mechanism by which miR-23a promotes tumor metastasis by changing N-glycan branching on the cell surface. [score:1]
Then, the effect of miR-23a on the lymph node metastasis of Hca-P cells in 615-mice was examined. [score:1]
“TGTGGT”, located at −203 to −198 bp in the miR-23a promoter, was predicted as the binding site for Runx2 (Fig.   4b). [score:1]
The in vivo results suggest that increased miR-23a levels can promote lymph node metastasis, while decreased miR-23a levels protect the lymph node invasion. [score:1]
The relative expression of miR-23a and several miRNAs, which are related to tumor malignancy 9, 10, 16, 20, 21, 28, 29, measured by microarray is displayed as a histogram (right). [score:1]
We performed a miRNA microarray analysis to analyze the miRNA profiles in these two cell lines [12] and found that miR-23a levels were significantly higher in Hca-P cells than in Hepa1–6 cells, which were identified by qRT-PCR (Fig.   1b). [score:1]
Next, we explored the effect of miR-23a on cell migration and invasion in vitro using transwell chambers with or without Matrigel. [score:1]
miR-23a modulates mouse HCC cell migration and invasion in vitro and in vivoNext, we explored the effect of miR-23a on cell migration and invasion in vitro using transwell chambers with or without Matrigel. [score:1]
To test the interaction between the 3′-UTR of Mgat3 and miR-23a in Hepa1–6 cells, 100 nM miR-23a mimic or scrambled miRNA was co -transfected with 100 ng of wild-type 3′UTR or mut 3′UTR. [score:1]
The associated DNA fragments were detected by RT-PCR and qPCR (Fig.   4d), and the results showed that Runx2 was able to bind to the −277 bp to −157 bp region upstream of the miR-23a gene. [score:1]
Given the stimulatory effect of miR-23a on cell proliferation, cells were pre -treated with 5 μM mitomycin-C for 1 h before being seeded. [score:1]
Together, these results indicate that miR-23a significantly enhances mouse HCC cell migration and invasion in vitro and in vivo. [score:1]
The specificity of miR-23a-Mgat3 3′UTR binding was also verified by the results of the Mgat4a and Mgat5 3′UTR control groups (see Supplementary Fig.   S1). [score:1]
The results were consistent with those of miRNA profiling (Fig.   1b), indicating the participation of miR-23a in tumor metastasis. [score:1]
miR-23a modulates mouse HCC cell migration and invasion in vitro and in vivo. [score:1]
Lee et al. showed that like protein-coding genes, the transcription of the miR-23a~27a~24-2 cluster can be Pol II dependent and the promoter region covering −603~+36 bp lacks the common promoter elements, such as a TATA box, the initiator element, or the TFIIB recognition element [24]. [score:1]
All these results indicate that miR-23a may promote metastatic activity by, at least in part, repressing Mgat3 activity in the N-glycan pathway in mouse HCC cells. [score:1]
[1 to 20 of 80 sentences]
4
[+] score: 166
miR-23a/b directly targets Tmem64miRNAs have been shown to regulate the expression of mRNAs by binding to coding sequences or the 3’-untranslated regions (3′-UTRs) of target genes. [score:11]
The decline in miR-23a/b expression in BMSCs with age results in an attenuation of the suppression of Tmem64 and consequently the increased expression of Tmem64 protein, which inhibits the Wnt/β-catenin signaling pathway. [score:9]
Moreover, a microRNA can regulate the expression of multiple target genes; therefore, the miR-23 target genes that are relevant to osteoblast maturation and BMSC differentiation might be different. [score:8]
These results together show that Tmem64 shows increased expression with age and is the major target of miR-23a/b during BMSC differentiation and that miR-23a/b affects Tmem64 expression at the post-transcriptional level. [score:7]
These findings suggest that the upregulation of miR-23a/b in BMSCs could be a potential therapeutic target for osteoporosis. [score:6]
To clarify whether miR-23a/b could directly target the Tmem64 gene, a luciferase reporter construct including the putative binding site of the Tmem64 3′-UTR (WT-pGL3- Tmem64) was generated, and three mutant nucleotides were introduced into the predicted target sequences (MUT-pGL3- Tmem64) and used as a control. [score:6]
2011) to predict the possible target genes of miR-23a/b, considering the predicted intersections of miRanda, PicTar, and TargetScan and using medium stringency. [score:5]
Alizarin Red staining indicated that the overexpression of miR-23a/b facilitated the osteogenic differentiation of BMSCs, whereas the silencing of miR-23a/b inhibited osteogenic differentiation (Figure 3b and c). [score:5]
The overexpression of miR-23a/b promoted the osteogenic differentiation of BMSCs, whereas the inhibition of miR-23a/b intensified adipogenic differentiation from BMSCs in vitro. [score:5]
Furthermore, we determined that miR-23a/b regulated BMSCs differentiation by directly targeting Teme64. [score:5]
The overexpression of miR-23a/b decreased endogenous levels of Tmem64 protein, whereas the inhibition of miR-23a/b elevated Tmem64 protein levels (Figure 4c); however, Tmem64 mRNA levels remained stable (Figure 4d). [score:5]
However, Hassan and colleagues have reported that miR-23a had an inhibitory role in the maturation of primary rat osteoblasts and mouse MC3T3-E1 cells through the targeting of SATB2. [score:5]
In this study, we demonstrated that Tmem64 was directly targeted by miR-23a/b and was responsible for regulating BMSC differentiation. [score:5]
[23] Several studies have shown that the activation of miR-23a by NFATc3 regulates cardiac hypertrophy [24] and that miR-23b inhibits autoimmune inflammation. [score:4]
In the present study, we observed that miR-23a/b is prominently downregulated in BMSCs of aged mice and humans. [score:4]
miR-23a/b is markedly downregulated in BMSCs during the aging process. [score:4]
In this study, we identified two novel miRNAs, miR-23a, and miR-23b, that are downregulated in the BMSCs of aged vs young mice and humans. [score:4]
miR-23a/b directly targets Tmem64. [score:4]
In addition, we confirmed that the level of miR-23a/b expression in human BMSCs also showed significant age-related differences. [score:3]
In the present study, we demonstrated that Tmem64 was the major target of miR-23a/b during mouse BMSC differentiation. [score:3]
Previously, it had been reported that miR-23a/b reinforces the expression of glutaminase in mitochondria and participates in glutamine metabolism. [score:3]
[5] We identified miR-23a/b to be the most significantly downregulated miRNAs in aged vs young mice, and in this study, we chose to study miR-23a/b further and investigated its function in the regulation of BMSC differentiation. [score:3]
[9] Our study revealed that miR-23a/b mediates BMSC differentiation by post-transcriptionally repressing Tmem64 expression. [score:3]
A QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) was used to insert mutations into the miR-23a/b seed region to obtain MUT-pGL3- Tmem64. [score:3]
We next determined the role of miR-23a/b during the osteogenic differentiation of BMSCs by overexpressing or silencing miR-23a/b in BMSCs. [score:3]
31) are potential target genes of miR-23a or miR-23b. [score:3]
miR-23a/b inhibits the adipogenic differentiation of BMSCs. [score:3]
Our results showed that miR-23a/b expression gradually increased in BMSCs from 6- to 8-week-old mice during the process of osteoblastic differentiation (Figure 3a). [score:3]
The overexpression of miR-23a/b attenuated lipid droplet formation in adipogenesis -induced BMSCs (Figure 2c and d). [score:3]
We demonstrate that miR-23a/b strikingly enhanced osteoblast and attenuated adipocyte differentiation from BMSCs by targeting Tmem64. [score:3]
miR-23a/b expression was revealed by to gradually decrease during adipogenic differentiation in the BMSCs of 6- to 8-week-old mice (Figure 2a). [score:3]
We transfected WT-pGL3- Tmem64 or MUT-pGL3- Tmem64 along with agomiR-23a/b or agomiR-NC into BMSCs and assessed the effects of miR-23a/b on luciferase translation by luciferase enzyme activity. [score:3]
[25] However, there had been no studies of the action of miR-23a/b on the regulation of BMSC differentiation. [score:2]
To further investigate the age-related switch in differentiation potential of BMSCs, we observed and identified two important downregulated miRNAs, miR-23a and miR-23b, in the BMSCs of aged mice. [score:2]
miR-23a and miR-23b belong to the same family and have strong similarities in their nucleotide sequences, and importantly, they function as synergistic regulators of BMSC functions. [score:2]
Taken together, these observations suggest that miR-23a/b negatively regulates the adipogenic differentiation of BMSCs. [score:2]
Consistently, the expression of miR-23a/b was notably decreased in elderly samples compared with that in young samples (Figure 1b and c). [score:2]
Sequence analysis showed one miR-23a/b binding site in the 3′-UTR of the Tmem64 gene (position 1069-1076; Figure 4a). [score:1]
This result suggests that miR-23a/b is involved in age-related effects on BMSCs in mouse and human. [score:1]
To overexpress or silence miR-23a/b in BMSCs for functional investigation, we transfected BMSCs with agomiR-23a/b, antagomiR-23a/b or their negative control and subsequently induced adipogenic differentiation (Figure 2b). [score:1]
miR-23a/b promotes the osteogenic differentiation of BMSCs. [score:1]
Consequently, our study suggests that miR-23a/b acts as an age-related ‘switch’ to divert BMSCs from being adipogenic to osteogenic. [score:1]
A segment of the mouse Tmem64 3′-untranslated region (UTR) containing the predicted miR-23a/b binding site was amplified by PCR using the forward primer 5′- CTAGAGGAATTCTGAAATGTGAAATTGTCTCAAGGCCGG - 3′ and the reverse primer 5′- CCTTGAGACAATTTCACATTTCAGAATTCCT-3′. [score:1]
Conversely, silencing miR-23a/b promoted lipid droplet formation (Figure 2c and d) and increased the levels of Pparg and Fabp4 mRNA during the adipogenic differentiation of BMSCs (Figure 2e and f). [score:1]
Our study confirmed that miR-23a/b has promoting effects on the osteogenic differentiation of mouse BMSCs in vitro. [score:1]
This finding confirmed that miR-23a/b can specifically bind to the predicted 3′-UTR of Tmem64. [score:1]
These results suggest that miR-23a/b has a critical role in BMSC differentiation. [score:1]
Altogether, all of these data indicate that miR-23a/b enhances the osteogenic differentiation of BMSCs. [score:1]
Taken together, these findings indicate that miR-23a/b has a crucial effect on the aging process of BMSCs in both mouse and human. [score:1]
[1 to 20 of 49 sentences]
5
[+] score: 144
Other miRNAs from this paper: rno-mir-23a
The results in Figure 5B,D showed that p-ERK1/2 level was significantly down-regulated by miR-23a mimic and the expression was up-regulated by miR-23a inhibitor. [score:11]
miR-23a overexpression down-regulated the phosphorylated ERK1/2 level and miR-23a inhibition up-regulated p-ERK1/2 level. [score:11]
The expression of miR-23a in C3HIOT1/2 cells was down-regulated or overexpressed by transiently transfected with mimic or inhibitor using the Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. [score:10]
The quantitative real-time PCR result showed that miR-23a expression was significantly down-regulated by MSCs injection, and CXCL13 treatment further promote the decrease of miR-23a expression in specimen. [score:8]
The Effect of miR-23a on ERK1/2 Expression in VitroTo further clarify the relationship between miR-23a and ERK1/2 in C3HIO1/2 cells, the expression of miR-23a was regulated by miR-23a mimic or miR-23a inhibitor. [score:8]
As shown in Figure 5A,C, the expression of miR-23a was effectively overexpressed or inhibited. [score:7]
Overexpression and Down-Regulation of miR-23a. [score:6]
To further clarify the relationship between miR-23a and ERK1/2 in C3HIO1/2 cells, the expression of miR-23a was regulated by miR-23a mimic or miR-23a inhibitor. [score:6]
As shown in Figure 4A, the CXCL13 significantly reduced the expression of miR-23a in cells, and si-CXCR5 abolished the CXCL13 induced down-regulation of miR-23a. [score:6]
The Effects of CXCL13 on miR-23a and MAPK Molecules Expression in VivoTo identify the mechanisms underlying the effects of MSCs and CXCL13 on the tendon bone healing, the expression of miR-23a was detected by real time PCR. [score:5]
It was reported that the reduced expression of miR-23a markedly increased TNF-α induced bone marrow MSCs apoptosis [9], but the overexpression of miR-23a is observed to promote the survival of MSCs exposed to hypoxia and serum deprivation [10]. [score:5]
Figure 5The effect of miR-23a on Extracellular signal-Regulated Kinase (ERK)1/2 expression in vitro. [score:4]
In addition, we also demonstrated that miR-23a regulated the expression of ERK1/2. [score:4]
The relative miR-23a expression was quantified by real-time PCR (A, C); The p-ERK1/2 and ERK1/2 expression were detected by western blotting (B, D); Data were shown as mean ± SD; t-test of independent sample was used to analyze the difference between two groups; * considered as significant difference. [score:4]
As shown in Figure 3A, the relative miR-23a level was significantly down-regulated by MSCs treatment. [score:4]
The Effect of miR-23a on ERK1/2 Expression in Vitro. [score:3]
These finds imply that inhibition of miR-23a is involved in the effects of CXCL13 on tendon-bone healing treated by MSCs. [score:3]
To clarify the molecule mechanisms of CXCL13 involved in the promotion of tendon-bone healing, we investigated the effects of CXCL13 on the expression of miR-23a, which is found to suppress the bone regeneration [11]. [score:3]
Figure 4The effects of CXCL13 on miR-23a and MAPK molecules expression in vitro. [score:3]
Figure 3The effects of CXCL13 on miR-23a and mitogen-activated protein kinase (MAPK) molecules expression in vivo. [score:3]
The miR-23a inhibitor, miR-23a mimic and negative control were produced by RiboBio Co. [score:3]
The Effects of CXCL13 on miR-23a and MAPK Molecules Expression in Vivo. [score:3]
The Effects of CXCL13 on miR-23a and MAPK Molecules Expression in Vitro In vitro experiments were explored to examine the effects of CXCL13 on C3HIOT1/2 cells. [score:3]
Interference of CXCL13 receptor canceled the effect of CXCL13 on miR-23a expression. [score:3]
The Effects of CXCL13 on miR-23a and MAPK Molecules Expression in Vitro. [score:3]
To identify the mechanisms underlying the effects of MSCs and CXCL13 on the tendon bone healing, the expression of miR-23a was detected by real time PCR. [score:3]
