sort by

303 publications mentioning mmu-mir-200c (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-200c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 383
It was confirmed that miR-200c directly targets FAP-1, a known inhibitor of CD95 -mediated apoptosis in these cells, and that the likely mechanism for the sensitivity seen was due to an increase of CD95 surface expression because of FAP-1 suppression. [score:10]
To determine whether down-regulation of the miR-200 family plays a role in arsenic -induced cell malignant transformation, we first transiently re-expressed miR-200b or -200c in arsenic-transformed cells and found that re -expression of miR-200b or -200c alone or together restored E-cadherin expression and the epithelial-like cellular morphology, and reduced the formation of colonies in soft agar. [score:10]
To determine whether miR-200 suppresses metastasis by targeting ZEB1, the ZEB1 expressing cDNA lacking the 3′UTR was engineered into the MDA-MB-231 LM2 cells that stably expressed miR-200b. [score:9]
Importantly, it was found when C2 was stably expressed the other cluster (C1) also showed a significant increase in expression levels; however, C1 overexpression did not increase the expression levels of C2 miR-200 members. [score:9]
Through down -regulating ZEB1 and ZEB2 expression, the miR-200 family can effectively up-regulate cellular E-cadherin level and maintain a cell in a more epithelial-like state. [score:7]
Additionally since these studies have shown that it is the overexpression of the miR-200c/141 cluster that causes the increase in metastatic colonization, it is possible that the miR-200c/141 cluster may act as a suppressor for early steps of metastasis, but facilitates post-extravasation events while the miR-200b/a/429 cluster suppresses metastasis at all steps. [score:7]
Using specific miR-200 inhibitors, this group found that the miR-200 inhibitors increased cell migration of Madin-Darby canine kidney epithelial cells, suggesting that the miR-200 family inhibits cell migration. [score:7]
Of these nine targets, three were confirmed as direct targets of miR-200: cofilin 2 (Cfl2), low-density lipoprotein receptor-related protein 1 (Lrp1) and Sec23a, a key component of COPII vesicles. [score:6]
Furthermore, these and others have shown that the miR-200 family is a strong inhibitor of EMT, and that EMT resulting from the loss of the miR-200 family depends on ZEB1 and/or ZEB2 up-regulation. [score:6]
Completing these studies will lead to the discovery of more miR-200 targets and ultimately the development of novel and targeted therapeutic options for the treatment of cancer. [score:6]
Further work showed that stably expressing miR-200c induces anoikis in these cells by directly targeting TrkB, a neurotrophic tyrosine receptor kinase. [score:6]
In addition, another study revealed that loss of miR-200c expression is associated with poorly differentiated endometrial carcinoma; and restoration of miR-200c in a papillary uterine cancer line significantly increased its chemosensitivity to the microtubule -targeting chemotherapeutics paclitaxel, vincristine, and epothilone B [103]. [score:5]
These findings suggest that downregulation of miR-200c may contribute to the development of chemoresistance in melanoma. [score:5]
Results from this experiment showed that expression of miR-200b and miR-200c enhance the sensitivity of LY2 breast cancer cells to growth inhibition by both 4-OHT and fulvestrant. [score:5]
Therefore, it was concluded that the miR-200 family elicits this inhibitory effect on cell migration by targeting both ZEB1/2. [score:5]
Schickel et al. found that stably expressing miR-200c in CAKI-1 kidney and HeyA8 ovarian or transiently expressing it in ACHN kidney cancer cells, caused these cells to be much more sensitive to CD95 (a death receptor) -mediated apoptosis when treated with a CD95 agonist [74]. [score:5]
These studies suggest that even though the miR-200 reduces the number of cancer cells in the bloodstream, probably by strongly inhibiting the early metastatic steps, those cancer cells that have high expression levels of miR-200s and do manage to get through the extravasation step are more capable of colonizing a distant organ. [score:5]
However, in contrast to the findings from above studies, Hamano et al. found that miR-200c overexpression induces cisplatin resistance in esophageal cancer cells (TE8-R) [106], suggesting that the relationship between the miR-200c expression levels and chemoresistance may be cellular context and drug dependent. [score:5]
Recent studies have shown that the miR-200 family can inhibit angiogenesis because the family targets multiple key players in this process. [score:5]
These data suggests that the miR-200 family targets pathways involved in inhibiting metastatic colonization. [score:5]
Recent studies suggest that the miR-200 family is pivotal in regulating EMT by targeting ZEB1 and ZEB2 via direct interactions with their 3′UTRs [61– 63]. [score:5]
It was determined that the promoter regions of the miR-200 family were indeed highly methylated upon treatment with the carcinogen, and demethylation induced by DNA methyltransferase inhibitors or demethylation chemicals increased the expression of the miR-200 family. [score:5]
The expression levels of the miR-200 family members was determined by qPCR in MCF-7 cells that were either sensitive or resistant (LY2) to endocrine treatment, and showed that the expression of miR-200b, -200a, and -200c was significantly decreased in the endocrine-resistant cell lines. [score:5]
In contrast, injection of the modified C2 or C1+C2 4TO7 cells (cell lines that both express high levels of all five miR-200 members) formed more lung metastases than the parental or C1 alone overexpressing 4TO7 cells [72]. [score:5]
Xu and colleagues were able to show that miR-200 family expression was significantly correlated with the status (benign, non-recurrent or recurrent primary, or metastatic) of a melanoma tumor, therefore expanding the potential role of the miR-200 family as a prognostic marker in this disease [91]. [score:5]
It has been shown that stably expressing both miR-200 cluster members reduced the ability of cancer cells to enter the blood stream, and that E-cadherin overexpression can also decrease the number of cells in the blood stream [72]. [score:5]
Not only has the miR-200 family been shown to inhibit cellular malignant transformation, but studies have also shown that they are capable of suppressing tumor growth. [score:5]
It was found that miR-200c was significantly downregulated in doxorubicin-resistant cells. [score:4]
Similarly, miR-200c has also been shown to directly target KDR [48]. [score:4]
Another study looked at the effects of miR-200 on targets that regulate the reorganization of the actin cytoskeleton to promote invasiveness [56]. [score:4]
A summary of the validated direct targets of the miR-200 family. [score:4]
Therefore, downregulation of miR-200 family levels in tumor cells can help the cell survive within the bloodstream by reducing apoptosis. [score:4]
Studies have shown that the miR-200 family plays a role in reducing chemoresistance by targeting these genes known to play a direct role in developing this resistance. [score:4]
This work showed for the first time a global regulatory network directly regulated by miR-200 family, which provided a novel mechanistic insight for miR-200 family maintaining the key features of the epithelial phenotype and preventing cell migration. [score:4]
The expression of the miR-200 family can be regulated through interactions with, and modifications of their promoters. [score:4]
Studies on the miR-200 family have enhanced our knowledge of the crucial roles that they may play in cancer development and progression through targeting a variety of important proteins. [score:4]
In another study, miR-200c was shown to target Noxa, a member of the Bcl-2 family, in MCF7 breast cancer cells [75]. [score:3]
Together, these studies suggest that loss of miR-200 expression may play an important role in the early stage of carcinogenesis. [score:3]
Recent research done in our laboratory has been the first to show an important role of the miR-200 family in inhibiting and preventing cell malignant transformation by a carcinogen exposure [35]. [score:3]
However, ours and other recent studies also suggest that the miR-200 family can inhibit cell migration independent of its effect on ZEB1/ZEB2. [score:3]
A miRNA microarray analysis showed that the expression levels of miR-200 family were drastically reduced in arsenic-transformed cells. [score:3]
However, ZEB1 and ZEB2 can also bind to the E-box sites close to the transcription start site of each of the miR-200 clusters inhibiting their transcription, resulting in a negative feedback loop [64, 65]. [score:3]
In striking contrast to the strong inhibitory effect of miR-200 family has on the early metastatic steps, studies have shown that miR-200 may promote metastatic colonization [72, 81]. [score:3]
The miR-200 family is highly conserved among vertebrate species and highly expressed within epithelial cells. [score:3]
A recent paper by Manavalan et al. has also shown a link between the miR-200 family and targeted therapy resistance in breast cancer cells [109]. [score:3]
Together, these findings suggest that loss of miR-200 expression plays a causal role in arsenic -induced cell malignant transformation and tumorigenesis. [score:3]
Early studies on the miR-200 family have shown that the miR-200 family can suppress cell migration. [score:3]
Moreover, profiling a group of mouse breast cancer cell lines (67NR, 168FARN, 4TO7, and 4T1) with different metastatic capabilities (67NR cells are unable to intravasate; 168FARN cells cannot extravasate efficiently; 4TO7 cells do not colonize distant organs well; and 4T1 cells are capable of completing all steps of metastasis) revealed that the most metastatic cells (4T1) had the highest level of miR-200 family expression. [score:3]
This again suggested that other targets of the miR-200 family are more important in colonization efficacy of a cancer cell. [score:3]
When bound, ZEB1 and ZEB2 can inhibit the transcription of the entire miR-200 family, while Sp1 and p53 binding has been shown to lead to activation of transcription of the miR-200b/200a/429 [32, 33] and the miR-200c/141 [33, 34] clusters, respectively. [score:3]
Since some of the data on the role of miR-200 family in cancer is controversial and cellular context dependent, it is important for future studies to tease apart which miR-200 family members act as a tumor suppressor and which may promote cancer progression. [score:3]
Through microarray and mass spectrometry analysis nine potential miR-200 targets were identified. [score:3]
Li and colleagues found that miR-200c expression was significantly lower in A549, H1299, and SPC-A-1sci non-small cell lung cancer (NSCLC) cells among other NSCLC cells [57]. [score:3]
To study the role of the miR-200s in metastatic colonization, Korpal et al. stably expressed cluster I (miR-200b/a/429: which will be referred to as C1), cluster II (miR-200c/141: C2) or clusters I and II (C1+C2) in the weakly metastatic 4TO7 cells. [score:3]
Some representative miR-200 targets involved in each step of the metastatic cascade are shown. [score:3]
Transient transfection of miR-200c reduced both formin homology domain-containing protein 1 (FHOD1) and Mg [2+]/Mn [2+] -dependent protein phosphatase 1F (PPM1F) levels, and inhibition of the miR-200b/c/429 cluster in MCF7 breast cancer cells increased FHOD1 and PPM1F levels. [score:3]
The identified miR-200 targets are critically involved in Rho-ROCK signaling, invadopodia formation, matrix metalloproteinase activity, and focal adhesions. [score:3]
Functional analysis in vitro and in vivo revealed that miR-200 increased metastatic colonization by targeting Sec23a. [score:3]
Transient transfection of a miR-200c mimic in MDA-MB-231 breast cancer cells showed a strong inhibitory effect on the invasive capabilities of these cells in Matrigel and when using a real-time cell analyzer. [score:3]
Further functional validation of the identified miR-200 targets revealed that they constitute subnetworks that play crucial roles in enabling cancer cells to migrate and invade. [score:3]
Li and colleagues found that mammary fat pad injection of the metastatic MDA-MB-231 LM2 breast cancer cells resulted in metastasis to the lung and bone, and this was greatly reduced by the stable expression of miR-200b or miR-200c [43]. [score:3]
Mechanistic studies from this group determined that miR-200c reduces drug resistance in these cells through targeting Neurotrophic Tyrosine Kinase, Receptor, Type 2 (TrkB) and BMI1 Polycomb Ring Finger Oncogene (BMI1) [102]. [score:3]
In contrast, overexpressing miR-200c resensitized these doxorubicin-resistant breast cancer cells to doxorubicin treatment. [score:3]
Bioinformatic analysis suggested ubiquitin specific peptidase 25 (USP25) as a potential target for miR-200c and a luciferase reporter assay confirmed the direct binding of miR-200c to its 3′UTR. [score:3]
Liu et al. found that the expression of miR-200c is decreased in melanoma tissues and cells, with a further decrease in metastatic primary melanoma tumors [100]. [score:3]
Through functional studies in these cells it was determined that miR-200c potentiates apoptosis to the clinically used proteasome inhibitor bortezomib by reducing Noxa levels. [score:3]
Figure 3 Some representative miR-200 targets involved in each step of the metastatic cascade are shown. [score:3]
In depth analysis revealed that miR-200c reduces the expression of ATP -binding cassette (ABC) transporters ABCG2, ABCG5 and MDR1 in WM115A melanoma cells. [score:3]
These two studies described above both looked at epigenetic silencing as a possible mechanism for the carcinogen -induced miR-200 expression loss seen in the HBECs. [score:3]
Therefore, the miR-200 family also plays a role in sensitivity to the specific targeted therapies available for breast cancer. [score:3]
Recent studies suggest that modifications to the promoter regions of each of the miR-200 clusters can cause the loss of the expression of the miR-200 family in cancer. [score:3]
Furthermore, the miR-200 family has also been shown to target the VEGF receptors. [score:3]
Recent research has suggested that the miR-200 family plays an important role in inhibiting cell malignant transformation and preventing tumor initiation. [score:3]
A luciferase reporter assay confirmed that miR-200c directly targets the 3′UTR of these mRNAs in MDA-MB-231, MCF-7, and HEK-293FT cells. [score:3]
Furthermore when these highly invasive cells were transiently transfected with miR-200c mimics, their invasive abilities were significantly decreased compared to cells transfected with control oligos, which suggests a suppressive role for miR-200c on NSCLC cell invasion. [score:2]
Gregory et al. first reported the inhibitory effect of miR-200 on cell migration using a transwell migration assay [61]. [score:2]
Our recent studies have also implicated the miR-200 family in the ZEB1-independent regulation of cell migration and metastasis. [score:2]
Using a miRNA microarray, Kovalchuk and colleagues found that the levels of miR-200a and miR-200c were significantly lower in MCF-7 breast cancer cells that were resistant to doxorubicin compared to the parental cells, suggesting that decreased expression of these miRNAs may contribute to doxorubicin resistance in breast cancer [104]. [score:2]
Transwell invasion assays showed that these cell lines that expressed lower levels of miR-200c had a higher invasive capability than other NSCLC cells. [score:2]
Comparing the expression levels of the miR-200 family members in gastric cancer cell lines, Valladares-Ayerbes and colleagues found that miR-200c levels were much significantly higher in cancer cells compared to normal cells [90]. [score:2]
When treated with a miR-200c inhibitor, these doxorubicin-resistant BT474 cells became even more resistant to doxorubicin treatment compared to control cells. [score:2]
Taken together, these data suggest that the miR-200 family plays crucial roles in the metastatic cascade by down -regulating important players involved in angiogenesis. [score:2]
Effect of the miR-200 family on tumor cell intravasation. [score:1]
Although current studies on the miR-200 family have shown promising results, more work is needed to further understand the role this family plays in cancer. [score:1]
The potential role of miR-200 family in cancer therapy. [score:1]
Effect of the miR-200 family on epithelial-to-mesenchymal transition and tumor cell migration. [score:1]
The promoter region of the miR-200c/-141 cluster has been shown to be hypermethylated [29, 30], whereas the miR-200b/-200a/-429 cluster has been shown to be silenced primarily through polycomb group -mediated histone modifications [31] in cancer. [score:1]
Further analysis using patient samples showed an inverse correlation between miR-200c blood levels and prognosis, which suggests miR-200c as a potential prognostic biomarker for gastric cancer. [score:1]
By generating a doxorubicin-resistant breast cancer cell line (BT474), Kopp et al. also showed that loss of miR-200c is important in developing chemoresistance [102]. [score:1]
Figure 1The miR-200 family consists of two clusters: Cluster I (miR-200b, - 200a, and - 429 is located on chromosome 1) and Cluster II (miR-200c and - 141 is located on chromosome 12). [score:1]
Studies showed potential in the use of members of the miR-200 family for cancer diagnosis. [score:1]
Indeed, Pecot et al. recently reported that higher miR-200 levels in ovarian, lung, renal and basal-like breast adenocarcinomas are associated with improved clinical outcome. [score:1]
Effect of the miR-200 family on tumor cell survival in circulation. [score:1]
Therefore, arsenic or tobacco carcinogens may induce cell transformation by increasing the methylation of the promoter regions of, and subsequently leading to silencing of, the miR-200 family. [score:1]
This is probably partly due to the difficulty in measuring intravasated cells in the blood stream, and that the miR-200 family has a strong suppressive effect on the earlier steps of the metastatic cascade. [score:1]
However, there has been little research done with respect to the mechanism by which miR-200 family reduces cancer cell intravasation. [score:1]
Alternatively, the miR-200 family members can also be divided into two functional groups based upon the similarities of their seed sequences (Figure 2). [score:1]
Furthermore, the increase in the level of miR-200c was accompanied by a decrease in stress fiber formation that was not accompanied by a change in RhoA activity, suggesting that miR-200c likely acted downstream of RhoA. [score:1]
The miR-200 family as potential diagnostic and prognostic tools. [score:1]
These studies suggest that body fluid miR-200 family levels may have different diagnostic values for different types of cancers. [score:1]
Effect of the miR-200 family on tumor cell extravasation and metastatic colonization. [score:1]
MiR-200 family members have been shown to regulate apoptosis and anoikis, and therefore may have an effect on tumor cell survival in circulation. [score:1]
However, higher levels of miR-141 are significantly associated with worse clinical outcome of luminal subtypes breast cancer [50], suggesting that miR-200 may exhibit differential functions among different breast cancer subtypes. [score:1]
Thus, ZEB1 and ZEB2 can keep a cell in a mesenchymal phenotype by repressing the transcription of both E-cadherin and the miR-200 family. [score:1]
Developing new and robust mo dels for the study of intravasation and extravasation steps of metastasis are also needed to advance our knowledge on the miR-200′s role in these critical processes. [score:1]
Alternatively, the promoter regions of the miR-200 family can be bound by the transcription factors zinc finger e-box bind homeobox 1 (ZEB1) and 2 (ZEB2 also known as SIP1), specificity protein 1 (Sp1), and p53. [score:1]
Given the contradictory results observed, the role of individual members of the miR-200 family in anoikis still needs to be further studied. [score:1]
Therefore more work is needed to determine the role of the miR-200 family in this early step of metastasis. [score:1]
Though much of the research on the miR-200 family in cancer drug resistance has focused mostly on miR-200b and -200c, it is possible that the other members of the miR-200 family may also play similar roles in the process due to their similar seed sequences. [score:1]
Zhang and colleagues also studied the role of miR-200 in anoikis in breast cancer [78]. [score:1]
The miRNA-200 (miR-200) family consists of five members, which form two clusters located in two different genomic regions. [score:1]
The miRNA-200 family. [score:1]
The miR-200 family is among the most wi dely studied miRNAs in cancer, this review will focus specifically on the role of the miR-200 family in cancer initiation, metastasis, diagnosis and treatment. [score:1]
Figure 2The miR-200 family members can also be separated into two functional groups based upon their seed sequences. [score:1]
Moreover, most of the research done on individual miR-200 family members focuses on miR-200b or -200c, therefore more work is needed on miR-200a, -141 and -429 and their individual role in cancer. [score:1]
Therefore, the interplay between the miR-200 family and ZEB1/ZEB2 plays an important role in driving the cell in to and out of EMT. [score:1]
The miR-200 family two clusters are located on two different chromosomes. [score:1]
The miR-200 family in cell transformation and tumorigenesis. [score:1]
As shown in Figure 1, the Cluster I miR-200s in humans contains miR-200b, -200a, and -429 (miR-200b/200a/429) located in an intergenic region of chromosome 1, and cluster II miR-200s contains miR-200c and -141 (miR-200c/141) located on chromosome 12 [27, 28]. [score:1]
Effect of the miR-200 family on tumor growth, angiogenesis, and nearby tissue invasion. [score:1]
To study the role of miR-200 in the last step of the metastatic cascade, Korpal and colleagues profiled the levels of the miR-200 family in primary and metastatic samples and found that the miR-200 family was higher in metastatic secondary tumors [72]. [score:1]
Of these 17 miRNAs, four of them were from the miR-200 family (miR-200b, -200a, -200c, and -141), and this group concluded that miR-200b was the best miRNA for determining CTC -positive MBC patients. [score:1]
Moreover, it was also found that the poorly metastatic 4TO7 cells can take up miR-200 from 4T1 EVs and become metastatic in a miR-200–dependent manner [82]. [score:1]
Howe et al. demonstrated that miR-200c levels were significantly reduced in BT549 and MDA-MB-231 triple negative breast cancer cells [77]. [score:1]
The miR-200 family in cancer metastasis. [score:1]
Current research on the miR-200 family has shown that the family can affect each step of the metastatic cascade. [score:1]
Together, these findings suggest that miR-200 levels may have the potential to serve as indicators of cancer prognosis. [score:1]
The miR-200 family members can also be separated into two functional groups based upon their seed sequences. [score:1]
The miR-200 family consists of two clusters: Cluster I (miR-200b, - 200a, and - 429 is located on chromosome 1) and Cluster II (miR-200c and - 141 is located on chromosome 12). [score:1]
Future work on the miR-200 family can help with better understanding the mechanism by which miR-200s affect cancer initiation, metastasis, and relapse. [score:1]
The sequences of the mature miRNA-200 family members. [score:1]
To further determine the underlying mechanism behind miR-200 promotion of metastatic colonization, Korpal and colleagues used a tail vein injection mo del with the modified 4TO7 cells described above. [score:1]
The role of the miR-200 family in apoptosis has already been discussed above in the survival in circulation section; therefore this section will focus primarily on the effect of miR-200s on chemoresistance. [score:1]
Since much work has focused on the effect of whole clusters/groups on metastasis, more work is also needed to be done on individual members of the miR-200 family to elucidate their role in each step of the metastatic cascade. [score:1]
Furthermore, a high level of circulating miR-141 was found to be associated with high-risk (Gleason score ≥ 8) tumors [92], while a lower level of cluster I of the miR-200 family was correlated with relapse [93] in prostate cancer. [score:1]
However, more research is needed to discern the function of each cluster as a whole and to elucidate the effect of each individual member of the miR-200 family on the metastatic cascade. [score:1]
[1 to 20 of 136 sentences]
2
[+] score: 288
2016.00140/full#supplementary-material Figure S1 miR-200 inhibitors up-regulate PTEN expression. [score:8]
Taken together, the miR-200 family, especially miR-200c, directly targets the 3′UTR of PTEN and inhibits its protein expression. [score:8]
In conclusion, our results show that at the early stage of Aβ damage, ER stress induces upregulation of miR-200c to inhibit PTEN expression and protect neurons from Aβ toxicity. [score:8]
Overexpression of miR-200c rescued such reduction upon Aβ treatment, whereas transfection of miR-200c inhibitors further exacerbated neurite outgrowth inhibition (Figure 4C, lower panel; Figures 4D,E, black bars). [score:7]
To identify the binding site of miR-200 that plays the most important role in miR-200-regulated PTEN protein expression, we generated three different site-directed mutations on PTEN 3′UTR. [score:6]
In our study, we found Aβ peptide treatment induces phosphorylation of PERK and eIF2 α and upregulates miR-200c expression, which were also observed in APP/PS1 mouse brains (4–6 months old). [score:6]
Since we have identified PTEN as a major target of miR-200c, we then altered the level of PTEN protein by overexpression or knocking down and examine neurite outgrowth by immunostaining same as above (Figure 3H). [score:6]
To explore the potential roles of miR-200 family members in translational regulation of PTEN expression, we co -transfected a luciferase reporter construct containing PTEN 3′UTR together with different miR-200 family members. [score:6]
We provided evidence showing that upregulation of miR-200 family by ER stress exhibited protective roles via PTEN suppression in early phase of AD. [score:6]
In order to understand the role of miR-200 family in AD development, we employed the TargetScan (version 6.2, 2012) database to predict potential miR-200 target genes. [score:6]
Consistently, in AchE -positive cortical neurons, overexpression of miR-200c or inhibition of PTEN promoted neurite outgrowth. [score:5]
Since miR-200c is dysregulated in the AD brain and is important for neuronal survival at least in part through regulating the expression of PTEN, we examined the role of miR-200c in Aβ -induced neuronal cell death. [score:5]
On the other hand, transfection of miR-200 inhibitors to HCT116 colon cancer cells that have high endogenous levels of miR-200 resulted in increased expression of PTEN (Figure S1). [score:5]
Overexpression of miR-200 family inhibitors dramatically enhanced luciferase reading (Figure 1C). [score:5]
Consistent with this notion, pretreatment of neuronal cells with PBA, an ER stress inhibitor, decreased the level of phospho-eIF2α and inhibited the induction of miR-200c (Figure 6C). [score:5]
Knocking down of PTEN resulted in similar increase in the percentage of living cells compared to the overexpression of miR-200c, whereas overexpression of PTEN protein caused significant cell death (Figure 2B). [score:5]
The correlated expression pattern of miR-200c and early ER stress markers suggested a link between Aβ -induced ER stress and microRNA expression. [score:5]
Overexpression of miR-200c enhanced NGF -induced neurite outgrowth, whereas inhibition of miR-200c showed the opposite effect (Figures 3E–G). [score:5]
To further elucidate the role of miR-200c during AD development, we examined the expression of both miR-200c and PTEN in mouse cortexes at different developmental stages of APP/PS1 transgenic mice. [score:5]
The mimic or inhibitors of miR-200 family and siPTEN/control siRNAs were synthesized by Life Technologies with sequences shown in Table 1. Table 1 Sequences of synthesized miR mimics/inhibitors or siRNA. [score:5]
The mimic or inhibitors of miR-200 family and siPTEN/control siRNAs were synthesized by Life Technologies with sequences shown in Table 1. Table 1 Sequences of synthesized miR mimics/inhibitors or siRNA. [score:5]
Overexpression of miR-200c significantly promoted cell viability of both PC12 cells and cultured rat cortical neurons, while overexpression of antisense oligo against miR-200c reduced the survival rate (Figures 2A,C). [score:5]
To test if the expression level of miR-200c in the peripheral blood has an indicative role for AD development, we examined plasma miR-200c level in both APP/PS1 mice and AD patients. [score:4]
As shown in Figure S2H and Figure 4, overexpression of miR-200c in AChE positive cells resulted in enhanced neurites outgrowth and knocking down of miR-200c caused a significant reduction in neurites length in AChE positive cells (Figure S2H; Figure 4C, upper panel; Figures 4D,E, white bars). [score:4]
Figure 6 Expression of miR-200c is regulated by Aβ -induced ER stress. [score:4]
Among them, microRNA-200 family showed a dynamic expression profile during AD development in the APPswe/PSΔE9 transgenic mice. [score:4]
Consistent with this notion, we found that overexpression of miR-200c and knocking down of PTEN protect neurite outgrowth in both PC12 cells and SCG neurons. [score:4]
When we divided the AD patients into two groups according to the disease severity, we found the plasma miR-200c levels of the 7 moderate to severe AD patients were modestly higher (Range = 1.45 × 10 [5] to 7.28 × 10 [5] copies/μl plasma, mean = 2.80 × 10 [5] ± 0.82 × 10 [5] copies/μl plasma) than that of the healthy controls (P = 0.058) (Figure 7B), indicating that plasma miR-200c may also be related to AD development. [score:4]
miR-200c is up-regulated in the plasma of moderate to severe AD patients. [score:4]
TrkA seems to be the regulatory target of miR-200c in the process of neurite outgrowth. [score:4]
Among the three sites, site II seems to have the most important role in the regulation of PTEN expression by miR-200 family. [score:4]
Among them, miR-200a/b/c, miR-141, and miR-429 in the miR-200 family were significantly upregulated in early age AD in mice. [score:4]
Under the stress of Aβ peptide, UPR is activated and miR-200c is upregulated under an thus far unknown mechanism We hypothesized that it might be due to the activation of transcriptional factors such as XBP1, ATF4, and ATF6. [score:4]
It is plausible that the upregulation of miR-200c induced by Aβ may be mediated by ER stress. [score:4]
We found that miR-200c significantly suppresses the level of PTEN expression in 293T cells (Figure 1G), which is consistent with aforementioned results in the luciferase reporter assay. [score:4]
Taken together, our data show that ER stress pathways play an essential role in Aβ -induced miR-200c expression. [score:3]
In this study, we identified PTEN as a target of miR-200 family in neuronal cells. [score:3]
HCT-116 cells were transfected with different combinations of miR-200 inhibitors as indicated. [score:3]
miR-200c expression is correlated with neuronal ER stress. [score:3]
As predicted by Targetscan (version 6.2, 2012), three miR-200 family bind sites (Site I and Site III for miR-141/200a, Site II for miR-200b/c/429) are highlighted. [score:3]
Both phospho-PERK and phospho-eIF2α increased in APP/PS1 transgenic mice at early stages, which is similar to the expression pattern of miR-200c. [score:3]
Figure 5 Expression pattern of miR-200c and PTEN in APP/PS1 mice brains is correlated with ER stress makers. [score:3]
The expression of PTEN showed a reciprocal pattern to that of miR-200c (Figures 5B,C). [score:3]
Overexpression of miR-200c reduced the insult of Aβ in both PC12 cells and cortical neurons (Figures 4A,B), indicating that the miRNA plays a protective role against Aβ -induced neuronal damage. [score:3]
The UPR signalings contributes to neuron homeostasis at the early stage of Aβ impairment at least partially via miR-200c and its targets. [score:3]
These results indicate that ER stress pathways are the mediators of Aβ–induced miR-200c expression. [score:3]
Expression of miR-200c increased gradually during in cultured cortical neurons and NGF -treated PC12 cells (Figures 3A,B). [score:3]
PC12 cells were transfected with miR-200c mimic or inhibitor followed by NGF treatment for 48 h and cell lysate was harvested. [score:3]
ER stress pathways are essential for Aβ–induced miR-200c expression changes. [score:3]
Identification of PTEN as a target of miR-200 family. [score:3]
Database prediction indicated that PTEN has three miR-200 family binding sites in its 3′UTR and may be one of the potential targets of miR-200 family (Figure 1A). [score:3]
Increased miR-200c expression in early stage AD is induced by ER stress. [score:3]
Among miR-200 family, miR-200c is the major microRNA that targets PTEN. [score:3]
The level of PTEN protein gradually decreased in the same process (Figures 3C,D), further supporting the notion that PTEN is a target of miR-200c. [score:3]
MiR-200c expression increased gradually along with phosphorylated eIF2α (Figures 6A,B, middle and lower panels). [score:2]
In addition to neuronal cell survival, we also tested whether miR-200c regulates neurite outgrowth. [score:2]
Members of the miRNA-200 family regulate olfactory neurogenesis. [score:2]
Among the five miR-200 family members, miR-200c plays the most important regulatory role and was used to represent miR-200 family in the following parts of the study (Figures 1D–F). [score:2]
Relative expression of miR-200c was detected by qPCR Data was represented as fold changes compared with the level at 2-month old; [*] P < 0.05). [score:2]
To test if TrkA signaling plays an important role in miR-200c mediated regulation of neurite outgrowth, AChE was stained to label those cortical neurons that are TrkA positive. [score:2]
It will be valuable to examine the level of plasma miR-200c in familial AD patients that harbor APP or PS1 mutations. [score:2]
These results indicate that miR-200c regulates neurite outgrowth of TrkA positive neurons. [score:2]
To further confirm whether plasma miR-200c in human samples is indicative for AD development, we collected 27 human plasma samples. [score:2]
Critical role of the miR-200 family in regulating differentiation and proliferation of neurons. [score:2]
Expression level of miR-200c is represented as the fold change compared to time point 0. (B) PC12 cells were treated with Aβ, followed by similar experiments described in (A). [score:2]
miR-200c plays protective roles in Aβ -induced neuronal cell damage. [score:1]
Figure 7 Detection of plasma-circulating miR-200c in AD mice mo del and patients. [score:1]
Figure 4 miR-200c protects neurons from Aβ -induced damage. [score:1]
In nerve system, miR-200 family is enriched in olfactory and has been implicated in neuronal proliferation and differentiation (Choi et al., 2008; Pandey et al., 2015). [score:1]
Figure S3 miR-200c cannot induce ER stress. [score:1]
Plasma miR-200c levels were much higher in APP/PS1 mice than wild type mice from 2 to 6 months of age (Figure 7A). [score:1]
For luciferase activity assay, we introduced mutations on each miR-200 family miR binding site by overlap PCR. [score:1]
Figure S2 miR-200c is important for neurite outgrowth in cultural SCG neuron. [score:1]
The effects of miR-200c on neurite outgrowth were not observed in rat cortical neurons (Figure S2G), which may stem from the difference where PC12 cells and SCG neurons use TrkA signaling but cortical neurons mainly use TrkB signaling. [score:1]
In the 14 AD human patients (among them 7 with mild AD and 7 with moderate to severe AD), plasma miR-200c levels (range = 4.5 × 10 [4] to 7.28 × 10 [5] copies/μl plasma; mean = 2.04 × 10 [5] ± 0.50 × 10 [5] copies/μl plasma) were not significantly different from that in the healthy controls (range = 5.3 × 10 [4] to 3.36 × 10 [5] copies/μl plasma; mean = 1.49 × 10 [5] ± 0.25 × 10 [5] copies/μl plasma). [score:1]
We found that miR-200c does not induce ER stress (Figure S3). [score:1]
However, when Aβ is accumulated to a threshold, the apoptosis program is started and miR-200c is decreased, which is consistent with the time scale of neuronal loss in this APP/PS1 mouse mo del. [score:1]
So we hypothesized that in this APP/PS1 mouse mo del brain, at the early stages of Aβ stress (4–6 months old), UPR is activated and miR-200c increases to play the protective roles. [score:1]
However, in human, only patients with moderate to severe AD have a relatively higher plasma miR-200c level, but not mild AD patients. [score:1]
Our data indicate that Aβ-miR-200c-PTEN pathway may play important roles in cholinergic neurons at the early stage of AD. [score:1]
At this late stage of ER stress induced by Aβ, miR-200c is decreased and PTEN is restored to accelerate the detrimental neuron death. [score:1]
Chronic exposure to Aβ peptide disrupts homeostasis of neurons and results in the face of miR-200c response and neuronal cell death. [score:1]
The TaqMan probe for miR-200c is 5′-FAM-CACTGGATACGACTCCATCATTACC- TAMRA-3′. [score:1]
Name of miRs/siRNAs Sequence miR-200a 5′-UAACACUGUCUGGUAACGAUGU miR-200b 5′-UAAUACUGCCUGGUAAUGAUGA miR-200c 5′-UAAUACUGCCGGGUAAUGAUGGA miR-141 5′-UAACACUGUCUGGUAAAGAUGG miR-429 5′-UAAUACUGUCUGGUAAUGCCGU miR-NC 5′-UAACGUGUCACGUCUCCGACUA Anti-miR-200c 5′-UAACACUUGCCGGGUAAUGGUGUA Anti-miR-NC 5′-UCUUGCCGGGCCCGAUCCAACGA siCont 5′-UUCUCCGAACGUGUCACGU siPTEN 5′-AACCCACCACAGCUAGAACUU 2.3 kb PTEN 3′UTR was amplified by PCR from a human cDNA library. [score:1]
pMIR-Reporter constructs containing either wild type or mutant fragments of PTEN 3′UTR were co -transfected into 293T cells with miR-200 family miRs (miR-141/200a, miR-200b/c/429, or miR-200c). [score:1]
MiR-200 family can be divided into two groups according to the seed sequences (group I: miR-141 and miR-200a; group II: miR-200b, miR-200c, and miR-429). [score:1]
Total RNA was also extracted and subjected to qPCR analysis of miR-200c (right panel). [score:1]
To further investigate the role of miR-200c on neurite outgrowth, miR-200c mimic or inhibitor was transfected into PC12 cells together with GFP as a transfection indicative marker. [score:1]
miR-200c and PTEN are involved in neuronal survival and neurite outgrowth. [score:1]
Figure 2 Effects of miR-200c and PTEN on neuronal cell viability. [score:1]
Cotransfection of miR-200b, miR-200c, a mixture of group I, group II or the whole family of miR-200s all resulted in a decrease in luciferase activity (Figure 1B). [score:1]
In this study, miR-200c helps to maintain the balance between survival and death during Aβ -induced ER stress. [score:1]
A series of truncations containing different miR-200 family binding sites were also amplified and cloned into the pMIR-REPORT vector. [score:1]
Figure 3 miR-200c is important for neurite outgrowth in PC12 cells and cultural cortical neuron. [score:1]
Human plasma samples and quantification of plasma circulating miR-200c. [score:1]
[1 to 20 of 95 sentences]
3
[+] score: 285
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-200a
Genes associated with angiogenesis were also enriched, with increased expression of 5/6 anti-angiogenic gene decreased expression of 11/15 pro-angiogenic genes (Supplementary Fig.   5B), suggesting that miR-200 -targeted genes may play a role in the inhibition of angiogenesis. [score:9]
The expression levels of miR200c in miR-200c -overexpressing SNU-685 were comparable to the EAC cell lines, whereas miR-200c -overexpressing JHUCS-1 cells had approximately a 14-fold increased expression when compared to EAC cell lines (Supplementary Fig.   3). [score:8]
However, stable miR-200c OE in JHUCS-1 and SNU-685 cells led to robust upregulation of epithelial genes and downregulation of mesenchymal genes. [score:7]
Secondly, the miR-200 knockdown we achieved was sufficient to increase expression of ZEB1 and ZEB2, which are direct targets of miR-200c. [score:7]
Relative RNA expression of miR-200b/c -depleted vs scramble -treated Ishikawa and MFE-280 cells, and miR-200c -overexpressed vs non -targeting control treated SNU-685 and JHUCS-1 cells, are shown. [score:7]
Using mutational profiling and analysis of miRNA and mRNA expression, we confirmed that our mo del cell lines match miR-200 and EMT gene expression profiles representative of EACs (specifically, endometrioid and serous histologic subtypes) and UCSs. [score:6]
For miR-200c -overexpressed JHUCS-1 cells, decreased vimentin expression and readiness to undergo a complete MET may partly be attributed to the mutational profile of this cell line. [score:6]
In UCS cell lines, we also observed increased expression of ZEB1 and ZEB2, transcription factors upstream in the EMT pathway that are targeted by miR-200 for degradation (Fig.   1C). [score:5]
With microRNA therapy emerging as a viable and novel therapeutic approach, miR-200c -targeted treatment may be an attractive option for the treatment of this aggressive disease. [score:5]
Expression vector pUCori-EF1-Puro-SV40PolyA-Amp [r] containing a hsa-miR-200c precursor construct (Cell Biolabs) was used to generate stable clones expressing miR-200c. [score:5]
Specifically, ectopic miR-200 expression was shown to decrease metastasis, inhibit angiogenesis, and induce normal vascularization. [score:5]
These findings are consistent with our mRNA and protein expression results, and further confirm that JHUCS-1 cells readily undergo complete MET upon miR-200c overexpression. [score:5]
Here, we demonstrate that systemic miR-200c DOPC nanoliposome treatment in a murine xenograft UCS mo del can effectively reach the target tissue, increase intra-tumoral miR-200c expression, and decrease UCS tumor growth. [score:5]
Figure 4Differential expression of EMT/MET-related genes in EAC-miR-200 depleted and UCS-miR-200 overexpressed cells. [score:5]
We achieved stable miR-200c overexpression (miR-200c OE) by transfecting JHUCS-1 and SNU-685 UCS cells with an expression vector containing a miR-200c precursor construct and then performing clonal selection. [score:5]
In summary, our mo del cell lines are representative of EAC and UCS, based on both mutational landscape and miR-200/EMT expression features. [score:4]
The presence of other mutations in JHUCS-1 cells, such as PTEN and ARID1A, might also prime these cells to undergo a complete MET upon miR-200c overexpression. [score:4]
Firstly, we used miR-200b and miR-200c inhibitors to ensure knockdown of both miR-200 gene clusters. [score:4]
Compared to non -targeting controls (NTCs), clones with miR-200c OE demonstrated changes in gene expression consistent with MET (Fig.   3B). [score:4]
Whole transcriptome sequencing confirms MET changes in miR-200 overexpressed UCS cells and suggests a role for miR-200 in the regulation of angiogenesis. [score:4]
Upon analysis of intra-tumoral miR-200c expression by real-time PCR, when compared to control, tumors treated with DOPC-miR200c showed a 31, 2.9 and 5.9-fold increase in miR-200c expression 24, 48 and 72 hours post-injection, respectively (Fig.   6B). [score:4]
This is likely due to a lack of significantly decreased vimentin expression in miR-200c -overexpressed compared to control SNU-685 cells. [score:4]
We did not observe changes in cellular morphology after miR-200 depletion in either of the EAC cell lines after 40 days of growth (Supplementary Fig.   1), suggesting that the increase in ZEB1/2 expression alone is not sufficient to drive EAC cells to undergo EMT. [score:3]
Finally, we show that miR-200 overexpression in UCS cells leads to decreased tumor growth and aggressiveness both in vitro and in vivo. [score:3]
Bar graphs represent relative miR-200c expression. [score:3]
While miR-200 overexpression in JHUCS-1 cells resulted in MET functional changes (increased cell adhesion and decreased cell migration and invasion), we did not observe the same changes in SNU-685 cells (decreased cell adhesion, no significant change in cell migration or invasion). [score:3]
The cobblestone-shaped miR-200c -overexpressed cells are outlined in orange. [score:3]
miR-200 overexpression can induce MET 22, 23, 31; however, miR-200 -driven MET in UCS has not been previously reported. [score:3]
These studies all emphasize the therapeutic potential that lies in targeted treatment with miR-200c. [score:3]
A recent study exploring the clinical outcomes related to miR-200 expression found that miR-200 plays an important role in metastasis and angiogenesis [32]. [score:3]
Four days after seeding, proliferation was decreased by ~37% and ~67% in miR-200 overexpressing SNU-685 and JHUCS-1 cells, respectively. [score:3]
pathologic) are ultimately determined by a complex interplay between pro-angiogenic and anti-angiogenic factors, it appears that miR-200 is associated with inhibition of angiogenesis. [score:3]
Figure 3Effects of ectopic miR-200 overexpression in UCS cell lines. [score:3]
Given that EMT is a reversible process, we sought to explore whether miR-200 overexpression in UCS cells would cause MET. [score:3]
There were no statistically significant differences in migration or invasion between miR-200c -overexpressed and control SNU-685 cells. [score:3]
In contrast, tumors overexpressing miR-200c showed distinct morphologic changes. [score:3]
Ectopic expression of miR-200 has been shown to increase sensitivity of ovarian, breast and endometrial cancer cells to chemotherapeutic agents 48– 51 and enhance radiosensitivity in lung cancer [52]. [score:3]
This may be one mechanism by which increased miR-200 expression in UCS cells leads to decreased tumor growth and metastasis. [score:3]
Taken together, our data suggest that the only consistent EMT-like changes achievable in EAC cells, either by constitutive miR-200 depletion or exogenous TGF-β treatment, are increases in ZEB1 and ZEB2 expression. [score:3]
In conclusion, although miR-200 depletion and increase in ZEB1/2 expression resulted in a modest decrease in cellular adhesion, there was no evidence of molecular or functional complete EMT. [score:3]
We demonstrate that xenografted UCS tumors with miR-200 overexpression show striking changes in morphologic and immunohistochemical phenotype, becoming more epithelial and less mesenchymal-like. [score:3]
This suggests that, using the DOPC nanoliposome technology, miR-200c is indeed being delivered to the tumor tissue, and that even moderate increase in miR-200c expression and subtle changes in the EMT markers are sufficient to decrease tumor growth. [score:3]
Generation of miR200c -overexpressing clones. [score:3]
Xenografting studies further confirmed that miR-200c overexpression in JHUCS-1 cells results in MET. [score:3]
Notably, 913 differentially expressed genes were identified in UCS cells with miR-200c OE, whereas only 185 genes were identified in EAC cells with miR-200b/c KD. [score:3]
Our data show that, despite miR-200 depletion and subsequent increases in ZEB1/2 expression in EACs, there is no evidence of complete EMT induction. [score:3]
NTC and miR-200c overexpressing JHUCS-1 cells were injected subcutaneously into NSG mice. [score:3]
Bar graphs depict relative miR-200c expression in xenografted tumors. [score:3]
After selecting our cell lines, we sought to examine whether their miR-200 expression and EMT signature profiles were consistent with their named histologic subtypes. [score:3]
3 different miR-200c -overexpressed JHUCS-1 clones over 37 days (n = 4 per group). [score:3]
Quantitative PCR was performed on all clones to confirm miR-200c overexpression. [score:3]
In our study, whole transcriptome sequencing of UCS cells with miR-200c overexpression revealed significant enrichment for genes associated with angiogenesis. [score:3]
JHUCS-1 cells overexpressing miR-200c demonstrated increased adhesion as well as decreased migration and invasion, suggestive of biological MET changes (Fig.   3G). [score:3]
NSG mice were subcutaneously injected with miR-200c -overexpressed and control cells. [score:3]
miR-200c overexpression data are normalized to NTC. [score:3]
We hypothesized that miR-200 overexpression in UCS cells would result in a less aggressive, epithelial-like phenotype. [score:3]
Using TaqMan® RT-PCR, we confirmed 9,457-fold and 24,961-fold increased miR-200c expression in SNU-685 and JHUCS-1 clones, respectively (Fig.   3A). [score:3]
Conversely, ectopic expression of miR-200c in UCS cell lines resulted in MET, with acquisition of an epithelial-like phenotype and decreased tumor growth. [score:3]
In our study, miR-200c overexpression in both cell lines led to molecular alterations, morphologic changes, and decreased cell proliferation, suggestive of MET. [score:3]
miR-200 -depleted EACs exhibit increased ZEB1 and ZEB2 expression without significant changes in other EMT markers. [score:3]
Ectopic miR-200c overexpression in UCSs induces MET. [score:3]
Fold-change in migration or invasion was calculated by comparing miR-200 knockdown or miR-200 expressing cells to their negative controls. [score:2]
Changes in miR-200, mRNA and protein expression were assayed 15 days after the treatment. [score:2]
We examined the gene expression of miR-200 and several well-established EMT markers (ZEB1, ZEB2, E-cadherin, N-cadherin and vimentin) using TaqMan® Real-Time PCR Assays (Fig.   1B–D). [score:2]
Proliferation for either miR-200 knockdown or miR-200 expressing cells was calculated relative to negative controls. [score:2]
Similar to our in vitro cell proliferation results, mice bearing miR-200c -overexpressed cells had substantially smaller tumors compared to mice bearing control cells (Fig.   5A). [score:2]
Taken together, our in vitro and in vivo data strongly support the conclusion that JHUCS-1 cells readily undergo miR-200 driven MET, leading to decreased tumor aggressiveness. [score:1]
miR-200c -induced MET in UCS cells leads to decreased in vivo tumor growth and epithelial-like morphologic changes. [score:1]
Although UCSs are hypothesized to evolve from EACs 4, 18, 19, 30, the role of miR-200 -driven EMT in the oncogenesis of UCSs has not been previously studied. [score:1]
Our results suggest that while UCSs do not appear to develop from EACs by miR-200 -dependent EMT, UCS cell lines readily undergo miR-200 -induced MET resulting in decreased tumor growth and aggressiveness. [score:1]
Systemic miR-200c-DOPC nanoliposome treatment decreases in vivo UCS tumor growthFinally, we sought to test whether in vivo on-target effects could be achieved using the well-characterized DOPC nanoliposomal method of systemic miR-200c delivery in a murine xenograft mo del. [score:1]
Lack of functional changes in miR-200 -depleted EACs further confirms the absence of complete EMT. [score:1]
1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC) nanoliposomes were used for miRNA delivery, as previously described 32, 33. miRNA-DOPC nanoliposomes were prepared using mirVana miRNA mimic negative control #1 (Ambion) or mirVana miR-200c miRNA mimic (has-miR-200c-3p:MC11714; Ambion). [score:1]
Altogether, our results lead us to conclude that UCSs are unlikely to develop from EACs via EMT in a miR-200 -dependent and exclusive manner. [score:1]
Mice bearing subcutaneous JHUCS-1 wild-type cells were treated with DOPC-Scramble or DOPC-miR200c nanoliposomes, twice weekly by tail vein injection, beginning on day 7 after cell implantation (Fig.   6A). [score:1]
Liposomal nanoparticle preparation and in vivo administration1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC) nanoliposomes were used for miRNA delivery, as previously described 32, 33. miRNA-DOPC nanoliposomes were prepared using mirVana miRNA mimic negative control #1 (Ambion) or mirVana miR-200c miRNA mimic (has-miR-200c-3p:MC11714; Ambion). [score:1]
miR-200c decreases tumor growth, and may affect angiogenesis and chemosensitivity. [score:1]
In comparison, tumors with miR-200c OE demonstrated significant IHC differences: ZEB1 staining was absent, E-cadherin demonstrated strong, patchy membranous staining, and vimentin staining was minimal. [score:1]
Figure 2Effects of consecutive transient miR-200 depletion in EAC cell lines. [score:1]
Here, we test the hypothesis that UCSs arise from a carcinomatous origin via miR-200 -driven EMT. [score:1]
The morphologic changes in JHUCS-1 cells upon stable miR-200c OE further confirm a complete MET (Fig.   5D and E). [score:1]
We tested the hypothesis that UCSs evolve from EACs by EMT in a miR-200 -dependent manner. [score:1]
Vimentin mRNA levels decreased by 71% in JHUCS-1 cells with miR-200c OE, while no significant changes were observed in SNU-685 cells. [score:1]
To investigate whether EACs undergo a miR-200 -driven EMT resulting in a UCS phenotype, we depleted miR-200b/c in Ishikawa and MFE-280 cells using single-stranded RNAs that inhibit endogenous microRNAs. [score:1]
Altogether, our data show that increased miR-200c is sufficient to evoke molecular and biological changes consistent with MET, fully in JHUCS-1, and partially in SNU-685 cell lines. [score:1]
Finally, we sought to test whether in vivo on-target effects could be achieved using the well-characterized DOPC nanoliposomal method of systemic miR-200c delivery in a murine xenograft mo del. [score:1]
In UCS cells that underwent miR-200c OE, GO, KEGG pathway analysis and functional annotation clustering all showed enrichment in MET-related genes (e. g. cellular adhesion, tight/occluding junctions, actin binding/cytoskeleton (Supplementary Figs  4 and 5A). [score:1]
Consistent with our prior findings, this suggests that miR-200c OE drives a more complete MET in JHUCS-1 cells than in SNU-685 cells. [score:1]
Failure to induce miR-200 -dependent EMT in EAC cell lines due to transient and/or insufficient miR-200 depletion is unlikely for several reasons. [score:1]
Tumors from mice treated with DOPC-miR200c nanoliposomes were harvested 24, 48 or 72 hours after treatment. [score:1]
Figure 6Systemic miR-200c nanoliposome treatment decreases in vivo UCS tumor growth. [score:1]
JHUCS-1 and SNU-685 cells were transfected with the miR-200c plasmids using FuGENE HD reagent (Promega) and selected in growth medium containing puromycin at 1 μg/ml. [score:1]
There is also abundant evidence linking miR-200 to treatment sensitivity [47]. [score:1]
We show that while EAC cell lines are resistant to full EMT, UCSs readily undergo miR-200 -induced MET. [score:1]
Systemic miR-200c-DOPC nanoliposome treatment decreases in vivo UCS tumor growth. [score:1]
There were no statistically significant differences in tumor growth between DOPC-Scramble and DOPC-miR-200c treated groups on Day 7 or Day 17. [score:1]
We then examined the effects of miR-200c OE on cellular adhesion, migration and invasion using methodology as previously described. [score:1]
miR-200c -induced MET in UCS cells leads to decreased in vivo tumor growth and epithelial-like morphologic changesTo test whether miR-200c OE leads to decreased tumor growth in vivo, we developed murine UCS xenograft mo dels. [score:1]
Additionally, EMT is a reversible process, and mesenchymal-epithelial transition (MET) has been shown to decrease tumor aggressiveness 22, 23. miR-200 has been identified as a key element in the EMT pathway 24– 26. [score:1]
To test whether miR-200c OE leads to decreased tumor growth in vivo, we developed murine UCS xenograft mo dels. [score:1]
In comparison, cells with miR-200c OE appeared more cobblestone-shaped, consistent with an epithelial morphology. [score:1]
Furthermore, miR-200c OE in both cell lines resulted in morphologic changes indicative of MET. [score:1]
One week after JHUCS-1 wild-type cells (5 × 10 [6]) were injected subcutaneously over the posterior flank of 5–6 week old NSG mice, the mice were randomly assigned to treatment with control miRNA-DOPC or miR-200c-DOPC. [score:1]
Levels of miR-200b and miR-200c remained decreased over 10 transfection cycles. [score:1]
To explore whether EACs are able to undergo complete EMT by mechanisms other than miR-200 depletion, we treated Ishikawa, HEC-251 and MFE-280 cells with TGF-β, a well-defined and potent inducer of a full EMT response (Supplementary Fig.   2). [score:1]
To test the hypothesis that UCSs develop from a carcinomatous phenotype in a miR-200 -dependent manner, we selected endometrial adenocarcinoma (EAC) cell lines based on histologic and genetic profiles (Fig.   1A). [score:1]
[1 to 20 of 106 sentences]
4
[+] score: 265
We also found that miR-200c/141 overexpression increased expression and nuclear localization of SerpinB2 transcription factors (c-Jun, FosB and c-Fos), increased SerpinB2 promoter activity, and downregulated miR-26b and miR-124a, suggesting that miR-200c/141 directly or indirectly affects transcription factors and/or miRNAs to upregulate SeripinB2. [score:13]
Lung metastatic tumor tissue immunohistochemistry (IHC) analyses revealed that miR-200c/141 overexpression upregulated SerpinB2 in cancer cells, but downregulated SerpinE1 (Figure 3K). [score:9]
