sort by

76 publications mentioning mmu-mir-212

Open access articles that are associated with the species Mus musculus and mention the gene name mir-212. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 358
To confirm whether XIAP is critical for the function of miR-212 in RCC, we overexpressed XIAP in CAKI-2 cells overexpressing miR-212 and investigated whether restoring XIAP expression could reverse the inhibitory effect of miR-212 on CAKI-2 cells. [score:7]
Therefore, these data indicate that miR-212 inhibits the proliferation, migration and invasion of RCC cells by targeting XIAP protein, and can potentially serve as a promising therapeutic target for RCC. [score:7]
XIAP overexpression reversed the inhibitory effect of miR-212 overexpression on CAKI-2 cells. [score:7]
After confirming the expression and function of miR-212 and XIAP in RCC, we lastly examined whether aberrant expression of miR-212 and its downstream target XIAP could predict the prognosis of RCC patients. [score:7]
The top 8 downregulated (hsa-miR-200c, hsa-miR-212, hsa-miR-29a, hsa-miR-532, hsa-miR-141, hsa-miR-1, hsa-miR-363, hsa-miR-187) and 8 upregulated (hsa-miR-487, hsa-miR-452, hsa-miR-1233, hsa-miR-92a, hsa-miR-106b, hsa-miR-1290, hsa-miR-320, hsa-miR-26a) miRNAs were presented in Figure 1A. [score:7]
The expression level of miR-212 is down-regulated in RCC. [score:6]
In summary, this study finds that miR-212 is down-regulated in RCC and its decreased expression is associated with RCC progression. [score:6]
In this study we demonstrated that overexpression of miR-212 could inhibit the viability, proliferation, migration and invasion of RCC cells while miR-212 knockdown promoted these biological functions of RCC cells. [score:6]
Furthermore, Kaplen-Merier analysis demonstrated that both miR-212 down-regulation and XIAP overexpression predicted the poor prognosis of RCC patients. [score:6]
X-linked inhibitor of apoptosis protein (XIAP) was found to be the direct downstream target of miR-212. [score:6]
Moreover, inhibiting XIAP expression in ACHN cells (P<0.05, Figure 8A) abrogated the promoting effect of miR-212 knockdown on cell viability (P<0.05, Figure 8B), proliferation (P<0.05, Figure 8C), migration (P<0.05, Figure 8D) and invasion (P<0.05, Figure 8E). [score:6]
X-linked inhibitor of apoptosis protein (XIAP), a critical regulator of cell proliferation, apoptosis and motility [17– 19], was predicted to be a potentially downstream target of miR-212. [score:6]
As shown in Figure 7A, XIAP vector significantly increased XIAP expression in in CAKI-2 cells overexpressing miR-212 (P<0.05). [score:5]
To clarify the molecular mechanisms underlying the tumor suppressive roles of miR-212 in RCC, we used the public database to search for the potentially downstream targets of miR-212. [score:5]
On the other hand, miR-212 inhibitor significantly decreased the expression of miR-212 in ACHN cells (P<0.05, Figure 3A). [score:5]
Functionally, overexpressing XIAP reversed the inhibitory effects of miR-212 on cell viability (P<0.05, Figure 7B), proliferation (P<0.05, Figure 7C and 7D), migration (P<0.05, Figure 7F) and invasion (P<0.05, Figure 7F). [score:5]
MiR-212 overexpressing vector, the control vector, miR-212 inhibitor and the negative control were bought from the company of Genecopoeia (Guangzhou, China). [score:5]
Functionally, miR-212 was found to inhibit the growth of hepatocellular carcinoma by targeting FOXA1 [10]. [score:5]
Therefore, these data indicate that miR-212 plays tumor-suppressive role in RCC by inhibiting the proliferation, migration and invasion of RCC cells. [score:5]
These data demonstrate that miR-212 could inhibit the expression of XIAP in RCC cells by interacting with the 3′-UTR of XIAP. [score:5]
Study of gastric cancer also demonstrated that miR-212 inhibited the proliferation of gastric cancer cells by inhibiting [21]. [score:5]
Therefore, miR-212 exerted its tumor suppressive roles in RCC by inhibiting cell viability, proliferation, migration and invasion. [score:5]
Transfection of miR-212 inhibitor significantly decreased the expression of miR-212 in ACHN cells. [score:5]
Taken together, these data demonstrate that miR-212 can inhibit XIAP expression in RCC. [score:5]
ACHN cells in 24-well plates were cultured in OptimMEM reduced serum media (Life Technologies), and were transfected with luciferase reporter construct (the wt or mt 3′-UTR of XIAP) and miR-212 overexpressing vector, miR-212 inhibitor, corresponding control vectors or negative control vectors using Fugene (Promega, Madison, WI, USA). [score:5]
miR-212 overexpression inhibited the in vivo growth of CAKI-2 cells in nude mice. [score:5]
MiR-212 downregulation and XIAP overexpression predict poor prognosis of RCC. [score:5]
In contrast, miR-212 overexpression or knockdown did not have any effect on the luciferase activity of mutated XIAP 3′-UTR (Figure 6B). [score:4]
MiR-212 exerted its tumor suppressive roles in RCC by targeting XIAP. [score:4]
MiR-212 was one of the downregulated miRNAs in RCC tissues. [score:4]
Furthermore, we identify that XIAP protein was the direct downstream target of miR-212. [score:4]
Downregulating miR-212 increased the luciferase activity of wild type XIAP 3′-UTR but not mutated 3′-UTR of XIAP. [score:4]
Figure 3 (A) miR-212 inhibitor was used to knockdown miR-212 in ACHN cells. [score:4]
MiR-212 overexpression significantly inhibited the cell migration and invasion of CAKI-2 cells. [score:4]
In this study, we identified that miR-212 was down-regulated in RCC tissues and cells. [score:4]
The data in Supplementary Figure 1A and 1B showed that miR-212 overexpression increased the Caspase3/7 activity while its knockdown decreased the Caspase3/7 activity (P<0.05). [score:4]
MiR-212 overexpression inhibited the cell viability, proliferation, migration and invasion of CAKI-2 cells. [score:4]
MiR-212 overexpression significantly inhibited the cell viability of CAKI-2 cells. [score:4]
Overexpression of miR-212 significantly decreased while miR-212 knockdown significantly increased the luciferase activity of wild type XIAP 3′-UTR (P<0.05, Figure 6B). [score:4]
RCC patients with low expression level of miR-212 had significantly decreased rate of Overall survival (OS) (A) and Recurrent-free survival (RFS) (B). [score:3]
Transfection of miR-212 mimic significantly increased the expression of miR-212 in CAKI-2 cells. [score:3]
Figure 7 (A) The XIAP vector significantly increased the mRNA and protein level of XIAP in CAKI-2 overexpressing miR-212. [score:3]
Decreased expression level of miR-212 was correlated with poor prognosis of RCC patients. [score:3]
These data indicate that XIAP is not only a downstream target of miR-212, but also a functional mediator of miR-212 in RCC. [score:3]
Previous stduies showed FOXA1, HBEGF, MECP2 and PED were the downstream targets of miR-212 in different types of cells. [score:3]
On the other hand, miR-212 was also found to be overexpressed and play oncogenic roles in pancreatic cancer [15, 16]. [score:3]
The expression of XIAP in RCC tissues was negatively correlated with miR-212 level. [score:3]
In vivo studies also confirmed that miR-212 inhibited the growth of RCC cells in nude mice. [score:3]
Furthermore, and western blot confirmed that miR-212 overexpression decreased the mRNA (P<0.05, Figure 5C) and protein (P<0.05, Figure 5D) level of XIAP in CAKI-2 cells. [score:3]
XIAP mediates the tumor suppressive functions of miR-212 in RCC. [score:3]
XIAP knockdown abrogated the promoting effect of miR-212 knockdown on ACHN cells. [score:3]
RCC patients with high expression level of miR-212 had significantly decreased rate of OS (C) and RFS (D). [score:3]
However, the expression and function of miR-212 in RCC remain unknown. [score:3]
The expression of miR-212 was significantly decreased in RCC tissues of TNM I stage. [score:3]
Furthermore, the expression level of miR-212 in RCC tissues at stage II-IV was significantly decreased (P<0.05, Figure 1D). [score:3]
MiR-212 overexpression significantly inhibited the cell proliferation of CAKI-2 cells, as suggested by BrdU assay and 3D culture. [score:3]
Ki67 staining and Tunel staining confirmed that miR-212 overexpression significantly decreased the proliferation (P<0.05, Figure 4B) and decreased the apoptosis (P<0.05, Figure 4B) of CAKI-2 cells in nude mice. [score:3]
IAP expression is negatively correlated with miR-212 level in RCC tissues. [score:3]
These data demonstrate that miR-212 is a tumor suppressive microRNA in RCC. [score:3]
The expression of miR-212 was significantly decreased in RCC tissues. [score:3]
further confirmed that the expression of miR-212 was significantly decreased in RCC tissues. [score:3]
Figure 4MiR-212 inhibited the in vivo growth of RCC cell in nude mice (A) CAKI-2 control cells and CAKI cell overexpressing miR-212 were subcutaneous injected into nude mice to investigate the effect of miR-212 on in vivo growth of RCC cells. [score:3]
XIAP is the downstream target of miR-212 in RCC. [score:3]
Overexpression of miR-212 significantly decreased the cell viability of CAKI-2 cells (P<0.05, Figure 2B). [score:3]
In this study,, western blot and luciferase activity assay demonstrated that XIAP was the direct downstream target of miR-212 in RCC. [score:3]
To clarify the detailed mechanisms by which miR-212 exerts tumor suppressive effects in RCC cells, we further investigated the downstream target of miR-212. [score:3]
However, study of pancreatic cancer cells found that miR-212 promoted cell proliferation by targeting patched-1 [16]. [score:3]
CAKI-2 cells transfected with miR-212 overexpressing vector or control vectors were suspended in 100 uL PBS and were injected subcutaneously into the flank of nude mouse. [score:3]
Transfection of miR-212 overexpressing vector into CAKI-2 cells significantly increased miR-212 level in CAKI-2 cells (P<0.05, Figure 2A). [score:3]
The expression of miR-212 was significantly decreased in RCC tissues of T1 stage. [score:3]
The mean expression level of miR-212 and XIAP was defined as cutoff value to divide RCC patients into: miR-212 low group and high group, and, XIAP low group and high group. [score:3]
XIAP was the downstream target of miR-212 in RCC. [score:3]
Figure 2 (A) miR-212 mimic was used to overexpress miR-212 in CAKI-2 cells. [score:3]
As shown in Figure 9A and 9B, decreased expression of miR-212 was correlated with decreased rate of overall survival (OS) (P<0.05) and recurrent-free survival (RFS) (P<0.05). [score:3]
In vitro and in vivo studies confirm that miR-212 inhibit the proliferation, migration and invasion of RCC cells. [score:3]
MiR-212 inhibited the in vivo growth of RCC cell in nude mice. [score:2]
MiR-212 level was negatively correlated with XIAP expression in RCC tissues. [score:2]
MiR-212 inhibited the proliferation, migration and invasion of RCC cells. [score:2]
BrdU and 3D culture demonstrated that compared with control vector, miR-212 overexpressing vector significantly decreased the proliferative ability of CAKI-2 cells (P<0.05, Figure 2C and 2D). [score:2]
MiR-212 expression was decreased in RCC. [score:2]
Western blot further demonstrated that in RCC tissues with high miR-212 level, the expression of XIAP was significantly decreased, compared with the tissues of low miR-212 level (P<0.05, Figure 6C). [score:2]
Furthermore, Transwell assay confirmed that forced expression of miR-212 significantly reduced the migration (P<0.05, Figure 2E) and invasion (P<0.05, Figure 2F) of CAKI-2 cells. [score:2]
Compared with HK-2 cells, the expression of miR-212 was significantly decreased in RCC cell lines (ACHN, 786-O, SN12PM6, OS-RC-2 and CAKI-2). [score:2]
Figure 8 (A) The XIAP shRNA significantly decreased the mRNA and protein level of XIAP in ACHN cells with miR-212 knockdown. [score:2]
MiR-212 level was negatively correlated with XIAP expression level in RCC tissues. [score:2]
Knockdown of miR-212 resulted in increased cell viability (P<0.05, Figure 3B), proliferation (P<0.05, Figure 3C and 3D), migration (P<0.05, Figure 3E) and invasion (P<0.05, Figure 3F) of ACHN cells. [score:2]
Compared with CAKI-2 cells transfected with control vector, CAKI-2 cells overexpressing miR-212 showed significantly decreased in vivo growth ability (P<0.05, Figure 4A). [score:2]
MiR-212 inhibits the proliferation, migration and invasion of RCC cells. [score:2]
To further confirm the regulatory effect of miR-212 on XIAP, we measured the expression level of XIAP in RCC tissues. [score:2]
Lastly, we evaluated the expression level of miR-212 in RCC cell lines. [score:1]
Lastly, miR-212 and XIAP are prognostic predictors for RCC patients. [score:1]
In RCC tissues of advanced T stage and TNM stage, the level of miR-212 was significantly decreased. [score:1]
GAPDH and U6 were used as the internal control for XIAP and miR-212, respectively. [score:1]
Taken together, these data indicate miR-212 is significantly decreased in RCC tissues and cells. [score:1]
More importantly, XIAP was found to mediate the functional influence of miR-212 on cell viability, proliferation, migration and invasion. [score:1]
Mutated XIAP 3′-UTR was generated in the complementary site for the seed region of miR-212. [score:1]
To investigate the functional role of miR-212 in RCC, we overexpressed miR-212 in CAKI-2 cells. [score:1]
Addtionally, we examined the effect of miR-212 on the Caspase3/7 activity on RCC cells. [score:1]
Among these miRNAs, miR-212 was one of the top downregualted miRNAs in RCC. [score:1]
MiR-212 knockdown significantly promoted the cell migration and invasion of ACHN cells. [score:1]
Correlation analysis for XIAP and miR-212 showed that the level of miR-212 was negatively correlated with the XIAP level in RCC tissues (P<0.05, Figure 6B). [score:1]
MiR-212 knockdown promoted the cell viability, proliferation, migration and invasion of ACHN cells. [score:1]
MiR-212 knockdown significantly promoted the cell viability of ACHN cells. [score:1]
These indicate that miR-212 and XIAP can both serve as prognosis predictor for RCC patients. [score:1]
These indicate that miR-212 and XIAP are promising prognostic predictors for RCC patients. [score:1]
XIAP level was significantly decreased in RCC tissues with high level of miR-212 [*], P<0.05 by t test and Spearman's correlation analysis. [score:1]
MiR-212 knockdown increased the mRNA (P<0.05, Figure 5E) and protein (P<0.05, Figure 5F) level of XIAP in CAKI-2 cells. [score:1]
Furthermore, we demonstrated that miR-212 was significantly decreased in RCC cell lines. [score:1]
The prognostic value of miR-212 and XIAP for RCC patients assessed. [score:1]
As shown in Figure 5A, XIAP 3′-UTR contained the complementary sequences for miR-212 binding. [score:1]
Among numerous miRNAs, miR-212 was one of the significantly downregualted miRNAs in RCC tissues. [score:1]
[1 to 20 of 111 sentences]
2
[+] score: 219
Consistently, inhibition of the miRNA cluster by transfection of antisense (as-) into the TCDD- or DIM -treated breast cancer cells mitigated the agonists’ inhibitory effects on invasion of MDA-MB-231 and T47D (Fig.   3c), suggesting a direct inhibitory role of miR-212/132 on motility of MDA-MB-231 and T47D cells. [score:8]
