sort by

213 publications mentioning mmu-mir-181a-1 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-181a-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 390
Excess NEFA in the liver increases miR-181a expression, which in turn decreases SIRT1 expression and activity via translation inhibition, resulting in reduced lipidolysis, impaired insulin sensitivity, and increased gluconeogenesis and lipid synthesis. [score:9]
MiR-181a overexpression or SIRT1 knockdown impairs glucose and lipid metabolism in vivoTo explore the function of miR-181a and SIRT1 in vivo, we used Antagomir of miR-181 (Ago-181a) and adenovirus expressing a mouse SIRT1 short hairpin RNA (shRNA) (Ad-shRNA SIRT1) to overexpress miR-181a and knock down SIRT1, respectively, in the livers of mice. [score:9]
However, a previous study showed that miR-181a suppressed lipogenesis in bovine mammary epithelial cells by targeting acyl-CoA synthetase long-chain family member 1 (ACSL1) [48], and another study showed that miR-181a inhibited lipid accumulation by targeting isocitrate dehydrogenase 1 (IDH1) in mouse embryonic fibroblast cells [49]. [score:9]
Figure 8 Excess NEFA in the liver increases miR-181a expression, which in turn decreases SIRT1 expression and activity via translation inhibition, resulting in reduced lipidolysis, impaired insulin sensitivity, and increased gluconeogenesis and lipid synthesis. [score:9]
A recent study reported that miR-181a and b, miR-199b, miR-135a and miR-205 targeted endogenous SIRT1 and downregulated its expression in mouse embryonic stem cells [28]. [score:8]
The results showed that HepG2 cells transfected with miR-181a mimics or treated with NEFA displayed decreases in SIRTI and PGC-1α protein expression levels and increases in PGC-1α acetylation levels, indicating inhibited SIRT1 expression and activity (Figure 6A). [score:7]
Studies have shown that miR-181a is highly expressed in many tissues, such as the thymus, brain and liver [26, 27], and that miR-181a suppresses SIRT1 protein expression in HEK293T and mouse embryonic stem cells [28, 29]. [score:7]
In addition, miR-181a inhibitor -induced increases in PPARα expression and decreases in SREBP-1c expression were also blocked by SIRT1 siRNA transfection (Figure 4J). [score:7]
To inhibit or increase miR-181a expression, we transfected the hepatocytes with either 10 nM miR-181a mimics or 50 nM inhibitors for 48 h using X-tremeGENE siRNA Transfection Reagent (Roche), according to the manufacturer’s instructions. [score:7]
Subsequent experiments showed that miR-181a overexpression impaired the insulin signaling pathway and glucose metabolism, elevated SREBP-1c protein expression levels and TG contents, and decreased PPARα protein expression levels in dairy cow hepatocytes and HepG2 cells. [score:7]
To explore the function of miR-181a and SIRT1 in vivo, we used Antagomir of miR-181 (Ago-181a) and adenovirus expressing a mouse SIRT1 short hairpin RNA (shRNA) (Ad-shRNA SIRT1) to overexpress miR-181a and knock down SIRT1, respectively, in the livers of mice. [score:6]
Besides, hepatocytes transfected with miR-181a inhibitors exhibited significantly decreased miR-181a expression and increased SIRT1 mRNA expression compared with control hepatocytes (Supplementary Figure 4B, Figure 2F). [score:6]
Consistent with the results of the above experiment, the results of this experiment showed that inhibiting miR-181a in hepatocytes significantly increased insulin-stimulated IR, Akt and GSK3β phosphorylation (Figure 3F) and significantly decreased G6Pase and PEPCK mRNA expression in the miR-181a inhibitor -treated hepatocyte group compared with the control group (Figure 3G). [score:6]
The results showed that hepatocytes co -treated with NEFA and miR-181a inhibitors displayed a significant increase in their PPARα protein expression levels and a decrease in their SREBP-1c protein expression levels compared with hepatocytes treated with NEFA alone (Figure 4F). [score:6]
Consistent with these results, our results also showed that PPARα protein expression was decreased, while SREBP-1c protein expression was increased in mice in which miR-181a was overexpressed or SIRT1 was silenced compared with control mice (Figure 7Ga and 7Gb). [score:6]
Our results implied that miR-181a overexpression decreased SIRT1 expression and activity and subsequently decreased PGC-1α protein expression levels and increased PGC-1α acetylation levels in cow hepatocytes, HepG2 cells and mice compared with control cells and mice. [score:6]
Taken together, these data indicate that high miR-181a expression may partially reduce SIRT1 expression and activity and miR-181a may be a regulator of glucose and lipid metabolism. [score:6]
The present study demonstrated that excess NEFA increases miR-181a expression, which in turn decreases SIRT1 expression and activity in hepatocytes. [score:5]
To determine whether SIRT1 mediates the effects of miR-181a on hepatocyte glucose and lipid metabolism, we transfected hepatocytes with SIRT1 siRNA, which decreased SIRTI and PGC-1α protein expression and increased PGC-1α acetylation levels, changes indicative of SIRT1 inhibition (Supplementary Figure 8). [score:5]
Inhibition of miR-181a alleviates high NEFA concentration -induced metabolic disorder by enhancing SIRT1 expression and activity in hepatocytes. [score:5]
Therefore, inhibiting miR-181a or increasing SIRT1 expression and activity may contribute to reductions in metabolic dysfunction in dairy cows or patients with NAFLD. [score:5]
MiR-181a overexpression impairs and miR-181a inhibition improves glucose and lipid metabolism in vitro. [score:5]
Inhibition of miR-181a alleviates high NEFA concentration -induced metabolic disorders by enhancing SIRT1 expression and activity in hepatocytes. [score:5]
MiR-181a overexpression impairs and miR-181a inhibition improves glucose and lipid homeostasis in HepG2 cells. [score:5]
MiR-181a overexpression impairs and miR-181a inhibition improves glucose and lipid metabolism in hepatocytes. [score:5]
The relative expression levels of miR-181a in serum were normalized to those of cel-miR-39-3p, and the relative expression levels of miR-181a/mRNA in the liver and hepatocytes were normalized to those of U6/β-actin, whose cycles-to-threshold values were not affected by time, treatment, or interactions, findings that validated its usefulness as a control gene. [score:5]
Using TargetScan, we found that SIRT1 contains a potential miRNA response element (MRE) for miR-181a in its 3′-untranslated region (UTR; Figure 2A). [score:5]
Figure 3MiR-181a overexpression impairs and miR-181a inhibition improves glucose and lipid metabolism in vitro(A, B, C, D and E) Hepatocytes were transfected with 10 nM miR-181a mimics or negative controls in the absence or presence of 100 nM insulin. [score:5]
The abovementioned decreases in SIRT1 protein expression levels and activity in hepatocytes were also significantly enhanced by treatment with miR-181a inhibitors (Figure 4A). [score:5]
In addition, NEFA -induced G6Pase and PEPCK mRNA expression levels were significantly reduced by the miR-181a inhibitors (Figure 4C). [score:5]
These data indicate that miR-181a overexpression impairs and miR-181a inhibition improves glucose and lipid homeostasis in HepG2 cells. [score:5]
Moreover, the medium glucose concentration of the indicated group was significantly lower than that of the control group (Figure 3H), and PPARα and SREBP-1c protein expression levels were significantly higher and lower in the miR-181a inhibitor -treated hepatocyte group than the control group, respectively (Figure 3I). [score:5]
We also found that miR-181a inhibition rescued NEFA -mediated SIRT1-PGC-1α pathway inhibition. [score:5]
Hepatocytes co -treated with NEFA (1.2 mM) and miR-181a inhibitors (50 nM) displayed a significant decrease in their miR-181a expression level compared with hepatocytes treated with NEFA alone (Supplementary Figure 6). [score:4]
In addition, SIRT1 and PGC-1α protein expression levels were markedly increased, and acetylated PGC-1α levels were significantly decreased in hepatocytes transfected with miR-181a inhibitors compared with control hepatocytes (Figure 2G). [score:4]
As expected, RT-qPCR analysis revealed that miR-181a was overexpressed (Supplementary Figure 4A), whereas SIRT1 mRNA expression levels were significantly decreased in these hepatocytes compared with control hepatocytes (Figure 2D). [score:4]
To determine whether SIRT1 is a direct target of miR-181a, the 3’-UTR of the SIRT1 mRNA, including the miR-181a putative binding site, was cloned downstream of the luciferase reporter gene. [score:4]
In addition, HepG2 cells transfected with miR-181a mimics or treated with NEFA also displayed decreased PPARα protein expression levels and increased SREBP-1c protein expression levels and TG content compared with control cells (Figure 6F and 6G). [score:4]
Hepatocytes co -treated with NEFA and miR-181a inhibitors displayed a significant increase in SIRT1 protein expression levels and activity compared with cells treated with NEFA alone, changes that were reversed by SIRT1 siRNA transfection (Figure 4H). [score:4]
We found that overexpressing miR-181a decreased PPARα protein expression levels in the indicated group of hepatocytes compared with the control group of hepatocytes (Figure 3D). [score:4]
In the present work, we identified SIRT1 as a target of miR-181a and provide both in vivo and in vitro data demonstrating that hepatic miR-181a is a core regulator of hepatic glucose and lipid metabolism. [score:4]
SIRT1 is a directly target of miR-181a. [score:4]
We next assessed the functional contribution of upregulated miR-181a or silenced SIRT1 to lipid metabolism. [score:4]
To investigate whether increased miR-181a expression contributes to the development of metabolic disorders, we used miR-181a mimics to overexpress miR-181a in dairy cow hepatocytes. [score:4]
Consistent with these findings, the mRNA expression levels of the gluconeogenic genes glucose-6-phosphatase (G6Pase) and phosphoenolpyruvate carboxykinase (PEPCK) were all elevated in hepatocytes overexpressing miR-181a compared with control hepatocytes (Figure 3B). [score:4]
Collectively, these findings indicate that overexpressing miR-181a or knocking down SIRT1 in mice causes insulin resistance and impairs glucose homeostasis. [score:4]
These data demonstrated that SIRT1 was a direct target of miR-181a. [score:4]
These data strongly suggest that overexpressing miR-181a or knocking down SIRT1 increases lipid accumulation in vivo. [score:4]
Taken together, these data clearly suggest that SIRT1 is a direct target of miR-181a. [score:4]
In addition, we found that inhibiting miR-181a reversed the effects of NEFA on the lipogenic genes fatty acid synthase (FAS) and stearoyl-CoA desaturase 1 (SCD-1) and the lipolytic genes carnitine palmitoyltransferase I (CPT-I) and carnitine palmitoyltransferase II (CPT-II) (Supplementary Figure 7). [score:3]
MiR-181a plays crucial roles in tumorigenesis by targeting critical regulators of metastasis, cell cycle, and differentiation [27, 45, 46]. [score:3]
More importantly, inhibition of miR-181a significantly improved insulin sensitivity and attenuated the impairments in glucose metabolism induced by NEFA in HepG2 cells (Figure 6B–6E). [score:3]
Moreover, insulin -dependent IR, Akt and GSK3β phosphorylation was significantly increased by miR-181a inhibition under NEFA treatment conditions, this effect was reversed by SIRT1 siRNA (Figure 4I). [score:3]
Moreover, the glycogen content in hepatocytes and the glucose level in the medium were significantly higher and lower in hepatocytes co -treated with NEFA and miR-181a inhibitors than hepatocytes treated with NEFA alone, respectively (Figure 4D and 4E). [score:3]
Taken together, these results demonstrate that miR-181a overexpression impairs insulin sensitivity and glucose and lipid metabolism in the hepatocytes of dairy cows. [score:3]
Figure 2 (A) Schematic representation of the SIRT1 3’-UTR and the putative miR-181a target site. [score:3]
Collectively, these data suggest that inhibiting endogenous miR-181a improves insulin sensitivity and glucose and lipid metabolism in hepatocytes. [score:3]
Consistent with these findings, we found that NEFA -induced TG content in hepatocytes was significantly reduced by miR-181a inhibitors (Figure 4G). [score:3]
These effects were reversed in HepG2 cells transfected with miR-181a inhibitors (Figure 6A). [score:3]
MiR-181a overexpression or SIRT1 knockdown impairs glucose and lipid metabolism in vivo. [score:3]
Based on the above findings, we hypothesized that inhibiting miR-181a may improve insulin sensitivity and decrease lipid accumulation under NEFA treatment conditions in hepatocytes. [score:3]
Wild-type SIRT1 3’ -UTR reporter plasmids or mutated SIRT1 3’-UTR reporter plasmids were co -transfected with miR-181a inhibitor or the negative control. [score:3]
In contrast, miR-181a inhibition abolished NEFA -induced metabolic disorders in dairy cow hepatocytes and HepG2 cells. [score:3]
The results showed that serum and hepatic miR-181a expression levels were significantly higher in patients and dairy cows with NAFLD, as well as in high-fat diet (HFD) and ob/ob mice (Figure 1E–1J; Supplementary Figure 2A and 2B). [score:3]
MiR-181a directly targets SIRT1. [score:3]
These findings are indicative of the importance of hepatic miR-181a-SIRT1 in glucose and lipid metabolism and suggest that miR-181a-SIRT1 has promise as a novel target for the treatment of NAFLD. [score:3]
Taken together, these results demonstrate that inhibiting miR-181a is sufficient for preventing NEFA -induced abnormal lipid metabolism in hepatocytes. [score:3]
Taken together, these data indicate that miR-181a inhibitors improve glucose homeostasis in NEFA-stimulated hepatocytes. [score:3]
Moreover, due to the effects of decreased insulin sensitivity and increased gluconeogenesis, the glucose level of the medium in the miR-181a-overexpression group was significantly higher than that of the medium in the control group (Figure 3C). [score:3]
We further analyzed miR-181a expression in hepatocytes treated with different concentrations of NEFA. [score:3]
Thus, we hypothesized that alterations in miR-181a expression may affect hepatic energy metabolism. [score:3]
As expected, inhibition of miR-181a reversed the effects of NEFA on lipid metabolism in HepG2 cells (Figure 6F and 6G). [score:3]
Figure 6HepG2 cells were divided into 4 groups as follows: a control group, mimics group (HepG2 cells transfected with 10 nM mimics), NEFA group (treated with 1.2 mM NEFA), and miR-181a + NEFA group (transfected with 50 nM miR-181a inhibitors and then treated with 1.2 mM NEFA). [score:3]
Figure 4 (A, B, C, D, E, F and G) Hepatocytes were divided into 3 groups as follows: a control group (transfected with 50 nM negative control), NEFA group (treated with 1.2 mM NEFA), and miR-181a + NEFA group (transfected with 50 nM miR-181a inhibitors and then treated with 1.2 mM NEFA). [score:3]
HepG2 cells were divided into 4 groups as follows: a control group, mimics group (HepG2 cells transfected with 10 nM mimics), NEFA group (treated with 1.2 mM NEFA), and miR-181a + NEFA group (transfected with 50 nM miR-181a inhibitors and then treated with 1.2 mM NEFA). [score:3]
In addition, miR-181a acts as a potent tumor suppressor in the liver [47], the central organ involved in controlling glucose homeostasis and lipid metabolism. [score:3]
Hepatic overexpression of miR-181a or knockdown of SIRT1 both resulted in augmented random glucose levels (Supplementary Figure 9B), and the glucose-tolerance tests (GTT) and insulin-tolerance tests (ITT) results showed that glucose and insulin sensitivity were impaired in mice injected with Ago-181a or Ad-shRNA SIRT1 compared with control mice (Figure 7B and 7C). [score:3]
Based on these findings, we concluded that SIRT1 mediates the regulatory function of miR-181a in glucose and lipid metabolism. [score:2]
MiR-181a expression in the liver of Ago-181a -treated mice was 32-fold higher than that in the livers of control mice (Supplementary Figure 9A). [score:2]
Conversely, SREBP-1c protein expression levels were increased in hepatocytes transfected with miR-181a mimics compared with control hepatocytes (Figure 3D). [score:2]
Furthermore, miR-181a expression levels were increased and SIRT1-PGC-1α pathway activity was decreased in the liver of dairy cows and patients with NAFLD, as well as in HFD mice and ob/ob mice and hepatocytes treated with NEFA, compared with the corresponding controls. [score:2]
Consequently, hepatocyte TG content was significantly decreased in the miR-181a inhibitor -treated hepatocyte group compared with the control group (Figure 3J). [score:2]
As expected, the miR-181a inhibitors markedly increased insulin -induced IR, Akt and GSK3β phosphorylation in the indicated group of hepatocytes compared with the group of hepatocytes treated with NEFA alone (Figure 4B). [score:2]
In our study, we were surprised to find that miR-181a expression levels were significantly increased in the liver and blood of patients and dairy cows with NAFLD, as well as in HFD and ob/ob mice and hepatocytes treated with NEFA, compared with the corresponding controls. [score:2]
The proposed mo del for the metabolic regulation of miR-181a-SIRT1. [score:2]
More importantly, overexpressing miR-181a in mouse livers reduced glucose and insulin sensitivity and hepatic glycogen content and increased hepatic lipid accumulation in treated livers compared with control livers. [score:2]
Based on these data, we propose that miR-181a may be involved in regulating hepatic glucose and lipid metabolism. [score:2]
MiR-181a expression is increased in patients, mice and cows with NAFLD. [score:2]
In addition, AKT phosphorylation levels and glycogen content were significantly decreased in HepG2 cells transfected with miR-181a mimics or treated with NEFA compared with control cells (Figure 6B and 6D), and the medium glucose concentration and G6Pase and PEPCK mRNA expression levels were significantly higher in HepG2 cells transfected with miR-181a mimics or treated with NEFA than in control cells (Figure 6C and 6E). [score:2]
Taken together, our data showed that miR-181a is a negative regulator of hepatic glucose and lipid metabolism. [score:2]
The results showed that NEFA dose -dependently elevated miR-181a expression in treated hepatocytes compared with control hepatocytes (Figure 1K). [score:2]
Subsequently, we transfected dairy cow hepatocytes with miR-181a mimics. [score:1]
The mutant form, with a mutated putative miR-181a binding site was also cloned in the same manner. [score:1]
We next determined the effects of the miR-181a mimics on lipid metabolism in hepatocytes. [score:1]
Wild-type SIRT1 3’ -UTR reporter plasmids or mutated SIRT1 3’-UTR reporter plasmids were co -transfected with miR-181a mimic or the negative control. [score:1]
Furthermore, we also evaluated lipid metabolism in hepatocytes co -treated with NEFA and miR-181a inhibitors. [score:1]
We also measured glycogen content in the livers of mice in which miR-181a was overexpressed or SIRT1 was silenced. [score:1]
The above observations prompted us to evaluate the effects of inhibiting endogenous miR-181a on hepatocyte glucose and lipid metabolism. [score:1]
First, we assessed the effects of miR-181a on insulin signaling in hepatocytes stimulated with insulin. [score:1]
However, the biological function of miR-181a in NAFLD has not been reported in the literature. [score:1]
These data indicate that insulin sensitivity and glucose metabolism are impaired by NEFA or miR-181a mimics in HepG2 cells. [score:1]
We next measured miR-181a expression in the sera and livers of patients and dairy cows with NAFLD. [score:1]
Despite the significance of miR-181a in cancer, its function in metabolism and metabolic disease is poorly characterized. [score:1]
uk/) showed that four miR-181s, namely, miR-181a, miR-181b, miR-181c, and miR-181d, have been identified previously. [score:1]
[1 to 20 of 104 sentences]
2
[+] score: 315
This effect is supported by our findings: activin A down-regulated miR-181a expression in mGC; overexpression of miR-181a suppressed mGC proliferation; miR-181a inhibitor promoted mGC proliferation; miR-181a bound to the 3′-UTR of acvr2a resulting in reduced expression of acvr2a in mGC; overexpression of acvr2a blocked miR-181a’s inhibitory effect on mGC proliferation. [score:18]
In the present study, we demonstrated that miR-181a suppressed mouse granulosa cell (mGC) proliferation by targeting activin receptor IIA (acvr2a), while overexpression of acvr2a blocked miR-181a’s inhibitory effect on mGC proliferation, indicating that miR-181a may play an important role in ovarian follicle development. [score:10]
0059667.g004 Figure 4 mGC was transfected with indicated miR-181a inhibitor (anti-sense oligonucleotide of miR-181a) or miRNA inhibitor negative control (miRNA inhibitor control) for 48 h. (A) MiR-181a expression was measured by qRT-PCR. [score:7]
Our study showed that miR-181a suppressed acvr2a expression by targeting its 3′-UTR (Fig. 3). [score:7]
Taken together, these results demonstrate that miR-181a inhibits the proliferation of granulosa cells through suppressing the expression levels of cyclin D2 and PCNA. [score:7]
Consistent with the inhibition of Smad2 phosphorylation by miR-181a, the promoting effect of activin A on mGC proliferation was inhibited by miR-181a overexpression (Fig. 5E). [score:7]
mGC was transfected with indicated miR-181a inhibitor (anti-sense oligonucleotide of miR-181a) or miRNA inhibitor negative control (miRNA inhibitor control) for 48 h. (A) MiR-181a expression was measured by qRT-PCR. [score:7]
qRT-PCR analysis revealed that miR-181a expression was reduced (Fig. 4A), CCK-8 assay showed that the proliferation of mGC was enhanced (Fig. 4B), and qRT-PCR and Western blot results displayed that cyclin D2 expression was up-regulated (Fig. 4C and 4D). [score:7]
Furthermore, we observed that activin A -induced cyclin D2 expression in mGC was significantly suppressed by the overexpression of miR-181a (Fig. 5F and 5G). [score:7]
Since the results in the present study indicate that miR-181a plays an important role in granulosa cell proliferation and ovarian follicle development, we speculated whether patients with ovarian dysfunction and reproductive diseases had abnormal expression of miR-181a. [score:6]
Our results showed that miR-181a inhibited the phosphorylation of Smad2 on Ser [465/467] (Fig. 5) and that miR-181a decreased the expression of cyclin D2 and PCNA in mGC, leading to an attenuation of cell proliferation (Fig. 2). [score:5]
This indicates that through binding to the 3′-UTR of acvr2a, miR-181a has more powerful influences on acvr2a translation inhibition than mRNA degradation in mGC. [score:5]
Thus, all these data suggest that miR-181a inhibits mGC proliferation by targeting acvr2a. [score:5]
These results suggest that miR-181a may inhibit the proliferation of granulosa cells and the development of follicles in vivo, and we will do further study to identify this regulation effect in the future. [score:5]
Moreover, we found that the proliferation of KGN cells, a human ovarian granulosa-like tumour cell line, was suppressed after overexpression of miR-181a (Fig. S1A), with a concomitant reduction of PCNA protein level (Fig. S1B). [score:5]
Inhibition of mGC Proliferation and Relevant Gene Expression in mGC by miR-181a. [score:5]
Our study indicates that adenovirus mediated miR-181a overexpression inhibited mGC proliferation. [score:5]
These data support that miR-181a inhibits mGC proliferation by targeting acvr2a. [score:5]
Inhibition of proliferation of and relevant gene expression in mouse granulosa cells (mGC) by miR-181a. [score:5]
MiR-181a mimics, synthesized oligonucleotides, were also found to suppress mGC proliferation (unpublished data), suggesting that inhibition of mGC proliferation should be closely associated with miR-181a, rather than the toxic effect of Ad-miR-181a. [score:5]
Thus activin A inhibited miR-181a expression in mGC in a dose- and time -dependent manner. [score:5]
Given that miR-181a expression was reduced in mGC treated with activin A, and miR-181a negatively influenced mGC proliferation (Fig. 2), we hypothesized that the target gene of miR-181a may be a component of the activin signaling pathway. [score:5]
Particularly, increased expression of acvr2a in mGC reversed the inhibitory effect of miR-181a on mGC proliferation (Fig. 3F). [score:5]
Furthermore, compared with that in primary follicles, miR-181a expression was reduced in preantral follicles, where granulosa cell proliferation was activated, whereas acvr2a expression was abundant in them (Fig. 7C and 7D). [score:4]
qRT-PCR results showed that, compared with the expression in primary follicles, miR-181a expression in preantral and antral follicles was decreased (Fig. 7C), while acvr2a levels were increased (Fig. 7D). [score:4]
Variation of miR-181a and acvr2a Expression in Development of Ovaries and during Ovarian Follicle Maturation in Neonatal Mice. [score:4]
The negative regulation of acvr2a expression suggests that miR-181a may play an important role in the activin signaling pathway. [score:4]
In conclusion, the present study has demonstrated that miR-181a inactivates activin -induced granulosa cell proliferation by down -regulating the expression of acvr2a. [score:4]
To clarify whether the miRNA-target relationship between miR-181a and acvr2a also exists in KGN cells, we performed luciferase assay, qRT-PCR, and Western blotting, and found that miR-181a also targets ACVR2A in KGN cells (Fig. S3). [score:4]
Variation of miR-181a and acvr2a expression in development of ovaries and during ovarian follicle maturation. [score:4]
Consistent with this hypothesis, CYP19A1, which encodes the key enzyme for estrogen biosynthesis, was found to be down-regulated by miR-181a in mGC (Fig. 6A). [score:4]
Compared to that in control group, overexpression of miR-181a in transfected mGC significantly decreased the luciferase activity (Fig. 3B), indicating that acvr2a is a target gene of miR-181a. [score:4]
Here, to investigate the role of activin A in regulating miR-181a expression in mGC, we examined miR-181a expression in mGC after activin A treatment at various concentrations (10, 25, 50, 100, and 200 ng/ml) for 24 h. As shown in Fig. 1A, in the presence of activin A, the ratio of miR-181a to U6 was reduced; as the concentration of activin A was increasing, the reduction was more remarkable. [score:4]
qRT-PCR analysis revealed that, compared with that at day 3, the expression of miR-181a was decreased at day 8, 12, and 21 respectively (Fig. 7A), whereas acvr2a expression was increased (Fig. 7B). [score:4]
For each transfection, 50 or 100 nM of miR-181a inhibitor or siRNA was added to each well on the six-well plate according to the protocol of the manufacturer. [score:3]
Preconfluent (60 to 70%) HEK293T cells in 60-mm dish was transfected with 1 µg of the GFP expression plasmid (pEGFP-C1 m acvr2a 3′-UTR) and Ad-miR-181a construct using Nanofectin. [score:3]
Figure S4 Inhibition of the phosphorylation of Smad2 in KGN cells by miR-181a. [score:3]
The results of quantitative real-time PCR (qRT-PCR) analysis showed that cyclin D2 mRNA level was decreased in mGC infected with Ad-miR-181a (Fig. 2C), and Western blot results revealed that cyclin D2 and PCNA protein levels were also reduced in mGC with miR-181a overexpression in a dose -dependent manner (Fig. 2D and 2E). [score:3]
The examination of phosphorylated Smad2 level in both mGC and KGN cells infected with Ad-miR-181a revealed that miR-181a suppressed Smad2 phosphorylation in both cell types (Fig. 5B and Fig. S4). [score:3]
Granulosa cells were seeded into 96-well plates at approximately 5,000 cells per well, cultured in growth medium (100 µl per well) and infected with adenovirus or miR-181a inhibitor. [score:3]
Identification of acvr2a as a target gene of miR-181a in mouse granulosa cells (mGC). [score:3]
Lingenfelter et al. also reported that miR-181a may have an important role in oocytes by targeting nucleoplasmin 2 [45]. [score:3]
Expression of miR-181a (A) and acvr2a (B) assessed by qRT-PCR in day 3, 8, 12, and 21 mouse ovaries. [score:3]
In the present study, we found that miR-181a expression was markedly reduced in 8, 12, and 21-day-old mouse ovaries, in which granulosa cell proliferation is initiated and activated, while acvr2a level was increasing (Fig. 7A and 7B). [score:3]
Effect of activin A on miR-181a expression and mouse granulosa cell (mGC) proliferation. [score:3]
Recently, we found that miR-181a expression was much higher in the blood of POF patients by microarray study (unpublished data). [score:3]
Effect of Activin A on miR-181a Expression in mGC and on mGC Proliferation. [score:3]
Our results showed that the mRNA of CYP19A1, P450scc, and ESR1 in mGC was modestly enhanced by activin A, and simultaneous expression of miR-181a reversed this enhancement (Fig. 6A, 6B, and 6C). [score:3]
Recently, Sirotkin et al. reported that miR-181a reduced proliferating cell nuclear antigen (PCNA) expression in human granulosa cells [29]. [score:3]
Here we investigated the suppressive effect of miR-181a on activin A -induced gene expression. [score:3]
Identification of acvr2a as a Target Gene of miR-181a. [score:3]
To identify whether mouse acvr2a was involved in miR-181a’s inhibitory function in mGC, we infected mGC with Ad-miR-181a and/or Ad-flag-m acvr2a. [score:3]
0059667.g007 Figure 7 Expression of miR-181a (A) and acvr2a (B) assessed by qRT-PCR in day 3, 8, 12, and 21 mouse ovaries. [score:3]
Effect of miR-181a Inhibitor on mGC Proliferation. [score:3]
The adenovirus bearing LacZ (Ad-LacZ) was obtained from Clontech (Palo Alto, CA, USA) and used as the control in the miR-181a overexpression experiments [52], [53]. [score:3]
Effect of miR-181a inhibitor on mouse granulosa cell (mGC) proliferation. [score:3]
Herein, we identified that miR-181a suppresses mGC proliferation through binding to the 3′-UTR of acvr2a. [score:3]
In the present study, we demonstrated that miR-181a exerted a suppressive effect on mGC proliferation. [score:3]
Figure S3 Identification of ACVR2A as a target gene of miR-181a in KGN cells. [score:3]
Following co-transfection of HEK293T cells with this plasmid and the plasmid containing miR-181a, fluorescence microscopy and Western blotting displayed that GFP expression was decreased (Fig. 3C). [score:3]
To detect miR-181a expression, cDNA was synthesized using the following miR-181a-specific stem-loop primer: 5′-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAG ACTCACCG-3′ as previously described [55]. [score:2]
Next, we tested whether miR-181a could regulate the proliferation of mGC. [score:2]
These results further support miR-181a as a critical regulator in the proliferation of granulosa cells. [score:2]
The relationship between miR-181a and acvr2a in mGC proliferation helps us understand the mechanisms of follicle development at a post-transcriptional level, which may be involved in the pathology of POF. [score:2]
Regulation of Activin -induced Genes by miR-181a. [score:2]
MiR-181a inhibitor. [score:2]
MiR-181a has been found to be abundant and play a bifunctional role in primordial germ cells: inhibiting their somatic differentiation and preventing them from entering meiosis [44]. [score:2]
To further investigate the relationship between miR-181a and acvr2a during ovarian development, we examined their expression profiles in mouse ovaries and follicles. [score:2]
This indicates that miR-181a plays a potential role in regulating the steroidogenesis of granulosa cells. [score:2]
Regulation of activin -induced genes by miR-181a. [score:2]
We also infected mGC with Ad-miR-181a before activin A stimulation. [score:1]
Preconfluent (60 to 70%) mGC in six-well plates was infected with Ad-miR-181a and then transfected with 300 ng of the firefly luciferase reporter plasmid (Luc-acvr2a-3′-UTR) and 20 ng of the Renilla luciferase reporter plasmid, pRL-RSV (Promega), using Lipofectamine 2000 transfection reagent. [score:1]
The findings imply that miR-181a may be involved in the pathogenesis of POF. [score:1]
As shown in Fig. 5C, the effect of activin A on Smad2 phosphorylation was apparently attenuated by miR-181a, but the protein levels of Smad2 was not affected by miR-181a or activin A (Fig. 5C). [score:1]
qRT-PCR analysis of miR-181a in the blood of POF patients (n = 8) and of normal females (n = 11). [score:1]
qRT-PCR analysis of miR-181a (C) and acvr2a (D) in primary (pri), preantral (pre), and antral follicles of 21-day-old mouse ovaries. [score:1]
qRT-PCR analysis showed that miR-181a levels were significantly enhanced in POF patients (Fig. 8). [score:1]
Increased miR-181a Levels in the Blood of Premature Ovarian Failure Patients. [score:1]
Since activins function by binding to ACVR2A or ACVR2B, and activating intracellular Smads via phosphorylation [15], we tested whether this function could be attenuated by miR-181a. [score:1]
To verify above results from a different standpoint, we transfected mGC with a synthesized anti-sense oligonucleotide of miR-181a. [score:1]
0059667.g008 Figure 8 qRT-PCR analysis of miR-181a in the blood of POF patients (n = 8) and of normal females (n = 11). [score:1]
Using qRT-PCR, we verified the increased level of miR-181a in the blood of POF patients (Fig. 8). [score:1]
Similarly, the ratio of miR-181a to U6 in mGC was decreased more significantly when mGC was cultured for longer time (Fig. 1B). [score:1]
We examined miR-181a levels in the blood of normal females (n = 11) and patients (n = 8) with premature ovarian failure (POF) in whom FSH levels were elevated (Table S1). [score:1]
Furthermore, qRT-PCR and Western blot results showed that acvr2a mRNA and protein levels were decreased in mGC infected with Ad-miR-181a (Fig. 3D and 3E). [score:1]
Figure S1 Effect of miR-181a on KGN cell proliferation. [score:1]
Inactivation of the Activin Signaling Pathway by miR-181a. [score:1]
We focused on acvr2a, one of the consistently predicted genes that contain the seed sequence of miR-181a (http://www. [score:1]
Inactivation of the activin signaling pathway by miR-181a. [score:1]
Adenoviruses harboring a 456-bp DNA fragment encompassing the hsa-miR-181a gene (Ad-miR-181a) and Flag-tagged mouse acvr2a (Ad-flag-m acvr2a) were generated using the AdMax (Microbix Biosystems, Inc. [score:1]
The miR-181a and acvr2a levels in ovaries from mice at various ages (day 3, 8, 12, and 21) were assessed. [score:1]
0059667.g003 Figure 3(A) Putative binding sites for human (hsa) miR-181a and mouse (mmu) miR-181a in the 3′-UTR of the acvr2a gene. [score:1]
In addition, the level of miR-181a was also lower in antral follicles, which contain differentiated, steroidogenic granulosa cells. [score:1]
Interestingly, the protein level of acvr2a in mGC was dramatically decreased by miR-181a, whereas the mRNA level was only slightly reduced. [score:1]
After mGC was infected with adenovirus containing miR-181a (Ad-miR-181a), mature miR-181a in the cells was increased (Fig. 2A). [score:1]
[1 to 20 of 95 sentences]
3
[+] score: 304
Delivery of synthetic miR-181a mimic by transferrin (Tf)-conjugated nanoparticles (NP) enhanced miR-181a levels and inhibited RAS -dependent signaling pathways in AMLBecause higher miR-181a levels are associated with improved outcomes in AML [2, 9, 26– 28], and because miR-181a downregulation contributed to leukemia growth (Figure 1) and directly targeted KRAS, NRAS and MAPK1, we reasoned that increasing miR-181a may have therapeutic value in AML. [score:9]
Figure 3Treatment with Tf-NP- miR-181a increased mature miR-181a levels; downregulated KRAS, NRAS, and MAPK1; and inhibited the RAS-MAPK1 signaling pathwayMature miR-181a, miR-181b and miR-140 expression levels in KG1a, OCI-AML3 and MV4-11 cells (A) and primary patient blasts (n = 3) (C). [score:8]
Because higher miR-181a levels are associated with improved outcomes in AML [2, 9, 26– 28], and because miR-181a downregulation contributed to leukemia growth (Figure 1) and directly targeted KRAS, NRAS and MAPK1, we reasoned that increasing miR-181a may have therapeutic value in AML. [score:7]
Next, to demonstrate that NRAS is also a direct miR-181a target, we cloned the predicted miR-181a -binding-site in the NRAS 3′-UTR into a luciferase reporter, and we observed a 26 ± 6% (P < 0.0001) downregulation of luciferase activity. [score:7]
Treatment with Tf-NP- miR-181a increased mature miR-181a levels; downregulated KRAS, NRAS, and MAPK1; and inhibited the RAS-MAPK1 signaling pathway. [score:6]
These findings led us to postulate a tumor suppressor activity of miR-181a that we first tested by overexpressing or knocking-down miR-181a in the FLT3-ITD positive MV4-11 AML cell line by lentiviral infection (Figure 1A). [score:6]
Figure 2NRAS, KRAS and MAPK1 are direct targets of miR-181a(A) KRAS, NRAS and MAPK1 protein expression in infected MV4-11 and OCI-AML3 cells with lenti-181a, lenti-sc or lenti-anti-181a. [score:6]