Here, we observed altered gene expression in MDA-MB-231 cells overexpressing miR-200c/141, with 10 genes (SerpinB2, MAL2, C15orf54, PLCβ4, MPZL2, LCP1, KRTAP2-4, EDN1, ID2, EGR1) upregulated. [score:8]
Our preliminary studies showed that miR-200c/141 cluster overexpression in a triple -negative (TN) human BCC line, MDA-MB-231, which lacks estrogen receptor (ER), progesterone receptor (PR) and human epidermal receptor 2 (HER2) expression, enhances the migration and invasion abilities [12], upregulates SerpinB2 and promotes lymph node (LN) and lung metastasis in mouse mo dels. [score:8]
miR-200 members regulate global gene expression through RNA silencing and direct or indirect post-transcriptional targeting, thereby modulating many biological processes, including cell cycle control, proliferation, apoptosis, and invasion [1, 2, 4– 8, 23, 24]. [score:8]
miR-200c/141 overexpression upregulated SerpinB2, and siRNA -mediated SerpinB2 knockdown successfully reduced SerpinB2 levels in MDA-MB-231 [miR-200c/141] cells (Figures 3A and 3B). [score:7]
Both SerpinB2 forms were upregulated in MDA-MB-231 [miR-200c/141] cells (13.48 ± 0.74-fold, P<0.0001) relative to controls, whereas SerpinE1 was downregulated (0.056 ± 0.02-fold, P<0.0001) (Figure 1D). [score:7]
Mouse xenograft results showed that upregulation of SerpinB2 by miR-200c/141 overexpression might be a main mechanism for increased lung metastasis in MDA-MB-231 cells. [score:6]
miR-124a was upregulated in Hs578T [miR-200c/141] and in HCC-38 [miR-200c/141] cells but was downregulated in MCF-7 [miR-200c/141] cells compared to controls (Supplementary Figure 3C). [score:6]
With respect to the role of SerpinB2 in lung metastasis, we demonstrated that SerpinB2 knockdown suppressed miR-200c/141 overexpression -induced migration and lung metastasis by MDA-MB-231 cells. [score:6]
On the contrary to the effect of miR-200c/141 on increased SerpinB2 expression in MDA-MB-231 cells, SerpinB2 mRNA and protein were downregulated in Hs578T [miR-200c/141] and HCC-38 [miR-200c/141] cells. [score:6]
The microRNA-200 (miR-200) family consists of five members in two clusters, miR-200c/141 and miR-200b/a/429, which likely target different, but sometimes overlapping genes, thereby regulating many biological processes as oncomiRs or tumor suppressors [1, 2]. [score:6]
Taken together, our findings provide new insights into the role of SerpinB2, which was upregulated by miR-200c/141 overexpression, in promoting BCC lung and LN metastasis, and suggest that SerpinB2 could be used to assess metastasis risk in BC patients. [score:6]
Our data suggest that miR-200c/141 cluster overexpression is likely responsible for SerpinB2 upregulation and release in MDA-MB-231 cells. [score:6]
Consistent with BLI and magnetic resonance imaging (MRI), GFP imaging and gross anatomy revealed that miR-200c/141 overexpression promoted increased numbers and masses of MDA-MB-231 cell lung metastases, whereas SerpinB2 knockdown suppressed MDA-MB-231 [miR-200c/141] cell metastasis (Figure 3G). [score:6]
SerpinB2 knockdown suppresses miR-200c/141 cluster overexpression -induced lung metastasis in mice. [score:6]
miR-124a and miR-26b, which directly target SepinB2, were downregulated in MDA-MB-231 [miR-200c/141] cells compared to controls (Supplementary Figure 2D). [score:6]
miR-200c/141 cluster overexpression upregulates SerpinB2. [score:6]
Together, these results showed that miR-200c/141 overexpression increases SerpinB2 indirectly by regulating SerpinB2 transcription factors and miRNAs in MDA-MB-231 cells. [score:5]
We speculate that miR200c/141 may involve in posttranscriptional regulation for upregulation of c-Jun and c-Fos via miRNA -mediated mRNA stability and miRNA -mediated decoy. [score:5]
From real-time RT-PCR analyses verifying the cDNA microarray results, the top 10 genes upregulated by miR-200c/141 were as follows: SerpinB2 (114.52 ± 4.0-fold); MAL2 (101.56 ± 3.8-fold); C15orf54 (15.94 ± 0.3-fold); PLCβ4 (9.22 ± 0.27-fold); MPZL2 (7.55 ± 0.15-fold); LCP1 (6.33 ± 0.02-fold); KRTAP2-4 (6.12 ± 0.34-fold); EDN1 (5.41 ± 0.13-fold); ID2 (4.24 ± 0.13-fold); and EGR1 (1.14 ± 0.18-fold) (Figure 1B). [score:4]
Although a significantly higher level of miR-200c was observed in HCC-38 [miR-200c/141], Hs578T [miR-200c/141], and MCF-7 [miR-200c/141] cells relative to controls, SerpinB2, c-Jun and c-Fos mRNAs were downregulated (Supplementary Figures 3A, 3B, and 3C). [score:4]
In conclusion, SerpinB2 upregulation was shown to be involved in miR-200c/141 cluster-promoted lung and LN metastasis in BC xenograft mo dels. [score:4]
Slight uPA downregulation was observed in MDA-MB-231 [miR-200c/141] cells, but was not significant (0.79 ± 0.13-fold, P=0.19) (Figure 1D). [score:4]
We observed increases in transcription factor expression (c-Jun, c-Fos and FosB mRNAs), nuclear localization of the transcription factor, c-Jun, and SerpinB2 promoter-directed chloramphenicol acetyltransferase (CAT) activity in MDA-MB-231 [miR-200c/141] cells relative to controls (Supplementary Figures 2A, 2B and 2C). [score:4]
SerpinB2 knockdown decreased lung metastasis promoted by miR-200c/141 overexpression in BC cells. [score:4]
Decreases of miR-124a and miR-26b in MDA-MB-231 [miR-200c/141] cells may be due to the overexpression of genes to regulate hypermethylation. [score:4]
miR-200c/141 cluster overexpression promotes BCC lung and LN metastasis in mice. [score:3]
After transduction of miR-200c/141-GFP lentivirus into MDA-MB-231 cells and selection with puromycin (3 μg/ml), MDA-MB-231 cells overexpressed miR-200c/141 were sorted using a FACSCalibur flow cytometer (BD Biosciences, San Joese, CA, USA). [score:3]
Levels of miR-200c (201.88 ± 7.92-fold) and miR-141 (51.26 ± 3.48-fold) assessed by real-time RT-PCR were higher in MDA-MB-231 cells overexpressed miR-200c/141 (MDA-MB-231 [miR-200c/141] cells) than MDA-MB-231 cells (control) (P<0.0001) (Supplementary Figure 1). [score:3]
Despite advances in our understanding of BC-related miR-200 members, their precise roles in breast cancer cell (BCC) metastasis are largely unknown, in part because each miR-200 has several putative targets with disparate functions. [score:3]
The underlying mechanisms by which miR-200 overexpression promotes metastasis require further study, and genes that serve as intermediaries in miR-200 -associated metastasis are yet be identified. [score:3]
Based on our results, the effect of miR-200c/141 on SerpinB2 expression is only MDA-MB-231 cell type specific. [score:3]
Heat map of relative gene expression in control and MDA-MB-231 [miR-200c/141] cells (A) Real-time RT-PCR analysis of the top 10 genes (SerpinB2, MAL2, C15orf54, PLCβ4, MPZL2, LCP1, KRTAP2-4, EDN1, ID2, and EGR1) (B) Representative images (C) and complete data (D) from SerpinB2, SerpinE1, and uPA western blots with control and MDA-MB-231 [miR-200c/141] cell lysates Representative SerpinB2 western blot with control and MDA-MB-231 [miR-200c/141] cell CM (E) Data from western blots of both SerpinB2 forms secreted from control and MDA-MB-231 [miR-200c/141] cells (F) *** P<0.001. [score:3]
However, miR-200c/141 expression was not associated with TNBC patient clinicopathological features (Supplementary Table 1). [score:3]
Individual miR-200 family member target genes appear to be cancer type- and context -dependent [3]. [score:3]
miR-26b was upregulated in only Hs578T [miR-200c/141] cells compared to control (Supplementary Figure 3C). [score:3]
Consistent with these observations, we found that stable miR-200c/141 cluster overexpression in TNBC MDA-MB-231 cells promoted lung metastasis in a mouse mo del. [score:3]
miR-200c/141 cluster overexpression increases lung and LN metastasis in a mouse xenograft mo del. [score:3]
These genes were not predicted targets of miR-200c/141 cluster members. [score:3]
Additionally, lentivirus containing firefly luciferase and GFP was transduced into miR-200c/141 -overexpressing MDA-MB-231 cells for animal studies. [score:3]
The stable overexpression of the miR-200c/141 cluster increased both SerpinB2 forms, and decreased SerpinE1 in MDA-MB-231 cells. [score:3]
In many cancers, miR-200 member expression status serves as a surrogate marker for metastasis, response to drug treatments, and patient outcomes [4– 9]. [score:3]
Gene expression profiling was performed using the Human Gene 1.0 STmicroarray (Affymetrix, Santa Clara, CA, USA) with control and MDA-MB-231 [miR-200c/141] cells. [score:3]
Figure 1Heat map of relative gene expression in control and MDA-MB-231 [miR-200c/141] cells (A) Real-time RT-PCR analysis of the top 10 genes (SerpinB2, MAL2, C15orf54, PLCβ4, MPZL2, LCP1, KRTAP2-4, EDN1, ID2, and EGR1) (B) Representative images (C) and complete data (D) from SerpinB2, SerpinE1, and uPA western blots with control and MDA-MB-231 [miR-200c/141] cell lysates Representative SerpinB2 western blot with control and MDA-MB-231 [miR-200c/141] cell CM (E) Data from western blots of both SerpinB2 forms secreted from control and MDA-MB-231 [miR-200c/141] cells (F) *** P<0.001. [score:3]
miR-200c overexpression predicts poor outcome in patients with hormone receptor -negative breast cancer [9]. [score:3]
MDA-MB-231 and miR-200c/141 -overexpressing MDA-MB-231 cells are referred to as control and MDA-MB-231 [miR-200c/141]. [score:3]
The purpose of this study was to clarify whether SerpinB2 is involved in metastasis promoted by miR-200c/141 cluster overexpression in mouse xenograft mo dels. [score:3]
miR-124a and miR-26b which are able to target SepinB2 [29] decreased in MDA-MB-231 [miR-200c/141] cells compared to control. [score:2]
We observed macrophage infiltration within lung metastatic foci of MDA-MB-231 [miR-200c/141] xenograft tumors; SerpinB2 knockdown decreased this infiltration, suggesting that SerpinB2 promotes TNBC cell lung metastasis via macrophages recruitmentto tumors. [score:2]
SerpinB2 expression was stronger in orthotopic primary tumors of MDA-MB-231 [miR-200c/141] mice compared to controls at 40 days (Figures 2F and 2G, P=0.003). [score:2]
MDA-MB-231 [miR-200c/141] cell xenograft tumors displayed extensive macrophage infiltration (stained with F4/80 as a pan macrophage marker) into lung tissues, and SerpinB2 knockdown decreased macrophage infiltration into these tumors (Supplementary Figure 6). [score:2]
Lung metastases were greater in number and mass in MDA-MB-231 [miR-200c/141] tumors compared to controls, and SerpinB2 overexpression was observed in MDA-MB-231 [miR-200c/141] tumor lung metastases (Figure 2E). [score:2]
Korpal M, et al. reported high miR-200 family levels in lung-pleural metastases with reduced BC patient survival and poor prognosis [7]. [score:1]
Secreted SerpinB2 was predominantly in its >60 kDa form in CM from both MDA-MB-231 [miR-200c/141] and control cells, and a high amount of the 47-kDa form was observed in MDA-MB-231 [miR-200c/141] cell CM. [score:1]
Figure 2A shows bioluminescence imaging (BLI) of controls and MDA-MB-231 [miR-200c/141] cells. [score:1]
5×10 [3] control cells, MDA-MB-231 [miR-200c/141]+scramble cells and MDA-MB-231 [miR-200c/141]+si-SerpinB2 cells exhibited 8.9×10 [6] ± 0.7 photon/sec/cm [2]/sr, 8.9×10 [6] ± 0.4 photon/sec/cm [2]/sr, and 9.0×10 [6] ± 0.2 photon/sec/cm [2]/sr, respectively (Figure 3C and 3D). [score:1]
Representative BLI of control and MDA-MB-231 [miR-200c/141] cells (A) Total photon flux of the bioluminescent signals emitted from control and MDA-MB-231 [miR-200c/141] cells. [score:1]
Figure 3Representative RT-PCR (A) and western blotting results (B) for SerpinB2, SerpinE1, and uPA in control and MDA-MB-231 [miR-200c/141] cells transfected with SerpinB2 or scramble siRNA. [score:1]
Thus, SerpinB2 likely represents an effector or mediator of miR-200c/141 cluster -induced metastatic behavior in TNBCs. [score:1]
Figure 2Representative BLI of control and MDA-MB-231 [miR-200c/141] cells (A) Total photon flux of the bioluminescent signals emitted from control and MDA-MB-231 [miR-200c/141] cells. [score:1]
There is, as yet, no report of underlying mechanism by which miR-200c/141 increase c-Jun, c-Fos, and FosB or decrease miR-124a and miR-26b. [score:1]
Regional LN metastasis distant from the primary tumor was observed in two cases of five MDA-MB-231 [miR-200c/141] mice, while LN metastasis was not detected in controls (Figure 2I). [score:1]
At 56 days, these signals were up to 5-fold greater in MDA-MB-231 [miR-200c/141] mice (6.85×10 [7] ± 16.85 photon/sec/cm [2]/sr) than in controls (1.34×10 [7] ± 5.05 photon/sec/cm [2]/sr) (Figure 2D, P=0.007). [score:1]
Both SerpinB2 forms were present at higher levels in MDA-MB-231 [miR-200c/141] cells relative to controls (P<0.0001) (Figure 1F). [score:1]
A 47-kDa SerpinB2 was detected in MDA-MB-231 [miR-200c/141] cell conditioned medium (CM), but large forms (>60-kDa) were highly detected in both control and MDA-MB-231 [miR-200c/141] cell CM (Figure 1E). [score:1]
Tumor-bearing mice were randomly assigned to one of three groups: MDA-MB-231 (n=6); MDA-MB-231 [miR-200c/141] (n=6); and MDA-MB-231 [miR-200c/141]+si-SerpinB2 (n=6). [score:1]
In TNBC patients, we found a positive correlation between miR-200c, miR-141 and SerpinB2 mRNA. [score:1]
A wound-healing assay showed that SerpinB2 knockdown decreased MDA-MB-231 [miR-200c/141] cell migration (Supplementary Figure 4). [score:1]
Lentiviral vectors containing the miR-200c/141 cluster (GenBank ID: 406985 406933) and GFP constructs were kindly supplied by Dr. [score:1]
H&E staining of lung sections (Figure 3H) showed that lung metastasis scores and areas were greater in MDA-MB-231 [miR-200c/141] than in control (P<0.001), and were reduced in MDA-MB-231 [miR-200c/141]+si-SerpinB2 (P<0.001 and P=0.0045) (Figures 3I and 3J). [score:1]
Orthotopic xenografts were established via injection of 1×10 [6] MDA-MB-231 [miR-200c/141] (n=5) or control cells (n=5) into the fat pad of the 4th mammary gland of 5-week old mice. [score:1]
This is consistent with our xenograft results, and supports the potential role of the miR-200 family in promoting metastasis. [score:1]
Cytokeratin 8/18/19, GFP and SerpinB2 immunostaining showed LN metastases only in MDA-MB-231 [miR-200c/141] tumors, and not in controls (Figure 2H). [score:1]
Representative BLI (C) and total photon flux (D) of the bioluminescent signals in control, MDA-MB-231 [miR-200c/141], and MDA-MB-231 [miR-200c/141]+si-SerpinB2 cells. [score:1]
Total RNAs were isolated from breast cancer tissue of 21 patients with TNBC and real-time RT-PCR was performed to analyze miR-200c, miR-141 and SerpinB2 mRNA. [score:1]
In BC patients and animal mo dels, high miR-200c and miR-141 levels have been associated with enhanced metastatic colonization and poor clinical outcomes [7, 9, 10, 22, 23]. [score:1]
Together, our findings suggest that miR-200c, miR-141 and SerpinB2 are poor prognostic factors in TNBC. [score:1]
miR-200c (P=0.098) and miR-141 (P=0.013) levels positively correlated with SerpinB2 mRNA (Supplementary Figure 7). [score:1]
Figure 1C shows levels of SerpinB2 (47-kDa and >60-kDa forms) SerpinE1, and uPA in control and MDA-MB-231 [miR-200c/141] cell lysates. [score:1]
Representative RT-PCR (A) and western blotting results (B) for SerpinB2, SerpinE1, and uPA in control and MDA-MB-231 [miR-200c/141] cells transfected with SerpinB2 or scramble siRNA. [score:1]
[1 to 20 of 81 sentences]
5
[+] score: 265
The miR-200 target gene Zeb2 is down-regulated and E-cadherin is up-regulated in 4T1 cells. [score:9]
Over -expression of miR-200b and/or miR-200c in 4TO7 cells, either by transient transfection of miRNA mimics or infection with a miR-141-200c cluster -expressing retrovirus, led to a loss of Zeb2 expression, an increase in E-cadherin expression and the acquisition of an epithelial-like morphology. [score:9]
Over -expression of miR-200 in 4TO7 cells down-regulates Zeb2 expression, resulting in increased E-cadherin. [score:8]
The low expression of Zeb2 protein in 4T1 cells relative to 168FARN and 4TO7 cells is consistent with inhibition of Zeb2 translation by miR-200. [score:7]
Expression of miR-200, which promotes a mesenchymal to epithelial cell transition (MET) by inhibiting Zeb2 expression, unexpectedly enhances macroscopic metastases in mouse breast cancer cell lines. [score:7]
Knocking down Zeb2 had a similar effect as expressing miR-200c, except that Cdh2 mRNA was also significantly suppressed by reducing Zeb2. [score:6]
As a consequence of miR-200 expression, 4T1 cells have reduced Zeb2 expression and high E-cadherin expression compared to 4TO7 cells. [score:6]
The most prominent change in miRNA expression by microarray analysis between the three cell lines not able to colonize distant sites (67NR, 168FARN and 4TO7 cells) and 4T1 cells was up-regulation of several members of the miR-200 family in 4T1 cells (Figure 1A, Table S1). [score:6]
0007181.g005 Figure 5 (A) miR-200c expression is increased in 4TO7 cells stably expressing the miR-141-200c cluster from a retroviral vector. [score:5]
Protein expression of Zeb2 protein negatively correlates and E-cadherin positively correlates with miR-200 expression. [score:5]
The effect of exogenous miR-200 expression on E-cadherin expression and cell morphology of 4TO7 cells was also analyzed by fluorescence microscopy (Figure 4). [score:5]
To determine whether a gene was also a predicted target of miR-200b and c, the presence of miR-200 family binding sites was analyzed using TargetScan 5.0 (www. [score:5]
The TargetScan5.0 algorithm identified the zinc finger E-box binding homeobox 2 (Zeb2/SIP1/ZFXH1B) gene as the highest likelihood target gene of the miR-200 family with 6 potential miR-429/miR-200b/miR-200c binding sites and an additional 3 potential miR-141/miR-200a binding sites in its 3′UTR. [score:5]
miR-200 over -expression in 4TO7 cells reduces Zeb2 and Snai1 and increases E-cadherin expression. [score:5]
The cells incapable of colonization had very low to undetectable expression of all miR-200 family members, while 4T1 cells expressed miR-429, miR-200b and miR-200c. [score:5]
0007181.g003 Figure 3 (A) Zeb2 expression decreases and E-Cadherin (Cdh1) expression increases, analyzed by immunoblot relative to Gapdh, after transfection of 4TO7 cells with miR-200b and/or miR-200c. [score:5]
miR-200c levels, normalized to U6 snRNA expression, are shown relative to expression in 4T1 cells. [score:5]
Over -expressing either miR-200b or miR-200c or both led to a loss of Zeb2 expression and a concomitant increase in E-cadherin (Cdh1) levels (Figure 3A). [score:5]
This miRNA -mediated silencing of Zeb2 was the result of the directed targeting of the Zeb2 3′UTR by the miR-200 family, as previously reported [30]– [37]. [score:4]
This up-regulation of miR-200 family members was particularly pronounced in serous and endometroid histotypes. [score:4]
To test the direct targeting of Zeb2 by miR-200, the complete Zeb2 3′-UTR was cloned downstream of a Renilla luciferase reporter gene. [score:4]
To determine the effect of miR-200c cluster expression on colony formation, soft agar assays were performed using 4TO7 cells that were untreated or stably expressed a control vector, the miR-141-200c cluster, or a Zeb2 shRNA. [score:4]
The miR-200 family is up-regulated in 4T1 cells. [score:4]
To determine whether miR-200 regulates Zeb2 and E-cadherin expression in these breast cancer cell lines, we transfected 4TO7 cells with mimics of miR-200b or miR-200c alone or in combination. [score:4]
4TO7 cells over -expressing miR-200 or knocked down for Zeb2 morphologically resembled 4T1 cells. [score:4]
No significant signal was detected for miR-200a and 141 (N. D.  = not detected), averaged signal for all samples below 500), but the remaining miR-200 family members were highly expressed in 4T1 cells relative to the less metastatic 67NR, 168FARN, and 4TO7 cells. [score:3]
These findings are surprising since the miR-200 family was previously shown to promote epithelial characteristics by inhibiting the transcriptional repressor Zeb2 and thereby enhancing E-cadherin expression. [score:3]
Figure S1 The Zeb1 3′-UTR is a target of the miR-200 family of miRNAs. [score:3]
Moreover, over -expressing miR-200 in 4TO7 cells enabled them to metastasize to lung and liver. [score:3]
Based on the EMT hypothesis of cancer metastasis, it is expected that miR-200 expression would lead to a decrease in metastasis. [score:3]
In addition, they are encoded from 2 gene clusters in mice - miR-200c and miR-141 on chromosome 6 and miR-200b, miR-200a and miR-429 on chromosome 4. In agreement with recent papers [30]– [37], we found that the miR-200 family members target the transcriptional repressor Zeb2. [score:3]
Altering miR-200 or Zeb2 expression did not significantly change the number or size of colonies (Figure 6A, data not shown). [score:3]
Moreover, over -expression of the miR-200 family significantly correlated with decreased survival. [score:3]
Surprisingly, our results with this series of isogenic mouse mammary tumor cells showed the opposite effect - expression of miR-200 family members either endogenously in 4T1 cells or by retroviral transduction in 4TO7 cells enhanced both in vitro motility and in vivo metastases. [score:3]
We cannot rule out that some of the 4T1 or miR-200 -expressing 4TO7 cells transiently became E-cadherin- and more mesenchymal in vivo under the influence of local stromal factors. [score:3]
4T1 cells and miR-200 -expressing 4TO7 cells did not differ from parental 4TO7 cells in proliferative rate in vitro or growth in soft agar, but they both established primary tumors more rapidly and were capable of colonizing distant tissues. [score:3]
Although highly homologous, the miR-200 family members (miR-141, miR-429, miR-200a, miR-200b and miR-200c) can be divided into two functional groups based on their seed sequences, nucleotides 2 to 7 of the miRNA, which play an important role in target recognition. [score:3]
miR-200 expression does not alter colony formation or cell proliferation, but enhances cell motility in vitro. [score:3]
Stable expression of the miR-200c cluster in 4TO7 cells increased miR-200c expression to ∼3-fold higher than that of 4T1 cells as measured by qRT-PCR (Figure 5A). [score:3]
The members of the miR-200 family of miRNAs (miR-200b, miR-200c and miR-429) were highly expressed in 4T1 cells but undetectable in 4TO7 cells. [score:3]
0007181.g001 Figure 1 (A) miRNA microarray analysis of miR-200 family expression in 4 isogenic mouse breast cancer cell lines. [score:3]
Higher expression of the miR-200 family in the cell line capable of forming distant metastases was unexpected since the miR-200 family has been linked to epithelial differentiation [30]– [36] that is normally associated with decreased metastatic potential. [score:3]
In fact, expression of miR-429, miR-200b and miR-200c was elevated in the highly metastatic 4T1 cells but absent from 4TO7 cells, which can perform all of the steps leading up to the establishment of lung metastases except establishing the secondary tumor. [score:3]
Croce and colleagues found that the miR-200 family (miR-200a, miR-200b, miR-200c and miR-141) were upregulated in human ovarian cancers compared to normal ovarian tissue [51]. [score:3]
Exogenous miR-200 expression enhances the epithelial morphology of 4TO7 cells. [score:3]
4TO7 cells treated with either of the miR-200 mimics adopted an epithelial-like morphology and expressed high levels of E-cadherin, similar to the highly metastatic 4T1 cells. [score:3]
miR-200c expression increased Cdh1 mRNA, an epithelial marker, and decreased Snai1 and Zeb2, mesenchymal markers, but had no effect on N-cadherin (cdh2) or vimentin (Vim). [score:3]
miR-200 expression in 4TO7 cells confers in vivo metastatic potential. [score:3]
The expression of several genes involved in determining the epithelial or mesenchymal nature of cells were also analyzed by qRT-PCR in 4TO7 cells which had been treated with the miR-200c mimic, an siRNA against Zeb2 or a control siRNA (Figure 3C). [score:3]
These studies also showed that miR-200 expression enforces an epithelial phenotype in tumor cells, as we confirmed here in these mouse breast cancer cells. [score:3]
Transient over -expression of miR-200b and/or miR-200c in 4TO7 cells increased the number of migrating cells to that of 4T1 cells. [score:3]
However, the 4T1 and miR-200 -expressing 4TO7 cells retained some vimentin expression, suggesting that they may have some characteristics of both epithelial and mesenchymal cells. [score:3]
Although there was a delay in detecting 4TO7 primary tumors relative to 4T1 or miR-200 -expressing 4TO7 tumors, once tumors became palpable, mathematical mo deling did not show any significant change in their doubling times (data not shown). [score:3]
Over -expression of miR-200 in 4TO7 cells converts fibroblastic cells to an epithelial morphology. [score:3]
In fact, the more epithelial 4T1 and miR-200 -expressing 4TO7 cells were better able to traverse an artificial basement membrane in vitro than their more mesenchymal relatives. [score:3]
As expected, the miR-200c cluster -transfected cells expressed E-cadherin protein, which was undetected in the control virus -treated cells (Figure 5B). [score:3]
Transfection of miR-200b and/or miR-200c in 4TO7 cells increased E-cadherin expression, which also concentrated at cell junctions and shifted 4TO7 morphology from spindle-shaped cells to cobblestone-forming epithelial cells. [score:3]
Unlike Zeb2, Snai1 is not a predicted target of the miR-200 family. [score:3]
MiR-200 family member expression distinguishes highly metastatic 4T1 cells from 67NR, 168FARN, and 4TO7 cells. [score:2]
4T1 cells that form macroscopic metastases had elevated expression of miR-200 family miRNAs compared to related cells that invade distant tissues, but are unable to colonize. [score:2]
Although this paper is the first to show the direct enhancement of metastasis by the miR-200 family, changes in miR-200 family levels have been associated with enhanced tumorigenesis. [score:2]
In addition, members of the miR-200 family of miRNAs, miR-141 and miR-200b, were found to be over-expressed in malignant cholangiocarcinoma cells compared to non-malignant cells [55]. [score:2]
We next performed transwell migration assays to determine the effect of miR-200b and miR-200c expression on the ability of 4TO7 cells to penetrate through an 8-µm porous membrane overlaid with basement membrane components (laminin, collagen IV, heparan sulfate proteoglycans, entactin/nidogen). [score:2]
Expression of some members of the miR-200 family of miRNAs (miR-429, miR-200b, and miR-200c) was increased more than 100-fold in 4T1 cells compared to 4TO7 cells. [score:2]
In particular, it would be worthwhile to examine whether the miR-200 family might have a role in regulating the metastasis of different human breast cancer subtypes. [score:2]
To measure cell proliferation, 4TO7 cells (5×10 [5] cells/well in 6-well plates) were seeded and after 24 h, transfected with miR-200c mimics (50 nM) or siRNAs targeting Zeb2 or luciferase using Lipofectamine 2000 (Invitrogen) following the manufacturer's protocol. [score:1]
4TO7 cells were co -transfected with the Zeb2 3′-UTR luciferase plasmid or a control vector and either the control (ctl), miR-200b and/or miR-200c miRNA mimics. [score:1]
4TO7 cells were transfected with miRNA mimics (miR-200b and/or miR-200c) (Dharmacon) or Zeb2 or firefly luciferase siRNAs using Lipofectamine 2000 (Invitrogen). [score:1]
4TO7 and 4T1 cells were plated on glass cover slips and either left untreated or treated with miR-200b and/or miR-200c or a control miRNA mimic. [score:1]
Conversely, E-cadherin mRNA increased in cells transfected with either Zeb2 siRNA (2.1-fold) or miR-200c mimic (2.5-fold). [score:1]
The chromosomal locus (12p13.31) from which miR-141 and miR-200c are encoded is associated with chromosomal gain in biliary tract cancers. [score:1]
The 2 groups differ by a single seed nucleotide - miR-200b, miR-429 and miR-200c share the 5′-AAUACU-3′seed sequence and miR-200a and miR-141 have the 5′-AACACU-3′ seed. [score:1]
To evaluate the effect of miR-200 and Zeb2 on tumor formation and metastasis, we next engineered retroviruses encoding the miR-141-200c cluster mature miRNAs or control virus expressing firefly luciferase shRNA or Zeb2 shRNA within the miR-30 stem. [score:1]
0007181.g004 Figure 4 (A) Phase contrast microscopy of 4TO7 cells that were either mock treated or transfected with the miRNA control (ctl), miR-200b, or miR-200c mimic. [score:1]
Cells were co -transfected with psiCheck2 vector that contains the full length Zeb1 3′-UTR and with miR-200b and/or miR-200c miRNA mimics. [score:1]
In addition, mRNA for the mesenchymal transcription factor Snai1 was significantly reduced in 4TO7 cells transfected with either Zeb2 siRNA or miR-200c mimic. [score:1]
Transfection of both miR-200b and miR-200c had no added effect, presumably because these miRNAs redundantly bind to the same miRNA recognition sites (MRE). [score:1]
The decrease in Snai1 mRNA after treatment with miR-200c could be secondary to Zeb2 silencing and/or to recognition of a noncanonical MRE in Snai1. [score:1]
Zeb2 mRNA was significantly decreased in 4TO7 cells treated with either the Zeb2 siRNA or the miR-200c miRNA mimic. [score:1]
miR-200 enhances 4TO7 cells migration through a basement membrane, but does not affect cell proliferation. [score:1]
Transcripts for vimentin and N-cadherin, markers of mesenchymal cells, were not significantly altered by the miR-200c mimic, although N-cadherin mRNA was slightly, but significantly, decreased in the Zeb2 siRNA -treated cells. [score:1]
[1 to 20 of 81 sentences]
6
[+] score: 262
Finally, we sought to determine if the epigenetic regulation of miR-200c expression in normal cells is conserved evolutionarily, reasoning that DNA methylation-linked control of miR-200c expression across mammalian species would provide further experimental support for epigenetic control of cell-type specific expression of miR-200c. [score:8]
Second, different histone codes exist between miR-200c/141 expressing and non -expressing cells that accurately mirror the expression and DNA methylation states. [score:7]
Mamm Genome 9 Hurteau GJ Carlson JA Spivack SD Brock GJ 2007 Overexpression of the microRNA hsa-miR-200c leads to reduced expression of transcription factor 8 and increased expression of E-cadherin. [score:7]
In this study, we show that the epigenetic state is closely linked to normal cell type specific expression of miR-200c and miR-141, and this epigenetic state is dysregulated in carcinoma cells, where loss of miR200c/141 expression is linked to aberrant DNA methylation and histone modifications. [score:6]
The significant conservation in DNA sequence, patterns of cell type-specific DNA methylation, and the associated miR-200c expression patterns between the human and mouse genomes, which are separated by 75 million years of evolution [22], provides evidence that epigenetic mechanisms play a functional role in the control of miR-200c expression. [score:5]
miR-200c and miR-141 expression is lost in different types of cancer cells [5], [11], [20], [21], and we sought to determine if this loss of expression was linked to epigenetic changes in the miR-200c/miR-141 CpG island. [score:5]
We show two prostate cancer cell lines (PC3 and PC3 B1) where loss of miR-200c and miR-141 expression is linked with aberrant DNA methylation of the mir-200c/141 CpG island (Figure 3B; Figure S3), and two prostate cancer cell lines (LNCaP and DU145) that retain miR-200c/miR-141 expression and an unmethylated mir-200c/141 CpG island. [score:5]
Mouse keratinocytes expressed significant levels of miR-200c, while the mouse fibroblasts did not express detectable levels of miR-200c (Figure 6B). [score:5]
Our small RNA library sequencing data (Figure 1A) show that the miR-200 family is highly expressed in cultured normal human mammary epithelial cells (HMEC) derived from three different individuals, whereas the isogenic human mammary fibroblast cells (FB) lack miR-200 family expression (Figure 1A). [score:5]
Taken together, the results from the analyses of miR-200c/141 expression, DNA methylation, and histone modification states across a variety of normal and cancer cell types demonstrate a close link between the expression of mir-200c/141 and the epigenetic state of their associated CpG island. [score:5]
In all cases, miR-200c and miR-141 were highly expressed in epithelial cells, but were not expressed in fibroblasts. [score:5]
The left panel shows the expression of miR-200c in the same samples as panel A. The right panel shows the expression of miR-200c in human prostate epithelial cells (PREC), prostate stromal fibroblasts (PSF), human skin keratinocytes (Kcytes) and skin fibroblasts (HFF). [score:5]
B. Mouse cells show a similar cell type specific pattern in miR-200c expression to human cells and this expression is linked to the DNA methylation state of the CpG island. [score:5]
The PC3 cells that have lost miR-200c and miR-141 expression, display an aberrantly methylated CpG island and a mesenchymal phenotype, whereas LnCaP and Du145 retain miR-200c and miR-141 expression and an epithelial phenotype [11], [30]. [score:5]
In summary, our findings provide multiple lines of evidence that epigenetic mechanisms are involved in the regulation of miR-200c/141 expression in both normal and cancer cells. [score:4]
Regulation of the miR-200 family expression in normal and cancer cells is not fully understood. [score:4]
In addition to the role of miR-200c and miR-141 in the phenotypic conversion of normal cells, dysregulation of normal patterns of miR-200c expression occurs in multiple types of cancer cells and is linked to tumor progression [2], [6], [12], [13], [14], [15]. [score:4]
Mouse cells show a similar inverse correlation between DNA methylation and miR-200c expression. [score:3]
B. miR-200c expression and mir-200c CpG island methylation in four prostate cancer cell lines. [score:3]
To demonstrate the functional significance of the epigenetic state of the miR-200c/mir-141 CpG island in cancer cells, we exposed cancer cells to the epigenetic modifier and DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (5-AdC). [score:3]
The other four breast cancer cell lines tested do not express miR-200c and miR-141 and exhibit a densely methylated mir-200c CpG island. [score:3]
It is apparent from the small RNA library sequencing data (Figure 1A) that the most highly expressed members of the miR-200 family in HMEC are miR-200c and miR-141. [score:3]
The histone modification state of the mir-200c cluster CpG island also shows cell type-specific differences that are closely linked to the expression state of miR-200c/141 in normal and cancer cells. [score:3]
The epigenetic modifier drug, 5-aza-2′-deoxycytidine, reactivates miR-200c/miR-141 expression showing that epigenetic mechanisms play a functional role in their transcriptional control. [score:3]
B. Real-time PCR assessment of miR-200c expression in normal cell types. [score:3]
miR-200c is expressed in an epithelial selective fashion. [score:3]
The CpG island is unmethylated in human miR-200/miR-141 expressing epithelial cells and in miR-200c/miR-141 positive tumor cells. [score:3]
The microRNA-200 family participates in the maintenance of an epithelial phenotype and loss of its expression can result in epithelial to mesenchymal transition (EMT). [score:3]
Epigenetic mechanisms participate in the control of miR-200c and miR-141 expression in both normal and cancer cells. [score:3]
Dysregulation of miR-200c and miR-141 occurs in multiple cancer types [5], [11], [20], [21], [23], [24], [25], [26], and this dysregulation involves a compromise of the epigenetic state of the CpG island associated with miR-200c and miR141. [score:3]
Since miR-200c and miR141 play an important role in EMT and therefore cell identity, disruption of mechanisms that govern cell type specific DNA methylation patterns during carcinogenesis could likely effect expression of miR-200c and miR141 and provide phenotypic plasticity to cancer cells. [score:3]
Seven of the breast cancer cell lines tested express miR-200c and miR-141 and each has an unmethylated mir-200c CpG island. [score:3]
Figure 4 shows 5-AdC reactivated miR-200c expression in all three cancer cell lines. [score:3]
A CpG island near the predicted mir-200c/mir-141 transcription start site shows a striking correlation between miR-200c and miR-141 expression and DNA methylation in both normal and cancer cells, as determined by MassARRAY technology. [score:3]
Furthermore, the loss of expression of miR-200 family members is linked to an aggressive cancer phenotype. [score:3]
The upper panel shows the expression of miR-200c detected by real-time PCR. [score:3]
Similarly, the breast cancer cell lines that had lost miR-200c/141 expression lost histone H3 acetylation and K4 trimethylation and acquired a repressive histone state, enriched for the H3 lysine 9 dimethylation mark (Figure 5). [score:3]
In contrast, those breast cancer cell lines that express miR-200c and miR-141 and have an unmethylated CpG island display an epithelial phenotype [11], [29]. [score:3]
A. miR-200 family expression according to massive parallel sequencing of small RNA libraries from a set of three isogenic pairs of human mammary epithelial cells (HMEC) and fibroblasts (FB). [score:3]
We report that DNA methylation plays a role in the normal cell type-specific expression of miR-200c and miR-141 and this role appears evolutionarily conserved, since similar results were obtained in mouse. [score:3]
We corroborated the expression of miR-200c and miR-141 in the same set of normal mammary samples by real-time PCR, and then expanded these results to pairs of epithelial cells and fibroblasts from prostate and skin, as well (Figure 1B; Figure S1). [score:3]
miR-200 family expression according to massive parallel sequencing of small RNA libraries from a set of three isogenic pairs of human mammary epithelial cells (HMEC) and fibroblasts (FB). [score:3]
reactivates miR-200c expression in breast and prostate cancer cell lines. [score:3]
0008697.g003 Figure 3 A. miR-200c expression and mir-200c CpG island methylation in eleven breast cancer cell lines. [score:3]
The inverse correlation between miRNA expression and DNA methylation extends to other miR-200c/miR-141 -positive/negative pairs of normal cells, such as prostate epithelial cells and skin keratinocytes, and their mesenchymal cell type counterparts, prostate and skin fibroblasts. [score:3]
These data suggest that epigenetic mechanisms participate in the inappropriate repression of miR-200c/miR-141 expression in cancer cells. [score:3]
All four of the breast cancer cell lines that lost miR-200c and miR-141 expression have an aberrantly methylated mir-200c/141 CpG island, and each of these cell lines displays a mesenchymal phenotype [11], [29]. [score:3]
Figure S2DNA methylation of the mir-200c CpG island inversely correlates with miR-200c expression in normal human samples. [score:3]
We analyzed 11 breast cancer cell lines, and in each case, miR-200c and miR-141 expression was closely linked to the DNA methylation state of the CpG island (Figure 3A; Figure S3). [score:3]
The top panel of each figure shows the expression of miR-200c in cancer samples as detected by real-time PCR, normalized to let-7a. [score:3]
A. miR-200c expression and mir-200c CpG island methylation in eleven breast cancer cell lines. [score:3]
The miR-200c/miR-141 -negative breast cancer cell lines MDA-MB-231 and BT549 and prostate cancer cell line PC3 were treated with 3 µM 5-AdC for 96 h and miR-200c/141 expression was assessed by real-time PCR. [score:3]
The mechanism responsible for the control of miR-200c expression in both normal and cancer cells is not fully understood. [score:3]
Epigenetic control of miR-200c expression is evolutionarily conserved. [score:3]
The left panel shows the expression of miR-200c in mouse epithelial cells (308, 6R90, SKH-1 epidermis) and mouse fibroblast cell lines (NIH 3T3, NR6, NIH 3T6) as detected by real-time PCR. [score:3]
The CpG units within the MassARRAY amplicon are numbered in the reverse direction, with CpG 2 being located within the miR-200c coding sequence. [score:2]
miR-200c and miR-141 are members of the miR-200 family and are important regulators of the epithelial to mesenchymal transition (EMT) [5], [9], [10], [11]. [score:2]
CpG units within MassARRAY amplicon are numbered in reverse direction, with CpG 1 being located within the miR-200c coding sequence. [score:2]
Finally, we found that the miR-200c regulation by DNA methylation is evolutionarily conserved between humans and mice. [score:2]
The level of miR-200c increased 4.3-fold in MDA-MB-231 (p-value = 0.0004), 6.4-fold in BT549 (p-value = 0.0107) and 4.2-fold in PC3 cells (p-value = 0.0072). [score:1]
The regions encoding the mir-200c and mir-141 hairpins and the putative transcription start (TSS) region inferred from the human EST track of the UCSC genome browser are displayed, and each circle on this track represents the position of a CpG dinucleotide. [score:1]
The y-axis shows fold enrichment of each histone mark over input DNA within the mir-200c CpG island. [score:1]
Together these results indicate that cancer cells derived from normal miR-200c/miR-141 -positive epithelial cells can replicate the cell type-specific DNA methylation pattern of the miR-200c/141 CpG island seen in normal miR-200c/miR-141 -negative cells, and that the aberrant DNA methylation of the miR200c/141 CpG island in these cancer cells is associated with its transcriptional silencing in carcinoma cells. [score:1]
The mir-200c CpG island shows differential cytosine methylation between miR-200c -positive and miR-200c -negative normal human tissues. [score:1]
DNA methylation of mir-200c CpG island in breast and prostate cancer cell lines. [score:1]
A MassARRAY amplicon was designed to analyze the DNA methylation state of the mouse mir-200c/141 region homologous to that analyzed in human (Figure 6A). [score:1]
The regions encoding the hairpins of mir-200c and mir-141 and the putative transcription start (TSS) inferred from the mouse EST track displayed on the UCSC genome browser are shown, and each circle on this track represents the location of a CpG dinucleotide. [score:1]
Since the miR-200c cluster plays a significant role in EMT, our results suggest an important role for DNA methylation in the control of phenotypic conversions in normal cells. [score:1]
Results show that the CpG sites are unmethylated in three separate strains of miR-200c/miR-141 -positive HMEC. [score:1]
revealed that the miR-200c -positive keratinocytes showed minimal DNA methylation in the mir-200c CpG island, while the miR-200c -negative mouse fibroblasts showed extensive DNA methylation of all CpG sites in the region (Figure 6B). [score:1]
Similar to the human hsa-mir-200c, the mouse mmu-mir-200c contains a CpG island, identified by the program CpG Cluster. [score:1]
Results suggest that these carcinoma cells may co-opt de novo DNA methylation pathways involved in the epigenetic control of normal cell type-specific genes, such as those that govern the epigenetic state of miR-200c/miR-141. [score:1]
The CpG island is heavily methylated in human miR-200c/miR-141 negative fibroblasts and miR-200c/miR-141 negative tumor cells. [score:1]
With the average of 63,829 counts out of 3,926,984 per library in HMEC, miR-200c forms 1.625% of all small RNAs in these cells. [score:1]
One cluster resides on human chromosome 1 and encodes miR-200b, miR-200a, and miR-429, while the other cluster is located on human chromosome 12, and encodes miR-200c and miR-141. [score:1]
No enrichment of trimethylation of histone H3 lysine 27 was detected in the miR-200c/141 CpG island in the samples analyzed (Figure S5). [score:1]
Thus, the miR-200c cluster CpG island is unmethylated in normal miR-200c/miR-141 -positive epithelial cells, while being densely methylated in the paired normal miR-200c/miR-141 -negative fibroblasts (Figure 1B, Figure 2B, Figure S2). [score:1]
In contrast, all the CpG sites are highly methylated in the isogenic miR-200c/miR-141 -negative fibroblast strains. [score:1]
HMEC samples are shown in green, isogenic FB samples are shown in red, and two miR-200 -negative breast cancer cell lines are in blue. [score:1]
The mir-200c hairpin coding sequence and approximately 300 bp of upstream genomic sequence is CpG rich. [score:1]
To evaluate a potential role for DNA methylation in the control of miR-200c/141 in mice, CpG methylation and miRNA expression were analyzed in mouse epithelial cells (epidermis of SKH-1 mouse and keratinocyte cell lines 308 and 6R90) and mouse fibroblasts (cell lines NIH 3T3, NIH 3T6, and NR6). [score:1]
We used MassARRAY technology to analyze the DNA methylation state of the mir-200c cluster CpG island (Figure 2B). [score:1]
A. A diagram of the genomic region of hsa-mir-200c. [score:1]
Enrichment of permissive histone modifications, H3 acetylation and H3K4 trimethylation, is seen in normal miR-200c/miR-141 -positive epithelial cells, as determined by chromatin immunoprecipitation coupled to real-time PCR. [score:1]
Strikingly similar results for miR-200c were found between the human cells and mouse cells. [score:1]
Cells were treated with 3 µM 5-aza-2′-deoxycytidine for 96 h. The level of expression of miR-200c was measured by real-time PCR. [score:1]
In contrast, in the isogenic miR-200c/miR-141 -negative mammary fibroblasts permissive histone modifications are absent, and the repressive H3 lysine 9 dimethylation mark is present (Figure 5). [score:1]
Figure 5 shows the results of chromatin immunoprecipitations coupled to quantitative real-time PCR analysis that were used to examine the histone modification state of the miR-200c/141 CpG island in normal and cancer cells. [score:1]
The histone modification state of the mir-200c CpG island. [score:1]
Similar to the human mir-200c/141 genomic region, the mouse mir-200c/141 genomic region also contains a CpG island (Figure 6A; length 325 bp, GC% 66.77, O/E ratio 0.58, 19 CpGs, p-value 1.06×10 [−10]). [score:1]
Figure S5Histone H3 K27 trimethylation state of the mir-200c CpG island. [score:1]
A. Diagram of the mouse mmu-mir-200c genomic interval. [score:1]
0008697.g006 Figure 6 A. Diagram of the mouse mmu-mir-200c genomic interval. [score:1]
Taken together, these findings indicate that miR-200c/141 is an evolutionarily conserved epigenetically labile miRNA cluster. [score:1]
The bottom panel shows the methylation level of the mir-200c CpG island region in the same cancer samples. [score:1]
The CpG island of mir-200c/141 in the three different strains of miR-200c/miR-141 -positive HMEC exists in a transcriptionally competent state; it is enriched for the transcriptionally permissive modifications of histone H3 acetylation (H3Ac) and lysine 4 trimethylation (H3TriMeK4), while the transcriptionally repressive histone mark of histone H3 lysine 9 dimethylation (H3DiMeK9) is underrepresented (Figure 5). [score:1]
The whole genomic cluster containing mir-200c and mir-141 is well conserved between the human and mouse genome. [score:1]
The miR-200 family is comprised of five miRNAs that are encoded within two clusters. [score:1]
A diagram of the genomic region of hsa-mir-200c. [score:1]
The right panel shows the methylation level of the mir-200c CpG island region in the same mouse samples. [score:1]
Since miR-200c plays a significant role in EMT, our results suggest that DNA methylation plays an important role in the control of phenotypic conversions of normal and cancer cells. [score:1]
In contrast, repressive H3K9 dimethylation marks are present in normal miR-200c/miR-141 -negative fibroblasts and miR-200c/miR-141 negative cancer cells and the permissive histone modifications are absent. [score:1]
The y-axis shows a lack of enrichment of the histone H3 K27 trimethylation mark within the mir-200c CpG island relative to input DNA in all the samples analyzed. [score:1]
Aberrant DNA methylation of the miR-200c/141 CpG island is closely linked to their inappropriate silencing in cancer cells. [score:1]
The bottom panel shows the methylation level of mir-200c CpG island region in the same human samples. [score:1]
Histone H3 lysine 27 trimethylation levels of the region of the mir-200c CpG island described in Figure 2A were analyzed by chromatin immunoprecipitation coupled to real-time PCR. [score:1]
Third, the epigenetic modifier 5-aza-2′-deoxycytidine relieves the repression of miR-200c/miR-141 in cancer cell lines. [score:1]
0008697.g004 Figure 4Cells were treated with 3 µM 5-aza-2′-deoxycytidine for 96 h. The level of expression of miR-200c was measured by real-time PCR. [score:1]
The epigenetic state of the miR-200c/141 CpG island shows clear and extensive cell type specific differences between normal miR-200c/141 -positive and miR-200c/141 -negative cells. [score:1]
[1 to 20 of 109 sentences]
7
[+] score: 250
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-200a
In A459 cells, the overexpression of miR-200c was found to suppress EMT through downregulating N-cadherin and vimentin while upregulating E-cadherin, and it also significantly reduced cell invasion and migration through inhibiting ZEB2 expression [32]. [score:15]
Chang et al. have shown that miR-200c inhibits EMT and metastasis of breast cancer cells by targeting HMGB1 [31], and Jiao et al. have reported that miR-200c inhibits the metastasis of A549 cells by targeting ZEB2, an EMT regulator [32]. [score:10]
The data showed that miR-200c was significantly downregulated in tumour tissue compared with normal tissue; in addition, the overexpression of HMGB1 did not directly affect miR-200c expression in NSCLC. [score:8]
In this study, the overexpression of miR-200c reduced endogenous HMGB1 expression, suggesting that HMGB1 expression is negatively regulated by miR-200c in A549 cells (Fig 5). [score:8]
Our data were consistent with the above study and showed that the overexpression of miR-200c inhibited migration, invasion, and cytoskeletal F-actin rearrangement in A549 cells by downregulating HMGB1. [score:8]
Furthermore, the inhibition of miR-200c expression increased EMT, which was similar to the effect of HMGB1 overexpression. [score:7]
In this study, we transfected miR-200c mimic or inhibitor into A549 cells to identify whether it can inhibit HMGB1 expression and exert anti-tumour effects. [score:7]
Overall, these data strongly suggest that miR-200c transfection significantly downregulated HMGB1 and suppressed HMGB1-regulated lung cancer EMT and progression. [score:7]
The results indicated that the overexpression of miR-200c significantly reduced HMGB1 expression by binding to its 3′untranslated region. [score:7]
The data suggested that miR-200c inhibitsα-SMA and vimentin expression and attenuates the nuclear translocation of β-catenin, indicating that it suppresses EMT processes. [score:7]
Chang et al. suggested that miR-200c inhibited the invasion and migration of breast cancer cells via targeting the expression of HMGB1 [31]. [score:7]
In various cancers, miR-200c has been demonstrated to be an effective tumour suppressor that inhibits cancer development, proliferation, EMT, therapy resistance, and metastasis [17, 30]. [score:6]
Previous studies have reported that miR-200c inhibits EMT processes in cancer cells by regulating the expression of EMT markers including E-cadherin, N-cadherin, TCF8/ZEB1, Snail, vimentin, and β-catenin [33, 34]. [score:6]
Nevertheless, it is not known whether miR-200c acts as a tumour suppressor through downregulating HMGB1 in NSCLC. [score:6]
Previous studies have demonstrated that endogenous miR-200c suppresses EMT by regulating cell adhesion through targeting the E-cadherin transcriptional repressors ZEB1 and ZEB2 [15, 16]. [score:6]
However, it remains unknown whether miR-200c can inhibit HMGB1 expression in lung cancer cells. [score:5]
A recent study has demonstrated that miR-200c overexpression significantly accelerates cell cycle arrest at G [0]/G [1] phase, inhibits cell proliferation, and induces cell apoptosis in A549 cells, possibly through activating the p53/p21 pathway [47]. [score:5]
How the effects of targeting both HMGB1 and ZEB2 in contributing to the EMT inhibition induced by miR200c need to be further performed. [score:5]
2014; 34: 201– 6. 32 Jiao A, Sui M, Zhang L, Sun P, Geng D, Zhang W, et al MicroRNA-200c inhibits the metastasis of non-small cell lung cancer cells by targeting ZEB2, an epithelial-mesenchymal transition regulator. [score:5]
In contrast, the silencing of miR-200c expression increased HMGB1 expression in A549 cells. [score:5]
Fourth, miR200c is also known to target ZEB2, which can inhibit EMT in lung cancer especially A549 cells. [score:5]
Real-time PCR analysis of miR-200c expression in A459 cells after transfection with a miR-200c mimic or inhibitor (B). [score:5]
miR-200c suppresses the expression of EMT -associated proteins in A549 cells. [score:5]
Therefore, to further evaluate whether miR-200c can inhibit EMT processes in lung cancer, we examined the expression of α-SMA, vimentin, and β-catenin expression by real-time PCR (Fig 6A), western blotting (Fig 6B), and immunocytochemical staining (Fig 6C). [score:5]
Our results characterised HMGB1 as a potential target of miR-200c and showed that miR-200c may regulate A549 cell EMT, and cancer progression by targeting HMGB1. [score:4]
miR-200c regulates HMGB1 expression in lung cancer cells. [score:4]
This study aimed to investigate whether miR-200c exerts tumour suppressor effects in NSCLC in vivo and in vitro via downregulating HMGB1 and thereby reducing EMT, invasion, and migration. [score:4]
miR-200c inhibits lung cancer cell invasion and metastasis. [score:3]
First, we did not explore the clinical data for the correlation between miR-200c expression and EMT metastasis/invasion; therefore, the results of this study should be applied to human subjects with caution. [score:3]
Alignment of the sequence of miR-200c with that of the 3′untranslated region of HMGB1 showing the putative binding sites (A). [score:3]
Overexpression of miR-200c significantly decreased filopodia formation and limited the filopodia contact area between cells and substrates. [score:3]
The expression of miR-200c in normal/tumour tissue transfected with or without LV-HMGB1 was analysed by real-time PCR (Fig 8C and 8D). [score:3]
A549 cells were transfected with HMGB1 siRNA (AM16106; Life Technologies), miR-200c-3p mimic (MC11714; Life Technologies) or miR-200c inhibitor (MH11714; Life Technologies)using the Lipofectamine [®] RNAiMAX kit (Thermo Fisher Scientific). [score:3]
MicroRNA-200c (miR-200c), belongs to the microRNA-200 family, and is highly expressed in normal epithelial cells [13, 14]. [score:3]
miR-200c inhibits EMT, migration, invasion, and cytoskeletal rearrangement in A549 cells. [score:3]
Furthermore, Perdigão–Henriques et al. demonstrated that miR-200c suppresses cancer migration and invasion by stabilising actin filaments in lamellipodia and filopodia to promote the epithelial phenotype [35]. [score:3]
Cell transfection with HMGB1 siRNA and miRNA-200c mimic and inhibitor. [score:3]
0180844.g006 Fig 6 A miR-200c mimic or inhibitor was applied to A459 cells for 24h and then the mRNA and protein expression levels of α-SMA, vimentin, and β-catenin were measured by real-time PCR (A), western blotting (B), and immunocytochemical staining (C). [score:3]
A miR-200c mimic or inhibitor was applied to A459 cells for 24h and then the mRNA and protein expression levels of α-SMA, vimentin, and β-catenin were measured by real-time PCR (A), western blotting (B), and immunocytochemical staining (C). [score:3]
miR-200c and HMGB1 expression affect the EMT of NSCLC xenografts in vivo. [score:3]
These data support the role of miR-200c as a suppressor of HMGB1 signalling in the lung. [score:3]
Our results indicated that miR-200c attenuated cancer EMT, invasion, and migration through decreasing HMGB1 expression. [score:3]
Cell transfections with HMGB1 siRNA and miR-200c mimic and inhibitor were performed as described previously [24]. [score:3]
Transfection mixtures containing 0.25 ml of Lipofectamine [®] 2000 (Life Technologies), 25 ml of Opti-MEM [™] (Life Technologies), and 10 nM siRNA or15 pmol/ml miR-200c inhibitor or mimic were incubated at room temperature for 10 min and then added to A549 cells seeded in 6-well plates in medium containing 10% (v/v) FBS. [score:3]
0180844.g005 Fig 5. Alignment of the sequence of miR-200c with that of the 3′untranslated region of HMGB1 showing the putative binding sites (A). [score:3]
This finding supports miR-200c as a potential treatment target in NSCLC. [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
Therefore, miR-200c may represent a molecular biomarker of NSCLC outcome, and on the other hand, it could be a therapeutic target for the reduction of lung cancer progression. [score:3]
Further studies of HMGB1-regulated signalling pathways implicated in lung cancer EMT and cancer progression are required to validate the potential of miR-200c for use in therapy for lung cancer. [score:2]
Moreover, real-time PCR (Fig 5C), western blotting (Fig 5D), and immunocytochemical staining (Fig 5E) were used to evaluate whether HMGB1 expression is regulated by miR-200c in A549 cells. [score:2]
