sort by

75 publications mentioning mmu-mir-100

Open access articles that are associated with the species Mus musculus and mention the gene name mir-100. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 300
Other miRNAs from this paper: mmu-mir-142a, mmu-mir-151, mmu-mir-195a, mmu-mir-195b, mmu-mir-142b
Consistently, restoration of miR-100 expression, like knockdown of Rac1 and ICMT, significantly reduced MMP2 activity (Figure 4E, upper panel and Supplementary Figure 7B), while overexpression of constitutively active Rac1 (Q61L) attenuated the inhibitory effect of miR-100 on MMP2 activity (Figure 4E, lower panel). [score:8]
Furthermore, polo-like kinase 1 (PLK1), mechanistic target of rapamycin (mTOR), insulin-like growth factor 1 receptor (IGF1R), FK506 binding protein 51 (FKBP51), insulin-like growth factor 2 (IGF2) and homeobox A1 (HOXA1) have been identified as direct targets of miR-100 [6- 11], which mediate the growth -inhibitory or apoptosis-promoting effects of miR-100. [score:8]
In this study, overexpression of miR-100 or knockdown of its target genes Rac1 and ICMT significantly reduced the level of phosphorylated Akt, and inhibition of PI3K/Akt by LY294002 attenuated the anti-miR-100-enhanced MMP2 activity. [score:8]
These findings provide a novel mechanistic insight into the role of miR-100 in suppressing metastasis, highlight the significance of miR-100 downregulation in HCC progression and implicate miR-100 as a potential therapeutic target for HCC. [score:8]
In the present study, we showed that expression of miR-100 was significantly decreased in HCC with metastatic potential, and both in vitro and in vivo studies disclosed that the restoration of miR-100 expression dramatically inhibited the metastatic capacity of HCC cells. [score:7]
Because activation of PI3K/Akt pathway may enhance MMP2 expression [24], which is essential for cell invasion by degrading extracellular matrix, we therefore examined whether the suppression of Rac1 by miR-100 could result in inhibition of Akt and consequently reduced MMP2 activity. [score:7]
It has been shown that reduced expression of miR-100 is correlated with higher incidence of lymph node metastasis and poor survival of HCC patients [12] and miR-100 inhibits cell growth and induces apoptosis by targeting PLK1 in HCC cells [12, 13]. [score:7]
First, both gain- and loss-of function analyses revealed that miR-100 directly suppressed the expression of Rac1 and its upstream regulator ICMT, and the level of miR-100 was negatively correlated with the level of Rac1 in mouse xenograft and human HCC tissues. [score:7]
miR-100 suppresses metastasis of HCC cells in vitro and in vivoTo explore the significance of miR-100 downregulation in HCC development, the correlation between miR-100 level and the clinical features of HCC patients was first analyzed. [score:7]
miR-100 directly inhibits the expression of Rac1 and ICMT. [score:6]
Taken together, miR-100 may negatively regulate the ICMT-Rac1 signaling and therefore inhibit metastasis of HCC cells by suppressing lamellipodia formation and MMP2 activation (Figure 4G). [score:6]
We find that miR-100 promotes the autophagy of HCC cells by inhibiting the expression of mTOR and IGF-1R [14]. [score:5]
These findings indicate that miR-100 may negatively regulate the expression of Rac1 and ICMT by directly binding to their 3′-UTRs. [score:5]
The levels of mature miR-100 were analyzed using qPCR, and the minimum P-value approach was used to choose the cutoff point for separating the miR-100-low expression and miR-100 -high expression groups. [score:5]
Silencing of either Rac1 or ICMT significantly suppressed in vitro migration and invasion of QGY-7703 cells, which phenocopied the effect of miR-100 overexpression (Figure 3A-C). [score:5]
In agreement with the above results, antagonism of endogenous miR-100 by anti-miR-100 led to an increase in MMP-2 level (Figure 4F, lanes 1 and 2), while LY294002, a specific inhibitor of PI3K, abolished the stimulatory effect of anti-miR-100 in MMP2 expression (Figure 4F). [score:5]
To identify the downstream molecules responsible for the anti-metastasis function of miR-100, the putative targets of miR-100 were predicted using TargetScan (Release 4.2) and MiRanda databases (August 2010 release). [score:5]
To generate the miR-100 lentiviral expression vector (pCDH-miR-100), a 402-bp genomic fragment that encompassed the corresponding miR-100 precursor and its 5′- and 3′-flanking sequences was inserted into the EcoRI and BamHI sites of pCDH-CMV-MCS-EF1-copGFP (System Biosciences), a lentiviral vector that expresses fluorescent copGFP. [score:5]
Moreover, expression of constitutively active Rac1 (Q61L) attenuated the inhibition of miR-100 on MMP2 activity. [score:5]
The QGY-7703 or Hepa1-6 sublines, which stably expressed miR-100 (QGY-miR-100 or Hepa-miR-100), and the matched control lines (QGY-Ctrl or Hepa-Ctrl) were established using lentiviral expression system as described [14]. [score:5]
To explore the significance of miR-100 downregulation in HCC development, the correlation between miR-100 level and the clinical features of HCC patients was first analyzed. [score:5]
Figure 4(A) Restoration of miR-100 expression suppressed lamellipodia formation. [score:5]
Downregulation of miR-100 is a prevalent event in various types of cancers. [score:4]
These data suggest that miR-100 downregulation may contribute to HCC metastasis. [score:4]
Rac1 and ICMT are direct targets of miR-100. [score:4]
MicroRNA-100 (miR-100) is frequently downregulated in multiple malignancies. [score:4]
Collectively, both in vitro and in vivo studies indicate that miR-100 is able to repress metastasis of HCC cells and its downregulation may facilitate HCC metastasis. [score:4]
To further elucidate the role of miR-100 in HCC metastasis, the miR-100 stable -expressing cell lines were established using mouse Hepa1-6 and human QGY-7703 cells (Supplementary Figure 1 and 2A). [score:3]
Rac1 expression was quantified based on immunohistochemical staining and miR-100 levels were detected by qPCR. [score:3]
Our data clearly suggest that miR-100 may inhibit the migration, invasion and metastasis of HCC cells and is therefore a potential candidate for anti-metastasis therapy. [score:3]
Third, the constitutively active form of Rac1 antagonized the anti-metastatic effect of miR-100 overexpression. [score:3]
All miRNA mimic, small interfering RNA (siRNA) duplexes and miR-100 inhibitor were purchased from GenePharma (Shanghai, China). [score:3]
In order to validate whether miR-100 could inhibit metastasis of HCC cells in vivo, Hepa-Ctrl (control) and Hepa-miR-100 cells were implanted into murine livers. [score:3]
Further investigation revealed that reintroduction of miR-100 diminished the endogenous expression of both Rac1 and ICMT proteins (Figure 2C), while inhibition of endogenous miR-100 increased the level of Rac1 and ICMT (Figure 2D). [score:3]
These data imply that miR-100 may abrogate MMP2 activation, at least partially through suppression of Rac1-Akt signaling transduction. [score:3]
miR-100 inhibits lamellipodia formation and MMP2 activity of HCC cells. [score:3]
Upper panel, effect of miR-100 and its target genes on MMP2 activity. [score:3]
Mechanism investigations revealed that miR-100 suppressed metastasis of HCC cells by targeting the ICMT-Rac1 signaling. [score:3]
Second, inhibition of the ICMT-Rac1 signaling by miR-100 attenuated lamellipodia formation and MMP2 activation, which are the essential events for the migratory and invasive activity of tumor cells. [score:3]
miR-100 exerts its anti-metastasis function by suppressing the ICMT-Rac1 signaling. [score:3]
The inhibitor of miR-100 (anti-miR-100) had a sequence complementary to the mature miR-100. [score:3]
QGY-7703 cells were co -transfected with NC or miR-100 and the Rac1 (Q61L) expression plasmid for 48 hours, then applied to F-actin staining. [score:3]
Briefly, lentiviruses were generated by transiently co-transfecting HEK293T cells with the lentiviral expression vector (pCDH-miR-100 or pCDH-CMV-MCS-EF1-copGFP, System Biosciences, CA, USA) and packaging plasmid mix (Lenti-X HTX Packaging Mix, Clontech, CA, USA) using calcium phosphate precipitation. [score:3]
miR-100 suppresses metastasis of HCC cells in vitro and in vivo. [score:3]
As shown, the level of phosphorylated Akt was remarkably reduced in QGY-7703 cells transfected with either miR-100 or siRNA targeting Rac1 or ICMT (Figure 4D, left panel), whereas the phosphorylated Akt was elevated when endogenous miR-100 was antagonized in SMMC-7721 cells (Figure 4D, right panel). [score:3]
Association of miR-100 Expression with Clinical Features [a]. [score:3]
Stable expression of miR-100 in Hepa1-6 (Hepa-miR-100) led to substantial reduction in the number of cells that migrated and invaded through the transwell chamber (Figure 1B and C). [score:3]
In this study, we identified miR-100 as a novel suppressor of the Rac1 signaling and HCC metastasis, based on the following evidences. [score:3]
miR-100 inhibits metastasis of HCC cells. [score:3]
QGY-7703 cells in a 48-well plate were co -transfected with 20 nM of miR-100 or NC duplex, 10 ng of psiCHECK2 luciferase reporter plasmids that contained either wild-type or mutant 3′-UTR of the target genes. [score:3]
The restoration of miR-100 expression significantly repressed the in vitro migration and invasion and the in vivo metastasis of HCC cells. [score:3]
Moreover, the level of miR-100 was negatively related to the expression of ICMT and Rac1 in tumor tissues (Figure 2E-G). [score:3]
Hepa1-6 cells with stable expression of miR-100 (Hepa-miR-100) and control cells (Hepa-Ctrl) were added to transwell chamber without (B, 5×10 [4]) or with (C, 1×10 [5]) Matrigel coating. [score:3]
To evaluate whether ICMT and Rac1 were functional targets of miR-100, siRNA targeting ICMT or Rac1 was transfected into QGY-7703 cells (Supplementary Figure 4). [score:3]
Furthermore, wound healing scratch test revealed that introduction of miR-100 also suppressed the mobility of HCC cells in a two dimensional way (Supplementary Figure 2D). [score:3]
On the other hand, introduction of constitutively active Rac1 (Q61L) [21] into QGY-7703 cells (Supplementary Figure 6) attenuated the suppressive effect of miR-100 on cell migration and invasion (Figure 3D and E). [score:3]
Furthermore, the Kaplan-Meier plots revealed that reduced miR-100 expression was related to shorter recurrence-free survival of HCC patients (Figure 1A). [score:3]
As shown, suppression of endogenous miR-100 by anti-miR-100 enhanced both the migratory and invasive ability of SMMC-7721 cells (Figure 1D and E). [score:3]
The decreased miR-100 expression was significantly associated with venous invasion, advanced TNM stage, tumor nodule without complete capsule and poorer cell differentiation (Table 1). [score:3]
Additionally, constitutively active Rac1 could abrogate the miR-100 -induced suppression of lamellipodia formation (Figure 4C). [score:3]
miR-100 has been reported to inhibit the growth and promote the apoptosis and autophagy of HCC cells [12- 14]. [score:3]
Dual-luciferase reporter analysis revealed that co-transfection of miR-100 significantly suppressed the activity of renilla luciferase with wild-type 3′-UTR of Rac1 or ICMT, whereas this effect was attenuated when the predicted miR-100 binding sites were mutated (Figure 2A and B). [score:3]
miR-100 inhibits growth of bladder and breast cancer cells [6, 7], promotes apoptosis of acute lymphoblastic leukemia, cervical and lung cancer cells [8- 10], and enhances chemotherapeutic sensitivity in ovarian cancer cells [11]. [score:3]
Subsequent mechanism investigations revealed that miR-100 exerted its anti-metastasis function by directly repressing the expression of ICMT and Rac1, and consequently abrogating the Rac1 signaling. [score:2]
In this study, we provide further evidence to support miR-100 as an anti-metastatic miRNA in HCC, which expand our understanding about the regulatory network of miR-100 and the mechanisms of HCC metastasis. [score:2]
QGY-7703 cells that were co -transfected with NC or miR-100 and the Rac1 (Q61L) expression plasmid were submitted to in vitro migration (D, 3.5×10 [4]) and invasion (E, 7.5×10 [4]) assays. [score:2]
qPCR analysis for miR-100 expression was performed on a LightCycler 480 (Roche Diagnostics, Mannheim, Germany) using a TaqMan MicroRNA Assay kit (Applied Biosystems, CA, USA). [score:2]
Mutations were generated in the complementary site that binds to the seed region of miR-100. [score:2]
In recent years, important advances have been made in exploring the regulatory function of miR-100 in cell proliferation and apoptosis. [score:2]
To date, most publications have focused on exploring the regulatory function of miR-100 in cell proliferation and cell death [6- 14]. [score:2]
These data imply that miR-100 may attenuate MMP2 activity, at least partially, through Rac1-Akt pathway. [score:1]
In the present study, we further showed that miR-100 displayed more pronounced reduction in the HCC tissues with metastatic potential. [score:1]
We have previously found that the level of miR-100 was significantly decreased in HCC tissues [14, 15]. [score:1]
Lower panel, antagonism of the constitutively active Rac1 (Q61L) against the function of miR-100. [score:1]
The plasmids psiCHECK2-Rac1-3′UTR-MUT and psiCHECK2-ICMT-3′UTR-MUT, which carried the mutated sequences in the complementary sites of the seed region of miR-100, were produced by site-specific mutagenesis based on psiCHECK2-Rac1-3′UTR-WT and psiCHECK2-ICMT-3′UTR-WT, respectively. [score:1]
The mature miR-100 level was examined by qPCR and normalized to RNU6B level. [score:1]
The role of miR-100 in tumor metastasis remained unknown. [score:1]
Twenty-four hours after transfection with anti-miR-C or anti-miR-100, SMMC-7721 cells without (−) or with (+) treatment of 10 μM LY294002 for 48 hours were analyzed by RT-PCR. [score:1]
SMMC-7721 cells transfected with anti-miR-C or anti-miR-100 were added to transwell chamber without (D, 5×10 [4]) or with (E, 7.5×10 [4]) Matrigel coating. [score:1]
To create luciferase reporter constructs psiCHECK2-Rac1-3′UTR-WT and psiCHECK2-ICMT-3′UTR-WT, a wild-type 3′-UTR segments of human Rac1 (461 bp) or ICMT (271 bp) mRNA that contained putative binding sites for miR-100 were inserted downstream the renilla luciferase coding region in psiCHECK2 (Promega, WI, USA). [score:1]
Figure 1(A) Lower miR-100 level was associated with shorter recurrence-free survival of HCC patients. [score:1]
To verify the above findings from gain-of-function studies, loss-of-function analysis was carried out in human SMMC-7721 cells, which showed higher miR-100 level than QGY-7703 and Hepa1-6 cells (Supplementary Figure 3). [score:1]
Hepa-Ctrl and Hepa-miR-100 cells or QGY-7703 and SMMC-7721 cells that were transfected for 48 hours, were added to coverslip that had been pre-coated with 80 μg Matrigel (R&D Systems) in a 48-well plate, allowed to spread for 3 hours at 37 °C and then fixed, permeabilized and stained with fluorescent phalloidin (Life Technologies), a probe for filamentous actin. [score:1]
Hepa-Ctrl and Hepa-miR-100 cells (1×10 [6]) were inoculated under the capsules of the left hepatic lobes of C57BL/6J mice and maintained for 35 days. [score:1]
Forty-eight hours after transfection with anti-miR-C or anti-miR-100, SMMC-7721 cells were analyzed by immunoblotting. [score:1]
Hepa-Ctrl or Hepa-miR-100 cells (1×10 [6]) were resuspended in 25 μl of Matrigel (mixed with 1×PBS at 1:1 volume ratio; cat. [score:1]
Figure 2(A) miR-100 and its putative binding sequences in the 3′-UTR of Rac1 and ICMT. [score:1]
Right panel, SMMC-7721 cells transfected with anti-miR-C (lane 1) or anti-miR-100 (lane 2). [score:1]
Both anti-miR-100 and anti-miR-C were 2′-O-methyl -modified oligoribonucleotides. [score:1]
Hepa-miR-100 groups: 6/6 vs 2/5, Figure 1F). [score:1]
Our results suggest that miR-100 simultaneously represses two molecules in the Rac1 signaling pathway, which may provide a more effective prevention for tumor metastasis. [score:1]
miR-100 exerts its anti-metastasis function by abrogating the ICMT-Rac1 signaling. [score:1]
Representative H&E-stained sections of lung tissues in Hepa-Ctrl and Hepa-miR-100 groups are shown. [score:1]
The anti-miR-C, which is non-homologous to any human genome sequences, was used as a negative control for anti-miR-100. [score:1]
[1 to 20 of 94 sentences]
2
[+] score: 292
Despite the fact that isolated (low) GFP cells (V [miR-100]) had two to three-fold higher miR-100 expression than control (V [cont]) or endogenous miR-100 expression in GBM (Figure 4A), this expression level was significantly below the endogenous miR-100 level in control astrocytes (Figure 4A). [score:7]
Overexpression of miR-100 and specific SMRT/NCOR2 targeted inhibition relating to tumor proliferation and apoptosis in vitro, and in vivo observations of reduced tumor size and improved animal tumor mo del survival were shown. [score:7]
Although GFP expression indicated vector activation, amplified expression of miR-100 was also directly confirmed quantitatively by qPCR. [score:6]
