sort by

117 publications mentioning mmu-mir-10a (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-10a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 397
To build up the direct link between the activation of Akt and increased cell survival, we used an inhibitor (Akt Inhibitor VI) to inhibit the phosphorylation (activation) of Akt in the miR-10a -overexpressed old hBM-MSCs (O-10a-P-AKT Inh; Additional file  9: Figure S8A). [score:10]
Furthermore, inhibition of miR-10a target gene KLF4 also increased both cell survival and the antiapoptotic-related protein expression while it decreased cellular apoptosis and the proapoptosis-related protein expression. [score:9]
Expression of Akt phosphorylation in miR-10a -overexpressed old hBM-MSCs (O-10a) inhibited by Akt Inhibitor VI during 72-h culture under hypoxia conditions. [score:9]
In addition, we found that miR-10a overexpression or KLF4 downregulation increased VEGF and SDF expression and secretion. [score:8]
Downregulation of miR-10a or overexpression of KLF4 in old hBM-MSCs increased apoptotic gene expression. [score:8]
Lentiviral vectors used to transduce old hBM-MSCs to downregulate miR-10a expression (O-anti10a) or overexpress KLF4 (O-KLF4). [score:8]
Angiogenesis and expression of angiogenic factors determined in mice that received implantation of control vector-transduced young hBM-MSCs (Y-c), control vector-transduced old hBM-MSCs (O-c), miR-10a -overexpressed old hBM-MSCs (O-10a), or KLF4 -inhibited old hBM-MSCs (O-antiKLF4) into border region immediately following MI. [score:7]
miR-10a upregulation or KLF4 downregulation increased old hBM-MSC survival and decreased apoptosis by activating AKT. [score:7]
To inhibit Akt phosphorylation in the miR-10a -overexpressed old hBM-MSCs, 50 μM Akt Inhibitor VI (catalog number 124013; Merck) was used to treat the cells for 72 h under hypoxia conditions following the manufacturer’s instructions. [score:7]
Through lentivirus -mediated upregulation of miR-10a and downregulation of KLF4 in aged hBM-MSCs in vitro, we revealed that miR-10a decreased hypoxia -induced cell apoptosis and increased cell survival of aged hBM-MSCs by repressing the KLF4–BAX/BCL2 pathway. [score:7]
miR-10a -overexpressed or KLF4 -downregulated old hBM-MSCs (3 × 10 [5] cells/mouse) implanted into infarcted mouse hearts. [score:6]
Fig. 6Implantation of miR-10a -overexpressed or KLF4 -downregulated old hBM-MSCs into ischemic area of mouse hearts improved cardiac function after MI. [score:6]
However, overexpression of miR-10a (O-10a) or inhibition of KLF4 (O-antiKLF4) increased VEGF and SDF mRNA (Additional file  10: Figure S9B) and protein expression compared with that in O hBM-MSCs (Fig.   8g, h). [score:6]
In vivo, miR-10a -overexpressed or KLF4 -downregulated old hBM-MSCs were implanted into infarcted mouse hearts after myocardial infarction (MI). [score:6]
Fig. 4Downregulation of miR-10a or overexpression of KLF4 in old hBM-MSCs increased hypoxia -induced apoptosis and decreased cell survival. [score:6]
Transplantation of miR-10a -overexpressed or KLF4 -downregulated old hBM-MSCs activated AKT and stimulated angiogenesis in the ischemic hearts, thereby improving cardiac function. [score:6]
miR-10a -overexpressed or KLF4 -downregulated hBM-MSCs increased angiogenesis in infarcted mouse hearts. [score:6]
DAPI 4′,6-diamidino-2-phenylindole, TUNEL terminal deoxynucleotidyl transferase dUTP nick end labeling, RFU relative fluorescence units KLF4 is one of the targets of miR-10a and was upregulated in O hBM-MSCs. [score:6]
Our data show that miR-10a overexpression or KLF4 downregulation activated AKT both in aged hBM-MSCs and in ischemic mouse hearts. [score:6]
Lentivirus which carries KLF4 vector used to infect miR-10a -upregulated old hBM-MSCs (O-10a) to restore KLF4 expression (O-10a-KLF4). [score:6]
The molecular mechanism study revealed that transplantation of miR-10a -overexpressed or KLF4 -downregulated O hBM-MSCs activated AKT in infarcted mouse hearts, which led to increased survival of implanted cells. [score:6]
DAPI 4′,6-diamidino-2-phenylindole, KLF4 Krüpple-like factor 4, TUNEL terminal deoxynucleotidyl transferase dUTP nick end labeling, RFU relative fluorescence units To further confirm that KLF4 is indeed the direct target of miR-10a in mediating hypoxia -induced O hBM-MSC apoptosis, KLF4 expression was restored by a rescue experiment (Additional file  3: Figure S2E). [score:6]
However, overexpression of miR-10a (O-10a) or inhibition of KLF4 expression (O-antiKLF4) increased cell survival but decreased cell apoptosis when compared with the group receiving O hBM-MSCs (O-c). [score:6]
Implantation of miR-10a -overexpressed or KLF4 -downregulated old hBM-MSCs into infarcted mouse hearts improved cardiac function after MI. [score:6]
In the present study, miR-10a was overexpressed or KLF4 was downregulated in old hBM-MSCs by lentiviral transduction. [score:6]
However, overexpression of miR-10a (O-10a) or inhibition of KLF4 e (O-antiKLF4) increased VEGF and SDF mRNA and protein expression when compared with the O-c group (Fig.   8e, f). [score:6]
Downregulation of miR-10a or overexpression of KLF4 in old hBM-MSCs increased hypoxia -induced apoptosis and decreased cell survival. [score:6]
For this purpose, miR-10a -overexpressed O hBM-MSCs were transduced with a lentivirus which carried the KLF4 vector and the restoration of KLF4 expression was confirmed (O-10a-KLF4). [score:5]
Cell survival and biochemical changes determined in mice that received implantation of control vector-transduced young hBM-MSCs (Y-c), control vector-transduced old hBM-MSCs (O-c), miR-10a -overexpressed old hBM-MSCs (O-10a), or KLF4 -inhibited old hBM-MSCs (O-antiKLF4) into border region immediately following MI. [score:5]
Lentiviral constructs for overexpression of miR-10a (O-10a), KLF4 (O-KLF4), or inhibition of miR-10a and KLF4 (O-anti10a and O-antiKLF4) in hBM-MSCs were purchased from GenePharma as reported previously [7]. [score:5]
Overexpression of miR-10a in old hBM-MSCs decreased apoptotic gene expression. [score:5]
To test whether the reverse would post a detrimental effect, miR-10a was effectively inhibited in O hBM-MSCs (Additional file  3: Figure S2C) or KLF4 was overexpressed in O hBM-MSCs (Additional file  3: Figure S2D). [score:5]
Overexpression or inhibition of miR-10a or KLF4 in hBM-MSCs was achieved through lentiviral transduction. [score:5]
In the current study, we investigated whether upregulation of miR-10a or downregulation of KLF4 can rejuvenate aged hBM-MSCs and improve aged hBM-MSC survival when transplanted into ischemic mouse hearts. [score:5]
Cardiac function was determined by echocardiography in mice that received implantation of control medium (Media), control vector-transduced young hBM-MSCs (Y-c), control vector-transduced old hBM-MSCs (O-c), miR-10a -overexpressed old hBM-MSCs (O-10a), or KLF4 -inhibited old hBM-MSCs (O-antiKLF4) into the border region immediately following MI. [score:5]
Mechanistic studies revealed that overexpression of miR-10a in aged hBM-MSCs activated Akt and stimulated the expression of angiogenic factors, thus increasing angiogenesis in ischemic mouse hearts. [score:5]
Cardiac function determined by echocardiography in mice that received implantation of control medium (Media), control vector-transduced young hBM-MSCs (Y-c), control vector-transduced old hBM-MSCs (O-c), miR-10a -overexpressed old hBM-MSCs (O-10a), or KLF4 -inhibited old hBM-MSCs (O-antiKLF4) into border region immediately following MI. [score:5]
Accordingly, restoration of the miR-10a level in O hBM-MSCs increased the antiapoptotic-related protein expression and decreased the proapoptosis-related protein expression. [score:5]
They also found that downregulation of miR10a/10b in clonal cells interfered with cell proliferation and enhanced cell apoptosis by activating the NF-κB -dependent p53 pathway [13]. [score:4]
However, overexpression of miR-10a (O-10a) or inhibition of KLF4 (O-antiKLF4) increased capillary and arteriole formation when compared with the group receiving O hBM-MSC implantation only. [score:4]
To the contrary, the expression of KLF4, which was one of the targets of miR-10a, was significantly increased in O hBM-MSCs compared with Y hBM-MSCs (Fig.   1h). [score:4]
To the contrary, downregulation of miR-10a in aged hBM-MSCs increased hypoxia -induced apoptosis and decreased cell survival. [score:4]
The percentage of apoptotic cells (TUNEL [+]) was significantly higher in miR-10a -inhibited old hBM-MSCs (O-anti10a) and KLF4 -overexpressed old hBM-MSCs (O-KLF4) compared with the control vector-transduced old hBM-MSCs (O-c) that were cultured for 72 h under hypoxia conditions (Fig.   4a). [score:4]
Expression of miR-10a and KLF4 in old hBM-MSCs regulated by lentiviral vector. [score:4]
In addition, Bim, the proapoptotic factor, is directly targeted by miR-10a, resulting in repressing Casp9 which is a crucial factor in the apoptotic pathway [27]. [score:4]
Consistent with previous data, we also found that upregulation of miR-10a in aged hBM-MSCs decreased hypoxia -induced apoptosis and increased cell survival. [score:4]
Another study has also shown that miR-10a inhibited KLF4 and RB1-inducible coiled-coil 1(RB1CC1) regulated cell apoptosis in acute myeloid leukemia (AML) [14]. [score:4]
On the other hand, KLF4, one of the miR-10a target genes, has been reported to play a role in regulating cell apoptosis. [score:4]
Upregulation of miR-10a in old hBM-MSCs decreased hypoxia -induced apoptosis and increased cell survival. [score:4]
All of these data implied the possible link between the downregulation of miR-10a and the increased O hBM-MSC apoptosis. [score:4]
miR-10a -upregulated old hBM-MSCs (O-10a) also infected by the control lentivirus (O-10a-c). [score:4]
DAPI 4′,6-diamidino-2-phenylindole, KLF4 Krüpple-like factor 4, TUNEL terminal deoxynucleotidyl transferase dUTP nick end labeling, RFU relative fluorescence units To evaluate whether modifying miR-10a or KLF4 levels in O hBM-MSCs can maximize the beneficial effects of stem cell therapy, miR-10a -overexpressed or KLF4 -downregulated old hBM-MSCs were implanted into infarcted mouse hearts. [score:4]
In our previous paper, using a luciferase reporter assay, we reported that KLF4 is a direct target of miR-10a. [score:3]
DAPI 4′,6-diamidino-2-phenylindole, KLF4 Krüpple-like factor 4, TUNEL terminal deoxynucleotidyl transferase dUTP nick end labeling, RFU relative fluorescence units All of this evidence suggested that miR-10a, through suppression of KLF4, may rescue O hBM-MSCs from hypoxia -induced apoptosis. [score:3]
The percentage of apoptotic cells (TUNEL [+]) was decreased in miR-10a -upregulated O hBM-MSCs (O-10a) compared with the control vector-transduced O hBM-MSCs (O-c) that were cultured for 72 h under hypoxia conditions (Fig.   2a). [score:3]
miR-10a expression was significantly higher in O-10a than in control vector-transduced (O) hBM-MSCs (A). [score:3]
We also found that miR-10a increased differentiation and decrease senescence in old hBM-MSCs through the target gene Krüpple-like factor 4 (KLF4) [7]. [score:3]
Implantation of miR-10a -overexpressed old hBM-MSCs into the ischemic area of mouse hearts improved cell survival and cardiac function after MI. [score:3]
Previous studies have found that expression of miR10a/10b was controlled by TWIST-1 and via the NF-κB and P53 axis, to control TNF-α -induced (and stroma -dependent) apoptosis in clonal myeloid cells. [score:3]
After restoring the expression of KLF4, miR10a lost its antiapoptotic effect on O hBM-MSCs. [score:3]
miR-10a overexpression increased old hBM-MSC survival and decreased apoptosis by activating AKT. [score:3]
DAPI 4′,6-diamidino-2-phenylindole, hBM-MSC human mesenchymal stem cell, KLF4 Krüpple-like factor 4, MI myocardial infarction, SDF stromal cell-derived factor, VEGF vascular endothelial growth factor The present study demonstrated that restoring the miR-10a level in O hBM-MSCs increased cell survival and decreased apoptosis under in-vitro hypoxia and in-vivo ischemic conditions by repressing the expression of KLF4. [score:3]
All of this evidence led us to postulate that miR-10a may mitigate cellular apoptosis of aged hBM-MSCs through its target gene KLF4. [score:3]
miR-10a expression was significantly lower in O-anti10a than in control vector-transduced O hBM-MSCs (C). [score:3]
Our study demonstrated that miR-10a decreased aged hBM-MSC apoptosis and increased cell survival through suppression of KLF4. [score:3]
Furthermore, transplantation of miR-10a or anti-KLF4-pretreated O hBM-MSCs increased the expression and secretion of angiogenic factors VEGF and SDF, which increased angiogenesis in infarcted mouse hearts. [score:3]
Fig. 2Overexpression of miR-10a in old hBM-MSCs decreased hypoxia -induced apoptosis and increased cell survival. [score:3]
Overexpression of miR-10a in both young and old hBM-MSCs decreased hypoxia -induced apoptosis and increased cell survival. [score:3]
We also examined the effects of miR-10a on Y hBM-MSCs and found that cell apoptosis was decreased (Additional file  5: Figure S4A) and cell survival (Additional file  5: Figure S4B) was increased in miR-10a -upregulated Y hBM-MSCs (Y-10a) compared with the control vector-transduced Y hBM-MSCs (Y-c). [score:3]
Therefore, the TWIST-1/miR10/p53 axis can serve as a potential new target for therapeutic interventions in advanced myelodysplastic syndromes [13]. [score:3]
In vivo, transplantation of miR-10a -overexpressed aged hBM-MSCs promoted implanted stem cell survival and improved cardiac function after MI. [score:3]
Indeed, some studies have shown that miR-10a and KLF4 regulate cell apoptosis in other cell types [13, 14]. [score:2]
The expression of miR-10a was significantly decreased in O hBM-MSCs compared with Y hBM-MSCs (Fig.   1g). [score:2]
On the other hand, knockdown of miR-10a in the NPM1 mutated cell line OCI-AML3 decreased cellular survival and clonogenic growth [14]. [score:2]
DAPI 4′,6-diamidino-2-phenylindole, hBM-MSC human mesenchymal stem cell, KLF4 Krüpple-like factor 4, MI myocardial infarction, TUNEL terminal deoxynucleotidyl transferase dUTP nick end labeling To determine whether angiogenesis is also affected by regulating the miR-10a or KLF4 level in O hBM-MSCs, capillary and arteriole densities were quantified by isolectin stain (Fig.   8a, b) and α-smooth muscle actin (α-SMA) stain (Fig.   8c, d) respectively in all four experimental groups at 3 and 7 days post MI. [score:2]
We speculated that miR10a may also have additional effects related to cellular apoptosis and survival to regulate aged hBM-MSC function. [score:2]
Expression of (g) miR-10a and (h) KLF4 compared in Y and O hBM-MSCs. [score:2]
However, other studies have suggested that miR-10a may have additional effects other than regulating cell senescence and differentiation. [score:2]
miR-10a is also reported to regulate cell apoptosis in the human cumulus–oocytes complex [26]. [score:2]
All of these data clearly demonstrated that modifying the miR-10a or KLF4 level in O hBM-MSCs enhanced the beneficial effects of stem cell therapy and further improved cardiac function. [score:1]
miR-10a delivered by exosomes sustains the number of chemotherapy-damaged granulosa cells and reduces the number of chemotherapy-damaged apoptotic granulosa cells following nitrogen mustard treatment for 24–48 h [28]. [score:1]
To determine whether KLF4 was involved in miR-10a -mediated cellular apoptosis, we effectively inhibited KLF4 in O hBM-MSCs (Additional file  3: Figure S2B) and evaluated cell apoptosis. [score:1]
Here, we have shown that restoring miR-10a in aged hBM-MSCs increased cell survival and decreased apoptosis when transplanted into the ischemic mouse hearts. [score:1]
We believe these results showed that miR-10a, through activating Akt, increased cell survival whereas inactivation of Akt reversed this effect. [score:1]
miR-10a has also been reported as a prosurvival factor. [score:1]
miR-10a rejuvenated aged hBM-MSCs which improved angiogenesis and cardiac function in injured mouse hearts. [score:1]
miR-10a and KLF4 -modified stem cells could be a potent vehicle to combine cell and gene therapies to improve heart function after injury. [score:1]
Fig. 5Antiapoptotic effect of miR-10a attenuated by restoration of KLF4. [score:1]
To evaluate the antiapoptotic effect of miR-10a in vivo, the survival of implanted cells was detected by lentiviral -mediated GFP expression in the border region of the mouse hearts at 3 days (Fig.   7a, b) and 7 days (Fig.   7c, d) post MI. [score:1]
miR-10a transduced into young (Y-10a) and old (O-10a) hBM-MSCs by lentiviral vector. [score:1]
Antiapoptotic effect of miR-10a attenuated by restoration of KLF4 quantified by RT-qPCR. [score:1]
miR-10a transduced into old hBM-MSCs by lentiviral vector (O-10a). [score:1]
We demonstrated previously that miR-10a is significantly decreased in aged hBM-MSCs and restoration of the miR-10a level attenuated cell senescence and increased the differentiation capacity of aged hBM-MSCs by repressing Krüpple-like factor 4 (KLF4). [score:1]
Our data suggested that miR-10a increased the survival of aged hBM-MSCs which in turn secreted more VEGF and SDF to stimulate angiogenesis in the infarcted hearts. [score:1]
The effect of miR-10a on cellular apoptosis has been reported recently. [score:1]
After culture for 72 h under hypoxia conditions, apoptosis was detected with the TUNEL assay (Additional file  9: Figure S8B) and cell survival was detected by CCK-8 assay in control vector-transduced (O-c), miR-10a -overexpressed (O-10a), and O-10a-P-AKT Inh old hBM-MSCs. [score:1]
We believe the antiapoptotic effect of miR-10a may be mediated through activation of AKT. [score:1]
Also, miR-10a decreased cell senescence in aged hBM-MSCs by repressing KLF4 [7]. [score:1]
The antiapoptotic effect of miR-10a is attenuated by the restoration of KLF4. [score:1]
All of these effects of miR-10a ultimately led to enhanced efficacy of stem cell therapy and the improvement of cardiac function after MI. [score:1]
Lentiviral vector carrying miR-10a sequence used to transduce old hBM-MSCs (O-10a) and control vector-transduced old hBM-MSCs (O-c) served as control. [score:1]
All of these findings support the notion that miR-10a is a prosurvival factor, which counteracts the apoptotic signals. [score:1]
In vivo, miR-10a -overexpressed hBM-MSCs were implanted into the border region of mouse hearts following myocardial infarction (MI), and cardiac function and related biological changes were investigated. [score:1]
The Lenti-miR-10a sequence was TACCCTGTAGATCCGAATTTGTG. [score:1]
Lentiviral vector carrying anti-miR-10a sequence used to transduce old hBM-MSCs (O-anti10a). [score:1]
Collectively, these data revealed that miR-10a, through activation of AKT, increased hBM-MSC survival, thus improving cardiac function. [score:1]
Our previous study found that miR-196a, miR-486-5p, miR-664-star, and miR-378-star were significantly increased whereas miR-10a, miR-708, and miR-3197 were decreased in old hBM-MSCs. [score:1]
The effects of miR-10a on Y hBM-MSC apoptosis and survival followed the same trend as in O hBM-MSCs but at a much lower magnitude. [score:1]
DAPI 4′,6-diamidino-2-phenylindole, KLF4 Krüpple-like factor 4, TUNEL terminal deoxynucleotidyl transferase dUTP nick end labeling, RQ relative quantity, RFU relative fluorescence units Next, to further test whether miR-10a was related to O hBM-MSC apoptosis, miR-10a was overexpressed in O hBM-MSCs (Additional file  3: Figure S2A) and cellular apoptosis was evaluated. [score:1]
These findings suggested that restoring the miR-10a level reduced hypoxia -induced apoptosis in O hBM-MSCs. [score:1]
[1 to 20 of 110 sentences]
2
[+] score: 372
Other miRNAs from this paper: mmu-mir-10b, mmu-mir-184
Interestingly, intestinal miR-10a expression has previously been shown to be downregulated by microbiota in mice [75], and considering the antibacterial functions of Lpo in innate immunity, it is alluring to suggest that miR-10 could function as the sensor of immune stimuli in this environment where its downregulation would induce Lpo as an antibacterial mechanism in normal epithelium. [score:9]
Lactoperoxidase (Lpo) was strikingly deregulated between miR-10a KO and WT intestines and our data suggests that LPO is an indirect target of miR-10a, being directly regulated by the transcription factor and primary miR-10a target KLF4. [score:9]
Instead we obtained evidence supporting a mo del where LPO expression is regulated by the primary miR-10a target KLF4, which is indeed over-expressed in the intestines of miR-10a KO mice. [score:8]
Altogether, these results suggest that Lpo is not directly regulated by miR-10a via cognate interaction with target sites in the mRNA but instead that Lpo is regulated at the transcriptional level, probably by one or several primary targets of miR-10a. [score:8]
This could, in part, explain the lack of detected variation in the expression levels of direct miR-10a targets (including Klf4) in our microarray experiments, since the occurrence of small degrees of deregulation of primary targets could have a measurable effect only upon convergence in a secondary node. [score:7]
Co -expression of miR-10 and Hox genes during development [6], [7] and experimental evidence of miR-10 targeting of HOX transcripts [8]– [10] has suggested a role for this miRNA family in development. [score:7]
Figure S3Relative expression levels of known miR-10a targets and genes with oncogenic or tumor suppressor potential relevant in intestinal tumorigenesis. [score:7]
Importantly, both up- and downregulation of miR-10 has been reported in several cancers and although the number of studies where such deregulation was causally linked to the pathogenesis of cancer remains scarce (for a review, see [4]), some miR-10 targets have been demonstrated to be mechanistically linked to metastasis, invasion and migration as well as cell proliferation [9], [10], [13]– [16]. [score:7]
al. showing an upregulation of miR-10a in stage II but not in stage I colon cancer samples [24], though the pathogenic role of miR-10a upregulation in advanced colon cancer remains to be elucidated. [score:7]
