sort by

17 publications mentioning rno-mir-338

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-338. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 171
Other miRNAs from this paper: rno-mir-346, rno-mir-208a
A detailed survey of miR-338-5p targets using the in silico TargetScan tool reveals that this miRNA has number of transcription regulators (such as SP3, and SP2 transcription factors) as putative targets, which could be modulated in their expression and subsequent function upon miR-338-5p overexpression, resulting in altered AATK mRNA transcription. [score:12]
To examine whether the onset of miR-338 expression in hippocampal neurons in culture was correlated with the expression of AATK, the expression levels of the pre- and mature miR-338 strands, as well as AATK during in vitro differentiation of these neurons were investigated. [score:5]
The outcome of these studies indicate that while overexpression of miR-338-5p may have modest, although not significant, effects on AATK mRNA levels, most pronounced reduction of the host gene mRNA levels is observed following the overexpression of miR-338-3p in B35 cells. [score:5]
To assess whether miR-338 can specifically target AATK mRNAs, B35 cells were co -transfected with the miR-338 expression vector and a luciferase reporter plasmid containing the rat AATK 3′UTR. [score:5]
The data represents relative fold change in AATK and miR-338 expression levels to DIV 0. Previous reports have demonstrated that retinoic acid -mediated neuronal differentiation of human neuroblastoma cells results in the synchronized induction of expression levels of miR-338-3p and its host gene AATK [9]. [score:5]
The data represents relative fold change in AATK and miR-338 expression levels to DIV 0. Since previous studies have also demonstrated a role for AATK in stimulating neuronal differentiation [19], we here monitored the gene expression changes of precursor (pre-) and mature miR-338 strands and their host gene (AATK) during the first 21 days in vitro (DIV) neuronal differentiation. [score:5]
The presence of the miR-338 expression vector significantly reduced luciferase activity by 15% in B35 cells as compared to null-vector co -transfected neurons, indicating that 3′UTR of AATK mRNA is targeted by miR-338 (Figure 3C). [score:4]
Follow-up bioinformatic surveys identified that the 3′UTR of rat AATK mRNA contains two putative binding sites for miR-338-3p, suggesting that this miRNA may regulate the expression of its host gene during neuronal differentiation or degeneration. [score:4]
To explore whether miR-338 regulates AATK mRNA levels in neurons, AATK mRNA levels were monitored after transfecting rat B35 neuroblastoma cells with a miR-338 expression vector. [score:4]
In addition, miR-338-3p is enriched in distal axons, where it modulates mitochondrial function, and consequently oxygen dependent metabolic pathways in sympathetic neurons by regulating the expression levels of cytochrome c oxidase, subunit IV [17], [18]. [score:4]
The miRNASelect pEGP-mmu-mir-338 and its corresponding negative control vector pEFP-mir -null expression vectors were commercially obtained from Cell Biolabs (San Diego). [score:3]
AATK Is a Target of miR-338 in Neurons. [score:3]
The double-stranded RNA that mimics endogenous rat miR-338-3p [UCCAGCAUCAGUGAUUUUGUUGA], rat miR-338-5p [AACAAUAUCCUGGUGCUG AGUG], and miR-NT, used as a non -targeting control, were obtained from Qiagen. [score:3]
Moreover, the 3′UTR of human AATK mRNA contained a conserved sequence complementary to the seed target region of miR-338-3p (Figure 2). [score:3]
To initially explore this postulate, the TargetScan algorithm [21], [22] was used to search for miR-338 binding sites in the 3′UTR of AATK mRNA. [score:3]