In present study, we demonstrated that chemotactic factor CXCL13 promoted the effect of MSCs on tendon-bone healing in rat experiment, and regulation of miR-23a and MAPK signal was involved in the process of tendon-bone healing. [score:2]
These results suggest that CXCL13 plays a role in tendon-bone healing by ERK1/2 regulation via miR-23a. [score:2]
Compared with tendon in Group 2, the ones treated with CXCL13 and MSCs had a lower level of miR-23a expression. [score:2]
In the present study, we hypothesized that CXCL13/CXCR5 may play a role in the effects of MSCs on tendon-bone healing via miR-23a regulation. [score:2]
In vitro experiments suggested that the activation of ERK1/2 via miR-23a was involved in the process of MSCs treated bone regeneration. [score:1]
In addition, in vitro experiment also observed that CXCL13 reduced the level of miR-23a in C3HIO1/2 cells. [score:1]
In addition, it was demonstrated that miR-23a significantly impede osteoblast differentiation, and its effects can be reversed by the corresponding anti-miRNAs [11]. [score:1]
However, little is known about how miR-23a plays a role in bone regeneration. [score:1]
[1 to 20 of 34 sentences]
6
[+] score: 132
Therefore, the observation that expression of these 2 miRNAs behaves differently in response to the same pathological stimuli and that expression of miRNA-23a did not seem to vary between mice, in contrast to miRNA-206, prompted us to suggest that regulation of miRNA-23a expression might be part of a more general process of regulation than the expression of miRNA-206. [score:11]
We found an opposite expression pattern between the loss of miRNA-23a and the upregulation of APAF-1 in atrophied mouse tissue that correlated well with detection of the active form of caspase 9. In contrast, in the non-denervated tissues the expression of APAF-1 and cleaved form of Caspase 9 proteins were almost undetectable. [score:8]
To gain insight into the underlying biological consequence of miRNA-23a deregulation in response to muscular atrophy at late time points of atrophy development, we looked at the expression of APAF-1, as well as the main downstream target of the miRNA-23a/APAF-1 axis of regulation, Caspase 9. At autopsy, we collected the atrophied tibialis anterior muscle tissues of the RILES/23aT and RILES groups of mice and performed a western-blot analysis with specific APAF-1 and Caspase-9 antibodies (Fig 8A). [score:8]
Therefore, we propose that in addition to the role of miRNA-23a in the early stage of atrophy, the downregulation of miRNA-23a in the late development phase of this disease might also play a significant role by modulating the miRNA-23a/APAF-1/Caspase 9 axis of regulation. [score:8]
We established, in real time, the kinetic of miRNA-23a expression during development of this disease and examined the potential implication of the miRNA 23a/APAF-1/Caspase 9 axis of regulation in the apoptosis of skeletal muscle undergoing muscular atrophy. [score:7]
These results suggest that the down-regulation of miRNA-23a in the late phase of muscular atrophy might be a detrimental event that could contribute to muscular atrophy development by promoting apoptosis through activation of Caspase 9. Notably, our assumptions are in agreement with a previous study [28] that demonstrated that ectopic expression of miRNA-23a reinforces the protection of skeletal muscle tissues from atrophy both in vitro and in vivo and that miRNA-23a transgenic mice show better resistance to skeletal atrophy induced by administration of dexamethasone. [score:7]
Second, because in other cellular contexts, miRNA-23a is reported to be an anti-apoptotic miRNA, overexpressed in several stress conditions that mediate its protecting function through the downregulation of APAF-1, a major constituent of the apoptosome machinery in cells [30– 33]. [score:6]
In contrast, the expression of miRNA-23a was significantly down-regulated (P = 0.016) in the atrophied skeletal muscle tissues. [score:6]
Mechanistically, miRNA-23a acts as a negative regulator of MAFbx/atrogen-1 and MuRF1 expression, two well-known ubiquitin ligases of the proteasome pathway responsible for the rapid proteolysis of skeletal muscle protein in the early stage of atrophy development [28]. [score:5]
The down-regulation of miRNA-23a in the tibialis anterior muscles of the mice in response to denervation was intriguing. [score:4]
Non-invasive bioluminescence monitoring of miRNA-23a expression during development of skeletal muscle atrophy. [score:4]
Real time monitoring of miRNA-23a expression during muscular atrophy development. [score:4]
To make apparent the kinetic of miRNA-23a expression, the quantitative bioluminescence values collected in each mouse from the pRILES and pRILES/23aT groups of animals were plotted as a function of time (right panels, Fig 7B and 7C). [score:3]
We also established the dynamic expression pattern of miRNA-23a in response to muscular atrophy induced by sciatic nerve transection of one leg of the mice. [score:3]
A) Schematic representation of the procedure used to establish the kinetic of miRNA-23a expression in response to muscular atrophy. [score:3]
Nevertheless, further investigations are required to fully validate the potential value of miRNA-23a as a therapeutic target to treat this chronic disease. [score:3]
At late time points, the expression of miRNA-23a was almost undetectable. [score:3]
Based on these data, we focused our experiment on miRNA-23a, -486 and -206 and managed to visualize their expression by SPECT/CT imaging. [score:3]
We established the kinetic of miRNA-23a expression in response to muscular atrophy. [score:3]
The kinetics of miRNA-23a were almost similar for all mice, with a common shape, comparable to an inverted sigmoid curve, characterized by elevated expressions at early time points and a slow and progressive decrease of expression over time. [score:3]
A possible functional link of correlation between the expression of miRNA-23a and apoptosis of the denervated skeletal muscle tissues has not yet been reported. [score:3]
0177492.g007 Fig 7 A) Schematic representation of the procedure used to establish the kinetic of miRNA-23a expression in response to muscular atrophy. [score:3]
The statistical analysis of the bioluminescence data indicated that the relative miRNA-23a expression values detected in the RILES/23aT group of mice (0.83 ± 0.18 x 10 [7]) was almost 3 fold superior to the basal value detected in the RILES control group of mice (0.28 ± 0.05 x 10 [7]). [score:3]
This again correlated well with the opposite expression pattern between APAF-1 and miRNA-23a. [score:3]
The information collected by bioluminescence imaging guided us to elucidate, at least partially, the biological significance of miRNA-23a deregulation in the apoptotic program of denervated tibialis skeletal muscle tissues. [score:2]
However additional studies are required to confirm this hypothesis and to define more precisely the exact mode of regulation exerted by miRNA-23a in this process. [score:2]
We thus attempted to investigate this point and decided to establish the exact kinetic of miRNA-23a expression during the development of atrophy. [score:2]
We thus hypothesized that miRNA-23a might contribute to the apoptosis of atrophied muscle tissues through regulation of APAF-1. Our Western-Blot analysis performed at day 20 after denervation supports this statement. [score:2]
of this longitudinal analysis indicated that expression of miRNA-23a was high during the first phase of atrophy development (day 0 to day 5) for all the 5 mice investigated and started to decrease gradually from day 5 to day 15, becoming almost undetectable at day 20, the end point of our experiment. [score:2]
The involvement of miR-23a/APAF1 regulation axis in colorectal cancer. [score:2]
The well-known myomirs-133b and -1 were selected in addition to other non-specific muscle miRNAs such as miRNA-23a, -486, -221, previously alleged to be functionally involved in the biology of skeletal muscle cells [27]. [score:1]
In this study, we denoted the RINES plasmids as follows: pRINES/122T when the RINES plasmid contains 4 complementary block sequences to the miRNA-122, and pRINES/23aT when the RINES plasmid contains 4 complementary block sequences to the miRNA-23a. [score:1]
To investigate this hypothesis, we focused on the late time point of atrophy development as the deregulation of miRNA-23a was more pronounced from day 5 to 18. [score:1]
As the kinetic of miRNA-23a expression in response to muscular atrophy has not been previously reported, we decided to investigate this point by molecular imaging. [score:1]
Furthermore, many reports have assigned a key biological role of miRNA-23a in the apoptotic program of many different cell types through modulation of APAF-1, a main compound of the apoptosome, that once bound to cytochrome C can promote the cleavage of the procaspase 9 and the production of the active form of this caspase[30– 33]. [score:1]
Our results suggest that the manipulation of miRNA-23a might have a dual therapeutic interest. [score:1]
[1 to 20 of 36 sentences]
7
[+] score: 125
Other miRNAs from this paper: mmu-mir-27b, mmu-mir-24-1, mmu-mir-24-2, mmu-mir-27a
Figure 6E shows a schematic diagram of the strong p65 -dependent up-regulation of the miR-23a-27a-24 cluster and that the miR-23a-27a-24 cluster further inhibits erythroid protein expression (Figure 6E). [score:8]
p65 binds to the miR-23a-27a-24 cluster promoter to upregulate expression. [score:6]
The results indicated that p65 inhibits the expression of erythroid proteins through the miR-23a-27a-24 cluster rather than directly through a gene promoter. [score:6]
p65 binds to the miR-23a-27a-24 cluster promoter and upregulates expression of the three miRNAs. [score:6]
The miR-23a-27a-24 cluster was found to have altered expression in several types of cancers with consistent or inconsistent expression [32]. [score:5]
Transfection of a miR-24 inhibitor induced expression of band3 protein and promoted differentiation of K562 cells [37], suggesting that the miR-23a-27a-24 cluster can block erythroid terminal differentiation. [score:5]
At the present time, we do not understand the reason and purpose of elevated expression of p65 and the miR-23a-27a-24 cluster in physiological erythropoiesis, but it is clear that expression levels of this protein and the miRNA cluster must decrease to ensure the induction of erythroid proteins, including band3, globin, band4.1R and GPA, which promote red blood cell maturation [34– 36]. [score:5]
In the present paper, we provide evidence that a novel regulation pathway for erythropoiesis links p65 and the miR-23a-27a-24 cluster with erythroid protein expression. [score:4]
Taken together, these results highlight a novel regulation pathway that links the p65/miR-23a-27a-24 cluster with erythroid protein expression to play a vital role in erythropoiesis. [score:4]
Moreover, these miRNAs target the erythroid proteome thus establishing a p65/miR-23a-27a-24/erythroid proteome pathway, the regulation of which plays an essential role in erythropoiesis. [score:4]
Our findings also connect a novel regulation pathway of the p65/miR-23a-27a-24 cluster with the erythroid proteome, which may also be applicable approach for designing therapies to target leukemia. [score:4]
If elevation of the p65/miR-23a-27a-24 cluster is a key event in leukemia, a p65 inhibitor could effectively relieve leukemia progression. [score:3]
In the present study we found that the miR-23a-27a-24 cluster is highly expressed in erythroleukemia K562 cells and plays a vital role in arresting cell differentiation. [score:3]
High expression level of the p65/miR-23a-27a-24 cluster is a vital pathogenesis factor of erythroleukemia and other types of leukemia. [score:3]
The p65/miR-23a-27a-24 cluster targets erythroid genes. [score:3]
For the miRNA overexpression mo del C57BL/6 mice (6-8 weeks) were randomly divided into FBL-3 control, pLVX-vector, pLVX-miR23a, pLVX-miR27a and pLVX-miR24 groups (n = 7 per group). [score:3]
In order to prove the existence of p65/miR-23a-27a-24 cluster axis in the control of erythroid differentiation, erythroleukemia mice were co -treated with p65 inhibitor and miRNA mimics. [score:3]
Dynamic changes of p65/miR-23a-27a-24 expression during erythropoiesis. [score:3]
These results indicated that the expression level of the p65/miR-23a-27a-24 cluster also participates in the progression of other types of leukemia. [score:3]
The vector pLVX-miR23a, pLVX-miR27a and pLVX-miR24 group mice separately received 2×10 [6] pLVX-vector, pLVX-miR23a, pLVX-miR27a or pLVX-miR24 overexpressing FBL-3 cells through intravenous lateral tail vein injection. [score:3]
G (an envelope plasmid) and pLVX-miR23a, pLVX-miR27a and pLVX-miR24 over -expression plasmids were separately co -transfected into HEK293T cells using X-treme GENE (Roche). [score:3]
To test the inhibitory effects of the miR-23a-27a-24 cluster on erythroid gene expression, four typical erythroid genes band3, p16, GPA and band4.1R were selected for further investigation. [score:3]
Expression of the p65/miR-23a-27a-24 cluster in other human leukemia cell lines and nucleated peripheral cells from leukemia patients. [score:3]
If such decreases in p65 and miR-23a-27a-24 cluster levels do not occur, expression of the erythroid proteins could be silenced and erythroid progenitor cell differentiation would be arrested, which in turn leads to malignant transformation. [score:3]
Stable overexpression of miR-23a, miR-27a and miR-24 promoted mouse erythroleukemia progression. [score:3]
These results indicated that high levels of the p65/miR-23a-27a-24 cluster contribute to the development of erythroleukemia. [score:2]
We therefore considered that the miR-23a-27a-24 cluster may target the functional proteome of red blood cells. [score:2]
To explore the possible role of p65 in regulating the miR-23a-27a-24 cluster, we searched for potential p65 binding sites within the cluster promoter. [score:2]
Meanwhile, more metastatic lesions in livers from miR-23a- and miR-27a -overexpressing mice were observed as compared with control mice (Figure 9D–9F). [score:2]
These results indicated that high levels of the p65/miR-23a-27a-24 cluster might be involved in the development of erythroleukemia. [score:2]
To address why the p65/miR-23a-27a-24 cluster is maintained at very high levels in K562 cells, the 3′ UTR region of the p65 gene was cloned and sequenced, but no mutation was identified, suggesting that the p65/miR-23a-27a-24 is functional. [score:2]