In a differential microRNA profiling analysis of GBM against non-tumor cell lines, miR-100 was one of the top down-regulated miRNAs (data not shown), and QPCR assays confirmed the low endogenous miR-100 expression in all four GBM lines (Figure 1A). [score:5]
3B), and high GFP (and miR-100) -expressing cells not used to avoid miR-100 overexpression-related apoptosis. [score:5]
Candidate mRNA targets of has-miR-100 ID of each transcripts PhastCons score mirSVR score TMPRSS13 NM_001077263 0.65 -1.29 SMARCA5 NM_003601 0.73 -1.27 ANKAR AK058144 0.71 -1.26 NCOR2 (SMRT) NM_006312 0.64 -1.24 These were the top 4 out of 1389 targets predicted by microRNA. [score:5]
Although a survival advantage for mice implanted with 22T V [miR-100] was not observed (P = 248; n=8/group), we hypothesized that higher miR-100 expression (>100 fold, and closer to miR-100 expression in normal cells) may be needed to significantly improve survival. [score:5]
Cell death has been prevented when SMRT/NCOR2 was overexpressed together with miR-100 overexpression. [score:5]
To test in vivo effects of miR-100 expression, an expression vector of tetracycline-inducible promoter linked to miR-100 and GFP genes was created. [score:5]
The isolated low-medium miR-100 expressing cell lines showed two to three-fold higher expression than in untransfected GBM cells (Figure 4A). [score:5]
Rescue of SMRT/NCOR2 inhibition by overexpressing it (with a vector) in the presence of miR-100 significantly reduced cell death up to 100% (Figure 3, A & B). [score:5]
Since we identified SMRT/NCOR2 as a target for miR-100 inhibition, tumor xenograft brain sections were immuno-labeled with anti-SMRT/NCOR2 and anti-Ki-67 (Figure 4, C & E). [score:5]
Therefore, although we first identified miR100 down-regulation via microarray analysis of GBM cells isolated via serum-free media (Figure S1), the clinical applicability of our results will be further supported if verified in planned experiments with serum-free, stem cell media cultured GBM lines. [score:4]
In this work, microRNA profiling analysis of human GBM against human non-tumor cell lines, miR-100 was one of the top down-regulated microRNAs. [score:4]
miR-100 is down-regulated in GBM. [score:4]
This reporter assay confirmed miR-100’s ability to directly inhibit SMRT/NCOR2 expression, compared to control microRNAs (P < 0.01; Figure 1D; Supp. [score:4]
To examine the possibility that therapeutic miR-100 effects required much higher expression levels, a cohort of sixteen mice were implanted with native (22T) tumor xenografts that were then challenged with direct orthotopic injection of miR-100 or control miR. [score:4]
Proliferation was partially inhibited (30% -50%) by miR-100 overexpression compared to control miR (P < 0.05; n=3/line; Figure 1C). [score:4]
SMRT/NCOR2 (silencing mediator of retinoid or thyroid receptor) was identified in silico as a candidate miR-100 regulated target gene (Supp. [score:4]
Overall, we report data showing anti-tumor role for miR-100 in GBM, and reveal that regulation of miR-100 levels, plus SMRT/NCOR2 and associated downstream pathways (e. g. HDAC3) are potential therapeutic targets for GBM. [score:4]
Over-Expression of miR-100 Reduces Proliferation. [score:3]
Western blot analysis of SMRT/NCOR2 – Silencing mediator of retinoic acid and thyroid hormone receptor – (also known as NCOR2) in both miR-100 transfected cells and scramble miR controls revealed an average of 50% higher SMRT/NCOR2 expression in scramble miR transfection controls (P < 0.01; n=3; Figure 1E; Supp. [score:3]
Western blot analysis showed an average 50% reduction in SMRT/NCOR2 protein level in four GBM cell lines after miR-100 overexpression, and congruent results were obtained with siSMRT/NCOR2 (Figure 1E). [score:3]
miR-100 decreases GBM proliferation and targets SMRT/NCOR2. [score:3]
TaqMan real-time PCR assays were used to confirmed miR-100 down-regulation. [score:3]
Microarray analysis comparing miR100 expression in two independent human GBM specimens cultured in stem cell media conditions with human neural stem cells (hNSCs). [score:3]
22T GBM-derived lines stably transfected with a doxycycline-inducible miR-100-GFP lentiviral vector were isolated that exhibit low/medium GFP expression after 24 hours of induction for further analysis (Supp. [score:3]
Figure S4 Western blot of reduced SMRT protein when miR-100 was over expressed. [score:3]
Moreover, miR-100 overexpression via therapeutic tumor injection improved animal survival. [score:3]
Luciferase reporter activity was inhibited more than fifty percent (P < 0.01; n=3) in the presence of miR-100, but unaffected when the miR-100 seed sequence in the 3’UTR reporter was mutated. [score:3]
All GBM lines showed significantly lower miR-100 expression. [score:3]
V [miR-100] (22T and U251) had (40% and 60%) less Ki-67 labeling, respectively, suggesting induction of miR-100 expression reduced in vivo tumor cell proliferation (P < 0.01; n=3/group; Figure 4F). [score:3]
Luciferase reporter assays were performed to assess whether miR-100 directly inhibits SMRT/NCOR2. [score:3]
Transient miR-100 overexpression in all GBM lines show reduced cell growth by an average of 50% (Figure 1B). [score:3]
Xenograft mo dels were created by implanting modified 22T GBM cells expressing inducible low/medium miR-100-GFP, or 22T GBM cells transfected with control vector (inducible GFP only). [score:3]
SMRT/NCOR2 is one of the top four predicted miR-100 targets at microrna. [score:3]
After confirming miR-100 over -expression in transfected GBM (Supp. [score:3]
0080865.g001 Figure 1 (A) Quantitative PCR showed native miR-100 expression in multiple GBM tumor lines relative to normal control (astrocyte extracted from non-tumor brain). [score:3]
In this work, the therapeutic utility of miR-100 over -expression was tested and shows reduced GBM proliferation and improved survival in a mouse xenograft mo del. [score:3]
Patient-derived GBM (22T and 33T) and standard laboratory GBM lines (U87 and U251) exhibited low endogenous miR-100 expression. [score:3]
QPCR confirmed miR-100 overexpression in miR-100 transfected cells (Figure S3A). [score:3]
Ten thousand cells were plated for 24 hours and then treated with miR-100, control miRs, or miR-100 in combination with SMRT/NCOR2 expression vector (pSMRT; Fisher Scientific). [score:3]
miR-100 Expression Vector. [score:3]
Tumor proliferation was markedly reduced and GBM apoptosis was induced by miR-100 expression above endogenous GBM levels. [score:3]
SMRT/NCOR2 Gene is targeted by miR-100. [score:3]
Altered miR-100 expression was confirmed with quantitative polymerase chain reaction (qPCR) in four GBM lines (serum cultured patient-derived primary GBM lines (22T, 33T) and two standard laboratory GBM lines (U251, U87)). [score:3]
Our data suggested that miR-100 acts as ‘anti-tumorigenic’ and we tested whether miR-100 over -expression reduces tumorigenicity. [score:3]
In silico analysis showed that SMRT/NCOR2 is one of the top targets of miR-100, which was confirmed experimentally. [score:3]
In addition, Liu et al. displayed miR-100 as tumor suppressor and clinical marker for high tumor stage in non-small cell lung cancer [19]. [score:3]
The two to three fold higher miR-100 expression (compared to endogenous GBM miR-100 expression) showed significantly reduced tumor proliferation activity, (shown by Ki-67 assay), but did not lead to a statistically significant improvement in survival (P = 0.248; n=8). [score:3]
Upon addition of doxycycline, low to medium GFP (and miR-100) -expressing cells were collected via flow cytometry (Supp. [score:3]
The low-medium expressing miR-100 cells were implanted orthotopically into mouse brains to generate tumor xenografts. [score:3]
In conclusion, this study provides strong evidence that miR-100 activity inhibits GBM tumorigenicity in vitro and in vivo. [score:3]
Top 4 predicted hsa-mir-100 mRNA targets from microRNA. [score:3]
Figure S1 Identification of altered miR-100 expression in glioblastoma. [score:3]
Then, animals were treated with doxycycline (10 mg/kg) to induce miR-100 expression from integrated vectors starting 8 days after implantation, and administered every other day at until animals were moribund or sacrificed. [score:3]
Luciferase reporter assays showed that miR-100 specifically inhibited luciferase-SMRT/NCOR2 3’UTR activity, and suggested a direct relationship between SMRT/NCOR2 and miR-100 (Figure 1D). [score:3]
SMRT levels was reduced when both siSMRT and pre-miR-100 were overexpressed, n=3. [score:3]
Significant miR-100 down-regulation was detected in multiple patient-derived and established GBM cell lines compared to control, non-tumor brain cells, thus suggesting anti-oncogenic role for miR-100. [score:3]
The therapeutic potential of miR-100 to suppress GBM proliferation and improve survival was explored in this study. [score:3]
Since similar patterns with all cell lines were observed in pilot experiments, we chose to focus on creating one tumor line (22T) with stable inducible miR-100 expression for animal experiments. [score:3]
Both transient miR-100 over -expression and siSMRT/NCOR2 activity introduced a minimum of 70% more cell death than controls in all cell lines tested (Figure 2, A & B). [score:3]
Doxycycline was administered every other day to induce miR-100 expression starting eight days after implantation when tumor was detectable on MRI. [score:3]
Simultaneous overexpression of both miR-100 and SMRT/NCOR2 eliminated proliferation bias produced by miR-100 elevation. [score:3]
Stable transfected GBM cell lines harboring an inducible miR-100 expression vector (miR-100 at two-three fold higher level than endogenous GBM levels) showed marked reduction of both Ki-67 proliferation by 40%, and SMRT/NCOR2 level by 70% in tumor xenografts. [score:3]
In lung and colon cancer studies, miR-100 dysregulation was linked to cancer progression [18, 19]. [score:2]
0080865.g004 Figure 4(A) Treatment of 22T GBM cells with a miR-100 expressing vector (V [miR-100]) increased miR-100 levels by 3-fold compared to control vector (V [cont]) treated cells. [score:2]
0080865.g003 Figure 3 (A) Treatment with both pre-miR-100 and SMRT/NCOR2 (pSMRT/NCOR2) overexpression prevented avoided induced cell death as shown by TUNEL staining compared to pre-miR-100 alone. [score:2]
Experiments with single dose miR-100 injection directly into tumor xenografts were performed with two implanted GBM lines (22T and U87). [score:2]
Mouse xenograft brain specimens (both groups harvested at equivalent times) were analyzed, grossly showing that xenografts induced for miR-100 expression were markedly reduced in growth and size (22T V [miR-100] compared to control 22T V [cont] samples; Figure 4B). [score:2]
Microarray analysis showed markedly decreased miR100 expression in two independent human GBM specimens cultured in stem cell media conditions compared to human neural stem cells (hNSCs) (Supp. [score:2]
Compared to control astrocyte cells derived from brains free of malignancy, all four GBM lines show an average 70% lower level of miR-100 expression (P < 0.01; n=3/line; Figure 1A). [score:2]
After GBM implantation, mice were imaged with MRI starting at day 8. After detecting tumor xenografts at least 0.5 cm in size, 60 pmoles of miR-100 precursor or control miR were directly injected into xenografts. [score:2]
Animals harboring miR-100 expressing xenografts did not have a significantly longer survival compared to the control group (p = 0.248). [score:2]
In addition, EdU assay illustrated reduced proliferation with miR-100 overexpression by 40% in all GBM lines. [score:2]
Interestingly, both miR-100 overexpression and SMRT/NCOR2 silencing showed increased GBM apoptosis via TUNEL assay. [score:2]
To assess whether the doxycycline -induced three-fold increase in miR-100 expression influenced animal survival, a cohort of xenografted mice with either V [miR-100] or V [cont] were treated with doxycycline in a survival assay. [score:2]
This is consistent with an anti-oncogenic role for miR-100 in GBM. [score:1]
The same pattern was seen with miR-100 transfected cells (P < 0.01; n=3; Figure 2, A & B). [score:1]
Figure S2 miR-100 predicted binding. [score:1]
miR-100 improves survival. [score:1]
microRNA-100 precursor, siRNA (silencer)/siSMRT, and control miR (non-specific microRNAs) were purchased from Life Technologies (formerly Invitrogen). [score:1]
In xenografts, more SMRT/NCOR2 was seen in control (V [cont]) brain than V [miR-100] brain. [score:1]
More Ki-67 staining was seen in control (V [cont]) brain than V [miR-100] brain. [score:1]
Transfections with miR-100, siSMRT/NCOR2 or control miR were done the next morning. [score:1]
Inducible test vectors with miR-100 and GFP genes (V [miR-100]) and control vectors (V [cont. ]) [score:1]
miR-100 induces cell death. [score:1]
miR-100 decreases tumor size. [score:1]
Scramble (control miR) and miR-100 microRNAs were used at 15 pmoles per 500k cells. [score:1]
The inducible miR-100/GFP vector integrated into tumor cell genomes via lentiviral transfection. [score:1]
Group over the V [miR-100] group. [score:1]
Inspection of mouse brains grossly after death showed larger xenografts in the control mice than tumors in the miR-100 group (Figure 4B). [score:1]
No further miR treatment was given and survival analysis showed that a single dose of pre-mir-100 extended survival 25% more than untreated controls (P < 0.01; n=8/gp; Figure 5, C & D). [score:1]
Since GBM cells are highly invasive in humans and grow rapidly in culture, miR-100’s effect on GBM proliferation was tested via partially restoring miR-100 activity through transient transfection. [score:1]
0080865.g005 Figure 5 (A) T1 gadolinium enhanced MRI show smaller tumor xenografts after miR-100 treatment versus control miR treatment. [score:1]
0080865.g002 Figure 2 (A) Treatment with either pre-miR-100 or SMRT/NCOR2 siRNA (siSMRT/NCOR2) induced cell death as shown by TUNEL staining. [score:1]
miR-100 reduces tumor mass and improves prognosis. [score:1]
Recently, miR-100 was reported to have anti-angiogenic function through mTOR signaling repression in endothelial cells [18]. [score:1]
The SMRT/NCOR2 3’UTR is 1052nt long and the miR100 seed sequence is located from 665 to 676nt. [score:1]
Figure S3 Quality control of miR-100 transfection and isolation of stable miR-100 transfectants. [score:1]
An orthotopic xenograft mo del was used to test in vivo miR-100 effects. [score:1]
60 pmoles of microRNA-100 or control microRNA were injected at previously reported stereotactic coordinates used for tumor cell implantation [23, 33]. [score:1]
The following were designed and ordered from Genecopoeia (Rockville, MD): an inducible DNA construct (pEZ-lv201 backbone) containing miR-100 and GFP coding sequences, and a control vector that did not contain miR-100 coding sequence. [score:1]
One had the 3’UTR of SMRT mRNA with miR100 seed sequence, while this was mutated in the negative control. [score:1]
Then, miR-100 microRNA precursors were transfected. [score:1]
This is consistent with an anti-oncogenic role for miR-100 in GBM (Figure 1C). [score:1]
The miR-100 -injected xenografts were smaller on MRI than the control miR -injected xenografts (Figure 5A). [score:1]
exhibited up to 70% and 40% more SMRT/NCOR2 label than 22T and U251 V [miR-100] xenografts, respectively (Figure 4 C & D). [score:1]
The miR-100 group showed significantly reduced tumor progression, while control miR treatment did not alter tumors (Figure 5A). [score:1]
Precursors of miR-100 (pre-miR-100) were transiently transfected into the four GBM lines (22T, 33T, U251, U87) following overnight serum starvation. [score:1]
org algorithm for hsa-miR-100. [score:1]
Both vectors were co -transfected with pre-miR-100 or control miRs. [score:1]
Therefore these data suggest that miR-100 has anti-tumor effect by modulating SMRT/NCOR2. [score:1]
[1 to 20 of 113 sentences]
3
[+] score: 273
Upregulation of miR-100 is found in gastric cancer and pediatric acute myeloid leukaemia [10, 11], whereas frequent downregulation of miR-100 occurs in various types of malignancies including HCC [12- 17], indicating the context -dependent effect of miR-100 in cancer development. [score:8]
Furthermore, we observed a correlation between p62 upregulation and miR-100 downregulation. [score:7]
Dual-luciferase reporter system showed that co-transfection of miR-100 significantly suppressed the activity of firefly luciferase reporter with the wild-type 3'UTR of mTOR or IGF-1R, whereas this effect was abrogated when the predicted miR-100 binding site at 3′UTR was mutated (Figure 5A, Supplementary Figure 3), suggesting that miR-100 may suppress gene expression by binding to the 3′UTR of mTOR or IGF-1R. [score:7]
Furthermore, the downregulation of miR-100 was correlated with the upregulation of p62 (Figure 3C), suggesting an in vivo pro-autophagy effect of miR-100. [score:7]
Figure 1 (A) Ectopic expression of miR-100 induced a significant accumulation of LC3B-II and downregulation of p62. [score:6]
miR-100 promotes autophagy by directly inhibiting the expression of mTOR and IGF-1R. [score:6]