Pre-miR-338 levels are visualized on 4% agarose gels containing ethidium bromide using UV absorption (254 nm wavelength), and pre-miR-338 band intensities are expressed relative to U6 snRNA. [score:3]
Mature miR-338 levels are expressed relative to U6 snRNA, whereas AATK levels are normalized to the levels of β-actin. [score:3]
Previous reports have demonstrated that retinoic acid -mediated neuronal differentiation of human neuroblastoma cells results in the synchronized induction of expression levels of miR-338-3p and its host gene AATK [9]. [score:3]
Thus, miR-338 mediated fine-tuning of AATK expression levels during the onset of neuronal differentiation and apoptosis may be an important physiological mechanism to control differentiation and the number of neurons. [score:3]
In contrast, luciferase levels did not change significantly when the miR-338-5p mimic was co -transfected with this reporter plasmid, indicating that rat AATK mRNA is specifically targeted by miR-338-3p. [score:3]
To evaluate whether the expression of miR-338 and AATK mRNA is functionally related, the possibility that miR-338 has the capacity to regulate AATK mRNA expression was considered. [score:3]
This ribonucleoprotein complex targets cis-acting binding sites for miR-338-3p (red blocks) located on the 3′UTR of AATK mRNA, resulting in the degradation of the transcript (orange block). [score:3]
Furthermore qRT-PCR assessment of miR-338-3p levels, expressed relative to U6 snRNA following pmiR-338 overexression versus the null condition. [score:3]
0031022.g002 Figure 2An overview of in silico identified putative miR-338 target sites within the AATK 3′UTR. [score:3]
Both AATK and miR-338 are highly conserved genes, and prominently expressed within the vertebrate central nervous system (CNS) [12], [15]. [score:3]
Here we propose a mo del, in which one of the two complementary versions of mature miR-338, namely miR-338-3p, generated through splicing and Dicer -mediated maturation, has the capacity to modulate the expression level of its host gene AATK in rat neuroblastoma cell lines (Figure 5). [score:3]
Profiling miR-338 and AATK Expression in Hippocampal Neurons during Differentiation in vitro. [score:3]
An overview of in silico identified putative miR-338 target sites within the AATK 3′UTR. [score:3]
The Targetscan algorithm [33] was used to interrogate the 3′UTR sequence of AATK mRNA for putative binding sites of miR-338. [score:3]
Despite the lack of a cis-acting binding site for miR-338-5p in rat AATK mRNA, our studies indicate that overexpression of this mature miRNA resulted in a modest reduction of host gene mRNA levels in rat neuroblastoma cell lines. [score:3]
B35 Cells were co -transfected with luciferase encoding the 3′UTR of rat AATK (indicated as 3′AATK) and either miR-338-3p, miR-338-5p mimics, or with miR-NT serving as non -targeting control ribo-oligonucleotides. [score:3]
Although both miR-338 and AATK are known to be specifically expressed in neuronal tissue [15], [19], [20], little is known about their relative abundance during neuronal maturation and neurite outgrowth. [score:3]
Transfection of miR-338-3p and-5p resulted in an approximately hundredfold increase in mature miR-338 levels, as compared to the endogenous miR-338 levels in non-target miRNA (miR-NT) -transfected neuroblastoma cells (Figure 4A). [score:2]
The outcome of this experiment strongly suggests that the AATK mRNA levels and the levels of the (pre,-3p,-5p) miR-338 in rat hippocampal neurons are not coordinately regulated. [score:2]
MiR-338 is encoded within the AATK gene and is expressed during maturation of hippocampal neurons. [score:2]
