sort by

25 publications mentioning mmu-mir-346

Open access articles that are associated with the species Mus musculus and mention the gene name mir-346. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 334
Other miRNAs from this paper: mmu-mir-141
We also performed the rescue experiments by inhibiting the expression of SMYD3 and found the down-regulation of SMYD3 could neutralize the inhibitory effects of miR-346 on HCC. [score:10]
Similarly, HepG2, which had a relative high expression of miR-346, was transfected with miR-346 inhibitor to down-regulate the miR-346 expression. [score:10]
To further examine the direct interaction between SMYD3 and miR-346, we up-regulated the SMYD3 expression in SMMC-7721 with up-regulation of miR-346 and performed the EdU proliferation assays. [score:9]
Therefore, by using western blot and real-time-PCR, we identified the expression of miR-346 was over -expression in HCC cells transfected with miR-346 inhibitor and down-regulated in HCC cells treated with miR-346 mimics compared with the control. [score:9]
Our findings illuminated miR-346 targeting SMYD3 to inhibit the proliferation of HCC and its down-regulation predicts a poor prognosis. [score:8]
The results showed inhibitory effects of miR-346 on HCC proliferation can be partially neutralized by the over -expression of SMYD3, which implied SMYD3 was an oncogene in HCC as a target of miR-346. [score:7]
To examine the effects of SMYD3 underlying the inhibitory effects of miR-346 on HCC cells, we transfected the miR-346 over-expressed SMMC-7721 cells with SMYD3 -expressing lentivirus. [score:7]
To determine which target gene was responsible for the function of miR-346 on HCC proliferation, we predicted the target gene of miR-346 via utilizing two Bioinformatics databases: Target Scan (http://www. [score:7]
Figure 3MiR-346 suppressed proliferation in vitro was associated with cell cycle (A) Proliferation ability was detected by CCK8 assay, over -expression of miR-346 inhibited SMMC-7721 cells proliferation, whereas knock-down of miR-346 promoted HepG2 cells proliferation. [score:7]
Figure 5 (A,B) The findings from the real-time-PCR and western blot suggested that over -expression of miR-346 could suppress the expression of SMYD3 in HCC cells. [score:7]
Besides, using HCC cells and human normal L02 liver cells, we confirmed that miR-346 expression was down-regulated in the HCC cells in comparison with L02 cells. [score:6]
And the results of Pearson correlation analyses showed that miR-346 expression was negatively associated with the expression of SMYD3, which indicated miR-346 was a crucial upstream regulatory molecule of SMYD3[17, 27, 28]. [score:6]
The increased percentage of G1 phase was obtained in miR-346 over-expressed HCC cells while the loss of miR-346 could caused the up-regulation of S phase (Figure 3D). [score:6]
By using the Pearson correlation analysis, the expression of SMYD3 was found to be negatively associated with miR-346 expression (Figure 4C). [score:5]
Figure 7 (A,B) The findings of Kaplan–Meier analysis indicated that patients with low expression of miR-346 had a better OS and RFS than the miR-346 high expression group. [score:5]
The results of prediction showed the overlapping target gene for miR-346 from these two databases was SMYD3 contained a conserved putative target site for miR-346 (Figure 4A). [score:5]
By using real-time-PCR, we found the expression of miR-346 was significantly down-regulated in 110 pairs of human HCC tissues compared with the corresponding adjacent tissues (Figure 1C). [score:5]
Then we examined the expression of miR-346 in human HCC cell lines and human normal liver cells, the results showed miR-346 was over-expressed in human normal L02 cells in comparison with HCC cells (Figure 2A). [score:5]
The real-time PCR and western blot confirmed that the miR-346 could inhibit the SMYD3 expression in HCC cells (Figure 5A and 5B). [score:5]
The results showed over -expression of miR-346 could inhibit the proliferation of SMMC-7721. [score:5]
MiR-346 inhibited tumor growth in vivoTo further examine the effects of miR-346 on tumorigenesis in vivo, nude mice were subcutaneously injected with SMMC-7721 cells stably transfected with the ectopic expression lentivirus of miR-346 (Figure 6A). [score:5]
All lentiviral vectors expressed enhanced green fluorescent protein (GFP), the expression of miR-346 and SMYD3 in the treated cells was confirmed by real-time-PCR 48h after the transfection. [score:5]
As indicated in Figure 5D, miR-346 mimics significantly suppressed luciferase activity of SMYD3 containing a wild-type 3’-UTR, but had no effect on activity of SMYD3 with a mutant 3’-UTR, meanwhile treatment with miR-346 inhibitor increased luciferase activity of SMYD3. [score:5]
Collectively, the results above indicated SMYD3 was a direct target gene of miR-346. [score:4]
Stable over -expression of miR-346 decreased the proliferation of SMMC-7721 cells while knockdown of miR-346 increased the proliferation of HepG2 cells. [score:4]
We next detected whether the expression of SMYD3 could be regulated by miR-346. [score:4]
And the results of Kaplan–Meier analysis showed that HCC patients with low expression of miR-346 had a better OS and RFS compared with the miR-346 high expression group. [score:4]
Here, in this study, we obtained the down-regulated miR-346 in HCC tumor tissues. [score:4]
Via performing the EdU assays, we found that over -expression of SMYD3 partially counteracted the inhibitory effects of miR-346 on HCC proliferation (Figure 5C). [score:4]
MiR-346 suppressed proliferation of HCC by targeting SMYD3. [score:4]
The results of the EdU assays proved that miR-346 prevented HCC proliferation partially through suppressing the expression of SMYD3. [score:4]
Then, bioinformatic algorithms and luciferase reporter assays proved that miR-346 directly targeted SET and MYND domain containing 3(SMYD3). [score:3]
In conclusion, we illuminate that miR-346 act as a tumor suppressor miRNA in HCC tumorigenesis and progression. [score:3]
The results of Chi-square analyses showed the expression levels of miR-346 were associated with tumor size (P=0.012) and TNM grade (P=0.006) of HCC patients (Table 2). [score:3]
Besides, we also found the inhibitory effects of miR-346 on proliferation were associated with cell cycle. [score:3]
Figure 6MiR-346 inhibited tumor growth in vivo (A,B) BALB/c Nude mice (6 weeks of age) were subcutaneous transplantated with SMMC-7721 cells, Lv-miR-346 SMMC-7721 cells(1×10 [7]) in the right groin and Lv-NC SMMC-7721 (1×10 [7]) cells in the left groin. [score:3]
In addition, the results of Chi-square analysis showed the expression of miR-346 associated with the tumor size and TNM of HCC patients. [score:3]