As shown in Fig 7E, FE-SEM analysis indicated that overexpression of miR-200c was reduced filopodia average number and length (2.0~3.0 μm in length) compared with control (3.0~5.0 μm in length) or anti-miR-200c group (8~10 μm in length). [score:2]
MiR-200c has been shown to have tumour suppressor effects in various cancers [47, 48]. [score:2]
Furthermore, miR200c has also been reported to regulate proliferation, invasion, metastasis, and chemosensitivity in various cancers [17– 19]. [score:2]
Prognostic significance of microRNA-200c in various types of cancer: An updated meta-analysis of 34 studies. [score:1]
The expression of miR-200c was measured by real-time PCR analysis (Fig 5B). [score:1]
2016; 6. 13 Kumar S, Nag A, C Mandal C. A Comprehensive review on miR-200c, a promising cancer biomarker with therapeutic potential. [score:1]
Normal/tumour tissue transfected with or without LV-HMGB1were collected and the expression of miR-200c was measured by real-time PCR (C and D). [score:1]
do) and found that HMGB1 (NM_002128) contained potential binding sites for miR-200c (Fig 5A). [score:1]
[1 to 20 of 58 sentences]
8
[+] score: 242
Other miRNAs from this paper: mmu-mir-141, mmu-mir-200b, mmu-mir-200a, mmu-mir-429
In total, 744 patients were available for analyses of expression of miR-200 s. Most miR-200 s were downregulated in late-stage primary tumors, but all miR-200 s were downregulated in the primary tumors with metastasis (Fig.   3c). [score:9]
Likewise, direct binding of the KAT2B/P300/ZEB1 complex to the miR200c/141 promoter activates their transcription in cancer cells, but disruption of KAT2B and P300 interactions downregulates the promoter activity of miR-200c/141, indicating a direct functional regulation of miR200c/141 by the KAT2B/P300/ZEB1 complex in cancer cells [39]. [score:7]
Apart from the miR-200-ZEB1/2-E-cadherin axis, miR-200 s inhibit Wnt through CTNNB1, NOTCH through JAG1, and SNAIL through SNAI2, and other direct targets, FN1, MSN, NTRK2, LEPR, and ARHGAP19, all of which are necessary for tumor metastasis [15– 17]. [score:6]
Since endogenous FOXP3 is expressed in the normal immortalized human epithelial cell line, MCF10A [31], we knocked down FOXP3 in MCF10A cells by short hairpin RNAs [31] and found that expressions of miR-200c and miR-141 in the cells were decreased after FOXP3 silencing (Additional file 1: Figure S1A-B). [score:6]
Likewise, early evidence showed increased expression levels of miR-200c and miR-141 in metastatic breast tumors [13], but recent studies revealed decreased expression of miR-200c in primary breast tumors with lymph node metastasis [50– 52]. [score:5]
All experiments were repeated three times To determine if miR-200 is expressed in human breast cancers, the breast invasive carcinoma (n = 1100) expression dataset (RNAseqV2, UNC) from NCI The Cancer Genome Atlas (TCGA) was examined. [score:5]
Recent studies suggest that the miR-200c/141 cluster may act as a suppressor for the early stages of metastasis, but facilitate post-extravasation events, and that the miR-200b/a/429 cluster suppresses metastasis at all stages [13, 14, 53]. [score:5]
In cancer cells, miR-200 s induce epithelial differentiation by suppressing ZEB1/2 and subsequently increasing E-cadherin expression [11, 12]. [score:5]
All experiments were repeated three times To determine if miR-200 is expressed in human breast cancers, the breast invasive carcinoma (n = 1100) expression dataset (RNAseqV2, UNC) from NCI The Cancer Genome Atlas (TCGA) was examined. [score:5]
With the Foxp3 sf/+ spontaneous breast cancer mouse mo del, we observed downregulation of miR-200c and miR-141 in primary breast cancer cells, especially in mice with lung metastases. [score:4]
Members of the human and mouse miR-200 family (miR-200 s), including two clusters (cluster 1: miR-200b, 200a, and 429, on chromosome 1, and cluster 2: miR-200c and miR-141, on chromosome 12), inhibit the epithelial-mesenchymal transition (EMT) [11, 12] but promote the mesenchymal-epithelial transition (MET) [13, 14], thereby regulating tumor metastasis by a reversible EMT-MET transition. [score:4]
Our analysis of TCGA database identified downregulation of miR-200 s in primary breast cancer cells in patients with distant metastases. [score:4]
On the other hand, expression levels of miR-200c and miR-141 in exosomes, but not cell-free and exosome-free culture medium, were reduced in the FOXP3-knockdown MCF10A cells (Additional file 1: Figure S1C-D). [score:4]
a- c Quantification of miR-200c and miR-141 (by quantitative (q)PCR) as a percentage of RNU6B or cel-mir-39 expression in FOXP3/GFP-Tet-off MCF7 cells without Dox at 0, 1, 2, 3, and 5 days. [score:3]
To avoid the potential effect of FOXP3 [+] TILs, we selected the CD25 [low] tumors, indicative of few FOXP3 [+] TILs, to assess the association between expression of FOXP3 and miR-200 s in the TCGA breast cancers (Additional file 1: Figure S2C). [score:3]
Decreased levels of miR-200 s in tumor cells have been implicated in the invasion and metastasis of breast cancer [11, 12, 18], but, in preclinical mo dels, restoration of miR-200c reduced metastases [19], suggesting that the miR-200 s function as tumor suppressors. [score:3]
ZEB1 and ZEB2 both bind to the two miR-200 clusters, causing inhibition of the transcription of all miR-200 s; Sp1 binds the miR-200b/a/429 cluster [44, 54] and p53 binds the miR-200c/141 cluster [44, 55], leading to activation of transcription of miR200s. [score:3]
All experiments were repeated three times For an independent Caucasian cohort, the plasma levels of miR-200c and miR-141 were examined for 50 patients with local breast cancer (42 with pT1-2N0M0 and 8 with pT3-4N0M0) and 25 patients with metastatic breast cancer (15 with only lymph node involvement (N1-3) after surgery, and 10 with distant metastatic disease (i. e., lungs, liver, bones) (M1) diagnosed after surgery). [score:3]
These data indicate that miR-200c and miR-141 at miR-200 cluster 2 are downstream targets of FOXP3. [score:3]
e Llevels of miR-200c and miR-141 in blood cells presented as percentages of RUN6B expression for patients with localized breast cancer, patients with metastatic breast cancer, and normal female controls. [score:3]
All experiments were repeated three times For an independent Caucasian cohort, the plasma levels of miR-200c and miR-141 were examined for 50 patients with local breast cancer (42 with pT1-2N0M0 and 8 with pT3-4N0M0) and 25 patients with metastatic breast cancer (15 with only lymph node involvement (N1-3) after surgery, and 10 with distant metastatic disease (i. e., lungs, liver, bones) (M1) diagnosed after surgery). [score:3]
According to our previous ChIP-sequencing data [30], the binding signals of FOXP3 are close (-3.4 kb) to the locus at non-regulated miR-200 cluster 1 (miR-200a/b/429) but distal (-20 kb) to the locus at FOXP3-regulated miR-200 cluster 2 (miR-200c/141) in FOXP3/GFP-Tet-off MCF-7 cells (Additional file 1: Figure S3A-B). [score:3]
Association of expression levels of miR-200 s with ER/PR/HER2 status in breast cancer cells. [score:3]
Although, during breast cancer metastasis, there was differential expression of miR-200c and miR-141 in tumor cells (Figs.   3b and c) and plasma (Figs.   3d, 4a and b), whether miR-200c and miR-141 were released by tumor cells or blood cells [48] was not determined. [score:3]
In murine cancers and human xenograft mo dels, miR-200 -expressing tumor cells and extracellular vesicles from these tumor cells promote breast cancer metastasis and confer the capacity for these cells to colonize distant tissues in an miR-200 -dependent manner [20]. [score:3]
In further studies, isolation of circulating CTCs and exosomes from mice or patients with breast cancer and comparison of expression levels of miR-200 s between CTCs and exosomes will address this hypothesis. [score:3]
In total, 542 samples were available for analyses of expression of both miR-200 s and FOXP3. [score:3]
Since expression levels of miR-200c and miR-141 in blood cells are not changed in humans or mice, tumor cells are likely to be the source, but future studies are needed to address this complex mechanism of action. [score:3]
These data indicate that in MCF-7 cells, miR-200c and miR-141 are regulated indirectly by FOXP3. [score:3]
Functional studies have found conflicting results on the role of miR-200 s in suppressing or promoting metastasis in different cellular contexts [11– 14]. [score:3]
Thus, these data suggest that FOXP3 -induced miR-200c/141 may function as metastatic suppressors at primary sites [11, 12, 18, 19] but as metastatic promotors at metastatic sites [13, 14]. [score:3]
To determine if expression patterns in human breast cancers reflect the data from mice, the levels of plasma miR-200c and miR-141 were examined by nest-qPCR analysis of a breast cancer population. [score:3]
Associations between expression of FOXP3 and miR-200 s in TCGA breast cancer samples. [score:3]
c Quantification of miR-200 s (by qPCR) as a percentage of RUN6B expression in T47D (left), BT474 (middle), and MDA-MB-468 (right) cells at 48 h after transfection. [score:3]
e Quantification of levels of exosomal miR-200c and miR-141 in mouse plasma (by qPCR) as percentages of cel-mir-39 expression. [score:3]
h Relative quantification of miR-200c and miR-141 (by qPCR) as percentages of RNU6B in FOXP3/GFP-Tet-off MCF7 cells with scramble or siRNA of FOXP3 target genes at 0, 24, and 48 h. All data in each group were normalized to the scramble control at 0 h. Data are presented as the means ± SD of triplicates. [score:3]
In breast cancer cells, however, expression of miR-200 s was not related to ER/PR/HER2 status (Additional file 1: Figure S5A-C). [score:3]
Further, our data suggested the cell origin of circulating miR-200c and miR-141 and their transcriptional regulation in cultured cells and during tumor progression in animal mo dels of spontaneous breast cancer. [score:2]
Furthermore, the literature was reviewed to identify 10 candidates of transcriptional regulators of miR-200c and miR-141: ASCL2 [38], EP300 [39], KAT2B [39], KLF5 [40], MUC1 [41], PITX2 [42], TGFβ1 [43], TP53 [44], and ZEB1/2 [45]. [score:2]
Of note, miR-200c/141 were reduced after KAT2B or PITX2 knockdown and were then induced by FOXP3 in the PITX2-silenced cells, but no significant changes were evident after FOXP3 induction in the KAT2B-silenced cells (Fig.   2h). [score:2]
However, the effect of KAT2B knockdown on the miR-200 cluster 1 miRNAs was not observed in FOXP3/GFP-Tet-off MCF7 cells (Additional file 1: Figure S4). [score:2]
In the present work, we explored the relevance of FOXP3 -mediated transcriptional regulation of miR-200 s in breast cancer cells in mice and humans. [score:2]
miR-200c and miR-141 are regulated by a FOXP3-KAT2B axis in breast cancer cells, and circulating levels of miR-200c and miR-141 are potential biomarkers for early detection of breast cancer metastases. [score:2]
Thus, in FOXP3 -mediated transcriptional regulation of miR-200c and miR-141, KAT2B and PITX2 appeared to be coordinators between FOXP3 and miR-200c and miR-141. [score:2]
During tumor progression in the Foxp3 [sf/+] female mice, there were increased levels of plasma miR-200c and miR-141 at miR-200 cluster 2 (Fig.   3d, the time points of breast tumor development are indicated by vertical arrows) but not at miR-200 cluster 1 (Additional file 1: Figure S6). [score:2]
b Amounts of DNA precipitated, expressed as a percentage of the total input DNA, as determined by chromatin immunoprecipitation (ChIP) analyses of FOXP3 -binding sites in the promoter region of miR-200c and miR-141 in FOXP3/GFP-Tet-off MCF7 cells without doxycycline (Dox) at 0 and 48 h. A FOXP3 -binding locus up to 20 kb upstream of miR-200c/141, as shown in our ChIP-seq data (Additional file 1: Figure S3B), was used as a positive control for the FOXP3 ChIP assay. [score:2]
These data suggest the presence of a FOXP3-KAT2B-miR200c/141 axis in breast cancer cells and a differential mechanism of transcriptional regulation between the two miR-200 clusters. [score:2]
To validate our observation in breast cancer cells, we used heterozygous Foxp3 [sf/+] breast cancer mice to analyze the regulation of mouse miR-200 s during tumor progression. [score:2]
In breast cancer cells, miR-200c and miR-141 are regulated by a FOXP3-KAT2B axis, and circulating miR-200c and miR-141 are potential biomarkers for early detection of tumor metastasis. [score:2]
Molecular mechanism for transcriptional regulation of miR-200c and miR-141 by FOXP3 in breast cancer cells. [score:2]
In the present study, FOXP3, through direct binding of KAT2B to the miR-200c/141 cluster, leads to activation of transcription of miR200c/141. [score:2]
These observations were confirmed with FOXP3 -transfected T47D (ER [+], PR [+], HER2 [-]), BT474 (ER [+], PR [+], HER2 [+]), and MDA-MB-468 (ER [-], PR [-], HER2 [-]) cells at 48 hours after transfection (1.8-fold to 2.4-fold miR-200c induction, 3.6-fold to 6.7-fold miR-141 induction) (Fig.   1c). [score:1]
Likewise, high levels of all miR-200 s were validated in FOXP3 [high] tumors relative to those in FOXP3 [low] tumors (Additional file 1: Figure S2C). [score:1]
In the present study, we identified a FOXP3-KAT2B-miR-200c/141 transcriptional axis in breast cancer cells. [score:1]
f Plasma miR-200c and miR-141 levels presented as aCt values for breast cancer patients with estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) status. [score:1]
A recent functional analysis revealed that extracellular vesicles containing miR-200c and miR-141 promote breast cancer cell metastasis through an enhanced MET transition [20]. [score:1]
For localized cases versus controls, the area under curve (AUC) for plasma miR-200c and miR-141 was 0.557 (95% confidence intervals: 0.441, 0.672) and 0.582 (0.463, 0.702), respectively, but, for metastatic cases versus localized cases, the AUC for plasma miR-200c and miR-141 was higher at 0.770 (0.661, 0.880) and 0.678 (0.558, 0.799), respectively (Figs.   4c and d). [score:1]
However, in peripheral blood cells, no significant changes in the miR-200 s levels were evident (Figs.   5d and Additional file 1: Figure S9). [score:1]
Demographic and other variables, including age, ethnicity, ER/PR/HER2 status, and clinical factors are summarized in Table  1. The plasma levels of miR-200c and miR-141 were determined for 33 patients diagnosed with breast cancer (19 with pT1-4, 11 with N1-3, and 3 with M1), 6 patients with ductal carcinoma in situ (DCIS), 30 patients with benign breast tumors, 21 women with a family history of breast cancer, and 44 healthy female controls. [score:1]
Levels of miR-200c and miR-141 in exosomes increased with time after FOXP3 induction (Fig.   5c). [score:1]
Fig. 1FOXP3 induces miR-200c and miR-141 in breast cancer cells. [score:1]
[d]Normal healthy women without family history of breast cancer Two independent cohorts of human subjects were divided for assessment and validation of the miR-200 family as potential biomarkers. [score:1]
d Levels of miR-200c and miR-141 in mouse blood cells (measured by qPCR) as a percentages of snoRNA202 expression. [score:1]
Potential binding signals of FOXP3 in the promoter regions of the miR-200 family and KAT2B gene. [score:1]
During tumor progression, the amounts of miR-200c and miR-141 are low in primary breast cancer cells but high in circulating plasma. [score:1]
Levels of exosomal miR-200c and miR-141 were higher (2.1/2.3-fold) in the mice with breast cancers, especially in those with tumor metastases (2.6/3.6-fold), than in mice without breast cancer (Fig.   5e). [score:1]
As shown, miRs-200c and miR-141 at miR-200 cluster 2 (2.0-fold to 3.2-fold miR-200c induction; 1.8-fold to 2.6-fold miR-141 induction), but not miRs-200b, 200a, and 429 at miR-200 cluster 1, were induced after FOXP3 induction (Fig.   1b). [score:1]
All experiments were repeated three times MiR-200c is 100% conserved between mice and humans, and miR-141 differs by one nucleotide in 5p, demonstrating that miRs-200c and miR-141 are highly conserved between mice and humans. [score:1]
Although extracellular miR-200c and miR-141 were also increased in cell culture medium, this increase was not dependent on intracellular miR-200c and miR-141. [score:1]
Thus, circulating miR-200 s are promising biomarkers for breast cancer metastasis. [score:1]
b Plasma miR-200c and miR-141 levels represented as aCt values for patients with localized breast cancer, patients with metastatic breast cancer, and normal female controls. [score:1]
d Plasma levels of miR-200c and miR-141 (determined by nest-qPCR) during tumor progression in Foxp3 [sf/+] female mice. [score:1]
Levels of extracellular miR-200c and miR-141 in the culture medium appeared to be increased, but there were intermittent increases and decreases (Fig.   5b). [score:1]
This finding supports the idea that exosomal miR-200c and miR-141 are involved in metastasis of breast cancer and that they are biomarkers for early prediction of tumor metastasis. [score:1]
The results established that KAT2B, but not PITX2, is required for FOXP3 -mediated transcriptional induction of miR-200c and miR-141. [score:1]
There was also no significant difference in plasma miR-200c and miR-141 levels between healthy women with and without a family history of breast cancer, suggesting that plasma levels of miR-200c and miR-141 are not hereditary. [score:1]
Third, in patients with breast cancer, the levels of miR-200c and 141 were lower in FOXP3 [low] relative to those with FOXP3 [high] breast cancer cells, especially in late-stage and metastatic cancer cells. [score:1]
c Concentrations of cluster 1 and cluster 2 miR-200 s in human breast cancer samples at various tumor stages (tumor-node-metastasis (TNM) staging classifies cancers based on T1-T4, N, and M), as determined from data for 271 patients listed in the NCI The Cancer Genome Atlas (TCGA). [score:1]
Fig. 2FOXP3 induces the transcriptional activity of miR-200c and miR-141 in breast cancer cells through KAT2B. [score:1]
High levels of all miR-200 s were present in FOXP3 [high] tumors relative to those in FOXP3 [low] tumors (Additional file 1: Figure S2A). [score:1]
Levels of miR-200c and miR-141 in normal immortalized human epithelial cell line MCF10A. [score:1]
The transcriptional activity of miR-200b/a/429 on miR-200 cluster 1 after FOXP3 induction and KAT2B silencing in breast cancer cells. [score:1]
b Relative quantification (by quantitative (q)PCR) of miR-200 clusters 1 and 2 in FOXP3/GFP-Tet-off MCF7 cells without Dox at 0, 24, and 48 h. The concentrations of miR-200 s at 0 h were used as a reference. [score:1]
Levels of miR-200 s in the FOXP3/GFP-Tet-off MCF-7 cell lines were assessed by use of qPCR at 24 and 48 hours after FOXP3 induction. [score:1]
All experiments were repeated three times To determine the levels of miR-200 s in circulation during tumor progression, plasma was collected monthly from Foxp3 [sf/+] female mice after 1 year of age. [score:1]
In Foxp3 [sf/+] mice, circulating miR-200c and miR-141 are unlikely to be released from blood cells. [score:1]
As circulating miR-200 s reflect the CTC status of patients with breast cancer [21], they may be released from CTCs through exosomes rather than from blood cells or primary tumor cells. [score:1]
Furthermore, plasma miR-200c and miR-141 levels were elevated during tumor metastasis (Fig.   3d). [score:1]
During FOXP3 induction, exosomal miR-200c and miR-141 were elevated, along with intracellular miR-200c and miR-141. [score:1]
However, the levels of miR-200c and miR-141 in tumor cells and in the circulation differed in mice, and differed in humans between patients with metastatic breast cancer, patients with localized breast cancer, and healthy female controls. [score:1]
Further, high levels of circulating miR-200 s in breast cancer patients are associated with increased numbers of circulating tumor cells (CTCs) [21], which are a predictor of metastasis up to 2 years prior to clinical diagnosis [22] and of shorter brain-metastasis-free survival [23]. [score:1]
Fig. 4Plasma levels of miR-200c and miR-141 are elevated in patients with metastatic breast cancer. [score:1]
Fig. 5Levels of tumor-derived exosomal miR-200c and miR-141 in breast cancer cells and animals. [score:1]
These data suggest that the elevated plasma levels of miR-200c and miR-141 in these mice are not derived from peripheral blood cells. [score:1]
a Location of human miR-200c and miR-141 on chromosome 12. [score:1]
[d]Normal healthy women without family history of breast cancer Two independent cohorts of human subjects were divided for assessment and validation of the miR-200 family as potential biomarkers. [score:1]
Of note, we also observed secretions of miR-200c and miR-141 in culture medium or in the circulation through exosomes in breast cancer cells and in animal mo dels. [score:1]
However, in both humans and mice, we found that miR-200c and miR-141 decrease in tumors but increase in the circulation, and are not changed in the blood cells. [score:1]
However, the cellular origin, mechanism of release, and function of circulating miR-200 s during tumor progression and metastasis remain elusive. [score:1]
There was no significant difference in plasma levels of miR-200c and miR-141 between patients with DCIS and healthy controls. [score:1]
The levels of miR-200c and miR-141 were low in primary tumor cells but were high in the circulation of patients with metastatic breast cancer. [score:1]
For patients with invasive breast cancer, plasma levels of miR-141, but not miR-200c, were higher (a lower adjusted Ct value correlated with a higher level) than levels for the other groups examined (Fig.   4a). [score:1]
FOXP3 induces miR-200c and miR-141 in human breast cancer cells. [score:1]
c, d Sensitivity and specificity of plasma miR-200c and miR-141 for patients with localized breast cancer relative to normal female controls and patients with metastatic breast cancer relative to patients with localized breast cancer. [score:1]
During breast cancer metastasis, plasma levels of miR-200c and miR-141 are likely derived from tumor cells. [score:1]
Participants (259), including patients with breast cancer or benign breast tumors, members of breast cancer families, and healthy controls, were assessed for tumor and circulating levels of the miR-200 family. [score:1]
There were no significant differences between localized cases, metastatic cases, and controls in the levels of miR-200c and miR-141 in peripheral blood cells (Fig.   4e). [score:1]
Finally, in Foxp3 [sf/+] mice, plasma miR-200c and miR-141 appeared to be released from tumor cells. [score:1]
Since plasma miR-200c and miR-141 increase prior to metastasis, they may serve as biomarkers for early detection of tumor metastasis, which is supported by results of recent studies [5, 21, 22]. [score:1]
The levels of miR-200c and miR-141 were higher in plasma from patients with metastatic breast cancer than in plasma from those with localized breast cancer, with benign breast tumors, with a family history of breast cancer, or from healthy controls. [score:1]
b Levels of cluster 1 and cluster 2 miR-200 s (measured by quantitative (q)PCR) as percentages of snoRNA202 expression in microdissected breast epithelial cells and tumor cells. [score:1]
ROC analysis predicted the capacity of plasma miR-200c and miR-141 to differentiate localized cases (Fig.   4c) from normal control cases or metastatic cases from localized cases (Fig.   4d). [score:1]
Conversely, some studies suggest that, in cancer cells, miR-200 s promote tumor metastasis through promotion of tumor colonization at metastatic sites [13, 14]. [score:1]
All experiments were repeated three times To determine the levels of miR-200 s in circulation during tumor progression, plasma was collected monthly from Foxp3 [sf/+] female mice after 1 year of age. [score:1]
To determine if miR-200c and miR-141 levels were changed in exosomes present in the plasma of mice, plasma was prepared from the blood of Foxp3 [sf/+] mice at 2 years of age, and exosomes were extracted. [score:1]
First, we identified a FOXP3-KAT2B-miR-200c/141 axis in breast cancer cells. [score:1]
In patients with breast cancer, increased levels of circulating miR-200 s may be a predictor of CTCs [21], metastasis up to 2 years prior to clinical diagnosis [22], and poor survival [23]. [score:1]
In patients with breast cancer, high levels of plasma miR-200c and miR-141 are associated with tumor metastasis. [score:1]
Of note, miR-200c and miR-141 appeared to be released from breast cancer cells into the culture medium or into the circulation of mice during tumor progression. [score:1]
At 0 to 5 days in culture without Dox, levels of miR-200c and miR-141 in tumor cells increased as FOXP3 was induced (Fig.   5a). [score:1]
Fig. 3Changes in miR-200 s in tumor cells and plasma during breast cancer progression. [score:1]
Levels of miR-200c and miR-141 were lower in Foxp3 [sf/+] tumor cells than in normal breast epithelial cells, but plasma levels of miR-200c and miR-141 in the Foxp3 [sf/+] mice increased during tumor progression and metastasis. [score:1]
a Plasma levels of miR-200c and miR-141 presented as adjusted PCR cycle threshold (aCt) values for normal female controls, patients with benign breast tumors, those with a family history of breast cancer, patients with breast ductal carcinoma in situ (DCIS), and patients with breast cancer. [score:1]
Thus, exosomes may be transporters for releasing or secreting miR-200c and miR-141 from tumor cells. [score:1]
[1 to 20 of 124 sentences]
9
[+] score: 242
However, the stable overexpression of the miR-200c in the CD117 [+]CD44 [+]CSCs resulted in a significant down-regulation of ZEB-1 and the Vimentin expression, an upregulation of the E-cadherin expression as well as a decrease of colony forming, migratory and invasion in vitro. [score:13]
We found that the down-regulation of the ZEB1 expression in the CD44 [+]CD117 [+]CSCs indeed had the similar effects as the miR-200c overexpression in the CD44 [+]CD117 [+]CSCs; this was reflected in the significant suppression of the tumorigenesis and tumor metastasis in the mice injected with the shZEB1 CD44 [+]CD117 [+]CSCs in comparison with the mice injected with the CD44 [+]CD117 [+]CSCs or with the CD44 [+]CD117 [+]CSCs with lentivirus mock. [score:10]
Apparently, the miR-200c overexpression decreased the ZEB1 expression, which directly inhibited the EMT of the CD44 [+]CD117 [+]CSCs, and reduced the CSC metastasis potential. [score:8]
However, restoration of the miR-200c served as a tumor suppressor by directly targeting the zinc-finger E-box binding homeobox 1 (ZEB1) to inhibit EMT and ovarian cancer metastasis [7- 10]. [score:8]
We noticed that the enforced overexpression of miR200c in the CD44 [+]CD117 [+]CSCs significantly reduced the expressions of both ZEB1 and Vimentin, but increased the expression of E-cadherin in the RNA and the protein levels in tumor samples. [score:7]
In some studies, miR-200c was found to be down-regulated in ovarian cancer cell lines and in stage III ovarian tumors; the miR-200c down-regulation correlated with poor prognoses. [score:7]
Because the stable miR-200c overexpression in the established tumors delayed tumor progression and extended the survival of the tumor-bearing mice, we wanted to find out if the miR-200c overexpression would inhibit tumor metastasis. [score:7]
Our results suggested that the miR-200c overexpression, by modulating the EMT, specifically inhibited the ZEB1 expression in the CD117 [+]CD44 [+]CSCs and reduced cell tumorigenicity and lung metastasis in our nude mouse mo del. [score:7]
Importantly, the miR-200c overexpression significantly inhibited the CD117 [+]CD44 [+]CSCs xenograft growth and lung metastasis in vivo in nude mice by inhibition of the EMT. [score:7]
The down- regulation of the ZEB-1 expression in the CD117 [+]CD44 [+]CSCs induced the similar effects as the miR-200c overexpression. [score:6]
In addition, the down-regulation of ZEB-1 showed the same efficacy as the miR-200c overexpression in the CD117 [+]CD44 [+]CSCs. [score:6]
To assess the relationship between ZEB1 and miR-200c in the CD44 [+]CD117 [+]CSCs, we asked whether the down-regulation of ZEB1 would have similar effects as the miR-200c overexpression. [score:6]
A. The CD117 [+]CD44 [+]CSCs isolated from the human EOC S KOV3 cell line were identified by FCM; B. The miR-200c expression differences between the non CD117 [+]CD44 [+]CSCs and the CD117 [+]CD44 [+]CSCs were detected by qRT-PCR; C. The top and bottom panels show the morphological structures of the CD44 [+]CD117 [+]CSCs with the stable miR-200c overexpression under a fluorescence microscope and a light microscope, respectively. [score:5]
Because the miR-200c overexpression exhibited significant effects on the colony forming and on the migratory and invasion of CD44 [+]CD117 [+]CSCs in vitro, we sought to determine whether the miR-200c overexpression could affect the establishment and progression of ovarian cancer in vivo nude mouse mo del. [score:5]
The miR-200c overexpression in the tumors significantly increased the E-cadherin expression (Figure  4C, 4F). [score:5]
miR-200c inhibited ZEB1,Vimentin and enhanced E-Cadherin expression levels in tumor as well as decreased tumor lung metastasis in nude mouse mo del. [score:5]
Therefore, we wanted to find out whether the miR-200c overexpression would also impact the ZEB1 expression in the tumors of the nude mice that were injected with the CD44 [+]CD117 [+]CSCs with lentivirus miR-200c. [score:5]
Figure 4 Impacts of the overexpression of miR-200c on ZEB1, E-Cadherin, and the Vimentin expressions in tumors, and tumor cell metastasis in mouse lungs. [score:5]
The results revealed that the miR-200c overexpression in the tumors led to a marked reduction of ZEB1 mRNA (Figure  4A), Vimentin mRNA (Figure  4B) and the protein expressions (Figure  4D) compared with the CD44 [+]CD117 [+]CSCs with lentivirus mock and with the CD44 [+]CD117 [+]CSCs without lentivirus infection. [score:4]
Our goal for this study was to assess the epigenetically regulation function of the miR-200c overexpression in the EMT, the tumorigenicity, and the metastasis of the EOC CD117 [+]CD44 [+]CSCs in vitro and in vivo. [score:4]
We found in vitro a direct association between the miR-200c overexpression and the capability of the CD117 [+]CD44 [+]CSC in colony forming, migration and invasion. [score:4]
In EOC, metastases account for the majority of deaths from gynecologic malignancies [35, 36], therefore, we next explored the relationship between the miR-200c overexpression and tumor metastases. [score:3]
In particular, we noticed the evident relationship between the miR-200c and the ZEB1 expression. [score:3]
These results suggested that the miR-200c overexpression not only effectively decreased the colony forming capability but also obviously reduced the tumorigenicity and the tumor burden in our establishment mouse mo del. [score:3]
In comparison, for the group that was injected with the 5 × 10 [4] CD44 [+] CD117 [+]CSCs with the miR-200c overexpression, only 3 out of the 6 mice with equal injection of 5 × 10 [4] cells developed tumors after 56 days into the observation; the tumor sizes of these 3 mice were also smaller than those of the control group mice. [score:3]
In summary, the findings from our experiments demonstrate that the overexpression of miR-200c significantly reduced the CD117 [+]CD44 [+]CSCs xenograft growth and lung metastasis in vivo, partially through the reversal of the EMT phenotype. [score:3]
Figure 1 Identification, selection and detection of the miR-200c expression in the CD44 [+ ] CD117 [+] CSCs. [score:3]
Figure 3 The miR-200c overexpression decreased tumor progression of CD44 [+ ] CD117 [+ ] CSCs in xenograft mice. [score:3]
Isolation of CD44 [+]CD117 [+]CSCs, transduction of lentivirus miR-200c and production of stable expression colonies. [score:3]
As was described in the method section, the CD44 [+]CD117 [+]CSCs were isolated from the S KOV-3 cell line using MACS and were identified for cell phenotype using FCM to study the miR-200c overexpression in CD44 [+]CD117 [+]CSCs. [score:3]
The CD44 [+]CD117 [+]CSCs were transduced with the pHAGE-CMV- miR-200c-IzsGreen lentivirus, and were selected by the IzsGreen expression [7, 19]. [score:3]
However, it is unknown whether the EOC CSCs, the “seed cells” in EOC, are closely associated with the miR-200 family expression. [score:3]
With the stable miR-200c overexpression in the CD44 [+]CD117 [+]CSCs, the cells markedly decreased the colony forming capability. [score:3]
Figure  1B indicates that the miR-200c expression analyzed by qRT-PCR was markedly lower in the CD44 [+]CD117 [+]CSCs than in the non CD44 [+]CD117 [+]CSCs. [score:3]
The results suggested that the stable miR-200c overexpression in established tumors delayed tumor progression. [score:3]
The cell migration and invasion in vitro results indicated that the stable miR-200c overexpression in the CD44 [+]CD117 [+]CSCs reduced cell migration and invasion. [score:3]
Effect of miR-200c overexpression on the capability of colony formation and cellular motility of CD44 [+] CD117 [+] CSCsTo characterize the function of miR-200c in the CD44 [+]CD117 [+]CSCs, we examined the effects of miR-200c overexpression on the CD44 [+]CD117 [+]CSCs with regard to colony forming, cell migration, cell invasive ability, and cell proliferation ability, respectively. [score:3]
Overexpression of miR-200c reduced ovarian tumor formation and tumor burden. [score:3]
Our findings were in agreement with a recent report that the overexpression of miR-429, a member of the miR-200 family of microRNAs, in the mesenchymal-like ovarian cancer cells resulted in the mesenchymal–epithelial transition [33]. [score:3]
Phenotype identification, morphologic characteristics and miR-200c expression in lentivirus transduced CD44 [+]CD117 [+]CSCsAs was described in the method section, the CD44 [+]CD117 [+]CSCs were isolated from the S KOV-3 cell line using MACS and were identified for cell phenotype using FCM to study the miR-200c overexpression in CD44 [+]CD117 [+]CSCs. [score:3]
The CD44 [+]CD117 [+]CSCs transduced with lentivirus-mock (left) or lentivirus miR-200c (right) in the stem cell culture medium; D. miR-200c expression differences among the CD44 [+]CD117 [+]CSCs transduced with lentivirus-mock, the lentivirus miR-200c and without lentivirus infection were detected by qRT-PCR. [score:3]
The findings from our study demonstrated that the population of the rare CD44 [+]CD117 [+]CSCs (3.1%) existed in the human EOC S KOV3 cell line, and that the CD44 [+] CD117 [+]CSCs showed lower expression of miR-200c than the non CD44 [+]CD117 [+]CSCs. [score:3]
Figure  1D presents the results of the miR-200c expression analyzed by qRT-PCR. [score:3]
The overexpression of miR-200c clearly resulted in a significant reduction in cell migration in comparison the control cells (CD44 [+]CD117 [+]CSCs with lentivirus mock and CD44 [+]CD117 [+]CSCs without lentivirus infection); the differences were statistically significant (Figure  2E). [score:3]
The CD44 [+]CD117 [+]CSCs transduced with the lentivirus miR-200c (the rightmost bar) exhibited a significantly higher level of miR-200c overexpression than the CD44 [+]CD117 [+]CSCs transduced with the lentivirus mock (18 ± 5 vs 3 ± 1, P < 0.01) or the CD44 [+]CD117 [+]CSCs (18 ± 5 vs 2 ± 1, P < 0.01). [score:3]
Isolation of CD44 [+]CD117 [+]CSCs, transduction of lentivirus miR-200c and production of stable expression coloniesThe CD44 [+]CD117 [+]CSCs were isolated from the S KOV3 cell line by using the magnetic- associated cell sorting (MACS) method as described previously [16, 17]. [score:3]
Effect of miR-200c overexpression on the capability of colony formation and cellular motility of CD44 [+] CD117 [+] CSCs. [score:3]
Next, we detected the miR-200c expression in the CD44 [+]CD117 [+]CSCs and in the lentivirus miR-200c transduced CD44 [+]CD117 [+]CSCs after the cells were stably selected using a single clone screening method. [score:3]
To generate the miR-200c expression lentivirus vector, we amplified an insert (full-length human miR-200c) by PCR from S KOV3 DNA. [score:3]
These findings from this study suggest that the miR-200c overexpression may be considered a critical approach for the EOC CD117 [+]CD44 [+]CSCs in clinical trials. [score:2]
The miR-200c expression was reduced in the CD117 [+]CD44 [+]CSCs compared with the non-CD117 [+]CD44 [+]CSCs. [score:2]
The overexpression of miR-200c resulted in fewer CD44 [+]CD117 [+]CSCs with lentivirus miR-200c (mean ± SD: 70.81% ± 2.16%), in the bottom of the chamber insert, than in the CD44 [+]CD117 [+]CSCs with lentivirus miR-200c compared with the CD44 [+]CD117 [+]CSCs with lentivirus mock (125.92% ± 2.14%), or than the CD44 [+]CD117 [+]CSCs without lentivirus infection (162.26% ± 6.78%) (Figure  2C, 2F). [score:2]
The 36 mice were randomly divided into six groups of equal size (6) as follows: group 1 for CD44 [+]CD117 [+]CSCs with lentivirus miR-200c; group 2 for CD44 [+]CD117 [+]CSCs with lentivirus mock; group 3 for CD44 [+]CD117 [+]CSCs without lentivirus infection; group 4 for CD44 [+]CD117 [+]CSCs transfected with the shZEB1; group 5 for CD44 [+]CD117 [+]CSCs transfected with the scrambled control siRNA; group 6 for CD44 [+]CD117 [+]CSCs without transfection. [score:1]
The mice injected with the 5 × 10 [4] CD44 [+]CD117 [+]CSCs with lentivirus miR-200c showed much higher tumor free rates than the mice injected with the 5 × 10 [4] CD44 [+]CD117 [+]CSCs with lentivirus mock or 5 × 10 [4] CD44 [+]CD117 [+]CSCs without lentivirus infection on different days after the injection. [score:1]
Morphologically, the CD44 [+]CD117 [+]CSCs transduced with the lentivirus miR-200c appeared to be fusiform-shaped and closely connected clones in the media, whereas the CD44 [+]CD117 [+]CSCs transduced with the lentivirus mock seemed to have a looser and more dispersed structure (Figure  1C). [score:1]
Figure 2 The CD44 [+] CD117 [+] CSCs transduced with lentivirus miR-200c reduced the ability of colony forming, cell migration, invasion and cell proliferation in vitro. [score:1]
The plating colony formation rates were about 60% and 50% for the CD44 [+]CD117 [+]CSCs and the CD44 [+]CD117 [+]CSCs transduced with lentivirus mock, respectively; the colony formation rates were less than 20% for the CD44 [+]CD117 [+]CSCs transduced with the lentivirus miR-200c (Figure  2A, 2D). [score:1]
The EOC CD117 [+]CD44 [+]CSCs were isolated from the human ovarian cancer cell line S KOV3 by using a magnetic-activated cell sorting system, and the lentivirus miR-200c transduced CSCs were then selected for the study. [score:1]
To characterize the function of miR-200c in the CD44 [+]CD117 [+]CSCs, we examined the effects of miR-200c overexpression on the CD44 [+]CD117 [+]CSCs with regard to colony forming, cell migration, cell invasive ability, and cell proliferation ability, respectively. [score:1]
The lentivirus miR-200c was produced from the transient transfection of the HEK293T cells with pHAGE-CMV- miR-200c-IZsGreen, psPAX2, and pMD2. [score:1]
Numerous studies of EOC have focused on modulating the miR-200 family (including miR-200a, miR-200b, miR-200c, and miR-141) [31- 34]. [score:1]
Phenotype identification, morphologic characteristics and miR-200c expression in lentivirus transduced CD44 [+]CD117 [+]CSCs. [score:1]
Figure  4H shows that the tumor lung metastasis was significantly reduced in the mice injected with the CD44 [+]CD117 [+]CSCs with lentivirus miR-200c in comparison with the mice of the two control groups (Figure  4I). [score:1]
The goal of this study was to investigate the effect of miRNA-200c overexpression on the EMT, tumorigenicity and metastasis of epithelial ovarian cancer (EOC) CSCs. [score:1]
The lung tumor metastasis in the mice injected with the CD44 [+]CD117 [+]CSCs with lentivirus miR-200c was markedly decreased. [score:1]
The labels ‘WT, mock and miR-200c’ denote the CD44 [+]CD117 [+] CSCs, the CD44 [+]CD117 [+] CSCs transduced with lentivirus-mock, and the lentivirus miR-200c, respectively. [score:1]
A. 5 × 10 [4] CD44 [+]CD117 [+]CSCs transduced with lentivirus miR-200c or lentivirus-mock or without infection were subcutaneously injected in the nude mice (n = 6/group). [score:1]
The results show that more brown cells were found in miR-200c-CD44 [+]CD117 [+]CSCs of tumor tissue than the control cells. [score:1]
It is known that the feedback loop mo del links ZEB1 to miR-200c in melanoma and breast cancer cells, and that ZEB1 and miR-200c repress each other in the loop that impacts the change in EMT-MET[10, 23]. [score:1]
To accomplish this goal, we transduced the lentivirus miR-200c vector into the CD117 [+]CD44 [+]CSCs that were isolated from the human EOC S KOV3 cell line [15, 16]. [score:1]
[1 to 20 of 70 sentences]
10
[+] score: 241
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-200a
The relevant regulatory mechanisms may be indirect because some of them are up-regulated on miR-200 overexpression, and even down-regulated genes lack miR-200 binding sites on their 3′-UTRs, with the exception of Tgfb2 [30]. [score:11]
Yellow: genes up-regulated by miR-200 overexpression; blue: genes down-regulated by miR-200 overexpression. [score:11]
miR-200 down-regulates Bmp4 through GATA4 and GATA6To identify the mediators of miR-200’s suppressive effect on Bmp4 expression, we first searched for putative transcriptional regulators that act on the Bmp4 promoter. [score:9]
ZEB1, a transcription suppressor of miR-200, enhanced Bmp4 expression in a low metastatic lung cancer cell line (393P), but miR-200 suppressed Bmp4 expression in 344SQ (Fig.   1c) and 531LN2 (Additional file 1: Figure S4), which was confirmed by (Fig.   1d). [score:9]
Transcriptional profiling revealed that expression of several cytokines/chemokines and their receptors is up- or down-regulated by miR-200 overexpression (Fig.   1a). [score:8]
miR-200 down-regulated BMP4 via direct targeting of the GATA4 and GATA6 transcription factors that stimulate Bmp4 transcription. [score:7]
Of interest, Jag2-KD suppressed Bmp4 mRNA expression (Fig.   6g), which may be mediated by enhancing the expression of miR-200 family members, especially, miR-200b/200a/429 (Fig.   6h). [score:7]
In addition, miR-200b repressed Gata4 and Gata6 mRNA expression in 344SQ cells (Fig.   2d), and ectopic GATA4 or GATA6 expression in 344SQ_miR-200 cells reinstated the Bmp4 mRNA level suppressed by miR-200 (Fig.   2e). [score:7]
Recently, we published our findings that the miR-200/ZEB1 negative-feedback loop regulates CD8 [+] tumor-infiltrating lymphocytes by directly targeting PD-L1 expression [29], which strongly supports the idea that modulation of the immune system is a prerequisite to cancer metastasis. [score:7]
Mean + SD, n = 3; p, two-tailed Student’s t-test In the present study, we showed that miR-200 suppresses BMP4 indirectly through the GATA4 and GATA6 transcription factors and that BMP4 knockdown inhibits cancer cell growth, migration, invasion, and metastasis. [score:7]
On the basis of these data, we propose that miR-200 down-regulates Bmp4 through direct targeting of its transcription factors, GATA4 and GATA6. [score:7]
To identify the mediators of miR-200’s suppressive effect on Bmp4 expression, we first searched for putative transcriptional regulators that act on the Bmp4 promoter. [score:6]
Indirect regulation by miR-200 could be achieved through targeting of transcription factors such as ZEB1 [8], ETS1 [31], and GATA4/6, as proposed herein, which would vastly expand miR-200’s regulatory network. [score:6]
Bmp4 is down-regulated in miR-200 -overexpressing cells. [score:6]
The effect of miR-200 on BMP4 expression may not be mediated via direct 3′ -untranslated region (UTR) binding because there is no putative miR-200 binding site on Bmp4’s 3′ -UTR (http://www. [score:6]
Up-regulation of BMP4 in metastatic-prone, mesenchymal lung cancer cells was first observed in our previous study, which aimed to identify the target genes of miR-200 systematically through a proteomic analysis coupled with stable isotope labeling by amino acids in cell culture (SILAC) and mass spectrometry [31]. [score:6]
org), and less chromosomal DNA of the Bmp4 promoter region was immunoprecipitated by an RNA polymerase II (Pol-II) antibody from 344SQ_miR-200 cells than from 344SQ_vec control cells (Fig.   1e), which clearly suggests transcriptional regulation of Bmp4 mRNA expression by miR-200 via indirect mechanisms. [score:5]
Among hundreds of genes down-regulated by miR-200, we focused on bone morphogenetic protein 4 (BMP4), a member of the transforming growth factor β (TGF-β) superfamily, which is involved not only in early embryonic development but also in cellular growth, differentiation, and tumorigenesis [9]. [score:5]
Ectopic expression of a miR-200 cluster (miR-200b/200a/429) in a highly metastatic murine lung adenocarcinoma cell line (344SQ) blocks EMT and metastasis and induces global gene expression changes [6]. [score:5]
miR-200b and 200c suppressed Gata4 3′ -UTR activity, and miR-200a inhibited Gata6 3′ -UTR activity as reported previously [13], which were restored by mutating the miR-200 binding sites on their 3′-UTRs (Fig.   2b and 2c). [score:5]
miR-200 down-regulates Bmp4 through GATA4 and GATA6. [score:4]
j Diagram of a regulatory loop involving BMP4, JAG2, and miR-200 To clarify the roles of BMP4 in lung tumorigenesis and metastasis, we analyzed the expression levels of Bmp4 mRNA and miR-200 family members in 13 KP cell lines (Fig.   1b and Additional file 1: Figure S1). [score:4]
ZEB1 and miR-200 form a double -negative feedback loop [7, 8] that plays a key role in determining the metastatic fate of epithelial cancers through the regulation of downstream target genes and microRNAs (miRNAs). [score:4]
BMP4 up-regulated JAG2, an upstream factor of miR-200; therefore,. [score:4]
We have clearly demonstrated here that BMP4 is indirectly suppressed by miR-200 and that BMP4 promotes tumor cell migration/invasion and metastasis. [score:4]
Previously, we reported that GATA factors are down-regulated by miR-200 [12, 13]. [score:4]
Based on these findings, we concluded that BMP4 is one of the key downstream factors that mediate miR-200’s effects on lung tumorigenesis and metastasis and is a candidate target for directed cancer therapy. [score:4]
In addition, Bmp4-KD increased miR-200b/200a/429 expression (Fig.   6i) by removing the negative regulator of miR-200, JAG2. [score:4]
MicroRNA-200 (miR-200) suppresses the epithelial-mesenchymal transition of various cancer cells, including lung adenocarcinoma cells. [score:3]
Expression of BMP4 is inversely correlated with that of miR-200. [score:3]
Mesenchymal-like cells exhibited higher Bmp4 mRNA expression than did epithelial-like cells, and Bmp4 tended to correlate negatively with miR-200 members. [score:3]
To clarify the roles of BMP4 in lung tumorigenesis and metastasis, we analyzed the expression levels of Bmp4 mRNA and miR-200 family members in 13 KP cell lines (Fig.   1b and Additional file 1: Figure S1). [score:3]
We found that bone morphogenetic protein 4 (BMP4) was decreased in miR-200 -overexpressing cells and epithelial-like lung cancer cells. [score:3]
To identify genes downstream of miR-200, we performed microarray -based transcriptional profiling in KP cells overexpressing a miR-200 cluster, miR-200b/200a/429 [6]. [score:3]
Promoter and 3′-untranslated region (UTR) luciferase reporter assays were performed to discover the mechanism of regulation of BMP4 by miR-200. [score:3]
j Diagram of a regulatory loop involving BMP4, JAG2, and miR-200 In this study, we investigated the function of BMP4, a TGF-β superfamily member, which is down-regulated by miR-200 in murine lung adenocarcinoma cell lines. [score:3]
Phase contrast microscope images of 3-D acini were taken 12 days after cell seeding We previously reported that JAG2, a Notch ligand, promotes lung adenocarcinoma metastasis by suppressing miR-200, which is mediated by GATA3 [12]. [score:3]
Similar to ectopic expression of miR-200, depletion of BMP4 also induced abnormal shape and multiple-lumen formation of 3-D acini (Fig.   4), which could be caused by misorientation of mitotic spindles [17, 18]. [score:3]
Fig. 2GATA4 and GATA6, transcription factors of BMP4, are miR-200 target genes. [score:3]
JAG2, miR-200, and BMP4 form a regulatory loop. [score:2]
BMP4 functions as a pro-tumorigenic factor in a murine lung cancer mo del, and its transcription is regulated by miR-200 and GATA4/6. [score:2]
Fig. 6JAG2, miR-200, and BMP4 form a regulatory loop. [score:2]
In addition, we integrated BMP4 into the JAG/Notch signaling pathway and proposed a regulatory loop consisting of JAG2, GATA3, miR-200, and BMP4 (Fig.   6h), suggesting that BMP4 interconnects with various cell signaling partners to induce tumorigenesis and metastasis in lung adenocarcinomas. [score:2]
From the tumors of these KRAS/p53-mutant mice (KP mice), we also established several murine lung cancer cell lines (KP cells) that exhibit various levels of metastatic potential mainly regulated by ZEB1 and microRNA-200 (miR-200) [6]. [score:2]
It is also noteworthy that miR-200 can regulate a variety of immune-related genes, including cytokines (e. g., Il11, Ifna1, Csf1, Tgfb2, Il7), chemokines (e. g., Cxcl12, Ccl6, Cxcl7), and their receptors (e. g., Tlr12, Lepr, Tlr1) (Fig.   1a). [score:2]
Collectively, we propose a regulatory loop comprising JAG2, GATA3, miR-200, GATA4/6, and BMP4 (Fig.   6j). [score:2]
Similarly, 344SQ_miR-200 cells formed irregular acini with multiple lumens (Fig.   4c), suggesting that the miR-200/BMP4 pathway regulates normal acinus formation in Matrigel 3-D culture. [score:2]
In summary, BMP4 functions as a pro-tumorigenic factor in a murine lung cancer mo del and is regulated by miR-200 and GATA4/6. [score:2]
The miR-200b/200a/429 cluster seems to be more influenced by BMP4–JAG2–GATA3 pathway than the miR-200c/141 cluster, which might be caused by differential binding preference of transcription factors and co-regulators. [score:2]
Mean + SD, n = 3; p, two-tailed Student’s t-test Bmp4 knockdown suppresses migration, invasion, tumorigenesis, and metastasis of lung cancer cellsNext, to investigate the biological role of Bmp4 repression by miR-200, we depleted BMP4 in 344SQ cells (Fig.   3a) and H157 human lung cancer cells (Additional file 1: Figure S5A) by stable transfection of shRNAs. [score:2]
Similar negative correlations between Bmp4 and miR-200 members were also observed in human lung adenocarcinomas and breast invasive carcinomas (Additional file 1: Figure S2 and S3). [score:1]
However, only the correlation between Bmp4 and miR-200c was statistically significant (r = -0.495, p = 0.043; one-tailed Spearman’s rank correlation), which might be due to an insufficient sample size (n = 13). [score:1]
Negative correlation between BMP4 and miR-200 family members in human lung adenocarcinomas. [score:1]
Negative correlation between Bmp4 and miR-200 family members in murine lung adenocarcinoma cells. [score:1]
3′-UTR reporters (500 ng) and pGL3-control (50 ng, Promega) were co -transfected into 344SQ cells seeded on 24-well plates (1x10 [5] cells/well) in the presence or absence of Pre-miR™ miR-200 precursors (5 nM, Ambion). [score:1]
i qRT-PCR of miR-200 family members in 344SQ-NTC and Bmp4-KD (#2 and #3) cells. [score:1]
BMP4 miR-200 Lung cancer Metastasis Lung cancer is the leading cause of cancer-related death in both men and women worldwide [1]. [score:1]
Interestingly, Gata4 and Gata6 have conserved miR-200 binding sites on their 3′-UTRs: Gata4 has a miR-200b/200c/429 site and Gata6 has a miR-200a/141 site (http://www. [score:1]
To test for direct interaction between miR-200 and these 3′-UTRs, we made Gata4 and Gata6 3′ -UTR reporter constructs and performed luciferase assays after co-transfection with miR-200 mimics. [score:1]
Blue: DAPI, red: β-catenin, green: ZO-1. c Matrigel 3-D culture of 344SQ_vec and miR-200 cells. [score:1]
b Quantitative RT-PCR (qRT-PCR) of Bmp4 and miR-200c in 13 murine lung adenocarcinoma cells. [score:1]
Negative correlation between BMP4 and miR-200 family members in human breast invasive carcinomas. [score:1]
h qRT-PCR of miR-200 family members (200a, 200b, 200c, 141, and 429) in 344SQ- Jag2-KD and 344SQ-NTC. [score:1]
344SQ cells were co -transfected with control (con) or miR-200 mimics and 3′-UTR reporter constructs. [score:1]
[1 to 20 of 64 sentences]
11
[+] score: 225
The mo deling results of miR-200c inhibitor and the expression of miR-200c after tumorigenesis in nude mice are described in 1. To explore the effects of XIST and miR-200c expression on proliferation and EMT, IHC assays were performed to detect the expression of Ki67 and E-cadherin. [score:8]
miR-200c mimics (Catalog#: HmiR-SN0301), miR-200c inhibitor (Catalog#: HmiR-AN0301), mimics scramble (Catalog#: CmiR-SN0001) and inhibitor scramble (Catalog#: CmiR-AN0001) purchased from GeneCopoeia (Maryland, USA) were used to construct the overexpression and knockdown mo dels, as well as negative controls. [score:8]
XIST knockdown dramatically increased the expression of EMT -associated factor E-cadherin compared with that in the control group (Fig.   5e), whereas co-transfection with miR-200c inhibitor partially restored the expression levels of this protein. [score:7]
These data indicate that EMT processes that reflect the ability of metastasis and invasion are inhibited by miR-200c overexpression and XIST knockdown. [score:6]
Our present study suggests that lncRNA XIST knockdown inhibits the stemness properties and tumourigenicity by sponing miR-200c in BCSC-like cells and reveals a potential strategy of targeting XIST for bladder cancer therapy. [score:6]
In the present study, which aimed to detect the metastasis potential of BCSC 5637 and T24 under miR-200c overexpression or XIST knockdown condition, we detected the protein expression of E-cadherin, vimentin, ZEB1 and ZEB2, which are known as EMT-specific markers, by. [score:6]
LncRNA XIST may act as an inhibitor of miR-200c to regulate the stemness properties and tumourigenicity of bladder cancer cells, and our findings might reveal a potential strategy of targeting XIST for bladder cancer therapy. [score:6]
The results indicated that miR-200c overexpression and XIST knockdown could inhibit cell clone formation, self-renewal ability and EMT in BCSC-like cells. [score:6]
The high expression of LncRNA XIST in tumour tissues promotes cancer progression, whereas that of miR-200c inhibits cancer progression. [score:5]
miR-200c overexpression inhibited the cell clone formation and self-renewal properties of BCSC-like cells. [score:5]
The results suggested that the expression of E-cadherin was increased and that of vimentin, ZEB1 and ZEB2 were decreased in the BCSC-like 5637 and T24 cells under miR-200c overexpression and XIST knockdown compared with cells in their respective control groups. [score:5]
miR-200c knockdown could restore the tumour growth inhibition caused by XIST knockdown. [score:5]
Several studies have reported that lncRNA XIST expression is negatively associated with miR-200c expression in tumour tissues [16, 17]. [score:5]
In the present study, we found that XIST expression was negatively correlated with miR-200c expression in human BCSC-like cells. [score:5]
Compared with the control group, xenografts in the anti-XIST group were much smaller and lighter, and co-transfection with miR-200c inhibitor could partially revert the inhibition of tumour growth (Fig.   5a–c). [score:4]
Our results demonstrated that the self-renewal and clone formation capacities were significantly decreased with miR-200c overexpression and XIST knockdown in the BCSC-like 5637 and T24 cells. [score:4]
miR-200c expression has also been demonstrated to participate in the regulation of the epithelial-to-mesenchymal transition (EMT), which is a biological process responsible for tumour progression, invasion and migration in bladder cancer cells [12]. [score:4]
The objectives were to detect biological effects of BCSCs with miR-200c overexpression or with XIST knockdown. [score:4]
The mutation-carrying psiCHECKTM-2 vector with a different sequence of the miR-200c binding site, named as the XIST-mutation (Mut), as the control group, was constructed using the QuickChange Site-Directed Mutagenesis Kit (Stratagene, California, USA). [score:4]
miR-200c has a low expression and XIST has a high expression in the sphere forming cells compared to the parental cells. [score:4]
Biological effects including cell clone formation, sphere formation, self-renewal properties and mouse tumourigenesis were examined in BCSC-like cells with miR-200c overexpression or XIST knockdown. [score:4]
These findings suggest that miR-200c inhibited the growth in human bladder cancer cells. [score:3]
a The relative mRNA expression level of miR-200 was detected using qPCR in sphere and parental cells. [score:3]
Our results demonstrated that miR-200c can inhibit the stemness properties such as self-renewal, clone formation and EMT in human bladder cancer cells. [score:3]
The efficiency of clone formation and self-renewal and the phenomenon of EMT were decreased after miR-200c overexpression. [score:3]
These results suggested that miR-200c inhibits the proliferation, metastasis and migration in human bladder cancer cells. [score:3]