Conversely, overexpression of miR-338-5p did not alter AATK levels significantly, as compared to the AATK mRNA levels of miR-NT transfected control samples. [score:2]
In miR-338 overexpressing cells, AATK mRNA levels decreased by 30% when compared with null-vector -transfected neurons (Figure 3B). [score:2]
In the current study, gene expression analysis was combined with luciferase -based gene activity assay, to further examine the functional association of miR-338-3p and miR-338-5p in relation to their host gene. [score:2]
In conclusion, the current investigations have determined the expression pattern of miR-338 and its host gene AATK during in vitro differentiation of primary hippocampal neurons and assessed the possible regulation of AATK by miR-338-3p. [score:2]
Regulation of AATK by mature miR-338 Strands. [score:2]
MiR-338 targets AATK. [score:2]
Proposed mo del of AATK regulation by its intronic miR-338. [score:2]
In rat hippocampal neurons, the expression levels for pre-, and mature miR-338 strands remained at significantly lower levels as compared to AATK mRNA levels. [score:2]
This notion is further supported by our observation that luciferase activity upon miR-338-5p introduction remained unchanged, suggesting that miR-338-5p lacks the capacity to directly modulate AATK levels through interacting with its 3′UTR. [score:2]
However, in some cases such as for miR-338, both strands (5p and 3p) are selected, and can function as post-transriptional repressors [14]. [score:1]
Little is known about the role of miR-338 in maintaining neuronal function. [score:1]
Similar to many intronic miRNAs, miR-338 lacks its own promoter and is therefore processed out of its intronic sequence [27], [28]. [score:1]
Subsequent splicing generates the miR-338 precursor hairpin followed by Dicer -mediated maturation, leading to the incorporation of the mature miR-338-3p strand into the RISC complex. [score:1]
Collectively, these results suggest that miR-338-3p has the capacity to modulate rat AATK mRNA levels. [score:1]
To specifically delineate the contribution of mature miR-338-3p, or miR-338-5p in reducing AATK mRNA levels, we individually lipofected double-stranded miR-338-3p and miR-338-5p mimics into B35 cells. [score:1]
0031022.g003 Figure 3(A) Pre-miR-338, and miR-338-3p levels in B35 cells (transfected with pmiR-338 or pmiR -null plasmids) were quantified following PCR. [score:1]
A recent paper has suggested that miR-338 is involved in the control of neuroblast apoptosis and in neuroblastoma pathogenesis [25]. [score:1]
0031022.g001 Figure 1(A) A schematic overview of rat miR-338 encoded within the seventh intron (depicted in blue) of the AATK gene located on chromosome 11, with the exons shown in red. [score:1]
Afterwards until DIV10, miR-338-3p expression levels decreased slightly, and remained at a relatively low level throughout the differentiation period (measured up until DIV 21). [score:1]
To further substantiate this finding, we co -transfected B35 cells with the luciferase reporter plasmid containing the AATK 3′UTR combined with either miR-338-3p, or with miR-338-5p. [score:1]
The miR-338 seed sequence is indicated in red. [score:1]
In addition, pre-miR-338 levels increased slightly within the first day in culture, followed by gradually decreased levels between DIV 3 and DIV 14, when pre-miR levels resumed to DIV 1 levels. [score:1]
The depicted genes are Rattus norvegicus AATK (rno-AATK) and miR-338 (rno-miR-338). [score:1]
Transcription, splicing and further processing will produce mature miR-338-3p and miR-338-5p from the seventh intron of the AATK gene (Figure 1A). [score:1]
This in silicio analysis identified two 7-mer binding sequences within the 3′UTR of rat AATK mRNA which have the potential to function as a putative binding site for miR-338-3p (Figure 2). [score:1]
