sort by

140 publications mentioning mmu-mir-19a (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-19a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 455
Other miRNAs from this paper: mmu-mir-19b-2, mmu-mir-22, mmu-mir-19b-1
Significant upregulation of miR-19a or TIA1 was observed in the miR-19a -overexpressing or TIA1 -overexpressing groups, respectively, and TIA1 overexpression could truly reverse the inhibition effect of miR-19a on TIA1 (Additional file 10: Figure S7G–I). [score:12]
In this study, we proved that miR-19a inhibits TIA1 to indirectly downregulate PDCD4, which is a TIA1 target [46] as well as an important tumor suppressor [9] in CRC. [score:11]
To prepare the nude mouse xenograft mo del, we first infected SW480 cells with a miR-19a overexpression lentivirus, transfected SW480 cells with a TIA1 overexpression plasmid, or co -transfected SW480 cells with the miR-19a overexpression lentivirus and TIA1 overexpression plasmid. [score:9]
a– cs (Transwell) were performed in SW480 cells that were transfected with equal doses of control mimic, miR-19a mimic, control inhibitor or miR-19a inhibitor (upper panel), or with equal doses of control mimic plus control plasmid, miR-19a mimic plus control plasmid, control mimic plus TIA1 overexpression plasmid, or miR-19a mimic plus TIA1 overexpression plasmid (lower panel). [score:9]
H&E results showed increased cell mitosis in the miR-19a -overexpressing group and decreased mitosis in the TIA1 -overexpressing group, whereas xenografts with both miR-19a and TIA1 overexpression exhibited less cell mitosis compared to xenografts with miR-19a overexpression alone (Fig.   7f). [score:8]
In this study, we showed that c-Myc indirectly suppresses TIA1 expression through enhancing miR-19a expression in CRC. [score:8]
When the TIA1 overexpression plasmid or siRNA (the efficacies of which were shown in Additional file 8: Figure S5B–D) was used to neutralize the effects of the miR-19a mimic or inhibitor on TIA1 expression, respectively, the PDCD4 levels were also recovered (Fig.   4d and e). [score:7]
d and e Western blot analysis of TIA1 and PDCD4 protein levels in SW480 cells transfected with control mimic, miR-19a mimic, miR-19a mimic plus TIA1 plasmid, control inhibitor, miR-19a inhibitor, or miR-19a inhibitor plus si-TIA1. [score:7]
In contrast, reduced TIA1 protein expression caused by the c-Myc overexpression plasmid was rescued by the co-added miR-19a inhibitor (Fig.   4a and b). [score:7]
f Quantitative RT-PCR analysis of PDCD4 mRNA levels in SW480 cells transfected with control mimic, miR-19a mimic, miR-19a mimic plus TIA1 plasmid, control inhibitor, miR-19a inhibitor, or miR-19a inhibitor plus si-TIA1. [score:7]
SW480 cells were infected with a control lentivirus or a miR-19a lentivirus, transfected with a TIA1 overexpression plasmid, or co -transfected with a miR-19a overexpression lentivirus and a TIA1 overexpression plasmid. [score:7]
Some oncomiR functions of miR-19a may be indirectly executed by inhibiting its indirect target PDCD4. [score:7]
TIA1 overexpression in the miR-19a lentivirus-infected group restored the suppression of TIA1 and Ki-67 caused by miR-19a overexpression (Fig.   7f– h). [score:7]
Because c-Myc can transcriptionally upregulate miR-19a, we speculated that c-Myc also influences the miR-19a target gene TIA1. [score:6]
The upregulation of miR-19a and consequential suppression of TIA1 protein by lentivirus infection are shown in Additional file 10: Figure S7A–C. [score:6]
We proposed that, by suppressing TIA1, miR-19a also indirectly influences its myriad downstream targets. [score:6]
In this study, we performed a meta-analysis of the miRNA expression profile in CRC and found that some miRNAs (especially miR-19a) were dramatically upregulated. [score:6]
We suppose that there are many other indirect regulation relationships similar to miR-19a and PDCD4, and these relationships greatly complicate the miR-19a—target regulatory network. [score:6]
Next, we efficiently overexpressed or knocked down the miR-19a level in SW480 cells with a miR-19a mimic or inhibitor, respectively (Fig.   3d). [score:6]
Thus, restoration of TIA1 expression can reverse miR-19a -induced cell proliferation, suggesting that targeting TIA1 is one mechanism by which miR-19a exerts its oncomiR function. [score:5]
Immunohistochemical staining revealed lower TIA1 and higher Ki-67 levels in tumors from the miR-19a -overexpressing group, whereas tumors from the TIA1 -overexpressing group showed increased TIA1 and decreased Ki-67 levels (Fig.   7f– h). [score:5]
As anticipated, TIA1 protein levels dramatically decreased upon miR-19a overexpression, whereas treatment with the miR-19a inhibitor increased TIA1 protein levels (Fig.   3e and f). [score:5]
e and f Western blot analysis of TIA1 protein levels in SW480, Caco2 and HT-29 cells transfected with control mimic, miR-19a mimic, control inhibitor or miR-19a inhibitor. [score:5]
ds (CCK-8) were performed 12, 24, 36 and 48 and 60 h after transfection of SW480 cells with equal doses of control mimic plus control plasmid, miR-19a mimic plus control plasmid, control mimic plus TIA1 overexpression plasmid, or miR-19a mimic plus TIA1 overexpression plasmid. [score:5]
As shown in Fig.   2c and Additional file 6: Figure S3C, miR-19a expression has a higher inverse correlation coefficient (R = -0.8224) with TIA1 expression than miR-19b (R = -0.6425). [score:5]
as (CCK-8) were performed 12, 24, 36, 48 and 60 h after the transfection of SW480 cells with equal doses of control mimic, miR-19a mimic, control inhibitor or miR-19a inhibitor. [score:5]
miR-19a directly regulates TIA1 expression at the post-transcriptional level. [score:5]
A lentiviral expression plasmid that can express miR-19a was purchased from GenePharma (Shanghai, China). [score:5]
b and cs (EdU) were performed in SW480 cells transfected with equal doses of control mimic, miR-19a mimic, control inhibitor or miR-19a inhibitor. [score:5]
d Quantitative RT-PCR analysis of miR-19a levels in SW480, Caco2 and HT-29 cells transfected with control mimic, miR-19a mimic, control inhibitor or miR-19a inhibitor. [score:5]
Among the 10 most upregulated miRNAs (Additional file 3: Table S3), miR-19a and miR-19b (miR-19a/b) were identified as the candidate regulators of TIA1. [score:5]
e and fs (EdU) were performed in SW480 cells transfected with equal doses of control mimic plus control plasmid, miR-19a mimic plus control plasmid, control mimic plus TIA1 overexpression plasmid, or miR-19a mimic plus TIA1 overexpression plasmid. [score:5]
As a control, GAPDH mRNA could not be detected in the pull-down product precipitated by the miR-19a probe (Fig.   3g), since GAPDH was not a predicted target of miR-19a according to the target prediction softwares. [score:5]
We then transfected SW480 cells with the miR-19a mimic or inhibitor to reverse the effect of the c-Myc siRNA or overexpression plasmid on miR-19a, respectively (Fig.   4c). [score:5]
Because a single miRNA has multiple target genes [36], it is necessary to determine whether the effect of miR-19a on CRC cell proliferation is derived from miR-19a -mediated TIA1 suppression. [score:5]
As expected, miR-19a overexpression resulted in an approximately 70% reduction in luciferase reporter activity compared to cells transfected with the control mimic, whereas miR-19a inhibition resulted in a 50% increase in reporter activity compared to cells transfected with the control inhibitor (Fig.   3i). [score:5]
The volumes or weights of xenografted tumors were smaller or lower in the control group than in the miR-19a -overexpressing group but larger or higher than in the TIA1 -overexpressing group, respectively (Fig.   7c– e). [score:5]
Moreover, compared with cells transfected with miR-19a mimic alone, those transfected with both the miR-19a mimic and TIA1 overexpression plasmid exhibited a significantly lower migration rate (Fig.   6a and c), suggesting that miR-19a-resistant TIA1 is sufficient to rescue the suppression of TIA1 through miR-19a and attenuate the pro-migration effect of miR-19a on CRC cells. [score:4]
Above this threshold, we found 7 significantly upregulated miRNAs, and miR-19a ranked first among them. [score:4]
These results suggested that targeting miR-19a may be a practical method to control CRC development and ameliorate symptoms, as has been shown by other groups [50, 51, 53]. [score:4]
In sum, we obtained 29 significantly upregulated miRNAs, and miR-19a/b was at the top of the list (Additional file 3: Table S3). [score:4]
Identification of TIA1 as a direct target gene of miR-19a. [score:4]
We chose PDCD4 as a target to investigate whether miR-19a modulates PDCD4 expression through regulation of TIA1. [score:4]
We predicted that TIA1 was a target of miR-19a and validated that miR-19a binded directly to the 3’-UTR of TIA1 mRNA. [score:4]
This study highlights an oncomiR role for miR-19a in regulating TIA1 in CRC and suggests that miR-19a may be a novel molecular therapeutic target for CRC. [score:4]
miR-19a overexpression or knockdown no longer affected the mutated reporter activity (Fig.   3i), suggesting that the binding sites strongly contribute to the miRNA-mRNA interactions. [score:4]
For the luciferase reporter assays, SW480 cells were cultured in 24-well plates, and each well was co -transfected with 0.2 μg of firefly luciferase reporter plasmid, 0.2 μg of β-galactosidase (β-gal) expression plasmid (Ambion), and equal amounts (50 pmol) of miR-19a mimic, miR-19a inhibitor or the scrambled negative control RNAs using Lipofectamine 2000 (Invitrogen). [score:4]
Therefore, we focused on a vital post-transcriptional regulator, miRNA, and provided the first evidence supporting the important role of miR-19a as an oncomiR in CRC targeting TIA1. [score:4]
In this study, we identified TIA1 as a direct target gene of miR-19a in CRC. [score:4]
PDCD4 displayed the same trend in the alteration in the direction of the TIA1 protein after treatment with the miR-19a mimic or inhibitor (Fig.   4d and e). [score:4]
Next, three CRC cell lines (SW480, Caco2 and HT29) were used to demonstrate the direct targeting of TIA1 by miR-19a. [score:4]
As expected, an inverse correlation between miR-19a and TIA1 expression was observed in these CRC cell lines (Fig.   3a– c). [score:3]
miR-19a promotes CRC growth in vivo by targeting TIA1. [score:3]
These results are consistent with the in vitro findings, which firmly validated the oncomiR role of miR-19a in CRC tumorigenesis through targeting TIA1. [score:3]
We then investigated whether rescuing miR-19a -mediated-TIA1 suppression with a TIA1 overexpression plasmid attenuates the pro-proliferation effect of miR-19a on CRC cells. [score:3]
For miRNA pull-down, SW480 cells which were transfected with biotinylated miR-19a (miR-19a probe) or control probe (Genescript, Nanjing, China) were harvested in lysis buffer (20 mM Tris pH 7.5, 100 mM KCl, 5 mM MgCl2, 0.5% NP-40 and 1 U/ul Recombinant RNAse inhibitor (TaKaRa)), and the total RNA was pretreated with DNaseI and then heated at 65 °C for 5 min, followed by an instant ice bath. [score:3]
We then validated that the promotion of cell migration by miR-19a was a result of the inhibition of TIA1. [score:3]
miR-19a could promote cell proliferation and migration in CRC cells and accelerated tumor growth in xenograft mice by targeting TIA1. [score:3]
To check if it was the predicted seed sequence binding sites that caused the miRNA-mRNA interaction, we constructed a firefly reporter plasmid containing a fragment of TIA1 3’-UTR across the two conserved miR-19a binding sites and then transfected the resulting plasmid into SW480 cells along with the miR-19a mimic, miR-19a inhibitor or scrambled negative control RNAs. [score:3]
miR-19a can also target TIA1 in LC and GC tissues and cell lines. [score:3]
miR-19a repressed TIA1 expression in all the four cells, too (Fig.   3d– f, Additional file 4: Figure S1I and J and Additional file 7: Figure S4A). [score:3]
In summary, this study demonstrated for the first time that miR-19a can target TIA1 to promote CRC tumorigenesis, and we identified the c-MYC—miR-19a—TIA1—PDCD4 axis in CRC (The working mo del was shown in Fig.   7i). [score:3]
miR-19a/b belong to the miR-19 family and only differ by a single nucleotide at position 11, a region minimally important for target recognition [42]. [score:3]
Furthermore, we revealed the important effects of miR-19a -driven suppression of TIA1 on the promotion of CRC cell proliferation and migration and on tumor growth in a xenografted nude mouse mo del. [score:3]
miR-19a promotes CRC cell proliferation by targeting TIA1. [score:3]
We then used 3 bioinformatic algorithms to predict miRNAs that could target TIA1 and identified miR-19a as an ideal candidate. [score:3]
miR-19a can also enhance the invasion and metastasis of CRC cells by targeting TG2 [34]. [score:3]
More research should be conducted on miR-19a and TIA1, and we would like to further elucidate the molecular mechanisms of CRC and develop new approaches for molecular therapeutics for this disease. [score:3]
a and b Western blot analysis of c-Myc and TIA1 protein levels in SW480 cells transfected with control siRNA, si-c-Myc, si-c-Myc plus miR-19a mimic, control plasmid, c-Myc plasmid, or c-Myc plasmid plus miR-19a inhibitor. [score:3]
c Quantitative RT-PCR analysis of miR-19a levels in SW480 cells transfected with control siRNA, si-c-Myc, si-c-Myc plus miR-19a mimic, control plasmid, c-Myc plasmid, or c-Myc plasmid plus miR-19a inhibitor. [score:3]
miR-19a promotes CRC cell migration by targeting TIA1. [score:3]
The overexpression of TIA1 attenuated the growth-promoting effects of miR-19a, suggesting that miR-19a promotes tumor growth by silencing TIA1 (Fig.   7c– e). [score:3]
Moreover, we provided evidence that miR-19a can promote CRC cell proliferation and migration in vitro and accelerate tumor growth in vivo by targeting TIA1. [score:3]
Therefore, miR-19a/b generally have overlapping target genes. [score:3]
We observed the anticipated decrease or increase in miR-19a levels after treatment with c-Myc siRNA or the overexpression plasmid, respectively (Fig.   4c). [score:3]
It is easy to speculate that by suppressing TIA1, miR-19a may also influence the downstream genes of TIA1. [score:3]
miR-19a is overexpressed and functions as an oncomiR in many cancer types, including bladder cancer [55], cervical cancer [56], gastric cancer [57], pancreatic cancer [58], renal cancer [59], lung cancer [60] and CRC [32– 34]. [score:3]
Subsequently, we experimentally validated TIA1 as a genuine miR-19a target in three CRC cell lines. [score:3]
The predicted interaction between miR-19a/b and the target sites in the TIA1 3’-UTR are illustrated in Fig.   2a and Additional file 6: Figure S3A. [score:3]
SW480 cells transfected with a miR-19a mimic exhibited increased proliferation; in contrast, miR-19a inhibition had the opposite effect on cell proliferation (Fig.   5a– c). [score:3]
miR-19a has been reported to be significantly overexpressed in CRC [32]. [score:3]
We hypothesized that miR-19a can promote CRC progression by suppressing TIA1. [score:3]
Such modification did not affect the suppression of TIA1 by miR-19a (Additional file 7: Figure S4B and C). [score:3]
b Quantitative RT-PCR analysis of miR-19a expression levels in the same 16 pairs of CRC and normal tissue samples. [score:3]
Thus, although miR-19a/b have similar sequences, similar expression patterns and the same binding potential to TIA1, we focused on miR-19a for further experiments. [score:3]
Fig. 2Identification of TIA1 as a miR-19a target. [score:3]
As expected, TIA1 protein expression was attenuated by co-treatment with the miR-19a mimic and c-Myc siRNA compared with treatment with c-Myc siRNA alone. [score:2]
As a consequence, TIA1 protein levels showed an inverse alteration trend compared to the expression of c-Myc and miR-19a (Fig.   4a and b). [score:2]
i Working mo del of the c-Myc-miR-19a-TIA1-PDCD4 regulatory axis in CRC. [score:2]
Taken together, the results reveal that there is a c-MYC-miR-19a-TIA1-PDCD4 regulatory axis in CRC cells. [score:2]
Thus, TIA1 functions as a bridge to link upstream regulators (such as miR-19a) and downstream effectors (such as PDCD4). [score:2]
Ki-67 immunofluorescence and soft-agar colony formation assay results indicated that miR-19a could promote SW480 cells proliferation and anchorage-independent growth by targeting TIA1 (Fig.   7a and b, Additional file 10: Figure S7D–F). [score:2]
c-MYC, miR-19a, TIA1 and PDCD4 form a regulatory axis in CRC. [score:2]
As expected, cells co -transfected with the miR-19a mimic and TIA1 overexpression plasmid showed lower proliferation rates compared to cells transfected with the miR-19a mimic alone (Fig.   5d– f). [score:2]
Fig. 4c-MYC, miR-19a, TIA1 and PDCD4 form a regulatory axis in CRC. [score:2]
Then we measured miR-19a level in LC and GC tissues mentioned above, and we also observed upregulated miR-19a level and reverse correlation between miR-19a and TIA1 protein levels in the two cancer types (Additional file 4: Figure S1C, D, G and H). [score:2]
TIA1 mRNA was only enriched in the pull-down product precipitated by the miR-19a probe and was undetectable in the product that was precipitated by control probe (Fig.   3g), suggesting that miR-19a directly binds to TIA1 mRNA in SW480 cells. [score:2]
Two predicted hybridizations were identified between miR-19a/b and the 3’-UTR of TIA1. [score:1]
More research should focus on characterizing the feasibility of targeting miR-19a in CRC therapy and developing simplified and cost-effective manipulation methods. [score:1]
Firstly, we performed a biotin-avidin pull-down assay to assess the direct binding of miR-19a to TIA1 mRNA. [score:1]
Furthermore, we illustrated the inverse correlation between miR-19a/b and TIA1 protein levels using Pearson’s correlation scatter plots. [score:1]
a Quantitative RT-PCR analysis of miR-19 levels in SW480, Caco2 and HT-29 cells. [score:1]
