sort by

120 publications mentioning mmu-mir-214 (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-214. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 450
c Twist1 overexpression upregulated miR-214 expression and downregulated SUFU expression, and (d) the protein levels of profibrotic markers FN and α-SMA was upregulated by Twist1 in HSCs. [score:16]
e Twist1 overexpression upregulated miR-214 expression and downregulated SUFU expression, and f the protein level of profibrotic markers FN was upregulated by Twist1 in LX2. [score:16]
Importantly, Sufu expression was upregulated in response to antagomiR-214 treatment (Fig.   7g, h), suggesting that miR-214 suppression can modulate the expression of Sufu for the treatment of liver fibrosis and indicating miR-214 has a potential to be used as a therapeutic target in clinical studies for liver fibrosis. [score:12]
Relative expression levels are shown as the means ± s. e. m obtained from triplicate experiments (unpaired two-sample Student’s t test, * P < 0.05 and **P < 0.01) To explore the mechanism by which miR-214 regulates HSC activation and to identify the relevant target genes of miR-214, we conducted bioinformatics analyses using the commonly used software including TargetScan, miRBase, and miRanda, and found that Sufu, a downstream factor of Hedgehog signaling, could be a potential target of miR-214. [score:10]
Thus, increasing the expression of mature miR-214 which targets the 3′-UTR of Sufu to suppress its translation. [score:9]
In this study, we took advantage of rat primary HSCs and human LX2 cells for in vitro studies, and found that the knockdown of miR-214 expression in HSCs and LX2 cells using antagomiR-214 resulted in cell morphological changes, decreased expression of profibrotic genes, and inhibition of cell proliferation. [score:8]
Relative expression levels are shown as the means ± standard deviation obtained from triplicate experiments (unpaired two-sample Student’s t test, * P < 0.05 and ** P < 0.01) To study the functional relevance of miR-214 in fibrogenesis, we knocked down the expression of miR-214 using antagomiRs or overexpressed miR-214 using mimics in activated rat primary HSCs and human HSC cell line (LX2). [score:8]
Indeed, Sufu expression was reduced in the clinical cirrhosis tissues (Fig.   5j) and was negatively correlated with miR-214 expression, indicating that miR-214 regulates fibrogenesis by targeting Sufu to modulate the Hedgehog signal pathway. [score:8]
Both Lakner et al. [17] and Maubach et al. [26] took advantage of microarray technology to identify that miR-214 is upregulated during HSC activation, whereas Chen et al. [27] showed that miR-214 is downregulated. [score:7]
Moreover, luciferase assay indicated that miR-214 inhibited Sufu expression by directly targeting the 3′-UTR of Sufu mRNA (Fig.   4e, f). [score:7]
Functional studies demonstrated that miR-214 plays a pivotal role in hepatic fibrosis by regulating Sufu expression, and knockdown of miR-214 expression by antagomiRs effectively alleviate liver fibrosis in CCl [4] -treated mice. [score:7]
This indicated that Twist1 regulates the expression of miR-214, which indirectly affects Sufu levels and profibrotic markers expression in vitro. [score:7]
Intriguingly, miR-214 was one of the most significantly upregulated miRNA in aHSCs and its upregulation was further validated by real-time quantitative PCR (RT-qPCR) analysis (Fig.   1e). [score:7]
As expected, Twist1 overexpression resulted in a significant increase in miR-214 expression accompanied by a reduction in Sufu expression in HSCs (Fig.   6c) or LX2 cells (Fig.   6e). [score:7]
For example, miR-214 expression is upregulated in the renal fibrosis, and genetic deletion of miR-214 significantly attenuated kidney interstitial fibrosis induced by unilateral ureteral obstruction [30]. [score:6]
miR-214 expression is upregulated in different liver injury mo dels. [score:6]
To determine whether Twist1 regulates miR-214 expression in HSCs and in liver fibrosis mo dels, we overexpressed Twist1 in rat HSCs (Fig.   6a) or LX2 (Fig.   6b) using lentiviral vectors containing GFP. [score:6]
Conversely, the constructs with the mutated forms of 3′-UTR resulted in no significant change in luciferase activity in HEK 293T cells (Fig.   4f, g) or HSCs (Supplementary Fig.   3a and 3b), indicating that miR-214 influences Sufu expression by directly targeting the 3′-UTR of Sufu mRNA. [score:6]
In summary, we found that miR-214 expression is significantly upregulated during HSC activation and liver injury samples. [score:6]
Mechanistically, miR-214 enhances HSC activation by suppressing Sufu expression and thus regulates the Hedgehog signaling pathway. [score:6]
Twist1 was found to be upregulated during fibrosis 28, 29, which further supports that miR-214 expression increased during liver fibrosis. [score:6]
In this rat mo del of liver fibrosis, miR-214 expression was found to be upregulated in a manner dependent on the severity of liver fibrosis (Fig.   2c). [score:6]
Therefore, we overexpressed Twist1 to verify whether Twist1 also regulates miR-214 expression in HSCs. [score:6]
Moreover, we also showed that the expression of miR-214 was upregulated with the progression of hepatic fibrosis in CCl [4] -treated rat or mouse mo del, an HFD -induced NASH mouse mo del and in patients with cirrhosis (Fig.   2). [score:6]
These findings indicate that miR-214 has great potential to be used as a biomarker of hepatic fibrosis and a therapeutic target for treating liver diseases (Fig.   8). [score:5]
Furthermore, we observed high expression of Twist1 in clinical cirrhosis samples (Fig.   6g), which was positively correlated with miR-214 expression. [score:5]
Most importantly, we observed reduced Sufu expression in clinical cirrhosis liver samples, which was negatively correlated with miR-214 expression (Fig.   5). [score:5]
miR-214 regulates Sufu expression by direct binding to the 3′-UTR of its mRNA. [score:5]
Relative expression levels are shown as the means ± s. e. m obtained from triplicate experiments (unpaired two-sample Student’s t test, * P < 0.05 and **P < 0.01) a HSCs were transfected with either antagomiR-214 or NC-miR for 48 h, and the expression of miR-214 was detected by and b protein levels of FN and α-SMA were examined using Western blotting. [score:5]
All of these data suggested that Twist1 can indirectly affect fibrogenesis by upregulating miR-214. [score:5]
Following treatment, Sufu expression was upregulated due to decreased miR-214 level in the CCl [4]/antagomiR-214 group when compared with that in the CCl [4]/NC-miR group. [score:5]
The 3′-UTR region of rat and mouse Sufu mRNA containing the potential miR-214 binding site was cloned into pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega, Madison, WI, USA). [score:5]
In this study, we compared miRNA expression profiles between activated and quiescent HSCs (qHSCs) using microarray analysis and identified miR-214 as a significantly upregulated miRNA during HSC activation. [score:5]
However, qRT-PCR analysis demonstrated negligible effects of miR-214 on Sufu mRNA level (Fig.   4c, d), indicating that miR-214 may repress Sufu expression at the translational level. [score:5]
CCl [4] treatment induced miR-214 overexpression in mouse livers, which was markedly suppressed by antagomiR-214 (Fig.   7b). [score:5]
On the contrary, miR-214 overexpression promoted cell proliferation and induced profibrotic gene expression (Fig.   3 and Supplementary Fig.   2), thereby confirming that miR-214 takes part in the hepatic fibrogenesis. [score:5]
Using bioinformatics analysis, we identified Sufu, a well-known negative regulator of the Hedgehog pathway, as the potential target of miR-214. [score:4]
Mo del representing miR-214 regulates Sufu expression to participate in liver fibrogenesis. [score:4]
n. s. nonsignificant Based on the above data, we hypothesized that miR-214 affects fibrogenesis by regulating Sufu expression. [score:4]
To evaluate the therapeutic potential of miR-214 repression for anti-fibrosis in vivo, chemically synthesized antagomiR-214 oligos were injected into CCl [4] -treated mice to downregulate miR-214 expression in the liver. [score:4]
To investigate whether miR-214 directly target Sufu expression, we cloned the 3′-UTR sequences of rat or mouse Sufu mRNA into the luciferase reporter vector. [score:4]
miR-214 regulates fibrotic gene expression and promotes HSC cell proliferation. [score:4]
Sufu is a direct target of miR-214. [score:4]
In this study, we found that miR-214 was the most significantly upregulated miRNA during HSC activation (Fig.   1). [score:4]
Upregulation of miR-214 in different liver injury mo dels. [score:4]
As shown in Fig.   4a, b, Sufu expression clearly decreased in the cells transfected with miR-214 mimics compared with that in the control cells, while transfection with antagomiR-214 increased Sufu protein expression. [score:4]
This confirmed the regulation of miR-214 expression by Twist1 via the E-box element. [score:4]
Moreover, we conducted sited-directed mutagenesis to destroy the potential miR-214 binding site to further validate target specificity (Fig.   4e). [score:4]
Moreover, miR-214 expression is regulated by the transcriptional factor Twist1 through its binding to E-box element within the miR-214 promoter. [score:4]
Therefore, miR-214 plays a pivotal role in liver fibrosis by regulating Hedgehog signaling and may be used as a potential therapeutic target. [score:4]
Similar results were obtained in human LX2 cells by the knockdown (Supplementary Fig.   2a and 2b) or overexpression of miR-214 (Supplementary Fig.   2d and 2e). [score:4]
However, whether miR-214 regulates Sufu expression in HSCs and in liver fibrosis mo dels has not yet been examined. [score:4]
b data for miR-214 expression in livers from olive oil -treated, CCl [4]/NC-miR -treated, CCl [4]/antagomir-214 -treated mice (n = 5 per group). [score:3]
As expected, we found Twist1 induced the expression of miR-214 in HSCs and LX2 cells, respectively (Fig.   6c–f). [score:3]
Increased expression of miR-214 in activated HSCs. [score:3]
Since NASH has been recognized as a major cause of liver fibrosis [21], we examined miR-214 expression in the early stages of liver fibrosis. [score:3]
Taken together, our data clearly demonstrate that miR-214 has an important role in HSC activation and hepatic fibrosis through affecting Sufu expression. [score:3]
Fig. 3 a HSCs were transfected with either antagomiR-214 or NC-miR for 48 h, and the expression of miR-214 was detected by and b protein levels of FN and α-SMA were examined using Western blotting. [score:3]
GANT-61 is an inhibitor for Gli -induced transcript Transcription of miR-214 gene is induced by the binding of Twist1 with the E-box element in the promoter region of the miR-214 gene. [score:3]
In contrast, the overexpression of miR-214 via mimics increased the protein level of FN and α-SMA (Fig.   3c, d). [score:3]
Mutations within potential miR-214 binding sites were introduced by QuikChange Site-Directed Mutagenesis Kit (Life Technologies, Grand Island, NY, USA). [score:3]
Whether miR-214 expression increases or decreases during HSC activation is controversial. [score:3]
Luciferase activity was significantly repressed by the constructs harboring the wild-type rat or mouse miR-214 target sequence. [score:3]
Twist1 acts on an E-box elements to promote miR-214 expression in HSCs and LX2 cells. [score:3]
miR-214 expression was found to be significantly higher in human cirrhotic liver samples (Fig.   2f), and this was accompanied by high levels of FN protein (Supplementary Fig.   1e and 1f). [score:3]
miR-214 expression is increased during HSC activation. [score:3]
n. s. nonsignificant a, b Inverse correlation between miR-214 and Sufu expression in (a) rat primary HSCs and b human LX2 cells transfected with miR-214 mimics or antagomiR-214. [score:3]
n. s. nonsignificant To further confirm that miR-214 expression is driven by Twist1, we analyzed miR-214 promoter sequences and noted that the promoter contains E-box elements, which are known to be bound by Twist1 homodimers [24]. [score:3]
In addition, luciferase reporter assay results confirmed that Twist1 regulate miR-214 expression through the E-box element within the promoter (Fig.   6h, i). [score:3]
In contrast, overexpression of miR-214 could significantly promote cell growth in HSCs (Fig.   3g) and LX2 cells (Supplementary Fig.   2f). [score:3]
In this study, we identified that miR-214 effectively repressed Sufu expression in HSCs and LX2 cells (Fig.   4a, b). [score:3]
miR-214 -mediated fibrogenesis depends on Sufu expression. [score:3]
Masson’s trichrome and H&E staining clearly demonstrated that antagomiR-214 treatment effectively ameliorate liver fibrosis, implying that miR-214 is a therapeutic target for hepatic fibrosis treatment (Fig.   7). [score:3]
As expected, miR-214 expression was successfully reduced by antagomiR-214 in HSCs (Fig.   3a). [score:3]
The protein level of FN and α-SMA were significantly repressed following the inhibition of miR-214 in HSCs (Fig.   3b). [score:3]
HEK 293T cells were co -transfected with vectors containing either the wild-type (wt) or mutant (mut) target sites of Sufu and either miR-214 mimics or negative control (NC). [score:3]
Furthermore, cell growth was suppressed after the repression of miR-214 by antagomiR-214 in rat primary HSCs (Fig.   3e, f) and human LX2 (Supplementary Fig.   2c), which was accompanied by the decrease of cell numbers and the change of cell morphology (Supplementary Fig.   2g and 2h) in HSCs and LX2, respectively. [score:3]
c HSCs were transfected with miR-214 mimics or NC-miR for 48 h, and the expression of miR-214 was detected by and d the protein levels of FN and α-SMA were detected by Western blotting. [score:3]
Most importantly, Twist1 was high expression in patients with cirrhosis which was positively correlated with miR-214 level (Fig.   6g). [score:3]
Fig. 4 a, b Inverse correlation between miR-214 and Sufu expression in (a) rat primary HSCs and b human LX2 cells transfected with miR-214 mimics or antagomiR-214. [score:3]
Moreover, miR-214 expression is controlled by the transcription factor Twist1, which binds to E-box elements within the miR-214 promoter. [score:3]
n. s. nonsignificantTo further confirm that miR-214 expression is driven by Twist1, we analyzed miR-214 promoter sequences and noted that the promoter contains E-box elements, which are known to be bound by Twist1 homodimers [24]. [score:3]
miR-214 promotes expression of profibrotic markers and cell proliferation in HSCs and LX2 cells. [score:3]
e Differential expression of miR-214 in primary rat HSCs was validated using. [score:3]
These results indicated an increasing expression of miR-214 in aHSCs and suggested a key role of miR-214 in HSC activation. [score:3]
Twist1 affects liver fibrogenesis by regulating miR-214. [score:2]
The mutant miR-214 promoter containing 2-base point mutation (CATCTG → CACGTG) in the E-box site was generated and verified by DNA sequencing. [score:2]
Compared with that in the control mice, miR-214 expression was significantly increased in the mice with HFD -induced liver samples (Fig.   2e), similar to what was observed in the rat mo del of CCl [4] -induced liver fibrosis. [score:2]
Through luciferase assay and, we demonstrated that Twist1 bound to the E-box element within the promoter and induced miR-214 expression (Fig.   6). [score:2]
For the miR-214 knockdown study, HSCs and LX2 cells were transfected with antagomiR-214 or negative control (NC). [score:2]
Moreover, miR-214 has been reported to target the 3′-UTR of Sufu mRNA in human lung adenocarcinoma cells by luciferase assay [23]. [score:2]
Indeed, knockdown of miR-214 significantly increased the percentage of cells in the G1 phase and reduced the percentage of cells in S and G2 phases, indicating that miR-214 can influence cell cycle distribution in HSCs (Supplementary Fig.   2i–k). [score:2]
n. s. nonsignificant According to the above data, miR-214 plays a vital role in fibrogenesis in vitro. [score:1]
Values represent the means ± standard deviation (SD), * P < 0.05 and ** P < 0.01 In a systematic approach to identify the involvement of miR-214 in liver fibrosis, we employed a well-established rodent mo del of carbon tetrachloride (CCl [4]) -induced liver fibrosis [20]. [score:1]
However, further studies are needed to elucidate the overall function of miR-214 and the associated mechanisms in liver fibrosis. [score:1]
Several reports showed that miR-214 participated in fibrosis. [score:1]
However, the role of miR-214 in liver fibrosis is controversial according to the literatures. [score:1]
However, in accordance with miR-214 reduction, liver damage was obviously ameliorated in the CCl [4]/antagomiR-214 group mice (Fig.   7c, d), which was accompanied by a reduction in COL1α1 mRNA level (Fig.   7e) and decreased α-SMA levels, which as detected by immunohistochemistry (Fig.   7f). [score:1]
These results suggest that miR-214 may play a crucial role in the HSC activation and liver fibrosis. [score:1]
The level of miR-214 in liver tissues was examined via. [score:1]
The miR-214 promoter region was amplified by PCR from the genomic DNA of primary rat HSCs, and the resultant fragments were cloned into pGL4.27 vector (Promega, Madison, WI, USA) at XhoI and HindIII (New England Biolabs, Ipswich, MA, USA) sites. [score:1]
b The mRNA level of α-SMA and COL1α1 and c miR-214 level was detected in CCl [4] -treated rat liver sections at different time points. [score:1]
The analyses were performed on BD LSR flow cytometer (BD Biosciences, San Jose, CA, USA) For examining whether miR-214 directly target Sufu mRNA, pMir-Report-sufu reporter plasmids were co -transfected with miR-214 mimics or scramble into HEK 293T cells using Lipofectamine 2000 for 24 h. After transfection, both firefly and Renilla luciferase activities were measured by Dual-Luciferase Assays Kit (Promega, Madison, WI, USA). [score:1]
In the cardiac tissues, miR-214 is a sensitive marker of cardiac stress, and miR-214- deletion leads to increased fibrosis after ischemic injury [31]. [score:1]
Therefore, miR-214 likely plays a crucial role in the initiation or/and progression of liver fibrosis. [score:1]
Fig. 8Transcription of miR-214 gene is induced by the binding of Twist1 with the E-box element in the promoter region of the miR-214 gene. [score:1]
For investigating whether Twist1 binds to the promoter of miR-214 gene, the recombinant pGL4.27 plasmid containing wild-type or mutant miR-214 gene promoter was co -transfected into HEK 293T cells with Twist1 expression plasmid and pRL-TK containing Renilla luciferase reporter gene. [score:1]
These results demonstrated the functional relevance of miR-214 in fibrogenesis in vitro. [score:1]
To further understand the differences, we found that Chen et al. [27] normalized miR-214 expression to GAPDH mRNA while we normalized miR-214 levels to U6 RNA, a noncoding small nuclear RNA commonly used for miRNA measurement. [score:1]
c, d analyses of Sufu mRNA levels after transfection of miR-214 mimics or antagomiR in HSCs (c) and in LX2 cells (d). [score:1]
To this end, we transfected miR-214 mimics or antagomiR-214 into rat primary HSCs and human LX2 cells. [score:1]
AntagomiR-214 ameliorates liver fibrosis induced by CCl [4] in miceAccording to the above data, miR-214 plays a vital role in fibrogenesis in vitro. [score:1]
The sequence of mature miR-214 is identical in human, rat, and mouse, and bioinformatics analysis revealed that Sufu mRNAs have the potential miR-214 binding sites (Fig.   4e). [score:1]
Blue shading indicates the seed sequence of miR-214. [score:1]
f miR-214 expression in the liver of cirrhosis or healthy controls was measured by. [score:1]
e Potential miR-214 binding sites were predicted in the 3′-UTR of rat or mouse Sufu mRNAs. [score:1]
[1 to 20 of 116 sentences]
2
[+] score: 423
This complex process, involving chondrocyte commitment, proliferation, differentiation and hypertrophy, is governed by tightly orchestrated genetic and epigenetic programs and its disruption leads to pathological consequences 1– 3. MicroRNAs (miRNAs) are small non-coding RNAs, usually transcribed by RNA Polymerase II (Pol II), which regulate gene expression by translational repression or by messenger RNA (mRNA) degradation 4, 5. miRNAs have emerged as important regulators of skeleton formation where they exert multiple levels of control from cell fate decision, to proliferation, differentiation and cellular activities 6– 8. In that sense, it is not surprising that skeletal key players, such as Runx2 and Sox9, are regulated by several miRNAs 7– 9. Particularly, miR-214 was shown to inhibit bone formation by regulating Atf4 [10], and to promote osteoclastogenesis by targeting Pten [11]. [score:13]
The following pattern of expression was observed: i) low levels of expression from 18-somite stage to 36 hpf; ii) progressive increase in expression from 2–6 days post fertilization (dpf), with a peak at 6 dpf (over 30-fold change comparing to 24 hours post fertilization, hpf), iii) decrease in miR-214 expression at 15 dpf; iv) progressive increase from 15 to 60 dpf (reaching 110-fold increase compared to 24 hpf); and v) a general decrease in miR-214 expression in young adults (at 81 dpf; similar levels observed in male and female) (Fig.   1A). [score:10]
Since bioinformatic analysis did not indicate Mgp or Oc as direct targets of miR-214 (data not shown), down-regulation of these genes was most likely indirect. [score:8]
Interestingly, miR-214 overexpression lead to an overall down-regulation of Atf4 putative transcriptional targets such as Sox9, Col2a1 and Mgp, where we have identified several conserved putative -binding sites for Atf4, and also for Runx2, one of its skeletal cooperative partners (Supplementary Fig.   S8). [score:8]
miR-214 overexpression impairs zebrafish cartilage formation in vivoIn order to confirm the chondrogenic role of miR-214 in vivo, and since our previous data revealed that miR-214 was poorly expressed or absent in early stages of zebrafish development (Fig.   1A), we decided to overexpress this miRNA in zebrafish embryos by injecting 1-cell stage zebrafish eggs with miR-214 mimic or negative control (NC). [score:8]
For instance, miR-214 regulates the Hedgehog pathway in zebrafish by targeting sufu 19, 43 and was shown to regulate the WNT pathway through direct regulation of β-Catenin in humans [44]. [score:7]
We propose that at least part of miR-214 effects in chondrogenesis are Atf4 -dependent since this gene was consistently decreased upon miR-214 overexpression and unaltered upon miR-214 down-regulation, thus suggesting a direct repressive effect by miR-214 (Fig.   7), as previously validated by other authors [10]. [score:7]
The pattern of expression found for miR-214 during zebrafish development indicate that it might regulate distinct processes of skeleton formation, and further suggests that a tight regulation of miR-214 is required for a proper skeletal development. [score:7]
For chondrocyte differentiation to progress, miR-214 levels decrease thus alleviating the expression of their targets as well as the expression of chondrocyte markers. [score:7]
Upon miR-214 overexpression, Atf4 expression concomitantly decreased, suggesting that this gene could also be a target of miR-214 in chondrogenesis. [score:7]
We found that miR-214 is expressed in the cartilage of zebrafish, and is downregulated during differentiation of murine ATDC5 chondrogenic cells. [score:6]
A miRNA mimic (MmiR-214) and an antagomiR (AmiR-214) with the respective controls (NC) were used to overexpress or down-regulate miR-214. [score:6]
Therefore, in our experimental conditions, down-regulation of both Oc and Mgp upon miR-214 overexpression should represent a drawback in the differentiation process, probably with consequences at mineralization. [score:6]
During differentiation, transcriptional repressors such as AP2α should overcome ETS1 action leading to the repression of miR-214 transcription and downregulate its expression. [score:6]
In order to confirm the chondrogenic role of miR-214 in vivo, and since our previous data revealed that miR-214 was poorly expressed or absent in early stages of zebrafish development (Fig.   1A), we decided to overexpress this miRNA in zebrafish embryos by injecting 1-cell stage zebrafish eggs with miR-214 mimic or negative control (NC). [score:6]
miR-214 was highly expressed in confluent cells but strongly downregulated (over 10-fold change) during early (T9) differentiation (Fig.   3B). [score:6]
In fact, in vitro and in vivo gain-of-function experiments revealed that miR-214 was able to inhibit chondrogenesis, as evidenced by down-regulation of chondrogenic marker genes, and by the observation of phenotypic changes in cartilage formation in zebrafish miR-214 -injected embryos. [score:6]
Wang X miR-214 targets ATF4 to inhibit bone formationNat. [score:5]
ETS1 promotes miR-214 expression in undifferentiated cells, although other factors might impact on miR-214 expression. [score:5]
Notably, all markers were down-regulated in miR-214 -injected embryos (Fig.   6A) demonstrating that in fact cartilage development was hampered. [score:5]
In order to get further insight into the effect of miR-214 overexpression in these larvae, we performed gene expression analysis for key markers of cartilage formation: sox9, sox10, col2a1, col10a1, runx2 and mgp. [score:5]
Gene expression analysis of ATDC5 cells indicated that miR-214 is differentially expressed during chondrocytic differentiation. [score:5]
Thus, based on the important role of Atf4 on chondrogenesis, and the inverse patterns of expression of Atf4 and miR-214 during ATDC5 differentiation (Supplementary Fig.   S4 and Fig.   3B), we propose that Atf4 could be a target of miR-214 in ATDC5 cells, probably contributing to a mitigation of cell differentiation. [score:5]
More recently, the potential use of miR-214 as a therapeutic target in skeletal disorders was evidenced when miR-214 was shown to transit from osteoclast-derived exosomes to osteoblasts, and inhibit bone formation through Atf4 blockage [12]. [score:5]
Nevertheless, these genes play crucial roles on cartilage development and maintenance 51, 52 and their down-regulation in miR-214 -injected embryos further supports a cartilage hindered phenotype. [score:5]
Since miR-214 expression strongly decreased upon ATDC5 cell differentiation, we speculated if miR-214 could be a natural inhibitor of chondrogenesis. [score:5]
However, the levels expression found for ETS1 during ATDC5 differentiation (Supplementary Fig.   S4) are not in line with miR-214 expression pattern (Fig.   3B). [score:5]
Surprisingly, at this stage the expression levels of Col2a1, Col10a1, Tnap, Sox9 and Sp7 were not affected by miR-214 overexpression (data not shown). [score:5]
On the contrary, the repression of Atf4 by miR-214 overexpression in ATDC5 cells is likely a direct effect, since this regulatory mechanism was previously demonstrated in osteoblasts [10] and upon antagomiR transfection Atf4 levels were restored to those found in the control (Supplementary Fig.   S5). [score:5]
Embryos injected with MmiR-214 had a 5-fold miR-214 up-regulation over NC at 3 dpf (Fig.   5A). [score:4]
miR-214 is downregulated during ATDC5 chondrogenic differentiation. [score:4]
The pattern of expression of miR-214 during zebrafish development and ATDC5 chondrogenic differentiation suggested that this miRNA was most likely associated to chondrogenesis. [score:4]
Altogether, these results indicate that ETS1 could be important to control vertebrate skeletogenesis through a putative regulation of Dnm3os/miR-214 expression. [score:4]
Due to the pattern of expression of miR-214 found in ATDC5 cells, and in order to confirm our results on Dnm3os transcriptional regulation, we performed a ChIP analysis of Dnm3os promoter in undifferentiated ATDC5 cells using antibodies against ETS1, SP1, TWIST1 and RNA polymerase II (positive control). [score:4]
In early development in zebrafish, miR-214 was previously shown to be expressed in somites and in the mesenchyme surrounding developing skeletal elements 15, 19. [score:4]
Supporting this notion, miR-214 gain-of-function in zebrafish was shown to impair cranial cartilage formation, and this was accompanied by a downregulation of atf4 and of crucial cartilage markers, thus unveiling a negative impact of miR-214 on chondrogenesis. [score:4]
Regarding non-skeletal components, miR-214 was detected in zebrafish brain, muscle and kidney (Fig.   1B), consistent with Dnm3os pattern of expression found during mouse development [18]. [score:4]
Not only this pattern of expression suggested that miR-214 could play a negative role on chondrogenesis, similar to what was previously shown during osteogenesis in MC3T3 cells [10], but also that its levels should be tightly regulated during chondrocyte differentiation. [score:4]
To clarify this issue, we first analysed miR-214 expression throughout zebrafish development, from blastula to adulthood, focusing on crucial stages of skeletal formation (Fig.   1A). [score:4]
Nevertheless, Mgp and Oc were still down-regulated upon loss-of-function of miR-214 (Supplementary Fig.   S5), indicating that miR-214 mode of action in chondrogenesis might be more complex. [score:4]
Such TFs could be important for miR-214 down-regulation during ATDC5 differentiation. [score:4]
To further understand a putative involvement of miR-214 in zebrafish skeletogenesis, the spatial component of miR-214 expression was analysed by in situ hybridization (Fig.   1B) at: i) 10 dpf, corresponding to the onset of vertebra calcification; ii) 20 dpf, when vertebra calcification is completed; and iii) 90 dpf, corresponding to young adult fish with active bone remo delling [23]. [score:3]
To further explore this possibility, and to get further insight into the role of miR-214 in chondrogenesis, we altered the expression of miR-214 in ATDC5 cells through gain and loss of function experiments. [score:3]
The lower levels of expression during intermediate and later stages of differentiation suggest that miR-214 might be important to maintain chondrocytes in an undifferentiated condition. [score:3]
Li D Osteoclast-derived exosomal miR-214-3p inhibits osteoblastic bone formationNat. [score:3]
miR-214 overexpression impairs zebrafish cartilage formation in vivo. [score:3]
Higher levels of miR-214 contribute to maintain an undifferentiated cell state, possibly by blocking ATF4 and/or by controling Hh and WNT pathways through targeting of Sufu and β-Catenin, respectively. [score:3]
High levels of miR-214 during early chondrocytic cell differentiation seem to delay this process by affecting the expression of important players of chondrogenesis, as Sox9. [score:3]
Importantly, we found that both aft4 paralogs in zebrafish, atf4a and atf4b, were decreased upon miR-214 overexpression (Fig.   5B). [score:3]
On the contrary, forced expression of miR-214 significantly reduced Mgp, Oc and Atf4 levels by approximately 20%, 60% and 40% respectively (Fig.   4B), suggesting that normal cell differentiation was most likely compromised. [score:3]
Accordingly, precisely in the later stage of differentiation, the expression of miR-214 was slightly increased in WT cells (Fig.   3B), when Mgp and Oc levels are higher. [score:3]
Since in previous studies, Atf4 seemed to be pivotal for miR-214 mechanism of action in the mammalian skeleton, we sought to investigate atf4 expression upon miR-214 ectopic expression. [score:3]
Thus, we analysed the expression of miR-214 in several calcified tissues from zebrafish (branchial arches, vertebra and skull) and mouse (cartilage from the ear, vertebra, calvaria and femur); given the known role of miR-214 in myogenesis, we decided to use muscle as a positive control 19, 27. [score:3]
Li N Flynt AS Kim HR Solnica-Krezel L Patton JG Dispatched Homolog 2 is targeted by miR-214 through a combination of three weak microRNA recognition sitesNucleic Acids Res. [score:3]
Liu J MicroRNA-214 promotes myogenic differentiation by facilitating exit from mitosis via down-regulation of proto-oncogene N-rasJ. [score:3]
miR-214 mitigates the expression of chondrogenic markers during ATDC5 differentiation. [score:3]
This was consistent with the detection of putative binding sites for miR-214 in both transcripts (Fig.   5C), and further supported the hypothesis that both genes are miR-214 targets in zebrafish. [score:3]
Regarding cartilage, miR-214 expression was evident in the chondrocranium, in the pharyngeal cartilage and basal region of branchial filaments, in the ceratohyal, and in the basis of pectoral fins (Fig.   1B). [score:3]
This is also in agreement with previous studies showing similar patterns of expression for miR-199 and miR-214 in different systems 15, 20, 21. [score:3]
Importantly, both targets have conserved binding sites for miR-214 (data not shown). [score:3]
Surprisingly, ETS1 but not TWIST1 was enriched in Dnm3os promoter (Fig.   3C), along with RNA polymerase II, thus confirming that Dnm3os, and miR-214, are expressed in undifferentiated ATDC5 cells. [score:3]
In general, our histological analysis confirmed that chondrogenesis is impaired when miR-214 is overexpressed, and suggested that chondrocytes lost their ability to differentiate and produce the main components of cartilage ECM. [score:3]
Scale bars: 0.2 mm for a, e, f and k; 0.1 mm for b, c, d, h, i and j; and 0.05 mm for g. (C) Relative expression of miR-214 in zebrafish (left panel) and mouse (right panel) adult tissues, determined by miRNA qPCR. [score:3]
Microinjection of zebrafish and in vivo effect of miR-214 overexpressionOne-cell stage embryos were microinjected with 4,6 nl of MmiR-214 or NC at 18 μM in 1 × Danieau solution (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM Ca(NO3)2, 5.0 mM HEPES pH 7.6), under a MZ6.0 stereomicroscope (Leica) using a Nanoliter 2010 microinjector (World Precision Instruments LLC). [score:3]
In zebrafish, we also detected miR-214 expression in eye lens and retina (Fig.   1B), consistent with previous data obtained in X. laevies, suggesting that miR-214 could also be associated with cell fate in zebrafish retina [25]. [score:3]
Figure 4Effect of miR-214 on the expression of marker genes for chondrocyte differentiation in ATDC5 cells. [score:3]
To further explore this possibility, we tested the effect of miR-214 overexpression on Hh pathway by assessing the levels of a universal marker for activation of this pathway, Patched 1 (Ptch1). [score:3]
This discrepancy suggests that although ETS1 might contribute for miR-214 expression in undifferentiated ATDC5 cells, other TFs should also be determinant. [score:3]
Even though, one must consider that miR-214 is also known to control signalling pathways crucial for chondrogenesis, such as the Hh and WNT pathways by targeting Sufu and β-Catenin respectively 19, 44. [score:3]
However, miR-214 is known to regulate genes and pathways with important functions in chondrogenesis and alternative targets should be considered. [score:3]
Zhao C miR-214 promotes osteoclastogenesis by targeting Pten/PI3k/Akt pathwayRNA Biol. [score:3]
In the previous section we confirmed that miR-214 and miR-199a have similar temporal expression patterns, consistent with the fact that both miRNAs derive from the same transcript. [score:3]
Microinjection of zebrafish and in vivo effect of miR-214 overexpression. [score:3]
In subsequent stages (T21 and T36), miR-214 expression was somewhat increased, but its levels remained low comparing to T0 (6-fold lower in T36) (Fig.   3B). [score:3]
We found high levels of miR-214 expression in all skeletal tissues, although the highest level was observed in the muscle of both zebrafish and mouse (Fig.   1C). [score:3]
miR-214 overexpression during ATDC5 cell differentiation. [score:3]
miR-214 temporal expression correlates with skeletogenesis time-points. [score:3]
Levels of miR-214 were determined by miRNA qPCR, normalized using U6 small RNA expression and using day 0 (T0) as reference. [score:3]
This was evidenced by the high levels of miR-214 expression found during early stages of cartilage formation in zebrafish and in undifferentiated ATDC5 cells. [score:3]
Once miR-214 expression decreases, Atf4 levels also increase, and chondrocytic differentiation proceeds (Fig.   7). [score:3]
miR-214 spatial expression correlates with skeletal structures. [score:3]
Not only this result contributed to uncover the transcriptional regulation of Dnm3os (and miR-214) in ATDC5 cells, but also it highlighted a possible role for ETS1 in chondrogenesis, a topic that remains controversial. [score:2]
QPCR analysis confirmed the altered expression of miR-214 in both experiments compared to NC at T14 (Fig.   4A, Supplementary Fig.   S5). [score:2]
Mir-214 expression is associated with skeleton formation of zebrafish. [score:2]
To better understand miR-214 regulation in skeletal cells, in particularly in chondrogenesis, we used the ATDC5 chondrocytic cell line. [score:2]
These putative regulations might also contribute for miR-214 mode of action. [score:2]
In addition, miR-214 was detected in zebrafish vertebral column, reinforcing the idea that miR-214 is important for the onset of calcification during development 10, 26. [score:2]
M. J. N. and E. R. participated in ChIP-assay experiments and P. G. in miR-214 overexpression in vivo experiments. [score:2]
The next set of experiments aimed at exploring a possible conservation of miR-214 transcriptional regulatory mechanisms. [score:2]
In mammalian mo dels, this transcript was shown to be essential for normal growth and development of the skeleton [16], and particularly, miR-214 was found to control both osteogenesis and osteoclastogenesis 10, 11. [score:2]
miR-214 was detected in both skeletal and non-skeletal components of zebrafish body throughout development, confirming previous studies discussed next 16, 18. [score:2]
Altogether, these data suggest that a tight regulation of miR-214 levels is required for a proper control of molecules impacting on chondrogenesis, such as Mgp and Oc, and consequent normal chondrocyte differentiation. [score:2]
Indeed, Ptch1 levels were significantly increased in ATDC5 cells overexpressing miR-214 compared to control cells (Supplementary Fig.   S6), suggesting that this pathway could also be involved in miR-214 effects in chondrogenesis. [score:2]
MiR-214 was also expressed in the notochordal sheath and in scales (Fig.   1B). [score:2]
Although the putative role of miR-214 in chondrogenesis remains generally unknown, it is now accepted that the Dnm3 opposite strand (Dnm3os) transcript, which encodes miR-214 and miR-199a cluster [15], is crucial for normal mouse skeletal development, including cartilage formation [16]. [score:2]
miR-214 mode of action could be in part explained by direct repression of Atf4. [score:2]
Transcriptional regulation of miR-214 in skeletal-related cell lines. [score:2]
Taken together, our results evidence for the first time that miR-214 could have an important role on chondrogenesis and cartilage formation, similarly to what was previously observed in osteogenesis. [score:1]
While almost half of the embryos had severe deformities in the whole body (head and trunk), two thirds presented a clear flattening of the mandible (Fig.   5D,E), a predominant observation in the miR-214 -injected embryos. [score:1]
After 2 h in pre-hybridization solution (50% formamide, 5 × saline sodium citrate buffer (SSC), 500 μg tRNA, 50 μg Heparin, 0.1%Tween and 9.2 mM of citric acid), sections were incubated with 40 nM of LNA ISH probe (Exiqon) specific for detection of dre-miR-214 (Supplementary Table  S1). [score:1]
Although these studies pointed towards a possible role of miR-214 in skeletogenesis, they failed to demonstrate a clear association with tissue calcification. [score:1]
Arrowheads indicate head deformations resulting from flattening of the mandible; arrows indicate differences on staining intensities of main cartilaginous structures (either absent or weak in miR-214 -injected embryos). [score:1]
These reports suggest that a role for miR-214 in chondrogenesis is still to uncover. [score:1]
Analysis of putative miR-214 binding sites analysis was performed using RNAhybrid (https://bibiserv2. [score:1]
The cluster miR-199a-2/miR-214 is transcribed from the opposite strand of Dynamin 3 (Dnm3), in a common primary transcript called Dnm3os 15, 16, 18. [score:1]
Although recent studies have demonstrated that miR-214 plays a role in skeleton formation 10, 11, the involvement of miR-214 in chondrogenesis remains unknown. [score:1]
This analysis revealed different levels of phenotype severity, which could be due to distinct levels of miR-214 mimic incorporation in each embryo. [score:1]
In this study, we explored a putative role for miR-214 on cartilage formation. [score:1]
Detection of dre-miR-214 was performed using an ISH protocol adapted from the method described by Kloosterman et al. [56] using LNA (Locked Nucleic Acid) -modified oligonucleotide 5′-Digoxigenin (DIG) labelled probe. [score:1]
However, the putative role of miR-214 in chondrogenesis remains to be explored. [score:1]
Notably, all miR-214 -injected embryos (n = 29) presented a reduced intensity of alcian blue staining indicating that the composition of the matrix in cartilaginous structures was altered and suggesting a defective chondrocyte function (Fig.   5D,E). [score:1]
The levels of miR-214 during chondrogenesis are distinct in undifferentiated cells and in differentiating cells. [score:1]