In this study, we found that frequent downregulation of miR-100 was associated with reduced autophagy in human HCC tissues, and the restoration of miR-100 promoted the Atg7 -dependent autophagy and subsequent apoptotic cell death, and inhibited the in vivo growth of HCC cells. [score:6]
We showed that miR-100 directly suppressed the expression of mTOR and IGF-1R in HCC cells. [score:6]
We found that rapamycin, one of the mTOR inhibitors, caused Akt activation in a dose -dependent manner in HepG2 cells and the introduction of miR-100 significantly downregulated the level of active Akt in the rapamycin -treated cells (data not shown). [score:6]
The restoration of miR-100 expression resulted in significant accumulation of LC3B-II and downregulation of p62 protein in both HepG2 and Huh7 cells (Figure 1A). [score:6]
Considering the multiple inhibitory function of miR-100 on both IGF-1R and mTOR, we speculate that miR-100 may have more potent anti-tumor activity than mTOR inhibitors alone. [score:5]
We found that the restoration of miR-100 induced autophagy and led to cell death and in vivo growth inhibition of HCC cells, suggesting miR-100 as an attractive target for anti-cancer therapy. [score:5]
Figure 6Restoration of miR-100 expression promotes apoptotic cell death and inhibits in vivo tumor growth(A) miR-100 -induced autophagy led to massive cell death. [score:5]
Furthermore, overexpression of miR-100 inhibits the proliferation and promotes the apoptosis of lung cancer and acute lymphoblastic leukaemia cells [16, 17]. [score:5]
These results indicate that miR-100 induces autophagy in HCC cells by targeting mTOR and IGF-1R, although other unidentified targets may also be involved. [score:5]
Restoration of miR-100 expression promotes apoptotic cell death and inhibits in vivo tumor growth. [score:5]
To construct the miR-100 expression vector (pCDH-miR-100), a 514 bp DNA fragment encompassing the mature miR-100 sequence and its 5′- and 3′-flanking regions, was amplified and integrated into the EcoRI/ BamHI sites of pCDH-CMV-MCS-EF1-copGFP (System Biosciences, Mountain View, CA, USA, Supplementary Figure 7), a lentiviral vector that expresses fluorescent copGFP. [score:5]
The HepG2 subline with stable miR-100 expression (HepG2-pCDH-miR-100) and its control line (HepG2-pCDH-control) were established using the lentiviral expression system. [score:5]
In summary, our findings, based on clinical samples, cell and mouse mo dels, disclose a new regulatory mechanism of autophagy and a novel biological function of miR-100, and provide a potential molecular target for HCC therapy. [score:4]
PLK1, mTOR, IGF-1R, FKBP5 and RBSP3 have been identified as the direct targets of miR-100 [13, 15- 18]. [score:4]
Previous studies have identified mTOR and IGF-1R as the direct targets of miR-100 [22]. [score:4]
Figure 3(A) Downregulation of miR-100 in HCC tissues. [score:4]
Interestingly, the inhibition of Atg7 markedly attenuated the miR-100 -induced accumulation of LC3B-II in HepG2 cells (Figure 4B, lanes 1~4), whereas knockdown of Beclin-1 did not affect the level of miR-100-promoted autophagy (Figure 4B, lanes 5~6). [score:4]
Knockdown of mTOR and IGF-1R closely mimicked the autophagy-promoting effect of miR-100 overexpression in our cell mo dels. [score:4]
Our data highlight the importance of miR-100 in autophagy regulation, and the significance of miR-100 and autophagy deregulation in HCC development. [score:4]
Although abnormal miR-100 expression is frequently observed in various types of cancers, the biological outcome of miR-100 deregulation is largely cellular context -dependent. [score:4]
As shown, miR-100 was downregulated in the majority of HCC tissues (Figure 3A), with 13 out of 24 (54.2%) HCC tissues displaying a more than 50% reduction. [score:4]
To determine the role of Beclin-1 and Atg7 in the miR-100 -induced autophagy, siRNA approach was used to selectively knockdown the expression of Beclin-1 and Atg7 (Figure 4A). [score:4]
It is inspiring to find that a single miRNA may repress HCC development via multiple mechanisms, which makes miR-100 a promising target for anti-HCC therapy. [score:4]
Furthermore, frequent downregulation of miR-100 was associated with reduced autophagy in human HCC tissues. [score:4]
Notably, miR-100 was downregulated in the majority of examined cell lines (Supplementary Figure 1). [score:4]
To further confirm the autophagy-promoting effect of miR-100 in vivo, we detected the expression levels of miR-100 and p62 in the paired HCC and adjacent nontumor liver tissues. [score:3]
Furthermore, silencing of Atg7 expression or CQ-treatment significantly attenuated the cell death in miR-100-transfectants (Figure 6A). [score:3]
Figure 2(A) Overexpression of miR-100 increased the number and size of punctate LC3B aggregates. [score:3]
The mean level of miR-100 in nontumor tissues was set as relative expression 1. ***, P < 0.001. [score:3]
The stable expression of miR-100 was confirmed by qPCR and the immunofluorescent intensity of CopGFP was determined by flow cytometry (Gallios). [score:3]
However, overexpression of miR-100 did not affect the levels of Beclin-1 and Atg7, two critical autophagy-related molecules (Supplementary Figure 2). [score:3]
miR-100 expression was analyzed in 24 paired HCC (T) and adjacent nontumor (N) liver tissues by real-time quantitative PCR. [score:3]
In this study, we found that miR-100 promoted the Atg7 -dependent autophagy and subsequent apoptotic cell death by modulating the expression of IGF-1R and mTOR in HCC cells. [score:3]
Quantitative Real-Time PCR (qPCR) analysis for miR-100 expression. [score:3]
Figure 5(A) Overexpression of miR-100 repressed the activity of a luciferase reporter that contained the wild-type 3′UTR of mTOR or IGF-1R. [score:3]
It has been shown that miR-100 promotes the proliferation of acute myeloid leukaemia [18] but suppresses the proliferation of HCC, breast and bladder cancer cells [13- 15]. [score:3]
In addition, the restoration of miR-100 reduced the expression of cellular mTOR and IGF-1R proteins (Figure 5B, Supplementary Figure 4A), whereas the antagonism of endogenous miR-100 increased the level of mTOR and IGF-1R proteins in HepG2 (Figure 5C) and MHCC97-L cells (Supplementary Figure 4B). [score:3]
Establishment of the miR-100 stable -expressing HepG2 subline. [score:3]
Collectively, these data suggest that miR-100 may induce autophagy, at least partly, by repressing the expression of mTOR and IGF-1R. [score:3]
These data suggest that the autophagy induced by miR-100 may lead to cell death and thereby inhibitory tumor growth of HCC cells. [score:3]
Mouse xenograft mo dels revealed that the restoration of miR-100 inhibited the in vivo growth of HCC cells. [score:3]
Briefly, lentiviruses were generated by transiently co-transfecting HEK293T cells with the lentiviral expression vectors (pCDH-CMV-MCS-EF1-copGFP or pCDH-miR-100) and the lentivirus packaging vectors (pMD2. [score:3]
To uncover the effect of endogenous miR-100 on autophagy, HepG2 and MHCC97-L cells were transfected with sequence-specific inhibitor of miR-100 (anti-miR-100) or its negative control (anti-miR-NC), then subjected to serum deprivation. [score:3]
We further examined whether overexpression of miR-100 disrupted the mitochondrial membrane potential (ΔΨm). [score:3]
Previous studies have revealed that miR-100 can suppress the proliferation of HCC cells [13]. [score:3]
293T cells grown in a 48-well plate were co -transfected with 5 nM of either NC or miR-100 duplex, 10 ng of firefly luciferase reporter plasmid comprising the wild-type or mutant 3′UTR of target gene, and 2 ng of pRL-TK (Promega, Madison, WI, USA). [score:3]
The altered expression of miR-100 and p62 in HCC tissues. [score:3]
HepG2-pCDH-miR-100, a HepG2 subline with stable miR-100 expression, and HepG2-pCDH-control cells were injected subcutaneously into nude mice and tumor growth was monitored using in vivo imaging. [score:3]
Knockdown of Atg7 but not Beclin-1 attenuates the miR-100 -induced autophagy. [score:2]
Immunofluorescent staining disclosed that the introduction of miR-100 obviously enhanced the punctate LC3B signals (Figure 2A), whereas knockdown of endogenous miR-100 by anti-miR-100 decreased LC3B signals (Figure 2B). [score:2]
qPCR analysis of miR-100 expression was performed on a LightCycler 480 (Roche Diagnostics, Germany) using a TaqMan MicroRNA Assay kit (Applied Biosystems, Foster City, CA). [score:2]
Furthermore, knockdown of either mTOR or IGF-1R significantly enhanced the LC3B-II level and punctate LC3B signals in both HepG2 (Figure 5D and E) and MHCC97-L cells (Supplementary Figure 4C), which phenocopied the effect of miR-100. [score:2]
To date, the role of miR-100 in the regulation of autophagy has not been elucidated yet. [score:2]
Deregulation of miR-100 has been observed in different human neoplasms. [score:2]
Both gain- and loss-of-function studies revealed the pro-autophagy effect of miR-100. [score:1]
HepG2 and Huh7 cells were non -transfected (lane 1) or transfected with NC or miR-100 duplex for 72 hours before immunoblotting. [score:1]
The anti-miR-NC, which is non-homologous to any human genome sequences, was used as a negative control for anti-miR-100. [score:1]
Most published studies so far have focused on analyzing the effect of miR-100 on cell growth. [score:1]
HepG2 cells were reversely transfected with NC or miR-100 for 48 hours, followed by incubation in the 10% FBS-containing DMEM (lanes 1 and 2) or serum-free DMEM (lanes 3-6) without (−) or with (+) 10 μM chloroquine (CQ) for 24 hours. [score:1]
Therefore, HepG2 and Huh7 cells, both of which displayed very low miR-100 levels, were subjected to immunobloting for LC3B-II and p62 after being transfected with negative control (NC) or miR-100 duplex. [score:1]
The percentage of Annexin V-staining cells significantly increased in the miR-100 -transfected group, implying simultaneous induction of apoptosis by miR-100 (Figure 6B, C). [score:1]
Next, we confirmed the effect of miR-100 on autophagy by morphological examination. [score:1]
Taken together, these data suggest that miR-100 may promote the Atg7 -dependent autophagy. [score:1]
The mutant 3′UTR (Supplementary Figure 3), which carries the mutated sequence in the complementary site for the seed region of miR-100, was generated using fusion PCR based on the construct with wild-type 3′UTR. [score:1]
These findings suggest that miR-100 may promote the autophagy of HCC cells. [score:1]
The anti-miR-100, with a sequence complementary to mature miR-100, was a 2′- O-methyl -modified oligoribonucleotide. [score:1]
The level of miR-100 was normalized to that of U6B, which yielded a 2 [−ΔΔC]t value. [score:1]
Morphological examination discloses the autophagy-promoting function of miR-100. [score:1]
Next, the role of miR-100 on in vivo tumor growth was analyzed. [score:1]
HepG2 cells were transfected with miR-100 or NC duplex and then cultured in serum-free medium. [score:1]
HepG2 (C) and MHCC97-L (D) cells were non -transfected (lanes 1 and 4) or transfected with anti-miR-NC or anti-miR-100 for 48 hours, then incubated in the serum-free DMEM without (−) or with (+) 10 μM CQ for 24 hours. [score:1]
The miR-100 -induced autophagy promotes apoptotic cell death and represses tumor growth. [score:1]
Interestingly, the restoration of miR-100 resulted in massive cell death upon serum starvation, as manifested by the increased number of trypan blue-staining cells (Figure 6A, bars 1~3). [score:1]
These results suggest that the miR-100 -induced autophagy may trigger mitochondrial apoptotic pathway in our cell mo dels. [score:1]
Autophagy may lead to either cell survival or cell death, we therefore explored the consequence of the miR-100 -induced autophagy. [score:1]
To date, there is no report showing the effect of miR-100 on autophagy. [score:1]
The miR-100 or p62 level in HCC tissue relative to that in adjacent nontumor tissue (T/N) was used. [score:1]
Compared with the control group, knockdown of miR-100 by anti-miR-100 led to a significant reduction in LC3B-II protein, both in the absence and presence of CQ (Figure 1C and D). [score:1]
miR-100 promotes the Atg7 -dependent autophagy in HCC cells. [score:1]
To evaluate the role of miR-100 in autophagic process, miR-100 expression was first analyzed in different hepatoma cell lines. [score:1]
The negative control RNA duplex (named as NC) for both miR-100 and siRNAs was non-homologous to any human genome sequences. [score:1]
Effect of miR-100 on the levels of LC3B-II and p62 in HCC cells. [score:1]
Therefore, miR-100 reduction may represent one of the mechanisms responsible for the low autophagy level in HCC tissues. [score:1]
Regardless of the presence or absence of serum, the miR-100 -transfected cells displayed much more accumulation of LC3B-II than NC-transfectants (Figure 1B, lanes 1~4). [score:1]
HepG2-pCDH-control and HepG2-pCDH-miR-100 cells (5×10 [6]) were suspended in 100 μl 1xPBS and then injected subcutaneously into either side of the posterior flank of the same male BALB/c athymic nude mouse at 5-6 weeks of age. [score:1]
Therefore, the effect of miR-100 on the serum starvation -induced autophagy was further studied. [score:1]
HepG2 cells were transfected with NC or miR-100 for 48 hours, then cultured in the serum-free DMEM with 10 μM CQ for 24 hours before examination by transmission electron microscopy. [score:1]
To create luciferase reporter construct, a wild-type 3′UTR fragment of human IGF-1R or mTOR mRNA that contained the putative binding sites for miR-100 was PCR-amplified and inserted into the EcoRI and XbaI sites downstream of the stop codon of firefly luciferase in pGL3cm vector, which was generated previously [12]. [score:1]
HepG2-pCDH-control and HepG2-pCDH-miR-100 cells were injected subcutaneously into either side of the posterior flank of the same mouse. [score:1]
[1 to 20 of 95 sentences]
4
[+] score: 222
[21] In our study, we observed the effect on the cell proliferation of BEAS-2B after silencing the expression of miR-100 by using miR-100 inhibitor lentivirus expression vector (miR-100 -inhibitor). [score:9]
[9] However, in lung cancers, the expression of miR-100 was downregulated, suggesting it played a tumor suppressor function. [score:8]
To study whether arsenic can effect synergistically with miR-100 inhibited, the BEAS-2B cells transfected with miR-100 inhibitor lentivirus expression vector were incubated with or without 0.25 μM arsenic for 10 weeks (AS 20 passages) and 20 weeks (AS 40 passages). [score:7]
C. The colony-formation assay revealed that colony number and colony size were increased following inhibition of miR-100 in BEAS-2B cells, similar trend was observed in the AS -treated cells(AS (40) and AS (20)) when the expression of miR-100 was inhibited. [score:6]
Luo J, Chen B, Ji XX, Zhou SW, Zheng D Overexpression of miR-100 inhibits cancer growth, migration, and chemosensitivity in human NSCLC cells through fibroblast growth factor receptor 3. Tumour Biol 2016; 37(12):15517-24; PMID:26314855; https://doi. [score:5]
Similar trend was observed in the AS -treated cells when the expression of miR-100 was inhibited, especially in as BEAS-2B (Inh-miR-100)-AS (20) or AS (40) cells. [score:5]
Xiao F, Bai Y, Chen Z, Li Y, Luo L, Huang J, Yang J, Liao H, Guo L Downregulation of HOXA1 gene affects small cell lung cancer cell survival and chemoresistance under the regulation of miR-100. [score:5]
We demonstrated that inhibition of miR-100 expression in BEAS-2B cells led to enhancement of cell proliferation and migration. [score:5]
For control or miR-100–3p inhibition group, a sequence encoding a miR-100–3p negative control or its specific inhibitor was cloned into the lentiviral vector hU6-MCS-Ubiquitin–EGFP -IRES-puromycin. [score:5]
In our study, we have established BEAS-2B cell lines with stable expression of miR-100 inhibitor, and then treated the cells with 0.25 μM arsenic for 10 weeks (AS 20 passages) and 20 weeks (AS 40 passages). [score:5]
The results shown that chronic arsenic treatment promoted the malignant transformation of BEAS-2B cell after inhibition of miR-100 expression. [score:5]
To test this hypothesis, BEAS–2B cells were treated with low-dose of As [2]O [3] chronically, and lentiviral vectors were used to mediate the inhibition of miR-100 expression. [score:5]
Luo reported that, overexpression of miR-100 in non-small cell lung cancer cell inhibited the cancer growth, migration, and chemo-sensitivity through FGFR3. [score:5]
[24] Consistently, in the process of chronic arsenic exposure, we observed that chronic arsenic treatment of BEAS-2B cells, when the expression of miR-100 was inhibited, underwent a marked morphologic change, i. e., from epithelial to spindle-like mesenchymal morphology (Fig.  5A). [score:5]
Li BH, Zhou JS, Ye F, Cheng XD, Zhou CY, Lu WG, Xie X Reduced miR-100 expression in cervical cancer and precursors and its carcinogenic effect through targeting PLK1 protein. [score:5]
B. by using flow cytometry system suggested that inhibition of miR-100 accelerated cell re-entering into the S phase, especially in as BEAS-2B(miR-100 -inhibitor)-AS(40) cells. [score:5]