Subsequently, we mutated the miR-19a binding sites in the TIA1 3’-UTR fragment on the reporter plasmid to eliminate miR-19a binding ability. [score:1]
Furthermore, the miR-19a/b binding sequences in the TIA1 3’-UTR are highly conserved across species (Fig.   2a and Additional file 6: Figure S3A). [score:1]
More importantly, miR-19a is associated with lymph metastasis and mediates TNF-α -induced EMT in CRC [32]. [score:1]
Similar to the effect on SW480 proliferation, miR-19a promoted SW480 migration (Fig.   6a and b). [score:1]
g Quantitative RT-PCR analysis of TIA1 and GAPDH mRNA levels in SW480 after pulling down with control probe or miR-19a probe; h Quantitative RT-PCR analysis of miR-19a and miR-22 levels in SW480 after pulling down with control probes or two TIA1 mRNA probes; i The relative luciferase activities in SW480 transfected with wild type or mutant TIA1 3’-UTR. [score:1]
miR-19a has been wi dely studied and is thought to be a key oncogenic component of mir-17-92 [54]. [score:1]
a Schematic description of the hypothetical duplex formed by the interactions between the binding site in the TIA1 3’-UTR and miR-19a. [score:1]
a and bs of SW480 cells infected with miR-19a lentivirus, transfected with TIA1 vector or both. [score:1]
miR-19 level of SW480 was set as control. [score:1]
We also detected an inverse correlation between miR-19a and TIA1 protein levels in CRC tissues. [score:1]
However, the alteration of miR-19a had little effect on the TIA1 mRNA level (Additional file 7: Figure S4A). [score:1]
In addition, we investigated the biological effects of TIA1 inhibition by miR-19a both in vitro by CCK-8, EdU, Transwell, Ki67 immunofluorescence ands and in vivo by a xenograft mice mo del. [score:1]
These studies have revealed an important oncogenic role of miR-19a in CRC. [score:1]
SW480 cells that were infected with miR-19a lentivirus or transfected with TIA1 vector were suspended in RPMI-1640 with 0.3% Agarose L. M. P (Biocam) solution, and plated onto solidified 0.6% Agarose L. M. P in 60 mm dish (Corning) at a density of 3 × 106 cells/mL in triplicate. [score:1]
The efficiency of miR-19a lentivirus and TIA1 vector on TIA1 protein level and SW480 proliferation. [score:1]
c Pearson’s correlation scatter plot of the level of miR-19 and TIA1 protein in SW480, Caco2 and HT-29 cells. [score:1]
Consequently, miR-19a was only enriched in the pull-down products precipitated by the anti-TIA1 mRNA probes and was unot present in the product precipitated by control probe (Fig.   3h). [score:1]
c Pearson’s correlation scatter plot of the fold changes of miR-19a and TIA1 protein in human CRC tissue pairs. [score:1]
The miR-19a seed sequence and the seed sequence binding sites in the TIA1 3’-UTR are indicated in red. [score:1]
We then examined the effect of miR-19a lentivirus or TIA1 vector on SW480 proliferation and malignancy. [score:1]
miR-19a belongs to a well-known and important miRNA family named mir-17-92 (also known as oncomir-1) and is a miRNA polycistron with pleiotropic functions in cell survival, proliferation, differentiation and angiogenesis [28– 31]. [score:1]
We designed a miR-19a mimic whose 3’ terminal was biotinylated (miR-19a probe). [score:1]
Colorectal cancer microRNA miR-19a TIA1 Colorectal cancer (CRC) is one of the most prevalent malignant tumors, with high morbidity and mortality worldwide. [score:1]
Then, we repeated the miR-19a mimic and inhibitor transfection experiment in SW480 cells and measured both the TIA1 and PDCD4 protein levels. [score:1]
Effect of miR-19a on TIA1 mRNA level and the efficacies of miR-19a probe and TIA1 mRNA probes. [score:1]
Taken together, these data revealed that miR-19a promotes CRC cell migration by silencing TIA1. [score:1]
However, the precise molecular mechanism through which miR-19a influences CRC progression remains unknown. [score:1]
SW480 cells were seeded on cell slide (Fisherbrand) in 24-well plates and then infected with miR-19a lentivirus or transfected with TIA1 vector. [score:1]
Moreover, miR-19a has been found to be induced by PRL-3 to promote the proliferation and metastasis of CRC cells [33]. [score:1]
Among these miRNAs, miR-19a is one of the most important. [score:1]
First, we screened the full PDCD4 mRNA (including 5’-UTR, CDS and 3’-UTR) and identified no miR-19a binding site. [score:1]
miR-19a belongs to a well-known oncomiR cluster, namely the miR-17-92 cluster. [score:1]
The results indicated that miR-19a and TIA1 have opposite effects on CRC cell proliferation. [score:1]
An 800-bp fragment of the TIA1 3’-UTR containing the two conserved miR-19a binding sites was inserted into a luciferase reporter plasmid (Genescript, Nanjing, China). [score:1]
To test binding specificity, sequences that interacted with the miR-19a seed sequence were mutated from TTGCACA to AACGTGT, and the synthetic TIA1 3’-UTR mutant fragment was inserted into an equivalent reporter plasmid (Genescript, Nanjing, China). [score:1]
[1 to 20 of 137 sentences]
2
[+] score: 231
miR-19a suppresses HBP1 expression and up-regulates MIF to promote the release of inflammatory factors TNF-α and IL-6. In addition, miR-19a was up-regulated by the TNF-α in both THP-1 and RAW264.7 cells. [score:11]
We show that the miR-19a down-regulates HBP1, resulting in MIF up-regulation and increased secretion of inflammatory cytokines TNF-α and IL-6, while miR-19a inhibition has the opposite effects. [score:9]
To search potential targets of miR-19a, we performed several miRNA target prediction algorithms available online, including TargetMiner, MirDB, PicTar, Targetscan. [score:9]
Taken together, these data indicate that HBP1 is a functional target of miR-19a, which directly targets its 3′UTR, and that HBP1 serves as an effector of miR-19a by regulating MIF expression and IL-6 and TNF-α secretion and thereby affecting foam cell formation. [score:9]
Other reports suggest that miR-19a is up-regulated in endothelial blood vessel cells under hypoxia-inducible factor and shear stress 25– 27, and miR-19a suppresses IL-10 expression in peripheral B cells from patients with atherosclerosis [28] suggesting that miR-19a may participate in atherosclerosis. [score:8]
TNF-α -mediated expression of miR-19a upregulates MIF by targeting HBP1 and promotes the release of inflammatory cytokines TNF-α and IL-6. This TNF-α-miR-19a-HBP1-MIF forward feedback loop results in foam cell formation and promotes AS progression. [score:8]
The expression levels of miR-19a in the blood and arteries of the antagomiR-19a group are significantly lower than that in the control group, Additionally, the expression of HBP1 in the arterial wall of ApoE -null mice is upregulated with antagonistic miR-19a treatment. [score:8]
We found that overexpression of HBP1 rescued HBP1 downregulation that was mediated by miR-19a (Fig.   4G) and weaken the pro-inflammatory effects (increased IL-6 and TNF-α secretion) caused by miR-19a (Fig.   4I,K). [score:6]
These results support differential roles of miR-19a and miR-19b in regulating circulating lipids, as miR-19b targets ABCA1 and miR-19a targets HBP1. [score:6]
Through TNF-α-miR-19a-HBP1-MIF pathway, miR-19a up-regulates MIF and promotes the release of inflammatory cytokines TNF-α and IL-6. TNF-α promotes the expression of miR-19a, resulting in a forward feedback formed (Fig.   6). [score:6]
HBP1 as a functional target of miR-19a regulates the expression of MIF in foam cell formation. [score:6]
We found that the expression of miR-19a is upregulated by oxLDL stimulation in a dose- and time -dependent manner (Fig.   1D,E). [score:6]
We found that the expression of miR-19a was upregulated by oxLDL stimulation in a dose- and time -dependent manner (Fig.   1F,G). [score:6]
With the miR-19a mimic, we found that miR-19a suppressed reporter activity and that the site 2 mutant rescued such suppression, whereas the site 1 mutant had no effect (Fig.   3B). [score:5]
In contrast, inhibition of HBP1 by the siRNA restrained the protein level of HBP1 that was induced by knockdown of miR-19a (Fig.   4H) and reversed the phenotype (reduced IL-6 and TNF-α secretion) caused by miR-19a knockdown (Fig.   4J–L). [score:5]
In this study, we demonstrated that miR-19a is highly abundant in the blood and tissue of patients with atherosclerotic coronary artery disease and identified HMG box-transcription protein1 (HBP1) as a new target for miR-19a. [score:5]
All the results suggest that miR-19a regulate HBP1 by directly target the site 2 on the 3′UTR of HBP1. [score:5]
To further examine whether HBP1 is a functional target of miR-19a during foam cell formation, THP-1 cells were transfected with the miR-19a mimic, siHBP1–1, or the HBP1 overexpression vector. [score:5]
In addition, introduction of the miR-19a inhibitor caused an evidently increase in luciferase activity (Fig.   3C), which was abolished by the mutation at site 2 but not at site 1. Double mutations had similar impact as the site 2 mutant. [score:5]
Thus there is a forward feedback loop during atherosclerosis (Fig.   6): TNF-α stimulates the expression of miR-19a to suppress HBP1 and subsequently elevate MIF production, which in turn increases TNF-α secretion. [score:5]
Additionally, we also detected significantly higher expression of HBP1 in the arterial wall of antagonistic miR-19a -treated ApoE null mice immunohistochemistry than the control, implying that miR-19a represses HBP1 expression in mice (Fig.   5I,J). [score:5]
Overexpression of miR-19a decreased the level of HBP1 and increased the level of MIF; miR-19a inhibition had the opposite effects (Fig.   3D,E). [score:5]
Next, to investigate whether miR-19a regulates lipid uptake of macrophages, we transfected THP-1-derived macrophages with a miR-19a inhibitor, then incubated cells with Dil-oxLDL for 6 h. Both fluorescent imaging and fluorescence activated cell sorting (FACS) results showed that inhibition of miR-19a repressed the lipid uptake of macrophages and reduced foam cell formation (Fig.   2G,H and I). [score:4]
miR-19a directly targets the 3′UTR of HBP1. [score:4]
In addition, miR-19a is upregulated by TNF-α. [score:4]
These results indicate that miR-19a inhibition alleviates the inflammatory response and slows the development of AS. [score:4]
Interesting, miR-19a was also upregulated by the TNF-α in both THP-1 and RAW264.7 cells (Fig.   1H,I). [score:4]
In the present work, we ascertain HBP1 as a novel target gene of miR-19a in atherosclerosis. [score:3]
It has been reported that HBP1 could be a target gene of miR-19a and miR-17–5p in tumor cells 29, 30. [score:3]
Conversely, inhibition of miR-19a had the opposite effects (Fig.   2E,F). [score:3]
We also demonstrate that overexpression of miR-19a promotes foam cell formation. [score:3]
1×10 [4] HEK-293T cells were seeded into 96-well plates for 24 hours, and the cells were transfected with pRL-TK-HBP1–3′UTR or pRL-TK-HBP1–3′UTR mutant (mut1 or mut2) vectors (100 ng), 10 ng of pGL3 control (Promega, Madison, USA), and 10 pmol miR-19a mimic or miR-19a inhibitor using Lipofectamine LTX and Plus reagent (Invitrogen, Carlsbad, CA, USA). [score:3]
Next, we determined the relative expression level of miR-19a in 38 pairs of atherosclerotic lesion and normal LIMA from the same patients using qRT-PCR and found that the miR-19a level was remarkably higher in the atherosclerotic lesion than in the normal LIMA (Fig.   1C). [score:3]
Inhibition of miR-19a, therefore, may be a novel strategy to combat atherosclerosis. [score:3]
To validate that the expression of miR-19a was increased in patients with AS, we also measured the miR-19a expression level using qRT-PCR and found that miR-19a level was indeed higher in the plasma from patients with CAD (Fig.   1B). [score:3]
miR-19a is overexpressed in the plasma and atherosclerotic plaques of CAD patients and is induced by oxLDL in human macrophages. [score:3]
HBP1 (HMG box-transcription protein1), which acts as a transcriptional repressor, is identified as a potential target of miR-19a. [score:3]
THP-1-derived macrophages were transfected with miR-19a mimic or miR-19a inhibitor at the indicated dose (Fig.   2A,D). [score:3]
In summary, our present work demonstrates that miR-19a is elevated in the circulation and atherosclerotic lesions of patients with coronary artery disease. [score:3]
Overall, these results suggest that miR-19a inhibition attenuates atherosclerosis in mice. [score:3]
We found that overexpression of miR-19a in macrophages enhanced IL-6 and TNF-α production (Fig.   2B,C). [score:3]
Furthermore, mouse RAW 264.7 cells was used to test whether miR-19a is regulated by oxLDL stimulation mice. [score:2]
Two HBP1 3′-UTR mutants with mutation in the miR-19a binding site are also shown. [score:2]
Inflammatory cytokine production and lipid uptake is regulated by miR-19a. [score:2]
THP-1-derived macrophages were transfected with miR-19a inhibitor for 48 hours, and then incubated with 20 μg/ml Dil-oxLDL (Yiyuan biotechnology Guangzhou, China) for 6 hours at 37 °C For FACS assay, cells were washed three times with PBS before subjected to FACS (fluorescence activated cell sorting). [score:2]
Figure 2Inflammatory factor production and lipid uptake is regulated by miR-19a. [score:2]
The expression level of miR-19a in plasma and aortic tissue from antagomiR-19a -injected ApoE [−/−]mice was decreased notably compared with the control group (Fig.   5A, B). [score:2]
We reveal enrichment of serum miR-19a in coronary patients in comparison with healthy individuals, and miR-19a overexpression in atherosclerotic tissues of arterial walls compared to LIMA tissues. [score:2]
We made mutants for both sites and performed a luciferase reporter assay in HEK-293T cells by transfecting a miR-19a mimic (or a miR-19a inhibitor) and a luciferase reporter downstream with either the wild type HBP1 3′UTR or its mutants (Fig.   3A). [score:2]
High-fat fed ApoE [−/−] mice are treated with a miR-19a antagonist, antagomiR-19a. [score:1]
Finally, we used an animal mo del to determine the role of miR-19a in atherosclerosis. [score:1]
Atherosclerosis continues to be one of the biggest threat to human health and its initiation, prevention, and treatment invite extensive biological and medical research 22, 23. miR-19a is an important member of the miR-17–92 polycistronic gene cluster, which include seven microRNAs (miR−17–5p and −3p, miR-18a, miR19a and b, miR-20a and miR-92a) [24]. [score:1]
Figure 6 Schematic presentation of miR-19a in atherosclerosis. [score:1]
This study implies miR-19a as a promoter to inflammation and atherosclerosis. [score:1]
The results showed that miR-19a levels were significantly higher in CAD patients (Fig.   1A). [score:1]
We also demonstrate the role of miR-19a in vivo using an animal mo del of atherosclerosis. [score:1]
There are two putative binding sites in the HBP1 3′UTR to the seed sequence of miR-19a and both are highly conserved in human, chimp, mouse, rat, and dog. [score:1]
These results imply that miR-19a is a pro-inflammatory miRNA during atherosclerosis. [score:1]
To investigate the expression of miR-19a in an in vitro mo del, THP-1 cells were treated with 100 nM PMA and subsequently stimulated with oxLDL at different concentrations (0, 10, 50 μg/ml) for 24 h or with 50 μg/ml oxLDL for different durations (0, 12, and 24 h) 18, 19. [score:1]
[1 to 20 of 59 sentences]
3
[+] score: 204
Down-regulation of PTEN rescued the effects of miR-19a inhibitor suppression on the activation of the AKT/GSK pathway (d and e) and improved glycogenesis (b and c) in NCTC 1469 cells and HEP 1–6cells. [score:8]
The down-regulation of miR-19a by IL-6 was assessed in the livers of C57BL/6J mice injected with IL-6. These results suggest that IL-6 suppresses the expression of miR-19a in vivo and in vitro. [score:8]
Moreover, the level of PTEN was decreased in the NCTC1469 cells and HEP 1–6 cells transfected with miR-19a mimics (Fig. 4d,e), whereas down-regulation of miR-19a elevated the level of PTEN (Fig. 4f,g), suggesting that miR-19a negatively regulates the expression of PTEN by directly binding to its 3’-UTR. [score:8]
MiRNA target prediction databases, including Miranda, TargetScan and PicTar, were used to analyze miR-19a target genes. [score:7]
As shown in Fig. 1b–g, treatment with IL-6 but not glucose and TNF-α led to down-regulated miR-19a expression. [score:6]
The results show that the treatment with IL-6 but not glucose and TNF-α led to down-regulated miR-19a expression in liver cells. [score:6]
Our studies indicate that over -expression of miR-19a in NCTC 1469 cells and HEP 1–6 cells led to increased activation of the AKT/GSK pathway and synthesis of glycogen, whereas down-regulation of miR-19a impaired AKT/GSK phosphorylation and glycogenesis. [score:6]
Down-regulation of PTEN rescued the effects of miR-19a suppression on the activation of the AKT/GSK pathway and improved glycogenesis in NCTC 1469 cells and HEP 1–6 cells. [score:6]
Down-regulation of PTEN rescued the effects of miR-19a suppression on the activation of the AKT/GSK pathway and improved glycogenesis in NCTC 1469 cells and HEP 1–6 cells (Fig. 5d,e). [score:6]
Hiperfect transfection reagent (Qiagen) was used for the transfection of miR-19a mimics and inhibitor, and 48 h after transfection, the expression of miR-19a was detected by real-time PCR. [score:5]
Our results suggest that miR-19a negatively regulates the expression of PTEN by directly binding to its 3'-UTR. [score:5]
Three binding sites of miR-19a on the 3'-UTR of PTEN were analyzed by miRNA target prediction databases, including Miranda, TargetScan and PicTar (Fig. 4a). [score:5]
Three binding sites of miR-19a on 3'-UTR of PTEN were analyzed by miRNA target prediction databases, including Miranda, TargetScan and PicTar. [score:5]
However, transfection with miR-19a inhibitor only decreased the expression of miR-19a to 30–40%. [score:5]
To further determine the role of miR-19a in IL-6 -induced insulin resistance, NCTC 1469 cells and HEP 1–6 cells were treated with 10 ng/ml IL-6 for 24 h followed by transfection with miR-19a mimics or inhibitor for 48 h. Over -expression of miR-19a ameliorated IL-6 -induced impaired activation of the AKT/GSK pathway (Fig. 3a,b) and synthesis of glycogen (Fig. 3e,f) in NCTC 1469 cells and HEP 1–6 cells. [score:5]