Interestingly, miR-212/132 over -expression showed direct anti-migration, anti-expansion and anti-invasion properties, and an inhibition of the miRNA cluster mitigated the anti-invasive properties of TCDD and DIM. [score:6]
The suppressive effects of TCDD and DIM on metastasis of breast cancer cells is concomitant with higher miR-212/132 expression. [score:5]
The current results, for the first time, demonstrated that toxic and non-toxic Ahr agonists suppressed breast cancer metastasis through triggering the transcription of SOX4 -targeting miR-212/132 cluster. [score:5]
In the current study, over -expression of miR-212/132 showed anti-invasive properties, and inhibition of Ahr agonist -induced miRNA cluster abrogated the agonists’ anti-invasive properties in MDA-MB-231 and T47D. [score:5]
c Inhibition of miR-212/132 cluster by antisense partially blocked the inhibitory effects of TCDD and DIM on invasion of MDA-MB-231 and T47D cells. [score:5]
An application of miRNA target scan algorithm, i. e., MiRaNda [32], predicted that SOX4 is a candidate target gene of the miR-212/132 cluster (Fig.   4e). [score:5]
Agonist-activated Ahr regulates miR-212/132 expression in breast cancer cells. [score:4]
b and d * P < 0.05, significantly different from DMSO -treated control or Ahr agonist- and siAhr-treatments To investigate whether Ahr was directly involved in miR-212/132 expression, first, Ahr was inhibited by RNA interference. [score:4]
b and d * P < 0.05, significantly different from DMSO -treated control or Ahr agonist- and siAhr-treatmentsTo investigate whether Ahr was directly involved in miR-212/132 expression, first, Ahr was inhibited by RNA interference. [score:4]
Activation of Ahr by TCDD and DIM decreased the luciferase activities significantly, and these effects were reversed by co-transfection with as-miR-132 (Fig.   4c) and as-miR-212 (Fig.   4d), suggesting a regulatory role of the miRNA cluster on SOX4 gene expression. [score:4]
Knockdown of Ahr in Ahr agonists -treated cells significantly inhibited the luciferase activity driven by miR-212/132 promoter (Fig.   2d). [score:4]
TCDD and DIM down-regulate SOX4 in breast cancer cells by triggering Ahr-miR-212/132 axis. [score:4]
These results suggested that the agonist-activated Ahr was involved in up-regulation of miR-212/132 in both breast cancer cell lines. [score:4]
It was further shown that miR-212/132 cluster is a metastasis suppressor in breast cancer cells. [score:3]
Collectively, the results demonstrated for the first time that Ahr directly regulated miR-212/132 transcription by functional binding on miR-212/132 promoter. [score:3]
These results suggest a new mechanism through which miR-212/132 mediate the anti-metastatic properties of TCDD and DIM by targeting the pro-metastatic factor SOX4. [score:3]
As shown in Fig.   4f, over -expression of miR-212/132 significantly decreased the luciferase activity. [score:3]
a TCDD (1–25 nmol/L) and DIM (10–50 μmol/L) induced miR-212/132 cluster in MDA-MB-231 and T47D cells, miRNA expression was quantified by real-time PCR. [score:3]
Fig. 4TCDD and DIM suppress the pro-metastatic factor SOX4 by inducing the miR-212/132 cluster. [score:3]
Notably, the effects of Ahr agonists on SOX4 were repealed by Ahr knockdown and partially reversed by miR-212/132 antisense in Ahr agonist -treated cells, suggesting an involvement of other molecules, i. e., miRNAs, in the regulatory role of Ahr agonists on SOX4. [score:3]
Efficiency of miR-212/132 inhibition by antisense was confirmed by real-time-PCR as shown in Fig.   3d. [score:3]
These results identified SOX4 as a new target gene of the miR-212/132 cluster in MDA-MB-231 and T47D cells. [score:3]
c and d Co-transfection of 3′UTR-SOX4-luc and miRNA antisense, as-miR-132 or as-miR-212, mitigated the inhibitory effects of TCDD and DIM on the luciferase activity in MDA-MB-231 and T47D. [score:3]
c TCDD and DIM induced the miR-212/132 expression in pulmonary nodules of MDA-MB-231- or T47D -injected mice. [score:3]
A direct regulatory role of Ahr on the miR-212/132 gene by association with XRE boxes was tested by, and confirmed by luciferase activity. [score:3]
Inhibition of miR-212/132 in Ahr-agonist treated cells mitigated the anti-invasive effects of the agonists, and transfection with mimics showed supporting results, suggesting that miR-212/132 cluster mediated, at least partially, the anti-invasive effects of TCDD and DIM. [score:3]
Taken together, the findings provide the first evidences of the synergistic anti-metastatic properties of miR-212/132 cluster through suppression of SOX4. [score:3]
TCDD, and to a lesser extent DIM, significantly induced the expression of miR-212/132 cluster in the isolated nodules of MDA-MB-231- or T47D -injected mice (Fig.   5c). [score:3]
Fig. 5TCDD and DIM suppress metastasis of breast cancer cells to the lungs and induce miR-212/132 in vivo. [score:3]
The expression of miR-212/132 cluster and coding genes were examined by real-time PCR, and the protein levels were detected by western blot. [score:3]
Effects of TCDD and DIM and two additional Ahr agonists on miR-212/132 expression in breast cancer cells. [score:3]
SOX4 is a new target gene of miR-212/132 cluster in breast cancer cells. [score:3]
a Over -expression of the miR-212/132 cluster by mimics suppressed the migration of MDA-MB-231 and expansion of T47D cells in wound healing assay compared with siNS -transfected control. [score:3]
e SOX4 is a potential target gene of the miR-212/132 cluster; complementary binding site of miR-212/132 on the SOX4 3′UTR. [score:3]
MiR-212/132 has a direct inhibitory role on motility of breast cancer cells. [score:3]
To support these findings, two more Ahr-specific agonists were used to examine their effects on the miR-212/132 cluster expression. [score:3]
Over -expression of miR-132 and miR-212 showed inhibitory effects on migration of MDA-MB-231 and expansion of T47D cells in wound healing assay, and invasion in Boyden chamber in both cell lines compared with siNS -transfected controls (Fig.   3a and b). [score:3]
To further test a direct regulatory role of Ahr, 1 kb of miR-212/132 promoter was analyzed for the xenobiotic responsive elements (XRE) using transcription factor prediction software. [score:3]
Together, these results confirmed for the first time that Ahr directly regulated the transcription of miR-212/132 gene. [score:3]
Over -expression of miR-212/132 in both cell lines decreased SOX4 mRNA (Additional file 1: Figure S5A and B). [score:3]
A reciprocal correlation was identified between Ahr agonists -induced miR-212/132 and the pro-metastatic SRY-related HMG-box4 (SOX4), and a new specific binding sites for miR-212/132 were identified on the untranslated region (3′UTR) of SOX4. [score:3]
f Co-transfection of 3′UTR-SOX4-luc and miRNA mimics, miR-132 or miR-212, suppressed the luciferase activity in MDA-MB-231 and T47D. [score:3]
Potential binding sites of miR-212/132 cluster (HGNC:31589/HGNC:31516) on the 3′UTR of SOX4 (HGNC:11200) were queried by the miRNA target prediction software microRNA. [score:3]
d siAhr suppressed the luciferase activity of miR-212/132 promoter reporter. [score:3]
Taken together, the results identified SOX4 as a new target gene of the miR-212/132 cluster in human breast cancer cells. [score:3]
The binding specificity of miR-212/132 cluster on the SOX4 3′UTR was examined by mutation in the sequence on which miR-212/132 seed sequence bind (from GACTGTT to GAGACGG). [score:2]
b Mimics of the miR-212/132 cluster suppressed the invasion of MDA-MB-231 and T47D cells in the Boyden chamber assay. [score:2]
To study whether the miR-212/132 cluster has a direct role on motility of breast cancer cells, the cluster mimics were transfected separately into MDA-MB-231 and T47D cells. [score:2]
b siAhr blocked the 10 nmol/L TCDD- and 25 μmol/L DIM -induced miR-212/132 expression in MDA-MB-231 and T47D cells compared with the siNS -transfected control. [score:2]
MiR-212 and miR-132 are tandem miRNAs at the same location on chromosome 17 in humans, called miR-212/132 cluster, and they share the same seed sequence and the transcriptional regulatory elements. [score:2]
The miR-212/132 cluster was transcriptionally activated in MDA-MB-231 and T47D cells by TCDD and DIM, and this activation was regulated by Ahr. [score:2]
Both TCDD and DIM reduced the luciferase activity of the 3′UTR-SOX4 construct that contains the predicted binding sites for the miR-212/132 cluster, and mutation in these sites restored the luciferase activity. [score:2]
Analysis of the regulatory elements of the miR-212/132 gene using online software, i. e., Promo V3.0.2 [31], revealed the presence of two XRE boxes (GCGTG) located within 1 kb relative to the transcription site. [score:2]
Analysis of the regulatory elements of the miR-212/132 gene was performed using transcription factor prediction software [http://alggen. [score:2]
Chinen I, Nakahama T, Kimura A, Nguyen NT, Takemori H, Kumagai A, et al. The aryl hydrocarbon receptor/microRNA-212/132 axis in T cells regulates IL-10 production to maintain intestinal homeostasis. [score:2]
For example, miR-212/132 cluster is involved in mammary gland development [9, 10], neuronal differentiation and cognitive processes [11– 13], cardiac hypertrophy and cardiomyocyte autophagy [14], autoimmune inflammation [15], vasodilatory function and angiogenic responses [16]. [score:2]
Thus, the effects of TCDD and DIM on miR-212/132 expression and metastatic features in human breast cancer cells were investigated. [score:1]
Further in vivo studies demonstrated that the Ahr-miR-212/132-SOX4 module was induced by Ahr activation. [score:1]
Taken together, the results not only provide a new miRNA -based mechanism to understand the anti-metastatic properties of Ahr agonists, but also provide the first evidence of the synergistic anti-metastatic properties of the members of miR-212/132 cluster in human breast cancer cells, opening intriguing possibilities of using this miRNA cluster as an innovative therapeutic strategy for breast cancer. [score:1]
These effects were abrogated when the 3′UTR-SOX4-luc was replaced with a reporter contains a mutated sequence where miR-212/132 seed sequence binds (Fig.   4g). [score:1]
The role of miR-212/132 cluster on migration of MDA-MB-231, expansion of T47D and invasion of breast cancer cells were examined by the transfection of miRNA mimics, miR-132 and miR-212, or antisense, as-miR-132, as-miR-212. [score:1]
a– d * P < 0.05, significantly different from Veh -treated controlTo test whether Ahr agonists induce miR-212/132-SOX4 module in vivo, miRNA cluster and SOX4 mRNA were quantified in the pulmonary nodules. [score:1]
The 3′UTR-SOX4-luc construct (SwitchGear Genomics, Menlo Park, CA) was co -transfected with miR-212/132 mimics or antisense (Ambion) at 250 nmol/L as previously described [45]. [score:1]
To examine the hypothesis of Ahr-miR-212/132 axis in breast cancer cells, the expression of miR-212/132 cluster was measured by real-time PCR. [score:1]
The Ahr physically bound to the XRE-2 located at 830 bp from miR-212/132 transcription site (Fig.   2c). [score:1]
Fig. 2TCDD and DIM induce miR-212/132 cluster in breast cancer cells in an Ahr -dependent fashion. [score:1]
Finally, luciferase activity was quantified in breast cancer cells co -transfected with miR-212/132 promoter reporter and siAhr. [score:1]
a– d * P < 0.05, significantly different from Veh -treated control To test whether Ahr agonists induce miR-212/132-SOX4 module in vivo, miRNA cluster and SOX4 mRNA were quantified in the pulmonary nodules. [score:1]
MiR-212 and miR-132 are tandem miRNAs located in an intergenic region on chromosome 17 in humans, and they share the same seed sequence AACAGUCU. [score:1]
In recent studies, we found that TCDD and 6-formylindolo[3,2-b]carbazole (FICZ) induced the highly conserved miR-212/132 cluster in the murine cellular immune compartment [15, 30]. [score:1]
Effects of miR-212/132 mimics on mRNA level of SOX4. [score:1]
Recently, we demonstrated that agonist-activated Ahr induced a highly conserved miRNA cluster, named miR-212/132, in murine cellular immune compartment. [score:1]
The siAhr and siNS control (Ambion, Austin, TX) were co -transfected with the miR-212/132 promoter reporter at the final concentration of 75 nmol/L. [score:1]
c analysis of Ahr binding activity on XRE box on upstream sequence of miR-212/132 gene. [score:1]
miR-212/132 Aryl hydrocarbon receptor Breast cancer Metastasis Breast cancer is the most common cause of cancer -associated deaths amongst women in developed and developing countries [1]. [score:1]
For endogenous controls, GAPDH was used for Ahr, CYP1A1 and SOX4, and RNU6B was used for miR-212/132. [score:1]
d Efficiency of miR-212/132 knockdown by antisense compared with siNS was confirmed by real-time PCR. [score:1]
The MDA-MB-231 and T47D cells were transfected with 3′UTR-SOX4-luc construct, which contains the candidate binding sites for miR-212/132 cluster (MiRaNda v. 21) [32]. [score:1]
Besides, biological effects of Ahr-miR-212/132 axis were examined in vitro by cell migration, expansion and invasion, and examined in vivo by orthotopic mo del of spontaneous metastasis. [score:1]
Consistent with the in vitro results, TCDD induced a reciprocal correlation between miR-212/132 and SOX4 in vivo, which may explain, at least partially, the anti-metastatic properties. [score:1]
Therefore, it was hypothesized here that the miR-212/132 cluster may be induced in human breast cancer cells by Ahr agonists, and may contribute to their anti-metastatic properties. [score:1]
In previous studies, we demonstrated that activation of Ahr by TCDD and FICZ induced the highly conserved miR-212/132 cluster in murine cellular immune compartment, and supporting results were obtained in Ahr [−/−] mice [15, 30, 45]. [score:1]
Also, co-transfection of the 3′UTR-SOX4-luc and miR-212/132 mimics or miRNA mimics alone showed supporting results. [score:1]
Also, current study suggest a new miRNA -based mechanism elucidating the anti-metastatic properties of Ahr agonists, suggesting possibility of using miR-212/132 to control metastasis in breast cancer patients. [score:1]
Therefore, it was predicted in the current study that Ahr agonists induce miR-212/132 in human breast cancer cell lines, and these miRNAs may contribute to the anti-tumor properties of these agonists. [score:1]
To examine this prediction, MDA-MB-231 and T47D cells were first transfected with miR-212/132 mimics. [score:1]
g MiRNA mimics did not decrease the luciferase activity when co -transfected with 3′UTR-SOX4-luc that contains mutated binding sites for miR-212/132. [score:1]
The effects of Ahr agonists on Ahr-miR-212/132-SOX4 module in vivo were tested using an established orthotopic mo del of tumor growth and spontaneous metastasis. [score:1]
illustrated in Fig.   2b show that siAhr blocked the Ahr agonist -induced miR-212/132 cluster. [score:1]
The cells were also co -transfected with 3′UTR-SOX4-luc construct and miR-212/132 mimics. [score:1]
[1 to 20 of 91 sentences]
3
[+] score: 165