Concerning skeletal elements of zebrafish, miR-214 was found at sites where new bone is being formed, and also in several cartilaginous structures. [score:1]
Negative effects of mir-214 on chondrogenesis. [score:1]
Altogether, data collected in this report pointed towards a putative negative role of miR-214 on vertebrate cartilage formation. [score:1]
From head to tail, miR-214 was detected in eye lens (arrowhead, a, b), retina (white arrowheads, a, b), brain (arrow, a), chondrocranium (asterisk, a, b), pharyngeal cartilage (white arrows, a, c), kidney (arrows, d), scales (arrow, e), muscle myotomes (arrowheads, e), cartilage in the base of pectoral fins (arrows, f), notochordal sheath (arrow, g), osteoid of haemal arches (arrows, h) and growth zones of vertebral body (arrowheads, i). [score:1]
Figure 7 A mo del for miR-214 mode of action in chondrogenesis. [score:1]
For all groups (MmiR-214, NC and WT), the highest mortality was observed at 24 hpf, although miR-214 -injected embryos presented twice as much mortality (approximately 30%) comparing to NC (approximately 17%) and WT (approximately 12%). [score:1]
Thus, our results provide the first evidence indicating a possible role of miR-214 in chondrogenesis. [score:1]
Based on our results, we propose that low levels of miR-214 are most likely required in order for chondrogenesis to initiate/proceed. [score:1]
Overall, this miR-214 spatial distribution suggests a functional conservation in vertebrates. [score:1]
Nevertheless, one cannot disregard the putative involvement of miR-214 in other processes occurring simultaneously with skeletogenesis, not addressed in the scope of this study. [score:1]
Figure 3Analysis of miR-214 transcriptional activity in skeletal-derived cell lines. [score:1]
Nevertheless, some cartilaginous structures, e. g. pharyngeal arch cartilage (Supplementary Fig.   S7A and B), seemed to be properly placed and resembled a chondrocyte packing, but lacked reactivity to safranin-O in the miR-214 -injected embryos. [score:1]
Cells were seeded in 24-well plates (2.5 × 10 [4] cells/well), incubated for 16 h and transfected with miRIDIAN microRNA mimic for mmu-miR-214 (from now on designated MmiR-214) or negative control scrambled miR 1 (NC) (Dharmacon) at a final concentration of 50 nM, using EzWay (Koma Biotech) transfection reagent. [score:1]
This result suggested a functional conservation of miR-214 in skeletogenesis between zebrafish and mammals. [score:1]
In fact, we could not detect the presence of mature chondrocytes in miR-214 -injected embryos as evidenced in NC (Fig.   6B and Supplementary Fig.   S7). [score:1]
Flynt AS Li N Thatcher EJ Solnica-Krezel L Patton JG Zebrafish miR-214 modulates Hedgehog signaling to specify muscle cell fateNat. [score:1]
Cartilage associated proteoglycans (evidenced by safranin-O) are either absent or present in low amounts in the Ethmoid plate (Ep) or hyosympletic (Hs), respectively, of miR-214 -injected embryos comparing to NC. [score:1]
However, to the best of our knowledge, miR-214 was never detected in cartilage. [score:1]
We further investigated the distribution of miR-214 in adult zebrafish calcified tissues, and argued if its expression could be comparable to other vertebrates. [score:1]
As for newly forming bone, miR-214 was detected in arches and in the growth zones of the vertebral centra (Fig.   1B). [score:1]
Herein, we show that miR-214 has a role in chondrogenesis and an underlying mechanism for miR-214 action is proposed. [score:1]
Loss-of-function experiments further supported that miR-214 levels should be important for proper chondrocyte differentiation, although it also revealed that the role of miR-214 might be more complex than originally expected. [score:1]
However, data collected in our study suggests that miR-214 might have a role in chondrogenesis. [score:1]
Gross morphology analysis revealed four phenotypes in miR-214 -injected embryos comparing to NC: i) the embryos were generally smaller; ii) pericardium was enlarged; iii) the eyes were smaller and less developed; and iv) larvae presented alterations in the size and number of otoliths. [score:1]
[1 to 20 of 136 sentences]
3
[+] score: 371
As expected, expression of Cyclin E1, a downstream target of c-MYC, was also downregulated by sulforaphane and partially rescued by miR-214 inhibitor (Figure 3A). [score:10]
E. Either SFN or miR-214 downregulated expression of the EGFP-c- MYC-Flag fusion protein whereas inhibition of miR-214 partially rescued the suppressive effect of SFN as detected by Western blot analyses with either Flag or c-MYC antibody. [score:10]
Figure 1 c-MYC is a direct target of miR-214 A. SFN downregulated the expression of c-MYC. [score:9]
In the present study, we show that SFN potently inhibited c-MYC expression through upregulating miR-214. [score:8]
Figure 2SFN negatively regulates the expression of c-MYC through miR-214 A. miR-214 suppressed exogenously expressed 3'UTR-less c-MYC in NIH3T3 and H460 cells. [score:8]
SFN exerted these functions through upregulation of miR-214 expression, which in turn targeted c-MYC, β-cantenin, and EZH2. [score:8]
SFN negatively regulates the expression of c-MYC through miR-214Since miR-214 targets c-MYC potentially at its CDS instead of its 3'UTR, we examined if miR-214 represses exogenously expressed 3'UTR-less c-MYC. [score:8]
In this regard, direct and indirect inhibition of c-MYC can be considered as a crucial function of miR-214 as a tumor suppressing regulator in NSCLC cells. [score:7]
Since c-MYC is a known target of β-catenin [43], thus in addition to direct regulation by miR-214, c-MYC can be indirectly regulated by miR-214 through β-catenin. [score:7]
Compared with control group, miR-214 mimic markedly suppressed the luciferase activity of psi- c-MYC-CDS whereas miR-214 inhibitor upregulated its activity. [score:7]
G. Fluorescence microscopic examination of EGFP expression showed that SFN or miR-214 repressed the fusion protein and the inhibitory effect of SFN was partially rescued by inhibiting miR-214. [score:7]
Taken together, these results strongly suggested that SFN represses c-MYC expression through upregulating miR-214. [score:6]
c-MYC is an authentic target of miR-214We next performed luciferase reporter assays to determine whether miR-214 could inhibit activity of the luciferase reporter gene by binding to the predicted target sites. [score:6]
We found that EZH2 was upregulated following mir-214 inhibition in H460 cells, in agreement with previous reports. [score:6]
Comparison of the miRNA expression profiles between the control and SFN treated samples revealed a number of miRNA including miR-214, miR-145, miR-199a, and miR-199b that were significantly upregulated in SFN -treated H460 cells and were reported to be involved in tumorigenesis and progression (Supplementary Figure 3A & 3B). [score:6]
We next examined whether inhibition of miR-214 could rescue SFN -induced downregulation of endogenous c-MYC protein. [score:6]
We further showed that EZH2 level was downregulated by SFN and this effect was partially blocked by co-treatment with miR-214 inhibitor. [score:6]
B. Doxorubicin -induced c-MYC protein expression was also suppressed by SFN or miR-214. [score:5]
Figure 4 A. Treatment with cisplatin boosted c-MYC protein expression that was suppressed by either SFN or miR-214. [score:5]
Expression levels of c-MYC, β-catenin, Cyclin E, EZH2, and Survivin were increased by miR-214 inhibitor and reduced by sulforaphane treatment. [score:5]
B. SFN suppressed luciferase activities of psi-c-MYC-CDS (left panel) and psi-CTNNB1-3'UTR (right panel) in H460 cells and these effects were rescued by inhibiting miR-214. [score:5]
A. miR-214 suppressed exogenously expressed 3'UTR-less c-MYC in NIH3T3 and H460 cells. [score:5]
A. Treatment with cisplatin boosted c-MYC protein expression that was suppressed by either SFN or miR-214. [score:5]
Since miR-214 targets c-MYC potentially at its CDS instead of its 3'UTR, we examined if miR-214 represses exogenously expressed 3'UTR-less c-MYC. [score:5]
miR-214 mimic markedly suppressed luciferase activity and miR-214 inhibitor elevated luciferase activity. [score:5]
Importantly, inhibition of miR-214 partially rescued the suppressive effects induced by SFN (Figure 2E). [score:5]
This finding was substantiated by our observations that plasmid or lentiviral vector -mediated expression of 3'UTR-less c-MYC cDNA and chemotherapeutic drug cisplatin- or doxorubicin -induced endogenous c-MYC accumulation was also suppressed by either SFN or miR-214. [score:5]
The results showed that luciferase activity of psiCHECK2 vector containing the target sequence of CTNNB1-3'UTR (psi-CTNNB1-3'UTR WT) was significantly decreased by miR-214 mimic and increased by miR-214 inhibitor. [score:5]
Suppressive effects of SFN were attenuated by miR-214 inhibitor. [score:5]
Strikingly, these inhibitory effects of SFN were totally blocked in the presence of miR-214 inhibitor, indicating that miR-214 mediates the repressing effect of SFN on β-catenin. [score:5]
Effects of miR-214 on regulation of endogenous c-MYC protein were examined in H460 cells transfected with miR-214 mimic or inhibitor. [score:4]
E. miR-214 downregulated endogenous c-MYC and β-catenin protein levels. [score:4]
In view of recent finding that c-MYC is a crucial regulator of CSCs [13] and chemoresistance [28] in various malignancies, we examined the biological consequences of SFN/miR-214 -mediated inhibition c-MYC in NSCLC. [score:4]
F. Inhibitory effects of either SFN or miR-214 on the fusion protein were abolished when pEGFP-c-MYC-Flag was replaced with pEGFP-c-MYC-Flag Mut, which harbors the mutations of miR-214 binding sites. [score:4]
Interestingly, a recent study found that the β-catenin gene CTNNB1 is a direct target of miR-214 in human hepatocellular carcinoma [25]. [score:4]
These results indicate that miR-214 directly binds to the two predicted target sites. [score:4]
Similarly, we showed that Survivin was downregulated by SFN/miR-214 signaling. [score:4]
Taken together, these results strongly suggested that c-MYC is a direct target of miR-214. [score:4]
We next performed luciferase reporter assays to determine whether miR-214 could inhibit activity of the luciferase reporter gene by binding to the predicted target sites. [score:4]
SFN negatively regulates the expression of c-MYC through miR-214. [score:4]
In the present study, we provided strong evidences demonstrating that SFN, a natural compound derived from broccoli and other cruciferous vegetables, upregulated miR-214 that, in turn, repressed c-MYC by binding to its CDS. [score:4]
SFN/miR-214 signaling downregulates multiple oncoproteins. [score:4]
c-MYC is a direct target of miR-214. [score:4]
We found that either SFN or miR-214 repressed expression of the fusion protein detected by antibody against either Flag or c-MYC. [score:3]
SFN/miR-214 inhibited CSC properties and enhanced chemotherapeutic drug -induced cytotoxicity. [score:3]
For this purpose, a luciferase reporter vector psiCHECK2 containing the full length c-MYC CDS was constructed (named psi- c-MYC-CDS) and co -transfected into 293T cells together with a negative control (NC) irrelevant miRNA -mimic, miR-214 -mimic, or miR-214 inhibitor. [score:3]
Apoptosis-inducing effect of SFN was diminished by miR-214 inhibitor while the effect of cisplatin was enhanced by c-MYC siRNA, respectively (Figure 5C). [score:3]
A. H460 cells were treated with SFN, miR-214 inhibitor, or both of them for 48 hours. [score:3]
The results showed that luciferase activity of psi-c-MYC-CDS was reduced by SFN and this effect is attenuated by miR-214 inhibitor (Figure 3B, left panel). [score:3]
H. SFN and miR-214 did not affect the expression of EGFP encoded by pEGFP-c-MYC-Flag Mut. [score:3]
293T cells were co -transfected with pEGFP-c-MYC-Flag plus NC -mimic, miR-214 mimic, or treated with SFN in the absence of presence of miR-214 inhibitor. [score:3]
The oncogene Survivin is another target of miR-214 [27]. [score:3]
If miR-214 targets c-MYC at its CDS, we expect to see an obvious decrease in the c-MYC level after co-transfection with lv-ef1a-c-MYC and miR-214 mimic. [score:3]
Our results showed that treatment with either cisplatin or doxorubicin stimulated c-MYC accumulation that was effectively repressed by co-treatment with SFN or by ectopic expression of miR-214. [score:3]
On the other hand, when pEGFP-c-MYC-Flag was replaced with pEGFP-c-MYC-Flag Mut that harbors mutant miR-214 binding sites, neither SFN nor miR-214 affected expression of the fusion protein (Figure 2F). [score:3]
Sulforaphane or miR-214 suppressed cisplatin-enriched ALDH+ population. [score:3]
The effect of SFN was attenuated by miR-214 inhibitor while cisplatin sensitivity was enhanced by c-MYC siRNA (Figure 5B). [score:3]
H460 cells were treated with SFN, miR-214 inhibitor, or both for 48 hours. [score:3]
Similarly, either SFN or miR-214 repressed doxorubicin -induced c-MYC expression (Figure 4B). [score:3]
D. Sulforaphane or miR-214 suppressed cisplatin-enriched CD133+ population. [score:3]
Importantly, repressive effect of SFN on cell viability was substantially compromised in the presence of miR-214 inhibitor, suggesting that function of SFN is mediated by miR-214. [score:3]
c-MYC is an authentic target of miR-214. [score:3]
The oligonucleotide primers were designed to introduce the mutations of miR-214 target sites without affecting amino acid sequences. [score:3]
It has been reported that the enhancer of zeste homologue 2 gene (Ezh2) was targeted by miR-214 in mouse skeletal muscle and embryonic stem cells [26] and in human hepatocellular carcinoma [25]. [score:3]
We next examined the role of SFN/miR-214/c-MYC signaling in tumor spheroid formation and CD133 surface marker expression that are surrogates for CSCs of NSCLC [23, 29]. [score:3]
Western blot analyses showed that c-MYC protein was reduced by miR-214 mimic and elevated by miR-214 inhibitor (Figure 1E). [score:3]
Expression of PTEN was unaffected by miR-214. [score:3]
To further validate that c-MYC is an authentic target of miR-214, we subcloned the full length c-MYC coding region cDNA, again devoid of its 3'UTR, and a Flag epitope tag sequence into the pEGFP-C1 vector to create pEGFP-c-MYC-Flag that encodes an EGFP-c-MYC-Flag fusion protein (Figure 2B). [score:3]
To test this, luciferase reporter assay was performed to determine whether miR-214 could directly target the 3'UTR of CTNNB1. [score:3]
Further, cisplatin -induced c-MYC accumulation was potently suppressed by co-treatment with either SFN or miR-214. [score:3]
Intriguingly, the effect of SFN on repressing c-MYC was severely compromised in the presence of miR-214 inhibitor (Figure 3A). [score:3]
Similar effects of SFN and miR-214 on the EGFP-c-MYC-Flag fusion protein were also revealed by fluorescence microscopic examination of EGFP expression (Figure 2G & 2H). [score:3]
The miR-214 mimic, negative control, and miR-214 inhibitor were purchased from GenePharma (Suzhou, China). [score:3]
Figure 3 A. H460 cells were treated with SFN, miR-214 inhibitor, or both of them for 48 hours. [score:3]
Similar to c-MYC, β-catenin was reduced by miR- 214 mimic and elevated by miR-214 inhibitor (Figure 1E). [score:3]
Cells were co -transfected with a luciferase reporter containing the full length c-MYC CDS (psi-c-MYC-CDS) with NC -mimic control, miR-214 mimic, or miR-214 inhibitor. [score:3]
SFN/miR-214 signaling inhibits multiple oncoproteins. [score:3]
Here we demonstrated that similar to c-MYC, β-catenin is also regulated by SFN via miR-214 in NSCLC cells. [score:2]
These luciferase reporters were then individually co -transfected into 293T cells with miR-214 inhibitor followed by luciferase assays. [score:2]
In view of the fact that c-MYC is a crucial regulator of CSCs [13] and SFN possesses the capability in suppressing CSCs in pancreatic [4] and breast [5] cancers, we investigated functional impact of the SFN/miR-214/c-MYC pathway on CSCs in NSCLC. [score:2]
Compared with the control group, the levels of c-MYC were increased by miR-214 inhibitor and reduced following SFN treatment. [score:2]
To confirm that miR-214 directly interacts with these two binding sites, double-stranded oligonucleotides of approximate 60bp containing the wild-type or mutated binding sites were synthesized, inserted into the psiCHECK2 vector, and named psi-1405 WT, psi-1405 Mut, psi-1683 WT and psi-1683 Mut, respectively. [score:2]
Based on these observations, we presume that regulation of β-catenin by SFN is also mediated by miR-214 in NSCLC cells. [score:2]
SFN/miR-214/c-MYC pathway regulates CSCs in NSCLC. [score:2]
H460 cells were treated with cisplatin (5 μmol/L), cisplatin (5 μmol/L) plus sulforaphane (10 μmol/L), or cisplatin (5 μmol/L) plus miR-214 mimic for 48 hours and subjected to flow cytometric analysis with a CD133 antibody. [score:1]
Next, we evaluated whether inhibition of miR-214 could rescue the SFN -induced repression of the c-MYC fusion protein. [score:1]
To generate the psi-1405 WT, psi-1405 Mut, psi-1683 WT and psi-1683 Mut luciferase reporters, double-strand oligonucleotides containing the wild-type or mutant miR-214 binding sites were synthesized and cloned into the Xho I and Pme I sites of the psiCHECK-2 dual luciferase reporter. [score:1]
B. Computational analyses with RNA22 and RNAhybrid algorithms predicted two miR-214 binding sites within the c-MYC CDS. [score:1]
To this end, we firstly examined capabilities of SFN and miR-214 in modulation of c-MYC accumulation in response to cisplatin, which is a commonly prescribed chemotherapeutic drug for patients with lung cancer and is capable of inducing CSC phenotypes in NSCLCs [23]. [score:1]
C. Cisplatin increases the formation of tumor spheroids, while combination of cisplatin with SFN or miR-214 decreased tumor spheroid formation. [score:1]
Similar to CD133+, ALDH+ population enriched by cisplatin was reduced by either SFN or miR-214. [score:1]
However, the effect of cisplatin was totally blocked by SFN and partially reversed by miR-214. [score:1]
Based on RNA22 and RNAhybrid algorithms, two potential miR-214 binding sites were identified at nucleotide1405 and 1683 of the c-MYC CDS (Figure 1B). [score:1]
Sequence alignments of miR-214 and the c-MYC are shown. [score:1]
D. H460 cells were co -transfected with a luciferase reporter containing a wild type or mutated miR-214 binding site (pWT1405, pMut1405, pWT1683, or pMut1683) together with NC or miR-214 mimic. [score:1]
Next, flow cytometric analysis with a CD133 antibody showed that CD133+ population was enriched by cisplatin and this effect was partially blocked by either SFN or miR-214 (Figure 4D). [score:1]
NIH3T3 and H460 cells were co -transfected with pLv-ef1a-c-MYC plus NC -mimic control or miR-214 mimic followed by Western blot analysis with c-MYC antibody. [score:1]
[1 to 20 of 97 sentences]
4
[+] score: 311
Also miR-214 exhibited a heterogeneous expression pattern, and analysis of serial sections indicated that Dio3 and miR-214 were co-expressed in cardiomyocytes, suggesting either that Dio3 and miR-214 are independently upregulated or that the expression of miR-214 and Dio3 expression is mechanistically linked. [score:12]
Having confirmed the suppressive effect of miR-214 on Dio3 expression, it was unexpected that the expression of miR-214 was increased in the post-MI mouse heart, given the marked upregulation of cardiac Dio3 activity in this mo del (8, 25). [score:10]
Our results show that Dio3 is a target of miR-214 and suggest that a negative feedback mechanism exists, in which the upregulation of miR-214 dampens the MI -induced upregulation of Dio3, limiting the reduction of cardiac T3 signaling. [score:9]
However, this miR-214-3p (hereafter referred to as miR-214) was upregulated in MI, implying suppression of Dio3 expression. [score:8]
This implies that expression of miR-214 is negatively regulated by T3, and this was confirmed by the finding that treatment of hypothyroid mice with T3 markedly suppressed miR-214 expression levels in the LV. [score:8]
Second, the results indicate a novel negative feedback mechanism regulating Dio3 expression in the post-MI mouse heart, in which a Dio3 -mediated decrease of T3 levels results in increased expression miR-214, which subsequently reduces Dio3 expression. [score:8]
The decreased level of T3 stimulates the expression of miR-214, which adds to the effects of other MI -induced regulatory pathways on miR-214 expression (the dotted arrow indicates that the relationship between T3 and miR-214 is inferred from indirect evidence). [score:7]
Upregulation of Hif-1α after MI is generally observed in the infarct or peri-infarct zone, but Hif-1α -dependent transcription activity was found in the remote LV at day 5 post-MI (Pol, unpublished results), which may contribute to miR-214 upregulation. [score:7]
To further explore the possible interaction between Dio3 and miR-214 expression, we analyzed miR-214 expression at 3, 5, 7, 14, 28, and 56 days post-MI surgery in the same set of LV samples that was previously used for analysis of Dio3 mRNA expression and Dio3 activity (8). [score:7]
Based on the finding that miR-214 targets Dio3, we expected cardiomyocytes expressing a high level of Dio3 protein to have a low expression level of miR-214, and vice versa. [score:7]
We show that Dio3 mRNA is a target of miR-214, and that this miRNA may play a role in a negative feedback mechanism regulating Dio3 expression in the post-MI heart, thereby limiting the decrease of cardiac T3 levels. [score:6]
In contrast to the apparently unfavorable effects of miR-214 in cardiac hypertrophy and heart failure, miR-214 has been shown to protect the heart from ischemic injury in a knock-out mo del, by suppressing the expression of the sodium calcium exchanger Ncx1 and consequently preventing Ca [2+] overload of cardiomyocytes and subsequent cell death (22). [score:6]
Upregulated expression of the highly conserved miR-214 in cardiac hypertrophy and heart failure has been demonstrated in several cardiac miRNA profiling studies in both human and experimental animal mo dels (21, 24– 26). [score:6]
The suggested regulation of miR-214 expression by increased Dio3 expression would most likely be mediated by a local reduction in T3 levels induced by Dio3. [score:6]
The observed 30% reduction of reporter expression is comparable to the in vitro effects of miR-199b and miR-214, targeting Dyrk1a and Ncx1, respectively, which have been shown to modify cardiac performance (22, 24). [score:5]
It has been shown that elevated expression levels of miR-214 induce hypertrophy (21, 27) by suppressing peroxisome proliferator-activated receptor δ (Pparδ) (27). [score:5]
We hypothesize that the documented local decrease of T3 levels stimulates the expression of miR-214, which dampens Dio3 expression. [score:5]
Increased miR-214 expression in turn decreases Dio3 expression, thereby dampening the reduction of T3 levels by Dio3. [score:5]
Total RNA isolated from the LV of hypothyroid (−T3) and hypothyroid mice treated with T3 for three days (+T3) was analyzed by qPCR for miR-214 expression using U6 snRNA as correction factor (A), and for Dio3 mRNA expression using Hprt as correction factor (B). [score:5]
In conclusion, this study first shows that miR-214 is able to target both the human and the mouse 3′UTR of DIO3, affecting mRNA and protein expression. [score:5]
These data indicate that the increase in Dio3 mRNA expression and Dio3 activity precede miR-214 induction, suggesting that any mechanistic link between the two involves an effect of Dio3 activity on the expression of miR-214. [score:5]
Our data suggest that in the post-MI heart, Dio3 expression may at least be additionally modulated by T3 via changes in miR-214 expression. [score:5]
Dio3 Expression Precedes miR-214 Expression in the Post-MI LV. [score:5]
Taken together, the result of the present study support the involvement of miR-214 in a negative feedback mechanism regulating Dio3 expression. [score:4]
Further research is needed to elucidate the mechanism of interaction of miR-214 in regulating DIO3 expression. [score:4]
Given the observed role of miR-214 in cardiac remo deling, we tested its possible relevance for the regulation of Dio3 expression. [score:4]
Here, we validated the increased expression level of miR-214 in the post-MI heart using quantitative RT PCR analysis with U6 snRNA as correction factor, showing a significant threefold increase in miR-214 expression in the LV tissue 7 days post-MI surgery compared to sham-operated mice (Figure 2). [score:4]
These findings suggest that reduced T3 levels may play a role in a negative feedback mechanism regulating Dio3 expression that involves miR-214. [score:4]
In silico analysis revealed that of all miRNAs that were shown to be differentially regulated in the post-MI mouse heart (25), miR-214 was predicted to have the highest potential to target Dio3. [score:4]
Furthermore, the expression of miR-214 expression reached a maximum level at day 7 post-MI, by which time the Dio3 mRNA and Dio3 activity levels appeared to go down, but still remained elevated compared to sham. [score:4]
However, the substantially greater relative reduction of DIO3 protein expression compared to the effect on the DIO3 mRNA level does suggest an additional effect of miR-214 on translation efficiency. [score:4]
T3 Decreases Cardiac miR-214 Expression. [score:3]
Therefore, we examined the effect of T3 on miR-214 expression in LV tissue of hypothyroid (−T3) and hypothyroid mice treated with T3 for 3 days (+T3) mice. [score:3]
These luciferase reporter experiments support the in silico prediction that binding of miR-214 to the Dio3 3′UTR results in repression of Dio3 protein expression. [score:3]
The indicated area shows a group of cardiomyocytes expressing both Dio3 protein and miR-214, with adjoining cells negative for both. [score:3]
The expression of miR-214 remained, however, unchanged up to at least 56 days post-MI. [score:3]
In silico analysis predicts a target sequence for miR-214 in the stem of SECIS element of the 3′UTR of Dio3 in mice, which is highly conserved among species. [score:3]
Left-ventricular samples from a previous study were used to assess miR-214 expression (30). [score:3]
Surprisingly, miR-214 in situ hybridization revealed a similar heterogeneous pattern, with the majority of miR-214 positive cardiomyocytes co -expressing Dio3 (Figure 5). [score:3]
Validation of Dio3 as a Target of miR-214. [score:3]
MiR-214 expression is likely to be regulated by other mechanisms associated with the remo deling process in addition to the decreased T3 levels. [score:3]
Dio3 and miR-214 Are Co-Expressed in Adult Cardiomyocytes. [score:3]
We hypothesized that interference of miR-214 with the SECIS element of DIO3 would result in increased levels of the truncated protein, and this was tested by analyzing the protein expression of full-length human DIO3 in COS-7 cells co -transfected with miR-214 using Ab 677 to detect the full-length 36 kDa DIO3 protein and Ab 675 to detect the 18 kDa truncated form of DIO3. [score:3]
Figure 3 Dio3 is targeted by miR-214. [score:3]
These data suggest a mechanistic link between miR-214 and Dio3 expression, which could involve the Dio3 -mediated reduction of cardiac T3 levels. [score:3]
Figure 1Conserved miR-214 target site in the 3′-UTR of Dio3. [score:3]
While Dio3 mRNA levels and Dio3 activity were already increased to high levels at days 3–5 post-MI, miR-214 expression was still only modestly elevated. [score:3]
Analysis of the 3′UTR of Dio3 showed the presence of a highly conserved miR-214 target site in the SECIS element (Figure 1), which is present in both mouse and human DIO3. [score:3]
The results indicate that binding of miR-214 results in a decreased DIO3 mRNA stability, and although the reduction of DIO3 protein levels is larger than that of DIO3 mRNA, it cannot be inferred from these data that DIO3 translation efficiency is also affected by miR-214. [score:3]
Figure 5 Dio3 protein and miR-214 are co-expressed. [score:3]
Analysis of the Role of miR-214 in the Translation of DIO3 in Transfected COS Cells and the Involvement of the SECIS Element. [score:3]
For the sake of clarity, the miR-214 data are shown in separate panels in combination with Dio3 mRNA expression (A) and Dio3 activity (B). [score:3]
An interesting feature of the conserved miR-214 target site in the 3′UTR of Dio3 is that it is located within the SECIS element, which is a secondary, double-stranded RNA structure. [score:3]
Since the SECIS element is essential for the incorporation of selenocysteine in DIO3, it led us to the question whether miR-214 might also interfere with DIO3 translation at this level. [score:3]
Although miR-214 significantly affected DIO3 protein expression, the levels of both full-length and truncated protein were equally reduced, indicating that miR-214 does not interfere with the insertion of Sec. [score:3]
The increase of miR-214 over time is in line with previous results in a mouse MI mo del (26), showing increasing miR-214 expression levels over time in remote myocardium (26). [score:3]
The latter option was supported by comparison of the temporal changes in miR-214 expression in the remo deling LV from the onset of MI up to 56 days later, with those of Dio3 mRNA and Dio3 activity as previously determined in the same samples. [score:3]
Figure 6Time course of miR-214 expression, Dio3 mRNA and Dio3 activity after MI. [score:3]
In Silico Analyses: Dio3 Is a Bona Fide Target of miR-214. [score:3]
Sequence analysis of the mouse Dio3 3′UTR predicted the presence of a miR-214 target site in the SECIS element, which was found to be highly conserved among species. [score:3]
Figure 2 Increased miR-214 expression in the post-MI LV. [score:3]
To explore the possible interplay between miR-214 and Dio3, their expression in cardiomyocytes was studied in sections of LV tissue. [score:3]
This may be a direct effect on transcription or processing of miR-214, but perhaps more likely involves components of the signal transduction pathways that drive physiological rather than pathological hypertrophy, and which are triggered by the effect of T3 on cardiac hemodynamic load (14, 30). [score:2]
Exposure of the heart to high systemic levels of T3 resulted in a 50% reduction of miR-214 expression in the LV compared to the LV of hypothyroid mice (Figure 7). [score:2]
Co-transfecting the wtD3 plasmid with mimic miR-214 caused a ~13% reduction in mRNA expression when compared to cells co -transfected with negative control miR-1 (Figure 4C). [score:2]
Figure 8 Proposed mechanism of Dio3 regulation by miR-214. [score:2]
Figure 5 shows that miR-214 expression levels did not increase significantly until day 5 following MI compared to sham-operated mice, and reached a plateau at post-MI day 7, which was maintained for at least 56 days without significant changes. [score:2]
MiR-214 Expression Is Increased in the Remo deling LV of the Post-MI Heart. [score:2]
Mir-214 expression levels were determined by quantitative RT PCR analysis in remote LV tissue from sham and MI animals isolated at day 7 post surgery. [score:2]
MiR-214 was identified as having a high potential to target the 3′UTR of Dio3. [score:2]
Expression levels of miR-214-3p were analyzed using miRCURY LNA miRNA primers and normalized against U6 snRNA (Exiqon, Vedbæk, Denmark). [score:2]
Transfection experiments using a construct with a Renilla luciferase reporter gene containing the mouse Dio3 3′UTR demonstrated functional interaction of miR-214 with Dio3 mRNA. [score:1]
These included Pre-miR-214 (100 nM); a combination of Pre-miR-214 (50 nM) and Anti-miR-214 (50 nM); or negative control miR#1 (100 nM) (Ambion, Foster City, CA, USA). [score:1]
The addition of Anti-miR-214 to the transfection mix containing miR-214 abolished the repression (Figure 3). [score:1]
In a previous study, we identified miR-214 as a differentially regulated miRNA in the remo deling LV of the post-MI mouse heart compared to the LV of sham-operated mice, using TaqMan Megaplex array analysis of all 641 mouse miRNAs known at the time. [score:1]
The results show a 30% reduction in RLuc activity when co-transfecting the reporter construct for 24 h with Pre-miR-214, relative to the “no-miR. [score:1]
A site complementary to the seed region of miR-214, which is highly conserved among species, was found to be located in the SECIS element, which is a secondary RNA structure (Figure 1). [score:1]
It was shown that Hif-1α, which is a key determinant of progression in the remo deling LV (41), activates the locus dinamin 3 opposite site (Dnm3os) harboring miR-214 (27). [score:1]
To increase the accuracy of the determination of miR-214 -dependent luciferase activity, cells were transfected with 50 ng of a single dual-luciferase reporter plasmid containing the Dio3 3′-UTR downstream of the Renilla luciferase gene (RLuc). [score:1]
To investigate whether miR-214 targets Dio3, we performed in vitro luciferase reporter experiments. [score:1]
Figure 7 Effect of T3 treatment on the levels of miR-214 and Dio3 mRNA. [score:1]
This suggests that binding of miR-214 to the DIO3 3′UTR does not interfere with selenocysteine incorporation. [score:1]
Representative images of immunohistochemical staining for Dio3 (A) and miR-214 in situ hybridization (B) in sequential sections of LV tissue 7 days post-MI. [score:1]
Values are means ± SEM, miR-214 (n = 5), Dio3 mRNA (n [3d] = 7, n [5d] = 6, n [7d] = 16, n [28d] = 10, n [56d] = 16) and Dio3 activity (n [3d] = 8, n [5d] = 9, n [7d] = 16, n [28d] = 6, n [56d] = 6). [score:1]
Therefore, we performed miR-214 in situ hybridization and Dio3 immunohistochemistry on serial sections of post-MI LV tissue. [score:1]
A dual-luciferase construct containing the complete Dio3 3′UTR downstream of the Renilla luciferase gene was used to analyze the interaction between miR-214 and the 3′UTR of Dio3. [score:1]
No-miR: control without co-transfection; ctrl-miR: + negative control/scrambled miR-1; P214: + Pre-miR-214; PA214: + Pre-miR-214 and Anti-miR-214. [score:1]
[1 to 20 of 87 sentences]
5
[+] score: 305
Using chemically synthesized microRNA mimics and precursor microRNA (pre-miRNA) expression vectors, we demonstrate that miR-214 is a potent growth inhibitor and a suppressor of RMS tumorigenesis, acting on human N -ras, a conserved target of the miR-214 myogenic and tumor suppressor functions. [score:11]
Like all microRNAs, miR-214 either suppresses the protein product translation or induces messenger RNA degradation of a wide range of target genes by forming imperfect base-pairing between its seed sequence and recognition sequences in the mRNA target 3'-UTR [47]. [score:9]
To determine if human N -ras is also a direct target of miR-214 -mediated translational regulation, we cloned the 3'-UTR of human N -ras in the pGL-3p vector and made various mutant constructs lacking miR-214 recognition sites (Fig. 5A). [score:7]
To further demonstrate that human N-ras is a major target gene that mediates the tumor suppressor activity of miR-214 in RD cells, we infected the P2GM and P-214 stable RD cells with adenoviruses that express N-ras from a microRNA-resistant, 3'-UTR-less cDNA. [score:7]
To further demonstrate its tumor suppression function, we asked if forced expression of miR-214 inhibits the ability of RD cells to form anchorage -dependent or independent foci in culture or xenograft tumors in nude mice. [score:7]
Here, we show that miR-214 expression is significantly down-regulated in a number of RMS cell lines relative to normal human skeletal muscles and fibroblasts. [score:6]
So, despite having a different set of targets and regulating muscle differentiation by a different mechanism, miR-214 is also a potent suppressor of RMS cell growth. [score:6]
Inverse correlation of miR-214 and N-ras expression in lung and prostate cancers RT-qPCR quantification of miR-214 expression in human. [score:5]
Human N-ras is a conserved tumor suppression target of miR-214. [score:5]
MiR-214 was also noted to promote cell cycle exit, a prerequisite of cell differentiation [32], and through global gene expression profiling, N -ras was identified as a target that mediates the miR-214 myogenic function [33]. [score:5]
The results indicated that the full length 3'UTR of N-ras afforded a 60% inhibition of the pGL3-p luciferase activity that could be attributed to the miR-214 over -expression in the P-214 stable RD cells (Fig. 5C). [score:5]
In xenograft tumors formed by the MSCV-P2GM vector-bearing RD cells that did not express miR-214, N -ras exhibited robust expression. [score:5]
When re-introduced back into RD cells, miR-214 ostensibly blunted N -ras expression and suppressed the xenogaft tumor growth (Fig. 6A). [score:5]
These results argue that N -ras is likely a major target of miR-214, and call for further scrutiny of miR-214 expression in primary human RMS samples. [score:5]
Although not required for embryonic development in mammals [29, 30], miR-214 is capable of regulating the differentiation of myogenic progenitor cells through many of its evolutionarily conserved targets and by many mechanisms. [score:5]
Our results indicate that miR-214 exerts its tumor suppressor function by targeting proto-oncogene N -ras in both mouse and human cells. [score:5]
The results indicated that expression of miR-214 was drastically down-regulated in both types of lung cancers as compared to normal lung tissues (Fig. 7A, 7B). [score:5]
Since miR-214 was reported to be one of the up-regulated microRNAs during cardiac hypertrophy [38], we also examined the role of miR-214 in the adult heart by the transverse aortic constriction procedure [39]. [score:4]
Negativecontrol:UUCUCCGAACGUGUCACGUTT MiR-214 mimic: ACAGGUAGUCUGAACACUGGGUU InhibitorNC :CAGUACUUUUGUGUAGUACAA MiR-214 inhibitor:ACUGCCUGUCUGUGCCUGCUGU Total RNAs from cultured cells, human skeletal muscles, and tumors were extracted using the RNAiso reagent and the cDNA was synthesized in reverse transcription reactions using the PrimeScript RT reagent kit (from a TAKARA distributor, China). [score:4]
The myogenic function of miR-214 was first reported in zebrafish [28], in which its downregulation by morpholino -mediated RNA silencing led to a loss of the slow muscle cells due to interruption of normal Hedgehog signaling. [score:4]
To determine if the miR-214 and N-ras regulatory loop also applies to other types of tumors, we examined the expression of these two genes in adenocarcinomas and squamous carcinomas of the lung as well as prostatic carcinomas by qPCR and IHC staining, respectively. [score:4]
Negativecontrol:UUCUCCGAACGUGUCACGUTT MiR-214 mimic: ACAGGUAGUCUGAACACUGGGUU InhibitorNC :CAGUACUUUUGUGUAGUACAA MiR-214 inhibitor:ACUGCCUGUCUGUGCCUGCUGU Total RNAs from cultured cells, human skeletal muscles, and tumors were extracted using the RNAiso reagent and the cDNA was synthesized in reverse transcription reactions using the PrimeScript RT reagent kit (from a TAKARA distributor, China). [score:4]
The tumor suppressor function of miR-214 is directly related to its normal role in promoting cell cycle exit, a prerequisite to myogenic differentiation. [score:4]
Having demonstrated the growth inhibitory function of miR-214 through N -ras, we sought to determine if this regulatory loop actually is associated with tumorigenesis. [score:4]
Dysregulation of miR-214 in RMS cell lines correlates with its growth inhibitory property. [score:4]
Figure 1(A) Schematic representation of the miR-214 genomic locus and the conditional knockout targeting construct. [score:4]
We further compared miR-214 expression in RD and Rh30 cells to that in primary human fibroblasts and HEK293 cells and found that tumor miR-214 levels were also reduced (Fig. 2B), suggesting that the reduction of miR-214 expression in RMS cells cannot be simply attributed to adaptation to cell culture, rather it is probably an intrinsic property of cancer cells. [score:4]
Our current investigation further extended miR-214 function to tumor suppression and revealed a likely causal correlation between marked up-regulation of N -ras and human RMS tumorigenesis. [score:4]
miR-214 inhibits RD cell growth and differentiation through N-ras. [score:3]
Using the stem-loop RT-PCR and by comparing to endogenous U6 snRNA, we observed a noticeable reduction of miR-214 expression in both RD and Rh30 cells relative to its level in the normal human skeletal muscle (Fig. 2A). [score:3]
3), suggesting that miR-214 inhibits cell proliferation. [score:3]
6C, 6D), albeit miR-1 exhibited more potent activity in suppressing the anchorage-independent colony formation than miR-214. [score:3]
Forced expression of N-ras also reversed the anti-proliferative effect of miR-214 (Fig. 5G). [score:3]
After plating approximately 500 stably transfected cells in a 60 mm petri dish and culturing for 14 days, we observed about 68 colonies of RD cells carrying the P2GM vector, and below 40 colonies of RD cells expressing either miR-1 or miR-214 (Fig. 4A and 4B). [score:3]
We also tested the anti-proliferative activity of miR-214 in prostate tumor lines, DU-145 and PC3, by over -expressing miR-214 from a MSCV -based viral vector P2GM [42] and observed similar growth retardation (Supplementary sFig. [score:3]
In light of miR-214 roles in promoting myogenic differentiation and cell growth control, we speculated that it might possess a tumor suppressor function. [score:3]
Since RMS is a cancer of dysregulated myogenic precursors, we sought to determine if miR-214 regulates RMS cell growth. [score:3]