In the present study, we show that p65 is a strong positive regulator of the miR-23a-27a-24 cluster. [score:2]
To disrupt protein-DNA cross-links, eluted samples were supplemented and the DNA was purified and analyzed by RT-PCR using primers directed against a 144bp fragment spanning bases +74 to +217 of the miR-23a-27a-24 promoter. [score:1]
The pGL3-promoter-miR plasmid contained the miR-23a-27a-24 cluster promoter region. [score:1]
To understand the expanding role of the p65/miR-23a-27a-24 cluster in leukemia progression, cells from the acute promyelocytic leukemia cell line (APL) NB4 were treated with all-trans-retinoic acid (ATRA, 1mmol/L) for 3d to induce differentiation. [score:1]
MiR-23a and miR-27a promote the progression of leukemia in mice. [score:1]
A. The expression levels of miR-23a, miR-27a or miR-24 in FBL-3 cells were measured by real-time PCR. [score:1]
Nonetheless, these data demonstrated that sustained high levels of the p65/miR-23a-27a-24 cluster disturb normal hematopoiesis and contribute to leukemia progression. [score:1]
High level of the p65/miR-23a-27a-24 cluster is a major event in erythroleukemia. [score:1]
Taken together, these results highlight the importance of the p65/miR-23a-27a-24 cluster in erythroleukemia progression. [score:1]
To determine whether the p65/miR-23a-27a-24 cluster is associated with erythroid differentiation, BMDCs were cultured in erythroid differentiation medium for 10 days using a protocol that was described previously [18, 25, 26]. [score:1]
In addition, we collected six peripheral granulocyte samples from three AML patients and three APL patients and detected the level of the p65/miR-23a-27a-24 cluster in these samples. [score:1]
The pLVX-miR-23a, pLVX-miR-27a and pLVX-miR-24 lentiviral vectors contained miR-23a, miR-27a and miR-24, respectively. [score:1]
To further explore the role of the p65/miR-23a-27a-24 cluster in the progression of erythroleukemia, the three miRNAs were cloned into the lentivirus vector pLVX and stably transfected into FBL-3 cells. [score:1]
[1 to 20 of 44 sentences]
8
[+] score: 111
Other miRNAs from this paper: mmu-mir-23b, mmu-mir-27b, mmu-mir-24-1, mmu-mir-24-2, mmu-mir-27a
At later stages, the increased expression of the miR-23a cluster can directly downregulate Prdm16 by targeting its 3′UTR, which relieves the repression of the downstream targets of TGF-β signalling in promoting the differentiation of osteoblasts into osteocytes (Fig. 5a,b). [score:11]
When miR-23a cluster is upregulated during osteoblast differentiation, Prdm16 is suppressed by the miR-23a cluster in a direct manner, which leads to increased H3 acetylation in the regulatory region, followed by induction of Sost by the phosphorylated Smad2/3 complex. [score:8]
The miR-23a cluster also downregulates other targets, such as Satb2, one of the osteoblast transcription factors. [score:6]
Prdm16 is a direct target of the miR-23a cluster and suppresses Sost. [score:6]
In agreement with the reduced osteoblast activity and number observed in Col1a1-miR-23aC GOF mice, expression of Satb2, a previously reported target of both miR-23a and miR-27a identified in murine osteoblast studies in vitro 5, was significantly decreased in these mutants (Fig. 2k). [score:5]
In the absence of miR-23a cluster, Prdm16 forms a negative complex with phosphorylated Smad2/3 and is recruited to the promoter of Smad -binding element (SBE) to suppress downstream target genes such as Sost. [score:5]
Taken together with the data of direct suppression of Prdm16 by miR-27a shown in Fig. 3c,d, we conclude that Prdm16 is a negative regulator of osteoblast terminal differentiation into osteocytes, which is controlled post-transcriptionally by the miR-23a cluster. [score:5]
Prdm16 is a direct target of miR-27a and suppresses SostTo investigate the molecular mechanisms through which miR-23a regulates bone homeostasis and terminal differentiation of osteoblasts into osteocytes, we performed analysis on RNA isolated from calvarial bones of Col1a1-miR-23aC mice and WT littermates (). [score:5]
List of predicted targets of miR-23a, miR-27a and miR-24-2 among differentially expressed genes. [score:5]
During mature osteoblast to osteocyte differentiation, the miR-23a cluster suppresses Prdm16, a negative regulator of TGF-β signalling and enhances TGF-β signalling to accelerate osteocyte differentiation. [score:4]
In vivo bioluminescence imagingWe injected P3 transgenic Col1a1-miR23aC, Col1a1-miR-23a decoy, Col1a1-miR-27a decoy mice and WT littermates expressing the TGF-β reporter transgene with D-luciferin (Gold Bio, 150 mg kg [−1], i. p. ), anaesthetized them with isoflurane (Piramal) and performed imaging 10 min after injection using a bioluminescence imaging system (Xenogen). [score:3]
We injected P3 transgenic Col1a1-miR23aC, Col1a1-miR-23a decoy, Col1a1-miR-27a decoy mice and WT littermates expressing the TGF-β reporter transgene with D-luciferin (Gold Bio, 150 mg kg [−1], i. p. ), anaesthetized them with isoflurane (Piramal) and performed imaging 10 min after injection using a bioluminescence imaging system (Xenogen). [score:3]
Our study demonstrates a specific role for the miR-23a cluster in osteocyte differentiation in vivo, but also identifies how it targets TGF-β signalling function during this process. [score:3]
To examine the physiological role of each individual miRNA in the miR-23a cluster, we generated osteogenic-specific LOF transgenic mouse mo dels expressing decoys for miR-23a, miR-27a or miR-24-2 individually under the control of the Col1a1-2.3 kb promoter (Supplementary Fig. 1a). [score:3]
Cg-Tg(SBE/TK-luc)7Twc/J) and bred to Col1a1-miR23aC, Col1a1-miR-23a decoy and Col1a1-miR-27a decoy transgenic mice to generate the GOF and LOF mice expressing the TGF-β reporter transgene and wild-type littermates. [score:3]
This suggests that GOF of the miR-23a cluster can regulate osteocyte differentiation in both trabecular and cortical bones. [score:2]
Prior cell studies showed that the miR-23a cluster was induced during differentiation and could regulate osteoblast differentiation in vitro 7 29. [score:2]
The miR-23a cluster regulates osteocyte differentiation. [score:2]
Indeed, this in vivo study indicates that the miR-23a cluster regulates the TGF-β signalling pathway in vivo during bone homeostasis. [score:2]
Overall, our study has identified a physiological role for the miR-23a cluster in the regulation of the terminal differentiation of osteoblasts into osteocytes via Prdm16/TGF-β signalling (Fig. 5b). [score:2]
To generate the osteoblast-specific GOF Col1a1-miR23aC transgenic mice, a 991 bp fragment of genomic DNA containing the miR-23a cluster was cloned downstream of the 2.3 kb Collagen type I, alpha 1 (Col1a1) 2.3 kb promoter into a transgenic vector 6 containing the tyrosinase minigene and the woodchuck post-transcriptional regulatory element sequence (Supplementary Fig. 1a). [score:2]
How to cite this article: Zeng, H. -C. et al. MicroRNA miR-23a cluster promotes osteocyte differentiation by regulating TGF-β signalling in osteoblasts. [score:2]
Here we show that the miR-23a cluster regulates osteoblast-to-osteocyte differentiation using both GOF and LOF mouse mo dels. [score:2]
In the bones of Col1a1-miR-23aC mice, mature miR-23a, miR-27a and miR-24-2 were overexpressed 2.5-, 2.5- and 4.1-fold, respectively, compared to WT littermates, as determined by quantitative real-time PCR (qRT–PCR; Supplementary Fig. 1d). [score:2]
N/Bone area) was increased in Col1a1-miR-23aC mice but decreased in Col1a1-miR-23a decoy and Col1a1-miR-27a decoy mice (N=7). [score:1]
By contrast, the Col1a1-miR-23a decoy and Col1a1-miR-27a decoy LOF reporter mice showed decreased bioluminescence (Fig. 4a,b). [score:1]
To characterize the in vivo function of the miR-23a cluster in bone, we generated an osteoblast-specific GOF mouse mo del overexpressing the cluster under the control of the Collagen type I, alpha 1 (Col1a1) 2.3 kb promoter (Col1a1-miR-23aC; Supplementary Fig. 1a). [score:1]
23aC, Col1a1-miR-23aC; 23D, Col1a1-miR-23a decoy; 27D, Col1a1-miR-27a decoy. [score:1]
Col1a1-miR-23 decoy (N=7 for WT, 11 for 23D); Col1a1-miR-27 decoy (N=8 for WT, 11 for 27D); 24D, Col1a1-miR-24 decoy (N=10 for WT, 7 for 24D). [score:1]
Identification of the miR-23a cluster in bone. [score:1]
To identify miRNAs with relevant functions in bone, we performed analysis on calvarial tissue from wild-type (WT) mice (Fig. 1a) and identified the miRNA-23a (miR-23a) cluster as enriched in bone. [score:1]
Taken together, these results suggest that miR-23a and miR-27a in the miR-23a cluster both contribute to bone homeostasis. [score:1]
Together, these data support an accelerated differentiation of mature osteoblasts into osteocytes in the mo dels of GOF of the miR-23 cluster. [score:1]
Consistent with our finding, the miR-23a cluster was induced during C2C12 osteoblastogenesis upon treatment with BMP2 (ref. [score:1]
In the miR-23a or miR-27a LOF mo dels osteocyte differentiation was affected primarily in trabecular bone in the spine, but not in cortical bone in the femur. [score:1]
The miR-23a cluster affects osteocyte differentiation. [score:1]
Identification of the miR-23a cluster in bone and in vivo function. [score:1]
Col1a1-miR-23a decoy (Col1a1-miR-23D) and Col1a1-miR-27a decoy (Col1a1-miR-27D) transgenic mice were fed soft chow because of dentin defects. [score:1]
Taken together, these results suggest that the miR-23a cluster can accelerate the differentiation of mature osteoblasts into osteocytes. [score:1]
Col1a1-miR-23 decoy (23D) and Col1a1-miR-27 decoy (27D) mice showed a low bone mass phenotype, but not Col1a1-miR-24 decoy (24D) mice. [score:1]
The mo dels of miR-23a cluster in osteocyte differentiation. [score:1]
The role of the miR-23a cluster at the early stages of osteoblast differentiation is not clear yet. [score:1]
[1 to 20 of 42 sentences]
9
[+] score: 60
The association between a reduction in miR-23 expression and an increase in PGC-1α protein content indicates that miR-23 may negatively regulate PGC-1α protein expression. [score:6]
In this study, we found that down-regulation of miR-23 is associated with a significant increase in PGC-1α mRNA expression and protein content in quadriceps of C57Bl/6J male mice three hours following an acute bout of endurance exercise. [score:6]
An acute bout of endurance exercise results in the down-regulation of miR-23 and increases in cellular PGC-1α protein content along with several of its downstream mitochondrial targets. [score:6]
miR-23 expression, a putative regulator of PGC-1α mRNA translation [24], was significantly decreased (84% END vs. [score:6]
We speculate that dysregulation of miR-23 expression may be partly responsible for the etiology of these pathologies, and modulation of miR-23 could be a future therapeutic target for conditions where physical activity is not medically feasible. [score:6]
PGC-1α mRNA expression, protein content and miR-23 expression are normalized to β-2 microglobulin, actin and Rnu6, respectively. [score:5]
PGC-1α (A) mRNA expression and (B) protein content, and (C) miR-23 expression in the quadriceps of C57Bl/6J mice (N = 7/group) 3-hour following an acute bout of END exercise vs. [score:5]
0005610.g001 Figure 1PGC-1α (A) mRNA expression and (B) protein content, and (C) miR-23 expression in the quadriceps of C57Bl/6J mice (N = 7/group) 3-hour following an acute bout of END exercise vs. [score:5]
Linear regression was carried out to define correlation between PGC-1α content and miR-23 expression. [score:3]
The increase in PGC-1α protein content was significantly negatively correlated with decreased expression of miR-23 (R = 0.62; P = 0.032; Figure 1D). [score:3]
During the recovery period following exercise, the decrease in miR-23 may be permissive for an increase in PGC-1α protein, possibly via increased translation or stability of PGC-1α mRNA. [score:3]
PGC-1α content and miR-23 expression following exercise. [score:3]
They identified miR-23 as a putative regulator of PGC-1α protein content. [score:2]
Indeed we observed a significant reduction in miR-23 transcript following acute endurance exercise (Figure 1C) which was significantly correlated with increases in PGC-1α protein content (Figure 1D). [score:1]
[1 to 20 of 14 sentences]
10
[+] score: 60
Other miRNAs from this paper: mmu-mir-23b, mmu-mir-27b, mmu-mir-24-1, mmu-mir-24-2, mmu-mir-27a
The PI3K/Akt pathway can be upregulated by mirn23a targeting the pathway inhibitors Pten (miR-23), and PPP2RSE (regulatory subunit of PP2A, miR-23)[53, 54]. [score:9]
The miR-23a miRNA cluster promotes myeloid development at the expense of B cell development, as evidenced by overexpression and genetic knockout studies[20, 42]. [score:6]
We observe that expression of the entire mirn23a cluster or miR-23a alone represses expression of a luciferase transcript containing the Bach1 3’UTR (Fig 3C). [score:5]
The Bach1 3’UTRs contains a conserved targeting site for miR-23a/b as predicted by the targetscan algorithm[25]. [score:5]
Knockdown of EBF1 resulted in significantly increased expression of miR-23a, miR-24, and miR-27a, consistent with EBF1 negatively regulating mirn23a (Fig 8B). [score:5]
Cells overexpressing EBF1 showed a significant decrease in miR-23a, miR-27a, and miR-24 expression (Fig 8D). [score:5]
Overexpression of miR-23acl or miR-23a alone results in significantly decreased expression of RLU when the Bach1 3’ UTR is present D) RNA was prepared from wildtype and mirn23a [-/-] EML cells and analyzed by qRTPCR. [score:5]
Genes differentially regulated >2 fold between control and miR-23a overexpressing cell lines are shown. [score:4]
Genes significantly changed in miR-23a overexpressing 70Z/3 Pre-B Cells. [score:3]
Additionally, miR-23a has been shown to target Smad5[59]. [score:3]
C) Heat map showing the individual components of the IL2/Stat5 signaling pathways affected by miR-23a, miR-24, or miR-27a expression. [score:3]
C) To confirm mirn23a regulation of Bach1, LightSwitch luciferase reporter assays with the Bach1 3’UTR were conducted in 293T cells overexpressing empty vector control (MSCV), the entire mir23a cluster (MSCV-miR-23acl), or miR-23a alone (MSCV-miR-23a). [score:3]
S2 Table Two unique MiR-23a overexpressing 70Z/3 cell lines were generated through limiting dilution along with a control line infected with empty retrovirus. [score:2]