The miR-10a target Klf4 is upregulated in miR-10a KO mice and induces transcription of LPO in vitro We hypothesized that one or more transcription factors under miR-10a regulation could be responsible for enhancing LPO transcription. [score:7]
Lpo is a secondary target of miR-10a in the intestines of female mice and in human cell linesInterestingly, Lpo was identified as exceptionally highly upregulated in the intestines of miR-10a KO female mice, displaying a 9.44 fold increase in expression compared to WT (p = 1.1e-6; adjusted for multiple testing). [score:7]
We defined three datasets: upregulated set (296 transcripts) with P-values≤0.05 and log FC>0, upregulated set (156 transcripts) with P-values≤0.05 and log FC<0, and no change set containing 323 transcripts from the gene set with P-value near 1. HCT-116 cells were seeded in 6-well plates and reverse transfected with 50 nM Allstars negative control (Qiagen; Cat: 1027281) or a miR-10a duplex (Ambion; AM17100, PM10787) using Lipofectamine2000 (Invitrogen). [score:7]
The miR-10a target Klf4 is upregulated in miR-10a KO mice and induces transcription of LPO in vitro. [score:6]
Nevertheless, these results are in agreement with the virtual lack of phenotypic differences upon inhibition or overexpression of miR-10 during zebra fish development [7]. [score:6]
Interestingly, we find that loss of miR-10a mediates an increase in intestinal adenomas in female mice only and delineate the pathway to involve aberrant upregulation of the miR-10a target Klf4 and subsequent transcriptional activation of the Lpo gene encoding the antibacterial protein Lactoperoxidase. [score:6]
Klf4, a zinc finger-type transcription factor primarily expressed in the gastrointestinal tract, is an important regulator of differentiation and cell growth arrest of the colonic epithelium and was previously shown to be regulated by miR-10a [50], [51]. [score:5]
Consistently, all stained WT samples had faint Lpo signal in a limited area of the intestine thus scoring low expression while the majority of miR-10a KO tissue samples had a significantly more intense Lpo signal and a more widespread Lpo expression pattern, thus scoring medium to high (Figure 3C and 3D). [score:5]
From the obtained lists of transcription factors, we extracted those that were predicted as putative miR-10a targets by TargetScan [49] and pursued the analysis of one interesting candidate: Krüppel-like factor 4 (Klf4). [score:5]
By the indirect upregulation of Lpo levels in the intestinal epithelium, miR-10a deficiency in these mice creates an environment where estrogen could be transformed into potent depurinating mutagens that can ultimately lead to the initiation of cancer and tumor formation. [score:5]
Of notice, although not tested experimentally, our bioinformatics approach identified other transcription factors representing primary miR-10a targets with putative binding sites in the LPO promoter, suggesting that additional factors may participate in the indirect regulation of LPO by miR-10a. [score:5]
The targeting vector was introduced into embryonic stem (ES) cells, selected with G418 and correctly targeted clones with the genotype miR-10a [+/neo] were identified by Southern blotting (data not shown). [score:5]
Interestingly, Lpo was identified as exceptionally highly upregulated in the intestines of miR-10a KO female mice, displaying a 9.44 fold increase in expression compared to WT (p = 1.1e-6; adjusted for multiple testing). [score:5]
Similar degrees of Lpo upregulation were obtained in male miR-10a KO mice (data not shown). [score:4]
Although adaptation to loss of miR-10a or functional redundancy by the remaining miR-10b could account for the invariable levels of miR-10 intestinal targets in the absence of miR-10a, low levels of mRNA deregulation upon miRNA alterations have been previously observed [39], [40]. [score:4]
Given the importance of genome stability in the initiation and progression of intestinal tumorigenesis [48], a similar mechanism might be involved in the phenotype observed in miR-10a [−/−];Apc [Min] female mice, i. e. the upregulation of Lpo in miR-10a KO mice would enhance estrogen oncogenic activation, leading to a highly instable genomic environment. [score:4]
1003913.g005 Figure 5Klf4 is upregulated in miR-10a KO intestines. [score:4]
Furthermore, and as mentioned above, not only Klf4 but likely other primary targets of miR-10a are also involved in the regulation of Lpo. [score:4]
1003913.g003 Figure 3 Lpo is transcriptionally upregulated in the intestines of miR-10a deficient female mice. [score:4]
Furthermore, profiling studies have shown that miR-10a expression is deregulated in human colon cancer [9], [24], [25]. [score:4]
Our results are in contrast with reports of miR-10a upregulation in colon cancer samples [24], [25]. [score:4]
Here we showed that Lpo is constitutively upregulated in the intestinal epithelium of miR-10a [−/−] mice and that when these mice were crossed with Apc [Min] mice, females displayed a significantly increased tumor burden in their intestinal epithelium. [score:4]
Lpo is transcriptionally upregulated in the intestines of miR-10a deficient female mice. [score:4]
To determine whether Lpo was a direct target of miR-10a, via the putative binding sites identified in the 5′ UTR and the CDS of the gene, luciferase reporters holding the 5′ UTR, the entire CDS or a fragment of the CDS containing the most potent binding site were constructed. [score:4]
Klf4 is upregulated in miR-10a KO intestines. [score:4]
Further qRT-PCR analysis of Lpo transcripts in intestinal samples using primers in intronic and exonic sequence elements, revealed that the primary transcript of Lpo was upregulated in miR-10a KO samples to similar levels as the Lpo mRNA (Figure S4C and S4D), indicating that Lpo deregulation is transcriptional. [score:4]
Transcript abundance of selected oncogenes and tumor suppressors, relevant in intestinal tumorigenesis or previously predicted as miR-10a targets but not detected in the microarray, were also unchanged in miR-10a deficient compared to WT intestines (Figure S3). [score:4]
In addition, we did not detect any enrichment for predicted miR-10a targets among the deregulated transcripts. [score:4]
Regarding the regulatory mechanism, the Lactoperoxidase mRNA does not contain a miR-10a target site in its 3′UTR. [score:4]
Although 452 transcripts were significantly deregulated in the miR-10a KO samples compared to WT (P≤0.05), the levels of up- or downregulation were modest and only three protein coding genes had false discovery rates (FDR) lower than 15% (Table S2). [score:4]
However, as suggested in our study, oncogenic downregulation of miR-10a might be a very early event promoting cellular transformation by a similar mechanism to the one previously described for Lpo in mammary carcinoma [44]. [score:4]
Identification of miR-10a targets in the intestines of female mice. [score:3]
Functional interactions between microRNAs and target sites in other locations than the 3′UTR have been described before, including for miR-10a [69]– [74]. [score:3]
Figure S4 Lpo is a secondary target of miR-10a. [score:3]
Importantly, miR-10a mediated repression of this target was also observed at the protein level (Figure 4B). [score:3]
Scale bar 100 µm (C) VisiomorphDP software scoring of Klf4 expression level estimated by distribution and staining intensity in Klf4 stained intestines of WT and miR-10a KO mice. [score:3]
Comparison of Klf4 expression between miR-10a [+/+] (n = 5) and miR-10a [−/−] (n = 8) mice was done by Students t-test and the analysis revealed a significant scoring difference (p = 0.019) between the two genotypes. [score:3]
miR-10a (A) and miR-10b (B) expression levels in different organs of B6 mice as detected by qRT-PCR. [score:3]
Transcription factor KLF4 is regulated by miR-10a and can regulate the LPO promoter in vitro. [score:3]
Therefore, colon mRNA expression was analyzed in miR-10a KO and WT female mice using Affymetrix microarrays. [score:3]
Figure S2 miR-10 expression levels in a panel of different organs. [score:3]
Generation of miR-10a KO miceTo assess the physiological role and pathophysiological significance of miR-10a, we generated a null allele of miR-10a by gene targeting. [score:3]
The targeted locus consisted of a loxP-flanked neo selection cassette, which replaced the 70 central nucleotides of the pre-miRNA sequence of miR-10a (Figure 1A). [score:3]
Comparison of Lpo expression between miR-10a [+/+] (n = 5) and miR-10a [−/−] (n = 10) mice was done by Pearson Chi-square test with exact probability and the analysis revealed a significant scoring difference (P≤0.006) between the two genotypes. [score:3]
Despite the body of evidence suggesting a role for miR-10 in Hox regulation, the miR-10a [−/−] mice showed an absence of major developmental defects in the posterior trunk. [score:3]
1003913.g004 Figure 4Transcription factor KLF4 is regulated by miR-10a and can regulate the LPO promoter in vitro. [score:3]
Particular interest in the miR-10 family members arises from their conserved genomic location in Hox clusters and the increasing amount of evidence for their implication in vertebrate biology and human disease [4]. [score:3]
These results confirm KLF4 as a target of miR-10a as previously described [50]. [score:3]
We therefore tested the functionality of putative miR-10a binding sites in the 5′UTR and coding region of LPO, however, our results led us to exclude the possibility of a direct posttranscriptional regulation of LPO by miR-10a. [score:3]
Mammalian miR-10a and miR-10b are located upstream from HoxB4 and HoxD4 respectively and they present a very high degree of sequence conservation, differing at their eleventh nucleotide only (U and A respectively), which thermodynamically enables them to target a fully overlapping set of mRNAs [11],. [score:3]
The miR-10 miRNA family members are encoded in evolutionarily conserved loci within the Homeobox (Hox) gene clusters of developmental regulators [4], [5]. [score:3]
The targeting construct (TC) harbored a miR-10a inactivated allele, where 70 nucleotides from the pre-miRNA sequence were replaced with a neomycin resistance cassette (neo) flanked by loxP sites and long homologous regions for recombination. [score:3]
The miR-10a targeting plasmid was constructed using standard recombineering techniques. [score:3]
F1 miR-10a [neo/+] males were crossed to a ubiquitously expressing Cre mouse line to eliminate the neo resistance cassette by Cre-LoxP recombination. [score:3]
Generation of miR-10a neo/+ ES cellsThe miR-10a targeting plasmid was constructed using standard recombineering techniques. [score:3]
Here we addressed the question of the direct causal effect of miR-10a in mammalian homeostasis, with a special focus on tumor development, by generating miR-10a null mice. [score:3]
Lpo is a secondary target of miR-10a in the intestines of female mice and in human cell lines. [score:3]
Nevertheless, transcriptomic, bioinformatics and biochemical evidence allowed us to reveal a regulatory network where miR-10a can indirectly alter the levels of LPO through KLF4. [score:3]
Profiling of WT mouse tissues for miR-10a and miR-10b revealed that miR-10a was relatively highly expressed in the mouse intestinal tract (Figure S2). [score:3]
Breeding of miR-10a [+/neo] mice to a mouse strain holding an ubiquitously expressed Cre recombinase transgene [26] resulted in deletion of the miR-10a genomic sequence and its replacement by a residual LoxP site, yielding mice with the miR-10a [+/−] genotype (Figure 1B). [score:3]
To assess the physiological role and pathophysiological significance of miR-10a, we generated a null allele of miR-10a by gene targeting. [score:3]
However, none of the reporters were affected by co-transfection with a miR-10a duplex (Figure S4B), suggesting that the identified sites were not functional miR-10a targets in this set-up. [score:3]
Interestingly, one gene, Lactoperoxidase, consistently showed an exceptionally high degree of deregulation in the intestines of miR-10a deficient mice and to our knowledge this is the first report correlating this gene in to a specific miRNA deficiency. [score:2]
qRT-PCR confirmed Lpo overexpression by 29-fold in female miR-10a KO intestines compared to WT (Figure 3A). [score:2]
Here we have generated a miR-10a knock out (KO) mouse and crossed it with the Apc [Min] colon cancer mouse mo del of familial adenomatous polyposis. [score:2]
Here, we provide causal evidence for the involvement of the conserved microRNA miR-10a in the development of intestinal adenomas in the face of activated Wnt signaling. [score:2]
Table S2Deregulated genes in the intestines of miR-10a [−/−] mice. [score:2]
Hence, our in silico, in vitro and in vivo results support the existence of a regulatory network linking miR-10a to LPO via KLF4 and potentially other transcription factors. [score:2]
HoxB4 is located 992 nucleotides downstream from the miR-10a gene and the transcription of both genes has been proposed to be co-regulated [6], [7]. [score:2]
Interestingly, only in female mice the specific lack of miR-10a sensitized the intestinal epithelium to increased tumor development. [score:2]
In summary, here we present evidence that miR-10a, through a complex regulatory network involving the transcription factor Klf4, can contribute to tumor formation in female mice. [score:2]
Interestingly, miR-10a was previously found to be moderately up regulated in solid tumors and stage II but not in stage I cancers in the colon [24], [25]. [score:2]
A double inactivation of miR-10a and miR-10b would allow disambiguation of the miR-10 role in mammalian development. [score:2]
In our microarray experiment we used intestinal RNA from only 6 animals (miR-10a KO; n = 3 and WT; n = 3) and we hypothesized that the limited population could account for the lack of detectable Klf4 de-regulation. [score:2]
We hypothesized that one or more transcription factors under miR-10a regulation could be responsible for enhancing LPO transcription. [score:2]
HCT-116 cells were seeded in 6-well plates and reversely transfected with 50 nM of Allstars negative control (Qiagen; cat:1027281), a miR-10a duplex (Ambion; AM17100, PM10787) or siRNAs against KLF4 (pool of two siRNAs with sequences: CCUUACACAUGAAGAGGCA[dT][dT], GUGGAUAUCAGGGUAUAAA[dT][dT], 25 nM each) using Lipofectamine2000 (Invitrogen). [score:1]
Only males were used for breeding with miR-10a [+/+] or miR-10a [−/−] mice. [score:1]
In the case of miR-10a [−/−] mice, the lack of appreciable phenotypes could be explained by redundancy and functional compensation by miR-10b, which levels remained unaffected in miR-10a KO mice. [score:1]
However, having such a defense program constantly activated in the presence of estrogen, as would be the case in the miR-10a [−/−] female mice, would ultimately be damaging for the cells. [score:1]
Tumor multiplicity in the small (A) and large intestines (B) of female and male miR-10a [+/+];Apc [Min] (WT; n = 22 and n = 19 for each sex) and miR-10a [−/−];Apc [Min] (KO; n = 15 and n = 16 for each sex) mice; each dot represents data for one mouse. [score:1]
Using an in vitro setup, in the epithelial-like colon carcinoma cell line HCT-116, we demonstrated a 50% reduction of KLF4 mRNA abundance upon transfection with miR-10a (Figure 4A). [score:1]
Accordingly, analysis of protein extracts from miR-10a KO and WT intestines equally revealed a strong induction of Lpo in miR-10a deficient samples (Figure 3B). [score:1]
Strikingly, the mean tumor multiplicity in small intestines of miR-10a [−/−];Apc [Min] female mice (79.33, n = 15) was almost twice as high as in corresponding miR-10a [+/+];Apc [Min] age matched controls (41.95, n = 22) (p = 0.0042) (Figure 2A). [score:1]
Deletion of miR-10a did not interfere with transcription of HoxB4 since similar levels of HoxB4 mRNA were detected by quantitative RT-PCR in intestinal samples (Figure S1E). [score:1]
Affymetrix probe set intensity of miR-10a KO and WT samples were preprocessed using the aroma package in BioConductor, including steps of background correction, normalization, and summarization by RMA (Robust Multichip Average) method. [score:1]
Disruption of miR-10a leads to enhanced intestinal tumorigenesis in Apc [Min] mice. [score:1]
qRT-PCR using specific primers for miR-10b on the same RNA showed no significant difference in the level of this close member of the miR-10 family, suggesting no occurrence of dose -dependent compensation via trans-regulation of miR-10b in the absence of miR-10a (Figure S1D). [score:1]
Therefore we suggest that miR-10a may serve as a potential diagnostic marker for identifying groups of women that are at high risk of developing colorectal cancer. [score:1]
To obtain the final miR-10a null allele (KO), the neomycin cassette was removed in the mouse germ line by breeding heterozygous mice to transgenic mice harboring the Cre transgene. [score:1]
miR-10a KO mice were generated as follows. [score:1]
The increased tumor multiplicity and colonic epithelial dysplasia along with unaffected adenoma sizes in the absence of miR-10a, suggest that miR-10a is involved in the tumor initiation/promotion steps but not in enhancing cell proliferation in the Apc [Min] mo del of intestinal neoplasia [33], [34]. [score:1]
To confirm that the mutant allele was null, quantitative RT-PCR was performed on RNAs extracted from the intestines of WT and homozygous (miR-10a [−/−]) mutant mice (Figure S1C). [score:1]
Data are shown as mean ± S. D. of miR-10a KO (n = 16) and WT (n = 13) samples relative to an average of the controls. [score:1]
1003913.g002 Figure 2Disruption of miR-10a leads to enhanced intestinal tumorigenesis in Apc [Min] mice. [score:1]
Detection of mature miR-10a (C) and miR-10b (D) by qRT-PCR in intestines of miR-10a [+/+] (WT) and miR-10a [−/−] (KO) mice. [score:1]
HCT-116 cells were seeded in 96-well plates (15000 cells/well) and transfected the next day with 30 nM of miR-10a mimic (Applied Biosystems; AM17100, PM10787) or control (Qiagen; Allstars neg control: 1027281) and 100 ng of psi-CHECK-2-Lpo-5′UTR alone, or 100 ng of pPK-CMV-Lpo-CDS or pPK-CMV-Lpo-10a-site together with 10 ng pRL-TK (Promega; Renilla vector used for normalization) using Lipofectamine2000 (Invitrogen). [score:1]
Total RNA was extracted from colon samples of 4 months old, WT and miR-10a [−/−] female mice. [score:1]
internal amplified a 273 bp fragment corresponding to the miR-10 WT allele and 361 bp for the floxed miR-10a KO allele, L_chkinsrtmiR10a. [score:1]
Generation of miR-10a neo/+ ES cells. [score:1]
5 amplified 291 bp from the miR-10a [neo] allele. [score:1]
Noteworthy, the miR-10a genotype did not affect tumor multiplicity in Apc [Min] male mice irrespective of the anatomic location (p [small intestine] = 0.61, p [large intestine] = 0.16; Figures 2A and 2B). [score:1]
Interbreeding of heterozygous miR-10a [+/−] mice produced homozygous null (miR-10a [−/−]) offspring at the expected Men delian ratios (Figure S1A). [score:1]
1003913.g001 Figure 1Generation of miR-10a KO mice. [score:1]
Middle panel is a typical example of a low-grade dysplasia in miR-10a [+/+];Apc [Min] (WT) mice with accumulation of irregular goblet cells pattern (arrowheads) and some loss of nuclear polarity (indicated by “+”). [score:1]
Right panel shows a typical miR-10a [−/−];Apc [Min] (KO) high-grade dysplasia with a large area of loss of goblet cells, widespread loss of nuclear polarity, nuclear pleomorphism, and almost complete loss of villus organization (indicated by “*”). [score:1]
carrying the miR-10a floxed allele (miR-10a [−]) were intercrossed with C57BL/6 mice for at least 7 generations before generating experimental cohorts. [score:1]
carrying the miR-10a floxed allele (miR-10a [−]) were intercrossed with B6 mice for at least 7 generations before generating experimental cohorts of homozygous mutant and control mice. [score:1]
No significant difference was observed in mean tumor diameters between miR-10a [−/−];Apc [Min] and miR-10a [+/+];Apc [Min] control mice irrespective of gender (p = 0.614 for males and p = 0.071 for females; Figure 2C). [score:1]
In agreement with the analysis of Lpo mRNA and Lpo protein level, a clear difference in both intensity and distribution area of Lpo staining was observed between miR-10a KO and WT mice (p≤0.006, Pearson chi-square test with exact probability). [score:1]
To examine the impact of disrupting miR-10a in Apc [Min] mice, the miR-10a KO and Apc [Min] mouse strains (both in a C57BL/6 background) were intercrossed. [score:1]
Generation of miR-10a KO mice. [score:1]
miR-10a deficiency enhances intestinal tumorigensis in female Apc [Min] mice. [score:1]
No bona fide miR-10a binding sites could be identified in the 3′ UTR of Lpo but cryptic sites in the 5′ UTR and coding sequence (CDS) carried significant complementarity to miR-10a (Figure S4A). [score:1]
[1 to 20 of 122 sentences]
3
[+] score: 221
Other miRNAs from this paper: mmu-mir-150, mmu-mir-690
Of the four miRNAs examined (miR-10a-5p yielded 0 predicted targets in the previously established regulation network), miR-10a-3p, miR-548as-5p and miR-371b-5p’s predicted targets all showed significant enrichment in the GO terms “regulation of alkaline phosphatase activity” and “skeletal system development”, while “positive regulation of ossification” was enriched only in miR-10a-3p’s targets (P < 0.05, fold enrichment = 5.1, Fig.   1C and Supplementary Data  2). [score:11]
However, a recent report indicated that miR-10a has a suppressive role in osteoblast differentiation of MC3T3-E1 cells and angiogenic activity of MUVECs by downregulating β-catenin expression [26]. [score:8]
Western blot analysis also confirmed the miR-10a-3p -mediated inhibition of ID3 translation, but the effect on HAND2 expression was less notable (Fig.   4F). [score:7]
PLL cells stably expressing miR-10a-3p or OPLL cells stably expressing miR-10a-3p short hairpin inhibitor (Fig.   S3A,B) were incubated with Bio-Oss Collagen scaffolds and implanted subcutaneously, and the scaffolds were harvested after 6 weeks and analyzed using micro computed tomography (micro-CT, Fig.   6A). [score:7]