As expected, genomic ablation of miR-214 did not alter the expression of the cistronic miR-199a or Dnm3os, the noncoding primary RNA (Fig. 1D). [score:3]
The reduction in miR-214 expression was even more pronounced when RNA levels were examined using the Taqman real time PCR (Fig. 2B). [score:3]
Moreover, the average sizes of miR-1 and miR-214 -expressing colonies were much smaller than that of the vector cells (Fig. 4A). [score:3]
Stem-loop RT-PCR confirmed the ectopic expression of miR-1 and miR-214 in their respective tumors (Fig. 4G). [score:3]
The miR-214 specific inhibition is defined in the text. [score:3]
Pre-miR-1 for:TTGCGGCCGCAA GCTTGGGACACATACTTCTT Pre-miR-1 rev: GGTTTAAACC GCCTGAAATACATACTTCT Pre-miR-214 for: TTGCGGCCGCAA GGCCTGGCTGGACAGAGTT Pre-miR-214 rev: GGTTTAAACC AGGCTGGGTTGTCATGTGACT  FL-for: CTATGAAAATTTCAAAACAGT  FL-rev: GAATATAAGAATTATGACTAAGCC  S1-for: CTTCCACAGCACAAACAC  S1-rev: AACAAACCAAACAGCAAT  S2-for: GTTTAGTCTTTCACCATCC  S2-rev: GAAGCAGAACGCACCATT  S3-for: ATATCAGTACTTGAGGATTCAACCGT  S3-rev: ATTATGACTAAGCCAAGAA MicroRNA mimics and inhibitors were purchased from Dharmacon, Inc. [score:3]
On histological sections, xenograft tumors expressing pre-miR-1 or pre-miR-214 showed decreased staining for Ki67 but increased staining for MHC (Fig. 4F), suggesting a benign growth relative to the vector-bearing tumors. [score:3]
Thus, N -ras is a conserved target of miR-214 in human cells as well. [score:3]
miR-214 suppressed colony formation and xenograft tumorigenesis. [score:3]
For these purposes, we generated stable RD cells expressing pre-miR-214 or pre-miR-1 from the constitutive P2GM vector. [score:3]
miR-214 is a suppressor of human RMS cell growth. [score:3]
So, despite both miR-1 and miR-214 are able to induce RD cells to undergo myogenic differentiation (Fig. 3D, 3E) and suppress their tumorigenic activities (Fig. 4A-4E), only miR-214 reached these outcomes through blocking N-ras. [score:3]
Examination of the liver, lung, heart, and muscle by stem-loop PCR detection showed a robust miR-214 expression in the control B6 mice, but miR-214 is absent from those tissues in the homozygously deleted mice or at a reduced level in the heterozygotes (Fig. 1C). [score:3]
Each of the three miR-214 recognition sites exhibited inhibitory activity with site 1 showing the strongest while site 2 the weakest (Fig. 5C). [score:3]
To address this possibility, we examined miR-214 expression in two human RMS cell lines, RD and Rh30, which are derived from tumors of the embryonal and alveolar origin, respectively. [score:3]
Sequences of miR214 inhibitor or mimics as well as nonspecific control are as follows. [score:3]
However, our data on the contrary showed that miR-214 is engaged in tumor suppression in vivo. [score:3]
Pre-miR-1 for:TTGCGGCCGCAA GCTTGGGACACATACTTCTT Pre-miR-1 rev: GGTTTAAACC GCCTGAAATACATACTTCT Pre-miR-214 for: TTGCGGCCGCAA GGCCTGGCTGGACAGAGTT Pre-miR-214 rev: GGTTTAAACC AGGCTGGGTTGTCATGTGACT  FL-for: CTATGAAAATTTCAAAACAGT  FL-rev: GAATATAAGAATTATGACTAAGCC  S1-for: CTTCCACAGCACAAACAC  S1-rev: AACAAACCAAACAGCAAT  S2-for: GTTTAGTCTTTCACCATCC  S2-rev: GAAGCAGAACGCACCATT  S3-for: ATATCAGTACTTGAGGATTCAACCGT  S3-rev: ATTATGACTAAGCCAAGAA MicroRNA mimics and inhibitors were purchased from Dharmacon, Inc. [score:3]
Thus, miR-214 likely possesses an anti-tumor function in suppressing RMS tumorigenesis through N-ras. [score:3]
This observation likely explains why miR-214 is effective in suppressing RMS tumorigenesis. [score:3]
During the 5-day span of differentiation, total level of miR-214 in the transfected RD cells was maintained at a higher level than the ns control by the mimic (Fig. 3G), suggesting a causal relationship between miR-214 overexpression and accelerated exit from the mitosis. [score:3]
miR-214 inhibits colony formation and xenograft tumor growth. [score:3]
We previously identified N -ras as a target of miR-214 that mediates its myogenic function in mouse myoblasts, and found the miR-214 recognition sequences in both mouse and human N -ras [33], thus the sequence basis for the functional conservation in these two species. [score:3]
Taken together, these results indicate that miR-214 is a growth inhibitor of different types of tumor cells. [score:3]
Germline deletion of the miR-214 locus was achieved by crossing miR-214 [cko] to EIIa-cre driver mice that express the cre recombinase ubiquitously. [score:3]
After switching the cells to differentiation medium and incubation for 5 days, we found that forced expression of N-ras neutralized the pro-myogenic effect of miR-214 in RD cells, which was determined by immunofluorescence staining of MHC (Fig. 5D), and RT-PCR detection of myogenin (Fig. 5E) and MHC (Fig. 5F) mRNAs [33]. [score:3]
In mouse C2C12 myoblasts, miR-214 was reported to form a negative feedback loop with a polycomb group component Ezh2 that controls the expression of miR-214 as well as myogenic transcription factors MyoD and Myogenin through epigenetic modifications of the chromatin structure [31]. [score:3]
miR-214 inhibits the proliferation of murine embryonic fibroblasts. [score:3]
MiR-214 is part of this network, although its function is not required during embryonic development as miR-214 null embryos were carried to full term and the pups grew healthy and fertile [29, 30]. [score:2]
We then compared the luciferase activities of these constructs in the vector control P2GM and pre-miR-214 -expressing stable RD cells, and calculated miR-214-specific inhibition, which is defined as the ratio of luciferase activities between these two pools of RD cells normalized for the value elicited from the pGL3-p vector in the P2GM carrying RD cells. [score:2]
MiR-214 inhibits embryonic cell proliferation. [score:2]
MiR-214 is a ubiquitously expressed microRNA with important muscle function. [score:2]
Compared to the vector-bearing control RD cells, those that expressed pre-miR-1 or pre-miR-214 grew much slower (Fig. 4C, and 4D), and reached to smaller terminal sizes (Fig. 4E). [score:2]
Several recent studies identified other genes that are regulated by miR-214, such as Ezh2 and Pten [26, 31, 40]; however, we did not detect any change in these two protein levels in miR-214 [−/−] MEFs. [score:2]
When assayed for anchorage-independent growth in top agar plates, stable RD cells expressing pre-miR-1 or pre-miR-214 also formed fewer foci than the P2GM RD cells (Supplementary sFig. [score:2]
48 hours after transfection, 20 μM EdU was added for 1 hour, and MEFs from wt and miR-214 knockout mice were incubated with 20 μM EdU for 4 hours or 6 hours. [score:2]
Homozygous miR-214 [−/−] mice were born healthy at the expected Men delian ratio and exhibited no overt developmental abnormally. [score:2]
These findings strongly support the relevance of miR-214 and N- ras regulatory loop in RMS etiology. [score:2]
Thus, although miR-214 is not essential for embryonic development and loss of miR-214 by itself is not sufficient to cause cancer in mice, it normally exerts a negative control on cell growth. [score:2]
For these reasons, miR-214 is likely a good candidate for the development of an anti-RMS therapeutic antagomiR. [score:2]
In the presence of 10% FBS, RD cells did not undergo apoptosis and neither miR-1 nor miR-214 were able to induce such (Fig. 3C). [score:1]
In contrast, the levels of N -ras mRNA transcript and protein increased markedly in miR-214 [−/−] MEFs (Fig. 1D, 1E), in keeping with our previous observation in C2C12 cells [33]. [score:1]
To determine if miR-214 plays a role in the homeostatic maintenance of the muscle function in the adult, we created the muscle injury mo del in miR-214 [−/−] and the control B6 mice by cardiotoxin III injection in the tibia calf [37]. [score:1]
In this study, we investigated the roles of miR-214 in suppressing RMS cell growth and xenograft tumor formation. [score:1]
Once again, no statistic significant difference was observed in a range of parameters between miR-214 [−/−] and the control B6 mice (Supplementary sFig. [score:1]
Human genomic DNA fragments containing pre-miR-1 or pre-miR-214 sequences were amplified by PCR and inserted at the NotI and PmeI site in the MSCV-P2Gm vector. [score:1]
To further characterize the tumor suppression properties of miR-214, we examined the ability of RD cells to undergo apoptosis and differentiation after they received miR-214mi or controls through transfection. [score:1]
MiR-214 is encoded along with miR-199a in a 7.8 kb bi-cistronic primary microRNA transcription unit, Dynamin 3 opposite strand (Dnm3os), which is embedded on the reverse strand in an intron of the Dynamin 3 (Dnm3) gene [33]. [score:1]
Figure 2 (A) RT-PCR detection of miR-1, miR-133a, and miR-214 in RD and Rh30 cells, as well as in normal skeletal muscles (SKM). [score:1]
Flow cytometry analyses indicated that after serum depletion for 3 days, about 32% of RD cells transfected with the ns control became double positive for Annexin V and PI, an indication of late stage of cell death [44], but this percentage increased to 56.9% and 52.8% when the cells were transfected with miR-1mi and miR-214, respectively (Fig. 3B and 3C). [score:1]
Figure 5 (A) Predicted miR-214 recognition sites in the 3'-UTR of human N-ras and schematic representation of human N-ras 3'UTR reporter constructs. [score:1]
Figure 6 (A) IHC staining of N-ras in xenograft tumors derived from RD stable cells carrying P2GM, P2GM-miR-1, and P2GM-miR-214 constructs. [score:1]
Nevertheless, immunofluorescence staining of Ki67 indicated a progressive increase in the rate of ribosomal RNA transcription after removing one (heterozygotes) or both (homozygotes) alleles of miR-214 (Fig. 1F, supplementary sFig. [score:1]
miR-214 promotes apoptosis and myogenic differentiation of RD cells. [score:1]
Full length or fragments of the N-ras 3'-UTR containing miR-214 recognition sequences were inserted behind the luciferase coding sequence at the XbaI site in the pGL3-promoter vector (Promega, WI, USA). [score:1]
To determine if miR-214 exerts any physiological control on cell growth and differentiation, we isolated the primary murine fibroblasts (MEFs) from miR-214 [−/−] and control B6 embryos. [score:1]
During the process of tumorigenesis, pre-cancerous cells endure enormous selective pressure to reorganize their metabolic program and miR-214 becomes engaged to counter tumor growth. [score:1]
Once again, miR-214 is not a sufficient inducer of apoptosis on its own. [score:1]
The node defined by miR-214 likely reacts to stress cues as it has been demonstrated to protect the mouse heart from ischemic injury by controlling Ca [2+] overload and death [29]. [score:1]
In contrast, both the messenger RNA and protein levels of N -ras increased dramatically when miR-214 was lost completely. [score:1]
Mouse N -ras contains two miR-214 recognition sites in its 3'-UTR, whereas human N -ras has one site that matches to the 7-nucleotide seed sequence of miR-214 and two imperfect sites (Fig. 5A). [score:1]
Figure 4 (A) 500 stable RD cells carrying constitutive P2Gm vector, P2Gm-miR-1, or P2Gm-miR-214 were cultured in 60 mm petri dishes in the presence of 10 μg/ml puromycin for 14 days. [score:1]
For generating the stable cell lines, P2GM, P2GM-miR-1(P-1) or P2GM-miR-214(P-214) plasmids were transfected into RD cells using Lipofectamie according to the manufacturer's procedure (Invitrogen). [score:1]
[1 to 20 of 100 sentences]
6
[+] score: 287
Contrast to the previous reports that miR-214 was upregulated in the myocardium of a rat AAC mo del, and of a mouse ischemia/reperfusion (IR) injury mo del and of a rat isoproterenol injection mo del [16– 19], our present data showed that miR-214-3p was significantly down-regulated in the myocardium of a mouse Ang-II infusion mo del, and was upregulated in Ang-II -induced mouse myofibroblasts. [score:10]
Additionally, miR-214-3p mimic inhibited expressions of fibrosis-related genes through targeting EZH1 and -2 expressions at both mRNA and protein levels in myofibroblasts. [score:9]
Our data have also revealed that miR-214-3p inhibits fibrotic phenotype in cardiac myofibroblasts through down-regulation of EZH1 and -2. We also concluded that activation of the NF-κB signaling pathway contributes to the upregulation of miR-214-3p in Ang-II -induced myofibroblasts. [score:9]
However, the results of cellular experiments in vitro indicated that α-SMA, except for Col1a1 and Col3a1, was not dramatically up-regulated by enforced expression of EZH1, -2 and PPAR-γ siRNA, and was not markedly suppressed by miR-214-3p mimic, EZH1 siRNA, EZH2 siRNA, as well. [score:8]
Results of western blot assay showed that miR-214-3p mimic and EZH1 siRNA could efficiently suppress the expressions of Col1a1 and Col3a1, and increase the expression of PPAR-γ, without significant effect on the expression of α-SMA in myofibroblasts (p < 0.05, p < 0.01, respectively) (Figure 5A). [score:8]
Western blot assay showed that miR-214-3p mimic and EZH2 siRNA could markedly suppress the expressions of Col1a1 and Col3a1, and increase the expression of PPAR-γ, without significant effect on the expression of α-SMA in myofibroblasts (p < 0.05, p < 0.01, respectively) (Figure 5C). [score:8]
The present study has provided several lines of evidence to support the notion that miR-214-3p inhibits expressions of fibrosis-related genes through targeting EZH1 and -2. First, the in silico prediction indicated that EZH1 and -2 were potential targets of miR-214-3p, and the dual luciferase assay revealed that miR-214-3p specifically bound to the 804-810, 1623-1629 sites in the 3′-UTR of EZH1, and the 161-168 site in the 3′-UTR of EZH2. [score:8]
MiR-214-3p enhances PPAR-γ expression by targeting EZH1 and -2, resulting in the suppressing the expression of fibrosis related genes, including Col1a1 and Col3a1, in myofibroblasts. [score:8]
Notably, we further revealed EZH1, as another important target of miR-214-3p, mediated the anti-fibrotic effect of miR-214-3p by suppressing PPAR-γ expression in mouse myofibroblasts. [score:7]
Moreover, in parallel with the findings with EZH1 siRNA and EZH2 siRNA, over -expression of miR-214-3p reduced the expression of Col1a1 and Col3a1, but enhanced the expression of PPAR-γ in myofibroblasts. [score:7]
We used NF-κB P65 siRNA, NF-κB P65 inhibitor JSH23 and QNZ to further verify the participation of NF-κB P65 pathway in Ang-II-promoted upregulation of miR-214-3p in myofibroblasts. [score:6]
Knockdown of P65 by P65 siRNA inhibited Ang-II-promoted miR-214-3p expression in myofibroblats (Figure 6C). [score:6]
However, one study showed that downregulation of miR-214 by antagonists attenuated cardiac fibroblast proliferation and collagen synthesis via inhibition of Mfn2 and activation of ERK1/2 MAPK signaling [18]. [score:6]
In the present study, injection of miR-214-3p was shown to inhibit Ang-II -induced expressions of fibrosis-related genes, including Col1a1, Col3a1 and α-SMA, in mouse myocardium in vivo. [score:5]
Expression of miR-214-3p in Ang-II -induced myofibroblasts and its effect on expressions of Col1a1, Col3a1 and α-SMA in myofibroblasts. [score:5]
Our data demonstrated the anti-fibrotic effect of miR-214-3p by targeting EZH1 and -2, resulting in increase of PPAR-γ and suppression of Col1a1 and Col3a1 in mouse myofibroblasts. [score:5]
Meanwhile, our western blot results demonstrated that expression of Col1a1, Col3a1 and α-SMA in mouse myocardium in response to Ang-II infusion was also suppressed by miR-214-3p injection (p < 0.05, p < 0.01, respectively) (Figure 2B). [score:5]
Expressions of Col1a1, Col3a1 and α-SMA in mouse myofibroblasts with transfection of miR-214-3p mimic, EZH1 siRNA, EZH2 siRNA and PPAR-γ siRNA, or overexpression of EZH1 and -2, respectively. [score:5]
Consistently, miR-214-3p could efficiently inhibit expressions of Col1a1 and Col3a1 in mouse myofibroblasts. [score:5]
Meanwhile, miR-214-3p was observed upregulated in Ang-II -induced myofibroblasts (p < 0.01) (Figure 3B). [score:4]
The NF-κB signal pathway was verified to mediate the upregulation of miR-214-3p in myofibroblasts exposed to Ang-II. [score:4]
MiR-214-3p expression in Ang-II -induced myofibroblasts with knockdown of P65 C., or with pre-treatment with NF-kB inhibitor JSH23 and QNZ, respectively D., was assessed by RT-qPCR assay. [score:4]
Collectively, our data suggest that up-regulation of miR-214-3p in Ang-II -induced myofibroblats results from the activation of NF-κB signaling. [score:4]
Up-regulation of microRNA-214-3p (miR-214-3p) in mouse myofibroblasts through NF-kB pathway. [score:4]
Taken together, our results have demonstrated that miR-214-3p is down-regulated in cardiac fibrosis, and miR-214-3p ameliorates cardiac fibrotic responses in vivo and in vitro. [score:4]
Similarly, knockdown of miR-214 in vivo using a specific antagomir (miR-214 inhibitor) prevented cardiac remo deling and dysfunction in a mouse heart failure mo del of pressure overload [26]. [score:4]
Results of FIHC assay revealed that Col1a1 and Col3a1 expression was significantly suppressed in miR-214-3p -modified mouse myofibroblasts (p < 0.05, p < 0.01, respectively) (Figure 3C). [score:4]
Since our data showed that miR-214-3p was markedly down-regulated in the myocardium of a mouse Ang-II infusion mo del. [score:4]
This opposite results of miR-214 expression in the fibrotic myocardium in vivo may result from different types of animal mo dels. [score:3]
The matching positions for miR-214-3p within 3′-UTR of the targeted mRNAs are shown in Figure 4A. [score:3]
The relative ratio of the FL/RL was used to indicate the suppression of EZH1 and -2 by miR-214-3p. [score:3]
Data are shown as mean ± sem, * p < 0.05, ** p < 0.01 vs scramble control, N = 3 in A., C., E. * p < 0.05, ** p < 0.01 vs rAd-GFP control, N = 3 in B., D. Previous report showed that NF-κB activation suppresses miR-214 transcription in hepatocellular carcinoma cells [19]. [score:3]
However, it was reported that miR-214 expression was negatively modulated by the NF-κB P65 pathway in hepatocellular carcinoma (HCC) cells [36]. [score:3]
Verification of EZH1 and -2 as target genes of miR-214-3p. [score:3]
Figure 5 A. Protein expression of EZH1, Col1a1, Col3a1, α-SMA and PPAR-γ in myofibroblasts with transfection of miR-214-3p mimic, EZH1 siRNA, respectively. [score:3]
MicroRNA-214-3p (miR-214-3p) expression in the fibrotic myocardium of a mouse Ang-II infusion mo del. [score:3]
Collectedly, the role and potential target gene of miR-214 in cardiac fibrosis have not been well-illustrated. [score:3]
The RT-qPCR result demonstrated that treatment with either JSH23 or QNZ prevented Ang-II -induced miR-214-3p expression (Figure 6D). [score:3]
MiR-214-3p is upregulated in Ang-II -induced myofibroblasts via NF-κB pathway. [score:3]
Our present data has been supported by previous studies showing that EZH2 was a target of miR-214-3p [31, 32]. [score:3]
Figure 4 A. Verification of EZH1 and -2 as a target gene of miR-214-3p by the dual luciferase reporter system. [score:3]
Therefore, the present study suggests that miR-214-3p might be a potential target for prevention and treatment of cardiac fibrosis (as shown in Figure 7). [score:3]
This conclusion has been supported by previous studies showing the protective effect of miR-214 by inhibition of fibrosis [16, 19, 27]. [score:3]
Figure 7 MiR-214-3p is upregulated in Ang-II -induced myofibroblasts via NF-κB pathway. [score:3]
C. Protein expression of EZH2, Col1a1, Col3a1, α-SMA and PPAR-γ in myofibroblasts with transfection of miR-214-3p mimic, EZH2 siRNA, respectively. [score:3]
Then, we examined the expression of EZH1 and -2 in mouse myofibroblasts transfected with miR-214-3p mimic. [score:3]
org) showed that EZH1 and -2 were potential target genes of miR-214-3p. [score:3]
Decreased expression of miR-214-3p in the fibrotic mouse myocardium. [score:3]
N = 5-8. MiR-214-3p attenuates Ang-II -induced fibrotic phenotype in vivoTo further demonstrate the potential role of miR-214-3p in Ang-II -induced myocardial fibrosis, we determined whether restoring miR-214-3p expression via tail vein injection of miR-214-3p agomir could exert protective effect on the myocardial fibrosis. [score:3]
MiR-214-3p is up-regulated by Ang-II through the NF-κB pathway in myofibroblasts. [score:3]
The Masson staining results revealed that myocardial fibrosis was markedly increased in Ang-II infusion mice, but which could be reversed by enforced expression of miR-214-3p (p < 0.05, p < 0.01, respectively) (Figure 2A). [score:3]
Phenotype of myocardial fibrosis of a mouse Ang-II infusion mo del with enforced expression of miR-214-3p. [score:3]
A. Verification of EZH1 and -2 as a target gene of miR-214-3p by the dual luciferase reporter system. [score:3]
Previous report showed that NF-κB activation suppresses miR-214 transcription in hepatocellular carcinoma cells [19]. [score:3]
N = 5-8. To further demonstrate the potential role of miR-214-3p in Ang-II -induced myocardial fibrosis, we determined whether restoring miR-214-3p expression via tail vein injection of miR-214-3p agomir could exert protective effect on the myocardial fibrosis. [score:3]
A. Protein expression of EZH1, Col1a1, Col3a1, α-SMA and PPAR-γ in myofibroblasts with transfection of miR-214-3p mimic, EZH1 siRNA, respectively. [score:3]
MicroRNA-214-3p (miR-214-3p) negatively modulates EZH1 and -2 expression. [score:3]
C. Expressions of Col1a1, Col3a1 and α-SMA in miR-214-3p -modified myofibroblasts by FIHC assay. [score:2]
Using a site-directed mutagenesis kit (TransGen, Beijing, China), the miR-214-3p binding site sequence CCUGCUG was replaced with CCACGAG, CCAGCUG was replaced with CCACGAG to construct the corresponding recombinant luciferase reporter plasmids containing the mutant potential miR-214 binding sequences. [score:2]
Mechanistically, the cardioprotective role of miR-214 was attributed to its repression on sodium/calcium exchanger 1 (Ncx1) and regulation of cardiomyocyte Ca [2]+ homeostasis [16]. [score:2]
Compared with the negative scramble control, mRNA and protein expression of EZH1 and -2 were significantly decreased in miR-214-3p -modified myofibroblasts (p < 0.05, p < 0.01, respectively) (Figure 4D, 4E). [score:2]
MiR-214-3p attenuates expression of fibrosis-related genes in myofibroblasts. [score:2]
Nevertheless, the mechanism underlying the down-regulation of miR-214-3p in mouse fibrotic myocardium warrants further investigation. [score:2]
B. Expression of miR-214-3p in Ang-II -induced myofibroblasts by RT-qPCR assay. [score:2]
MiR-214-3p, EZH1 siRNA and EZH2 siRNA attenuate expressions of Col1a1 and Col3a1 in myofibroblasts. [score:2]
MRNA and protein expressions of EZH1 D. and EZH2 E. in miR-214-3p -modified myofibroblasts by RT-qPCR and Western blot assay, respectively. [score:2]
MicroRNA-214 (miR-214) was shown involved in the pathogenesis of cardiac fibrosis [16– 19], but the role of miR-214 in cardiac fibrosis has not yet been well understood. [score:1]
According to our previous report [20], the recombinant luciferase reporter plasmid containing the potential miR-214-3p binding site sequences of EZH1 and -2 genes were constructed. [score:1]
RT-qPCR result showed that the level of miR-214-3p was dramatically increased in miR-214-3p -modified myofibroblasts (p < 0.001) (Figure 4C). [score:1]
Human embryonic kidney (HEK) 293 cells (3×10 [5] cells per well in the 12-well plate) were cotransfected with 200 ng of recombinant luciferase reporter plasmid, 50 nM miR-214-3p mimic, and 20 ng of pRL-TK plasmid as an internal control (Promega, Madison, WI). [score:1]
Absence of miR-214 was shown to cause loss of cardiac contractility and increase of apoptosis in response to IR injury in mice. [score:1]
Therefore, our data have demonstrated the anti-fibrotic effect of miR-214-3p, instead of a pro-fibrotic effect, in cardiac fibrosis. [score:1]
The seed sequence of miR-214-3p is CAGCAGG, and the complementary nucleotide sequences are shown in red words. [score:1]
As expected, the level of miR-214-3p was significantly increased in the myocardium of mice received injection of miR-214-3p agomir (Supplimentary Figure 1). [score:1]
Cells were transfected with 50 nM scramble or miR-214-3p mimic, or 50 nM siRNA for EZH1, -2, PPAR-γ or NF-κB P65 (Ribobio, Guangzhou, China) by oligofectamine reagent (Invitrogen, Carlsbad, CA). [score:1]
Predicted miR-214-3p seed matches to the sequence in the 3′UTR of EZH1 and -2 mRNA. [score:1]
Schematic diagram of the mechanism whereby miR-214-3p exerts the anti-fibrotic effect in cardiac fibrosis. [score:1]
Data are shown as mean ± sem, * p < 0.05, ** p < 0.01 vs scramble control, N = 3 in A., C., E. * p < 0.05, ** p < 0.01 vs rAd-GFP control, N = 3 in B., D. Then, miR-214-3p mimic and EZH2 siRNA were also transfected into mouse myofibroblasts. [score:1]
The amount of 20 nmol NC agomir or 20 nmol miR-214-3p agomir was delivered into each mouse via tail vein injection at 4 interval time points within 14 d. Mice were sacrificed with an overdose of sodium pentobarbital (200 mg/kg, ip) at the end of experiments. [score:1]
In the present study, we investigated the effect and potential targets of miR-214-3p in Ang-II -induced fibrosis in vivo and in vitro. [score:1]
Data are shown as mean ± sem, * p < 0.05, ** p < 0.01 vs scramble control, N = 3 in A., C., E. * p < 0.05, ** p < 0.01 vs rAd-GFP control, N = 3 in B., D. Then, miR-214-3p mimic and EZH2 siRNA were also transfected into mouse myofibroblasts. [score:1]
And the anti-fibrotic effect of miR-214 was also reported in a rat mo del of acute myocardial infarction (AMI) [19]. [score:1]
[1 to 20 of 82 sentences]
7
[+] score: 277
In summary, our findings revealed that ER stress suppresses the expression of the miR-199a/214 cluster by activating NFκB to upregulate pro-survival XBP-1 expression, which suggested a novel UPR/NFκB/miR-214/XBP-1 regulatory circuitry whose dysfunction may contribute to tumor survival and progression of HCC. [score:11]
To start unraveling the regulatory mechanisms of miR-199a2/214 expression under UPR conditions in greater detail, we further found that UPR activated NFκB with concomitant suppression of miR-199a2/214 transcription, and this suppression was reversed by NFκB inhibitor PDTC in HepG2 cells, which suggested that NFκB is a potential negative regulator of the miR-199a-2/miR-214 cluster. [score:11]
Putative miR-214 targets were predicted using target prediction programs, miRBase and TargetScan. [score:7]
We further identified that NFκB activated by unfolded protein response (UPR) suppresses miR-199a2/214 transcription, and demonstrated that activation of UPR and endoplasmic reticulum (ER) stress represents an important mechanism responsible for miR-214 and miR-199a-3p/5p down-regulation in HCC development. [score:7]
Restored XBP-1 expression reduced miR-214 overexpression induced HCC tumor suppression in vitro and in vivo. [score:7]
Moreover, we found that the expressions of Ezh2 and plexin-B1 were not negatively correlated with miR-214 in miR-214 -downregulated HCC tumor samples (data not shown). [score:6]
Together, these studies indicated that down-regulated miR-214 in HCC cancer induces the over -expression of XBP-1, which in turn accelerates tumorigenesis. [score:6]
In our study, we showed that NFκB and XBP-1 were predominantly expressed but miR-214 was significantly reduced in human HCC tissues, miR-214 directly targets XBP-1, and UPR or hypoxia induced-NFκB activation negatively controls the miR-199a/214 cluster transcription in HCC cells. [score:6]
The real-time RT-PCR results showed that miR-214 expression was significantly down-regulated in HepG2 cells after TG and TM treatment for 24 h (Figure 5A). [score:6]
Decreased miR-214 expression was observed in 65% of HCC (15 of 23 cases), and consistent down-regulation of both miR-199a-3p and miR-199a-5p also were detected in as much as 73% of HCC (17 of 23 cases) (Figure 1A and B). [score:6]
Thus, miR-199a and miR-214 expression levels are down-regulated by UPR under various physiological and pathological conditions. [score:6]
Result show that miR-214 and miR-199a-3p/5p was significantly down-regulated in HepG2 cells after TG and TM treatments or anoxia, further suggesting that UPR activated XBP-1 or mTOR and ERK pathway to protect tumor cell survival though suppression of the miR-199a2/214 cluster in HCC. [score:6]
These data suggest that miR-214 directly recognizes the 3′UTR of XBP-1 mRNA and inhibits XBP-1 translation. [score:6]
Result show that pre-miR-199a2 and pre-miR-214 expression were markedly decreased in HepG2 cells, while pre-miR-199a1 expression is not altered compared with that in human normal liver, which suggest that pri-miR-199a2 transcription is mainly suppressed in HCC. [score:6]
Furthermore, the suppressive effect of miR-214 in HCC tumor formation and growth was studied in vitro and in vivo, and reintroduction of XBP-1s attenuated miR-214 -mediated suppression. [score:5]
Furthermore, ectopic expression of miR-214 dramatically suppressed the ability of HCC cells to form colonies in vitro and to develop tumors in a subcutaneous xenotransplantation mo del of the BALB/c athymic nude mice. [score:5]
As the UPR transcription factor XBP-1 was identified as a target of miR-214 and recent studies have revealed the important functions of miR-199a/b-3p in HCC carcinogenesis and progression by targeting mTOR and c-Met or PAK4/Raf/MEK/ERK Pathway in HCC cells [5], [21], we decided to further investigate the correlation between UPR activation and miR-199a/214 down -expression. [score:5]
It will be interesting now to determine whether over -expression of miR-214 or modulation of its targeting could provide a new treatment modality for miR-214 -deficient tumor, such as HCC, cervical cancer and breast cancer. [score:5]
But in cervical cancer [27], [29] and breast cancer [35], miR-214 expression was reduced, suggesting a tumor suppressor gene-like function. [score:5]
Re -expression of miR-214 in HCC cell lines (HepG2 and SMMC-7721) inhibited proliferation and induced apoptosis. [score:5]
It is consistent with recent reports that miR-214 is down-regulated in human cervical cancer and negatively regulates Hela cell proliferation [27], [29]. [score:5]
Figure S3 The NFKB and XBP-1s protein expression in miR-214-underexpressed HCC tissues were analyzed by western blotting. [score:5]
0031518.g005 Figure 5(A) HepG2 cells treated with Thapsigargin(TG, 5 µmol/L) and tunicamycin (TM, 5 µg/ml) for 24 h were analyzed by western blotting for GRP94 and XBP1 expression levels and analyzed by real-time RT-PCR for miR-199a-3p/-5p and miR-214 expression. [score:5]
Therefore, a new UPR/NFκB/miR-214/XBP-1 regulatory circuitry was suggested in HCC progression, in which NFκB was activated by UPR and participated in the negative regulation of miR-199a/214 to regulate HCC progression (Figure 7). [score:4]
Further, we tested whether upregulated miR-214 induces HCC cell apoptosis and cell death, by determining the number of early and late apoptotic HepG2 cells following treatments with miR-214 mimics by flow cytometric analysis. [score:4]
These results suggest that miR-214 targets XBP-1 by directly binding the 3′ UTR of XBP-1. 10.1371/journal. [score:4]
miR-214 directly targets XBP-1 by interaction with the 3′-UTR. [score:4]
These results suggest that miR-214 targets XBP-1 by directly binding the 3′ UTR of XBP-1. 10.1371/journal. [score:4]
To further verify a potent role for the miR-214/XBP-1 pathway in mediating tumor cells survival and in regulating HCC tumor growth, we re-expressed XBP-1 in miR-214 treated HCC cells. [score:4]
Our study suggest that modulation of miR-214 levels may provide a new therapeutic approach for cancer treatment and revealed that UPR may offer a new explanation for why the miR-199a/214 cluster were down-regulated in the progression in HCC. [score:4]
XBP-1 was shown to be a direct target of miR-214 by interaction with the 3′-UTR. [score:4]
As miR-214 targets XBP-1 and XBP-1 is a key effector of UPR and ER stress [31], [32], we further investigated whether there might be a link between miR-214 down -expression and the activation of UPR in HCC in hepatoma cells. [score:3]
showed that these miRNAs were all significantly down-regulated and miR-199a-3p>miR-199a-5p>miR-214 compared with adjacent nontumorous liver tissues. [score:3]
In the present study, we showed that miR-199a-3p, miR-199a-5p and miR-214 expression was significantly reduced in HCC tissues. [score:3]
To validate the impact of UPR on miR-214 expression in HCC cells, two classic UPR inducer thapsigargin (TG) and tunicamycin (TM) was used to induce activation of the UPR in HepG2 cells. [score:3]
Moreover, western blot analysis showed that XBP-1 protein level was increased in miR-214 -downregulated human HCC tissues compared with adjacent nontumorous liver tissues (Figure S3). [score:3]
However, the current knowledge about miR-214 expression and function in HCC is still rather unclear. [score:3]
These results indicate a growth -inhibitory role of miR-214 in HCC. [score:3]
In our study, we further identified XBP-1 as a new target of miR-214 by binding its 3′-UTR in HCC cells. [score:3]
Our analysis revealed that XBP-1 was a potential target of miR-214. [score:3]
To confirm that XBP-1 is a putative target of miR-214, we constructed two luciferase reporter vectors with wild-type XBP-1 3′UTR and mutated XBP-1 3′UTR (the complementary sequence in the seed region of miR-214 binding site was mutated). [score:3]
Based on those observations, we assumed that XBP-1, but not Ezh2 and plexin-B1, is the “primary” target of miR214 in HCC, depending on the different cellular context. [score:3]
Therefore, we next searched for the target genes of miR-214 in HCC. [score:3]
Moreover, reintroduction of XBP-1s attenuated miR-214 -mediated suppression of HCC cells proliferation, colony and tumor formation. [score:3]
These results suggest that miR-214 may function as a putative tumor suppressor in HCC cells. [score:3]
Figure S7 pre-miR-199a1, pre-miR-199a2 and pre-miR-214 expression were detected by qRT-PCR in human normal liver and HepG2 cells. [score:3]
The expression levels of miR-199a and miR-214 were also lower in HCC cells exposed to anoxia induced by CoCl [2] (100 µmol/L) (Figure 5B). [score:3]
Similarly, we found that XBP-1 protein level was increased in miR-214-downexpressed human HCC tissues. [score:3]
HepG2 and SMMC-7721 cells were transfected with miRNA/siRNA negative control (miR-con and siR-con), miR-214 mimics or siRNA targeting human NFκB/p65 (RiboBio, Guangzhou, China) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) following the manufacturer's protocol. [score:3]
These data indicated that NFκB is a potential negative regulator of the miR-199a-2/miR-214 cluster. [score:2]
miR-214 regulates HCC tumor formation and growth in vitro and in vivo. [score:2]
In parallel, in HCC cell lines HepG2 and SMMC-7721, miR-199a-3p/5p and miR-214 expression was markedly decreased compared with that in human normal liver (Figure 1C). [score:2]
miR-214 regulates HCC cell proliferation and apoptosis. [score:2]
When co -transfected with miR-214 mimics into HepG2 cells, the relative luciferase activity of a XBP-1 3′UTR luciferase reporter was significantly suppressed by ∼50% compared with the transfection of negative control. [score:2]
NFκB is a potential negative regulator of the miR-199a-2/miR-214 gene. [score:2]
As shown in Figure S7, miR-199a2 and miR-214 were regulated as a cluster from pri-miR-199a2 within the human Dnm3os genes; we next examined the miR-199a2 promoter region for transcription factor binding sites, and identified 3 potential putative NFκB binding sites in a 1.2-kb DNA fragment upstream to the pre-miR-199a2 (Figure S8). [score:2]
The results of the in vitro assays indicated that exogenous miR-214 significantly inhibited the proliferation of hepatoma cell lines. [score:2]
miR-214 negatively regulates XBP-1 through binding to 3′-UTR of the XBP-1.. [score:2]
Similar results were also found in HepG2 cell xenografts trandfected with miR-214 mimics in vivo (Figure S4 and S5). [score:1]
Interestingly, at the 3′-end of the pri-miR-199a2 transcript, there is the precursor sequence for another miRNA pair hsa-mir-214 and hsa-mir-214* [24]. [score:1]
The miR-214, miR-199a-3p and miR-199a-5p level was quantified by real-time quantitative-PCR using TransStartTM SYBR Green qPCR Supermix (TransGen Biotech, Beijing, China), and with U6 small nuclear RNA as an internal normalized reference. [score:1]
Interestingly, similar result of miR-214 -mediated XBP-1 repression was also attained in Hela cells. [score:1]
The miR-214/XBP-1 pathway was shown in this work, while miR-199a-3p/mTOR and miR-199a-5p/DDR1 pathways were reported by other studies. [score:1]
HepG2 cells were plated at low density (200 cells/well) after transfection by miR-control, miR-214 mimics. [score:1]
Furthermore, the miPPR-199a2 region is shown here to be the authentic miR-199a2 promoter that produces the primary transcript harboring the miR-199a-3p, miR-199a-5p and miR-214 sequences as a cluster [25]. [score:1]
0031518.g007 Figure 7 The miR-214/XBP-1 pathway was shown in this work, while miR-199a-3p/mTOR and miR-199a-5p/DDR1 pathways were reported by other studies. [score:1]
HepG2 cells were transiently transfected with indicated plasmids with miR-control, miR-214 mimics. [score:1]
To study the role of the miR-199a/214 cluster in the HCC, levels of miR-214 and miR-199a-3p/5p were determined in 23 pairs of HCC and adjacent benign tissues using real-time PCR. [score:1]
Figure S5 Effect of miR-214 on tumour formation in nude mouse HepG2 xenograft mo del. [score:1]
We found that sequence alignment of hsa-miR-214 with 3′-UTR of the human XBP-1 gene identified a miR-214 binding site (Figure 2A). [score:1]
Consistently, similar effects were also detected in SMMC-7721 cells treated with cholesterol-conjugated 2′-O-methyl -modified miR-214 mimics (agomir-214) (Figure 3D). [score:1]
We further found that transient transfection of HepG2 and SMMC-7721 cells with miR-214 efficiently reduced XBP-1 protein levels detected by western blotting analysis (Figure 2C), which was independent of ATF6 and IRE1 signaling (Figure S1). [score:1]
Several miR-214 targets have been characterized in various tumor types (ovarian cancer, cervical cancer and melanoma) including MEK3, JNK1 [29], PTEN [28], [36], Plexin-B1 [27], Ezh2 [35], [37], and TFAP2C [26] and so on. [score:1]
miR-199a2 and miR-214 have been reported to be produced from a single intron-less transcript of Dynamin 3 opposite (Dnm3os) that is embedded in the opposite strand within an intron of Dynamin in mouse and human [23], [24]. [score:1]
0031518.g002 Figure 2(A) Sequence alignment of human miR-214 with 3′-UTR of XBP-1. The seed sequence of miR-214 matches 3′-UTR of XBP-1 for creating the XBP-1 3′-UTR or mutant luciferase reporter construct. [score:1]
HepG2 and SMMC-7721 cells (3000 per well) were transfected with miR-214 or miR-control in 96-well culture plates. [score:1]
Figure S2 Western blot showing XBP-1protein in Hela cells transfected with miR-control and miR-214 mimics, β-actin as loading controls. [score:1]
Increased level of miR-214 was found in ovarian cancer [28], gastric cancer [34] and melanoma [26], inducing chemotherapy resistance or tumor metastasis. [score:1]
To determine the impact of the miR-214 on HCC cell proliferation, HepG2 and SMMC-7721 cells, were respectively transfected with miR-214 mimics or miR-control and analyzed for cell growth. [score:1]
Figure S1 Western blot showing P-IRE1 and ATF6 protein in HepG2 cells transfected with miR-control and miR-214 mimics, GAPDH as loading controls. [score:1]
The expressions of pre-miR-199a1, pre-miR-199a2, and pre-miR-214 were measured by quantitative RT-PCR, as described previously [59], [60]. [score:1]
To further explore the role of miR-214 in hepatocarcinogenesis, we disclosed that the ER stress -induced pro-survival factor XBP-1 is a target of miR-214 by using western blot assay and luciferase reporter assay. [score:1]
Although miR-199a-3p and miR-199a-5p have been reported to contribute to liver carcinogenesis [5], [21], [22], the role of miR-214 in HCC tumorigenesis has not been elucidated. [score:1]
Figure S4 Effect of miR-214 on colony formation of hepatoma cell lines. [score:1]
The above findings prompted us to explore the biological significance of miR-214 in HCC tumorigenesis in vivo. [score:1]
miR-214 mimics and miR-con transfected HepG2 cells (1×10 [6]), or agomir-214 and agomir-NC treated SMMC-7721 cells (1×10 [6]) transfected with pCMV-XL5-XBP-1s plasmid individually, and were suspended in 100 µL PBS and then injected s. c. into either side of the posterior flank of the same female BALB/c athymic nude mouse at 5 to 6 weeks of age, as described previously [6], [16], [20], [62], [63], [64]. [score:1]
miR-con and miR-214 in Fig. S5 indicate the flanks injected with miR-control -transfected and miR-214 mimics -transfected HepG2 cells, respectively. [score:1]
As expected, few Annexin V -positive cells were detected in the miR-control -treated or untreated cells, whereas miR-214 restoration increased the percentage of apoptotic cells (∼20% in HepG2) as judged by Annexin V staining (Figure 3C). [score:1]
More and more studies documented that miR-214 is involved in human ovarian cancer, cervical cancer and melanoma tumour progression [26], [27], [28], [29]. [score:1]
[1 to 20 of 89 sentences]
8
[+] score: 268