With regard to AML, we previously provided preliminary evidence that miR-181 may target elements of the “inflammasome” that ultimately lead to NF-κB activation and leukemia growth, while Li et al. showed that miR-181 promoted apoptosis, reduced viability and delayed leukemogenesis in MLL-rearranged AML by downregulating the homeobox gene PBX3 [28]. [score:6]
In summary, we showed the effective delivery of miR-181a via Tf-conjugated nanoparticles and in turn downregulation of KRAS, NRAS and MAPK1 and inhibition of the RAS-MAPK1 and RAS-AKT-kinase signaling cascade. [score:6]
In these brain tumors miR-181a was shown to target the anti-apoptotic genes BCL2 and MCL1, and downregulated miR-181a reduced glucose deprivation -induced apoptosis and caused mitochondrial dysfunction in astrocytes [22, 49, 50]. [score:6]
We identified two miR-181a -binding sites in the KRAS 3′-UTR and observed a 28 ± 4% (P = 0.003) and a 25 ± 1% (P = 0.007) downregulation of luciferase activity on site 1 and site 2 after co-transfecting 293T cells with miR-181a compared with scramble expressing controls. [score:5]
Overexpression of miR-181a (lenti- 181a) inhibited cell growth (Figure 1B; lenti- 181a vs. [score:5]
In summary, we unveil here a previously unreported activity of miR-181a that directly downregulates NRAS, KRAS and MAPK1 and RAS -dependent downstream signals supporting leukemogenesis. [score:5]
However, mutations on both sites of MAPK1 could completely rescue the miR-181a -induced downregulation (Figure 2D). [score:5]
The reduced proliferation induced by Tf-NP- miR-181a treatment was reversed by lentiviral expression of KRAS, NRAS and MAPK1 in OCI-AML3 cells (Supplementary Figure S5A–S5C; Supplementary Table S3) attenuating the anti-leukemic activity of Tf-NP- miR-181a and thereby supporting the relevance of these targets to leukemogenesis. [score:5]
However, in glioma high expression of miR-181 seems to have tumor suppressor activity [22]. [score:5]
Mutations in the seed sequences of the KRAS 3′-UTRs rescued the miR-181a -induced downregulation (Figure 2B). [score:5]
However, the mechanisms through which miR-181a attenuates disease aggressiveness and the full spectrum of its targets still remain to be fully understood in AML. [score:5]
An introduced mutation in the seed sequence rescued the miR-181a -induced downregulation (Figure 2C). [score:5]
KRAS, NRAS and MAPK1 are direct targets of miR-181a. [score:4]
NRAS, KRAS and MAPK1 are direct targets of miR-181a. [score:4]
miR181a overexpression by a lenti- 181a vector reduced KRAS, NRAS, and MAPK1 protein levels 5.2, 2.1, and 6.5-fold, respectively, compared to scramble expressing controls in MV4-11 cells (Figure 2A). [score:4]
We previously reported that chemotherapy -treated patients with AML with higher miR-181a expression achieved complete remission (CR) more frequently and had longer survival compared to lower miR-181a expressing patients [2, 9]. [score:4]
When we mutated the two sites separately, we observed a 13 ± 3% (site 1; P = 0.004) and a 15 ± 3% (site 2; P = 0.006) miR-181a- induced downregulation of the luciferase activity. [score:4]
In these cells, RAS and MAPK1 proteins were downregulated in the Tf-NP- miR-181a treated mice (Figure 5D and 5F). [score:4]
Recently, KRAS was shown to be a direct miR-181a target in oral squamous cell carcinoma [44]. [score:4]
Anti-leukemic activity of miR-181aWe previously reported that chemotherapy -treated patients with AML with higher miR-181a expression achieved complete remission (CR) more frequently and had longer survival compared to lower miR-181a expressing patients [2, 9]. [score:4]
Collectively, these results support that KRAS, NRAS and MAPK1 are direct miR-181a targets. [score:4]
We first validated KRAS as a direct miR-181a target. [score:4]
Next we showed that the modulation of KRAS, NRAS and MAPK1 expression by miR-181a was caused by direct binding to the respective 3′-UTRs. [score:4]
KRAS has been shown to be a direct miR-181a target in oral squamous cell carcinoma [44]. [score:4]
Consistent with these results, anti- miR-181a treatment resulted in upregulation of the KRAS, NRAS and MAPK1 proteins in HL60 cells that present with higher levels of endogenous miR-181a (Supplementary Figures S2A and S3). [score:4]
First, we found that the delivered synthetic miR-181a was functional, as it downregulated KRAS, NRAS and MAPK1 proteins (KG1a: 4.3, 4.4 and 5.5-fold; OCI-AML3: 3.2, 3.9 and 2.2-fold; MV4-11: 1.5, 4.4 and 4.6-fold, respectively) compared to Tf-NP-sc treatment (Figure 3B). [score:3]
In line with these clinical observations, we and others showed that miR-181a expression is associated with a higher sensitivity to cytarabine in AML cell lines [45, 46]. [score:3]
NRAS, KRAS, p-MEK, MEK, p-AKT, AKT, MAPK1, and MYC expression in KG1a, OCI-AML3 and MV4-11 cells (B) and primary patient blasts (n = 3) (D) treated with mock, Tf-NP-sc and Tf-NP- miR-181a. [score:3]
In hematologic malignancies higher expression of miR-181 is associated with better outcomes [2, 9, 26– 28]. [score:3]
We then tested whether miR-181a was able to reduce the expression of these genes in AML cells. [score:3]
Figure 1Higher levels of miR-181a are associated with a less aggressive phenotype in AML cells and longer survival in a murine AML mo del(A) miR-181a expression in MV4-11 cells after lentiviral infection. [score:3]
We hypothesized that higher miR-181a levels attenuate AML aggressiveness by targeting RAS and/or its downstream effectors in myeloid blasts, thereby reducing proliferation and decreasing the apoptotic threshold. [score:3]
org) we first identified putative miR-181a -binding sites in the 3′-untranslated regions (3′-UTRs) of KRAS, NRAS and MAPK1. [score:3]
Altogether, our results support miR-181a replacement as a potential anti-leukemic, RAS targeting strategy in AML. [score:3]
High expression of miR-181 has been associated with poor clinical outcomes in patients with colorectal cancer [20] and lymph node metastasis in oral squamous cell carcinoma [21]. [score:3]
To date, however the molecular basis for the attenuation of disease aggressiveness by miR-181a remains to be fully elucidated. [score:3]
In other types of cancers miR-181a has been associated with both tumor suppressor and oncogene functions [20– 28], implying context-specific effects. [score:3]
Here, we first tested whether KRAS and other genes involved in these pathways, including NRAS and its downstream effectors (i. e., MAPK1), were miR-181a targets in AML. [score:3]
lenti-sc: P = 0.009), whereas downregulation of miR-181a (lenti- anti-181a) enhanced cell proliferation compared to cells transfected with a vector carrying a scramble sequence (lenti-sc) (Figure 1B; lenti-sc vs. [score:3]
Relatively low expression of miR-181a is associated with worse outcomes in AML patients [2, 9, 28]. [score:3]
To validate the RAS-MAPK1 and RAS-AKT-kinase-pathways as relevant anti-leukemic miR-181a targets, we treated KG1a and MV4-11 cells with Tf-NP loaded with siRNAs for KRAS, NRAS and MAPK1 (Supplementary Figure S4A). [score:3]
miR-181a, miR-181b and miR-140 expression were normalized to U44. [score:3]
Indeed, we recently reported the favorable impact of higher miR-181a expression in both AML cytogenetically normal (CN) or abnormal (CA) patients [2, 9, 28]. [score:3]
In a previous study, we demonstrated that lenalidomide increases endogenous miR-181a [45], by enhancing the expression of C/EBPα isoforms, which bind to the miR-181a promoter and induce the transcription of miR-181a. [score:3]
To further support the putative tumor suppressor activity of miR-181a, we engrafted NSG mice with virally transduced MV4-11 cells through a tail vein. [score:3]
Here, we first demonstrated that miR-181a targets the RAS-MAPK1 and RAS-AKT pathways, which have been found to be activated and support AML leukemogenesis [54– 58]. [score:3]
Mature miR-181a, miR-181b and miR-140 expression levels in KG1a, OCI-AML3 and MV4-11 cells (A) and primary patient blasts (n = 3) (C). [score:3]
We observed a 33 ± 2% (P = 0.0002) downregulation of luciferase activity with miR-181a treatment compared to cells with scramble control treatment. [score:3]
Additionally, NRAS and the RAS-downstream effector MAPK1 are in silico predicted to be putative miR-181a targets. [score:3]
The efficient delivery of miR-181a mimics by Tf-NPs decreased the targets and their downstream effectors (AKT, MEK, MYC). [score:3]
Delivery of synthetic miR-181a mimic by transferrin (Tf)-conjugated nanoparticles (NP) enhanced miR-181a levels and inhibited RAS -dependent signaling pathways in AML. [score:3]
We concluded that higher miR-181a expression leads to a less aggressive AML phenotype, thereby functionally validating the previously reported prognostic results [2, 9, 28]. [score:3]
Here we show that this system could be adapted to the delivery of miR-181a mimics and exert an efficient inhibitory effect on the RAS-MAPK1 and RAS-AKT kinase pathways, thereby resulting in a significant anti-leukemic activity. [score:3]
Whereas in colorectal cancer [20] and lymph node metastasis in oral squamous cell carcinoma [21] a high miR-181 level seems to be associated with worse clinical outcomes, in glioma this miR has tumor suppressor function [22]. [score:3]
The miR-181 family comprises four mature miRs (miR-181a, miR-181b, miR-181c, miR-181d) and has been associated with the regulation of inflammatory mechanisms [17, 18]. [score:2]
Tf-NP- miR-181a treatment significantly reduced the disease burden and prolonged survival compared to Tf-NP-sc (P = 0.0002) or saline (P = 0.0001) treatment (Figure 5G). [score:2]
Anti-leukemic activity of miR-181a. [score:1]
scramble - > 0.01 μM DNR: 22.88 ± 4.61% annexinV+, P = 0.001) and OCI-AML3 (miR-181a - > 0.04 μM DNR: 70.92 ± 5.01% vs. [score:1]
It should also be underscored that we and others have reported that increased levels of miR-181 lead to enhancement of sensitivity to chemotherapy in AML mo dels [45, 46, 63]. [score:1]
Next, we examined the anti-leukemic activity of Tf-NP- miR-181a in vivo. [score:1]
Increased levels of miR-181a resulted in decreased protein levels of KRAS, NRAS and MAPK1 by 6.3, 6.8 and 5.6-fold in patient 1; 6.4, 1.6 and 19.7-fold in patient 2; and 2.3, 2.4 and 3.4-fold in patient 3, respectively (Figure 3D). [score:1]
In contrast, cytospins of bone marrow cells and histopathology of sternum, spleen and liver from Tf-NP- miR-181a treated leukemic mice were similar to that of the age-matched blank control groups (Figure 5B). [score:1]
Higher levels of miR-181a are associated with a less aggressive phenotype in AML cells and longer survival in a murine AML mo del. [score:1]
Thus, we envision that potential clinical benefit of miR-181a replacement will be more likely if applied in combination with chemotherapy. [score:1]
In addition, after 24 hours of priming cells with miR-181a, daunorubicin (DNR) was added to treat the cells for another 72 hours. [score:1]
Tf-NP- miR-181a treatment in AML cells. [score:1]
The miRZip anti- miR-181a (lenti-anti-181a) and scramble vectors were purchased from System Biosciences. [score:1]
Our results show that KRAS, NRAS and MAPK1 proteins may be effectively reduced by utilizing RNA compounds mimicking miR-181a. [score:1]
We showed that a nanoparticle -based delivery system could be used to efficiently increase otherwise low levels of miR-181a and achieve anti-leukemic activity in AML mo dels with no evident toxicity. [score:1]
Here, we provided evidence that AML cells with reduced levels of miR-181a had a more aggressive AML phenotype, and we validated this clinical observation functionally. [score:1]
Other strategies to increase miR-181a have also been tested by our group with significant results. [score:1]
We also identified two putative miR-181a binding sites in the MAPK1 3′-UTR. [score:1]
Systemic delivery of Tf-NP-miR-181a in an AML mouse mo del. [score:1]
Consistent with these results, knock-down of miR-181a by a lenti- anti-181a increased KRAS, NRAS and MAPK1 1.5, 1.5 and 1.8-fold compared to scramble controls (Figure 2A). [score:1]
293T cells were co -transfected with luciferase vector (pGL4.24), Renilla control vector and miR-181a mimic or scramble control. [score:1]
After 24 hours exposure, mature miR-181a levels increased 211 ± 31, 880 ± 10 and 142 ± 10-fold in KG1a, OCI-AML3 and MV4-11 cells, respectively, whereas levels of miR-181b and unrelated miR-140 remained unchanged (Figure 3A). [score:1]
Treatment with Tf-NP- miR-181a had anti-leukemic activity in AML cells. [score:1]
The synthetic double-stranded miR-181a, miR-scramble (sc), and KRAS, NRAS and MAPK1 siRNAs were purchased from Ambion. [score:1]
Randomly, three mice from each group (i. e. saline, Tf-NP-sc or Tf-NP- miR-181a treated group) were sacrificed after eight treatment doses. [score:1]
KG1a, OCI-AML3 and MV4-11 cells (1 × 10 [5]/mL) were plated in 12-well plates and treated with nanoparticles (Tf-NP-sc or Tf-NP- miR-181a at a final concentration of 10 nM) or were mock treated (buffer only). [score:1]
Mice were treated with saline, Tf-NP-sc or Tf-NP- miR-181a (1.5 mg/kg/d three times/week). [score:1]
Saline (control), Tf-NP-sc or Tf-NP- miR-181a were administrated (1.5 mg/kg/d miR three times/week) through a tail vein 10 days after the engraftment of MV4-11 cells in NSG mice (each group n = 11). [score:1]
Bai et al. also demonstrated that miR-181a may reduce BCL2 and thus enhance chemosensitivity of AML cells [46]. [score:1]
Cell growth curve (A) and colony numbers (B) of KG1a, OCI-AML3 and MV4-11 cells treated with Tf-NP- miR-181a, Tf-NP-sc or mock. [score:1]
cDNA was synthesized using Superscript III (Invitrogen) or the Taqman miR Reverse Transcription kit (Applied Biosystems, Foster City, CA) for miR-181a, miR-181b, miR-140 and U44. [score:1]
Tf-NP-sc; P = 0.03) in the saline, Tf-NP-sc and Tf-NP- miR-181a groups, respectively (Figure 5A). [score:1]
The miR-181 -family has been reported to be an effector in inflammatory response by TNF-α, IL-6, IL-1β, IL-8 and IL-10 [17, 18, 51– 53]. [score:1]
Therefore, we reasoned that the delivery of synthetic miR-181a mimics may increase the low endogenous levels of miR-181a in AML blasts and lead to anti-leukemic activity. [score:1]
The median survival time of the remaining mice was 26, 28.5 and 35 days for the animal groups treated with saline, Tf-NP-sc and Tf-NP- miR-181a, respectively. [score:1]
We chose KG1a, MV4-11 and OCI-AML cells as mo dels because of the relatively low miR-181a levels and activated RAS pathways (Supplementary Figure S2). [score:1]
The median survival for the animals engrafted with the lenti- miR-181a, lenti-sc and lenti- anti-181a transduced cells were 43, 33.5 and 28.5 days, respectively (Figure 1D). [score:1]
MV4-11 and OCI-AML3 cells and four AML patient blast samples cells were treated with Tf-NP- miR-181a, siRNAs, Tf-NP-sc and mock for 24 hours. [score:1]
Here, we used a similar approach to deliver synthetic miR-181a mimics. [score:1]
Physiologically, miR-181 may accelerate the megakaryocyte differentiation of CD34 -positive hematopoietic cells [19]. [score:1]
To validate these results, we treated primary AML blasts having activated RAS from three AML patients (Patient No 1-3; Supplementary Table S2) (Supplementary Figure S2) with Tf-NP- miR-181a and again observed an increase in miR-181a (Figure 3C). [score:1]
However, lenalidomide has several unwanted side-effects at the doses necessary to achieve plasma concentrations at which miR-181a was increased. [score:1]
Having shown that the Tf-NP- delivery-system was able to deliver miR-181a to AML blasts, we next tested the impact of Tf-NP- miR-181a on RAS activity. [score:1]
The data are shown as relative luciferase activity of miR-181a mimic transfected cells with respect to the scramble control of nine data points from three independent transfections. [score:1]
In solid tumors the role of miR-181 seems to be organ-specific. [score:1]
We also observed a more than 50% reduction of colony formation following Tf-NP- miR-181a treatment after 2 weeks (Figure 4B). [score:1]
In contrast, we could not identify putative miR-181a binding sites in the 3′-UTR of HRAS, which is rarely mutated in AML. [score:1]
Figure 4Treatment with Tf-NP- miR-181a had anti-leukemic activity in AML cellsCell growth curve (A) and colony numbers (B) of KG1a, OCI-AML3 and MV4-11 cells treated with Tf-NP- miR-181a, Tf-NP-sc or mock. [score:1]
The stemloop of miR-181a with 200 bp flanking sequence was cloned into the HIV based lentiviral dual promoter vector (pCDH-CMV-MCS-EF1-copGFP+Puro cDNA; System Biosciences, Mountain View, CA). [score:1]
Treatment with Tf-NP- miR-181a induced apoptosis in both MV4-11 (28.69 ± 5.88% vs. [score:1]
We observed that miR-181a treatment enhanced the apoptotic effect of DNR in MV4-11 (miR-181a - > 0.01 μM DNR: 45.27 ± 5.99% vs. [score:1]
[1 to 20 of 112 sentences]
4
[+] score: 301
Altogether, results of our expression analyses in CNS tissue, miRNA overexpression studies in macrophages and lymphocytes and mRNA target identification and expression analyses suggest that miR-181a and -b modulate immune responses through their anti-inflammatory effects on T cell differentiation and also macrophages, phenomena which might be of therapeutic value in autoimmune neuroinflammation as well other inflammatory disorders associated with mononuclear cell activation. [score:9]
miR-181a overexpression significantly inhibited Smad7 expression (Figure 5E), whereas Socs3 and Tgfbr1 expression levels did not display a significant change (Figures 5F,G). [score:9]
Moreover, miR181a and -b both show a degree of upregulation in activated lymphocytes before their levels get suppressed (Figures 2D,E), a phenomenon which might be indicative of the presence of a complex miRNA regulatory system in leukocytes. [score:7]
To examine the expression of miR-181a and -b in the CNS during MS disease, we first performed a quantitative expression analysis on white matter samples obtained from autopsied brain tissues of MS patients and non-MS controls. [score:7]
Considering that miRNAs might affect the expression of genes at the translational level the possibility of regulating Smad7 protein levels by miR-181a and -b remains. [score:6]
This upregulation at later time points was consistent with the suppression of miR-181a and -b in activated lymphocyte at the same time points and an overall negative correlation was observed between Smad7 and miR-181a and -b levels in these cells. [score:6]
Overexpression of miR-181a and -b mimic sequences reduced proinflammatory gene expression in macrophages and polarization toward M1 phenotype. [score:5]
Expression of miR-181a (H) and miR-181b (I) were quantified in the spinal cord tissue derived from EAE mice at different stages of disease. [score:5]
Asking whether miR-181 overexpression might affect the differentiation of macrophages toward M1 or M2 phenotypes, we examined the expression of iNos, a key M1 marker, and arginase and Mrc1 as M2 markers in transfected cells. [score:5]
Interestingly, gene ontology and pathway analysis performed on miR-181 predicted targets has shown an overrepresentation of TCR signaling and TGF-β signaling pathways among miR-181a and -b’s predicted targets (20). [score:5]
Interestingly, analysis of the expression of murine miR-181a and -b in lumbar cord tissue samples from EAE mice in three phases of disease (pre-onset, acute and chronic) showed significant reduction for both miR-181a and -b levels in acute and chronic phases (Figures 1H,I). [score:5]
Expression analyses revealed a significant decrease in miR-181a and -b levels in brain white matter from MS patients as well as in spinal cords of EAE mice during the acute and chronic phases of disease. [score:5]
Similarly, inhibition of miR-181a by an antagomir delayed and dampened EAE disease (51). [score:5]
Indeed, two miRNA expression profiling studies on tissues derived from MS patients have demonstrated differential expression of miR-181 family members in MS brain tissue (13, 14). [score:5]
A luciferase reporter assay system was used to examine the ability of the miR-181a and -b to knock down the expression of these target genes. [score:5]
iNos expression was markedly reduced in miR-181a or -b overexpressing cells. [score:5]
Luciferase assays revealed Suppressor of mothers against decapentaplegic 7 (Smad7), as a direct target of miR-181a and -b. Our data highlight the anti-inflammatory actions of miR-181a and -b in the context of autoimmune neuroinflammation. [score:5]
In this study, using broad conservation of miRNA binding sites across species and known effects on T cell differentiation as selection criteria, we chose to study three transcripts, i. e., Socs3, Tgfbr1, and Smad7, as potential targets of miR-181a and -b. SOCS proteins negatively regulate Janus kinase/signal transducer and activator of transcription pathways (Jak/STAT). [score:4]
In the context of MS, both up- and downregulation of miR-181 mature isoforms have been reported in MS brains, this is likely a consequence of the degree of inflammation and tissue location with respect to MS lesions (13, 14). [score:4]
Li et al. have shown that enhanced expression of miR-181a and -b in different stages of T cell development promotes positive and negative selection through enhancing TCR sensitivity and signaling strength (19). [score:4]
A profiling study performed by Junker et al reported downregulation of miR-181 family members in MS lesions (13). [score:4]
miR-181a and miR-181b Are Downregulated in the CNS of MS Patients and EAE Animal Mo del. [score:4]
Targets of miR-181a and -b with known roles in immune pathways were also identified in relevant databases and interaction of miRNAs with 3′-UTR region of targets were examined using molecular assays. [score:4]
Overall, these results implied that miR-181a regulated Smad7 but not Socs3 and Tgfbr1 expression. [score:4]
Overall these data showed that Smad7 expression was associated with alterations in miR-181 levels leading to molecular effects that influence T cell differentiation and macrophage activation in the context of autoimmune neuroinflammation. [score:3]
miR-181a and -b have multiple predicted mRNA targets with known roles in immune response. [score:3]
We next asked whether activation of T cells might influence the expression of miR-181a and -b in these cells. [score:3]
Expression analysis for putative inflammatory cytokines Tnfa, Il1b, and Il6 showed diminished levels of Tnfa and Il6 transcripts in cells transfected with miR-181a or miR-181b sequences (Figure 3), whereas Il1b levels were unaffected. [score:3]
We provide evidence for miR-181a and -b suppression in the CNS in MS and EAE, as well as activated lymphocytes. [score:3]
To extend the analyses of miR181a and -b’s effects on Smad7 expression in lymphocytes, we transfected activated lymphocytes with miR-181a or -b mimics or negative control sequences. [score:3]
In a study on monocytes and macrophages, Xie et al. (45) showed anti-inflammatory effects for miR-181a by targeting IL1α in mice and human monocytes and macrophages (45). [score:3]
However, in contrast to the effect on Th1 differentiation, mir-181a-1/b-1 -deficient mice showed a delayed and attenuated EAE phenotype which was a consequence of inhibition of T cell migration into the CNS. [score:3]
Moreover, gene ontology analysis of miR-181a and -b’s predicted targets has shown an overrepresentation of immune pathways including T-cell receptor signaling and transforming growth factor (TGF)-β signaling (20). [score:3]
Smad7 Transcript Levels Are Negatively Correlated with miR-181a and -b Expression in CNS of EAE Mice and Activated Lymphocytes. [score:3]
miR-181a and -b Expression Are Reduced following Immune Cell Activation. [score:3]
Primary macrophages were transfected with miR-181a, miR-181b, or negative control sequences and then exposed to LPS (100 ng) for 12 h. The expression of inflammatory cytokines Tnfa, Il1, and Il6 together with M1/M2 markers iNOS, Mrc1, and arginase were then analyzed. [score:3]
miR-181a has also been shown to attenuate the ox-LDL-stimulated immune inflammatory response in dendritic cells by targeting c-fos (47). [score:3]
These findings are in agreement with our results which also point to the inhibitory effect of miR-181a and -b on Th1 polarization. [score:3]
Figure S1 miR-181a and miR-181b expression levels after transfection with miR-181a and miR-181b mimics. [score:3]
miR-181a and -b Directly Interact with and Regulate Smad7 Signaling Molecule in Cells. [score:3]
Overall, these data indicated that activation of immune cells could be associated with diminished expression of miR-181 isoforms, which in turn might play a role in subsequent pathogenic events. [score:3]
This finding was associated with a significant negative correlation between Smad7 and miR-181a and -b expression levels (Figures 7B,C). [score:3]
Expression analysis of MOG-stimulated cells showed significant reduction of miR-181a levels at 10 and 40 µg/ml concentrations of MOG at the 12-h time point (Figure 2B). [score:3]
To examine the expression levels of miR-181 isoforms in T cells following polyclonal activation, we stimulated splenocytes with anti-CD3/CD28 antibodies and studied the transcript levels at several time points following stimulation. [score:3]
Levels of target transcripts were also quantified in miR-181a and -b transfected lymphocytes. [score:3]
Interestingly, miR-181a overexpression led to a significant increase in the frequency of these induced Treg cells. [score:3]
Figure S3 The expression of inflammatory cytokines and M1/M2 markers in resting macrophages (without LPS treatment) following miR-181a and -b mimic transfection. [score:3]
In this study, we examined the role of miR-181a and -b in MS/EAE disease process. [score:3]
Figure 5Smad7 transcripts are targeted by miR-181a and miR-181b. [score:3]
Expression of mir-181a (B) and miR-181b (C) were determined by quantitative real-time PCR analysis at three time points. [score:3]
Among miR-181a and -b predicted targets, we focused on molecules with known roles in T cell differentiation or cytokine signaling which also showed miRNA binding site conservation for miR-181a and -b in human and mouse (Figure 5A). [score:3]
In separate experiments, splenocytes were stimulated with anti-CD3 and anti-CD28 for indicated time points and expression of miR-181a (D) and miR-181b (E) were quantified. [score:3]
miR-181 family members show altered expression in MS tissues although their participation in MS pathogenesis remains uncertain. [score:3]
Consistently, Smad7 transcript levels were significantly increased in the spinal cords of EAE mice in the chronic phase of disease and an overall negative correlation between Smad7 transcript levels with miR-181a and -b was detected. [score:3]
To examine whether diminished expression of miR-181 isoforms might occur in these cells following activation, we evaluated miR-181a and -b expression levels in primary macrophages and lymphocytes following cell activation. [score:3]
miR-181a and -b mimic sequences inhibited Th1 generation in CD4 [+] T cells and miR-181a mimic sequences also promoted Treg differentiation. [score:3]
Interestingly, overexpression of miR-181a and miR-181b mimic sequence reduced the frequency of Th1 cells (Figures 4D,G). [score:3]
We also show that increased levels of miR-181a and -b attenuate LPS -induced macrophage inflammatory responses and decrease the expression of M1 -associated macrophage markers. [score:3]
Our data indicate that miR-181a and -b might exert these effects by targeting Smad7. [score:3]
Moreover, we demonstrate that miR-181a and -b could regulate the differentiation of T helper cells; miR-181a and -b both decrease differentiation toward a pathogenic Th1 phenotype and miR181a also increases generation of T regulatory cells. [score:3]
Suppression of miR-181a was observed following antigen-specific or polyclonal activation of lymphocytes as well as in macrophages following LPS treatment. [score:3]
miR-181a and miR-181b are highly expressed in the brain, bone marrow, spleen, and thymus (10, 18). [score:3]
miR-181 Family Members Regulate the Differentiation of Th1 Cells and Tregs. [score:2]
miR-181a and -b expression levels together with their actions were then analyzed in macrophage and T cell differentiation assays. [score:2]
miR-181a and -b Regulate Activation and Polarization of Macrophages. [score:2]
In the present study, molecular assays using 3′-UTR-luciferase vectors showed suppression of Smad7 by miR-181a and -b, whereas the results revealed no significant interaction between miR-181a/-b and Socs3 or Tgfbr1 mRNAs. [score:2]
Studies on mouse astrocytes have also indicated a regulatory role for miR-181 family members in these cells (46). [score:2]
Members of the miR-181 family are among dysregulated miRNAs in the CNS of patients affected by MS (13, 14). [score:2]
The impact of miR-181a and -b on lymphopoiesis and T cell development has been elucidated by previous studies (10, 19, 48– 50). [score:2]
Prior studies have reported on the roles of miR-181 family members in development and function of immune cells, including their role in B cell and T cell differentiation and activities (10, 19). [score:2]
miR-181 -deficient mice show severe defects in development of B, T, NK and NKT cells (49). [score:2]
Purified naïve CD4 [+] T cells were transfected with miR-181a and -b mimic sequences and cultured in Th1, Th17, or T regulatory polarizing conditions for a period of 4 days, as described in Section “ Materials and. [score:2]
In addition to monocytoid cells, we observed effects of miR-181a and -b on T helper cell phenotypic development, whereby both miR-181a and -b decreased Th1 cells differentiation and miR-181a promoted Treg cell generation. [score:2]
Luciferase reporter assays were performed to investigate the interaction of miR-181a and -b with the 3′-UTR of potential target transcripts, and the expression of target genes was measured in the CNS of EAE mice, activated lymphocytes, and macrophages. [score:2]
Altogether, the data indicate the miR-181a and -b are likely to act as negative regulators of macrophage activation and they might also tip the balance of macrophage differentiation away from the proinflammatory M1 phenotype. [score:2]
The present findings of miR-181a and -b dysregulation in MS brains are in part consistent with previous miRNA studies in MS brains. [score:2]
Expression analysis on brain autopsy samples shows levels of miR181a and miR-181b in the brains of MS patients (n = 10) compared with non-MS controls (n = 10) (Mann–Whitney U test, * p ≤ 0.05) (A). [score:2]
Given the decreased levels of miR-181a and -b in mice with EAE and the regulation of Smad7 expression by miR-181a and -b, we investigated Smad7 transcript levels in MS brain tissue as well as the lumbar spinal cord tissue of EAE mice. [score:2]
To examine the role of the miRNAs in leukocyte differentiation and function, miR-181a and -b mimic sequences were transfected into cultured primary macrophages and purified CD4 [+] T cells which were then analyzed by RT-PCR and flow cytometry. [score:1]
” PsiCheck vectors containing the 3′-UTR of Smad7, Socs3, or Tgfbr1 mRNA were co -transfected along with miR-181a or miR-181b mimic sequences, or a scrambled negative control sequence into HEK293T cells. [score:1]
miRNA-181a and -b mimic as well as scrambled sequences were purchased from Qiagen (Syn-mmu-miR-181a miScript miRNA Mimic, Syn-mmu-miR-181b miScript miRNA Mimic, AllStars Negative Control siRNA). [score:1]
As shown in Figures 2D,E, activated T cells showed reduced levels of miR-181a and miR-181b at 24 and 48 h time points after stimulation. [score:1]
Interestingly, in their study mir-181a-1/b-1 deletion augmented Th1 differentiation in vitro and also caused an increase in Th1 and Th17 differentiation in the spleens of EAE mice while there was no difference in Treg differentiation and function (51). [score:1]
miR-181a, miR-181b, and negative control sequences were transfected into purified naïve CD4 [+] T cells, which were then activated and polarized. [score:1]
Schaffert et al. have reported that mir-181a-1/b-1 deletion in mice leads to the selection of more autoreactive T cells and higher reactivity of peripheral T cells to self-antigens. [score:1]
miR-181a and miR-181b mimics, negative control, and Attractene transfection reagent were purchased from Qiagen (Syn-mmu-miR-181a miScript miRNA Mimic, Syn-mmu-miR-181b miScript miRNA Mimic, AllStars Negative Control siRNA). [score:1]
miR-181a reduction was also observed at 10 µg/ml MOG concentration at 24-h time point (Figure 2B). [score:1]
Correlation analyses revealed a significant inverse correlation between miR-181a or miR-181 b and Smad7 transcripts in EAE tissues (Figures 6C,D). [score:1]
Likewise, Th17 polarizing conditions increased IL17 immunopositive cells (Figure 4B), but the frequency of these cells did not reveal any difference following miR-181a or miR-181b transfection (Figures 4E,G). [score:1]
Briefly, 3 µl of Hiperfect Transfection Reagent was added to 100 µl of serum-free DMEM medium containing miR-181a or miR-181b mimics or negative control at a final concentration of 50 nM. [score:1]
So it seems that while miR-181a and -b diminish differentiation of T cells toward the pathogenic Th1/Th17 phenotypes, they are also required for efficient infiltration of CNS by myelin-reactive T cells. [score:1]
These observations are consistent with previous studies, which have demonstrated anti-inflammatory roles for miR-181a (45, 46). [score:1]
Overall, these data suggested that miR-181a and miR-181b diminished polarization of activated T cells toward a Th1 phenotype, a finding that was associated with increased Treg differentiation for miR-181a isoform. [score:1]
We also measured miR181a and -b expression in transfected lymphocytes by real-time PCR (Figure S1 in). [score:1]
Our current data show that miR181a is induced in the spinal cords of EAE mice right before the onset of symptoms and then it shows a decrease in the acute and chronic phases (Figure 1I). [score:1]
So it seems that the stage of T cell activation and the dynamics of the lesion formation are other determinants of miR181a and -b levels. [score:1]
At the pre-onset phase, miR-181a showed an increase while miR-181b was reduced similar to the acute and chronic phases. [score:1]
Correlation analysis was performed between Smad7 mRNA levels and miR-181a or miR-181b in acute and chronic phases of EAE (C,D) (Pearson correlation; * p < 0.05). [score:1]
The miR-181 family is highly conserved and consists of four members (miR-181a, miR-181b, miR-181c, and miR-181d) in both humans and mice. [score:1]
Primary macrophage cultures were treated with LPS (10 and 100 ng/ml) for 12 h and the expression of miR-181a and miR-181b were measured (A). [score:1]
Nonetheless, there is limited information regarding the role of miR-181a and -b in MS pathogenesis. [score:1]
Correlation analysis between miR-181a/-b and Smad7 mRNA levels in activated lymphocytes are shown (B,C). [score:1]
As shown in Figure 5B, cells transfected with a Smad7-3′-UTR-containing plasmid showed significant reduction in luciferase activity following transfection with miR-181a and -b, indicating the interaction between miRNA and the 3′-UTR region. [score:1]
The sequence of the predicted binding site for miR-181a and miR-181b are shown on 3′-UTR of mouse Smad7, Socs3, or Tgfbr1 mRNA (in italic and bold) (A). [score:1]
miR-181a and -b influence differentiation of T helper cell and activation of macrophages, providing potential therapeutic options for controlling inflammation in MS. [score:1]
Our experiments on monocytoid cells showed that miR-181a and -b diminished proinflammatory cytokine production and differentiation toward the M1 phenotype. [score:1]
[1 to 20 of 106 sentences]
5
[+] score: 278
Since the expression of miR-181a is downregulated and Sirt1 expression is upregulated in muscle during ageing, and miR-181 negatively regulates myotube size, we suggest that age-related changes in miR-181a and its target gene(s) expression may act as a failing compensatory mechanism intended to preventing loss of muscle mass and potentially function. [score:16]
The expression of SIRT1 protein, but not mRNA in C2C12 myotubes was downregulated following overexpression of miR-181 and upregulated following inhibition of miR-181 function (Fig.   4d–f). [score:13]
We did not detect significant changes in p21 mRNA expression following manipulation of miR-181a levels, however p21 expression was downregulated following SIRT1 upregulation in C2C12 myotubes indicating that SIRT1 may play additional, miR-181-independent function in muscle, such as regulating cell senescence (Fig. S5). [score:12]
Error bars show SEM, *p < 0.05 (compared to control), n = 4The effect of changes in miR-181 and SIRT1 expression on the expression of p21, a cell cycle regulator associated with senescence and upregulated in muscle of older mice, was examined (Table  2; Fig. S5). [score:8]
Error bars show SEM; *p < 0.05 (compared with control or scrambled control as indicated); n = 3To validate Sirt1 as a physiologically relevant miR-181 target gene in muscle, the expression of Sirt1 transcript and protein was examined in C2C12 myotubes following miR-181 overexpression or inhibition using miRNA mimic or antimiR (AM181), respectively (Fig.   4c, d). [score:8]