These results proved that treatment of BEAS-2B cells with arsenic, after inhibiting the expression of miR-100, resulted in EMT, as evidenced by reduction of the epithelial marker E-cadherin, and induction of the mesenchymal markers vimentin, ZEB1, and the matrix metalloproteinases MMP-3, MMP-9, and nuclear β-catenin. [score:5]
These changes promoted an adhesion switch to predominately cell-matrix interactions, were accompanied by drastic morphological changes, and were associated with the upregulation of a variety of cytoskeletal proteins that contribute to increased cell motility [34] [,] [35] In our study, miR-100 inactivation in combination with chronic arsenic treatment of BEAS-2B caused EMT phenotype, a sign with more malignant features, particularly associated with increased metastatic potential. [score:4]
Liu J, Lu KH, Liu ZL, Sun M, De W, Wang ZX MicroRNA-100 is a potential molecular marker of non-small cell lung cancer and functions as a tumor suppressor by targeting polo-like kinase 1. BMC Cancer 2012; 12: 519; PMID:23151088; https://doi. [score:4]
[20] In present study, both in vitro and in vivo experiments were performed to test our hypothesis that downregulation of miR-100 combined with chronic arsenic exposure could enhance metastasis and proliferation of BEAS-2B by promoting EMT, and our results confirmed this notion. [score:4]
A. BEAS-2B cells with inhibited miR-100 were exposed to 0 or 0.25 μM of As [2]O [3] for 0, 20, or 40 passages, and typical images with or without treatment are shown. [score:3]
The combination of miR-100 inhibition and chronic arsenic treatment promote the cell proliferation significantly. [score:3]
Wang S, Xue S, Dai Y, Yang J, Chen Z, Fang X, Zhou W, Wu W, Li Q Reduced expression of microRNA-100 confers unfavorable prognosis in patients with bladder cancer. [score:3]
The results showing that the colony number and colony size were increased following inhibition of miR-100 in BEAS-2B cells. [score:3]
Chen D, Sun Y, Yuan Y, Han Z, Zhang P, Zhang J, You MJ, Teruya-Feldstein J, Wang M, Gupta S, et al. miR-100 induces epithelial-mesenchymal transition but suppresses tumorigenesis, migration and invasion. [score:3]
Note the morphological shift of BEAS-2B cells from epithelial-like to mesenchymal-like when miR-100 inhibition. [score:3]
BEAS-2B cells with miR-100 inactivation were exposed to 5 μM As [2]O [3] in the short term, i. e., 0, 6, 12, and 24 h. We then examined the expression of EMT markers in treated cells. [score:3]
Lentivirus -mediated suppression of miR-100–3p. [score:3]
For arsenic acute stimulate, 5 μM As [2]O [3] (Sigma) was co-cultured with BEAS-2B cells with or without miR-100 inhibition for 0 h, 6 h, 12 h, and 24 h, respectively. [score:3]
One thousand arsenic treated BEAS-2B (miR-100 -inhibitor) and BEAS-2B (miR-NC) cells were re-suspended in 1mL of complete medium (DMEM medium with 10%FBS) containing 0.6% agar and were then plated on top of a bottom layer that contains 1.2% agar (BD) with complete medium. [score:3]
[29] In the present study, the miR-100 inactivation promoted arsenic induced carcinogenesis in human lung bronchial epithelial cells, which might reveal the oncogenic transformation of lung disease under the arsenic exposure. [score:3]
Taken together, these results confirmed that inhibition of miR-100 promoted proliferation of BEAS-2B cells, and chronic arsenic treatment increased BEAS-2B cell proliferation. [score:3]
Furthermore, to understand the synergistic effect of arsenic on BEAS-2B cells after inhibition of miR-100, the cells were treated with arsenic chronically. [score:3]
Arsenic treated BEAS-2B (miR-100 -inhibitor) and BEAS-2B (miR-NC) cells were seeded and cultured on 96-well plates at an initial density of 2000/well after trypsinization. [score:3]
Arsenic treated BEAS-2B (miR-100 -inhibitor) and BEAS-2B(miR-NC) cells were harvested. [score:3]
[8] Study found that, in prostate cancer, the miR-100 expression was elevated and associated with increased metastasis. [score:3]
Next, the effect of miR-100 inhibition on cell cycle progress of BEAS-2B cells was determined by flow cytometry (Fig.  1B). [score:3]
The arsenic exposure affected on oncogenic transformation via affect the miR-100 expression. [score:3]
[22] In this study, we observed that inhibition of miR-100 promoted anchorage-independent cell growth in soft agar (Fig.  2). [score:3]
Left panel: BEAS-2B cells with inhibited miR-100 were exposed to 0 or 0.25 μM of arsenic for 20, or 40 passages, or 5 μM of arsenic for 0, 6, 12, 24h. [score:3]
These results demonstrated that inhibition of miR-100 promoted the ability of migration of BEAS-2B cells, while chronic arsenic treatment increased migration synergistically. [score:3]
A. BEAS-2B cells with miR-100 inhibition were exposed to 0 or 0.25 μM As [2]O [3] for 20, and 40 passages. [score:3]
Left panel: The soft agar colony formation assay shows that inhibition of miR-100 promotes anchorage-independent growth of BEAS-2B cells. [score:2]
For the migration assays, a total of 2 × 10 [4] arsenic treated BEAS-2B(miR-100 -inhibitor) and BEAS-2B (miR-NC) cells in serum-free media were placed into the upper chamber of an insert (8 μm pore size, millepore). [score:2]
As showed in Fig.  3, inhibition of miR-100 promoted the migration of BEAS-2B cells by approximately 50.5% compared with control group. [score:2]
MiR-100 was downregulated in the lung cancer, and considered as a diagnostic bio-marker. [score:2]
Compared with BEAS-2B/miR-NC cells, BEAS-2B/miR-100 -inhibition cells showed the increased percentage of S phase cells and decreased percentage of G [0]/G [1] phase cells. [score:2]
org/ 10.1007/s13277-015-3267-8 25740059 9. Leite KR, Tomiyama A, Reis ST, Sousa-Canavez JM, Sanudo A, Dall'Oglio MF, Camara-Lopes LH, Srougi M MicroRNA-100 expression is independently related to biochemical recurrence of prostate cancer. [score:2]
Left panel: Transwell assays were performed to evaluate the migratory capabilities of the cells untransfected, transfected with either a miR-100–3p inhibitor (Inh-miR-100) or a miR-100–3p inhibitor control (Inh-NC) with or without chronic arsenic treatment. [score:2]
Furthermore, chronic arsenic treatment promotes the anchorage-independent growth of BEAS-2B cells after the miR-100 inactivation, indicated by the increased colony size and colony number. [score:1]
Figure 3. Inactivation of miR-100 combined with arsenic treatment promotes migration of BEAS-2B cells. [score:1]
Our data indicate that inactivation of miR-100 combined with chronic arsenic treatment promotes tumorigenicity of BEAS-2B cells via activation of EMT. [score:1]
Literatures indicated that miR-100 is a novel EMT inducer, and validated in human tumors that miR-100 correlates with EMT -associated markers. [score:1]
We found that the proliferation ability of BEAS-2B cells increased after the inactivation of miR-100. [score:1]
Inactivation of miR-100 combined with chronic arsenic treatment induces the EMT like transition. [score:1]
Similarly, we found that chronic arsenic treatment after miR-100 inactivation contributed the BEAS-2B cells to re-enter the cell cycle(S phase). [score:1]
To determine whether arsenic promoted migration of BEAS-2B cells after miR-100 inactivation, the cells were treated with low dose of arsenic chronically. [score:1]
Inactivation of miR-100 combined with chronic arsenic treatment promotes anchorage- independent growth of BEAS-2B cells. [score:1]
[32] Xiao observed that the HOXA1 mediated the chemo-resistance of small cell lung cancer under the regulation of MiR-100. [score:1]
2016.09.015 27634639 8. Qin C, Huang RY, Wang ZX Potential role of miR-100 in cancer diagnosis, prognosis, and therapy. [score:1]
Inactivation of miR-100 combined with arsenic promotes migration of BEAS-2B cells. [score:1]
Figure 4. Inactivation of miR-100 combined with arsenic treatment promotes mammary tumor growth of BEAS-2B cells. [score:1]
Figure 2. Inactivation of miR-100 combined with arsenic treatment promotes anchorage- independent growth of BEAS-2B cells. [score:1]
[36-38] In this study, we identified as an EMT inducer, and demonstrated that inactivation of miR-100 in BEAS-2B cells led to significant enhancement of cell proliferation and migration. [score:1]
As shown in Fig.  4A, the tumor growth was promoted after the chronic arsenic treatment, and this effect was significantly enhanced by the inactivation of miR-100. [score:1]
Figure 1. Inactivation of miR-100, combined with arsenic treatment, promotes proliferation of BEAS-2B cells. [score:1]
Inactivation of miR-100 combined with chronic arsenic treatment promotes tumorigenesis of BEAS-2B cells in mice. [score:1]
Inactivation of miR-100 combined with arsenic promotes proliferation of BEAS-2B cells. [score:1]
Similar trend was observed in the chronic arsenic treated cells (AS [40] and AS [20]) after the miR-100 inactivation. [score:1]
[24] In our study, we observed that EMT is involved in inactivation of miR-100 and chronic arsenic treated BEAS-2B cells. [score:1]
In this study, we hypothesize that inactivation of miR-100 combined with low concentration of arsenic exposure could promote the malignant transformation of human bronchial epithelial cells (BEAS-2B cell) by promoting EMT. [score:1]
[7] The research about the relationship between miR-100 and tumor has made significant progresses, but the data so far are still controversial. [score:1]
Arsenic treated BEAS-2B (miR-100 -inhibitor) and BEAS-2B(miR-NC) cells were seeded and cultured on 60 mm [2] plates at an initial density of 400/well after trypsinization, each group was measured in 3 parallel wells, and incubated for 2 weeks at 37°C, 5% CO [2]. [score:1]
As illustrated in Fig.  4B-D, the miR-100 inactivation combined with chronic arsenic treatment significantly increased the weight of the mammary tumors. [score:1]
[31] The low miR-100 might be a poor prognostic factor in non-small cell lung cancer patients. [score:1]
To further determine the synergistic effect of chronic arsenic treatment combined with miR-100 inactivation, the cells were treated with arsenic for 20 passages and 40 passages, respectively. [score:1]
The inactivation of miR-100 and chronic arsenic treatment might play synergistic role in this process. [score:1]
The colony number and size was significantly increased after the inactivation of miR-100 in BEAS-2B cells. [score:1]
Carcinogenesis lung cancer micro RNA miR-100 Lung cancer is the leading cause of mortality worldwide. [score:1]
The chronic arsenic treatment combined with miR-100 inactivation enhanced tumor growth. [score:1]
Our results showed that, the inactivation of miR-100 combined with arsenic treatment significantly promoted the proliferation, viability, and migration of BEAS-2B cells in vitro, and tumorigenesis in vivo. [score:1]
The miR-100 inactivation BEAS-2B cells with or without chronic arsenic treatment were injected into BALB/C nude mice. [score:1]
Overall, the morphological and molecular changes have all suggested that BEAS-2B cells with the inactivation of miR-100 underwent an EMT process after the As [2]O [3] exposure. [score:1]
A. the representative image showed mammary tumors from the miR-100 inactivation (Lv-Inh-miR100. ) [score:1]
[1 to 20 of 84 sentences]
5
[+] score: 155
Immunoblot analysis showed that the expression level of PLK1 was indeed up-regulated and down-regulated in Huh7 cells upon silencing and overexpressing miR-100, respectively (Figure 5E, middle and right panel). [score:11]
Even when Huh7 cells were simultaneously with pCMV-HBV and miR-100 expressing plasmid, the degree of PLK1 down-regulation was similar to that of miR-100 overexpression alone (Figure S6C, lane 3 vs. [score:8]
This PLK1 up-regulatory effect was inhibited by overexpression of miR-100 (Figure 5F, lane 3 vs. [score:8]
Binding inhibition of miR-100 by HBV preC-pol led to up-regulation of PLK1. [score:6]
Our data indicated that preC-pol overexpression in the LFCD mutant could exert an effect mimicking that of anti-miR-100, resulting in PLK1 up-regulation to promote tumor growth. [score:6]
This result indicated that the physical interaction between preC-pol and miR-100 resulted in an inhibitory effect on the miR-100 function, leading to PLK1 up-regulation. [score:6]
Up-regulation of polo-like kinase 1 (PLK1) level by overexpression of preC-pol through its interaction with miR-100. [score:6]
The cytosolic HBV preC-pol physically interacted with miR-100 to inhibit its normal function, leading to PLK1 overexpresssion, promoting HCC cell growth. [score:5]
Moreover, patients with HBV polymerase (+) and high PLK1 level had the worst postoperative survival, suggesting that HCCs in which miR-100 was greatly inhibited by HBV polymerase overexpression, resulting in higher level of PLK1, had the greatest growth advantage (Figure 7). [score:5]
According to these results, the preC-pol -induced PLK1 overexpression was likely mediated through its binding to miR-100 to inhibit its function. [score:5]
When compared with the purple group (HBV pol (+) and high miR-100 expression) and blue group (HBV pol (−) and low miR-100 expression), the yellow group had significant unfavorable survival (P = 0.009). [score:4]
Similarly, significant suppression of cell proliferation was found in Huh7-pol and HepG2-pol cells expressing miR-100 by MTT assay (Figure S9, Day 4, Huh7-pol: 12.3-fold ± 0.42 vs. [score:4]
Suppression of tumor growth by miR-100 in Huh7-pol xenografts. [score:3]
HCC patients with positive HBV polymerase IHC staining accompanied by low miR-100 or high PLK1 expression levels had unfavorable postoperative survivals. [score:3]
A and B. Kaplan-Meier analysis for postoperative recurrence-free survivals between HCC patients expressing high and low hepatic levels of miR-100 (A) or PLK1 (B). [score:3]
Figure 6 A to C. Huh7-pol cells with (blue dash line) or without (red dash line) miR-100 overexpression were subcutaneously injected into nude mice. [score:3]
In contrast, patients with both HBV pol (+) and low miR-100 expression had the poorest survival (Figure 7C, yellow group; P < 0.001). [score:3]
Despite the cell proliferation was also decreased in -neo and -HBV cell lines expressing miR-100, the reduction was less prominent in these two types of cell lines (Figure S9, Day 4, Huh7-neo: 8.4-fold ± 0.48 vs. [score:3]
Furthermore, it was known that PLK1 was an important target of miR-100 [23, 33]. [score:3]
Figure 7 A and B. Kaplan-Meier analysis for postoperative recurrence-free survivals between HCC patients expressing high and low hepatic levels of miR-100 (A) or PLK1 (B). [score:3]
As shown in Figure S7, promotion of tumor growth was observed in xenografts with miR-100 down-regulated, when compared to the controls. [score:3]
A to C. Huh7-pol cells with (blue dash line) or without (red dash line) miR-100 overexpression were subcutaneously injected into nude mice. [score:3]
The levels of miR-100 expressed in Huh7-pol xenografts were assessed using stem-loop RT-qPCR (Figure S8). [score:3]
Previous report indicated that the PLK1 was a target of miR-100 [23]. [score:3]
Suppression effects of tumorigenicity by miR-100 in Huh7-pol xenografts. [score:3]
The relative expression level of miR-100 was assessed by RT-qPCR (top right). [score:3]
The miR-100 was able to suppress tumor growth in several cancers, including HCC. [score:3]
Huh7-pol cells without and with miR-100 overexpression were subcutaneous injected into nude mice on the left (pCDH group) and right (miR-100 group) side of back, respectively. [score:3]
HCC patients with low miR-100 (P = 0.032) and high PLK1 (P = 0.283) expression level had a shorter recurrence-free survival by Kaplan-Meier survival analysis (Figures 7A and 7B). [score:3]
Interestingly, when combined with HBV polymerase staining results (Figure 4D), patients with both HBV pol (−) and high miR-100 expression had favorable postoperative survival (Figure 7C, green group). [score:3]
This phenomenon could be reversed by overexpression of miR-100 in vitro and in vivo (Figures 5F and 6). [score:3]
F. PLK1 protein levels in pCMV-pol transfected or untransfected Huh7 cells with or without overexpression of miR-100. [score:3]
Association between postoperative survival and hepatic miR-100, PLK1 and HBV polymerase antigen expression. [score:3]
To further understand the function of miR-100 on hepatoma cells, HepG2 cells, which harbored higher endogenous miR-100 (than did Huh7 cells), were used to knockdown miR-100 for xenograft experiments. [score:2]
Subsequently, we examined the regulatory mechanism mediated by preC-pol-miR-100 interaction in the xenograft mo del. [score:2]
Decrease of PLK1 expression in the miR-100 group was observed when compared with that in the pCDH group (Figures 6D and 6E). [score:2]
The final volume and weight of xenografts in the miR-100 group were significantly smaller and lighter than the paired tumors in the pCDH group (Figures 6A to 6C). [score:1]
E. PLK1 protein levels in Huh7 cells transfected with (+) or without (−) pCMV-pol (left), anti-miR-100 (middle) or miR-100 (right). [score:1]
Indeed, the miR-9, miR-10b and miR-100 were discovered physically interact with preC-pol. [score:1]