As we have previously demonstrated that miR-214-3p directly targets the 3′-untranslated region (UTR) of ATF4 mRNA to inhibit osteoblast activity 23, to further verify whether the downregulated osteoblast activity was caused by the miR-214-3p in the co-cultured osteoclasts, we transfected osteoblasts with lentiviral vector for expression of exogenous ATF4 mRNA 3′UTR (LV-ATF4 3′UTR) before co-culture with OC-miR-214-3p osteoclasts. [score:13]
In addition, the in vitro data further illustrated that elevated miR-214-3p in osteoclast could suppress osteoblast activity, as evidenced by the markedly downregulated mRNA levels of osteoblast activity-related marker genes in the osteoblasts co-cultured with the osteoclasts overexpressing miR-214-3p. [score:8]
These results indicated that elevated miR-214-3p in osteoclasts could contribute to the upregulated miR-214-3p in osteoblasts and the downregulated osteoblast activity in vitro. [score:7]
More importantly, we found that elevated miR-214-3p in osteoclasts could result in reduced bone formation, which could be rescued by osteoclast -targeted inhibition of miR-214-3p. [score:5]
To examine whether the bone phenotype of OC-miR-214-3p mice could be rescued by therapeutic inhibition of miR-214-3p in osteoclasts, we performed weekly pulsed-injections of antagomiR-214-3p (AMO, 10 mg kg [−1]) encapsulated by our previously developed osteoclast -targeting delivery system, that is, (D-Asp [8])-liposome 33, in 4-week-old OC-miR-214-3p mice (Fig. 4a). [score:5]
To confirm that the above therapeutic effect was attributed to the osteoclast -targeted- delivery of antagomir-214-3p but not to the uptake of antagomir-214-3p in other bone marrow cells that could be potential sources of exosomal miR-214-3p, we investigated whether blocking the interaction between the targeting moiety (D-Asp [8]) and bone resorption surfaces by pretreatment with D-Asp [8] could abolish the beneficial effect of osteoclast -targeted- delivery of antagomir-214-3p on bone formation. [score:5]
Collectively, these results indicate that osteoclast -targeted inhibition miR-214-3p could promote bone formation in ageing OVX mice. [score:5]
The 20-nt guide sequences targeting mouse mmu- miR-214-3p was designed and cloned into a Cas9-2A-Puro plasmid containing a mouse CMV promoter -driven Cas9 expression cassette. [score:5]
Thus, we evaluated the therapeutic effect of osteoclast -targeted miR-214-3p inhibition by administration of antagomiR-214-3p delivered by our recently developed osteoclast -targeting delivery system 33. [score:5]
Towards translational medicine, therapeutic inhibition of miR-214-3p in osteoclasts may be a potential bone anabolic strategy to reverse the established osteoporosis. [score:5]
To test whether miR-214-3p inhibition in osteoclasts could promote bone formation, we performed pulsed administration of antagomir-214-3p (AMO) encapsulated by the aforementioned osteoclast -targeting delivery system 33 in an ageing OVX mouse mo del. [score:5]
and real-time PCR analysis at 24 h after AMO injection confirmed that antagomir-214-3p could be effectively delivered to osteoclasts in vivo, as evidenced by the numerous instances of co-localization of fluorescein amidite (FAM) -labelled antagomiR-214-3p with CTSK [+] cells (osteoclasts) in distal femur cryosections and the downregulated miR-214-3p level in CTSK [+] cells isolated by LCM (Supplementary Fig. 10). [score:4]
To delineate the role of osteoclastic miR-214-3p in regulating bone formation, we generated a genetic mouse mo del in which miR-214-3p was specifically overexpressed in osteoclasts (OC-miR-214-3p mice). [score:4]
Considering the role of exosomal miR-214-3p derived from osteoclasts in regulating osteoblastic bone formation, inhibition of this miRNA in osteoclasts may exert beneficial effect on bone formation. [score:4]
Osteoclastic miR-214-3p inhibit osteoblast activity. [score:3]
Given that Ctsk has been recently reported to be expressed in osteocytes 31, we examined the miR-214-3p level in osteocytes from either the OC-miR-214 mice or WT mice by Q-PCR analysis. [score:3]
The ROSA26-miR-214-3p knock-in mice containing the miR-214-3p knock-in allele were generated, and then crossed with the Ctsk-cre transgenic mice to obtain the OC-miR-214-3p mice. [score:3]
MC-3T3-E1 cells/RAW264.7 cells cultured in DMEM medium were transfected with Cas9-2A-Puro control and mmu- miR-214-3p gene -targeted gRNA-containing plasmids using Lipofectamine 2000 (Life technologies). [score:3]
To examine whether exosomal miR-214-3p derived from osteoclasts could inhibit bone formation in vivo, a batch of 3-month-old female C57BL/6J mice were intravenously injected with PKH67 -labelled exosomes (100 μg per mouse) isolated and purified from the supernatant of OC-miR-214-3p osteoclasts or equal volume of phosphate-buffered solution (PBS, set as negative control). [score:3]
Osteoclast -targeted antagomir-214-3p treatment rescues bone phenotype in OC-miR-214-3p mice. [score:3]
Exosomal miR-214-3p from osteoclasts inhibits osteoblast activity. [score:3]
Thus, all these data indicate that the aberrantly elevated miR-214-3p in osteoclasts may contribute to the suppression on osteoblast activity and reduction on bone formation. [score:3]
Collectively, our results indicate that osteoclast-derived exosomal miR-214-3p could be transferred into osteoblasts to inhibit osteoblastic bone formation. [score:3]
To delineate whether exosomal miR-214-3p transferred from osteoclasts could inhibit osteoblast activity, we co-cultured osteoclasts with osteoblasts in a Transwell system with a 0.4-μm pore polyethylene terephthalate (PET) membrane that allowed transfer of exosomes (50–150 nm) but blocked most of the other shed microvesicles (0.4–1 μm in diameter) and apoptotic bodies (diameter>1 μm; ref. [score:3]
Thereafter, we examined the mRNA expression of osteoblast activity-related marker genes (Alp, Opn, Bsp and Bglap) in osteoblasts at 48 h after co-culture with OC-miR-214-3p and WT osteoclasts, respectively. [score:3]
The mRNA levels of those genes were all remarkably downregulated in osteoblasts co-cultured with OC-miR-214-3p osteoclasts when compared with those in osteoblasts co-cultured with WT osteoclasts (Fig. 5d). [score:3]
Thereafter, we performed a series of studies to rigorously address whether osteoclast-derived exosomal miR-214-3p released from could be transferred into osteoblasts to inhibit bone formation. [score:3]
Taken together, these results indicate that exosomal miR-214-3p could be transferred from osteoclasts to osteoblasts to inhibit osteoblast activity in vitro. [score:3]
Osteoclast-derived exosomal miR-214-3p inhibits bone formation. [score:3]
Osteoclast-derived exosomal miR-214-3p inhibit bone formation. [score:3]
These data hinted that elevated miR-214-3p in osteoclasts could inhibit osteoblast activity in vitro. [score:3]
Consistently, the miR-214-3p level in osteoblasts co-cultured with OC-miR-214-3p osteoclasts was significantly upregulated as compared with that in osteoblasts co-cultured with WT osteoclasts (Fig. 5b). [score:3]
miR-214-3p -depleted MC-3T3-E1 cells and RAW264.7 cellsA CRISPR/Cas9 system targeting mmu-miR-214-3p gene was purchased from Shanghai Integrated Biotech Solutions Co. [score:3]
Taken together, our study suggests that exosomal miR-214-3p could serve as an intercellular messenger to mediate osteoclast-to-osteoblast communication for inhibiting osteoblastic bone formation. [score:3]
Taken together, these data imply that exosomal miR-214-3p derived from osteoclasts could inhibit bone formation in vivo. [score:3]
How to cite this article: Li, D. et al. Osteoclast-derived exosomal miR-214-3p inhibits osteoblastic bone formation. [score:3]
It has been reported that miR-214-3p promotes osteoclast differentiation by targeting the Pten/PI3k/Akt pathway 24. [score:3]
All these results suggest that inhibition of miR-214-3p in osteoclasts could promote bone formation and increase bone mass in ageing OVX mice. [score:3]
Inhibition of miR-214-3p in osteoclasts promotes bone formation. [score:3]
A CRISPR/Cas9 system targeting mmu-miR-214-3p gene was purchased from Shanghai Integrated Biotech Solutions Co. [score:3]
In brief, a cassette containing the following components was constructed to target the Rosa26 locus: FRT-LoxP-stop codons-three SV40 poly(A) sequences- LoxP-mmu-miR-214-3p-WPRE-bGH poly(A)-AttB-PGK promoter- FRT-Neo-PGK poly(A)-AttP (Fig. 2a). [score:3]
In this study, we performed a series of in vitro and in vivo studies to identify that osteoclast-derived exosomal miR-214-3p could transfer to osteoblasts to inhibit bone formation, proposing a paradigm of miRNA -mediated osteoclast-to-osteoblast communication for participation in homeostasis mechanism of local bone environment. [score:3]
Elevated miR-214-3p in osteoclasts inhibits bone formation. [score:3]
Taken together, these data suggest that elevated miR-214-3p in osteoclasts could inhibit bone formation. [score:3]
In the present study, we identified that exosomal miR-214-3p could be transferred from osteoclasts to osteoblasts to regulate bone formation, serving as an intercellular messenger to mediate osteoclast-to-osteoblast communication. [score:2]
To generate the OC-miR-214-3p mice, first, we generate the Rosa26-PCAG-STOP [fl]- mmu-miR-214-3p-knock-in mice. [score:2]
Thereafter, the chimeric mice were intercrossed with C57BL/6 mice to obtain F1 heterozygote mice and then backcrossed with C57BL/6 mice to expand the enough number of heterozygote Rosa26-PCAG-STOP [fl]- mmu-miR-214-knock-in mice. [score:2]
Thereafter, we crossed the Rosa26-PCAG-STOP [fl]- mmu-miR-214-knock-in mice with Ctsk-Cre mice to obtain OC-miR-214-3p mice. [score:2]
To investigate the role of osteoclastic miR-214-3p in regulating bone formation, we generated a mouse strain containing the miR-214-3p knock-in allele, then crossed them with the Ctsk-cre transgenic mice to obtain the osteoclast-specific miR-214-3p knock-in (OC-miR-214-3p) mice (Fig. 3a–c). [score:2]
We found no significant difference in the osteocytic miR-214 levels between OC-miR-214 and WT mice (Supplementary Fig. 7). [score:1]
Four weeks after the first AMO injection, micro-CT analysis revealed significantly higher bone mass with well-organized trabecular architecture at distal femur in OC-miR-214-3p+AMO mice, which was similar to those in WT mice (Fig. 4b). [score:1]
On the other hand, the intra-osseous mRNA levels of bone formation marker genes, including alkaline phosphatase (Alp), osteopontin (Opn), bone sialoprotein (Bsp) and Bglap, were all remarkably lower in OC-miR-214-3p mice than those in WT mice (Fig. 3e). [score:1]
N (trabecular numbers), were all significantly lower in OC-miR-214-3p mice than those in WT mice (Fig. 3g). [score:1]
Increased intraosseous miR-214-3p associates with elevated serum exosomal miR-214-3p and reduced bone formation in elderly patients. [score:1]
On the other hand, the miR-214-3p level in miR-214-3p -depleted osteoblasts co-cultured with OC-miR-214-3p osteoclasts was significantly higher than that in miR-214-3p -depleted osteoblasts co-cultured with WT osteoclasts (Fig. 6d). [score:1]
Eight weeks after the first injection, we performed real-time PCR analysis to examine the miR-214-3p level in osteoclasts (CTSK [+] cells) and osteoblasts (ALP [+] cells) isolated from distal femur cryosections by LCM, respectively. [score:1]
Subsequently, another batch of 3-month-old female C57BL/6J mice were intravenously injected with exosomes (100 μg per mouse) isolated and purified from the supernatant of either OC-miR-214-3p osteoclasts (OC-miR-214-3p-exosomes) or WT osteoclasts (WT-exosomes; Fig. 8a). [score:1]
Conversely, the level of either intracellular miR-214-3p or supernatant exosomal miR-214-3p in mature osteoclasts was higher than that in osteoclast precursors, and the level of intracellular miR-214-3p in OSCAR [+] cells (purified osteoclasts) was also higher than that in OSCAR [−] cells (non-osteoclasts; Supplementary Fig. 3e,f). [score:1]
We transfected the OC-miR-214-3p osteoclasts with CMV-GFP-CD63 to label the osteoclast-derived exosomes and detected numerous GFP -positive particles in the co-cultured osteoblasts. [score:1]
To confirm whether osteoclast-derived exosomal miR-214-3p contributes to the elevated miR-214-3p in osteoblasts, the miR-214-3p -depleted osteoclasts and the miR-214-3p -depleted osteoblasts were differentiated from the miR-214-3p -depleted RAW264.7 cell line and the miR-214-3p -depleted MC3T3-E1 cell line, respectively, wherein miR-214-3p gene was depleted using the CRISPR-Cas9 system 38 (Supplementary Fig. 13). [score:1]
Consistently, we observed the elevated bone resorption in OC-miR-214-3p mice and found that miR-214-3p could promote osteoclast differentiation in vitro. [score:1]
Consistently, we found an age-related increase in miR-214-3p level in whole serum and serum exosomes from OVX mice, respectively (Fig. 2b). [score:1]
Pm (osteoclast number per bone perimeter) at distal femur were both remarkably higher in OC-miR-214-3p mice when compared with those in WT mice (Fig. 3i), and miR-214-3p could promote osteoclast differentiation in vitro (Supplementary Fig. 9), suggesting a dual role of miR-214-3p in regulating bone formation and bone resorption. [score:1]
The undecalcified bone histology showed that the width between xylenol orange and calcein green labelling at distal femur in OC-miR-214-3p+AMO mice resembled that in WT mice (Fig. 4d). [score:1]
We found that the miR-214-3p level in osteoblasts co-cultured with miR-214-3p -depleted osteoclasts was significantly lower than that in osteoblasts co-cultured with miR-214-3p-intact osteoclasts, whereas no significant difference in the level of either pri-miR-214-3p or pre-miR-214-3p level was found between the osteoblasts co-cultured with miR-214-3p -depleted osteoclasts and miR-214-3p-intact osteoclasts (Fig. 6c). [score:1]
Interestingly, the miR-214-3p level was almost equal in whole serum and serum exosomes (Supplementary Fig. 2a,b). [score:1]
One unit included the mmu-miR-214-3p stem–loop, a 200-bp 5′ flanking sequence and a 200-bp 3′ flanking sequence. [score:1]
We found an age-related increase in the level of either pri-miR-214-3p, pre-miR-214-3p or miR-214-3p in osteoclasts, wherein the increased miR-214-3p level was correlated with the increased serum exosomal miR-214-3p level and decreased BFR/BS, respectively (Fig. 2b,e). [score:1]
Given that exosomes could protect miRNAs from RNase -induced degradation and mediate intercellular communication 37, we next verifed whether exosomal miR-214-3p was transferred from osteoclasts to osteoblasts. [score:1]
Subsequently, we examined the levels of pri-miR-214-3p, pre-miR-214-3p and mature miR-214-3p in CTSK [+] cells (osteoclasts) isolated from distal femur cryosections in the above ageing OVX mice by laser-captured microdissection (LCM) in combination with real-time PCR. [score:1]
Consistently, the values of micro-CT parameters in OC-miR-214-3p+AMO mice were almost restored to the levels in WT mice (Fig. 4c and Supplementary Fig. 11a). [score:1]
To determine whether osteoclasts (or osteoblasts) make greater contribution to serum exosomal miR-214-3p rather than osteoblasts (or osteoclasts), we examined the miR-214-3p level in the cultured osteoblasts and osteoclasts, respectively. [score:1]
The mmu- miR-214-3p gRNA oligonucleotides were as follows: forward, 5′-ACCGTGCCTGCTGTACAGGTGAG-3′, reverse, 5′-AAACCTCACCTGTACAGCAGGCA-3′. [score:1]
Similarly, miR-214-3p was also abundant in the supernatant exosomes of mouse OCs rather than in those of mouse OBs in vitro (Supplementary Fig. 3b). [score:1]
N) at distal femur in mice treated with OC-miR-214-3p exosomes (Fig. 8d,e). [score:1]
Interestingly, the age-related increase in miR-214-3p level was accelerated in those specimens from the above elderly patients with low-energy fractures (Fig. 1b). [score:1]
The OC-miR-214-3p osteoclasts were transfected with CMV-GFP-CD63 before co-culture with osteoblasts (Fig. 6a). [score:1]
Qualitatively, undecalcified bone histology showed that the width between double labelling at distal femur was smaller in OC-miR-214-3p mice than that in WT mice (Fig. 3h). [score:1]
We observed numerous GFP [+] particles within osteoblasts after 24 h co-culture with OC-miR-214-3p osteoclasts by confocal imaging (Fig. 6b). [score:1]
N) at the distal femur metaphysis from the mice administered with either OC-miR-214-3p Exo or WT-Exo, respectively. [score:1]
Moreover, the miR-214-3p level in serum exosomes was negatively correlated with the BFR/BS in OVX mice (Fig. 2e). [score:1]
Another batch of 3-month-old female C57BL/6J mice received eight consecutive intravenous injections of either OC-miR-214-3p exosomes or WT exosomes (100 μg per mouse) at a weekly interval and killed 1 week after the last injection (Fig. 8a). [score:1]
Then, we examined the bone phenotype in 2-month-old OC-miR-214-3p mice. [score:1]
As miR-214-3p is evolutionally conserved among several species 23, we explored the above relationships in an ageing OVX mouse mo del (Fig. 2a). [score:1]
Consistently, after the mice were injected with PKH67 -labelled exosomes derived from OC-miR-214-3p osteoclasts, we detected intra-osseous fluorescence signal and observed co-localization of PKH67 -positive particles with osteoblasts in vivo. [score:1]
Reduced bone formation in OC-miR-214-3p mice. [score:1]
Osteoclast-derived exosomal miR-214-3p transfer to osteoblasts. [score:1]
Pm) at the distal femur metaphysis from the mice administered with either OC-miR-214-3p Exo or WT-Exo, respectively. [score:1]
In addition, we found a positive correlation between the serum exosomal miR-214-3p level and intra-osseous miR-214-3p level in elderly women with fractures and between the serum exosomal miR-214-3p level and intra-osteoclast miR-214-3p level in OVX mice, respectively. [score:1]
All these data suggest that exosomal miR-214-3p could be transferred from osteoclasts to osteoblasts. [score:1]
Furthermore, we found increased miR-214-3p level with no changes in the level of either pri-miR-214-3p or pre-miR-214-3p in osteoblasts after injecting the above osteoclast-derived exosomes in vivo. [score:1]
In addition, our in vitro data postulated that the osteoclasts rather than osteoblasts could contribute to the serum exosomal miR-214-3p, as evidenced by the abundant miR-214-3p in supernatant exosomes of the osteoclasts (mouse and human OCs) rather than the osteoblasts (mouse and human OBs) in vitro. [score:1]
Pm) at the distal femur metaphysis from WT and OC-miR-214-3p mice. [score:1]
The relative miR-214-3p level in each group was normalized to the mean value of the 60–69 group. [score:1]
The above data suggested that osteoclasts rather than osteoblasts could make greater contribution to the elevated serum exosomal miR-214-3p level. [score:1]
We found abundant miR-214-3p in mature mouse osteoclasts (mouse OCs) differentiated from bone marrow macrophages (BMMs) but not in mature mouse osteoblasts (mouse OBs) differentiated from calvarial bone-derived osteoblast precursor cells (Supplementary Fig. 3a). [score:1]
The 4-week-old OC-miR-214-3p or WT mice were intravenously injected with PBS (OC214-3p/WT), (D-Asp) [8]-liposome (vehicle) alone (OC214-3p+Veh/WT+Veh), (D-Asp) [8]-liposome-antagomir nonsense control (OC214-3p+NC/WT+NC) and (D-Asp) [8]-liposome-antagomir-214-3p (OC214-3p+AMO/WT+AMO), respectively, at a weekly interval and killed 4 weeks after the first treatment. [score:1]
The real-time PCR analysis showed that only the level of miR-214-3p but not the other examined miRNAs increased with age in whole serum, serum exosomes and bone specimens, respectively (Fig. 1b and Supplementary Fig. 1c). [score:1]
Thus, it hints that miR-214-3p in osteoclasts could be released in exosome-encapsulated form. [score:1]
As expected, the mRNA levels of osteoblast activity-related marker genes in the osteoblasts transfected with LV-ATF4 3′UTR and co-cultured with OC-miR-214-3p osteoclasts were partially restored to the levels in the non -transfected osteoblasts co-cultured with WT osteoclasts (Fig. 5e). [score:1]
All these data suggest that elevated miR-214-3p in osteoclasts could result in reduced bone formation. [score:1]
N) at the distal femur metaphysis from WT and OC-miR-214-3p mice. [score:1]
The relative miR-214-3p level in each group was normalized to the mean value of the OVX-BS group. [score:1]
In consistent with a recent study showing that 3′ end-uridylated miRNA isoforms appear overrepresented in exosomes 30, we also detected 3′ end-uridylated miR-214-3p in the above serum exosomes, suggesting that miR-214-3p was enriched in serum exosomes (Supplementary Fig. 1d). [score:1]
Similarly, the miR-214-3p levels in whole serum and serum exosomes were also almost equal in OVX mice (Supplementary Fig. 2c,d). [score:1]
After exosomes isolation from the culture medium of OC-miR-214-3p osteoclasts differentiated from OC-miR-214-3p mice-derived BMMs, the isolated exosomes were pre -labelled using PKH67 Green Fluorescent Cell Linker Kit (Sigma). [score:1]
Thereafter, the osteoblasts were co-cultured with OC-miR-214-3p and WT osteoclasts, respectively, wherein the supernatant were harvested for exosomes isolation and miRNAs extraction. [score:1]
miR-214-3p -depleted MC-3T3-E1 cells and RAW264.7 cells. [score:1]
High miR-214-3p in osteoclasts associates with reduced bone formation. [score:1]
These results suggest that the exogenous osteoclastic miR-214-3p could transfer to become constitutional part of mature miR-214-3p in osteoblasts. [score:1]
Moreover, the level of miR-214-3p was remarkably higher in OSCAR [+] cells than that in ALP [+] cells (Supplementary Fig. 3g). [score:1]
Similarly, the level of mature miR-214-3p also significantly increased in miR-214-3p -depleted osteoblasts after co-culture with the OC-miR-214-3p osteoclasts, whereas the level of either mature miR-214-3p, pri-miR-214-3p or pre-miR-214-3p did not significantly increase in osteoblasts after co-culture with miR-214-3p -depleted osteoclasts. [score:1]
The osteoblasts derived from the calvarial bone of newborn C57BL/6 mice were co-cultured with the osteoclasts derived from OC-miR-214-3p mice (OC-miR-214-3p OCs) or WT mice (WT OCs), or cultured without osteoclasts (No OC). [score:1]
Pm at distal femur were all lower in mice treated with OC-miR-214-3p exosomes than those in mice treated with WT exosomes (Fig. 8f,g). [score:1]
Increased intra-osteoclast miR-214-3p associates with elevated serum exosomal miR-214-3p and reduced bone formation in OVX mice. [score:1]
The female C57BL/6 mice were intravenously injected with purified exosomes derived from either OC-miR-214-3p (OC-miR-214-3p Exo) or WT (WT-Exo) osteoclasts. [score:1]
For studies 4 and 5, based on our pilot data with a small sample size, it showed a percentage difference of 7.6% at least in ‘BFR/BS' between OC-miR-214-3p exosomes -treated mice and WT exosomes -treated mice or between the OVX mice in AMO and NC group. [score:1]
Another group of OC-miR-214-3p or WT mice were killed at 4-week-old before treatment initiation as baseline (OC214-3p-BS/WT-BS). [score:1]
The osteoclasts were differentiated from BMMs from the OC-miR-214-3p and WT mice, respectively, under the stimulation of macrophage colony-stimulating factor (M-CSF) and receptor activator for nuclear factor-κB ligand (RANKL) 35. [score:1]
To exclude the possibility that the elevated supernatant miR-214-3p level was caused by the increased exosome production in osteoclasts, the number of exosomes was assessed by nanosight technology. [score:1]
Consistently, we also found an age-related increase in miR-214-3p level in whole serum, serum exosomes and bone tissues in the age-matched controls without fractures, respectively (Fig. 1b and Supplementary Tables 4 and 5). [score:1]
Pm) in OC-miR-214-3p+AMO mice were almost restored to the levels in WT mice, respectively (Fig. 4e and Supplementary Fig. 11b). [score:1]
Impressively, the result showed that the reducing effect of (D-Asp [8])-lipsome-antagomir-214-3p treatment on miR-214-3p levels in osteoclasts and osteoblasts were almost prevented in those OVX mice pretreated with D-Asp [8] 24 h ahead of each AMO treatment (Supplementary Fig. 16a). [score:1]
However, no significant difference in the level of either pri-miR-214-3p or pre-miR-214-3p in osteoblasts was found between the two co-cultures (Fig. 5c). [score:1]
Therefore, at this stage, it could not be excluded that exosomes derived from non-osteoclasts, for example, endothelial cells-derived exosomes 39, may also contribute to the serum exosomal miR-214-3p level. [score:1]
We found that the level of either intracellular miR-214-3p and supernatant exosomal miR-214-3p in mature osteoblasts was lower than that in osteoblast precursors, and the level of intracellular miR-214-3p in ALP [+] cells (purified osteoblasts) was also lower than that in ALP [−] cells (non-osteoblasts) (Supplementary Fig. 3c,d). [score:1]
We found a close association between the elevated miR-214-3p in osteoclasts and reduced bone formation, as evidenced by the negative correlation between the intra-osseous miR-214-3p level and BGLAP mRNA level in elderly women with fractures, and between the intra-osteoclast miR-214-3p level and bone formation rate in OVX mice. [score:1]
Taken together, these data indicate that increased miR-214-3p in osteoclasts associates with reduced bone formation. [score:1]
CMV-GFP-CD63 were transfected into the OC-miR-214-3p osteoclasts to label the osteoclast-derived exosomes. [score:1]
More importantly, the in vivo data showed that administration of exosomes derived from the OC-miR-214-3p osteoclasts could result in reduced bone formation. [score:1]
We postulated that the transfected ATF4 mRNA 3′UTR could compete with the endogenous ATF4 mRNA to combine with the transferred miR-214-3p from OC-miR-214-3p osteoclasts. [score:1]
Then, we performed real-time PCR to examine the miR-214-3p level in osteoblasts (ALP [+] cells) isolated from bone marrow cells by FACS at 24 h after exosome treatments. [score:1]
Real-time PCR analysis revealed that the miR-214-3p level in either supernatant or supernatant exosomes in the co-culture of osteoblasts and OC-miR-214-3p osteoclasts was dramatically higher than those in the co-culture of osteoblasts and WT osteoclasts at 24 h after co-culture (Fig. 5b). [score:1]
Consistently, the miR-214-3p levels in osteoclasts and serum exosomes were both remarkably higher in OC-miR-214-3p mice than those in WT mice (Fig. 3d). [score:1]
The osteoblasts transfected with either vehicle (OC-miR-214 3p+Veh), nonsense 3′UTR control (OC-miR-214 3p+NC) or ATF4 mRNA 3′UTR (OC-miR-214 3p+ ATF4 mRNA 3′UTR) were co-cultured with the OC-miR-214 3p osteoclasts. [score:1]
Furthermore, the serum exosomal miR-214-3p level was positively correlated with the intra-osseous miR-214-3p level (Fig. 1e), whereas we found a negative correlation between serum exosomal miR-214-3p level and intra-osseous BGLAP mRNA level and between intra-osseous miR-214-3p level and intra-osseous BGLAP mRNA level, respectively (Fig. 1e). [score:1]
To investigate whether the osteoclast-derived exosomal miR-214-3p could be transferred into osteoblasts to inhibit bone formation, we transfected the osteoblasts with ATF4 3′UTR and found that the repressed osteoblast activity after co-culture with OC-miR-214-3p osteoclasts could be remarkably restored. [score:1]
[1 to 20 of 137 sentences]
9
[+] score: 266
This conclusion was based upon the following findings: (i) inhibition of miR-214 ameliorated high glucose -induced expression of hypertrophic marker genes in human MCs; (ii) in vivo studies in db/db mice further confirmed that inhibition of miR-214 significantly reduced the expression of SM22, α-SMA and collagen IV, markedly restored PTEN level, and attenuated albuminuria and mesangial expansion; (iii) miR-214 was identified to target PTEN. [score:11]
The results demonstrated that overexpression of miR-214 inhibited the expression of PTEN and activated the expression of α-SMA, SM22 and collagen IV. [score:9]
In vivo study further confirmed that inhibition of miR-214 markedly downregulated the expression of SM22, α-SMA in isolated glomeruli and attenuated the mesangial expansion in db/db mice. [score:8]
In addition, co-transfection of human MCs with lentiviral vectors expressing miR-214 and CDS of PTEN induced an increase in PTEN expression and a decrease in expression of hypertrophic-related genes. [score:7]
In addition, our data showed that miR-214 targeted the same sites as previously reported 26, however, we found that inhibition of miR-214 reduced the expression of SM22, α-SMA, restored PTEN level, as well as attenuated albuminuria and mesangial expansion in db/db mice. [score:7]
More importantly, we transfected human MCs with lentiviral vectors expressing miR-214 and coding sequence (CDS) of PTEN in high glucose -treated human MCs to confirm whether miR-214 regulated mesangial hypertrophy by targeting PTEN. [score:6]
We found that miR-214 directly targeted PTEN, which was consistent with PTEN being a target of miR-214 in monocytes in vitro as previously reported 26. [score:6]
Moreover, inhibition of miR-214 also reduced mRNA and protein expression of hypertrophic markers α-SMA, SM22 and collagen IV in diabetic glomeruli (Fig. 5B–D). [score:5]
These data conclusively demonstrated that inhibition of miR-214 ameliorated glomerular hypertrophy in db/db mice and this effect was associated with the restoration of PTEN expression. [score:5]
Treatment with miR-214 inhibitor attenuated glomerular hypertrophy, accompanied by restoration of PTEN expression in db/db mice. [score:5]
However, inhibition of miR-214 significantly restored the mRNA and protein expression of PTEN in diabetic glomeruli (Fig. 5B–D). [score:5]
In this study, we showed that inhibition of miR-214 significantly ameliorated glomerular hypertrophy under diabetic conditions by targeting PTEN in vivo and in vitro. [score:5]
Moreover, human MCs were infected with lentiviral vectors expressing miR-214 and coding sequence (CDS) of PTEN, thus inducing overexpression of miR-214 and PTEN in the cells. [score:5]
Finally, in vivo studies further confirmed that treatment with miR-214 inhibitor restored protein and mRNA expression of PTEN in kidney tissue from db/db mice. [score:5]
We performed sequence alignment of PTEN 3′-untranslated region (UTR) by using five species including human, rat, mouse, cow and dog, and then listed miR-214 target sites region (Fig. 3D). [score:5]
Inhibition of miR-214 attenuated glomerular hypertrophy via targeting PTEN in db/db mice. [score:5]
First, we listed candidate miRNA genes and target genes on degree level, and used the degree to take miR-214 as the strongest candidate gene and take PTEN as the strongest target gene (data shown in supplementary Tables S1 and S2). [score:5]
These results suggest that inhibition of miR-214 might ameliorate glomerular hypertrophy under diabetic condition by targeting PTEN. [score:5]
Control: MCs cultured in high glucose served as control; ScRNA: MCs transfected with scramble control; miR-214: MCs infected with lentiviral vectors expressing miR-214; miR-214+PTEN: MCs infected with lentiviral vectors expressing miR-214 and CDS of PTEN. [score:5]
MiR-214 contributed to diabetic MC hypertrophy in vitro by targeting PTENTransfection of anti-miR-214 reduced the mRNA expression of miR-214, α-SMA, SM22 and collagen IV in high glucose -treated human MCs (Fig. 3A). [score:5]
However, inhibition of miR-214 significantly reduced expression of hypertrophic markers α-SMA, SM22 and collagen IV, and partially restored PTEN protein level in high glucose-stimulated human MCs. [score:5]
In contrast, inhibition of miR-214 significantly restored the expression of PTEN in diabetic kidneys (Fig. 5A). [score:5]
We found that inhibition of miR-214 reduced the expression of α-SMA and SM22, accompanied by an increase in the protein level of PTEN. [score:5]
These results indicated that miR-214 contributed to MC hypertrophy, and inhibition of miRNA-214 ameliorated high glucose -induced expression of hypertrophic marker genes and significantly restored PTEN protein level in human MCs. [score:5]
The cells were infected with miR-214 inhibitor -expressing lentivirus at a dose of 5 × 10 [6] TU as published previously 37, while the cells cultured in serum-free DMEM with 5 mmol/L of glucose and 20 mmol/L of mannitol served as a control as previously described 38. [score:5]
In this study, we showed that miR-214 was markedly upregulated in isolated glomeruli in db/db mice. [score:4]
Overexpression of PTEN could ameliorate miR-214 -mediated MC hypertrophy while knockdown of PTEN mimicked the MC hypertrophy. [score:4]
To further explore the mechanisms by which miR-214 regulated diabetic glomerular hypertrophy, we examined the expression of PTEN in the kidneys. [score:4]
Taken together, overexpression of PTEN markedly attenuated miR-214 -mediated MC hypertrophy while knockdown of PTEN mimicked miR-214 -mediated MC hypertrophy. [score:4]
miR-214 contributed to human MC hypertrophy by directly targeting PTEN in vitro. [score:4]
These results indicated that the lentivirus-packed miR-214 inhibitor significantly knocked down the endogenous miR-214 and the delivery procedure was effective (Fig. 4B). [score:4]
Thus, miR-214 regulated mesangial hypertrophy by targeting PTEN. [score:4]
These results strongly indicated that targeting miR-214 might be an attractive strategy to attenuate diabetic kidney injury. [score:3]
These results have demonstrated that inhibition of miR-214 significantly ameliorates functional (UAE) and morphological glomerular defects in db/db mice. [score:3]
Furthermore, we examined the ultrastructure of mesangial area by electron microscopy and found that inhibition of miR-214 also attenuated ECM deposition in db/db mice (Fig. 4E). [score:3]
We did not examine the effects of miR-214 inhibition on diabetic podocytes. [score:3]
Recent study has demonstrated that deletion of miR-214 inhibits tubulointerstitial lesions in a unilateral ureteral obstruction (UUO) mouse mo del 33. [score:3]
A mutant of the 3′UTR with a mutation of complementary sequences for the seed sequence of miR-214 was developed by the QuikChange II Site-Directed Mutagenesis Kit (Stratagene, CA). [score:3]
Diabetic mice were then randomly divided into three groups (n = 10/each group): (1) untreated db/db group (db/db); (2) db/db group infected with scrambled control and (3) db/db group treated with miR-214 inhibitor (Invitrogen, CA). [score:3]
Treatment with miR-214 inhibitor also markedly reduced the miR-214 level in isolated glomeruli from db/db mice. [score:3]
In contrast, treatment with miR-214 inhibitor significantly ameliorated mesangial expansion in db/db mice (Fig. 4C,D). [score:3]
db/m, db/m control mice; db/db, diabetic db/db mice; ScRNA, db/db mice treated with miR-214 scramble; anti-miR-214, db/db mice treated with miR-214 inhibitor. [score:3]
To test the role of miR-214 in the pathogenesis of MC hypertrophy, we transfected a miR-214 inhibitor (System Bioscience) into cultured human MCs. [score:3]
Transfection of anti-miR-214 reduced the mRNA expression of miR-214, α-SMA, SM22 and collagen IV in high glucose -treated human MCs (Fig. 3A). [score:3]
As shown in supplementary Tables S1 and S2, we used the degree to take miR-214 as the strongest candidate gene among all the candidate miRNAs while PTEN has the highest degree value among all the potential target genes. [score:3]
To examine the effect of miR-214 on DN in vivo, we delivered lentivirus-packed miR-214 inhibitor at a dose of 1 × 10 [7] TU into diabetic mice by tail vein injections every 2 weeks. [score:3]
After mutating the nucleotides of seeding sequence in the 3′ UTR of PTEN, the inhibitory effect of miR-214 mimics on luciferase reporter activity were largely abolished (Fig. 3F). [score:3]
LG + Osm, low glucose (5 mmol/L) supplemented with mannitol (20 mmol/L); HG, high glucose (25 mmol/L); ScRNA, HG with scramble control; anti-miR214, HG with transfection of miR-214 inhibitor. [score:3]
These results clearly demonstrated that inhibition of miR-214 attenuated glomerular hypertrophy under diabetic conditions in vivo and in vitro. [score:3]
We also demonstrated that miR-214 promoted human MC hypertrophy and overexpression of collagen IV proteins in the presence of high glucose. [score:3]
However, treatment with miR-214 inhibitor significantly decreased UAE in db/db mice (Fig. 4A). [score:3]
Aberrant expression of miR-214 was identified in a wide range of human tumors such as nasopharyngeal carcinoma, breast cancer, ovarian cancer, colorectal cancer etc. [score:3]
Treatment with miR-214 inhibitor ameliorated the glomerular mesangial expansion in db/db mice. [score:3]
Inhibition of miR-214 ameliorated albuminuria and glomerular mesangial expansion in db/db mice. [score:3]
We also used a luciferase assay in HEK293 cells to identify whether PTEN as the target of miR-214. [score:2]
These results demonstrated a direct binding of miR-214 to the 3′ UTR of PTEN. [score:2]
We further demonstrated that exogenous PTEN markedly ameliorated miR-214 -mediated MC hypertrophy while knockdown of PTEN mimicked the MC hypertrophy. [score:2]
MiR-214 contributed to diabetic MC hypertrophy in vitro by targeting PTEN. [score:2]
However, the potential role of miR-214 in the development of DN has not been fully explored. [score:2]
Our results showed that knockdown of miR-214 significantly attenuated UAE and glomerular mesangial expansion, which was accompanied by restoration of the PTEN level in diabetic db/db mice. [score:2]
We further revealed the mechanisms underlying the regulation of miR-214 on MC hypertrophy. [score:2]
In summary, these results suggest that the regulatory effects of miR-214 on PTEN are likely to be accountable for its action against diabetic MC hypertrophy. [score:2]
Our study showed that miR-214 promoted diabetic MC hypertrophy via PTEN and provided an understanding of the role of miRNA in the pathophysiology of DN. [score:1]
In conclusion, cross talk between miR-214 and PTEN attenuated glomerular hypertrophy under diabetic conditions in vivo and in vitro. [score:1]
Second, we examined the role of miR-214 in the pathogenesis of MC hypertrophy in vitro. [score:1]
miR-214 mimics were co -transfected with either WT or mutant-PTEN-psi-CHECK-2 Vector into HEK 293 cells, respectively. [score:1]
To further support our findings, in vivo experiments were performed to investigate the role of PTEN as a downstream target of miR-214 in diabetic MC hypertrophy. [score:1]
We constructed a wild type (WT) or mutated (MU) PTEN-psi-CHECK-2 vector (the mutated complementary sequences of 3′ UTR of PTEN for the seed sequence of miR-214) (Fig. 3E). [score:1]
How to cite this article: Wang, X. et al. Cross talk between miR-214 and PTEN attenuates glomerular hypertrophy under diabetic conditions. [score:1]
Thus, the effects of miR-214 inhibition on the morphology of human MCs and podocyte injury in diabetes need to be further investigated in future studies. [score:1]
The 3′ UTR of human PTEN (Gene ID: 5728) containing complementary sequences for the seed sequence of miR-214 was amplified by PCR and cloned into the psi-CHECK-2 Vector (Promega, WI) (a wild type of psi-CHECK-2-PTEN-3′UTR, WT). [score:1]
These findings suggest that miR-214 may represent a novel therapeutic approach for DN. [score:1]
miR-214+PTEN. [score:1]
Our study demonstrated that cross talk between miR-214 and PTEN attenuated glomerular hypertrophy under diabetic conditions in vivo and in vitro. [score:1]
[1 to 20 of 74 sentences]
10
[+] score: 251
Moreover, data from the co-transfection experiments showed that while QKI knockdown or miR-214 inhibition alone in the differentiating ESCs significantly up-regulated or down-regulated various VSMCs specific gene expression, respectively, inhibition of QKI almost abolished the inhibitory effects of miR-214 inhibition on VSMCs specific gene expression (Figure 4G), suggesting that miR-214 regulates VSMCs gene expression through modulation of QKI. [score:23]
org), and two highly conserved binding sites for miR-214 have been identified within the 3′UTR of QKI-6/7, but not QKI-5. Notably, both miR-214 binding sites are localized within the shared 3′UTR region of QKI-6 and QKI-7. Indeed, QKI gene and protein expression levels were significantly down-regulated or up-regulated by over -expression or inhibition of miR-214 in the differentiating ESCs (Figure 3A, 3B, 3C and 3D), respectively, demonstrating a negative regulatory role of miR-214 in QKI gene expression. [score:16]
As a result, miR-214 overexpression dramatically increased the expression of VSMCs markers such as SMA and SM22 at both mRNA (Figure 1D (quantification)) and protein levels (Figure 1E, 1F), whereas, miR-214 inhibition significantly downregulated the expression of VSMCs markers (Figure 1D-1F). [score:12]
Data from our miRNA reporter assay showed that the activity of luciferase from construct harbouring the QKI 3′UTR was significantly down-regulated or -up-regulated by miR-214 over -expression or inhibition, respectively (Figure 3E) while the luciferase activity of reporters with QKI 3′UTR mutation was little change (Figure 3F). [score:11]
Meanwhile, we have identified QKI as the mRNA target of miR-214, further demonstrated that miR-214 inhibited its target gene QKI, during ESC-SMC differentiation. [score:7]
Taken together, we have successful uncovered a novel regulatory role of miR-214 in VSMCs differentiation from ESCs in vitro and in vivo, and provided sufficient evidence to support our hypothesis that miR-214 regulates ESC-SMC differentiation though suppressing its target gene QKI. [score:7]