However, we need to further investigate the effects of miR-19a over -expression and PTEN knockdown in the livers of db/db mice or PTEN over -expression in the normal mice on glucose metabolism. [score:4]
We found that treatment with IL-6 impaired the activation of the PI3K/AKT pathway and decreased the levels of glycogen in vitro and in vivo 8. Because db/db mice are complex and accompanied by other factors, such as elevated levels of serum glucose and inflammatory factor TNF-α, it is difficult to determine the involvement of IL-6 in the down-regulation of miR-19a. [score:4]
However, down-regulation of miR-19a further promoted IL-6 -induced reduced AKT/GSK pathway activation (Fig. 3c,d) and glycogenesis (Fig. 3g,h) in NCTC 1469 cells and HEP 1–6 cells. [score:4]
Our data demonstrate the possibility that down-regulation of miR-19a is involved in the pathogenesis of hepatic insulin resistance. [score:4]
MiR-19a is down-regulated in the livers of db/db mice and mice injected with IL-6 as well as mouse NCTC 1469 hepatocytes and HEP 1–6 hepatocytes treated with IL-6. MiR-19a ameliorates IL-6 -induced impaired phosphorylationof the AKT/GSK pathway and synthesis of glycogen in hepatocytes. [score:3]
Phosphorylation of the AKT/GSK pathway (d and j) and synthesis of glycogen (f and l) in the NCTC 1469 cells and HEP 1–6 cells transfected with miR-19a inhibitor. [score:3]
The expression of miR-19a was increased more than 100 times by transfection with miR-19a mimics. [score:3]
However, miR-19a inhibitor increases the PTEN protein level significantly. [score:3]
MiR-19a might activate the AKT/GSK pathway and glycogenesis via down -regulating PTEN expression. [score:3]
MiR-19a is down-regulated in the livers of db/db mice and mice injected with IL-6 as well as mouse NCTC 1469 hepatocytes and HEP 1-6 hepatocytes treated with IL-6.. [score:3]
Jian He et al reported that shear stress increased the expression of miR-19a and improved the PI3K pathway. [score:3]
More importantly, over -expression of miR-19a ameliorated IL-6 -induced reduced glycogen synthesis in hepatocytes. [score:3]
To confirm the effect of IL-6 on the expression of miR-19a in vivo, 12-week-old male C57BL/6J mice were injected with 16 μg/ml IL-6 by pumps for 7 days. [score:3]
control or miR-19a inhibitor or LY294002). [score:3]
How to cite this article: Dou, L. et al. MiR-19a regulates PTEN expression to mediate glycogen synthesis in hepatocytes. [score:3]
Expression of miR-19a was also reduced in the livers of mice injected with IL-6 (Fig. 1h). [score:3]
Therefore, in the present study, we further investigated the contribution of miR-19a to insulin resistance via direct regulation of PTEN expression. [score:3]
In a previous study, we found that db/db mice exhibited decreased levels of miR-200s, including miR-200a, miR-200b and miR-200c, impaired activation of the AKT/GSK pathway and reduced glycogenesis in the livers, accompanied by elevated serum concentrations of IL-6 8. The present study also showed reduced expression of miR-19a in the livers of db/db mice. [score:3]
Activation of the AKT/GSK pathway (a and b) and synthesis of glycogen (e and f) in the NCTC 1469 cells and HEP 1–6 cells treated with 10 ng/ml IL-6 for 24 h followed by transfection with miR-19a mimics for 48 h. AKT/GSK pathway activation (c and d) and glycogenesis (g and h) in the NCTC 1469 cells and HEP 1–6 cells treated with 10 ng/ml IL-6 for 24 h followed by transfection with miR-19a inhibitor for 48 h. Data represent the mean ± S. D. N = 3 independent experiments. [score:3]
Inhibition of miR-19a blocked glycogenesis (Fig. 2i,j) and the activation of the PI3K/AKT pathway (Fig. 2k,l). [score:3]
Consistently, real-time PCR verified reduced miR-19a expression in the livers of db/db mice (Fig. 1a). [score:3]
The mimic and inhibitor of miR-19a were purchased from Genepharm (Shanghai, China). [score:3]
In parallel with the increased miR-19a expression, the synthesis of glycogen and the activation of the AKT/glycogen synthase kinase (GSK) pathway were elevated in both NCTC 1469 cells and HEP 1–6 cells transfected with miR-19a mimics (Fig. 2c–f). [score:3]
Moreover, inhibition of the PI3K pathway attenuated the shear -induced miR-19a 18. [score:3]
As shown in Fig. 4b,c, over -expression of miR-19a dramatically reduced the luciferase activity in the NCTC1469 cells and HEP 1–6 cells transfected with the luciferase reporter vector containing the 3'-UTR of PTEN. [score:3]
The analysis predicted PTEN as the target of miR-19a, and there are several binding sites for the miR-19a at the PTEN 3'-UTR. [score:3]
What is the target gene that is involved in the role of miR-19a in glycogenesis? [score:3]
To gain further insights into the role of PTEN in miR-19a -mediated glycogenesis, siRNA (si-1519) targeting PTEN mRNA was transfected into NCTC 1469 cells and HEP 1–6 cells. [score:3]
PTEN is identified as a target gene of miR-19a. [score:3]
Therefore, miR-19a inhibitor did not significantly affect luciferase activity. [score:3]
MiR-19a mimics and inhibitor were transfected into both types of cells for 48 h. As shown in Fig. 2a and 2b, the level of miR-19a was increased to more than 100-fold in the two cell lines transfected with miR-19a mimics compared with those transfected with miRNA mimic control. [score:2]
These findings provide mechanistic insight into the effects of miR-19a on the regulation of the AKT/GSK pathway and the synthesis of glycogen in hepatocytes. [score:2]
In contrast, the level of miR-19a was decreased to 30-40% compared with those transfected with miRNA inhibitor control (Fig. 2g,h). [score:2]
A previous study found that miR-19a and miR-19b participated in glioma genesis via negative regulation of PTEN 17. [score:2]
MiR-19a inhibitor did not affect luciferase activity (right). [score:2]
A luciferase reporter assay was used to assess whether miR-19a can directly bind to the 3’-UTR of PTEN. [score:1]
For the luciferase assay, the 3'-untranslated region (UTR) of PTEN, including the binding sites for miR-19a, was amplified from NCTC 1469 cells using the following primers (restriction sites are underlined):PTEN-UTR-F-Sac I: TC GAGCTCGGGTTCACGTCCTACCCCTTTPTEN-UTR-R-Xba l: GC TCTAGAGC TTCGTGCAGTGCTGTAAATTT PCR was performed with genome DNA isolated from NCTC 1469 cells, and the PCR product was then digested with Sac I and Xba I (NEB). [score:1]
A luciferase reporter assay was used to assess whether miR-19a can directly bind to the 3'-UTR of PTEN. [score:1]
Supplemental Table1 shows that the level of miR-19a was decreased in the livers of db/db mice. [score:1]
The results indicated that miR-19a was one of the miRNAs which significantly affected the activation of the PI3K/AKT pathway. [score:1]
For the luciferase assay, the 3'-untranslated region (UTR) of PTEN, including the binding sites for miR-19a, was amplified from NCTC 1469 cells using the following primers (restriction sites are underlined): PTEN-UTR-F-Sac I: TC GAGCTCGGGTTCACGTCCTACCCCTTT PTEN-UTR-R-Xba l: GC TCTAGAGC TTCGTGCAGTGCTGTAAATTT PCR was performed with genome DNA isolated from NCTC 1469 cells, and the PCR product was then digested with Sac I and Xba I (NEB). [score:1]
Activation of the AKT/GSK pathway (b and h) and synthesis of glycogen (e and k) in the NCTC 1469 cells and HEP 1–6 cells transfected with miR-19a mimics. [score:1]
PTEN participates in miR-19a -mediated glycogenesis in hepatocytes. [score:1]
In addition, miR-19a has three binding sites in the PTEN 3’-UTR, but our luciferase vector only contains two binding sites. [score:1]
[1 to 20 of 59 sentences]
4
[+] score: 171
Other miRNAs from this paper: hsa-mir-19a
Significantly, forced -expression of miR-19a-3p downregulated SphK2 and efficiently inhibited U2OS cell growth. [score:8]
When analyzing tumor tissue lysates, we showed that SphK2 expression was indeed downregulated in tumors expressing SphK2-shRNA or miR-19a-3p (Figure 6D, two sets). [score:8]
Additionally, the SphK2 mRNA 3′-UTR luciferase activity was also largely inhibited in miR-19a -expressing U2OS cells, indicating that SphK2 should be the direct target of miR-19a. [score:8]
Introduction of miR-19a -mimic significantly increased miR-19a-3p expression (Supplementary Figure 2A), which downregulated SphK2 protein and mRNA (Supplementary Figure 2B), causing growth inhibition (Supplementary Figure 2C) and cell apoptosis ((Supplementary Figure 2D). [score:8]
Thus, expression of miR-19a-3p downregulates SphK2 and inhibits OS cell growth. [score:8]
Remarkably, SphK2 mRNA and protein were both significantly downregulated after expressing miR-19a (Figure 4C). [score:6]
Figure 5Downregulation of miR-19a-3p in human OS tissues and cellsRelative miR-19a-3p expression (vs. [score:6]
These results suggest that knockdown of SphK2, by targeted-shRNA or miR-19a-3p, inhibited U2OS tumor growth in nude mice. [score:6]
Thus, forced -expression of miR-19a-3p downregulated SphK2 in U2OS cells. [score:6]
As demonstrated, miR-19a-3p putatively targets the 3′ UTR (untranslated region) of SphK2 mRNA (Figure 4A). [score:5]
Fourth, SphK2 silence, by targeted-shRNA or miR-19a-3p, dramatically inhibited U2OS tumor growth in nude mice. [score:5]
Expression of microRNA-19a silences SphK2 and inhibits OS cell growth. [score:5]
Third, forced -expression of miR-19a-3p, the potential anti-SphK2 miRNA, silenced SphK2 and inhibited U2OS cell growth. [score:5]
It is therefore possible that miR-19a-3p downregulation is the cause of SphK2 upregulation in human OS cells, although this hypothesis warrants further investigations. [score:5]
More importantly, miR-19a-3p level was decreased in the OS tissues/cells, corresponding to SphK2 upregulation. [score:4]
Downregulation of miR-19a-3p in human OS tissues and cells. [score:4]
Further studies showed that U2OS cell growth, tested by cell counting assay, was also inhibited after stably expressing miR-19a-3p (Figure 4E). [score:4]
These results confirmed miR-19a-3p downregulation in human OS tissues and cells. [score:4]
Downregulation of miR-19a-3p in human OS tissues and cells. [score:4]
The volumes of tumor expressing SphK2-shRNA or miR-19a-3p were much lower than the control tumors (Figure 6A). [score:3]
Via search the “TargetScan” database, we discovered one potential anti-SphK2 microRNA: microRNA-19a-3p (“ miR-19a-3p”). [score:3]
In the miR-19a -expressing cells, Histone DNA ELISA OD (Figure 4F) and TUNEL percentage (Figure 4G) were both increased. [score:3]
Furthermore, expression a single miRNA, miR-19a for example, could exhibit reverse activities under different contexts [55– 57]. [score:3]
Results in Figure 6B confirmed that SphK2-shRNA- or miR-19a-3p -expressing tumors were dramatically lighter than the control tumors. [score:3]
Parental U2OS cells (“Par”), as well as cells stably expressing SphK2-shRNA (“L1”) or miR-19a-3p (“L1”), were injected s. c. to the nude mice; Estimated tumor volume (A) and mice body weight (deducting tumor weight, C) were recorded weekly for total six weeks. [score:3]
Relative miR-19a-3p expression (vs. [score:3]
Estimated tumor growth curve results in Figure 6A demonstrated that U2OS tumors expressing SphK2-shRNA or miR-19a-3p grew significantly slower than the control tumors (from parental cells). [score:3]
It should be noted that the same miRNA (miR-19a-3p in our study) might have other target proteins and exert different and sometimes contradictory functions in cancer progression [54]. [score:3]
One novel finding of this study is that miR-19a-3p could be the specific SphK2 -targeting miRNA. [score:3]
Next, miR-19a -mimic oligonucleotides were transfected to U2OS cells, and stable cells (three lines, “L1-L3”) expressing miR-19a were established. [score:3]
Figure 6Parental U2OS cells (“Par”), as well as cells stably expressing SphK2-shRNA (“L1”) or miR-19a-3p (“L1”), were injected s. c. to the nude mice; Estimated tumor volume (A) and mice body weight (deducting tumor weight, C) were recorded weekly for total six weeks. [score:3]
Expression of miR-19a-3p in the above-mentioned human OS tissues (See Figure 1) was also tested. [score:3]
miR-19a-3p putatively targets the 3′ UTR of SphK2 mRNA (A). [score:3]
miR-19a-3p putatively targets the 3′UTR of SphK2 mRNA. [score:3]
Parental U2OS cells, as well as cells stably expressing SphK2-shRNA or miR-19a-3p, were injected s. c. to the nude mice. [score:3]
Expression of miR-19a-3p in the stable OS cells was tested by the qRT-PCR assay. [score:2]
miR-19a-3p expression was tested via the TaqMan microRNA assay (Applied Biosystems, Shanghai, China), from 5 ng of total RNA [63]. [score:2]
U2OS/MG-63 cells were transfected with 20 nM of miR-19a mimic oligonucleotides (Ambion, Shanghai, China) by Lipofectamine 2000 (Invitrogen). [score:1]
After two days, cells were split and were transfected with miR-19a mimic again. [score:1]
The reporter vector with the 3′-UTR of SphK2 carrying a putative miR-19a-3p binding site (Position 493-499) was designed, constructed, sequence-verified by Genepharm (Shanghai, China). [score:1]
Expression of miR-19a-3p (B) and SphK2 (protein and mRNA, C), as well as the relative SphK2 mRNA 3′-UTR luciferase activity (D) in the stable USO2 cells with miR-19a -mimic (three lines, “L1-L3”) or miR-control (“miR-C”), and in the parental control cells (“Par”) were shown; Cells were also subjected to the cell counting assay (E) and the listed apoptosis assays (F and G). [score:1]
Female nude mice (6-8 weeks age, 17.5-18.8 g weight) were subcutaneously (s. c. ) inoculated with 5 × 10 [6] U2OS cells (in 0.2 mL DMEM/10% FBS), with/out SphK2-shRNA or miR-19a-3p, into the right flanks. [score:1]
On the other hand, apoptosis level was increased in the stable cells with miR-19a-3p (Figure 4F and 4G). [score:1]
miR-19a transfection. [score:1]
The construct was transfected together with the miR-19a mimic to U2OS cells. [score:1]
Therefore, it will be interesting to further understand the functional complexity of miR-19a, and to verify it as a potential anti-OS miRNA. [score:1]
Further, miR-19a-3p level in all four lines of human OS cells (MG63, SaOs2, G293 and U2OS) was also lower than that in the osteoblastic cells (OB-6 and hFOB1.19 lines) (Figure 5B). [score:1]
[1 to 20 of 47 sentences]
5
[+] score: 158
Our results indicate that the 60 nt target protector is the most effective at blocking miR-19a activity at the Pten 3′UTR 60 nt TARGET PROTECTOR BLOCKS miR-19a ACTIVITY IN VITROTo ensure that the 60 nt target protector was transcribed and expressed as expected, we performed a northern blot assay using RNA extracted from N2a cells transfected with either the target protector or an empty vector. [score:10]
Our results indicate that the 60 nt target protector is the most effective at blocking miR-19a activity at the Pten 3′UTR To ensure that the 60 nt target protector was transcribed and expressed as expected, we performed a northern blot assay using RNA extracted from N2a cells transfected with either the target protector or an empty vector. [score:8]
To test further whether decreased proliferation of neural progenitors in target protector electroporation is caused by up-regulation of Pten, which is usually suppressed by miR-19a, we electroporated full length Pten containing the 3′UTR with miR-19a binding sites (Pten-FL-3′ UTR). [score:8]
To apply this concept in mammalian development, we designed plasmid -based mRNA target protectors using miR-19a:Pten regulation, since our previous work and others have demonstrated the targeting effect of miR-19a on Pten (Mu et al., 2009; Olive et al., 2009; Mavrakis et al., 2010; Bian et al., 2013). [score:7]
60 nt TARGET PROTECTOR BLOCKS miR-19a ACTIVITY IN VIVOHaving established that the plasmid -based target protector is effective in vitro, we sought to apply it in vivo, where such a tool can provide insight to the function of specific miRNA–mRNA interactions during development. [score:6]
To validate that miR-19a targeting of Pten is responsible for RGC proliferation, we introduced Pten target protectors into E13.5 cortices, which should result in a decrease of RGCs. [score:5]
Protein extracts were harvested by lysing N2a cells transfected with combinations miR-19a, 60 nt target protector, and empty vector with RIPA lysis buffer (150 mM NaCl, 1 mM Na [4]P [2]O [7], 1 mM NaF, 1 mM EDTA, 1 mM PMSF, 2 mM Na [3]VO [4], 1% NP-40, 50 mM Tris, pH 7.5) with complete [TM] EDTA-free protease inhibitor mixture (Roche Diagnostics, Indianapolis, IN, USA). [score:5]
To test the target protectors, we used a luciferase vector containing only the second miR-19a binding site of the Pten 3′UTR (the first miR-19a binding site was mutated in the Pten 3′UTR), and cotransfected it with miR-19a and each target protector in N2a cells. [score:5]
While our plasmid -based target protectors are shown to be very effective for dissecting the miR-19a: Pten relationship, we have applied them to other miRNA:target pairs with mixed results. [score:5]
We previously established that miR-19a regulates Pten posttranscriptionally by preventing its translation (Bian et al., 2013). [score:4]
The numbers of BrdU [+] and Ki67 [+] cells were significantly decreased after Pten target protectors were electroporated compared to empty vector electroporation, suggesting a functional result of the blockade of miR-19a silencing effect on Pten expression (Figure 4). [score:4]
Neither miR-19a nor any of the target protectors had an effect on the luciferase activity of the Pten 3′UTR containing a mutation in both miR-19a binding sites (Figure 2B). [score:4]
We previously established that miR-19a targeting of Pten promotes progenitor cell expansion in the developing mouse cortex (Bian et al., 2013). [score:3]
In this study, we successfully introduced target protectors for two miR-19a binding sites and we recommend this combinatorial approach for derepression of multiple pathway members. [score:3]