Error bars show SEM, *p < 0.05 (compared to control), n = 4 The effect of changes in miR-181 and SIRT1 expression on the expression of p21, a cell cycle regulator associated with senescence and upregulated in muscle of older mice, was examined (Table  2; Fig. S5). [score:8]
Error bars show SEM; *p < 0.05 (compared with control or scrambled control as indicated); n = 3 To validate Sirt1 as a physiologically relevant miR-181 target gene in muscle, the expression of Sirt1 transcript and protein was examined in C2C12 myotubes following miR-181 overexpression or inhibition using miRNA mimic or antimiR (AM181), respectively (Fig.   4c, d). [score:8]
b SIRT1, but not miR-181a upregulation or inhibition had an effect on p21 mRNA expression in C2C12 myotubes as shown by qPCR. [score:8]
We have validated Sirt1 as a physiologically relevant direct miR-181a target in C2C12 myotubes (Fig.   4) and showed that miR-181 regulates myotube size through Sirt1, and potentially other target genes (Fig.   5). [score:7]
miR-181a has been previously shown to regulate muscle regeneration (Naguibneva et al. 2006) and downregulation of its expression may be also related to deterioration of satellite cell function and impaired regeneration of muscle during ageing. [score:7]
Since miR-181a, but not miR-181d, expression was significantly affected by ageing and it was predicted to have a central role in the microRNA:mRNA interactions affected by ageing, we analysed the expression of several miR-181a predicted target genes associated with muscle function by qPCR and western blot (Fig.   3c, d). [score:7]
We have validated differential expression of miR-181a and mRNA and analysed protein expression of miR-181a predicted targets genes: Sirt1, Pten, Meox2, in the mouse TA muscle during ageing (Fig.   3). [score:7]
Mutation of the putative target site in the 3′UTR rendered the reporter construct insensitive to miR-181, indicating that interaction with the target site is required for the response (Fig.   4b, c). [score:6]
Further analysis of the interactome of miRNAs differentially expressed during ageing in mouse and human muscle revealed that insulin, MAPK and TGFβ signalling, as well as ER stress, are likely to be regulated by these microRNAs; with miR-181a potentially playing a key role in age -associated changes in gene expression and signalling pathways in muscle. [score:6]
Finally, we validated Sirt1 as a miR-181a target and demonstrated that manipulation of miR-181a expression regulates myotube size in vitro. [score:6]
d Western blot and quantification showing differential protein expression of miR-181a predicted targets in TA muscle of mice during ageing. [score:5]
Co-transfection of SIRT1 overexpression construct together with miR-181 mimic rescued the miR-181 -induced phenotype, indicating the importance of Sirt1 as miR-181 target gene in controlling myotube size (Fig.   5). [score:5]
The analysis of miR-181a predicted targets supports this hypothesis, as miR-181a predicted target genes include genes/pathways with known role(s) in maintaining muscle homeostasis, for example Sirt1, Pten, and p38, Tgfβ, Tnfα, NF-kB and insulin signalling pathways (Fig. S3). [score:5]
miR-181a directly regulates the expression of Sirt1. [score:5]
Ingenuity pathways analysis indicated that differential expression of these 7 microRNAs and consequently their target genes may result in defective insulin, MAPK and TGFβ signalling, with microRNA-181a being central to controlling these interactions. [score:5]
Error bars show SEM; n = 4–7; *p < 0.05 miR-181a directly regulates the expression of Sirt1The 3′UTR of Sirt1 has one putative miR-181 binding site conserved between human and mouse (Fig.   4a). [score:5]
c qPCR showing relative (to β-2-microglobulin) expression of miR-181a predicted target genes in muscle of mice during ageing. [score:5]
These data suggest that changes in miR-181a and expression of its target gene Sirt1 in skeletal muscle during ageing may indeed have functional consequences on muscle homeostasis, specifically myofibre hypertrophy and/or atrophy. [score:5]
These data show that miR-181a directly regulated SIRT1 expression at the protein level. [score:5]
We demonstrated that miR-181a is predicted to play a central role in ageing-related disrupted muscle homeostasis and validated differential expression of microRNA-181a and its target genes in skeletal muscle during ageing. [score:5]
a Alignment of putative miR-181a target site in the 3′UTR of Sirt1 gene; human and mouse sequence are indicated; conserved miR-181a putative target site is indicated in red; complementary nucleotides are shown in orange, miR-181a seed sequence is shown in blue. [score:5]
These data suggest that ageing -associated changes in miR-181a and expression of its target gene(s) may indeed be associated with the ageing-related disrupted balance between muscle hypertrophy and atrophy. [score:5]
Co-transfection with miR-181a mimic but not miR-24 mimic, led to downregulation of GFP protein expression compared to mock -transfected control (Ctrl), as shown by representative western blot. [score:5]
Expression of miR-181 and its target gene, Sirt1, was manipulated in C2C12 myotubes; following transfections myotubes were stained for myosin heavy chain: MF20 - green; DAPI-blue. [score:5]
C2C12 myotubes were transfected with miR-181 mimic or inhibitor (AM) or SIRT1 overexpression construct. [score:5]
miR-181a and SIRT1 protein expression were inversely correlated in muscle during ageing suggesting that Sirt1 may be one of the key miR-181a targets in skeletal muscle during ageing. [score:5]
The GFP reporter containing wild type Sirt1 3′UTR was efficiently regulated by miR-181 but not by miR-24; a microRNA not predicted to target Sirt1 (negative control) (Fig.   4b, c). [score:4]
d, e Endogenous SIRT1 protein but not mRNA expression is regulated by miR-181 in C2C12 myotubes, as shown by representative Western blot or qPCR, respectively. [score:4]
miR-181a overexpression led to a significant decrease in myotube diameter, whereas miR-181a inhibition led to an increase in myotube diameter as compared to mock- and scrambled -transfected controls (Fig.   5). [score:4]
b GFP- Sirt1 3′UTR sensor constructs containing conserved mouse wild type or mutated miR-181a target site were transfected into mouse myoblasts. [score:3]
Among the analysed miR-181a predicted target genes, SIRT1 protein levels were significantly affected by ageing (Fig.   3d, e). [score:3]
Predicted target genes of miR-181 were initially chosen based on the global profiling data. [score:3]
Supplementary material 4 (TIFF 2558 kb)Fig. S5 miR-181 does not control the expression of p21, a marker of senescence. [score:3]
To establish whether age-related changes in miR-181a expression may have functional consequences on muscle homeostasis, C2C12 myotubes were used as an in vitro mo del to study myotube hypertrophy and/or atrophy. [score:3]
b qPCR showing relative expression of miR-181a and miR-181d relative to Rnu-6 in TA muscle of mice during ageing. [score:3]
Supplementary material 2 (JPEG 3354 kb) Fig. S3 Predicted miR-181a targets are shown. [score:3]
The 3′UTR region of Sirt1 with a wild type (WT) or mutated miR-181 target site (mutant) were synthesised using GeneArt service (Invitrogen) and cloned into a GFP TOPO vector (Invitrogen). [score:3]
5 microRNAs with a role in muscle biology: miR-26a (Dey et al. 2012), miR-499 (van Rooij et al. 2009a), miR34b (Roberts et al. 2012), miR-30c (Ketley et al. 2013) and miR-181a (Naguibneva et al. 2006) were validated as differentially expressed during ageing in the skeletal muscle of mice (Fig.   3a). [score:3]
Among miR-181a predicted targets, SIRT1 protein levels were significantly changed in muscle during ageing (Fig.   3). [score:3]
The input was miR-181a predicted targets (with high confidence). [score:3]
Myotubes were transfected with either 100 nM miRNA-181, 100 nM antimiR-181 or 2.5 µg SIRT1 overexpression vector (Addgene, 1791) (Brunet et al. 2004) using Lipofectamine 2000™. [score:3]
Supplementary material 3 (TIFF 16208 kb)Fig. S4 a miR-181 expression can be modulated in C2C12 myotubes. [score:3]
The differential expression of miR-181a, miR-133a, miR-26a, miR-499, miR-34b and miR-30c was validated in muscle during ageing (Fig.   3a, b). [score:3]
Future experiments using in vivo mo del organism(s) will determine whether age-related changes in miR-181a expression may indeed act as a compensatory mechanism to maintain muscle mass and potentially function during ageing. [score:3]
Interestingly, miR-181a is predicted to target several hundred genes (Figs. 2, S3), including genes associated with p38, NF-kB and TGFβ signalling, as well as genes previously reported to play an important role in skeletal muscle, such as Sirt1, Pten and Nfatc1 (Figs. 2, S3). [score:3]
qPCR showing miR-181a expression relative to Rnu-6 following mock transfection or transfections with scrambled antimiR, miR-181a mimic or antimiR-181a. [score:3]
To establish whether miR-181 directly interacts with the Sirt1 3′UTR, we generated a reporter construct containing a fragment of the Sirt1 3′UTR downstream of a GFP reporter (“wild type”). [score:2]
a MF20 immunostaining showing myotube size regulation by miR-181a and Sirt1. [score:2]
Changes in miR-181a:Sirt1 affect myotube size. [score:1]
Among the differentially expressed microRNAs were miR-181a, miR-208-5p or miR-499, miR-130a, miR-26a and miR-30c with previously characterised functions in skeletal muscle. [score:1]
“Mutant” reporter contained a mutated miR-181 binding site. [score:1]
Error bars show SEM; n = 4–7; *p < 0.05 The 3′UTR of Sirt1 has one putative miR-181 binding site conserved between human and mouse (Fig.   4a). [score:1]
[1 to 20 of 57 sentences]
6
[+] score: 278
Other miRNAs from this paper: mmu-mir-181a-2, mmu-mir-199a-1, mmu-mir-199a-2
Upregulation of SNHG12 expression and downregulation of miR-181a expression in NSCLC tissues and cell lines. [score:11]
Results indicated that the level of SNHG12 expression was upregulated while miR-181a expression was downregulated in tumor tissues when compared with adjacent normal tissues (Figure 1A and 1B). [score:10]
Moreover, SNHG12 overexpression or miR-181a inhibition significantly increased the protein levels of MAPK/Slug pathway, while the mutant SNHG12 overexpression had no obvious effect on these protein expression levels (Figure 5A and 5B). [score:9]
Moreover, miR-181a was downregulated by ectopic SNHG12, and its upregulation was observed after SNHG12 knockdown (Figure 2G). [score:8]
However, miR-181a inhibition by anti-miR-181a abolished the inhibitory effect of SNHG12 downregulation on MAPK/Slug pathway. [score:8]
Altogether, these results demonstrated that miR-181a suppressed p-MAPK1, p-MAP2K1 and Slug expression, crucial proteins of MAPK/Slug pathway, by targeting MAPK1 and MAP2K1. [score:7]
In summary, our study found upregulated SNHG12 and downregulated miR-181a in NSCLC tumor tissues and cell lines. [score:7]
Moreover, SNHG12 overexpression or miR-181a inhibition significantly increased the the MDR of NSCLC cells, while the mutant SNHG12 overexpression had no obvious effect on the MDR (Figure 3D-3F). [score:7]
However, overexpression of SNHG12 with miR181a -binding site mutants had no significant effect on miR-181a expression (Figure 2G), which suggested that the inhibitory effect of SNHG12 on miR-181a depended on the miR181a -binding site. [score:7]
SNHG12 is upregulated and miR-181a is downregulated in NSCLC tissues and cell lines. [score:7]
As shown in Figure 4F-4I, miR-181a overexpression significantly decreased the levels of MAPK1, p-MAPK1, MAP2K1, p-MAP2K1 and Slug while miR-181a inhibition elevated the levels of these proteins, indicating the inhibitory effect of miR-181a on MAPK/Slug pathway. [score:7]
As shown in Figure 3A-3C, SNHG12 overexpression, SNHG12 knockdown and miR-181a inhibition were successful in A549/PTX, A549/DDP and PC9/AB2 cells. [score:6]
Collectively, these data confirmed that SNHG12 directly suppressed miR-181a expression by sponging miR-181a in NSCLC. [score:6]
Upregulation of miR-181a increased the resistance of S KOV3/PTX cells to paclitaxel by promoting EMT and inhibiting paclitaxel -induced cell apoptosis in ovarian cancer [8]. [score:6]
miR-181a targets MAPK1 and MAP2K1, regulating p-MAPK1, p-MAP2K1 and Slug expression. [score:6]
SNHG12 directly suppresses miR-181a expression. [score:6]
miR-181a targets MAPK1 and MAP2K1, regulating p-MAPK1, p-MAP2K1 and slug expression. [score:6]
Therefore, the web -based miRNA databases TargetScan and miRBase were used to predict the possible targets of miR-181a. [score:5]
MTT assay and flow cytometry analysis suggested that downregulation of miR-181a dramatically increased IC50 values of cisplatin (Figure 6G and 6H) and remarkedly suppressed cell apoptosis (Figure 6K and 6L) in A549 cells, which was abated by MAPK1 or MAP2K1 siRNAs- mediated inactivation of MAPK/Slug pathway. [score:5]
Moreover, miR-181a inhibition led to MDR of A549 cells by targeting MAPK1 and MAP2K1. [score:5]
The results confirmed that miR-181a overexpression led to a dramatical reduction of the wild-type reporter activity in A549/DDP cells (Figure 2C), oppositely, a significant increase in the wild-type reporter activity when endogenous miR-181a was inhibited by anti-miR-181a (Figure 2D). [score:5]
Collectively, miR-181a enhanced the cisplatin sensitivity of A549 cells through suppressing MAPK/Slug pathway by targeting MAPK1 and MAP2K1. [score:5]
For instance, miR-181a attenuated the chemoresistance with inhibition of EMT and metastatic potential by targeting Twist1 in tongue squamous cell carcinoma [5]. [score:5]
All these results suggested that silence of SNHG12 reversed MDR of resistant cell strains in NSCLC by regulating miR-181a expression. [score:4]
As shown in Figure 7E and 7F, SNHG12 knockdown dramatically increased miR-181a expression and significantly reduced MAPK1, p-MAPK1, MAP2K1, p-MAP2K1 and Slug protein levels in mice tissues. [score:4]
qRT-PCR analysis revealed that SNHG12 expression (Figure 1C and 1D) was dramatically increased and miR-181a expression (Figure 1E and 1F) was remarkedly reduced in A549, H1299, PC9 and H358 cells when compared with HBE cells (Figure 1C-1F). [score:4]
The mutant miR-181a target sites for SHNG12 (SHNG12-Mut), MAPK1 3’UTR (MAPK1-Mut) and MAP2K1 3’UTR (MAP2K1-Mut1 or MAP2K1-Mut2) were generated by using the QuikChange II Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA). [score:4]
In contrast, microRNA-181a induced the chemoresistance of human cervical squamous cell carcinoma via apoptosis reversion at least partly by downregulating PRKCD [7]. [score:4]
Moreover, miR-181a inhibition could prevent cisplatin -induced A549 apoptosis, which could be reversed by MAPK1 or MAP2K1 knockdown. [score:4]
As shown in Figure 4A and 4B, a target site for miR-181a were identified in the 3’ UTR of MAPK1, and two potential binding sequences for miR-181a was presented in the 3’ UTR of MAP2K1. [score:3]
qRT-PCR analysis further confirmed that SNHG12 negatively modulated miR-181a expression in A549/DDP cells. [score:3]
These data suggested that silence of SNHG12 suppressed MAPK/Slug pathway by sponging miR-181a. [score:3]
MAPK1 and MAP2K1 were previously reported as the target genes of miR-181a in salivary adenoid cystic carcinoma [30], in agreement with our study. [score:3]
An inverse correlation between SNHG12 and miR-181a expressions stimulated our interest to determine whether a ceRNA mechanism existed between SNHG12 and miR-181a. [score:3]
For verifying that MAPK1 and MAP2K1 were targets of miR-181a, (pGL3-MAPK1-Wt or pGL3-MAPK1-Mut) or (pGL3-MAP2K1-Wt1 or pGL3-MAP2K1-Mut1) or (pGL3-MAP2K1-Wt2 or pGL3-MAP2K1-Mut2) were transfected into A549/DDP cells in combination with miR-181a mimics or miR-Con. [score:3]
miR-181a mimics, scramble miRNA control (miR-Con), miR-181a inhibitors (anti-miR-181a) and its nonspecific control (anti-miR-Con) were purchased from GenePharma (Shanghai, China). [score:3]
Then, the effect of SNHG12 on miR-181a expression was detected in A549/DDP cells transfected with (pcDNA-SNHG12 or pcDNA-SNHG12-Mut) or (si-SNHG12-1 or si-SNHG12-2). [score:3]
For SNHG12 overexpression, the wild or miR-181a biding site mutant SNHG12 sequence was amplified and inserted into pcDNA 3.1 vector from Ribobio (Guangzhou, China). [score:3]
Figure 1 (A and B) Expression levels of SNHG12 and miR-181a in 22 pairs of NSCLC tumor and adjacent normal tissue specimens were examined by qRT-PCR analysis. [score:3]
However, miR-181a inhibition abolished si-SNHG12 -mediated sensitivity of resistant cell strains to cisplatin, paclitaxel and gefitinib (Figure 3D-3F). [score:3]
Moreover, our results (Figure 1) showed that SNHG12 and miR-181a displayed opposing expression in NSCLC tissues and cell lines. [score:3]
As expected, SNHG12 contains one conserved target binding site of miR-181a (Figure 2A). [score:3]
Also, considerable experimental evidence confirmed the involvement of miR-181a in drug sensitivity or resistance, functioning as either an oncogene or a tumor suppressor depending on the cancer type and/or cellular context. [score:3]
To ascertain the expression levels of SNHG12 and miR-181a in NSCLC tissues, qRT-PCR analysis was performed in 22 paired NSCLC tumor tissue specimens and adjacent normal tissues. [score:3]
Furthermore, SNHG12 was confirmed to release miR-181a target genes MAPK1 and MAP2K1, by sponging miR-181a in A549/DDP cells. [score:3]
miR-181a overexpression enhanced the sensitivity of NSCLC cells to cisplatin by stimulating Bax oligomerization and activating proapoptotic caspases [6]. [score:3]
qRT-PCR analysis was performed to detect the expressions of SNHG12 (C and D) and miR-181a (E and F) in NSCLC cell lines (A549, A549/DDP, A549/PTX, H1299, H1299/PTX, H1299/DDP, PC9, PC9/AB2, H358 and H358/AB2) and immortalization of human bronchial epithelial cell line HBE. [score:3]
Therefore, we speculated that SNHG12 may inhibit miR-181a by sponging miR-181a. [score:3]
The sequence fragment of SHNG12 (SHNG12-Wt), MAPK1 (MAPK1-Wt) 3’UTR and MAP2K1 3’UTR (MAP2K1-Wt1 or MAP2K1-Wt2) containing the putative target sites for miR-181a were amplified and inserted into the pGL3-reporter-vector (Promega, Madison, WI, USA). [score:3]
Firstly, the transfection efficiencies of SNHG12 overexpression vectors, SNHG12 siRNAs and anti-miR-181a were detected in A549/PTX, A549/DDP and PC9/AB2 cells. [score:3]
However, how miR-181a is regulated and the mechanism by which miR-181a affects the drug resistance in NSCLC are largely unknown. [score:2]
Functionally, SNHG12 knockdown induced sensitivity of A549/DDP to cisplatin, A549/PTX to paclitaxel and PC9/AB2 to gefitinib by sponging miR-181a. [score:2]
To further investigate whether the effect of MAPK/Slug pathway suppression on cisplatin resistance and apoptosis was regulated by miR-181a, A549 cells were transfected with anti-miR-181a or (anti-miR-181a or anti-miR-Con) in combination with si-MAPK1 or si-MAP2K1. [score:2]
However, the mutant reporter activities in all transfected cells had no significant changes (Figure 2C and 2D), indicating that the regulatory effect was dependent on the binding of SNHG12 and miR-181a. [score:2]
In contrast, A549/PTX, A549/DDP, H1299/PTX, H1299/DDP, PC9/AB2 and H358/AB2 cells exhibited low -expression levels of miR-181a compared with their parental cell strains A549, H1299, PC9 and H358 (Figure 1E and 1F). [score:2]
To further test the regulatory effect of miR-181a on MAPK/Slug pathway, western blot analysis was performed to examine the protein levels of MAPK1, p-MAPK1, MAP2K1, p-MAP2K1 and Slug. [score:2]
All these findings illuminated that SNHG12 acted as a ceRNA to regulate MAPK1 and MAP2K1 by sponging miR-181a in NSCLC. [score:2]
SNHG12 regulates MAPK/Slug pathway by sponging miR-181a. [score:2]
To further explore whether both SNHG12 and miR-181a were in the RISC complex, RIP experiments were performed on A549/DDP cell extracts using antibodies against Ago2. [score:1]
Figure 2 (A) The binding site of miR-181a within the SNHG12. [score:1]
SNHG12 acts as a miR-181a sponge. [score:1]
Blockage of MAPK/Slug pathway reversed anti-miR-181a -mediated change in resistance to cisplatin and apoptosis in A549 cells. [score:1]
Mechanically, SNHG12 acted as an oncogene in NSCLC MDR via inducing apoptosis through modulating MAPK/Slug pathway by sponging miR-181a and releasing MAPK1 and MAP2K1. [score:1]
Considering that the higher expression of SNHG12 and lower miR-181a levels in A549/PTX, A549/DDP and PC9/AB2 cells, these cells were used for further investigations. [score:1]
Figure 5A549 and A549/DPP cells were transfected with (si-Con or si-SNHG12) or (Vector or pcDNA-SNHG12 or pcDNA-SNHG12-Mut) or (anti-miR-181a or anti-miR-Con) or co -transfected with si-SNHG12-1 and anti-miR-181a or anti-miR-Con. [score:1]
As shown in Figure 2E, SNHG12 and miR-181a were enriched in Ago2 pellets relative to control IgG. [score:1]
A549 and A549/DPP cells were transfected with (si-Con or si-SNHG12) or (Vector or pcDNA-SNHG12 or pcDNA-SNHG12-Mut) or (anti-miR-181a or anti-miR-Con) or co -transfected with si-SNHG12-1 and anti-miR-181a or anti-miR-Con. [score:1]
For confirming the binding interaction between SHNG12 and miR-181a, A549/DDP cells were co -transfected with (miR-181a mimics or miR-Con) or (anti-miR-181a or anti-miR-Con) and pGL3-SHNG12-Wt or pGL3-SHNG12-Mut. [score:1]
Fold changes of SNHG12 and miR-181a were analyzed using the 2 [-ΔΔCt] method by normalizing to GAPDH and U6 snRNA, respectively. [score:1]
Then, the level of SNHG12 and miR-181a was further determined in NSCLC cell lines A549 and its drug-resistant cell strains (A549/DDP and A549/PTX), H1299 and its drug-resistant cell strains (H1299/DDP and H1299/PTX), PC9 and its gefitinib-resistant cell strain PC9/AB2, H358 and its gefitinib-resistant cell strain H358/AB2, and immortalization of human bronchial epithelial cell line HBE. [score:1]
Furthermore, it was displayed that a negative correlation existed between SNHG12 and miR-181a in NSCLC tumor tissues (Figure 2H). [score:1]
All these data revealed that the SNHG12-miR-181a-MAPK/Slug axis enhanced the drug sensitivity of NSCLC cells by promoting drug -induced cell apoptosis. [score:1]
Inactivation of MAPK/Slug pathway reversed anti-miR-181a -mediated change in resistance to cisplatin and apoptosis in A549 cells. [score:1]
Finally, the levels of SNHG12 and miR-181a in the precipitates were detected by qRT-PCR. [score:1]
Figure 4 (A and B) The putative miR-181a -binding sites within the 3’ UTR of MAPK1 and MAP2K1. [score:1]
SNHG12 promotes MAPK/Slug pathway by sponging miR-181a. [score:1]
Our findings revealed a SNHG12-miR-181a-MAPK/Slug axis in NSCLC MDR, providing a new modulation strategy to overcome chemoresistance of NSCLC. [score:1]
Detection of SNHG12 and miR-181a using qRT-PCR. [score:1]
A549/PTX, A549/DDP and PC9/AB2 cells were transfected with (pcDNA-SNHG12 or pcDNA-SNHG12-Mut) or (si-SHNG12-1 or si-SHNG12-2) or anti-miR-181a or (si-SHNG12-1 or si-SHNG12-2 + anti-miR-181a). [score:1]
[1 to 20 of 79 sentences]
7
[+] score: 250
We also showed that transfection with miR-181a mimics or inhibitors resulted in a down-regulation or up-regulation in pro-inflammatory cytokines, such as IL-1β, IL-6, and TNF-α. [score:9]
miR-181a suppresses TNF-α -induced transcription of pro-inflammatory genes in liver epithelial cells by targeting p300/CBP -associated factor (Zhao et al., 2012), and inhibits oxidized low-density lipoprotein-stimulated inflammatory responses in dendritic cells by targeting c-Fos (Wu et al., 2012). [score:9]
As displayed in Figure 2A, miR-181a expression was significantly decreased upon LPS stimulation and the down-regulation of miR-181a expression was dose -dependent. [score:8]
Downregulation of miR-181a protects mice from LPS -induced acute lung injury by targeting Bcl-2. Biomed. [score:6]
These results imply that miR-181a is able to bind to TLR4 mRNA directly and inhibits its translation. [score:6]
These results imply that miR-181a inhibits TLR4 expression by directly binding the 3′-UTR of TLR4 mRNA. [score:6]
Twenty-four hours after transfection, the transfection efficacy was assessed by qPCR, and the results confirmed that transfection with miR-181a mimics or inhibitors led to a dramatical increase or decrease in miR-181a expression (Figures 3A,B). [score:5]
Downregulation of PCAF by miR-181a/b provides feedback regulation to TNF-α–induced transcription of proinflammatory genes in liver epithelial cells. [score:5]
Furthermore, bioinformatics predictions made with TargetScan and miRanda showed that TLR4 is a putative target of miR-181a. [score:5]
To find out the possible target of miR-181a, we next detected the expression of upstream molecules of NF-κB pathway. [score:5]
To further elucidate the mechanisms by which miR-181a regulates LPS -induced inflammatory responses, a siRNA specific for TLR4 (si-TLR4) was used to knock down TLR4 expression in macrophages, and then, the expression level of TLR4 was measured by qPCR and western blotting. [score:5]
The results of our study not only demonstrates that miR-181a targets TLR4 directly to regulate the activation of NF-κB and subsequent secretion of inflammatory cytokines in response to LPS stimulation, but also reveal further that this miRNA represses the intracellular ROS accumulation. [score:5]
In the present study, we identified that over -expression or inhibition of miR-181a significantly decreased or increased the LPS -induced production of IL-1β, IL-6, and TNF-α in macrophages. [score:5]
miR-181a mimics Sense 5′-AACAUUCAACGCUGUCGGUGAGU-3′ Antisense 5′-UCACCGACAGCGUUGAAUGUUUU-3′ Mimics NC Sense 5′-UUCUCCGAACGUGUCACGUTT-3′ Antisense 5′-ACGUGACACGUUCGGAGAATT-3′ miR-181a inhibitors Sense 5′-ACUCACCGACAGCGUUGAAUGUU-3′ Inhibitors NC Sense 5′-CAGUACUUUUGUGUAGUACAA-3′ TLR4 siRNA Sense 5′-GGACAGCUUAUAACCUUAATT-3′ Antisense 5′-UUAAGGUUAUAAGCUGUCCTT-3′ siRNA NC Sense 5′-UUCUCCGAACGUGUCACGUTT-3′ Antisense 5′-ACGUGACACGUUCGGAGAATT-3′ 24 h after transfection with miR-181a mimics or inhibitors or the respective controls, the cells were then stimulated with 2 μg/mL LPS for 12 h. The levels of TNF-α, IL-1β, and IL-6 in the cell culture supernatants were measured with kits according to the manufacturer’s protocols. [score:5]
These data suggests that miR-181a could suppress LPS -induced activation of NF-κB pathway, likely through decreasing TLR4 expression. [score:5]
As shown in Figures 3C– F, over -expression or inhibition of miR-181a significantly decreased or increased the LPS -induced secretion of pro-inflammatory cytokines. [score:5]
Further experiments demonstrated that miR-181a decreased TLR4 expression by binding directly to the 3′-UTR of TLR4. [score:4]
In order to explore the programmed feedback mechanism of miR-181a regulating inflammation, it is essential to study its target genes. [score:4]
However, this finding is contrary to another published report which has suggested that miR-181a is up-regulated in the lung tissues (Li et al., 2016). [score:4]
Furthermore, down-regulation of miR-181a in macrophages stimulated with LPS in a dose- and time -dependent manner was also found, indicating miR-181a may have an important biological function in LPS -induced inflammation. [score:4]
To determine whether TLR4 is a direct target of miR-181a, we cloned 3′-UTR of TLR4 into a psiCHECK [TM]-2 vector (Promega, Madison, WI, United States) to generate a wild- or mutant-type TLR4 3′-UTR luciferase reporter vector. [score:4]
This study revealed that miR-181a could be an important negative regulator of inflammation and shed new light on therapeutic approaches toward some inflammatory diseases including ALI. [score:4]
Subsequently, we demonstrated that miR-181a is down-regulated in the lung tissues of LPS-challenged mice, consistent with a previous study (Cai et al., 2012). [score:4]
miR-181a Is Down-regulated in LPS-Stimulated Macrophages. [score:4]
All these findings indicates, that miR-181a may be a negative regulator of LPS-stimulated inflammation via the suppression of ROS generation and TLR4-NF-κB pathway. [score:4]
Taken together, these findings strongly demonstrate miR-181a is implicated in the negative regulation of LPS -induced inflammation through inhibiting TLR4-NF-κB pathway. [score:4]
FIGURE 5TLR4 is a molecular target of miR-181a. [score:3]
Besides, we also tested miR-181a expression at different time points of LPS treatment. [score:3]
In contrast, their levels were dramatically reduced while over -expression of miR-181a. [score:3]
hsa-mir-181a and hsa-mir-181b function as tumor suppressors in human glioma cells. [score:3]
Collectively, these data strongly demonstrate that the TLR4 was the very target of miR-181a following LPS stimulation. [score:3]
These results reveal that miR-181a could also alleviate the inflammatory response mediated by inhibition of the ROS production (Figure 8). [score:3]
Here, we found that LPS treatment highly decreased the expression of miR-181a in lung tissues and macrophages. [score:3]
The cells were transfected with miR-181a mimics, miR-181a inhibitors, siRNA or the negative controls using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, United States) according to the manufacturer’s instructions. [score:3]
The relative expression of miR-181a was normalized to U6 snRNA. [score:3]
TLR4 Is a Molecular Target of miR-181a. [score:3]
miR-181a Suppressed LPS-Induced Activation of NF-κB Pathway. [score:3]
Recently, it has been reported that miR-181a is associated with tumor growth and immune response (Seoudi et al., 2012), and suppresses TNF-α -induced transcription of pro-inflammatory genes (Zhao et al., 2012). [score:3]
microRNA-181a represses ox-LDL-stimulated inflammatory response in dendritic cell by targeting c-Fos. [score:3]
In addition, bioinformatic softwares (TargetScan and miRanda) showed that there are two putative binding sites between miR-181a and the 3′-UTR of TLR4 (Figure 5F). [score:3]
To further vindicate the mechanism of miR-181a in cytokines inhibition, we then determined the ability of miR-181a to modulate the activation of NF-κB pathway in macrophages. [score:3]
Previous research has shown that miR-181a is mainly involved in modulation of tumor cell growth, and acts as a tumor suppressor in human glioma cells (Shi et al., 2008). [score:3]
The possible sites of binding between TLR4 and miR-181a were predicted using TargetScan [1] and miRanda [2]. [score:3]
Moreover, TLR4 expression was also silenced using si-TLR4 so as to further verify whether TLR4 is involved in the anti-inflammatory effect of miR-181a. [score:3]
The relative expression levels of miR-181a and mRNAs were normalized to the endogenous references U6 snRNA and GAPDH following the 2 [-ΔΔCt] method. [score:3]
We found that miR-181a mimics markedly decreased the luciferase activity for the wild-type 3-UTR of TLR4 but showed no inhibition effect for the mutated 3′-UTR of TLR4 (Figure 5G). [score:3]
As displayed in Figures 5A– E, transfection with miR-181a mimics restrained the protein level of TLR4 but not the mRNA level, indicating that miR-181a may function at the translational level. [score:3]
We transfected macrophages with miR-181a mimics or negative controls and then examined the expression of TLR4. [score:3]
To unravel the specific role of miR-181a in cytokines production in LPS -induced inflammatory response, macrophages were transiently transfected with miR-181a mimics or inhibitors. [score:3]
The Expression of miR-181a Is Reduced in the Lung Tissues of LPS-Challenged Mice. [score:3]
showed that LPS decreased miR-181a expression in a time -dependent manner and reached a nadir at 12 h (Figure 2B). [score:3]
In the present study, miR-181a mimics markedly suppressed the intracellular ROS accumulation in LPS -induced macrophages. [score:3]
To further validate that TLR4 is a molecular target of miR-181a, the luciferase reporter assay was performed. [score:2]
Moreover, the immunoregulatory effect of miR-181a in differentiation of T helper cell and activation of macrophages has also been proposed (Ghorbani et al., 2017). [score:2]
However, the TLR4 expression was also decreased by miR-181a mimics in the absence of LPS compared with the control mimics (Figures 4F,G). [score:2]
TNF-α mRNA is negatively regulated by microRNA-181a-5p in maturation of dendritic cells induced by high mobility group box-1 protein. [score:2]
miR-181a also negatively regulates immune responses in DCs (Zhu et al., 2017), and influences differentiation of T helper cell and activation of macrophages (Ghorbani et al., 2017). [score:2]
We also studied the effect of miR-181a in NF-κB activation by dual-luciferase assay, and the results showed that miR-181a inhibited NF-κB activation (Figure 4C). [score:2]
In order to explore whether miR-181a is involved in this immune reaction, we measured the expression of miR-181a in the lung tissues of ALI mice. [score:1]
However, we are not certain whether miR-181a has an anti-inflammatory effect in LPS -induced inflammation in ALI. [score:1]
To further confirm that miR-181a is able to directly bind to TLR4 mRNA, a luciferase reporter assay was performed. [score:1]
Therefore, we employed an in vivo ALI mo del as well as an in vitro inflammation mo del using RAW 264.7 macrophages to explore the possible role of miR-181a in inflammatory response induced by LPS. [score:1]
miR-181a Reduces LPS-Induced Intracellular ROS Accumulation in Macrophages. [score:1]
The observations showed that miR-181a likely provided a negative feedback to inflammation stimulated by LPS. [score:1]
miR-181a belongs to the miR-181 family, and its nucleic acid sequence is highly conserved in mammals (Ji et al., 2009). [score:1]
miR-181a Decreases the LPS-Induced Production of Pro-inflammatory Cytokines. [score:1]
To investigate the effect of miR-181a in LPS -induced inflammation in ALI, the expression of miR-181a in LPS-stimulated RAW 264.7 macrophages was also detected. [score:1]
Briefly, macrophages were co -transfected with pNF-κB-Luc, pRL-TK control vectors and miR-181a mimics along with indicated controls. [score:1]
More importantly, miR-181a could function as an apoptosis promoter in the pathogenesis of ALI (Li et al., 2016). [score:1]
Identification of microRNA-181 by genome-wide screening as a critical player in EpCAM -positive hepatic cancer stem cells. [score:1]
These results further confirm that miR-181a is involved in LPS -mediated immune response. [score:1]
In present study, we found that miR-181a mimics dramatically decreased the TLR4 protein level. [score:1]
qPCR assay showed that the level of miR-181a was markedly suppressed in lung tissues of ALI mice when compared to that of the control group (Figure 1F). [score:1]
Luciferase activity was significantly reduced when co -transfected miR-181a mimics with wild-type TLR4 3′-UTR vector, whereas no significant change was observed with mutant-type TLR4 3′-UTR vector. [score:1]
These results suggest that miR-181a could also alleviate LPS -induced inflammation through reducing TLR4 -mediated ROS production. [score:1]
Briefly, the wild- or mutant-type TLR4 3′-UTR luciferase reporter vectors were transfected into HEK293T cells, and then treated with miR-181a mimics or control mimics. [score:1]
FIGURE 8 Schematic diagram of signaling pathways related to anti-inflammatory effects of miR-181a on LPS -induced inflammation. [score:1]
Cells were co -transfected with the wild- or mutant-type TLR4 3′-UTR luciferase reporter vectors, as well as miR-181a mimics or mimics NC. [score:1]
Cells were harvested, and miR-181a expression was measured by qPCR. [score:1]
More notably, anti-inflammatory function of miR-181a has been identified in some recent studies. [score:1]
Intriguingly, the activation of NF-κB pathway by LPS was also repressed following transfection with miR-181a mimics. [score:1]
Macrophages were transfected with miR-181a mimics or si-TLR4 or the respective controls for 24 h, then incubated with 10 μM DCFH-DA for 30 min followed by stimulation with 2 μg/mL LPS for an additional 30 min. [score:1]
These results indicate that miR-181a play an anti-inflammatory role in the LPS -induced inflammatory response. [score:1]
MicroRNA-181 variants regulate T cell phenotype in the context of autoimmune neuroinflammation. [score:1]
[1 to 20 of 84 sentences]
8
[+] score: 228
The TNF-α 3′UTR containing the mutated ssc-miR-130a-3p target sequence (TTGCACT to AACGTGA), ssc-miR-181a target sequence (TGAATGT to ACTTACA), ssc-miR-181b target sequence (TGAATGT to ACTTACA), ssc-miR-301a-3p target sequence (TTGCACT to AACGTGA), mmu-miR-130a-3p target sequence (TTGCACT to AACGTGA), mmu-miR-181a target sequence (TGAATGT to ACTTACA), mmu-miR-181b target sequence (TGAATGT to ACTTACA), mmu-miR-301a-3p target sequence (TTGCACT to AACGTGA), and mmu-miR-351-5p target sequence (CTCAGGG to GAGTCCC) were cloned into the pMIR-REPORT Luciferase vector. [score:19]