After 6–8 days in sphere formation culture, the anti-XIST plasmid or the miR-200c overexpression plasmid was transfected in sphere forming cells using the transfection reagent. [score:3]
In different human cancers, such as ovarian [9], breast [10] and prostate [11] cancers, miR-200c expression is obviously reduced. [score:3]
These results suggested that miR-200c had the lowest expression in human BCSC-like cells. [score:3]
The T24 sphere forming cells (1 × 10 [7]) transfected with anti-XIST plasmid and miR-200c inhibitor were subcutaneously injected into the left and right flanks of 6-week-old NOD/SCID mice that were purchased from the Laboratory Animal Centre of Xiangya Hospital of Central South University. [score:3]
miR-200c functions as a tumour suppressor that impacts the growth of bladder cancer cells and the epithelial-to-mesenchymal transition (EMT). [score:3]
These data revealed that miR-200c functions in inhibiting the stemness properties and that lncRNA XIST possesses the reverse function in bladder cancer cells. [score:3]
d miR-200c mimics affected the expression of EMT -associated factors such as E-cadherin, vimentin and ZEB1 and ZEB2 proteins. [score:3]
c The targeted binding sites of miR-200c and XIST. [score:3]
We cloned the predicted miR-200c binding site of XIST, named as XIST-Wt, and a mutated targeting site of XIST, named as XIST-Mut vector. [score:3]
miR-200c was found to have a low expression in BCSC-like cells that possess stemness properties. [score:3]
Based on the results from our study investigating the underlying mechanism of XIST and miR-200c in regulating bladder cancer cell growth and invasion, XIST might be considered as a potential target for suppressing the proliferation, metastasis and tumourigenicity of human BCSCs. [score:3]
Fig.  2Targeting relationship between miR-200c and XIST. [score:3]
Numerous studies have demonstrated that miR-200c functions as a tumour suppressor that impacts the cancer cell growth and survival [7, 8]. [score:3]
anti-con group To further ascertain a functional relationship between miR-200c and XIST, the relative expression of miR-200c was detected using qPCR and shown to be significantly increased after XIST knockdown compared with that in the control group both in 5637 and T24 cells (Fig.   4b). [score:3]
anti-con group To further ascertain a functional relationship between miR-200c and XIST, the relative expression of miR-200c was detected using qPCR and shown to be significantly increased after XIST knockdown compared with that in the control group both in 5637 and T24 cells (Fig.   4b). [score:3]
These results suggested that miR-200c inhibits the self-renewal ability of BCSC-like cells. [score:3]
1. The relative mRNA expression levels of miR-200c in T24 sphere forming cells (A) and mouse tissues (B). [score:3]
was used to examine the changes of XIST and miR-200c expression levels. [score:3]
The miR-200c overexpression mo del was successfully constructed. [score:3]
Furthermore, we used the sphere forming 5637 and T24 cells as BCSC mo dels to investigate their self-renewal and clone formation capacities under miR-200c overexpression or XIST knockdown condition. [score:2]
Moreover, the results suggested that lncRNA XIST performs the exact opposite function as miR-200c in regulating the proliferation and metastasis of bladder cancer cells. [score:2]
Therefore, this study aimed to explore the function and regulatory mechanism of XIST and miR-200c in the maintenance of the stemness properties and tumourigenicity of human bladder cancer cells. [score:2]
The cancer stem cells were isolated from cell lines 5637 and T24 in the present study to better understand the biological function and regulatory mechanisms of lncRNA XIST and miR-200c in human bladder cancer cells. [score:2]
Cell self-renewal assays were performed using ultra-low adhesion, 96-well plates containing 200 μL stem cell growth medium at a density of 1 cell/well after transfection with the anti-XIST plasmid or the miR-200c overexpression plasmid. [score:2]
This study aimed to examine the relationship between lncRNA XIST and miR-200c and to assess their functions in the regulation of the stemness properties and tumourigenicity of human bladder cancer stem cell (BCSC)-like cells. [score:2]
In addition, we detected that the expression of EMT -associated factors such as E-cadherin was significantly increased and that of vimentin, ZEB1 and ZEB2 was significantly decreased in the miR-200c mimics group compared to the mimics NC group (Fig.   3d). [score:2]
Together with the results of the dual luciferase reporter assay, this demonstrated that XIST directly forms a complementary base pair with miR-200c and acts as a molecular sponge of miR-200c to regulate the biological functions of bladder cancer cells. [score:2]
To identify whether miR-200c has a function in targeting XIST, dual luciferase reporter assays were performed. [score:2]
Fig.  5XIST and miR-200c regulated the tumour growth and proliferation in vivo. [score:2]
Only the relative expression of miR-200c was significantly decreased in the BCSC sphere cells compared to the parental cells in the 5637 and T24 cell lines. [score:2]
Therefore, we speculate a competitive relationship between XIST and miR-200c in the regulation of tumour cell occurrence, proliferation and invasion. [score:2]
These results suggest that XIST regulates BCSC-like cells by functioning as a molecular sponge of miR-200c. [score:2]
qPCR revealed decreased mRNA expression levels of miR-200a, miR-200b, miR-200c (Fig.   2a) in the sphere forming cells compared to the parental cells in 5637 and T24 cell lines. [score:2]
To explore the effect of miR-200c on the proliferation and metastasis in the BCSC-like cells, we transfected the first passage of BCSC-like 5637 and T24 cells with the miR-200c mimics (the miR-200c mimics group) or negative control (the mimics NC group). [score:1]
XIST and miR-200c are associated with tumour growth and proliferation in vivo. [score:1]
In this study, we predicted lncRNAs with complementary base pairing with miR-200c using an online software program (http://www. [score:1]
In addition, we assumed that lncRNA XIST performed these functions by acting as a molecular sponge of miR-200c in human bladder cancer cells. [score:1]
The results showed a dramatically decreased relative luciferase activity in 5637 and T24 parental cells co -transfected with XIST-Wt and miR-200c and no significant changes in the group co -transfected with XIST-Wt and miR-NC and in the group co -transfected with XIST-Mut and miR-200c or miR-NC (Fig.   2d). [score:1]
The psiCHECKTM-2 vector with the cloned miR-200c binding site of XIST, named XIST-wild type (WT), was co -transfected with miR-200c mimics or mimics NC using the Lipofectamine [2000] transfection reagent. [score:1]
The mechanism and function of XIST and miR-200c in the pathogenesis of bladder cancer remain largely unknown. [score:1]
The assay showed that the self-renewal capacity of BCSC-like 5637 and T24 cells was significantly inhibited in the miR-200c mimics group compared to the mimics NC group (Fig.   3c). [score:1]
miR-200c and lncRNA XIST have been reported to affect the biological functions of multiple cancer cells including gastric cancer and breast cancer cells, respectively [21, 22]. [score:1]
These evidences may suggest a relationship between miR-200c and XIST influencing the biological functions of bladder cancer cells. [score:1]
miR-200a (Catalog#: HmiRQP0297), miR-200b (Catalog#: HmiRQP0299), miR-200c (Catalog#: HmiRQP0301) and U6 (Catalog#: HmiRQP9001) were purchased from GeneCopoeia. [score:1]
Furthermore, our software analysis revealed a binding site between miR-200c and XIST (Fig.   2c). [score:1]
The effect of miR-200c and lncRNA XIST in bladder cancer and a potential relationship between miR-200c and XIST remain largely unknown. [score:1]
b miR-200c was significantly increased in the XIST knockdown group compared to the control group. [score:1]
[1 to 20 of 73 sentences]
12
[+] score: 213
In addition, re -expression of miR-200c into MMTV-Wnt-1 induced murine mammary tumor cells almost completely suppressed colony formation and re -expression of miR-200c in human breast cancer stem cells almost completely inhibited in vivo tumor growth in NOD/SCID mice [18, 82]. [score:9]
The top 15 differentially expressed microRNAs based on fold change (p<0.05) are presented in Table 1. The most differentially expressed miRNA was mmu-miR-429, a member of the miR-200 family, and 4 of the 5 miR-200f members (miR-141, miR-200b, miR-200c and miR-429) were in the top 15 differentially expressed miRNAs (shaded in Table 1). [score:7]
Re -expression of miR-200c in RJ423200c cells only had a modest effect on mesenchymal gene expression (Figure 5A-5H) and only Twist1 was significantly down-regulated in RJ423200c cells compared to RJ423EV cells (Figure 5E). [score:7]
This analysis identified 5 potential miR-200c targets and these targets are listed in Table 6. Quantitative RT-PCR confirmed that these 5 genes were significantly downregulated in RJ423200c cells compared to RJ423EV cells (Table 6). [score:7]
TaqMan RT-PCR revealed that the RJ423200c cells expressed significantly higher levels of miR-200c compared to RJ423EV cells (>300-fold increase in miR-200c levels) and the level of miR-200c expression in the RJ423200c cells was nearly restored to the levels expressed by RJ345 cells (Figure 4). [score:6]
5-aza-2′-deoxycytidine treatment significantly increased the expression of both miR-200c (4.6-fold) and miR-200b (4.7-fold) suggesting that the expression of both miR-200 clusters are regulated, at least in part, by methylation. [score:6]
genes downregulated in RJ423200c cells with potential miR-200c target sequences. [score:6]
Interestingly, one of the genes regulated by miR-200c and found to be significantly downregulated in RJ42300c cells was Flt1 [87]. [score:5]
Promoter hypermethylation appears to be the primary mechanism for silencing miR-200c/141 expression while histone modifications via the Polycomb group has been reported to be responsible for silencing miR-200b/200a/429 expression [17]. [score:5]
Re -expression of miR-200c impairs mammary tumor growth in vivoTo determine whether re -expression of miR-200c in RJ423 cells affected mammary tumor growth in vivo, RJ423EV and RJ423200c cells were injected into the 4 [th] mammary glands of wild type, FVB mice. [score:5]
Our findings indicate that miR-200c can suppress proliferation and colony formation of murine claudin-low tumor cells in vitro and impair tumor growth in vivo, potentially through inhibiting angiogenesis. [score:5]
It should be noted that although only miR-200c was re-expressed in RJ423 cells, miR-200c has hundreds of predicted mRNA targets (microrna. [score:5]
Thus, our work further demonstrates the importance of restoring miR-200c expression as a mechanism to inhibit the growth/tumorigenic potential of claudin-low mammary tumor cells. [score:5]
Quantitative RT-PCR was used to validate the differential expression of the miR-200 family and as shown in Table 2, all 5 members of the miR-200f (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) were expressed at significantly higher levels in the PMT samples compared to the RST samples. [score:4]
org) and thus can potentially be regulated by miR-200c expression. [score:4]
Expression of the miR-200 clusters appears to be regulated by modifications to the promoter regions of each cluster. [score:4]
None of the other miR-200f members were elevated in the RJ423200c cells indicating that miR-200c was specifically upregulated in these cells (Figure 4). [score:4]
Inhibition of angiogenesis by miR-200c is consistent with a study by Pecot et al [92] that showed miR-200 family members could regulate tumor angiogenesis in basal-like breast cancer. [score:4]
The lack of change in invasive properties following miR-200c re -expression in our study could be due to the modest changes in several of the mesenchymal genes such as Zeb1 and Zeb2 that have also been implicated in regulating cell migration and invasion [75– 79]. [score:4]
Other miR-200c targets identified by included Arhgap6, Dmd, Slc14a1, and Vldlr. [score:3]
Re -expression of miR-200c impairs mammary tumor growth in vivo. [score:3]
One specific example is a study by Shimono et al [18] that compared miRNA profiles between breast cancer stem cells and the remaining non-tumorigenic, breast cancer cells and 3 miRNA clusters, miR-200c/141, miR-200b/200a/429 and miR-183/96/182, were consistently downregulated in breast cancer stem cells [18]. [score:3]
The expression of the other miR-200f members was not affected by transfection with the CMV-miR200c plasmid. [score:3]
Cell morphology displayed by RJ423EV and RJ423200c cells grown as monolayers was similar suggesting the re -expressing only miR-200c was insufficient to convert the mesenchymal RJ423 cells to epithelial cells. [score:3]
In this plasmid, mmu-miR-200c expression is driven by a CMV promoter. [score:3]
RJ423 cells were transfected with either the control plasmid (pCMV-MIR) creating RJ423EV cells or a plasmid expressing miR-200c driven by a CMV promoter (pCMV-MIR containing the miR-200c) creating RJ423200c cells. [score:3]
miR-200c and miR-200b (first miRNA in miR-200c/141 or miR-200b/200a/429 cluster) levels in RJ423 cells treated daily with DMSO or 3μM of the DNA methyltransferase inhibitor, 5-aza-2′-deoxycytidine (5-aza) for 72hrs (B). [score:3]
To further understand the genetic alterations induced by re -expression of miR-200c in RJ423 cells, was performed on RJ423EV and RJ423200c cells using 3 independent replicates for each cell line. [score:3]
The microRNA expression plasmid containing murine miR-200c was purchased from Origene (cat # SC400903; Origene Technologies, Rockville, MD). [score:3]
Re -expression of miR-200c in RJ423 cells. [score:3]
Although iPathwayGuide did not identify Vegfc as a miR-200c target, Vegfc does contain a predicted miR-200c binding site (microRNA. [score:3]
Re -expression of miR-200c impairs cell proliferation and anchorage independent growth but not invasion in vitro. [score:3]
Neither Zeb1 nor Zeb2 were significantly reduced by the re -expression of miR-200c in RJ423 cells. [score:3]
In summary, re -expression of miR-200c in murine claudin-low mammary tumor cells reduces proliferation and colony formation in vitro and tumor growth in vivo. [score:3]
Re -expression of miR-200c did however induce a partial reversion of sphere morphology when the cells were grown as three dimensional cultures in matrigel. [score:3]
Expression (mean ± SEM) of miR-200a, miR-200b, miR-200c, miR-141 and miR-429 in RJ345 cells, RJ423 cells containing the empty vector control (RJ423EV) or RJ423 cells containing miR-200c (RJ423200c) as determined by Taqman RT-PCR. [score:3]
Previous reports indicate that the miR-200c/miR-141 promoter region can be methylated and this methylation decreases miR-200c and miR-141 expression [44– 47]. [score:3]
To determine the function of miR-200f in murine mammary tumor cells with features of human claudin-low breast cancer, miR-200c was re-expressed in RJ423 cells. [score:3]
Therefore, our study and others suggest that miR-200c can inhibit progenitor/stem cell function in mammary tumor cells. [score:3]
To determine whether re -expression of miR-200c in RJ423 cells affected mammary tumor growth in vivo, RJ423EV and RJ423200c cells were injected into the 4 [th] mammary glands of wild type, FVB mice. [score:3]
Re -expression of miR-200c impairs cell proliferation and anchorage independent growth but not invasion in vitroProliferation was determined using phospho-histone H3 immunofluorescence in RJ345, RJ423EV and RJ423200c cells. [score:3]
The two significant biological pathways and top 5 molecular functions identified by iPathwayGuide are presented in Table 5. This software was also used to identify genes downregulated in RJ423200c cells compared to RJ423EV cells that had miR-200c consensus sequences as predicted by iPathwayGuide software. [score:3]
In the first approach, DNA isolated from RJ345, RJ423 and RJ348 cells using a Quick-DNA Universal Kit (Cedarlane, Burlington, ON) or DNA isolated from primary mammary tumors (PMTs) or recurrent spindle tumors (RSTs), described in [41], using DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD) was sent to Zymo Research Corporation for targeted bisulfite sequencing of the miR-200c/141 promoter region. [score:3]
This family of microRNAs is expressed as two clusters on distinct chromosomes with the miR-200c/miR-141 cluster located on chromosome 12 in humans and chromosome 6 in mice and the miR-200b/miR-200a/miR-429 cluster located on chromosome 1 in humans and chromosome 4 in mice [15]. [score:3]
First, targeted bisulfite sequencing of a putative miR-200c/miR-141 promoter region was performed in RJ345, RJ423 and RJ348 cell lines as well as in PMT and RST samples. [score:3]
This study focused on miR-200c as it was easier to manipulate a single miRNA rather than one or both miR-200f clusters and regulating an individual miRNA would simplify the analysis as each miRNA can potentially regulate hundreds or even thousands of mRNAs. [score:3]
Our findings are consistent with the study by Song et al [62] who demonstrated that miR-200c can suppress mammary tumor cell proliferation. [score:3]
Expression of miR-200c in RJ345, RJ348 and RJ423 cells. [score:3]
These findings suggest that expression of miR-200c negatively impacts cell proliferation rates. [score:3]
However, re -expression of miR-200c in RJ423 cells did not significantly alter cell invasion. [score:3]
Under these conditions, RJ423EV cells produced significantly more colonies than RJ345 cells while re -expression of miR-200c in RJ423200c completely abolished the ability of RJ423 cells to produce colonies in a soft agar assay (Figure 6B). [score:2]
miR-200c is regulated by promoter methylation. [score:2]
One family of microRNAs that has garnered considerable attention in cancer biology is the miRNA-200 family (miR-200f) which consists of 5 members, miR-141, miR-200a, miR-200b, miR-200c and miR-429. [score:1]
At the end of the treatment period, RNA was extracted and Taqman qRT-PCR for miR-200c or miR-200b (first member of each cluster) was performed as described above using SnoRNA202 and SnoRNA234 as normalizers. [score:1]
miR-200c promoter methylation analysis. [score:1]
Evaluation of the methylation status of 30 CpG sites ~1000bp upstream of the miR-200c/miR-141 cluster on murine chromosome 6 as determined by targeted bisulfite sequencing. [score:1]
Since one of the hallmarks of claudin-low breast cancer is the suppression of miR-200f members, this manuscript evaluated the impact of re -expressing a miR-200f member, namely miR-200c, in murine mammary tumor cells with characteristics similar to human claudin-low breast cancer. [score:1]
Figure 3B shows the levels of the first member of each miR-200f cluster (miR-200c and miR-200b) in RJ423 cells treated with the vehicle control (DMSO) or 5-aza-2′-deoxycytidine. [score:1]
Two approaches were utilized to determine methylation of the miR-200c promoter. [score:1]
miR-200a and miR-141 share the same seed sequence (AACACUG) that is different from the seed sequence of miR-200b, miR-200c and miR-429 by one nucleotide [16]. [score:1]
In order to evaluate the function of the miR-200f in mesenchymal mammary tumor cells, miR-200c was re-expressed in RJ423 cells. [score:1]
To assess miR-200c promoter methylation in our mo del systems two approaches were employed. [score:1]
The seed sequence, the region of the miRNA that determines mRNA binding, is the same in miR-200b, miR-200c, and miR-429 (AAUACUG). [score:1]
Using a plasmid containing mmu-miR-200c driven by a CMV promoter, mature miR-200c levels could be restored nearly to the level observed in RJ345 cells and >300-fold higher than RJ423 cells transfected with an empty vector (RJ423EV cells). [score:1]
In an attempt to understand the mechanism of reduced tumor growth induced by miR-200c, proliferation, apoptosis and blood vessel density were assessed. [score:1]
RJ423200c cells were created by transfecting RJ423 cells with 1μg of the pCMV-miR-200c plasmid using 5μl/ml of Lipofectamine 2000 (Thermo Fisher Scientific, Burlington, ON). [score:1]
[1 to 20 of 66 sentences]
13
[+] score: 205
In this study we have identified microRNAs whose expression is influenced by knock-down of Nkx2-1. Using genome- wide miRNA expression profiling in a lung adenocarcinoma-derived mouse epithelial cell line (MLE15) [21], we observed that reduction of Nkx2-1 levels to approximately half of that in control cells promoted significant and reproducible changes in miRNA expression patterns, including a high up-regulation of miR-200c. [score:11]
We intersected TargetScanMouse predicted targets with 557 genes showing anti-correlated expression to that of miR-200c (Figure  4A) in Nkx2-1 knockdown cells. [score:8]
Therefore, a reduction of Nkx2-1may modulate the proliferative activity of lung epithelial cells not only by direct inhibition of cyclin B, as it was previously described [12, 13], but also through direct or indirect activation of miR-200c to inhibit downstream oncogenes. [score:8]
In particular, we identified a regulatory link between Nkx2-1, the known tumor suppressor miR-200c, and the developmental and oncogenic transcription factors Nfib and Myb, adding new players to the regulatory mechanisms driven by Nkx2-1 in lung epithelial cells that may have implications in lung development and tumorigenesis. [score:7]
Gene ontology analysis of predicted miR-200c targets down-regulated in Nkx2-1 knock-down cells. [score:7]
Mouse lungs lacking functional phosphorylated Nkx2-1 showed increased expression of miR-200c and alterations in the expression of other top regulated miRNAs. [score:6]
The studies indicate that down-regulation of Nkx2-1 de-represses miR-200c, either by a direct or an indirect mechanism. [score:6]
Expression of miR-200c is higher in adult rat lung alveolar cells than fibroblasts, and its expression is lower during development than in adult lung. [score:6]
In this study we have characterized miRNAs regulated by Nkx2-1 in a mouse lung cell line system by genome-wide analysis of mRNA and miRNA profiles and confirm the expression patterns of highly regulated miRNAs in normal mouse lung and in lungs expressing phosphorylation mutant Nkx2-1. In particular, we found a regulatory link between Nkx2-1, miR-200c and the nuclear factor I/B (Nfib) and myeloblastosis oncogene (Myb). [score:6]
Particularly, miR-200c, negatively regulated by Nkx2-1, reduces the expression of downstream targets Nfib and Myb. [score:6]
A significant number of miR-200c targets whose expression was negatively correlated to miR-200c in the microarray analysis were overrepresented in the transcriptional regulation GO category (Additional file 4: Table S3). [score:6]
Predicted targets of miR-200c were retrieved from TargetScanMouse (Release 6.2) [27]. [score:5]
Predicted targets of miR-200c were downloaded from TargetScanMouse 6.2 (aggregate PCT > 0.1) [27]. [score:5]
In lung adenocarcinoma a high-level of NKX2-1 expression is significantly associated with longer overall survival [7], whereas a high-level of miR-200c expression is associated with shorter overall survival [30] supporting the inverse correlation. [score:5]
One well studied function of the miR-200 family is the induction of an epithelial phenotype by inhibiting the transcriptional repressor Zeb2 and thereby enhancing E-cadherin expression [31, 35]. [score:5]
Downstream, miR-200c reduces the expression of its predicted targets Nfib and Myb. [score:5]
The expression of miR-141, clustered and usually co-expressed with miR-200c [30], is higher in Nkx2-1-shRNA than in control (p = 0.0196; FDR = 0.087) (Table  1) following the same trend than miR-200c. [score:5]
miR-200c controls expression of its predicted targets Nfib and Myb. [score:5]
mmu-miR-200c and mmu-miR-1195 predicted target genes identified in TargetScanMouse 6.2. [score:5]
By RT-qPCR analysis we showed that absence of phosphorylated NKX2-1 results in a significant increment in the levels of miR-200c and miR-221; miR-1195 is down-regulated although no significantly, showing a similar trend than in Nkx2-1 knockdown experiments in MLE15 cells (Figure  2C). [score:5]
3′UTR reporter assays support a direct regulation of the predicted targets Nfib and Myb by miR-200c. [score:4]
From these, 29 miRNAs increased their expression levels by Nkx2-1 knock-down including miR-200c (16.7 fold), miR-200b (1.7 fold), miR-221 (4.2 fold), and miR-222 (3.7 fold) (Figure  2A and Table  1). [score:4]
By miRNA array analyses of mouse epithelial cell lines in which endogenous Nkx2-1 was knocked-down, we revealed that 29 miRNAs were negatively regulated including miR-200c, and 39 miRNAs were positively regulated by Nkx2-1 including miR-1195. [score:4]
These transcription factors [38, 39] and other known miR-200c targets such as E2F3 [40] and Kras [41] have been linked to lung epithelial proliferation in development and in tumorigenesis acting as oncogenes. [score:4]
So, Nkx2-1 has a strong effect in controlling the levels of miR-200c expression but this control might be indirect. [score:4]
In support of these results, a search in a ChIP-chip dataset of NKX2-1 target genes in mouse lung development that we previously published [12] indicates a significant binding of NKX2-1 within the 1kb 5′ flanking region of the miR-200c gene (Figure  3C). [score:4]
The other predicted target, Myb has been recently linked to the differentiation of airway epithelial cells [43], and was shown to be regulated by miR-200c in glioblastomas [44] and breast cancer cells [43]. [score:4]
Expression patterns of the most altered miRNAs (miR-200c, miR-221, miR-1195, and miR-378) were analyzed in Nkx2-1 knock-down cells by RT-qPCR (Figure  2B) confirming the microarray data. [score:4]
Figure 4 Analysis of predicted targets of miR-200c. [score:3]
Adjusted p value < 0.0005 (C) Selected transcription factors target of miR-200c were validated by RT-qPCR in Nkx2-1 shRNA treated cells vs. [score:3]
Plasmids harboring a Firefly luciferase reporter and the 3′UTR flanking region of the mir-200c predicted targets Myb (MmiT029722-MT01), Nfib (MmiT027729a2-MT01), and Six1 (MmiT028207-MT01), or a control vector (CmiT000001-MT01) were co -transfected in MLE15 cells either with a pre-miR-200c plasmid (MmiR3304-MR01) or with an scrambled control clone (CmiR0001-MR01) using EndoFectin Plus transfection kit. [score:3]
A total of 770 predicted targets of miR-200c (total context score ≤ −0.01) were identified (Additional file 2: Table S1). [score:3]
The transcription factors Gata4 [33], Ntf3 [34] and Sox2 [35] are experimentally validated targets of miR-200c in human cells. [score:3]
The intersection showed 32 genes whose changes in expression were anti-correlated with miR-200c (including the transcription factors Gata4, Myb, Nfib Ntf3, Phf6, Six1, Sox2, and Trps1) (Figure  4B). [score:3]
These data indicate a potential regulatory link between NKX2-1 and miR-200c, miR-221, or miR-1195. [score:2]
The 5′ flanking region of miR-200c exhibits intense transcriptional activity (15-fold ± 0.66; p = 0.0005) with normal levels of Nkx2-1. Unexpectedly, we found that knock-down of Nkx2-1 resulted in lower transcriptional activity of this 1kb fragment (8-fold ± 0.24; p = 1.6 × 10 [−6]). [score:2]
But in epithelial cell contexts, as the ones described in this work, increased miR-200c may regulate cellular processes other than MET, such as proliferation, or survival of lung cells. [score:2]
Alternatively, the elements mediating Nkx2-1 repression of miR-200c might be located in regulatory regions beyond the -1kb 5′ flanking region. [score:2]
Nkx2-1 is recognized to act mainly as a transcriptional activator [11], binding to the promoters/enhancers of 58% of activated downstream genes but only to 23% of genes repressed by Nkx2-1. Therefore, most genes repressed by Nkx2-1 do so by mechanisms other than direct promoter binding as may be the case for miR-200c. [score:2]
The individual functions of NKX2-1 [5- 7, 49], miR-200c [30, 50, 51], MYB [39, 52], and NFIB [42] in lung development and/or lung cancer have been wi dely documented. [score:2]
Promoter reporter assays indicated that 1kb of the miR-200c 5′ flanking region was transcriptionally active but did not mediate Nkx2-1- repression of miR-200c expression. [score:2]
We selected Nfib, Six1, and Myb to perform 3′UTR-luciferase reporter assays in MLE 15 cells expressing pre-miR-200c or scrambled control. [score:2]
Thus, miR-200c-Luc and miR-221-Luc plasmids were transiently transfected using Lipofectamine 2000 (Life Technologies, Grans Island, NY) in the cell lines described above. [score:1]
miR-200c was initially identified as a lung-specific miRNA in rats [37]. [score:1]
miR-200c –Luc; (**) p < 0.05 in miR-200c-Luc + scrambled vs. [score:1]
Most studies about miR-200c have been performed in the mesenchymal-epithelial transition (MET) context. [score:1]
In the latter, the human MYB 3′UTR was shown to contain miR-200c binding sites. [score:1]
Our data shows that miR-200c represses Nfib and Myb genes. [score:1]
Detailed ChIP methods are described in Additional file 1. Genomic regions (1.1 kb) 5′ to the first nucleotide of miR-200c and of miR-221 pre-miRNA sequences were retrieved from the UCSC Mouse Genome Browser [29]. [score:1]
Analysis of histone marks in distinct microRNA loci to identify putative transcription start sites (TSS) indicates that a putative TSS of miR-200c in mouse cells might be within 5 kb of the pre-miRNA sequence [32]. [score:1]
Nkx2-1 controls transcriptional activity of the miR-200c 5′ flanking region. [score:1]
For miR-200c, the enrichment of the IP fractions with the Nkx2-1 antibody and IgG were 28 and 0.4% of input while for miR-1195, were 129% and 1.3% of input respectively. [score:1]
We used oligonucleotides with restriction enzyme adaptors to amplify ~ 0.9-1kb of each region by PCR (miR-200c F 5′-SacI CAGGCAGACACTGCCATCT-3′, R 5′-HindIII CTACCCAACCAGTCCACCTCC-3′; miR-221 F 5′-SacI AGGAGAGGCCCTTGGTATAG-3′, R 5′-HindIII GTTCAGCCTGCAAATTATCC). [score:1]
Data represents binding signal (y axis) for each probe on the promoter tiling array (x axis) corresponding to the 5′ flanking region of the pre-miR-200c. [score:1]
miR-200c. [score:1]
Supporting its role in maintaining an epithelial phenotype in the lung, miR-200c expression is significantly reduced in the lung of mice with experimental fibrosis and in lungs of IPF patients where the epithelium undergoes profound alterations by acquiring some mesenchymal characteristics. [score:1]
No difference in luciferase activity was observed in cells co -transfected with Six-1-Luciferase and pre-miR-200c or scrambled plasmids. [score:1]
The miR-200c 5′flanking fragment is highly conserved in humans where it is transcriptionally active [31]. [score:1]
Because of the high conservation between mouse and human homologs of Nkx2-1, Nfib, Myb, and miR-200c it is likely that these links apply to human cells. [score:1]
[1 to 20 of 59 sentences]
14
[+] score: 189
Other miRNAs from this paper: mmu-mir-141, mmu-mir-200b, mmu-mir-200a, mmu-mir-34a, mmu-mir-429
Western blotting showed that the over -expression of miR-200b and miR-200c obviously reduced the level of JUN protein (Figure 4C), while the inhibition of miR-200b and miR-200c significantly elevated the expression of JUN in Hep1-6 cells (Figure 4D), demonstrating that jun is a target gene of miR-200b and miR-200c. [score:9]
jun is a target gene of miR-200b and miR-200cTo explore the specific mechanism by which miR-200b and miR-200c regulate lipogenesis in hepatocytes, miR-200b and miR-200c target genes were identified through the bioinformatics websites miRBase, TargetScan and RNA22. [score:8]
These results suggest that the up-regulation of miR-200b and miR-200c expression in the liver may prevent the accumulation of hepatic triglycerides in HFD-fed mice by suppressing JUN-SREBP1-stimulated lipogenesis. [score:8]
Additional experiments conducted in Hep1-6 and NCTC1469 cells revealed that the reduced expression of miR-200b and miR-200c led to abnormal lipid accumulation in hepatocytes, whereas the up-regulation of miR-200b and miR-200c impaired lipid accumulation and the expression of lipogenic proteins such as SREBP1 and FAS. [score:8]
To determine whether miR-200b and miR-200c are involved in abnormal hepatic lipid accumulation, the expression of miR-200b and miR-200c was suppressed in two murine liver cell lines, Hep1-6 and NCTC1469, by transfection with miR-200b and miR-200c inhibitors. [score:7]
To explore the specific mechanism by which miR-200b and miR-200c regulate lipogenesis in hepatocytes, miR-200b and miR-200c target genes were identified through the bioinformatics websites miRBase, TargetScan and RNA22. [score:6]
The up-regulation of miR-200b and miR-200c expression in the liver prevents hepatic lipid accumulation in HFD-fed mice. [score:6]
The up-regulation of miR-200b and miR-200c expression in the liver prevents hepatic lipid accumulation in mice fed a HFD. [score:6]
Previously, we examined miRNA expression in the livers of db/db mice and found that the expression of the miR-200 family members miR-200a, miR-200b and miR-200c was reduced in response to hepatic insulin resistance [23]. [score:5]
The findings suggest that the reduced expression of miR-200b and miR-200c participated in abnormal hepatic lipid accumulation by stimulating JUN expression and activating the transcription of srebp1. [score:5]
To determine whether miR-200b and miR-200c are involved in hepatic lipid accumulation in vivo, miR-200b and miR-200c were over-expressed in the livers of HFD-fed mice through the use of recombinant adenovirus expressing miR-200b and miR-200c mimics (Ad-miR-200b & Ad-miR-200c), respectively. [score:5]
The reduced expression of miR-200b and miR-200c contributes to abnormal hepatic lipid accumulation by stimulating JUN expression and activating the transcription of srebp1. [score:5]
Researchers demonstrated that the miR-200 family influences cancer development and progression by targeting various important signaling factors. [score:4]
More importantly, we demonstrated that down-regulation of miR-200b and miR-200c could partially reverse sitagliptin -induced decreased levels of SREBP1 and FAS, and reduced contents of intracellular triglyceride in Hep1-6 cells (Figure 7F, 7G). [score:4]
Importantly, the expression of miR-200b and miR-200c was suppressed in the livers of NAFLD patients (Figure 1F), and the levels of lipogenic proteins such as SREBP1 and FAS were elevated compared with the healthy controls (Figure 1G). [score:4]
More importantly, the knockdown of jun could partially ameliorate the miR-200b and miR-200c inhibition -induced increased SREBP1 and FAS levels in Hep1-6 cells (Figure 5G). [score:4]
In this study, we provide preliminary evidence that the elevated expression of miR-200b and miR-200c might contribute to the sitagliptin -induced reduction of hepatic lipid accumulation in HFD-fed mice. [score:3]
The over -expression of miR-200b and miR-200c reverses oleic acid/palmitic acid -induced lipid accumulation in hepatocytes. [score:3]
These data indicated that an increase in miR-200b and miR-200c expression might be associated with the sitagliptin -induced reversal of hepatic lipid accumulation in HFD-fed mice. [score:3]
This finding suggests that reduced miR-200b and miR-200c expression might contribute to abnormal lipid accumulation in hepatocytes. [score:3]
As shown in Figure 2A and 2B, the transfection of both Hep1-6 and NCTC1469 cells with miR-200b and miR-200c inhibitors resulted in a significant increase in intracellular triglyceride levels. [score:3]
Furthermore, the mutant of jun 3′UTR was inserted into the pmirGLO plasmid, but overexpression of miR-200b and miR-200c could not decrease the relative luciferase activity of pmirGLO- jun-3′UTR-Mut (Figure 4B). [score:3]
Elevated miR-200b and miR-200c expression is associated with sitagliptin-reduced hepatic lipid accumulation in mice fed a HFD. [score:3]
In contrast, the over -expression of miR-200b and miR-200c significantly reduced lipid accumulation in Hep1-6 and NCTC1469 cells transfected with miR-200b and miR-200c mimics (Figure 2E and 2F). [score:3]
In this manuscript, we identified jun as a target gene of miR-200b and miR-200c. [score:3]
In the present study, Hep1-6 cells were pre -treated with a mixture of oleic acid/palmitic acid (2:1, M/M) for 24 h and then treated with 1 μM sitagliptin for 24 h. Real-time reverse-transcription PCR indicated that sitagliptin rescued the oleic acid/palmitic acid–induced reduction of miR-200b and miR-200c expression in Hep1-6 cells (Figure 7A). [score:3]
jun is a target gene of miR-200b and miR-200c. [score:3]
Elevated miR-200b and miR-200c expression is associated with sitagliptin-reduced hepatic lipid accumulation in HFD-fed mice. [score:3]
And the adenovirus vector expressing mimics of miR-200b or miR-200c was constructed by Genechem (Shanghai, China). [score:3]
Figure 7(A) Real-time reverse-transcription PCR analysis of miR-200b and miR-200c expression in Hep1-6 cells pre -treated with a mixture of oleic acid/palmitic acid (2:1, M/M) for 24 h and then treated with 1 μM sitagliptin for 24 h. (B) Quantification of miR-200b and miR-200c in the livers of HFD-fed mice treated with sitagliptin. [score:3]
To identify the potential role of the miR-200 family in lipid metabolism, relative expression patterns were analyzed in the steatotic livers of HFD-fed mice and NAFLD patients. [score:3]
Reduced miR-200b and miR-200c expression contributes to abnormal lipid accumulation in Hep1-6 and NCTC1469 cells. [score:3]
Taken together, these data suggest that miR-200b and miR-200c are involved in lipogenesis through stimulation of JUN expression and the subsequent activation of srebp1 transcription. [score:3]
These results indicate that miR-200b and miR-200c suppressed hepatic lipogenesis. [score:3]
More importantly, this enhancement of hepatic miR-200b and miR-200c expression led to a significant reduction in liver weight and in the liver weight-to-body weight ratio (Figure 6B, 6C). [score:3]
Instead, a transcription factor, jun, was predicted to be a target gene of miR-200b and miR-200c (Figure 4A). [score:3]
This was accompanied by decreased SREBP1 and FAS levels (Figure 2G and 2H), indicating that miR-200b and miR-200c mimics have a suppressive role in lipid accumulation. [score:3]
Figure 3(A, B) Oil red O staining of Hep1-6 and NCTC1469 cells pre -treated with a mixture of oleic acid/palmitic acid (2:1, M/M) for 24 h. (C, D) Western blots showing the expression of SREBP1 and FAS in Hep1-6 and NCTC1469 cells pre -treated with a mixture of oleic acid/palmitic acid (2:1, M/M) for 24 h and then transfected with miR-200b and miR-200c mimics. [score:3]
Figure 4miR-200b and miR-200c bind to the 3′UTR of jun(A) TargetScan-predicted miR-200b and miR-200c bind to the 3′UTR of jun. [score:3]
The miR-200 family, including miR-200a, miR-200b, miR-200c, miR-141 and miR-429, has been reported to be dysregulated in several types of cancers including gastric cancer, breast cancer and bladder cancer [20– 22]. [score:2]
Moreover, knock down of miR-200b and miR-200c could partially rescue sitagliptin -induced reduced levels of SREBP1 and FAS, and decreased contents of intracellular triglyceride in Hep1-6 cells In conclusion, our findings may shed light on the specific molecular mechanism by which miR-200b and miR-200c are correlated with hepatic lipid metabolism. [score:2]
To further assess the requirement of miR-200 in sitagliptin's effect, miR-200b and miR-200c were knocked down in the Hep1-6 cells pre -treated with a mixture of oleic acid/palmitic acid and treated with sitagliptin. [score:2]
As shown in Figure 4B, the miR-200b and miR-200c mimics significantly reduced the relative luciferase activity of pmirGLO- jun-3′UTR, indicating a direct binding. [score:2]
The aim of this study was to explore the potential role of the miR-200 family in the regulation of hepatic lipid metabolism. [score:2]
miR-200b and miR-200c bind to the 3′UTR of jun. [score:1]
The levels of miR-200b and miR-200c are reduced in the steatotic livers of HFD-fed mice and NAFLD patients. [score:1]
As shown in Figure 1D, the levels of miR-200b and miR-200c, but not the levels of other members of the miR-200 family including miR-200a, miR-141 and miR-429, were obviously reduced in the livers of HFD-fed mice. [score:1]
Interestingly, miR-200b and miR-200c were enhanced in the livers of HFD-fed mice treated with sitagliptin (Figure 7B). [score:1]
In this study, we found that only miR-200b and miR-200c were decreased in the livers of NAFLD patients and mice fed a HFD. [score:1]
However, the role of the miR-200 family in hepatic lipid metabolism remains unknown. [score:1]
These data suggest that miR-200b and miR-200c may be involved in hepatic lipogenesis. [score:1]
The levels of miR-200b and miR-200c are reduced in the steatotic livers of NAFLD patients and mice fed a HFD. [score:1]
Interestingly, the transfection of both Hep1-6 and NCTC1469 cells with miR-200b and miR-200c mimics partially reversed the formation of the O/P -induced lipid droplets (Figure 3A and 3B) and the elevation of SREBP1 and FAS levels (Figure 3C and 3D). [score:1]
To further investigate the suppressive role of miR-200b and miR-200c mimics in lipid accumulation, Hep1-6 and NCTC1469 cells were pre -treated with a mixture of oleic acid and palmitic acid (2:1, M/M) for 24 h. Oil red O staining revealed that pre-treatment with oleic acid/palmitic acid (O/P) significantly promoted lipid accumulation in Hep1-6 and NCTC1469 cells (Figure 3A and 3B). [score:1]
Seven days after administration of Ad-miR-200b and Ad-miR-200c to the mice by tail vein injection, the hepatic levels of miR-200b and miR-200c were elevated by 3.43- and 2.93-fold, respectively (Figure 6A). [score:1]
Figure 2(A, B) The measurement of triglyceride levels in Hep1-6 and NCTC1469 murine liver cells transfected with miR-200b and miR-200c inhibitors. [score:1]
Bioinformatics predictions revealed that there were conserved miR-200b and miR-200c binding sites in the 3′UTR of jun. [score:1]
Interestingly, the levels of miR-200b and miR-200c were increased in the livers of HFD-fed mice treated with sitagliptin. [score:1]
In a previous study, we demonstrated that the reduction of miR-200a, miR-200b and miR-200c in hepatocytes contributed to IL -induced insulin resistance [23]. [score:1]
The miR-200 family has been extensively studied in different tumors [29– 31]. [score:1]
[1 to 20 of 60 sentences]
15
[+] score: 182
These EMT-type cells also showed decreased expression of miR-200 or let-7, and reversal of EMT by forcing expression of miR-200 significantly inhibited clonogenic and prostasphere-forming ability, which was consistent with the inhibition of Notch1 and Lin28B expression. [score:11]
Loss of miR-200b and miR-200c lead to increased ZEB1, Notch1 and Lin28B expression, resulting in decreased expression of let-7. Downregulation of let-7 leads to the up-regulation of Sox2, Nanog and Oct4, which together with Notch1 and Lin28B contribute to stem cell signatures. [score:11]
The expression of ZEB1 was found to be down-regulated by forced expression of miR-200b and miR-200c (Fig. 4C), which was consistent with the reversal of EMT phenotype (Fig 4A). [score:8]
These results were consistent with down-regulation of Notch1 expression and reversal of EMT phenotype as characterized by increased expression of E-cadherin and decreased expression of ZEB1 as well as cellular morphology change in ARCaP [M] cells transfected with pre-miR-200c precursors (Fig. 4F and Fig. 4G). [score:8]
These results suggest that miR-200b and miR-200c but not miR-200a inhibited self-renewal of PC3 PDGF-D cells by controlling target gene expressions of miR-200b and miR-200c. [score:7]
Our results presented above showed that the miR-200b and miR-200c inhibited lin28B expression (Fig. 4C), which is known to bind to primary let-7 and pre-let-7 RNA and inhibits the accumulation of mature let-7 miRNA [19]. [score:7]
Reversal of EMT by re -expression of miR-200 inhibited prostasphere-forming ability of EMT-type cells and reduced the expression of Notch1 and Lin28B. [score:7]
Interestingly, recent studies have also shown that miR-200 family not only could regulate the processes of EMT by targeting E-box binding protein ZEB1 and ZEB2 [15] but was also associated with stem-like cell signatures by regulating the expression of Bmi1 [16], [17]. [score:7]
Moreover, knock-down of Lin28B markedly increased let-7 expression, suggesting that miR-200 and let-7 could act as a target for the prevention of tumor recurrence and metastasis in PCa. [score:6]
Down-regulation of Notch1 by miR-200 was partially responsible for the inhibition of colonogenic and prostasphere-forming ability of PC3 PDGF-D cells. [score:6]
We found that re -expression of miR-200b and miR-200c dramatically reduced the sphere-forming ability concomitant with decreased expression of Lin28B and Notch1 in PC3 PDGF-D cells. [score:5]
The miR-200b and miR-200c transfection dramatically reduced the expression of Notch1 and lin28B, but had no effect on the expression of Bmi1 (Fig. 4C). [score:5]
Thus, we assessed the expression of the putative targets of miR-200b and miR-200c such as Notch1, Bmi1 and lin28B in PC3 PDGF-D cells transfected with miR-200 family because miR-200b and miR-200c have three or one putative binding sites in the 3′UTR of Lin28B, Bmi1 mRNA (Fig. S3) and Notch1 mRNA. [score:5]
Moreover, re -expression of miR-200b or miR-200c dramatically reduced the activity of 3′UTR of Notch1 luciferase in PC3 PDGF-D cells, while re -expression of miR-200a with one base of seed sequence different from miR-200b and miR-200c had no effects on the activity of 3′UTR of Notch1 luciferase (Fig. 5B). [score:5]
More importantly, re -expression of miR-200b and miR-200c significantly inhibited the prostasphere-forming ability of PC3 PDGF-D cells (Fig. 4B). [score:5]
Moreover, miR-200 and let-7 played a critical role in linking EMT phenotype with stem cell signatures by regulating the expression of Lin28B and Notch1. [score:4]
Interestingly, miR-200b and miR-200c were significantly decreased in PC3 PDGF-D cells and miR-200c was down-regulated in ARCaP [M] cells. [score:4]
These results suggest that miR-200 mediated down-regulation of Notch1 was partially responsible for self-renewal capacity and colonogenic growth of EMT-like cells having stem cell features. [score:4]
Interestingly, recent studies have shown that some natural agents could up-regulate miR-200 and reverse the EMT phenotype [44], [45]. [score:4]
The miR-200, especially miR-200b and miR-200c were identified to be mechanically linked with EMT phenotype and stem cell signatures in these cells via regulation of Notch1 and/or Lin28B expression. [score:4]
These results suggest that the miR-200b and miR-200c regulate the Notch1 expression by binding to 3′UTR of Notch1 mRNA. [score:4]
In our previous studies, we found significant down-regulation of miR-200 family in PC3 PDGF-D cells with EMT phenotype [28], which was consistent with our miRNA microarray data (Table S3). [score:4]
To determine whether Notch1 is the direct target of miR-200b and miR-200c, we analyzed the activity of 3′ UTR of Notch1 in PC3 Neo and PC3 PDGF-D cells transfected with 3′UTR of Notch1 luciferase plasmid as well as PC3 PDGF-D cells co -transfected with 3′UTR of Notch1 luciferase plasmid and miR-200b or miR-200c. [score:4]
Two evolutionary conserved families, miR-200 and let-7 have been shown to regulate the differentiation processes during the development. [score:3]
To reveal whether expressions of miR-200 family are associated with stem cell signatures, PC3 PDGF-D cells were transfected with miR-200a, miR-200b and miR-200c. [score:3]
Lin28B, a Lin28 homolog, was significantly repressed by re -expression of miR-200b and miR-200c in our cell mo del. [score:3]
In this study, we found that PCa cells with EMT phenotype displayed stem-like cell features characterized by increased expression of Sox2, Nanog, Oct4, Lin28B and/or Notch1, consistent with enhanced clonogenic and sphere (prostasphere)-forming ability and tumorigenecity in mice, which was associated with decreased expression of miR-200 and/or let-7 family. [score:3]
MiR-200 repressed the self-renewal capacity by regulating Notch1 and Lin28B expression. [score:3]
MiR-200b and miR-200c expression linked cancer stem cell signatures with EMT phenotype. [score:3]
Figure S2 MiR-200b and miR-200c inhibited prostasphere-forming ability of PC3 PDGF-D cells. [score:3]
In order to investigate whether miR-200 family could contribute to the generation of cancer stem-like cell characteristics in ARCaP [M] and PC3 PDGF-D cells by regulating the expression of Nanog, Oct4 and Sox2, Lin28B and other stem cell -associated makers, we have searched targets of miR-200 family in www. [score:2]
We also found that miR-200c expression was repressed in ARCaP [M] cells compared with ARCaP [E] cells (Fig. 4D). [score:2]
The miR-200c also dramatically reduced the sphere-forming ability concomitant with decreased expression of Notch1 in ARCaP [M] cells compared to its isogenic ARCaP [E] cells. [score:2]
Therefore, we analyzed the expression of Lin28B, Notch1 and Bmi1, and performed the sphere-forming assay using ARCaP [M] and PC3 PDGF-D cells transfected with miR-200. [score:2]
Moreover, re -expression of miR-200c in ARCaP [M] cells by transfection with pre-miR-200c precursors markedly reduced the prostasphere-forming capacity compared to transfection with control miRNA (Fig. 4E). [score:2]
0012445.g005 Figure 5 (A) Conserved, predicted binding sites for the seed sequences of miR-200b and mir-200c in the 3′UTR of Notch1 mRNA. [score:1]
Thus, miR-200b and miR-200c appear to play a central role in linking EMT with stem cell features in prostate cancer progression. [score:1]
We found that miR-200b and miR-200c have three binding sites at the 3′UTR of Lin28B mRNA, one in Notch1, Sox2 and Bmi1. [score:1]
Single cell suspensions of PC3 Neo, PC3 PDGF-D, ARCaP [E], ARCaP [M] and PC3 PDGF-D cells transfected with Sox2, Nanog, Oct4, Lin28B or control siRNA as well as miR-200 and let-7, were plated on ultra low adherent wells of 6-well plate (Corning, Lowell, MA) at 1000 or 2000 cells/well in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen). [score:1]
MiR-200b and miR-200c reduced the number of prostaspheres. [score:1]
We found that transfection of miR-200b and miR-200c induced reversal of EMT to MET phenotype (Fig. 4A). [score:1]
Conserved, predicted binding sites for the seed sequences of miR-200b and mir-200c in the 3′UTR of Lin28B or Bmi1 mRNA were shown. [score:1]
Table S3 The levels of miR-200 and let-7 family in PC3 Neo and PC3 PDGF-D cells. [score:1]
0012445.g004 Figure 4PC3 PDGF-D cells were transfected with pre-miR-200. [score:1]
Cells were transfected with 100 nmol/L of Sox2, Nanog, Oct4, Lin28B siRNA or control siRNA (Santa Cruz) as well as 20 nmol/L of miR-200 or let-7 (Ambion, Austin, TX) using DharmaFECT3 siRNA transfection reagent (DHARMACON, Lafayette, CO). [score:1]
Taken together, PC3 PDGF-D cells with EMT signatures showed stem-like cell characteristics through over -expression of Nanog, Oct4 and Sox2, Lin28B and activation of polycomb repressor complex 2. The miR-200 family plays a critical role in mediating EMT phenotype induced by various factors including PDGF-D [28], [40], [41]. [score:1]
Figure S3 Binding sites of miR-200b and miR-200c in 3′UTR of Lin28B or Bmi1 mRNA. [score:1]
3 days after transfection, cells were split and transfected repeatedly with pre-miR-200 every 3–4 days for 14 days. [score:1]
The miR-200b and miR-200c has one binding sites in the 3′UTR of Notch1 (Fig. 5A). [score:1]
PC3 Neo and PC3 PDGF-D cells were seeded at a density of 6×10 [3] cells per well in 96-well plate and incubated for 24 h. The cells were co -transfected with Notch1 3′UTR luciferase plasmid (Switch Gear Genomics, Menlo Park, CA) and pre-miR-200 using DharmaFECT duo transfection reagent (DHARMACON, Lafayette, CO). [score:1]
PC3 PDGF-D cells were transfected with pre-miR-200. [score:1]
[1 to 20 of 51 sentences]
16
[+] score: 167
Our previous data show that miR-200c is highly induced by ischemia and its inhibition is able to increase limb perfusion, reverting the downregulation of its targets responsible of apoptosis, senescence, ROS increase, and nitric oxide (NO) decrease [10]. [score:8]
Our results showed that miR-200c inhibits myogenic differentiation when forced miR-200c overexpression was performed in myoblasts; moreover, when miR-200c is overexpressed in differentiated myotubes, a decrease in myotube number and size was also observed. [score:7]
In keeping, the present study demonstrates that miR-200c that we previously showed to be upregulated upon ischemia [9, 10] is associated with myotube loss and is upregulated in mdx and DMD. [score:7]
Therefore, we showed that miR-200c upregulation decreases NO, increases ROS production, and induces p66Shc protein phosphorylation in Ser-36; this, in turn, induces ROS via different mechanisms, one of which is the inhibition of FOXO1 transcription of ROS scavengers, reinforcing this molecular circuitry [10]. [score:6]
miR-200c upregulation might contribute to the establishment of the negative consequences associated with this muscle disease, such as muscle wasting, lack of muscle regeneration, necrosis, NO decrease, and oxidative stress increase. [score:6]
We demonstrated that miR-200c is the most upregulated family member and is responsible for apoptosis and senescence by targeting zinc finger E-box -binding homeobox 1 (ZEB1) protein [9]. [score:6]
p66Shc phosphorylation in Ser-36 is increased in mdx muscles, and miR-200c expression levels are upregulated both in mdx muscles and in differentiated human myoblasts of DMD. [score:6]
In a recent publication, we demonstrated that miR-200c increased ROS production and induced p66Shc protein phosphorylation in Ser-36; this mechanism upregulated ROS and inhibited FOXO1 transcription of ROS scavengers, reinforcing this molecular circuitry [10]. [score:6]
We then analyzed myogenic differentiation by Western blot, and we observed that ZEB1, MyHC, myogenin, and MyoD proteins were all downregulated upon miR-200c overexpression (Figure 2(d)). [score:6]
We then analyzed myogenic differentiation by Western blot analysis, and we observed that ZEB1, MyHC, and myogenin proteins were all downregulated upon miR-200c overexpression, whereas MyoD was not affected (Figure 1(c)). [score:6]
3.1. miR-200c Overexpression Inhibits Myogenic Differentiation. [score:5]
The results of the present work show that miR-200c impairs muscle differentiation, whereas miR-200c inhibition ameliorates differentiation; moreover, both miR-200c expression levels and p66Shc phosphorylation in Ser-36 increase in mdx mice. [score:5]
Our recent report demonstrated that miR-200c targets directly SIRT1 and also two important proteins that modulate NO production and ROS scavenger transcription, that is, endothelial nitric oxide synthase (eNOS) and FOXO1. [score:4]
Interestingly, in adductor muscles of mdx, a miR-200c upregulation was found in a miRNA screening, although not significantly [13]. [score:4]
We previously showed that the miR-200 family is upregulated upon oxidative stress in different cells, such as endothelial cells, human fibroblasts, murine myoblasts, and myotubes [9]. [score:4]
Indeed, Greco et al. found that in adductor muscles of mdx, a miR-200c upregulation was present, although not significant [13]. [score:4]
3.2. miR-200c Inhibition Enhances Myogenic Differentiation. [score:3]
Moreover, a decrease in differentiation index, fusion index, and number of nuclei within myotubes was also observed in differentiated miR-200c -overexpressing cells (Figure 2(c)). [score:3]
Moreover, in C2C12 -overexpressing miR-200c, p66 wt was phosphorylated also in basal conditions, that is, without H [2]O [2], and the phosphorylation in Ser-36 increased even further upon H [2]O [2] treatment (Figures 4(a) and 4(b)). [score:3]
Herein, we wanted to dissect the role of miR-200c in muscle differentiation and to comprehend whether miR-200c levels were modulated in muscle pathological diseases associated with oxidative stress increase, such as Duchenne muscular dystrophy (DMD) [11, 12]. [score:3]
miR-200c levels were normalized to U6 small RNA expression as previously reported [24, 25]. [score:3]
To this aim, we overexpressed miR-200c in C2C12 myoblasts; then, we shifted the cells to differentiation medium (DM). [score:3]
As shown in phase contrast images of Figure 2(a), we started from cells with a similar degree of differentiation prior to infection (upper panels); we found that miR-200c overexpression decreased the myotube number (Figure 2(a) lower panels), assessed also by MyHC immunofluorescence staining (Figure 2(b)). [score:3]
All these results suggested a role for miR-200c in myogenic differentiation inhibition and in myotube loss. [score:3]
Stable expression of miR-200c, anti-miR-200c, or miR-scramble in C2C12 cells was generated by viral infection using lentiviral supernatants. [score:3]
Although further experiments should be accomplished in order to point to miR-200c as a therapeutic target, these data strongly suggest its possible involvement in muscle wasting in DMD, through apoptosis and senescence induction, as well as, by the induction of ROS and the decrease of NO. [score:3]