miR-19a reduced luciferase activity in the absence of target protector. [score:3]
Ectopic expression of full length Pten containing the 3′UTR (Pten-FL-3′ UTR) showed a similar effect, while co-electroporation of Pten-FL-3′ UTR and miR-19a ablated this effect. [score:3]
60 nt TARGET PROTECTOR BLOCKS miR-19a ACTIVITY IN VIVO. [score:3]
We expected that blocking miR-19a activity with the target protector will result in decreased proliferation of progenitors. [score:3]
Using our Pten target protectors, we further demonstrate that the specific effects of miR-19a on RGC expansion occur through silencing Pten. [score:3]
FIGURE 2Target protectors for Pten block miR-19a -induced repression. [score:3]
Genome-wide RNA -mediated interference screen identifies miR-19 targets in Notch -induced T-cell acute lymphoblastic leukaemia. [score:3]
TARGET PROTECTORS REVEAL THE ROLE OF miR-19a REPRESSION OF Pten IN THE DEVELOPING CORTEX. [score:3]
To observe the maximum effect of blocking miR-19a binding to Pten, we also designed a 60 nt target protector for the first binding site in the Pten 3′UTR and used in utero electroporation to introduce protectors for both miR-19a binding sites in the Pten 3′UTR into the embryonic day 13.5 (E13.5) cortex, analyzed at E14.5. [score:3]
Here, we have designed and optimized target protectors for the miR-19a binding sites in the Pten 3′UTR. [score:3]
miR-19a EXPRESSION CONSTRUCT. [score:3]
Thus, the miR-19a: Pten relationship provides an ideal readout for testing Pten derepression through target protectors. [score:3]
For the second miR-19a binding site, target protectors with three lengths of complementarity to the Pten 3′UTR were designed: 22, 40, and 60 nucleotides (nt; Figure 2A). [score:3]
All the primers for cloning of targets in the 3′UTR and their mutation are listed as the following: Pten-3′UTR: F: 5′-CATCTAGAATACATCCACAGGGTTTTGACA-3′, R: 5′-TTGAAGCCCTAATCCCAACTCT-3′; Pten-3′UTR-miR-19a-mut1: 5′-CCGGGTTCACGTCCTACCCCATTACAATTGTGGCAACAGATAAGTTT-3′. [score:3]
To optimize the minimum length of sequence complementarity necessary for maximum protector efficacy, we designed target protectors with three lengths of complementarity for the second miR-19a binding site in the Pten 3′UTR (Figure 2A). [score:3]
To generate the miR-19a expression construct, the miRNA fragment was inserted into pcDNA3.1 for transfection in cell lines, and pCAGIG for electroporation. [score:3]
FIGURE 4Target protectors block miR-19a repression of Pten in the developing mouse cortex. [score:3]
These results show that miR-19a targeting of Pten is critical for proliferation of RGCs in the developing cortex but does not affect the IP cell population. [score:3]
60 nt TARGET PROTECTOR BLOCKS miR-19a ACTIVITY IN VITRO. [score:3]
Ectopic expression of Pten-FL-3′ UTR showed a similar effect, while co-electroporation of Pten-FL-3′ UTR and miR-19a ablated this effect. [score:3]
Previous work in our lab has shown that in the developing cortex, miR-19a targets Pten mRNA (Bian et al., 2013). [score:3]
Neither miR-19a nor the 60 nt target protector had an effect on the luciferase activity of the full length Pten 3′UTR when the miR-19a binding sites were mutated. [score:3]
We hypothesized that an effective target protector would block miR-19a activity in the 3′UTR of Pten in a luciferase assay, resulting in a recovery of luciferase activity. [score:2]
Indeed, a Western blot assay showed that transfection of only exogenous miR-19a results in a decrease of endogenous Pten, while cotransfection of exogenous miR-19a and the target protector, or the protector alone significantly rescues the endogenous Pten protein levels (Figures 3C, D). [score:2]
The first miR-19a binding site was mutated using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) according to manufacturer’s instructions. [score:2]
In the developing mouse cortex, Pten functions to repress progenitor expansion; therefore its repression by miR-19a results in increased proliferation (Groszer et al., 2001; Zheng et al., 2008). [score:1]
The seed binding sequence of miR-19a is highlighted in green, and the entire length of miR-19a along the Pten 3′UTR is highlighted in red. [score:1]
miR-19 is a key oncogenic component of mir-17-92. [score:1]
Protectors were designed as perfectly complementary sequence covering the miR-19a binding sites in the Pten 3′UTR. [score:1]
When Pten-FL-3′ UTR was co-electroporated with exogenous miR-19a, the numbers of BrdU [+] and Ki67 [+] cells were recovered to wild type levels, indicating that the change is dependent on miR-19a activity on the Pten 3′UTR (Figure 4). [score:1]
Our previous work has shown that the miRNA family miR-17-92, containing miR-19a, promotes RGC proliferation (Bian et al., 2013). [score:1]
We also revealed an important role of the miR-19a: Pten interaction in the developing cortex, demonstrating the great potential of this essential new tool. [score:1]
The precursor hairpin sequence of miR-19a and ~100 nt of genomic sequence flanking each side of the hairpin sequence was amplified by PCR from the genomic locus of the mouse miR-17-92 cluster. [score:1]
When Pten-FL-3′ UTR and miR-19a were co-electroporated, the number of Pax6 [+] RGCs was recovered, while the number of Tbr2 [+] IPs remained unchanged (Figure 5). [score:1]
[1 to 20 of 48 sentences]
6
[+] score: 69
We first confirmed miR-19 antagomir activity using a β-galactosidase (β-Gal) reporter containing multiple miR-19 binding sites within the 3′UTR that allow translational suppression in the presence of miR-19. [score:5]
Based on the partial residual expression of the miR-17 and miR-92 families (Figure 7B, 7C), and the generally very low expression of the miR-18 family (Figure 7D, note y axis units), we hypothesized that loss of the miR-19 family was responsible for the defective invasion of 17KPC cell lines. [score:5]
TIMP2, CST3, and TGM2 are all predicted targets of miR-19 that are also suppressors of invasion [37, 39, 62, 63] and could potentially explain the reduced invasiveness of 17KPC cell lines. [score:5]
In contrast, miR-19 family miRNAs can only be expressed from the mir-17~92 and mir-106a~363 clusters, and 17KPC lines were found to completely lack expression of this miRNA family (Figure 7E). [score:5]
In addition, expression profiling and proteomic studies will be required to identify the mechanisms through which miR-19 miRNAs regulate invadopodia formation and function. [score:4]
To validate that miR-19 family miRNAs play an important role in invasion, we utilized antagomirs–short oligonucleotides that bind and inactivate miRNAs–to specifically knock down miR-19 function in KPC lines with high invasive capacity and varying levels of miR-19 expression [56]. [score:4]
miR-19 family expression is absent in 17KPC cell lines. [score:3]
Invadopodia rosette formation (G) and FITC-gelatin degradation (H) in the KPC cell lines 9910#1 and 9248#1 treated with control or miR-19 -targeting antagomirs. [score:3]
The human pancreatic cancer cell lines MIA Paca-2 and PANC-1 are also invasive and express relatively high levels of miR-19 (Figure 8F). [score:3]
Figure 8(A) Transwell invasion through Matrigel of KPC cell lines treated with control or miR-19 -targeting antagomirs at the indicated concentrations. [score:3]
Indeed, the cell line with the highest expression of miR-19, 9415#2, was resistant to antagomirs at a concentration of 50 nM, but responded when treated with antagomirs at 100 nM (Figure 8A, 8C). [score:3]
PDAC cell line invasion and invadopodia formation is suppressed by miR-19 antagomirs. [score:3]
This response inversely correlated with the level of endogenous miR-19 family expression, suggesting a dosage response (Figure 8C). [score:3]
MiR-19 antagomirs significantly inhibited KPC cell line invasion, but not migration, consistent with an invasion-specific effect for miR-19 family miRNAs (Figure 8A, 8B). [score:3]
These data demonstrate that miR-19 miRNAs regulate PDAC cell invasion. [score:2]
We next ascertained whether miR-19 regulates invasion in human PDAC cells. [score:2]
In addition, we find that mir-17~92 miRNAs, in particular miR-19 family miRNAs, promote PDAC cell invasion by regulating the formation of extracellular matrix-degrading invadopodia rosettes. [score:2]
Pooled antagomirs against miR-19a and miR-19b enhanced reporter activity in a KPC cell line, but not in a 17KPC cell line (Supplementary Figure 9). [score:1]
Furthermore, treatment with miR-19 antagomirs was sufficient to reduce the number of invadopodia rosettes formed in KPC cells (Figure 8G, Supplementary Figure 10) and also decreased the gelatin degradation capacity of these cell lines (Figure 8H, Supplementary Figure 11). [score:1]
Indeed, TGM2 is linked to miR-19 -mediated invasion in colorectal cancer cells [37]. [score:1]
Given that our data point to a major effect of miR-19 on invadopodia formation and/or stability, and since none of the above factors are known to influence invadopodia, these negative findings are perhaps not surprising. [score:1]
Thus, we have identified a novel role for miR-19 in pancreatic cancer cells. [score:1]
In fact, few studies exist that link miR-19 to cancer cell invasion in any tumor type [36, 37]. [score:1]
miR-19 promotes invadopodia formation and the invasiveness of pancreatic cancer cell lines. [score:1]
Using antagomirs against miR-19, we demonstrated that miR-19 family miRNAs are key drivers of invadopodia formation and the invasive capacity of human and murine pancreatic cancer cells. [score:1]
Future studies will be required to validate the significance of miR-19 family miRNAs in the invasive phenotype of PDAC in vivo. [score:1]
Of note, the miR-19 microRNAs have been associated with tumor cell invasion and metastasis in gastric cancer [35], lung cancer [36] and colon cancer [37]. [score:1]
Some miRNAs share sufficient sequence similarity that standard oligonucleotides amplify both species equally (e. g. miR-19a and miR-19b), and therefore not all miRNAs are individually plotted. [score:1]
[1 to 20 of 28 sentences]
7
[+] score: 63
xlsx”): Column 1: predicted target gene list used for GSEA; Column 2: subset list of predicted target genes present on microaarray; Column 3: leading edge subset of genes that were found to be either up or downregulated by comparing −H−D vs +H+D (normalized p value indicated on the top of the column); Column 4: leading edge subset gene list that were found to be either up or downregulated by comparing −H−D vs +H+D (normalized p value indicated on the top of the column); Column 5: intersection between leading edge gene lists in columns 3 and 4. Lists of leading edge common targets for miR-17 and miR-20 (intersection of the four gene lists in columns 3 and 4 on sheets miR-17 and miR-20), miR-19a and miR19b (intersection of the four gene lists in columns 3 and 4 on sheets miR-19a and miR-19b) as well as for miR-451 (intersection of gene lists in columns 3 and 4 in sheet miR-451) that have been used to generate the histograms presented in Figure 3B, C and D are given in sheet named «Gene list profile». [score:13]
During this study, we found that several other known miR-17-92 targets such as PTEN (miR-19 and miR-17/20a target) [24], TxNIP/VDUP (miR-17/20a target) [44] E2F1 (miR-17/20a) [45], [46] and P21 (miR-17/20a target) [45], [47] were surprisingly not regulated in response to miR-17-92 expression variations in NN10#5 and 745A#44 cells. [score:12]
This analysis (Figure 3A) revealed that genes belonging to the predicted targets lists of miR-17, miR-20a, miR-19a and miR19b but not to those of miR-18a or miR-92a were significantly over-represented among genes up-regulated in response to HMBA and Dox (resulting in down regulation of miR-17-92 cluster). [score:7]
B: Mean relative expression profiles of the leading edge subsets of common predicted targets for miR-17/20a, miR-19a/19b and miR-451 identified by GSEA in response to progressive decrease of miR-17-92 expression or progressive increase of miR-451 induced by indicated combinations of HMBA and Dox treatment in 745A#44 cells. [score:7]
We also compared mean expression levels of genes in the leading edge subsets of common miR-17/miR-20a, common miR-19a/miR-19b and miR-451 targets identified in response to HMBA in the other two conditions (+Dox only or +HMBA only) which are associated with intermediate pri-miR-17-92 expression levels (Figure 1). [score:6]
In summary, these analyses indicated that miR-17-92 cluster in 745A#44 cells is mainly involved in the down-regulation of predicted targets of miR-17/miR-20a and miR-19a/miR-19b rather than miR-18a or miR-92a. [score:6]
As expected from authentic target genes, variations in the levels of miR-17/miR-20a and of miR-19a/miR-19b targets were inversely correlated with the variations of pri-miR-17-92a levels (compare Figure 3B with pri-miR-17-92a and miRNAs profiles in Figure 1A). [score:5]
Except for miR-18, the oncogenic contributions of miR-17/20a, miR-19a/b and miR-92 have all been demonstrated and several functional targets identified, including E2F1, PTEN and BIM1 [26]. [score:3]
Identification of miR-17/miR-20a and miR-19a/miR-19b signatures in the transcriptome of 745A#44 cells displaying decreased levels of miR-17-92 cluster. [score:1]
Figure S4 Comparison of miR-17, miR18, miR-19a, miR19b and miR92 levels between NN10#5, 745A#44 and K16 erythroleukemic cells. [score:1]
This miR-17-92 cluster comprises six miRNAs that can be grouped into four sub-families based on their seed sequence (miR-17 and miR-20a, miR-18a, miR-19a and b and miR-92a) [19]. [score:1]
Given the very high similarity between miR-17 and miR-20a or miR-19a and miR-19b, this retrospective analysis was performed on the intersection of the leading edge subset of miR-17 and miR-20a or miR-19a and miR-19b, respectively. [score:1]
[1 to 20 of 12 sentences]
8
[+] score: 50
In line with reduced expression levels in failing hearts of old mice, decreased miR-18a, miR-19a, and miR-19b expression was associated with severe heart failure at old age (Fig. 3A), while miRNA expression in old patients with a preserved function was not different from young ICM patients (Fig. 3A). [score:7]
The pro-oncogenic activity of miR-17–92 partially involves the regulation of the ECM proteins CTGF and thrombospondin-1 (TSP-1) by the cluster members miR-18 and miR-19, through sequence-specific targeting within the 3′-untranslated region (3′-UTR) of these gene transcripts (Supporting information Fig. S1) (Dews et al., 2006). [score:6]
Together, these data suggest that regulation of CTGF and TSP-1 is the result of the shared expression of miR-18a, miR-19a, and miR19b, enabling modest changes in miRNA expression to control transcriptional repression. [score:6]
In conclusion, our study is the first to show that miRNA expression of the miR-17–92 cluster changes with cardiac aging and associates decreased miR-18a, miR-19a, and miR-19b expression with age-related remo deling in the heart. [score:5]
At 104 weeks of age, HF-prone mice had significantly reduced expression levels of miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1 as compared to 12-week littermates (Fig. 2C and Supporting information Table S1), coinciding with the observed increased presence of their targets TSP-1 and CTGF. [score:4]
Our in vitro results support a role for miR-18a, miR-19a, and miR-19b in regulating CTGF and TSP-1 expression in the aged cardiomyocyte. [score:4]
These findings confirm the expression profiles in aged HF-prone mice and again suggest that miR-18a, miR-19a, and miR-19b could transcriptionally repress CTGF and TSP-1 levels in cardiomyocyte aging and HF at old age. [score:3]
CTGF and TSP-1 have been identified as target genes of the miR-17–92 cluster (Dews et al., 2006), more specifically of the cluster members miR-18a and miR-19a/b (Suarez et al., 2008; Ohgawara et al., 2009). [score:3]
This, together with miR-18 and miR-19 targeting CTGF and TSP-1 and the fact that ECM proteins are crucial for healthy cardiac aging, has led us to hypothesize that these miRNAs play a role in age-related cardiac remo deling. [score:3]
Therefore, we investigated whether age-related changes in miR-18a, miR-19a, and miR-19b expression regulate CTGF, TSP-1, and collagen levels in rodent mo dels of aging -associated heart failure and in the human failing heart. [score:2]
The three miR-17–92 cluster members miR-18a, miR-19a, and miR-19b specifically target the ECM proteins CTGF and TSP-1. To investigate the role of these genes in human HF, we studied their expression profiles in cardiac biopsies of idiopathic cardiomyopathy (ICM) patients at old age with a moderately decreased or preserved systolic function (ejection fraction (EF) between 40 and 55%) (Paulus et al., 2007) and severely impaired cardiac function (EF < 30%) and compared them to young ICM subjects. [score:2]
From the six members of the miR-17–92 cluster, miR-18a, miR-19a, and miR-19b were among the most strongly repressed miRNAs in aged cardiomyocytes and hearts of old failure-prone mice. [score:1]
CTGF, TSP-1, miR-18a, miR-19a, and miR-19b levels in aged HF-resistant (12 weeks, n = 8; 52 weeks, n = 8; and 104 weeks, n = 9) and HF-prone mice (12 weeks, n = 6; 52 weeks, n = 11; and 104 weeks, n = 9). [score:1]
This cluster encodes six miRNAs (miR-17, miR-18a, miR-19a, miR-19b, miR-20a, and miR-92a-1) that are located within an 800-base pair region of human chromosome 13. [score:1]
Importantly, miR-18a, miR-19a, and miR-19b were among the most strongly repressed miRNAs. [score:1]
RT-PCR analysis of miR-18a, miR-19a, miR-19b, CTGF, and TSP-1 transcript levels in myocardial biopsies from idiopathic cardiomyopathy (ICM) patients at older age with normal (n = 5) and severely impaired (n = 9) cardiac function. [score:1]
[1 to 20 of 16 sentences]
9
[+] score: 47
miR-19a was significantly down-regulated in hippocampus and brainstem motor nuclei and significantly up-regulated in primary motor cortex of G93A-SOD1 compared to control (p < 0.01). [score:6]