ESCs were induced to differentiate towards VSMCs for 4 days, and the differentiating ESCs were transfected with either miRNA mimics negative control (mimic control in short), miR-214 mimics, or miRNA inhibitor negative control (inhibitor control in short) or miR-214 inhibitor, respectively. [score:7]
in vitroThe expression level of miR-214 was upregulated during VSMCs differentiation from ESCs (Figure 1A). [score:6]
The expression level of miR-214 was upregulated during VSMCs differentiation from ESCs (Figure 1A). [score:6]
A-D. Modulations of miR-214 expression levels negatively regulate QKI gene expression. [score:6]
miR-214 was found to regulate the polycomb protein Ezh2 in skeletal muscle and embryonic stem cell [26], and suppress stem-like traits in human hepatocellular carcinoma though targeting beta-catenin pathway [27]. [score:6]
Figure 3 A-D. Modulations of miR-214 expression levels negatively regulate QKI gene expression. [score:6]
Figure 6 miR-214 was found to regulate the polycomb protein Ezh2 in skeletal muscle and embryonic stem cell [26], and suppress stem-like traits in human hepatocellular carcinoma though targeting beta-catenin pathway [27]. [score:6]
Importantly, it has been recently reported that miR-214 was specifically expressed during neuroblastoma differentiation, cortical development and embryonic stem cells differentiation [24, 28], and that miR-214 suppressed osteogenic differentiation [29]. [score:6]
Altogether, above data has firmly confirmed that QKI is a direct target of miR-214, which was inhibited by miR-214 during VSMCs differentiation. [score:6]
QKI was emerged as one of the top targets of miR-214 in several computational algorithmic databases, such as Targetscan (www. [score:5]
Target gene, QKI, is suppressed by miR-214 during VSMCs differentiation. [score:5]
As expected, miR-214 mimics and miR-214 inhibitor transfection resulted in a significant increase and decrease of miR-214 expression in the differentiating ESCs (Figure 1B, 1C). [score:5]
during VSMCs differentiationIt has been suggested that miR-214 may inhibit angiogenesis by targeting QKI and reduce angiogenic growth factor release [30]. [score:5]
It has been suggested that miR-214 may inhibit angiogenesis by targeting QKI and reduce angiogenic growth factor release [30]. [score:5]
Target gene, QKI, is suppressed by miR-214. [score:5]
Schematic representation of the mechanism by which miR-214 regulates ESCs differentiation towards VSMCs by targeting QKI. [score:4]
Such notion has been supported by following observations: the expression of QKI gene and protein levels were negatively regulated by miR-214 in the differentiating ESCs, and the QKI 3′UTR reporter activity was reversely modulated by miR-214. [score:4]
Figure 1 A. Up-regulated miR-214 during VSMCs differentiation from ESCs. [score:4]
Target gene, QKI, is negatively regulated by miR-214. [score:4]
A. Up-regulated miR-214 during VSMCs differentiation from ESCs. [score:4]
More vasculture-like structures were observed in the Matrigel implants of miR-214 mimics -transfected cells C. B and D. More SMA -positive cells were observed in the Matrigel plugs implanted with miR-214 over -expressing ESCs. [score:3]
In our system, we have provided clear and solid evidence to suggest that QKI is a functional target gene of miR-214 during VSMCs differentiation from stem cells. [score:3]
Taken together, our data provided evidence to support that miR-214 promotes VSMCs differentiation by suppressing QKI (Figure 6). [score:3]
Some vascular structures were observed with miR-214 overexpression, while there were no defined vascular structures in control group (Figure 2A and the quantification in Figures 2C). [score:3]
Day 2~3 differentiating ESCs were co -transfected with miR-214 inhibitor, QKI siRNA or respective negative control as indicated in the figure, and cultured for further 48-72 hours. [score:3]
Day 2~3 differentiating ESCs were transfected with miR-214 mimic or inhibitor, or respective negative controls, and cultured in VSMCs differentiation medium for 48 to 72 hours. [score:3]
B-F. SMC-specific gene expression was modulated by miR-214. [score:3]
Briefly, control or miR-214 over -expression ESCs (10 [6] in 50μl aMEM) were labeled as green fluorescence PKH67 (sigma), mixed with 50μl of Matrigel (Becton Dickinson Labware) and PDGF-BB (100ng/ml) at 4°C, and subcutaneously injected into C57BL/6J mice. [score:3]
In the present study, we have advanced our knowledge of the molecular mechanism mediating VSMCs differentiation by confirming an important role of miR-214 in promoting VSMCs specific gene expression and VSMCs differentiation from murine ESCs in vitro and in vivo. [score:3]
Briefly, 0.33 μg/well of the reporter plasmids were co -transfected with the miR-214 mimics, miR-214 inhibitor or respective controls (2 μl/well) using jetPRIME® (Polyplus-transfection SA) according to the protocol provided. [score:3]
To elucidate the potential function of miR-214 during ESC-SMC differentiation, the chemically synthesized miR-214 inhibitor or miR-214 mimic was used in the miR-214 loss-of-function and gain-of-function experiments, respectively. [score:3]
QKI repression is required for miR-214 induced VSMCs gene expressions. [score:3]
We have demonstrated that QKI is the mRNA target of miR-214 during VSMCs differentiation. [score:3]
miR-214 mediated VSMCs gene expression through modulating QKI. [score:3]
Mouse ESCs were seeded on Collagen IV coated dishes and cultured in differentiated media, the expression of miR-214 during VSMCs differentiation was assessed through RT-qPCR analyses. [score:3]
By using our well-established VSMCs differentiation system and miR array technique, miR-214 was emerged as a potential miR candidate to regulate VSMCs differentiation. [score:2]
Meanwhile, our data also revealed that QKI was regulated by miR-214 in VSMCs differentiation. [score:2]
Immunofluorescence staining with antibody of SMA showed that compared with control, more SMA -positive cells were presented in the Matrigel implants mixed with miR-214 overexpressing ESCs (Figure 2B and 2D). [score:2]
All the aforementioned studies indicated that miR-214 was one of major regulators during stem cells differentiation. [score:2]
By utilizing gain/lose-of function analyses, we confirm miR-214 promotes VSMCs differentiation from murine ESCs in vitro. [score:1]
To further investigate the underlying mechanisms of miR-214 -mediated VSMCs differentiation, the potential mRNA targets of miR-214 were scrutinized. [score:1]
Far left, the Matrigel plug when harvested at 13 days post-implantation; H&E images of the Matrigel plugs with cells transfected with control mimics (middle) or miR-214 mimics (far right), respectively. [score:1]
miR-214 and SMC differentiation. [score:1]
Furthermore, we also provide clear evidence to support that miR-214 enhances embryonic VSMCs differentiation in vivo by using another well-established in vivo Martigel implantation mo del. [score:1]
E-F. ESCs were forced to differentiate towards VSMCs for 4 days, and co-transfections of miR-214 mimic with the luciferase plasmid of the QKI-UTR-wt or QKI-UTR-mt were performed. [score:1]
miR-214 promotes VSMCs differentiation in vivo. [score:1]
To further explore the functional importance of miR-214 in VSMCs differentiation in vivo, ESCs labelled with PKH67 were transfected with mimic controls or miR-214 mimic and subcutaneously injected into C57BL/6J mice as described in our previous study [12, 25]. [score:1]
However, up to now, the mechanism roles of miR-214 in ESC-SMC differentiation are still not well understood. [score:1]
After then the miR-214 mimic or mimic control were introduced to the cells by transfection. [score:1]
In the present study, we demonstrated for the first time that miR-214 plays an important role in murine ESCs differentiation towards VSMCs in vitro and in vivo. [score:1]
These data suggest an important role of miR-214 in VSMCs differentiation from ESCs. [score:1]
miR-214 is involved in VSMCs differentiation in vivoTo further explore the functional importance of miR-214 in VSMCs differentiation in vivo, ESCs labelled with PKH67 were transfected with mimic controls or miR-214 mimic and subcutaneously injected into C57BL/6J mice as described in our previous study [12, 25]. [score:1]
miR-214 is involved in VSMCs differentiation in vivo. [score:1]
Taken together, these data clearly suggested a central role of miR-214 in VSMCs differentiation from stem cells in vivo. [score:1]
Important role of miR-214 in VSMCs differentiation from ESCs. [score:1]
These observations clearly imply that miR-214 played an important role in ESC-SMC differentiation. [score:1]
[1 to 20 of 62 sentences]
11
[+] score: 246
Other miRNAs from this paper: mmu-mir-208b
Our data have also revealed that miR-214-3p inhibits hypertrophic phenotype in cardiomyocytes through down-regulation of MEF2C expression. [score:8]
Similarly, miR-214 was upregulated in H [2]O [2] -treated cardiac myocytes, and overexpression of miR-214 alleviated H [2]O [2] -induced cardiac cell apoptosis through suppressing the phosphatase and tensin homolog deleted on chromosome 10 (PTEN) 20. [score:8]
However, inactivation of NF-κB P65 by IKB-α overexpression inhibited Ang-II-promoted miR-214-3p expression. [score:7]
Moreover, in parallel with the findings with MEF2C siRNA, over -expression of miR-214-3p decreased the cell size of mouse cardiomyocytes and the expression of ANP and β-MHC and suppressed Ang-II -induced cardiomyocyte hypertrophy. [score:7]
To further establish the role of miR-214 downregulation in Ang-II -induced cardiac hypertrophic myocardium, we determined if overexpression of miR-214-3p via tail vein injection of miR-214-3p agomir had protective effects on the cardiac hypertrophy. [score:6]
MiR-214-3p expression in Ang-II -induced NMVCs with knockdown of P65 (B), or with pre-treatment with the NF-κB inhibitor JSH23 or QNZ, respectively (C), or with overexpression of IKB-α (D) was assessed by RT-qPCR assay. [score:6]
Knockdown of P65 by P65 siRNA inhibited Ang-II-promoted miR-214-3p expression in NMVCs (Fig. 5B). [score:6]
MiR-214-3p attenuates Ang-II -induced hypertrophic phenotype in vivo and in vitroTo further establish the role of miR-214 downregulation in Ang-II -induced cardiac hypertrophic myocardium, we determined if overexpression of miR-214-3p via tail vein injection of miR-214-3p agomir had protective effects on the cardiac hypertrophy. [score:6]
We used NF-κB P65 siRNA, NF-κB P65 inhibitor JSH23 and QNZ to further verify the role of the NF-κB P65 pathway in Ang-II-promoted upregulation of miR-214-3p in mouse cardiomyocytes. [score:6]
Consistently, activation of NF-κB P65 by IKK-β overexpression enhanced miR-214-3p expression in mouse cardiomyocytes. [score:5]
How to cite this article: Tang, C. -M. et al. Myocyte-specific enhancer factor 2C: a novel target gene of miR-214-3p in suppressing angiotensin II -induced cardiomyocyte hypertrophy. [score:5]
Our current study has provided several lines of evidence to support the notion that miR-214-3p inhibits cardiac hypertrophy through targeting MEF2C. [score:5]
Consistently, our western blot results showed that protein expression of ANP, β-MHC and MEF2C could be inhibited by miR-214-3p mimic and MEF2C siRNA in Ang-II -induced NMVCs (p < 0.05, p < 0.01, respectively) (Fig. 4B). [score:5]
Additionally, miR-214-3p mimic inhibited MEF2C expression at both mRNA and protein levels in mouse cardiomyocytes. [score:5]
Moreover, enforced expression of IKB-α, which inactivates the NF-κB P65 pathway, attenuated Ang-II-stimulated miR-214-3p expression in NMVCs (Fig. 5D). [score:5]
Consistently, miR-214-3p also significantly inhibited ANP and β-MHC expression in Ang-II -treated mouse cardiomyocytes. [score:5]
However, enforced expression of IKK-β, which activates the NF-κB P65 pathway, enhanced miR-214-3p expression (Fig. 5E). [score:5]
Additionally, miR-214-3p expression in NMVCs with overexpression of IKK-β was also detected (E). [score:5]
Meanwhile, our western blot results demonstrated that ANP and β-MHC protein expression in mouse myocardium in response to Ang-II infusion was also suppressed by miR-214-3p injection (Fig. 2D). [score:5]
N = 3. (E) MEF2C mRNA and protein expression in the myocardium of Ang-II-infusion mouse mo del of cardiac hypertrophy with overexpression of miR-214-3p. [score:5]
The enhancer of zeste homolog 2 (EZH2) was reported to be a direct target of miR-214 during cardiac hypertrophy in vitro and in vivo 7 21. [score:4]
Collectively, our results suggest that up-regulation of miR-214-3p in Ang-II -induced hypertrophic cardiomyocytes results from activation of the NF-κB pathway. [score:4]
In the present study, we observed that miR-214-3p was significantly down-regulated in the hypertrophic myocardium of a mouse Ang-II infusion mo del and a mouse TAC mo del. [score:4]
Taken together, our results have demonstrated that miR-214-3p is down-regulated in cardiac hypertrophy, and miR-214-3p ameliorates cardiac hypertrophic responses in vivo and in vitro. [score:4]
Up-regulation of microRNA-214-3p (miR-214-3p) in NMVCs through the NF-κB pathway. [score:4]
Importantly, the upregulation of MEF2C mRNA and protein was reversed by miR-214-3p agomir injection in the myocardium in the mouse Ang-II infusion mo del. [score:4]
Thereafter, we delivered miR-214-3p agomir via tail vein to increase miR-214-3p level in mouse myocardium to further confirm the role of miR-214-3p downregulation in Ang-II -induced cardiac hypertrophy. [score:4]
We have also shown that miR-214-3p was upregulated in Ang-II -induced hypertrophic mouse cardiomyocytes. [score:4]
We also conclude that activation of the NF-κB signaling pathway contributes to the upregulation of miR-214-3p in Ang-II -induced mouse cardiomyocytes. [score:4]
It was previously reported that miR-214 was upregulated during the ischemic injury (IR), and genetic deletion of miR-214 in mice caused loss of cardiac contractility and increased apoptosis in response to IR injury. [score:4]
Overexpression of microRNA-214-3p (miR-214-3p) attenuates Ang-II -induced cardiac hypertrophy in vivo and in vitro. [score:3]
To date, the role and potential target gene of miR-214 in cardiac hypertrophy have not been well-illustrated. [score:3]
Consistently, our results showed that the expression of miR-214-3p was decreased in the above mouse and human hypertrophic myocardium (Fig. 1A–C). [score:3]
The relative ratio of the FL/RL was used to indicate the suppression of MEF2C by miR-214-3p. [score:3]
MicroRNA-214-3p (miR-214-3p) negatively modulates MEF2C expression. [score:3]
MicroRNA-214-3p (miR-214-3p) inhibits hypertrophic phenotype of NMVCs in vitro. [score:3]
Consistently, miR-214-3p also markedly attenuated Ang-II -induced ANP and β-MHC protein expressions in NMVCs (Fig. 2E). [score:3]
Therefore, the present study suggests that miR-214-3p might be a potential target for prevention and treatment of cardiac hypertrophy. [score:3]
Interestingly, it was reported that miR-214 expression was negatively modulated by the NF-κB P65 pathway in hepatocellular carcinoma (HCC) cells 18. [score:3]
The WGA staining results showed that cell size of cardiomyocyte in the myocardium was markedly increased in Ang-II infusion mice, which was reversed by enforced expression of miR-214-3p (Fig. 2C). [score:3]
org) showed that MEF2C was a potential target gene of miR-214-3p. [score:3]
MicroRNA-214-3p (miR-214-3p) expression in the hypertrophic myocardium and cardiomyocytes. [score:3]
It was previously reported that NF-κB activation suppresses miR-214 transcription in hepatocellular carcinoma cells 18. [score:3]
Moreover, MEF2C mRNA and protein expression in the myocardium of Ang-II infusion mice could also be reversed by enforced increase of miR-214-3p (Fig. 3E). [score:3]
Verification of MEF2C as a target gene of miR-214-3p. [score:3]
Our data demonstrated that treatment with either JSH23 or QNZ prevented Ang-II -induced miR-214-3p expression (Fig. 5C). [score:3]
MiR-214-3pis up-regulated by Ang-II through the NF-κB pathway. [score:3]
Decreased expression of miR-214-3p in the hypertrophic myocardium and cardiomyocyte. [score:3]
Next, we examined the expression of MEF2C in NMVCs transfected with miR-214-3p mimic or MEF2C siRNA. [score:3]
The matching position for miR-214-3p within 3′-UTR of the targeted mRNAs is shown in Fig. 3A. [score:3]
N = 5-8. MEF2C mRNA and protein expression in Ang-II -induced mouse cardiomyocytes (C) and mouse cardiomyocytes transfected with miR-214-3p mimic or MEF2C siRNA (D). [score:3]
First, the in silico prediction indicated that MEF2C was a potential target of miR-214-3p, and the dual luciferase assay revealed that miR-214-3p specifically bound to the 4372-4378 site in the 3′-UTR of MEF2C. [score:2]
Using a site-directed mutagenesis kit (TransGen, Beijing, China), the miR-214-3p binding site sequence GTCGTCC was replaced with GAGCACC to construct a recombinant luciferase reporter plasmid containing the mutant potential miR-214 binding sequence. [score:2]
Mechanistically, the cardioprotective role of miR-214 during IR injury was attributed to its repression on sodium/calcium exchanger 1 (Ncx1) and regulation of cardiomyocyte Ca [2] [+] homeostasis 19. [score:2]
Nevertheless, the mechanism underlying the down-regulation of miR-214-3p in human and mouse hypertrophic myocardium warrants further investigation. [score:2]
Expression of miR-214-3p in mouse myocardium and cardiomyocytes by RT-qPCR assay. [score:2]
Compared with the negative scramble control, MEF2C mRNA and protein expression was significantly reduced in miR-214-3p mimic -modified NMVCs and also in NMVCs transfected with MEF2C siRNA (p < 0.05, p < 0.01, respectively) (Fig. 3D). [score:2]
To normalize RNA content, U6 was used for miR-214-3p template normalization and GAPDH was used for coding genes template normalization. [score:1]
Human embryonic kidney (HEK) 293 cells (3 × 10 [5] cells per well in the 12-well plate) were cotransfected with 200 ng of recombinant luciferase reporter plasmid, 50 nM miR-214-3p mimic, and 20 ng of pRL-TK plasmid as an internal control (Promega, Madison, WI). [score:1]
was performed to reveal cardiac structure and function changes in Ang-II infusion mice with or without miR-214-3p agomir injection (Fig. 2A). [score:1]
The 2 [−ΔΔCt] method was used to calculate relative expression levels of miR-214-3p and coding genes 16. [score:1]
The thickened LV walls (LVPWd, LVPWs) and decreases in the LV internal diameters (LVIDd, LVIDs) were observed in Ang-II infusion mice, but miR-214-3p agomir injection efficiently reversed the increase of LVPW and the decrease of LVID in Ang-II infusion mice (Fig. 2B, Supplimentary Fig. 1). [score:1]
Reverse-transcription quantitative PCR (RT-qPCR) for miR-214-3p was performed on cDNA generated from 0.5 μg total RNA according to the manufacturer’s protocol (Ribobio, China). [score:1]
In addition, the compensatory increases of ejection fraction (EF) and fractional shortening (FS) were markedly relieved by miR-214-3p agomir delivery in Ang-II infusion mice (Fig. 2B). [score:1]
The seed sequence of miR-214-3p is UGGAAUG, and the complementary nucleotide sequences are shown in red words. [score:1]
results demonstrated that cell size changes of Ang-II -treated NMVCs were markedly reversed by miR-214-3p mimic and MEF2C siRNA, respectively (p < 0.05) (Fig. 4A). [score:1]
Predicted miR-214-3p seed matches to the sequence in the 3′-UTR of MEF2C gene mRNA. [score:1]
Additionally, attenuation of miR-214-3p was also observed in the myocardium of patients with hypertrophy. [score:1]
As expected, the level of miR-214-3p was significantly increased in the myocardium of mice received injection of miR-214-3p agomir (Supplimentary Fig. 1). [score:1]
The amount of 20 nmol NC agomir or miR-214-3p agomir was delivered into each mouse via tail vein injection at 4 interval time points within 14 d. Left ventricular (LV) function variables were assessed by transthoracic echocardiography 2 weeks after the mini-osmotic pump implant surgery. [score:1]
MiR-214-3p mimic and MEF2C siRNA were transfected into NMVCs, followed by assay and examining the expressions of hypertrophy-related genes. [score:1]
Therefore, our data have demonstrated a protective role of miR-214-3p in cardiac hypertrophy, instead of a pro-hypertrophy effect. [score:1]
According to our previous report 17, the recombinant luciferase reporter plasmid containing the potential miR-214-3p binding site sequence of MEF2C gene was constructed. [score:1]
[1 to 20 of 73 sentences]
12
[+] score: 240
Increased expression of miR-214 by transfection of LmiR-214 suppresses PTEN expression, increases the levels of phosphorylated Akt, represses Bim1 expression and induces Bad phosphorylation in the myocardium. [score:9]
Indeed, our data show that increased expression of miR-214 by transfection of LmiR-214 into H9C2 cells suppresses PTEN expression and increases the levels of Akt phosphorylation in the presence and absence of H/R challenge. [score:7]
However, transfection of LmiR-214 further decreases the cytosolic levels of Bim1 in both sham and I/R groups, indicating increased expression of miR-214 may suppress the expression and translocation of Bim1 from cytosol to mitochondria. [score:7]
We demonstrated in the present study that increased in vivo expression of miR-214 by LmiR-214 transfection suppresses the expression of Bim1 in the myocardium following I/R injury and that in vitro enhanced miR-214 levels prevent the translocation of Bim1 from the cytosol to the mitochondria. [score:7]
To determine whether NF-κB signaling involves Pam3CSK4 induced miR-214 expression, we treated cells with NF-κB specific inhibitor, JSH-23 and observed that JSH-23 treatment significantly prevented Pam3CSK4 induced increases in the expression of miR-214 (Figure 1B). [score:7]
Increased expression of miR-214 suppresses Bim expression and increases Bad phosphorylation in the myocardium following myocardial I/R. [score:7]
Increased expression of miR-214 suppresses the expression and mitochondrial translocation of Bim1 and increases the levels of phosphorylated Bad in cardiomyoblasts H9C2 cells. [score:7]
We transfected mouse hearts with lentivirus expressing miR-214 (LmiR-214) or lentivirus expressing miR-control (LmiR-control) via the right common carotid artery as described previously [1, 2]. [score:5]
Our findings indicate that targeting PTEN expression by mir-214, resulting in activation of Akt could be responsible for Bad phosphorylation. [score:5]
The data suggests that miR-214 targets PTEN expression, resulting in activation of PI3K/Akt signaling. [score:5]
In addition, in vitro data shows transfection of miR-214 mimics to H9C2 cells suppresses the expression and translocation of Bim1 from cytosol to mitochondria and induces Bad phosphorylation. [score:5]
H9C2 cardiomyoblasts were transfected with lentivirus expressing miR-214 (LmiR-214) or lentivirus expressing scrambled miR-control (LmiR-control) respectively, to establish cell lines of LmiR-214 and LmiR-control. [score:5]
Collectively, targeting Bim1 expression and preventing its translocation from cytosol to mitochondria could be an important protective mechanism of miR-214 in myocardial I/R injury. [score:5]
Specifically, we observed that miR-214 suppresses PTEN expression, leading to activation of PI3K/Akt signaling. [score:5]
However, PI3K inhibition with LY294002 (LY) significantly prevented Pam3CSK4 induced Akt phosphorylation but did not alter Pam3CSK4 induced increases in miR-214 expression. [score:5]
To examine whether increased expression of miR-214 will activate PI3K/Akt signaling, we transfected H9C2 cells with lentivirus expressing miR-214 (LmiR-214) or LmiR-control respectively, before the cells were subjected to hypoxia (4 h) followed by reoxygenation (H/R). [score:5]
We found that miR-214 significantly suppresses PTEN expression, leading to Akt phosphorylation in the myocardium. [score:5]
In addition, miR-214 suppresses the expression and translocation of Bim1 from the cytosol to the mitochondria. [score:5]
Aurora et al reported that the expression of Bim1 in the myocardium was significantly increased in miR-214 deficient mice 7 days after myocardial I/R injury, indicating that miR-214 may target Bim [10]. [score:5]
In contrast, miR-214 markedly suppresses the expression of Bim1 in the cytosol and decreases the levels of Bim1 in the mitochondria following H/R challenge. [score:5]
We also found that increased expression of miR-214 represses the expression of Bim1 and prevents its translocation from the cytosol to mitochondria. [score:5]
In the present study, we demonstrated that increased expression of miR-214 by transfection of the myocardium with lentivirus expressing miR-214 (LmiR-214) protects hearts from I/R injury. [score:5]
D-G. H9C2 cells were transfected with lentivirus expressing miR-214 (LmiR-214) or lentivirus expressing miR-control (LmiR-control) respectively. [score:5]
Increased miR-214 levels suppressed PTEN expression and increased Akt phosphorylation in H9C2 cardiomyoblasts. [score:5]
PTEN, a negative regulator of PI3K/Akt signaling is a potential target of miR-214. [score:4]
MiR-214 was constructed into a lentivirus expressing vector using a lentivirus expressing system (Invitrogen Corporation) as described previously [1, 2]. [score:4]
Construction of lentivirus expressing miR-214. [score:3]
The H9C2 cardiomyoblasts stably expressing miR-214 or miR-con were generated by transfection of LmiR-214 or LmiR-con and selection with Blasticidin (Invitrogen). [score:3]
To understand the mechanisms by which miR-214 protects against myocardial I/R injury, Aurora et al [10] observed that miR-214 targets sodium-calcium exchanger-1, thereby influencing calcium trafficking in cardiac myocytes after myocardial I/R injury [10]. [score:3]
These authors demonstrated that miR-214 targets sodium-calcium exchanger-1, thus influencing cardiac myocyte calcium trafficking following myocardial I/R injury [10]. [score:3]
B-C. NF-κB activation is required for Pam3CSK4 induced miR-214 expression. [score:3]
Our in vitro and in vivo data show that increased miR-214 expression significantly enhances Bad phosphorylation, thereby blocking Bad's pro-apoptotic effect. [score:3]
In vitro experimentsThe H9C2 cardiomyoblasts stably expressing miR-214 or miR-con were generated by transfection of LmiR-214 or LmiR-con and selection with Blasticidin (Invitrogen). [score:3]
Increased expression of miR-214 attenuates H/R induced cell injury and increases survival in H9C2 cardiomyoblasts. [score:3]
Seven days after transfection, the hearts were harvested and transfection efficiency was evaluated by examining the green fluorescent protein (GFP) expression and the expression of miR-214 in the heart tissues. [score:3]
Transient expression of miR-214 in H9C2 cells was accomplished by transfection of miR-214 mimics (40 nM) or miR-control mimics (40 nM). [score:3]
We also examined whether increased expression of miR-214 will protect against myocardial I/R -induced injury. [score:3]
Increased expression of miR-214 attenuates I/R induced myocardial apoptosis. [score:3]
Since Pam3CSK4 induced activation of PI3K/Akt signaling [20], we examined whether increased miR-214 expression would activate PI3K/Akt signaling. [score:3]
In addition, miR-214 represses the expression of pro-apoptotic protein Bim1 [10] and its translocation from cytosol to the mitochondria, thus preventing I/R induced apoptosis. [score:3]
Collectively, these data suggest the TLR2 ligand induced increases in the expression of miR-214 are mediated through NF-κB activation pathway. [score:3]
Transfection of lentivirus expressing miR-214 into the myocardium improves cardiac function and decreases infarct size following myocardial I/R injury. [score:3]
Interestingly, we observed that miR-214 expression in the myocardium was significantly increased by a TLR2 ligand, Pam3CSK4, in the presence and absence of I/R. [score:3]
We observed that increased expression of miR-214 significantly attenuates I/R -induced myocardial apoptosis. [score:3]
Figure 1 A. TLR4 deficiency or TLR2 ligand, Pam3CSK4 treatment increases the expression of miR-214 in the myocardium. [score:3]
Future studies should search for which natural conditions will induce miR-214 expression. [score:3]
Our in vitro data shows that increased expression of miR-214 markedly activates PI3K/Akt signaling and protects H9C2 cells from H/R -induced injury. [score:3]
Increased expression of miR-214 attenuates I/R -induced myocardial apoptosis. [score:3]
Collectively, the in vitro data suggests that miR-214 has a protective effect on H/R -induced cell injury via suppression of PTEN, leading to activation of PI3K/Akt signaling. [score:3]
In the present study, we demonstrated that increased expression of miR-214 in the myocardium significantly attenuates I/R -induced cardiac dysfunction and myocardial infarct size. [score:3]
In addition, cell viability was markedly improved by increased expression of miR-214. [score:3]
However, increased expression of miR-214 prevents I/R -induced myocardial caspase-3/7 and caspase-8 activities (Figures 3B and 3C). [score:3]
To investigate the underlying mechanisms by which TLR2 modulation regulates the miR-214 expression, H9C2 cardiomyoblasts were treated with TLR2 specific ligand Pam3CSK4. [score:2]
MiR-214 could be a target for the induction of protection against myocardial I/R injury. [score:2]
In summary, our data demonstrated that miR-214 plays a protective role in myocardial I/R injury. [score:1]
The cells were harvested for qPCR measurement of miR-214 expression (B) and for Western blot analysis of Akt phosphorylation (C). [score:1]
Our in vitro and in vivo data suggests that miR-214 protects cells from H/R induced damage and attenuates I/R induced myocardial injury. [score:1]
H9C2 cells were transfected with miR-214 mimics. [score:1]
Briefly, the oligonucleotides for miR-214 were synthesized at Integrated DNA Technologies, annealed and ligated into pcDNATM6.2-GW/EmGFP-miR. [score:1]
D. The level of miR-214 was increased following LmiR-214 transfection. [score:1]
Our data indicates that activation of PI3K/Akt signaling by miR-214 may be an important mechanism for protection against I/R injury. [score:1]
Recently, Aurora et al [10] have shown that deficiency of miR-214 resulted in severe myocardial ischemia/reperfusion (I/R) injury and increased fibrosis progression as well as cardiac myocyte apoptosis. [score:1]
As shown in Figure 1B, the levels of miR-214 in Pam3CSK4 treated cells are significantly increased. [score:1]
To examine the effect of miR-214 on Bim1 translocation from cytosol to mitochondria, we transfected H9C2 cells with miR-214 mimics or scrambled miR-control respectively, before the cells were subjected to hypoxia/reoxygenation (H/R). [score:1]
miR-214 has been reported to protect cardiac myocytes from H [2]O [2] -induced injury [9]. [score:1]
Next, we investigated whether increased expression of miR-214 in the myocardium would protect the hearts from I/R -induced injury. [score:1]
Our data is consistent with the report by Aurora et al [10] showing that deficiency of miR-214 resulted in more severe cardiac dysfunction and myocardial I/R injury, indicating that miR-214 is essential for cardioprotection against I/R injury. [score:1]
Figure 5H9C2 cells were transfected with miR-214 mimics. [score:1]
[1 to 20 of 68 sentences]
13
[+] score: 219
These results clearly suggest a close correlation between miR-214-5p expression in the liver, fibrosis development, and fibrosis-related mRNA expression. [score:6]
Conversely, the overexpression of miR-214-5p in LX-2 cells did not alter the expression of MAPK/Erk kinase 3 (MEK3), transcription factor AP-2 gamma (TFAP2C) [29], Plenxin-B1 [30], c-Jun N-terminal kinase 1 (Jnk1) [34], phosphatase and tensin homolog (PTEN) [35], enhancer of zeste homolog 2 (Ezh2) [36], and Quaking mRNA [24], which had been reported to be targets of miR-214 (MEK3: 0.72- to 0.77-fold, Jnk1: 1.05- to 1.20-fold, PTEN: 0.97- to 1.12-fold, Plenxin-B1: 0.99-fold, Ezh2: 0.96-fold, TFAP2C: 0.94-fold, and Quaking: 0.88- to 1.18-fold change compared with cells transfected with control miRNA). [score:6]
These data and the upregulation of Twist-1 in MCDD -induced mouse liver fibrosis (Figure 4) suggest that Twist-1 controls the expression of the miR-214/199a cluster in the liver. [score:6]
The present study showed that miR-214 expression is upregulated in a fibrosis progression -dependent manner in the livers of patients with chronic HCV infection and in mice with diet -induced steatohepatitis (Figures  1 and 2). [score:6]
The results are expressed relative to the expression of miR-214-5p in HepG2. [score:5]
The present study revealed that miR-214-5p overexpression in LX-2 cells significantly increased MMP-2, MMP-9, α-SMA, and TGF-β1 mRNA expression. [score:5]
The results are expressed relative to the expression of miR-214-5p at day 1. * P < 0.05. [score:5]
The results are expressed relative to the expression of miR-214-5p at 5 weeks of the MCCD. [score:5]
Figure 5 Effect of miR-214 overexpression on mRNA expression in LX-2 cells. [score:5]
The overexpression of miR-214-5p in LX-2 cells increased the expression of fibrosis-related genes, such as matrix metalloproteinase (MMP)-2, MMP-9, α-smooth muscle actin, and transforming growth factor (TGF)-β1. [score:5]
The results are expressed relative to miR-214 expression in cells that did not receive TGF-β1 treatment. [score:5]
The results are expressed relative to the expression of miR-214-5p in the livers of rats fed the methionine- and choline-control diet (MCCD) for 10 weeks. [score:5]
The results are expressed relative to the expression of miR-214-5p in hepatocytes. [score:5]
TGF-β induces miR-214 expression in rat tubular epithelial cells and mesangial cells [23], and miR-214 interacts with Quaking to inhibit angiogenesis [24]. [score:5]
The effect of miR-214 overexpression on gene expression in stellate cells. [score:5]
miR-214-5p was upregulated in human and mouse livers in a fibrosis progression–dependent manner. [score:4]
miR-214 expression in stellate cells is regulated by TGF-β and possibly by the transcription factor Twist-1. These results should be pursued further to identify the role of miR-214-5p in liver fibrogenesis and to develop a biomarker that reflects the stage of liver fibrosis more accurately than a pathological staging score. [score:4]
A transcription factor, Twist-1, binds to the E-box region, regulating miR-214 and miR-199a expression [22]. [score:4]
The overexpression of miR-214 significantly increased the expression of matrix metalloproteinase-2 (MMP-2), MMP-9, α-SMA, and TGF-β1 compared to cells transfected with control microRNA (1.7-, 2.8-, 1.7- and 2.0-fold, respectively; P < 0.01) (Figure 5). [score:4]
Here, we report the upregulation of miR-214-5p in a fibrosis progression–dependent manner in HCV-infected human livers and in the livers of a rodent fibrosis mo del. [score:4]
Twist-1 may regulate miR-214-5p expression in the liver, particularly in stellate cells. [score:4]
Figure 6 Regulation of miR-214-5p expression. [score:4]
miR-214-5p was overexpressed in LX-2 cells by transfection with an miR-214 precursor. [score:3]
miR-214 expression in a rat resolution mo del of liver fibrosis. [score:3]
Expression of miR-214-5p in methionine- and choline -deficient diet (MCDD) -induced liver fibrosis and recovery phase in rats. [score:3]
miR-214-5p was localized to non-parenchymal cells and hepatic stellate cells but expressed at negligible levels in hepatocytes (Figure 4D). [score:3]
In contrast, the expression of the miR-214/199a cluster is controlled by the transcription factor Twist-1 [22]. [score:3]
miR-214 expression in a mouse mo del of liver fibrosis. [score:3]
miR-214-5p expression in hepatic stellate cells. [score:3]
Figure 4 miR-214-5p expression in liver cells, including stellate cells. [score:3]
As expected, the induction of miR-214-5p was accompanied by an increase in the expression of α-SMA, Col1a1, PDGFR-β, and FN1 mRNA (Figure 4B). [score:3]
We investigated the effect of miR-214-5p overexpression on fibrosis-related gene expression in stellate cells to clarify the role of this miRNA in stellate cell activation. [score:3]
miR-214-5p expression was significantly higher in the livers of MCDD-fed mice than in control mice (2.1-fold, P < 0.01 at 5 weeks; and 4.8-fold, P < 0.01 at 15 weeks) (Figure 2C). [score:3]
We assessed the stimulatory effect of TGF-β on miR-214-5p expression in LX-2 cells. [score:3]
TGF-β [1] induces miR-214 expression in rat tubular epithelial cells and mesangial cells [23]. [score:3]
Induction of miR-214 expression by TGF-β1. [score:3]
The miR-214-5p expression in Hc, the NPC fraction, and the HSC fraction was analyzed using real-time PCR. [score:3]
Further studies will be needed to clarify the possible involvement of Twist-1 in the expression of miR-214-5p in LX-2 cells. [score:3]
In addition, miR-214-5p expression was markedly higher in LX-2, a wi dely used human hepatic stellate cell line, than in human liver cancer cell lines such as HepG2 and Huh7 (108- and 39-fold, respectively) (Figure 4C). [score:3]
The expression of miR-214-5p and genes that are involved in liver fibrosis were analyzed in hepatitis C virus-infected human livers, rodent fibrotic livers, a human stellate cell line (LX-2), and the cells from intact mouse livers using real-time PCR. [score:3]
Figure 3 miR-214-5p expression in rat livers with fibrosis induced by a methionine- and choline -deficient diet. [score:3]
Therefore, the mRNA targets of miR-214-5p in LX-2 cells are not identical to those in previous reports. [score:3]
In addition, we quantitatively confirmed the miR-214-5p expression levels in 35 HCV patients with individual stages of liver fibrosis (Figure 1A) using real-time PCR. [score:3]
miR-214-5p expression in the livers of 35 hepatitis C virus (HCV)-infected patients was analyzed using real-time PCR. [score:3]
TGF-β [1] (3 and 10 ng/ml) significantly stimulated miR-214-5p expression in LX-2 cells after 24 hours (1.75-fold, P < 0.05)(Figure 6A). [score:3]
miR-214 expression in chronic hepatitis C patients. [score:3]
We found that miR-214-5p expression increased according to the stage of fibrosis (P = 0.000108) (Figure 1B) and was significantly higher in patients with advanced liver fibrosis than in those with mild fibrosis (F1/F2 versus F3/F4: 3.2-fold, P < 0.05; F1 versus F2-4: 3.1-fold, P < 0.05) (Figure 1C,D). [score:3]
We also found that miR-214-5p overexpression had a negligible effect on LX-2 proliferation and migration. [score:3]
Figure 2 miR-214-5p expression in mouse livers with fibrosis induced by an methionine- and choline -deficient diet. [score:3]
miR-214-5p expression was significantly greater in the livers of rats that received MCDD for 10 weeks than in those that received MCCD for 10 weeks. [score:3]
miR-214 expression was quantitated using real-time PCR. [score:3]
Figure 1 miR-214-5p expression in the livers of patients with chronic hepatitis C virus infection. [score:3]
miR-214-5p expression increased during the culture -dependent activation of mouse primary stellate cells and was significantly higher in stellate cells than in hepatocytes. [score:3]
miR-214-5p expression increased during the culture -dependent activation process in mouse stellate cells (2.7-fold increase at day 7 compared to day 1, P < 0.05) (Figure 4A). [score:2]
We report an increase in miR-214-5p in liver fibrosis in humans and mice and the possible association of miR-214-5p with stellate cell activation. [score:1]
miR-214-5p may play crucial roles in the activation of stellate cells and the progression of liver fibrosis. [score:1]
These results indicate the strong participation of miR-214 in the activation of stellate cells. [score:1]
TGF-β stimulation induced miR-214-5p in LX-2 cells. [score:1]
These results suggest that miR-214 induction in fibrotic livers reflects the number and activation status of hepatic stellate cells. [score:1]
miR-214-5p is a product of the 110 bp miR-214 gene in the intron of the Dynamin-3 gene on human Chromosome 1-NC_000001.10, which produces a mature miRNA with a sequence of ugccugucuacacuugcugugc [22]. [score:1]
The role of miR-214-5p in hepatic stellate cell activation is also discussed. [score:1]
The present study clarified the role of miR-214-5p in hepatic fibrogenesis using human clinical tissue samples, livers from rodent mo dels, and cultured hepatic stellate cells. [score:1]
We next isolated individual hepatocytes, non-parenchymal cells, and hepatic stellate cells from intact mouse livers to verify the cellular source of miR-214-5p. [score:1]
miR-214 has previously been predicted to be a key molecule in proliferation in breast [27] and ovarian cancer cells [28], tumor progression in melanoma [29], and growth in HeLa cells [30]. [score:1]
We assessed the contribution of activated hepatic stellate cells to the increase in miR-214-5p in fibrotic mouse livers. [score:1]
These results suggest that the miR-214/199a cluster plays a primary role in stellate cell activation. [score:1]
miR-214-5p precursors and negative control miRNA were transfected into LX-2 cells using Lipofectamine 2000 (Invitrogen) at a final concentration of 50 nM, as described previously [20, 25]. [score:1]
However, the pathophysiological roles of miR-214 remain largely unknown. [score:1]
miR-214 and miR-199a are encoded in a region that contains an E-box DNA promoter sequence [22]. [score:1]
This is the first report to show that miR-214-5p is involved in organ fibrogenesis, specifically in the liver. [score:1]
The effect of miR-214-5p overexpression in LX-2 cells on cell function was investigated. [score:1]