Moreover, we showed that anti-miR-200c treatment in hind limb ischemia in mice rescued the decrease of miR-200c protein targets and improved limb perfusion [10]. [score:3]
In summary, cells were infected with lentiviral virus for 2 h and then were recovered in complete fresh medium for 24 h. Afterwards, infected cells were selected by puromycin-containing medium (Sigma) for 72 h. miR-200c overexpression was controlled by quantitative real-time PCR (RT-qPCR) (see methods below). [score:3]
We found that miR-200c inhibited myotube formation as assessed by MyHC immunofluorescence staining (Figure 1(a)). [score:3]
miR-200c overexpression was also performed in C2C12 after 24 hrs of myogenic differentiation. [score:3]
We analyzed miR-200c expression levels in different muscles, that is, quadriceps (Q), gastrocnemius (GA), tibialis anterior (TA), extensor digitorum longus (EDL), and soleus (SOL), in both young (4-week-old mice (4 w)) and older mice (36-week-old mice (36 w)) (Figures 5(a) and 5(b)). [score:3]
We analyzed myogenic differentiation by Western blot, and we found that MyHC, myogenin, and MyoD proteins were increased at 48 h and 72 h of DM upon anti-miR-200c expression at higher levels compared to anti-scramble -treated C2C12 (Figure 3(c)). [score:2]
We found that miR-200c was significantly higher in mdx mice compared to wt, in all muscle groups examined, both in young and older mice (Figures 5(a) and 5(b)); indeed, in Q of young (~6-fold) and in GA of older mice (~12-fold), we found a very high increase of miR-200c expression (Figures 5(a) and 5(b)). [score:2]
An increase of miR-200c expression was also found in human myoblasts derived from muscle biopsies of DMD patients cultured in muscle differentiation medium, compared to human-differentiated myoblasts derived from muscle biopsies of healthy donors (Figure 5(c)). [score:2]
As shown in Figure 4c, we found an increase in Ser-36 phosphorylation in the immunoprecipitates of p66 in miR-200c -overexpressing C2C12 compared to scramble control (Figures 4(c) and 4(d)). [score:2]
This miRNA family consists of five members (miR-200c, miR-141, miR-200a, miR-200b, and miR-429). [score:1]
We therefore asked whether miR-200c phosphorylated p66Shc in this residue, also in C2C12 myoblasts. [score:1]
We then asked whether anti-miR-200c treatment was able to ameliorate myogenic differentiation. [score:1]
We previously found that miR-200c induces oxidative stress and p66Shc phosphorylation in Ser-36 in endothelial cells [10]. [score:1]
Moreover, miR-200c increases also in differentiated human myoblasts of DMD. [score:1]
Taken together, these results suggest a pivotal role of miR-200c in oxidative stress induction in DMD via a p66Shc -dependent mechanism. [score:1]
3.3. miR-200c Increased p66Shc Phosphorylation in Ser-36 in C2C12 Myoblasts. [score:1]
We also demonstrated that miR-200c is induced following acute hind limb ischemia in skeletal muscles and this induction was oxidative stress dependent, since in p66Shc [−/−] mice, which exhibit less oxidative stress than wild-type (wt) mice [1], miR-200c increase is significantly attenuated [9]. [score:1]
Taken together, these results indicate that miR-200c enhances p66Shc phosphorylation in Ser-36 as well as in C2C12 myoblasts, supporting its role in oxidative stress production [10]. [score:1]
Further, we aimed at establishing whether endogenous p66 was phosphorylated in Ser-36 by miR-200c. [score:1]
These results suggest a role for miR-200c in oxidative stress increase in mdx mice, mediated, at least in part, by p66Shc -dependent mechanism. [score:1]
Therefore, we transduced C2C12 cells with anti-miR-200c lentiviral particles and we shifted cells to DM for increasing period of times. [score:1]
To this aim, we transduced C2C12 with miR-200c and scramble control and then transfected the cells with a p66Shc wt cells or a mutated p66 (p66mut) plasmid in which Ser-36 was replaced with Ala, that is not phosphorylable. [score:1]
1-miR-200c and plko. [score:1]
In this report, we dissected the role of the oxidative stress -induced miR-200c on muscle differentiation, since our and other laboratories reported a decrease in myogenic differentiation upon oxidative stress in vitro [1, 27– 29]. [score:1]
Therefore, we asked whether miR-200c modulation had an effect on myogenic differentiation. [score:1]
We found that anti-miR-200c increased myotube formation as assessed by MyHC immunofluorescence staining (Figure 3(a)). [score:1]
We also demonstrated that miR-200c is highly induced upon H [2]O [2] treatment in C2C12 in both myoblasts and differentiated myotubes [9]. [score:1]
Notably, p66 phosphorylation in Ser-36 was increased in older mice also in basal conditions and was even higher in Q and particularly in GA, showing that older mice displayed higher miR-200c (Figure 5(d)). [score:1]
We previously showed that, in endothelial cells, miR-200c induces p66Shc phosphorylation in Ser-36, a phosphorylation known to be elicited by oxidative stress [10]. [score:1]
1-anti-miR-200c constructs were described previously [9, 10]. [score:1]
In keeping, anti-miR-200c treatment in growing myoblasts accelerates myogenic differentiation, increasing myotube numbers and size. [score:1]
Therefore, we hypothesized a miR-200c role in muscle wasting and myotube loss via a p66Shc -dependent mechanism in DMD. [score:1]
3.4. miR-200c and p66Shc Phosphorylation in Ser-36 Increase in Skeletal Muscles of mdx Mice. [score:1]
[1 to 20 of 59 sentences]
17
[+] score: 166
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-191, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, mmu-mir-429, mmu-mir-449a, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, mmu-mir-449c, mmu-mir-449b, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-124b
These results argue that lfng and zfhx1 can be efficiently downregulated by the miR-200 family alone, whereas foxg1 and neuroD, although likely genuine targets, may require the combined action of several miRNA species in addition to miR-200 action, in order to be efficiently downregulated. [score:9]
Our data show that expression patterns of genes expressed throughout the brain and in areas devoid of miR-200 family expression were comparable between wild-type and triple MO morphants, indicating that widespread neural defects were absent in the morphant fish (Figure 7D). [score:7]
Intriguingly, miR-200 family members are coordinately expressed from different loci, yet members express different 5′ seed heptamers, changes in which are thought to alter the binding specificity to target mRNA (Doench and Sharp, 2004; Lewis et al., 2005). [score:7]
Knocking down the expression of mature miR-200 family members led to impairment of mature olfactory marker expression and expansion of the early marker, foxg1, in the olfactory primordium. [score:6]
Expression of the miR-200 family can be detected in olfactory placodes as early as E9.5, which is the first identifiable stage of olfactory development, with continued expression within the MOE anlage in the posterodorsal aspect of the olfactory pit at E11.5 (Figure 2B). [score:6]
In addition, in situ hybridization analyses (Figure 7C) show that a mixture of all three morpholinos (Triple MO mix: miR-141 MO, miR-200b MO, and miR-429 MO) was sufficient to simultaneously inhibit the expression of all five mature zebrafish miR-200 family members to threshold levels of detection. [score:5]
We conclude that foxg1, zfhx1, and lfng are likely to be genuine targets for miR-200 family members in both mouse and zebrafish olfactory systems, while neuroD might only be a target in the fish. [score:5]
As predicted from sequence analyses and thermal stability calculations, miR-141 MO specifically inhibited miR-200a and miR-141, miR-200b MO specifically inhibited miR-200b and miR-200c, and miR-429 MO specifically inhibited miR-429 (Figure S4B). [score:5]
Antisense morpholino experiments in zebrafish reveal that the inhibition of expression of a single miRNA family, miR-200, largely phenocopies the defect in terminal olfactory differentiation resulting from lack of Dicer function in mouse olfactory progenitor cells. [score:5]
Exogenous miR-200 duplex RNA was able to reduce expression of the lfng and zfhx1 reporters, while miR-200 duplexes did not affect GFP expression levels for the foxg1 and neuroD reporters (Figure 8B). [score:5]
Moreover, increased foxg1 expression observed in the zebrafish morpholino experiments and in the mouse conditional Dicer microarray experiments (Table S3) also suggests that foxg1 may be a genuine miR-200 family target. [score:5]
Embryos injected with either miR-141/miR-200a or miR-200b/miR-429 pairs of antisense morpholinos showed lack of expression of the corresponding miR-200 members with a given 5′ seed but did not display any change in OMP expression relative to wild-type controls (data not shown). [score:5]
In situ hybridization analyses using LNA antisense probes to detect mature miRNAs indicated that 4 ng per embryo per miR-200 family member was the minimal dose required to knock down miRNA expression to threshold levels of detection (data not shown). [score:4]
Taken together, these results indicate that in the absence of miR-200 family expression during olfactory placodal development, zebrafish olfactory progenitors are unable to undergo normal terminal differentiation and, instead, undergo apoptosis. [score:4]
We conclude that mature zebrafish miR-200 family members can be specifically and efficiently knocked down in various combinations in the developing olfactory system using antisense morpholinos without confounding “off-target” effects. [score:4]
Due to the molecular and cellular similarity of mouse and zebrafish olfactory development processes and the high degree of conservation between the miR-200 miRNAs in the respective organisms, we reasoned that physiologically meaningful targets were likely to be conserved between the zebrafish and mouse genomes. [score:4]
Preliminary data suggest that lunatic fringe (lfng) and zinc-finger homeobox 1 (zfhx1), two key factors associated with Notch and BMP pathways, respectively, as well as foxg1, a transcription factor required for normal olfactory development, may be relevant miR-200 targets. [score:4]
However, miR-141 and -200a express different 5′ seed heptamers from miR- 200b, -200c, and -429 and are thus likely to form two functional subgroups within the miR-200 family (Figure 2C; Doench and Sharp, 2004; Lewis et al., 2005). [score:3]
A subset, including the miR-200 family, shows high olfactory enrichment and expression patterns consistent with a role during olfactory neurogenesis. [score:3]
In the adult, the expression pattern of all miR-200 family members is restricted to the immature and mature neuronal cell layers of the MOE and is excluded from the basal and sustentacular cell layers (Figure 2B). [score:3]
The strong, specific, and coordinated expression of miR-200 members in the MOE anlage and in the mature and immature MOE is consistent with a potential role of this miRNA family during MOE neurogenesis. [score:3]
In order to further validate the physiological requirement for miR-200's action on these targets, we generated GFP reporters containing the full-length 3′ UTRs for zebrafish neuroD, foxg1, zfhx1, and lfng (Giraldez et al., 2006). [score:3]
Notch and TGFβ Signaling Pathways and Foxg1 Are Candidate Targets of the miR-200 Family. [score:3]
In addition, other predicted miR-200 family targets may also contribute to the olfactory phenotypes observed in morphant fish and the Foxg1-Cre;Dicer [loxP/loxP] mutant mice. [score:3]
In addition, our preliminary microarray and GFP-sensor experiments suggest that foxg1 itself, as well as lunatic fringe (lfng) and zinc-finger homeobox 1 (zfhx1), two key factors associated with Notch and BMP pathways, respectively, may be genuine miR-200 targets. [score:3]
From the over 100 distinct miRNAs identified in olfactory tissues, the most abundant miRNAs isolated from our study include species that are wi dely expressed in many neural tissues (miR-124a and let-7 variants), as well as a highly restricted family of miRNAs (miR-200). [score:3]
Recently, independent reports have demonstrated that the miR-200 family is highly expressed in skin epidermal cells (Yi et al., 2006). [score:3]
By contrast, we identified 12 miRNAs corresponding to 9 families (miR-199, miR-140, miR-152, miR-214, miR-205, miR-200, miR-183, miR-182, miR-96) that displayed highly enriched expression in the olfactory system (Figure 1A). [score:3]
To gain further insights into the role of the miR-200 family in mediating olfactory differentiation, we used a bioinformatic approach to predict and validate potential miR-200 targets. [score:3]
Thus, the regulatory step involving the miR-200 family, and shown here to be essential for olfactory neurogenesis, may be employed by other systems of epithelial origin to ensure the proper mediation of critical signaling cascades during development. [score:3]
Accordingly, we decided to focus our efforts on potential functions mediated by the miR-200 family, which is among the most highly and most specifically miRNA subset expressed in the developing olfactory system. [score:3]
All individual members of the miR-200 family display similar expression patterns. [score:3]
We designed three morpholino antisense oligonucleotides predicted to each target the mature sequence of one or a few members of the miR-200 family (Figure S4A). [score:3]
Morpholinos targeting the miR-200 family were generated as described in. [score:3]
Moreover, as shown in the mouse, miR-200 family members display early expression in zebrafish (Wienholds et al., 2005) and appear highly enriched in olfactory tissues by the time olfactory placodes arise at 26 hpf (Figure 7A). [score:3]
The function of miR-200 during olfactory development is likely to be conserved throughout evolution, as judged from the absolute conservation of miR-200 orthologs between mouse and zebrafish with respect to the relative genomic clustering position, the conserved seed region sequences, the conserved size of the family, and the conserved arm of the hairpin that generates the mature miRNA (Figure S3). [score:2]
The morpholino knockdown experiments show that miR-200 family members are likely to act redundantly, even though they display different 5′ seed regions. [score:2]
The intriguing specificity and intensity of expression of the miR-200 family members in the MOE prompted us to pursue an in-depth investigation of their distribution during embryonic development and in the adult. [score:2]
These results indicate that the functional loss of the miR-200 family precludes normal differentiation of olfactory progenitor cells into mature olfactory neurons and thus phenocopies an important aspect of the Dicer knockout phenotype observed both in mice and zebrafish. [score:2]
The miR-200 family is therefore among the first neuronal miRNA families in vertebrates with a loss-of-function phenotype. [score:1]
We used the MicroCosm system that interfaces the miRanda prediction software with miRBase, the accepted database of miRNA classification, to confirm that mouse orthologs of zebrafish neuroD, foxg1, zfhx1, and lfng have conserved miR-200 seeds in their 3′UTRs (Griffiths-Jones et al., 2006) (Figure 8A). [score:1]
In mouse, the miR-200 family is composed of five family members (miR-141, -200a, -200b, -200c, -429) clustered into two loci of chromosomes 4 and 6 (Figure 2C). [score:1]
These results suggest that the loss of miR-200 family function disrupts terminal differentiation of olfactory progenitor cells, thus phenocopying an important aspect of the defects observed in mouse Foxg1-Cre; Dicer [loxP/loxP] mutant MOE. [score:1]
We subsequently performed immunohistochemical identification of proliferating and apoptotic cells in order to determine whether miR-200 morphant olfactory phenotypes are accompanied by increased cellular apoptosis, as observed in Dicer null mouse olfactory placodes. [score:1]
In order to test the specificity of each morpholino (MO) sequence, we systematically injected one-cell zebrafish embryos with either miR-141 MO, miR-200b MO, or miR-429 MO and performed in situ hybridization against all five miRNAs of the miR-200 family. [score:1]
To evaluate the contribution of specific miRNAs, we focused on the miR-200 family, which is highly and specifically expressed in the developing olfactory system. [score:1]
By contrast, miR-200 morphant olfactory epithelia presented significantly increased numbers of apoptotic cells relative to wild-type controls (mean ± SEM, WT 12.55 ± 1.46, n = 11; mutant 30.67 ± 2.59, n = 12, p < 0.01, Student's t test) (Figure 7F), as detected by TUNEL staining. [score:1]
How does the miR-200 family mediate its control of olfactory neurogenesis? [score:1]
One of these families, miR-200 family comprising miR-200a, miR-200b, miR-200c, miR-429, and miR-141, also highly detected by microarray, was among the most frequently cloned species in all olfactory tissues examined (Table S2). [score:1]
miR-200 Family Members Are Required for the Proper Differentiation of Olfactory Progenitor Cells. [score:1]
We next wished to determine whether the distinct 5′ seeds contributed differentially to the physiological function of the miRNA-200 family. [score:1]
Loss of function of the miR-200 family phenocopies the terminal differentiation defect observed in absence of all miRNA activity in olfactory progenitors. [score:1]
Finally, we eliminated the function of all miR-200 family members by injecting embryos simultaneously with the Triple MO mix. [score:1]
[1 to 20 of 53 sentences]
18
[+] score: 164
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-214, hsa-mir-200b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, hsa-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-200a, hsa-mir-130b, hsa-mir-376a-1, mmu-mir-376a, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, hsa-mir-429, mmu-mir-429, hsa-mir-450a-1, mmu-mir-450a-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-130b, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, hsa-mir-450a-2, dre-let-7j, hsa-mir-376a-2, mmu-mir-450a-2, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Some of the miR-9 and miR-200-class targets upregulated in the mutant OE (Qk, Foxf2) are mesenchymally-expressed rather than OE-expressed, while other targets were actually downregulated in the absence of Dlx5 (Akap6, Elmod1, Snap25) (Table 1C). [score:15]
To determine whether the forced expression of DLX5 may result in an upregulation of miR-9 and miR-200-class RNAs, SH-SY5Y cells were transfected with myc-tagged wild-type DLX5 or Q178P mutant DLX5 expression vectors, and the relative abundance of miR-9 and miR-200 was quantified by Real-Time qPCR. [score:8]
In summary, since miR-9 and miR-200-class are down-modulated in the absence of Dlx5, while Foxg1 protein level is up-regulated, and since the 3′ UTR of the Foxg1 mRNA is a predicted target of these miRs, we can infer that the Dlx5-miR-Foxg1 regulation is most likely a direct one. [score:8]
Two possible explanations: either changes in the abundance of miR-9 and miR-200-class cause changes in the abundance of target RNAs that are too modest to pass the imposed cut-off value, or these miRs preferentially affect translation and not stability of the target mRNAs. [score:7]
For chromatin immunoprecipitation (ChIP) we used the human SHSY-5Y neuroblastoma cells, which express low endogenous levels of Dlx5, miR-9 and miR-200, transfected with 5 μg of DLX5-myc-tag expression vector (from Open-Biosystem) or with the same vector in which the Q178P mutation (Shamseldin et al., 2012) was introduced (BioFab, Rome, sequence verified). [score:6]
A significant enrichment of miR-9 and miR-200-class target sequences was detected in the 3′ UTR of genes up-regulated in the Dlx5 [−/−] OE (Table 1A, B). [score:6]
myc-tagged version of either the WT or the Q178P mutant DLX5 were expressed in the SH-SY5Y human neuroblastoma cells, which express DLX5, miR-9 and miR-200 endogenously. [score:5]
We also show that Dlx5 promotes expression of miR-9 and miR-200 class, thereby tends to repress Foxg1 protein translation. [score:5]
•Dlx5 controls the expressions of miR9 and miR-200, which target the Foxg1 mRNA • miR-9 and -200 are needed for olfactory neurons differentiation and axon extension • miR-9 and -200 are required for the genesis and position of GnRH neurons. [score:5]
2.9To downmodulate endogenously expressed miR-9 and miR-200 we used the commercially available Ambion anti-miR inhibitors (Life Technologies). [score:5]
To downmodulate endogenously expressed miR-9 and miR-200 we used the commercially available Ambion anti-miR inhibitors (Life Technologies). [score:5]
On the contrary, DLX5 overexpression did not induce changes in miR-200 expression, either in SH-SY5Y (Fig.  2d) or in GN11 (neuroendocrine) or in U2OS (osteosarcoma) cells (data not shown). [score:5]
Next we intersected the predicted miR-9 and miR-200-class targets with the coding mRNAs found to be differentially expressed in the Dlx5 [−/−] OE compared to the WT (Garaffo et al., 2013). [score:4]
To overexpress miR-9 and miR-200 exogenously we used commercially available Ambion pre-miR precursors (Life Technologies). [score:3]
miR-200a, miR-200b, miR-141 and miR-429 share the same seed sequence and likely target the same mRNAs; for this reason they are grouped in a single miR class (named miR-200-class). [score:3]
The 3′ UTR of tetrapod and zebrafish Foxg1 mRNAs hosts miR-9 and miR-200 target sequences. [score:3]
To functionally demonstrate a role of miR-9 and miR-200-class for olfactory development, and the involvement of Foxg1 in this regulation in vivo, the zebrafish mo del was again used. [score:3]
3.7To determine whether miR-9 and miR-200-class play a role in GnRH neuronal differentiation and migration, we used the GnRH3:GFP transgenic zebrafish strain, in which the GFP reporter is expressed under the transcriptional control of a fragment of the z- GnRH3 promoter. [score:3]
Searching for functionally relevant targets of miR-9 and miR-200 clsss in the OE. [score:3]
Here we show that mouse and fish foxg1 mRNA is a target of miR-9 and miR-200 class, both of which are down-modulated in the Dlx5 null embryonic OE. [score:3]
We also show that miR-9 and miR-200-class target (amongst others) the foxg1 mRNA, through which they likely exert their functions. [score:3]
Instead, we could easily monitor the number and position of early GFP -expressing neurons, and noted that upon depletion of miR-200 class they appear reduced in number but normally clustered. [score:3]
To determine whether miR-9 and miR-200-class play a role in GnRH neuronal differentiation and migration, we used the GnRH3:GFP transgenic zebrafish strain, in which the GFP reporter is expressed under the transcriptional control of a fragment of the z- GnRH3 promoter. [score:3]
The results presented here indicate that loss of Dlx5 causes a down-modulation of miR-9 and of miR-200-class, which results in the over -expression of the Foxg1 protein. [score:3]
3.6To functionally demonstrate a role of miR-9 and miR-200-class for olfactory development, and the involvement of Foxg1 in this regulation in vivo, the zebrafish mo del was again used. [score:3]
In the same cells, the expression of pre -miR-200 led to a 3.9-fold decrease in Foxg1 proteins level (Fig.  3c). [score:3]
The most abundant miRs expressed in the developing mouse OE are: the miR-200-class (- 200a, - 200b, - 200c, - 141 and - 429), miR-199, miR-152, miR-214, miR-205, miR-183, miR-182 and miR-96 (Choi et al., 2008). [score:3]
Examining olfactory development more thoroughly we now can implicate the miR-9 and miR-200-class networks in a more complex phenotype reminiscent of the Kallmann syndrome (see below). [score:2]
Another indication comes from a study in zebrafish, showing a role of miR-200-class for olfactory development (Choi et al., 2008). [score:2]
To determine whether miR-9 and miR-200-class may modulate Foxg1 protein level, the effect of introduction of pre-miR-9 or depletion of endogenous miR-9 on Foxg1 protein level was assayed by Western blot analysis in SH-SY5Y cells, which express DLX5, miR-9, miR-200-class and Foxg1 endogenously. [score:2]
Thus, both miR-9 and miR-200 negatively regulate Foxg1 protein level. [score:2]
Genomic regulation of miR-9 and miR-200 by Dlx5. [score:2]
miR-9 and miR-200-class regulate Foxg1. [score:2]
In this work we define the role of miR-9 and miR-200-class in the development of the olfactory system, with functions ranging from ORN differentiation to axon guidance, glomerulus formation and GnRH neuron migration. [score:2]
Starting from profile data obtained from a mouse mo del of Kallmann syndrome, we functionally examined this pathway in zebrafish showing that miR-9 and miR-200-class are required for normal differentiation of the ORNs, for the extension and connectivity of the olfactory axons, and for the migration of the GnRH neurons from the nasal primordium to the forebrain. [score:1]
It has also been shown that miR-200 represses neural induction of human embryonic stem cells, via modulation of Pax6 and Zeb transcription factors (Du et al., 2013). [score:1]
No Dlx5 binding site was predicted within a 50 kb range from the miR-9.1, miR-141, miR-200c and miR-376a loci. [score:1]
miR200a and miR200b could not be tested by in situ hybridization due to high sequence conservation between all members of the miR-200-class. [score:1]
To complement the previous (static) data with live images of the migrating GnRH3 neurons, we carried out few time-lapse video recordings on untreated (4) and z- miR-200-class MO injected (4) embryos at earlier ages (36–52 hpf), in order to observe the first appearance of these neurons. [score:1]
We depleted the miR-200 class in fish zygotes, by injecting a mix of anti -miR-200 MO previously described and found to efficiently down-modulate several miR of the class-200 and to affect ORN differentiation (Choi et al., 2008). [score:1]
We previously verified that the depletion of miR-9 and miR-200-class in zebrafish embryos leads to higher level of z-foxg1 mRNA (no Ab efficiently recognizes the z-foxg1 protein). [score:1]
The 3′ UTR of the mammalian and fish Foxg1 mRNA contains seed sequences for miR-9 and miR-200 (Suppl. [score:1]
The abundance of z-hoxa-7a and z-hoxa-10b mRNAs did not greatly change, indicating that the differentiation delay observed upon depletion of miR-200-class is specific. [score:1]
Thus, our results provide the first evidence of the participation of miR-9 and miR-200-class in these early events. [score:1]
z-foxg1 mRNA level increased by three-folds when either miR-9 or miR-200-class were depleted (Figs.  5e and 6f). [score:1]
In control embryos, we counted an average of 13 (+/− 2) GnRH3::GFP + neurons/embryo at 72 hpf, while in miR-9 and miR-200 MO injected embryos the average number was, respectively, 5 (+/− 1) and 6 (+/− 1) (Suppl. [score:1]
3.4The 3′ UTR of the mammalian and fish Foxg1 mRNA contains seed sequences for miR-9 and miR-200 (Suppl. [score:1]
Depletion of miR-9 and miR-200-class in zebrafish results in altered GnRH neuron genesis and position. [score:1]
Previous results in which zebrafish embryos were injected with anti- miR-200 class MOs found a delayed ORN differentiation, but axonal organization and GnRH neuron migration was not assessed (Choi et al., 2008). [score:1]
com/request/, while the anti- z-miR-200 MO mix was as previously published (Choi et al., 2008). [score:1]
Similarly, the depletion of miR-200-class (N = 23) resulted in a reduced number of GFP + neurons in 22% of GFP + embryos with the phenotype “reduced number” and 50% of the cases showing the phenotype “scattered position” (Fig.  7). [score:1]
We used the same MOs indicated above to deplete miR-9 and miR-200 class in GnRH3::GFP zygotes, and examined the effect on the number and position of the GFP + neurons associated to the terminal nerves, between 36 and 72 hpf. [score:1]
In Danio rerio (zebrafish) the miR-200-class is required for the proliferation, differentiation and survival of ORNs (Choi et al., 2008). [score:1]
Upon injection of the anti-miR-200 MO mix, only about 24% of examined embryos turned out CFP + (vs. [score:1]
Using reporter zebrafish strains to visualize the embryonic olfactory axons (Miyasaka et al., 2005; Sato et al., 2005; Yoshida et al., 2002) or the GnRH + neurons (Abraham et al., 2008, 2009, 2010), we show that miR-9 and miR-200-class play a role in ORN differentiation and axonal organization. [score:1]
miR-9 and miR-200 mediate the Dlx5-Foxg1 cascade. [score:1]
Depletion of miR-9 and miR-200-class in zebrafish results in delayed ORN differentiation. [score:1]
We injected anti- miR-9 and anti- miR200 (or control) MOs in WT zygotes, then at 48 hpf we extracted total -RNA from these and carried out Real-Time qPCR analyses. [score:1]
[1 to 20 of 58 sentences]
19
[+] score: 161
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-200a
In addition, miR200c overexpression or ZEB1 knockdown is most likely to suppress tumor malignancy by enhancing E-cadherin expression (Figures  4 and 5A) and/or by inhibiting signals that suppress E-cadherin function. [score:12]
Since the malignant melanocytes can spread to distant locations and cause metastasis this process is involved in the EMT of melanoma in which miR200c and ZEB1 may be downregulation or upregulation. [score:7]
It was found that the expression of TGF-β, Vimentin, ZEB-1 and N-Cad was significantly decreased in tumor tissues from the B16F10/GPI-IL-21 vaccination of mice challenged by the B16F10/miR200c cells compared with other groups, whereas the expression of SMAD-7 and E-cadherin was significantly increased in tumor tissues, and the differences were statistically significant as are shown in Figures  4B-C. Consistent with the results of western blotting, the immunohistochemical analysis of tumor tissue sections showed that the molecular expression of TGF-β, Vimentin, ZEB-1 and N-cadherin was also reduced in tumor tissues, and that the SMAD-7 and E-cadherin expression was remarkably increased in the B16F10/GPI-IL-21 vaccination of mice that were then challenged by the B16F10/miR200c cells compared with B16F10/WT cells (Figure  5). [score:7]
From these results, we concluded that the B16F10/GPI-IL-21 vaccination of mice could result in the changes of EMT-related molecular expression in tumor tissues from the mice challenged by the B16F10/miR200c cells or the B16F10/shZEB1 cells that increased miR200c expression or decreased ZEB1 expression. [score:7]
To analyze the mechanisms of the overexpression of miR200c or knockdown of ZEB1 for reinforcing the antimelanoma efficacy of the tumor vaccine B16F10/GPI-IL-21, we detected the EMT-related molecular expression in tumor tissues from the immunized mice. [score:6]
Here, we show that the tumor vaccine B16F10/GPI-IL-21 in combination with potentially synergistic active therapies, such as either miR200c overexpression or ZEB1 knockdown, significantly represses tumor growth, blocks melanoma EMT program and inhibits tumor metastasis in a murine melanoma mo del. [score:6]
Regulation expression of miR200c and ZEB1 in B16F10 cells positively led to expression changes of TGF-β, Vimentin, ZEB-1, N-cadherin, SMAD-7 and E-cadherin in tumor tissues from the B16F10/GPI-IL-21 vaccination of mice, which are correlated with progression of EMT of B16F10 cells as well as influence of melanoma growth and metastasis in mice. [score:6]
To address the functional significance of the miR200c overexpression or ZEB1 knockdown in B16F10 cells, we tested the EMT-related molecular expression in tumor tissues. [score:6]
These results indicate that the tumor vaccine B16F10/GPI-IL-21 in combination with miR200c overexpression or ZEB1 knockdown effectively inhibited melanoma growth and metastasis a murine mo del. [score:6]
On the basis of these findings, we speculated that enforced miR-200c expression in melanoma B16F10 cells profoundly impairs cell tumorigenicity and phenotype change of EMT along with significantly decreased expression of TGF-β, Vimentin, ZEB-1and N-cadherin. [score:5]
Figure  1L indicates miR-200c expression is lower in the B16F10 WT cells than in B16F10/miR-200c cells, whereas the expression of ZEB1 was higher in the B16F10 WT cells than in B16F10/ miR-200c cells (Figure  1L and M). [score:5]
It has been observed that the expression of TGF-β, Vimentin, ZEB-1 and N-cadherin detected by western blot was markedly decreased, accompanied with increased expression of SMAD-7 and E-cadherin in the B16F10/GPI-IL-21 vaccination of mice challenged by the B16F10/miR200c cells. [score:5]
Our previous studies indicated that the disturbance of EMT-miR-200c-ZEB1 feedback loop promoted the melanoma proliferation and invasive metastasis [16], and that the miR-200c overexpression in CD44 [+]CD133 [+]B16F10 cells markedly inhibited the cell proliferation and invasion ability in vitro as well as tumorigenicity in vivo[18]. [score:5]
After the endogenous expression of miR-200c or ZEB1 in the B16F10 cells was identified by RT-PCR (data not shown), we analyzed the expression of miR-200c and ZEB1 in the transfected and transduced B16F10 cells. [score:5]
More recent approaches have centered on a series of molecules known as potentially regulating tumor progression such as microRNA-200c (miR200c) [12] and zinc finger E-box binding homeobox 1 (ZEB1) [13], which have provided proofs that overexpression of miR200c or knockdown of ZEB1 could repress tumor ‘epithelial to mesenchymal transition’ (EMT) program that activates cellular mobility, subsequent tumor metastasis [14- 16]. [score:5]
The efficacy mechanisms may involve in reinforcing immune responses, increasing expression of miR200c, E-cadherin and SMAD-7 and decreasing expression of TGF-β, ZEB1, Vimentin and N-cadherin in tumor tissues from the immunized mice. [score:5]
Our data represents the first attempt to improve the tumor vaccine B16F10/GPI-IL-21 efficacy in combination with miR200c overexpression or ZEB1 knockdown in B16F10 cells. [score:4]
Figure 3 B16F10/GPI-IL-21 vaccination of C57BL/6 mice in combination with either miR200c overexpression or ZEB1 knockdown against B16F10 melanoma. [score:4]
To augment therapeutic B16F10 melanoma efficacy by tumor vaccine B16F10/ GPI-IL-21 in C57BL/6 mice, we adopted a novel strategy that the tumor vaccine B16F10/GPI-IL-21 were combined with miR200c overexpression or ZEB1 knockdown in B16F10 cells in current antitumor experiment. [score:4]
It was found that the expression of ZEB1 was higher in the B16F10 wild type (WT) cells than in B16F10/shZEB1 cells, whereas the miR-200c expression was obviously increased in B16F10/ZEB1 cells compared with B16F10 WT cells (Figure  1H and I). [score:4]
Tumor vaccine B16F10/GPI-IL-21 in combination with miR200c overexpression or ZEB1 knockdown reduced melanoma growth and metastasis. [score:4]
To elicit a potent antitumor efficacy against melanoma, we used tumor vaccine in combination with miR200c overexpression or ZEB1 knockdown to assess the efficacy of treatment of murine melanoma. [score:4]
Therefore, we next combined the tumor vaccine B16F10/GPI-IL-21 with miR200c overexpression or ZEB1 knockdown in B16F10 cells to test the novel strategy for optimizing the therapeutic management of melanoma growth and metastasis in mice. [score:4]
In the present study, our goal was to use a tumor vaccine B16F10/GPI-IL-21 in combination with regulation expression of miR200c and ZEB1 against melanoma, an aggressive skin cancer that there is no cure in advanced stages until now. [score:4]
Screen of transfected and transduced clones and identification of expression of IL-21, miR-200c and ZEB1 in a different B16F10 cells. [score:3]
B16F10 cells were infected with the pHAGE-CMV-miR-200c-IzsGreen lentivirus, and were selected by the IzsGreen expression [21]. [score:3]
Figure 1 Observation of the different clones and detection of expression of IL-21, miR-200c and ZEB1 in B16F10 cells. [score:3]
In an experimental mo del of melanoma growth and metastases, we found the tumor growth was significantly inhibited in the B16F10/GPI-IL-21 vaccination of mice that were then challenged by the B16F10/miR200c cells, which was reflected in weaker tumorigenicity, smaller tumor volumes, lower lung metastases and longer survival in melanoma bearing mice than those of mice that were challenged by the B16F10 cells (Figure  3). [score:3]
To generate the miR-200c expression lentivirus vector, we amplified an insert (full-length mouse miR-200c) by PCR from B16F10 cell DNA. [score:3]
Transduction of lentivirus miR-200c and production of stable expression clones. [score:3]
The stable expression clones were selected by limiting the dilution assay and designated‘B16F10/miR200c’ [22]. [score:2]
In addition, the tumor vaccine B16F10/GPI-IL-21 significantly inhibited the tumor growth and reduced counts of lung metastases in mice challenged by B16F10/GPI-IL-21, B16F10/shZEB1 and B16F10/miR200c respectively compared with the control mice challenged by B16F10 cells. [score:2]
About 10 days after the final immunization, the mice were randomly divided into four groups: the B16F10/wild type (WT) group; B16F10/shZEB1 group; B16F10/miR200 group and B16F10/GPI-IL-21 group. [score:1]
The vaccine was immunized into mice challenged by B16F10 cells or B16F10 cells stably transduced with lentiviral-miR200c (B16F10/miR200c) or transfected with the ZEB1-shRNA recombinant (B16F10/shZEB1) or the B16F10/GPI-IL-21 vaccine. [score:1]
The results suggested that the clones stably transfected with shRNA1 or stably infected with lentivirus miR-200c were successfully isolated from the B16F10 cells. [score:1]
Even though, the B16F10/GPI-IL-21 vaccination of mice challenged by the B16F10/shZEB1 cells or B16F10/GPI-IL-21 cells also indicated antitumor efficacy this efficacy was remarkably found in B16F10/miR200c cell group. [score:1]
To develop B16F10/miR200c and B16F10/shZEB1, we first constructed the miR-200c lentivirus vector and shZEB1 recombinant and then transduced and transfected them into B16F10 cells, respectively, and finally the clones stably transduced with miR-200c lentivirus vector or transfected with shRNA1 recombinant were screened. [score:1]
The lentivirus miR-200c was produced from the transient transfection of the HEK293T cells with pHAGE-CMV-miR-200c-IZsGreen, psPAX2, and pMD2. [score:1]
We thank Dengyu Cheng, Wenhu Cao, and Yurong Liu for their help with short hairpin RNA sequence design and transduction of lentivirus miR-200c. [score:1]
EMT: Epithelial to mesenchymal transition; GPI: Glycosylpho sphatidylinositol; miR200c: microRNA-200c; ZEB1: Zinc-finger E-box binding homeobox 1; CFSE: Carboxyfluoroscein diacetate succinimidyl ester; FACS: Fluorescence-assisted cell; ELISPOT: Enzyme-linked immunospot; TGF-β: Transforming growth factor-β; IFN-γ: Interferonγ; TNF-α: Tumor necrosis factor α; IL-4: Interleukin 4. The authors declared that they have no competing interests. [score:1]
Compared with the immunized mice that were challenged by the B16F10 cells, only 1 out of the 6 mice developed tumor after the mice were challenged by the B16F10/shZEB1 cells, and the measurable tumors were not detected in other 5 mice until 60 days into the observation, but the most powerful antimelanoma efficacy was found in the immunized mice that were challenged by the B16F10/miR200c cells, which was reflected in 1 out of the 6 mice developing the smaller tumor, the longer survival time, the lower tumor metastasis counts and the weaker pathological changes in murine lung than those of other mice that were shown in Figure  3. The results from the tumor area and tumor metastasis counts in lungs suggested that the synergism antitumor efficacy was found in mice immunized with the tumor vaccine B16F10/GPI-IL-21 in combination with either overexpression of miR200c or knockdown of ZEB1 in B16F10 cells. [score:1]
[1 to 20 of 41 sentences]
20
[+] score: 159
In green are the gene targets of miR200/182 members that are down-regulated in brain tissue acutely infected with HSV-1. In grey are putative targets of miR200/182 members whose expression was determined to be unchanged. [score:10]
Amongst these genes, 2260 were also predicted targets of miR-200/182, from which 200 were downregulated and 54 upregulated more than 2-fold in mouse brain following infection. [score:9]
Using the target prediction software TargetScan in conjunction with gene expression profiling, we found that miR-200/182 may in fact modulate the biosynthesis of heparan sulfate proteoglycans (HSPGs). [score:7]
In particular, several miR-200/182 members were downregulated in rabies virus infection [67] and West Nile virus infection [16] of mice while upregulated in HCMV [15, 68] and influenza infection of cell culture [69– 70]. [score:7]
However, a report describing the targeting of Myd88 by miR-200b and miR-200c followed by subsequent downregulation of proinflammatory molecules in THP-1 cells exist but is not a common theme in the literature [66]. [score:6]
The 7 canonical pathways that were significantly enriched (p-value<0.05) in the group of genes that were downregulated in HSVE and also predicted targets of miR-200/182 are shown in Fig 6A. [score:6]
miR-200/182 expression was upregulated during HSVE. [score:6]
Several miR-200/182 members are able to downregulate the expression of Sdc2, a core protein of HSPGs that is important for attachment of numerous viruses, including HSV-1, for entry into the host cell. [score:6]
A number of downregulated genes targeted by miR-200/182 (including the sulfotransferases HS3ST1, HS3ST3A1, HS6ST2 and SDC2) are involved in heparan sulfate proteoglycan (HSPG) biosynthesis (Fig 6C). [score:6]
One heparan sulfate proteoglycan, Sdc2, was predicted by TargetScan to be targeted at multiple conserved sites by at least 5 different members of the miR-200/182 miRNA group; miR-141, miR-200b/c, miR-182, miR-96 and miR-183. [score:5]
Induction of miR-200/182 expression visualized by in situ hybridization in brain tissueWe used ISH to visualize the expression of a subset of induced miRNAs (miR-141, miR-183, miR-200a and miR-155) within the brain of infected mice. [score:5]
Using luciferase assays, we found that miR-96, miR-141, miR-183 and miR-200c all caused a downregulation of Sdc2 expression. [score:5]
Using luciferase assays, we found that miR-96, miR-141, miR-183 and miR-200c all downregulated the expression of Sdc2. [score:5]
TargetScan version 6.2 (June 2012) was used to curate a list of predicted mouse specific miRNA target genes for miR-200/182 members [34]. [score:5]
We confirmed that miR-96, miR-141, miR-183 and miR-200c all bound to the Sdc2 3’UTR, resulting in ~2-fold downregulation (p-value<0.001) of the luciferase reporter gene (Fig 6D). [score:4]
The induction of miR-200/182 miRNAs in HSV-1 infected brains may therefore play a role as a host mechanism to mitigate virus entry and spread by downregulating SDC2. [score:4]
0169081.g005 Fig 5Detection of miR-200/182 upregulation in HSVE brain tissues by in situ hybridization. [score:4]
Upregulation of miR-200/182 members and miR-155 was detected in HSV-1 infected cortex region. [score:4]
Detection of miR-200/182 upregulation in HSVE brain tissues by in situ hybridization. [score:4]
miR-200/182 and several others were upregulated in HSVE brain samples. [score:4]
Given the upregulation of miR-200/182 members during acute HSV-1 infection, we employed a bioinformatics approach to explore their functionality within the context of HSV-1 -induced encephalitis. [score:4]
miR-200/182 members may regulate expression of heparan sulfate proteoglycan, syndecan-2 (Sdc2). [score:4]
In addition the miR-429, a member of the miRNA-200 family, was upregulated 2-fold showing a similar trend of induction. [score:4]
We also observed the upregulation of 7 miRNAs belonging to the related and often co-transcribed miRNA-200 family (miR-200a,b,c/miR-141/miR-429) and miRNA-182 cluster (miR-182/miR-183), henceforth collectively referred to as miR-200/182. [score:4]
There are, however, reports listing the deregulation of miR-200/182 members in a number of other viral disease mo dels. [score:4]
Overall, our data suggests that miR-200/182 induction may result in downregulation of Sdc2 in an in vivo mouse mo del of HSVE. [score:4]
miR-200/182 expression was induction in HSV-1 positive areas of the brain. [score:3]
The expression of the miR-200 family has been shown to be particularly enriched in epithelial and endothelial tissues [43, 45]. [score:3]
Induction of miR-200/182 expression visualized by in situ hybridization in brain tissue. [score:3]
Based on the staining patterns of miR-200/182 as determined by ISH, it appeared that members of these miRNA families could also be expressed and induced in neurons. [score:3]
Furthermore, we identified the co-ordinate dysregulation of miR-200/182 family members during acute encephalitis. [score:2]
These miRNAs were induced in areas of the tissue heavily infected by HSV-1. In addition, a potential role for miR-200/182 members is the regulation of HSPG synthesis. [score:2]
The induction of multiple members of the highly related, and often co-transcribed, miRNA-200 family and miRNA-182 cluster was our most striking finding. [score:1]
Interestingly, 6 members of the related and often co-transcribed miRNA-200 family (miR-200a,b,c/miR-141/miR-429) and miRNA-182 cluster (miR-182/miR-183), henceforth referred to collectively as miR-200/182, were amongst the highest induced in HSV-1 infected brain. [score:1]
In addition miR-141 is expressed in normal human astrocytes and the role for this miRNA in these cells, and other members of miR-200 family and miR-182 cluster, has not yet been investigated [65]. [score:1]
Total RNA was extracted from these samples and real-time PCR was used to profile for 3 select miR-200/182 members (miR-141, miR-200a and miR-183) as well as miR-155. [score:1]
Previous studies have shown the miR-200 family to be induced by oxidative stress and play a role in apoptosis and so we hypothesized that the significant induction of these miRNAs we saw in our mo del of HSV-1 induced encephalitis may be related to tissue damage during infection [43]. [score:1]
The role of microRNAs miR-200b and miR-200c in TLR4 signaling and NF-kappaB activation. [score:1]
Bioinformatic analysis of miR-200/182 function identifies a potential role in heparan sulfate proteoglycan (HSPG) biosynthesis. [score:1]
[1 to 20 of 39 sentences]
21
[+] score: 153
Other miRNAs from this paper: mmu-mir-141, mmu-mir-200b, mmu-mir-200a, mmu-mir-429
On the basis of previous data, In general, the predicted miR-200 family target genes were downregulated in DMPCs because miR-200 family expression was upregulated in DMPCs. [score:11]
Relative to miR-200 family inhibition cells (miR-200s inhibitors DMPC group; 65.2 ± 8.9%), a decrease cells in G0/G1 phase of the cell cycle was observed following miR-200 family inhibition combining with overexpression of RSAD2 in DMPC (RSAD2-DMPC group; 58.4 ± 1.7%, P < 0.05) (Fig. 6a). [score:9]
Then, we further predicted the miR-200 family target genes by comparing the upregulated miRNAs and the downregulated mRNAs on two web sites: http://www. [score:9]
Up-regulation of miR-200 family inhibits the RSAD2 protein expression, the process of which significantly promotes podocyte differentiation (right). [score:8]
Down-regulation of miR-200 family fail to inhibit the RSAD2 protein expression in undifferentiated podocytes (left). [score:8]
The miR-200 family directly regulates RSAD2 expression by targeting the 3′-UTR of RSAD2. [score:7]
More intriguingly, miR-200 family directly inhibited the RASD2 expression, which can reverse miR-200a/200b/429 -mediated promotion of cell differentiation (Fig. 8). [score:6]
In this study, we found that miR-200a, miR-200b and miR-429 were upregulated in DMPCs, whereas the expression of miR-200c and miR-141 were not affected (Fig. 1). [score:6]
Furthermore, the blockade of miR-200 family by RNA interference inhibited the expression of RASD2 and arrested cellular differentiation. [score:5]
As shown above, overexpression of miR-200 family inhibited RSAD2 in HEK293 cells. [score:5]
Over -expression of RSAD2 combining with restraint of miR-200 family revealed inhibition of cell differentiation and proliferation. [score:5]
Consequently, we studied the effect of miR-200 family inhibition on the rearrangement of cytoskeleton and expression of biomarkers, which would reveal the effect of miR-200 family on podocyte differentiation. [score:5]
If this also holds true for podocytes, one might predict that restraint of miR-200 family expression combining with higher expression of RSAD2 may restrict podocyte differentiation. [score:5]
To confirm the biological function of miR-200 family in podocyte differentiation, we examined cell cycle distribution after a simultaneous inhibition of the expression of miR-200a, miR-200b and miR-429. [score:5]
All together, these results suggested that miR-200 family directly regulated the expression ofRSAD2 by interacting with its 3′-UTR. [score:5]
Notably, the three miR-200a/200b/429 are all located on chromosome 4, which indicates a potential key role of the three members on chromosome 4 in podocyte differentiation, but not the other two members (miR-200c and miR-141) on chromosome 6. Thus, a negative control or miR-200a, miR-200b and miR-429 inhibitors were all co -transfected together into DMPCs for 48 h. We found that restraint of miR-200 family significantly inhibited podocyte differentiation (Figs 2 and 3). [score:5]
Our further assay by restraint of miR-200 family expression combining with higher expression of RSAD2 in podocytes showed a restriction of podocyte differentiation (Fig. 6), which further confirmed the pivotal role of miR-200s/RSAD2 signaling in podocyte differentiation. [score:4]
RSAD2 is a predicted target gene of miR-200 family. [score:3]
Over -expression of RSAD2 combining with restraint of miR-200 family revealed promotion of cell dedifferentiation and proliferation. [score:3]
Restraint of miR-200 family revealed inhibition of cell differentiation and apoptosis. [score:3]
Since restraint of miR-200 family inhibited podocyte differentiation, we further explored the effect of restraint of miR-200 family on podocyte apoptosis. [score:3]
We then looked for miR-200 family putative targets. [score:3]
Both of the web sites showed the same sequences of RSAD2 targeting by miR-200 family (Fig. 4a). [score:3]
The results showed that miR-200 family modulated cell differentiation through the inhibition of RSAD2. [score:3]
To investigate the expression level of miR-200 family during the differentiation of podocytes, a recent study in our laboratory has identified the miRNAs and mRNA expression levels in undifferentiated and differentiated podocytes using miRNA and mRNA microarray 16. [score:3]
Hence, these findings indicate that miR-200 family may potentially promote podocyte differentiation through repression of RSAD2 expression. [score:3]
RSAD2 was a predicted target gene of miR-200 family. [score:3]
Several genes have been reported to be the targets of the miR-200 family, including ZEB1 29, ZEB2 30, Foxf2 31 and SIP1 32. [score:3]
MiR-200 family restraint reveals a significant inhibition in podocyte differentiation. [score:2]
Together, functional assays in podocytes demonstrated that miR-200 family inhibited RSAD2 to promote podocyte differentiation. [score:2]
Notably, the three members are all located on chromosome 4, which indicated a potential key role of the three members of miR-200 family in podocyte differentiation. [score:1]
Proposed mechanism of miR-200 family modulating RSAD2 protein and their roles in podocyte differentiation. [score:1]
In the present study, we show a relationship between miR-200 family and RSAD2 in podocyte differentiation. [score:1]
Restraint of miR-200 family affects cell cycle and apoptosis. [score:1]
Though the members of the miR-200 family (the miR-200b/200c/429 group and the miR-200a/141 group) share the similarities of their seed sequences 25, the biological function of miR-200a/200b/429 subfamily in our study may undergo a chromosome -dependent molecular mechanism. [score:1]
Restraint of miR-200 family affects differentiation marker and reveals rearrangement of cytoskeleton. [score:1]
How to cite this article: Li, Z. et al. miR-200 family promotes podocyte differentiation through repression of RSAD2. [score:1]
Since report has revealed the critical role of mir-200 family in cell proliferation 33, These results indicated that the novel role of the miR-200s/RSAD2 signaling in podocyte proliferation. [score:1]
[1 to 20 of 38 sentences]
22
[+] score: 149
At 15 dpe in both, control and miR-200 -gof conditions the percentage of GFP + cells expressing calretinin was approximately 2% suggesting that the calretinin expressing neuroblasts at 4 and 7 dpe after miR-200 -gof electroporation either downregulated calretinin or died at later stages. [score:8]
Altogether these results show that knockdown of miR-200 family microRNAs interferes with terminal neuronal differentiation while their premature expression induces in a subset of postnatally generated precursors defined aspects of neuronal maturation: cell-cycle exit and premature expression of a mature neuron marker. [score:6]
miR-200 induces calretinin expression through Zeb2 inhibition. [score:5]
The miR-200 -gof and a GFP- expression vectors were co-electroporated into the SVZ and Zeb2 expression was analyzed in the RMS at 4 dpe. [score:5]
Only in the miR-200 over -expression condition GFP + cells expressing calretinin are detected. [score:5]
miR-200 sponge partially rescues the inhibitory activity of the miR-200 expression vector. [score:5]
Moreover, transgenic co -expression of Zeb2 rescued the miR-200 mediated induction in calretinin expression (Fig. 4d). [score:5]
These did not express significant levels of either GluR2 or DCX (Fig. 2b), thus likely representing glia and GluR2 negative neurons 28. qRT-PCR analyses to detect miR-200b and miR-141 as representative members of each of the two miR-200 clusters showed strongest expression in the mature GABAergic (GFP-low) population (Fig. 2c), in agreement with the deep-sequencing data (Fig. 1). [score:5]
The quantity of NeuN negative cells in the OB after miR-200 knockdown increases by only 5%, while premature expression of the family induces calretinin in less than 10% of all transfected cells. [score:4]
microRNA expression in the OB neurogenic system: the miR-200 family. [score:3]
Taken together, the above results demonstrate that miR-200 microRNAs expression increases with maturation in the postnatal neuronal lineage that generates OB interneurons. [score:3]
Such a role for Zeb2 in the differentiation process would account for the appearance of calretinin positive cells in the RMS in the context of miR-200 overexpression. [score:3]
All miR-200 family members are exclusively expressed in the OB but not in the stem cell or migratory compartments. [score:3]
How to cite this article: Beclin, C. et al. miR-200 family controls late steps of postnatal forebrain neurogenesis via Zeb2 inhibition. [score:3]
First, we analyzed the consequences of miR-200 inhibition on neuronal differentiation in the OB using the miR-200-sponge. [score:3]
Our finding that the miR-200 promoter fragment that we used to drive GFP expression is only active in a small fraction of the transfected neurons supports this potential lack of competence. [score:3]
miR-200c and miR-141 are localized on chromosome 6 and were expressed at lower levels (Fig. 1c). [score:3]
We conclude that regulation of Zeb2 by miR-200 family microRNAs regulates neuronal maturation during postnatal neurogenesis. [score:3]
Together with their synchronized expression this suggested a redundant or cooperative function of the miR-200 family members in the OB. [score:3]
We asked if premature expression of miR-200 family microRNAs interfered with Zeb2 levels in neuronal precursors. [score:3]
As miR-200 expression occurs during late stages of OB neurogenesis, we analyzed the electroporated cells at 15 dpe, a time point of advanced maturation. [score:3]
The miR-200 expression vector (miR-200 -gof) was generated by PCR amplification of both miR-200 clusters from CD1 mouse genomic DNA and sub-cloning of amplified fragments into pCX-MCS2. [score:3]
Altogether, these data strongly indicated that the miR-200 induced increase in neuronal differentiation in the RMS was mediated by inhibition of Zeb2. [score:3]
GFP -expressing cells showed significantly less Zeb2 immunoreactivity when miR-200 -gof was present (Fig. 4b,c). [score:3]
Therefore we aimed at refining miR-200 family expression in the system combining transgenic and sorting approaches. [score:3]
Another question concerns the observation that only a small fraction of neuronal precursors shows altered differentiation after interference with miR-200 expression. [score:3]
First, we constructed an in vivo expression vector that generates a single transcript containing the two genomic regions harboring the miR-200 family clusters under the control of the chicken β-actin promoter (miR-200 -gof, Fig. 3a). [score:3]
The limited effects might be due to the fact that only a subfraction of the transfected cells are responsive to either inhibition or increase of miR-200 microRNAs. [score:3]