The mirn23a gene is located on murine chromosome 8 and codes for 3 pre-miRNAs: miR-23a, miR-24-2, and miR-27a. [score:1]
1x10 [5] 293T cells were transfected in a 24 well plate with a LightSwitch control (no 3’ UTR) or experimental (with Bach1 3’ UTR) reporter, along with an empty vector miRNA control (MSCV), MSCV-miR23a27a24, or MSCV-miR23a. [score:1]
[1 to 20 of 15 sentences]
11
[+] score: 58
Other miRNAs from this paper: mmu-mir-23b
The presence of 2700046G09Rik in oligodendroglia potentiates and signals the activation of the miR-23a-PTEN/Akt-mTOR cascades in the correct developmental stage, thus regulating the expression of myelin genes in oligodendrocytes. [score:5]
Consistent with these observations, the developmental expression pattern of miR-23 in vivo is reciprocal to that of the lamin B1 [26, 91]. [score:4]
Likewise, identification of upstream enhancer/repressor elements that can modulate miRNA expression and additional downstream effectors of lamin B1 and miR-23 may provide novel insights into the mechanisms of oligodendrocyte development, myelin formation, and maintenance. [score:4]
Importantly, the adverse effect of LMNB1 overexpression in oligodendrocytes can be abrogated by miR-23, suggesting that it may be a negative regulator of lamin B1 [26]. [score:4]
miR-23a upregulates 2700046G09Rik transcription, and 2700046G09Rik in turn lengthens the half-life of miR-23a, thus potentiating its repressive effects. [score:4]
miRNA-23 (miR-23) is among the most abundant miRNAs in oligodendrocytes [85, 86] and is able to counteract the expression of Lmnb1[26, 57]. [score:3]
To explore possible miR-23a targets that are important for CNS myelination, RNA-Seq approach was applied to examine oligodendrocytes derived from both miR-23a transgenic mice and control littermates. [score:3]
In the presence of excess miR-23 in cell culture, a greater proportion of cells express mature markers of oligodendrocytes that are accompanied by multipolar morphological appearance and increased levels of mature myelin proteins, indicating that miR-23 can enhance differentiation. [score:3]
MiRNA-23 regulates myelination through multiple targets including LMNB1. [score:3]
In addition, 2700046G09Rik may aid in the cellular re-compartmentation of miR-23a into P-bodies, which could also contribute to the regulation of PTEN levels, suggesting that interplay of miR-23a and 2700046G09Rik infers additional molecular regulation of mRNA decay [91]. [score:3]
Interestingly, a long non-coding RNA (lncRNA) neighboring PTEN, 2700046G09Rik, was identified in the same study as another miR-23a target and modulates PTEN itself in a miR-23a dependent manner. [score:3]
The in vivo effects of miR-23 on oligodendrocyte differentiation and myelin formation in the CNS were validated by transgenic mice overexpressing mmu-miR-23a driven by an oligodendrocyte specific promoter [2’ , 3’-cyclic ucleotide 3’-phophodiesterase (Cnp)] [91]. [score:3]
Figure 1 Mo del for the mechanism of miR-23a in regulating myelination. [score:2]
In addition, miR-23 can also enhance oligodendrocyte development through other lamin B1 independent pathways such as PTEN/Akt/mTOR. [score:2]
Importantly, the adverse effect of lamin B1 on oligodendrocyte cells can be abrogated by miR-23 as a negative regulator of lamin B1 [26]. [score:2]
For example, miR-23a may ameliorate reduced levels of oligodendrocyte- and myelin-specific proteins in ADLD. [score:1]
miR-23a represses lamin B1 leading to increased myelination. [score:1]
Therefore, repressive effects on PTEN can either occur with miR-23a alone or in coordination with 2700046G09Rik. [score:1]
Moreover, we discuss the emerging role of non-coding RNAs (ncRNAs) in modulating gene networks, specifically investigating miR-23 as a potential target for the treatment of ADLD and other demyelinating disorders. [score:1]
Genetic interaction studies using mouse mo dels in the future will further reveal lamin B1 dependent and independent effects of miR-23a, and thus determine the possibility of developing non-coding RNAs as potential therapeutic intervention as well. [score:1]
These mice exhibit increased myelin thickness, providing in vivo evidence that miR-23a enhances myelin synthesis [91]. [score:1]
In addition, 2700046G09Rik re-compartments and alters miR-23a sub-cellular localization, which further enhances repressive effects of miR-23a on PTEN. [score:1]
These data implicate a novel role for miR-23a in the coordination of proteins and non-coding RNAs for generating and maintaining healthy myelin [91]. [score:1]
PTEN was identified as a potential target and further characterization confirmed that the PTEN/PI3K/Akt/mTOR pathway is modulated by miR-23a (Figure  1). [score:1]
2700046G09Rik interacts with and stabilizes miR-23a. [score:1]
[1 to 20 of 25 sentences]
12
[+] score: 52
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-27b, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-182, mmu-mir-199a-1, mmu-mir-122, mmu-mir-143, mmu-mir-298, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-27a, mmu-mir-31, mmu-mir-98, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-181b-1, mmu-mir-379, mmu-mir-181b-2, mmu-mir-449a, mmu-mir-451a, mmu-mir-466a, mmu-mir-486a, mmu-mir-671, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-491, mmu-mir-700, mmu-mir-500, mmu-mir-18b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-669e, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-669a-10, mmu-mir-669a-11, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-486b, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-145b, mmu-let-7j, mmu-mir-451b, mmu-let-7k, mmu-mir-126b, mmu-mir-466c-3
To validate the expression of some of the miRs obtained from high-throughput miR array data, we selected 2 upregulated miRs (miR-122 and miR-181b) and 3 downregulated miRs (miR-23a, miR-98, and miR-31). [score:9]
To validate the miR array data, we studied several differentially expressed miRs (upregulated miRs: miR-122 and miR-181a and downregulated miRs: miR-23a, miR-18b, miR-31, and miR-182). [score:9]
The data obtained from miR analysis and highly complementary sequence property of miR-23a and mmu-let-7e demonstrated that TCDD may regulate Fas/FasL expression via downregulating miRs (miR-23a and mmu-let-7e). [score:7]
In this context, we analyzed miRs (miR-23a and mmu-let-7e) that were downregulated and are associated with Fas and FasL expression respectively. [score:6]
Similarly, the expression of miRs, miR-31, miR-23a, and miR-18b which regulate CYP1A1, Fas, and FasL respectively, were decreased following TCDD treatment. [score:4]
org and/or TargetScanMouse 5.1databases, highly complementary sequence of miR-23a with 3′-UTR region of Fas and highly complementary sequence of mmu-let-7e with FasL gene was observed (Table 2). [score:3]
Similarly, we observed downregulation of miR-23a, miR-18b, miR-31 and miR-182 in TCDD -treated thymocytes when compared to vehicle controls (Fig 2A–B). [score:3]
Validation of expression profile of miRs (miR-23a, -18b, -31, -182, -122, and 181a) in fetal thymi post-TCDD exposure. [score:3]
For example, miR-23a and miR-23b were downregulated in TCDD -treated thymocytes when compared to vehicle -treated thymocytes (Table 1). [score:3]
There were at least six miRs (miR-23a, -23b, -18b, -98, 200a, and -491) that were significantly downregulated (Table 1) in fetal thymi when compared to vehicle. [score:3]
Upon analysis of highly complementary sequence of miR-23a and mmu-let-7e using microRNA. [score:1]
miR-23a and miR-23b possessed highly omplementary sequence with Fas 3′UTR region (Table 2) whereas, miR-18b and miR-98 showed highly complementary sequence with FasL 3′UTR region (Table 2). [score:1]
[1 to 20 of 12 sentences]
13
[+] score: 49
Our findings were in consistent with studies using the hemin -treated K562s or EPO -induced CD34+ HPCs to differentiate into mature erythrocytes, revealing the upregulation of miR-23a, miR-27a or miR-24 during erythropoiesis, whereas an activin A -mediated erythroid mo dels reported the inhibitory role of miR-24 in haemaglobin accumulation. [score:6]
Based on the aforementioned observations, we propose that the GATA1/2 switch at the miR-23a∼27a∼24-2 promoter is responsible for their upregulation during erythropoiesis. [score:4]
Primary and mature transcripts of the miR-23a∼27a∼24-2 cluster were upregulated in differentiated erythroid cellsThe miR-23a∼27a∼24-2 cluster encodes a single primary transcript composed of 3 miRNAs: miR-23a, miR-27a and miR-24. [score:4]
Primary and mature transcripts of the miR-23a∼27a∼24-2 cluster were upregulated in differentiated erythroid cells. [score:4]
These results suggest the occurrence of GATA-1-directed positive regulation of the miR-23a∼27a∼24-2 cluster (Figure 1K). [score:3]
Figure 1. GATA-1 was located on the upstream of miR-23a∼27a∼24-2 cluster and activated its expression during erythropoiesis. [score:3]
The miR-23a∼27a∼24-2 cluster was regulated by GATA1/2 switch during erythroid differentiationGiven the aforementioned observations that GATA-1 could reside on the −557 promoter site of miR-23a∼27a∼24-2 cluster and activate transcription, we attempted to determine whether GATA-2 and GATA-1 share the same −557 binding site but yield different biological outputs. [score:2]
Despite the fact that miR-451, miR-23a and mir-223 were shown to suffer from GATA-1 regulation in some species (6, 7, 11), there are virtually no data about GATA-1/2 switch dynamically operating on their genes during erythropoiesis. [score:2]
Recently, we reported that miR-23a was a positive erythroid regulator and activated by GATA-1 along erythroid differentiation (7). [score:2]
The activity of GATA-1 on the miR-23a∼27a∼24-2 promoter was examined by using a luciferase reporter assay following co-transfection with a GATA-1 overexpressing-vector and either a wild-type pGL-3-promoter construct (WT) or a mutant promoter (MUT) in 293T cells. [score:2]
So far, a number of non-coding regulators such as miR-451 (5, 6), miR-23a (7), miR-221/222 (8), miR-376a (9) and miR-223 (10) were reported to play positive or negative roles in controlling erythropoiesis. [score:2]
The miR-23a∼27a∼24-2 cluster was regulated by GATA1/2 switch during erythroid differentiation. [score:2]
Thus, the miR-23a∼27a∼24-2 cluster could coordinate with different TFs to determine or maintain such cell fates. [score:1]
Given the significant associations of miR-23a in erythropoiesis demonstrated in our previous studies (7), we decided to examine the primary and mature products from miR-23a∼27a∼24-2 cluster. [score:1]
Here, we demonstrate that the GATA-1/2 switch occurs at the common gene locus encoding miR-23a, miR-27a and miR-24. [score:1]
Given the aforementioned observations that GATA-1 could reside on the −557 promoter site of miR-23a∼27a∼24-2 cluster and activate transcription, we attempted to determine whether GATA-2 and GATA-1 share the same −557 binding site but yield different biological outputs. [score:1]
edu/cgi-bin/tess) sequence analysis was performed and revealed two putative GATA sites scattered within the promoter region of human miR-23a∼27a∼24-2 loci (Figure 1E; detailed information is shown in Supplementary Figure S1). [score:1]
Furthermore, q-PCR using specific Taqman probes revealed that pri-miR-23a∼27a∼24-2 and mature miR-27a, miR-24 and miR-23a were increased in EPO -driven erythroid differentiation of primary cultured human CD34+ HPCs (Figure 1D). [score:1]
The miR-23a∼27a∼24-2 cluster encodes a single primary transcript composed of 3 miRNAs: miR-23a, miR-27a and miR-24. [score:1]
To confirm this mo del, we analysed the association of GATA-2 and GATA-1 with the −557 site of the miR-23a∼27a∼24-2 cluster following miRNA treatment. [score:1]
This cluster is composed of three members, miR-23a, miR-27a and miR-24, and has been linked to osteoblast differentiation, angiogenesis, cardiac remo delling, skeletal muscle atrophy and tumorigenesis (27–29). [score:1]
These results suggest that GATA-2 -dependent miR-23a∼27a∼24-2 cluster repression occurs. [score:1]
To further establish the connection between GATA-2 and miR-27a/24, the levels of both the primary and mature miR-23a∼27a∼24-2 clusters were evaluated in K562s transfected with either siRNAs specific to GATA-2 or constructs over -expressing GATA-2 (Figure 5D). [score:1]
GATA-1 was located on the miR-23a∼27a∼24-2 cluster promoter and activated its transcription. [score:1]
Therefore, changes in miR-23a∼27a∼24-2 cluster transcription would be able to be predicted by disruption of this feedback loop. [score:1]
[1 to 20 of 25 sentences]
14
[+] score: 37
Three miRNAs (mmu-miR-378, mmu-miR-199a-3p and mmu-miR-181b) were downregulated and one (mmu-miR-23a) was upregulated in baicalin treated mice compared with UVB irradiated mice, and they were predicted to be related to DNA repair signaling pathway. [score:6]
MiR-23a appeared to be the only upregulated miRNA in baicalin treated and irradiated mice. [score:4]
Expression levels of mmu-miR-233, mmu-miR-141, mmu-miR-23a and mmu-miR-181b were validated using quantitative real-time PCR (qRT-PCR). [score:3]
Top1, as the possible gene target of miRNA-23a, may be associated with accelerated CPD removal of baicalin shown in the present study. [score:3]
The expression levels of mmu-miR-233, mmu-miR-141, mmu-miR-23a and mmu-miR-181b were normalized by subtracting their Ct values from that of the internal control mmu-actin, to obtain [Δ]Ct. [score:3]
We predict that changes in miR-23a expression in the skin may stimulate cell differentiation and cell homing. [score:3]
To confirm the microarray findings, we measured the expression levels of four miRNAs (mmu-miR-223, mmu-miR-141, mmu-miR-23a and mmu-miR-181b) that may be related to the regulation of cellular processes using qRT-PCR. [score:2]
MiR-23a has also been reported to target at the gene encoding stromal cell-derived factor 1 alpha (CXCL12), which is involved in several physiological processes in the skin [24]. [score:2]
Four miRNAs (mmu-miR-23a, mmu-miR-378*, mmu-miR-199a-3p and mmu-miR-181b) were found to be differentially expressed in the UVB group compared with the baicalin plus UVB treated group (P < 0.05). [score:2]
MiR-23a has also been predicted to target the gene encoding topoisomerase I (Top1), which plays an essential role in DNA repair [26]. [score:2]
The results showed that mmu-miR-23a was highly expressed in the baicalin plus UVB group compared with the UVB group, whereas there was no significant difference between the control group and the UVB group. [score:2]