One day after the implantation, the cells were transfected with 25 nM of miR-346 mimics, anti-miR-346 inhibitor and the negative control (GenePharma, Shanghai, China), using Lipofectamine 2000 reagent (GIBCO, Carlsbad, USA) according to the manufacturer’s protocol. [score:3]
MiR-346 was aberrantly down-regulated in HCC tissues and cell lines. [score:3]
Chi-square analysis showed the expression levels of miR-346 were associated with tumor size and TNM grade. [score:3]
The Ct values of U6 and GAPDH were used as the internal control to normalize the relative expression of miR-346 and SMYD3, respectively. [score:3]
The expression of miR-346 of pretreated cells was shown in Figure 2B and 2C. [score:3]
The aberrant expression of miR-346 indicated that miR-346 might display a crucial role in the carcinogenesis of HCC. [score:3]
Taken together, we demonstrated that miR-346 was a potential tumor suppressor of HCC. [score:3]
Meanwhile, all miR-346 and SMYD3 ectopic expression lentivirus as well as the negative control lentivirus were purchased from Gene Chem (Shanghai, China). [score:3]
Figure 4 (A) Bioinformatic prediction was employed to analyze the potential target gene of miR-346. [score:3]
By utilizing the bioinformatics prediction programs, we found that the 3’-UTR of SMYD3 contained a conserved putative target site for miR-346. [score:3]
These findings strongly supported the viewpoint that miR-346 could inhibit the proliferation of HCC. [score:3]
In our current study, we focused on the miR-346 expression in HCC tissues and its effects on the malignant phenotype of HCC cells including proliferation and cell cycle. [score:3]
Furthermore, miR-346 prevents HCC proliferation partially through modulating the expression of SMYD3. [score:3]
The results above indicated that the aberrant expression of miR-346 has the potential for the early detection HCC. [score:3]
MiR-346 induced the down-regulation of SMYD3. [score:3]
Coincidentally, the effects of SMYD3 on HCC cells seemed to associate with the abnormal expression of miR-346. [score:3]
What’s more, the results of luciferase reporter assay suggested that SMYD3 was a direct target gene of miR-346. [score:3]
As shown in Figure 6B-6D, tumor growth was dramatically suppressed by the miR-346 from day 5 to till sacrifice. [score:3]
Expression of miR-346 was determined using MicroRNA First-Strand Synthesis and miRNA Quantitation kits (Takara, Dalian, China) according to the manufacturer’s instructions. [score:3]
The results we achieved suggested miR-346 could suppress the HCC proliferation in vitro. [score:3]
At last, the cox proportional hazards analysis showed that low expression of miR-346 was an an independent prognostic factor for HCC. [score:3]
MiR-346 was aberrantly down-regulated in HCC cell lines. [score:3]
We found miR-346 was significantly down-regulated in the HCC tissues compared with the non-tumor controls and was associated with the tumor size and TNM grade. [score:3]
Correlation between miR-346 expression and clinicopathological information of HCC patients (n=110). [score:3]
To further examine the effects of miR-346 on tumorigenesis in vivo, nude mice were subcutaneously injected with SMMC-7721 cells stably transfected with the ectopic expression lentivirus of miR-346 (Figure 6A). [score:3]
We also transfected SMMC-7721 cells with the up-regulated lentivirus of miR-346 to perform further in vivo assay. [score:3]
At last, we performed the Kaplan–Meier analysis and Cox proportional regression analysis and found low expression of miR-346 could be a potential biomarker for predicting the survival of HCC patients. [score:3]
SMYD3 was predicted as target for miR-346. [score:3]
Our data illuminated that miR-346 was a significant upstream molecule which modulated the expression of SMYD3. [score:3]
In our study, real-time-PCR demonstrated that miR-346 was significantly down-regulated in HCC tissues and cells compared with the non-tumorous tissues and cells. [score:3]
The results of cell cycle showed the HCC cells treated with miR-346 mimics, inhibitor and negative control exerted differential distribution of cell cycle phases. [score:3]
The following day, the cells were respectively co -transfected with 25 nM of miR-346 mimic, miR-346 inhibitor or miR-NC (GenePharma, Shanghai, China) and 500 ng of 3’-UTR (WT or Mut) of SMYD3 pmirGLO recombinant vectors. [score:3]
Additionally, the in vitro and in vivo assays confirmed that miR-346 suppressed the proliferation of HCC. [score:2]
Interestingly, the HepG2 with low -expression of miR-346 also showed more proliferation capacity compared with the control cells (Figure 3A). [score:2]
MiR-346 suppressed proliferation in vitro was associated with cell cycle. [score:2]
MiR-346 inhibited tumor growth in vivo. [score:2]
The results showed that miR-346 expression was significantly decreased in HCC tumor tissues compared with the corresponding adjacent non-tumorous tissues. [score:2]
To further confirm the potential correlations between the expression of miR-346 and tumor size, a series of functional assays including CCK-8, plate cloning and EdU were performed to determine whether the gain or loss of miR-346 could affect the HCC proliferation. [score:2]
Further investigation revealed that miR-346 was involved in the development of HCC by acting as a tumor suppresser gene. [score:2]
Based on the correlations between miR-346 expression and tumor size from the Chi-square analyses, CCK-8 assays were conducted to explore the potential function of miR-346 on HCC cells. [score:2]
MiR-346 induced the suppression of SMYD3. [score:2]
In addition, the results of the in vitro and vivo assays indicated miR-346 suppressed the proliferation of HCC cells. [score:2]
The results above have preliminarily confirmed miR-346 could display a crucial role in the carcinogenesis of HCC, however, the precise mechanisms underlying its effects were still unknown. [score:1]
In the subcutaneous transplantation mo del, 6 mice was implanted with Lv-miR-346-SMMC-7721 cells(1×10 [7]) in the right groin, and Lv-NC-SMMC-7721 cells (1×10 [7]) in the left groin. [score:1]
DNA sequences containing the miR-346 binding site on the 3’-UTR of SMYD3 were cloned into the downstream of the firefly luciferase stop codon in a pmirGLO control vector (Promega, Milan, Italy). [score:1]
However, the clinical significance of miR-346 in HCC and the underlying molecular mechanisms still require elusive. [score:1]
We will investigate the detailed mechanism of the suppression of miR-346 in human HCC in further study. [score:1]
miR-346 was significantly associated with prognosis of HCC. [score:1]
As shown in Figure 3B and 3C, miR-346 indeed displayed the function to prevent the proliferation of HCC cells in vitro. [score:1]
To further explore the potential effects of miR-346, we treated SMMC-7721 with miR-346 mimics. [score:1]
Furthermore, Kaplan–Meier analyses and Cox proportional regression analyses demonstrated miR-346 as an independent prognostic factor for the HCC patients. [score:1]