[1 to 20 of 71 sentences]
14
[+] score: 218
Other miRNAs from this paper: hsa-mir-214
To address the function of miR-214 in NPC carcinogenesis, an inhibitor -mediated knockdown approach was employed to suppress the expression of endogenous miR-214, and subsequently determine the effect on cell growth. [score:8]
The results showed that miR-214 was overexpressed in human NPC and knockdown of miR-214 increased apoptosis and suppressed cell growth in vitro as well as in vivo. [score:6]
In addition, knockdown of miR-214 in NPC cells could increase apoptosis and suppress cell growth, proliferation in vitro and suppress tumour growth in vivo. [score:6]
We predicted potential direct targets of miR-214 by at least three of TargetScan6.2, PicTar5, miRWalk, miRDB, DIANAmT and miRanda 3.0 programs. [score:6]
MiR-214 is upregulated in several human tumors, such as ovarian cancer [10], gastric cancer [11], Sézary syndrome [12] and melanoma [13], but downregulation in cervical cancer [14], [15], [16], pancreatic cancer [17], hepatocellular carcinoma [18], [19] and breast cancer [20]. [score:6]
qRT-PCR and Western blot showed that knockdown of miR-214 using LNA-antimiR-214 led to upregulation of endogenous Bim and BAX in both CNE2 and SUNE1 cells, respectively. [score:5]
In addition, miR-214 induces cell survival and cisplatin resistance by binding to 3′-UTR of PTEN leading to inhibition of PTEN translation and activation of Akt pathway [21]. [score:5]
However, miR-214 expression was reduced in cervical cancer [14], [15], [16], pancreatic cancer [17], hepatocellular carcinoma [18], [19] and breast cancer [20], suggesting a tumor suppressor gene-like function. [score:5]
TargetScan6.2, PicTar5, miRWalk, miRDB, DIANAmT and miRanda 3.0 programs were used to predict putative targets of miR-214 respectively. [score:5]
We further tested whether miR-214 could directly repress the identified mRNA targets through 3′ UTR interactions (Figure 5A). [score:4]
Knockdown of miR-214 suppresses tumorigenesis in vivo To address the potential effects of miR-214 on the growth of nasopharyngeal carcinoma cells in vivo, CNE2 cells transfected with LNA-antimiR-214 or LAN-control were subcutaneously injected into nude mice. [score:4]
was performed to identify Bim as a direct target of miR-214 in NPC cells. [score:4]
In brief, these results indicated that Bim was a direct target of miR-214. [score:4]
The results showed that knockdown of miR-214 led to remarkable inhibition of cell growth and proliferation in both CNE2 and SUNE1 cells. [score:4]
Bim is a direct target of miR-214 in NPC cell lines. [score:4]
With respect to the relationship of miR-214 and Bim, further studies on knockdown of Bim in vivo and in vitro might give us more information for better understanding the roles of Bim expression affected by miR-214 on proliferation and apoptosis in nasopharyngeal carcinoma. [score:4]
Knockdown of miR-214 results in cell growth suppression. [score:4]
0086149.g004 Figure 4Knockdown of miR-214 inhibits tumor growth in nude mice: in vivo functional studies. [score:4]
Furthermore, we identified Bim (Bcl-2-interacting mediator of cell death) as a direct target of miR-214. [score:4]
Knockdown of miR-214 could suppress cell proliferation in vitro and in vivo, and induced apoptosis in vivo. [score:4]
Knockdown of miR-214 suppresses tumorigenesis in vivo. [score:4]
Knockdown of miR-214 inhibits tumor growth in nude mice: in vivo functional studies. [score:4]
Moreover, some other genes implicated in cell proliferation, invasion and apoptosis, were direct targets of miR-214, including Ezh2 [20], HDGF [19], Lactoferrin [24], and so on. [score:4]
Overexpression of miR-214 resulted in a significant decrease in luciferase expression in pMIR-report-Bim 3′UTR -transfected cells, but not in pMIR-report-mut-Bim 3′UTR -transfected cells, compared with the miR-control. [score:4]
In our study, we found that knockdown of miR-214 could increase endogenous Bim protein expression in NPC cells (CNE2 and SUNE1). [score:4]
QRT-PCR was performed to confirm miR-214 expression of CNE2 and SUNE1 cells transfected with LNA-antimiR-214 (50 nM) after 48 hours transfection. [score:3]
MiR-214 has also been identified to be involvement of cervical cancer development by targeting MEK3, JNK1 [14], GALNT7 [15] and Plexin-B1 [16]. [score:3]
Previous study reported that miR-214 induces cell survival and cisplatin resistance of ovarian cancer primarily through targeting the PTEN [21]. [score:3]
MiR-214 expression in xenograft tumors of LNA-control group was higher than that of the LNA-antimiR-214 group (P = 0.017; Figure 4D, 4F). [score:3]
These findings suggested that miR-214 was overexpressed in NPC cell lines and tissues. [score:3]
It was concluded that miR-214 acted as different biological function through different target gene in NPC. [score:3]
0086149.g002 Figure 2(A) Forty-eight hours post-transfection, miR-214 expression levels (normalized to U6 RNA) were significantly decreased by 82% (P<0.01) in CNE2/LNA-antimiR-214 and 87.7% (P<0.01) in SUNE1/LNA-antimiR-214 cells, relative to the LNA-control. [score:3]
At present, several targeted genes of miR-214 have been identified in various tumor types. [score:3]
Silencing of miR-214 suppresses cell proliferation in NPC cells. [score:3]
Our findings suggest that miR-214 could play an important role in NPC carcinogenesis, and might be a better way of being prognostic or potentially therapeutic target for NPC patients. [score:3]
Bim is the target gene of miR-214. [score:3]
We performed fluorescence in situ hybridization (FISH) on 5 NPC patients and 5 healthy controls (HCs) to examine the expression of miR-214. [score:3]
Li and his colleagues' study, lactotransferrin was identified as a target gene of miR-214 [23]. [score:3]
The expression of mature miR-214 was determined by SYBR Green quantitative real time PCR amplification on an ABI 7500HT instrument (Applied Biosystems). [score:3]
MiR-214 is upregulated in several human tumors, such as ovarian cancer, gastric cancer, Sezary syndrome, and melanoma [10], [11], [12], [13]. [score:3]
The prediction of potential targets of miR-214. [score:3]
Furthermore, elevated expression of miR-214 was associated with chemotherapy resistance [21] or tumor metastasis [13]. [score:3]
These results suggest that miR-214 inhibition can induce apoptosis in CNE2 and SUNE1 cells. [score:3]
In conclusion, we report that miR-214 expression was increased in NPC tissues and NPC cells. [score:3]
The miR-214 showed higher expression in NPC patients relative to HCs (Figure 1B, P = 0.001, n = 5). [score:3]
Expression of miR-214 in NPC tissues and NPC cell lines. [score:3]
In this study, miR-214 was identified to be significantly higher expression in NPC compared to control. [score:2]
Relative qRT-PCR analysis shows that CNE2, SUNE1, and HONE1 cells express higher levels of miR-214 compared with NPEC2 Bmi-1 cells. [score:2]
MiR-214 could contribute to melanoma tumour progression through suppression of TFAP2C. [score:2]
Knockdown of miR-214 induces apoptosis in vitro. [score:2]
MiR-214 is overexpressed in NPC tissues and cell lines. [score:2]
The colony formation assay (A) and MTT assay (B) showed that knockdown of miR-214 in CNE2 and SUNE1 cells resulted in inhibition of cell growth in vitro. [score:2]
Cell culture and knockdown of miR-214. [score:2]
0086149.g001 Figure 1(A) Representative picture of fluorescence density for miR-214 expression in 5 NPC patients compared to adjacent normal tissues (400× magnification). [score:2]
Obviously, the overexpression of miR-214 was observed in NPC tissues compared to normal adjacent tissue (NATs). [score:2]
MiR-214 positive signals detected by FISH are in green, which is upregulated in NPC tumor cells compared to the adjacent epithelial cells. [score:2]
Knockdown of miR-214 induces apoptosis in vitro CNE2 and SUNE1 cells were transfected with LNA-antimiR-214 or LNA-control. [score:2]
Fluorescence in situ hybridization (FISH) of miR-214 was performed on 5 µm tissue sections of NPC following the manufacturer's instructions. [score:1]
Also, quantitative RT-PCR (qRT-PCR) was utilized to test the miR-214 level in NPC patients and HCs. [score:1]
J Hepatol 20 Derfoul A, Juan AH, Difilippantonio MJ, Palanisamy N, Ried T, et al (2011) Decreased microRNA-214 levels in breast cancer cells coincides with increased cell proliferation, invasion and accumulation of the Polycomb Ezh2 methyltransferase. [score:1]
Validation of tumor growth-promoting activity of miR-214 in an animal mo del. [score:1]
Two genes (Bim and BAX) were predicted to have at least one potential binding site at their 3′-UTRs for miR-214 (Figure 5A). [score:1]
To address the potential effects of miR-214 on the growth of nasopharyngeal carcinoma cells in vivo, CNE2 cells transfected with LNA-antimiR-214 or LAN-control were subcutaneously injected into nude mice. [score:1]
These findings suggested that miR-214 could promote NPC progression due to partially repressing endogenous Bim. [score:1]
Fors, 293T cells were seeded in 12-well plates and transfected with wide type or mutant reporter constructs (50 ng) together with miR-214 or miR-control (50 nM, GenePharma, Shanghai, China) and Renilla plasmid (10 ng) using lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). [score:1]
However, the role of miR-214 in nasopharyngeal carcinoma (NPC) is still unknown. [score:1]
For data analysis, cycle threshold (Ct) for U6 (reference) and miR-214 (sample) were determined in triplicate (shown as arithmetical mean). [score:1]
These plasmids and pCMV-Renilla (internal control) and miR-214 or miR-control were transiently transfected into 293T cells. [score:1]
Following a post-fixation step in 4% paraformaldehyde (PFA), LNA-miR-214 detection probe (Exiqon, Vedbek, Denmark) or LNA-control (Exiqon, Vedbek, Denmark) was hybridized to the sections at 58°C for 4 hours carried out in a Hybrite (Abbott Laboratories, Shanghai, China). [score:1]
Pairing of miR-214 with Bim 3′UTR region and BAX 3′UTR region. [score:1]
We further investigated the effect of miR-214 on the expression of Bim and BAX by qRT-PCR as well as Western blot. [score:1]
Li and his colleagues' study showing high-level of miR-214 in NPC [23]. [score:1]
In order to completely understand the role of miR-214 in clinical practice, the levels of miR-214 in the FFPEs sample would be analyzed to determine whether miR-214 is a hallmark for prognosis and diagnosis. [score:1]
Silencing of miR-214 induces apoptosis in NPC cells. [score:1]
[1 to 20 of 74 sentences]
15
[+] score: 204
Among the upregulated miRNAs, miR-214 has been demonstrated to be upregulated during osteoclastogenesis and inhibit osteoblast function by targeting ATF4 [42, 55], which hints that miR-214 in the exosome may be involved in the crosstalk between osteoclasts and osteoblasts. [score:11]
Taken together, these findings indicate that secreted miR-214-containing exosomes from osteoclasts can be taken up by osteoblasts, resulting in the transfer of miR-214 into osteoblasts and thus downregulation of miR-214 target gene expression. [score:8]
miR-214 levels and copies in the exosomes were markedly upregulated by miR-214 mimics and downregulated by anti-miR-214 (Figure 2c and Supplementary Figure S2a). [score:7]
Nine miRNAs (miR-148a-3p, miR-183a-5p, miR-214-3p, miR-27a-3p, miR-92a-3p, miR-378a-3p, miR-23a-3p, miR-21a-5p and miR-16-5p) were upregulated, and four (miR-155-5p, miR-199a-3p, miR-320-3p and miR-125a-5p) were downregulated in exosomes from RANKL -induced RAW 264.7 cells compared with RAW 264.7 cells (Figure 1f and Supplementary Figure S1d). [score:6]
Osteoclasts highly express miR-214, the expression of which is further increased during RANKL -induced osteoclastogenesis. [score:5]
Exosomes from osteoclast-specific miR-214 -overexpressing mice inhibit osteoblast function in vivo. [score:5]
Accordingly, Rab27a knockdown reduced miR-214 transmission -induced downregulation of Atf4 protein levels, in addition to Alp, Bglap and Col1α1 mRNA levels and Alp staining in hFOB1.19 cells (Figure 3h–j). [score:5]
Exosomes from osteoclast-specific miR-214 -overexpressing mice inhibit osteoblast function in vivoTo investigate the role of osteoclast-derived miR-214 in the suppression of osteoblast function in vivo, we used osteoclast-specific Acp5 miR-214 transgenic (OC-TG214) mice [55] and found that miR-214 levels were markedly higher in osteoclasts (Oscar [+] cells) isolated from OC-TG214 mice (Figure 5a). [score:5]
Consistent with these results, the expression of Atf4 protein, the target of miR-214 in osteoblasts, was also altered by exosomes harboring different miR-214 levels (Figure 2f). [score:5]
Moreover, osteoclast-specific miR-214 transgenic mice (OC-TG214) exhibited downregulated osteoblast activity and increased levels of circulating miR-214. [score:4]
miR-214 levels in these cells were not upregulated by exosomes from osteoporotic patients (Figure 6h). [score:4]
To investigate the role of exosomes in the transfer of miR-214, exosome production was blocked by the neutral sphingomyelinase inhibitor GW4869 [56], and exosome release inhibited by Rab27a small interfering RNA (siRNA) (Figure 3a and Supplementary Figure S3a and b), GW4869 and Rab27a siRNA had no apparent direct effect on miR-214 level or osteoclast activity (Supplementary Figure S3c–f). [score:4]
miR-214 levels in Oscar [+] cells and Alp [+] cells were markedly upregulated in OVX mice (Supplementary Figure S7c). [score:4]
In this regard, osteoclast-derived, miR-214-containing exosomes act as a coupling inhibitor to negatively regulate osteoblasts. [score:4]
miR-214 levels were not upregulated by exosomes from human osteoclasts in hFOB1.19 cells transfected with Epha2 siRNA (Figure 4k). [score:4]
miR-214 level in osteoblasts (Alp [+] cells) isolated from OC-TG214 mice was also significantly upregulated (Figure 5b). [score:4]
miR-214 levels in circulating exosomes were significantly upregulated in osteoclast-specific miR-214 transgenic mice. [score:4]
Therefore, one can speculate that, given the function of osteoblast upregulation, more RANKL is available to stimulate osteoclastogenesis, which, in turn, produces more miR-214 to reduce osteoblast differentiation, thus forming a negative feedback loop to maintain bone formation and resorption homeostasis. [score:4]
Accordingly, GW4869 reversed miR-214 transmission -induced downregulation of ATF4 protein levels and Alp, Bglap and Col1α1 mRNA levels in hFOB1.19 cells (Figure 3c and d). [score:4]
miR-214 levels in Oscar [+] cells were significantly upregulated in Rab27a siRNA -treated mice (Figure 7e). [score:4]
Moreover, miR-214 was upregulated in both exosomes and serum in blood from hindlimb suspension and OVX -induced osteoporotic mice. [score:4]
Levels of miR-214 encapsulated in exosomes and those of ephrinA2 on the exosome membrane were highly upregulated in OC-TG214 mice, osteoporotic patients and ovariectomized (OVX) mice. [score:4]
Moreover, when exosome release from osteoclasts was inhibited by transfection of Rab27a siRNA (Figure 3f), miR-214 transfer from osteoclasts to osteoblasts was also attenuated (Figure 3g). [score:3]
Osteoclast-derived exosomes transfer miR-214 to osteoblasts and inhibit their activity. [score:3]
Under basal conditions, inhibition of exosome release by Rab27a siRNA treatment resulted in reduced circulation of miR-214 levels both in the serum and exosomes (Supplementary Figure S9f). [score:3]
miR-214 transfer was attenuated when exosome production in osteoclasts was inhibited by GW4869 (Figure 3b). [score:3]
The transfer of miR-214 from mouse osteoclasts to mouse osteoblasts was inhibited by GW4869 or Rab27a siRNA in a similar manner (Supplementary Figure S3g–o). [score:3]
Overall, we found that osteoclasts secreted miRNA-enriched exosomes, and osteoclast-derived exosomes preferentially transferred miR-214 into osteoblasts to inhibit their activity. [score:3]
Osteoclast-derived exosomes bind to osteoblasts through an ephrinA2/EphA2 interaction to suppress osteoblast function by releasing miR-214. [score:3]
In this study, we identified a novel mode of osteoclast–osteoblast communication, in which miR-214 is secreted by osteoclasts encapsulated in exosomes and then transferred to osteoblasts to inhibit their function. [score:3]
Exosomes from both osteoporotic patients and OVX mice contained higher levels of miR-214 and ephrinA2 protein, suggesting that exosomes exert a marked inhibitory function on osteoblast activity. [score:3]
These results demonstrated that miR-214 is essential in the exosome -mediated inhibitory effect on osteoblasts. [score:3]
Simultaneously, miR-214 levels in osteoblasts were also increased and osteoblast function inhibited. [score:3]
Consequently, miR-214 is transferred into osteoblasts to inhibit their activity. [score:3]
The relative expression level of miR-214 was determined by the cycle number via qPCR, with their levels normalized to the average of cel-miR-39 using the 2 [−ΔΔCT] method. [score:3]
These findings underscore the clinical significance of elevated miR-214 levels in the serum of osteoporotic patients and suggest its potential use as a marker for the diagnosis of osteoporosis and as a target for osteoporosis therapeutics. [score:3]
These results suggest that osteoclast secretes miRNA-contained exosomes, which include miR-214, the key regulator of bone remo deling. [score:2]
In this study, we not only identified a correlation between miR-214 levels in serum and osteoporosis but also clarified the mechanism of its regulation on the balance between osteoblasts and osteoclasts. [score:2]
When ephrinA2 was knocked down in human osteoclasts by Efna2 siRNA (Figure 4b and c), miR-214 levels remained unchanged in the exosomes derived from these human osteoclasts (Figure 4d). [score:2]
However, osteoclast activity in osteoblast-specific transgenic miR-214 mice (OB-TG214) remained similar to that in WT mice (Supplementary Figure S6c–f), suggesting that miR-214 may be unidirectionally transferred from osteoclasts to osteoblasts in vivo. [score:2]
However, Sema4D knockdown in osteoclasts had no effect on osteoclast-derived exosome -mediated miR-214 transfer from osteoclasts to osteoblasts (Supplementary Figure S5a–e). [score:2]
The osteoclast and osteoblast transwell coculture experiments demonstrated that miR-214-containing exosomes serve as mediators of osteoclast–osteoblast crosstalk, and this process is independent of direct cell contact. [score:2]
When MC3T3-E1 cells were incubated with these exosomes, the miR-214* copies in these cells were three times of miR-214 levels (Supplementary Figure S2s). [score:1]
Stem-loop RT-PCR was used for the quantification of miR-214. [score:1]
Two microliters of diluted cDNA (1:5) were used for miR-214 absolute quantitative analysis by qRT-PCR. [score:1]
The results showed that miR-214* copies in the exosomes secreted from miR-214* -transfected mouse osteoclasts were eight times of miR-214 copies (Supplementary Figure S2r). [score:1]
miR-214 levels were markedly increased when MC3T3-E1 cells were incubated with miR-214 mimic -transfected RAW 264.7 cells (Supplementary Figure S2l). [score:1]
Consistent with the changes in Alp mRNA levels, cells that received exosomes with lower miR-214 levels displayed enhanced Alp staining, whereas those with higher miR-214 levels exhibited weak Alp staining (Figure 2h). [score:1]
First, the levels of miR-214 in the serum from osteoporotic patients and non-osteoporotic individuals were determined. [score:1]
To investigate the role of osteoclast-derived miR-214 in the suppression of osteoblast function in vivo, we used osteoclast-specific Acp5 miR-214 transgenic (OC-TG214) mice [55] and found that miR-214 levels were markedly higher in osteoclasts (Oscar [+] cells) isolated from OC-TG214 mice (Figure 5a). [score:1]
Osteoclasts secrete miR-214-enriched exosomes. [score:1]
Characteristics of exosomes from osteoporotic patients and mice and the inhibitory effect of miR-214 on osteoblasts. [score:1]
To further monitor the transport of miR-214 from osteoclasts to osteoblasts, we designed a miR-214 star variant (miR-214*) (Supplementary Figure S2p), which could be distinguished from miR-214 by quantitative reverse transcription-PCR (qRT-PCR) (Supplementary Figure S2q), and the absolute copies of miR-214* and miR-214 in exosomes and osteoblasts could be quantified. [score:1]
Unfortunately, osteoclast activity was also enhanced, and miR-214 levels were increased in osteoclasts following a reduction in Rab27a levels. [score:1]
However, there was no change in mRNA levels of Dnm3os, which encodes miR-214 (Figure 2e), suggesting that miR-214 was transferred from the exosomes to hFOB1.19 cells. [score:1]
To analyze the effect of miR-214-containing exosomes from OC-TG214 mice on osteoblast function, serum exosomes were isolated and incubated with MC3T3-E1 cells. [score:1]
These results suggest that both the transfer of miR-214 from osteoclasts and its function in osteoblasts are dependent on exosomes. [score:1]
miR-214 was diluted into 0.2, 2, 20, 200, 2 000 and 20 000 n m, and 1 μl was reverse transcribed into 10 μl cDNA. [score:1]
However, there was no change in mRNA levels of Dnm3os, which encodes miR-214 (Supplementary Figure S2o). [score:1]
However, Dnm3os mRNA levels remain unchanged (Figure 5c), which indicated that the increased miR-214 in osteoblasts was mainly from its importation from osteoclasts. [score:1]
When MC3T3-E1 cells were cultured in the presence of exosomes collected from the supernatant of osteoclasts transfected with FAM-labeled miR-214, the cells exhibited a fine granular fluorescent pattern within the cytoplasm, indicating the incorporation of miR-214 into MC3T3-E1 cells (Figure 2b). [score:1]
miR-214* was diluted into 0.23, 2.3, 23, 230, 2 300 and 23 000 n m, and 1 μl was reverse transcribed into 10 μl cDNA. [score:1]
Similarly, miR-214 levels were increased in exosomes during the process of osteoclastogenesis (Figure 1k) and protected from RNase degradation (Figure 1l). [score:1]
However, miR-214 levels in serum, exosomes and osteoblasts were markedly reduced in Rab27a siRNA -treated mice (Figure 7f and g and Supplementary Figure S9a). [score:1]
miR-214 levels in hFOB1.19 cells were much higher when incubated with exosomes from osteoporotic patients than non-osteoporotic individuals (Figure 6d). [score:1]
Next, we examined whether miR-214 is transferred via exosomes from osteoclasts to osteoblasts. [score:1]
Quantification of miR-214 and miR-214* copies. [score:1]
To further confirm the role of miR-214 in this process, we antagonized miR-214 level in osteoblasts with anti-miR-214. [score:1]
miR-214 levels were significantly increased in MC3T3-E1 cells following incubation with exosomes from the serum of OC-TG214 mice (Figure 5g). [score:1]
For this study, we used osteoblast-specific miR-214 transgenic mice (OB-TG214) and osteoclast-specific miR-214 transgenic mice (OC-TG214), which were reported previously [42, 55]. [score:1]
miR-214 levels in the blood could serve as a biomarker for osteoporosis diagnostic purposes. [score:1]
When these osteoblasts were incubated with exosomes, there were no changes of miR-214 levels in these cells. [score:1]
Using the standard curves, we quantitated miR-214 and miR-214 star copies in osteoblast, osteoclast and exosomes from miR-214 star -transfected osteoclasts. [score:1]
Circulating miR-214 levels in exosomes and serum were increased significantly in osteoclast-specific transgenic mice, suggesting that osteoclast-secreted exosomes exist not only in the bone microenvironment but can also enter the blood. [score:1]
First, the standard curve was made according to the absolute copies of miR-214 or miR-214* and its Ct value, respectively. [score:1]
Quantitative analysis of miR-214 was performed on the pellet of extracellular vesicles generated by differential centrifugation. [score:1]
According to the CT value of miR-214, we found that miR-214 mainly existed in exosome but not in AB (apoptotic body) and MV (microvesicle) isolated from RAW 264.7 cell culture medium (Figure 1h). [score:1]
miR-214 in lipid-bilayered exosomes was protected from RNase degradation (Figure 1g). [score:1]
When those exosomes were incubated with hFOB1.19 cells, miR-214 levels and copies in these cells were changed accordingly with the levels in the exosomes (Figure 2d and Supplementary Figure S2b). [score:1]
When MC3T3-E1 cells were cocultured with mouse osteoclasts, miR-214* copies in MC3T3-E1 cells were about 2.5 times of miR-214 levels in MC3T3-E1 cells (Supplementary Figure S2t). [score:1]
To further explore the role of miR-214 in exosome function in human osteoblast hFOB1.19 cells, exosomes were isolated from the supernatant of RANKL -induced human osteoclasts transfected with miR-214 mimics, anti-miR-214 or negative control (NC). [score:1]
To further investigate the clinical significance of miR-214 carried by exosomes, as a circulating miRNA, in the inhibition of bone formation, exosomes from the serum of osteoporotic patients and non-osteoporotic individuals were isolated and incubated with osteoblasts. [score:1]
Diluted cDNA (1:10) were used for detecting miRNA expression by qPCR using the miScript SYBR Green PCR Kit with miR-214 miScript Primer Assay (Qiagen). [score:1]
[1 to 20 of 83 sentences]
16
[+] score: 189
Other miRNAs from this paper: hsa-mir-214
MiR-214-3p directly targets Traf3 to regulate osteoclast activity in vitroWe next sought to understand how osteoclastic miR-214-3p regulates the osteoclast activity and bone resorption during the development of OBM. [score:7]
In addition, the TRAF3 protein levels in osteoclasts were downregulated after transfection with agomir-214 but not the nonsense agomir control or mutant agomir-214, whereas no differences in the Traf3 mRNA levels were found among different treatments, suggesting a role of miR-214-3p in the posttranscriptional regulation on TRAF3 protein expression. [score:7]
We used miRBase (version 21) and TargetScan (release version 6.2) to predict the candidate target genes of miR-214-3p, wherein we found that Traf3 mRNA contains a miR-214-3p binding site in its 3′ untranslated region (3′UTR) (Fig. 4a). [score:7]
Given that the osteoclastic miR-214-3p could transfer to osteoblast to inhibit bone formation 24, the current strategy of inhibiting osteoclastic miR-214-3p may also exert anabolic effect on bone formation. [score:5]
Given that a recent study reported that miR-214-3p targets phosphatase and tensin homolog (PTEN) to promote osteoclastogenesis 17, we also examined the protein expression of PTEN in the bone specimens. [score:5]
Osteoclast -targeted inhibition of miR-214-3p attenuates osteolytic bone metastasis. [score:5]
Elevated miR-214-3p in osteoclast targets Traf3 to promote osteoclastic bone resorption in vivoNext, we investigated the role of osteoclastic miR-214-3p in regulating bone resorption in vivo using our previously established osteoclast-specific miR-214-3p knock-in (OC-214) mice that overexpressing miR-214-3p under the control of Cre -mediated recombination driven by the Ctsk promoter 23 24. [score:5]
MiR-214-3p directly targets Traf3 to regulate osteoclast activity in vitro. [score:4]
Moreover, the luciferase activity of the WT Traf3 3′ UTR was notably upregulated after the endogenous levels of miR-214-3p were reduced by antagomir-214-3p treatment (Fig. 4f). [score:4]
We further found that miR-214-3p could target TRAF3 to stimulate the osteoclastic bone resorption during the development of OBM. [score:4]
The results showed that osteoclast -targeting antagomir-214-3p treatment could dramatically diminish bone metastatic lesions in BCX nude mice, respectively, which could be explained by the decreased bone resorption after knocking down the miR-214-3p level within osteoclasts by antagomir-214. [score:4]
In this study, we found that elevated miR-214-3p within osteoclast could target TRAF3 to promote osteoclastic bone resorption during the development OBM. [score:4]
Given that our data from breast cancer patients also showed that the intraosseous PTEN protein expression seemed to be not affected under pathological conditions of OBM, we next sought to elucidate the mechanisms by which miR-214-3p regulates osteoclastic bone resorption. [score:4]
These data suggest that the metastatic breast cancer cells could stimulate miR-214-3p expression in osteoclast precursors to promote osteoclast formation during the development of OBM. [score:4]
To determine whether miR-214-3p could directly target Traf3, the RAW264.7 cells were transfected with luciferase reporters containing either a wild-type (WT) Traf3 3′UTR or a mutant Traf3 3′UTR (Fig. 4d). [score:4]
Considering the distinct role of miR-214-3p described here, we also evaluated the therapeutic effect of inhibiting miR-214-3p within osteoclasts on the development of OBM in BCX nude mice using antagomir-214-3p encapsulated in our established osteoclast -targeting delivery system 25. [score:4]
The data from OBM patients as well as murine mo dels concordantly showed a close association between the aberrantly elevated osteoclastic miR-214-3p expression and the increased bone resorption during the progression of OBM. [score:3]
In brief, a cassette containing the following components was constructed to target the Rosa26 locus: FRT-LoxP-stop codons-three SV40 poly(A) sequences- LoxP-mmu-miR-214-3p-WPRE-bGH poly(A)-AttB-PGK promoter- FRT-Neo-PGK poly(A)-AttP. [score:3]
The elevated miR-214-3p within osteoclast targets TRAF3 to promote osteoclastic bone resorption in vivo. [score:3]
Collectively, it indicates that the elevated miR-214-3p in osteoclast could target Traf3 to promote osteoclastic bone resorption in vivo. [score:3]
These data suggest that therapeutic inhibition of miR-214-3p within osteoclast could attenuates osteolytic bone metastasis. [score:3]
Six weeks after the first treatment, the intraosseous miR-214-3p level in BCX nude mice treated with AMO was significantly lower than that in BCX nude mice without AMO treatment (Supplementary Fig. 6a,b), suggesting the efficient inhibition of miR-214-3p in BCX nude mice after AMO treatment. [score:3]
Notably, the time -dependent increase in the expression of miR-214-3p, Ctsk and Trap were more pronounced in the presence of CM from breast cancer (Supplementary Fig. 4a). [score:3]
On the other hand, it has been proved that miR-214-3p could target p53 to enhance the invasion ability of breast cancer cells 27, while depletion of miR-214-3p could block the dissemination of breast cancer cells 28, suggesting an important role of miR-214-3p in mediating breast cancer metastasis. [score:3]
Collectively, it strongly suggests that miR-214-3p could regulate the amount of TRAF3 proteins to contribute to the excessive osteoclastic bone resorption during the development of OBM. [score:3]
Elevated miR-214-3p in osteoclast targets Traf3 to promote osteoclastic bone resorption in vivo. [score:3]
Next, we investigated the role of osteoclastic miR-214-3p in regulating bone resorption in vivo using our previously established osteoclast-specific miR-214-3p knock-in (OC-214) mice that overexpressing miR-214-3p under the control of Cre -mediated recombination driven by the Ctsk promoter 23 24. [score:3]
Moreover, we examined the effect of miR-214-3p on the protein expression level of NFATc1, NIK and p65 (RelA) in RAW 264.7 undergone RANKL -induced osteoclast differentiation. [score:3]
How to cite this article: Liu, J. et al. Osteoclastic miR-214 targets TRAF3 to contribute to osteolytic bone metastasis of breast cancer. [score:3]
We next sought to understand how osteoclastic miR-214-3p regulates the osteoclast activity and bone resorption during the development of OBM. [score:3]
All these data suggest that the elevated expression of miR-214-3p within osteoclast could promote osteoclastic bone resorption in OC-214 mice. [score:3]
In this study, we further found that the CM from breast cancer cells could dramatically stimulate the expression of miR-214-3p and induce the osteoclast differentiation in vitro, which could be blocked/promoted by antagomir-214-3p/agomir-214-3p treatment. [score:3]
These data suggest that the highly expressed intraosseous miR-214-3p were closely associated with the elevated bone resorption in OBM patients. [score:3]
The targeted ES clones were microinjected into C57BL/6 blastocysts, and male chimeras were mated to C57BL/6 females to obtain miR-214-3p  flox-neo/+ mice, which were then intercrossed with flp- deleter mice (JAX, 009086) to remove neo cassette in order to generate miR-214-3p  flox/+ mice. [score:3]
On the other hand, a recent study shows that miR-214-3p could promote osteoclastogenesis and increase osteoclast activity by targeting PTEN during osteoclast differentiation from bone marrow monocytes (BMMs) 17. [score:3]
Our results suggest that therapeutic inhibition of miR-214-3p in osteoclasts may be a potential therapeutic strategy for OBM with dominant osteoclastic bone resorption. [score:3]
Thereafter, we crossed the Rosa26-PCAG-STOP [fl]- mmu-miR-214-knock-in mice with heterozygous Ctsk-cre mice to obtain OC-miR-214 mice. [score:2]
High miR-214-3p in osteoclasts correlates with elevated bone resorption during the development of OBM. [score:2]
Collectively, these data imply a close association between the elevated osteoclastic miR-214-3p level and the excessive bone resorption during the development of OBM. [score:2]
For miRNA expression, the TaqMan primer-probe combinations for miRNA-214-3p and RUN6B were products of Ambion. [score:2]
Firstly, we generate the Rosa26-PCAG-STOP [fl]- mmu-miR-214-3p-knock-in mice. [score:2]
The optimal dosage of antagomir-214-3p was determined in our pilot study, in which almost 80% knockdown efficiency of osteoclastic miR-214-3p was achieved at a dose of 10 mg/kg. [score:2]
Then, the mice were intercrossed with nude mice to obtain the miR-214-3p flox/− nude mice, which were then crossed with the Ctsk-Cre mice to generate the osteoclast-specific miR-214-3p knockout nude mice (Ctsk; miR-214-3p flox/ flox, hereafter C KO mice) and the relative controls (miR-214-3p flox/ flox, hereafter WT mice). [score:2]
Thereafter, the chimeric mice were intercrossed with C57BL/6 mice to obtain F1 heterozygote mice and then backcrossed with C57BL/6 mice to expand the enough number of heterozygote Rosa26-PCAG-STOP [fl]- mmu-miR-214-knock-in mice. [score:2]
Impressively, we found that osteoclast-specific ablation of miR-214-3p could substantially prevent the development of OBM, as evidenced by the low level of CTX-I and bone resorption-related parameters as well as the diminished metastasis to bone in the C KO nude mice after BCX. [score:2]
More importantly, the evidences from the luciferase reporter assay and the gain- and loss-of-function experiments indicate that TRAF3 could be a functional target of miR-214-3p. [score:2]
MiR-214-3p targets Traf3 to functionally promote osteoclast differentiation in vitro. [score:2]
We then transfected the RAW264.7 cells with WT Traf3 3′ UTR to block the binding of endogenous miR-214-3p to Traf3. [score:1]
In addition, we have previously shown that miR-214-3p could promote osteoclast differentiation in vitro. [score:1]
Elevated miR-214-3p level associates with increased bone resorption in bone specimens from breast cancer patients. [score:1]
However, the limitation of this study was that we didn’t examine the effect of miR-214-3p agomir or antagomir on osteoclast differentiation from human peripheral blood mononuclear cells. [score:1]
We observed a gradual increase in the miR-214-3p levels together with a decrease in the amount of TRAF3 protein in RAW 264.7 cells during RANKL -induced osteoclastogenesis (Fig. 4b). [score:1]
On the other hand, the OC-miR-214-3p mice were generated according to our published protocols 24. [score:1]
Consistently, we observed a time -dependent decrease in the TRAF3 protein level, which was accompanied by a gradual increase in the miR-214-3p level, during osteoclastogenesis in vitro. [score:1]
Genetic ablation of osteoclastic miR-214-3p prevents osteolytic bone metastasis in BCX nude mice. [score:1]
To examine the effect of osteoclast-specific miR-214-3p depletion on osteolytic bone metastasis, the C KO mice and WT controls were grafted with human breast cancer cells through intraventricular injection and sacrificed at 8 weeks after xenografts. [score:1]
To investigate whether the elevated miR-214-3p within osteoclasts could promote osteoclastic bone resorption via targeting Traf3 in vivo, we evaluated the degree of bone resorption in the OC-214 mice weekly administrated with or without TRAF3 3′UTR-containing plasmid (20 μg per mice) encapsulated in the our previously developed osteoclast -targeted delivery system 25. [score:1]
The female miR-214-3p  flox/+ mice in C57BL/6 background were intercrossed with the male BALB/c nu/nu mice to obtain the miR-214-3p flox/+ nude mice. [score:1]
Note: miR-214-3p levels were normalized to U6 and osteoclast marker genes mRNA levels were normalized to Gapdh. [score:1]
The relative quantification of miR-214 expression was calculated using the 2 [−∆∆CT] method. [score:1]
Moreover, the correlation analysis indicated that the osteoclastic miR-214-3p level was positively correlated with Oc. [score:1]
The levels of miR-214-3p were normalized to the mean value of control group. [score:1]
Thereafter, the miR-214-3p  flox/+ nude mice were crossed with the Ctsk-cre nude mice to obtain the Ctsk;miR-214-3p  flox/ flox (C KO) nude mice and the miR-214-3p  flox/ flox (wild-type, WT) controls. [score:1]
Loss of miR-214-3p within osteoclasts prevents osteolytic bone metastasis. [score:1]
Thus, the above findings suggest that loss of miR-214-3p within osteoclasts could prevent osteolytic bone metastasis. [score:1]
The correlation analysis further revealed that the miR-214-3p level was positively correlated with the mRNA levels of bone resorption marker genes in bone specimens pooled from breast cancer patients with/without OBM (Fig. 1c). [score:1]
Elevated osteoclastic miR-214-3p level associates with increased bone resorption in bone specimens from BCX nude mice. [score:1]
S/BS and between osteoclastic miR-214-3p level and serum CTX-I levels was performed, respectively. [score:1]
Among the osteoclastogenic miRNAs, the intraosseous miR-214-3p level in OBM patients was significantly higher than that in breast cancer patients without OBM and cancer-free individuals, respectively (Fig. 1a). [score:1]
OC-214: OC-miR-214-3p mice; WT: age-matched littermates; BS: mice that were sacrificed before treatment as baseline; PBS: mice treated with PBS as blank control; Veh: mice treated with (D-Asp) [8]-liposome alone; 3′UTR-Mut: mice treated with (D-Asp) [8]-liposome-mutant Traf3 3′UTR plasmid; 3′UTR: mice treated with (D-Asp) [8]-liposome- Traf3 3′UTR plasmid. [score:1]
Since we have previously demonstrated that the osteoclast could secrete exosomal miR-214-3p to the bone microenvironment 24, it was reasonable to expect that the aberrant elevated miR-214-3p levels in osteoclasts may, in turn, contribute to affect the colonized cancer cells at the bone metastatic site. [score:1]
Traf3 mRNA 3′UTR containing the miR-214-3p -binding sequences for the mouse Traf3 gene was amplified by PCR from mouse genomic DNA. [score:1]
The osteoclastic miR-214-3p level within OSCAR [+] cells, the value of Oc. [score:1]
As expected, the miR-214-3p level and the mRNA levels of Ctsk and Trap gradually increased during the osteoclast differentiation. [score:1]
Q-PCR analysis of the miR-214-3p levels (a) and the TRAP and CTSK mRNA levels (b) in osteoclasts and non-osteoclasts isolated from bone marrow cells by MACS. [score:1]
The miR-214-3p  flox/− mice were generated as previously reported 21. [score:1]
We next evaluated the therapeutic effect of inhibiting osteoclastic miR-214-3p on osteolytic bone metastasis. [score:1]
[1 to 20 of 77 sentences]
17
[+] score: 171
In order to prove a direct regulation of PHLPP2 expression by miR-214, a miScript Target Protector (TP) specific for the binding site of miR-214 on the 3′ untranslated region (UTR) of the mouse PHLPP2 has been used. [score:9]
In addition, bypassing the MGO -dependent downregulation of miR-214 by miR-214 mimics transfection in MAECs, a rescue effect of Akt phosphorylation as well as PHLPP2 levels is observed, strengthening our hypothesis that the downregulation of miR-214 may contribute to the MGO -dependent effect through its new target, PHLPP2. [score:9]
Considering PHLPP2 as a direct target of miR-214, we subsequently verified whether the negative effect of MGO on the insulin signaling pathway in MAECs may be mediated by miR-214 downregulation. [score:7]
Furthermore, for the first time, the direct regulatory effect of miR-214 on the PHLPP2 expression has been verified using both a target site protector specific for the binding site of miR-214 in the 3′UTR of mouse PHLPP2 and a reporter gene assay with the 3′UTR of mouse PHLPP2 cloned downstream of the Firefly luciferase gene. [score:6]
While no further increase is observed in the former case, thus excluding that two different mechanisms are due to miR-214 and MGO, a reversion in the PHLPP2 expression is obtained when the MGO -dependent downregulation of miR-214 is specifically bypassed in the latter case. [score:6]
PHLPP2 is a high confidence predicted target of both miR-214 and miR-126, based on our search using 10 different miRNA target prediction programs to retrieve information on any interaction between PHLPP2 and these specific miRNAs. [score:5]