We recently found that the expression of neural (miR-9, miR-124a) and cell cycle-related (miR-19a and -19b) miRNAs was significantly associated with altered neuronal fate of cultured ependymal stem/progenitor cells isolated from spinal cord of ALS mice, and that these alterations became more marked as disease progressed [28], suggesting that these miRNAs are involved in ALS pathogenesis and progression. [score:5]
In the present study we have found that in whole brain and brain regions concerned with neurogenesis (SVZ and hippocampus) and affected by motor neuron degeneration (primary motor cortex and brainstem motor nuclei), altered expression of neural fate miR-124a and miR-9 (but not miR-134), cell cycle-related miR-19a and -19b, astrocyte-related miR-125b and oligodendrocyte -related miR-219 occur in late stage disease (18 weeks). [score:5]
Interestingly, at week 18, expression levels of miR-9 and miR-124a, but not miR-134, were significant lower in G93A-SOD1 whole spinal cord than in Wt-SOD1 spinal cord (p < 0.05 and p < 0.01, respectively), whereas miR-19a and -19b expression levels were significantly higher in ALS than Wt-SOD1 mice (p < 0.01 and p < 0.05, respectively) (Additional file 1: Figure S1). [score:5]
Expression of miR-9, miR-124a, miR-19a and -19b was significantly increased in G93A-SOD1 whole brain at late stage disease compared to B6. [score:4]
With regard to miR-19a and -19b, these are involved in cell cycle regulation and their expression is enhanced in several stem cell types [13, 46]. [score:4]
miR-19a and -19b were up-regulated in primary motor cortex and hippocampus, respectively. [score:4]
SJL and Wt-SOD1 mice, except for miR-19a, which was significantly down-regulated in ALS brain (p < 0.05) (Figure  1). [score:4]
At 8 weeks expression levels of miR-9, miR-124a, miR-19a and -19b did not differ significantly between whole brains of G93A-SOD1, B6. [score:3]
We next analyzed the expression of miR-9, miR-124a, miR-19a and -19b, miR-125 and miR-219 in manually dissected SVZ, hippocampus, primary motor cortex and brainstem motor nuclei in 18-week-old ALS mice compared to same age controls. [score:2]
We found that miR-19a was significantly down regulated in hippocampus, while, as expected, Ccnd2 levels correlated inversely with miR-19a. [score:2]
At week 18, miR-9, miR-124a, miR-19a and -19b levels were significantly higher in G93A-SOD1 than control brains (p < 0.01 both B6. [score:1]
In the present study, we first investigated the expression of miR-9, miR-124a, miR-19a, miR-19b and miR-134 in the whole brain of G93A-SOD1 mice in comparison with that of B6. [score:1]
Here we investigated neural miR-9, miR-124a, miR-125b, miR-219, miR-134, and cell cycle-related miR-19a and -19b, in G93A-SOD1 mouse brain in pre-symptomatic and late stage disease. [score:1]
[1 to 20 of 14 sentences]
10
[+] score: 47
Based on the experiments using specific miR inhibitors, the mechanisms of the effects of miR-18a-5p, miR-19a-3p, and miR-19b-3p on the up-regulation of activated STAT3 might be the suppression of genes for regulatory proteins of STAT3 such as protein inhibitor of activated STAT3 (PIAS3) and suppressor of cytokine signaling 1 and 3 (SOCS1, SOCS3) [29– 32]. [score:13]
Interestingly, miRNA inhibitors targeted to miR-18a-5p, miR-19a-3p, and miR-19b-3p down-regulated the expression of BCL2, BCL2L1, BIRC5, and MMP9, target genes of STAT3, which implied the positive feedback loop of STAT3/miR-17-92 clusters (Fig. 7B-E). [score:12]
In particular, inhibition of miR-18a-5p, miR-19a-3p, and miR-19b-3p resulted in differential up-regulation of mRNA expressioin of PIAS3, SOCS1, and SOCS3, coding genes for regulatory proteins of STAT3 such as (Supplemental Fig. 6–8). [score:9]
In order to figure out feedback effects of miR-17-92 clusters on STAT3 activation, we evaluated the expression of target genes of STAT3 which demonstrated higher expression in Y79 cells than other retinal constituent cells: BCL2, BCL2L1, BIRC5, and MMP9 according to the treatment with specific miRNA inhibitors to components of miR-17-92 clusters: miR-18a-5p, miR-19a-3p, and miR-19b-3p. [score:7]
org demonstrated that sequences from 998 through 1020 in the 3′ UTR region of CCND1 are targets for miR-17 and miR-20a, those from 1770 through 1784 are those for miR-19a, and those from 1777 through 1782 are those for miR-19b. [score:3]
Interestingly, the inhibition of miR-18a-5p, miR-19-3p, and miR-19b-3p induced the decrease in the proportion of pSTAT3 -positive retinoblastoma cells. [score:3]
[1 to 20 of 6 sentences]
11
[+] score: 46
Interestingly, of the 5 MYCN -targeting miRNAs with positive correlation to MYCN expression or activity, 3 miRNAs, miR-19a-3p, miR-19b-3p and miR-494-3p, showed significantly increased expression during tumor development (Fig. 4B), further supporting the hypothesis that MYCN induces the expression of these miRNAs. [score:10]
It is conceivable that these miRNAs act both in a MYCN negative regulatory feed-back loop as well as via repression of important neuroblastoma tumor suppressor genes: indeed, miR-19a-3p targets ESR1 [32], a ligand-inducible transcription factor implicated in neuronal differentiation, whereas miR-19b-3p represses DKK3 expression [33], a marker of tumor differentiation with elevated expression levels in favorable tumors. [score:10]
Of the five MYCN -targeting miRNAs with positive correlation to MYCN expression or activity (Fig. 2A), three miRNAs, miR-19b-3p, miR-19a-3p and miR-34c-5p, showed induction of expression (Fig. 5), supporting the assumption that MYCN induces the expression of these miRNAs. [score:9]
Indeed, miR-19a-3p and miR-19b-3p, members of the oncogenic miR-17-92 cluster, have been shown to be direct transcriptional targets of MYCN in neuroblastoma cells [5, 24], and the region upstream to miR-494-3p contains E-box sequences (data not shown), suggesting that MYCN can induce its expression. [score:6]
Considering the 5 MYCN -induced miRNAs, the data in the LSL- MYCN;Dbh-iCre tumors again fully recapitulated the findings from the TH-MYCN progression mo del: miR-19a-3p, miR-19b-3p and miR-494-3p showed increased expression in tumors compared to wild-type control tissue (Fig. 4D), whereas miR-34c-5p and miR-449a are respectively significantly downregulated and not regulated in LSL- MYCN;Dbh-iCre tumors. [score:6]
Subsequent analysis of these miRNAs in in vivo MYCN mo del systems showed that activation of MYCN is associated to increased expression of miR-19a-3p, miR-19b-3p and miR-494-3p. [score:3]
Two of these miRNAs, miR-19a-3p and miR-19b-3p, are part of the oncogenic miR-17-92 cluster and were already known to be directly induced by MYCN in neuroblastoma cells [10]. [score:2]
[1 to 20 of 7 sentences]
12
[+] score: 46
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
Treatment of MLTC-1 cells with Bt [2]cAMP for 6 h increased the expression of miRNA-212, miRNA-183, miRNA-132, miRNA-182 and miRNA-96, and inhibited the expression of miRNA-138 and miRNA-19a. [score:7]
Treatment of MLTC-1 cells with Bt [2]cAMP for 6 h increased the expression of miRNA-212, miRNA-183, miRNA-132, miRNA-182 and miRNA-96 and inhibited the expression of miRNA-138 and miRNA-19a (Fig. 4B ). [score:7]
Bt [2]cAMP stimulation of granulosa cells caused down-regulation of a majority of miRNAs, including miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, miRNA-138 and miRNA-19a, but expression levels of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 were significantly increased. [score:6]
Using qRT-PCR, we confirmed the down-regulation of miRNA-200b, miR-122, miR-19a, miRNA-466b, and miRNA-27a expression (Fig. 3 ). [score:6]
qRT-PCR measurements indicated that exposure of primary rat granulosa cells to Bt [2]cAMP for 24 h inhibited the expression of miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, and miRNA-138 and miRNA-19a while enhancing the expression of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 (Fig. 4 ). [score:5]
MiR-183, miR-96 and miR-19a were predicted to target the ABCA1 gene. [score:3]
We next evaluated the effects of Bt [2]cAMP stimulation of rat ovarian granulosa cells and of mouse MLTC-1 Leydig tumor cells on the expression of twelve miRNAs (miRNA-212, miRNA-122, miRNA-183, miRNA-200b, miRNA-466b, miRNA-182, miRNA-96, miRNA-27a, miRNA-132, miRNA-214, miRNA-138 and miRNA-19a) whose adrenal expression was differentially altered in response to treatment of rats with ACTH, 17α-E2 or DEX. [score:3]
More specifically, we assessed the impact of Bt [2]cAMP treatment on the expression of miRNA-212, miRNA-122, miRNA-27a, miRNA-466b, miRNA-200b, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96 and miRNA-19a. [score:3]
The levels of expression of miRNA-212, miRNA-122, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96, miRNA-466b, miRNA-200b, and miRNA-19a are shown. [score:3]
Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
Dexamethasone treatment decreased miRNA-200b, miR-122, miR-19a, miRNA-466b and miRNA27a levels, but increased miRNA-183 levels. [score:1]
0078040.g003 Figure 3Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
[1 to 20 of 12 sentences]
13
[+] score: 33
For example, we recently identified a network of miR-19 targets converging on the control of inflammation by virtue of regulating the expression of components of the NF-κB signalling pathway (27). [score:6]
Indeed, while miR-19a-3p did not have the predicted highly inhibitory motif, it was able to repress TLR7 sensing independently of miR-19 targeting in miR-19 -deficient cells (Figure 1). [score:5]
Moreover, microarray profiling of mRNA expression in BMMs after DOTAP -mediated LNA/DNA AMO transfection (for miR-19a-3p, miR-15a-5p and miR-34a-5p) did not result in a significant de-repression of genes targeted by these miRNAs according to specific hexamer enrichment analyses with DIANA-mirExtra (42) (data not shown). [score:5]
To distinguish the direct contribution of miR-19 and -92 in TLR7 sensing from a potential off-target effect of the 2′OMe AMOs used, experiments were replicated in BMMs from miR-17∼92 [flox/ flox] × LysMCre mice—where levels of mature miR-17-5p, miR-19a-3p and miR-92a-3p were decreased by ∼70% (Figure 1B). [score:4]
Critically, pre-treatment with the miR-19a-3p 2′OMe AMO still reduced TNF-α production by ∼50%, suggesting an activity independent of its miRNA -targeting function (Figure 1A). [score:3]
We have recently reported a positive regulatory role for miR-19 miRNAs (including both miR-19a-3p and miR-19b-3p) in the control of nuclear factor kappa B (NF-κB) signalling in several cell lines (27). [score:2]
In agreement with our previous results, miR-19a-3p inhibition resulted in ∼70% decreased TNF-α production in response to transfected immunostimulatory ssRNA (B-406AS-1), when compared to the non-2′OMe control RNA sequence (RD) (Figure 1A). [score:2]
miR-17∼92 [flox/ flox] mice (Jax mice stock 8458 – on a mixed C57BL/6 and 129S4 background) harbouring loxP sites on each side of the miR-17∼92 cluster (Mir17, Mir18, Mir19a, Mir20a, Mir19b-1, Mir92–1) (23), were bred to LysMCre mice (kind gift from Dr. [score:1]
In this work, we originally set out to study the role of the individual members of the miR-17∼92 cluster of miRNAs (miR-17/20a, miR-19a/b, miR-18a and miR-92a) on TLR7 -driven NF-κB signalling in mouse primary macrophages. [score:1]
Gantier M. P. Stunden H. J. McCoy C. E. Behlke M. A. Wang D. Kaparakis-Liaskos M. Sarvestani S. T. Yang Y. H. Xu D. Corr S. C. A miR-19 regulon that controls NF-kappaB signalingNucleic Acids Res. [score:1]
In accord with our previous findings (27), we demonstrated that 2′OMe AMO -mediated blocking of miR-19 significantly reduced the production of TNF-α induced by immunostimulatory ssRNA in WT BMMs. [score:1]
However, this effect of the miR-19a-3p 2′OMe was mostly retained in BMMs depleted of miR-19a-3p and miR-19b-3p, indicative of a miRNA-independent effect (Figure 1). [score:1]
To investigate the specific impact of miR-19 inhibition, relative to that of other members of the same cluster of miRNAs (miR-17-5p, miR-18a-5p and miR-92a-3p), we measured the inhibition of TLR7 signalling in primary mouse BMMs treated with specific 2′OMe AMOs. [score:1]
[1 to 20 of 13 sentences]
14
[+] score: 28
Other miRNAs from this paper: hsa-mir-17, hsa-mir-19a, hsa-mir-34a, mmu-mir-34a, mmu-mir-17
Similar to the previous results, SHK also down-regulated the expression of miR-19a in a dose-manner in BL cells, which negatively regulated the expression of PTEN. [score:9]
MiR-19a is one of the oncogenic miR-17-92-cluster members which is up-regulated by C-MYC and can cause the activation of the PI3K/AKT pathway through down-regulation of PTEN [9]. [score:7]
As shown in Fig.   3E,F, 10058-F4 inhibited the expression of both C-MYC and miR-19a. [score:5]
Apart from association with cell proliferation and growth, C-MYC ties up with a great number of micro -RNAs that function as oncogenes such as miR-19a [9] or tumor suppressor genes such as miR-34a [33]. [score:3]
Additionally, consistent with our previous findings in vitro, the miR-19a expression of the SHK group was remarkably lower than the control group (Fig.   5E). [score:3]
In this study, we found that SHK also induced a dose -dependent reduction of miR-19a for Namalwa cells (Fig.   3B). [score:1]
[1 to 20 of 6 sentences]
15
[+] score: 24
In contrast, expression of miR-19a and miR-20a was downregulated in mouse NS cell differentiation. [score:6]
The possible role of miR-19a on cell survival, may explain why this miRNA was upregulated at early stages after the induction of mouse NS cell differentiation. [score:4]
The onset of miR-19a expression correlates with induction of proliferation during the first 3 days of differentiation (data not shown). [score:3]
Curiously, miR-19a expression was mostly increased during the first 3 days of differentiation, gradually decreasing toward control levels. [score:3]
Expression of specific proapoptotic (miR-16, let-7a and miR-34a) and antiapoptotic miRNAs (miR-20a and miR-19a) were analyzed by quantitative Real Time-PCR from 10 ng of total RNA using specific Taqman primers and GAPDH for normalization. [score:2]
Only limited information is available regarding the physiological role of miR-19a. [score:1]
However, additional studies are required to determine the specific role of both miR-20a and miR-19a during cell differentiation, and also evaluate if their expression is restricted to a specific cell type. [score:1]
In addition, the expression of antiapoptotic miR-19a and 20a was also evaluated. [score:1]
miR-19a and miR-20a are members of the miR-17-92 cluster [61], which consists of seven mature miRNAs, previously linked to tumorigenesis. [score:1]
Further, miR-19 appears to affect the level of proapoptotic protein Bim, thereby preventing apoptosis and promoting cell survival. [score:1]
Recently, additional functions have been assigned to this cluster, particularly to miR-20a and miR-19a. [score:1]
[1 to 20 of 11 sentences]
16
[+] score: 21
Our results have shown that miR-17 and miR-19 directly inhibit Pparα expression in cystic kidneys, but whether reducing Pparα gene dosage is sufficient to promote cyst growth is not known. [score:6]
miR-17 and miR-19 binding to Pparα 3′-UTR lead to reduced Pparα expression, which in turn affects mitochondrial metabolism in kidney epithelial cells. [score:3]
Similarly, deleting the miR-19 binding site abolished miR-19 -mediated, but not miR-17 -mediated, repression. [score:1]
Luciferase reporter assays revealed that compared with scramble, both miR-17 and miR-19 mimics suppressed wild-type Pparα 3′-UTR. [score:1]
Both miR-17 and miR-19 repressed Pparα 3′-UTR. [score:1]
The seed sequences for the miR-17 and the miR-19 binding sites were mutated in the WT-Pparα 3′-UTR construct to produce the Pparα 3′-UTR (Δ17) and Pparα 3′-UTR (Δ19) constructs. [score:1]
The following miRNA mimics were purchased from Dharmacon, Inc (Thermo Fischer Scientific Inc) - miR-17 (catalogue # C-310561-07-0005), miR-19a (catalogue # C-310563-05-0005) and negative control or Scrambled (catalogue # CN-001000-01-05). [score:1]
To test whether the binding sites are functional, we co -transfected mIMCD3 cells with a luciferase reporter plasmid containing Pparα 3′-UTR and miR-17, miR-19, or scramble mimics (Fig. 8b). [score:1]
Deleting the miR-17 binding site prevented miR-17 -mediated, but not miR-19 -mediated, repression. [score:1]
mIMCD3 cells were co -transfected with this plasmid and scramble (scr, black), miR-17 mimic (red) or miR-19 mimic (blue) (n=3). [score:1]
Watson-Crick base-pairing between miR-17/ PPARΑ 3′-UTR and miR-19/ PPARΑ 3′-UTR is shown. [score:1]
mIMCD3 cells were plated in six-well dishes (2 × 10 [5] cells per well) and transfected with 0.4 μg of pLS-Renilla-3′-UTR plasmids, and 10 nM of miR-17 or miR-19a mimic. [score:1]
In the cytoplasm, the mature miRNAs (miR-17 and miR-19) bind to Pparα 3′-UTR. [score:1]
Pparα 3′-UTR harbours an evolutionarily conserved binding site for miR-17 and miR-19 families (Fig. 8a). [score:1]
[1 to 20 of 14 sentences]
17
[+] score: 20
[37] The upregulation of p38α (MAPK14) protein seen in the current human study may be owing to the decreased expression of miR-19a/b, members of the miR-17/92 cluster, or miR-185-5p, as they are predicted to target human MAPK14 (TargetScan release 7.0: http://www/targetscan. [score:12]
34, 45 A recent study of the miR-17/92 cluster and miR-106a/b has shown that miR-19 and miR-92a repress PTEN and TBR2, and suppress the transition from radial glial cells to intermediate progenitors, [46] and that miR-17 and 106a/b repress p38α (MAPK14), leading to increased neurogenic and suppressed gliogenic competences in mice. [score:5]
34, 35 The miR-17/92 cluster (Figure 3c) includes miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1. Therefore, we set out to precisely quantify the expression levels of those eight miRNAs (miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, miR-92a-1 and miR-106a/b), all of which belong to the miR-17 family or the miR-17/92 cluster, using real-time quantitative RT-PCR with U6 snRNA as an internal control probe. [score:3]