In a previous study, miR-23a was identified as a growth and localization miRNA in hematopoietic progenitor cells and neuron development [23]. [score:2]
The figure shows that mmu-miR-23a is highly expressed in the baicalin plus UVB group compared with the UVB group, and mmu-miR-223 is increased by more than ten fold in UVB treated skin compared with control. [score:1]
Fig. 3 The figure shows that mmu-miR-23a is highly expressed in the baicalin plus UVB group compared with the UVB group, and mmu-miR-223 is increased by more than ten fold in UVB treated skin compared with control. [score:1]
B: mmu-miR-23a. [score:1]
[1 to 20 of 15 sentences]
15
[+] score: 35
While hsa-miR-23a and hsa-miR-23b were highly expressed in human pancreatic cancer cells-derived xenografts, they were barely detectable in saliva in this mo del of tumor-bearing mice. [score:3]
We found that these cells and resulting xenografts express high levels of hsa-miR-21, hsa-miR-23a, hsa-miR-23b and hsa-miR-29c (S3 and S4 Tables). [score:3]
We identified hsa-miR-21, hsa-miR-23a, hsa-miR-23b and miR-29c as being significantly upregulated in saliva of pancreatic cancer patients compared to control, showing sensitivities of 71.4%, 85.7%, 85,7% and 57%, respectively and excellent specificity (100%). [score:3]
In this article, we have identified hsa-miR-21, hsa-miR-23a and hsa-miR-23b that were differently expressed between saliva samples of patients with a malignant tumor and cancer-free patients, with excellent specificity and sensitivity. [score:3]
Interestingly, hsa-miR-23a and hsa-miR23b are overexpressed in the saliva of patients with pancreatic cancer precursor lesions. [score:3]
Taken together, we demonstrate for the first time that salivary miRNA are indicative of pancreatic disease and can be used to diagnose unresectable PDAC (hsa-miR-21, hsa-miR-23a, hsa-miR-23b) or pancreatitis (hsa-miR-210). [score:3]
We found that 4 miRNAs (hsa-miR-21, hsa-miR23a, hsa-miR-23b and hsa-miR-29c) were significantly expressed in saliva from patients with pancreatic cancer (n = 7), while undetectable in the saliva of control patients (n = 4; Wilcoxon test, 0.001< p < 0.03) (Fig 1 and Table 2). [score:3]
Hsa-miR-21, hsa-miR-23a and hsa-miR-23b were found significantly deregulated in the saliva of resectable PDAC patients as compared to healthy control during the discovery phase, but were not further investigated as they didn’t exhibit at least a 4-fold change in expression between the two groups [24]. [score:1]
In this pilot study, we found that four salivary miRNAs (hsa-miR-21, hsa-miR-23a, hsa-miR-23b and hsa-miR-29c) successfully segregated PDAC patients from cancer-free donors, while hsa-miR-210 and let-7c indicate pancreatitis and hsa-miR-216 discriminates pancreatitis from cancer. [score:1]
On the contrary, patients diagnosed with pancreatitis and elevated salivary hsa-miR-21, hsa-miR-23a and hsa-miR-23b, or patients diagnosed with IPMN and elevated salivary hsa-miR-23a and hsa-miR-23b may be at-risk of developing PDAC and may require careful clinical follow-up. [score:1]
Of more than 90 miRNAs tested, 4 were identified as being significantly deregulated in saliva of pancreatic cancer patients compared to control (hsa-miR-21, hsa-miR-23a, hsa-miR-23b and hsa-miR-29c). [score:1]
On the other hand, salivary hsa-miR-23a, hsa-miR-23b and hsa-miR-29c were detected at low levels in the saliva of PDAC-bearing mice (Fig 2 and S5 Table). [score:1]
However, our study tends to indicate that hsa-miR-21, hsa-miR-23a and hsa-miR-23b are present in the saliva of patients with pancreatitis, while hsa-miR-210 is detected in the saliva of a fraction of patients with PDAC. [score:1]
In addition, hsa-miR-21, hsa-miR-23a and hsa-miR-23b were strictly specific to cancer patients, with excellent sensitivity (71.4% and 85.7%, respectively). [score:1]
We have obtained preliminary results suggesting that hsa-miR-23a and hsa-miR-23b are also be present in saliva from patients diagnosed with IPMN, and could be used for decision making in IPMN management. [score:1]
Hsa-miR-23a has recently been associated with KRAS [30] and C-MYC [31] mediated signaling pathway, and described as a candidate driving miRNA in pancreatic cancer [30]. [score:1]
Of note, hsa-miR-21, hsa-miR23a, hsa-miR-23b and hsa-miR-29c could be detected in the saliva of patients with pancreatitis (Fig 1). [score:1]
Analysis of salivary hsa-miR-21, hsa-miR-23a, hsa-miR-23b and hsa-miR-29c levels and Lucia blood levels in mice xenografted with Mia PACA-2 Lucia cells at the time indicated following tumor induction. [score:1]
Hsa-miR-23a has also been linked to impaired NK cell cytotoxicity [32], EMT [33] and resistance to treatment [34– 36]. [score:1]
In addition, hsa-miR-23a and hsa-miR-23b are present in the saliva of patients with IPMN. [score:1]
To our knowledge, we provide herein the first demonstration that hsa-miR-23a and hsa-miR-23b could be detected in the saliva of patients diagnosed with cancer; however, the specificity of both candidate miRNAs for PDAC is still to be demonstrated. [score:1]
[1 to 20 of 21 sentences]
16
[+] score: 31
Description miR-451[39] Upregulated in heart due to ischemia miR-22[40] Elevated serum levels in patients with stablechronic systolic heart failure miR-133[41] Downregulated in transverse aortic constrictionand isoproterenol -induced hypertrophy miR-709[42] Upregulated in rat heart four weeks after chronicdoxorubicin treatment miR-126[43] Association with outcome of ischemic andnonischemic cardiomyopathy in patients withchronic heart failure miR-30[44] Inversely related to CTGF in two rodent mo delsof heart disease, and human pathological leftventricular hypertrophy miR-29[45] Downregulated in the heart region adjacent toan infarct miR-143[46] Molecular key to switching of the vascular smoothmuscle cell phenotype that plays a critical role incardiovascular disease pathogenesis miR-24[47] Regulates cardiac fibrosis after myocardial infarction miR-23[48] Upregulated during cardiac hypertrophy miR-378[49] Cardiac hypertrophy control miR-125[50] Important regulator of hESC differentiation to cardiacmuscle(potential therapeutic application) miR-675[51] Elevated in plasma of heart failure patients let-7[52] Aberrant expression of let-7 members incardiovascular disease miR-16[53] Circulating prognostic biomarker in critical limbischemia miR-26[54] Downregulated in a rat cardiac hypertrophy mo del miR-669[55] Prevents skeletal muscle differentiation in postnatalcardiac progenitors To further confirm biological suitability of the identified miRNAs, we examined KEGG pathway enrichment using miRNA target genes (see ). [score:31]
[1 to 20 of 1 sentences]
17
[+] score: 31
miR-126, miR-24 and miR-23a are selectively expressed in microvascular endothelial cells in vivo, whereas miR-145 is expressed in pericytes. [score:5]
In addition, miR-23a, miR-23b, miR-24 and miR-30d were shown to be upregulated in hypoxia [38]. [score:4]
We identified miR-145, miR-126, miR-24 and miR-23a as enriched in microvessels, and showed that microvascular expression of miR-145 is due to its presence in pericytes. [score:3]
Differential expression of miR-126, miR-145, miR-24, and miR-23a in the mature microvasculature. [score:3]
The miRNAs identified in the present study - miR-145, miR-30D, miR-24, miR-23a and miR-23b - are therefore possible targets in future therapeutic strategies. [score:3]
miR-145, miR-126, miR-24, and miR-23a were selectively expressed in microvascular fragments isolated from a range of tissues. [score:3]
By screening for mature miRNAs with vascular expression patterns we found that miR-145, miR-126, miR-23a, and miR-24 were enriched in the microvasculature in vivo. [score:3]
In addition, miR-23a and miR-24 were consistently differentially expressed, with enrichments ranging from 5- to 16-fold. [score:3]
Many of the miRNAs we identified scored favorably in one or more of these screens, including miR-23a [6- 8, 12], miR-23b [7, 8, 12], miR-24 [7, 8, 12] and miR-126 [6, 8, 12]. [score:1]
miR-145, miR-126, miR-24 and miR-23a were consistently enriched in adult microvessels. [score:1]
Based on the above described in silico analyses, we chose to further characterize the expression of miR-126-3p (the predominant mature form of this miRNA, hereafter referred to as miR-126), miR-145, miR-30d, miR-23b, miR-24 and miR-23a; the latter being co-transcribed with miR-24 [1]. [score:1]
miR-23a and miR-24 were enriched in sprouts from EBs but not in fragments from embryonic day 14 kidneys. [score:1]
[1 to 20 of 12 sentences]
18
[+] score: 31
Expression of miR-23a was upregulated in differentiated cells as compared to stem/precursors, as expected (Figure 1C ). [score:5]
In support of this hypothesis, the lineage-specific segregation of miR-124 and miR-23a activity was clearly highlighted in vivo, where >90% of striatal neurons and >95% of parenchymal astrocytes downregulated GFP following direct injection of LV. [score:5]
miRT23a-transduced NSCs (Figure 3D, E ) confirmed the upregulation of miR-124 and miR-23a during neuronal and glial differentiation, respectively. [score:4]
Based on the available data and on our expression profile we selected miR-93 and miR-125b for further analysis, in order to assess their activity in stem/early progenitor cells and the cell-specific modulation during lineage commitment and differentiation, considering the neuronal-specific miR-124 [11], [43] and the astroglial-specific miR-23a [33] as reference. [score:3]
Quantitative PCR analysis confirmed that miR-125b and miR-93 are abundantly expressed in stem/precursor cells when compared to miR-23a and miR-124 (Figure 1B ). [score:2]
miR-23a antisense: ccgggatcacattgccagggatttccatcgatcacattgccagggatttccctat. [score:1]
Activity of miR-124 and miR-23a in NSC-derived neurons and astrocytes. [score:1]
NB: 4 copies of miR-23a were generated by successive ligation of 2 oligonucleotide products (each containing 2 tandem repeats complementary to miR-23a) into the pBlueNA subcloning construct. [score:1]
Modulation of miR-124 and miR-23a Activity in NSC-derived Neurons and Astroglia. [score:1]
Similarly, the presence of heterogeneous glial cell populations in NSC-derived progeny might explain the variable pattern of miR-23a activity. [score:1]
TaqMan quantitative real-time PCR was performed with hsa-miR-16, hsa-let7a, hsa-miR-125b, mmu-miR93, mmu-miR-124a, hsa-miR-23a, hsa-miR-106b, hsa-miR-25 and hsa-miR-9 specific probes (Life Technologies-Applied Biosystems) on ABI7900 thermal cycler. [score:1]
miR-23a sense: ctagatagggaaatccctggcaatgtgatcgatggaaatccctggcaatgtgatc. [score:1]
By using (bd)LV sensor vectors we validated and extended previous results on the neuronal-specific miR-124 and provided new data on the activity of the astroglial-specific miR-23a. [score:1]
miRT-transduced NSC-derived populations were analyzed by FACS and by IF, using the same experimental protocol described for miR-23a and miR-124. [score:1]
miRT-transduced NSC-derived cultures and brain tissue, in particular for miR-124 and miR-23a, whose activity is enriched in mature neurons and astrocytes, the most represented cell types in the adult striatal parenchyma. [score:1]
miR-124 and miR-23a activity in NSCs monitored using LV. [score:1]
Activity of miR-124, miR-23a, miR-125b and miR-93a in striatal cell types. [score:1]
[1 to 20 of 17 sentences]
19
[+] score: 27
However, the mechanism by which the miRNA expression is regulated in neurons remains unknown, and the pathway by which hypoxia downregulates the expression of miR-23a/b and miR-27a/b is also unknown. [score:9]
Our previous study showed that miR-23/27 regulates neuronal sensitivity to apoptosis by suppressing Apaf-1 expression [10]. [score:6]
Previous studies have shown that c-Myc differentially regulates miR-23 and miR-27 expression at the transcriptional level in different cell types [24, 25]. [score:4]
Previous studies have reported that c-Myc suppresses miR-23a/b [24] or promotes the miR-23a/24–2/27a cluster at the transcriptional level [25] in different cell lines. [score:3]
More recently, Li et al successfully repeated this experiment and found that c-Myc promotes the expression of the miR-23a/24–2/27a cluster in MCF-7 cells, suggesting that c-Myc has an alternative functional role in a highly context -dependent manner in cell lines with different origins [25]. [score:3]
It has been reported that c-Myc represses miR-23a and miR-23b at the transcriptional level in human P-493B lymphoma cells and PC3 prostate cancer cells [24]. [score:1]
In our previous study, we showed that the levels of miR-23a/b and miR-27a/b in the cortices of E19.5 mice were decreased during hypoxia [10]. [score:1]
[1 to 20 of 7 sentences]
20
[+] score: 24
These results were easy to understand; as atrogin-1 and MuRF1 are the target genes of miR-23a, the secretion of miR-23a by exosome should facilitate the induced expression of these atrophy-inducing genes. [score:5]
The overexpression of miR-23a could repress muscles atrophy both in vitro and in vivo. [score:3]
Wada et al. reported that miR-23a represses the expression of both atrogin-1 and MuRF1 by binding to its 3′UTR [34]. [score:3]
In conclusion, analysis of miR-23a, miR-206, and miR-499 serum levels proved their potential to serve as powerful noninvasive prognostic biomarkers for muscle atrophy. [score:1]
As expected, serum miR-23a, miR-206, and miR-499 levels were positively correlated with the ratio of soleus volume loss in subjects after 45 days of HDBR (Figure 5). [score:1]
Moreover, the levels of miR-23a, miR-206, and miR-499 increased during HU in a time -dependent manner. [score:1]
Moreover, Hudson et al. demonstrated that, during glucocorticoid -induced atrophy, Dex treatment induces the secretion of exosomes from C2C12 myotubes into the medium, enriched with miR-23a and miR-1 [35]. [score:1]
Therefore, our results suggested that the serum levels of miR-23a/206/499 could serve as valuable biomarkers for the diagnosis of muscle atrophy. [score:1]
Their results suggest that Dex can induce the secretion of miR-23a by exosomes. [score:1]
In our research, significant increases were found in the serum levels of miR-23a/206/499 during the HDBR. [score:1]
The results show that the levels of miR-23a, miR-206, and miR-499 were induced after 30 and 45 days of HDBR (Figures 4(b), 4(d), and 4(f)). [score:1]
The levels of miR-23a/206/499 were positively correlated with the ratio of soleus volume loss in HDBR subjects. [score:1]