Herein, we further identified miR-181a and miR-301a-3p to be involved in the posttranscriptional regulation of TNF-α in both Omp25-expressed PAMs and mouse RAW264.7 cells, yet found that Omp25 specially induced miR-130a-3p to inhibit TNF-α expression in porcine macrophages, and Omp25 specially induced miR-351-5p to inhibit TNF-α expression in murine macrophages via targeting the 3′UTR of TNF-α. [score:14]
Downregulation of Omp25-Induced miRNAs Improves TNF-α Production and Promotes Intracellular Bacterial Clearance in WT B. suis-Infected MacrophagesNow we have shown that Omp25 expression can induce miR-130a-3p, miR-146a, miR-181a, miR-301a-3p, or miR-351-5p in PAMs and mouse RAW264.7 cells, but whether or not the WT B. suis infection can also upregulate the expression of these miRNAs needs to be examined. [score:11]
These data demonstrate miR-130a-3p, miR-181a, miR-181b, or miR-301a-3p regulates the TNF-α expression at the transcriptional level via targeting its 3′UTR, while miR-351-5p may inhibit murine TNF-α expression both at transcriptional and posttranscriptional level. [score:10]
Taken together, the results present in here demonstrate that miR-130a-3p, miR-181a, and miR-301a-3p regulate TNF-α expression at posttranscriptional level, miR-146a regulates TNF-α expression at posttranscriptional level, whereas miR-351-5p specifically regulate mouse TNF-α expression at both transcriptional and posttranscriptional levels. [score:10]
These results suggest that miR-130a-3p, miR-181a, miR-181b, and miR-301a-3p inhibit TNF-α expression at the posttranscriptional level, while miR-146a and miR-351-5p likely inhibit TNF-α expression in transcriptional level. [score:9]
Further studies revealed that miR-130a-3p, miR-181a, and miR-301a-3p target to the 3′UTR region of TNF-α to restrain TNF-α production at the posttranscriptional level, whereas miR-146a and miR-351-5p transcriptionally suppress the expression of TNF-α by targeting TRAF6 and IRAK1 (Figure 9). [score:9]
These results not only further confirm that the inhibitory effect of miR-130a-3p, miR-181a, or miR-301a-3p on TNF-α is at posttranscriptional level, likely by targeting to the 3′UTR of TNF-α, but also demonstrate that Brucella Omp25 regulates TNF-α expression by multiple modes of action. [score:8]
Now we have shown that Omp25 expression can induce miR-130a-3p, miR-146a, miR-181a, miR-301a-3p, or miR-351-5p in PAMs and mouse RAW264.7 cells, but whether or not the WT B. suis infection can also upregulate the expression of these miRNAs needs to be examined. [score:8]
To further determine the roles of miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p in regulating TNF-α, cells were transfected with inhibitor control, miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, miR-351-5p inhibitor, or miRNA inhibitor mix and infected with LV-Omp25 or LV-Blank. [score:8]
In PAMs, transfection of miR-130a-3p, miR-146a, miR-181a, and miR-301a-3p inhibitors apparently improved the relative TNF-α levels compared with the inhibitor control, but miR-181b and miR-351-5p inhibitors had no effects on TNF-α expression (Figure 7A). [score:8]
Our results showed that in Omp25 -expressing PAMs, the levels of miR-130a-3p, miR-146a, miR-181a, miR-181b, and miR-301a-3p were upregulated, while miR-125a-5p, miR-125b-5p, and miR-146b were downregulated compared to controls (Figure 4A). [score:8]
Notably, in PAMs transfected with a mix of miR-130a-3p, miR-146a, miR-181a, and miR-301a-3p inhibitors, as well as in mouse RAW264.7 cells transfected with a mix of miR-146a, miR-181a, miR-301a-3p, and miR-351-5p inhibitors, the inhibitory effects of Omp25 on TNF-α induction were further attenuated, leading to the levels of TNF-α were almost close to that of LV-Blank (Figures 7A,B). [score:7]
In mouse RAW264.7 cells, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p were upregulated, while miR-125a-5p and miR-146b were downregulated (Figure 4B). [score:7]
Figure 8Deficiency of Omp25 decreases B. suis -induced miR-130a-3p, miR-146a, miR-181a, miR-301a-3p, or miR-351-5p whereas inhibition of these miRNAs upregulates tumor necrosis factor (TNF)-α and promotes the intracellular clearance of wild-type (WT). [score:6]
Importantly, B. suis infection induces higher levels expression of miR-146a, miR-181a, miR-181b, or miR-301a-3p in both PAMs and mouse RAW264.7 cells, yet specifically upregulates miR-130a-3p in PAMs and miR-351-5p in RAW264.7 cells, respectively. [score:6]
In both PAMs and mouse RAW264.7 cells, we showed that miR-181a and -301a-3p participated in the posttranscriptional regulation of TNF-α inhibition by Omp25, suggesting that Brucella Omp25 adopts similar mechanisms to interfere with the expression of TNF-α in macrophages from different mammals through employing these miRNAs. [score:6]
At the posttranscriptional levels, Brucella Omp25 inhibits LPS -induced TNF-α via upregulating miR-181a and miR-301a-3p (in both porcine and murine macrophages), or miR-130a-3p (in porcine macrophages), or miR-351-5p (in murine macrophages). [score:6]
In this study, we found that B. suis Omp25 upregulated miR-130a-3p, miR-146a, miR-181a, miR-301a-3p, or miR-351-5p, which was correlated with TNF-α inhibition. [score:6]
These results demonstrate that in the process of Omp25 inhibiting TNF-α expression, miRNAs (miR-130a-3p, miR-146a, miR-181a, and miR-301a-3p) play principal roles in PAMs, while miRNAs (miR-146a, miR-181a, miR-301a-3p, and miR-351-5p) play principal roles in mouse RAW264.7 cells. [score:5]
We found that Omp25 -induced miR-146a, miR-181a, and miR-301a-3p regulate TNF-α in both PAMs and mouse RAW264.7 cells, whereas Omp25 -induced miR-130a-3p and miR-351-5p specifically regulate TNF-α expression in porcine and murine macrophages, respectively. [score:5]
Altogether, these results indicate that miR-146a, miR-181a, and miR-301a-3p participate in the regulation of TNF-α in both PAMs and mouse RAW264.7 cells, whereas miR-130a-3p and miR-351-5p specifically regulate TNF-α expression in porcine and murine cells, respectively. [score:5]
miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p Inhibit TNF-α Expression at Transcriptional or Posttranscriptional Levels. [score:5]
In summary, the present data in this study provide certain evidences for miRNAs (miR-130a-3p, miR-146a, miR-181a, miR-301a-3p, and miR-351-5p) participation of Brucella Omp25 -induced TNF-α suppression in porcine and murine macrophages and demonstrate that different regulation patterns are employed by Omp25 between porcine and murine macrophages in this regulatory process. [score:5]
Altogether, these data demonstrate that Omp25 induces the expression of several miRNAs in PAMs and mouse RAW264.7 cells, with miR-146a, miR-181a, miR-181b, and miR-301a-3p being commonly upregulated in both PAMs and mouse RAW264.7 cells compared to miR-130a-3p and miR-351-5p, which are specific for PAMs and mouse RAW264.7 cells, respectively. [score:5]
Figure 7miR-146a, miR-181a, and miR-301a-3p participate in the regulation of tumor necrosis factor (TNF)-α in both porcine alveolar macrophages (PAMs) and mouse RAW264.7 cells, whereas miR-130a-3p and miR-351-5p differentially regulate TNF-α expression in porcine and murine cells. [score:5]
miR-146a, miR-181a, and miR-301a-3p Participate in the Regulation of TNF-α in Both PAMs and Mouse RAW264.7 Cells, whereas miR-130a-3p and miR-351-5p Specially Regulates TNF-α Expression in Porcine and Murine Cells. [score:5]
Figure 5Upregulation of miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p blocks LPS-stimulated TNF-α production. [score:4]
Considering that miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p might participate in the negative regulation of TNF-α production in Omp25 -expressing cells, we measured the expression of these miRNAs in PAMs and mouse RAW264.7 cells after LV-Omp25 infection. [score:4]
We found that WT B. suis induced higher levels of miR-130a-3p, miR-146a, miR-181a, and miR-301a-3p expression than that of Δ omp25 B. suis in PAMs (Figures 8A–D). [score:3]
Given above results, we reasoned that miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p likely play crucial roles in the Omp25 inhibition of LPS -induced TNF-α production. [score:3]
To confirm that TNF-α is regulated at posttranscriptional level by which miRNA, we constructed reporter plasmids encoding the WT 3′UTR of porcine or murine TNF-α mRNA downstream of the firefly luciferase gene (porcine or murine TNF-α WT-3′UTR), as well as parallel plasmids containing mismatches in the predicted binding sites (miR-130a-3p, miR-181a, miR-181b, miR-301a-3p, or miR-351-5p MT-3′UTR) of the 3′UTR region (Figure S5 in). [score:2]
Role of miR-181 family in regulating vascular inflammation and immunity. [score:2]
showed that the levels of miR-130a-3p, miR-146a, miR-181a, miR-181b, and miR-301a-3p increased at 12–36 h in LV-Omp25-infected PAMs, whereas miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p showed similar changes in LV-Omp25-infected RAW264.7 cells (Figures 4C–G,I–M). [score:1]
Additionally, miR-181 family also plays crucial roles in inflammation (44), likely by binding to human TNF-α mRNA 3′UTR to promote the fine-tuning of TNF-α in immunoparalysis (45). [score:1]
To test this, PAMs and mouse RAW264.7 cells were transfected with miRNA control, miR-130a-3p mimics, miR-146a mimics, miR-181a mimics, miR-181b mimics, miR-301a-3p mimics, or miR-351-5p mimics, and stimulated the transfected cells with LPS for 24 h. In PAMs, transfection of the mimics of miR-130a-3p, miR-146a, miR-181a, miR-181b, and miR-301a-3p decreased LPS -induced TNF-α, except miR-351-5p (Figure 5A). [score:1]
In RAW264.7 cells, transfection of the mimics of miR-130a-3p, miR-146a, miR-181a, miR-181b, miR-301a-3p, and miR-351-5p decreased LPS -induced TNF-α (Figure 5B). [score:1]
[1 to 20 of 37 sentences]
9
[+] score: 218
Suppression of KRAS by siRNA knock down, on the other hand, decreased viability in primary patient-derived SCC cells (SCC) similarly as miR-181a overexpression did (Fig 4E). [score:6]
A large screen of miRNA expression in SCC singled out miR-181a as downregulated in our SCC patient samples. [score:6]
miR-181a shows tumor suppressive effect against oral squamous cell carcinoma cells by downregulating K-ras. [score:6]
SCC13 cells, on the other hand, exhibited lower KRAS levels when miR-181a was upregulated either by transfection of miRNA mimics (Fig 3C) or by stable miR-181a over expression (Fig 3D). [score:6]
TGF-beta upregulates miR-181a expression to promote breast cancer metastasis. [score:6]
Showing functionality beyond epithelial cancers, miR181a overexpression suppresses cell growth in xenograft tumors in chronic myelogenous leukemia [28] and large B-cell lymphoma [29]. [score:5]
miR-181a mediates its tumor-suppressive role through KRAS signaling via the MAPK pathwayFollowing the observation that miR-181a in keratinocytes correlated negatively with KRAS expression and with cellular viability, we were interested in a functional role of KRAS in keratinocytes. [score:5]
miR-181a targets KRAS directly. [score:4]
KRAS is a direct target of miR-181a. [score:4]
The result revealed that KRAS, when overexpressed, was able to boost viability in HaCaT similarly as a miR-181a knock down did. [score:4]
Healthy cells with repressed miR-181a, either by transfection of miRNA inhibitors (Fig 3A) or by stable knock down (Fig 3B), showed higher KRAS protein and mRNA levels. [score:4]
Following our observation of an inverse correlation between miR-181a levels and cellular viability, we were speculating that an upregulation of miR-181a would lead to decreased cellular viability in cancer cells. [score:4]
Interestingly, healthy primary keratinocytes and HaCaT cells were vulnerable to miR-181a upregulation to a certain degree as well (Fig 2E). [score:4]
Our findings indicate a crucial role for miR-181a in regulating keratinocyte proliferation mediated by KRAS interaction and MEK pathway inhibition, prompting us to validate these findings in a xenograft mouse mo del. [score:4]
KRAS is a direct target of miR-181aNext we aimed to unravel the molecular mechanism laying behind miR-181a’s negative effect on cellular viability. [score:4]
Notably, the Ras family members HRAS and RhoA are most likely not subjected to miR-181a posttranscriptional regulation in SCC13 cells as demonstrated by transfectional miR-181a modulation and gene expression analysis via qPCR and Western blotting (S12 Fig). [score:4]
miR-181a mediates its tumor-suppressive role through KRAS signaling via the MAPK pathway. [score:3]
S9 Fig Indicated pUNO KRAS over expression plasmids and miR-181a mimics were transfected simultaneously into HEK293T cells for 48 hours. [score:3]
Our data shows that differentiation in keratinocytes at large increases miR-181a expression, suggesting a role for miR-181a in a common pathway of differentiation, and that removing miR-181a is critical for the transition of keratinocytes into SCC. [score:3]
Additionally, overexpressed KRAS rescued miR-181a mimics -induced effects in SCC13 to a large part (Fig 4F). [score:3]
miR-181a mediates its tumor suppressive role through KRAS which signals via the MAPK pathway. [score:3]
A smaller part of the data on miR-181a, however, identifies miR-181a as a tumor suppressor in some cancers of the brain and the hematopoietic lineage [20– 22]. [score:3]
An additional conformation was done in SCC13 cells transduced with a stable miR-181a over expression plasmid (ki miR-181a). [score:3]
miR-181a is downregulated in SCC compared to normal skin. [score:3]
Maintained miR-181a expression in tumors with Tet-On miR-181a and in vitro cell cultures confirmed a robust miRNA induction by doxycycline activation (S6D Fig and S7A Fig). [score:3]
Low levels of miR-181a result in increased cellular viability in vivo and in vitroDecreased cellular presence of miRNAs presumably permits increased activity of their downstream targets and might in turn promote tumor formation. [score:3]
We thus studied expression and functionality of miR-181a in primary patient-derived and various cell lines representing normal skin and SCC. [score:3]
S3 Fig Primary keratinocytes and HaCaT cells were transfected with miR-181a inhibitors or control sequence and seeded into Petri dishes. [score:3]
As expected, these cells exhibited lower viability compared to control cells, while their miR-181a levels were strongly upregulated (Fig 2C and Figure B in S7 Fig). [score:3]
Our data show a tumor-suppressive role of miR-181a in the context of keratinocyte cancer with an impact on SCC proliferation. [score:3]
miRNA (ki miR-181a) for stable miRNA overexpression (C) or transfected with miRNA mimics for 48 hours (D + E). [score:3]
Hsa-miR-181a-5p expression and effects on cell proliferation in gastric cancer. [score:3]
Furthermore, the protein levels of Ras family members HRAS and RhoA were not affected by miR-181a modulation further underlining KRAS as miR-181a’s functional target in SCC. [score:3]
Therefore, we established a tetracycline-inducible miR-181a over expression mo del based on pTRIPZ Tet-On plasmid and SCC13 cells (Tet-On miR-181a). [score:3]
Reducing miR-181a’s target KRAS, using siRNA, abolished this effect (Fig 4B). [score:3]
This system allowed us to perceive the miR-181a- KRAS interaction above the background of endogenous KRAS expression. [score:3]
miR-181a over expressing cells, on the other hand, grew slower and reach termination criteria at later time points (Fig 2A and Figures A-C in S6 Fig). [score:3]
Following the observation that miR-181a in keratinocytes correlated negatively with KRAS expression and with cellular viability, we were interested in a functional role of KRAS in keratinocytes. [score:3]
However, only the cells containing the wild type KRAS 3’UTR were vulnerable to miR-181a mimic transfection resulting in reduced KRAS protein translation and thus in reduced cellular viability (Fig 3F). [score:3]
0185028.g002 Fig 2(A) SCC13 was transduced with pTRIPZ for inducible miRNA overexpression (SCC13 Tet-ON miR-181a) and injected subcutaneously into nude mice. [score:3]
The panel in the left illustrates the three main miR-181a binding sites in KRAS 3’UTR and the according mutations. [score:2]
Contrary to miR-181a knockdown, reestablishing miR-181a levels in SCC attenuates cancer both in vivo and in vitro. [score:2]
miR-181a hair pin sequence plus 210 base pairs of the flanking region in either direction and the according Gibson Assembly adapters were synthesized (Integrated DNA Technologies). [score:2]
Indeed, HaCaT cells harboring a stable miR-181a knockdown (kd miR-181a) and injected subcutaneously into nude mice had pronounced cyst formation capability while the respective control cells hardly formed a cyst (Fig 1B and S4A and S4B Fig). [score:2]
Fittingly, transfection of synthetic miRNAs (miRNA mimics) into cancer cells or stable miR-181a knock in led to decreased cellular viability accompanied by cell rounding and detachment (Fig 2D and Figure B in S8 Fig). [score:2]
Up regulation of miR-181a leads to decreased tumor growth in vivo. [score:2]
On the contrary, knockdown of miR-181a did not induce proliferation in primary SCC cells or SCC13 in which miR-181a was already lower, indicating that a 3-5-fold reduction in miR-181a was already sufficient to confer the maximum induction of proliferation (Fig 1F). [score:2]
miR-181a levels of HaCaT cells harboring stable miR-181a knock down. [score:2]
Aiming to address the question whether there is a direct functional connection between miR-181a and KRAS we transfected HaCaT kd miR-181a with siRNA against KRAS or control siRNA. [score:2]
In summary, our data singles out miR-181a as a critical determinant in keratinocyte differentiation and control of SCC development. [score:2]
As expected, HaCaT cells harboring a stable miR-181a knock-down proliferated faster when only transfected with control siRNA, similarly as observed before. [score:2]
Since SCC can be characterized by disturbed differentiation, we speculated that miR-181a expression might be regulated during this process. [score:2]
Our data suggest that such posttranscriptional control of KRAS by miR-181a may be critical in SCC development. [score:2]
Based on known interaction of miR181a with KRAS [30], our study identified a direct interaction of the proto-oncogene KRAS with miR-181a in SCC confirming findings from other organ tumors [15, 26]. [score:2]
miR-181a knock down promotes cyst formation in vivo. [score:2]
We thus support the previously found interaction between miR-181a and KRAS 3’UTR and directly link its main functional consequence to SCC, namely a change in cellular viability. [score:2]
miR-181a levels of SCC13 with artificial miR-181a up regulation. [score:2]
Up regulation of miR-181a leads to decreased viability in cancer cells. [score:2]
miR-181a up regulation induces apoptosis in SCC13. [score:2]
miR-181a showed low abundance among SCC confirmed by TaqMan qPCR (Fig 1A). [score:1]
Initially, we treated HaCaT cells using epidermal growth factor (EGF) to trigger MAPK signaling, resulting in enhanced proliferation rates similarly as observed in HaCaT kd miR-181a (Fig 4C). [score:1]
Cells harboring the wild type KRAS ‘3UTR had reduced KRAS protein after miR-181a mimics treatment while cells harboring a mutated 3’UTR were less responsive to miR-181a mimics (S9 Fig). [score:1]
Endogenous miR-181a levels of cell lines used in the present study. [score:1]
4 × 10 [6] HaCaT kd miR-181a, 1 × 10 [6] of SCC13 Tet-On miR-181a, or the according number of control cells were suspended in PBS and injected subcutaneously after mice accommodated to their new habitat for 10–14 days. [score:1]
Next we aimed to unravel the molecular mechanism laying behind miR-181a’s negative effect on cellular viability. [score:1]
miR-181a modulation does not lead to changes in mRNA/protein levels of Ras family members HRAS and RhoA. [score:1]
Low levels of miR-181a result in increased cellular viability in vivo and in vitro. [score:1]
S8 Fig(A) SCC13 cells were transfected with miR-181a mimics for 48 hours. [score:1]
Cells were transfected with miR-181a mimics for 48 hours and seeded into petri dishes. [score:1]
S7 Fig (A) SCC13 Tet-On miR-181a were incubated with 500nM doxycycline for 48 hours. [score:1]
In addition, Tet-On miR-181a showed decreased viability when doxycycline was added to the medium (Fig 2B). [score:1]
During differentiation miR-181a levels went up (S10C Fig and S11 Fig). [score:1]
We thus believe that miR-181a is an important mediator of differentiation in keratinocytes. [score:1]
Low abundance of miR-181a is found in patient derived SCC specimen compared to normal skin and down regulation of miR-181a leads to increased viability in healthy keratinocytes. [score:1]
The effect size on SCC in our study seems larger, suggesting therapeutic potential for miR-181a against SCC. [score:1]
Comparing these matured cells with proliferating ones revealed increased miR-181a levels accompanied by clearly elevated differentiation markers in the differentiated subset (Figure A in S10 Fig). [score:1]
These discrepancies on the function of miR-181a in different tumors, highlight miR-181a’s context specificity depending on the environment. [score:1]
miR-181a levels increased during keratinocyte differentiation. [score:1]
Manipulating miR-181a in vivo demonstrates the potential of miR-181a as a potential therapeutic miRNA in SCC. [score:1]
The proto-oncogene KRAS plays a critical role in a variety of malignancies and the interplay of miR-181a and KRAS has been described in other epithelial cancers [15]. [score:1]
S6 Fig (A) SCC13 Tet-ON miR-181a were injected subcutaneously into nude mice. [score:1]
High levels of miR-181a result in decelerated cellular viability in vivo and in vitro. [score:1]
The published body of evidence on miR-181a mainly shows a carcinogenic role for miR-181a such as in [16– 19], making miR-181a a so-called `oncomir´. [score:1]
In our study we have identified miR-181a as a critical factor in SCC progression. [score:1]
miR-181a levels were determined via TaqMan qPCR. [score:1]
miR-181a levels of HaCaT kd miR-181a were determined via TaqMan qPCR. [score:1]
miRNA (kd miR-181a / ki miR-181a) for stable miRNA modulation (B and D). [score:1]
SCC13 cells, transfected with miR-181a mimics, were stained using BD Pharmigen’s FITC Annexin V Apoptosis Detection Kit I following the manufacturer’s protocol. [score:1]
miR-181a levels are increased during keratinocyte differentiation. [score:1]
A 3’UTR containing mutated miR-181a binding sites served as a control (Fig 3E). [score:1]
miR-181a levels of various cell lines were determined via TaqMan qPCR. [score:1]
[1 to 20 of 91 sentences]
10
[+] score: 212
We also find that similar to induction of miR-181a, knockdown of IDH1 analogously down-regulates the expression levels of lipid synthesis-related genes and up-regulates expression levels of β-oxidation- and cholesterol transport-related genes, thereby inhibiting lipid accumulation. [score:14]
Correlated with the inhibitory effect of miR-181a on IDH1 expression, both mimics -mediated transient expression and transgenic expression of miR-181a resulted in a dramatic decrease in IDH1 enzymatic activity (Figures 3F and 3G). [score:9]
To determine whether miR-181a down-regulates IDH1 expression, miR-181a mimics or inhibitors were utilized. [score:8]
Overexpression of miR-181a decreases, whereas inhibition of miR-181a increases IDH1 expression levels and enzymatic activity. [score:7]
MiR-181a directly targets IDH1 and inhibits its expression. [score:7]
The sequences for control and miR-181a inhibitors were as follows: control inhibitor, 5′-CAGUACUUUUGUAGUACAA-3′ and miR-181 inhibitor, 5′-ACUCACCGACAGCGUUGAAUGUU-3′. [score:7]
To further understand how miR-181a inhibits lipid accumulation, we searched the TargetScan database for the potential targets of miR-181a. [score:7]
IDH1 knockdown resulted in the decreased expression of lipid synthesis-related genes and the increased expression of β-oxidation- and cholesterol transport-related genes (Figure 4A), which recapitulated the phenotype of miR-181a induction. [score:6]
The findings that IDH1 is a direct target of miR-181 and the opposite phenotypes displayed by miR-181a TG and IDH1 TG mice led us to test the possibility that miR-181a may regulate lipid metabolism through IDH1. [score:5]
As a control, overexpression of miR-181a decreased, whereas reduced expression of miR-181a increased protein levels of Acly (Figure 3D). [score:5]
Moreover, mice treated with miR-181a inhibitor exhibited increased body weight than control inhibitor -treated mice under both normal diet and HFD treatment conditions (Supplementary Figure S1C), and this phenomenon was not caused by changes in food intake (Supplementary Figure S1D). [score:5]
Together, these data suggest that miR-181a inhibits lipid accumulation via inhibition of lipid synthesis and stimulation of β-oxidation and cholesterol transport. [score:5]
Given the important role of miR-181a in regulating lipid metabolism, it would be interesting to determine whether and how expression of miR-181a is regulated under various lipogenic conditions in the future. [score:5]
The sequences for miRNA-181a mimics and inhibitors were as follows: miR-181a mimics, sense 5′-AACAUUCAACGCUGUCGGUGAGU-3′ and antisense 5′-UCACCGACAGCGUUGAAUGUUUU-3′; and miR-181a inhibitor, 5′-ACUCACCGACAGCGUUGAAUGUU-3′. [score:5]
MiR-181a down-regulates triglycerides and total cholesterol levels in vivoWe have recently characterized the inhibitory function of miR-181 in the regulation of embryo implantation in mice (unpublished data). [score:5]
In contrast, inhibitors-decreased expression of miR-181a greatly increased the enzymatic activity of IDH1 (Figure 3H). [score:5]
The results showed that treatment of miR-181a mimics led to the decreased expression of lipid synthesis-related genes and the increased expression of β-oxidation- and cholesterol transport-related genes in MEF cells treated with and without oleic acids (Figures 2B and 2C). [score:5]
In addition, induced expression of miR-181a by its mimics or decreased expression of IDH1 by its shRNA markedly reduced levels of TGs and T-CHO in MEF cells (Figure 4B). [score:5]
To knockdown miR-181a in mice, six-week old miR-181 WT male mice were given administration of nanoparticles packed with either control or miR-181a inhibitors four times at one-week intervals 33. [score:4]
To explore the molecular mechanism whereby miR-181a regulates lipid metabolism, we first performed real-time RT-PCR analysis to examine expression levels of the genes involved in lipid synthesis, β-oxidation, or cholesterol transport in livers of miR-181a TG and WT mice. [score:4]
IDH1 is a direct target gene of miR-181a. [score:4]
These combined data suggest that IDH1 is a direct target of miR-181a. [score:4]
By using ORO and BODIPY staining, we further showed that knockdown of IDH1 in MEF cells reversed the increased levels of lipid levels by miR-181a inhibitors treatment, and induction of IDH1 recovered miR-181a-decreased lipid levels in MEF cells (Figure 4H). [score:4]
Treatment of miR-181a mimics resulted in the reduced protein levels of IDH1 but not its homologous protein IDH2, whereas miR-181a inhibitors showed the opposite effect in MEF cells (Figure 3D). [score:3]
miR-181a inhibits lipid accumulation. [score:3]
We next determined the effect of miR-181a inhibitors on TGs and T-CHO levels in vivo. [score:3]
miR-181a inhibits lipid accumulation through IDH1. [score:3]
MiR-181a WT mice were injected with either miR-181a or control inhibitor, and one month later, blood and liver lysates were extracted, TGs and T-CHO were then examined. [score:3]
MiR-181a down-regulates triglycerides and total cholesterol levels in vivo. [score:3]
Therefore, our data suggest that miR-181a may be a potential therapeutic target for lipid metabolism disorders such as hyperlipidemia and obesity. [score:3]
Induction of miR-181a indeed reduced the luciferase expression from the wild-type but not the mutant reporter plasmid (Figure 3C). [score:3]
Sixteen candidate genes were identified using this method (Supplementary Figure S4A), among which the IDH1 gene 3′ untranslated region (3′-UTR) contains one putative site (UGAAUGU) that matched to the miR-181a seed region (Figure 3A). [score:3]
We next determined the effect of miR-181a on these genes expression in MEF cells treated with or without oleic acids (OA), a well known stimulator of TGs synthesis. [score:3]
Transgenic expression of miR-181a decreased the levels of the genes involved in lipid synthesis, including Acaca, Acacb, Srebf1, Fasn1 and Acly (Figure 2A). [score:3]
IDH1 TG mice exhibited abnormal lipid metabolism 19, which is opposite to the phenotype of miR-181a TG mice, indicating that miR-181a may function through targeting IDH1. [score:3]
More importantly, we show that Therefore, these data suggest that the miR-181a-IDH1 axis plays an important role in the regulation of lipid metabolism. [score:2]
To determine whether miR-181a is involved in the regulation of lipid metabolism, six-week old miR-181 TG and WT male mice were fed with high fat diet (HFD) for 10 weeks. [score:2]
The results showed that mice injected with miR-181a inhibitors exhibited a great increase in TGs and T-CHO levels when compared with control group (Figure 1E). [score:2]
These data indicate that miR-181a regulates lipid metabolism through IDH1. [score:2]
Therefore, it is not surprised to see that miR-181a is involved in the regulation of various cellular functions. [score:2]
To explore whether miR-181a is involved in the regulation of lipid metabolism, both miR-181 TG and WT mice were fed with high fat diet (HFD), and after 10 weeks of feeding, miR-181a TG mice exhibited smaller size and lower body weight than miR-181a WT mice (Figures 1A and 1B) while these mice showed no obvious differences in food intake (Supplementary Figure S1B). [score:2]
Here we provide solid evidence demonstrating the critical function of miR-181a in regulating lipid metabolism. [score:2]
These data strongly suggest miR-181a as a novel regulator of lipid metabolism. [score:2]
MiR-181a mimics and inhibitors were purchase from Genepharma Company (Shanghai, China). [score:2]
MiR-181a inhibits lipid accumulation. [score:2]
Treatment of either miR-181a -overexpressing MEF cells or miR-181a TG mice-derived TTFs with OA showed a much faster decrease in both TGs and T-CHO levels compared to control cells (Figure 2E and supplementary Figure S3). [score:2]
We have recently characterized the inhibitory function of miR-181 in the regulation of embryo implantation in mice (unpublished data). [score:2]
To investigate whether miR-181a could down-regulate levels of triglycerides (TGs) and total cholesterol (T-CHO), liver lysates and blood from miR-181a TG and WT mice were analyzed for TGs and T-CHO contents. [score:2]
It is possible that miR-181a has diverse functions in different cellular context. [score:1]
Correlated with more body weight reduction of miR-181a TG mice under HFD treatment, TGs and T-CHO levels were more significantly decreased in miR-181a TG mice when fed with HFD (Figure 1D). [score:1]
The pCAG-miR-181a plasmids were injected into the zygote pronucleus after they were linearized by I-CEUI. [score:1]
Similar data were also obtained in tail-tip fibroblasts (TTFs) from miR-181a TG mice (Supplementary Figures S2A and S2B). [score:1]
miR-181a reduces triglycerides and total cholesterol levels in mice. [score:1]
Additionally, miR-181a inhibited lipid levels in MEF cells after OA treatment, as evaluated by Oil Red O (ORO) staining (Figure 2D). [score:1]
Similar results were also obtained in various tissues such as heart, lung, liver, spleen and kidney from miR-181a TG mice (Figure 3E). [score:1]
In this study, we also observe that miR-181a TG mice exhibit both smaller size and lower body weight than control mice, partially due to decreased levels of triglycerides and total cholesterol. [score:1]
The representative images of miR-181a TG and WT mice were then taken and shown. [score:1]
Conversely, the levels of the genes involved in β-oxidation and cholesterol transport were increased upon miR-181a induction, such as AbcG1, Abcg5, Apoe, Cpt1a, Crot, Abca1, Apoa1 and Hadhb (Figure 2A). [score:1]
To isolate tail-tip fibroblasts, ~2 cm length of tail-tip was cut from two-month-old miR-181a transgenic or wild-type male mice. [score:1]
MiR-181a regulates lipid metabolism through IDH1. [score:1]
Intriguingly, we noticed that miR-181a transgenic (TG) mice exhibited relatively smaller size and lower body weight than miR-181a wild type (WT) mice under normal maintaining conditions (Figure 1A and supplementary Figure S1A). [score:1]
also revealed that treatment of miR-181a mimics greatly decreased the number of lipid droplets in MEF cells under OA treatment conditions (Figure 2F). [score:1]
Taken together, these findings demonstrate the physiological function of miR-181a in decreasing TGs and T-CHO levels. [score:1]
[1 to 20 of 63 sentences]
11
[+] score: 207
Putative targets of nine differentially expressed miRNAs that were validated by RT-qPCR (upregulated: mmu-miR-151-3p, mmu-miR-155-5p, mmu-miR-181a-5p, and mmu-miR-328-3p; and downregulated: mmu-miR-21a-5p, mmu-miR-98-5p, mmu-miR-145a-5p, mmu-miR-146b-5p, and mmu-miR-374b-5p) were obtained from the miRWalk database. [score:11]
On the other hand, BMDMs were transfected with small, chemically modified single-stranded RNA molecules designed to specifically bind to and inhibit endogenous mmu-miR181a-5p or mmu-miR-21a-5p (inhibitors) and enable miRNA functional analysis by downregulation of miRNA activity (mirVana™ miRNA mimics or inhibitors—Thermo Fischer Scientific, MA, USA). [score:10]
MyD88 Plays an Important Role in Regulating the Expression of miRNAs During B. abortus InfectionSince innate immunity is the first line of host immune defense against bacterial pathogens and our group has previously demonstrated the important role of MyD88 adaptor molecule during B. abortus infection (25), we evaluated the influence of MyD88 during differential expression of miRNAs upregulated (mmu-miR-181a-5p and mmu-miR-328-3p) or downregulated (mmu-miR-21a-5p, mmu-miR-98-5p, and mmu-miR-146b-5p) by infection. [score:10]
According to the expression levels and fold-change comparing Brucella-infected versus NI libraries, we selected four miRNAs that were upregulated (mmu-miR-151-3p, mmu-miR-155-5p, mmu-miR-181a-5p, and mmu-miR-328-3p) and five miRNAs that were downregulated (mmu-miR-21a-5p, mmu-miR-98-5p, mmu-miR-145a-5p, mmu-miR-146b-5p, and mmu-miR-374b-5p) for validation and further analysis. [score:9]
Differential expression of validated upregulated miRNAs (A) mmu-miR-181a-5p and (B) mmu-miR-328-3p or validated downregulated miRNAs (C) mmu-miR-21a-5p, (D) mmu-miR-98-5p, and (E) mmu-miR-146b-5p were assessed by real-time PCR and normalized to SNORD61 in bone marrow-derived macrophages from C57BL/6 and MyD88 KO mice. [score:9]
We observed a dependence of MyD88 in upregulation of mmu-miR-181a-5p, while it was not observed differences of upregulation of mmu-miR-328-3p in the absence of MyD88. [score:7]
Validated upregulated miRNAs (F) mmu-miR-181a-5p and (G) mmu-miR-328-3p or validated downregulated miRNAs (H) mmu-miR-21a-5p, (I) mmu-miR-98-5p, and (J) mmu-miR-146b-5p were also assessed by real-time PCR in spleens from C57BL/6 and MyD88 KO mice. [score:7]
Furthermore, analysis of MyD88 regulation of miRNAs expression ex vivo in mouse spleens revealed that among upregulated miRNAs, only mmu-miR-181a-5p shows the same profile in macrophages and ex vivo. [score:7]
For further validation, we chose four upregulated (mmu-miR-151-3p, mmu-miR-155-5p, mmu-miR-181a-5p, and mmu-miR-328-3p) and five downregulated (mmu-miR-21a-5p, mmu-miR-98-5p, mmu-miR-145a-5p, mmu-miR-146b-5p, and mmu-miR-374b-5p) miRNAs (Table S6 in) in infected samples by real-time PCR in macrophages. [score:7]
We observed a dependence of MyD88 in upregulation of mmu-miR-181a-5p (Figure 5A), while it was not observed differences of upregulation of mmu-miR-328-3p in the absence of MyD88 (Figure 5B). [score:7]
The intracellular bacteria B. abortus enters the host cell and upregulates miR-181a-5p and downregulates miR-21-5p. [score:7]
Since innate immunity is the first line of host immune defense against bacterial pathogens and our group has previously demonstrated the important role of MyD88 adaptor molecule during B. abortus infection (25), we evaluated the influence of MyD88 during differential expression of miRNAs upregulated (mmu-miR-181a-5p and mmu-miR-328-3p) or downregulated (mmu-miR-21a-5p, mmu-miR-98-5p, and mmu-miR-146b-5p) by infection. [score:7]
Recently, Luo et al. (29) have identified that B. suis upregulates miR-146a, miR-181a, miR-181b, and miR-301a-3p leading to reduced TNF-α expression in Raw264.7 cells. [score:6]
Figure 6TNF-α expression is modulated by mmu-miR-181a-5p, while IL-10 gene expression is regulated by mmu-miR-21a-5p during Brucella abortus infection. [score:6]
miR-181a-5p mimic diminished TNF-α expression whereas miRNA inhibitor increased TNF-α transcripts. [score:5]