Using inhibition of miR-10a-3p in OPLL cells and overexpression in PLL cells, we showed that miR-10a-3p can actively modulate the ossification level of ligament cells by targeting ID3, thus promoting the binding of RUNX2 to ossification-related genes (Fig.   7C). [score:7]
D. Uncropped blot images were shown in the Supplementary Fig.   5. How downregulation of ID3 by miR-10a-3p affects ossification-related gene expression is still unknown. [score:6]
Using computational prediction and validation, we found that miR-10a-3p can actively suppress the translation of ID3, a RUNX2 negative regulator, to promote osteogenic differentiation and mineral deposition of posterior ligament both in vitro and in vivo. [score:6]
We found that although miR-10a-3p inhibition attenuated the expression of ossification-related genes, lowered the ALP activities and reduced mineral deposition, ID3 knockdown significantly rescued these changes (Fig.   5D–F). [score:6]
D. Uncropped blot images were shown in the Supplementary Fig.   5. How downregulation of ID3 by miR-10a-3p affects ossification-related gene expression is still unknown. [score:6]
We found that the luciferase activities from constructs containing the wild type ID3 3′ untranslated transcript region (3′UTR) were significantly reduced after miR-10a-3p overexpression, while mutation in the predicted binding site rescued this reduction (Fig.   4E). [score:6]
Further functional studies also confirmed the hypothesis that miR-10a-3p actively downregulate the expression of ID3, promoting the function of the ossification core factor RUNX2. [score:6]
ID3, however, showed more positively stained cells after miR-10a-3p inhibition, while its overexpression resulted in decreased staining (Fig.   7B). [score:5]
We found that overexpression of miR-10a-3p in PLL cells did reduce the mRNA level of ID3, indicating ID3 may be the effective target of miR-10a-3p (Fig.   4D). [score:5]
The red squares represent predicted miR-10a-3p target sites, while crossed red square represents mutated target sites. [score:5]
Among these genes, miR-10a-3p overexpression was most effective in elevating the expression level of ossification-related genes. [score:5]
Immunohistochemistry staining of OCN and RUNX2 confirmed that miR-10a-3p overexpression resulted in more positively stained cells, while its inhibition resulted in fewer stained cells (Figs  7B and S4B). [score:5]
However, miR-10a-3p overexpression resulted in increased lamellar bone formation, and its inhibition led to decreased bone formation (Fig.   7B). [score:5]
Similar results were obtained from analysis of the expression levels of RUNX2, OSX, OPN and ALP, which were significantly reduced by miR-10a-3p inhibition at both the mRNA and protein levels (Fig.   3C,D). [score:5]
The error bars represents ± S. D. To verify this connection, we first tested whether miR-10a-3p could reduce the expression of these two candidates directly. [score:4]
The error bars represents ± S. D. To verify this connection, we first tested whether miR-10a-3p could reduce the expression of these two candidates directly. [score:4]
In PLL groups (Figs  6C and S3C), stable miR-10a-3p overexpression resulted in increased BV/TV and BMD compared to the negative control group and stable miR-10a-5p overexpression group (which served as a negative miRNA control group). [score:4]
After miR-10a-3p overexpression, RUNX2 binding to OCN and ALP significantly increased in PLL cells, which is similar to the result of ID3 knockdown. [score:4]
Here, our findings showed that both miR-10a-3p and its target ID3 differs greatly between PLL and OPLL, making it a possible functional pair that take an active role in the development of OPLL. [score:4]
Taken together, the results indicated that a negative ossification regulator, ID3, is a functional target of miR-10a-3p in posterior ligament cells. [score:4]
We found that the expression changes of these two negative regulators of ossification were indeed inversely correlated with the ossification-related factors RUNX2, ALP and OCN between OPLL and PLL cells (Fig.   4B), while miR-10a-3p was also inversely correlated with the candidates (Figs  4C and S1A–C). [score:4]
evaluating the binding proficiency of RUNX2 to OCN (G) and ALP (H) in miR-10a-3p overexpressed inhibited or ID3 knockdown ligament cells. [score:4]
The PLL, OPLL or MSC cells were first passaged and when 80% confluent, the cells were treated with indicated virus vectors to modify their expression of miR-10a-3p. [score:3]
ID3 is targeted by microRNA-10a. [score:3]
After the analysis, HAND2 and ID3 were selected as potential targets of miR-10a-3p. [score:3]
The ossification-promoting effects of miR-10a-3p and-5p were further supported by real-time PCR expression analyses of ossification-related RUNX2, OSX, OPN and ALP (Fig.   2E). [score:3]
Moreover, computational prediction in our study yielded 0 potential ossification-related targets for miR-10a-5p, which indicates that miR-10a-5p may function differently in OPLL via other mechanisms. [score:3]
As expected, inhibition using the miR-10a-3p antagomir significantly increased the protein and mRNA level of ID3 (Fig.   4G). [score:3]
Figure 3Inhibition of miR-10a-3p reduced osteogenic phenotype of OPLL cells. [score:3]
Although we identified ID3 as the primary target of miR-10a-3p, their relationship in the ossification process of OPLL is unclear. [score:3]
While miR-10a-3p inhibition showed the reverse effect in OPLL cells (Figs  5G,H and S2A,B). [score:3]
HAND2 and ID3 were the two remaining highly suspected targets of miR-10a-3p used in further analysis. [score:3]
By overexpressing the candidate miRNAs, we found that both miR-10a-3p and-5p showed significant increases in alizarin red staining and ALP activities of osteo -induced PLL cells (Fig.   2C,D). [score:3]
Figure 4ID3 is targeted by miR-10a-3p. [score:3]
Next, we investigated whether inhibition of miR-10a-3p using an antagomir would increases the expression of ID3 and HAND2 in OPLL cells. [score:3]
MicroRNA-10a promotes ossification by targeting ID2/RUNX2 signaling in vivoTo fully characterize the function of miR-10a-3p in OPLL development, we used an in vivo bone formation strategy. [score:2]
We analyzed antagomir -treated OPLL cells using alizarin red staining and ALP activity assays and showed that inhibition of miR-10a-3p, but not miR-10a-5p, significantly reduced the mineral deposition and ALP activities (Fig.   3A,B). [score:2]
Evaluation of the osteogenic phenotypes of ID3 knockdown on miR-10a-3p inhibited ligament cells using alizarin red staining/quantification (E) and ALP staining/quantification (F). [score:2]
Taken together, we found that miR-10a-3p can actively regulate the ossification of both PLL and OPLL cells in vitro. [score:2]
Our findings indicate that miR-10a-3p is indeed a vital player in osteogenesis of OPLL and serves as an upstream regulator of the ID3/RUNX2 axis. [score:2]
MiR-10a-3p overexpression and short-hairpin silencing lentivirus vectors were all synthesized and cloned by Obio Technology Corp (Shanghai, China). [score:2]
MicroRNA-10a promotes ossification by targeting ID2/RUNX2 signaling in vivo. [score:2]
In the present study, we found that miR-10a-3p exerts its function through the ID3/RUNX2 axis, which defined their upstream modulator and for the first time revealed their vital roles in the development of OPLL. [score:2]
Next, we performed ID3 knockdown in miR-10a-3p -inhibited osteo -induced OPLL cells and evaluated the ossification phenotype. [score:2]
These results indicate a role of miR-10a-3p, miR-548as-5p and miR-371b-5p in regulating the ossification process of OPLL. [score:2]
Our work here demonstrated the important role of miR-10a-3p in the ossification process of OPLL, and revealed its mechanism through the ID2/RUNX2 axis, which may further contributes to the understanding of OPLL development. [score:2]
The function of RUNX2 is regulated by microRNA-10a. [score:2]
Figure 5The function of RUNX2 is regulated by miR-10a-3p. [score:2]
These results indicated that miR-10a-3p -mediated promotion of ossification in posterior ligament cells requires ID3. [score:1]
Notably, β-catenin levels were not significantly varied between PLL and OPLL ligament cells [9], and the mechanism which Li et al. proposed is between miR-10a-5p and β-catenin, not the miR-10a-3p we focused on. [score:1]
Figure 7ID3 is modulated by miR-10a-3p in vivo. [score:1]
Thus, we validated the function and mechanism of miR-10a-3p in PLL and OPLL primary ligament cells in vitro. [score:1]
Our investigations found that among the four top regulated miRNAs, miR-10a-3p strongly promoted PLL cell ossification, indicating that miR-10a may be a critical regulator of this pathological process. [score:1]
Through computational analysis, we try to elucidate the function of four most altered OPLL-specific miRNAs, and found that miR-10a-3p showed most significant effect. [score:1]
In the OPLL groups (Figs  6D and S3D) stable miR-10a-3p knockdown resulted in lower BV/TV and BMD compared with the other treatment groups. [score:1]
Yan Y MicroRNA-10a is involved in the metastatic process by regulating Eph tyrosine kinase receptor A4 -mediated epithelial-mesenchymal transition and adhesion in hepatoma cellsHepatology (Baltimore, Md. ) [score:1]
These results further confirmed that miR-10a-3p, not its complementary miR-10a-5p, is functional in promoting posterior ligament cell ossification in vivo. [score:1]
However, one of the main drawbacks of this study is that how miR-10a expression is initiated in OPLL are still unclear and require further investigation [33]. [score:1]
D. Thus, we confirmed the function and mechanism of miR-10a-3p in promoting posterior ligament cell ossification both in vitro and in vivo. [score:1]
These results indicate a connection between miR-10a-3p and the two candidate genes. [score:1]
D. Thus, we confirmed the function and mechanism of miR-10a-3p in promoting posterior ligament cell ossification both in vitro and in vivo. [score:1]
[1 to 20 of 65 sentences]
4
[+] score: 195
Neither GFP [-]YFP [-] nor GFP [+]YFP [-] cells expressed miR-10a, while there was significant miR-10a expression in thymic GFP [+]YFP [+] Treg suggesting that miR-10a expression occurs temporally after FoxP3 expression (Fig. 2b). [score:9]
Individual CD4 [+] thymocyte subpopulations were purified including GFP [-]YFP [-] cells that do not express FoxP3 (and never did), GFP [+]YFP [-] cells where FoxP3 was turned on but cre activity was not sufficient to result in detectable YFP protein levels yet, and GFP [+]YFP [+] which represented actively expressing “bona fide” nTreg as a means to determine the temporal expression of miR-10a during thymic nTreg development (Fig. 2b). [score:8]
This notion is supported by the fact that NOD Treg express very low levels of miR-10a without NOD mice developing scurfy-like disease and miR-10a -deficient Treg are present in normal numbers and express normal levels of FoxP3 (data not shown). [score:7]
Nevertheless, the result demonstrates that within thymocytes miR-10a expression is restricted to Treg (independent of their origin of generation) and FoxP3 expression precedes miR-10a expression. [score:7]
Pharmacologic miR-10a inhibition did indeed inhibit the expression level of miR-10a. [score:7]
miR-10a Expression in Treg Inversely Correlates with Susceptibility to Autoimmune Disease. [score:5]
Interestingly, miR-10a expression seems to be specifically induced in Treg since the two flanking protein-coding genes are not detectable (HoxB5) or barely expressed (HoxB4) in naive, Th1, Th2, Th17, induced Treg (iTreg) or nTreg [14]. [score:5]
These results suggest that FoxP3 expression alone is not sufficient to drive miR-10a expression. [score:5]
miR-10a expression in Treg inversely correlates with susceptibility to autoimmune disease. [score:5]
Neither T cell activation by stimulating purified CD4 [+]CD25 [-] cells with anti-CD3 and anti-CD28 did induce miR-10a (data not shown) nor in vitro skewing into Th1 and Th17 cells increased miR-10a expression above levels seen under neutral culture conditions (data not shown) suggesting that miR-10a expression is limited to the FoxP3 [+] T cell lineage. [score:5]
How can the discrepancy between in vitro inhibition of miR-10a expression with antagomiRs versus genetic ablation be explained? [score:5]
Of note, miR-10a levels in exFoxP3 cells (GFP [-]YFP [+]) were equal or slightly higher to Tconv (GFP [-]YFP [-]) levels but much lower than in nTreg cells (GFP [+]YFP [+]) (Fig. 2c) illustrating a tight correlation between FoxP3 and miR-10a expression suggesting that miR-10a may be a stabilizing factor of Foxp3 expression. [score:5]
To validate the expression profiling, we analyzed miR-10a expression by qPCR in various purified cell populations from FoxP3-GFP or FoxP3-GFP-hCre reporter mice. [score:5]
Thus, we found an inverse correlation of Treg-specific miR-10a expression with susceptibility to autoimmune disease. [score:5]
0036684.g002 Figure 2qPCR analysis of relative expression of miR-10a in purified T cells. [score:3]
Therefore, we determined miR-10a expression levels in diabetes-prone NOD and autoimmune-resistant B6 Treg cells (CD4 [+]CD25 [+]CD62L [hi]). [score:3]
Finally, miR-10a might be expressed and functional only in a subset of Treg as it has become clear that CD4 [+]CD25 [+]FoxP3 [+] cells are heterogeneous and may be functionally diverse, depending on tissue location and activation status [23], [24]. [score:3]
Furthermore, miR-10a -deficient Treg cells suppress colitis in an adoptive transfer mo del (Jeker & Bluestone, unpublished results). [score:3]
Treg from autoimmune-resistant B6 mice had the highest miR-10a expression while Treg from autoimmune-prone NOD mice had the lowest (Fig 6b). [score:3]
The differential expression of miR-10a was confirmed by qPCR on RNA from freshly purified CD4 [+]GFP [-] Tconv and CD4 [+]GFP [+] Treg populations from FoxP3-GFP reporter [8] and FoxP3-GFP-hCre reporter mice (Fig. 1b). [score:3]
CD4 SP cells expressed miR-10a levels comparable to DN cells (Fig. 2a). [score:3]
As noted previously, miR-10a is expressed in Treg but not bulk CD4 [+] or CD8 [+] Tconv cells (data not shown). [score:3]
Although RA -treated GFP [-] (FoxP3 [-]) cells did express low levels of miR-10a in the absence of TGF-ß, the presence of TGF-ß synergized to maximally induce miR-10a. [score:3]
Next, we analyzed miR-10a expression in peripheral T cell subsets. [score:3]
miR-10a expression was similar in Tregs independent of sex or age (5 weeks to 16 weeks old mice) (data not shown). [score:3]
qRT-PCR for miR-10a expression by FACS-purified CD4 [+]CD25 [+]CD62L [hi] Treg. [score:3]
Despite an intriguing expression pattern, we were not able to define the miR-10a function in Treg in vivo. [score:3]
To test whether miR-10a levels in Treg cells correlated with autoimmune susceptibility, we screened various inbred mouse strains for Treg-specific miR-10a expression. [score:3]
Since we detected miR-10a in nTreg but reduced levels in unstable exFoxP3 cells (Fig. 2a-c) we tested miR-10a levels in TGF-ß -induced iTreg cells, hypothesizing that like exFoxP3 cells they would have reduced miR-10a expression. [score:3]
As observed in non-autoimmune prone mice (Fig. 1 and 2), NOD Treg expressed miR-10a but at much lower levels than their B6 counterparts (Fig. 6a). [score:3]
Based on its expression, we hypothesized that miR-10a might facilitate/maintain high and stable FoxP3 levels. [score:3]
Therefore, it seems likely that in T cells RA directly induces miR-10a through direct binding of RARE elements in the HoxB/miR-10a locus. [score:3]
b) qPCR of relative miR-10a expression by sorted Tconv (GFP [-]) and Treg (GFP [+]). [score:3]
Next we examined the relationship between miR-10a and FoxP3 expression. [score:3]
All samples were normalized to miR-10a expression in BALB/c mice. [score:3]
0036684.g006 Figure 6qRT-PCR for miR-10a expression by FACS-purified CD4 [+]CD25 [+]CD62L [hi] Treg. [score:3]
qPCR analysis of relative expression of miR-10a in purified T cells. [score:3]
b) Relative miR-10a expression in Treg from B6, 129X1/SvJ, 129S6/SvEvTac, DBA/2J, BALB/c and NOD/ShiLtJ mice. [score:3]
In a pancreatic cancer cell line RA directly binds to a retinoic acid response element (RARE) in the HoxB cluster and induces miR-10a [18]. [score:2]
RA alone or in combination with TGF-ß induced miR-10a (Fig. 3). [score:1]
Together these results suggest that high FoxP3 levels in nTreg cells are positively controlled by miR-10a. [score:1]
Alternatively, miR-10b might compensate for the absence of miR-10a in miR-10a -deficient Treg, since miRNAs are often redundant [21]. [score:1]
Annealing temperatures for IDT reactions were: mmu-miR-10a, mmu-miR-16, mmu-miR-155, hsa-miR-155∶47.5°C. [score:1]
a) Amplification plots for miR-10a on Treg cDNA from B6 and NOD mice. [score:1]
miR-10a was readily detected in Treg cells (n>7 independent experiments). [score:1]
0036684.g003 Figure 3All-trans retinoic acid but not TGF-ß induces miR-10a in CD4 [+] T cells. [score:1]
Little or no miR-10a signal was observed in DN thymocytes and no signal was detected in DP or CD8 SP thymocytes. [score:1]
In summary, RA but not TGF-ß alone can induce miR-10a in conventional CD4 [+] T cells. [score:1]
0036684.g004 Figure 4Treg-specific miR-10a modulates FoxP3 stability in vitro. [score:1]
miR-10a is dispensable for TGFβ and retinoic acid -mediated FoxP3 induction. [score:1]
Thus, miR-10a is dispensable for FoxP3 induction. [score:1]
Temporally controlled conditional miR-10a ablation might reveal its function [22]. [score:1]
miR-10a Marks Treg Cells. [score:1]
miR-10a is Dispensable for TGFβ and Retinoic Acid -mediated FoxP3 Induction. [score:1]
Indeed, despite substantial FoxP3 (GFP) induction (data not shown) miR-10a was not induced in GFP [+] cells (Fig. 3). [score:1]
However, miR-10a -deficient mice are fertile and age without obvious phenotypic abnormalities (Stadthagen & Lund, unpublished results). [score:1]
All-trans retinoic acid but not TGF-ß induces miR-10a in CD4 [+] T cells. [score:1]
The highly specific miR-10a expression in Tregs led us to investigate inductive signals. [score:1]
All-trans Retinoic Acid but Not TGF-ß Induces miR-10a in CD4 [+] T Cells. [score:1]
Treg numbers and phenotype appear normal under homeostatic conditions (data not shown) and miR-10a was dispensable for FoxP3 induction in naïve T cells. [score:1]
The signal for Tconv is comparable to miR-10a in NOD Treg (data not shown). [score:1]
Treg-specific miR-10a modulates FoxP3 stability in vitro. [score:1]
In summary, miR-10a marks Treg cells in thymocytes, LN and spleen but not other T cell subsets such as early thymocytes, bulk CD4 [+], and CD8 [+] T cells. [score:1]
To test if miR-10a was required for RA -mediated iTreg induction we purified naïve CD4 [+]CD62L [hi]25 [−] Tconv and activated them in vitro with anti-CD3 and anti-CD28 mAb in the presence of RA, TGFβ or a combination of the two. [score:1]
Treg-specific miR-10a Modulates FoxP3 Stability in vitro. [score:1]
We tested if RA could induce miR-10a in T cells. [score:1]
Given the strong induction of miR-10a by RA, the added benefit of RA might partially be accomplished through miR-10a, which is embedded in the HoxB cluster, a genomic region with known RA responsiveness. [score:1]
Cells were from wildtype (“control”) or littermate miR-10a -deficient (“ko”) mice. [score:1]
These observations suggest that thymic Treg sense a signal to actively and specifically induce miR-10a. [score:1]
miR-10a marks Treg cells. [score:1]
Likewise, the only miRNA specific for Treg cells was miR-10a. [score:1]
Treg-specific miR-10a Modulates FoxP3 Stability in vitro Our understanding of the molecular mechanisms that maintain Treg stability remain uncertain although miRNAs do stabilize Treg lineage identity [4]. [score:1]
However, there was no difference between miR-10a sufficient and miR-10a -deficient cells (Fig. 5b). [score:1]
miR-10a -deficient mice were backcrossed for >7 generations to B6 (Gustavo Stadthagen & Anders Lund, unpublished results). [score:1]
The Treg-enriched miRNAs miR-155 and miR-10a are on their own largely dispensable for global Treg function under homeostatic conditions in vivo [26] and data not shown. [score:1]
All-trans Retinoic Acid but Not TGF-ß Induces miR-10a in CD4 [+] T CellsThe highly specific miR-10a expression in Tregs led us to investigate inductive signals. [score:1]
We can not exclude that a small part of the miR-10a signal detected in GFP [+]YFP [+] Treg stems from recirculating Treg. [score:1]
[1 to 20 of 77 sentences]
5
[+] score: 165
Other miRNAs from this paper: mmu-mir-10b, hsa-mir-10a, hsa-mir-10b, rno-mir-10a, rno-mir-10b
Hierarchical clustering of the differentiated expressed genes (DEGs) showed that the DEG expression patterns were quite similar regardless of whether miR-10a or miR-10b was overexpressed in GCs, implying similar functions for miR-10a and miR-10b in GCs (Fig. 4B). [score:7]
To summarize, these results showed that FSH, FGF9 and TGF pathway signalling could inhibit miR-10a and miR-10b expression in hGCs, mGCs and rGCs, which suggests that the FSH/FGF9 and TGF-β pathway may function as an upstream regulator of miR-10a and miR-10b in GCs; these effects were conserved among different species (Fig. 3D). [score:6]
To determine whether BDNF was direct target of miR-10a and miR-10b, the putative miR-10 target 3′ UTR was cloned into a reporter plasmid downstream of a luciferase gene (Fig. 5F). [score:6]
Similar to GCs overexpressing the miR-10 family, proliferation was inhibited (Fig. 6A) and apoptosis was induced (Fig. 6B) upon BDNF knockdown. [score:6]
To further identify the associated pathways and direct targets of miR-10a and miR-10b in GCs, RNA-seq was performed for miR-10a/b -overexpressing granulosa cells (Fig. 4A). [score:6]
By combining the RNA-seq and miRNA target prediction software results, BDNF was predicted to be a potential direct target of miR-10a/b in GCs (Fig. 5A). [score:6]
