sort by

71 publications mentioning mmu-mir-218-2

Open access articles that are associated with the species Mus musculus and mention the gene name mir-218-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 258
Analysis of total RNA to determine the relative expression of miR218 targets through qRT-PCR in CSCs at 48 h after transfection using the mimic-control, miR218 mimic, inhibitor-control and miR218 inhibitor. [score:9]
For miR218 upregulation or knockdown, an miR218 mimic and inhibitor were synthesized as unconjugated and fully phosphorothioated mixed DNA oligonuleotides with a 6-carboxyfluorescein (FAM) moiety at the 5′ end (Shanghai GenePharma Co. [score:7]
To determine whether the regulation of cell proliferation and differentiation through miR218 is directly mediated by sFRP2, we transfected the miR218 inhibitor and sFRP2 shRNA into CSCs and examined sFRP2 expression levels through western blotting (Fig. 4A). [score:7]
Overexpression of the miR218 mimic decreased differentiation, whereas overexpression of the inhibitor increased differentiation, as reflected by TnI and α-MHC, two markers of myocardium maturation (Fig. 2E). [score:7]
We therefore examined the mRNA expression of each target in response to the miR218 mimic and the miR218 inhibitor. [score:7]
However, the expression of α-MHC was not detected on day 6. Similarly, the mRNA expression of α-MHC, β-MHC, and cardiac-α-actin was significantly decreased on days 3, 6, 9, 12 and 20 in the miR218 mimic group but was increased in the inhibitor group (Fig. 2F). [score:7]
results showed that treatment with the miR218 mimic increased endogenous Tcf-1 and Lef-1 expression, whereas treatment with the miR218 inhibitor decreased Tcf-1 and Lef-1 gene expression. [score:7]
However, the increase in miR218 expression was not sufficient to inhibit the differentiation of CSCs; additional miR218 expression was required to affect this biological process. [score:7]
We observed that miR218 was upregulated in proliferating and differentiating CSCs, but it promoted the proliferation and inhibited the differentiation of CSCs. [score:6]
The proliferation results also suggested that cells transfected with the combination of the miR218 inhibitor and sFRP2 shRNA (5.13% ± 0.30% and 9.59% ± 0.67%, respectively) showed higher proliferation than those treated with the miR218 inhibitor (1.77% ± 0.17% and 5.69 ± 0.33%, respectively) (Fig. 4B), whereas differentiation was restricted in the combined transfection group compared with miR218 inhibitor treatment. [score:6]
To determine whether miR218 directly regulates sFRP2, we performed dual luciferase reporter experiments and observed that the luciferase activity of sFRP2-WT was markedly reduced after transfection with the miR218 mimic for 24 h. However, single and double mutations partially or completely abolished the repression induced by miR218 (Fig. 3C), indicating that miR218 could specifically target the binding sites in the 3′ UTR of sFRP2. [score:6]
These results suggested that miR218 inhibited differentiation and that the Wnt signaling pathway may have been activated, thus leading to increased miR218 expression. [score:5]
The correlation between miR218 expression and the protein levels of the target genes was examined through Pearson’s correlation analysis. [score:5]
The putative target sites of miR218 were predicted by using TargetScan, microRNA and PicTar software. [score:5]
results showed that the expression of TnI and α-MHC was decreased in the miR218 mimic group and elevated in the inhibitor group. [score:5]
We subsequently detected β-catenin mRNA expression levels in response to transfection with the miR218 mimic and miR218 inhibitor (Fig. 5E). [score:5]
After transfection, miR218 expression levels were examined through qRT-PCR, which demonstrated that miR218 expression continued for 30 days (Fig. 2A). [score:5]
The expression of the remaining 8 miRNAs was assessed via qRT-PCR, revealing that the expression of miR218 was relatively higher in differentiating cells. [score:5]
Furthermore, in subsequent experiments, we found that the activation of canonical Wnt signaling paralleled the increasing expression of miR218, whereas when the cells were transfected with the miR218 mimic, differentiation was inhibited. [score:5]
The functional activity of miR218 was assessed in CSCs after forced expression of an miR218 mimic and an miR218 inhibitor. [score:5]
, Cambridge MA) was co -transfected with the mimic-control, miR-218 mimic, inhibitor-control and miR218 inhibitor, along with 5 ng of a Renilla LUC reporter plasmid using Oligofectamine (Invitrogen) in CSCs (60% confluency). [score:5]
To address the mechanism through which miR218 regulates cardiac differentiation, we examined the predicted targets of miR218. [score:4]
Illustration of the positive feedback loop between miR218 and Wnt signaling that constantly renews Wnt signaling through regulation of the Wnt inhibitor sFRP2. [score:4]
qRT-PCR analysis was performed to confirm the level of miR218 during cell proliferation and differentiation, and surprisingly, the levels of miR218 were shown to be upregulated (Fig. 1C,D), as were the levels of the pre-miRNAs miR218-1 and 218-2. Therefore, we selected miR218 for functional follow-up studies to examine the significance of this molecule for proliferation and differentiation in CSCs. [score:4]
Compared with that of the control group, the expression of TnI and α-MHC was reduced 0.5-fold in the miR218 mimic group and increased approximately 2-fold in the miR218 inhibitor group (Fig. 2G). [score:4]
miR218 subsequently downregulates the key Wnt signaling antagonist sFRP2, thereby potentiating Wnt signaling. [score:4]
After transfection, knockdown of β-catenin decreased miR218 expression (Fig. 7D). [score:4]
These results suggested that sFRP2 knockdown following miR218 inhibition reduced cell differentiation and promoted cell proliferation. [score:4]
Together, these results indicated that sFRP2 is a direct target of miR218 in CSCs. [score:4]
We also examined the protein expression levels of sFRP2 in response to miR218. [score:3]
The results showed that Wnt signaling activity was increased 3.1-fold in the miR218 mimic group and decreased 18% in the miR218 inhibitor group (Fig. 5C). [score:3]
We established that miR218 acted as a central regulatory node that optimized Wnt signaling, thus regulating myocardial proliferation and differentiation. [score:3]
These data confirmed that the effects of miR218 on cell proliferation and differentiation could be attributed to the target protein sFRP2. [score:3]
Western blot analysis revealed that the levels of β-catenin and the phosphorylated GSk3β protein in the Wnt signaling pathway were significantly increased by the miR218 mimic and decreased by the miR218 inhibitor during CSC differentiation (Fig. 5F). [score:3]
MiR218 regulates cell proliferation and differentiation through targeting sFRP2. [score:3]
MiR218 regulates cell proliferation and differentiation by targeting sFRP2. [score:3]
We observed that sFRP2 protein levels were significantly decreased by treatment with the miR218 mimic and increased by treatment with the miR218 inhibitor (Fig. 3D). [score:3]
To further confirm the effects of miR218 on CSCs through canonical Wnt signaling, we examined the proliferation and differentiation of CSCs after transfection with the miR218 mimic and treatment with 5 μM 6-Bromoindirubin-3′-oxime (BIO) (a Gsk3 inhibitor). [score:3]
Indeed, overexpression of the Wnt signaling pathway increased miR218, miR218-1 and miR218-2 levels by approximately 2.2-, 2.8- and 2.4-fold, respectively (Fig. 7B). [score:3]
The data obtained in the present study suggested that miR218 expression is negatively correlated with cardiomyocyte differentiation. [score:3]
Hence, the observed effect on the proliferation of miR218 might be associated with the Wnt signaling target Cyclin D1. [score:3]
SFRP2 is a validated target of miR218 in CSCs. [score:3]
The WT Wnt TOPflash reporter was transfected into CSCs together with the mimic-control, miR218 mimic, inhibitor-control and miR218 inhibitor for 24 h. Relative luciferase activity was measured and plotted. [score:3]
Similarly, BIO restored the differentiation of CSCs that was inhibited by the miR218 mimic (Fig. 6C). [score:3]
Interestingly, the increased miR218 expression in the differentiating cells did not promote the differentiation of CSCs. [score:3]
Therefore, these data showed that miR218 promotes cell proliferation and inhibits the cardiac differentiation of CSCs. [score:3]
SFRP2 is a target of miR218. [score:3]
We next examined the DNA context by using flow cytometry in miR218 mimic- and inhibitor -treated CSCs. [score:3]
Therefore, the miR218/Wnt-signaling axis defines a molecular network that promotes myocardial proliferation and inhibits differentiation. [score:3]
For cell cycle analysis, the cells were harvested at 48 h after transfection with the miR218 mimic or inhibitor, then washed twice with PBS and fixed in 75% ethanol overnight. [score:3]
Cyclin D1 was increased by the miR218 mimic and decreased by the inhibitor (Fig. 5G). [score:3]
Reintroduction of miR218 significantly promoted the proliferation and inhibited the differentiation of CSCs. [score:3]
mir218 and canonical Wnt signaling regulate CSC proliferation and differentiation through a variety of mechanisms. [score:2]
The EdU results showed that the miR218 mimic group was more proliferative (5.73% ± 0.66%) than the control group (3.52% ± 0.45%), whereas the inhibitor group (1.88% ± 0.32%) exhibited lower proliferation compared with the control group (Fig. 2C). [score:2]
For example, in acute and chronic lymphocytic leukemia, miR218 and miR-34a are considered to function as tumor suppressor miRNAs 25 26. [score:2]
How to cite this article: Wang, Y. et al. MiR218 Modulates Wnt Signaling in Mouse Cardiac Stem Cells by Promoting Proliferation and Inhibiting Differentiation through a Positive Feedback Loop. [score:2]
MiR218 promotes cell proliferation and inhibits cardiac differentiation. [score:2]
Thus, miR218 and Wnt signaling are coupled through a forward -positive feedback loop and together form a biological regulatory circuit. [score:2]
A Wnt-responsive was performed to confirm that Wnt signaling was involved in the effects of miR218 on CSC proliferation and differentiation. [score:1]
Here, we provided evidence of a novel positive feedback loop involving canonical Wnt signaling and miR218 that likely contributes to CSC differentiation and proliferation (Fig. 8). [score:1]
BIO restored the effects of miR218 on the proliferation and cardiac differentiation of CSCs. [score:1]
U6 was employed for miR218 template normalization. [score:1]
In the present study, we sought to examine whether miR218 affects cell proliferation and cardiac differentiation in CSCs. [score:1]
In recent years, miR218 has been implicated in the “fine-tuning” of Slit-Robo pathway genes and the generation of negative feedback in response to Slit gene activation 27. [score:1]
Instead, as miR218 levels increased in differentiating cells, the differentiation capacity of the CSCs gradually disappeared. [score:1]
Hassan et al. 29 have observed that miR-218 promotes the differentiation of osteoblasts and osteomimicry of metastatic cancer cells through a Wnt signaling circuit. [score:1]
Here, we focused on miR218 to determine whether this molecule could be used in vitro to modulate cardiomyocyte differentiation and proliferation. [score:1]
MiR218 is a positive regulator of canonical Wnt signaling. [score:1]
Moreover, Fish et al. 28 have indicated that miR218 and multiple Slit/Robo signaling components are required for heart tube formation in zebrafish, and this network modulates the previously unappreciated function of VEGF signaling during this process. [score:1]
Canonical Wnt signaling induces miR218 transcription. [score:1]
To identify the mechanisms associated with miR218 and Wnt signaling in cardiomyogenesis, we examined whether two transcriptional mediators of activated Wnt signaling, Tcf-1 and Lef-1, responded to miR218 (Fig. 5A,B). [score:1]
The data also showed that the miR218 mimic promoted G1 to S transition in CSCs. [score:1]
Notably, the role of miR218 in the differentiation of CSCs has not yet been studied. [score:1]
MiR218 is involved in the regulation of cell proliferation and differentiation. [score:1]
Zhang et al. 30 have also shown that miR-218 and Wnt/β-catenin signaling promotes osteogenic differentiation of human adipose tissue-derived stem cells. [score:1]
In summary, we provide evidence of a novel positive feedback loop involving canonical Wnt signaling and miR218 and likely contributing to human myocardial proliferation and differentiation. [score:1]
The miR218 binding site in the seed sequences within the 3′ UTR of sFRP2 mRNA is illustrated in Fig. 3B. [score:1]