This study was designed to explore the role of miR-346 in the pathogenesis of hepatocellular carcinoma. [score:1]
Besides, Kaplan–Meier analyses and Cox proportional regression analyses suggest that miR-346 is an independent prognostic factor for the patients with HCC. [score:1]
MiR-346 is previously identified as closely related to the development and progress of various malignancies including squamous cell carcinoma, cervical cancer, prostate cancer, non-small cell lung cancer and haryngeal carcinoma [22- 25]. [score:1]
Furthermore, we confirmed miR-346 could prevent the HCC proliferation in vivo. [score:1]
Then the results of Cox proportional regression analysis also demonstrated that miR-346 might be a prognostic factor for the HCC patients (adjusted hazard ratio (AHR): 0.116 [95% Confidence Interval (CI):0.033–0.445]) (Table 3). [score:1]
At last, we performed Kaplan–Meier analysis to investigate the correlation between the miR-346 expression and overall survival (OS) or relapse-free survival (RFS) of the HCC patients (Figure 7A and 7B). [score:1]
In addition, the miR-346 was previously identified as an oncogenic function in human cancers such as breast cancer, lung cancer and nasopharyngeal carcinoma, etc. [score:1]
Used median as cutoff, we divided 110 HCC samples into two subgroups including miR-346 high group and low group. [score:1]
Among the candidate, miR-346 presented the most significant fold change and p value (Table 1). [score:1]
Since miR-346 was demonstrated to be involved in the modulation of cell proliferation, we next analyzed whether the loss or gain of miR-346 can affect the cell cycle of HCC. [score:1]
[1 to 20 of 98 sentences]
2
[+] score: 295
Our data reveals that the miR-346 -inhibited XPC facilitates the expression of Snail, which further suppresses the expression of E-Cadherin, leading to rescue cancer cells from E-Cadherin -mediated proliferation, migration and invasion inhibition, and apoptosis impetus. [score:11]
Results demonstrated both miR-346 mimic and si-XPC suppressed the protein expression of XPC, and then resulted in an increased phosphorylation of ERK1/2 in both A549 and SPC-A-1 cell lines (Fig. 10A–B), indicating that XPC is able to inhibit the ERK pathway in NSCLC cells, and miR-346 could activate ERK pathway by directly targeting XPC. [score:10]
Figure 10 Mo del of the mechanism by which miR-346 suppresses XPC then activating ERK/Snail pathway, which leads to down-regulation of E-Cadherin expression and facilitates cell proliferation and metastasis, and inhibits cell apoptosis in lung cancer. [score:10]
In addition, both miR-346 mimic and XPC knockdown -enhanced Snail expression could be blocked by the inhibition of the ERK pathway, accompanied by an increased expression of E-Cadherin (Fig. 10A–B). [score:8]
Moreover, we also revealed up-regulation of miR-346 facilitated NSCLC cell growth, migration and invasion, and promoted G1/S transition, as well as suppressing NSCLC apoptosis through targeting XPC. [score:8]
Expression of XPC is up-regulated in primary human lung cancer and negatively expressed related to miR-346. [score:8]
Figure 2Expression of XPC is up-regulated in primary human lung cancer and negatively expressed related to miR-346(A-B) Western-blot of XPC protein and qRT-PCR of XPC mRNA in lung cancer tissues and adjacent-normal lung cancers. [score:8]
Although there was no significant association between miR-346 expression and sex, differentiation, or histological tumor type smoking, up-regulated expression of miR-346 was commonly observed in NSCLC patients with elder age, bigger tumor sizes, smokers, positive lymph node metastasis, and advanced stage (P <0.05, Table 1). [score:8]
We show for the first time that miR-346 directly targets and regulates the full-length 3′-UTR of the human XPC mRNA, which is down-regulated lung cancer. [score:8]
We determined the effects of miR-346 over -expression or inhibition, and XPC inhibition on cell proliferation via. [score:7]
miR-346 directly targeting 3′-UTR of XPC mRNA, contributes to down-regulation of XPC protein. [score:7]
Expression of XPC is down-regulated in primary human NSCLC and negatively related to miR-346. [score:6]
Here, we reported that miR-346 is indeed up-regulated in NSCLC compared with the matching normal lung tissues, and found 3′-UTR of the human XPC mRNA is really a target of miR-346. [score:5]
Taken together, these results clearly demonstrated that miR-346 expression markedly promoted the migration and invasion motility of NSCLC cells through targeting XPC. [score:5]
MiR-346 mimic and mimic negative control, miR-346 inhibitor and inhibitor negative control were purchased from GenePharma Co. [score:5]
Here, we observed an increase of Snail expression at the protein levels and a concomi-tant decrease of E-cadherin expression after miR-346 mimic or si-XPC treatment in lung cancer cell lines. [score:5]
Ectopic expression of miR-346 suppresses apoptosis in A549 and SPC-A-1 cells. [score:5]
In conclusion, we reveal that miR-346 facilitates NSCLC cell growth and metastasis in by directly targeting 3′-UTR of XPC. [score:4]
Wang et al. also found that miR-346 regulates osteogenic differen-tiation of human bone marrow-derived mesenchymal stem cells by targeting the Wnt/β-catenin pathway [24]. [score:4]
miR-346 directly targeting XPC and then activating ERK/Snail pathway, which leads to decrease of E-cadherin. [score:4]
The oncogenic role of miR-346 in NSCLC is thus at least partly realized by downregulating XPC. [score:4]
Next, we examined miR-346 expression in NSCLC cell lines, and results demonstrated a higher expression of miR-346 in A549, SPC-A-1, H1299, 95-D, SK-MES-1, NCI-H520 and NCI-H460 cell lines, compared with that of in normal lung cells 16HBE (Fig. 1B). [score:4]
Whether XPC is the only direct target of miR-346 is still unknown. [score:4]
miR-346 up-regulation was detected in 108/114 (94.74%) of NSCLC tumors (Fig. 1A). [score:4]
Thus, it was concluded that the increased expression of miR-346 might make sense in initiation or development of NSCLC. [score:4]
Here, we also revealed a direct link between miR-346 and XPC expression in NSCLC patients, and observed that XPC and miR-346 levels were inversely correlated in human NSCLC specimens (Fig. 2C). [score:4]
A549 and SPC-A-1 cells (which have high endogenous miR-346 expression) transfected with miR-346 mimics and si-XPC showed increased proliferation (P <0.05), which was rescued by ASO-346 treatment (Fig. 5A–B). [score:3]
Furthermore, multivariate Cox regression analysis revealed that high (>3.7 folds of increase, n=78) miR-346 expression, elder age, and advanced stage are independent predictors of overall survival in NSCLC patients (Table 2). [score:3]