MiR-338-3p -dependent regulation of AATK mRNA would thus offer a mechanism to control availability of this neuronal mRNA during neuronal differentiation and degeneration. [score:1]
This investigation revealed an uncorrelated expression pattern of the intronic miR-338-3p, and-5p with their host gene. [score:1]
This outcome is in agreement with bioinformatics analyses shown in Figure 2, in which the miR-338-5p binding site is restricted to the 3′UTR of the mouse homologue of AATK mRNA, and is very poorly conserved evolutionary. [score:1]
While the levels of miR-338-5p, continuously elevated within the assessment period (ten-fold until DIV 21), miR-338-3p levels increased only during early neuronal differentiation (fifteen-fold until DIV 6). [score:1]
As shown in Figure 4B, in miR-338-3p transfected cells a significant reduction of AATK mRNA levels was achieved. [score:1]
Transfection of DNA constructs and miR-338 mimics. [score:1]
The initial results derived from B35 cells transfected with the miR-338 vector suggest that miR-338 has the capacity to modulate AATK mRNA levels. [score:1]
Real-time PCR was performed with 1/10 diluted cDNA using the Maxima SYBR Green/ROX qPCR master mix (Fermentas) or the miScript SYBR green PCR kit (Qiagen) for detection of mature miR-338 (-3p, and-5p). [score:1]
Furthermore, the 3′UTR of mouse AATK mRNA was found to contain two putative cis-acting binding sites for miR-338-3p, and one putative binding site for miR-338-5p. [score:1]
The precursor miR-338 sequence is intronically encoded within the Apoptosis -associated Tyrosine Kinase (AATK, also known as AATYK) host gene [9]. [score:1]
For detection of mature miR-338 (-3p, and-5p), the miScript reverse transcription kit (Qiagen) was utilized. [score:1]
Recent studies have indicated a role for miR-338-3p in oligodendrocyte differentiation and maturation [16]. [score:1]
[1 to 20 of 72 sentences]
2
[+] score: 154
Other miRNAs from this paper: rno-mir-93, rno-mir-146a
Researches show that miR-338 expression was down-regulated in liver cancer and oral squamous cell carcinoma, and this reduced level of miR-338 was closely related to malignant activities like cancer metastasis that can cause BCP [25– 27]; thus we can infer that miR-338 expression may also be down-regulated. [score:11]
CXCR4 confirmed as a target gene of miR-338Biomedical database and TargetScan (target point analysing tool) were employed, and the gene structures were analysed by gene complementation theory, verifying that CXCR4 was one of the target genes of miR-338 in bone cancer cells with the pre-experiment, and also that miRNA-338 seems to play a biological role by identifying and combining with CXCR4 mRNA. [score:9]
Furthermore, miR-338 through targeted regulation of CXCR4 expression affected and delayed the development of morphine tolerance in BCP. [score:7]
Biomedical database and TargetScan (target point analysing tool) were employed, and the gene structures were analysed by gene complementation theory, verifying that CXCR4 was one of the target genes of miR-338 in bone cancer cells with the pre-experiment, and also that miRNA-338 seems to play a biological role by identifying and combining with CXCR4 mRNA. [score:7]
Figure 4 Figure 5Comparisons of expressions of miR-338 and CXCR4 after lentivirus infection(A) mRNA expressions of CXCR4 and miR-338 in L [3-4] spinal cord tissues detected by qRT-PCR in each group on the 14th day after virus suspension injection in BCP rats undergoing morphine tolerance. [score:5]
Figure 4 Figure 5Comparisons of expressions of miR-338 and CXCR4 after lentivirus infection(A) mRNA expressions of CXCR4 and miR-338 in L [3-4] spinal cord tissues detected by qRT-PCR in each group on the 14th day after virus suspension injection in BCP rats undergoing morphine tolerance. [score:5]