Indeed, the five members of the miR-200 -family were exclusively expressed in the OB and densely clustered in the heat map representation (Fig. 1b,c). [score:3]
Moreover, both, Zeb2 loss-of-function and miR-200 gain-of-function led to a comparable phenotype, the premature expression of the late neuronal subtype marker calretinin. [score:3]
This demonstrates that miR-200b and miR-141, and therefore likely the entire miR-200 family, are present in the postnatal neurogenic lineages and that their expression level increases with maturation. [score:3]
However, 4 days after miR-200 -gof electroporation 4.79% ± 1.15%, (Fig. 3g) of the GFP positive cells in the RMS expressed calretinin and this percentage increased to 8.96%; ± 1.82% at 7 dpe (Fig. 3f,g). [score:3]
Simultaneous expression of the miR-200-sponge was able to partially restore luciferase activity (Fig. 3b), altogether demonstrating that both vectors were functional. [score:3]
Knockdown of miR-200 significantly increased the percentage of electroporated cells in the OB that were negative for NeuN, a marker for mature neurons (control: 1.99% ± 0,43%; miR-200-sponge: 7.32% ± 1.76%; Fig. 3c,d). [score:2]
Mir-200 family target Zeb2 in the OB neurogenic system. [score:2]
Next, we aimed at analyzing the regulatory mechanism that underlies the differentiation-inducing function of miR-200 family microRNAs in the system. [score:2]
In cancer cells the interaction between miR-200 and Zeb proteins is a key regulatory event in the control of epithelial-mesenchymal transition (EMT) and has been extensively implicated in the metastasis of different cancer types. [score:2]
Another family of microRNAs that is tightly regulated during postnatal OB neurogenesis is the miR-200 family, that has been implicated in neurogenesis in cultured cells 25 and sensory neurons 26. [score:2]
miR-200 family microRNAs regulate neuronal differentiation. [score:2]
First, repression of Zeb2 by miR-200 microRNAs has a direct impact on differentiation of at least a subfraction of neuronal progenitors. [score:2]
Differences between groups of cells were analyzed pairwise with a t-test (control vs miR-200 calretinin positive P < 2.2e-16; control vs miR-200 calretinin negative P < 2.2e-16); n = number of cells used for analysis; an = number of animals from which analyzed cells were issued. [score:1]
Co-transfection of HeLa cells with miR-200 -gof and the resulting plasmid strongly repressed luciferase activity. [score:1]
The miR-200 family contains two different seed sequences (differing in only one nucleotide) and both sequences are present in the two genomic loci. [score:1]
We then used in vivo brain electroporation to introduce the miR-200-sponge or miR-200 -gof constructs into the OB neurogenic system. [score:1]
In vivo functional analysis of miR-200 microRNAs. [score:1]
The sponge construct was designed according to 58 with 4 repetitions of 2 oligonucleotides (5′-GACACATCGTTACTCTCAGTGTTAGACACGGCATTACTCTCAGTATTA and 5′-GACTTCATCATTACTCCCAGTATTAGACCCATCTTTACTCTCAGTGTTA) partially complementary to any member of the miR-200 family were placed behind a destabilized GFP gene in pCX-d2-GFP plasmid. [score:1]
Differences between groups were analyzed pairwise with the Man and Whitney test (control (n = 5 animals) vs miR-200 (n = 5 animals) P = 0.008816, miR-200 (n = 5 animals) vs miR-200 + Zeb2 (n = 7 animals) P = 0.04236). [score:1]
The best-characterized targets of the miR-200 family, albeit in cancer backgrounds, are the zinc finger proteins Zeb1 and Zeb2 30. [score:1]
We focused our functional analysis on the miR-200 family. [score:1]
It would also explain the lack of differentiation, as measured by decreased NeuN staining, when miR-200 is inhibited. [score:1]
Second, we investigated if expression of the miR-200 members at early stages of OB neurogenesis was sufficient to induce premature neuronal differentiation. [score:1]
To this end we electroporated miR-200 -gof into the lateral ventricular wall and analyzed their progeny. [score:1]
The 3′UTR of the zinc finger/homeodomain transcription factor Zeb2, a well-characterized miR-200 target 30, was cloned downstream the firefly luciferase gene in the pmiRGlo vector (Promega). [score:1]
Second, we designed a miR-200-sponge that contained four repeats capable to bind each of the miR-200 family members (Fig. 3a). [score:1]
We thus investigated whether premature expression of miR-200 can induce premature exit of cell-cycle. [score:1]
[1 to 20 of 55 sentences]
23
[+] score: 146
While some downregulated miRNAs were observed, we focused on the significantly upregulated miR-200 family members (miR-141, -200a, -200b, -200c, and -429) and the miR-183 family members (miR-96, -182, and -183), which had higher expression levels in 10-month-old Tg2576 mice (fold-change > 2.0, unpaired Student’s t-test; p < 0.05; Fig 1A). [score:9]
Although their diminished levels did not correspond with the number of target sites or scores predicted from the 3'-UTR sequence in silico, all candidate genes were demonstrated to have direct target sites for miR-200b or miR-200c. [score:6]
Taken together, we speculate that miR-200b and miR-200c expression in neuronal cells has the potential to suppress the cytotoxic damage caused by Aβ, especially Aβ1–42, in the early stages of AD by regulating Aβ secretion. [score:6]
Both miR-200b and miR-200c expression levels in PMNCs were markedly increased by Aβ1–42 stimulation after 36 h of treatment, and the peak in the elevation of miRNA expression was observed at 72 h, with a six-fold increase being found (Fig 2A). [score:5]
The findings from our in vitro study suggest that miR-200b and/or miR-200c targeting of S6K1 could suppress Aβ generation through amelioration of insulin resistance. [score:5]
This could include downstream genes of target genes post-transcriptionally inhibited by miR-200b or miR-200c. [score:5]
Effect of miR-200b and miR-200c on Aβ -induced toxicity in vitroTo verify whether expression of miR-200b and miR-200c are altered in response to the neuronal damage induced by Aβ1–42, we treated PMNCs with Aβ1–42 peptides and examined miRNA expression levels using qRT-PCR. [score:5]
The above-mentioned network consisted of differentially expressed genes in 10-month-old Tg2576 mouse cortex presenting highly expression of miR-200 family (Fig 1C). [score:5]
To verify whether expression of miR-200b and miR-200c are altered in response to the neuronal damage induced by Aβ1–42, we treated PMNCs with Aβ1–42 peptides and examined miRNA expression levels using qRT-PCR. [score:5]
The marked upregulation of members of the miR-200 family was confined to the phase of increasing Aβ deposition, and disappeared in the plateau phase (17-month-old mice). [score:4]
In this study, we showed that miR-200 family members were upregulated in the cortices of 10-month-old Tg2576 mice, which might bring about compensative effects in relation to Aβ -induced toxicity. [score:4]
analysis for anti-phospho IRS-1 on serine (S) 302/307, S307/312, S636/639, and S1097/1101 revealed that downstream regulation of S6K1 was inhibited by miR-200b and miR-200c. [score:4]
The miRNAs that were upregulated were members of the miR-200 and miR-183 families. [score:4]
data showed that ZEB1 was clearly downregulated in miR-200b and miR-200c transfected SH-SY5Y cells (Fig 4C). [score:4]
0196929.g005 Fig 5 analysis for anti-phospho IRS-1 on serine (S) 302/307, S307/312, S636/639, and S1097/1101 revealed that downstream regulation of S6K1 was inhibited by miR-200b and miR-200c. [score:4]
To elucidate the miR-200b and miR-200c signaling pathways involved in Aβ -induced toxicity, we explored their direct targets using RIP-Chip. [score:4]
Growing evidence indicates that the miR-200 family is involved in cancer cell migration via the targeting of ZEB1 and ZEB2 [45– 48]. [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
Surprisingly, Aβ1–42 secretion was markedly suppressed in miR-200b and miR-200c transfected PMNCs, and the impairment of Aβ secretion in the conditioned medium was dependent on the miRNA concentrations used (Fig 2B). [score:3]
Although neurological reports for the miRNA-200 family are few, one neurological study has shown that members of the miR-200 family contribute to olfactory neurogenesis [49], and a microarray study showed that miR-200c is differentially expressed in AD brains [50]. [score:3]
Intriguingly, miR-8 in flies (homologous to miR-200 in mammals) has been revealed to target FOG2, which binds to a subunit of PI3K and activates insulin signaling [51]. [score:3]
The results for miR-200b (left) and miR-200c (right) are shown as expression of miRNA in the treated sample relative to that of the DMSO treated control sample at each time point. [score:3]
We postulated that miR-200b and/or miR-200c would inhibit S6K1, which would result in a reduction in the insulin resistance induced by oAβ. [score:3]
Suppressive effect of miR-200b and miR-200c on Aβ generation in vitro. [score:3]
A total of 171 and 204 genes were immunoprecipitated as candidate targets of miR-200b and miR-200c, respectively (fold-change > 2.0, t-test; p < 0.05; S1 Table). [score:3]
The Accutarget miRNA mimic miR-200b/c (a mixture containing equal molar concentrations of miR-200b and miR-200c) or Negative control #1 (NC) (HPLC-grade; Bioneer, Daejon, Korea) was prepared for intracerebroventricular (i. c. v. ) transfection into mouse brains, using Invivofectamine® 2.0 reagent (Invitrogen) in accordance with the manufacturer’s protocol. [score:3]
Identification of miR-200b and miR-200c targets. [score:3]
The members of the miR-200 family and related differentially expressed mRNA network are implicated in insulin signaling in the cortex of 10-month-old Tg2576 mice. [score:3]
The miR-200 family was upregulated in the cortices of 10-month-old Tg2576 mice as compared with age-matched WT mice in the microarray analysis. [score:3]
0196929.g002 Fig 2Suppressive effect of miR-200b and miR-200c on Aβ generation in vitro. [score:3]
The reduction in S302/307 and S1097/1101 phosphorylation suggests that S6K1 is a target of miR-200b and/or miR-200c. [score:3]
We used ZEB1, which has been shown to be a target for miR-200b and miR-200c, as a positive control in these experiments. [score:3]
In this study, we investigated the function of the miR-200 family, the upregulation of which may represent an innate defense response rather than being the result of Aβ -induced toxicity. [score:2]
Predictably, the inhibitory effects on each gene were low, although significant differences were observed in ZEB1 and S6K1 levels in SH-SY5Y cells transfected with miR-200b and miR-200c compared to NC (Fig 4B). [score:2]
Given that S6K1 is a target of miR-200b and/or miR-200c, we evaluated its downstream regulation. [score:2]
MiR-200b and/or miR-200c may play a defensive role with regard to intracellular Aβ production, as well as extracellular Aβ -induced toxicity by promoting insulin signaling. [score:1]
This finding suggests that miR-200c in part contributes to the promotion of insulin signaling through the PI3K/mTOR pathway. [score:1]
The levels of S6K1 were somewhat decreased in miR-200c -transfected cells. [score:1]
The list of immunoprecipitated (IP) genes were two-fold greater in SH-SY5Y cells transfected with miR-200b or miR-200c than in NC cells (t-test; p < 0.05). [score:1]
We observed that S6K1 -dependent phosphorylation of IRS1 on S307 and S1101 was diminished in SH-SY5Y cells treated with miR-200b and miR-200c. [score:1]
Effects of miR-200b and miR-200c on Aβ -induced toxicity in vivoIn order to evaluate the inhibitory effect of miR-200b/c on Aβ -induced toxicity in vivo, the spatial memory of oAβ injected mice was tested using the Barnes maze. [score:1]
S1 TableThe list of immunoprecipitated (IP) genes were two-fold greater in SH-SY5Y cells transfected with miR-200b or miR-200c than in NC cells (t-test; p < 0.05). [score:1]
The activities of all of these were significantly reduced by miR-200b and/or miR-200c transfection (Fig 4A). [score:1]
These findings suggest that miR-200b and miR-200c have defensive roles against Aβ -induced toxicity. [score:1]
S6K1 -dependent serine phosphorylation of IRS-1. S6K1 -dependent serine phosphorylation of IRS1 in SH-SY5Y cells transfected with miR-200b and miR-200c. [score:1]
Effect of miR-200b and miR-200c on Aβ -induced toxicity in vitro. [score:1]
images showed that S6K1 -dependent phosphorylation of IRS-1 on S307 and S1101, but not IRS-1 itself, were decreased in miR-200b- and miR-200c -transfected SH-SY5Y cells (Fig 5). [score:1]
Effects of miR-200b and miR-200c on Aβ -induced toxicity in vivo. [score:1]
[1 to 20 of 48 sentences]
24
[+] score: 140
Furthermore, qPCR was performed again to validate the downregulated and upregulated expression of selected miRNAs that may be relevant to development and confirmed that miR-135, miR-302, miR-449a, miR-200b, miR-200c, miR-193b, miR-130, and miR-141 were downregulated, whereas miR-10a, miR-181, and miR-470 were upregulated by RA treatment (Fig 4C and 4D). [score:16]
Moreover, miR-200b and miR-200c expression antagonized RA -induced differentiation, whereas inhibition of miR-200b and miR-200c expression enhanced RA -induced suppression of the pluripotency genes Oct4 and Nanog and promoted RA -induced Nestin upregulation. [score:12]
Representative miRNAs that were downregulated after treatment with 1 μM RA for 24 h. (E, F, and G) MiR-200a, miR-200b, and miR-200c relative expression levels after transfection with the expression vector PCDH-miR-200b or PCDH-miR-200c for 48 h. (H) qPCR revealed enhanced Oct4 and Nanog expression levels after transfection with the expression vectors PCDH-miR200a, PCDH-miR200b, or PCDH-miR200c for 48 h (without RA). [score:12]
To provide further confirmation that deficiency of miR-200b or miR-200c caused mESCs differentiation, mESCs were transfected with the expression vector for miR-200b or miR-200c and 24 h later treated with RA for an additional 24 h. Both qPCR and western blotting indicated that miR-200b/200c antagonized RA -induced Nestin upregulation (Fig 5H and 5I) as well as Oct4 and Nanog downregulation in mESCs (Fig 5G and 5I). [score:9]
We chose members of the miR-200 family, miR-200a, miR-200b, and miR-200c because these are abundantly expressed in mESCs and demonstrated that upregulation of miR-200b or miR-200c increased the expression of two key embryonic stemness genes Oct4 and Nanog, thereby promoting pluripotency [65]. [score:8]
From the significantly altered miRNAs, we examined the roles of two pluripotency -associated miRNAs, miR-200b and miR-200c [43], and further confirmed that RA partially induced mESC differentiation by inhibiting miR-200b and miR-200c expression, which in turn led to the downregulation of pluripotency genes that normally serve to retard differentiation into ectoderm germ cells. [score:8]
To test this idea, we transfected mESCs with the miR-200b inhibitor or miR-200c inhibitor and verified the effect of the inhibitor by q-PCR (Fig 5A and 5B). [score:7]
Thus, downregulation of the expression of miR-200b or miR-200c promoted the differentiation of mESCs. [score:6]
miR-200c targets a NF-kappaB up-regulated TrkB/NTF3 autocrine signaling loop to enhance anoikis sensitivity in triple negative breast cancer. [score:6]
Retinoic acid inhibited the pluripotency of stem cells by supressing the expression of miR-200b and miR-200c. [score:5]
In this mo del, RA treatment inhibited miR-200 family expression. [score:5]
These observations strongly suggest that the two important stemness markers, Nanog and Oct4, were regulated by RA through its repression of miR-200b/c expression, and miR-200b and miR-200c play vital roles in RA -induced differentiation of mESCs. [score:4]
The relative levels of Sox2 (A) and Klf4 (B) detected by western blot after miR-200b and miR-200c expression vectors into J1 ES cells for 24 h and treatment with RA for an additional 24 h. (TIF) Click here for additional data file. [score:3]
Loss of AP activity confirmed the differentiation of mESCs and loss of pluripotency after transfection of miR-200b and miR-200c inhibitors (Fig 5F). [score:3]
Retinoic acid -induced differentiation is mediated by the suppression of miR-200b and miR-200c. [score:3]
Thus, miR-200b and miR-200c are RA-modulated miRNAs that control changes in downstream gene expression patterns required for RA -induced differentiation. [score:3]
The relative levels of Sox2 (A) and Klf4 (B) detected by western blot after miR-200b and miR-200c expression vectors into J1 ES cells for 24 h and treatment with RA for an additional 24 h. (TIF) Fold change values were provided in comparison with J1 mESCs treated by DMSO. [score:3]
To further clarify the miR-200b/c roles in RA -induced differentiation, we used an inhibitor of miR-200b and miR-200c to substitute the RA -induced deficiency. [score:3]
The pri-miRNA miR-200a, miR-200b and miR-200c were amplified from the J1 genome and were inserted into the multiple cloning site (MCS) of the expression vector pCDH-CMV-MCS-EF1-copGFP (System Biosciences, CA, USA). [score:3]
In particular, miR-200b and miR-200c play vital roles in RA -induced differentiation of mESCs by suppressing genes associated with the maintenance of pluripotency. [score:3]
Our data demonstrated that the expression of miR-200b and miR-200c antagonized RA -induced differentiation in mESCs, consistent with the observation that miR-200b/200c deficiency in mESCs promoted differentiation in the absence of RA. [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
We constructed expression vectors for miR-200a,miR-200b, and miR-200c (Fig 4E, 4F and 4G). [score:3]
The miR-200 family is considered essential for tumor development by regulating epithelial transition [63]. [score:2]
The microRNA-200 family regulates epithelial to mesenchymal transition. [score:2]
Therefore, we concluded that RA induced the differentiation of mESCs by repressing miR-200b and miR-200c factors essential for maintaining the pluripotency of mESCs. [score:1]
We found that repressed miR-200b and miR-200c could reduce the pluripotency of mESCs in the absence of RA. [score:1]
Moreover, AP activity was maintained upon RA -treated mESCs transfected with miR-200b or miR-200c (Fig 5J). [score:1]
We conclude that RA induced mESC differentiation by repressing miR-200b and miR-200c factors is essential for maintaining the pluripotency of mESCs. [score:1]
Let-7 and miR-200 microRNAs. [score:1]
[1 to 20 of 30 sentences]
25
[+] score: 138
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-200a
In conclusion, we verified that TAM up-regulates miR-200c expression in mesenchymal TNBC cell lines MDA-MB-231 and MCF-7/ADR, by downregulating DNMT expression, thus attenuating cell migratory capacities in vivo and in vitro. [score:11]
These results imply that TAM regulate miR-200c expression by downregulating DNMT expression. [score:9]
Therefore, TAM can apparently reverse EMT by downregulating DNMTs, thus increasing miR-200c expression. [score:6]
Our results indicate that TAM inhibits cell migration and enhances chemosensitivity of mesenchymal TNBC cells by reversing their EMT-like property; and that this EMT-reversal effect results from upregulation of miR-200c through demethylating its promoter. [score:6]
Data were expressed as mean ± SD (n = 3), * P < 0.05; d, Relative expressions of miR-200c cells in MDA-MB-231 cells treated with or without 5aza for 72 h determined by realtime -PCR. [score:5]
b, Western blot analysis showed the expression of DNMT1 and DNMT3a in MCF-7/ADR and MDA-MB-231 cells treated with or without TAM for 48 h. c, MCF-7/ADR cells were transfected with either NC or si-DNMT1 or si-DNMT3a or si-DNMT1 and si-DNMT3a for 48 h; Relative expressions of miR-200c were determined by realtime-PCR in indicated cells. [score:5]
Our result showed that double knockdown of DNMT1 and DNMT3a also upregulated miR-200c, which confirmed the relationship between miRNA and hypermethylation. [score:5]
miRNA array analysis of two types of breast cancer cells showed that miR-200c expression was inhibited in mesenchymal TNBC cells, but increased after TAM treatment due to demethylation of miR-200c promoters. [score:5]
After TAM treatment, DNMT expression decreased and miR-200c expression increased in TNBC cells. [score:5]
However, after treatment with 5 μmol/L TAM for 48 h, miR-200c expression restored in the mesenchymal MCF-7ADR cells; this treatment did not affect miR-200c expression in non-TNBC cells MCF-7 (Fig. 4d). [score:5]
Tryndyak VP Beland FA Pogribny IP E-cadherin transcriptional down-regulation by epigenetic and microRNA-200 family alterations is related to mesenchymal and drug-resistant phenotypes in human breast cancer cellsInt J Cancer. [score:4]
Reciprocally, the process of EMT could also regulate miR-200c expression [17]. [score:4]
To evaluate the demethylation effect on miR-200c expression, we examined miR-200c expression after treatment with 5-azacytidine (5-AZA), a specific inhibitor of DNA methylation, for 72 h. Quantitative real-time PCR revealed that the relative fold change of miR-200c was 2.23 ± 0.67 -fold after treatment with 5-AZA for 3 days, compared with negative control, using MDA-MB-231 cells (P < 0.05; Fig. 5d). [score:4]
The result was consistence with the research of Vrba, et al. who also showed the important role of DNA methylation in regulating miR-200c expression and the control of phenotypic conversions in cancer cells [44]. [score:4]
Together, these data suggested that TAM increased miR-200c by partially inhibition of DNMT1 and DNMT3a to reverse EMT in mesenchymal TNBC cells. [score:3]
We also verified the existence of CpG islands in miR-200c promoters, and high expression of DNMTs in mesenchymal TNBC cells. [score:3]
Expression and methylation status of miR-200 might be useful as markers for EMT in breast cancer [43]. [score:3]
Compared with scrambled siRNA control cells, knockdown of DNMT1 and DNMT3a significantly increased the miR-200c expression (Fig. 6c), accompanying with decreased vimentin and increased E-cadherin in MDA-MB-231 and MCF-7/ADR cells (Fig. 6d). [score:3]
To confirm that miR-200c is regulated by DNMTs, we used siRNAs to double-knock DNMT1 and DNMT3a. [score:3]
This prediction indicated that miR-200c expression might be affected by demethylation of its promoters. [score:3]
These results suggested that 5-AZA also reversed EMT via increased miR-200c expression, and decreased migration ability in TNBC cells. [score:3]
Consistent with a recent report [22], miR-200c expression, which is commonly acknowledged to affect EMT, showed dramatic difference between the two cell lines. [score:3]
d, Relative expression of miR-200c cells in MCF-7 and MCF-7/ADR cells treated with or without TAM for 48 h determined by realtime-PCR. [score:3]
Sequence analysis of miR-200c promoters revealed the presence of a highly-expressed CpG island upstream of the miR-200c cluster (blue, Fig. 5a). [score:3]
The reported role of the miR-200 family as EMT inhibitors, to reduce tumor cell migration was confirmed by our microarray analysis [39]. [score:3]
MiR-200c could promote breast cancer cell epithelial identity, and repress related genes that regulate E-cadherin and cell polarity [40], and reportedly regulates the EMT process directly, thus affecting chemosensitivity [17]. [score:3]
c, Relative expression of miR-200c in MCF-7 and MCF-7/ADR cells determined by realtime-PCR. [score:3]
b, Relative expression of miR-200c in MCF-7 and MCF-7/ADR cells determined by microarray analysis. [score:3]
Fig. 4TAM reversed EMT by up -regulating miR-200c of mesenchymal TNBC cells. [score:2]
TAM reversed EMT by up -regulating miR-200c. [score:2]
However, to our knowledge, this is the first report of the mechanism of how TAM regulates miR-200c. [score:2]
Consistent with the microarray analysis result, the relative fold change was 34.508-fold in MCF-7 cells in the expression of miR-200c compared with MCF-7/ADR cells (Fig. 4c). [score:2]
Relative fold change was 128.6-fold in MCF-7 cells in the expression of miR-200c compared with MCF-7/ADR cells (Fig. 4b). [score:2]
The promoter sequence of miR-200c was predicted by an online. [score:1]
a, An online was used to detect the CpG islands of 3000 bp of miR-200c promoter sequence, upstream of the miR-200c cluster. [score:1]
These results suggested that TAM could induce increased miR-200c in mesenchymal TNBC cells. [score:1]
Fig. 5Promoter region of miR-200c were hypermethylated in TNBC cells. [score:1]
Relative expression of miR-200c was measured by quantitative real-time PCR. [score:1]
The miR-200c promoter region used an island size of 3000 nucleotides, a GC percentage of at least 50% and an observation/expectation CpG ratio of more than 0.6. [score:1]
As DNA methylation can change promoter activity [42], we used online software to predict the methylation status of miR-200c promoters. [score:1]
miR-200c promoter regions were hypermethylated in TNBC cells. [score:1]
[1 to 20 of 41 sentences]
26
[+] score: 117
Other miRNAs from this paper: mmu-mir-141, mmu-mir-146a, mmu-mir-200b, mmu-mir-200a, mmu-mir-429
miR-200a/200b mimics inhibit HG -induced endothelial OGT expression, protein O-GlcNAcylation, and inflammatory phenotypesTo examine the potential regulation of OGT expression by the miR-200 family, transfection assays with 200a/200b mimics or inhibitors were performed to determine whether miR-200a/200b mimics modulates OGT gene expression. [score:11]
To determine whether HG -induced downregulation of miR-200 members also modulates ZEB-1 gene expression, we examined the effects of HG on ZEB-1 expression. [score:8]
To examine the potential regulation of OGT expression by the miR-200 family, transfection assays with 200a/200b mimics or inhibitors were performed to determine whether miR-200a/200b mimics modulates OGT gene expression. [score:7]
Interestingly, the miR-200 family members were not predicted to bind to the mouse ICAM-1 3′-UTR; however, our results show that miR-200a/200b mimics significantly attenuated endothelial ICAM-1 expression, suggesting that ICAM-1 expression was indirectly regulated by miR-200a/200b mimics in the db/db diabetic mice. [score:7]
miR-200c is upregulated by oxidative stress and induces endothelial cell apoptosis and senescence via ZEB1 inhibition. [score:6]
The transcriptional inhibitor ZEB-1 is a well-known target of the miR-200 family members through a reciprocal repression mechanism to promote epithelial-mesenchymal transition and cancer invasion (Burk et al., 2008). [score:5]
While we did not investigate the role of miR-141 and miR-200c/429 in regulating OGT expression, it is possible that all members of the miR-200 family can regulate OGT expression, as they have the same seed sequence as either miR-200a or miR-200b. [score:5]
Inhibition of miR-200c restores endothelial function in diabetic mice through suppression of COX-2. Diabetes 65, 1196– 1207. [score:5]
The miR-200 family is now known to play an inhibitory role in cancer progression because of the strong suppressive effects of its members on cell transformation, migration, proliferation, invasion, and metastasis (Humphries and Yang, 2015). [score:5]
Belgardt et al. reported that β-cell specific overexpression of miR-200 family induced β-cell apoptosis and type 2 diabetes, whereas miR-200 family knock-out reduced β-cell apoptosis and improved type 2 diabetes symptoms (Belgardt et al., 2015). [score:4]
However, this study confirmed that the miR-200 family is dysregulated in HG-stimulated HAECs, and both in vitro and in vivo experiments revealed that miR-200a/200b have therapeutic potential in treating diabetic vascular disease. [score:4]
Magenta and colleagues reported that miR-200 family members were increased in H [2]O [2]-stimulated human umbilical endothelial cells, which play a critical role in ROS -mediated senescence and apoptosis by downregulating the zinc-finger E-box binding homeobox 1 (ZEB-1) (Magenta et al., 2011). [score:4]
Similarly, HG stimulation for 24 h caused a significant decrease in the miR-200a, miR-141, miR-200b, miR-200c, and miR-429 expression levels to 27, 18, 39, 71, and 39%, respectively, of the levels in the unstimulated control. [score:3]
As shown in Figure 2B, real-time PCR analyses showed that HG stimulation for 12 h resulted in a significant decrease in miR-200a, miR-141, miR-200b, miR-200c, and miR-429 expression levels to 53, 38, 11, 42, and 33%, respectively, of the levels in the unstimulated control. [score:3]
These findings suggest that the miR-200 family has cytoprotective roles, consistent with its role as a tumor suppressor. [score:3]
non-diabetic samples), suggesting that the miR-200 family has various roles in inflammation -associated diseases, including diabetes. [score:3]
Moreover, they noted that a miR-200c mimic impaired endothelial -dependent relaxation in the non-diabetic mouse aorta, whereas an miR-200c inhibitor enhanced endothelial -dependent relaxation in the diabetic db/db mice (Zhang et al., 2016). [score:3]
Zhang et al. reported that miR-200c expression was increased in the diabetic mouse aorta and HG-stimulated mouse aortic endothelial cells. [score:3]
Furthermore, downregulation of miR-200 family members in the HG-stimulated HAECs can modulate the expression levels of ZEB-1. To investigate whether miR-200a/200b can interact with the 3′-UTR of OGT mRNA, we performed a luciferase reporter assay. [score:3]
The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. [score:2]
The microRNA-200 family regulates pancreatic beta cell survival in type 2 diabetes. [score:2]
All members of the miR-200 family were showed homology with the 3′-UTR of human OGT mRNA in their seed sequences (Figure 2A), indicating potential regulation of OGT by miR-200 members. [score:2]
Similarly, 24 h HG stimulation decreased miR-200a, miR-141, miR-200b, miR-200c, and miR-429 expression levels to 27, 18, 39, 71, and 39% of the control level, respectively N = 5. ** p < 0.01 and *** p < 0.001 compared with control. [score:2]
There is conflicting evidence regarding the regulatory role of miR-200 family members in diabetes. [score:2]
Particularly, members of the miR-200 family are highly sensitive to ROS. [score:1]
A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells. [score:1]
The five known miR-200 members are located on two chromosomes (chromosome 12: miR-141 and miR-200c; chromosome 1, miR-200a, miR-200b, and miR-429) and are highly conserved in higher vertebrates (Gheldof et al., 2012). [score:1]
MicroRNA-200 is induced by thioredoxin-interacting protein and regulates Zeb1 protein signaling and beta cell apoptosis. [score:1]
However, the miRanda-mirSVR database identified all five miR-200 family members as potential binding partners of the mouse Ogt 3′-UTR. [score:1]
Based on manual sequence alignment, both human OGT and mouse Ogt 3′-UTRs share an identical nucleotide sequence (5′-AGUAUU-3′) that is complementary to the seed sequence of miR-200 functional group 2, suggesting that human OGT 3′-UTR also binds to miR-200b/200c/429, similar to mouse Ogt. [score:1]
In this study, web -based bioinformatics analysis using miRanda-mirSVR and miRDB database revealed that the members of the miR-200 functional group 1, but not of group 2, may bind to the 3′-UTR of human OGT mRNA. [score:1]
In contrast, the miR-200 family has also been reported to have protective effects. [score:1]
However, reports of miR-200 family members in diabetes -associated studies are conflicting. [score:1]
The microRNA-200 family: still much to discover. [score:1]
The miR-200 family has been reported to have a detrimental effect. [score:1]
Although ROS is involved in modulating the miR-200 family and protein O-GlcNAcylation, the interplay between these factors is not clear. [score:1]
Nanoparticle -mediated miR200-b delivery for the treatment of diabetic retinopathy. [score:1]
P160801-000 H20; miR-200c: Cat No. [score:1]
Some studies showed that miR-200 family members have harmful effects on diabetes progression (Filios et al., 2014; Belgardt et al., 2015), diabetes -induced inflammation (Reddy et al., 2012), and diabetes -induced endothelial dysfunction (Zhang et al., 2016), while others showed that members of the miR-200 family have protective effects because of their anti-inflammatory (McArthur et al., 2011) and anti-fibrotic properties (Wei et al., 2014). [score:1]
[1 to 20 of 39 sentences]
27
[+] score: 116
Cumulatively, our study provided the first evidence that: (1) DOXO promotes a compensatory response in human CmPC by the CXCR4 upregulation, making this cardiac mesenchymal subpopulation more prone to respond to SDF1 protective stimuli; (2) DOXO induces the upregulation of miR-200c which, in turn, downregulates ZEB1; 3) ZEB1 binds to the CXCR4 promoter repressing its expression (Supplementary Fig. S4); (4) the activation of the SDF1/CXCR4 axis is protective both in vivo and in vitro against the adverse cardiac events induced by DOXO; (5) SDF1 treatment is able to rescue cardiac dysfunction via a miR-200c/ ZEB1/p53 pathway modulation. [score:12]
We have previously demonstrated that p53 is necessary for miR-200c upregulation by oxidative stress in EC [24] and DOXO treatment is known to induce p53 and oxidative stress; [29] in keeping, we found that ZEB1 protein was downregulated 24 h after DOXO treatment, a time point at which p53 protein expression was upregulated (Figures 4c and d). [score:12]
Since DOXO cardiotoxicity has been ascribed to oxidative stress and DNA damage, we tested the possibility that DOXO could affect the expression of miR-200c and its target protein ZEB1, that our group demonstrated to be modulated by oxidative stress and to stimulate apoptosis and senescence of HUVECs via the upregulation of miR-200c and the downregulation of ZEB1. [score:11]
[41] Notwithstanding acute upregulation of miR-200c ultimately leads to CXCR4 upregulation and consequent SDF1 -induced amelioration of cardiotoxicity, chronic upregulation of miR-200c might be one of the leading causes for the establishment of DOXO -induced apoptosis and senescence. [score:10]
Further, our results proved that miR-200c upregulation and the concomitant inhibition of its target ZEB1 is implicated in the increased expression of CXCR4. [score:10]
[41] In this study the mechanism of CXCR4 upregulation involved another transcription factor targeted by the miR-200 family that is Zinc-Finger-E-Box-Binding-Homeobox-2 (ZEB2), which also binds to and inhibits E-boxes. [score:8]
Moreover, we tested the mRNA expression levels of ZEB1 and we observed that, inversely to miR-200c, ZEB1 mRNA was downregulated by DOXO and returned to control levels in DOXO+SDF1 -treated mice (Figure 8b). [score:6]
Moreover, our results indicated that in LV specimens of mice treated with SDF1+DOXO there is a decrease of miR-200c and p53 upregulation caused by DOXO and a restoration of ZEB1 expression, explaining SDF1 positive effect also via the modulation of this molecular pathway. [score:6]
Conversely, the mRNA level of the miR-200c target ZEB1 was downregulated (Figure 4b). [score:6]
[24] Recently, we demonstrated that miR-200c upregulation is responsible of reactive oxygen species production and nitric oxide decrease by targeting three important proteins involved in endothelial function (i. e., Sirtuin1, endothelial nitric oxide synthase and Forkhead box O1), further supporting a role for this miRNA in cardiotoxicity. [score:6]
[24]We found that miR-200c was upregulated after 24 h of DOXO treatment (Figure 4a). [score:4]
[24] Since DOXO is known to induce p53 and oxidative stress, [29] the upregulation of miR-200c was expected. [score:4]
We have previously showed that p53 is necessary for miR-200c upregulation by oxidative stress in EC. [score:4]
[24] We found that miR-200c was upregulated after 24 h of DOXO treatment (Figure 4a). [score:4]
In keeping with this, the upregulation of CXCR4 by the miR-200 family was already reported in mouse embryonic stem cells upon nitric oxide treatment. [score:4]
In fact, we previously demonstrated that oxidative stress inducing miR-200c causes ZEB1 downregulation which enhances apoptosis and senescence in EC and in different cell types. [score:4]
Interestingly, SDF1 treatment upon DOXO significantly reduced miR-200c levels (Figure 8a). [score:1]
Doxorubicin modulates miR-200c/ZEB1 pathway in CmPC. [score:1]
We successively asked whether SDF1 cardioprotection was due to the modulation of miR-200c/ZEB1/p53 pathway. [score:1]
Moreover, we demonstrated a novel implication of miR-200c/ZEB1 pathway in response to DOXO. [score:1]
SDF1 partially rescues DOXO -dependent cardiac dysfunction via a miR-200c/ ZEB1/p53 pathway modulation. [score:1]
[1 to 20 of 21 sentences]
28
[+] score: 116
In order to confirm that miR-200 family miRNAs and miR-182/96/183 family miRNAs are involved in ULM and/or ULM-related gene expression, we compiled a list of potential targets of these miRNAs in various ULM mRNAs using three computational target prediction programs: TargetScan (www. [score:9]
Effect of inhibition or overexpression of the miR-200 family and the miR-182 family miRNAs on OGD -induced cell death in SHSY5Y cells. [score:5]
The results strongly suggest that theses predicted target sites are real and SUMO and other ULM mRNAs are indeed targeted and controlled by the miR-200 family and the miR-182 family miRNAs. [score:5]
We found quite a few potential target sites for miR-200 and miR-141, and some for miR-182/183/96 in SUMO-related genes and other ULMs as shown in Table 2. miRNA::mRNA target prediction is based on assumptions of certain values for temperature, salt and other conditions and the results are all too often dependent on the algorithm employed by each tool. [score:5]
html) We have established that the miR-200 family and the miR-182 family miRNAs target SUMO and other ULMs, and that inactivation of these miRNAs increases both global SUMOylation and global conjugation of other ULMs resembling the changes in posttranslational modifications that have been noted in ground squirrels during hibernation torpor. [score:5]
We have established that the miR-200 family and the miR-182 family miRNAs target SUMO and other ULMs, and that inactivation of these miRNAs increases both global SUMOylation and global conjugation of other ULMs resembling the changes in posttranslational modifications that have been noted in ground squirrels during hibernation torpor. [score:5]
Human neuroblastoma SHSY5Y cells were transfected with miRNAs (miR200c, miR183, miR182, miR141, miR-96) mimics or inhibitors (Thermo Scientific Dhamacon miRIDIAN microRNA Mimics & Hairpin Inhibitors) using Lipofectamine RNAimax (Invitrogen). [score:5]
In order to examine whether some (if not all) of these predicted target sites are really recognized by either miR-200 family or miR-182/183/96 family miRNAs, we made firefly luciferase reporter constructs containing individual predicted target sequences for the miRNAs of interest. [score:5]
We could confirm that miR-200, miR-182, miR-183, miR-141, miR-96, miR-122 and miR-429 were indeed down regulated, and miR-34 and miR-206 were upregulated during hibernation torpor (Fig. 2B). [score:5]
We also show in SHSY5Y cells that inhibition of miR-200 family and/or miR-182 family miRNA activity makes cells more tolerant to oxygen/glucose deprivation (OGD), perhaps via an increase in post-translational modification of cellular proteins by various ULM species. [score:5]
The roles of miR-200 family and miR-182 family miRNAs, which we found to be down-regulated during hibernation torpor, have been examined in various areas of research, especially cancer, but the studies have generally been correlational. [score:4]
As a non- cancer related function, miR-200c was reported to be upregulated by oxidative stress and to induce endothelial cell apoptosis and senescence [27]. [score:4]
Conversely, the endogenous level of miR-200c is very low, so the apparent fold inhibition is low, but the fold increase by its specific mimic is huge. [score:3]
We transfected SHSY5Y cells with inhibitors or mimics for several miR-200 family and the miR-182 family miRNAs (miR-200c, miR-141, miR-182, miR-183 and miR-96) in duplicate plates, incubated them for 2 days, and subjected one plate of cells to OGD, and the other plate of cells to normal culture conditiions as a control. [score:3]
Interestingly, SHSY5Y cells became more tolerant to OGD -induced cell death when activities of miR-200 family and/or miR-182 family miRNAs were inhibited (Fig. 6B), and more sensitive when mimics of these miRNAs were transfected (Fig. 6B). [score:3]
Effect of miRNA inhibitors and mimics for miR-200 family and miR-182 family members on ULM conjugation levels in SHSY5Y cells. [score:3]
Cells transfected with miRNA inhibitors, especially miR-200 family (miR-200c and miR-141) showed much far less cell death (Fig. 6B), but cells transfected with miRNA mimics, especially from the miR-182 family, caused more cell death (Fig. 6B). [score:3]
miR-200 family and miR-182 family members of miRNAs indeed target various ULM and/or ULM related genes. [score:3]
Effects of inhibitors and mimics for miR-200 family and miR-182 family miRNAs on OGD -induced cell death in SHSY5Y. [score:3]
The DNA sequences of target sites for miR-200 family and/or miR-182 family miRNAs in each gene are shown in the supplemental materials (Table S2). [score:3]
Identification of potential targets of miR-200 family and miR-183/96/182 family miRNAs in ULMs and/or ULM-related genes. [score:3]
Roh's group [37] reported that miR-200 family and miR-182 family miRNAs increased at 3 hrs after an ischemic preconditioning (15 min transient focal cerebral ischemia) in mice and that overexpressing these miRNAs made mouse neuroblast cells (Neuro-2a) more resistant to OGD (16 h). [score:3]
25Gravgaard KH, Lyng MB, Laenkholm AV, Sokilde R, Nielsen BS, et al. (2012) The miRNA-200 family and miRNA-9 exhibit differential expression in primary versus corresponding metastatic tissue in breast cancer. [score:3]
The clear increase in expression of miR-200 and miR-182 family miRNAs at the 3 hour timepoint may have reflected the sublethal ischemic stress that induces ischemic tolerance, but at the times that OGD tolerance was tested, these miRNA levels may well have been depressed. [score:3]
These results suggest that inhibiting miR-200 family and miR-182 family miRNAs does protect SHSY5Y cells from OGD -induced cell death. [score:3]
0047787.g003 Figure 3 (A) SHSY5Y cells were transfected with hairpin inhibitors for human miR-200c, miR-182, miR-183 and miR-141 individually, the levels of these miRNAs were measured by qPCR, and expressed relative (fold change) to endogenous levels. [score:3]
We also report that two miRNA families, miR-200 family (miR-200a/miR-200b/miR-200c/miR-141/miR-429) and miR-182 family (miR-182/miR-183/miR-96), which were consistently lower in the brain samples from torpor phase ground squirrels compared to active animals, are involved in expression of various ULM proteins and their global protein conjugation. [score:2]
Of these families, miR-200 had the greatest number of differentially regulated members (n = 48) and the largest magnitude difference between means of the LH and ACR states (Δ = −3.04). [score:2]
In particular, two miRNA families, the miR-200 family (miR-200a, b, c, miR-496, and miR-141) and the miR-182 family (miR-182, miR-183 and miR-96) were consistently down regulated during torpor phase. [score:2]
MiR-182, miR-96, miR-200, miR-183 and miR-141 were among the most highly regulated miRNAs with a 13∼20-fold decrease during the torpor phase of the hibernation cycle. [score:2]
From the results of our microRNA array study of ground squirrel brain (comparing active and torpor phase), we found that most miRNAs were unchanged or increased during torpor phase, but certain miRNAs such as miR-200 family (miR-200a, -200b, -200c, -141, -429) and miR-182 family (miR-182, -183, -96) miRNAs were consistently decreased (Fig. 2A and Table S1). [score:1]
We wondered whether the tolerance to in vitro “ischemia” by OGD in cultured cells (e. g. SHSY5Y) would change if miR-200 family and/or miR-182 family miRNA activity levels were reduced or increased. [score:1]
The order of endogenous levels of the microRNAs tested in SHSY5Y cells is miR-182>>miR-141≥miR-183>miR-200c. [score:1]
Close relationships of miR-200 family miRNAs with cancer cell invasion or cancer metastasis have been reported repeatedly [23]- [26]. [score:1]
[1 to 20 of 34 sentences]
29
[+] score: 107
Following the knockdown of DCLK1, miR-200 miRNAs were upregulated and resulted in inhibition of its downstream targets (EMT-transcription and angiogenic factors). [score:9]
siRNA -mediated knockdown of DCLK1 in BxPC-3 cells results in decreased expression of miR-200a, miR-200b and miR-200c (A), decreased expression of ZEB1 and ZEB2 (B), and decreased expression of VEGFR1 and VEGFR2 (C). [score:8]
Furthermore, it was found that overexpression of miR-200 family significantly inhibits the NOTCH pathway in pancreatic cancer cells, which suggests the NOTCH pathway may be one of the miR-200 targets [60]. [score:7]
Nevertheless, in this study, inhibition of DCLK1 results in inhibition of pluripotency markers and induction of miR-200 (EMT inhibitor) and thereby drives the cancer cells towards a differentiated state with reduced invasive properties. [score:7]
Similar to miR-200a, we observed a significant upregulation of miR-200b (1.5-fold) (Figure 5A) and miR-200c (2-fold) (Figure 5A) following the knockdown of DCLK1. [score:5]
Following the knockdown of DCLK1, there was a significant downregulation of miR-200a, miR-200b and miR-200c (Figure 5B) mediated luciferase activity. [score:5]
Figure S4 NPsiRNA -mediated knockdown of DCLK1 downregulates EMT transcription factors ZEB1, ZEB2 and angiogenic factors VEGFR1 and VEGFR2 via miR-200 in BxPC-3 cells. [score:5]
It has been demonstrated that miR-200 inhibits lung adenocarcinoma invasion and metastasis by targeting VEGFR1. [score:5]
These data taken together indicate that knockdown of DCLK1 inhibits EMT and invasion by regulating miR-200 in human pancreatic tumor xenografts and cancer cells. [score:5]
Here, we found DCLK1 regulating miR-200 and its downstream targets. [score:4]
DCLK1 negatively regulates miR-200 and inhibits EMT and invasion. [score:4]
We also observed a subsequent reduction of miR-200 downstream targets ZEB1 and ZEB2 (Figure 5C), SNAIL and SLUG (Figure 5D) following the knockdown of DCLK1 in pancreatic tumor xenografts. [score:4]
A, siRNA -mediated knockdown of DCLK1 results in increased expression of pri-miR-200a, pri-miR-200b and pri-miR-200c by real-time RT-PCR. [score:4]
These data indicate that DCLK1 regulates miR-200 and its downstream targets in PDAC. [score:4]
0073940.g005 Figure 5DCLK1 negatively regulates miR-200 and inhibits EMT and invasion. [score:4]
The let- 7 and miR-200 families are well-known regulators of key differentiation programs during development. [score:3]
These data indicate that VEGFR1 and VEGFR2 are downstream targets of miR-200. [score:3]
Recently, a number of reports have identified the microRNA (miRNA) miR-200 family as fundamental markers and regulators of EMT [10– 12]. [score:2]
A putative binding site for miR-200 was observed in the 3’ UTR of VEGFR1, and it was demonstrated that miR-200 negatively regulates VEGFR1 [48]. [score:2]
DCLK1 regulates miR-200 family genes and EMT in pancreatic cancer. [score:2]
The studies presented clearly implicate DCLK1 in the regulation of miR-143/145, miR-200, EMT, pluripotency, angiogenesis, NOTCH1, and cancer stemness. [score:2]
B, Following the knockdown of DCLK1, a decrease in miR-200a, miR-200b and miR-200c dependent luciferase activity was observed in AsPC-1 cells. [score:2]
Next, we wanted to investigate whether DCLK1 regulates the downstream targets of miR-200. [score:2]
Loss of let- 7 in cancer results in progression and dedifferentiation, and the miR-200 family has been shown to be a key regulator of EMT. [score:2]
Recent studies have demonstrated that miR-200a, b and c (miR-200) are known to regulate EMT and angiogenesis [48]. [score:2]
These data taken together indicate that DCLK1 regulates VEGFR1 and VEGFR2 via miR-200 in PDAC. [score:2]
Similarly in AsPC-1 tumor xenografts, a 2-fold induction of pri-miR-200 a (p < 0.01) (Figure 5A) was observed. [score:1]
Moreover, alteration of the miR-200 family has been found to be associated with the NOTCH signaling pathway in pancreatic CSCs. [score:1]
Based on previous studies and computational analysis of the 3’ UTR of VEGFR1 and VEGFR2, we observed a putative binding site for miR-200 (miR-200a, b and c) [48, 49]. [score:1]
[1 to 20 of 29 sentences]
30
[+] score: 106
: primary mouse or human keratinocytes were transfected with miR-200c mimic or negative control RNA and allowed to migrate for 48 hours (n = 3; mean ± SE; **p < 0.001; Wilcoxon rank sum test); (e): primary mouse keratinocytes transfected with miR-200c inhibitor exhibited accelerated migration compared to the negative control (n = 3; mean ± SD; *p < 0.05; Student’s t test); (f) RT-qPCR: Accelerated wound closure induced by anti-miR-200c is associated with upregulation of genes controlling cell migration, including Zeb1, Srf, Clic4, Rac1, Met in mouse keratinocytes treated with miR-200c inhibitor (n = 3; mean ± SD; *p < 0.05; Student’s t test); (g) Ca [2+] -induced differentiation in mouse primary keratinocytes; increase in the expression of miR-200c 48 hours after Ca [2+] treatment (n = 3, mean ± SD; **p < 0.01; Student’s t test); (h) Ca [2+] -induced differentiation in human keratinocytes; increase in the expression of miR-200c at 48 h and 72 h after Ca [2+] treatment (n = 3, mean ± SD; **p < 0.01; Student’s t test); (i) Ca [2+] -induced differentiation in mouse keratinocytes; downregulation of Loricrin and Involucrin expression in primary mouse keratinocytes transfected with miR-200c inhibitor 48 hours after Ca [2+] treatment (n = 3, mean ± SD; *p < 0.05; Student’s t test). [score:18]
Transfection of mouse keratinocytes with miR-200c inhibitor resulted in decreased expression of differentiation -associated genes, such as Krt1, Lor and Ivl, while the expression of Krt14, a marker of undifferentiated keratinocytes, was not affected by miR-200c inhibition (Fig.   2g). [score:9]
Similar to in vivo observations, miR-200c expression was downregulated in both primary mouse and human keratinocytes during closure of scratch -induced wounds (Fig.   2a,b). [score:6]
Keratinocyte differentiation was induced in both primary mouse and human keratinocytes in vitro by their exposure to high calcium medium [45]; it was associated with significant upregulation in the expression of miR-200c (Fig.   2g,h). [score:6]
In addition to the transient upregulation of miR-200c during wound healing in aged mouse skin, miR-200c expression was significantly increased in the intact unwounded skin of 2-year-old mice in contrast to 8 week-old mice (Fig.   1e, Supplementary Table  2). [score:6]
All these genes have previously been shown to be involved in the control of cell migration during cutaneous wound healing 40– 43 and, more importantly, are potential target genes of miR-200c identified by the TargetScan software [44]. [score:5]
The miR-200 family consists of epithelial-specific miRNAs that are known to function as negative regulators of epithelial to mesenchymal transition (EMT) by targeting E-cadherin transcriptional repressors, zinc finger E-box -binding homeobox 1 (ZEB1) and ZEB2 [37]. [score:4]
Taken together, these data suggest that miR-200c can be involved in the regulation of different aspects of wound healing, sustaining keratinocyte differentiation and inhibiting their migration. [score:4]
miR-200c compromises wound healing in human ex vivo skinTo further demonstrate the inhibitory effects of miR-200c on skin repair induced by injury, a human ex vivo skin wound healing mo del was used as described before [48]. [score:3]
To further demonstrate the inhibitory effects of miR-200c on skin repair induced by injury, a human ex vivo skin wound healing mo del was used as described before [48]. [score:3]
Therefore, this experiment confirms that aberrant levels of miR-200c may indeed compromise wound healing by suppressing the process of re-epithelialisation. [score:3]
Therefore, the aberrant expression of miR-200c in the epithelial edges of chronic wounds (Fig.   1g) could have a negatively impact not only on keratinocyte migration, but may also interfere with their differentiation. [score:3]
In conclusion, our study for the first time 1) reports differences in the expression of miRNAs in young and aged mouse skin wounds that suggest involvement of various miRNAs in age -associated impairment in wound healing; 2) provides evidence about contribution of miR-31 to the delay in wound healing in aged skin; 3) identifies miR-200c as an important player in successful re-epithelialisation during cutaneous wound healing that can exert positive and negative effects on keratinocyte differentiation and migration, respectively. [score:3]
Transfections of the cells were performed using Lipofectamine RNAiMAX (ThermoFisher Scientific) using 100 nM miR-200c mimic (ThermoFisher Scientific), 200 nM inhibitor (Dharmacon) and corresponding negative controls according to the manufacturers’ protocol. [score:3]
The wound epithelium treated with miR-200c mimic exhibited reduced expression of Keratin 16, Keratin 17 and CD49f (Integrin, alpha 6), markers of keratinocyte migration (Fig.   3f,g,h). [score:3]
Our data suggest that the increased expression of miR-200c in aged skin could contribute to the impaired skin repair associated with ageing and might be implicated in the pathogenesis of chronic wounds. [score:3]
For BrdU analysis, the keratinocytes were seeded on collagen-coated sterile glass coverslips in a 6-well cell culture dish and transfected with miR-200c inhibitor or negative control RNA. [score:3]
Moreover, accelerated wound closure induced by anti-miR-200c in scratch assay was associated with upregulation of Zeb1, serum response factor (Srf), chloride intracellular channel 4 (Clic4), RAS-related C3 botulinum toxin substrate 1 (Rac1) and hepatocyte growth factor receptor (Met) (Fig.   2f). [score:3]
This fact makes miR-200 family members potential candidates for the regulation of re-epithelialisation during wound healing. [score:2]
miR-200c regulates keratinocyte migration and differentiation. [score:2]
miR-200c compromises wound healing in human ex vivo skin. [score:1]
Moreover, fluorescence-activated cell sorting (FACS) analysis of human immortalised keratinocytes, HaCaT cells, transfected with miR-200c mimic did not show any changes in proliferation in response to the increased levels of miR-200c (Supplementary Figure  1c). [score:1]
However, miR-200c mimic significantly reduced primary mouse and human keratinocyte migration in transwell assay (Fig.   2d), while inhibition of miR-200c in keratinocytes resulted in significant acceleration of their migration in scratch assay (Fig.   2e). [score:1]
Acute wounds were topically treated at the time of wounding with 50 μM of miR-200c mimic and corresponding scrambled control (Dharmacon) dissolved in 30% pluronic F-127 gel (Sigma) [13]. [score:1]
Next, we examined the involvement of miR-200c in keratinocyte differentiation. [score:1]
Twenty-four hours after cell seeding to the membrane in the upper chamber of the transwell insert, keratinocytes were transfected with miR-200c mimic or negative control RNA as described above. [score:1]
Similarly, miR-200c levels are higher in the human aged epidermis (Fig.   1f). [score:1]
Consistently, quantification of Ki-67 positive cells in the primary mouse keratinocytes 24 hours after transfection with miR-200c mimic also revealed no effect of miR-200c on keratinocyte proliferation (Supplementary Figure  1a,b). [score:1]
Thus, miR-200c can exert stimulatory effects on epidermal differentiation that is also known to be essential for proper wound healing. [score:1]
No significant difference in the proliferation rate was detected in anti-miR-200c treated and corresponding control groups in both mouse and human keratinocytes (Fig.   2c). [score:1]
There are multiple reasons to suggest that miR-200c may be involved in wound healing. [score:1]
Excisional wounds were treated with either miR-200c mimic or a scrambled control for 5 consecutive days (Fig.   3a). [score:1]
Possible effects of miR-200c on keratinocyte proliferation were evaluated by transfecting primary mouse and human epidermal keratinocytes with miR-200c inhibitor for 48 hours followed by quantitative analysis of bromodeoxyuridine (BrdU) positive cells. [score:1]
Elevated levels of miR-200c in the skin could contribute to the age -associated delay in wound healing and compromised skin repair in chronic wounds. [score:1]
[1 to 20 of 34 sentences]
31
[+] score: 92
Other miRNAs from this paper: mmu-mir-141, mmu-mir-200b, mmu-mir-200a, mmu-mir-429
We found that Notch-1 could be one of the target genes of miR-200 family (miR-200b, miR-200c) because over -expression of these miRNAs significantly inhibited Notch-1 expression in prostate cancer [31] and pancreatic cancer (unpublished data). [score:9]
Moreover, novel strategies for the re -expression of miR-200 and its consequence could be tested in this animal mo del, which would help in the rational drug design in addition to Notch and NF-κB targeted drugs for the treatment of human PDAC for improving the overall survival of patients diagnosed with this devastating disease. [score:7]