The correlation of the other three miRNAs was also provided in Supplementary Figure 2. These results indicated that serum levels of miR-23a, miR-206, and miR-499 might represent the extent of muscle degeneration following HDBR. [score:1]
There were significantly increased levels of miR-23a, miR-206, and miR-499 in serum of HDBR participants after 45 days of head-down bed rest. [score:1]
As the levels of miR-23a/206/499 were positively correlated with the ratio of muscle loss, they can be used to predict the degree of muscle atrophy. [score:1]
Our results indicated that starvation induced C2C12 myotubes atrophy led to the secretion of miR-1, miR-23a, miR-133, miR-206, miR-208b, and miR-499 into the culture medium, which could be used as indicators for muscle atrophy. [score:1]
[1 to 20 of 16 sentences]
21
[+] score: 22
Consistent with the results of the microarray, the expressions of miR-23a, 15b, 27a, 146a, 34a, 451 and 223 were consistent with the level of inflammation (Fig. 4A), and the changes in the expressions of miR-101a, 101b and 148a were in inverse proportion to the inflammation level after transplantation (Fig. 4B). [score:5]
Additionally, miR-23a was expressed at significantly higher levels in the blood from patients with Crohn's disease 36. [score:5]
The miR-223, miR-23a and miR-15b levels were downregulated in the sera of multiple sclerosis patients. [score:4]
Further, the expression levels of miR-223 and miR-23a were altered in PBMCs from multiple sclerosis patients 35. [score:3]
Furthermore, the expression of miR-23a and miR-27a/b was significantly lower in the mouse livers damaged by carbon tetrachloride administration than in the normal liver 40. [score:3]
MiR-27a and miR-23a belong to the same cluster. [score:1]
These data suggested that miR-23a could play a role in the pathogenesis of neural disorders and have some beneficial effects for treating damaged skin. [score:1]
[1 to 20 of 7 sentences]
22
[+] score: 19
The increased miR-23a expression may be caused by the down-regulation of its inhibitor C-myc [27]. [score:8]
MiR-23a was up-regulated after, and the expression of all its targets, except Hoxb4, was reduced [27], [30]– [33] (Figure 2F). [score:7]
By contrast, some miRNAs that are significantly up-regulated were also observed, including miR-290 cluster members, miR-291a and miR-291b, miR-129-1-3p, miR-129-2-3p, miR-23a-3p, miR-434-3p, miR-145-5p, and miR-203-3p. [score:4]
[1 to 20 of 3 sentences]
23
[+] score: 18
Silencing PRDM14 reduced the expression of miRNAs upregulated in breast cancer tissues (e. g. miR-106a, miR-149, miR-18a, miR-221, miR-222, miR-224, miR-23a, miR-24, miR-27a/b, and miR-493) and increased expression of those that were downregulated (e. g. miR-15a, miR-150, miR-183, and miR-203). [score:11]
PRDM14 -transfected breast cancer cell lines also exhibited increased expression of oncogenic microRNAs (miRNAs) (miR-101, miR-155, miR-21, miR-221, and miR-23a) and decreased expression of tumor suppressor miRNAs (miR-128a, miR-200a/b, and miR-520f) (Supplementary Table 2). [score:7]
[1 to 20 of 2 sentences]
24
[+] score: 18
The inhibition of miR-23a, an inhibitor of CTL cytotoxicity, has been shown to preserve immune competence in the tumour microenvironment and enhance ACT therapy 46. miRNAs can also be used in combination with monoclonal antibodies targeting inhibitor molecules. [score:9]
In human CD8 [+] T cells, miR-23a cluster (miR-23a, miR-27a, miR-24), and miR-720 were upregulated by TGF-β 36 37. [score:4]
In mouse CD8 [+] T cells, miR-23a was effectively upregulated by TGF-β in TCR-activated CTLs and mediated tumor immune evasion 38. [score:4]
In tumour-infiltrating CTLs, miR-23a repressed the transcription factor BLIMP-1 and led to impairment of effector cell differentiation and CTLs cytotoxicity 38. [score:1]
[1 to 20 of 4 sentences]
25
[+] score: 17
IPost up-regulated miR-1, miR-15b, miR-21, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-214, miR-208 and miR-499, while down-regulated miR-23a and miR-9 as compared with Sham group. [score:6]
Compared with sham group, the expressions of miR-1, miR-15b, miR-21, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-214, miR-208 and miR-499 were increased in IPost hearts, while miR-9 and miR-23a were down-regulated in IPost mo dels. [score:5]
As previously reported, a collection of miRNAs were abnormally expressed in ischemic mouse hearts in response to I/R injury, such as miR-1, miR-9, miR-15b, miR-21, miR-23a, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-208, miR-214 and miR-499 [20, 21, 28]. [score:3]
Then real-time quantitative PCR was performed to quantify the expression level of miR-1, miR-9, miR-15b, miR-21, miR-23a, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-208, miR-214 and miR-499 with SYBR Green PCR Master Mix (Applied Biosystems) according to the manufacturer’s instructions. [score:3]
[1 to 20 of 4 sentences]
26
[+] score: 17
Transfection with miR-23a downregulated the expression levels of XIAP (X-linked inhibitor of apoptosis protein) and caspase-3 protein and upregulated caspase-3 protein expression in human ovarian GCs, along with an increased apoptosis rate. [score:13]
Differentially expressed plasma microRNAs in premature ovarian failure patients and the potential regulatory function of mir-23a in granulosa cell apoptosis. [score:4]
[1 to 20 of 2 sentences]
27
[+] score: 16
miR-23a, miR-27a and miR-27b expression was significantly lower in the burned skin than in the normal skin (p<0.05). [score:3]
However, miR-23a, which has been identified to directly regulate SDF-1α 3′UTR by other researchers, was not among the five miRNAs identified by our methods. [score:3]
The expression of miR-23a, miR-27a and miR-27b were significantly lower in the burned skin compared to the normal skin (p<0.05) (Figure 4B). [score:2]
These results suggest that miR-23a, miR-27a, and miR-27b might be involved in the regulation of SDF-1α in the context of burned skin. [score:2]
The gene-specific primer pairs used to amplify specific target genes were as follows, and GenBank accession numbers also be included: mmu-miR-1(NR_029528.1): GSP, 5′-GGGGTGGAATGTAAAGAAGT-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; mmu-miR-136(AJ 459747.1): GSP, 5′-GGAACTCCATTTGTTTTGA-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; mmu-miR-214(NR_029796.1): GSP, 5′-GACAGCAGGCACAGACA-3′ and reverse, 5′-TGCGTGTCGTGGAGTC-3′; mmu-miR-23a (NR_029740.1): GSP, 5′-CCATCACATGCCAGG-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; mmu-miR-27a (NR_029746.1): GSP, 5′-GGGGTTCACAGTGGCTAA-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; mmu-miR-27b(NR_029531.1): GSP, 5′-GGGGTTCACAGTGGCTAAG′ -3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; U6(NM_001204274.1): forward, 5′-GCTTCGGCAGCACATATACTAAAAT-3′ and reverse, 5′-CGCTTCACGAATTTGCGTGTCAT-3′; VEGF (NC_000083.6): forward, 5′-GTCCAACTTCTGGGCTCTTCT-3′ and reverse, 5′-CCTTCTCTTCCCCTCTCT-3′. [score:2]
Furthermore, miR-23a, which was detected by other researchers [20] but was not among the five miRNAs identified by our methods, was also included for comparative analysis. [score:1]
Figure S1 The effects of miR-23a, miR-136, miR-1 and miR-214 on MSC migration. [score:1]
They were named LV-mmu-mir-1, LV-mmu-mir-136, LV-mmu-mir-214, LV-mmu-mir-23a, LV-mmu-mir-27a, LV-mmu-mir-27b, and LV-cel-mir-67 (the negative control). [score:1]
Lane 1, MSCs; lane 2, MSCs/cel-miR-67; lane 3, MSCs/miR-27b; lane 4, MSCs/miR-27a; lane 5, MSCs/miR-1; lane 6, MSCs/miR-23a; lane 7, MSCs/miR-136; lane 8, MSCs/miR-214. [score:1]
[1 to 20 of 9 sentences]
28
[+] score: 16
In addition, miR-27a is a member of the miR-23a/27a/24-2 gene cluster, promoting the expression of M1 cytokines while reducing the expression of M2 cytokines, suggesting that it plays an important role in the activation and polarization of macrophages (39). [score:5]
miR-23a is a member of miR-23a/27a/24-2 cluster, which has been shown to promote macrophage polarization by targeting JAK1 and STAT-6 directly in murine macrophages (39). [score:4]
Our results are in accordance with Ma and colleagues findings, where they demonstrated that miR-23a/27a/24-2 was downregulated in mouse peritoneal macrophages stimulated with LPS (39). [score:4]
Our work is in line with a previous report showing the effects of miR-23a/27a/24-2 on the expression of pro-inflammatory cytokines in murine macrophages (39). [score:3]
[1 to 20 of 4 sentences]
29
[+] score: 14
To validate the microarray results, the expressions of five miRNAs were quantified using real-time quantitative PCR, including two up-regulated (miR-23a-3p and miR-215-5p) and three down-regulated (miR-27b-3p, miR-101a-3p, and miR-6394) miRNAs (Fig.   2d). [score:9]
Only 15 miRNAs from the 64 DEMs had validated target genes in IPA by target filter analysis, including miR-6349, miR-101a-3p, miR-6394, miR-126a-3p, miR-721, miR-143-3p, miR-497a-5p, miR-93-5p, miR-215-5p, miR-199a-3p, miR-23a-3p, miR-27b-3p, miR-2861, miR-30a-5p, and miR-370-3p. [score:5]
[1 to 20 of 2 sentences]
30
[+] score: 12
Other miRNAs, such as miR-23a, miR-31, miR-132, or miR-16, were also significantly downregulated with cardamonin treatment for 24 h compared to that of treatment for 3 h. Since most of miRs have been downregulated and miR-21 was strongly suppressed by cardamonin, we used miR-21 mimics and miR-21 inhibitors to test the function of cardamonin on HUVECs. [score:10]
We selected 14 of these miRs which might have been involved in regulation of angiogenesis, including miR-17-5p, miR-19a, miR-23a, miR-24, miR-31, miR-34a, miR-126, miR-130a, miR-132, miR-16, miR-21, miR-217, miR-221, and miR-378 for our study. [score:2]
[1 to 20 of 2 sentences]
31
[+] score: 11
Other miRNAs from this paper: hsa-mir-23a, mmu-mir-23b, hsa-mir-23b, hsa-mir-23c
Translational suppression of atrophic regulators by microRNA-23a integrates resistance to skeletal muscle atrophy. [score:6]
For example, it has been previously shown that miR-23 a suppresses the translation of both MAFbx/atrogin-1 and MuRF-1 in a 3_-UTR -dependent manner (Wada et al., 2011). [score:5]
[1 to 20 of 2 sentences]
32
[+] score: 11
It has been reported that the expression levels of 23a-27a-24–2 cluster members are significantly up-regulated upon treatment with isoproterenol and aldosterone, but only miR-23a participates in initiating the hypertrophic response [52]. [score:6]
Two other clusters, miR-23a∼27a∼24-2 and mir-23b-27b-24-1, each containing three miRNA genes, were observed in the present study to be up-regulated to different degrees in the old versus young adult heart. [score:4]
miR-23a, miR-27b were also induced during early hypertrophic growth in response to pressure-overload [53], [54]. [score:1]
[1 to 20 of 3 sentences]
33
[+] score: 10
Some of the important miRs with known/putative targets and differentially regulated by TWEAK are presented in Figure 3. Our results showed that TWEAK reduced the expression of muscle-specific miR-1, miR-133a, miR-133b and miR-206 in addition to several other miRs including miR-27, miR-23, miR-93, miR-199, miR-107, and miR-192 (Figure 3A). [score:6]
Low-density miRNA array of TWEAK -treated C2C12 myotubes showed down-regulation of miR-1, miR-133a, miR-133b, miR-206, miR-27, miR-23, miR-93, miR-199, miR-107, and miR-192. [score:4]
[1 to 20 of 2 sentences]
34
[+] score: 10
For example, miR-23 and miR-203 have been shown to enhance radiosensitivity by targeting IL8/Stat3 and IL8/AKT signalling pathway, respectively in nasopharyngeal carcinoma [24, 25]; miR-205 has been reported to function as a tumour radiosensitizer by inhibiting DNA repair pathway via down-regulation of ZEB1 and Ubc13 in breast cancer cells [26]; miR-15a/16 can enhance radiation sensitivity of NSCLC cells by targeting the TLR1/NF-κB signalling pathway [27]. [score:10]
[1 to 20 of 1 sentences]
35
[+] score: 10
Other miRNAs from this paper: mmu-mir-21a, mmu-mir-27a, mmu-mir-592, mmu-mir-21b, mmu-mir-21c
Similarly, miR-23a was found to be elevated in 5-FU CRC cells, and its target APAF-1 along with caspases-3 and -7 were down-regulated in these cells. [score:6]
In this regard, miR-23a and miR-21 have gained the most interest, owing to an aberrant expression of these miRNAs in CRC cells. [score:3]
Interestingly, introduction of miR-23a antisense into 5-FU resistant cells showed an increased level of apoptotic protease activating facter-1 (APAF-1), along with an enhanced activation of caspase-3 and -7, subsequently enhanced the 5-FU induced apoptosis in these cells [40]. [score:1]
[1 to 20 of 3 sentences]
36
[+] score: 9
miR-31, miR-150 and miR-184 have shown to be downregulated in oxygen -induced retinopathy mice mo dels [20]; miR-23~24~27 cluster was upregulated in laser induced CNV mice mo dels [21]. [score:7]
Zhou Q. Gallagher R. Ufret-Vincenty R. Li X. Olson E. N. Wang S. Regulation of angiogenesis and choroidal neovascularization by members of microRNA-23∼27∼24 clusters Proc. [score:2]
[1 to 20 of 2 sentences]
37
[+] score: 9
The 6 upregulated miRNAs (mmu-miR-5132-5p, mmu-miR-3104-5p, mmu-miR-669c-5p, mmu-miR-705, mmu-miR-760-3p, mmu-miR-1962) and the 9 downregulated miRNAs (mmu-miR-146a, mmu-miR-138, mmu-miR-5123, mmu-miR-196b, mmu-miR-5099, mmu-miR-150, mmu-miR-145, mmu-miR-27a, mmu-miR-23a) chosen for validation were also based on their target genes predicted, whose functions are well relevant to inflammation and cancer. [score:9]
[1 to 20 of 1 sentences]
38
[+] score: 9
Other miRNAs from this paper: hsa-mir-23a
Recent studies have highlighted that TGF-β mediates the immunosuppression of CD8 [+] T cells by elevating miR-23a and downregulating Blimp-1, or by upregulating Foxp1 [32– 34]. [score:9]
[1 to 20 of 1 sentences]
39
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
This spatial pattern of expression closely mirrors that of miR-23a, miR-143, and miR-150, all of which putatively target the Hoxa11 mRNA. [score:5]
For instance, among the 66 uniformly expressed miRNAs for which IPA assigned functions, we identified 12 candidates that have been implicated in androgen regulation, including: let-7a-5p, miR-15a-5p, miR-17-5p, miR-19b-3p, miR-23a-3p, miR-24-3p, miR-27b-3p, miR-30a-5p, miR-34a-5p, miR-140-5p, miR-193a-3p, miR-205-5p (S1 Fig). [score:4]
[1 to 20 of 2 sentences]
40
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In addition to miR-23b, miR-30a, and miR-125b, which, as we showed by qRT-PCR and miRNA-Seq, are upregulated by HDI, several other putative Prdm1 targeting miRNAs, including miR-125a, miR-96, miR-351, miR-30c, miR-182, miR-23a, miR-200b, miR-200c, miR-365, let-7, miR-98, and miR-133, were also significantly increased by HDI. [score:6]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