[1 to 20 of 3 sentences]
18
[+] score: 20
miR-31 (A), miR-17 (B) and miR-19a (C) expression in a panel of breast cancer cell lines. [score:3]
HER2 human epithelial growth factor receptor 2, neg negative We interrogated the relative expression of miR-31, miR-184, miR-17 and miR-19a in a panel of human breast cancer cell lines. [score:3]
miR-31 (D), miR-17 (E), and miR-19a (F) expression in murine tumour mo dels. [score:3]
HER2 human epithelial growth factor receptor 2, neg negativeWe interrogated the relative expression of miR-31, miR-184, miR-17 and miR-19a in a panel of human breast cancer cell lines. [score:3]
miR-17 and miR-19a were relatively evenly expressed across cell lines (Additional file 1: Figure S1B, C). [score:3]
We validated the expression of miR-31, miR-184, miR-17 and miR-19a in TEBs and ducts by quantitative RT-PCR (Fig.   1c). [score:3]
In addition, we also examined miR-17 and miR-19a, in these murine tumours. [score:1]
When we performed unsupervised hierarchical clustering (Fig.   1b), and miR-31 was tightly clustered to several members of the proto-oncogenic miR 17–92 cluster, such as miR-17, miR-18a and miR-19a. [score:1]
[1 to 20 of 8 sentences]
19
[+] score: 19
Importantly, the reduction of miR21, miR19a and miR203, and the increased expression of miR200a, miR200b and miR205 are compatible with a possible reduction in the metastatic potential of 940 cells upon ectopic expression of huΔNp63α, and may explain the indirect regulation of EMT-mediating transcription factors described above. [score:7]
We observed a significant reduction in the expression of miR21, miR34a, miR200c, miR203 and miR19a, whereas miR200a, miR200b and miR205 displayed increased expression in HuΔNp63α -expressing 940 cells (Fig. 2I). [score:7]
In the present study we show that the experimental deregulation of p63 levels promoted altered expression of various miRNA previously involved in EMT and tumor metastasis, including miR-21, miR-34a, miR-200a, miR-200b, miR-203, miR19a and miR205. [score:4]
These include miR21, miR200 family, miR34 family, miR130a, miR203, miR19a and miR205. [score:1]
[1 to 20 of 4 sentences]
20
[+] score: 19
The key reasons are as follows: Bim and Stat3 genes harbor miR-20a binding sites, and c-Kit and Socs3 genes harbor miR-19 binding sites, which are conserved across different phyla (ie, human, monkey, mouse, and rat) (Figures 8A, B and S7A, B); Bim is identified as direct targets of miR-17, 43, 44 miR-20a, [44] and miR-92a; [44] Stat3 is identified as direct targets of miR-17 45, 46 and miR-20a; 45, 46 Socs3 is identified as a direct target of miR-19a; [47] and Bim, Stat3, c-Kit, and Socs3 have been demonstrated to be implicated in the process of spermatogenesis. [score:10]
The miR-17-92 cluster and its 6 different mature microRNAs, including miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92a, play important roles in embryo development, immune system, kidney and heart development, adipose differentiation, aging, and tumorigenicity. [score:3]
Collins AS McCoy CE Lloyd AT miR-19a: an effective regulator of SOCS3 and enhancer of JAK-STAT signalling. [score:2]
The miR-17-92 gene cluster encodes 6 miRNAs of 4 miRNA families: the miR-17 family including miR-17-5p and miR-20a, the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and the miR-92 family. [score:1]
The 3’-UTRs of Bim and Stat3 mRNA contain complementary site for the seed region of miR-20a (Figure 8A and B), and the 3’-UTRs of c-Kit and Socs3 mRNA contain complementary site for the seed region of miR-19 (data not shown). [score:1]
[4] The miR-17-92 gene cluster encodes 6 miRNAs of 4 miRNA families: the miR-17 family including miR-17 and miR-20a, the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and the miR-92 family. [score:1]
Olive V Bennett MJ Walker JC miR-19 is a key oncogenic component of mir-17-92. [score:1]
[1 to 20 of 7 sentences]
21
[+] score: 19
Of these OncomiRs, the expression levels of miR-21, miR-155, miR-221/222, miR-17, miR-19a/19b, and miR-20a/20b were higher in OCI-Ly10 cells, whereas the expression levels of miR-21, miR-155, miR-125a-5p/125b, miR-146a/146b-5p, and miR-17 were higher in SUDHL-4 and DB cells (Figure 1C). [score:5]
Overexpression of miR-17~92 cluster (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) induces lymphoma [29]. [score:3]
A tandem sequence containing 10 copies of complementary sequences to the seed sequences of highly expressed OncomiRs (miR-21, miR-155, miR-221/222, miR-125a-5p/125b, miR-146a/146b-5p, miR-17, miR-19a/19b, miR-20a/20b) in DLBCL (Table 1) was generated and used as the encoding sequence for i-lncRNA. [score:3]
The expression levels of miR-21, miR-155, miR-221/222, miR-125a-5p/125b, miR-146a/146b-5p, miR-17, miR-19a/19b, and miR-20a/20b were significantly higher in the OCI-Ly10, SUDHL-4, and DB cells than in the IM-9 cells. [score:3]
Based on the mechanisms of miRNA functions, we selected those that are highly expressed in DLBCL, including miR-21, miR-155, miR-221/222, miR-125a-5p/125b, and miR-146a/146b-5p, as well as the miR-17-92 family members miR-17, miR-19a/19b, and miR-20a/20b; subsequently, we generated tandem sequences of 10 copies of the antisense sequences to these miRNA seed sequences and synthesized an interfering long non-coding RNA (i-lncRNA). [score:3]
The i-lncRNA-involved OncomiRs were not always decreased, miR-21 was decreased, miR-221 was increased, and the expression of miR-155, miR-17, miR-19a and miR-20a was not changed, compared with the control group. [score:2]
[1 to 20 of 6 sentences]
22
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
We have recently shown that HDI downregulated the expression of AID and Blimp-1 by upregulating miR-155, miR-181b, and miR-361, which silence Aicda mRNA, and miR-23b, miR-30a, and miR-125b, which silence Prdm1 mRNA, but not miR-19a/b, miR-20a, and miR-25, which are not known to regulate Aicda, Prdm1, or Xbp1 (16). [score:10]
The selectivity of HDI -mediated silencing of AICDA/Aicda and PRDM1/Prdm1 was emphasized by unchanged expression of HoxC4 and Irf4 (important inducers/modulators of AICDA/Aicda), Rev1 and Ung (central elements for CSR/SHM), and Bcl6, Bach2, or Pax5 (repressors of PRDM1/Prdm1 expression), as well as unchanged expression of miR-19a/b, miR-20a, and miR-25, which are not known to regulate AICDA/Aicda or PRDM1/Prdm1. [score:8]
[1 to 20 of 2 sentences]
23
[+] score: 17
Other miRNAs from this paper: mmu-mir-106a, mmu-mir-106b, mmu-mir-19b-2, mmu-mir-17, mmu-mir-19b-1
Treatment of SHH-MB with tiny LNAs directed against miR-17/20a/106b/93 and miR-19a/b-1 from the miR-17∼92 cluster family inhibits proliferation of SHH-MB in vitro and in vivo (Murphy et al., 2013). [score:4]
Analysis of the microRNAs expressed by the two clusters revealed that miR-19a and miR-19b-1 that share the same seed sequence are encoded only by the miR-17∼92 but not the miR-106b∼25 cluster (Fig.  10). [score:3]
Expression of miR-19a and miR-106b encoded by the miR-17∼92 cluster family in cerebella during embryogenesis. [score:3]
Fig. 1. Expression of miR-19a and miR-106b encoded by the miR-17∼92 cluster family in cerebella during embryogenesis. [score:3]
Purification of GNPs from P7 cerebella, RNA extraction from dissected embryonic and postnatal (P4 and P7) cerebella or from purified GNPs, and Q-RT-PCR for miR-19a and miR-106b were performed, as previously described (Uziel et al., 2005; Uziel et al., 2009). [score:1]
miR-19 is a key oncogenic component of mir-17-92. [score:1]
At E18.5, cerebella of all 4 genotypes were indistinguishable displaying the 5 cardinal lobes separated by four principal fissures (Fig.  2A–D) despite complete Cre -mediated recombination of the two miR-17∼92 alleles (supplementary material Fig. S1A) and reduced levels of miR-19a in cerebella of miR-17∼92c KO mice (supplementary material Fig. S1B, lane 2). [score:1]
Relative levels of mature microRNAs miR-19a (B) and miR-106b (C) were determined by Q-RT-PCR on total RNA extracted from total cerebella of wild-type mice (lanes 1–3) at E14.5 (lanes 1), E16.5 (lanes 2) and E18.5 (lanes 3). [score:1]
[1 to 20 of 8 sentences]
24
[+] score: 17
Furthermore, miR-19 targeting downregulates the expression of BIM, a proapoptotic gene, that has been described to be expressed under the control of 17~92 cluster in other malignancies [33]. [score:10]
SOCS-1 downregulation induces constitutive STAT3 phosphorylation, which is reversed when MM cell lines are transfected with anti miR-19. [score:4]
miR-19a and -19b have been identified as negative regulator of SOCS-1, a protein that controls IL-6 mediated signaling. [score:2]
Among others, cluster members include miR-19a, -19b, and miR-32. [score:1]
[1 to 20 of 4 sentences]
25
[+] score: 16
Accessing the detailed page, we further acquired that miR-19a regulates H3K4me3 states of the miR-17-92 cluster through directly targeting Egr2 and Jardi1b and influences DNA methylation of H3R8 and H4R3 by repressing PRMT5. [score:5]
Similarly, the epigenetic modifications that can affect miR-19a could be searched in the ‘Epigenetic Modification Affects miRNA Expression’ section. [score:3]
The searching result page shows nine records indicating that H3K4me3, H3K79me2, histone acetylation and DNA methylation can all affect miR-19a expression in diverse conditions (Figure 2b). [score:3]
To this end, we merged the aforementioned regulatory information and created a molecular network to reflect the interaction between miR-19a and diverse epigenetics (Figure 2c). [score:2]
Taking miR-19a as an example, we learned that miR-19a can both affect H3K4me3 states in human macrophage and control DNA methylation modification of human leukemia and lymphoma cells through querying in the ‘MiRNA Regulates Epigenetic Modifications’ section (Figure 2a). [score:2]
Figure 2. Searching result and integrated network of ‘miR-19a’. [score:1]
[1 to 20 of 6 sentences]
26
[+] score: 16
As shown in Figure 8C, 4/5 of the analyzed miRNAs (i. e., let-7a, miR-19a, miR-144 and miR-302b) were significantly differentially expressed in spontaneous and radio -induced MB, according to their deregulation at short-term post-irradiation. [score:4]
Furthermore, results from Murphy and colleagues [28], showed the therapeutic potential of 8-mer LNA-anti-miRs in inhibiting miR-17, 20a, 106b, and 93 (anti-miR-17) and miR-19a and 19b-1 (anti-miR-19) in two murine SHH -driven MB mo dels. [score:3]
In absence of irradiation, here we show no difference in expression levels of three miRNAs belonging to miR-17∼92 cluster (miR-17, miR-19a, miR-20a; Figure 7), although at P2/3 GCPs are actively proliferating. [score:3]
One miRNA was contra-regulated (mmu-miR-19a-5p). [score:2]
Notably, at short term after irradiation, their expression in Ptch1 [+/−] GCPs was significantly higher compared with WT cells and a higher expression of the miR-19a characterizes radio -induced compared with spontaneous tumors. [score:1]
Second, we analyzed 3 members of the 17∼92 cluster, i. e., miR-17, miR-19a, miR-20a, involved in cell survival and viability. [score:1]
One of the miRNAs of interest is miR19a-5p, belonging to one of the best-known miRNA clusters, the miR-17∼92, which encodes six miRNAs (i. e., miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1) [24]. [score:1]
Bonferroni post-hoc tests, for unirradiated conditions, did not show any significant difference between WT and mutant cells in miR-17 and miR-19a, while a mild significance is observable in miR-20a (P < 0.01). [score:1]
[1 to 20 of 8 sentences]
27
[+] score: 15
miRNAs that were downregulated during granulopoiesis, including miR-17, miR-19a and miR-20a, were amongst those previously shown to be upregulated in leukemia [48]. [score:7]
Several members of the polycistronic miR-17-92 cluster and the homologous miR-106a-92 cluster (miR-17, miR-19a, miR-20a, miR-92a and miR-106a) were expressed at the highest levels in promyelocytes (Figure 3B). [score:3]
Many miRNAs that we identified as being differentially expressed in granulopoiesis were not previously implicated in this process including miR-19a, miR-19b miR-24, miR-26a, miR-26b, miR-93, miR-106b, miR-191, miR-139-5p, miR-140 and miR-195 (Figures 2A and 3, Additional file 1). [score:3]
Amongst these are those differentially regulated in our study including miR-16, miR-19a, miR-26a, miR-26b, miR-139, miR-195 and miR-223. [score:2]
[1 to 20 of 4 sentences]
28
[+] score: 15
Other miRNAs from this paper: hsa-mir-19a, hsa-mir-106a, mmu-mir-106a, mmu-mir-106b, hsa-mir-106b
We previously reported that GSE down-regulated the miR-17-92 cluster host gene (MIR17HG) and miR-19a/b in various NSCLC (A549, H520, H1299) and bronchial premalignant cancer cells, leading to up-regulations of their downstream targets - tumor suppressors PTEN and IGF2R [8]. [score:11]
However, it is noteworthy that GSE did not significantly decrease MIR106B nor miR-106b expression in H520, a squamous cell carcinoma cell line, in contrast to what was observed with miR-19a/b. [score:3]
We recently reported that modulations of oncogenic microRNA (miRNA) or oncomir miR-19a/b, contributed to the antineoplastic properties of GSE against non-small cell lung cancer (NSCLC) and bronchial premalignant cells [8]. [score:1]
[1 to 20 of 3 sentences]
29
[+] score: 15
In addition to its oncogenic effects, the miR-19 regulon is reported to control NF-κB signaling by targeting members of the ubiquitin-editing protein complex in the cells stimulated with purified bacterial product (47), suggesting that targeting this miRNA regulon could regulate the activity of NF-κB signaling in inflammation. [score:6]
Lewis A, Mehta S, Hanna LN, Rogalski LA, Jeffery R, Nijhuis A, Kumagai T, Biancheri P, Bundy JG, Bishop CL, Feakins R, Di Sabatino A, Lee JC, Lindsay JO, Silver A 2015 Low serum levels of microRNA-19 are associated with a stricturing Crohn's disease phenotype. [score:3]
Huhn D, Kousholt AN, Sorensen CS, Sartori AA 2015 miR-19, a component of the oncogenic miR-17 approximately 92 cluster, targets the DNA-end resection factor CtIP. [score:3]
Gantier MP, Stunden HJ, McCoy CE, Behlke MA, Wang D, Kaparakis-Liaskos M, Sarvestani ST, Yang YH, Xu D, Corr SC, Morand EF, Williams BR 2012 A miR-19 regulon that controls NF-kappaB signaling. [score:1]
To date, no study has reported the role of the miR-19 regulon in the context of any virus -mediated inflammatory response. [score:1]
Genetic anatomization of the relative contribution of the individual miRNAs of this cluster has demonstrated that miR-19 recapitulated on its own the oncogenic effects of the full cluster (63). [score:1]
[1 to 20 of 6 sentences]
30
[+] score: 14
It is suggested that SMAD2/4 is regulated by miR-18 in neuroblastoma cells [66] and that SMAD4 is targeted by miR-19a/b in thyroid follicular cells [68]. [score:4]
One possible relevant difference between these two clusters is that miR-17-92, but not miR-106b-25, expresses members of the miR-19 and miR-18 families. [score:3]
Furthermore, the antiangiogenic proteins TSP11 and CTGF are both negatively regulated by miR-18 and miR-19 [58]. [score:2]
Both the evolutionary sequence analysis and the seed-sequence -based grouping partition these miRNAs into four families: the miR-106 family (miR-17, miR-20a/b, miR-106a/b, and miR-93), the miR-18 family (miR-18a/b), the miR-19 family (miR-19a/b-1/2), and the miR-92 family (miR-25, miR-92a-1/2, and miR-363). [score:1]
The six miRNAs can be grouped into four miRNA families based on their seed-sequence: the miR-17 family (miR-17 and miR-20a), the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and miR-92 family (miR-92a-1) [31, 34, 39]. [score:1]
It is tempting to speculate that loss of miR-19a, miR-19b, and miR-18 is significantly responsible for the phenotype caused by deletion of miR-17-92. [score:1]
In addition, it has been demonstrated that miR-18 and miR-19 repress the antiangiogenic factors TSP-1 and CTGF [51]. [score:1]
The primary transcript encodes six mature miRNAs: miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1 (Figure 2, Table 1). [score:1]
[1 to 20 of 8 sentences]
31
[+] score: 13
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-150, mmu-mir-206, mmu-mir-192, mmu-mir-126b
For example, Chen et al. [11] found that miR-19a and tumour necrosis factor-α (TNF-α) levels are markedly downregulated and upregulated, respectively, in active human UC and dextran sodium sulphate (DSS) -induced mouse experimental colitis; that miR-19a directly regulates TNF-α; and that miR-19a -inhibitor treatment markedly elevates the expression of the inflammatory factors TNF-α, interleukin-8 (IL-8), and granulocyte-macrophage colony-stimulating factor. [score:13]
[1 to 20 of 1 sentences]
32
[+] score: 13
HEK 293T cells were seeded onto 24-well plates for 12 h. Afterwards, 0.2 μg of firefly luciferase reporter plasmid; 0.2 μg of β-galactosidase expression vector (Ambion); 0.2 μg of expression vector pcDNA3.1 -overexpressing miR-17-92 cluster; empty vector pcDNA3.1; or 10-, 20-, 50-nM miR-17, miR-20a, miR-19a, and miR-19b mimics were transfected into the cells. [score:7]
org) bioinformatics tools, we found that among those miRNAs in miR-17-92 cluster, miR-19a/b may target CNTFR and miR-17, miR-20a, and miR-19a/b may target glycoprotein 130 (GP130), respectively (Fig.   2a, b). [score:5]
b Sequence alignment of mature miR-19a, miR-19b, miR-17, and miR-20a revealed their seed sequences that were reverse complementary to the seed-matched sequence within the 3′ UTR of mouse CNTFR or GP130, respectively. [score:1]
[1 to 20 of 3 sentences]
33
[+] score: 12
Indeed, some R1-miR19 displayed a relatively low body weight and a normal glucose regulation, whereas their respective R2-miR19 progeny displayed the full disorder (increased body weight, altered blood glucose levels and insulin tolerance). [score:2]
This phenomenon was made apparent by analysis of the progenies of individual R1-miR19 males crossed with control females, namely the R2-miR19 progenies (Fig. 4e). [score:1]