Furthermore, the expression pattern of miRNA-212 during early embryogenesis is inversely correlated with FIGLA expression during early embryogenesis, such that miR-212 expression increases steadily from 2-cell to 8-cell stage of embryogenesis, while FIGLA expression decreases gradually during the same period. [score:9]
In human lung cancer [54], pancreatic cancer [55], breast cancer [56] and colorectal cancer [57], miR-212 expression was significantly up regulated, whereas in osteosarcoma [58] and gastric cancers [59], the expression of miR-212 has been shown to be down-regulated. [score:9]
Since we have shown that miR-212 is capable of regulating FIGLA expression through direct binding to the 3’ UTR of its mRNA and that miR-212 is differentially expressed during early embryogenesis, we next investigated whether miR-212 regulates FIGLA expression in early embryos. [score:8]
Western blot analysis with an antibody against FLAG shows a significant inhibition of FLAG-tagged FIGLA protein expression in cells expressing miR-212 compared to the control cells without miR-212 (Figure 5A), indicating that translation of FIGLA is repressed by miR-212. [score:8]
Third, miR-212 suppresses the activity of a luciferase reporter fused with the 3`UTR of FIGLA in a MRE dependent manner, and finally, ectopic expression of miR-212 mimic in bovine early embryos significantly represses FIGLA protein expression. [score:7]
Expression analysis during oocyte maturation and early embryonic development showed that miR-212 is expressed in GV oocytes and tends to increase at the 4-cell and 8-cell stage embryos followed by a decline at morula and blastocyst stages (Figure 4B). [score:6]
First, the expression of miR-212 is inversely correlated to the expression of FIGLA during bovine early embryonic development. [score:6]
In order to test if miR-212 is indeed capable of regulating FIGLA protein expression, we used the human cervical cancer cell line HeLa because it expresses neither FIGLA nor miR-212 (data not shown). [score:6]
Suppression of luciferase activity was abolished when the mutation was introduced into the seed region of the miRNA-212 recognition sequence in the FIGLA 3’ UTR (Figure 5B), indicating that the predicted MRE is critical for the direct and specific binding of miR-212 to FIGLA mRNA. [score:5]
Ectopic expression of miR-212 suppressed the activity of the luciferase construct containing the miR-212 binding site of FIGLA mRNA at its 3’ end. [score:5]
Deregulation of miR-212/132 has also been associated with several neurological disorders, such as Alzheimer’s disease and tauopathies [51]. [score:4]
Following LH/hCG stimulation in the ovarian cells miR-132 and miR-212 were found to be highly up regulated and computational analysis has identified nearly 77 putative mRNA as potential targets of miR-212 and miR-132 in granulosa cells [60]. [score:4]
MiR-212 was predominantly expressed in hypothalamus and brain (Figure 4A), which is consistent with the expression profile observed in mice [43]. [score:4]
The inverse correlation between miR-212 and FIGLA expression supports that miR-212 might be a post-transcriptional regulator of FIGLA during MET. [score:4]
Mutation of the miR-212 miRNA recognition element (MRE) in the FIGLA 3’ UTR was performed using the QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturer’s instructions. [score:3]
The expression of miR-212 has been reported in different kinds of tumors. [score:3]
miRNA-212 binding site prediction and expression analysis. [score:3]
Expression analysis of miR-212. [score:3]
To determine the expression profiles of miRNA-212 in bovine tissues and embryos, quantitative real-time PCR was performed. [score:3]
Effect and specificity of miRNA-212 action on FIGLA expression. [score:3]
Furthermore, secondary structure analysis revealed that the apparent miR-212 target site was positioned on a hairpin-loop structure in an exposed position, which might facilitate miRNA accessibility. [score:3]
miR-212 represses endogenous FIGLA expression in early embryos. [score:3]
Second, miR-212 represses the expression of bovine FIGLA protein in HeLa cells. [score:3]
miR-212 expression plasmid (pcDNA3.1: miR-212) was constructed by cloning a 220 bp fragment (surrounding pre-miR-212) amplified from bovine genomic DNA. [score:3]
In addition, expression of miR-212 in fetal and adult ovary was also detected (Figure 4A). [score:3]
Here, we report the cloning of the bovine orthologue of FIGLA gene, the characterization of its mRNA and protein expression during bovine oocyte maturation and early embryonic development, and the demonstration of miRNA-212 as a potential negative regulator of bovine FIGLA during bovine early embryogenesis. [score:3]
Although such direct evidence from mammals is limited, we hypothesize a similar mechanism is likely to be involved in the negative regulation of FIGLA by miR-212 in bovine embryos during MET. [score:3]
Our report is the first to identify a miRNA that directly regulates FIGLA and display a novel potential role for miR-212 during early embryogenesis. [score:3]
Effect of miR-212 on FIGLA expression in early embryos. [score:3]
Taken together, these data indicate that miR-212 binds to the 3’ UTR of FIGLA mRNA and impairs FIGLA mRNA translation. [score:3]
Besides their multiple roles in neuronal development, increasing evidence point towards an important involvement of miR-212 and miR-132 in mediating many other biological processes, including inflammation [52], immune function [53] and other cellular dysfunctions such as cancer. [score:2]
These findings suggest that miR-212 is likely an important regulator of FIGLA. [score:2]
As shown in Figure 6, microinjection of miR-212 mimic into bovine embryos effectively reduced FIGLA protein expression in 8-cell embryos compared to the uninjected and the negative control miRNA mimic injected embryos. [score:2]
The expression of miRNA-212 in multiple tissues, oocytes and early embryos was performed as described previously [32] (See Table S1 for primers used in the analysis). [score:2]
Our results support and unveil a novel potential role for miR-212 in regulating maternal mRNAs during early embryogenesis. [score:2]
We also provide several lines of evidence to support a new role for miR-212 as a bona fide negative regulator of FIGLA during early embryogenesis. [score:2]
miR-212 and miR-132 are evolutionary conserved tandem miRNAs, well known for their essential role in the development, maturation and function of neurons [42]. [score:2]
Furthermore, recent evidence has demonstrated that miR-212 and miR-132 play an important role as post-transcriptional regulators in granulosa cells [60]. [score:2]
A four-base pair mismatch mutation was introduced in the predicted MRE in the 3’ UTR of the FIGLA for miR-212 such that interaction between miR-212 and FIGLA mRNA was compromised. [score:2]
miR-212 specifically regulates bovine FIGLA in vitro in HeLa cells. [score:2]
miR-212 arises from the miR-212/132 cluster (which comprises miR-212 and miR-132). [score:1]
Furthermore, in order to validate the specificity and the efficacy of miR-212 action through the predicted binding site; we inserted FIGLA 3’ UTR sequence downstream of the firefly luciferase-coding region. [score:1]
0076114.g004 Figure 4. (A) Tissue distribution of miR-212 analyzed by quantitative real time PCR. [score:1]
Prediction of a miR-212 binding site in the 3`UTR of bovine FIGLA mRNA. [score:1]
The identified MRE has a low predicted free energy of hybridization with miR-212 (−20.86 kcal/mol), suggesting a stable miR:MRE duplex within the 6 nt seed region at the 5` end of the miRNA (Figure 3). [score:1]
miR-212 and miR-132 are closely related as they have identical seed sequences and the mature miRNA differs only by four nucleotides. [score:1]
HeLa cells were grown in culture and transiently transfected with pcDNA3.1: FLAG-FIGLA and either pcDNA3.1: miR-212 or empty pcDNA3.1 vector as a negative control. [score:1]
0076114.g006 Figure 6 Effect of miR-212 mimic microinjection on abundance of FIGLA protein in 8-cell embryos as determined by immuofluorescent staining with anti-FIGLA antibody (n = 2 pools of 20 embryos per treatment). [score:1]
0076114.g003 Figure 3Prediction of a miR-212 binding site in the 3`UTR of bovine FIGLA mRNA. [score:1]
The computational search identified a miRNA recognition element (MRE) for miR-212 in bovine FIGLA 3`UTR. [score:1]
Mature miRNA-212 mimic (MIMAT0022695) and a negative control miRNA mimic (cel-miR-67, CN- 001000-01-05) were obtained from Dharmacon Technologies (Dharmacon Inc, Lafayette, CO), and diluted with RNase free water to a final concentration of 20 µM before microinjection. [score:1]
Effect of miR-212 mimic microinjection on abundance of FIGLA protein in 8-cell embryos as determined by immuofluorescent staining with anti-FIGLA antibody (n = 2 pools of 20 embryos per treatment). [score:1]
[1 to 20 of 52 sentences]
4
[+] score: 117
Other miRNAs from this paper: mmu-mir-132, rno-mir-132, rno-mir-212
It has been reported that miR-212-3p promoted angiogenesis to attenuate ischemic heart disease by inhibiting the expression of Rasa1/Spred1, thus upregulating Ras/mitogen-activated protein kinase [17]. [score:10]
Zhao JL miR-212/132 downregulates SMAD2 expression to suppress the G1/S phase transition of the cell cycle and the epithelial to mesenchymal transition in cervical cancer cellsIUBMB Life. [score:8]
The qPCR and western blot results showed that the miR-212-3p mimic inhibited NR4A2 –expression (Fig.   7d, e), as well as the expression of p53 and Bax. [score:7]
org) predicted that miR-212-3p was a putative miRNA targeting NR4A2 based on target sequences at the NR4A2 3′ untranslated region (UTR). [score:7]
In our research, we found that miR-212-3p expression decreased in ischemia, and its target NR4A2 increased, inhibiting the apoptosis of cardiomyocytes. [score:7]
The graphic image shows that ischemia inhibited the expression of miR-212-3p, thus increasing its target NR4A2 levels. [score:7]
Data are expressed as the mean + S. D. * P < 0.05; ** P < 0.01; n = 3To verify the regulation of NR4A2 by miR-212-3p, we cloned the wild-type 3′UTR sequence of NR4A2 into a luciferase reporter vector (Fig.   7c), and then we performed a luciferase reporter assay to determine whether miR-212-3p could directly regulate the expression of NR4A2 in H9c2 cardiomyocytes (Fig.   8). [score:7]
Data are expressed as the mean + S. D. * P < 0.05; ** P < 0.01; n = 3 To verify the regulation of NR4A2 by miR-212-3p, we cloned the wild-type 3′UTR sequence of NR4A2 into a luciferase reporter vector (Fig.   7c), and then we performed a luciferase reporter assay to determine whether miR-212-3p could directly regulate the expression of NR4A2 in H9c2 cardiomyocytes (Fig.   8). [score:7]
An inhibitor of miR-212-3p suppressed the cleavage of PARP and caspase3, and thus it inhibited cardiomyocyte apoptosis as NR4A2 did, whereas a miR-212-3p mimic did not affect the above-mentioned apoptosis markers, perhaps because apoptosis was saturated (Fig.   7b). [score:7]
In this study, the preliminary miRNA microarray results associated with predictive analysis by TargetScan suggested that miR-212-3p was the potential miRNA targeting NR4A2. [score:5]
It was reported that miR-132, one member of the miR-132/212 cluster, is induced by H [2]O [2] to target NR4A2 to aggravate apoptosis [33], but whether NR4A2 is the target of miR-212-3p in cardiomyocytes was unknown. [score:5]
NR4A2 was the target of miR-212-3p. [score:3]
e H9c2 cells were transfected with miR-212-3p inhibitor or mimic in ischemic conditions, and then, NR4A2, p53 and Bax were detected by western blot. [score:3]
First, miR-212-3p expression and function was detected in cardiomyocytes exposed to ischemia. [score:3]
b H9c2 cells were transfected with inhibitor or mimic of miR-212-3p followed by serum deprivation for 12 h. Changes in PARP, caspase3 and LC3 were analyzed by western blot. [score:3]
NR4A2 was the target of miR-212-3p in cardiomyocytes. [score:3]
MiR-212-3p is the upstream regulator of NR4A2 expression in ischemic cardiomyocytes. [score:3]
Expression of miR-212-3p was analyzed by qPCR. [score:3]
d H9c2 cells were transfected with miR-212-3p inhibitor in ischemic conditions, and NR4A2 levels were detected by qPCR. [score:3]
Most research on miR-212-3p has focused on its roles in the development of tumors and neurons, but its function in heart has been less reported 15, 16. [score:2]
MiR-212-3p possesses highly conserved sequences among vertebrates, and its expression is high in both the brain and heart, suggesting that it has an important role in the heart. [score:2]
Remenyi J Regulation of the miR-212/132 locus by MSK1 and CREB in response to neurotrophinsBiochem. [score:2]
c Website-predicted target of miR-212-3p and luciferase reporter plasmid containing the native NR4A2 3’UTR was co -transfected with miR-212-3p mimic in HEK293 cells for 24 h followed by a dual-luciferase activity assay. [score:2]
All the data verified that miR-212-3p is the upstream regulator of NR4A2 (Fig.   7c–e). [score:2]
Then, luciferase reporter plasmids were co -transfected with control or miR-212-3p mimic into HEK293 cells with Lipofectamine 2000 (Invitrogen). [score:1]
Currently, the function of miR-212-3p in ischemia -induced cardiomyocyte apoptosis is unknown. [score:1]
Here, we studied the role of NR4A2 in ischemia -induced cardiomyocyte apoptosis and autophagy and reported a miR-212-3p/NR4A2/p53/Bax pathway in autophagy -dependent apoptosis in ischemia-stimulated cardiomyocytes. [score:1]
The qPCR showed that miR-212-3p decreased in ischemic conditions (Fig.   7a). [score:1]
MiR-212-3p has been shown to have important roles in regulating cardiac hypertrophy [32]. [score:1]
Furthermore, we reported a new role of miR-212-3p in cardiomyocyte apoptosis and autophagy. [score:1]
[1 to 20 of 30 sentences]
5
[+] score: 103
This suggests that there is the potential for Acad9 to both indirectly regulate miR-212 expression and in turn be directly regulated by miR-212 expression. [score:9]
In order to determine if the number of significant correlations within a behavioural category was overrepresented, we conducted Fishers Exact Tests which showed that behaviour traits in general were overrepresented with miR-31 expression (p < 0.05) and cocaine related traits were overrepresented with both miR-34c expression (p < 0.05) and miR-212 expression (p < 0.1) (see Table  5). [score:7]
Of particular interest was the QTL for miR-212 expression on chromosome 3, within which we found two expression probe sets that were significantly correlated with miR-212 expression. [score:7]
Further analysis of these QTLs revealed two genes, Tnik and Phf17, under the miR-212 regulatory QTLs, whose expression levels were significantly correlated with miR-212 expression. [score:6]
We found that the gene Acad9, which lies under the QTL for miR-212 expression on chromosome 3, had two predicted miR-212 target sites. [score:5]
In particular, it was shown that striatal miR-212 expression is increased following extended cocaine use in rats and that increases in striatal miR-212 expression leads to decreases in cocaine intake following extended access conditions. [score:5]