Most interestingly, recent studies have shown that the miR-200 family regulates EMT by targeting ZEB expression. [score:6]
Based on our results, we conclude that one possible mechanism by which the tumors developed in the compound KCI transgenic mice with activated K-ras and Ink4a/Arf deficiency is in part due to the loss of miR-200 family, which leads to the activation of Jagged/Notch and NF-κB signaling pathway, resulting in the up-regulation of NF-κB target genes, such as MMP-9, c-myc, survivin, Bcl-2, cyclin D1, and COX-2 as summarized in the cartoon diagram (Fig. 7) and contributes to tumor aggressiveness. [score:6]
We have reported earlier that miR-200a, miR-200b, and miR-200c are down-regulated in gemcitabine-resistant pancreatic cancer cells, which have high expression of Notch pathway and contributed to the acquisition of EMT phenotype [33], [34]. [score:6]
C, The expression of miR-200 family was down-regulated in the tumors of the KCI mice as assessed by real-time RT-PCR. [score:6]
Furthermore, we have shown that miR-200 family regulates the expression of ZEB1, slug, E-cadherin, and vimentin, and thus suggested the re -expression of miR-200 could be useful for the reversal of EMT phenotype to mesenchymal-to-epithelial transition (MET), which has been partly documented in our recent publication [34]. [score:6]
Consistent with this notion, we found loss of miR-200a, miR-200b, and miR-200c expression in the tumors of KCI mice, suggesting that activated Notch pathway could also be due to the loss of expression of miR-200 family. [score:5]
Moreover, we found down-regulation of miR-200 family, which could also play important roles in tumor development and progression of PDAC in the compound transgenic mice. [score:5]
Recently many studies have shown that the miR-200 family regulates EMT by targeting zinc-finger E-box binding homeobox 1 (ZEB1) and ZEB2. [score:4]
Our previous studies have shown that miR-200a, miR-200b, and miR-200c were down-regulated in gemcitabine-resistant pancreatic cancer cells, consistent with the observed EMT phenotype [32], [33]. [score:4]
The miRNA-200 family was down-regulated in KCI mice. [score:4]
Moreover, we found alterations in the expression of miR-200 family, which could also play important roles in tumor development and progression of PDAC in the compound transgenic mice with activated K-ras and Ink4a/Arf deficiency. [score:4]
Recently, it has been reported that miR-200 family members target Notch pathway components, such as Jagged-1 [35], [36]. [score:3]
As expected, the expression of miR-200a, miR-200b and miR-200c was significantly decreased in the tumors of KCI mice (Fig. 3C). [score:3]
To address whether miR-200 family is involved in the tumors of KCI mice which showed high expression of Notch (Notch-2 and 4) signaling pathway, we investigated the expression of miR-200 family. [score:3]
One important miRNA is miR-200 family, which is involved in the regulation of EMT, stem cells and the regulation of Notch pathway [35], [36]. [score:3]
The miR-200 family have been found to regulate Notch signaling pathway [31]. [score:2]
Our results suggest that the activation of Notch and NF-κB together with the loss of miR-200 family is mechanistically linked with the development and progression of PDAC in the compound K-ras [G12D] and Ink4a/Arf deficient transgenic mice. [score:2]
In order to examine whether miR-200 family regulate Notch pathway, we transfected miR-200b precursor into Rink-1 cells. [score:2]
The miR-200 family has five members: miR-200a, miR-200b, miR-200c, miR-141 and miR-429. [score:1]
Since we found low expression of miR-200 family in the tumors of KCI mice, we assessed the EMT markers to investigate whether the tumors in the KCI mice underwent EMT or not. [score:1]
[1 to 20 of 22 sentences]
32
[+] score: 91
Other miRNAs from this paper: mmu-mir-141, mmu-mir-200b, mmu-mir-192, mmu-mir-200a, mmu-mir-429
Conversely, there are several reports that miR-200 family members and miR-192 can be down-regulated by TGF-beta, and this promotes EMT in cancer and other cell lines via subsequent up-regulation of targets ZEB1 and ZEB2 to repress E-cadherin [1]– [4]. [score:9]
Thus, TGF-beta -induced increase in the expression of microRNAs (miR-192 and miR-200 family members) might coordinately down-regulate E-box repressors Zeb1 and Zeb2 to inhibit EMT and fibrosis of kidneys. [score:8]
Previous studies showed that inhibition of EMT by miR-200 family members was mediated by their inhibition of the expression of the E-cadherin repressors ZEB1 and ZEB2 through binding to the 3′-UTR region of ZEB1 and ZEB2 mRNAs [1]– [3]. [score:7]
We also observed that Zeb1 and Zeb2 was a target of miR-200 family members that tended to be up-regulated by TGF-beta in kidney tubular cell lines. [score:6]
Several reports have shown that members of the miR-200 family (miR-200a,b,c, miR-141 and miR-429) inhibit EMT through direct targeting of ZEB1 and ZEB2, which encode transcriptional repressors of E-cadherin in kidney tubular cells [1], breast cancer cells [2], and mammary epithelial cells [3]. [score:6]
All miR-200 family precursors tested were capable of inhibiting the reduction of E-cadherin and up-regulation of N-cadherin affected by TGF-beta in HK-2 cells (Fig. 1b, c). [score:6]
We suggest that members of the miR-200 family, and miR-200b specifically, might constitute novel therapeutic targets in various kidney diseases. [score:5]
Finally, an alternative therapeutic approach in kidney disease may be to identify compounds that increase the expression levels of members of the miR-200 family of microRNAs. [score:5]
Conversely, the down-regulation of ZEB1 and ZEB2 by TGF-beta via miR-200 family and miR-192 can affect upstream E-box regions [14]. [score:4]
This study indicates that miR-200 family is up-regulated after ureter obstruction, miR-200b being strongly induced, and that miR-200b ameliorates tubulointerstitial fibrosis in obstructed kidneys. [score:4]
In order to confirm that miR-200 family members target ZEB1 and ZEB2 3′-UTRs, we co -transfected either ZEB1-3′UTR-luciferase or ZEB2-3′UTR-luciferase reporter vectors with miR-200 family precursors in HK-2 cells. [score:3]
miR-200 family members target the transcriptional repressors ZEB1 and ZEB2. [score:3]
showed that expression of all members of the miR-200 family tested were increased in a time -dependent manner after ureter obstruction (Fig. 1d); the induction of miR-200b was most pronounced. [score:3]
Given their ability to inhibit EMT, we investigated whether injection of miR-200 miRNA family precursors - chemically modified double strand of RNA which form RNA -induced silencing complex (RISC) like complex and can be processed by endonuclease Dicer into mature miR-200 family in cells - could ameliorate tubulointerstitial fibrosis by inhibition of EMT of tubular epithelial cells in UUO mo del mice. [score:3]
In this report, we show that members of the miR-200 family of miRNAs are induced after ureter obstruction and that miR-200b ameliorates tubulointerstitial fibrosis in obstructed kidneys via inhibition of EMT of tubular cells. [score:3]
Several articles have shown that the miR-200 family targets ZEB1 and ZEB2 [1]– [4]. [score:3]
Recent reports have indicated that a double -negative feedback loop between ZEB1, ZEB2 and miRNA-200 family members regulates EMT in kidney tubular cells [4]. [score:2]
In western blotting, each band has been quantitated and subjected to densitometry to determine if statistically significant difference exists between groups d, Changes in miR-200 family levels in UUO mo del mice kidneys, as measured by TaqMan qRT-PCR and normalized to U6 expression. [score:1]
miR-200 family members can ameliorate EMT and tubulointerstitial fibrosis in UUO mo del mouse kidneys. [score:1]
We suggest that the therapeutic role of miR-200 family members be investigated in other mo dels of kidney disease, particularly in the context of these factors. [score:1]
b, c, in HK-2 cells treated with TGF-beta and transfected with control miR or miR-200 members precursors individually. [score:1]
Since the most efficient in vitro inhibition of TGF-beta was mediated by the miR200-b miRNA (Fig. 1b and Fig. 1c) we next evaluated its effect in vivo by injecting miR-200b precursor via the abdominal vein prior to occlusion of the left ureter. [score:1]
0013614.g003 Figure 3Normalized activity of luciferase reporter with the ZEB1 or ZEB2 3′UTR in HK-2 cells in the presence of co -transfected negative control pre-miR or miR-200 family individually. [score:1]
To assess the effect of miR-200 family precursor on reporter activity, 50 pM of synthetic precursor miRNAs (pre-miRs) (Ambion) were co -transfected. [score:1]
The luciferase activity of both reporters was significantly reduced in the presence of all miR-200 family members tested (Fig. 3). [score:1]
b. Changes in miR-200 family levels in Balbc mice kidneys 12, 24, 48 hours after intravenously administration of miR-200b precursor, as measured by TaqMan qRT-PCR and normalized to U6 expression. [score:1]
These results indicate that members of the miR-200 family of miRNAs are induced after ureter obstruction and that miR-200b ameliorates tubulointerstitial fibrosis in obstructed kidneys. [score:1]
Normalized activity of luciferase reporter with the ZEB1 or ZEB2 3′UTR in HK-2 cells in the presence of co -transfected negative control pre-miR or miR-200 family individually. [score:1]
[1 to 20 of 28 sentences]
33
[+] score: 87
As a matter of fact, the over -expression of miR-200c down-regulates both cMaf mRNA and protein expression with the subsequent decrease in Gcg RNA and suppresses Zfpm2 at both RNA and protein levels, effectively attenuating the α-cell phenotype. [score:10]
To test if the expression of miR-200c, miR-125b and miR-182 could contribute to the low expression of cMaf in beta cells, Min6 cells were transfected with a combination of 200 nM each miR-200c, miR-125b, and miR-182 exogenous hairpin inhibitors (Dharmacon-Thermo Scientific). [score:7]
miR-200c down-regulated the expression of cMaf mRNA and protein. [score:6]
The overexpression of miR-200c also downregulated Zfpm2 mRNA and protein levels (Fig. 4C ). [score:6]
Compared to irrelevant negative control the transfected mimic miR-200c significantly down-regulated the 3′UTR reporter activity (Fig. 4A ), indicating that miR-200c recognized the specific site on 3′-UTR of cMaf and could modulate the expression and function of this gene. [score:5]
72 hrs overe-xpression of mimic miR-200c (50 nM) inhibits the expression of endogenous cMaf (RNA and protein) and RNA Gcg, (n = 8), * p = 0.0078 and 0.0495 (Gcg), Wilcoxon signed rank test-2 tails. [score:5]
B. miR-200c inhibits Maf, Gcg expression in α-TC6 cells. [score:5]
We then over-expressed miR-200c in αTC6 cells and analyzed the effects on cMaf and Zfpm2 expression. [score:5]
Among the β-miRNAs potentially targeting cMaf are miR-125b, miR-182 and miR-200c, which are 27.3-, 9.7- and 3.3 fold more expressed in β-cells (Table 1 ). [score:5]
The difference in expression is particularly high because miR-200c is almost undetectable in alphaTC6 cells. [score:3]
C. miR-200c inhibits Zfpm2 at RNA and protein levels, (n = 8), * p = 0.0078, Wilcoxon signed rank test-2 tails. [score:3]
To asses if cMAf is a target for miR-200c, the firefly Luciferase was used as a reporter gene. [score:3]
In addition, miR-200c has been shown to target Zfpm2 [42]. [score:3]
miR-200c targets the 3′UTR of cMaf. [score:3]
B. Differential expression of β-miRNAs: miR-200c, miR-125b and miR-182 assessed by qRT-PCR. [score:3]
Conversely, inhibition of miR-200c, miR-125b and miR-182 in Min6 cells increased the amount of cMaf transcripts. [score:3]
To demonstrate if the cMaf 3′UTR is a target of miR-200c, αTC6 cells were co -transfected with luciferase reporter containing the 3′-UTR of murine cMaf and exogenous mimic miR-200c or irrelevant negative control mimic. [score:3]
Moreover, in Min6 the expression of miR-125b, miR-182 and miR-200c is much higher than in alpha TC6. [score:3]
Both miR-200c and Zfpm2 are conserved components of the insulin pathway, a critical regulator of metabolism and cell/tissue growth in animals. [score:2]
In n = 4 independent experiments we found a 222 fold (Min6 vs alphaTC6) for miR-125b, 27 fold for miR-182 and 166×103 for miR-200c (Fig. 3B ). [score:1]
U6 small nuclear RNA was used as endogenous control, mean ± SD (n = 4), * p = 0.005, 0.005 and 0.0022 (t-test, 2 tails) for miR-200c, miR-125b and miR-182. [score:1]
The pEZX- MT01-cMaf 3′UTR-fLuc (GeneCopoeia; Rockville MD) vector (1 µg) was transfected into cells with Dharmafect duo (Dharmacon -Thermo Scientific Lafyate CO) alone or together with either mimic miR-200c (50 nM) or irrelevant mimic (50 nM) (Thermo Scientific –Dharmacon). [score:1]
α-TC6, transfected either with 50 nM mimic miR-200c, mimic miR-182,, mimic miR-125b or irrelevant control were lysed in SDS, Tris-HCL buffer (pH 6.8), and aliquots corresponding to 1.8 to 2.6 µg of protein (for cMaf nuclear proteins) were subjected to. [score:1]
[1 to 20 of 23 sentences]
34
[+] score: 71
Because ZEB factors induce EMT by suppressing the expression of epithelial marker genes, including E-cadherin [9, 10], the overexpression of miR-200 s decreases expression of ZEB factors and induces epithelial differentiation. [score:9]
The cells were analyzed on culture day 6. We transfected synthesized miR-200c (Qiagen) and/or a miR-21 inhibitor composed of single-stranded, modified RNAs that specifically inhibit miR-21 function (miScript miRNA Inhibitor; Qiagen) into isolated mouse alveolar type II cells using HiPerFect Transfection Reagent (Qiagen). [score:7]
Transfection of both miR-200c and the miR-21 inhibitor had no significant added effect on the down-regulation of mesenchymal cell markers (Figure  6). [score:6]
We also examined the levels of miR-200c, one of the miR-200 family microRNAs that are expressed in the cells, preserve epithelial phenotypes and function as EMT suppressors. [score:5]
Neither synthesized miR-200c nor the miR-21 inhibitor prevented the decrease in SFTPC expression. [score:5]
The transfection of synthesized miR-200c significantly attenuated the increased expression of vimentin and α-SMA as well as that of Zeb1/2 and prevented the decrease in E-cadherin expression in cultured mouse alveolar type II cells that was induced by the pro-EMT environment containing TGF-β (Figure  6). [score:5]
The specific primer sets for quantification were purchased from Qiagen as follows: MS00001827 for miR-200c; MS00011487 for miR-21; MS00033740 for RNU6B snRNA (a constitutively expressed housekeeping control); QT00121163 for E-cadherin; QT00109424 for Surfactant protein C (SP-C); QT00110467 for VE-cadherin; QT00159670 for Vimentin; QT00140119 for alpha-smooth muscle actin (α-SMA); QT00105385 for ZEB1; QT00148995 for ZEB2 (E-cadherin repressors); QT01658692 for glyceraldehyde-3-phosphate dehydrogenase (GAPDH, a constitutively expressed gene). [score:4]
We also transfected non-specific oligonucleotides as negative controls or synthesized miR-200c as positive controls because miR-200c has been reported to be an EMT suppressor. [score:3]
A recent publication showed that the miR-200 family members inhibit TGF-β -induced EMT in a rat alveolar epithelial cell line [11]. [score:3]
Phase contrast images of cultured mouse alveolar type II cells showed that cells cultured under EMT-inducing conditions adopted a spindle-like shape with irregular processes, whereas cells transfected with miR-21 inhibitor as well as synthesized miR-200c adopted a cobblestone-like appearance and had lamellar body-like granules (Figure  7). [score:3]
In contrast to miR-21, the EMT inducing culture conditions decreased the expression of miR-200c (Figure  5D). [score:3]
Note that the cells cultured under EMT-inducing conditions adopted their spindle-like shape with irregular processes, whereas cells transfected with synthesized miR-200c and/or miR-21 inhibitor adopted a cobblestone-like appearance and had granules (lamellar bodies). [score:3]
In contrast to miR-21, miR-200c decreased significantly in epithelial cells, implying that miR-200c also functions as an EMT suppressor in lung epithelial cells (Figure  2D). [score:3]
200c & 21-i: cells co -transfected with both synthesized miR-200c and miR-21 inhibitor. [score:3]
The miR-200 family targets the ZEB factors (ZEB1 and ZEB2) that function as transcriptional repressors. [score:3]
The microRNA-200 (miR-200) family can reverse EMT and induce an epithelial phenotype in cancer cells [3- 8]. [score:1]
Therefore, it is likely that microRNAs, including let-7d, miR-21 and miR200c, that are involved in TGF-β signaling also play a significant role in EMT during lung fibrosis [2, 11, 14]. [score:1]
miR-200c: cells transfected with synthesized miR-200c. [score:1]
In contrast, the levels of miR-200c were decreased significantly in alveolar type II cells from IPF patients (Figure  4B). [score:1]
miR-200c & miR-21-i: cells co -transfected with both synthesized miR-200c and miR-21-i. The data were analyzed by one-way analysis of variance with a post hoc test (Scheffé’s test). [score:1]
The levels of miR-200c were much higher in lung epithelial cells than in endothelial or mesenchymal cells in saline treated mice (Figure  2D). [score:1]
[1 to 20 of 21 sentences]
35
[+] score: 70
miR-375 was expressed at an average of 4 × 10 [4] copies/ng of RNA (Fig. 1 F), whereas miR-200a and miR-200c were expressed about 10-fold higher (Fig. 1, G and H). [score:5]
A second study (9) reported a dose -dependent increase in plasma miR-29b and miR-200c in human subjects who consumed 0.25–1 liter of milk and suggested target gene regulation in peripheral blood mononuclear cells. [score:4]
To further examine expression patterns throughout lactation, miR-375 and two representative members of the miR-200 family, miR-200a and miR-200c, were absolutely quantified in milk from pups ranging in age from day 1–14 of lactation. [score:3]
Systematic analysis of miR-375 and miR-200c expression in pup tissues of KO pups receiving WT milk provided no evidence of miRNA uptake from milk. [score:3]
To prevent confounding effects of miRNAs that are derived from tissues of suckling offspring, we utilized two different miRNA -deficient mouse strains as a mo del system, the miR-375 knockout (375 KO) mouse and the miR-200c/141 knockout (200c KO) mouse. [score:3]
Several studies analyzing miRNAs in milk emphasize enrichments in “immune-related” miRNAs such as miR-146b, miR-27b, and the miR-200 family (14, 17, 18, 22), which were also among the more highly expressed miRNAs in murine milk. [score:3]
As an additional example of murine milk miRNA, we selected miR-200c, expressed roughly 10-fold higher than miR-375 in murine milk. [score:3]
To further establish whether other miRNAs may be taken up from milk, D14 enterocytes, plasma, and liver samples were analyzed for miR-200c expression in the analogous 200c KO experiments (Fig. 3, M–O). [score:3]
In our study, we chose to focus on D14 of lactation because of the persisting expression of both miR-375 and miR-200c in milk at this later lactation day. [score:3]
E–H, results are represented as mean ± S. E. miR-375, designated as the main focus of this study because of its identity as a single-locus miRNA, and miR-200, selected as a secondary example of a milk miRNA, revealed intermediate expression in milk derived from the stomachs of WT mice (Fig. 1 E). [score:3]
E–H, results are represented as mean ± S. E. miR-375, designated as the main focus of this study because of its identity as a single-locus miRNA, and miR-200, selected as a secondary example of a milk miRNA, revealed intermediate expression in milk derived from the stomachs of WT mice (Fig. 1 E). [score:3]
These comparisons reveal that miR-375 and miR-200c are genuinely highly expressed in milk clots and are not solely the result of contaminating cells or secretions. [score:3]
Importantly, both miR-375 and miR-200c have been detected in rat milk whey (18) and have been found to be among the top 10 most expressed miRNAs in porcine milk exosomes (17) and, in the case of miR-200c, in human milk as well (21). [score:3]
Our results are in stark contrast with the conclusion drawn by Baier et al. (9) that the up-regulation of 1.5 × 10 [5] copies of miR-200c measured in human plasma following consumption of 250 ml of bovine milk is derived directly from the milk. [score:3]
M–O, relative miR-200c expression or copy number per microliter of plasma in D14 small intestine enterocytes (n = 20) (M), D14 plasma (n = 8) (N), and D14 liver (n = 10) (O). [score:3]
miR-200c expression was used as an RNA loading control. [score:3]
Belgardt B. F., Ahmed K., Spranger M., Latreille M., Denzler R., Kondratiuk N., von Meyenn F., Villena F. N., Herrmanns K., Bosco D., Kerr-Conte J., Pattou F., Rulicke T., Stoffel M. (2015) The microRNA-200 family regulates pancreatic β cell survival in type 2 diabetes. [score:2]
Although high sequence similarity between miR-200 family members (28) led to less reliable quantification of miR-200c, analysis of this second miRNA nevertheless provided additional insights into the behavior of milk miRNAs in general. [score:1]
miR-200c, a prototypical epithelial miRNA, is a member of the miR-200 family composed of two chromosomal clusters: miR-200a/200b/429 and miR-200c/141 (28). [score:1]
miR-375 and miR-200c probes were designed as the reverse complement of the mature miRNA sequence (Sigma; miR-375, 5′-TCACGCGAGCCGAACGAACAAA-3′; miR-200c, 5′-TCCATCATTACCCGGCAGTATTA-3′), and 20 pmol was labeled with [γ- [32]P]dATP (PerkinElmer Life Sciences) using T4 polynucleotide kinase (New England Biolabs). [score:1]
This issue lessens confidence in the claims made by Baier et al. (9) that an increase in miR-200c and miR-29b following human consumption of bovine milk is solely due to uptake from the milk because there is exact sequence homology between the bovine and human forms of both miRNAs. [score:1]
Because of infertility of the global miR-200 KO mouse (35), we focused on the miR-141/200c KO mo del. [score:1]
miR-375 was measured as target of interest and miR-200c as a positive control for RNA loading. [score:1]
Therefore, despite a similar intake of milk-derived miR-200c, we do not detect uptake as reported by Baier et al. (9), suggesting that the increase in miR-200c expression they measure may be endogenous (42). [score:1]
miR-200c expression was measured as RNA loading control. [score:1]
For absolute quantification of miRNAs, synthetic miRNAs comprising the mature miRNA sequence (Sigma) were serially diluted in water and used as input for RT-qPCR reactions, generating standard curves against which to compare experimental cycle threshold (Ct) values (mmu-miR-375-3p, 5′-UUUGUUCGUUCGGCUCGCGUGA-3′; mmu-miR-200a-3p, 5′-UAACACUGUCUGGUAACGAUGU-3′; mmu-miR-200c-3p, 5′-UAAUACUGCCGGGUAAUGAUGGA-3′; mmu-let-7f-5p, 5′-UGAGGUAGUAGAUUGUAUAGUU-3′; mmu-miR-194-5p, 5′-UGUAACAGCAACUCCAUGUGGA-3′; mmu-miR-122-5p, 5′-UGGAGUGUGACAAUGGUGUUUG-3′; mmu-miR-33-5p, 5′-GUGCAUUGUAGUUGCAUUGCA-3′; and mmu-miR-16-5p, 5′-UAGCAGCACGUAAAUAUUGGCG-3′). [score:1]
Determination of a qPCR detection limit was not instructive in this case because of cross-detection of other miR-200 family members, although the lack of change between 200c KO pups receiving WT milk versus 200c KO milk suggests a negligible uptake. [score:1]
miR-375 and miR-200c analysis of pup plasma, however, revealed no further indication of miRNA uptake. [score:1]
D, miR-200c copy number per nanogram of RNA in D14 gastric milk from pups of the miR-200c pup exchange (n = 4). [score:1]
250 ml of milk therefore amounts to 1 × 10 [14] copies of miR-200c or 1 × 10 [9] copies/g of body weight of a 75-kg human adult. [score:1]
miR-200c is a member of a miRNA family composed of five members that are divided into two genomic clusters, miR-141/200c and miR-200a/b/429. [score:1]
Following the conservative assumption that the average D14 pup has a stomach volume of 50 μl (41), we can estimate that murine milk contains ≈4 × 10 [7] copies of miR-200c/μl, implying that, for an equivalent copy number consumed per gram of body weight, an 8-g mouse would need to consume 200 μl of milk. [score:1]
FIGURE 3. miR-375 and miR-200c are not taken up into offspring tissues or blood. [score:1]
F–H, copy number per nanogram of RNA of miR-375 (F), miR-200a (G), and miR-200c (H) in WT milk throughout lactation (n = 4–6). [score:1]
[1 to 20 of 34 sentences]
36
[+] score: 70
Previous studies have found that molecules such as miR200c, ZEB1 and transforming growth factor β (TGF-β), can potentially regulate tumor progression [4, 10, 11], and that the overexpression of miR200c or the knockdown of TGF-β1 or ZEB1 could inhibit the tumor cell EMT program that activates cellular mobility and subsequent tumor metastasis [12- 14], in particular, the TGF-β1 signaling blockade has proven to be efficient in preventing the development of a variety of tumor types [15]. [score:8]
We have previously reported that the tumor vaccine of the glycosylphosphatidylinositol (GPI)-anchored interleukin 21(B16F10/GPI-IL-21) in combination with the overexpression of microRNA-200c (miR200c) or with a knockdown of the zinc-finger E-box binding homeobox 1(ZEB1), which is a transcription factor [7], significantly induced immune responses to the B16F10 cells, diminished tumor growth and inhibited the melanoma epithelial to mesenchymal transition (EMT) program. [score:6]
In addition, MiR-200c has been shown to suppress EMT, to attribute to the targeting of ZEB1/ZEB2, repressors of the cell-cell contact protein E-cadherin, and to mainly regulate the cellular epithelial and interstitial state conversion to finish the typical phenotype changes of EMT in the process of tumor cell growth [10, 17, 18]. [score:5]
Similarly, the analysis indicated that the expressions of TGF-β, N-cadherin Vimentin, ZEB-1, SMAD-2, SMAD-3, SMAD-7, GLI1 and GLI2 were all decreased, too, and that the SMAD-7 and E-cadherin expression were markedly increased in the tumor tissues from the mice vaccinated with the B16F10/GPI-IL-21 vaccine and challenged by the B16F10/shTGF-β1 and the injection of miR200c agomir. [score:5]
In this study, we developed a new strategy that combined the B16F10/GPI-IL-21 vaccination with the TGF-β1 knockdown in the B16F10 cells and with the miR200c agomir injection to elicit immune responses against the B16F10 melanoma and to inhibit tumor metastases in a murine mo del. [score:4]
In conclusion, our study indicated that the enhanced antitumor immune response induced by the B16F10/GPI-IL-21 vaccine and the changed EMT-related molecular expression mediated by TGF-β1 knockdown and miR200c agomir optimized the synergism antitumor regimen in the B16F10 melanoma-bearing C57BL/6 mice. [score:4]
The results showed that the B16F10/GPI-IL-21 combined with the down-regulated TGF-β1 and the administration of miR200c agomir group remarkably enhanced the CTL and NK cytotoxic activities in comparison with any other groups (Figure 4A and 4B); the differences were statistically significant (Figure 4C). [score:4]
To reinforce the antitumor efficacy of B16F10/GPI-IL-21 in the B16F10 melanoma-bearing C57BL/6 mice, we down regulated the TGF-β1 expression in the B16F10 cells by the RNAi technology and injection of miR200c agomir simultaneously. [score:4]
For this reason, we designed an anti-melanoma paradigm that employed the down-regulation of TGF-β1 in combination with the injection of miR200c agomir to enhance the antitumor effect of the B16F10/GPI-IL-21 vaccine on the B16F10 melanoma bearing mice. [score:4]
Inhibition of melanoma growth and metastasis in vaccinated mice challenged with B16F10/shTGF-β1 cells plus minus miR200c agomir. [score:3]
EMT -associated molecule expression analyzed by immu­nohistochemistry and in vaccinated mice challenged with B16F10/shTGF-β1 cells plus minus miR200c agomir. [score:3]
These findings supported the use of a combination of the B16F10/GPI-IL-21 vaccine and the transcriptional regulation of TGF-β1 and miR200c approaches in the clinic melanoma treatment. [score:2]
In addition, the CD4 [+]CD25 [+]Treg cells derived from the splenocytes and tumor draining lymph nodes were significantly reduced in the tumor vaccine in combination with shTGF-β1 and miR200c group as shown in Figure 4D, 4E and 4F; these findings suggested that the multiple immune effects were induced through using the tumor vaccine B16F10/GPI-IL-21 combined with the down- regulated TGF-β1 and the administration of miR200c agomir. [score:2]
Compared with those from other groups, the expression of TGF-β1, Vimentin, ZEB-1, N-cadherin, Gli1/2, and P-Smad2/3 was significantly decreased in the tumor areas from the mice vaccinated with B16F10/GPI-IL-21 combined with the B16F10/shTGF-β1 challenge and the administration of miR200c agomir. [score:2]
This comprehensive efficacy decreased the malignant B16F10 cell's tumor initiation and high metastasis potential in the mice, suggesting that the TGF-β1 signaling blockade and modulation of miR200c impacted cell metastasis by regulating several EMT-related processes. [score:2]
Figure 6A portrays the apparent metastatic focus seen in the lungs and lymph nodes of the mice challenged by B16F10/shTGF-β1 or challenged by B16F10/shTGF-β1 with the injection of miR200c agomir, even in the B16F10/GPI-IL-21 vaccinated mice with the B16F10/shTGF-β1 challenge. [score:1]
The results from the tumorigenicity and the tumor lung metastasis counts suggested that the synergism antitumor efficacy was found in the mice immunized with the tumor vaccine B16F10/GPI-IL-21 and then challenged by the B16F10-shTGF-β1 cells and the injection of miR200c agomir (Figure 5). [score:1]
We locally injected 1.5 nmol miR-200c agomir (micrONTM miRNA agomir mouse mir-200c-3p, Bioribo Company) in 0.1 ml saline buffer were locally injected into a B16F10 cells-forming tumor mass once every 4 days for 8 times. [score:1]
We found that 3 of the 6 mice developed tumors on Day 18, Day 21 and Day 24, respectively after the mice were challenged by the B16F10-shTGF-β1 cells, and that 2 of the 6 mice challenged by the B16F10-shTGF-β1 cells with the injection of miR200c agomir developed tumors on Day 21 and Day 27, respectively (Figure 5B). [score:1]
The three groups were the B16F10/GPI-IL-21+ B16F10/shTGF-β1 group (the mice were challenged by 5×10 [5] B16F10/shTGF-β1), the B16F10/GPI-IL-21+B16F10/shTGF-β1+ miR200c group (the mice were challenged by 5×10 [5] B16F10/shTGF-β1 accompanied with the injection of miR200c agomir), and the B16F10/GPI-IL-21+B16F10/Scrambled + miR200c/Scrambled group (the mice were challenged by 5×10 [5] B16F10/Scrambled cells accompanied with the injection of miR200c/Scrambled). [score:1]
Our data demonstrated that high level of IFN-γ and low level of TGF-β1 did reinforce antitumor effectiveness and result in being nearly free of the B16F10 melanoma as well as less metastatic focus in the lungs and lymph nodes in the mice that were received B16F10/GPI-IL-21 vaccine and challenged by the shTGF-β1-B16F10 cells along with the miR200c agomir administration. [score:1]
Figure 3A and 3B show that the serum IFN-γ level was significantly elevated, whereas the TGF-β1 level was notably decreased in the mice that were immunized with B16F10/GPI-IL-21 and challenged by B16F10/shTGF-β1 cells with miR200c agomir injection, or the B16F10/GPI-IL-21 immunized mice challenged by the B16F10/shTGF-β1 cells, in comparison with the non-vaccinated mice that were challenged by the B16F10/shTGF-β1 cells with injection of miR200c or challenged by the B16F10/shTGF-β1 cells only. [score:1]
In contrast, only 1 of the 6 mice in the experiment group grew the smallest tumor on Day 33 (Figure 5A-5C) along with the obvious reduction in pulmonary metastasis (Figure 5D) in the group challenged by B16F10/GPI-IL-21 combined with B16F10-shTGF-β1 and miR200c. [score:1]
The non-vaccinated mice were used as the control, and the mice were challenged by 5×10 [5] B16F10/shTGF-β1(the B16F10/shTGF-β1 group)or by 5×10 [5] B16F10/shTGF-β1 accompanied with the injection of miR200c agomir (the B16F10/shTGF-β1+ miR200c group). [score:1]
Tumor growth and metastasis in vaccinated mice challenged with B16F10/shTGF-β1 cells plus minus miR200c agomir. [score:1]
Induced immune responses in vaccinated mice challenged with B16F10/shTGF-β1 cells plus minus miR200c agomir. [score:1]
In particular, the mice that received the B16F10/GPI-IL-21 vaccination combined with the B16F10/shTGF-β1 challenge and the administration of miR200c agomir showed stronger CTL and NK activities and lower CD4 [+]CD25 [+]Treg cells than any other mice; these treated mice also showed a reduction in the serum TGF-β1 level and an increase in the IFN-γ level. [score:1]
[1 to 20 of 27 sentences]
37
[+] score: 70
Other miRNAs from this paper: mmu-mir-200b, hsa-mir-200b, mmu-mir-200a, hsa-mir-200c, hsa-mir-200a
It is of note that further down-regulation of Zeb1 in Zeb1 null MEF cells had little effects on miR-200 expression (Figure  4B), possibly due to [1] the level of Zeb1 protein in het MEF cells is low enough to relieve the repression on miR-200 family, further decrease in Zeb1 expression in null cells will not increase in miR-200 expression accordingly or/and [2] it is also possible that Zeb1 might down-regulate other unknown factor(s) that positively regulates expression of miR-200 family at the same time and thereby makes the regulation network more complex. [score:17]
Our results suggest that E2F-Rb1 binds constitutively to the Ets1 promoter and limits the level of expression, but a second major impact of Rb1 on Ets1 expression is mediated through Rb1 repression of Zeb1 [40] and in turn induction of miR-200, which targets Ets1. [score:7]
Knockdown of Zeb1 in the T KO MEFs using shRNA lenvirirus, as described previously [17], eliminated much of the induction of Ets1 (Figure  4D), suggesting that induction of Zeb1 and repression of miR-200 as Rb1 family members are mutated is contributing significantly to the upregulation of Ets1. [score:5]
Because miR-200 has been shown to target Ets1 [19], we wondered if Zeb1 might also affect expression of Ets1. [score:5]
We link the effect of Zeb1 to its regulation of miR-200, which in turn target Ets1. [score:4]
Such findings raised the possibility that Zeb1 might feedback to induce Ets1 via its repression of miR-200, and that Rb1 might also influence Ets1 expression via its regulation of Zeb1. [score:4]
Rrm2, ribonucleotide reductase, Ntf3, neurotrophin 3. Zeb1 is a target of the miR-200 family, but in a negative loop Zeb1 feeds back to repress transcription of miR-200 family members [20, 21]. [score:3]
We link Rb1 repression of Zeb1 to induction of miR-200 family members, which in turn target Ets1 mRNA. [score:3]
miR-200 also represses Zeb1, but in a double negative loop Zeb1 binds the promoters of miR-200 family members and represses their expression [20, 21]. [score:3]
These results suggest that Rb1-E2F binds the Ets1 promoter to limit its level of expression, but it is induction of Zeb1 and in turn repression of miR-200 when the Rb1 family activity is lost that is responsible for most of the induction of Ets1. [score:3]
Taken together, our results provide evidence of an amplification loop consisting of Ets1 and Zeb1, which is mediated by miR-200 and regulated by Rb1. [score:2]
Figure 8 Mo del depicting an Ets1-Zeb1 amplification loop that is dependent upon miR-200 and regulated by Rb1. [score:2]
These results imply that CtBP -dependent transcription repression of miR-200 family members by Zeb1 is important for regulation of Ets1 and for thymocyte differentiation. [score:2]
We propose that Ets1 and Zeb1 form an amplification loop that is dependent upon Zeb1 repression of miR-200 and regulated by the Rb1 family (Figure  8). [score:2]
These findings suggest that Ets1 and Zeb1 comprise an amplification loop that is dependent upon miR-200 and regulated by Rb1. [score:2]
As we demonstrated previously [16], mutation of Rb1 family members led to induction of Zeb1 and this induction of Zeb1 was accompanied by repression of miR-200 (Figure  4C) and, as shown above, Ets1 (Figure  1). [score:2]
Zeb1 repression of the miR-200 family is linked to induction of Ets1. [score:1]
Ets1 Zeb1 miR-200 Thymocyte differentiation Lung adenocarcinoma c-Ets1 was identified as a proto-oncogene based on v-ets in the genome of the avian leukemia retrovirus E26, and is the founding member of the Ets family of transcription factors [1]. [score:1]
Recent studies have found that Ets is repressed by miR-200 family members [19]. [score:1]
Taken together, these results suggest an amplification loop between Ets1 and Zeb1, where Ets1 increases transcription of Zeb1, and Zeb1 in turn represses miR-200 to further elevate Ets1. [score:1]
[1 to 20 of 20 sentences]
38
[+] score: 69
Several down-regulated (i. e. miR-1, miR-7, miR-34a, miR-122, miR-125b, miR-200) or up-regulated (i. e. miR-17, miR-18, miR-19, miR-155, miR-93, miR-221/222) miRNAs have been identified as tumor suppressor or oncomirs, respectively, by targeting and regulating genes involved in cell proliferation, apoptosis, angiogenesis and metastasis [13]. [score:12]
Some miRNAs were overexpressed in tumors (miR-155, miR-193b, miR-27a, miR-31, miR-99b, miR-484, miR-574-3p, miR-125a-5p, miR-182), whereas others displayed down-regulation (miR-20a, miR-200c, miR-93, miR-340-5p, miR-720) or a comparable level of expression (miR-200a) with respect to non tumor tissues. [score:8]
A number of dysregulated microRNAs in this mo del were already described in the pathogenesis of liver disease and showed concordant level of expression with respect to that already described in literature (miR-155, miR-20a, miR-182, miR-200a, miR-200c, miR-27a, miR-31, miR-99b) or discordant expression level (miR-193b, miR-93, miR-125a-5p). [score:8]
MiR-200a was found to be up-regulated in NAFLD [51], significantly down-regulated in human HCC samples and, along with miR-200 family members, has been described as a marker able to distinguish between cirrhotic and cancer tissues [52, 53]. [score:7]
It is known that miR-200 family plays a role as tumor suppressor by inhibiting epithelial-to-mesenchymal transition (EMT) and repressing cancer stem cells; in addition, its deregulation has been described in several tumor types, including hepatocarcinoma [50]. [score:6]
MiR-200c was also found to be up-regulated in NAFLD and down-regulated in human HCC as well as in intrahepatic cholangiocarcinoma (ICC) samples [51, 54]. [score:6]
MiR-200a and c, members of the miR-200 family, showed different behavior: after expression level’s decrease (6 months), miR-200a increased during the progression of hepatic damage (12 months), whereas miR-200c revealed a trend of down-regulation during HF diet treatment and in tumors. [score:6]
The same authors also described NCAM1, a known hepatic stem cells marker strictly connected to EMT process, as a miR-200c direct target. [score:4]
MiR-20a, miR-200c, miR-27a, miR-99b displayed a global, more or less marked, down-regulation during the treatment. [score:4]
Karakatsanis A Papaconstantinou I Gazouli M Lyberopoulou A Polymeneas G Voros D Expression of MicroRNAs, miR-21, miR-31, miR-122, miR-145, miR-146a, miR-200c, miR-221, miR-222, and miR-223 in patients with hepatocellular carcinoma or intrahepatic cholangiocarcinoma and its prognostic significanceMol Carcinog. [score:3]
Dhayat SA Mardin WA Kohler G Bahde R Vowinkel T Wolters H The microRNA-200 family-A potential diagnostic marker in hepatocellular carcinoma?J Surg Oncol. [score:1]
Feng X Wang Z Fillmore R Xi Y MiR-200, a new star miRNA in human cancerCancer Lett. [score:1]
Analogously, several miR-200c binding sites are predicted on Mus musculus ZEB1, ZEB2 and NCAM1 3′UTR, indicating its putative role in the mouse mo del here presented. [score:1]
Oishi N Kumar MR Roessler S Ji J Forgues M Budhu A Transcriptomic profiling reveals hepatic stem-like gene signatures and interplay of miR-200c and epithelial-mesenchymal transition in intrahepatic cholangiocarcinomaHepatology. [score:1]
With regard to ICC, Oishi et al. [54] found that miR-200c and miR-141, were negatively correlated with genes involved in the TGF-β, NF-κB and Smad signaling pathway. [score:1]
[1 to 20 of 15 sentences]
39
[+] score: 68
Similarly, inhibitor-resistant NCI-H2122 tumors were E-cadherin negative upon antibody staining but showed high hsa-miR200c-3p expression; SK-OV-3 tumors, moderately sensitive to BI 853520 in spite of marked E-cadherin expression, showed intermediate levels of hsa-miR-200c-3p expression. [score:9]
Expression of CDH1 (=gene encoding E-cadherin) mRNA and of hsa-miR-200c-3p microRNA was analyzed using Affymetrix GeneChip Exon 1.0 and Affymetrix GeneChip miRNA 3.0, respectively (2–3 tumors per group) n. s. statistically not significant (p > 0.05), n. a. data not available [a]CDH1 mutation in NCI-H2122 In order to obtain independent confirmation of the relationship between E-cadherin expression and sensitivity to BI 853520 and move towards a more quantitative correlation we analyzed expression of E-cadherin mRNA by GeneChip analysis (Table 3). [score:8]
All highly sensitive tumors expressed low levels of hsa-miR-200c-3p (log2 expression values, 6.24–8.25; n = 7); whereas all resistant tumors showed high expression (13.13–13.69; n = 4). [score:7]
Additional studies will be required to demonstrate that quantification of hsa-miR-200c-3p expression in patient-derived tumor samples is technically feasible and to survey the frequency distribution of hsa-miR-200c-3p expression and correlation with E-cadherin expression in various cancer types. [score:7]
In the majority of our tumor mo dels, low hsa-miR-200c-3p expression correlated with low E-cadherin expression, however, hsa-miR-200c-3p expression data have helped to resolve inconsistencies in several cases. [score:7]
b hsa-miR-200c-3p expression We next attempted to move beyond E-cadherin as a marker for EMT, a process which involves changes in multiple signaling pathways and in the expression of hundreds of genes and can be partial or complete, reversible or irreversible. [score:5]
b hsa-miR-200c-3p expressionWe next attempted to move beyond E-cadherin as a marker for EMT, a process which involves changes in multiple signaling pathways and in the expression of hundreds of genes and can be partial or complete, reversible or irreversible. [score:5]
Our results indicate that 57 microRNAs are differentially expressed in those groups (adjusted p value ≤0.05 and fold-change ≥2; Supplement Table 5); of these, hsa-miR-200c-3p showed the most pronounced difference: expression was on average 68-fold lower in highly sensitive than in resistant tumors (adjusted p value, 1.03e-12). [score:5]
For example, SW480 colon carcinomas were resistant to BI 853520 even though they were classified low for E-cadherin; high hsa-miR-200c-3p expression has clearly identified these tumors as epithelial-like. [score:3]
Fig. 4E-cadherin mRNA and hsa-miRNA-200c-3p expression and sensitivity to BI 853520 in adenocarcinoma xenograft mo dels. [score:3]
Our results indicate that hsa-miR-200c-3p may represent a useful additional, or alternative, marker for EMT and sensitivity to FAK inhibition. [score:3]
Taken together, our experiments have shown that in vivo efficacy of the highly selective FAK inhibitor BI 853520 in mouse adenocarcinoma mo dels is linked to a mesenchymal tumor phenotype characterized by low E-cadherin mRNA and protein levels and by low expression of miRNA hsa-miR-200c-3p. [score:3]
Table 3 and Fig. 4b illustrate the relationship between hsa-miR-200c-3p expression and TGI for all samples analyzed. [score:3]
[1 to 20 of 13 sentences]
40
[+] score: 64
miR-200 family knockdown by a single miR inhibitor plasmidBecause one miR inhibitor can potentially inhibit different members of the same miR family, we asked if a PMIS construct containing two inhibitors targeting an miR family could inhibit the complete miR family. [score:14]
However, the inhibitor to miR-429 was not as effective at knocking down miR-200c expression compared with inhibitors 200a and 200b, due to flanking sequence divergence of miR-429 (and the inhibitor). [score:9]
To inhibit the miR-200 family, PMIS-miR-200b-200a was constructed and contains a U6 promoter followed by an miR-200b inhibitor, a second U6 promoter followed by miR-200a inhibitor (Figure 1c). [score:7]
This construct allows for the expression of multiple miR inhibitors from one plasmid to inhibit the entire miR-200 family (Figure 4g). [score:7]
[41] To test if the PMIS-miR-200 inhibits miR-200 function in vitro and promotes EMT, a stable MDCK cell line was made that expresses PMIS-miR-200a-200b. [score:5]
Overexpression of miR-200 promotes a mesenchymal-to-epithelial transition in MDCK-Pez cells and conversely inhibition of miR-200 causes EMT in MDCK cells. [score:5]
The miR-17 inhibitor (PMIS-miR-17) reduced endogenous mature miR-17 levels to ~25% in 293 cells, whereas the miR-200c inhibitor (PMIS-miR-200c) does not change the level of miR-17 (Figure 2a). [score:5]
miR-200 family knockdown by a single miR inhibitor plasmid. [score:4]
For AGO2 and DICER pull down, cell extract of 293FT cell stably expressing PMIS vector, PMIS-miR-200c or PMIS-miR-17 were incubated with AGO2 (Cell Signaling) and DICER (Abcam) antibodies. [score:3]
PMIS-miR-200c inhibits miR-200c to ~90% but does not affect miR-17 levels (Figure 2a). [score:3]
The following oligos were also used: miR-200a rf, 5′-TCGAATGACCACATCGTTACCAGACAGTGTTACTCGAGCTGC-3′ and miR-200a rr, 5′-GGCCGCAGCTCGAGTAACACTGTCTGGTAACGATGTGGTCAT-3′ miR-200b rf, 5′-TCGAATGACCTCATCATTACCAGGCAGTATTACTCGAGCTGC-3′ and miR-200b rr, 5′-GGCCGCAGCTCGAGTAATACTGCCTGGTAATGATGAGGTCAT-3′ miR-200c rf, 5′-TCGAATGACCTCCATCATTACCCGGCAGTATTACTCGAGCTGC-3′ and miR-200c rr, 5′-GGCCGCAGCTCGAGTAATACTGCCGGGTAATGATGGAGGTCAT-3′ miR-141 rf, 5′-TCGAATGACCCCATCTTTACCAGACAGTGTTACTCGAGCTGC-3′ and miR-141 rr, 5′-GGCCGCAGCTCGAGTAACACTGTCTGGTAAAGATGGGGTCAT-3′ miR-429 rf, 5′-TCGAATGACCACGGCATTACCAGACAGTATTACTCGAGCTGC-3′ and miR-429 rr, 5′-GGCCGCAGCTCGAGTAATACTGTCTGGTAATGCCGTGGTCAT-3′. [score:1]
The miR-200 family has two subfamilies, miR-200a-3p/141-3p and miR-200b-3p/200c-3p/429-3p (Figure 4a). [score:1]
[1 to 20 of 12 sentences]
41
[+] score: 63
HMGA2 has also been shown to function as an activator of Snail1 and Slug (Snail2) expression (inhibitors of E-cadherin/miR-200 expression), suggesting that p53/TA-p73/p63, by suppressing the expression of both Snail and Slug, it could induce the expression of E–cadherin and miR-200. [score:13]
Considering ZEB1 is a suppressor of E-cadherin, TA-p73 and p21 expression, increased expression of miR-200c (an inducer of epithelial phenotype) will result in increased expression of the tumor suppressor E-cadherin/TA-p73/p21 and in turn, this will result in inhibition of proliferation, EMT, invasion, metastasis and CSCs proliferation [45], [63], [64], [65], [66], [67]. [score:13]
Together, these data suggest that p53/TA-p73/p63, by negatively regulating the expression of lin-28/TUT4ase through its target miRs, it could increase the processing of the tumor suppressor-miRNAs, let-7, miR-200c, miR-143, and miR-107 [Figure 3]. [score:8]
Evidently, TA-p73/p63 appears to increase E-cadherin expression (a negative regulator of EMT), by suppressing ZEB1/2 through its target miRs, such as miR-192, miR-215, miR-145, miR-203, miR-200b, miR-200c, miR-183, miR-92a/b, miR-132, and miR-30a-e [45]. [score:8]
B) The tumor suppressor miRNA, miR-200c has also been shown to inhibit the expression of ZEB1 [45]. [score:7]
Together, p53/TA-p73/p63, by increasing the expression of miR-145, let-7, and miR-200, it could decrease the expression of metastasis promoting factors, and stem cell factors. [score:5]
Interestingly, ectopic expression of miR-200c has been shown to inhibit lung carcinoma cell lines' ability to undergo EMT, invade, and metastasize. [score:5]
p53, TA-p73/p63, and ΔNp63 regulate the processing of the tumor suppressor miRNAs, let-7, miR-200, miR-143, and miR-107. [score:4]
[1 to 20 of 8 sentences]
42
[+] score: 62
They found that miR-200 family inhibitors down-regulated pro-SP-C and SP-B expression. [score:8]
Of note, we did not observe upregulation of the primary direct targets of the miR-200 family in the transcriptome analysis of miR-200b [−/−] lungs. [score:7]
Others have shown that miR-200 is down-regulated in a mouse mo del of fibrotic lung disease and human patients with idiopathic pulmonary fibrosis (IPF) [21]. [score:6]
miR-200a and miR-429 were significantly downregulated, but no changes were observed in abundance of miR-200c and miR-141 ** P < 0.01, Student’s t-test, Data represent mean ± SEM of at least four independent experiments. [score:4]
Therefore, changes in proteins of the direct gene targets of the miR-200 family might not be reflected in the transcriptome of miR-200b [−/−] lungs. [score:4]
Benlhabib H Guo W Pierce BM Men delson CR The miR-200 Family and Its Targets Regulate Type II Cell Differentiation in Human Fetal LungJ. [score:4]
Members of the miR-200 family are down-regulated in the lungs of patients with IPF and a mouse mo del of lung fibrosis [21]. [score:4]
Moreover, miR-200c and miR-141, which are transcribed independently, are expressed normally suggesting that there are no compensatory effects. [score:3]
The expression of miR-200c and miR-141 did not change in the miR-200b [−/−] lungs compared to miR-200b [+/+] lungs, suggesting that there were no compensatory effects on other family members (Fig.   1f and Supplementary Fig. 5). [score:2]
Using human fetal lung cultures, Benlhabib, et al. showed previously that miR-200 family members regulate epithelial type II cell differentiation and function [33]. [score:2]
Du, J. T. et al. MicroRNA-200 family members are weakly expressed in the neurosensory epithelia of the developing zebrafish (Danio rerio) inner ear. [score:2]
MiR-200b belongs to the miR-200 family (miR-141, miR-429, miR-200a, miR-200b and miR-200c) and regulates epithelial-to-mesenchymal transition (EMT) in cancer and organ fibrosis 17– 20. [score:2]
The expression of miR-200c and miR-141 did not change in the miR-200b [−/−] fetal lungs compared to miR-200b [+/+] lungs, suggesting that there were no compensatory effects on other family members. [score:2]
miR-200b [−/−] lungs have dysfunctional surfactant and denser parenchyma with more fibroblast- like cellsSome of the lung function abnormalities in miR-200 [−/−] could result directly from changes in surfactant function or distal airway branching. [score:2]
Some of the lung function abnormalities in miR-200 [−/−] could result directly from changes in surfactant function or distal airway branching. [score:2]
mRNA-Seq whole transcriptome analysis demonstrated that mRNAs of epithelial cell differentiation and surfactant genes are most affected in miR-200b [−/−] lungsIn order to evaluate the effect on downstream targets and associated pathways owing to loss of miR-200b on the lung tissue transcriptome, we performed Next Generation Sequencing (NGS) on total RNA samples from lungs of three 8-week-old miR-200b [−/−] mice and three miR-200 [+/+] (wt) mice. [score:1]
Like what we observed in fetal lungs, adult miR-200b [−/−] lungs had lower miR-200ba and miR-429 abundance, but no changes in miR-200c and miR-141 abundance (Supplementary Fig. 5). [score:1]
Although miR-200c has the exact same seed sequence as miR-200b, the abundance of this microRNA along with miR141 was not changed in lungs and kidneys of 8-week old miR-200b [−/−] mice suggesting the absence of any compensatory effects of these two miR-200 family members in miR-200b deficient mice. [score:1]
Therefore, we assessed the biophysical function of surfactant from miR-200b [−/−] and miR-200 [+/+] lungs using capillary surfactometry. [score:1]
In order to evaluate the effect on downstream targets and associated pathways owing to loss of miR-200b on the lung tissue transcriptome, we performed Next Generation Sequencing (NGS) on total RNA samples from lungs of three 8-week-old miR-200b [−/−] mice and three miR-200 [+/+] (wt) mice. [score:1]
We then scanned three complete sections per lung of three miR-200b [+/+] and three miR-200 [−/−] lungs using an Axio Scan. [score:1]
These two miR-200 family members share the same transcript with miR-200b. [score:1]
We observed lower percentages of airspace in miR-200 [−/−] lungs (Fig.   3d). [score:1]
[1 to 20 of 23 sentences]
43
[+] score: 59
A hypothetical mo del of age -dependent miRNAs regulating LCs development and function is shown in Figure 6. Table 1 miRNAs in aging putative targets function in LC reference miR709↑ RANK LC development and homeostasis↓ 49 IRF8 LC development and homeostasis↓ 29 AhR impair LC maturation 33 miR449↑ TGFβRII LC development and homeostasis↓ 32, 46 RunX3 LC development and homeostasis↓ 30 CSF1R LC development and survival↓ 35 miR9↑ TGFβRII LC development and turnover↓ 32, 46 RunX3 LC development and homeostasis↓ 30 RANK LC development and homeostasis↓ 49 miR10a↓ Gfi1 LC development and homeostasis↓ 28 miR200c↓ C/EBP LC differentiation↓ 31 Langerin LC antigen uptake ↑ 22, 23 Gfi1 LC development and homeostasis↓ 28 miR744↓ TGFβI inhibit LC maturation 32, 46 miR20b↓ RANKL inhibit LC maturation 34 miR205↓ C/EBP LC differentiation↓ 31 The density of LCs in the epidermis is known to decrease with age in mice [21]. [score:19]
A hypothetical mo del of age -dependent miRNAs regulating LCs development and function is shown in Figure 6. Table 1 miRNAs in aging putative targets function in LC reference miR709↑ RANK LC development and homeostasis↓ 49 IRF8 LC development and homeostasis↓ 29 AhR impair LC maturation 33 miR449↑ TGFβRII LC development and homeostasis↓ 32, 46 RunX3 LC development and homeostasis↓ 30 CSF1R LC development and survival↓ 35 miR9↑ TGFβRII LC development and turnover↓ 32, 46 RunX3 LC development and homeostasis↓ 30 RANK LC development and homeostasis↓ 49 miR10a↓ Gfi1 LC development and homeostasis↓ 28 miR200c↓ C/EBP LC differentiation↓ 31 Langerin LC antigen uptake ↑ 22, 23 Gfi1 LC development and homeostasis↓ 28 miR744↓ TGFβI inhibit LC maturation 32, 46 miR20b↓ RANKL inhibit LC maturation 34 miR205↓ C/EBP LC differentiation↓ 31 (A) LCs were isolated using AutoMACS with anti-MHCII-PE and anti-PE microbeadsfollowed by a cell sorter. [score:19]
Downregulated miR-200 in aged LCs may upregulate its target, Gfi1, which could then arrest LCs commitment. [score:9]
Our miRNA array data showed that the expression level of miR-200 that potentially targets Langerin, was downregualted in aged LCs. [score:5]
Based on the miRNAs potentially linked to LCs development and function, we have further confirmed that miR-709, miR-449 and miR-9 were upregualated in aging, while miR-200c and miR-10a were downregulated in aging by using single TaqMan RT-PCR assays (Figure 5 D). [score:4]
Gfi1 is a potential target of miR-200. [score:3]
[1 to 20 of 6 sentences]
44
[+] score: 55
Overexpression of MUC1-C(AQA) in A549 cells was associated with decreases in ZEB1 (Fig. 5A, left and right) and upregulation of miR-200c expression (Fig. 5B). [score:8]
Silencing MUC1-C confers the coordinate downregulation of ZEB1 and induction of miR-200c expression. [score:6]
Notably in this regard, recent studies have shown that MUC1-C induces EMT in breast cancer cells by the upregulation of ZEB1 and the coordinate suppression of miR-200c [17]. [score:6]
The coordinate upregulation of ZEB1 and suppression of miR-200c, an inducer of epithelial differentiation, is associated with the induction of EMT [26]. [score:6]
Accordingly, we found that targeting MUC1-C with the downregulation of ZEB1 and induction of miR-200c resulted in MET, indicating that MUC1-C is necessary for conferring the EMT phenotype in these KRAS-independent NSCLC cells (Fig. 7E). [score:6]
Thus, with the suppression of ZEB1 and induction of miR-200c, silencing MUC1-C in A549 cells was associated with upregulation of E-cadherin, and decreases in N-cadherin and vimentin, consistent with reversal of EMT (Fig. 4A). [score:6]
These findings provided support for a mo del in which MUC1-C contributes to the activation of AKT and thereby the coordinate induction of ZEB1 and suppression of miR-200c expression. [score:5]
Moreover and consistent with ZEB1 -mediated suppression of miR-200c [26], we found that silencing MUC1-C is associated with induction of miR-200c levels (Figs. 3G and H). [score:3]
In turn, MUC1-C associates with ZEB1 and the MUC1-C/ZEB1 complex suppresses transcription of miR-200c, an inducer of epithelial differentiation [17]. [score:3]
The results are expressed as relative miR-200c levels (mean±SD of three determinations) as compared to that obtained for U6 as a control. [score:2]
In the present studies, silencing MUC1-C in NSCLC cells decreased ZEB1, which in turn was associated with increases in miR-200c, and significantly, reversal of the EMT phenotype. [score:1]
Treatment of A549 cells with GO-203 also decreased ZEB1 mRNA and increased miR-200c levels (Figs. 5D and E). [score:1]
Analysis of miR-200c. [score:1]
miR-200c is an inducer of epithelial differentiation [26]. [score:1]
[1 to 20 of 14 sentences]
45
[+] score: 55
It has been suggested that different cell lines regulate miR-200 expression through distinct epigenetic mechanisms [27]. [score:4]