[1 to 20 of 2 sentences]
41
[+] score: 9
Wada S. Kato Y. Okutsu M. Miyaki S. Suzuki K. Yan Z. Schiaffino S. Asahara H. Ushida T. Akimoto T. Translational suppression of atrophic regulators by microRNA-23a integrates resistance to skeletal muscle atrophy J. Biol. [score:6]
miR-23a was recently shown to decrease MAFbx and MuRF1 expression in skeletal muscle [18]. [score:3]
[1 to 20 of 2 sentences]
42
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-2, hsa-let-7c, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-2, hsa-mir-100, hsa-mir-29b-2, mmu-let-7i, mmu-mir-99b, mmu-mir-125a, mmu-mir-130a, mmu-mir-142a, mmu-mir-144, mmu-mir-155, mmu-mir-183, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-148a, mmu-mir-143, hsa-mir-181c, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-298, mmu-mir-34b, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-130a, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-125a, mmu-mir-148a, mmu-mir-196a-1, mmu-let-7a-2, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-mir-15a, mmu-mir-16-1, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, rno-mir-148b, mmu-mir-148b, hsa-mir-200c, hsa-mir-155, mmu-mir-100, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181c, hsa-mir-34b, hsa-mir-99b, hsa-mir-374a, hsa-mir-148b, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7i, rno-mir-21, rno-mir-22, rno-mir-23a, rno-mir-24-2, rno-mir-29b-2, rno-mir-34b, rno-mir-99b, rno-mir-100, rno-mir-124-1, rno-mir-124-2, rno-mir-125a, rno-mir-130a, rno-mir-142, rno-mir-143, rno-mir-144, rno-mir-181c, rno-mir-183, rno-mir-199a, rno-mir-200c, rno-mir-200b, rno-mir-181a-1, rno-mir-298, hsa-mir-193b, hsa-mir-497, hsa-mir-568, hsa-mir-572, hsa-mir-596, hsa-mir-612, rno-mir-664-1, rno-mir-664-2, rno-mir-497, mmu-mir-374b, mmu-mir-497a, mmu-mir-193b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-568, hsa-mir-298, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, hsa-mir-664a, mmu-mir-664, rno-mir-568, hsa-mir-664b, mmu-mir-21b, mmu-mir-21c, rno-mir-155, mmu-mir-142b, mmu-mir-497b, rno-mir-148a, rno-mir-15a, rno-mir-193b
Although there is no evident feature supporting the 5' end of the human pri-miRNA, we identify two ditags, U_168800 and U_1688001, with their 5' tags located at 394 bp upstream of hsa-miR-23a. [score:1]
The predicted TSS in mouse is supported by 3 FANTOM 5'CAGE tags at 7,651 bp from the start of mmu-miR-23a. [score:1]
Figure 4 Consensus display of transcription features mapped in the flanking regions surrounding the cluster mir-23a~27a~24-2 in human, mouse and rat. [score:1]
miR-23a~27a~24-2. miR-124-1. Group II pri-miRNAs. [score:1]
The distances are relative to the 5' end of the miR-23a precursor. [score:1]
Eponine predicts 9 TSSs at an average distance of 7,560 bp and 7,504 bp upstream of the start of the miR-23a in mouse and rat respectively, but none in human. [score:1]
Taken together, these data suggest that the 5' end of the pri-miRNA is ~7500 bp upstream of miR-23a. [score:1]
The human, mouse and rat mir-23a~27a~24-2 features are shown in green, red and blue respectively. [score:1]
[1 to 20 of 8 sentences]
43
[+] score: 8
Remarkably, miR27b was recently shown to inhibit MMP13 expression in IL-1β -treated chondrocytes [21] and miR23a/b could negatively regulate Runx2, a transcription factor involved in chondrocyte terminal differentiation, OA, and osteoblastogenesis [54]. [score:6]
These genes are organized in a cluster including three different miRs (miR-23a or b/27a or b/24). [score:1]
Therefore, miR-24 repression is in vivo always accompanied by that of miR27a/b and miR23a/b (Figure  4A and D). [score:1]
[1 to 20 of 3 sentences]
44
[+] score: 8
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30b, mmu-mir-99a, mmu-mir-126a, mmu-mir-132, mmu-mir-141, mmu-mir-181a-2, mmu-mir-185, mmu-mir-193a, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-34c, mmu-let-7d, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-34a, mmu-mir-200c, mmu-mir-212, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-378a, mmu-mir-451a, mmu-mir-674, mmu-mir-423, mmu-mir-146b, bta-mir-26a-2, bta-let-7f-2, bta-mir-16b, bta-mir-20a, bta-mir-26b, bta-mir-99a, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-193a, bta-let-7d, bta-mir-132, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-423, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-23b, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-34a, bta-mir-141, bta-mir-146b, bta-mir-16a, bta-mir-185, bta-mir-196a-2, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-29b-1, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-2284y-1, mmu-let-7j, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285t, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2284ab, bta-mir-2284ac
Carcinogenesis 64 Lian S, Shi R, Bai T, Liu Y, Miao W, et al (2013) Anti-miRNA-23a Oligonucleotide Suppresses Glioma Cells Growth by Targeting Apoptotic Protease Activating Factor-1. Curr Pharm Des 19: 6382– 6389. [score:5]
Two novel miRNA displayed significant homology to those known in the species (mmu-3_28325-3p to mmu-miR-23a-3p and bta-16_10094-5p to bta-miR-2284j). [score:1]
Moreover, miR-23a has been described as being involved in the processes of EMT [63] or apoptosis [64]. [score:1]
Among the 24 common miRNA, seven other miRNA (miR-16-5p, miR-23a-3p, miR-126-5p, miR-126-3p, and three members of the miR-200 family (miR-200a-3p, miR-200b-3p, miR-200c-3p)) were mainly detected in the top 30 of different epithelial tissues, such as kidney, lung or endometrium (Table S4, Figure S2), suggesting that they could be involved in physiological processes linked to epithelial cell functions. [score:1]
[1 to 20 of 4 sentences]
45
[+] score: 8
Other miRNAs from this paper: mmu-mir-24-2, mmu-mir-27a
Moreover, downregulation of miR-27a was also paralleled by decreased luciferase activity in R KO cells transfected with a construct (pmiR-27a-luc) containing the -639 to +36 region of the promoter for the miR-23a-miR-27a-miR-24-2 [41] cluster (Figure 5B). [score:4]
BA also decreased luciferase activity in R KO cells transfected with a construct containing the -639 to +39 region of the miR-27a promoter, and we are currently examining the mechanisms associated with ROS -dependent effects on critical transcription factors interacting with the promoter and also the functional significance of ROS -dependent downregulation of miR-23a and miR-24-2 which form part of the miR-23a-miR-27a-miR24-2 cluster. [score:4]
[1 to 20 of 2 sentences]
46
[+] score: 8
Other miRNAs from this paper: mmu-mir-23b, mmu-mir-155
For both target sequences, the following series of shRNAs were created for comparison: N19 – a simple stem-loop design [2], F – a 'frayed' shRNA design employing artificial asymmetry [28], and mi23 – a shRNA utilizing the miR23 loop reported to increase cytoplasmic expression [29, 30]. [score:5]
While we noticed a modest increase in knockdown efficiency by the addition of the miR23 loop at a 10:1 ratio of shRNA to pGL3-MELK, there was no significant increase in efficacy with the miR23 loop at lower molar ratios of shRNA to pGL3-MELK (data not shown) as had been previously reported [30]. [score:2]
As there did not appear to be a reproducible improvement with modified shRNAs (F or miR23), we have utilized a N19 shRNA design for the remainder of this study. [score:1]
[1 to 20 of 3 sentences]
47
[+] score: 8
For example, the fluoxetine induced up-regulation of let-7 family (let-7c/d/f/k) and miR-23a/b have been shown to have high risk of temporal lobe epilepsy [50]. [score:4]
Song Y. J. Tian X. B. Zhang S. Zhang Y. X. Li X. Li D. Cheng Y. Zhang J. N. Kang C. S. Zhao W. Temporal lobe epilepsy induces differential expression of hippocampal miRNAs including let-7e and miR-23a/bBrain Res. [score:3]
The well-studied miRNAs within this group included let-7 family (let-7c/d/f/k), miR-212 cluster (miR-212-3p and miR-132-3p/5p), miR-23a/b, miR-9-3p/5p, miR-411 clusters (miR-299a and miR-329) and miR-466 clusters (miR-466m-5p and miR-669f-5p) (Figure 2 and Table 1). [score:1]
[1 to 20 of 3 sentences]
48
[+] score: 7
Other miRNAs from this paper: hsa-mir-23a
72, 89 Tumor-derived TGF- β directly suppressed CTL effector function by elevating miR-23a and downregulating Blimp-1, a key transcription factor involved in T-cell differentiation. [score:7]
[1 to 20 of 1 sentences]
49
[+] score: 7
We analyzed by Q-PCR the expression of three miRNAs (miR-24, miR-23a and miR-29b) known to be expressed in thyroid epithelial cells [20]. [score:5]
Dicer-amplifying primers positions are shown in A. (C) Q-PCR analysis of mature miR-24, miR-23a, miR-29b relative expression in mice thyroids. [score:2]
[1 to 20 of 2 sentences]
50
[+] score: 7
Huang S He X Ding J Liang L Zhao Y Zhang Z Upregulation of miR-23a ~ 27a ~ 24 decreases transforming growth factor-beta -induced tumor-suppressive activities in human hepatocellular carcinoma cellsInt J Cancer. [score:6]
Among them, miR-122, miR-21, miR-155, miR-23a, miR-143, whose target genes have been characterized in both NAFLD (i. e. PPARα, PTEN C/EBPβ, ORP8, G6PC) and HCC (i. e. CCNG1, IGF-1R, ADAM17, PTEN, SOCS1, C/EBPβ, FNDC3B) [14]. [score:1]
[1 to 20 of 2 sentences]
51
[+] score: 7
The comparison between control- and MPA -treated cells revealed that 16 miRNAs were significantly modulated by more than two-fold (P < 0.05, Figure 1A), nine miRNAs were upregulated (miR-191*, miR-17*, miR- 470*, miR-451, miR-702, miR-434-3p, miR-493, miR-23a* and miR-485*) and seven were downregulated (miR-378*, miR-376a, miR-224, miR-190b, miR-16, miR-410 and miR-197) (Figure 1B). [score:7]
[1 to 20 of 1 sentences]
52
[+] score: 7
Figure 2B displays discrepancies between the miRNA array and RT-qPCR data, showing that only 3 down-regulated miRNAs (miR-150, miR-28 and miR-151-5p) and 8 upregulated miRNAs (miR-let-7e, miR-103, miR-107, miR-27a, miR-23a, miR-21, miR-155 and miR-146a) showed similar trends in altered miRNA levels. [score:7]
[1 to 20 of 1 sentences]
53
[+] score: 6
No sign of hemolysis was detected in the samples as attested by dCq (miR-23a - miR-451) (Fig.   S7B), and the unchanged expression levels of let-7d-3p mmu-miR-21a-5p, two miRNAs that were not identified as colitis -associated, ruled out the possibility of a global circulating miRNA reduction due to anti-TNFα therapy (Fig.   S7C and D). [score:3]
Hemolysis was detected using the ratio of miR-451a (a miRNA highly expressed in red blood cells) to miR-23a-3p (a microRNA unaffected by hemolysis) a sensitive indicator detecting down to 0.001% hemolysis in serum [32]. [score:3]
[1 to 20 of 2 sentences]
54
[+] score: 6
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Another report demonstrates that miR-23 facilitates OL development by negatively regulating lamin B1 (LMNB1), a protein found to repress production of MBP, proteolipid protein 1 (PLP), and myelin oligodendrocyte glycoprotein (MOG) [19]. [score:3]
Expression data from our microarray results show high levels of miR-23a throughout the GP to OL stages. [score:3]
[1 to 20 of 2 sentences]
55
[+] score: 6
Nine miRNAs (miR-148a-3p, miR-183a-5p, miR-214-3p, miR-27a-3p, miR-92a-3p, miR-378a-3p, miR-23a-3p, miR-21a-5p and miR-16-5p) were upregulated, and four (miR-155-5p, miR-199a-3p, miR-320-3p and miR-125a-5p) were downregulated in exosomes from RANKL -induced RAW 264.7 cells compared with RAW 264.7 cells (Figure 1f and Supplementary Figure S1d). [score:6]
[1 to 20 of 1 sentences]
56
[+] score: 6
For experimental confirmation of the expression pattern based on microarray testing, Q-PCR was performed for some genes (ABCC4 from temporal up-pattern, CYP3A11 from temporal down-pattern, and FOXA1 from non-pattern) and microRNAs (miR-23a-3p and miR-466b-3p). [score:3]
CYP3A11 was specifically the target of miR-23a-3p (Table  1). [score:3]
[1 to 20 of 2 sentences]
57
[+] score: 6
Microarray analysis showed altered expression of some miRNAs in hepatomas such as let-7a, miR-21, miR-23, miR-130, whereas the hepato-specific miR-122a and others were found downregulated in 70% of HCCs and in HCC-derived cell lines [20], [46], [47], as reported in our data (Table 1). [score:6]
[1 to 20 of 1 sentences]
58
[+] score: 6
miR-299, miR-182, miR-23a and miR-125b are representative of varying degrees of differential expression in the array. [score:3]
Four additional miRNAs, miR-299, miR-182, miR-23a and miR-125b, representing varying degrees of differential expression were validated using. [score:3]
[1 to 20 of 2 sentences]
59
[+] score: 5
Venn analyses revealed sixteen differentially expressed miRNAs in wildtype primary mesenchymal cells that were treated with dexamethasone (Fig. 1A), of which eleven were up regulated (let-7 family, miR-125b, miR-146a, miR-148a + b, miR-152, miR-423) (Table S1) and five were down regulated (miR-1724a, miR-23a+b, miR-24-1,-2, miR-29a) (Table S1). [score:5]
[1 to 20 of 1 sentences]
60
[+] score: 5
The miRNA expression profiles were normalized either to reference gene U6 (snRNA) or to the average obtained between miR-23a, miR-23b, and miR-24, whose expression levels are stable under the experimental conditions applied in this study. [score:5]
[1 to 20 of 1 sentences]
61
[+] score: 5
ZNF91 belongs to a C [2]H [2] zinc finger (ZNF) gene family that is greatly expanded in the primate lineage and known to contain exceptionally abundant target sites for several miRNA families, including miR-23, miR-181 and miR-199 [28]. [score:3]
In particular, a circRNA generated from the ZNF91 locus (circRNA-ZNF91) contains 24 miR-23 sites (Figure  6E), 19 of which were 8-nucleotide sites. [score:1]
miR-23 and miR-296 seed matches are indicated. [score:1]
[1 to 20 of 3 sentences]
62
[+] score: 5
Other miRNAs from this paper: mmu-mir-15a, mmu-mir-16-1, mmu-mir-486a, mmu-mir-486b
The induction of HbF can be obtained by using low molecular weight drugs causing the induction of the γ-globin gene (6– 8, 14– 17), artificial promoters (18, 19), decoy molecules targeting transcription factors involved in the transcriptional repression of γ-globin genes (MYB, KLF-1 and BCL-11A) (20, 21), or microRNAs targeting mRNAs coding for these repressors (data are available for microRNAs miR-15a, miR-16-1, miR-486-3p and miR-23a/27a) (22– 24). [score:5]
[1 to 20 of 1 sentences]
63
[+] score: 5