In conclusion, we found that miR-10 family members, including miR-10a and miR-10b, are expressed at basal levels in GCs but are highly expressed in theca and stroma cells within the ovary. [score:5]
miR-10a and miR-10b directly targeted BDNF in GCs, suggesting that the miR-10 family might also affect other normal ovary functions apart from GC development. [score:5]
Here, we demonstrated that two members in the miR-10 family, miR-10a and miR-10b, function as anti-proliferation and pro-apoptosis factors in human, mouse and rat GCs by directly targeting the 3′ UTR of BDNF in GCs. [score:4]
Gene ontology results suggested that miR-10a and miR-10b target genes were highly related to cell growth, proliferation, development and reproduction (Fig. 4C and Supplementary Fig. 1D). [score:4]
These results indicated that BDNF was a direct target of miR-10a and miR-10b in GCs. [score:4]
BDNF is a direct target of the miR-10 family in granulosa cells. [score:4]
To prove that the downstream target of the miR-10 family, BDNF, could mediate the function of the miR-10 family in GCs, shRNA was used to knockdown BDNF in GCs (Supplementary Fig. 1G). [score:4]
BDNF is a direct target of miR-10a/b in GCs. [score:4]
miR-10a and miR-10b expression in granulosa cells is regulated by extrinsic/intrinsic signals. [score:4]
To further confirm that the anti-proliferative and pro-apoptotic functions of the miR-10 family in GCs are at least partially via BDNF, recombinant BDNF was used to treat miR-10a/b -overexpressing GCs. [score:3]
miR-10 family expression in normal and atretic granulosa cells. [score:3]
miR-10 family expression was abundant in the remaining GCs in atretic follicles (Fig. 1F). [score:3]
A putative miR-10 binding site in the BDNF 3′-untranslated region (UTR) was also identified (Fig. 5B). [score:3]
Using fluorescence in situ hybridization (FISH), both miR-10a and miR-10b were shown to be expressed in mouse and rat GCs (Fig. 1C and Supplementary Fig. 1C). [score:3]
The opposite expression patterns for BDNF and the miR-10 family in GCs further indicated the repressive effect of miR-10a/b on BDNF (Fig. 5C). [score:3]
By using RNA-seq screening, bioinformatics prediction, qPCR, Western blot analysis, luciferase reporter assays and FISH-IF validation, BDNF was identified as a direct target of the miR-10 family in GCs. [score:3]
As validated by, BDNF was inhibited at the mRNA by the miR-10 family in GCs (Fig. 5D). [score:3]
MiRNAs are small non-coding RNAs that repress mRNA translation at the post-transcriptional level 7. Many miRNAs that share a common “seed sequence” form a family and are located on different chromosomes in the genome; one such example is the miR-10 family, which is a highly conserved family among different species. [score:3]
As shown in Fig. 3B, treatment with these TGF-β superfamily ligands inhibited miR-10a and miR-10b in GCs. [score:3]
By using RNA-seq and qPCR, miR-10a and miR-10b were shown to inhibit many key genes within the TGF-β pathway, including ligands, receptors and transcription factors. [score:3]
As shown in Fig. 5E, miR-10a/b overexpression led to a significant decrease in BDNF protein levels compared with the negative control. [score:2]
Taken together, these results suggest that miR-10a and miR-10b might play a negative role in follicle development. [score:2]
In this study, we found that these critical regulatory factors could repress miR-10a and miR-10b in granulosa cells, further indicating the negative roles of the miR-10 family during folliculogenesis. [score:2]
Both miR-10a and miR-10b could repress proliferation and induce apoptosis in human, mouse and rat granulosa cells, at least partly through repressing BDNF by directly binding to its 3′ UTR. [score:2]
How to cite this article: Jiajie, T. et al. Conserved miR-10 family represses proliferation and induces apoptosis in ovarian granulosa cells. [score:1]
However, the function of the miR-10 family is still unknown in other species, such as humans, mice and rats. [score:1]
The general function of the miR-10 family in granulosa cells. [score:1]
These results indicate that the miR-10a and miR-10b precursors and mature sequences are highly conserved and might have similar functions in mammals. [score:1]
The miR-10 family has two members, miR-10a and miR-10b. [score:1]
miR-10 family members repressed proliferation and induced apoptosis in granulosa cells. [score:1]
Additionally, the TGFβ pathway and miR-10a/b form a negative feedback loop in GCs. [score:1]
Both miR-10a and miR-10b were induced by TGF-β1 in GC. [score:1]
Some essential genes in this pathway, including ACVR2A, ACVR2B, SMAD1, SMAD3, BMP4 and AMH, were significantly repressed by both miR-10a and miR-10b in GCs (Fig. 4E). [score:1]
Taken together, the results showed that BDNF could at least partially mediate the function of the miR-10 family in GCs. [score:1]
All of the cells were transfected with 20 nM of either miR-10a or miR-10b mimic (GenePharma) using the Lipofectamine RNAiMAX transfection reagent and Opti-MEM medium (Life Technologies) according to the manufacturer’s instructions. [score:1]
Effects of exposure to hormone and growth factors on miR-10a and miR-10b in granulosa cells. [score:1]
BDNF rescues miR-10 family-caused effects in GCs. [score:1]
We also identified six asymmetric bulges in the structures of the hsa-miR-10a and hsa-miR-10b duplexes (Fig. 1B). [score:1]
It was also reported that miR-10 could repress proliferation in porcine granulosa cells 19. [score:1]
miR-10a and miR-10b repress proliferation and induce apoptosis in human, mouse and rat granulosa cells. [score:1]
HEK293T cells grown in 24-well plates were transfected with 50 nM miR-10a and miR-10b mimic (GenePharma, China) and 100 ng of pmirGLO vector (Promega, USA) tagged with either a BDNF 3′ UTR that includes the miR-10 binding sites or the empty plasmid using Lipofectamine 2000 (Invitrogen, USA). [score:1]
These data confirmed that the miR-10 family simultaneously represses proliferation and induces apoptosis in GCs; this effect is conserved among humans, mice and rats. [score:1]
BMP4 and BMP15 are from the BMP family, and Activin A is a member of the Activin family, and all are components of the TGF-β pathway 23, suggesting that the TGF-β signalling pathway might also repress the miR-10 family in GCs. [score:1]
Moreover, the miR-10 family and the TGF-β pathway form a negative feedback loop in GCs. [score:1]
Both miR-10a and miR-10b gradually decreased during follicle maturation (Fig. 1D) and increased by follicle atresia, as determined by (Fig. 1E). [score:1]
This study provides new insights into how the miR-10 family functions in the female reproductive system. [score:1]
These results indicate that the miR-10 family has similar functions in GCs in different species. [score:1]
As expected, the mediator of FSH in GCs, cAMP, also greatly repressed miR-10a and miR-10b in GCs (Fig. 3A). [score:1]
The seed region (UCAAGUA) of miR-10 is conserved among vertebrate species. [score:1]
miR-10 family is highly conserved among different species. [score:1]
Consistent with these observations, our data showed that the miR-10 family decreased proliferation and induced apoptosis in granulosa cell. [score:1]
miRCURY LNA miRNA detection probes for miR-10a and miR-10b were purchased from Exiqon (613307–310 and 613028–310, respectively; Vedbaek, Denmark). [score:1]
The results showed that both the miR-10a and miR-10b mimics repressed the fluorescence from the 3′ UTR compared with the negative control, indicating that miR-10a and miR-10b could directly bind to the BDNF 3′ UTR. [score:1]
In contrast, apoptosis was induced by miR-10a and miR-10b in GCs of different species (Fig. 2C). [score:1]
By using Ki-67 staining, the proliferation of GCs was also found to be repressed by the miR-10 family (Fig. 2B). [score:1]
SVOG cells were collected 48 h after transfection with miR-10a/b mimics and/or negative control. [score:1]
BDNF rescues miR-10a- and miR-10b -induced proliferation repression and apoptosis induction in GCs. [score:1]
The effect of the miR-10 family on GCs on a transcriptome-wide scale. [score:1]
The nucleotide sequence of the miR-10a and miR-10b precursors are highly conserved in mammals (Fig. 1A). [score:1]
As expected, BDNF could rescue GC apoptosis caused by miR-10a and miR-10b mimic transfection (Fig. 6D). [score:1]
Therefore, we tested the effect of recombinant TGF-β1 on miR-10a/b in GCs. [score:1]
miR-10 was identified as a specific marker for mouse granulosa cells from previous miRNA-sequencing results 17. [score:1]
We also identified that miR-10a/b and the TGF-β pathway form a negative feedback loop in granulosa cells. [score:1]
The mature hsa-miR-10a-5p and hsa-miR-10b-5p sequences are UACCCUGUAGAUCCGAAUUUGUG and UACCCUGUAGAACCGAAUUUGUG, respectively, and have only one different nucleotide. [score:1]
The results showed that FGF9 could also greatly repress the miR-10 family in GCs (Fig. 3A). [score:1]
miR-10a and miR-10b mimic treatment significantly reduced the viability of human, mouse and rat GCs (Fig. 2A). [score:1]
To further explore whether BDNF mediates the function of the miR-10 family in GC apoptosis, GCs were co -treated with miR-10 family mimics in the presence of recombinant BDNF or vehicle control. [score:1]
Identification of miR-10a and miR-10b in granulosa cells. [score:1]
Follicle-stimulating hormone (FSH) could stimulate granulosa cells to convert androgens to oestradiol via aromatase 20 and maintain GC proliferation and maturation 21. miR-10a and miR-10b were significantly decreased by recombinant human FSH in hGCs, mGCs and rGCs (Fig. 3A). [score:1]
Additionally, many hormones and growth factors in the ovary repressed the miR-10 family in GCs. [score:1]
These results indicate that autocrine and/or endocrine signals from hormones or growth factors during granulosa cell differentiation are involved in repressing the miR-10 family in GCs. [score:1]
Considering that TGF-β superfamily ligands could greatly repress the miR-10 family in GCs, this result suggests that the miR-10 family and the TGF-β pathway might be involved in a negative feedback loop. [score:1]
Based on small RNA-seq from a previous study, miR-10 is a specific marker for mouse granulosa cells 17. [score:1]
[1 to 20 of 79 sentences]
6
[+] score: 134
First, we knocked down the expression of miR-146a or/and miR-10a in AFSCs or in AFSC-derived exosomes using miRNA inhibitors and confirmed expression by qRT-PCR (Fig. 2a,b). [score:8]
Inhibitors (#MIN0000158 for miR-146a and #MIN0000648 for miR-10a, Qiagen) and inhibitor negative control (miScript Inhibitor Negative Control, #1027271, Qiagen) were employed for the transfection. [score:7]
The results met our expectation, expression levels of miR-146a and miR-10a were suppressed in both of the producer cells and their exosomes when RNA inhibitors were administered. [score:7]
We then predicted the targets of miRNAs using miRBase/miRanda, and it revealed that Irak1 and Traf6 are potential target genes of miR146a while Bim is the putative target gene of miR-10a (Fig. 1e). [score:7]
The down-regulation of miR-146a led to a reduction in miR-10a expression and vice versa, which is in accordance with a previous study 42. [score:6]
The expression level of miR-146a, miR-10a and their predicted target mRNAs in GCs cultured with 30 μg ml [−1] of exosomes proteins were analyzed by qRT-PCR according to the manufacturer’s instructions. [score:5]
A similar result was also observed in the expression level of Bim, the predicted miR-10a target gene, 12 hours after miR-10a delivery (Fig. 3c). [score:5]
AFSCs were used for inhibitor transfection, targeting miR-146a, miR-10a or both. [score:5]
Interestingly, these miRNAs also highly enriched in AFSC-derived exosomes (Supplementary Table 1), and it is possible that transferring not only miR-10a and miR-146a but also these miRNAs via AFSC-derived exosomes to damaged GCs rescues the cells from apoptosis through suppressing the apoptotic-related target genes and then prevents follicles from atresia (Fig. 4c). [score:5]
Interestingly, the knockdown of miR-146a resulted in the down-regulation of miR-10a and vice versa (Fig. 2a,b). [score:5]
According to previous reports and our data, miR-10a directly targets Bim and results in the down regulation of Casp9, which are crucial factors in apoptotic pathway 33. [score:5]
In contrast, when miR-10a was directly delivered to damaged GCs in vitro or to ovaries in CTx-mice, it exerted the effectively anti-apoptotic effect as its target genes silenced. [score:4]
Between the two miRNAs, the knockdown of miR-146a in exosomes ablated the anti-apoptotic properties in damaged GCs after 48 hours of culture compared with that in the negative control, whereas the down-regulation of miR-10a disrupted this activity at as early as 24 hours (Fig. 2d). [score:4]
Several groups have reported that miR-146a functions in repressing NF-κB pathway 43 44, which has been shown to negatively regulate the expression of miR-10a 45. [score:4]
Our results show that the down-regulation of miR-146a or miR-10a attenuated the efficacy of sustaining survival in damaged GCs compared with that in negative control, whereas the double knockdown of both miRNAs impaired the effect more prominently (Fig. 2c). [score:4]
Down-regulation of miR-146a and/or miR-10a impaired the effects of AFSC-derived exosomes on damaged GCs in vitro. [score:4]
Moreover, recent studies have evidenced that miR-10a targets Bcl-6 46, which results in down regulation of miR-146a 47. [score:4]
Similarly, delivery of only miR-10a or both miR-146a and miR-10a miRNAs significantly suppresses follicular atresia at day 3, whereas there was no significant difference among each group at other time points (Fig. 4a). [score:3]
The expression level of mature miR-146a and miR-10a in AFSCs, NIH-3T3 and their corresponding exosomes was analyzed by qRT-PCR. [score:3]
The expression of both miR-146a and miR-10a was significantly increased in AFSCs and in AFSC-derived exosomes than that in NIH-3T3 and NIH-3T3-derived exosomes (Fig. 1a,b). [score:3]
After transfection, expression levels of mature miR-146a and miR-10a in AFSCs and their exosomes were analyzed by qRT-PCR according to the manufacturer’s protocol. [score:3]
Our data demonstrated the increased levels of miR-146a and miR-10a as well as the decreased levels of the target genes of these miRNAs in CTx-damaged GCs after culture with AFSC-derived exosomes. [score:3]
In addition, miR-10a has been shown to modulate cell apoptosis through the suppression of pro-apoptotic factor, Bim 31. [score:3]
According to previous studies, miR-146a can potentially rescue damaged cells in various injury mo dels 30 48, and miR-10a is associated with the regulation of cell apoptosis in human cumulus-oocytes complex 49. [score:2]
In our study, knocking down miR-146a and miR-10a reduces the therapeutic effects of AFSC-derived exosomes implying these two miRNAs have essential roles in exosome activity in damaged GCs. [score:2]
To further assess whether miRNAs have the capacity to preserve follicles in CTx -treated mice, we directly injected PKH26 -labelled liposomes carrying miR-146a or/and miR-10a into bilateral ovaries of CTx -treated mice. [score:2]
AFSCs can restore the fertility and prevent POF in CTx treated mice possibly by delivering miR-146a, miR-10a and other potential miRNAs via exosomes to damaged GCs, and in turn down -regulating the pro-apoptotic genes. [score:2]
Thus, we propose that miR-146a may play a minor role in the therapeutic effects through an indirect way, while miR-10a acts as a predominant factor. [score:2]
To verify the accuracy of the results, we selected miR-146a and miR-10a, the most highly enriched miRNAs in AFSC-derived exosomes (287.20- and 54.96-fold respectively; Supplementary Table 1), for further validation by quantitative reverse transcription (qRT)-PCR. [score:1]
Nevertheless, the delivery of miR-146a reduced the average level of GC apoptosis comparing to negative control (NC) (from around 90% to 66% at 24 hours of culture; from around 82% to 60% at 48 hours of culture) with no statistical difference (Fig. 3f) and that the delivery of both miRNAs only slightly reduced the average level of GC apoptosis comparing to miR-10a alone (from around 18% to 9% at 24 hours of culture; from around 29% to 13% at 48 hours of culture) with no significant difference between the combination and miR-10a alone (Fig. 3f). [score:1]
The downstream gene of Bim, Casp9, was significantly reduced 24 hours after miR-10a delivery (Fig. 3d). [score:1]
At day 3, 48 hours after the injection, the delivery of miR-10a or both miR-146a and miR-10a miRNAs significantly repressed the apoptosis, and there was no significant difference between these two groups (Fig. 4a). [score:1]
How to cite this article: Xiao, G. -Y. et al. Exosomal miR-10a derived from amniotic fluid stem cells preserves ovarian follicles after chemotherapy. [score:1]
Additionally, we noticed that the therapeutic effects of the delivery of miR-146a and miR-10a via liposomes were lower than that of exosomes in vivo. [score:1]
Interestingly, we observed a potential link between miR-146a and miR-10a. [score:1]
Hence, we used miR-146a and miR-10a for the further investigation, since they both are associated with the suppression of cell apoptosis 30 31. [score:1]
Next, we further examined whether miR-146a or miR-10a itself can similarly reproduce the actions of AFSC-derived exosomes in damaged GCs. [score:1]
MicroRNA mimics (#MSY0000158 for miR-146a and #MSY0000648 for miR-10a, Qiagen) and negative control siRNA (AllStars Negative Control siRNA, #SI03650318, Qiagen) were employed for the study. [score:1]
The miScript Primer Assays were used to assess the expression level of miR-146a and miR-10a (#MS00001638 for miR-146a and #MS00032242 for miR-10a, Qiagen), whereas RNU6-2 (#MS00033740, Qiagen) was used as an endogenous control. [score:1]
These results suggest that miR-146a and miR-10a could have a critical role in the restorative effect of AFSCs. [score:1]
CTx-mice with the injection of RNase-free water only, liposome with negative control mixture, liposome with miR-146a mimic, liposome with miR-10a mimic or liposome with both miR146a and miR-10a mimics were designated to CTx-water-, CTx-Lipo-NC-, CTx-Lipo-OE146a-, CTx-Lipo-OE10a- and CTx-Lipo-OE146a and 10a -mice. [score:1]
We next examined whether miR-146a and miR-10a contributed therapeutic value. [score:1]
To validate that AFSCs could deliver miR-146a and miR-10a to damaged GCs via exosomes, we cultured damaged GCs with AFSC-derived exosomes. [score:1]
These findings indicate that miR-10a plays a pivotal role in the therapeutic effects of AFSCs in CTx -induced ovarian failure. [score:1]
Our findings imply that the delivery of miR-10a could be useful for the preservation of ovarian follicles in female patients after CTx. [score:1]
[1 to 20 of 45 sentences]
7
[+] score: 114
To further demonstrate that GP1BA is a target gene of miR-10a and -10b, we transfected the β/IX -expressing Chinese Hamster Ovary (CHO) cells with a mixture of the human GP Ibα expression vector and miR-10a/b or negative control miRNA mimics, to examine if GP Ibα expression changes at the protein level. [score:9]
When we transfected miR-10a or -10b mimics into either the GP Ibβ/GP IX -expressing cells along with a DNA construct harboring both the coding and 3′-UTR sequences of the human GP1BA gene, or murine lineage negative cells prior to megakaryocytic differentiation, we found that miR-10a and -10b mimics inhibit the GP Ibα mRNA expression and transient expression of GP Ibα protein on the cell surface, as compared to the negative control miRNA or other miRNA mimics tested. [score:8]
Does dysregulated expression of HoxB4 alter normal megakaryopoiesis due to a simultaneous dysregulation of miR-10a production and therein GP Ibα expression? [score:7]
In agreement, it has been reported that the expression levels of miR-10a were significantly down-regulated by ~50-fold [15], which occurred 4 days after in vitro megakaryocytic differentiation of hematopoietic CD34 [+] progenitor cells. [score:6]
Considering the fact that miR-10a and -10b differ in only one nucleotide (Figure 1D, dotted) and have an identical seed sequence, our data demonstrated that miR-10a and -10b can negatively regulate the expression of the GP1BA gene through the base pairing of their seed sequences to the complementary target site in the 3′-UTR of the human GP1BA gene. [score:6]
Thus, our data demonstrate that GP Ibα is a novel regulatory target of miR-10a and -10b, and suggest that a reduction of the miR-10a and -10b levels is essential for the normal progression of the late stage of megakaryopoiesis by promoting a sufficient expression of GP Ibα and subsequent formation of the GP Ib-IX-V complex on the surface of megakaryocytes and platelets. [score:6]
Furthermore, by performing a literature review, we found that miR-10a, miR-10b and miR-107 were previously reported to be involved in the regulation of hematopoietic gene expression [15, 19], and miR-299-3p is predicted to target the 3′-UTRs of both human and mouse GP1BA gene. [score:6]
Interestingly, we found that upon mutation the strong inhibitory effect we observed initially was abolished through use of the mutant constructs (Figure 1E), indicating that the predicted target sites of miR-10a and -10b in the 3′-UTR of the human GP1BA gene are functional. [score:6]
In addition, we also tested miR-10a or -10b inhibitors in this megakaryocyte differentiation system; we observed neither an early expression of GP Ibα mRNA at day 1 nor a significant increase of GP Ibα mRNA level at day 2 (Figure 2C). [score:5]
Based on these previous observations and the data from this study, it is conceivable that active expression of human GP Ibα in the late stage of megakaryocyte differentiation depends on a significant reduction of the miR-10a expression. [score:5]
In particular, we have established a connection between two previous observations, i. e., drastic decrease in the expression of miR-10a and -10b accompanied by a marked production of sufficient amounts of GP Ibα molecules in the late stage of megakaryocyte development, two critical steps for normal megakaryocytic endomitosis and platelet production. [score:4]