Figure 1 eQTL peak for miR-212 on chromosome 3. The eQTL for miR-212 expression is shown for chromosome 3. The triangles on the x-axis represent the location of the probe sets that were significantly associated with miR-212 expression (q < 0.2)We examined whether there were any genes under these eQTL peaks that contained predicted miRNA binding sites. [score:5]
Furthermore, miR-212 is known to be regulated by MeCP2, an important regulator of neuroplasticity, and to affect BDNF expression and neuroplasticity in postmitotic neurons [36]. [score:5]
The gene Acad9, which codes for a mitochondrial Acyl-CoA dehydrogenase, had two predicted miR-212 target sites and was negatively correlated with miR-212 expression (r = -. [score:5]
Furthermore its expression was also negatively correlated with miR-212 expression. [score:5]
Further studies are required to determine which genetic variant potentially underlies this correlation, and what genes and mechanisms this variant acts upon to indirectly regulate miR-212 expression. [score:5]
Figure 1 eQTL peak for miR-212 on chromosome 3. The eQTL for miR-212 expression is shown for chromosome 3. The triangles on the x-axis represent the location of the probe sets that were significantly associated with miR-212 expression (q < 0.2) We examined whether there were any genes under these eQTL peaks that contained predicted miRNA binding sites. [score:5]
for co-expressed transcripts of miR-212 supports a role for miR-212 in the regulation of the cytoskeleton and of MAPK kinase pathways, functions that overlap with those of Tnik and suggesting that the miR-212 and Tnik correlation may underlie a real functional relationship between these genes. [score:4]
We found significant correlations between both miR-34c and miR-212 expression and cocaine-related behaviours. [score:3]
Neither of the genes, Phf17 and Tnik, have a predicted miR-212 target site. [score:3]
As cocaine addiction is wi dely believed to result in changes in neurocircuitry [37], miR-212 is an excellent candidate for susceptibility to cocaine addiction, further supported by a previous finding that miR-212 expression affects dendrite growth and arborisation [38]. [score:3]
The η [2] values for miRNA gene expression by strain are 0.21, 0.33, 0.28, 0.27 and 0.37 for miR-15b, miR-31, miR-34c, miR-212 and miR-301a, respectively. [score:3]
We found that miR-212 expression is correlated with cocaine-related behaviour, consistent with a reported role for this miRNA in the control of cocaine consumption. [score:3]
The existence of such a site is not required to posit a mechanism by which genetic variation in that a functional process can indirectly regulate the abundance of miR-212. [score:3]
Two of these correlations survived multiple testing correction, 1429870_at (gene Tnik) and 1438412_at (gene Phf17), both lying underneath the expression QTL (eQTL) for miR-212 on chromosome 3 (see Figure  1). [score:3]
Furthermore, we found evidence of genetic covariation of miR-212 abundance and cocaine related behaviours that is strongly supported by previous functional studies, demonstrating the value of this approach for discovery of new functional roles and downstream processes regulated by miRNA. [score:2]
The mature miRNA expression for the five miRNAs miR-15b, miR-31, miR-34c, miR-212, and miR-301a were quantified in the individual BXD animals using Taqman RT-PCR assays (Applied Biosystems, Life Technologies, Foster City, CA, USA). [score:2]
Evidence of genetic covariation of miR-212 abundance and cocaine related behaviours is strongly supported by previous functional studies, demonstrating the value of this approach for discovery of new functional roles and downstream processes regulated by miRNA. [score:2]
QTL analysis was conducted for miRNA expression for those miRNAs investigated in the BXD RI strains (miR-15b, miR-31, miR-34c, miR-212, and miR- 301a). [score:1]
This is particularly interesting for miR-212, which has previously been shown to control cocaine intake [35]. [score:1]
It should be noted that neither of the genes corresponding to these probe sets, Phf17 and Tnik, have a predicted miR-212 binding site or any RNA genes within their transcripts. [score:1]
[1 to 20 of 26 sentences]
6
[+] score: 101
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
ACTH up-regulated the expression of miRNA-212, miRNA-182, miRNA-183, miRNA-132, and miRNA-96 and down-regulated the levels of miRNA-466b, miRNA-214, miRNA-503, and miRNA-27a. [score:9]
Both ACTH and 17α-E2 up-regulated the expression of miRNA-212, miRNA-132, miRNA-154, miRNA-494, miRNA-872, miRNA-194, and miRNA-24-1, but reduced the expression of miRNA-322, miRNA-20b, miRNA-339, miRNA-27a, miRNA-551b, and miRNA-1224. [score:8]
Real-time quantitative PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats. [score:7]
Real-time PCR (qRT-PCR) measurements demonstrated that ACTH treatment upregulated the expression of miRNA-212, miRNA-183, miRNA-182, miRNA-132 and miRNA-96, while down -regulating the expression of miRNA-466b, miRNA-214, miRNA-503 and miRNA-27a. [score:7]
qRT-PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats (Fig. 3 ). [score:7]
The levels of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377, and miRNA-96 were up-regulated, whereas miR-125b, miRNA-200b, miR-122, miRNA-466b, miR-138, miRNA-214, miRNA-503 and miRNA27a were down-regulated in response to 17α-E2 treatment. [score:7]
Treatment of MLTC-1 cells with Bt [2]cAMP for 6 h increased the expression of miRNA-212, miRNA-183, miRNA-132, miRNA-182 and miRNA-96 and inhibited the expression of miRNA-138 and miRNA-19a (Fig. 4B ). [score:7]
Treatment of MLTC-1 cells with Bt [2]cAMP for 6 h increased the expression of miRNA-212, miRNA-183, miRNA-132, miRNA-182 and miRNA-96, and inhibited the expression of miRNA-138 and miRNA-19a. [score:7]
Bt [2]cAMP stimulation of granulosa cells caused down-regulation of a majority of miRNAs, including miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, miRNA-138 and miRNA-19a, but expression levels of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 were significantly increased. [score:6]
The level of expression of miR-212 and miR-132 was up-regulated (>1.5-fold) by both ACTH and 17α-E2 treatments. [score:6]
qRT-PCR measurements indicated that exposure of primary rat granulosa cells to Bt [2]cAMP for 24 h inhibited the expression of miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, and miRNA-138 and miRNA-19a while enhancing the expression of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 (Fig. 4 ). [score:5]
Real-time PCR (qRT-PCR) confirmed ACTH -mediated up-regulation of miRNA-212, miRNA-183, miRNA-182, miRNA-132 and miRNA-96. [score:4]
The precursor for miRNA-212 was also up-regulated. [score:4]
ACTH treatment caused maximum up-regulation of two miRNAs, miRNA-212 and miRNA-132, with a fold-stimulation of 4.23 and 3.43, respectively. [score:4]
We next evaluated the effects of Bt [2]cAMP stimulation of rat ovarian granulosa cells and of mouse MLTC-1 Leydig tumor cells on the expression of twelve miRNAs (miRNA-212, miRNA-122, miRNA-183, miRNA-200b, miRNA-466b, miRNA-182, miRNA-96, miRNA-27a, miRNA-132, miRNA-214, miRNA-138 and miRNA-19a) whose adrenal expression was differentially altered in response to treatment of rats with ACTH, 17α-E2 or DEX. [score:3]
The levels of expression of miRNA-212, miRNA-122, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96, miRNA-466b, miRNA-200b, and miRNA-19a are shown. [score:3]
More specifically, we assessed the impact of Bt [2]cAMP treatment on the expression of miRNA-212, miRNA-122, miRNA-27a, miRNA-466b, miRNA-200b, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96 and miRNA-19a. [score:3]
0078040.g003 Figure 3Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
Moreover, cultured mouse granulosa cells exhibited a robust induction of miRNA-132 and miRNA-212 when challenged with 8BrcAMP [36]. [score:1]
Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
One study reported a robust induction of miRNA-21, miRNA-132 and miRNA-212 following in vivo stimulation of mouse ovaries with LH/hCG [36]. [score:1]
[1 to 20 of 21 sentences]
7
[+] score: 96
Other miRNAs from this paper: mmu-mir-132, mmu-mir-16-1, mmu-mir-16-2
To confirm that the knockout did not express either miR-132 or miR-212, total RNA was isolated from cortex or cerebellum of the mice, and analysed for the expression of mature miR-132 and miR-212 by qPCR (Fig. 2A, B). [score:6]
Much of the initial work on miR-132 and miR-212 function has relied on the use of the overexpression of miRNA mimetics or inhibitors. [score:5]
Interestingly while miR-132 and miR-212 have similar seed sequences, suggesting they could have some targets in common, the seed sequences of miR-132* and miR-212* are different suggesting they would have distinct targets in vivo. [score:5]
Interestingly expression of both miR-132 and miR-212 could be detected in the cortex and cerebellum of either MSK1/2 knockout or CREB Ser133Ala knockin mice, although there was a trend for reduced levels in the cortex. [score:5]
Conditional knockout mice for miR-132 and miR-212 were generated by insertion of loxP sites in the 5′ region of the intron encoding miR-132 and miR-212 and in exon2 using the targeting strategy shown in Fig. 1A. [score:4]
This indicates that other mechanisms in addition to the MSK-CREB dependent pathway promote miR-132 and miR-212 expression during development of the CNS. [score:4]
No miR-132 or miR-212 expression could be detected in the miR-132/212 knockout brain tissue. [score:4]
were crossed to Flp transgenic mice to excise Neomycin resistance cassette and then Cre expressing mice to delete miR-132 and miR-212. [score:3]
Both wild-type and mice homozygous for the floxed allele had comparable levels of both miR-132 and miR-212, indicating that the insertion of the loxP sites did not affect the expression of the two miRNAs. [score:3]
The deletion of miR-132 and miR-212 was achieved by crossing these mice to transgenic mice expressing Cre recombinase under a constitutive promoter (Taconis Artemis), following deletion mice were crossed away from the Cre transgene before experimental mice were generated. [score:3]
The expression of both miR-132 and miR-212 has been shown to be increased after the induction of LTP by high frequency stimulation in the dentate gyrus. [score:3]
Expression or miR-132 and miR-212 in the CNS. [score:3]
miR-132 or miR-212 do however have roles in regulating synaptic transmission and synaptic plasticity, and it would therefore be of interest to examine the effect of miR-132/212 knockout in behavioural mo dels. [score:3]
Briefly, the targeting vector was designed to introduce LoxP sites either side of the region encoding miR-132 and miR-212. [score:3]
Through the generation of a miR-132/miR-212 double knockout, we have shown that these miRNAs are not essential for development or fertility. [score:3]
These mice still express normal levels of miR-132 and miR-212 (Fig. 2). [score:3]
Several targets have been proposed for miR-132 or miR-212, including MeCP2, p250GAP, p120GasGAP, p300, SirT1, Foxp2 and MMP9 [4], [10], [11], [12], [13], [14], [15]. [score:3]
In addition, deletion of miR-132 and miR-212 in mice has shown a role for these miRNAs in mammary gland development [12] and cardiovascular function [21]. [score:2]
0062509.g005 Figure 5miR-132 and miR-212 do not regulate LPS -induced cytokine production in vivo. [score:2]
miR-132 and miR-212 do not regulate LPS -induced cytokine production in vivo. [score:2]
However, as expected, mature miR-132 and miR-212 could not be detected in the knockout cells (Fig. 6D). [score:2]
The effects of Sendai virus infection on IFNβ or nur77 mRNA was unaffected by the knockout of miR-132 and miR-212 (Fig. 3B and D). [score:2]
0062509.g001 Figure 1miR-132/212 knockout mice were generated by insertion of LoxP sites in the 1 [st] intron and exon2 of the small non coding RNA gene that contains miR-132 and miR-212 (A). [score:2]
miR-132/212 knockout mice were generated by insertion of LoxP sites in the 1 [st] intron and exon2 of the small non coding RNA gene that contains miR-132 and miR-212 (A). [score:2]
To further examine the roles for miR-132 or miR-212 in innate immunity, bone marrow derived macrophages (BMDMs) were isolated from the knockout mice and stimulated with a panel of TLR agonists including LPS (TLR4), CpG (TLR9), Pam3-CSK4 (TLR1/2), Pam2-CSK4 (TLR2/3) and CL097 (TLR7). [score:2]
In vivo miR-132 and miR-212 have been linked to several processes in the brain including circadian rhythms, cocaine addiction and ocular dominance [22], [23], [24], [25], [26]. [score:1]
In summary, miR-132 and miR-212 are two related miRNAs that can be induced by a variety of signals and in various cell types and have proposed functions in both the CNS and immunity. [score:1]
miR-132 and miR-212 are two related miRNAs that are encoded from the same intron of a small non-coding gene that is located on chromosome 11 in mice and chromosome 17 in humans. [score:1]
In cells, the transcription of the primary transcript for miR-132 and miR-212 can be induced by a variety of signals, including BDNF stimulation and synaptic activity in neurons, PMA and anisomycin in fibroblasts and LPS in THP-1 cells [3], [4], [5], [6], [7], [8]. [score:1]
The levels of mature miR-132 and miR-212 were determined by qPCR. [score:1]
Analysis of cortical neuronal cultures demonstrated that knockout of miR-132 and miR-212 did not result in significant differences in neuronal morphology compared to wild-type control cultures between 2 and 4 days in vitro. [score:1]
Stimulation of the cultured neurons with the glutamate receptor agonist NMDA was able to increase miR-132 and miR-212 levels in wild-type cells (Fig. 6D). [score:1]
Deletion of miR212/132 influences hippocampal synaptic transmission and plasticity. [score:1]
miR-132 and miR-212 are not critical for IFNβ induction in MEFs infected by Sendai virus. [score:1]
Processing of the pri-miR-132/212 transcript has been shown to give rise to 4 miRNA species; miR-132, miR-212 as well as the star sequences for both miR-132 and miR-212 [3]. [score:1]
The levels of pri-miR-132/212, miR-132, miR-212 (D), p250-Gap and MeCP2 (E) were determined. [score:1]
miR-132 and miR-212 are not required for cytokine induction in BMDMs. [score:1]
Significantly however, this was independent of miR-132 and miR-212 indicating that in this system it did not require modulation of p300 levels by miR-132. [score:1]
Electrophysiological experiments however do indicate that miR-132 or miR-212 play a role in synaptic function. [score:1]
Initially we examined the role of miR-132 and miR-212 in mouse embryonic fibroblasts. [score:1]
In mice, miR-132 and miR-212 are encoded in the 1 [st] intron of a small non-coding gene on chromosome 11. [score:1]
Germline transmitting chimeric mice were crossed to Flpe transgenic mice (also on a C57Bl/6 background) to delete the neomycin cassette, resulting in mice with a conditional allele for miR-132 miR-212. [score:1]
[1 to 20 of 42 sentences]
8
[+] score: 90
Other miRNAs from this paper: mmu-mir-132