CXCR4 protein expression change was measured with and immunohistochemistry (Figure 5B), with results showing that miR-338 expression of the pLV-THM- miR-338 group was significantly higher than those of the CXCR4 shRNA, blank control and PBS control groups, while miR-338 expression of the pLV-THM-anti- miR-338 group was remarkably lower that those three groups (all P<0.05). [score:5]
Furthermore, the present study confirmed that CXCR4 is a direct downstream target gene of miR-338, suggesting it plays a biological role by identifying and binding CXCR4 mRNA, providing a new insight into the development of morphine tolerance. [score:5]
The mutant and wild-type sequence of 3′-UTR of CXCR4 gene was connected to the dual luciferase reporter gene vector to construct the recombinant plasmids pmiR-PB-Report [TM] Vector-CXCR4-3′-UTR and pmiR-PB-Report [TM] Vector-CXCR4-3′-UTR-Del, which were then divided into pmiR-PB-Report [TM] Vector-CXCR4-3′-UTR, miR-338 negative control (NC), pmiR-PB-Report [TM] Vector-CXCR4-3′-UTR, miR-338mimics, pmiR-PB-Report [TM] Vector-CXCR4-3′-UTR, miR338 inhibitor, pmiR-PB-Report [TM] Vector -CXCR4-3′-UTR-Del, miR338 mimics, pmiR-PB-Report [TM] Vector-CXCR4-3′-UTR-Del, miR-338 inhibitor, pmiR-PB-Report Vector -CXCR4-3′-UTR-Del and miR338 NC groups. [score:5]
Figure 2Comparisons of mRNA and protein expressions of miR-338 and CXCR4 among four groups(A) Comparisons of mRNA expressionsof miR-338 and CXCR4 detected by qRT-PCR among each group. [score:5]
Furthermore, past studies have indicated that miR-338 can affect cancer invasion and metastasis by reducing CXCR4 expression [29], so as to slow the development of BCP. [score:4]
While miR-338 is a kind of brain-specific miRNA [10] also expressed in spinal cord [24], it is safe to infer that miR-338 is related to development of morphine tolerance. [score:4]
There have been reports on miRNAs and their regulation of CXCR4 [16], yet literature on miR-338’s targeting of CXCR4 is not wi dely available. [score:4]
In order to further confirm that CXCR4 is a direct target gene of miR-338, CXCR4-3′-UTR-WT, CXCR4-3′-UTR-Mut and miR-338 mimics were co -transfected with miRNA-NC as an NC. [score:4]
Figure 1 Comparisons of miR-338 and CXCR4 mRNA and protein expression among four groupsIn order to confirm the roles of miR-338 and CXCR4 in BCP rat with morphine tolerance, ten rats taken from the normal saline, normal morphine, mo del saline and mo del morphine groups were killed after the successful establishment of BCP rat with morphine tolerance (on the 7th day after injection with morphine). [score:3]
Further studies are required, however, to fully understand the specific mechanisms of miR-338 targeting of CXCR4. [score:3]
After the injection, ten rats in each group were killed on the 7th day to detect expressions of miR-338 and CXCR4. [score:3]
It was found that miR-338 and CXCR4 played important roles in morphine tolerance in BCP and that miR-338 can inhibit CXCR4 to delay the formation of morphine tolerance in BCP. [score:3]
Therefore, this present study aimed to explore the mechanism of miR-338’s regulation on CXCR4 in development of morphine tolerance in rats with BCP by establishing a BCP rat mo del with chronic morphine tolerance. [score:3]
Thus, this research created a BCP rat mo del to assess the mechanisms of miR-338 targeting CXCR4 during the formation of morphine tolerance in BCP. [score:3]
The miR-338 and CXCR4 mRNA expressions in L [3-4] spinal tissues were detected with qRT-PCR on the 14th day (Figure 5A). [score:3]
CXCR4 confirmed as a target gene of miR-338. [score:3]