Our study showed miR-346 was upregulated in NSCLC tumor samples as compared with corresponding adjacent normal tissues (Fig. 1). [score:3]
Our experimental data may provide a strategy that targeting XPC possibly administered by miR-346, might be a clinically effective anti-NSCLC therapeutic strategy. [score:3]
miR-346 was ectopically expressed in NSCLC cell lines. [score:3]
Figure 9(A- B) Expression of XPC, phospho-ERK1/2, ERK2, Snail, and E-cadherin were detected in A549 and spc-a-1 cells either transiently transfected with NC, miR-346, si-XPC, or ASO-346. [score:3]
Figure 4 XPC proto-oncogene is a target of miR-346 at specific 3′-UTR sites(A) The 3′-UTR of XPC harbors one miR-346 cognate site. [score:3]
However, the percentage of apoptotic cells induced by miR-346 was increased to the basal level when the cells were treated with the specific miR-346 inhibitor (Fig. 7A–B). [score:3]
MiR-346 targets human XPCTo clarify the relationship between miR-346 and XPC, basic information about hsa-miR-346 was collected from miRBase. [score:3]
However, when treated with ASO-346, migration in miR-346 -expression defected A549 and SPC-A-1 cells were significantly decreased by approximately 48% and 31% relative to blank A549 and SPC-A-1 cells (Fig. 6A–B) respectively. [score:3]
Kaplan-Meier analysis indicated that high miR-346 expression was associated with poorer overall survival (log-rank test, P <0.0001, Fig. 1C). [score:3]
In addition, our results of western-blot demonstrated that the decreased expression (48% or 55% of decrease) of XPC in tumors developed from miR-346 mimic or si-XPC treated nude mice relative to that of control tumors (Fig. 8D). [score:3]
However, loss of miR-346 suppressed cell proliferation in A549 and SPC-A-1 cells (Fig. 5A–B). [score:3]
MiR-346 facilitates cell proliferation and colony formation, and promotes G1/S transition through down-regulation of XPC in NSCLC. [score:3]
MiR-346 is up-regulated in primary human lung cancer and NSCLC cell lines, and predicts a worse prognosis. [score:3]
In the present study, restoration of E-Cadherin expression in miR-346 -induced XPC-silencing NSCLC cells can neutralize XPC deficiency -induced cell proliferation, migration and invasion both in vitro and in vivo. [score:3]
When the XPC 3′-UTR was attached to the luciferase gene, luciferase activity decreased significantly (P <0.05) in A549 and SPC-A-1 cells transfected with miR-346 mimics, demonstrating that XPC was the target of miR-346 (Fig. 4B). [score:3]
XPC proto-oncogene is a target of miR-346 at specific 3′-UTR sites. [score:3]
In addition, we demonstrated that miR-346 overexpression expedited tumor growth in vivo (Fig. 8). [score:3]
MiR-346 is down-regulated in primary NSCLC tissues and cell lines, and predicts a worse prognosis. [score:3]
MiR-346 (MIMAT0000773), a recognized oncogenic miRNA, has been shown to be played an important role in several diseases. [score:3]
The miR-346 expression was examined by qRT-PCR (Fig. 8C). [score:3]
Ectopic expression of miR-346 in A549 and SPC-A-1 cells reduces cell migration and invasion motility. [score:3]
To examine the effect of miR-346 on endogenous XPC expression, we treated A549 and SPC-A-1 cells with NC, miR-346, si-XPC or ASO-346 for indicated time. [score:3]
C. Scatter plots showing the inverse association between miR-346 level and XPC mRNA expression. [score:3]
We also showed that high miR-346 expression correlated with advanced clinical stage and lymph node metastasis. [score:3]
In our present study, we discovered that miR-346 and XPC were promising potential prognostic marker for NSCLC, and found miR-346 is dramatically upregulated in human NSCLC tissues compared with normal lung tissues. [score:3]
XPC levels were decreased by ectopic miR-346 expression in NSCLC cells (Fig. 4). [score:3]
However, when treated with ASO-346, invasion in miR-346 -expression defected A549 and SPC-A-1 cells were significantly decreased by approximately 58% and 49% relative to blank A549 and SPC-A-1 cells (Fig. 6C–D), separately. [score:3]
To verify XPC targeting by miR-346, reporter constructs in which the XPC 3′-UTR, either wild type or mutated in the miR-346 binding sites, was cloned downstream of the luciferase open reading frame (ORF) (Fig. 4A). [score:3]
Ectopic expression of miR-346 facilitates tumor growth in vivo. [score:3]
Average miR-346 expression was approximately 3.7-fold higher in NSCLC specimens as compared with corresponding adjacent normal tissues (P <0.05, Fig. 1A). [score:2]
MiR-346 suppresses tumor growth in vivo. [score:2]
Luciferase activity assay results verified that XPC was a target of miR-346. [score:2]
After 8 days, NC, miR-346 mimic, si-XPC or ASO-346 was directly injected into the implanted tumor every 4 days for seven times. [score:2]
Western blot assay revealed that both miR-346 and si-XPC treatment decreased the protein level of XPC in A549 and SPC-A-1 cells, while ASO-346 treatment showed an increase in the XPC protein expression than NC treated A549 and SPC-A-1 cells (Fig. 4C). [score:2]
MiR-346 targets human XPC. [score:2]
MiR-346 suppresses NSCLC cell apoptosis. [score:2]
In addition, we also tested the caspase-3 and caspase-7 activity after treatment of A549 and SPC-A-1 cells with NC, miR-346 mimic, si-XPC or ASO-346, and results showed that miR-346 mimic and si-XPC treatment significantly decreased the caspase-3 and caspase-7 activity in A549 and SPC-A-1 cell lysate, by approximately 74% and 79%, or 54% and 49% of decrease (caspase-3 activity), 83% and 92%, or 47% and 41% of decrease (caspase-7 activity), than that of in blank A549 and SPC-A-1 cells (Fig. 7C–F), respectively. [score:1]
Our results of flow cytocytometric analysis revealed that miR-346 mimic or si-XPC treatment contributed to a 62% and 70%, or 56% and 67% of decrease in apoptotic cell death of A549 and SPC-A-1 cells (Fig. 7A–B), respectively. [score:1]
Thus, miR-346 promotes the growth of established NSCLC xenografts. [score:1]
miR-346 mimic or mimic NC was transfected into A549 and SPC-A-1 cells. [score:1]
Previous studies indicated that miR-346 might be an oncogenic miRNA in some cancers, including cervical cancer [21, 22], cutaneous squamous cell carcinoma [23]. [score:1]
However, the functional role and mechanistic action of miR-346 in NSCLC remained largely unclear. [score:1]
The tumor volume and weight of mice treated with miR-346 mimic or si-XPC were significantly increased (0.56-fold or 0.38-fold of increase in tumor weight, respectively) relative to that of treated with NC (Fig. 8A–B). [score:1]
The cells were washed with 1× PBS (pH7.4) and then transiently transfected with 50 nM NC or miR-346, 100 nM ASO-346 or si-XPC, using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. [score:1]
Moreover, we evaluated the correlation between XPC mRNA and miR-346 expression in 114 NSCLC tissues, and results revealed expression of XPC mRNA and miR-346 exhibited a significantly inverse correlation as calculated by Pearson correlation (r=−0.51, P <0.0001) (Fig. 2C). [score:1]