After three steps of screening (Supplementary information), only three of them (miR-100, miR-10b and miR-9) remained significantly enriched in the polymerase immunoprecipitates. [score:1]
Clinical analysis showed that miR-100 level was associated with postoperative prognosis in HBV-related HCCs. [score:1]
The greatest abundance of miR-100 in the immunoprecipitate implied that polymerase-miR-100 interaction might exert a biological effect (Figure 5C). [score:1]
To further investigate the clinical correlation of miR-100 or PLK1 expression in HCC patients, 140 samples derived from non-cancerous liver tissues of HBV-related HCC patients were analyzed. [score:1]
Of them, 4 miRNAs (miR-9, miR-10b, miR-124 and miR-100) remained to have a ≥ 1.5-fold difference (Figure 5B, lower panel). [score:1]
lane 2), mimicking the miR-100 silencing effect. [score:1]
Combined analysis showed that HBV polymerase (+) was modifying the clinical predictive effect of miR-100. [score:1]
Furthermore, among the 115 patients, Pearson's correlation analysis revealed a negative correlation between miR-100 and PLK1 (r = −0.191, P = 0.041). [score:1]
The pCDH-CMV-MCS-EF1-copGFP (pCDH), pmiRZip, pCDH-miR-100 and pmiRZip-100 plasmids were purchased from SBI System Biosciences (Mountain View, CA). [score:1]
[1 to 20 of 48 sentences]
6
[+] score: 147
The upregulation of mTOR, Raptor, and SMADs in ECs co-cultured with NSPCs was accompanied by downregulation of miR-155, miR-100, and miR-let-7i, which points to the possible involvement of these miRNAs in mediating NSPCs influence on EC morphology and protein expression. [score:9]
analysis detected a 6-fold downregulation of miR-155, a 3-fold downregulation of miR-100, and a 2.8-fold downregulation of miR-let-7i, in the ECs grown in the presence of NSPCs (as compared to EC monocultures). [score:9]
According to TargetScan miRNA target prediction software, the insulin-like growth factor receptor IGF-1R is a possible predicted target for miR-100 and the miR-let-7 cluster. [score:7]
Affymetrix analysis of the ECs treated with PD 173074 and SB431542 for 24 hours, showed that the inhibitors eliminated the NSPC effect on the endothelial miRNA profile, as demonstrated earlier in the table seen in Figure 3. In the presence of PD 173074, the expression of miR-155, miR-100, and miR-let-7i in ECs did not change after 24 hours of co-culture with NSPCs (the fold change of the miRNA expression was +1.02, -1.07, and -1.02, respectively). [score:7]
In agreement with this prediction, overexpression of miR-100 and miR-let-7i leads to significant downregulation (43 and 34%, respectively) of both precursor (pro-IGF-1R) and mature forms of IGF-1R. [score:6]
According to the literature, miR-100 regulates mTOR signaling [23], miR-155 regulates SMAD protein expression [25], and miR-let-7i is a member of a larger angiogenesis regulating miRNA family [30]. [score:6]
We speculate that miR-100 upregulation suppresses mTOR phosphorylation (and thus mTOR signaling) via a p53/IGF-1R/mTOR signaling pathway. [score:6]
Resulting downregulation (blue arrow) of miR-155, miR-100, and miR-let-7i leads to the increased (red arrow) expression of mTOR, SMAD2, and SMAD3, and thus activation of the mTOR and TGF-β signaling cascade and transcription of genes responsible for endothelial morphogenesis. [score:6]
Inhibition of miR-100 and miR-let-7i resulted in the upregulation of SMAD-2 and SMAD-3 (Figure 4A and 4B). [score:6]
Specific synthetic inhibitors for miR-155, miR-100, and miR-let-7i, as well as the Cy3 dye-labeled anti-miR control inhibitor (AB/Ambion), were used in 30 nM concentration. [score:5]
24 hours after transfection, EC lysates were subjected to immunoblot analysis using the mTOR signaling pathway antibody kit and antibodies recognizing SMAD-2 and SMAD-3. The changes in protein expression levels influenced by the inhibition of miR-100, miR-155, and miR-let-7i, were quantified (based on the results of at least three independent experiments). [score:5]
ECs were transfected with specific synthetic inhibitors of miR-155, miR-100 and miR-let-7i, and Cy3 dye-labeled anti-miR control inhibitor. [score:5]
Thus, changes seen in the expression of miR-155, miR-100, and miR-let-7i are consistent between the two methods: all three miRNAs were suppressed in ECs grown in the presence of NSPCs. [score:5]
Recently, miR-100 was found to regulate (inhibit) in vitro and in vivo vascularization, via the mTOR signaling pathway [15]. [score:4]
Interestingly, co -expression of miR-155 and miR-100 resulted in a dramatic (~67%) reduction of mTOR phosphorylation (Figure 4C, striped bar and D, right immunoblot), suggesting a possible synergistic action of these two miRNAs in the regulation of mTOR activity. [score:4]
MicroRNAs miR-155, miR-100, and miR-let-7i, which are downregulated in ECs under the influence of NSPCs, were identified as potential mediators of the NSPC/EC interaction. [score:4]
Our miR-155 and miR-100 double-overexpression results point to a possible synergistic negative action of these two miRNAs. [score:3]
For the miRNA functional studies, we first performed transfection of ECs with synthetic inhibitors for the specific miRNAs miR-155, miR-100, and miR-let-7i (30 nM final concentration). [score:3]
For miRNA overexpression, miR-155, miR-100, and miR-let-7i-specific pre-miR miRNA precursors, and the pre-miR miRNA negative control were transfected into ECs. [score:3]
ECs were transfected with pre-miR miRNA precursors (E) and anti-miR inhibitors (F) specific for miR155 and miR-100. [score:3]
D: Representative immunoblots for the data depicted on C. Overexpression of miR-100 resulted in a significant (more than 35%) decrease in mTOR phosphorylation (Figure 4C and 4D, p-mTOR). [score:3]
For miRNA overexpression experiments, we used miR-155, miR-100, and miR-let-7i specific pre-miR miRNA precursors (mimics) and pre-miR miRNA negative control, in a final concentration of 30 nM (AB/Ambion). [score:3]
D: Representative immunoblots for the data depicted on C. Overexpression of miR-100 resulted in a significant (more than 35%) decrease in mTOR phosphorylation (Figure 4C and 4D, p-mTOR). [score:3]
To study the effect of miRNA overexpression, ECs were transfected with miR-155, miR-100, and miR-let-7i-specific pre-miR miRNA precursors and pre-miR miRNA negative control. [score:3]
ECs were transfected with synthetic inhibitors for miR-155, miR-100, and miR-let-7i, as well as Cy3 dye-labeled control anti-miR. [score:3]
Changes in miR-155, miR-100 and miR-let-7i expression significantly affect in vitro endothelial morphogenesis. [score:3]
Figure 5 Changes in miR-155, miR-100, and miR-let-7i expression affect in vitro endothelial morphogenesis. [score:3]
Similarly, SB431542 also eliminated NSPC -induced miRNA expression changes: miRNA-155 decreased by 1.15-fold, miR-100 increased 1.16 fold, and the miR-let-7i fold change was 1.05. [score:3]
In the present study, we did not aim to identify or confirm the genuine target genes for miR-155, miR-100, and miR-let-7i. [score:3]
The in vitro endothelial morphogenesis assay demonstrated that inhibition of miR-155, miR-100 and miR-let-7i significantly enhanced EC morphogenesis: the number of tubule branch points (thus complexity of the tubular structures) was significantly increased. [score:2]
NSPC-regulated miR-155, miR-100, and miR-let-7i alter in vitro EC morphogenesis, possibly through modulation of pro-angiogenic mTOR, TFG-β and IGF signaling pathways. [score:2]
It is not known whether or not the transcriptional and/or post-transcriptional regulators of miR-155 (such as ETS1), miR-100, and miR-let-7i (including MYC and LIN28) are affected by NSPCs and pro-angiogenic receptor signaling. [score:2]
MetaCore pathway analysis and data mining algorithms from the GeneGo software determined that the major negatively regulated factors influenced by miR-155 and miR-100, include mTOR, Raptor, and SMAD proteins (Figure 3C). [score:2]
ECs were transfected with pre-miR miRNA negative control, miR-155, miR-100, and miR-let-7i-specific pre-miR miRNA precursors, or co -transfected with pre-miR-155 and pre-miR-100 (pre-miR-155+100). [score:1]
MicroRNAs miR-155, miR-100, and miR-let-7i. [score:1]
In turn, IGF-1R and mTOR signaling are both modulated by miR-100 [23, 24]. [score:1]
Of these choices miR-100 and miR-155 demonstrated the most prominent effects on EC morphogenesis. [score:1]
Another characteristic parameter, tubule length, was also significantly increased after the inhibition of miR-155 and miR-100 (Figure 5A). [score:1]
These findings are in agreement with other studies demonstrating a negative effect of miR-100 on IGF-1R and mTOR signaling pathways [23]. [score:1]
[1 to 20 of 39 sentences]
7
[+] score: 134
In order to shed light on the functionality of miR-99b-5p and miR-100-5p in Aβ -induced pathologies, we predicted the potential targets of these two miRNAs using three online target prediction databases (miRDB, miRanda, and TargetScan) (Luo et al., 2014). [score:7]
miRNA-100 inhibits human bladder urothelial carcinogenesis by directly targeting mTOR. [score:6]
When we used ER stress inhibitor PBA to treat PC12 cells together with Aβ, the levels of miR-99b-5p and miR-100-5p after Aβ treatment were further upregulated (Figure 4B). [score:6]
Reduced miR-100 expression in cervical cancer and precursors and its carcinogenic effect through targeting PLK1 protein. [score:5]
It has been reported that mammalian target of rapamycin (mTOR) is one of the targets of both miR-99 and miR-100 (Sun et al., 2011; Li et al., 2013; Xu et al., 2013). [score:5]
miR-100 suppresses IGF2 and inhibits breast tumorigenesis by interfering with proliferation and survival signaling. [score:5]
Downregulation of HOXA1 gene affects small cell lung cancer cell survival and chemoresistance under the regulation of miR-100. [score:5]
Here, mTOR is a common target of miR-99 and miR-100, and it is also a pivotal molecule involved in neurodegenerative diseases. [score:5]
MiR-100 regulates cell differentiation and survival by targeting RBSP3, a phosphatase-like tumor suppressor in acute myeloid leukemia. [score:5]
MicroRNA-100/99a, deregulated in acute lymphoblastic leukaemia, suppress proliferation and promote apoptosis by regulating the FKBP51 and IGF1R/mTOR signalling pathways. [score:4]
Figure 2 Both miR-99b-5p and miR-100-5p negatively regulate mTOR expression in PC12 cells as well as in APP/PS1 mice. [score:4]
The inverse-correlated expression profile of miR-99b-5p/miR-100-5p and mTOR also indicates that miRNAs-regulated mTOR pathway may play different roles during the progression of brain injuries induced by Aβ deposition. [score:4]
Our previous study demonstrated that miR-99b-5p/miR-100-5p was upregulated in 9-month-old APP/PS1 mice cortexes via high-throughput sequencing (Luo et al., 2014). [score:4]
We hypothesized that miR-99b-5p/miR-100-5p might also be one of the target genes. [score:3]
Figure 1 The expression levels of miR-99b-5p and miR-100-5p in APP/PS1 mice and Aβ -treated PC12 cells. [score:3]
This trend is opposite to the results in cortex tissues, indicating that the biogenesis, circulation, and distribution of miR-99b-5p and miR-100-5p along the development of Aβ -induced pathologies might be regulated by complicated yet sophisticated machinery. [score:3]
mTOR, PLK1 (Polo-like kinase 1), FKBP51 (FK506 binding protein 51), IGF1R (insulin-like growth factor 1 receptor), IGF2 (insulin-like growth factor 2), and HOXA1 (homeobox A1) have been proved as the target genes of miR-100 (Nagaraja et al., 2010; Li et al., 2011, 2013; Gebeshuber and Martinez, 2013; Xu et al., 2013; Xiao et al., 2014). [score:3]
Overexpression of miR-99b-5p and miR-100-5p dramatically reduced the mRNA and protein levels of mTOR in PC12 cells. [score:3]
miR-99b-5p and miR-100 Inhibit Cell Viability of Primary Neurons and PC12 Cells. [score:3]
Our previous study found that miR-99b-5p and miR-100-5p were abnormally expressed in the brains of APPswe/PS1ΔE9 double-transgenic mice [APP/PS1 mice (Luo et al., 2014)], which have AD symptoms after 6 months of age, suggesting their pivotal roles in Aβ deposition -associated AD pathology. [score:3]
miR-99b-5p and miR-100-5p Are Involved in Aβ-Induced Alzheimer’s Disease. [score:3]
To further explore the association of miR-99b-5p/miR-100 with Aβ -associated pathologies, real-time PCR was performed to determine the expression pattern along the aging progress in six to eight pairs of APP/PS1 and WT mice at each indicated age stage (2-, 4-, 6-, 9-, 12-, and 15-month-old). [score:3]
The expression levels of miR-99b-5p and miR-100-5p were significantly decreased at early stages (6 and 9 months) but increased at late stages (12 and 15 months) of APP/PS1 mice when compared with age-matched WT mice (Figure 1A), indicating that miR-99b-5p and miR-100-5p are dynamically regulated and exert their functions in accordance with different stages of brain pathologies induced by Aβ deposition. [score:3]
Then the cells were treated with Aβ1–42 for 24 h. The viability of primary rat neurons was dramatically decreased when miR-99b-5p or miR-100-5p was overexpressed. [score:3]
On the contrary, cell viability was increased when miR-99b-5p or miR-100-5p was inhibited (Figure 3A). [score:3]
The Expression Change of miR-99b-5p and miR-100-5p Induced by Aβ is Related to ER Stress. [score:3]
To determine the role of miR-99b-5p and miR-100-5p in cell viability, we transfected the mimics or inhibitors of miR-99b-5p and miR-100-5p to primary rat cortical neurons or PC12 cells, respectively. [score:3]
mTOR Is One of the Targets of miR-99b-5p and miR-100-5p in PC12 Cells. [score:3]
Relative expression levels of miR-99b-5p and miR-100-5p are represented as fold change compared to vehicle controls. [score:2]
In this study, we chose APP/PS1 mice to explore the link between miR-99b-5p/miR-100-5p and Aβ -induced pathological development. [score:2]
Interestingly, the expression levels of miR-99b-5p and miR-100 in APP/PS1 mice brains were decreased at early stages (6–9 months old) and increased at late stages (12–15 months old) when compared with age-matched WT mice. [score:2]
Therefore, the role of mTOR under the regulation of miR-99b-5p and miR-100-5p in Aβ -induced neuronal pathologies needs to be further illuminated. [score:2]
Figure 4 ER stress regulates miR-99b-5p and miR-100-5p. [score:2]
A link between mir-100 and FRAP1/mTOR in clear cell ovarian cancer. [score:1]
In this study, we used APP/PS1 mice to determine the role of miR-99b-5p and miR-100-5p in Aβ -associated brain pathologies. [score:1]
This result suggests that miR-99b-5p/miR-100-5p play distinct roles during different stages of Aβ deposition -induced brain pathologies. [score:1]
Figure 3 MiR-99b-5p and miR-100-5p reduce cell viability. [score:1]
Recently, Denk et al. (2015) found that miR-100 in cerebrospinal fluid (CSF) from AD patients could serve as one of the reliable biomarkers to detect AD. [score:1]
MiR-99b-5p and miR-100-5p were half-quantified by real-time PCR. [score:1]
MiR-99b-5p and miR-100-5p belong to the same miR-99 family, which consists of three members, miR-99a, miR-99b, and miR-100. [score:1]
At UPR stages (6–9 months), the levels of miR-99b-5p/miR-100-5p were decreased, which were beneficial for neuron survival and synaptic plasticity. [score:1]
Both miR-99b-5p and miR-100-5p mimics were used to establish standard curves for the determination of the miRNAs copies in plasma. [score:1]
At the early stage of Aβ-treatment (6 h), miR-99b-5p/miR-100-5p levels were declined. [score:1]
After the normalization and calculation by referring to standard curve, we found that APP/PS1 mice showed higher expression levels of miR-99b-5p and miR-100-5p at 2, 4, 6, and 9 months in plasma, but lower at 12 months as well as 15 months (Figure 1B). [score:1]
In order to verify whether miR-99b-5p and miR-100-5p were detectable in mice plasma and thus could be used as biomarkers for diagnosis of AD, we detected the plasmatic copy numbers of two miRNAs via Taqman probe -based qPCR. [score:1]
To determine whether the dynamic change of miR-99b-5p and miR-100-5p is related to Aβ -induced ER stress, we induced ER stress by TG in differentiated PC12 cells. [score:1]
In PC12 cells, we also observed the similar results (Figure 3B), suggesting that either miR-99b-5p or miR-100-5p can further promote the neuronal cell death induced by Aβ1–42. [score:1]
[1 to 20 of 47 sentences]
8
[+] score: 124
It is worth noting that while the expression of the AKT2 gene was also down-regulated by miR-100 treatment (Figure 4A ), no targeting sequence was identified in AKT2 mRNA sequence. [score:8]
It is possible that miR-100 indirectly regulates AKT2 by targeting factors that control AKT2 gene expression. [score:7]
Down-regulation of hsa-miR-99b and hsa-miR-100 was confirmed in human skin wounds (Figure S1), while no apparent difference was observed in the expression of hsa-miR-99a. [score:6]
HaCaT cells were transfected with mimics for miR-99a, miR-99b, miR-100 or negative control mimic, or treated with PI3 Kinase Inhibitor LY294002 (LY), mTOR Inhibitor Rapamycin (Rapa) or vehicle alone (DMSO). [score:5]