The R1-miR19 fathers and their respective R2-miR19 progenies are indicated by grey-filled or red-filled circles. [score:1]
At 16 weeks of age, two R1-miR19 male were crossed with females to obtain the R2-miR19 progeny. [score:1]
Further investigation on the miR-19 mice through the transcriptomic analysis of either early embryo and/or adipose-derived stem cells will provide additional insight into the mechanisms of miR-19 action and will help to identify genes involved in the development of obesity and/or metabolic disorders at the very early stages of development. [score:1]
Indeed, it is interesting to note that some R2-miR19 mice developed the full miR19 phenotypes despite the normal metabolic features of their R1-miR19 progenitors. [score:1]
Strikingly, males and females born from miR19b-microinjected one-cell embryos (designated R1-miR19) had, in average, body weights greater than the controls (34.17g ± 6.5 vs. [score:1]
This individual variation was also evident in R1-miR19 mice. [score:1]
None of the R1-miR19 mice, however, showed increased values of fasting glucose levels (Fig. 4c), which is at odds with the more complete pathology observed for the WD series, but is similar to the R1-sperm injected progenies and to the previously published reports of metabolic alterations without overt diabetes 10. [score:1]
By quantitative RT-PCR analysis, we confirmed the deregulation of miR-182, miR-19a, miR-19b, miR-29a and miR-340 in testis and sperm RNA of the WD males compared to SD males (Table 1). [score:1]
Theses results suggest that upon RNA injection, epigenetic changes take place which can remain phenotypically silent but are later transmitted to the progeny (R2-miR19 obese males were born from R1-miR19 normal males) (Fig. 4). [score:1]
[1 to 20 of 11 sentences]
34
[+] score: 12
0023837.g005 Figure 5(A) No change in relative luciferase activity of p50-3′UTR (bearing no predicted recognition site for miR-125b or miR-150) in cells co -transfected with pre- miR-125b and pre-miR-150 compared to cells co -transfected with empty vector U61; (B) RT-PCR showing (i) reduction in p53 mRNA in cells expressing exogenous pre-miR-150 and pre-miR-125b compared to cells expressing empty vector U61, (ii) no reduction in p53 mRNA in cells expressing exogenous pre-miR-19a and pre-miR-146a compared to cells expressing empty vector U61. [score:6]
Although endogenous p53 level was decreased by over expressing miR-125b and miR-150, there was no change in p53 level either in the presence of exogenous miR-19a or miR-146a (negative control), which bears no predicted recognition site in the 3′UTR of p53 (Figure 5B ). [score:3]
Although endogenous p53 level was decreased by over expressing miR-125b or miR-150, there was no change in p53 level either in the presence of exogenous miR-19a or miR-146a (Figure 5B and 5C ). [score:3]
[1 to 20 of 3 sentences]
35
[+] score: 12
7 inhibited miR-19a at 95% and miR-92a at ~65% (Figure 10b). [score:3]
However, miR-19 and -92 appear to regulate thyroid and cervical vertebrae development (without fusion of the vertebrae) and mandible and head size (microcephaly) (Figure 13b). [score:3]
miR-19 expression was decreased in PMIS-miR-19-92 embryos but not in WT or PMIS-miR-17-18 (Figure 11b). [score:3]
Both miR-17 and miR-19 expression levels were decreased in the PMIS-miR-17-18-19-92 embryos compared with WT (Figure 11b). [score:2]
36, 37 As controls, the levels of m iR-23a, miR-200b and miR-19 were not affected by PMIS-miR-17-18. [score:1]
[1 to 20 of 5 sentences]
36
[+] score: 12
Also, miR-125a-5p/-351, miR-200c/-429, miR-106b/-17, miR-363/-92b, miR-181b/-181d, miR-19a/-19b, let-7d/-7f, miR-18a/-18b, miR-128/-27b and miR-106a/-291a-3p pairs exhibited significant synergy and their association to aging and/or cardiovascular diseases is supported in many cases by a disease database and previous studies. [score:5]
2013.125 24212931 42. van Almen GC Verhesen W van Leeuwen RE van de Vrie M Eurlings C Schellings MW MicroRNA-18 and microRNA-19 regulate CTGF and TSP-1 expression in age-related heart failureAging Cell. [score:4]
Moreover, the work of van Almen et al. [42] linked miR-19a and miR-19b with age-related heart failure. [score:1]
The same study validates the presence of miR-19b in the miR-19a/-19b pair which ranked second and both miRNAs were defined as age -dependent. [score:1]
We corroborate to this observation since the miR-19a/-19b and miR-18a/-18b pairs scored high in terms of synergy (2 [nd] and 7 [th] rank respectively) despite not participating in the consensus modules. [score:1]
[1 to 20 of 5 sentences]
37
[+] score: 12
Several down-regulated (i. e. miR-1, miR-7, miR-34a, miR-122, miR-125b, miR-200) or up-regulated (i. e. miR-17, miR-18, miR-19, miR-155, miR-93, miR-221/222) miRNAs have been identified as tumor suppressor or oncomirs, respectively, by targeting and regulating genes involved in cell proliferation, apoptosis, angiogenesis and metastasis [13]. [score:12]
[1 to 20 of 1 sentences]
38
[+] score: 11
Mir-19a, which is also predicted to inhibit SOCS1, has been shown to decrease SOCS3 expression and subsequent IFN-α and IL-6 signaling by regulating the JAK-STAT pathway (180). [score:5]
Other miRNAs are predicted to bind SOCS1, including mir-150 (172), mir-221 (173), mir-572 (174), and mir-19a (175); upregulation of these miRNAs correlates with increased inflammation. [score:4]
miR-19a: an effective regulator of SOCS3 and enhancer of JAK-STAT signalling. [score:2]
[1 to 20 of 3 sentences]
39
[+] score: 11
In HepG2 cells, miR-192, miR-204, miR-18, miR-19 and miR-211 could down-regulate HOTTIP expression (all P<0.05). [score:6]
All miRNA mimics (miR-138, miR-18, miR-192, miR-215, miR-19, miR-204 and miR-211), miRNA inhibitors(miR-192 and miR-204) and small interfering RNA (siRNA) duplexes (siHOTTIP-1 and siHOTTIP-2) were products of Genepharma (Shanghai, China). [score:3]
20 nmol/L mimics of miR-138, miR-18, miR-192, miR-215, miR-19, miR-204, and miR-211, two HOTTIP siRNAs (siHOTTIP-1 and siHOTTIP-2)or NC RNA were transfected into SMMC7721,HepG2 and Hep3B HCC cells. [score:1]
* MicroRNAs Seed position Conservation Primates Mammals Other Vertebrates miR-138 chr7:27245289 89% 30% 0% miR-18 chr7:27238346 89% 30% 0% miR-192/215 chr7:27241747 89% 91% 77% miR-19 chr7:27245115 100% 0% 0% miR-204/211 chr7:27245995 89% 43% 0%*Data from miRcode (http://www. [score:1]
[1 to 20 of 4 sentences]
40
[+] score: 11
Moreover, we detected some other documented oncogenic microRNAs including miR-9 and miR-19a, and tumor suppressing microRNAs including miR-28, miR-33a, miR-34a and miR-214, as well as their targets E-cadherin, PTEN, HoxB3, Pim, KIT and FGFR1, respectively [21– 26], to figure out the Res -induced microRNA expression profile. [score:7]
Here, we also showed that Res did not up-regulate oncogenic miR-9 and miR-19a in HCT-116 cells. [score:4]
[1 to 20 of 2 sentences]
41
[+] score: 11
In particular, miR-19 was reported to be upregulated in the Basal subtypes, miR-200c downregulated in Normal-like tumors and miR-223 downmodulated in luminal-B breast cancers [64]. [score:7]
miR-19a and miR-21 were highly expressed also in some stroma cells, in particular in activated dendritic cells (Figure 1C, log2 scale). [score:3]
All tumor cells resulted almost empty for miR-223 and miR-340, while showed variable levels for miR-200b and miR-203 and higher levels of miR-19 and miR-21. [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 11
All the members of the cluster were cloned from purified P6 SCs [14], in situ hybridization with LNA (Locked Nucleic Acid) on adult testes showed miR-17 and miR-20a expression in SCs [12], and ulterior analysis of the small RNA transcriptome of SCs purified from mice at postnatal day 6 revealed high levels of expression for miR-19a and miR-19b, intermediated levels for miR-17 and miR-20a and low levels for miR-18a and miR-92a [16]. [score:5]
As an example, despite the fact that the number of deregulated genes in the embryonic tail buds of mice harboring a homozygous deletion for the miR-17 seed family (~500) was lower than the observed in the same tissue of homozygous mutants for the miR-19 seed family (~700), skeletal malformations were observed in the former mice (defects in axial patterning regulation), but not in the latter ones. [score:3]
The miR-17-92 cluster, also known as Mirc1, is a polycistronic miRNA gene encoding six members (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) which are highly conserved in vertebrates and expressed in practically all tissues analyzed during embryonic and postnatal stages [5– 7]. [score:3]
[1 to 20 of 3 sentences]
43
[+] score: 10
miR-19a promotes cell growth and tumorigenesis through targeting SOCS1 in gastric cancer. [score:3]
miR-19, a component of the oncogenic miR-17~92 cluster, targets the DNA-end resection factor CtIP. [score:3]
miR-19a: An Effective Regulator of SOCS3 and Enhancer of JAK-STAT Signalling. [score:2]
Our calculation showed that each naïve B cell expresses 900–1,800 molecules of miR-17, miR-19, and miR-92 subfamily miRNAs, and 80 molecules of miR-18 subfamily miRNAs (Fig 3B and 3C and S7 Table). [score:1]
They fall into four miRNA subfamilies (miR-17, miR-18, miR-19, and miR-92 subfamilies), with members in each subfamily sharing the same seed sequence. [score:1]
[1 to 20 of 5 sentences]
44
[+] score: 10
Of the four miRNAs identified, miR-19a and miR-19b did not regulate ANO1, while miR-144 regulated ANO1 only indirectly as indicated by preliminary experiments (Supplementary Figs.   1– 6). [score:4]
Four miRNAs were predicted to target ANO1: miR-9, miR-19a, miR-19b, and miR-144. [score:3]
Additionally, we confirmed the specificity of the miR-9 mimic by quantifying the expression of other miRNAs (including miR-19a) by qRT-PCR (Supplementary Fig.   10). [score:3]
[1 to 20 of 3 sentences]
45
[+] score: 10
Other miRNAs from this paper: mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-130a, mmu-mir-186, mmu-mir-200b, mmu-mir-202, mmu-mir-30e, mmu-let-7d, mmu-mir-130b, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-192, mmu-mir-200a, mmu-mir-15a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-200c, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-466a, mmu-mir-467a-1, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-467b, mmu-mir-669c, mmu-mir-709, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-574, mmu-mir-466d, mmu-mir-467e, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-669e, mmu-mir-467g, mmu-mir-467h, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-21b, mmu-mir-130c, mmu-mir-21c, mmu-mir-30f, mmu-mir-466c-3
miR-19 has been reported to be downregulated by CsA in vitro[18] while miR-574 has been reported to be downregulated with acute rejection in human [19]. [score:7]
Two microRNAs—miR-19 and miR-574 have been reported to be related to CsA immunosuppression effect. [score:3]
[1 to 20 of 2 sentences]
46
[+] score: 9
Supporting in vitro and tissue level high expression of miR-17-5p, a clinical study proves serum levels of miR-17 along with miR-19a, miR-20a and miR-223 were significantly upregulated in CRC patients compared to controls [104]. [score:5]
In marked contrast, antisense oligonucleotides against miR-18a, miR-19a or miR-92-1 led to no or slight inhibition of cell growth, indicating that single miRNAs of the miR-17-92 cluster have distinct roles on cancer formation and progression. [score:3]
The miR-17-92 cluster transcript comprises six miRNAs - miR-17-5p, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1 - and is highly conserved among vertebrates [19, 20]. [score:1]
[1 to 20 of 3 sentences]
47
[+] score: 9
[44] Of particular note, a recent study revealed that HIF1α expression in EC promoted lesion formation by enhancing expression of proinflammatory microRNA-19a. [score:5]
Akhtar S Hartmann P Karshovska E Rinderknecht FA Subramanian P Gremse F Grommes J Jacobs M Kiessling F Weber C Steffens S Schober A Endothelial hypoxia-inducible factor-1α promotes atherosclerosis and monocyte recruitment by upregulating microRNA-19a. [score:4]
[1 to 20 of 2 sentences]
48
[+] score: 9
We evaluated the expression of PTEN and these miRs by real-time PCR, and we noticed that PTEN was lower-expressed (Fig. 1c), while miR-32-5p, miR-21-5p, miR-19a-3p, miR-92a-3p, and miR-486-5p were all highly-expressed in Bel/5-FU cells (Fig. 1d). [score:5]
Increasing evidence shows that PTEN -regulating miRs, such as miR-141-3p [10], miR-29a [11], miR-21 [12– 16], miR-19a [17], miR-92a [18], and miR-486 [19] contribute to anti-tumor treatment resistance. [score:2]
The relative expression of miR-32-5p, miR-21-5p, miR-19a-3p, miR-92a-3p, miR-486-5p and U6, PTEN, Twist, Snail, and GAPDH mRNA was measured with SYBR® Premix Ex Taq™ II (Perfect Real Time, Takara, Shiga, Japan) as previously described [8]. [score:1]
org databases) and literature review, we found that miR-32-5p, miR-19a-3p, miR-92a-3p, and miR-486-5p have complementary binding sites to the 3’-UTR of PTEN (Fig. 1b and Additional file 3). [score:1]
[1 to 20 of 4 sentences]
49
[+] score: 9
To address this issue, we first screened the miRNAs whose expressions are modulated in 4T1 cells by miRNA microarray analysis using both total cellular miRNA and exosomal miRNA after treatment with 100 μM of EGCG for 24 h. In brief, a set of miRNAs including let-7, miR-16, miR-18b, miR-20a, miR-25, miR-92, miR-93, miR-221, and miR-320 were up-regulated, and dozens of miRNAs including miR-10a, miR-18a, miR-19a, miR-26b, miR-29b, miR-34b, miR-98, miR-129, miR-181d were down-regulated in both total cellular and exosomal fraction by EGCG treatment (data not shown). [score:9]
[1 to 20 of 1 sentences]
50
[+] score: 9
Inhibition of miR-17 and miR-20a in cells overexpressing the miR-17-92 cluster can induce apoptosis, while inhibition of miR-18a and miR-19a did not have the same effect and inhibition of miR-92-1 resulted in only a modest reduction of cell growth [25]. [score:9]
[1 to 20 of 1 sentences]
51
[+] score: 9
The top-ranking biological networks associated with (A) miR-124, (B) miR-19, (C) miR-29 and (D) miR-20/17/106/93 predicted target genes are depicted. [score:3]
0044060.g004 Figure 4The top-ranking biological networks associated with (A) miR-124, (B) miR-19, (C) miR-29 and (D) miR-20/17/106/93 predicted target genes are depicted. [score:3]
The highest-ranking IPA networks associated with miR-124, miR-19, miR-29 and miR-20/17/106/93 predicted targets are depicted in Figure 4 and Figure S1. [score:3]
[1 to 20 of 3 sentences]
52
[+] score: 8
In addition to miR-720, many of the 68 miRNAs modulated by ADAM8 have been found to be upregulated in breast cancer or previously implicated in tumorigenesis (such as miR-19a, miR-106b, miR-181a-2, miR-30a, miR-93, miR-30d, and miR-10b) [37, 40, 75– 78]. [score:4]
Wang X Chen Z MicroRNA-19a functions as an oncogenic microRNA in non-small cell lung cancer by targeting the suppressor of cytokine signaling 1 and mediating STAT3 activationInt J Mol Med. [score:4]
[1 to 20 of 2 sentences]
53
[+] score: 8
Other miRNAs from this paper: mmu-mir-106b, mmu-mir-17
To evaluate how the loss of Dicer affects the expression of mature microRNAs, we determined the expression of miR-19a (from the miR-17~92 cluster) and miR-106b (from the miR-106b~25 cluster) in the developing cerebella of control and Dicer c KO embryos at E14.5, E16.5 and E18.5 by Q-RT-PCR (Fig 5B and 5C, lanes 1–6). [score:3]
Relative levels of mature microRNAs miR-19a (B) and miR-106b (C) were determined by Q-RT-PCR on total RNA extracted from total cerebella of control (lanes 1–3) and Dicer c KO (lanes 4–6) mice at E14.5 (lanes 1, 4), E16.5 (lanes 2, 5) and E18.5 (lanes 3, 6). [score:1]
Therefore deletion of Dicer resulted in a delayed decrease of miR-19a and miR-106b microRNAs with significant loss of those microRNAs at E16.5. [score:1]
In the present study, we used two of the microRNAs encoded by the miR-17~92 cluster family (miR-19a and miR106b) to determine the level of microRNA biogenesis. [score:1]
While the levels of miR-19a and miR-106b were not statistically different at E14.5 (Fig 5B and 5C, lane 1 versus lane 4), their levels were significantly reduced at E16.5 (Fig 5B and 5C, lane 2 versus lane 5, p = 0.0386 and 0.0001, respectively) and at E18.5 (Fig 5B and 5C, lane 3 versus lane 6, p = 0.0005 and 0.0005, respectively). [score:1]
Purification of GNPs from P7 cerebella, RNA extraction from dissected embryonic and P7 whole cerebella or from purified GNPs, and Quantitative-Reverse Transcriptase-Polymerase Chain Reaction (Q-RT-PCR) for miR-19a and miR-106b were performed, as previously described [26, 33]. [score:1]
[1 to 20 of 6 sentences]
54
[+] score: 8
But the relative expression levels of miR-18a, miR-19a, miR-19b-1, and miR-92a-1 did not show significantly changed after treatment with GEN (Figure 4). [score:3]
Figure 4 (A-F) represents relative expression level of miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1, respectively. [score:3]
Figure 2 (A-F) represents miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a and miR-92a-1, respectively. [score:1]
This cluster includes miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a-1 [13, 14]. [score:1]
[1 to 20 of 4 sentences]
55
[+] score: 8
The following synthetic miRNA mimics were used in this study: Mimic Transfection Control with Dy547 (cel-mir-67 conjugated with Dy547), Dharmacon CP-004500-01-10 miRIDIAN microRNA Mimic Negative Control #1 (cel-mir-67), Dharmacon CN-001000-01-10 miRIDIAN Mimic hsa-miR-17, Dharmacon C-300485-05-0005 miRIDIAN Mimic hsa-miR-18a, Dharmacon C-300487-05-0005 miRIDIAN Mimic hsa-miR-19a, Dharmacon C-300488-03-0005 miRIDIAN Mimic hsa-miR-20a, Dharmacon C-300491-03-0005 miRIDIAN Mimic hsa-miR-19b, Dharmacon C-300489-03-0005 hsa-miR-92a, custom synthesized by Shanghai GenePharma miRIDIAN Mimic hsa-miR-155, Dharmacon C-300647-05-0010 Generation of miR-17~92 -expressing lentivirus was previously described (Hong et al., 2010). [score:3]