Yang H. Kong W. He L. Zhao J. J. O’Donnell J. D. Wang J. Wenham R. M. Coppola D. Kruk P. A. Nicosia S. V. MicroRNA expression profiling in human ovarian cancer: mir-214 induces cell survival and cisplatin resistance by targeting PTENCancer Res. [score:5]
Interestingly, transfection of a specific antisense inhibitor for miR-214 (miR-214 inhibitor) induces a dose -dependent increase of PHLPP2 protein levels in MAECs (Figure 2a). [score:5]
Jin Y. Yang C. J. Xu X. Cao J. N. Feng Q. T. Yang J. MiR-214 regulates the pathogenesis of patients with coronary artery disease by targeting VEGFMol. [score:5]
miR-214 levels were modulated by transfecting MAECs with 0.5, 5, or 50 nmol/L miR-214 -mimic (mmu-miR-214 miRIDIAN Mimic) or miR-214 -inhibitor (mmu-miR-214 miRIDIAN Harpin Inhibitor). [score:5]
After quantification with NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA), total RNA was reverse transcribed using the miScript II RT Kit (QIAGEN), and the differential expression of miRNA-214 was analyzed by real time-PCR using the miScript SYBR Green PCR Kit (QIAGEN) and quantified as expression units relative to U6 snRNA, used as housekeeping small RNA. [score:5]
In MAECs transfected with the miR-214 inhibitor, PHLPP2 levels are increased by about 4-fold, and are comparable both to that observed in MGO -treated control cells and miR-214 inhibitor plus MGO co -treated cells (Figure 3a). [score:5]
Moreover, miR-214 has been reported to activate the PI3K/Akt signaling by targeting PTEN expression in several cell types, including ovarian and gastric cancer cells [38, 39, 40, 41, 42, 43]. [score:5]
Finally, miR-214 downregulation was also validated in vivo in the aortic tissue of a non-diabetic mouse mo del knocked down for glyoxalase 1 (Glo1KD mice), described to have high levels of MGO -modified proteins [22, 23]. [score:5]
Duan Q. Yang L. Gong W. Chaugai S. Wang F. Chen C. Wang P. Zou M. H. Wang D. W. MicroRNA-214 Is Upregulated in Heart Failure Patients and Suppresses XBP1-Mediated Endothelial Cells AngiogenesisJ. [score:5]
Interestingly, the inhibition of the endogenous miR-214 in MAECs is sufficient to cause a significant increase in PHLPP2 protein levels, comparable to that obtained upon MGO treatment; in addition, when miR-214 is overexpressed, the phosphatase levels are significantly decreased. [score:5]
In order to strengthen the role of miR-214 in the MGO effect on the PHLPP2 levels in MAECs, this miRNA has been both inhibited and overexpressed in presence of MGO. [score:5]
Van Mil A. Grundmann S. Goumans M. J. Lei Z. Oerlemans M. I. Jaksani S. Doevendans P. A. Sluijter J. P. MicroRNA-214 inhibits angiogenesis by targeting Quaking and reducing angiogenic growth factor releaseCardiovasc. [score:4]
Similarly, the transfection of MAECs with miR-214 inhibitor significantly decreases insulin-stimulated Akt phosphorylation compared to MAECs transfected with control inhibitor (Figure 5a). [score:4]
Liu J. Chen W. Zhang H. Liu T. Zhao L. miR-214 targets the PTEN -mediated PI3K/Akt signaling pathway and regulates cell proliferation and apoptosis in ovarian cancerOncol. [score:4]
org prediction, suggesting that other miRNAs highly expressed in MAECs may regulate PTEN in a mutually exclusive fashion and independently from any changes in miR-214 levels upon MGO treatment. [score:4]
This search has allowed the identification of candidate genes involved in insulin signal transduction as potential targets of miR-214 and miR-126. [score:3]
Surprisingly, despite PTEN being a wi dely validated target of miR-214 [38, 39, 40, 41, 42, 43], its levels have not been altered by MGO in MAECs. [score:3]
It has been also shown that miR-214 targets IRS and Akt in C2C12 myoblasts [44]. [score:3]
In accordance with the previous results, a significant reduction in PHLPP2 levels is observed in MAECs overexpressing miR-214 with the transfection of the highest concentration (50 nmol/L) of a RNA oligonucleotide which specifically mimics miR-214 (miR-214 mimic). [score:3]
Yang T. S. Yang X. H. Wang X. D. Wang Y. L. Zhou B. Song Z. S. MiR-214 regulate gastric cancer cell proliferation, migration and invasion by targeting PTENCancer Cell Int. [score:3]
MAECs were plated in 6-well plates and co -transfected with 100 ng of the pEZX-MT06 control reporter vector or the pEZX-MT06/PHLPP2-3′UTR reporter vector and 50 nmol/L miR-214 mimic or a non -targeting control oligonucleotide (mimic control) using DharmaFECT 4 (Dharmacon), according to manufacturer’s instructions. [score:3]
Zhang Q. Zhang S. miR-214 promotes radioresistance in human ovarian cancer cells by targeting PTENBiosci. [score:3]
Hence, these findings highlight an important role for miR-214 under diabetic conditions and suggest that strategies aimed at restoring miR-214 levels or inhibiting PHLPP2 protein levels in endothelial cells may provide the basis for the rationale design of novel therapies for insulin resistance and vascular complications. [score:3]
The decrease in the protein levels of PHLPP2, which is induced by miR-214 mimic, is no longer observed in MAECs transfected with both the miScript Target Protector (TP) and miR-214 mimic (Figure 4a). [score:3]
Employing an integrated approach using public bioinformatics tools, we have identified several phosphatases as potential targets of both miR-214 and miR-126. [score:3]
Finally, to prove the role of miR-214 on endothelial MGO -mediated insulin-resistance, we analyzed the effect of miR-214 inhibitor and miR-214 mimic on insulin -dependent phosphorylation of Akt. [score:3]
Taken together, these results suggest an inverse correlation between PHLPP2 and miR-214, but not with miR-126, supporting the bioinformatic target prediction only for miR-214. [score:3]
Therefore, these results demonstrate that miR-214 mediates the effect of MGO on the PHLPP2 expression. [score:3]
Figure 6 shows that miR-214 expression is reduced by 45% in the aortic tissue of Glo1KD mice compared to wild type (WT) mice. [score:2]
One possible explanation for the lack of PTEN regulation by miR-214 in our cellular mo del is that the binding site for miR-214 in the 3′UTR of mouse PTEN overlaps with the binding site for several other miRNAs in accordance with the microRNA. [score:2]
Xin R. Bai F. Feng Y. Jiu M. Liu X. Bai F. Nie Y. Fan D. MicroRNA-214 promotes peritoneal metastasis through regulating PTEN negatively in gastric cancerClin. [score:1]
We confirmed that 4 out of these 84 miRNAs were significantly altered in MGO -treated MAECs: miR-126, miR-190a, miR-214 and miR-450a [21]. [score:1]
MAECs were co -transfected with both 0.1 nmol/L miR-214 TP and 50 nmol/L miR-214 mimic using DharmaFECT 4 (Dharmacon), according to manufacturer’s instructions. [score:1]
Wang X. Shen E. Wang Y. Li J. Cheng D. Chen Y. Gui D. Wang N. Cross talk between miR-214 and PTEN attenuates glomerular hypertrophy under diabetic conditionsSci. [score:1]
In conclusion, for the first time, this study provides evidence that an essential link exists between miR-214 and insulin resistance and between miR-214 -dependent insulin resistance and PHLPP2 in endothelial cells. [score:1]
We obtained positive information from 8 and 7 programs for miR-214 and miR-126, respectively. [score:1]
To this end, we evaluated the Akt phosphorylation levels on serine 473 following the specific inhibition of miR-214 in MAECs. [score:1]
For the present study, both miR-214 and miR-126 appear to be attractive candidates, since they control endothelial cell function and angiogenesis [30, 31, 32, 33, 34, 35]. [score:1]
The transfection of miR-214 mimic induces a 25% reduction of luciferase activity driven by the PHLPP2-3′UTR, while no effect on luciferase activity is induced by miR-214 mimic in the empty control vector -transfected cells (Figure 4b), demonstrating that miR-214 binds the PHLPP2-3′UTR region. [score:1]
In this study, we have demonstrated that miR-214 negatively affects the responsiveness to insulin in MAECs by interacting with PHLPP2, which is a novel finding not previously reported to the best of our knowledge. [score:1]
In addition, in the presence of MGO, the transfection of MAECs with the miR-214 mimic reverses the effect due to MGO, leading to a 2.5-fold reduction of PHLPP2 (Figure 3b). [score:1]
Differently, the transfection of miR-214 mimic prevents the MGO deleterious effect on the insulin -dependent Akt phosphorylation (Figure 5b). [score:1]
By our previous investigations, we have also found that the expression of other three miRNAs is related to diabetes: miR-214, miR-450a, and miR-126 are reduced by 32%, 22%, and 30%, respectively, in MAECs exposed to MGO [21]. [score:1]
Furthermore, a miR-214 -dependent regulation of PHLPP2 was confirmed by luciferase reporter assays, performed in MAECs using a construct in which the PHLPP2-3′UTR is cloned immediately downstream of the Firefly luciferase. [score:1]
Taken together, these results show that miR-214, but not miR-126, is able to modulate the protein levels of PHLPP2. [score:1]
[1 to 20 of 51 sentences]
18
[+] score: 107
From this analysis, three differentially expressed microRNAs were revealed, namely, miR-214 (permutation p value 3.7×10 [−3]), expressed specifically in human PBMCs exposed to either HMGB1 [+/+] or HMGB1 [−/−] lysates, and miR-34c (permutation p value 6×10 [−4]), expressed in PBMCs exposed to HMGB1 [+/+] lysates alone (Table 1). [score:9]
Together these data suggest that hsa-miR-214 expression is a general “DAMPmiR” expressed in human PBMCs exposed to damaged cells, while hsa-miR-34c is a miRNA that is sensitive to the presence of HMGB1 in damaged cells. [score:5]
These results support the observation that both hsa-miR-34c and hsa-miR-214 are upregulated when human PBMCs are exposed to damaged or necrotic cells, where hsa-miR34c appears to be responsive to the presence of HMGB1. [score:4]
Here, we report that when human PBMCs are exposed to damaged HMGB1 [+/+] cell lysates, or conditioned media from serum-starved and glucose-deprived cells, both hsa-miR-34c and hsa-miR-214 are upregulated. [score:4]
It will be interesting to test whether the expression of miR-214 in inflammatory tumors is functional in promoting tumor growth. [score:3]
High levels of miR-214 expression in human pancreatic tumors [20] have been observed, indicating that miR-214 may be a general marker of damage -associated inflammation, particularly in highly metastatic tumors etiologically associated with chronic inflammation, such as pancreatic cancer. [score:3]
Expression levels of miR-34c and miR-214 are changed when donor PBMCs are exposed to conditioned media from dying cells. [score:3]
Expression of Hsa-miR-34c and Hsa-miR-214 does not Increase in Human PBMCs Stimulated with Specific Pathogen-activated Molecular Pattern Molecules (PAMPs) or TLR Ligands. [score:3]
A: Changes in miR-34c, miR-214 and miR-155 expression in PMBCs (from one donor) exposed to conditioned media from HMGB1 [+/+] and HMGB1 [−/−] MEF cells. [score:3]
miR-34c and miR-214 are Differentially Expressed in Human PBMCs Following Exposure to Damaged/necrotic Cell Lysates. [score:3]
B: Changes in miR-34c, miR-214 and miR-155 expression in PBMCs from another donor exposed to conditioned media. [score:3]
Levels of miR-34c and miR-214 Expression (and Pro-inflammatory Cytokine Release) Increased After Exposure of Donor PBMCs to Conditioned Media from Serum-starved and Glucose-deprived Cells. [score:3]
High levels of miR-214 expression have been reported in a murine mo del of renal ischemia reperfusion injury [21]. [score:3]
hsa-miR-34c and hsa-miR-214 are expressed at negligible levels in human PBMCs stimulated with various PAMPS or TLR ligands. [score:3]
0038899.g005 Figure 5 A: Changes in miR-34c, miR-214 and miR-155 expression in PMBCs (from one donor) exposed to conditioned media from HMGB1 [+/+] and HMGB1 [−/−] MEF cells. [score:3]
Our findings clearly indicate that miR-34c and miR-214 are specifically expressed in human PBMCs following exposure to sterile cell lysates or conditioned media from stressed cells, but not when exposed to PAMPs as TLR ligands. [score:3]
Expression of miR-34c and miR-214 was negligible in all samples stimulated with the various TLR ligands. [score:3]
Exposure of PBMCs to conditioned media with heat shock at 42°C further increased levels of miR-214 expression. [score:3]
Interestingly, levels of miR-214 were differentially expressed in PBMCs exposed to HMGB1 [+/+] or HMGB1 [−/−] conditioned media, but was not significantly affected when exposed to the respective lysates. [score:3]
The fold expression changes for hsa-miR-214 varied from 2.8 to 5.7 in donor PBMCs exposed to HMGB1 [−/−] lysates, while in donor PBMCs exposed to HMGB1 [+/+] lysates, it varied from 2.9 to 7.3 fold. [score:3]
Expression of hsa-miR-34c and hsa-miR-214 is a hallmark of human PBMCs exposed to necrotic cell lysates. [score:3]
Fig. 3 shows the fold expression changes (as log2-transformed values) of miR-34a, miR-34c, miR-214, and miR-155 after stimulation of donor PBMCs with various concentrations of TLR ligands. [score:3]
Expression levels of miR-34c and miR-214 were assessed in conditioned media from stressed (hypoxia, serum starvation) cells. [score:3]
C: Fold changes in expression (as log-2-transformed RQ values) of hsa-miR-34c and hsa-miR-214 in donor PBMCs exposed to the indicated HCT116 necrotic lysates for 48 hrs. [score:3]
As observed previously with necrotic lysates, hsa-miR-214 expression increased in donor PBMCs exposed to both types of HCT116 lysate. [score:3]
Figure 1C shows the fold expression changes (as log 2-transformed values) for hsa-miR-34a, miR-34b, miR-34c, miR-214 and miR-155 under these conditions. [score:3]
To determine whether any PAMPs or TLR ligands are associated with miR-34c or miR-214 expression changes in donor PBMCs, we stimulated the cells with various PAMPS or known TLR ligands. [score:3]
One of the validated functional targets for miR214 is PTEN, a phosphatase and tensin homolog and a gene often deleted in many forms of cancer [19], [20]. [score:3]
Changes in miR-34c, miR-214 and miR-155 expression in PMBCs pre-incubated with 50 µM glybenclamide (Glyb) for 30 minutes before being exposed to conditioned media (MEF CM) for 48 hrs were used to assess the inflammasome pathway. [score:3]
Hsa-miR-214 expression clustered with other miRs (such as miR-10b and miR-125b) when donor PBMCs were exposed to both types of cell lysate (Figure 1A, middle panel). [score:3]
As shown in Fig. 5, both miR-34c and miR-214 were significantly expressed in cultures exposed to the conditioned media, compared to untreated cultures. [score:2]
From the microRNA profiling data, fold expression values (as log 2–transformed RQ values) for the statistically significant microRNAs (hsa-miR-34a, miR-34c, miR-214, and miR-155) were calculated for each donor after exposure to lysates or LPS (Figure 1B). [score:1]
This indicates that miR-214 may be a specific biomarker for internal tissue damage/injury. [score:1]
Using a Taqman microRNA profiling low-density PCR array we identified several microRNA genes, including miR-34c, miR-214, miR-210, miR-125b and miR-10b in human PBMCs, which are involved in the inflammatory response to damaged cells. [score:1]
Total mRNA was isolated from donor PBMCs and Taqman miR PCR was carried out for miR-34c, mir-214, miR-155 and the endogenous nucleolar control RNA, RNU48. [score:1]
Some of the other “DAMPmiRs” that clustered together with miR-214 include miR-125b and miR-10b, where the latter can be involved in metastasis [22], [23]. [score:1]
[1 to 20 of 36 sentences]
19
[+] score: 104
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
ACTH up-regulated the expression of miRNA-212, miRNA-182, miRNA-183, miRNA-132, and miRNA-96 and down-regulated the levels of miRNA-466b, miRNA-214, miRNA-503, and miRNA-27a. [score:9]
Real-time PCR (qRT-PCR) measurements demonstrated that ACTH treatment upregulated the expression of miRNA-212, miRNA-183, miRNA-182, miRNA-132 and miRNA-96, while down -regulating the expression of miRNA-466b, miRNA-214, miRNA-503 and miRNA-27a. [score:7]
Real-time quantitative PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats. [score:7]
The levels of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377, and miRNA-96 were up-regulated, whereas miR-125b, miRNA-200b, miR-122, miRNA-466b, miR-138, miRNA-214, miRNA-503 and miRNA27a were down-regulated in response to 17α-E2 treatment. [score:7]
qRT-PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats (Fig. 3 ). [score:7]
0078040.g006 Figure 6miRNA-132 and miRNA-214 binding sites in the 3′ UTR of the mouse SREBP-1c and LDLR genes mediate the downregulation of SREBP-1c and LDLR expression by miRNA-132 and miRNA-214, respectively. [score:6]
miRNA-132 and miRNA-214 binding sites in the 3′ UTR of the mouse SREBP-1c and LDLR genes mediate the downregulation of SREBP-1c and LDLR expression by miRNA-132 and miRNA-214, respectively. [score:6]
Bt [2]cAMP stimulation of granulosa cells caused down-regulation of a majority of miRNAs, including miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, miRNA-138 and miRNA-19a, but expression levels of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 were significantly increased. [score:6]
We also obtained evidence that miR-132 and miRNA-214 inhibit the expression of SREBP-1c and LDLR, respectively. [score:5]
Significant expression was also observed for miRNA-27a, miRNA-132 and miRNA-214, whereas very low expression was noted for all of the remaining (seven) miRNAs. [score:5]
miRNA-132 and miRNA-214 Suppress SREBP-1c and LDLR by Targeting Specific Site(s) within the 3′ UTR of SREBP-1c and LDLR, Respectively. [score:5]
qRT-PCR measurements indicated that exposure of primary rat granulosa cells to Bt [2]cAMP for 24 h inhibited the expression of miRNA-200b, miRNA-466b, miRNA-27a, miRNA-214, and miRNA-138 and miRNA-19a while enhancing the expression of miRNA-212, miRNA-183, miRNA-182, and miRNA-132 (Fig. 4 ). [score:5]
Significant ACTH -induced down-regulation of miRNA-466b, miRNA-214, miRNA-503 and miRNA-27a was also observed (Fig. 3 ). [score:4]
Here, we directly assessed the binding of miRNA-138, miRNA-132 and miRNA-182/miRNA-214 to the 3′UTR of StAR, SREBP-1c, and LDLR, respectively, and regulation of their expression levels, by carrying out luciferase reporter gene assays. [score:4]
More specifically, we assessed the impact of Bt [2]cAMP treatment on the expression of miRNA-212, miRNA-122, miRNA-27a, miRNA-466b, miRNA-200b, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96 and miRNA-19a. [score:3]
Overexpression of pre-miRNA-132 and pre-miRNA-214 significantly decreased the luciferase activity of the 3′UTR of the SREBP-1c and LDLR reporter containing micRNA-132 and miRNA-214 binding sites, respectively. [score:3]
The levels of expression of miRNA-212, miRNA-122, miRNA-138, miRNA-214, miRNA-183, miRNA-182, miRNA-132, miRNA-96, miRNA-466b, miRNA-200b, and miRNA-19a are shown. [score:3]
We next evaluated the effects of Bt [2]cAMP stimulation of rat ovarian granulosa cells and of mouse MLTC-1 Leydig tumor cells on the expression of twelve miRNAs (miRNA-212, miRNA-122, miRNA-183, miRNA-200b, miRNA-466b, miRNA-182, miRNA-96, miRNA-27a, miRNA-132, miRNA-214, miRNA-138 and miRNA-19a) whose adrenal expression was differentially altered in response to treatment of rats with ACTH, 17α-E2 or DEX. [score:3]
Overexpression of pre-miRNA-132 and pre-miRNA-214 significantly decreased the luciferase activity of the 3′UTR of the SREBP-1c and LDLR reporter containing micRNA-132 and miRNA-214 binding sites, respectively (Fig. 6 ). [score:3]
Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
CHO cells were co -transfected individually with StAR 3′-UTR (containing the putative site I or site II for miRNA-138 binding) ± pre-miRNA-138-5p (panel B), SREBP-1c 3′-UTR (containing the putative binding site for miRNA-132) ± pre-miRNA-132-3p, LDLR 3′-UTR (containing the putative binding site for miRNA-182), or LDLR 3′-UTR (containing the putative site I, site II or site III for miRNA-214 binding) ± pre-miRNA-214-3p for 36h, followed by determination of luciferase activities. [score:1]
Individual fragments of the 3′ UTR region of the StAR gene containing site I or site II binding site for miRNA-138-5p, the 3′-UTR of SREBP-1c containing a binding site for miRNA-132-5p, the 3′-UTR of LDLR containing a binding site for miRNA-182-5p or the 3′-UTR of LDLR containing site I, site II, or site III binding site for miRNA-214-3p were inserted downstream of the luciferase open reading frame of pMIR-REPORT vector. [score:1]
CHO cells were co -transfected individually with the StAR 3′-UTR (containing putative site I or site II for miRNA-138 binding) ± pre-miRNA-138-5p (panel B), the SREBP-1c 3′-UTR (containing putative binding site for miRNA-132) ± pre-miRNA-132-3p (panel C), the LDLR 3′-UTR (containing putative binding site for miRNA-182) (panel D), or the LDLR 3′-UTR (containing putative site I, site II or site III for miRNA-214 binding) ± pre-miRNA-214-3p for 36 h (panel E). [score:1]
0078040.g003 Figure 3Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
Seed sequences of the putative miRNA-138-5p, miRNA-132-3p and miRNA-182-5p/miRNA-214-3p binding sites in the 3′-UTR of mouse StAR, SREBP-1c and LDLR genes, respectively. [score:1]
[1 to 20 of 25 sentences]
20
[+] score: 53
Upregulated expression of miR-214 in tumors is linked to tumor progression and poor prognosis in OS and a proposed mechanism of action is that miR-214 promotes OS proliferation and invasion through direct suppression of leucine zipper, putative tumor suppressor 1 (LZTS1) 19, 20. [score:11]
At 14 weeks from injection and in the presence of tumor, miR-205-5p was significantly downregulated and miR-214 and miR-574-3p were upregulated. [score:7]
The miRNA pattern of expression remained similar to previous experiments with increased levels of mir-214, miR-335-5p, and miR-574-3p in the diseased state. [score:5]
MicroRNA 205-5p was decreased 2.68-fold (95% CI 2.17–2.89) in diseased mice compared to controls, whereas miR-214 and miR-335-5p were increased 2.37- (95% CI 1.81–2.93) and 2.69-fold (95% CI 2.12–3.26), respectively, in diseased mice. [score:4]
These reports corroborate our data that plasma miR-214 is associated with metastatic disease and can be used as both a diagnostic biomarker and a prognostic biomarker for patient outcome. [score:3]
Our studies revealed plasma miR-205-5p was downregulated in GEMM mice with OS compared to wild-type littermate controls, whereas levels of miR-214 and miR-335-5p were significantly higher in GEMM mice. [score:3]
Next, we further stratified all patients that presented with metastatic disease and noted that low plasma miR-214 levels could distinguish a subpopulation of patients with significantly enhanced overall survival (P = 0.008), Figure 5B. [score:3]
Three of the four miRNAs (miR-205-5p-5p, miR-214, and miR-335-5p) were validated in an independent set of diseased and wild-type mice to be statistically significant (P < 0.05) using a two-sample, two-tailed Student’s t-test comparing the 2 [−ΔCq] values of the two groups MicroRNA-574-3p was not statistically significant in final statistical analysis, but was included in simultaneous studies based on preliminary results (P =  0.15) (Fig. 1). [score:3]
The levels of miR-205-5p, miR-574-3p, and miR-214 were significant from baseline at the time of tumor development (14 week time point). [score:2]
We found that miR-214 levels differ significantly between metastatic and nonmetastatic patients (P = 0.016), suggesting an association between metastatic status and miR-214 levels. [score:1]
Four miRNAs (miR-205-5p-5p, miR-214, miR-335-5p, and miR-574-3p) were chosen as candidate miRNAs based on reports in published literature, the presence of a conserved known human homologue, and the fold change in the global qPCR analysis. [score:1]
As shown in Figure 5A, the areas under the curves (AUCs) were 0.70 (95% CI 0.576–0.827), 0.8 0(95% CI 0.699–0.909), 0.78 (95% CI 0.661–0.898), and 0.88 (95% CI 0.794–0.957) for miR-205-5p, miR-214, miR-335-5p, and miR-574-3p, respectively. [score:1]
Finally, we provide evidence that plasma miR-214, a member of the signature, has prognostic significance in human OS patient plasma samples. [score:1]
Therefore, we monitored the levels of miR-205-5p, miR-214, miR-335-5p, and miR-574-3p prior to and serially after transplantation of OS cells. [score:1]
Analysis of our metastatic cohort suggests that plasma miR-214 levels can identify this subpopulation, as the 20% of metastatic patients with low miR-214 levels are all presently alive. [score:1]
Data are now emerging on the importance of miR-214 in OS. [score:1]
While our study is the first report of plasma miR-205-5p, miR-214, miR-335-5p, and miR-574-3p to be used as biomarkers, the literature supports that each of these miRNAs may have an important biologic function in OS. [score:1]
Lastly, we have identified that low plasma levels of miR-214 in metastatic patients at time of diagnosis is associated with an excellent prognosis. [score:1]
This result needs to be repeated in a larger sample size with longer follow-up times, but plasma miR-214 could be the first biomarker identified that can discriminate which metastatic patients will have a good outcome with current therapeutic regimens. [score:1]
Areas under the curve (AUCs) were 0.70 (95% CI 0.576–0.827), 0.80 (95% CI 0.699–0.909), 0.78 (95% CI 0.661–0.898), and 0.88 (95% CI 0.794–0.957) for miR-205-5p, miR-214, miR-335-5p, and miR-574-3p, respectively. [score:1]
The ΔCq cut-points were 8.34 for miR-205-5p, 10.31 for miR-214, 9.78 for miR-335-5p and 6.08 for miR-574-3p. [score:1]
[1 to 20 of 21 sentences]
21
[+] score: 50
significantly decreased when the expression of up-regulated miR-214 was down-regulated (pooled MD = [4.88]; 95% confidence interval [CI]: [1.05]- [8.70]; p = 0.08; Figure 4, part 4) [34, 50]. [score:9]
This study showed that miR-214 was frequently up-regulated in OS specimens than noncancerous, and over -expression of miR-214 could promote OS cell proliferation, invasion and tumor growth in nude mice. [score:6]
significantly decreased when the expression of up-regulated miR-214 was recovered (pooled MD = [5.65]; 95% confidence interval [CI]: [3.23]- [8.07]; p = 0.72; Figure 9, part 5) [34, 50]. [score:6]
As we could see in Figure 9, the effects on inhibiting tumor volume were most significant when the aberrantly expressed miR-34a, miR-143 and miR-214 were corrected, and then followed by miR-195 and miR-133a Figure 9 SD, standard deviation; CI, confidence interval. [score:5]
As we could see in Figure 4A, the effect on inhibiting tumor weight was most significant when the aberrantly expressed oncogene miR-214 was corrected, and followed by rescuing miR-143, then miR-195 or miR-34a. [score:5]
As we could see in Figure 9, the effects on inhibiting tumor volume were most significant when the aberrantly expressed miR-34a, miR-143 and miR-214 were corrected, and then followed by miR-195 and miR-133a Figure 9 SD, standard deviation; CI, confidence interval. [score:5]
Once tumor weight and tumor volume both were taken into account, our results demonstrated that the anti-osteosarcoma effects were the best when miRNAs were infected into OS cells with lentivirus vectors, the up-regulated oncogene miR-214 was corrected or OS xenograft mo dels were produced by subcutaneous injection. [score:4]
The weight of miR-214 -overexpressing tumor was > 2-fold higher than that of the controls. [score:3]
This resulted 5 different miRNAs were analyzed, including 4 tumor suppressor miRNAs(miR-195, miR-143, miR-34a and miR-133) and 1oncogene(miR-214). [score:3]
This resulted 4 different miRNAs were anylyzed, including 3 tumor suppressor miRNAs(miR-195, miR-143 and miR-34a) and 1 oncogene(miR-214). [score:3]
The other study reported that miR-214 was infected into OS cells by lentivirus vectors [34]. [score:1]
[1 to 20 of 11 sentences]
22
[+] score: 45
Mir-214/mir-214* and mir-199a-5p/mir199a-3p are clustered on pri -mir-199a-2 within the Dnm3os gene in mouse as well as in human genome and were strongly upregulated by VPA (8.7/20.6- and 9.8/11.1-fold, respectively), while exposure to arsenite significantly reduced the expression of these miRNAs (−2.4/−1.97- and −2.4/−2.9-fold, respectively). [score:6]
In four independent differentiation procedures we could confirm the microarray data (Fig. 5A)–that is, a strong concentration -dependent induction of muscle-specific/abundant miRNA (mir-206, mir-10a, mir-214, mir-145, mir-143, mir-199a) and a significant downregulation of the expression of neuro-specific miRNAs (mir-124, mir-128, mir-137, mir-491, mir-383) in comparison to the solvent control. [score:6]
Mir-214 is expressed in C2C12 myoblasts and strongly induced in the course of differentiation where it regulates both proliferation and differentiation depending on the culturing conditions, probably by targeting negative regulators of MRFs [82]. [score:6]
The mir-214/mir-199a cluster is regulated during embryonic development by transcription factor Twist1 [77], [78], the expression of which was significantly induced by VPA in our cell system (2.2-fold). [score:5]
Moreover, mir-214, mir-145 and mir-199a were significantly downregulated in these cells. [score:4]
In situ hybridization of regulated miRNA may contribute to the understanding of the role of these miRNA in differentiated cells and clarify whether the expression of mir-214 is restricted to muscle cells or induced in neural cells as well. [score:4]
Comparing to the solvent control, in cells treated with VPA we observed a strong upregulation of myogenic miRNAs (myo- mirs: mir-206, mir-133a,b), or miRNAs shown to be involved in muscle differentiation and specification (mir-10a, mir-143/ mir-145 cluster, mir-214, mir-322, mir-199a). [score:4]
2009.08.008 [doi] 84 Liu J, Luo XJ, Xiong AW, Zhang ZD, Yue S, et al (2010) MicroRNA-214 promotes myogenic differentiation by facilitating exit from mitosis via down-regulation of proto-oncogene N-ras. [score:3]
Most regulated miRNAs shown in our study are highly conserved between mice and humans (e. g. mir-206, mir-214, mir-10a, mir-124, mir-137, mir-128, mir-9) [61], [62]. [score:2]
Furthermore, the histone methyltransferase Ezh2, a polycomb group protein, as well as N-Ras, both of which known repressors of skeletal myogenesis, were shown to be negatively regulated by mir-214 during muscle differentiation [83], [84]. [score:2]
Mir-214 was shown to specify muscle cell fate in the embryonic development of zebrafish by modulation of Hedgehog signaling during early segmentation stages [81]. [score:1]
Mir-214, mir-199a and mir-145 were also induced but not to such an extent as seen for VPA. [score:1]
Importantly, clustering of some miRNA genes within the genome is also conserved between human and mice (e. g. mir-206/mir-133b, mir-214/mir199a, mir-10a/HoxB4, mir-145/143 clusters, all of which have been studied here) (www. [score:1]
[1 to 20 of 13 sentences]
23
[+] score: 41
Irrespective of the cause of cardiac hypertrophy, the downregulation of miR-1 and upregulation of miR-214 seems to be implicated wi dely in murine cardiac disease, and in human cardiomyopathy. [score:9]
Seven miRNAs showed differential expression (Figure 1a, Figure S2a); miR-1 and miR-542-3p showed decreased expression, whereas miR-132, miR-214, miRNA-31, miR-210 and miR-10b showed increased expression. [score:7]
miR-214 was previously reported as the most strongly upregulated miRNA at end-stage human ischemic- and dilated cardiomyopathy, and following aortic stenosis, and may contribute to cardiac hypertrophy as overexpression in cardiomyocytes induces hypertrophic growth [6], [11]. [score:6]
We confirmed the upregulation of miR-214 and miR-132 during early-stage disease in DBL mice. [score:6]
These include miR-1, miR-133, miR-30 and miR-150 which often show reduced expression, and miR-21, miR-199 and miR-214 which often show increased expression [6], [7], [8], [9], [11], [12], and they may represent miRNAs with a central role in cardiac remo delling. [score:5]
miR-199a-3p, which is co-transcribed with miR-214, was also downregulated. [score:4]
The expression levels of miR-132 and miR-214, which were increased at age 10 days in the DBL mice, remained elevated at age 16 days. [score:3]
miR-31 recorded the highest fold change (3.38x) in DBL mice at age 16 days, followed by miR-34b-3p (3.35x), miR-146b (2.77x), miR-214 (2.57x), miR-142-3p (2.24x) and the cardiac stress responsive miR-21 (2.09x). [score:1]
[1 to 20 of 8 sentences]
24
[+] score: 38
Among the ten miRNAs validated by qRT-PCR, we found that mmu-miR-487b-5p, mmu-miR-709, mmu-miR-182-5p, mmu-miR-214-3p and mmu-miR-467a-3p were up-regulated in HCC-activated Tregs, mmu-miR-142-5p, mmu-miR-30b-5p, mmu-miR-409-3p and mmu-miR-129-5p were down-regulated (P < 0.01), while miR-344e-5p did not change significantly, as shown in Figure 1C. [score:7]
In control Tregs, mmu-miR-487b-5p, mmu-miR-214-3p, mmu-miR-30b-5p and mmu-miR-129-5p showed significant down-regulation while mmu-miR-409-3p showed significant up-regulation (Figure 2C, left). [score:7]
Compared with control Tregs, although mmu-miR-487b-5p and mmu-miR-129-5p showed similar down-regulation in HCC-activated Tregs, mmu-miR-409-3p was actually significantly down-regulated; mmu-miR-214-3p and mmu-miR-30b-5p did not exhibit significant changes (Figure 2C, right). [score:6]
Compared with the healthy controls, the expression levels of hsa-miR-182-5p, hsa-miR-214-3p, hsa-miR-129-5p and hsa-miR-30b-5p were significantly up-regulated in Tregs from HCC patients while the hsa-miR-409-3p and hsa-miR-142-5p did not show significant changes (Figure 3). [score:5]
Tregs from HCC patients and healthy controls finally confirmed the up-regulation of four miRNAs (hsa-miR-182-5p, hsa-miR-214-3p, hsa-miR-129-5p and hsa-miR-30b-5p). [score:4]
Interestingly, compared with data from the murine mo del, two of the four miRNAs (hsa-miR-182-5p and hsa-miR-214-3p) showed the similar up-regulation while the other two miRNAs (hsa-miR-129-5p and hsa-miR-30b-5p) showed reverse changes. [score:3]
indicated the four miRNAs (hsa-miR-182-5p, hsa-miR-214-3p, hsa-miR-129-5p and hsa-miR-30b-5p) targeted eight signaling pathways involved in Tregs. [score:3]
The functions of these four miRNAs (hsa-miR-182-5p, hsa-miR-214-3p, hsa-miR-129-5p and hsa-miR-30b-5p) in human Tregs are not clear. [score:1]
Two miRNAs (mmu-miR-214-3p and mmu-miR-30b-5p) were significantly changed only in control Tregs. [score:1]
As mmu-miR-155 and mmu-let-7i have been well documented in T cells [19, 24, 25], we observed that mmu-miR-487b-5p and mmu-miR-214-3p were classified into the same group with mmu-miR-155 and mmu-let-7i respectively after hierarchical clustering (data not shown). [score:1]
[1 to 20 of 10 sentences]
25
[+] score: 37
The quantitative PCR results confirmed the expression of two most upregulated (hsa-miR-361-5p and hsa-miR-214) and downregulated (hsa-miR-1225-5p and hsa-miR-148a) miRNAs in the same 35 GC pairs (Figure 1B). [score:9]
Upregulation of miR-214 is present in pancreatic, hepatoblastoma, gastric, osteosarcoma, esophageal, ovarian, bladder and melanoma cancer whereas its downregulation could be found in some other caner types including hepatocellular, cervical, breast, prostate cancer [40]. [score:7]
B. Validation of two most differentially upregulated (miR-214 and miR-361-5p) and downregulated (miR-148a and miR-1225-5p) miRNAs in tumor and corresponding nontumorous pairs used for microarray analysis. [score:7]
Two most upregulated (hsa-miR-361-5p and hsa-miR-214) and two most downregulated (hsa-miR-1225-5p and hsa-miR-148a) miRNAs were further validated using qRT-PCR in GC tissue pairs. [score:7]
The average mRNA expression levels in cancerous tissues were increased by 2.81- and 1.92-fold (p < 0.01 for both) for hsa-miR-361-5p and hsa-miR-214, but decreased by 4.76- and 6.25-fold (p < 0.01 for both) for hsa-miR-148a and hsa-miR-1225-5p relative to those in the adjacent normal tissues. [score:3]
These suggest that miR-214 may function as either a tumor suppressor or tumorigenic miRNA. [score:3]
The role of miR-214 in human cancers appears contradictory. [score:1]
[1 to 20 of 7 sentences]
26
[+] score: 32
The inhibitory nature of miRNA, through miR-214, may reflect a role in suppressing self-renewal and therefore promoting differentiation. [score:5]
Mesenchymal-specific expression of miR-214/ Dnm3os in the developing kidneyOne of the first steps to gain insights into the biological role of miRNAs is to determine tissue localization. [score:3]
Of these, miR-214 from the Dnm3os host gene provided the most reliable probe set expression profile. [score:3]
Mesenchymal-specific expression of miR-214/ Dnm3os in the developing kidney. [score:3]
Figure 4Mesenchyme-specific expression of host gene Dnm3os for miR-214. [score:3]
SISH validation of Dnm3os/miR-214 confirmed the interstitial mesenchyme specific expression profile but was also detected in the cap mesenchyme (Figure 4B and [GUDMAP:10816]). [score:3]
A: Affymetrix probeset 1427298_at directly overlaps miR-214. [score:2]
This gene may also be regulated by miR-214. [score:2]
miR-214 has also been shown to promote ES cell differentiation via the regulation polycomb group proteins [75] and by modulating Hedgehog signalling [76]. [score:2]
We focused on Affymetrix probesets that directly overlapped with the embedded miRNA, which lead to the identification of miR-214 from the Dnm3os transcript. [score:2]
This hypothesis aligns with the previously described role of miR-214 as a promoter of cellular differentiation of skeletal muscle cells. [score:1]
Of these probesets, three were co-incidentally positioned to overlap the embedded miRNAs within the primary transcript (let-7b:1440357_at; miR-425:1459927_at; miR-214: 1427298_at). [score:1]
Dnm3os ncRNA host gene for microRNAs, miR-199 and miR-214. [score:1]
Further validation will be required to determine which cellular population of the cap mesenchyme miR-214 is restricted to and whether it is distinct from the Six2 population. [score:1]
[1 to 20 of 14 sentences]
27
[+] score: 28
It was reported that miR-381 was up-regulated in mouse liver and acted as a hub regulators [30], miR-142-3p can suppresses the migration and invasion of HCC cells by regulating RAC1 [31], and miR-214 can suppress invasion, stem-like traits and recurrence of HCC through targeting beta-catenin pathway [32]. [score:12]
MiR-214 and miR-375 suppress the proliferation of HCC cells by directly targeting E2F3 and AEG-1 respectively [16, 17]. [score:6]
In this network, the top three significant miRNAs with most targets were miR-381-3p, miR-142a-3p, miR-214-3p, which may be the important regulatory factors in DEN HCC. [score:4]
Network analysis revealed that miRNAs such as miR-381-3p, miR-142a-3p, miR-214-3p and TFs such as Egr1, Atf3 and Klf4 are the hub regulators in HCC. [score:2]
From network analysis, miR-381-3p, miR-142a-3p, miR-214-3p and Egr1, Atf3, Klf4 were identified to be the most important regulators in HCC. [score:2]
Network analysis revealed that several miRNAs such as miR-381-3p, miR-142a-3p, miR-214-3p and TFs such as Egr1, Atf3 and Klf4 were the core regulators in HCC. [score:2]
[1 to 20 of 6 sentences]
28
[+] score: 23
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-210, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-16c, gga-mir-214, sma-let-7, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
In contrast, the miRNAs up-regulated in the liver (miR-199-3p, miR-199-5p, miR-21, miR-214 and miR-210) showed significantly higher levels in mouse serum at 12 weeks post infection (Fig. 2), however these failed to differentiate S. mansoni infected from uninfected humans (Fig. S4). [score:4]
As shown in Fig. 2, the levels of miR-192, miR-194 and miR-122 in serum do not change between 4–12 weeks post infection, whereas five of the miRNAs that are up-regulated in the liver are also significantly elevated in serum at 12 weeks post infection (p<0.05), ranging from 2.6 fold (miR-21) to 4.7 fold (miR-214) (Table S2). [score:4]
Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infectionBetween weeks 6 and 12, female parasites continue to produce ∼300 eggs per day [51], resulting in an increase in the number of granulomas in the liver and the development of fibrosis [45]. [score:4]
The miRNAs that displayed the largest differential expression included miR-199a and miR-214, which are known to be altered in liver fibrosis caused by hepatitis C infection or induced by carbon tetrachloride [47], [48]. [score:3]
Temporal expression analysis of miR-199, miR-214, miR-21, miR-210, miR-122, miR-192 and miR-194 in the liver during S. mansoni infection. [score:3]
Thirty-three mouse miRNAs were differentially expressed in infected compared to naïve mice (>2 fold change, p<0.05) including miR-199a-3p, miR-199a-5p, miR-214 and miR-21, which have previously been associated with liver fibrosis in other settings. [score:2]
Consistent with the array results, there was an increase in miR-199-5p, miR-199-3p, miR-214, miR-21, miR-210, and a reduction of miR-192, miR-194, miR-365, miR-122 and miR-151 in the liver tissue of S. mansoni infected mice as compared to naïve mice; miR-9 and miR-744 did not display differential expression and were not analysed further (Table 1). [score:2]
The 5 host miRNAs were detectable in serum (miR-21, miR-199-3p, miR-199-5p, miR-210, miR-214) but showed variable abundance and failed to differentiate ‘egg -positive’ and ‘egg -negative’ participants (Fig. S4). [score:1]
[1 to 20 of 8 sentences]
29
[+] score: 22