Also, miR-338 mRNA expression in the mo del saline and mo del morphine groups was lower than those of the normal saline group and the normal morphine group respectively (both P<0.05, Figure 2A). [score:3]
Expressions of CXCR4 mRNA and protein in the pLV-THM- miR-338 group, pLV-THM-anti- miR-338 and CXCR4 shRNA groups were lower than those of other groups (all P<0.05). [score:3]
There was no significant difference in miR-338 expression among the CXCR4 shRNA, blank control and PBS control groups (all P>0.05). [score:3]
One-way ANOVA was used to compare behaviour indices and mRNA expressions of miR-338 and CXCR4 of rats at specific time points among different groups. [score:3]
L [3-4] segments of the spines were removed to detect expression changes of miR-338 and CXCR4. [score:3]
The study found that after building morphine tolerance in BCP rat mo del, miR-338 showed significantly lower expression, suggesting that miR-338 may be related to the formation of BCP. [score:3]
Comparisons of miR-338 and CXCR4 mRNA and protein expression among four groups. [score:3]
Comparisons of mRNA and protein expressions of miR-338 and CXCR4 among four groups. [score:3]
As a brain-specific miRNA, miR-338 is located in the eighth intron of apoptosis -associated tyrosine kinase (AATK) [9], and it is believed to target pathways in cells proliferation and differentiation [10]. [score:3]
miR-338 is located in chromosome 17q25 of AATK gene and plays vital roles in promoting cells apoptosis, neuron differentiation and neurite extension At G [0]/G [1] stage, miR-338 can inhibit cells’ proliferation, metastasis and invasion [22]. [score:3]
Comparisons of expressions of miR-338 and CXCR4 after lentivirus infection. [score:3]
One study showed that miR-338 overexpression in cancer cells is abnormal [11], and reduces cell metastasis, invasion, proliferation and apoptosis [12]. [score:3]
Based on a successful construction of BCP rat mo del, the present study of chronic morphine tolerance found that miR-338 and CXCR4 played key roles in BCP morphine tolerance development. [score:2]
Recombinant pLV-THM- miR-338 and CXCR4 shRNA lentiviral vector were synthesized by Shanghai GenePharma Co. [score:1]
The remaining 40 rat mo dels were randomly divided into the pLV-THM-miR-338, CXCR4 shRNA, blank control and PBS control groups. [score:1]
There was no significant difference in the effect of miR-338 on mutant plasmid (P=0.404), as shown in Figure 3. Figure 3(A) The sequences for combined site of miR-338 and CXCR4-3′-UTR region. [score:1]
miR-338-3p, as a subgroup of miR-338, is also understood to inhabit cancer genes in various cancers [13]. [score:1]
On the 7th, 9th, 11th and 14th day after injection, 50% MWTs in the pLV-THM- miR-338 and CXCR4 shRNA groups were significantly higher than those of the other four groups (all P<0.05), but an opposite result was observed in the pLV-THM-anti- miR-338 group. [score:1]
After the successful establishment of BCP rat mo del with morphine tolerance, the remaining 40 rats were randomly divided into pLV-THM- miR-338, pLV-THM-anti- miR-338, CXCR4 shRNA, blank control and PBS control groups, and intravenous injection of virus suspension of the same titre or equivalent sterile PBS solution was performed. [score:1]
Figure 1 In order to confirm the roles of miR-338 and CXCR4 in BCP rat with morphine tolerance, ten rats taken from the normal saline, normal morphine, mo del saline and mo del morphine groups were killed after the successful establishment of BCP rat with morphine tolerance (on the 7th day after injection with morphine). [score:1]
The sequence of pLV-THM- miR-338 was 5′-CAACAAAAUCACUGAUGCUGGA-3′ and the plasmid sequence of CXCR4 shRNA was 5′-AGACTGATGAAGGCCAGGATT-3′. [score:1]