In combination with bioinformatics target site prediction algorithms (Targetscan), we selected Rasa1, Spred1 and Spry1 which have a high prediction context score and are conserved among species, as shown in Figure 4A and D. Since Rasa1 was already a confirmed miR-132 target 10, we only cloned the 3′UTR of Spred1 and Spry1 into a luciferase reporter vector and analysed whether miR-132 and miR-212 could suppress luciferase activity in HEK293 cells. [score:9]
As microRNA functions by inhibiting its targets, we reason that knockdown of Spred1, Spry1 and Rasa1 should have similar effect as overexpression of miR132 and miR-212. [score:8]
Human umbilical venous endothelial cells (Lonza, Breda, the Netherland) were cultured in EGM2 according to manufacturer’s instructions, and all experiments were performed before passage 7. HUVECS were transfected with either 20 nmol/l Spred1 (s46287), Spry1 (s20026), Rasa1 (120290), Silencer select negative control#1 (4390843), or with mirVana miRNA mimic negative control (4464085), hsa-miR-132-3p mimics (MC10166), hsa-miR-212-3p mimics (MC10340), mirVana miRNA inhibitor negative control1 (4464077), hsa-miR-132-3p inhibitor (AM10166), hsa-miR-212-3p inhibitor (AM10340; all from Life Technologies) using Lipofectamine 2000 (Life Technologies). [score:7]
Following overexpression of miR-132 and miR-212 in HUVECs in the co-culture assays, we detected reduced levels of Spred1, Spry1 and Rasa1 protein; while inhibition of the miR-132 and miR-212 led to elevated Spred1, Spry1 and Rasa1 expression. [score:6]
We confirmed that Rasa1 is a direct target of miR-132 and miR-212, and further expanded their target spectrum thereby including Spred1 and Spry1. [score:6]
Knockdown of these three targets mimicked overexpression of miR-132 or miR-212 in the in vitro neovascularization assay and on the modulation of phosphorylated ERK1/2. [score:5]
MiRNA-132 and miR-212 is upregulated upon hind-limb ischaemia. [score:4]
As expected, subsequent knockdown of Spred1, Spry1, Rasa1 and a combination of these three via siRNA knockdown in HUVECs (Fig. 6C) showed similar neovascularization responses as overexpression of miR-132 or miR-212, total number of junctions, tubules and tubule length were increased compared to control conditions (Fig. 6A and B). [score:4]
Here, we show that upregulation of miR-132 and miR-212 upon hindlimb ischaemia is involved in the arteriogenic response: microRNA-132/212 KO animals display delayed perfusion restoration upon femoral artery occlusion. [score:4]
Although these two miRNAs share the same seed sequences and hereby belong to the same miRNA family, the level of mature miR-132 expression is significantly higher than that of miR-212 in the thigh muscle, indicating that miR-132 might be more active in the arteriogenic response, as previously reported for miR-212 being a more dominant miRNA in angiogenesis (Fig. 1A). [score:3]
Our results demonstrate a new role for miR-132 and miR-212 in the facilitation of the arteriogenic responses after hind-limb induced by targeting and enhancing Ras-MAPK signalling. [score:3]
To understand the function of miR-132 and miR-212 in arteriogenesis, we performed hind-limb ischaemia on WT mice and checked the expression of these two microRNAs in the thigh muscle at different time points after hind-limb ischaemia. [score:3]
Compared with siRNA controls and miR controls, overexpression of miR-132 and miR-212 or knockdown of Spred1, Spry1and Rasa1, indeed prolonged ERK1/2 phosphorylation (Fig. 5A– D). [score:3]
Conversely, inhibiting miR-132 and miR-212 using anti-miRs resulted in some decline in the total number of junctions, tubules and tubule length (Fig. 3B). [score:3]
Given the fact that the expression of the mature miR-132 is 40-fold higher than miR-212 (Fig.  S1A), we tend to believe that miR-132 plays a major role in the arteriogenic response after hindlimb ischaemia. [score:3]
miR-132 and miR-212 were inhibited or enhanced in HUVECs only, either by using anti-miR-132 and anti-miR-212, or by supplementing miR-132 mimics and miR-212 mimics, respectively. [score:3]
Figure 6Knockdown targets of miR132 and miR212 Rasa1, Spred1 and Spry1 mimics effect of miR-132 and miR-212 in HUVECs pericytes neovascularization assay. [score:3]
However, it is still possible that a specific cell population, highly expressing miR-212 but not miR-132, is more important for the vascular growth after hindlimb ischaemia. [score:3]
In line with this hypothesis, a recent study showed that miR-212 is stronger in the regulation of vasodilatation than miR-132 40. [score:2]
We found that both miR-132 and miR-212 can significantly suppress the Spred1-3′UTR and Spry1-3′UTR luciferase activity at 25 nmol/l, compared with scramble control miRNAs (Fig. 4B and E). [score:2]
The biological function of miR-132 and miR-212 may be different, although they share the same seed sequence. [score:1]
In addition, 25 nmol/l miR mimic controls, miR-132 mimics or miR-212 mimics were introduced by using Lipofectamine 2000 (Life Technologies). [score:1]
By qRT-PCR, we found that miR-132 and miR-212 levels were significantly increased on day 4 and day 7 (Fig. 1A and B) after hindlimb ischaemia in the adductor muscle. [score:1]
Figure 3Effect of miR132 and miR212 in HUVECs angiogenesis in co-culture with pericytes. [score:1]
To monitor the effects of miR-132 and miR-212 in angiogenesis, transfected HUVEC-GFP and PKH26 stained pericytes were suspended in a 2.5 mg/ml collagen type I (BD Biosciences, USA) as described by Stratman et al. 26. [score:1]
Since both miR-132 and miR-212 are removed in the KO mice, it is impossible to determine which one should be responsible for the impaired arteriogenesis response. [score:1]
[1 to 20 of 26 sentences]
9
[+] score: 88
Of note, miR212/132 play a role in neurodevelopment as well as the adult brain and have been linked to neurodevelopmental brain diseases such as schizophrenia (Clovis et al., 2012, Miller et al., 2012). [score:5]
“EEi + miRNA212/132 inhibitors” oocytes were injected with RNA from mice + miR212/132 inhibitors. [score:5]
RNA in both groups was co -injected with scrambled RNA allowing us to include a third group in which we injected into oocytes sperm RNA from mice along with miR212/132 inhibitor, which we had previously validated for its inhibitory action (Figure S3). [score:5]
Finally, miR212/132 are not upregulated in the offspring of fathers (Figure S8), which suggests that the mechanisms underlying -mediated enhanced synaptic plasticity and cognition in the F0 and F1 generation are likely to be different. [score:4]
” Convincing data show that downregulation of miR212/132 leads to impairment of synaptic plasticity and learning and memory (Hansen et al., 2010, Hansen et al., 2013, Scott et al., 2012). [score:4]
We found that miR132 and miR212 were upregulated both in sperm and hippocampus of mice that were exposed to for 10 weeks (Figures 3A and 3B). [score:4]
Especially interesting will be to see whether induces upregulation of miR212/132 in oocytes and whether this or other processes play a role in the intergenerational transmission of -mediated enhanced synaptic plasticity and cognition. [score:4]
The constructs were cotransfected into HEK293 cells with miR-212/132 mimics (5 nM, QIAGEN) or miR-212/132 inhibitors (5 nM for 3p arms, 50 nM for 5p arms, Exiqon) using lipofectamine according to the manufacturer’s instructions. [score:3]
The following oligonucleotides were used for cloning the miRNA target sequences into pmirGLO: miR-132-3p F: AAACTAGCGGCCGCTAGTCGACCATGGCTGTAGACTGTTA miR-132-3p R: CTAGATAACAGTCTACAGCCATGGTCGACTAGCGGCCGCTAGTTT miR-132-5p F: AAACTAGCGGCCGCTAGTGTAACAATCGAAAGCCACGGTTT miR-132-5p R: CTAGAAACCGTGGCTTTCGATTGTTACACTAGCGGCCGCTAGTTT miR-212-3p F: AAACTAGCGGCCGCTAGTTGGCCGTGACTGGAGACTGTTAT miR-212-3p R: CTAGATAACAGTCTCCAGTCACGGCCAACTAGCGGCCGCTAGTTT miR-212-5p F: AAACTAGCGGCCGCTAGTAGTAAGCAGTCTAGAGCCAAGGT Animals were sacrificed by cervical dislocation. [score:3]
These data could indicate that expression of miR212/132 in the brain is more responsive to external stimuli than that in sperm. [score:3]
Also, here, we included a group where sperm RNA was co -injected with miR212/132 inhibitors (Figure 4D). [score:3]
[∗]p < 0.05. n = 9 (HC sperm RNA + negative control oocyte injections), n = 14 (EE sperm RNA + negative control oocyte injections), n = 18 (EE sperm RNA + miR-212/132 inhibitor oocyte injections). [score:3]
These data suggest that moderate increase in miR212/132 facilitates, whereas excess increase in its expression impairs learning and memory, a finding that is not uncommon for molecules implicated with memory function (Fischer et al., 2005). [score:3]
Alternatively, there is evidence that brain-derived exosomes, which are known to carry also miRs, have been detected in the circulation (Shi et al., 2014), and thus it is not entirely impossible that increased levels of miR212/132 in sperm originate from increased miR212/132 expression in other tissues such as the brain. [score:3]
• Exercising male mice pass a cognitive benefit to their offspring • This phenomenon is mediated by altered expression of sperm RNA • Levels of miR212/132 in sperm play a key role in this intergenerational effect epigenetics brain microRNA memory intergenerational transgenerational exercise environmental enrichment cognition There is emerging evidence that exposure to environmental stimuli can initiate processes that transmit information to the next generation via non-genetic mechanisms (Bale, 2015, Bohacek and Mansuy, 2015, Fischer, 2014). [score:3]
We observed that the offspring born to oocytes injected with RNA from 10-week mice exhibited enhanced LTP, which was reversed to control (HC) levels if miR212/132 inhibitors were co-administered (Figures 3C and 3D). [score:3]
The following oligonucleotides were used for cloning the miRNA target sequences into pmirGLO: miR-132-3p F: AAACTAGCGGCCGCTAGTCGACCATGGCTGTAGACTGTTA miR-132-3p R: CTAGATAACAGTCTACAGCCATGGTCGACTAGCGGCCGCTAGTTT miR-132-5p F: AAACTAGCGGCCGCTAGTGTAACAATCGAAAGCCACGGTTT miR-132-5p R: CTAGAAACCGTGGCTTTCGATTGTTACACTAGCGGCCGCTAGTTT miR-212-3p F: AAACTAGCGGCCGCTAGTTGGCCGTGACTGGAGACTGTTAT miR-212-3p R: CTAGATAACAGTCTCCAGTCACGGCCAACTAGCGGCCGCTAGTTT miR-212-5p F: AAACTAGCGGCCGCTAGTAGTAAGCAGTCTAGAGCCAAGGT were sacrificed by cervical dislocation. [score:3]
Sperm RNA from a pool of HC or mice was isolated and mixed with scrambled negative control (vehicle) or miR212/132 inhibitors and injected into the cytoplasm of fertilized oocytes. [score:3]
Mice that were born from oocytes injected with sperm RNA and co -injected with miR212/132 inhibitors exhibited a similar, albeit insignificant, trend for memory enhancement (Figures 4E and S6F–S6H; percentage time freezing: p = 0.28, Mann-Whitney test; platform crossings: p = 0.19, Mann-Whitney test; relative time of platform occupancy: p = 0.08, t test). [score:3]
Therefore, we assayed the expression of the miR212/132 cluster in mice upon training. [score:2]
Figure 3 miR212/132 Are Increased in the Brain and Sperm of Males and They Are Involved in Intergenerational Inheritance of the Enhanced LTP Phenotype(A) from sperm of 10-week males (n = 7) demonstrates increased expression of miR212/132 when compared to HC males (n = 6; [∗∗]p < 0.01, [∗]p < 0.05, t test). [score:2]
However, inhibition of miR212/132 in fertilized oocytes injected with sperm RNA from mice did not occlude the inheritance of improved memory function assayed in the behavioral paradigms. [score:2]
PubMed IDs for the papers linked to miR212/132 are 22845676, 22246100, 19557767, 23520022, 27392631, 20613834; let-7d are 23425148, 21307844, 20557304, 25799420; let-7c are 25962166, 21676127; let-7-b are 21676127, 27539004; miR34c are 26402112, 21946562; miR124 are 24784359, 22837048. [score:1]
In this context, it is interesting to note that the -mediated intergenerational inheritance of LTP enhancement was linked to the action of miR212/132. [score:1]
These data demonstrate that in adult males enhances hippocampal synaptic plasticity in their offspring and that this effect is mediated through sperm RNA causally involving miR212/132. [score:1]
Using these criteria, we identified 6 miRs that showed more than 1 PubMed hit, namely, miR212/132, let-7d, let-7c, let-7b, miR34c, and miR124. [score:1]
An equally interesting question relates to the mechanisms that lead to increased miR212/132 levels in sperm. [score:1]
For miR212/132, the was performed for both active and inactive arms. [score:1]
Thus, we suggest that in case of miR212/132 our “loss-of-function” experiment is the most reliable experimental approach to support a role of miR212/132 in intergenerational inheritance. [score:1]
In contrast, miR212/132 levels cannot explain the enhanced memory function indicating that additional mechanisms contribute to the intergenerational enhancement of learning behavior in response to. [score:1]
In contrast to its effect on LTP, the miR212/132 cluster appeared to have no effect on the behavioral readout. [score:1]
These data argue against a general increase of sperm miRs in response to and led us to hypothesize that miR212/132 might play a role in the intergenerational transmission of the phenotype. [score:1]
For example, our data show that miR212/132 are already increased after 2 weeks of in the hippocampus, but only after 10 weeks of in sperm. [score:1]
These findings suggest that the intergenerational effect of on LTP and memory enhancement critically depends on sperm RNA and that the LTP effect is mediated via altered levels of miR212/132. [score:1]
In support of this view, we observed that hippocampal levels of miR212/132 increase in fathers exposed to (F0 generation; see Figure 3), a finding that is in line with previous data linking moderately increased miR212/132 levels to memory enhancement (Hansen et al., 2016, Hernandez-Rapp et al., 2015, Scott et al., 2012), but not in their adult offspring (F1 generation; see Figure S8). [score:1]
Next, we decided to address the question of whether sperm RNA and in particular miR212/132 would play a role in the memory enhancement seen in the offspring born to fathers. [score:1]
An experiment that could have provided additional evidence for the involvement of miR212/132 in the intergenerational transmission of enhanced LTP would be to inject these miRNAs specifically into fertilized oocytes and perform the tests on the resulting progeny. [score:1]
[1 to 20 of 37 sentences]
10
[+] score: 82
Some of the RNA binding proteins such as EWS, HNRNPM, HNRNPU and DHX36 showed an inhibitory effect on mmu-miR-212/132 processing and/or RNA maturation since knocking them down resulted in elevated miR-132, miR-212 and GFP expression (Supplementary Figure 5A). [score:6]
Figure 2D shows that neither the transfection of miR-212/132::GFP nor the inhibition of the miR-132 loop sequence affected the expression of the Luciferase reporter. [score:5]
However, impairing p72 expression also had a detrimental effect on GFP expression suggesting that p72 is not only required for proper miR-212/132 processing but is also involved in the maturation of the GFP mRNA. [score:5]
The Luciferase plasmid was co -transfected with a GFP or miR-212/132::GFP expressing plasmid, together with a 2′- O-Methyl oligonucleotide targeting the mir-132 loop sequence or a 2′- O-Methyl oligonucleotide complementary to the human let-7 as negative control. [score:5]