[1 to 20 of 77 sentences]
2
[+] score: 246
Meanwhile, up-regulated miR-218 could enhance the expression of p-Akt, which can be inhibited by PI3K inhibitor, indicating that miR-218 might regulate the expression of HIF-1α and VEGF through PI3K/Akt pathway. [score:13]
Expression of miR-218 was significantly up-regulated in the IH group and was significantly inhibited when cells were transfected with miR-218 inhibitor. [score:10]
These results indicated that to silence Robo1 could enhance the expression of HIF-1α, indicating that miR-218 might regulate expression of HIF-1α targeting on Robo1. [score:8]
Studies show that miR-218 is frequently down-regulated in various cancers and acts as a tumor suppressor by targeting different proteins [13- 15]. [score:8]
The IH condition could significantly enhance their expression and when miR-218 was interrupted the over expression was apparently inhibited. [score:7]
Apoptosis assay showed that down regulation of miR-218 could inhibit intermittent hypoxia induced cell apoptosis, decrease expression of caspase-3 and bax and increase expression of bcl-2 under intermittent hypoxia condition. [score:7]
In IH cells transfected with miR-218 inhibitor, expression of Robo1 was significantly higher than normal IH cells and expression of HIF-1α was significantly lower than normal IH cells. [score:7]
showed that IH condition could significantly enhance the expression of both HIF-1α and VEGF compared with the normoxia cells, P<0.001, while down regulation of miR-218 significantly inhibited the increase of the two factors, P<0.001, indicating the regulating influence of miR-218 on HIF-1α and VEGF (Figure 2). [score:6]
However, when IH cells were treated with both miR-218 inhibitor and si-Robo1, expression of HIF-1α significantly increased compared with the cells only treated with miR-218 inhibitor, P<0.001 (Figure 6C). [score:6]
Down regulation of miR-218 reduced expression of caspase-3, bax and enhanced expression of bcl-2 under intermittent hypoxia. [score:6]
These results indicated that miR-218 might regulate expression of HIF-1α targeting on Robo1. [score:6]
showed that when IH cells were treated with both miR-218 inhibitor and si-Robo1, expression of HIF-1α significantly increased compared with the cells only treated with miR-218 inhibitor. [score:6]
Here we confirmed that in normal endothelial cells, Robo1 was significantly down regulated when cells were transfected with miR-218 mimic and was significantly up regulated when cells were transfected with miR-218 inhibitor, P<0.05 (Figure 6B). [score:5]
Inhibition of miR-218 could reduce the expression of HIF-1α and protect against IH -induced apoptosis in mice aortic endothelial cells. [score:5]
And when treated with miR-218 inhibitor, the interference significantly reduced its expression compared with the IH group, P<0.001, which showed successfully down regulation of miR-218 under IH (Figure 1). [score:5]
showed that down -expression of miR-218 could significantly reduce the expression of HIF-1α and protect against intermittent hypoxia -induced apoptosis in mice aortic endothelial cells targeting on Robo1, which needs further investigation to get deeper insights. [score:5]
In this study, we demonstrated that down -expression of miR-218 could reduce the expression of HIF-1α, VEGF and protect against intermittent hypoxia -induced apoptosis in normal mice aortic endothelial cells for the first time. [score:5]
showed that increased expression of miR-218 could also significantly induce the expression of HIF-1α and VEGF. [score:5]
In miR-218 interference group, expression of miR-218 was significantly reduced, while in intermittent hypoxia groups its expression increased significantly as expected. [score:5]
Besides, we used miRNA chip analysis and found that miR-218 was up-regulated during intermittent hypoxia in the previous study. [score:4]
Expression of HIF-1αin different group of cells, [*] P<0.05, compared with the miR-218 inhibitor group. [score:4]
However when LY294002 was added, the over expression effects of HIF-1α, VEGF and p-AKT induced by miR-218 were significantly inhibited compared with miR-128 mimic group, P<0.001. [score:4]
Combining with the alteration of apoptosis related proteins, we could deduce that down regulation of miR-218 could significantly inhibit the intermittent hypoxia -induced cell apoptosis. [score:4]
However, when miR-218 was down regulated, both of the above two effects were inhibited. [score:4]
However, when expression of miR-218 was interrupted, the above influence was significantly inhibited compared with the IH group, P<0.001,. [score:4]
showed that under IH condition, when treated with miR-218 mimic, the expression of HIF-1α and VEGF significantly increased compared with the negative control, P<0.001, which demonstrated that miR-218 could also increase the expression of the two factors (Figure 3A and 3B). [score:4]
PI3K/Akt pathway was involved in regulation of miR-218 on expression of HIF-1α and VEGF. [score:4]
Down regulation of miR-218 could reduce the expression of HIF-1α and VEGF under intermittent hypoxia condition. [score:4]
Then to further study the mechanism of the regulation effect of miR-218 on HIF-1α and VEGF, we used miR-218 mimic and PI3K inhibitor LY294002. [score:4]
Down regulation of miR-218 inhibited intermittent hypoxia induced cell apoptosis. [score:4]
These results indicated that miR-218 may regulate the expression of HIF-1α and VEGF through PI3K/Akt pathway. [score:4]
Down regulation of miR-218 significantly reduced expression of HIF-1α and VEGF under intermittent hypoxia. [score:4]
These results suggested that down regulation of miR-218 could affect expression of cell apoptosis proteins. [score:4]
Meanwhile, up regulating miR-218 could also enhance the expression of p-Akt (Figure 3B). [score:4]
Several studies have reported that Robo1 was one of the targets of miR-218 (Figure 6A) [18], but few of them demonstrated relationship of Robo1 and miR-218 in endothelial cells. [score:3]
Previous studies have shown that miR-218 could reduce HIF-2α through targeting multiple components such as EGFR, PLCγ1, PIK3C2A, and ARAF, but to our best knowledge, there are no studies focusing on relationship of miR-218 and intermittent hypoxia [22]. [score:3]
Anti-miR-218 inhibitor, miR -negative control and miR-218 mimic were used to tranfect the cells in different groups under IH condition. [score:3]
Cells in this section were divided into 4 different groups: the interference and negative groups, which were described above; the miR-218 mimic group, using miR-218 mimic to transfect cells; the miR-218 mimic and PI3K inhibitor group, which were transfected with miR-218 mimic and then treated with LY294002. [score:3]
Finally, we evaluated expression of Robo1 as possible target of miR-218. [score:3]
Figure 1Expression of miR-218 in different cell groups. [score:3]
Expression of Robo1 in different group of cells, [*]P<0.05, compared with the NC group, [#]P<0.05, compared with the miR-218 inhibitor group. [score:3]
MiR-218 negative control, miR-218 mimic and inhibitor were all purchased from RiboBio, Guangzhou, China. [score:3]
In conclusion, the present study determined the change of HIF-1α and VEGF when miR-218 was down regulated in mice aortic endothelial cells under intermittent hypoxia and studied the influence of down regulating miR-218 on intermittent hypoxia -induced cell apoptosis. [score:3]
All these results suggested that in endothelial cells miR-218 might also target on Robo1 under condition of hypoxia. [score:3]
First, cells were divided into 4 groups: cells transfected with anti-miR-218 inhibitor and incubated under intermittent hypoxia; the negative group, cells transfected with miR -negative control and incubated under intermittent hypoxia; the IH group, cells incubated under intermittent hypoxia; and the normoxia cells, cells cultured under normoxia. [score:3]
Expression of miR-218 in different cell groups. [score:3]
Several studies have reported that Robo1 was one of the targets of miR-218 [18], but few of them demonstrated relationship of Robo1 and miR-218 in endothelial cells. [score:3]
These results showed that miR-218 was closely related with expression of HIF-1α and VEGF. [score:3]
Expression of miR-218 was determined using RT-PCR in different cell groups. [score:3]
Cells were cultured to 30-50% confluence and transfected with miR-218 inhibitor, negative control, miR-218 mimic or si -RNA and si-Negative Control (all purchased from RiboBio, Guangzhou, China) (10 nmol/L) using Lipofectamine 2000 (Invitrogen) in serum-free Opti-MEM medium (Gibco) according to the manufacturer’s instruction. [score:3]
First we established a mo del of down regulated miR-218 in mice aortic endothelial cells under intermittent hypoxia condition and results showed the establishment was successful. [score:2]
Robo1 was involved in the regulation of miR-218 on HIF-1α in mice aortic endothelial cells. [score:2]
In cells transfected with miR-218 mimic, expression of HIF-1α and VEGF significantly increased compared with the control. [score:2]
In the present study, we used miR-218 mimic and PI3K inhibitor LY294002 to investigate the regulation mechanism of miR-218 on HIF-1α and VEGF. [score:2]
However, the role of miR-218 in IH has not been reported yet. [score:1]
MiR-218 is a vertebrate-specific intronic miRNA which attracted lots of attentions in recent years. [score:1]
Figure 6 (A) Conservation of the miR-218 binding site in Robo1, from ref [18]. [score:1]
are shown in Figure 5. When treated with miR-218 inhibitor, cell apoptosis rate significantly decreased compared with the IH group, P<0.001,, in which the apoptosis rate significantly increased compared with the blank, P<0.001,. [score:1]
To investigate the effects of miR-218 on expression of hypoxia-inducible factors 1α (HIF-1α), vascular endothelial growth factor (VEGF) and cell apoptosis in normal mice aortic endothelial cells under intermittent hypoxia (IH) condition. [score:1]
[1 to 20 of 59 sentences]
3
[+] score: 235
Although we do not know whether the slit2 is expressed in proepicardial cells, it is tempting to speculate that the up regulation of the Tbx5- miR-218 circuit might also impact the proepicardial cell migration by targeting robo1 or other cell migration regulators such as Semaphorins, some members of this large class of molecules being predicted targets of miR-218 (not shown). [score:9]
Tbx5 over -expression tripled slit2 expression, almost doubled miR-218 expression and had no effect on slit3 expression (Fig. 1C). [score:9]
To verify whether miR-218 over -expression can affect cardiac valve development, we analyzed the expression of the tie-2 gene, a member of the Tie family of tyrosine kinase receptors, which is expressed mainly in endothelial cells [31] and is up regulated during atrio-ventricular canal differentiation [32], [33]. [score:9]
Moreover, the transfection of a siRNA mix against Slit2 cut the level of Slit2 by half without affecting miR-218 expression, supporting the idea that miR-218 expression depends on the regulation of Slit2 transcription rather than on its translation. [score:8]
Interestingly, down-regulation of miR-218 is able to rescue most of the defects generated by Tbx5 over -expression, demonstrating the pivotal role of miR-218 in mediating the effects of Tbx5 dosage on heart development. [score:7]
slit3 expression was also analyzed since its host miRNA, miR-218-2, cannot be separately quantified because it is identical to miR-218-1. In agreement with the literature [19], we observed tight co -expression of slit2 and miR-218, and a general correlation among tbx5, slit2, slit3 and miR-218 expression (Fig. S2). [score:7]
To show that the slit/ miR-218 increase was at least partially dependent on Tbx5, tbx5 was up- or down-regulated by transfecting P19CL6 cells with a tbx5-carrying expression vector (CMV-Tbx5), or with a siRNA mix directed against tbx5, respectively. [score:7]
The knockdown efficiency of these morpholinos was confirmed by their ability to down-regulate mature miR-218 (Fig. S4A), and to rescue the phenotype caused by miR-218a over -expression (Fig. S4B). [score:7]
miR-218 and Robo1 are supposed to be upregulated and downregulated, respectively, when myocardial cell migration is about to end. [score:7]
Therefore it is likely that modulation of Tbx5 in general, and over -expression of miR-218 as a consequence of Tbx5 up-regulation in particular, might have a higher impact on CHD population than previously hypothesized. [score:6]
In this view, Tbx5 mis -expression by mRNA microinjection at the one-cell stage might speed up the up-regulation of miR-218 and reduce the migration of myocardial cells precociously, which in turn might affect heart morphogenesis by impairing the correct interaction between myocardial and endocardial cells. [score:6]