0064434.g002 Figure 2HaCaT cells were transfected with mimics for miR-99a, miR-99b, miR-100 or negative control mimic, or treated with PI3 Kinase Inhibitor LY294002 (LY), mTOR Inhibitor Rapamycin (Rapa) or vehicle alone (DMSO). [score:5]
Hierarchical clustering analysis revealed several groups of microRNAs that exhibit similar expression patterns, including a 9-microRNA group (mmu-miR-152, mmu-miR-365, mmu-let-7d*, mmu-miR-125a-5p, mmu-miR-181d, mmu-miR-99a, mmu-miR-100, mmu-miR-30c, mmu-miR-125b-5p, named as cluster X in Figure 1A ) which was down-regulated during the early phase of wound healing (day 1) as compared to unwounded skin (day 0), and returned to basal level during the later phase of wound healing (day 5) (Table 1 ). [score:5]
A 9-microRNA cluster (mmu-miR-152, mmu-miR-365, mmu-let-7d*, mmu-miR-125a-5p, mmu-miR-181d, mmu-miR-99a, mmu-miR-100, mmu-miR-30c, mmu-miR-125b-5p, which exhibited statistical significant down-regulation on day 1 and returned to basal level on day 5) was named as cluster X (marked by solid bar on the right). [score:4]
As a control, we also tested the enrichment of FOSL1 mRNA, a known miR-138 targeting gene without a miR-100 targeting site, in the RIP-IP assay. [score:4]
These results confirmed that miR-100 directly interacts with these targeting sites in AKT1 mRNA. [score:4]
B) Dual luciferase reporter assays were performed to test the interactions of miR-100 and the targeting sequences in the AKT1 mRNA using constructs containing the predicted targeting sequences and the corresponding mutants cloned into the 3′-UTR of the reporter gene. [score:4]
Alternatively, miR-100 may regulate the expression of mTOR gene through a novel RISC-independent pathway. [score:4]
Alternatively, AKT2 may be regulated by miR-100 through a noncanonical targeting sequence. [score:4]
This result suggested that miR-100 -mediated regulation of mTOR expression is independent of Ago2. [score:4]
J Biol Chem 2011, 286∶40104-9] with no known miR-100 targeting site, in the Ago2 co-IP fractions. [score:3]
When both targeting sites were mutated, the effect of miR-100 on the luciferase activity was abolished. [score:3]
While we confirmed the effect of the miR-99 family on Raptor in an oral cancer cell line (UM1), we did not observe any apparent change in Raptor expression after transfecting the HaCaT cells with miR-99a, miR-99b or miR-100 mimic (data not shown). [score:3]
As shown in Figure 1C, differential expression of mmu-miR-99a and mmu-miR-100 during wound healing was confirmed by quantitative RT-PCR in additional animals (n = 10). [score:3]
C) The differential expression of miR-99a, miR99b and miR-100 were confirmed by quantitative RT-PCR in additional mice at 0, 1 and 5 days post-wounding (6 mice per groups). [score:3]
and miR-100 mimic, miR-138 mimic or non -targeting microRNA mimic (Dharmacon). [score:3]
When the seed region of one of the two targeting sites was mutated, the miR-100 -mediated reduction in luciferase activity was still observed. [score:3]
Additional studies are needed to explore the mechanisms that contribute to miR-100 -mediated AKT2 expressional change. [score:3]
The relative expression levels of miR-99a, miR-99b and miR-100 were determined by TaqMan microRNA assays as previously described [24]. [score:2]
To directly demonstrate the effect of miR-99 family on PI3K/AKT and mTOR signaling, we investigated the effect of miR-100 on the phosphorylation of p70 S6 Kinase (p70S6K) and eukaryotic translation initiation factor 4E binding protein 1 (4E-BP1), two important signaling molecules that lie downstream of PI3K/AKT and mTOR [36]. [score:2]
The miR-99 family members (miR-99a/b and miR-100) have been shown to regulate cell proliferation and cell migration in several types of cancer of epithelial origin [24], [33], [34], however, their role(s) in wound healing are not well defined. [score:2]
When cells were transfected with miR-100, the luciferase activities of the construct containing both targeting sites was significantly reduced as compared to the cells transfected with negative control. [score:2]
Among the cluster X microRNAs, mmu-miR-99a and mmu-miR-100 are members of miR-99 family. [score:1]
HaCaT cells were treated with anti-miR-100 LNA or negative control LNA. [score:1]
Reduction in the AKT1 mRNA level was also observed in cells treated with miR-99b or miR-100 (Figure 4D ). [score:1]
As shown in Figure 4A, decreases in IGF1R and mTOR protein levels were observed in cells that were treated with miR-100, miR-99a or miR-99b. [score:1]
HaCaT cells were transfected with either negative control mimic (A) or miR-100 mimic (B), and then stimulated with IGF1 or serum. [score:1]
Figure S2 The effect of anti-miR-100 treatment on cell proliferation and cell migration. [score:1]
As shown in Figure 2A, ectopic transfection of miR-99a, miR-99b, and miR-100 mimic to HaCaT cells led to a statistically significant down-regulation in cell proliferation (measured by MTT assay). [score:1]
The effect of miR-100 on the phosphorylation of p70S6K and 4E-BP1. [score:1]
Figure S5 MicroRNA-100-directed enrichment of IGF1R mRNA in the RISC complex. [score:1]
Decrease in the AKT2 protein level was also observed in cells treated with miR-100, but not in cells treated with miR-99a or miR-99b. [score:1]
As shown in Figure S2, when cells were treated with anti-miR-100 LNA, statistically significant increases in cell proliferation and migration were observed. [score:1]
The miR-100 -mediated change in IGF1R mRNA level was less drastic. [score:1]
HaCaT cells were transfected with mimics for miR-99a, miR-99b, miR-100 or negative control mimic. [score:1]
As shown in Figure S5C, a statistically significant enrichment of FOSL1 was observed in cells treated with miR-138, and no difference was detected in cells treated with miR-100. [score:1]
The wounds were treated with an ectopic application of 25 μL of miR-100 mimic (Dharmacon) or negative control (Dharmacon) with LipofectAMINE (Invitrogen) dissolved in saline solution at a final concentration of 2 μM. [score:1]
RISCs containing other Argonaute proteins (e. g., Ago1) may be utilized by miR-100 to recruit mTOR mRNA. [score:1]
To further confirm that miR-100 directly interacts with AKT1 mRNA, we tested the miR-100 -mediated binding of RISC to AKT1 mRNA using an Ago2 -based ribonucleoprotein-IP assay (RIP-IP). [score:1]
An apparent enrichment of FOSL1 was observed in cells treated with miR-138, and no difference was observed in cells treated with miR-100. [score:1]
Apparent reduction in the serum -induced phosphorylation of p70S6K and 4E-BP1 was also observed in cells pre -treated with miR-100. [score:1]
Figure S3 The effect of miR-100 on IGF1R, mTOR, AKT1 mRNA levels in mouse skin wounds. [score:1]
MicroRNA-100 directly interacts with AKT1 mRNA. [score:1]
For functional analysis, miR-99a, miR-99b, miR-100 or control microRNA mimic (Dharmacon) was transfected into the cells using DharmaFECT Transfection Reagent 1 as described previously [20], [21]. [score:1]
As shown in Figure 4A, the AKT1 protein level decreased in cells that were treated with miR-100, miR-99a or miR-99b. [score:1]
Significant reduction in mTOR mRNA level was observed in cells that were treated with miR-99a, miR-99b or miR-100 (Figure 4B ). [score:1]
Statistically significant down-regulation in cell proliferation was also observed in cells treated with miR-99b and miR-100 mimic as measured by quantifying the DNA content (CyQUANT assay, Figure 2B ). [score:1]
0064434.g004 Figure 4HaCaT cells were transfected with mimics for miR-99a, miR-99b, miR-100 or negative control mimic. [score:1]
However, when cells were pre -treated with miR-100 mimic, the IGF1 -induced phosphorylation of p70S6K and 4E-BP1 were reduced dramatically. [score:1]
0064434.g003 Figure 3HaCaT cells were transfected with either negative control mimic (A) or miR-100 mimic (B), and then stimulated with IGF1 or serum. [score:1]
[1 to 20 of 53 sentences]
9
[+] score: 86
Other miRNAs from this paper: hsa-mir-100
In the GC cells, HAGLROS knockdown by siRNAs caused miR-100-5p up-regulation (Fig. 5c), while overexpression of miR-100-5p by transfection with mimics caused HAGLROS down-regulation (Fig. 5d). [score:10]
The miR-100-5p mimics significantly reduced the luciferase activity, while the miR-100-5p inhibitor markedly strengthened it, indicating that mTOR was a direct target of miR-100-5p. [score:6]
c miR-100-5p expression was examined in SGC-7901 and BGC-823 cells with HAGLROS knockdown by siRNAs, and HAGLROS expression was tested to determine the transfection efficiencies. [score:6]
In the one hand, HAGLROS competitively sponged miR-100-5p to increase mTOR expression by antagonizing miR-100-5p -mediated mTOR mRNA inhibition. [score:5]
HAGLROS overexpression negated the decrease in luciferase activity induced by overexpressing miR-100-5p (Fig. 6d). [score:5]
Mechanistic studies showed that HAGLROS regulated mTOR signaling by functioning as a competing endogenous RNA (ceRNA), which suppressed the degradation of mTOR mRNA by competing with miR-100-5p. [score:4]
Moreover, the expression of miR-100-5p and HAGLROS showed an inverse correlation in tumor samples in the higher expression of HAGLROS in GC compared to the adjacent non-cancerous tissue (Fig. 5e). [score:4]
To verifying this hypothesis, the 3′-UTR of mTOR was cloned into a luciferase vector and transfected into 293T cells together with miR-100-5p mimics, an miR-100-5p inhibitor or a negative control. [score:3]
Our study demonstrates that the GC -associated lncRNA HAGLROS is an oncogenic lncRNA that promotes tumorigenesis and progression through mTOR pathway -mediated autophagy suppression by serving as a ceRNA for miR-100-5p and as a cytoplasmic scaffold to bind mTORC1. [score:3]
These results show that HAGLROS and miR-100-5p are competitively expressed. [score:3]
On the one hand, HAGLROS functions as a ceRNA to increase mTOR mRNA expression through competing with miR-100-5p, on the other hand, HAGLROS binds mTORC1 key proteins to activate the complex and finally participates in cellular biological processes. [score:3]
c The effect of miR-100-5p overexpression by transfection with miR-100-5p mimics on mTOR mRNA level in GC cells. [score:3]
The fact that transfection of miR-100-5p mimics attenuated mTOR mRNA levels (Fig. 6c) suggested that mTOR might be the target of miR-100-5p. [score:3]
Endogenous HAGLROS pull-down by AGO2 was significantly enriched in miR-100-5p -overexpressing cells (Fig. 5g). [score:3]
The 3′-UTR of mTOR was cloned into the luciferase vector and transfected into 293T together with miR-100-5p mimics, the miR-100-5p inhibitor, the HAGLROS plasmid or the negative control. [score:3]
d Relative luciferase activity of mTOR mRNA 3’-UTR was determined after transfection with miR-100-5p mimics, miR-100-5p inhibitor or HAGLROS plasmid. [score:3]
We performed anti-AGO2 RIP to detect whether HAGLROS was regulated by miR-100-5p in an AGO2 -dependent manner. [score:2]
e The expression of miR-100-5p in tumor samples of GC compared to adjacent non-cancerous tissues. [score:2]
Subsequently, the 3′-UTR of mTOR was co -transfected with the HAGLROS plasmid and miR-100-5p mimics. [score:1]
This result implied that HAGLROS bound to miR-100-5p and released mTOR from miR-100-5p, further demonstrating the existence of HAGLROS-mTOR crosstalk through competition for miR-100-5p binding. [score:1]
Fig. 5Subcellular localization of HAGLROS and its “sponge” function as a ceRNA competing with miR-100-5p. [score:1]
lncRNA HAGLROS miR-100-5p mTOR Gastric cancer Autophagy Recent evidence indicates that although more than 70% of the eukaryotic genome is transcribed, only approximately 1 to 2% of the transcriptome contributes to protein-coding RNA, suggesting that transcription is not limited to the protein-coding portion of the eukaryotic genome but includes other non-protein-coding sections [1, 2]. [score:1]
HAGLROS functions as a ceRNA to antagonize miR-100-5p -mediated mTOR mRNA degradation. [score:1]
b Bioinformatic analysis of the interactions of HAGLROS with miR-100-5p and mTOR mRNA. [score:1]
; HAGLROS and mTOR interact through competition for miR-100-5p binding. [score:1]
php) software suggested that HAGLROS could bind both miR-100-5p and mTOR mRNA (Fig. 6b). [score:1]
The miR-100-5p sequence was synthesized, inserted into the pGL3-basic vector and co -transfected with wild-type and mutant HAGLROS (the binding site for miR-100-5p was mutated) plasmid into 293T cells. [score:1]
d HAGLROS levels were examined in SGC-7901 and BGC-823 cells transfected with miR-100-5p, and miR-100-5p levels were tested for transfection efficiencies. [score:1]
Error bars indicate the means ± S. E. M. * P < 0.05, ** P < 0.01, # P < 0.05To further determine the interaction of miR-100-5p and HAGLROS, we constructed luciferase vectors of wild-type and mutant HAGLROS (the binding site for miR-100-5p was mutated). [score:1]
php) software suggested that HAGLROS could bind both miR-100-5p and the Argonaute 2 (Ago2) protein. [score:1]
Error bars indicate the means ± S. E. M. * P < 0.05, ** P < 0.01, # P < 0.05 To further determine the interaction of miR-100-5p and HAGLROS, we constructed luciferase vectors of wild-type and mutant HAGLROS (the binding site for miR-100-5p was mutated). [score:1]
HAGLROS, as a mainly cytoplasmic lncRNA, serves as a sponge for miR-100-5p. [score:1]
Fig. 6HAGLROS antagonized miR-100-5p -mediated mTOR mRNA degradation. [score:1]
[1 to 20 of 33 sentences]
10
[+] score: 82
MiR-21 and miR-100 inhibition causes an increase of the expression levels of their target genes while miR-192 overexpression decreases target gene expression levels (B) In vitro modulation of miR-21, miR-100 and miR-192 expression result in a reduction of HSC activation. [score:15]
On the contrary, an inhibition of the endogenous miR-100 expression level enhanced the expression of its two predicted target genes, i. e. BTG2 and SPARCL1, but also caused a ~20% reduction of the basal expression of pro-fibrogenic genes such as COL1A1 and LOX. [score:11]
Indeed, 66% of miRNAs expressed in qHSCs were associated with at least 6 target genes with an average of 17,28 ± 10,7 target genes per miRNA, whereas we did not find any miRNA up regulated in aHSCs with more than 4 predicted targets except for miR-100 (Fig. 3B). [score:10]
MiR-100 is the up-regulated miRNA following HSC activation and has the highest number of predicted targets and miR-21 is not only up-regulated in activated HSC but also in human cirrhotic tissue. [score:9]
In concordance with the integrative analysis, functional in vitro assays showed that mir-100 inhibition resulted in SPARCL1 up-regulation and in a significant reduction of COL1A1 and LOX expression levels. [score:7]
Primer sequences used are listed in Supplementary Table 3. In vitro modulation of miRNA expression in human HSCs (LX2)In order to validate relevant miRNA-mRNA interactions resulting from the integrative analysis, miR-21 and miR-100 expression were knocked down and miR-192 was over-expressed in a human HSC cell line (LX2) (kindly provided by Dr. [score:7]
Reduction of miR-21 and miR-100 expression and up-regulation of miR-192 in LX2 cells was achieved by transfecting miR-21 antagomir (50 nM), miR-100 antagomir (50 nM) or miR-192 mimic (50 nM), respectively (n = 3). [score:6]
Among all miRNAs found highly expressed in aHSCs, miR-100 is the miRNA with the highest number of predicted target genes. [score:5]
Primer sequences used are listed in Supplementary Table 3. In order to validate relevant miRNA-mRNA interactions resulting from the integrative analysis, miR-21 and miR-100 expression were knocked down and miR-192 was over-expressed in a human HSC cell line (LX2) (kindly provided by Dr. [score:5]
LX2 cells were transfected with 50 nM of mirVana [TM] miRNA Inhibitor for miR-21 and miR-100 and mirVana [TM] miRNA mimic for miR-192 (Life Technologies) using JetPRIME® (PolyPlus, Illkirch, France) according to the manufacturer’s recommendations. [score:3]
In vitro modulation of miRNA-21, miRNA-100 and miRNA-192 expression in LX2 cells. [score:3]
As a control miRNA we used miR-100 and miR-21. [score:1]
[1 to 20 of 12 sentences]
11
[+] score: 35
Other miRNAs from this paper: mmu-let-7b, mmu-mir-16-1, mmu-mir-16-2
We also demonstrated that high mir-100 expression was associated with significant decreases in ERα gene expression level in oligospermic group. [score:5]
Expression level of mir-100, let-7b and ERα in oligospermic and control group We determined the expression levels of mir-100, let-7b and ERα in oligospermic and control group. [score:5]
It was proved that mir-100 targets ERα gene and directly sets the level of the ERα gene (10, 23). [score:4]
Figure 1Relative expression levels of mir-100 and let-7b in oligospermic and control group. [score:3]
By real-time quantitative RT-PCR analysis, we found that, expression levels of mir-100 and let-7b were much higher in oligospermic than control group (P=0.008 and P=0.009, respectively, Figure 1). [score:3]
Previous studies showed that mir-100 and let-7b were predicted to target ERα gene (10, 11). [score:3]