Next, we examined the role of miR-346 on A549 and SPC-A-1 cells migration and invasion. [score:1]
To validate the oncogenic role of miR-346 in vivo, we established a BALB/c nude mouse xenograft mo del using A549 cells. [score:1]
The miR-346 affects cell proliferation and cell cycle. [score:1]
miR-346 expression was measured in 114 NSCLC samples and corresponding adjacent normal tissues by qRT-PCR. [score:1]
We examined the effects of miR-346 on NSCLC cells in vitro and in vivo. [score:1]
These results demonstrated that miR-346 indeed promoted apoptosis in A549 and SPC-A-1 cells. [score:1]
Figure 5(A- B)s of A549 and SPC-A-1 cells after transfected with NC, miR-346, si-XPC and ASO-346. [score:1]
The predicted miR-346 binding site was present in XPC 3′-UTRs. [score:1]
Importantly, high miR-346 (Fig. 1C) and low XPC levels (Fig. 3) were correlated with shorter overall NSCLC patient survival, indicating that miR-346 and XPC may serve as NSCLC biomarkers for clinical outcome prediction, optimal therapy selection and risk group assignment. [score:1]
This result demonstrates miR-346 significantly facilitates the tumorigenicity of A549 cells in the nude mouse xenograft mo del. [score:1]
Additionally, in A549 and SPC-A-1 cells transfected with miR-346 mimics or si-XPC, the number of cells in G1 phase of the cell cycle decreased and the number in S phase increased (P <0.05, Fig. 5C–D), and this was again rescued by ASO-346 treatment (P<0.05). [score:1]
Our results indicated that miR-346 facilitated NSCLC cell proliferation and promoted the G1/S transition (Fig. 5). [score:1]
To clarify the relationship between miR-346 and XPC, basic information about hsa-miR-346 was collected from miRBase. [score:1]
Influence of miR-346 expression and clinical characteristics on overall survival in NSCLC patients. [score:1]
We then explored the efficiency of miR-346 on A549 and SPC-A-1 cells apoptosis. [score:1]
Moreover, Semaan and his colleagues reported miR-346 controls release of TNF-α protein and stability of its mRNA in rheumatoid arthritis via tristetraprolin stabilization [25]. [score:1]
We used Transwell migration approache to assess the role of miR-346 on the ability of A549 and SPC-A-1 cells migration. [score:1]
Figure 1(A) miR-346 is significantly increased in primary human lung cancer tissues in comparison to adjacent-normal lung cancer tissues. [score:1]
As expected, invasion of miR-346 mimic or si-XPC treated cells was increased by 0.46-fold or 0.54-fold in A549 and 1.1-fold or 0.96-fold in SPC-A-1 cells, relative to the blank A549 and SPC-A-1 cells (Fig. 6C–D), respectively. [score:1]
[1 to 20 of 92 sentences]
3
[+] score: 200
Target mRNA Accession number Forward primer (5′-3′) Reverse primer (5′-3′) Reference sXBP1 NM_001079539 CTGAGTCCGCAGCAGGT TGTCCAGAATGCCCAACAGG Galluzzi et al., 2016 RFX1 NM_002918 CTCCCTGAACCCCCTGGA CCAGCCGCCAGTGAGATG TAP1 NM_000593 CCCAGAAGCCAACTATGGAGG AGCCTCGTCTACCTCTGTGT IL18 NM_001562 TGACTGTAGAGATAATGCACCCC AGTTACAGCCATACCTCTAGGC BCAP31 NM_001139457 TGCTGTCCTTCCTGCTTAGA CACTAGCACTCTCCGCCTG B2M NM_004048 ACTGAATTCACCCCCACTGA CCTCCATGATGCTGCTTACA Zhang et al., 2005 GUSB NM_000181 GCTACTACTTGAAGATGGTGATCG AGTTAGAGTTGCTCACAAAGGTC Galluzzi et al., 2016 In Silico Analysis of miRNA TargetsThe miRWalk 2.0 (Dweep and Gretz, 2015) and miRTarBase (Chou et al., 2018) databases for experimentally validated microRNA-target interactions were used for miR-346 target identification. [score:7]
FIGURE 5Expression of predicted miR-346 target genes in infected THP-1-derived macrophages transfected with miR-346 inhibitor. [score:7]
It is noteworthy that upregulation of sXBP1 and miR-346, and downregulation of IL18 and RFX1 were observed in infected cells regardless of Leishmania subgenus, pointing to a possible common pathogenic mechanism in the L. (Leishmania) and L. (Viannia) parasites. [score:7]
We found that TAP1 was about three times more expressed in THP-1-derived macrophages, making this transcript less susceptible to downregulation by miR-346 (Supplementary Figure S3). [score:6]
The unfolded protein response (UPR)-activated transcription factor X-box -binding protein 1 (XBP1) induces microRNA-346 expression that targets the human antigen peptide transporter 1 (TAP1) mRNA and governs immune regulatory genes. [score:6]
To monitor the possible effects of miR-346 upregulation, we selected four genes (TAP1, BCAP31, RFX1, IL18) associated with MHC and interferon gamma production from the 76 identified genes, and their expression was monitored by qPCR in cells infected with Leishmania parasites. [score:6]
Moreover, an increase in TAP1 and BCAP31 mRNA was also partly observed in infected cells treated with miR-346 inhibitor, suggesting a role of miR-346 in counteracting the upregulation of these genes during infection. [score:6]
It is noteworthy that the basal expression of RFX1 in THP-1-derived macrophages was lower than that of other genes (Supplementary Figure S2), making this gene more prone to be regulated by the low expressed miR-346. [score:6]
Before infection, cells were transfected with the miR-346 inhibitor (dark gray bars) or with the miRNA inhibitor negative control (light gray bars) (n = 4). [score:5]
The miR-346 target genes were inputted as the “target set,” and human genes with NCBI gene ID downloaded from the Ensembl database were inputted as “background set. [score:5]
As an ER stress positive control, cells were treated with 0.5 μg/ml tunicamycin for 4 h or 1mM dithiothreitol (DTT) for 1 h. To test the impact of hsa-miR-346 on expression of predicted target genes following Leishmania spp. [score:5]
TAP1 has been shown to be regulated by miR-346 in other cellular mo dels, including HeLa cells (Bartoszewski et al., 2011), but it was not found downregulated in our infection mo del. [score:5]
infection, THP-1 derived macrophages were transfected with the miR-346 inhibitor and the miRNA inhibitor negative control (Integrated DNA Technologies) at 50 nM final concentration. [score:5]
In Silico Identification of miR-346 TargetsIn order to identify the transcripts targeted by miR-346 in infected macrophages, we used the validated module of miRWalk 2.0 and miRTarBase. [score:5]
Target mRNA Accession number Forward primer (5′-3′) Reverse primer (5′-3′) Reference sXBP1 NM_001079539 CTGAGTCCGCAGCAGGT TGTCCAGAATGCCCAACAGG Galluzzi et al., 2016 RFX1 NM_002918 CTCCCTGAACCCCCTGGA CCAGCCGCCAGTGAGATG TAP1 NM_000593 CCCAGAAGCCAACTATGGAGG AGCCTCGTCTACCTCTGTGT IL18 NM_001562 TGACTGTAGAGATAATGCACCCC AGTTACAGCCATACCTCTAGGC BCAP31 NM_001139457 TGCTGTCCTTCCTGCTTAGA CACTAGCACTCTCCGCCTG B2M NM_004048 ACTGAATTCACCCCCACTGA CCTCCATGATGCTGCTTACA Zhang et al., 2005 GUSB NM_000181 GCTACTACTTGAAGATGGTGATCG AGTTAGAGTTGCTCACAAAGGTC Galluzzi et al., 2016 The miRWalk 2.0 (Dweep and Gretz, 2015) and miRTarBase (Chou et al., 2018) databases for experimentally validated microRNA-target interactions were used for miR-346 target identification. [score:5]