Tbx5 Over -expression can be Rescued by Down-regulation of miR-218. [score:6]
Therefore our data showing a migration delay of cmlc2 -positive cardiac precursors in embryos over -expressing miR-218 (Fig. 4), but not in embryos in which miR-218 was down-regulated by MO-218 injection (Fig. 4C), are in line with these findings. [score:6]
We confirmed a correlation between tbx5 and miR-218 expression and showed that alterations of miR-218 expression have a significant impact on zebrafish heart development. [score:6]
Down-regulation of miR-218 can rescue the defects generated by tbx5 over -expression. [score:6]
This hypothesis is supported by the observation that miR-218 down-regulation by MO-218a injection rescues the effects of Tbx5 over -expression (Fig. 6). [score:6]
We reasoned that if the phenotype induced by Tbx5 over -expression was due, at least in part, to increased expression of miR-218, the co-injection of MO-218 should rescue the Tbx5 gain of function phenotype. [score:5]
The apparent lack of phenotype that we observed after MO-218a injection (Fig. 2D,I) and the very low expression of miR-218 at early developmental stages, suggest that decreased miR-218a should not contribute to the phenotype generated by Tbx5 knockdown. [score:5]
This result strengthened our hypothesis that the effect of Tbx5 over -expression on heart development might, at least in part, be be mediated by miR-218. [score:4]
Overall, these observations suggest that Tbx5 over -expression affects heart and eye development and that this might be at least partially mediated by miR-218. [score:4]
miR-218 over -expression affects cardiac development. [score:4]
All together these data indicate that correct expression of miR-218 is crucial for proper cardiac development. [score:4]
Moreover, we showed that Tbx5 deregulation affects miR-218 expression. [score:4]
org); ii) the miR-218-1 host gene, slit2, is highly sensitive to Tbx5 mis -expression [8]; iii) the secreted Slit ligands, together with their Robo receptors, contribute to the control of oriented cell tissue growth during chamber morphogenesis of the mammalian heart [18]; iv) Slit/ miR-218/Robo are part of a regulatory loop required during heart tube formation in zebrafish [16]. [score:4]
This is inconsistent with both our data and with the results of Fish et al. [16] who observed that Robo1 knock-down generates the same phenotype, because the same authors also showed that Robo1 is targeted by miR-218. [score:4]
tbx5 and miR-218 are Co-expressed in Mouse Tissues and in Cardiomyocyte Differentiation of P19CL6 Cells. [score:3]
Even after injection of high miR-218 doses, cardia bifida was never observed, suggesting that miR-218 over -expression slows down but does not arrest the migration of cardiomyocytes to the midline. [score:3]
miR-218 has also been shown to affect cancer progression by inhibiting tumor cell migration and metastasis via the repression of the Slit2/Robo1 pathway in gastric [40] and in nasopharyngeal [39] tumors, respectively. [score:3]
Q-RT-PCR detection of pre-miR-218-1 and pre-miR-218-2 relative expression in P19CL6 cells during differentiation (A), or 48 h after plasmids or siRNA transfection (B). [score:3]
It is interesting to know that Pax2, that is negatively controlled by Tbx5 [45], is a predicted target of miR-218. [score:3]
robo1 has been identified as a target of miR-218 in many different organs and tissues [19], [39], [41]. [score:3]
miR-218 over -expression causes a delay in early heart field migration. [score:3]
On the other hand, tbx5 silencing, the effect of which was highest 2 days after silencing (6th day in culture, see ), caused significant reduction of slit2 and miR-218 expression 4 days after transfection (8th day in culture, Fig. 1D). [score:3]
tbx5 and miR-218 are co-expressed in cardiomyocyte differentiation of P19CL6 cells. [score:3]
miR-218 Over -expression Decreases the Migration of Myocardial Precursors. [score:3]
Pre-miRNA 218-1 expression paralleled the increase in miR-218 level during cardiomyocyte differentiation (Fig. S3A) and after Tbx5 modulation (Fig. S3B). [score:3]
Figure S7 miR-218 targets the 3′ UTR of robo1 in zebrafish embryos. [score:3]
B, qRT-PCR analysis of t bx5, slit2, slit3 and miR-218 relative expression in either expanding (GM) or differentiating (8,10,12 days) P19CL6 cells. [score:3]
Figure S2 tbx5 and miR-218 are co-expressed in mouse tissues. [score:3]
We showed a functional relation between Tbx5, Slit2 and miR-218 in P19CL6 cells in which a progressive increase of Tbx5, Slit2 and miR-218 expression was observed during cardiomyocyte differentiation. [score:3]
However miR-218b, an intergenic miRNA, has very low expression, suggesting that its contribution to the global miR-218 level might be irrelevant [16]. [score:3]
Figure S3 Expression of pre-miR-218-1 parallels that of mature miR-218 during mouse differentiation and tbx5 modulation. [score:3]
To demonstrate that the Tbx5/ miR-218 regulatory circuit is also functional during development, we used the zebrafish as a mo del system. [score:3]
A progressive increase in tbx5 expression was also observed (Fig. 1B), which was paralleled by an increase in slit2, slit3 and miR-218 transcripts. [score:3]
Figure S5 miR-218 dysregulation does not affect vascular integrity. [score:2]
To assess whether there are functional regulatory interactions among Tbx5, Slit2 and miR-218, we first examined these genes in an in vitro mo del for cardiomyocyte differentiation. [score:2]
In mice, it has been shown that miR-218 regulates vascular patterning by modulating Slit-Robo signaling [19]. [score:2]
In line with the hypothesis that miR-218 might be a Tbx5 effector, we demonstrated that miR-218a deregulation generates cardiac defects (Fig. 2A). [score:2]
Our data suggest that the haplo-insufficiency of the Tbx5 gene, at the moment the most significant cause of HOS, does not impact heart and upper limb formation through miR-218 misregulation. [score:2]
The simplest explanation for this might be that other key RNAs controlled by Tbx5 than miR-218 might be necessary for heart morphogenesis by regulating mechanisms other than myocardial cell migration. [score:2]
Our data show that miR-218 is part of a regulatory circuit through which Tbx5 controls heart morphogenesis. [score:2]
To analyze the role of miR-218 in heart development, we decided to use zebrafish since this mo del is particularly informative for studying cardiac early patterning networks due to its relatively simple two-chambered heart coupled with its ability to develop even in the absence of a functioning heart. [score:2]
We focused our attention on miR-218 since: i) it is conserved from human to zebrafish (www. [score:1]
The total numbers of embryos analyzed were as follows: Ct miRNA (1 ng) n = 293; miR-214 mimic (1 ng) n = 104; miR-492 mimic (1 ng) n = 103; miR-218 mimic (35 pg) n = 107; miR-218 mimic (135 pg) n = 180; miR-218 mimic (260 pg) n = 318; miR-218 mimic (2 ng) n = 180; MO-Ct (8 ng) n = 207; MO [D]-218 (12 ng) n = 323; MO [M]-218 (2 ng) n = 112; MO [M]-218 (4 ng) n = 165; MO [M]-218 (8 ng) n = 182. [score:1]
In zebrafish, as in mammals, two isoforms of miR-218, miR-218a-1 and miR-218a-2, are embedded in slit3 and slit2 genes, respectively. [score:1]
The authors showed that miR-218 -driven repression of Robo1/2 and of heparan sulfate proteoglycans (HSPGs), which are proteins essential for Slit/Robo signaling, negatively affects endothelial cell (EC) migration. [score:1]
At the moment we do not know how miR-218 might also partially rescue eye defects. [score:1]
Confocal images of representative 72 hpf Tg(flk1:eGFP) embryos injected with 260 pg of miR-Ct (A), 260 pg of miR-218 mimic (B) or 8 ng MO [D]-218 (C). [score:1]
A negative role of miR-218 on cell migration has been highlighted in different biological contexts. [score:1]
C, Q-RT-PCR detection of slit2 and mature miR-218 in P19CL6 cells transfected with a mix of two siRNAs against slit2 or with a siRNA-Ct. [score:1]
C,D, phenotypes induced at 72 hpf by increasing doses of miR-218 mimic (C) or MO [M]/MO [D]-218 (D) injection. [score:1]
The anti-DIG antibody-alkaline phosphatase Fab fragment was diluted 1∶4.000 in MABlock buffer (2% Blocking reagent in 100 mM Maleic acid and 150 mM NaCl) and incubation was performed at +4°C for gene probes and at room temperature for miR-218 probe. [score:1]
Whole mount in situ hybridization was performed as previously described [53] with some modification: pre-hybridization temperature was 62°C; hybridization temperature was 62°C for gene probes and 52°C for miR-218 probe. [score:1]
A-D, relative expression of tbx5, slit2, slit3 and miR-218 as evaluated by q-RT-PCR in different newborn mouse tissues. [score:1]
[1 to 20 of 64 sentences]
4
[+] score: 233
Other miRNAs from this paper: mmu-mir-191, mmu-mir-218-1
Furthermore, using 5-Aza-2′-deoxycytidine (5-AZA) to inhibit DNA methylation, we found that miR-218 expression was significantly (P < 0.05) increased in shGFP cells but not in ADAM9 knockdown cells (Fig. 2B), suggesting ADAM9 may inhibit miR-218 expression via DNA methylation. [score:10]
Although several reports have documented that up-regulation of CDCP1 expression was associated with disease progression in different human tumor types 20, our data are the first study to report that CDCP1 is regulated by miR-218, and hence provide a novel regulatory mechanism of miR-218 involved in the ADAM9-CDCP1 axis in lung adenocarcinoma. [score:10]
For example, miR-218 can suppress nasopharyngeal cancer progression through down-regulation of BIRC5 (survivin) and the SLIT2 (slit guidance ligand 2)-ROBO1 (roundabout guidance receptor 1) pathway 22. miR-218 may also target mTOR component RICTOR (Rictor) in oral cancer 23. [score:8]
Notably, the ectopic expression of miR-218 can act as a tumor suppressor by targeting genes related to proliferation, apoptosis, and invasion 17. [score:7]
Ectopic expression of CDCP1 lacking the 3′UTR increased CDCP1 protein expression and remained high level of CDCP1 with co -expression of pri-mir-218 (Fig. 4E). [score:7]
To further confirm that CDCP1 expression could be inhibited by miR-218, we inserted the primary mir-218 sequence behind the EGFP gene sequence and proved that miR-218 can be successfully expressed (Fig. 4A). [score:7]
To further demonstrate that the suppressed oncogenic properties of miR-218 directly through target CDCP1, western blot analysis and cell migration assays were performed in lung cancer F4 cells over -expressing pri-mir-218 and/or CDCP1 lacking 3′UTR (Fig. 4E,F). [score:7]
Consistent with the CDCP1 level, ectopic expression of CDCP1 lacking the 3′UTR increased cell migration and over -expression of miR-218 cannot inhibit the mobility of lung adenocarcinoma cells (Fig. 4F). [score:7]
Here we demonstrated that ADAM9 could inhibit the expression of miR-218 and that miR-218 can directly bind to the 3′-UTR of CDCP1. [score:6]
Down-regulation of miR-218 led to CDCP1 overexpression, which promoted malignancy of lung cancer cells. [score:6]
Overexpression of miR-218 inhibits tumor metastasis and increases survival in mice bearing brain-metastatic lung cancer cells. [score:5]
Thus, overexpression of miR-218 did inhibit oncogenetic ability in lung cancer cells, such as migration, anoikis resistance, and tumor sphere formation. [score:5]
How to cite this article: Chiu, K. -L. et al. ADAM9 enhances CDCP1 protein expression by suppressing miR-218 for lung tumor metastasis. [score:5]
To examine whether restoration of miR-218 would inhibit the tumorigenesis of cancer cells, we constructed an inducible tet-on plasmid to express pri-mir-218. [score:5]
Mutations of the miR-218 binding sites in the CDCP1 3′-UTR or mutations of the primary miR-218 sequence were made using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s protocol. [score:4]
Taken together, these results show that miR-218 expression is decreased in lung cancer cells and could be re -induced in ADAM9 knockdown lung cancer cells. [score:4]
The majority (80%) of tumor samples had lower expression levels of miR-218 as compared to their normal counterparts; seven tumor samples had less than half the miR-218 expression of their normal tissue counterparts (Fig. 2D). [score:4]
Furthermore, the WTA binding site seems to play a more important role than the WTC site in miR-218 regulation, because the suppressive effect of miR-218 in the WTA mutant is strongly reversed and consistently observed in three lung cancer cell lines (Fig. 3). [score:4]
The results showed that, regardless of the mutated sites, both mutations of miR-218 could relieve the suppression of luciferase activity (Fig. 3E). [score:4]