Both PTEN and AKT1 are common targets for mir-100 and let-7b. [score:3]
In the present study, we investigated the expression levels of mir-100, let-7b, their common target gene (ERα) and their correlation with oligospermic and normospermic control in men. [score:3]
In our study, we investigated mir-100, let-7b and their common target ERα gene expression in oligospermic infertile patients and compared them with normospermic fertile control by real-time PCR methods. [score:2]
Our result showed that mir-100 in oligospermic was significantly over expressed compared to control group. [score:2]
We have defined efficacy of mir-100, let-7b and ERα in oligospermic infertile patients. [score:1]
Fertility Has-mir-100 Has-let-7b MicroRNA Infertility is defined as a failure to bring baby after 12 or more months of consistently intercourse without contraception (1). [score:1]
[1 to 20 of 12 sentences]
12
[+] score: 31
In Alzheimer’s disease (AD), miR-100-5p was downregulated in the early-middle stages,, but upregulated at the late stages of the disease. [score:11]
Downregulation of miR-100-5p at the early stages of AD may protect neurons from amyloid β -induced apoptosis, while such protection can be lost at later stages when miR-100-5p gets upregulated [63]. [score:7]
Recently, miR-100-5p was shown to be an upregulated circulating marker of Huntington’s disease [61]. [score:6]
Two miRNAs (miR-191-5p and miR-100-5p) were up-regulated in TNBC and TNBC/DCP animals, as compared to intact controls (Figure 3). [score:3]
Along with miR-191-5p, miR-100-5p was upregulated in TNBC animals and TNBC/DCP animals, as compared to intact controls. [score:3]
More studies are needed to dissect the roles of miR-100-5p and PI3K/Akt/mTOR in tumor brain and chemo brain and how they relate to the changes induced by TNBC tumor growth and DCP treatment. [score:1]
[1 to 20 of 6 sentences]
13
[+] score: 25
The panel of differentially expressed miRNAs were validated by real-time PCR using TaqMan assays, and the results were consistent with the data that showed up-regulation of miR-21, miR-221, miR-100 and miR-26a and down-regulation of miR-26b, miR-141, miR-96, miR483-3p, miR-216, and miR-217 in the KC compared to control mice (Figure 1A). [score:7]
We have shown that in tumor samples compared to normal samples, the majority of miRNAs (miR-216, miR-217, miR-100, miR-345, miR-141, miR-483-3p, miR-26b, miR-150, Let-7b, Let-195 and miR-96) were downregulated, and few were upregulated (miR-146b, miR-205, miR-31, miR-192, miR-194 21, miR-379, miR-431, miR-541, and miR-199b). [score:6]
Further, at 50 weeks of age, the expression of miR-216, miR-217, miR-345, miR-141, miR-483-3p, miR-26b, miR-96, Let-7b (p-value = 0.01), miR-100, miR-26a and miR-150 (p-value = 0.094) were further downregulated in KC animals compared to control mice (Figure 2D). [score:5]
Several studies have shown the abnormal expression of miRNAs including miR-21, Let-7b, miR-100, miR-217, and miR-216 in PC and have proposed them as candidates for early diagnosis and potential molecular targets [23, 24]. [score:5]
Similarly, the expression of miR-10, miR-21, miR-100 and miR-155 was shown to increase in p48-Cre/Kras [G12D] mice when compared to control animals [59]. [score:2]
[1 to 20 of 5 sentences]
14
[+] score: 24
The upregulated miRNAs included mmu-miR-34a-5p, mmu-miR-129b-5p, mmu-miR-451a, mmu-miR-144-5p and mmu-miR-129b-3p, whereas highly downregulated miRNAs included mmu-miR-100-5p, mmu-miR-99a-5p, mmu-miR-33-5p, mmu-miR-125a-5p, mmu-miR-128-1-5p, mmu-miR-181b-1-3p, mmu-miR-188-5p, mmu-miR-196b-5p, mmu-miR-211-5p, mmu-miR-224-5p, mmu-miR-455-3p, mmu-miR-504-5p, mmu-miR-592-5p, mmu-miR-5107-3p, mmu-miR-5120, and mmu-let-7i-3p. [score:7]
Aberrant Expression of miRNAs in Lin [−]c-Kit [+] Cells of Mice Exposed to BenzeneWe detected the expression of 8 miRNAs (mmu-miR-129b-5p, mmu-miR-451a, mmu-miR-34a-5p, mmu-miR-144-5p, mmu-miR-342-3p, mmu-miR-100-5p, mmu-miR-181a-5p, and mmu-miR-196b-5p) in Lin [−]c-Kit [+] cells through qRT-PCR. [score:5]
In agreement with the sequencing data, the expression levels of mmu-miR-129b-5p, mmu-miR-451a, mmu-miR-34a-5p and mmu-miR-144-5p increased in the benzene exposure group, whereas the levels of mmu-miR-342-3p, mmu-miR-100-5p, mmu-miR-181a-5p, and mmu-miR-196b-5p decreased in the benzene exposure group (Figure 3). [score:3]
We detected the expression of 8 miRNAs (mmu-miR-129b-5p, mmu-miR-451a, mmu-miR-34a-5p, mmu-miR-144-5p, mmu-miR-342-3p, mmu-miR-100-5p, mmu-miR-181a-5p, and mmu-miR-196b-5p) in Lin [−]c-Kit [+] cells through qRT-PCR. [score:3]
MiR-100 could promote the cell proliferation of promyelocytic blasts and block granulocyte/monocyte differentiation by targeting RBSP3 in AML [44]. [score:2]
Akbari Moqadam F. Lange-Turenhout E. A. Aries I. M. Pieters R. den Boer M. L. MiR-125b, miR-100 and miR-99a co-regulate vincristine resistance in childhood acute lymphoblastic leukemia Leuk. [score:2]
MiR-129-5p and miR-100 were obviously different between patients with acute myeloid leukemia (AML) and normal controls [39, 44]. [score:1]
Of these miRNAs, five miRNAs, including mmu-miR-34a-5p, mmu-miR-342-3p, mmu-miR-100-5p, mmu-miR-181a-5p and mmu-miR-196b-5p, significantly changed in mice exposed to benzene. [score:1]
[1 to 20 of 8 sentences]
15
[+] score: 17
In the ileum, IPA indicated that increases in miR-34a-5p alters NF-κB; let-7g and miR-98 regulates STAT3; miR-34a, mR-188-5p, let-7a-5p, and miR-151-5p regulate MAPK; miR-20b regulates IL-10; let-7g and miR-98 regulate IL-10, IL-13, IL-6; miR-15b regulates IL-6; whereas miR-99a and miR-100 regulate TNF (Fig 8). [score:7]
CI increases not only miR-15, miR-99, and miR-100 that target IL-6 and TNF, but also let-7g and miR-98 that target STAT3, whose activation transcribes iNOS [61– 64]. [score:5]
RI and CI also increase miR-15, miR-99, and miR-100, which target IL-6 and TNF. [score:3]
Increases in miR-98, let-7g, miR-15b, miR-99a, and miR-100 predict to regulate STAT3, IL-10, IL-13, IL-6, and TNF. [score:2]
[1 to 20 of 4 sentences]
16
[+] score: 17
It is important to note that only 9 miRNAs (miR-100-5p, miR-130a-5p, miR-146b-3p, miR-147-3p, miR-151-5p, miR-155-3p, miR-223-3p, miR-301a-3p, and miR-495-3p) were significantly upregulated or downregulated in both lungs infected with either wild type w81 or the mouse-adapted ma81 strain at all time points (Tables  1 and 2). [score:7]
Twenty-seven and 20 differentially expressed miRNAs identified to be commonly presented at 1 and 3 dpi were presented in Tables  3 and 4. Of these, only miR-100-5p, miR-130a-5p, miR-146b-3p, miR-147-3p, miR-151-5p, miR-155-3p, miR-223-3p, miR-301a-3p, and miR-495-3p were commonly upregulated at both 1 and 3 dpi. [score:6]
It is noteworthy that only 9 miRNAs (miR-100-5p, miR-130a-5p, miR-146b-3p, miR-147-3p, miR-151-5p, miR-155-3p, miR-223-3p, miR-301a-3p, and miR-495-3p) were significantly upregulated in both lungs infected with either wild type w81 or the mouse-adapted ma81 strain at both time points. [score:4]
[1 to 20 of 3 sentences]
17
[+] score: 16
miR-34 family are reportedly as tumor-suppressor miRNAs implicated in reduced CSC properties and increased sensitivity to drug treatment by directly targeting NOTCH1 46. miR-100 is also upregulated in the TR subpopulation, and its expression levels relate to the cellular differentiation state, with lowest expression in cells displaying stem cell markers 47. [score:13]
The TR [2] subpopulation showed a significant increase in the expression levels of miR-93-5p, miR-34a-5p, miR-100-5p and miR-34c-5p (Fig. 4C). [score:3]
[1 to 20 of 2 sentences]
18
[+] score: 14
miRNA -dependent mTor pathway downregulation supports human iTreg generation (31) as evidenced by inhibition of iTreg differentiation in CD4+ T-cells overexpressing miR-100. [score:8]
Together, these data identify miRNA agonist targets (miR-99a, miR-150, iR-15b-16, miR-100, miR-126, and miR-155) that can be exploited to increase iTreg generation. [score:3]
The specific miR-100 editing (C-to-U transversion) changes the miR-100 target from mTor to SMAD2, augmenting TGF-β signaling and iTreg differentiation. [score:3]
[1 to 20 of 3 sentences]
19
[+] score: 13
The up-regulation of microRNA-100-5p predicts the down-regulation of 36 microRNA targets linked to G-protein -associated signaling (P = 4.08E-04) and cell proliferation processes (P = 1.53E-04). [score:9]
Doxycycline treatment had a direct impact on the expression of 2 microRNAs in Tregs: microRNA-100-5p and -1249-3p. [score:4]
[1 to 20 of 2 sentences]
20
[+] score: 13
Members of the miR-99 family (miR99a, and miR100, the fourth and seventh most abundant mouse sRNAs) are miRNAs that have been shown to co-enrich with polyribosomes in mammalian neurons, and regulate the mammalian target of rapamycin (mTOR) pathway 46. miR22, the eighth most abundant mouse sRNA, is important for cerebellar development, and in adults has been shown to protect neurons from neurodegeneration, and is down regulated in both Huntington’s and Alzheimer’s disease 47. miR127, along with a cluster of miRNAs found on chromosome14q32, is maternally expressed, and the down regulation of miRNAs within this cluster (including miR127) has been linked to schizophrenia 48. [score:11]
The third, fourth, seventh, eighth and ninth mapped to neuronal associated microRNAs, including miR128, miR99, miR100, miR22, and miR127 (21–22 nt). [score:1]
The most abundant sequences of sRNAs isolated and sequenced were over 30 nt; however, we did isolate and sequence miRNAs in the 20–21 nt range, including miR128, miR99a, miR100, miR22, and miR127. [score:1]
[1 to 20 of 3 sentences]
21
[+] score: 11
The results given in Table S1 show that expressions of miR-100, miR-125b, miR-135a, miR-138, miR-150, miR-146a, miR-221 which were decreased in HD cell mo del [33] were also decreased in and the expressions of miR-127-3p and miR-214 were increased in both STHdh [Q111]/Hdh [Q111] cells [33] and the R6/2 mouse mo del. [score:5]
Other miRNAs which showed a consistent expression pattern across the mo dels were miR-100, miR-214, miR-299, miR-335, miR-34a and miR-148a. [score:3]
Expressions of miR-100 and miR-135b were also decreased in two of the four cell mo dels. [score:3]
[1 to 20 of 3 sentences]
22
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Other miRNAs recently implicated in breast cancer include miR-100, shown to target SMARCA5, SMARCD1, and BMPR2 genes, which directly influence tumor cell proliferation [80], and miR-30c, known to target TWF1 and IL-11 [81], both of which are expressed in the MaSC/basal lineage. [score:8]
Deng L Shang L Bai S Chen J He X Martin-Trevino R MicroRNA100 inhibits self-renewal of breast cancer stem-like cells and breast tumor developmentCancer Res. [score:3]
[1 to 20 of 2 sentences]
23
[+] score: 10
EF24 treatment inhibits miR-21 expression, but does not affect the expression of several other miRNAs, including miR-100, -126, -181a and -200a. [score:7]
As shown in Figure 4A and D EF24 treatment of DU145 and B16 cells, respectively, reduced miR-21 levels by >70%, while it had no effect on the expression levels of miR-100, -126, -181a and -200a (Fig. 4B and E). [score:3]
[1 to 20 of 2 sentences]
24
[+] score: 10
To this end, inhibition of miR-100 has been shown previously to enhance perfusion recovery following FAL (Grundmann et al., 2011), and we have recently determined that miR-199a inhibition is a potent enhancer of perfusion recovery and arteriogenesis following FAL in Balb/c mice (Heuslein and Price, 2017). [score:5]
MicroRNA-100 regulates neovascularization by suppression of mammalian target of rapamycin in endothelial and vascular smooth muscle cells. [score:5]
[1 to 20 of 2 sentences]
25
[+] score: 9
Moreover, analysis of the miRNA expression profiling data and the list of target mRNAs showed that miR-100, miR-184 and miR-10a were especially expressed in human MII oocytes, while miR-29a, miR-30d, miR-21, miR-93, miR-320a, miR-125a and let7 were expressed in the human cumulus cells. [score:9]
[1 to 20 of 1 sentences]
26
[+] score: 9
The O. volvulus miR-100 and bantam miRNAs identified have distinct sequences outside of their seed regions from the miRNAs in H. polygyrus (Figure  4). [score:1]
Strikingly multiple miR-100 and bantam family members are present in the datasets. [score:1]
We recently identified 16 miRNAs in the serum of mice infected with the filarial nematode L. sigmodontis and four of these are identical to the O. volvulus miRNAs detected in human serum (mir-71, two miR-100 members, and one bantam family member) and one is derived from the other arm of the hairpin of a O. volvulus miRNA (miR-87). [score:1]
Four of these are also identical to those found in the serum of mice infected with L. sigmodontis including miR-100 and bantam family members. [score:1]
A common feature in all the infections is the presence of miR-71, bantam family and miR-100 family miRNAs (where family is defined based on identical seed sequences, nucleotides 2–8). [score:1]
The factors dictating the expansion of this miRNA family are not known; miR-100 is one of the oldest miRNAs, having evolved in the last common ancestor of Eumetazoa (the highly conserved sequence is noted in Figure  4 and is identical across parasitic nematodes and all of their mammalian hosts). [score:1]
The conserved miR-100 sequence (Eumetazoa) is shown in relation to the nematode family members identified in these datasets: O. volvulus (OVO), O. ochengi (OOC), L. sigmodontis (LSI) or H. polygyrus (Hpolygyrus). [score:1]
Figure 4 Sequences of extracellular miR-100 and bantam family members in nematode parasites. [score:1]
We previously identified 5 miR-100 family members within the top 20 most abundant miRNAs secreted by H. polygyrus [9]. [score:1]
[1 to 20 of 9 sentences]
27
[+] score: 8
It has been reported that miR-100 is downregulated and targets mTOR in clear cell ovarian cancer [29] and childhood adrenocortical tumors [20]. [score:6]
These characteristics of miR-100 and miR-199a-3p are quite similar to those of miR-99a, indicating that mTOR expression might be regulated redundantly by various closely related miRNAs. [score:2]
[1 to 20 of 2 sentences]
28
[+] score: 8
Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42]. [score:8]
[1 to 20 of 1 sentences]
29
[+] score: 8
KEGG pathway analysis predicted, with a high degree of confidence (p<0.001), miR-99b regulation of the mTOR (mammalian target of rapamycin) pathway, whereas association of miR-99a and miR-100 with the mTOR pathway was predicted with lower confidence (p<0.005) (Figures 5B, 6B, and 9B). [score:4]
miR-99a-5p belongs to expression cluster 4, miR-99b-5p to cluster 7, and miR-100-5p to cluster 3 (Figures 5A, 6A, and 9A). [score:3]
The validity of this pathway clustering approach is further supported by analysis of the miRNA family formed by miR-99a, miR-99b, and miR-100. [score:1]
[1 to 20 of 3 sentences]
30
[+] score: 8
In addition, developmental upregulation of some miRNAs identified in our screen was observed in differentiating oligodendrocytes in vitro, including miR-146, miR-23b, miR-24, and miR-27b in one study [13] and miR-204, miR-27b and miR-100 very recently in another study [20]. [score:5]
Besides miR-34a, other miRNAs that were identified in our screen were previously found to be associated with an inhibitory effect on proliferation of non-neural tumor cells, including miR-24 in HeLa cells [25] and miR-100 in oral squamous cell carcinoma [26]. [score:3]
[1 to 20 of 2 sentences]
31
[+] score: 7
Three miRNAs (miR-126-3p, miR-221 and miR-200c) were exclusively up-regulated in thymocytes of DBA-1/J strain, and three others (miR-let-7e, miR-100 and miR-19a*) were exclusively up-regulated in the DBA-2/J strain. [score:7]
[1 to 20 of 1 sentences]
32
[+] score: 7
We confirmed that six of the eight selected down-regulated hsa-miRNAs (miR-145, miR-497, miR-150, miR-342-5p, miR-34b* and miR-100) were significantly down-regulated in NPC tissues, whereas miR-195 and miR-143 exhibited no significant difference between the two groups of subjects (Fig. 1D). [score:7]
[1 to 20 of 1 sentences]
33
[+] score: 7
showed that the expression of the top four most abundant miRNAs (miR-184, miR-100, miR-9b and let-7) is stable during the crab oocyte maturation. [score:3]
miR-100 and let-7 are involved in developmental timing in the nematode and the fly [22]. [score:2]
The selected miRNAs include top four most abundance miRNAs (miR-184, miR-100, miR-9b and let-7) in the ovaries and two miRNAs (miR-275 and miR-252) related to oogenesis in fruit fly [13]. [score:1]
The top 4 most abundant miRNAs include miR-184, miR-100, miR-9b and let-7. Each of these miRNAs has more than 10,000 reads. [score:1]
[1 to 20 of 4 sentences]
34
[+] score: 7
We also observed significant inhibition of immunostimulatory ssRNA sensing by select LNA/DNA phosphorothioate AMOs from Classes 3 and 4. Although miRNA -based mechanisms could be at play for LNA/DNA AMOs targeting abundant miRNAs (such as miR-191-5p, miR-16-5p, miR-29a-3p or miR-100-5p), such effects can be ruled out for other AMOs of Class 3 targeting poorly abundant miR-224-5p, miR-331-3p, miR-134-5p or miR-31-5p. [score:7]