The following synthetic miRNA mimics were used in this study: Mimic Transfection Control with Dy547 (cel-mir-67 conjugated with Dy547), Dharmacon CP-004500-01-10 miRIDIAN microRNA Mimic Negative Control #1 (cel-mir-67), Dharmacon CN-001000-01-10 miRIDIAN Mimic hsa-miR-17, Dharmacon C-300485-05-0005 miRIDIAN Mimic hsa-miR-18a, Dharmacon C-300487-05-0005 miRIDIAN Mimic hsa-miR-19a, Dharmacon C-300488-03-0005 miRIDIAN Mimic hsa-miR-20a, Dharmacon C-300491-03-0005 miRIDIAN Mimic hsa-miR-19b, Dharmacon C-300489-03-0005 hsa-miR-92a, custom synthesized by Shanghai GenePharma miRIDIAN Mimic hsa-miR-155, Dharmacon C-300647-05-0010 Transfection of miR-17~92-expresing plasmid was previously described (Xiao et al., 2008). [score:1]
At this transfection concentration, the cellular levels of miR-17 and miR-19 family miRNAs reached 10-fold of endogenous levels in 30 min post-transfection, peaked around 23-fold at 3–6 h, and started to decline afterwards (Figure 4A). [score:1]
For example, the probe mixture for the miR-17 subfamily contains probes for miR-17, miR-20a, miR-106a, miR-20b, miR-106b, and miR-93, the probe mixture for the miR-18 subfamily contains probes for miR-18a and miR-18b, the probe mixture for the miR-19 subfamily contains probes for miR-19a and miR-19b, and the probe mixture for the miR-92 subfamily contains probes for miR-92, miR-363, and miR-25. [score:1]
miR-17 and miR-20a belong to the miR-17 family, while miR-19a and miR-19b belong to the miR-19 family. [score:1]
Since cel-mir-67 is a C. elegans miRNA that has no homolog in mammalian species, we decided to perform the same experiments using microRNA-17~92 (miR-17~92), a miRNA cluster encoding six mature miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b, and miR-92). [score:1]
[1 to 20 of 6 sentences]
56
[+] score: 8
Other miRNAs from this paper: hsa-mir-19a
Accordingly, addition of IL-4 increased the expression of miR-19a and suppressed IL-10 also in-vitro. [score:5]
B cells of ovalbumin-sensitized mice expressed high levels of the micro RNA miR-19a in the intestinal mucosa, in parallel with low levels of IL-10 [49]. [score:3]
[1 to 20 of 2 sentences]
57
[+] score: 8
Bone morphogenetic protein receptor 2 (BMPR2) is known to be targeted by miR-19a, −20a and miR-25 [28] and predicted to be targeted by miR-455. [score:5]
miR-19a, −140, −150 and -26b are predicted to target white fat-related genes (BMP2 or BMPR2 or HOXC9) [39, 41] and therefore may have a role in selecting cell fate toward brown adipogenesis. [score:3]
[1 to 20 of 2 sentences]
58
[+] score: 8
21, 26 miRNA expression was increased between 5- and 16-fold upon transduction (miR-17 5.2-fold, miR-18a 2.1-fold, miR-19a 9-fold, miR-19b 10.6-fold, and miR-20a 15.8-fold). [score:3]
The polycistronic microRNA cluster miR-17∼92 encodes miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1. [13] Notably, miR-17∼92 -deficient mice suffer significant developmental cardiac defects and lung hypoplasia though interrogation of haematopoiesis identified isolated defects in B-lineage development. [score:3]
[19] It is interesting to note that while this effect, in MYC -driven lymphoma at least, is primarily mediated by miR-19 family members (miR-19a/b), we have identified principally a miR-17 family- (miR-17, miR-20a/b, miR-106a/b and miR-93) and miR-18 family(miR-18a/b) -driven effect in BCR-ABL -positive ALL on BCL2, indicating differences in pro- and anti-apoptotic functions of miR-17∼92 between the various cellular contexts. [score:1]
[19] Dissection of the miR-17∼92 cluster has demonstrated that miR-19 is both necessary and sufficient to abrogate apoptosis, at least in Myc -mediated lymphomagenesis most likely by repression of PTEN and BIM. [score:1]
[1 to 20 of 4 sentences]
59
[+] score: 7
Most importantly, one of the predicted targets of miR-19a and -19b is the tumor suppressor PTEN [48], which negatively controls proliferation of PGCs. [score:5]
MiR-19a and -19b may regulate PTEN dosage, and consequently regulate PGC proliferation. [score:2]
[1 to 20 of 2 sentences]
60
[+] score: 7
The type II TGF-β receptor, Tgfbr2, a predicted target of miR-17 and miR-19 group miRNAs [19], was upregulated at both the protein and mRNA levels (Fig.   3a, d). [score:6]
Olive V miR-19 is a key oncogenic component of mir-17-92Genes Dev. [score:1]
[1 to 20 of 2 sentences]
61
[+] score: 7
Chaudhry et al. reported that let-7e or c-Myc related miRNAs (miR-17-3p, miR-17-5p, miR-19a, and miR-142-5p) were downregulated after 3 h following 100 mGy acute dose in AG1522 normal human skin fibroblasts, but were upregulated after 3 h following 4 Gy acute dose [31]. [score:7]
[1 to 20 of 1 sentences]
62
[+] score: 7
Other miRNAs from this paper: mmu-mir-19b-2, mmu-mir-19b-1
[68] Micro -RNA (miR-19) directly downregulates TG2 expression and enhances the invasion of colorectal cancer cells. [score:7]
[1 to 20 of 1 sentences]
63
[+] score: 7
A spectrum of miRNAs including miR-337-5p, miR-17-1, miR-15a, miR-491-5p, miR-339, miR-337-3p, miR-241, miR-19a were predicted to down regulate oncogenic targets like TGFβ, BCLXW, BCL-Xl, STATs, c-MYC and SMAD (as represented by red lines). [score:4]
For example, miR-337-5p, miR-17-1, miR-15a, miR-491-5p, miR-339, miR-337-3p, miR-241, miR-19a were found to modulate oncogenic targets including TGFβ, STATs, c-MYC and SMAD. [score:3]
[1 to 20 of 2 sentences]
64
[+] score: 7
Three miRNAs (miR-126-3p, miR-221 and miR-200c) were exclusively up-regulated in thymocytes of DBA-1/J strain, and three others (miR-let-7e, miR-100 and miR-19a*) were exclusively up-regulated in the DBA-2/J strain. [score:7]
[1 to 20 of 1 sentences]
65
[+] score: 6
Moreover, the expression of the closely related family members miR-17 (which only differs from miR-20a by 2 nucleotides) and miR-19a (which only differs from miR-19b by one nucleotide) was not significantly changed, and might compensate for the reduction in miR-20a and miR-19b expression, respectively. [score:5]
MiR-92a [−/−] mice showed a moderate, but significant decrease in miR-19a, miR-19b, and miR-20a in the heart, whereas only miR-19b and miR-20a were significantly decreased in muscle and miR-18a was significantly reduced in skeletal tissue (Figure 1C, Figure S1A/B). [score:1]
[1 to 20 of 2 sentences]
66
[+] score: 6
Seventeen miRNAs were found which had 2-folds or greater differences in levels in VemR A375 melanoma cells as compared with parental A375 cells by microarray (Figure 1B and Supplementary Table S1), with 7 down-regulated miRNAs including miR-7 (40.3-fold), miR-18a-5p (5.2-fold), miR-19a-3p (3.6-fold), miR-20b-5p (3.4-fold), miR-17-5p (3.2-fold), miR-20a-5p (3.1-fold), and miR-19b-3p (2.8-fold) and 10 up-regulated miRNAs including miR-514a-3p (116-fold), miR-129-1-3p (87-fold), miR-509-3p (83-fold), miR-629-3p (22-fold), miR-937-5p (4.6-fold), miR-3960 (4.3-fold), miR-1915-3p (3.2-fold), miR-6090 (3.1-fold), miR-4281 (2.6-fold) and miR-4634 (2-fold). [score:6]
[1 to 20 of 1 sentences]
67
[+] score: 6
PAK2 is a target of miR-93 and miR-106a; PAK6 is a target of miR-19a and miR-19b [69]. [score:5]
As shown in Table 4, eight miRNAs were observed to belong to the miR-17 family; three miRNAs were identified to belong to the miR-19 family and three miRNAs to the miR-25 family; the miR-363-5p was found to belong to the miR-363 family, but its sequence was similar in part to that of miR-25 family members (Table 3). [score:1]
[1 to 20 of 2 sentences]
68
[+] score: 6
Recent reports also demonstrated that Sp1 promotes other miRNA gene expression such as miR-19a, and Sp1 was also regarded as an upstream factor of miR-19a mediated down-regulation of RHOB and promotion of pancreatic cancer [25]. [score:6]
[1 to 20 of 1 sentences]
69
[+] score: 6
Increased expression of miR-17-92 cluster is usually associated with oncogenesis, cell growth and proliferation, while decreased expression of miR-19 and other members of the miR-17-92 cluster are generally associated with cellular senescence [48]– [50]. [score:5]
The miR-17–92 cluster is comprised of 6 miRNA genes: miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92–1, all of which are located on chromosome 14 in the mouse. [score:1]
[1 to 20 of 2 sentences]
70
[+] score: 6
Other miRNAs from this paper: hsa-mir-19a, hsa-mir-92a-1, mmu-mir-92a-1, hsa-mir-421, mmu-mir-421
Similar results were obtained with miR-19a-5p, a member of the miR-17-92 cluster, known to be upregulated by MYC/MYCN [32], whereas another member of the miR-17-92 cluster, namely miR-92a-1-5p, or DKK3, another MYCN regulated gene [33] were not regulated by ATM silencing in SK-N-SH or CLB-Ga cells as assessed by real-time quantitative PCR (Supplementary Figure S5). [score:6]
[1 to 20 of 1 sentences]
71
[+] score: 6
The mir-17 family is the one most enriched (p = 3.24 E-4; Table S6) and comprises mir-17, mir-18a, mir-19a, mir-20a, mir-19b-1 and mir-92-1. This family is expressed as polycistronic units, revealing a common regulatory mechanism [62], that is confirmed by the similarity of their expression profiles (Figure 4 D). [score:6]
[1 to 20 of 1 sentences]
72
[+] score: 5
Relevant to polyQ-ATXN1 cytotoxicity, Lee et al. found that ATXN1 levels might be post-transcriptionally regulated by miRNA, specifically miR-19, miR-101, and miR-130. [score:2]
miR-19, miR-101 and miR-130 co-regulate ATXN1 levels to potentially modulate SCA1 pathogenesis. [score:2]
When miR-19, miR101, and miR130 were transfected into HEK293T, HeLa and MCF7 cells, a marked decrease in ATXN1 levels was observed. [score:1]
[1 to 20 of 3 sentences]
73
[+] score: 5
miR-19 was found to be the principal oncogenic component of this cluster, targeting the tumour suppressor PTEN [13]. [score:5]
[1 to 20 of 1 sentences]
74
[+] score: 5
MicroRNA-19a mediates the suppressive effect of laminar flow on cyclin D1 expression in human umbilical vein endothelial cells. [score:4]
A miR-19 regulon that controls NF-kappaB signaling. [score:1]
[1 to 20 of 2 sentences]
75
[+] score: 5
Furthermore, the miR-19a/b family regulates cardiac hypertrophy and survival by repressing the target genes atrogin-1 and MuRF-1 (35). [score:4]
MicroRNA-19b (miR-19b) is part of the miR-17–92 cluster, which encodes miR-17, miR-18a, miR-19a, miR-19b, miR-20a and miR-92a-1. The miR-17–92 cluster is required to induce cardiomyocyte proliferation in postnatal and adult hearts (4). [score:1]
[1 to 20 of 2 sentences]
76
[+] score: 5
Pezzolesi MG Platzer P Waite KA Differential expression of PTEN -targeting microRNAs miR-19a and miR-21 in Cowden syndromeAm J Hum Genet. [score:5]
[1 to 20 of 1 sentences]
77
[+] score: 5
The expression of these miRNAs were therefore determined in both p100+/+ and p100−/− cells, and the expression of miR-302a, miR-302b and miR-302d was found to be significantly decreased in p100−/− cells, whereas there was no observable difference on miR-17, miR-19a, miR-20a and miR-106b between p100+/+ and p100−/− cells (Figure 4E). [score:5]
[1 to 20 of 1 sentences]
78
[+] score: 5
However, although TLR2 is targeted by several human miRNAs including miR-105, miR-19, miR-1225-5p, miR-143 and miR-154 in a variety of cell types [38– 42], no viral miRNA has been shown to target TLR2—until now. [score:5]
[1 to 20 of 1 sentences]
79
[+] score: 5
All of these miRNAs are up-regulated in iPS cells, indicating the importance of miR-17 and miR-19 in the activation and maintenance of iPS pluripotency (Table 1). [score:4]
Among 82 pre-miRNAs for these 73 mature miRNAs, which are commonly involved for activation and maintenance, we found all 7/8 members of the miR-17 family, all 3/3 members of the miR-19 family, 6/6 miRNAs in the cluster of miR-17-92 and 3/3 miRNAs in the cluster of miR-106-93. [score:1]
[1 to 20 of 2 sentences]
80
[+] score: 5
Whether miRNA species such as miR-19a are truly kidney specific or represent liver toxicity prognosis markers is an important area for further development. [score:2]
This is supported by the case reported in this paper, which demonstrated a decrease in miR-19a before serum creatinine was elevated. [score:1]
In the present study the performance of the leading miRNA, miR-19a, was modest with regard to separating liver injury from liver and kidney injury (ROC-AUC 0.76). [score:1]
In line with the array data, both miR-382-5p and miR-19a substantially decreased in concentration and, interestingly, they remained below the hospital admission level (Fig. 6C,D). [score:1]
[1 to 20 of 4 sentences]
81
[+] score: 4
For example, in this study we screened miRNAs that have been reported to be upregulated in IBD, including miR-223, miR-21, miR-155, miR-19a, miR-101, miR-594, and miR-16. [score:4]
[1 to 20 of 1 sentences]
82
[+] score: 4
Impressively, we found that although several members of the miR-17-92 cluster (miR-17, miR-18a, miR-19a, miR-20a), miR-146a, and miR-101a were not changed in purified splenic B cells, they were significantly upregulated in splenic T cells (Fig. 3). [score:4]
[1 to 20 of 1 sentences]
83
[+] score: 4
In addition, the miR-17-19 cluster, which comprises seven miRNAs (miR-17-5p, miR-17-3p, miR-18, miR-19a, miR-20, miR-19b, and miR-92-1) and promotes cell proliferation in various cancers, has been demonstrated to be significantly upregulated at the clonal expansion stage of adipocyte differentiation. [score:4]
[1 to 20 of 1 sentences]
84
[+] score: 4
The miR-17-92 (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a) cluster was previously described to be regulated by cell cycle via E2F3 binding and by a negative feedback loop through miR-17 that targets E2F2 (ref. [score:4]
[1 to 20 of 1 sentences]
85
[+] score: 4
For example, three of the Treg-enriched miRNAs, miR-17-3p, miR-19a-5p and miR-19b-5p are all predicted to target numerous signalling molecules, including multiple MAP kinases, serine/threonine kinases and phosphatases, as well as various transcription factors and cell cycle regulators. [score:4]
[1 to 20 of 1 sentences]
86
[+] score: 4
Some up-regulated miRNAs such as miR-19a, miR-24 and miR-128a were unchanged at the level of their primary transcripts. [score:4]
[1 to 20 of 1 sentences]
87
[+] score: 4
Recently it has been demonstrated that astrocytes secrete exosomes containing miR-19a, which regulates PTEN expression in brain tumor cell, thus influencing the outgrowth of brain metastases [11]. [score:4]
[1 to 20 of 1 sentences]
88
[+] score: 4
However, inspection of the human IRF8 3′UTR revealed potential target sites for multiple miRNAs, including miR-130a, miR-19a and miR-19b, which are differentially regulated in mouse pDCs and cDCs (results herein). [score:4]
[1 to 20 of 1 sentences]
89
[+] score: 4
MicroRNAs like miR-19a, 34b, 129, 135a, 142-3p, miR-153, miR-186, miR-187, and miR-301a were significantly downregulated in Cs1-ko mice. [score:4]
[1 to 20 of 1 sentences]
90
[+] score: 4
In addition, 7 microRNAs of the 17~92 and paralog 106b~25 clusters (namely miR-19a, miR-19b, miR-20a, miR-25, miR-92, miR-93 and miR-106b) were identified among the 53 most expressed microRNAs (groups A and B, see Table 1). [score:3]
Considering the role of the miR-19~92 cluster in lymphocyte development and proliferation, it is tempting to speculate that its expression may be related to the greater proliferative potential and memory precursor-like capacity, characteristic of central memory cells compared to more differentiated subsets (in particular late effector memory cells). [score:1]
[1 to 20 of 2 sentences]
91
[+] score: 3
A previous study has indicated that the expression of miR-144-5p, miR-144-3p, miR-142-5p, and miR-19a-3p in whole blood extends the lifespan of rats for 2 weeks after radiation [13]. [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
MiR-19, which is a component of the miR-17/Oncomir-1 miR polycistron, interferes with the expression of the antiapoptotic Ras homolog B (rhoB). [score:3]
[1 to 20 of 1 sentences]
93
[+] score: 3
Real-time PCR analyses showed a significant decrease of miR-17, miR-18a, miR-20a and miR-92a in bone tissues, reduction of all family members in bone marrow and reduced expression of miR-17, miR-18a, miR-19a, miR-20a and miR-92a could be observed in BMMSCs (Fig. 4A-C). [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
Meanwhile, the expression of miR-21, miR-10a, miR-126, miR-10b, miR-19a, miR-19b was significantly increased after adding into HUVECs culture, suggesting that HUVECs might release these miRs (Table 1). [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 3
Thus, in different stages of the lung development, Prdx6 may show different functions which are mainly determined by mmu-mir-503 and mmu-mir-19a, respectively. [score:2]
Gene Prdx6 is involved in one circuit in the early stage (IRF1~mmu-mir-503~Prdx6), while involved in the other two circuits containing the same miRNA (MYC~mmu-mir-19a~Prdx6, IRF1~mmu-mir-19a~Prdx6) in the late stage. [score:1]
[1 to 20 of 2 sentences]
96
[+] score: 3
Significant differences in miR-19a expression emerged between radio -induced and spontaneous MB in our previous work [23]. [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
miR-17 and miR-20a belong to a group of commonly overexpressed miRNAs, the miR-17∼92 cluster, which is located on mouse chromosome 14 (13 in humans) and comprises 7 mature miRNAs (miR-17-5p and, miR-18a, miR-19a and b, miR-20a, and miR-92a). [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
In contrast, miR-18a, miR-19a, miR-19b and miR-20a expression levels were significantly lower in PMBL than in DLBCL. [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
Other miRNAs from this paper: mmu-mir-146a, mmu-mir-432
Delayed cell cycle progression in STHdh/Hdh cells, a cell mo del for Huntington's disease mediated by microRNA-19a, microRNA-146a and microRNA-432. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
The miRNAs that contributed most prominently to PC1 (human - mouse split) were miR-93 and miR-19a, with a lesser contribution from miR-19b, miR-20a and miR-130b, while the miRNAs that contributed most significantly to PC2 (MYCN high versus low expression) were miR-17, miR-25, miR-20b and miR-15b. [score:3]
[1 to 20 of 1 sentences]