Of the miRNA candidates, miR-218 was selected after confirmation that its expression levels were significantly (P < 0.01) increased in ADAM9 knockdown cells using quantitative miR-RT-PCR (Fig. 2A). [score:4]
CDCP1 expression is regulated by miR-218. [score:4]
Taken together, our results demonstrate that miR-218 provides an antitumor effect in inhibiting brain metastases of lung tumors in mice. [score:3]
Induction of miR-218 inhibits tumor cell mobility, anchorage-free survival and tumor sphere formation. [score:3]
miR-218 directly regulates CDCP1. [score:3]
The expression of miR-218 is reduced in lung cancer cells. [score:3]
Also, it has been reported that miR-218 reduced self-renewal capacity in glioma stem-like cells by targeting stem cell promoting oncogene BMI1(BMI1 proto-oncogene, polycomb ring finger) 29. [score:3]
Lung cancer cells expressing doxycycline-inducible pri-mir-218 were generated by infecting Bm7brmx2 cells with a lentiviral tet-on-pri-mir-218 plasmid to generate stable cell lines, as previously described 16. [score:3]
As expected, luciferase activity did not decrease in cells treated with miR-218 antagomir alone or combination of miR-218 mimic and antagomir (Fig. 3F), indicating the fact that miR-218 targets CDCP1. [score:3]
Although there are three potential targeting sites in the 3′-UTR of CDCP1, in this study, we demonstrated that miR-218 can directly bind to two of them (1,840–1,860 bp and 2,951–2,971 bp, labeled as WTA and WTC in Fig. 3) using luciferase reporter assays. [score:3]
Restoration of miR-218 expression might be a new therapeutic strategy to prevent lung cancer cells metastasizing to brain. [score:3]
These studies support our findings that miR-218 indeed suppresses many oncogenic genes and has great anti-tumorigenic potential. [score:3]
CDCP1 is a target of miR-218. [score:3]
Lastly, we also examined the endogenous expression levels of miR-218 in 10 primary clinical lung tumor specimens. [score:3]
We mutated these binding sites to determine which binding sites were targeted by miR-218 (Fig. 3A). [score:3]
The protein levels of CDCP1 were decreased in miR-218 overexpressing cells (Fig. 4B). [score:3]
Induction of miR-218 inhibits tumor cell mobility, anchorage-free survival, and tumor sphere formation. [score:3]
Similar suppression of luciferase activity was found in cells transduced with pri-mir-218 or treated with miR-218 mimic (Fig. 3F). [score:3]
The mice were treated with doxycycline (2 mg) to induce miR-218 expression by intraperitoneal injection once a day for 9 days. [score:3]
Mutation sequences at these 3 miR-218 binding sites and miR-218 mutation at seed or non-seed sites are marked with red letters and underlines. [score:3]
The expression levels of miR-218 were detected 48 h after transfection. [score:3]
To explore whether miR-218 can bind and regulate CDCP1, we used miRSystem to predict binding sites of miR-218 in the CDCP1 3′ untranslated region (3′-UTR) and examined their interaction using luciferase assays. [score:3]
CDCP1 expression is modulated by miR-218. [score:3]
As shown in Fig. 5A, the expression levels of miR-218 were induced in the presence of doxycycline. [score:3]
Restoring the miR-218 levels in lung cancer cells provided an antitumor effect, as shown by reduction of anoikis resistance, suppression of tumor sphere formation, and decreased metastasis. [score:3]
The migration ability of lung cancer Bm7 cells transfected with miR-218 mimic was significantly inhibited (Fig. 4D). [score:3]
For instance, miR-218 is under-expressed in CD44 [+] prostate cancer cells 27, which are enriched in TICs 28. [score:3]
To further investigate mutations at site B, we mutated additional nucleotides at site B (MTBB) but still could not relieve the suppression of luciferase activity (Fig. 3D), suggesting site B was not a binding site for miR-218. [score:2]
By co-transfecting the miR-218 plasmids (construct shown in Fig. 4A) and the reporter construct, which contained the CDCP1 3′-UTR behind the luciferase gene, we showed that miR-218 was better able to inhibit the luciferase activity compared with the empty vector control in HEK 293 cells (Fig. 3B), A549 cells (Fig. 3C), and F4 cells (Fig. 3D). [score:2]
To further demonstrate that CDCP1 is the target of miR-218, miR-218 mimic and antagomir were applied in luciferase assays. [score:2]
In addition, mutations of miR-218 at the seed site or non-seed site were constructed to evaluate which region of miR-218 was essential for targeting CDCP1 (Fig. 3A). [score:2]
A schematic representation of the pri-mir-218 construct is shown at the top. [score:1]
The plasmid containing sequences of primary miR-218 was constructed as previously described 16. [score:1]
WT: wild-type; MTA, MTB, MTC: mutation at site A, B, or C, respectively; MTBB: extended length of mutant sequence at site B. (E) Luciferase assays of A549 cells co -transfected with pri-mir-218 wild-type or mutants, the firefly luciferase construct of CDCP1 3′-UTR, and the Renilla luciferase control. [score:1]
Bm7brmx2 cells with lentiviral tetracycline-inducible pri-mir-218 plasmid were injected intracardially into SCID mice. [score:1]
Consistent with these findings, we demonstrated that miR-218 influences TIC formation in lung cancer. [score:1]
To examine whether invasion ability was correlated with the levels of miR-218, we examined the endogenous levels of miR-218 in three lung cancer cells with progressive invasion ability (Bm7brm >F4 >CL1-0). [score:1]
Conversely, when lung cancer cells were treated with miR-218 antagomirs, levels of miR-218 were decreased (Fig. 4G), but the amount of CDCP1 protein was increased in lung cancer cells at 48 h after miR-218 antagomirs transfection (Fig. 4H). [score:1]
Three miR-218 binding sites were predicted in the CDCP1 3′-UTR using miRSystem 19, located at 1,840–1,860 bp, 2,100–2,119 bp, and 2,951–2,971 bp relative to the transcription start site. [score:1]
Recently, miR-218 attracts scientists’ attention due to significant repression in several kinds of cancer tissues and correlation with poor prognosis 17. [score:1]
In addition, the migration ability of lung cancer F4 cells transfected with miR-218 antagomirs was significantly increased (Fig. 4I). [score:1]
N = 9 in the negative control (Neg) group and N = 7 in the pri-mir-218 group. [score:1]
A549 and H1299 cells were administered 50 nM of miR-218 mimic. [score:1]
Three potential miR-218 binding sites are located at 1,840–1,860 bp (site WTA), 2,100–2,119 bp (site WTB), and 2,951–2,971 bp (site WTC) from the transcription start site of CDCP1. [score:1]
The levels of miR-218 were decreased as the invasion ability of lung cancer cell lines increased (Fig. 2C). [score:1]
Quantitation of miR-218 was performed as previously described 16. [score:1]
Taken together, these results showed that miR-218 can bind to the 3′-UTR of CDCP1 at two sites. [score:1]
Also, we used another xenograft animal mo del to determine the therapeutic effect of miR-218 plasmids. [score:1]
One day after tumor inoculation, tumor-bearing mice were treated with systemic delivery of liposomal DNA complex containing pri-mir-218 twice a week for 3 weeks. [score:1]
ADAM9 and CDCP1 are positively correlated (R = 0.44), whereas miR-218 negatively correlated with ADAM9 (R = −0.01) and CDCP1 (R = −0.27). [score:1]
A similar observation was found in lung cancer cells transfected with miR-218 mimic oligomers (Fig. 4C). [score:1]
Arrows indicate the time points of pri-mir-218-liposome therapy. [score:1]
miR-218 reduces lung cancer metastasis and improves animal survival. [score:1]
To further evaluate the antitumor effects of miR-218 in vivo, we established a metastatic lung tumor animal mo del by intracardially inoculating human lung cancer cells, Bm7brmx2 with inducible expression of pri-mir-218, into severe combined immunodeficiency (SCID) mice. [score:1]
Thus, miR-218 could be used as a therapeutic agent for lung cancer. [score:1]
In addition, the tumor-initiating cell (TIC) formation (Fig. 5E) and sphere size (Fig. 5F) were significantly reduced in miR-218 induced cells. [score:1]
Interestingly, the WTA binding site (1,840–1,860 bp) exists only in primates and the WTC binding site (2,951–2,971 bp) contains evolutionarily conserved binding sites for miR-218 in mice. [score:1]
Starting one day after cancer cell injection, tumor bearing mice were treated with 25 μg of pri-mir-218-liposome complexes by i. v. injection twice a week for 3 weeks. [score:1]
[1 to 20 of 77 sentences]
5
[+] score: 156
Other miRNAs from this paper: mmu-mir-21a, mmu-mir-218-1, mmu-mir-21b, mmu-mir-21c
The upregulation of miR-218 (Figure 7B) and downregulation of Bmi1 (Figure 7C) were confirmed by real-time RT-PCR and western blotting analysis, respectively. [score:7]
Most importantly, previous study showed that miR-218 expression is significantly upregulated by Andro pretreatment in human alveolar epithelial A549 cells with reduced inflammatory response and oxidative stress [32]. [score:6]
Taken together, these results demonstrated that miR-218 -induced downregulation of Bmi1 suppressed self-renewal, tumor cell motility and invasion in OSCC cells. [score:6]
Figure 7(A) Quantification of tumor volume changes following administration of Andrographolide; (B) relative miR-218 expression and (C) Bmi1 expression in the excised tumors. [score:5]
In particular, it has been found that miR-218 acts as a tumor suppressor by targeting many oncogenes related to proliferation [24], apoptosis [25] and invasion [26]. [score:5]
Most importantly, overexpression of miR-218 significantly suppressed the radio-resistance (Figure 5F). [score:5]
Following identification of Bmi1 as the potential target of miR-218 through Target Scan program, we constructed reporter plasmids containing either full-length or mutated forms of the 3′UTR region of Bmi1 (Figure 5B). [score:5]
To our knowledge, this is the first report demonstrating miR-218 expression is crucial for maintaining metastasis of OSCC via targeting Bmi1. [score:5]
In conclusion, our data indicate that andrographolide can inhibit oncogenic properties of OCSCs through activation of miR-218 -targeting Bmi1. [score:5]
Consistent with the previous studies, we showed knockdown of miR-218 expression in non-CSCs induced self-renewal, tumor cell motility and invasion in OSCC, while knockdown of Bmi1 effectively reversed these phenomena (Figure 5). [score:5]
The luciferase activity was assessed and presented as relative units to Mock -treated cells; (D) mRNA expression of miR-218 and (E) protein expression of Bmi1 in OCSCs transfected with pLV-miR-scrambled (pLV-miR-Scr. ) [score:5]
Overexpression of miR-218 significantly suppressed self-renewal ability (Supplementary Figure S1A) and nvasion capacity (Supplementary Figure S1B) in OCSCs. [score:5]
Additionally, several studies have reported that suppression of miR-218 resulted in increased invasive ability of gastric cancer [43], glioma [44] or pancreatic ductal adenocarcinoma cells [45], whereas restoration of miR-218 led to significant inhibition of cell migration and invasion in OSCC [46], cervical squamous cell carcinoma [42] and renal carcinoma cells [47]. [score:5]
miR-218 is a vertebrate-specific intronic miRNA coexpressed with its host genes, tumor suppressor gene SLIT2/3. [score:5]
miR-218 suppresses cancer stemness and invasiveness by targeting Bmi1. [score:5]
Andrographolide increases the expression of tumor suppressive miR-218. [score:5]
Overexpression of miR-218 was shown to inhibit lung cancer metastasis in tumor bearing mice [32, 42]. [score:5]
Several studies have shown that miR-218 is significantly downregulated in colorectal cancer [28], breast cancer [29], clear cell renal cell carcinoma [30], supporting miR-218 as a key factor in human tumorigenesis. [score:4]
Identification of Bmi18 as a direct target of miR-218 in OCSCs. [score:4]
First, the elevated expression of Bmi1 in non-CSCs treated with miR-218 knockdown sponge (Spg-miR-218) was verified by western blotting (Figure 6A). [score:4]
Among various factors regulating metastasis properties, miR-218 has been recently identified as a metastasis suppressor. [score:4]
It was found that miR-218 was dramatically downregulated in metastatic prostate [41] and cervical cancer cells [32]. [score:4]
In the current study, we found delivery of andrographolide caused a dose -dependent increase in the level of miR-218 expression using real-time RT-PCR analysis (Figure 5A). [score:3]
Furthermore, we exogenously overexpressed miR-218 in OCSCs and the efficiency was validated by real-time RT-PCR analysis (Figure 5D). [score:3]
In accordance with the previous finding, the protein level of Bmi1 was decreased in the miR-218 -overexpressing OCSCs (Figure 5E). [score:3]
The role of Bmi1 in the miR-218 -mediated inhibition of cancer stemness was further clarified. [score:3]