[1 to 20 of 1 sentences]
35
[+] score: 7
Similarly, the next most highly expressed mGliomiRs have at least 6 fold higher expression in MG than neurons, and miR-100 has less than 1% expression in neurons as compared to MG (Fig. 2A, Supplement Table 2). [score:6]
For the other mGliomiRs, miR-135a 40 51, miR-23a 45, and miR-99a 40 have been reported in astrocytes as well as for Schwann cells in the sciatic nerve along with miR-100 48, indicating that these miRNAs could be common among glia. [score:1]
[1 to 20 of 2 sentences]
36
[+] score: 7
Among the five miRNAs predicted to target SREBP-1c, gga-miR-99a, gga-miR-100, gga-miR-200b and gga-miR-429 were found to be significantly (P < 0.05) up-regulated in the liver of leptin -treated chickens. [score:6]
It is noteworthy that gga-miR-99a and gga-miR-100 belong to the miRNA gene family of miR-99, while the remaining three miRNAs, gga-miR-200a, gga-miR-200b and gga-miR-429, belong to the miRNA gene family of miR-8, located in the same miRNA cluster. [score:1]
[1 to 20 of 2 sentences]
37
[+] score: 6
The predicted targets of miR-100* and a prevalent 5′ isomiR derived from a +1 position (57% and 77% of HL-1 and heart biopsy tags, respectively) have similar proportions of targets functioning in cardiovascular development. [score:6]
[1 to 20 of 1 sentences]
38
[+] score: 6
Analysis revealed significantly increased expression of miR-21-5p, miR-100-5p and miR-146-5p, and decreased expression miR-126-5p, in SIVE. [score:5]
Additionally, we also found two other miRNAs to increase at much lower levels of change and significance, miR-100-5p and miR-146-5p, and one miRNA to be decreased, miR-126-5p. [score:1]
[1 to 20 of 2 sentences]
39
[+] score: 6
Cluster1-a (let-7a-2, miR-100, miR-125b-1) and Cluster1-b (let-7c, miR-99a, miR-125b-2) are involved in HSPC (hematopoietic stem and progenitor cell) homeostasis such as self-renewal, proliferation, quiescence, and differentiation by blocking TGFβ pathway and amplifying Wnt signaling (Emmrich et al., 2014), whereas LIN28B represses let-7 to inhibit erythroid development and maintain stemness (Copley et al., 2013; Lee et al., 2013b). [score:4]
However, miR-125a is responsible for most of these properties in cluster 1-c and the transcription of miRNAs in cluster 1-a (let-7a-2, miR-100, and miR-125b-1) are loosely related (Sempere et al., 2004; Gerrits et al., 2012). [score:1]
Cluster 1, which contains three miRNAs, including let-7a, miR-100, and miR-125, is also conserved in D. melanogaster (Table  2). [score:1]
[1 to 20 of 3 sentences]
40
[+] score: 6
Expression levels of miR-99b-5p and miR-100-5p were reduced in 6- and 9-month-old AD mice, but increased at 12 months of age. [score:3]
Similar to miR-331-3p, some miRNAs such as miR-99b-5p, miR-100, miR-7b-5p and miR-501-3p also have a reversed expression change at late stage of AD (12 months) compared with those at relatively early AD stages (6 to 9 months). [score:2]
Among them, nine miRNAs (miR-99b-5p, miR-7b-5p, miR-7a-5p, miR-501-3p, miR-434-3p, miR-409-5p, miR-331-3p, miR-138-5p and miR-100-5p) showed consistent changes in both groups. [score:1]
[1 to 20 of 3 sentences]
41
[+] score: 6
miR-100 is downregulated after femoral artery occlusion and inhibition of miR-100 restores perfusion in hindlimb ischemic region in vivo [18]. [score:6]
[1 to 20 of 1 sentences]
42
[+] score: 5
Such as miR-100, miR-124, miR-206, miR-5116 and miR-760 were significantly downregulated in ICAM-1 knockout mouse lung tissue. [score:5]
[1 to 20 of 1 sentences]
43
[+] score: 5
The secretory products are dominated by miRNAs with identical seed sites to mouse miRNAs, many of which are ancient: six are shared among Eumetazoa (lin-4/miR-125 and five miR-100 family members, Fig. 2a, red) and five among Bilatera (miR-79/miR-9, miR-83/miR-29, miR-263/miR-183 and two let-7 family members, Fig. 2a, blue). [score:1]
Blots were prehybridized in PerfectHyb (Sigma) for 1 h at 42 °C before overnight incubation with DNA probes (Invitrogen) that were perfectly complementary to the miRNA or Y RNA: miR-100: 5′-ACACAAGTTCGGATCTACGGGTT-3′, YRNA-5P: 5′-ACCCTACGACTCCGGACCAAGCGCG-3′, YRNA-3P: 5p-GCGCCGGTCGAGCTTTTGTCGAAGGGAAT-3p, Y RNA-loop: 5p-AAGGGAATTCGAGACATTGTTGATAAC-3p. [score:1]
Analysis of miRNA levels in ultracentrifugation fractions was carried out using the miScript system (Qiagen) with unmodified DNA probes identical to the full-length parasite miRNA (Life Sciences): miR-100: 5′-AACCCGTAGATCCGAACTTGTGT-3′, miR-71: 5′-TGAAAGACATGGGTAGTGAGAC-3′, let-7: 5′-TGAGGTAGTAGGTTGTATAGTT-3′ and miR-60: 5′-TATTATGCACATTTTCTGGTTCA-3′. [score:1]
Although we cannot rule out the possibility that some of the miRNAs in serum could derive from dying worms, the most abundant miRNAs detected are homologues of those found in H. polygyrus exosomes, including miR-100, bantam, miR-71 and miR-263 (Table 2, Fig. 8). [score:1]
Northern blot analysis confirmed the specificity of small RNA biotypes in vesicles versus supernatant, showing miR-100 to be exclusively present in the vesicles and the Y RNA fragment to be exclusively present in the supernatant (Fig. 4b). [score:1]
[1 to 20 of 5 sentences]
44
[+] score: 5
microRNA-100 promotes the autophagy of hepatocellular carcinoma cells by inhibiting the expression of mTOR and IGF-1R [41]. [score:5]
[1 to 20 of 1 sentences]
45
[+] score: 5
The following conventions for miRNA naming are used: (i) The predicted stem-loop portion of the primary transcript is named by a 3 or 4 letter species prefix and a numerical suffix (e. g. hsa-mir-100 in Homo sapiens). [score:1]
Whereas, the name of the excised ~22 nucleotide sequence (mature miRNA) contains the same mir, prefix and suffix as stem-loop but with capital miR (e. g. hsa-miR-100). [score:1]
In some cases, the asterisk has been used to denote the less predominant form (e. g. hsa-miR-100*). [score:1]
and a prefixed species identifier (e. g. hsa-miR-100) [7, 37, 38]. [score:1]
The following conventions for miRNA naming are used: (i) The predicted stem-loop portion of the primary transcript is named by a 3 or 4 letter species prefix and a numerical suffix (e. g. hsa-mir-100 in Homo sapiens). [score:1]
[1 to 20 of 5 sentences]
46
[+] score: 5
Members of let-7 (a, b, c, d, e), and 11 other miRNAs (miR-100, -10a, -10b, -132, -143, -181a, -196b, -199a-5p, -23a, -383, -505) are also listed as miRNA that are expressed at high level in somatic cells in human analysis (Fig. 1C), suggesting that these miRNAs are relatively low expression level in pluripotent cells commonly in human and mouse. [score:5]
[1 to 20 of 1 sentences]
47
[+] score: 5
The two ESFT cell lines revealed a similar miRNA expression profile, characterized by repression of the entire let-7 family, miRNA-100, miRNA-125b and miRNA-31, and over -expression of the miRNA 17–92 cluster and its paralogs miRNA-106a and miRNA-106b (Figure 1A). [score:3]
Right: Real-Time PCR analysis of miRNA-100 and miRNA-125b in MSC, A673, TC252 cells and primary ESFT. [score:1]
A) Real-Time PCR analysis of miRNA-100, miRNA-125b in MSC, STA-ET-8.2 and SK-ES-1 cells. [score:1]
[1 to 20 of 3 sentences]
48
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
MiR-206, miR-133, miR-199, miR-100 and miR-195 were implicated in the autophagy pathway targeting BCL2, MTOR and SQSTM1 as possible autophagy gene targets (Table 6). [score:5]
[1 to 20 of 1 sentences]
49
[+] score: 5
6 miRNAs (miR-221-3p, miR-181-5p, miR-181b-5p, miR-712-5p, miR-345-5p, miR-100-5p; Fig. 4a2,b2) showed a lower expression level in KO crypts than KO villi, but showed higher expression level in WT crypts than WT villi (Fig. 4b2: Red spots vs Fig. 4a2: Blue spots). [score:5]
[1 to 20 of 1 sentences]
50
[+] score: 5
miR-100 suppressed the maintenance and expansion of CSCs in breast cancer, and ectopic expression of this miRNA enhanced CSC differentiation [8, 9]. [score:5]
[1 to 20 of 1 sentences]
51
[+] score: 5
Other miRNAs from this paper: mmu-mir-122
Combination of C/EBPα and promoter in miR-100 could suppress tumor metastasis by targeting ZBTB7A in gastric cancer [10]. [score:5]
[1 to 20 of 1 sentences]
52
[+] score: 4
The overexpression of miR-100, let-7e, and miR-99a, which have been shown to be powerful regulators of the epithelial-to-mesenchymal transition (EMT) [28– 30], was found in the mesenchymal tumor subtype. [score:4]
[1 to 20 of 1 sentences]
53
[+] score: 4
Overexpression of miR-100 can increase radiosensitivity in human glioma cells [21], while radioprotective effects have been observed in epithelial cells after miR-125a regulation [48]. [score:4]
[1 to 20 of 1 sentences]
54
[+] score: 4
Previous studies demonstrated that other miRNAs, such as let-7 [37], miR-100, and miR-200c [38], were also downregulated in CSCs. [score:4]
[1 to 20 of 1 sentences]
55
[+] score: 4
Once again we identified a number of miRNAs whose expression appeared to be repressed at a single time point including miR-187 (1 hrs), miR-27b (6 h), miR-29c (6 h), miR-100 (6 h), miR-149 (6 h), miR-150 (6 h) and miR-154 (6 h) (Table S2). [score:3]
Nonetheless, bioinformatic investigation of the 3' UTRs of TNF-α, KC and MIP-2 predicts that only TNF-α might contain MRE sites for miR-25 and miR-100 and implies that miRNAs are unlikely to regulate the LPS -induced response through direct action upon the mRNAs of these inflammatory mediators. [score:1]
[1 to 20 of 2 sentences]
56
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-mir-34c, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, mmu-mir-346, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, hsa-mir-381, mmu-mir-375, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-346, hsa-mir-196b, mmu-mir-196b, hsa-mir-18b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, mmu-mir-92b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Our results are also mostly in agreement with those of Esau et al. [25] who identified a similar expression pattern regarding miR-130b, miR-30c, miR-30a*, miR-191, miR-30d, miR-196, miR-30b, miR-19b, miR-92, miR-138 and miR-100 during differentiation of cultured human adipocytes. [score:3]
[1 to 20 of 1 sentences]
57
[+] score: 3
MicroRNA-100 regulates osteogenic differentiation of human adipose-derived mesenchymal stem cells by targeting BMPR2. [score:3]
[1 to 20 of 1 sentences]
58
[+] score: 3
miR-100 has been shown to inhibit GVHD-related neovascularization, which is a common pathomechanistic feature of GVHD and ischemia [10]. [score:3]
[1 to 20 of 1 sentences]
59
[+] score: 3
Furthermore, the expression levels of 8 DEMs (i. e., miRNA-1927, miRNA-802-5p, miRNA-6236, miRNA-3968, miRNA-126-5p, miRNA-100-5p, miRNA-5100, and miRNA-3102-3p) were also verified by qRT-PCR (Supplementary Table S5). [score:3]
[1 to 20 of 1 sentences]
60
[+] score: 3
Three miRNAs associated with human basal-type tumors (miR-135b, miR-505 and miR-155), and seven miRNAs associated with human luminal type tumors (let-7a, let-7f, miR-100, miR-130a, miR-152, miR-214 and miR-29b) are similarly expressed in mouse basal-like and luminal-type tumors, respectively. [score:3]
[1 to 20 of 1 sentences]
61
[+] score: 3
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
A comparison of effects of ACTH and DEX shows that both hormones increased the expression miRNA-181b, miRNA-672, and miRNA-100, and significantly decreased the levels of miRNA-92a, and miRNA-466b. [score:3]
[1 to 20 of 1 sentences]
62
[+] score: 3
Differential expression of microRNAs let-7a, miR-125b, miR-100 and miR-21 and interaction with NF-kB pathway genes in periodontitis pathogenesis. [score:3]
[1 to 20 of 1 sentences]
63
[+] score: 3
MiRNA entities for normalization were selected via NormFinder analysis based on microarray data (39) and mmu-miR-100-5p was used for normalization. [score:1]
Mmu-miR-100-5p was used for normalization using the ΔΔ C [t] method. [score:1]
/design ID (custom) Target miRNA sequence mmu-miR-33-5p 204632 GUGCAUUGUAGUUGCAUUGCA mmu-miR-100-5p 204133 AACCCGUAGAUCCGAACUUGUG mmu-miR-1971 206999 (custom)/design ID 212160 GUAAAGGCUGGGCUGAGA mmu-miR-1947-3p 206999 (custom)/design ID 212154 GCACUGAGCUAGCUCUCCCUCC rno-miR-3559-3p 206999 (custom)/design ID 212147 AUGUAGUACUGAGUCUGUCGUG ebv-miR-BART8-3p 206999 (custom)/design ID 212150 GUCACAAUCUAUGGGGUCGUAGA We employed either pre-designed LNA™ PCR primer sets for miRCURY LNA™ Universal RT microRNA PCR or Custom LNA™ PCR primers (UniRT) (Exiqon A/S, Vedbaek, Denmark). [score:1]
[1 to 20 of 3 sentences]
64
[+] score: 3
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Brain research 55 Henson B Bhattacharjee S O'Dee D Feingold E Gollin S 2009 Decreased expression of miR-125b and miR-100 in oral cancer cells contributes to malignancy. [score:3]
[1 to 20 of 1 sentences]
65
[+] score: 3
For example, Lee EJ 2007 et al. [44] showed that the miRNAs miR155, miR21, miR222, Let7, miR376a, miR301, miR100, miR125, miR142 and others are overexpressed significantly in human PC. [score:3]
[1 to 20 of 1 sentences]
66
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-2, hsa-let-7c, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-2, hsa-mir-100, hsa-mir-29b-2, mmu-let-7i, mmu-mir-99b, mmu-mir-125a, mmu-mir-130a, mmu-mir-142a, mmu-mir-144, mmu-mir-155, mmu-mir-183, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-148a, mmu-mir-143, hsa-mir-181c, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-298, mmu-mir-34b, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-130a, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-125a, mmu-mir-148a, mmu-mir-196a-1, mmu-let-7a-2, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-mir-15a, mmu-mir-16-1, mmu-mir-21a, mmu-mir-22, mmu-mir-23a, mmu-mir-24-2, rno-mir-148b, mmu-mir-148b, hsa-mir-200c, hsa-mir-155, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181c, hsa-mir-34b, hsa-mir-99b, hsa-mir-374a, hsa-mir-148b, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7i, rno-mir-21, rno-mir-22, rno-mir-23a, rno-mir-24-2, rno-mir-29b-2, rno-mir-34b, rno-mir-99b, rno-mir-100, rno-mir-124-1, rno-mir-124-2, rno-mir-125a, rno-mir-130a, rno-mir-142, rno-mir-143, rno-mir-144, rno-mir-181c, rno-mir-183, rno-mir-199a, rno-mir-200c, rno-mir-200b, rno-mir-181a-1, rno-mir-298, hsa-mir-193b, hsa-mir-497, hsa-mir-568, hsa-mir-572, hsa-mir-596, hsa-mir-612, rno-mir-664-1, rno-mir-664-2, rno-mir-497, mmu-mir-374b, mmu-mir-497a, mmu-mir-193b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-568, hsa-mir-298, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, hsa-mir-664a, mmu-mir-664, rno-mir-568, hsa-mir-664b, mmu-mir-21b, mmu-mir-21c, rno-mir-155, mmu-mir-142b, mmu-mir-497b, rno-mir-148a, rno-mir-15a, rno-mir-193b
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
[1 to 20 of 2 sentences]
67
[+] score: 2
These include miRNAs with known roles in breast cancer development such as miR-7, miR-10b, miR-21, miR-100, miR-155, miR-195, miR-221, and miR-218. [score:2]
[1 to 20 of 1 sentences]
68
[+] score: 1
The AMO-miR-100-scrambled (0.144 mM/shrimp) was included in the injections. [score:1]
[1 to 20 of 1 sentences]
69
[+] score: 1
In the simple search module, a search box enables users to retrieve data based on gene name (e. g., PTEN, has-miR-100 and HOTAIR) or GPA id (e. g., GPAHSA000001). [score:1]
[1 to 20 of 1 sentences]
70
[+] score: 1
Of the 74 metastamiRs identified in this study, we found an overlap of 16 metastamiRs, including Hsa-miR-148b, Hsa-miR-23a, Hsa-miR-100, Hsa-miR-93, Hsa-miR-125b, Hsa-miR-98, Hsa-miR-92a, Hsa-miR-29b, Hsa-miR-30c, Hsa-let-7a, Hsa-let-7b, Hsa-let-7c, Hsa-let-7e, Hsa-let-7f, and Hsa-let-7g, with the findings of other researchers. [score:1]
[1 to 20 of 1 sentences]
71
[+] score: 1
These miRNAs include miR-29a/b, miR-100, miR-107, miR-130b, miR-193b, miR-343-3p, miR-351, and miR-455. [score:1]
[1 to 20 of 1 sentences]
72
[+] score: 1
For example, in breast cancer, the transfer of EVs containing miR-100, miR-122 and miR-30a from resistance MCF-7 breast cancer cells are known to promote chemotherapy resistance to MCF-7 drugs sensitive cells [11]. [score:1]
[1 to 20 of 1 sentences]
73
[+] score: 1
A cluster brings together miRNAs with inter-miRNA distance up to 10 kb and can form a polycistronic transcriptional unit (for example, mir-100/let-7/mir-125 and mir-71/mir-2 clusters) [6– 8]. [score:1]
[1 to 20 of 1 sentences]
74
[+] score: 1
Thus, the mice were administered, in approximately 6 seconds, with a bolus injection in the tail vein with 10% of their weights (g) in volume (ml) of a complex containing MIRUS polimer solution (Madison, USA) and approximately 20 mg of DNA according to the manufacturer's instructions (MIRUS: MIR-100 trans IT [® ]in vivo gene delivery system) at a constant rate. [score:1]
[1 to 20 of 1 sentences]
75
[+] score: 1
41 mmu-miR-33 −59.71 mmu-miR-222 1.23 mmu-miR-93 −1.52 mmu-miR-124 −97.01 mmu-miR-429 1.07 mmu-miR-192 −1.52 mmu-miR-129-5p −111.43 mmu-miR-100 −1.74 mmu-miR-210 −157.59 mmu-miR-20a −2 mmu-miR-134 −194.01 mmu-miR-137 −2 mmu-miR-215 −222.86 mmu-miR-194 −2.14 mmu-miR-452 −675.59 mmu-miR-196a −2.64 mmu-miR-223 −955.43 Differentiated sample versus control sample [DIF EBs d8/CONTROL EBs d8]. [score:1]
[1 to 20 of 1 sentences]