Downregulation of miR-200 family members might underlie kidney cyst formation in Dicer mutant kidneys. [score:4]
Members of the miR-200 family were highly expressed in the kidney, lung, small intestine, and exocrine glands (Figure 2(a)). [score:3]
Members of the miR-200 family are commonly expressed in tubular tissues, and it is impossible to classify these tissues using only the miR-200 family. [score:3]
The expression of miR-200a, miR-200b, miR-200c, miR-192, miR-194, and miR-449a was validated with real-time RT-PCR in rat tissues in order to discriminate the kidney from other tissues with a tubular structure. [score:3]
In the present study, the expression of miR-200c was higher in the lacrimal gland and salivary gland than in other tubular tissues. [score:3]
As expected, members of the miR-200 family were highly expressed in exocrine glands and epithelial cells. [score:3]
The miR-200 family consists of five members (miR-200a, miR-200b, miR-200c, miR-141, and miR-429), which are clustered and expressed as the miR-200b-200a-429 cluster at chromosomal location 1p36 and the miR-200c-141 cluster at chromosomal location 12p13. [score:3]
Members of the miR-200 family were highly expressed in the proximal tubule. [score:3]
Members of the miR-200 family were expressed at high levels in each tissue with a tubular structure (Figures 3(a)– 3(c)). [score:3]
In human tissues, the results of the miRNA array analysis showed that miR-200a, miR-200b, and miR-200c (miR-200 family) were highly expressed in the kidney, lung, salivary gland, trachea, colon, prostate, liver, and pancreas (Figure 1). [score:3]
To examine the miR-200 family in the kidney, miRNA array analysis was performed to compare expression in the proximal tubule and mesangial cells. [score:3]
Our results showed that miR-200 family members were expressed at high levels in various tissues with a tubular structure: the kidney (proximal tubule and collecting duct), lung, pancreas (duct cells), small intestine (intestinal villus), bile duct, and exocrine glands (duct cells). [score:3]
The lacrimal gland and salivary gland are formed from the ectoderm, and the expression ratio of miR-200a/b and miR-200c might depend on the germ layer. [score:3]
Members of the miR-200 family are highly expressed in the kidney and lung. [score:3]
We assessed whether the plasma concentrations of miR-200a, miR-200b, and miR-200c could be used as a biomarker for acute kidney injury (Figure 4). [score:1]
miR-200c was not detected in urine. [score:1]
These results suggest that the miR-200 family is closely associated with tubular structure. [score:1]
In the future, we will assess the potential of the urinary miR-200 family as biomarkers of the renal tubular dysfunction in humans. [score:1]
Patel et al. have reported that miR-200 family members play important roles in renal tubule maturation by repressing Pkd1 in the kidney [25]. [score:1]
We assessed whether the urinary concentrations of miR-200a and miR-200c could be used as a biomarker for renal tubular dysfunction (Figure 5). [score:1]
We assessed whether the miR-200 family could be used as a biomarker for kidney injury. [score:1]
Consistently, the plasma concentrations of the miR-200 family members and miR-192 and miR-194 increased significantly. [score:1]
[1 to 20 of 23 sentences]
46
[+] score: 54
Fig. 8b), increased expression of Nog (a miR-200c-3p target) 31 after transfection of miR-200c antagomir, and Pdcd4 (a miR-21 target) 32 and Casp3 (which is known to be upregulated in the miR-21 knockout mouse) 33 after transfection of miR-21 antagomir. [score:11]
After transfecting antagomirs targeting miR-200c-3p and miR-590-5p in explanted E13.5 mandibles, or in explanted E13.5 SMGs attached to the tongue (Fig. 3a), the analysis of miRNA expression by qRT-PCR showed a selective decrease in miRNA expression using both LFS and NFS transfections compared to an irrelevant arbitrarily selected target small nucleolar RNA Snord61 and snRNA U61 (Fig. 3b). [score:8]
Expression differences in miRNAs after transfection of the corresponding antagomirs using LFS (pink squares) or NFS (blue triangles) are statistically significant (T-Student paired one tailed test), as follows: miR-200c-3p expression in molar tooth germs (p = 0.006), in incisors (p = 0.010), and SMGs (p = 0.011) using Anta-200c (graph in the middle); miR-590-5p expression in molar tooth germs (p = 0.010), in incisors (p = 0.006), and SMGs (p = 0.004), using Anta-590 (graph on the right). [score:7]
We selected antagomirs targeting miR-590-5p, previously defined as a component of the molar tooth germ miRNA expression signature (Fig. 2d), and miR-200c, a known regulatory component of tooth 29 and SMG 17 morphogenesis. [score:6]
Note increased proliferation (EdU) in the lingual (L) side to the tooth germ (in b, c, e), and the progression of epithelial morphogenesis (from cap to bell stage) after targeting miR-429-3p (b), miR-325-3p (c), and miR-200c-3p (e), whereas epithelial proliferation and morphogenesis were inhibited with miR-590-5p antagomir transfection, compared to off-target antagomir (a). [score:6]
In contrast to the results obtained after off-target antagomir transfection, mandibular explants, transfected with antagomirs targeting miR-429-3p, miR-325-3p, miR-590-5p, or miR-200c-3p exhibited striking changes in molar germ morphogenesis (Fig. 4a–e). [score:5]
In addition, to help validate our miRNA functional perturbation method, we included in this analysis the miR-200c-3p (Fig. 2e), which although not differentially expressed in molar and incisor tooth germs compared to SMGs and lungs, is known to play a role in regulating epithelial proliferation during odontogenesis 29 and SMG branching morphogenesis 17. [score:3]
The decreases in miR-200c expression (middle graph, Fig. 3b) using the corresponding antagomir transfected with LFS (pink squares) and NFS (blue triangles) were, respectively: 42.0% and 81% (molar tooth germs), 43.0% and 72.0% (developing incisors), and 36.0% and 80.0% (SMGs). [score:3]
We found that miR-590-5p perturbation produced abnormal cap stage formation during molar tooth germ morphogenesis (Fig. 4d,f, upper panel), and that miR-200c-3p loss-of-function via its antagomir (Fig. 4e) increased proliferation in both epithelial and mesenchymal tissues, as previously observed in SMG 17 and in tooth morphogenesis in a miR-200c knockout mouse 31. [score:2]
miR-200c-3p, a known regulatory component of the morphogenetic processes in embryonic tooth and SMG, is also included. [score:2]
miR-200c-3p antagomir increased epithelial molar tooth germ proliferation (Fig. 4e), in agreement with previous experiments that genetically removed miR-200c during murine tooth morphogenesis 31. [score:1]
[1 to 20 of 11 sentences]
47
[+] score: 51
In epithelial cells, miR-200 family microRNAs and E-cadherin maintain higher level expression by repressing ZEB1, ZEB2 and TGFβ; on the other hand, in mesenchymal cells and tumors, the up-regulation of ZEB factors is triggered by TGFβ and suppresses the transcription of miR-141/200c by binding to their putative common promoter region. [score:8]
In our primary dataset, ZEB1 and ZEB2 were both up-regulated in six out of our eight ccRCC samples and, their expression levels were highly anti-correlated with the miR-200 family in both tumor and normal samples. [score:6]
Recently, several other groups have reported a role for the miR-200 family in the Epithelial-Mesenchymal-transition (EMT) and in cancer cell migration, the latter by directly targeting the transcription factors ZEB1 and ZEB2, which regulate E-Cadherin, a mediator of cell-cell adhesion [84, 85]. [score:5]
It is clear that loss of mir-200c regulation contributes to an increase in VEGFA transcript while for the other three (tumor suppressor genes), the level of transcript decreases because of a gain in the level of the corresponding microRNA. [score:4]
As confirmation of these results, down-regulation of miR-141 and miR-200c and their function on ZEB2 in ccRCC has recently been reported [87]. [score:4]
In Figure 2 we plot microRNA and mRNA levels for miR-200c and its target VEGFA. [score:3]
Expression levels of miR-200c and VEGFA in the primary dataset showing anti-correlation in both ccRCC and matched normal kidney tissue. [score:3]
Note that the levels of miR-200c and its target VEGFA are not only anti-correlated overall, but are also anti-correlated separately in both ccRCC and normal tissue. [score:3]
For instance, loss of miR-149, miR-200c and mir-141 causes gain of function of oncogenes (KCNMA1, LOX), VEGFA and SEMA6A respectively and increased levels of miR-142-3p, miR-185, mir-34a, miR-224, miR-21 cause loss of function of tumor suppressors LRRC2, PTPN13, SFRP1, ERBB4, and (SLC12A1, TCF21) respectively. [score:3]
B-E. Agilent chip expression levels of miR-200c, miR-244, miR-34a and miR-21 versus the levels of mRNA that they regulate: VEGFA, ERBB4, SFRP1 and SLC12A1 respectively as measured by qRT-PCR for 12 validation set samples The dark circles represent the values in ccRCC and the light circles in normal kidney. [score:2]
As the p-values in Figure 4 indicate, we validate a strong anti-correlation signature between mRNA levels of (KCNMA1, LOX), VEGF, SEMA6A, (LRRC2, PTPN13), SFRP1, ERBB4, SLC12A1 and TCF21, and their identified regulators: miR-149, miR-200c, mir-141, miR-142-3p, miR-185, mir-34a, miR-224 and miR-21 respectively. [score:2]
In Figure 3B-E, we plot the qRT-PCR expression levels of ERBB4, SFRP1, SLC12A1 and VEGFA versus Agilent chip measured levels of their regulatory microRNA (miR-224, miR-34a, miR-21 and miR-200c) for the twelve samples of Figure 3A. [score:2]
We also noted that in our data, the anti-correlation between VEGFA and the miR-200 family was strongest in normal kidney tissue, suggesting that loss of this regulation may be an important factor providing a permissive environment for HIF transcriptional signaling. [score:2]
This plot suggests that loss of miR-200c function in ccRCC contributes to increase in VEGF levels. [score:1]
Five miR-200 family members contain very similar seed sequences - AAUACU for miR-200b/200c/429 and AACACU for miR-200a*/141 [84]. [score:1]
Another example is the miR-200 family which includes two microRNA clusters, one on Chromosome 1p36.3 (miR-200a*/200b/429) and another on Chromosome 12p13 (miR-200c/141). [score:1]
We also found strong anti-correlation between VEGFA and the miR-200 family of microRNA: miR-200a*, 200b, 200c and miR-141. [score:1]
[1 to 20 of 17 sentences]
48
[+] score: 47
Korpal M Lee ES Hu G Kang Y The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2J Biol Chem. [score:6]
In fact, the miR-200 microRNAs have been established as master regulators of the EMT program in both physiological and pathological conditions 19, 21, 27, 31. miR-200b was recently shown to suppress invasiveness and to modulate the cytoskeletal and adhesive machinery by targeting Kindlin-2 in oesophageal squamous cell carcinoma cells [32]. [score:6]
Expression levels of N-Cadherin, Fibronectin and Vimentin were significantly downregulated (p < 0.05) in the tumours derived from the miR-200b-overexressing MDA-MB-231 (miR200) cells compared to the tumours from the control (Scram) counterparts (Fig.   6F–H, respectively). [score:5]
Overexpression of miR-200b slowed the growth of primary tumours; at the 5-week time point when all the primary tumours were removed, the average volume of the tumours derived from the miR-200 -overexpressing MDA-MB-231 cells (miR200b) was more than 3-fold less (p < 0.01) than those derived from the control (Scram) cells (Fig.   6A). [score:5]
Gregory PA The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat Cell Biol. [score:4]
Park SM Gaur AB Lengyel E Peter ME The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2Genes Dev. [score:3]
Mutation of the seed sequence of miR-200b in the 3′-UTR of K2 (K2 3′UTR with scrambled miR-200 seed sequence) abrogated the effect of the exogenous miR-200b (Fig.   5H); the levels of luciferase activity did not show any significant difference when compared to the control cells or those treated with the non -targeting microRNA (Fig.   5H). [score:3]
These cells remained either untreated (Ctrl) or transfected with either a non -targeting micro -RNA (NT-miR) or the miR-200b mimics (miR200). [score:3]
qt-RT-PCR analyses of total RNA from the primary tumours showed that Kindlin-2 mRNA levels were significantly lower in the tumours derived from the miR-200b -expressing MDA-MB-231 (miR200) cells (Fig.   6E) compared to those derived from the control (Scram) counterparts. [score:2]
Sossey-Alaoui K Bialkowska K Plow EF The miR200 family of microRNAs regulates WAVE3 -dependent cancer cell invasionJ Biol Chem. [score:2]
We used the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA), as per the manufacturer’s instructions, to generate the K2 3′-UTR variants, where seed sequences that are recognized by miR200 microRNA were deleted. [score:2]
Burk U A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cellsEMBO Rep. [score:1]
Kindlin-2 was also reported to promote BC invasion through epigenetic silencing of members of the miR-200 gene family [33]. [score:1]
In contrast, transfection of the 231-wild-type K2-3′UTR cells with miR-200b mimics (miR200) resulted in ~60% reduction (p < 0.05) in luciferase activity (Fig.   5G). [score:1]
Spaderna S Brabletz T Opitz OG The miR-200 family: central player for gain and loss of the epithelial phenotypeGastroenterology. [score:1]
Korpal M Kang Y The emerging role of miR-200 family of microRNAs in epithelial-mesenchymal transition and cancer metastasisRNA Biol. [score:1]
The miR-200 family is no stranger to EMT. [score:1]
[1 to 20 of 17 sentences]
49
[+] score: 45
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
This approach proved effective at identifying several mRNAs whose relative levels of expression were positively correlated with that of their targeting miRNA(s), a subset of which are represented in Fig 9. These studies were therefore extended by employing a knockdown strategy in which an immortalized mouse caput epididymal epithelial cell line (mECap) was co -transfected with a cherry red reporter and miRNA mimics of either miR-200c, miR-486 (shown to be significantly up-regulated in the caput and caudal regions, respectively), or a scrambled negative control (mirVana). [score:9]
These candidate miRNAs included representatives that exhibited regulated patterns of expression from each of the two primary classes detected, namely: those with highest expression in the caput (let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p), or highest expression in the cauda (miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:8]
As shown in Fig 10 this strategy proved effective in eliciting a significant reduction in the expression of both Mapk14 (targeted by miR-200c) (Fig 10A) and Foxo1 (targeted by miR-486) (Fig 10B) mRNA. [score:7]
In order to verify the next generation sequence data, nine differentially expressed miRNAs were selected for targeted validation using qRT-PCR, including representatives with highest expression in the proximal (caput: let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p) and distal (cauda: miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:7]
0135605.g008 Fig 8In order to verify the next generation sequence data, nine differentially expressed miRNAs were selected for targeted validation using qRT-PCR, including representatives with highest expression in the proximal (caput: let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p) and distal (cauda: miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:7]
In this context, qPCR confirmed highly significant down-regulation of let-7c-5p, let-7b-5p, miR-375-3p, miR-467d-3p, and miR-200c-3p between the proximal and distal epididymal segments. [score:4]
miRNA mimics of miR-200c-3p, miR-486-5p and a scrambled negative control (mirVana) were transfected separately at a concentration 5 nM using lipofectamine 2000 along with a cherry red internal control (0.5 μg) in Opti-MEM (Life Technologies) as per manufacturer’s instructions. [score:1]
To confirm the functional significance of epididymal miRNAs, an immortalized mouse caput epididymal epithelial cell line (mECap) was co -transfected with a cherry red reporter and miRNA mimics of either (A) miR-200c, (B) miR-486, or a scrambled negative control (mirVana). [score:1]
0135605.g010 Fig 10To confirm the functional significance of epididymal miRNAs, an immortalized mouse caput epididymal epithelial cell line (mECap) was co -transfected with a cherry red reporter and miRNA mimics of either (A) miR-200c, (B) miR-486, or a scrambled negative control (mirVana). [score:1]
[1 to 20 of 9 sentences]
50
[+] score: 45
HL-1 atrial cardiomyocytes transfected with miR-29 and miR-200 (Fig 8) significantly down-regulate Cacna1c, Hnc4 and Ryr2 expression, while Camk2a was significantly decreased with miR-200 but not miR-29 (Fig 8). [score:6]
We provide herein evidences that miR-29 and miR-200 over -expression also contributes to ion channel expression remo deling. [score:5]
Observe that miR-29 and miR-200 over -expression leads to significant decreased of Cacna1c, Hcn4, Ryr2 and Camk2a (except for miR-29a) expression. [score:5]
miR-29 over -expression in HL1 atrial cardiomyocyte deregulate Cacna1c, Hnc4 and Ryr2, influencing therefore both the calcium handling and pacemaker activity, whereas miR-200 regulated Cacna1c, Ryr2 and Camk2a, in addition to Scn5a as previously reported [64], impacting therefore also in calcium handling. [score:5]
qPCR of left atrial chambers demonstrated that miR-1, miR-26b, miR-29a, miR-30e, miR-106b, miR-133 and miR-200 are up-regulated in HTD rats as compared to controls (Fig 1), demonstrating a similar microRNA expression profile as in atrial-specific Pitx2 deficient mice [14, 16]. [score:5]
HL-1 cells (6 × 10 [5] cells per well) were transfected with plasmids containing expression constructs for Pitx2, Wnt8a (Addgene), Wnt11a (Addgene, Cambridge, MA, USA), premiR-29a, pre-miR-200 (Exiqon) or siRNA-Pitx2c, siRNA-Zfhx3, siRNA-Enpep, siRNA-Sod2 (Sigma, Aldrich, Munich, Germany) as previously described [14, 34]. [score:3]
Thus these data demonstrate that miR-29 and miR-200 impaired expression also contributes to develop pro-arrhythmogenic substrates. [score:3]
miR-29a and miR-200 expression in HL-1 atrial cardiomyocytes transfected cells. [score:3]
Whereas it is wi dely documented that redox signaling can compromise ion channel functioning and calcium homeostasis in cardiomyocytes [67], in our system we observed no influence of H [2]O [2] administration on the regulatory impact of Pitx2 in distinct ion channels such as Scn5a, Kcnj2 and Cacna1c as well as multiple Pitx2-regulated microRNAs such as miR-1, miR-26, miR-29 and miR-200, in which redox impairment impact is less documented [68]. [score:3]
We have previously demonstrated that Pitx2 modulates expression of miR-29 and miR-200, among other microRNAs [16] and furthermore we have demonstrated in this study that modulation of distinct ion channel is greatly influenced by H [2]0 [2] administration while microRNA signature is mostly dependent on Pitx2c but not H [2]0 [2] administration. [score:3]
Several lines of evidence have already reported the key regulatory role of miR-1 [60– 62], miR-26 [63], miR-106b [64], miR-133 [65– 66] and miR-200 [64] in arrhythmogenesis. [score:2]
Modulation of miR-29 and miR-200 alters cardiac action potential determinants. [score:1]
Importantly, miR-29 and miR-200 are not significantly impaired in SHR atrial chambers, suggesting that Wnt-microRNA might be a pivotal candidate establishing fundamental differences between HTD and HTN in atrial arrhythmogenesis susceptibility. [score:1]
[1 to 20 of 13 sentences]
51
[+] score: 34
Amongst these, oxidative stress -induced upregulation of the miR-200 family caused senescence [103]. [score:4]
It was shown the entire miR-200/182 cluster is upregulated in acute herpes simplex virus 1 encephalitis [80]. [score:4]
We observed the upregulation of eight miRNAs that make up a related miR-200 family (miR-200a, 200b, 200c, miR-141, miR-429) and a miR-183/96/182 cluster. [score:4]
Overall, much remains to be discovered about the miR-200 family’s roles in various diseases and conditions, including cancer and cancer treatment -associated CNS toxicity. [score:3]
We noted a commonality between all three groups (PR+BC, PR+BC/CRIZ, and PR+BC/TOP): miR 200 family (miR-200a, miR-200b, miR-200c, miR-141, and miR-429), miR-183/96/182 cluster, miR-30d-5p, and miR-191-5p were up-regulated, as compared to intact controls. [score:3]
Both tumor growth and chemotherapy treatment led to the upregulation of the miR-200 family, as compared to intact animals. [score:3]
A recent study analyzed and compared the miRNA profiles of gastric adenocarcinomas and brain metastatic carcinomas and identified the upregulation of, among others, the miR-200 family members miR-141-3p and miR-200b-3p in the brain metastatic samples [84]. [score:3]
Therefore, deregulation of the miR-200 family could be involved in brain metastasis via the Zeb/miR-200 family feedback loop. [score:2]
The miR-200 family was associated with brain metastases [84], and miR-30d-5p was implicated in medulloblastoma development [102]. [score:2]
Chemo and tumor brain -induced miRNA changes involved several miRNA families, such as the miR-200 family and miR-183/96/182 cluster, which were deregulated in PR+BC tumor-bearing and chemotherapy -treated animals. [score:2]
The miR-200 family is important for the proper balance between neuronal proliferation and differentiation during development [81]. [score:2]
Green arrow - miR-200 family; blue arrow - miR-183/96/182 cluster; red arrow - other common miRNAs. [score:1]
These miRNAs are often co-transcribed and referred to as the miR-200/182 cluster. [score:1]
[1 to 20 of 13 sentences]
52
[+] score: 34
As illustrated in Figure 2, TGF-β1 up-regulates miR-21, miR192, miR-377, miR-382, and miR-491-5p, but down-regulates miR-29 and miR-200 families during renal fibrosis (Kantharidis et al., 2011; Kriegel et al., 2012; Lan and Chung, 2012; Chung et al., 2013a, b). [score:7]
The miR-200 family regulates TGF-beta1 -induced renal tubular epithelial to mesenchymal transition through Smad pathway by targeting ZEB1 and ZEB2 expression. [score:6]
The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2. [score:6]
The miR-29 and miR-200 are TGF-β1 -dependent anti-fibrotic miRNAs that are extensively suppressed in the diseased kidneys (Qin et al., 2011). [score:5]
Moreover, recent studies also revealed that overexpression of miR-29, miR-200 or inhibition of miR-21 and miR-192 can effectively decelerate the progression of renal fibrosis (Oba et al., 2010; Chung et al., 2010a; Qin et al., 2011; Zhong et al., 2011, 2013; Chen et al., 2014) (Figure 3). [score:5]
As miR-200 has a major role in maintaining the epithelial differentiation, delivery of miR-200b significantly reduces renal fibrotic response by suppressing the transcriptional repressors of E-cadherin ZEB1 and ZEB2 (Korpal et al., 2008; Oba et al., 2010). [score:3]
The miR-200 family contains miR-200a, miR-200b, miR-200c, miR-429, and miR-141 (Howe et al., 2012). [score:1]
The miR-200 and miR-221/222 microRNA families: opposing effects on epithelial identity. [score:1]
[1 to 20 of 8 sentences]
53
[+] score: 34
The miR-200 family has also been shown to inhibit the EMT, stimulating the epithelial phenotype and cancer cell migration by direct targeting of the E-cadherin transcriptional repressors ZEB1 and ZEB2 [23]. [score:6]
Expression levels of miR-302s and miR-369s were lower compared to that of miR-200c, suggesting that miR-200c expression is already high in many colon cancer cells and may be refractory to exogenous overexpression. [score:6]
In this regard, we did not use miR-200c in this study, since the additional expression of miR-200c in endogenously miR-200c -expressing cancer cells did not indicate an apparent anti-cancer effect. [score:5]
Reportedly, the miR-200 family is recognized as a master regulator of the epithelial phenotype by targeting ZEB1 and ZEB2, two important transcriptional repressors of cell adherence (E-cadherin) and polarity (CRB3 and LGL2) genes [22]. [score:4]
In contrast, miR-200c expression was high in nine primary tumors examined and many cell lines, such as HT29. [score:3]
0127119.g001 Fig 1 A) Relative expression of endogenous miR-302s (miR-302a,-b,-c, and-d), miR-369s (miR-369-3p and-5p), and miR-200c in primary tumors and colon cancer cell lines. [score:3]
A) Relative expression of endogenous miR-302s (miR-302a,-b,-c, and-d), miR-369s (miR-369-3p and-5p), and miR-200c in primary tumors and colon cancer cell lines. [score:3]
It has been shown that a set of three miRs (miR-302s, miR-369s and miR-200c) selected from numerous miRs expressed exclusively in induced pluripotent stem cells (iPSCs)/ESCs, elicited reprogramming [13]; a significant role for miR-367 was also shown [12]. [score:3]
Previous studies indicated that miR-302a,-b,-c, and-d (miR-302s), miR369-3p,-5p (miR-369s) and miR-200c could elicit cellular reprogramming in normal somatic cells [13]. [score:1]
[1 to 20 of 9 sentences]
54
[+] score: 34
In this study, we provide strong evidence that KLF8 promotes the expression of EGFR by both directly activating the gene promoter and by repressing its inhibitory microRNA141, a member of the microRNA-200 family to release its translation. [score:8]
Figure 3 A. KLF8 inhibits the expression of miR7, miR141 and miR200c. [score:5]
miR141 belongs to the microRNA-200 family that is known to inhibit EMT and metastasis [35] by inhibiting the EMT-inducing ZEB1 and SIP1 [28, 36]. [score:5]
A. KLF8 inhibits the expression of miR7, miR141 and miR200c. [score:5]
In breast cancer, for example, the microRNA-200 family members have been shown to inhibit EMT and invasion in breast cancer [28]. [score:3]
We have identified both miR141 and miR200c as targets of repression by KLF8 by microRNA microarray analysis [6]. [score:3]
miR141 belongs to the miR-200 family and this family of microRNAs plays a crucial role in inhibiting EMT, invasion and metastasis [30, 31]. [score:3]
Since miR141 and miR200c share the same promoter and KLF8 strongly represses this promoter (Figure 3G), it is likely that the regulation of miR200c and ZEB1 by KLF8 also contributes to the overall outcomes of the tumor progression. [score:2]
[1 to 20 of 8 sentences]
55
[+] score: 32
Other miRNAs from this paper: mmu-mir-200b, hsa-mir-200b, mmu-mir-200a, hsa-mir-200c, hsa-mir-200a
When Grhl2 was over-expressed, expression levels of the miR-200 family were up-regulated. [score:8]
EMT inducers, including Snai1, Twist1, Zeb1 and Zeb2, were up-regulated in Grhl2 knockdown MCF10A cells while expression levels of primary microRNA of miR-200c∼141 cluster whose products are negative regulators of Zeb1 and Zeb2, was decreased (Figure 2F). [score:8]
4T1-control cells recovered from primary tumors were mainly comprised of epithelial cells, and expressed E-cadherin, Grhl2 and miR-200, while 4T1-control cells recovered from lungs were characterized by mesenchymal morphology and did not express E-cadherin, Grhl2 and miR-200 (Figure 4F, 4G, 4H, 4I). [score:3]
Our data suggest that Grhl2 could be the transcription factor that drives the expression of miR-200 in breast cancer cells. [score:3]
Members of the miR-200 family are epithelial specific microRNAs and play a critical role in EMT by targeting Zeb1 and Zeb2 [21], [22]. [score:3]
In contrast, 4T1-Wnt7A2 cells recovered from either primary tumors or lungs had a spindle or round-like mesenchymal morphology and did not express E-cadherin, Grhl2 and miR-200 (Figure 4F, 4G, 4H, 4I). [score:3]
In Grhl2 knockdown MCF10A cells, the transcription level of miR-200c∼141 cluster was decreased. [score:2]
4T1-Wnt7A1 cells recovered from either primary tumors or lungs were characterized by a cobble-stone like epithelial morphology and expressed high levels of E-cadherin, Grhl2 and miR-200 (Figure 4F, 4G, 4H, 4I). [score:1]
Relative expression levels of primary microRNA-200C∼141 cluster, primary microRNA-200b∼200a cluster, and EMT inducers were measured by quantitative realtime PCR. [score:1]
[1 to 20 of 9 sentences]
56
[+] score: 32
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-205, mmu-mir-200a, mmu-mir-429
We then assessed whether overexpression of Etv5 could increase expression levels of any miRNA-200 family members. [score:5]
Expectedly, all the miRNA-200 family members were found to be expressed with higher expression levels in OSKME combination when compared that with OSKM during the first seven days of reprogramming (Fig.   3b). [score:4]
Gregory PA The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat. [score:4]
Interestingly, there are five sites in 3′ UTR of Zeb1 potentially targeted by cluster A of miRNA-200 family members (miR-200b,-200c, and -429) and three sites by cluster B of miRNA-200 family members (miR-200a and -141) (Fig.   3a). [score:3]
In parallel, Etv5 knockdown can promote specification of epiblast and its derivative mesoendoderm and ectoderm In this study, we demonstrated that Etv5 could promote MET at the early stage of reprogramming through Tet2-miR200- Zeb1 regulation axis, which further increased the final efficiency of iPSCs induction (Fig.   3e). [score:3]
Three sites (green) are supposed to be targeted by cluster B of miR-200 family (miR-200a, and -141). [score:3]
Five sites (orange) are supposed to be targeted by cluster A of miR-200 family (miR-200b,-200c and -429). [score:3]
Wang G Critical regulation of miR-200/ZEB2 pathway in Oct4/Sox2 -induced mesenchymal-to-epithelial transition and induced pluripotent stem cell generationProc. [score:2]
b RT-qPCR analysis of miR-200 family members during the early stage of reprogramming (Day 0–7). [score:1]
Data are shown as mean ± SD (n = 3), OSKM + EV was set as the control, * P < 0.05, ** P < 0.01, *** P < 0.001. c The diagram of genomic structure of miR-200 family on chromosome 4 and chromosome 6. The red regions represent miRNA clusters and green regions represent conserved noncoding sequence (CNS) across mammals. [score:1]
a Predicted binding sites of miR-200 family located in 3′ UTR of Zeb1. [score:1]
This speculation is consistent with the observation that Oct4/ Sox2 can induce MET by miR-200- Zeb2 pathway [14]. [score:1]
We first analyzed the complementation of 3′ UTR of Zeb1 mRNA and miRNA-200 family members. [score:1]
[1 to 20 of 13 sentences]
57
[+] score: 31
Importantly, although miR-200a-3p and miR-200b-3p had similar inhibitory activities, miR-200c-3p was a less potent inhibitor (Figure 2B). [score:5]
Relying on the variations between the miR-200a-3p and miR-200b-3p AMOs, we defined a central core UUACCA sequence changed to UUACCC in miR-200c-3p, which is potentially directly involved in the inhibitory activity of these 2′OMe AMOs on TLR7 sensing (Figure 4C). [score:4]
Given the similarity of the sequences, we were able to identify a central region (UUACCA) that was not conserved in miR-200c-3p and could be at play in the inhibitory activity of these molecules. [score:3]
We noted that miR-200a-3p, miR-200b-3p and miR-200c-3p 2′OMe AMOs had a strong inhibitory effect on immunostimulatory ssRNA sensing in primary BMMs. [score:3]
These results were confirmed in dose-response studies in primary BMMs, demonstrating that the miR-200a-3p 2′OMe AMO was significantly more inhibitory than the miR-200c-3p AMO (Figure 4A). [score:3]
While the native miR-200c-3p 2′OMe AMO was significantly less inhibitory than miR-200a-3p 2′OMe AMO, activity of its mutated variant miR-200c-3p mut (restoring the core UUACCA sequence) did not significantly differ from that of miR-200a-3p in either human PBMCs or mouse BMMs (Figure 4F). [score:3]
Given that the miR-200b-3p and miR-200c-3p AMOs only differ by two bases, we hypothesized that one of these two variations in the miR-200c-3p AMO was responsible for the decreased TLR7 -inhibitory activity (Figure 4C). [score:3]
To validate the TLR7 -inhibitory function of this motif in the miR-200 2′OMe AMOs, we synthesized two AMO variants of the miR-200a-3p 2′OMe AMO, with one (miR-200a-3p mut1) and three (miR-200a-3p mut2) base changes in the most conserved residues of the enriched motif (Figure 4C and D). [score:3]
While comparing the effects of miR-200 AMO variants, we noted that miR-200c-3p had a lesser capacity to inhibit TNF-α production, compared to miR-200a-3p and miR-200b-3p. [score:2]
Similar results were found with immunostimulatory ssRNA sensing in human PBMCs on TLR8, where the miR-200c-3p AMO was also significantly less potent than the miR-200a-3p AMO at reducing TNF-α production (Figure 4B). [score:1]
Ordinary two-way ANOVA with Dunnett's multiple comparison tests to miR-200c-3p+B-406AS-1 are shown. [score:1]
[1 to 20 of 11 sentences]
58
[+] score: 31
miR-200 family members directly target Zeb1/Zeb2 and enhance E-cadherin expression, resulting in the suppression of murine mammary tumor cell migration [33, 36]. [score:8]
In contrast, Zeb1 suppresses the expression of miR-200 family members, forming a regulatory feedback loop [37]. [score:6]
However, the function of miR-200a in the initiation of vertebrate embryo development has not been reported (A list of miR-200 family members targets in stem cells and development is shown in Table 1). [score:5]
The miR-200 family consists of five members (miR-200a, -200b, -200c, -141 and -429) that are expressed as two separate polycistronic pri-miRNA transcripts. [score:3]
To determine whether miR-200 family is responsive to ES cell differentiation, we analyzed miR-200 mumbers (miR-200a, miR-200b and miR-429) expression during ES cell spontaneous differentiation by quantitative real-time PCR. [score:3]
miR-200 family menbers in stem cells and development. [score:2]
Previous studies show that miR-200 family members are emerging as important regulators of cell proliferation, differentiation and metastasis [29– 31]. [score:2]
The sequences encoding miR-200b/200a/429 exist as a cluster on mouse chromosomes 4, and those encoding miR-200c/141 exist as a cluster on chromosome 6 [32]. [score:1]
In previous studies, miR-200 family members were shown to promote the mesenchymal-epithelial transition (MET) and to activate the differentiation of pancreatic, colorectal and breast cancer cells into epithelial cells [33– 35]. [score:1]
[1 to 20 of 9 sentences]
59
[+] score: 30
The miR-299a-3p, miR-302b-5p, miR-499 and miR-200c-3p were all up-regulated in EPO-MVs; the up-regulation of miR-499 and miR-200c-3p was significant (p < 0.001, n = 3). [score:7]
Korpal M Lee ES Hu G Kang Y The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2J Biol Chem. [score:6]
The miRNA profiles of the MVs revealed that EPO-MVs changed 212 miRNAs (fold-change ≥ 1.5), including miR-299, miR-499, miR-302, and miRNA-200, and that 70.28 % of these changes involved upregulation. [score:4]
Our findings also demonstrate that miR-299, miR-499, miR-302, and miRNA-200 were upregulated in EPO-MVs (Fig.   8c). [score:4]
d The bar plot shows the top ten enrichment score value of the significant enrichment pathway of the predicted possible target genes of miR-299a-3p, miR-302b-5p, miR-499 and miR-200c-3p. [score:3]
In vitro studies have demonstrated that members of the miRNA-200 family inhibit the E-cadherin transcriptional repressors ZEB1 and ZEB2, which are implicated in EMT [45]. [score:3]
e The plot shows top ten biologic functions from the predicted possible target genes of miR-299a-3p, miR-302b-5p, miR-499 and miR-200c-3p, P-value cutoff (p < 0.05). [score:3]
[1 to 20 of 7 sentences]
60
[+] score: 30
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-200a
We previously showed that GRHL2 upregulates the expression of miR-200 family genes and other epithelial-specific genes, e. g., p63, K14, E-Cad, and β-catenin, while it suppressed mesenchymal regulators, e. g., fibronectin (FN), N-Cad, ZEB1, and ZEB2 [7]. [score:9]
Generally, GRHL2 regulates epithelial phenotype through direct transcriptional control of its target genes, e. g., E-Cad, p63, hTERT, miR-200 family genes, and EDC genes 4, 5, 7. The current study revealed an alternative pathway, in which GRHL2 determines epithelial phenotype through activation of the MAP kinase signaling, which then suppresses Smad -dependent TGF-β signaling molecules. [score:7]
This pathway is distinct from the transcriptional regulation of the target genes, e. g., E-cadherin, hTERT, p63, and miR-200 family genes, by direct GRHL2 binding at the promoter regions Mechanistic scheme is drawn to depict the functional interaction between GRHL2 and TGF-β signaling through Erk and JNK MAP kinase signaling. [score:5]
This pathway is distinct from the transcriptional regulation of the target genes, e. g., E-cadherin, hTERT, p63, and miR-200 family genes, by direct GRHL2 binding at the promoter regions SCC4, SCC9, FaDu, and SCC15 cell lines were purchased from the ATCC (Manassas, VA) and were cultured in DMEM/Ham’s F-12 (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS) and 0.4 µg/ml hydrocortisone. [score:5]
In addition, GRHL2 is a critical determinant of the epithelial phenotype through transcriptional regulation of the relevant effector molecules, e. g., miR-200 family genes and ZEB1, which also determine cellular plasticity 7– 9. GRHL2 has been shown to suppress epithelial–mesenchyme transition (EMT) induced by TGF-β in human mammary epithelial cells [9], while the mechanisms underlying the functional interaction between GRHL2 and TGF-β are not known. [score:4]
[1 to 20 of 5 sentences]
61
[+] score: 29
Five of these miRNAs were upregulated (miR-429, miR-200a, miR-200b, miR-200c and miR-10b) and one of them was downregulated (miR29-b) in the aggressive S2B11 clone compared to S2D10 (Figure 6A). [score:6]
We found that five miRNAs were significantly upregulated (miR-429, miR-200a, miR-200b, miR-200c and miR-10b) and one of them was significantly downregulated (miR-29b) in aggressive clone compared to non-aggressive one. [score:6]
This upregulation may be a key event in the aggressive clones of heterogeneous DCIS lesions, and the specific roles of the miR-200 family in our aggressive clones and their contribution to disease progression will be the focus in our future studies. [score:6]
We have observed that four members of miR-200 family were upregulated in our aggressive clones. [score:4]
MiR-200b, miR-200c and miR-429 were shown to be upregulated in DCIS lesions compared to normal breast tissues [23]. [score:3]
MiR-200 family regulates epithelial-to-mesenchymal transition (EMT) and mesenchymal-to-epithelial transition (MET) through the inhibition of ZEB1 and ZEB2 [26]. [score:3]
MiR-200 family is an example to such miRNAs. [score:1]
[1 to 20 of 7 sentences]
62
[+] score: 27
For example, miR200 targets snai2, zeb1 and zeb2 mRNA [57– 59] whereas miR203 targets snai1 and zeb2 mRNA [59], and miR34 targets snai1 mRNA [60]. [score:7]
The miR200 expression can also be induced by p63 and p73 proteins, while miR34 is only induced by p73 but is down-regulated by p63 [65– 67]. [score:6]
The different isoforms of AKT seem to have opposing roles in the regulation of microRNAs: AKT1 inhibits miR34 and activates miR200 while AKT2 inhibits miR200 and activates miR34 [81]. [score:6]
To make our mo delling more insightful, we reduced the complexity by lumping variables into modules corresponding to signalling pathways: the TGF-β pathway (TGFb_pthw consisting of TGFbeta, SMAD), Notch pathway (Notch_pthw, includes activated Notch intracellular domain (NICD), the WNT pathway (WNT_pthw consisting of DKK1, CTNNB1), the p53 pathway (p53, consisting of p53), the p63-p73 proteins (p63_73 consisting of p63 and p73), the miRNA (miR34, miR200, miR203), the EMT regulators (EMT_reg including Twist1, Zeb1, Zeb2, Snai1, Snai2, Cdh2, Vim), E-cadherin (Ecadh with Cdh1), growth factors (GF), the ERK pathway (ERK_pthw: ERK), p21 is included in the CellCycleArrest phenotype, AKT1 module and AKT2 module. [score:2]
miR200 ZEB2 (SNAI1 | (SNAI2 & TWIST1) | NICD) & ! [score:1]
Cell migration depends on pathways involving AKT, ERK, Vimentin, miR200 and p63 but also on the acquisition of EMT and invasive abilities such as producing MMPs to dissolve the laminae propria enabling migration to distant sites. [score:1]
AKT1 Apoptosis (p53 | p63 | p73 | miR200 | miR34) & ! [score:1]
AKT1 GF !CDH1 & (GF | CDH2) miR200 (p63 | p53 | p73) & ! [score:1]
miR200 & ! [score:1]
miR203 CellCycleArrest (miR203 | miR200 | miR34 | ZEB2 | p21) & ! [score:1]
[1 to 20 of 10 sentences]
63
[+] score: 27
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-203, mmu-mir-205, mmu-mir-200a
Upregulation of CDH1 in OSC-19 RICs may be directly caused by KLF4 [36], since they did not show downregulation of SNAI, ZEB families or up-regulation of miR-200 family. [score:11]
It has been reported that the EMT-inducing transcription factors, which suppress the CDH1 expression, are negatively regulated by the miRNAs (miR-200 family, miR-203, and miR-205, etc. ) [score:6]
The HOC313 RICs showed increased levels of miR-200 family members (miR-200a, -200b, -200c, -141, and -429), miR-203, and miR-205 (Fig 3G), which could down-regulate the SNAI and ZEB families [15– 17]. [score:4]
In accordance with this observation, significant up-regulation of miR-200 family, (miR-200a, -200b, -200c, -141, and -429), miR-203, and miR205 was detected in the RICs from HOC313 cells. [score:4]
The OSC-19 RICs showed increased levels of miR-203 and miR-205, although the miR-200 family members were not altered (Fig 4I). [score:1]
This result is consistent with the previous study showing that OCT3/4 and SOX2 induce the miR-200 family during iPS generation [35]. [score:1]
[1 to 20 of 6 sentences]
64
[+] score: 27
miR-21a-3p, miR-31-5p, miR-155-5p and miR-200c were upregulated while miR-217-5p, miR-802-5p, miR-375-5p and miR-216-5p were downregulated (Color figure online) Surprisingly, in upregulated mRNAs, it was not the classical pancreatic progenitor-related genes that changed the most. [score:10]
miR-21a-3p, miR-31-5p, miR-155-5p and miR-200c were upregulated while miR-217-5p, miR-802-5p, miR-375-5p and miR-216-5p were downregulated (Color figure online) Surprisingly, in upregulated mRNAs, it was not the classical pancreatic progenitor-related genes that changed the most. [score:10]
In our results, miR-21a, miR-31, miR-200c and miR-155 were upregulated and miR-217, miR-802, miR-375 and miR-216 were downregulated (Additional file 9: Table S5). [score:7]
[1 to 20 of 3 sentences]
65
[+] score: 27
According to prior work, the miR-200 family is induced by NO donors and contributes to Zeb2 downregulation during mESC mesendodermal differentiation [28]. [score:4]
Western blot analysis showed that the inhibition of miR-200b, the most NO-sensitive miR-200 family member, rescued Zeb1 levels both in DM and in NO conditions (Supplementary Fig.   3d). [score:3]
Of note, miR-200c and miR-141, belonging to the miR-200 family cluster 2 and mapping to mouse chromosome 6 (Supplementary Fig.   1c, left lower cartoon), were not significantly upregulated by NO compared to controls (Supplementary Fig.   1c, middle lower graph). [score:3]
Kim Y Lineage-specific expression of miR-200 family in human embryonic stem cells during in vitro differentiationInt. [score:3]
Furthermore, p53 positively regulates the miR-200 family transcription 34, 35 and NO is among the signaling molecules regulating p53 [35]. [score:3]
Brabletz S Brabletz T The ZEB/miR-200 feedback loop--a motor of cellular plasticity in development and cancer?EMBO Rep. [score:2]
Moreover, ChIP experiments revealed a feedback loop regulation between Zeb1 and miR-200 family in mESC (Supplementary Fig.   3e). [score:2]
To establish whether the NO -mediated Zeb1 down-modulation was regulated by induction of miR-200 family, we analyzed Zeb1 protein levels in mESC transfected with scramble or anti-miR-200b oligonucleotides. [score:2]
In this condition, chromatin immunoprecipitation (ChIP) showed p53 bound to the miR-200 cluster 1 promoter region (Supplementary Fig.   1f). [score:1]
To assess NO responsiveness at the molecular level, we evaluated the expression of the miR-200 family members. [score:1]
This evidence suggests the presence of a molecular circuitry involving mir-200, Zeb factors, Hdacs and pluripotency genes contributing to keep mESC undifferentiated [30]. [score:1]
Specifically, we observed an enrichment of Zeb1 binding on miR-200 family cluster 1 promoter in mESC kept in GS, suggesting active repression of the miR-200 family in self-renewal condition. [score:1]
Conversely, in cells released from GS in the presence of NO, miR-200 family member induction was robust and significant for all cluster components (Supplementary Fig.   1c, right graphs). [score:1]
[1 to 20 of 13 sentences]
66
[+] score: 26
PJ up-regulates genes involved in cell adhesion such as E-cadherin, intercellular adhesion molecule 1 (ICAM1) and myristoylated alanine-rich protein kinase C (MARCKS) and down-regulates genes involved in cell migration such as type I collagen, tenascin C and chimerin 1. In addition, anti-invasive microRNAs such as miR-335 (predicted targets include COL1A1, TNC, SOX4), miR-205 (predicted targets include CHN1, PRKCE), miR-200 (predicted targets include ZEB1, ZEB2), and miR-126 (predicted targets include SLC45A3), are up-regulated, whereas pro-invasive microRNA such as miR-21 (predicted targets include MARCKS, PDCD4, TPM1) and miR-373 (predicted targets include CD44), are down-regulated. [score:25]
Furthermore, we found that L + E + P increases several well-known anti-invasive miRNAs, such as miR-200c and miR-335, while decreasing several oncogenic miRNAs, such as miR-21 and miR-29b. [score:1]
[1 to 20 of 2 sentences]
67
[+] score: 25
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Shimono Y Zabala M Cho RW Lobo N Dalerba P Qian D Downregulation of miRNA-200c links breast cancer stem cells with normal stem cellsCell. [score:4]
Gregory PA Bert AG Paterson EL Barry SC Tsykin A Farshid G The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat Cell Biol. [score:4]
Interestingly, miR-200c targets the mRNA encoding BMI1, a key regulator of the self-renewal of stem cells in multiple tissues. [score:4]
In human mammary epithelial cell lines, the expression of the miR-200 family was recently found to be subject to epigenetic regulation, whereby DNA methylation and histone modifications were altered during the transition between stem-like and nonstem states [67]. [score:4]
In the mouse mammary epithelial cell line, Comma-Dβ [19], the expression of miR-205 and miR-22 but not let-7 and miR-93 was linked to progenitor-like properties, while miR-200c appears to function within the basal cell compartment of normal breast tissue [20]. [score:3]
More specifically, the expression of some miRNAs has been linked to histopathological features such as HER2/ neu or ER/PR status (miR-30), metastasis (miR-126 and miR-335) and the EMT (miR-205 and miR-200 family) [43, 76– 79]. [score:3]
Bracken CP Gregory PA Kolesnikoff N Bert AG Wang J Shannon MF A double -negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transitionCancer Res. [score:2]
Lim YY Wright JA Attema JL Gregory PA Bert AG Smith E Epigenetic modulation of the miR-200 family is associated with transition to a breast cancer stem-cell-like stateJ Cell Sci. [score:1]
[1 to 20 of 8 sentences]
68
[+] score: 23
When compared with expression profiles of miRNAs associated with renal cancer, there was a 15% overlap with the miRNAs described in a recent report [54]; however, only miR-376a [67] out of the highly upregulated miRNAs, and miR-638, miR-200b and miR-200c from the highly downregulated miRNAs, were found to be in common between our studies and other studies [67], [70], [71], [72]. [score:8]
Similarly, the miRNAs down-regulated in 10-87 HP cells and 10-87 T cells, such as miR-31, miR-200c, miR-218, and miR-183, were also found to be down-regulated in A4497 VERO cells and SF-VERO cells. [score:7]
These initial changes consisted of the down-regulation of multiple miRNAs, highlighted by the down-regulation of miR-31, miR-200c, and miR-218. [score:7]
qRT-PCR analysis confirmed that miR-376a, miR-654-3p, miR-543, miR-382, miR-31, miR-200c, miR-218, and miR-183 paralleled the microarray miRNA levels. [score:1]
[1 to 20 of 4 sentences]
69
[+] score: 23
In MDA-MB-231 cells expressing the OVOLs, we used to assess expression of miR-200 family members (miR-200a, miR-200b, miR-200c, miR-141, miR-429, miR205, miR-203), relative to controls miR-U6 and miR16. [score:5]
Comparing these observations to the MDA-MB-231 mo del, we found no general correlation between the expression of OVOL and the members of miR-200 -family across cell types, suggesting that regulation of miRNA-200s is cell-type specific. [score:4]
Specifically, ZEB1 can induce EMT by repressing epithelial proteins and by downregulating its own miR-200 repressors. [score:4]
However, the expression of both OVOL TFs resulted in the induction of miR-429, miR-208 and miR-200c. [score:3]
It has been proposed that EMT is regulated by reciprocal feedback loops between ZEB1/ZEB2 TFs and members of the MicroRNA miR-200 family [6, 7]. [score:2]
This suggests that, in addition to the previously described mechanism, the OVOL -mediated MET may involve regulation of the miR-200 family. [score:2]
The double-transduced cells showed greater than 2-fold increases in miR-200a, miR-200c, and miR-429 (Figure 6E), while only modest changes were seen in the single-transduced cells. [score:1]
Given evidence of reciprocal feedback loops between ZEB1/2 and miR-200 family members in EMT-MET transformations [7, 26], we explored the contribution of miR-200s as potential inducers of epithelial differentiation in the breast and prostate cancer mo dels. [score:1]
It has been suggested that ZEB1 mediates EMT-MET plasticity through a feedback loop including the microRNA-200 family [26]. [score:1]
[1 to 20 of 9 sentences]
70
[+] score: 22
Some of the results are in accordance with previous studies, such as the up-regulation of mmu-miR-221 and mmu-miR222 cluster and the down-regulation of the mmu-miR-200 family, as well as of mmu-miR-204, mmu-miR-30a*, mmu-miR-193, mmu-miR-378 and mmu-miR-30e*. [score:7]
On the contrary, the following miRNAs were down-regulated in WAT after HFD feeding: mmu-miR-141, mmu-miR-200a, mmu-miR-200b, mmu-miR-200c, mmu-miR-122, mmu-miR-204, mmu-miR-133b, mmu-miR-1, mmu-miR-30a*, mmu-miR-130a, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-203, mmu-miR-378 and mmu-miR-30e*. [score:4]
The down-regulation of mmu-miR-200b and mmu-miR-200c after HFD -induced obesity, is in accordance with a previous study which showed that the mmu-miR-200 family promotes adipogenesis [43]. [score:4]
Mmu-miR-200b and mmu-miR-200c(members of the mmu-miR-200 family), mmu-miR-203 and mmu-miR-192 target Zeb1 and Zeb2 that regulate epithelial to mesenchymal transition [41] and have recently been implicated in adipogenesis and obesity [42]. [score:4]
The following 22 murine microRNAs were selected for qPCR validation of their expression: mmu-miR-1, mmu-miR-21, mmu-miR-30a*, mmu-miR-30e*, mmu-miR-122, mmu-miR-130a, mmu-miR-133b, mmu-miR-141, mmu-miR-142-3p, mmu-miR-142-5p, mmu-miR-146a, mmu-miR-146b, mmu-miR-192, mmu-miR-193a-3p, mmu-miR-200b, mmu-miR-200c, mmu-miR-203, mmu-miR-204, mmu-miR-222, mmu-miR-342-3p, mmu-miR-378 and mmu-miR-379. [score:3]
[1 to 20 of 5 sentences]
71
[+] score: 21
The miR-200 family was significantly upregulated during T2AECs differentiation in fetal lung; miR-200 induction was inversely correlated with expression of known targets, transcription factors ZEB1/2, and TGF-β2. [score:8]
miR-200 antagonists inhibited thyroid transcription factor (TTF)-1 and surfactant proteins and upregulated TGF-β2 and ZEB1 expression in T2AECs [44]. [score:8]
Benlhabib H Guo W Pierce BM Men delson CR The miR-200 family and its targets regulate type II cell differentiation in human fetal lungJ. [score:4]
Koutsaki M Spandidos DA Zaravinos A Epithelial-mesenchymal transition -associated miRNAs in ovarian carcinoma, with highlight on the miR-200 family: prognostic value and prospective role in ovarian cancer therapeuticsCancer Lett. [score:1]
[1 to 20 of 4 sentences]
72
[+] score: 20
The highly conserved miR-200 family is composed of five members, miR-200a, miR-200b, miR-200c, miR-141 and miR-429, which are similar in sequence and are clustered and expressed as two separate polycistronic pri-miR transcripts: the miR-200b/a/429 cluster on chromosome 4 and the miR-200c/141 cluster on chromosome 6. The miR-200 family has been reported to be strongly expressed in lung, kidney and thymus tissues [13]. [score:5]
The miR-200 family has also been shown to be involved in the epithelial-to-mesenchymal transition in humans, thereby enhancing cancer cell colonization in distant tissues by targeting zeb1, and in the regulation of olfactory neurogenesis and osmotic stress in zebrafish [16, 17]. [score:4]
MiR-200, down-regulated in the livers of db/db mice, also contribute to IL-6 -induced insulin resistance [21]. [score:3]
Hasuwa et al revealed the requirement of miR-200 family and their target zeb1 in hypothalamo-pituitary-ovarian axis to support female ovulation [13]. [score:3]
Our data suggest either that the role of the miR-200 family in the regulation of body weight homeostasis is not evolutionarily conserved or that mice are not completely analogous to flies. [score:2]
miR-8, the homolog of miR-200 in Drosophila, has been reported to positively regulate body size [18]. [score:2]
Previous studies showed the critical functions of miR-200 family in female reproduction [14, 15]. [score:1]
[1 to 20 of 7 sentences]
73
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
Out of these 25 miRNAs, 18 miRNAs were differentially expressed in a consistent manner between the 2 groups (Figure 4A, highlighted); 8 miRNAs were downregulated in both groups (miR-16, miR-200, miR-205, miR-3064, miR-379, miR-431, miR-485 and miR-491) and 10 miRNAs were upregulated in both groups (miR-194, miR-1894, miR-211, miR-3072, miR- 3077, miR-4436, miR-5128, miR-669a, miR-669c and miR-6967). [score:9]
MiRNAs (miR-199 and miR-200) were significantly upregulated in cbs [+/–] in comparison with the control ([*] p < 0.05, [**] p < 0.01). [score:4]
However, miR-199 (p value = 0.01) and miR-200 (p value = 0.004) in contrary to the microarray results were significantly upregulated in cbs [+/–] in comparison with the control cbs [+/+] (p value < 0.05). [score:4]
Hcy also induces alteration of miRNAs related to tight junctions signaling such as miR-128, miR-132, miR-133, miR-195, miR-3473, miR-19, miR-200, miR-205, miR-214, miR-217, miR-23, miR-26, miR-29, miR-30, miR-31 AND miR-690. [score:1]
[1 to 20 of 4 sentences]
74
[+] score: 16
Of these, 12 (mir-9, mir-200c, mir-708, mir-377, mir-26b, mir-296, mir-369, mir-32, mir-1965, mir-1190, mir-135b and mir-201) were differentially up-regulated and five (mir-291a, mir-190b, mir-297c, mir-713 and mir-470) were differentially down-regulated. [score:7]
The up-regulated miRNAs, including miR-708, miR-296, miR-200c, miR-377 and miR-1190, were all strongly predicted to affect target genes involved in the MAPK pathway. [score:6]
Mitogen-activated protein kinase (MAPK) signaling pathway was one of the most significant pathways to be affected by 74 target genes of miR-708, miR-296, miR-200c, miR-377 and miR-1190 (Table 1). [score:3]
[1 to 20 of 3 sentences]
75
[+] score: 16
Other miRNAs from this paper: mmu-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-mir-200a, mmu-mir-34a
In particular, our work is consistent with the findings that p53 upregulates miR-200 which in turns downregulates Zeb1 and Zeb2 and reduces EMT in liver cancer cells [43]. [score:7]
In mammary epithelial cells and HCC cell lines, p53 regulates EMT by up -regulating the expression of miR-200, thereby repressing Zeb1 and Zeb2 [42], [43]. [score:5]
In our study, we did find a decreased expression of miR-200 family members when p53 was silenced (Figure S6 in File S1), further supporting the idea that p53 may influence EMT through regulating miR-200 family. [score:4]
[1 to 20 of 3 sentences]
76
[+] score: 16
Concomitant with the large induction of epithelial -associated genes and repression of mesenchymal regulators, MET -associated miRNAs miR-205-5p and the miR-200 family (miR-200a-3p, miR-200b-3p, miR-200c-3p, miR-141-3p and miR-429-3p) [23- 26] were markedly upregulated (at least four-fold) in the Thy1- to SSEA1+ transition (Figure 2; Additional file 3). [score:5]
Another TGFβ pathway miRNA, miR-203-3p, was not upregulated until the Thy1- to SSEA1+ transition, along with the miR-200 family [35]. [score:4]
The miR-200 family did not significantly decline in the newly reprogrammed Oct4-GFP+ line; however, many of these miRNAs were expressed at lower levels in the iPSC line with higher passages and in the mES cell line, suggesting that, with additional passages, iPSCs more closely resemble mES cells. [score:3]
miRNAs associated with the MET (miR-200a, b, c-3p, miR-141-3p, miR-429-3p, miR-205-5p) [23- 26] were not differentially expressed between the piPSC lines and the stem cell lines, with the exception of miR-200c-3p. [score:3]
Interestingly, the Dlk1-Dio3 miRNAs<