In addition, our results indicated that miR-218 may play a pivotal role in the anti-CSCs property of andrographolide by targeting Bmi1. [score:3]
In the present study, we demonstrated the role of Bmi1 in the miR-218 -mediated inhibition of cancer stemness and invasiveness. [score:3]
Figure 6(A) Protein expression of Bmi1, (B) sphere formation, (C) wound-healing and (D) invasion ability in ALDH1 [−]CD44 [−] non cancer stem cells (non-CSC) transfected with Spg-Ctl, Spg-miR-218, sh-Luc or sh-Bmi1. [score:3]
Involvement of Bmi1 in tumor suppressive function of miR-218. [score:3]
Administration of andrographolide exerts an inhibitory effect on tumor growth in vivo through miR-218 activation. [score:3]
Administration of andrographolide exerts an inhibitory effect on tumor growth in vivo through miR-218 activationTo validate the efficacy of andrographolide -mediated anti-tumorigenic function in vivo, immunocompromised mice bearing OCSC xenografts received andrographolide treatment or vehicle (water) by oral gavage. [score:3]
Figure 5(A) miR-218 expression in andrographolide -treated OCSCs; (B) Schematic representation of the constructed Bmi1 3′UTR reporter plasmids; (C) The wild-type or mutant form of Bmi1 reporter was co -transfected with miR-218 or empty vector (Mock) into OCSCs. [score:3]
Future research should thoroughly explore the miR-218/Bmi1 axis in regulation of EMT in OSCC. [score:2]
We showed that silencing of endogenous miR-218 induced sphere-forming capability in non-CSCs, which was abolished by knockdown of Bmi1 (Figure 6B). [score:2]
Luciferase reporter assay showed that miR-218 decreased the luciferase activity of reporter plasmids containing full-length Bmi1 3′UTR and this phenomenon was not observed in mutant form (Figure 5C), confirming Bmi1 as a target of miR-218 in OCSCs. [score:2]
For example, miR-218 attenuates self-renewal in glioma stem-like cells [31]. [score:1]
The mature form of miR-218 is generated from two separate loci, miR-218-1 and miR-218-2, which are located on chromosomes 4p15.31 and 5q35.1 within the introns of SLIT2 and SLIT3, respectively [27]. [score:1]
Also, wound-healing (Figure 6C) and invasion (Figure 6D) abilities were increased in Spg-miR-218 -treated non-CSCs, and silencing of Bmi1 counteracted these responses (Figure 6C–6D). [score:1]
or pLV-miR-218; (F) Survival fraction of pLV-miR-Scr or pLV-miR-218 -treated OCSCs after various doses of radiation. [score:1]
miR-218 Sponge. [score:1]
After 20 days, the animals were euthanized, and the primary tumors were weighed and for miR-218/Bmi1 analysis. [score:1]
Consequently, it is imperative to elucidate the relationship between Andro and miR-218 in eliciting anti-OSCC activity. [score:1]
Oligos for miR-218 sponge, and scramble construction were constructed using a pcDNA 6.2-GW/EmGFP-miR plasmid (Invitrogen). [score:1]
[1 to 20 of 44 sentences]
6
[+] score: 148
Furthermore, overexpression of miR-218 in C6 cells downregulated Mecp2 expression level (Fig. 6c), which further confirmed that Mecp2 is a target of miR-218. [score:10]
Our research found that miR-218 in NAc decreased by heroin administration and overexpression of miR-218 inhibited heroin seeking behavior, providing a direct evidence of miR-218 involved in heroin induced behavioral plasticity. [score:6]
These data support the notion that miR-218 directly targets Mecp2 in a sequence-specific manner and thus inhibits heroin seeking behavior. [score:6]
MiR-218 targets, co-predicted by at least two canonical databases (PicTar, TargetScan, DIANA, miRanda), were enriched in KEGG pathways highly relevant to neuronal functions, such as gap junction and long-term depression (Fig. 5a), suggesting its potential involvement in regulation of neuronal plasticity. [score:6]
Chronic heroin administration downregulates miR-218 expression level in NAc. [score:6]
MiR-218 inhibits heroin -induced CPP by directly targeting MeCP2. [score:5]
Recent large-scale miRNA expression profiling showed that miR-218 exhibits ubiquitous enrichment in hippocampus, cortex and cerebellum, but exhibits lower expression in olfactory bulb and brain stem 40. [score:5]
In the present study, we found that miR-218 was downregulated by chronic heroin use in NAc. [score:4]
Together with the predicted pathway of its target genes, we postulate that miR-218 is essential to the regulation of neuronal plasticity. [score:4]
How to cite this article: Yan, B. et al. MiR-218 targets MeCP2 and inhibits heroin seeking behavior. [score:4]
miR-218 was significantly downregulated by chronic heroin exposure (CS, Chronic Saline, n = 10; AH, Acute Heroin, n = 6; CH, Chronic Heroin, n = 6; One-way ANOVA, * P < 0.05 vs. [score:4]
MiR-218 is encoded by an intron of the Slit gene and inhibits the expression of Robo1 which play important roles in axonal growth 36 37. [score:4]
We selected a few predicted targets of miR-218, which are indicated by both KARG database and recent literature to contribute to drug -induced neuroplasticity, and tested the validity of the miRNA-gene regulatory relationship. [score:4]
MiR-218 regulates drug addiction network and directly targets MeCP2. [score:4]
Coincident with miR-218 overexpression result, heroin CPP was significantly blocked in Mecp2 [308/y] mice (Fig. 6d). [score:3]
Data are shown as mean ± s. e. m. (a) Schematic representation of miR-218 sequence and its target sequences within the 3′ UTR of Mecp2. [score:3]
Reduced luciferase activity indicated that these genes were the directly regulated by miR-218 (Fig. S1). [score:3]
The lentivirus construct and packaging were performed as we described previously 6. Briefly, human U6 promoter and small hairpin RNA that overexpress miR-218 (LV-miR-218, TTGTGCTTGATCTAACCATGT) or control sequences (LV-control, GCAGTTATCACGTCTATGTTT) were cloned into FG12 plasmid and co -transfected into HEK293T cells with pMDLg/RRE, pRSV/rev and pHCMV-G for lentivirus packaging. [score:3]
also confirmed that chronic, but not acute heroin administration (AH, saline twice daily intraperitoneal injections for 7 days, then one injection of heroin, 1 mg/kg), significantly reduced the expression level of miR-218 in NAc (Fig. 2a). [score:3]
To determine if miR-218 played a role in heroin -induced reinforcement, the effect of miR-218 overexpression in NAc was examined on CPP. [score:3]
To explore the role of miR-218 in heroin -induced behavioral plasticity, we delivered recombinant lentivirus that express miR-218 (LV-miR-218) or scramble control sequence (LV-control) into the NAc region (Fig. 3a). [score:3]
Data are shown as mean ± s. e. m. (a) MirSystem analysis of miR-218 target genes revealed significant enrichment in neuronal plasticity-related pathways. [score:3]
We found that the expression of luciferase with mutant Mecp2 3′ UTR was not affected by miR-218 mimic transfection, in contrast to significantly attenuated activity of luciferase with wild type Mecp2 3′ UTR (Fig. 6b). [score:3]
Lentiviral -mediated overexpression of miR-218 in NAc. [score:3]
Consistently, bioinformatic analysis indicated the predicted targets of miR-218 was enriched in addiction-related genes and involved in neuroplasticity. [score:3]
As shown in Fig. 6a, the predicted miR-218 target sequences of Mecp2 were highly conserved among mammals. [score:3]
Using luciferase reporter system, we first cloned each predicted target site into the 3′ UTR of Renilla luciferase and co -transfected the constructs with miR-218 mimic or scramble control in HEK293T cells. [score:3]
MiR-218 is down-regulated in response to chronic heroin administration. [score:3]
Overexpression of miR-218 in NAc decreased heroin conditioned preference and heroin self-administration. [score:3]
Predicted target sequences of miR-218 were cloned to the 3′ UTR of Renilla luciferase of psiCHECK-2 vector. [score:3]
However, the role of miR-218 in other drug induced plasticity and the downstream signaling pathways regulated by miR-218 in addiction are remained to be elucidated. [score:2]
Taken together, our results reveal that miR-218 is involved in heroin induced behavioral plasticity possibly by regulating Mecp2. [score:2]
MiR-218, whose role in drug addiction has not been reported, was second highest scored, and microarray analysis indicated that miR-218 was down regulated in response to chronic heroin exposure (Fig. 1d). [score:2]
Consistent with CPP results, miR-218 overexpression significantly reduced heroin acquisition compared with the control group (Fig. 4b). [score:2]
Moreover, Bonferroni’s post hoc analysis revealed that rats with miR-218 overexpression in the NAc exhibited reduced preference to the heroin-paired chamber, compared with LV-control injected rats (Fig. 4a). [score:2]
MiR-218 inhibits heroin seeking behavior. [score:2]
Moreover, the decrease of miR-218 level induced by chronic heroin exposure was restricted to NAc, since no significant change of miR-218 level was observed in mPFC or hippocampus (Fig. 2b). [score:1]
Data are shown as mean ± s. e. m. (a) CPP score of LV-control and LV-miR-218 group in pre-test and test session. [score:1]
The seed sequence is indicated by bold letters, while the pairing sequence of miR-218 is in red bold letters. [score:1]
MiR-218 regulates synaptic plasticity-related genes. [score:1]
Heroin induced CPP is decreased in LV-miR-218 group (LV-control, n = 10, LV-miR-218, n = 9, ** P < 0.01 vs. [score:1]
We transfected 500 ng recombinant vector with 10 pmol miRNA mimic or scramble (miR-218, TTGTGCTTGATCTAACCATGT, Scramble, GCAGTTATCACGTCTATGTTT) into HEK293T cells with Lipofectamine 2000 (Invitrogen). [score:1]
Rats were subjected to LV-control or LV-miR-218 injection. [score:1]
Next, we carried out heroin self-administration tests to further validate the role of miR-218 in heroin seeking behavior. [score:1]
Recent studies indicated that miR-218 plays a crucial role in motor neuron differentiation and loss of miR-218 cause systemic neuromuscular failure 38 39. [score:1]
To infer biological roles and network communities of miR-218, miRSystem database 23 was used for characterizing enriched functions and pathways of miR-218 targets. [score:1]
Quantitative PCR analysis revealed that significant increase of miR-218 level could be detected 3 days after lentivirus injection and a 2-fold increase was observed 7 days after LV-miR-218 injection in NAc (Fig. 3c). [score:1]
Rats were subjected to heroin self-administration procedure for eight days and then randomly grouped to receive NAc LV-control or LV-miR-218 injection. [score:1]
LV-miR-218 group showed decreased heroin consumption after lentivirus injection (LV-control, n = 6, LV-miR-218, n = 9, Two-way RM ANOVA. [score:1]
MiR-218 regulates heroin reinforcement. [score:1]
Rats were trained to self-administer heroin for 8 consecutive days, then subjected to LV-miR-218 or LV-control injection. [score:1]
One week after NAc infusion of LV-miR-218 or LV-control, rats were given repeated heroin injections paired with a contextually-distinct chamber in CPP apparatus, and their performance in the subsequent CPP test was scored. [score:1]
[1 to 20 of 52 sentences]
7
[+] score: 96
Other miRNAs from this paper: mmu-mir-142a, mmu-mir-152, mmu-mir-188, mmu-mir-218-1, mmu-mir-142b
Transfection of mimics of miR-218 strikingly downregulated Rictor, whereas miR-218 antagomirs upregulated Rictor protein level (Figure 4b). [score:7]
Cells were transfected with a Rictor expression vector (pRK5-myc-Rictor, addgene, cat #1860), or with 100 nM miR-218 mimic, miR-218 inhibitor or scramble Control oligo using the transfection agent lipo2000 (Invitrogen, Carlsbad, Canada) according to the manufacturer's instructions. [score:5]
Instead, enhanced expression of miR-218 targeted Rictor and appeared to be responsible for the loss of Rictor with aging in osteoblasts. [score:5]
Quantitative real-time PCR analysis of the level of 13 high score miRNAs revealed that miR-218 was strongly upregulated in osteoblasts from aged mice (expression increased 1013% in osteoblasts from aged mice compared with those from young mice) (Figure 4a). [score:5]
Meanwhile, other miRNAs (miR-152, miR-142, and so on) could also target to Rictor, and increased miR-218 may have other targets important for osteoblast such as Runx2 in this process (Figure 6c), all of which might contribute to age-related bone loss. [score:5]
Accordingly, phosphorylation of Akt(S473) and paxillin, two downstream targets that mediate Rictor-regulated cell survival and actin organization, respectively, were enhanced by miR-218 mimics or reduced by miR-218 antagomirs (Figure 4b). [score:4]
To determine whether miR-218 targets Rictor directly in osteoblasts, we cloned the 3′ UTR of Rictor into a luciferase construct. [score:4]
Together, these results suggest that miR-218 directly targets Rictor in osteoblasts. [score:4]