, Waltham, MA, U. S. A. ) was used to dilute miR-338 mimics to 100 nmol/l, 15 μl of OPTI-MEM to dilute recombinant plasmid CXCR4-WT or CXCR4-Mut to 100 ng and 25 μl of OPTI-MEM to dilute Lipofectamine 2000 to 0.25 μl. [score:1]
When transfection efficacy reached an average of 80%, in the pLV-THM- miR-338, pLV-THM- anti-miR-338 and CXCR4 shRNA groups, the titres of lentivirus were 4.8 × 10 [8] TU/ml, 5.5 × 10 [8] TU/ml and 6.9 × 10 [6] TU/ml respectively. [score:1]
In the pLV-THM- miR-338, pLV-THM-anti- miR-338 and CXCR4 shRNA groups, 50% MWT began to rise from the 9th day, reached its highest point on the 11th day and returned to the same condition as prior to lentivirus injection on the 14th day. [score:1]
There was no significant difference in the effect of miR-338 on mutant plasmid (P=0.404), as shown in Figure 3. Figure 3(A) The sequences for combined site of miR-338 and CXCR4-3′-UTR region. [score:1]
[1 to 20 of 47 sentences]
3
[+] score: 27
Other miRNAs from this paper: rno-mir-327, rno-mir-127, rno-mir-210, rno-mir-377, rno-mir-465
The expression levels of miR-465 [*] and miR-377 [*] were the most significantly upregulated, while the expression levels of miR-327 and miR-338 were the most downregulated. [score:11]
miR-465 [*] and miR-377 [*] were selected as the most upregulated miRNAs, while miR-327 and miR-338 exhibited the most downregulated expression. [score:9]
Furthermore, miR-327 is upregulated in myocardial microvascular endothelial cells in impaired angiogenesis of type 2 diabetic rats (29), while miR-338 has been previously found to be downregulated in rats with pulmonary fibrosis (30). [score:7]
[1 to 20 of 3 sentences]
4
[+] score: 20
Specifically, miR-195 potentially regulates vesicle -associated membrane protein 1 (VAMP1), miR-30a targets actinin, alpha 1 (ACTN1), miR-21 targets paired-like homeodomain 2 (PITX2) in D6; miR-132 potentially regulates solute carrier family 2, member 1 (SLC2A1), nuclear receptor subfamily 4, group A, member 2 (NR4A2) and Cdc42 guanine nucleotide exchange factor 9 (ARHGEF9), miR-203 targets calcium binding protein 7 (CABP7), miR-17-5p targets early growth response 2 (EGR2) in S6; miR-330 potentially regulates CD247, nerve growth factor receptor (NGFR) and FAT tumor suppressor homolog 3 (FAT3), miR-338 targets ADAM metallopeptidase domain 17 (ADAM17), miR-218 targets src kinase associated phosphoprotein 1 (SKAP1), miR-185 targets calcium channel, voltage -dependent, N type, alpha 1B subunit (CACNA1B) in S9. [score:20]
[1 to 20 of 1 sentences]
5
[+] score: 19
These selected miRNAs included the seven most strongly upregulated miRNAs (miR-330, miR-338, miR-223, miR-20a, miR-181a, miR-592, miR-212) in the Ago2 IP at 30 min, the only downregulated miRNA (miR-29b) in the Ago2 IP at 30 min, and the three most strongly upregulated miRNAs (miR-219, miR-384, let-7f) in the Ago2 IP at 120 min post-HFS (significant by t-test with Dunn–Bonferroni correction and 1-Way ANOVA with LSD test). [score:10]
When comparing miRNA Ago2/input expression ratios, eight miRNAs (miR-384, miR-29b, miR-219, miR-592, miR-20a, miR-330 miR-223, and miR-34a) exhibited increases relative to the contralateral dentate gyrus, whereas five miRNAs (miR-let7f, miR-338, miR-212, miR-19a, and miR-326) showed decreases in this ratio. [score:3]
In contrast, 3 miRNAs (miR-let7f, miR-338, and miR-212) exhibited decreased expression in the Ago2 IP relative to input. [score:3]
Target gene list sizes for miRNAs with activity -dependent association with Ago2 for the 8 enhanced miRNAs were 97 (miR-20a), 156 (miR-219), 58 (miR-223), 114 (miR-29b), 30 (miR-330), 91 (miR-34a), 156 (miR-384), and 53 (miR-592) and for the 5 depleted miRNAs were 52 (let-7f), 55 (miR-338), 47 (miR-212), 255 (miR-19a), 32 (miR-326). [score:3]