Downregulation of FUS, HNRNP2 and HNRNPF increased the GFP level without significantly affecting miR-132 and miR-212 levels suggesting that they may be involved in RNA maturation independently from miRNA processing. [score:4]
p72 was the only protein that influenced the level of miR-132 more than the processing of miR-212 since it’s downregulation significantly decreased the ratio of the mature miRNAs generated from miR-212/132::GFP (Fig. 5A). [score:4]
The accumulation of the miR-132 loop small RNA could also be observed in human cells expressing the miR-212/132::GFP plasmid (Fig. 2B). [score:3]
In the case of the mouse miR-132 we have found that FUS only elevates miR-132 and miR-212 level in vitro if its related protein EWS is inhibited. [score:3]
hsa-miR-132; mature miRNA Sequence: UAACAGUCUACAGCCAUGGUCG; (ABI/Life Technologies; 4427975); hsa-miR-212; mature miRNA Sequence: UAACAGUCUCCAGUCACGGCC; (ABI/Life Technologies; 4427975); hsa-miR-132-loop; custom-made target sequence: CUGUGGGAACCGGAGGUA; (ABI/Life Technologies; custom-made); hsa-miR-16; mature miRNA Sequence: UAGCAGCACGUAAAUAUUGGCG; (ABI/Life Technologies; 4427975). [score:3]
To test if the affinity purified miR-132 loop associated proteins played roles in the processing of miR-132 we knocked down each of the proteins that bound selectively to the miR-132 loop sequence with siRNA in Hela cells that were then transfected with the miR-212/132::GFP reporter plasmid (Fig. 1B). [score:2]
Among these, only p72 showed preference for facilitating miR-132 maturation, however; knocking down many of the affinity-purified proteins altered the level of the pri-miR-212/132 and/or the abundance of both miRNAs. [score:2]
Among the proteins that were shown to specifically bind to the miR-132 loop sequence and were tested in vitro for miRNA processing, only p72/DDX17 showed a clear ability to favor miR-132 processing over miR-212, in spite of the fact that knock down of p72 resulted in a significant drop of the recombinant pri-miRNA as well as both mature miRNA levels. [score:2]
This suggests that a conserved mechanism exists between mice and humans that favors the accumulation of mature miR-132 over miR-212 provided they are co-transcribed. [score:1]
To further confirm that p72 specifically recognizes the miR-132 loop, we immunoprecipitated endogenous p72 from HeLa cells that were transfected with wild type mmu-miR-212/132::GFP and the two loop mutants (6332 and 1483 in Fig. 3) that showed impaired miR-132 processing. [score:1]
This is supported by the fact that the reconstitution of the closed loop reinstated the 3–5 fold differences between the levels of the mature miR-132 and miR-212 without significantly affecting the level of miR-212 (Fig. 3D). [score:1]
To test these properties, we transfected the miR-212/132::GFP construct into HeLa cells and 16 hours later we immunopurified (IP) endogenous Ago2, the main effector protein of the human RNA induced silencing complex (RISC). [score:1]
Additionally, the exon downstream from the pri-miR-212/132 containing intron was fused to GFP mRNA (Fig. 1B). [score:1]
This modification in the miR-212/132::GFP reporter resulted in a decreased miR-132 level, suggesting that proteins that facilitate miR-132 processing may fail to bind to this sequence (Fig. 3B,D). [score:1]
This was further supported by the fact that processing efficiencies of both pre-miR-132 and pre-miR-212 into their respective mature miRNAs were very similar (Supplementary Figure 1B). [score:1]
The mutant pri-miR-212/132::GFP constructs were generated by PCR mutagenesis using KOD Hot Start DNA polymerase (Novagen). [score:1]
To test whether this uneven processing can be recapitulated in cultured laboratory cell lines we generated a reporter plasmid (mmu-miR-212/132::GFP) that encodes the mouse pri-miRNA-212/132 bearing intron, flanked by its two endogenous exons. [score:1]
Next, we transfected HeLa cells with the above-mentioned miR-212/132::GFP expressing plasmids and measured the concentration of both mature miR-132 and miR-212 using qPCR (Fig. 3D). [score:1]
The wild type pri-miR-212/132::GFP plasmid was used as a parental plasmid. [score:1]
miR-132 and miR-212 levels were quantified by qPCR and the absolute values were plotted. [score:1]
In humans, miR-132 and miR-212 are transcribed independently while in mice these miRNAs share the same pri-miRNA and this dissimilarity may require different sets of auxiliary factors for efficient processing. [score:1]
To exclude the possibility that changing the loop structure affected the fi delity of miR-132 processing we repeated the experiment but this time we used Northern blotting which is inherently less sensitive to the heterogeneity of miRNAs, to detect and quantify miR-132 and miR-212 levels. [score:1]
We have shown that the relatively closed loop structure of miR-132 is a key determinant for the favorable processing of miR-132 over miR-212. [score:1]
HeLa cells were transfected with GFP control plasmid (GFP), the miR-212/132::GFP reporter (wt) and two mutants with relaxed miR-132 loop sequences (Fig. 3B) followed by immunoprecipitation with p72 antibody. [score:1]
Uneven processing of the miR-212/132 cluster does not depend on the specific cellular context. [score:1]
Cells were plated onto 10 cm dishes, transfected with wild type pri-miR-212/312::GFP reporter or 2 mutant pri-miR-212/312::GFP constructs for 16 hours using 2 μg plasmid/dish and following the standard Effectene (Qiagen) transfection protocol. [score:1]
In the 1483 plasmid the 1158–1160 GGG of the pri-miR-212/132 was mutagenized to CCC (TGTGGGAACCGGAGGT/TGT cccAACCGGAGGT). [score:1]
p72/DDX17 influence the stability of pri-miR-212/132 and the level of mature miR-132, miR-212 in vitro. [score:1]
Our data also shows that competing with both the miR-132 and miR-212 loop sequences results in the decrease of the level of the pri-miRNA, judging from the level of the surrogate GFP protein level. [score:1]
Uneven processing of the miR-212/132 cluster does not depend on the specific cellular contextWe have previously reported that there is a significant difference between the steady state levels of mature miR-132 and miR-212 in primary cortical neurons isolated from mice, in spite of the fact that they are co-transcribed in the same intron of a non coding gene 30. [score:1]
Cells were plated onto 10 cm dishes, transfected with wild type pri-miR-212/312::GFP reporter construct for 16 hours using 2 μg plasmid/dish and following the standard Effectene (Qiagen) transfection protocol. [score:1]
We have previously reported that there is a significant difference between the steady state levels of mature miR-132 and miR-212 in primary cortical neurons isolated from mice, in spite of the fact that they are co-transcribed in the same intron of a non coding gene 30. [score:1]
The wild type construct again resulted in unequal processing of miR-132 and miR-212 by generating approximately 3 fold more miR-132 than miR-212. [score:1]
Deep sequencing of brain-derived neurotrophic factor (BDNF) stimulated primary mouse cortical neuronal cultures revealed that the miR-212/132 miRNA cluster produces five small RNAs, miR-212, miR-212*, miR-132, miR-132* and a 18bp long small RNA derived from the loop of miR-132 30 (Fig. 2A). [score:1]
Our aim was to identify protein factors that facilitate mmu-miR-132 processing over its co-transcribed and related miRNA, mmu-miR-212. [score:1]
Uneven processing of the mouse miR-212/132 cluster can be recapitulated in cultured mammalian cells. [score:1]
In this study, we dissect the molecular mechanism responsible for the asymmetric production of the co-transcribed miRNAs, miR-212 and miR-132 in mice. [score:1]
We were looking for outcomes that are similar to the effect of miR-132 loop mutants that resulted in a decreased miR-132 processing without drastically changing the level of miR-212 (Fig. 3D). [score:1]
One explanation for this discrepancy could be the fundamentally different transcriptional organization of miR-132 and miR-212 in mice and humans. [score:1]
Our data show that miR-132 is significantly more abundant than miR-212 in each of the cells and tissues we examined, suggesting a general mechanism that favors the accumulation of miR-132 over miR-212. [score:1]
We observed that the accumulation of miR-132 was significantly more prominent than the accumulation of miR-212 in both cell lines (Fig. 1C). [score:1]
The wild type pri-miR-212/132::GFP was generated using the mouse miR132/212 exon-intron-exon (1.46 kb) sequence which was amplified from a mouse BAC (bacterial artificial chromosome) clone (RP23-142A14), and the purified PCR product was cloned into HindIII/BamHI cloning site of pEGFP-N1 (Clontech) in a ligation reaction using HindIII/BglII sites. [score:1]
Interestingly, both mutants with the more relaxed loop structure significantly decreased the level of the mature miR-132 without affecting the quantity of miR-212, suggesting that the loop structure is necessary for efficient miR-132 processing. [score:1]
mmu-miR-132: UAACAGUCUACAGCCAUGGUCG; mmu-miR-132 complementary sequence: CGACCAUGGCUGUAGACUGUUA (used as a probe for Northern hybridization); mmu-miR-212: UAACAGUCUCCAGUCACGGCC; mmu-miR-212 complementary sequence: GGCCGUGACUGGAGACUGUUA (used as a probe for Northern hybridization); tRNA-Ile complementary sequence: UGGUGGCCCGUACGGGGAUCGA (used as a probe for Northern hybridization). [score:1]
After closer examination of the human and murine miR-132/212 sequences it became clear that the apical UGU sequence is intact in miR-132 but it is missing from miR-212. [score:1]
The stability of the mature miR-212 and miR-132 is similar. [score:1]
[1 to 20 of 50 sentences]
11
[+] score: 63
In particular, Methyl-CpG -binding protein 2 Mecp2, which is involved in chromatin remo deling and a target of miR-132 and miR-212, activates Per transcription while the miR-132 target genes PAIP2A and BTG2 attenuate PER protein translation, both of which may result in a dampening of light induced Per expression or accelerated PER decay [29, 44], thus, influencing behavioral resetting. [score:9]
Contradictory results between knockout, knockdown and overexpression studies (summarized in Table 1) might be explained by parallel, but independent effects of miR-132 and miR-212 on behavioral resetting and Per gene expression in the SCN. [score:7]
Diurnal variation of miR-132 and miR-212 expression data was tested by fitting a cosine wave (equation y = B + (A * cos (2 * π * ((x–Ps) / 24)))) to gene expression data, where B is the baseline, A is the amplitude, Ps is the phase shift, with a fixed 24-hour period; significance was determined by F-test. [score:5]
Direct targets of miR-212 and miR-132 in the SCN are known to interact with Per genes [29, 44]. [score:4]
miR-212 and miR-132 are strongly expressed in the SCN of 129/Sv mice (Fig 1A and 1B) and exhibit rhythmic transcription profiles under constant darkness (DD) conditions (Fig 1C and 1D). [score:3]
miR-212 and miR-132 share the same seed region and they can therefore target the same mRNAs [27]. [score:3]
miR-132 and miR-212 expression in the SCN. [score:3]
Circadian profiles of miR-132 and miR-212 expression were determined in the SCN of 129/Sv wildtype mice. [score:3]
MeCP2 controls BDNF expression and cocaine intake through homeostatic interactions with microRNA-212. [score:3]
We found the clock modulator miR-132 and miR-212 to be expressed rhythmically in the central circadian clock. [score:3]
For all experiments, 2–3 months old in-house bred WT and homozygous miR-132 [-/-] /212 [-/-] (KO) littermate mice in either of the background strains (C57BL/6N and 129/Sv) were used The miR-212/132 null mouse line has been generated by genomic targeting of the miR-212/132 locus in ES cells that has been derived from inbred wild-type 129/Sv (full name: 129S2/SvPasOrlRj) background. [score:3]
Data are represented as mean ± SEM, ** p < 0.01, *** p < 0.001. miR-212 and miR-132 are strongly expressed in the SCN of 129/Sv mice (Fig 1A and 1B) and exhibit rhythmic transcription profiles under constant darkness (DD) conditions (Fig 1C and 1D). [score:3]
Due to their identical “seed” sequence [27] and in order to avoid redundancy effects after targeting of either miR-132 or miR-212 alone, we have used mice lacking both miRs (miR-132 [-/-] /212 [-/-]). [score:3]
Our double knockout is also efficiently circumventing a potential miR-132 and miR-212 redundancy. [score:2]
Nevertheless, loss-of-function of, both, miR-132 and miR-212 on the 129/Sv background seemed to further enhance the previously described circadian resetting phenotype. [score:1]
The founder mice were also bred in parallel with the wildtype C57BL/6N mice and the heterozygote progenies has been subsequently bred with the wildtype C57BL/6N mice for a minimum of 6 generations to obtain miR-212/132 null mouse line in almost pure (>%98, N6) C57BL/6N background. [score:1]
miR-132 and miR-212 are produced from a single transcript encoded by the murine miR-132/212 locus on chromosome 11 [24]. [score:1]
miR-132 and miR-212 show overlapping circadian oscillations in the SCN with slightly different phases. [score:1]
Interestingly, miRs act as modifiers [19] and impact on circadian clock function [28] and covariation in miR-212 abundance and function was documented in different background strains, including C57BL/6 [17, 18, 51]. [score:1]
Modulation of Per gene activity in the SCN of miR-212/132 [-/-] mice may affect the ability of the central clock to respond to light. [score:1]
Indeed, the main functions of miR-212 and miR-132 overlap in the context of neuronal or immune functions. [score:1]
0176547.g001 Fig 1(A, B) Gene expression patterns of miR-132 (A) and miR-212 (B) in the brain of 129/Sv mice measured by ISH. [score:1]
Significant rhythms are illustrated with fitted cosine curves (Cosine-wave regression, F-test: (C) miR-132: p < 0.01, (D) miR-212: p < 0.05). [score:1]
[1 to 20 of 23 sentences]
12
[+] score: 52
To further understand the down-regulation in expression of the cholinergic α7 nAChR (global) and AChE-S (brain region specific) genes, we performed qRT PCR analysis for quantifying the expression of AChE-S targeting miRs: miR-132 and its co-clustered miR-212 in the above mentioned four brain regions. [score:10]
Taken together, our current findings, summarized in Figure 8, demonstrate that: LPS -induced inflammation stimulates the ACh -mediated and miRNA-regulated anti-inflammatory pathway in the brain; however, down-regulation of the α7 nAChRs makes this pathway ineffective; Inflammation dampens the mitochondrial cholinergic anti-apoptotic pathway and stimulates miRNAs assumed to decrease the brain cells viability; The α7-specific antibody aggravates LPS -induced inflammation by preventing the expression of anti-inflammatory miR-212 and stimulates the LPS-like signaling by itself; The α7-specific antibody dampens the excessive up-regulation of pro-apoptotic miRNAs upon inflammation and maintains mitochondrial integrity that may support the brain cells viability. [score:10]