ROS stimulate miR-218 to downregulate Rictor in osteoblasts from aged mice. [score:4]
As expected, miR-218 mimics downregulated the Rictor/mTORC2 signaling pathway and phosphorylation of Akt(S473) and paxillin, whereas miR-218 antagomirs enhanced the Rictor/mTORC2 signaling pathway (Figures 5c and d). [score:4]
[36] We found that silencing of either Slit2 and Slit3 decreased the expression of miR-218, suggesting the regulation of miR-218 by its host genes in osteoblasts (Supplementary Figure S9). [score:4]
These findings suggest that ROS stimulates miR-218 -mediated Rictor downregulation in osteoblasts of aged mice. [score:4]
ROS scavenger reduces miR-218 and Rictor expression and aged-related bone loss in mice. [score:3]
Rictor is a target of miR-218 in osteoblasts. [score:3]
Both miR-188 and miR-218 are potential therapeutic targets for age-related osteopenia. [score:3]
To confirm the correlation of ROS with miR-218 and Rictor expression and aged-related bone loss in vivo, aging mice were administrated with ROS scavenger NAC. [score:3]
Several microRNAs, including miR-188, miR-218, have been reported to target Rictor in human and mice cells. [score:3]
miR-218 represses osteoblast adhesion and survival by targeting Rictor. [score:3]
We propose a novel functional pathway important for age-related bone loss independent of the accumulation of adipocytes in the bone marrow: accumulation of ROS with aging stimulates transcription of miR-218, which in turn targets Rictor, impairing osteoblast adhesion to the bone surface and promoting osteoblast apoptosis. [score:3]
Importantly, overexpression of Rictor rescued the reduction of Akt(S473) and paxillin phosphorylation and cell adhesion and the enhancement of apoptosis by miR-218 mimics (Figures 5e–g). [score:3]
Importantly, in addition to the impaired bone loss, miR-218 level (Figure 7j) and decreased cleaved-PARP, whereas Rictor expression and P-Akt(S473) were enhanced in NAC -treated mice (Figure 7l). [score:3]
Mutations of two putative miR-218 sites which are conservedin human versus mouse in the Rictor 3′ UTR abrogated responsiveness to miR-218 (Figure 4d). [score:2]
Reporter assays using miR-218 -expressing osteoblasts revealed that miR-218 repressed Rictor UTRs (Figure 4d). [score:2]
We next asked whether Rictor mediates the regulation of osteoblasts via miR-218. [score:2]
There are two miR-218 sites in the Rictor 3′ UTR (Figure 4c). [score:1]
34, 35 To explain the age-related increase of miR-218 and reduction of Rictor in osteoblasts, we further explored the potential role of ROS in this process. [score:1]
Moreover, previous studies have shown that miR-218 located at 4p15.31 and 5q35.1 within the intron of Slit2 and Slit3. [score:1]
These results suggest that both of these predicted sites contribute equally to miR-218 -mediated Rictor reduction. [score:1]
miR-218 reduces osteoblast adhesion and enhances osteoblast apoptosis, further confirming the negative role of miR-218 in bone formation. [score:1]
miR-218 mimics reduced cell adhesion and enhanced serum starvation -induced apoptosis, whereas miR-218 antagomirs enhanced cell adhesion, but reduced apoptosis in osteoblasts (Figures 5a and b). [score:1]
Strikingly, hydrogen peroxide (H [2]O [2]) treatment increased miR-218 level by 18 times in osteoblasts (Figure 6b; Supplementary Figure S8). [score:1]
To further define the role of miR-218 in osteoblasts, the effects of miR-218 mimics and antagomirs on cell adhesion, stress -induced apoptosis in primary osteoblasts and osteoblast cell line MC3T3-E1 were examined. [score:1]
[1 to 20 of 32 sentences]
8
[+] score: 24
Other miRNAs from this paper: mmu-mir-218-1
Moreover, in our previous study, we found that overexpression of miR-218 in glioma cells markedly suppresses the motility, invasion, and proliferation of glioma cells [18, 19], so miR-218 mimics was attached on AuCOOH (AuCOOH_miR218 mimics) surface as bio drug. [score:5]
Sigmoidal fittings were performed by Graphpad Prism 5.01 software Based on our previous study on miR-218, we found that overexpressing of miR-218 could inhibit the growth of glioma. [score:5]
Delaying effect of tumor growth was primarily due to following factors, targeted delivery of nanogels by FA, synergistical effects of miR-218 mimics and Temozolomide. [score:3]
Tumor-homing and sequential drug delivery system AuCOOH@FACS nanogels for sequential delivery of miR-218 mimics (as a bio-drug) and Temozolomide (as a chemo-drug) was established by using of CS and FA-CS nanogels for intracellular negative gold nanoparticles delivery. [score:1]
Next day, the cells were washed with PBS and incubated with AuCOOH miR-218 mimics, AuCOOH_miR-218 mimics@CS and AuCOOH_miR-218 mimics@FACS (150nM Gold nanoparticles in chitosan) for 6 h cells were washed three times with PBS and lysed. [score:1]
Au nanoparticles Chitosan Folic acid Drug delivery miR-218 Temozolomide Nanoscaled drug carriers have been used wi dely for drug delivery such as liposomes [1– 3], microspheres [4, 5], polymeric shells, etc. [score:1]
Then cells we separately treated with 0.1 mL of Temozolomide (at concentration determined by IC [50]) and Temozolomide + miR-218 mimics medium solutions. [score:1]
As shown in Fig.   4b-c, in U87MG cells, cytotoxicity of Temozolomide was significantly potentiated by miR-218 mimics cotreatment. [score:1]
Under nitrogen atmosphere, MUA solution and miR-218 mimics solution were added dropwise to the gold NPs solution and stirred for 2 days. [score:1]
After outer miR-218 mimics and Temozolomide cotreatment, the average tumor size was less than 1/4 that in the saline control group. [score:1]
For synthesis of AuCOOH_miR-218 mimics, 20 mg of pentane thiol-capped 2 nm gold NPs, 20 mg miR-218 mimics (with thiol group), and 60 mg of MUA were weighed in three separate vials and 5 ml dry DCM was added to each of the vials. [score:1]
Fig. 5 Quantification of the amount of AuCOOH miR-218 mimics, AuCOOH_miR-218 mimics@CS and AuCOOH_miR-218 mimics@FACS present in U87MG and A549 cells. [score:1]
Temozolomide was then released by diffusion due to FA-CS nanogel swelling, followed by miR-218 mimics was released by place exchange of GSH in tumor cells. [score:1]
Herein, we established a novel AuCOOH@FACS nanogel system for co- delivery miR-218 mimics (as bio-drug) and Temozolomide(as chemo-drug). [score:1]
[1 to 20 of 14 sentences]
9
[+] score: 22
Here, we intended to identify suitable MREs for bladder cancer specific adenovirus -mediated TRAIL expression from the miRNAs with downregulated expression in bladder cancer, including miR-1 [18- 21], miR-99a [22], miR-100 [23], miR-101 [24, 25], miR-125b [23, 26, 27], miR-133a [18, 20, 21, 23, 28- 30], miR-143 [22, 23, 31- 33], miR-145 [21, 23, 29- 31, 34], miR-195-5p [35], miR-199a-3p [36], miR-200 [37, 38], miR-203 [39, 40], miR-205 [37], miR-218 [21, 41], miR-490-5p [42], miR-493 [43], miR-517a [44], miR-574-3p [45], miR-1826 [46] and let-7c [42]. [score:8]
Bladder cancer-specific expression of TRAIL genes was achieved by employing MREs of miR-1, miR-133 and miR-218. [score:3]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
Application of MREs of miR-1, miR-133 and miR-218 restrained exogenous gene expression within bladder cancer cells. [score:3]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
AACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACC AAGCACAAACAAACACC AAGCACAA-3′), which contained two copies of miR-1 MREs, two copies of miR-133 MREs and two copies of miR-218 MREs. [score:1]
Ad-TRAIL-MRE-1-133-218 contained MREs of miR-1, miR-133 and miR-218 that were inserted immediately following TRAIL gene. [score:1]
[1 to 20 of 7 sentences]
10
[+] score: 18
Consistent with increases in miR218, expression of its target IκB kinase B was reduced (not shown). [score:5]
Changes in the expression were confirmed by qPCR, which showed that miR21 is decreased by 50% whereas miR218 is increased by 500% in Cx43‐deficient osteocytic cells (Fig.   2B). [score:3]
Although we also found that miR218 levels are increased in Cx43 [def] cells, this increase was not reproduced in bones from old mice or mice lacking Cx43 in osteocytes, suggesting that whereas miR21 is regulated by Cx43, signals other than Cx43 are involved in miR218 regulation in vivo. [score:3]
The expression of miR218 was not significantly changed in the bones from aging mice, although it showed a tendency toward increase in 18‐month‐old mice (Fig.   2D). [score:3]
On the contrary, miR218, a pro‐apoptotic miR, was expressed at higher levels in Cx43‐deficient MLO‐Y4 cells, compared to cells treated with scramble shRNA. [score:2]
On the other hand, silencing Cx43 did not alter the levels of miR21, miR218 (Fig.   2C), or IκB kinase B (not shown) in Ob‐6 osteoblastic cells. [score:1]
Furthermore, Cx43 [ΔOt] mice lacking Cx43 in osteocytes exhibit reduced miR21 levels; however, miR218 and IκB kinase B were not altered (Fig.   2E). [score:1]
[1 to 20 of 7 sentences]
11
[+] score: 18
Expression of miR-124 and miR-137, respectively, increased up to 8- and 24-fold, expression of miR-129 and miR-139, respectively, decreased up to 2- and 4-fold, and expression of miR-7 and miR-218 did not change appreciably. [score:7]
Of the 35 miRNAs, we identified six HGA-miRNAs, which were down-regulated in both AA and GBM tumors at a more stringent degree of significance (P < 0.01): miR-7, miR-124, miR-129, miR-137, miR-139 and miR-218. [score:4]
We identified six miRNAs of particular interest, miR-7, miR-124, miR-129, miR-137, miR-139 and miR-218, which were down-regulated in both AAs and GBMs (Figure 1A, Additional file 8 and Table 1) at a more stringent level of significance (P ≤ 0.01). [score:4]
We observed that the majority of the HGA-miRNAs show expression changes during, or have been implicated in, differentiation of various cell lineages: miR-7 during photoreceptor differentiation [23]; miR-124 and miR-137 during erythropoiesis [24]; miR-124 and miR-218 during neuronal differentiation of embryonal carcinoma cell differentiation [25]; miR-124 during neuronal differentiation of ES cells [12]. [score:3]
[1 to 20 of 4 sentences]
12
[+] score: 16
Interestingly, reduced miR-218 expression was negatively correlated (Rs < −0.750) with both neutrophils, B cells, T cells and DC numbers, suggesting that a reduced miR-218 expression could be implicated in directional migration of these cell types towards the inflamed lung [7]. [score:6]
In lungs of patients with COPD, we have shown the involvement of down-regulated miRNA-218-5p in recruiting inflammatory cells towards the airways, thereby assisting in the sustained inflammation [7]. [score:4]
Spearman correlation analysis between the expression of (b) miR-155 and % B cells in lung, (c) miR-21 and total macrophage numbers in BAL supernatant, (d) miR-146a and total neutrophil numbers in BAL supernatant and between (e) miR-218 and total neutrophils in BAL supernatant following 24 weeks of air or CS exposure. [score:3]
Remarkably, let-7c and miR-218 were significantly reduced (Table  S4). [score:1]
p-value = 0.0014, Fig.   5c), while miR-142-3p, miR-21, miR-146a as well as miR-218 and let-7 family members correlated with neutrophil numbers (Fig.   5d,e). [score:1]
p-value = 0.0067, Fig.   5b) and miR-152, miR-30a-5p, miR-30c, miR-218 and miR-26a correlated with several immune cell types in lung tissue. [score:1]
[1 to 20 of 6 sentences]
13
[+] score: 15
Similarly, the miRNAs down-regulated in 10-87 HP cells and 10-87 T cells, such as miR-31, miR-200c, miR-218, and miR-183, were also found to be down-regulated in A4497 VERO cells and SF-VERO cells. [score:7]
These initial changes consisted of the down-regulation of multiple miRNAs, highlighted by the down-regulation of miR-31, miR-200c, and miR-218. [score:7]
qRT-PCR analysis confirmed that miR-376a, miR-654-3p, miR-543, miR-382, miR-31, miR-200c, miR-218, and miR-183 paralleled the microarray miRNA levels. [score:1]
[1 to 20 of 3 sentences]
14
[+] score: 14
miR-218 was upregulated in liver from NASH mo del mice and miR-218 is a well studied cancer-preventive miRNA [45]. [score:4]
miR-218 may have a role in NASH progression via AdipoR2 downregulation. [score:4]
Moreover, a recent study showed that miR-218 targets adiponectin receptor 2 (AdipoR2) in cultured hepatoma cells, HepG2, and attenuates the adiponectin signal [46]. [score:3]
Further studies will be needed to clarify the function of miR-218 and miR-342 in NAFLD pathology. [score:1]
Additionally, we are the first to suggest that miR-218 and -342 are candidate NAFLD miRNAs. [score:1]
miR-218 and miR-342 were also newly predicted candidate NAFLD miRNAs based on mouse mo dels. [score:1]
[1 to 20 of 6 sentences]
15
[+] score: 14