Taken together, our study identifies GP Ibα as a novel and physiologically relevant target of miR-10a and -10b, and provides a new piece of information to our pool of knowledge regarding the miRNA -based regulation of megakaryopoiesis. [score:4]
Therefore, we chose to assess four miRNAs (miR-10a, miR-10b, miR-107, and miR-299-3p) and investigate if they can target the 3′-UTR and regulate the expression of human GP Ibα (Figure 1A). [score:4]
Nevertheless, our data demonstrate that miR-10a and -10b can repress human GP1BA gene expression through miRNA -mediated mRNA degradation. [score:3]
However, PITA prediction showed that only the first five of these seven miRNAs are potentially capable of targeting the human GP1BA gene (miR-10a, -10b, -107, -153, and -299-3p). [score:3]
In the human genome, miR-10a is located upstream of the HoxB4 (Homeobox B4) gene within the HOXB (Homeobox B) gene cluster of chromosome 17q21 and its expression corresponds to that of HoxB4. [score:3]
A half million enriched Lin [−/−] cells were first transfected with 80 nM of miR-10a/b mimics or inhibitors (Qiagen) or negative control miRNA mimics using a HiPerFect Transfection Reagent (Qiagen). [score:3]
As shown in Figure 2B, upon megakaryocytic differentiation, these cells progressively express increasing amounts of human GP Ibα mRNA, the level of which was decreased by ~40% (densitometry analysis, Figure 2D) or 2–3-fold (qPCR quantification, Figure 2E) 4 days after the introduction of exogenous miR-10a or -10b. [score:3]
PCR conditions for miR-10a and miR-10b were as follows: 95 °C for 15 min followed by 40 cycles of 94 °C for 15 s, 57 °C for 30 s and 70 °C for 40 s. The 2−ΔΔ Ct method was used to determine relative expression levels. [score:3]
A total of 173 miRNAs were predicted to bind to the 3′-UTR of the human GP1BA gene by TargetScan, seven of which were also returned by miRanda (miR-10a, -10b, -107, -153, -299-3p, -300 and -381). [score:3]
Interestingly, we also employed the same bioinformatics approach to analyze the 3'-UTRs of other GP Ib-IX-V subunit genes, i. e., GP Ibβ, GP IX and GP V, and found that, of the proteins forming the GP Ib-IX-V complex, miR-10a and -10b specifically regulate the human GP1BA gene only. [score:2]
Meanwhile, because miR-10a and -10b do not introduce any mutations to the GP Ibα coding sequence, and thereby do not alter the amino acid composition in the mature GP Ibα protein, it is unlikely that miR-10a and miR-10b can alter GP Ib-IX-V complex formation. [score:2]
To the best of our knowledge, miR-10a and -10b are the first two miRNAs that have been identified and experimentally validated for human GP1BA gene regulation. [score:2]
To further evaluate the specificity, we mutated the seed sequences of the putative miR-10a and -10b targeting sites in the GP1BA 3′-UTR (Figure 1D, underlined), and tested if miR-10a and -10b mimics could inhibit the activity of the firefly luciferase in the mutant construct as compared to the cells transfected with the wild-type constructs. [score:2]
How is the miR-10a host gene, HoxB4, regulated during megakaryocyte differentiation? [score:2]
We also quantified the levels of miR-10a and -10b mimics within the progenitor cells at day 4, and found the levels of transfected miR-10a and -10b mimics were increased by approximately 30-fold (Figure 2F), a ratio comparable to the degree of reduction of these two miRNAs in the late stage of human megakaryopoiesis (~12–50-fold) [15]. [score:1]
In our study, we searched for potential binding sites for miR-10a and -10b in these two regions of the human GP1BA gene, and found that only the 3′-UTR possesses such sites. [score:1]
One, how is the GP Ibα mRNA degraded by miR-10a in megakaryocytes? [score:1]
Site-directed mutagenesis was performed to remove the putative miR-10a or -10b recognition sites in these constructs (MT-3′-UTR reporter) by using the following two primers (Stratagene): 5′-CCCTCCCTATCAGGGAGTGTTCCTTACCTCCAAC-3′ and 5′-AGGAACACTCCCTGATAGGGAGGGGTCTTAGTTCC-3′. [score:1]
One day after seeding, the cells were transfected with 0.5 μg pDX-hGP Ibα plasmid DNAs along with 80 nM of miR-10a/b or negative control miRNA mimics using an Attractene Transfection Reagent. [score:1]
However, sustaining high levels of miR-10a and miR-10b cause degradation of GP Ibα mRNA, resulting in low amounts of GP Ibα protein. [score:1]
After we co -transfected this reporter construct into HeLa cells along with various concentrations of miRNA mimics (ranging from 5 to 40 nM), only the cells co -transfected with the miR-10a or -10b mimics showed a significant reduction in their firefly luciferase activities (Figure 1C). [score:1]
[1 to 20 of 32 sentences]
8
[+] score: 90
Previous studies have shown that miR-10a can target IL-12/IL-23p40 expression [32] and pro-apoptotic protein Bim [33], while miR-30d can negatively regulate apoptotic caspase CASP3 [34] and tumor suppressor p53 gene [35]. [score:8]
The study by Shi et al. [8] demonstrated that podocytes strongly expressed four members of the miR-30 family that may target genes such as vimentin, heat-shock protein 20 and immediate early response 3. Through the silencing of these target genes, the miR-30 and miR-10 miRNA families play an essential role in podocyte homeostasis and podocytopathies, which is in agreement with our finding in the present study. [score:7]
Indeed, it has been reported that during nephrogenesis, nephron progenitors highly expressing miR-10a and miR-10a can target Bim [24]. [score:5]
Serving as negative regulators of cell apoptosis, miR-10a and miR-30d have been found to be upregulated in various cancer tissues, such as prostate cancer [36]. [score:5]
This result was further validated using a TaqMan probe -based qRT-PCR, we detected the expression of miR-10a, miR-30d and miR-192 in various mouse organs: the heart, spleen, kidney, colon and lung. [score:3]
Because miR-10a and miR-30d are enriched in kidney tissue (Figure 1), urinary miR-10a and miR-30d are probably derived directly from the kidneys, particularly when kidney injury has occurred. [score:2]
In addition, urinary miR-10a and miR-30d are highly enriched to the kidney; therefore, the elevation of these miRNAs may be directly linked to the injuries of kidney. [score:2]
The elevation of kidney-enriched miR-10a and miR-30d in urine (Figure 2) but not serum (Figure S2) during renal I/R indicated that these miRNAs may be directly correlated with kidney injury. [score:2]
We used both I/R -induced acute kidney injury and STZ diabetes -induced chronic kidney injury animal mo dels and showed that changes in the levels of urinary miR-10a and miR-30d occurred as a result of renal damage. [score:1]
Alteration of the urinary miR-10a and miR-30d levels in FSGS patients. [score:1]
A) Levels of miR-10a and miR-30d in mouse kidney with or without renal I/R. [score:1]
These results collectively suggest that elevation of mouse urinary miR-10a and miR-30d during renal I/R is likely due to the release of mature miR-10a and miR-30d from mouse kidney tissue. [score:1]
Together, these results strongly suggest that urinary miR-10a and miR-30d could serve as sensitive and specific biomarkers for kidney injury. [score:1]
To find out whether the elevation of urinary miR-10a and miR-30d also occurs in patient with kidney injuries, we assessed the levels of urinary miR-10a and miR-30d in FSGS patients. [score:1]
More importantly, the levels of urinary miR-10a and miR-30d were significantly increased in mice with either unilateral ischemia/reperfusion or bilateral ischemia/reperfusion. [score:1]
Interestingly, recent study by Lorenzen et al. [31] showed that miR-10a was released into urine and could be detected in kidney transplant patients at the onset of acute T-cell mediated rejection, which may suggest a mild acute kidney injury during the process of T-cell mediated rejection. [score:1]
Identification of miR-10a and miR-30d as kidney-specific miRNAs. [score:1]
Elevation of the urinary miR-10a and miR-30d levels in mice with renal I/R -mediated injury. [score:1]
The results for the human urine samples further confirmed the feasibility of using the urinary miR-10a and miR-30d levels to detect kidney injury in humans. [score:1]
After bilateral renal I/R, the level of miR-30d in serum was still unchanged, while the level of miR-10a was reduced. [score:1]
High levels of urinary kidney-enriched miR-10a and miR-30d clearly indicate the kidney injuries in FSGS patients. [score:1]
Figure S3 The levels of miR-10a, miR-30d, pre-miR-10a and pre-miR-30d in mouse kidney tissues detected by TaqMan probe -based qRT-PCR with U6 serving as an internal control. [score:1]
Using different mouse renal injury mo dels, we reported that miR-10a and miR-30d were readily detected in urine and that their levels specifically correlated with mouse kidney injury induced by renal ischemia-reperfusion or STZ treatment. [score:1]
Elevation of the urinary miR-10a and miR-30d levels can be detected in mice with unilateral I/R in which the protein levels were not changed, suggesting that the urinary miR-10a and miR-30d levels can reflect mild or early kidney injury. [score:1]
A, the serum miR-10a level was decreased in DS I/R mice but not SS I/R mice. [score:1]
Through decreasing the levels of these apoptotic or pro-apoptotic proteins and inflammatory cytokines, miR-10a and miR-30d might provide a protection to kidney tissues/cells. [score:1]
Interestingly, the levels of pre-miR-10a and pre-miR-30d in mouse kidney tissues were not changed (Figure S3B). [score:1]
Therefore, an elevation of urinary miR-10a/miR-30d levels correlates to a decrease of kidney miR-10a/miR-30d levels, which links to cell apoptosis and kidney injury/damage. [score:1]
As shown in Figure S2, no alteration of miR-10a or miR-30d in mouse serum was observed after unilateral renal I/R. [score:1]
Interestingly, although the chronic hyperglycemia caused an elevation of urinary miR-10a and miR-30d likely due to the kidney damage, a short period of high blood glucose exposure did not increase the level of these kidney-specific miRNAs in urine. [score:1]
The elevation of the urinary levels of miR-10a and miR-30d was also confirmed in urine samples from patients with focal segmental glomerulosclerosis (FSGS). [score:1]
To test whether urinary miR-10a and miR-30d can be biomarkers for diabetes -induced renal injury, we employed streptozotocin (STZ) -treated diabetic mice as another kidney injury mo del. [score:1]
In summary, our study demonstrated that miR-10 and miR-30d are stably present in human and animal urine and that the elevation of the urinary miR-10a and miR-30d levels can serve as a novel urine -based biomarker of kidney injury. [score:1]
Next we determined the levels of miR-10a and miR-30d in mouse kidney tissue with or without renal I/R. [score:1]
Figure S2 Level of serum miR-10a and miR-30d in mice with/without renal ischemia-reperfusion injury. [score:1]
This hypothesis is supported by our observation that the elevation of miR-10a and miR-30d concentrations occurred only in urine and not in serum when mice were treated with renal I/R. [score:1]
Urine samples from normal male C57BL/6J mice (6–8 weeks old, 22–25 g) and male C57BL/6J mice with kidney injuries were collected, and absolute levels of miR-10a and miR-30d were assessed. [score:1]
By challenging 12 h–fasting mice with an intraperitoneal injection of glucose (2 g/kg of body weight), we found no elevation of urinary miR-10a and miR-30d within 1–3 h (data not shown). [score:1]
These results strongly suggest that urinary miR-10a and miR-30d can serve as ideal biomarkers for kidney injury. [score:1]
In the present study, we observed increases in the urinary concentrations of miR-10a and miR-30d corresponding to kidney injuries. [score:1]
These results suggest that the elevation of urinary miR-10a and miR-30d levels may specifically reflect hyperglycemia -induced kidney injury. [score:1]
In contrast, reduction of miR-10a and miR-30d in kidney cells would cause cell apoptosis and damage, which may finally lead to renal dysfunction. [score:1]
Therefore, we also detected the levels of miR-10a and miR-30d in mouse serum with or without renal I/R. [score:1]
For mouse kidney, after rule out the miRNAs with very low total signal, we found that miR-10a and miR-30d, as well as other miRNAs in miR-1 and miR-30 families, were relatively enriched in kidney tissue. [score:1]
Clarifying the role of miR-10a and miR-30d in the tumorigenesis processes of these cancer cells may be helpful for understanding the correlation between urinary miR-10a/miR-30d and kidney injures. [score:1]
C–D, significant elevation of the urinary miR-10a (C) and miR-30d (D) levels in mice with either SS I/R or DS I/R. [score:1]
By comparing the levels of miRNA in sera and urine, we found that kidney-enriched miRNAs, such as miR-10a and miR-30d, were present in urine, and their concentrations were approximately 1/10 of those in sera. [score:1]
However, it could also be true that renal cells and tissues actively release more miR-10a and miR-30d into circulation under the stress. [score:1]
Moreover, pre-miR-10a and pre-miR-30d were not detected in mouse urine by qRT-PCR (data not shown). [score:1]
Next, we tested whether miR-10a and miR-30d are released into animal urine under normal and injury conditions. [score:1]
Elevation of the urinary miR-10a and miR-30d levels but not serum miR-10a and miR-30d in mice with STZ diabetes -associated kidney injury. [score:1]
As shown in Figure 1, we found that mouse kidneys contained a significantly higher level of miR-10a and miR-30d than did other tissues, confirming that these two miRNAs are kidney specific. [score:1]
Importantly, when kidney injury occurred, the levels of miR-10a and miR-30d in urine were strikingly elevated, while their levels in the serum were not increased. [score:1]
Note that the levels of urinary miR-10a (A) and miR-30d (B) were significantly increased in mice with STZ diabetes -induced kidney injury, whereas the levels of serum miR-10a (C) and miR-30d (D) were not altered. [score:1]
As shown in Figure S3A, both miR-10a and miR-30d in mouse kidney were significantly reduced during renal I/R. [score:1]
B) Levels of pre-miR-10a and pre-miR-30d in mouse kidney with or without renal I/R. [score:1]
Identification of miR-10a and miR-30d as mouse kidney-enriched miRNAs. [score:1]
Furthermore, urinary miR-10a and miR-30d exhibited a diagnostic sensitivity that was considerably superior to that of BUN when the results were correlated to the histopathological results. [score:1]
Interestingly, we found that the miR-10a and miR-30d levels in serum were not correlated with kidney injury. [score:1]
Note that, following renal I/R, the levels of mouse kidney miR-10a and miR-30d are decreased whereas the levels of pre-miR-10a and pre-miR-30d are not changed. [score:1]
0051140.g003 Figure 3Note that the levels of urinary miR-10a (A) and miR-30d (B) were significantly increased in mice with STZ diabetes -induced kidney injury, whereas the levels of serum miR-10a (C) and miR-30d (D) were not altered. [score:1]
Elevation of miR-10a and miR-30d levels in the urine of FSGS patients. [score:1]
The role of tissue miR-10a and miR-30d in kidney function also strengthens our conclusion that urinary miR-10a and miR-30d can serve as indicators for kidney injury. [score:1]
As shown in Figure 4, we found that the urinary miR-10a and miR-30d levels in FSGS patients were significantly higher than those in healthy volunteers, indicating the severity of the kidney injuries in these patients. [score:1]
[1 to 20 of 64 sentences]
9
[+] score: 74
In addition, only mir-10a was found upregulated after VPA treatment of primary cortical neurons (Fig. S3), thus suggesting that the expression of mir-10a might be directly affected by VPA even at later stages of neural development. [score:8]
The finding that mir-10a is the earliest upregulated gene, which, in contrast to myogenic factors or mir-206, already displayed a significant increase in the expression level on day 5 of differentiation in VPA -treated mESCs, suggests that it plays a central role in the stimulation of myogenesis during VPA -mediated disturbance of neural differentiation. [score:6]
In four independent differentiation procedures we could confirm the microarray data (Fig. 5A)–that is, a strong concentration -dependent induction of muscle-specific/abundant miRNA (mir-206, mir-10a, mir-214, mir-145, mir-143, mir-199a) and a significant downregulation of the expression of neuro-specific miRNAs (mir-124, mir-128, mir-137, mir-491, mir-383) in comparison to the solvent control. [score:6]
In addition, the fact that about 40% of all known miRNAs could be affected by HDAC inhibitors while the percentage of protein encoding genes rather remains low [38] reinforces our hypothesis that mir-10a could be a first and direct target of VPA. [score:6]
Taking into account the known mechanism of VPA as a HDAC inhibitor we can suggest possible activation of mir-10a and mir-206 genes by VPA through the inhibition of HDAC and, as a result, acetylation/activation of histones in the miRNA promoter regions. [score:5]
To understand which transcription factor or miRNA expression was affected first by VPA treatment, and thus possibly contributing to the stimulation of myogenic differentiation, we analyzed the time kinetics of the expression of myo-genes together with crucial miRNAs (mir-206, mir-10a) and marker for differentiated muscle tissue (Actc1) in the course of differentiation. [score:5]
Huang and co-authors were able to demonstrate that mir-10a expression is strongly increased upon retinoic acid -induced muscle differentiation of ESCs, where it determines the smooth muscle lineage by targeting Hdac4 [72]. [score:5]
Both miRNAs are upregulated in response to retinoic acid, a common inducer of cellular differentiation in different cell types and mir-10a/b were shown to contribute to retinoic acid -induced differentiation of neuroblastoma cells [72], [73]. [score:4]
Comparing to the solvent control, in cells treated with VPA we observed a strong upregulation of myogenic miRNAs (myo- mirs: mir-206, mir-133a,b), or miRNAs shown to be involved in muscle differentiation and specification (mir-10a, mir-143/ mir-145 cluster, mir-214, mir-322, mir-199a). [score:4]
Both, pri -mir-10 and pri -mir-206 were significantly upregulated upon VPA treatment, suggesting that VPA affects the transcription and not the processing of these two miRNAs. [score:4]
This would be in line with the induction of mir-10a expression in primary neurons (Fig. S3). [score:3]
As expected, we observed the induction of mir-206 and mir-10a expression upon TSA treatment. [score:3]
Only mir-10a was significantly affected by VPA in primary cortical neurons, suggesting that this miRNA could be a primary target of VPA (Fig. S3). [score:3]
As expected, we observed a significant induction (p<0.05) of mir-206 expression in VPA -treated cells as early as on day 12 of differentiation, while mir-10a was strongly induced in VPA -treated but not in control samples from day 5 of differentiation, suggesting that this miRNA could be the first signal stimulating myogenesis under VPA exposure during neural differentiation of mESCs (Fig. 7B). [score:3]
In the future studies chromatin immunoprecipitation (CHIP) analysis of the mir-10 promoter region may be helpful to clarify whether VPA induces the acetylation/activation of histone complexes in the regulatory regions of the mir-10a locus. [score:2]
Most regulated miRNAs shown in our study are highly conserved between mice and humans (e. g. mir-206, mir-214, mir-10a, mir-124, mir-137, mir-128, mir-9) [61], [62]. [score:2]
Importantly, clustering of some miRNA genes within the genome is also conserved between human and mice (e. g. mir-206/mir-133b, mir-214/mir199a, mir-10a/HoxB4, mir-145/143 clusters, all of which have been studied here) (www. [score:1]
Neither mir-206 nor mir-10a could be detected in undifferentiated mESCs. [score:1]
0098892.g009 Figure 9TSA induction of mir-206 and mir-10a during neural differentiation of mES cells. [score:1]
TSA induction of mir-206 and mir-10a during neural differentiation of mES cells. [score:1]
mir-206 was not detected in primary cultures, while mir-10a was strongly induced upon VPA treatment. [score:1]
[1 to 20 of 21 sentences]
10
[+] score: 52
Table 1 The role of miRNAs in autoimmune diseases miRNA Predicted/Identified targets Function Related diseases miR-22 IRF8Enhances CD11c [+]CD11b [+]B220 [−] cDC generation at the expense of pDCs miR-142 IRF8Plays a pivotal role in the maintenance of CD4 [+] DCs miR-142-3p IL-6 Specifically inhibits IL-6 expression by moDC MS miR-21 IL-12p35, Wnt1 Negatively regulates the production of IL-12 by moDC; negatively regulate the development of moDC SLE, IBD, UC, MS miR-10a IL-12/IL-23p40 Suppress the production of IL-12 and IL-23 by moDC SLE miR-148/152 Calcium/Calmodulin- dependent protein kinase IIa Suppress the production of IL-12 and IL-6 SLE miR-23b Notch1, NF-κB Inhibits the production of IL-12 while promotes IL-10 production UC miR-155 SOCS1, SHIP1, TAB2 Positively regulates the production of several pro-inflammatory cytokines including IL-6, IL-23, IL-12, and TNF-α RA, IBD miR-146a IRAK1, TRAF6 Negatively regulates TLR4-NF-κB pathway in monocytes RA, SLE, IBD miR-34a JAG1 Negatively regulates the development of moDC MS miR-223 C/EBPβNegatively regulates LCs -mediated antigen-specific CD8 [+] T cell proliferation, production of inflammatory cytokine TNFα, IL-1β, and IL-23 by intestinal DCs. [score:25]
Compared to miR-21 and miR-10a that directly target IL-12 genes, some other miRNAs target the signaling components that will affect multiple downstream targets. [score:7]
Besides, as miR-10a has also been demonstrated to negatively regulate DC function by direct targeting IL-12/IL-23p40 (Xue et al., 2011), its lower expression in SLE patients may also promote the autoimmune responses. [score:7]
Ectopic expression of miR-10a in moDCs suppressed both production of IL-12 and IL-23 (Xue et al., 2011). [score:5]