Taken together, our current findings, summarized in Figure 8, demonstrate that: LPS -induced inflammation stimulates the ACh -mediated and miRNA-regulated anti-inflammatory pathway in the brain; however, down-regulation of the α7 nAChRs makes this pathway ineffective; Inflammation dampens the mitochondrial cholinergic anti-apoptotic pathway and stimulates miRNAs assumed to decrease the brain cells viability; The α7-specific antibody aggravates LPS -induced inflammation by preventing the expression of anti-inflammatory miR-212 and stimulates the LPS-like signaling by itself; The α7-specific antibody dampens the excessive up-regulation of pro-apoptotic miRNAs upon inflammation and maintains mitochondrial integrity that may support the brain cells viability. [score:10]
We observed significant LPS -induced increases in the expression levels of miR-212 in all of the tested brain regions, whereas miR-132 showed region-specific (frontal cortex and cerebellum) increases in its expression, correlating to AChE-S expression (Figures 3A,B vs. [score:7]
The general up-regulation of miRNA-212 in all studied brain areas and its significant inhibition by the α7-specific antibody in the frontal cortex, striatum and hippocampus suggests its specific involvement in inflammation-related mechanisms, different from those regulated by miRNA-132. [score:7]
In comparison, the antibody treatment clearly prevented LPS -induced miR-212 up-regulation in all brain regions except cerebellum (Figure 6B). [score:4]
Nicotine (3 days) failed to significantly affect either miR-132 or miR-212 expression. [score:3]
In addition to their involvement in inflammation-related processes, both miRNA-132 and miRNA-212 protect neurons against H [2]O [2] -mediated cell death, and their loss causes neuronal apoptosis via elevated levels of the cell death -associated proteins PTEN, FOXO3 and P300 that antagonize Akt pro-survival signaling (Wong et al., 2013). [score:1]
[1 to 20 of 8 sentences]
13
[+] score: 31
The combined analysis of miRNAs and mRNAs in the visual cortex of wt and miR-132/212 null mice revealed that genes downregulated with age and upregulated by miR-132/212 deletion are highly enriched with miR-132-3p targets and, to a much lesser extent, with targets of miR-212-5p, the only two members of the miR-132 family abundantly expressed in the visual cortex. [score:13]
Moreover, a significant enrichment in miR-132-3p targets was present in the genes upregulated in the miR-132/212 mutant cortex (54 genes, odds ratio 5.07; Fisher exact test P<0.0001, ), whereas the enrichment in miR-212-5p targets was not significant (14 genes, odds ratio 1.50; Fisher exact test P=0.13, ). [score:8]
MiR-212-5p targets were also significantly enriched in age -downregulated genes albeit with a minor odds ratio than miR-132-3p (, 132 genes, odds ratio=1.74; Fisher exact test P<0.0001). [score:6]
Then, we investigated the impact of developmental regulation of miR-132-3p and miR-212-5p on gene expression by analysing the transcriptome in the same samples used for the small. [score:3]
Among the members of the miR-132 family, miR-132-3p and miR-212-5p were the only miRNAs represented at high levels. [score:1]
[1 to 20 of 5 sentences]
14
[+] score: 29
Of these miRNAs, four were upregulated (mmu-miR-199a-5p, mmu-miR-329-3p, mmu-miR-136-5p, and mmu-miR-16-1-3p), and one was downregulated (mmu-miR-212-3p). [score:7]
For the downregulated miRNA, mmu-miR-212-3p, 231 candidate target genes were predicted (S3 Table). [score:6]
Previously, mmu-miR-212 was found to post-transcriptionally regulate C-terminal -binding protein 1 [36], a protein that was recently shown to repress the expression of steroidogenic factor 1 [37], a nuclear receptor involved in ovarian, adrenal, and testis development and function [38]. [score:5]
In our study, mmu-miR-212-3p was downregulated in vitrified mouse blastocysts. [score:4]
In mouse periovulatory granulosa cells, mmu-miR-212 was found to be highly upregulated following luteinizing hormone (LH)/hCG induction [36]. [score:4]
In this study, 5 of the 760 identified miRNAs, namely, mmu-miR-199a-5p, mmu-miR-329-3p, mmu-miR-136-5p, mmu-miR-16-1-3p, and mmu-miR-212-3p, showed significantly different expression between the vitrified and fresh mouse blastocysts. [score:3]
[1 to 20 of 6 sentences]
15
[+] score: 24
Of the 36 differentially expressed miRNAs, 20 were down-regulated in WT crypts compared with WT villi (Fig. 4a1, with all 18 blue spots below the purple spots, and Fig. 4a2, with the first two blue spots below the purple spots), 1 miRNA (miR-212-3p) showed the same level of expression in WT villi and crypts (Fig. 4a2; the third blue spot, overlapping the purple spot), and 15 miRNAs were up-regulated in WT crypts relative to villi (Fig. 4a2, with blue spots 4 to 18 above the purple spots). [score:10]
The expression of its target protein Actb was in agreement with miR-212-3p expression (Fig. 11g,h). [score:7]
Both miR-212-3p and its target Actb showed no expression gradient along the crypt-villus axis in WT and PepT1 KO mice; however, the levels of expression of miR-212-3p were equivalently high in WT crypts and villi and equivalently low in PepT1 KO crypts and villi (Fig. 11g,h). [score:7]
[1 to 20 of 3 sentences]
16
[+] score: 21
The results show upregulation of the non-coding RNAs miR-212, miR-132, miR-410, Snord14d and Snord14e following memory acquisition (FC30') and retrieval (RT30') (Figure 5A); although the levels of upregulation observed differ between the two time-points. [score:7]
Differential regulation of miR-132 and miR-212 after memory acquisition and retrieval raises the interesting possibility that they target different genes during those processes, although so far the few known experimentally validated targets are shared between miR-132 and miR-212 [60]. [score:6]
Finally, we examine genome-wide non-coding RNA regulation following memory acquisition and retrieval, pointing to a likely important role of microRNAs miR-132, miR-212, miR-410 and snoRNAs Snord14d and Snord14e in posttranscriptional regulation during both processes as well as a specific role for and miR-219 and its target CAMKIIγ after retrieval. [score:5]
MicroRNA genes miR-212, miR-132 and miR-219 were selected for further validation. [score:1]
MiR-212 and miR-132 are CREB -dependent microRNAs derived from the same precursor that are induced by LTP [59] and play an important role in neuronal plasticity [60]. [score:1]
The induction of miR-212 and miR-132 is not surprising given that they both are induced by LTP [59] and miR-132 has been shown to increase in response to the Barnes maze learning paradigm [66]. [score:1]
[1 to 20 of 6 sentences]
17
[+] score: 21
Strikingly, two of the downstream targets of IGF-1 signalling, namely connexin 43 and zona occludens 1, are also validated targets for miR-206 [46], [55] and miR-212 [56], [57] (depleted from the cerebellum) respectively. [score:5]
Our data provides a detailed map of miRNA brain expression in rats and shows that there are some differences in the expression in the cerebellum of a subset of the detectable transcripts, which are either highly enriched (miR-206 and miR-497) or nearly depleted (miR-132, miR-212, miR-221 and miR-222). [score:5]
Biochim Biophys Acta 56 Tang Y Banan A Forsyth CB Fields JZ Lau CK 2008 Effect of alcohol on miR-212 expression in intestinal epithelial cells and its potential role in alcoholic liver disease. [score:5]
Forebrain enrichment was also seen for the two members of the miR-132 family (miR-132 and miR-212), which were also most highly expressed in the hippocampus and amygdaloid regions. [score:3]
Notably, we found reciprocal expression profiles for a subset of the miRNAs predominantly found (> ten times) in either the cerebellum (miR-206 and miR-497) or the forebrain regions (miR-132, miR-212, miR-221 and miR-222). [score:3]
[1 to 20 of 5 sentences]
18
[+] score: 17
The top striatum hits include the downregulated Mir212/ Mir132 cluster whose knockout has been implicated in impaired synaptic function [18] and down-regulation in neuronal death via the PTEN/FOXO3a signaling pathway [19]. [score:7]
The strongest negative microRNA-module correlations were observed between striatum module M39 and Mir132 (mean correlation -0.79) and Mir212 (mean correlation -0.75); module M39 is also strongly enriched in predicted targets of both microRNAs (p = 1×10 [−7] for targets predicted by MicroRNA. [score:5]
The Mir132/ Mir212 cluster has been implicated in neuronal survival and shows strongest down-regulation in the striatum, followed by cerebellum and cortex. [score:3]
Consistent with the notion that microRNA responses are broadly distinct across all four brain regions, we only identified three microRNAs (Mir484, Mir212, and Mir6944) that are commonly dysregulated across all 4 brain regions. [score:1]
The Mir212/ Mir132 cluster has also been implicated in regulation of aging-related processes via interaction with FOXO3 [23]. [score:1]
[1 to 20 of 5 sentences]
19
[+] score: 15
To validate the data of the miRNA array, we conducted real-time quantitative reverse transcriptional polymerase chain reaction (qRT-PCR) for the expression of six upregulated miRNAs (mmu-miR-574-5p, mmu-miR-466i, mmu-miR-342-3p, mmu-let-7i, mmu-miR-34a and mmu-miR-188-5p) and five downregulated miRNAs (mmu-miR-378a-3p, mmu-miR-202, mmu-miR-378b, mmu-miR-378d and mmu-miR-212-3p) in liver tissues from the CCl [4] group (n = 5) and the control group (n = 4). [score:9]
Among these 12 miRNAs, seven miRNAs, including mmu-miR-574-5p, mmu-miR-466i-5p, mmu-miR-342-3p, mmu-let7i-5p, mmu-miR-34a-5p, mmu-miR-188-5p and mmu-miR-5119, were upregulated, whereas five miRNAs, including mmu-miR-378a-3p, mmu-miR-202-3p, mmu-miR-378b, mmu-miR-378d and mmu-miR-212-3p, were downregulated in CCl [4] compared to the control group (Table 1). [score:6]
[1 to 20 of 2 sentences]
20
[+] score: 15
Other miRNAs from this paper: mmu-mir-125a, mmu-mir-132, mmu-mir-122, mmu-mir-375
In cervical cancer, Zhao et al. demonstrated that levels of microRNA-122 (miR-212) and miR-132, both of which are from the same gene cluster, are reduced in cancerous tissues compared to adjacent normal tissues; furthermore, over -expression of miR-212/132 increased cell cycle arrest at the G1/S phase, inhibited cell proliferation, increased E-cadherin levels, decreased vimentin levels, and inhibited EMT, migration, and invasion in cervical cancer cells by targeting Smad2 [26]. [score:8]
Jiang et al. reported that over -expression of miR-212/132 increases radiosensitivity and suppresses cell migration in lung cancer by mediating cell proliferation and apoptosis; inhibition of miR-212/132 has the opposite effects [33]. [score:7]
[1 to 20 of 2 sentences]
21
[+] score: 13
There are also a number of miRNAs such as miR-132, miR-212, miR-130a and miR-152 shown to be upregulated in the pancreatic islets of the wi dely-studied T2D mo del Goto-Kakizaki rats (Esguerra et al., 2011) with active roles in beta cell stimulus-secretion coupling (Malm et al., 2016; Ofori et al., 2017). [score:4]
miR-132 and miR-212 expression in INS-1 832/13 cells (A–B) or in EndoC-βH1 cells (C–D) at different confluences. [score:3]
Among the other miRNAs included in this study, we observed significantly higher expression levels of miR-132 and miR-212 at higher confluences in INS-1 832/13 cells (Figs. 3A– 3B) but only an increasing trend in the human EndoC-βH1 cells (Figs. 3C– 3D). [score:3]
The following primers from TaqMan [®] Gene Expression and TaqMan [®] miRNA Assays were used for qPCR: Cav1/CAV1 (Rn00755834_m1/Hs00971716_m1), Aifm1/AIFM1 (Rn00442540_m1/ Hs00377585_m1), miR-375 (TM_ 000564), miR-200a (TM_000502), miR-130a (TM_00454), miR-152 (TM_000475), miR-132 (TM_000457) and miR-212 (TM_002551) were used for qPCR. [score:1]
We also investigated the influence of confluence on the expression levels of miR-200a, miR-130a, miR-152, miR-132 and miR-212. [score:1]
Although we showed that miR-375, which is one of the most enriched beta cell miRNA was not significantly influenced by confluence level in cultured rat and human beta cell lines, we clearly demonstrated that miR-132 and miR-212 are more dependent on cellular densities, as was shown for some miRNAs in other cells types (Hwang, Wentzel & Men dell, 2009; Van Rooij, 2011). [score:1]
[1 to 20 of 6 sentences]
22
[+] score: 12
Other miRNAs from this paper: mmu-mir-132, hsa-mir-212, hsa-mir-132
Note that the prediction tools (PITA, TargetScan, Pictar) made no distinction between miR-132 and miR-212 targets, as both miRs share the same seed sequence 20. [score:5]
Interestingly, Sirt1 mRNA levels (negatively) correlate with miR-212 in AD 62 (in contrast to our western blot data) and corroborates a multi-layered regulation of Sirt1 expression. [score:4]
Similar results were obtained with miR-212 (Fig. 2d,e). [score:1]
Notably, no correlation was found between miR-132 (or miR-212), Sirt1 and Aβ in individual groups (controls, MCI, AD) (see Supplementary Table S5). [score:1]
On the other hand, miR-212 did not correlate with Sirt1 (Fig. 4f). [score:1]
[1 to 20 of 5 sentences]
23
[+] score: 12
These included miR-8 family overexpressed in FCx and comprising of miRNAs from two chromosomal clusters, miR-429, miR-200a, miR-200a*, miR-200b, and miR-200b* from chromosome 4, and miR-141 and miR-200c from chromosome 6. Also, a chromosome 6 cluster with miR-182, miR-96, and miR-183 and a chromosome 11 cluster with miR-212 and miR-312 were expressed on a higher level in FCx. [score:5]
For example, in the ceramide pathway (Figure 5), miR132 and miR-212 were predicted to regulate Ras, Pi3k, Pp2a, and Tnfr1, miR-200a to regulate Nsmaf, Pp2a, and Map2k4, and miR-200b, miR-200c, and miR-429 to regulate Ras, Pp2a, Map3k1, and Jun. [score:4]
For example, acute stress increases let-7a, miR-9 and miR-26a/b expression levels in the mouse frontal cortex (FCx), but not in the hippocampus (HP) [8], and miR-212 signalling in the rat striatum has a role in determining vulnerability to cocaine addiction [9]. [score:3]
[1 to 20 of 3 sentences]
24
[+] score: 10
Selective downregulation of miR-212 observed in AA PCa is correlated with upregulation of splicing factor hnRNP-H1, upregulation of AR-V7 and antiandrogen resistance in PCa cell lines 47. [score:10]
[1 to 20 of 1 sentences]
25
[+] score: 9
Another example is connective tissue growth factor, Ctgf, which in the present study is targeted by three upregulated miRNAs, miR-212, 124, and 18a, suggesting a strong downregulation. [score:9]
[1 to 20 of 1 sentences]
26
[+] score: 8
If we further apply the disease filter (selecting gastric cancer in the stomach), miR-212-3p is now hidden in only 22 predicted miRNA of MECP2. [score:3]
Even by considering the common predicted miRNAs from three existing miRNA target prediction databases (i. e. setting the database filter equal to three), miR-212-3p is still hidden in 537 predicted miRNAs of the gene MECP2, suggesting that applying the database filter alone is not an efficient way to reduce the non-functional miRNAs of MECP2. [score:3]
For example, human gene MECP2 is known to be regulated by miR-212-3p in gastric cancer cells [33]. [score:2]
[1 to 20 of 3 sentences]
27
[+] score: 8
Other miRNAs from this paper: mmu-mir-138-2, mmu-mir-338, mmu-mir-138-1