miR-346 is Upregulated in U937 and THP-1-Derived Macrophages Infected With L. (L. ) infantum and L. (V. ) sp. [score:4]
[∗] p < 0.05; [∗∗] p < 0.01. miR-346 is Upregulated in U937 and THP-1-Derived Macrophages Infected With L. (L. ) infantum and L. (V. ) sp. [score:4]
ER Stress Induces Upregulation of miR-346 in Human Monocytic Cell Line. [score:4]
The transfection with the miR-346 inhibitor resulted in a significant increase in relative amount of RFX1 mRNA, compared to cells transfected with miRNA inhibitor negative control (Figure 5A). [score:4]
However, a significant upregulation of miR-346 was detected after 24 h infection with L. (L. ) infantum (Figure 2A). [score:4]
However, experiments with the miR-346 inhibitor indicated that miR-346 has a role in the regulation of RFX1 mRNA, but not in IL18 mRNA. [score:4]
Importantly, miR-346 (Figure 4B), as well as sXBP1 (not shown), still appeared significantly upregulated after 48 h infection. [score:4]
To further investigate whether miR-346 is involved in post-transcriptional regulation of its predicted target genes in Leishmania infection, we transfected THP-1 derived macrophages with a miR-346 inhibitor. [score:4]
A significant upregulation of miR-346 was detected, along with the induction of sXBP1, in both U937 and THP-1-derived macrophages infected with four L. (L. ) infantum strains and/or one L. (V. ) sp. [score:4]
In summary, miR-346 was found to be upregulated in two human cell line-derived macrophages infected with four different strains/isolates of L. (L. ) infantum, as well as one L. (V. ) sp. [score:4]
We hypothesized that this downregulation could be mediated by miR-346. [score:4]
It has been shown that miR-346 is induced in response to ER stress in different cell types (Calu-3, HeLa, primary glioblastoma, and primary astrocytoma cells) and that its expression is induced by sXBP1 (Bartoszewski et al., 2011). [score:3]
The expression of miR-346 and sXBP1 significantly increased in treated cells in response to all tested ER stressor molecules (Figure 1). [score:3]
To assess the potential effects of infection -induced miR-346, four genes (TAP1, IL18, BCAP31, RFX1) were selected among the predicted targets of miR-346 based on information in the literature and on their function in relation to the immune response. [score:3]
If the role of miR-346 in the modulation of the immune response is confirmed, this molecule could be an attractive anti- Leishmania drug target. [score:3]
RFX1 mRNA Is a Target of miR-346 in Infected THP-1-Derived Macrophages. [score:3]
These results were consistent with data reported in the literature using other cell types and established a rational basis for the assessment of miR-346 expression in our infection mo del. [score:3]
strainsFirst, the expression of miR-346, as well as miR-146a and miR-126, was monitored in U937-derived macrophages infected with L. (L. ) infantum MHOM/TN/80/IPT1 as described in methods. [score:3]
Indeed, several miR-346 targets are associated with immune functions (e. g., MHC- or interferon -associated genes) (Supplementary Table S2). [score:3]
THP-1 Transfection With miR-346 Inhibitor. [score:3]
The fact that BCAP31 and TAP1 expression were not affected might be explained by the low amount of miR-346 in cell line-derived macrophages. [score:3]
In particular, the expression of miR-346, involved in the modulation of the immune response, was shown to be mediated by sXBP1 (Bartoszewski et al., 2011). [score:3]
The expression of miR-346 was then further investigated in THP-1-derived macrophages infected with L. (L. ) infantum MHOM/TN/80/IPT1, as well as human clinical isolate 31U and canine clinical isolates 1 and 2. All strains induced miR-346 and sXBP1 expression (Figures 3A,B). [score:3]
In order to identify the transcripts targeted by miR-346 in infected macrophages, we used the validated module of miRWalk 2.0 and miRTarBase. [score:3]
First, the expression of miR-346, as well as miR-146a and miR-126, was monitored in U937-derived macrophages infected with L. (L. ) infantum MHOM/TN/80/IPT1 as described in methods. [score:3]
THP-1 cells were treated with tunicamycin and DTT as ER stressors and sXBP1 and miR-346 expression were monitored as described in methods. [score:3]
In Silico Identification of miR-346 Targets. [score:3]
A significant dysregulation of miR-346 has never been reported in Leishmania infection. [score:2]
MiR-346 plays a role in the modulation of the immune response by targeting MHC -associated genes or interferon-inducible genes (Bartoszewski et al., 2011). [score:2]
It is also noteworthy that miR-346 was poorly expressed (C [t] > 32) in monocytic cell lines compared to miR-146a and miR-126. [score:2]
Alternatively, it could reflect a more complex regulation of miR-346 transcription, in which some other factors may be involved. [score:2]
Therefore, IL18 and RFX1 were more likely to be regulated by the poorly represented miR-346 in our infection mo del. [score:2]
Since miR-346 has been shown to have a role in both the modulation of the immune response and in cell survival under ER stress, antisense strategy against this target could be considered for anti- Leishmania approaches. [score:2]
Moreover, miR-346 has been shown to act as a pro-survival factor under ER stress in HeLa cells, by promoting autophagy. [score:1]
The cDNA synthesis for three microRNAs (miR-126, miR-146a, and miR-346) was performed by TaqMan [TM] MicroRNA Reverse Transcription Kit (Applied Biosystems) using 12.5 ng of total RNA. [score:1]
TAP1 is one of the best characterized miR-346 target and it is involved in the pumping of degraded cytosolic peptides across the endoplasmic reticulum into the membrane-bound compartment where MHC class I molecules assemble. [score:1]
miR-346 functions as a pro-survival factor under ER stress by activating mitophagy. [score:1]
Indeed, its silencing could lead to a more efficient immune response and/or to early death of infected macrophages, since miR-346 was also shown to protect cells from death under ER stress. [score:1]
In other words, the magnitude of the induction of sXBP1 did not appear to be proportionally related to the induction of miR-346. [score:1]
To explore the potential role of miR-346 in Leishmania infection, we first determined whether miR-346 could be induced following ER stress in a monocytic cell line. [score:1]
Interestingly, it has been shown that miR-346 is induced by sXBP1 during ER stress in various cell types (Bartoszewski et al., 2011). [score:1]
In light of these findings, and considering that Leishmania infection elicited sXBP1, we investigated miR-346 expression in human cell line-derived macrophages infected with Leishmania parasites. [score:1]