Among upregulated miRNAs, only mmu-miR-181a-5p showed the same profile of MyD88 regulation in vitro and ex vivo (Figure 5F). [score:5]
Therefore, we tested the effect of miR-181a-5p mimic or inhibitor in TNF-α expression during Brucella-infected BMDMs. [score:5]
Second, mimics and inhibitors transfection for mmu-miR-181a-5p (C) or mmu-miR-21a-5p (D) showed increase or inhibition of specific miRNAs in BMDMs. [score:5]
Therefore, we decided to search for GBP genes as potential targets for miR-181a-5p or miR-21a-5p regulation. [score:4]
In summary, the findings present here provide evidences that miR-181a-5p regulates TNF-α and miR-21a-5p influences IL-10 expression during B. abortus infection (Figure 8). [score:4]
In Vitro Evaluation of TNF-α, IL-10, and GBP5 Targets for Selected miRNAsTo evaluate putative targets of selected miRNAs, BMDMs were transfected for 24 h with small, chemically modified double-stranded RNAs that mimic endogenous mmu-miR-181a-5p or mmu-miR-21a-5p (mimics) to enable miRNAs functional analysis by upregulation of their activities. [score:4]
To evaluate putative targets of selected miRNAs, BMDMs were transfected for 24 h with small, chemically modified double-stranded RNAs that mimic endogenous mmu-miR-181a-5p or mmu-miR-21a-5p (mimics) to enable miRNAs functional analysis by upregulation of their activities. [score:4]
miR-181a-5p regulates TNF-α and miR-21a-5p influences IL-10 expression during bacterial infection. [score:4]
Each of these miRNAs, mmu-miR-181a-5p and mmu-miR-21a-5p, could regulate several mRNA targets that could affect the host immune responses to B. abortus (Table S3 in). [score:4]
These results corroborate the ability of miR-181a-5p to downregulate TNF-α in Brucella-infected BMDMs. [score:4]
Four miRNAs were validated by real-time PCR as upregulated: (A) mmu-miR-151-3p, (B) mmu-miR-155-5p, (C) mmu-miR-181a-5p, and (D) mmu-miR-328-3p. [score:4]
More recently, Luo et al. (29) have demonstrated that Brucella suis upregulated miR-181a that correlated with decreased TNF-α in Raw264.7 macrophage cell line. [score:4]
These data suggest that upregulation of miR-181a-5p prevents further increase in TNF-α levels during B. abortus infection. [score:4]
miR-181a-5p and miR-21a-5p Regulate Important Immune Pathways During B. abortus Infectionmmu-miR-181a-5p and mmu-miR-21a-5p showed differential expression during B. abortus infection in vivo and in vitro in a MyD88 -dependent manner. [score:4]
To further investigate whether miR-181a-5p can influence TNF-α expression in BMDMs during B. abortus infection, we transfected macrophages with the specific mimic or inhibitor for mmu-miR-181a-5p before infection. [score:3]
First, we determined time dependent of mmu-miR-181a-5p (A) or mmu-miR-21a-5p (B) expression during B. abortus infection in bone marrow-derived macrophages (BMDMs). [score:3]
BMDMs transfected with mimic or inhibitor for mmu-miR-181a-5p was infected with B. abortus and the level of TNF-α mRNA was determined by qPCR (F). [score:3]
By contrast, when the miR-181a-5p inhibitor was transfected in BMDMs, we observed an increase in TNF-α mRNA levels. [score:3]
First, we analyzed the kinetics of expression for mmu-miR-181a-5p or mmu-miR-21a-5p during B. abortus infection in macrophages. [score:3]
mmu-miR-181a-5p and mmu-miR-21a-5p showed differential expression during B. abortus infection in vivo and in vitro in a MyD88 -dependent manner. [score:3]
We found that GBP2, GBP4, GBP5, and GBP8 are putative targets for miR-21a-5p but not for miR-181a-5p. [score:3]
miR-181a-5p and miR-21a-5p Regulate Important Immune Pathways During B. abortus Infection. [score:2]
mmu-miR-181a-5p was reported to be important in the regulation of NF-κB activation and TNF-α production (28). [score:2]
Nevertheless, we observed a slight reduction in mmu-miR-181a-5p expression at 3 h when compared with 1 or 6 h post-infection. [score:2]
Figure 8Schematic mo del of the role of miR-181a-5p and miR-21a-5p during Brucella abortus infection. [score:1]
As observed in Figure 6F when the miR-181a-5p mimic was used, there was a decrease in TNF-α transcripts in B. abortus-infected macrophages. [score:1]
To characterize the role of these miRNAs during B. abortus infection, we transfected macrophages with miRNA mimics or inhibitors for mmu-miR-181a-5p or mmu-miR-21a-5p. [score:1]
C57BL/6 mice were infected intraperitoneally at 1, 3, or 6 days post-infection, and the relative expression of miRNAs: (A) mmu-miR-151-3p, (B) mmu-miR-155-5p, (C) mmu-miR-181a-5p, (D) mmu-miR-328-3p, (E) mmu-miR-21a-5p, (F) mmu-miR-98-5p, (G) mmu-miR-145a-3p, (H) mmu-miR-146b-5p, and (I) mmu-miR-374b-5p were evaluated in mouse spleens. [score:1]
In addition, according to Dan et al. (40), stability of TNF-α mRNA was influenced by miR-181a-5p. [score:1]
We carried out further functional analysis using mmu-miR-181a-5p and mmu-miR-21a-5p. [score:1]
[1 to 20 of 45 sentences]
12
[+] score: 142
miR-181 overexpression down-regulates endogenous MADD expression. [score:8]
Studies on human glioma and glioma cell lines have shown decreased expression of miR-181 family members together with apoptosis induction and tumor growth inhibition following miRNA overexpression [41, 42]. [score:7]
These findings show that miR-181a and miR-181b can suppress the endogenous levels of DENN/MADD while only miR-181b inhibitor can increase DENN/MADD expression. [score:7]
ANOVA, Tukey post hoc (**p≤0.01 relative to negative control) We next studied the effect of miR-181a and miR-181b expression on endogenous mRNA expression and protein level of DENN/MADD using L929 mouse fibroblast cell line. [score:5]
Bioinformatics analysis using miRNA target prediction algorithms (including TargetScan) has shown that the 3’ UTR of the DENN/MADD molecule might include a potential binding site for miR-181a and miR-181b both in human and mouse. [score:5]
Transfection efficiency was assessed by expression analysis of microRNAs in transfected cells with miR-181a and miR-181b and also by monitoring green fluorescent protein (GFP) expression using fluorescence microscope. [score:5]
Aberrant expression of miR-181 in neurodegenerative disease like multiple sclerosis has also been reported in previous studies [15, 17]. [score:5]
Additionally, extensive increase of miR-181a and miR-181b expression levels confirmed efficiency of microRNAs over expression (S2B and S2C Fig). [score:5]
We next analyzed the impact of enhanced miR-181a and miR-181b expression on TNF -induced mitochondrial membrane potential alterations, Bcl2 family member expression levels and eventually cell death in L929 cells exposed to TNF-α. [score:5]
miR-181 upregulation enhances TNF -induced apoptosis. [score:4]
Among the microRNAs which are predicted to target DENN/MADD, we focused on miR-181 family members because of their implication in regulating apoptosis pathways and their broad conservation across species. [score:4]
Considering the role of Bcl2 family members in regulating the mitochondrial membrane potential, we next analyzed the expression of pro-apoptotic Bax and anti-apoptotic Bcl-2 molecules following miR-181a and miR-181b transfection. [score:4]
Quantitative analysis of Bax and Bcl-2 mRNA expression was also performed post TNF- α treatment (30 minutes) using Real time PCR A) TMRE histogram of untreated and TNF-α treated cells B) Representative flow cytometry plots of transfected cells with miRNA mimics following TNF-α exposure C) Geo mean fluorescent intensity of transfected cells with miR-181a and miR-181b mimics and negative control. [score:3]
B) miR-181a, C) miR-181b expression levels after transfection with miR-181a and miR-181b mimics are shown. [score:3]
0174368.g003 Fig 3 L929 cells were transfected with miR-181a, miR-181b mimics, inhibitors and negative control (50nM) for 24 or 48 hours. [score:3]
miRNA transfection studies were then carried out to determine the effect of miR-181a and miR-181b overexpression on endogenous DENN/MADD levels in L929 cells, a murine fibroblast cell line which is sensitive to TNF -induced apoptosis. [score:3]
In silico analysis of target mRNAs for miR-181a, miR-181b. [score:3]
B) The miR-181a and miR-181b sequence alignments with their predicted target site in 3’UTR of MADD mRNA are presented. [score:3]
DENN/MADD transcripts are targeted by miR-181. [score:3]
Other studies on astrocytes have shown increased resistance to apoptosis following miR-181 reduction likely through altered expression of Bcl-2 family members. [score:3]
To examine whether miR-181a or miR-181b expression might affect mitochondrial membrane potential following TNF treatment, we performed flow cytometric analysis on L929 cells transfected with miRNA or control sequences using TMRE dye, which labels active mitochondria inside the cells. [score:3]
Gene ontology analysis on the putative targets of miR-181 also indicates the involvement of this microRNA in cellular death processes (S4 Fig). [score:3]
Protein levels of DENN/MADD changed significantly in transfected cells, decreasing in the presence of miR-181a and miR -181b mimics and increasing after transfection with miR-181b inhibitor (Fig 3B). [score:3]
miRNA-181a and 181b mimics and inhibitors as well as negative control sequence were purchased from Qiagen. [score:3]
D) Bax/Bcl-2 ratio following overexpression of miR-181a and miR-181b. [score:3]
0174368.g005 Fig 5Cultured L929 cells transfected with miR-181a and miR-181b mimics, inhibitors or negative control sequences (50nM) were treated with TNF-α (50 ng/mL) for 12 h. A) Representative flow cytometry graphs after double staining with Annexin V-FITC and propidium iodide. [score:3]
Suppression of DENN/MADD could explain the resulting enhancement in TNF mediated apoptosis, however, the possibility remains that miR-181 might also affect other apoptosis mediators downstream of TNF receptor and its adaptor molecules. [score:3]
Cultured L929 cells transfected with miR-181a and miR-181b mimics, inhibitors or negative control sequences (50nM) were treated with TNF-α (50 ng/mL) for 12 h. A) Representative flow cytometry graphs after double staining with Annexin V-FITC and propidium iodide. [score:3]
L929 cells were transfected with miR-181a or miR-181b mimics or inhibitors sequences as described in Materials and Methods. [score:3]
miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. [score:3]
We finally investigated whether overexpression or inhibition of miR-181a or miR-181b might affect TNF-α induced apoptosis in L929 cells. [score:3]
L929 cells were transfected with miR-181a, miR-181b mimics, inhibitors and negative control (50nM) for 24 or 48 hours. [score:3]
We also provide experimental findings indicating alteration of mitochondrial membrane potential in L929 cells following miR-181 mimic transfection. [score:1]
miR-181 repress DENN/MADD mRNA levels in L929 cells. [score:1]
Bioinformatics analyses show the conserved sequence of miR-181a and miR-181b between human and mouse and a potential conserved binding site on the 3’ UTR of DENN/MADD (Fig 1). [score:1]
Following transfection of L929 cells with miR-181a, miR-181b mimics and negative control miRNA mimic (50nM) for 24 hours, cells were treated by TNF-α (50ng/ml) for 3 hours and then stained with TMRE. [score:1]
miR-181 family of miRNAs is a broadly conserved group of miRNAs and its members have been revealed to influence different aspects of cell biology, including cell proliferation, differentiation and death [18– 23]. [score:1]
The effect did not reach statistical significance for miR-181a. [score:1]
miR-181a and miR-181b mimicsand negative control were purchased from Qiagen. [score:1]
In this study, we explored the potential interactions between miR-181a or miR-181b miRNA species with DENN/MADD adaptor molecule, and their subsequent effects on TNF -mediated cell death. [score:1]
0174368.g004 Fig 4Following transfection of L929 cells with miR-181a, miR-181b mimics and negative control miRNA mimic (50nM) for 24 hours, cells were treated by TNF-α (50ng/ml) for 3 hours and then stained with TMRE. [score:1]
Co-transfection of HEK293T cells with vectors encoding the 3'UTR of DENN/MADD ligated to the Renilla luciferase with microRNA mimic sequences and negative control sequence showed significant decrease of luciferase activity in cells transfected with miR-181 b mimic sequences. [score:1]
Psicheck vector containing the 3'UTR of MADD mRNA was co -transfected along with miR-181a or miR-181b mimic sequences or negative control into HEK293T cells. [score:1]
Similar effect was not observed for cells transfected with miR-181a species (Fig 5B). [score:1]
In the current study, we show experimental evidence pointing to the regulation of DENN/MADD by miRNA-181 through luciferase assays and transfection experiments. [score:1]
Homology between miRNA binding site at 3’UTR of MADD between human and mouse D) miR-181a and miR-181b mature miRNA sequences homology in human and mouse. [score:1]
While Bax/Bcl-2 ratio was significantly increased following miR-181b transfection, the ratio did not show a significant difference for miR-181a transfection (Fig 4D). [score:1]
Melting curve plots for actin, DENN/MADD, Bcl-2, Bax, Snord68, miR-181a and miR-181b genes. [score:1]
Cells were first transfected with 50nM of oligonucleotides (including miR-181a and miR-181b mimics, anti-miR-181a and anti-miR-181b, negative control for 24 hours and then exposed to TNF-α (50ng/ml). [score:1]
Experiments were performed to verify the interaction between miR-181a or miR-181b with the 3' UTR of DENN/MADD. [score:1]
[1 to 20 of 50 sentences]
13
[+] score: 126
also demonstrate suppression of NPM2 translation by miR-181a and suggest that expression of this essential nuclear factor during early embryogenesis is potentially regulated by miR-181a. [score:8]
In this study, we report the cloning of bovine NPM2, its mRNA and protein expression during oocyte maturation and early embryonic development and the potential role of miR-181a in regulation of its expression. [score:7]
Quantification of NPM2 protein expression using densitometry (Figure 7B) confirmed that co -expression with miR-181a decreased the level of NPM2 protein (P < 0.05), indicating that translation of NPM2 is repressed by miR-181a. [score:7]
Transfection experiments showed that bovine NPM2 protein expression is reduced in Hela cells expressing miR-181a compared to control cells without miR-181a, indicating that translation of NPM2 is repressed by miR-181a. [score:6]
The inverse correlation between miR-181a and NPM2 expression during early embryogenesis further supports our hypothesis that NPM2 might be down-regulated by miR-181a. [score:6]
To test if miR-181a regulates NPM2 protein expression in the context of its native mRNA sequence, co -expression studies using a construct containing the full length bovine NPM2 cDNA and a plasmid designed to deliver bovine miR-181a were performed. [score:6]
It has also been reported that miR-181a down regulates the expression of zinc finger (ZNF) genes by targeting the sequences coding for the ZNF C2H2 domain [40]. [score:6]
Co -expression of bovine NPM2 and miRNA-181a in Hela cells was performed to determine if expression of bovine NPM2 is regulated by miRNA-181a. [score:6]
Our data suggest that expression of bovine NPM2 is temporally regulated during early embryogenesis and miR-181a may play a role in its regulation. [score:5]
The aims of this study were to clone the bovine NPM2 gene, determine its temporal expression during oocyte development and early embryogenesis, and evaluate the potential role of miRNA-181a in regulation of its expression. [score:5]
The involvement of miR-181a in regulating the expression of NPM2 supports a new role of this miRNA in early embryonic development. [score:5]
Figure 7Western blot analysis of NPM2 protein expression in Hela cells transfected with NPM2 and miR-181a expression plasmids. [score:5]
A. A representative Western blot showing suppression of NPM2 protein in cells expressing miR-181a. [score:5]
using antibodies against bovine NPM2 showed that expression of bovine NPM2 protein was reduced in cells expressing miR-181a compared to control cells without miR-181a (Figure 7A, the minor band present is all samples apparently is a non-specific signal). [score:4]
HeLa cells expressing bovine miR-181a were transfected with NPM2 plasmid (1 μg) or pcDNA3.1 vector (1 μg) using FuGene [® ]6 transfection reagent (Roche Applied Science, Indianapolis, IN) according to the manufacturer's instructions. [score:3]
Recent studies have suggested that miR-181a may function as a tumor suppressor in cancer cells [38] or a modulator of cisplatin -induced cancer cell death [39]. [score:3]
Following a drop in 2-cell stage embryos, the level of miR-181a increases again in embryos at 4-cell to 16 cell stage, a period corresponding to the time of embryonic genome activation in cattle when expression of NPM2 decreases gradually. [score:3]
Figure 6 Quantitative real-time PCR analysis of miR-181a expression in oocytes and early embryos (mean ± SEM, n = 3). [score:3]
Differences in expression of NPM2 mRNA and protein and miRNA-181a between samples were analyzed by GLM procedures of SAS with LS means (SAS 9.1.3, SAS Institute Inc. [score:3]
Stable HeLa cells expressing bovine miR-181a was generated by transfecting the cells with miRNA-181a plasmid followed by selection in G418. [score:3]
Evidence of translational silencing of bovine NPM2 by miR-181a. [score:3]
Control Hela cells not expressing bovine miR181a were also transfected with NPM2 plasmid or pcDNA3.1 vector. [score:3]
An initial experiment was conducted using real time PCR to determine if miR-181a is expressed in oocytes and early embryos. [score:3]
The plasmid designed to express the bovine miR-181a was prepared by cloning a 262 bp genomic fragment containing the pre-miR-181a into pcDNA3.1. [score:3]
Quantitative real time PCR analysis of miR-181a expression in oocytes and early stage embryos was performed as described [25]. [score:3]
of miR-181a expression in oocytes and early stage embryos was performed as described [25]. [score:3]
There appears to be an increase in miR-181 in oocytes during the transition from GV to MII stage. [score:1]
A miR-181a binding site in the 3'UTR of the NPM2 transcript was identified. [score:1]
A miR-181a binding site in bovine NPM2 3'UTR was identified (Figure 5A). [score:1]
Quantity of miR-181a was normalized to miR-125b. [score:1]
miR-181a is a conserved miRNA that has been identified in diverse species. [score:1]
Figure 5Prediction of a miR-181a binding site in the 3'-UTR of NPM2 cDNA. [score:1]
The outlined box indicates the conserved miR-181a binding site. [score:1]
As shown in Figure 6, miR-181a is present in all stages of oocytes and early embryos examined. [score:1]
A. Predicted miR-181a binding site in bovine NPM2 3'-UTR. [score:1]
[1 to 20 of 35 sentences]
14
[+] score: 124
A miRNA array analysis revealed that among the miRNAs that are downregulated during osteoblastic differentiation, miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a, and miR-181a seemed most likely to target the osteogenesis-related transcription factors Dlx5 and Msx2, acting as potential inhibitors of osteogenesis by directly targeting these osteogenesis-related transcription factors. [score:11]
Our results show that miR-124a suppressed Dlx5 expression and miR-181a suppressed Msx2 expression, and we concluded that each miRNA significantly and negatively regulates osteoblastic differentiation. [score:10]
In our preliminary experiment, transfection of anti-miR-124a and anti-miR-181a did not induce osteoblastic differentiation in mouse iPS cells (data not shown), suggesting that suppression of miR-124a and miR181a, which directly target Dlx5 and Msx2, is not sufficient to induce osteoblastic differentiation of mouse iPS cells, but that suppression of at least one miRNA of miR-10a, miR-10b, miR-9-3p and miR-19b besides miR-124a and miR-181a is required for osteoblastic differentiation. [score:8]
mir-124a Directly Targets Dlx5, and mir-181a Directly Targets Msx2. [score:7]
The overexpression of miRNAs for the 3′-UTR wild-type and mutant-type Dlx5 and Msx2 sequences in osteoblasts confirmed that these genes are direct targets of miR-124a and miR-181a. [score:6]
We focused on the 6 miRNAs, miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a, and miR-181a that were significantly downregulated during BMP-4 -induced osteoblastic differentiation, and they seemed to target the transcription factors Dlx5 and Msx2 and to be associated with osteoblast differentiation (Table 3). [score:6]
Thus, the targeting of Dlx5 and Msx2 mRNA by miR-124a and miR-181a is a key mechanism for negatively regulating these factors in order to suppress osteoblastic differentiation in non-osseous cells. [score:6]
To our knowledge, our study is the first report to show that the annealing of miR-124a and miR-181a to Dlx5 and Msx2 mRNA reduced expression levels of these genes, inhibiting osteoblastic differentiation. [score:5]
Ectopic expression of miR-124a and miR-181a significantly suppressed the luciferase activity of the wild-type 3′-UTR reporter plasmids, but not that of the mutant-type 3′-UTR reporter plasmids (Fig. 4C, 4D). [score:5]
Having found that miR-124a and miR-181a specifically and directly regulated and suppressed Dlx5 and Msx2, we investigated whether osteoblastic differentiation could be induced by suppression of miRNAs. [score:5]
The microCosm and TargetScan databases predicted that miR-124a and miR-181a would target Dlx5 and Msx2, respectively. [score:5]
Transfection of miR-181a also downregulated mRNA of Msx2 and OC, but not Runx2, ALP or OX in MC3T3-E1 cells (Fig. 4H). [score:4]
A miRNA array analysis revealed that six miRNAs including miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a and miR-181a were significantly downregulated. [score:4]
Interestingly, miR-124a and miR-181a directly target the transcription factors Dlx5 and Msx2, both of which were increased by about 80-and 30-fold, respectively. [score:4]
We introduced miR-124a and miR-181a into mouse MC3T3-E1 cells to validate the hypothesis that miR-124a and miR-181a negatively regulate osteoblastic differentiation by targeting key signal transduction factors. [score:4]
The protocol shown in Fig. 5A was used to induce osteoblastic differentiation with 6 anti-miRNAs (anti-miR-124a, anti-miR-181a, anti-miR-10a, anti-miR-10b, anti-miR-9-3p, and anti-miR-19b) targeting Msx2 or Dlx5 in iPS cells. [score:3]
Six miRNAs including miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a, and miR-181a putatively targeted Dlx5 and Msx2 mRNA (Table 3). [score:3]
In addition, transfection of miR-124a and miR-181a into mouse osteo-progenitor MC3T3-E1 cells significantly reduced expression of Dlx5, Runx2, osteocalcin and ALP, and Msx2 and osteocalcin, respectively. [score:3]
When miR-181a was overexpressed in MC3T3-E1 cells, Msx2 protein was significantly decreased (Fig. 4F). [score:3]
0043800.g003 Figure 3 (A) Time course of miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a, and miR-181a expression in differentiated iPS cells. [score:3]
Functional activity of miR-124a and miR-181a on target genes. [score:3]
This indicated that miR-124a and miR-181a directly regulate Dlx5 and Msx2 through the 3′-UTRs of their mRNAs. [score:3]
After determining that the putative binding region of mir-124a is located in the 3′-UTR of Dlx5 mRNA (Fig. 4A) and that that of mir-181a is located in the 3′-UTR of Msx2 mRNA (Fig. 4B), we investigated whether the miRNA binding regulates the putative targets by assessing miR-124a activity on Dlx5 and miR-181a activity on Msx2. [score:2]
In the present study, we demonstrate that six miRNAs including miR-10a, miR-10b, miR-19b, miR-9-3p, miR-124a and miR-181a miRNAs, especially miR-124a and miR-181a, are important regulatory factors in osteoblastic differentiation of mouse iPS cells. [score:2]
Double-stranded Ambion synthetic oligo -RNAs representing mature sequences that mimic the endogenous miR-124a and miR-181a miRNAs and negative control molecules were obtained from Life Technologies. [score:1]
MC3T3-E1 cells at 30%–50% confluence were transfected with miR-124a, miR-181a, and the miRNA negative control, of which concentrations were 50 nM, with the oligo-fectamine product manufactured by Life Technologies in accordance with the manufacturer’s instructions. [score:1]
The functional activity of miR-124a and miR-181a was specific because the miRNA-control (miR-C) did not affect wild-type or mutant constructs. [score:1]
This was performed with a reporter plasmid, into which the wild-type or mutant-type 3′-UTR binding sequences of the respective seed regions of miR-124a and miR-181a from Dlx5 and Msx2 were cloned into the 3′-UTR of a luciferase gene (Fig. 4A, 4B). [score:1]
What are functions of these 6 miRNAs including miR-124a, miR-181a, miR-10a, miR-10b, miR-9-3p, and miR-19b in osteoblastic differentiation of mouse iPS cells? [score:1]
For functional studies examining the effects of the anti-miRNAs on cell differentiation, the mouse iPS cells were transfected on day 1 and day 8 after EB formation with anti-miR-124a, anti-miR-181a, anti-miR-10a, anti-miR-10b, anti-miR-19b, and anti-miR-9-3p for 72 h, followed by culture in GMEM without osteogenic factor. [score:1]
0043800.g005 Figure 5(A) Schematic representation of the osteoblast differentiation protocol for iPS cells which were transfected with 6 anti-miRNAs including anti-miR-124a, anti-miR-181a, anti-miR-10a, anti-miR-10b, anti-miR-19b, and anti-miR-9-3p. [score:1]
Complementary pairing between miR-181a and Msx2 is shown. [score:1]
The putative binding sites of miR-124a and miR-181a are the 3′-UTRs of Dlx5 and Msx2 mRNAs, respectively. [score:1]
[1 to 20 of 33 sentences]
15
[+] score: 120
The results showed that miR-181 overexpression significantly decreased the luciferase activity, and mutations in the miR-181 binding site from the DAX-1 3′-UTR abolished this effect, suggesting that miR-181 directly inhibited DAX-1 expression by targeting the 3′-UTR (Fig. 4B). [score:11]
miR-181 targets the DAX-1 3′-untranslated region (3′-UTR) and downregulates its expression. [score:10]
They demonstrate that miR-181 overexpression causes the upregulation of AR target genes, suggesting that the proliferative role of miR-181, at least in part, may be dependent on androgen signaling. [score:8]
In the present study, elevated expression levels of AR target genes and proteins, including prostate-specific antigen, cyclin -dependent kinase (CDK) 1 and CDK2, was observed in LNCaP cells overexpressing miR-181 (Fig. 5). [score:7]
Therefore, these results suggest that miR-181 may negatively regulate DAX-1 expression at the translational level in LNCaP cells. [score:6]
In order to understand the underlying mechanism, potential targets of miR-181 were determined using TargetScan software. [score:5]
Previous studies have demonstrated that the upregulation of hepatic miR-181 promotes the growth, clonogenic survival, migration and invasion of hepatocellular carcinoma cells (7, 8). [score:4]
It was found that miR-181 is significantly upregulated in cancer tissues compared with that in normal adjacent tissues, as shown in Fig. 1. Since miR-181 was found to be upregulated in prostate cancer tissues, the effect of miR-181 on prostate cancer cell growth was investigated. [score:4]
Furthermore, in the present study DAX-1 was identified as a direct target of miR-181 in prostate cancer cells. [score:4]
miR-181 is upregulated in prostate cancer tissues. [score:4]
In addition, miR-181 overexpression was observed to promote the growth of LNCaP tumors in nude mice. [score:3]
The results suggest that miR-181 may be a potential therapeutic target for the treatment of prostate cancer in the future. [score:3]
The expression of miR-181 was analyzed in prostate cancer tissues and adjacent normal tissues using qPCR. [score:3]
DAX-1 was identified as a potential target of miR-181. [score:3]
In addition, the average tumor weight was significantly increased by miR-181 overexpression (Fig. 3C), suggesting that miR-181 may promote tumor growth in vivo. [score:3]
Furthermore, miR-181 overexpression decreased the percentage of cells in the G1 phase and increased the percentage of cells in the S phase (Fig. 2D). [score:3]
miR-181 overexpression promotes prostate cancer cell proliferation in vitro. [score:3]
Furthermore, the expression level of miR-181 is significantly associated with overall survival in hematological malignancies and may be an important clinical prognostic factor for patients with hepatocellular carcinoma (9). [score:3]
Therefore, in the present study, the expression of miR-181 was determined in prostate cancer tissues. [score:3]
A total of 2×10 [5] LNCaP cells stably expressing miR-181 or NC were injected subcutaneously into the dorsal flank of the mice. [score:3]
In the present study, it was demonstrated for the first time, to the best of our knowledge, that miR-181 overexpression may promote cell proliferation and cell-cycle progression in LNCaP cells. [score:3]
In combination, these results further confirm that DAX-1 is an important target gene of miR-181 in prostate cancer cells. [score:3]
Mutations were introduced in potential miR-181 binding sites using a site-directed mutagenesis kit (Qiagen). [score:3]
miR-181 overexpression promotes tumor growth in vivo. [score:3]
Therefore, miR-181 may be an onco-miRNA in the development of prostate cancer. [score:2]
To analyze miR-181 expression, specific stem-loop reverse transcription primers (Invitrogen Life Technologies) were used. [score:2]
The tumor size and volume were markedly increased in mice injected with LNCaP cells overexpressing miR-181 compared with those in control mice (Fig. 3A and B). [score:2]
To investigate whether DAX-1 may be directly targeted by miR-181, a luciferase reporter vector was constructed, containing the putative miR-181 binding sites within the DAX-1 3′-UTR. [score:2]
To further investigate the function of miR-181 on tumor growth in vivo, LNCaP cells with stable overexpression of miR-181 were generated and injected subcutaneously into the dorsal flank of nude mice. [score:1]
Notably, the 3′-UTR of DAX-1 mRNA was observed to contain a complementary site for the seed region of miR-181 (Fig. 4A). [score:1]
Furthermore, miR-181 mimics decreased the endogenous protein levels of DAX-1, as indicated by western blot analysis (Fig. 4C), while the DAX-1 mRNA levels remained unchanged (Fig. 4D). [score:1]
LNCaP cells were transfected with miR-181 mimics or NC (Fig. 2A). [score:1]
In conclusion, the present study provides a novel role for miR-181 in prostate cancer cell proliferation. [score:1]
Furthermore, the targets of miR-181 were investigated in order to determine the underlying mechanism of miR-181 in prostate cancer. [score:1]
Human miR-181 mimics and negative controls (NC) were purchased from Qiagen (Shanghai, China). [score:1]
[1 to 20 of 35 sentences]
16
[+] score: 110
Relative quantification revealed no compensatory up-regulation of miR181d in miR-181a/b-1 knockout thymocytes (Fig 1C). [score:5]
The rationale behind this aim was straightforward: The miR-181a/b-1 cluster is highly expressed during thymocyte development and positively regulates TCR signal strength [31, 35, 36]. [score:5]
This was not necessarily expected from the literature, since deficiency in miR-181a/b-1 lead to reduced expression of Notch target genes, including. [score:5]
We and others recently reported that the miR-181a/b-1 cluster is highly expressed during thymocyte development and positively regulates TCR signal strength [31, 34– 36]. [score:5]
The miR-181a/b-1 cluster is differentially expressed across all DN immature stages of thymocyte development. [score:4]
Consistent with the dominant expression pattern of miR-181a/b-1 in thymocytes, these findings support the idea that this miRNA is less important at early developmental stages. [score:4]
Accordingly, miR-181a/b-1 -deficient animals display severely impaired development of invariant αβ NKT cells, which are agonist-selected at the DP stage, although other cellular functions, such as metabolism or Notch signaling have also been proposed to be regulated by miR-181a/b-1 [31, 38, 39]. [score:3]
Overall, this study revealed a mild effect of miR-181a/b-1-deficiency on the γδ TCR repertoire, which is consistent with a moderate expression level of the miR-181a/b-1-cluster in DN3 thymocytes and in γδ T cells. [score:3]
0145010.g001 Fig 1(A) Expression analysis of miR-181a in FACS-sorted thymocytes pooled from 5 adult or 8 neonatal TcrdH2BeGFP mice. [score:3]
These data are consistent with previous studies showing that miR-181a and miR-181b are predominantly expressed from mir-181ab1 in thymocytes [38]. [score:3]
Consequently, two recent studies had revealed a critical role for miR-181a/b-1 in development of agonist-selected invariant αβ NKT cells using two independent loss of function knock-out mice lines [31, 39]. [score:3]
Here we found comparably high expression levels of miR-181a in DN2, DN3, and γδ thymocytes as shown by relative quantification of miR-181a in comparison to the small nuclear RNA sno412 (Fig 1A). [score:3]
Quantitative RT-PCR analysis of miRNA expression was carried out using the following TaqMan probes: hsa-miR-181a, TM:000480 (Applied Biosystems); hsa-miR-181d, TM:001099 (Applied Biosystems). [score:3]
Also, given the myriad functions of miR-181a/b-1 in T cell development, our study does not formally exclude a cell intrinsic function of miR-181a/b-1 in γδ NKT cell development and selection. [score:3]
Although mice with a complete knock-out of all three miR-181 clusters are presumably lethal [38, 39]future work might rely on the combined T cell progenitor specific conditional deletion of all threemiR-181 clusters. [score:2]
Together, this indicates that deletion of miR-181a/b-1 does neither alter thymic γδ NKT cells numbers nor their thymic development into cluster B effector T cells. [score:2]
Cells from miR181a/b-1 deficient as well as from sufficient control mice were both capable to produce IFN-γ after in vitro stimulation with PMA/ionomycin although the frequency of IFN-γ [+] γδ NKT cells was slightly reduced in the knockout mice (Fig 3D). [score:2]
Therefore, lethally irradiated wild type mice were reconstituted with a 1:1 mixture of miR-181a/b-1 knockout and wild type bone marrow cells. [score:2]
Since such CCR6 [+] IL-17-producing effector γδ T cells were suggested to require no antigen-specific TCR engagement for their differentiation [24, 42], it is conceivable that their thymic development is relatively less affected by the absence of miR-181a/b-1. Interestingly, a recent report showed that IFN-γ-producing and IL-17-producing γδ T cells developed from DN2 cells, while only IFN-γ-producing γδ T cells developed from DN3 cells [47]. [score:2]
We found that miR-181a/b-1-deficiency alters the γδ TCR repertoire to some degree, whereas tuning of TCR sensitivity by the miR-181a/b-1-cluster is not critically required for the development and expansion of γδ NKT cells. [score:2]
While the number of all NK1.1 [+] cells was reduced in miR-181a/b-1 [–/–]mice due to impaired development of αβ iNKT cells (Fig 1F), numbers of NK1.1 [+] γδ T cells were comparable to miR-181a/b-1-sufficient controls (Fig 1G). [score:2]
In miR-181a/b-1 [–/–]mice the development of αβ NKT cells and most prominently that of CD1d-restricted semi-invariant so-called iNKT cells, is disturbed as indicated by massively reduced numbers of αβ KT cells [31, 39]. [score:2]
Nonetheless, overall numbers and frequencies of thymic and peripheral γδ T cells were largely unaltered in the absence of miR-181a/b-1. Analysis of mixed bone marrow chimeras indicated that, in general, the development of γδ thymocytes was not compromised by miR-181a/b-1 deficiency. [score:2]
The aim of this study was to analyze the impact of miR-181a/b-1-deficiency on the development and homeostasis of γδ T cells. [score:2]
However, a thorough analysis of their early thymic ontogeny would be required to make a statement that DETC development and selection are not at all affected by the presence or absence of miR-181a/b-1. For the latter, our data underline that αβ NKT cells and γδ NKT cells share many but not all features. [score:2]
Thymic development of γδ T cells in the absence of miR-181a/b-1. Thymic γδ T cells in the absence of miR-181a/b-1.. [score:2]
Although staining with antibodies directed against the γδ TCR and CD3ε can also identify most bona fide γδ T cells, the combination of these two genetic mo dels allowed us to better monitor the impact of miR-181a/b-1 on selection, intra-thymic expansion and differentiation of γδ T cells. [score:2]
Such a shift in Vγ-chain usage towards Vγ6 [+] γδ T cells might reflect that development and thymic persistence of the latter are relatively less dependent on miR-181a/b-1-modulated TCR signal sensitivity. [score:2]
NK1.1 [+] γδ NKT cells fill empty iNKT niches in the liver of miR-181a/b-1 -deficient mice. [score:1]
γδ NKT cells fill empty iNKT liver niches in miR-181a/b-1 deficient mice. [score:1]