Both miR-212-3p and miR-138-5p were significantly down-regulated in response to METH and were previously demonstrated as important regulators of cocaine addiction and neuronal plasticity 7 38. [score:5]
Examples of negatively correlated interactions include miR-212-3p, miR-338-3p and miR-138-5p and their potential targets involved in neural functions, Arc, Fos and Ntrk1 respectively. [score:3]
[1 to 20 of 2 sentences]
28
[+] score: 8
Ubiquitously expressed miR-16, miR-21, and miR-212 were used as positive controls, and did not show any significant differences between wt, mdx and tg serum, whereas miR-122a and miR-323 which expressed specifically in liver and brain, respectively, and miR-302 did not dectect in all of EVs (S3B Fig). [score:5]
miR-16, miR-21, and miR-212 were used as ubiquitous-expressed miRNAs. [score:3]
[1 to 20 of 2 sentences]
29
[+] score: 7
Worth mentioning is the case of hsa-miR-132-3p and hsa-miR-212-3p that exhibit similar mature sequences and share the same seed region, yet only few targets were demonstrated to be targeted by both of them, and each of these miRNAs may also repress specific targets (Wanet et al. 2012). [score:7]
[1 to 20 of 1 sentences]
30
[+] score: 7
Interestingly, the miR-132 knockout (resulting in miR-132/miR-212 double knockout, as they are coded by the same gene) is not essential for development or fertility of mice; however, its function is related to specific aspects of synaptic plasticity [13]. [score:4]
The expression levels of the primary and precursor forms of miR-212 and miR-132 were induced during long-term potentiation (LTP; an electrophysiological mo del of the synaptic plasticity) in the rat adult dentate gyrus [8] and upon brain-derived neurotrophic factor (BDNF) stimulation of primary cortical mouse neurons [9]. [score:3]
[1 to 20 of 2 sentences]
31
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
A triple comparison was also done that included cbs [–/–], cbs [+/–] and STZ retinas, which revealed 6 miRNAs (miR-194, miR-16, miR-212, miR-30c, miR-5128 and miR-669c) that were commonly changed among cbs [–/–], cbs [+/–] and diabetes; 2 of these miRNAs were consistently changed among the three groups (miR-194 was upregulated and miR-16 was downregulated). [score:7]
[1 to 20 of 1 sentences]
32
[+] score: 7
Other miRNAs from this paper: mmu-mir-132, mmu-mir-146a, mmu-mir-155
Nahid et al. also showed that PGN stimulation caused rapid upregulation of miR-132 and miR-212 THP-1 monocytes and primary macrophages thereby downregulating IRAK4 and that this induction was induction relative to LPS -induced miR-146a induction [42]. [score:7]
[1 to 20 of 1 sentences]
33
[+] score: 6
Under hypoxic microenvironment, the expression of miR-31 in dendritic cells (DCs) is elevated and the expression of miR-1296 in hepatocellular carcinoma tissue is reduced 4, 5. Notably, miR-212/132 cluster knockout mice show high percentage of IL-10-producing CD4 [+] T cells in colons [6]. [score:6]
[1 to 20 of 1 sentences]
34
[+] score: 6
Conversely, within the pro-myogenic pool, miR-424/-146b/-181a are associated with myogenesis and muscle development 28– 30. miR-212/-132 have been shown to inhibit MECP2 [31], which in turn regulates muscle maturation [32]. [score:5]
Following this RNA-seq -based filter, we identified miR-34c-5p/34c-3p/-362/-210/-590 for fibroblast-derived MiPs, and miR-212/-132/-424/-146b/-181a for MAB-MiPs (Fig.   4e and Supplementary Fig.   2). [score:1]
[1 to 20 of 2 sentences]
35
[+] score: 6
Seven miRNAs (mmu-miR-574-5p, mmu-miR-466i-5p, mmu-miR-342-3p, mmu-let7i-5p, mmu-miR-34a-5p, mmu-miR-188-5p and mmu-miR-5119) were upregulated and the other five (mmu-miR-378a-3p, mmu-miR-202-3p, mmu-miR-378b, mmu-miR-378d and mmu-miR-212-3p) were downregulated in the CCl [4] group compared with the control (Fig. 1a,b). [score:6]
[1 to 20 of 1 sentences]
36
[+] score: 6
In agreement with our data, the downregulation of miR-212-3p by CR in the serum of long-lived B6C3F1 mice have been observed [19], however, we did not observe any significant difference in the expression of other 12 miRNAs which were common for both studies [19]. [score:6]
[1 to 20 of 1 sentences]
37
[+] score: 6
Among the up-regulated miRNAs, mmu-mir-1298 had the highest fold change with 4.025 during 21d-P6 followed by mmu-mir-212 and mmu-mir-132 with a fold change of 3.71 and 3.28, respectively. [score:4]
For example, miR-132 and miR-212 respond to luteinizing hormone (LH)/human chorionic gonadotropin (hCG) thus, these miRNAs play important roles in post-transcriptional regulation of granulosa cells [23]. [score:2]
[1 to 20 of 2 sentences]
38
[+] score: 5
Other miRNAs from this paper: mmu-mir-203
Effect of alcohol on miR-212 expression in intestinal epithelial cells and its potential role in alcoholic liver disease. [score:5]
[1 to 20 of 1 sentences]
39
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
MiR-132 and miR-212 are increased in pancreatic cancer and target the retinoblastoma tumor suppressor. [score:5]
[1 to 20 of 1 sentences]
40
[+] score: 5
The miR-132/mir-212 cluster can also regulate hematopoietic stem cells survival during aging by regulating FoxO3 expression [56]. [score:5]
[1 to 20 of 1 sentences]
41
[+] score: 4
In addition, miR-106a, miR-146, miR-155, miR-150, miR-17-3p, miR-191, miR-197, miR-192, miR-21, miR-203, miR-205, miR-210, miR-212, and miR-214 have been reported to be up-regulated in lung cancer [12]. [score:4]
[1 to 20 of 1 sentences]
42
[+] score: 4
Two miRNAs, miR-132 and miR-212 were found to be highly up-regulated following LH/hCG induction [33]. [score:4]
[1 to 20 of 1 sentences]
43
[+] score: 4
Furthermore, miR-212 negatively regulates autophagy by inhibiting SIRT1 [45]. [score:4]
[1 to 20 of 1 sentences]
44
[+] score: 4
Other miRNAs from this paper: mmu-mir-132, mmu-mir-134
MiR-212/132 expression is regulated by the CREB transcription factor [39] that is also implicated in dendritic growth [40], neuronal maturation [41], and memory formation [42]. [score:3]
These changes were coupled to epigenetic modulation via increased levels of microRNAs (miR-132/miR-212, miR-134). [score:1]
[1 to 20 of 2 sentences]
45
[+] score: 4
Fiedler et al. reported that miR-132, miR-212, and miR-21 in mGC were up-regulated by LH/hCG [40]. [score:4]
[1 to 20 of 1 sentences]
46
[+] score: 4
Recently, miR-212 has been identified as a new player and implicated in alcohol -induced intestinal permeability, where it targets a major tight junction protein, Zonula occludens 1 (ZO-1) [28]. [score:3]
Induction of miR-212 and decrease in ZO-1 protein were observed both in colon biopsy samples from patients with ALD and in alcohol -treated CaCO-2 cells [28]. [score:1]
[1 to 20 of 2 sentences]
47
[+] score: 3
In the human study 10 miRNAs were extracted, and the change in their expression level varied significantly between F0 and F3 (F0F3: hsa-miR-212, 23b, and 422b). [score:3]
[1 to 20 of 1 sentences]
48
[+] score: 3
In lung cancer, multiple miRNAs, such as let-7 family, miR-200, miR-486 and miR-146a have been identified as tumor suppressors [10– 14]; on the other hand, miR-31, miR-212 and miR-196a were found to promote NSCLC carcinogenesis [15– 17]. [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 3
We performed Assay 1 in 293T cells using hundreds of miRNA minigenes in our genetic library (Lu et al, 2011) and found that 4 miRNAs (miR-33a, miR-33b, miR-212 and miR-203) significantly down-regulated the c-Myc -dependent reporter (Fig 1B; Supporting Information Fig S1A). [score:3]
[1 to 20 of 1 sentences]
50
[+] score: 3
Im H-I Hollander JA Bali P Kenny PJ (2010) MeCP2 controls BDNF expression and cocaine intake through homeostatic interactions with microRNA-212. [score:3]
[1 to 20 of 1 sentences]
51
[+] score: 3
For example, cocaine self-administration in rats reportedly increases expression of the miR-212 in striatum, and experimentally increasing miR-212 levels in this region decreases cocaine reward [21]. [score:3]
[1 to 20 of 1 sentences]
52
[+] score: 3
MeCP2 controls BDNF expression and cocaine intake through homeostatic interactions with microRNA-212. [score:3]
[1 to 20 of 1 sentences]
53
[+] score: 3
In another related study, it is reported that alcohol increased the miR-212 expression in intestinal epithelial cells [29]. [score:3]
[1 to 20 of 1 sentences]
54
[+] score: 3
miR-212/132 expression and functions: within and beyond the neuronal compartment. [score:3]
[1 to 20 of 1 sentences]
55
[+] score: 2
In addition, further in vivo studies, such as a study using floxed miR-212/132 mice [44] to specifically ablate miR-132 in GCs, could improve our understanding of the effect of miR-132 on E [2] synthesis. [score:1]
miR-21, which in addition to miR-132 and miR-212, is an LH -induced miRNA, blocks apoptosis in mGCs [32]. [score:1]
[1 to 20 of 2 sentences]
56
[+] score: 2
Recently, Ucar and colleagues [27] have shown that miR-212 and miR-132 are indispensable during the development of the mammary gland. [score:2]
[1 to 20 of 1 sentences]
57
[+] score: 2
This regulation appeared specific to miR-29 binding since changes in luciferase activity were not impacted when transfections were repeated with an irrelevant miRNA, miR-212, or with the miR-29 site deleted from the collagen 3′UTR (Mutant). [score:2]
[1 to 20 of 1 sentences]
58
[+] score: 2
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30b, mmu-mir-99a, mmu-mir-126a, mmu-mir-132, mmu-mir-141, mmu-mir-181a-2, mmu-mir-185, mmu-mir-193a, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-34c, mmu-let-7d, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-22, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-34a, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-378a, mmu-mir-451a, mmu-mir-674, mmu-mir-423, mmu-mir-146b, bta-mir-26a-2, bta-let-7f-2, bta-mir-16b, bta-mir-20a, bta-mir-26b, bta-mir-99a, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-193a, bta-let-7d, bta-mir-132, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-423, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-23b, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-34a, bta-mir-141, bta-mir-146b, bta-mir-16a, bta-mir-185, bta-mir-196a-2, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-29b-1, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-2284y-1, mmu-let-7j, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285t, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2284ab, bta-mir-2284ac
Ucar and colleagues [25] showed that miR-212 and miR-132 are essential during mammary gland development. [score:2]
[1 to 20 of 1 sentences]
59
[+] score: 2
Ucar A Gupta SK Fiedler J Erikci E Kardasinski M Batkai S The miRNA-212/132 family regulates both cardiac hypertrophy and cardiomyocyte autophagyNat Commun. [score:2]
[1 to 20 of 1 sentences]
60
[+] score: 2
Other miRNAs from this paper: mmu-mir-132, mmu-mir-146a
Regulation of TLR2 -mediated tolerance and cross-tolerance through IRAK4 modulation by miR-132 and miR-212. [score:2]
[1 to 20 of 1 sentences]
61
[+] score: 2
Other miRNAs from this paper: mmu-mir-132, rno-mir-132, rno-mir-212
Gonadotropin-releasing hormone induces miR-132 and miR-212 to regulate cellular morphology and migration in immortalized LbetaT2 pituitary gonadotrope cells. [score:2]
[1 to 20 of 1 sentences]
62
[+] score: 2
Further, miR-212, which has a similar sequence to miR-132, was not reduced. [score:1]
miR-212 is highly homologous to miR-132 and generated from the same transcript, making it a particularly good specificity control. [score:1]
[1 to 20 of 2 sentences]
63
[+] score: 2
Other miRNAs from this paper: mmu-mir-132
miR-212 and miR-132 are dispensable for mouse mammary gland development. [score:2]
[1 to 20 of 1 sentences]
64
[+] score: 2
The miRNA-212/132 family regulates both cardiac hypertrophy and cardiomyocyte autophagy. [score:2]
[1 to 20 of 1 sentences]
65
[+] score: 2
For example, miR-546 and miR-710 were increased in response to cytokines whereas let-7e and miR-212-3p were more abundant in exosomes of untreated MIN6B1 cells (see Additional file 3: Figure S2B for confirmation of these results by qPCR). [score:1]
B) The level of let-7e, miR-212-3p, miR-546 and miR-710 in exosomes from MIN6B1 treated or not with cytokines for 48 h cells was determined by qPCR. [score:1]
[1 to 20 of 2 sentences]
66
[+] score: 1
The results revealed the levels of miR-206, miR-30e, miR-216b, miR-133a, and miR-212 exhibited the top five significant changes upon histamine treatment, among which miR-206, miR-30e, miR-216b, and miR-133a increased, whereas miR-212 decreased (Fig.   5a; Supplementary Figure  3a). [score:1]
[1 to 20 of 1 sentences]
67
[+] score: 1
Among them, miR-212, miR-29b, miR-21 and miR-221 were confirmed to be increased in both rat and mouse denervated gastrocnemius muscles (Fig. 1e). [score:1]
[1 to 20 of 1 sentences]
68
[+] score: 1
Tang Y. Zhang L. Forsyth C. B. Shaikh M. Song S. Keshavarzian A. The role of miR-212 and iNOS in alcohol -induced intestinal barrier dysfunction and steatohepatitisAlcohol Clin. [score:1]
[1 to 20 of 1 sentences]
69
[+] score: 1
Other miRNAs from this paper: mmu-mir-132, hsa-mir-212, hsa-mir-132
The microRNA212/132 family is one of the most studied miRNA family closely related to MeCP2. [score:1]
[1 to 20 of 1 sentences]
70
[+] score: 1
Indeed, it has been reported that multiple miRNAs participate in synaptic and cognitive impairment and AD-like neuropathology, including miR-9, miR-34, miR-132, miR-137, miR-188, miR-204, miR-211, and miR-212 [71– 77]. [score:1]
[1 to 20 of 1 sentences]
71
[+] score: 1
Eleven miRNAs were randomly selected for qPCR analysis for each age: GD 17.0 miR-1843-5p, miR-485-3p, miR-711, miR-3962, miR-3067-3p, miR-212-3p, miR-669i, miR-877, miR-26b-3p, miR-465c-3p, let-7b-3p; GD 18.0 miR-1843-5p, miR-485-3p, miR-3473d, miR-132-5p, miR-3074-1-3p, miR-128-2-5p, miR-130b-5p, miR-490-5p, miR-669h-3p, miR-3058-5p, miR-146b. [score:1]
[1 to 20 of 1 sentences]
72
[+] score: 1
HH10 [11] T cell HeLa, BM* S5_3196A [16] B cell* 253. d KON006.05 [11] T cellB3_4153A [16] B cell mir-212* T5_11746C1 [16] B cell Hic1/Dph1 Heart Hepatocellular carcinoma, lung cancer mir-132* S5_7233D [16] B cell Frontal Cortex* i142-4000p [13] Lymphoma mir-22* S3_049b [17] B cell 2010305C02Rik Skeletal Muscle* S158_3_11_29 [17] myeloid mir-142160. [score:1]
[1 to 20 of 1 sentences]
73
[+] score: 1
The well-studied miRNAs within this group included let-7 family (let-7c/d/f/k), miR-212 cluster (miR-212-3p and miR-132-3p/5p), miR-23a/b, miR-9-3p/5p, miR-411 clusters (miR-299a and miR-329) and miR-466 clusters (miR-466m-5p and miR-669f-5p) (Figure 2 and Table 1). [score:1]
[1 to 20 of 1 sentences]
74
[+] score: 1
Other miRNAs from this paper: hsa-mir-212
Increased cocaine -induced conditioned place preference during periadolescence in maternally separated male BALB/c mice: the role of cortical BDNF, microRNA-212, and MeCP2. [score:1]
[1 to 20 of 1 sentences]
75
[+] score: 1
Other miRNAs from this paper: hsa-mir-212
Several microRNAs are associated with BDNF depletion [72, 73], one of them, microRNA-212, was increased after ECS in rat’s DG [46]. [score:1]
[1 to 20 of 1 sentences]
76
[+] score: 1
Hollander et al. reported cocaine SA increase miR-212 in striatum and increasing miR-212 in this region decrease cocaine reward 18. [score:1]
[1 to 20 of 1 sentences]