Both the number of migrated cells and the integrated intensity of migrated cells were significantly lower in miR-218-1 overexpressing cells, suggesting that cell migration was suppressed by miR-218-1. Figure 3Cytobiology change after treating cells with miR-218 mimics. [score:5]
Both the number of migrated cells and the integrated intensity of migrated cells were significantly lower in miR-218-1 overexpressing cells, suggesting that cell migration was suppressed by miR-218-1. Figure 3Cytobiology change after treating cells with miR-218 mimics. [score:5]
The 3′ UTR sequence of RET and PLAG1 predicted to interact with miR-218 or a mutated sequence with the predicted target sites were inserted into the KpnI and SacI sites of pGL3 promoter vector (Genscript, Nanjing, China). [score:3]
Cells were transfected with miR-218 mimics as well as negative controls or treated with SLIT2-N for 48 hrs. [score:1]
[1 to 20 of 4 sentences]
16
[+] score: 13
[53] [,] [71] [,] [72] miR-218 knock-down in zebrafish results in a phenotype similar to robo1 overexpression, suggesting functional regulation of Slit–Robo signalling by miR-218. [score:5]
Additionally, cross-talk was found between Robo1, Vegfa, and the Vegfr2 receptor to control heart field migration, indicating a Slit/miR-218/Robo/Vegf feedback regulatory loop regulating heart field migration. [score:3]
[71] miR-218 is able to repress expression of both robo1 and robo2 mRNA. [score:3]
Intriguingly, both slit2 and slit3 have a miRNA encoded within an intron, mir218-1, and mir218-2, respectively. [score:1]
Microrna-218 regulates vascular patterning by modulation of Slit-Robo signaling. [score:1]
[1 to 20 of 5 sentences]
17
[+] score: 12
Guo J. Zhang J. F. Wang W. M. Cheung F. W. Lu Y. F. Ng C. F. Kung H. F. Liu W. K. MicroRNA-218 inhibits melanogenesis by directly suppressing microphthalmia -associated transcription factor expression RNA Biol. [score:7]
For example, ectopic miR-218 dramatically reduced Mitf expression, suppressed Tyr activity, and induced depigmentation in murine immortalized melan-a melanocytes [21]. [score:5]
[1 to 20 of 2 sentences]
18
[+] score: 12
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-1a-2, mmu-mir-218-1, mmu-mir-1b
In our study, we found that ADAM9 dysregulates several miRNAs, such as miR-218 and miR-1, the top two miRNAs targeting the CDCP1 3′-UTR for reducing CDCP1 protein expression. [score:6]
Our previous study demonstrated that ADAM9 promotes lung cancer metastasis by enhancing the function of CDCP1 [3] and regulates the expression of several genes through dysregulation of miRNAs, such as activation of N-cadherin (CDH2; cadherin 2) and CDCP1 through miR-218 [14, 15]. [score:5]
The two miRNAs showing the highest fold-change were miR-218 and miR-1, and because miR-218 was assessed in our previous report [15], miR-1 was selected for further analysis in this study. [score:1]
[1 to 20 of 3 sentences]
19
[+] score: 12
[27] On the other hand, we also identified tumour suppressive miRNAs, like miR-218 that are upregulated in p53 mutant cells, and in the case of miR-218 downregulated in p53 wt cells. [score:9]
The same is true for miR-218, an miRNA that seems to acts as a tumour suppressor 72, 73 and promotes stem cell differentiation. [score:3]
[1 to 20 of 2 sentences]
20
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Expression of the MaSC/basal-specific miRNAs miR-34b, miR-204 and miR-218 is upregulated in luminal cells of Ezh2 -deficient samples compared to littermate controls. [score:5]
MiR-34b, miR-204 and miR-218 are expressed highly in the MaSC/basal subset. [score:3]
MiRNAs were extracted from MaSC/basal and luminal cells sorted from either control or Ezh2 -deficient mouse mammary glands, and quantitative RT-PCR was then performed for the MaSC/basal-specific miRNAs miR-34b, miR-204 and miR-218, as their promoter regions were enriched for H3K27me3 marks in the luminal subsets (Fig.   6a). [score:1]
a Track files or read coverage graphs for H3K4me3 and H3K27me3 marks present in the 3 kb upstream region of miR-34b (top panel), miR-204 (middle panel) and miR-218 (bottom panel) in each epithelial subset. [score:1]
Representative track file histograms for the MaSC/basal-specific miRs-34b/c, miR-204 and miR-218, highlighting the distribution of H3K27me3 and H3K4me3 peaks, are shown in Fig.   6a. [score:1]
[1 to 20 of 5 sentences]
21
[+] score: 11
Other miRNAs from this paper: mmu-mir-128-1, mmu-mir-218-1, mmu-mir-128-2
miR-218 and miR-128 down-regulate cathepsin B expression when they are up-regulated in medulloblastoma cell lines (84) and AD monocytes and lymphocytes (85) and are expressed in brain neurons (81, 86). [score:11]
[1 to 20 of 1 sentences]
22
[+] score: 10
Differential expression of miR-708 and miR-218 was not reported in the literature. [score:3]
Eight high priority miRNAs were identified: miR-215, miR-137, miR-708, miR-31, and miR-135b were differentially expressed in APC tumors and miR-215, miR-133a, miR-467d, miR-218, miR-708, miR-31, and miR-135b in colitis -associated tumors. [score:3]
a. * miR-218 not reported Expression of microRNAs in human colon tumors compared to normal controls as indicated in corresponding references. [score:2]
Likewise, miR-218 is induced in colitis -associated tumors but is not induced in APC tumors and has not been reported to be induced in human tumors. [score:1]
In addition, 1 miRNA was uniquely repressed in APC tumors (miR-137), and 3 miRNAs were uniquely induced in CAC tumors (miR-133a, miR-467d, and miR-218). [score:1]
[1 to 20 of 5 sentences]
23
[+] score: 10
We found correlations indicating putative intrathymic functions for some miRNAs, such as miR-183 that direct regulates integrin β1 expression (56), miR-143, suppressing fibronectin directly (57), miR-218 controlling focal adhesion kinase (58), and miR-203 increasing metalloproteinase-1 expression (59). [score:10]
[1 to 20 of 1 sentences]
24
[+] score: 9
Inhibition of FGF signaling through SU5402 -treated primitive streak regions of chick embryos identified up-regulation of let-7b, miR-9, miR-19b, miR-107, miR-130b, miR-148a, miR-203, and miR-218 and down-regulation of miR-29a and miR-489 (Bobbs et al. 2012). [score:9]
[1 to 20 of 1 sentences]
25
[+] score: 9
miR-218 was chosen for normalisation due to a high degree of similarity in expression levels between CF and non-CF brushings observed in the expression profiling screen. [score:5]
Expression of miRNAs relative to miR-218 was determined using the 2 [(−ΔΔCt)] method. [score:3]
Figure  2B shows the levels of these miRNAs, normalised to miR-218, in the samples studied here. [score:1]
[1 to 20 of 3 sentences]
26
[+] score: 8
For example, hsa-miR-133a, hsa-miR-200b, hsa-miR-206, and hsa-miR-218 were considered as tooth tissue-specific miRNAs [4]; eight differentially expressed miRNAs were expressed during morphogenesis and seven were expressed in the incisor cervical loop containing the stem cell niche [1]; the three most highly expressed microRNAs in dental epithelium were identified as mmu-miR-24, mmu-miR-200c, and mmu-miR-205, while mmu-miR-199a-3p and mmu-miR-705 were found in dental mesenchyme [2]; and miR-200 was suggested to play an important role in the formation of incisor cervical loop during stem cell–fueled incisor growth [5]. [score:8]
[1 to 20 of 1 sentences]
27
[+] score: 8
Mir-218 exerts suppressing function to NPC by down -regulating survivin expression and SLIT2-BOBO1 pathway [20], and miR-26a acts the similar function for inhibiting cell growth and tumorigenesis through repression of EZH2miR [21]. [score:8]
[1 to 20 of 1 sentences]
28
[+] score: 8
Other miRNAs from this paper: mmu-mir-218-1, mmu-mir-221
On the other hand, AdipoR2 has been identified as a direct target of miR-218 (Du et al., 2015). [score:4]
MicroRNA-218 targets adiponectin receptor 2 to regulate adiponectin signaling. [score:3]
One potential explanation of our observations may be the role of miR-218 in this signaling process, which nevertheless needs further clarification. [score:1]
[1 to 20 of 3 sentences]
29
[+] score: 8
Of these possible nonspecific targets, only 3 are expressed in adult dentate gyrus -miR-187, miR-218, and miR-301 (Fig. 4b). [score:5]
Only three microRNAs were both reduced in the multiplex array and expressed endogenously in the dentate gyrus – miR-187, miR-218, and miR-301. [score:3]
[1 to 20 of 2 sentences]
30
[+] score: 8
Thus, for six miRNA families – mir-135, mir-205, mir-142-3p, mir-15/16, mir-218 and mir-24 - we obtained evidence for their functional relevance in the inner ear on two levels: (a) the miRNAs were differentially expressed between the two tissues; and (b) their predicted targets were differentially expressed in a manner consistent with the currently accepted mo del of miRNA regulation. [score:8]
[1 to 20 of 1 sentences]
31
[+] score: 7
For examples, mir-218 (C46) is dynamically expressed in developing liver and pancreas, which targets Hepatocytes Nuclear Factor-6 (HNF-6/OC-1) and OC-2 to regulate liver and pancreas development [26]. [score:7]
[1 to 20 of 1 sentences]
32
[+] score: 7
At LT, mmu-miR-29c and -98 are downregulated but upregulation of mmu-miR-125b-5p and -574-5p, and progressive normalization of the levels of mmu-miR-218, -690 and -805 would then be part of the reduction of the inflammatory process at the late stage of the asthma mo del through the modulation of TNFα receptors. [score:7]
[1 to 20 of 1 sentences]
33
[+] score: 6
One miRNA, miR-24-2*, was upregulated and three miRNAs, miR-204, miR-218, miR-455* were downregulated in P7 Ercc1 [−/−] MEFs grown in 20% O [2] compared to P3 Ercc1 [−/−] MEFs (Table 4). [score:6]
[1 to 20 of 1 sentences]
34
[+] score: 6
miR-23b is involved in the mechano-transduction of proliferative signals in endothelial cells [38], [39], whereas miR-218 was recently shown to be a critical regulator of vasculogenesis and heart tube formation during development [39], [40]. [score:3]
miR-218 was recently shown to function in vascular development [37]– [39] and to be required for heart tube formation [28], [39], [40]. [score:2]
One should also remark that both miR-126 and miR-218 interact with the VEGF pathway, raising the hypothesis that VEGF is involved in CSCs differentiation into endothelial cells. [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 6
Profiling of miRNAs expression was also performed in the YAC128 and R6/2 mice, showing that nine miRNAs (miR-22, miR-29c, miR-128, miR-132, miR-138, miR-218, miR-222, miR-344, and miR-674*) are commonly down-regulated in 12-month-old YAC128 mice and 10-week-old R6/2 mice (100). [score:6]
[1 to 20 of 1 sentences]
36
[+] score: 6
Other miRNAs from this paper: mmu-mir-218-1
The ability of these various factors to regulate Sost expression is epigenetically determined by histone deacetylase (HDAC) enzymes such as Sirt1 and HDAC5 [33], [34], and once expressed Sost RNA stability is influenced by micro -RNAs such as miR-218 [35]. [score:6]
[1 to 20 of 1 sentences]
37
[+] score: 6
Lian JB et al. found that antagonizing miR-218-5p attenuates Wnt signaling and reduces metastatic bone disease of triple negative breast cancer cells [28]. [score:3]
Taipaleenmaki, H. et al. Antagonizing miR-218-5p attenuates Wnt signaling and reduces metastatic bone disease of triple negative breast cancer cells. [score:3]
[1 to 20 of 2 sentences]
38
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-33a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-191, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-10a, mmu-mir-218-1, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-let-7a-3, gga-mir-155, gga-mir-18a, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-mir-126, gga-let-7a-2, gga-mir-27b, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, hsa-mir-33b, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-675, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, hsa-mir-675, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-664a, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, gga-mir-10a, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, mmu-mir-126b, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
Out of the 26 miRNA/host gene pairs with coordinated expression, 11 have been found to be coordinately expressed in both, human and mouse [19], [27], [59], [61]– [64], [67]– [69], [71], [73]– [79]: mir-103/ PANK3, mir-107/ PANK1, mir-126/ EGFL7, mir-128-1/ R3HDM1, mir-140/ WWP2, mir-211/ TRPM1, mir-218-1/ SLIT2, mir-218-2/ SLIT3, mir-27b/ C9orf3, mir-33/ SREBF2, and mir-499/ MYH7B. [score:5]
[1 to 20 of 1 sentences]
39
[+] score: 5
Other miRNAs from this paper: mmu-mir-218-1
Qin Y Myostatin inhibits osteoblastic differentiation by suppressing osteocyte-derived exosomal microRNA-218: A novel mechanism in muscle-bone communicationJ. [score:5]
[1 to 20 of 1 sentences]
40
[+] score: 5