In miR-181a/b-1 [–/–]mice the paucity of iNKT cells is not restricted to the thymic compartment but also transmitted into periphery [31]. [score:1]
Unchanged peripheral lymph node γδ T cells in the absence of miR-181a/b-1. Unchanged peripheral lymph node γδ T cell compartment in the absence of miR-181a/b-1.. [score:1]
Normal DETC numbers and phenotype in the absence of miR-181a/b-1. Dendritic epidermal T cells develop in the absence of miR-181a/b-1.. [score:1]
NK1.1 [+] γδ NKT cells fill empty iNKT niches in the liver of miR-181a/b-1 -deficient miceγδ NKT cells mainly home to and reside within the liver, similar to αβ iNKT cells [41]. [score:1]
Peripheral lymph nodes (pLN) displayed no difference of total γδ T cell numbers in miR-181a/b-1 [–/–]mice and miR-181a/b-1 sufficient controls (Fig 2A). [score:1]
However, we did not observe differences between miR-181a/b-1 [–/–]mice and controls in pLN γδ T cells (Fig 2C). [score:1]
In the thymus, we found a higher frequency of thymic Vγ6 [+] cells in miR-181a/b-1 -deficient mice. [score:1]
To this end, we crossed Tcrd-H2BeGFP reporter mice [4] to a miR-181a/b-1 [–/–]deficient strain [31]. [score:1]
Although TCR-specificity plays a critical role in the development of Vγ1 [+]Vδ6.3 [+] γδ T cells, their frequencies were unchanged in miR-181a/b-1 deficient as compared to sufficient controls (Fig 3G). [score:1]
However, RNA-sequencing revealed that miR-181a was already the fifteenth and third most abundant of all miRNAs in the DN2 and DN3 stages, respectively [37]. [score:1]
Therefore, we analyzed the composition of the γδ T cell compartment in the liver of miR-181a/b-1 [–/–]mice. [score:1]
However, we observed a slight TCR repertoire shift in miR-181a/b-1 deficient thymic γδ T cells. [score:1]
In order to confirm the high abundance of miR-181a/b-1 in immature thymocytes, we measured expression of miR-181a in FACS-sorted thymocyte subsets derived from TcrdH2BeGFP mice. [score:1]
However, γδ T cells numbers were not significantly different in the absence of miR-181a/b-1 (Fig 1B). [score:1]
TcrdH2BeGFP (C57BL/6-Tcrdc [tm1Mal]/J;[4]) and miR-181a/b-1 [–/–](C57BL/6-Mirc14 [tm1.1Ankr]) were already described. [score:1]
Both, miR-181a/b-1 deficient as well as wild type donor lymphocytes comparably reconstituted Vγ1 [+] and Vγ4 [+] thymocytes. [score:1]
Scatter plot shows ratios of miR-181a/b-1 [–/–](KO) and miR-181a/b-1 sufficient wild type (WT) donor Vγ1 [+] and Vγ4 [+] cells among all lymphocytes, respectively. [score:1]
The ratios of miR-181a/b-1 [–/–]donor cells and wild type donor cells, identified by congenic markers, were approximately one, indicating that none of the donor cells had a cell intrinsic advantage over the other (Fig 1E). [score:1]
Contour plots show representative CD1d tet binding versus γδ-GFP reporter fluorescence from two independent experiments, with each involving 3 mice per group of miR-181a/b-1 deficient (–/–) and miR-181a/b-1 sufficient (ctrl. ) [score:1]
At the same time, numbers and frequencies of liver-resident NK cells and conventional αβ T cells were similar in miR-181a/b-1 [–/–]and control mice (data not shown). [score:1]
Finally, we tested whether the absence of miR-181a/b-1 would impact the presence of DETCs, which are to date the sole γδ T cell population with an established requirement for TCR-specific positive thymic selection [12, 22, 23, 42]. [score:1]
However, we detected no differences in frequencies or phenotype as shown by FACS analysis of skin lymphocytes (Fig 5A) as well as by histological analysis of epidermal sheets from ears of miR-181a/b-1 -deficient and miR-181a/b-1-proficient TcrdH2BeGFP reporter mice (Fig 5B). [score:1]
In this study, we address whether miR-181a/b-1 influenced a potential agonistic selection of thymic γδ T cells and whether it affected their differentiation towards an IL-17- or IFN-γ-producing effector phenotype. [score:1]
Bone marrow was isolated from miR-181a/b-1 [–/–](KO, CD45.2) and C57BL/6 wild type (WT, CD45.1/CD45.2) mice. [score:1]
Thus, it was likely that miR-181a/b-1-deficiency would also alter the efficiency of γδ T cell production of those subsets that potentially required agonistic TCR signals for their thymic selection. [score:1]
They were crossed to obtain miR-181a/b-1 [–/–]x TcrdH2BeGFP mice. [score:1]
Together, this indicates that augmented numbers of NK1.1 [+] γδ NKT cells in the liver of miR-181a/b-1 deficient mice are not due to expansion of semi invariant Vγ1 [+]Vδ6.3 [+] γδ T cells, but rather result from increased frequencies of NK1.1 [+] γδ NKT cells using other TCR chain combinations. [score:1]
Scatter plot shows ratios of miR-181a/b-1 [–/–](KO) and miR-181a/b-1 sufficient wild type (WT) donor cells among all lymphocytes, αβ vNKT, αβ iNKT and γδ NKT lymphocytes, respectively, pooled data from two independent experiments with each 4 mice per group, harmonic mean. [score:1]
[1 to 20 of 58 sentences]
17
[+] score: 109
A beta-galactosidase expressing vector and the luciferase reporter constructs containing the 3′untranslated region of murine Cd69, Prox1, and Lif genes were co -transfected along with vector alone or vectors expressing miR-181a or miR-181d at the indicated amounts (100 or 300 ng). [score:7]
A beta-galactosidase expressing vector, and luciferase reporter constructs containing the 3′ untranslated region of the murine Cd69, Prox1, and Lif (WT or with point mutations in two putative miR-181 binding sites (Mut. [score:6]
Thus, the entire miR-181 family could modulate stress responses by targeting Lif and IL-6, especially since IL-6 is a putative target of these miRs (Table 1). [score:5]
Our luciferase reporter assays support distinct functions for this family as Cd69 and Prox1 are targeted by both miR-181a and miR-181d, while miR-181d preferentially targets Lif. [score:4]
By performing luciferase reporter assays with defined targets, miR-181d targeted a similar set of genes as miR-181a. [score:4]
Since the PCR amplification is not as stringent as the arrays, and it is likely that miR-181a can be amplified to a small degree when using a miR-181d specific primers, causing a less obvious down-regulation. [score:3]
The miR-181 family members have overlapping targets such as Cd69, Prox1, Bcl-2, dual specificity phosphatases, and protein tyrosine phosphatases (Table 1). [score:3]
Mir-181a and miR-181d have both overlapping and distinct gene targets. [score:3]
This miR has both similar and distinct gene targets as miR-181a, another member of miR-181 family. [score:3]
However, the over -expression of miR-181d, but not miR-181a, reduced the luciferase activity when Lif was located at the 3′end of the reporter (Figure 5C). [score:3]
Lif) genes were co -transfected along with vector alone or vectors expressing mir-181a or miR-181d. [score:3]
Interestingly, the 3′ untranslated region (UTR) of Lif contains 5 putative miR-181 binding sites (Figure S4A). [score:3]
It should be noted that the down-regulation of the miR-181 family was not as obvious with the RT-PCR assays as with the arrays. [score:3]
These experiments indicate that miR-181 family members can have both overlapping and distinct gene targets. [score:3]
Cd69 and Prox-1 are previously reported miR-181a targets [41], [54], and are used in this study as positive controls for miR-181a. [score:3]
Of the miR-181 family members that were stress responsive in the thymus, miR-181a and miR-181b were also weakly expressed in the brain and spleen. [score:3]
MiR-181d, a member of the miR-181 family, had a 5–15 fold reduced expression following LPS or dexamethasone treatment, suggesting an important functional role for this miR in thymopoiesis. [score:3]
B) Schematic representation of the reporter constructs and predicted binding sites of miR-181 family in the 3′ untranslated region of Cd69, prox1, and Lif. [score:3]
The reduced expression of the miR-17-90 cluster and the miR-181 family was even more pronounced in the DP population (Figure 4B). [score:3]
Figure S5 Dose-response analysis of miR-181 target genes. [score:3]
MiR-181a is highly expressed in DP thymocytes, representing 15% of the total miR pool [39], [40], [41]. [score:3]
To determine whether miR-181a and miR-181d have overlapping or distinct target specificities, the 3′ UTRs of murine Cd69, Prox1, and Lif were cloned downstream of a luciferase reporter construct (Figure 5B). [score:3]
Less is known about the role of the three other miR-181 family members (miR-181b, c, and d), two of which are expressed in developing thymocytes [39]. [score:3]
Target specificity of miR-181 family members. [score:3]
MiR-15a, miR-17, mir-20a, miR-20b, miR-106a, miR-128, miR-181a, miR-181b, and miR-181d were consistently down regulated (Figure 2C). [score:2]
Comparing all the thymocyte subsets, the CD8 SP was the most divergent, with the miR-17-90 cluster up regulated 2-fold and the miR-181 group unaffected by the LPS treatment. [score:2]
This difference could also explain why miR-181d expression levels are very susceptible to stress compared to miR-181a or miR-181b. [score:2]
We found that luciferase activities of both Cd69 and Prox1 were repressed in cells expressing miR-181a or miR-181d, compared to the vector controls (Figure 5C). [score:2]
Thus, the pre-miR loop nucleotides of miR-181a versus miR-181c result in the differential ability of miR-181a to regulate thymocyte development compared to miR-181c [53]. [score:2]
In addition, miR-181d and miR-181c are encoded on a chromosome (murine chromosome 8) distinct from the miR-181a and miR-181b cluster, which have undergone gene duplication on two separate chromosomes (murine chromosomes 1 and 2). [score:1]
This is because miR-181a, miR-181b, miR-181c, and miR-181d are very conserved, with only 1–4 bp differences within this family. [score:1]
The individual miRs (miR-150, miR-205, miR-128, miR-181a, miR-181b, miR-181d) were detected by Northern blotting. [score:1]
These included the miR-17-90 cluster, which have anti-apoptotic functions, and the miR-181 family, which contribute to T cell tolerance. [score:1]
The seed sequence of miR-181 is underlined. [score:1]
While all murine miR-181 family members have the same seed region (nucleotides 2–8 at the 5′ end), miR-181d is the most divergent based on total pre-miR sequence, and its precise function is unknown (Figure 5A) [53], [54]. [score:1]
These findings suggest important functional distinctions between miR-181a and miR-181d. [score:1]
The normally high levels of miR-181a maintain T cell tolerance to self-peptide/MHC molecules, with a reduction in this miR increasing the number of self-reactive T cells [42]. [score:1]
A) Homology of miR-181 family members with the seed sequences shaded. [score:1]
0027580.g005 Figure 5 A) Homology of miR-181 family members with the seed sequences shaded. [score:1]
PCR-amplified genetic fragments (500–700 base pairs) containing miR-181a or miR-181d were cloned into the pCDNA3.1 vector (Invitrogen, Carlsbad, CA). [score:1]
Each graph represents mean +/− SD of the ratio of the normalized luciferase activity in miR-181 and control vector transfections from three independent experiments, with each sample tested in triplicate (n. s.  = not significant, *p<0.05, **p<0.01, *** p<0.001, versus vector alone, unpaired Student t-test). [score:1]
A) Predicted interactions of miR-181a and miR-181d with their binding sites in the murine LIF 3′UTR. [score:1]
This miR is a member of the miR-181 family, with all four members sharing an almost identical seed sequence. [score:1]
Northern blots were performed for the selected miRs A) Mir-125, B) MiR-150, C) MiR-181a, and D) MiR-181d. [score:1]
Each graph represents mean +/− SD, using the ratio of the normalized luciferase activity in miR-181 and control vector transfections. [score:1]
[1 to 20 of 45 sentences]
18
[+] score: 95
The expression of miR-181a is downregulated as thymocytes mature [31] and in this way may account for developmentally regulated changes in the responsiveness of thymocytes to TCR signaling. [score:8]
In contrast to mature CD4+ T cells, the miR-181 site affected eGFP- Cd69 3'UTR expression in CD4+ CD8+ DP thymocytes, which express maximal levels of the developmentally regulated miR-181 [31]. [score:7]
Mutation of the miR-181 site in the Cd69 3'UTR did not measurably affect the expression of eGFP in mature CD4+ T cells (Fig. 3C), which express only low levels of the developmentally regulated miR-181 [31]. [score:6]
In addition, miR-181, which also targets Cd69 and is a known modulator of T cell receptor signaling, also affects cell-to-cell variation of CD69 expression. [score:5]
miR-181 is a known modulator of TCR signal transduction [36– 38] and our data show that the deletion of mir-181ab1 affected the CV of CD69 expression mainly by altering the proportion of thymocytes that expressed CD69 at high levels. [score:5]
org) and established target of miR-34 [28] as well as the predicted miR-181 targets Ly6a and H2-K1 (www. [score:5]
The expression of mature microRNAs, including miR-181a, is reduced by ∼ 90% at the DP stage of development as demonstrated by northern blotting with U6 snRNA as a loading control, data from [26]. [score:4]
D) The CV of CD69 expression in miR-181a -deficient and control CD69 hi CD25+ DP thymocytes is slightly higher than in control thymocytes. [score:3]
miR-181a affected variation by modulating the responsiveness of thymocytes to activation signals, acting at least in part upstream on the target mRNA Cd69. [score:3]
To explore the influence of miR-181 on the CV of CD69 expression we analysed DP thymocytes deficient in mir-181ab1, which accounts for most of the miR-181a and -b copies in DP thymocytes [36]. [score:3]
A) Histogram overlays of CD69 expression by control (black) and miR-181a -deficient (red) DP thymocytes activated for 18 hours with 125ng H57/ml. [score:3]
miR-181a controls cell-to-cell variation in CD69 expression. [score:3]
Interestingly, CD69 expression in miR-181 -deficient DP thymocytes also showed an increased CV (Fig. 4A) over a range of activation conditions (Fig. 4B). [score:3]
Our data are consistent with this mo del and further suggest that developmental regulation of miR-181a reduces cell-to-cell variability of thymocyte responses to TCR signaling. [score:3]
A dual fluorescence reporter system identifies endogenous microRNAs that target the Cd69 3'UTR in DP thymocytesThe Cd69 3'UTR contains predicted sites for miR-181, miR-130 and miR-17/20 (http://www. [score:3]
1005020.g004 Fig 4A) Histogram overlays of CD69 expression by control (black) and miR-181a -deficient (red) DP thymocytes activated for 18 hours with 125ng H57/ml. [score:3]
Following activation, miR-181 -deficient DP thymocytes showed increased mean CD69 expression (control = 245 ± 17, mean miR-181 ko = 278 ± 10, n = 26, P<10 [–10], 2-tailed T-test). [score:3]
These results show that miR-181 is an important determinant of cell-to-cell variability in CD69 expression in activated DP thymocytes, and is required to restrict the fraction of CD69 [hi] DP cells. [score:3]
B) The CV of CD69 expression is higher in miR-181a -deficient than in control DP thymocytes (n = 7–8, ** p<0.005, *** p<0.0005). [score:3]
microRNA-181a controls cell-to-cell variability in CD69 expression. [score:3]
org) and there is firm experimental evidence for Cd69 regulation by miR-181a, miR-130 and the miR-17-92 cluster (which encodes the microRNAs miR-17, -18, -19a, -19b, -20a, and -92 [34] in T lymphocytes [31– 33]. [score:2]
The microRNA miR-181 is a critical cellular metabolic rheostat essential for NKT cell ontogenesis and lymphocyte development and homeostasis. [score:2]
Based on reported cloning frequencies (89884 miR-181a-1/2 per 10 [6] microRNAs in DP, 1465 miR-17 per 10 [6] microRNAs in DP thymocytes, and 1050 miR-20a per 10 [6] microRNAs in DP [64]. [score:1]
CD69 controls cell migration and sphingosine 1-phosphate signaling [30], and the Cd69 mRNA is a well-characterised target of miR-181 and other microRNAs [31– 33]. [score:1]
Modulating the strength and threshold of NOTCH oncogenic signals by mir-181a-1/b-1. PLoS Genet. [score:1]
The 842 nt 3’ UTR of Cd69 contains predicted binding sites for miR-181, miR-130 and miR-17-20 starting at positions 255, 354 and 391, respectively, which were mutated alone and in combination. [score:1]
miR-181a is present at 400 [36] to 800 [31] copies per DP thymocyte. [score:1]
We focused our subsequent analysis on miR-181a and the miR-17-92 cluster. [score:1]
miReduce analysis [27] of 3'UTR motifs associated with post-transcriptional de-repression in Lck-Cre DP thymocytes (see GSE57511) showed enrichment for microRNAs miR-181, miR-17 and miR-142 (Fig. 1B). [score:1]
The increased CV was due mainly to a higher fraction of CD69 [hi] cells among miR-181 -deficient DP thymocytes (Fig. 4C). [score:1]
C) The frequency of CD69 hi CD25+ DP cells is higher in miR-181a -deficient than in control DP thymocytes (n = 12, P<10–5). [score:1]
This is consistent with a role for miR-181 as a modulator of TCR signaling [36– 38] (Fig. 4E). [score:1]
E) Mo del for the action of miR-181 upstream of TCR signaling and on Cd69 mRNA. [score:1]
The Cd69 3'UTR contains predicted sites for miR-181, miR-130 and miR-17/20 (http://www. [score:1]
[1 to 20 of 34 sentences]
19
[+] score: 91
We also found that CARM1 was post-transcriptionally regulated and was directly targeted by miR-181, which represses the 3′ untranslated region (3′UTR) of CARM1 in hESCs. [score:7]
In differentiated hESCs, H3K27 methylation is inhibited because of the reduction of core pluripotency factors, and miR-181 family members are consequently significantly induced and down-regulate CARM1 activity. [score:6]
In this context, we scanned for microRNAs that target CARM1 and finally identified the miR-181 family as the critical regulator of CARM1 expression. [score:6]
In differentiated hESCs, H3K27 methylation is inhibited due to the reduction of core pluripotency factors, and miR-181 family members are subsequently induced and down-regulate CARM1 activity. [score:6]
Taken together, these results show that miR-181 directly regulates CARM1 by targeting its 3′UTR and that miR-181c may play a prominent role among the 4 members during hESC differentiation. [score:5]
Although the miR-181 family also regulates many target genes [21], [46], [47], [48], [49], it is important to highlight that in mouse ESCs, the miR-181 family regulates another histone modulator, Cbx7, which plays a critical role in maintaining ESC pluripotency [50]. [score:5]
0053146.g002 Figure 2The miR-181 family directly regulates CARM1 expression in hESC. [score:5]
To investigate whether CARM1 can be directly targeted by miR-181, we engineered luciferase reporters that have either the wild-type 3′UTR of CARM1, or a mutant 3′UTR with three point mutations in the target sites as a negative control (Fig. 2C). [score:5]
The miR-181 family directly regulates CARM1 expression in hESC. [score:5]
Enforced Expression of miR-181c Induced hESC Differentiation by Targeting CARM1 We selectively transfected miR-181c mimics in undifferentiated hESCs to study the effect of miR-181 on hESCs differentiation. [score:5]
All the results indicated that CARM1 down-regulation may greatly contribute to the miR-181-meidated hESC differentiation. [score:4]
Future studies will explore how the expression of the miR-181 family is regulated in ESC differentiation and whether other transcriptional factors are associated with CARM1. [score:4]
By contrast, the expression of mutant reporters was not repressed by miR-181 (Fig. 2D). [score:3]
Thus, we suggest that CARM1 is one of the key target genes of the miR-181 family during the progression of ESCs differentiation. [score:3]
Our work suggests that downstream targets of the miR-181 family include epigenetic factors that reconfigure the H3 arginine methylation signature during the process of hESC differentiation. [score:3]
We also found that the expression levels of the miR-181c/d primary transcripts (pri-181c/d) were notably elevated after differentiation in comparison to the primary transcripts of miR-181a and miR-181b (pri-181a1/b1 and pri-181a2/b2) (Fig. 2B). [score:3]
Considering that the sites of the CARM1 3′UTR that are targeted by miR-181 family members are conserved in mammals, we suppose that the interaction between miR-181 and CARM1 is conserved in mESCs. [score:3]
The mature transcripts of the 4 members of the miR-181 family were all found to be significantly increased in differentiated hESCs, and miR-181c had the highest expression level (Fig. 2A). [score:3]
miR-181 Family Members are Critical Regulators of CARM1 during hESC Differentiation. [score:2]
Our results also suggest that the miR-181/CARM1/core-pluripotency-factors regulatory loop may be a novel mo del pathway involved in the modulation of hESC pluripotency (Figure 4E). [score:2]
We found that the mimics of miR-181a/b/c/d significantly reduced the luciferase activities of the wild-type CARM1 reporters in comparison to the negative control. [score:1]
We selectively transfected miR-181c mimics in undifferentiated hESCs to study the effect of miR-181 on hESCs differentiation. [score:1]
miR-181a, -181b, -181c and -181d mimics and control RNAs were synthesized by GenePharma (Shanghai, China). [score:1]
The luciferase reporters were co -transfected with miR-181a/b/c/d mimics into HEK293 cells. [score:1]
To study the role of endogenous miR-181 in repressing the CARM1 3′UTR reporter in differentiated hESCs, we co -transfected the wild-type 3′UTR luciferase reporter and the negative control luciferase into differentiated hESCs. [score:1]
This finding suggests that the miR-181 family may also promote differentiation by affecting histone modulation in mESCs. [score:1]
[1 to 20 of 26 sentences]
20
[+] score: 80
miR-181a underexpression could increase signaling by targeting TCRα and CD69 [25] and miR-96 overexpression could increase signaling by targeting DUSP 1 [28]. [score:9]
miR-181a, which is underexpressed in lymphoproliferative disease and in homeostatic proliferation, has multiple targets in the Ras/Erk pathway. [score:7]
miR-181a, which is underexpressed in lymphoproliferative disease and in homeostatic proliferation, targets Bcl-2 [25], which is anti-apoptotic. [score:7]
miR-181a could potentially down-regulate TCR signaling by targeting TCRα [25]. [score:6]
In the PI3K pathway (Figure S4 and Table S6), miR-181a underexpression could result in altered signaling by targeting SirT1 [31]. [score:5]
This analysis confirmed the trends observed previously in the Nanostring analysis (i. e. overexpression of miR-21, miR-146a and miR-148a and underexpression of miR-181a in LAT Y136F CD4 [+] T cells compared to wild type CD4 [+] T cells) using a different method and multiple replicates. [score:4]
miR-181a was dramatically downregulated in LAT Y136F T cells and in T cells undergoing homeostatic proliferation in comparison to wild type memory T cells. [score:4]
In hyper-proliferating LAT Y136F T cells, one miRNA (miR-181a) was underexpressed more than 10-fold compared to C57BL/6 memory CD4 [+] T cells and another was underexpressed more than 5-fold (miR-466a/b). [score:4]
Whether underexpression of miR-181a is a marker or cause of active proliferation in these settings remains to be determined. [score:3]
In the case of homeostatic proliferation, miR-181a was also underexpressed more than 10-fold relative to C57BL/6 memory CD4 [+] T cells. [score:3]
So underexpression of miR-181a could lead to increased signaling. [score:3]
Three miRNAs had altered expression in LAT Y136F CD4 [+] T cells and in CD4 [+] T cells undergoing homeostatic proliferation (miR-181a, miR148a and miR-96). [score:3]
RNAs from three groups of wild type mice (each containing sorted naïve or memory CD4 [+] T cells from pools of five to eight C57BL/6 mice per group) and four individual LAT Y136F mice were analyzed for levels of miR-21, miR-146a, miR148a and miR-181a (miRNAs with more than ten-fold differences in expression between LAT Y136F and C57BL/6 naïve CD4 [+] T cells). [score:3]
Therefore underexpression of miR-181a could lead to lower levels of apoptosis, which could lead to an overall lymphoproliferative outcome. [score:3]
Four miRNAs (miR-21, miR-181a, miR-146a and miR-148a) have a greater than 10-fold difference in expression between LAT Y136F and naïve C57BL/6 CD4 [+] T cells and five additional miRNAs have greater than 5-fold differences (Table 1; miR-669f, miR-155, miR-466a/b, miR-125a and miR-96). [score:3]
However, the opposite effect would be predicted based on other miR-181a targets [26]. [score:3]
Because miR-181a was dramatically underexpressed in LAT Y136F CD4 [+] T cells and in T cells from mice undergoing homeostatic proliferation compared to CD4 [+] T cells from H. polygyrus-infected mice, it may be involved in T cell expansion in T cell -depleted environments. [score:2]
Three miRNAs showed more than 10-fold differences of expression in CD4 [+] T cells from mice undergoing homeostatic proliferation compared to naïve C57BL/6 CD4 [+] T cells (miR-21, miR-181a and miR-146a, Table S1) and two additional miRNAs showed greater than 5-fold differences (miR148a and miR-96, Table 1). [score:2]
In addition we can compose a list of other miRNAs that are differentially regulated more than 5-fold among various combinations of the three proliferative states: miR-96, miR-125a, miR-139, miR-148a, miR-155, miR-181a, miR-361, miR-466a/b and miR669f. [score:2]
Comparison of hyper-proliferative LAT Y136F T cells to T cells from mice previously infected with H. polygyrus showed one miRNA with a greater than 5- or 10-fold difference, miR-181a. [score:1]
After reverse transcription, qPCR was performed using TaqMan® Universal PCR Master Mix II (No UNG), cDNA, and TaqMan® hydrolysis probes, hsa-miR-21, hsa-miR-146a, hsa-miR-148a, hsa-miR-181a, and snoRNA202. [score:1]
In addition, comparison of miRNAs from CD4 [+] T cells undergoing homeostatic proliferation to those from H. polygyrus-infected mice showed one miRNA with a greater than 5- or 10-fold difference, miR-181a. [score:1]
H poly mmu-miR-150 ↑ mmu-miR-181a ↓↓ ↓↓ mmu-miR-669f ↓ ↓ mmu-miR-29c ↑ mmu-miR-155 ↑ ↑ mmu-miR-467f mmu-miR-466a/b-3p ↓ ↓ mmu-miR-361 ↑↑ ↓ mmu-miR-547 mmu-miR-1949 mmu-miR-345-3p ↓ ↑ mmu-miR-101b mmu-miR-340-5p mmu-miR-148a ↑ ↑ mmu-miR-139-5p ↓↓ ↓ mmu-miR-132 ↑ ↑ mmu-miR-539 ↓ mmu-miR-125a-5p ↑↑ ↑ ↓ mmu-miR-130b *miRNAs with Nanostring counts that passed the minimum intensity filter and have >2-fold differences among any two-way comparison. [score:1]
[1 to 20 of 23 sentences]
21
[+] score: 71
Nuclear Malat1 is directly targeted by miR-181a/Ago2 machinery upon myoblast differentiationThe interesting downregulation of Malat1 at the very early stage of myogenic differentiation suggested that its expression must be tightly regulated. [score:10]
Indeed, by cloning the identified miR-18a binding region in Malat1 into a luciferase reporter vector, we found that transfection of precursor oligos of miR-181a (pre-181a) but not a negative control or an irrelevant miR-193a downregulated the reporter activity (Figure 6b); moreover, mutating the predicted binding site (Figure 6a, Mutant) abolished this targeting effect (Figure 6b), suggesting that indeed miR-181a directly targeted Malat1 through the above-identified site. [score:9]
In line with the finding, overexpression of miR-181a by transfecting the precursor miR-181a oligos led to a significant downregulation of the endogenous Malat1 in differentiating C2C12 cells (Figure 6c, 60% decrease, Supplementary Figure S7a and b), whereas depletion of miR-181a by Antagomirs (Anti-181a) increased the expression of Malat1 (Figure 6d, 1.5-fold, Supplementary Figure S7c). [score:8]
In contrast to the notable downregulation of Malat1 expression in the early stage of C2C12 differentiation (Figure 1d), miR-181a expression level was found to gradually increase (Figure 6e), supporting their functional antagonization during this stage. [score:8]
To further explore how miR-181/Ago2 downregulates Malat1 transcripts, we first tested whether they could suppress Malat1 transcription as increasing lines of evidence showed the non-canonical functions of nuclear miRNA/Ago in recruiting epigenetic silencing complex, which triggered transcriptional silencing [48]. [score:6]
We thus looked for miRNAs that could potentially target Malat1 upon differentiation; this led to the discovery of a sequence complementarity between Malat1 and 82 miRNAs (Supplementary Table S2) including miR-181a (Figure 6a), which happens to be a well-known regulator of skeletal myogenesis [47]. [score:4]
Lastly, we also demonstrate that Malat1 transcript is directly targeted by miR-181a and degraded through Ago2 -dependent nuclear RNA -induced silencing complex (nRISC) machinery occurring in the myoblast nucleus. [score:4]
At the onset of differentiation, miR-181a expression is induced, causing Malat1 degradation through their direct interaction and Ago2 -dependent nRISC machinery in the nucleus. [score:4]
Nuclear Malat1 is directly targeted by miR-181a/Ago2 machinery upon myoblast differentiation. [score:4]
Lastly, to confirm the functionality of the miR-181a/ Malat1 regulation, we further demonstrated that knockdown of Malat1 could revert the anti-myogenic effect of anti-miR-181a treatment on myogenesis (Figure 6n). [score:3]
However, by nuclear run-on assay, we did not detect a decrease in nascent Malat1 transcription by miR-181a overexpression, suggesting that the regulation may not be at the transcriptional level; instead, miR-181/Ago2 may cause Malat1 degradation through an nRISC machinery (Figure 6k). [score:3]
Still, we were uncertain about whether this miR-181a/ Malat1 regulation could occur in the nucleus where Malat1 was enriched, given that the miRNA -mediated silencing machinery is traditionally thought to mainly function in the cytoplasm. [score:2]
Indeed, as previously reported [47], miR-181a is known for its pro-myogenic function in myoblast cells. [score:1]
Although the high abundance and stability of Malat1 could suggest a competing endogenous function titrating the amount of miR-181a, emerging reports start to demonstrate that the microRNAs binding could also reduce lncRNA stability [14]. [score:1]
To construct Malat1 luciferase reporter plasmids, a 45 bp fragment encompassing WT mmu-miR-181a-5p -binding site (5′-cAaagacctgtagagctg ttgaatgtttgcagctggca-3′) or mutated binding site (5′-cAaagacctgtagagctg cctgcgacttgcagctggca-3′) was cloned into pMIR-report vector (AM5795, Life Technologies, Carlsbad, CA, USA) between Spe| and Sac| sites. [score:1]
To eliminate our doubts, we examined the subcellular localization of miR-181a and detected a substantial amount of miR-181a in the nuclear portion (Figure 6f). [score:1]
Altogether, the above data suggested that Malat1 was reduced by miR-181a/Ago2 degradation through the nRISC -dependent machinery in the nucleus of myoblast cells upon early differentiation. [score:1]
Anti-miR-NC and miR-181a were obtained from Ribobio and transfected at a final concentration of 100 n M. siAgo2 oligos or miRNA oligos (50 nM) were used for transient transfections. [score:1]
[1 to 20 of 18 sentences]
22
[+] score: 68
However, CHIR downregulated mature miR-302a, miR-302b, miR-302c, miR-181a and miR-181b expression, and BIO slightly downregulated miR-181a and miR-181b (Fig. 4e). [score:9]
The expression of the miR-302-367 cluster and the miR-181 family of miRNAs are activated by Wnt/β-catenin pathway 26 27, thereby we speculated that members of these family should be upregulated by BIO and CHIR because these inhibitors activate Wnt/β-catenin signalling. [score:8]
The small RNA deep-sequencing data shows that most of differentially expressed miRNAs in the BIO- and CHIR -treated cells were downregulated, including the Wnt/β-catenin-regulated miR-302-367 cluster and miR-181 family members. [score:7]
These data suggest that BIO and CHIR inhibit miRNA maturation, particularly inhibiting maturation of Wnt/β-catenin signalling-activated miR-302-367 cluster and miR-181 family of miRNAs, is probably because inhibition of GSK3 activity disturbs the nuclear localisation of Drosha. [score:7]
Additionally, BIO downregulated the expression of miR-181 family of miRNAs (Table 1). [score:6]
Unexpectedly, CHIR significantly downregulated the expression of miR-302-367 cluster and miR-181 family members, including miR-302a-5p, miR-302b-3p, miR-302d-3p, miR-181a-2-3p, miR-181a-5p, miR-181b-5p, miR-181c-5p, miR-181c-3p, and miR-181d-5p (Table 1). [score:6]
β-catenin was overexpressed in J1 mESCs using the vector pCMV-Myc- β-catenin (Fig. 4a), and the expression of primary and mature forms of miR-302, miR-181a and miR-181b were determined by qPCR. [score:5]
Expression of miR-302-367 cluster and miR-181 family members in BIO and CHIR treated mESCs detected by small RNA deep-sequencing. [score:3]
The expression of miR-302a-5p, miR-302b-5p, miR-302c-5p, miR-181a-5p, and miR-181b-5p in β-catenin transfected J1 mESCs was determined by qPCR. [score:3]
To better understand how BIO and CHIR regulate miRNAs that induced by Wnt/β-catenin signalling, we compared the expression of primary and mature miRNAs of miR-302-367 cluster and miR-181 family following BIO and CHIR treatment in J1 mESCs. [score:3]
It should be noted that miR-211 was strongly increased in both BIO- and CHIR -treated J1 mESCs, and that miR-181a was inhibited by both BIO and CHIR (Fig. 3i, 3j). [score:3]
The expression of miR-302a-5p, miR-302b-5p, miR-302c-5p, miR-181a-5p, and miR-181b-5p in BIO- or CHIR -treated J1 mESCs was determined by qPCR. [score:3]
Additionally, β-catenin overexpression increased the levels of mature miR-302a, miR-302b, miR-302c, miR-181a and miR-181b when compared with controls (Fig. 4c). [score:2]
The qPCR results of precursor form of the miR-302-367 cluster and miR-181 family members confirmed this notion. [score:1]
for miR-302a, miR-302b, miR-302c, miR-302d, miR-181a and miR-181b were validated by qPCR (Fig. 3i and 3j). [score:1]
To further analyse this, the precursor forms of miR-302a, miR-302b, miR-302c, miR-302d, miR-181a and miR-181b was examined by qPCR in J1 mESCs. [score:1]
[1 to 20 of 16 sentences]
23
[+] score: 61
Although miR-181a expression is a critical modulator in thymocytes, our data do not support a role for either miR-181a1 or miR-181b1 expression in TECs as deletion of these miRs had no effect on thymic development. [score:6]
Ectopic miR-181a expression in hematopoietic stem cells (HSCs) increases B cells and decreases CD8+ T cells, indicating that hematopoietic lineage-specific miRs can regulate immune development[19]. [score:5]
Moreover, increasing miR-181a expression in immature T cells reduced their sensitivity to peptide antigens and, as a result of down -regulating multiple phosphatases[19], impaired both positive and negative selection. [score:4]
Ectopic expression of miR-181a in DN thymocytes resulted in a quantitative increase in the percentage of DP cells and a decrease in the proportion of CD8+ SP cells, suggesting that miR-181a influences early thymic development at pre-TCR and TCR -dependent stages. [score:4]
Li et al. [19] showed that miR-181a is expressed at high levels during each of the first 3 DN stages of early thymocyte development as well as in cells undergoing positive selection. [score:4]
Moreover, transgenic miR-181a expression augmented TCR -mediated T cell activation following antigenic stimulation. [score:3]
Whereas miR-181a-1 and miR-181b-1 are on mouse chromosome 1, ~150-bp apart, miR-181a-2 and miR-181b-2 are on mouse chromosome 2, 1.1 kb apart from each other [23] MiR-181a is highly expressed in the thymus and at lower levels by cells in the heart, lymph nodes and bone marrow (BM)[11, 13]. [score:3]
It has been well defined that miR-181a is highly expressed in the thymus, especially in DP thymocytes[19]. [score:3]
In order to determine the functional role of miR-181-5p in TEC, the cell line mTEC1 was transfected with miR-181a-5p mimic, miR-181a-5p inhibitor, or a negative control and their in vitro proliferation was quantified[28]. [score:3]
A direct correlation was observed between high miR-181a-5p levels and proliferation possibly mediated by Smad3 phosphorylation and blocked activation of signaling by transforming growth factor-beta, a negative regulator of proliferation. [score:3]
Deletion of both miR-181 and miR-181 in mice perturbed Natural Killer T (NKT) cell and thymocyte development by regulation through PTEN phosphatase modulation of phosphatidylinositol 3-kinase (PI3K) that affects their anabolic activity[24]. [score:3]
Contrary to an over -expression of miR-181a and miR-181b in TEC, miR-181a1 and miR-181b1 deletion in Foxn1-Cre::Mir181a1/b1 [fl/fl] mice did not impact on total or lineage-specific TEC cellularity. [score:3]
MiR-181a has been shown to be expressed at high levels in the thymus[19, 21]. [score:2]
Role of miR-181 family in regulating vascular inflammation and immunity. [score:2]
Previous studies have shown that MiR-181a-5p is expressed in TECs at high levels in young mice (1 month of age) but decreased significantly with age[28]. [score:2]
This resulted in decreased number of T cells and an increase number of B cells showing that miR-181 acts as a positive regulator of B cells. [score:2]