Interestingly, miR-214 reduced SDF-1α expression but did not inhibit the directional migration of MSCs (Figure S1). [score:6]
Interestingly, miR-1, miR136 and miR214 inhibited SDF-1α protein expression without affecting the luciferase activity of the p-MIR-Report-SDF-1α 3′UTR. [score:5]
miR-214 is a post-transcriptional regulator of AP-2α, a transcription factor (TF) that inhibits the cancer cell metastatic phenotype. [score:4]
The gene-specific primer pairs used to amplify specific target genes were as follows, and GenBank accession numbers also be included: mmu-miR-1(NR_029528.1): GSP, 5′-GGGGTGGAATGTAAAGAAGT-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; mmu-miR-136(AJ 459747.1): GSP, 5′-GGAACTCCATTTGTTTTGA-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; mmu-miR-214(NR_029796.1): GSP, 5′-GACAGCAGGCACAGACA-3′ and reverse, 5′-TGCGTGTCGTGGAGTC-3′; mmu-miR-23a (NR_029740.1): GSP, 5′-CCATCACATGCCAGG-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; mmu-miR-27a (NR_029746.1): GSP, 5′-GGGGTTCACAGTGGCTAA-3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; mmu-miR-27b(NR_029531.1): GSP, 5′-GGGGTTCACAGTGGCTAAG′ -3′ and reverse, 5′-CAGTGCGTGTCGTGGAGT-3′; U6(NM_001204274.1): forward, 5′-GCTTCGGCAGCACATATACTAAAAT-3′ and reverse, 5′-CGCTTCACGAATTTGCGTGTCAT-3′; VEGF (NC_000083.6): forward, 5′-GTCCAACTTCTGGGCTCTTCT-3′ and reverse, 5′-CCTTCTCTTCCCCTCTCT-3′. [score:2]
Because 47% of miRNA target sequences are located in the 3′UTRs of mRNAs, 47% of them in open reading frames (ORFs) and the rest in the 5′UTR [35]– [36], we speculate that miR-1, miR136 and miR214 may bind to the ORF or 5′UTR of SDF-1α, but confirmation require further investigation. [score:1]
Figure S1 The effects of miR-23a, miR-136, miR-1 and miR-214 on MSC migration. [score:1]
As shown in Figure 5A, miR-27b, miR-27a, miR-1, miR-136, and miR-214 reduced the level of SDF-1α protein. [score:1]
Lane 1, MSCs; lane 2, MSCs/cel-miR-67; lane 3, MSCs/miR-27b; lane 4, MSCs/miR-27a; lane 5, MSCs/miR-1; lane 6, MSCs/miR-23a; lane 7, MSCs/miR-136; lane 8, MSCs/miR-214. [score:1]
They were named LV-mmu-mir-1, LV-mmu-mir-136, LV-mmu-mir-214, LV-mmu-mir-23a, LV-mmu-mir-27a, LV-mmu-mir-27b, and LV-cel-mir-67 (the negative control). [score:1]
[1 to 20 of 9 sentences]
30
[+] score: 21
MiR-214 has also been shown to enhance neurite outgrowth and its expression is up regulated during the mouse cortical neuron, embryonic stem cells development, and at the early developmental stages in embryonic retina [87]– [88]. [score:5]
0112019.g007 Figure 7The fold upregulation of three miRNAs, miR-376a, miR-214 and miR-199a-3p, in the injury groups over the sham mice was validated using the individual real time PCR assays. [score:3]
Down regulated mir-106b and up regulated miR-376a and miR-214 along with other modulated miRNAs at the acute stage of injury, may reflect the metabolic active state of neural tissue engaged in the immediate response to injury that involve neuroprotection, synaptic plasticity, axonal damage/regeneration, and neurogenesis. [score:3]
The fold upregulation of three miRNAs, miR-376a, miR-214 and miR-199a-3p, in the injury groups over the sham mice was validated using the individual real time PCR assays. [score:3]
Eight of the significantly modulated miRNAs, miR-106b, miR-199a-3p, miR-214, miR-218, miR-31, miR-434-3p, miR-671-3p, and miR-574-3p were predicted to significantly modulate several nervous system function and disease related pathways. [score:3]
The expression profile of 3 out of 13 commonly modulated miRNAs, miR-199-3p, miR-214, and miR-376a that have been shown to be important in brain related processes and functions was also validated using the singleplex miRNA assay (Life Technologies, Carlsbad, CA) (Figure 7). [score:2]
Expression of miRNAs, miR-214, miR-376a and miR-199a-3p was validated using the singleplex miRNA assay (Life technologies, Carlsbad, CA; Assay# 002306, 001069 and 002304, respectively). [score:1]
However, miR-214 levels have been shown to decrease in the neurons of the dorsal root ganglion after an injury to the sciatic nerve [89]. [score:1]
[1 to 20 of 8 sentences]
31
[+] score: 21
On the other hand, up-regulation of miR-214 in the CR group was associated with down-regulation of mRNA levels of its known target genes, Ncx1 and Camk2d (P< 0.01 and P<0.02 respectively) in the hearts of CR as compared to AL mice (Panel B in Fig. B in S2 File). [score:8]
0130658.g006 Fig 6 (A) qPCR validation of selected miRs from the microRNA array showing significant down-regulation of miR-21 and miR-92a and significant up-regulation of miR-27, miR-29, miR-208 and miR-214 in CR compared to Ad lib. [score:6]
Of note, miR-214, which has previously been shown to reduce Ca [2+] overload -induced cardiomyocyte death in an ischemia-reperfusion injury mo del [33], was up-regulated in CR mice. [score:4]
In addition, miR-27, miR-29, miR-208 and miR-214 were significantly up-regulated in CR as compared to AL groups (+2.969±0.5318, P<0.05; +7.483±1.084, P<0.002; +2.483±0.9468, P<0.009; and +2.003±0.5865, P<0.02; fold change respectively, N = 3) (Fig 6A). [score:3]
[1 to 20 of 4 sentences]
32
[+] score: 20
Our data also show that mmu-miR-214-3p is highly predicted to target Pax7 and we propose that it may act as a negative regulator of myoblast proliferation in vivo by directly regulating the Pax7/Myod1 pathway. [score:6]
Supressing mmu-miR-214-3p expression maintains C2C12 myoblasts in an active cell cycle and inhibits myogenic differentiation [68]. [score:5]
b Box-plots of miRNA expression levels of mmu-miR-134-5p, mmu-miR-136-5p, mmu-miR-214-3p, mmu-miR-296-5p in mouse quadriceps muscle at 2 days, 2 weeks, 4 weeks and 12 weeks after birth. [score:3]
Mmu-miR-214-3p inhibits proliferation and promotes differentiation of the immortalized C2C12 mouse myogenic cell line in vitro [67]. [score:3]
In porcine skeletal muscle, the homologous ssc-miR-214-3p is highly expressed in the foetal stages (embryonic day 90) when compared with post-natal levels (post-partum day 120) [66]. [score:2]
The top-ranked miRNAs for cluster B were mmu-miR-134–5p, mmu-miR-136–5p, mmu-miR-214–3p and mmu-miR-295–5p. [score:1]
[1 to 20 of 6 sentences]
33
[+] score: 19
Right panel, the relative expression levels of miR-214, miR-433, and miR-524-5p were detected by the TaqMan miRNA expression array (normalized to RNU44 and RNU48) with the ratio of Malme-3 to Malme-3M. [score:5]
The expression of miR-214, miR-433, and miR-524-5p is suppressed in melanoma. [score:5]
Previous studies have reported that both miR-214 and miR-433 are associated with the MAPK/ERK pathway; miR-214 is the regulator of ERK1/2, and miR-433 is the regulator of Runx2 [28- 30]. [score:3]
We noted that only three miRNAs, miR-214, miR-433, and miR-524-5p, exhibited relative expression similar to that observed in our screen of Malme-3 versus Malme-3M cells (Figure 1A, right panel). [score:3]
Expression of miR-214, miR-433, and miR-524-5p is reduced in melanoma cells. [score:3]
[1 to 20 of 5 sentences]
34
[+] score: 19
We previously suggested that of the miRs analyzed, nine (miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194) stand out as being differentially expressed in C57BL/6 mice undergoing IRI compared to the expression observed in mice undergoing a sham procedure [14]. [score:4]
Our previous work showed that in C57BL/6 mice, expression of miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194 is significantly different between IRI and sham control groups at all times analyzed [14]. [score:3]
Shown is a three-dimensional plot of the first three PCs obtained by performing PCA on expression data for miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194 obtained for kidneys from C57BL/6 mice following IRI (blue line) or sham surgery (red lines). [score:3]
Shown is a three-dimensional plot of the first three PCs obtained by performing PCA on expression data for miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194 obtained for kidneys from C57BL/6 mice following IRI (blue line) or sham surgery (red lines) (Movie S3). [score:3]
Movie showing the rotation of a three-dimensional plot of the first three PCs obtained by performing PCA on all expression data obtained for kidneys from C57BL/6 mice following IRI (blue line) or sham surgery (red lines) in which we eliminated miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194 from the analysis. [score:3]
Panel C, Shown is a three-dimensional plot of the first three PCs obtained by performing PCA on all expression data obtained for kidneys from C57BL/6 mice following IRI (blue line) or sham surgery (red lines) in which we eliminated miR-21, miR-20a, miR-146a, miR-199a-3p, miR-214, miR-192, miR-187, miR-805 and miR-194 from the analysis. [score:3]
[1 to 20 of 6 sentences]
35
[+] score: 18
Among the up regulated miRNAs in STHdh [Q111]/Hdh [Q111] cells, expressions of miR-214, miR-299 and miR-335 were also up regulated in three of the four cell mo dels and expression of miR-199a was increased in two cell mo dels. [score:7]
The results given in Table S1 show that expressions of miR-100, miR-125b, miR-135a, miR-138, miR-150, miR-146a, miR-221 which were decreased in HD cell mo del [33] were also decreased in and the expressions of miR-127-3p and miR-214 were increased in both STHdh [Q111]/Hdh [Q111] cells [33] and the R6/2 mouse mo del. [score:5]
Other miRNAs which showed a consistent expression pattern across the mo dels were miR-100, miR-214, miR-299, miR-335, miR-34a and miR-148a. [score:3]
, miR-127 and miR-214) were increased and expressions of three miRNAs (viz. [score:3]
[1 to 20 of 4 sentences]
36
[+] score: 18
We demonstrate that overexpression of these HMGA1 pseudogenes increases HMGA1 protein levels, and inhibits the suppression of HMGA1 protein synthesis by miRNAs that target the HMGA1 gene, namely, miR-15, miR-16, miR-214, and miR-761 [31- 34]. [score:9]
Figure 2 HMGA1P6 and HMGA1P7 are targeted by HMGA1 -targeting miRNAs (A) qRT-PCR analysis of HMGA1P6 (left), HMGA1P7 (middle) and HMGA1 (right) mRNA from the MCF7 cells transfected with scrambled-oligonucleotide, miR-15, miR-16, miR-214 and miR-761. [score:5]
Within the high homology regions, we found perfectly conserved seed matches for miRNAs that have been predicted (miR-103, miR-142-3p, miR-370, and miR-432) or already demonstrated (miR-15 [31], miR-16 [31], miR-26a [32], miR-214 [33], miR-548c-3p [34] and miR-761 [33]) to target the HMGA1 gene (Figure 1B and 1C). [score:3]
Relative luciferase activity in HEK293 cells transiently transfected with miR-15, miR-16, miR-214, miR-761 and a control scrambled oligonucleotide. [score:1]
[1 to 20 of 4 sentences]
37
[+] score: 18
In the STHdhQ111/HdhQ111 striatal cell mo del of HD, exogenous expression of miR-214, miR-150, miR-146a, and miR-125b reduced mutant huntingtin expression and aggregation whereas mutations to these miRNAs prevented, and loss of function reversed, their effect [147]. [score:6]
Based on these findings, upregulation of miR-9, miR-9*, miR-22, miR-34b, miR-125b, miR-137, miR-146a, miR148a, miR-150, miR-196a, and miR-214 may have therapeutic potential against mutant HTT, REST, HDAC4, apoptosis, and other pathobiological factors in HD. [score:4]
HTT gene expression is regulated by miR-137, miR-148a, and miR-214, with HTT mRNA concentrations reduced by 40%–50% in HEK293T cells after transfection with each of these microRNAs [101]. [score:4]
These functional data support some (miR-22, miR-125b, miR-146a, miR-150) and contradict other (miR-34b, miR-148a, and miR-214) Table 2 miRNA targets. [score:3]
The effects of psychotropics on the other miRNAs listed in Table 2, particularly miR-9, miR-9*, miR-22, miR-34b, miR-125b, miR-137, miR-146a, miR148a, miR-150, miR-196a, and miR-214, as well as on REST, deserve study in HD mo dels. [score:1]
[1 to 20 of 5 sentences]
38
[+] score: 17
IPost up-regulated miR-1, miR-15b, miR-21, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-214, miR-208 and miR-499, while down-regulated miR-23a and miR-9 as compared with Sham group. [score:6]
Compared with sham group, the expressions of miR-1, miR-15b, miR-21, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-214, miR-208 and miR-499 were increased in IPost hearts, while miR-9 and miR-23a were down-regulated in IPost mo dels. [score:5]
Then real-time quantitative PCR was performed to quantify the expression level of miR-1, miR-9, miR-15b, miR-21, miR-23a, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-208, miR-214 and miR-499 with SYBR Green PCR Master Mix (Applied Biosystems) according to the manufacturer’s instructions. [score:3]
As previously reported, a collection of miRNAs were abnormally expressed in ischemic mouse hearts in response to I/R injury, such as miR-1, miR-9, miR-15b, miR-21, miR-23a, miR-24, miR-26a, miR-27, miR-133a, miR-199a, miR-208, miR-214 and miR-499 [20, 21, 28]. [score:3]
[1 to 20 of 4 sentences]
39
[+] score: 16
In fact, growing evidence of indirect p53 deregulation in MM through MDM2 overexpression, TP53 promoter hypermethylation and alterations in certain miRNAs that directly or indirectly affect p53 expression, such as miR-25, miR-30d, miR-125a-5p and miR-214, have been reported. [score:9]
In this regard, we have also demonstrated that miR-214 activates p53 by targeting PSMD10 that encodes the oncoprotein gankyrin, which negatively regulates p53 by enhancing its proteasomal degradation [118]. [score:4]
Specifically, using gain-of-function experiments and luciferase reporter assays we observed that ectopic transfection of miR-214 decreased the level of gankyrin protein by directly targeting PSMD10 3′-UTR. [score:3]
[1 to 20 of 3 sentences]
40
[+] score: 16
2015; 3. 19 Wang X, Guo B, Li Q, Peng J, Yang Z, Wang A, et al miR-214 targets ATF4 to inhibit bone formation. [score:5]
In fact, we found that miR-214 could also target both LRP5 and β-catenin, which might be the crucial reason why miR-214 strongly suppressed osteogenesis. [score:5]
miR-214 was reported to significantly inhibit bone formation [19]. [score:3]
Because miR-375-3p has these effects which are similar to miR-214, it might be a promising miRNAs inhibiting bone formation. [score:3]
[1 to 20 of 4 sentences]
41
[+] score: 15
Blocking TGF- β downstream signaling in rat epithelial cells decreased the expression of miR-21 and miR-214 and prevented TGF- β -induced EMT by increasing E-cadherin expression and decreasing α-SMA and collagen type I expression. [score:7]
TGF- β -induced overexpression of miR-21 and miR-214 in tubular epithelial cells caused epithelial-mesenchymal transition- (EMT-) like changes characterized by decreased E-cadherin expression and increased α-smooth muscle actin (α-SMA) and collagen type I expression. [score:5]
These results suggest that TGF-B -induced miR-21 and miR-214 expression may contribute to extracellular matrix production and mesangial proliferative glomerulonephritis [56]. [score:3]
[1 to 20 of 3 sentences]
42
[+] score: 14
Moreover, the following target proteins, involved in resistance to apoptosis were downregulated: BCL-XL, targeted by miR122, BCL-2, targeted by miR122 [36], and in less extent XBP-1, targeted by miR214 [37]. [score:12]
MVs released from DCR-Kd HLSC (MV DCR−), but not from CTR-A HLSC (MV CTR-A), showed a significant reduction of miR223, miR24, miR31, miR122, and miR214 as detected by qRT-PCR (Fig. 4B). [score:1]
Among miRNAs present in MV-HLSC [10], several ones were associated with potential antitumor activity, such as miR451, miR223, miR24, miR125b, miR31, miR214, and miR122. [score:1]
[1 to 20 of 3 sentences]
43
[+] score: 14
We demonstrate that HMGA1P7 overexpression increases H19 and Igf2 levels inhibiting their mRNA suppression by miRNAs that target HMGA1P7 gene, namely, miR-15, miR-16, miR-214, and miR-761. [score:9]
To this aim, we transfected miR-15, miR-16, miR-214 and miR-761 (already reported to target HMGA1P7) 17 into NIH3T3 cells, and analyzed H19 and Igf2 mRNA levels by qRT-PCR. [score:3]
The luciferase signal was considerably lower after transfection with miR-15, miR-16, miR-214 and miR-761 in comparison with the cells transfected with the scrambled oligonucleotide (Fig. 4B). [score:1]
Relative luciferase activity in HEK293 cells transiently transfected with miR-15, miR-16, miR-214, miR-761 and a control scrambled oligonucleotide. [score:1]
[1 to 20 of 4 sentences]
44
[+] score: 13
We observed several miRNAs that are significantly up-regulated in IL-4 stimulated primary microglia, including miR-145 and mir-214. [score:4]
Upon M2a-skewing of primary microglia we observed up-regulation in two miRNAs: miR-145 and miR-214. [score:4]
miR-214 has no known roles in either microglial or macrophage biology. [score:1]
However, Jindra, PT et al. reported a role for miR-214 in T cell proliferation [56], suggesting a similar function as miR-145. [score:1]
The association of miR-145 or miR-214 with the IL-4/STAT6 signaling pathway has never been reported in microglia. [score:1]
In IL-4 stimulated microglia we observed miR-145 as the most increased miRNA (2.66-fold) along with miR-297b-5p and miR-214 (all greater than 2.0-fold increase, p<0.05, Fig. 2E). [score:1]
Interestingly both miR-145 and miR-214 are anti-oncogenic miRNAs [51]– [54]. [score:1]
[1 to 20 of 7 sentences]
45
[+] score: 12
In fact, miR-222 has been found to be upregulated in 10 different myopathies: a study by Eisenberg et al. [31] reported that a large number of miRs were differentially expressed in various muscular pathologies and, that, in particular, the expression of five miRs (miR-146b, miR-221, miR-155, miR-214, miR-222) was altered in all the analyzed syndromes. [score:8]
Among these miRs, five (miR-146b, miR-221, miR-155, miR-214, and miR-222) were found to be consistently dysregulated in the different analyzed diseases [31]. [score:4]
[1 to 20 of 2 sentences]
46
[+] score: 11
As the hepatic stellate cells trans-differentiation into myofibroblasts has been regarded as a key event in liver fibrogenesis [44], it is reasonable to suggest that this miRNA could be a potential target of anti-fibrosis therapy if further investigation can confirm that the up-regulation of mmu-miR-214 indeed occurs in the HSCs. [score:4]
Our result here may also support this hypothesis, as mmu-miR-214 was up-regulated ∼4-fold in the liver of mice in the late infection of S. japonicum compared to that of normal mice. [score:3]
In addition, some other miRNAs previously reported to be associated with fibrosis, such as miR-34c, miR-199, and miR-214, also exhibited a peak expression in the liver of infected mice at 45 dpi (Table 2 and Figure 3). [score:3]
Recently, Iizuka et al. suggested that miR-214-5p may play crucial roles in the activation of stellate cells and the progression of liver fibrosis [43]. [score:1]
[1 to 20 of 4 sentences]
47
[+] score: 11
Wang X miR-214 targets ATF4 to inhibit bone formationNat. [score:5]
Next, this delivery system was used to target the delivery of the antagomir of miR-214 and acquired an anti-osteoporosis effect in both ovariectomized and hindlimb-unloaded mice [17]. [score:3]
Wang et al. first revealed that miR-214 inhibits osteoblast function in the hindlimb unloading (HU) mo del, which simulated the bone loss induced by microgravity [17]. [score:3]
[1 to 20 of 3 sentences]
48
[+] score: 10
Other miRNAs from this paper: mmu-mir-155, mmu-mir-182, mmu-mir-183
We found that miR-214 regulated ICAM-1 expression differentially in Cm infected wild type and IL-17A deficient mice and lead to significant differences in upper genital pathology [18]. [score:4]
Additionally, we have reported that miR-214, selected from our initial report [11], specifically regulates ICAM-1 in the Cm infected genital tract, and contributes to causation of upper genital pathology in wild type and IL-17A deficient mice [18]. [score:2]
We have demonstrated that miR -mediated modulation of host immunity in the genital tract (i. e., miR-214 regulates ICAM-1) contributes to upper genital pathology in Cm infected mice [18]. [score:2]
Additionally, we have recently reported the regulation of intracellular adhesion molecule (ICAM)-1 gene by miR-214 in Cm infected mice [18]. [score:2]
[1 to 20 of 4 sentences]
49
[+] score: 10
For example, miR-200a, miR-429 and miR-141 were shown to play important roles in neurogenesis, epithelial-to-mesenchymal transition and Notch signaling [73, 75– 84], miR-214 was found to be overexpressed in fetal sclera versus adult sclera and shown to play important role in brain and retina development and function [36, 85– 89], miR-18b, miR-21, miR-101a, miR-200a and miR-429 were found to be involved in stem cell function and differentiation [90– 100], miR-1306 negatively regulated Alzheimer’s disease gene ADAM10 [101]. [score:7]
Several miRNAs exhibited more than 10-fold change in expression in the myopic retina (Table 1), including mmu-miR-1947-5p (FC = 31.5, p = 1.47 × 10 [−04]), mmu-miR-200a-5p (FC = 18.8, p = 9.46 × 10 [−05]), mmu-miR-141-5p (FC = 13.9, p = 4.75 × 10 [−06]), mmu-miR-465b-5p (FC = 12.8, p = 5.93 × 10 [−04]), mmu-miR-214-5p (FC = 12.6, p = 8.27 × 10 [−03]), mmu-miR-1936 (FC = 12.3, p = 9.56 × 10 [−06]), mmu-miR-466f-5p (FC = 11.5, p = 3.85 × 10 [−03]), mmu-miR-669o-5p (FC = 10.9, p = 2.18 × 10 [−03]), mmu-miR-18b-5p (FC = 10.1, p = 1.79 × 10 [−03]), and mmu-miR-145-5p (FC = -10.5, p = 8.87 × 10 [−09]). [score:3]
[1 to 20 of 2 sentences]
50
[+] score: 10
Mature ID Fold Regulation miR-135b −2.6965 miR-363 −2.5995 miR-98 −2.543 miR-132 −2.355 miR-103 −2.1776 miR-99b −2.044 miR-135a −1.8734 let-7d −1.7861 miR-130a −1.6538 miR-152 −1.6246 miR-129-5p −1.6232 miR-298 −1.6169 miR-185 −1.6035 miR-214 −1.5746 miR-140 −1.5688 miR-134 −1.5667 miR-18b −1.5607 miR-194 −1.5509 let-7f −1.5107 miR-149 −1.51 A. Scatterplot showing relative expression of miRNAs by macroarray. [score:4]
Mature ID Fold Regulation miR-135b −2.6965 miR-363 −2.5995 miR-98 −2.543 miR-132 −2.355 miR-103 −2.1776 miR-99b −2.044 miR-135a −1.8734 let-7d −1.7861 miR-130a −1.6538 miR-152 −1.6246 miR-129-5p −1.6232 miR-298 −1.6169 miR-185 −1.6035 miR-214 −1.5746 miR-140 −1.5688 miR-134 −1.5667 miR-18b −1.5607 miR-194 −1.5509 let-7f −1.5107 miR-149 −1.51 Because miRNAs typically regulate translation in animal cells, we compared CXCL10 and STAT1 protein levels in both control and Dicer [d/d] animals and cells. [score:4]
This indicates that Stat1 mRNA could be controlled in a miRNA -dependent manner, and indeed, the miRanda algorithm predicts potential binding sites in its 3’ UTR for numerous miRNAs including miR-214, miR-194 and miR-140, which are listed in Table 2. An alternative hypothesis for differential gene expression in Dicer [d/d] splenocytes compared to wild-type could reside in a modification in the proportion of the cellular content if this organ. [score:2]
[1 to 20 of 3 sentences]
51
[+] score: 10
The transcription factor Twist-1 regulates expression of the miR-199a2/ miR-214 cluster during development of specific neural cell populations in mouse embryogenesis [32]. [score:5]
We demonstrated that PPAR-α agonists induced transcription of the miR-199a2/ miR-214 cluster leading to down-regulation of HIF-1α levels, manifested by significant decreases in HIF-1α -dependent gene transcription. [score:4]
The latter gene produces a long noncoding RNA, serving as pri-miRNA for miR-199a2 and miR-214, the transcription of which is subject to trans-activation by PPAR-α. [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 9
While the role of miRs (miR-214, miR-126) is known to contribute to endothelial diseases [36], the multifactorial etiology of hemophilic arthropathy is likely to involve other miRs) that further regulate the target molecules involved in arthropathy (VEGF-α, HIF-2α and MMP 3 and MMP 9). [score:6]
Heishima K. Mori T. Ichikawa Y. Sakai H. Kuranaga Y. Nakagawa T. Tanaka Y. Okamura Y. Masuzawa M. Sugito N. MicroRNA-214 and microRNA-126 are potential biomarkers for malignant endothelial proliferative diseases Int. [score:3]
[1 to 20 of 2 sentences]
53
[+] score: 9
For example, miR-214, which displayed up-regulation, could target ATF4, a positive transcription factor regulated osteoblast function, to inhibit bone formation [56]. [score:9]
[1 to 20 of 1 sentences]
54
[+] score: 9
MiR-214 targets ATF4 to inhibit bone formation. [score:4]
MicroRNA-214 suppresses gluconeogenesis by targeting activating transcriptional factor 4. J. Biol. [score:4]
MicroRNA-214 controls skin and hair follicle development by modulating the activity of the Wnt pathway. [score:1]
[1 to 20 of 3 sentences]
55
[+] score: 9
Other miRNAs from this paper: mmu-mir-185, mmu-mir-34a, mmu-mir-770, mmu-mir-421
[24] Overexpression of miR-214 in radiosensitive NSCLC cells protects against RT -induced apoptosis via downregulation of p38 kinase. [score:6]
[15] MiR-214 is upregulated in radio-resistant non-small cell lung cancer (NSCLC) cells relative to their radiosensitive counterparts. [score:3]
[1 to 20 of 2 sentences]
56
[+] score: 9
For instance, significant down-regulation of circRNA ITCH was discovered in lung cancer and up -regulating its expression could markedly elevate its parental cancer-suppressive gene ITCH through sponging oncogenic miR-7 and miR-214 [9]. [score:9]
[1 to 20 of 1 sentences]
57
[+] score: 8
Other miRNAs from this paper: mmu-mir-22, mmu-mir-675
While miR-214 suppresses gluconeogenesis by targeting ATF4 [42], miR-33b regulates gluconeogenesis by targeting PCK1 and G6PC [43]. [score:8]
[1 to 20 of 1 sentences]
58
[+] score: 8
MiRNA target site/Species Human Mouse Cow Dog Chicken FrogTargeting Twist2 miR-15b-3p + − + + − − − miR-33-5p + + + + − + − miR-137-3p + + + + − + − miR-145a-5p + + + + − − + miR-151-5p + + + + − + − miR-214-5p + + + + − − − miR-326-3p + + + + − − − miR-337-3p + + + + − + − miR-361-5p + + + + − − − miR-378a-5p + + + + − − − miR-381-3p + + + + − + − miR-409-3p + + + + − − − miR-450b-5p + + + + − + − miR-508-3p + + + + − − − miR-543-3p + + + + − − − miR-576-5p + + + + − − − miR-580 + + + + − − − miR-591 + + + + − − − MicroRNAs underlined were tested in this study. [score:5]
While this work was under revision, miR-214 [36], miR-300, miR-539 and miR-543 [37] have also been reported to target the TWIST1 3′UTR. [score:3]
[1 to 20 of 2 sentences]
59
[+] score: 8
In our study, we did not detect any significant effect of CR on miR-214 or miR-669c expression, suggesting that the expression of these two miRNAs is affected by aging but not by CR. [score:5]
The expression of miR-93, miR-214, and miR-669c [20- 21] in the mouse liver and miR-93 and miR-34a in the rat liver are significantly increased with age [20, 46]. [score:3]
[1 to 20 of 2 sentences]
60
[+] score: 8
For example, during SARS coronavirus infection process, miR-17 [∗], mir-574-5p, and miR-214, were up-regulated, and miR-98 and miR-223 were down regulated. [score:5]
Among these miRNAs, miR-17 [∗], mir-574-5p inhibited the replication of SARS coronavirus, whereas miR-214 contribute to immune escape of the bronchial alveolar stem cells (BASC) (Mallick et al., 2009). [score:3]
[1 to 20 of 2 sentences]
61
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
The analysis showed miRNAs that were related to ER stress pathway (let-7f, miR-351, miR-127, miR-133a, miR-195, miR-214 and miR-503), suggesting CASP3, CASP7, XBP1, ATF6 and ATF4 as possible target genes for these miRNAs (Table 4). [score:3]
Furthermore, the pathway analysis links a group of miRNAs that were differentially expressed in cbs [+/–] retina to oxidative stress pathway such as miR-205, miR-206, miR-217, miR-30, miR-27, miR-214 and miR-3473. [score:3]
Hcy also induces alteration of miRNAs related to tight junctions signaling such as miR-128, miR-132, miR-133, miR-195, miR-3473, miR-19, miR-200, miR-205, miR-214, miR-217, miR-23, miR-26, miR-29, miR-30, miR-31 AND miR-690. [score:1]
Other miRNAs were linked to the hypoxia signaling pathway, for instance, miR-205, miR-214, miR-217, miR-27, miR-29, miR-30 and miR-31. [score:1]
[1 to 20 of 4 sentences]
62
[+] score: 8
Chen et al. showed miR-214 inhibits apoptosis in pancreatic cancer tissues by downregulating ING4 expression [29]. [score:8]
[1 to 20 of 1 sentences]
63
[+] score: 7
miRNAs have been reported to be involved in regulation of angiogenesis through different mechanisms, including miR-214 reducing the secretion of the hepatoma-derived growth factor in human hepatoma [43], miR-221 regulating andiogenin and CXCL16 expression levels [44], and miR-29b reducing the expression of matrix metalloproteinase 2 [45]. [score:7]
[1 to 20 of 1 sentences]
64
[+] score: 7
of these, miR-21, miR-214, and miR-494 are upregulated in NSCLC. [score:4]
Several research reported that PTEN function as a target gene of miR-21 [28], miR-214 [29], miR-494 [30], miR-26a [31], miR-144 [32] and miR-153 [33]. [score:3]
[1 to 20 of 2 sentences]
65
[+] score: 7
Moreover, we detected some other documented oncogenic microRNAs including miR-9 and miR-19a, and tumor suppressing microRNAs including miR-28, miR-33a, miR-34a and miR-214, as well as their targets E-cadherin, PTEN, HoxB3, Pim, KIT and FGFR1, respectively [21– 26], to figure out the Res -induced microRNA expression profile. [score:7]
[1 to 20 of 1 sentences]
66
[+] score: 6
3) SM genes are indirectly and negatively controlled by SRF through SM miRNAs; we previously found that a large number of SM miRNAs, such as miR-143/miR-145 and miR-199a/miR-214, are SRF targets [26], and SM miRNAs target SM genes (see Table S5). [score:6]
[1 to 20 of 1 sentences]
67
[+] score: 6
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In a similar fashion, another highly differentially expressed miRNA (miR-214) which displays a highly complementary alignment within the 3′ UTR of MOBP mRNA demonstrates a decrease in OP cells then a sharp increase in OLs. [score:3]
MiR-214 also shows a ∼34-fold decrease from the OP1 to OP2 transition and has a strong evolutionarily conserved 8mer target site to Mobp, which is important for providing the proper structural properties of myelin. [score:2]
The key miRNAs discussed in this manuscript were validated by conducting real-time qRT-PCR for samples from the appropriate stages, including the following: miR-199a and miR-145 at the OP1, OP2, OP3, and OL stages; miR-214 at the OP1 and OP2 stages; miR-184 and miR-1183 at the GP and OP1 stages (Table 1 ). [score:1]
[1 to 20 of 3 sentences]
68
[+] score: 5
Other miRNAs from this paper: mmu-mir-665
[25] Polytarchou et al. [26] recently have found that miR-214 was overexpressed by IL-6/STAT3 signaling activation, and modulated the expressions of phosphatase and tensin homolog (PTEN), PDZ and LIM domain 2 (PDLIM2) and phosphorylation of AKT, which induced the activation of nuclear factor- κB (NF- κB). [score:5]
[1 to 20 of 1 sentences]
69
[+] score: 5
The top 5 miRNAs with the highest expression values were miR-19b, miR-125b, miR-17, miR-214 and miR-34b; miR-19b was most substantially expressed with a copy number of 11,333 per cell. [score:5]
[1 to 20 of 1 sentences]
70
[+] score: 5
Wang X. Guo B. Li Q. Peng J. Yang Z. Wang A. Li D. Hou Z. Lv K. Kan G. miR-214 targets atf4 to inhibit bone formation Nat. [score:5]
[1 to 20 of 1 sentences]
71
[+] score: 5
Other miRNAs from this paper: mmu-mir-205, hsa-mir-205, hsa-mir-214, hsa-mir-494, mmu-mir-494
But it is unclear whether and how these confirmed miRNAs such as miR-205, miR-494, miR-214 directly targeting PTEN co-regulate the PTEN/Akt pathway, further effects the DDP resistance and other biological function in a collaborative or antagonistic manner. [score:5]
[1 to 20 of 1 sentences]
72
[+] score: 5
Ectopic expression of miR-214 confers resistance to cisplatin in ovarian cancer cells by targeting PTEN [13]. [score:5]
[1 to 20 of 1 sentences]
73
[+] score: 4
Chen H. Shalom-Feuerstein R. Riley J. Zhang S. -D. Tucci P. Agostini M. Aberdam D. Knight R. A. Genchi G. Nicotera P. miR-7 and miR-214 are specifically expressed during neuroblastoma differentiation, cortical development and embryonic stem cells differentiation, and control neurite outgrowth in vitro Biochem. [score:4]
[1 to 20 of 1 sentences]
74
[+] score: 4
Among the miRNAs strongly down-regulated at all tested times were miR-199b-5p (decreased 70-fold), miR-214 (decreased 37-fold), and miR-143 (decreased 13-fold), known to promote differentiation of ESCs, neuroblasts, and smooth muscle progenitors, respectively [46], [47]. [score:4]
[1 to 20 of 1 sentences]
75
[+] score: 4
Levels of expression of Clu and Tgfb1 in teeth are markedly decreased following in vivo transfection with anti-mmu-miR-214 [23]. [score:3]
Using injections of anti-mmu-miR-214 into the mandible close to the developing first molar in newborn mice resulted in hypomineralization of the enamel with remnants of organic material and reduced surface roughness after acid etching [22]. [score:1]
[1 to 20 of 2 sentences]
76
[+] score: 4
Targeting the Wnt-regulatory protein CTNNBIP1 by microRNA-214 enhances the stemness and self-renewal of cancer stem-like cells in lung adenocarcinomas. [score:4]
[1 to 20 of 1 sentences]
77
[+] score: 4
Thus, p73, by increasing the expression of Ago-1/2, it could increase the processing of miRNAs, such as let-7 (HMGA2; lin-28; EGFR; Kras; c-myc; Bcl-xL), miR-134 (Nanog; LRH1; Oct-4; Collagenase-3; Stromelysin), miR-130b (ERK2; Fosl1; TGFβR1; ERα; Tcf-4; Collagenase-3; Ago4; Dicer; p63), miR-214 (EZH2; CTNNB1), miR-449a (CDK6; SirT1; HDAC1; E2F-1), miR-503 (CCND1; Fosl1), miR-181d (ERK2; TGFβR1; Tcl-1; ERα; AID; Bcl-2) and miR-379 (lin-28) [Figure 2] [31], [32]. [score:3]
The C-terminal NHL domain of TRIM-32 forms complex with Ago1, and thereby promotes the efficiency of processing of a number of miRNAs [Figure 2], including let-7, miR-134, miR-130, miR-214, 449, 379, 181, and miR-503 [31]. [score:1]
[1 to 20 of 2 sentences]
78
[+] score: 4
For example, Dnmos3, a non-coding RNA transcript which is processed into three microRNAs, miR-199a, miR-199a* and miR-214, is expressed from E9.5 in multiple locations and knockouts show reduced viability and skeletal defects, with shortened heads, osteopenia, and defects in the neural arch and spinous process [43]. [score:4]
[1 to 20 of 1 sentences]
79
[+] score: 4
In addition, miR-106a, miR-146, miR-155, miR-150, miR-17-3p, miR-191, miR-197, miR-192, miR-21, miR-203, miR-205, miR-210, miR-212, and miR-214 have been reported to be up-regulated in lung cancer [12]. [score:4]
[1 to 20 of 1 sentences]
80
[+] score: 4
For example, PTEN is down-regulated by miR-214 in ovarian cancer [59]. [score:4]
[1 to 20 of 1 sentences]
81
[+] score: 4
Other miRNAs from this paper: ssc-mir-214
MiR-214 inhibits cell growth in hepatocellular carcinoma through suppression of beta-catenin. [score:4]
[1 to 20 of 1 sentences]
82
[+] score: 4
The following TaqMan RT-PCR assays from Life Technologies were used to assess expression of mmu-miR-455, mmu-miR-574-3p, mmu-miR-448-5p, mmu-miR-45c-5p, mmu-miR-34c-3p, mmu-miR-204, mmu-miR-1839-3p, mmu-miR-153, mmu-miR-1983, mmu-miR-214 in mouse: 002455 (mmu-miR-455), 002349 (mmu-miR-574-3p), 464921_mat (mmu-miR-448-5p), 000428 (mmu-miR-45c-5p), 001197 (mmu-miR-204), 002584 (mmu-miR-34c*), 121203_mat (mmu-miR-1839-3p), 001191 (mmu-miR-153), 121204_mat (mmu-miR-1983), 002306 (mmu-miR-214) and 001973 (U6 snRNA). [score:2]
RT-PCR analysis was performed for miR-448, miR-34c, miR-34c*, miR-204, miR-1839-3p, miR-153, miR-1983, miR-214, miR-455, miR-574-3p. [score:1]
miR array profiling identified ten specific miRs that were altered (>1.5 fold, p < 0.05) by morphine (miR-204, miR-448, miR-455, miR-574, miR-34c, miR-34c*, miR-1839, miR-153, miR-1983 and miR-214) and RT-PCR analysis was performed for those ten miRs. [score:1]
[1 to 20 of 3 sentences]
83
[+] score: 4
Yuan Y MicroRNA-98 and microRNA-214 post-transcriptionally regulate enhancer of zeste homolog 2 and inhibit migration and invasion in human esophageal squamous cell carcinomaMol Cancer. [score:4]
[1 to 20 of 1 sentences]
84
[+] score: 4
Studies to examine the dose- and time- dependent regulation of miR-214 and miR-125a, by androgens, are ongoing in our laboratories. [score:2]
However, only two miRs, miR-214 and miR-125a, positively correlated with androgen action in prostate. [score:1]
Detection of miRs in serum miR-214 and miR-125a. [score:1]
[1 to 20 of 3 sentences]
85
[+] score: 4
Other miRNAs from this paper: hsa-mir-214
Furthermore, ovarian cancer cells have been shown to reprogram normal fibroblasts into becoming CAFs through the downregulation of miR-214, which increased the production of CCL5 and endowed fibroblasts with tumor-promoting properties (32). [score:4]
[1 to 20 of 1 sentences]
86
[+] score: 4
Many miRNAs, such as miR-1, miR-133, miR-29, miR-214, miR-206, miR-486, miR-208b, and miR-499 were involved in the regulation of skeletal myogenesis by binding to its target genes 36, 37. [score:4]
[1 to 20 of 1 sentences]
87
[+] score: 4
It has been reported that norcantharidin, a biosynthesized demethylated cantharidin, has anticancer effects by the regulation of M1 macrophage polarization via miR-214 expression [16]. [score:4]
[1 to 20 of 1 sentences]
88
[+] score: 4
MiR-27b, miR-214, miR-199a-3p, miR-182, miR-183, miR-200a, and miR-322 were found to be downregulated, whereas miR-705 and miR-1224 were increased after 4 weeks of alcohol feeding in mice [26]. [score:4]
[1 to 20 of 1 sentences]
89
[+] score: 3
However, the miR-214, -124, -132, -127-5p, -146b-5p, and -16-5p reported in other PD mo dels, were not found the different expression [26, 30, 54, 55, 57, 60]. [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-214, hsa-mir-200b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, hsa-mir-200c, mmu-mir-200c, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-200a, hsa-mir-130b, hsa-mir-376a-1, mmu-mir-376a, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, hsa-mir-429, mmu-mir-429, hsa-mir-450a-1, mmu-mir-450a-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-130b, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, hsa-mir-450a-2, dre-let-7j, hsa-mir-376a-2, mmu-mir-450a-2, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The most abundant miRs expressed in the developing mouse OE are: the miR-200-class (- 200a, - 200b, - 200c, - 141 and - 429), miR-199, miR-152, miR-214, miR-205, miR-183, miR-182 and miR-96 (Choi et al., 2008). [score:3]
[1 to 20 of 1 sentences]
91
[+] score: 3
Among those, let-7i, miR-146b, miR-152, miR-155, miR-214*, miR-299 and miR-411 are similarly regulated in differentiating MSCs, whereas miR-421, miR-702 and miR-703 were oppositely regulated in MSCs. [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
Sun et al. provided evidences and testified that osteoclasts secreted circulating miR-214 to inhibit osteoblast activity[18]. [score:3]
[1 to 20 of 1 sentences]
93
[+] score: 3
Other miRNAs from this paper: hsa-mir-214, hsa-mir-370, mmu-mir-370
Addition of a miR-370 mimic led to reduction of the luciferase activity of the SLD5 3′-UTR, whereas miR-214 as a negative control had no affect (Fig. 4C). [score:1]
We used the pRL-TK vector (Promega) for normalized values of reporter activity, and a miR-214 mimic was used as a negative control. [score:1]
miR-214 was used as a control. [score:1]
[1 to 20 of 3 sentences]
94
[+] score: 3
Three miRNAs associated with human basal-type tumors (miR-135b, miR-505 and miR-155), and seven miRNAs associated with human luminal type tumors (let-7a, let-7f, miR-100, miR-130a, miR-152, miR-214 and miR-29b) are similarly expressed in mouse basal-like and luminal-type tumors, respectively. [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 3
Specific examples illustrating these functions include the exon–intron circRNAs EIciEIF3J and EIciPAIP2, which were found to promote gene transcription [9], and cir-ITCH, which sponged three microRNAs (miR-7, miR-17, and miR-214) and thereby increased the levels of ITCH, an inhibitor of the Wnt/β-catenin signaling pathway [16]. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
Other miRNAs candidates including miR-214, clustered with miR-199a-2 on mouse chromosome 1 as well as other miRNAs that have been previously associated to fibrosis, including miR-221-222 and miR-449a [37], [38] also showed an enhanced expression in the lung fibrosis-susceptible mice. [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
Expression levels of five miRNAs [miR-23a (−1.52), miR-23b (−1.58), miR-34 (−1.78), miR-214 (−2.31), and miR-322 (−2.31)] were shown to be significantly decreased in Cmah -null mouse-derived livers by Liver miFinder microRNA PCR array analysis (Figure 3(d)). [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
Five miRNAs (miR-146b, miR-221, miR-155, miR-214 and miR-222) were consistently regulated in almost all samples that were examined [15], suggesting a possible involvement of common miRNA -mediated regulatory mechanisms in muscle disorders. [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
NC and miR-214 inhibitor (10 nmol) in 0.1 ml of saline buffer was administered intratumorally every 2 days for 4 weeks. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-140, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-191, mmu-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, mmu-mir-200c, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, mmu-mir-429, mmu-mir-449a, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, mmu-mir-449c, mmu-mir-449b, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-124b
By contrast, we identified 12 miRNAs corresponding to 9 families (miR-199, miR-140, miR-152, miR-214, miR-205, miR-200, miR-183, miR-182, miR-96) that displayed highly enriched expression in the olfactory system (Figure 1A). [score:3]
[1 to 20 of 1 sentences]