Genes implicated in Toll-like receptors signaling such as GSK3B (a glycogen synthase kinase), SOCS3 (a suppressor of cytokine signalling-3) and ATF2 (an activating transcription factor) were defined as targets of modulated miRNAs during all time-course of the mouse mo del of asthma, respectively mmu-miR-23a, -23b, -26b, -29b, -29c, -155 and -214 for Gsk3b; mmu-miR30b, -30c, -30d, -152, -203, -207, -218 and -455 for Atf2; mmu-miR30b, -30c, -30d, -152, -203, -207, -218 and -455 for Socs3. [score:5]
[1 to 20 of 1 sentences]
64
[+] score: 5
NFATs may also control genes encoding signaling molecules as variate as Ca [2+] regulators [inositol 1,4,5-trisphosphate (IP [3]) receptor (IP [3]R), regulator of calcineurin 1 (RCAN1)], growth factors (VEGF, neurotrophins), myelination genes (P0 and Krox-20), glucose regulation genes (insulin, HNF1, PDX, and GLUT2), cell cycle and death regulator/activators [p21 [Waf1], c-Myc, cyclin -dependent kinase 4 (CDK4), B-cell lymphoma 2 (Bcl-2), and cyclins A2, D1, and D2], oncogenes (Wnt, β-catenin), microRNAs (miR-21, miR-23, miR-24, miR-27, miR-125, miR-195, miR-199, and miR-224), and surfactants (sftpa, sftpb, sftpc, and abca3) [9, 65– 74]. [score:5]
[1 to 20 of 1 sentences]
65
[+] score: 5
Cold Inducible RNA binding protein is involved in chronic hypoxia induced neuron apoptosis by down -regulating HIF-1α expression and regulated By microRNA-23a. [score:5]
[1 to 20 of 1 sentences]
66
[+] score: 5
The mirn23a gene codes for three miRNAs, miR-23a, miR-27a, and miR-24–2, which is expressed as a pri-miRNA from its own independent transcription unit. [score:3]
B) The mirn23a miRNAs, miR-23a, 24–2, and 27a are clustered on mouse chromosome 8 and transcribed from an independent transcription unit. [score:1]
Q-RT-PCR was performed with RNA extracted from the isolated fractions to examine the relative levels of mature mirn23a/ mirn23b miRNAs: miR-24, mir-23a, miR23b, miR-27a, and miR-27b (Fig. 7B, 7C). [score:1]
[1 to 20 of 3 sentences]
67
[+] score: 5
Further support for Smad3 regulation of miR-27 is seen in published work from Sun et al, which revealed the presence of a Smad binding element in the miR-24-2/miR-23a/miR-27a cluster upstream regulatory sequence and that the Smad binding site was critical for TGF-β1 -mediated inhibition of miR-24-2/miR-23a/miR-27a [31]. [score:5]
[1 to 20 of 1 sentences]
68
[+] score: 5
Several evolutionarily conserved and functionally significant miRNAs, such as miRNA-150, miRNA-21, miRNA-29a and miRNA-23a, were also detected in serum samples [25], [26], [27], [28], [29]. [score:1]
B: Counts from a non-responsive molecule miRNA-23a, comparable to that of miRNA-150 in control animals. [score:1]
miRNA-23a, whose counts in controls are comparable to that of miRNA-150 was used as another control (Figure 5B). [score:1]
These include miRNA-25, miRNA-106b, let-7g and miRNA-93 (Figure 3), while the level of miRNA-23a was not increased in samples with higher levels of hemolysis. [score:1]
B: Counts from a non-responsive molecule miRNA-23a (control). [score:1]
[1 to 20 of 5 sentences]
69
[+] score: 4
Other miRNAs from this paper: mmu-mir-208a
Qi R. Wang Q. Wang J. Huang J. Jiang S. Xiao R. Liu Z. Yang F. Expression Pattern and Regulatory Role of microRNA-23a in Conjugated Linoleic Acids-Induced Apoptosis of Adipocytes Cell. [score:4]
[1 to 20 of 1 sentences]
70
[+] score: 4
Recently, some specific miRNAs, such as miR-9, miR-23, and miR-29a, were found to participate in the regulation of oligodendrocyte differentiation and myelin maintenance, as well as in the pathogenesis of demyelination-related diseases. [score:4]
[1 to 20 of 1 sentences]
71
[+] score: 4
In addition, upregulation of mir-26a, mir-29a and mir-23a (Boon et al., 2011; Dellago et al., 2013) has been reported in aging mice and humans. [score:4]
[1 to 20 of 1 sentences]
72
[+] score: 4
Similarly, miR-23–miR-27–miR-24 cluster overexpression impairs TGF-β -mediated Treg induction (42). [score:3]
Moreover, miRNA (miR-31, miR-17–miR-92, and miR-23–miR-27–miR-24) antagomir treatment of T cells in vitro may be exploited to support iTreg generation, while in vivo treatment may foster pTreg generation. [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 4
Other miRNAs from this paper: mmu-mir-182
Pressure overload and hypertrophic GPCR agonists are known to downregulate Foxo3 through the action of miR-23a 28. [score:4]
[1 to 20 of 1 sentences]
74
[+] score: 4
Downregulated miRs that are identified as putative hubs but that are not DE by the filtering criteria (miR-mmu-let-7a-5p, mmu-miR-23a-5p, mmu-miR-23a-3p, mmu-miR-205-5p) are also depicted as gray oblongs. [score:4]
[1 to 20 of 1 sentences]
75
[+] score: 3
Expression levels of five miRNAs [miR-23a (−1.52), miR-23b (−1.58), miR-34 (−1.78), miR-214 (−2.31), and miR-322 (−2.31)] were shown to be significantly decreased in Cmah -null mouse-derived livers by Liver miFinder microRNA PCR array analysis (Figure 3(d)). [score:3]
[1 to 20 of 1 sentences]
76
[+] score: 3
Fifteen miRNAs were highly expressed in both liver and brain: miR-709, let-7a, let-7f, let-7c, let-7d, miR-26a, let-7b, let-7g, miR-26b, miR-29a, miR-126-3p, miR-23b, miR-30c, miR-16, and miR-23a. [score:3]
[1 to 20 of 1 sentences]
77
[+] score: 3
Conversely, microRNA-23a overexpression protects adult muscle tissue from atrophy (Wada et al. 2011). [score:3]
[1 to 20 of 1 sentences]
78
[+] score: 3
Other miRNAs from this paper: mmu-mir-203, mmu-mir-143
Wang L. Chen X. Zheng Y. Li F. Lu Z. Chen C. Liu J. Wang Y. Peng Y. Shen Z. MiR-23a inhibits myogenic differentiation through down regulation of fast myosin heavy chain isoformsExp. [score:3]
[1 to 20 of 1 sentences]
79
[+] score: 3
Other miRNAs from this paper: hsa-mir-23a
Zhang et al. found that miR-23a-regulated autophagy is a novel and important regulator of UV -induced premature senescence [9]. [score:3]
[1 to 20 of 1 sentences]
80
[+] score: 3
Other miRNAs from this paper: mmu-mir-23b
Dependence of cancer cells on exogenous Gln is driven by Myc protein, which suppresses miR-23a and miR-23b, leading to the induction of glutaminase (GLS) [15]. [score:3]
[1 to 20 of 1 sentences]
81
[+] score: 3
Komatsu S Plasma microRNA profiles: identification of miR-23a as a novel biomarker for chemoresistance in esophageal squamous cell carcinomaOncotarget 2016 42. [score:3]
[1 to 20 of 1 sentences]
82
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-18a, hsa-mir-21, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-30a, mmu-mir-99a, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-138-2, hsa-mir-192, mmu-mir-204, mmu-mir-122, hsa-mir-204, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-138-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-26a-1, mmu-mir-103-1, mmu-mir-103-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-26a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-26a-2, hsa-mir-376c, hsa-mir-381, mmu-mir-381, mmu-mir-133a-2, rno-let-7a-1, rno-let-7a-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-18a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-26a, rno-mir-30a, rno-mir-99a, rno-mir-103-2, rno-mir-103-1, rno-mir-122, rno-mir-126a, rno-mir-133a, rno-mir-138-2, rno-mir-138-1, rno-mir-192, rno-mir-204, mmu-mir-411, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-193b, rno-mir-1, mmu-mir-376c, rno-mir-376c, rno-mir-381, hsa-mir-574, hsa-mir-652, hsa-mir-411, bta-mir-26a-2, bta-mir-103-1, bta-mir-16b, bta-mir-18a, bta-mir-21, bta-mir-99a, bta-mir-126, mmu-mir-652, bta-mir-138-2, bta-mir-192, bta-mir-23a, bta-mir-30a, bta-let-7a-1, bta-mir-122, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-204, mmu-mir-193b, mmu-mir-574, rno-mir-411, rno-mir-652, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-1-2, bta-mir-1-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-138-1, bta-mir-193b, bta-mir-26a-1, bta-mir-381, bta-mir-411a, bta-mir-451, bta-mir-9-1, bta-mir-9-2, bta-mir-376c, bta-mir-1388, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-451b, bta-mir-574, bta-mir-652, mmu-mir-21b, mmu-mir-21c, mmu-mir-451b, bta-mir-411b, bta-mir-411c, mmu-mir-126b, rno-mir-193b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The five most abundant miRNAs across the 11 tissues were miR-23a, -23b, -99a, -125b and -126-5p, accounting for 44.3% of all small RNA sequences (Additional file 3). [score:1]
Five miRNAs (miR-23a, -23b, -99a, -125b and -126-5p) were very abundant across the 11 tissues, accounting for 44.3% of all small RNA sequences. [score:1]
We argue that there must be additional important factors other than internal stability to determine which arm of the miRNA precursor becomes the mature miRNA or miRNA* since the following observations can not be explained: (1) Most miRNAs observed in this study had a variant of isoforms generated by Dicer and a few of the 5' end variants even processed by Drosha (e. g., four bta-miR-23a variants had an additional A nucleotide at the 5' end, Additional file 3). [score:1]
[1 to 20 of 3 sentences]
83
[+] score: 3
Mir-23a regulation of x-linked inhibitor of apoptosis (xiap) contributes to sex differences in the response to cerebral ischemia. [score:3]
[1 to 20 of 1 sentences]
84
[+] score: 3
It has been demonstrated that when dystrophin synthesis was restored the levels of miR-1, miR-133a, miR-29c, miR-30c, and miR-206 increased, while miR-23a expression did not change (Cacchiarelli et al., 2010). [score:3]
[1 to 20 of 1 sentences]
85
[+] score: 3
Among these miRNAs, four miRNAs, including miR-23a, miR-326, miR-346_MM 1 and miR-370, were further significantly downregulated by ischemic preconditioning compared with the levels in non-preconditioned controls. [score:3]
[1 to 20 of 1 sentences]
86
[+] score: 3
Other miRNAs from this paper: mmu-mir-23b
c-MYC, which is known to stimulate cell proliferation, transcriptionally represses miR-23a and miR-23b, which are repressors of GLS1 expression. [score:3]
[1 to 20 of 1 sentences]
87
[+] score: 3
miR-23a, which is expressed in all the lines, was analyzed as a control (*, p<0.001; **, p<0.002; #, p<0.04). [score:3]
[1 to 20 of 1 sentences]
88
[+] score: 3
One that is expressed in red blood cells (miRNA-451), and one that is relatively stable in serum and plasma and not affected by hemolysis (miRNA-23a). [score:3]
[1 to 20 of 1 sentences]
89
[+] score: 3
For example, hsa-mir-155 and hsa-mir-23a (that were robustly expressed in previous studies [23] and in deep sequencing datasets) were undetectable in all samples in version 2.0 plates. [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 3
Another eight constitutive miRNAs (let-7d-5p, let-7f-5p, miR-23a-3p, miR-26a-5p, miR-30a-3p, miR-3od-5p, miR-191-5p, and miR-192-5p), which showed homogeneous expression in the microarray analysis were used for normalization. [score:3]
[1 to 20 of 1 sentences]
91
[+] score: 3
In addition, accumulating evidence suggests that the aberrant expressions of miRNAs, such as miR-1, miR-133, miR-23a, miR-206, miR-27, miR-628, miR-431 and miR-21 (refs 17, 18, 19, 20, 21, 22, 23, 24), contribute to muscle atrophy. [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
For example, miRNA-21, miRNA-23a, miRNA-24, miRNA-133, miRNA-208/miRNA-195 and miRNA-199 have been shown to be involved in cardiac hypertrophy (15- 17), miRNA-1 in arrhythmia (18), miRNA-29 and miRNA-21 in cardiac fibrosis (19, 20), miRNA-210 and miRNA-494 in ischemic heart disease (21) and miRNA-129 in heart failure (22). [score:3]
[1 to 20 of 1 sentences]
93
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-217, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-34a, mmu-mir-98, mmu-mir-322, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-18b, hsa-mir-503, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, hsa-mir-744, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
A previous study showed that runx2 is a target of miR-30c, miR-135a, miR-204, miR-133a, miR-217, miR-205, miR-34, miR-23a and miR-338 [34]. [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
Other miRNAs from this paper: mmu-mir-23b, mmu-mir-27b, mmu-mir-27a
In agreement, simultaneous knockdown of miR-23 and miR-27b in the miR-23/27/24 cluster attenuated neonatal retinal angiogenesis as well as laser -induced choroidal neovascularization [28]. [score:2]
There are similar findings regarding other members of the miR-23/27/24 cluster distinct from miR-27b [57]. [score:1]
[1 to 20 of 2 sentences]
95
[+] score: 3
Other miRNAs from this paper: hsa-mir-23a, mmu-mir-23b, hsa-mir-23b, hsa-mir-23c
LMNB1 is negatively regulated by miR-23, which is also implicated in ADLD variants and it has been proposed that an over representation of lamin B1 mRNA sequesters miR-23 leading to disturbances in myelin protein production [60,66]. [score:2]
Future studies should focus on lamin B1 interactions (e. g. with miR-23) which will form the basis of understand the pathways that do depend on these lamins. [score:1]
[1 to 20 of 2 sentences]
96
[+] score: 3
Indeed, we also found that EVs contain miRs known to act in the modulation of VEGF levels (miR-16.1, -93), VEGF receptors (miR-16.1), as well as both positive and negative regulators of the VEGF signal transduction cascade (miR-23a, -27a, -221, -322 and -145) [21]. [score:2]
EVs contained miRNAs that specifically modulate VEGF/VEGFRs signaling [21] including miR-16.1, miR-23a, miR-27a, miR-93, miR-221, miR-145 and miR-322 [Suppl. [score:1]
[1 to 20 of 2 sentences]
97
[+] score: 3
Hassan et al. demonstrated that RUNX2 induced the expression of miR-23a/27a/24-2, which in turn acted as a negative feedback factor to hamper RUNX2 activity [10]. [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
We found that miRNAs with higher expression in WBCs includes different miRNA families: mir-15, mir-17, mir-181, mir-23, mir-27 and mir-29 families. [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
Among these 77 dysregulated miRs, we identified 12 altered miRNAs that were 1.5 fold regulated by DMCs and average intensity >100, including miR-23a-3p, miR-3069-5p, miR-26a-5p, miR-142-3p, miR-21a-5p, miR-223-3p, miR-16-5p, miR-22-3p, let-7g-5p, let-7b-5p, miR-878-3p, miR-489-3p. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 2
sham rat) Peers' studies hsa-miR-34a-3p 2.63 upUp, Jess Morhayim[15] hsa-miR-433-3p 1.24 up This study hsa-miR-106b 2.24 up This study hsa-miR-23a 0.48 downDown, Sylvia Weilner[27] hsa-miR-328-3p 0.38 down Down, Sylvia Weilner hsa-miR-29b-3p 2.1 up Up, Jess Morhayim hsa-miR-146a-5p 2.68 up Up, Jess Morhayim hsa-miR-148a-3p 1.85 upUp, Cheng[28] We noted that DKK1 played important role in the development of osteoporosis. [score:2]
[1 to 20 of 1 sentences]