In particular, miR-346 was shown to promote mitophagy, thus reducing the ROS level in the cell (Guo et al., 2018). [score:1]
[1 to 20 of 58 sentences]
4
[+] score: 46
The expressions of miR-711, miR-714, miR-744, miR-2137, miR-5130, miR-1892, miR-328, miR-346, miR-5099, and miR-705 were significantly upregulated in I/R injured heart grafts, while miR-490, miR-491, miR-210, miR-362, miR-24, miR-423, miR-128, miR-328, miR -181, and miR-532 were downregulated. [score:9]
As compared with cells under normxia, miR-711, miR-714, miR-328, miR-346, miR-210, miR-744, miR-5130, miR-181a and miR-2137 were significantly over-expressed in hypoxia/reperfusion treated cardiomyocytes, while the expression of miR-491, miR-211, miR-532, miR-185, miR-425, miR-128, miR-24 was down-regulated (Figure 4B). [score:7]
The findings of our study demonstrate that miR-711, miR-2137 miR-705, miR-5130, miR-346, miR-714, and miR-744 were significantly upregulated (>2 fold change) in I/R injured hearts, while miR-210, miR-490, miR-491, miR-425, miR-423-3p, and miR-532-3p were downregulated. [score:7]
Our data also showed that miR-346 was highly expressed in normal heart tissues and upregulated by I/R. [score:6]
There are 90 putative targets of miR-346 predicted by the TargetScan. [score:5]
It has been demonstrated that miR-346 can target receptor-interacting protein 140 (RIP140), TNFα, Leukemia inhibitory factor (LIF), IL18 and antigen peptide transporter 1 (TAP1) [56], [59], [60]. [score:5]
The expression of LIF was decreased in the I/R injured heart grafts (data not shown), indicating miR-346 may negatively regulate LIF. [score:4]
The expression of miR-346 was positively correlated with the severity of ischemic injury in a mouse hepatic ischemia/reperfusion injury mo del [58]. [score:3]
[1 to 20 of 8 sentences]
5
[+] score: 45
Specifically, in miR-153 transfected ALCs, the expression of miR-3085 and miR-346 was upregulated compared with negative control siRNA, while the expression of miR-298, miR-135a, miR-376b and miR-203 was downregulated (P < 0.05) (Fig. 3b and). [score:10]
In miR-153 transfected ALCs compared with negative control siRNA transfected ALCs, the expression of miR-3085 and miR-346 was upregulated, while the expression of miR-298, miR-135a, miR-376b and miR-203 was downregulated. [score:10]
The expression of miR-203 did not show any statistically significant changes in response to EMD uptake in either cell mo del; and, decreased expression of miR-346 was only significant in ALCs (Fig. 6a,b and). [score:5]
The expression of miR-203 did not show any statistically significant changes in response to EMD uptake in either cell mo dels (a, b), and decreased expression of miR-346 was only significant in ALCs (a). [score:5]
MiR-31, miR-21, miR-135a, miR-138, miR-203 and miR-346 showed statistically significant differential expression between the two ameloblast-like cell mo dels. [score:3]
There were statistically significant differences in the expression of miR-138 and miR-346 in LS8 cells transfected by miR-153 and by negative control siRNA. [score:3]
Additionally, miR-31, miR-21, miR-135a, miR-138, miR-203 and miR-346 showed significantly differential expression patterns between ALCs and LS8 cells (P < 0.05) (Fig. 3a and). [score:3]
In addition there were statistically significant differences in the expression of miR-138 and miR-346 in LS8 cells transfected by miR-153 and by negative control siRNA (P < 0.05) (Fig. 3c and). [score:3]
In the significantly enriched functional categories, such as those labeled with ‘endosome membrane’ or ‘lysosomal lumen’, miR-153 together with miR-3085, miR-298, miR-138, miR-135a, miR376b, miR-203 and miR-346 were predicted to be epigenetic regulators involved in endocytosis and endosomal/lysosomal pathways 11. [score:2]
In order to identify that ALCs and LS8 cells are suitable mo dels for investigating the functional role of miR-153, the baseline expression of miR-153 (along with miR-31, miR-21, miR-223, miR-410, miR-3085, miR-298, miR-135a, miR-138, miR376b, miR-203 and miR-346) was quantified by real-time PCR. [score:1]
[1 to 20 of 10 sentences]
6
[+] score: 23
Interestingly miR-346 has also been shown to target receptor-interacting protein 140 (RIP140) mRNA, and thereby upregulate its protein expression without altering mRNA levels [74]. [score:8]
The result of this comparison is expressed in Supplementary Figure 1. It appears, based on the miRz database, that some of the twelve dysregulated miRNAs, most notably miR-210, miR-294, and miRs-466f-5p are highly expressed in several tissues, whereas others (miR-139-3p, miR-197, miR-1896, miR-346, and miR-1906) have not been detected. [score:6]
Another miRNA that was found to be downregulated in embryos of B[a]P exposed fathers relative to embryos of control fathers was miR-346. [score:4]
The reduced expression of miR-346 observed in embryos of exposed fathers in the present study could indicate reduced RIP140 transrepression of gene regulation. [score:4]
MiR-346 has been shown to be involved in regulation of carcinogenesis, inflammatory response, and differentiation [71– 73]. [score:1]
[1 to 20 of 5 sentences]
7
[+] score: 11
The number of target genes predicted for each differentially expressed miRNA varied from 4 (miR-223) to 490 (miR-346*), with an average of 168 for up-regulated miRNAs and 96 for down-regulated miRNAs (Figure 2A and B). [score:11]
[1 to 20 of 1 sentences]
8
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-138-2, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
MicroRNA mir-346 targets the 5′-untranslated region of receptor-interacting protein 140 (RIP140) mRNA and up-regulates its protein expression. [score:10]
[1 to 20 of 1 sentences]
9
[+] score: 9
Overexpression of miR-346 activates Wnt/β-catenin and increases downstream gene expression by targeting Tcf-1 and inhibiting glycogen synthase kinase-3β, which promotes osteogenic differentiation [41]. [score:9]
[1 to 20 of 1 sentences]
10
[+] score: 8
Out of 12 miRNA families that were predicted to target the PRKAG1 sense promoter in both human and mouse, nine (miR-718, miR-1224, miR-188, miR-346, miR-296, miR-671, miR-221, miR-1306, miR-506) can form highly stable duplex structures with their target sites (MFE ≤ −30 kcal/mol) in both organisms. [score:5]
In addition, six families (miR-34, miR-718, miR-346, miR-671, miR-340, miR-1306) target upstream sequences that contain previously reported AGO binding sites in both organisms. [score:3]
[1 to 20 of 2 sentences]
11
[+] score: 8
The five highest-ranking miRNA candidates that are binding targets of each circRNA were identified as: 1) For mmu_circRNA_40001:mmu-miR-466f, mmu-miR-466i-5p, mmu-miR-669n, mmu-miR-1187, and mmu-miR-466c-5p; 2) For mmu_circRNA_013120: mmu-miR-6541, mmu-miR-669c-3p, mmu-miR-466f-5p, mmu-miR-669m-5p, and mmu-miR-466j; and 3) For mmu_circRNA_40806: mmu-miR-7038-3p, mmu-miR-20a-3p, mmu-miR-145a-3p, mmu-miR-346-3p, and mmu-miR-149-5p. [score:3]