MiR-10a also directly targets the IL-12 gene. [score:3]
Seven miRNAs (miR-31, miR-95, miR-99a, miR-130b, miR-10a, miR-134, and miR-146a) were expressed at 6-fold lower level in SLE patients than that of healthy controls (Tang et al., 2009). [score:3]
Unlike miR-21, miR-10a negatively regulates the production of IL-12/IL-23p40. [score:2]
[1 to 20 of 7 sentences]
11
[+] score: 50
A miRNA array analysis revealed that among the miRNAs that are downregulated during osteoblastic differentiation, miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a, and miR-181a seemed most likely to target the osteogenesis-related transcription factors Dlx5 and Msx2, acting as potential inhibitors of osteogenesis by directly targeting these osteogenesis-related transcription factors. [score:11]
In our preliminary experiment, transfection of anti-miR-124a and anti-miR-181a did not induce osteoblastic differentiation in mouse iPS cells (data not shown), suggesting that suppression of miR-124a and miR181a, which directly target Dlx5 and Msx2, is not sufficient to induce osteoblastic differentiation of mouse iPS cells, but that suppression of at least one miRNA of miR-10a, miR-10b, miR-9-3p and miR-19b besides miR-124a and miR-181a is required for osteoblastic differentiation. [score:8]
We focused on the 6 miRNAs, miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a, and miR-181a that were significantly downregulated during BMP-4 -induced osteoblastic differentiation, and they seemed to target the transcription factors Dlx5 and Msx2 and to be associated with osteoblast differentiation (Table 3). [score:6]
A miRNA array analysis revealed that six miRNAs including miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a and miR-181a were significantly downregulated. [score:4]
In addition, miR-10a putatively targets Smad2, Wnt8A and Wnt6, and FGF6, suggesting that miR-10a reflects BMP, Wnt and FGF signals. [score:3]
Considering the putative target genes in Table 3, miR-10a, miR-10b, miR-19b and miR-9-3p may constitute a control mechanism for Dlx5 and Msx2. [score:3]
Six miRNAs including miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a, and miR-181a putatively targeted Dlx5 and Msx2 mRNA (Table 3). [score:3]
0043800.g003 Figure 3 (A) Time course of miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a, and miR-181a expression in differentiated iPS cells. [score:3]
The protocol shown in Fig. 5A was used to induce osteoblastic differentiation with 6 anti-miRNAs (anti-miR-124a, anti-miR-181a, anti-miR-10a, anti-miR-10b, anti-miR-9-3p, and anti-miR-19b) targeting Msx2 or Dlx5 in iPS cells. [score:3]
In the present study, we demonstrate that six miRNAs including miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a and miR-181a miRNAs, especially miR-124a and miR-181a, are important regulatory factors in osteoblastic differentiation of mouse iPS cells. [score:2]
What are functions of these 6 miRNAs including miR-124a, miR-181a, miR-10a, miR-10b, miR-9-3p, and miR-19b in osteoblastic differentiation of mouse iPS cells? [score:1]
For functional studies examining the effects of the anti-miRNAs on cell differentiation, the mouse iPS cells were transfected on day 1 and day 8 after EB formation with anti-miR-124a, anti-miR-181a, anti-miR-10a, anti-miR-10b, anti-miR-19b, and anti-miR-9-3p for 72 h, followed by culture in GMEM without osteogenic factor. [score:1]
Although it has been reported that a number of miRNAs, miR-204/211 [13], miR-125b [14], miR-133 and miR-135 [15], miR-141 and miR-200a [16], and miR-29b [17], were involved in osteoblastic differentiation, a few papers have been reported with regard to the functions of miR-10a, miR-10b, miR-9-3p and miR-19b. [score:1]
0043800.g005 Figure 5(A) Schematic representation of the osteoblast differentiation protocol for iPS cells which were transfected with 6 anti-miRNAs including anti-miR-124a, anti-miR-181a, anti-miR-10a, anti-miR-10b, anti-miR-19b, and anti-miR-9-3p. [score:1]
[1 to 20 of 14 sentences]
12
[+] score: 49
Microbiota downregulates dendritic cell expression of miR-10a, which targets IL-12/IL-23p40. [score:8]
Laminar flow promotes the expression of miR-10a, which negatively regulates NF-κB activity in ECs by directly targeting TAK1 and β -TRC. [score:7]
The aortic arch experiences disturbed flow dynamics and elevated NF-κB activity, which suggests that NF-κB may negatively regulate miR-10a expression. [score:4]
In support of this, Xue et al. (2011) showed that miR-10a is downregulated by TLR -mediated NF-κB activity in intestinal dendritic cells. [score:4]
Other microRNAs, such as miR-10a (Fang et al., 2010) and miR-92a (Wu et al., 2011; Fang and Davies, 2012; Loyer et al., 2014), are regulated by laminar flow, a potent inhibitor of EC inflammatory pathways. [score:4]
These results suggested that laminar flow promotes the expression of miR-10a; however, it should be noted that miR-10a does not appear to be regulated by KLF2 (Hergenreider et al., 2012). [score:4]
To identify microRNAs that might contribute to the regulation of vascular inflammation, Fang et al. (2010) performed microRNA arrays on atherosusceptible versus atheroprotective regions of the vasculature in swine mo dels, and found that miR-10a is an EC-enriched microRNA that is decreased in regions that are prone to the development of atherosclerosis, such as the lesser curvature of the aortic arch. [score:3]
The role of miR-10a in atherosclerosis has not been tested, but the results of Fang et al. (2010) suggest that miR-10a may suppress atherogenesis; linking flow dynamics with NF-κB signaling. [score:3]
Functional characterization of this microRNA revealed that miR-10a negatively regulates NF-κB activity in cultured human ECs by directly targeting MAP3K7 (also known as TAK1) and β -TRC (Fang et al., 2010; Figure 1). [score:3]
MiR-10a AND miR-92a CONTRIBUTE TO THE REGULATION OF NF-κB IN RESPONSE TO BLOOD FLOW. [score:2]
The differential flow -mediated regulation of miR-10a in the vasculature was confirmed in mouse mo dels (Fang et al., 2010). [score:2]
The recent generation of miR-10a knock-out mice (Stadthagen et al., 2013) will be useful to test this hypothesis. [score:2]
MicroRNA-10a regulation of proinflammatory phenotype in athero-susceptible endothelium in vivo and in vitro. [score:1]
Loss of miR-10a activates lpo and collaborates with activated Wnt signaling in inducing intestinal neoplasia in female mice. [score:1]
MiR-155 has been intensely studied for its role in controlling inflammation, but in contrast to miR-146a, miR-10a, miR-92a, and miR-181b, which appear to have predominantly pro- or anti-inflammatory roles, studies on miR-155 have often revealed conflicting roles for this microRNA. [score:1]
[1 to 20 of 15 sentences]
13
[+] score: 42
A hypothetical mo del of age -dependent miRNAs regulating LCs development and function is shown in Figure 6. Table 1 miRNAs in aging putative targets function in LC reference miR709↑ RANK LC development and homeostasis↓ 49 IRF8 LC development and homeostasis↓ 29 AhR impair LC maturation 33 miR449↑ TGFβRII LC development and homeostasis↓ 32, 46 RunX3 LC development and homeostasis↓ 30 CSF1R LC development and survival↓ 35 miR9↑ TGFβRII LC development and turnover↓ 32, 46 RunX3 LC development and homeostasis↓ 30 RANK LC development and homeostasis↓ 49 miR10a↓ Gfi1 LC development and homeostasis↓ 28 miR200c↓ C/EBP LC differentiation↓ 31 Langerin LC antigen uptake ↑ 22, 23 Gfi1 LC development and homeostasis↓ 28 miR744↓ TGFβI inhibit LC maturation 32, 46 miR20b↓ RANKL inhibit LC maturation 34 miR205↓ C/EBP LC differentiation↓ 31 The density of LCs in the epidermis is known to decrease with age in mice [21]. [score:19]
A hypothetical mo del of age -dependent miRNAs regulating LCs development and function is shown in Figure 6. Table 1 miRNAs in aging putative targets function in LC reference miR709↑ RANK LC development and homeostasis↓ 49 IRF8 LC development and homeostasis↓ 29 AhR impair LC maturation 33 miR449↑ TGFβRII LC development and homeostasis↓ 32, 46 RunX3 LC development and homeostasis↓ 30 CSF1R LC development and survival↓ 35 miR9↑ TGFβRII LC development and turnover↓ 32, 46 RunX3 LC development and homeostasis↓ 30 RANK LC development and homeostasis↓ 49 miR10a↓ Gfi1 LC development and homeostasis↓ 28 miR200c↓ C/EBP LC differentiation↓ 31 Langerin LC antigen uptake ↑ 22, 23 Gfi1 LC development and homeostasis↓ 28 miR744↓ TGFβI inhibit LC maturation 32, 46 miR20b↓ RANKL inhibit LC maturation 34 miR205↓ C/EBP LC differentiation↓ 31 (A) LCs were isolated using AutoMACS with anti-MHCII-PE and anti-PE microbeadsfollowed by a cell sorter. [score:19]
Based on the miRNAs potentially linked to LCs development and function, we have further confirmed that miR-709, miR-449 and miR-9 were upregualated in aging, while miR-200c and miR-10a were downregulated in aging by using single TaqMan RT-PCR assays (Figure 5 D). [score:4]
[1 to 20 of 3 sentences]
14
[+] score: 37
In this study, we also predicted targets of miRNAs, and found the targets of miR-10a miR-10b miR-414 and miR-466 in the HOX clusters (Additional file 9). [score:5]
The prediction of microRNA target analysis showed that several known microRNA targets, such as miR-10, miR-414 and miR-464, were found in the tammar HOX clusters. [score:5]
There was a strikingly high level of conservation of HOX gene sequence and structure and non-protein coding genes including the microRNAs miR-196a, miR-196b, miR-10a and miR-10b and the long non-coding RNAs HOTAIR, HOTAIRM1 and HOXA11AS that play critical roles in regulating gene expression and controlling development. [score:5]
Non-coding RNAs known to be involved in regulation of HOX gene expression [16, 17], include the highly conserved microRNAs [18], such as miR-196[19] and miR-10[20]. [score:4]
Using the tammar as a reference and searching the microRNA database we were able to identify four known HOX microRNAs (miR-196a miR-196b miR-10a and miR-10b), and most significantly, we uncovered one new potential microRNA, meu-miR-6313 in the tammar which was expressed in testis and fibroblasts. [score:3]
By microRNA deep sequencing and comparative genomic analyses, two conserved microRNAs (miR-10a and miR-10b) were identified and one new candidate microRNA with typical hairpin precursor structure that is expressed in both fibroblasts and testes was found. [score:3]
We found that miR-10a and miR-10b were strongly expressed in the testis. [score:3]
Regarding targets of miRNAs in the tammar HOX clusters, valid miRNA hits to miR-10a, miR-10b, miR-414 and miR-466 were confirmed (details referred to Additional file 9). [score:3]
In silico analysis as well in vitro and in vivo experiments have shown that the miRNAs miR-10 and miR-196 target several HOX genes, such as HOXA5/7/9, HOXB1/6/7/8, HOXC8, HOXD8, HOXA1/3/7, HOXB3 and HOXD10 [18- 20, 50, 51]. [score:3]
We examined the presence of known microRNAs, miR-196a1, miR-196a2, miR-196b, miR-10a and miR-10b, previously described in the human, mouse and zebrafish HOX clusters. [score:1]
Interestingly, the long-coding RNAs (HOTAIR, HOTAIRM1 and HOXA11AS) and microRNAs (miR-196a2, miR-196b, miR-10a and miR-10b) were highly conserved in this marsupial. [score:1]
microRNAs miR-10a located between HOXB4 and HOXB5 is highly conserved in all species. [score:1]
[1 to 20 of 12 sentences]
15
[+] score: 34
Among these upregulated miRNAs were miR-10a, which is a candidate tumor suppressor and suppresses apoptosis in leukemia [39], miR-409 that suppresses tumor cell invasion and metastasis in gastric cancer [40], and miR-206 and miR-345, which are frequently downregulated in various types of cancers and are believed to act as tumor suppressors [41], [42]. [score:15]
As shown in Figure 9C, there was excellent concordance in the data from the miRNA profiling and qPCR, the expression of miR-21, miR-26a, miR-24, miR-30b and miR-29a was down-regulated by EF24 treatment both in vitro and in vivo, while the expression of miR-345, miR-409, miR-10a and miR-206 was upregulated by EF24 treatment. [score:11]
Only four miRNAs (miR-10a, miR-409, miR-206 and miR-345) were upregulated both in vitro and in vivo, which reportedly act as tumor suppressors or inhibitors of cell cycle progression. [score:8]
[1 to 20 of 3 sentences]
16
[+] score: 32
Some miRNAs are induced by Foxp3, leading to either down-regulation of a specific target (e. g., miR-155 repressing SOCS1) or inducing positive feedback on Foxp3 expression (miR-10a, in combination with ATRA and TGF-β). [score:8]
Of note, expression of miR-10a is lowest in Tregs from animals prone to autoimmune disease, such as non-obese diabetic (NOD) mice, and in Tregs with unstable Foxp3 expression (Jeker et al., 2012). [score:7]
miR-10a is functionally linked to stabilization of Foxp3 expression (Jeker et al., 2012) and targets the transcriptional repressor Bcl-6 and corepressor Ncor2 to limit conversion of iTregs to Tfh (Takahashi et al., 2012). [score:5]
miR-10a expression in Tregs that lose Foxp3 expression is the same as in Teffs (Jeker et al., 2012). [score:5]
Mir-10a, on the other hand, is preferentially expressed in tTregs, but poorly expressed in iTregs induced with TGF-β without ATRA (Jeker et al., 2012; Takahashi et al., 2012). [score:4]
TGF-β and retinoic acid induce the microRNA miR-10a, which targets Bcl-6 and constrains the plasticity of helper T cells. [score:3]
[1 to 20 of 6 sentences]
17
[+] score: 30
The anterior expression border of miR-10a is likewise posterior to the r6/7 expression border of the full Hoxb4 domain [20]. [score:5]
miR-10a and miR-10b are expressed in the central nervous system and trunk in a sub-domain of the Hoxb4 and Hoxd4 expression domains. [score:5]
The coordinated regulation of both genes suggests that they may have shared functions during early development such as has been described for the shared repressive functions of the miR-10 family and hoxb4 in zebrafish [35]. [score:3]
miR-10a, located upstream of Hoxb4, was reported to repress Hoxd4 transcription by targeting its promoter region in human breast cancer cells [13]. [score:3]
Drosha cleavage of the Hoxb4/ pri-miR-10a transcript generates similar uncapped Hoxb4 transcriptsSimilar to miR-10b and Hoxd4, miR-10a is located in a conserved position 5′ to Hoxb4 (Fig. 1A). [score:1]
For example, both the position and sequence of the miR-10 family are conserved in Drosophila, ancestral vertebrates, teleosts and mammals [10]– [12]. [score:1]
In mammals, the sequence of mature miR-10a and miR-10b differs by a single nucleotide. [score:1]
There are three known microRNAs or miRNA families embedded in vertebrate Hox clusters: miR-10, miR-615 and miR-196 (Fig. 1A). [score:1]
The zebrafish miR-10 family is also found to repress hoxb1a and hoxb3a within the spinal cord in cooperation with hoxb4a [35]. [score:1]
The cleavage site is exactly 11 bp from the bottom of both the pri- miR-10b and pri- miR-10a stem junction on the downstream side. [score:1]
Drosha cleavage of the Hoxb4/ pri-miR-10a transcript generates similar uncapped Hoxb4 transcripts. [score:1]
The remaining two miR-10 family members, miR-10c and miR-10d, are located at homologous positions near sites from which 4 [th] group paralogs have been lost in the HoxBa and (vestigial) HoxDb clusters [48]. [score:1]
A similar result was obtained for the Drosha cleavage product of miR-10a and Hoxb4. [score:1]
In the zebrafish genome, three miR-10 members, miR-10b-1, miR-10b-2, and miR-10c, are positioned upstream of the Hox group 4 paralogs hoxd4a, hoxc4a and hoxb4a, respectively [48]. [score:1]
A miR-10 family member is embedded 5′ to the coding region of each of these Hox genes. [score:1]
Similar to miR-10b and Hoxd4, miR-10a is located in a conserved position 5′ to Hoxb4 (Fig. 1A). [score:1]
The relationship between the miR-10 family and Hox4 genes is surprisingly well conserved through evolution. [score:1]
qPCR analysis showed that both miR-10a and Hoxb4 transcripts are induced in a similar manner to miR-10b and Hoxd4 transcripts during RA -induced P19 neural differentiation (unpublished observations). [score:1]
[1 to 20 of 18 sentences]
18
[+] score: 30
Similarly, down-regulation of miR-10a, miR-126-5p, miR-204, and miR-488 at E17.5 were inversely correlated with up-regulation of Ltbp1, Edil3, P2rx7, and Fgfr3 respectively (Additional file 21). [score:7]
miR-204 and miR-488 (A) were down-regulated in Pkd1 [-/- ]kidneys whereas miR10a, miR-30a, miR-96, miR-126-5p, miR-182, miR-200a and miR-429 (B) were up-regulated in Pkd1 [-/- ]kidneys. [score:7]
Expression of 9 miRNAs (miR-204, miR-488, miR10a, miR-30a, miR-96, miR-126-5p, miR-182, miR-200a and miR-429), predicted to target significantly regulated genes at E14.5 was assayed using miRNA-qPCR. [score:5]
For example, miR-30a-5p may be involved in histone deactylase inhibitor pathways, apoptosis, calcium and Wnt signaling (Figure 9); miR-10a may be involved in TGF-β and hedgehog signaling; miR-204 may be involved in calcium signaling while miR-488 may be involved in MAPK signaling by targeting Fgfr3 (Figure 9). [score:5]
Expression of 9 miRNAs (miR-10a, miR-126-5p, miR-200a, miR-204, miR-429, miR-488, miR-96, miR-182 and miR-30a-5p), predicted to target significantly regulated genes at E17.5 was evaluated using miRNA-qPCR assays. [score:3]
We tested this hypothesis by determining the differential expression of 9 miRNAs (mmu-miR-10a, mmu-miR-30a-5p, mmu-miR-96, mmu-miR-126-5p, mmu-miR-182, mmu-miR-200a, mmu-miR-204, mmu-miR-429, and mmu-miR-488) between WT and Pkd1 [-/- ]genotypes at E14.5 and E17.5 (Figures 7 and 8). [score:3]
[1 to 20 of 6 sentences]
19
[+] score: 26
In particular, podocytes seemed to express miR-26a according to our mouse study 3. As shown by the Glo/TI ratio (Fig. 4d), miR-26a and miR-10a also seemed to be expressed in the dog Glo compared to TI. [score:4]
Although there is no report about miR-10a in Glo cells, downregulation of miR-26a and miR-10a in Glo was reported in a CKD mouse mo del 3. Decreased miR-26a in the kidneys is also demonstrated in diabetic nephropathy of humans and mice 17. [score:4]
When the expression levels were corrected to that of miR-191, the levels of miR-146a, miR-21a, miR-10a, and miR-10b tended to be higher in UExo of KD dogs than in UExo of HC dogs. [score:3]
Although differences in miR-10b and miR-10a levels did not match between TaqMan PCR and, we analyzed these miRNAs because their read number was high (Table 1), and they are highly expressed in human urine 13 as well as in dog and cat kidneys 4. This methodological difference might be affected by the differences between individual samples in TaqMan PCR and pooled samples in. [score:3]
Furthermore, the levels of miR-21a, miR-10a, and miR-10b were less than 1.0 in dogs with KD, meaning that they tended to be expressed in TI rather than in Glo in dogs with KD. [score:3]
Both TI damage score and KD score were negatively correlated with Glo levels of miR-486, miR-10a, and miR-10b. [score:1]
Urinary Cr was significantly and positively correlated with miR-26a, miR-486, miR-10a, miR-10b, and miR-191. [score:1]
Serum BUN and Cr, and Glo damage score were negatively correlated with Glo levels of miR-26a, miR-10a, and miR-10b. [score:1]
Regarding the Glo to TI ratio (Table 4), miR-26a, miR-146a, and miR-10a were negatively correlated with Glo damage and KD scores, and miR-146a and miR-10a were negatively correlated with TI damage score and serum Cr, respectively. [score:1]
Significant differences were observed in terms of miR-21a and miR-10a levels between the groups. [score:1]
miR-3107, miR-486a, miR-21a, miR-10a, and miR-10b satisfied these requirements. [score:1]
Decreased Glo miRNAs in KD such as miR-26a, miR-10a, and miR-10b significantly and strongly correlated with renal dysfunction and Glo injuries in dogs. [score:1]
Serum Cr was significantly and negatively correlated with miR-26a, miR-10a, miR-10b, and miR-191 and positively correlated with miR-21a. [score:1]
Significant differences were detected in miR-26a, miR-10a, and miR-10b between the groups. [score:1]
[1 to 20 of 14 sentences]
20
[+] score: 19
Other miRNAs from this paper: mmu-mir-146a, mmu-mir-10b
Target sequences of TALENs are as follows; TGGGGCCTCCAGGAGCC and TGTTGATTTTGTGGTTT for the gene desert on mouse chromosome 11, TCTGTGTGTATCCCCAG and TTGATATAACCCATGGA for mmu-mir-146a, TCTGTATATACCCTGTA and TGACCACAAAATTCCTT for mmu-mir-10a and TGTAACGTTGTCTATAT and TGGGTACCACACAAATT for mmu-mir-10b. [score:3]
Production of mmu-mir-10a and -10b knockout mice. [score:2]
Utilizing above condition, we set out to make a knockout mouse deficient in series of miRNAs; mmu-mir-146a, mmu-mir-10a, and mmu-mir -10b. [score:2]
We tested this possibility by RT-PCR analysis of mir-10a* using 6-base deleted mir-10a mutant mouse. [score:1]
To this end, mRNAs without polyA synthesized from TALEN plasmids for mmu-mir-10a and -10b were mixed and injected into fertilized oocytes at the concentration of 100, 200 and 400 ng/µl each for single TALEN pair. [score:1]
We next tried to generate mmu-mir-10a and -10b deficient mice. [score:1]
Since F1 pups should be heterozygous, it seems likely that founder of mmu-mir-10a mutant 3 and mmu-mir-10b mutant 1 are heterozygous mutants without mosaicism. [score:1]
Higher concentration of RNA mixture for microinjection enabled us to produce mmu-mir-10b, prompted us to try microinjection of TALEN mRNAs at the concentration of 500 ng/µl for generating mmu-mir-10a deficient mice. [score:1]
To examine if the mutated alleles induced by microinjection of TALEN RNAs can be transmitted to next generation or not, two independent heterozygous mice deficient for mmu-mir-10a and -10b were mated with wild type C57BL/6 strain. [score:1]
To test this, we ordered construction of TALENs for specific gene desert of mouse genome, which is located on chromosome 11, mmu-mir-146a, mmu-mir-10a and mmu-mir-10b from Cellectis bioresearch. [score:1]
Ratios of the intensities of digested/undigested bands were quantified, showing that lane 1, 9 and 10 of Figure 3C (mmu-mir-10a mutant 3) are similar (0.39, 0.39 and 0.37, respectively), and lane 2 and 7 in Figure 3D are similar (0.19 and 0.24, respectively). [score:1]