The importance of miR-181 genes has been shown to be important in cellular growth, development, endothelial cell function and also plays an important role in the immune system[19] [20] [21]. [score:2]
In mature CD8+ T cells that were transduced with miR-181a, the TCR was much more sensitive to antigenic stimulation based on the number of peptides required to produce IL-2. Studies by Chen et al. [21], evaluated the ectopic expression of miR-181 in murine lineage negative bone marrow cells. [score:1]
TaqMan Probes used for miRNA181 detection were: mmu-miR-181a (mature miRNA sequence): ACCGACCGUUGACUGUACCUUG, miRBase Accession Number MIMAT0005443. [score:1]
These mice had a decrease in the absolute number of thymocytes further emphasizing the important role miR-181 plays in thymus[24]. [score:1]
In mice with a miR-181 deletion, the absolute number of thymocytes is significantly decreased, highlighting the important role miR-181 plays in thymus[24]. [score:1]
The family of miR181 genes is encoded by 6 miRNAs on three separate chromosomes- MiR-181a1, miR-181a2, miR-181b1, miR-181b2, miR-181c, and miR-181d[22]. [score:1]
miRNA181 [a/b] relative expression was calculated as 2 [-∆Ct] values. [score:1]
Because levels of miR-181a-5p were at low levels in aged mice, one might have predicted that Foxn1-Cre::Mir181a1/b1 [fl/fl] mice would have had an involuted thymus. [score:1]
[1 to 20 of 24 sentences]
24
[+] score: 61
Interestingly, a gene expression analysis of mice lacking miR-181a/b revealed a distinct set of targets. [score:5]
While a number of mRNA targets of miR-181 have been reported, it is not known whether miR-181d has overlapping and/or distinct targets. [score:5]
In developing thymocytes, miR-181a controls T-cell repertoire selection by targeting CD69, Bcl2, Dusp5, Dusp6, Shp2, Ptpn22, and Pten, the protein products of which regulate signaling pathways [31], [36], [37], [38], [39], [40], [41]. [score:4]
Such results reveal a differential regulation of miR-181 family members under both steady and disease states [11], [34], [35]. [score:4]
In our study, the phosphatidylinositol signaling system and metabolic pathways were the most significant pathways enriched among the miR-181d down-regulated genes, consistent with the findings using miR-181a/b -deficient mice. [score:4]
While miR-181a/b knock-out (KO) mice have normal αβ T cell development, their NK T cell development is blocked [39], [41]. [score:4]
Reductions in miR-181a increase the cell survival of astrocytes from ischemia-like injury following glucose deprivation, in part via elevations in one of its targets, Bcl2 [36]. [score:3]
All miR-181 family members are primarily expressed in the thymus, at levels at least 10-20 fold higher than the brain and liver [35]. [score:3]
Interestingly, while miR-181d was down-modulated around 15-fold, the much more abundantly expressed miR-181a and miR-181b family members were only minimally affected [11]. [score:3]
These experiments suggest that the targeted elimination of one miR-181 family member is insufficient to modulate the stress responsiveness of developing thymocytes. [score:3]
None of the miR-181 family members are normally expressed in these cells [11]. [score:3]
Consistent with this, a complete targeting of all miR-181 family members causes an embryonic lethality [39]. [score:3]
MiR-181a targets mRNAs encoding TCR signaling proteins, thereby controlling repertoire selection by modulating signaling thresholds [40], [48]. [score:2]
MiR-181 family members also target Bcl2, with its reduction increasing the GC-sensitivity of DP thymocytes [19], [36], [53]. [score:2]
Contrasting this, the complete deficiency of all miR-181 family members is embryonic lethal, suggesting a functional compensation or redundancy [38]. [score:1]
These results suggest that multiple miR-181 family members function in a compensatory manner. [score:1]
MiR-181a regulates signaling down-stream of Notch1 [37], [38]. [score:1]
It is a member of miR-181 family that includes miR-181a, miR-181b, and miR-181c. [score:1]
CD69 is previously reported as one of the overlapping targes of miR-181a and miR-181d [11], [53]. [score:1]
It is also plausible that stress can lead to a metabolic reprogramming in immature thymocytes by modulating miR-181 levels. [score:1]
This indicates that the processing of the miR-181c/d locus during stress is very distinct from the two miR-181a/b loci. [score:1]
In contrast to the stress effects on miR-181d, miR-181c remains unchanged while miR-181a and miR-181b are reduced 2- and 6-fold, respectively [11]. [score:1]
Most studies to date have focused on miR-181a, the most abundant miR in DP thymocytes [35]. [score:1]
This strongly argues for a functional redundancy/compensatory process among the miR-181 family members. [score:1]
The miR-181 family comprises four members, miR-181a, miR-181b, miR-181c, and miR-181d, which are generated from three separate genomic clusters (miR-181ab1, miR-181ab2, and miR-181cd) [32], [33]. [score:1]
0085274.g001 Figure 1(A) Schematic shows the sequence homology between mature miR-181 family members. [score:1]
Accordingly, T cell-specific elimination of miR-181 family members might be beneficial to recover from thymic atrophy. [score:1]
[1 to 20 of 27 sentences]
25
[+] score: 61
[7] Furthermore, miR-181a has been reported to be decreased in vascular smooth muscle cells (VSMCs) when stimulated by angiotensin II, whereas overexpression of miR-181a resulted in inhibition of adhesion of VSMCs to collagen and reduced expression of osteopontin, a multifunctional protein found in abundance in atherosclerotic plaques. [score:7]
[9] The miR-181 family has also been reported to play an essential role in early NKT cell development by targeting 3'-UTR of PTEN in the thymus. [score:4]
Activin and TGFbeta regulate expression of the microRNA-181 family to promote cell migration and invasion in breast cancer cells. [score:4]
To see the temporal changes in miR-181a and miR-181b expression, WT mice aorta at different ages (4 weeks, 20 weeks, 40 weeks) were tested for miR-181a and miR-181b by qPCR. [score:3]
We have validated the miR-181a and miR-181b expression in the aorta of the miR-181a1/b1 [-/-] (a/b KO) mouse mo del using qPCR (Fig 1A and 1B). [score:3]
miR-181a/b is not associated with circulating levels of Angiotensin II and expression of Angiotensin II receptors. [score:3]
[13] C, Relative expression of miR-181a and miR-181b at 4 weeks, 20 weeks and 40 weeks of age in WT mice aorta (n = 3–4). [score:3]
Several studies have suggested that TGF-β induces miR-181 expression. [score:3]
[7, 8] Accumulating evidence indicates that miR-181 modulates vascular function by targeting multiple key cell signaling pathways, including NF-κB signaling in the vascular endothelium as well as the PI-kinase pathway. [score:3]
Role of miR-181 family in regulating vascular inflammation and immunity. [score:2]
Better understanding of the role of miR-181 in the development of vascular stiffness and systolic hypertension may lead to novel therapeutic approaches in the future. [score:2]
miR-181 and metabolic regulation in the immune system. [score:2]
miR-181a/b regulates vascular stiffness and systolic blood pressure with age. [score:2]
0174108.g001 Fig 1 A, B, qPCR of miR-181a and miR-181b in the aortic tissue. [score:1]
Losartan mitigates age -associated increase in BP and PWV in miR-181a/b deficient mice. [score:1]
Activation of TGF- β pathways in VSMCs in miR-181a/b deficient mice. [score:1]
In theory, the entire miR-181 family can bind to the same 3'-UTR region of TGF-β ligand. [score:1]
This is due to 99.9% homology between the sequences (miR-181a and miR-181c; miR-181b and miR-181d). [score:1]
Endothelial NO production in the miR-181a/b [-/-] miceTo determine if the differences in phenylephrine response curve was due to nitric oxide production, diaminofluorescein (DAF) fluorescence intensity was observed at baseline and after administration of acetylcholine in DAF loaded vascular strips. [score:1]
miR-181b but not miR-181a decreases with age. [score:1]
This further suggests that depletion of miR-181a/b promotes vascular stiffness via ECM remo deling by activating TGF-β signaling in VSMCs. [score:1]
We used male mice deficient for the miRNA clusters miR-181a1b1 (containing the miR-181a-1 and miR-181b-1 cluster, located on chromosome 1) (miR-181a1/b1 [-/-]). [score:1]
[7, 40, 41] The mature sequence of miR-181a1 and miR-181a2, and miR-181b1 and miR-181b2 are identical, but they are encoded from two different genomic loci: the miR-181a1 and miR-181b1 cluster is located on chromosome 1, and the miR-181a2 and miR-181b2 cluster is located on chromosome 9. [42] To test the baseline vascular function of miR-181 family in vivo, we used mice deficient for the miR-181a1-miR-181b1 cluster. [score:1]
We hypothesized that the chronic depletion of miR-181a/b will lead to vascular stiffening either by endothelial dysfunction or by ECM remo deling or their combination. [score:1]
Among the six mature family members, miR-181 a1, a2, b1, b2, c, and d, it has been found that miR-181a1 and miR-181b1 are the most prevalent in the aorta of mice. [score:1]
[7, 8, 10, 33] However, there is no evidence showing the role of miR-181 in baseline vascular function. [score:1]
Role of miR-181a/b in TGF-β -mediated pathways contributing to vascular stiffness. [score:1]
[11] However, the role of the miR-181 family in overall vascular function, including endothelial function and vascular stiffness, remains unknown. [score:1]
Mechanical and functional properties of the aorta in the miR-181a/b [-/-] mice. [score:1]
Endothelial NO production in the miR-181a/b [-/-] mice. [score:1]
[10] Together, these results suggest that the miR-181 family is an important modulator of vascular inflammation. [score:1]
Here we tested whether the miR-181 family can influence the pathogenesis of hypertension and vascular stiffening. [score:1]
The critical role for the miR-181 family in vascular inflammation has been documented. [score:1]
[1 to 20 of 33 sentences]
26
[+] score: 57
These data confirm that miR-181a and b, miR-9, miR-204, miR-135a, and miR-199b target endogenous SIRT1 and downregulate its expression. [score:8]
Since SIRT1 inhibition induces T-cell hyperactivation [38], miR-181a may also target SIRT1 during T cell development. [score:6]
Since activation of SIRT1 in neuronal precursors promotes astrocyte formation over neurogenesis [34], SIRT1 might represent a critical target for miR-9. Another similar example is miR-181, which is transiently upregulated during muscle differentiation [35]. [score:6]
miR-181a also regulates T-cell-receptor sensitivity and signal strength during T-cell development, in part by targeting tyrosine phosphatases [37]. [score:5]
For example, miR-181a and b function as tumor suppressors in the brain, but their loss negatively correlates with glioma grade, and restoration of their expression induces apoptosis of glioma cells [49]. [score:5]
Site-directed mutagenesis was performed using a QuikChange II Site-Directed Mutagenesis kit (Stratagene; La Jolla, CA) to mutate base pairs 3-6 in the predicted seed region targeted by miR-181 and miR-9 in the SIRT1 3'-UTR. [score:5]
Furthermore, miR-181 and miR-29 family members are downregulated in chronic lymphocytic leukemia, and miR-29 is lost in colon, breast, and lung cancer [50, 53]. [score:4]
Specifically, SIRT1 expression is repressed by miR-181a and b, miR-9, miR-204, miR-135a, and miR-199b. [score:3]
Overexpression of miR-181a and b, miR-9, miR-204, miR-135a, and miR-199b decreased SIRT1 protein levels in mESCs (Figure 4B). [score:3]
Thus, miR-181 family members and miR-9 target the 3'-UTR of SIRT1 through the predicted seed sites. [score:3]
The specificity of this inhibition was demonstrated by testing the effect of the same miRNAs on a construct in which the miR-181 seed -binding site was mutated (pGL3-SIRT1 3'-UTR 181mt; Figure 4A, left panel). [score:3]
miR-181a and b, miR-9, miR-204, miR-135a, and miR-199b target endogenous SIRT1. [score:3]
Thus, regulation of SIRT1 by miR-181 might contribute to the muscle differentiation program. [score:2]
We found that miR-181a, b, and c repressed luciferase activity by 25-30% (Figure 4A, left panel). [score:1]
[1 to 20 of 14 sentences]
27
[+] score: 43
Consistent with the role of miRNA-181a in suppressing DUSP6 expression [8], ANCD4 cells responded better when treated with a pharmacological inhibitor of DUSP, BCI, prior to activation (Figure  9J). [score:7]
Consistent with the role of miRNA-181a in suppressing DUSP6 expression [8], when NCD4lo and NCD4hi cells were treated with a pharmacological inhibitor of DUSP, (E)-2-benzylidene-3-(cyclohexylamino)-2,3-dihydro-1H-inden-1-one (BCI) prior to activation, NCD4lo cells responded better following treatment with BCI (Figure  8D), while NCD4hi cells showed no effect of BCI. [score:7]
Notably, TCR -mediated signal sensitivity in mouse T cells is also modulated by miRNA-181a [6], which represses expression of dual-specific phosphatase-6 (DUSP6), a molecule linked to human longevity [7] which suppresses phosphorylation of Erk in human T cells [8]. [score:5]
NCD4 cells from older people are reported to express lower levels of miR-181a (relative to a control miRNA, miR-142) than NCD4 cells from young people [8]. [score:3]
Our data show that miR-181a levels are lower in both ANCD4 cells and in NCD4lo cells, and the DUSP inhibitor enhances proliferative responses of both ANCD4 and NCD4lo cells. [score:3]
Indeed, miR-181a levels are lower in NCD4lo cells, and a DUSP inhibitor rescues both the poor responsiveness and the Th2-skewing of these cells. [score:3]
CD4lo cells were smaller with higher CD5 levels and lower levels of the dual-specific phosphatase (DUSP)6-suppressing micro -RNA miR181a, and responded poorly with more Th2-skewed outcomes. [score:3]
Since Erk phosphorylation has been reported to be controlled by DUSP6 in human T cells, where DUSP6 is regulated by the miR-181a, it was plausible to examine the miR-181a-DUSP axis for a role in the functional differences between NCD4lo and NCD4hi cells. [score:2]
Finally, our data also show that another molecular component regulating the hyporesponsiveness shared by both ANCD4 and NCD4lo cells is the Erk-DUSP6-miR-181a axis. [score:2]
The defective phosphorylation of Erk in human T cells is regulated by the activity of DUSP6, which in turn is controlled by miR-181a [8]. [score:2]
Figure 8 The Erk-DUSP6-miR181a axis contributes to hyporesponsiveness of NCD4lo T cells. [score:1]
Real time PCR for miR-181a and miR142. [score:1]
Thus, the miR-181a-DUSP axis is at least one mechanism contributing to the alteration of functionality over peripheral residence time in NCD4 cells. [score:1]
The Erk-DUSP6-miR-181a axis contributes to hyporesponsiveness of NCD4 T cells during peripheral residence. [score:1]
I. ΔΔCt values of Real time RT-PCR for miR-181a normalized to miR-142 on ANCD4 and YNCD4 cells (Mean ± SE from five sets of independently sorted cells). [score:1]
C. ΔΔCt values of Real time RT-PCR for miR-181a normalized to miR-142 on NCD4hi and NCD4lo cells (Mean ± SE from four sets of independently sorted cells). [score:1]
[1 to 20 of 16 sentences]
28
[+] score: 43
MiR-181 family members play a key role in the regulation of lymphocyte development and function [6- 11]; in particular, miR-181c has been shown to suppress the activation of CD4+ T cells [10]. [score:5]
MiR-181 has been shown to inhibit inflammation in astrocytes, microglia, and dendritic cells by suppressing cytokine levels [11, 14, 15, 22], and miR-181c -transfected BV2 cell culture medium reduced neuronal apoptosis induced by LPS [15]. [score:5]
MicroRNA-181a suppresses mouse granulosa cell proliferation by targeting activin receptor IIA. [score:4]
The lymphocyte miRNA microarray analysis of acute stroke patients revealed that miR-181 family members, including hsa-miR-181a/c/d, were among the top 44 down- or up-regulated miRNAs (Table 1, P < 0.05), implying that this family is clinically relevant. [score:4]
microRNA-181a represses ox-LDL -treated inflammatory response in dendritic cell by targeting c-Fos. [score:3]
Bcl-2, a mitochondrial membrane -associated protein, is a target of miR-181 that mediates miR-181a -mediated Neuro-2a cell death upon oxidative stress [14], miR-181a-triggered mitochondrial dysfunction and astrocyte death upon glucose deprivation [9], and miR-181d -induced glioma cell apoptosis [23]. [score:3]
miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. [score:3]
Hence, miR-181 causes cell injury mainly by targeting mitochondrial proteins. [score:3]
hsa-mir-181a and hsa-mir-181b function as tumor suppressors in human glioma cells. [score:3]
Inhibition of microRNA-181 reduces forebrain ischemia -induced neuronal loss. [score:3]
miR-181 regulates GRP78 and influences outcome from cerebral ischemia in vitro and in vivo. [score:2]
A previous study found that miR-181a prevented Neuro-2a cell death induced by serum deprivation or H [2]O [2]. [score:1]
In our ischemic stroke mo del, we demonstrated that the miR-181c agomir exacerbated brain ischemia-reperfusion injury, consistent with the reported effects of miR-181a in a mouse stroke mo del [13]. [score:1]
MicroRNA-181 regulates CARM1 and histone arginine methylation to promote differentiation of human embryonic stem cells. [score:1]
This is consistent with a previous observation that miR-181 levels were reduced in the brain tissue of rats subjected to transient focal ischemia [12], and were decreased in the ischemic penumbra, but increased in the ischemic core following transient focal ischemia in the mouse [13]. [score:1]
Evidence for miR-181 involvement in neuroinflammatory responses of astrocytes. [score:1]
[1 to 20 of 16 sentences]
29
[+] score: 38
Another study revealed that miR-181 could effectively suppress the expression of Lin28 expression, disrupt the Lin28-let-7 reciprocal regulatory loop, upregulate Let-7, and eventually promote the differentiation of megakaryocytic. [score:11]
MiR-181a was upregulated in AML and myelodysplastic syndromes [47, 48] but downregulated in multiple myeloma and chronic lymphocyte leukemia [49, 50]. [score:6]
Aberrant Expression of miRNAs in Lin [−]c-Kit [+] Cells of Mice Exposed to BenzeneWe detected the expression of 8 miRNAs (mmu-miR-129b-5p, mmu-miR-451a, mmu-miR-34a-5p, mmu-miR-144-5p, mmu-miR-342-3p, mmu-miR-100-5p, mmu-miR-181a-5p, and mmu-miR-196b-5p) in Lin [−]c-Kit [+] cells through qRT-PCR. [score:5]
Chen et al. [51] reported that miR-181 was preferentially expressed in B cells of bone marrow in mice; moreover, a tissue culture differentiation assay in mice showed that the fraction of B-lineage cells increased after ectopic expression in HSPCs. [score:4]
We detected the expression of 8 miRNAs (mmu-miR-129b-5p, mmu-miR-451a, mmu-miR-34a-5p, mmu-miR-144-5p, mmu-miR-342-3p, mmu-miR-100-5p, mmu-miR-181a-5p, and mmu-miR-196b-5p) in Lin [−]c-Kit [+] cells through qRT-PCR. [score:3]
In agreement with the sequencing data, the expression levels of mmu-miR-129b-5p, mmu-miR-451a, mmu-miR-34a-5p and mmu-miR-144-5p increased in the benzene exposure group, whereas the levels of mmu-miR-342-3p, mmu-miR-100-5p, mmu-miR-181a-5p, and mmu-miR-196b-5p decreased in the benzene exposure group (Figure 3). [score:3]
However, the expression of miR-181a in different hematological malignancies were inconsistent. [score:3]
Nevertheless, miR-181 had no function on hemin -induced erythrocyte differentiation [52]. [score:1]
Of these miRNAs, five miRNAs, including mmu-miR-34a-5p, mmu-miR-342-3p, mmu-miR-100-5p, mmu-miR-181a-5p and mmu-miR-196b-5p, significantly changed in mice exposed to benzene. [score:1]
Li X. Zhang J. Gao L. McClellan S. Finan M. A. Butler T. W. Owen L. B. Piazza G. A. Xi Y. MiR-181 mediates cell differentiation by interrupting the Lin28 and let-7 feedback circuit Cell Death Differ. [score:1]
[1 to 20 of 10 sentences]
30
[+] score: 31
miR-181 is thought to function partly through inhibition of Hox-A11 expression [60]. [score:5]
An acute bout of endurance exercise results in the up-regulation of miR-1 and miR-181. [score:4]
In addition, miR-181 was found to be strongly up-regulated in regenerating muscle from an in vivo mouse mo del of muscle injury [60]. [score:4]
miR-1 and miR-181 expression in the quadriceps of C57Bl/6J mice (N = 7/group) 3-hour following an acute bout of END exercise vs. [score:3]
miR-1 and miR-181 expression following exercise. [score:3]
Both miR-1 and miR-181 expression, were increased in quadriceps by 40% and 37% (END vs. [score:3]
0005610.g004 Figure 4miR-1 and miR-181 expression in the quadriceps of C57Bl/6J mice (N = 7/group) 3-hour following an acute bout of END exercise vs. [score:3]
miR-1 and miR-181 are thought to play an important role in muscle differentiation and development as positive regulators of skeletal muscle remo deling and maintenance [26]. [score:3]
miR-1 and miR-181 expression are normalized to Rnu6. [score:3]
[1 to 20 of 9 sentences]
31
[+] score: 29
Here we report that this is indeed the case; in particular, our results show that three microRNAs (miRNAs), mmu-miR-181a-1*, mmu-miR-30e and mmu-miR-34a, show no age -dependent up-regulation in CR animals, seen in ad lib-fed controls, nor reciprocal up-regulation of their target, the Bcl-2 gene. [score:9]
Immunocytochemistry analysis of miRNA (mmu-miR-34a, mmu-miR-30e and mmu-miR-181a-1*) suppression of endogenous Bcl-2 in both 293 (A) and NIH-3T3 (B) cell strains. [score:3]
Among these, three microRNAs, mmu-mir-181a-1*, mmu-mir-34a and mmu-mir-30e, exhibit the most significant down-regulation in brains of CR-fed mice, in an age -dependent manner, compared to ad lib-fed mice (Figure 1B). [score:3]
In the present study, our data report that lead microRNAs (mmu-miR-181a-1*, mmu-miR-30e and mmu-miR-34a) are not up-regulated in the older CR mouse brain, compared with their ad lib counterparts. [score:3]
Figure 3. Immunocytochemistry analysis of miRNA (mmu-miR-34a, mmu-miR-30e and mmu-miR-181a-1*) suppression of endogenous Bcl-2 in both 293 (A) and NIH-3T3 (B) cell strains. [score:3]
)Among these, three microRNAs, mmu-mir-181a-1*, mmu-mir-34a and mmu-mir-30e, exhibit the most significant down-regulation in brains of CR-fed mice, in an age -dependent manner, compared to ad lib-fed mice (Figure 1B). [score:3]
In brief, 1 × 10 [6] cells were suspended in 100 μL nucleofector solution, and transfected with 5 μg of plasmids (vector control, scrambled control, mmu-miR-34a, mmu-miR-30e or mmu-miR-181a-1*). [score:1]
For co-transfection, the Bcl-2 3'UTR construct was co -transfected with vector alone, scrambled control, miR-34a, miR-30e and miR-181a-1* (1:1 ratio). [score:1]
Figure 2. (A) In situ hybridization (ISH) detection of miRNAs (mmu-miR-34a, mmu-miR-30e and mmu-miR-181a-1*)in mouse brain tissues from both CR- and Ad lib-fed mice. [score:1]
Graphical representations of densitometric analysis of miRNA (mmu-miR-34a, mmu-miR-30e and mmu-miR-181a-1*) staining in cortex and hippocampal regions. [score:1]
Graphical representations of densitometric analysis of miRNA (mmu-miR-34a, mmu-miR-30e and mmu-miR-181a-1*) hybridization in cortex and hippocampal regions. [score:1]
[1 to 20 of 11 sentences]
32
[+] score: 28
As shown, the expression levels of miR-183 and miR-181 were significantly downregulated, while miR-29a and miR-34a were upregulated with aging compared to P21. [score:8]
In the inner ear, miR-181a is upregulated during regeneration of the sensory epithelium in the basilar papilla of chicken, suggesting that miR-181a is involved in mechanisms that control proliferation and differentiation in the auditory sensory epithelium [19]. [score:4]
Among all the family members, miR-181a/b/d exhibited significant downregulation in the OC of both strains in our microarray analyses and q-PCR validation. [score:4]
The two downregulated miRNAs, miR-181 and miR-183, are important for proliferation and differentiation, respectively [39]– [42]. [score:4]
miRNAs that were significantly downregulated include members of the miR-181 and miR-183 families. [score:4]
The anti-apoptotic category of miRNAs includes miR-17, miR-181a/b/d, and miR-182/183 [45]. [score:1]
The miR-181 family is known to mediate proliferation in many cells [54], [65], [66]. [score:1]
miR-181a has been specifically shown to have a proliferative effect in human myeloid leukemia cells [67]. [score:1]
Other studies have shown that miR-181a and the let-7 family play important roles in hair cell regeneration in chicken and newt [18]– [20]. [score:1]
[1 to 20 of 9 sentences]
33
[+] score: 26
Auxiliary pairing regulates miRNA–target specificity in vivoAs a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:7]
identified functional, non-canonical regulation globally for miR-128 and miR-124 (Fig. 2), and for individual miR-9, miR-181, miR-30 and miR-125 targets (Fig. 4f and Fig. 8b–m). [score:4]
As a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:4]
Smad7, a previously confirmed miR-181a target, served as a positive control 68. [score:3]
miRNA mimics repressed most miR-9 (6/7) and miR-181a (5/6) targets examined, including all with canonical seeds and several with seedless interactions and no canonical seed matches in their 3′-UTRs (Fig. 4f). [score:3]
Analysis of miR-125 and miR-181 families revealed additional intra -family target preferences (Supplementary Fig. 9a–d). [score:3]
Similarly, miR-181 family members were enriched in both seed -dependent and -independent classes. [score:1]
Interestingly, a number of major miRNAs enriched for seedless interactions (for example, miR-9, miR-181, miR-30 and miR-186) have AU-rich seed sites, indicating that weak seed-pairing stability may favour seedless non-canonical interactions 10. [score:1]
[1 to 20 of 8 sentences]
34
[+] score: 26
Moreover, the commonly upregulated oral cancer specific miR-181a-3p which does not have interaction site with OIP5-AS1 remains upregulated (P = 0.0319) in undifferentiated tumors suggesting that the other miRNAs might be tightly regulated by overexpressed OIP5-AS1 through its sponging activity. [score:10]
For expression studies, along with the 6 miRNAs, miR-140-5p which were shown to control the tumor metastasis in HNSCC and miR-181a-3p, an oral cancer-specific upregulated miRNA that was included as a background control to study lncRNA OIP5-AS1’s sponging activity. [score:6]
miR-137 which shares the least common downstream target and miR-181a-3p which don’t have interaction site with OIP5-AS1 and nor seed match for stemness TFs was upregulated in undifferentiated oral tumors. [score:6]
However, the oral cancer specific miRNA, miR-181a-3p was upregulated in the undifferentiated oral tumors (Fig.   3b). [score:4]
[1 to 20 of 4 sentences]
35
[+] score: 23
Moreover, miR-181 is showed to be involved in synaptic plasticity and memory processing of Alzheimer's disease mice via targeting functional gene expression (Rodriguez-Ortiz et al., 2014). [score:7]
Upregulation of miR-181 decreases c-Fos and SIRT-1 in the hippocampus of 3xTg-AD mice. [score:4]
To be noted, study has pointed out that MEG3 serves as a competing endogenous RNA for miR-181 in other disease mo del. [score:3]
miR-181 regulates GRP78 and influences outcome from cerebral ischemia in vitro and in vivo. [score:2]
MiR-181 suppressed proliferation, migration, and invasion of astrocytoma and was proved to be involved in neuroinflammatory responses of astrocytes (Hutchison et al., 2013; Zhi et al., 2014). [score:2]
Basing on our data and online reference, we proposed that MEG3 might function as a regulator for miR-181 in ischemic neuron. [score:2]
Evidence for miR-181 involvement in neuroinflammatory responses of astrocytes. [score:1]
Interestingly, MEG3 has been recognized as a competing endogenous RNA for miR-181 in other experiments (Peng et al., 2015). [score:1]
As for brain ischemia, miR-181 contributes to astrocyte, a neuroprotective cell for brain ischemia (Ouyang et al., 2014), cell apoptosis in ischemic injury brain and in vitro glucose deprivation cultured astrocyte (Ouyang et al., 2012). [score:1]
[1 to 20 of 9 sentences]
36
[+] score: 23
Compared to ALK(−) ALCLs, miR-203, miR-135b, miR-886-5p/3p, miR-20b, miR-106a and miR-183 were significantly upregulated in ALK(+) ALCLs while others (miR-155, miR-181a, miR-210, miR-29a/b, miR-342-5p/3p, miR-369-3p miR-374a/b, miR-423-5p, miR-625, miR-205, miR-146a and miR-26a) were down-regulated (Table 1). [score:6]
Thus, the decreased expression of miR-181a and the increased expression of miR-203 in ALK(+) ALCL might provide a mechanism by which these tumors escape immune surveillance. [score:5]
Furthermore, miR-203 was identified by Steinhilber and colleagues as part of a signature of three miRNA (miR-181a, miR-146b-5p and miR-203) significantly regulated by the C/EBPβ transcription factor, which is specifically overexpressed in ALK(+) ALCL cell lines and shown to promote tumoral cell proliferation and survival (Table 2 and Table 3). [score:4]
Surprisingly, only few miRNA identified as part of the signature distinguishing ALK(+) ALCL from T-cells or ALK(−) ALCL were affected by ALK knockdown: miR-20b, miR-106a, miR-886-5p and miR-181a. [score:2]
In addition, this miRNA is one of the three miRNA (miR-181a, miR-146b-5p and miR-203) regulated by the C/EBPβ transcription factor. [score:2]
miR-181a regulates T-cell differentiation and modulates TCR (T Cell Receptor) signaling strength. [score:2]
2.3.2. miR-181a and miR-16 as Regulators of Tumor Microenvironment. [score:2]
[1 to 20 of 7 sentences]
37
[+] score: 18
Selection of the differentially expressed miRNAs under the relatively strict conditions (≥500 sequence reads in at least one of the libraries selected for comparison, ≥5-fold difference in expression, and a p value of ≤ 0.01) identified nine upregulated miRNAs (let-7e-5p, miR-101a-3p, miR-151-5p, miR-181a-5p, miR-204-5p, miR-340-5p, miR-381-3p, miR-411-5p, miR-9-5p, and miR-219-2-3p) at 3 d, but none at 7 d or 14 d, suggesting that these upregulated miRNAs impact biological functions, particularly during the early stages after nerve allotransplantation with FK506 immunosuppression. [score:13]
Among the nine upregulated miRNAs (let-7e-5p, miR-101a-3p, miR-151-5p, miR-181a-5p, miR-204-5p, miR-340-5p, miR-381-3p, miR-411-5p, miR-9-5p, and miR-219-2-3p), miR-9-5p had the highest fold-change (≥50-fold at 3 d), followed by miR-340-5p with 38.8-fold. [score:4]
Nine candidate miRNAs (let-7e-5p, miR-101a-3p, miR-151-5p, miR-181a-5p, miR-204-5p, miR-340-5p, miR-381-3p, miR-411-5p, and miR-9-5p) were identified. [score:1]
[1 to 20 of 3 sentences]
38
[+] score: 18
In particular, the up-regulation of microRNA-709, microRNA-320 and microRNA-128a, and down-regulation of microRNA-181a-1-3p, microRNA-30b and microRNA-374 were confirmed by RT-PCR (Fig. 3E). [score:7]
In this regard, the evidence of microRNA-181a-1-3p down-regulation associated with DP cells reduction in the thymus of Tat-Tg mice suggests that the partial maturation block from DN4 to DP step could be consequence of Tat repression of mir-181a-1-3p expression. [score:6]
Over -expression of the precursor mir-181a-1 in DN thymic progenitors was previously shown to increase the number of DP cells 59. [score:3]
Among others, microRNA-181a-1-3p was significantly down regulated in Tat-Tg mice. [score:2]
[1 to 20 of 4 sentences]
39
[+] score: 17
In order to mitigate the observed off- target transgene expression in ganglion cells following intravitreal delivery of hGRK1-containing AAV vectors, we incorporated a target sequence for miR181, an miRNA shown to be expressed exclusively in ganglion cells and inner retina into our AAV vectors (Atlas of miRNA distribution: http://mirneye. [score:9]
Similar to methods previously described, [32] we further restricted transgene expression to PRs by incorporating multiple target sequences for miR181, an miRNA endogenously expressed in cells of the inner and middle retina. [score:7]
A hGRK1-GFP-miR181c construct was also generated and packaged in AAV2(quad Y−F+T−V) by inserting four tandem copies of complementary sequence for mature miR-181 (5′ ACTCACCGACAGGTTGAA 3′) (Atlas of miRNA distribution: http://mirneye. [score:1]
[1 to 20 of 3 sentences]
40
[+] score: 17
Expressions of miR-1, miR-9*, miR-26b, miR-96, miR-129-3p, miR-133, miR-138, miR-181a, miR-182, miR-335 and let7-d were explored by in situ hybridization (ISH) using locked nucleic acid (LNA) probes (Exiqon). [score:3]
In relation to the eye, miR-7 has been shown to play an important role in photoreceptor differentiation in Drosophila [25] and other miRs, such as miR-9, miR-96, miR-124a, miR-181, miR-182, and miR-183, were found to be highly expressed during morphogenesis of the zebrafish eye [16]. [score:3]
MiR-181a was strongest in expression among these three miRs and was detected in the inner part of the INL, probably corresponding to amacrine cells and in the ganglion cell layer (Figure 3b). [score:3]
Note that columns are in descending order of difference between retinal and platform expression; y-axes are to different scales; and bars for miR-181a in brain and miR-204 in mouse platform are missing in panel a because of incomplete data. [score:3]
Previously, miR-9, miR-29c, miR-96, miR-124a, miR-181a, miR-182, miR-183, and miR-204 were localized in the mouse retina by ISH [26- 28]. [score:1]
Eyes from 1-month-old c57 animals were fixed in 4% paraformaldehyde, and 12 μm cryosections were in situ hybridized with 5'-digoxigenin labeled locked nucleic acid (LNA) microRNA (miR) probes for (a) let-7, (b) miR-181a, and (c,d) miR-182. [score:1]
Both let-7 and miR-181a were mainly localized in the nuclear layers (Figure 3a,b), in contrast, miR-182 labeling was weaker in the ONL (cell bodies) but was strongly localized in the photoreceptor inner segments and between the ONL and INL, possibly in photoreceptor synapses (Figure 3c,d). [score:1]
It is notable that only the analysis of let-7, miR-181a, and miR-182 produced detectable signals (Figure 3). [score:1]
In mouse, a number of miRs (for instance, miR-181a, miR-182, miR-183 and miR-184) were detected at high levels in various parts of the eye, including the lens, cornea, and retina [26, 27]. [score:1]
[1 to 20 of 9 sentences]
41
[+] score: 16
Other miRNAs from this paper: mmu-mir-181a-2, hsa-mir-181a-2, hsa-mir-181a-1
Ras proteins interact with multiple downstream effector pathways, the best studied of which are those involved in mitogenic signalling, such as the RAF/MEK/ERK pathway, and survival, such as the phosphoinositol-3 kinase (PI3K)/PDK/AKT pathway 2. Among ras oncogenes, K- ras is the most frequently activated in human tumours, with missense mutations at codons 12, 13, and 61 resulting in decreased GTPase activity and constitutive signalling 3. Although in some countries, such as India, the prevalence of K-RAS mutations in oral squamous cell carcinomas is as high as 50%, due to environmental factors, in Western countries such as the UK the prevalence is much lower, ∼5% 4– 6. Following analysis of micro -RNA expression patterns in human oral squamous cell carcinomas (OSCC), Shin et al 6 concluded that miR-181a functions as an OSCC suppressor by targeting the K-RAS oncogene, suppressing expression of mutant K-RAS in OSCC cell lines and inhibiting their growth in culture, indicating the importance of mutated K-RAS as a driver mutation for OSCC growth. [score:16]
[1 to 20 of 1 sentences]
42
[+] score: 16
Additionally, over -expression of miR-181a down regulated cyclin D2 and PCNA expression by binding to the target gene acvr2a in the granulosa cells, resulting in the inhibition of cellar proliferation [12]. [score:10]
Previous research reported that miR-181a expression was down-regulated in a dose- and time -dependent manner under activin A treatment in mouse granulosa cells (mGC). [score:6]
[1 to 20 of 2 sentences]
43
[+] score: 16
For example, miR-181a overexpression facilitated proliferation, migration, autophagy, and decreased apoptosis by suppressing interferon regulatory factor 2 (IRF2) expression in lung cancer [19]. [score:8]
These results discovered that TP53TG1 -mediated increase of cisplatin sensitivity and apoptosis was abated following the restoration of miR-18a expression in A549/DDP cells, while si-TP53TG1 -induced decrease of cisplatin sensitivity and apoptosis was antagonized after transfection miR-181a inhibitor in A549 cells. [score:5]
Firstly, the effect of miR-181a and TP53TG1 on PTEN expression was explored in A549 cells by transfecting with miR-18a mimics, anti-miR-18a, si-TP53TG1#1 or pcDNA-TP53TG1. [score:3]
[1 to 20 of 3 sentences]
44
[+] score: 16
In this study, miR-181a was identified as an miRNA differentially expressed in T and B cells, and the ectopic expression of miR-181a generated a substantial increase in the generation of B cells both in vitro and in vivo [11]. [score:5]
However, miR-181a was shown to downregulate the threshold of TCR signaling in thymocytes [28]. [score:4]
Bartel's group first demonstrated that miR-181a is differentially expressed in T and B cells. [score:3]