For example, among the observed circRNA/miRNA interactions, the potential miRNA targets of mmu_circRNA_40806 include miR-149-5p, mmu-miR-346-3p, and mmu-miR-20a-3p. [score:3]
Furthermore, another previous study indicates that mmu-miR-346-3p regulates cell viability through the mTOR signaling pathway in mouse embryonic fibroblast cells treated with polyethylenimine [31]. [score:2]
[1 to 20 of 3 sentences]
12
[+] score: 6
The 5′ UTR of the RIP140 mRNA has been found to be targeted by microRNA (miRNA) mir-346. [score:3]
Rather than silencing RIP140 expression, mir-346 has been found to function in an atypical manner, increasing the protein levels and therefore the repressive activity of the cofactor, but a miRNA antagomir can be used to dampen RIP140 activity [129]. [score:3]
[1 to 20 of 2 sentences]
13
[+] score: 6
Among these nine miRNAs, miR-615, miR-193b and miR-346 were upregulated after inhibition of uc. [score:6]
[1 to 20 of 1 sentences]
14
[+] score: 6
In this study, five miRNAs (miR-29a, miR-29b, miR-126*, miR-127-3p, miR324-3p) were found upregulated and four (miR-188-5p, miR-25, miR-320a, miR-346) downregulated in both quiescent and active UC compared to healthy controls (Fasseu et al., 2010). [score:6]
[1 to 20 of 1 sentences]
15
[+] score: 5
Figure 3 Intracellular fold change analysis of miR-143-3p, miR-145-5p and miR-346 in HMEC-1 cells incubated with EVs from H1437 cells over expressing miR-143, miR-145 and miR-Scramble, compared to HMEC-1 cells receiving no. [score:2]
Intracellular fold change analysis of miR-143-3p, miR-145-5p and miR-346 in HMEC-1 cells incubated with EVs from H1437 cells over expressing miR-143, miR-145 and miR-Scramble, compared to HMEC-1 cells receiving no. [score:2]
On the other hand, HMEC-1 cells showed no significant changes in intracellular levels of a miRNA (miR-346) that was not found in EVs from H1437 cells (Figure 3). [score:1]
[1 to 20 of 3 sentences]
16
[+] score: 5
Among these miRNAs, the expression of 10 miRNAs (miR337, miR714, miR346, miR500, miR101b, miR434, miR501, miR410, miR672 and miR425) was significantly decreased, and we therefore did not further examine the expression levels of these molecules by using quantitative RT-PCR (qRT-PCR). [score:5]
[1 to 20 of 1 sentences]
17
[+] score: 5
Expression of the miR-346-5p miRNA in BXD mice was not correlated with impulsivity (Table 3), and therefore was not included into further analyses. [score:3]
A product of the mir-346 gene is a hairpin-shaped mir-346 precursor, which gives rise to two mature miRNAs: miR-346-5p and miR-346-3p (Figure 2C), of which the former is a predominant form. [score:1]
Despite a substantial size of this locus (6.9 Mb), it contains only a single miRNA gene (chr14:34,894,609–34,894,706) called mir-346 (Figure 2B). [score:1]
[1 to 20 of 3 sentences]
18
[+] score: 3
Examples of such miRNAs include those that show enriched expression in brain tissue such as miR-451 and miR-488 (see [32]) and miRNAs that have been implicated in the etiology of other tumor types, such as miR-346 in follicular thyroid carcinoma [36]. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 3
miRNA Fold change at 3 dpi Fold change at 5 dpi mmu-miR-466h-3p NS (Not significant) 14.311053 mmu-miR-346-5p NS 3.4766614 mmu-miR-877-3p NS 3.416667 mmu-miR-7a-5p NS 2.1413074 mmu-miR-5107-5p NS −2.047792 mmu-miR-3473a −2.2872427 −2.1317267 mmu-miR-150-5p NS −2.1770155 mmu-miR-3473b −3.2475147 −2.282881 mmu-miR-721 NS −2.6864858 mmu-miR-669b-5p NS −2.9408455 mmu-miR-709 NS −3.0065749 mmu-miR-669n NS −3.0094464 mmu-miR-468-3p NS −3.40051 mmu-miR-466m-5p NS −4.33538 mmu-miR-32-3p NS −4.5324426 mmu-miR-466h-5p NS −4.9673104 mmu-miR-3082-5p NS −6.01648 mmu-miR-466i-5p NS −7.6776285 mmu-miR-1187 NS −8.772696 mmu-miR-574-5p NS −9.259378 To confirm the validity of the differentially expressed miRNAs that had been identified by microarray analysis, we performed real-time PCR on all 20 of these miRNAs using the polyA tailing technique. [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-mir-34c, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, hsa-mir-381, mmu-mir-375, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-346, hsa-mir-196b, mmu-mir-196b, hsa-mir-18b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, mmu-mir-92b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Mir-136 and mir-718 were not detectable in the adipocyte cultures using the Taqman assays-on-demand, while mir-346, mir-298, mir-330 and mir-501 were expressed at low levels (Ct levels above 33), see Table 1. This suggests that currently there is no gold standard method (when RNA is limiting) to validate miRNA data profiles. [score:2]
5 miR-298 33.2 ±0.2 33.8 ±0.2 33.5 ±0.6 33.5 ±0.4 miR-346 35.7 ±1.1 36.4 ±0.8 35.7 ±0.6 34.7 ±0.4 miR-501 34.5 ±0.9 34.4 ±0.9 34.6 ±0.1 34.4 ±0.4 miR-718 ND ND ND ND miR-720 22.5 ±0.3 22.9 ±0.1 23.4 ±0.4 22.9 ±0. [score:1]
[1 to 20 of 2 sentences]
21
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
1Proliferation, Invasion, Tumor suppression [63– 66] miR-344 ↓2.0 ↓3.2 NA miR-346 ↓2.4Proliferation [67, 68] miR-362 ↓2.3Proliferation, Invasion, Apoptosis [69– 76] miR-369 ↓2.8 ↓2.6 ↓2.1Aerobic glycolysis [77] miR-374 ↑3.0 ↓2.2 NA miR-449 ↑2.7 ↑2.4Proliferation [78– 81] miR-463 ↓2.7 NAmiR-466 [°] ↑2.4 ↑2.1 ↓3.5 NA miR-483 ↓3.2Apoptosis [82] miR-493 ↑2.1 ↓2.2Proliferation [83– 85] miR-499a ↓5.0 ↑2.3Proliferation [86] miR-504 ↓2.6 ↑2.0Proliferation, Apoptosis [87, 88] miR-579 ↑2.8 NAmiR-582 [^] ↑2.4Proliferation [89] miR-615 ↓2.1Proliferation, Invasion [90, 91] miR-652 ↑2.4Proliferation, EMT [92, 93] miR-669b ↓2.1 NA miR-669h ↓3.6 ↑2.3 NA miR-669i ↓2.3 NA miR-669k ↓7.2 ↓5. [score:3]
[1 to 20 of 1 sentences]
22
[+] score: 3
The existence of microRNAs targeting RIP140, such as miR346 discovered in the brain, that increases the stability of RIP140 proteins [39], might explain the discrepancy observed between skeletal muscles. [score:3]
[1 to 20 of 1 sentences]
23
[+] score: 2
Other miRNAs from this paper: hsa-mir-346
Moreover, ER-stress induced miR-346 negatively regulates mRNA for the antigen peptide transporter 1 (TAP1), which might explain the reduced MHC class I presentation during ER-stress [51]. [score:2]
[1 to 20 of 1 sentences]
24
[+] score: 1
These are mir-26b, mir-29a, mir-34b, mir-92-1, mir-93, mir-133a-1, mir-133a-2, mir-193, mir-221, mir-223, mir-301, mir-323 and mir-346. [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
age-matched WT mice, we detected a significant lower abundance of miR-132, miR-138, miR-139, miR-146a, miR-146b, miR-22, miR-24, miR-29a, and miR-29c as well as a higher abundance of miR-346 (Figure 4, Supplementary Table 4). [score:1]
[1 to 20 of 1 sentences]