We examined the genome editing activities of TALEN pairs for the gene desert, mmu-mir-146a, mmu-mir-10a and mmu-mir-10b in NIH3T3 cultured cell line. [score:1]
As shown in Fig. 3C and 3D, mutated mmu-mir-10a and -10b allele were identified. [score:1]
Both mutants have mutated mmu-mir-10b and wild type mmu-mir-10a alleles (Fig. 2B). [score:1]
Real-time RT-PCR analysis of miR-10a*. [score:1]
[1 to 20 of 15 sentences]
21
[+] score: 16
Furthermore, qPCR was performed again to validate the downregulated and upregulated expression of selected miRNAs that may be relevant to development and confirmed that miR-135, miR-302, miR-449a, miR-200b, miR-200c, miR-193b, miR-130, and miR-141 were downregulated, whereas miR-10a, miR-181, and miR-470 were upregulated by RA treatment (Fig 4C and 4D). [score:16]
[1 to 20 of 1 sentences]
22
[+] score: 16
Although not required for Foxp3 expression, miR-10a contributes to Treg stability by targeting the transcriptional repressor Bcl-6 resulting in high and sustained Foxp3 (Figure 1C) (38, 43, 45). [score:5]
Thus, to increase Foxp3 expression and promote Treg stability and suppressor function, approaches can be undertaken to increase miR-10a or miR-95 and/or decrease miR-15a-17, miR-24, or miR-210. [score:5]
miR-10a, which is induced in Treg following RA and TGF-β exposure, is one of few miRNAs exclusively expressed in tTreg (38, 43, 44). [score:3]
In this regard, miR-10a antagomir -treated Tregs exhibit decreased Foxp3 protein expression (46). [score:3]
[1 to 20 of 4 sentences]
23
[+] score: 16
miR-125b, miR-126, miR-10b, miR-10a and miR-191 were underexpressed in cancer samples, whereas miR-26b, miR-607 and miR-135b were overexpressed. [score:5]
In fact, miR-125b, miR-126, miR-10b, miR-10a and miR-191 were underexpressed whereas miR-26b, miR-607 and miR-135b were overexpressed in cancer samples examined, in comparison with the gynecomastia samples. [score:5]
Other miRNAs similarly altered after the enrichment, such as miR-191, miR-454, miR-10a, miR-374a, miR-10b, miR-218, miR-140-3p and miR-126, were downregulated in cancer. [score:4]
analysisTo confirm the results of microarray analysis, we performed quantitative real-time PCR analysis on a limited number of samples (19 cancer samples, five gynecomastia samples) using probes corresponding to miR-125b, miR-126, miR-10b, miR-10a, miR-191, miR-26b, miR-607 and miR-135b (Figure 2). [score:1]
To confirm the results of microarray analysis, we performed quantitative real-time PCR analysis on a limited number of samples (19 cancer samples, five gynecomastia samples) using probes corresponding to miR-125b, miR-126, miR-10b, miR-10a, miR-191, miR-26b, miR-607 and miR-135b (Figure 2). [score:1]
[1 to 20 of 5 sentences]
24
[+] score: 14
To validate this correlation, we transfected five EVs miRNAs (miR-27b-3p, miR-10a-5p, miR-21-5p, miR-181a-5p and miR92a-3p) in UCB-CD34+ cells (Figure 3B) confirming the down-regulation of their predicted target genes (miR-27b-3p/MPL and ZFP36, miR-10a-5p/MPL, miR-21-5p/ANXA1, miR-181a-5p/CEBPA and EGR2, miR92a-3p/ CEBPA and EGR2) (Figure 3C). [score:6]
By contrast, over -expression of miR-27b-3p and miR-10a-5p showed a reduction of CD38 expression, i. e. a phenotypic pattern typical of undifferentiated stem cells. [score:5]
To demonstrate that a decrease of cell differentiation is induced by BM-MSC EVs miRNAs we transfect together miR-27b-3p and miR-10a-5p (Figure 5C). [score:1]
UCB-CD34+ were transfected with 60 nM of miRNA precursor molecules (miR-27b-3p mimic, miR-10a-5p mimic, miR-21-5p mimic, miR-181a-5p mimic and miR92a-3p mimic) (Life Technologies) or negative control (Life Technologies) using Lipofectamine 2000 (Life Technologies), according to the manifacturer's instructions. [score:1]
In particular, miR-21 is strongly involved in apoptosis pathways [45– 47]; miR-10a plays a crucial role in megakaryocytic differentiation [48]. [score:1]
[1 to 20 of 5 sentences]
25
[+] score: 14
S2 FigExpression levels of miR-10a are significantly downregulated in (A) human colorectal adenocarcinoma (conventional (n = 18), mucinous (n = 20) and chronic UC (n = 13) -associated CRC) tumor areas compared to matched R [0] margins and (B) colon carcinoma-like Caco-2 [D299G] cells compared to enterocyte-like Caco-2 [WT], as determined by qPCR. [score:4]
In contrast, miR-1, miR-10a and miR-133a were downregulated in human CRC tumour tissues, regardless of the histological subtype (S1A, S2A and S3A Figs). [score:4]
S4 FigExpression levels of (A) miR-205, (B) miR-373, (C) miR-1, (D) miR-10a and (E) miR-133a in different human colonic adenocarcinoma cell lines (LS 174T, HT-29, HCT 116 and SW480), in comparison to naïve (untransfected) Caco-2, Caco-2 [WT] and Caco-2 [D299G] cells, as determined by qPCR (n ≥ 2 samples/cell line). [score:3]
Expression levels of miR-10a in human CRC patient samples and Caco-2 subclones. [score:3]
[1 to 20 of 4 sentences]
26
[+] score: 11
Regarding circulating miRNAs as potential biomarkers of diabetic cardiomyopathy, we found an association between differential miRNA expressions in myocardium and plasma at 16 months in 8 miRNAs (let-7f-5p, miR-10a-5p, miR-19b-3p, miR-25-3p, miR-140-5p, miR-146a-5p, miR-181b-5p, miR-499-5p). [score:3]
We found 8 circulating miRNAs that were less abundant in the obese mice than in normal mice, indicating an association between their gene expression in myocardium: let-7f-5p (FC: 5.4), miR-10a-5p (FC: 2.3), miRNA-19b-3p (FC: 2.5), miR-25-3p (FC: 3.4), miR-140-5p (FC: 4.5), miR-146a-5p (FC: 3.3), miR-181b-5p (FC: 5.2) and miR-499-5p (FC: 2.2). [score:3]
At 16 months, all 15 miRNAs were significantly downregulated in heart tissue of obese mice compared to heart tissue of normal mice: let-7f-5p (FC: 3.3), miR-10a-5p (FC: 2.6), miRNA-19b-3p (FC: 5.0), miR-25-3p (FC: 2.6), miR30e-5p (FC: 5.6), miR-140-5p (FC: 5.0), miR-155-5p (FC: 1.7), miR-146a-5p (FC: 4.0), miR-181b-5p (3.0), miR-199a-3p (FC: 3.6), miR-322 (FC: 1.5), miR-451 (FC: 1.9), miR-499-5p (FC: 5.4), miR-669m-5p (FC: 1.7) and miR-3473b (FC: 3.4). [score:3]
The circulating miR-10a-5p was proposed as a non-invasive biomarker of transplant rejection in heart transplant recipients [50], indicating worse prognosis and a reduction of its level in plasma. [score:1]
Based on previous pre-clinic studies, the miRNAs validated by RT-qPCR in our study are involved in alteration of glucose and lipid metabolism via insulin pathways (let-7f-5p, miR-10a-5p, miR-322) 20– 22, in cardiomyocytes apoptosis (miR-19b-3p, miR-25-3p, miR-30e-5p, miR-140-5p, miR-199a-3p, miR-499) 23– 28, in mitochondrial function (miR-181a/b) [29], in pro-inflammatory signalling (miR-146a-5p, miR-155, miR-181b-3p, miR-3473b) 30– 33, and in cardiac hypertrophy (miR-451) [34] and myocardial fibrosis process (miR-19b) 35, 36. [score:1]
[1 to 20 of 5 sentences]
27
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-101-1, dme-mir-1, dme-mir-2a-1, dme-mir-2a-2, dme-mir-2b-1, dme-mir-2b-2, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-101a, mmu-mir-124-3, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-137, mmu-mir-140, mmu-mir-142a, mmu-mir-155, mmu-mir-10b, mmu-mir-183, mmu-mir-193a, mmu-mir-203, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-183, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-222, hsa-mir-223, dme-mir-133, dme-mir-34, dme-mir-124, dme-mir-79, dme-mir-210, dme-mir-87, mmu-mir-295, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, dme-let-7, dme-mir-307a, dme-mir-2c, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-193a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-27a, mmu-mir-34a, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-210, mmu-mir-223, mmu-mir-222, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-411, hsa-mir-193b, hsa-mir-411, mmu-mir-193b, hsa-mir-944, dme-mir-193, dme-mir-137, dme-mir-994, mmu-mir-1b, mmu-mir-101c, hsa-mir-203b, mmu-mir-133c, mmu-let-7j, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, mmu-mir-124b
In a mo del of mouse leukemia, miRNA variants of mmu-miR-10a, mmu-miR-155, mmu-miR-27a, mmumiR-27c, mmu-let-7a and mmu-miR-222 are found DE across disease and normal conditions (17). [score:3]
Furthermore, miR-10a-5p. [score:1]
Two conserved miRNA families with multiple members, i. e. miR-133 and miR-10, had individual members with large differential 5′-isomiR arm abundances. [score:1]
One such example is the miR-10 family where 5′-isomiRs of the same seed ‘CCCUGUA’ contributed to 21.8% and 28.6% of the miR-10a-5p abundances in human and mouse, respectively. [score:1]
We observed that miRNA orthologues (miR-10, miR-133, miR-137 and miR-79 in Table 3) swapped major miRNAs and 5′-isomiRs and had largely different 5′-isomiR arm abundances across human, mouse, fruitfly and worm. [score:1]
For example, miR-10-5p. [score:1]
iso1 in human and mouse had a high arm abundance, whereas miR-10-5p. [score:1]
iso1 in fruitfly is the major miR-10a-5p in human and mouse (miRBase, Supplementary Figure S2). [score:1]
of 5′-isomiR reads Arm abundance hsa-miR-203 GAAAUGU 3p 8 8,774,451 45.5 hsa-miR-140 CCACAGG 3p 37 1,072,944 39.5 hsa-miR-126 GUACCGU 3p 54 776,502 13.8 hsa-miR-199b ACAGUAG 3p 55 724,009 27.0 hsa-miR-101 UACAGUA 3p 57 662,855 27.3 hsa-miR-10a CCCUGUA 5p 59 661,921 22.7 hsa-miR-143 UGAGAUG 3p 69 619,911 1.8 hsa-miR-378a UGGACUU 3p 71 402,197 6.0 hsa-miR-29a UAGCACC 3p 77 334,605 18.1 hsa-let-7a AGGUAGU 5p 89 269,329 0.6 The arm abundance of a 5′-isomiR is the percentage of all reads mapped to one arm that represents the 5′-isomiR. [score:1]
[1 to 20 of 9 sentences]
28
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Luminal-restricted miRNAs included miR-10a (targets KLF4 and PIK3CA) [41, 42], miR-200a/b (targets EMT (epithelial mesenchymal transition) genes) [43], miR-148a (targets Bim) [44] and miR-375 (targets PDK1) [45]. [score:9]
In the context of miRNAs that potentially control these pathways, we identified several luminal-restricted miRNAs, including miR-10a, miR-200a/b, miR-203, miR-148a. [score:1]
[1 to 20 of 2 sentences]
29
[+] score: 10
miRNAFold change [a] Targets described in T cells Predicted effect of decreased miR in Tregs Citations miR-21 14.8 down Dnmt1, SATB1Loss of Foxp3, acquisition of T [eff] phenotype 68, 84, 85 miR-125a 5.5 down STAT3, IFNγ, IL-13Decreased suppressive function, acquisition of T [eff] phenotype 71 miR-146a 3.9 down STAT1 signaling Production of IFNγ 67 miR-29b 3.4 down IFNγ Production of IFNγ 72– 74 miR-10a 2.3 down Bcl-6 Decrease in Foxp3 69, 70 miR-155 2.2 down SOCS1, SATB1Decreased CD25 -mediated survival, acquisition of T [eff] phenotype 85, 86 [a]fold change in expression levels, NIKtg Tregs vs. [score:7]
Of these, miR-10a and miR-21 also help maintain Foxp3 expression in Tregs 68– 70, and miR-29 has been shown to restrain IFNγ production in Th1 cells 72– 74. [score:3]
[1 to 20 of 2 sentences]
30
[+] score: 10
Nevertheless, p63 has been found to be relevant for tissue development [44, 45] and miR-10a is one of the most upregulated miRNA during endodermal differentiation from human embryonic stem cells [46]. [score:5]
miR-10a was proven to be overexpressed and functionally relevant in various tumors, including AML [41] while p63 is a critical transcriptional regulator of cancer cells [42]. [score:4]
One circuit involves the master transcription factor Runx1 or Acute Myeloid Leukemia 1 (AML1), miR-10a and the p63 (TP73L), three genes found implicated in leukemia. [score:1]
[1 to 20 of 3 sentences]
31
[+] score: 10
Recently, other investigators showed that miR-10a could target and inhibit effectively GATA6 expression, which reduced the proliferation of hCMPCs during heart development [21]. [score:6]
Liang D Zhen L Yuan T Huang J Deng F Wuyahan Zhang H Pan L Liu Y The E Yu Z Zhu W Zhang Y Li L Peng L Li J Chen YH miR-10a regulates proliferation of human cardiomyocyte progenitor cells by targeting GATA6PLoS One. [score:4]
[1 to 20 of 2 sentences]
32
[+] score: 9
Moreover, analysis of the miRNA expression profiling data and the list of target mRNAs showed that miR-100, miR-184 and miR-10a were especially expressed in human MII oocytes, while miR-29a, miR-30d, miR-21, miR-93, miR-320a, miR-125a and let7 were expressed in the human cumulus cells. [score:9]
[1 to 20 of 1 sentences]
33
[+] score: 9
In naïve peripheral CD3 [+] T cells, we found six miRNAs exclusively up-regulated in DBA-1/J mice (miR-195, miR-689, miR-500, miR-196b, miR-10a and miR-805) and four exclusively up-regulated in DBA-2/J mice (miR-467e, miR-101a, miR-125-5p and miR-669a). [score:7]
Figure 6a shows that miRNAs miR-196b, miR-805 and miR-10a regulated CD8a mRNA in the peripheral T cells of the DBA-1/J strain. [score:2]
[1 to 20 of 2 sentences]
34
[+] score: 9
Of the 186 miRNAs the expression of which was altered, nine were up-regulated at both time points (miR-125a-3p, miR-297c, miR-421, miR-452, miR-483, miR-574-3p, miR-574-5p, miR-669a, miR-720) and 11 were down-regulated at both time points (let-7g, miR-107, miR-10a, miR-15a, miR-15b, miR-199b*, miR-26a, miR-29c, miR-324-5p, miR-331-3p, miR-342-3p). [score:9]
[1 to 20 of 1 sentences]
35
[+] score: 9
Other miRNAs from this paper: mmu-mir-205, mmu-mir-221, mmu-mir-222
To further explore how PTEN was up-regulated in lung cancer cells by SFE, we detected multiple known PTEN -targeting miRNAs including miR-10a, miR-205, miR-221, and miR-222. [score:6]
In the rescue assays, we observed that the anti-cancer effects of SFE were significantly inhibited by miR-10a, miR-205, miR-221, or miR-222 (Figure 3F). [score:2]
Moreover, to validate the biological function of these miRNAs in lung cancer cells, we transfected A549 and H1299 cells with mimics of miR-10a, miR-205, miR-221, or miR-222 with or without treatment of SFE. [score:1]
[1 to 20 of 3 sentences]
36
[+] score: 9
These results suggested that high-abundance miRNAs such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7 were closely related to the development of 18 d-old females before pairing, whereas during the development from 18 d to 23 d, all of these high-abundance miRNAs were down-regulated not only in 23 DSI, but also in 23SSI. [score:6]
In particular, nearly all high-abundance miRNAs, such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7, were down-regulated in both, compared with 18DSI or 18SSI. [score:3]
[1 to 20 of 2 sentences]
37
[+] score: 9
MiR-10a suppresses the expression of the catalytic subunit of PI3 kinase, leading to decreased AKT phosphorylation. [score:4]
It is interesting to note that miR-10a targets two key signaling molecules involved in cell proliferation, i. e., PI3 kinase and ERK MAP kinase. [score:3]
Recent reports have identified the specific role of miR-221 and miR-10a in the regulation of ASM proliferation [33, 39]. [score:2]
[1 to 20 of 3 sentences]
38
[+] score: 9
To address this issue, we first screened the miRNAs whose expressions are modulated in 4T1 cells by miRNA microarray analysis using both total cellular miRNA and exosomal miRNA after treatment with 100 μM of EGCG for 24 h. In brief, a set of miRNAs including let-7, miR-16, miR-18b, miR-20a, miR-25, miR-92, miR-93, miR-221, and miR-320 were up-regulated, and dozens of miRNAs including miR-10a, miR-18a, miR-19a, miR-26b, miR-29b, miR-34b, miR-98, miR-129, miR-181d were down-regulated in both total cellular and exosomal fraction by EGCG treatment (data not shown). [score:9]
[1 to 20 of 1 sentences]
39
[+] score: 8
Considering a probe signal of over 100 as abundance, eleven of the 28 miRNAs (miR-342-3p, miR-342-5p, miR-376c-3p, miR-301b-3p, let-7f-5p, miR-539-3p, miR-491-3p, miR-10a-5p, miR-98-5p, miR-652-5p, and miR-34a-5p) were shown to have targets that are tightly related to AD and could easily be detected. [score:3]
Several miRNAs derived from our microarray analysis targeted PTEN, such as miR-376c-3p, miR-342-3p, let-7f-5p, miR-10a-5p, miR-301b-3p, miR-98-5p, miR-1251-5p, and miR-34a-5p. [score:3]
To our knowledge, this is the first study to identify the potential effects of miR-342-3p, miR-491-3p, miR-539-3p, miR-376c-3p, miR-10a-5p, and miR-652-5p in the progression of AD. [score:1]
For further analysis, we chose 11 evidently different miRNAs that were conserved between both human and mouse: miR-342-3p, miR-342-5p, miR-376c-3p, miR-301b-3p, let-7f-5p, miR-539-3p, miR-491-3p, miR-10a-5p, miR-98-5p, miR-652-5p, and miR-34a-5p. [score:1]
[1 to 20 of 4 sentences]
40
[+] score: 8
miRNA expression fold change was determined by the ΔΔCT method, using the geometric mean of miR-10a and miR-195 to normalize data. [score:3]
All data were normalised to the expression of two reference microRNAs (mmu-miR-10a-5p and mmu-miR-195a-5p) that we found to be invariable and ubiquitous endogenous in the Taqman PCR array data set and then validated by the individual Taqman qPCR assays in the extended cohort (S2 Table). [score:2]
Mean dCt were derived from the geometric mean of mmu-miR-10a-5p and mmu-miR-195-5p (the least variable microRNAs across all samples). [score:1]
Both miR-10a and miR-195 were determined to be invariable and ubiquitous endogenous controls by two approaches; cel-miR normalisation of array data (data not shown), and subsequent qPCR data (S2 Table). [score:1]
The (A) geometric mean of mmu-miR-10a-5p and mmu-miR-195-5p or (B) mmu-miR-10a-5p alone was used as a reference microRNA (the least variable microRNA(s) across all samples in the present experimental setup). [score:1]
[1 to 20 of 5 sentences]
41
[+] score: 8
Furthermore, miR-10a expression is stimulated by TGF-β, making it a good example of how environmental factors coordinate distinct miRNA pathways and regulates cell fate. [score:4]
An example is the regulatory action exerted by miR-10a and miR-182 upon Th1- or Th2 -associated T regulatory cells, respectively, where CD4 [+]Foxp3 [+] cells orchestrate distinct miRNA pathways in response to local environmental factors (48). [score:3]
Although, it is unclear if the increased miR-10a in TEC from infected mice is part of a host response due TGF-β enhancement or if miR-10a is a fine-tuning factor in TEC, our results suggest that TGF-β signaling is a key pathway in the thymic involution process. [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 8
Knocking down CHL1 expression by miR-10a increased colony formation activity, migration and invasion of human cervical cancer cells, whereas over -expression of CHL1 abolished the effects of miR-10a (Long et al., 2012). [score:6]
MicroRNA-10a targets CHL1 and promotes cell growth, migration and invasion in human cervical cancer cells. [score:2]
[1 to 20 of 2 sentences]
43
[+] score: 7
5′UTR -targeted miRNA -mediated translation increase has been shown for miR-10a and the target ribosomal protein mRNA [19]. [score:7]
[1 to 20 of 1 sentences]
44
[+] score: 7
For example, miR-192-5p+1 was 22-fold more highly expressed in human beta cells than in MIN6, miR-10a-5p+1 was 23-fold more highly expressed in human islets than in MIN6, and miR-183-5p+1 was nearly 3-fold more highly expressed in MIN6 than in human beta cells or islets (Fig. 3B). [score:7]
[1 to 20 of 1 sentences]
45
[+] score: 7
Other miRNAs from this paper: dre-mir-10a
miRNAs can also increase the translation of certain mRNAs; for example, under amino acid starvation conditions, miRNA10a was reported to bind the 5′UTR of ribosomal protein mRNAs and enhance their translation [139]. [score:5]
MicroRNA-10a binds the 5'UTR of ribosomal protein mRNAs and enhances their translation. [score:2]
[1 to 20 of 2 sentences]
46
[+] score: 7
For example, let-7 represses adipogenesis in hMSCs and 3T3-L1 cells 31 32; let-7e, let-7b, miR-28a-5p, and miR-10a are upregulated, while let-7c and miR-125b are downregulated in either preadipocytes or mature adipocytes of obese vs. [score:7]
[1 to 20 of 1 sentences]
47
[+] score: 7
Wang F Yang XY Zhao JY Yu LW Zhang P Duan WY Chong M Gui YH miR-10a and miR-10b target the 3’-untranslated region of TBX5 to repress its expression. [score:7]
[1 to 20 of 1 sentences]
48
[+] score: 7
Other miRNAs from this paper: mmu-mir-205, hsa-mir-10a, hsa-mir-205, hsa-mir-200c, mmu-mir-200c
This data should prove useful to understand the role of miRNAs in normal external ear development in mammals and might hint over miRNA involvement in the etiology of microtia [4] Data was validated by Whole mount in situ hybridization in a subset of miRNAs whose mRNA targets have been associated with external ear development and present clear differential spatiotemporal expression patterns (mmu-miR-10a, mmu-miR-200c and mmu-miR-205) [1], [2], [3], [5]. [score:7]
[1 to 20 of 1 sentences]
49
[+] score: 6
In addition, mir-10a which was down regulated in Activin A treated samples was further down regulated in Activin A plus Wnt3a treated samples, while it was up-regulated in Wnt3a treated sample. [score:6]
[1 to 20 of 1 sentences]
50
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-33a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-191, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-let-7a-3, gga-mir-155, gga-mir-18a, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-mir-126, gga-let-7a-2, gga-mir-27b, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, hsa-mir-33b, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-675, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, hsa-mir-675, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-664a, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, gga-mir-10a, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, mmu-mir-126b, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
Previous studies revealed that five miRNA genes as well as their host genes (hsa-mir-10a/ HOXB4, hsa-mir-126/ EGFL7, hsa-mir-152/ COPZ2, hsa-mir-191/ DALRD3, and hsa-mir-342/ EVL) were found to be epigenetically downregulated, either by histone modification and/or CpG island hypermethylation in the promoter region in cancer cells [27], [86]– [89] (Table 2 ). [score:4]
C) MicroRNA gene hsa-mir-10a located within two overlapping protein-coding genes. [score:1]
For example hsa-mir-10a overlapped with both, HOXB3 (homeobox B3) and HOXB4 (homeobox B4) (Figure 3C ). [score:1]
[1 to 20 of 3 sentences]