Ectopic expression of miR-181a in HSCs results in an increase in B cells both in vivo and in vitro [11]. [score:3]
The first miRNA reported to have a role in B cell differentiation was miR-181a [11]. [score:1]
[1 to 20 of 5 sentences]
45
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-29a, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-194-1, mmu-mir-200b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-140, hsa-mir-194-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-29a, mmu-mir-96, mmu-mir-34a, mmu-mir-135b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-17, mmu-mir-200c, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-376c, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-135b, mmu-mir-181b-2, mmu-mir-376b, dre-mir-34a, dre-mir-181b-1, dre-mir-181b-2, dre-mir-182, dre-mir-183, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-15a-1, dre-mir-15a-2, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-29a, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-181c, dre-mir-194a, dre-mir-194b, dre-mir-200b, dre-mir-200c, hsa-mir-376b, hsa-mir-181d, hsa-mir-507, dre-let-7j, dre-mir-135b, dre-mir-181a-2, hsa-mir-376a-2, mmu-mir-376c, dre-mir-34b, dre-mir-34c, mmu-mir-181d, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, mmu-mir-124b
The data verified that two miRNAs, miR-29a and -34a, which have been implicated in apoptotic pathways, are up-regulated and the two miRNAs, miR-181 and -183, which have been shown to have roles in proliferation and differentiation, are down-regulated While it is believed that a major cause of ARHL is the death of hair cells, other age-related changes in the central auditory pathways cannot be ruled out. [score:7]
Overexpression of miRNA-181a was indeed able to stimulate proliferation within the basilar papilla, with new cells labeling with the hair cell marker myosin VI. [score:3]
Gene expression analysis of forskolin treated basilar papillae identifies microRNA181a as a mediator of proliferation. [score:2]
miR-181a, which was greatly enriched in the proliferating basilar papilla and as it had previously been identified to have a role in promoting proliferation in a human leukemia cell line, was selected as a hair cell proliferation candidate. [score:1]
A subsequent study further explored miR-181a involvement in the pro-proliferative processes in chickens (Frucht et al., 2011). [score:1]
Cells were transfected with pre-miRNA181a or anti-miR181a and imaged. [score:1]
A significant number of new hair cells could be observed, providing a role of miR-181a in the pro-proliferative process. [score:1]
[1 to 20 of 7 sentences]
46
[+] score: 16
Gnai1 was suppressed by mmu-miR-381 and mmu-miR-181a/b/c, and inhibited by Rgs1 and Rgs19 in the spinal cord of Ews/Ewsr1 KO mice. [score:5]
In the order of the significance score by SAM, 15 up-regulated miRNAs are mmu-miR-127, mmu-miR-410, mmu-miR-433, mmu-miR-138, mmu-miR-181c, mmu-miR-382, mmu-miR-19b, mmu-miR-381, mmu-miR-666-3p, mmu-miR-376a, mmu-miR-873, mmu-miR-181a, mmu-miR-383, mmu-miR-181b, and mmu-miR-99b. [score:4]
In the spinal cord of Ews/Ewsr1 KO mice, microRNAs, such as mmu-miR-381 and mmu-miR-181a/b/c were up-regulated. [score:4]
Notably, increased levels of mmu-miR-381 and mmu-miR-181a/b/c were directly associated with the down regulation of G protein complex in the spinal cord of Ews/Ewsr1 KO mice. [score:3]
[1 to 20 of 4 sentences]
47
[+] score: 16
The qPCR analysis confirmed that Dgcr8 [Δ/Δ] NSCs did not express mature miRNAs such as miR-20a, miR-181a, let-7b, and miR-9/9 [∗], which are abundantly expressed in Dgcr8 [flox/ flox] NSCs (Figure 2D). [score:5]
Among the miRNAs examined, we found that let-7b, miR-20a, and miR-181a were reliably expressed in the Dgcr8 [flox/ flox] TTFs, but expression of all three miRNAs was reduced to negligible levels in the Dgcr8 [Δ/Δ] TTFs (Figure 1B), which is consistent with the previous report (Kim et al., 2012). [score:5]
Together with the Yamanaka factors (OCT4, SOX2, KLF4, and c-MYC) (Takahashi and Yamanaka, 2006), co -expression of the miRNA cluster 302/367 or 106a/363; members of the miR-302, miR-294, or miR-181 family; or miR-93 and miR-106b greatly enhance iPSC derivation efficiency (Judson et al., 2013, Li et al., 2011, Liao et al., 2011, Lin et al., 2011, Subramanyam et al., 2011). [score:3]
Recent work has demonstrated that miRNAs such as miR-294, miR-302, and miR-181 family members facilitate (Judson et al., 2013, Li et al., 2011, Liao et al., 2011, Lin et al., 2011, Melton et al., 2010, Subramanyam et al., 2011), but let-7 family members inhibit, reprogramming (Melton et al., 2010, Unternaehrer et al., 2014). [score:3]
[1 to 20 of 4 sentences]
48
[+] score: 16
Furthermore, qPCR was performed again to validate the downregulated and upregulated expression of selected miRNAs that may be relevant to development and confirmed that miR-135, miR-302, miR-449a, miR-200b, miR-200c, miR-193b, miR-130, and miR-141 were downregulated, whereas miR-10a, miR-181, and miR-470 were upregulated by RA treatment (Fig 4C and 4D). [score:16]
[1 to 20 of 1 sentences]
49
[+] score: 15
Overexpression of miR-181a in hepatocytes can suppress SIRT1 at the protein level and therefore reduce insulin sensitivity [63]. [score:5]
One of the main targets of miR-181 is the ATM mRNA, an important cell cycle checkpoint kinase [61] that has role in repairing double strand DNA breaks [62]. [score:3]
miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. [score:3]
In astrocytes, the reduction of miR-181a expression was associated with reduced cell death, reduced oxidative stress, and increased mitochondrial function [64]. [score:3]
The mir-181 family has a role in differentiation of hematopoietic cells [60], and was shown to be induced by TGF-β ligands [61]. [score:1]
[1 to 20 of 5 sentences]
50
[+] score: 15
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
DEX treatment up-regulated the expression of miRNA-483, miRNA-181a-1, miRNA-490 and miRNA-181b-1, while it down-regulated the levels of miR-122, miR-466b, miR-200b, miR-877, miR-296, miRNA-27a and precursor of miR-504. [score:9]
The expression of miRNA-483, miRNA-181a-1, miRNA-490 and miRNA and miRNA-181b-1 was up-regulated in response to dexamethasone treatment. [score:6]
[1 to 20 of 2 sentences]
51
[+] score: 15
Many of the other shared miRNAs had higher levels of expression in neurons than in MG; these include miR-181a, let-7g, miR-30c and let-7d; let-7c is the only miRNA in the shared group with higher expression levels in MG than in neurons, but does not fall in the mGliomiR category (expression levels in neurons >20%, Fig. 2C, Supplement Table 2). [score:7]
Three of the top four miRNAs expressed in adult MG, miR-204, miR-125-5p and miR-181a, showed large increases in their expression between the P11 and adult, while miR-9, did not increase. [score:5]
For example, miR-204, miR-9, and miR-181a, the most highly expressed miRNAs in MG, showed the greatest decline in vitro, together with some members of the let-7 family. [score:3]
[1 to 20 of 3 sentences]
52
[+] score: 14
When murine macrophages were incubated with docetaxel at 0.8 μg/ml for 1 h, only miR-146a expression was significantly increased in comparison with the control (Figure 7D); 3 hours later, the expression of miR-155, miR-150 and miR-146a was significantly increased (Figure 7B, C, D) while miR-181a and miR-125b had no significant changes (Figure 7A, E). [score:5]
Three hours later, miR-155, miR-150 and miR-146a expressions were enhanced (Figure 7B, C, D), while miR-181a and miR-125b showed no significant change (Figure 7A, E). [score:3]
Expression levels of microRNAs (miR-181a, miR-155, miR-150, miR-146a and miR-125b) were detected according to our lab previously described by Yuan et al. [21]. [score:3]
Previous studies have shown that miR-155, miR-150, miR-146a, miR-181a and miR-125b are involved in the innate immune reactions. [score:1]
In this study, miR-181a, miR-155, miR-150, miR-146a and miR-125b were analyzed to identify microRNAs possibly involved in responses to docetaxel stimulation (Figure 7). [score:1]
Real-time PCR was performed to determination of miR-181a (A), miR-155 (B), miR-150 (C), miR-146a (D) and miR-125b (E) as described in methods. [score:1]
[1 to 20 of 6 sentences]
53
[+] score: 14
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-27b, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-182, mmu-mir-199a-1, mmu-mir-122, mmu-mir-143, mmu-mir-298, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-27a, mmu-mir-31, mmu-mir-98, mmu-mir-199a-2, mmu-mir-181b-1, mmu-mir-379, mmu-mir-181b-2, mmu-mir-449a, mmu-mir-451a, mmu-mir-466a, mmu-mir-486a, mmu-mir-671, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-491, mmu-mir-700, mmu-mir-500, mmu-mir-18b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-669e, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-669a-10, mmu-mir-669a-11, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-486b, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-145b, mmu-let-7j, mmu-mir-451b, mmu-let-7k, mmu-mir-126b, mmu-mir-466c-3
To validate the miR array data, we studied several differentially expressed miRs (upregulated miRs: miR-122 and miR-181a and downregulated miRs: miR-23a, miR-18b, miR-31, and miR-182). [score:9]
Real-Time PCR analysis demonstrated upregulated expression of miR-122 and miR-181a in thymocytes treated with TCDD when compared to vehicle -treated thymocytes (Fig 2A–B). [score:5]
[1 to 20 of 2 sentences]
54
[+] score: 14
Regulation of CXCR4 function by miRNAs may also occur at the signaling level as another regulator of NK cell development, miR-181, was shown to repress PTEN expression in NKT cells thus allowing proper CXCL12-stimulation of Akt without affecting CXCR4 expression during thymic development (54). [score:9]
In human, miRNA-181 expression increases during NK cell maturation and promotes NK cell differentiation by regulating Notch signaling, essential for lymphocyte development (26). [score:5]
[1 to 20 of 2 sentences]
55
[+] score: 14
As compared with cells under normxia, miR-711, miR-714, miR-328, miR-346, miR-210, miR-744, miR-5130, miR-181a and miR-2137 were significantly over-expressed in hypoxia/reperfusion treated cardiomyocytes, while the expression of miR-491, miR-211, miR-532, miR-185, miR-425, miR-128, miR-24 was down-regulated (Figure 4B). [score:7]
For example, miR-2137, miR-5130 and miR-5112 were highly expressed in heart tissues; miR-490, miR-491, miR-181, miR-362, miR-425, and miR-3104 were expressed at quite a low level (Ct value ∼ over 30), whereas 32 out of those 58 altered miRNA were expressed at an extremely low level in hearts and there were almost no Ct value detected by qPCR. [score:7]
[1 to 20 of 2 sentences]
56
[+] score: 14
Suppression of miR-181-a/-b produced a significant delay in tumour development in a mouse mo del of MM, confirming that this miRNA nourishes MM tumour growth. [score:4]
Pichiorri et al. [25] have shown that miR-181-a/-b, miR-106b~25 and miR-32 are up-regulated in MGUS, MM primary cells and cell lines. [score:4]
Moreover, miR-21, as well as miR-181-a/-b, is upregulated in two drug resistant MM cell lines when compared with parental line [31]. [score:3]
Finally, miR-181-a/-b were significantly upregulated in two drug resistant MM cell lines when compared with parental line [31]. [score:3]
[1 to 20 of 4 sentences]
57
[+] score: 13
For example, differences in the transcripts level of two microRNA were detected (Table S2 in): mir181-b was downregulated in the 3NF/pCI, while mir1186 was downregulated in K3/pCI. [score:7]
Interestingly, mir181-b inhibits the expression of importin-α3 that is crucial for translocation of NF-κB from cytoplasm to nucleus. [score:5]
The level of mir181-b is reduced after proinflamatory stimulation, e. g., by TNF-α and the transcription of NF-κB -dependent genes can be activated (33). [score:1]
[1 to 20 of 3 sentences]
58
[+] score: 13
Specifically, miR-181 family members (including miR-181c) were found to be upregulated in hepatocarcinoma stem cells [64] and are misexpressed in different forms of leukemia [68], [69], [70]. [score:6]
This suggests distinct commitments of Smad2/3 in either the transcriptional (Smad4 -dependent) or post-transcriptional (Smad4-independent) regulation of miR-181 family members. [score:2]
Interestingly, several studies have demonstrated the deregulation of the miR-181 family [64], [65], [66], [67], [68], [69], [70] and members of the pri-miR-341∼3072 cluster [71], [72], [73], [74], [75], [76], [77], [78], [79], in various forms of cancer. [score:2]
However, in this study siRNA knockdown of Smad4 actually increases mature levels of miR-181 family members, consistent with a Smad4-independent role for Smad effectors, as demonstrated by previous studies [44], [45], [46]. [score:2]
miR-181 family members and miR-382 have been previously reported to respond to TGF-β/Activin treatment in different cells and tissues [46], [61], [62], [63]. [score:1]
[1 to 20 of 5 sentences]
59
[+] score: 12
Similarly, while miR-133a and miR-181 were down-regulated, the mRNA level of their target, pro-survival gene Mcl1 [36, 37] was up-regulated in the CR heart (Fig. A in S2 File). [score:9]
miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. [score:3]
[1 to 20 of 2 sentences]
60
[+] score: 12
In this work, we have discovered that, knockdown of Beclin‐1 by siRNA protected the cells from miR181‐5p‐ADSC‐induced autophagy and propose that miR‐181‐5p induces autophagy by inhibiting the STAT3/Bcl‐2/Beclin 1‐dependent pathway. [score:4]
Furthermore, the up‐regulated expression of fibrotic genes in HST‐T6 cells induced by TGF‐β1 was repressed following the addition of isolated miR181‐5p‐ ADSC exosomes compared with miR‐67‐ ADSCexosomes. [score:3]
We found that miR181‐5p down‐regulated STAT3 and Bcl‐2 and activated autophagy in HST‐T6 cells. [score:2]
Exosomes from miR181‐5p‐ ADSCs down‐regulated Stat3 and Bcl‐2 and activated autophagy in the HST‐T6 cells. [score:2]
By exploiting the characteristics of exosome excretion, we have shown that up‐regulated expression of fibrotic genes in HST‐T6 cells induced by TGF‐β1 was repressed following the addition of isolated exosomes containing miR181‐5p compared with exosomes containing the control miR‐67 from C. elegans. [score:1]
[1 to 20 of 5 sentences]
61
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-33b, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
A detailed analysis was made on the four most significantly down-regulated miRNAs, namely miR-33, miR-330, miR-181a, and miR-10b, as determined through microarray analysis and qRT-PCR. [score:4]
Formaldehyde exposure also altered the expression level of miR-181a, which has known associations with leukemogenesis (Marcucci et al., 2009). [score:3]
A stringent computational matching approach was used to identify predicted mRNA targets for miR-33, miR-330, miR-181a, and miR-10b. [score:3]
Nevertheless, the dysregulation of miR-181a upon exposure to formaldehyde is of interest. [score:2]
[1 to 20 of 4 sentences]
62
[+] score: 12
Consistent with these results, miR-181 has also been reported to be upregulated in various human cancer types, including CRC (Nakajima et al., 2006; Xi et al., 2006; Schetter et al., 2008; Degagne et al., 2014; Liu et al., 2014), hepatocellular cancer (Wang et al., 2010a), breast cancer (Mansueto et al., 2010) and ovarian cancer (Parikh et al., 2014). [score:4]
Among them, human miR-181a/b have more gene copies (Ji et al., 2009) and higher expression levels (Landgraf et al., 2007) than miR-181c/d. [score:3]
We identified miRNAs in the miR-181 family as the top candidates. [score:1]
During the CRC oncogenic process, miR-181 can promote tumor growth and metastasis (Ji et al., 2014) and is tightly associated with a poor prognosis (Nishimura et al., 2012) and the chemoresponse of CRC patients (Nakajima et al., 2006). [score:1]
There are four miR-181 family members (miR-181a/b/c/d) encoded by three independent transcripts on three separate chromosomes. [score:1]
In addition, miR-181a/b have been more closely implicated in cancer than miR-181c/d, and have thus received more attention in the miRNA field (Mansueto et al., 2010; Wang et al., 2010a; Liu et al., 2014; Parikh et al., 2014). [score:1]
For miR-181a/b, the minimum free energy value of the hybrid between miR-181b and the conserved binding site on the PDCD4 3′-UTR is -17.4 kcal/mol and is lower than that of miR-181a (−16.2 kcal/mol), suggesting that miR-181b may bind more tightly to PDCD4 3′-UTR than miR-181a. [score:1]
[1 to 20 of 7 sentences]
63
[+] score: 11
Taylor MA Sossey-Alaoui K Thompson CL Danielpour D Schiemann WP TGF-β upregulates miR-181a expression to promote breast cancer metastasisJ Clin Invest. [score:6]
Harekrushna Panda T-DC Xiaoping L Nasser C Endometrial miR-181a and miR-98 expression is altered during transition from normal into cancerous state and target PGR, PGRMC1, CYP19A1, DDX3X, and TIMP3J Clin Endocrinol Metab. [score:5]
[1 to 20 of 2 sentences]
64
[+] score: 11
To validate this correlation, we transfected five EVs miRNAs (miR-27b-3p, miR-10a-5p, miR-21-5p, miR-181a-5p and miR92a-3p) in UCB-CD34+ cells (Figure 3B) confirming the down-regulation of their predicted target genes (miR-27b-3p/MPL and ZFP36, miR-10a-5p/MPL, miR-21-5p/ANXA1, miR-181a-5p/CEBPA and EGR2, miR92a-3p/ CEBPA and EGR2) (Figure 3C). [score:6]
In fact, UCB-CD34+ cells, after overexpression of miR-21-5p, miR-181a-5p and miR92a-3p showed a significant decrease of apoptosis pathway and of caspase 3/7 activity. [score:3]
UCB-CD34+ were transfected with 60 nM of miRNA precursor molecules (miR-27b-3p mimic, miR-10a-5p mimic, miR-21-5p mimic, miR-181a-5p mimic and miR92a-3p mimic) (Life Technologies) or negative control (Life Technologies) using Lipofectamine 2000 (Life Technologies), according to the manifacturer's instructions. [score:1]
To further confirm apoptosis process reduction due to BM-MSC-derived EVs miRNAs, we transfected together miR-21-5p, miR-181a-5p and miR92a-3p (Figure 4E) in UCB-CD34+. [score:1]
[1 to 20 of 4 sentences]
65
[+] score: 11
miR-181 is upregulated during myocyte differentiation and represses homeobox protein Hox-A11, a repressor of muscle-cell differentiation, thereby allowing new muscle growth [81]. [score:4]
In addition to well-known myomiRs, recent studies have demonstrated that miR-486 [49], miR-378 [50], miR181a [80], miR-21a, miR-101a, and miR-151 [54] are also involved in regulation of myogenesis and several other ubiquitously expressed miRNAs have also been found to participate in myogenesis, including miR-26a [51], miR-27b [52, 53], and miR-29 [44]. [score:4]
The expression of miR-133 (miR-133a, miR-133b), miR-1, and miR-181 (miR-181a, miR-181b, and miR-181c) was profiled in muscle from patients affected by myotonic dystrophy type1 and it was observed that they were specifically induced during myogenesis [82]. [score:3]
[1 to 20 of 3 sentences]
66
[+] score: 11
By analyzing these 6 miRNAs using RT-PCR, we found that miR-140 and miR-181a are significantly down-regulated in the Nr2f1 [–/–] inner ear by 4.5-fold (P=0.004) and 1.7-fold (P=0.046) compared with wildtype (WT), respectively, while the other 4 miRNAs were not significantly down-regulated (Figure 2A ). [score:6]
Of note, miR-140, -181b and -191 each have a putative NR2F1 binding site close to the proximal portion of their genes and since miR-181b is found in a family cluster we also included miR-181a and -181c, which may be coregulated and share similar gene targets. [score:4]
This suggests a tissue-specific role for miR-140 and miR-181a in the Nr2f1 [–/–] inner ear. [score:1]
[1 to 20 of 3 sentences]
67
[+] score: 11
In our experimental conditions, 18 h post OxS, we observed an increase in TNF-α and IL-1β levels and 4 h post OxS we observed a decrease in miR-181-5p and miR-146a; these miRNAs are known to target TNF-α and IL-1β, respectively [79]. [score:3]
In response to OxS, the expression levels of miR-21-5p, miR-1195, miR-181a-5p, and miR-191-5p (as shown in Fig.   8) were changed significantly and this could result in the observed increased levels of STAT3. [score:3]
miR-21-5p, miR-181a-5p, and miR-1195 shown in the present study to be altered significantly in response to O [3] have also been shown to directly interact with STAT3. [score:2]
The levels of microRNAs (miR-21-5p, miR-181a-5p, miR-1195) in response to O [3] are shown in Table  1; these are known to interact directly with STAT3. [score:2]
miR-1195 has been shown by in silico analysis to bind STAT3 [62], while miR-181a-5p has been shown with quantitative RT-PCR to be increased after activation of STAT3 by IL-6 [63]. [score:1]
[1 to 20 of 5 sentences]
68
[+] score: 10
As each miRNA can have multiple targets, we performed an analysis to discover additional mRNA genes that are computationally predicted to be targets of the three most highly expressed miRNAs, miR-182, miR-181a and miR-26a. [score:7]
The second most abundant miRNA in the cochlear and vestibular sensory epithelia, miR-181a-5p, has no known validated targets in the inner ear. [score:3]
[1 to 20 of 2 sentences]
69
[+] score: 10
The expression of miR-1A and miR-181 was detected at baseline and was increased at six and 24 hours after hepatectomy (Fig 3C). [score:3]
For validation, the expression of miR-1A and miR-181 was examined in exRNA obtained from serum samples obtained from an independent group of mice undergoing partial hepatectomy. [score:3]
A droplet digital PCR assay was used to analyze the expression of miR-1A, miR-181a-5p-A, and miR-222 in serum obtained at baseline, 6, and 24 hours after partial hepatectomy. [score:2]
miR-1A and miR-181 were most significantly altered microRNA in both serum and in hepatic tissues, and their presence in serum was quantitated using digital PCR. [score:1]
A comparison of miRNA that were increased within hepatic tissues as well as elevated in the circulation following partial hepatectomy revealed that the most prominent and sustained changes occurred for miRNA-1A and miRNA-181a-5p-A (Fig 3A and 3B). [score:1]
[1 to 20 of 5 sentences]
70
[+] score: 9
We found a significant up-regulation of oncogenic miRNAs and a significant down-regulation of tumor-suppressing miRNAs, which included let-7, miR-17-92, miR-10b, miR-15, miR-16, miR-26, and miR-181. [score:9]
[1 to 20 of 1 sentences]
71
[+] score: 9
Activated B cells and CLL cells exhibit similar miR expression profiles that include the upregulation of miR-34a, miR-155, and miR-342-3p and the downregulation of miR-103, miR-181a, and miR-181b [10]. [score:9]
[1 to 20 of 1 sentences]
72
[+] score: 9
Consistently, we previously demonstrated that CBX7 negatively regulates the expression of miR-181 that has among its targets CBX7, creating a synergistic loop that contributes to breast cancer progression [11]. [score:6]
The results presented in Fig.   1 confirm a drastic overexpression of miR-181, miR-137, miR-199, miR-706 and miR-719 and repression of miR-155 in Cbx7 KO MEFs in comparison with the WT ones. [score:3]
[1 to 20 of 2 sentences]
73
[+] score: 9
In this study, we also observed up-regulated expression of SGTB, targeted by miR-133a-3p, miR-181a-5p, miR-409-5p, and miR-542-3p, at both the transcriptional and protein levels in Sertoli cells following exposure to MC-LR (Supplementary Figure S1B and Fig. 5B). [score:8]
In this study, many miRNAs associated with azoospermia, such as miR-199a-5p 21, miR-181a 22, miR-221 23, miR-141 19, and miR-429 19 24, were found to be significantly modulated by exposure to MC-LR (Table 1). [score:1]
[1 to 20 of 2 sentences]
74
[+] score: 9
It has previously been reported that upregulating miR-21 or downregulating miR-181a reduces H [2]O [2] -induced apoptosis in H9C2 cardiomyocytes, and that overexpressing miR-210 contributes to the protective effect of insulin against apoptosis in H [2]O [2] -treated H9C2 cardiomyocytes [34– 36]. [score:9]
[1 to 20 of 1 sentences]
75
[+] score: 8
miR-181 and miR-29 could down-regulate TCL1, Mcl1, Bcl2 and Bcl2L11 [46- 48]. [score:4]
From our analyses, miR-181b appeared to be the strongest TCL1 inhibitor among members of the miR-181 or miR-29 families. [score:3]
Following transfection of miRNA mimics of the miR-181 and miR-29 families, we assessed the TCL1 protein level. [score:1]
[1 to 20 of 3 sentences]
76
[+] score: 8
Indeed, miR-181 is highly expressed in the blood vasculature, but significantly reduced in lymphatic endothelial cells, reciprocally to Prox1 expression [32]. [score:5]
The regulation of Prox1 by miR-181 further highlighted the contribution of RNA interference in the induction of lymphatic endothelium. [score:2]
In addition, recent studies reported the role of miR-99b, miR-181a, and miR-181b in the differentiation of human embryonic stem cells to vascular endothelial cells [29]. [score:1]
[1 to 20 of 3 sentences]
77
[+] score: 8
Non-coding RNAs, such as miR-138-5p, have also been implicated in the regulation of telomerase, which was shown to regulate telomerase activity in thyroid carcinoma cells [11], similar effects can also be seen through miR-181a regulated tumor-specific anti-cancer effects in liver cancer[12]. [score:4]
Targeted anticancer effect through microRNA-181a regulated tumor-specific hTERT replacement. [score:4]
[1 to 20 of 2 sentences]
78
[+] score: 8
Since we have previously shown that HMGA1 is able to negatively regulate CBX7 expression (Mansueto et al., 2010) and that HMGA1 positively regulates miR-181 that has CBX7 as target, we can envisage a HMGA1-CBX7 network that operates in the regulation of tumour progression and adipocyte cell growth and differentiation. [score:8]
[1 to 20 of 1 sentences]
79
[+] score: 8
At 10 femtomoles concentration of the mir-181a amplicon the two non target assays for mir-181b and mir-181c gave only a background signal. [score:2]
As shown in Figure 3D, in this range, the assay generated for the detection of mir-181a was able to detect the targets in a linear manner across a dynamic range of six orders of magnitude. [score:2]
Amplification plot of synthetic mir-181a miRNA ranging from 10 pM to 10 [–4] pM input mir-181a amplicon (C). [score:1]
Hsa-mir-181a, b, and c RNA amplicons were obtained from Sigma-Aldrich. [score:1]
Sequence similarities and differences between mir-181a, b, and c (B). [score:1]
Standard curve of synthetic mir-181a miRNA (D). [score:1]
[1 to 20 of 6 sentences]
80
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Our study revealed miR-181 and miR-142-3p with relatively high expression in thymus (Figure 2C), and miR18a and miR-20a appeared to be weakly expressed in thymus (Figure 2D). [score:5]
Additionally, miR-1 and miR-133 in the heart, miR-181a and miR-142-3p in the thymus, miR-194 in the liver, and miR-143 in the stomach showed the highest levels of expression. [score:3]
[1 to 20 of 2 sentences]
81
[+] score: 8
For example, the expression levels of miRNA-181a, miR-155, miR-150, miRNA-221, miR-106a, miRNA-221, miR-146a and miR-146b were increased in OVA -induced mouse mo del of asthma [15– 18]; the miR-126, miR-145 and miR-106a expression levels were increased in house dust mite (HDM) -induced experimental asthma mo del [19– 21]; and miR-21 was up-regulated in lung-specific interleukin (IL)-13 -induced asthma mo del [22]. [score:8]
[1 to 20 of 1 sentences]
82
[+] score: 7
The most significantly downregulated (mmu-miR-31, mmu-miR-455, mmu-miR-744, mmu-miR-695, mmu-miR-181a, mmu-miR-181d, mmu-miR-182, mmu-miR-190, mmu-miR-194) and upregulated miRNAs (mmu-miR-34c, mmu-miR-124, mmu-miR-142–3p, mmu-miR-706, mmu-miR-29c) were analyzed. [score:7]
[1 to 20 of 1 sentences]
83
[+] score: 7
Previous reports have revealed an important role for Egr1 in different hematological conditions: Egr1 regulates hematopoietic stem cell proliferation and localization [13]; haploinsufficiency of Egr1 promotes N-ethyl-nitrosourea (ENU) induced myeloproliferative disorder (MPD) [30]; concordant loss of Tp53 in Egr1 and Apc haploinsufficient HSPCs leads to AML in mice [31]; miRNA-181a modulates acute lymphoblastic leukemia by targeting Egr1[32]; miRNA-146a modulates B-cell oncogenesis through Egr1 [33]; and the NF-κB/EGR1/BIM pathway regulates cytotoxicity of mTOR dual inhibitors in malignant lymphoid cells[34]. [score:7]
[1 to 20 of 1 sentences]
84
[+] score: 7
Chronic cocaine exposure also regulates miR-124 and miR-181a expression in brain, and overexpression of miR-124 in NAc reduced cocaine CPP while miR-181a has the opposite effect 33. [score:6]
Among these 16 candidate miRNAs, miR-181a, a miRNA previously implicated in cocaine -induced plasticity 17, was top-ranked. [score:1]
[1 to 20 of 2 sentences]
85
[+] score: 7
For example, miR-29, miR-181 and miR-148a can promote myoblast differentiation by inhibiting the expression of downstream target genes Akt3, Hox-A1 and ROCK1 at protein levels [10– 12]. [score:7]
[1 to 20 of 1 sentences]
86
[+] score: 7
During the course of CIA, six miRNAs (miR-181a, miR-144, miR-17*, miR-202-3p, miR-467a* and miR-500) were up-regulated in peripheral CD3 [+] T lymphocytes of DBA-1/J strain. [score:4]
For example, miR-181a [26], miR-181c [27], miR-155 [28], miR-150 [29], miR-146 [13], and miR-142 [30] regulate T cell sensitivity to antigen stimulation, transcription factors, and activation -induced cell death. [score:2]
To the best of our knowledge, only miR-181a and miR-221, from the interaction networks showed in this study, have been previously identified as playing a role in T lymphocytes [26], [54]. [score:1]
[1 to 20 of 3 sentences]
87
[+] score: 7
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-155, mmu-mir-181a-2, mmu-mir-182, mmu-mir-126b
While miRNA155 is not involved in T cell suppression after alcohol and burn injury, additional studies should be carried out to explore the role of other miRNAs (e. g. miRNA126, miRNA181a and miRNA182), implicated in T cell development and differentiation, in suppressed T cell IFN-γ after alcohol and burn injury. [score:6]
Several miRNAs (e. g. miR126, miR155, mir181a, miR182 etc. ) [score:1]
[1 to 20 of 2 sentences]
88
[+] score: 7
In Table 1, numerous miRNAs tied to androgen response in PCa are strikingly downregulated, such as miR-27b-3p, miR-141-3p, miR-181a-5p, miR-221-3p, and miR-375-3p. [score:4]
Consistent with these observations is the fact that miRNAs predicted to target AR, such as miR-23b-5p, miR-181-5p, and miR-205-5p are constitutively reduced in TRAMP prostates. [score:3]
[1 to 20 of 2 sentences]
89
[+] score: 7
miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. [score:3]
Several of the miRNAs on the list from P7 wildtype forebrain astrocytes such as miR-21, miR-223, miR-146a and miR-181 (S2 Table) have been previously shown to regulate astrocyte functions [26– 30]. [score:2]
While the relationship of these miRNAs and their potential targets will need to be further evaluated, the IPA analysis was able to identify two miRNAs, miR-181a and miR-125b that have been previously reported to regulate astrocytes [28, 31, 32]. [score:2]
[1 to 20 of 3 sentences]
90
[+] score: 6
Bioinformatics analyzed showed the FAS was targeted of miR-2320 and miR-181a and SERPINE was target of miR-769-3p and miR-128 in p53 signaling pathways 19. [score:5]
To testify if miRNAs in milk-derived exosomes could enter into IPEC-J2 cells, we determined the level of miR-7134, miR-1343, miR-2320, miR-181a, miR-769-3p and miR-128 in IPEC-J2 cells after incubation with exosomes. [score:1]
[1 to 20 of 2 sentences]
91
[+] score: 6
Other miRNAs from this paper: mmu-mir-181a-2, hsa-mir-181a-2, hsa-mir-181a-1
Also, repressed expression of Spry2 can be caused by downregulation of miR-181a in LECs from PCO patients[62, 63]. [score:6]
[1 to 20 of 1 sentences]
92
[+] score: 6
MiR-181c-5p is a known tumor suppressor in neuroblastoma: it belongs to the miR-181 family, whose members are known to be upregulated after MYCN silencing [26, 27]. [score:6]
[1 to 20 of 1 sentences]
93
[+] score: 6
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-127, mmu-mir-134, mmu-mir-136, mmu-mir-154, mmu-mir-181a-2, mmu-mir-143, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-21a, rno-mir-329, mmu-mir-329, mmu-mir-1a-2, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-375, mmu-mir-379, mmu-mir-181b-2, rno-mir-21, rno-mir-127, rno-mir-134, rno-mir-136, rno-mir-143, rno-mir-154, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-196a, rno-mir-181a-1, mmu-mir-196b, rno-mir-196b-1, mmu-mir-412, mmu-mir-370, oar-mir-431, oar-mir-127, oar-mir-432, oar-mir-136, mmu-mir-431, mmu-mir-433, rno-mir-431, rno-mir-433, ssc-mir-181b-2, ssc-mir-181c, ssc-mir-136, ssc-mir-196a-2, ssc-mir-21, rno-mir-370, rno-mir-412, rno-mir-1, mmu-mir-485, mmu-mir-541, rno-mir-541, rno-mir-493, rno-mir-379, rno-mir-485, mmu-mir-668, bta-mir-21, bta-mir-181a-2, bta-mir-127, bta-mir-181b-2, bta-mir-181c, mmu-mir-181d, mmu-mir-493, rno-mir-181d, rno-mir-196c, rno-mir-375, mmu-mir-1b, bta-mir-1-2, bta-mir-1-1, bta-mir-134, bta-mir-136, bta-mir-143, bta-mir-154a, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-329a, bta-mir-329b, bta-mir-370, bta-mir-375, bta-mir-379, bta-mir-412, bta-mir-431, bta-mir-432, bta-mir-433, bta-mir-485, bta-mir-493, bta-mir-541, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-1, ssc-mir-181a-1, mmu-mir-432, rno-mir-668, ssc-mir-143, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-196b-1, ssc-mir-127, ssc-mir-432, oar-mir-21, oar-mir-181a-1, oar-mir-493, oar-mir-433, oar-mir-370, oar-mir-379, oar-mir-329b, oar-mir-329a, oar-mir-134, oar-mir-668, oar-mir-485, oar-mir-154a, oar-mir-154b, oar-mir-541, oar-mir-412, mmu-mir-21b, mmu-mir-21c, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-370, ssc-mir-493, bta-mir-154c, bta-mir-154b, oar-mir-143, oar-mir-181a-2, chi-mir-1, chi-mir-127, chi-mir-134, chi-mir-136, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-181b, chi-mir-181c, chi-mir-181d, chi-mir-196a, chi-mir-196b, chi-mir-21, chi-mir-329a, chi-mir-329b, chi-mir-379, chi-mir-412, chi-mir-432, chi-mir-433, chi-mir-485, chi-mir-493, rno-mir-196b-2, bta-mir-668, ssc-mir-375
For example, miR-273 and the lys-6 miRNA have been shown to be involved in the development of the nervous system in nematode worm [3]; miR-430 was reported to regulate the brain development of zebrafish [4]; miR-181 controlled the differentiation of mammalian blood cell to B cells [5]; miR-375 regulated mammalian islet cell growth and insulin secretion [6]; miR-143 played a role in adipocyte differentiation [7]; miR-196 was found to be involved in the formation of mammalian limbs [8]; and miR-1 was implicated in cardiac development [9]. [score:6]
[1 to 20 of 1 sentences]
94
[+] score: 6
In addition, it has been reported that miR-181 promotes the development of NK cells from CD34 [+] hematopoietic progenitor cells and IFN-γ production in primary human CD56 [+]CD3 [−] NK cell, at least in part through the suppression of nemo-like kinase (NLK), an inhibitor of Notch signaling [48]. [score:6]
[1 to 20 of 1 sentences]
95
[+] score: 6
Recently, several miRNAs including miR-181a and b, miR-9, miR-204, miR-199b, and miR-135a were shown to down-regulate SIRT1 expression in mESC [22]. [score:6]
[1 to 20 of 1 sentences]
96
[+] score: 6
A single study reported that CR prevented the age -dependent increase of miR-181a-1, miR-30e and miR-34a, along with the reciprocal up-regulation of their target Bcl-2 gene in mouse brain tissues, suggesting that CR decreased apoptosis and induced a gain in neuronal survival [44]. [score:6]
[1 to 20 of 1 sentences]
97
[+] score: 6
Interestingly, the miR-103-2 (16,537 CPM), miR-107 (2,068 CPM), miR-181 (6,627 CPM) and miR-30 (5,740 CPM) families have not previously been associated with the development of the brain, but were found to be highly expressed in our dataset. [score:4]
MiR-181 plays a crucial role in modulating haematopoietic lineage differentiation [53] whereas miR-30 has been strongly implicated with kidney development and nephropathies [54]. [score:2]
[1 to 20 of 2 sentences]
98
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
Several microRNAs had similar expression when comparing results from the present study with those of There were nine microRNAs (bta-miR-10b, bta-miR-423-3p, bta-miR-99a-5p, bta-miR-181a, bta-miR-423-5p, bta-miR-148a, bta-miR-26a, bta-miR-192, and bta-miR-486), that were upregulated in earlier stages of life in both studies. [score:6]
[1 to 20 of 1 sentences]
99
[+] score: 6
Furthermore, miR-124 (Dutta et al., 2013), miR-132, miR-181a (Saba et al., 2012), and miR-223 (Harraz et al., 2012) were reported to directly or indirectly influence the protein levels of some subunits of AMPARs and/or NMDARs. [score:3]
Dopamine-regulated microRNA MiR-181a controls GluA2 surface expression in hippocampal neurons. [score:3]
[1 to 20 of 2 sentences]
100
[+] score: 6
Among the microRNAs, miR-182 in the Udown group together with 8 microRNAs in the Uup group (miR-96, miR-30a, miR-20a, miR-93, miR-384-5p, miR-106b, miR-17, and miR-181a) targeted Ppp3r1. [score:3]
miR-182 in the Udown group together with miR-96, miR-30a, miR-20a, miR-93, miR-106b, miR-17, miR-384-5p, and miR-181a in the Uup group targeted Caln (Fig 6). [score:3]
[1 to 20 of 2 sentences]