[1 to 20 of 4 sentences]
6
[+] score: 13
Of the 30 miRNAs they found upregulated in traumatic spinal cord injury, miR-223, miR-214, miR-20b-5p, miR-17, miR-146a, miR-199a-3p, miR-221-3p, miR-146b, and miR-145 were also upregulated in our study, and among the 16 downregulated miRNAs in traumatic spinal cord injury, miR-34a and miR-338 were also downregulated after ventral combined with dorsal root avulsion in our study. [score:13]
[1 to 20 of 1 sentences]
7
[+] score: 9
As well characterized examples, miR-9 has been shown to regulate embryonic neurogenesis by targeting the transcription factor TLX [8]; miR-219 [9] and miR-338 [10] have been identified as regulators of oligodendrocyte differentiation; miR-124 have been shown to promote neuronal differentiation and regulate adult neurogenesis [11, 12]; and miR-134 have been shown to regulate dendritic spine morphology through inhibiting the local translation of Limk1 [13]. [score:9]
[1 to 20 of 1 sentences]
8
[+] score: 8
Other miRNAs from this paper: rno-mir-219a-1, rno-mir-219a-2, rno-mir-219b
Finally, SOX10 directly regulates the expression of EGR2 [28] and miR-338 [20]. [score:5]
To allow oligodendrocyte differentiation and myelin production, SOX6 mRNA is targeted for degradation by two microRNAs (miR) in these cells: miR-219 and miR-338 [40]. [score:3]
[1 to 20 of 2 sentences]
9
[+] score: 5
Notably, a panel of 11 Runx2 -targeting miRNAs (miR-23a, miR-30c, miR-34c, miR-133a, miR-135a, miR-137, miR-204, miR-205, miR-217, miR-218, and miR-338) is expressed in a lineage-related pattern in mesenchymal cell types [20]. [score:5]
[1 to 20 of 1 sentences]
10
[+] score: 5
MicroRNA-338–3p inhibits glucocorticoid -induced osteoclast formation through RANKL targeting. [score:4]
GC function was related to miR-338 (Zhang et al., 2016) and miR-433 (Smith et al., 2016) in osteoclast formation. [score:1]
[1 to 20 of 2 sentences]
11
[+] score: 4
The death of specific cell types may explain the downregulation of microRNAs that are associated with neurons, such as miR-124 and miR-128 [48], and those associated with oligodendrocytes, such as miR-219, miR-138, and miR-338 [49], [50]. [score:4]
[1 to 20 of 1 sentences]
12
[+] score: 4
The two miRNAs with the lowest p value up-regulated in LDeep (miR-219 and miR-338) are involved in oligodendrocyte differentiation (Barca-Mayo and Lu 2012). [score:4]
[1 to 20 of 1 sentences]
13
[+] score: 3
Other miRNAs from this paper: rno-mir-365
Mei HX, Zhou MH, Zhang XW, Huang XX, Wang YL, Wang PF, et al. Effects of miR-338 on morphine tolerance by targeting CXCR4 in a rat mo del of bone cancer pain. [score:3]
[1 to 20 of 1 sentences]
14
[+] score: 2
Other miRNAs from this paper: rno-mir-219a-1, rno-mir-219a-2, rno-mir-219b
A possible future strategy might be to check the levels of some SOX6 and HES5 regulators such as miR-219 or miR-338 and their therapeutic potential in stroke [26]. [score:2]
[1 to 20 of 1 sentences]
15
[+] score: 1
Among the 11 miRNAs quantified, 4 were not modulated after 7 days or 2 months MI: miR-29b-3p, miR-338-3p, miR-133a and miR-483-3p interacting respectively with tropomyosin alpha-1 chain, pyruvate kinase PKM and phosphoglycerate mutase 1 (Fig.   1B–E). [score:1]
[1 to 20 of 1 sentences]
16
[+] score: 1
Other miRNAs from this paper: hsa-mir-338
3397-14.2015 25855182 7. Aschrafi A MicroRNA-338 regulates local cytochrome c oxidase IV mRNA levels and oxidative phosphorylation in the axons of sympathetic neuronsJ. [score:1]
[1 to 20 of 1 sentences]
17
[+] score: 1
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Similarly, recent rodent studies demonstrated the roles of miR-219 [56], [57] and miR-338 [57] in controlling oligodendrocyte differentiation. [score:1]
[1 to 20 of 1 sentences]