51
[+] score: 6
org) revealed several target sites for BDNF: miR-206-3p, miR-10a-5p, miR-1b, miR-195-5p, and miR-497-5p that were conserved in humans. [score:3]
In contrast, miR-1b decreased and there was no change observed in miR-10a-5p (Fig.   5a). [score:1]
In contrast to the aforementioned studies in aging muscle, most of the miRNAs studied herein have been examined in the context of experimental denervation, including miR-206 (increases after reinnervation), miR-10a-5p (increases four- to seven-fold with denervation), miR-1 (increases up to 10-fold following denervation and remains elevated after reinnervation), miR-195 (increases up to 10-fold with denervation), miR-21 (increases with denervation), miR-221 (no consistent change), miR-222 (no consistent change), and miR-98 (increases up to 10-fold with denervation) [43, 47, 48]. [score:1]
MicroRNAs predicted to influence neurotrophins: a BDNF (miR-206-3p, miR-10a-5p, miR-1b, miR-195-5p and miR-497-5p), b NT3 (miR-21-5p, miR-222-3p and miR-221-3p), and c NGF (let-7b-5p and miR-98-5p) were quantified by qPCR analysis in YA (n = 8) vs VO (n = 10) rat vastus lateralis muscle and WT (n = 8) vs Sarco (n = 7) gastrocnemius muscle. [score:1]
[1 to 20 of 4 sentences]
52
[+] score: 6
As summarized in Table 2, we noticed that most of the miRNAs (miR-10a-5p, miR-193a-3p, miR-200b-5p, miR-222-3p) that are actively sorted into exosomes have tumour suppressive effects involving cell growth suppression, whereas miRNAs (miR-196a/b, miR-181d-5p, miR-155-5p) that have oncogenic effects are retained in the tumour cells even though the levels of the oncogenic miRNAs are higher in their donor cells than in the exosomes. [score:5]
These changes are specific as other miRNAs, including miR-10a, miR-30b, miR-200b and miR-151, are not changed in amount regardless of the origin, whether from the exosomes of cultured tumour cells or metastatic CT26 cells, suggesting that the microenvironment has an effect on the composition of the exosomal miRNA profile. [score:1]
[1 to 20 of 2 sentences]
53
[+] score: 6
MiR-10a represses NF-κB activity by targeting MAP kinase kinase kinase 7 (MAP3K7, also known as TAK1) and β-transducin repeat-containing gene (β-TRC), which mediate IκB degradation (Fang et al, 2010). [score:2]
For example, miR-10a levels are decreased in regions of the mouse aorta that are susceptible to the development of atherosclerosis (Fang et al, 2010). [score:2]
This implies that miR-146 may have an even broader anti-inflammatory role than miR-10a, miR-31, miR-17-5p or miR-181b. [score:1]
The MiScript system was also used for the analysis of other microRNAs (miR-10a, miR-17, miR-31, miR-155 and miR-181b) in wild-type and miR-146a [−/−] hearts. [score:1]
[1 to 20 of 4 sentences]
54
[+] score: 5
A similar selective inhibition of lung tumors was observed in MCS-exposed female Swiss H mice [21], in which 3 miRNAs (miR-10a, miR-125, and miR-130a) involved in estrogen and HER2 pathways were differentially expressed in adenoma-bearing male and female mice [27]. [score:5]
[1 to 20 of 1 sentences]
55
[+] score: 5
Tong L. Lin L. Wu S. Guo Z. Wang T. Qin Y. Wang R. Zhong X. Wu X. Wang Y. MiR-10a* up-regulates coxsackievirus B3 biosynthesis by targeting the 3D-coding sequence Nucleic Acids Res. [score:5]
[1 to 20 of 1 sentences]
56
[+] score: 5
In addition, the miR-10, 15, 17, and 181 families were similarly regulated. [score:2]
Other miRNA families that are commonly regulated after ionizing radiation include the miR-10, 15, 17, and 181 families. [score:2]
The miR-10 family includes four miRNAs (miR-10, 99, 100, and 125). [score:1]
[1 to 20 of 3 sentences]
57
[+] score: 5
Other miRNAs from this paper: mmu-mir-664
Zhang et al. showed that acarbose can suppress proinflammatory cytokine expression in the gut by activating the miRNAs miR-10a-5p and miR-664 in diabetic rats 44. [score:5]
[1 to 20 of 1 sentences]
58
[+] score: 5
Among the targets for differentially expressed miRNAs in spleen of M. fortis, miR-328*, miR-10a and miR-10b had important roles in the immune response (involved in Toll-like receptor signaling pathway in miR-10a and miR-10b) and signal pathway induction (involved in MAPK signaling pathway and Wnt signaling pathway in miR-328*). [score:5]
[1 to 20 of 1 sentences]
59
[+] score: 5
Other miRNAs from this paper: mmu-mir-10b
The brain weight was not affected by drug treatments in WT mice (Fig. 1i; n = 6 WT UNT = 0.42 ± 0.01 g; n = 7 WT VEH = 0.44 ± 0.01 g; n = 7 WT DMI10 = 0.41 ± 0.01 g; n = 6 WT MIR10 = 0.41 ± 0.02 g; n = 6 WT MIR50 = 0.42 ± 0.01 g; One Way ANOVA, p = 0.503). [score:1]
were weighed every day during the 14 days of treatment, and at p28, the KO-VEH group showed around 30% lower body weight with respect to the WT-VEH group and this difference was maintained until p41 irrespective of the drug treatment (Fig. 1g,h; n = 7 WT VEH = 21.81 ± 0.68 g; n = 8 WT DMI10 = 19.05 ± 0.62 g; n = 6 WT MIR10 = 20.46 ± 0.84 g; n = 6 WT MIR50 = 20.61 ± 1.50 g ; n = 7 KO VEH = 16.22 ± 1.20 g; n = 17 KO DMI10 = 14.40 ± 0.96 g; n = 7 KO MIR10 = 16.13 ± 1.22 g; n = 15 KO MIR50 = 15.20 ± 0.98 g; t-test, p = 0.002 VEH; p = 0.005 DMI10; p = 0.017 MIR10; p = 0.002 MIR50). [score:1]
Louis, MO, USA), desipramine 10 mg/Kg (DMI10; Vinci-Biochem, Florence, Italy), mirtazapine 10–50 mg/Kg (MIR10–50, Abcam, Cambridge, UK). [score:1]
Values are represented as mean ± SEM; *p = 0.002 VEH; **p = 0.005 DMI10; *p = 0.017 MIR10; **p = 0.002 MIR50 (t-test; n = as in (g)). [score:1]
We observed a slight but not significant increase in brain weight with desipramine (DMI10 = 86.3%), and mirtazapine 10 mg/Kg (MIR10 = 86.0%) (n = 8 DMI10 0.36 ± 0.010 g, n = 6 MIR10 0.36 ± 0.013 g). [score:1]
[1 to 20 of 5 sentences]
60
[+] score: 5
Of particular interest to this research is the observation that co-incubation of alcohol-exposed mouse embryos with folic acid, which is involved in establishing DNA methylation, was able to prevent altered expression of mir-10a and its target gene Hoxa1 (Wang et al., 2009). [score:5]
[1 to 20 of 1 sentences]
61
[+] score: 5
Other miRNAs from this paper: mmu-mir-142a, mmu-mir-294, mmu-mir-504, mmu-mir-142b
Figure S1 Schematic representation of the binding sites for miR-294/295-3p, miR-142-3p and miR-10a* in D1 receptor 3′UTR and the seed recognition nucleotides that were targeted for mutation. [score:4]
Partial nucleotide sequence (from nucleotides 560 to 1250) of the 1277 bp D1 3′UTR that shows the putative binding sites (highlighted in yellow) for miR-294/295-3p, miR-142-3p and miR-10a*. [score:1]
[1 to 20 of 2 sentences]
62
[+] score: 5
Other miRNAs from this paper: hsa-mir-10a, dre-mir-10a
Retinoic acid receptor antagonists inhibit miR-10a expression and block metastatic behavior of pancreatic cancer. [score:5]
[1 to 20 of 1 sentences]
63
[+] score: 5
These findings demonstrated that schistosomal eggs release EVs during development in vitro and these 30–100 nm sized vesicles carry miRNAs that are both parasite-specific and homologs of mammalian (host) (e. g. mouse miR-10) miRNAs. [score:2]
Among the 13 known Sja-miRNAs identified in the egg EVs, Sja-bantam, Sja-miR-10 and Sja-miR-3479-3p were all previously detected in serum obtained from rabbits infected with S. japonicum [39]. [score:1]
We found 13 known S. japonicum miRNAs (reads >100) present in the schistosomal egg EV libraries (Table  2 and Additional file 2: Table S1), including three miRNAs (miR-10, bantam and miR-3479-3p) that were present in the plasma of S. japonicum infected host rabbits in a previous study [39]. [score:1]
Interestingly, bantam and miR-10 were significantly enriched in the libraries of EVs derived from schistosomal adult worms, whereas miR-3479-3p did not appear in those EV libraries [33]. [score:1]
[1 to 20 of 4 sentences]
64
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Our study showed that no miRNA was different between males and females in adenoma-free mice, while 3 miRNAs (miR-10a, miR-125, and miR-130a) were differentially expressed in adenoma-bearing male and female mice. [score:3]
According to volcano-plot analyses, no miRNA was different in males and females from adenoma-free mice, whereas 3 miRNAs (miR-10a, miR-125, and miR- 130a) from adenoma-bearing mice showed intergender differences. [score:1]
In particular, miR-10a is related to estrogen dependent cancer promotion [112, 113], miR-130a both to the estrogen and HER2 pathways [114, 115], and miR-125 to HER2/erbb2 estrogen sensitive oncogene activation [116, 117]. [score:1]
[1 to 20 of 3 sentences]
65
[+] score: 5
The mir-196 family regulates Hox8 and Hox7 genes, the function of mir10 is unknown. [score:2]
A few microRNAs are apparently linked to protein coding genes, most notably mir-10 and mir-196 which are located in the (short) intergenic regions in the Hox gene clusters of vertebrates [4- 7]. [score:1]
The mir10 and the mir196 precursors are located at specific positions in the Hox gene clusters [4- 7]. [score:1]
mir10 is a good example of this typical substitution pattern, which gives rise to a hairpin structure. [score:1]
[1 to 20 of 4 sentences]
66
[+] score: 5
For instance, although miRNAs are known to predominantly act in translational repression, miR-10 has been recently found to bind a group of transcripts containing a terminal oligo-pyrimidine (TOP) motif and to induce their translation [47]. [score:5]
[1 to 20 of 1 sentences]
67
[+] score: 4
It has been shown that miR-10a binds the 5′-UTR of ribosomal protein mRNAs and enhances their translation rather than negative regulation [26]. [score:4]
[1 to 20 of 1 sentences]
68
[+] score: 4
Three of these (sja-bantam, sja-miR-3479-3p, sja-miR-10-5p) were further detected in the plasma of S. japonicum-infected mice by stem-loop RT-PCR analysis [22]. [score:1]
Sja-miR-10-5p was excluded from analysis due to its high sequence homology with mammalian host orthologs. [score:1]
Detection of parasite-derived miRNAs in the serum of C57BL/6 and BALB/c mice during S. japonicum infectionUsing a deep sequencing method, Cheng et al. identified the presence of five schistosome-specific miRNAs (sja-bantam, sja-miR-3479-3p, sja-miR-10-5p, sja-miR-3096 and sja-miR-8185) in the plasma of S. japonicum-infected rabbits. [score:1]
Using a deep sequencing method, Cheng et al. identified the presence of five schistosome-specific miRNAs (sja-bantam, sja-miR-3479-3p, sja-miR-10-5p, sja-miR-3096 and sja-miR-8185) in the plasma of S. japonicum-infected rabbits. [score:1]
[1 to 20 of 4 sentences]
69
[+] score: 4
miR-10a and the miR-689 were also expressed in the liver at levels 10-fold higher than those in the brain[see Supplemental Material, Table 2 (http://www. [score:3]
In brain tissues, we detected 58 miRNAs in treated mice but not in controls, whereas we detected only four miRNAs (miR-10a, miR-10b, miR-712*, and miR-715) in control brain tissues but not in treated samples [see Supplemental Material, Table 3 (http://www. [score:1]
[1 to 20 of 2 sentences]
70
[+] score: 4
Despite that miR-17∼92 is dispensable for the development of tT [reg] cells in vivo, miR-17∼92 ablation reduces the frequency of MOG [35–55]-specific pT [reg] cells during EAE 45. miR-10a is induced by TGF-β1 and RA, and promotes the differentiation of pT [reg] cells through inhibiting Bcl-6 (ref. [score:4]
[1 to 20 of 1 sentences]
71
[+] score: 4
From the set of the 87 Aire -dependent miRNAs identified in this study, we identified 6 miRNAs (miR-10, miR-30e*, miR142-3p, miR-425, miR-338-3p, and miR-297) that were shared with the set of Aire -dependent miRNAs identified by in vitro Aire-knockdown of an mTEC cell line (35) and 4 miRNAs (miR-206, miR-10b, miR-181c, and miR-363) whose expression was previously detected in TECs. [score:4]
[1 to 20 of 1 sentences]
72
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-25, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, dme-mir-1, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-124-3, mmu-mir-134, mmu-mir-10b, hsa-mir-10a, hsa-mir-10b, dme-mir-92a, dme-mir-124, dme-mir-92b, mmu-let-7d, dme-let-7, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-134, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-92a-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-17, mmu-mir-25, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-92a-1, hsa-mir-379, mmu-mir-379, mmu-mir-412, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-92-1, gga-mir-17, gga-mir-1a-2, gga-mir-124a, gga-mir-10b, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-1a-1, gga-mir-124b, gga-mir-1b, gga-let-7a-2, gga-let-7j, gga-let-7k, dre-mir-10a, dre-mir-10b-1, dre-mir-430b-1, hsa-mir-449a, mmu-mir-449a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-25, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-412, hsa-mir-511, dre-let-7j, hsa-mir-92b, hsa-mir-449b, gga-mir-449a, hsa-mir-758, hsa-mir-767, hsa-mir-449c, hsa-mir-802, mmu-mir-758, mmu-mir-802, mmu-mir-449c, mmu-mir-105, mmu-mir-92b, mmu-mir-449b, mmu-mir-511, mmu-mir-1b, gga-mir-1c, gga-mir-449c, gga-mir-10a, gga-mir-449b, gga-mir-124a-2, mmu-mir-767, mmu-let-7j, mmu-let-7k, gga-mir-124c, gga-mir-92-2, gga-mir-449d, mmu-mir-124b, gga-mir-10c, gga-let-7l-1, gga-let-7l-2
Others, the mir-10, 99, 100, 125 family for example, diverge in the mature forms (See additional file 8: The mir-10, 99, 100, 125 family). [score:1]
Sequence alignment and selected secondary structure of the miRNAs in the mir-10, 99, 100, 125 family. [score:1]
Click here for file The mir-10, 99, 100, 125 family. [score:1]
The mir-10, 99, 100, 125 family. [score:1]
[1 to 20 of 4 sentences]
73
[+] score: 3
Several miRNAs were found with different expression levels in PD mo dels, such as miR-135a-5p, -214 and -124 in 1-methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine (MPTP) mice [55– 58], miR-155 in AAV-α-Syn PD mice [59], and miR-10a, -10b, -212, -132, -495 in A30P tg mice [26]. [score:3]
[1 to 20 of 1 sentences]
74
[+] score: 3
We previously reported a panel of significantly decreased miRNAs in NASH rat mo del [20], where miR-146, miR-29b and miR-10a were predicted to regulate HDMCP through bioinformatics method (Fig 5A). [score:2]
As shown in Fig 5B, both miR-29b and miR-146 levels were significantly lower in HFFA treated group while miR-10a level was decreased but not reached statistical significance. [score:1]
[1 to 20 of 2 sentences]
75
[+] score: 3
Other miRNAs from this paper: mmu-let-7e, bta-mir-10a, bta-let-7e
Many studies have shown the effect of miRNAs on T helper cell differentiation, including the effect of let-7e on Th1/Th17 differentiation in EAE [25], miRNA 155 on Th17 differentiation [26], and miR10a induced by TGF-β that inhibits the plasticity of T cell subsets [27]. [score:3]
[1 to 20 of 1 sentences]
76
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, hsa-mir-676, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The miRNA families that change expression in both mice and rats were: mir-7, mir-9, mir-10, mir-15, mir-17, mir-26, mir-29, mir-30, mir-101, mir-130, mir-181, mir-204, mir-339, mir-340, mir-368, mir-434, mir-467. [score:3]
[1 to 20 of 1 sentences]
77
[+] score: 3
Meanwhile, the expression of miR-21, miR-10a, miR-126, miR-10b, miR-19a, miR-19b was significantly increased after adding into HUVECs culture, suggesting that HUVECs might release these miRs (Table 1). [score:3]
[1 to 20 of 1 sentences]
78
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-210, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-16c, gga-mir-214, sma-let-7, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
Notably, a study published after submission of this manuscript identified 5 miRNAs derived from S. japonicum in the plasma of infected rabbits and 3 of these are identical or homologous to those identified here: bantam, miR-3479-3p and miR-10-5p [70], providing independent validation for the presence of trematode miRNAs in the serum of infected animals. [score:1]
22962218:+ 7 sma-miR-10-5p AACCCUGUAGACCCGAGUUUGG S_mansoni. [score:1]
The other 2 miRNAs, sma-miR-10-5p and sma-let-7-3p, were excluded from analysis because they are highly similar to homologous mouse miRNAs that are present at >100 fold higher read frequencies (Table S3). [score:1]
[1 to 20 of 3 sentences]
79
[+] score: 3
In cells with an activated MAPK/ERK pathway, the expression levels of let-7a, miR-10, miR-22, miR-26, miR-34, and miR-125a were lower, and those of miR-20, miR-25, and miR-135b, were higher (Supplementary Table 1). [score:3]
[1 to 20 of 1 sentences]
80
[+] score: 3
Wu B. W. Wu M. S. Guo J. D. Effects of microRNA-10a on synapse remo deling in hippocampal neurons and neuronal cell proliferation and apoptosis through the BDNF signaling pathway in a rat mo del of Alzheimer’s diseaseJ. [score:3]
[1 to 20 of 1 sentences]
81
[+] score: 3
Since then, it has been discovered that a number of other miRNAs, including miR-17 [13, 19], miR-27 [19, 20, 41], miR-24 [19], miR-10 [19, 20], and let-7 [12, 19, 20], play an important role in lymphoma biology. [score:1]
This miRNA signature consists of 10 miRNAs: miR-130, miR-27, miR-17, miR-10, miR-155, let-7a-5p, let-7, miR-24-3p, miR-15, and miR-16-5p. [score:1]
Since miRNAs can have different aliases, the 10 miRNAs (Fig 1) are identified as the following for the rest of this manuscript: let-7 = let-7b, let-7a-5p = let-7c, miR-10 = miR-10b, miR-130 = miR-130a, miR-155 = miR-155, miR-27 = miR27a, miR-24-3p = miR-24, miR-17 = miR-18a, miR-15 = miR-15a, and miR-16-5p = miR-497. [score:1]
[1 to 20 of 3 sentences]
82
[+] score: 3
Amongst the 1735 CPC pairs, 18 were expressed from the same genomic locus (including the well documented hsa-miR-10a-HOXB5 and hsa-miR-196a-HOXB7 pairs [43], [44]. [score:3]
[1 to 20 of 1 sentences]
83
[+] score: 3
Other miRNAs from this paper: hsa-mir-10a
Evidence for Hoxb4 and mir-10a was missing in the databases and we confirmed their co-transcription by RT-PCR, providing hereby an explanation for the observation that these two genes have markedly similar expression patterns [19]. [score:3]
[1 to 20 of 1 sentences]
84
[+] score: 3
Furthermore, the RA-inducible microRNA miR-10a was found to be expressed in both nT [reg] and iT [reg] cells, playing an important role in blocking the plasticity of T [reg] cells [25]. [score:3]
[1 to 20 of 1 sentences]
85
[+] score: 3
MicroRNAs targeting MDM4: miR-191, miR-10a, miR-885-3p, miR-34a, miR-661 [reviewed in Ref. [score:3]
[1 to 20 of 1 sentences]
86
[+] score: 2
Longevinex exceeded the effect of resveratrol in 15 of the 25 miRNAs including miR-10a, miR-20b, miR-21. [score:1]
1 up 3.7 down 12 down 1.1 miR-10a up 6.4 up 5.2 up 3.5 down 116 down 1.6 snoRNA202 up 3.8 up 4.7 up 3.2 down 6 down 3 miR-27b down 1.4 up 1.9 up 3.2 up 1 up 1 miR-29c up 5.4 up 4.5 up 3.1 up 1.5 down 1.5 miR-345-5p up 14.3 up 31.7 up 2.4 down 4.7 up 1.1 rno-miR-24-1 down 25.3 up 1.2 up 2.1 down 1.2 down 1.9 miR-687 up 3.8 up 1.8 up 2 down 1.7 down 11.5 miR-27a up 34 up 12. [score:1]
[1 to 20 of 2 sentences]
87
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Cortex let-7c-1, miR-10a, miR-21, miR-124a-1, miR-128a, miR-135b, miR-150, miR-199a, miR-217, miR-329, miR-451. [score:1]
Olfactory bulb let-7b, let-7c-1, let-7c-2, miR-10a, miR-16, miR-17, miR-21, miR-22, miR-28, miR-29c, miR-124a-1, miR-124a-3, miR-128a, miR-135b, miR-143, miR-148b, miR-150, miR-199a, miR-206, miR-217, miR-223, miR-29b-1, miR-329, miR-331, miR-429, miR-451. [score:1]
[1 to 20 of 2 sentences]
88
[+] score: 2
miR-10 regulates Hoxb1 and Hoxb3 [89]. [score:2]
[1 to 20 of 1 sentences]
89
[+] score: 2
miR-10 in development and cancer. [score:2]
[1 to 20 of 1 sentences]
90
[+] score: 2
MicroRNA-10a binds the 5'UTR of ribosomal protein mRNAs and enhances their translation. [score:2]
[1 to 20 of 1 sentences]
91
[+] score: 2
MicroRNA-10a binds the 5'UTR of ribosomal protein mRNAs and enhances their translation. [score:2]
[1 to 20 of 1 sentences]
92
[+] score: 2
Similarly, the expression of miR-10, miR-21, miR-100 and miR-155 was shown to increase in p48-Cre/Kras [G12D] mice when compared to control animals [59]. [score:2]
[1 to 20 of 1 sentences]
93
[+] score: 2
For example, MSCs transplantation improved proliferation of endogenous neural stem cells in subventricular zone and prevented apoptosis of new born cells which migrating to ischemic environment in a rat stroke mo del [11], while exosomes containing miR-10a secreted from amniotic fluid-derived MSCs ameliorated apoptosis of granulosa cells and ovarian follicular atresia after chemotherapy [12]. [score:1]
Exosomal miR-10a derived from amniotic fluid stem cells preserves ovarian follicles after chemotherapy. [score:1]
[1 to 20 of 2 sentences]
94
[+] score: 2
Other miRNAs from this paper: hsa-mir-10a
Indeed, miRNA-10a regulates the pro-inflammatory phenotype of the endothelium through a post-transcriptional mechanism [51]. [score:2]
[1 to 20 of 1 sentences]
95
[+] score: 2
An example is miR-10a that on the one hand is known to promote the differentiation of human mesenchymal stem cells [69] and on the other contributes to cancer development. [score:2]
[1 to 20 of 1 sentences]
96
[+] score: 2
MicroRNA-10a binds the 5'UTR of ribosomal protein mRNAs and enhances their translation. [score:2]
[1 to 20 of 1 sentences]
97
[+] score: 1
In a study of Wang et al. again in a kidney injury mo del, miR-10a and miR-30d were found decreased in tissue and increased in urine after injury [65]. [score:1]
[1 to 20 of 1 sentences]
98
[+] score: 1
The authors investigated the time-course expression of miR-10a, -29a, -98, -99a, -124a, -134, -183 following CFA injection into the rat masseter muscle. [score:1]
[1 to 20 of 1 sentences]
99
[+] score: 1
This analysis also identified three mouse miRNA homologues: miR-193, miR-10 and miR-200, within the top five most abundant secreted miRNAs. [score:1]
[1 to 20 of 1 sentences]
100
[+] score: 1
Other miRNAs from this paper: mmu-mir-150, mmu-mir-155
miR-155 might stabilize Treg by facilitating IL-2 signaling 37] and miR-10a might stabilize the Treg lineage 38,39] but genetic deletion of either miRNA does not lead to substantial loss of FoxP3 indicating that other miRNAs or a combination of miRNAs must be stabilizing FoxP3. [score:1]
[1 to 20 of 1 sentences]