A total of 11 miRNAs, let-7, miR-9, miR-206, miR-138, miR-133, miR-152, miR-137, miR-128, miR-143, miR-27b and miR-218 were co-expressed by 18 synaptic transmission target genes (Table S6). [score:5]
[1 to 20 of 1 sentences]
41
[+] score: 4
Yamasaki T MicroRNA-218 inhibits cell migration and invasion in renal cell carcinoma through targeting caveolin-2 involved in focal adhesion pathwayJ. [score:4]
[1 to 20 of 1 sentences]
42
[+] score: 4
While our present study only focused downstream of DNMTs, we propose to further study in the future how DNMTs are regulated by IGF-1. In addition, other microRNAs (miR-137, miR-218) may bind to the 3’-UTR of c-kit mRNA and modify the c-kit expression level. [score:4]
[1 to 20 of 1 sentences]
43
[+] score: 4
MicroRNA-218 inhibits glioma invasion, migration, proliferation, and cancer stem-like cell self-renewal by targeting the polycomb group gene Bmi1. [score:4]
[1 to 20 of 1 sentences]
44
[+] score: 4
MiR-218 inhibits the invasion and metastasis of gastric cancer by targeting the Robo1 receptor [26]. [score:4]
[1 to 20 of 1 sentences]
45
[+] score: 4
Mir218 is strongly downregulated in the striatum and has been implicated in establishing motor neuron fate as a downstream effector of Isl1-Lhx3 [24]. [score:3]
These 15 microRNAs include Mir128 (in both -1 and -2 forms) that has been implicated in regulating motor behavior by modulating neuronal signaling networks and excitability in adult neurons [30]; Mir218, Mir369 and Mir543. [score:1]
[1 to 20 of 2 sentences]
46
[+] score: 4
Other miRNAs similarly altered after the enrichment, such as miR-191, miR-454, miR-10a, miR-374a, miR-10b, miR-218, miR-140-3p and miR-126, were downregulated in cancer. [score:4]
[1 to 20 of 1 sentences]
47
[+] score: 3
Eight of the significantly modulated miRNAs, miR-106b, miR-199a-3p, miR-214, miR-218, miR-31, miR-434-3p, miR-671-3p, and miR-574-3p were predicted to significantly modulate several nervous system function and disease related pathways. [score:3]
[1 to 20 of 1 sentences]
48
[+] score: 3
microRNAs (miRNAs) are endogenous non-coding RNAs that facilitate sequence -dependent posttranscriptional silencing, playing pivotal roles in brain development and neuronal function 1– 3. miRNA activity is required for motor neuron survival [4] and broad dysregulation of miRNA biogenesis is associated with Amyotrophic Lateral Sclerosis (ALS) 4– 8. Several miRNA genes have already been suggested to play critical roles in motor neurons, including miR-155 [5], miR-206 [6], miR-338 [9], miR-9 [4] and miR-218 10– 12. [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 3
Other miRNAs from this paper: mmu-mir-218-1
Mir-218–2 is located within intron 14 of slit3, and the potential loss of mir-218–2 expression may contribute to the phenotype resulting from the loss of functional slit3. [score:3]
[1 to 20 of 1 sentences]
50
[+] score: 3
Other miRNAs from this paper: mmu-mir-188, mmu-mir-218-1
Interestingly, several miRNA including miR-188 and miR-218 increase with aging in either BMSC or osteoblasts, and may be responsible for the age -dependent decrease in rictor expression 64, 65. [score:3]
[1 to 20 of 1 sentences]
51
[+] score: 3
Interestingly, two extreme conditions of nutritional stress, i. e., caloric restriction and high fat diet -induced obesity, modified the hypothalamic pattern of expression of a set of miRNAs including let7a, mir-9 [*], mir-30e, mir-132, mir-145, mir-200a, and mir-218 (Sangiao-Alvarellos et al., 2014). [score:3]
[1 to 20 of 1 sentences]
52
[+] score: 3
Recently, a substantial number of deregulated miRNAs including miR-106b-25 cluster, miR-21, miR-218, miR-7, and miR-335 have been identified as modulators of cell growth, apoptosis, migration, or invasion in gastric cancer development [11]– [15]. [score:3]
[1 to 20 of 1 sentences]
53
[+] score: 3
Some of these miRNAs, for example, miR-9, miR-9*, miR-218, miR-204, and miR-129-3p, are highly expressed in the brain with signals higher than 40,000. [score:3]
[1 to 20 of 1 sentences]
54
[+] score: 3
The expression trend of 12 of them (i. e. miR-21, miR-10b and miR-124) was in line with previously published results, whereas 2 miRNAs (miR-137 and miR-218) showed an opposite trend [24]. [score:3]
[1 to 20 of 1 sentences]
55
[+] score: 3
On the basis of studies in other systems, all of the upregulated miRs are considered to be pro-apoptotic [29], particularly miR-16, miR-30a, miR-27b, miR-125b, miR-30c, miR-1, and miR-218. [score:3]
[1 to 20 of 1 sentences]
56
[+] score: 3
Aberrant expression of miR-218 and miR-204 in human mesial temporal lobe epilepsy and hippocampal sclerosis-Convergence on axonal guidance. [score:3]
[1 to 20 of 1 sentences]
57
[+] score: 2
Earlier observations by others showed miR-138, miR-218 and miR-222 to be down regulated in HD mouse mo dels [30], [48] which had also been confirmed by us in HD cell mo del [33]. [score:2]
[1 to 20 of 1 sentences]
58
[+] score: 2
The effects of nicotine and LPS were of similar direction for six miRs (miR-26, let-7f, let-7c, miR-30, miR-21a and miR-434) and showed an opposite impact for other four miRs (miR-9, let-7j, miR-218 and miR-125). [score:2]
[1 to 20 of 1 sentences]
59
[+] score: 2
For example, miR-218 was reported to exert anti-GBM activity via NF-kB regulation [12]. [score:2]
[1 to 20 of 1 sentences]
60
[+] score: 2
These include miRNAs with known roles in breast cancer development such as miR-7, miR-10b, miR-21, miR-100, miR-155, miR-195, miR-221, and miR-218. [score:2]
[1 to 20 of 1 sentences]
61
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-32, hsa-mir-33a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-99a, mmu-mir-126a, mmu-mir-128-1, mmu-mir-130a, mmu-mir-140, mmu-mir-154, mmu-mir-204, mmu-mir-143, hsa-mir-204, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-222, hsa-mir-223, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-128-1, hsa-mir-130a, hsa-mir-140, hsa-mir-143, hsa-mir-126, hsa-mir-129-2, hsa-mir-154, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-340, mmu-mir-107, mmu-mir-32, mmu-mir-218-1, mmu-mir-223, mmu-mir-26a-2, mmu-mir-211, mmu-mir-222, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, hsa-mir-340, mmu-mir-409, hsa-mir-409, hsa-mir-499a, hsa-mir-455, hsa-mir-670, mmu-mir-1249, mmu-mir-670, mmu-mir-499, mmu-mir-455, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-222, bta-mir-26b, bta-mir-27a, bta-mir-499, bta-mir-99a, bta-mir-126, bta-mir-128-1, bta-mir-34b, bta-mir-107, bta-mir-140, bta-mir-15b, bta-mir-218-2, bta-let-7d, bta-mir-29c, bta-mir-455, bta-let-7g, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-204, hsa-mir-1249, hsa-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-129-2, bta-mir-130a, bta-mir-143, bta-mir-154a, bta-mir-211, bta-mir-218-1, bta-mir-223, bta-mir-26a-1, bta-mir-301a, bta-mir-32, bta-mir-33a, bta-mir-340, bta-mir-379, bta-mir-409a, bta-mir-670, mmu-mir-1306, bta-mir-1306, bta-mir-1249, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, hsa-mir-1260b, bta-mir-2284w, bta-mir-2284x, bta-mir-409b, hsa-mir-499b, bta-mir-1260b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-6119, mmu-let-7j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-154c, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, chi-let-7a, chi-let-7b, chi-let-7c, chi-let-7d, chi-let-7e, chi-let-7f, chi-let-7g, chi-let-7i, chi-mir-103, chi-mir-107, chi-mir-1249, chi-mir-126, chi-mir-1306, chi-mir-130a, chi-mir-140, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-15b, chi-mir-16b, chi-mir-204, chi-mir-211, chi-mir-222, chi-mir-223, chi-mir-2284a, chi-mir-2284b, chi-mir-2284c, chi-mir-2284d, chi-mir-2284e, chi-mir-26a, chi-mir-26b, chi-mir-27a, chi-mir-29a, chi-mir-29c, chi-mir-301a, chi-mir-33a, chi-mir-340, chi-mir-34b, chi-mir-34c, chi-mir-379, chi-mir-409, chi-mir-455, chi-mir-499, chi-mir-99a, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
In addition, among these ten miRNA, mir-128-2, mir-218-2 and mir-301a were found in the ARPP21 (cAMP-regulated phosphoprotein), SLIT3 (Slit homolog 3) and SKA2 (Spindle and kinetochore associated complex subunit 2) genes in human, mouse, cow and chicken [65]. [score:2]
[1 to 20 of 1 sentences]
62
[+] score: 2
In line with previous studies in mice, we also found moderate enrichment of miR-195 [39], [40] in the cerebellum and of miR-218 in the hippocampus [39] (Figure S2). [score:1]
In all, we found moderate (three-fold) region-specific enrichment of 48 miRNAs (e. g. miR-138, miR-195 and miR-218, Figure S2). [score:1]
[1 to 20 of 2 sentences]
63
[+] score: 2
Hassan et al. reported that miR-218 promoted the differentiation of bone marrow stromal cells by activating a positive Wnt signaling loop [42]. [score:1]
Hassan M. Q. Maeda Y. Taipaleenmaki H. Zhang W. Jafferji M. Gordon J. A. Li Z. Croce C. M. van Wijnen A. J. Stein J. L. Mir-218 directs a wnt signaling circuit to promote differentiation of osteoblasts and osteomimicry of metastatic cancer cells J. Biol. [score:1]
[1 to 20 of 2 sentences]
64
[+] score: 1
For example, miR218 was reported to be able to promote the differentiation of BMSCs by activating a positive Wnt signaling loop [25]. [score:1]
[1 to 20 of 1 sentences]
65
[+] score: 1
Using significant microarray genes with a p < 0.01, ToppCluster identified 7 different miRNA binding sites, with 9 different miRNAs listed: MIR-32, MIR-92, MIR-96, MIR-129-5p, MIR-140-3p, MIR-141, MIR-200A, MIR-218, and MIR-1271. [score:1]
[1 to 20 of 1 sentences]
66
[+] score: 1
MicroRNA-218 regulates vascular patterning by modulation of Slit-Robo signaling. [score:1]
[1 to 20 of 1 sentences]
67
[+] score: 1
miRNA name (Release 17)† Accession Number miRNA name (Release 20)† Fold Changes P-Value (8)‡ P-Value (5)ǁ FDR (8)‡ mmu-miR-696 MIMAT0003483 mmu-miR-696 0.54 2.66E-03 3.65E-02 6.33E-02 mmu-miR-449c MIMAT0003460 mmu-miR-449c-5p 0.58 2.70E-06 9.81E-04 8.86E-04 mmu-miR-7a MIMAT0000677 mmu-miR-7a-5p 0.60 1.67E-03 3.66E-03 5.12E-02 mmu-miR-205 MIMAT0000238 mmu-miR-205-5p 0.62 3.03E-01 3.86E-03 7.56E-01 mmu-miR-450a-2* MIMAT0004789 mmu-miR-450a-2-3p 0.63 1.00E-04 7.93E-03 9.42E-03 mmu-miR-1199* MIMAT0017333 mmu-miR-1199-3p 0.63 1.40E-04 1.10E-02 1.02E-02 mmu-miR-374c MIMAT0014953 mmu-miR-374c-5p 0.63 8.79E-03 1.62E-02 1.56E-01 mmu-miR-218 MIMAT0000663 mmu-miR-218-5p 0.64 1.72E-03 3.82E-03 5. 12E-02 mmu-let-7b* MIMAT0004621 mmu-let-7b-3p 0.66 4.01E-04 4.74E-03 2.19E-02† Based on http://www. [score:1]
[1 to 20 of 1 sentences]
68
[+] score: 1
Conickx and colleagues demonstrated that miR-218-5p plays a protective role in cigarette smoke–induced inflammation and COPD, indicating a crucial role for miR-218-5p in the pathogenesis of COPD [8]. [score:1]
[1 to 20 of 1 sentences]
69
[+] score: 1
These include mir-24-2, mir-30c-2, mir-125a, mir-130a, mir-196, mir-215, mir-218-2, and mir-367. [score:1]
[1 to 20 of 1 sentences]
70
[+] score: 1
MicroRNA-218 regulates vascular patterning by modulation of Slit-Robo signaling. [score:1]
[1 to 20 of 1 sentences]
71
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-98, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-141, mmu-mir-194-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-203a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-200b, mmu-mir-300, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-141, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-343, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, mmu-mir-200c, mmu-mir-218-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-135a-2, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-326, hsa-mir-135b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-21, rno-mir-26b, rno-mir-27b, rno-mir-27a, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-33, rno-mir-98, rno-mir-126a, rno-mir-133a, rno-mir-135a, rno-mir-141, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-203a, rno-mir-211, rno-mir-218a-2, rno-mir-218a-1, rno-mir-300, hsa-mir-429, mmu-mir-429, rno-mir-429, hsa-mir-485, hsa-mir-511, hsa-mir-532, mmu-mir-532, rno-mir-133b, mmu-mir-485, rno-mir-485, hsa-mir-33b, mmu-mir-702, mmu-mir-343, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, hsa-mir-300, mmu-mir-511, rno-mir-466b-1, rno-mir-466b-2, rno-mir-532, rno-mir-511, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466b-8, hsa-mir-3120, rno-mir-203b, rno-mir-3557, rno-mir-218b, rno-mir-3569, rno-mir-133c, rno-mir-702, rno-mir-3120, hsa-mir-203b, mmu-mir-344i, rno-mir-344i, rno-mir-6316, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-3569, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, rno-mir-466b-3, rno-mir-466b-4, mmu-mir-203b
By the same method, we found that MRAK081523 and Plxna4 had the same MREs for miR-218, miR-141, miR-98 and let-7. Plxna4 reportedly promotes tumour progression and tumour angiogenesis by enhancing VEGF and basic fibroblast growth factor signalling [44]. [score:1]
[1 to 20 of 1 sentences]